Datasets:

rahul77
/

pubtables-1m-batch5

Modalities:

Image

Text

Formats:

Size:

Libraries:

Dataset card Data Studio Files Files and versions

xet

Community

Dataset Viewer

Auto-converted to Parquet

Split (1)

train · 500 rows

image imagewidth (px) 258 933	latex stringlengths 198 5.27k	filename stringlengths 18 19
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline \textbf{MIGS ID} & \textbf{Property} & \textbf{Term} \\ \hline MIGS-31 & Finishing quality & finished \\ \hline MIGS-28 & Libraries used & Three genomic libraries: one 454 pyrosequence standard library, one 454 PE library (10.5 kb insert size), one Illumina library \\ \hline MIGS-29 & Sequencing platforms & Illumina GAii, 454 GS FLX Titanium \\ \hline MIGS-31.2 & Sequencing coverage & 960.0 $\times$ Illumina; 47.3 $\times$ pyrosequence \\ \hline MIGS-30 & Assemblers & Newbler version 2.3, Velvet version 0.7.63, phrap version SPS - 4.24 \\ \hline MIGS-32 & Gene calling method & Prodigal 1.4, GenePRIMP \\ \hline & INSDC ID & CP002631 \\ \hline & Genbank Date of Release & April 15, 2011 \\ \hline & GOLD ID & Gc01722 \\ \hline & NCBI project ID & 50825 \\ \hline & Database: IMG-GEBA & 2504557012 \\ \hline MIGS-13 & Source material identifier & DSM 2489 \\ \hline & Project relevance & Tree of Life, GEBA \\ \hline \end{tabular}} \end{table}	PMC3156407_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & & \multicolumn{3}{\|l\|}{\textbf{Anxiety}} & \multicolumn{3}{\|l\|}{\textbf{Depression}} \\ \hline & & \textbf{ADL} & \textbf{Cognitive impairment} & \textbf{Behavioural problems} & \textbf{ADL} & \textbf{Cognitive impairment} & \textbf{Behavioural problems} \\ \hline Subgroups & LPHB & .11 & -.13 & .12 & -.03 & -.04 & .02 \\ \hline & HPHB & -.10 & .07 & .19 & .06 & .13 & .23 \\ \hline & LPLB & .021 & -.001 & .31�� & -.156� & .14 & .20�� \\ \hline & HPLB & .02 & .24 & .46�� & -.14 & .29� & .40�� \\ \hline \end{tabular}} \end{table}	PMC6128659_table_3
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline & \multicolumn{3}{\|l\|}{\textbf{Public School}} & \multicolumn{3}{\|l\|}{\textbf{Private School}} \\ \hline & \textbf{Adjusted PRa} & \textbf{95\%CI} & \textbf{pb} & \textbf{Adjusted PRa} & \textbf{95\%CI} & \textbf{pb} \\ \hline \multicolumn{7}{\|l\|}{Sedentary lifestyle} \\ \hline \multicolumn{7}{\|l\|}{Gender} \\ \hline Male & 0.72 & 0.63–0.81 & $<$0.001* & 0.68 & 0.57–0.80 & $<$0.001* \\ \hline Female & 1 & & & 1 \\ \hline \end{tabular}} \end{table}	PMC5117583_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Complications} & \textbf{Beijing} & \textbf{NY} \\ \hline Hydrocephalus & 7 (0.4 \%) & 0 (0.0 \%) \\ \hline Meningitis & 3 (0.2 \%) & 0 (0.0 \%) \\ \hline Permanent bulbar palsy & 4 (0.3 \%) & 0 (0.0 \%) \\ \hline Cerebellar infarction & 3 (0.2 \%) & 0 (0.0 \%) \\ \hline Cerebellar hemorrhage & 1 (0.1 \%) & 0 (0.0 \%) \\ \hline Pseudomeningocele & 3 (0.2 \%) & 0 (0.0 \%) \\ \hline Total & 21 (1.4 \%) & 0 (0.0 \%) \\ \hline \end{tabular}} \end{table}	PMC4980444_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Characteristics} & \textbf{No. of moderately ill patients (\%) n = 342} & \textbf{No. of severe patients (\%) n = 188} & \multicolumn{2}{\|l\|}{\textbf{Univariate*}} & \multicolumn{2}{\|l\|}{\textbf{Multivariate{}} \\ \hline & & & \textbf{OR (95\% CI)} & \textbf{p-value} & \textbf{aOR (95\% CI)} & \textbf{p-value} \\ \hline Male, sex & 213 (62.3) & 132 (70.2) & 1.43 (0.98–2.09) & 0.07 & 1.69 (1.09–2.63) & ,0.05 \\ \hline \multicolumn{7}{\|l\|}{Age, years} \\ \hline 2–17 & 146 (42.7) & 55 (29.3) & Ref & & Ref \\ \hline 18–49 & 110 (32.2) & 65 (34.6) & 1.57 (1.01–2.43) & 0.68 & 1.06 (0.63–1.80) & 0.80 \\ \hline \$50 & 86 (25.2) & 68 (36.2) & 2.10 (1.35–3.27) & ,0.01 & 1.01 (0.56–1.83) & 0.93 \\ \hline At least 1 underlying medical condition & 106 (31.0) & 100 (53.2) & 2.53 (1.75–3.65) & ,0.0001 & 2.50 (1.54–4.06) & ,0.01 \\ \hline \multicolumn{7}{\|l\|}{Days from symptom onset to hospital admission} \\ \hline On symptom day 0–2 & 189 (55.4) & 71 (38.4) & Ref & & Ref \\ \hline On symptom day \$3 & 152 (44.6) & 114 (61.6) & 2.00 (1.39–2.88) & ,0.001 & 2.00 (1.30–3.04) & ,0.01 \\ \hline \multicolumn{7}{\|l\|}{Days from symptom onset to antiviral treatment initiation{} \\ \hline On symptom day 0–2 & 51 (34.9) & 23 (17.4) \\ \hline On symptom day 3–4 & 35 (24.0) & 34 (25.8) & 2.15 (1.09–4.23) & 0.37 & 1.64 (0.77–3.49) & 0.81 \\ \hline On symptom day .5 & 60 (41.1) & 75 (56.8) & 2.77 (1.52–5.04) & ,0.01 & 3.12 (1.54–6.35) & ,0.01 \\ \hline \end{tabular}} \end{table}	PMC3564919_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{Group} & \multicolumn{2}{\|l\|}{\textbf{Week 1 a}} & \multicolumn{2}{\|l\|}{\textbf{Week 12}} & \textbf{P-value within group b} & \textbf{P-value between groups c} \\ \hline & & \textbf{Mean} & \textbf{SEM} & \textbf{Mean} & \textbf{SEM} \\ \hline LDL integrated particle size (Å) & ADF & 261 & $\pm$ 1 & 265 & $\pm$ 2 & 0.01 & 0.20 \\ \hline & CR & 260 & $\pm$ 2 & 264 & $\pm$ 2 & 0.01 \\ \hline & Exercise & 260 & $\pm$ 2 & 261 & $\pm$ 1 & 0.70 \\ \hline & Control & 260 & $\pm$ 2 & 260 & $\pm$ 2 & 0.49 \\ \hline \% Large LDL particles & ADF & 40 & $\pm$ 4 & 48 & $\pm$ 5 & 0.04 & 0.43 \\ \hline & CR & 47 & $\pm$ 5 & 52 & $\pm$ 5 & 0.07 \\ \hline & Exercise & 49 & $\pm$ 4 & 49 & $\pm$ 4 & 0.49 \\ \hline & Control & 42 & $\pm$ 4 & 41 & $\pm$ 4 & 0.53 \\ \hline \% Medium LDL particles & ADF & 35 & $\pm$ 2 & 34 & $\pm$ 2 & 0.75 & 0.49 \\ \hline & CR & 36 & $\pm$ 3 & 34 & $\pm$ 3 & 0.57 \\ \hline & Exercise & 35 & $\pm$ 2 & 34 & $\pm$ 2 & 0.48 \\ \hline & Control & 39 & $\pm$ 2 & 39 & $\pm$ 2 & 0.87 \\ \hline \% Small LDL particles & ADF & 25 & $\pm$ 3 & 18 & $\pm$ 3 & 0.04 & 0.75 \\ \hline & CR & 18 & $\pm$ 3 & 14 & $\pm$ 4 & 0.29 \\ \hline & Exercise & 17 & $\pm$ 3 & 17 & $\pm$ 3 & 0.89 \\ \hline & Control & 19 & $\pm$ 4 & 20 & $\pm$ 4 & 0.50 \\ \hline \% Large HDL particles & ADF & 34 & $\pm$ 3 & 34 & $\pm$ 3 & 0.93 & 0.98 \\ \hline & CR & 34 & $\pm$ 4 & 36 & $\pm$ 5 & 0.67 \\ \hline & Exercise & 28 & $\pm$ 3 & 34 & $\pm$ 3 & 0.04 \\ \hline & Control & 34 & $\pm$ 4 & 34 & $\pm$ 5 & 0.98 \\ \hline \% Medium HDL particles & ADF & 49 & $\pm$ 3 & 46 & $\pm$ 3 & 0.39 & 0.31 \\ \hline & CR & 43 & $\pm$ 4 & 44 & $\pm$ 4 & 0.85 \\ \hline & Exercise & 52 & $\pm$ 3 & 52 & $\pm$ 3 & 0.80 \\ \hline & Control & 45 & $\pm$ 3 & 44 & $\pm$ 4 & 0.64 \\ \hline \% Small HDL particles & ADF & 18 & $\pm$ 3 & 20 & $\pm$ 3 & 0.61 & 0.53 \\ \hline & CR & 22 & $\pm$ 4 & 20 & $\pm$ 6 & 0.57 \\ \hline & Exercise & 21 & $\pm$ 4 & 14 & $\pm$ 3 & 0.03 \\ \hline & Control & 21 & $\pm$ 3 & 22 & $\pm$ 3 & 0.60 \\ \hline \end{tabular}} \end{table}	PMC3150311_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline & \textbf{x} & \textbf{y} & \textbf{z} & \textbf{Uiso/Ueq} \\ \hline S & 0.07308 (7) & 0.15388 (7) & 0.18224 (8) & 0.0444 (3) \\ \hline O & 0.3343 (2) & −0.0997 (2) & −0.2453 (3) & 0.0751 (8) \\ \hline N1 & 0.0991 (2) & −0.0816 (2) & 0.2420 (3) & 0.0438 (6) \\ \hline N2 & 0.0458 (2) & −0.0359 (2) & 0.3336 (3) & 0.0450 (6) \\ \hline N3 & −0.0237 (2) & 0.1545 (2) & 0.3882 (3) & 0.0564 (7) \\ \hline H3A & −0.0449 & 0.1197 & 0.4550 & 0.068 \\ \hline H3B & −0.0344 & 0.2337 & 0.3693 & 0.068* \\ \hline C1 & 0.4549 (4) & 0.1716 (4) & −0.4561 (5) & 0.0764 (12) \\ \hline H1B & 0.4826 & 0.2314 & −0.5046 & 0.092* \\ \hline C2 & 0.3629 (4) & 0.1137 (4) & −0.5265 (5) & 0.0870 (13) \\ \hline H2B & 0.3273 & 0.1343 & −0.6242 & 0.104* \\ \hline C3 & 0.3208 (3) & 0.0249 (4) & −0.4566 (5) & 0.0729 (11) \\ \hline H3C & 0.2572 & −0.0142 & −0.5061 & 0.087* \\ \hline C4 & 0.3732 (3) & −0.0048 (3) & −0.3145 (4) & 0.0526 (8) \\ \hline C5 & 0.4662 (3) & 0.0517 (4) & −0.2422 (4) & 0.0721 (11) \\ \hline H5A & 0.5027 & 0.0301 & −0.1451 & 0.086* \\ \hline C6 & 0.5062 (3) & 0.1415 (4) & −0.3144 (5) & 0.0834 (13) \\ \hline H6A & 0.5691 & 0.1818 & −0.2648 & 0.100* \\ \hline C7 & 0.2835 (3) & −0.0671 (3) & −0.1459 (4) & 0.0501 (8) \\ \hline C8 & 0.2482 (3) & 0.0534 (3) & −0.1339 (4) & 0.0586 (9) \\ \hline H8A & 0.2603 & 0.1185 & −0.1918 & 0.070* \\ \hline C9 & 0.1947 (3) & 0.0763 (3) & −0.0349 (4) & 0.0537 (9) \\ \hline H9A & 0.1701 & 0.1573 & −0.0272 & 0.064* \\ \hline C10 & 0.1769 (2) & −0.0194 (3) & 0.0532 (3) & 0.0383 (7) \\ \hline C11 & 0.2148 (2) & −0.1399 (3) & 0.0400 (4) & 0.0481 (8) \\ \hline H11A & 0.2044 & −0.2051 & 0.0989 & 0.058* \\ \hline C12 & 0.2673 (2) & −0.1634 (3) & −0.0592 (4) & 0.0516 (8) \\ \hline H12A & 0.2919 & −0.2443 & −0.0677 & 0.062* \\ \hline C13 & 0.1199 (2) & 0.0043 (3) & 0.1577 (3) & 0.0375 (7) \\ \hline C14 & 0.0255 (2) & 0.0854 (3) & 0.3138 (3) & 0.0406 (7) \\ \hline \end{tabular}} \end{table}	PMC2977727_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{n} & \textbf{Min} & \textbf{Max} & \textbf{Mean} & \textbf{Std Dev.} \\ \hline Behavior & 89 & 2.83 & 4.34 & 3.86 & 0.53 \\ \hline Change & 89 & 4.13 & 4.47 & 4.26 & 0.54 \\ \hline PU/PEU & 89 & 4.02 & 4.46 & 4.26 & 0.51 \\ \hline \end{tabular}} \end{table}	PMC3423046_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline Bruker SMART CCD area-detector diffractometer & 2983 independent reflections \\ \hline Radiation source: fine-focus sealed tube & 1404 reflections with I $>$ 2$\sigma$(I) \\ \hline graphite & Rint = 0.070 \\ \hline $\phi$ and $\omega$ scans & $\theta$max = 27.2°, $\theta$min = 1.4° \\ \hline Absorption correction: numerical (SADABS; Bruker, 2003) & h = −15$\rightarrow$14 \\ \hline Tmin = 0.861, Tmax = 0.865 & k = −4$\rightarrow$4 \\ \hline 11154 measured reflections & l = −38$\rightarrow$37 \\ \hline \end{tabular}} \end{table}	PMC3213638_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline & \multicolumn{4}{\|l\|}{\textbf{Odds ratio (95\% confidence interval) \& p-valuea}} \\ \hline & \multicolumn{2}{\|l\|}{\textbf{Non-weighted risk score}} & \multicolumn{2}{\|l\|}{\textbf{Weighted risk score}} \\ \hline & \textbf{unadjusted} & \textbf{adjustedb} & \textbf{unadjusted} & \textbf{adjustedb} \\ \hline neutropenia (n = 1676) & 0.98 (0.96, 0.99) p = 0.04 & 0.98 (0.96, 1.00) p = 0.06 & 0.98 (0.95, 1.01) p = 0.16 & 0.98 (0.95, 1.01) p = 0.20 \\ \hline neuropathy (n = 1279) & 0.99 (0.97, 1.01) p = 0.41 & 0.99 (0.97, 1.01) p = 0.48 & 0.98 (0.95, 1.02) p = 0.37 & 0.99 (0.95, 1.02) p = 0.47 \\ \hline \end{tabular}} \end{table}	PMC4938564_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline & \textbf{Young's modulus (N/mm)} & \textbf{Poisson's ratio} \\ \hline Cancellous bone & 1370 & 0.30 \\ \hline of Cortical bone & 13700 & 0.26 \\ \hline PDL & 0.6668 & 0.49 \\ \hline the Tooth & 20000 & 0.30 \\ \hline Bracket and SS wire & 214000 & 0.30 \\ \hline \end{tabular}} \end{table}	PMC4884016_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline \textbf{Variable} & \textbf{n(\%)*} \\ \hline Age & 21.04 (1.96) \\ \hline \multicolumn{2}{\|l\|}{Gender} \\ \hline Male & 215 (40.41\%) \\ \hline Female & 317 (59.59\%) \\ \hline \multicolumn{2}{\|l\|}{Institution} \\ \hline Allama Iqbal Medical College & 178 (33.5\%) \\ \hline FMH College of Medicine \& Dentistry & 75 (14.1\%) \\ \hline Sharif Medical \& Dental College & 129 (24.2\%) \\ \hline Services Institute of Medical Sciences & 150 (28.2\%) \\ \hline \multicolumn{2}{\|l\|}{Year of Study} \\ \hline 3rd Year MBBS & 151 (28.4\%) \\ \hline 4th Year MBBS & 196 (36.8\%) \\ \hline Final Year MBBS & 185 (34.7\%) \\ \hline \end{tabular}} \end{table}	PMC3119193_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline Refinement on F2 & Secondary atom site location: difference Fourier map \\ \hline Least-squares matrix: full & Hydrogen site location: inferred from neighbouring sites \\ \hline R[F2 $>$ 2$\sigma$(F2)] = 0.073 & H-atom parameters constrained \\ \hline wR(F2) = 0.206 & w = 1/[$\sigma$2(Fo 2) + (0.1044P)2 + 37.5508P] where P = (Fo 2 + 2Fc 2)/3 \\ \hline S = 1.02 & ($\Delta$/$\sigma$)max = 0.018 \\ \hline 15556 reflections & $\Delta$$\rho$max = 5.46 e Å−3 \\ \hline 999 parameters & $\Delta$$\rho$min = −1.00 e Å−3 \\ \hline 1092 restraints & Extinction correction: SHELXL97 (Sheldrick, 2008) \\ \hline Primary atom site location: structure-invariant direct methods \\ \hline \end{tabular}} \end{table}	PMC3212259_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Response} & \textbf{Equation (variables are ordered by partial R2)} & \textbf{R2} & \textbf{Adjusted R2} & \textbf{LOOCVa R2} & \textbf{Highest Variance Inflation Factor (variable)} & \textbf{p-value} & \textbf{RMSEb} & \textbf{Measured Responsec} \\ \hline Log Annual NO & 1.53 − 1.4e-04 $\times$ DIST to TACZ + 6.9e-01 $\times$ LNDIST to PRSC − 3.1e- 06 $\times$ GRS.500 − 4.4e-02 $\times$ SLP − 3.0e-05 $\times$ URF.100 & 0.78 & 0.71 & 0.66 & 1.8 (LNDIST to PRSC) & $<$ 0.001 & 32.1 & 88 (23–312) \\ \hline Log Cooler Season NO & 1.92 + 5.1e-01 $\times$ LNDIST to PRSC + 4.7e-05 $\times$ TPDC.2500 − 1.1e-04 $\times$ DIST to BST − 3.2e-04 $\times$ DIST to PST − 2.1e-06 $\times$ GRS.400 & 0.69 & 0.60 & 0.53 & 1.5 (TPDC.2500) & $<$ 0.001 & 38.6 & 117 (30–358) \\ \hline Log Warmer Season NO & 0.68 − 1.5e-04 $\times$ DIST to TACZ + 7.4e-01 $\times$ LNDIST to PRSC − 6.3e- 02 $\times$ SLP − 2.0e-06 $\times$ GRS.500 + 9.4e-04 $\times$ DIST to GRS & 0.72 & 0.64 & 0.59 & 2.2 (SLP) & $<$ 0.001 & 36.9 & 60 (17–268) \\ \hline Log Annual NO2 & 2.9 + 1.1e-05 $\times$ OFIC.300 − 1.5e-04 $\times$ DIST to SNS + 1.7e-01 $\times$ LNDIST to PRSC + 2.2e-05 $\times$ OTHR.300 & 0.69 & 0.62 & 0.57 & 1.3 (LNDIST to PRSC) & $<$ 0.001 & 9.9 & 53 (22–96) \\ \hline (Log Cooler Season NO2)3 & − 5.7e + 01 + 5.9e-04 $\times$ OFIC.300 + 1.1e-01 $\times$ $\times$ ELEV − 4.1e-03 $\times$ DIST to AIR + 8.3e-04 $\times$ OTHR.400 − 1.5e-03 $\times$ ARD.100 & 0.75 & 0.68 & 0.58 & 3.8 (DIST to AIR) & $<$ 0.001 & 9.2 & 62 (21–103) \\ \hline (Log Warmer Season NO2)−1 & 3.3e-01 − 6.8e-07 $\times$ OFIC.300 + 1.2e-05 $\times$ DIST to SNS − 1.0e-02 $\times$ LNDIST to PRSC & 0.64 & 0.58 & 0.51 & 1.2 (LNDIST to PRSC) & $<$ 0.001 & 10.2 & 45 (23–89) \\ \hline (Log Annual NOX)−2 & 9.2e-02 + 2.0e-06 $\times$ DIST to TACZ − 6.5e-03 $\times$ LNDIST to PRSC + 2.6e- 05 $\times$ DIST to OFIC − 3.2e-03 $\times$ LNDIST to HZRFAC − 1.2e-03 $\times$ BGD.400 & 0.71 & 0.62 & 0.58 & 1.7 (DIST to OFIC) & $<$ 0.001 & 52.7 & 142 (66–385) \\ \hline (Log Cooler Season NOX)−1 & 2.9e-01 + 5.8e-06 $\times$ $\times$ DIST to TACZ − 1.1e-02 $\times$ LNDIST to HZRFAC + 1.6e- 06 $\times$ URF.100 + 8.8e-08 $\times$ GRS.400 − 9.2e-03 $\times$ LNDIST to PRSC & 0.79 & 0.73 & 0.63 & 1.9 (DIST to TACZ) & $<$ 0.001 & 37.1 & 180 (76–435) \\ \hline (Log Warmer Season NOX)−4 & 7.1e-03 − 8.1e-04 $\times$ LNDIST to PRSC + 1.3e-07 $\times$ DIST to TACZ − 4.0e- 04 $\times$ (OFIC.100)0.1 − 1.3e-04 $\times$ $\times$ BGD.400 + 3.4e-05 $\times$ SLP & 0.61 & 0.50 & 0.42 & 1.9 (LNDIST to PRSC) & 0.004 & 44.8 & 105 (49–336) \\ \hline \multicolumn{3}{\|l\|}{Radius variable types included in the models were:} & \multicolumn{6}{\|l\|}{The log-linear distance variables included in the models were:} \\ \hline \multicolumn{3}{\|l\|}{GRS = green space area} & \multicolumn{6}{\|l\|}{LNDIST to HZRFAC = log distance to hazardous facilities} \\ \hline \multicolumn{3}{\|l\|}{OFIC = official/commercial land use area} & \multicolumn{6}{\|l\|}{LNDIST to PRSC = log distance to the nearest primary school} \\ \hline \multicolumn{9}{\|l\|}{OTHR = other land use area} \\ \hline \multicolumn{3}{\|l\|}{URF = urban facilities area} & \multicolumn{6}{\|l\|}{Other variable included in the models were:} \\ \hline \multicolumn{3}{\|l\|}{ARD = arid/undeveloped area} & \multicolumn{6}{\|l\|}{BGD = bridge length in a buffer radii divided by distance to the bridges} \\ \hline \multicolumn{3}{\|l\|}{The linear distance variables included in the models were:} & \multicolumn{6}{\|l\|}{ELEV = elevation} \\ \hline \multicolumn{3}{\|l\|}{DIST to AIR = distance to airport or air cargo facilities} & \multicolumn{6}{\|l\|}{SLP = slope} \\ \hline \multicolumn{3}{\|l\|}{DIST to BST = distance to bus terminal} & \multicolumn{6}{\|l\|}{TPDC = population density excluding unemployed and children $<$ 5 years} \\ \hline \multicolumn{9}{\|l\|}{DIST to GRS = distance to green space area} \\ \hline \multicolumn{3}{\|l\|}{DIST to SNS = distance to sensitive area} & \multicolumn{6}{\|l\|}{For variables of the form XXX.YYY the XXX indicates the variable type, and the YYY indicates the buffer size, in meters.} \\ \hline \multicolumn{9}{\|l\|}{DIST to OFIC = distance to official/commercial area} \\ \hline \multicolumn{9}{\|l\|}{DIST to PST = distance to petrol stations} \\ \hline \multicolumn{3}{\|l\|}{DIST to TACZ = distance to the traffic access control zone} \\ \hline \end{tabular}} \end{table}	PMC5020732_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline \textbf{matK} & \textbf{E. arvense unique substitutions} & \textbf{none} \\ \hline & E. arvense substitutions shared with other Equisetum species but not with E. palustre & With E. fluvatile: 265 C, 511 G With E. diffusum, E. fluvatile: 294 A, 344 C 351 C, 374 C, 397 G, 502 T, 512 C, 567 G, 572 A, 619 T, 636 A, 670 G. With E. diffusum, E. fluviatile, E. sylvaticum: 212 T, 462 T. With E. diffusum, E. fluviatile, E. hyemale, E. sylvaticum: 372 G. \\ \hline & E. palustre unique substitutions & 273 C, 311 A, 391 C, 575 C, 594 C. \\ \hline & E. palustre substitutions shared with other Equisetum species but not with E. arvense & With E. laevigatum, E. myriochaetum: 600 G. With E. sylvaticum, E. telmateia: 534 C. With E. hyemale, E. ramosissimum: 421 A. \\ \hline trnH-psbA & E. arvense unique substitutions & 193 A \\ \hline & E. arvense substitutions shared with other Equisetum species but not with E. palustre & With E. diffusum, E. fluviatile: 141 A, 87 A. \\ \hline & E. palustre unique substitutions & 124 A, 200 A. \\ \hline & E. palustre substitutions shared with other Equisetum species but not with E. arvense & With E. diffusum, E. bogotense, E. sylvaticum: 121 G, 122 T, 123 A, 125 T, 126 A. With E. pratense, E. sylvaticum, E. telmateia: 151 C. \\ \hline \end{tabular}} \end{table}	PMC4499799_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Treatments} & \textbf{Sequence number*} & \textbf{OTUs} & \multicolumn{2}{\|l\|}{\textbf{Estimated OTU richness}} & \textbf{Shannon} \\ \hline & & & \textbf{CHAO1} & \textbf{ACE} \\ \hline CE1 & 1306 & 595 & 1422(1216;1698) & 2433(2197;2704) & 5.85(5.78;5.92) \\ \hline CE2 & 1306 & 639 & 1764(1486;2135) & 3082(2800;3401) & 5.99(5.92;6.05) \\ \hline CE3 & 1306 & 596 & 1296(1122;1527) & 2062(1863;2292) & 5.88(5.81;5.95) \\ \hline GC1 & 1306 & 613 & 1415(1217;1678) & 2286(2071;2534) & 5.95(5.89;6.02) \\ \hline GC2 & 1306 & 578 & 1300(1112;1554) & 1868(1696;2066) & 5.91(5.85;5.97) \\ \hline GC3 & 1306 & 624 & 1530(1305;1830) & 2247(2033;2494) & 5.99(5.93;6.06) \\ \hline BC1 & 1306 & 705 & 2033(1721;2440) & 3840(3496;4226) & 6.11(6.04;6.17) \\ \hline BC2 & 1306 & 565 & 1228(1054;1463) & 1684(1527;1867) & 5.87(5.80;5.93) \\ \hline BC3 & 1306 & 598 & 1556(1312;1882) & 2644(2394;2928) & 5.88(5.81;5.95) \\ \hline Total & 11754 \\ \hline \end{tabular}} \end{table}	PMC3606482_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline & \multicolumn{3}{\|l\|}{\textbf{Men}} & \multicolumn{3}{\|l\|}{\textbf{Women}} \\ \hline & \textbf{Newly sick listed n = 1 073 \% (95\% C.I)} & \textbf{General population n = 1 730 \% (95\% C.I)} & \textbf{Difference \% (95\% C.I.)} & \textbf{Newly sick listed n = 2 131 \% (95\% C.I)} & \textbf{General population n = 2 145 \% (95\% C.I)} & \textbf{Difference \% (95\% C.I.)} \\ \hline Neoplastic disease & 3.2 (2.1–4.2) & 0.7 (0.3–1.1) & 0.03 (0.01–0.04)* & 4.1 (3.2-4.9) & 0.9 (0.5–1.3) & 0.03 (0.02–0.04)* \\ \hline Endocrine & 5.5 (4.1–6.9) & 3.2 (2.4–4.1) & 0.02 (0.01–0.04)* & 8.2 (7.0–9.3) & 5.2 (4.2–6.1) & 0.03 (0.02–0.04)* \\ \hline Psychiatric & 8.4 (6.7–10.0) & 4.1 (3.2–5.0) & 0.04 (0.02–0.06)* & 11.4 (10.0–12.8) & 6.9 (5.8–8.0) & 0.05 (0.03–0.06)* \\ \hline Neurologic & 4.1 (2.9–5.3) & 2.4 (1.7–3.2) & 0.02 (0.00–0.03) & 4.3 (3.5–5.2) & 3.3 (2.5–4.0) & 0.01 (0.00–0.02) \\ \hline Cardiovascular & 16.8 (14.5–19.0) & 9.8 (8.4–11.2) & 0.07 (0.04–0.10)* & 10.5 (9.2–11.8) & 7.4 (6.3–8.5) & 0.03 (0.01–0.05)* \\ \hline Pulmonary & 10.4 (8.6–12.3) & 11.0 (9.6–12.5) & −0.01 (−0.03–0.02) & 13.8 (12.3–15.3) & 13.1 (11.7–14.5) & 0.01 (−0.01–0.03) \\ \hline Gastrointestinal & 12.6 (10.6–14.6) & 7.6 (6.3–8.8) & 0.05 (0.03–0.07)* & 15.4 (13.9–17.0) & 12.1 (10.7–13.5) & 0.03 (0.01–0.05)* \\ \hline Skin and allergic & 8.1 (6.5–9.7) & 7.0 (5.8–8.2) & 0.01 (−0.01–0.03) & 10.5 (9.2–11.8) & 10.7 (9.4–12.0) & 0.00 (−0.02–0.02) \\ \hline Musculoskeletal & 21.5 (19.1–24.0) & 14.4 (12.8–16.1) & 0.07 (0.04–0.10)* & 29.1 (27.2–31.0) & 20.0 (18.4–21.7) & 0.09 (0.07–0.12)* \\ \hline Rheumatic & 2.8 (1.8–3.8) & 1.4 (0.8–2.0) & 0.01 (0.00–0.03) & 6.5 (5.5–7.6) & 3.9 (3.1–4.7) & 0.03 (0.01–0.04)* \\ \hline Gynaecologic & – & – & & 5.0 (4.1–5.9) & 3.9 (3.1–4.6) & 0.01 (0.00–0.02) \\ \hline Other & 5.2 (3.9–6.5) & 2.8 (2.0–3.5) & 0.02 (0.01–0.04)* & 3.3 (2.6–4.1) & 2.6 (1.9–3.2) & 0.01 (0.00–0.02) \\ \hline No Disease & 33.2 (30.4–36.0) & 54.2 (51.8–56.5) & −0.21 (−0.25– -0.17)* & 29.1 (27.2–31.1) & 45.7 (43.6–47.8) & −0.17 (−0.19– -0.14)* \\ \hline One chronic disease & 44.7 (41.8–47.7) & 32.6 (30.4–34.8) & 0.12 (0.08–0.16)* & 37.8 (35.8–39.9) & 32.3 (30.3–34.3) & 0.06 (0.03–0.08)* \\ \hline More than one chronic disease & 22.1 (19.6–24.6) & 13.2 (11.6–14.8) & 0.09 (0.06–0.12)* & 33.0 (31.0–35.0) & 22.0 (20.3–23.8) & 0.11 (0.08–0.14)* \\ \hline \end{tabular}} \end{table}	PMC3626677_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline & \textbf{Cases/total} & \textbf{OR (95\%CI)} \\ \hline 0 MLE & 23/725 & Reference \\ \hline Only child MLE & 15/332 & 1.55(0.79,3.03) \\ \hline Only adult MLE & 69/1,581 & 1.60(0.98,2.60) \\ \hline Child \& Adult MLE & 91/2,123 & 1.67(1.04,2.68) \\ \hline \end{tabular}} \end{table}	PMC4578856_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{ID No.} & \textbf{FitValue} & \textbf{Estimate} & \textbf{HBA_1} & \textbf{HBA_2} & \textbf{HY_3} & \textbf{RA_4} \\ \hline F0325-0146 & 6.580 & 4.599 & 1 & 1 & 1 & 1 \\ \hline F0289-0199 & 6.446 & 6.266 & 1 & 1 & 1 & 1 \\ \hline F0922-0370 & 5.935 & 20.327 & 1 & 1 & 1 & 1 \\ \hline F0012-0228 & 5.690 & 35.775 & 1 & 1 & 1 & 1 \\ \hline F0496-0019 & 5.623 & 41.719 & 1 & 1 & 1 & 1 \\ \hline F0737-0405 & 5.55006 & 49.3217 & 1 & 1 & 1 & 1 \\ \hline F0382-0020 & 5.53538 & 51.0174 & 1 & 1 & 1 & 1 \\ \hline F0325-0148 & 5.1207 & 132.555 & 1 & 1 & 1 & 1 \\ \hline F0737-0312 & 5.00395 & 173.442 & 1 & 1 & 1 & 1 \\ \hline F0725-0356 & 4.98991 & 179.137 & 1 & 1 & 1 & 1 \\ \hline F0301-0263 & 4.9208 & 210.04 & 1 & 1 & 1 & 1 \\ \hline F0473-0314 & 4.90716 & 216.74 & 1 & 1 & 1 & 1 \\ \hline F0922-0913 & 4.87165 & 235.207 & 1 & 1 & 1 & 1 \\ \hline F1601-0068 & 4.58408 & 456.055 & 1 & 1 & 1 & 1 \\ \hline F0463-0195 & 4.50862 & 542.605 & 1 & 1 & 1 & 1 \\ \hline F0866-0317 & 4.26226 & 956.832 & 1 & 1 & 1 & 1 \\ \hline F0537-0936 & 4.17732 & 1,163.54 & 1 & 1 & 1 & 1 \\ \hline F0180-0144 & 3.96884 & 1,880.45 & 1 & 1 & 1 & 1 \\ \hline F0922-0900 & 3.95736 & 1,930.82 & 1 & 1 & 1 & 1 \\ \hline \end{tabular}} \end{table}	PMC4682379_table_10
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Carcinogenesis Model} & \textbf{Carcinogen} & \textbf{Eugenol Administration} & \textbf{Effect} & \textbf{References} \\ \hline Skin carcinogenesis & DMBA + TPA & Topical & Reduction in tumor incidence and size; and/or development of papillomatous keratoacanthoma with minimal cell proliferation but without squamous cell carcinoma & [20] \\ \hline Skin carcinogenesis & DMBA + croton oil & Topical & Inhibition of tumor formation ~60\% & [21,22] \\ \hline Skin carcinogenesis & benzo[a]pyrene & Topical & Inhibition of tumor formation ~50\% & [23] \\ \hline Skin Carcinogenesis & DMBA & Topical & Minimal protection & [24] \\ \hline Gastric carcinogenesis & MNNG & Intragastric & Inhibition of tumor formation ~75\% & [25,26] \\ \hline Lung carcinogenesis & Urethane & Oral & No protection & [28] \\ \hline \end{tabular}} \end{table}	PMC5748817_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & \multicolumn{2}{\|l\|}{\textbf{Nephrotic range proteinuria with hematuria}} & \textbf{P} & \multicolumn{2}{\|l\|}{\textbf{Nephrotic range proteinuria without hematuria}} & \textbf{P} & \multicolumn{2}{\|l\|}{\textbf{Nephrotic range proteinuria with or without hematuria}} & \textbf{P} \\ \hline \textbf{Renal pathology} & \textbf{$\geq$65 (n = 73)} & \textbf{18–64 (n = 461)} & & \textbf{$\geq$65 (n = 115)} & \textbf{18–64 (n = 453)} & & \textbf{$\geq$65 (n = 188)} & \textbf{18–64 (n = 916)} \\ \hline MGN & 22 (30.1\%) & 49 (10.6\%) & $<$0.001 & 25 (21.7\%) & 106 (23.4\%) & 0.804 & 47 (25.0\%) & 155 (16.9\%) & 0.013 \\ \hline FSGS & 15 (20.6\%) & 79 (17.1\%) & 0.508 & 23 (20.0\%) & 81 (17.9\%) & 0.591 & 38 (20.2\%) & 160 (17.5\%) & 0.404 \\ \hline Amyloidosis & 9 (12.3\%) & 13 (2.8\%) & 0.001 & 29 (25.2\%) & 44 (9.7\%) & $<$0.001 & 38 (20.2\%) & 57 (6.2\%) & $<$0.001 \\ \hline Pauci immune GN crescentic GN focal segmental GN & 7 (9.6\%) 3 (4.1\%) 4 (5.5\%) & 31 (6.7\%) 18 (3.9\%) 13 (2.8) & 0.336 1.000 0.271 & 3 (2.6\%) 1 (0.9\%) 2 (1.7\%) & 4 (0.9\%) 2 (0.4\%) 2 (0.4\%) & 0.151 0.493 0.184 & 10 (5.3\%) 4 (2.1\%) 6 (3.2\%) & 35 (3.8\%) 20 (2.2\%) 15 (1.6\%) & 0.317 1.000 0.151 \\ \hline IgAN & 6 (8.2\%) & 114 (24.7\%) & 0.001 & 4 (3.5\%) & 39 (8.6\%) & 0.075 & 10 (5.3\%) & 154 (16.8\%) & $<$0.001 \\ \hline MCD & 5 (6.9\%) & 30 (6.5\%) & 0.804 & 11 (9.6\%) & 84 (18.5\%) & 0.025 & 16 (8.5\%) & 114 (12.5\%) & 0.137 \\ \hline Membrano-proliferative GN & 5 (6.9\%) & 30 (6.5\%) & 0.804 & 1 (0.9\%) & 11 (2.4\%) & 0.475 & 6 (3.2\%) & 41 (4.5\%) & 0.553 \\ \hline DKD & 2 (2.7\%) & 26 (5.6\%) & 0.405 & 13 (11.3\%) & 23 (5.1\%) & 0.029 & 15 (8.0\%) & 49 (5.4\%) & 0.170 \\ \hline LN & 1 (1.4\%) & 51 (11.1\%) & 0.005 & 0 & 23 (5.1\%) & 0.007 & 1 (0.5\%) & 74 (8.1\%) & $<$0.001 \\ \hline End-stage kidney & 1 (1.4\%) & 4 (0.9\%) & 0.522 & 1 (0.9\%) & 8 (1.8\%) & 0.695 & 2 (1.1\%) & 12 (1.3\%) & 1.000 \\ \hline Arterionephrosclerosis & 1 (1.4\%) & 2 (0.4\%) & 0.357 & 1 (0.9\%) & 5 (1.1\%) & 1.000 & 2 (1.1\%) & 7 (0.8\%) & 0.655 \\ \hline MGA & 0 & 3 (0.7\%) & 1.000 & 1 (0.9\%) & 11 (2.4\%) & 0.475 & 1 (0.5\%) & 15 (1.6\%) & 0.498 \\ \hline Thrombotic microangiopathy & 0 & 9 (2.0\%) & 0.618 & 1 (0.9\%) & 6 (1.3\%) & 1.000 & 1 (0.5\%) & 15 (1.6\%) & 0.498 \\ \hline Unclassified lesions & 0 & 13 (2.8\%) & 0.232 & 3 (2.6\%) & 14 (3.1\%) & 1.000 & 3 (1.6\%) & 27 (3.0\%) & 0.458 \\ \hline \end{tabular}} \end{table}	PMC5123353_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Antibody} & \textbf{Median value of titer in AS patients} & \textbf{Median value of titer in control patients} & \textbf{P value} \\ \hline IgA ASCA & 1.24 & 1.10 & 0.28 \\ \hline IgG ASCA & 4.70 & 4.05 & 0.29 \\ \hline Anti-I2 & 11.78 & 7.86 & 0.0172 \\ \hline Anti-OmpC & 8.61 & 7.70 & 0.30 \\ \hline Anti-CBir1 & 16.26 & 15.05 & 0.63 \\ \hline ANCA & 11.6 & 12.1 & 0.65 \\ \hline \end{tabular}} \end{table}	PMC3003540_table_3
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline D—H···A & D—H & H···A & D···A & D—H···A \\ \hline O35—H35···O27 & 0.82 & 1.99 & 2.784 (3) & 163 \\ \hline C9—H9···O35i & 0.93 & 2.46 & 3.320 (4) & 153 \\ \hline C19—H19···O11ii & 0.93 & 2.60 & 3.403 (3) & 144 \\ \hline \end{tabular}} \end{table}	PMC3011768_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline & \multicolumn{3}{\|l\|}{\textbf{Wukro Town (n = 103)}} & \multicolumn{3}{\|l\|}{\textbf{Kilteawlaelo (n = 195)}} \\ \hline \textbf{Variables} & \textbf{Agree n (\%)} & \textbf{Neutral n (\%)} & \textbf{Disagree n (\%)} & \textbf{Agree n (\%)} & \textbf{Neutral n (\%)} & \textbf{Disagree n (\%)} \\ \hline LACM is important for married women & 86 (83) & 7 (6.7) & 10 (10.3) & 134 (68.7) & 10 (5.1) & 51 (26.2) \\ \hline LACM effectively prevents pregnancy & 86 (83) & 7 (6.7) & 10 (10.3) & 192 (98.5) & 1 (0.5) & 2 (1) \\ \hline It is difficult to get LACMs & 5 (4.8) & 4 (4) & 94 (91.2) & 47 (24.1) & 20 (10.3) & 128 (65.6) \\ \hline There is risk of using LACMs & 22 (21.4) & 20 (19.4) & 61 (59.2) & 106 (54.4) & 30 (15.4) & 59 (30.3) \\ \hline Intend to use LACM in the future & 88 (85.4) & 5 (4.9) & 10 (9.7) & 162 (83.1) & 13 (6.7) & 20 (10.3) \\ \hline \end{tabular}} \end{table}	PMC4560916_table_3
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{No} & \textbf{AREA} & \textbf{Total Amount of Events} & \textbf{Max. Magnitude} & \textbf{Median Magnitude} & \textbf{Number of Mainshocks} \\ \hline 1 & Aragonese & 1775 & 6.2 & 4.2 & 208 \\ \hline 2 & Cyprus & 1412 & 6.1 & 4.3 & 376 \\ \hline 3 & Elat Deep & 1365 & 5.3 & 3.35 & 154 \\ \hline 4 & Sinai & 526 & 5 & 3.5 & 145 \\ \hline 5 & Saudi Arabia & 457 & 5.8 & 4.1 & 139 \\ \hline 6 & Arnona Dakar & 454 & 5.5 & 3.4 & 110 \\ \hline 7 & East Mediterranean Sea & 446 & 5.5 & 4.2 & 282 \\ \hline 8 & Suez & 359 & 5.4 & 4.3 & 225 \\ \hline 9 & Dead Sea & 341 & 5.2 & 3.5 & 203 \\ \hline 10 & Arava Valley & 306 & 4.3 & 3.4 & 191 \\ \hline \end{tabular}} \end{table}	PMC4790910_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Protein or gene} & \textbf{Ac} & \textbf{Ad} & \textbf{Na} & \textbf{Hc} & \textbf{Ans} & \textbf{Ass} & \textbf{Tc} & \textbf{Bm} & \textbf{Di} & \textbf{Ov} \\ \hline ATP6 & 85.9 & 85.4 & 86.9 & 78.8 & 73.3 & 74.3 & 74.8 & 19.8 & 21.7 & 21.2 \\ \hline COX1 & 97.3 & 96.9 & 97.3 & 94.2 & 89.7 & 90.8 & 91.6 & 50.7 & 50.9 & 51.4 \\ \hline COX2 & 89.6 & 88.3 & 92.2 & 87.4 & 79.7 & 82.7 & 81.8 & 41.4 & 41.8 & 40.5 \\ \hline COX3 & 96.0 & 95.6 & 94.5 & 91.8 & 80.7 & 82.3 & 83.5 & 33.2 & 33.2 & 32.0 \\ \hline CYTB & 87.0 & 87.0 & 83.7 & 79.1 & 69.4 & 73.2 & 72.4 & 53.2 & 51.6 & 53.5 \\ \hline NAD1 & 84.4 & 84.4 & 84.8 & 74.4 & 69.3 & 69.6 & 69.5 & 48.4 & 52.3 & 50.1 \\ \hline NAD2 & 72.5 & 71.1 & 69.7 & 50.1 & 53.5 & 48.1 & 52.2 & 35.4 & 30.8 & 35.2 \\ \hline NAD3 & 81.9 & 81.9 & 75.6 & 67.5 & 64.8 & 67.5 & 63.9 & 38.3 & 37.5 & 39.2 \\ \hline NAD4 & 79.2 & 79.4 & 80.6 & 69.6 & 67.4 & 65.0 & 65.0 & 45.2 & 44.4 & 44.1 \\ \hline NAD4L & 93.5 & 93.5 & 92.2 & 65.8 & 71.4 & 68.8 & 64.9 & 30.3 & 37.5 & 33.7 \\ \hline NAD5 & 78.5 & 77.9 & 79.1 & 67.3 & 63.2 & 64.7 & 64.5 & 42.1 & 39.1 & 39.9 \\ \hline NAD6 & 67.3 & 70.1 & 70.8 & 48.6 & 58.3 & 57.6 & 52.7 & 27.8 & 28.4 & 29.8 \\ \hline rrnL & 83.4 & 82.6 & 80.2 & 73.9 & 69.2 & 70.1 & 67.5 & 63.9 & 62.8 & 61.6 \\ \hline rrnS & 86.8 & 85.6 & 86.0 & 75.6 & 74.5 & 71.2 & 70.6 & 61.1 & 61.3 & 60.5 \\ \hline \end{tabular}} \end{table}	PMC2656527_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Covariate} & \multicolumn{2}{\|l\|}{\textbf{All‑ cause mortality}} & \multicolumn{2}{\|l\|}{\textbf{Malaria specific mortality}} \\ \hline & \textbf{Post‑neonates HR (95\% CI)} & \textbf{Child (1–4 year HR (95\% CI)} & \textbf{Post‑neonates HR (95\% CI)} & \textbf{Child (1–4 year HR (95\% CI)} \\ \hline Constant & 0.05 (0.01, 0.80) & 0.04 (0.01, 0.5) & 0.02 (0.00, 0.03) & 0.05 (0.01, 0.37) \\ \hline Agea & 0.95 (0.83, 0.99) & 1.01 (0.96, 1.04) & 0.75 (0.41, 0.99) & 0.96 (0.89, 1.03) \\ \hline Log10 EIR & 4.89 (2.42, 6.93) & 5.35 (3.42, 7.86) & 3.45 (1.36, 5.44) & 4.54 (2.42, 7.56) \\ \hline ITN use & 0.75 (0.52, 0.97) & 0.96 (0.76, 1.16) & 0.80 (0.57, 1.10) & 0.98 (0.64, 1.25) \\ \hline Random error & 0.56 (0.17, 2.70) & 0.37 (0.16, 1.13) & 0.62 (0.18, 1.66) & 0.52 (0.17, 1.29) \\ \hline Spatial variation & 0.86 (0.18, 1.33) & 0.52 (0.17, 1.04) & 0.62 (0.18, 1.66) & 0.60 (0.18, 1.29) \\ \hline Temporal variation & 0.72 (0.21, 1.48) & 0.48 (0.18, 1.97) & 0.65 (0.19, 1.40) & 0.52 (0.18, 1.61) \\ \hline Spatial range (3/$\rho$)b & 11.10 (2.22, 34.41) & 17.76 (3.33, 39.96) & 26.64 (9.99, 41.07) & 27.75 (9.99, 41.07) \\ \hline \end{tabular}} \end{table}	PMC5774157_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline & \multicolumn{2}{\|l\|}{\textbf{Mean Amplitude (mV) (300–800 ms)}} & \multicolumn{2}{\|l\|}{\textbf{Peak Amplitude (mV) (jackknifed values)}} & \multicolumn{2}{\|l\|}{\textbf{Peak Latency (ms) (jackknifed values)}} \\ \hline \textbf{Condition} & \textbf{M} & \textbf{SE} & \textbf{M} & \textbf{SE} & \textbf{M} & \textbf{SE} \\ \hline Target Present Search & 21.33 & 0.40 & 22.20 & 0.06 & 704 & 0.5 \\ \hline Target Absent Search & 21.15 & 0.25 & 21.90 & 0.03 & 680 & 0.6 \\ \hline Change Detection & 21.43 & 0.32 & 21.96 & 0.05 & 536 & 9.4 \\ \hline \end{tabular}} \end{table}	PMC2777337_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline \textbf{Adverse event during treatment} & \textbf{Number of episodes} \\ \hline Nasal Discomfort/Pain due to catheter & 3 \\ \hline Nasal discomfort due to cooling & 2 \\ \hline Hypertension & 2 \\ \hline Mild epistaxis & 1 \\ \hline Discomfort due to excess fluid dripping from nose & 2 \\ \hline \multicolumn{2}{\|l\|}{Adverse Event Following Treatment} \\ \hline Transient recurrent sneezing & 2 \\ \hline Runny nose & 2 \\ \hline Strange taste & 1 \\ \hline Strange smell & 1 \\ \hline Dry eyes & 1 \\ \hline Dizziness & 1 \\ \hline Sinus pressure & 1 \\ \hline \end{tabular}} \end{table}	PMC4405521_table_5
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline \textbf{Species} & \textbf{Host(s)} \\ \hline Phytophthora capsici & Curcubits (e.g., Cucurbita pepo) \\ \hline Phytophthora infestans & Solanaceae (e.g., Solanum tuberosum) \\ \hline Phytophthora kernoviae & Fagus sylvatica, Rhododendron \\ \hline Phytophthora lateralis & Chamaecyparis lawsoniana \\ \hline Phytophthora parasitica & Broad range, including Nicotiana tabacum \\ \hline Phytophthora ramorum & Broad range, including Quercus, Rhododendron \\ \hline Phytophthora sojae & Glycine max \\ \hline Phytopythium vexans & Tropical forest species \\ \hline Pythium aphanidermatum & Broad range, virulent at higher temperatures \\ \hline Pythium arrhenomanes & Monocots \\ \hline Pythium irregulare & Broad range, virulent at lower temperatures \\ \hline Pythium iwayami & Monocots, virulent at lower temperatures \\ \hline Pythium ultimum var. sporangiiferum & Broad range \\ \hline Pythium ultimum var. ultimum & Broad range, virulent at higher temperatures \\ \hline \end{tabular}} \end{table}	PMC5023847_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline & \textbf{Infected patients} & \textbf{Control patients} \\ \hline Number of patients & 30 & 5 \\ \hline Age (years)a & 58.6 (23–86) & 52.6 (21–71) \\ \hline Gender (male/female) & 10/20 & 3/2 \\ \hline \multicolumn{3}{\|l\|}{Infection types} \\ \hline Bacterial & 8 & 0 \\ \hline Viral & 11 & 0 \\ \hline Bacteria–bacteria & 2 & 0 \\ \hline Virus–bacteria & 8 & 0 \\ \hline Virus–fungus & 1 & 0 \\ \hline \multicolumn{3}{\|l\|}{Severity and outcomes} \\ \hline APACHE III scoresa & 67 (36–128) & 57 (35–83) \\ \hline Length of ventilation (days)a & 8.7 (2–28) & 3.8 (1–8) \\ \hline Length of ICU stay (days)a & 11.5 (2–37) & 6 (2–11) \\ \hline Length of hospital stay (days)a & 16 (2–45) & 8.6 (2–16) \\ \hline Alive/dead & 22/8 & 5/0 \\ \hline \end{tabular}} \end{table}	PMC5904094_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Category} & \textbf{No. of Articles} & \textbf{\%} \\ \hline \multicolumn{3}{\|l\|}{Journal Type} \\ \hline General & 45 & 48\% \\ \hline Human & 40 & 43\% \\ \hline Animal & 7 & 8\% \\ \hline Plants & 1 & 1\% \\ \hline \multicolumn{3}{\|l\|}{Sector} \\ \hline Human & 53 & 57\% \\ \hline Animal & 27 & 29\% \\ \hline General & 13 & 14\% \\ \hline Plant & 0 & 0\% \\ \hline Environment & 0 & 0\% \\ \hline \multicolumn{3}{\|l\|}{Setting} \\ \hline Lab-based & 57 & 61\% \\ \hline Clinical/Facility-based & 25 & 27\% \\ \hline Urban community-based & 5 & 5\% \\ \hline Urban-Rural (mixed) community-based & 3 & 3\% \\ \hline Occupational & 2 & 2\% \\ \hline Rural community-based & 1 & 1\% \\ \hline \multicolumn{3}{\|l\|}{Species} \\ \hline Pathogen & 54 & 58\% \\ \hline Human & 32 & 34\% \\ \hline Dog & 6 & 6\% \\ \hline Multiple Animals & 1 & 1\% \\ \hline Plants & 0 & 0\% \\ \hline \multicolumn{3}{\|l\|}{Instruments of Health Research} \\ \hline Research for development of new interventions & 58 & 62\% \\ \hline Basic Epidemiologic Research & 26 & 28\% \\ \hline Research to improve existing interventions & 6 & 6\% \\ \hline Health policy and systems research & 3 & 3\% \\ \hline \multicolumn{3}{\|l\|}{Factorial} \\ \hline Genetic and Biological & 81 & 87\% \\ \hline Social, Political, Economic (including Epidemiology) & 12 & 13\% \\ \hline Physical and Environmental & 0 & 0\% \\ \hline Ecological & 0 & 0\% \\ \hline Grand Total & 93 & 100\% \\ \hline \end{tabular}} \end{table}	PMC3413711_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Mean age (years)} & \textbf{N} & \textbf{Type} & \textbf{C/C} & \textbf{C/G} & \textbf{G/G} & \textbf{Padd} & \textbf{Pdom} & \textbf{Prec} \\ \hline 7.6 & 6,013 & Systolic & 98.578 (8.550) & 98.644 (9.058) & 98.932 (9.259) & 0.275 & 0.731 & 0.265 \\ \hline & & Diastolic & 55.799 (5.592) & 56.409 (6.590) & 56.301 (6.665) & 0.986 & 0.358 & 0.749 \\ \hline 9.9 & 5,806 & Systolic & 102.821 (8.875) & 102.710 (9.280) & 102.710 (9.280) & 0.897 & 0.897 & 0.918 \\ \hline & & Diastolic & 57.959 (6.336) & 57.431 (6.357) & 57.359 (6.388) & 0.393 & 0.298 & 0.537 \\ \hline 11.8 & 5,378 & Systolic & 104.706 (10.054) & 105.494 (9.858) & 105.496 (9.810) & 0.660 & 0.386 & 0.832 \\ \hline & & Diastolic & 58.399 (6.155) & 58.899 (6.509) & 58.659 (6.585) & 0.452 & 0.594 & 0.309 \\ \hline 15.5 & 4,087 & Systolic & 122.208 (10.398) & 122.660 (10.928) & 123.098 (10.890) & 0.187 & 0.493 & 0.207 \\ \hline & & Diastolic & 67.609 (8.107) & 67.512 (8.946) & 67.412 (8.696) & 0.709 & 0.850 & 0.720 \\ \hline \end{tabular}} \end{table}	PMC4388908_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Breast Clinicopathological characteristics} & \textbf{Cancer} & \textbf{Fibroadenoma} & \textbf{Normal} \\ \hline Number of patients & 103 & 35 & 30 \\ \hline Median Patient Age yrs & 56 (35–90) & 44 (17–62) & 46.5 (24–58) \\ \hline \multicolumn{4}{\|l\|}{Menopausal Status} \\ \hline Post & 72 \\ \hline Pre & 32 \\ \hline \multicolumn{4}{\|l\|}{Histological Subtype} \\ \hline Invasive Ductal & 78 \\ \hline Invasive Lobular & 11 \\ \hline Other & 14 \\ \hline \multicolumn{4}{\|l\|}{Intrinsic Subtype} \\ \hline Luminal A (ER/PR+, HER2/neu-) & 42 \\ \hline Luminal B (ER/PR+, HER2/neu+) & 18 \\ \hline HER2 Over expressing (ER-, PR-, HER2/neu+) & 16 \\ \hline Triple-Negative (ER-, PR-, HER2/neu-) & 16 \\ \hline Unknown & 11 \\ \hline \multicolumn{4}{\|l\|}{Tumour Grade} \\ \hline 1 & 5 \\ \hline 2 & 32 \\ \hline 3 & 55 \\ \hline \multicolumn{4}{\|l\|}{Tumour size} \\ \hline 1 & 19 \\ \hline 2 & 39 \\ \hline 3 & 10 \\ \hline \multicolumn{4}{\|l\|}{UICC Stage} \\ \hline Stage 1 & 23 \\ \hline Stage 2 & 36 \\ \hline Stage 3 & 21 \\ \hline Stage 4 & 10 \\ \hline \end{tabular}} \end{table}	PMC4425901_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{Reference} & \textbf{Ph} & \textbf{Masking} & \textbf{Histology} & \textbf{No.} & \textbf{Treatment arms} \\ \hline \multicolumn{7}{\|l\|}{Nivolumab} \\ \hline 1 & Brahmer J. et al. (2015) & 3 & Open-label & NSCLC (Sq) & 272 & Nivolumab \\ \hline & & & & & & Docetaxel \\ \hline 2 & Borghaei H. et al. (2015) & 3 & Open-label & NSCLC (Non-Sq) & 582 & Nivolumab \\ \hline & & & & & & Docetaxel \\ \hline 3 & Motzer RJ. et al. (2015) & 3 & Open-label & Renal & 821 & Nivolumab \\ \hline & & & & & & Everolimus \\ \hline 4 & Ferris RL. et al. (2016) & 3 & Open-label & Head\&Neck & 361 & Nivolumab \\ \hline & & & & & & MTX/Docetaxel/Cetuximab \\ \hline 5 & Robert C. et al. (2015) & 3 & Double-blind & Melanoma & 418 & Nivolumab \\ \hline & & & & & & Dacarbazine \\ \hline 6 & Weber JS. et al. (2015) & 3 & Open-label & Melanoma & 405 & Nivolumab \\ \hline & & & & & & Chemotherapy \\ \hline \multicolumn{7}{\|l\|}{Pembrolizumab} \\ \hline 7 & Herbst RS. et al. (2016) & 2/3 & Open-label & NSCLC (PDL1 $>$ 1\%) & 1034 & Pembrolizumab 2 mg/Kg \\ \hline & & & & & & Pembrolizumab 10 mg/kg \\ \hline & & & & & & Docetaxel \\ \hline 8 & Ribas A. et al. (2015) & 2 & Open-label & Melanoma & 540 & Pembrolizumab 2 mg/kg \\ \hline & & & & & & Pembrolizumab 10 mg/kg \\ \hline & & & & & & Chemotherapy \\ \hline 9 & Reck M. et al. (2016) & 3 & Open-label & NSCLC (PDL1 $>$ 50\%) & 305 & Pembrolizumab \\ \hline & & & & & & Chemotherapy \\ \hline 10 & Bellmunt J. et al. (2017) & 3 & Open-label & Urothelial carcinoma & 542 & Pembrolizumab \\ \hline & & & & & & Docetaxel/Paclitaxel/ Vinflunine \\ \hline \multicolumn{7}{\|l\|}{Atezolizumab} \\ \hline 11 & Fehrenbacher L. et al. (2016) & 2 & Open-label & NSCLC & 287 & Atezolizumab \\ \hline & & & & & & Docetaxel \\ \hline 12 & Rittmeyer A. et al. (2016) & 3 & Open-label & NSCLC & 850 & Atezolizumab \\ \hline & & & & & & Docetaxel \\ \hline \end{tabular}} \end{table}	PMC5823578_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & & & & \multicolumn{4}{\|l\|}{\textbf{SIRS criteria}} \\ \hline \textbf{Dog} & \textbf{Age} & \textbf{Breed} & \textbf{Presenting Signs} & \textbf{HR (per min)} & \textbf{RR (per minute)} & \textbf{Body temperature (°C)} & \textbf{WBC ($\times$ 103/$\mu$L)} & \textbf{Diagnosis} \\ \hline 1 & 11 & Pug & Acute onset of respiratory distress following 24 h of treatment for presumed aspiration pneumonia & 60 & 60 & 37.2 & 27.3 & Respiratory failure secondary to aspiration pneumonia \\ \hline 2 & 2 & Mixed & Acute onset of respiratory distress with right-sided pneumothorax and small-volume pleural effusion & 84 & 60 & 39.4 & 22.0 & Bacterial pyothorax \\ \hline 3 & 9 & German Shepherd Dog & Chronic lethargy, inappetence and abdominal pain & 150 & 36 & 43.5 & 9.72 & Septic peritonitis due to gastric wall necrosis \\ \hline 4 & 8 & Brittany Spaniel & Intermittent productive cough & 114 & 30 & 38.9 & 18.3 & Chronic bronchitis \\ \hline 5 & 14 & Newfoundland & 1-week history of cough and abdominal swelling Atrial fibrillation & 240 & 40 & 38.1 & N/A & Congestive heart failure \\ \hline \end{tabular}} \end{table}	PMC6020318_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Temporal resolution} & \textbf{NTrans} & \textbf{200($\mu$s)/NTrans} & \textbf{NCS} \\ \hline T0 & 0$<$ NTrans $<$ = 10 & 20$\mu$s to 200$\mu$s & 10 \\ \hline T1 & 10$<$ NTrans $<$ = 100 & 2$\mu$s to 20$\mu$s & 35 \\ \hline T2 & 100$<$ NTrans $<$ = 1000 & 200ns to 2$\mu$s & 434 \\ \hline T3 & 1000$<$ NTrans $<$ = 10000 & 20ns to 200ns & 12967 \\ \hline T4 & 10000$<$ NTrans $<$ = 100000 & 2ns to 20ns & 40356 \\ \hline \end{tabular}} \end{table}	PMC4461368_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Class} & \textbf{Subclass} & \textbf{Number of gene families} & \textbf{Number of genes} & \textbf{Number of pseudogenes} \\ \hline ANTP & HOXL & 14 & 52 & 0 \\ \hline & NKL & 23 & 48 & 19b \\ \hline PRD & PAX & 3 & 7a & 0 \\ \hline & PAXL & 28 & 43 & 24c, d \\ \hline LIM & & 6 & 12 & 0 \\ \hline POU & & 7 & 16 & 8e \\ \hline HNF & & 2 & 3 & 0 \\ \hline SINE & & 3 & 6 & 0 \\ \hline TALE & & 6 & 20 & 10f \\ \hline CUT & & 3 & 7 & 3g \\ \hline PROS & & 1 & 2 & 0 \\ \hline ZF & & 5 & 14 & 1h \\ \hline CERS & & 1 & 5i & 0 \\ \hline Totals & & 102 & 235a & 65b-h \\ \hline \end{tabular}} \end{table}	PMC2211742_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Variables} & \textbf{B} & \textbf{b} & \textbf{t-statistic} & \textbf{p-value} \\ \hline Age & −0.113 & −0.021 & −1.80 & .0731 \\ \hline Education & −0.218 & −0.095 & −3.02 & .0028 \\ \hline Income & −0.063 & −0.038 & −0.73 & .4679 \\ \hline Married & 0.030 & 0.068 & 0.42 & .6753 \\ \hline Female sex & 0.070 & 0.160 & 0.75 & .4528 \\ \hline African American Race & −0.046 & −0.106 & −0.49 & .6234 \\ \hline African American Race x Female sex Interaction & 0.036 & 0.091 & 0.32 & .7486 \\ \hline Heart Disease & 0.187 & 0.214 & 3.09 & .0023 \\ \hline Musculoskeletal Conditions & 0.187 & 0.214 & 2.83 & .0050 \\ \hline Microvascular Diseases & 0.169 & 0.193 & 2.77 & .0061 \\ \hline \end{tabular}} \end{table}	PMC5663150_table_3
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{MacoNPV- B} & \multicolumn{5}{\|l\|}{\textbf{Homologoues (\% aa identity)}} \\ \hline & \textbf{ORF54} & \textbf{ORF55} & \textbf{ORF56} & \textbf{ORF57} & \textbf{ORF58} \\ \hline XecnGV & ORF65(98) & ORF64(98) & ORF62(93) & ORF61(98) & ORF131(84) ORF60(60) \\ \hline HearGV & ORF60(94) & ORF59(94) & ORF58(55) & ORF57(94) & ORF133(89) ORF54(50) \\ \hline \end{tabular}} \end{table}	PMC3545888_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{OMIM} & \textbf{GAD} & \textbf{MSigDB} & \textbf{GeneSigDB} & \textbf{miRecords} & \textbf{HPD} & \textbf{HAPPI*} \\ \hline OMIM & 9012 & 1862 & 3489 & 2792 & 231 & 2559 & 3849 \\ \hline GAD & & 7293 & 6821 & 6450 & 432 & 3202 & 4922 \\ \hline MSigDB & & & 30525 & 17209 & 759 & 6229 & 10677 \\ \hline GeneSigDB & & & & 36791 & 900 & 5904 & 10395 \\ \hline miRecords & & & & & 1395 & 443 & 725 \\ \hline HPD & & & & & & 12228 & 10512 \\ \hline HAPPI & & & & & & & 21955 \\ \hline \end{tabular}} \end{table}	PMC3439733_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & \multicolumn{8}{\|l\|}{\textbf{S. Typhimurium (\% of total S. Typhimurium, n = 114)}} & \multicolumn{4}{\|l\|}{\textbf{S. Enteritidis (\% of total S. Enteritidis, n = 78)}} & \textbf{Total (\% of total NTS)} \\ \hline & \textbf{blood} & \textbf{Stool} & \textbf{blood \& stool} & \textbf{urine} & \textbf{CSF} & \textbf{Soil} & \textbf{Sewer water} & \textbf{ND} & \textbf{blood} & \textbf{Stool} & \textbf{blood \& stool} & \textbf{ND} \\ \hline Invasive & 48 (42\%) & − & 7 (6\%) & 3 (3\%) & 2 (2\%) & − & − & & 22 (28\%) & − & 5 (6\%) & − & 87 (45\%) \\ \hline Gastrointestinal & − & 24 (21\%) & − & − & − & − & − & − & − & 32 (41\%) & − & − & 56 (29\%) \\ \hline Healthy carriers & − & 21 (18\%) & − & − & − & − & − & − & − & 10 (13\%) & − & − & 31 (16\%) \\ \hline Environmental & − & − & − & − & − & 1 (1\%) & 1 (1\%) & − & − & − & − & − & 2 (1\%) \\ \hline ND & − & − & − & − & − & − & − & 7 (6\%) & − & − & − & 9 (12\%) & 16 (8\%) \\ \hline Total & \multicolumn{8}{\|l\|}{114} & \multicolumn{4}{\|l\|}{78} & 192 \\ \hline \end{tabular}} \end{table}	PMC4352093_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & & \multicolumn{4}{\|l\|}{\textbf{P. falciparum}} & \multicolumn{4}{\|l\|}{\textbf{P. vivax}} \\ \hline & & \textbf{GMD} & \textbf{$\beta$} & \textbf{95\% CI} & \textbf{P-value} & \textbf{GMD} & \textbf{$\beta$} & \textbf{95\% CI} & \textbf{P-value} \\ \hline Gene copies/$\mu$L (log) & & & 0.13 & [0.02, 0.24] & 0.022 & & 0.57 & [0.43, 0.72] & $<$0.001 \\ \hline Age group & 0–3 & 21.1 & 0 & & $<$0.001 & 10.5 & 0 & & 0.026 \\ \hline & $>$3–6 & 15.2 & -0.46 & [-1.14, 0.21] & & 2.8 & -0.47 & [-0.81, -0.13] \\ \hline & $>$6–9 & 2.8 & -1.04 & [-1.70, -0.39] & & 2.0 & -0.23 & [-0.57, 0.11] \\ \hline & $>$9–12 & 8.9 & -1.06 & [-1.77, -0.35] & & 1.8 & -0.55 & [-0.97, -0.13] \\ \hline & $>$12–20 & 5.0 & -1.31 & [-2.00, -0.63] & & 1.9 & -0.45 & [-0.90, -0.00] \\ \hline & $>$20 & 3.2 & -1.39 & [-2.05, -0.74] & & 1.9 & -0.55 & [-0.95, -0.16] \\ \hline Malaria last 2 weeks & Yes & 28.3 & 0.94 & [0.48, 1.40] & $<$0.001 & 61.9 & & & NS \\ \hline & No & 4.3 & & & & 2.5 \\ \hline Intercept & & & 0.53 & [-0.15, 1.20] & & & -0.46 & [-0.88, -0.04] & 0.032 \\ \hline \end{tabular}} \end{table}	PMC4440770_table_3
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & & \multicolumn{3}{\|l\|}{\textbf{Men}} & \multicolumn{3}{\|l\|}{\textbf{Women}} \\ \hline & & \textbf{Control n = 99} & \textbf{Exposed n = 115} & \textbf{P- value} & \textbf{Control n = 80} & \textbf{Exposed n = 108} & \textbf{P-value} \\ \hline Age & AM (SD)a & 48.3 (14.3) & 48.2 (17.5) & 0.95b & 47.2 (14.9) & 45.3 (15.9) & 0.42b \\ \hline At work & n (\%) & 81 (82) & 84 (73) & 0.13c & 61 (76) & 77 (71) & 0.45c \\ \hline Sick leave/rehabilitation & n (\%) & 0 (0) & 3 (3) & - & 7 (9) & 8 (7) & 0.74c \\ \hline Disability pension & n (\%) & 5 (5) & 8 (7) & 0.78c & 6 (8) & 6 (6) & 0.76c \\ \hline Retirement pension & n (\%) & 9 (9) & 18 (16) & 0.15c & 7 (9) & 13 (12) & 0.47c \\ \hline Student & n (\%) & 5 (5) & 3 (3) & 0.48c & 7 (9) & 11 (10) & 0.74c \\ \hline Others & n (\%) & 0 (0) & 0 (0) & - & 0 (0) & 2 (2) & - \\ \hline Years of education after lower secondary school & Med (Q1,Q3)d & 3 (1, 4.5) & 3 (1, 4) & 0.34f & 3 (2, 6) & 3 (2, 5) & 0.45f \\ \hline High occupational exposure & n (\%) & 37 (38) & 37 (32) & 0.39c & 4 (5) & 11 (10) & 0.20c \\ \hline \multicolumn{8}{\|l\|}{Smoking status} \\ \hline Present smoking & n (\%) & 25 (25) & 34 (30) & 0.54c & 11 (14) & 28 (26) & 0.047c \\ \hline Years & Med (Q1,Q3)d & 22 (14, 30) & 20 (10, 37) & 0.98f & 20 (20, 35) & 22 (10, 30) & 0.99f \\ \hline Present cigarettes pr day & Med (Q1,Q3)d & 10 (9) & 12 (5) & 0.37f & 10 (9) & 10 (5) & 0.82f \\ \hline Earlier smoked & n (\%) & 39 (39) & 40 (35) & 0.74c & 30 (38) & 31 (35) & 0.56c \\ \hline Years & Med (Q1,Q3)d & 15 (10, 22) & 18 (10, 30) & 0.62f & 15 (5, 20) & 10 (8, 18) & 0.71f \\ \hline Never smoked & n (\%) & 33 (33) & 41 (36) & 0,84c & 37 (46) & 48 (44) & 0,28c \\ \hline Cats or dogs at home & n (\%) & 39 (39) & 46 (40) & 0.62c & 34 (43) & 50 (46) & 0.61c \\ \hline Building moisture at home & n (\%) & 8 (8) & 8 (7) & 0.90c & 4 (5) & 9 (8) & 0.79c \\ \hline Floor carpets at home & n (\%) & 3 (3) & 2 (2) & 0,66e & 4 (5) & 2 (2) & 0.40e \\ \hline Infection in the preceding month & n (\%) & 36 (37) & 33 (29) & 0.23c & 25 (31) & 39 (36) & 0.46c \\ \hline Impact score $>$ =22 & n (\%) & 0 (0) & 11 (10) & - & 1(1) & 10 (9) & 0.026e \\ \hline Height (m) & AM (SD)a & 1,79 (0,06) & 1,79 (0,05) & 0.71b & 1,67 (0,05) & 1,66 (0,06) & 0.32b \\ \hline Body mass index (kg/m2) & AM (SD)a & 26.5 (3.7) & 26.9 (4.0) & 0.52b & 27.6 (5.5) & 26.3 (6.4) & 0.14b \\ \hline PhadiatopW positive & n (\%) & 31 (31) & 22 (19) & 0.046c & 15 (19) & 25 (23) & 0.45c \\ \hline \end{tabular}} \end{table}	PMC3549740_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Edge} & \textbf{Weight} & \textbf{Reference for weight} \\ \hline CDR & 1.0 & Ratio of CDR:FR mutations \\ \hline FR & 0.79 \\ \hline CDR - exposed & 0.78 & Ratio of buried:exposed CDR mutations \\ \hline CDR - buried & 1.0 \\ \hline FR - exposed & 1.0 & Ratio of buried:exposed FR mutations \\ \hline FR - buried & 0.85 \\ \hline CDR - exposed - $\Delta$ & 0.69 & Ratio of mutations increasing ($\Delta$) sheet-forming propensities to mutations decreasing (▽) sheet-forming propensities in exposed CDR residues \\ \hline CDR - exposed - ▽ & 0.31 \\ \hline CDR - buried - $\Delta$ & 1.00 & Ratio of mutations increasing ($\Delta$) sheet-forming propensities to mutations decreasing (▽) sheet-forming propensities in buried CDR residues \\ \hline CDR - buried - ▽ & 0.76 \\ \hline FR - exposed - $\Delta$ & 1.00 & Ratio of mutations increasing ($\Delta$) sheet-forming propensities to mutations decreasing (▽) sheet-forming propensities in exposed FR residues \\ \hline FR - exposed - ▽ & 0.95 \\ \hline FR - buried - $\Delta$ & 0.74 & Ratio of mutations increasing ($\Delta$) sheet-forming propensities to mutations decreasing (▽) sheet-forming propensities in buried FR residues \\ \hline FR - buried –▽ & 0.43 \\ \hline \end{tabular}} \end{table}	PMC3098112_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline \multicolumn{2}{\|l\|}{\textbf{HBeAg-positive CHB patients}} \\ \hline \textbf{Factors} & \textbf{points} \\ \hline \multicolumn{2}{\|l\|}{Model A} \\ \hline HBsAg $<$ 250 IU/mL & 1 \\ \hline HBV DNA $<$ 2.5 $\times$ 107 IU/mL & 1 \\ \hline \multicolumn{2}{\|l\|}{Model B} \\ \hline HBsAg $<$ 250 IU/mL & 2 \\ \hline HBV DNA $<$ 2.5 $\times$ 107 IU/mL & 2 \\ \hline ALT $\geq$ 200 U/L & 1 \\ \hline \end{tabular}} \end{table}	PMC4941731_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline & & \textbf{N} & \textbf{Ne} & \textbf{H} & \textbf{He} \\ \hline MCL1 & real time RT-PCR & 1 & 2.97 & 5.53 & 8.24 \\ \hline & DNA microarray & 1 & 3.44 & 3.92 & 5.27 \\ \hline BAK 1 & real time RT-PCR & 1 & 3.37 & 0.96 & 2.92 \\ \hline & DNA microarray & 1 & 3.42 & 0.75 & 2.13 \\ \hline GPX1 & real time RT-PCR & 1 & 4.04 & 0.94 & 2.21 \\ \hline & DNA microarray & 1 & 2.88 & 0.69 & 1.43 \\ \hline CDKN1A & real time RT-PCR & 1 & 3.65 & 0.72 & 2.44 \\ \hline & DNA microarray & 1 & 3.02 & 0.52 & 1.64 \\ \hline JUN & real time RT-PCR & 1 & 1.45 & 5.54 & 4.36 \\ \hline & DNA microarray & 1 & 1.66 & 2.33 & 3.28 \\ \hline \end{tabular}} \end{table}	PMC2330149_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Cases} & \textbf{Pearson r (x-axis)} & \textbf{Pearson r (y-axis)} & \textbf{ROM in automatic tracking (x- axis)} & \textbf{ROM in manual tracking (x-axis)} & \textbf{Relative errors \% (x-axis)} & \textbf{ROM in automatic tracking (y- axis)} & \textbf{ROM in manual tracking (y-axis)} & \textbf{Relative errors \% (y-axis)} & \textbf{ROM in automatic tracking (2D)} & \textbf{ROM in manual tracking (2D)} & \textbf{Relative errors \% (2D)} \\ \hline \multicolumn{12}{\|l\|}{Unmasked group (10 loops from 8 trajectories)} \\ \hline Raw & 0.982 & 0.982 & 55.22$\pm$15.06 & 57.57 $\pm$13.87 & 6.1$\pm$4.7 & 53.96$\pm$26.69 & 55.77 $\pm$26.49 & 6.5$\pm$4.7 & 70.72$\pm$23.31 & 72.67 $\pm$23.45 & 5.6$\pm$4.1 \\ \hline RawNC & 0.977 & 0.954 & 54.98$\pm$16.21 & 56.87 $\pm$14.58 & 8.7$\pm$5.0 & 55.06$\pm$27.24 & 56.39 $\pm$25.27 & 6.5$\pm$4.5 & 71.50$\pm$23.65 & 72.54 $\pm$22.45 & 5.9$\pm$3.9 \\ \hline RawNCC & 0.977 & 0.958 & 0.27$\pm$0.10 & 0.29$\pm$0.11 & 9.2$\pm$6.6 & 0.27$\pm$0.18 & 0.29$\pm$0.18 & 8.6$\pm$6.0 & 0.36$\pm$0.17 & 0.38$\pm$0.18 & 6.9$\pm$4.8 \\ \hline Smo & 0.991 & 0.990 & 55.01$\pm$15.01 & 55.00 $\pm$14.63 & 4.8$\pm$3.8 & 53.16$\pm$26.53 & 53.12 $\pm$26.55 & 4.6$\pm$3.1 & 70.53$\pm$22.80 & 69.88 $\pm$23.62 & 4.6$\pm$3.4 \\ \hline SmoNC & 0.984 & 0.967 & 54.49$\pm$16.19 & 53.58 $\pm$14.41 & 6.5$\pm$4.6 & 53.95$\pm$26.96 & 53.67 $\pm$25.97 & 4.8$\pm$4.6 & 71.35$\pm$23.33 & 69.90 $\pm$23.12 & 4.8$\pm$3.9 \\ \hline SmoNCC & 0.984 & 0.971 & 0.27$\pm$0.10 & 0.28$\pm$0.11 & 7.6$\pm$5.4 & 0.27$\pm$0.17 & 0.28$\pm$0.18 & 5.4$\pm$4.6 & 0.36$\pm$0.17 & 0.37$\pm$0.18 & 5.4$\pm$3.3 \\ \hline \multicolumn{12}{\|l\|}{Masked group (10 loops from 9 trajectories)} \\ \hline Raw & 0.975 & 0.965 & 56.23$\pm$22.04 & 58.44 $\pm$22.34 & 6.1$\pm$5.1 & 41.80$\pm$16.06 & 43.01 $\pm$15.89 & 5.0$\pm$4.3 & 63.80$\pm$22.52 & 65.89 $\pm$23.32 & 5.3$\pm$5.8 \\ \hline RawNC & 0.972 & 0.946 & 56.00$\pm$18.39 & 57.30 $\pm$16.89 & 7.3$\pm$6.5 & 41.63$\pm$15.46 & 43.48 $\pm$15.32 & 8.5$\pm$7.8 & 64.01$\pm$21.30 & 64.24 $\pm$18.38 & 6.4$\pm$5.4 \\ \hline RawNCC & 0.969 & 0.942 & 0.31$\pm$0.13 & 0.33$\pm$0.14 & 8.6$\pm$7.6 & 0.22$\pm$0.10 & 0.23$\pm$0.11 & 7.1$\pm$6.5 & 0.356$\pm$0.14 & 0.36$\pm$0.14 & 6.0$\pm$6.2 \\ \hline Smo & 0.982 & 0.978 & 55.50$\pm$22.41 & 56.11 $\pm$22.00 & 4.3$\pm$4.0 & 40.66$\pm$16.43 & 41.03 $\pm$15.51 & 3.3$\pm$4.1 & 62.68$\pm$22.46 & 63.53 $\pm$22.73 & 4.1$\pm$4.7 \\ \hline SmoNC & 0.979 & 0.961 & 55.14$\pm$18.49 & 55.37 $\pm$17.23 & 5.0$\pm$5.6 & 40.35$\pm$15.89 & 41.67 $\pm$15.03 & 6.9$\pm$7.1 & 63.12$\pm$21.44 & 62.56 $\pm$18.48 & 6.2$\pm$4.3 \\ \hline SmoNCC & 0.975 & 0.957 & 0.31$\pm$0.13 & 0.32$\pm$0.14 & 6.8$\pm$6.9 & 0.21$\pm$0.10 & 0.22$\pm$0.10 & 5.8$\pm$6.0 & 0.35$\pm$0.15 & 0.35$\pm$0.14 & 5.5$\pm$4.9 \\ \hline \end{tabular}} \end{table}	PMC5705154_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Adverse events} & \textbf{Paccagnella et al. 201018} & \textbf{Chen et al. 201119} & \textbf{Haddad et al. 201320} & \textbf{Cohen et al. 201421} & \textbf{Hitt et al. 201422} & \textbf{Incidence (\%)} \\ \hline \multicolumn{7}{\|l\|}{Haematologic} \\ \hline Anemia & NR & NR & NR & 1/136 & 4/153 & 1.73\% \\ \hline Thrombocytopenia & NR & NR & NR & 4/136 & 5/153 & 3.11\% \\ \hline Neutropenia & NR & NR & NR & 15/136 & 29/153 & 15.22\% \\ \hline Febrile neutropenia & NR & NR & NR & NR & 26/153 & 16.99\% \\ \hline Leukopenia & NR & NR & NR & 38/136 & 24/153 & 21.45\% \\ \hline \multicolumn{7}{\|l\|}{Non-haematologic} \\ \hline Fatigue & NR & NR & NR & 10/136 & 16/153 & 9.00\% \\ \hline Nausea/Vomiting & NR & NR & NR & 8/136 & 15/153 & 7.96\% \\ \hline Mucositis & NR & NR & NR & 21/136 & 14/153 & 12.11\% \\ \hline Pain & NR & NR & NR & 2/136 & NR & 1.47\% \\ \hline Dysphagia & NR & NR & NR & 4/136 & 2/153 & 2.08\% \\ \hline Anorexia & NR & NR & NR & 10/136 & NR & 7.35\% \\ \hline \end{tabular}} \end{table}	PMC4455182_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Patient characteristics} & \multicolumn{3}{\|l\|}{\textbf{Group}} & \textbf{P-value} \\ \hline & \textbf{Faculty physician (\%)} & \textbf{General doctor (\%)} & \textbf{Resident (\%)} \\ \hline Mean age (SD), years & 50.39 (15.65) & 49.32 (15.86) & 49.55 (15.39) & 0.07 \\ \hline \multicolumn{5}{\|l\|}{Sex} \\ \hline Male & 233 (30.50) & 92 (24.90) & 249 (31.50) & 0.07 \\ \hline Female & 530 (69.50) & 277 (75.10) & 542 (68.50) \\ \hline \multicolumn{5}{\|l\|}{Status of patients} \\ \hline New patients & 113 (14.50) & 75 (16.40) & 235 (36.70) & 0.00 \\ \hline Existing patients & 665 (85.50) & 382 (83.60) & 405 (63.30) \\ \hline \multicolumn{5}{\|l\|}{Funding of patient} \\ \hline Universal coverage & 37 (4.70) & 8 (1.80) & 30 (4.70) & 0.10 \\ \hline Social welfare & 62 (7.90) & 38 (8.40) & 38 (5.90) \\ \hline Government welfare & 416 (53.10) & 248 (54.70) & 294 (45.80) \\ \hline Self-payment & 269 (34.30) & 159 (35.10) & 280 (43.60) \\ \hline \multicolumn{5}{\|l\|}{Chronic illness} \\ \hline yes & 259 (35.60) & 141 (33.30) & 199 (34.40) & 0.68 \\ \hline no & 469 (64.40) & 286 (66.70) & 379 (65.60) \\ \hline \multicolumn{5}{\|l\|}{Accommodation} \\ \hline Owner & 566 (72.80) & 322 (72.20) & 436 (69.40) & 0.36 \\ \hline Renting & 212 (27.20) & 124 (27.80) & 192 (30.60) \\ \hline \multicolumn{5}{\|l\|}{Occupation} \\ \hline Business owner & 51 (7.10) & 33 (7.90) & 40 (7.0) & 0.47 \\ \hline Employee & 155 (21.70) & 98 (23.30) & 154 (27.00) \\ \hline Government worker & 121 (16.90) & 81 (19.30) & 95 (16.60) \\ \hline Student & 39 (5.50) & 20 (4.80) & 33 (5.80) \\ \hline Housewife & 234 (32.80) & 134 (31.90) & 167 (29.20) \\ \hline Unemployed & 5 (0.70) & 1 (0.20) & 7 (1.20) \\ \hline Disabled & 14 (2.00) & 10 (2.40) & 15 (2.60) \\ \hline Retired & 95 (13.30) & 43 (10.20) & 60 (10.50) \\ \hline \multicolumn{5}{\|l\|}{Income (Baht/month)} \\ \hline $<$ 5,000 & 50 (14.20) & 68 (21.20) & 33 (15.20) & 0.13 \\ \hline 5,001–10,000 & 113 (32.10) & 106 (33.00) & 66 (30.40) \\ \hline 10,001–30,000 & 160 (45.50) & 131 (40.80) & 108 (49.80) \\ \hline 30,001–50,000 & 21 (6.00) & 11 (3.40) & 6 (2.80) \\ \hline $>$50,000 & 8 (2.30) & 5 (1.60) & 4 (1.80) \\ \hline \end{tabular}} \end{table}	PMC1852109_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline C13H12N2OS & F(000) = 512 \\ \hline Mr = 244.31 & Dx = 1.340 Mg m−3 \\ \hline Monoclinic, P21/c & Mo K$\alpha$ radiation, $\lambda$ = 0.71073 Å \\ \hline Hall symbol: -P 2ybc & Cell parameters from 1759 reflections \\ \hline a = 14.920 (3) Å & $\theta$ = 27.5–3.4° \\ \hline b = 5.3976 (11) Å & µ = 0.25 mm−1 \\ \hline c = 15.636 (3) Å & T = 293 K \\ \hline $\beta$ = 105.87 (3)° & Block, colorless \\ \hline V = 1211.2 (4) Å3 & 0.22 $\times$ 0.20 $\times$ 0.18 mm \\ \hline Z = 4 \\ \hline \end{tabular}} \end{table}	PMC2979519_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Classification} & \multicolumn{6}{\|l\|}{\textbf{Percentage of total sequences1 Treatment2}} & \textbf{Effect} & \textbf{SEM} & \textbf{P-value4} \\ \hline \\ \hline & \multicolumn{2}{\|l\|}{\textbf{Control}} & \multicolumn{2}{\|l\|}{\textbf{Powder}} & \multicolumn{2}{\|l\|}{\textbf{Tablet}} \\ \hline & \multicolumn{6}{\|l\|}{\textbf{Fescue Seed3}} \\ \hline & \textbf{E+} & \textbf{E-} & \textbf{E+} & \textbf{E-} & \textbf{E+} & \textbf{E-} \\ \hline Actinomycetales_unclassified & 0.0011b & NDb & 0.013ab & 0.0027b & 0.012ab & 0.019a & Treatment & 0.0047 & 0.018 \\ \hline Alphaproteobacteria_unclassified & 0.012bc & 0.017abc & 0.0255ab & NDc & 0.0203abc & 0.037a & Seed $\times$ Treatment & 0.0071 & 0.020 \\ \hline Anaeroplasma & 0.054ab & 0.067ab & 0.0233b & 0.075ab & 0.044b & 0.108a & Seed $\times$ Treatment & 0.019 & 0.037 \\ \hline Anaerovibrio & 0.074bc & 0.014c & 0.244a & 0.104bc & 0.158ab & 0.096bc & Seed & 0.0447 & 0.027 \\ \hline Arcobacter & 0.928bc & 0.277c & 1.44b & 2.34a & 1.39b & 0.574bc & Seed $\times$ Treatment & 0.2937 & 0.015 \\ \hline Bacteria_unclassified & 4.06b & 5.56a & 5.54a & 4.16ab & 4.23ab & 5.49ab & Seed $\times$ Treatment & 0.4920 & 0.015 \\ \hline Bacteroidetes_unclassified & 8.77d & 13.96a & 12.62ab & 10.11cd & 11.26bc & 11.58abc & Seed $\times$ Treatment & 0.8247 & 0.001 \\ \hline Bulleidia & 0.079b & 0.21a & 0.11b & 0.12b & 0.086b & 0.096b & Seed $\times$ Treatment & 0.0219 & 0.019 \\ \hline Christensenellaceae_unclassified & 0.81b & 1.61a & 0.742b & 0.801b & 0.721b & 0.941b & Seed & 0.1092 & 0.031 \\ \hline Clostridiales_unclassified & 3.33b & 5.60a & 4.18ab & 3.92b & 3.22b & 3.98b & Seed $\times$ Treatment & 0.2961 & 0.039 \\ \hline Corynebacterium & 0.041c & 0.065bc & 0.131a & 0.109ab & 0.066bc & 0.076bc & Seed & 0.0014 & 0.009 \\ \hline Endomicrobia_unclassified & NDb & 0.0115a & NDb & 0.0015b & 0.0015b & 0.0056ab & Seed $\times$ Treatment & 0.0024 & 0.007 \\ \hline Gammaproteobacteria_unclassified & 0.018cd & 0.06ab & 0.056abc & 0.013d & 0.043bcd & 0.083a & Seed $\times$ Treatment & 0.0152 & 0.006 \\ \hline Megasphaera & 0.117a & 0.018b & 0.0411b & 0.0431b & 0.0344b & 0.0286b & Seed $\times$ Treatment & 0.0502 & 0.008 \\ \hline Methylobacillus & ND & 0.0014 & 0.0043 & 0.0042 & ND & ND & Treatment & 0.0051 & 0.020 \\ \hline ML615J.28_unclassified & 0.027b & 0.065b & 0.109b & 0.123b & 0.123b & 0.456a & Treatment & 0.3030 & 0.009 \\ \hline Moraxella & 0.0092ab & 0.0012b & 0.0142ab & 0.0029b & 0.027a & 0.0088ab & Seed & 0.0038 & 0.030 \\ \hline Olsenella & 0.0292b & 0.148a & 0.053b & 0.038b & 0.034b & 0.039b & Seed $\times$ Treatment & 0.0233 & 0.021 \\ \hline p.75.a5 & 0.028c & 0.103a & 0.047bc & 0.071ab & 0.063abc & 0.071ab & Seed & 0.0134 & 0.004 \\ \hline Peptoniphilus & 0.0069ab & NDb & NDb & 0.0146a & 0.0063ab & 0.0044b & Seed $\times$ Treatment & 0.0033 & 0.011 \\ \hline Peptostreptococcaceae_unclassified & 0.0578a & 0.0088c & 0.0024c & 0.0278bc & 0.0373ab & 0.0162bc & Seed $\times$ Treatment & 0.0094 & 0.003 \\ \hline Pirellulaceae_unclassified & 0.066b & 0.196a & 0.0811b & 0.125ab & 0.0677b & 0.103ab & Seed & 0.0192 & 0.019 \\ \hline Planococcaceae_unclassified & 0.095a & 0.0014b & 0.0044b & 0.0118b & 0.007b & 0.0136b & Seed $\times$ Treatment & 0.0168 & 0.010 \\ \hline Proteiniclasticum & 1.45ab & 0.223c & 2.25a & 1.29b & 1.27b & 1.35ab & Seed & 0.1770 & 0.011 \\ \hline Proteiniphilum & 0.097ab & 0.027ab & 0.0203ab & 0.0069b & 0.124a & 0.0148b & Seed & 0.0203 & 0.037 \\ \hline Proteobacteria_unclassified & 0.157b & 0.196b & 0.272ab & 0.192b & 0.263ab & 0.378a & Treatment & 0.0332 & 0.021 \\ \hline Pseudobutyrivibrio & 0.496bc & 0.237c & 1.11ab & 0.831abc & 1.24a & 0.681abc & Treatment & 0.1568 & 0.020 \\ \hline Ruminococcaceae_unclassified & 2.18cd & 3.45a & 2.75b & 2.04d & 2.20cd & 2.66bc & Seed $\times$ Treatment & 0.1852 & 0.002 \\ \hline Schwartzia & 0.0334bc & 0.0087c & 0.0766ab & 0.079a & 0.065ab & 0.060ab & Treatment & 0.0108 & 0.004 \\ \hline Selenomonas & 0.219bc & 0.159c & 0.459abc & 0.629a & 0.543ab & 0.514ab & Treatment & 0.0842 & 0.012 \\ \hline SR1_unclassified & 0.230bc & 0.0901c & 0.903ab & 0.950a & 0.954a & 0.607abc & Treatment & 0.236 & 0.0104 \\ \hline Succiniclasticum & 0.672b & 1.67a & 0.662b & 0.774b & 0.627b & 0.632b & Seed $\times$ Treatment & 0.191 & 0.0349 \\ \hline Succinivibrio & 0.002b & 0.014a & NDb & 0.004ab & 0.0015b & 0.0088ab & Seed & 0.1670 & 0.027 \\ \hline Tenericutes_unclassified & 1.21cd & 1.01d & 2.43a & 1.32bcd & 2.14ab & 2.07abc & Seed & 0.2967 & 0.008 \\ \hline Treponema & 0.0078a & NDb & NDb & 0.0028b & NDb & 0.0031b & Seed $\times$ Treatment & 0.0011 & $<$ 0.001 \\ \hline Wautersiella & 0.445b & 0.797b & 0.865ab & 0.709b & 0.722b & 1.31a & Seed $\times$ Treatment & 0.153 & $<$ 0.001 \\ \hline \end{tabular}} \end{table}	PMC6193618_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline & & \textbf{Frequency, person} & \textbf{Proportion, \%} & \textbf{Age, years old (SD)} \\ \hline Gender & Male & 49 & 40.8 & 61 (10.9) \\ \hline & Female & 71 & 59.2 & 62 (12.1) \\ \hline Facility & Field & 56 & 46.7 & 65 (10.7) \\ \hline & PVC greenhouse & 64 & 53.3 & 59 (11.9) \\ \hline Crops & Chili & 27 & 22.5 & 60 (11.8) \\ \hline & Lettuce & 6 & 5.0 & 62 (15.9) \\ \hline & Apple & 9 & 7.5 & 64 (8.9) \\ \hline & Oriental melon & 46 & 38.3 & 57 (11.0) \\ \hline & Weed scraping & 10 & 8.3 & 68 (8.6) \\ \hline & Flower & 6 & 5.0 & 73 (3.5) \\ \hline & Othersa & 16 & 13.3 & 69 (8.9) \\ \hline \end{tabular}} \end{table}	PMC4640324_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Vegetation} & \textbf{Camera height (m)} & \multicolumn{2}{\|l\|}{\textbf{Time-lapse camera}} & \multicolumn{2}{\|l\|}{\textbf{Motion-activated camera}} \\ \hline & & \textbf{Total no. imagesa} & \textbf{No. sheep visits} & \textbf{No. sheep visits detected} & \textbf{False negative records (\%)b} \\ \hline Short grass & 1.2 & 181 & 95 & 30 & 68 \\ \hline Tall heather & 0.6 & 181 & 71 & 27 & 62 \\ \hline Tall heather & 1.2 & 181 & 71 & 36 & 49 \\ \hline \end{tabular}} \end{table}	PMC4623860_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline Center for Computational Research at SUNY Buffalo & http://www.ccr.buffalo.edu/display/WEB/Outreach \\ \hline Cold Spring Harbor Laboratory Dolan Learning Center & http://www.dnalc.org/programs/fieldtrips/hsbioinform.html \\ \hline CusMiBio, University of Milan, Italy [9] & http://www.cusmibio.unimi.it/english03.html \\ \hline Harvard University Life Sciences/HHMI (see MicrobiologyR Lesson PlansRRecreating the Tree of Life Using Bioinformatics) & http://outreach.mcb.harvard.edu/materials.htm \\ \hline International Society for Computational Biology & http://www.iscb.org/high-schoolsecondary-school-resources \\ \hline Netherlands Bioinformatics Centre & http://www.bioinformaticsatschool.eu/ \\ \hline Northwest Association for Biomedical Research & http://www.nwabr.org/education/itest.html \\ \hline University of British Columbia: The Educational Facilities of the Michael Smith Labs & http://www.bioteach.ubc.ca/tag/bioinformatics/ http://www.bioteach.ubc.ca/genetics-fieldtrips/ \\ \hline Washington University Saint Louis Science Outreach & http://www.so.wustl.edu/ \\ \hline Whitehead Institute Bioinformatics Education Page & http://jura.wi.mit.edu/bio/education/ \\ \hline \end{tabular}} \end{table}	PMC3203059_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline & \textbf{CuO} & \textbf{TiO2} \\ \hline Shape & spheroid & spheroid \\ \hline size of primary particles (TEM) & 22$\pm$5 nm & 25$\pm$10 nm \\ \hline & 70$\pm$27 nm \\ \hline zeta potential & +3.3 mV & -11.3 mV \\ \hline XRD & conform & Anatase \\ \hline crystaline domain size (XRD) & ca.18 nm & ca.26 nm \\ \hline average size (diameter) in water (DLS)* & 210$\pm$ 20 nm & 80$\pm$10 nm \\ \hline average size (diameter) in water (DLS)† & 250 $\pm$ 17 nm & 130$\pm$10 nm \\ \hline average size (diameter) in culture medium† & 270 $\pm$ 10 nm & 135$\pm$5 nm \\ \hline \end{tabular}} \end{table}	PMC4406518_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{n 51 675} & \textbf{SF (n = 14 234) n (\%)} & \textbf{NP (n = 20 371) n (\%)} & \textbf{NVP (n = 17 070) n (\%)} & \textbf{P valuea} \\ \hline \\ \hline \\ \hline Gestation length & 51 675 & & & & 0.001 \\ \hline Normal range 37–42 weeks & 49 181 & 13 460 (94.6) & 19 461 (95.5) & 16 260 (95.3) \\ \hline Early birth 35–36 weeks & 1545 & 491 (3.4) & 553 (2.7) & 501 (2.9) \\ \hline Very early birth 28–34 weeks & 949 & 283 (2.0) & 357 (1.8) & 309 (1.8) \\ \hline Caesarean delivery & 51 675 & & & & $<$0.001 \\ \hline No & 44 416 & 12 104 (85.0) & 17 654 (86.7) & 14 658 (85.9) \\ \hline Planned caesarean delivery & 2544 & 644 (4.5) & 1027 (5.0) & 873 (5.1) \\ \hline Emergency caesarean delivery & 4065 & 1270 (8.9) & 1447 (7.1) & 1348 (7.9) \\ \hline Unspecified & 650 & 216 (1.5) & 243 (1.2) & 191 (1.1) \\ \hline If yes to caesarean delivery, reason & & & & & $<$0.001 \\ \hline Breech presentation & 756 & 283 (29.1) & 258 (19.9) & 215 (21.0) \\ \hline Previous caesarean delivery & 447 & 116 (11.9) & 194 (14.9) & 137 (13.4) \\ \hline Pregnancy complication/ill mother & 650 & 175 (18.0) & 262 (20.2) & 213 (20.8) \\ \hline Poor growth/fetus complication & 198 & 68 (7.0) & 83 (6.4) & 47 (4.6) \\ \hline Own preference & 314 & 76 (7.8) & 130 (10.0) & 108 (10.5) \\ \hline Other & 931 & 255 (26.2) & 371 (28.6) & 305 (29.8) \\ \hline Multiple answers & 465 \\ \hline Mortality & 51 675 & & & & 0.60 \\ \hline Born alive, lived $>$1 y & 51 585 & 14 206 (99.8) & 20 340 (99.8) & 17 039 (99.8) \\ \hline Born alive, died $\leq$1 y & 90 & 28 (0.2) & 31 (0.2) & 31 (0.2) \\ \hline Anthropometry & & Mean (SD) & Mean (SD) & Mean (SD) & P valueb \\ \hline Weight of placenta at birth (g) & 50 115 & 661.5 (145.2) & 677.9 (145.9) & 678.3 (144.9) & $<$0.001 \\ \hline Weight of infant at birth (g) & 51 106 & 3561.5 (515.1) & 3638.5 (506.4) & 3605.5 (508.6) & $<$0.001 \\ \hline Length of infant at birth (cm) & 49 180 & 50.4 (2.1) & 50.6 (2.0) & 50.4 (2.1) & $<$0.001 \\ \hline Head circ. of infant at birth (cm) & 50 319 & 35.3 (1.5) & 35.4 (1.5) & 35.3 (1.5) & $<$0.001 \\ \hline \end{tabular}} \end{table}	PMC4477493_table_3
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{miRNAs} & \textbf{AUC (95 \% CI)} & \textbf{Sensitivity (95 \% CI)} & \textbf{Specificity (95 \% CI)} & \textbf{P value} \\ \hline miR-31 & 0.76 (0.70 to 0.83) & 61.66 (55.35 to 67.68) & 81.86 (76.23 to 86.83) & $<$0.001 \\ \hline miR-21 & 0.80 (0.72 to 0.86) & 79.47 (72.38 to 82.94) & 70.98 (65.48 to 77.46) & $<$0.001 \\ \hline miR-210 & 0.84 (0.78 to 0.90) & 76.58 (68.35 to 80.13) & 81.16 (75–23.37 to 86.18) & $<$0.001 \\ \hline Combined use of 3 miRNAs & 0.89 (0.85 to 0.94) & 81.48 (68.5 to 90.75) & 85.91 (72.41 to 94.25) & $<$0.001 \\ \hline \end{tabular}} \end{table}	PMC5070138_table_3
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Study} & \textbf{Outcome} & \textbf{Parameter estimate and 95\% confidence interval} \\ \hline \multicolumn{3}{\|l\|}{Mortality 2° to COPD} \\ \hline Ishida W, et al., Japan, 2007 [23] & Decreased mortality 2° to COPD in statin users & Inverse correlation between statin prescriptions dispensed and mortality due COPD by prefecture, p $<$ 0.0001 \\ \hline \multicolumn{3}{\|l\|}{Respiratory-related urgent care} \\ \hline Keddissi JI, et al., USA, 2007 [26] & Reduction in respiratory-related emergency- department-visits and/or hospitalizations in statin users & Incidence of respiratory related urgent care, obstructive spirometry group 0.12 $\pm$ 0.29/ patient-yrs in statin users versus 0.19 $\pm$ 0.32/ patient-yrs in control, p = 0.02 \\ \hline \multicolumn{3}{\|l\|}{Lung function} \\ \hline Keddissi JI, et al., USA, 2007 [26] & Lower decline in FEV1 and FVC/yr in statin users & Obstructive spirometry group change in FEV1 +5 $\pm$ 207 ml/yr in statin users change in FEV1–86 $\pm$ 168 ml/yr in control (p $<$ 0.0001) change in FVC +33 $\pm$ 452 ml/yr in statin users change in FVC-150 $\pm$ 328 ml/yr in control (p $<$ 0.0001) \\ \hline Lee T-M, et al., Taiwan, 2008 [19] & No difference in pulmonary function parameters in statin users & Pravastatin group: FEV1\% at baseline 51 $\pm$ 18, at follow-up 55 $\pm$ 19 Placebo group: FEV1\% at baseline 56 $\pm$ 13, at follow-up 55 $\pm$ 14, p $>$ 0.05 \\ \hline \multicolumn{3}{\|l\|}{Exercise capacity} \\ \hline Lee T-M, et al., Taiwan, 2008 [19] & Improvement in exercise time in statin users & Pravastatin group: exercise time in s at baseline 599 $\pm$ 323, at follow-up 922 $\pm$ 328 Placebo group: exercise time in s at baseline 608 $\pm$ 273, at follow-up 609 $\pm$ 180, p $<$ 0.05 \\ \hline \multicolumn{3}{\|l\|}{Borg dyspnea score after exercise tests} \\ \hline Lee T-M, et al., Taiwan, 2008 [19] & Lesser degree of dyspnea after exercise in statin users & Pravastatin group: Borg dyspnea score at baseline 7.0 $\pm$ 0.8, at follow-up 4.0 $\pm$ 0.7 Placebo group: Borg dyspnea score at baseline 6.9 $\pm$ 0.8, at follow-up 6.9 $\pm$ 1.0, p $<$ 0.05 \\ \hline \multicolumn{3}{\|l\|}{CRP/IL-6 levels} \\ \hline Lee T-M, et al., Taiwan, 2008 [19] & Decrease in CRP/IL-6 levels in statin users & Pravastatin group: CRP (mg/l) at baseline 3.94 $\pm$ 3.54, at follow-up 3.85 $\pm$ 2.56 Placebo group: CRP (mg/l) at baseline 4.06 $\pm$ 2.67, at follow-up 2.66 $\pm$ 2.49, p $<$ 0.05 \\ \hline \end{tabular}} \end{table}	PMC2716302_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Attack ID} & \textbf{Attack} & \textbf{Parameters} \\ \hline FLIP & Flip & Horizontal flip \\ \hline DQ1 & Frame rate change & 20 fps \\ \hline & Contrast change & +10\% \\ \hline & Noise Addition & Gaussian: mean = 0; variance = 0.01 \\ \hline DQ2 & Frame rate change & 20 fps \\ \hline & Brightness change & +10\% \\ \hline & Cropping & 10\% of the frame border \\ \hline DQ3 & Frame dropping & 10\% dropped \\ \hline & Rotation & +5o \\ \hline & Brightness change & +10\% \\ \hline FLIP + DQ2 & Flip & Horizontal flip \\ \hline & Frame rate change & 20 fps \\ \hline & Brightness change & +10\% \\ \hline & Cropping & 10\% of the frame border \\ \hline PROJ & Projection & $\theta$ = 1o using MATLAB projective2d = ([cos($\theta$) -sin($\theta$) 0.001; sin($\theta$) cos($\theta$) 0.001; 0 0 1]); \\ \hline PROJ + DQ2 & Projection & $\theta$ = 1o using MATLAB projective2d = ([cos($\theta$) -sin($\theta$) 0.001; sin($\theta$) cos($\theta$) 0.001; 0 0 1]); \\ \hline & Frame rate change & 20 fps \\ \hline & Brightness change & +10\% \\ \hline & Cropping & 10\% of the frame border \\ \hline POST1 & Insertion of patterns & Standard image baboon.jpg 30x30 pixels \\ \hline POST2 & Subtitles & 35 characters are inserted [49] in the first frame of each second of the video \\ \hline POST3 & PiP & Original video resized to 90\% at front \\ \hline POST4 & PiP & Original video resized to 90\% at front \\ \hline & Insertion of patterns & Standard image baboon.jpg 30x30 pixels \\ \hline & Subtitles & 35 characters are inserted [49] in the first frame of each second of the video \\ \hline \end{tabular}} \end{table}	PMC5115698_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \multicolumn{2}{\|l\|}{\textbf{Polymorphisms}} & \multicolumn{2}{\|l\|}{\textbf{French}} & \multicolumn{2}{\|l\|}{\textbf{German}} \\ \hline \textbf{rs1878326} & \textbf{rs4945} & \textbf{FCTL (n = 238)} & \textbf{FAMD (n = 269)} & \textbf{GCTL (n = 253)} & \textbf{GAMD (n = 298)} \\ \hline A & C & 0.426 & 0.342 & 0.355 & 0.344 \\ \hline A & A & 0.252 & 0.293 & 0.289 & 0.245 \\ \hline C & C & 0.284 & 0.299 & 0.310 & 0.359 \\ \hline C & A & 0.038 & 0.066 & 0.045 & 0.052 \\ \hline \end{tabular}} \end{table}	PMC3305292_table_4
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & & \multicolumn{6}{\|l\|}{\textbf{HELIOS indicator set}} & \textbf{3 M PSI} & \textbf{SP Mort} & \textbf{SP LOS} \\ \hline & & \textbf{3 M HELIOS group} & \textbf{3 M HELIOS target} & \textbf{InMed HELIOS assessment} & \textbf{InMed HELIOS benchmarking} & \textbf{InMed HELIOS rates} & \textbf{InMed HELIOS target} \\ \hline 3 M HELIOS group & Coefficient & & 0.867 (0.523- 0.968) & 0.571 (-0.092-0.883) & 0.903 (0.634-0.977) & 0.855 (0.488- 0.965) & 0.891 (0.595-0.974) & 0.304 (-0.403- 0.784) & 0.413 (-0.293- 0.827) & 0.426 (-0.278- 0.832) \\ \hline & Sig. (2- sided) & & 0.001 & 0.084 & 0.000 & 0.002 & 0.001 & 0.393 & 0.235 & 0.220 \\ \hline 3 M HELIOS target & Coefficient & & & 0.559 (-0.109-0.879) & 0.915 (0.673-0.980) & 0.673 (0.075- 0.915) & 0.927 (0.714-0.983) & 0.000 (-0.630- 0.630) & 0.292 (-0.414- 0.779) & 0.085 (-0.575- 0.678) \\ \hline & Sig. (2- sided) & & & 0.093 & 0.000 & 0.033 & 0.000 & 1.000 & 0.413 & 0.815 \\ \hline InMed HELIOS assessment & Coefficient & & & & 0.657 (0.047-0.910) & 0.802 (0.348- 0.951) & 0.693 (0.112-0.921) & 0.405 (-0.302- 0.824) & 0.811 (0.371- 0.954) & 0.409 (-0.253- 0.810) \\ \hline & Sig. (2- sided) & & & & 0.039 & 0.005 & 0.026 & 0.245 & 0.004 & 0.241 \\ \hline InMed HELIOS benchmarking & Coefficient & & & & & 0.855 (0.488- 0.965) & 0.915 (0.673-0.980) & 0.036 (-0.607- 0.651) & 0.529 (-0.151- 0.869) & 0.188 (-0.501- 0.731) \\ \hline & Sig. (2- sided) & & & & & 0.002 & 0.000 & 0.920 & 0.116 & 0.602 \\ \hline InMed HELIOS rates & Coefficient & & & & & & 0.770 (0.272-0.943) & 0.353 (-0.356- 0.804) & 0.723 (0.171- 0.930) & 0.547 (-0.126- 0.875) \\ \hline & Sig. (2- sided) & & & & & & 0.009 & 0.318 & 0.018 & 0.102 \\ \hline InMed HELIOS target & Coefficient & & & & & & & 0.128 (-0.546- 0.701) & 0.498 (-0.192- 0.858) & 0.128 (-0.546- 0.701) \\ \hline & Sig. (2- sided) & & & & & & & 0.725 & 0.143 & 0.725 \\ \hline 3 M PSI & Coefficient & & & & & & & & 0.396 (-0.311- 0.821) & 0.829 (0.417- 0.958) \\ \hline & Sig. (2- sided) & & & & & & & & 0.257 & 0.003 \\ \hline SP Mort & Coefficient & & & & & & & & & 0.341 (-0.368- 0.799) \\ \hline & Sig. (2- sided) & & & & & & & & & 0.334 \\ \hline SP LOS & Coefficient \\ \hline & Sig. (2- sided) \\ \hline \end{tabular}} \end{table}	PMC3114706_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Scales} & \textbf{Variable in equation} & \textbf{Standardized Beta} & \textbf{R2} & \textbf{Sig.} & \textbf{Number of samples} \\ \hline Zone1 & \multicolumn{4}{\|l\|}{no variables were entered} & 27 \\ \hline Zone2 & \multicolumn{4}{\|l\|}{no variables were entered} & 17 \\ \hline Zone3 & \multicolumn{4}{\|l\|}{no variables were entered} & 14 \\ \hline Zone4 & \multicolumn{4}{\|l\|}{no variables were entered} & 10 \\ \hline Zone5 & \multicolumn{2}{\|l\|}{WI-IPC3 0.527 WI-IPC4 0.085} & 0.452 & 0.001 & 8 \\ \hline \\ \hline \end{tabular}} \end{table}	PMC3524620_table_4
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{in a Primer name} & \textbf{Nucleotide sequence (5’ to 3’)} & \textbf{Ta (°C)} & \textbf{Expected size (bp)} \\ \hline sys- matK _F & CTTCTTATTTACGATTAACATCTTCT & 57 & 160 \\ \hline matK _R & TTTCCTTGATATCGAACATAATG \\ \hline rbcL_F & GGTACATGGACAACTGTGTGGA & 57 & 150 \\ \hline rbcL _R & ACAGAACCTTCTTCAAAAAGGTCTA \\ \hline nucleo- rpoC_F & CCSATTGTATGGGAAATACTT & 57 & 170 \\ \hline rpoC _R & CTTACAAACTAATGGATGTAA \\ \hline de- trnL_F & GAATCGACCGTTCAAGTATCC & 57 & 150 \\ \hline trnL _R & TATAGGAAACCCATATTTGATCCAATC \\ \hline \end{tabular}} \end{table}	PMC4448308_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Anther size (mm)} & \textbf{$<$1} & \textbf{1–2} & \textbf{2–3} & \textbf{3–4} & \textbf{4–5} & \textbf{5–5.5} & \textbf{5.5–6.5} \\ \hline Normal (n = 28) & 0 & 0 & 0 & 0 & 0 & 36\% & 64\% \\ \hline fzt (n = 150) & 11\% & 49\% & 25\% & 15\% & 0 & 0 & 0 \\ \hline \end{tabular}} \end{table}	PMC4706427_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline \textbf{Soil properties} & \textbf{Shinille soil} \\ \hline pH in H2O & 7.74 \\ \hline EC (mS/cm) & 4.12 \\ \hline Organic carbon (\%) & 2.15 \\ \hline Total nitrogen (\%) & 0.29 \\ \hline Available P (mg kg−1) & 25.85 \\ \hline Ca (cmol(+) kg−1) & 31.10 \\ \hline Mg (cmol(+) kg−1) & 3.22 \\ \hline Na (cmol(+) kg−1) & 0.14 \\ \hline K (cmol(+) kg−1) & 2.22 \\ \hline CEC (cmol(+) kg−1) & 25.90 \\ \hline Zn (mg kg−1) & 1.19 \\ \hline Fe (mg kg−1) & 2.2 \\ \hline B (mg kg−1) & 0.86 \\ \hline NH4-N (mg kg−1) & 26.22 \\ \hline NO3-N (mg kg−1) & 23 \\ \hline Clay (g kg−1) & 27 \\ \hline Silt (g kg−1) & 50 \\ \hline Sand (g kg−1) & 23 \\ \hline Textural class & Loam \\ \hline Number of rhizobia nodulating soybean & None \\ \hline \end{tabular}} \end{table}	PMC4447725_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Case} & \textbf{ETI Successful} & \textbf{Type of injury} & \textbf{NACA} & \textbf{CGS} & \textbf{RTS} & \textbf{Outcome} \\ \hline Oesophageal intubation & Yes & Blunt & 6 & 3 & 3.51 & Dead $<$ 24 h \\ \hline Bleeding & No & Blunt & 6 & 3 & 2.78 & Dead $<$ 24 h \\ \hline $>$ 2 ETI attempts & Yes & Blunt & 6 & 5 & 5.03 & Alive at discharge \\ \hline Emergency tracheotomy & No & Burns with facial laceration & 6 & 3 & 0.58 & Dead $<$ 24 h \\ \hline Naso-tracheal intubation & Yes & Blunt & 7 & 3 & 0.00 & Dead on scene \\ \hline \end{tabular}} \end{table}	PMC2903496_table_3
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Secondary diagnosis} & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} & \textbf{6} & \textbf{7} \\ \hline Atrial fibrillation (\%) & 17.16 & --- & 4.26 & --- & 5.95 & 3.85 & 6.02 \\ \hline Anaemia (\%) & 1.49 & --- & 2.13 & --- & 1.19 & --- & --- \\ \hline Respirat. tract infection (\%) & 0.75 & --- & --- & 5.26 & --- & --- & 4.82 \\ \hline COPD (\%) & 8.21 & 9.68 & 2.13 & 2.63 & 11.90 & --- & 22.89 \\ \hline Diabetes (\%) & 11.94 & --- & 17.02 & 10.53 & 13.10 & --- & 12.05 \\ \hline Hypertension (\%) & 0.75 & --- & --- & --- & 2.38 & 3.85 & --- \\ \hline Hyperthyroidism (\%) & 1.49 & --- & --- & --- & 3.75 & --- & 3.61 \\ \hline Renal insufficiency (\%) & 9.70 & --- & 4.26 & 2.63 & 16.67 & --- & 6.02 \\ \hline Total (\%) & 22.5 & 9.0 & 18.7 & 16.0 & 24.3 & 7.7 & 28.7 \\ \hline \end{tabular}} \end{table}	PMC4384319_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline \textbf{Risk factor} & \textbf{Relative risk} \\ \hline Lack of social engagement & 2.34 (1.18–4.65) \\ \hline Depression & 1.90 (1.55–2.33) \\ \hline Physical inactivity & 1.82 (1.19–2.45) \\ \hline Hypertension (midlife) & 1.61 (1.16–2.24) \\ \hline Obesity (midlife) & 1.60 (1.34–1.92) \\ \hline Smoking & 1.59 (1.15–2.20) \\ \hline Low education & 1.59 (1.35–1.86) \\ \hline Diabetes & 1.39 (1.17–1.66) \\ \hline \end{tabular}} \end{table}	PMC5112261_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline \textbf{to Category} \\ \hline pio- Total number of reads & 1,366,749 \\ \hline as Total length of reads (bp) & 625,825,203 \\ \hline been Total number of reads cleaned & 1,361,424 \\ \hline and Total length of reads cleaned (bp) & 598,655,879 \\ \hline Number of reads placed & 1,302,023 \\ \hline the Number of singletons & 10,992 \\ \hline a Total length of singletons (bp) & 3,714,066 \\ \hline Average length of singletons (bp) & 337 \\ \hline Largest singleton (bp) & 692 \\ \hline Ontho- Number of contigs & 39,088 \\ \hline tran- Total length of contigs (bp) & 22,806,009 \\ \hline study Average length of contigs (bp) & 583 \\ \hline Largest contig (bp) & 6,401 \\ \hline Average read coverage of contigs & 24 \\ \hline \end{tabular}} \end{table}	PMC3019233_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{n} & \textbf{20th centile (days)} & \textbf{50th centile/ median (days)} & \textbf{80th centile (days)} & \multicolumn{3}{\|l\|}{\textbf{\% over 1 year}} & \multicolumn{3}{\|l\|}{\textbf{\% over 5 years}} \\ \hline & & & & & \textbf{\%} & \multicolumn{2}{\|l\|}{\textbf{95\% confidence interval}} & \textbf{\%} & \multicolumn{2}{\|l\|}{\textbf{95\% confi- dence interval}} \\ \hline & & & & & & \textbf{Lower} & \textbf{Upper} & & \textbf{Lower} & \textbf{Upper} \\ \hline All & 1,085 & 21.0 & 119.0 & 1,031.0 & 33.5 & 30.7 & 36.3 & 13 & 11.1 & 15.1 \\ \hline \multicolumn{11}{\|l\|}{Commissioning} \\ \hline General & 900 & 17.0 & 80.0 & 497.0 & 23.4 & 20.8 & 26.3 & 17.9 & 15.5 & 20.5 \\ \hline Forensic & 185 & 400.8 & 1,367.0 & 4,044.8 & 81.2 & 74.8 & 86.1 & 39.1 & 32.5 & 46.4 \\ \hline \multicolumn{11}{\|l\|}{Open or secure} \\ \hline Open & 869 & 17.0 & 83.0 & 524 & 24.2 & 21.4 & 27.1 & 8 & 6.3 & 9.9 \\ \hline Secure & 216 & 134.4 & 1,023.0 & 3,334.0 & 70.8 & 64.4 & 76.5 & 33.1 & 27.1 & 39.6 \\ \hline \multicolumn{11}{\|l\|}{Designated length of stay} \\ \hline Acute & 660 & 12.0 & 42.5 & 142.5 & 6.3 & 4.7 & 8.5 & 0 & 0 & 0.01 \\ \hline Medium/rehabilita- tion & 173 & 134.8 & 389.0 & 1,333.6 & 52.6 & 42.5 & 59.9 & 13.0 & 9.0 & 19.2 \\ \hline Long stay & 252 & 694.6 & 1689.5 & 4,394.0 & 91.1 & 87.1 & 94.2 & 47.0 & 40.8 & 53.0 \\ \hline \multicolumn{11}{\|l\|}{Mental Health Act status} \\ \hline Informal & 602 & 15.0 & 84.0 & 737.2 & 28.1 & 24.6 & 31.8 & 10.4 & 8.3 & 13.2 \\ \hline Civil detention & 324 & 20.0 & 91.0 & 447.0 & 22.0 & 17.8 & 26.7 & 5.8 & 3.8 & 9.0 \\ \hline Forensic unre- stricted & 34 & 83.0 & 400.0 & 1,735.0 & 65.9 & 50.8 & 80.9 & 16.1 & 6.4 & 30.1 \\ \hline Forensic restricted & 124 & 404.0 & 1,565.5 & 4,172.0 & 82.7 & 74.6 & 88.0 & 43.1 & 35.1 & 52.3 \\ \hline \multicolumn{11}{\|l\|}{Level of therapeutic security} \\ \hline Open & 865 & 16.2 & 82.0 & 506.6 & 23.7 & 21.0 & 26.6 & 8 & 6.4 & 10.0 \\ \hline Low & 63 & 50.4 & 540.0 & 1,362.6 & 51.6 & 38.8 & 62.7 & 10.3 & 5.5 & 32.3 \\ \hline Medium & 86 & 167.4 & 571.5 & 1,744.6 & 65.1 & 54.6 & 74.3 & 14.4 & 8.2 & 22.8 \\ \hline High & 71 & 1,540.2 & 3,327.0 & 1,930.8 & 96.8 & 90.3 & 99.2 & 91.1 & 82.8 & 96.1 \\ \hline \end{tabular}} \end{table}	PMC4485346_table_6
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{Patient 1} & \textbf{Patient 2} & \textbf{Patient 3} & \textbf{Patient 4} & \textbf{Patient 5} \\ \hline Age & 55 & 50 & 67 & 72 & 72 \\ \hline Gender & Male & Male & Male & Male & Male \\ \hline Primary tumor & Sigmoid colon & Ascending colon & Rectum & Rectum & Sigmoid colon \\ \hline Operation & Sigmoidectomy & Right colectomy & Hartmann & High anterior resection & Sigmoidectomy \\ \hline Operating time, minutes & 145 & 75 & 90 & 130 & 225 \\ \hline Bleeding, mL & 60 & 15 & 130 & 60 & 290 \\ \hline Metastatic site & Liver & Liver & Liver & Liver & Liver \\ \hline & & & Lung & Lung \\ \hline \end{tabular}} \end{table}	PMC3570337_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Domains} & \textbf{Pre-OP (n = 12)} & \textbf{Post-OP (n = 12)} & \textbf{P values} \\ \hline Sexual desire & 3.2 $\pm$ 0.8 & 3.4 $\pm$ 0.3 & 0.31 \\ \hline Sexual arousal & 3.9 $\pm$ 0.6 & 4.0 $\pm$ 0.9 & 0.34 \\ \hline Lubrication & 5.7 $\pm$ 2.1 & 5.6 $\pm$ 0.3 & 0.28 \\ \hline Orgasm & 5.6 $\pm$ 0.4 & 5.6 $\pm$ 0.6 & 0.17 \\ \hline Satisfaction & 5.5 $\pm$ 0.8 & 5.5 $\pm$ 0.7 & 0.17 \\ \hline Dyspareunia & 3.7 $\pm$ 1.4 & 5.4 $\pm$ 0.6 & 0.009+ \\ \hline Total scores & 27.5 $\pm$ 2.5 & 29.4 $\pm$ 2.2 & 0.037+ \\ \hline \end{tabular}} \end{table}	PMC5861080_table_6
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|} \hline & \multicolumn{3}{\|l\|}{\textbf{Age at menarche, years Odds ratio (95\% confidence interval)a, b}} \\ \hline \\ \hline \textbf{Tumor characteristic} & \textbf{11} & \textbf{$>$ 11 and 13} & \textbf{$>$ 13 and 14} \\ \hline \multicolumn{4}{\|l\|}{Tumor size} \\ \hline \multicolumn{4}{\|l\|}{1–10 mm} \\ \hline 11–20 mm & 1.00 (0.65–1.53) & 0.96 (0.74–1.25) & 1.01 (0.76–1.33) \\ \hline 21 mm & 1.05 (0.64–1.72) & 1.43 (1.06–1.92) & 1.32 (0.96–1.81) \\ \hline \multicolumn{4}{\|l\|}{Grade} \\ \hline \multicolumn{4}{\|l\|}{Low} \\ \hline Medium & 2.05 (1.00–4.19) & 1.47 (1.00–2.15) & 1.74 (1.15–2.62) \\ \hline High & 2.04 (1.01–4.16) & 1.55 (1.06–2.26) & 1.45 (1.00–2.19) \\ \hline \multicolumn{4}{\|l\|}{ER status} \\ \hline \multicolumn{4}{\|l\|}{Positive} \\ \hline Negative & 1.33 (0.82–2.16) & 0.94 (0.68–1.29) & 1.15 (0.83–1.61) \\ \hline \multicolumn{4}{\|l\|}{PR status} \\ \hline \multicolumn{4}{\|l\|}{Positive} \\ \hline Negative & 0.86 (0.54–1.36) & 0.99 (0.75–1.30) & 1.24 (0.93–1.66) \\ \hline \multicolumn{4}{\|l\|}{Lymph node involvement} \\ \hline \multicolumn{4}{\|l\|}{Absent} \\ \hline Present & 1.49 (1.02–2.19) & 1.29 (1.02–1.65) & 1.22 (0.95–1.58) \\ \hline \multicolumn{4}{\|l\|}{Histology} \\ \hline \multicolumn{4}{\|l\|}{Ductal} \\ \hline Lobular & 1.17 (0.68–2.01) & 1.08 (0.76–1.52) & 0.99 (0.68–1.43) \\ \hline All other & 0.68 (0.39–1.18) & 1.09 (0.81–1.46) & 0.92 (0.66–1.26) \\ \hline \end{tabular}} \end{table}	PMC2656904_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline & \textbf{Initial 3 months (n = 583 individuals)} & & \textbf{After 3 months (n = 559 individuals)} \\ \hline Variable & Unadjusted Hazard Ratio (95\% CI) & Adjusted Hazard Ratio (95\% CI) & Unadjusted Hazard Ratio (95\% CI) & Adjusted Hazard Ratio (95\% CI) \\ \hline Age (years) & 0.99 (0.95-1.04) & 0.87 (0.79-0.96) & 0.98 (0.95-1.10) & N/S \\ \hline \multicolumn{5}{\|l\|}{Sex;} \\ \hline Female & REF & & REF \\ \hline Male & 4.17 (1.83-.54) & 9.55 (2.35-38.78) & 0.59 (0.30-1.16) & 0.55 (0.27-1.10) \\ \hline Log10 HIV RNA & 1.85 (0.86-3.97) & 2.69 (1.11-6.51) & 0.83 (0.59-1.13) & N/S \\ \hline Transfer in & 0.99 (0.13-7.30) & N/S & 0.38 (0.05-2.78) & N/S \\ \hline Log10 CD4 & 1.35 (0.78-2.40) & 2.02 (0.58-4.76) & 0.83 (0.65-1.07) & 0.87(0.67-1.13) \\ \hline \multicolumn{5}{\|l\|}{Prior TB;} \\ \hline No & REF & & REF \\ \hline Yes & 1.42 (0.63-3.20) & 1.16 (0.33-4.03) & 1.77 (1.04-2.98) & 1.32 (0.73-2.38) \\ \hline \multicolumn{5}{\|l\|}{WHO stage} \\ \hline 1 or 2 & REF & & REF \\ \hline 3 or 4 & 2.33 (0.92-5.92) & N/S & 2.11 (1.15-3.87) & 1.94 (0.99-3.38) \\ \hline Unknown & 0.40 (0.05-3.32) & N/S & 1.27 (0.52-3.12) & 1.43 (0.58-3.56) \\ \hline \end{tabular}} \end{table}	PMC2835706_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Features} & \textbf{AUC} & \multicolumn{2}{\|l\|}{\textbf{95\% Conf. Int.}} & \textbf{p-value} \\ \hline \textbf{HHL Skewness} & \textbf{0.51} & \textbf{0.40} & \textbf{0.57} & \textbf{0.74} \\ \hline HLH Median & 0.52 & 0.44 & 0.61 & 0.64 \\ \hline LoG5 Low Intensity Small Area Emp. & 0.54 & 0.46 & 0.63 & 0.35 \\ \hline LLH Short Run Low Gray Level Emp. & 0.55 & 0.37 & 0.54 & 0.35 \\ \hline Difference Entropy & 0.56 & 0.35 & 0.52 & 0.21 \\ \hline HHH Mean & 0.58 & 0.50 & 0.66 & 0.09 \\ \hline LoG4 High Intensity Large Area Emp. & 0.59 & 0.50 & 0.67 & 0.08 \\ \hline HLL Cluster Prominence & 0.60 & 0.51 & 0.68 & 0.05 \\ \hline Spherical disproportion & 0.61 & 0.53 & 0.69 & 0.02 \\ \hline LoG5 Inv. Diff. Normalized & 0.61 & 0.53 & 0.70 & 0.02 \\ \hline HLH Low Intensity Large Area Emp. & 0.63 & 0.54 & 0.71 & 0.01 \\ \hline HHL Mean & 0.63 & 0.55 & 0.71 & $<$0.001 \\ \hline Run Length Non-uniformity & 0.65 & 0.56 & 0.73 & $<$0.001 \\ \hline Minimum & 0.65 & 0.57 & 0.73 & $<$0.001 \\ \hline HHH High Intensity Large Area Emp. & 0.69 & 0.61 & 0.77 & $<$0.001 \\ \hline \end{tabular}} \end{table}	PMC5690632_table_3
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Clinical variant} & \textbf{Healthy dogs} & \textbf{Babesiosis positive dogs} \\ \hline Rectal temperature (°F) & 102.00$\pm$00.21 & 102.96$\pm$00.23 \\ \hline Heart rate (beats/min) & 117.00$\pm$03.04 & 129.88$\pm$02.94 \\ \hline Respiration rate (breaths/min) & 28.50$\pm$01.67 & 36.56$\pm$02.22 \\ \hline CRT (seconds) & 01.25$\pm$00.16 & 02.37$\pm$00.13 \\ \hline \end{tabular}} \end{table}	PMC5682268_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline Refinement on F2 & Secondary atom site location: difference Fourier map \\ \hline Least-squares matrix: full & Hydrogen site location: inferred from neighbouring sites \\ \hline R[F2 $>$ 2$\sigma$(F2)] = 0.031 & H atoms treated by a mixture of independent and constrained refinement \\ \hline wR(F2) = 0.087 & w = 1/[$\sigma$2(Fo 2) + (0.0424P)2 + 0.6484P] where P = (Fo 2 + 2Fc 2)/3 \\ \hline S = 1.05 & ($\Delta$/$\sigma$)max = 0.001 \\ \hline 4096 reflections & $\Delta$$\rho$max = 0.36 e Å−3 \\ \hline 251 parameters & $\Delta$$\rho$min = −0.40 e Å−3 \\ \hline 3 restraints & Extinction correction: none \\ \hline Primary atom site location: structure-invariant direct methods \\ \hline \end{tabular}} \end{table}	PMC2961304_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Study} & \textbf{Trial type} & \textbf{Random sample} & \textbf{Allocation concealment} & \textbf{Blinded allocation} & \textbf{Lost of follow-up} & \textbf{ITT} & \textbf{Grade} \\ \hline Lo CM & RCT & Adequate & Adequate & Unclear & Yes & Yes & A \\ \hline Li M & RCT & Adequate & Unclear & Unclear & Yes & Yes & B \\ \hline Li N & nRCT & Adequate & Adequate & Unclear & Yes & Yes & B \\ \hline Sun HC & RCT & Adequate & Adequate & Adequate & Yes & Yes & A \\ \hline Chen LT & RCT & Adequate & Adequate & Adequate & Yes & Yes & A \\ \hline Chao Zou & nRCT & Adequate & Adequate & Adequate & Yes & Yes & A \\ \hline \end{tabular}} \end{table}	PMC4899889_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Treatments} & \multicolumn{3}{\|l\|}{\textbf{Proximal ileum}} & \multicolumn{3}{\|l\|}{\textbf{Distal ileum}} \\ \hline & \textbf{Amylose, \%} & \textbf{Amylopectin, \%} & \textbf{Total starch, \%} & \textbf{Amylose, \%} & \textbf{Amylopectin, \%} & \textbf{Total starch, \%} \\ \hline Control & 95.64 & 93.38 & 93.82 & 97.86 & 93.89c & 94.87c \\ \hline Enzyme A & 97.06 & 95.13 & 95.38 & 97.61 & 96.12abc & 96.51abc \\ \hline Enzyme B & 97.47 & 97.09 & 97.20 & 97.80 & 97.08ab & 97.29ab \\ \hline Enzyme C & 97.93 & 96.27 & 96.71 & 97.93 & 97.58a & 97.67a \\ \hline Enzyme D & 96.33 & 94.71 & 94.74 & 97.29 & 94.12bc & 94.94bc \\ \hline Enzyme E & 97.39 & 96.51 & 96.73 & 98.47 & 97.30a & 97.60a \\ \hline SEM & 0.550 & 0.647 & 0.607 & 0.416 & 0.592 & 0.492 \\ \hline P-value & 0.266 & 0.256 & 0.080 & 0.671 & 0.033 & 0.025 \\ \hline \end{tabular}} \end{table}	PMC5846306_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Analyses} & \textbf{Dose Group} & \multicolumn{3}{\|l\|}{\textbf{Proportion of Responders}} & \multicolumn{2}{\|l\|}{\textbf{SBA Titers four weeks after vaccination}} \\ \hline & & \textbf{n/N} & \textbf{\%} & \textbf{95\% CI} & \textbf{GMT} & \textbf{95\% CI} \\ \hline \multicolumn{7}{\|l\|}{Serogroup A} \\ \hline MITT & Full & 249/289 & 86.2 & 82.2–90.2 & 3607.1 & 2952.8–4406.3 \\ \hline & 1/5 dose & 173/224 & 77.2 & 71.7–82.7 & 2035.4 & 1600.1–2589.0 \\ \hline & 1/10 dose & 159/230 & 69.1 & 63.2 -75.0 & 1367.6 & 1083.1–1726.8 \\ \hline PP & Full & 247/287 & 86.1 & 82.1–90.1 & 3612.6 & 2953.3–4419.1 \\ \hline & 1/5 dose & 172/222 & 77.5 & 72.0–83.0 & 2054.4 & 1612.2–2618.0 \\ \hline & 1/10 dose & 159/229 & 69.4 & 63.5–75.3 & 1369.3 & 1083.3–1730.7 \\ \hline Non immune & Full & 140/148 & 94.6 & 91.0–98.2 & 1918.0 & 1426.0–2579.8 \\ \hline & 1/5 dose & 94/102 & 92.2 & 87.0–97.4 & 852.3 & 573.2–1267.5 \\ \hline & 1/10 dose & 98/111 & 88.3 & 82.4–94.2 & 754.1 & 495.3–1148.1 \\ \hline \multicolumn{7}{\|l\|}{Serogroup W135} \\ \hline MITT & Full & 269/289 & 93.1 & 90.2–96.0 & 2190.3 & 1728.9–2774.6 \\ \hline & 1/5 dose & 212/224 & 94.6 & 91.7–97.5 & 2029.1 & 1573.7–2616.2 \\ \hline & 1/10 dose & 220/231 & 95.2 & 92.5–97.9 & 2422.7 & 1979.9–2964.6 \\ \hline PP & Full & 267/286 & 93.4 & 90.5–96.3 & 2175.9 & 1714.2–2762.0 \\ \hline & 1/5 dose & 210/222 & 94.6 & 91.6–97.6 & 2041.6 & 1582.2–2634.5 \\ \hline & 1/10 dose & 219/229 & 95.6 & 93.0–98.2 & 2426.3 & 1979.7–2973.7 \\ \hline Non immune & Full & 207/221 & 93.7 & 90.5–96.9 & 1539.5 & 1160.0–2043.2 \\ \hline & 1/5 dose & 168/178 & 94.4 & 91.0–97.8 & 1517.4 & 1129.3–2039.0 \\ \hline & 1/10 dose & 172/177 & 97.2 & 94.8–99.6 & 2008.3 & 1583.0–2547.9 \\ \hline \multicolumn{7}{\|l\|}{Serogroup C} \\ \hline MITT & Full & 259/284 & 91.2 & 87.9–94.5 & 1168.3 & 911.0–1498.2 \\ \hline & 1/5 dose & 179/222 & 80.6 & 75.4–85.8 & 472.1 & 332.3–670.6 \\ \hline & 1/10 dose & 171/223 & 76.7 & 71.2–82.2 & 399.3 & 277.1–575.4 \\ \hline PP & Full & 257/282 & 91.1 & 87.8–94.4 & 1175.1 & 914.9–1509.3 \\ \hline & 1/5 dose & 177/220 & 80.4 & 75.2–85.6 & 467.3 & 328.0–665.8 \\ \hline & 1/10 dose & 170/222 & 76.6 & 71.1–82.1 & 396.3 & 274.6–572.0 \\ \hline Non immune & Full & 252/271 & 93.0 & 90.0–96.0 & 1108.5 & 858.4–1431.5 \\ \hline & 1/5 dose & 172/211 & 81.5 & 76.3–86.7 & 412.2 & 288.2–589.6 \\ \hline & 1/10 dose & 156/202 & 77.2 & 71.4–83.0 & 315.6 & 214.8–463.8 \\ \hline \multicolumn{7}{\|l\|}{Serogroup Y} \\ \hline MITT & Full & 242/286 & 84.6 & 80.4–88.8 & 936.2 & 673.7–1301.0 \\ \hline & 1/5 dose & 185/224 & 82.6 & 77.7–87.5 & 772.7 & 529.2–1128.2 \\ \hline & 1/10 dose & 194/231 & 84.0 & 79.3–88.7 & 822.6 & 569.8–1187.5 \\ \hline PP & Full & 240/284 & 84.5 & 80.3–88.7 & 924.2 & 663.8–1286.7 \\ \hline & 1/5 dose & 183/222 & 82.4 & 77.4–87.4 & 768.3 & 524.4–1125.6 \\ \hline & 1/10 dose & 193/230 & 83.9 & 79.2–88.6 & 816.8 & 565.1–1180.8 \\ \hline Non immune & Full & 238/282 & 84.4 & 80.2–88.6 & 916.8 & 657.3–1278.8 \\ \hline & 1/5 dose & 175/214 & 81.8 & 76.7–86.9 & 687.5 & 466.1–1014.1 \\ \hline & 1/10 dose & 191/228 & 83.8 & 79.0–88.6 & 798.1 & 551.1–1155.7 \\ \hline \end{tabular}} \end{table}	PMC2584372_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{Never N (\%)} & \textbf{Rarely N (\%)} & \textbf{Occasionally N (\%)} & \textbf{Pretty Often N (\%)} & \textbf{Very Often N (\%)} \\ \hline To prepare for a [rheumatology/gastroenterology] visit & 44 (22.0) & 37 (18.5) & 73 (36.5) & 33 (16.5) & 13 (6.5) \\ \hline Because you did not understand the information from the [rheumatology/gastroenterology] provider & 86 (43.0) & 69 (34.5) & 38 (19.0) & 6 (3.0) & 1 (0.5) \\ \hline Because you wanted more information than the [rheumatology/gastroenterology] provider gave you & 26 (12.9) & 39 (19.4) & 73 (36.3) & 37 (18.4) & 26 (12.9) \\ \hline Because you did not remember what was said during the visit about treatment with biologics & 72 (36.0) & 60 (30.0) & 51 (25.5) & 14 (7.0) & 3 (1.5) \\ \hline Because you wanted to know about other people’s experiences being treated with biologics & 26 (13.0) & 24 (12.0) & 70 (35.0) & 50 (25.0) & 30 (15.0) \\ \hline To increase your confidence in your decision & 18 (9.0) & 19 (9.5) & 67 (33.5) & 50 (25.0) & 46 (23.0) \\ \hline \end{tabular}} \end{table}	PMC5024421_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline & \multicolumn{2}{\|l\|}{\textbf{Total a}} & \multicolumn{4}{\|l\|}{\textbf{Index eGFR (ml/min/1.73 m2)}} \\ \hline & & & \textbf{$\geq$60 b OR (95\% CI)} & \textbf{P} & \textbf{30 ~ 59 c OR (95\% CI)} & \textbf{P} \\ \hline & \textbf{OR (95\% CI)} & \textbf{P} \\ \hline Index eGFR $<$ 60 ml/min/1.73 m2 (yes vs. no) & 2.21 (1.37 ~ 3.58) & 0.001 & NA & NA & NA & NA \\ \hline RIFLE category of AWRF (vs. no AWRF) & 1.95 (1.16 ~ 3.29) & 0.012 & - & $<$0.001 & - & $<$0.001 \\ \hline Risk & - & - & 1.06 (0.48 ~ 2.33) & 0.890 & 1.07 (0.37 ~ 3.08) & 0.895 \\ \hline Injury & - & - & 3.49 (1.48 ~ 8.26) & 0.004 & 4.09 (1.56 ~ 10.70) & 0.004 \\ \hline Failure & - & - & 10.00 (3.74 ~ 26.76) & $<$0.001 & 10.76 (2.12 ~ 54.48) & 0.004 \\ \hline LVEF $<$ 45\% on admission (yes vs. no) & 2.17 (1.35 ~ 3.51) & 0.002 & 2.02(1.08 ~ 3.77) & 0.028 & 3.37(1.55 ~ 7.30) & 0.002 \\ \hline NYHA class 4 on admission (yes vs. no) & 2.58 (1.48 ~ 4.50) & 0.001 & 2.03 (1.02 ~ 4.06) & 0.045 & 5.49 (1.92 ~ 15.71) & 0.001 \\ \hline Systolic blood pressure $>$ 160 mm Hg on admission (yes vs. no) & 2.74 (1.22 ~ 6.17) & 0.015 & - & - & - & - \\ \hline Fasting plasma glucose $>$ 7.0 mmol/L on admission (yes vs. no) & 3.98 (2.46 ~ 6.43) & $<$0.001 & - & - & - & - \\ \hline Diuretic resistance (yes vs. no) & 2.03 (1.19 ~ 3.49) & 0.010 & 2.21(1.03 ~ 4.74) & 0.042 & 2.69(1.15 ~ 6.25) & 0.022 \\ \hline \end{tabular}} \end{table}	PMC3411407_table_3
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Authors} & \textbf{Study group} & \textbf{Age} & \textbf{Study design} & \textbf{Tests used} & \textbf{Aerobic power} & \textbf{Strength power} & \textbf{Psychological hormonal findings} \\ \hline Boone and Gilmore, 1995 & 11 sedentary male & Not specified & Cross-over & Treadmill test & O2max, DP & Not tested & No differences \\ \hline Dabbs and Mohammed, 1992 & 11 M/F & Not specified & Not controlled & Blood sample & Not tested & Not tested & No modifications in blood testosterone levels \\ \hline Fisher, 1997 & 166 varsity athletes (n = 83 football; n = 73 baseball) & Not specified & Controlled & General investigation & Not tested & Not tested & Religion has an impact on sexual behavior, depending also on the kind of sport (team vs. individual) \\ \hline Frauman, 1982 & 144 subjects + 78 undergraduate subjects & Not specified & Exploratory & Questionnaire & Not tested & Not tested & Physical exercise modifies sex behavior in a statistically significant way (Pearson’s correlation p $<$ 0.001) \\ \hline Johnson, 1968 & 14married Female Athletes & 24–49 years, mean 28 years & Randomized & Hand grip–dynamometer & Not tested & No modifications & Not tested \\ \hline Meston and Gorzalka, 1995 & Female & Not specified & Not controlled & Vaginal photoplethysmograph & Not tested & Not tested & Acute exercise increase arousal in female \\ \hline Pour et al., 2013 & Not tested (brief revision of literature & Since 18 years & Revision & Anonymous questionnaire, Mental Health & Mental Health & Not tested & Positive psychological impact \\ \hline Sztajzel et al., 2000 & 15 male athletes high level & 20–40 years & Randomized & Cycloergometer Ex Test & HR & Not tested & No significant differences \\ \hline & & & & Mental Test \\ \hline Vouyoukas, 2011 & 8 participants & Not specified & Thesis, observational & Cardiovascular and muscular test & VO2max, DP & Hand grip flexibility, & No differences \\ \hline \end{tabular}} \end{table}	PMC4914923_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline \multicolumn{2}{\|l\|}{Symptoms:} \\ \hline • & Exposure (work)-related cough, chest tightness, dyspnea, fever, with latency period of several hrs \\ \hline • & Progressive flu-like symptoms during the exposure periods (e.g. working week) with solution at days off \\ \hline • & Dyspnea on exertion \\ \hline • & Weight loss in the absence of any other reason \\ \hline \multicolumn{2}{\|l\|}{Clinical/physical examination:} \\ \hline • & Fine bibasilar end-inspiratory crackles in advanced chronic forms clubbing and respiratory distress \\ \hline \multicolumn{2}{\|l\|}{Serology:} \\ \hline • & Presence of high serum concentrations of antigen-specific IgG antibodies \\ \hline \multicolumn{2}{\|l\|}{Lung function testing:} \\ \hline • & FVC $<$ 80\% predicted (below lower limit of normal) or \\ \hline • & FVC $<$ 70\% pred. and/or TL,CO $<$ 80\% pred. or \\ \hline • & TL,CO $<$ 60\% pred. or hypoxemia during exercise \\ \hline \multicolumn{2}{\|l\|}{Radiology:} \\ \hline • & Abnormal chest x-ray (nodular, patchy and/or diffuse ground glass pattern) \\ \hline • & Abnormal HRCT (ground glass, nodular and/ or patchy opacities, mosaic or UIP pattern \\ \hline \multicolumn{2}{\|l\|}{Serial lung function testing and clinical investigations during antigen exposure periods and days off (for minimal diagnostic changes see SIC below):} \\ \hline \multicolumn{2}{\|l\|}{Specific inhalation challenge (minimal changes after 5-12 hrs):} \\ \hline • & FVC and TLC -15\% \\ \hline • & TL,CO -15\% or Pa,O2 – 7 mmHg \\ \hline • & New fine bibasilar end-inspiratory crackles \\ \hline • & Systemic symptoms (temperature + 1°C and leukocytosis + 2.5 $\times$ 109/L) \\ \hline \end{tabular}} \end{table}	PMC4408564_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline \textbf{qPCR primer} & \textbf{Sequence} \\ \hline RPS6 right & TGA TGT CCG CCA GTA TGT TG \\ \hline RPS6 left & TCT TGG TAC GCT GCT TCT TC \\ \hline TFAP2 right & ATT GAC CTA CAG TGC CCA GC \\ \hline TFAP2 left & ATG CTT TGG AAA TTG ACG GA \\ \hline PAX6 right & CAC ATG AAC AGT CAG CCA ATG \\ \hline PAX6 left & GGC CAG TAT TGA GAC ATA TCA GG \\ \hline EDNRA right & CAT GAC TTG TGA GAT GTT GAA CAG \\ \hline EDNRA left & CTG TTT TTG CCA CTT CTC GAC \\ \hline FOXD3 right & TTG ACG AAG CAG TCG TTG AG \\ \hline FOXD3 left & TCT GCG AGT TCA TCA GCA AC \\ \hline SIX3 right & CGA GGG GAG TGG ACA CTT \\ \hline SIX3 left & ATG CCG CTC GGT CCA AT \\ \hline SNAI2 right & TGA CCT GTC TGC AAA TGC TC \\ \hline SNAI2 left & CAG ACC CTG GTT GCT TCA A \\ \hline SOX10 right & CTT TCT TGT GCT GCA TAC GG \\ \hline SOX10 left & AGC TCA GCA AGA CGC TGG \\ \hline FOXG1 right & TGA ATG AAA TGG CAA AGC AG \\ \hline FOXG1 left & TGC AAT GTG GGG AGA ATA CA \\ \hline \end{tabular}} \end{table}	PMC6057744_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline \textbf{Aim} & \textbf{Question} \\ \hline Attitude and practice underlying SAP behaviour & 1. What is your opinion about the surgical antibiotic prophylaxis in your hospital? 2. According to clinical guidelines, the use of third or fourth-generation cephalosporins is not recommended for surgical prophylaxis. In fact, they have not been proven to be more effective than first or second-generation cephalosporins, while there are many negative effects caused by the inappropriate use of these antibiotics, including the emergence of antibiotic resistance. Another recommendation concerns the duration of antibiotic prophylaxis, that should be limited to the perioperative period, while the decision to continue prophylaxis beyond the first 24 postoperative hours is not recommended. a. What is your opinion? b. What are, in your opinion, the obstacles to the application of these recommendations? \\ \hline \end{tabular}} \end{table}	PMC5139116_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Parameter} & \textbf{Value} & \textbf{Value (Natural Units)} \\ \hline Frecuency (f) & - & 2.4 GHz \\ \hline Wave length ($\lambda$) & - & 0.125 m \\ \hline Transmitted power (PT) & 3 dBm = −27 dB & 1.995 mW \\ \hline Antenna gain (GT y GR) & 32.39 dBm = 2.3880 dB & 1.7330 \\ \hline Obstacle losses (LOBS) & 0 dBm = −30 dB & 0.001 \\ \hline Cable losses (LT y LR) & 29.77 dBm = −0.2325 dB & 0.9479 \\ \hline Sensitivity & −97 dBm = −127 dB & 0.1995 pW \\ \hline \end{tabular}} \end{table}	PMC4701321_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|} \hline & \textbf{n} & \textbf{RRR (95\% CI)} & \textbf{P-value} \\ \hline 1. Other trauma/no PTSD & 365 & Reference \\ \hline 2. Other trauma/PTSD & 15 & 1.03 (0.99, 1.06) & 0.090 \\ \hline 3. Assaultive violence/no PTSD & 131 & 1.02 (1.01, 1.03) & 0.003 \\ \hline 4. Assaultive violence/PTSD & 30 & 1.04 (1.01, 1.06) & 0.002 \\ \hline 2. vs. 4. & – & .99 (0.95, 1.03) & 0.652 \\ \hline \end{tabular}} \end{table}	PMC3677906_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline & \multicolumn{4}{\|l\|}{\textbf{Spearman’s correlation coefficients (p value is two-tailed)}} \\ \hline & \textbf{NoV I} & \textbf{NoV II} & \textbf{EoV} & \textbf{AdV} \\ \hline TC & −0.503(0.196) & −0.353(0.260) & 0.359(0.452) & 0.052(0.921) \\ \hline FC & 0.078(0.878) & −0.685(0.016) & −0.462(0.113) & 0.221(0.618) \\ \hline E. coli & −0.334(0.326) & −0.587(0.088) & 0.213(0.727) & −0.213(0.727) \\ \hline \end{tabular}} \end{table}	PMC5755429_table_5
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Functional type} & \textbf{Fluffy tails (F$>$2)} & \textbf{No fluffy tails (F$<$2)} & \textbf{Positive rate} & \textbf{Negative rate} \\ \hline Regulatory regions & 51 & 9 & 85 \% & 15 \% \\ \hline Exons & 1 & 59 & 1.6 \% & 98.4 \% \\ \hline Non-coding presumed non- regulatory & 10 & 50 & 16 \% & 84 \% \\ \hline \end{tabular}} \end{table}	PMC1127108_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline Bruker SMART APEX CCD diffractometer & 3525 independent reflections \\ \hline Radiation source: fine-focus sealed tube & 1981 reflections with I $>$ 2$\sigma$(I) \\ \hline graphite & Rint = 0.046 \\ \hline Detector resolution: 0.3 pixels mm-1 & $\theta$max = 26.4°, $\theta$min = 2.1° \\ \hline $\omega$ scans & h = −12$\rightarrow$12 \\ \hline Absorption correction: multi-scan (SADABS; Bruker, 2006) & k = −13$\rightarrow$13 \\ \hline Tmin = 0.955, Tmax = 0.965 & l = −20$\rightarrow$20 \\ \hline 13533 measured reflections \\ \hline \end{tabular}} \end{table}	PMC3201509_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Energy carrier} & \textbf{Process} & \textbf{Blue water footprint (m3/1012 J)} \\ \hline Wind energy & Construction, erection and operation of the turbines & 0.0a \\ \hline Coal & Surface mining & 2–5a \\ \hline & Deep mining & 3–20a \\ \hline & Benefication & 4b \\ \hline & Slurry pipeline & 40–85b \\ \hline & Other plant operation & 90b \\ \hline & Mining, benefication, slurry pipeline and other plant operations & 136–199 \\ \hline Oil & Onshore oil extraction and production & 3–8a \\ \hline & Oil refining & 25–65a \\ \hline & Other plant operations & 70a \\ \hline & Onshore oil extraction and production, oil refining and other plant operations & 98–143 \\ \hline Natural gas & Processing & 6a \\ \hline & Pipeline operation & 3a \\ \hline & Plant operation & 100a \\ \hline & Gas processing, pipeline operation and plant operations & 109 \\ \hline Coal-powered electricity & Cooling & 0.87–15.9b \\ \hline Nuclear powered electricity & Cooling & 1.91–12.2b \\ \hline Oil/gas powered electricity & Cooling & 1.23–11.2b \\ \hline Solar thermal energy & Cooling and mirror washing & 27–1111a \\ \hline Hydropower from China & Evaporation & 3600c \\ \hline \end{tabular}} \end{table}	PMC4648423_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Validated by mimMiner or not (Y/ N) a} & \textbf{Validated by combination or not (Y/N) a} & \textbf{913 genes of monogenic diseases} & \textbf{427 genes of 165 polygenic diseases} \\ \hline N & N & 736 & 324 \\ \hline Y & Y & 116 & 75 \\ \hline Y & N & 17 & 7 \\ \hline N & Y & 44 & 21 \\ \hline \end{tabular}} \end{table}	PMC4944959_table_6
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline \textbf{Type of non-RCT PAM} & \textbf{n} \\ \hline Drug interaction and PK studies & 7 \\ \hline Post-authorisation safety studies & 5 \\ \hline Single-arm studies & 4 \\ \hline Long-term observational or non-interventional studies & 3 \\ \hline Registries & 2 \\ \hline Cohort studies & 2 \\ \hline Other & 1 \\ \hline \end{tabular}} \end{table}	PMC5042914_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Flight style estimate} & \textbf{No phylogeny} & \textbf{Livezey \& Zusi [35]} & \textbf{Hackett et al. [34]} \\ \hline Brachial index & F = 0.22, df = 1,58, p = 0.64 & F = 0.002, df = 1,57, p = 0.96 & F = 0.05, df = 1,57, p = 0.82 \\ \hline Rayner [40] & F = 2.19, df = 5,44, p = 0.07 & F = 1.59, df = 5,44, p = 0.18 & F = 1.33, df = 5,44, p = 0.27 \\ \hline Norberg [41] & F = 2.03, df = 4,47, p = 0.11 & F = 0.57, df = 4,47, p = 0.69 & F = 0.76, df = 4,47, p = 0.56 \\ \hline Wang et al. [42] & F = 0.62, df = 4,27, p = 0.65 & F = 0.09, df = 4,27, p = 0.98 & F = 0.15, df = 4,27, p = 0.96 \\ \hline \end{tabular}} \end{table}	PMC3692442_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Day} & \textbf{WT chimera} & \textbf{Rev-erb DKO chimera} \\ \hline 0 & 29 & 28 \\ \hline 1 & 28 & 27 \\ \hline 2 & 26 & 25 \\ \hline 3 & 17 & 17 \\ \hline 4 & 21 & 20 \\ \hline 5 & 22 & 20 \\ \hline 6 & 22 & 20 \\ \hline 7 & 13 & 12 \\ \hline 8 & 20 & 16 \\ \hline 9 & 12 & 9 \\ \hline 10 & 7 & 7 \\ \hline 11 & 12 & 9 \\ \hline 12 & 7 & 7 \\ \hline \end{tabular}} \end{table}	PMC4963201_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{VLPs} & \multicolumn{10}{\|l\|}{\textbf{VHH GI.1 specific}} & \multicolumn{8}{\|l\|}{\textbf{VHH GII.4 specific}} \\ \hline & \textbf{N1} & \textbf{N2} & \textbf{N3} & \textbf{N4} & \textbf{N5} & \textbf{N6} & \textbf{N7} & \textbf{N8} & \textbf{N9} & \textbf{N10} & \textbf{M1} & \textbf{M2} & \textbf{M3} & \textbf{M4} & \textbf{M5} & \textbf{M6} & \textbf{M7} & \textbf{M8} \\ \hline Norwalk (GI.1) & + & + & + & + & + & + & + & + & + & + \\ \hline MD2004 (GII.4) & & & & & & & & & & & + & + & + & + & + & + & + & + \\ \hline Chimeric GII.4 (S) / GI.1 (P) & + & + & + & + & + & + & + & + & + & + \\ \hline Chimeric GI.1 (S) / GII.4 (P) & & & & & & & & & & & + & + & + & + & + & + & + & + \\ \hline Binding Domain & P & P & P & P & P & P & P & P & P & P & P & P & P & P & P & P & P & P \\ \hline \end{tabular}} \end{table}	PMC4534396_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Gene Symbol} & \textbf{Gene Name} & \textbf{Biology Process} & \textbf{Fold Change} & \textbf{P value} \\ \hline EGR4 & early growth response 4 & regulation of cell proliferation; positive regulation of transcription; positive regulation of macromolecule metabolic process; & 12.01 & 1.81E- 153 \\ \hline EGR1 & early growth response 1 & positive regulation of transcription; cell activation; & 8.69 & 0 \\ \hline CCR4 & chemokine (C-C motif) receptor 4 & inflammatory response; defense response; response to bacterium; chemotaxis; immune response; homeostatic process; cell migration; & 7.84 & 1.80E- 06 \\ \hline LST1 & leukocyte specific transcript 1 & immune response; regulation of cell proliferation; & 7.55 & 9.81E- 03 \\ \hline FOS & v-fos FBJ murine osteosarcoma viral oncogene homolog & inflammatory response; defense response; response to extracellular/ endogenous stimulus; positive regulation of transcription; positive regulation of macromolecule metabolic process; & 7.53 & 0 \\ \hline COLEC12 & collectin sub-family member 12 & defense response; immune response; & 5.37 & 1.49E- 02 \\ \hline ARC & activity-regulated cytoskeleton-associated protein & Regionalization; endocytosis; pattern specification process; endoderm development; & 3.42 & 1.59E- 66 \\ \hline CCL20 & chemokine (C-C motif) ligand 20 & inflammatory response; defense response; response to bacterium; chemotaxis; immune response & 3.22 & 9.02E- 31 \\ \hline DUSP2 & dual specificity phosphatase 2 & regulation of phosphorylation; & 3.12 & 4.18E- 05 \\ \hline PTGS2 & prostaglandin-endoperoxide synthase 2 & response to extracellular/endogenous stimulus; response to bacterium; regulation of apoptosis; positive regulation of cell communication; regulation of cell proliferation; & 3.07 & 0 \\ \hline CREB5 & cAMP responsive element binding protein 5 & positive regulation of transcription; positive regulation of macromolecule metabolic process; & 3.02 & 2.13E- 27 \\ \hline ROCK1P1 & Rho-associated, coiled-coil containing protein kinase 1 pseudogene 1 & regulation of apoptosis; cell migration; & 2.56 & 2.81E-3 \\ \hline JUN & jun oncogene & response to extracellular stimulus; positive regulation of transcription; response to bacterium; regulation of phosphorylation; positive regulation of macromolecule metabolic process; homeostatic process; regulation of apoptosis; regulation of cell proliferation; & 1.98 & 0 \\ \hline ABL2 & v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson- related gene) & phosphate metabolic process; cytoskeleton organization; actin filament organization; cell adhesion; phosphorylation; & 1.58 & 0 \\ \hline CALCB & calcitonin-related polypeptide beta & cellular calcium ion homeostasis; signal transduction; & -7.15 & 6.26E- 05 \\ \hline LY6D & lymphocyte antigen 6 complex, locus D & cell adhesion; lymphocyte differentiation; response to stilbenoid; & -4.77 & 2.57E- 05 \\ \hline HOXA9 & homeobox A9 & skeletal system development; immune system development; hemopoiesis & -4.01 & 1.08E- 09 \\ \hline \end{tabular}} \end{table}	PMC4537115_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Gleason score} & \textbf{N} & \textbf{High} & \textbf{Low} \\ \hline 6 & 20 & 5 & 15 \\ \hline 7 & 20 & 12 & 8 \\ \hline 8 & 30 & 27 & 3 \\ \hline 9 & 10 & 9 & 1 \\ \hline 10 & 10 & 10 & 0 \\ \hline \end{tabular}} \end{table}	PMC4880832_table_0