image
imagewidth (px) 258
933
| latex
stringlengths 198
5.27k
| filename
stringlengths 18
19
|
|---|---|---|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{GO ID} & \textbf{Biological process} & \textbf{Gene Counts} & \textbf{P-value} & \textbf{Bon. Adjusted p-values} & \textbf{FDR} \\
\hline
GO:0006955 & Immune response & 38 & 0.040 & 1 & 0.044 \\
\hline
GO:0042493 & Response to drug & 18 & 0.010 & 1 & 0.023 \\
\hline
GO:0046649 & Lymphocyte activation & 18 & 0.032 & 1 & 0.037 \\
\hline
GO:0019221 & Cytokine-mediated signaling pathway & 12 & 0.026 & 1 & 0.036 \\
\hline
GO:0090068 & Positive regulation of cell cycle process & 13 & 0.000 & 0.295 & 0.003 \\
\hline
GO:0032496 & Response to lipopolysaccharide & 10 & 0.036 & 1 & 0.040 \\
\hline
GO:0034097 & Response to cytokine stimulus & 17 & 0.020 & 1 & 0.032 \\
\hline
\end{tabular}}
\end{table}
|
PMC5687707_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{K01179: Endoglucanase} & \textbf{Arctic Wolf} & \textbf{Beaver} & \textbf{Coyote} & \textbf{Porcupine} \\
\hline
Clostridium & 22.95\% & 48.66\% & 25.83\% & 42.82\% \\
\hline
Eubacterium & 11.51\% & 23.52\% & 10.06\% & 24.93\% \\
\hline
Methanobrevibacter & 17.49\% & 1.23\% & 19.13\% & 2.18\% \\
\hline
Lactococcus & 4.96\% & 3.25\% & 8.19\% & 13.73\% \\
\hline
Deinococcus & 9.00\% & 4.55\% & 10.77\% & 3.28\% \\
\hline
Alicyclobacillus & 4.98\% & 3.54\% & 6.14\% & 6.87\% \\
\hline
Burkholderia & 8.67\% & 2.08\% & 5.13\% & 0.17\% \\
\hline
Cellulophaga & 1.47\% & 6.11\% & 4.14\% & 3.56\% \\
\hline
Klebsiella & 5.23\% & 0.17\% & 5.59\% & 0.15\% \\
\hline
Pseudomonas & 7.31\% & 1.08\% & 1.20\% & 0.17\% \\
\hline
Escherichia & 4.97\% & 0.22\% & 3.25\% & 0.43\% \\
\hline
\end{tabular}}
\end{table}
|
PMC5744928_table_7
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
& \textbf{Time (minutes)} & \textbf{p} \\
\hline
. & 17.1 $\pm$ 2.4 vs. 20.9 $\pm$ 5.5 & 0.04 \\
\hline
1.5T: FWHM v 6SD (IS) & 17.1 $\pm$ 2.4 vs. 19.4 $\pm$ 3.1 & 0.09 \\
\hline
1.5T: FWHM v 7SD (IS) & 17.1 $\pm$ 2.4 vs. 19.1 $\pm$ 3.7 & 0.13 \\
\hline
1.5T: FWHM v 8SD (IS) & 17.1 $\pm$ 2.4 vs. 19.6 $\pm$ 3.2 & $<$0.01 \\
\hline
1.5T: FWHM v OAT (IS) & 17.1 $\pm$ 2.4 vs. 18.0 $\pm$ 2.6 & 0.45 \\
\hline
1.5T: FWHM v MANUAL (IS) & 17.1 $\pm$ 2.4 vs. 21.1 $\pm$ 4.7 & 0.01 \\
\hline
1.5T: 5SD v OAT (IS) & 20.9 $\pm$ 5.5 vs. 18.0 $\pm$ 2.6 & 0.21 \\
\hline
1.5T: 2SD v OAT (AAR) & 17.1 $\pm$ 2.4 vs. 16.7 $\pm$ 2.6 & 0.73 \\
\hline
1.5T: 2SD v MANUAL (AAR) & 17.1 $\pm$ 2.4 vs. 18.3 $\pm$ 2.6 & 0.14 \\
\hline
1.5T: OAT v MANUAL (AAR) & 16.7 $\pm$ 2.6 vs. 18.3 $\pm$ 2.6 & 0.07 \\
\hline
3T: FWHM v 5SD (IS) & 18.9 $\pm$ 2.7 vs. 24.7 $\pm$ 9.1 & 0.08 \\
\hline
3T: FWHM v 6SD (IS) & 18.9 $\pm$ 2.7 vs. 22.2 $\pm$ 5.2 & 0.07 \\
\hline
3T: FWHM v 7SD (IS) & 18.9 $\pm$ 2.7 vs. 22.5 $\pm$ 5.3 & 0.07 \\
\hline
3T: FWHM v 8SD (IS) & 18.9 $\pm$ 2.7 vs. 21.2 $\pm$ 3.0 & 0.08 \\
\hline
3T: FWHM v OAT (IS) & 18.9 $\pm$ 2.7 vs. 20.7 $\pm$ 3.2 & 0.11 \\
\hline
3T: FWHM v MANUAL (IS) & 18.9 $\pm$ 2.7 vs. 24.0 $\pm$ 3.7 & $<$0.01 \\
\hline
3T: 5SD v OAT (IS) & 24.7 $\pm$ 9.1 vs. 20.7 $\pm$ 3.2 & 0.25 \\
\hline
3T: 2SD v OAT (AAR) & 19.6 $\pm$ 2.7 vs. 18.5 $\pm$ 2.6 & 0.26 \\
\hline
3T: 2SD v MANUAL (AAR) & 19.6 $\pm$ 2.7 vs. 18.3 $\pm$ 2.6 & 0.31 \\
\hline
3T: OAT v MANUAL (AAR) & 18.5 $\pm$ 2.6 vs. 18.3 $\pm$ 2.6 & 0.83 \\
\hline
\end{tabular}}
\end{table}
|
PMC4347654_table_4
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
& \textbf{Confirmed H1N1v ILI cases} & \textbf{ILI controls (non-H1N1v cases)} \\
\hline
IlI (fever+1 other symptom) & 186 (96\%) & 83 (89\%) \\
\hline
\multicolumn{3}{|l|}{Of those with ILI} \\
\hline
Adults & 115 (62\%) & 58 (70\%) \\
\hline
Children & 71 (38\%) & 25 (30\%) \\
\hline
Risk group & 36 (19\%) & 21 (25\%) \\
\hline
Hospital admission & 16 (9\%) & 7 (8\%) \\
\hline
Antivirals & 132 (71\%) & 44 (53\%) p = 0.0065* \\
\hline
Antivirals within 2 days after onset & 65 (35\%) & 26 (31\%) \\
\hline
\end{tabular}}
\end{table}
|
PMC3047534_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\multicolumn{3}{|l|}{Total number of 16-year-olds in the city of Uppsala: n = 2,465} \\
\hline
\multicolumn{3}{|l|}{Participated in the screening procedure: n = 2,300} \\
\hline
\multicolumn{3}{|l|}{Delivered complete screening questionnaires: n = 2,270} \\
\hline
& Selected due to high scores on the Beck Depression Inventory (BDI) or Center for Epidemiological Studies scale (CES) or had attempted suicide & Selected as controls \\
\hline
Selected for interview & n = 355 & n = 355 \\
\hline
Interviewed (structured interview by means of DICA) & n = 314 & n = 317 \\
\hline
Refused to participate in follow up & n = 6 & n = 10 \\
\hline
Interviewed and willing to participate in follow-up & n = 308 & n = 307 \\
\hline
Depressed at DICA interview & & n = 55 \\
\hline
& Depressed at screening or at interview or having at least one suicide attempt: n = 363 & Controls (not depressed at screening or interview and without any suicide attempt): n = 252 \\
\hline
Incomplete personal identification nr & n = 1 & n = 2 \\
\hline
Included in follow-up & n = 362 & n = 250 \\
\hline
Men/Women & 80/282 & 56/194 \\
\hline
Age at follow up, years & 31.6 $\pm$ 0.7 & 31.6 $\pm$ 0.6 \\
\hline
Major depression at first investigation Females/Males & 213/48 \\
\hline
Dysthymia and sub-syndromal depression at first investigation Females/Males & 70/31 \\
\hline
\end{tabular}}
\end{table}
|
PMC2853351_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
& \textbf{Machakos} & \textbf{Trans Nzoia} \\
\hline
Timing & September 2014 & October 2014 \\
\hline
Regions & Eastern region & Rift Valley region \\
\hline
Sub-regions & Masinga Sub County Yatta Sub County Kangundo Sub County Matungulu Sub County Kathiani Sub County Machakos Town Sub County Mwala Sub County & Cherangani Sub County Kwanza Sub County Saboti Sub County Endebess Sub County Kiminini Sub County \\
\hline
Number of groups & 12 & 14 \\
\hline
Characteristics of Participants- Focus group discussions & 2urban \&2 rural 4 20 years or younger 4 24-29 years old & 4 urban \& 4 rural 3 20 years or younger 3 24-29 years old \\
\hline
Language of focus group discussion & Swahili and Kamba & Kalenjin, Luhya and Swahili \\
\hline
\end{tabular}}
\end{table}
|
PMC5075459_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Outcome variables} & \multicolumn{3}{|l|}{\textbf{Antiplatelet}} & \multicolumn{3}{|l|}{\textbf{ACEI/ARB}} & \multicolumn{3}{|l|}{\textbf{Statin}} & \multicolumn{3}{|l|}{\textbf{Beta-blockers}} \\
\hline
& \textbf{Yes} & \textbf{No} & \textbf{Adjusted OR a (95\%CI)} & \textbf{Yes} & \textbf{No} & \textbf{Adjusted OR a (95\%CI)} & \textbf{Yes} & \textbf{No} & \textbf{Adjusted OR a (95\%CI)} & \textbf{Yes} & \textbf{No} & \textbf{Adjusted OR a (95\%CI)} \\
\hline
\multicolumn{13}{|l|}{Severity at presentation} \\
\hline
STEMI subtype b & 23.8 & 46.6 & 0.50(0.46–0.54) & 23.3 & 42.4 & 0.58(0.52–0.65) & 20.3 & 42.5 & 0.47(0.42–0.53) & 19.2 & 43.6 & 0.43(0.39–0.48) \\
\hline
SBP$<$90mmHg & 1.0 & 2.2 & 0.53(0.38–0.75) & 0.8 & 2.0 & 0.48(0.29–0.80) & 0.8 & 2.0 & 0.49(0.29–0.83) & 0.7 & 2.0 & 0.40(0.24–0.67) \\
\hline
HR$>$ = 100bpm & 6.5 & 9.4 & 0.69(0.60–0.80) & 7.2 & 8.8 & 0.82(0.68–0.98) & 5.0 & 9.1 & 0.56(0.45–0.69) & 5.7 & 9.1 & 0.67(0.55–0.80) \\
\hline
\multicolumn{13}{|l|}{Complications} \\
\hline
Arrhythmia & 4.4 & 6.5 & 0.63(0.53–0.75) & 4.0 & 6.2 & 0.64(0.50–0.80) & 3.4 & 6.2 & 0.53(0.40–0.68) & 3.0 & 6.4 & 0.45(0.35–0.58) \\
\hline
\multicolumn{13}{|l|}{MACE} \\
\hline
Total MACEs & 3.9 & 5.4 & 0.70(0.58–0.84) & 3.4 & 5.2 & 0.59(0.46–0.76) & 3.7 & 5.2 & 0.73(0.57–0.94) & 3.5 & 5.3 & 0.70(0.55–0.89) \\
\hline
Death & 2.1 & 3.4 & 0.62(0.49–0.79) & 1.8 & 3.2 & 0.55(0.39–0.77) & 1.6 & 3.2 & 0.52(0.36–0.76) & 1.8 & 3.3 & 0.63(0.46–0.87) \\
\hline
Cardiac death & 1.8 & 3.2 & 0.57(0.44–0.73) & 1.5 & 3.0 & 0.48(0.33–0.70) & 1.3 & 3.0 & 0.43(0.29–0.66) & 1.6 & 3.0 & 0.58(0.41–0.82) \\
\hline
Non-fatal MI & 1.1 & 1.6 & 0.64(0.45–0.90) & 0.7 & 1.6 & 0.42(0.25–0.71) & 1.3 & 1.4 & 0.91(0.59–1.40) & 1.0 & 1.5 & 0.67(0.43–1.04) \\
\hline
\end{tabular}}
\end{table}
|
PMC5023149_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
& \textbf{Total n} & \textbf{\%} & \textbf{HIV+ n} & \textbf{\%} & \textbf{HIV2 n} & \textbf{\%} & \textbf{p value} \\
\hline
\\
\hline
Ever had transactional sex (N = 1194) & 827 & 69.3 & 170 & 78.7 & 657 & 67.2 & 0.001 \\
\hline
.20 lifetime partners (N = 1202) & 417 & 34.7 & 88 & 40.6 & 329 & 33.4 & 0.058 \\
\hline
Consistent condom use in the last year (N = 1065) & 403 & 37.8 & 76 & 37.4 & 327 & 37.9 & 0.903 \\
\hline
Heavy alcohol use in the last year (N = 1185) & 215 & 18.1 & 32 & 15.0 & 183 & 18.8 & 0.223 \\
\hline
Ever had sex with a prostitute (N = 1155) & 213 & 18.1 & 41 & 19.3 & 172 & 17.8 & 0.603 \\
\hline
Had a khwapheni in last year (N = 1189) & 752 & 63.3 & 136 & 63.9 & 616 & 62.1 & 0.824 \\
\hline
Ever had anal sex with a man (N = 1229) & 54 & 4.4 & 13 & 5.8 & 41 & 4.1 & 0.283 \\
\hline
Ever had a genital ulcer (N = 1182) & 364 & 30.8 & 99 & 46.5 & 265 & 27.4 & ,0.0001 \\
\hline
Ever been circumcised (N = 1182) & 472 & 40.0 & 67 & 31.6 & 405 & 41.8 & 0.016 \\
\hline
Relationship control scale: high equity (N = 1036) & 179 & 17.3 & 19 & 9.8 & 160 & 19.0 & 0.003 \\
\hline
mid equity & 717 & 69.2 & 150 & 77.7 & 567 & 67.3 \\
\hline
low equity & 140 & 13.5 & 24 & 12.4 & 116 & 13.8 \\
\hline
.1 episode of physical intimate partner violence (N = 1180) & 362 & 30.7 & 86 & 39.3 & 276 & 28.7 & 0.003 \\
\hline
Ever raped a woman (N = 1211) & 358 & 29.6 & 70 & 31.3 & 288 & 29.2 & 0.533 \\
\hline
Raped a woman in the past year (N = 1208) & 63 & 5.2 & 8 & 3.6 & 55 & 5.6 & 0.223 \\
\hline
Ever raped a man (N = 1205) & 36 & 3.0 & 10 & 4.5 & 26 & 2.7 & 0.091 \\
\hline
Ever raped a girl ,15 (N = 1125) & 60 & 5.3 & 10 & 5.0 & 50 & 5.4 & 0.796 \\
\hline
\end{tabular}}
\end{table}
|
PMC3173408_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Concentration (µg/mL)} & \multicolumn{5}{|l|}{\textbf{Test drugs}} & \multicolumn{2}{|l|}{\textbf{Parameter and statistics}} \\
\hline
& \textbf{Az} & \textbf{Rc} & \textbf{Az + Rc} & \textbf{Pento} & \textbf{AMB} & \textbf{F value} & \textbf{p value} \\
\hline
Optimal efficacy (\%) & 72 & 59.5 & 88 & 98 & 92 & 17.311 & 0.002 \\
\hline
Concentration at optimal efficacy & 25.5 & 28.2 & 35.1 & 25.2 & 34.5 & 9.212 & 0.001 \\
\hline
IC90 & – & – & 34.5 & 15.5 & 24.5 & 19.221 & 0.001 \\
\hline
IC50 & 11.5 & 16.5 & 9.0 & 6.5 & 4.5 & 12.489 & 0.000 \\
\hline
\end{tabular}}
\end{table}
|
PMC4635543_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{Saturated fatty acids} & \textbf{Linoleic acid (omega 6)} & \textbf{Total omega 3} & \textbf{Monounsaturated fatty acids} \\
\hline
Corn oila & 13 & 61 & 1 & 26 \\
\hline
Canola oila & 6 & 20 & 10 & 62 \\
\hline
n-3 supp.b & 9 & 6 & 63 & 21 \\
\hline
\end{tabular}}
\end{table}
|
PMC2669087_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Project} & \textbf{Project ID} & \textbf{Samples} & \textbf{Salinity range (PSU)} & \textbf{Reference} \\
\hline
Global Ocean Sampling Expedition & CAM_PROJ_GOS & 56 & 0.1–37, 63 (hypersaline) & [12] \\
\hline
Global Ocean Sampling Baltic Sea & CAM_P_0001109 & 19 & 0–34 & [13] \\
\hline
Freshwater metagenomes & PRJEB4844 & 9 & 0 & [109] \\
\hline
Lake Lanier metagenome by 454 & SRR063691 & 1 & 0 & [76] \\
\hline
Metagenomics of the Amazon & SRR091234 & 1 & 0 & [113] \\
\hline
\end{tabular}}
\end{table}
|
PMC4699468_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Variable} & \multicolumn{2}{|l|}{\textbf{Significance}} \\
\hline
\textbf{Muscle Total CoQ10 (mcg/mg) T2 pre $\yen$} & \textbf{r value} & \textbf{0.423} \\
\hline
& p value & 0.007 \\
\hline
Muscle Total CoQ10 (mcg/mg) T2 post & r value & 0.189 \\
\hline
& p value & 0.250 \\
\hline
Muscle Total CoQ10 (mcg/mg) T3 pre & r value & 0.247 \\
\hline
& p value & 0.125 \\
\hline
Muscle Total CoQ10 (mcg/mg) T3 post & r value & 0.244 \\
\hline
& p value & 0.134 \\
\hline
Oxygen Consumption (mL·kg-1·min-1) T1 $\yen$ & r value & 0.389 \\
\hline
& p value & 0.013 \\
\hline
Oxygen Consumption (mL·kg-1·min-1) T2 $\yen$ & r value & 0.381 \\
\hline
& p value & 0.017 \\
\hline
Oxygen Consumption (mL·kg-1·min-1) T3 $\yen$ & r value & 0.429 \\
\hline
& p value & 0.006 \\
\hline
Time to exhaustion (Min) T1 $\yen$ & r value & 0.419 \\
\hline
& p value & 0.007 \\
\hline
Time to exhaustion (Min) T2 $\yen$ & r value & 0.454 \\
\hline
& p value & 0.004 \\
\hline
Time to exhaustion (Min) T3 $\yen$ & r value & 0.485 \\
\hline
& p value & 0.001 \\
\hline
\end{tabular}}
\end{table}
|
PMC2315638_table_7
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Adolescent physiological factors} & \textbf{Key points from systematic review results} & \textbf{Implementation considerations} \\
\hline
Neurological decision- making ability & • When adolescents are in situations that involve a high level of emotion (e.g. times of great excitement), they are less likely to spend time considering the (potentially risky) consequences • In high emotion situations (or so called ‘hot’ emotional contexts) decision- making processes may therefore be different from less charged (‘cold’ or deliberative) situations & • Interventions to support adolescents, and those who care for them, can raise awareness of this likelihood and help adolescents to identify that their ‘gut’, or immediate reaction, in such situations may put them at risk • Knowledge of such variations may help adolescents to differentiate between their decision-making ability in a variety of situations and apply different strategies. For example, gaining the skills to recognise when a rash or unhealthy decision is likely to occur \\
\hline
Reward processing & • Reward processing develops across adolescence & • Interventions to support adolescents should encourage the rewards that healthy behaviours can give (for example being more active and looking/ feeling healthier as a result) • In addition, the benefits of saying ‘no’ to unhealthy behaviours can be emphasised (for example refusing cigarettes and having fresher breath, skin, and clothes as a result) \\
\hline
& • In situations where adolescents need to concentrate intensely (for example when playing computer games), they may be more likely to accept an immediate reward without considering the consequences (for example they may be more likely to eat an unhealthy snack and lose their appetite for more nutritious food) & • An understanding of this likelihood may be helpful for both adolescents and those who care for them. In addition, interventions that act as prompts or reminders for adolescents may be of help \\
\hline
Age and stage & • Many new experiences that children encounter as they develop through adolescence can impact on future health (for example, smoking) & • It is important that early interventions, at a younger age, explain the potential consequences (good or bad) in a supportive way. This early approach may help adolescents make healthier choices at a later stage (for example, turning down an offer of a cigarette for the first time) \\
\hline
& • Younger adolescents may be less able to stop acting on impulse, due to the developing (neurological) maturation processes & • Interventions that focus on controlling impulsive action may be better suited to older adolescents \\
\hline
& • Younger adolescents may respond better to interventions that focus on immediate rewards (for example, the immediate benefits of taking exercise, such as glowing skin, feeling energised). In contrast, older adolescents may be better able to see the longer term outcomes and anticipate those benefits (for example, having good muscle tone as a result of regular exercise) & • Interventions that are responsive to and implemented in an age and stage appropriate way may be more effective due to their acknowledgement of the physiological maturation process \\
\hline
\end{tabular}}
\end{table}
|
PMC5879600_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Outcome/output} & \textbf{Indicators} & \textbf{Achievement (2009)} \\
\hline
\multicolumn{3}{|l|}{Outcome} \\
\hline
1. New knowledge relevant to global and local health needs & Implications of research findings or results for current knowledge/understanding or programs/ interventions in relation to MDGs or national priorities. & Review of progress and policy development demonstrates significant contributions in 6/8 priority areas of Strategic Plan 2001-2010 \\
\hline
2. Changes in programs, policies and practices which incorporate this knowledge & Changes in national/regional or international policy/programs consistent with new knowledge/ research findings. & Significant policy changes/policy contribution in 5/8 priority areas of Strategic Plan 2001-2010 \\
\hline
\multicolumn{3}{|l|}{Outputs} \\
\hline
1. Updated research agenda which identifies priority research areas \& objectives & Revisions to the priority research areas based on consultation with stakeholders and research findings undertaken at least every 2 years. & Strategic Plan 2010-2020 provides information on new research directions and justification \\
\hline
2. Program of research protocols and research activities which contribute to the objectives in the priority research areas identified in the Strategic Plan & Number of new research protocols/activities approved by research priority area and research phase during the last 12 months & Increase in infections (27\%), health systems (17\%); decrease in diarrhoea (9\%) and HIV (8\%) Shift towards operational research \\
\hline
3. Research program addresses issues of gender, environment, poverty and equity where relevant. & No/\% of protocols approved during the last 12 months which address - gender, environment, poverty and equity. & Very low proportions - no significant change over 2007-2009 periods. Reporting is not capturing this information. \\
\hline
4. Research undertaken by ICDDR,B is regarded as high quality and innovative by international peers. & No. of publications in the high impact peer reviewed journals by research priority area during last 12 months. & Most in traditional strong areas of diarrhoea (1/3), infections, child health \\
\hline
& No. of citations in peer reviewed literature for key publications in each priority research area over a 5 year period. & Citation rate by area: highest in diarrhoea (7.3); infectious disease (4.9); child health (4.5) \\
\hline
5. Research undertaken by ICDDR,B is conducted according to ethical standards & Presence of policies on scientific misconduct, acknowledgement, authorship, sex trafficking, allocation core funds & Policies established, but compliance not known \\
\hline
& Numbers and proportion of investigators certified for human research & Proportion has risen to 97\% from low levels in previous years \\
\hline
\end{tabular}}
\end{table}
|
PMC3169480_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& & & \multicolumn{2}{|l|}{\textbf{Fragment Contributions}} \\
\hline
\textbf{Compound} & \textbf{Actual pIC50} & \textbf{Predicted pIC50} & \textbf{R1} & \textbf{R2} \\
\hline
finger- 4 & 5.39 & 5.23 & 0.39 & 0.40 \\
\hline
or 5b & 4.85 & 4.84 & 0.38 & 0.02 \\
\hline
not 6a & 5.07 & 4.86 & 0.02 & 0.40 \\
\hline
or 7a & 5.85 & 5.49 & 0.65 & 0.40 \\
\hline
deals 7b & 5.25 & 5.11 & 0.65 & 0.02 \\
\hline
8a & 5.36 & 5.17 & 0.34 & 0.40 \\
\hline
into 8b & 4.92 & 4.79 & 0.34 & 0.02 \\
\hline
9 & 6.24 & 6.27 & 1.44 & 0.40 \\
\hline
9b & 6.37 & 5.89 & 1.44 & 0.02 \\
\hline
are 11 & 5.33 & 5.24 & 0.40 & 0.40 \\
\hline
from 12 & 6.19 & 5.98 & 1.15 & 0.40 \\
\hline
were 13 & 6.33 & 6.16 & 1.32 & 0.40 \\
\hline
The 14 & 5.85 & 5.65 & 0.81 & 0.40 \\
\hline
16 & 5.32 & 5.10 & 0.26 & 0.40 \\
\hline
17 & 5.48 & 5.19 & 0.36 & 0.40 \\
\hline
valid- 18 & 5.74 & 5.60 & 0.76 & 0.40 \\
\hline
such 19 & 5.62 & 5.40 & 0.56 & 0.40 \\
\hline
error. 20 & 5.38 & 5.19 & 0.36 & 0.40 \\
\hline
chal- 21 & 4.89 & 4.72 & -0.12 & 0.40 \\
\hline
22 & 5.68 & 5.40 & 0.56 & 0.40 \\
\hline
25 & 6.17 & 5.97 & 1.14 & 0.40 \\
\hline
26 & 5.82 & 5.67 & 0.83 & 0.40 \\
\hline
27 & 5.51 & 5.50 & 0.66 & 0.40 \\
\hline
28(temp) & 6.66 & 6.64 & 1.80 & 0.40 \\
\hline
abil- 30a & 6.48 & 6.44 & 1.60 & 0.40 \\
\hline
q2 30b & 6.11 & 6.06 & 1.60 & 0.02 \\
\hline
devel- 31 & 6.17 & 6.24 & 1.41 & 0.40 \\
\hline
0.975, 32 & 5.82 & 5.78 & 0.94 & 0.40 \\
\hline
stan- 33a & 4.68 & 4.73 & -0.11 & 0.40 \\
\hline
that 34 & 4.85 & 4.74 & -0.10 & 0.40 \\
\hline
PLS 35 & 4.52 & 4.44 & -0.40 & 0.40 \\
\hline
\multicolumn{5}{|l|}{of Test set} \\
\hline
by 5a & 5.27 & 5.22 & 0.38 & 0.40 \\
\hline
were 6b & 5.00 & 4.48 & 0.02 & 0.02 \\
\hline
10 & 6.07 & 6.24 & 1.40 & 0.40 \\
\hline
The 15 & 6.20 & 6.16 & 1.32 & 0.40 \\
\hline
and 23 & 5.85 & 5.74 & 0.90 & 0.40 \\
\hline
24 & 5.96 & 6.44 & 1.60 & 0.40 \\
\hline
of 29 & 5.47 & 5.81 & 0.97 & 0.40 \\
\hline
33b & 4.72 & 4.35 & -0.11 & 0.02 \\
\hline
\end{tabular}}
\end{table}
|
PMC3038138_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{Clinical scenario} & \textbf{Percent of PCP’s that agreed} \\
\hline
half Initial consultation & 94 \% \\
\hline
en- Change in management & 92 \% \\
\hline
Operative note & 86 \% \\
\hline
Every clinical encounter & 50 \% \\
\hline
\end{tabular}}
\end{table}
|
PMC4696345_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Gene} & \textbf{Gene symbol} & \textbf{OMIM\#} & \textbf{Remarks} \\
\hline
Glycine receptor, alpha 4 subunit & GLRA4 & - & Glycine receptors mediate neurotransmission in the spinal cord and brain stem. Human GLRA4 is considered as a pseudogene and has a stop codon before the predicted transmembrane domain (exon 9) [11, 36]. \\
\hline
Mortality factor 4 like 2 & MORF4L2 & 300409 & May be implicated in cellular senescence like 2 [52]. The mouse homolog (MgrX) is not essential for growth and development [37] \\
\hline
Transcription Elongation Factor A-Like 1 & TCEAL1 & 300237 & Nuclear phosphoprotein having 48 \% Elongation homology to transcription factor SII factor A-like-1 [53]. \\
\hline
\end{tabular}}
\end{table}
|
PMC4979147_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Items} & \textbf{Controls (n = 440)} & \textbf{TAD patients (n = 315)} & \textbf{p Value} \\
\hline
Age & 51.3 $\pm$ 14.4 & 51.3 $\pm$ 11.1 & NS \\
\hline
Gender (male) n (\%) & 223 (50.7) & 241 (76.5) & $<$0.01 \\
\hline
Smoking n (\%) & 191 (43.4) & 153 (48.6) & NS \\
\hline
Alcohol n (\%) & 92 (20.9) & 75 (23.8) & NS \\
\hline
Diabetes n (\%) & 65 (14.8) & 53 (16.8) & NS \\
\hline
Hypertension n (\%) & 367 (83.4) & 258 (81.9) & NS \\
\hline
Dyslipidaemia n (\%) & 258 (58.6) & 198 (62.9) & NS \\
\hline
CAD n (\%) & 73 (16.6) & 68 (21.6) & NS \\
\hline
\end{tabular}}
\end{table}
|
PMC4712614_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
& \textbf{Training gain} & \textbf{Test gain} & \textbf{AUC values} \\
\hline
Species distribution model for Amphistegina spp. & 2.2215 & 2.1563 & 0.9513 \\
\hline
\multicolumn{4}{|l|}{Model without variable:} \\
\hline
Mean sea-surface temperature & 1.4824 & 1.3361 & 0.8897 \\
\hline
Mean diffuse attenuation & 2.1529 & 2.1274 & 0.9509 \\
\hline
Minimum chlorophyll a & 2.1804 & 2.148 & 0.9505 \\
\hline
Maximum photosynthetically available radiation & 2.1852 & 2.1442 & 0.951 \\
\hline
Sea-surface temperature range & 2.0586 & 2.038 & 0.9459 \\
\hline
\multicolumn{4}{|l|}{Model with variable in isolation:} \\
\hline
Mean sea-surface temperature & 0.5427 & 0.6459 & 0.8018 \\
\hline
Mean diffuse attenuation & 0.6616 & 0.5953 & 0.7959 \\
\hline
Minimum chlorophyll a & 0.6413 & 0.5856 & 0.7923 \\
\hline
Maximum photosynthetically available radiation & 0.3108 & 0.2944 & 0.6908 \\
\hline
Sea-surface temperature range & 0.2637 & 0.3123 & 0.7012 \\
\hline
\end{tabular}}
\end{table}
|
PMC3566174_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
Bruker Kappa APEXII CCD diffractometer & 2886 independent reflections \\
\hline
Radiation source: fine-focus sealed tube & 1920 reflections with I $>$ 2$\sigma$(I) \\
\hline
graphite & Rint = 0.042 \\
\hline
Detector resolution: 8.3 pixels mm-1 & $\theta$max = 25.1°, $\theta$min = 2.3° \\
\hline
$\omega$ scans & h = −5$\rightarrow$3 \\
\hline
Absorption correction: multi-scan (SADABS; Bruker, 2005) & k = −19$\rightarrow$19 \\
\hline
Tmin = 0.962, Tmax = 0.970 & l = −25$\rightarrow$25 \\
\hline
12183 measured reflections \\
\hline
\end{tabular}}
\end{table}
|
PMC3007868_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Soil samples} & \textbf{Sampling sites} & \textbf{Latitude \& Longitude} & \textbf{Land use} & \textbf{Soil type} & \textbf{Climate} \\
\hline
1–18 & Yujiang, Jiangxi province & 28°13′ N, 116°54′ E & Crops land & Quaternary red Clay (Ultisol) & Subtropical monsoon \\
\hline
19–37 & Yujiang, Jiangxi province & 28°13′ N, 116°54′ E & Anthropogenic forest & Quaternary red Clay (Ultisol) & Subtropical monsoon \\
\hline
38–45 & Wuhan, Hubei province & 30°29′ N, 114°22′ E & Crops land & Yellow-brown soil (Alfisol) & Subtropical monsoon \\
\hline
46–51 & Wuhan, Hubei province & 30°29′ N, 114°22′ E & Anthropogenic forest & Yellow-brown soil (Alfisol) & Subtropical monsoon \\
\hline
52–69 & Xianning, Hubei province & 29°5′ N, 114°15′ E & Crops land & Red soil (Ultisol) & Subtropical monsoon \\
\hline
70–71 & Zhijiang, Hubei province & 30°26′ N, 110°30′ E & Crops land & Yellow-brown soil (Alfisol) & Subtropical monsoon \\
\hline
72–82 & Fengqiu, Henan province & 35°00′ N, 114°24′ E & Crops land & Sandy loam (Aquic inceptisols) & Continental temperate monsoon \\
\hline
83–84 & Anyang, Henan province & 35°32′ N, 114°50′ E & Crops land & Sandy loam (Aquic inceptisols) & Continental temperate monsoon \\
\hline
\end{tabular}}
\end{table}
|
PMC4864422_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
& \textbf{Sequences (n)} \\
\hline
Raw sequencing reads & 1,409,706 \\
\hline
Reads for assembly & 1,280,970 \\
\hline
Reads assembled & 1,168,029 \\
\hline
Contigs & 26,802 \\
\hline
Singletons & 73,675 \\
\hline
Total unique sequences & 100,477 \\
\hline
\end{tabular}}
\end{table}
|
PMC3412804_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{$\delta$} & \textbf{C1} & \textbf{C2} & \textbf{C3} & \textbf{C4} & \textbf{C5} & \textbf{C6} & \textbf{C7} & \textbf{C8} & \textbf{C9} & \textbf{C} & \textbf{V} & \textbf{V1} & \textbf{V2} & \textbf{V3} & \textbf{V4} & \textbf{V5} & \textbf{V6} & \textbf{V7} & \textbf{V8} \\
\hline
C1 & 0 & 4.40 & 5.08 & 4.63 & 4.65 & 5.08 & 4.26 & 4.70 & 3.52 & 2.55 & 3.70 & 3.62 & 2.80 & 3.67 & 3.77 & 3.37 & 3.70 & 4.00 & 3.25 \\
\hline
C2 & & 0 & 6.25 & 5.77 & 5.93 & 6.38 & 5.90 & 4.65 & 5.37 & 2.58 & 4.60 & 4.46 & 3.47 & 4.53 & 4.72 & 4.96 & 4.94 & 4.72 & 3.78 \\
\hline
C3 & & & 0 & 6.00 & 6.62 & 5.69 & 5.77 & 5.35 & 5.35 & 2.85 & 4.86 & 4.78 & 4.07 & 4.51 & 4.71 & 4.87 & 5.18 & 4.76 & 4.73 \\
\hline
C4 & & & & 0 & 6.36 & 5.71 & 5.22 & 5.06 & 5.09 & 2.65 & 4.95 & 4.70 & 3.48 & 4.85 & 5.14 & 5.04 & 4.13 & 5.26 & 4.28 \\
\hline
C5 & & & & & 0 & 6.86 & 6.08 & 6.17 & 5.00 & 2.97 & 4.88 & 4.81 & 3.64 & 4.96 & 5.35 & 4.95 & 5.41 & 4.71 & 4.54 \\
\hline
C6 & & & & & & 0 & 6.21 & 4.70 & 5.25 & 3.18 & 4.70 & 4.60 & 3.40 & 4.75 & 4.74 & 4.75 & 4.67 & 5.20 & 3.90 \\
\hline
C7 & & & & & & & 0 & 4.92 & 4.85 & 2.37 & 4.71 & 5.15 & 3.93 & 5.16 & 4.99 & 4.93 & 4.63 & 4.47 & 4.88 \\
\hline
C8 & & & & & & & & 0 & 4.34 & 2.66 & 4.68 & 3.77 & 3.20 & 4.25 & 4.11 & 4.80 & 4.04 & 4.50 & 3.36 \\
\hline
C9 & & & & & & & & & 0 & 2.48 & 3.84 & 3.92 & 3.22 & 4.16 & 4.32 & 4.13 & 4.84 & 4.00 & 3.32 \\
\hline
C & & & & & & & & & & 0 & 3.35 & 3.64 & 3.19 & 3.70 & 3.78 & 3.62 & 3.99 & 2.96 & 3.01 \\
\hline
V & & & & & & & & & & & 0 & 2.25 & 2.07 & 1.91 & 2.11 & 2.09 & 2.21 & 1.87 & 2.36 \\
\hline
V1 & & & & & & & & & & & & 0 & 2.41 & 3.79 & 3.26 & 3.07 & 3.59 & 3.64 & 3.57 \\
\hline
V2 & & & & & & & & & & & & & 0 & 2.79 & 2.73 & 2.71 & 2.59 & 2.77 & 2.34 \\
\hline
V3 & & & & & & & & & & & & & & 0 & 3.63 & 3.77 & 3.60 & 4.54 & 3.41 \\
\hline
V4 & & & & & & & & & & & & & & & 0 & 3.57 & 3.66 & 4.09 & 4.03 \\
\hline
V5 & & & & & & & & & & & & & & & & 0 & 4.08 & 3.77 & 3.69 \\
\hline
V6 & & & & & & & & & & & & & & & & & 0 & 4.25 & 3.52 \\
\hline
V7 & & & & & & & & & & & & & & & & & & 0 & 3.83 \\
\hline
V8 & & & & & & & & & & & & & & & & & & & 0 \\
\hline
\end{tabular}}
\end{table}
|
PMC1847453_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Gene} & \textbf{Gene ID} & \textbf{Forward primer} & \textbf{Reverse primer} & \textbf{Source} \\
\hline
Hprt (set a) & 15452 & TGACACTGGCAAAACAATGCA & GGTCCTTTTCACCAGCAAGCT & [12,6] \\
\hline
Hprt (set b) & 15452 & AAGACTTGCTCGAGATGTCATGAA & ATCCAGCAGGTCAGCAAAGAA & [6] \\
\hline
Gas6 & 14456 & TGCTGGCTTCCGAGTCTTC & CGGGGTCGTTCTCGAACAC & Primer Bank ID: 9506715a1 \\
\hline
Rara & 19401 & TTCTTTCCCCCTATGCTGGGT & GGGAGGGCTGGGTACTATCTC & Primer Bank ID: 22800363a1 \\
\hline
Sulf2 & 72043 & CTGCCACTATGGCTGCTGTC & GTTGGGCCGGATGTTCCTG & Primer Bank ID: 26330131a1 \\
\hline
\end{tabular}}
\end{table}
|
PMC4589800_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Predictors} & \multicolumn{2}{|l|}{\textbf{Unadjusted Model}} & \multicolumn{2}{|l|}{\textbf{Adjusted Model}} \\
\hline
& \textbf{HR} & \textbf{95\% CI} & \textbf{HR} & \textbf{95\% CI} \\
\hline
Age & 1.00 & 0.99–1.01 & 1.00 & 0.98–1.00 \\
\hline
Male sex & 0.77 & 0.49–1.27 & 1.25 & 0.65–2.47 \\
\hline
Diabetes mellitus & 1.17 & 0.73–1.84 & 1.00 & 0.57–1.73 \\
\hline
Smoker & 0.70 & 0.45–1.08 & 0.48 & 0.25–0.94 \\
\hline
Drinking habit & 1.04 & 0.68–1.61 & 1.43 & 0.83–2.50 \\
\hline
\multicolumn{5}{|l|}{Extent/Chest X-ray} \\
\hline
1 & \multicolumn{2}{|l|}{reference} & \multicolumn{2}{|l|}{reference} \\
\hline
2 & 0.98 & 0.55–1.93 & 1.54 & 0.73–3.44 \\
\hline
3 & 0.61 & 0.27–1.37 & 1.07 & 0.42–2.74 \\
\hline
Cavity/Chest X-ray & 0.86 & 0.54–1.37 & 1.11 & 0.65–1.95 \\
\hline
Sputum smear grading$\geqq$3+ & 0.51 & 0.33–0.80 & 0.40 & 0.23–0.71 \\
\hline
\end{tabular}}
\end{table}
|
PMC4641703_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Statement} & \textbf{Unwilling} & \textbf{Willing} \\
\hline
1. go out with ‘Z’ in the weekend & 8.8 (8.0- 9.7) & 91.2 (90.3- 92.0) \\
\hline
2. do joint study with ‘Z’ & 12.2 (11.3-13.2) & 87.8 (86.8- 88.7) \\
\hline
3. invite ‘Z’ to your house & 10.7 (9.8- 11.6) & 89.3 (88.4- 90.2) \\
\hline
4. go to ‘Z’s house & 14.5 (13.5- 15.5) & 85.5 (84.5- 86.5) \\
\hline
5. develop a close friendship with ‘Z’ & 6.8 (6.0- 7.5) & 93.2 (92.5- 94.0) \\
\hline
\end{tabular}}
\end{table}
|
PMC4472246_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{Village} & \textbf{Paddy category} & \textbf{No. of Habitats} & \textbf{1stinstars} & \textbf{2nd instars} & \textbf{3rd instars} & \textbf{4th instars} & \textbf{Pupae} \\
\hline
Kangichiri & Ploughed & 25 & 1.41 & 0.95 & 0.09 & 0.00 & 0.36 \\
\hline
& Flooded & 23 & 1.67 & 1.10 & 0.30 & 0.00 & 0.36 \\
\hline
& Post transplanting & 30 & 6.02 & 3.00 & 1.89 & 1.20 & 0.99 \\
\hline
& Tillering & 28 & 8.00 & 6.67 & 2.00 & 3.22 & 0.67 \\
\hline
& Flowering/ maturation & 27 & 0.01 & 0.00 & 0.02 & 0.01 & 0.00 \\
\hline
& Fallow & 27 & 1.00 & 0.67 & 0.00 & 0.00 & 0.01 \\
\hline
Kiuria & Ploughed & 22 & 0.00 & 0.00 & 0.00 & 0.00 & 0.00 \\
\hline
& Flooded & 23 & 1.23 & 0.65 & 0.07 & 0.01 & 0.0 \\
\hline
& Post transplanting & 21 & 5.58 & 1.63 & 0.17 & 0.51 & 0.19 \\
\hline
& Tillering & 22 & 8.50 & 5.25 & 0.25 & 0.25 & 1.25 \\
\hline
& Flowering/ maturation & 20 & 0.02 & 0.00 & 0.01 & 0.0 & 0.00 \\
\hline
& Fallow & 14 & 0.03 & 0.01 & 0.0 & 0.01 & 0.00 \\
\hline
Rurumi & Ploughed & 18 & 0.00 & 0.00 & 0.00 & 0.00 & 0.00 \\
\hline
& Flooded & 21 & 1.56 & 1.28 & 0.09 & 0.06 & 0.19 \\
\hline
& Post transplanting & 20 & 5.73 & 3.37 & 1.17 & 1.03 & 0.47 \\
\hline
& Tillering & 20 & 4.91 & 4.67 & 1.19 & 1.11 & 1.00 \\
\hline
& Flowering/ maturation & 15 & 0.00 & 0.00 & 0.00 & 0.00 & 0.00 \\
\hline
& Fallow & 12 & 1.17 & 0.00 & 0.00 & 0.00 & 0.00 \\
\hline
\end{tabular}}
\end{table}
|
PMC1636646_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{x} & \textbf{y} & \textbf{z} & \textbf{Uiso*/Ueq} \\
\hline
As1 & 0.59797 (3) & 0.2500 & 0.56866 (7) & 0.0046 (2) \\
\hline
Na1 & 0.5000 & 0.5000 & 0.0000 & 0.0088 (3) \\
\hline
Ca1 & 0.28059 (6) & 0.2500 & 0.49344 (14) & 0.0053 (2) \\
\hline
O1 & 0.4611 (2) & 0.2500 & 0.6849 (5) & 0.0075 (5) \\
\hline
O2 & 0.6038 (2) & 0.2500 & 0.2482 (6) & 0.0068 (6) \\
\hline
O3 & 0.66769 (14) & 0.0513 (3) & 0.7038 (3) & 0.0068 (4) \\
\hline
\end{tabular}}
\end{table}
|
PMC3238576_table_3
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Gene} & \textbf{Forward primer (5' to 3')} & \textbf{Reverse primer (5' to 3')} \\
\hline
ST3GAL5 & CCC TGA ACC AGT TCG ATG TT & CAT TGC TTG AAG CCA GTT GA \\
\hline
NEU3 & CCT GAA GCC ACT GAT GGA A & TTC CTG CCT GAC ACA ATC TG \\
\hline
IL-6 & TAC ATC CTC GAC GGC ATC TC & GCT ACA TTT GCC GAA GAG CC \\
\hline
TLR4 & TGA GCA GTC GTG CTG GTA TC & CAG GGC TTT TCT GAG TCG T \\
\hline
GAPDH & GCA AAT TCC ATG GCA CCG T & TCG CCC CAC TTG ATT TTG G \\
\hline
\end{tabular}}
\end{table}
|
PMC2907690_table_5
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Species} & \textbf{Family} & \textbf{Origin} & \textbf{Habit} \\
\hline
Tabebuia heterophylla & Bignoniaceae & native & tree to 20 m height \\
\hline
Chrysobalanus icaco & Chrysobalanaceae & native & shrub/tree \\
\hline
Morisonia americana & Conneraceae & native & tree to 10 m height \\
\hline
Lonchocarpus benthamianus & Fabaceae & native & shrub/tree to 4 m height \\
\hline
Ocotea coriacea & Lauraceae & native & shrub/tree to 6 m height \\
\hline
Eugenia ligustrina & Myrtaceae & native & shrub/tree to 7 m height \\
\hline
Eugenia sp. & Myrtaceae & native & NA \\
\hline
Myrcia citrifolia & Myrtaceae & native & shrub/tree \\
\hline
Pimenta racemosa & Myrtaceae & introduced & tree to 13 m height \\
\hline
Pisonia fragrans & Nyctaginaceae & native & tree to 14 m height \\
\hline
Swietenia macrophylla & Meliaceae & introduced & tree to 30–50 m height \\
\hline
Swietenia mahagoni & Meliaceae & introduced & tree to 30–50 m height \\
\hline
\end{tabular}}
\end{table}
|
PMC3076449_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Eye} & \multicolumn{2}{|l|}{\textbf{Strabismics group}} & \multicolumn{2}{|l|}{\textbf{Anisometropics group}} \\
\hline
& \textbf{P50 latency (ms)} & \textbf{P50 amplitude (µv))} & \textbf{P50 latency (ms)} & \textbf{P50 amplitude (µv)} \\
\hline
Amblyopic eye & 52.6$\pm$4.4 & 1.7$\pm$0.96 & 50.4$\pm$4.9 & 1.9$\pm$1.13 \\
\hline
Non-amblyopic eye & 52.6$\pm$4.9 & 3.1$\pm$1.3 & 49.4$\pm$5.09 & 3.5$\pm$1.6 \\
\hline
\end{tabular}}
\end{table}
|
PMC3407582_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Organism} & \textbf{Read (Mb)} & \textbf{Fold coverage} & \textbf{No. of scaffolds} & \textbf{Genome size (bp)} & \textbf{G�C content (\%)} & \textbf{Accession no.} \\
\hline
D. aestuarii NBRC 106260T & 291 & 104 & 3 & 2,790,392 & 69.1 & BBRD00000000 \\
\hline
D. aurantiaca NBRC 106265T & 265 & 103 & 4 & 2,565,694 & 64.6 & BBRF00000000 \\
\hline
D. flava NBRC 105854T & 215 & 84 & 3 & 2,546,965 & 64.7 & BBRA00000000 \\
\hline
D. globuliformis NBRC 106266T & 262 & 100 & 7 & 2,622,354 & 66.3 & BBRG00000000 \\
\hline
D. lutea NBRC 106155T & 264 & 100 & 40 & 2,643,741 & 65.9 & BBRC00000000 \\
\hline
D. oxidasica NBRC 106264T & 224 & 85 & 5 & 2,623,557 & 64.1 & BBRE00000000 \\
\hline
D. salsinemoris NBRC 105323T & 215 & 67 & 14 & 3,209,522 & 70.2 & BBQZ00000000 \\
\hline
D. sediminicola NBRC 105855T & 226 & 92 & 8 & 2,460,989 & 62.7 & BBRB00000000 \\
\hline
\end{tabular}}
\end{table}
|
PMC4400432_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Reference} & \textbf{Country} & \textbf{Rural} & \textbf{Urban} & \textbf{Total} \\
\hline
Brighton 1985 [20] & South Africa & 29.5 (25.64–33.30) \\
\hline
Solomon 1976 [27] & South Africa & 29.7 (24.46–34.92) \\
\hline
Meyers 1982 [23] & South Africa & 82.7 (76.10–89.26) & 55.1 (40.74–73.54) & 77.2 (70.70–83.62) \\
\hline
Silman 1993 [37] & Nigeria & 0.4 (0.12–0.68) \\
\hline
Kaddu-Mukasa 2011 [40] & Uganda & 0.3 (-0.32–0.98) \\
\hline
Bija 2014 [42] & Tunisia & & 14.8 (13.31 to 16.27) \\
\hline
\end{tabular}}
\end{table}
|
PMC4524637_table_4
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Variable} & \textbf{Variable category} & \textbf{n} & \textbf{Palermo (\%)} & \textbf{Naples (\%)} & \textbf{Rome (\%)} & \textbf{Milan (\%)} & \textbf{Turin (\%)} & \textbf{Mean (\%)} & \textbf{CV} & \textbf{pa} \\
\hline
Gender & Male & 438 & 29.9 & 23.9 & 29.4 & 28.6 & 29.6 & 28.28 & 8.8 & �0.05 \\
\hline
& Female & 1,102 & 70.1 & 76.1 & 70.6 & 71.4 & 70.4 & 71.72 & 3.5 \\
\hline
Age (years) & 18�24 & 45 & 2.8 & 2.8 & 2.8 & 2.9 & 3.6 & 2.98 & 11.7 & �0.05 \\
\hline
& 25�34 & 164 & 10.6 & 10.8 & 13.3 & 10.0 & 6.8 & 10.30 & 22.6 \\
\hline
& 35�44 & 362 & 24.4 & 27.1 & 18.6 & 17.7 & 27.6 & 23.08 & 20.3 \\
\hline
& 45�54 & 291 & 24.0 & 23.9 & 20.9 & 18.3 & 21.6 & 21.74 & 10.9 \\
\hline
& 55�64 & 349 & 23.6 & 17.9 & 22.1 & 25.4 & 16.0 & 21.00 & 18.7 \\
\hline
& ]65 & 329 & 14.6 & 17.5 & 22.3 & 25.7 & 24.4 & 20.90 & 22.5 \\
\hline
Household composition & 1 (interviewee) & 134 & 3.9 & 4.0 & 8.7 & 12.3 & 13.2 & 8.42 & 52.4 & �0.05 \\
\hline
& 2 & 432 & 21.3 & 20.3 & 30.8 & 36.0 & 26.8 & 27.04 & 24.3 \\
\hline
& 3 & 379 & 20.5 & 21.9 & 24.6 & 27.4 & 27.6 & 24.40 & 13.1 \\
\hline
& 4 & 447 & 36.2 & 36.3 & 30.6 & 18.3 & 26.8 & 29.64 & 25.3 \\
\hline
& 5 & 121 & 14.2 & 13.9 & 4.4 & 5.4 & 4.8 & 8.54 & 59.1 \\
\hline
& �5 & 27 & 3.9 & 3.6 & 0.9 & 0.6 & 0.8 & 1.96 & 83.7 \\
\hline
Education level & Elementary & 176 & 11.0 & 15.5 & 10.4 & 9.7 & 12.0 & 11.72 & 19.4 & �0.05 \\
\hline
& Junior high & 361 & 28.3 & 22.7 & 17.9 & 24.0 & 28.0 & 24.18 & 17.7 \\
\hline
& Middle level & 658 & 40.6 & 43.4 & 48.3 & 39.4 & 39.2 & 42.18 & 9.0 \\
\hline
& Bachelor & 325 & 19.3 & 17.9 & 22.0 & 24.9 & 19.2 & 20.66 & 13.6 \\
\hline
& Post-bachelor & 20 & 0.8 & 0.4 & 1.4 & 2.0 & 1.6 & 1.24 & 51.5 \\
\hline
Partner’s education level & Elementary & 102 & 5.1 & 8.4 & 5.7 & 6.9 & 7.6 & 6.74 & 20.0 & �0.05 \\
\hline
& Junior high & 291 & 23.6 & 25.9 & 14.7 & 16.3 & 18.0 & 19.70 & 24.5 \\
\hline
& Middle level & 491 & 34.6 & 31.5 & 34.9 & 29.7 & 27.2 & 31.58 & 10.4 \\
\hline
& Bachelor & 279 & 15.7 & 15.1 & 18.6 & 18.9 & 21.6 & 17.98 & 14.7 \\
\hline
& Post-bachelor & 11 & 0.8 & 1.2 & 0.7 & 0.3 & 0.8 & 0.76 & 42.2 \\
\hline
& Without spouse & 366 & 20.1 & 17.9 & 25.3 & 28.0 & 24.8 & 23.22 & 17.7 \\
\hline
\end{tabular}}
\end{table}
|
PMC5088346_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{XIAP expression} & \textbf{Low (\%)} & \textbf{High (\%)} \\
\hline
Pre-chemotherapy & 43(72) & 17(28) \\
\hline
Post-chemotherapy & 31(52) & 29(48) \\
\hline
P & 0.011 \\
\hline
\end{tabular}}
\end{table}
|
PMC3293890_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{main category} & \textbf{thematic areaS of data collection} & \textbf{Source of data} & \textbf{viSit and time of data collection} \\
\hline
Maternal morbidity & \multicolumn{2}{|l|}{1. Antepartum hemorrhage 1. Maternal self–report 2. Postpartum hemorrhage 2. Maternal self–report and birth attendant interview 3. Hypertensive disorders of pregnancy 3. Measurements of blood pres- sure and urine protein at all home visits, maternal self–re- port 4. Difficulty in labor 4. Maternal self–report and birth attendant interview 5. Infection 5. Maternal self–report 6. Obstetric fistula 6. Maternal self–report} & Antenatal home visits (24–28 weeks, 32–36 weeks, 37–40 weeks), postna- tal home visits (day 1–6 and day 42– 60 after birth), birth attendant inter- views 0–6 days after birth, health facility records \\
\hline
\\
\hline
\\
\hline
\\
\hline
\\
\hline
\\
\hline
Background characteristics & Socio–economic, baseline characteristics of the woman and her household, including an asset inventory & Maternal self–report & Baseline home visit at enrolment \\
\hline
Medical history & Previous obstetric and gynecological history, birth defects, prematurity, stillbirths and IUGR among previous babies, previous medical and surgical history & Maternal self–reports and health facility records & Baseline home visit at enrolment \\
\hline
Risk factors and exposures & Cigarette smoking, alcohol ingestion, smoke from biomass cooking fuels & Maternal self–reports & Baseline home visit at enrolment \\
\hline
Anthropometry & Paternal and maternal weights and heights, ma- ternal mid–upper arm circumference & Health facility records & All antenatal and postnatal home visits \\
\hline
Screening for hypertensive disorders of pregnancy & Measurement of blood pressure and testing urine for proteins & Direct measurement during home visits & All visits except delivery visits \\
\hline
\end{tabular}}
\end{table}
|
PMC5019012_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{Function} & \textbf{Gene} & \textbf{Fold change} \\
\hline
cell cycle progression and proliferation & CCL20 & 5.2 $\pm$ 0.4 \\
\hline
& cell division cycle 2 & 2.3 $\pm$ 0.1 \\
\hline
& cyclin A2 & 3.4 $\pm$ 0.2 \\
\hline
& cyclin B1 & 3.5 $\pm$ 0.6 \\
\hline
& cyclin E & 5.2 $\pm$ 0.6 \\
\hline
& Ki67 & 3.1 $\pm$ 0.3 \\
\hline
& PCNA & 4.1 $\pm$ 0.6 \\
\hline
angiogenesis & CXCL1 & 2.1 $\pm$ 0.4 \\
\hline
& CXCL8 & 3.2 $\pm$ 0.6 \\
\hline
& FGF2 & 4.6 $\pm$ 0.2 \\
\hline
& HGF & 4.1 $\pm$ 0.5 \\
\hline
& HIF-3$\alpha$ & 5.2 $\pm$ 0.3 \\
\hline
& VEGF & 2.5 $\pm$ 0.2 \\
\hline
inflammation & CCL2 & 5.2 $\pm$ 0.4 \\
\hline
& IL-1R & 3.2 $\pm$ 0.3 \\
\hline
& IL-6R & 2.1 $\pm$ 0.3 \\
\hline
ECM remodeling & ADAM & 2.1 $\pm$ 0.1 \\
\hline
& MMP-2 & 5.7 $\pm$ 0.3 \\
\hline
& MMP-9 & 3.3 $\pm$ 0.6 \\
\hline
& TIMP-1 & 3.4 $\pm$ 0.2 \\
\hline
& PAI-1 & 3.2 $\pm$ 0.4 \\
\hline
& u-PA & 6.4 $\pm$ 0.5 \\
\hline
\end{tabular}}
\end{table}
|
PMC4745719_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
& \textbf{Site-I} & \textbf{Site-II} \\
\hline
Location & Magdalena River valley & Orinoco River basin \\
\hline
Survey period & April-August 2014 & April-May 2014 \\
\hline
Traps active & 47 & 52 \\
\hline
Trap nights & 2251 & 2457 \\
\hline
Minimum Convex Camera polygon (km2) & 154.8 & 151.3 \\
\hline
N recorded & 10 & 6 \\
\hline
MMDM (km) & 4.2 & 5.7 \\
\hline
Effective sampled area (km2) & 396.2 & 537.2 \\
\hline
\end{tabular}}
\end{table}
|
PMC4856405_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Species} & \textbf{\# genes amplified1} & \textbf{\# disrupted genes} & \textbf{\% disrupted} \\
\hline
A449 & 162 & 16 & 100 \\
\hline
A449 cDNA & 16 & 16 & 100 \\
\hline
A. salmonicida subsp. salmonicida ATCC 33658T & 15 & 15 & 100 \\
\hline
A. salmonicida subsp. salmonicida ATCC 51413 (non-pigmented) & 16 & 16 & 100 \\
\hline
A. salmonicida subsp. masoucida ATCC 27013T & 13 & 3 & 23 \\
\hline
A. salmonicida subsp. achromogenes ATCC 33659T & 14 & 3 & 21 \\
\hline
A. salmonicida subsp. smithia ATCC 49393T & 15 & 4 & 27 \\
\hline
A. bestarium ATCC 51108T & 7 & 0 & 0 \\
\hline
A. veronii bv. sobria ATCC 9071 & 4 & 0 & 0 \\
\hline
A. sobria ATCC 43979T & 2 & 0 & 0 \\
\hline
A. caviae ATCC 15468T & 2 & 0 & 0 \\
\hline
A. hydrophila ATCC 7966T & 132 & 0 & 0 \\
\hline
\end{tabular}}
\end{table}
|
PMC2556355_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Brand/Model} & \textbf{Optical Resolution} & \textbf{Dmax 1} & \textbf{Color Depth} & \textbf{Cost} \\
\hline
\multicolumn{5}{|l|}{Creo/Kodak} \\
\hline
Eversmart Supreme & 5600 dpi & 4.3 & 48-bit color & \$ 45,000 \\
\hline
iQsmart3 & 3175 dpi & 4.0 & & \$ 20,000 \\
\hline
\multicolumn{5}{|l|}{Epson Expression} \\
\hline
10000 XL & 2540 dpi & 3.8 & 48-bit color & \$ 2,500–\$ 3,000 \\
\hline
\end{tabular}}
\end{table}
|
PMC4553449_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Model} & \textbf{Estimate (s.e.)} & \textbf{t} & \textbf{P} & \textbf{$\lambda$} \\
\hline
\multicolumn{5}{|l|}{FMR (n = 27 species)} \\
\hline
Food load manipulation ability & −0.059 (0.016) & −3.71 & 0.001 & 0.01 \\
\hline
Body mass & 0.013 (0.021) & 0.64 & 0.53 \\
\hline
\multicolumn{5}{|l|}{WL (n = 24 species)} \\
\hline
Food load manipulation ability & 0.148 (0.059) & 2.49 & 0.021 & 0.70 \\
\hline
Body mass & 0.278 (0.053) & 5.25 & $<$ 0.001 \\
\hline
\end{tabular}}
\end{table}
|
PMC3698194_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
& \multicolumn{3}{|l|}{\textbf{Median (95\% CI)}} \\
\hline
& \textbf{WT KRAS (n = 86)} & \textbf{MT KRAS (n = 59)} & \textbf{Overall (n = 154)} \\
\hline
\\
\hline
\multicolumn{4}{|l|}{Time to first integument toxicity, days [min, max]} \\
\hline
Any grade & 8.0 (7,0, 10.0) & 10.0 (7.0, 13.0) & 8.0 (7.0, 11.0) \\
\hline
& [0, 155] & [0, 125] & [0, 155] \\
\hline
Grade $\geq$3 & NE (300.0, NE) & NE (175.0, NE) & 408.0 (300.0, NE) \\
\hline
& [6, 528] & [0, 389] & [0, 528] \\
\hline
\multicolumn{4}{|l|}{Duration of integument toxicity, days [min, max]} \\
\hline
Any grade & 452.0 (244.0, NE) & 321.0 (228.0, 371.0) & 334.0 (244.0, NE) \\
\hline
& [14, 492] & [19, 445] & [14, 492] \\
\hline
Grade $\geq$3 & 32.0 (17.0, 43.0) & 55.5 (25.0, 80.0) & 36.0 (25.0, 54.0) \\
\hline
& [5, 322] & [5, 268] & [5, 322] \\
\hline
\multicolumn{4}{|l|}{Time to resolution, days [min, max]} \\
\hline
Any grade & 103.0 (55.0, NE) & 71.0 (52.0, 86.0) & 71.0 (59.0, 162.0) \\
\hline
& [0, 309] & [5, 162] & [0, 309] \\
\hline
Grade $\geq$3 & 103.0 (68.0, NE) & 86.0 (86.0, 162.0) & 86.0 (68.0, 162.0) \\
\hline
& [0, 124] & [12, 162] & [0, 162] \\
\hline
\end{tabular}}
\end{table}
|
PMC3520865_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Basic data, part I} & \textbf{Diabetes duration (year)} & \textbf{Height (cm)} & \textbf{Weight (kg)} & \textbf{HbA1c (\%)} \\
\hline
Reported from professionals (mean/median) & 16.1/12 & 171.2/171 & 84.2/84 & 7.5/7.3 \\
\hline
Self-reported (mean/median) & 16.9/14 & 171.3/171 & 82.8/82 & 7.5/7.2 \\
\hline
Difference in mean & -0.78a & -0.09 & 1.42a & 0.0 \\
\hline
\end{tabular}}
\end{table}
|
PMC4678468_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Ethnic groups} & \textbf{H63D+/+ rs2032451} & \textbf{Number} & \textbf{H63D+/− rs2032451} & \textbf{Number} & \textbf{H63D−/− rs2032451} & \textbf{Number} \\
\hline
\\
\hline
Russians & T/T & 3 & G/T & 9 & G/G & 8 \\
\hline
Tatars & T/T & 1 & G/T & 18 \\
\hline
Mansis & & & G/T & 5 \\
\hline
Nanaians & & & G/T & 5 & G/G & 6 \\
\hline
Nivkhs & & & G/T & 3 & G/G & 5 \\
\hline
Altaians & T/T & 1 & G/T & 4 \\
\hline
Khakas & & & G/T & 9 \\
\hline
Koryaks & & & G/T & 3 \\
\hline
Kazakhs & & & G/T & 9 \\
\hline
Shorians & & & G/T & 16 \\
\hline
Chukchis & & & G/T & 2 \\
\hline
Total & & 5 & & 83 & & 19 \\
\hline
\end{tabular}}
\end{table}
|
PMC4912798_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Parameters} & \textbf{Event (+)} & \textbf{Event (-)} & \textbf{P value} \\
\hline
n & 13 & 115 \\
\hline
Age (year) & 84.2$\pm$1.19 & 83.6$\pm$0.39 & 0.6202 \\
\hline
Female (\%) & 11 (84.6) & 73 (63.5) & 0.2166 \\
\hline
CAD (\%) & 7 (53.9) & 37 (32.2) & 0.1336 \\
\hline
HT (\%) & 10 (76.9) & 83 (72.2) & 1.000 \\
\hline
CKD (\%) & 9 (69.2) & 65 (56.5) & 0.5553 \\
\hline
DM (\%) & 4 (30.8) & 31 (27.0) & 0.7502 \\
\hline
BNP (pg/ml) & 462$\pm$119 & 358$\pm$40 & 0.4111 \\
\hline
LVDd (mm) & 44.5$\pm$1.6 & 44.2$\pm$0.50 & 0.8403 \\
\hline
LVDs (mm) & 29.8$\pm$1.9 & 27.8$\pm$0.63 & 0.3145 \\
\hline
IVS (mm) & 10.3$\pm$0.60 & 11.1$\pm$0.19 & 0.1605 \\
\hline
PW (mm) & 10.3$\pm$0.40 & 10.6$\pm$0.14 & 0.4965 \\
\hline
LVEF (\%) & 56.7$\pm$3.5 & 63.1$\pm$1.2 & 0.0799 \\
\hline
LVMI (g/m2) & 118$\pm$8.9 & 119$\pm$3.0 & 0.9402 \\
\hline
E (cm/s) & 78.3$\pm$9.4 & 81.6$\pm$2.8 & 0.7373 \\
\hline
A (cm/s) & 101.9$\pm$10.1 & 106.7$\pm$3.0 & 0.6495 \\
\hline
E/A & 0.80$\pm$0.19 & 0.80$\pm$0.05 & 0.9901 \\
\hline
Dct (ms) & 275$\pm$28 & 269$\pm$9 & 0.8246 \\
\hline
Septal e’ (cm/s) & 3.78$\pm$0.39 & 3.86$\pm$0.12 & 0.8502 \\
\hline
Lateral e’ (cm/s) & 6.07$\pm$0.51 & 5.40$\pm$0.17 & 0.2186 \\
\hline
Averaged e’ (cm/s) & 5.22$\pm$1.78 & 4.65$\pm$1.29 & 0.1441 \\
\hline
E/e’ & 16.2$\pm$2.6 & 17.8$\pm$0.75 & 0.5588 \\
\hline
Peak AV velocity (m/s) & 4.57$\pm$0.21 & 4.53$\pm$0.07 & 0.8488 \\
\hline
AV mean PG (mmHg) & 50.1$\pm$5.0 & 49.9$\pm$1.7 & 0.9765 \\
\hline
AVA (cm2) & 0.57$\pm$0.05 & 0.66$\pm$0.02 & 0.1107 \\
\hline
AR ($\geqq$3) (\%) & 0 (0) & 16(13.9) & 0.3687 \\
\hline
MR ($\geqq$3) (\%) & 3 (23.1) & 8 (7.0) & 0.084 \\
\hline
TR ($\geqq$3) (\%) & 2 (15.4) & 5 (4.4) & 0.1495 \\
\hline
GLS (\%) & -11.6$\pm$1.2 & -15.1$\pm$0.4 & 0.0061 \\
\hline
SR_E (/s) & 0.71$\pm$0.10 & 0.78$\pm$0.03 & 0.5043 \\
\hline
E/SR_E (cm) & 142$\pm$22.5 & 122$\pm$6.6 & 0.3801 \\
\hline
\end{tabular}}
\end{table}
|
PMC6181329_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Protein} & \textbf{Toxicity Modifiers} & \textbf{Description} & \textbf{Other Models} & \textbf{References} \\
\hline
Tau & Pin1 (yeast homologue Ess1) & Depletion of Pin1 isomerase activity results in reduced growth of Tau expressing yeast cells. & mouse model & [93,196,197] \\
\hline
A$\beta$ & peptidomimetic inhibitors & Inhibition of A$\beta$42 aggregation by peptidomimetics. & - & [169] \\
\hline
A$\beta$ & latrepirdine (Dimebon$\text{TM}$) & Latrepirdine induces autophagy and decreases the intracellular GFP-A$\beta$42 levels in yeast. & Hela cells, mouse model & [170,174] \\
\hline
A$\beta$ & clioquinol & Small molecule screen identified several 8-hydroxyquinolines, including clioquinol, that ameliorate A$\beta$ toxicity. & mouse model, nematode model & [175–179] \\
\hline
A$\beta$ & dihydropyrimidine-thiones & Phenotypic small molecule yeast screen identified dihydropyrimidine-thiones that rescue A$\beta$-induced toxicity in a metal dependent manner. & nematode model & [176] \\
\hline
A$\beta$ & PICALM (yeast homologues Yap1801, Yap1802) & Screening of overexpression library yielded suppressors and enhancers of A$\beta$42 toxicity, including the PICALM suppressor. & rat cortical neurons & [181–183] \\
\hline
\end{tabular}}
\end{table}
|
PMC6073265_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{|l|}{\textbf{2010}} & \multicolumn{2}{|l|}{\textbf{2030}} \\
\hline
& \textbf{number of people with diabetes millions} & \textbf{Prevalence of diabetes \%} & \textbf{number of people with diabetes millions} & \textbf{Prevalence of diabetes \%} & \textbf{increase in number of people with diabetes} \\
\hline
\textbf{region} & & & & & \textbf{\%} \\
\hline
Europe & 55.2 & 6.9 & 66.2 & 8.1 & 20.0 \\
\hline
North America and Caribbean & 37.4 & 10.2 & 53.2 & 12.1 & 42.4 \\
\hline
Middle East and North Africa & 26.6 & 9.3 & 51.7 & 10.8 & 93.9 \\
\hline
South and Central America & 18 & 6.6 & 29.6 & 7.8 & 65.1 \\
\hline
Western Pacific (incl. China) & 76.7 & 4.7 & 112.8 & 5.7 & 47.0 \\
\hline
Southeast Asia (incl. India) & 58.7 & 7.6 & 101 & 9.1 & 72.1 \\
\hline
Sub-Saharan Africa & 12.1 & 3.8 & 23.9 & 4.7 & 98.1 \\
\hline
total (average) & 284.6 & (6.4) & 438.4 & (7.7) & 54.0 \\
\hline
\end{tabular}}
\end{table}
|
PMC3218390_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
\textbf{RSH Grade} & \textbf{Description} & \textbf{Management} \\
\hline
and ACS Grade I—mild & Intramuscular, unilateral, and does not dissect along fascia adjacent to the rectus muscle & Observation \\
\hline
is the ACS. Grade II—moderate & Intramuscular, dissects along adjacent fascia, may involve bilateral rectus muscles but without extension into the prevesical space & Anticoagulation reversal \\
\hline
is Grade III—severe & Dissects along the fascia and extends into the peritoneum and the prevesical space. & Anticoagulation reversal Blood product administration \\
\hline
\end{tabular}}
\end{table}
|
PMC3534252_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Clinical group} & \textbf{Controls (n = 27)} & \textbf{Not Infected (n = 118)} & \textbf{Infected (n = 74)} \\
\hline
& & & & Culture positive (n = 41) & Culture Negative (n = 33) \\
\hline
Duration of antibiotic therapy (days) & 0 (0,0) & 2 (1,3) & 5 (5,7) & 7 (5,7) & 5 (5,7) \\
\hline
sICAM-1 (ng/ml), & 165 (130,290) & 168 (140,228) & 341 (236,554) P $<$ 0.001 & 405 (252,666) P $<$ 0.001 & 306 (230,484) P $<$ 0.001 \\
\hline
hsCRP(mg/l), & 0.1 (0.1,0.4) & 0.1 (0.1,0.7) & 0.85 (0.3,15.9) P $<$ 0.001 & 2.0 (0.7,21.2) P $<$ 0.001 & 0.45 (0.1,2.2) P = 0.012 \\
\hline
SAA(mg/l) & 0.9 (0.9,1.0) & 1.0 (0.9,2.0) & 1.5 (0.9,5.8) P = 0.004 & 2.0 (1.0-10.0) P = 0.001 & 1.0 (0.9,2.0) P $>$ 0.05 \\
\hline
sE-selectin(ng/ml) & 71 (51,118) & 90 (59,124) & 135 (94,192) P $<$ 0.001 & 158 (94,207) P $<$ 0.001 & 109 (92,184) P = 0.009 \\
\hline
\end{tabular}}
\end{table}
|
PMC2868836_table_3
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{The GREET checklist item} & \textbf{n} & \multicolumn{3}{|l|}{\textbf{Agreement with consensus criterion ratings}} \\
\hline
& & \textbf{Agreementa n (\%)} & \textbf{Partiala agreement n (\%)} & \textbf{Noa agreement n (\%)} \\
\hline
\\
\hline
1. Title & 31 & 21 (68) & 8 (26) & 2 (6) \\
\hline
2. Theory & 31 & 18 (58) & 7 (23) & 6 (19) \\
\hline
3. Learning objectives & 31 & 18 (58) & 11 (35) & 2 (6) \\
\hline
4. Steps of EBP & 31 & 6 (19) & 18 (58) & 7 (23) \\
\hline
5. Materials & 31 & 8 (26) & 20 (65) & 3 (9) \\
\hline
6. Learning strategies & 31 & 22 (71) & 8 (26) & 1 (3) \\
\hline
7. Incentives & 31 & 24 (78) & 1 (3) & 6 (19) \\
\hline
8. Instructors & 31 & 25 (81) & 6 (19) & 0 (0) \\
\hline
9. Delivery & 31 & 16 (52) & 10 (32) & 5 (16) \\
\hline
10. Environment & 31 & 15 (49) & 9 (28) & 7 (23) \\
\hline
11. Schedule & 31 & 16 (52) & 14 (45) & 1 (3) \\
\hline
12. Face to face time & 31 & 18 (58) & 8 (26) & 5 (16) \\
\hline
13. Adaptations & 31 & 16 (52) & 9 (28) & 6 (20) \\
\hline
14. Modifications & 31 & 26 (84) & 1 (3) & 4 (13) \\
\hline
15. Attendance & 31 & 20 (64) & 7 (23) & 4 (13) \\
\hline
16. Planned delivery & 31 & 29 (94) & 0 (0) & 2 (6) \\
\hline
17. Actual schedule & 31 & 25 (81) & 4 (13) & 2 (6) \\
\hline
Reliability: & \multicolumn{4}{|l|}{ICC (95 \% CI), p=} \\
\hline
Criterion validity ICC (95 \% CI), p= & \multicolumn{4}{|l|}{0.73 (.51–.88), p $<$ .0001} \\
\hline
Inter-rater reliability ICC (95 \% CI), p= & \multicolumn{4}{|l|}{0.96 (.93–.98), p $<$ .0001} \\
\hline
\end{tabular}}
\end{table}
|
PMC5011880_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Condition} & \multicolumn{3}{|l|}{\textbf{Single task}} & \multicolumn{3}{|l|}{\textbf{Inhibition dual task}} & \multicolumn{3}{|l|}{\textbf{Control to Inhibition}} \\
\hline
\textbf{Trial type} & \textbf{Correct} & \textbf{Incorrect} & \textbf{"New"} & \textbf{Correct} & \textbf{Incorrect} & \textbf{"New"} & \textbf{Correct} & \textbf{Incorrect} & \textbf{"New"} \\
\hline
Related Colour & 393 & 63 & 48 & 275 & 68 & 89 & 311 & 48 & 73 \\
\hline
Opposite Colour & 336 & 108 & 60 & 206 & 111 & 115 & 265 & 89 & 78 \\
\hline
Colour 1 / Neutral colour related & 173 & 53 & 26 & 129 & 43 & 44 & 127 & 47 & 42 \\
\hline
Colour 2 / Neutral colour related & 188 & 36 & 28 & 121 & 39 & 56 & 134 & 38 & 44 \\
\hline
& Expected & Unexpected & “New” & Expected & Unexpected & “New” & Expected & Unexpected & “New” \\
\hline
New / Colour 1 or 2 related & 35 & 27 & 442 & 36 & 13 & 383 & 27 & 19 & 386 \\
\hline
& “Colour 1” & “Colour 2” & “New” & “Colour 1” & “Colour 2” & “New” & “Colour 1” & “Colour 2” & “New” \\
\hline
New / Neutral colour related & 13 & 8 & 231 & 6 & 13 & 197 & 8 & 6 & 202 \\
\hline
\end{tabular}}
\end{table}
|
PMC4591844_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
S1—C1 & 1.811 (2) & C3—C2 & 1.341 (3) \\
\hline
S1—S1i & 2.0254 (12) & C3—C4 & 1.416 (4) \\
\hline
O1—C5 & 1.361 (3) & C3—H3 & 0.9300 \\
\hline
O1—C2 & 1.372 (3) & C4—C5 & 1.324 (4) \\
\hline
O2—C1 & 1.202 (3) & C4—H4 & 0.9300 \\
\hline
C1—C2 & 1.455 (3) & C5—H5 & 0.9300 \\
\hline
C1—S1—S1i & 99.92 (8) & C3—C2—C1 & 132.3 (2) \\
\hline
C5—O1—C2 & 106.0 (2) & O1—C2—C1 & 117.8 (2) \\
\hline
O2—C1—C2 & 123.6 (2) & C5—C4—C3 & 106.9 (3) \\
\hline
O2—C1—S1 & 123.74 (19) & C5—C4—H4 & 126.5 \\
\hline
C2—C1—S1 & 112.64 (17) & C3—C4—H4 & 126.5 \\
\hline
C2—C3—C4 & 106.5 (2) & C4—C5—O1 & 110.8 (3) \\
\hline
C2—C3—H3 & 126.8 & C4—C5—H5 & 124.6 \\
\hline
C4—C3—H3 & 126.8 & O1—C5—H5 & 124.6 \\
\hline
C3—C2—O1 & 109.9 (2) \\
\hline
S1i—S1—C1—O2 & 1.2 (2) & S1—C1—C2—C3 & 179.3 (2) \\
\hline
S1i—S1—C1—C2 & −178.38 (15) & O2—C1—C2—O1 & 179.5 (2) \\
\hline
C4—C3—C2—O1 & 0.0 (3) & S1—C1—C2—O1 & −1.0 (3) \\
\hline
C4—C3—C2—C1 & 179.7 (2) & C2—C3—C4—C5 & 0.2 (3) \\
\hline
C5—O1—C2—C3 & −0.2 (3) & C3—C4—C5—O1 & −0.4 (3) \\
\hline
C5—O1—C2—C1 & 180.0 (2) & C2—O1—C5—C4 & 0.4 (3) \\
\hline
O2—C1—C2—C3 & −0.3 (4) \\
\hline
\end{tabular}}
\end{table}
|
PMC3247447_table_3
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
& \textbf{Tertile level} & \textbf{Relative Change in population access (\%)} \\
\hline
Water & Lowest & -7.0 to 2.3 \\
\hline
& Middle & 2.4 to 8.5 \\
\hline
& Highest & 11.1 to 71.0 \\
\hline
Sanitation & Lowest & -20.8 to 3.2 \\
\hline
& Middle & 3.7 to 14.8 \\
\hline
& Highest & 17.9 to 118.2 \\
\hline
\end{tabular}}
\end{table}
|
PMC2921361_table_3
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Antimicrobial Agents} & \multicolumn{3}{|l|}{\textbf{MSSA (n = 74) a}} & \multicolumn{3}{|l|}{\textbf{MRSA (n = 200) a}} & \multicolumn{3}{|l|}{\textbf{MSCNS (n = 19) a}} & \multicolumn{3}{|l|}{\textbf{MRCNS (n = 33) a}} \\
\hline
& \textbf{Range} & \textbf{MIC50} & \textbf{MIC90} & \textbf{Range} & \textbf{MIC50} & \textbf{MIC90} & \textbf{Range} & \textbf{MIC50} & \textbf{MIC90} & \textbf{Range} & \textbf{MIC50} & \textbf{MIC90} \\
\hline
LCB01-0648 & 0.25–0.5 & 0.5 & 0.5 & 0.125–0.5 & 0.5 & 0.5 & 0.125–0.5 & 0.25 & 0.5 & 0.125–1 & 0.25 & 0.5 \\
\hline
Linezolid & 2 & 2 & 2 & 1–2 & 2 & 2 & 1–2 & 1 & 2 & 1–2 & 1 & 2 \\
\hline
Oxacillin & 0.06–4 & 0.25 & 0.5 & 8–64 & $>$64 & $>$64 & 0.03–1 & 0.125 & 1 & 2–64 & $>$64 & $>$64 \\
\hline
Erythromycin & 0.125–64 & 0.25 & $>$64 & 0.25–64 & $>$64 & $>$64 & 0.06–64 & 0.25 & $>$64 & 0.06–64 & $>$64 & $>$64 \\
\hline
Ciprofloxacin & 0.06–64 & 0.25 & 0.5 & 0.125–64 & 32 & $>$64 & 0.06–8 & 0.125 & 8 & 0.06–64 & 8 & 32 \\
\hline
Sparfloxacin & 0.015–8 & 0.06 & 0.125 & 0.06–64 & 16 & $>$64 & 0.03–8 & 0.125 & 4 & 0.03–32 & 4 & 16 \\
\hline
Moxifloxacin & 0.015–8 & 0.06 & 0.125 & 0.03–64 & 4 & 64 & 0.03–4 & 0.125 & 4 & 0.06–16 & 2 & 8 \\
\hline
Gemifloxacin & 0.008–8 & 0.015 & 0.06 & 0.008–64 & 2 & 64 & 0.008–0.5 & 0.015 & 0.5 & 0.008–8 & 0.5 & 4 \\
\hline
Vancomycin & 0.25–2 & 1 & 1 & 0.5–4 & 1 & 2 & 1–4 & 2 & 4 & 1–4 & 2 & 4 \\
\hline
Quinupristin–dalfopristin & 0.125–0.5 & 0.25 & 0.5 & 0.125–1 & 0.5 & 1 & 0.125–1 & 0.25 & 1 & 0.125–8 & 0.25 & 2 \\
\hline
\end{tabular}}
\end{table}
|
PMC6155267_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Rs10954213} & \multicolumn{2}{|l|}{\textbf{Allele}} & \multicolumn{3}{|l|}{\textbf{Genotype}} \\
\hline
\textbf{Group} & \textbf{A} & \textbf{G} & \textbf{AA} & \textbf{AG} & \textbf{GG} \\
\hline
BPD & 129 & 153 & 33 & 63 & 45 \\
\hline
C & 183 & 197 & 44 & 95 & 51 \\
\hline
MDD & 8 & 6 & 1 & 6 & 0 \\
\hline
SZ & 100 & 96 & 25 & 50 & 23 \\
\hline
\end{tabular}}
\end{table}
|
PMC2760574_table_5
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Resins} & \textbf{pHa} & \textbf{Fluorescence preservation of neuronsb} & \textbf{Time for penetration of a whole mouse brain} \\
\hline
HPMA & 7.12 & 210\% & .2 weeks \\
\hline
GMA & 6.0 & 69.98\% & 3 days \\
\hline
Unicryl & 5.12 & 51.54\% & 2 days \\
\hline
LR White & 4.8 & 27.59\% & 2 days \\
\hline
\end{tabular}}
\end{table}
|
PMC3618106_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{\#} & \textbf{Study location} & \textbf{Environment sample} & \textbf{Sample size} & \textbf{Lead level} & \textbf{References} \\
\hline
1 & Guilan & Blood plasma & \multicolumn{2}{|l|}{90 ill children 11.643 mg/dl 90 healthy children 4.924 mg/dl} & [64] \\
\hline
\\
\hline
2 & Birjand & Teeth & 108 children aging 5-12 years (deciduous teeth) & 1.9671.62 mg/dl & [65] \\
\hline
3 & Tehran & Blood & 100 children with hyperactivity and attention deficit & 7.272.365 mg/dl 7.18673.186 mg/dl & [66] \\
\hline
\\
\hline
& & & 100 healthy children \\
\hline
4 & Mashhad & Blood & 32 children aging 3-7 years old & 16.38175.719 mg/dl & [67] \\
\hline
5 & Zanjan & Blood & 45 children aging 7-11 living around Anguran lead mine & 36.7724.67 mg/dl 15.57713.35 mg/dl & [68] \\
\hline
\\
\hline
& & & 36 children aging 7-11 (control) \\
\hline
6 & Mashhad & Blood & 206 children aging 1-7 years & 12.19573.359 mg/dl & [69] \\
\hline
7 & Semnan & Blood & 320 primary students aging 6-11 in Semnan’s schools & 21\% below 10 mg/dl 74\% between 10 and 20 mg/dl 5\% over 20 mg/dl & [70] \\
\hline
\\
\hline
\\
\hline
\end{tabular}}
\end{table}
|
PMC6139886_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
D—H···A & D—H & H···A & D···A & D—H···A \\
\hline
O3—H3···O2iv & 0.81 & 1.88 & 2.648 (2) & 157 \\
\hline
O5—H5···O6v & 0.78 & 1.88 & 2.651 (2) & 170 \\
\hline
\end{tabular}}
\end{table}
|
PMC2959783_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Brain region} & \textbf{N voxels} & \textbf{p corr} & \textbf{z-value} & \textbf{x} & \textbf{y} & \textbf{z} \\
\hline
R STS middle & 259 & 0.000 & Inf & 60 & -30 & 0 \\
\hline
R STS anterior & 49 & 0.004 & 5.24 & 54 & 12 & -21 \\
\hline
L STS & 113 & 0.000 & 6.07 & -57 & -30 & -3 \\
\hline
L STS & 65 & 0.000 & 5.98 & -57 & -3 & -12 \\
\hline
R amygdale & 55 & 0.002 & 5.38 & 21 & -6 & -15 \\
\hline
L amygdale & 31 & 0.000 & 5.84 & -21 & -6 & -15 \\
\hline
\end{tabular}}
\end{table}
|
PMC3247873_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Treatment Comparison} & \multicolumn{2}{|l|}{\textbf{Mixed Treatment Comparison}} & \multicolumn{2}{|l|}{\textbf{Adjusted Indirect Comparison}} \\
\hline
& \textbf{Odds Ratio} & \textbf{95\% Credible Interval} & \textbf{Odds Ratio} & \textbf{95\% Confidence Interval} \\
\hline
Fluconazole vs. Control & 0.81 & (0.48, 1.37) & 0.94 & (0.54, 1.63) \\
\hline
Itraconazole vs. Control & 0.90 & (0.41, 1.99) & 0.49 & (0.15, 1.56) \\
\hline
Liposomal Amphotericin B vs. Control & 0.50 & (0.09, 2.33) & 0.54 & (0.10, 2.52) \\
\hline
Ketoconazole vs. Control & 1.83 & (0.38, 8.93) & 1.66 & (0.41, 6.66) \\
\hline
Intraconazole vs. Fluconazole & 1.12 & (0.52, 2.41) & 1.69 & (0.58, 5.33) \\
\hline
Liposomal Amphotericin B vs. Fluconazole & 0.62 & (0.10, 3.17) & 0.57 & (0.09, 3.39) \\
\hline
Ketoconazole vs. Fluconazole & 2.27 & (0.43, 12.09) & 1.76 & (0.39, 7.94)*** \\
\hline
Liposomal Amphotericin B vs. Itraconazole & 0.55 & (0.09, 3.11) & 1.10 & (0.14, 8.65)**, *** \\
\hline
Ketoconazole vs. Itraconazole & 2.03 & (0.35, 11.87) & 3.38 & (0.54, 21.16)*** \\
\hline
Ketoconazole vs. Liposomal Amphotericine B & 3.68 & (0.41, 35.30) & 3.07 & (0.34, 27.48)*** \\
\hline
\end{tabular}}
\end{table}
|
PMC2760541_table_4
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Groups} & \textbf{Adult worms Mean$\pm$SD (\% reduction)} & \textbf{Liver eggs Mean$\pm$SD (\% reduction)} & \textbf{Liver eggs/Female adult worm (\% reduction)} \\
\hline
\\
\hline
\\
\hline
\multicolumn{4}{|l|}{Trial 1} \\
\hline
\multicolumn{4}{|l|}{Control} \\
\hline
(PBS+CFA/IFA) & 8.863.8 & 28342615972 & 944765324 \\
\hline
\multicolumn{4}{|l|}{n = 10} \\
\hline
SjGALE & 5.662.9 & 13324612379 & 318864536 \\
\hline
n = 10 & (35.7\%* ) & (53\%**) & (66.2\%**) \\
\hline
\multicolumn{4}{|l|}{Trial 2} \\
\hline
\multicolumn{4}{|l|}{Control} \\
\hline
(PBS+CFA/IFA) & 18.765.6 & 991166576 & 226561893 \\
\hline
\multicolumn{4}{|l|}{n = 10} \\
\hline
SjGALE & 12.565.5 & 531262565 & 9166368 \\
\hline
n = 8 & (33.0\%*) & (46.4\%**) & (59.5\%**) \\
\hline
\end{tabular}}
\end{table}
|
PMC3407071_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
(C5H6N)3[MoCl4O2]Cl & Dx = 1.642 Mg m−3 \\
\hline
Mr = 545.51 & Mo K$\alpha$ radiation, $\lambda$ = 0.71073 Å \\
\hline
Trigonal, P3121 & Cell parameters from 6207 reflections \\
\hline
Hall symbol: P 31 2" & $\theta$ = 5.5–33.1° \\
\hline
a = 11.3972 (2) Å & µ = 1.21 mm−1 \\
\hline
c = 29.4265 (9) Å & T = 150 K \\
\hline
V = 3310.28 (13) Å3 & Block, yellow \\
\hline
Z = 6 & 0.18 $\times$ 0.12 $\times$ 0.10 mm \\
\hline
F(000) = 1632 \\
\hline
\end{tabular}}
\end{table}
|
PMC3006702_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \multicolumn{2}{|l|}{\textbf{Baseline}} & \multicolumn{2}{|l|}{\textbf{Follow-up}} & \textbf{Weightchange (kg)} \\
\hline
& \textbf{Ab} & \textbf{Comorbidities} & \textbf{Ab} & \textbf{Comorbidities} \\
\hline
1 & EMA, tTG & iron-deficiency anemia & - & none & 0 \\
\hline
2 & EMA, tTG & iron-deficiency anemia & - & none & +7 \\
\hline
3 & EMA, tTG & thyroiditis & - & thyroiditis & +4 \\
\hline
4 & EMA, tTG & asthma & - & none & -3 \\
\hline
5 & EMA, tTG & thyroiditis & - & thyroiditis & 0 \\
\hline
6 & EMA, tTG & thyroiditis, iron-deficiency anemia & EMA, tTG & thyroiditis, iron-deficiency anemia & +1 \\
\hline
7 & EMA, tTG & vitiligo & EMA, tTG & vitiligo & +4 \\
\hline
8 & EMA, tTG & iron-deficiency anemia, thyroiditis, infertility & EMA, tTG & iron-deficiency anemia, thyroiditis, osteopenia & 0 \\
\hline
9 & - & osteopenia & - & iron-deficiency anemia, osteopenia & 0 \\
\hline
10 & EMA, tTG & none & EMA, tTG & none & +8 \\
\hline
11 & EMA, tTG & none & EMA, tTG & none & +3 \\
\hline
12 & EMA, tTG & none & EMA, tTG & none & +1 \\
\hline
13 & EMA, tTG & thyroiditis, iron-deficiency anemia & EMA, tTG & thyroiditis, iron-deficiency anemia & 0 \\
\hline
\end{tabular}}
\end{table}
|
PMC4460029_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Experiment} & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} \\
\hline
Level & 6\%, 6\% & 10\%, 10\% & 10\%, 20\% & NPL, 15\% & NPL, NPL \\
\hline
Country & Japan NIKKEI 225 & CSI 300 & & & British FISE 100 \\
\hline
\end{tabular}}
\end{table}
|
PMC4646506_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\multicolumn{7}{|l|}{\textbf{0.49 Two-stage methods GBLUP}} \\
\hline
\textbf{0.50} \\
\hline
\textbf{0.51} & \textbf{TMT} & \textbf{AT} & \textbf{TP} & \textbf{DT} & \textbf{MMF} & \textbf{AVGF} \\
\hline
0.37 Slope & 0.88 & 0.879 & 0.850 & 0.850 & 0.865 & 0.812 \\
\hline
0.50 Correlation & 0.780 & 0.861 & 0.800 & 0.720 & 0.770 & 0.702 \\
\hline
\multicolumn{7}{|l|}{0.50 Bayesian LASSO} \\
\hline
Slope & 0.870 & 0.922 & 0.800 & 0.810 & 0.860 & 0.862 \\
\hline
dEBV: Correlation & 0.780 & 0.814 & 0.830 & 0.770 & 0.730 & 0.717 \\
\hline
\multicolumn{7}{|l|}{BayesA} \\
\hline
Slope & 0.870 & 0.892 & 0.840 & 0.824 & 0.881 & 0.901 \\
\hline
from Correlation & 0.770 & 0.863 & 0.780 & 0.740 & 0.780 & 0.703 \\
\hline
\multicolumn{7}{|l|}{Single-step method} \\
\hline
\multicolumn{7}{|l|}{HBLUP} \\
\hline
Slope & 0.842 & 0.869 & 0.757 & 0.873 & 0.775 & 0.814 \\
\hline
Correlation & 0.907 & 0.929 & 0.867 & 0.925 & 0.880 & 0.897 \\
\hline
\end{tabular}}
\end{table}
|
PMC3507773_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Region} & \textbf{Explanatory variable} & \textbf{df} & \textbf{t} & \textbf{p-value} & \textbf{Explained variance (\%)} \\
\hline
Denmark & Fungicide & 1 & 1.2 & 0.263 & 2.9 \\
\hline
& Cycle & 2 & 13.7 & 0.001 & 41.3 \\
\hline
& Fungicide $\times$ Cycle & 2 & 3.6 & 0.002 & 9.3 \\
\hline
Germany & Fungicide & 1 & 1.2 & 0.299 & 6.3 \\
\hline
& Cycle & 1 & 3.6 & 0.001 & 16.5 \\
\hline
& Fungicide $\times$ Cycle & 1 & 1.1 & 0.365 & 5.1 \\
\hline
Sweden & Fungicide & 1 & 9.1 & 0.001 & 21.6 \\
\hline
& Cycle & 2 & 1.4 & 0.224 & 8.0 \\
\hline
& Fungicide $\times$ Cycle & 2 & 0.4 & 0.917 & 1.5 \\
\hline
\end{tabular}}
\end{table}
|
PMC6242862_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{aortic valve peak gradient} & \textbf{mitral valve peak velocity} \\
\hline
Ao max pg & MV peak velocity \\
\hline
AV peak gradient & mitral valve peak velocity \\
\hline
aortic valve peak gradient & MV peak recorded velocity \\
\hline
AV peak pressure gradient & mitral peak recorded velocity \\
\hline
aortic valve peak pressure gradient & peak velocity across MV \\
\hline
peak pressure gradient across aortic valve & peak velocity across mitral valve \\
\hline
peak pressure gradient across aortic bioprosthetic valve & peak velocity across mitral bioprosthetic valve \\
\hline
peak pressure gradient across aortic bioprosthesis & peak velocity across bioprosthetic mitral valve \\
\hline
Ao peak pressure forward flow gradient & peak velocity across mitral bioprosthesis \\
\hline
aortic valve peak pressure forward flow gradient & across mitral bioprosthetic valve peak velocity \\
\hline
peak transaortic valve gradient & across bioprosthetic mitral valve peak velocity \\
\hline
peak trans aortic valve pressure gradient & across mitral bioprosthesis peak velocity \\
\hline
peak Ao valve gradient & peak transmitral velocity \\
\hline
peak aortic valve gradient & peak mitral valve velocity \\
\hline
peak Ao pressure difference & peak mitral velocity \\
\hline
\end{tabular}}
\end{table}
|
PMC4849652_table_3
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
& \textbf{Genes} & \textbf{Transcripts} \\
\hline
Total & 15,392 & 18,966 \\
\hline
matcha & 14,898 & 18,472 \\
\hline
new & 494 & 494 \\
\hline
\end{tabular}}
\end{table}
|
PMC5940132_table_3
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Occupation} & \textbf{Prestige score} & \textbf{Occupation} & \textbf{Prestige score} \\
\hline
Doctor & 85.6 & Officer (armed forces) & 65.5 \\
\hline
Assemblyman & 84.7 & Police officer & 63.9 \\
\hline
Professor & 84.2 & Employee of a large company & 61.9 \\
\hline
Owner of a large company & 83.1 & Nurse & 61.3 \\
\hline
Lawyer & 82.7 & Computer programmer & 58.5 \\
\hline
Local governor, & 76.3 & Technician & 54.7 \\
\hline
Clergy & 75.9 & Skilled worker & 49.7 \\
\hline
Pharmacist & 74.5 & Small shop owner & 48.4 \\
\hline
School teacher & 71.9 & Salesman & 43.2 \\
\hline
Producer & 71.2 & Driver & 41.0 \\
\hline
Entertainer & 71.1 & Farmer & 40.0 \\
\hline
Journalist & 70.2 & Construction worker & 31.7 \\
\hline
Small-business owner & 70.1 \\
\hline
Variables & Mean (S.D.) & Factor loading & Cronbach’s alpha \\
\hline
Network diversity & 10.05 (5.90) & 0.767 & 0.81 \\
\hline
Upper reachability & 81.85 (6.75) & 0.927 \\
\hline
Range of prestige score & 40.94 (11.81) & 0.780 \\
\hline
Eigenvalue & \multicolumn{3}{|l|}{2.05} \\
\hline
Explained variance (\%) & \multicolumn{3}{|l|}{0.98} \\
\hline
\end{tabular}}
\end{table}
|
PMC3276420_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{GAS Strain} & \textbf{M-Type} & \textbf{Actual Value†} & \textbf{Hydrophobicity Index‡} \\
\hline
MGAS6183 WT & M41 & 92.6 $\pm$ .86 & 100 \\
\hline
MGAS6183 $\Delta$scl1 & M41 & 85.2 $\pm$ 2.2 & **92 \\
\hline
MGAS6183 $\Delta$scl1-C & M41 & 98.0 $\pm$ .31 & 105 \\
\hline
MGAS5005 WT & M1 & 80.3 $\pm$ .89 & 100 \\
\hline
MGAS5005 $\Delta$scl1 & M1 & 63.3 $\pm$ 3.2 & **79 \\
\hline
MGAS6143 WT & M28 & 94.3 $\pm$ .73 & 100 \\
\hline
MGAS6143 $\Delta$scl1 & M28 & 72.6 $\pm$ .62 & **78 \\
\hline
\end{tabular}}
\end{table}
|
PMC3268755_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Group} & \multicolumn{4}{|l|}{\textbf{\% of parasitaemia1 Concentration of IgG (mg/ml)2}} & \multicolumn{4}{|l|}{\textbf{\% of invasion inhibition4 Concentration of IgG (mg/ml)}} \\
\hline
\\
\hline
& \textbf{0.5} & \textbf{0.25} & \textbf{0.125} & \textbf{0.0625} & \textbf{0.5} & \textbf{0.25} & \textbf{0.125} & \textbf{0.0625} \\
\hline
Adjuvant control & 5.66 (60.12)3 & 5.76 (61.25) & 6.13 (60.32) & 5.34 (60.58) & - & - & - \\
\hline
PfAARP immune & 1.73 (60.31) & 2.63 (60.58) & 3 (60.7) & 3.24 (6013) & 69.41 & 54.34 & 51.10 & 39.4 \\
\hline
MSP-142 immune & 2.07 (60.12) & 1.93 (60.12) & 2.86 (60.31) & 3.4 (60.01) & 63.50 & 66.50 & 53.30 & 36.3 \\
\hline
\end{tabular}}
\end{table}
|
PMC2253826_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Number} & \textbf{AIC} & \textbf{BIC} & \textbf{SABIC} & \textbf{Adj. LMR-LRT (p-Value)} & \textbf{Entropy} & \multicolumn{5}{|l|}{\textbf{Class Size}} \\
\hline
\textbf{of Classes} & & & & & & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} \\
\hline
1 & 1960.95 & 1996.25 & 1958.28 & & & 140 \\
\hline
2 & 1356.58 & 1430.12 & 1351.03 & 620.704 (0.00) & 0.98 & 103 & 37 \\
\hline
3 & 1335.11 & 1431.58 & 1311.35 & 61.82 (0.01) & 0.97 & 101 & 21 & 18 \\
\hline
4 & 1319.79 & 1455.72 & 1326.00 & 19.34 (0.09) & 0.97 & 100 & 17 & 12 & 11 \\
\hline
5 & 1315.30 & 1474.15 & 1303.30 & 16.97 (0.17) & 0.89 & 52 & 48 & 17 & 12 & 11 \\
\hline
\end{tabular}}
\end{table}
|
PMC6068939_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|}
\hline
& \textbf{Healthy control serum (n = 20)} & \textbf{PM/DM patient serum (n = 29)} \\
\hline
Number of PM/DM & & 7/22 \\
\hline
Number of males/females & 9/11 & 9/20 \\
\hline
Age (years) & 38.6 $\pm$ 2.1 & 55.3 $\pm$ 2.5 \\
\hline
Duration of the disease (months) & & 21.6 $\pm$ 8.2 \\
\hline
Number of cases of new onset/flare & & 23/6 \\
\hline
Number of antinuclear antibody-positive & & 9 (n = 22) \\
\hline
Number of anti-Jo-1 antibody-positive & & 8 (n = 22) \\
\hline
Serum creatinine kinase (IU/l)a & & 4,063.8 $\pm$ 1,466.9 \\
\hline
Manual muscle testing score & & 39.0 $\pm$ 1.4 (n = 18) \\
\hline
Number of patients with ILD & & 19 \\
\hline
AaDO2 with ILD & & 31.5 $\pm$ 7.9 (n = 19) \\
\hline
\multicolumn{3}{|l|}{Treatment at time of blood sampling} \\
\hline
Untreated & & 19 \\
\hline
Prednisolone alone & & 4 \\
\hline
Prednisolone and cyclosporine & & 5 \\
\hline
Prednisolone and methotrexate & & 1 \\
\hline
\end{tabular}}
\end{table}
|
PMC3446414_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Subject} & \multicolumn{3}{|l|}{\textbf{Hypervariable region}} & \textbf{Haplogroup (mitotool)} \\
\hline
& \textbf{HVI (15991–16390)} & \textbf{HVII (034–369)} & \textbf{HVIII (423– 548)} \\
\hline
\#321 (GJGD-1) & 16129A, 16182C, 16183C, 16189C, 16232A, 16249C, 16304C, 16311C, 16344T & 73G, 152C, 249del, 263G, 315.1C & 514del, 515del & F1b1a \\
\hline
Researcher 1 & 16183C, 16189C, 16220C, 16254G, 16298C, 16362C & 73G, 249del, 263G, 315.1C & & F3b \\
\hline
\end{tabular}}
\end{table}
|
PMC4889107_table_4
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Substance} & \textbf{Sham} & \textbf{Saline} & \textbf{LPS} & \textbf{Kruskal-Wallis H(2, N = 33)} \\
\hline
\multicolumn{5}{|l|}{Alkanes} \\
\hline
Octadecane & 0,17 $\pm$ 0,11 & 0,18 $\pm$ 0,05 & 0,19 $\pm$ 0,11 & NS \\
\hline
Nonadecane & 0,29 $\pm$ 0,14 & 0,35 $\pm$ 0,21 & 0,15 $\pm$ 0,04 & NS \\
\hline
Eicosane & 0,09 $\pm$ 0,04 & 0,09 $\pm$ 0,03 & 0,06 $\pm$ 0,04 & NS \\
\hline
Heneicosane & 1,24 $\pm$ 0,40 & 1,73 $\pm$ 0,65 & 0,84 $\pm$ 0,20 & NS \\
\hline
Docosane & 0,14 $\pm$ 0,02 & 0,16 $\pm$ 0,04 & 0,11 $\pm$ 0,02 & NS \\
\hline
Tricosane & 4,42 $\pm$ 0,73 & 4,70 $\pm$ 0,89 & 3,92 $\pm$ 0,39 & NS \\
\hline
Tetracosane & tr & tr & tr & NS \\
\hline
Pentacosane & 2,88 $\pm$ 0,66 & 2,76 $\pm$ 0,16 & 2,99 $\pm$ 0,17 & NS \\
\hline
Hexacosane & 0,38 $\pm$ 0,13 & 0,38 $\pm$ 0,07 & 0,34 $\pm$ 0,04 & NS \\
\hline
Heptacosane & 10,21 $\pm$ 3,91 & 9,76 $\pm$ 1,76 & 9,88 $\pm$ 1,45 & NS \\
\hline
Octacosane & 0,67 $\pm$ 0,06 & 0,62 $\pm$ 0,04 & 0,59 $\pm$ 0,06 & NS \\
\hline
Nonacosane & 14,15 $\pm$ 0,83 & 12,56 $\pm$ 1,52 & 12,33 $\pm$ 1,12 & NS \\
\hline
Tritriacontane & 0,72 $\pm$ 0,15 & 0,76 $\pm$ 0,06 & 0,77 $\pm$ 0,06 & NS \\
\hline
Hentriacontane & 17,24 $\pm$ 3,59 & 17,49 $\pm$ 1,99 & 18,70 $\pm$ 1,12 & NS \\
\hline
Dotriacontane & 0,23 $\pm$ 0,06 & 0,30 $\pm$ 0,08 & 0,30 $\pm$ 0,07 & p = 0.05 \\
\hline
Tritriacontane & 3,03 $\pm$ 0,93 & 4,60 $\pm$ 1,51 & 4,51 $\pm$ 1,00 & p = 0.024 \\
\hline
\multicolumn{5}{|l|}{Alkenes} \\
\hline
Nonadecene & tr & tr & tr & NS \\
\hline
Tricosene & 0,30 $\pm$ 0,08 & 0,31 $\pm$ 0,06 & 0,29 $\pm$ 0,03 & NS \\
\hline
Pentacosene & 0,37 $\pm$ 0,06 & 0,35 $\pm$ 0,05 & 0,32 $\pm$ 0,03 & p = 0.049 \\
\hline
Heptacosene & 0,39 $\pm$ 0,11 & 0,36 $\pm$ 0,13 & 0,26 $\pm$ 0,04 & p = 0.001 \\
\hline
Nonacosene & 1,17 $\pm$ 0,09 & 0,96 $\pm$ 0,10 & 0,98 $\pm$ 0,08 & p = 0.014 \\
\hline
Hentriacontene Isomere1 & 4,42 $\pm$ 0,47 & 4,23 $\pm$ 0,21 & 4,37 $\pm$ 0,52 & NS \\
\hline
Hentriacontene Isomere 2 & 6,17 $\pm$ 0,52 & 6,06 $\pm$ 0,24 & 6,28 $\pm$ 0,61 & NS \\
\hline
Dotriacontene & 0,89 $\pm$ 0,12 & 0,98 $\pm$ 0,04 & 1,02 $\pm$ 0,08 & p = 0.026 \\
\hline
Tritriacontene & 16,77 $\pm$ 3,02 & 19,24 $\pm$ 0,49 & 20,30 $\pm$ 1,71 & p = 0.01 \\
\hline
\multicolumn{5}{|l|}{Alkynes} \\
\hline
Pentacosyne & tr & tr & tr & NS \\
\hline
Tritriacontyne & 2,08 $\pm$ 0,46 & 2,43 $\pm$ 0,83 & 2,44 $\pm$ 0,31 & NS \\
\hline
\multicolumn{5}{|l|}{Methylalkanes} \\
\hline
11,13,15-Methylpentacosane & 0,30 $\pm$ 0,07 & 0,29 $\pm$ 0,07 & 0,38 $\pm$ 0,04 & NS \\
\hline
11,13-Methylheptacosane & 2,39 $\pm$ 0,31 & 2,60 $\pm$ 0,58 & 2,50 $\pm$ 0,21 & NS \\
\hline
11,13,15-Methylnonacosane & 2,15 $\pm$ 0,19 & 2,34 $\pm$ 0,56 & 2,27 $\pm$ 0,24 & NS \\
\hline
11,13,15-Methylhentriacontane & 1,31 $\pm$ 0,12 & 1,43 $\pm$ 0,35 & 1,42 $\pm$ 0,15 & NS \\
\hline
11,13,15,17-Methyltritriacontane & 0,56 $\pm$ 0,07 & 0,68 $\pm$ 0,17 & 0,69 $\pm$ 0,08 & NS \\
\hline
\end{tabular}}
\end{table}
|
PMC2596086_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
& \multicolumn{6}{|l|}{\textbf{18–24 Years}} & \multicolumn{6}{|l|}{\textbf{25–30 Years}} & \multicolumn{6}{|l|}{\textbf{18–30 Years}} \\
\hline
& \multicolumn{2}{|l|}{\textbf{Total Fiber (g)}} & \multicolumn{2}{|l|}{\textbf{Insoluble Fiber (g)}} & \multicolumn{2}{|l|}{\textbf{Soluble Fiber (g)}} & \multicolumn{2}{|l|}{\textbf{Total Fiber (g)}} & \multicolumn{2}{|l|}{\textbf{Insoluble Fiber (g)}} & \multicolumn{2}{|l|}{\textbf{Soluble Fiber (g)}} & \multicolumn{2}{|l|}{\textbf{Total Fiber (g)}} & \multicolumn{2}{|l|}{\textbf{Insoluble Fiber (g)}} & \multicolumn{2}{|l|}{\textbf{Soluble Fiber (g)}} \\
\hline
& \textbf{Males} & \textbf{Females} & \textbf{Males} & \textbf{Females} & \textbf{Males} & \textbf{Females} & \textbf{Males} & \textbf{Females} & \textbf{Males} & \textbf{Females} & \textbf{Males} & \textbf{Females} & \textbf{Males} & \textbf{Females} & \textbf{Males} & \textbf{Females} & \textbf{Males} & \textbf{Females} \\
\hline
Median [IQR] & 5.3 [0.0–32.1] & 6.0 [0.0–32.7] & 0.0 [0.0–6.7] & 0.0 [0.0–10.9] & 0.0 [0.0–7.3] & 0.0 [0.0–32.7] & 3.6 [0.0–43.9] & 4.5 [0.0–48.9] & 0.0 [0.0–12.0] & 0.0 [0.0–18.0] & 0.0 [0.0–4.8] & 0.0 [0.0–14.9] & 4.3 [0.0–43.9] & 5.1 [0.0–48.9] & 0.0 [0.0–12.0] & 0.0 [0.0–18.0] & 0.0 [0.0–7.3] & 0.0 [0.0–14.9] \\
\hline
Total & \multicolumn{2}{|l|}{5.3 [0.0–32.7]} & \multicolumn{2}{|l|}{0.0 [0.0–10.9]} & \multicolumn{2}{|l|}{0.0 [0.0–12.9]} & \multicolumn{2}{|l|}{4.0 [0.0–48.9]} & \multicolumn{2}{|l|}{0.0 [0.0–18.0]} & \multicolumn{2}{|l|}{0.0 [0.0–14.9]} & \multicolumn{2}{|l|}{4.6 [0.0–48.9]} & \multicolumn{2}{|l|}{0.0 [0.0–18. 0]} & \multicolumn{2}{|l|}{0.0 [0.0–15.0]} \\
\hline
SD Total & \multicolumn{2}{|l|}{7.1 6.0 6.7} & \multicolumn{2}{|l|}{1.3 1.8 1.6} & \multicolumn{2}{|l|}{1.0 1.6 1.4} & \multicolumn{2}{|l|}{6.9 8.0 7.5} & \multicolumn{2}{|l|}{1.5 2.1 0.8} & \multicolumn{2}{|l|}{0.9 1.6 1.3} & \multicolumn{2}{|l|}{7.1 7.4 7.2} & \multicolumn{2}{|l|}{1.4 2.0 1.7} & \multicolumn{2}{|l|}{1.0 1.6 1.3} \\
\hline
\end{tabular}}
\end{table}
|
PMC5946289_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
\textbf{Peak No.} & \textbf{RT} & \textbf{Suggested formula} & \textbf{Mass} & \textbf{m/z} & \textbf{Identified component} \\
\hline
5 & 31.14 & C30 H48 O3 & 456.36 & 455.35 & Urosolic acid \\
\hline
8 & 16.35 & C11 H16 O3 & 196.11 & 197.12 & Ferulic acid \\
\hline
9 & 17.46 & C22H18O11 & 452.34 & 453.34 & Epigallocatechin gallate \\
\hline
11 & 19.49 & C13 H20 O2 & 678.50 & 340.26 & Icariin \\
\hline
13 & 21.27 & C11 H16 O2 & 181.13 & 181.12 & Caffeic acid \\
\hline
\end{tabular}}
\end{table}
|
PMC4658747_table_3
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& \textbf{BMP} & \textbf{BOP} & \textbf{BEP} & \textbf{Average} & \textbf{Percent} \\
\hline
Total cost savings per trip & 6.72 & 0.69 & 1.92 & 1.86 & 100 \\
\hline
Travel time cost savings per trip & 3.79 & 0.36 & 1.26 & 1.06 & 56.72 \\
\hline
Travel time variability cost saving per trip & 2.93 & 0.33 & 0.67 & 0.81 & 43.28 \\
\hline
\end{tabular}}
\end{table}
|
PMC6191166_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|}
\hline
\textbf{First author} & \textbf{Year} & \textbf{Cancer} & \textbf{Country} & \textbf{Ethnicity} & \textbf{SNPs} & \textbf{No.} & \textbf{Risk allele} \\
\hline
Guan (Current) & 2010 & LA-NSCLC & USA & Caucasian & -460T $>$ C, -634G $>$ C, and 936C $>$ T & 124 & T for -460T $>$ C \\
\hline
Formento [23] & 2009 & Head\&neck & France & Caucasian & -460T $>$ C, -634G $>$ C, and 936C $>$ T & 49 & None \\
\hline
Masago [20] & 2009 & Advanced NSCLC & Japan & Asian & -460T $>$ C, -1154G $>$ A, -2578C $>$ A, 405G $>$ C, and 936C $>$ T & 126 & C for -460T $>$ C, A for -1154G $>$ A, and A for -2578C $>$ A \\
\hline
Dassoulas [24] & 2009 & Colorectum & Greece & Caucasian & -460T $>$ C, -634G $>$ C, -1154G $>$ A, -2578C $>$ A, and 936C $>$ T & 312 & T for -460T $>$ C, G for -634G $>$ C, C for -2578C $>$ A, and C for 936C $>$ T \\
\hline
Bradbury [25] & 2009 & Esophagus & Canada & Caucasian & -460T $>$ C, 405G $>$ C, and 936C $>$ T & 361 & C for 936C $>$ T \\
\hline
Heist [9] & 2008 & Early NSCLC & USA & Caucasian & -460T $>$ C, 405G $>$ C, and 936C $>$ T & 462 & G for 405G $>$ C and C for 936C $>$ T \\
\hline
Kim [16] & 2008 & Colorectum & Korea & Asian & -634G $>$ C, -2578C $>$ A, and 936C $>$ T & 445 & G for -634G $>$ C and T for 936C $>$ T \\
\hline
Kim [26] & 2007 & Stomach & Korea & Asian & -116G $>$ A, -460T $>$ C, 405G $>$ C, and 936C $>$ T & 503 & C for -460T $>$ C and T for 936C $>$ T \\
\hline
Kawai [27] & 2007 & Renal cell & Japan & Asian & -634G $>$ C, -2578C $>$ A, and -1154G $>$ A & 213 & C for -2578C $>$ A \\
\hline
Hefler [17] & 2007 & Ovarian & Austria & Caucasian & -634G $>$ C, -1154G $>$ A, and -2578C $>$ A & 563 & None \\
\hline
Tzanakis [28] & 2006 & Stomach & Greece & Caucasian & -634G $>$ C, -2578C $>$ A, -1154G $>$ A, and 936C $>$ T & 100 & C for -634G $>$ C \\
\hline
Lu [19] & 2005 & Breast & China & Asian & -460T $>$ C, 405G $>$ C, and 936C $>$ T & 1119 & C for -460T $>$ C, and G for 405G $>$ C \\
\hline
\end{tabular}}
\end{table}
|
PMC2939547_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{|l|}{\textbf{m/z}} & \multicolumn{2}{|l|}{\textbf{Normalised relative intensity}} \\
\hline
\textbf{LTP fragments} & \textbf{Observed} & \textbf{Calculated} & \textbf{Wheat LTP alone} & \textbf{Wheat LTP + linoleic acid} \\
\hline
Intact protein (residues 1–90) & 10063.22 & 10063.18 & 518 & 705 \\
\hline
1–34 & 3474.74 & 3474.93 & 160 & 292 \\
\hline
1–39 & 4310.6 & 4309.77 & 2546 & 3290 \\
\hline
1–56 & 6243.58 & 6242.91 & 537 & 1047 \\
\hline
1–67 & 7477.3 & 7477.18 & 214 & 290 \\
\hline
1–79 & 8803.44 & 8803.75 & 270 & 2300 \\
\hline
17–39* & 2436.75 & 2436.65 & 805 & 1290 \\
\hline
17–56 & 4370.01 & 4369.78 & 533 & ND \\
\hline
17–61 & 4904.39 & 4904.39 & 90 & 90 \\
\hline
40–56 & 1951.23 & 1951.15 & 292 & ND \\
\hline
40–67 & 3185.43 & 3185.43 & 248 & 340 \\
\hline
40–79 & 4512.11 & 4512.0 & 128 & 656 \\
\hline
57–67* & 1252.34 & 1252.29 & 450 & ND \\
\hline
57–89 & 3739.16 & 3739.16 & 110 & 130 \\
\hline
68–79* & 1344.71 & 1344.58 & 334 & ND \\
\hline
80–90* & 1277.74 & 1277.45 & 1550 & 1200 \\
\hline
Unassigned & 3514.0 & — & 2833 & 1668 \\
\hline
Unassigned & 1098.54 & — & 1320 & ND \\
\hline
Unassigned & 2679.24 & — & 1373 & 1927 \\
\hline
Unassigned & 4334.4 & — & 1027 & 1070 \\
\hline
Unassigned & 5032.13 & — & 435 & ND \\
\hline
Unassigned & 5379.31 & — & 479 & ND \\
\hline
Unassigned & 5794.72 & — & 1004 & ND \\
\hline
Unassigned & 8673.0 & — & 312 & 400 \\
\hline
\end{tabular}}
\end{table}
|
PMC4960534_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Disease Phenotype Networks} & \textbf{Best C valuea} & \textbf{MRR, \%} & \textbf{Top-ranking genesb} & \textbf{TPR in the top 5, \%} & \textbf{TPR in the top 10, \%} & \textbf{TPR in the top 30, \%} \\
\hline
Lin & -12 & 7.89 & 80 & 39.34 & 47.78 & 62.06 \\
\hline
Sqrt & -12 & 7.90 & 81 & 39.11 & 48.01 & 61.83 \\
\hline
Maxmin & -18 & 7.96 & 81 & 36.77 & 46.37 & 61.12 \\
\hline
Tanimoto & -18 & 7.91 & 83 & 38.88 & 48.48 & 61.59 \\
\hline
mimMiner & -14 & 7.96 & 82 & 42.39 & 50.59 & 64.17 \\
\hline
\end{tabular}}
\end{table}
|
PMC4944959_table_3
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{3D MEDIC Patients} & \textbf{Mid-sag slices Mean DSC} & \textbf{std dev} & \textbf{n} & \textbf{Lateral slices Mean DSC} & \textbf{std dev} & \textbf{n} \\
\hline
p1 & 0.70 & 0.29 & 28 & 0.52 & 0.48 & 8 \\
\hline
p2 & 0.79 & 0.14 & 30 & 0.06 & 0.12 & 8 \\
\hline
p3 & 0.86 & 0.06 & 32 & 0.36 & 0.31 & 8 \\
\hline
p4 & 0.78 & 0.17 & 40 & 0.05 & 0.16 & 10 \\
\hline
p5 & 0.83 & 0.06 & 26 & 0.43 & 0.46 & 8 \\
\hline
p6 & 0.83 & 0.11 & 33 & 0.40 & 0.38 & 10 \\
\hline
p7 & 0.81 & 0.09 & 22 & 0.65 & 0.31 & 6 \\
\hline
p8 & 0.73 & 0.09 & 23 & 0.13 & 0.24 & 6 \\
\hline
p9 & 0.66 & 0.30 & 25 & 0.31 & 0.43 & 8 \\
\hline
\end{tabular}}
\end{table}
|
PMC3443448_table_2
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{SNP} & \textbf{Chr} & \textbf{Hg18 Position} & \textbf{A1} & \textbf{A2} & \textbf{MAF Controls} & \textbf{MAF Cases} & \textbf{MAF Pooled Controls} & \textbf{MAF Pooled Cases} & \textbf{GMAF} & \textbf{P- value} & \textbf{OR [95\% CI]} \\
\hline
rs1877670 & 8 & 22,546,561 & C & T & 22.3\% & 20.5\% & 29.0\% & 19.0\% & 44.3\% & 0.6716 & 0.900 [0.520– 1.550] \\
\hline
rs1996147 & 8 & 22,544,158 & G & A & 29.3\% & 25.1\% & 22.6\% & 15.3\% & 41.2\% & 0.4251 & 0.810 [0.490– 1.340] \\
\hline
rs35900184 & 8 & 143,693,411 & T & C & 31.9\% & 43.7\% & 25.1\% & 34.0\% & 26.5\% & 0.0448 & 1.650 [1.020– 2.680] \\
\hline
\end{tabular}}
\end{table}
|
PMC4608790_table_4
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \textbf{Underway} & \textbf{Humans} & \textbf{Policy} & \textbf{Pr (Chg $>$ 2.5)} & \textbf{Pr (Chg $>$ 5)} & \textbf{Don. Am't} \\
\hline
H.I.: low know & 6.04* & 5.69** & -0.87 & 8.11*** & 5.75** & 0.32 \\
\hline
& (3.10) & (2.62) & (3.46) & (2.82) & (2.79) & (1.30) \\
\hline
H.I.: high know & 5.45** & 4.33 & -0.58 & 3.52 & 5.85** & 1.15 \\
\hline
& (2.28) & (2.60) & (2.36) & (3.90) & (2.85) & (1.74) \\
\hline
S.I.: low know & -0.83 & -3.25 & -1.50 & 0.98 & 0.33 & -1.11 \\
\hline
& (1.87) & (2.18) & (3.30) & (2.55) & (2.71) & (0.98) \\
\hline
S.I.: high know & 1.80 & 5.31* & 0.03 & 3.69 & 5.67 & -0.98 \\
\hline
& (2.31) & (2.65) & (2.77) & (2.74) & (3.51) & (1.10) \\
\hline
Dep. var. mean & 74.29 & 68.04 & 33.58 & 56.43 & 41.33 & 8.72 \\
\hline
Observations & 1,259 & 1,259 & 1,259 & 1,259 & 1,259 & 1,259 \\
\hline
R-squared & 0.16 & 0.19 & 0.09 & 0.13 & 0.13 & 0.05 \\
\hline
\end{tabular}}
\end{table}
|
PMC4827814_table_4
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
\textbf{Parameter} & \textbf{Total (n = 348) (\%)} & \textbf{Luminal A (n = 162) (\%)} & \textbf{Luminal B (n = 84) (\%)} & \textbf{HER-2 (n = 27) (\%)} & \textbf{TNBC (n = 75) (\%)} & \textbf{p value} \\
\hline
G6PDH & & & & & & $<$0.001 \\
\hline
Negative & 297 (85.3) & 149 (92.0) & 70 (83.3) & 14 (51.9) & 64 (85.3) \\
\hline
Positive & 51 (14.7) & 13 (8.0) & 14 (16.7) & 13 (48.1) & 11 (14.7) \\
\hline
6PGL & & & & & & 0.009 \\
\hline
Negative & 261 (75.0) & 133 (82.1) & 58 (69.0) & 15 (55.6) & 55 (73.3) \\
\hline
Positive & 87 (25.0) & 29 (17.9) & 26 (31.0) & 12 (44.4) & 20 (26.7) \\
\hline
6PGDH & & & & & & $<$0.001 \\
\hline
Negative & 343 (98.6) & 162 (100.0) & 84 (100.0) & 27 (100.0) & 70 (93.3) \\
\hline
Positive & 5 (1.4) & 0 (0.0) & 0 (0.0) & 0 (0.0) & 5 (6.7) \\
\hline
NRF2 & & & & & & 0.894 \\
\hline
Negative & 311 (89.4) & 145 (89.5) & 76 (90.5) & 23 (85.2) & 67 (89.3) \\
\hline
Positive & 37 (10.6) & 17 (10.5) & 8 (9.5) & 4 (14.8) & 8 (10.7) \\
\hline
\end{tabular}}
\end{table}
|
PMC5845514_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \multicolumn{2}{|l|}{\textbf{ESS}} & \multicolumn{2}{|l|}{\textbf{EU-SILC}} \\
\hline
& \textbf{Model 1} & \textbf{Model 2} & \textbf{Model 3} & \textbf{Model 4} \\
\hline
No disability & 0.280*** & 0.210*** & 0.263*** & 0.183*** \\
\hline
\multicolumn{5}{|l|}{Trends among disabled peoplea} \\
\hline
Pre-2006 & (Baseline) & (Baseline) & (Baseline) & (Baseline) \\
\hline
2006–2011 & 0.051*** & 0.040** & −0.008 & −0.013 \\
\hline
Post-2011 & 0.089*** & 0.076*** & 0.027 & 0.026 \\
\hline
\multicolumn{5}{|l|}{Trends in disability employment gapa} \\
\hline
No disability * 2006–2011 & −0.013 & −0.008 & 0.030* & 0.030* \\
\hline
No disability * Post-2011 & −0.057*** & −0.049*** & 0.011 & 0.004 \\
\hline
Adjustment for compositional factorsb & No & Yes & No & Yes \\
\hline
Observations & 182,195 & 182,195 & 2,412,791 & 2,412,791 \\
\hline
\end{tabular}}
\end{table}
|
PMC5712075_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|l|}
\hline
\textbf{Comparison} & \textbf{Population} & \textbf{No. of studies} & \multicolumn{3}{|l|}{\textbf{Test of association (A vs G)}} & \textbf{Model} & \multicolumn{2}{|l|}{\textbf{Test of heterogeneity}} & \multicolumn{2}{|l|}{\textbf{Publication bias}} \\
\hline
& & & \textbf{OR (95\% CI)} & \textbf{Z} & \textbf{P Value} & & \textbf{P Value} & \textbf{I2 (\%)} & \textbf{Begg} & \textbf{Egger} \\
\hline
A vs G & Overall & 30 & 1.119(0.984-1.272) & 1.71 & 0.086 & R & 0 & 94.2 & 0.363 & 0.148 \\
\hline
& Caucasian & 10 & 0.843(0.653-1.088) & 1.31 & 0.189 & R & 0 & 96.9 & 0.592 & 0.542 \\
\hline
& Asian & 16 & 1.378(1.287-1.475) & 9.23 & 0 & R & 0.034 & 43.3 & 0.471 & 0.132 \\
\hline
& Non- Caucasian Europe & 3 & 0.949(0.843-1.070) & 0.85 & 0.395 & F & 0.916 & 0 & 1 & 0.581 \\
\hline
& African- American & 1 & 0.882(0.800-0.972) & 2.53 & 0.011 & NA & NA & NA & NA & NA \\
\hline
AA vs GG & Overall & 30 & 1.237(0.968-1.581) & 1.70 & 0.090 & R & 0 & 92.0 & 0.232 & 0.068 \\
\hline
& Caucasian & 10 & 0.745(0.466-1.192) & 1.23 & 0.220 & R & 0 & 96.2 & 0.592 & 0.579 \\
\hline
& Asian & 16 & 1.866(1.631-2.135) & 9.08 & 0 & F & 0.751 & 0 & 0.322 & 0.071 \\
\hline
& Non- Caucasian Europe & 3 & 0.901(0.71-1.145) & 0.85 & 0.396 & F & 0.917 & 0 & 1 & 0.585 \\
\hline
& African- American & 1 & 0.777(0.638-0.947) & 2.50 & 0.013 & NA & NA & NA & NA & NA \\
\hline
AA + AG vs GG & Overall & 30 & 1.186(0.998-1.409) & 1.94 & 0.052 & R & 0 & 87.1 & 0.148 & 0.036 \\
\hline
& Caucasian & 10 & 0.839(0.613-1.148) & 1.10 & 0.272 & R & 0 & 93.8 & 0.858 & 0.640 \\
\hline
& Asian & 16 & 1.667(1.462-1.901) & 7.64 & 0.000 & F & 0.97 & 0 & 0.126 & 0.118 \\
\hline
& Non- Caucasian Europe & 3 & 0.933(0.764-1.139) & 0.68 & 0.497 & F & 0.946 & 0 & 1 & 0.602 \\
\hline
& African- American & 1 & 0.850(0.733-0.986) & 2.15 & 0.032 & NA & NA & NA & NA & NA \\
\hline
AG + GG vs AA & Overall & 30 & 1.115(0.949-1.311) & 1.32 & 0.186 & R & 0.000 & 92.6 & 0.532 & 0.649 \\
\hline
& Caucasian & 10 & 0.780(0.552-1.102) & 1.41 & 0.159 & R & 0.000 & 95.9 & 0.858 & 0.535 \\
\hline
& Asian & 16 & 1.434(1.319-1.559) & 8.45 & 0.000 & R & 0.032 & 43.7 & 0.589 & 0.257 \\
\hline
& Non- Caucasian Europe & 3 & 0.933(0.7721.129) & 0.71 & 0.478 & F & 0.941 & 0 & 1 & 0.563 \\
\hline
& African- American & 1 & 0.840(0.707-0.999) & 1.97 & 0.048 & NA & NA & NA & NA & NA \\
\hline
\end{tabular}}
\end{table}
|
PMC5129943_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|l|l|l|}
\hline
\multicolumn{2}{|l|}{\textbf{Patient reason for consulting}} & \multicolumn{8}{|l|}{\textbf{GP practice staff response to e-consultation}} \\
\hline
& \textbf{Total number (\%)} & \textbf{Face to face \%} & \textbf{Phone consult \%} & \textbf{Prescription \%} & \textbf{Fit note \%} & \textbf{Test request \%} & \textbf{Refer routine \%} & \textbf{Advice \%} & \textbf{Other/ unknown \%} \\
\hline
Musculoskeletal/limb pain & 60 (12.4) & 48.3 & 38.3 & 1.7 & 0 & 1.7 & 3.3 & 1.7 & 0 \\
\hline
Infection/immunological & 70 (14.4) & 40.0 & 41.4 & 8.6 & 0 & 0 & 0 & 0 & 0 \\
\hline
Neurological & 26 (5.4) & 53.9 & 26.9 & 0 & 0 & 3.9 & 0 & 0 & 3.9 \\
\hline
Sexual/reproductive health & 41 (8.5) & 39.0 & 41.5 & 7.3 & 0 & 4.9 & 0 & 0 & 2.4 \\
\hline
Dermatological & 33 (6.8) & 48.5 & 21.2 & 18.2 & 0 & 0 & 0 & 3.0 & 0 \\
\hline
Respiratory & 25 (5.1) & 52.0 & 24.0 & 4.0 & 0 & 0 & 0 & 0 & 8.0 \\
\hline
Mental health & 29 (5.9) & 44.8 & 34.5 & 10.3 & 0 & 0 & 0 & 0 & 0 \\
\hline
Digestive & 19 (3.9) & 52.6 & 26.3 & 5.3 & 0 & 0 & 0 & 0 & 5.3 \\
\hline
Medication query/advice & 19 (3.9) & 0 & 73.7 & 10.5 & 0 & 0 & 0 & 0 & 5.3 \\
\hline
Administrative* & 109 (22.5) & 12.2 & 27.1 & 11.2 & 14.0 & 1.9 & 5.6 & 10.3 & 7.5 \\
\hline
Other/unclear & 54 (11.1) & 38.4 & 17.0 & 0 & 0 & 3.8 & 0 & 5.7 & 1.9 \\
\hline
Total & 485 (100) & 38.1 & 32.1 & 7.2 & 3.1 & 1.6 & 1.6 & 9.1 & 6.4 \\
\hline
\end{tabular}}
\end{table}
|
PMC5875620_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Research integrity topic} & \textbf{No. organizations with a code (\% all organizations)} & \textbf{No. of statements} & \textbf{Statements with prescriptive language (row \%)*} \\
\hline
Inaccuracy & 79 (10) & 112 & 74 (70) \\
\hline
Contributor/Contribution & 65 (8) & 99 & 63 (64) \\
\hline
Ethics & 63 (8) & 113 & 68 (60) \\
\hline
Plagiarism & 59 (7) & 74 & 53 (72) \\
\hline
Credit & 56 (7) & 81 & 62 (77) \\
\hline
Author/Authorship & 55 (7) & 78 & 49 (63) \\
\hline
Conflict of interest & 53 (7) & 72 & 44 (61) \\
\hline
Integrity & 48 (6) & 82 & 34 (42) \\
\hline
Bias† & 35 (4) & 56 & 25 (45) \\
\hline
Honesty & 33 (4) & 48 & 31 (65) \\
\hline
Falsification & 32 (4) & 34 & 24 (71) \\
\hline
Fabrication & 29 (3) & 30 & 24 (77) \\
\hline
Fraud/Fraudulent & 26 (3) & 37 & 19 (51) \\
\hline
Misrepresentation & 26 (3) & 41 & 28 (68) \\
\hline
Misconduct & 24 (3) & 55 & 29 (53) \\
\hline
Manipulation & 11 (1) & 16 & 7 \\
\hline
Questionable publication practices (QPP)– duplicate publication & 10 (1) & 11 & 8 \\
\hline
Dishonesty & 6 (1) & 7 & 3 \\
\hline
Dual interest/relationship & 6 (0.8) & 6 & 5 \\
\hline
Competing interest & 4 (0.5) & 4 & 1 \\
\hline
QPP–redundant publication & 4 (0.5) & 5 & 2 \\
\hline
Responsible conduct of research & 3 (0.4) & 3 & 2 \\
\hline
QPP–repetitive publication & 2 (0.3) & 2 & 2 \\
\hline
QPP–secondary publication & 2 (0.3) & 3 & 1 \\
\hline
Questionable research practices & 1 (0.1) & 1 & 0 \\
\hline
Malpractice & 0 & 0 & 0 \\
\hline
QPP–salami publication & 0 & 0 & 0 \\
\hline
\end{tabular}}
\end{table}
|
PMC4507982_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
& & \multicolumn{2}{|l|}{\textbf{TeleAtlas}} & \multicolumn{2}{|l|}{\textbf{ArcView/NAVTEQ}} \\
\hline
\textbf{Address status} & \textbf{N} & \textbf{Error1} & \textbf{N (\%)2} & \textbf{Error1} & \textbf{N (\%)2} \\
\hline
Self-reported Post-E911 Street & 71 & 132 (75, 309) & 52 (73\%) & 40 (17, 70) & 70 (99\%) \\
\hline
Self-reported Pre-E911 Street & 37 & 243 (117, 418) & 34 (92\%) & 236 (153, 413) & 29 (78\%) \\
\hline
Total Addresses3 & 135 & 174 (81, 357) & 86 (64\%) & 62 (25, 151) & 99 (73\%) \\
\hline
\end{tabular}}
\end{table}
|
PMC2867955_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
& \textbf{Home therapy pdC1-INH (n = 25)} & \textbf{Home therapy icatibant (n = 12)} & \textbf{Hospital therapy pdC1-INH (n = 19)} & \textbf{Overall (n = 56)} \\
\hline
\multicolumn{5}{|l|}{Sex, n (\%)} \\
\hline
Female & 14 (56.0) & 8 (66.7) & 12 (63.2) & 34 (60.7) \\
\hline
Male & 11 (44.0) & 4 (33.3) & 7 (36.8) & 22 (39.3) \\
\hline
Age, yrs, mean, ($\pm$SD) & 33.0 (19.0) & 36.0 (11.5) & 39.5 (24.2) & 36 (19.6) \\
\hline
\multicolumn{5}{|l|}{Age} \\
\hline
$\geq$ 15 years, n (\%) & 18 (72.0) & 12 (100.0) & 14 (73.7) & 44 (78.6) \\
\hline
$<$ 15 years, n (\%) & 7 (28.0) & 0 & 5 (26.3) & 12 (21.4) \\
\hline
Age at diagnosis, yrs, mean, ($\pm$SD) & 20 (16.0) & 30 (12.0) & 26 (20.0) & 25 (17.0) \\
\hline
Time since diagnosis, yrs, mean, ($\pm$SD) & 13.0 (8.0) & 6.0 (6.0) & 13.0 (12.0) & 11 (9.0) \\
\hline
Disease severity score, mean, (range) & 7.3 (3–10) & 6.7 (4–9) & 6.6 (3–10) & 6.9 (3–10) \\
\hline
Duration of home therapy, months, mean, (range) & 25.1 (6–60) & 32.7 (12–60) & - & - \\
\hline
Receiving long-term prophylaxis, n (\%) & 6 (24.0) & 2 (16.7) & 5 (26.3) & 13 (23.2) \\
\hline
\end{tabular}}
\end{table}
|
PMC5043538_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Donor} & \textbf{Age} & \textbf{Gender} & \textbf{Time to Harvesting} \\
\hline
H1 & 60 & F & 7 hrs \\
\hline
H2 & 52 & F & 6 hrs \\
\hline
H3 & 57 & M & 4 hrs \\
\hline
H4 & 53 & F & 3.5 hrs \\
\hline
H5 & 21 & M & 7 hrs \\
\hline
H6 & 50 & F & 6 hrs \\
\hline
H7 & 51 & F & 4 hrs \\
\hline
H8 & 2 & M & 3 hrs \\
\hline
H9 & 16 & F & 4 hrs \\
\hline
H10 & 43 & M & 3.75 hrs \\
\hline
H11 & 16 & M & 3 hrs \\
\hline
\end{tabular}}
\end{table}
|
PMC3206885_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|}
\hline
Bull & PCD (\%) & Oocyte (n) & Cleavage (\%) & Blastocyst (\%) & Hatch BL (HBL/ CV-\%) \\
\hline
C1 & 0.0 & 201 & 71.5 $\pm$ 13.8 ª & 37.4 $\pm$ 15.2 ª & 18.0 $\pm$ 9.7 a \\
\hline
C2 & 0.0 & 138 & 57.0 $\pm$ 18.2 ab & 19.8 $\pm$ 8.2 b & 2.5 $\pm$ 3.6 b \\
\hline
C3 & 0.0 & 219 & 59.4 $\pm$ 13.5 ab & 39.5 $\pm$ 16.1 ª & 16.5 $\pm$ 7.9 a \\
\hline
P1 & 28.5 & 210 & 72.0 $\pm$ 17.3 ª & 39.6 $\pm$ 11.3 ª & 16.1 $\pm$ 11.1 a \\
\hline
P2 & 40.5 & 295 & 50.2 $\pm$ 21.8 b & 21.3 $\pm$ 10.8 b & 2.7 $\pm$ 3.5 b \\
\hline
\end{tabular}}
\end{table}
|
PMC3292455_table_5
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Gene} & \textbf{Function} & \textbf{Mouse embryonic stem cells} & \textbf{Human embryonic stem cells} & \textbf{References} \\
\hline
p16 & Inhibitor of Cyclin/Cdk activity & No expression & No expression & Faast et al., 2004; Zhang et al., 2009 \\
\hline
p19 & Inhibitor of Cyclin/Cdk activity & No expression & Low expression & Li et al., 2009; Zhang et al., 2009 \\
\hline
p21 & Inhibitor of Cyclin/Cdk activity & No expression & No/very low expression & Stead et al., 2002; Neganova et al., 2009 \\
\hline
p27 & Inhibitor of Cyclin/Cdk activity & No expression & No/very low expression & Stead et al., 2002; Egozi et al., 2007; Neganova et al., 2009 \\
\hline
p57 & Inhibitor of Cyclin/Cdk activity & No expression & No expression & Becker et al., 2006; Sorrentino et al., 2007 \\
\hline
Rb & Maintains the Restriction point in G1 & Inactive & Active during G1 & Savatier et al., 1994; Conklin and Sage, 2009 \\
\hline
\end{tabular}}
\end{table}
|
PMC6020794_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{Location of the SNP(nucleotide position, region)*} & \multicolumn{3}{|l|}{\textbf{Mouse strains}} & \textbf{Functional implication (alteration of transcription factor binding affinity\#/ amino acid residue)} \\
\hline
& \textbf{BPN} & \textbf{BPH} & \textbf{BPL} \\
\hline
2874 bp, promoter & T & C & T & Binding affinity of c-Fos is more for ‘‘T’’ as compared to ‘‘C’’ \\
\hline
2740 bp, promoter & C & C & T & Binding affinity of n-Myc and Max is more for ‘‘T’’ than ‘‘C’’ \\
\hline
2486 bp, promoter & T & DT & T & Deletion of one T from a 13 nucleotide polyT region \\
\hline
+4643 bp, exon 3 & T & A & A & Alteration of the amino acid Phenyl alanine (BPN) to Isoleucine (BPH and BPL) in the trans-membrane region of the protein (at 62 residue position) \\
\hline
+4676 bp, exon 3 & T & A & A & Alteration of the amino acid Phenyl alanine (BPN) to Isoleucine (BPH and BPL), at the 73 residue position, in the trans-membrane region of the protein \\
\hline
+11531 bp, exon 9 & A & G & G & No change in the amino acid residue \\
\hline
+11577 bp, exon 9 & A & A & G & Alteration of the amino acid Asparagine (BPN and BPH) to Aspartate (BPL) at the 296 residue position, in the trans- membrane region of the protein \\
\hline
+12264 bp, exon 11 & G & A & G & Alteration of the amino acid Glutamic acid (BPN and BPL) to Lysine (BPH) at the 455 residue position, in the catalytic region of the protein \\
\hline
+15984 bp, exon 15 & T & G & G & Alteration of the amino acid Leucine (BPN) to Arginine (BPH and BPL) at the 645 residue position, in the catalytic region of the protein \\
\hline
+18745 bp, exon 17 & G & T & T & Alteration of the amino acid Glycine (BPN) to Cysteine (BPH and BPL) at the 763 residue position, in the catalytic region of the protein \\
\hline
+18849 bp, exon 18 & G & T & T & Alteration of the amino acid Lysine (BPN) to Asparagine (BPH and BPL) at the 770 residue position, in the catalytic region of the protein \\
\hline
+21205 bp, exon 20 (39-UTR) & T & C & C & - \\
\hline
+21410 bp, exon 20 (39-UTR) & T & C & C & - \\
\hline
+21446 bp, exon 20 (39-UTR) & T & C & C & - \\
\hline
\end{tabular}}
\end{table}
|
PMC3031630_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|}
\hline
\textbf{Objective} & \textbf{Indicator} \\
\hline
1. Optimize balance of quality vs. length of life given patient preferences & 1. Score on patient preferences/satisfaction survey \\
\hline
& 2. Length of life compared to algorithm based on stages of disease \\
\hline
2. Ensure timely screening, delivery, and follow-up of care & 3. Mean number of days between date provider orders test and date clerk schedules appointment with the patient \\
\hline
& 4. Percent of patients eligible for screening tests who receive them in the specified period. \\
\hline
& 5. Percent of patients eligible for diagnostic tests who receive them in the specified period. \\
\hline
3. Ensure care is evidence-based and comprehensive by providing the right expertise mix to care for patient & 6. Percent of provider type match per patient problem, i.e., the correct type of provider should be working on a patient for every problem on the patient problem list \\
\hline
\end{tabular}}
\end{table}
|
PMC4613788_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|}
\hline
\textbf{a) All anxieties (C)} & \textbf{Num df} & \textbf{Den df} & \textbf{F Value} & \textbf{P value1} \\
\hline
Maternal care & 1 & 431 & 16.69 & $<$0.0001 \\
\hline
Time spent alone/day & 1 & 431 & 3.93 & 0.0480 \\
\hline
Activities & 1 & 431 & 4.13 & 0.0427 \\
\hline
Age of separation from the mother & 1 & 431 & 5.83 & 0.0162 \\
\hline
\end{tabular}}
\end{table}
|
PMC4631323_table_3
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|l|l|l|}
\hline
& \multicolumn{3}{|l|}{\textbf{Low A}} & \multicolumn{3}{|l|}{\textbf{Low B}} \\
\hline
& \textbf{Observed} & \textbf{RR} & \textbf{p-value} & \textbf{Observed} & \textbf{RR} & \textbf{p-value} \\
\hline
Not Adjusted & 440 & 0.81 & 0.004 & * & * & * \\
\hline
Adjusted for Urban/Rural Status & 440 & 0.81 & 0.002 & * & * & * \\
\hline
Adjusted for SES & * & * & * & 94 & 0.63 & 0.009 \\
\hline
Adjusted for SES \& Urban/Rural Status & * & * & * & 94 & 0.635 & 0.016 \\
\hline
\end{tabular}}
\end{table}
|
PMC1180846_table_1
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Type of post consultation letter} & \textbf{Letter to General Practitioner} & \textbf{Letter to patient} & \textbf{Significance (Wilcoxin Signed Ranks test)} \\
\hline
Length of time to dictate letter (minutes $\pm$ SD, n) & 3.28 $\pm$ 2.2, 81 & 2.57 $\pm$ 1.42, 82 & p = 0.019 \\
\hline
Flesch Reading Ease Score & 49.76 $\pm$ 9.1, 84 & 55.44 $\pm$ 9.26, 84 & p $<$ 0.001 \\
\hline
Flesch-Kincaid Grade Level & 10.72 $\pm$ 1.43 & 11.04 $\pm$ 1.39 & p = 0.062 \\
\hline
Circled items in each letter & 31/63 circled 1–12 items & 16/63 circled 1–5 items & p $<$ 0.001 \\
\hline
Word Count & 444 $\pm$ 169.87 & 351.5 $\pm$ 129.05 & p $<$ 0.001 \\
\hline
\end{tabular}}
\end{table}
|
PMC1360088_table_0
|
|
\begin{table}
\scalebox{0.60}{
\begin{tabular}{|l|l|l|l|}
\hline
\textbf{Stage} & \textbf{n} & \textbf{Duration range (days)} & \textbf{Cumulative duration (days)} \\
\hline
1st & 20 & 5–10 & 6.6 \\
\hline
2nd & 43 & 2–4 & 9.7 \\
\hline
3rd & 26 & 6–10 & 18.2 \\
\hline
4th & 10 & 5–8 & 24.5 \\
\hline
5th & 10 & 4–5 & 28.9 \\
\hline
6th & 7 & 2–4 & 32.0 \\
\hline
\end{tabular}}
\end{table}
|
PMC3468633_table_0
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.