Split (1)

train · 500 rows

image imagewidth (px) 258 933	latex stringlengths 198 5.27k	filename stringlengths 18 19
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline Group ID & Age (yrs) & PTA-L (dB) & PTA-R (dB) & VCV in Quiet (dB) \\ \hline HI02 & 34.8 & 43.3 & 50.0 & n/a \\ \hline HI08 & 21.2 & 55.0 & 55.0 & n/a \\ \hline HI09 & 56.1 & 43.3 & 40.0 & 59.6 \\ \hline HI10 & 53.7 & 41.7 & 38.3 & 57.5 \\ \hline HI13 & 41.5 & 45.0 & 41.7 & 67.0 \\ \hline HI14 & 23.6 & 35.0 & 30.0 & 51.3 \\ \hline HI16 & 68.9 & 33.3 & 28.3 & 48.4 \\ \hline HI17 & 67.1 & 23.3 & 30.0 & 46.2 \\ \hline HI18 & 52.8 & 40.0 & 45.0 & 63.8 \\ \hline MEAN (sem) & 46.6 (5.8) & 40.0 (2.9) & 39.8 (3.1) & 56.2 (3.0) \\ \hline Group ID & Age (yrs) & PTA-L (dB) & PTA-R (dB) & VCV in Quiet (dB) \\ \hline NH01 & 18.4 & 13.3 & 15.0 & 28.0 \\ \hline NH03 & 44.8 & 6.7 & 6.7 & 33.6 \\ \hline NH04 & 38.1 & 3.3 & -3.3 & 30.4 \\ \hline NH06 & 48.3 & 8.3 & 3.3 & 28.9 \\ \hline NH07 & 45.0 & 8.3 & 6.7 & 26.7 \\ \hline NH11 & 38.8 & 1.7 & 5.0 & 28.5 \\ \hline NH12 & 66.8 & 8.3 & 11.7 & 37.8 \\ \hline MEAN (sem) & 42.9 (5.4) & 7.1 (1.4) & 6.4 (2.2) & 30.6 (1.5) \\ \hline Group ID & Age (yrs) & PTA-L (dB) & PTA-R (dB) & VCV in Quiet (dB) \\ \hline NHSL19 & 47.5 & 5.0 & 1.7 & n/a \\ \hline NHSL20 & 54.3 & 10.0 & 5.0 & n/a \\ \hline NHSL21 & 20.5 & 3.3 & 8.3 & 23.4 \\ \hline NHSL22 & 25.6 & 5.0 & 8.3 & 25.0 \\ \hline NHSL23 & 24.6 & 6.7 & 13.3 & 28.7 \\ \hline NHSL24 & 21.5 & 6.7 & 5.0 & 27.9 \\ \hline NHSL25 & 21.3 & 1.7 & 5.0 & 24.6 \\ \hline NHSL26 & 20.5 & 5.0 & 8.3 & 31.1 \\ \hline MEAN (sem) & 29.5 (4.8) & 5.4 (0.9) & 6.9 (1.2) & 26.8 (1.2) \\ \hline \end{tabular}} \end{table}	PMC4856319_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Code} & \textbf{Value} & \textbf{\%agea} & \textbf{Description} \\ \hline J & 161 & 9.7 & Translation \\ \hline A & 2 & 0.1 & RNA processing and modification \\ \hline K & 59 & 3.5 & Transcription \\ \hline L & 72 & 4.3 & Replication, recombination and repair \\ \hline B & 2 & 0.1 & Chromatin structure and dynamics \\ \hline D & 7 & 0.4 & Cell cycle control, mitosis and meiosis \\ \hline Y & 0 & 0.0 & Nuclear structure \\ \hline V & 18 & 1.1 & Defense mechanisms \\ \hline T & 20 & 1.2 & Signal transduction mechanisms \\ \hline M & 39 & 2.3 & Cell wall/membrane biogenesis \\ \hline N & 4 & 0.2 & Cell motility \\ \hline Z & 0 & 0.0 & Cytoskeleton \\ \hline W & 0 & 0.0 & Extracellular structures \\ \hline U & 11 & 0.7 & Intracellular trafficking and secretion \\ \hline O & 49 & 2.9 & Posttranslational modification, protein turnover, chaperones \\ \hline C & 79 & 4.7 & Energy production and conversion \\ \hline G & 79 & 4.7 & Carbohydrate transport and metabolism \\ \hline E & 73 & 4.4 & Amino acid transport and metabolism \\ \hline F & 44 & 2.6 & Nucleotide transport and metabolism \\ \hline H & 53 & 3.2 & Coenzyme transport and metabolism \\ \hline I & 15 & 0.9 & Lipid transport and metabolism \\ \hline P & 67 & 4.0 & Inorganic ion transport and metabolism \\ \hline Q & 5 & 0.3 & Secondary metabolites biosynthesis, transport and catabolism \\ \hline R & 194 & 11.6 & General function prediction only \\ \hline S & 116 & 7.0 & Function unknown \\ \hline - & 575 & 34.5 & Not in COGs \\ \hline \end{tabular}} \end{table}	PMC3236042_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Field devices for drought study} & \textbf{Cost} & \textbf{Strengths} & \textbf{Limitations} & \textbf{Suitable climate and soils} & \textbf{Reference} \\ \hline Late planting with drainage in rainy season trial & Large uniform field management & High chance of reproductive and terminal drought & Photoperiod non-sensitive & Semi-arid tropics & Pantuwan et al. (2002a) \\ \hline Dry-season trial & Large uniform field management & High chance of drought, vegetative drought & Photoperiod non-sensitive, genotype-by-season interaction & Semi-arid tropics & Pantuwan et al. (2004) \\ \hline Line-source sprinkler & Equipment, water source, monitoring & Different water regimes & Wind, space & Semi-arid to arid climate & Garrity and O’Toole (1994) \\ \hline Rainout shelter & Construction & All types of drought & Space, cost & & Lilley and Fukai (1994) \\ \hline Greenhouse & Construction & All types of drought & Space, cost, rhizosphere differences (small and loose) & & Yadav et al. (1997), Wade et al. (2000) \\ \hline Root restriction & Rhizosphere manipulation & Evaluation of non-root traitsa & Space & Hardpan, simulated lowland & Kato et al. (2007) \\ \hline Raised bed & Rhizosphere manipulation & Dry surface soil (interrupt capillary water) & Space & Sub-humid climate & Kato et al. (2007) \\ \hline \end{tabular}} \end{table}	PMC3429056_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Category} & \textbf{Gender} & \multicolumn{2}{\|l\|}{\textbf{Age}} & \textbf{Nutritional classification} \\ \hline & \textbf{Female a OR (95\%CI)} & \textbf{20 to 23 years b OR (95\%CI)} & \textbf{$>$23 years b OR (95\%CI)} & \textbf{BMI $>$ 25.1 kg•m−1 c OR (95\%CI)} \\ \hline Regular & 1.10 (0.95–1.28) & 1.01 (0.90–1.14) & 0.93 (0.80–1.08) & 0.92 (0.80–1.05) \\ \hline Good & 0.67 (0.60–0.75) & 0.83 (0.74–0.94) & 1.06 (0.91–1.24) & 0.88 (0.77–1.01) \\ \hline Very good & 0.54 (0.49–0.61) & 0.92 (0.82–1.03) & 0.86 (0.74–0.99) & 0.87 (0.76–1.12) \\ \hline Excellent & 0.57 (0.51–0.64) & 1.06 (0.94–1.19) & 1.16 (1.01–1.34) & 0.78 (0.69–1.09) \\ \hline \end{tabular}} \end{table}	PMC4478172_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & & \textbf{2001 IHM (\%)} & \textbf{2002 IHM (\%)} & \textbf{2003 IHM (\%)} & \textbf{2004 IHM (\%)} & \textbf{2005 IHM (\%)} & \textbf{2006 IHM (\%)} & \textbf{2007 IHM (\%)} & \textbf{2008 IHM (\%)} & \textbf{p*} \\ \hline \\ \hline 40-54 & Men & 0.00 & 0.16 & 0.24 & 0.15 & 0.00 & 0.06 & 0.17 & 0.11 & 0.924 \\ \hline & Women & 0.15 & 0.44 & 0.00 & 0.70 & 0.00 & 0.13 & 0.00 & 0.23 & 0.367 \\ \hline 50-64 & Men & 0.23 & 0.21 & 0.46 & 0.10 & 0.05 & 0.13 & 0.21 & 0.16 & 0.239 \\ \hline & Women & 0.06 & 0.06 & 0.06 & 0.06 & 0.13 & 0.12 & 0.28 & 0.27 & 0.018 \\ \hline 65-74 & Men & 0.49 & 0.49 & 0.41 & 0.18 & 0.39 & 0.34 & 0.31 & 0.19 & 0.025 \\ \hline & Women & 0.27 & 0.47 & 0.22 & 0.40 & 0.26 & 0.24 & 0.40 & 0.30 & 0.884 \\ \hline 75-84 & Men & 1.68 & 1.66 & 1.41 & 0.80 & 0.97 & 1.10 & 1.26 & 1.05 & 0.046 \\ \hline & Women & 0.77 & 0.84 & 0.52 & 1.06 & 0.70 & 0.87 & 0.69 & 0.71 & 0.736 \\ \hline $\geq$ 85 & Men & 8.75 & 8.28 & 3.91 & 9.55 & 5.73 & 5.53 & 4.90 & 6.10 & 0.004 \\ \hline & Women & 3.85 & 3.78 & 5.97 & 5.63 & 5.25 & 3.70 & 5.45 & 3.60 & 0.435 \\ \hline Total & Men & 0.75 & 0.76 & 0.69 & 0.47 & 0.47 & 0.53 & 0.60 & 0.55 & 0.511 \\ \hline & Women & 0.54 & 0.68 & 0.57 & 0.87 & 0.66 & 0.63 & 0.78 & 0.65 & 0.722 \\ \hline & Both & 0.63 & 0.71 & 0.62 & 0.69 & 0.57 & 0.59 & 0.69 & 0.61 & 0.479 \\ \hline \end{tabular}} \end{table}	PMC3041728_table_4
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Microbes} & & \textbf{dVIN-Sample1 (vulvar tissue)} & \textbf{Negative Control (vulvar tissue)} & \textbf{Positive Control (HHV3-positive cerebrospinal fluid)} \\ \hline \multicolumn{5}{\|l\|}{Virus} \\ \hline & Anelloviridae & 30 & 25 & 107,433 \\ \hline & Circoviridae & 0 & 2 & 0 \\ \hline & bacteriophage (Pseudomonas) & 158 & 72 & 3 \\ \hline & bacteriophage (other) & 17 & 231 & 42 \\ \hline & human herpesvirus 3 (HHV3) & 1 & 0 & 11,452 \\ \hline \multicolumn{5}{\|l\|}{Bacteria} \\ \hline & Pseudomonas & 2,942,883 & 970,177 & 7,505 \\ \hline & other bacteria & 279,849 & 122,218 & 1,569 \\ \hline & \% Pseudomonas & 91\% & 89\% & 83\% \\ \hline \end{tabular}} \end{table}	PMC4404153_table_3
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Response variable} & \textbf{Models} & \textbf{Intercept (a)} & \textbf{Slope} & \textbf{Phi} & \textbf{AICc} & \textbf{$\Delta$ AICc} & \textbf{Weight} & \textbf{Pseudo-R²} \\ \hline Species Richness (S) & a + blogAREA & 2.626 (0.151) & b = 0.144 (0.028) & — & 60.6 & 0 & 0.803 & 0.311 \\ \hline & a + blogPROX & 2.496 (0.189) & b = 0.133 (0.029) & — & 64.4 & 3.8 & 0.119 & 0.263 \\ \hline & a + blogAREA + clogPROX & 2.659 (0.165) & b = 0.164 (0.083) c = −0.021 (0.082) & — & 65.3 & 4.7 & 0.075 & 0.318 \\ \hline & a + blogAREA + clogPROX + dlogAREAlogPROX & 2.896 (0.414) & b = 0.078 (0.156) c = −0.047 (0.090) d = 0.009 (0.015) & — & 72.1 & 11.5 & 0.002 & 0.317 \\ \hline & a & 3.266 (0.065) & — & — & 81.7 & 21.2 & $<$0.001 & — \\ \hline Species similarity (Ss) & a + bSA + cSB + dSASB & 2.472 (0.389) & b = −0.078 (0.012) c = −0.058 (0.019) d = 0.002 (0.0006) & 80.85 (18.95) & −97.2 & 0 & 0.991 & 0.797 \\ \hline & a + bSA + cSB & 1.078 (0.188) & b = −0.033 (0.004) c = 0.012 (0.008) & 56.72 (13.26) & −87.1 & 10.1 & 0.006 & 0.586 \\ \hline & a + bSA + cSB + dDIST & 1.058 (0.186) & b = −0.034 (0.004) c = 0.010 (0.008) d = 0.005 (0.005) & 58.55 (13.69) & −85.5 & 11.6 & 0.003 & 0.606 \\ \hline & a + bDIST & 0.432 (0.152) & b = −0.002 (0.007) & 21.10 (4.86) & −56.4 & 40.8 & $<$0.001 & 0.002 \\ \hline & a & 0.391 (0.072) & — & 21.04 (4.85) & −54.1 & 43.1 & $<$0.001 & — \\ \hline \end{tabular}} \end{table}	PMC5736758_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Author (year)} & \textbf{Age} & \textbf{Symptoms} & \textbf{Histology} & \textbf{Outcome} \\ \hline Beaver (1986) [34] & 73 & Cholecystitis & Lobular & NM \\ \hline Rubin (1989) [43] & 55 & Biliary colic & Lobular & NM \\ \hline Pappo (1991) [44] & NM & Obstructive jaundice & Lobular & Alive (16 months) \\ \hline Crawford (1996) [35] & 66 & Cholecystitis & Ductal & Alive -1 year \\ \hline Crawford (1996) [35] & 57 & Cholecystitis & Lobular & Died-3 years \\ \hline Shah (2000) [38] & 78 & Bile peritonitis-necrotic gallbladder perforation & NM (description of Lobular) & Died-5 days \\ \hline Boari (2005) [31] & 81 & Cholecystitis & Undifferentiated & Not mentioned \\ \hline Doval (2006) [33] & NM & Cholecystitis & Lobular (signet) & Died ‘few months’ \\ \hline Murguia (2006) [32] & 62 & Biliary & Ductal & Died 2 years-without recurrence \\ \hline Zagouri (2007) [30] & 59 & Cholecystitis & Lobular & Alive (12 months) \\ \hline Manouras (2008) [45] & 46 & Cholecystitis & & Died- 1 year \\ \hline Jones (2009) [37] & 84 & Acute abdomen-Ruptured gallbladder & Lobular & Alive (34 months follow up). \\ \hline Present report (2010) & 56 & Cholecystitis & Ductal & Died 5 months \\ \hline \end{tabular}} \end{table}	PMC2944133_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Parameter} & \textbf{Adults} & \textbf{Children} \\ \hline Number (\% of total) & 659 (91\%) & 65 (9\%) \\ \hline Age (median, IQR) & 36 (31-43) & 6 (3-10) \\ \hline Number (\%) of females & 351 (53\%) & 28 (43\%) \\ \hline Year of ART start (median; range) & 2004 (2000- 2005) & 2004 (2002- 2005) \\ \hline ART free of charge at start (after 10 June 2004) & 440 (67\%) & 52 (80\%) \\ \hline CD4 at start of ART (median, IQR)* & 71 (22-141) & 184 (28-423) \\ \hline \multicolumn{3}{\|l\|}{Reason ART start} \\ \hline Low CD4 count & 72 (11\%) & 3 (5\%) \\ \hline WHO stage 3 & 444 (67\%) & 58 (89\%) \\ \hline WHO stage 4 & 124 (19\%) & 3 (5\%) \\ \hline Transfer in & 3 (0.5\%) & 0 (0\%) \\ \hline Not recorded & 16 (2.5\%) & 1 (1\%) \\ \hline Days of follow up on ART (median, IQR) & 73 (14-303) & 92 (13-210) \\ \hline \multicolumn{3}{\|l\|}{Number (\%) by time period since start of ART} \\ \hline No follow-up & 109 (17\%) & 13 (20\%) \\ \hline Months 1 to 6 & 331 (50\%) & 32 (49\%) \\ \hline Months 7 to 12 & 78 (12\%) & 12 (19\%) \\ \hline Months 13 or later & 141 (21\%) & 8 (12\%) \\ \hline Number (\%) with telephone contact ☎ & 307 (47\%) & 24 (37\%) \\ \hline Residence in Lilongwe & 567 (86\%) & 58 (89\%) \\ \hline \end{tabular}} \end{table}	PMC3039578_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline & \multicolumn{3}{\|l\|}{\textbf{2006}} & \multicolumn{3}{\|l\|}{\textbf{2007}} \\ \hline \textbf{of} & \textbf{Male} & \textbf{Female} & \textbf{Total} & \textbf{Male} & \textbf{Female} & \textbf{Total} \\ \hline \multicolumn{7}{\|l\|}{in Santa Rosa*} \\ \hline Adult & 6 & 9 & 15 & 6 & 8 & 14 \\ \hline Sub-adult & 2 & 7 & 9 & 2 & 6 & 8 \\ \hline Juvenile & 0 & 0 & 0 & 0 & 0 & 0 \\ \hline Infant & 4 & 2 & 6 & 3 & 2 & 5 \\ \hline Total & 12 & 18 & 30 & 11 & 16 & 27 \\ \hline \multicolumn{7}{\|l\|}{Punta Laguna – East} \\ \hline Adult & 2 & 8 & 10 & 1 & 8 & 9 \\ \hline Sub-adult & 1 & 0 & 1 & 3 & 3 & 6 \\ \hline of Juvenile & 2 & 2 & 4 & 2 & 2 & 4 \\ \hline Infant & 5 & 2 & 7 & 4 & 0 & 4 \\ \hline Total & 10 & 12 & 22 & 10 & 13 & 23 \\ \hline \multicolumn{7}{\|l\|}{Punta Laguna – West} \\ \hline Adult & 5 & 9 & 14 & 5 & 8 & 13 \\ \hline Sub-adult & 1 & 2 & 3 & 1 & 2 & 3 \\ \hline Juvenile & 3 & 4 & 7 & 3 & 4 & 7 \\ \hline Infant & 2 & 1 & 3 & 2 & 2 & 6‘ \\ \hline Total & 11 & 16 & 27 & 11 & 16 & 29 \\ \hline \end{tabular}} \end{table}	PMC3176216_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Subscale} & \textbf{Patients 7 years postoperative (n = 151)} & \textbf{Reference group 7 years Postoperative (n = 65)} & \textbf{p-value} \\ \hline SF-36 PF & 54 (27.2) & 69 (31.3) & 0.01 \\ \hline SF-36 RP & 45 (44.6) & 60 (46.0) & 0.05 \\ \hline SF-36 BP & 63 (28.1) & 69 (26.9) & 0.19 \\ \hline 10 SF-36 GH & 63 (22.4) & 62 (25.0) & 0.94 \\ \hline SF-36 VT & 59 (46.4) & 72 (43.0) & 0.05 \\ \hline the SF-36 SF & 62 (23.8) & 65 (21.8) & 0.36 \\ \hline SF-36 RE & 81 (23.2) & 79 (24.7) & 0.53 \\ \hline (Fig- SF-36 MH & 79 (19.1) & 72 (43.0) & 0.90 \\ \hline the WOMAC pain & 86 (16.5) & 91 (18.2) & 0.05 \\ \hline 7-year WOMAC stiffness & 78 (22.1) & 89 (20.0) & $<$0.001 \\ \hline WOMAC function & 76 (21.1) & 73 (23.8) & 0.56 \\ \hline \end{tabular}} \end{table}	PMC2847954_table_4
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & \multicolumn{9}{\|l\|}{\textbf{Mean ($\pm$ SEM) msec in SRTT performance}} \\ \hline & \multicolumn{3}{\|l\|}{\textbf{Training 1}} & \multicolumn{3}{\|l\|}{\textbf{Training 2}} & \multicolumn{3}{\|l\|}{\textbf{Retrieval}} \\ \hline \textbf{Block properties} & \textbf{Fixed} & \textbf{Random} & \textbf{Delta (Random- Fixed)} & \textbf{Fixed} & \textbf{Random} & \textbf{Delta (Random- Fixed)} & \textbf{Fixed} & \textbf{Random} & \textbf{Delta (Random - Fixed)} \\ \hline Block No.: & 2 & 3 & 3–2 & 6 & 7 & 7–6 & 9 & 10 & 10–9 \\ \hline Sleep group & 459.2 (14.9) & 476.5 (14.9) & 17.3 (8.4) & 411.2 (12.7) & 456.1 (12.9) & 44.8 (5.5) & 352.9 (14.23) & 458.2 (21.9) & 105.3 (22.9) \\ \hline Nighttime-awake group & 496.7 (16.8) & 511.2 (10.9) & 14.5 (14.2) & 433.9 (10.4) & 497.8 (13.9) & 63.9 (8.2) & 386.3 (10.3) & 462.2 (11.8) & 75.9 (9.7) \\ \hline Daytime- awake group & 558.2 (25.8) & 591.0 (21.8) & 32.8 (13.1) & 481.7 (25.7) & 538.7 (27.9) & 57.0 (11.4) & 446.6 (20.7) & 484.2 (14.2) & 37.6 (16.9) \\ \hline Daytime-awake- subsequent-WPAT group & 471.0 (36.8) & 524.7 (33.6) & 53.7 (9.8) & 462.7 (30.9) & 562.0 (31.1) & 99.3 (10.0) & 390.5 (22.0) & 517.9 (24.7) & 127.4 (6.9) \\ \hline \end{tabular}} \end{table}	PMC3514228_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{ZM651} & \textbf{IN98025} & \textbf{IN98026} & \textbf{TZ97008} & \textbf{ZA97002} & \textbf{TZ97005} & \textbf{CN98005} & \textbf{ZA97010} & \textbf{CN97001} & \textbf{ZA97012} \\ \hline ZM651 & * & 78 & 77 & 77 & 78 & 79 & 77 & 77 & 77 & 75 \\ \hline IN98025 & & * & 84 & 77 & 78 & 79 & 84 & 78 & 83 & 77 \\ \hline IN98026 & & & * & 79 & 78 & 80 & 85 & 79 & 85 & 78 \\ \hline TZ97008 & & & & * & 79 & 79 & 78 & 79 & 78 & 78 \\ \hline ZA97002 & & & & & * & 78 & 78 & 78 & 77 & 78 \\ \hline TZ97005 & & & & & & * & 79 & 77 & 80 & 77 \\ \hline CN98005 & & & & & & & * & 77 & 89 & 77 \\ \hline ZA97010 & & & & & & & & * & 78 & 81 \\ \hline CN97001 & & & & & & & & & * & 77 \\ \hline ZA97012 & & & & & & & & & & * \\ \hline \end{tabular}} \end{table}	PMC2920315_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline \textbf{miRNA} & \textbf{Sequence} \\ \hline U6 & gtgctcgcttcggcagcacatatac \\ \hline miR-15b & tagcagcacatcatggtttaca \\ \hline miR-29a & tagcaccatctgaaatcggtt \\ \hline miR-29b & tagcaccatttgaaatcagtgtt \\ \hline miR-29c & tagcaccatttgaaatcggt \\ \hline miR-197 & ttcaccaccttctccacccagc \\ \hline miR-200c & taatactgccgggtaatgatgga \\ \hline \end{tabular}} \end{table}	PMC6165274_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & \multicolumn{12}{\|l\|}{\textbf{Coffee Consumption, cups/day}} \\ \hline & \multicolumn{3}{\|l\|}{\textbf{1~2}} & \multicolumn{3}{\|l\|}{\textbf{2~3}} & \multicolumn{3}{\|l\|}{\textbf{3~4}} & \multicolumn{3}{\|l\|}{\textbf{$>$ 4}} \\ \hline & \textbf{Number of estimates} & \textbf{OR} & \textbf{95\% CI} & \textbf{Number of estimates} & \textbf{OR} & \textbf{95\% CI} & \textbf{Number of estimates} & \textbf{OR} & \textbf{95\% CI} & \textbf{Number of estimates} & \textbf{OR} & \textbf{95\% CI} \\ \hline \multicolumn{13}{\|l\|}{Sex} \\ \hline Men & 8 & 1.16 & 0.96, 1.40 & 7 & 1.15 & 0.88, 1.50 & 8 & 1.75 & 1.44, 2.14 & 12 & 2.01 & 1.71, 2.36 \\ \hline Women & 4 & 0.94 & 0.78, 1.14 & 6 & 0.91 & 0.74, 1.13 & 2 & 1.07 & 0.68, 1.68 & 6 & 0.91 & 0.67, 1.23 \\ \hline Both sexes & 6 & 1.05 & 0.85, 1.31 & 6 & 1.00 & 0.87, 1.16 & 3 & 1.14 & 0.75, 1.74 & 8 & 1.35 & 1.14, 1.61 \\ \hline \multicolumn{13}{\|l\|}{Coffee type} \\ \hline Caffeinated & 4 & 0.96 & 0.70, 1.31 & 2 & 1.03 & 0.80, 1.33 & 2 & 1.23 & 0.71, 2.13 & 5 & 1.45 & 0.99, 2.12 \\ \hline Decaffeinated & 3 & 1.15 & 0.81, 1.63 & 2 & 1.42 & 0.90, 2.25 & 2 & 1.42 & 0.82, 2.47 & 2 & 1.86 & 1.19, 2.90 \\ \hline All types & 11 & 1.07 & 0.95, 1.21 & 11 & 1.03 & 0.86, 1.22 & 9 & 1.49 & 1.07, 2.07 & 14 & 1.46 & 1.13, 1.88 \\ \hline \multicolumn{13}{\|l\|}{Study location} \\ \hline Europe & 12 & 1.03 & 0.88, 1.22 & 13 & 1.02 & 0.87, 1.20 & 10 & 1.29 & 0.98, 1.71 & 13 & 1.32 & 1.02, 1.72 \\ \hline United States & 5 & 1.15 & 0.96, 1.38 & 1 & 1.13 & 0.89, 1.43 & 3 & 1.68 & 1.29, 2.19 & 7 & 1.80 & 1.33, 2.45 \\ \hline \multicolumn{13}{\|l\|}{Study design} \\ \hline Cohort & 6 & 1.05 & 0.81, 1.36 & 4 & 0.87 & 0.72, 1.05 & 5 & 0.96 & 0.74, 1.24 & 10 & 1.19 & 0.91, 1.55 \\ \hline Case-control & 12 & 1.08 & 0.95, 1.22 & 11 & 1.14 & 0.98, 1.32 & 8 & 1.68 & 1.41, 1.99 & 11 & 1.79 & 1.45, 2.20 \\ \hline \multicolumn{13}{\|l\|}{NOS score} \\ \hline 9 & 10 & 1.00 & 0.84, 1.19 & 10 & 1.09 & 0.91, 1.30 & 7 & 1.33 & 0.93, 1.90 & 10 & 1.24 & 0.93, 1.65 \\ \hline 8 & 2 & 1.52 & 0.75, 3.10 & 0 & - & - & 2 & 1.69 & 0.53, 5.36 & 4 & 1.89 & 1.22, 2.93 \\ \hline 7 & 6 & 1.14 & 0.98, 1.31 & 5 & 0.98 & 0.80, 1.20 & 4 & 1.54 & 1.23, 1.93 & 7 & 1.71 & 1.32, 2.22 \\ \hline \end{tabular}} \end{table}	PMC5940396_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline \textbf{Items} & \textbf{Mean $\pm$ SD} \\ \hline Tumor volume (cm3) & 8.47 $\pm$ 6.22 \\ \hline No. of isocenters & 6.24 $\pm$ 1.11 \\ \hline Central dose (Gy) & 36.34 $\pm$ 2.11 \\ \hline Marginal dose (Gy) & 13.6 $\pm$ 1.02 \\ \hline Maximum dose (Gy) & 28.35 $\pm$ 5.37 \\ \hline \end{tabular}} \end{table}	PMC4617952_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Species} & \textbf{FST} \\ \hline H. vulcanorum & Mgahinga & Kahuzi-Biega \\ \hline \multicolumn{3}{\|l\|}{Mgahinga} \\ \hline Kahuzi-Biega & 0.005 \\ \hline Itombwe & 0.043 & 0.025 \\ \hline H. kerbispeterhansi & Mau \\ \hline Mt Elgon & 0.351 \\ \hline S. vulcanorum & Kahuzi-Biega & Itombwe \\ \hline \multicolumn{3}{\|l\|}{Kahuzi-Biega} \\ \hline Itombwe & 0.295 \\ \hline Echuya & 0.263 & 0.332 \\ \hline S. mundus & Mt Kenya & Mau \\ \hline \multicolumn{3}{\|l\|}{Mt Kenya} \\ \hline Mau & 0.184 \\ \hline Mt Elgon & 0.310 & 0.295 \\ \hline \end{tabular}} \end{table}	PMC4578943_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{of Genes} & \textbf{FlyBase r1.4} & \textbf{Hu et al. (2012)} & \textbf{M252} \\ \hline Total number of genes & 15 548 & 10 786 & 12 990 \\ \hline of of Total number of genes + strand & 7836 & 5416 & 6486 \\ \hline Total number of genes – strand & 7712 & 5370 & 6504 \\ \hline Mean gene length & 3.3 kb & 3.8 kb & 5.3 kb \\ \hline of Gene density genes/Mb & 113 & 86 & 104 \\ \hline Number of transcripts & 15 550 & 10 786 & 28 682 \\ \hline Average isoforms per gene & 1.0 & 1.0 & 2.5 \\ \hline Percentage of transcripts with introns & 77\% & 84\% & 90\% \\ \hline in Mean transcript length & 1.2 kb & 2.0 kb & 2.5 kb \\ \hline \multicolumn{4}{\|l\|}{Exons} \\ \hline Number & 53 445 & 44 029 & 52 755 \\ \hline Mean number per transcript & 3.4 & 4.1 & 4.1 \\ \hline GC content & 52.9 & 46.5 & 50.4 \\ \hline Mean length (bp) & 356 & 498 & 533 \\ \hline Total length (bp) & 19 040 408 & 21 918 667 & 28 112 055 \\ \hline \multicolumn{4}{\|l\|}{Introns} \\ \hline Number & 37 897 & 33 222 & 39 767 \\ \hline Mean number per transcript & 3.2 & 3.7 & 3.9 \\ \hline GC content & 37.3 & 48.4 & 36.5 \\ \hline Mean length (bp) & 870 & 585 & 887 \\ \hline Total length (bp) & 32 971 902 & 19 446 332 & 35 255 589 \\ \hline \multicolumn{4}{\|l\|}{UTRs*} \\ \hline Number of genes with UTRs & 4 & 9996 & 9274 \\ \hline Mean UTR length (bp) & 2 & 262 & 455 \\ \hline Number of 50UTRs & 4 & 9549 & 8991 \\ \hline Mean 50UTR length (bp) & 2 & 206 & 367 \\ \hline Number of 30UTRs & 0 & 9786 & 8833 \\ \hline Mean 30UTR length (bp) & – & 317 & 543 \\ \hline Pseudogenes & 2 & 0 & 781 \\ \hline \end{tabular}} \end{table}	PMC4344813_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Recipients} & \textbf{Vector ID} & \textbf{Vector architecture} & \textbf{No. of plant lines examined} & \textbf{No. of albino plant lines} & \textbf{No. of mosaic plant lines} & \textbf{Mutation rate (\%)} \\ \hline MD & pGGE1c & Cas9 + sgR1 & 152 & 109 & 24 & 87.5 \\ \hline MD & pGGE2c & Cas9 + sgR2 & 62 & 28 & 8 & 58.1 \\ \hline MD & pGGE3c & Cas9 + sgR1 + sgR2 & 18 & 16 & 2 & ND \\ \hline hCas9 transgenic MD & pGGE2 & sgR2 & 36 & 17 & 3 & 55.6 \\ \hline hCas9 transgenic MD & pGGE3 & sgR1 + sgR2 & 11 & 10 & 1 & ND \\ \hline MD & pGGE3 & sgR1 + sgR2 & 27 & 0 & 0 & 0 \\ \hline \end{tabular}} \end{table}	PMC4738242_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Colony} & \textbf{Head length to end of nasus} & \textbf{Head width (max.)} & \textbf{Pronotal width} & \textbf{Hind tibia length} \\ \hline GUA16 (n=12) & 1.38–1.50 & 0.76–0.84 & 0.36–0.41 & 0.66–0.78 \\ \hline GUA33 (n=12) & 1.48–1.63 & 0.83–0.91 & 0.42–0.48 & 0.76–0.84 \\ \hline HN431 (n=12) & 1.37–1.49 & 0.76–0.82 & 0.41–0.43 & 0.68–0.76 \\ \hline HN822 (n=10) & 1.37–1.46 & 0.71–0.80 & 0.36–0.39 & 0.64–0.75 \\ \hline NI114 (n=12) & 1.30–1.43 & 0.69–0.75 & 0.40–0.42 & 0.64–0.75 \\ \hline Range & 1.30–1.63 & 0.69–0.91 & 0.36–0.48 & 0.64–0.84 \\ \hline Mean & 1.44 & 0.78 & 0.40 & 0.72 \\ \hline \end{tabular}} \end{table}	PMC5027770_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Antibody} & \textbf{Supplier/source} & \textbf{Dilution} \\ \hline Rat-anti-mouse CD31(PECAM-1) & BD Pharmingen & 1:100 \\ \hline Rat-anti-mouse F4/80 (Clone A3-1) & Serotech & 1:50 \\ \hline Rabbit-anti-cow-cytokeratin & DAKO & 1:500 \\ \hline Rabbit-anti-cow-GFAP & DAKO & 1:500 \\ \hline Goat-anti-rabbit-pyruvate kinase & Rockland incorporation & 1:500-1:1,000 \\ \hline Mouse-anti-human pyruvate kinase (Clone DF 4) & Schebo Biotech AG & 1:50 \\ \hline Rabbit-anti-human-M2-Pk & Cell Signaling & 1:100 \\ \hline Chicken-anti-vimentin & Chemicon & 1:5,000 \\ \hline Mouse-anti-vimentin S82 & & 1:100 \\ \hline Rat-anti-BrdU & Serotech & 1:50 \\ \hline Mouse-anti-human-E-cadherin & BD Transduction laboratories & 1:100 \\ \hline Mouse-anti-rat-Nestin (Clone Rat-401) & Chemicon & 1:100 \\ \hline Anti-alpha-smooth muscle actin (Clone 1A4) & SIGMA & 1:100 \\ \hline Mouse-anti-human-N-cadherin & BD Transduction laboratories & 1:100 \\ \hline Rabbit-anti-mouse-LI-cadherin & Gift from Dr. R. Geßner & 1:1,000 \\ \hline \end{tabular}} \end{table}	PMC2964607_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline Category & Subcategory & Propertya \\ \hline Material properties & & PSD (ENM and aerosol) \\ \hline Geographical parameters & Physical description & Interfacial Area (air–water, air–soil) \\ \hline & & Mixing height \\ \hline & & Water depth \\ \hline & & Water flow rate \\ \hline & & Average suspend solids diameter \\ \hline & & Sediment depth \\ \hline & & Soil depth \\ \hline & Dry deposition to vegetation & Roughness factor \\ \hline & & Characteristic field length \\ \hline & & Crop vegetation factor \\ \hline & Dry deposition to soil & Roughness height \\ \hline & Wind resuspension of soil & Soil erodibility \\ \hline Meteorological parameters & & Monthly Temperature (air, water) \\ \hline & & Wind speed (monthly, annual average, max) \\ \hline & & Rainfall rate (monthly) \\ \hline LearNano parameters & & ENM Global production rate \\ \hline & & Transfer coefficients (ENM specific) \\ \hline & & Transfer coefficients (application specific) \\ \hline & & Transfer coefficients (region specific) \\ \hline \end{tabular}} \end{table}	PMC4419581_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Variable} & \textbf{N} & \textbf{Minimum} & \textbf{Maximum} & \textbf{Range} & \textbf{Lower quarter} & \textbf{Median} & \textbf{Upper quartile} \\ \hline Summation of scores for PCQ-P pre PDQ & 30 & 52 & 96 & 44 & 74.00 & 83.00 & 89.25 \\ \hline Summation of scores for PCQ-P post PDQ & 30 & 58 & 101 & 43 & 74.75 & 85.00 & 94.25 \\ \hline Summation of scores for CARE pre PDQ & 30 & 20 & 50 & 30 & 29.75 & 43.00 & 47.25 \\ \hline Summation of scores for CARE post PDQ & 30 & 25 & 50 & 25 & 35.50 & 43.00 & 48.00 \\ \hline \end{tabular}} \end{table}	PMC4399754_table_5
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|} \hline & \textbf{Heart failure (n = 28)} & \textbf{Controls (n = 10)} & \textbf{P value} \\ \hline Forced expiratory volume in 1 sec (\% predicted) & 83 � 14 & 104 � 14 & $<$0.001 \\ \hline Forced vital capacity (\% predicted) & 85 � 16 & 104 � 14 & 0.003 \\ \hline Total lung capacity (\% predicted) & 97 � 15 & 111 � 13 & 0.016 \\ \hline Functional residual capacity (\% predicted) & 80 � 18 & 94 � 15 & 0.125 \\ \hline Residual volume (\% predicted) & 99 � 24 & 93 � 31 & 0.487 \\ \hline Transfer factor for the lung for carbon monoxide (\% predicted) & 80 � 18 & 107 � 12 & $<$0.001 \\ \hline Maximal inspiratory pressure (\% predicted) & 83 � 27 & 108 � 36 & 0.044 \\ \hline Maximal expiratory pressure (\% predicted) & 92 � 25 & 112 � 22 & 0.047 \\ \hline \end{tabular}} \end{table}	PMC4632958_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline [Dy2(C9H9O3)6(C12H8N2)2] & F(000) = 1684 \\ \hline Mr = 1676.38 & Dx = 1.578 Mg m−3 \\ \hline Monoclinic, P21/c & Mo K$\alpha$ radiation, $\lambda$ = 0.71073 Å \\ \hline Hall symbol: -P 2ybc & Cell parameters from 9890 reflections \\ \hline a = 11.4738 (1) Å & $\theta$ = 1.6–25.0° \\ \hline b = 25.8057 (3) Å & µ = 2.18 mm−1 \\ \hline c = 13.8525 (2) Å & T = 296 K \\ \hline $\beta$ = 120.657 (1)° & Block, colourless \\ \hline V = 3528.32 (7) Å3 & 0.32 $\times$ 0.14 $\times$ 0.08 mm \\ \hline Z = 2 \\ \hline \end{tabular}} \end{table}	PMC3200901_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|} \hline & \textbf{Model 1 OR (95\% CI)} & \textbf{Model 2 OR (95\% CI)} & \textbf{Model 3 OR (95\% CI)} \\ \hline Unemployment & 1.42 (1.14-1.78) & 1.33 (1.06-1.66) & 1.25 (1.00-1.56) \\ \hline Sex (female) & 1.58 (1.43-1.74) & 1.56 (1.39-1.74) & 1.52 (1.36-1.70) \\ \hline Age in follow-up & 1.32 (1.25-1.40) & 1.34 (1.26-1.41) & 1.34 (1.26-1.41) \\ \hline Chronic Illness1 & & 1.17 (1.11-1.23) & 1.17 (1.11-1.23) \\ \hline Self-rated health: Very good & & 1.00 (ref) & 1.00 (ref) \\ \hline Good & & 1.39 (1.21-1.59) & 1.35 (1.18-1.54) \\ \hline Fair & & 2.08 (1.72-2.50) & 2.03 (1.68-2.44) \\ \hline Poor & & 3.70 (2.26-6.06) & 3.28 (2.00-5.38) \\ \hline Depressed: Never/rarely & & 1.00 (ref) & 1.00 (ref) \\ \hline Sometimes & & 1.10 (0.87-1.39) & 1.11 (0.88-1.40) \\ \hline Often & & 1.08 (0.85-1.36) & 1.08 (0.85-1.37) \\ \hline Almost all the time & & 1.14 (0.69-1.87) & 1.14 (0.70-1.89) \\ \hline Headache: Never rarely & & 1.00 (ref) & 1.00 (ref) \\ \hline Once or several times per month & & 1.02 (0.91-1.15) & 1.03 (0.92-1.16) \\ \hline Once or several times per week & & 1.02 (0.85-1.24) & 1.02 (0.84-1.23) \\ \hline Daily & & 1.35 (0.88-2.06) & 1.38 (0.91-2.11) \\ \hline Pain in neck or shoulder: Never/rarely & & 1.00 (ref) & 1.00 (ref) \\ \hline Once or several times per month & & 1.33 (1.18-1.51) & 1.31 (1.16-1.48) \\ \hline Once or several times per week & & 1.37 (1.16-1.63) & 1.32 (1.12-1.58) \\ \hline Daily & & 1.90 (1.61-2.24) & 1.80 (1.53-2.14) \\ \hline Smoking: Non-smoker & & 1.00 (ref) & 1.00 (ref) \\ \hline Former smoker & & 1.17 (1.01-1.35) & 1.11 (0.96-1.20) \\ \hline Smoker & & 1.52 (1.34-1.72) & 1.38 (1.22-1.98) \\ \hline Alcohol: Non-drinker & & 1.00 (ref) & 1.00 (ref) \\ \hline Up to 1-2 times per month & & 1.09 (0.97-1.22) & 1.07 (0.96-1-20) \\ \hline More than once a week/daily & & 1.47 (1.15-1.87) & 1.55 (1.22-1.98) \\ \hline Education: High level & & & 1.00 (ref) \\ \hline Medium level & & & 1.49 (1.27-1.74) \\ \hline Low Level & & & 2.05 (1.74-2.43) \\ \hline ICC: & 0.02 & 0.02 & 0.02 \\ \hline Log likelihood & -7898.4494 & -7690.2289 & -7649.9913 \\ \hline \end{tabular}} \end{table}	PMC3305666_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|} \hline Cl1—C6 & 1.8074 (10) & C3—H3 & 0.9500 \\ \hline Cl2—C7 & 1.8068 (9) & C4—C5 & 1.3918 (13) \\ \hline N1—C5 & 1.3425 (11) & C4—H4 & 0.9500 \\ \hline N1—C1 & 1.3438 (12) & C5—C7 & 1.5001 (12) \\ \hline C1—C2 & 1.3920 (14) & C6—H6A & 0.9900 \\ \hline C1—C6 & 1.5016 (13) & C6—H6B & 0.9900 \\ \hline C2—C3 & 1.3888 (13) & C7—H7A & 0.9900 \\ \hline C2—H2 & 0.9500 & C7—H7B & 0.9900 \\ \hline C3—C4 & 1.3883 (13) \\ \hline C5—N1—C1 & 117.41 (8) & N1—C5—C7 & 116.23 (8) \\ \hline N1—C1—C2 & 123.00 (8) & C4—C5—C7 & 120.39 (8) \\ \hline N1—C1—C6 & 116.32 (8) & C1—C6—Cl1 & 110.02 (6) \\ \hline C2—C1—C6 & 120.67 (8) & C1—C6—H6A & 109.7 \\ \hline C3—C2—C1 & 118.98 (9) & Cl1—C6—H6A & 109.7 \\ \hline C3—C2—H2 & 120.5 & C1—C6—H6B & 109.7 \\ \hline C1—C2—H2 & 120.5 & Cl1—C6—H6B & 109.7 \\ \hline C4—C3—C2 & 118.55 (9) & H6A—C6—H6B & 108.2 \\ \hline C4—C3—H3 & 120.7 & C5—C7—Cl2 & 109.50 (6) \\ \hline C2—C3—H3 & 120.7 & C5—C7—H7A & 109.8 \\ \hline C3—C4—C5 & 118.68 (8) & Cl2—C7—H7A & 109.8 \\ \hline C3—C4—H4 & 120.7 & C5—C7—H7B & 109.8 \\ \hline C5—C4—H4 & 120.7 & Cl2—C7—H7B & 109.8 \\ \hline N1—C5—C4 & 123.38 (8) & H7A—C7—H7B & 108.2 \\ \hline C5—N1—C1—C2 & −0.23 (12) & C1—N1—C5—C7 & −178.98 (7) \\ \hline C5—N1—C1—C6 & −179.72 (7) & C3—C4—C5—N1 & 0.01 (13) \\ \hline N1—C1—C2—C3 & −0.14 (14) & C3—C4—C5—C7 & 179.26 (8) \\ \hline C6—C1—C2—C3 & 179.33 (8) & N1—C1—C6—Cl1 & 91.43 (8) \\ \hline C1—C2—C3—C4 & 0.44 (13) & C2—C1—C6—Cl1 & −88.07 (9) \\ \hline C2—C3—C4—C5 & −0.38 (13) & N1—C5—C7—Cl2 & 90.05 (8) \\ \hline C1—N1—C5—C4 & 0.29 (12) & C4—C5—C7—Cl2 & −89.24 (9) \\ \hline \end{tabular}} \end{table}	PMC3151947_table_4
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Complication N (\%)} & \textbf{Detection} & \textbf{Treatment} \\ \hline Small mid-line erosion 2 (2\%) & During first year & Removed under local anesthesia \\ \hline Mesh penetrating the vagina (Unilateral) 2 (2\%) & First follow-up & Mesh removed in ORa \\ \hline Voiding dysfunction 1 (1\%) & Immediate post-opb & Resolved spontaneously after 1 month \\ \hline Groin pain – right due to hematoma 1 (1\%) & Immediate post-op & Resolved spontaneously after 6 weeks \\ \hline de novo UUIc 2 (2\%) & First follow-up & Successfully treated with anti-cholinergic drugs \\ \hline \end{tabular}} \end{table}	PMC5117977_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Gene} & \textbf{Coverage} & \textbf{\#G} & \textbf{\#A} & \textbf{Freq. of G} & \textbf{aa change} \\ \hline Gabra3 & 679 & 631 & 48 & 92.93\% & I/M \\ \hline Elavl2 & 633 & 9 & 624 & 1.422\% & I/V \\ \hline Elavl2 & 625 & 15 & 610 & 2.400\% & N/D \\ \hline Elavl4 & 443 & 4 & 439 & 0.903\% & 3' UTR \\ \hline Elavl4 & 462 & 3 & 459 & 0.649\% & 3' UTR \\ \hline Elavl4 & 220 & 2 & 218 & 0.909\% & T/A \\ \hline Matr3 & 220 & 3 & 217 & 1.364\% & R/G \\ \hline Stk22c & 209 & 2 & 207 & 0.957\% & D/G \\ \hline Ube1x & 349 & 3 & 346 & 0.860\% & I/M \\ \hline Xpo7 & 390 & 3 & 387 & 0.769\% & D/G \\ \hline Hnrph2 & 265 & 2 & 263 & 0.755\% & K/E \\ \hline \end{tabular}} \end{table}	PMC2831006_table_5
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline & \textbf{0\%} & \textbf{5\%} & \textbf{10\%} & \textbf{15\%} \\ \hline FA & 0.240 (0.236–0.261) & 0.216 (0.081–0.243) & 0.211* (0.190–0.236) & 0.206^ (0.190–0.231) \\ \hline Pennation Angle (°) & 19.54 (16.68–27.59) & 18.82 (16.58–26.34) & 18.79 (16.49–25.38) & 18.86 (16.39–25.38) \\ \hline Number of fibers & 1179 (357–2424) & 2722* (1487–3675) & 2838\# (2126–3644) & 2874\# (2126–3643) \\ \hline Fiber length (mm) & 16.82 (14.34–28.19) & 33.66^ (28.96–41.98) & 35.21^ (30.74–41.48) & 35.36^ (30.50–41.19) \\ \hline \end{tabular}} \end{table}	PMC4444336_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline \multicolumn{2}{\|l\|}{\textbf{No. of patients}} & \textbf{Weekday daytime 67441} & \textbf{Weekday night-time 9098} & \textbf{Weekend daytime 22911} & \textbf{Weekend night-time 4458} & \textbf{P-value} \\ \hline \multicolumn{2}{\|l\|}{Age, years, median (IQR)} & 77 (61–79) & 66 (57–76) & 69 (60–79) & 66 (56–76) & $<$0.05 \\ \hline \multicolumn{2}{\|l\|}{Male} & 49509 (73.4) & 7016 (77.1) & 17011 (74.2) & 3482 (78.1) & $<$0.001 \\ \hline \multicolumn{2}{\|l\|}{Ambulance use} & 40776 (60.5) & 7023 (77.2) & 15520 (67.7) & 3456 (77.5) & $<$0.001 \\ \hline \multicolumn{2}{\|l\|}{Clinic referral} & 30915 (45.8) & 2128 (23.4) & 7987 (34.9) & 1044 (23.4) & $<$0.001 \\ \hline Killip classification on admission & 1 & 34082 (50.5) & 4415 (48.5) & 11357 (49.6) & 2173 (48.7) & $<$0.001 \\ \hline & 2 & 19983 (29.6) & 2602 (28.6) & 6618 (28.9) & 1250 (28.0) \\ \hline & 3 & 5725 (8.5) & 853 (9.4) & 1970 (8.6) & 412 (9.2) \\ \hline & 4 & 7651 (11.3) & 1228 (13.5) & 2966 (12.9) & 623 (14.0) \\ \hline \multicolumn{7}{\|l\|}{Comorbidities present on admission} \\ \hline \multicolumn{2}{\|l\|}{Fatal arrhythmia} & 3042 (4.5) & 456 (5.0) & 1251 (5.5) & 240 (5.4) & $<$0.001 \\ \hline \multicolumn{2}{\|l\|}{Atrial fibrillation/Atrial flutter} & 3351 (5.0) & 400 (4.4) & 1165 (5.1) & 197 (4.4) & 0.024 \\ \hline \multicolumn{2}{\|l\|}{Hypertension} & 43409 (64.4) & 5943 (65.3) & 14660 (64.0) & 2977 (66.8) & 0.001 \\ \hline \multicolumn{2}{\|l\|}{Hyperlipidemia} & 40150 (59.5) & 5719 (62.9) & 13473 (58.8) & 2866 (64.3) & $<$0.001 \\ \hline \multicolumn{2}{\|l\|}{Cerebrovascular disease} & 3269 (4.8) & 345 (3.8) & 1061 (4.6) & 158 (3.5) & $<$0.001 \\ \hline \multicolumn{2}{\|l\|}{Diabetes} & 20201 (30.0) & 2579 (28.3) & 6554 (28.6) & 1186 (26.6) & $<$0.001 \\ \hline \multicolumn{2}{\|l\|}{Renal disease} & 2827 (4.2) & 234 (2.6) & 921 (4.0) & 110 (2.5) & $<$0.001 \\ \hline \multicolumn{2}{\|l\|}{Chronic pulmonary disease} & 1540 (2.3) & 166 (1.8) & 510 (2.2) & 83 (1.9) & 0.015 \\ \hline \multicolumn{2}{\|l\|}{Old myocardial infarction} & 959 (1.4) & 94 (1.0) & 351 (1.5) & 57 (1.3) & 0.006 \\ \hline \multicolumn{7}{\|l\|}{Revascularization therapy provided on the day of admission} \\ \hline \multicolumn{2}{\|l\|}{PCI} & 54052 (80.1) & 7481 (82.2) & 19055 (83.2) & 3625 (81.3) & $<$0.001 \\ \hline \multicolumn{2}{\|l\|}{CABG} & 438 (0.6) & 59 (0.6) & 113 (0.5) & 22 (0.5) & 0.044 \\ \hline \multicolumn{7}{\|l\|}{Mechanical support provided on the day of admission} \\ \hline \multicolumn{2}{\|l\|}{IABP} & 8010 (11.9) & 1286 (14.1) & 2975 (13.0) & 623 (14.0) & $<$0.001 \\ \hline \multicolumn{2}{\|l\|}{ECMO} & 825 (1.2) & 119 (1.3) & 325 (1.4) & 66 (1.5) & 0.085 \\ \hline \multicolumn{7}{\|l\|}{Drugs administered on the day of admission} \\ \hline \multicolumn{2}{\|l\|}{Aspirin} & 47695 (70.7) & 7078 (77.8) & 16357 (71.4) & 3496 (78.4) & $<$0.001 \\ \hline \multicolumn{2}{\|l\|}{ACE-I/ARB} & 15463 (22.9) & 2991 (32.9) & 5393 (23.5) & 1501 (33.7) & $<$0.001 \\ \hline \multicolumn{2}{\|l\|}{Statins} & 25445 (37.7) & 4354 (47.9) & 8508 (37.1) & 2115 (47.4) & $<$0.001 \\ \hline \multicolumn{2}{\|l\|}{$\beta$-blockers} & 10685 (15.8) & 1897 (20.9) & 3572 (15.6) & 920 (20.6) & $<$0.001 \\ \hline \multicolumn{2}{\|l\|}{In-hospital mortality} & 4566 (6.8) & 594 (6.5) & 1742 (7.6) & 294 (6.6) & $<$0.001 \\ \hline \end{tabular}} \end{table}	PMC5774760_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & \multicolumn{4}{\|l\|}{\textbf{Number of trees}} & \multicolumn{4}{\|l\|}{\textbf{Volume}} \\ \hline \textbf{Ecoregion sections} & \textbf{df} & \textbf{Mean of difference} & \textbf{t} & \textbf{p} & \textbf{df} & \textbf{Mean of difference} & \textbf{t} & \textbf{p} \\ \hline All Combined & 42,824 & −298.1 & −4.52 & $<$.0001 & 40,700 & −1,531.0 & −2.08 & .0379 \\ \hline 211E & 512 & −154.7 & −0.13 & .8984 & 598 & 2,925.2 & 0.11 & .9132 \\ \hline 211F & 1,949 & −389.6 & 1.44 & .1502 & 1,900 & −987.6 & −0.23 & .8196 \\ \hline 212K & 1,605 & 155.4 & 0.9 & .3697 & 1,103 & 3,842.6 & 1.64 & .1014 \\ \hline 212Q & 656 & −503.7 & −0.65 & .5152 & 763 & −4,800.9 & −0.99 & .3223 \\ \hline 212T & 2,358 & −128.8 & −2.7 & .0071 & 1,777 & −2,648.1 & −3.24 & .0012 \\ \hline 212X & 3,671 & −17.7 & −0.25 & .8048 & 2,754 & 365.7 & 0.36 & .7204 \\ \hline 221B & 424 & −2,014.9 & −1.67 & .0958 & 570 & −8,874.8 & −1.19 & .2362 \\ \hline 221E & 4,406 & −160.2 & −1.44 & .1511 & 4,806 & −1,580.5 & −1.53 & .1214 \\ \hline 221H & 1,289 & −379.4 & −1.3 & .1951 & 1,266 & 3,382.4 & 0.9 & .3697 \\ \hline 222I & 818 & 311.8 & 0.47 & .6353 & 712 & 18,600.1 & 1.22 & .2225 \\ \hline 222J & 725 & −1,093.7 & −2.97 & .0031 & 688 & −11,841.6 & −3.5 & .0005 \\ \hline 222L & 1,451 & −3,057.4 & −4.68 & $<$.0001 & 1,683 & −29,284.4 & −6.25 & $<$.0001 \\ \hline 222M & 811 & −483.8 & −1.14 & .2542 & 914 & −3,765.9 & −1.09 & .274 \\ \hline 223A & 7,113 & 0.2 & 0 & .9976 & 6,997 & −41.5 & −0.12 & .9074 \\ \hline 223E & 1,425 & −421.9 & −1.62 & .105 & 1,929 & 848.8 & 0.48 & .6336 \\ \hline 251C & 2,416 & −98.5 & −1.01 & .3102 & 2,489 & −877.9 & −0.85 & .3953 \\ \hline M221A & 2,117 & −363.2 & −0.87 & .3838 & 2,117 & −86.8 & 0.02 & .9842 \\ \hline M221B & 1,089 & 75.9 & 0.14 & .8883 & 1,805 & −2,657.2 & −0.81 & .4195 \\ \hline M221C & 1,723 & −45.0 & −0.19 & .8507 & 1,535 & −1,059.6 & −0.4 & .6859 \\ \hline \end{tabular}} \end{table}	PMC5756827_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Principles} & \textbf{Met} & \textbf{Partially Met} & \textbf{Not Met} & \textbf{Overall rating} \\ \hline Quality Improvement & 1.8 & 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.9 & & Partially Met \\ \hline Patient/Service User Focus & 2.1, 2.2 & 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9 & & Partially Met \\ \hline Organizational Planning and Performance & 3.1, 3.2, 3.3, 3.4 & 3.5, 3.7, 3.8, 3.9, 3.10 & 3.6 & Partially Met \\ \hline Safety & 4.3, 4.5, 4.6, 4.7, 4.8, 4.9, 4.10, & 4.1, 4.2, 4.4 & & Partially Met \\ \hline Standards Development & 5.2 & 5.1, 5.5, 5.6, 5.8, 5.14 & 5.3, 5.4, 5.7, 5.9, 5.10, 5.11, 5.12, 5.13 & Partially Met \\ \hline Standards Measurement & 6.1, 6.3, & 6.2, 6.4 & & Partially Met \\ \hline \end{tabular}} \end{table}	PMC2941252_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Sample size} & \multicolumn{3}{\|l\|}{\textbf{Power}} & \textbf{Type I error} \\ \hline & \textbf{$\beta$3 = -0.65} & \textbf{$\beta$3 = -0.95} & \textbf{$\beta$3 = -1.20} & \textbf{$\beta$3 = 0} \\ \hline 150 & 0.348 & 0.642 & 0.780 & 0.052 \\ \hline 200 & 0.540 & 0.668 & 0.894 & 0.048 \\ \hline 250 & 0.604 & 0.852 & 0.898 & 0.054 \\ \hline 300 & 0.664 & 0.884 & 0.960 & 0.046 \\ \hline 400 & 0.760 & 0.948 & 1.000 & 0.050 \\ \hline 600 & 0.876 & 1.000 & 1.000 & 0.052 \\ \hline \end{tabular}} \end{table}	PMC2099440_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Run ID} & \textbf{infAP} & \textbf{infNDCG} & \textbf{NDCG@10} & \textbf{P@10 (þpartial)} & \textbf{P@10 (�partial)} \\ \hline \\ \hline OHSU-1 & 0.3193 & 0.3965 & 0.6006 & 0.7467 & 0.3333 \\ \hline OHSU-2 & 0.1396 & 0.4024 & 0.3953 & 0.48 & 0.1933 \\ \hline OHSU-3 & 0.1921 & 0.4405 & 0.5345 & 0.6533 & 0.28 \\ \hline OHSU-4 & 0.2862 & 0.4454 & 0.6122 & 0.76 & 0.3333 \\ \hline OHSU-5 & 0.083 & 0.3156 & 0.2531 & 0.34 & 0.1133 \\ \hline \end{tabular}} \end{table}	PMC5737054_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{Total} & \textbf{Single-dose albendazole} & \textbf{Single-dose mebendazole} & \textbf{Triple-dose albendazole} & \textbf{Triple-dose mebendazole} \\ \hline Total n (\%) & 314 (100) & 82 (100) & 81 (100) & 68 (100) & 83 (100) \\ \hline Sex: Female n (\%) & 151 (48.1) & 35 (42.7) & 39 (48.2) & 36 (52.9) & 41 (49.4) \\ \hline \multicolumn{6}{\|l\|}{Age n (\%)} \\ \hline - 5–14 years & 42 (13.4) & 9 (11.0) & 8 (9.9) & 14 (20.6) & 11 (13.3) \\ \hline - 15–24 years & 88 (28.0) & 26 (31.7) & 20 (24.7) & 19 (27.9) & 23 (27.7) \\ \hline - 25+ years & 184 (58.6) & 47 (57.3) & 53 (65.4) & 35 (51.5) & 49 (59.0) \\ \hline \multicolumn{6}{\|l\|}{Parasite n (\%)} \\ \hline - Hookworm (95\% CI) & 228 (72.6; 67.7–77.5) & 55 (67.1) & 58 (71.6) & 50 (73.5) & 65 (78.3) \\ \hline - Ascaris lumbricoides (95\% CI) & 284 (90.4; 87.2–93.7) & 78 (95.1) & 71 (87.7) & 63 (92.6) & 72 (86.7) \\ \hline - Trichuris trichiura (95\% CI) & 234 (74.5; 69.7–79.3) & 65 (79.3) & 63 (77.8) & 48 (70.6) & 58 (69.9) \\ \hline - Taenia spp. (95\% CI) & 33 (10.5; 7.1–13.9) & 10 (12.2) & 6 (7.4) & 7 (10.3) & 10 (12.0) \\ \hline \end{tabular}} \end{table}	PMC3181256_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline & \textbf{Controls (n = 21)} & \textbf{Patients with PD (n = 21)} & \textbf{$\chi$2/t} & \textbf{P value} \\ \hline Sex, male:female & 8:13 & 12:9 & 1.53 & 0.35 \\ \hline Age in years, mean (SD) & 63.7 (9.8) & 64.5 (9.1) & −0.27 & 0.78 \\ \hline Disease duration in years, mean (SD) & 0 & 5.0 (3.0) & – & – \\ \hline the Hoehn–Yahr stage (SD) & 0 & 1.5 (0.7) & – & – \\ \hline UPDRS-III motor subscale score, median (SD) & 0 & 14.4 (8.9) & – & – \\ \hline \end{tabular}} \end{table}	PMC5700829_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Period} & \multicolumn{3}{\|l\|}{\textbf{Maternal educational attainment, HR (95\% CI)}} \\ \hline & \textbf{No education vs secondary or more} & \textbf{Primary incomplete vs secondary or more} & \textbf{Primary complete vs secondary or more} \\ \hline \multicolumn{4}{\|l\|}{Ifakara} \\ \hline 2000–2001 & 1.44 (0.92–2.27) & 1.28 (1.02–1.60) & 1.11 (0.96–1.29) \\ \hline 2002–2003 & 1.39 (0.99–1.96) & 1.27 (1.07–1.50) & 1.10 (0.99–1.23) \\ \hline 2004–2005 & 1.35 (1.04–1.75) & 1.26 (1.11–1.43) & 1.09 (1.00–1.19) \\ \hline 2006–2007 & 1.30 (1.02–1.66) & 1.25 (1.11–1.41) & 1.08 (1.00–1.17) \\ \hline 2008–2009 & 1.25 (0.93–1.70) & 1.24 (1.06–1.45) & 1.07 (0.97–1.18) \\ \hline 2010–2011 & 1.21 (0.81–1.82) & 1.23 (1.00–1.52) & 1.06 (0.92–1.21) \\ \hline \multicolumn{4}{\|l\|}{Rufiji} \\ \hline 2000–2001 & 1.52 (1.05–2.21) & 1.22 (1.00–1.48) & 1.08 (0.95–1.22) \\ \hline 2002–2003 & 1.42 (1.07–1.88) & 1.18 (1.02–1.37) & 1.06 (0.97–1.17) \\ \hline 2004–2005 & 1.33 (1.06–1.66) & 1.14 (1.01–1.28) & 1.05 (0.98–1.13) \\ \hline 2006–2007 & 1.24 (0.99–1.55) & 1.10 (0.98–1.24) & 1.04 (0.96–1.12) \\ \hline 2008–2009 & 1.16 (0.87–1.54) & 1.07 (0.92–1.24) & 1.03 (0.93–1.13) \\ \hline 2010–2011 & 1.08 (0.74–1.58) & 1.03 (0.84–1.26) & 1.01 (0.89–1.15) \\ \hline \multicolumn{4}{\|l\|}{All} \\ \hline 2000–2001 & 1.44 (1.08–1.92) & 1.29 (1.11–1.49) & 1.12 (1.01–1.23) \\ \hline 2002–2003 & 1.38 (1.11–1.72) & 1.26 (1.13–1.41) & 1.10 (1.03–1.18) \\ \hline 2004–2005 & 1.33 (1.12–1.57) & 1.23 (1.13–1.34) & 1.09 (1.03–1.15) \\ \hline 2006–2007 & 1.28 (1.08–1.51) & 1.20 (1.11–1.31) & 1.08 (1.02–1.13) \\ \hline 2008–2009 & 1.23 (1.00–1.51) & 1.18 (1.06–1.31) & 1.06 (0.99–1.14) \\ \hline 2010–2011 & 1.18 (0.90–1.55) & 1.15 (1.00–1.33) & 1.05 (0.96–1.15) \\ \hline \end{tabular}} \end{table}	PMC4794298_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{n = 1} & \textbf{GM} & \textbf{95\% CI} & \textbf{5th P} & \textbf{25th P} & \textbf{50th P} & \textbf{75th P} & \textbf{95th P} \\ \hline Total & 5,189 & 1.02 & (0.97, 1.08) & 0.20 & 0.58 & 1.00 & 1.87 & 4.82 \\ \hline \multicolumn{9}{\|l\|}{Age (yrs)} \\ \hline - 16 – 19 & 1,103 & 0.74 & (0.67, 0.82) & 0.20 & 0.40 & 0.77 & 1.40 & 3.10 \\ \hline - 20 – 29 & 1,404 & 0.88 & (0.81, 0.94) & 0.20 & 0.50 & 0.88 & 1.66 & 3.70 \\ \hline - 30 – 39 & 1,358 & 1.13 & (1.02, 1.24) & 0.20 & 0.60 & 1.10 & 2.20 & 5.80 \\ \hline - 40 – 49 & 1,324 & 1.14 & (1.07, 1.22) & 0.28 & 0.70 & 1.10 & 1.90 & 5.00 \\ \hline \multicolumn{9}{\|l\|}{Ethnicity} \\ \hline - White & 2,100 & 1.00 & (0.92, 1.07) & 0.20 & 0.53 & 1.00 & 1.85 & 4.89 \\ \hline - Mexican American & 1,248 & 0.77 & (0.71, 0.84) & 0.20 & 0.49 & 0.80 & 1.30 & 2.91 \\ \hline - Other Hispanic & 328 & 1.04 & (0.84, 1.29) & 0.20 & 0.66 & 1.09 & 1.90 & 3.59 \\ \hline - Black & 1,285 & 1.08 & (0.99, 1.17) & 0.30 & 0.63 & 1.04 & 1.75 & 4.10 \\ \hline - Other & 228 & 1.90 & (1.62, 2.24) & 0.40 & 0.90 & 2.03 & 3.60 & 8.50 \\ \hline \multicolumn{9}{\|l\|}{Country born} \\ \hline - US & 4,008 & 0.98 & (0.92, 1.04) & 0.20 & 0.54 & 0.95 & 1.70 & 4.45 \\ \hline - Foreign & 1,180 & 1.28 & (1.15, 1.42) & 0.28 & 0.70 & 1.25 & 2.49 & 6.52 \\ \hline \multicolumn{9}{\|l\|}{Household income (/yr)} \\ \hline - $<$ \$45,000 & 2,580 & 0.86 & (0.80, 0.92) & 0.20 & 0.50 & 0.82 & 1.54 & 3.64 \\ \hline - \$45,000-\$75,000 & 1,070 & 1.03 & (0.95, 1.11) & 0.23 & 0.60 & 1.00 & 1.80 & 4.90 \\ \hline - $>$ \$75,000 & 1,217 & 1.29 & (1.19, 1.30) & 0.30 & 0.60 & 1.27 & 2.30 & 5.82 \\ \hline \multicolumn{9}{\|l\|}{Education} \\ \hline - $<$ HS diploma & 1,695 & 0.76 & (0.70, 0.83) & 0.20 & 0.40 & 0.75 & 1.39 & 3.30 \\ \hline - HS diploma & 1,052 & 0.93 & (0.85, 1.00) & 0.20 & 0.50 & 0.90 & 1.60 & 4.01 \\ \hline - BA degree & 1,496 & 1.02 & (0.94, 1.11) & 0.20 & 0.60 & 1.00 & 1.80 & 4.10 \\ \hline - $>$ BA degree & 944 & 1.37 & (1.26, 1.49) & 0.30 & 0.72 & 1.35 & 2.62 & 6.40 \\ \hline \multicolumn{9}{\|l\|}{BMI (kg/m2)} \\ \hline - $<$ 30 & 3,920 & 1.10 & (1.03, 1.17) & 0.20 & 0.60 & 1.10 & 2.00 & 5.16 \\ \hline - $>$ = 30 & 1,706 & 0.89 & (0.83, 0.95) & 0.20 & 0.50 & 0.86 & 1.50 & 4.00 \\ \hline \multicolumn{9}{\|l\|}{Alcohol (g/day)} \\ \hline - $<$ 10 & 4,500 & 0.97 & (0.91, 1.03) & 0.20 & 0.53 & 0.93 & 1.71 & 4.50 \\ \hline - $>$ = 10 & 683 & 1.29 & (1.18, 1.42) & 0.30 & 0.71 & 1.29 & 2.31 & 5.58 \\ \hline \multicolumn{9}{\|l\|}{Seafood (/mo.)} \\ \hline - 1–4 servings & 4,422 & 0.93 & (0.88, 0.99) & 0.20 & 0.52 & 0.90 & 1.62 & 4.17 \\ \hline - 5–8 servings & 458 & 1.72 & (1.55, 1.91) & 0.41 & 0.90 & 1.76 & 3.01 & 7.52 \\ \hline - $>$/= 9 servings & 198 & 2.08 & (1.81, 2.39) & 0.65 & 1.14 & 1.92 & 3.70 & 10.60 \\ \hline \multicolumn{9}{\|l\|}{Hepatitis A} \\ \hline - No infection or immunization & 2,669 & 1.03 & (0.99, 1.07) & 0.20 & 0.60 & 1.00 & 1.90 & 4.90 \\ \hline - Infection or immunization & 1,484 & 1.04 & (0.99, 1.05) & 0.23 & 0.60 & 1.00 & 1.90 & 5.10 \\ \hline \multicolumn{9}{\|l\|}{Hepatitis B} \\ \hline - No infection or immunization & 4,957 & 1.01 & (0.96, 1.07) & 0.20 & 0.57 & 1.00 & 1.81 & 4.70 \\ \hline - Past or current infection 2 & 185 & 1.39 & (1.16, 1.65) & 0.20 & 0.70 & 1.30 & 3.80 & 6.90 \\ \hline - Immunization & 1,673 & 1.08 & (1.03, 1.13) & 0.20 & 0.68 & 1.07 & 1.98 & 4.90 \\ \hline \multicolumn{9}{\|l\|}{Hepatitis C} \\ \hline - No infection & 5,055 & 1.03 & (0.97, 1.09) & 0.20 & 0.59 & 1.00 & 1.89 & 4.80 \\ \hline - Past or current infection & 70 & 0.74 & (0.55, 1.01) & 0.20 & 0.40 & 0.85 & 1.60 & 3.40 \\ \hline \end{tabular}} \end{table}	PMC3511886_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline \textbf{MIGS ID} & \textbf{Property} & \textbf{Term} \\ \hline MIGS-31 & Finishing quality & Finished \\ \hline MIGS-28 & Libraries used & Three genomic libraries: one 454 pyrose- quence standard library, one 454 paired end 15 kb library, and one Illumina library \\ \hline MIGS-29 & Sequencing platforms & 454 Titanium; Illumina GAii \\ \hline MIGS-31.2 & Sequencing coverage & 94.5$\times$ pyrosequence and Illumina \\ \hline MIGS-30 & Assemblers & Newbler version 2.0.00.20- PostRelease- 11-05-2008-gcc-3.4.6/, phrap, Velvet \\ \hline MIGS-32 & Gene calling method & Prodigal 1.4, GenePRIMP \\ \hline & INSDC ID & CP002098 \\ \hline & Genbank Date of Release & August 24, 2010 \\ \hline & GOLD ID & Gc01330 \\ \hline & NCBI project ID & 33361 \\ \hline & Database: IMG-GEBA & 2502171146 \\ \hline MIGS-13 & Source material identifier & DSM 17230 \\ \hline & Project relevance & Tree of Life, GEBA \\ \hline \end{tabular}} \end{table}	PMC3035270_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & \multicolumn{3}{\|l\|}{\textbf{HIV-infected men (COVERTE: N = 126)}} & \multicolumn{3}{\|l\|}{\textbf{Men from general population (ENNS: N = 103)}} & \textbf{p-valueb} & \multicolumn{3}{\|l\|}{\textbf{HIV-infected women (COVERTE: N = 142)}} & \multicolumn{3}{\|l\|}{\textbf{Women from general population (ENNS: N = 142)}} & \textbf{p-valuec} & \textbf{p-valued} \\ \hline & \textbf{Mean} & \textbf{95\%CI} & \textbf{M} & \textbf{Meana} & \textbf{95\%CI} & \textbf{M} & & \textbf{Mean} & \textbf{95\%CI} & \textbf{M} & \textbf{Meana} & \textbf{95\%CI} & \textbf{M} \\ \hline BMI & 22.6 & 21.9– 23.2 & 0 & 24.1 & 22.8– 25.4 & 0 & 0.026 & 22.9 & 22.2– 23.7 & 0 & 23.5 & 22.2– 24.9 & 0 & 0.409 & 0.241 \\ \hline Waist/Hip ratio & 0.91 & 0.88– 0.93 & 22 & 0.86 & 0.85– 0.89 & 1 & $<$10−4 & 0.86 & 0.83– 0.89 & 18 & 0.76 & 0.75– 0.78 & 1 & $<$10−4 & $<$10−4 \\ \hline Waist circumference (cm) & 81.0 & 79.1– 82.9 & 22 & 84 & 80–88 & 1 & 0.419 & 80 & 77–83 & 17 & 76 & 73–78 & 1 & 0.002 & 0.016 \\ \hline Systolic blood pressure (mmHg) & 122 & 120–125 & 10 & 120 & 117–124 & 0 & 0.088 & 116 & 113–119 & 10 & 109 & 107–112 & 0 & $<$10−3 & $<$10−4 \\ \hline Diastolic blood pressure (mmHg) & 72 & 70–74 & 10 & 71 & 69–74 & 0 & 0.593 & 71 & 69–74 & 10 & 72 & 69–75 & 0 & 0.844 & 0.919 \\ \hline Fasting glucose (mmol/L) & 4.7 & 4.6–4.9 & 3 & 4.9 & 4.7–5.1 & 1 & 0.117 & 4.6 & 4.5–4.8 & 1 & 4.6 & 4.5–4.8 & 7 & 0.914 & 0.765 \\ \hline Triglycerides (mmol/L) & 1.4 & 1.1–1.7 & 1 & 1.1 & 0.9–1.2 & 0 & 0.003 & 1.0 & 0.9–1.2 & 1 & 0.9 & 0.8–1.1 & 0 & 0.311 & 0.021 \\ \hline Total cholesterol, (mmol/L) & 4.2 & 4.0–4.5 & 0 & 4.4 & 4.2–4.7 & 0 & 0.226 & 4.5 & 4.2–4.7 & 0 & 4.8 & 4.5–5.0 & 0 & 0.030 & 0.176 \\ \hline LDL-cholesterol, (mmol/L) & 2.4 & 2.2–2.6 & 5 & 2.6 & 2.5–2.8 & 7 & 0.044 & 2.5 & 2.3–2.7 & 6 & 2.8 & 2.6–3.0 & 4 & 0.045 & 0.120 \\ \hline HDL-cholesterol, (mmol/L) & 1.2 & 1.1–1.3 & 4 & 1.3 & 1.2–1.5 & 2 & 0.033 & 1.4 & 1.3–1.5 & 5 & 1.5 & 1.4–1.7 & 2 & 0.014 & 0.069 \\ \hline Non-HDL cholesterol, (mmol/L) & 3.0 & 2.8–3.3 & 4 & 3.1 & 2.9–3.3 & 2 & 0.673 & 3.0 & 2.8–3.2 & 5 & 3.2 & 3.0–3.5 & 2 & 0.093 & 0.326 \\ \hline Total to HDL-cholesterol ratio & 3.8 & 3.5–4.1 & 4 & 3.5 & 3.3–3.8 & 2 & 0.059 & 3.3 & 3.1–3.5 & 5 & 3.2 & 3.0–3.5 & 2 & 0.343 & 0.158 \\ \hline Triglycerides to HDL-cholesterol ratio & 1.4 & 1.1–1.8 & 5 & 0.9 & 0.7–1.1 & 2 & 0.003 & 0.8 & 0.7–0.9 & 6 & 0.6 & 0.6–0.7 & 2 & 0.008 & 0.0008 \\ \hline \end{tabular}} \end{table}	PMC6226109_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline C14H13ClO5 & F(000) = 616 \\ \hline Mr = 296.69 & Dx = 1.488 Mg m−3 \\ \hline Orthorhombic, P212121 & Mo K$\alpha$ radiation, $\lambda$ = 0.71073 Å \\ \hline Hall symbol: P 2ac 2ab & Cell parameters from 4024 reflections \\ \hline a = 4.8042 (1) Å & $\theta$ = 2.6–28.6° \\ \hline b = 14.9134 (4) Å & µ = 0.31 mm−1 \\ \hline c = 18.4793 (5) Å & T = 100 K \\ \hline V = 1323.99 (6) Å3 & Needle, colourless \\ \hline Z = 4 & 0.28 $\times$ 0.07 $\times$ 0.06 mm \\ \hline \end{tabular}} \end{table}	PMC3089165_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Bone} & \textbf{Site} & \textbf{Parameter} & \multicolumn{2}{\|l\|}{\textbf{Difference between intercepts (P-value)}} & \multicolumn{2}{\|l\|}{\textbf{Difference between slopes (P-value)}} & \multicolumn{2}{\|l\|}{\textbf{Slope of RA group (P-value)}} \\ \hline \textbf{Radius} & \textbf{4\%} & \textbf{BMC (g/cm)} & \textbf{0.01} & \textbf{(0.610)} & \textbf{- 0.01} & \textbf{(0.045)} & \textbf{0.04} & \textbf{(0.000)} \\ \hline & & Total CSA (mm2) & - 10.64 & (0.190) & - 2.10 & (0.319) & 7.62 & (0.000) \\ \hline & & Total BMD (mg/cm3) & 15.94 & (0.099) & - 1.76 & (0.483) & 4.16 & (0.035) \\ \hline & & Trab. BMD (mg/cm3) & 28.50 & (0.000) & - 3.61 & (0.052) & 5.29 & (0.000) \\ \hline & 66\% & BMC (g/cm) & 0.05 & (0.050) & - 0.01 & (0.154) & 0.03 & (0.000) \\ \hline & & Total CSA (mm2) & - 10.82 & (0.003) & - 1.54 & (0.108) & 3.84 & (0.000) \\ \hline & & Cort. CSA (mm2) & 5.57 & (0.023) & - 0.69 & (0.281) & 2.70 & (0.000) \\ \hline & & Cort. BMD (mg/cm3) & 42.58 & (0.000) & 0.55 & (0.869) & 1.07 & (0.686) \\ \hline & & Cort. Thickness (mm) & 0.29 & (0.001) & - 0.01 & (0.657) & 0.05 & (0.004) \\ \hline Tibia & 4\% & BMC (g/cm) & 0.08 & (0.267) & - 0.02 & (0.003) & 0.04 & (0.000) \\ \hline & & Total CSA (mm2) & - 53.01 & (0.031) & - 5.18 & (0.017) & 7.80 & (0.000) \\ \hline & & Total BMD (mg/cm3) & 22.13 & (0.008) & - 0.52 & (0.471) & 1.66 & (0.005) \\ \hline & & Trab. BMD (mg/cm3) & 21.71 & (0.003) & - 1.68 & (0.008) & 2.15 & (0.000) \\ \hline & 66\% & BMC (g/cm) & 0.02 & (0.742) & - 0.01 & (0.024) & 0.04 & (0.000) \\ \hline & & Total CSA (mm2) & - 17.41 & (0.178) & - 0.91 & (0.424) & 3.13 & (0.001) \\ \hline & & Cort. CSA (mm2) & 2.75 & (0.619) & - 1.38 & (0.005) & 2.98 & (0.000) \\ \hline & & Cort. BMD (mg/cm3) & 11.42 & (0.169) & 0.05 & (0.944) & 0.38 & (0.518) \\ \hline & & Cort. Thickness (mm) & 1.14 & (0.171) & - 0.02 & (0.038) & 0.03 & (0.000) \\ \hline MCP3 & 4\% & BMC (mg/cm) & 1.40 & (0.266) & - 0.35 & (0.287) & 1.41 & (0.000) \\ \hline & & Total CSA (mm2) & - 2.74 & (0.299) & - 0.42 & (0.543) & 1.71 & (0.002) \\ \hline & & Total BMD (mg/cm3) & 21.60 & (0.014) & - 3.36 & (0.138) & 7.52 & (0.000) \\ \hline & & Trab. BMD (mg/cm3) & 25.98 & (0.008) & - 4.28 & (0.092) & 8.64 & (0.000) \\ \hline & 30\% & BMC (mg/cm) & 1.67 & (0.194) & - 0.60 & (0.074) & 1.47 & (0.000) \\ \hline & & Total CSA (mm2) & - 7.33 & (0.000) & - 0.86 & (0.092) & 2.08 & (0.000) \\ \hline & & Cort. CSA (mm2) & 1.76 & (0.056) & - 0.49 & (0.039) & 1.13 & (0.000) \\ \hline & & Cort. BMD (mg/cm3) & 43.98 & (0.001) & - 1.39 & (0.667) & 2.61 & (0.300) \\ \hline & & Cort. Thickness (mm) & 0.16 & (0.001) & - 0.01 & (0.419) & 0.03 & (0.014) \\ \hline & 50\% & BMC (mg/cm) & 1.45 & (0.229) & - 0.43 & (0.168) & 1.58 & (0.000) \\ \hline & & Total CSA (mm2) & - 4.40 & (0.000) & - 0.44 & (0.113) & 1.18 & (0.000) \\ \hline & & Cort. CSA (mm2) & 1.60 & (0.073) & - 0.38 & (0.099) & 1.25 & (0.000) \\ \hline & & Cort. BMD (mg/cm3) & 32.25 & (0.002) & - 1.97 & (0.452) & 4.51 & (0.029) \\ \hline & & Cort. Thickness (mm) & 0.18 & (0.002) & - 0.01 & (0.588) & 0.04 & (0.000) \\ \hline & & relative cortical area & 0.07 & (0.000) & - 0.00 & (0.617) & 0.01 & (0.017) \\ \hline \end{tabular}} \end{table}	PMC2911913_table_3
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{Patient type} & \textbf{Sex} & \textbf{Age} & \textbf{Mean PA pressure (mmHg)} & \textbf{Medications} & \textbf{PVR (dyne*sec)/cm5} & \textbf{Lung tissue} \\ \hline 1 & Control (Benign tumor) & F & 35 & ND & None & ND & Yes \\ \hline 2 & Control (Lung Cancer) & F & 38 & ND & None & ND & Yes \\ \hline 3 & Control (Benign tumor) & M & 45 & ND & None & ND & Yes \\ \hline 4 & Control (Lung Cancer) & M & 51 & ND & None & ND & Yes \\ \hline 5 & Control (Hodgkin) & M & 48 & ND & None & ND & Yes \\ \hline 6 & Control (Benign tumor) & F & 44 & ND & None & ND & Yes \\ \hline 7 & Control (Lung Cancer) & F & 47 & ND & None & ND & Yes \\ \hline 8 & Control (Lung Cancer) & F & 50 & ND & None & ND & Yes \\ \hline 9 & iPAH & F & 58 & 56 & Epoprostenol/Lasix/Coumadin & 1709 & Yes \\ \hline 10 & iPAH & F & 36 & 67 & Epoprostenol/Lasix/Coumadin & 2274 & Yes \\ \hline 11 & SSC-PAH & F & 55 & 48 & Epoprostenol/Lasix/Coumadin & 980 & Yes \\ \hline 12 & PAH group1 & F & 64 & 59 & Bosentan/Lasix & 926 & Yes \\ \hline 13 & PAH group1 & M & 72 & 39 & Lasix/Sitaxsentan & 550 & Yes \\ \hline 14 & PAH group1 & M & 58 & 42 & Epoprostenol/Lasix/Coumadin & 991 & Yes \\ \hline 15 & PAH group1 & F & 51 & 51 & Lasix/coumadin & 1199 & Yes \\ \hline 16 & PAH group1 & F & 48 & 73 & Epoprostenol/Lasix & 1800 & Yes \\ \hline 17 & PAH group1 & F & 51 & 41 & Lasix & 990 & Yes \\ \hline 18 & PAH group1 & F & 68 & 37 & Lasix/coumadin/Norvasc & 544 & Yes \\ \hline \end{tabular}} \end{table}	PMC3193170_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Dog} & \textbf{Age} & \textbf{Gender} & \textbf{Start} & \textbf{Finish} \\ \hline Sound & 4 & F & 5 & 3 \\ \hline Cat & 2 & F & 5 & 3 \\ \hline Bato & 2 & M & 4 & 3 \\ \hline Basin & 4 & M & 4 & 3.5 \\ \hline Heath & 5 & M & 4 & 3 \\ \hline Yukon & 5 & M & 5 & 3.5 \\ \hline Carbon & 5 & M & 4 & 3 \\ \hline Braeburn & 5 & M & 5 & 3.5 \\ \hline Chica & 2 & F & 5 & 3 \\ \hline Krypton & 3 & M & 4 & 3 \\ \hline Copper & 5 & M & 5 & 3 \\ \hline Merc & 5 & M & 5 & 3 \\ \hline \end{tabular}} \end{table}	PMC5027292_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Step} & \textbf{No. SNPs} & \textbf{0} & \textbf{1} & \textbf{2} & \textbf{3} & \textbf{4} & \textbf{5} & \textbf{6} & \textbf{7} & \textbf{8} & \textbf{9} & \textbf{$\geq$10} \\ \hline 1 & Availablea & 1286 & 413 & 310 & 614 & 417 & 148 & 169 & 59 & 16 & 16 & 14 \\ \hline & AICb & 1286 & 1697 & 350 & 107 & 17 & 3 & 1 & 1 & 0 & 0 & 0 \\ \hline & p $\leq$ 0.01c & & 245 & 43 & 0 & 0 & 0 & 0 & 0 & 0 & 0 & 0 \\ \hline & p $\leq$ 0.001c & & 88 & 5 & 0 & 0 & 0 & 0 & 0 & 0 & 0 & 0 \\ \hline 3 & Linkagesd & 294 & 81 & 76 & 118 & 141 & 102 & 101 & 102 & 110 & 91 & 2264 \\ \hline & AIC & 294 & 664 & 362 & 295 & 270 & 236 & 187 & 147 & 127 & 101 & 645 \\ \hline & p $\leq$ 0.01c & & 930 & 433 & 188 & 101 & 58 & 38 & 21 & 11 & 11 & 32 \\ \hline & p $\leq$ 0.001c & & 572 & 151 & 60 & 25 & 12 & 10 & 3 & 6 & 2 & 2 \\ \hline \end{tabular}} \end{table}	PMC2367558_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Effect} & \textbf{Dfn,d} & \multicolumn{2}{\|l\|}{\textbf{mg C g−1 root}} & \multicolumn{2}{\|l\|}{\textbf{Phenolic content (µg ml−1g−1 root)}} \\ \hline & & \textbf{F} & \textbf{P} & \textbf{F} & \textbf{P} \\ \hline Cultivar & 1,1 & 0.06 & 0.81 & 5.03 & 0.03 \\ \hline Endophyte & 3,3 & 8.30 & 0.0006 & 8.66 & 0.0003 \\ \hline Cultivar $\times$ Endophyte & 3,3 & 4.09 & 0.02 & 3.75 & 0.02 \\ \hline \end{tabular}} \end{table}	PMC4391242_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Model} & \textbf{Percentage mean error} & \textbf{r2} \\ \hline from 1 & 197 \% & 0.93 \\ \hline individ- 2 & 193 \% & 0.93 \\ \hline 3 & 192 \% & 0.93 \\ \hline and 4 & 179 \% & 0.93 \\ \hline 5 & 181 \% & 0.93 \\ \hline 6 & 187 \% & 0.93 \\ \hline fea- predict- 7 & 189 \% & 0.93 \\ \hline to 8 & 194 \% & 0.93 \\ \hline least 9 & 198 \% & 0.93 \\ \hline 10 & 200 \% & 0.93 \\ \hline \end{tabular}} \end{table}	PMC4545320_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline \textbf{as Data} & \textbf{Statistical test} & \textbf{Post hoc test} \\ \hline Errors & Friedman & Wilcoxon \\ \hline TMS pulse), Average RTs & Three-way repeated measures ANOVA & Fisher’s LSD \\ \hline average were Baseline vs. rest MEPs & One-way repeated measures ANOVA & Fisher’s LSD \\ \hline with vs. Baseline MEPs across conditions & One-way repeated measures ANOVA & n.a. \\ \hline Given Target MEPs vs. baseline & Student’s t-test & n.a. \\ \hline and however, Normalized target MEPs across conditions & Three-way repeated measures ANOVA & Fisher’s LSD \\ \hline Average RTs without and with TMS & One-way repeated measures ANOVA & n.a. \\ \hline \end{tabular}} \end{table}	PMC6192378_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{U11} & \textbf{U22} & \textbf{U33} & \textbf{U12} & \textbf{U13} & \textbf{U23} \\ \hline O1 & 0.0424 (8) & 0.0206 (7) & 0.0280 (7) & −0.0067 (6) & 0.0148 (6) & −0.0004 (5) \\ \hline O2 & 0.0420 (8) & 0.0206 (7) & 0.0205 (6) & −0.0026 (6) & 0.0154 (6) & 0.0015 (5) \\ \hline O3 & 0.0346 (8) & 0.0423 (9) & 0.0303 (8) & −0.0006 (7) & 0.0079 (7) & 0.0120 (7) \\ \hline O4 & 0.0233 (7) & 0.0266 (7) & 0.0301 (7) & −0.0030 (5) & 0.0099 (6) & 0.0028 (6) \\ \hline N1 & 0.0283 (8) & 0.0172 (7) & 0.0201 (7) & −0.0012 (6) & 0.0119 (7) & 0.0001 (6) \\ \hline N2 & 0.0246 (8) & 0.0177 (7) & 0.0211 (7) & −0.0008 (6) & 0.0108 (6) & 0.0007 (6) \\ \hline N3 & 0.0275 (8) & 0.0192 (7) & 0.0226 (8) & −0.0042 (6) & 0.0110 (7) & −0.0027 (6) \\ \hline C1 & 0.0179 (8) & 0.0192 (9) & 0.0202 (8) & −0.0008 (7) & 0.0085 (7) & 0.0001 (7) \\ \hline C2 & 0.0199 (8) & 0.0194 (9) & 0.0198 (8) & −0.0022 (7) & 0.0094 (7) & −0.0015 (7) \\ \hline C3 & 0.0215 (9) & 0.0183 (9) & 0.0209 (8) & −0.0013 (7) & 0.0092 (7) & −0.0012 (7) \\ \hline C4 & 0.0294 (10) & 0.0199 (9) & 0.0219 (9) & −0.0032 (8) & 0.0114 (8) & 0.0010 (7) \\ \hline C5 & 0.0263 (9) & 0.0193 (9) & 0.0248 (9) & −0.0005 (7) & 0.0093 (8) & −0.0005 (7) \\ \hline C6 & 0.0340 (10) & 0.0205 (9) & 0.0233 (9) & −0.0065 (8) & 0.0164 (8) & −0.0037 (7) \\ \hline C7 & 0.0191 (8) & 0.0204 (9) & 0.0225 (9) & 0.0005 (7) & 0.0093 (7) & 0.0022 (7) \\ \hline C8 & 0.0410 (12) & 0.0279 (10) & 0.0263 (10) & −0.0007 (9) & 0.0176 (9) & 0.0068 (8) \\ \hline C9 & 0.0554 (14) & 0.0414 (13) & 0.0237 (10) & −0.0036 (11) & 0.0152 (10) & 0.0064 (9) \\ \hline C10 & 0.0354 (10) & 0.0223 (9) & 0.0177 (8) & 0.0003 (8) & 0.0143 (8) & 0.0017 (7) \\ \hline C11 & 0.0368 (11) & 0.0302 (11) & 0.0210 (9) & 0.0016 (9) & 0.0113 (9) & −0.0022 (8) \\ \hline C12 & 0.0343 (11) & 0.0490 (13) & 0.0320 (11) & −0.0023 (10) & 0.0198 (9) & 0.0007 (10) \\ \hline C13 & 0.0285 (10) & 0.0229 (9) & 0.0231 (9) & −0.0023 (8) & 0.0118 (8) & −0.0022 (8) \\ \hline C14 & 0.0223 (9) & 0.0337 (11) & 0.0321 (10) & −0.0019 (8) & 0.0121 (8) & −0.0006 (9) \\ \hline C15 & 0.0356 (12) & 0.0398 (13) & 0.0555 (15) & −0.0079 (10) & 0.0207 (11) & 0.0071 (11) \\ \hline C16 & 0.0289 (11) & 0.0602 (16) & 0.0395 (12) & −0.0135 (11) & 0.0133 (10) & −0.0149 (11) \\ \hline C17 & 0.0385 (12) & 0.0445 (13) & 0.0453 (13) & 0.0071 (10) & 0.0231 (11) & −0.0003 (11) \\ \hline \end{tabular}} \end{table}	PMC3238897_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline & \multicolumn{2}{\|l\|}{\textbf{all}} & \multicolumn{2}{\|l\|}{\textbf{Whites}} & \multicolumn{2}{\|l\|}{\textbf{Blacks}} \\ \hline & \textbf{n} & \textbf{\%} & \textbf{n} & \textbf{\%} & \textbf{n} & \textbf{\%} \\ \hline \multicolumn{7}{\|l\|}{Gender} \\ \hline Men & 3395 & 47.8 & 2683 & 47.9 & 121 & 37.7 \\ \hline Women & 3632 & 51.1 & 2917 & 52.1 & 200 & 62.3 \\ \hline & Mean & sD & Mean & sD & Mean & sD \\ \hline Age & 46.38 & 13.00 & 47.30 & 12.92 & 44.42 & 12.54 \\ \hline Education* & 6.77 & 2.49 & 6.90 & 2.47 & 6.22 & 2.47 \\ \hline Income* & 26773.24 & 26891.19 & 27326.10 & 27509.71 & 20762.54 & 19730.37 \\ \hline Chronic medical conditions (wave 1)* & 2.41 & 2.51 & 2.39 & 2.46 & 2.53 & 2.96 \\ \hline Chronic medical conditions (wave 1)* & 2.46 & 2.59 & 2.39 & 2.41 & 3.16 & 4.56 \\ \hline Negative affect (wave 1) & 1.54 & 0.62 & 1.53 & 0.61 & 1.53 & 0.65 \\ \hline Negative affect (wave 2)* & 1.51 & 0.58 & 1.50 & 0.56 & 1.67 & 0.83 \\ \hline \end{tabular}} \end{table}	PMC4996069_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|} \hline & \textbf{$\Theta$ (°C)} & \textbf{S} & \textbf{DOC ($\mu$mol·kg−1)} \\ \hline ENACW16 & 16.00 $\pm$ 0.13 & 36.20 $\pm$ 0.02 & 59.0 $\pm$ 2.1 \\ \hline ENACW12 & 12.30 $\pm$ 0.18 & 35.66 $\pm$ 0.03 & 55.4 $\pm$ 0.5 \\ \hline MW & 11.7 $\pm$ 0.2 & 36.500 $\pm$ 0.011 & 45.1 $\pm$ 1.1 \\ \hline SAIW & 6.0 $\pm$ 0.2 & 34.70 $\pm$ 0.03 & 51.7 $\pm$ 1.0 \\ \hline SPMW8 & 8.00 $\pm$ 0.11 & 35.230 $\pm$ 0.016 & 47.2 $\pm$ 1.1 \\ \hline SPMW7 & 7.07 $\pm$ 0.07 & 35.160 $\pm$ 0.006 & 50.2 $\pm$ 1.1 \\ \hline IrSPMW & 5.00 $\pm$ 0.02 & 35.014 $\pm$ 0.013 & 55.3 $\pm$ 1.1 \\ \hline LSW & 3.00 $\pm$ 0.19 & 34.87 $\pm$ 0.02 & 48.1 $\pm$ 0.4 \\ \hline ISOW & 2.60 $\pm$ 0.08 & 34.980 $\pm$ 0.003 & 48.4 $\pm$ 1.2 \\ \hline DSOW & 1.30 $\pm$ 0.06 & 34.905 $\pm$ 0.006 & 51.8 $\pm$ 1.9 \\ \hline PIW & 0.0 $\pm$ 0.2 & 34.65 $\pm$ 0.03 & 48.4 $\pm$ 5.4 \\ \hline NEADWL & 1.98 $\pm$ 0.03 & 34.895 $\pm$ 0.003 & 42.1 $\pm$ 0.6 \\ \hline r2 & & & 0.68 \\ \hline SDR & & & 2.6 \\ \hline SDR/$\epsilon$ & & & 3.7 \\ \hline \end{tabular}} \end{table}	PMC4886255_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Group} & \textbf{Patient Number} & \textbf{Follow up (months)} & \textbf{Raised IOP} & \textbf{Stepwise deterioration in retinopathy grade at last FU (ETDRS)} \\ \hline A & 1 & 15 & & 3 \\ \hline & & 14 & & 1 \\ \hline A & 2 & 6 & & 0 \\ \hline & & 8 & Yes: 34 mmHg & 0 \\ \hline A & 3 & 9 & & 0 \\ \hline A & 4 & 10 & & 0 \\ \hline & & 12 & Yes: 29 mm Hg & 1 \\ \hline A & 5 & 11 & Yes: 31 mm Hg & 0 \\ \hline A & 6 & 10 & & 1 \\ \hline & & 7 & & 0 \\ \hline A & 7 & 12 & & 0 \\ \hline A & 8 & 5 & Yes: 24 mmHg & 1 \\ \hline & & 5 & & 0 \\ \hline A & 9 & 7 & & 1 \\ \hline A & 10 & 6 & & 0 \\ \hline B & 10 & 4 & & 0 \\ \hline B & 11 & 8 & & 0 \\ \hline B & 12 & 4 & & 0 \\ \hline & & Mean FU = 8.5 \\ \hline \end{tabular}} \end{table}	PMC1183218_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Chemicals} & \textbf{Dm without synergists} & \textbf{Dm with PBO} & \textbf{Dm with DEF} \\ \hline propoxur & 1.97 (1.78–2.19) & 0.27 (0.17–0.42) & 1.01 (0.83–1.24) \\ \hline DEET & 1189 (1088–1299) & 611 (596–629) & 1078 (1005–1155) \\ \hline mixture & 319 (296–343) & 406 (385–428) & 128 (119–136) \\ \hline mixture ratio P:D & 1:600 & 1:2000 & 1:1000 \\ \hline \multicolumn{4}{\|l\|}{Slope of the regression lines ($\pm$ s.e.)} \\ \hline propoxur & 2.83 (0.19) & 2.16 (0.18) & 1.95 (0.22) \\ \hline DEET & 4.16 (0.42) & 3.98 (0.12) & 3.18 (0.20) \\ \hline mixture & 3.32 (0.18) & 3.76 (0.20) & 2.96 (0.14) \\ \hline \end{tabular}} \end{table}	PMC2680852_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Variable} & \textbf{NDEs group (mean $\pm$ SD)} & \textbf{Non-NDEs group (mean $\pm$ SD)} & \textbf{P} \\ \hline Age (years) & 57.9 $\pm$ 13.8 & 51.8 $\pm$ 14.6 & 0.217 \\ \hline Time until ROSC (minutes) & 8.3 $\pm$ 6.7 & 8.8 $\pm$ 5.3 & 0.772 \\ \hline petCO2 (kPa) & 5.7 $\pm$ 1.1 & 4.4 $\pm$ 1.2 & $<$ 0.01 \\ \hline pO2 (kPa) & 16.4 $\pm$ 11.1 & 25.3 $\pm$ 15.1 & 0.108 \\ \hline pCO2 (kPa) & 6.6 $\pm$ 2.3 & 5.3 $\pm$ 1.4 & 0.041 \\ \hline Serum sodium (mmol/l) & 139.2 $\pm$ 6.1 & 140.4 $\pm$ 4.0 & 0.439 \\ \hline Serum potassium (mmol/l) & 4.6 $\pm$ 1.2 & 4.1 $\pm$ 0.8 & 0.118 \\ \hline \end{tabular}} \end{table}	PMC2887177_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline \textbf{Study} & \textbf{Summary of relevant findings} \\ \hline Bickley and Beech (2002; N = 87) & 80\% had approach goals and $>$50\% used active strategies to achieve these. Few followed the Av-P pathway. Offenders following different offense pathways could be distinguished by characteristics (e.g., cognitive distortions, emotional congruence with children, victim types, and previous convictions). \\ \hline Webster (2005; N = 25) & Ap-E pathway was predominant for this sample before and after treatment. There was no support for the notion that offenders would change pathways following treatment. \\ \hline Yates and Kingston (2006; N = 80) & Av-P and Ap-A pathways were associated predominantly with incest offenders and rapists, respectively. For the Ap-E pathway, it comprised nearly equal numbers of rapists, child molesters against male victims, and incest offenders. The pathways were differentially associated with offender types. \\ \hline Keeling, Rose, and Beech (2006; N = 64) & Special needs offenders were compared with mainstream offenders. All but one offender had approach goals and almost 2/3 had a passive self-regulation style. Ap-E and Ap-A pathways were most common for mainstream offenders, and the latter for special needs offenders. \\ \hline Langdon, Maxted, Murphy, and the Sex Offenders Treatment Services Collaborative-Intellectual Disabilities Group (2007; N = 34) & Offenders with intellectual disability followed predominantly Ap-A and Ap-E offense pathways. Approach pathway offenders had higher levels of cognitive distortion and more denial about the negative impact of their offending on victims. No differences between offense pathways in terms of victim types. \\ \hline Ford, Rose, and Thrift (2009; N = 28) & Offenders with intellectual disability followed predominantly Ap-A and Ap-E offense pathways. Offenders with passive self- regulation had lower intellectual functioning than those with active self-regulation. \\ \hline Kingston, Yates, Simons, and Tyler (2009; N = 96) & Offenders with Ap-E pathway were most likely to offend against children. However, Ap-E and Ap-A pathway offenders were more likely than Avoidant pathway offenders to show sexual interest in children. Ap-A offenders were most likely to use interpersonal violence, but Av-P and Av-A pathway offenders were least likely. \\ \hline Kingston, Yates, and Firestone (2012; N = 275) & Rapists predominantly followed the Ap-A pathway, extrafamilial child molesters and mixed offenders followed the Ap-E pathway, and intrafamilial child molesters followed the Av-P pathway. Multivariate analyses revealed that Approach pathway offenders exhibited more problematic offense characteristics as well as higher risk and treatment need than those with inhibitory goals. \\ \hline \end{tabular}} \end{table}	PMC4441881_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Compound (concentration)} & \multicolumn{2}{\|l\|}{\textbf{Residual activity, \%}} \\ \hline & \textbf{Method A} & \textbf{Method B} \\ \hline None & 36.3 & 60 \\ \hline Glycine (1\%, w/v) & 100 & 100 \\ \hline Sucrose (10\%, w/v) & 56.1 & 64.8 \\ \hline D-Glucose (10\%, w/v) & 73.7 & 92.7 \\ \hline Trehalose (10\%, w/v) & 48.5 & 89.7 \\ \hline D-Sorbitol (10\%, w/v) & 59.1 & 93.9 \\ \hline Xylitol (10\%, w/v) & 32.7 & 85.4 \\ \hline D-myo-inositol (10\%, w/v) & 57.3 & 97.0 \\ \hline D-Glycerol (10\%, w/v) & 54.4 & 86.6 \\ \hline Bovine serum albumin (0.1\%, w/v) & 56.7 & 87.0 \\ \hline Bovine serum albumin (1\%, w/v) & 64.9 & 80.6 \\ \hline \end{tabular}} \end{table}	PMC3023689_table_3
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Parameter} & \textbf{P value} & \textbf{OR/$\beta$(CI)} \\ \hline Age & 0.07 & 0.9 (0.8-1.9) \\ \hline DM & 0.06 & 0.7 (0.9-1.4) \\ \hline Gender & 0.09 & 0.7 (0.4-1.7) \\ \hline hypertension & 0.07 & 0.6 (0.3-1.8) \\ \hline BMI Kg/m2 & 0.07 & 0.7(0.7-1.8) \\ \hline smoking & 0.1 & 0.8 (0.02-1.67) \\ \hline E velocity & 0.06 & 0.8 (1.1-1.9) \\ \hline A velocity & 0.07 & 0.7 (0.03-1.9) \\ \hline E/A velocity & 0.03 & 1.6 (1.1-1.9) \\ \hline \end{tabular}} \end{table}	PMC3636105_table_3
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{by Incidence} & \multicolumn{3}{\|l\|}{\textbf{Copeptin (pmol/l)a}} & \textbf{1 unit increase in loge copeptin} & \textbf{p trend} \\ \hline \textbf{with heart} & \textbf{$<$3.35 (n = 1376)} & \textbf{3.35–6.95 (n = 1151)} & \textbf{$\geq$6.96 (n = 581)} \\ \hline \multicolumn{6}{\|l\|}{CHD (n = 370)} \\ \hline Rate/1000 person-years (n) & 8.5 (134) & 11.4 (146) & 15.2 (90) \\ \hline Age-adjusted HR & 1.00 & 1.27 (1.01, 1.61) & 1.68 (1.28, 2.19) & 1.23 (1.00, 1.40) & 0.002 \\ \hline Model 1 & 1.00 & 1.24 (0.97, 1.57) & 1.45 (1.10, 1.92) & 1.15 (1.01, 1.30) & 0.04 \\ \hline Model 2 & 1.00 & 1.21 (0.95, 1.55) & 1.36 (1.01, 1.83) & 1.12 (0.98, 1.27) & 0.10 \\ \hline Model 2a & 1.00 & 1.24 (0.94, 1.62) & 1.22 (0.87, 1.71) & 1.04 (0.91, 1.19) & 0.54 \\ \hline \multicolumn{6}{\|l\|}{Stroke (n = 272)} \\ \hline Rate/1000 person-years (n) & 7.2 (111) & 8.2 (101) & 10.5 (60) \\ \hline Age-adjusted HR & 1.00 & 1.07 (0.81, 1.40) & 1.37 (1.00, 1.84) & 1.12 (0.97, 1.29) & 0.13 \\ \hline Model 1 & 1.00 & 1.00 (0.76, 1.32) & 1.16 (0.84, 1.62) & 1.03 (0.90, 1.17) & 0.65 \\ \hline Model 2 & 1.00 & 0.99 (0.75, 1.31) & 1.13 (0.80, 1.59) & 1.03 (0.90, 1.17) & 0.71 \\ \hline Model 2a & 1.00 & 1.12 (0.82, 1.53) & 1.26 (0.79, 1.71) & 1.05 (0.90, 1.24) & 0.52 \\ \hline \multicolumn{6}{\|l\|}{CVD death (n = 419)} \\ \hline Rate/1000 person-years (n) & 9.2 (144) & 13.2 (168) & 18.1 (107) \\ \hline Age-adjusted HR & 1.00 & 1.31 (1.05, 1.64) & 1.82 (1.41, 2.33) & 1.29 (1.14, 1.46) & 0.005 \\ \hline Model 1 & 1.00 & 1.18 (0.93, 1.48) & 1.43 (1.10, 1.86) & 1.13 (1.00, 1.28) & 0.05 \\ \hline Model 2 & 1.00 & 1.15 (0.91, 1.45) & 1.28 (0.97, 1.69) & 1.08 (0.95, 1.22) & 0.22 \\ \hline Model 2a & 1.00 & 1.19 (0.96, 1.60) & 1.02 (0.73, 1.43) & 0.97 (0.86, 1.11) & 0.62 \\ \hline \end{tabular}} \end{table}	PMC4969339_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline & \multicolumn{2}{\|l\|}{\textbf{Univariate analysis}} & \multicolumn{2}{\|l\|}{\textbf{Multivariate analysis}} \\ \hline & \textbf{P} & \textbf{Regression coefficient (SE)a} & \textbf{P} & \textbf{Relative risk (95\%CI)} \\ \hline \multicolumn{5}{\|l\|}{Overall survival} \\ \hline Expression of SOD2 & 0.047 & 2.13 (1.07) & 0.047 & 8.39 (1.03 to 68.40) \\ \hline T stage & 0.08 & 1.48 (0.84) & 0.14 & … \\ \hline Clinical stage & 0.16 & 1.19 (0.84) & … & … \\ \hline Distant metastasis & 0.07 & 1.37 (0.77) & 0.38 & … \\ \hline Recurrence & 0.84 & 0.18 (0.84) & … & … \\ \hline Age & 0.21 & 3.81 (3.06) & … & … \\ \hline Sex & 0.37 & − 0.75(0.83) & … & … \\ \hline \multicolumn{5}{\|l\|}{Disease-free survival} \\ \hline Expression of SOD2 & 0.046 & 0.90 (0.45) & 0.046 & 2.48 (1.02 to 6.03) \\ \hline T stage & 0.06 & 0.82 (0.44) & 0.65 & … \\ \hline Clinical stage & 0.12 & 0.69 (0.44) & … & … \\ \hline Distant metastasis & $<$ 0.001 & 1.87 (0.47) & $<$ 0.001 & 9.55 (3.50 to 26.04) \\ \hline Recurrence & $<$ 0.001 & 1.99 (0.47) & $<$ 0.001 & 9.87 (3.73 to 26.11) \\ \hline Age & 0.84 & − 0.09 (0.45) & … & … \\ \hline Sex & 0.64 & − 0.22(0.46) & … & … \\ \hline \end{tabular}} \end{table}	PMC4867643_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{BuL} & \textbf{CHB} & \textbf{CHD} & \textbf{JPT} & \textbf{CEU} & \textbf{GIH} & \textbf{MEX} & \textbf{TSI} & \textbf{ASW} & \textbf{LWK} & \textbf{MKK} & \textbf{YRI} \\ \hline BuL & 0 \\ \hline CHB & 0.04728 & 0 \\ \hline CHD & 0.04259 & −0.00161 & 0 \\ \hline JPT & 0.04914 & 0.00586 & 0.00761 & 0 \\ \hline CEU & 0.14462 & 0.13026 & 0.12708 & 0.11499 & 0 \\ \hline GIH & 0.15465 & 0.15697 & 0.15321 & 0.14338 & 0.03311 & 0 \\ \hline MEX & 0.09721 & 0.08424 & 0.07821 & 0.08033 & 0.02248 & 0.05258 & 0 \\ \hline TSI & 0.14058 & 0.11524 & 0.11626 & 0.10172 & 0.00012 & 0.04047 & 0.02447 & 0 \\ \hline ASW & 0.17273 & 0.1955 & 0.19394 & 0.17125 & 0.12124 & 0.08173 & 0.11144 & 0.12461 & 0 \\ \hline LWK & 0.23967 & 0.26654 & 0.26764 & 0.23703 & 0.18539 & 0.14618 & 0.18563 & 0.19061 & 0.01719 & 0 \\ \hline MKK & 0.20378 & 0.23189 & 0.23406 & 0.19985 & 0.13638 & 0.10553 & 0.15181 & 0.14253 & 0.01888 & 0.01336 & 0 \\ \hline YRI & 0.23439 & 0.26827 & 0.27045 & 0.23703 & 0.19138 & 0.14351 & 0.19235 & 0.1978 & 0.01513 & 0.00383 & 0.01359 & 0 \\ \hline \end{tabular}} \end{table}	PMC6503013_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline \textbf{Theme} & \textbf{Reference} \\ \hline \multicolumn{2}{\|l\|}{Pre-screen} \\ \hline Stigma and awareness of disease & 22, 24, 27, 29, 30, 31, 33, 34, 35, 36, 38, 39, 43, 43, 47, 50 \\ \hline Role of family & 27, 31, 32, 34, 36, 37, 38, 39 \\ \hline Existing health & 22, 27, 31, 34, 36, 40 \\ \hline Health insurance/financial/ Employment/driving & 21, 28, 35, 43 \\ \hline Duration of contact & 46 \\ \hline Locality & 37, 46 \\ \hline Current practice/practicalities & 36, 38, 40, 42, 44, 45, 49, 50 \\ \hline Lifestyle and life view & 21, 24, 26, 27, 28, 29, 33, 37, 48, 50 \\ \hline Training & 22, 31, 34, 36, 39, 47, 49, 50 \\ \hline \multicolumn{2}{\|l\|}{In-screen} \\ \hline Time constraints & 36, 41, 44, 45, 46 \\ \hline Inaccuracy of test & 41, 45 \\ \hline Cost & 38, 45 \\ \hline Communication & 22 \\ \hline \multicolumn{2}{\|l\|}{Post-screen} \\ \hline Lack of change in prognosis, treatment and patient benefit & 21, 23, 24, 26, 27, 28, 29, 31, 32, 33, 35, 36, 37, 38, 39, 41, 42, 44, 45, 47, 48, 49 \\ \hline Role of support & 30, 37 \\ \hline \end{tabular}} \end{table}	PMC4469007_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Variable} & \textbf{No. of patients} & \textbf{No. of HF} & \textbf{No. of death} & \textbf{Unadjusted HR (95\% CI) p value} & \textbf{LVH‑adjusted HR (95\% CI)a p value} & \textbf{E/e′‑adjusted HR (95\% CI)b p value} & \textbf{Adjusted HR (95\% CI)c p value} \\ \hline Age & 254 & 37 & 3 & 1.06 (0.99, 1.13) 0.064 & – & – & 1.06 (0.99, 1.14) 0.055 \\ \hline Male gender & 142 & 25 & 3 & 1.81 (0.92, 3.56) 0.086 & – & – & 1.36 (0.61, 2.92) 0.466 \\ \hline Obesity & 124 & 29 & 1 & 3.61 (1.76, 7.39) $<$ 0.001 & 2.87 (1.38, 5.98) 0.005 & 3.27 (1.58, 5.75) 0.001 & 2.97 (1.44, 6.30) 0.004 \\ \hline HbA1c & 32 & 10 & 2 & 3.27 (1.66, 6.43) 0.001 & 2.04 (0.99, 4.22) 0.054 & 2.47 (1.22, 5.00) 0.012 & 2.01 (0.93, 4.10) 0.077 \\ \hline LVH & 35 & 13 & 1 & 3.92 (2.04, 7.52) $<$ 0.001 & 3.24 (1.65, 6.38) 0.001 & – & 2.67 (1.25, 5.99) 0.011 \\ \hline E/e′ & 26 & 4 & 0 & 1.04 (0.37, 2.94) 0.934 & – & 1.11 (0.39, 3.18) 0.845 & 0.82 (0.26, 2.52) 0.724 \\ \hline Depression & 25 & 7 & 0 & 3.21 (1.41, 7.30) 0.005 & 2.80 (1.16, 6.76) 0.022 & 2.39 (1.01, 5.67) 0.048 & 3.14 (1.27, 7.74) 0.013 \\ \hline \end{tabular}} \end{table}	PMC5781289_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & \multicolumn{5}{\|l\|}{\textbf{parameter}} & \textbf{t value} & \textbf{df} & \textbf{Sig. (2 tailed)} \\ \hline & \textbf{mean} & \textbf{STD} & \textbf{Standard error} & \multicolumn{2}{\|l\|}{\textbf{99\% confidence interval}} \\ \hline & & & & \textbf{lower} & \textbf{Upper} \\ \hline Difference & -0.02 & 0.122 & 0.027 & -0.098 & 0.059 & -0.71 & 9 & 0.487 \\ \hline \end{tabular}} \end{table}	PMC4959725_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Category} & \textbf{n} & \textbf{\%} \\ \hline \multicolumn{3}{\|l\|}{Physical condition (n=6024)} \\ \hline Good & 3589 & 74.3\% \\ \hline Medium & 2238 & 66.8\% \\ \hline Bad & 197 & 61.4\% \\ \hline \multicolumn{3}{\|l\|}{Relationships (n=6020)} \\ \hline Good & 2421 & 73.1\% \\ \hline Medium & 3464 & 69.8\% \\ \hline Bad & 135 & 69.6\% \\ \hline \multicolumn{3}{\|l\|}{Appetite (n=6020)} \\ \hline Good & 3582 & 77.0\% \\ \hline Medium & 2146 & 64.4\% \\ \hline Bad & 292 & 49.3\% \\ \hline \multicolumn{3}{\|l\|}{Sleeping (n=6019)} \\ \hline Good & 3216 & 75.8\% \\ \hline Medium & 2266 & 67.6\% \\ \hline Bad & 537 & 57.9\% \\ \hline \multicolumn{3}{\|l\|}{Learning (n=6008)} \\ \hline Good & 1255 & 81.4\% \\ \hline Medium & 4253 & 70.6\% \\ \hline Bad & 500 & 51.2\% \\ \hline \multicolumn{3}{\|l\|}{Get along with classmates (n=6002)} \\ \hline Good & 3682 & 73.7\% \\ \hline Medium & 2266 & 67.1\% \\ \hline Bad & 54 & 64.8\% \\ \hline \end{tabular}} \end{table}	PMC3562148_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline \textbf{N} & \textbf{23} \\ \hline \multicolumn{2}{\|l\|}{Level of the hospital} \\ \hline I & 11 \\ \hline II & 12 \\ \hline \multicolumn{2}{\|l\|}{Working experience} \\ \hline $<$5 years & 13 \\ \hline $>$5 years & 10 \\ \hline \multicolumn{2}{\|l\|}{Participated in neonatal resuscitation requiring PPV:} \\ \hline no & 8 \\ \hline yes & 15 \\ \hline \multicolumn{2}{\|l\|}{Participated in neonatal resuscitation course during the previous 6 months:} \\ \hline no & 12 \\ \hline yes & 11 \\ \hline \end{tabular}} \end{table}	PMC5116137_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{image Displacement} & \multicolumn{2}{\|l\|}{\textbf{10 mm}} & \multicolumn{2}{\|l\|}{\textbf{50 mm}} & \multicolumn{2}{\|l\|}{\textbf{100 mm}} \\ \hline \textbf{Displacement axis} & \textbf{Frontal} & \textbf{Longitudinal} & \textbf{Frontal} & \textbf{Longitudinal} & \textbf{Frontal} & \textbf{Longitudinal} \\ \hline \multicolumn{7}{\|l\|}{SLRM} \\ \hline Average & 11.3 & 11.1 & 11.3 & 11.1 & 10.7 & 11.3 \\ \hline Standard deviation & 0.4 & 0.7 & 0.5 & 0.4 & 0.4 & 0.5 \\ \hline Minimum & 10.5 & 10.1 & 10.3 & 10.6 & 10.1 & 10.4 \\ \hline Maximum & 11.8 & 12.4 & 11.9 & 12.0 & 11.3 & 12.0 \\ \hline Repeatability & 0.11 & 0.23 & 0.17 & 0.12 & 0.13 & 0.17 \\ \hline \multicolumn{7}{\|l\|}{FLRM} \\ \hline Average & 4.6 & 4.7 & 4.6 & 5.1 & 4.4 & 5.2 \\ \hline Standard deviation & 0.2 & 0.4 & 0.3 & 0.4 & 0.3 & 0.3 \\ \hline Minimum & 4.4 & 4.3 & 4.2 & 4.7 & 3.7 & 4.7 \\ \hline Maximum & 5.0 & 5.5 & 5.1 & 5.8 & 4.9 & 5.6 \\ \hline Repeatability & 0.05 & 0.09 & 0.11 & 0.11 & 0.13 & 0.08 \\ \hline \end{tabular}} \end{table}	PMC6223760_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline \textbf{HPV type} & \textbf{Array positive} & \textbf{Array negative} \\ \hline 12 & 0 & 1 \\ \hline 34 & 1 & 0 \\ \hline 44 & 1 & 0 \\ \hline cand62 & 2 & 1 \\ \hline 67 & 1 & 0 \\ \hline 71 & 2 & 0 \\ \hline 72 & 3 & 0 \\ \hline 81 & 5 & 1 \\ \hline cand85 & 1 & 1 \\ \hline 97 & 1 & 0 \\ \hline 102 & 1 & 0 \\ \hline Total & 18 & 4 \\ \hline \end{tabular}} \end{table}	PMC3139178_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Variable} & \textbf{No-induction} & \textbf{rATG} & \textbf{Basiliximab} & \textbf{P value} \\ \hline 0.05 SCr ($\mu$mol/L)* & 120 [73; 260] & 121 [51; 261] & 137 [82; 246] & ns‡ \\ \hline eGFR (mL/s/1.73 m2)* & 0.80 [0.28; 1.18] & 0.89 [0.38; 1.81] & 0.65 [0.34; 1.45] & ns‡ \\ \hline Proteinuria (g/24)* & 0.18 [0.07; 2.58] & 0.18 [0.07; 11.58] & 0.25 [0.08; 1.11] & ns‡ \\ \hline \end{tabular}} \end{table}	PMC4545708_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Compound (Peak No.)} & \textbf{Retention time (min)} & \textbf{Calibration range (µg/mL)} & \textbf{Regression equation} & \textbf{Coefficient of correlation (R2)} \\ \hline Resveratroloside (Res, 1) & 4.83 & 0.75−12.00 & Y = 13280.0X + 3543.1 & 0.9931 \\ \hline Sennoside A (Se-A, 2) & 5.58 & 0.40−6.40 & Y = 42404.0X + 3029.2 & 0.9971 \\ \hline Baicalin (Ba, 3) & 10.91 & 5.00−80.00 & Y = 37233.0X + 52341 & 0.9983 \\ \hline Coptisine (Co, 4) & 18.42 & 0.10−2.40 & Y = 55585.0X + 5375.3 & 0.9903 \\ \hline Palmatine (Pa, 5) & 19.58 & 0.25−4.00 & Y = 13039.0X + 2777.9 & 0.9916 \\ \hline Berberine (Be, 6) & 21.13 & 0.75−12.00 & Y = 73590.0X − 1532.2 & 0.9986 \\ \hline Rhein (Rh, 7) & 23.81 & 0.10−1.60 & Y = 99814.0X + 8013.8 & 0.9939 \\ \hline Aloe-emodin (Ale, 8) & 24.37 & 0.075−1.200 & Y = 75638.0X + 1326.2 & 0.9975 \\ \hline Wogonin (Wo, 9) & 25.12 & 0.025−0.600 & Y = 90308.0X + 2655.5 & 0.9954 \\ \hline \end{tabular}} \end{table}	PMC5071620_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Community Type} & \textbf{Species Richness (S)} & \textbf{Diversity index (H)} & \textbf{True diversity (D)} & \textbf{Shannon’s evenness (J)} & \textbf{Hmax} \\ \hline 1 (18 plots) & 58 & 3.60 & 37 & 0.89 & 4.06 \\ \hline 2 (14 plots) & 66 & 3.85 & 47 & 0.92 & 4.19 \\ \hline 3 (8 plots) & 48 & 3.58 & 36 & 0.93 & 3.87 \\ \hline 4 (10 plots) & 32 & 3.17 & 24 & 0.91 & 3.47 \\ \hline Average & 51 & 3.55 & 36 & 0.91 & 3.90 \\ \hline \end{tabular}} \end{table}	PMC6192589_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & \multicolumn{3}{\|l\|}{\textbf{Damak (n = 93)}} & \multicolumn{3}{\|l\|}{\textbf{Charali (n = 73)}} & \multicolumn{3}{\|l\|}{\textbf{Bharatpur (n = 28)}} \\ \hline \textbf{Species name (scientific name)} & \textbf{PCR} & \textbf{Morpho} & \textbf{Both} & \textbf{PCR} & \textbf{Morpho} & \textbf{Both} & \textbf{PCR} & \textbf{Morpho} & \textbf{Both} \\ \hline Non-venomous species n = 107 & & & & & & & NA & NA & NA \\ \hline Common wolf snake (Lycodon aulicus) n = 11 & 2 & 7 & 1 & 1 & 2 & 0 \\ \hline Trinket snake (Coelognathus helena) n = 2 & 0 & 1 & 0 & 0 & 1 & 0 \\ \hline Indian rat snake (Ptyas mucosa) n = 3 & 1 & 1 & 0 & 1 & 0 & 0 \\ \hline Mock viper (Psammodynastes pulverulentus) n = 2 & 0 & 1 & 0 & 0 & 1 & 0 \\ \hline Checkered keelback (Xenochrophis piscator) n = 88 & 45 & 5 & 4 & 41 & 2 & 1 \\ \hline Spotted keelback water snake (Xenochrophis punctulatus) n = 1 & 1 & 0 & 0 & 0 & 0 & 0 \\ \hline \multicolumn{10}{\|l\|}{Venomous species n = 87} \\ \hline Montain pit viper (Ovophis monticola) n = 5 & 1 & 0 & 0 & 4 & 1 & 1 & 0 & 0 & 0 \\ \hline Unidentified pit viper (Trimeresurus sp.) n = 3 & 0 & 1 & 0 & 1 & 1 & 0 & 0 & 0 & 0 \\ \hline White-lipped pit viper (Trimeresurus albolabris) n = 5 & 2 & 1 & 0 & 2 & 0 & 0 & 0 & 0 & 0 \\ \hline Pope’s tree viper (Trimeresurus popeiorum) n = 1 & 0 & 0 & 0 & 1 & 0 & 0 & 0 & 0 & 0 \\ \hline Spectacled cobra (Naja naja) n = 42 & 16 & 15 & 5 & 7 & 3 & 1 & 4 & 4 & 1 \\ \hline Unidentified cobra (Naja sp.) n = 1 & 0 & 1 & 0 & 0 & 0 & 0 & 0 & 0 & 0 \\ \hline Monocellate cobra (Naja kaouthia) n = 1 & 0 & 0 & 0 & 0 & 0 & 0 & 1 & 0 & 0 \\ \hline King cobra (Ophiophagus hannah) n = 1 & 1 & 0 & 0 & 0 & 0 & 0 & 0 & 0 & 0 \\ \hline Common krait (Bungarus caeruleus) n = 22 & 0 & 0 & 0 & 2 & 0 & 0 & 17 & 10 & 7 \\ \hline Greater black krait (Bungarus niger) n = 1 & 0 & 0 & 0 & 0 & 1 & 0 & 0 & 0 & 0 \\ \hline Lesser black krait (Bungarus lividus) n = 5 & 0 & 1 & 0 & 2 & 2 & 0 & 0 & 0 & 0 \\ \hline \end{tabular}} \end{table}	PMC4841570_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline \textbf{Sample} & \textbf{IC50} \\ \hline BHT & 219.67$\pm$10.43a $\mu$g/ml \\ \hline GCO & 10.25$\pm$0.30b mg/ml \\ \hline HGCO & 15.38$\pm$0.72d mg/ml \\ \hline RCO & 11.99$\pm$0.51c mg/ml \\ \hline HRCO & 12.86$\pm$0.79c mg/ml \\ \hline \end{tabular}} \end{table}	PMC4569078_table_3
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|} \hline \textbf{Clinical outcomes (n, \%)} & \multicolumn{4}{\|l\|}{\textbf{Univariate multivariate}} \\ \hline & \textbf{HR (95\% CI)} & \textbf{P} & \textbf{HR (95\% CI)} & \textbf{P} \\ \hline MACE & 1.190 (0.976–1.451) & 0.085 & 1.145 (0.937–1.401) & 0.186 \\ \hline All‑cause death & 1.477 (0.827–2.637) & 0.188 & 1.268 (0.686–2.344) & 0.449 \\ \hline Cardiac death & 0.886 (0.363–2.159) & 0.790 & 0.772 (0.293–2.039) & 0.602 \\ \hline Non‑fatal MI & 0.834 (0.493–1.413) & 0.50 & 0.758 (0.441–1.304) & 0.317 \\ \hline Stent thrombosis & 0.692 (0.289–1.654) & 0.407 & 0.573 (0.222–1.480) & 0.250 \\ \hline Revascularization & 1.188 (0.936–1.508) & 0.157 & 1.184 (0.931–1.505) & 0.168 \\ \hline TVR & 1.619 (1.193–2.198) & 0.002 & 1.539 (1.128–2.099) & 0.007 \\ \hline TLR & 2.109 (1.501–2.963) & $<$ 0.001 & 1.963 (1.390–2.772) & $<$ 0.001 \\ \hline Stroke & 1.087 (0.611–1.932) & 0.778 & 0.976 (0.538–1.771) & 0.936 \\ \hline Bleeding & 1.022 (0.798–1.310) & 0.861 & 1.055 (0.807–1.379) & 0.696 \\ \hline BRAC 2_5 & 0.927 (0.625–1.374) & 0.705 & 0.929 (0.625–1.381) & 0.714 \\ \hline BRAC 3_5 & 0.613 (0.213–1.766) & 0.364 & 0.630 (0.216–1.839) & 0.397 \\ \hline \end{tabular}} \end{table}	PMC6090623_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{on Item} & \multicolumn{3}{\|l\|}{\textbf{Citrus pulp, fish by-product, and Bacillus subtilis fermentation biomass, \%}} & \textbf{SEM2} & \multicolumn{2}{\|l\|}{\textbf{P-values3}} \\ \hline & \textbf{0} & \textbf{2.5} & \textbf{5.0} & & \textbf{Linear} & \textbf{Quadratic} \\ \hline \multicolumn{7}{\|l\|}{Phase I (d 8–14)} \\ \hline DM & 84.63b & 84.99ab & 85.49a & 0.15 & 0.003 & 0.714 \\ \hline GE & 83.56b & 83.89ab & 84.19a & 0.12 & 0.005 & 0.890 \\ \hline CP & 79.66 & 79.93 & 80.21 & 0.275 & 0.098 & 0.906 \\ \hline Ash & 60.02b & 60.76ab & 61.72a & 0.26 & 0.005 & 0.461 \\ \hline Ca & 56.48 & 55.52 & 54.99 & 1.77 & 0.548 & 0.851 \\ \hline P & 45.58 & 45.22 & 45.04 & 1.03 & 0.690 & 0.592 \\ \hline \multicolumn{7}{\|l\|}{Phase II (d 22–28)} \\ \hline DM & 81.87 & 82.04 & 82.77 & 0.35 & 0.106 & 0.535 \\ \hline GE & 82.14 & 82.67 & 83.34 & 0.47 & 0.101 & 0.909 \\ \hline CP & 75.95 & 76.78 & 77.39 & 0.61 & 0.127 & 0.885 \\ \hline Ash & 54.98 & 55.34 & 55.57 & 0.75 & 0.595 & 0.947 \\ \hline Ca & 52.08 & 52.34 & 52.53 & 1.38 & 0.821 & 0.983 \\ \hline P & 46.96 & 47.57 & 48.67 & 1.52 & 0.448 & 0.894 \\ \hline \end{tabular}} \end{table}	PMC4540257_table_3
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Burden of disease} & \textbf{Pre-TCT number (\%)} & \textbf{95\% CI} & \textbf{Post-TCT number (\%)} & \textbf{95\% CI} & \textbf{Odds Ratio (95\% CI)} \\ \hline Yaws seroprevalence (dually-positive DPP rapid test) & 103/943 (10.9\%) & (6.5\%-17.5\%) & 27/1211 (2.2\%) & (1.3\%-3.7\%) & 0.19 (0.09–0.37) \\ \hline Prevalence of skin lesions & 337/943 (35.7\%) & (30.8\%-40.9\%) & 223/1211 (18.4\%) & (14.1\%-23.6\%) & 0.41 (0.31–0.52) \\ \hline Prevalence of yaws-like lesions with a dually positive DPP rapid test & 54/943 (5.7\%) & (3.2\%-9.9\%) & 7/1211 (0.6\%) & (0.2\%-1.6\%) & 0.10 (0.25–0.35) \\ \hline \end{tabular}} \end{table}	PMC5863939_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Outcome} & \textbf{Group} & \textbf{1996} & \multicolumn{2}{\|l\|}{\textbf{2007 2008 (Single cohort)†}} & \textbf{2009} & \textbf{2010} & \textbf{Overall OR} \\ \hline \\ \hline \multicolumn{8}{\|l\|}{BMI} \\ \hline $<$25, \% & Members & 51.2\% & 41\% & 37.6\% & 35.6\% & 41.5\% \\ \hline 25 to 30, \% & & 29.9\% & 32.2\% & 30\% & 36.5\% & 32\% \\ \hline $>$ = 30, \% & & 18.8\% & 26.8\% & 32.4\% & 27.9\% & 26.5\% \\ \hline $<$25, \% & Nonmembers & 50.9\% & 39.5\% & 38.9\% & 39.6\% & 36.6\% \\ \hline 25 to 30, \% & & 34.4\% & 33.5\% & 34.9\% & 30.2\% & 35.8\% \\ \hline $>$ = 30, \% & & 14.7\% & 27.1\% & 26.2\% & 30.2\% & 27.5\% \\ \hline & OR (95\% CI)‡ & 1.28 (0.91, 1.81) & 1.07 (0.89, 1.27) & 1.17 (0.99, 1.38) & 0.92 (0.71, 1.20) & 0.98 (0.76, 1.27) & 1.08 (0.97, 1.20) \\ \hline & P-value‡ & 0.27 & 0.93 & 0.20 & 0.29 & 0.49 & 0.17 \\ \hline $<$25, \% & National$\S$ & 47.8\% & 37\% & 36.6\% & 36\% & 35.5\% \\ \hline 25 to 30, \% & & 35.4\% & 36.7\% & 36.5\% & 36.2\% & 36.2\% \\ \hline $>$ = 30, \% & & 16.8\% & 26.3\% & 26.6\% & 26.9\% & 27.5\% \\ \hline P-values comparing to National estimates & Member vs. National & 0.12 & 0.36 & 0.05 & 0.95 & 0.21 \\ \hline & Non-member vs. National & 0.45 & 0.35 & 0.66 & 0.05 & 0.93 \\ \hline \end{tabular}} \end{table}	PMC4749948_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Peak No} & \textbf{Retention Time (Min)} & \textbf{MS + Tret identification} & \textbf{\%} \\ \hline 1 & 3.19 & N(b)-benzyl-14-(carboxymethyl) & 6.35 \\ \hline 2 & 3.21 & Benzene, 1.3-bis (3- phenoxyphenoxy) & 13.51 \\ \hline 3 & 3.43 & 2-Phenyl-2-tipyl-acenapthenone & 4.50 \\ \hline 4 & 5.96 & a-pinene & 0.49 \\ \hline 5 & 6.30 & Camphene & 0.14 \\ \hline 6 & 8.28 & 1.8 cineole & 0.91 \\ \hline 7 & 11.32 & Camphor & 2.77 \\ \hline 8 & 11.91 & Endo-Borneol & 1.76 \\ \hline 9 & 12.23 & Linalool & 0.20 \\ \hline 10 & 12.60 & 1-a-Terpineol & 0.43 \\ \hline 11 & 12.88 & a-Caryophyllene oxide & 0.95 \\ \hline 12 & 12.94 & Nopol & 0.45 \\ \hline 13 & 13.10 & 2-Pinen-4-one & 10.03 \\ \hline 14 & 15.12 & (-)-Bornyl acetate & 1.96 \\ \hline 15 & 17.81 & 1 Tetradecanol (Fatty alcohol) & 1.07 \\ \hline 16 & 22.60 & 5-Octadecene & 1.10 \\ \hline 17 & 29.64 & Hexadecanoic acid (Methyl ester) & 1.02 \\ \hline 18 & 30.38 & Palmitic acid & 3.91 \\ \hline 19 & 34.09 & 17-Pentatriacontene & 1.51 \\ \hline 20 & 36.27 & Tritetracontane & 1.36 \\ \hline 21 & 36.88 & 5.beta.-Pregn-11-ene & 1.71 \\ \hline 22 & 38.76 & 4-Imidozolidinone & 3.49 \\ \hline 23 & 40.52 & Naphthalene & 1.06 \\ \hline 24 & 40.82 & Quinoline & 1.58 \\ \hline TOTAL & & & 60.55\% \\ \hline \end{tabular}} \end{table}	PMC3080840_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Factor} & \textbf{Sub-groups} & \textbf{n} & \textbf{BUT(s)} & \textbf{Schirmer I test} & \textbf{FL} & \textbf{Corneal Sensitivity} \\ \hline Gender & Female & 896 & 3.63 $\pm$ 2.10 & 8.67 $\pm$ 5.89 & 0.59 $\pm$ 0.98 & 55.51 $\pm$ 10.21 \\ \hline & Male & 464 & 4.33 $\pm$ 2.70 & 9.59 $\pm$ 6.42 & 0.62 $\pm$ 1.16 & 53.64 $\pm$ 10.80 \\ \hline Statistic Value & & & −5.27 & −2.67 & − 0.49 & 3.14 \\ \hline P value & & & 0.00 & 0.01 & 0.62 & 0.00 \\ \hline \end{tabular}} \end{table}	PMC5946388_table_3
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{Hatori et al. [24]} & \textbf{Guler et al. [22]} & \textbf{Goz et al. [23]} & \textbf{Boudard et al. [27]} & \textbf{Our findings} \\ \hline Reentrainment & Absent (150 lx) & Most animals unable to entrain (700 lx) Advanced onset Others had light responses, but no stable circadian rhythms & Half able to entrain, more than 16 days required (100 lx) Advanced onset Half failed to entrain & Able to entrain, more than 12 days required (15 lx) Normal (300 lx) & Able to entrain, at least 8–11 days required (100 lx) Advanced onset \\ \hline Survival rate & $<$10\% & 3–17\% & 18–40\% & 63\% & 40–75\% \\ \hline \end{tabular}} \end{table}	PMC5735630_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline & \multicolumn{4}{\|l\|}{\textbf{Multi A}} & \multicolumn{4}{\|l\|}{\textbf{Multi B}} & \multicolumn{4}{\|l\|}{\textbf{Multi C}} \\ \hline & \textbf{VP2-03} & \textbf{VPTR7} & \textbf{VP1-11} & \textbf{VPTR5} & \textbf{VP1-10} & \textbf{VPTR1} & \textbf{VPTR8} & \textbf{VP1-17} & \textbf{VPTR4} & \textbf{VPTR3} & \textbf{VPTR6} & \textbf{VP2-07} \\ \hline Clinical isolates (n = 30) & 27 & 16 & 29 & 30 & 1 & 28 & 23 & 30 & 30 & 30 & 5 & 30 \\ \hline Percentage (\%) & 90.0 & 53.3 & 96.7 & 100.0 & 3.3 & 93.3 & 76.7 & 100.0 & 100.0 & 100.0 & 16.7 & 100.0 \\ \hline Oyster isolates (n = 28) & 24 & 17 & 27 & 28 & 23 & 28 & 23 & 28 & 27 & 28 & 4 & 28 \\ \hline Percentage (\%) & 85.7 & 60.7 & 96.4 & 100.0 & 82.1 & 100.0 & 82.1 & 100.0 & 96.4 & 100.0 & 14.3 & 100.0 \\ \hline \end{tabular}} \end{table}	PMC4462150_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline [Ni(C23H20Cl4N2O2)] & F000 = 1136 \\ \hline Mr = 556.92 & Dx = 1.644 Mg m−3 \\ \hline Monoclinic, P21/n & Mo K$\alpha$ radiation $\lambda$ = 0.71073 Å \\ \hline Hall symbol: -P 2yn & Cell parameters from 10509 reflections \\ \hline a = 13.344 (2) Å & $\theta$ = 1–27.5º \\ \hline b = 12.073 (2) Å & µ = 1.36 mm−1 \\ \hline c = 14.081 (2) Å & T = 294 (2) K \\ \hline $\beta$ = 97.181 (3)º & Prism, black \\ \hline V = 2250.6 (6) Å3 & 0.22 $\times$ 0.20 $\times$ 0.12 mm \\ \hline Z = 4 \\ \hline \end{tabular}} \end{table}	PMC2961846_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Interventions} & \textbf{Abbreviation} & \textbf{Description} \\ \hline \multicolumn{3}{\|l\|}{Psychotherapeutic intervention} \\ \hline Trauma-focused cognitive behavioural therapy & TF-CBT & CBT is a combination of cognitive and behavioural techniques. It also involves additional techniques such as relaxation training, affective modulation skills and enhancement of future safety and development. TF-CBT is a CBT programme that involves a trauma focus, which is usually performed through exposure or cognitive processing of thoughts related to the trauma. \\ \hline Non-trauma-focused cognitive behavioural therapy & Non-TF-CBT & Non-TF-CBT is a CBT programme that focuses on teaching skills for the reduction of anxiety. These treatments use procedures that directly target the person’s beliefs and behaviours rather than the discussions of specific traumas. \\ \hline Cognitive therapy & CT & CT mainly uses cognitive restructuring training, which aims at examining youths’ automatic thoughts and core schemas and evaluating the accuracy and affective consequences of their views. They aim to teach youths to engage in ‘rational’ thinking about themselves, the traumatic incident and the world. \\ \hline Behavioural therapy & BT & BT uses some form of behavioural training, especially for exposure -based therapy and narrative therapy, to help youth reduce trauma-related symptoms. BT is based on principles of habituation. \\ \hline Eye movement desensitisation and reprocessing & EMDR & EMDR aims to help a person reprocess their memories of a traumatic event. The therapy involves bringing distressing trauma-related images, beliefs and bodily sensations to mind. \\ \hline Psychodynamic therapy & DYN & Psychodynamic psychotherapy focuses on integrating the traumatic experience into the life experience of the individual as a whole. Childhood issues are often felt to be important. \\ \hline Play therapy & PT & PT used techniques to engage participants in recreational activities to help them cope with their problems and fears. \\ \hline Stress management & SM & SM mainly includes some form of relaxation or biofeedback \\ \hline Supportive therapy & ST & ST is an unstructured therapy without specific psychological techniques that it helped people to ventilate their experiences and emotions and offering empathy, for example, supportive counselling, attention control, minimal contact, active listening, common factor control, non-specific control. \\ \hline \multicolumn{3}{\|l\|}{Control conditions} \\ \hline Treatment as usual & TAU & TAU is often described as ‘usual care’ or ‘usual community treatment’ in trials, which may include any components of psychotherapy or pharmacotherapy for PTSD. It is not considered to be structured intervention but may have some treatment effects. \\ \hline Waitlist & WL & WL is a control condition in which the participants receive no active treatment during the study but are informed that they can receive one after the study period is over. \\ \hline No treatment & NT & NT is a control condition in which the participants receive no active treatment during the study and in which they do not expect to receive such after the study is over. \\ \hline \end{tabular}} \end{table}	PMC5857664_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline \textbf{EM operation} & \textbf{Definition} \\ \hline Overlap (x ❍ y) & x and y overlap if they have a part in common. \\ \hline Disjoint (x ι y) & x and y are disjoint if they share no parts in common. \\ \hline Binary product (x . y) & The parts that x and y share in common. \\ \hline Difference (x - y) & The largest portion of x which has no part in common with y. \\ \hline Binary sum (x + y) & The set consisting of individuals x and y. \\ \hline \end{tabular}} \end{table}	PMC1175956_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Total Number of References} & \textbf{Max. Part Weight (kg)} & \textbf{Av. Part weight (kg)} & \textbf{Min. Part Weight (kg)} & \textbf{Part Weight on Percentile 25} & \textbf{Part Weight on Percentile 50} & \textbf{Part Weight on Percentile 75} \\ \hline 2735 & 25 & 2.179 & 1.0 $\times$ 10−12 & 0.252 & 0.655 & 1.005 \\ \hline \end{tabular}} \end{table}	PMC6120002_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Variables} & \textbf{N (\%)} & \textbf{Mean} & \textbf{Std. Deviation} & \textbf{Min} & \textbf{Max} \\ \hline Gender & 12376 & - & - & - & - \\ \hline Males & 5660 (45.3) & - & - & - & - \\ \hline Females & 6716 (54.3) & - & - & - & - \\ \hline Body Mass Index & 10961$\S$ & 25.75 & 4.84 & 9.60 & 57.80 \\ \hline Under/Normal weight & 5449 (49.7) & - & - & - & - \\ \hline Overweight & 3710 (33.8) & - & - & - & - \\ \hline Obese & 1802 (16.4) & - & - & - & - \\ \hline Depression (\# years with MDE-lifetime) & 12282$\S$ & 0.41 & 8.20 & 0 & 67.00 \\ \hline No depression (0 years) & 10826 (88.1) & - & - & - & - \\ \hline Yes depression & 1456 (11.9) & - & - & - & - \\ \hline Physical Activity & 12375$\S$ & 2.27 & 2.34 & 0 & 28.70 \\ \hline Stress Management & 12352$\S$ & 2.31 & 0.93 & 1 & 5 \\ \hline Eating Habits & 1812$\S$ & 10.63 & 8.85 & 0 & 62 \\ \hline Relatives with Depression & 1512$\S$ & 1.76 & 3.02 & 0 & 55 \\ \hline \end{tabular}} \end{table}	PMC1868752_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{Symbol} & \textbf{Full name of tumor suppressor gene} & \textbf{Position} & \textbf{\% of patients with copy number losses} & \textbf{P value*} \\ \hline 1 & CDKN2A & cyclin-dependent kinase inhibitor 2A & 9p12 & 9.63 & 1.87610219 \\ \hline 2 & FHIT & Fragile histidine triad gene & 3p14.2 & 6.64 & 6.33610211 \\ \hline 3 & BRCA2 & breast cancer 2, early onset & 13q12.3 & 4.65 & 3.261026 \\ \hline 4 & TGFBR2 & transforming growth factor, beta receptor II & 3p22 & 4.31 & 1.5561025 \\ \hline 5 & FLCN & Folliculin & 17p11.2 & 3.65 & 0.00029 \\ \hline 6 & RB1 & retinoblastoma 1 & 13q14.2 & 2.66 & 0.012 \\ \hline 7 & NF2 & neurofibromin 2 (merlin) & 22q12.2 & 2.66 & 0.012 \\ \hline 8 & PTEN & phosphatase and tensin homolog & 10q23.3 & 1.66 & 0.19 \\ \hline 9 & EP300 & E1A binding protein p300 & 22q13.2 & 1.66 & 0.19 \\ \hline 10 & FBXW7 & F-box and WD repeat domain containing 7 & 4q31.3 & 1.66 & 0.19 \\ \hline 11 & APC & adenomatous polyposis coli & 5q21–q22 & 1.66 & 0.19 \\ \hline 12 & NOTCH1 & Notch homolog 1, translocation-associated & 9q34.3 & 1.66 & 0.19 \\ \hline 13 & FAT3 & FAT tumor suppressor homolog 3 & 11q14.3 & 1.33 & 0.36 \\ \hline 14 & SMARCB1 & SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily b, member 1 & 22q11 & 1.33 & 0.36 \\ \hline 15 & SMAD4 & mothers against decapentaplegic homolog 4 & 18q21.1 & 1.33 & 0.36 \\ \hline 16 & SMAD2 & mothers against decapentaplegic homolog 2 & 18q21.1 & 1.33 & 0.36 \\ \hline \end{tabular}} \end{table}	PMC3149069_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Variable} & \multicolumn{2}{\|l\|}{\textbf{Unemployment Duration (\%/n)}} & \textbf{t (p)} \\ \hline & \textbf{Short-term N = 234} & \textbf{Long-term N = 195} \\ \hline \multicolumn{4}{\|l\|}{Depression (in past 12 months)} \\ \hline Never & 15.8/37 & 16.4/32 & 0.17 (sn) \\ \hline Sometimes & 50.4/118 & 32.8/64 & 3.75 (p $<$ 0.001) \\ \hline Often & 29.5/69 & 39.5/77 & 2.17 (p $<$ 0.05) \\ \hline Always & 4.3/10 & 11.3/22 & 2.67 (p $<$ 0.01) \\ \hline \multicolumn{4}{\|l\|}{Depression (after unemployment)} \\ \hline Do not feel at all & 14.1/33 & 11.8/23 & 0.71 (sn) \\ \hline No significant changes & 43.2/101 & 33.8/66 & 2.01 (p $<$ 0.05) \\ \hline Feel more often & 39.7/93 & 51.8/101 & 2.52 (p $<$ 0.05) \\ \hline Feel less & 3.0/7 & 2.6/5 & 0.25 (sn) \\ \hline \multicolumn{4}{\|l\|}{Use of sedative drugs} \\ \hline At least once in the last 30 days & 19.2/45 & 25.6/50 & 1.58 (sn) \\ \hline \end{tabular}} \end{table}	PMC1526724_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|} \hline \textbf{Gene} & \textbf{Number of isolates} & \textbf{Percentage} \\ \hline mecA & 6 & 4.8 \\ \hline mecC & 8 & 6.5 \\ \hline blaZ from SCCmec XI & 8 & 6.5 \\ \hline blaZ & 24 & 19.4 \\ \hline erm(A) & 1 & 0.8 \\ \hline erm(B) & 1 & 0.8 \\ \hline erm(C) & 1 & 0.8 \\ \hline lnu(A) & 0 & 0.0 \\ \hline msr(A) & 0 & 0.0 \\ \hline mefA & 0 & 0.0 \\ \hline mph(C) & 0 & 0.0 \\ \hline vat-/vga genes & 0 & 0.0 \\ \hline aacA-aphD & 3 & 2.4 \\ \hline aadD & 3 & 2.4 \\ \hline aphA3 & 2 & 1.6 \\ \hline sat & 2 & 1.6 \\ \hline dfrS1 & 3 & 2.4 \\ \hline fusB & 0 & 0.0 \\ \hline fusC & 0 & 0.0 \\ \hline mupA & 0 & 0.0 \\ \hline tet(K) & 6 & 4.8 \\ \hline tet(M) & 1 & 0.8 \\ \hline cat & 3 & 2.4 \\ \hline cfr & 1 & 0.8 \\ \hline fexA & 1 & 0.8 \\ \hline qacA & 0 & 0.0 \\ \hline qacC & 0 & 0.0 \\ \hline vanA & 0 & 0.0 \\ \hline \end{tabular}} \end{table}	PMC5161505_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline two the Level 1 & Simple Interaction e.g. a yes/no answer to a question from a student or tutor \\ \hline to Level 2 & A short answer ($<$1 min) to a question from either student or tutor \\ \hline Level 3 & An extended interaction of at least 1 minute creating further discussion \\ \hline \end{tabular}} \end{table}	PMC3225808_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Inventory} & \multicolumn{3}{\|l\|}{\textbf{IPIP-NEO PI}} & \multicolumn{3}{\|l\|}{\textbf{AB5C}} & \multicolumn{3}{\|l\|}{\textbf{Marker scales}} \\ \hline \textbf{Scale} & \textbf{SfD} & \textbf{IM} & \textbf{PCA1} & \textbf{SfD} & \textbf{IM} & \textbf{PCA1} & \textbf{SfD} & \textbf{IM} & \textbf{PCA1} \\ \hline Extraversion & 0.62 & 0.46 & 0.74 & 0.59 & 0.78 & 0.84 & 0.47 & 0.68 & 0.72 \\ \hline Agreeableness & 0.75 & 0.59 & 0.82 & 0.28 & 0.39 & 0.58 & 0.31 & 0.66 & 0.61 \\ \hline Conscientiousness & 0.20 & 0.23 & 0.47 & 0.39 & 0.42 & 0.59 & 0.24 & 0.41 & 0.53 \\ \hline Emotional stability & 0.52 & 0.19 & 0.46 & 0.32 & 0.42 & 0.56 & 0.80 & 0.83 & 0.93 \\ \hline Openness & 0.26 & 0.34 & 0.46 & 0.44 & 0.39 & 0.53 & 0.60 & 0.62 & 0.78 \\ \hline \end{tabular}} \end{table}	PMC3618383_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline Age (years) & 62 $\pm$ 18 (19 to 100) \\ \hline Female/male & 83/97 \\ \hline SAPS II & 37 $\pm$ 18 (9 to 103) \\ \hline Mortality & 19\% (35 out of 180 patients) \\ \hline Cirrhosis & 6 \\ \hline Cancer & 45 \\ \hline Community-acquired/postoperative peritonitis & 112/68 \\ \hline \end{tabular}} \end{table}	PMC2717471_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Variable} & \textbf{n} & \textbf{Length of stay, r} & \textbf{P} \\ \hline Age & 102 & 0.090 & NS \\ \hline Referral lag (REFLAG) & 102 & 0.547 & 0.001 \\ \hline REFLAG/LOS & 97a & 70.087 & NS \\ \hline Log(REFLAG)/log(LOS) & 97a & 0.242 & 0.02 \\ \hline \end{tabular}} \end{table}	PMC4478928_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{n = 188} & \textbf{Strongly agree (\%)} & \textbf{Agree (\%)} & \textbf{Disagree (\%)} & \textbf{Strongly disagree (\%)} & \textbf{Mean} \\ \hline Respect & 74.5 & 22.3 & 2.7 & 0.5 & 3.71 \\ \hline Having good knowledge and skills in that field & 71.3 & 27.7 & & 0.5 & 3.71 \\ \hline Do no harm & 69.7 & 29.3 & 1.1 & & 3.69 \\ \hline Keeping the standard and quality of care & 69.1 & 26.6 & 4.3 & & 3.65 \\ \hline Upholding the right of the patient & 68.6 & 27.1 & 3.7 & & 3.65 \\ \hline Integrity & 66.5 & 30.3 & 2.3 & & 3.65 \\ \hline Commitment & 66 & 27.7 & 3.2 & 1.6 & 3.61 \\ \hline Treating the patient with equality & 64.4 & 30.9 & 2.7 & & 3.63 \\ \hline Communication & 63.3 & 29.8 & 4.3 & 1.1 & 3.58 \\ \hline Accountability & 60.1 & 32.4 & 4.3 & 1.1 & 3.55 \\ \hline Etiquette & 57.4 & 37.2 & 2.7 & 0.5 & 3.55 \\ \hline Keeping time & 54.3 & 30.3 & 10.6 & 2.1 & 3.4 \\ \hline Justice & 54.3 & 39.9 & 3.7 & & 3.52 \\ \hline Keeping time & 54.3 & 30.3 & 10.6 & 2.1 & 3.4 \\ \hline Availability & 52.1 & 38.8 & 7.4 & 1.6 & 3.4 \\ \hline Humility & 52.1 & 38.3 & 8.5 & & 3.44 \\ \hline Keeping societal values & 50.5 & 43.6 & 4.3 & & 3.47 \\ \hline Honesty & 49.5 & 42 & 5.3 & 1.1 & 3.43 \\ \hline Empathy & 41.5 & 51.6 & 5.3 & & 3.37 \\ \hline Dedication & 41 & 47.3 & 10.1 & 0.5 & 3.3 \\ \hline \end{tabular}} \end{table}	PMC4818896_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Method} & \textbf{N (Case)} & \textbf{TP} & \textbf{FP} & \textbf{TN} & \textbf{FN} & \textbf{Sen (\%)} & \textbf{Spe (\%)} & \textbf{LR+} & \textbf{LR−} & \textbf{PV+ (\%)} & \textbf{PV− (\%)} & \textbf{Consist ency (\%)} \\ \hline 2D-CEUS & 52 & 22 & 1 & 28 & 1 & 95.7 & 96.6 & 27.74 & 0.05 & 95.7 & 96.6 & 96.2 \\ \hline 2D ray-scale + CDFI & 52 & 10 & 14 & 15 & 13 & 43.5 & 51.7 & 0.90 & 1.09 & 41.6 & 53.5 & 48.1 \\ \hline \end{tabular}} \end{table}	PMC6198556_table_3
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|} \hline \textbf{Response} & \textbf{Number of patients (\%)} \\ \hline CR & 8 (16.7\%) \\ \hline PR & 26 (54.2\%) \\ \hline SD & 10 (20.8\%) \\ \hline PD & 4 (8.3\%) \\ \hline \end{tabular}} \end{table}	PMC5139704_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{Variants} & \textbf{Feed Matrix} & \textbf{Planned Moisture Content (\%)} & \textbf{Sodium Sulfite (g/kg Maize)} \\ \hline 1 & MK = Maize kernels & 14 & 0 \\ \hline 2 & MK & 14 & 1.25 \\ \hline 3 & MK & 14 & 2.5 \\ \hline 4 & MK & 14 & 5 \\ \hline 5 & MK & 14 & 10 \\ \hline 6 & MK & 30 & 0 \\ \hline 7 & MK & 30 & 1.25 \\ \hline 8 & MK & 30 & 2.5 \\ \hline 9 & MK & 30 & 5 \\ \hline 10 & MK & 30 & 10 \\ \hline 11 & MM = Maize meal & 14 & 0 \\ \hline 12 & MM & 14 & 1.25 \\ \hline 13 & MM & 14 & 2.5 \\ \hline 14 & MM & 14 & 5 \\ \hline 15 & MM & 14 & 10 \\ \hline 16 & MM & 30 & 0 \\ \hline 17 & MM & 30 & 1.25 \\ \hline 18 & MM & 30 & 2.5 \\ \hline 19 & MM & 30 & 5 \\ \hline 20 & MM & 30 & 10 \\ \hline \end{tabular}} \end{table}	PMC4379525_table_2
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|} \hline \textbf{a Antibiotic} & \textbf{DphoX: MIC $\pm$ SE (fold change)1} & \textbf{WT} & \textbf{phoXc} \\ \hline zithromycin & 0.0560.02 (1.5) & 0.03 & 0.0360.02 \\ \hline Ciprofloxacin & 0.1960.08 (3.0) & 0.06 & 0.06 \\ \hline Erythromycin & 0.2560.14 (1.4) & 0.1960.09 & 0.1260.09 \\ \hline Gentamicin & 1.5060.58 (1.5) & 1.0 & 1.0 \\ \hline has Tetracycline & 0.3160.19 (5.2) & 0.06 & 0.0660.04 \\ \hline Pi Florfenicol & 1.5060.58 (3.0) & 0.50 & 1 \\ \hline Nalidixic Acid & 16.069.2 (4.0) & 4 & 4 \\ \hline Telithromycin & 1.060.58 (2.0) & 0.50 & 0.50 \\ \hline Clindamycin & 0.3860.19 (2.0) & 0.1960.09 & 0.19 \\ \hline in Polymixin B & 6.3 (0.5) & 12.5 & 12.5 \\ \hline Cholic Acid & 10,000 (2.0) & 5,000 & 7,50063.5 \\ \hline Taurocholic Acid & 100 (1.2) & 83.3628.9 & 100 \\ \hline Deoxycholic Acid & 25,000 (1.0) & 25,000 & 25,000 \\ \hline Fowlicidin-1 & 16 (1.0) & 16 & 16 \\ \hline \end{tabular}} \end{table}	PMC3197622_table_0
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline \textbf{Patient no.} & \textbf{EDSS} & \textbf{Interval time (day)} & \textbf{Disease duration (year)} & \textbf{Pre-treatment scan} & \textbf{Post treatment scan} \\ \hline 1 & 4 & 90 & 9 & Moderate bifrontoparital & Mild bifrontoparital \\ \hline 2 & 5 & 30 & 8 & Severe Rt hemisphere & Mild Rt hemisphere \\ \hline 3 & 3 & 30 & 4 & Moderate diffuse cortical & Mild diffuse cortical \\ \hline 4 & 6 & 50 & 10 & Mild Rt hemisphere & Normal \\ \hline 5 & 2 & 240 & 7 & Moderate Rt hemisphere & Moderate Rt hemisphere \\ \hline 6 & 2 & 52 & 2 & Normal & Normal \\ \hline 7 & 3 & 60 & 6 & Moderate diffuse (L $>$ R) & Moderate diffuse (L $>$ R) \\ \hline 8 & 3 & 32 & 2 & Moderate Rt temporal & Moderate Rt temporal \\ \hline 9 & 3 & 50 & 3 & Moderate bi temporal & Mild bitemporal \\ \hline 10 & 6 & 70 & 13 & Moderate Rt posterior temporal & Normal \\ \hline 11 & 6 & 65 & 11 & Moderate bi temporoparital and caudate nucleus & Normal \\ \hline 12 & 8 & 26 & 7 & Moderate Rt occipital & Moderate Rt occipital \\ \hline 13 & 3 & 60 & 7 & Moderate Rt occipital & Moderate Rt occipital \\ \hline 14 & 8 & 60 & 1 & Moderate Lt occipital and putamen & Mild Lt occipital and putamen \\ \hline 15 & 4 & 40 & 5 & Moderate bifrontoparital and diffuse subcortical & Normal \\ \hline 16 & 2 & 60 & 5 & Moderate Lt occipital & Normal \\ \hline \end{tabular}} \end{table}	PMC4880822_table_1
	\begin{table} \scalebox{0.60}{ \begin{tabular}{\|l\|l\|l\|l\|l\|l\|} \hline & \textbf{Hospital} & \textbf{Community} & \textbf{LTC} & \textbf{Other} & \textbf{Total} \\ \hline Start (1999) & 2267 & 764 & 129 & 1843 & 5003 \\ \hline End (2007) & 2531 & 845 & 227 & 2461 & 6064 \\ \hline Change in Number & 264 & 81 & 98 & 618 & 1061 \\ \hline \multicolumn{6}{\|l\|}{(Start-End)} \\ \hline Percent Change & 11.6 & 10.6 & 76.0 & 33.5 & 21.2 \\ \hline \multicolumn{6}{\|l\|}{(Start-End)} \\ \hline Employment Sector Status & Expansion & Expansion & Expansion & Expansion & Expansion \\ \hline (Expansion vs. Contraction) \\ \hline \end{tabular}} \end{table}	PMC3507859_table_1

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.