id
int64 7
5.24k
| url
stringlengths 48
63
| content
stringlengths 567
149k
|
|---|---|---|
1,192 | https://bio-protocol.org/exchange/protocoldetail?id=1192&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Tomato Fruit Chromoplasts and Determination of ATP Levels
FH Francesc Hernández-Gras
RP Rocco Petrizzo
IP Irini Pateraki
MR Marta Renato
MA Maxime Angaman
Joaquín Azcón-Bieto
Albert Boronat
Published: Vol 4, Iss 15, Aug 5, 2014
DOI: 10.21769/BioProtoc.1192 Views: 10307
Edited by: Tie Liu
Reviewed by: Beery Yaakov
Original Research Article:
The authors used this protocol in Apr 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2013
Abstract
It has recently been reported that tomato fruit chromoplasts can synthesize ATP de novo using an ATP synthase complex harboring an atypical γ-subunit which is also present in a variety of plant species. However many aspects related with the biochemical processes underlying this process remain largely unknown. Here we describe detailed protocols for the isolation of tomato fruit chromoplasts and the determination of ATP levels (end-point measurements) and ATP synthesis rates (kinetic measurements) in these organelles using bioluminescent luciferin/luciferase based assays.
Keywords: Chromoplast Tomato Fruit ATP levels
Materials and Reagents
Red tomato fruits (MicroTom or Ailsa Craig, harvested 5-7 and 7-9 days after breaker stage, respectively)
Ultrapure water
NaCl (Sigma-Aldrich, catalog number: S7653 )
Trizma® base (Tris) (Sigma-Aldrich, catalog number: T6066 )
HCl (Merck KGaA, catalog number: 100317 )
Sorbitol (Sigma-Aldrich, catalog number: S1878 )
MgCl2 (Sigma-Aldrich, catalog number: M2670 )
KCl (Sigma-Aldrich, catalog number: P9541 )
L-Ascorbic acid (Sigma-Aldrich, catalog number: 255564 )
L-Cysteine (Sigma-Aldrich, catalog number: C7352 )
DL-Dithiothreitol (DTT) (Sigma-Aldrich, catalog number: 43819 )
Sucrose (Sigma-Aldrich, catalog number: S8501 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A7906 )
MnCl2 (Sigma-Aldrich, catalog number: M3634 )
KH2PO4 (Merck KGaA, catalog number: 104873 )
β-Nicotinamide adenine dinucleotide 2’-phosphate reduced tetrasodium salt hydrate (NADPH) (Sigma-Aldrich, catalog number: N7505 )
β-Nicotinamide adenine dinucleotide phosphate hydrate (NADP+) (Sigma-Aldrich, catalog number: N5755 )
β-Nicotinamide adenine dinucleotide reduced disodium salt hydrate (NADH) (Sigma-Aldrich, catalog number: N8129 )
β-Nicotinamide adenine dinucleotide hydrate (NAD+) (Sigma-Aldrich, catalog number: N1636 )
Flavin adenine dinucleotide disodium salt hydrate (FAD) (Sigma-Aldrich, catalog number: F6625 )
Sodium pyruvate (Sigma-Aldrich, catalog number: P2256 )
ATP Bioluminescence Assay Kit HS II (Roche Diagnostics, catalog number: 11699709001 )
ENLITEN® rLuciferase/Luciferin Reagent (Promega Corporation, catalog number: FF2021 )
RC DC Protein Assay kit (Bio-Rad Laboratories, catalog number: 500-0122 )
Adenosine 5’-diphosphate sodium salt (ADP) (Sigma-Aldrich, catalog number: A2754 )
Adenosine 5’-triphosphate disodium salt hydrate (ATP) (Sigma-Aldrich, catalog number: A2383 )
P1, P5-di(adenosine-5’) pentaphosphate pentasodium salt (DAPP) (Sigma-Aldrich, catalog number: D4022 )
2-[(2-Hydroxy-1,1-bis(hydroxymethyl)ethyl)amino]ethanesulfonic acid, N-[Tris(hydroxymethyl)methyl]-2-aminoethanesulfonic acid (TES) (Sigma-Aldrich, catalog number: T1375 )
4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid, N-(2-Hydroxyethyl)piperazine-N-(2-ethanesulfonic acid) (HEPES) (Sigma-Aldrich, catalog number: H4034 )
Ethylenediaminetetraacetic acid (EDTA) (Sigma-Aldrich, catalog number: E9884 )
Tween 20 (Sigma-Aldrich, catalog number: P1379 )
Miracloth (pore size of 22-25 µm) (Calbiochem®, catalog number: 475855 )
1 mM DAPP (stored at -20 °C)
10 mM FAD (stored at -80 °C)
100 mM NADH (stored at -80 °C)
100 mM NAD+ (stored at -80 °C)
100 mM NADPH (stored at -80 °C)
100 mM NADP+ (stored at -80 °C)
10 µM ATP standard solutions (stored at -80 °C)
0.1 µM ATP standard solutions (stored at -80 °C)
0.001 µM ATP standard solutions (stored at -80 °C)
1 M DTT (stored at -20 °C)
0.5 mM ADP
Washing solution (see Recipes)
0.5 M Tris-HCl buffer (see Recipes)
15% sucrose solution (see Recipes)
30% sucrose solution (see Recipes)
40% sucrose solution (see Recipes)
50% sucrose (see Recipes)
Buffer A (see Recipes)
Buffer B (see Recipes)
Buffer C (see Recipes)
Buffer D (see Recipes)
Buffer E (see Recipes)
Equipment
Glomax® 96 Microplate Luminometer w/Dual Injectors (Promega Corporation, catalog number: E6521 )
Centrifuge Avanti J-E (Beckman Coulter)
Ultracentrifuge Optima L-100xPI (Beckman Coulter)
SW 28 swinging-bucket rotor (Beckman Coulter) or equivalent
JA-14 rotor (Beckman Coulter) or equivalent
JA-20 rotor (Beckman Coulter) or equivalent
Polypropylene centrifuge tubes (250 ml) (Beckman Coulter)
Polypropylene centrifuge tubes (30 ml) (Beckman Coulter)
Polyallomer centrifuge tubes for SW 28 rotor (Beckman Coulter)
Waring blender 8011S (Dynamics Corporation of America)
Support stand, clamp holder and extension clamp
Glass beakers of different volume capacity
96-well microplates white (Porvair Sciences, catalog number: 204003 )
Bench orbital shaker
Micropipettes
Heat block
Benchtop microcentrifuge
Gauze (1 m x 1 m)
Software
Microsoft Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant cell biology > Organelle isolation
Plant Science > Plant biochemistry > Protein
Cell Biology > Organelle isolation > Fractionation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,193 | https://bio-protocol.org/exchange/protocoldetail?id=1193&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Purification of Herpesvirus Virions and Capsids
XD Xinghong Dai
Z. Hong Zhou
Published: Vol 4, Iss 15, Aug 5, 2014
DOI: 10.21769/BioProtoc.1193 Views: 16969
Edited by: Fanglian He
Reviewed by: Kathrin Sutter
Original Research Article:
The authors used this protocol in Aug 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2013
Abstract
This protocol was designed for large-scale purification of herpesvirus particles by cell culture. Virions and capsids are isolated from extracellular culture media and cell nuclei, respectively. Purity and concentration of the purified samples are usually sufficient for structural studies with cryo electron microscopy and cryo electron tomography. The protocol should also be generally suitable for purifying herpesvirus virions and capsids for other types of studies.
Keywords: Virus purification Herpesvirus Density gradient centrifuge
Materials and Reagents
Herpesvirus infected cells (e.g., Vero cells for herpes simplex virus culture, MRC5 cells for human cytomegalovirus culture)
PBS (pH 7.4)
Sucrose
NP-40
Dry ice
Dulbecco’s modified eagle medium (DMEM)
Fetal bovine serum (FBS)
Herpesvirus culture media (see Recipes)
Equipment
Laminar flow hood
Centrifuge with cool function
Ultracentrifuge
Ultra-Clear 38.5 ml tubes (fit in SW28 rotor) (Beckman Coulter, catalog number: 344058 )
Ultra-Clear 13.2 ml tubes (fit in SW41 rotor) (Beckman Coulter, catalog number: 344059 )
KimwipesTM tissue paper
Tweezers
Gradient master (Biocomp Instruments, catalog number: 107-201M )
Flashlight
Vortex
37 °C water bath
Syringe with 23 gauge hypodermic needle
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Dai, X. and Zhou, Z. H. (2014). Purification of Herpesvirus Virions and Capsids. Bio-protocol 4(15): e1193. DOI: 10.21769/BioProtoc.1193.
Dai, X., Yu, X., Gong, H., Jiang, X., Abenes, G., Liu, H., Shivakoti, S., Britt, W. J., Zhu, H., Liu, F. and Zhou, Z. H. (2013). The smallest capsid protein mediates binding of the essential tegument protein pp150 to stabilize DNA-containing capsids in human cytomegalovirus. PLoS Pathog 9(8): e1003525.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell isolation and culture
Microbiology > Microbe-host interactions > Virus
Cell Biology > Cell isolation and culture > Cell growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,194 | https://bio-protocol.org/exchange/protocoldetail?id=1194&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Generation and Maturation of Human Monocyte-derived DCs
MS Michela Spadaro
MM Monica Montone
FC Federica Cavallo
Published: Vol 4, Iss 15, Aug 5, 2014
DOI: 10.21769/BioProtoc.1194 Views: 23439
Reviewed by: Ivan ZanoniLee-Hwa Tai
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
Dendritic cells (DC) are antigen-presenting cells, which play a critical role in the regulation of the adaptive immune response. They act as a bridge between the innate and the adaptive immune systems. An approach to study their function and potentiality is to generate DC-like cells by culturing CD14+ monocyte-enriched peripheral blood mononuclear cells (PBMC). In the presence of GM-CSF and IL-4, these cultures give rise to large numbers of DC-like cells. Generating human-DC from PBMC is a useful tool to study biological functions of human DC.
Keywords: Monocyte-derived dendritic cells Peripheral blood mononuclear cells CD14+ GM-CSF IL-4
Materials and Reagents
Blood sample to obtain CD14+ cells
Histopaque -1077 (Sigma-Aldrich, catalog number: 10771 )
DPBS (Sigma-Aldrich, catalog number: D8537 )
autoMACS Rinsing Buffer (Miltenyi Biotec, catalog number: 130-091-222 )
Albumin from bovine serum (Sigma-Aldrich, catalog number: A1933 )
FITC-anti-CD14 antibody (BioLegend, catalog number: 301804 )
Recombinant human GM-CSF (Pepro Tech, catalog number: 300-03 )
Recombinant human IL-4 (Pepro Tech, catalog number: 200-04 )
RPMI-1640 medium (Life Technologies, InvitrogenTM, catalog number: 21875034 )
2-mercaptoethanol (Life Technologies, Gibco®, catalog number: 21985-023 )
Antibiotics: penicillin-streptomycin (Life Technologies, Gibco®, catalog number: 15070 )
Heat inactivated (at 56 °C for 30 min) qualified fetal bovine serum (Life Technologies, InvitrogenTM, catalog number: 26140-087 )
PE-anti-CD1a antibody (BioLegend, catalog number: 300106 )
Recombinant human IL1β (Thermo Fisher Scientific, catalog number: RIL1BI )
Recombinant human TNFα (Thermo Fisher Scientific, catalog number: RTNFAI )
Rabbit Immunoglobulin G (IgG) (Sigma-Aldrich, catalog number: I5006 )
FITC-anti-CD83 antibody (BioLegend, catalog number: 305306 )
PE-anti-CD80 antibody (BioLegend, catalog number: 305208 )
APC-anti-CD40 antibody (BD, catalog number: 555591 )
Isotype-matched mAbs (BioLegend, catalog number: 400113 )
Erylyse buffer (see Recipes)
Complete medium (see Recipes)
AutoMACS running buffer (see Recipes)
FACS wash buffer (see Recipes)
Propidium iodide (Sigma-Aldrich, catalog number: P4170) (see Recipes)
Equipment
Sterilized sierological pipettes (2, 5, 10, 25 ml) (Corning, Costar®, catalog numbers: 4486 , 4487 , 4487 , 4488 , 4489 )
50 ml conical tubes (BD, Falcon®, catalog number: 352070 )
Human CD14+ magnetic microbeads (Miltenyi Biotec, catalog number: 130-050-201 )
Filtration unit with pore size of 0.22 µm and polyethersulfone (PES) membrane (Thermo Fisher Scientific, catalog number: 431096 )
6-well tissue culture plate (BD, Falcon®, catalog number: 353046 )
FACS tube (Beckman Coulter, catalog number: 2523749 )
Refrigerated centrifuge with swing out rotor
AutoMACS separator (Miltenyi Biotec)
CyAn ADP flow cytometer (Beckman Coulter)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Spadaro, M., Montone, M. and Cavallo, F. (2014). Generation and Maturation of Human Monocyte-derived DCs. Bio-protocol 4(15): e1194. DOI: 10.21769/BioProtoc.1194.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Dendritic cell
Immunology > Immune cell isolation > Maintenance and differentiation
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,195 | https://bio-protocol.org/exchange/protocoldetail?id=1195&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Infectious Virus Yield Assay for Hepatitis E Virus
Yannick Debing
Kai Dallmeier
Johan Neyts
Published: Vol 4, Iss 15, Aug 5, 2014
DOI: 10.21769/BioProtoc.1195 Views: 10070
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
Hepatitis E virus (HEV) is one of the main causes of acute hepatitis worldwide. Infections are particularly severe in pregnant women and chronic hepatitis E is known to occur in immunocompromised patients. Current therapy (ribavirin or pegylated alpha interferon) has severe side effects and cannot be employed in all patients. In order to evaluate potential new inhibitors of HEV replication, a virus yield assay can be employed in which the amount of viral RNA progeny released into the culture medium is quantified by reverse-transcription quantitative PCR (RT-qPCR) (Debing et al., 2014).
Keywords: Hepatitis E virus Antiviral assay RT-qPCR Inhibitor Cell culture
Materials and Reagents
HepG2/C3A human hepatoma cell line (ATCC, catalog number: CRL-10741 )
Huh7 human hepatoma cell line (Japanese Collection of Research Bioresources, catalog number: JCRB0403 )
HEV Kernow-C1 p6 plasmid (genotype 3 full-length genome; a kind gift from Suzanne Emerson, NIH) (Shukla et al., 2012)
MluI restriction endonuclease with accompanying 10x buffer D (Promega Corporation, catalog number: R6381 )
QIAquick gel extraction kit (QIAGEN, catalog number: 28704 )
T7 RiboMAX large scale RNA production system (Promega Corporation, catalog number: P1300 )
RNeasy mini kit (QIAGEN, catalog number: 74104 )
ScriptCap m7G capping system (CELLSCRIPTTM, catalog number: C-SCCE0610 )
Anti-fungal agent (2.5 µg/ml, Fungizone) (Life Technologies, catalog number: 15290-018 )
Dulbecco’s modified Eagle’s medium with high glucose (DMEM) (Life Technologies, catalog number: 41965-039 )
Fetal bovine serum (FBS) (not heat-inactivated) (Life Technologies, catalog number: 10270-106 )
Opti-MEM I reduced serum medium (Life Technologies, catalog number: 31985-062 )
Lipofectin transfection reagent (Life Technologies, catalog number: 18292-011 )
Dulbecco’s phosphate-buffered saline (PBS) without Ca2+ and Mg2+ (Life Technologies, catalog number: 14190-094 )
Penicillin/Streptomycin (PS) (10,000 IU/ml) (Life Technologies, catalog number: 15140-148 )
CellTiter 96 AQueous MTS reagent powder [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium] (Promega corporation, catalog number: G1111 )
Phenazine methosulphate (PMS) (Sigma-Aldrich, catalog number: P9625 )
Minimum essential medium (MEM) (no glutamine, no phenol red) (Life Technologies, catalog number: 51200-046 )
NucleoSpin RNA virus kit (MACHEREY-NAGEL, catalog number: 740956 )
One step qRT-PCR MasterMix Low Rox for probe assays (Kaneka Corporation, Eurogentec, catalog number: RT-QPRT-032XLR )
Forward primer (5’-GGTGGTTTCTGGGGTGAC-3’) and reverse primer (5’- AGGGGTTGGTTGGATGAA-3’) (custom order) (Integrated DNA Technologies) (dissolved to a final concentration of 10 µM in buffer TE)
Fluorescent probe (5’-FAM-TGATTCTCAGCCCTTCGC-MGBNFQ-3’ with FAM, 6-carboxyfluorescein; MGBNFQ, minor groove binder non-fluorescent quencher) (Life Technologies, custom order) (dissolved to a final concentration of 10 µM in buffer TE)
qPCR DNA standard
The cloned cDNA target sequence is ligated into a plasmid (e.g. with the CloneJet PCR cloning kit, Thermo Fisher Scientific, catalog number: K1231 ) and miniprepped.
Note: The concentration is determined by spectrophotometry and a logarithmic dilution series is made in buffer TE over 6 orders of magnitude. Alternatively, the original Kernow-C1 p6 plasmid can be used to make such a dilution series.
Tris (hydroxymethyl) aminomethane powder (Trizma base) (Sigma-Aldrich, catalog number: T1503 ) (dissolved to 1 M and pH 8.0 in H2O)
Ethylenediaminetetraacetic acid disodium salt solution (EDTA, 0.5 M) (Sigma-Aldrich, catalog number: E7889 )
MTS/PMS solution (see Recipes)
Buffer TE (see Recipes)
Equipment
Spectrophotometer to determine RNA concentrations (e.g. Thermo Fischer Scientific, NanoDrop, model: ND-1000 )
Falcon transparent 6-well plate (Corning Incorporated, catalog number: 353046 )
Falcon transparent 96-well plate (Corning Incorporated, catalog number: 353072 )
37 °C and 35 °C 5% CO2 cell culture incubators
Centrifuge with temperature control
Saphire² microplate reader for absorbance (Tecan Trading AG)
PCR plate 96-well (SARSTEDT AG, catalog number: 72.1981.202 )
MicroAmp optical adhesive film (Life Technologies, catalog number: 4311971 )
ABI 7500 fast real-time PCR system (Life Technologies, catalog number: 4351107 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbe-host interactions > Virus
Microbiology > Microbial genetics > RNA
Molecular Biology > RNA > RNA detection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,196 | https://bio-protocol.org/exchange/protocoldetail?id=1196&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Luminescence-based Antiviral Assay for Hepatitis E Virus
Yannick Debing
Kai Dallmeier
Johan Neyts
Published: Vol 4, Iss 15, Aug 5, 2014
DOI: 10.21769/BioProtoc.1196 Views: 9373
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
Hepatitis E virus (HEV) is one of the main causes of acute hepatitis worldwide. Infections are particularly severe in pregnant women and chronic hepatitis E is known to occur in immunocompromised patients. Current therapy (ribavirin or pegylated alpha interferon) has severe side effects and cannot be employed in all patients. In order to evaluate potential new inhibitors of HEV replication, a luminescence-based replicon assay is particularly useful since it offers a rapid read-out and does not pose any biosafety risks (Debing et al., 2014).
Keywords: Hepatitis E virus Antiviral assay Subgenomic replicon Inhibitor
Materials and Reagents
HEV Kernow-C1 p6/luc plasmid (genotype 3 subgenomic replicon expressing Gaussia luciferase; a kind gift from Suzanne Emerson, NIH) (Shukla et al., 2012)
MluI restriction endonuclease with accompanying 10x buffer D (Promega Corporation, catalog number: R6381 )
pT7-IRES-FFLuc-YFsfRNA plasmid (constructed in-house; IRES, internal ribosome entry site; FFLuc, firefly luciferase; YFsfRNA, yellow fever virus small flaviviral RNA) (Debing et al., 2014)
Primers #1 (5’-CATATGTCGACTAATACGACTCACTATAGGGATCCGCCCCTCTCCC-3’) and #2 (5’-AGTGGTTTTGTGTTTGTCATCC-3’) (custom order) (Integrated DNA Technologies) (dissolved to a final concentration of 10 µM in buffer TE)
Kapa HiFi HotStart ReadyMix master mix (Kapa Biosystems, catalog number: KK2601 )
SeaKem LE agarose for gel electrophoresis (Lonza, catalog number: 50001 )
QIAquick gel extraction kit (QIAGEN, catalog number: 28704 )
T7 RiboMAX large scale RNA production system (Promega Corporation, catalog number: P1300 )
RNeasy mini kit (QIAGEN, catalog number: 74104 )
ScriptCap m7G capping system (CELLSCRIPTTM, catalog number: C-SCCE0610 )
Huh7 human hepatoma cell line (Japanese Collection of Research Bioresources, catalog number: JCRB0403)
Dulbecco’s modified Eagle’s medium with high glucose (DMEM) (Life Technologies, catalog number: 41965-039 )
Fetal bovine serum (FBS) (not heat-inactivated) (Life Technologies, catalog number: 10270-106 )
Opti-MEM I reduced serum medium (Life Technologies, catalog number: 31985-062 )
Lipofectin transfection reagent (Life Technologies, catalog number: 18292-011 )
Dulbecco’s phosphate-buffered saline (PBS) without Ca2+ and Mg2+ (Life Technologies, catalog number: 14190-094 )
Renilla luciferase assay system (Promega Corporation, catalog number: E2810 )
5x passive lysis buffer (Promega Corporation, catalog number: E1941 ) and demineralized H2O for dilution
Luciferase assay system (Promega Corporation, catalog number: E1501 )
CellTiter 96 AQueous MTS reagent powder [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium] (Promega Corporation, catalog number: G1111 )
Phenazine methosulphate (PMS) (Sigma-Aldrich, catalog number: P9625 )
Minimum essential medium (MEM) (no glutamine, no phenol red) (Life Technologies, catalog number: 51200-046 )
Tris(hydroxymethyl)aminomethane powder (Trizma base) (Sigma-Aldrich, catalog number: T1503 ) (dissolved to 1 M and pH 8.0 in H2O)
Ethylenediaminetetraacetic acid disodium salt solution (EDTA, 0.5 M) (Sigma-Aldrich, catalog number: E7889 )
MTS/PMS solution (see Recipes)
Buffer TE (see Recipes)
Equipment
Spectrophotometer to determine RNA concentrations (e.g. Thermo Fischer Scientific, NanoDrop, model: ND-1000 )
Falcon transparent 96-well plate (Corning Incorporated, catalog number: 353072 )
CulturPlate white 96-well plate (PerkinElmer, catalog number: 6005680 )
37 °C and 35 °C 5% CO2 cell culture incubators
Plate shaker
Saphire² microplate reader for both luminescence and absorbance (Tecan Trading AG)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Debing, Y., Dallmeier, K. and Neyts, J. (2014). Luminescence-based Antiviral Assay for Hepatitis E Virus. Bio-protocol 4(15): e1196. DOI: 10.21769/BioProtoc.1196.
Download Citation in RIS Format
Category
Microbiology > Antimicrobial assay > Replicon assay
Microbiology > Microbe-host interactions > Virus
Immunology > Host defense > Human
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,197 | https://bio-protocol.org/exchange/protocoldetail?id=1197&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantification of Flavin Production by Bacteria
SY Svetlana N. Yurgel
JL Joseph Lynch
JR Jennifer Rice
NA Neil Adhikari
SR Sanja Roje
Published: Vol 4, Iss 15, Aug 5, 2014
DOI: 10.21769/BioProtoc.1197 Views: 9838
Edited by: Zhaohui Liu
Reviewed by: Tie LiuFeng Li
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
This protocol provides a simple and fast method of quantification for intracellular flavin content, and for flavin secretion by bacteria. Intracellular flavins are extracted from bacterial pellets, and secreted flavins are examined in the cell growth medium. Flavins are separated and measured using HPLC with fluorescence detection, and quantified based on a comparison to standards.
Keywords: Riboflavin Biosynthetic Pathway FMN FAD Alpha-proteobacteria HPLC
Materials and Reagents
Sinorhizobium meliloti (S. meliloti 1021, Galibert et al., 2001)
Note: The protocol can be also applied to other bacteria.
Bio-Rad Protein Assay Kit I (Sigma-Aldrich, catalog number: 500-0001 )
Flavin standards:
Riboflavin (Sigma-Aldrich, catalog number: 95170 )
FMN (Sigma-Aldrich, catalog number: F2253 )
FAD (Sigma-Aldrich, catalog number: F6625 )
Lumichrome (Acros, catalog number: 146930010 )
Note: FMN and FAD were further purified as described previously (Sandov et al., 2008).
Ammonium formate
Formic acid
Methanol
YMB medium (Somerville and Kahn, 1983) (see Recipes) (1 plate per sample)
MMNH4 medium (Somerville and Kahn, 1983) (see Recipes) (6 ml per sample)
Extraction buffer (see Recipes)
HPLC mobile phase (see Recipes)
Note: Except as otherwise noted, all other chemicals were obtained from Sigma-Aldrich.
Equipment
Aluminum foil
Eppendorf 1.7 ml tubes (Thermo Fisher Scientific, catalog number: 14-222-168 )
14 ml Falcon tubes (BD Biosciences, catalog number: 352059 )
0.22 µm syringe filter for HPLC sample preparation (Microsolv Technology, catalog number: 58022-N04-C )
Scale (Ohaus Corporation, model: E10640 )
Mini-centrifuge
Shaker
HPLC: Waters Alliance 2695 HPLC system linked to a 2475 fluorescence detector
SunFire C18 reverse-phase column (4.6 x 150 mm, 3.5 µm)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Yurgel, S. N., Lynch, J., Rice, J., Adhikari, N. and Roje, S. (2014). Quantification of Flavin Production by Bacteria. Bio-protocol 4(15): e1197. DOI: 10.21769/BioProtoc.1197.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > In vitro model
Microbiology > Microbial biochemistry > Other compound
Plant Science > Plant physiology > Endosymbiosis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,198 | https://bio-protocol.org/exchange/protocoldetail?id=1198&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assay for GTP Cyclohydrolase II Activity in Bacterial Extracts
SY Svetlana N. Yurgel
NS Na Sa
JR Jennifer Rice
SR Sanja Roje
Published: Vol 4, Iss 15, Aug 5, 2014
DOI: 10.21769/BioProtoc.1198 Views: 6905
Edited by: Zhaohui Liu
Reviewed by: Tie LiuFeng Li
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
Riboflavin is the precursor of flavin nucleotides FMN and FAD, they play significant roles in all organisms. GTP is the initial precursor on riboflavin biosynthesis pathway and GTP cyclohydrolase II catalyzes the first step of this pathway. It converts GTP to 2,5-diamino-6-ribosylamino-4 (3H) -pyrimidinone 5'-phosphate. This protocol provides a reliable and fast method to assay GTP cyclohydrolase II activity from crude bacterial extracts. The product of the reaction catalyzed by GTP cyclohydrolase II, 2,5-diamino-6-ribosylamino-4 (3H) -pyrimidinone 5'-phosphate, is converted to its fluorescent derivative 6,7-dimethylpterin, which is then separated on a XTerra MS C18 column and detected using fluorescence HPLC system.
Materials and Reagents
Sinorhizobium meliloti (S. meliloti 1021, Galibert et al., 2001)
Note: The protocol can be also applied to other bacteria.
Bio-Rad Protein Assay Kit I (Sigma-Aldrich, catalog number: 500-0001 )
50 mM Tris-HCl buffer (pH 7.5) (5 ml per sample)
1x BugBuster reagent (Novagen, catalog number: 70921 )
0.5 M EDTA (pH 8.0) (2.5 µl per sample)
GTP (Guanosine 5’-triphosphate sodium salt hydrate) (Sigma-Aldrich, catalog number: G8877 )
HPLC Standard: 6,7-Dimethylpterin (Schircks Laboratories, catalog number: 11.503 )
Biotin
YMB medium (Somerville and Kahn, 1983) (see Recipes) (1 plate per sample)
MMNH4 medium (Somerville and Kahn, 1983) (see Recipes) (13 ml per sample)
Lysis buffer (see Recipes) (1 ml per sample)
Desalting buffer (see Recipes) (3 ml per sample)
RibA assay buffer (see Recipes) (2.5 µl per sample)
Derivatization reagent (see Recipes) (50 µl per sample)
HPLC mobile phase (see Recipes)
Note: Except as otherwise noted, all other chemicals were obtained from Sigma-Aldrich.
Equipment
14 ml Falcon tubes (BD Biosciences, catalog number: 352059 )
Eppendorf 1.7 ml tubes (Thermo Fisher Scientific, catalog number: 14-222-168 )
0.22 µm syringe filter (Microsolv Technology, catalog number: 58022-N04-C )
2 ml Zeba Spin Desalting Columns (Thermo Fisher Scientific, catalog number: 87768 )
Mini-centrifuge
Centrifuge
Shaker
HPLC: Waters Alliance 2695 HPLC system linked to a 2475 fluorescence detector
XTerra MS C18 column (4.6 x 100 mm, 5 µm) (Waters, part number: 186000486 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Yurgel, S. N., Sa, N., Rice, J. and Roje, S. (2014). Assay for GTP Cyclohydrolase II Activity in Bacterial Extracts. Bio-protocol 4(15): e1198. DOI: 10.21769/BioProtoc.1198.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > In vivo model
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,199 | https://bio-protocol.org/exchange/protocoldetail?id=1199&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Fluorometric Estimation of Viral Thermal Stability
Vamseedhar Rayaprolu
SK Shannon Kruse
RK Ravi Kant
NM Navid Movahed
DB Dewey Brooke
BB Brian Bothner
Published: Vol 4, Iss 15, Aug 5, 2014
DOI: 10.21769/BioProtoc.1199 Views: 12069
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Dec 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2013
Abstract
Differential Scanning Fluorimetry (DSF) is a rapid, economical, and a straightforward technique for estimating the thermal stability of proteins. The principle involves the binding of a fluorescent dye to thermally exposed hydrophobic pockets of a protein. The dyes used in this technique are highly fluorescent in a non-polar environment and are quenched when exposed to aqueous solution. The change in fluorescence can be used to follow unfolding of proteins induced by temperature, pH, or chaotropic agents. The method is well characterized for monomeric proteins. Here, we extend the application to supramolecular protein and nucleo-protein complexes using virus particles as an example. SYPRO-orange™ dye is the dye of choice because it is matched for use with q-PCR instruments and the fluorescence response is stable across a wide range of pH and temperatures. Advantages of this technique over standard biophysical methods include the ability for high-throughput screening of biological and technical replicates and the high sensitivity.
Keywords: Biophysics Virology Fluorescence Hydrophobic patches Subunit interactions
Materials and Reagents
Purified Virus Like Particles (VLPs) of Adeno-associated virus serotypes 1, 2, 5, 8
Purified recombinant AAV (rAAV) capsids packaging a green fluorescent protein gene (GFP), rAAV1-GFP, rAAV5-GFP, rAAV8-GFP
PBS (pH 7.0) at 25 °C
Citric acid (Thermo Fisher Scientific, catalog number: BP339-500 )
Disodium phosphate (VWR International, catalog number: BDH4538-1KGP )
5,000x SYPRO Orange (Life Technologies, catalog number: S6651 )
Sodium hydroxide (Thermo Fisher Scientific, catalog number: BP359-500 )
12 N hydrochloric acid (EMD Millipore, catalog number: HX0603-3 )
Sodium chloride (VWR International, catalog number: BDH4534-5KGP )
Magnesium chloride (Thermo Fisher Scientific, catalog number : BP214-500 )
Molecular biology grade water
Citrate-Phosphate buffer (see Recipes)
Equipment
Rotor Gene-3000, qPCR instrument with 36-well rotor (QIAGEN)
0.2 ml PCR tubes (BioExpress, catalog number: T-3013-1FC )
Aluminum foil
Pipette tips (10 µl, 200 µl) (VWR International, catalog numbers: 37001-162 and 53508-810 )
Pipetts (200 µl, 0.1-2.5 µl) (Eppendorf, BioExpress, catalog numbers: P-3015-6 and P-3015-1 )
pH meter (Accument Basic AB 15 pH meter) (Thermo Fisher Scientific)
Milli-Q purification system (EMD Millipore)
Software
Rotor gene software (Version 1.7, Build 94)
Microsoft Excel 2007 on Windows 7
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Rayaprolu, V., Kruse, S., Kant, R., Movahed, N., Brooke, D. and Bothner, B. (2014). Fluorometric Estimation of Viral Thermal Stability. Bio-protocol 4(15): e1199. DOI: 10.21769/BioProtoc.1199.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Modification
Biochemistry > Protein > Structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
12 | https://bio-protocol.org/exchange/protocoldetail?id=12&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Large Scale Native Affinity Purifications of Solubilized Membrane Proteins from Yeast
Bio-protocol Editor
Published: Jan 5, 2011
DOI: 10.21769/BioProtoc.12 Views: 18020
Download PDF
Ask a question
Favorite
Cited by
Abstract
This protocol can be used to purify membrane proteins from yeast samples under native conditions at a large scale. This protocol has been developed primarily for FLAG-tagged proteins. This protocol can however be slightly modified and applied to other tags, such as GST or HA.
Materials and Reagents
EDTA free protease inhibitors (Roche Diagnostics)
Digitonin (EMD Chemicals)
Protease Inhibitors (DMSO, leupeptin, pepstatin) (Sigma-Aldrich)
ANTI-Flag M2 affinity gel (Sigma-Aldrich)
3x FLAG peptide (Sigma-Aldrich)
NaF# (Ser/Thr phosphatase inhibitor)
Na3VO4 (Tyr phosphatase inhibitor)
HEPES
KOAc
Mg(OAc)2
CaCl2
Sorbitol
Glycerol
KOH
PMSF
DMSO
Lysis buffer (see Recipes)
Immunoprecipitation buffer (see Recipes)
50 ml lysis buffer (see Recipes)
14 ml IP buffer with 2% digitonin (see Recipes)
20 ml IP buffer with 0.1% digitonin (see Recipes)
40 ml IP buffer with 0.1% digitonin (see Recipes)
3x FLAG elution buffer (see Recipes)
Equipment
Avestin Emulsiflex C3 homogenizer (Avestin®)
Beckman centrifuge and Type 70 Ti rotor (Beckman Coulter)
Beckman polycarbonate centrifuge tubes (Beckman Coulter, catalog number: 355631 )
1 L centrifuge bottles
50 ml conical tubes
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Protein > Isolation and purification
Microbiology > Microbial biochemistry > Protein
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
120 | https://bio-protocol.org/exchange/protocoldetail?id=120&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
INF-gamma Release ELISpot Assay
HZ Huagang Zhang
Published: Vol 2, Iss 6, Mar 20, 2012
DOI: 10.21769/BioProtoc.120 Views: 21397
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
IFN-γ (Interferon-gamma) is produced mainly by activated T cells and NK cells. Production of IFN-γ (Interferon-gamma) by helper T cells as well as cytotoxic T cells is a hallmark of the TH1-type phenotype, thus, high-level production of IFN-γ (Interferon-gamma) is typically associated with effective host defense against intracellular pathogens. The Enzyme-Linked ImmunoSpot (ELISpot) assay is commonly used to assess the function of antigen specific T cells by detecting IFN-γ release. The ELISpot assay is a very sensitive immunoassay, allowing the detection of a secreted cytokine at the single cell level. With detection levels that can be as low as one cell in 100,000, the ELISpot is one of the most sensitive cellular assays available. Depending on the substance analyzed, the ELISpot assay is between 20 and 200 times more sensitive than a conventional ELISA.
Materials and Reagents
Mouse IFN-γ ELISpot kit (ALP) (Mabtech, catalog number: 3321-2A )
Human IFN-γ ELISpot kit (ALP) (Mabtech, catalog number: 3420-2A )
Note: The above ELISpot kits have been tested by the author and may be substituted with the kits desired by users.
SIGMAFAST™ BCIP®/NBT (Sigma-Aldrich, catalog number: B5655 )
Phosphate buffered saline (PBS)
Phorbol 12-myristate 13-acetate (PMA) (Sigma-Aldrich, catalog number: 79346 )
Ionomycin (Sigma-Aldrich, catalog number: I9657 )
Wash buffer (Santa Cruz Biotechnology, catalog number: sc-29113 ) (see Recipes)
Equipment
AID EliSpot Reader classic (Autoimmun Diagnostika GmbH)
ELISpot plate
37 °C humidified incubator
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zhang, H. (2012). INF-gamma Release ELISpot Assay. Bio-protocol 2(6): e120. DOI: 10.21769/BioProtoc.120.
Download Citation in RIS Format
Category
Immunology > Antibody analysis > Antibody detection
Biochemistry > Protein > Immunodetection
Immunology > Immune cell function > Lymphocyte
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,200 | https://bio-protocol.org/exchange/protocoldetail?id=1200&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantifying Fruit Dehiscence Using the Random Impact Test (RIT)
Teresa Lenser
GT Günter Theißen
Published: Vol 4, Iss 15, Aug 5, 2014
DOI: 10.21769/BioProtoc.1200 Views: 8384
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Nov 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2013
Abstract
Fruit dehiscence is an important evolutionary and agronomic trait. For quantifying and comparing the exact fruit dehiscence capability between individual plants, the random impact test has been described (Morgan et al., 1998; Bruce et al., 2002; Arnaud et al., 2010). Here, we describe the random impact test optimized to measure dehiscence capability in the Brassicaceae plant Lepidium campestre (L. campestre). However, with slight alterations regarding agitation force, agitation time, and drying conditions, the test should be applicable to a wide range of plant species with dehiscent fruits.
Keywords: Random impact test Fruit dehiscence Fruit opening
Materials and Reagents
L. campestre plants
Equipment
An open container (e.g. Falcon tube)
Desiccator or climate chamber allowing for the control of temperature and relative humidity
A number of steel balls (in our case with a diameter of 5 mm)
Mixer Mill (MM 400/Retsch) including two grinding jars (Figure 1)
Figure 1. Mixer Mill (MM400/Retsch)
A pair of tweezers
Software
Microsoft Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Lenser, T. and Theißen, G. (2014). Quantifying Fruit Dehiscence Using the Random Impact Test (RIT). Bio-protocol 4(15): e1200. DOI: 10.21769/BioProtoc.1200.
Download Citation in RIS Format
Category
Plant Science > Plant developmental biology > Morphogenesis
Plant Science > Plant physiology > Abiotic stress
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,201 | https://bio-protocol.org/exchange/protocoldetail?id=1201&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Floral Dip Transformation in Lepidium campestre
Teresa Lenser
GT Günter Theißen
Published: Vol 4, Iss 15, Aug 5, 2014
DOI: 10.21769/BioProtoc.1201 Views: 10494
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Nov 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2013
Abstract
Floral dip is a very common technique to stably transform Arabidopsis thaliana (Clough and Bent, 1998; Martinez-Trujillo et al., 2004; Zhang et al., 2006) and has also been adapted to some other plant species (Curtis and Nam, 2001; Tague, 2001; Bartholmes et al., 2008). Here, we describe this method optimized for transformation of the Brassicaceae plant Lepidium campestre (L. campestre).
Keywords: Floral dip Lepidium campestre Plant transformation Agrobacterium tumefaciens
Materials and Reagents
L. campestre seeds
Agrobacterium strain GV3101 (carrying a binary vector for plant transformation including resistance gene for bacterial selection and a T-DNA containing a Basta-resistance gene)
Seedling substrate (60% white peat; 20% frozen black peat; 20% coconut pulp) (Klasmann-Deilmann GmbH, recipe number: 080 )
Osmocote mini (The Scotts Company)
Triabon (COMPO)
Beef extract
Yeast extract
Peptone
Sucrose
MgSO4
Rifampicin (chromosomal resistance)
Gentamycin (helper plasmid resistance)
Further antibiotics depending on the transformation vector
Silwet L-77 (Lehle Seeds, catalog number: VIS-02 )
0.01% basta solution (Bayer CropScience GmbH, catalog number: 79011725 )
Soil (see Recipes)
YEB Medium (see Recipes)
Infiltration medium (see Recipes)
Equipment
Greenhouse for plant cultivation
Cold-room for plant vernalization
Vermiculite (1-2 mm)
28 °C incubator with shaking
Beaker
Centrifuge with temperature control
Spectrophotometer
Magnetic stirrer
Small plastic bags
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Lenser, T. and Theißen, G. (2014). Floral Dip Transformation in Lepidium campestre. Bio-protocol 4(15): e1201. DOI: 10.21769/BioProtoc.1201.
Download Citation in RIS Format
Category
Plant Science > Plant transformation > Agrobacterium
Molecular Biology > DNA > Transformation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,202 | https://bio-protocol.org/exchange/protocoldetail?id=1202&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Quantitative Analysis of Cellular Diacylglycerol Content
FT Fikadu G. Tafesse
KS Karin Strijbis
HP Hidde L. Ploegh
Published: Vol 4, Iss 15, Aug 5, 2014
DOI: 10.21769/BioProtoc.1202 Views: 11689
Edited by: Fanglian He
Reviewed by: Hong-guang Xia
Original Research Article:
The authors used this protocol in Jun 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2013
Abstract
Diacylglycerol (DAG) is a bioactive lipid with diverse biological roles. DAG transiently accumulates in a membrane upon receipt of an appropriate stimulus that activates phospholipase C to cleave phospholipids. The resulting hydrolysis product DAG binds to proteins such as protein kinase C to initiate a variety of downstream cellular processes. DAG kinases attenuate such responses by converting DAG to phosphatidic acid.
This protocol describes an assay designed to quantify cellular DAG levels. The assay exploits the enzymatic conversion of DAG (sn-1,2-diacylglycerol) to phosphatidic acid (1,2-diacyl- sn-glycerol-3-phosphate) in conjunction with the incorporation of a radiolabeled phosphate group by DAG kinase (Figure 1). This assay was described in (Strijbis et al., 2013).
Figure 1. The enzymatic conversion of DAG to phosphatidic acid by DAG kinase
Materials and Reagents
Cells (~2 x 106 cells)
Octyl-β-D-glucoside (Sigma-Aldrich, catalog number: O8001 )
Cardiolipin (Sigma-Aldrich, catalog number: C5646 )
Diethylenetriaminepenta acetic acid (DETAPAC) (Sigma-Aldrich, catalog number: D6518 )
Imidazole (Sigma-Aldrich, catalog number: I5513 )
NaCl (Sigma-Aldrich, catalog number: S7653 )
MgCl2 (Sigma-Aldrich, catalog number: M8266 )
EGTA (Boston Bio Products, catalog number: BM-151 )
DTT (Sigma-Aldrich, catalog number: D0632 )
DAG kinase (Sigma-Aldrich, catalog number: D3065 )
γ33-ATP (PerkinElmer, catalog number: NEG302H001MC )
DAG (Avanti Polar Lipids)
Phosphatidic acid (Sigma-Aldrich, catalog number: P9511 )
Chloroform (Thermo Fisher Scientific, catalog number: C298-50 )
Methanol (Thermo Fisher Scientific, catalog number: BP1105 )
Acetic acid (Sigma-Aldrich, catalog number: 695092 )
N2 gas (Middlesex Gases & Technologies)
Acetone (Thermo Fisher Scientific, catalog number: S70090 )
Equipment
Vortex
Centrifuge
Thin layer chromatography (TLC) (Whatman, catalog number: 4860-820 ) equipment (plates, developing tank)
Phospho-scanner (e.g. Fujifilm Corporation, model: BAS-2500 )
Phospho-imaging screens (e.g. Fujifilm Corporation, model: BAS-MS )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Tafesse, F. G., Strijbis, K. and Ploegh, H. L. (2014). Quantitative Analysis of Cellular Diacylglycerol Content. Bio-protocol 4(15): e1202. DOI: 10.21769/BioProtoc.1202.
Strijbis, K., Tafesse, F. G., Fairn, G. D., Witte, M. D., Dougan, S. K., Watson, N., Spooner, E., Esteban, A., Vyas, V. K., Fink, G. R., Grinstein, S. and Ploegh, H. L. (2013). Bruton's Tyrosine Kinase (BTK) and Vav1 contribute to Dectin1-dependent phagocytosis of Candida albicans in macrophages. PLoS Pathog 9(6): e1003446.
Download Citation in RIS Format
Category
Biochemistry > Lipid > Lipid measurement
Biochemistry > Lipid > Lipid isolation
Biochemistry > Protein > Interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,203 | https://bio-protocol.org/exchange/protocoldetail?id=1203&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
DNA Fragmentation Analysis
KM Kei-ichiro Mishiba
YN Yukihiro Nagashima
NH Noriko Hayashi
NK Nozomu Koizumi
Published: Vol 4, Iss 15, Aug 5, 2014
DOI: 10.21769/BioProtoc.1203 Views: 17244
Edited by: Ru Zhang
Reviewed by: Fang XuZhaohui Liu
Original Research Article:
The authors used this protocol in Apr 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2013
Abstract
DNA fragmentation with length corresponding to multiple integer of approximately 180 base pairs is a distinct feature of apoptosis in animals and programmed cell death in plants. This feature can simply be detected by DNA gel electrophoresis followed by ethidium bromide staining, although in some cases it is difficult to distinguish the DNA laddering. We herein describe a protocol to detect a programmed cell death-associated DNA laddering of plant tissues. After agarose-gel electrophoresis of genomic DNA, Southern hybridization using DIG-labeled genomic DNA probe is performed, that improves detection of DNA laddering.
Keywords: Programmed cell death DNA laddering Southern hybridization
Materials and Reagents
Fresh plant tissues
Nucleon PhytoPure DNA extraction kits (General Electric Company, catalog number: RPN8510 )
GeneMate LE Agarose (BioExpress, catalog number: E-3120 )
Biodyne Plus Nylon Membrane (Pall, catalog number: 60406 )
Wizard DNA Clean-Up System (Promega, catalog number: A7280 )
DIG-High Prime DNA Labeling and Detection Starter Kit II (Roche Diagnostics, catalog number: 11585614910 )
X-ray film
Saline sodium citrate (SSC)
Depurination solution (see Recipes)
Denaturation solution (see Recipes)
Neutralization solution (see Recipes)
1x TAE buffer (see Recipes)
Equipment
Plastic container for gel and membrane treatment
Centrifuge (Eppendorf, model: 5415R )
Spectrophotometer (Shimadzu, model: BioSpec-nano )
Shaker (BIO CRAFT, model: BC-700 )
Vacuum transfer apparatus (BIO CRAFT, model: BS-31 )
Hybridization oven and UV crosslinker (UVP, model: HybriLinker HL-2000 )
Vacuum concentrator (SavantTM, model: DNA SpeedVac DNA110 )
Hybridization incubator (TAITEC, model: HB-80 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant molecular biology > DNA
Molecular Biology > DNA > DNA damage and repair
Molecular Biology > DNA > Electrophoresis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,205 | https://bio-protocol.org/exchange/protocoldetail?id=1205&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Enzymatic Reactions and Detection of C3 Cleavage Fragments
CK Claudia Kemper
Martin Kolev
Published: Vol 4, Iss 16, Aug 20, 2014
DOI: 10.21769/BioProtoc.1205 Views: 10829
Reviewed by: Pia Giovannelli
Original Research Article:
The authors used this protocol in Dec 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2013
Abstract
The complement component C3 is the major effector molecule of the complement system. C3 circulates in the blood and interstitial fluids as pro-enzyme and is activated by enzymatic cleavage into a C3a portion, a classic anaphylatoxin that functions as chemoattractant and immune cell activator, and the C3b portion, the body’s most potent opsonin. C3 cleavage is in most cases mediated by an enzyme complex called the C3 convertase. However, it is now becoming increasingly clear that the cleavage of C3 by a range of ‘single’ proteases into bioactive C3a and C3b fragments is of high physiological significance. Here, we describe a protocol for the enzymatic cleavage of human C3 by the serine protease cathepsin L and the detection of the cleavage products C3a and C3b by western blotting as an example for this kind of enzymatic reactions.
Keywords: Complement system C3 Cathepsin L Cleavage
Materials and Reagents
Purified human C3 (Complement Technology, catalog number: A113 )
Purified human C3b (Complement Technology, catalog number: A114 )
Purified human C3a (Complement Technology, catalog number: A118 )
Recombinant human cathepsin L (CTSL) (R&D Systems, catalog number: 952-CY-010 )
1 M Dithiothreitol (DTT) (Life Technologies, catalog number: P2325 )
Tris acetate gels 3-8% or equivalent (Life Technologies, NuPAGE® Novex®, catalog number: WG1603BOX )
20x NuPAGE Tris acetate running buffer (Life Technologies, catalog number: LA0041 )
Protein size standard (Life Technologies, catalog number: LC5800 )
5x protein sample reducing loading buffer (Thermo Fisher Scientific, catalog number: 39000 )
Nitrocellulose membranes (Life Technologies, catalog number: IB301002 )
5% dried milk powder in 1x PBS (Marvel)
Tween 20 (Sigma-Aldrich, catalog number: P5927 )
Rabbit anti-C3d antibody recognizing the intact and cleaved C3 α-chain (Abcam, catalog number: ab17453 )
Rabbit anti-C3 antibody recognizing the C3 β-chain (MyBioSource, catalog number: MBS857324 )
Mouse anti-C3 antibody recognizing the C3a portion within the uncleaved C3 α-chain (Abcam, catalog number: ab36385 )
Mouse anti-C3a neoepitope antibody recognizing only cleaved C3a (Abcam, catalog number: ab11873 )
Secondary antibodies to rabbit and mouse Ig conjugated to Horseradish peroxidase (HRP) (GE Healthcare, catalog numbers: RPN4301 and NA9310 , respectively)
ClarityTM Western ECL substrate (Bio-Rad Laboratories, catalog number: 170-5060 )
NaCl (Sigma-Aldrich, catalog number S7653 )
KCl (Sigma-Aldrich, catalog number P9333 )
Na2HPO4 (Sigma-Aldrich, catalog number S7907 )
KH2PO4 (Sigma-Aldrich, catalog number P5655 )
MES (free acid) (Sigma-Aldrich, catalogue number M0164 )
Brij35 (Thermo Fisher Scientific, Pierce, catalog number: 28316 )
NaOH (Sigma-Aldrich, catalog number S8045 )
Tris base (Sigma-Aldrich, catalog number: T1503 )
HCl (Sigma-Aldrich, catalog number: 258148 )
10x phosphate buffered saline (PBS) (see Recipes)
0.5 M 2- (N-morpholino) ethanesulfonic acid (MES) buffer (see Recipes)
0.05 M Tris (hydroxymethyl) aminomethan (THAM) buffer (see Recipes)
Equipment
Centrifuge (Eppendorf, model: 5427 R )
37 °C, 5% CO2 cell culture incubator
Heating block (Eppendorf, catalog number: 5382000031 )
Reaction tubes (1.5 ml) (Eppendorf, catalog number: 0030125177 )
Pipettes of several volume sizes (for example, Eppendorf)
Power pack for gel electrophoresis (Bio-Rad Laboratories, catalog number: 164-5070 )
XCell4 SureLockTM Midi-Cell gel running tank (Bio-Rad Laboratories, catalog number: WR0100 )
Western blotting transfer equipment (Life Technologies, iBlot®, catalog number: IB21001 )
Western blot visualization machine Chemi Doc MP imaging system (Bio-Rad Laboratories, catalog number: 170-8280 )
Platform rocker (Stuart, catalog number: R11876-01 )
Cold room
Ice bucket
Software
ImageLab software 4.1 (Bio-Rad Laboratories)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kemper, C. and Kolev, M. (2014). Enzymatic Reactions and Detection of C3 Cleavage Fragments. Bio-protocol 4(16): e1205. DOI: 10.21769/BioProtoc.1205.
Download Citation in RIS Format
Category
Immunology > Host defense > General
Biochemistry > Protein > Activity
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,206 | https://bio-protocol.org/exchange/protocoldetail?id=1206&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Signaling Assays for Detection of Human G-protein-coupled Receptors in Yeast
Yasuyuki Nakamura
Jun Ishii
Akihiko Kondo
Published: Vol 4, Iss 16, Aug 20, 2014
DOI: 10.21769/BioProtoc.1206 Views: 10126
Reviewed by: Belen SanzMaureen Wirschell
Original Research Article:
The authors used this protocol in Dec 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2013
Abstract
G-protein-coupled receptors (GPCRs) are the largest group of cell-surface proteins and are major molecular targets for drug development. The protocol described herein is for the detection of human GPCR signaling in the yeast Saccharomyces cerevisiae. Using Zoanthus sp. green fluorescent protein (ZsGreen) as the reporter, engineered yeast cells expressing human GPCRs emit strong fluorescence in response to stimuli leading to receptor signal activation. This assay method would allow screening for agonistic ligands and critical mutations required for human GPCR signaling.
Keywords: Signaling assay G-protein-coupled receptor Biosensor Yeast Human GPCR
Materials and Reagents
Engineered Saccharomyces cerevisiae strain in which the ZsGreen reporter genes were integrated into the genome (IMFD-72ZsD: MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 sst2Δ::AUR1-C ste2Δ::LEU2 fig1Δ::ZsGreen his3Δ::PFIG1-ZsGreen far1Δ gpa1Δ::Gi3tp) (Nakamura et al., 2013)
Note: The expression of ZsGreen is controlled by the signal-responsive FIG1 promoter.
Multi-copy expression plasmid (pGK421 containing the PGK1 promoter, 2 μ origin and MET15 marker) (Togawa et al., 2010) encoding the GPCR of interest [e.g., somatostatin receptor subtype-5 (SSTR5); somatostatin receptor subtype-2 (SSTR2); or neurotensin receptor type-1 (NTSR1)] (Ishii et al., 2012; Ishii et al., 2014)
GPCR ligands [e.g., somatostatin (SST) (Merck KGaA, Calbiochem®, catalog number: 51110-01-1 ) and neurotensin (NTS) (Merck KGaA, Calbiochem®, catalog number: 39379-15-2)]
10 mg/ml carrier DNA (Takara Bio Company, Clontech, catalog number: 630440 )
Tris (hydroxymethyl) aminomethane (Tris.HCl) (Nacalai Tesque, catalog number: 35409-45 )
Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA 2Na∙2H2O) (Nacalai Tesque, catalog number: 15111-45 )
1 M Hydrochloric acid (HCl) (Nacalai Tesque, catalog number: 37314-15 )
Lithium acetate dihydrate (Sigma-Aldrich, catalog number: L6883 )
Acetic acid (Nacalai Tesque, catalog number: 00212-85 )
Polyethylene glycol (PEG) #4000 (Nacalai Tesque, catalog number: 28221-05 )
DMSO (Nacalai Tesque, catalog number: 13445-74 )
BD FACSFlow sheath fluid (BD, catalog number: 342003 )
Immersion oil (Olympus, catalog number: IMMOIL-F30CC )
Distilled water (dH2O)
Yeast extract (Nacalai Tesque, catalog number: 15838-45 )
Peptone (BD, catalog number: 211677 )
D-Glucose (Nacalai Tesque, catalog number: 16806-25 )
Yeast nitrogen base without amino acids (YNB) (BD, catalog number: 291940 )
L-Histidine (Nacalai Tesque, catalog number: 18116-92 )
L-Leucine (Nacalai Tesque, catalog number: 20327-62 )
Uracil (Nacalai Tesque, catalog number: 35824-82 )
3-(N-Morpholino)-2-hydroxypropanesulfonic acid (Mopso) (Nacalai Tesque, catalog number: 23421-64 )
Sodium hydroxide (NaOH) (Nacalai Tesque, catalog number: 31511-05 )
Agar (Nacalai Tesque, catalog number: 01028-85 )
10 x TE buffer (see Recipes)
10 x LiAc (see Recipes)
50% PEG (see Recipes)
TE/LiAc solution (see Recipes)
LiAc/PEG solution (see Recipes)
YPD medium (see Recipes)
Synthetic dextrose (SD) selective medium supplemented with histidine, leucine and uracil (see Recipes)
SDM71 selective medium supplemented with histidine, leucine and uracil (see Recipes)
Equipment
16.5 x 105 mm test tubes (AGC Techno Glass, catalog number: 9820TST16.5-105NP )
10-ml conical flasks (AGC Techno Glass, catalog number: 4980FK10 )
2-ml microcentrifuge tubes (WATSON, catalog number: 332-720C )
1.5-ml microcentrifuge tubes (WATSON, catalog number: 131-815C )
96-well cell culture plate (Corning, catalog number: 3596 )
Microplate sealing tape (AS ONE Corporation, catalog number: 1-6774-05 )
12.5 x 75 mm test tubes with 2-position caps (B & M Equipment, catalog number: 222-2036-050 )
Microscope glass slides (Matsunami Glass, catalog number: S091150 )
18 x 18 mm coverslips (Matsunami Glass, catalog number: C218181 )
Centrifuge (Eppendorf, model: MiniSpin plus )
Block incubator (Astec Industries, model: BI-516C )
Shaking incubator for test tubes and conical flasks (TAITEC, model: BR-43FL )
Shaking incubator for a 96-well cell culture plate (TAITEC, model: M∙BR-022UP )
Spectrophotometer (Shimadzu, model: UVmini-1240 )
BD FACSCanto II flow cytometer (BD)
Fluorescence microscope (Keyence Corporation, model: BZ-9000 )
100x objective lens (Nikon Corporation, model: CFI Plan Apo VC 100x H )
BZ filter cube (excitation filter, absorption filter, dichroic mirror) (Keyence Corporation, model: OP-66836 GFP-BP )
Software
BD FACSDiva software (v5.0) (BD)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Immune cell function > General
Biochemistry > Protein > Interaction
Cell Biology > Cell signaling > Stress response
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,207 | https://bio-protocol.org/exchange/protocoldetail?id=1207&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro DNA Polymerization Activity Assay Using Cell-free Extracts
Anurag K. Sinha
Malay K. Ray
Published: Vol 4, Iss 16, Aug 20, 2014
DOI: 10.21769/BioProtoc.1207 Views: 8445
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in Aug 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2013
Abstract
This protocol has been designed to measure the in-vitro DNA polymerization activity in crude cell extracts of the Antarctic bacterium Pseudomonas syrinagae Lz4W. This bacterium can grow at 4 °C with optimum growth rate at 22 °C. The slow growth rate of the bacterium observed at low temperature (4 °C) compared to higher temperature (22 °C) can be attributed to the reduced rate of DNA replication at low temperature. Here we describe a protocol which we have used to quantify the in vitro DNA polymerization of cell extracts at two different temperatures.
Keywords: DNA synthesis DNA labeling DNA polymerization activity Pseudomonas
Materials and Reagents
Pseudomonas syringae (P. syringae) Lz4W strain (Shivaji et al., 1989)
Escherichia coli (E. coli) DH5alpha strain
Random primer labelling kit (JONAKI Laboratory, catalog number: LCK 2 )
Note: Many companies like Roche Diagnostics, Thermo Fisher Scientific, Agilent, Clontech etc. provide similar kit.
Wizard Genomic DNA Purification Kit (Promega Corporation, catalog number: A1120 )
(Alpha 32P)-dATP (JONAKI Laboratory, catalog number: LCP 103 )
Lysozyme (Roche Diagnostics, catalog number: 10153516103 )
10% trichloroacetic acid (TCA) (Sigma-Aldrich, catalog number: T6399 )
KCl (Sigma-Aldrich, catalog number: P9541 )
50 mM Tris.HCl (pH 7.5)
10% sucrose (Sigma-Aldrich, catalog number: 84097 )
Peptone (HiMedia Laboratories, catalog number: RM 001-500G )
Yeast extracts (HiMedia Laboratories, catalog number: RM 027-500G )
Stop buffer (see Recipes)
Lysozyme solution (see Recipes)
ABM broth (Pavankumar et al., 2010) (see Recipes)
Equipment
BD PrecisionGlide needles 22G (BD, catalog number: 305156 )
Liquid scintillation analyzer (PerkinElmer, model: Tri-Carb 2900 TR )
Centrifuge (Eppendorf, model: 5810R, catalog number: 5811000.010 )
NanoDrop 1000 spectrophotometer (Thermo Fisher Scientific, catalog number 8482 )
Micro centrifuge tubes (1.5 ml) (tarsons, catalog number: 500010 )
F12- ED refrigerated/heating circulator (JULABO GmbH, catalog number: 9116612 )
Plastic scintillation vials (PerkinElmer, catalog number: 6000477 )
Separate laboratory design and workspace for radioactive work with proper guidelines
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sinha, A. K. and Ray, M. K. (2014). In vitro DNA Polymerization Activity Assay Using Cell-free Extracts. Bio-protocol 4(16): e1207. DOI: 10.21769/BioProtoc.1207.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > DNA
Molecular Biology > DNA > DNA synthesis
Molecular Biology > DNA > DNA labeling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,208 | https://bio-protocol.org/exchange/protocoldetail?id=1208&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Endolysin Expression, Purification and Activity Determination by Zymography
Alexander B. Westbye
PF Paul C. Fogg
John Thomas Beatty
Published: Vol 4, Iss 16, Aug 20, 2014
DOI: 10.21769/BioProtoc.1208 Views: 14775
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Nov 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2013
Abstract
Endolysins are peptidoglycan-degrading (muralytic) enzymes produced by many bacteriophages for cell lysis of the host bacterium. The enzymatic activity of muralytic enzymes can be assayed qualitatively using a zymogram containing incorporated peptidoglycan. This protocol describes the expression of a recombinant 6x His-tagged endolysin using an Escherichia coli (E. coli) expression system and native affinity purification of the protein using Ni-NTA agarose. For the zymogram, the protocol details isolation of crude peptidoglycan from the Gram-negative bacterium Rhodobacter capsulatus and the zymography of purified protein and crude cell lysate. Construction of an E. coli BL21 (DE3) pET28-a(+)-derived endolysin-expression system is briefly described.
The protocol described here was developed and optimized for the endolysin 555 utilized by the Rhodobacter capsulatus bacteriophage-like gene transfer agent (RcGTA) (Westbye et al., 2013) and to study the muralytic activities of protein P14 of RcGTA (Fogg et al., 2012), but should be transferrable as a general protocol to express and study a variety of endolysins.
Keywords: Endolysin Lysozyme Zymogram Peptidoglycan Muralytic
Materials and Reagents
Protein purification
pET28-a(+) (EMD Millipore, catalog number: 69864 ) or similar IPTG-inducible T7-based protein expression plasmid incorporating a 6x His tag
Standard reagents and tools for molecular cloning (see Hasmann et al., 2011)
E. coli BL21 (DE3) (New England BioLabs, catalog number: C2527I , or other source), or similar E. coli T7-based protein overexpression strain
Kanamycin sulfate (50 mg/ml in dH2O, filter sterilized) or appropriate antibiotic if using different plasmid
Isopropyl β-D-1-thiogalactopyranoside (IPTG) (100 mM in dH2O, filter sterilized)
Ni-NTA Agarose (QIAGEN, catalog number: 30210 )
Imidazole (2 M in dH2O)
Lysogeny broth (LB) (see Recipes)
Lysis buffer (see Recipes)
SDS-PAGE and zymogram
SDS-PAGE gel (12% separation and 4% stacking layer, He, 2011)
Laemmli buffer/sample loading buffer (He, 2011)
2-propanol
Renaturation buffer (see Recipes)
Coomassie brilliant blue protein stain solution (see Recipes)
YPS broth (see Recipes)
Destain solution (see Recipes)
Phosphate buffer (see Recipes)
Equipment
250 ml culture flasks
Incubator with shaker for culture flask (temperature adjustable) (or similar)
French press for cell lysis (see Note on alternative lysis methods)
Rotor JA-20 (Beckman Coulter) or equivalent
Centrifuge suitable for rotor (Beckman Coulter, model: J2-HS or similar)
Gravity column for Ni-NTA agarose
SDS-PAGE apparatus with power supply (Mini-Protean and PowerPac, Bio-Rad Laboratories or equivalent)
Microtube centrifuge (table-top)
Microwave (optional)
Flat (roux, or tissue culture) bottles (1 L for photoheterotrophic growth)
Light-emitting incubator for photoheterotrophic growth (see Note 6)
Erlenmeyer flask (500 ml) (pyrex, or other heat resistant glass)
Glass beaker (1 L or large enough to encompass a 500 ml flask) (pyrex, or other heat resistant glass)
Bunsen burner (or similar heat source)
Vacuum concentrator (Savant SpeedVac SC110A concentrator with UVS400 vacuum system, or similar) (optional)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Westbye, A. B., Fogg, P. C. and Beatty, J. T. (2014). Endolysin Expression, Purification and Activity Determination by Zymography. Bio-protocol 4(16): e1208. DOI: 10.21769/BioProtoc.1208.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Expression
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,209 | https://bio-protocol.org/exchange/protocoldetail?id=1209&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
siRNA Screening for Genes Involved in HSV-1 Replication
Samantha J. Griffiths
Jürgen Haas
Published: Vol 4, Iss 16, Aug 20, 2014
DOI: 10.21769/BioProtoc.1209 Views: 10350
Reviewed by: Pinchas Tsukerman
Original Research Article:
The authors used this protocol in Aug 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2013
Abstract
Small interfering RNAs (siRNAs) are small (typically 18-24 nucleotides) RNA molecules capable of silencing gene expression post-transcriptionally and as such, they provide a simple method by which the role of individual genes in complex cellular systems can be easily assessed. As siRNAs are easy to use experimentally, and can be designed to target any gene (including pathogens), their use is perfectly suited to and easily adapted to high-throughput genome-wide screening methodologies and a range of phenotypic assays. Here we describe the use of a large siRNA library (>8,000 genes targeted individually) to screen for and identify host factors functionally involved in the replication of a human herpesvirus (Herpes simplex virus type 1; HSV-1) (Griffiths et al., 2013; Griffiths, 2013).
Materials and Reagents
Hela cells (ATCC, catalog number: CCL-2 )
siRNA library (e.g. human siGENOME SMARTpool Druggable Genome siRNA library 0.5 nmol) (Thermo Fisher Scientific, catalog number: G-004605-05 )
5x siRNA buffer (Thermo Fisher Scientific, catalog number: B-002000-UB-100 )
RISC-free (RSCF) control siRNA (20 nmol) (Thermo Fisher Scientific, catalog number: D-001220-01-20 )
Scrambled, non-targeting control siRNA (20 nmol, human) (Thermo Fisher Scientific, catalog number: D-001206-13-20 )
Assay-specific control siRNAs
Fetal bovine serum (FBS) (LabTech, catalog number: FCS-SA-10454 )
Penicillin:streptomycin (5,000 units/ml each) (Lonza, catalog number: DE17-603E )
1x trypsin-EDTA liquid (0.05% Trypsin, 0.53 mM EDTA-4Na) (Life Technologies, catalog number: 25300096 )
Phosphate buffered saline without magnesium or calcium (Lonza, catalog number: 17-516F )
DMEM 4.5 g glucose/litre with L-glutamine and sodium pyruvate (Lonza, catalog number: BE12-604F )
1x DMEM/F12 1:1 (15 mM HEPES + L-glutamine, no phenol red) (Life Technologies, catalog number: 11039021 )
Hank’s balanced salt solution (HBSS) (Thermo Fisher Scientific, catalog number: HYC-001-181W )
Dharmafect 1 siRNA transfection reagent (Thermo Fisher Scientific, catalog number: T-2001 )
Sterile DNase and RNase-free distilled water (Life Technologies, catalog number: 10977-049 )
Ethanol (diluted in sterile RNase and DNase-free water)
CellTiter-Blue® cell viability reagent (Promega Corporation, catalog number: G8081 )
HSV-1-eGFP reporter virus (Arthur et al., 2001)
Growth medium (see Recipes)
Transfection medium (see Recipes)
Equipment
Pipette tips for robotic liquid handler (Axygen Zymark 200 µl sterile tips) (VWR International, catalog number: AXYGZT-200-L-R-S )
Polystyrene plate covers for 96-well plates (Thermo Fisher Scientific, catalog number: AB0752 )
Aluminium heat-sealing film for storage microplates (Thermo Fisher Scientific, catalog number: AB-0559 )
Adhesive plate seals (Starlab, catalog number: E2796-9793 )
384-well storage plates (Thermo Fisher Scientific, catalog number: AB-0781 )
Black 384-well clear flat-bottomed, sterile, tissue culture-treated plates (VWR International, catalog number: 734-1640 )
75 cm2 filter cap tissue culture flasks (Sigma-Aldrich, catalog number: C7106 )
175 cm2 filter cap tissue culture flasks (Sigma-Aldrich, catalog number: C7481 )
50 ml centrifuge tube (Corning, product number: 430290 )
Disposable hemocytometer (KOVA Glasstic slide 10 with counting grid) (HYCOR Biomedical, catalog number: 87144E )
Class II Microbiological safety cabinet
Humidified cell culture incubator (37 °C, 5% CO2)
Pipette aid (Alpha laboratories, catalog number: 4-131-201-E )
Centrifuge (e.g. Eppendorf, catalog number: 5811-000.010 )
Light microscope
8-channel multichannel pipette (2-10 μl volume) (Thermo Fisher Scientific, catalog number: 4661000 )
Multidrop 384 reagent dispenser (Thermo Fisher Scientific, catalog number: 5840150 )
Multidrop 384 standard tube dispensing cassette (Thermo Fisher Scientific, catalog number: 24072670 )
RapidPlate 384 robotic liquid handler (or equivalent) (discontinued) (QIAGEN)
Microplate heat sealer (e.g. ALPS 50 V Microplate heat sealer) (Thermo Fisher Scientific, catalog number: AB-1443 )
Gas-permeable adhesive microplate seals (Thermo Fisher Scientific, catalog number: AB-0718 )
Barcode printer (e.g. Brady® LABXPERT™ printer) (Sigma-Aldrich, catalog number: Z664588 )
Brady® LABXPERT™ printer labels (Thermo Fisher Scientific, catalog number: 12879858 )
Fluorescent plate reader (e.g. POLARstar OPTIMA, BMG LABTECH)
Stacker for plate reader (BMG LABTECH)
Software
Microsoft Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Griffiths, S. J. and Haas, J. (2014). siRNA Screening for Genes Involved in HSV-1 Replication. Bio-protocol 4(16): e1209. DOI: 10.21769/BioProtoc.1209.
Griffiths, S. J., Koegl, M., Boutell, C., Zenner, H. L., Crump, C. M., Pica, F., Gonzalez, O., Friedel, C. C., Barry, G., Martin, K., Craigon, M. H., Chen, R., Kaza, L. N., Fossum, E., Fazakerley, J. K., Efstathiou, S., Volpi, A., Zimmer, R., Ghazal, P. and Haas, J. (2013). A systematic analysis of host factors reveals a Med23-interferon-lambda regulatory axis against herpes simplex virus type 1 replication. PLoS Pathog 9(8): e1003514.
Download Citation in RIS Format
Category
Systems Biology > Genomics > Sequencing
Molecular Biology > RNA > RNA interference
Molecular Biology > DNA > Mutagenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,210 | https://bio-protocol.org/exchange/protocoldetail?id=1210&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
VZV Replication Assays
Samantha J. Griffiths
Jürgen Haas
Published: Vol 4, Iss 16, Aug 20, 2014
DOI: 10.21769/BioProtoc.1210 Views: 10954
Reviewed by: Pinchas Tsukerman
Original Research Article:
The authors used this protocol in Aug 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2013
Abstract
Varicella zoster virus (VZV) is a human herpesvirus which causes Varicella (chickenpox) upon primary infection and Zoster (shingles) following reactivation from latency (von Bokay, 1909). Whilst VZV is extensively studied, inherent features of VZV replication, such as cell-association of virus particles during in vitro culture and a restricted host range (limited to humans and some other primates) mean the cellular and viral mechanisms underlying VZV reactivation and pathogenesis remain largely uncharacterised. Much remains to be learnt about VZV, interactions with its host, and the development of disease. This protocol describes a basic VZV replication assay using a recombinant VZV-GFP reporter virus. As VZV is highly cell-associated in tissue culture, the reporter virus inoculum described here is a preparation of infected cells. This reporter virus-infected cell line can be used in combination with siRNA gene depletion or cDNA overexpression transfection protocols to determine the effect of individual cellular genes on virus replication.
Materials and Reagents
VZV-permissive human cells (e.g. MeWo cells) (ATCC, catalog number: HTB-65 )
Minimal essential medium eagle with Earle’s BBS, with L-glutamine (Lonza, catalog number: 12-611F )
Fetal bovine serum (FBS) (LabTech, catalog number: FCS-SA-10454 )
Penicillin: streptomycin (5,000 units/ml each) (Lonza, catalog number: DE17-603E )
Non-essential amino acids (NEAA) (Life Technologies, catalog number: 11140035 )
1x Trypsin-EDTA liquid (0.05% Trypsin, 0.53 mM EDTA-4Na) (Life Technologies, catalog number: 25300096 )
Phosphate buffered saline without Magnesium or Calcium (Lonza, catalog number: 17-516F )
Recombinant VZV-GFP cell-associated virus stock (Zerboni, 2000)
MeWo growth medium (see Recipes)
Equipment
75 cm2 filter cap tissue culture flasks (Sigma-Aldrich, catalog number: C7106-120EA )
96-well black tissue culture-treated plates (48/case) (VWR International, catalog number: 734-1609 )
50 ml centrifuge tube (e.g. Corning, catalog number: 430290 )
Disposable hemocytometer (KOVA Glasstic slide 10 with counting grid) (HYCOR Biomedical, catalog number: 87144E )
Fluorescent plate reader (e.g. POLARstar OPTIMA, BMG LABTECH)
Class II Microbiological safety cabinet
Humidified cell culture incubator (37 °C, 5% CO2)
Pipette aid (Alpha laboratories, catalog number: 4-131-201-E )
Centrifuge (e.g. Eppendorf, catalog number: 5811-000.010 )
Light microscope
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Griffiths, S. J. and Haas, J. (2014). VZV Replication Assays. Bio-protocol 4(16): e1210. DOI: 10.21769/BioProtoc.1210.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > In vitro model
Microbiology > Microbe-host interactions > Virus
Microbiology > Microbial cell biology > Cell isolation and culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,211 | https://bio-protocol.org/exchange/protocoldetail?id=1211&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Elevated Plus Maze Test to Assess Anxiety-like Behavior in the Mouse
Luciana M. Leo
FP Fabricio A. Pamplona
Published: Vol 4, Iss 16, Aug 20, 2014
DOI: 10.21769/BioProtoc.1211 Views: 28341
Edited by: Soyun Kim
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
The elevated plus maze task is a simple method to assess anxiety-like behaviors in rodents. This version describes the procedure used in mice. However, the protocol may also be applied to rats, considering a proportionally larger apparatus (arms: 10 x 50 cm; height: 55 cm). Briefly, the test is performed on a plus-shaped apparatus with two open and two closed arms. The animal is allowed to freely explore the maze for 5 min while the duration and frequency of entries into open and closed arms is recorded. The task is based on an approach-avoidance conflict, meaning that the animal is faced with a struggle between a propensity to explore a novel environment and an unconditioned fear of high and open spaces. Consequently, an anxiety-like state is characterized by increased open arm avoidance, compared to control animals. On account of being a very popular test, there can be considerable variations in the procedures applied across different laboratories. Here we provide a working protocol that has been able to detect both anxiogenic and anxiolyitic drug effects under the specified conditions. Protocol originally published in (Leo et al., 2014).
Materials and Reagents
Laboratory-bred plus maze-naïve mice
Note: Mice housed in groups of 4-5 per cage, kept in an environment with controlled temperature (around 23 °C) and humidity under a 12-12 h light-dark cycle with food and water ad libitum.
Paper towels and 70% ethanol for cleaning
Equipment
Elevated Plus maze (either customized apparatus or commercially available one)
Video camera (placed directly above the maze)
Indirect white light
Digital lux meter (Instrutherm, Mastech, Dr. Meter or similar)
Digital chronometers for manual analysis, or computer software (Any-maze, Ethovision or others) for automated analysis
Note: In our laboratory, we use a custom made plus-shaped maze sized for mice (Leo et al., 2014), which is elevated 50 cm above the ground, and consists of two opposite closed arms, two opposite open arms and a central square of 5 cm sides (see image below). The closed arms measure 30 x 5 cm and are constituted of white-painted wood, as are the 15 cm high walls that enclose the arms. Glossy painting should be avoided as to prevent excessive glare, thus a matte finish is recommended. The open arms measure 30 x 5 cm and are made of transparent acrylic; a 0.3 cm high transparent acrylic railing prevents animals from falling while exploring the open arms. The apparatus can be disassembled and moved to and from the experiment room where it is set up for use. Wood-made apparatuses covered with wood lacquer, painted in black or transparent Plexiglas apparatuses are also frequently found. Commercially available apparatuses, such as those from Stoelting Co. or Panlab S.L.U., are recommended as alternatives. The room illumination and apparatus light reflection strongly affect the elevated plus maze test. In our laboratory, a Samsung Flashcam digital camcorder is used, as it is more appropriate for posterior off-line analysis. One should always run pilot experiments to establish reliable baseline parameters and standardize the experimental environment before starting the experimental manipulations (drugs, procedure, transgenic animals, etc.).
Figure 1. Plus-shaped maze
Software
Automated computer software (Any-maze, Ethovision and others)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Leo, L. M. and Pamplona, F. A. (2014). Elevated Plus Maze Test to Assess Anxiety-like Behavior in the Mouse. Bio-protocol 4(16): e1211. DOI: 10.21769/BioProtoc.1211.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Animal model
Neuroscience > Behavioral neuroscience > Learning and memory
Neuroscience > Nervous system disorders > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,212 | https://bio-protocol.org/exchange/protocoldetail?id=1212&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
HIV-1 Fusion Assay
Marielle Cavrois
JN Jason Neidleman
Warner C. Greene
Published: Vol 4, Iss 16, Aug 20, 2014
DOI: 10.21769/BioProtoc.1212 Views: 15244
Original Research Article:
The authors used this protocol in Feb 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2014
Abstract
The HIV-1 fusion assay measures all steps in the HIV-1 life cycle up to and including viral fusion. It relies on the incorporation of a β-lactamase–Vpr (BlaM-Vpr) protein chimera into the virion and the subsequent transfer of this chimera into the target cell by fusion (Figure 1). The transfer is monitored by the enzymatic cleavage of CCF2, a fluorescent dye substrate of β-lactamase, loaded into the target cells. Cleavage of the β-lactam ring in CCF2 by β-lactamase changes the fluorescence emission spectrum of the dye from green (520 nm) to blue (447 nm). This change reflects virion fusion and can be detected by flow cytometry (Figure 2).
Materials and Reagents
293T cells (ATCC)
pAdVAntage (Promega Corporation, catalog number: E1711 )
pCMV4-BlaM-Vpr (Addgene, catalog number: 21950 )
pNL4-3 proviral DNA (NIH AIDS Reagent Program) or TN6-GFP encoding primary Env (available upon request to Warner Greene)
DMEM (Mediatech, Cellgro®, catalog number: 10-013-CV )
RPMI 1640 (Mediatech, Cellgro®, catalog number: 15-040-CV )
1x phosphate-buffered saline (PBS)
Fetal bovine serum (FBS)
100 U/ml of penicillin and 100 U/ml of streptomycin (Life Technologies, Gibco® catalog number: 15140-122 )
2 M CaCl2
Alliance HIV-I p24 ELISA kit (PerkinElmer, catalog number: NEK050B001KT ) or FlaQ assay reagents (Hayden et al., 2003)
Peripheral blood lymphocytes (PBLs)
CCF2-AM substrate and loading solutions (Life Technologies, catalog number: K1032 )
CO2-independent media (Life Technologies, Gibco®, catalog number: 18045-088 )
Probenecid (Sigma-Aldrich, catalog number: P8761 )
Mouse antihuman CD3 conjugated to APC-Cy7 and mouse antihuman CD4 conjugated to PE-Cy7 (BD Biosciences, catalog numbers: 557832 and 557852 )
BD CompBeads (BD Biosciences, catalog number: 552843 )
16% Paraformalehyde (Electron Microscopy Sciences, catalog number: 15710 )
HBSS (see Recipes)
Dulbecco’s modified Eagle medium (DMEM) culture media (see Recipes)
Roswell Park Memorial Institute (RPMI) culture media (see Recipes)
CCF2 loading solution (see Recipes)
Stock solution of probenecid (250 mM) prepared in 250 mM NaOH (see Recipes)
Development media (see Recipes)
Equipment
T175 cm2 culture flasks
96-well V-bottom plate (Corning Incorporated, catalog number: 3363 )
5, 10, 25 ml pipettes
50-ml Falcon tube
0.22 μm poresize Steriflip (EMD Millipore, catalog number: SE1M179M6 )
2 ml Nalgene tubes (Thermo Fisher Scientific, Nalgene®, catalog number: 5000-0020 )
Clear ultracentrifuge tubes (BD, catalog number: BD340437 )
37 °C, 5% CO2 incubator set at 90% humidity
Ultracentrifugation equipment with SW28 rotor
Flow cytometer
Note: The fusion assay alone requires a flow cytometer equipped with a violet laser excitation (405 nm) and two measurement parameters. The photomultiplicator tube (PMT) with a 450/50 nm band pass filter, commonly used for the detection of Pacific Blue, is used for the detection of the cleaved CCF2 substrate. The other PMT with a 515/20 nm band pass filter, commonly used for Amcyan detection, is used for the detection of the uncleaved CCF2 substrate. Additional PMTs are necessary for the measurement of the fluorochromes associated with the CD3 and CD4 antibodies. APC-Cy7 is excited by 633 nm red laser and detected with a PMT with a 755 long pass filters. PE-Cy7 is excited by a 531 nm yellow-green laser and detected with the PMT with a 755 long pass filter.
Software
FlowJoX software (Tree Star) or other FACS analysis software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Cavrois, M., Neidleman, J. and Greene, W. C. (2014). HIV-1 Fusion Assay . Bio-protocol 4(16): e1212. DOI: 10.21769/BioProtoc.1212.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Virus
Immunology > Host defense > Human
Biochemistry > Protein > Modification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,213 | https://bio-protocol.org/exchange/protocoldetail?id=1213&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assays of Polyphenol Oxidase Activity in Walnut Leaf Tissue
RG Ross Gertzen
Matthew A. Escobar
Published: Vol 4, Iss 16, Aug 20, 2014
DOI: 10.21769/BioProtoc.1213 Views: 21403
Edited by: Zhaohui Liu
Reviewed by: Saminathan Thangasamy
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
Polyphenol oxidase (PPO) is an enzyme that catalyzes the hydroxylation of monophenols into ortho-diphenols (cresolase activity) and the oxidation of o-diphenols into quinones (catecholase activity) (Figure 1). These quinones spontaneously polymerize to form dark-colored phytomelanins, most often seen in the browning of damaged plant tissue. PPO activity can be easily assayed in crude protein extracts from English walnut (Juglans regia) leaves and from many other plant tissue extracts. PPO activity is most commonly measured by spectrophotometric assay, in which the rate of phytomelanin production is quantified, or by oxygen electrode assay, in which the consumption of oxygen by the enzyme is quantified (Figure 1). Though simpler, the utility of the spectrophotometric assay is limited by variation in the absorption maxima of phytomelanins generated from different phenolic substrates. The oxygen electrode assay is generally considered the “gold standard” for measurement of PPO activity, but it is more time consuming and difficult to implement with monophenol substrates, since cresolase activity is typically quite low compared to catecholase activity. This protocol will describe crude protein extraction from walnut leaves, the spectrophotometric assay, and the oxygen electrode assay for determining PPO activity.
Keywords: Polyphenol oxidase Walnut Enzyme activity
Figure 1. The activity of the polyphenol oxidase enzyme
Materials and Reagents
Protein extraction
Juglans regia leaf tissue
Liquid nitrogen
Insoluble polyvinylpolypyrrolidone (PVPP) (Sigma-Aldrich, catalog number: 25249-54-1 )
Bovine serum albumin (BSA) (Thermo Fisher Scientific, catalog number: 9048-46-8 )
Bradford reagent (Bio-Rad Laboratories, catalog number: 500-0006 )
Tris base (Thermo Fisher Scientific, catalog number: 77-86-1 )
Citric acid monohydrate (Thermo Fisher Scientific, Acros Organics, catalog number: 5949-29-1 )
Cysteine hydrochloride (Thermo Fisher Scientific, catalog number: 7048-04-6 )
Ascorbic acid (Phyto Technology Laboratories®, catalog number: 50-81-7 )
Polyethylene glycol (PEG) 8000 (Thermo Fisher Scientific, catalog number: 25322-68-3 )
Glycerol (Thermo Fisher Scientific, catalog number: 56-81-5 )
Protein extraction buffer (see Recipes)
Spectrophotometric assay
Catalase (Thermo Fisher Scientific, catalog number: 9001-05-2 )
Kojic acid (Thermo Fisher Scientific, catalog number: 501-30-4 )
Monobasic dihydrogen sodium phosphate (Thermo Fisher Scientific, catalog number: 7558-80-7 )
Dibasic monohydrogen sodium phosphate (Thermo Fisher Scientific, catalog number: 7558-79-4 )
Sodium dodecyl sulfate (SDS) (Thermo Fisher Scientific, catalog number: 151-21-3 )
Sodium phosphate buffer containing phenolic substrate (see Recipes)
Oxygraph assay
Kojic acid (Thermo Fisher Scientific, catalog number: 501-30-4)
Sodium phosphate buffer containing phenolic substrate (see Recipes)
Assay buffer (see Recipes)
Equipment
Ceramic mortar and pestle
50 ml centrifuge tubes
30 ml Oak Ridge tubes (Thermo Fisher Scientific, Nalgene®, catalog number: 3114-0030 )
1.5 ml microfuge tubes
Spectrophotometer cuvettes or clear, flat bottom 96-well microtiter plates
Micropipettes
Vortexer
Floor centrifuge with rotor that accommodates 30 ml Oak Ridge tubes
Spectrophotometer or microplate reader (e.g. Molecular Devices SpectraMax M5)
Oxygen electrode with computer interface (e.g. Hansatech Instruments, Oxygraph)
-80 °C freezer
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant biochemistry > Protein
Plant Science > Plant metabolism > Phenolics
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,214 | https://bio-protocol.org/exchange/protocoldetail?id=1214&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
SGR-based Reporter to Assay Plant Transcription Factor-promoter Interactions
Shisong Ma
Savithramma Dinesh-Kumar
Published: Vol 4, Iss 16, Aug 20, 2014
DOI: 10.21769/BioProtoc.1214 Views: 10197
Reviewed by: Claudia CatalanottiKanika Gera
Original Research Article:
The authors used this protocol in Oct 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2013
Abstract
We developed an in vivo method to assay plant transcription factor (TF)–promoter interactions using the transient expression system in Nicotiana benthamiana (N. benthamiana) plants. The system uses the Arabidopsis stay green (SGR) gene as a reporter. Induction of SGR expression in N. benthamiana causes chlorophyll degradation and causes leaves to turn yellow.
Materials and Reagents
Plant material
4 to 5 week old healthy N. benthamiana plants
Vectors and bacteria strains
pDONR221 or other gateway DONR vector (Life Technologies, InvitrogenTM, catalog number: 12536-017 )
Escherichia coli (E. coli) DH10B or similar cells for molecular cloning
SGR reporter destination vector, SPDK 2388
Note: This vector contains the reporter gene SGR without promoter.
Binary vector for TFs over-expression (e.g. LIC6 from Arabidopsis Biological Resource Center)
Binary vector for expression of negative control protein [e.g. Actin7 (At5g09810) in LIC6]
Agrobacterium tumefaciens (A. tumefaciens) strain GV2260
Other materials
BP and LR clonase enzyme Kit (Life Technologies, InvitrogenTM, catalog numbers: 11789-013 and 11791-043 )
LB media
Acetosyringone (Sigma-Aldrich, catalog number: D134406 )
Infiltration medium (see Recipes)
Equipment
Incubator (42 °C)
1 ml Tuberculin syringes without needle (Tyco, catalog number: 8881501400 )
Controlled environment plant growth chamber (12 h of light per day, 21 °C)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant biochemistry > Protein
Plant Science > Plant molecular biology > DNA
Systems Biology > Interactome > Gene network
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,215 | https://bio-protocol.org/exchange/protocoldetail?id=1215&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Salinity Assay in Tomato
BR Begoña Renau-Morata
MS Manuel Sánchez-Perales
Joaquín Medina
RM Rosa Victoria Molina
RC Rocío Corrales
Laura Carrillo
PF Pedro Fernández-Nohales
JM Jorge Marqués
Stephan Pollmann
Jesús Vicente-Carbajosa
AG Antonio Granell
Sergio G. Nebauer
Published: Vol 4, Iss 16, Aug 20, 2014
DOI: 10.21769/BioProtoc.1215 Views: 15505
Edited by: Arsalan Daudi
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
Tomato is one of the most important horticultural crops worldwide, and is cultivated in semi-arid regions in which soil and groundwater salinity is an increasing limitation to yield. The assessment of the responses of new cultivars to salt and the comparisons among cultivars and wild species are of great interest in tomato breeding. This assay provides a reproducible and reliable method for screening tomato responses to NaCl salinity under hydroponic conditions in growth chambers. Although NaCl is the most commonly used salt in salinity studies, other salts such as Na2SO4, MgCl2 or MgSO4, usually found in saline soils, can also be assayed (Nebauer et al., 2013). Plants can be maintained for 30-45 days under the described conditions, although significant effects on growth can be observed after 10 days, depending on the salt and concentration used.
Keywords: Tomato Salinity assay Hydroponic Growth
Materials and Reagents
Solanum lycopersicum seeds
Agar
Sodium hypochlorite (NaClO)
Potassium nitrate (KNO3)
Ammonium nitrate (NH4NO3)
Calcium nitrate [Ca(NO3)2.4H2O]
Magnesium sulphate (MgSO4.7H2O)
Ethylene diamine-N, N bis (2hydroxyphenylacetic acid) Ferric sodium complex (Fe-EDDHA)
Boric acid (H3BO3)
Manganese chloride (MnCl2.4H2O)
Zinc sulphate (ZnSO4.7H2O )
Copper sulphate (CuSO4.5H2O)
Sodium molybdate (Na2MoO4.2H2O)
Sodium chloride (NaCl)
Sodium sulphate (Na2SO4)*
Magnesium chloride (MgCl2)*
Magnesium sulphate (MgSO4)*
*Note: These salts are necessary only if they have to be assayed. The standard assay is performed with NaCl.
Non-saline nutrient solution (see Recipes)
Salt stock solutions (see Recipes)
Equipment
Eppendorf-type tubes (1.5 ml)
Note: Caps are removed and the tube end is cut with scissors (Figure 1A). Tubes are placed in a tube rack (with a sealed bottom, Figure 1B) and filled with 0.6% agar in tap water (melted in a microwave) using a 50 ml syringe (Figure 1C-D).
Figure 1. Preparation of the tubes to hold plantlets. A) Cut tube, B) Racks with a sealed bottom, C) Filling tubes with agar in the rack and D) Tube filled with agar.
Opaque 10 L containers with cover
Polyethylene containers (40 cm long x 30 cm wide x 12 cm high) are used. Covers are bored with a drill to allow the placement of the Eppendorf-type tubes (Figure 2).
Figure 2. Example of a container with a bored cover to hold Eppendorf-type tubes
Petri dishes
50 ml syringe
Growth chamber
‘Aquarium’-type air pumps
Timer control
Microwave oven
Pasteur pipettes
Racks for Eppendorf-type tubes with a sealed bottom
Plastic trays with humidity domes
Precision balance (± 0.001)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Renau-Morata, B., Sánchez-Perales, M., Medina, J., Molina, R. V., Corrales, R., Carrillo, L., Fernández-Nohales, P., Marqués, J., Pollmann, S., Vicente-Carbajosa, J., Granell, A. and Nebauer, S. G. (2014). Salinity Assay in Tomato. Bio-protocol 4(16): e1215. DOI: 10.21769/BioProtoc.1215.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Abiotic stress
Plant Science > Plant physiology > Plant growth
Plant Science > Plant developmental biology > General
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,216 | https://bio-protocol.org/exchange/protocoldetail?id=1216&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Salinity Assay in Arabidopsis
AC Alba Rocío Corrales
Laura Carrillo
Sergio G. Nebauer
BR Begoña Renau-Morata
MS Manuel Sánchez-Perales
PF Pedro Fernández-Nohales
JM Jorge Marqués
AG Antonio Granell
Stephan Pollmann
Jesús Vicente-Carbajosa
RM Rosa Victoria Molina
Joaquín Medina
Published: Vol 4, Iss 16, Aug 20, 2014
DOI: 10.21769/BioProtoc.1216 Views: 19356
Edited by: Arsalan Daudi
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
Salinity is an important environmental constraint to crop productivity in arid and semi-arid regions of the world. The evaluation of the responses to salinity of different Arabidopsis ecotypes or transgenic lines is important to identify and investigate the role of different key genes. These new characterized genes involved in the response to salinity stress are of great interest to be incorporated in crops breeding programs. Here we provide a reproducible method to evaluate the performance of Arabidopsis lines to salinity stress by analysing primary and lateral root growth and fresh weight of plants grown under in vitro conditions in growth chambers. Even though NaCl is the most frequent used salinity tests, other salts (e.g. KCl, MgCl2) can be also evaluated by this method. Arabidopsis plants can be maintained for 15-20 days in these conditions, although effects on growth and biomass can be observed, depending on the used salt and concentration, within the first 10 days.
Keywords: Salinity tolerance Arabidopsis Plate assay Root length
Materials and Reagents
Arabidopsis thaliana ecotype Columbia (Col-0) and transgenic Arabidopsis lines 35S::SlCDF1 and 35S::SlCDF3 (background Col-0) seeds
70% ethanol
Sodium hypochlorite (NaClO)
Sodium dodecylsulphate (SDS)
Sterile water
Murashige & Skoog (MS) mediun including B5 vitamins (Duchefa Biochemie BV, catalog number: M0231 )
MES (Duchefa Biochemie BV, catalog number: M1503 )
Sucrose
NaCl
Agar (Duchefa Biochemie BV, catalog number: P1001 )
Medium composition (see Recipes)
Equipment
Square (120 x 120 mm) petri dishes polystyrene sterile
Growth chamber
Autoclave
Shaker
Image capturing device
Precision balance (± 0.0001)
Software
Image J software (http://rsb.info.nih.gov/ij) (Abrámoff et al., 2004)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Corrales, A. R., Carrillo, L., Nebauer, S. G., Renau-Morata, B., Sánchez-Perales, M., Fernández-Nohales, P., Marqués, J., Granell, A., Pollmann, S., Vicente-Carbajosa, J., Molina, R. V. and Medina, J. (2014). Salinity Assay in Arabidopsis. Bio-protocol 4(16): e1216. DOI: 10.21769/BioProtoc.1216.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Abiotic stress
Plant Science > Plant physiology > Plant growth
Plant Science > Plant developmental biology > General
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,217 | https://bio-protocol.org/exchange/protocoldetail?id=1217&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Vaccine-induced Cytokine Production Detected by Luminex Multiplex Analysis
Rachel Perret
SS Sophie R. Sierro
NB Natalia K. Botelho
SC Stephanie Corgnac
AD Alena Donda
Pedro Romero
Published: Vol 4, Iss 16, Aug 20, 2014
DOI: 10.21769/BioProtoc.1217 Views: 9155
Edited by: HongLok Lung
Reviewed by: Isabel Cristiane da Silva
Original Research Article:
The authors used this protocol in Nov 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2013
Abstract
Different vaccine and adjuvant combinations are known to rapidly induce antigen presenting cell (APC) maturation and pro-inflammatory cytokine and production, which in turn play an important role in the priming of antigen-specific T cells. Measuring cytokine production systemically in the serum fails to detect localized responses in the lymph nodes draining a subcutaneous immunization site. On the other hand, stimulating APC with vaccine formulations in vitro lacks the complexity of the lymph node microenvironment and the presence of other in vivo factors. Here we analyse cytokine production directly in vaccine draining lymph nodes (dLN) extracted early after in vivo vaccination. To do this we perform cytokine multiplex analysis of supernatants from whole dLN cell suspensions following a brief ex vivo incubation.
Materials and Reagents
C57BL/6 mice from Harlan Laboratories (the Netherlands)
Note: All mice used in this protocol were between 6 and 12 weeks of age and were sex and age matched for each individual experiment. Three mice were used per group in each experiment.
OVA257-264 and OVA323-339 peptides
Note: Peptides were manufactured by the Protein and Peptide Chemistry Facility (PPCF) of the University of Lausanne.
Iscove's modified Dulbecco's medium (IMDM), GlutaMAX™ supplement (Life Technologies, Gibco®, catalog number: 31980-030 )
Penicillin-Streptomycin (5,000 U/ml) (Life Technologies, Gibco®, catalog number: 15070063 )
2-Mercaptoethanol (2-ME, 55 mM) (Life Technologies, Gibco®, catalog number: 21985-023 )
Fœtal bovine serum (FBS) (performance sera with low endotoxin: qualified, US origin) (Life Technologies, catalog number: 26140 or similar)
Phosphate Buffered Saline (Laboratorium Dr. Bichsel AG)
Poly (I: C) HMW (tlrl-pic) and Imiquimod R837 (tlrl-imq, InvivoGen)
CpG-ODN 1826 (Coley Pharmaceuticals. No longer available. CpG-ODN 1826, tlrl-1826 from InvivoGen can be substitued)
Quil A saponin mix from Quillaja saponaria (Brenntag Nordic A/S)
Cytokine Mouse 10-Plex Panel for Luminex platform (Life Technologies, Novex®, catalog number: LMC0001 ) for use with the Luminex® 100™⁄200™ and FLEXMAP 3D® systems
User manual available online: http://tools.lifetechnologies.com/content/sfs/manuals/LMC0001_Protocol_Rev1.pdf
Complete iscove's modified Dulbecco's medium (cIMDM) (see Recipes)
Equipment
1 ml BD Tuberculin Syringe & 26 g or 27 g x 0.5" BD™ PrecisionGlide needle (Beckton Dickinson, catalog numbers: 3052111 or 305109 )
Falcon™ 24 well, non-treated, flat-bottom tissue culture plates (Corning, catalog number: 351147 )
~40 μm nylon gauze sheets cut into small squares, e.g. Nylon Mesh Lab Pak, 41 Microns Square Opening (Nitex, catalog number: 7050-1220-000-14 ) or Nylon 6 Mesh Sheet, 48 microns Mesh Size (Small Parts, catalog number: B0043D1SCE )
Plunger from 1ml BD™ Tuberculin Syringe (BD, catalog number: 309602 )
Dissection scissors and fine-nosed forceps or tweezers
Falcon™ 96 well, non-treated, U-bottom tissue culture plates (Corning, catalog number: 351177 )
Luminex® 200™ System with xPONENT® Software (Life Technologies, Novex®)
Software
xPONENT® software (Life Technologies, Novex®)
Statistical tests were performed using GraphPad Prism software
Note: The different groups were compared using One-way ANOVA with the Dunnett multiple comparison test, comparing all groups to the peptide alone group.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Perret, R., Sierro, S. R., Botelho, N. K., Corgnac, S., Donda, A. and Romero, P. (2014). Vaccine-induced Cytokine Production Detected by Luminex Multiplex Analysis. Bio-protocol 4(16): e1217. DOI: 10.21769/BioProtoc.1217.
Download Citation in RIS Format
Category
Cancer Biology > Tumor immunology > Biochemical assays
Cancer Biology > Inflammation > Animal models
Immunology > Immune cell function > Cytokine
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,218 | https://bio-protocol.org/exchange/protocoldetail?id=1218&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analysis of Tumor-infiltrating Lymphocytes Following CD45 Enrichment
Rachel Perret
SS Sophie R. Sierro
NB Natalia K. Botelho
SC Stephanie Corgnac
AD Alena Donda
Pedro Romero
Published: Vol 4, Iss 16, Aug 20, 2014
DOI: 10.21769/BioProtoc.1218 Views: 25718
Edited by: HongLok Lung
Reviewed by: Isabel Cristiane da Silva
Original Research Article:
The authors used this protocol in Nov 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2013
Abstract
Measuring antigen-specific T cell responses in the blood and lymphoid organs of vaccinated mice can give us a useful indication of the potency of a vaccine formulation. Unfortunately, systemic or even localized lymphoid T cell responses are not always predictive of the ability of a vaccine to induce tumor protection. Measuring the antigen-specific T cell response within the tumor infiltrating lymphocytes is a more accurate indicator or vaccine efficacy. However, multi-parameter flow cytometric analysis of T cells isolated from tumor tissue can be quite challenging due to the over-whelming number of tumor cells present in relation to the tumor infiltrating lymphocytes (TIL) and to problems associated to the large and adhesive nature of many tumor cell. Here we take advantage of a pre-flow separation of CD45+ leukocytes from the tumor tissue using the MACS magnetic cell sorting system, resulting in a much cleaner cell preparation with which to proceed to flow cytometric staining and analysis.
Keywords: TIL Tumor-infiltrating lymphocytes B16 melanoma CD45 enrichment CD8+ T cells
Materials and Reagents
Cell lines
The B16.OVA melanoma cell line (Fidler, 1975; Schuler et al., 2008) maintained in cDMEM supplemented with G418-sulphate (geneticin selective antibiotic) (at 1 mg/ml)
Note: Adherent cells detached using 0.25 % Trypsin-EDTA.
Mice
All mice used in this protocol were between 6 and 12 weeks of age and were sex and age matched for each individual experiment. Three mice were used per group in each experiment.
CD45.1 congenic (B6.SJL-PtprcaPep3b/BoyJArc), bred in-house at the SPF Animal Facility of the UNIL
OT-I mice (Hogquist et al., 1994)
OT-IIxFoxp3-eGFP mice [referred to as OT-II (Barnden et al., 1998, Wang et al., 2008)] bred in-house at the SPF Animal Facility of the UNIL
Antibodies
Va2 and Vb5.1/5.2 antibodies (BD Biosciences)
CD45 PE antibody (BD Biosciences)
CD45.1 APC-eFluor780 (eBioscience)
CD45.2 pacific blue (eBioscience)
CD8 eFluor700 (eBioscience)
CD4 PE-Texas red (eBioscience)
2.4G2 (Anti-FcgRII monoclonal antibody)
Buffers and media
Dulbecco’s modified Eagle’s medium (DMEM), high glucose, GlutaMAX™ supplement (Life Technologies, Gibco®, catalog number: 10566-016 )
1 M HEPES (Life Technologies, Gibco®, catalog number: 15630-080 )
Penicillin-streptomycin (5,000 U/ml) (Life Technologies, Gibco®, catalog number: 15070063 )
Fœtal bovine serum (FBS). (performance sera with low endotoxin : qualified, US origin) (Life Technologies, catalog number: 26140 or similar)
Geneticin® selective antibiotic (G418 Sulfate, 50 mg/ml) (Life Technologies, Gibco®, catalog number: 15630-080)
0.25% Trypsin-EDTA (1x) (phenol red) (Life Technologies, InvitrogenTM, catalog number: 25200056 )
Phosphate buffered saline (PBS) (Laboratorium Dr. Bichsel AG)
Collagenase, Type I (Life Technologies, Gibco®, catalog number: 17018-029 )
DNAse I (Roche Diagnostics, catalog numner: 0 4536282001 )
UltraPure™ 0.5 M EDTA (pH 8.0) (Life Technologies, InvitrogenTM, catalog number: 15575-020 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A9418 )
Complete Dulbecco’s modified Eagle’s medium (cDMEM) (see Recipes)
Tumor digesting buffer (see Recipes)
Flow Buffer (see Recipes)
MACS Buffer (see Recipes)
Peptides
OVA257-264 and OVA323-339 peptides
Note: Peptides were manufactured by the Protein and Peptide Chemistry Facility (PPCF) of the UNIL.
Adjuvants
Poly (I: C) HMW (tlrl-pic) and Imiquimod R837 (tlrl-imq, InvivoGen)
CpG-ODN 1826 (Coley Pharmaceuticals. No longer available. CpG-ODN 1826, tlrl-1826 from InvivoGen can be substituted.)
Quil A saponin mix from Quillaja saponaria (Brenntag Nordic A/S)
Commercial reagents
CD45 MACS microbeads, mouse (Miltenyi Biotec, catalog number: 130-052-301 )
Datasheet available online: https://www.miltenyibiotec.com/~/media/Images/Products/Import/0001200/IM0001245.ashx
LIVE/DEAD Aqua cell stain (Life Technologies, InvitrogenTM, catalog number: L34957 )
Equipment
Falcon™ 40 µm cell strainer (blue) (Corning, catalog number: 352340 )
1ml BD Tuberculin Syringe & 26 g or 27 g x 0.5" BD™ PrecisionGlide Needle (BD, catalog number: 3052111 or 305109 )
Falcon™ 50 ml conical centrifuge tubes (Corning, catalog number: 352070 )
Falcon™ 15 ml conical centrifuge tubes (Corning, catalog number: 352099 )
Falcon™ 6 well, non-treated, flat-bottom tissue culture (Corning, catalog number: 351147 )
Dissection scissors or scalpel blade and fine-tipped forceps or tweezers
10 ml BD™ syringe (catalog number: 309604 ) with 18 g or 20 g x 1" BD™ PrecisionGlide needle (BD, catalog number: 305195 or 305175 )
Haemocytometer
AutoMACS automatic cell separator (Miltenyi Biotech)
FACSCanto flow cytometers (BD)
Software
FlowJo software for Mac, version 9 software (TreeStar)
Prism Graphpad software
Note: It was used to perform One-way Anova test combined with the Dunnet’s post test for statistical analysis of 3 samples per group, per experiment. Experiments were repeated twice for statistical robustness.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cancer Biology > General technique > Cell biology assays
Immunology > Immune cell function > Antigen-specific response
Immunology > Animal model > Mouse
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,219 | https://bio-protocol.org/exchange/protocoldetail?id=1219&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Metabolite and Fatty Acid Analysis of Yeast Cells and Culture Supernatants
Liwei Chen
WC Wei Ning Chen
Published: Vol 4, Iss 17, Sep 5, 2014
DOI: 10.21769/BioProtoc.1219 Views: 16465
Reviewed by: Claudia CatalanottiAksiniya Asenova
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
Metabolite and fatty acid analysis play important roles in evaluating the metabolic state of microorganisms. To examine the growth state and metabolism response of cells to environmental stress or genetic modification, intracellular and extracellular metabolites including fatty acids are usually analyzed to help understand the cellular biochemical changes in microorganisms. In this protocol, gas chromatography-mass spectrometry based analysis was employed to investigate the fatty acids and other metabolites in yeast cells.
Keywords: Metabolite profiling Fatty acid analysis Saccharomyces cerevisiae
Materials and Reagents
Saccharomyces cerevisiae (S. cerevisiae) cells (EUROSCARF)
Methanol (Sigma-Aldrich, catalog number: 322415 )
Ethanol (Sigma-Aldrich, catalog number: 277649 )
Chloroform (Sigma-Aldrich, catalog number: C2432 )
Acetic acid (Sigma-Aldrich, catalog number: 320099 )
Heptadecanoic acid (Sigma-Aldrich, catalog number: H3500 )
Heptanoic acid (Sigma-Aldrich, catalog number: 75190 )
Ribitol (Sigma-Aldrich, catalog number: A5502 )
Fatty acid methyl esters (FAMEs) mix C8-C24 (Sigma-Aldrich, Supelco, catalog number: 18918 )
10% BF3-methanol (Fluka, catalog number: 15716 )
Hexane (Sigma-Aldrich, catalog number: 34859 )
SPE column (200 mg/3 ml) (Phenomenex, Strata, model: C18-E )
Adapter (Sigma-Aldrich, Supelco, catalog number: 57020-U )
Disposable syringe (Sigma-Aldrich, catalog number: Z116866 )
Sodium chloride (Sigma-Aldrich, catalog number: 746398 )
Methoxyamine hydrochloride (Sigma-Aldrich, catalog number: 226904 )
N-methyl-N-(trimethylsilyl)-trifluoroacetamide (MSTFA) with 1% trimethylchlorosilane (TMCS) (Fluka, catalog number: 69478 )
Agilent Technologies Vial Scr Fix Insert Clr PK100 (Agilent, catalog number: 5188-6591 )
10 mg/ml heptadecanoic acid (see Recipes)
10 mg/ml heptanoic acid (see Recipes)
2 mg/ml ribitol (see Recipes)
Saturated NaCl solution (see Recipes)
Equipment
Glass beads (acid-washed, 425-600 µm) (Sigma-Aldrich, catalog number: G8772 )
Fume hood
SSI 2341-S0S screw cap tubes
10 ml PP conical bottom tubes
HP-5MS capillary column (30 m x 0.250 mm i.d.; film thickness: 0.25 µm) (Agilent)
Centrifugal Evaporator RC10.09 (Thermo Fisher Scientific, catalog number: 11176780 )
Thermostatic Cabinet Lovibond ET619-4 (Tintometer GmbH, catalog number: ET2428210 )
Vortex mixer (CabNet)
Thermo-shaker
Eppendorf centriguge 5810R (10,000 rpm) (Eppendorf)
Thermo scientific Sorvall Legend Micro 21R centrifuge (12,000 rpm-14,000 rpm) (Thermo Fisher Scientific)
30 °C Orbital shaker incubator (Yihder Technology, model: LM-570RD )
NanoDrop 2000c spectrophotometer (Thermo Fisher Scientific)
FastPrep® -24 instrument (MP Biomedicals, model: 6004-500 )
Gas chromatography-mass spectrometry (GC-MS) system (Agilent, model: 7890A-5975C ) with an autoinjector G4513A
Software
Agilent MSD Chemstation data analysis software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chen, L. and Chen, W. N. (2014). Metabolite and Fatty Acid Analysis of Yeast Cells and Culture Supernatants. Bio-protocol 4(17): e1219. DOI: 10.21769/BioProtoc.1219.
Download Citation in RIS Format
Category
Microbiology > Microbial metabolism > Lipid
Cell Biology > Cell metabolism > Lipid
Biochemistry > Lipid > Lipid measurement
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
122 | https://bio-protocol.org/exchange/protocoldetail?id=122&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Intracellular Cytokine (INF-gamma) Staining Assay
HZ Huagang Zhang
Published: Vol 2, Iss 7, Apr 5, 2012
DOI: 10.21769/BioProtoc.122 Views: 35199
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
An intracellular cytokine (INF-gamma) staining assay is used to analyze the function of lymphocytes at the single cell level. By combining surface staining and intracellular cytokine staining, this assay can reveal the percentage of cytokine-releasing cells in a particular population, which cannot be obtained from an ELISpot assay.
Materials and Reagents
PE Rat Anti-Mouse IFN-γ (BD Biosciences, catalog number: 554412 )
PE Rat IgG1 κ Isotype Control (BD Biosciences, catalog number: 554685 )
Note: The above antibodies have been tested by the author and may be substituted with the antibodies desired by users.
BD Cytofix/CytopermTM Fixation/Permeabilization Solution Kit with BD GolgiStopTM (BD Biosciences, catalog number: 554715 )
1x phosphate buffered saline (PBS)
FACS staining buffer (1x PBS, 2% FBS)
Phorbol 12-myristate 13-acetate (PMA) (Sigma-Aldrich, catalog number: 79346 )
Ionomycin (Sigma-Aldrich, catalog number: I9657 )
Equipment
BECKMAN centrifuges and rotor (Beckman Coulter)
Incubator
96 well plates
Falcon round-bottom tubes
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zhang, H. (2012). Intracellular Cytokine (INF-gamma) Staining Assay. Bio-protocol 2(7): e122. DOI: 10.21769/BioProtoc.122.
Download Citation in RIS Format
Category
Immunology > Immune cell staining > Immunodetection
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,220 | https://bio-protocol.org/exchange/protocoldetail?id=1220&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Induction of Connexin-hemichannel Opening
Andrea Puhar
Philippe J. Sansonetti
Published: Vol 4, Iss 17, Sep 5, 2014
DOI: 10.21769/BioProtoc.1220 Views: 8317
Reviewed by: Vanesa Olivares-Illana
Original Research Article:
The authors used this protocol in Dec 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2013
Abstract
Connexins (Cxs) are integral membrane proteins of vertebrates that associate to form hexameric transmembrane channels, named hemichannels. Twenty-one Cx types have been described, which are named according to their molecular weight. Cxs are expressed in many cell types, e.g. epithelial cells, astrocytes and immune cells. Hemichannels allow the passage of molecules of up to 1-2 kDa along the concentration gradient. When surface-exposed, hemichannels mediate the exchange of molecules between the cytosol and the extracellular space. Hemichannels are closed by default, but several cues inducing their opening have been described, e.g. a drop in the extracellular Ca2+ concentration (Evans et al., 2006) or infection with enteric pathogens (Puhar et al., 2013; Tran Van Nhieu et al., 2003). This protocol was used with epithelial cells, in particular with polarized and non-polarized intestinal epithelial TC7 cells and with Hela cells that were stably transfected with Cx26 or Cx43 (Paemeleire et al., 2000). Nevertheless, it could likely be used with other Cx-expressing cell types. Whether hemichannels are open can be determined by electrophysiology or by measuring the release into the extracellular medium of a hemichannel permeable molecule (for example, ATP) or the uptake of a hemichannel-permeable, plasma membrane-impermeant molecule [for example, the fluorescent dye ethidium bromide-see associated protocol “Dye-uptake Experiment through Connexin Hemichannels” (Puhar and Sansonetti, 2014)].
Keywords: Hemichannel Infection Shigella Salmonella Enteropathogenic Escherichia coli (EPEC)
Materials and Reagents
Cell line of interest and assorted cell culture media and plasticware for propagation from supplier of choice
Shigella flexneri (wild-type or mutant of interest) expressing the adhesin AfaE [for example, serotype 5a wild-type strain M90T, serotype 5a non-invasive mxiD- mutant (for negative controls), or serotype 5a ipgD- mutant (upon infection with this strain hemichannels will stay open for extended time)]
Salmonella enterica serovar Typhimurium (for example wild-type strain SL1344)
Enteropathogenic Escherichia coli (EPEC) (for example serotype O127: H6 wild-type strain E2348/69)
Biocoat intestinal epithelium differentiation environment (BD Biosciences, catalog number depends on well size)
DMEM low glucose (Life Technologies, Gibco®, catalog number: A1515401 )
100x MEM non-essential amino acids (Life Technologies, Gibco®, catalog number: 11140050 )
100x 10,000 U/ml penicillin-streptomycin (Life Technologies, Gibco®, catalog number: 15140122 )
Fetal bovine serum (FBS) (heat-inactivated) (Life Technologies, Gibco®, catalog number: 10500056 )
Hank’s buffered salt solution (HBSS) (no phenol red) (Life Technologies, Gibco®, catalog number: 14025092 )
Hank’s buffered salt solution (HBSS) (no calcium, no magnesium, no phenol red) (Life Technologies, Gibco®, catalog number: 14175095 )
10x HBSS stock solutions instead of ready to use HBSS if desired (Life Technologies, Gibco®, catalog numbers: 14065056 and 14185052 )
1 M HEPES (Life Technologies, Gibco®, catalog number: 15630080 )
1 M MgCl2
0.5 M Na-EGTA
Growth media for bacteria [for example Luria-Bertani broth (Life Technologies, catalog number: 10855001 ); Luria-Bertani agar powder prepared according to manufacturer’s instructions (Life Technologies, catalog number: 22700025 ) for Salmonella and EPEC; tryptic soy broth (soybean-casein digest medium, BD, catalog number: 257107 ); tryptic soy agar powder prepared according to manufacturer’s instructions (soybean-casein digest agar medium, Difco, catalog number: 236950 ) for Shigella]
Growth media for bacteria containing Congo red (see Recipes)
Culture medium for propagation of TC7 cells (see Recipes)
Culture medium for propagation of HelaCx26 or HelaCx43 cells (see Recipes)
HBSS solution (see Recipes)
HBSS solution devoid of Ca2+ (see Recipes)
Equipment
Incubator for cell culture
Cover slips of desired size (e.g. 24 well plates) (if desired)
Water bath
Pipettes
Aspiration
Clean bench
Incubator for bacterial cultures
Centrifuge adapted to spin culture plates (for infections with EPEC)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Puhar, A. and Sansonetti, P. J. (2014). Induction of Connexin-hemichannel Opening. Bio-protocol 4(17): e1220. DOI: 10.21769/BioProtoc.1220.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > In vitro model
Microbiology > Microbial biochemistry > Protein
Cell Biology > Cell-based analysis > Transport
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,221 | https://bio-protocol.org/exchange/protocoldetail?id=1221&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Dye-uptake Experiment through Connexin Hemichannels
Andrea Puhar
Philippe J. Sansonetti
Published: Vol 4, Iss 17, Sep 5, 2014
DOI: 10.21769/BioProtoc.1221 Views: 11255
Reviewed by: Vanesa Olivares-Illana
Original Research Article:
The authors used this protocol in Dec 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2013
Abstract
Connexins (Cxs) are integral membrane proteins of vertebrates that associate to form hexameric transmembrane channels, named hemichannels. Twenty-one Cx types have been described, which are named according to their molecular weight. Cxs are expressed in many cell types, e.g. epithelial cells, astrocytes and immune cells. Hemichannels allow the passage of molecules of up to 1-2 kDa along the concentration gradient. When surface-exposed, hemichannels mediate the exchange of molecules between the cytosol and the extracellular space. Hemichannels are closed by default, but several cues inducing their opening have been described, e.g. a drop in the extracellular Ca2+ concentration (Evans et al., 2006) or infection with enteric pathogens (Puhar et al., 2013; Tran Van Nhieu et al., 2003). Hemichannel opening can be measured by electrophysiology, by quantifying the release of a hemichannel-permeable molecule into the extracellular medium or by quantifying the uptake of a hemichannel-permeable, plasma membrane-impermeant molecule. As the extent of uptake of a molecule is proportional to its concentration, exposure time, temperature (these parameters are controlled) and, importantly, to the number of active hemichannels on the cell surface, uptake assays are routinely used to assess hemichannel opening. This protocol for the uptake of the fluorescent dye ethidium bromide was used with Hela cells that were stably transfected with Cx26 or Cx43 (Paemeleire et al., 2000). Nevertheless, it could likely be used with other Cx-expressing cell types.
Materials and Reagents
Cell line of interest and assorted cell culture media and plasticware for propagation from supplier of choice
DMEM low glucose (Life Technologies, Gibco®, catalog number: A1515401 )
100x MEM non-essential amino acids (Life Technologies, Gibco®, catalog number: 11140050 )
100x 10,000 U/ml penicillin-streptomycin (Life Technologies, Gibco®, catalog number: 15140122 )
Fetal bovine serum (FBS) (heat-inactivated) (Life Technologies, Gibco®, catalog number: 10500056 )
Hank’s buffered salt solution (HBSS) (no phenol red) (Life Technologies, Gibco®, catalog number: 14025092 )
Hank’s buffered salt solution (HBSS) (no calcium, no magnesium, no phenol red) (Life Technologies, Gibco®, catalog number: 14175095 )
10x HBSS stock solutions instead of ready to use buffer if desired (Life Technologies, Gibco®, catalog numbers: 14065056 and 14185052 )
1 M HEPES (Life Technologies, Gibco®, catalog number: 15630080 )
1 M MgCl2
0.5 M Na-EGTA
Ethidium bromide solution (here: eurobio, 0.7 mg/ml)
Culture medium for propagation of HelaCx26 or HelaCx43 cells (see Recipes)
HBSS solution (see Recipes)
HBSS solution devoid of Ca2+ (see Recipes)
HBSS stock with ethidium bromide (see Recipes)
Acid washed coverslips (see Recipes)
Equipment
Incubator for cell culture
Cover slips and holder or glass bottom dishes for live cell imaging (e.g. MatTek)
Water bath
Pipettes
Aspiration
Clean bench
Fluorescence microscope (ideally temperature-controlled) equipped with a camera
Software
An image analysis software [e.g. ImageJ (http://imagej.nih.gov/ij/) or MetaMorph (Molecular Devices)]
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Puhar, A. and Sansonetti, P. J. (2014). Dye-uptake Experiment through Connexin Hemichannels. Bio-protocol 4(17): e1221. DOI: 10.21769/BioProtoc.1221.
Download Citation in RIS Format
Category
Cell Biology > Cell-based analysis > Transport
Cell Biology > Cell imaging > Fluorescence
Biochemistry > Protein > Structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,222 | https://bio-protocol.org/exchange/protocoldetail?id=1222&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Purification of the GfsA-3x FLAG Protein Expressed in Aspergillus nidulans
Takuji Oka
YK Yukako Katafuchi
KF Kohsai Fukuda
KE Keisuke Ekino
MG Masatoshi Goto
YN Yoshiyuki Nomura
Published: Vol 4, Iss 17, Sep 5, 2014
DOI: 10.21769/BioProtoc.1222 Views: 8707
Edited by: Fanglian He
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Dec 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2013
Abstract
GfsA is a fungal β-galactofuranosyltransferase involved in the biosynthesis of O-glycan. To investigate the enzymatic functions of GfsA, we attempted to obtain a recombinant protein of this enzyme from two heterologous host organisms. However, GfsA could not be expressed as a recombinant protein in either Escherichia coli (E. coli) or Saccharomyces cerevisiae (S. cerevisiae). Therefore, we decided to employ Aspergillus nidulans (A. nidulans) as the host organism, and produced a strain that expressed 3x FLAG-tagged GfsA using chromosomal tagging. To confirm its expression, a solubilized protein was prepared from the tagged strain and analyzed with an anti-FLAG antibody. The strain that expressed 3x FLAG-tagged GfsA produced a functional protein with a mass of approximately 67 kDa. The method described in this manuscript allows purification of the GfsA-3xFLAG protein as expressed in A. nidulans cells.
Keywords: Galactofuranose Galactofuranosyltransferase Aspergillus Protein purification
Materials and Reagents
Aspergillus nidulans expressing 3x FLAG-tagged GfsA (Komachi et al., 2013)
3x FLAG-peptide (Sigma-Aldrich, catalog number: F4799 )
ANTI-FLAG M2-agarose produced from mouse (Sigma-Aldrich, catalog number: A2220 )
Mouse IgG-agarose (Sigma-Aldrich, catalog number: A0919 )
2-[4-(2-Hydroxyethyl)-1-piperazinyl] ethanesulfonic acid (HEPES) (Dojindo Molecular Technologies, catalog number: GB10 )
Sodium hydroxide (NaOH) (Wako Pure Chemical Industries, catalog number: 198-13765 )
Sodium chloride (NaCl) (Wako Pure Chemical Industries, catalog number: 191-01665 )
Potassium chloride (KCl) (Wako Pure Chemical Industries, catalog number: 163-03545 )
Manganese (II) chloride tetrahydrate (MnCl2) (Wako Pure Chemical Industries, catalog number: 133-00725 )
Glycerol (Wako Pure Chemical Industries, catalog number: 075-00611 )
3-[(3-Cholamidopropyl) dimethylammonio]-2-hydroxypropanesulfonate (CHAPSO) (Dojindo Molecular Technologies, catalog number: C020 )
CompleteTM protease inhibitor cocktail tablets (EDTA-free) (Roche Diagnostics, catalog number: 1873580 )
Liquid nitrogen
Buffer A (see Recipes)
Minimal medium (MM) (see Recipes)
Hutner's trace elements (see Recipes)
Equipment
Spreader
500-ml Sakaguchi flasks
Mortar and pestle
Aspirator
Centrifuge with an angle rotor
Centrifuge with a swing rotor
Ultracentrifuge
Spatula
15-ml plastic centrifuge tube (e.g., Greiner Bio-One GmbH)
4 °C incubator
30 °C incubator
Rotator (e.g., TAITEC)
Filter paper (Munktell & Filtrak GmbH, catalog number: 113053 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Oka, T., Katafuchi, Y., Fukuda, K., Ekino, K., Goto, M. and Nomura, Y. (2014). Purification of the GfsA-3x FLAG Protein Expressed in Aspergillus nidulans. Bio-protocol 4(17): e1222. DOI: 10.21769/BioProtoc.1222.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Expression
Biochemistry > Protein > Labeling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,223 | https://bio-protocol.org/exchange/protocoldetail?id=1223&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of D-galactofuranose Content of Galactomannoproteins in Aspergillus nidulans
Takuji Oka
YK Yukako Katafuchi
KF Kohsai Fukuda
KE Keisuke Ekino
MG Masatoshi Goto
YN Yoshiyuki Nomura
Published: Vol 4, Iss 17, Sep 5, 2014
DOI: 10.21769/BioProtoc.1223 Views: 7790
Edited by: Fanglian He
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Dec 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2013
Abstract
Galactofuranose (Galf) is a component of several polysaccharides and glycoconjugates in certain species of filamentous fungi. Galf residues are frequently found in Aspergillus glycoproteins, including N-glycans and O-mannose glycans that modify many cell wall proteins and extracellular enzymes. It is known that furanoses, contained in oligosaccharides, are detected as pyranoses after hydrolysis, and that D-galactopyranose is not contained in the galactomannoproteins of Aspergillus spp. To determine the levels of D-galactofuranose in galactomannoproteins extracted from Aspergillus nidulans (A. nidulans), we measured the amount of D-galactopyranose production after galactomannoproteins hydrolysis. The method described in this manuscript allows determination of the D-galactofuranose content of galactomannoproteins in Aspergillus spp.
Keywords: Galactofuranose Aspergillus Cell wall Galactomannan
Materials and Reagents
Aspergillus nidulans conidia
Trisodium citrate dihydrate (C6H5Na3O7.2H2O) (Wako Pure Chemical Industries, catalog number: 191-01785 )
Citric acid (C6H8O7) (Wako Pure Chemical Industries, catalog number: 030-05525 )
Ethyl-4-aminobenzoate (C9H11NO2) (ABEE) (Tokyo Chemical Industry, catalog number: A0271 )
Sodium cyanoborohydride (NaBH3CN) (Tokyo Chemical Industry, catalog number: S0396 )
Chloroform (Wako Pure Chemical Industries, catalog number: 038-02606 )
Ethanol (Wako Pure Chemical Industries, catalog number: 050-00446 )
Trifluoroacetic acid (TFA) (Wako Pure Chemical Industries, catalog number: 206-10731 )
Glacial acetic acid (Wako Pure Chemical Industries, catalog number: 012-00245 )
Methanol (Wako Pure Chemical Industries, catalog number: 136-09475 )
D-galactose (Sigma-Aldrich, catalog number: G0750 )
ABEE labeling mixture (see Recipes)
HPLC solvent A (see Recipes)
HPLC solvent B (see Recipes)
Minimal medium (see Recipes)
Hutner's trace elements (see Recipes)
Equipment
50-ml plastic centrifuge tube (e.g., Greiner Bio-One GmbH)
1.5-ml conical screw cap tube and cap
Spreader
500-ml Sakaguchi flasks
Centrifuge
Rotator (e.g., TAITEC)
High-performance liquid chromatography (HPLC) system equipped with a fluorescence detector (Hitachi, LaChrom Elite, model: L-2485) and software for HPLC peak analysis (e.g., Hitachi, model: D-2000 Elite HPLC)
Centrifugal evaporator (e.g., SpeedVac®)
Heat block or water bath
GlycoScope Honenpak C18 column (4.6 mm x 75 mm) (COSMO BIO, catalog number: JOM-J715-1PC)
Filter paper (Munktell & Filtrak GmbH, catalog number: 113053 )
Dialysis membrane (BioDesign Inc. of New York, catalog number: D102 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial biochemistry > Carbohydrate
Microbiology > Microbial metabolism > Carbohydrate
Biochemistry > Carbohydrate > Glycoprotein
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,224 | https://bio-protocol.org/exchange/protocoldetail?id=1224&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Iodine Staining of Escherichia coli Expressing Genes Involved in the Synthesis of Bacterial Glycogen
Ana M. Demonte
Matías D. Asención Diez
Sergio A. Guerrero
Miguel A. Ballicora
Alberto A. Iglesias
Published: Vol 4, Iss 17, Sep 5, 2014
DOI: 10.21769/BioProtoc.1224 Views: 11740
Edited by: Fanglian He
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Dec 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2013
Abstract
The presence of intracellular glycogen can be detected by the following iodine staining technique. Cells with glycogen stain dark brown, whereas in its absence they remain with a pale yellowish color. It is hypothesized that iodine atoms fit into helical coils formed by the α-polyglucan to form a coloured glycogen-iodine complex. Here, we have studied the expression of Streptococcus mutans (S. mutans) genes that control the biosynthesis of this polysaccharide (Asencion Diez et al., 2013). Thus, we expressed glgC and glgD genes coding for both ADP-Glc pyrophosphorylase subunits in Escherichia coli (E. coli) AC70R1-504 cells to complement the deficient accumulation of glycogen by this strain (Iglesias et al., 1993). In control cells or in those where an inactive protein was expressed, the synthesis of the polysaccharide was undetectable by this iodine staining technique.
Keywords: Reserve polysaccharide Bacterial metabolism Qualitative analysis ADP-glucose Glycogenesis
Materials and Reagents
Cells: Non-transformed E. coli AC70R1-504 or harboring plasmids with the S. mutans glgC and glgD genes, separately or combined
Note: This strain has a deficient production of the ADP-glucose pyrophosphorylase enzyme in absence of complementary plasmids (Morán-Zorzano et al., 2007).
Luria-Bertani (LB) liquid medium
Antibiotics: Kanamycin (US Biological, catalog number: K0010 ) and spectinomycin (Sigma-Aldrich, catalog number: S4014 )
Inducers: Isopropyl β-D-1-thiogalactopyranoside (IPTG) (Sigma-Aldrich, catalog number: I6758 ) and nalidixic acid (Sigma-Aldrich, catalog number: N4382 )
Plasmids: pMAB6/glgC, expressing S. mutans glgC (induced by nalidixic acid) and pMAB5/glgD, expressing S. mutans glgD (induced by IPTG)
Note: These plasmids are compatible and bear resistance to spectinomycin and kanamycin, respectively (Asencion Diez et al., 2013).
D(+) Glucose (Sigma-Aldrich, catalog number: G5767 )
Iodine crystals (Biopack Medical, catalog number: 2000162300 )
Equipment
1.5 ml microcentrifuge tube (Deltalab, catalog number: 200400 )
Microcentrifuge (Beckman Coulter, model: 22R )
Shaker (at least 200 rpm) at 37 °C (Thermo Fisher Scientific)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Demonte, A. M., Diez, M. D. A., Guerrero, S. A., Ballicora, M. A. and Iglesias, A. A. (2014). Iodine Staining of Escherichia coli Expressing Genes Involved in the Synthesis of Bacterial Glycogen. Bio-protocol 4(17): e1224. DOI: 10.21769/BioProtoc.1224.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Carbohydrate
Biochemistry > Carbohydrate > Glycogen
Cell Biology > Cell staining > Carbohydrate
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,225 | https://bio-protocol.org/exchange/protocoldetail?id=1225&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Targeted Gene Mutation in Rice Using a CRISPR-Cas9 System
KX Kabin Xie
Bastian Minkenberg
Yinong Yang
Published: Vol 4, Iss 17, Sep 5, 2014
DOI: 10.21769/BioProtoc.1225 Views: 34392
Edited by: Arsalan Daudi
Reviewed by: Fang XuVinay Panwar
Original Research Article:
The authors used this protocol in Nov 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2013
Abstract
RNA-guided genome editing (RGE) using bacterial type II cluster regularly interspaced short palindromic repeats (CRISPR)–associated nuclease (Cas) has emerged as a simple and versatile tool for genome editing in many organisms including plant and crop species. In RGE based on the Streptococcus pyogenes CRISPR-Cas9 system, the Cas9 nuclease is directed by a short single guide RNA (gRNA or sgRNA) to generate double-strand breaks (DSB) at the specific sites of chromosomal DNA, thereby introducing mutations at the DSB by error-prone non-homologous end joining repairing. Cas9-gRNA recognizes targeted DNA based on complementarity between a gRNA spacer (~ 20 nt long leading sequence of gRNA) and its targeted DNA which precedes a protospacer-adjacent motif (PAM, Figure 1). In this protocol, we describe the general procedures for plant RGE using CRISPR-Cas9 system and Agrobacterium-mediated transformation. The protocol includes gRNA design, Cas9-gRNA plasmid construction and mutation detection (genotyping) for rice RGE and could be adapted for other plant species.
Figure 1. Schematic illustration of CRISPR-Cas9 system
Materials and Reagents
Oryza sativa L. ssp japonica, Kitaake, Nipponbare, or other cultivars
Agrobacterium tumefaciens strain EHA105
pRGEB31 (Xie and Yang, 2013) (Addgene plasmid 51295 , plasmid map is shown in Figure 2)
Figure 2. Schematic illustration of pRGE31 and pRGEB31 vectors. The pRGEB31 vector was used in this protocol.
Bsa I (New England Biolabs, catalog number: R0535S )
70%, 100% ethanol
Alkaline phosphatase, calf intestinal (CIP) (New England Biolabs, catalog number: M0290S )
T4 DNA ligase (New England Biolabs, catalog number: M0202S )
T4 polynucleotide kinase (T4 PNK) (New England Biolabs, catalog number: M0201S )
T7 endonuclease I (T7EI) (New England Biolabs, catalog number: M0302S )
GoTaq DNA polymerase (Promega Corporation, catalog number: M3001 )
Phusion high-fidelity polymerase (Thermo Fisher Scientific, catalog number: F530S )
5x green GoTaq® reaction buffer (Promega Corporation, catalog number: M7911 )
QIAGEN plasmid mini kit (QIAGEN, catalog number: 12123 )
QIAquick PCR purification kit (QIAGEN, catalog number: 28104 )
Hexadecyltrimethylammonium bromide (CTAB) (Sigma-Aldrich, catalog number: H9151 )
Sodium lauroyl sarcosinate (sarkosyl) (Thermo Fisher Scientific, catalog number: BP235-500 )
CTAB buffer (see Recipes)
Equipment
37 °C water bath
Thermal cycler
DNA electrophoresis apparatus
Microcentrifuge
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Xie, K., Minkenberg, B. and Yang, Y. (2014). Targeted Gene Mutation in Rice Using a CRISPR-Cas9 System. Bio-protocol 4(17): e1225. DOI: 10.21769/BioProtoc.1225.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > RNA
Molecular Biology > RNA > mRNA translation
Molecular Biology > DNA > Mutagenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,226 | https://bio-protocol.org/exchange/protocoldetail?id=1226&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Mitochondria from Potato Tubers
JH Jesper F. Havelund
Fernanda Salvato
MC Mingjie Chen
RR R.S.P. Rao
AR Adelina Rogowska-Wrzesinska
OJ Ole N. Jensen
DG David R. Gang
JT Jay J. Thelen
IM Ian Max Møller
Published: Vol 4, Iss 17, Sep 5, 2014
DOI: 10.21769/BioProtoc.1226 Views: 17615
Edited by: Tie Liu
Reviewed by: Zhaohui Liu
Original Research Article:
The authors used this protocol in Feb 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2014
Abstract
One way to study the function of plant mitochondria is to extract them from plant tissues in an uncontaminated, intact and functional form. The reductionist assumption is that the components present in such a preparation and the in vitro measurable functions or activities reliably reflect the in vivo properties of the organelle inside the plant cell. Here, we describe a method to isolate mitochondria from a relatively homogeneous plant tissue, the dormant potato tuber. The homogenization is done using a juice extractor, which is a relatively gentle homogenization procedure where the mitochondria are only exposed to strong shearing forces once. After removal of starch and large tissue pieces by filtration, differential centrifugation is used to remove residual starch as well as larger organelles. The crude mitochondria are then first purified by using a step Percoll gradient. The mitochondrial band from the step gradient is further purified by using a continuous Percoll gradient. The gradients remove contaminating amyloplasts and peroxisomes as well as ruptured mitochondria. The result is a highly purified, intact and functional mitochondrial preparation, which can be frozen and stored in liquid nitrogen in the presence of 5% (v/v) dimethylsulfoxide to preserve integrity and functionality for months.
Keywords: Mitochondria Potato Percoll gradient Subcellular localization
Materials and Reagents
Mannitol
3-morpholinopropane-1-sulfonic acid (MOPS)
Potassium hydroxide (KOH)
Bovine serum albumin (BSA)
Ethylenediaminetetraacetic acid (EDTA)
Cysteine
Percoll
Sucrose
Dimethylsulfoxide (DMSO)
Liquid nitrogen
Extraction medium (see Recipes)
Wash buffer (see Recipes)
Gradient buffers (see Recipes)
Percoll gradients (see Recipes)
Equipment
Potato tubers
6 x 250 ml precooled angle rotor (e.g., Beckman Coulter, model: JA-14 or Thermo Fisher Scientific, model: SLA-1500 )
8 x 50 ml pre-cooled angle rotor (e.g., Beckman Coulter, model: JA-20 or Thermo Fisher Scientific, model: SS-34 )
Juice extractor (kitchen appliance, e.g. Maginix Le duo XL)
Centrifuge (for 50 and 250 ml tubes) (e.g. Beckman Coulter or SorvallTM)
Paint brush (soft)
Cotton cloth or nylon net (e.g., mesh 60-120 μm)
Plastic Pasteur pipettes
Beakers
Measuring pipette
pH meter
Potato peeler
Funnel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant cell biology > Organelle isolation
Plant Science > Plant cell biology > Tissue analysis
Cell Biology > Organelle isolation > Mitochondria
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,227 | https://bio-protocol.org/exchange/protocoldetail?id=1227&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Evolution of Escherichia coli to Macrophage Cell Line
Migla Miskinyte
Isabel Gordo
Published: Vol 4, Iss 17, Sep 5, 2014
DOI: 10.21769/BioProtoc.1227 Views: 10277
Edited by: Fanglian He
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Dec 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2013
Abstract
The genomes of species of Escherichia coli (E. coli) show an extraordinary amount of diversity, which include commensal strains and strains belonging to different pathovars. Many strains of E. coli, which can cause mild or severe pathologies in humans, have a commensal ancestor. Understanding the evolutionary changes that can lead to a transition from commensal to pathogen is an important task, which requires integration of different methodologies. One method is experimental evolution of bacteria, in controlled environments, that mimic some of the selective pressures, likely to be important during the transition to pathogenesis. The success of such a transition will depend, at least partially, on ability of E. coli to adapt to the presence of cells of the immune system. Here, we describe a protocol for performing experimental evolution of a commensal strain of E. coli, a derivative of the well studied K12, under the constant selective pressure imposed by cells of the innate immune system, specifically RAW 264.7 murine macrophage cell line.
Keywords: Experimental evolution Fitness Host-microbe
Materials and Reagents
RAW 264.7 murine macrophage cell line (MΦ) (Sigma-Aldrich, catalog number: 91062702 )
E. coli strains, marked with constitutive expression of yellow (YFP) and cyan (CFP) fluorescent proteins (e. g. E. coli- MC4100, galK::CFP/YFP, AmpR StrepR)
RPMI media1640 (Life Technologies, Gibco®, catalog number: 11875-093 )
2-mercaptoethanol solution (Life Technologies, InvitrogenTM, catalog number: 31350-010 )
1 M Hepes buffer (Life Technologies, InvitrogenTM, catalog number: 15630-056 )
100 mM sodium pyruvate (Life Technologies, InvitrogenTM, catalog number: 11360-039 )
Heat-inactivated Fetal Bovine Serum (FBS) (Life Technologies, Gibco®, catalog number: 10500-064 )
GlutaMAX (100X) (Life Technologies, Gibco®, catalog number: 35050-038 )
10,000 U/ml penicillin/streptomycin (Life Technologies, Gibco®, catalog number: 15140-122 )
Streptomycin sulfate salt (Sigma-Aldrich, catalog number: S9137 )
50 mg/ml gentamycin solution (Sigma-Aldrich, catalog number: G1397 )
1x phosphate-buffered saline (PBS)
Trypan Blue solution (Sigma-Aldrich, catalog number: T8154 )
CpG-ODN -1826 (5´-TCCATGACGTTCCTGACGTT-3´) (Sigma-Aldrich)
RPMI-complete media (see Recipes)
RPMI-Strep media (see Recipes)
Equipment
CO2 incubators
Microscope
Luria-Bertani (LB) agar plates (Panreac Life-sciences, catalog number: 596661.1210 )
Centrifuge (Sigma-Aldrich, model: 4K15 with a rotor 11150 )
Neubauer cell counting chamber (VWR International, catalog number: 631-1114 )
Air flow chamber
12-well microtiter plates (Costar, catalog number: 3513 )
Cell culture flasks (25 cm2 and 75 cm2 growth area) (Corning, catalog numbers: 430639 and 430641 )
15 ml Falcon tubes
Cell scrapers (16 cm and 25 cm) (SARSTEDT AG, catalog numbers: 83.1832 and 83.1830 )
2 μm size beads (Sphero AccuCount Blank Particles) (Spherotech, catalog number: ACBP-20-10 )
LSR Fortessa Flow cytometer
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Miskinyte, M. and Gordo, I. (2014). Evolution of Escherichia coli to Macrophage Cell Line. Bio-protocol 4(17): e1227. DOI: 10.21769/BioProtoc.1227.
Miskinyte, M., Sousa, A., Ramiro, R. S., de Sousa, J. A., Kotlinowski, J., Caramalho, I., Magalhaes, S., Soares, M. P. and Gordo, I. (2013). The genetic basis of Escherichia coli pathoadaptation to macrophages. PLoS Pathog 9(12): e1003802.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Bacterium
Microbiology > Microbial genetics > DNA
Molecular Biology > DNA > Genotyping
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,228 | https://bio-protocol.org/exchange/protocoldetail?id=1228&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Fitness Measurements of Evolved Esherichia coli
Migla Miskinyte
Isabel Gordo
Published: Vol 4, Iss 17, Sep 5, 2014
DOI: 10.21769/BioProtoc.1228 Views: 11610
Edited by: Fanglian He
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Dec 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2013
Abstract
Bacteria can adapt very rapidly to novel selective pressures. In the transition from commensalism to pathogenicity bacteria have to face and adapt to the host immune system. Specifically, the antagonistic interaction imposed by one of the first line of defense of innate immunity cells, macrophages, on commensal bacteria, such as Escherichia coli (E. coli), can lead to its rapid adaptation. Such adaptation is characterized by the emergence of clones with mutations that allow them to better escape macrophage phagocytosis. Here, we describe how to quantify the amount of fitness increase of bacterial clones that evolved under the constant selective pressure of macrophages, from a murine cell line RAW 264.7. The most widely used assay for measuring fitness changes along an evolutionary laboratory experiment is a competitive fitness assay. This assay consists of determining how fast an evolved strain outcompetes the ancestral in a competition where each starts at equal frequency. The strains compete in the same environment of the evolution experiment and if the evolved strain has acquired strong beneficial mutations it will become significantly overrepresented in repeated competitive fitness assays.
Keywords: Experimental evolution Host-microbe Fitness
Materials and Reagents
RAW 264.7 murine macrophage cell line (MΦs)
E. coli strains, marked with constitutive expression of yellow (YFP) and cyan (CFP) fluorescent proteins (e.g. E. coli- MC4100, galK::CFP/YFP, AmpRStrepR)
RPMI media1640 (Life Technologies, Gibco®, catalog number: 11875-093 )
2-mercaptoethanol solution (Life Technologies, InvitrogenTM, catalog number: 31350-010 )
1 M HEPES buffer (Life Technologies, InvitrogenTM, catalog number: 15630-056 )
100 mM sodium pyruvate (Life Technologies, InvitrogenTM, catalog number: 11360-039 )
Heat-inactivated fetal bovine serum (FBS)
200 mM L-glutamine (Life Technologies, Gibco®, catalog number: 25030-081 )
10,000 U/ml penicillin/streptomycin (Life Technologies, Gibco®, catalog number: 15140-122 )
Streptomycin sulfate salt (Sigma-Aldrich, catalog number: S9137 )
50 mg/ml Gentamycin solution (Sigma-Aldrich, catalog number: G1397 )
1x Phosphate-buffered saline (PBS)
Trypan blue solution (Sigma-Aldrich, catalog number: T8154 )
CpG-ODN -1826 (Sigma-Aldrich) (5´-TCCATGACGTTCCTGACGTT-3´)
RPMI-complete media (see Recipes)
RPMI-strep media (see Recipes)
Equipment
37 °C, 5% CO2 cell culture incubator
Microscope
Centrifuge (Sigma-Aldrich, model: 4K15 with a rotor 11150)
Neubauer cell counting chamber
Air flow chamber
12-well microtiter plates
Cell culture flasks (25 cm2 and 75 cm2 growth area)
15 ml Falcons tubes
Cell scrapers
2 μm size beads (Sphero AccuCount Blank Particles)
Flow cytometer
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbe-host interactions > Bacterium
Microbiology > Microbial genetics > DNA
Molecular Biology > DNA > Genotyping
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,229 | https://bio-protocol.org/exchange/protocoldetail?id=1229&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Centrifuge Microscopy to Analyze the Sedimentary Movements of Amyloplasts
MT Masatsugu Toyota
NI Norifumi Ikeda
MT Masao Tasaka
MM Miyo Terao Morita
Published: Vol 4, Iss 17, Sep 5, 2014
DOI: 10.21769/BioProtoc.1229 Views: 8851
Edited by: Tie Liu
Reviewed by: Arsalan Daudi
Original Research Article:
The authors used this protocol in Nov 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2013
Abstract
A centrifuge microscope (CMS) functionally consists of a centrifuge producing a centrifugal force (hypergravity condition) and a microscope making an enlarged image of an object. This combination of equipment allows live-cell imaging during centrifugation. We have developed a new CMS (NSK Ltd.) to observe movements of the plant organelles such as amyloplasts, under hypergravity conditions (Toyota et al., 2013). This CMS is distinct from previously designed CMSs in terms of spatio-temporal resolution, ease of use and compactness. Here, we show a quick protocol to prepare a specimen of Arabidopsis inflorescence stem, use the CMS, obtain imaging data and analyze them using a single tracking method.
Materials and Reagents
Arabidopsis thaliana inflorescence stems
MS salt mixture (Wako Pure Chemical Industries, catalog number: 392-00591 )
1% (w/v) sucrose
0.05% (w/v) MES
0.1% (w/v) agar
Growth media (see Recipes)
Equipment
Fine tweezers
Scissors
Razor blade (Electron Microscopy Sciences, catalog number: 72000 )
Kimwipes
Aluminum chamber (custom built) (NSK Ltd.)
Silicone rubber (thickness: 0.5 mm) (AS ONE Corporation, catalog number: 6-611-01 )
Round cover glass (diameter: 12 mm) (Matsunami Glass, catalog number: CO12001 )
CMS system (Figure 1, not commercially available) (NSK Ltd., http://www.nsk.com/)
CMS is a newly designed compact centrifuge microscope, 30 cm in height and 20 cm in diameter. CMS consists of a direct-drive motor (NSK Ltd., MEGATORQUE MOTOR™, model: M-PS1006KN002 ) and optics including a 50x objective lens with a working distance of 18 mm (SLMPLN 50x, 0.35 NA, OLYMPUS), LED light source (SCHOTT MORITEX Corporation, model: MEBL-CW25 ) and a CCD camera (SENSOR TECHNOLOGY, model: STC172C ).
Figure 1. Overview of the CMS system
Windows computer [minimum computer requirements: Windows® XP or later, Pentium M 778 (1.6 GHz), RAM 1024 MB or higher]
Note: To install the software below, Windows computers are highly recommended.
Software
MEGATORQUE MOTOR™ controller (EDC megaterm software) (NSK Ltd., http://www.nsk.com/)
Note: This is free software to control the motor and is available only for Windows.
Video capture software (COREL, http://www.corel.com/)
Note: You can use any video capture soft/hardware that converts analog video signal into digital signal and stores the data in a computer.
G-Track spot-tracking software (G-Angstrom, http://www.g-angstrom.com/eng/products/index.php)
Note: This is a piece of commercial software to trace fluorescence/bright spots and available only for Windows.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Toyota, M., Ikeda, N., Tasaka, M. and Morita, M. T. (2014). Centrifuge Microscopy to Analyze the Sedimentary Movements of Amyloplasts. Bio-protocol 4(17): e1229. DOI: 10.21769/BioProtoc.1229.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell imaging
Plant Science > Plant cell biology > Tissue analysis
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
123 | https://bio-protocol.org/exchange/protocoldetail?id=123&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Probing Yeast Protein Microarrays for Protein-protein Interactions Using V5-epitope Tagged Fusion Protein Probes
JF Joseph Fasolo
MS Michael Snyder
Published: Vol 2, Iss 5, Mar 5, 2012
DOI: 10.21769/BioProtoc.123 Views: 12704
Original Research Article:
The authors used this protocol in Apr 2011
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2011
Abstract
Protein microarray is probably the only technique currently available for systematic investigation of protein-protein interactions. This protocol describes an optimized method to probe yeast protein microarrays for protein-protein interactions using purified V5-epitope tagged fusion protein. It should also apply to any other proteins with appropriate modifications.
Keywords: Kinase Protein-protein interaction Phosphorylation Protein microarray MAP Kinase
Materials and Reagents
Zirconia beads (Biospec Products, catalog number: 11079110zx 1.0mm dia)
His-tag affinity resin (His Spintrap, GE Life sciences, catalog number: 28-4013-53 )
Protein microarray (Life Technologies, catalog number: PAH0525101 )
V5-AlexaFluor 647 antibody (Life Technologies, catalog number: 451098 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
Potassium chloride
Sodium chloride
Triton X-100
Dithiothreitol (DTT) (Promega, catalog number: P1170 )
Phenylmethylsulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: P7626-250MG )
Imidazole (Sigma-Aldrich, catalog number: I5513-5G )
ATP (for kinases)
BSA
Tween-20
Yeast extract
Peptone
Galactose
Yeast nitrogen base
(NH4)2SO4
Raffinose (Sigma-Aldrich, catalog number: R0514-100G )
Agar
Lysis buffer (see Recipes)
Wash buffer 1 (see Recipes)
Wash buffer 2 (see Recipes)
Wash buffer 3 (see Recipes)
Elution buffer (see Recipes)
Probe buffer (see Recipes)
Blocking buffer (see Recipes)
3x YEP-GAL (see Recipes)
Synthetic complete minus uracil media (Sc-ura) (see Recipes)
Equipment
FastPrep Cell Lyser (MP Bio, catalog number: 116004500 - 1 each )
High speed centrifuges
JA-10 (or comparable) rotor
Axon 4200 AL microarray reader
50 ml conical tube
Wheel
Humidified chamber
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Systems Biology > Proteomics > Protein microarray
Microbiology > Microbial proteomics > Whole organism
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,230 | https://bio-protocol.org/exchange/protocoldetail?id=1230&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Gradient Flotation Centrifugation of Chloroplast Membranes
Venkatasalam Shanmugabalaji
FK Felix Kessler
Published: Vol 4, Iss 17, Sep 5, 2014
DOI: 10.21769/BioProtoc.1230 Views: 10816
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Jan 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2013
Abstract
Plastoglobules are lipoprotein particles physically attached to thylakoids in chloroplasts (Kessler et al., 1999). They are mainly composed of polar lipid, neutral lipids, and proteins (Vidi et al., 2006). Here we used simple sucrose gradient flotation centrifugation method to purify the plastoglobules from total chloroplast membranes (Vidi et al., 2007, Shanmugabalaji et al., 2013).
Keywords: Plastoglobule Gradient Chloroplast Membranes Centrifugation
Materials and Reagents
Anti-PGL35 (Agrisera, catalog number: AS06 116 )
Anti-TOC75 (Agrisera, catalog number: AS06 150 )
Anti-LHCB2 (Agrisera, catalog number: AS01 003 )
Na-ascorbate (Sigma-Aldrich, catalog number: 11140 )
BSA fraction V (Sigma-Aldrich, catalog number: 05470 )
PMSF/isopropanol (Sigma-Aldrich, catalog number: P7626 )
Tricine-HCl (Sigma-Aldrich, catalog number: T0377 )
DTT (Sigma-Aldrich, catalog number: 43819 )
HB buffer (see Recipes)
TE buffer (see Recipes)
Equipment
Miracloth (pore size: 22-25 µm) (Merck KGaA, catalog number: 475855 )
Centrifuge with JA-14 rotor
Potter homogenizer
Polycarbonate UltraClear SW28 tube
SW41Ti rotor (Beckman Coulter)
Spectrophotometer
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Shanmugabalaji, V. and Kessler, F. (2014). Gradient Flotation Centrifugation of Chloroplast Membranes. Bio-protocol 4(17): e1230. DOI: 10.21769/BioProtoc.1230.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Organelle isolation
Plant Science > Plant physiology > Photosynthesis
Cell Biology > Organelle isolation > Chloroplast
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,231 | https://bio-protocol.org/exchange/protocoldetail?id=1231&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analysis of L- and D-Amino Acids Using UPLC
YM Yuta Mutaguchi
TO Toshihisa Ohshima
Published: Vol 4, Iss 17, Sep 5, 2014
DOI: 10.21769/BioProtoc.1231 Views: 13241
Download PDF
Ask a question
Favorite
Cited by
Abstract
With the exception of glycine, α-amino acids are optically active, and two optical isomers (L- and D-) of each amino acid can be formed. Recent developments of analytical techniques have revealed that several free D-amino acids such as D-aspartate, D-serine and D-alanine exist in many kinds of organism including human and have biologically important roles. D-Aspartate regulates reproductive activity in animals and humans. D-Serine serves as a co-agonist of the N-methyl-D-aspartate receptor, which mediates glutamatergic neurotransmission. D-Alanine plays a role like osmolyte in crustaceans and mollusks. In this protocol, we describe a method for analysis of L- and D-amino acids using ultra-performance liquid chromatography (UPLC). To analyze D- and L-amino acids, the enantiomers are initially converted into diastereomers (diastereomers are stereoisomers that are not related as object and mirror image and are not enantiomers) using pre-column derivatization with o-phthaldialdehyde plus N-acylated cysteine (N-acethyl-L-cysteine or N-tert-butyloxycarbonyl-L-cysteine). The resultant derivatives are fluorescent diastereomers. This is followed by separation of the resultant fluorescent isoindol derivatives on an octadecylsilyl stationary phase using UPLC, and the fluorescence is detected by a fluorescence detector included in UPLC system. Using this method, 16 kinds of D-amino acid can be analyzed.
Materials and Reagents
N-Acetyl-L-cysteine (NAC) (Wako Pure Chemical Industries, catalog number: 017-05131 )
N-tert-butyloxycarbonyl-L-cysteine (NBC) (Funakoshi, catalog number: 04-621 )
o-Phthaldialdehyde (OPA) (Nacalai Tesque, catalog number: 27824-74 )
Methanol (Wako Pure Chemical Industries, catalog number: 132-06471 )
Acetonitrile (Wako Pure Chemical Industries, catalog number: 015-08633 )
Trichloroacetic acid (Wako Pure Chemical Industries, catalog number: 203-04952 )
Sodium hydroxide (Wako Pure Chemical Industries, catalog number: 192-15985 )
0.4 M sodium borate buffer (see Recipes)
Boric acid (Wako Pure Chemical Industries, catalog number: 021-02195 )
Sodium hydroxide (Wako Pure Chemical Industries, catalog number: 195-13775 )
50 mM sodium acetate buffer (see Recipes)
Acetic acid (Wako Pure Chemical Industries, catalog number: 192-01075 )
Sodium acetate (Wako Pure Chemical Industries, catalog number: 192-01075)
50% TCA (see Recipes)
1 M NaOH (see Recipes)
Equipment
ACQUITY UPLC-FLR system (Waters)
AccQ-Tag Ultra 2.1 x 100 mm column (Waters, catalog number: 186003837 )
ACQUITY binary solvent manager
ACQUITY sample manager
ACQUITY FLR detector
Sample vial: 12 x 32 mm glass screw neck vial, Quick Thread, LectraBond cap, PTFE/silicone septa, Total Recovery (Waters, catalog number: 186000384c )
Empower 2 software
Vortex (Taitec, catalog number: 0061271-000 )
Polytetrafluoroethylene membrane filters (4-mm diameter, 0.2-μm pore size) (Merck KGaA, catalog number: SLLGH04NL )
Amicon Ulta 0.5 ml centrifugal filter 3 K device (Merck KGaA, catalog number: UFC500396 )
Software
Empower 2 software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Protein > Fluorescence
Biochemistry > Protein > Structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,232 | https://bio-protocol.org/exchange/protocoldetail?id=1232&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Axenic Culture of Sclerotinia sclerotiorum and Preparation of Sclerotinia Culture Filtrate Elicitor 1 (SCFE1)-containing Fractions, Triggering Immune Responses in Arabidopsis thaliana
Malou Fraiture
FB Frédéric Brunner
Published: Vol 4, Iss 17, Sep 5, 2014
DOI: 10.21769/BioProtoc.1232 Views: 9181
Edited by: Ru Zhang
Original Research Article:
The authors used this protocol in Oct 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2013
Abstract
The necrotrophic white mold fungus Sclerotinia sclerotiorum (S. sclerotiorum) is pathogenic to a broad range of plant species, including the Brassicaceae model plant Arabidopsis thaliana (Boland and Hall, 1994; Bolton et al., 2006). In Arabidopsis thaliana (A. thaliana), the semi-purified proteinaceous S. sclerotinorum elicitor SCFE1 (Sclerotinia culture filtrate elicitor 1) is sensed at the plasma membrane by the receptor-like protein RLP30 and triggers strong immune responses (Zhang et al., 2013), similar to the bacterial elicitor flagellin (Felix et al., 1999). Elicitation of plant defenses with SCFE1 is a tool to dissect the signaling pathway involving RLP30 and to study immunity to necrotrophic fungi. Here, we describe a simple protocol to axenically grow S. sclerotiorum. Further, we present a two-step liquid chromatography-based method for the partial purification of SCFE1 from culture filtrate (Figure 1A-B). Measurement by gas chromatography of the emission of the plant stress hormone ethylene is proposed as a bioassay to monitor elicitor activity in the fractions throughout the purification procedure (Figure 1C).
Figure 1. Two-step chromatographic fractionation of S. sclerotiorum culture filtrate to obtain semi-purified SCFE1. A. Purification scheme of SCFE1. Crude filtrate (CF) is loaded onto a Sepharose SP cation exchange chromatography column. The eluate (S1) is diluted 10-fold and loaded onto a Source 15S cation exchange chromatography column. Elution is performed with a linear gradient of 0 to 0.3 M KCl and elution fractions of 0.5 ml (F1 - F100) are collected. FT = flow-through. B. Chromatogram of the SCFE1-containing fractions eluted from a Source 15S cation exchange chromatography column. The black line represents the protein elution profile monitored with OD280 nm. The grey line shows the increasing conductivity of the elution buffer. ma.u. = milli-arbitrary units. mS = milli-Siemens. C. Ethylene response in Arabidopsis Col-0 to SCFE1-containing fractions obtained by two-step cation exchange chromatography. Arabidopsis Col-0 leaf pieces are treated with 15 µl CF, undiluted and 10-fold diluted S1 as well as the Source 15S elution fractions (Fx). Treatment with 0.5 µM flg22 is used as a positive control for ethylene production. No treatment and treatment with 15 µl buffers A and B are used as negative controls. In this representative purification, SCFE1 is contained in fractions F24 to F52. Bars represent average values (n=2) ± S.D.
Keywords: Sclerotinia sclerotiorum Elicitor Cation exchange chromatography Ethylene assay Axenic culture
Materials and Reagents
Arabidopsis thaliana Col-0 purchased from ‘Nottingham Arabidopsis Stock Centre’
Sclerotinia sclerotiorum strain 1946 [purchased from the biological resource center ‘Deutsche Sammlung von Mikroorganismen und Zellkulturen’ (DSMZ) GmbH, shipped in a sterile culture tube on agar medium, stored at 15 °C in the dark]
Malt extract (Carl Roth, catalog number: X976.2 )
Peptone from casein (tryptic digest) (Carl Roth, catalog number: 8986.2 )
Agar-agar (bacteriological) (Carl Roth, catalog number: 2266.3 )
Ultrapure H2O (type 1) (filtered with MilliQ Reference purification system) (Merck KGaA)
MES [2-(N-morpholino) ethanesulfonic acid] (Carl Roth, catalog number: 4256.3 )
KCl (Carl Roth, catalog number: P017.1 ) (2 M solution with ultrapure H2O)
Ethanol (Merck KGaA, catalog number: 100983 ) (diluted to 20% with ultrapure H2O)
XK16/20 chromatography column (GE Healthcare, catalog number: 28-9889-37 )
Sepharose SP Fast Flow (GE Healthcare, catalog number: 17-0729-01 ) (stored at 4 °C)
Source 15S 4.6/100 PE column (GE Healthcare, catalog number: 17-5182-01 ) (stored at 4 °C)
GS90 soil (CL Ton Kokos) (Gebrüder Patzer, catalog number: 10-00800-40 )
Vermiculite for plant culture (BayWa AG or Gebrüder Patzer)
Rubber stoppers (Carl Roth, catalog number EC93.1 )
Flg22 peptide from Pseudomonas aeruginosa (Felix et al., 1999) (synthesized, 50 µM, stored at -20 °C)
Malt-peptone-agar (see Recipes)
Malt-peptone medium (see Recipes)
Buffer A (see Recipes)
Buffer B (see Recipes)
Equipment
Petri dishes (94 x 16 mm, with vents) (Greiner Bio-One GmbH, catalog number: 633180 )
Paraffin film (Parafilm M) (Sigma-Aldrich, catalog number: P7793 )
Needle holder (Carl Roth, catalog number: 6189.1 )
Lancets (Carl Roth, catalog number: 6181.1 )
1 L culture flasks (erlenmeyer-shaped, with straight neck and metal caps) (SCHOTT AG, DURAN®, catalog number: 21 771 54 )
Laboratory funnel (minimum 15 cm diameter) (Carl Roth, catalog number: YA51.1 )
Nylon mesh (60 µm pore size) (Carl Roth, catalog number: XA95.1 )
1 L laboratory bottles with screw-cap (SCHOTT AG, DURAN®, catalog number: 21 801 54 5 )
Small silica gel bag
50 ml Falcon conical centrifuge tubes (VWR International, catalog number: 21008-940 )
0.2 µm bottle-top filters for 500 ml (Carl Roth, catalog number: AC20.1 )
Paper scissors
6 ml thick-walled glass test tubes (Carl Roth, catalog number: HA75.1 )
1 ml syringe (B. Braun Melsungen AG, Omnifix-F Tuberculin, catalog number: 9161406V )
Syringe needle (27 Ga. x ¾ in., size 20) (B. Braun Melsungen AG, Sterican, catalog number: 4657705 )
Spatula (Carl Roth, catalog number: YK51.1 )
1.5 ml reaction tubes with caps (VWR International, catalog number: 700-5239 )
MilliQ Reference purification system (Merck KGaA, catalog number: Z00QSV001 )
Laminar flow clean bench
15 °C incubator
Front-loading lyophilizer of at least 10 L capacity with basins (e.g. L10, WKF-Gesellschaft für elektrophysikalischen Apparatebau, not produced anymore)
Floor-standing high-speed centrifuge (e.g. Sorvall RC-5B Plus Superspeed centrifuge and Sorvall SLA-1500 Superlite rotor with adapters for 50 ml Falcon conical centrifuge tubes, Thermo Fisher Scientific Inc., not produced anymore)
Vacuum pump (Gardner Denver, Welch, catalog number: 2522C-02 )
4 °C cold lab chamber or cold room
ÄKTA Explorer 10 liquid chromatography system (GE Healthcare, catalog number: 18-1300-00 ) equipped with:
Pump P-900
Sample pump P-960 (GE Healthcare, catalog number: 18-6727-00 )
Monitor UV-900 (GE Healthcare, catalog number: 18-1108-35 )
Monitor pH/C-900 (GE Healthcare, catalog number: 18-1129-74 )
Fraction collector Frac-950 (GE Healthcare, catalog number: 18-6083-00 )
Rack A for 18/30 mm tubes (GE Healthcare, catalog number: 18-6083-11 )
Rack B for 12 mm tubes (GE Healthcare, catalog number: 18-6083-12 )
Unicorn control software (version 4.12 or more)
Plant growth chamber (controlled light, temperature and humidity)
Gas chromatograph with Al2O3-column and flame-ionization detector (e.g. GC-14A with analysis unit C-R4AX Chromatopac, Shimadzu Deutschland GmbH, not produced anymore)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Fraiture, M. and Brunner, F. (2014). Axenic Culture of Sclerotinia sclerotiorum and Preparation of Sclerotinia Culture Filtrate Elicitor 1 (SCFE1)-containing Fractions, Triggering Immune Responses in Arabidopsis thaliana. Bio-protocol 4(17): e1232. DOI: 10.21769/BioProtoc.1232.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Perception and signaling
Microbiology > Microbe-host interactions > In vivo model
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,233 | https://bio-protocol.org/exchange/protocoldetail?id=1233&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Activity Assays for Bacteriophage Endolysin PlyPy
Rolf Lood
Vincent A. Fischetti
Published: Vol 4, Iss 18, Sep 20, 2014
DOI: 10.21769/BioProtoc.1233 Views: 10320
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Jun 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2014
Abstract
Bacterial viruses (bacteriophages) escape and kill their host by degrading the bacterial peptidoglycan layer through the mechanism of enzymes called endolysins: peptidoglycan degrading enzymes. The method included here is useful for the initial characterization of any endolysin, regardless of the specific catalytic domain (as long as the activity results in a reduction in the optical density), in order to determine its optimal enzymatic (lytic) activity. This protocol is specific for the Streptococcus pyogenes phage endolysin PlyPy, but can be adapted for any peptidoglycan degrading enzyme.
Keywords: Phage lysins Lysis Lytic activity Cell wall hydrolase Peptidoglycan cleavage
Materials and Reagents
Streptococcus pyogenes (S. pyogenes) strain MGAS 3 15
Purified phage lysin PlyPy (or other lysins of interest)
Brain heart infusion (BHI) broth (BD, catalog number: 237500 )
Agar (BD, catalog number: 214010 )
Tris (Thermo Fisher Scientific, catalog number: BP152-1 )
HCl (Thermo Fisher Scientific, catalog number: A144S-500 )
CaCl2.2H2O (Thermo Fisher Scientific, catalog number: C70-500 )
MgCl2.7H2O (AMRESCO, catalog number: 0288-100G )
ZnCl2 (Fluka, catalog number: 96468-50G )
DTT (Sigma-Aldrich, catalog number: D0632-10G )
Sodium acetate (Thermo Fisher Scientific, catalog number: S210-500 )
NaCl (Thermo Fisher Scientific, catalog number: S271-3 )
PlyPy activity buffer (see Recipes)
Equipment
37 °C incubator
Spectrophotometer (Bio-Rad Laboratories, SmartSpecTM, model: 3000 )
Table centrifuge (Eppendorf, model: 5810 R )
pH meter (Thermo Fisher Scientific, AccumetTM, model: 15)
15 ml tubes (Falcon®, catalog number: 352097 )
50 ml tubes (Falcon®, catalog number: 352098 )
Cuvettes (Sarstedt AG, catalog number: 67.742 )
96-well flat bottom plates (Falcon®, catalog number: 35-1172 )
96-well plate reader (Molecular Devices, SpectraMax Plus Reader)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbe-host interactions > Virus
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,234 | https://bio-protocol.org/exchange/protocoldetail?id=1234&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Transcription (IVT) and tRNA Binding Assay
Sonja MK Schoenfelder
Published: Vol 4, Iss 18, Sep 20, 2014
DOI: 10.21769/BioProtoc.1234 Views: 14697
Edited by: Fanglian He
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Sep 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2013
Abstract
This protocol describes the coupling of (i) “live” in vitro RNA transcription with (ii) binding by a radiolabeled, pre-formed tRNA followed by native gel electrophoresis and phosphorimager scan to visualize the complex. The necessity arose from the stable structure that one RNA forms in the absence of its interaction partner. The T-box leader RNA, a transcription control system, folds into a thermodynamically very stable stem-loop structure without the tRNA present, which makes in vitro binding interaction of both pre-formed RNAs very difficult. I therefore adjusted the binding assay to mimic the “natural” situation in the bacterial cell, where the pre-formed, stable tRNA is already present while the T-box leader RNA is actively transcribed by the RNA polymerase. The first part of the protocol also describes the in vitro transcription and labeling of the tRNA.
Keywords: T-box EMSA RNA-RNA interaction TRNA In vitro transcription
Materials and Reagents
For in vitro transcription (IVT) in general
T7 RNA polymerase including 5x T7 transcription buffer (Thermo Fisher Scientific, Fermentas, catalog number: EP0111 )
RiboLock RNase inhibitor (Thermo Fisher Scientific, Fermentas, catalog number: EO0381 )
100 mM of ATP, UTP, GTP, CTP (NTP set) (Thermo Fisher Scientific, Fermentas, catalog number: R0481 )
Recombinant DNase I (Life Technologies, Ambion®, catalog number: AM2235 )
RNase-free water (Life Technologies, Ambion®, catalog number: AM9932 )
[alpha 32P]-CTP (800 Ci/mmol, 10 µCi/µl) (PerkinElmer, catalog number: BLU008X )
1x T7 transcription buffer (see Recipes)
Note: Templates will be generated by PCR, so all reagents for PCR are needed, too.
For tRNA IVT in particular
MinElute PCR Purification Kit (QIAGEN, catalog number: 28004 )
Guanosine 5’-monophosphate disodium salt hydrate from yeast (GMP) (as 100 mM stock solution in RNase-free water) (Sigma-Aldrich, catalog number: G8377 )
Bio-Spin chromatography columns, Bio-Gel P-6 in Tris buffer (Bio-Rad Laboratories, catalog number: 732-6227 )
OptiPhase Supermix liquid scintillation cocktail (PerkinElmer, catalog number: 1200-439 )
Microbeta Starter kit plates (PerkinElmer, catalog number: 1450-486 )
For denaturing Urea-PAGE
Urea (Sigma-Aldrich, catalog number: U6504 )
Rotiphorese 40% acrylamide/bis-acrylamide (19:1) solution (Carl Roth, catalog number: 3030.1 )
Ammonium persulfate (APS) (Sigma-Aldrich, catalog number: 215589 ) [as 10% (w/v) solution in RNase-free water]
N,N,N’,N’-Tetramethylethylenediamine (TEMED) (Sigma-Aldrich, catalog number: T9281 )
2x MOPS buffer (e.g. Life Technologies, Ambion®, catalog number: AM9570 )
Formamide (e.g. Life Technologies, Ambion®, catalog number: AM9342 )
Formaldehyde (e.g. Sigma-Aldrich, catalog number: F8775 )
Saccharose (e.g. Sigma-Aldrich, catalog number: S7903 )
Bromophenol blue (e.g. Sigma-Aldrich, catalog number: B0126 )
Xylencyanol (e.g. Sigma-Aldrich, catalog number: X4126 )
1x TBE buffer (see Recipes)
2x RNA loading dye (see Recipes)
For native polyacrylamide gel electrophoresis (PAGE)
40% acrylamide/bis-acrylamide (19:1) solution, APS and TEMED as listed in C
Glycerol (e.g. Sigma-Aldrich, catalog number: G5516 )
Tris (e.g. Sigma-Aldrich, catalog number: T1503 )
Boric acid (e.g. Sigma-Aldrich, catalog number: B7901 )
EDTA (e.g. Sigma-Aldrich, catalog number: E9884 )
0.5x TBE buffer (see Recipes)
10x loading buffer (see Recipes)
Equipment
Basic lab equipment for molecular biology with emphasis on RNase-free
0.5 ml RNase-free microfuge tubes (Applied Biosystems®, catalog number: AM12300 )
1.5 ml RNase-free microfuge tubes (Applied Biosystems®, catalog number: AM12400 )
Microliter pipettes (e.g. Eppendorf) with tips and 15 ml or 50 ml tubes (e.g. SARSTEDT AG)
Table-top centrifuge (e.g. Microcentrifuge, Eppendorf, catalog number: 5425 )
Heating block for 1.5 ml and 0.5 ml tubes (e.g. Grant Instruments, Grant bio PCH-1 personal benchtop cooler/heaters)
Note: Templates will be generated by PCR, so a standard PCR thermo cycler is needed, too.
Lab equipment in designated area for radioactive work
Liquid scintillation counter (PerkinElmer, model: 1450 LSC & Luminescence counter)
Electrophoresis chamber, glass slides, spacers, clamps and combs for vertical PAGE (e.g. C.B.S. Scientific, catalog number: WSP2-SG-200 ), power supply (e.g. C.B.S. Scientific, catalog number: EPS-200-X)
Plastic wrap, transparent sheets and Whatman paper (e.g. Sigma-Aldrich, catalog number: Z742422 )
Gel dryer (Model 583 Gel Dryer) (Bio-Rad Laboratories, catalog number: 165-1746 ) with vacuum pump
PhosphorImager (Fujifilm FLA-7000) (GE Healthcare, catalog number: 28-9558-09 ) and PhosphorImager screen (storage phosphor screens) (VWR International, catalog number: 28-9564 ) in cassette (VWR International, catalog number: 63-0035 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Schoenfelder, S. M. (2014). In vitro Transcription (IVT) and tRNA Binding Assay. Bio-protocol 4(18): e1234. DOI: 10.21769/BioProtoc.1234.
Schoenfelder, S. M., Marincola, G., Geiger, T., Goerke, C., Wolz, C. and Ziebuhr, W. (2013). Methionine biosynthesis in Staphylococcus aureus is tightly controlled by a hierarchical network involving an initiator tRNA-specific T-box riboswitch. PLoS Pathog 9(9): e1003606.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > RNA
Molecular Biology > RNA > Transcription
Molecular Biology > RNA > RNA labeling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,235 | https://bio-protocol.org/exchange/protocoldetail?id=1235&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Gentamicin Protection Assay to Determine Bacterial Survival within Macrophages
SS Sargurunathan Subashchandrabose
HM Harry L.T. Mobley
Published: Vol 4, Iss 18, Sep 20, 2014
DOI: 10.21769/BioProtoc.1235 Views: 22448
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Dec 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2013
Abstract
Macrophages are key cells involved in orchestrating host defense against infections. Here, we describe the protocol for a bacterial killing assay in macrophages that can be adapted to any bacterial pathogen. Using this assay, we analyzed the survival of wild-type and mutant strains of Escherichia coli (E. coli) within RAW 264.7 cells, a widely used macrophage cell line. Bacterial mutants defective in intracellular survival within macrophages can be delineated using this assay.
Materials and Reagents
RAW 264.7 cells (ATCC, TIB-71 )
E. coli CFT073 or other strains of bacteria
LB broth (Beckton Dickinson, catalog number: 244610 )
Agar (Beckton Dickinson, catalog number: 214010 )
RPMI1640 (Life Technologies, catalog number: 11875-093 )
Gentamicin 50 mg/ml (Life Technologies, catalog number: 15750-102 )
PBS (pH 7.4)
LB plates (see Recipes)
Certified, heat inactivated fetal bovine serum (FBS) (Life Technologies, catalog number: 10082139 ) (see Recipes)
100x penicillin, streptomycin and glutamine (PSG) (Life Technologies, catalog number: 10378-016 ) (see Recipes)
Saponin (Sigma-Aldrich, catalog number: 8047-15-2) (see Recipes)
Equipment
24 well plates (Corning, Costar®, catalog number: 3524 )
0.22 micron filter (Millipore, catalog number: SCGP00525 )
37 °C, 5% CO2 incubator
Sorvall Legend RT table top centrifuge
Shimadzu UV-1601PC Spectrophotometer
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Antimicrobial assay > Killing assay
Microbiology > Microbe-host interactions > In vitro model
Immunology > Host defense > General
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,236 | https://bio-protocol.org/exchange/protocoldetail?id=1236&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Dimethylmethylene Blue Assay (DMMB)
Vivien Jane Coulson- Thomas
TG Tarsis Ferreira Gesteira
Published: Vol 4, Iss 18, Sep 20, 2014
DOI: 10.21769/BioProtoc.1236 Views: 61499
Original Research Article:
The authors used this protocol in Oct 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Oct 2013
Abstract
Glycosaminoglycans (GAGs) are long unbranched polysaccharides consisting of repeating disaccharide units composed of a hexosamine (glucosamine or galactosamine) and a hexuronic acid (glucuronic or iduronic acid). Depending on the disaccharide unit the GAGs can be organized into five groups: chondroitin sulfate, dermatan sulfate, heparan sulfate, keratan sulfate and hyaluronic acid. The GAGs are heterogeneous molecules with great variability in molecular mass and both sulfation density and pattern. Spectrophotometric assays to measure the GAG content in biological fluids and tissue/cell extracts are valuable tools. The dye 1,9-dimethylmethylene is a thiazine chromotrope agent that presents a change in the absorption spectrum due to the induction of metachromasia when bound to sulfated GAGs enabling rapid detection of GAGs in solution (Whitley et al., 1989; Chandrasekhar et al., 1987; Farndale et al., 1982). Moreover, there is a window in which a linear curve may be drawn (approximately between 0.5-5 μg of GAGs) enabling the quantification of GAGs in solution.
Keywords: Glycosaminoglycan quantification Proteoglycans Sulfated Glycosaminoglycan
Materials and Reagents
Dimethylmethylene blue (DMMB) (Sigma-Aldrich, catalog number: 341088 )
NaCl
Glycine (Sigma-Aldrich, catalog number: 410225 )
Glacial acetic acid (Sigma-Aldrich, catalog number: S7653 )
Tris-Base (Merck KGaA, catalog number: 648310 )
Bovine chondroitin 4-sulfate as standard (Sigma-Aldrich, catalog number: C9819 )
DMMB reagent (see Recipes)
Equipment
Plate mixer (VWR International, catalog number: 89202-332 )
Cover adhesive (R&D Systems, catalog number: DY992 )
Microplate reader with 525 nm (BioTek Instruments, catalog number: 11-120-531 )
96 well microplate spectrophotometer with 525 nm filter set (Thermo Fisher Scientific, catalog number: 51119200 )
Microplate shaker (VWR International, catalog number: 97043-608 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Coulson-Thomas, V. J. and Gesteira, T. F. (2014). Dimethylmethylene Blue Assay (DMMB). Bio-protocol 4(18): e1236. DOI: 10.21769/BioProtoc.1236.
Download Citation in RIS Format
Category
Biochemistry > Carbohydrate > Glycoprotein
Biochemistry > Carbohydrate > Polysaccharide
Cell Biology > Cell staining > Carbohydrate
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
2 Q&A
The table is wrong: 20ul of std stock (500 ug/ml) refers 10 ug std in 20ul added, the std concentration is still 500ug/ml, not 10ug/ml
0 Answer
5 Views
Dec 27, 2024
what amount of tris-base do you put in the making of the DMMB reagent?
0 Answer
8 Views
Mar 7, 2024
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,237 | https://bio-protocol.org/exchange/protocoldetail?id=1237&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protein-lipid Interaction Analysis by Surface Plasmon Resonance (SPR)
Olga Lucia Baron
David Pauron
Published: Vol 4, Iss 18, Sep 20, 2014
DOI: 10.21769/BioProtoc.1237 Views: 13122
Edited by: Fanglian He
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Dec 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2013
Abstract
Interactions of lipids with proteins are essential events in the framework of biological membranes. Assessment of the affinity and specificity of protein-lipid binding can give useful information to elucidate cell membrane functions. Surface Plasmon Resonance (SPR) is a powerful technology to study macromolecular interactions, allowing direct and rapid determination of association and dissociation rates using small amounts of samples. An extensive range of binding analyses can be performed by SPR such as protein–protein, protein–membrane (lipids), protein–carbohydrate, protein–nucleic acid and even protein-small molecules. This protocol describes the binding of an antimicrobial protein (used as ligand) to a lipopolysaccharide (LPS) (used as analyte) after immobilization onto a CM sensor chip by amine coupling.
Materials and Reagents
Purified protein as ligand (purity >90%) (1 ml at minimum 20 µg/ml)
Purified Lipid as analyte (minimum 300 µl at 2 mg/ml)
10 mM acetate buffer (pH 4 to 5.5) (GE Healthcare, catalog numbers: BR-1003-49 to 52)
Filtered deionized water
200 mM NaOH
HBS-EP buffer (GE Healthcare, catalog number: BR-1001-88 ) (see Recipes)
Amine coupling kit components (GE Healthcare, catalog number: BR-10000-50 ) (see Recipes)
Regeneration scouting kit components (GE Healthcare, catalog number: BR-1005-56 ) (see Recipes)
Equipment
Biacore 3000 system (GE Healthcare)
CM 5 sensor chip with carboxyl groups available for the amine coupling reaction (research grade) (GE Healthcare, catalog number: BR-1003-99 )
Glass vials (9 mm)
Glass vials (16 mm)
1.5 ml centrifuge tubes
Sonicator (Branson Bath-type ultrasonicator, model: 5510 )
Software
BiaEvaluation software (GE Healthcare)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Baron, O. L. and Pauron, D. (2014). Protein-lipid Interaction Analysis by Surface Plasmon Resonance (SPR). Bio-protocol 4(18): e1237. DOI: 10.21769/BioProtoc.1237.
Baron, O. L., van West, P., Industri, B., Ponchet, M., Dubreuil, G., Gourbal, B., Reichhart, J. M. and Coustau, C. (2013). Parental transfer of the antimicrobial protein LBP/BPI protects Biomphalaria glabrata eggs against oomycete infections. PLoS Pathog 9(12): e1003792.
Download Citation in RIS Format
Category
Biochemistry > Lipid > Lipid-protein interaction
Biochemistry > Lipid > Lipid binding
Biochemistry > Protein > Interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,238 | https://bio-protocol.org/exchange/protocoldetail?id=1238&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Extraction of Chloroplast Proteins from Transiently Transformed Nicotiana benthamiana Leaves
JK Joern Klinkenberg
Published: Vol 4, Iss 18, Sep 20, 2014
DOI: 10.21769/BioProtoc.1238 Views: 19331
Edited by: Tie Liu
Reviewed by: Sam-Geun Kong
Original Research Article:
The authors used this protocol in Feb 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2014
Abstract
This rapid protocol allows the extraction of chloroplast enriched proteins from Nicotiana benthamiana (N. benthamiana) leaves that were transiently transformed to express an epitope tagged protein of interest. Thus, it can serve as a tool to study the chloroplastidic localization of the protein of interest when it is combined with western-blot analysis.
Agrobacterium-mediated transformation (Agroinfiltration, Romeis et al., 2001) is used to transiently express a protein carrying an epitope tag in tobacco leaves. Here, co-infiltration with an Agrobacterium strain harboring 19 K from soil-borne wheat mosaic virus suppresses posttranscriptional gene silencing and therefore increases transformation efficiency (Te et al., 2005).
The chloroplast isolation of the transformed leaves is based with modifications on Romeis et al. (2001), and includes mechanical breakage of cell wall and membranes, the removal of unbroken tissue by filtration and the separation of intact chloroplasts by centrifugation through a Percoll layer.
Materials and Reagents
Nicotiana benthamiana plants
Agrobacterium tumefaciens (A. tumefaciens) strain GV3101 carrying a recombinant binary plasmid with the gene of interest fused to an epitope tag
Agrobacterium tumefaciens strain GV3101 harboring K19 (Te et al., 2005)
Tryptone (AppliChem GmbH, catalog number: 403682 .1210)
Yeast extract (AppliChem GmbH, catalog number: A1552 , 0500)
Sucrose (AppliChem GmbH, catalog number: A2211 , 0500)
MgSO4 (Merck KGaA, catalog number: 105886 )
Appropriate antibiotic
Agar (Carl Roth, catalog number: 2266.2 )
Acetosyringone (Sigma-Aldrich, catalog number: D134406 )
MES buffer (Carl Roth, catalog number: 4256.3 )
Liquid nitrogen
Percoll (GE healthcare, catalog number: 17-0891-01 )
EDTA (Carl Roth, catalog number: 8040.1 )
DTT (AppliChem GmbH, catalog number: A2948 )
MgCl2 (Merck KGaA, catalog number: 105833 )
Glycerol (AppliChem GmbH, catalog number A3739 ,0500)
Hepes (Carl Roth, catalog number: 9105 )
Sorbitol (Merck KGaA, catalog number: 56755 )
Serum bovine albumin (Carl Roth, catalog number 8076.2 )
Protease inhibitor cocktail Complete Mini EGTA-free (Roche Diagnostics, catalog number: 11 836 153 001 )
YEP medium (see Recipes)
Agromix buffer (see Recipes)
Isolation buffer (see Recipes)
Protein extraction buffer (see Recipes)
Equipment
1 ml syringe (Terumo Medical Corporation, catalog number: BS-01H )
Centrifuge cooled at 4 °C
47 μm nylon mesh (Carl Roth, catalog number: XA63.1 )
2 ml glass homogenizer with round bottom shape (A. Hartenstein, catalog number: HOG2 )
Light microscope with phase contrast condenser and phase contrast compatible objective lens, such as Objective LD A-Plan 40x/0.5 Ph2 (ZEISS)
Incubator shaker
Rotary shaker
Photospectrometer for OD600
1.5 ml reaction tubes (SARSTEDT AG, catalog number 72.706 )
50 ml conical centrifuge tubes (SARSTEDT AG, catalog number 62.548.004 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant cell biology > Organelle isolation
Plant Science > Plant biochemistry > Protein
Cell Biology > Organelle isolation > Chloroplast
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,239 | https://bio-protocol.org/exchange/protocoldetail?id=1239&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Thin Sections of Technovit 7100 Resin of Rice Endosperm and Staining
Ryo Matsushima
Published: Vol 4, Iss 18, Sep 20, 2014
DOI: 10.21769/BioProtoc.1239 Views: 14010
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Feb 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2014
Abstract
Starch is a biologically and commercially important carbohydrate that is accumulated in plant storage organs, such as seed endosperm. Starch is water-insoluble and forms transparent grains, referred to as starch grains (SGs). SGs are easily stained by iodine solution and can be observed under a normal microscope. Technovit 7100 resin is suitable for preparation of thin sections from endosperm. The thin sections and iodine staining can visualize SGs clearly inside the endosperm cell. This protocol provides the procedures to prepare thin sections of Technovit 7100 resin from rice endosperm. It can also be applicable to the seeds of other plant species.
Figure 1. Iodine-stained Technovit thin sections of matured endosperm cells in rice and barley. Starch grains (SGs) can be visualized as violet particles.
Materials and Reagents
Rice seeds
Technovit 7100 resin (Heraeus Kulzer)
Lugol solution (MP Biomedicals, catalog number: 155269 )
Formalin
Acetic acid
99.5% ethanol (commercially available one)
Instant adhesives (Aron alpha, Toagosei Co.)
FAA solution (see Recipes)
100% ethanol (see Recipes)
100% Technovit 7100 (I) (see Recipes)
25% Technovit 7100 resin (I) (see Recipes)
50% Technovit 7100 resin (I) (see Recipes)
75% Technovit 7100 resin (I) (see Recipes)
100% Technovit 7100 (II) (see Recipes)
Equipment
Silanized slides (Dako, catalog number: S3003 )
Wooden dowels (6 x 25 mm)
Razor blade (Feather, catalog number: FH-10 )
1.5 ml plastic tube
0.2 ml PCR tube
Molecular sieves 4A 1/16 (Nacalai tesque, catalog number: 04172-95 )
Ultramicrotome (Leica Microsystems, model: EM UC7 )
Diamond knife (Diatome AG, Ultra trim, 3.0 mm)
Rotator (TAITEC, model: RT-30mini )
Forceps (Vigor, stainless steel #5)
Aspirator (Ulvac, model: MDA-015 )
Microscope (OLYMPUS, model: AX70 )
Figure 2. A wooden dowel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Matsushima, R. (2014). Thin Sections of Technovit 7100 Resin of Rice Endosperm and Staining. Bio-protocol 4(18): e1239. DOI: 10.21769/BioProtoc.1239.
Matsushima, R., Maekawa, M., Kusano, M., Kondo, H., Fujita, N., Kawagoe, Y. and Sakamoto, W. (2014). Amyloplast-localized SUBSTANDARD STARCH GRAIN4 protein influences the size of starch grains in rice endosperm. Plant Physiol 164(2): 623-636.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Tissue analysis
Plant Science > Plant cell biology > Cell imaging
Biochemistry > Carbohydrate > Polysaccharide
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
124 | https://bio-protocol.org/exchange/protocoldetail?id=124&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protein-ligand Binding Assay by Liquid Chromatography-Mass Spectrometry
Xiyan Li
Published: Aug 20, 2011
DOI: 10.21769/BioProtoc.124 Views: 16797
Download PDF
Ask a question
Favorite
Cited by
Abstract
Protein-small molecule binding coefficients are determined by quantitative LC-MS in this method. Traditional biochemical plot is consequently used to set up the binding curve between a known protein and a small molecule (<1000 Da) to determine the affinity constant (Kd) and the stoichiometry (Bmax).
Keywords: Ligand binding LC-MS Molecular filtration Protein interaction Binding Curve
Materials and Reagents
Purified protein (preferred in solution without any detergent like Tween, Triton, etc., concentration > 1 mM)
Small molecule standard (best of highest available purity/grade, dissolved in the same solution used for proteins, in a 2-fold series of 10x desired concentration)
Note: To minimize organic solvent effect on binding, the stock solution has to be diluted in the same series in organic solvent first, and then mixed into the aqueous solution to make final standards.
Zeba spin desalting columns micro (Pierce Antibodies, catalog number: 89877 and 89878 )
Methanol (mass spec grade)
Equipment
Microcentrifuge
Quantitative LC-MS (such as HPLC-coupled triple quad)
Eppendorf Protein LoBind tubes (0.5 ml and 1.5 ml)
LCQuan software (Thermo Fisher Scientific)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Systems Biology > Interactome > Protein-ligand interaction
Biochemistry > Protein > Interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,240 | https://bio-protocol.org/exchange/protocoldetail?id=1240&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation and FACS Analysis on Mononuclear Cells from CNS Tissue
KM Kingston H.G. Mills
RM Róisín M. McManus
LD Lara Dungan
Published: Vol 4, Iss 18, Sep 20, 2014
DOI: 10.21769/BioProtoc.1240 Views: 12759
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Mar 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2013
Abstract
Immune cells, such as microglia are resident in the brain and spinal cord of normal mice and humans. Furthermore, macrophages, dendritic cells, T cells, B cells and NK cells infiltrate the CNS during certain infections or in neurodegenerative/neuroinflammatory diseases, such as experimental autoimmune encephalomyelitis (EAE) (a model for multiple sclerosis) or Alzheimer’s disease (Sutton et al., 2009; Browne et al., 2013). Infiltrating cells can be identified using immunohistological staining of sections from brain or spinal cords. However, more detailed phenotypic and functional analysis is possible following isolation of the immune cells from the CNS of normal or diseased mice. Purification of mononuclear cells from brain or spinal cord is dependent on perfusing the mouse to ensure removal of the blood from the CNS tissue, prior to dissociating the tissue and purification of the mononuclear cells on a percoll gradient. The technique provides single cell suspensions with cells of high viability that are suitable for FACS analysis or limited functional studies. The yields are usually low from the normal mouse brain or spinal cord, but higher from mice with EAE or CNS infection. When combined with intracellular cytokine staining and FACS, this technique is particularly useful for analysis of the pathogenic T cells (Th17 and Th1 cells) and their regulation/modulation in EAE.
Materials and Reagents
Mice (adult >6 weeks, any strain, e.g. C57BL/6 used for MOG-induced EAE)
Sodium pentobarbital (euthatal) (Merial)
Phosphate buffered saline (PBS) (Sigma-Aldrich, catalog number: D8537 )
10x PBS (Sigma-Aldrich, catalog number: D1408 )
RPMI solution(Sigma-Aldrich, catalog number: R0883 )
Penicillin-streptomycin (Sigma-Aldrich, catalog number: P4333 )
L-glutamine (Sigma-Aldrich, catalog number: G7513 )
FBS (Sigma-Aldrich, catalog number: F9665 )
Hank’s balanced salt solution (HBSS) (Sigma-Aldrich, catalog number: H9394 ) supplemented with 3% FBS
Collagenase D (Roche, catalog number: 11088858001 )
DNase I (Sigma-Aldrich, catalog number: D4263 )
Percoll Plus (Sigma-Aldrich, catalog number: 17-5445-01 )
Cell permeabilisation kit (contains IntraStain Reagent A and B) (Dako, Denmark, catalog number: K2311 )
Phorbol myristate acetate (PMA) (Sigma-Aldrich, catalog number: P1585 )
Ionomycin (Sigma-Aldrich, catalog number: I0634 )
Brefeldin A (BFA) (Sigma-Aldrich, catalog number: B7651 )
LIVE/DEAD® Fixable Aqua Dead Cell Stain kit (Life Technologies, catalog number: L34957 )
CD16/CD32 FcγRIII (BD Biosciences, catalog number: 553141 )
FACS antibodies (as appropriate)
Propidium iodide (PI) (Sigma-Aldrich, catalog number: P4864 )
Complete RPMI solution (see Recipes)
FACS buffer (see Recipes)
Stock isotonic percoll (SIP) (see Recipes).
Equipment
70 μm nylon mesh filter (Corning, catalog number: 352350 )
Shaker capable of 200 rpm at 37 °C
Tissue culture facilities including class II laminar flow hood
Bench-top centrifuge, preferably refrigerated (any model)
Flow cytometer
Software
Summit software (Dako)
FlowJo software (Tree Star)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Immune cell staining > Flow cytometry
Immunology > Immune cell isolation > Lymphocyte
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,241 | https://bio-protocol.org/exchange/protocoldetail?id=1241&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Generation of Aβ-specific T cell lines and in vivo Transfer
RM Róisín M. McManus
ML Marina A. Lynch
KM Kingston H.G. Mills
Published: Vol 4, Iss 18, Sep 20, 2014
DOI: 10.21769/BioProtoc.1241 Views: 8826
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Mar 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2013
Abstract
Amyloid-β (Aβ)-containing plaques accumulate in the brains of patients with Alzheimer’s disease (AD). Studies in transgenic mice which over-express amyloid precursor protein and presenilin 1 (APP/PS1 mice) have suggested that T cells that infiltrate the brain may influence the development of Aβ plaques and associated cognitive dysfuncation. Active immunization with Aβ peptides and adjuvants has been evaluated as a therapy for AD, based on the premise that it induces Aβ-specific antibodies that may help to clear the Aβ plaques. However, immunization with Aβ peptides and adjuvants also promotes the development of Aβ-specific T cells (McQuillan et al., 2010) and there is evidence that Aβ-specific T cell may influence the development of Aβ plaques and disease progression in AD patients. In the mouse model, Aβ-specific T cells that secrete IFN-γ (Th1 cells) have been shown to enhance the plaque burden (Browne et al., 2013). Adoptive transfer of Aβ-specific T cells that have been polarized in vitro to Th1, Th2, Th17 or Treg cells can be used to examine the function of these cells in vivo.
Materials and Reagents
C57BL/6 mice (adult, >6 weeks old; typically 4 per experiment)
Aβ1-42 peptide (Life Technologies, InvitrogenTM, catalog number: 03112 )
CpG (CpG-oligodeoxynucleotide 1668; 5′-tccatgacgttccgatgct-3′; Sigma-Genosys)
PBS (Sigma-Aldrich, catalog number: D8537 )
IL-1 (Immunotools, catalog number: 12340013 )
IL-2 (Immunotools, catalog number: 12340024 )
IL-4(Immunotools, catalog number: 12340043 )
IL-12 (Miltenyi, catalog number: 130-096-707 )
IL-23 (Miltenyi, catalog number: 130-096-676 )
Anti–IFNγ (BD, catalog number: 554430 )
Dexamethasone (Sigma-Aldrich, catalog number: D4902 )
High-performance liquid chromatography (HPLC)-grade water (sterile ddH2O)
RPMI medium (Sigma-Aldrich, catalog number: R0883 )
Penicillin-streptomycin (Sigma-Aldrich, catalog number: P4333 )
L-glutamine (Sigma-Aldrich, catalog number: G7513 )
FBS (Sigma-Aldrich, catalog number: F9665 )
Complete RPMI medium (see Recipes)
Equipment
Shaker capable of 200 rpm at 37 °C
24-well cell culture plates (Greiner Bio-one, catalog number: 662160 )
1 ml tuberculin syringes (BD, catalog number: 300013 )
70 μm nylon mesh filter (Corning, catalog number: 352350 )
Tissue culture facilities including class II laminar flow hood
Centrifuge
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：McManus, R. M., Lynch, M. A. and Mills, K. H. (2014). Generation of Aβ-specific T cell lines and in vivo Transfer. Bio-protocol 4(18): e1241. DOI: 10.21769/BioProtoc.1241.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Lymphocyte
Immunology > Immune cell isolation > Lymphocyte
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,242 | https://bio-protocol.org/exchange/protocoldetail?id=1242&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protocol for Biotin Bioassay-based Cross Feeding
Youjun Feng
JX Jie Xu
HZ Huimin Zhang
ZC Zeliang Chen
SS Swaminath Srinivas
Published: Vol 4, Iss 18, Sep 20, 2014
DOI: 10.21769/BioProtoc.1242 Views: 7430
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Aug 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2013
Abstract
Biotin bioassay-based cross-feeding experiments were performed to elucidate the effect on biotin production by bioRbme expression in Agrobacterium tumefaciens (A. tumefaciens) (Feng et al., 2013). The indicator strain used here is the biotin auxotrophic strain of Escherichia coli (E. coli), ER90 (ΔbioF bioC bioD), which was cross-fed by A. tumefaciens species (Feng et al., 2013a). The biotin-free M9 minimal medium plates were formulated as described by other and our research groups (Feng et al., 2013b; Lin et al., 2010; del et al., 1979). Of note, 0.01% (w/v) the redox indicator 2, 3, 5-triphenyl tetrazolium chloride (TTC) was supplemented into the above media. Consequently, biotin generation/production was observed via the reduction of TTC to the insoluble red formazan which is due to the ER90 growth fed by A. tumefaciens strains (Feng et al., 2014). Detailed procedures are described as follows.
Materials and Reagents
Four A. tumefaciens strains [NTL4 (WT), FYJ283 (ΔbioBFDA), FYJ212 (ΔbioRat) and FYJ341 (ΔbioR::Km+bioRbme)]
Biotin auxotrophic strain of E. coli, ER90
1 nM biotin (Sigma-Aldrich, catalog number: B4510 )
0.01% (w/v) 2, 3, 5-triphenyl tetrazolium chloride (TTC) (AMRESCO, catalog number: 0 765 )
0.1% vitamin-free casamino acids hydrolysate (Sigma-Aldrich, catalog number: C7710 )
MgSO4
Glucose
M9 minimal medium (see Recipes)
Equipment
Centrifuge
Petri dishes Petri dishes (90 mm) (Thermo Fisher Scientific, catalog number: 502VF )
Sterile paper disks (6 mm, BBL)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial metabolism > Other compound
Microbiology > Microbial biochemistry > Other compound
Microbiology > Microbial cell biology > Cell staining
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,243 | https://bio-protocol.org/exchange/protocoldetail?id=1243&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Combined in situ Hybridization/Immunohistochemistry (ISH/IH) on Free-floating Vibratome Tissue Sections
Manuel E. Lopez
Published: Vol 4, Iss 18, Sep 20, 2014
DOI: 10.21769/BioProtoc.1243 Views: 14081
Edited by: Xuecai Ge
Reviewed by: Hui Zhu
Original Research Article:
The authors used this protocol in Sep 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2012
Abstract
In situ hybridization and immunostaining are common techniques for localizing gene expression, the mRNA and protein respectively, within tissues. Both techniques can be applied to tissue sections to achieve similar goals, but in some cases, it is necessary to use them together. For example, complement C1q is a secreted protein complex that can target the innate immune response during inflammation. Complement has been found to be elevated early and before severe neurodegeneration in several disease models. Thus, complement may serve as an important marker for disease progression and may contribute to the pathology under certain conditions. Since complement is a secreted complex, immunostaining for C1q does not necessarily reveal where compliment is produced. In situ hybridization for complement components, C1q a, b, or c mRNA, is ideal to mark complement producing cells in tissue. In situ hybridization can be coupled with cell-type-specific immunostaining for accurate identification of the cell types involved. Protein localization and mRNA localization together can reveal details as to the relationship between complement producing and complement target cells within disease tissues. Here we outline the steps for combined in situ hybridization and immunostaining on the same tissue section. The protocol outlined here has been designed for detection of complement C1q in neurons and microglia in the mouse brain.
Provided here are two approaches for combined ISH/IH. In the 1st example, in situ hybridization of C1q mRNA is performed together with fluorescent detection of Purkinje neuron cell bodies using Calbindin-D28K antibody. In the 2nd example, C1q mRNA in situ is performed together with 3,3’-diaminobenzidine (DAB) detection of microglia using CD68 antibody. Please note that modifications to the protocol may be needed for the use of distinct probes and antibodies, as well as alternate tissue-processing methods that are not specified herein. For appropriate examples of procedure results, please see images published in Lopez et al.. (2012).
Materials and Reagents
Mice (to be obtained from appropriate sources and in accordance with approved animal regulations)
>200 ng/ml of purified DIG-labeled RNA probe [See Stevens et al. (2007) for source of C1q RNA probe. In general, size of probe can range from 500-1,500 bp or more. Probe size alone has not appeared to affect tissue penetration or alter background. Larger probes may have enhanced signal detection.]
RNaseZAP (Life Technologies, catalog number: AM9780 )
RNase free water (Life Technologies, catalog number: 10977-023 )
32% paraformaldehyde solution (VWR International, catalog number: 100496-496 )
10x RNase free phosphate buffer saline (PBS) (Life Technologies, catalog number: AM9624 )
20x RNase-free SSC buffer (Life Technologies, catalog number: 15557-036 )
Formamide (Sigma-Aldrich, catalog number: 47670 )
Tween-20 (Sigma-Aldrich, catalog number: P1379 )
tRNA (Roche Diagnostics, catalog number: 10109525001 )
Salmon testis DNA (Sigma-Aldrich, catalog number: D9156 )
Heparin salt (Sigma-Aldrich, catalog number: H4784 )
Sodium dodecyl sulfate (SDS) (Sigma-Aldrich, catalog number: L3771 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A9647 )
Triton X-100 (Sigma-Aldrich, catalog number: X100 )
Anti-Digoxigenin-AP (fab fragment) (Roche Diagnostics, catalog number: 11093274910 )
NBT/BCIP ready-to-use (Roche Diagnostics, catalog number: 11697471001 )
30% hydrogen peroxide
Methanol
Diethyl pyrocarbonate (DEPC) (Sigma-Aldrich, catalog number: D5758 )
Rat Anti-CD68 (Bio-Rad Laboratories, AbD Serotec, catalog number: MCA1957GA )
Rabbit Anti-Calbindin-D28k (Sigma-Aldrich, catalog number: C2724 )
Fluoromount-G (Thermo Fisher Scientific, catalog number: OB100-01 )
Anti-Rabbit Alexa 488 (Life Technologies, catalog number: A21206 )
Anti-Rat HRP (Jackson ImmunoResearch Laboratories, catalog number: 712035150 )
SIGMA FAST DAB (Sigma-Aldrich, catalog number: D4293 )
HNPP/Fast Red TR (Roche Diagnostics, catalog number: 11758888001 )
NBT/BCIP tablet (Roche Diagnostics)
PFA (see Recipes)
5x SSC (see Recipes)
Hybe (see Recipes)
Wash 1 (see Recipes)
Wash 2 (see Recipes)
Block (see Recipes)
DEPC block (see Recipes)
HPM (see Recipes)
Detection buffer (see Recipes)
Stop buffer (see Recipes)
Equipment
Vibratome (Leica Microsystems, model: VT1200 S or other vibratome machine)
1.5 ml or a 5 ml Eppendorf tube
Cold room (4 °C)
Nutator (VWR International, catalog number: 15172-203 )
Hybridization oven (60 °C)
Software
Photoshop, Image J, etc.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Lopez, M. E. (2014). Combined in situ Hybridization/Immunohistochemistry (ISH/IH) on Free-floating Vibratome Tissue Sections. Bio-protocol 4(18): e1243. DOI: 10.21769/BioProtoc.1243.
Download Citation in RIS Format
Category
Neuroscience > Development > Immunofluorescence
Biochemistry > Protein > Immunodetection
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,244 | https://bio-protocol.org/exchange/protocoldetail?id=1244&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection of Hog1 Phosphorylation in Candida albicans in Response to an Antifungal Protein
BH Brigitte ME Hayes
NW Nicole L van der Weerden
Published: Vol 4, Iss 18, Sep 20, 2014
DOI: 10.21769/BioProtoc.1244 Views: 8540
Original Research Article:
The authors used this protocol in Aug 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2013
Abstract
It is becoming increasingly apparent that stress signalling is important for tolerance of fungal species to antifungal chemicals and proteins. The high-osmolarity glycerol (HOG) pathway responds to a number of stressors including osmotic and oxidative stress. This protocol describes a method to detect activation of the Candida albicans (C. albicans) MAPK Hog1 by monitoring its phosphorylation in response to an antifungal protein.
Materials and Reagents
Candida albicans wild-type (WT)
C. albicans hog1Δ/Δ deletion mutant
Half-strength potato dextrose broth (½ PDB) (BD, DifcoTM, catalog number: 254920 )
Protein of interest (e.g. the plant defensin NaD1)
5 M NaCl
Ultrapure ice-cold water
Dry ice
20% trichloroacetic acid (TCA) (20% w/v)
10% trichloroacetic acid (TCA) (10% w/v)
100% ice-cold acetone
4x NuPAGE LDS sample buffer (Life Technologies, catalog number: NP0007 )
Bond-Breaker TCEP solution (neutral pH) (Thermo Fisher Scientific, catalog number: 77720 )
1 M Tris (pH 8.0)
Any kD Mini-PROTEAN TGX precast polyacrylamide gels (15 well) (Bio-Rad Laboratories, catalog number: 456-9036 )
10x Tris/glycine/SDS running buffer (Bio-Rad Laboratories, catalog number: 161-0072 )
5% (w/v) skim milk in TBS
Phospho-p38 MAPK (Thr180/Tyr182) antibody (Cell Signaling Technology, catalog number: 9211 )
Hog1 (y-215) antibody (Santa Cruz, catalog number: sc-9079 )
Amersham ECL rabbit IgG (HRP-linked antibody from donkey) (GE, catalog number: NA934 )
Amersham ECL Western blotting detection reagents (GE, catalog number: RPN2106 )
Yeast peptone dextrose broth (YPD) (see Recipes)
Yeast peptone dextrose agar (YPD agar) (see Recipes)
Tris-buffered saline (TBS) (see Recipes)
Tris-buffered saline with Tween 20 (TBST) (see Recipes)
Equipment
180 μm glass beads (acid-washed) (Sigma-Aldrich, catalog number: G1152 )
Trans-blot turbo mini PVDF transfer pack (Bio-Rad Laboratories, catalog number: 170-4156 )
50 ml tubes screw-cap tubes
30 °C shaking incubator
Spectrophotometer
500 ml baffled flask
Eppendorf 5810 R centrifuge (Eppendorf, catalog number: 5811 000.010 )
1.5 ml microfuge tubes
Vortex
Bench top centrifuge
Trans-blot turbo transfer system (Bio-Rad Laboratories, catalog number: 170-4155 )
Circular mixer
Bio-Rad ChemiDoc MP imaging system (Bio-Rad Laboratories, catalog number: 170-8280 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Antimicrobial assay > Antifungal assay
Microbiology > Microbial signaling > Phosphorylation
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,245 | https://bio-protocol.org/exchange/protocoldetail?id=1245&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Perls Staining for Histochemical Detection of Iron in Plant Samples
Tzvetina Brumbarova
Rumen Ivanov
Published: Vol 4, Iss 18, Sep 20, 2014
DOI: 10.21769/BioProtoc.1245 Views: 23224
Edited by: Ru Zhang
Reviewed by: Samik Bhattacharya
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
Visualization of iron (Fe) localization in plants has greatly enhanced our understanding of plant Fe homeostasis. One of the relatively simple and yet powerful techniques is the classical Perls blue stain (Perls, 1867). The technique is based on the conversion of ferrocyanide to insoluble crystals of Prussian blue in the presence of Fe3+ under acidic conditions. It has been extensively used in animal and human histology (Meguro et al., 2007) and has recently gained popularity in plant research. For specific purposes, Fe signals may be additionally enhanced in the 3,3’-diaminobenzidine tetrahydrochloride (DAB) intensification procedure (Meguro et al., 2007). It has been demonstrated that this intensification results in the detection of both Fe2+ and Fe3+ ions (Roschzttardtz et al., 2009). The method has been successfully applied at the whole plant, organ and subcellular levels, both with (Roschzttardtz et al., 2011; Schuler et al., 2012; Roschzttardtz et al., 2013; Ivanov et al., 2014) and without intensification (Stacey et al., 2008; Long et al., 2010).
Here, we present a full Perls staining and DAB intensification protocol, the way it is performed in our lab (Ivanov et al., 2014).
Keywords: Perls staining DAB intensification Iron deficiency Plant
Materials and Reagents
3,3’-diaminobenzidine tetrahydrochloride (DAB) (Sigma-Aldrich, catalog number: 32750 )
Chloroform (CHCl3)
Cobalt (II) chloride (CoCl2)
Ethanol (CH3CH2OH)
Glacial (water-free) acetic acid (CH3COOH)
Hydrogen peroxide (H2O2) (30%)
Hydrochloric acid (HCl) (37%)
Methanol (CH3OH)
Di-sodium hydrogenphosphate (Na2HPO4)
Sodium di-hydrogenphosphate (NaH2PO4)
Sodium azide (NaN3)
Potassium ferrocyanide (K4[Fe (Cn)6])
Fixing solution (see Recipes)
Staining solution (see Recipes)
0.1 M phosphate buffer (see Recipes)
1% 3,3’-diaminobenzidine tetrahydrochloride (DAB) stock (see Recipes)
Preparation solution (see Recipes)
1% CoCl2 (see Recipes)
Intensification solution (see Recipes)
Equipment
Vacuum pump (any model capable of producing 500 mbar vacuum)
1.5 ml tube
Standard incubator
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Brumbarova, T. and Ivanov, R. (2014). Perls Staining for Histochemical Detection of Iron in Plant Samples. Bio-protocol 4(18): e1245. DOI: 10.21769/BioProtoc.1245.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Tissue analysis
Plant Science > Plant physiology > Ion analysis
Cell Biology > Cell staining > Iron
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,246 | https://bio-protocol.org/exchange/protocoldetail?id=1246&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Chromogenic Substrate Assay for Determining the Activity of Plasma Kallikrein
PP Praveen Papareddy
MK Martina Kalle
AS Artur Schmidtchen
Published: Vol 4, Iss 19, Oct 5, 2014
DOI: 10.21769/BioProtoc.1246 Views: 9389
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in Dec 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2013
Abstract
The activation of the intrinsic pathway takes place at negatively charged surfaces, such as bacteria, and involves activation of cogulation Factor XII, which then leads to the activation of plasma kallikrein (PK) and coagulation Factor XI. To determine the PK activity on bacterial surfaces, bacteria were pre-incubated with peptides, followed by incubation with plasma, and the effect of peptide was recorded by measuring the PK activity.
Materials and Reagents
Specific bacteria [e.g. Escherichia coli (E. coli), ATCC, catalog number: 25922 ; Pseudomonas aeruginosa (P. aeruginosa), ATCC, catalog number: 27853 )]
3% Todd-Hewitt (TH) broth
3% TH agar plates
Human citrated plasma (fresh)
50 mM Tris/HCl (pH 7.4, sterile)
50 mM ZnCl2 in H2O (sterile)
Chromogenic substrate S-2302 (Chromogenix, catalog number: S820340 ) (4 mM in H2O)
DAPTTIN TC (Technoclone, catalog number: 5035060 )
Peptides (e.g. antimicrobial peptide LL-37) or other agents to be tested
Equipment
Microcentrifuge tube
BD vacutainer® plus blood collection tubes (BD, catalog number: 364305 )
96-well flat bottom plates
Centrifuge for microcentrifuge tubes
ELISA reader (A = 405 nm)
Incubator 37 °C
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial biochemistry > Protein
Immunology > Host defense > General
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,247 | https://bio-protocol.org/exchange/protocoldetail?id=1247&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Coagulation Assay
PP Praveen Papareddy
MK Martina Kalle
AS Artur Schmidtchen
Published: Vol 4, Iss 19, Oct 5, 2014
DOI: 10.21769/BioProtoc.1247 Views: 14185
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in Dec 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2013
Abstract
Clotting times can be measured by using citrate plasma. The intrinsic pathway of coagulation is measured by the activated partial thromboplastin time (aPTT), the extrinsic pathway of coagulation, monitored by measuring the prothrombin time (PT), and thrombin-induced fibrin-network formation (thrombin clotting time; TCT).
Materials and Reagents
Citrated plasma (fresh or frozen)
Eppendorf tubes
Coagulation reagents
Thrombin reagent (Technoclone, catalog number: 5100005 )
TriniCLOT PT Excel reagent (Trinity Biotech, catalog number: T1105 / T1106 )
DAPTTIN TC (Technoclone, catalog number: 5035060 )
30 mM CaCl2 (freshly made)
Test agent (e.g. antimicrobial peptide LL-37)
Equipment
BD vacutainer® plus blood collection tubes (BD, catalog number: 364305 )
Coagulometer (Mc10 Plus merlin medical)
Cuvettes and balls macro (merlin medical, catalog number: Z05100 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Host defense > General
Biochemistry > Other compound > Antimicrobial
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,248 | https://bio-protocol.org/exchange/protocoldetail?id=1248&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Analysis of Total Se Content in Rice
Lianhe Zhang
FY Feiyan Yu
KD Kun Deng
BH Bin Hu
Chengcai Chu
Published: Vol 4, Iss 19, Oct 5, 2014
DOI: 10.21769/BioProtoc.1248 Views: 8012
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
Total Se content in rice is normally low and it is difficult to determine it exactly because of Se volatilization and pollution during the digestion process. In this method, rice sample is digested thoroughly and Se volatilization is reduced greatly by designing a specific digestion tube, increasing digestion temperature by three steps, controlling the amount of mixed acid and adjusting the location of digestion tube in the digestion furnace. Se pollution is also reduced greatly by specific cleaning treatments.
Materials and Reagents
Rice sample: Polished rice or brown rice
10% HCl (Sigma-Aldrich, catalog number: 7647-01-0 )
65% HNO3 (Sigma-Aldrich, catalog number: 7697-37-2 )
72% HClO4 (Sigma-Aldrich, catalog number: 7601-90-3 )
6 mM HCl (Sigma-Aldrich, catalog number: 7647-01-0) (used for the reduction of SeO42- to SeO32-)
Selenium standard solution (Sigma-Aldrich, catalog number: 7782-49-2 ) (1, 5, 10, 20, 50, and 100 μg/L)
Acid mixture: HNO3: HClO4 (V/V) = 4:1
Equipment
Digestion tube (see Design digestion tube)
40 mesh nylon sieve (15 cm diameter)
A paper bag (8 x 10 cm)
Parafilm (Parafilm, catalog number: PM-996 )
Volumetric flask (25 ml)
Glass stopper (match 25 ml volumetric flask)
Atomic fluorescence spectrometer (AFS) (model number: BRAIC AFS 610A )
Inductively coupled plasma mass spectrometry (ICP-MS) (PerkinElmer, model number: ELAN-DRCe )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant physiology > Ion analysis
Plant Science > Plant biochemistry > Other compound
Plant Science > Plant physiology > Tissue analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,249 | https://bio-protocol.org/exchange/protocoldetail?id=1249&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Novel Object Recognition for Studying Memory in Mice
TH Tzyy-Nan Huang
YH Yi-Ping Hsueh
Published: Vol 4, Iss 19, Oct 5, 2014
DOI: 10.21769/BioProtoc.1249 Views: 31511
Edited by: Soyun Kim
Reviewed by: Yatang Li
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
Memory tests are important indexes of the brain functions for rodents behavior assay. Many memory tasks require external forces (e.g. electric shocks) or intrinsic forces (e.g. hunger and thirsty) to trigger the responses. Under those conditions, rodents are under stresses, such as pain, tired, malnutrition or dehydration, which potentially affect the natural neural responses. Novel object recognition is a non-force driving and spontaneous memory test. It is derived from curiosity but easy to be interfered with manipulation factors. In addition to stepwise procedure, the protocol described here emphasizes how to reduce the noise in the novel object recognition.
Keywords: Mouse behavior Memory Object recognition
Materials and Reagents
Mouse
Notes:
To reach statistic significance, at least 10 mice are required. 15 mice are ideal to minimize the individual variation.
C57BL/6, male, 2 months to one year old (2-4 months old is optimal), 3-5 mice are kept in one cage after weaning.
Cleaning solution
Note: Clean the chamber and/or objects using 70% ethanol first followed by sterile water (to remove the odor of ethanol). Air dry for 3 min.
Equipment
Apparatus
Note: The dimensions of plexiglas box is 40 cm x 40 cm x 40 cm. The color of plexiglas is frosted white or transparent. The frosted white plexiglas boxes can diminish the effect from outside views, if the mice have not experienced the open field test.
Figure 1. The apparatus for novel object recognition
Objects
Note: The size of objects is 4 cm x 4 cm x 4 cm approximately. The shape of objects is simple like the building blocks. The objects made by wood, metal or hard plastic are preferred, because those are resistant to biting demolition. Because mice are protanope (red color blindness), the colors of objects should be checked by analysis of Vischeck software (a free software available from the website: http://www.vischeck.com) to ensure that mice are able to distinguish them.
Camera/computer
Note: The raw data are stored in recording equipment for further analysis. The video tracking system such as “Smart system” (Panlab) can help you to easily get the exploration time of mice to the objects (the heads of mice crossover the object boundary lines indicated in Figure 1). The exploration time can also be counted manually. The results are further analyzed using the Prism (Graph Pad software).
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Huang, T. and Hsueh, Y. (2014). Novel Object Recognition for Studying Memory in Mice. Bio-protocol 4(19): e1249. DOI: 10.21769/BioProtoc.1249.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Learning and memory
Neuroscience > Behavioral neuroscience > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
125 | https://bio-protocol.org/exchange/protocoldetail?id=125&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Western Blot for Detecting Phosphorylated STAT3
HZ Huagang Zhang
Published: Aug 20, 2011
DOI: 10.21769/BioProtoc.125 Views: 26222
Download PDF
Ask a question
Favorite
Cited by
Abstract
The STAT3 transcription factor is an important signaling molecule for many cytokines and growth factor receptors and is constitutively activated in a number of human tumors and possesses oncogenic potential and anti-apoptotic activities. STAT3 is activated by phosphorylation at Tyr705, which induces dimerization, nuclear translocation, and DNA binding. Western blot is most commonly used to detect the activation of STAT3 by using an antibody that is specific for the phosphorylated tyrosine705.
Materials and Reagents
Tumor cell lines with constitutive activation of STAT3 (positive control).
DU145 (ATCC, catalog number: HTB-81 ™)
HepG2 (ATCC, catalog number: HB-8065 ™)
Hep3B (ATCC, catalog number: HB-8064 ™)
Huh7
Phospho-Stat3 (Tyr705) (D3A7) XP™ Rabbit (Cell Signaling Technology, catalog number: 9145 )
Stat3 (124H6) Mouse mAb (Cell Signaling Technology, catalog number: 9139 )
HRP Goat Anti-Rabbit I (BD Biosciences, catalog number: 554021 )
β-Actin (13E5) Rabbit mAb (Cell Signaling Technology, catalog number: 4970 )
Anti-mouse IgG, HRP-linked Antibody (Cell Signaling Technology, catalog number: 7076 )
Note: The above antibodies have been tested by the author and may be substituted with the antibodies desired by users.
Phosphate buffered saline (PBS)
1x halt protease and phosphatase inhibitor cocktail (Thermo Fisher Scientific, catalog number: 78440 )
M-PER mammalian protein extraction reagent (Thermo Fisher Scientific, catalog number: 78501 )
Bio-Rad protein assay dye reagent concentrate (Bio-Rad Laboratories, catalog number: 500-0006 )
10x Tris/Glycine/SDS (Bio-Rad Laboratories, catalog number: 161-0771 )
Methanol (Thermo Fisher Scientific, catalog number: A412-20 )
Tris buffered saline (Bio-Rad Laboratories, catalog number: 170-6435 )
Tween-20 (Santa Cruz Biotechnology, catalog number: sc-29113 )
Bovine serum albumin (BSA) (MP Biomedicals, catalog number: 810033 )
Supersignal west Dura extended duration substrate (Thermo Fisher Scientific, catalog number: 34075 )
Precision plus protein dual color standards (Bio-Rad Laboratories, catalog number: 161-0374 )
Restore plus western blot stripping buffer (Thermo Fisher Scientific, catalog number: 46430 )
Protein lysis buffer (see Recipes)
Electrophoresis buffer (see Recipes)
1x Tris buffered saline (TBS) (see Recipes)
Transfer buffer (see Recipes)
Blocking buffer (see Recipes)
Wash buffer (see Recipes)
Primary antibody dilution buffer (see Recipes)
Blotting membrane (see Recipes)
Equipment
Microcentrifuges (Eppendorf, model: 5415 R )
Thermolyne Rotomix (BioSurplus, model: 50800 )
Microcentrifuge tubes
Nitrocellulose or PVDF membrane
SmartSpec plus spectrophotometer (Bio-Rad Laboratories)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cancer Biology > Inflammation > Biochemical assays
Biochemistry > Protein > Immunodetection
Cell Biology > Cell signaling > Phosphorylation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,250 | https://bio-protocol.org/exchange/protocoldetail?id=1250&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Two-choice Digging Task in Mouse for Studying the Cognitive Flexibility
HC Hsiu-Chun Chuang
TH Tzyy-Nan Huang
YH Yi-Ping Hsueh
Published: Vol 4, Iss 19, Oct 5, 2014
DOI: 10.21769/BioProtoc.1250 Views: 12773
Edited by: Soyun Kim
Reviewed by: Yatang Li
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
Cognitive flexibility, the higher-order cognition involving reversal learning, has been defined as having the ability to shift one’s previous thoughts or actions to new situations depending on situational demands. Studies of neuropsychiatric disorders such as autism spectrum disorder (ASD) showed that restricted and repetitive patterns of activities are associated with the impairments of cognitive flexibility. Some behavioral tasks including attentional set-shifting task are used to assess cognitive flexibility in mouse models for psychiatric disorders (Birrell and Brown, 2000; Colacicco et al., 2002). Here we present a two-choice digging test, which is simplified and modified from set-shifting task, for using mice to study the reversal learning (Huang et al., 2014).
Keywords: Mouse behavior Cognitive flexibility Rigidity
Materials and Reagents
C57BL/6 mice (purchased from National Laboratory Animal Center)
Sterilized sunflower seeds (SunOpta, catalog number: 10AF4167 )
Cinnamon (Local bakery shop)
Sawdust (P.J. Murphy Forest Products Corporation, Sani-Chips®)
70% ethanol
Equipment
Apparatus
The apparatus (Figure 1) is made of opaque acrylic with a platform base and wall with two transparent plexiglas guillotine doors (25 x 20 x 15 cm). A waiting compartment (20 x 10 cm) at one end of the apparatus connected to two equally sized choice compartments at the other end via guillotine doors (15 x 10 cm).
Figure 1. The apparatus of two-choice digging task
Digging bowl
The digging bowl (45 mm in diameter, 25 mm in height) placed in each choice compartment is baited with sunflower seeds (30-35 mg) hidden underneath original- or cinnamon (2%)-flavored sawdust.
Note: The rewards should be buried under over 20 mm of sawdust.
Figure 2. The digging bowl
Software
The GraphPad Prism 5.0 (GraphPad Software) was used to generate the graphs and analyze the data of trials to acquisition and trials to relearn. A p-value less than 0.05 is considered statistically significant.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Neuroscience > Behavioral neuroscience > Cognition
Neuroscience > Behavioral neuroscience > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,251 | https://bio-protocol.org/exchange/protocoldetail?id=1251&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Pea Aphid Survival Assays on Arabidopsis thaliana
DP David C. Prince
SM Sam T. Mugford
TV Thomas R. Vincent
SH Saskia A. Hogenhout
Published: Vol 4, Iss 19, Oct 5, 2014
DOI: 10.21769/BioProtoc.1251 Views: 9303
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
Aphids are phloem-feeding insects that successfully colonize specific host plant species. Aphid performance on a given plant is commonly measured by assessing fecundity of an aphid species that is adapted to the host. However, this approach may not reveal roles for plant genes in defense pathways that adapted aphids suppress. The host range of the pea aphid (Acyrthosiphon pisum) is mostly restricted to plants of the legume family, and does not include Arabidopsis (Arabidopsis thaliana). Pea aphids die within a few days of being placed on Arabidopsis plants, and their survival therefore provides a sensitive measure of the status of the host plant defenses. This protocol describes how to measure the survival rate of the pea aphid on the non-host plant Arabidopsis. The protocol consists of two phases: first, obtaining a population of pea aphids of synchronized age; and secondly measuring their survival on Arabidopsis plants.
Materials and Reagents
3 to 4-week-old Vicia faba plants grown in 14 h light (18 °C)/10 h dark (15 °C)
7-week-old Arabidopsis plants grown in a short day condition (10 h light/14 h dark (22 °C)
Pea Aphids (Acyrthosiphon pisum) maintained on Vicia faba plants grown in 14 h light (18 °C)/10 h dark (15 °C)
Equipment
Plant growth facilities
Insect-proof cage to contain Vicia faba plants (Note 1)
Petri dish
Moist artist’s paintbrush (size 2 or 4)
Clip cages (Figure 1)
Plant labels
Marker pen
Figure 1. Clip cage. Composed of a metal double prong hair clip (50 mm long), two pieces of plastic tube (10 and 5 mm high, 2 mm thick, 25 mm diameter), two circles of felt (25 mm diameter, 4 mm across, 1 mm thick), and two pieces of fine gauze (25 mm diameter). The hair clip is heated and pushed into the plastic tubes. The felt and gauze are attached with superglue. Scale bar = 5 mm
Software
Microsoft® Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Prince, D. C., Mugford, S. T., Vincent, T. R. and Hogenhout, S. A. (2014). Pea Aphid Survival Assays on Arabidopsis thaliana. Bio-protocol 4(19): e1251. DOI: 10.21769/BioProtoc.1251.
Prince, D. C., Drurey, C., Zipfel, C. and Hogenhout, S. A. (2014). The leucine-rich repeat receptor-like kinase BRASSINOSTEROID INSENSITIVE1-ASSOCIATED KINASE1 and the cytochrome P450 PHYTOALEXIN DEFICIENT3 contribute to innate immunity to aphids in Arabidopsis. Plant Physiol 164(4): 2207-2219.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease bioassay
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,252 | https://bio-protocol.org/exchange/protocoldetail?id=1252&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Construction of Glycine Oxidase Mutant Libraries by Random Mutagenesis, Site Directed Mutagenesis and DNA Shuffling
Tao Zhan
Published: Vol 4, Iss 19, Oct 5, 2014
DOI: 10.21769/BioProtoc.1252 Views: 10136
Reviewed by: Kanika GeraAksiniya Asenova
Original Research Article:
The authors used this protocol in Nov 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2013
Abstract
Glyphosate, a broad spectrum herbicide widely used in agriculture all over the world, inhibits 5-enolpyruvylshikimate-3-phosphate synthase in the shikimate pathway, and glycine oxidase (GO) has been reported to be able to catalyze the oxidative deamination of various amines and cleave the C-N bond in glyphosate (Pedotti et al., 2009). Here, in an effort to improve the catalytic activity of the glycine oxidase that was cloned from a glyphosate-degrading marine strain of Bacillus cereus (BceGO), we used a bacteriophage T7 lysis-based method for high-throughput screening of oxidase activity and engineered the gene encoding BceGO by directed evolution.
Materials and Reagents
Bacillus cereus HYC-7
Escherichia coli (E.coli) DH5α strain, bacteriophage T7
Glyphosate (Sigma-Aldrich, catalog number: PS1051 )
Tryptone (Difco)
Yeast extract (Difco)
Ampicillin
o-Dianisidine dihydrochloride (Sigma-Aldrich, catalog number: D3252 )
Horseradish peroxidase (Sigma-Aldrich, catalog number: P6782 )
Protein expression vector of pGEX-6P-1 (the plasmid full length 4,984 bp) (GE Healthcare, catalog number: 28-9546-48 ; Genbank accession number: U78872.1)
Recombinant plasmid pGEX-GO contains encoding gene of glycine oxidase from Bacillus cereus HYC-7
The nucleotide sequence (1,110 bp) was submitted to the NCBI Genbank and gained the accession number (KC203486.1).
Taq DNA polymerase (Takara, catalog number: R500A )
DpnI restriction enzyme (Takara, catalog number: 1235A )
dATP, dTTP, dCTP, dGTP (Takara, catalog numbers: 4026Q , 4029Q , 4028Q , 4027Q )
TransStart® FastPfu DNA polymerase (TransGen Biotech, catalog number: AP221-01 )
High Pure dNTPs (TransGen Biotech, catalog number: AD101-01 )
Luria-Bertani medium (see Recipes)
Equipment
96 deep-well plates (Axygen, catalog number: P-DW-20-C-S )
Gel purification column (Axygen)
Thermo Multiskan spectrum plate reader (Thermo Scientific, catalog number: 51118600 )
Thermal cyclers (Bio-Rad Laboratories, catalog number: 186-1096 )
Ultrasonic processor (Sigma-Aldrich, catalog number: Z412619-1EA )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zhan, T. (2014). Construction of Glycine Oxidase Mutant Libraries by Random Mutagenesis, Site Directed Mutagenesis and DNA Shuffling. Bio-protocol 4(19): e1252. DOI: 10.21769/BioProtoc.1252.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > Mutagenesis
Molecular Biology > DNA > Mutagenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,253 | https://bio-protocol.org/exchange/protocoldetail?id=1253&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Expression and Purification of the Thermus thermophilus Argonaute Protein
Daan C. Swarts
MJ Matthijs M. Jore
John van der Oost
Published: Vol 4, Iss 19, Oct 5, 2014
DOI: 10.21769/BioProtoc.1253 Views: 10305
Reviewed by: Arsalan Daudi
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
The Argonaute protein of Thermus thermophilus (TtAgo) has recently been studied in detail. For its in vitro characterization, TtAgo was purified after heterologous expression in Escherichia coli (E. coli). As TtAgo expression is toxic, a tightly controlled system was used for protein expression. The expression strain E. coli KRX carries a chromosomal T7 RNA polymerase gene under control of a rhamnose promoter. The ago gene is expressed via an IPTG-inducible T7 promoter. This allows for tightly (double) controlled expression of (toxic) TtAgo. Here, we describe the steps required for controlled expression and purification of this toxic protein.
Materials and Reagents
Expression of TtAgo in E. coli KRX
Glycerol stock of Escherichia coli KRX (Promega corporation, catalog number: L3002 ) [encodes a T7 RNA polymerase gene under control of a rhamnose promoter], transformed with plasmids pRARE (EMD Millipore, plasmid of RosettaTM (DE3) Competent Cells, catalog number: 70954-3 ) [encodes tRNAs for rare codons to enhance protein translation efficiency] and pWUR702 [pCDF-1b derivative, with T. thermophilus HB27 TT_P0026 ago gene insert fused to an N-terminal strep(II)-tag, expression under control of an IPTG-inducible T7 promoter] (Addgene, catalog number: 53079 ).
Note: The plasmid pWUR703 (Addgene, catalog number: 53082 ) can be used for expression of TtAgoDM (Double Mutant, D478A, D546A). Expression and purification of this protein is identical to TtAgo expression and purification.
1,000x chloramphenicol solution (34 mg/ml) dissolved in 100% ethanol
1,000x streptomycin solution (50 mg/ml) dissolved in MilliQ H2O
20% D-glucose solution dissolved in MilliQ H2O (sterile filtered)
20% L-rhamnose solution dissolved in MilliQ H2O (sterile filtered)
1 M IPTG dissolved in MilliQ H2O (sterile filtered)
LB medium (see Recipes)
Purification of TtAgo
Cell pellet from o/n TtAgo expression (see above)
Strep-Tactin Sepharose® 50% suspension (IBA, catalog number: 2-1201-XXX )
1.2 ml Bio-Spin® Chromatography Columns (Bio-Rad Laboratories, catalog number: 732-6008 )
Buffer I (see Recipes)
Buffer II (see Recipes)
Buffer III (see Recipes)
Equipment
Expression of TtAgo in E. coli KRX
50 ml Greiner tube
2.5 L Erlenmeyer flask
Centrifuge
37 °C shaker incubator
20 °C shaker incubator
Ice-water bath (water and ice mixed)
Purification of TtAgo
French-Press, sonicator, or equivalent for cell disruption
Centrifuge
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Swarts, D. C., Jore, M. M. and Oost, J. V. D. (2014). Expression and Purification of the Thermus thermophilus Argonaute Protein. Bio-protocol 4(19): e1253. DOI: 10.21769/BioProtoc.1253.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Isolation and purification
Biochemistry > Protein > Expression
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,254 | https://bio-protocol.org/exchange/protocoldetail?id=1254&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Hypoxia Studies with Pimonidazole in vivo
Kristina Y. Aguilera
Rolf A. Brekken
Published: Vol 4, Iss 19, Oct 5, 2014
DOI: 10.21769/BioProtoc.1254 Views: 26640
Edited by: HongLok Lung
Reviewed by: Ralph Bottcher
Original Research Article:
The authors used this protocol in Feb 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2014
Abstract
Therapy-induced hypoxia drives changes in the tumor microenvironment that contribute to the poor response to therapy. Hypoxia is capable of driving the expression and/or activation of specific signaling cascades (e.g., c-Met, Axl, CTGF), the recruitment of tumor promoting immune cells, and the induction of cell survival pathways including autophagy (Phan et al., 2013; Hu et al., 2012; Ye et al., 2010). We have recently shown that anti-VEGF therapy-induced hypoxia can result in changes in the extracellular matrix that contribute to the aggressiveness of tumors post therapy (Aguilera et al., 2014). Importantly, therapies that induce hypoxia do not always increase epithelial plasticity and tumor aggressiveness (Ostapoff et al., 2013; Cenik et al., 2013). We have used pimonidazole to evaluate hypoxia in tumors and herein provide a detailed protocol for this useful tool to interrogate the levels of hypoxia in vivo.
The utility of the HypoxyprobeTM (pimonidazole hydrochloride) immunohistochemical analysis approach allows for the assessment of hypoxia in different tissues as well as cell types. Pimonidazole is a 2-nitroimidazole that is reductively activated specifically in hypoxic cells and forms stable adducts with thiol groups in proteins, peptides, and amino acids (Cenik et al., 2013; Arnold et al., 2010; Raleigh and Koch, 1990; Raleigh et al., 1998). Furthermore, the amount of pimonidazole that is detected is directly proportional to the level of hypoxia within tumors.
Materials and Reagents
HypoxyprobeTM-1 Plus Kit (HypoxyprobeTM, catalog number: HP1-1000Kit )
A rabbit, FITC-conjugated, secondary reagent is included in the HypoxyprobeTM-1 Plus Kit (HypoxyprobeTM, catalog number: HP1-1000Kit)
Sodium chloride ACS reagent (Sigma-Aldrich, catalog number: S9888 )
Milli Q H2O
Corning bottle-top vacuum filter system (Sigma-Aldrich, catalog number: CLS430769 )
PBS (Sigma-Aldrich, catalog number: P-4417 )
Anti-CD31 antibody (Dianova GmbH, catalog number: DIA-310 )
Anti-Meca32 antibody (Abcam, catalog number: ab27853 )
Anti-Endomucin antibody (Millipore, catalog number: MAB2624 )
Cy3-conjugated secondary IgG (Jackson ImmunoResearch Laboratories)
Tissue-Tek OCT compound (Ted Pella, catalog number: 27050 )
Liquid nitrogen
IsoFlo (isoflurane, USP) (Abbott Laboratories, catalog number: 05260-05 )
Carbon dioxide (Sigma-Aldrich, catalog number: 295108 -227G)
Superfrost plus; white microscope slides (Thermo Fisher Scientific, catalog number: 12-550-15 )
Liquid scintillation vials, plastic (Sigma-Aldrich, catalog number: M2026 -1000EA)
Prolong gold antifade mountant (Life Technologies, catalog number: P10144 )
Aqua Block/EIA/WB (EastCoast Bio, catalog number: PP82 )
Acetone (Sigma-Aldrich, catalog number: 320110 )
Micro cover glasses, rectangular, No. 1 (VWR International, catalog number: 48393-106 )
Tween 20 (Sigma-Aldrich, catalog number: P9416 -50ML)
0.9% saline (see Recipes)
30 mg/ml pimonidazole in 0.9% saline (see Recipes)
Antibody diluent (see Recipes)
20% aqua block (see Recipes)
PBS-t (see Recipes)
Equipment
Cryostat (Leica, catalog number: CM3050 S )
Low profile microtome blades (Accu Edge, catalog number: 4689 )
Surgical equipment (Braintree Scientific)
Fluorescent or bright-field microscope (Nikon Eclipse, model: E600 )
Fluorescent microscope camera (Photometrics, Cool Snap HQ)
Nikon filters (FITC: 96170M F HQ, Cy3/TRITC: 96171M R HG, DAPI/nuclei: 96101M UV-2E/C)
30 G x 1/2 in. precision glide needles (BD Biosciences, catalog number: 305106 )
Tuberculin syringe only (BD Biosciences, catalog number: 309659 )
Tailveiner restrainer for mice (Braintree Scientific, catalog number: TV-150 STD )
Software
NIS Elements software, ImageJ (open source software: http://imagej.nih.gov/ij/), or other image analysis software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Aguilera, K. Y. and Brekken, R. A. (2014). Hypoxia Studies with Pimonidazole in vivo. Bio-protocol 4(19): e1254. DOI: 10.21769/BioProtoc.1254.
Download Citation in RIS Format
Category
Cancer Biology > Cellular energetics > Tumor microenvironment
Cancer Biology > General technique > Biochemical assays
Cell Biology > Cell metabolism > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,255 | https://bio-protocol.org/exchange/protocoldetail?id=1255&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In utero Electroporation of the Embryonic Mouse Retina
FN Francisco Nieto-Lopez
LS Luisa Sanchez-Arrones
Published: Vol 4, Iss 19, Oct 5, 2014
DOI: 10.21769/BioProtoc.1255 Views: 14516
Edited by: Xuecai Ge
Reviewed by: Oneil G. Bhalala
Original Research Article:
The authors used this protocol in May 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2013
Abstract
This protocol is useful to manipulate gene expression in the embryonic retina and compare the result with the contralateral non electroporated retina. In addition, the electroporation of a membrane or cytoplasmic tagged GFP allows to determine the effects of gene manipulation on the outgrowth of retinal ganglion cell axons (Garcia-Frigola et al., 2007) or simply to follow axon outgrowth in mutant embryos. DNA can be directed to different quadrants of the retina (ventral or dorsally) by modifying the position of the electrodes (Petros et al., 2009; Sánchez-Arrones et al., 2013). After the procedure, embryos are left developing to the desired stage, including postnatal stages.
Keywords: Gene Expression Developmental Biology Visual System Retinal Ganglion Cells Neuroscience
Materials and Reagents
E13 embryos from C57BL6J pregnant mice (2 - 4 months old) were electroporated as described below. Animals were collected and handled following the Spanish (RD 223/88), European (86/609/ECC), and American (National Research Council, 1996) regulations.
Plasmid Midi Kit (Roche, catalog number: 0 3143414001 ) (e.g. Genopure Plasmid Midi Kit)
Fast green FCF (Sigma-Aldrich, catalog number: F7252 )
Sterile water
Isofluorane (Abbott Laboratories, catalog number: 880393.4 )
Sterile saline (see Recipes)
10x phosphate-buffered saline (PBS) (see Recipes)
Equipment
Borosilicate glass capillaries (World Precision Instruments, catalog number: 1B 100 F-4)
Micropipette puller (Sutter Instrument, model: P36 )
Aspirator tube assembly (Sigma-Aldrich, catalog number: A5177-5EA )
Black braided silk 3/0 (Lorca Marín S.A.Ctra, catalog number: 55159 )
Sterile gauze and cotton swab (Aposan, catalog number: 343160.6 )
Dissecting tools (Figure 1C)
Ring forceps (Karl Hammacher GmbH, catalog number: HSC 703-96 )
Serrated forceps (Fine Science Tools, catalog number: 11101-09 )
Forceps (Fine Science Tools, catalog number: 91150-20
Fine scissor (Fine Science Tools, catalog number: 14094-11 )
Dissecting microscope (Leica Microsystems, model: MZ125 ) and fiber optic light (LEICA KL 2500 LCD)
Squared Electroporator (BTX The Electroporation Experts, model: ECM830 )
Generator Footswitch (BTX The Electroporation Experts, model: 1250FS )
Platinum plate tweezers-type electrode (Nepa Gene, model: CUY650P5 )
Isofluorane vaporizer (Surgivet®, Smiths Medical, model: 100)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Neuroscience > Development > Neuron
Neuroscience > Neuroanatomy and circuitry > Animal model
Developmental Biology > Morphogenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,256 | https://bio-protocol.org/exchange/protocoldetail?id=1256&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Carotenoid Extraction and Quantification from Capsicum annuum
Richard D. Richins
JK James Kilcrease
LR Laura Rodgriguez-Uribe
MO Mary A. O’Connell
Published: Vol 4, Iss 19, Oct 5, 2014
DOI: 10.21769/BioProtoc.1256 Views: 13496
Edited by: Arsalan Daudi
Original Research Article:
The authors used this protocol in Dec 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2013
Abstract
Carotenoids are ubiquitous pigments that play key roles in photosynthesis and also accumulate to high levels in fruit and flowers. Specific carotenoids play essential roles in human health as these compounds are precursors for Vitamin A; other specific carotenoids are important sources of macular pigments and all carotenoids are important anti-oxidants. Accurate determination of the composition and concentration of this complex set of natural products is therefore important in many different scientific areas. One of the richest sources of these compounds is the fruit of Capsicum; these red, yellow and orange fruit accumulate multiple carotenes and xanthophylls. This report describes the detailed method for the extraction and quantification of specific carotenes and xanthophylls.
Materials and Reagents
Fresh Capsicum fruit (dissected into pericarp tissue, frozen at -80 °C or lyophilized pericarp tissue)
N2 gas
CHCl3 (HPLC grade) (Sigma-Aldrich, catalog number: 472476 )
2-propanol (HPLC grade) (Sigma-Aldrich, catalog number: 34863 )
Methanol (HPLC grade) (Sigma-Aldrich, catalog number: 179337 )
KOH (Sigma-Aldrich, catalog number: P-1767 )
Methyl-t-butyl ether (MTBE) (HPLC grade) (Sigma-Aldrich, catalog number: 34875 )
β-carotene (Sigma-Aldrich, catalog number: C4582 )
Lutein (Sigma-Aldrich, catalog number: 07168 )
Lycopene (Sigma-Aldrich, catalog number: 75051 )
Antheraxanthin (CaroteNature, catalog number: 0231 )
Capsanthin (CaroteNature, catalog number: 0335 )
Capsorubin (CaroteNature, catalog number: 0413 )
Zeaxanthin (CaroteNature, catalog number: 0119 )
Violaxanthin (CaroteNature, catalog number: 0259 )
β-cryptoxanthin (CaroteNature, catalog number: 0055 )
Methanolic KOH (add solid KOH crystals to methanol until the solution is saturated)
Equipment
Farberware soft grips (Food Chopper, model: 83427-93 )
Polytron generator (Polytron Technologies, model: PT 10-35 )
Temperature block (with 1.8 ml microfuge tube rack) (Thermolyne Dri-Bath, model: DB-17615 )
HPLC system equipped with a photodiode array detector and YMC carotenoid column (4.6 x 250 mm) (Waters)
Bath sonicator (Branson Ultrasonic Cleaner, model: 2510 )
Centrifuge (capable of 1,000 x g, 5 min at 4 °C)
Microcentrifuge
UV/Vis spectrophotometer
Vortex mixer
Fume hood
Nitrogen evaporator (Organomation Associates, model: N-EVAP-112 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant biochemistry > Other compound
Biochemistry > Other compound > Carotenoid
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,257 | https://bio-protocol.org/exchange/protocoldetail?id=1257&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Endogenous ABA Extraction and Measurement from Arabidopsis Leaves
Ning Liu
YD Yong Ding
MF Michael Fromm
ZA Zoya Avramova
Published: Vol 4, Iss 19, Oct 5, 2014
DOI: 10.21769/BioProtoc.1257 Views: 12099
Edited by: Arsalan Daudi
Reviewed by: Tie Liu
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
The endogenous messenger, the phytohormone abscisic acid (ABA) plays a major role in plant’s adaption to drought, salinity, cold and other abiotic stresses. In addition to abiotic stress signaling, ABA is involved also in developmental regulation and in responses to diverse biotic stresses. Dehydration stress results in a strong increase in endogenous ABA levels, which can be perceived by RCAR/PYR1/PYL receptors, initiating the ABA signaling pathway to coordinate the genome-wide gene expression, and plants adaptive physiological responses. ABA biosynthesis triggered by environmental cues as well as developmental signals occurs predominantly in vascular parenchyma cells. The measurement of ABA content in different organ/tissues is required to understandings how ABA is produced and delivered within the plants upon various stress conditions and to elucidate its regulatory role in both physiological and transcriptional responses.
Quantitation of ABA can be achieved by two approaches: 1) the use of gas chromatography–tandem mass spectrometry (GC-MS) and 2) the use of immunoassays. Both methods are sensitive to trace amount of ABA down to the low pico-gram (10-12 g/ml FW) range. The GC-MS method needs special facilities, however the antibody based method is relatively simple and can be carried out in laboratory. Here we describe an easy method for ABA extraction from Arabidopsis seedlings, and further determination of ABA levels by competitive ELISA kit.
Materials and Reagents
3-week old Arabidopsis thaliana (A. thaliana) plants.
Methanol (Thermo Fisher Scientific, Acros Organics, catalog number: AC124790010 )
Sterile deionized H2O
Sodium diethyldithiocarbamate trihydrate (Sigma-Aldrich, catalog number: D3506 )
Trizma® base (Sigma-Aldrich, catalog number: T1503 )
Magnesium chloride (Sigma-Aldrich, catalog number: M8266 )
Sodium chloride (Sigma-Aldrich, catalog number: S3104 )
Phytodtek ELISA kit (Agdia, catalog number: PDK 09347 )
Extraction buffer (see Recipes)
Methanolic Tris buffer (see Recipes)
Equipment
Microcentrifuge (Eppendorf, model: 5415R )
Tweezers or forceps
Mortar and pestle
Siliconized borosilicate tube (VWR International, catalog number: EPCTS-13100 )
Liquid nitrogen
pH meter (Corning, catalog number: 443i )
Refrigerator 4 °C
Refrigerated CentriVap Benchtop Vacuum Concentrator (Labconco, catalog: 7310020 )
Vertical light path photometer for microtiter plate (Dynex Semiconductor, MRX revelation microplate reader)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Liu, N., Ding, Y., Fromm, M. and Avramova, Z. (2014). Endogenous ABA Extraction and Measurement from Arabidopsis Leaves. Bio-protocol 4(19): e1257. DOI: 10.21769/BioProtoc.1257.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Plant hormone
Plant Science > Plant physiology > Tissue analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
Detailed Sequences Acquisition?
0 Answer
7 Views
Nov 22, 2022
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,258 | https://bio-protocol.org/exchange/protocoldetail?id=1258&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Agrobacterium tumefaciens-mediated Transformation of Walnut (Juglans regia)
Sriema L. Walawage
CL Charles A. Leslie
Matthew A. Escobar
AD Abhaya M. Dandekar
Published: Vol 4, Iss 19, Oct 5, 2014
DOI: 10.21769/BioProtoc.1258 Views: 13036
Edited by: Tie Liu
Reviewed by: Fang Xu
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
Like many woody plant species, walnut (Juglans regia) can be difficult to genetically transform and regenerate. However, somatic embryos have been used successfully for over two decades as a target tissue for transformation and regeneration of transgenic walnut plants. Walnut somatic embryos, initiated originally from developing zygotic embryos or anther tissue, will proliferate numerous secondary embryos from single cells in the epidermal layer. These single cells in intact somatic embryos can be efficiently transformed by Agrobacterium tumefaciens (A. tumefaciens). This gene transfer system is most efficient when Agrobacterium binary vector plasmids contain a scorable maker gene (e.g. uidA) and a selectable marker gene (e.g. nptII). This system should be applicable to any crop that undergoes repetitive embryogenesis from single Agrobacterium-susceptible cells. Here we describe the method of transforming somatic embryos in detail so that this technique can be applied to walnut and other woody plant species.
Materials and Reagents
Biological materials
Juglans regia somatic embryo cultures
Disarmed A. tumefaciens strain (e.g. EHA101) harboring binary vector of interest
For this protocol it is assumed that the vector harbors the nptII selectable marker gene and the uidA scorable marker gene (e.g. pDE00.0201 from Escobar et al., 2002).
Chemicals
Driver Kuniyuki walnut (DKW) medium with vitamins (PhytoTechnology Laboratories®, catalog number: D2470 )
Kanamycin sulfate (PhytoTechnology Laboratories®, catalog number: K378 )
Timentin® (PhytoTechnology Laboratories®, catalog number: T869 )
4-Hydroxy-3',5'-dimethoxyacetophenone (Acetosyringone) (PhytoTechnology Laboratories®, catalog number: A104 )
GelzanTM CM (Sigma-Aldrich, catalog number: G1910 )
SeaKem® LE agarose (Lonza, catalog number: 50004 )
Bacto® Agar/SuperPureTM agar (BTS, catalog number: A01PD )
Proline (PhytoTechnology Laboratories®, catalog number: D689 )
5-Bromo-4-chloro-3-indolyl β-D-glucuronide (X-gluc) (Sigma-Aldrich, catalog number: B5285 )
1 M sodium phosphate buffer (pH 7.0)
0.5 M EDTA (pH 8.0) (PhytoTechnology Laboratories®, catalog number: E 582 )
0.005 M potassium ferricyanide (Sigma-Aldrich, catalog number: 702587 )
0.005 M potassium ferrocyanide (Sigma-Aldrich, catalog number: P3289 )
Triton X-100 (Sigma-Aldrich, catalog number: 234729 )
Indole-3-butyric acid (IBA) (Sigma-Aldrich, catalog number: B-5386 )
6-Benzylaminopurine (BAP) (Sigma-Aldrich, catalog number: B-3408 )
Tryptone (BTS, catalog number: T01PD )
Yeast extract (BTS, catalog number: Y02MG )
NaCl (Thermo Fisher Scientific, catalog number: S271-3 )
Saturated ZnSO4 or NH4NO3 solution
10x PCR buffer (Applied Biosystems)
PCR primers
dNTPs (Applied Biosystems)
Taq DNA polymerase (Applied Biosystems)
DNeasy Plant Mini Kit (QIAGEN)
Media and supplements
Microbiological media
Agrobacterium liquid growth medium (LB liquid medium) (see Recipes)
Agrobacterium growth plates (LB solid medium) (see Recipes)
Plant media
Driver Kuniyuki walnut (DKW) basal medium (see Recipes)
Virulence induction medium (IM) (see Recipes)
Acetosyringone medium (AS) plates (see Recipes)
KAN/Timentin® selection medium (see Recipes)
KAN only selection medium (see Recipes)
DKW shoot medium (DKW basal medium with 1 mg/L BAP and 0.01 mg/L IBA) (see Recipes)
Glass and Plasticware
Sterile empty 100 x 15 mm Petri plates (VWR International, catalog number: 25384-342 )
Sterile empty 35 x 10 mm Petri plates (BD, FalconTM, catalog number: 25373-041 )
Sterile disposable 50 ml screw-cap centrifuge tubes (BD, FalconTM, catalog number: 352070 )
Sterile disposable cotton-plugged 10 ml pipettes
Plastic pipette tips (20, 200, and 1,000 µl) (Rainin, model: LTS )
Sterile disposable 6-well multiwell plates (BD Biosciences, Falcon®, catalog number: 08-772-1G )
Sterile disposable 96-well multiwell plates (BD Biosciences, Falcon®, catalog number: 08-772-2C )
Filter paper cut to fit in 100 x 15 mm Petri plates and autoclaved
Filter paper discs cut to the diameter of the wells of a 6-well multiwall plate and autoclaved
150 mm diameter desiccator (e.g. Nalgene, catalog number: 5313-0150 )
Magenta GA-7 vessels (Magenta Corp.)
Equipment
Spectrophotometer (e.g. Bio-Rad Laboratories, model: SmartSpec 3000 )
Laboratory centrifuge (e.g. Sigma-Aldrich, Laborzentrifugen Laboratory Centrifuge 3K 10 )
Micro-centrifuge (e.g. Denville, model: 260D )
Continuous power supply units for electrophoresis (e.g. Thermo EC, model: EC 105 and Hoefer, model: HE 33 Mini Submarine unit)
Electrophoresis units for agarose gels (e.g. Fisher Scientific, models: 03-500-124 , 03-500-132 , and 03-500-134 )
Laminar flow hood (e.g. EdgeGard, Baker, model: EG3252 )
Pipetman® 20, 200, and 1,000 µl (Rainin, model: LTS )
Analytical balance (e.g. Mettler Toledo, model: AT261 DeltaRange® )
Top loading electronic balance (e.g. Mettler, model: PM 2000 )
pH meter (e.g. Corning Pinnacle, model: 540 )
Constant temperature incubator (e.g. Napco, model: 301 )
Water baths (e.g.Thermo Scientific, model: 2870 )
Vortex mixer (e.g.: Scientific Industries, model: G 560 )
Freezer (- 80 °C) (e.g. New Brunswick, model: U 700 Premium)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Walawage, S. L., Leslie, C. A., Escobar, M. A. and Dandekar, A. M. (2014). Agrobacterium tumefaciens-mediated Transformation of Walnut (Juglans regia). Bio-protocol 4(19): e1258. DOI: 10.21769/BioProtoc.1258.
Araji, S., Grammer, T. A., Gertzen, R., Anderson, S. D., Mikulic-Petkovsek, M., Veberic, R., Phu, M. L., Solar, A., Leslie, C. A., Dandekar, A. M. and Escobar, M. A. (2014). Novel roles for the polyphenol oxidase enzyme in secondary metabolism and the regulation of cell death in walnut. Plant Physiol 164(3): 1191-1203.
Download Citation in RIS Format
Category
Plant Science > Plant transformation > Agrobacterium
Plant Science > Plant developmental biology > General
Molecular Biology > DNA > Transformation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,259 | https://bio-protocol.org/exchange/protocoldetail?id=1259&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Localisation and Quantification of Reactive Oxygen Species and Nitric Oxide in Arabidopsis Roots in Response to Fungal Infection
KG Kapuganti J. Gupta
YB Yariv Brotman
LM Luis A. J. Mur
Published: Vol 4, Iss 19, Oct 5, 2014
DOI: 10.21769/BioProtoc.1259 Views: 11700
Edited by: Zhaohui Liu
Reviewed by: Igor Cesarino
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
Nitric oxide and reactive oxygen species have emerged as important signalling molecules in plants. The half-lives of NO and ROS are very short therefore rapid and precise measurements are required for the understanding biological roles of these redox active species. Various organelles and compartments generate NO and ROS thus it is important to determine precise location of these free radicals in order to understand their signalling roles. Diaminofluorescen (DAF) and fluorescent 2', 7'-dichlorofluorescein (DCF) dyes are employed to determine NO and ROS localisation. The advantage of this approach is that the dyes diffuse precisely to NO and ROS producing sites and generate fluorescence which can be detected by fluorescence- or confocal laser scanning microscopes. However, this technique has its disadvantages; particularly the specificity of the fluorescence signals needs to be established. Therefore, the use scavenger of NO such as cPTIO and ROS such as ascorbate is required to confirm the specificity of the fluorescence signal and ideally, confirmation of data obtained using other methods due to advantage and disadvantage associated with each method (Gupta and Igamberdiev, 2013). Here we describe a method to detect NO and ROS production from Arabidopsis roots in response to infection by Trichoderma, Fusarium using DAF, gas phase Griess reagent assay and DCF fluorescence methods.
Materials and Reagents
Plant materials: 1-3 weeks old Arabidopsis thaliana sterile seedlings grown in vitro conditions
20 mM HEPES (pH 7.2) (Sigma-Aldrich, catalog number: H3375 )
MS medium with vitamins (Duchefa Biochemie, catalog number: M0222 )
Sodium hypochlorite (NaOCl) (Sigma-Aldrich, catalog number: 425044 )
DAF-2DA (Enzo Life Sciences, catalog number: ALX-620-056-M001 )
PDA medium (Potato dextrose agar)
DCF-2DA fluorescent dye (Life Technologies, InvitrogenTM, catalog number: D-399 )
Carboxy-PTIO potassium salt (Sigma-Aldrich, catalog number: C221 )
Sulphaniliamide (Sigma-Aldrich, catalog number: S9251 )
N-(1-naphthyl) ethylenediamine (NED) (Sigma-Aldrich, catalog number: 222488 )
Potato dextrose agar (PDA) (Difco)
Equipment
Slides
Coverslips
Leica fluorescent microscope
Sterilised forceps
Sterile pipette tips
Micro centrifuge tubes
Micropore tape (VWR International, catalog number: 115-8172 )
Petri dishes
Software
Image J software (version 1.45) Wayne Rasband (NIH)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant immunity > Perception and signaling
Plant Science > Plant physiology > Ion analysis
Biochemistry > Other compound > Reactive oxygen species
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
126 | https://bio-protocol.org/exchange/protocoldetail?id=126&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Arabidopsis Growing Protocol – A General Guide
Xiyan Li
Published: Sep 5, 2011
DOI: 10.21769/BioProtoc.126 Views: 38078
Download PDF
Ask a question
Favorite
Cited by
Abstract
Arabidopsis as the model organism for higher plants is widely studied among plant biology labs around the world. However, taking care of this tiny plant may not be trivial. Here is a general guide used for the Heven Sze lab at the University of Maryland, College Park. A lot of efforts have been taken by the Sze lab and fellow lab members to formulate a general guide for Arabidopsis plant growth in the lab.
Materials and Reagents
Arabidopsis seed
Miracle-Gro® Potting Mix with Fertilizer (2 cubic feet bag) (The Scotts Miracle-Gro Company, model: 74278300 from Lowe’s, Item: 156581)
Miracle-Gro® 8 Qt. Miracle Gro® Perlite (The Scotts Miracle-Gro Company, model: 70752300 , Lowe’s, Item: 68468)
0.1% Triton X-100
Deionized water (D.I. water)
Sterile D.I. water
70% ethanol
Drierite
KNO3
FeNa-EDTA
KH2PO4
MgSO4
Ca(NO3)2.4H2O
Sterilization solution (see Recipes)
1/4 Strength Hoagland’s solution (see Recipes)
Homemade MS (Murashige and Skoog, 1962) medium for Arabidopsis plants under different Ca2+/Mn2+ conditions (see Recipes)
Equipment
The Scotts Miracle-Gro Company
Autoclave bin
Scooper
Fisher dishes
Pots (14 x 8.5 x 6 cm)
Aluminum foil
Humidome
Sealed container
Nylon mesh
Autoclave tape
Growth chamber
Microcentrifuge
Small Fisher dishes (100 x 15 mm size)
Whatman filter paper
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant physiology > Plant growth
Plant Science > Plant developmental biology > General
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,260 | https://bio-protocol.org/exchange/protocoldetail?id=1260&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation and in vivo Transfer of Antigen Presenting Cells
PA Pooja Arora
SK Shalu Sharma Kharkwal
SP Steven A. Porcelli
Published: Vol 4, Iss 19, Oct 5, 2014
DOI: 10.21769/BioProtoc.1260 Views: 12348
Reviewed by: Jia LiSavita Nair
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
Transfer of antigen presenting cells in vivo is a method used by immunologists to examine the potency of antigen presentation by a selected population of cells. This method is most commonly used to analyze presentation of protein antigens to MHC class I or II restricted T cells, but it can also be used for studies of nonconventional antigens such as CD1-presented lipids. In a recent study focusing on CD1d-restricted glycolipid antigen presentation to Natural Killer T cells, we compared antigen presenting properties of splenic B cells, CD8αPos dendritc cells (DCs) and CD8αNeg DCs (Arora et al., 2014). This protocol describes the detailed method used for isolation of these cell populations, and their transfer into recipient mice to analyze their antigen presenting properties.
As a percentage of total mononuclear cells, an average spleen contains approximately 1-3% myeloid dendritic cells (DCs). In absolute numbers, this translates to approximately 0.6-1.8 x 106 DCs. To enhance the number of DCs in spleen, mice were injected subcutaneously with cells from a cultured melanoma cell line (B16.Flt3L) which has been engineered to express the fms-related tyrosine kinase 3 ligand (Flt3L) (Mach et al., 2000). This protein is a growth factor homologous to colony stimulating factor-1 and plays a critical role in the differentiation of hematopoietic stem cells. Administration of this protein into mice as a purified protein results in the expansion of both CD8αPos and CD8αNeg DC subsets in multiple organs. Similar expansion is also seen in mice that have been implanted with tumor cells overexpressing this protein (Mach et al., 2000). In our experience, up to 60% of the total mononuclear cells in a spleen from a mouse with a palpable B16.Flt3L tumor can be CD11c positive dendritic cells, thereby giving a total yield of up to 5 x 107 DCs per mouse. A schematic illustrating the cell enrichment protocol is included in Figure 1, and representative data on purity of cell populations obtained with this protocol is shown in Figure 2.
Keywords: Isolation Antigen presenting cell (APC) Dendritic Cell Purification Antigen pulsing
Materials and Reagents
Source of splenocytes: 6-8 week old female C57BL/6 mice (Jackson ImmunoResearch Laboratories)
Murine B16.Flt3L melanoma cell line [as described by Mach et al. (2000)]
Ultrapure water
0.05% Trypsin-EDTA (Life Technologies, Gibco®, catalog number: 25300-054 )
Isoflurane (Sigma-Aldrich, catalog number: CDS019936 -250MG)
Collagenase D (Roche Diagnostics, catalog number: 11088858001 )
DNase I, dry powder (QIAGEN, catalog number: 79254 )
70% Ethanol (prepared from 200 proof ethanol) (Thermo Fisher Scientific, catalog number: 9-6705-004-220 )
RBC lysis buffer (Sigma-Aldrich, catalog number: R7757 )
RPMI-1640 medium with L-glutamine (Life Technologies, Gibco®, catalog number: 11875-119 )
DMEM medium with L-glutamine (Life Technologies, Gibco®, catalog number: 11995-073 )
200 mM L-glutamine (Life Technologies, catalog number: 25030081 )
MEM non-essential amino acids (Life Technologies, Gibco®, catalog number: 11140-050 )
MEM essential amino acids (Life Technologies, catalog number: 11130-051 )
β-mercaptoethanol (Life Technologies, InvitrogenTM, catalog number: 21985-023 )
Sodium pyruvate (Life Technologies, catalog number: 11360-070 )
HEPES (Life Technologies, InvitrogenTM, catalog number: 15630 )
Phosphate buffered saline (PBS) (Ca2+ and Mg2+ free, pH 7.2) (Life Technologies, InvitrogenTM, catalog number: 20012-050 )
Dulbecco’s PBS (DPBS) with Ca2+ and Mg2+ (Life Technologies, Gibco®, catalog number: 14040-182 )
0.5 M Ethylenediaminetetraacetate (EDTA) solution (Life Technologies, catalog number: 15575-020 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A2153 )
Fetal calf serum (Atlanta Biologicals, catalog number: S11050 )
Penicillin/streptomycin (Life Technologies, InvitrogenTM, catalog number: 15140-163 )
Trypan blue (dry powder) (Sigma-Aldrich, catalog number: T6146 -5G)
Magnetic beads conjugated with anti-mouse CD19 (Miltenyi Biotech, catalog number: 120-000-323 )
Magnetic beads conjugated with anti-mouse CD11c (Miltenyi Biotech, catalog number: 130-152-001 )
CD8αPos mouse DC isolation kit (Miltenyi Biotech, catalog number: 130-091-169 )
Fc-gamma receptor blocking antibody (Clone 2.4G2) (BD Biosciences, catalog number: 553141 ).
Anti-mouse CD11c-FITC (BD Biosciences, catalog number: 553801 )
Anti-mouse CD8α-PerCP (BD Biosciences, catalog number: 553036 )
Anti-mouse B220-PE (BD Biosciences, catalog number: 553090 )
0.08% trypan blue (see Recipes)
Serum free DMEM and RPMI media (see Recipes)
Complete RPMI and DMEM media (see Recipes)
MACS buffer (see Recipes)
FACS staining buffer (see Recipes)
10x collagenase D solution (see Recipes)
Equipment
1 ml syringes (BD, catalog number: 26048 )
23 G1 needle (BD, catalog number: 305145 )
100 mm Petri dishes (Thermo Fisher Scientific, catalog number: 0875712 )
Surgical instruments (Kent Scientific, catalog number: INSMOUSEKIT )
Cell strainer (70 µm) (BD, catalog number: 352350 )
Large Petri plates (Thermo Fisher Scientific, catalog number: FB0875712 )
Vacuum filtration system (500 ml, 0.22 um) (Corning, catalog number: 431097 )
LS columns (Miltenyi Biotec, catalog number: 130-042-401 )
Magnetic stand MACS separator (Miltenyi Biotec, catalog number: 130-042-302 )
Wide-bore 200 μl pipette tips (PerkinElmer, catalog number: 111623 )
Corning ultra-low attachment 96-well plates (Corning, catalog number: CLS3474-24EA )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Arora, P., Kharkwal, S. S. and Porcelli, S. A. (2014). Isolation and in vivo Transfer of Antigen Presenting Cells. Bio-protocol 4(19): e1260. DOI: 10.21769/BioProtoc.1260.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Antigen-specific response
Immunology > Immune cell function > Lymphocyte
Immunology > Immune cell isolation > Lymphocyte
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,261 | https://bio-protocol.org/exchange/protocoldetail?id=1261&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Plastic Embedding of Arabidopsis Stem Sections
FC Florian Chevalier*
SI Soledad Montalbán Iglesias*
ÓS Óscar Javier Sánchez*
LM Lluís Montoliu
Pilar Cubas
*Contributed equally to this work
Published: Vol 4, Iss 20, Oct 20, 2014
DOI: 10.21769/BioProtoc.1261 Views: 13921
Edited by: Ru Zhang
Reviewed by: Elias Bassil
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
The inflorescence stem of the flowering plant Arabidopsis thaliana (thale cress) is an excellent model system to investigate plant vascular tissue patterning and development. Plant vasculature is a complex conducting tissue arranged in strands called vascular bundles, formed by xylem (tissue that carries water) and phloem (tissue that carries photosynthates and signaling molecules). Xylem and phloem are originated from cell division of the meristematic cells of the vascular cambium. In Arabidopsis the flowering stem elongates about three weeks after germination. At this stage it is possible to visualize defects in its development and morphology. Here we describe a protocol to embed in plastic (resin) stem segments either freshly dissected from living plants or previously assayed for β-glucuronidase. This protocol provides an excellent cellular morphology ideal to visualize stem cell types including those of vascular bundles using high-resolution light microscopy.
Keywords: Arabidopsis Resin sections Stem Vascular tissue phenotype Plastic sections
Materials and Reagents
30 day-old Arabidopsis stem fragments
90% acetone
4% glutaraldehyde
0.1% Tween 20
Absolute ethanol
Historesin standard kit (Reichert-Jung, catalog number: 7O-2218-500)
Components:
Basic resin liquid (Figure 2A)
Activator powder
Hardener
Cresyl violet acetate (Sigma-Aldrich, catalog number: C-5042)
Preinfiltration solution (see Recipes)
Infiltration solution (see Recipes)
Embedding medium (see Recipes)
Cresyl violet staining medium (see Recipes)
Equipment
Vacuum pump (Figure 1)
Vacuum jar (Figure 1)
Histomold trays (6 x 8 mm) (Leica Microsystems, catalog number: 14702218311)
Histomold trays (13 x 19 mm) (Leica Microsystems, catalog number: 14702218313)
Specimen Holder adapter (Leica Microsystems, catalog number: 14702218310)
Drying oven DO-90 (Raypa)
Motorized microtome Leica RM2155 (Leica Microsystems)
Water/ethanol bath HI 1210 (Leica Microsystems)
Tungsten carbide disposable blades TC-65 (Leica Microsystems, catalog number: 140216266379)
Glass slides Superfrost ultra plus (Menzel-Glasër, catalog number: J3800AMNZ)
Surgipath micromount (Leica Microsystems, catalog number: 3801731)
Coverslip (24 x 60) (Menzel-Glasër, catalog number: BB024060A1)
Figure 1. Vacuum jar and vacuum pump used for tissue infiltration
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chevalier, F., Iglesias, S. M., Sánchez, Ó. J., Montoliu, L. and Cubas, P. (2014). Plastic Embedding of Arabidopsis Stem Sections. Bio-protocol 4(20): e1261. DOI: 10.21769/BioProtoc.1261.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell imaging
Plant Science > Plant developmental biology > Morphogenesis
Cell Biology > Cell imaging > Fixed-tissue imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,262 | https://bio-protocol.org/exchange/protocoldetail?id=1262&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Expression and Purification of the Eukaryotic MBP-MOS1 Transposase from Sf21 Insect Cells
JJ Jérôme Jaillet
AD Audrey Dussaussois-Montagne
SR Sylvaine Renault
Corinne Augé-Gouillou
Published: Vol 4, Iss 20, Oct 20, 2014
DOI: 10.21769/BioProtoc.1262 Views: 10891
Reviewed by: Longping Victor Tse
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
Here, we present the full-length protocol for purifying the recombinant MOS1 transposase from insect cells used in our recent publication (Pflieger et al., 2014), which involved a N-terminal MBP-tag and maltose-affinity chromatography.
Due to their overall basic properties, transposases are often difficult to purify, especially because they tend to aggregate. Since the 90s, we chose a method of purification without a denaturation step. Our first priority was to preserve the 3D structure of the protein in order to maintain its biochemical activities with the highest specific activity. Nevertheless, our production/purification made from bacteria regularly contain truncated products (or degradation products) and their levels increase with concentration of purified transposase. In contrast, production/purification made from eukaryotic cells do not contain such degradation product. We thus developed a protocol involving the pVL1392 baculovirus transfer vector and the BaculoGoldTM baculovirus expression system, allowing the expression of recombinant MOS1 from baculovirus-infected Sf21 cells.
Materials and Reagents
Sf21 cells (Life Technologies, Gibco®, catalog number: 11497 )
Insect Express Sf9/S2 medium (PAA, catalog number: E15-875 )
Fetal bovine serum (Life Technologies, Gibco®)
Baculogold baculovirus expression system (BD Biosciences, catalog numbers: 554739 and 560129 )
Anti-MBP anti-body (Santa Cruz, catalog number: sc-808 )
Tris.HCl (pH 7.6)
NaCl
DTT
NP40
Antiprotease cocktails (like Roche’s EDTA-free cocktail tablets, catalog number: 11-873 580-001 )
Maltose
Bovine serum albumin (BSA)
Lysis buffer (see Recipes)
Binding buffer (see Recipes)
Elution buffer (see Recipes)
Equipment
25 cm2, 150 cm2 flask (usual culture-cell equipment)
1 ml prepacked column (GE Healthcare, MBPTrap™ HP) or 1 ml of amylose resin in batch (New England Biolabs)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Molecular Biology > Protein > Expression
Biochemistry > Protein > Expression
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,263 | https://bio-protocol.org/exchange/protocoldetail?id=1263&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Seed Storage Reserve Analysis
Harrie van Erp
GM Guillaume Menard
PE Peter J. Eastmond
Published: Vol 4, Iss 20, Oct 20, 2014
DOI: 10.21769/BioProtoc.1263 Views: 8530
Edited by: Tie Liu
Reviewed by: Yurong Xie
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
One of the major goals of plant research is to improve crop yield, by for instance increasing seed oil or protein content. Besides this, extensive research is done to change seed fatty acid (FA) composition in order to make vegetable oils more suitable for specific purposes. To determine the effect of genetic changes on seed FA composition, oil, protein and sugar content it’s important to use standardised protocols to compare results between different research groups. Here we describe standardised methods for the analysis of seed FA composition, oil, protein and sugar content.
Materials and Reagents
Dry oilseed rape (Brassica napus) seed samples
KCl (Sigma-Aldrich, catalog number: 31248-500G )
Methanolic-HCl (Sigma-Aldrich, catalog number: 33050-U )
Hexane (Sigma-Aldrich, catalog number: 10549380 )
Toluene (Sigma-Aldrich, catalog number: 650579 )
Pentadecanoin (Nu-Chek, catalog number: N-15-A )
Heptadecanoin (Nu-Check, catalog number: N-17-A )
Fatty acid standard (Supelco 37 component FAME mix) (Sigma-Aldrich, Supelco, catalog number: 47885-U )
6 ml screw cap glass vial (Schott AG, VWR, catalog number: 391-0140 ).
Organic solvent resistant caps for 6 ml screw cap vials (SKS-Science, catalog number: 240409 ).
GC column (BPX70) (SGE Analytical Science, catalog number: 0 54600 )
98% ethanol (Sigma-Aldrich, catalog number: 459844 )
Sodium hydroxide (NaOH) (Sigma-Aldrich, catalog number: S5881 )
80% ethanol (v/v) diluted in distilled water
50% ethanol (v/v) diluted in distilled water
0.1 M NaOH (4 g/L) in distilled water
Potassium hydroxide (KOH) (Sigma-Aldrich, catalog number: 484016 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M8266 )
Adenosine-5'-triphosphate (ATP) (Roche Diagnostics, catalog number: 10 127 531 001 )
Sucrose (Sigma-Aldrich, catalog number: 84097 )
Nicotinamide adenine dinucleotide phosphate (NADP) (Roche Diagnostics, catalog number: 10 240 35 4001 )
Glucose-6-Phosphate Dehydrogenase grade II (G6PDHII) (Roche Diagnostics, catalog number: 10 737 232 001 ) (80 μl, centrifuge and resuspend pellet in 200 μl of Buffer B)
Hexokinase (HK) (Roche Diagnostics, catalog number: 11 426 362 001 ) (120 μl, centrifuge and resuspend pellet in 200 μl of Buffer B)
Phosphoglucose isomerase (PGI) (Roche Diagnostics, catalog number: 10 128 139 001 ) (60 μl, centrifuge and resuspend pellet in 200 μl of Buffer B)
Invertase (INV) (Sigma-Aldrich, catalog number: I4504 ) (as much as possible to dissolve in 200 μl of Buffer B)
60 mg/ml ATP in distilled water
36 mg/ml NADP in distilled water
Buffer A (see Recipes)
Buffer B (see Recipes)
Reagent mix 1 (see Recipes)
Equipment
Gas chromatograph (GC) (Agilent, model: 7890A )
MinispecMQ20 (Bruker Corporation)
Robotic sample handling system (Rohasys BV)
Centrifuges
For the "Sucrose and protein content determination" procedure: Eppendorf Centrifuge 5415 R (Eppendorf, catalog number: 022621408 )
For the "Determination of seed FA content and composition" procedure: Eppendorf Centrifuge 5810 R (Eppendorf, catalog number: 5811 000.010 )
Vortex-Genie 2 Shaker (Scientific Industries, Cole-Parmer, catalog number: UY-04724-05 )
2 ml Eppendorf tube (Sigma-Aldrich, catalog number: T2795 but not important )
Microplate 96 wells (Sigma-Aldrich, catalog number: M4561 but not important )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Erp, H. V., Menard, G. and Eastmond, P. J. (2014). Seed Storage Reserve Analysis. Bio-protocol 4(20): e1263. DOI: 10.21769/BioProtoc.1263.
van Erp, H., Kelly, A. A., Menard, G. and Eastmond, P. J. (2014). Multigene engineering of triacylglycerol metabolism boosts seed oil content in Arabidopsis. Plant Physiol 165(1): 30-36.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Tissue analysis
Plant Science > Plant biochemistry > Lipid
Biochemistry > Lipid > Lipid measurement
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,264 | https://bio-protocol.org/exchange/protocoldetail?id=1264&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of TACE Activity in Extracts from Cultured Cells
Xiuling Xu
MP Mabel T. Padilla
Yong Lin
Published: Vol 4, Iss 20, Oct 20, 2014
DOI: 10.21769/BioProtoc.1264 Views: 8631
Edited by: HongLok Lung
Reviewed by: Elizabeth V. ClarkeGuillaume Bompard
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
In cigarette smoke–induced and inflammation-associated lung cancer development, cigarette smoke extract (CSE) activates tumor necrosis factor-alpha (TNF-α) secretion from macrophages. TNF-α converting enzyme (TACE), also known as α-Secretase or ADAM17 (A Disintegrin and Metalloprotease), is a member of the ADAM family of metalloproteases. TACE mediated ectodomain shedding leads to the conversion of the inactive TNF-α precursor into the active mature pro-inflammatory cytokine. The SensoLyte 520 TACE (α-Secretase) Activity Assay Kit was used to detect TACE activity in CSE-activated macrophages. This assay is reliable, reproducible and easy to carry out in 96 well plate format.
Keywords: TACE TNF-alpha Cell culture Extract Secretion
Materials and Reagents
Cultured cells such as the macrophage line THP1
SensoLyte 520 TACE (α-Secretase) Activity Assay Kit *Fluorimetric* (AnaSpec, catalog number: 72085 )
Components used from the kit:
Component A QXL™ 520/5-FAM (TACE substrate, Ex/Em = 490 nm/520 nm)
Component B 5-FAM, fluorescence reference standard (Ex/Em = 490 nm/520 nm)
Component C assay buffer
Triton-X 100 (Sigma-Aldrich, catalog number: T8532 )
Phosphate buffered saline (PBS) (see Recipes)
Equipment
96 well black microplate (for fluorescence analysis) (Greiner Bio-One GmbH, catalog number: 655077 )
Tube/vial unidirectional rotator (Glas-Col, catalog number: 099A RD4512 )
Cell lifter (polyethylene, sterile) (Corning Incorporated Costar, catalog number: 3008 )
1.5 ml microcentrifuge tubes (polypropylene) (USA Scientific, catalog number: 1615-5599 )
Microplate fluorometer with detection range (excitation 490 nm and emission 520 nm) (settings recommended by SensoLyte 520 TACE Activity Assay Kit) (Thermo Fisher Scientific, Fluoroskan AscentTM) (used for TACE activity assay)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Xu, X., Padilla, M. T. and Lin, Y. (2014). Measurement of TACE Activity in Extracts from Cultured Cells. Bio-protocol 4(20): e1264. DOI: 10.21769/BioProtoc.1264.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Cytokine
Immunology > Immune cell function > Macrophage
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,265 | https://bio-protocol.org/exchange/protocoldetail?id=1265&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Extraction and Purification of Mycobacterial Mycolic Acids
CD Christian M. Dupont
LK Laurent Kremer
Published: Vol 4, Iss 20, Oct 20, 2014
DOI: 10.21769/BioProtoc.1265 Views: 13458
Edited by: Fanglian He
Reviewed by: Elizabeth Libby
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
Mycolic acids are major long-chain fatty acids, containing up to 80-90 carbon atoms that represent essential components of the mycobacterial cell wall (Pawelczyk and Kremer, 2014). Each mycobacterial species possesses a specific mycolic acid profile characterized by various chemical modifications that decorate the lipid. Mycolic acids play a critical role in the architecture and impermeability of the cell envelope, hence the natural resistance of mycobacteria to most antibiotic treatments. They are also key determinants of virulence in pathogenic species, including Mycobacterium tuberculosis (M. tuberculosis), the causative agent of tuberculosis. In addition, they are known as the primary target of several first-line and second-line antitubercular drugs. Thus, the unique enzymes involved in the mycolic acid biosynthetic pathway represent an attractive reservoir of targets for future chemotherapy whose developments are particularly warranted in the context of multi-drug-resistant and extensively-drug-resistant strains of M. tuberculosis. Herein, we describe a protocol to extract the mycolic acids from mycobacteria. Purification of the various subspecies may be particularly useful for subsequent structural studies involving mass spectrometry or NMR. The qualitative and quantitative biochemical characterization of the mycolic acid pattern by thin layer chromatography can be used to address how drugs alter mycolic acid biosynthesis (Alahari et al., 2007, Hartkoorn et al., 2012), to study the phenotypes of genetically modified mutants affected in this metabolic pathway (Bhatt et al., 2007) or to unravel new mycolic acid regulatory mechanisms (Vilcheze et al., 2014). The same protocol can be applied to all mycobacteria, including environmental and pathogenic species.
Keywords: Mycobacterium Mycolic acid Cell wall Thin layer chromatography Lipid
Materials and Reagents
Mycobacterial cultures including Mycobacterium tuberculosis, BCG, M. smegmatis and M. abscessus but can be extended to any other species.
Tyloxapol (C17H30O4) (Sigma-Aldrich, catalog number: T8761 )
Glycerol (C3H8O3, 99.5%) (Euromedex, catalog number: 50405 )
Potassium diphosphate (K2HPO4) (Merck KGaA, catalog number: 1.05104 )
L-asparagine monohydrate (C4H10N2O4, ≥99%) (Sigma-Aldrich, catalog number: A8381 )
Citric acid (C6H8O7, 99%) (Sigma-Aldrich, catalog number: C0759 )
Ferric ammonium citrate (C7H13FeNO7) (Sigma-Aldrich, catalog number: F5879 )
Zinc sulfate heptahydrate (ZnSO4.7H2O, ≥99%) (Sigma-Aldrich, catalog number: Z4750 )
Magnesium sulfate (MgSO4) (Sigma-Aldrich, catalog number: M7506 )
Tetrabutyl ammonium hydroxyde (TBAH) (C16H37NO, 40% solution) (Sigma-Aldrich, catalog number: 178780 )
Dichloromethane (CH2Cl2, ≥99.8%) (Carlo Erba, catalog number: 412622000 )
Iodomethane (CH3I, 99%) (Sigma-Aldrich, catalog number: I850-7 )
Diethylether (CH3CH2OCH2CH3, 99.5%) (Carlo Erba, catalog number: 447521 )
Hexane [CH3(CH2)4CH3, pure isomeric mixture] (Carlo Erba, catalog number: 339852 )
Ethyl acetate (CH3COOC2H5, 99.9%) (Carlo Erba, catalog number: 448251 )
Molybdophosphoric acid hydrate (H5Mo12O41P) (Sigma-Aldrich, catalog number P7390 )
Rhodamine 6G (C28H31ClN2O3, Dye content ~95 %) (Sigma-Aldrich, catalog number R4127 )
Middlebrook 7H9 broth (Difco, catalog number: 271310 )
Sauton’s media (see Recipes)
Equipment
Aluminium Silica gel TLC plates 60F254 (Merck KGaA, catalog number: 1.05554.0001 )
Plastic Silica gel TLC plates 60F254 (Merck KGaA, catalog number: 1.05735.0001 )
Round-bottom borosilicate glass tubes (Corning, catalog number: 99449-16 ) with phenolic screw caps (Corning, catalog number: 9998-15 )
10 µl capillary tubes Ringcaps (Dutscher Scientific, catalog number: 0 90512 )
Spectrophotometer
75 cm2 tissue culture flasks (Sarstedt, catalog number: 83.1813 )
37 °C incubator or 30 °C incubator for growing mycobacteria such as M. marinum
Notes: Atypical mycobacteria and BCG should be handled according to institutional standards of practice for biosafety whereas M. tuberculosis cultures should be handled in biosafety level 3 facility.
50 ml conical Corning CentriStart tubes (Corning, catalog number: 430828 )
15 ml conical Corning CentriStart tubes (Corning, catalog number: 430790 )
Centrifuge with swinging bucket rotor for spinning down bacterial cultures (for example, Prolabo, model: HR340 with the 15 ml and 50 ml adaptors)
pH meter
Ultrasonic waterbath (Bandelin Sonorex, model: RK102H )
Stuart Rotator SB3
Stuart block heater (Stuart, model: SBH200D )
TLC developing tank
Zymark TurboVap evaporator (Biotage, catalog number: C133718 )
Handheld UV lamp VL-6-LC 365 nm/254 nm
1800W Heat gun (Power Performance, model: PHG1800T2 )
Reagent Sprayer, all glass, with 100 ml Erlenmeyer flask (CAMAG, catalog number: 022.6100 )
TLC Spray Cabinet (CAMAG, catalog number: 0 22.623 0)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Dupont, C. M. and Kremer, L. (2014). Extraction and Purification of Mycobacterial Mycolic Acids . Bio-protocol 4(20): e1265. DOI: 10.21769/BioProtoc.1265.
Alahari, A., Trivelli, X., Guérardel, Y., Dover, L. G., Besra, G. S., Sacchettini, J. C., Reynolds, R. C., Coxon, G. D. and Kremer, L. (2007). Thiacetazone, an antitubercular drug that inhibits cyclopropanation of cell wall mycolic acids in mycobacteria. PLoS One 2(12): e1343.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Lipid
Biochemistry > Lipid > Lipid isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,266 | https://bio-protocol.org/exchange/protocoldetail?id=1266&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Assay for Cytidine Deaminase Activity of APOBEC3 Protein
Smita Nair
AR Alan Rein
Published: Vol 4, Iss 20, Oct 20, 2014
DOI: 10.21769/BioProtoc.1266 Views: 12406
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
Cytidine deaminases are enzymes that catalyze the removal of an amino group from cytidine, forming uridine. APOBEC3 (ApolipoproteinB mRNA editing enzyme, catalytic polypeptide like) proteins are cytidine deaminases that deaminate cytidines in polynucleotides (RNA/DNA), resulting in editing of their target substrates. Mammalian APOBEC3 proteins are an important element in cellular defenses against retrovirus replication, and this “restriction” of retroviral infections is partially due to the cytidine deaminase activity of the APOBEC3.The present protocol (Nair et al., 2014) describes the assay to detect the deaminase activity of mouse APOBEC3 protein, which targets cytidines present in TCC or TTC motifs in a single-stranded DNA substrate. In brief, the protein preparation to be assayed is incubated with a fluorophore-labeled oligodeoxynucleotide containing the deamination target motif (radiolabeled oligonucleotide substrates have also been successfully used by other groups). Cytidines in the oligonucleotide are deaminated to uridines; the addition of Uracil DNA Glycosylase (UDG) catalyzes the hydrolysis of the N-glycosylic bond between uracil and sugar, generating an abasic (AB) site in the oligonucleotide. Mild alkali treatment cleaves the substrate oligonucleotide at the AB site; cleaved products are resolved from uncleaved substrate by denaturing polyacrylamide gel electrophoresis and visualized on a fluorescence scanner.
The protocol described here is mainly adapted from that described by Iwatani et al. (2006) with modifications. The assay can, of course, be used to detect the activity of other APOBEC3 deaminases targeting DNA substrates, using oligonucleotides containing the cytidine-containing target sequence for the deaminase.
Keywords: APOBEC3 Retrovirus restriction Cytidine deaminase In vitro deaminase assay
Materials and Reagents
5’ N-AlexaFluor488-labeled oligodeoxynucleotide (custom synthesized from Integrated DNA Technologies)
Example: 5' -/5Alex488N/ATA ATA ATA ATA ATA ATA ATA ATA TCC ATA ATA ATA ATA ATA ATA ATA-3’, PAGE purified, 250 nmol synthesis scale (see Recipes) (while a 48-base oligodeoxynucleotide is described here, both longer and shorter oligodeoxynucleotides could undoubtedly be used).
Nuclease-free or autoclaved sterile water
1 U/µl Uracil DNA glycosylase (Thermo Fisher Scientific, catalog number: EN0361 )
0.6 N NaOH
2x RNA loading dye (Thermo Fisher Scientific, catalog number: R0641 )
10 bp DNA ladder (Life Technologies, catalog number: 10821-015 )
Tris (Sigma-Aldrich)
NaCl (Sigma-Aldrich)
DTT (Sigma-Aldrich)
Novex® TBE-UREA gel (Life Technologies, catalog number: EC6885BOX/EC68852BOX )
Boric acid
EDTA
10x deaminase buffer (see Recipes)
10x Uracil DNA glycosylase reaction buffer (see Recipes)
10x Tris borate EDTA (TBE) buffer (see Recipes)
N-AlexaFluor labelled oligodeoxynucleotides (see Recipes)
Equipment
RNase- and DNase-free 0.5 ml microcentrifuge tubes
37 °C water bath
Heating Block set to 95 °C
XCellSureLock® Mini-Cell Electrophoresis apparatus (Life Technologies, catalog number: EI0001 )
Powerpac Basic Power Supply (Bio-Rad Laboratories, catalog number: 164-5050 )
Typhoon Imager (Trio+, variable mode imager) (GE Healthcare, catalog number: 2340730 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Nair, S. and Rein, A. (2014). In vitro Assay for Cytidine Deaminase Activity of APOBEC3 Protein. Bio-protocol 4(20): e1266. DOI: 10.21769/BioProtoc.1266.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,267 | https://bio-protocol.org/exchange/protocoldetail?id=1267&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Olfactory Habituation in Fasted Mice
Tifany Desprez
GM Giovanni Marsicano
Edgar Soria-Gomez
Published: Vol 4, Iss 20, Oct 20, 2014
DOI: 10.21769/BioProtoc.1267 Views: 9062
Edited by: Soyun Kim
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
Sensory perception is tightly modulated by the individual’s internal states. In particular, it has been shown that olfactory processes are constantly influenced by metabolic signals reflecting the energy status of the body. Thus, it is important to implement novel approaches to evaluate the impact of body energy changes on olfactory performance. Here, we describe a behavioral protocol to accurately evaluate olfactory habituation in fasted mice (Soria-Gomez et al., 2014) using basic equipment that mice are familiar with. Briefly, the mouse is placed in a test cage where it is presented first, an odorless solvent (the control), then an odor A (twice) and finally an odor B. This test relies on the fact that animals present an attenuation of the behavioral response after several presentations of the same olfactory stimulus.
Keywords: Food intake Fasting Mice Olfactory habituation Olfactory test
Materials and Reagents
Animals: C57/BL6N male mice (Janvier Labs)
Mineral oil (Sigma-Aldrich, catalog number: M-5904 )
Isoamyl acetate (banana odor) (Sigma-Aldrich, catalog number: W205508 )
Benzaldehyde (almond odor) (Sigma-Aldrich, catalog number: 418099 )
20% ethanol
Note: Mineral oil was used as a solvent, because of its odorless property as reported in the literature (Linster et al., 2009; Qiu et al., 2014; Slotnick and Restrepo, 2005; Tan et al., 2010). Almond and banana odors were used as novel, yet neutral odors(Yang et al., 2013; Yang and Crawley, 2009). However, other odors are also suitable to test in our conditions, such as hexanal.
Equipment
Standard individual plexiglass cage for mice (see Figure 1A)
Water bottle cap with sipper tube made in stainless steel (from now called Odor holder, see Figure 1B) (Tecniplast)
Filter paper (Thermo Fisher Scientific, see Figure 1C and Figure 2)
Opaque eppendorfs (1 ml volume) (Eppendorf, see Figure 1C)
Scissors
10 µl pipet
10 µl pipet tips
Tissue paper
Standard table to place the test cage
CCTV camera for an aerial view of the test
Standard computer (PC or Mac)
Figure 1. Basic material to perform the olfactory habituation test. A) Test cage made in plexiglass (12 cm width x 30 cm length x 13 cm height), with a circular perforation (5 cm diameter) in one of the extremes. B) Odor holder made in stainless steel (5 cm height from the base to the top of the sipper tube; base of 5 cm diameter; the hole of the sipper tube of 3 mm diameter). C) Standard opaque Eppendorf (left) containing the odor solution and the filter paper (3 cm height x 1 cm width) used to administer the odor. This filter paper is introduced in the sipper tube of B).
Software
Video recording software (GrabBee, grabbee.software.informer.com)
Software to analyze exploratory behavior (Behav_Scor_v3.0_beta)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Desprez, T., Marsicano, G. and Soria-Gómez, E. (2014). Olfactory Habituation in Fasted Mice. Bio-protocol 4(20): e1267. DOI: 10.21769/BioProtoc.1267.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Cognition
Neuroscience > Behavioral neuroscience > Learning and memory
Neuroscience > Sensory and motor systems
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,268 | https://bio-protocol.org/exchange/protocoldetail?id=1268&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Fluorescence Recovery after Photobleaching (FRAP) Assay to Measure the Dynamics of Fluorescence Tagged Proteins in Endoplasmic Reticulum Membranes of Plant Cells
José Antonio Navarro
MS Marta Serra-Soriano
Vicente Pallás
Published: Vol 4, Iss 20, Oct 20, 2014
DOI: 10.21769/BioProtoc.1268 Views: 17680
Edited by: Tie Liu
Reviewed by: Hiromasa SaitohArsalan Daudi
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
In this protocol, we used fluorescence recovery after photobleaching (FRAP) to measure the influence that some mutations and drug treatment have on mobility of a green fluorescent protein (GFP)-fused viral transmembrane protein into endoplasmic reticulum membranes (Serra-Soriano et al., 2014). The proteins of interest were transiently expressed in Nicotiana benthamiana (N. benthamiana) epidermic cells by agro-infiltration. To minimize transient overexpression artifacts, fluorescence intensity values were gathered at 36 hpi using an inverted Zeiss LSM 780 confocal microscope. Only epidermic cells showing moderated expression levels and homogenous distribution through the ER of the GFP-tagged proteins were used for further experiments. To examine the role of actin polymerization in the mobilization of GFP-tagged proteins, we pretreated tissue samples either with latrunculin B, an inhibitor of actin polymerization, or with DMSO as control. The generated fluorescence recovery curves were used to obtain the percentage of maximum fluorescence recovery (MFR), which corresponds to the mobile fraction, and the half-time of maximum recovery (t1/2) values.
Materials and Reagents
3-4 weeks old Nicotiana benthamiana plants
Agrobacterium tumefaciens (A. tumefaciens) C58C1 strain or similar transformed with the binary vector pMOG800 harboring the protein coding sequence. In our case they were:
pMGFP-p7B encoding GFP-fused Melon necrotic spot virus (MNSV) p7B
pMGFP-p7B [D7AP10A] encoding GFP-fused MNSV p7B carrying D7AP10A mutation
pMGFP-p7B [K49A] encoding GFP-fused MNSV p7B carrying K49A mutation
pMGFP-KDEL encoding a GFP engineered to be targeted to the ER lumen
Yeast extract (Difco, catalog number: 212750 )
Tryptone (Difco, catalog number: 211705 )
Sodium chloride (NaCl) (Panreac Applichem, catalog number: 131659 )
Acetosyringone (Sigma-Aldrich, catalog number: D134406 )
MES (Sigma-Aldrich, catalog number: M8250 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M9272 )
Antibiotics
Kanamycin (50 mg/ml) (Sigma-Aldrich, catalog number: K4000 )
Rifampicin (50 mg/ml) (Duchefa Biochemie, catalog number: R0146 )
Mowiol® 4-88 (Sigma-Aldrich, catalog number: 81381 )
Dabco® 33-LV (Sigma-Aldrich, catalog number: 290734 )
Tris base (Roche Diagnostics, catalog number: 03118142001 )
Tris-HCl (1 M, pH 5.6)
Immersion oil Immersol 518 F (ZEISS, catalog number: 444960-0000-000 )
Latrunculin B (Sigma-Aldrich, catalog number: L5288 )
25 µM Latrunculin B solution in 10 mM DMSO
LB medium (see Recipes)
Agrobacterium infiltration buffer (see Recipes)
Mowiol mounting medium (see Recipes)
Equipment
28 °C growing chamber
15 ml culture tubes
Swinging centrifuge rotor for 15 ml tubes
1.5 ml tubes (standard Eppendorf tubes or similar)
BioPhotometer plus (Eppendorf)
1 ml syringes without needle
Plant growing chamber
Fine paddle forceps
Petri culture dishes 35 x 10 mm
Microscope slides 76 x 26 mm (Menzel-Gläser, catalog number: AA00000112E )
Microscope cover slips 24 x 24 mm Nr. 1 (Menzel-Gläser, catalog number: BB024024A1 )
Adhesive one-sided tape
A cork borer (one centimeter diameter) or similar cutting device such as a scalpel blade.
An inverted confocal microscope (ZEISS, model: LSM 780)
Plan-Apochromat 63x/1.40 oil objective
Software
Graphpad prism software (http://www.graphpad.com)
MS Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Navarro, J. A., Serra-Soriano, M. and Pallás, V. (2014). Fluorescence Recovery after Photobleaching (FRAP) Assay to Measure the Dynamics of Fluorescence Tagged Proteins in Endoplasmic Reticulum Membranes of Plant Cells. Bio-protocol 4(20): e1268. DOI: 10.21769/BioProtoc.1268.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell imaging
Cell Biology > Cell imaging > Live-cell imaging
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,269 | https://bio-protocol.org/exchange/protocoldetail?id=1269&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Protocol to Measure the Extent of Cell-to-cell Movement of RNA Viruses in Planta
José Antonio Navarro
MS Marta Serra-Soriano
Vicente Pallás
Published: Vol 4, Iss 20, Oct 20, 2014
DOI: 10.21769/BioProtoc.1269 Views: 7633
Edited by: Tie Liu
Reviewed by: Hiromasa SaitohArsalan Daudi
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
Here, we present a simple and rapid protocol to measure the extent of cell-to-cell movement of RNA viruses in planta. To do that, the green fluorescent protein (GFP) gene was incorporated into the genome of Melon necrotic spot virus (MNSV) as a coat protein (CP) fusion protein using the Thosea asigna virus 2A catalytic peptide (TaV 2a) (Serra-Soriano et al., 2014). TaV 2a allows the co-translational cleavage of the fusion protein resulting in the independent expression of both proteins (Kim et al., 2011). Viral infection was initiated by agro-infiltration of Cucumis melo leaves. At 6-7 days post-infiltration, fluorescent infection foci images were taken with a fluorescent stereo microscope and infection areas were measured using FIJI software.
Keywords: Plant virus Tombusviridae virus movement Melon necrotic spot virus movement proteins
Materials and Reagents
3-4 weeks old Cucumis melo L. subsp. melo cv. Galia plants
Agrobacterium tumefaciens (A. tumefaciens) strain C58C1, or similar, transformed with the binary vector harboring the GFP-tagged viral genome
In our case, pMNSV(Al)/GFP encoding GFP-tagged Melon necrotic spot virus (MNSV) genome under the control of the Cauliflower mosaic virus (CaMV) 35S promoter and the potato proteinase inhibitor terminator (PoPit) (Figure 1).
Figure 1. Schematic representation of the recombinant infectious clone pMNSV(Al)/GFP used in this assay
Yeast extract (Difco, catalog number: 212750 )
Tryptone (Difco, catalog number: 211705 )
Sodium chloride (NaCl) (Panreac Applichem, catalog number: 131659 )
Acetosyringone (Sigma-Aldrich, catalog number: D134406 )
MES (Sigma-Aldrich, catalog number: M8250 )
Magnesium chloride (MgCl2) (Sigma-Aldrich, catalog number: M9272 )
Antibiotics
LB medium (see Recipes)
Agrobacterium infiltration buffer (see Recipes)
Equipment
28 °C growing chamber
15 ml culture tubes
Swinging centrifuge rotor for 15 ml tubes
1.5 ml tubes (standard Eppendorf tubes or similar)
BioPhotometer plus (Eppendorf, catalog number: 6132000008 )
1 ml syringes without needle
Plant growing chamber
Leica MZ12 fluorescent stereo microscope
Software
Adobe Photoshop CS5 or higher
ImageJ, FIJI or similar software
MS Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Navarro, J. A., Serra-Soriano, M. and Pallás, V. (2014). A Protocol to Measure the Extent of Cell-to-cell Movement of RNA Viruses in Planta. Bio-protocol 4(20): e1269. DOI: 10.21769/BioProtoc.1269.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Perception and signaling
Plant Science > Plant immunity > Disease bioassay
Microbiology > Microbe-host interactions > In vivo model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
127 | https://bio-protocol.org/exchange/protocoldetail?id=127&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Extraction of Root Apoplastic Wall Fluid for Apoplastic Peroxidase Activity Assay
Xiyan Li
Published: Sep 5, 2011
DOI: 10.21769/BioProtoc.127 Views: 16718
Download PDF
Ask a question
Favorite
Cited by
Abstract
Plant roots secret a lot of peroxidases to counteract environmental influences. This protocol describes a way to extract root apoplastic wall fluid from Arabidopsis plants and to determine the peroxidase activity using guaiacol as substrate.
Keywords: Peroxidase Root Guaiacol Apoplastic fluid Enzyme activity
Materials and Reagents
10 mM Na+-PO4 (pH 6.0)
Guaiacol
Agar
MES-K
1/4x modified Hoagland medium (see general growth protocol for recipes)
Solid medium (see Recipes)
Equipment
UV-vis Spectrometer
Arabidopsis growth facility
15 ml Falcon tube
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant cell biology > Cell structure
Biochemistry > Protein > Activity
Plant Science > Plant biochemistry > Protein
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
How much of apoplastic fluid can be obtained per one root of 2.5 weeks old Arabidopsis plant?
1 Answer
50 Views
Jul 7, 2022
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,270 | https://bio-protocol.org/exchange/protocoldetail?id=1270&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Design of a Transcription-based Secretion Activity Reporter (TSAR) for the Type III Secretion Apparatus of Shigella flexneri and Uses Thereof
François Xavier Campbell-Valois
Pamela Schnupf
Philippe J. Sansonetti
Published: Vol 4, Iss 20, Oct 20, 2014
DOI: 10.21769/BioProtoc.1270 Views: 10668
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Feb 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2014
Abstract
Many gram-negative bacterial pathogens, including Shigella flexneri, are able to translocate bacterial proteins, dubbed effectors, across the host cell plasma membrane into the host cell cytosol using a syringe-like structure, the type three secretion apparatus (T3SA). While some bacteria use their T3SA to modulate their phagosomal environment (Salmonella spp.), establish pedestal structure to form microcolonies on the plasma membrane (Enteropathogenic Escherichi coli) or lyse their entry vacuole (Shigella spp.), they all have in common a tightly regulated activity of their T3SA. However, the tracking of the activity of the T3SA in infected cells and tissue has been difficult to perform. Using the property of MxiE-dependent promoters that are upregulated when the T3SA is active, we have recently designed a transcription-based secretion activity reporter (TSAR) that allows the following of the activity of the S. flexneri T3SA in real-time in tissue culture cells and in vivo using fast maturing GFP intrinsic fluorescence. Herein we describe the design of the TSAR and its application to fixed and live samples for microscopy and flow cytometry in a colonic epithelial cell model using TC7 tissue culture cells.
Keywords: Shigella Transcriptional reporter Green Fluorescent Protein Type Three Secretion Apparatus Bacteril
Materials and Reagents
Transcription-based secretion activity reporter plasmids (pTSAR1.3, pTSAR1Ud2.1 or pTSAR1Ud2.4s)
Note: Directly available under material transfer agreement (MTA) from Philippe Sansonetti’s laboratory.
Petri dish of Tryptone Casein Soya (TCS) agar (BD Biosciences, catalog number: 236950 ) supplemented with 0.01% Congo red (CR) (SERVA Electrophoresis GmbH, catalog number: 27215.01 ) and the appropriate antibiotic
TCS Broth (BD Biosciences, catalog number: 211825 )
Ampicillin (MP Biomedicals, catalog number: 0 219452605 )
Polylysine (Sigma-Aldrich, catalog number: P1274 )
Human tissue culture cells such as as colonic epithelial TC7 cells (a clone of Caco-2 cells)
Note: Only polarized epithelial cells permit efficient cell-to-cell spread of Shigella spp. We also recommend using Human cells because it is the sole natural host of Shigella, although most cell lines of other origins tested are also readily infected and could be used for practical reasons.
DMEM (Life Technologies, catalog number: 31885 )
FCS (Biowest, catalog number: S1810-100 )
Penicillin/Streptomycin (Life Technologies, catalog number: 15140 )
Non-essential amino acids (Life Technologies, catalog number: 11140 )
0.25% trypsin-EDTA (Life Technologies, catalog number: 25200-056 )
Fibronectin from human plasma (Sigma-Aldrich, catalog number: F0895 ) (optional)
HEPES (Life Technologies, catalog number: 15630-056 )
Gentamicin (Sigma-Aldrich, catalog number: G1397 )
Cell mask deep red (Life Technologies, catalog number: C10046 )
Cytochalasin D (Sigma-Aldrich, catalog number: C2873 )
Live imaging medium containing DMEMgfp-2 (Evrogen, catalog number: MC102)
PFA (Electron Microscopy Sciences, catalog number: 15714 )
Glycine (Sigma-Aldrich, catalog number: G7126 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 ) (optional)
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A 9647) (optional)
Gelatin (Sigma-Aldrich, catalog number: G1393 ) (optional)
Sodium azide (Sigma-Aldrich, catalog number: 0 8591 ) (optional)
DAPI stock solution (Sigma-Aldrich, catalog number: D9542 ) (optional)
MOWIOL (Sigma-Aldrich, catalog number: 81381 )
1,4-diazobicyclo-[2,2,2]-octaned (DABCO) (Sigma-Aldrich, catalog number: D27802 )
Glycerol (VWR International, catalog number: 24388.295 ) alternatively Prolong mounting medium (Life Technologies, catalog number: P36930 )
10x phosphate-buffer saline (PBS) (see Recipes)
PBS/10 µg/ml polylysine (see Recipes)
DMEM-HEPES (see Recipes)
Chase medium (see Recipes)
Live imaging medium (see Recipes)
PBS/4% PFA (see Recipes)
PBS/100 mM glycine (see Recipes)
5,000x DAPI stock solution (see Recipes)
Mounting medium (see Recipes)
Growth medium for TC7 cells (see Recipes)
Equipment
35 mm petri dish with glass bottom or 8-wells microplate (Ibidi®, catalog numbers: 81158 and 80826 , respectively) for live microscopy
24-well plate
Coverslips no. 1.5, 12 mm in diameter (Harvard Apparatus, catalog number: 64-0712 )
Laminar flow hood for cell culture
Heating water bath
Tabletop centrifuge for 1.5-2 ml Eppendorf tubes
Tabletop centrifuge with plate-holding rotor
CO2 incubator for cell culture
Tweezers
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Campbell-Valois, F. X., Schnupf, P. and Sansonetti, P. J. (2014). Design of a Transcription-based Secretion Activity Reporter (TSAR) for the Type III Secretion Apparatus of Shigella flexneri and Uses Thereof. Bio-protocol 4(20): e1270. DOI: 10.21769/BioProtoc.1270.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Molecular Biology > Protein > Expression
Cell Biology > Cell imaging > Fixed-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,271 | https://bio-protocol.org/exchange/protocoldetail?id=1271&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection of the Secreted and Cytoplasmic Fractions of IpaB, IpaC and IpaD by Lysozyme Permeabilization
François Xavier Campbell-Valois
Pamela Schnupf
Philippe J. Sansonetti
Published: Vol 4, Iss 20, Oct 20, 2014
DOI: 10.21769/BioProtoc.1271 Views: 9150
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Feb 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2014
Abstract
Gram negative bacterial pathogens, such as Shigella flexneri, which possess a Type Three Secretion System (T3SS), are able to transfer bacterial proteins, dubbed translocators and effectors, from their cytoplasm into the cytoplasm of their host cells using a syringe like needle complex. For Shigella, it has been shown that during cellular invasion, the intrabacterial pool of translocators and effectors is completely depleted upon activation of the TTS Apparatus and is then progressively replenished while bacteria remain inside host cells. Replenishment of effectors allows for cell-to-cell spreading events, which also necessitate reactivation of the T3SA, and lead to another round of depletion of intrabacterial effector stores. To understand the state of individual intracellular bacteria during infection, it is therefore of interest to be able to locate and evaluate the relative quantity of the intrabacterial and secreted pool of translocators and effectors. We recently adapted a method based on EDTA and lysozyme to permeabilize the cell wall of bacteria present within host cells in order to label the intrabacterial pool of the tip protein IpaD and the translocators IpaB and IpaC. Herein, we describe in detail the protocol to perform the successive labeling of the intrabacterial and secreted pools. This method is theoretically extendable to virulence factors secreted by other secretion systems and other bacterial pathogens.
Materials and Reagents
Shigella spp. Strain(s) (e.g. M90T)
Human tissue culture cells such as colonic epithelial TC7 cells (a clone of Caco-2 cells)
Note: Only polarized epithelial cells permit efficient cell-to-cell spread of Shigella spp. We also recommend using human cells because it is the sole natural host of Shigella, although most cell lines of other origins tested are also readily infected and could be used for practical reasons.
Petri dish of Tryptone Casein Soja (TCS) agar (BD Biosciences, catalog number: 236950 ) supplemented with 0.01% Congo red (CR) (SERVA Electrophoresis GmbH, catalog number: 27215.01 ) and the appropriate antibiotic
TCS broth (BD Biosciences, catalog number: 211825 )
Polylysine (Sigma-Aldrich, catalog number: P1274 )
DMEM (Life Technologies, catalog number: 31885 )
FCS (Biowest, catalog number: S1810-100 )
Penicillin/streptomycin (Life Technologies, catalog number: 15140 )
Non-essential amino acids (Life Technologies, catalog number: 11140 )
Trypsin-EDTA (Life Technologies, catalog number: 25200-056 )
Fibronectin from human plasma (Sigma-Aldrich, catalog number: F0895 ) (optional)
HEPES (Life Technologies, catalog number: 15630-056 )
Gentamycin (EUROMEDEX, catalog number: EU0540-A )
PFA (Electron Microscopy Sciences, catalog number: 15714 )
Glycine (Sigma-Aldrich, catalog number: G7126 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A 9647 )
Gelatin (Sigma-Aldrich, catalog number: G1393 )
Sodium azide (Sigma-Aldrich, catalog number: 0 8591 )
Goat anti-mouse IgG Alexa568 (highly cross absorbed) (Life Technologies, catalog number: A11036 )
Goat anti-mouse IgG Alexa647 (highly cross absorbed) (Life Technologies, catalog number: A21236 )
Lysozyme (Sigma-Aldrich, catalog number: 6876 )
5, 000x DAPI stock solution (Sigma-Aldrich, catalog number: D9542 ) (optional) (see Recipes)
MOWIOL (Sigma-Aldrich, catalog number: 81381 )
1,4-diazobicyclo-[2,2,2]-octane d (DABCO) (Sigma-Aldrich, catalog number: D27802 )
Glycerol (VWR International, catalog number: 24388.295 ) alternatively Prolong mounting medium (Life Technologies, catalog number: P36930 )
10x phosphate-buffer saline (PBS) (see Recipes)
PBS/10 µg/ml polylysine (see Recipes)
DMEM/20 mM HEPES (see Recipes)
Chase medium (see Recipes)
PBS/4% PFA (see Recipes)
PBS/100 mM glycine (see Recipes)
PBS/0.1% Triton X-100 (see Recipes)
PBS/1% BSA/0.2% gelatin (see Recipes)
Lysozyme reaction buffer (see Recipes)
5,000x DAPI stock solution (see Recipes)
Mounting medium (see Recipes)
Growth medium for TC7 cells (see Recipes)
Equipment
24-well plates
Coverslips no. 1.5, 12 mm in diameter (Harvard Apparatus, catalog number: 64-0712 )
Laminar flow hood for cell culture
Heating water bath
Tabletop centrifuge for 1.5 ml Eppendorf tubes
Tabletop centrifuge with plate-holding rotor
CO2 incubator for cell culture
Tweezers
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial biochemistry > Protein
Microbiology > Microbe-host interactions > Bacterium
Biochemistry > Protein > Labeling
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,272 | https://bio-protocol.org/exchange/protocoldetail?id=1272&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measuring UV-induced Mutagenesis at the CAN1 Locus in Saccharomyces cerevisiae
Ildiko Unk
Andreea Daraba
Published: Vol 4, Iss 20, Oct 20, 2014
DOI: 10.21769/BioProtoc.1272 Views: 11998
Reviewed by: Kanika GeraEmilia Krypotou
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
There are several methods to measure the capacity of yeast cell to respond to environmental impacts on their genome by mutating it. One frequently used method involves the detection of forward mutations in the CAN1 gene. The CAN1 gene encodes for an arginine permease that is responsible for the uptake of arginine and it can also transport the toxic analog of arginine, canavanine (Whelan et al., 1979). When CAN1 cells are grown on a media containing canavanine but lacking arginine, the cells die because of the uptake of the toxic canavanine. However, if a mutation in the CAN1 gene inactivates the permease, that cell survives and forms a colony on the plate.
The following protocol describes the measurement of UV-induced mutagenesis at the CAN1 locus.
Keywords: Yeast Mutagenesis Forward mutations Canavanine UV light
Materials and Reagents
Strains that have the wild type CAN1 gene (e.g., BY4741, EMY747)
Yeast nitrogen base [w/o amino acids and w (NH4)2SO4] (Difco)
Adenine (Sigma-Aldrich)
Arginine (Sigma-Aldrich)
Canavanine (Sigma-Aldrich)
Histidine (Sigma-Aldrich)
Isoleucine (Sigma-Aldrich)
Leucine(Sigma-Aldrich)
Lysine (Sigma-Aldrich)
Methionine (Sigma-Aldrich)
Phenylalanine (Sigma-Aldrich)
Tryptophan (Sigma-Aldrich)
Tyrosine (Sigma-Aldrich)
Uracil (Sigma-Aldrich)
Valine (Sigma-Aldrich)
Yeast extract
Pepton
D-glucose
Bacto agar
Yeast extract-pepton-D-glucose (YPD) media (see Recipes) (or other media needed for the strain in use)
Synthetic complete media (SC) plates (see Recipes)
SC-arginine plates containing canavanine (+can) (see Recipes)
Equipment
30 °C incubator-shaker (180-200 round per minute)
30 °C incubator
Glass slide
Centrifuge
Microscope
Vortex
UV-irradiation machine
Box
Spreader
Culture tube
Waterbath sonicator
Hemocytometer (Burker counting chamber)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Unk, I. and Daraba, A. (2014). Measuring UV-induced Mutagenesis at the CAN1 Locus in Saccharomyces cerevisiae. Bio-protocol 4(20): e1272. DOI: 10.21769/BioProtoc.1272.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > Mutagenesis
Microbiology > Microbial genetics > DNA
Molecular Biology > DNA > Mutagenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,273 | https://bio-protocol.org/exchange/protocoldetail?id=1273&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Synchronization of Saccharomyces cerevisiae Cells in G1 Phase of the Cell Cycle
Ildiko Unk
Andreea Daraba
Published: Vol 4, Iss 20, Oct 20, 2014
DOI: 10.21769/BioProtoc.1273 Views: 16346
Reviewed by: Kanika GeraEmilia Krypotou
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
The baker’s yeast, Saccharomyces cerevisiae is a widely used model organism in molecular biology because of the high homology it shares with human cells in many basic cellular processes such as DNA replication, repair, recombination, transcription, and because of the ease its genome can be manipulated. Other advantages of working with yeast are its fast production rate which is comparable to bacteria’s, and its cheap maintenance.
To examine certain phenomena, for example whether a mutation affects the passage through a cell cycle phase, it can be necessary to work with a yeast culture, in which all the cells are in the same phase of the cell cycle. Yeasts can be arrested and kept in different phases of the cell cycle. Here we describe the method that allows synchronizing and keeping yeast cells in the G1 phase of the cell cycle with the mating pheromone, α-factor. Only MATa cells can be synchronized with α-factor which is produced by MATα cells. It is highly recommended to use a MATa bar1 deletion strain. The BAR1 gene encodes for an extracellular protease that inactivates α-factor by cleaving it (MacKay et al., 1988). To counteract the Bar1 protease activity when using BAR1 cells, 100-1000 times more α-factor is needed as compared to bar1 deletion cells (α-factor is quite expensive!), and still the synchrony will be transient. In contrast, bar1 deletion cells can be kept in G1 phase with α-factor for several hours, and the degree of synchronization is usually higher than using a BAR1 strain. Moreover, bar1 deletion cells can be synchronized even at high cell density, whereas BAR1 cells, due to the activity of the secreted Bar1 protease, only at low cell density.
Keywords: Alpha mating factor G1 phase Yeast
Materials and Reagents
MATa bar1 deletion strain (can be engineered in the lab, or purchased from stock repositories like EUROSCARF)
Yeast extract
Peptone
D-glucose
95% ethanol
Yeast extract-peptone-dextrose (YPD) media (see Recipes) (or other media needed for the strain in use)
α-factor (α-mating factor acetate salt) (Sigma-Aldrich, catalog number: T6901-5MG ) (see Recipes)
Pronase (protease, from streptomyces griseus) (Sigma-Aldrich, catalog number: P6911-5G ) (see Recipes)
Equipment
30 °C incubator-shaker (180-200 rounds per minute)
Microscope
Glass slide
Coverslips
Centrifuge
Spectrophotometer
Vortex
Culture tube
Culture flask
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Unk, I. and Daraba, A. (2014). Synchronization of Saccharomyces cerevisiae Cells in G1 Phase of the Cell Cycle. Bio-protocol 4(20): e1273. DOI: 10.21769/BioProtoc.1273.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell isolation and culture
Cell Biology > Cell isolation and culture > Cell growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,274 | https://bio-protocol.org/exchange/protocoldetail?id=1274&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Severe Fever with Thrombocytopenia Syndrome Virus Infection of Cell Cultures
Yinyan Sun
Wenhui Li
Published: Vol 4, Iss 20, Oct 20, 2014
DOI: 10.21769/BioProtoc.1274 Views: 8129
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
Severe fever with thrombocytopenia syndrome virus (SFTSV) can infect multiple cells, such as Vero, RD, BHK21, HUVEC and 293T. Vero cells are highly susceptible, so they were used to isolate virus from sera of patients, as well as for producing virus in the laboratory. Other cells can be used for additional functional analysis.
Materials and Reagents
Vero cells (acquired from ATCC, CCL-81 )
SFTSV from patients sera
Dulbecco’s modified Eagle medium (DMEM) + 4.5 g/L D-glucose with L-Glutamine (Life Technology, catalog number: C11965500BT )
Fetal bovine serum (FBS) (Life Technologies, Gibco®, catalog number: 10091148 )
Penicillin streptomycin (PS) (Life Technologies, Gibco®, catalog number: 15140-122 )
Antibody against nuclear protein (NP) of SFTSV
Note: Produced in rabbit by the Antibody Facility of our institute (Sun et al., 2014), the antibody was affinity purified, 1 mg/ml, the working concentration is 5 μg/ml.
TRIzol reagent (Life Technologies, InvitrogenTM, catalog number: 15596-026 )
Reverse Transcriptase M-MLV (RNase H) [Takara Biotechnology (Dalian), catalog number: D2639A ]
SYBR Premix Ex TaqTM Perfect Real Time [Takara Biotechnology (Dalian), catalog number: DRR039A ]
Methanol
4',6-diamidino-2-phenylindole (DAPI)
Alexa Fluor 488 goat anti-rabbit (Life Technologies, InvitrogenTM, catalog number: A11008 )
Hipure Plasmid Filter Midiprep Kit (Life Technologies, catalog number: K210005 )
Maintaining cell culture (see Recipes)
Infection cell culture (see Recipes)
Mounting media (see Recipes)
Equipment
T25 flask (25 cm2) (BD, FalconTM, catalog number: 353108 )
Tissue culture plate, 24-well flat bottom (BD, FalconTM, catalog number: 353047 ) or 48-well plate (BD, FalconTM, catalog number: 353078 )
25-cm bottles
37 °C, 5% CO2 incubator
7500 fast Real Time PCR System (Life Technologies, Applied Biosystems®)
Zeiss LSM510 Meta laser scanning confocal microscope
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Sun, Y. and Li, W. (2014). Severe Fever with Thrombocytopenia Syndrome Virus Infection of Cell Cultures. Bio-protocol 4(20): e1274. DOI: 10.21769/BioProtoc.1274.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Virus
Microbiology > Microbe-host interactions > In vitro model
Microbiology > Microbial cell biology > Cell isolation and culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,275 | https://bio-protocol.org/exchange/protocoldetail?id=1275&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Multiplexed Small RNA Libraries from Plants
KG Kerrigan B. Gilbert
NF Noah Fahlgren
KK Kristin D. Kasschau
EC Elisabeth J. Chapman
JC James C. Carrington
Alberto Carbonell
Published: Vol 4, Iss 21, Nov 5, 2014
DOI: 10.21769/BioProtoc.1275 Views: 13133
Edited by: Tie Liu
Reviewed by: Feng Li
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
High-throughput sequencing is a powerful tool for exploring small RNA populations in plants. The ever-increasing output from an Illumina Sequencing System allows for multiplexing multiple samples while still obtaining sufficient data for small RNA discovery and characterization. Here we describe a protocol for generating multiplexed small RNA libraries for sequencing up to 12 samples in one lane of an Illumina HiSeq System single-end, 50 base pair run. RNA ligases are used to add the 3’ and 5’ adaptors to purified small RNAs; ligation products that lack a small RNA molecule (adaptor-adaptor products) are intentionally depleted. After cDNA synthesis, a linear PCR step amplifies the DNA fragments. The 3’ PCR primers used here include unique 6-nucleotide sequences to allow for multiplexing up to 12 samples.
Keywords: Small RNA High-throughput sequencing Library preparation Multiplexing SRNA-seq
Materials and Reagents
Low molecular weight gel-based small RNA isolation
ssRNA marker (Takara Bio Company, catalog number: 3416 )
Reagents for 17% polyacrylamide, 7M Urea PAGE
37.5:1 polyacrylamide:bisacrylamide (see Recipes)
Urea (Life Technologies, catalog number: 15505-050 )
TEMED (Life Technologies, catalog number: 15524-010 )
10% ammonium persulfate (Sigma-Aldrich, catalog number: A3678-100G ) (see Recipes)
2x RNA loading dye (see Recipes)
DE81-based nucleic acid purification
Fiber glass (Corning Incorporated, catalog number: 988-10144 )
Extra thick blot paper (Bio-Rad Laboratories, catalog number: 170-3969 )
Whatman DE81 ion exchange cellulose chromatography paper (Thermo Fisher Scientific, catalog number: 05-717-1A )
GlycoBlue coprecipitant (Life Technologies, catalog number: AM9516 )
100% ethanol
75% ethanol
EB buffer (QIAGEN, catalog number: 19086 )
Qubit RNA HS Assay Kit for quantification of purified small RNAs (Life Technologies, catalog number: Q32852 )
Qubit dsDNA HS Assay Kit for quantification of DNA amplicon (Life Technologies, catalog number: Q32854 )
Low salt buffer (see Recipes)
High salt buffer (see Recipes)
Multiplexed small RNA libraries preparation
8-Strip PCR thin-walled, 200 µl tubes (Corning Incorporated, Axygen®, catalog number: PCR-0208-CP-C )
miRNA cloning linker 1 (/5'App/CTGTAGGCACCATCAAT/3'ddC/; 1 nm) (Integrated DNA Technologies, catalog number: 11-04-03-05 )
Truncated, K227Q mutation T4 RNA ligase 2 (New England Biolabs, catalog number: M0351L )
De-adenylase (New England Biolabs, catalog number: M0331S )
Exonuclease VII (United State Biological, catalog number: 70082Z )
RNA 5’ adapter (GUUCAGAGUUCUACAGUCCGACGAUC) (Illumina RA5, catalog number: 15013205 )
dATP (Life Technologies, catalog number: 55082 )
T4 RNA ligase I (Life Technologies, catalog number: AM2141 )
RT-PCR primer (ATTGATGGTGCCTACAG; 25 nmol; de-salted) (Integrated DNA Technologies)
SuperScript III (Life Technologies, catalog number: 18080051 )
Phusion high fidelity II (Thermo Fisher Scientific, catalog number: F549L )
5' PCR primer (Illumina small RNA PCR primer 2: AATGATACGGCGACCACCGACAGGTTCAGA-GTTCTACAGTCCGA)
3' indexed PCR primer I1 - I12 (100 nmol; PAGE-purified) (Integrated DNA Technologies)
Note: The barcodes below (underlined sequences) are reverse complemented in the final Illumina output sequence (see sequence in square brackets for each primer).
I1 [CGATGT]: CAAGCAGAAGACGGCATACGAACATCGATTGATGGTGCCTACAG
I2 [GATCAC]: CAAGCAGAAGACGGCATACGAGTGATCATTGATGGTGCCTACAG
I3 [CAGATG]: CAAGCAGAAGACGGCATACGACATCTGATTGATGGTGCCTACAG
I4 [TACGTT]: CAAGCAGAAGACGGCATACGAAACGTAATTGATGGTGCCTACAG
I5 [TTACCA]: CAAGCAGAAGACGGCATACGATGGTAAATTGATGGTGCCTACAG
I6 [ACTGTA]: CAAGCAGAAGACGGCATACGATACAGTATTGATGGTGCCTACAG
I7 [ATCACG]: CAAGCAGAAGACGGCATACGACGTGATATTGATGGTGCCTACAG
I8 [ACTTGT]: CAAGCAGAAGACGGCATACGAACAAGTATTGATGGTGCCTACAG
I9 [GCCAAT]: CAAGCAGAAGACGGCATACGAATTGGCATTGATGGTGCCTACAG
I10 [TGCTAG]: CAAGCAGAAGACGGCATACGACTAGCAATTGATGGTGCCTACAG
I11 [CTTGTA]: CAAGCAGAAGACGGCATACGATACAAGATTGATGGTGCCTACAG
I12 [TCAGGC]: CAAGCAGAAGACGGCATACGAGCCTGAATTGATGGTGCCTACAG
QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106)
Diethylpyrocarbonate (DEPC)-H2O/RNase-free H2O
DNA size marker suitable for detecting a ~120 bp fragment (50 bp step ladder, Promega Corporation, catalog number: G4521 ; 25 bp step ladder, Promega Corporation, catalog number: G4511 )
3 M sodium acetate (NaOAc) (pH 5.5)
Reagents for 6% native PAGE
37.5:1 polyacrylamide:bisacrylamide (see Recipes)
TEMED (Life Technologies, catalog number: 15524-010)
10% ammonium persulfate (Sigma-Aldrich, catalog number: A3678-100G) (see Recipes)
Equipment
Thermocycler
Microcentrifuge: For use at room temperature and at 4 °C
Fisher gel-loading tips (Thermo Fisher Scientific, catalog number: 02-707-182 )
Agarose gel electrophoresis systems (Bio-Rad Laboratories, Sub-Cell GT system)
Polyacrylamide gel electrophoresis system (Thermo Fisher Scientific, owl Dual-Gel vertical electrophoresis systems)
65 °C water bath
Semi-dry blotting system (Sigma-Aldrich, semi-dry blotter, catalog number: Z340502 )
Heating block
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Gilbert, K. B., Fahlgren, N., Kasschau, K. D., Chapman, E. J., Carrington, J. C. and Carbonell, A. (2014). Preparation of Multiplexed Small RNA Libraries from Plants. Bio-protocol 4(21): e1275. DOI: 10.21769/BioProtoc.1275.
Carbonell, A., Takeda, A., Fahlgren, N., Johnson, S. C., Cuperus, J. T. and Carrington, J. C. (2014). New generation of artificial MicroRNA and synthetic trans-acting small interfering RNA vectors for efficient gene silencing in Arabidopsis. Plant Physiol 165(1): 15-29.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > RNA
Systems Biology > Transcriptomics > RNA-seq
Molecular Biology > RNA > RNA sequencing
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,276 | https://bio-protocol.org/exchange/protocoldetail?id=1276&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Binding Affinity Measurement of Antibodies from Crude Hybridoma Samples by SPR
DN Dorin Mlaki Ndao
DH David T. Hickman
ML María Pilar López-Deber
AD Aurélien Davranche
AP Andrea Pfeifer
AM Andreas Muhs
Published: Vol 4, Iss 21, Nov 5, 2014
DOI: 10.21769/BioProtoc.1276 Views: 16045
Original Research Article:
The authors used this protocol in Jan 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2013
Abstract
Surface Plasmon Resonance (SPR) is widely used to generate kinetic and affinity information on specific interactions between biomolecules. This technique is label-free and monitors the binding event in real-time. It is generally used for characterization of monoclonal antibody - antigen interactions. This protocol describes specifically the use of SPR with a Biacore T100 instrument to measure the affinity of crude hybridoma samples to a protein. For that purpose an anti-IgG antibody was firstly covalently immobilized onto a CM5 chip by amide coupling (Canziani et al., 2004; Schraml and Biehl, 2012). Then the antibodies from hybridoma supernatants were captured non-covalently onto the surface via their Fc region providing an optimal analyte-binding orientation. Finally, the resulting complex was stabilized by crosslinking with EDC/NHS to avoid baseline drift during measurement and regeneration (Pope et al., 2009). Then the interaction with the protein was monitored at several concentrations and its affinity towards the immobilized antibodies was determined with the corresponding KD obtained from classical kinetics analysis. This set-up avoids the avidity effects of the bivalent antibodies, allows the use of non-purified analytes with unknown concentrations and the specific capture of the antibodies in a similar stable covalent-orientated manner.
Materials and Reagents
Dulbecco’s phosphate buffered saline (D-PBS) (Sigma-Aldrich, catalog number: D8537 ) as running buffer during immobilization and binding analysis
Amine coupling kit (GE Healthcare, catalog number: BR-1000-50 ) containing:
750 mg N-ethyl-N’-(3-dimethylaminopropyl) carbodiimide hydrochloride (EDC)
115 mg N-hydroxysuccinimide (NHS)
10.5 ml Ethanolamine-HCl (pH 8.5)
Mouse antibody capture kit (GE Healthcare, catalog number: BR-1008-38 )
10 mM acetate buffer (pH 5) (GE Healthcare, catalog number: BR-1003-51 )
10 mM acetate buffer (pH 5.5) (GE Healthcare, catalog number: BR-1003-52 )
10 mM Glycine-HCl (pH 1.7) (GE Healthcare, catalog number: BR-1008-38) as regeneration buffer
Reagents for immobilization (see Recipes)
Ligands (see Recipes)
Reagents for binding assay (see Recipes)
Analyte (see Recipes)
Equipment
Sensor chip with carboxyl groups available for the amine coupling reaction: Serie S sensor chip CM5 (GE Healthcare, catalog number: BR-1005-30 )
Instrument for SPR analysis: Biacore T100 instrument and Evaluation Software (GE Healthcare)
Micropipettes (100-1,000 µl) (Eppendorf, catalog number: 033023B )
Micropipettes (10-100 µl) (Eppendorf, catalog number: 033021B
Micropipettes (2-20 µl) (Eppendorf, catalog number: 033019B )
Plastic vials (0.8 ml) (GE Healthcare, catalog number: BR-1002-12 )
Rubber caps (type 3) (GE Healthcare, catalog number: BR-1005-02 )
Software
Biacore T100 Evaluation Software (GE Healthcare)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ndao, D. M., Hickman, D. T., López-Deber, M. P., Davranche, A., Pfeifer, A. and Muhs, A. (2014). Binding Affinity Measurement of Antibodies from Crude Hybridoma Samples by SPR. Bio-protocol 4(21): e1276. DOI: 10.21769/BioProtoc.1276.
Download Citation in RIS Format
Category
Immunology > Antibody analysis > Antibody-antigen interaction
Immunology > Antibody analysis > Antibody function
Biochemistry > Protein > Interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,277 | https://bio-protocol.org/exchange/protocoldetail?id=1277&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Extraction of Total Proteins from Rice Plant
DL Da-Gin Lin
CW Chang-Sheng Wang
Published: Vol 4, Iss 21, Nov 5, 2014
DOI: 10.21769/BioProtoc.1277 Views: 42877
Reviewed by: Feng LiCindy Ast
Original Research Article:
The authors used this protocol in Jan 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2014
Abstract
This protocol provides an efficient method for preparation of high-quality proteins from rice leaves and grains. The method involves phenol extraction to separate proteins from the non-protein components such as polysaccharides, lipids and phenolic compounds that are commonly enriched in plant tissues. Following isolation, proteins are precipitated with ammonium acetate/methanol and then solubilized for proteomic analysis. As the protocol is simple, universal, and most importantly compatible with silver staining, it has been applied to our routine protein extraction from rice and many other plant tissues and it even works fine in animal tissues for the requirement of electrophoretic separation.
Keywords: Rice Protein extraction Proteomics Two dimentional gel electrophresis Staining methods
Materials and Reagents
Tainung 67
Note: TNG67, an elite japonica type rice variety, has been a leading variety in Taiwan for more than 30 years since it been released in 1978.
SA0420
Note: An aroma mutant, exhibits an agreeable taro-like flavor, was selected from the TNG67 mutation pool developed via sodium azide mutagenesis.
Liquid nitrogen
Acetone (Merck KGaA, catalog number: 1.00012.4000 )
NH4OAc (Merck KGaA, catalog number: 1.01116.1000 )
DTT (Merck KGaA, catalog number: 1.11474.0001 )
CHAPS (GE Healthcare, catalog number: 17-1314-01 )
HCl (Merck KGaA, catalog number: 1.09063.1000 )
2-mercaptoethanol (Sigma-Aldrich, catalog number: M6250 )
2-propanol (Merck KGaA, catalog number: 1.09634.2500 )
Methanol (Merck KGaA, catalog number: 1.06007.4000 )
NaCl (Merck KGaA, catalog number: 7710CN )
NaOH (Merck KGaA, catalog number: 1.06469.1000 )
KCl (Merck KGaA, catalog number: 1.04936.1000 )
PMSF (Merck KGaA, catalog number: 52332 )
Phenol (saturated, pH 6.6/7.9) (AMRESCO, catalog number: 0945 )
PVPP (Merck KGaA, catalog number: 1.07302.0100 )
Seasand (Merck KGaA, catalog number: 107711 )
Sucrose (GERBU Biotechnik GmbH, catalog number: 1366 )
Triton X-100 (GERBU Biotechnik GmbH, catalog number: 2000 )
Tris-base (AMRESCO, catalog number: 0497 )
Urea (AMRESCO, catalog number: 0378 )
Miracloth (Calbiochem®, catalog number: 475855-1R )
Extraction buffer (see Recipes)
Precipitation buffer (see Recipes)
0.5 M EDTA (see Recipes)
Lysis buffer (see Recipes)
40 mM PMSF (see Recipes)
Equipment
Mortar (Φ 9 cm) and pestle (attached with Φ 12 cm mortar) (Figure 1)
Figure 1. Mortar and pestle
Pipetman (Gilson, model: p5000 , p1000 , p200 , p100 , p20 and p10 )
High-Speed Refrigerated Centrifuges and No.46 Rotor (Hitachi, model: himac CR22F )
50 ml centrifuge tube (Thermo Fisher Scientific, Nalgene®, model: 3119-0050 )
-20 °C refrigerator (Firstek Scientific, model: F-25 )
SpeedVac system (Thermo Fisher Scientific, model: SPD speed Vac and UVS400 universal vacuum system )
Ultrasonic machine (ULTRASONIC, model: LC130H )
Chemical fume hood (CHUNG FU, model: HAP-090 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Lin, D. and Wang, C. (2014). Extraction of Total Proteins from Rice Plant. Bio-protocol 4(21): e1277. DOI: 10.21769/BioProtoc.1277.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
Name protein is extracted from rice leaf and what is it's application?
0 Answer
5 Views
Dec 2, 2023
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,278 | https://bio-protocol.org/exchange/protocoldetail?id=1278&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Proton-driven Antiport in Escherichia coli
SH Scarlett R. Holdsworth
Christopher J. Law
Published: Vol 4, Iss 21, Nov 5, 2014
DOI: 10.21769/BioProtoc.1278 Views: 8711
Reviewed by: Aksiniya AsenovaKanika Gera
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
Secondary active transport of substrates across the inner membrane is vital to the bacterial cell. Of the secondary active transporter families, the ubiquitous major facilitator superfamily (MFS) is the largest and most functionally diverse (Reddy et al., 2012). Recently, it was reported that the MFS multidrug efflux protein MdtM from Escherichia coli (E. coli) functions physiologically in protection of bacterial cells against bile salts (Paul et al., 2014). The MdtM transporter imparts bile salt resistance to the bacterial cell by coupling the exchange of external protons (H+) to the efflux of bile salts from the cell interior via an antiport reaction. This protocol describes, using fluorometry, how to detect the bile salt/H+ antiport activity of MdtM in inverted membrane vesicles of an antiporter-deficient strain of E. coli TO114 cells by measuring transmembrane ∆pH. This method exploits the changes that occur in the intensity of the fluorescence signal (quenching and dequenching) of the pH-sensitive dye acridine orange in response to changes in [H+] in the vesicular lumen. Due to low levels of endogenous transporter expression that would normally make the contribution of individual transporters such as MdtM to proton-driven antiport difficult to detect, the method typically necessitates that the transporter of interest be overexpressed from a multicopy plasmid. Although the first section of the protocol described here is very specific to the overexpression of MdtM from the pBAD/Myc-His A expression vector, the protocol describing the subsequent measurement of bile salt efflux by MdtM can be readily adapted for measurement of antiport of other substrates by any other antiporter that exchanges protons for countersubstrate.
Materials and Reagents
pBAD/Myc-His A expression vector (Life Technologies, catalog number: V440-01 )
L-(+)-arabinose (Sigma-Aldrich, catalog number: A3256 )
Carbenicillin (Carbenicillin Direct)
Agar (Sigma-Aldrich, catalog number: A1296 )
Tryptone (Fluka, catalog number: T7293 )
Yeast extract (Fluka, catalog number: 92114 )
Potassium chloride (Thermo Fisher Scientific, catalog number: BP366 )
Escherichia coli (E. coli) TO114 (gift of Prof. Hiroshi Kobayashi, Chiba University, Japan)
Acridine orange hemi (zinc chloride) salt (Sigma-Aldrich, catalog number: A6014 )
BisTris propane (BTP) (Sigma-Aldrich, catalog number: B6755 )
Phenylmethanesulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: P7626 )
Deoxyribonuclease I (DNase) from bovine pancreas (Sigma-Aldrich, catalog number: DN25 )
Carbonyl cyanide 3-chlorophenylhydrazone (CCCP) (Sigma-Aldrich, catalog number: C2759 )
Sodium DL-lactate solution 50% aqueous (VWR International, catalog number: 27927.298 )
Magnesium sulphate heptahydrate (MgSO4.7H2O) (Thermo Fisher Scientific, catalog number: M/1000/60 )
Sodium cholate hydrate (Sigma-Aldrich, catalog number: C1254 )
Absolute ethanol (Thermo Fisher Scientific, catalog number: E/0650DF/17 )
High purity (18 MΩ) Millipore or AnalR water
Choline chloride (Sigma-Aldrich, catalog number: C1879 )
Sucrose (Sigma-Aldrich, catalog number: 84097 )
DL-dithiothreitol(Sigma-Aldrich, catalog number: 43815 )
TRIZMA base (Sigma-Aldrich, catalog number: T1503 )
32% hydrochloric acid (VWR International, catalog number: 20254.321 )
LBK agar (see Recipes)
LBK liquid medium (see Recipes)
Tris/choline/dithiothreitol/sucrose (TCDS) buffer (see Recipes)
Transport assay buffer (see Recipes)
200 mM sodium DL-lactate solution (see Recipes)
Equipment
Temperature-controlled shaking incubator for bacterial growth
Petri dishes for bacterial colony growth
100 ml conical flasks
250 ml conical flasks (x2)
5,000 ml conical flasks (x2)
Large ice bucket
Refrigerated, large capacity centrifuge and rotor for harvesting bacterial cells
1,000 ml or 500 ml centrifuge pots and lids
Benchtop vortexer
100 ml beaker and stir bar to fit
Magnetic stirrer
25 ml disposable plastic pipettes
Selection of single channel pipettes (1,000 µl, 100 µl, 20 µl, 10 µl)
Pipette tips for above
Refrigerated centrifuge and rotor capable of spinning ~50 ml tubes at 18k x g
Refrigerated ultracentrifuge, rotor and polycarbonate ultracentrifuge tubes capable of handling ~30 - 50 ml volumes
French Press (Thermo Fisher Scientific, catalogue number: FA-078 )
Standard pressure cell (40 kpsi; 35 ml capacity) (Thermo Fisher Scientific, catalog number: FA-031 )
50 ml syringes (for filtering solutions)
0.22 µm sterile filters to fit 50 ml syringe
1 L and 500 ml Duran bottles with lids
1.5 ml Eppendorf tubes
Medical wipes (Kimwipes®)
Parafilm
UV/vis spectrophotometer and 10 mm pathlength quartz cuvette
10 x 4 mm, 1,400 µl volume quartz cuvette for fluorescence spectroscopy (Hellma, catalog number: 104F-QG )
Small magnetic stir bar to fit inside quartz cuvette
Fluorometer e.g. Fluoromax-4 (Horiba) capable of performing time-based acquisition measurements and fitted with a temperature controlled cuvette holder and stirrer
Source of compressed air (either aerosol can or fixed supply) for drying cuvette
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Holdsworth, S. R. and Law, C. J. (2014). Measurement of Proton-driven Antiport in Escherichia coli. Bio-protocol 4(21): e1278. DOI: 10.21769/BioProtoc.1278.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Other compound
Microbiology > Microbial metabolism > Nutrient transport
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,279 | https://bio-protocol.org/exchange/protocoldetail?id=1279&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of the Electrogenicity of Bile Salt/H+ Antiport in Escherichia coli
SH Scarlett R. Holdsworth
Christopher J. Law
Published: Vol 4, Iss 21, Nov 5, 2014
DOI: 10.21769/BioProtoc.1279 Views: 7105
Reviewed by: Aksiniya AsenovaKanika Gera
Original Research Article:
The authors used this protocol in May 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2014
Abstract
The transmembrane proton gradient (ΔpH) is the primary source of energy exploited by secondary active substrate/H+ antiporters to drive the electroneutral transport of substrates across the Escherichia coli (E. coli) inner membrane. Such electroneutral transport results in no net movement of charges across the membrane. The charge on the transported substrate and the stoichiometry of the exchange reaction, however, can result in an electrogenic reaction which is driven by both the ΔpH and the electrical (∆Ψ) components of the proton electrochemical gradient, resulting in a net movement of electrical charges across the membrane. We have shown that the major facilitator superfamily transporter MdtM - a multidrug efflux protein from E. coli that functions physiologically in protection of bacterial cells against bile salts - imparts bile salt resistance to the bacterial cell by coupling the exchange of external protons (H+) to the efflux of bile salts from the cell interior via an electrogenic antiport reaction (Paul et al., 2014). This protocol describes, using fluorometry, how to detect electrogenic antiport activity of MdtM in inverted membrane vesicles of an antiporter-deficient strain of E. coli TO114 cells by measuring transmembrane ∆Ψ. The method exploits changes that occur in the intensity of the fluorescence signal (quenching and dequenching) of the probe Oxonol V in response to changes in membrane potential due to the MdtM-catalysed sodium cholate/H+ exchange reaction. The protocol can be adapted to detect activity of any secondary active antiporter that couples the electrogenic translocation of H+ across a biological membrane to that of its counter-substrate, and may be used to unmask otherwise camouflaged transport activities and physiological roles.
Keywords: Membrane transport Exchange Acridine orange Fluorescence quenching Antiporter
Materials and Reagents
E. coli TO114 (gift of Prof. Hiroshi Kobayashi, Chiba University, Japan)
E. coli BW25113 (National BioResource Project, Japan)
pBAD/Myc-His A expression vector (Life Technologies, catalog number: V440-01 )
L-(+)-arabinose (Sigma-Aldrich, catalog number: A3256 )
Carbenicillin (Carbenicillin Direct)
Agar (Sigma-Aldrich, catalog number: A1296 )
Tryptone (Fluka, catalog number: T7293 )
Yeast extract (Fluka, catalog number: 92114)
Potassium chloride (Thermo Fisher Scientific, catalog number: BP366 )
Bis-(3-phenyl-5-oxoisoxazol-4-yl)pentamethine oxonol (Oxonol V) (Life Technologies, Molecular Probes®, catalog number: O-266 )
Note: In our original work we used Oxonol V supplied by Cambridge Bioscience Ltd. However, this product no longer appears in their catalogue.
Nigericin (Sigma-Aldrich, catalog number: N7143 )
Valinomycin (Sigma-Aldrich, catalog number: 94675 )
BisTris propane (BTP) (Sigma-Aldrich, catalog number: B6755 )
Phenylmethanesulfonyl fluoride (PMSF) (Sigma-Aldrich, catalog number: P7626 )
Deoxyribonuclease I (DNase) from bovine pancreas (Sigma-Aldrich, catalog number: DN25 )
Carbonyl cyanide 3-chlorophenylhydrazone (CCCP) (Sigma-Aldrich, catalog number: C2759 )
Sodium DL-lactate solution 50% aqueous (VWR International, catalogue number: 27927.298 )
Magnesium sulphate heptahydrate (MgSO4.7H2O) (Thermo Fisher Scientific, catalogue number: M/1000/60 )
Sodium cholate hydrate (Sigma-Aldrich, catalog number: C1254 )
Sodium D-gluconate (Sigma-Aldrich, catalog number: S2054 )
Potassium D-gluconate (Sigma-Aldrich, catalog number: G4500 )
Absolute ethanol (Thermo Fisher Scientific, catalogue number: E/0650DF/17 )
High purity (18 MΩ) Millipore or AnalR water
D-sorbitol (Sigma-Aldrich, catalog number: S1876 )
Sucrose (Sigma-Aldrich, catalog number: 84097 )
DL-dithiothreitol(Sigma-Aldrich, catalog number: 43815 )
TRIZMA base (Sigma-Aldrich, catalog number: T1503 )
Sulphuric acid (Sigma-Aldrich, catalog number: 320501 )
LBK agar (see Recipes)
LBK liquid medium (see Recipes)
Tris/sorbitol/dithiothreitol/sucrose (TSDS) buffer (see Recipes)
Transport assay buffer (see Recipes)
2 M sodium D-gluconate stock solution (see Recipes)
2 M potassium D-gluconate stock solution (see Recipes)
Equipment
Temperature-controlled shaking incubator for bacterial growth
Large ice bucket
Petri dishes for bacterial colony growth
100 ml conical flasks
250 ml conical flasks (x2)
5,000 ml conical flask
Refrigerated, large capacity centrifuge and rotor for harvesting bacterial cells
1,000 ml or 500 ml centrifuge pots and lids
Benchtop vortexer
100 ml beaker and stir bar to fit
Magnetic stirrer
25 ml disposable plastic pipettes
Selection of single channel pipettes (1,000 µl, 100 µl, 20 µl, 10 µl)
Pipette tips for above
Refrigerated centrifuge and rotor capable of spinning ~50 ml tubes at 18k x g.
Refrigerated ultracentrifuge, rotor and polycarbonate ultracentrifuge tubes capable of handling ~30 - 50 ml volumes
French Press (Thermo Electron Corp, catalogue number: FA-078 )
Standard pressure cell (40 kpsi; 35 ml capacity) (Thermo Electron Corp, catalogue number: FA-031 )
50 ml syringes (for filtering solutions)
0.22 µm sterile filters to fit 50 ml syringe
1 L and 500 ml Duran bottles with lids
1.5 ml Eppendorf tubes
Medical wipes (Kimwipes®)
Parafilm
UV/vis spectrophotometer and 10 mm pathlength quartz cuvette
10 x 4 mm, 1,400 µl volume quartz cuvette for fluorescence spectroscopy (Hellma, catalog number: 104F-QG )
Small magnetic stir bar to fit inside quartz cuvette
Fluorometer e.g. Fluoromax-4 (Horiba) capable of performing time-based acquisition measurements and fitted with a temperature controlled cuvette holder and stirrer
Source of compressed air (either aerosol can or fixed supply) for drying cuvette
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Holdsworth, S. R. and Law, C. J. (2014). Measurement of the Electrogenicity of Bile Salt/H+ Antiport in Escherichia coli. Bio-protocol 4(21): e1279. DOI: 10.21769/BioProtoc.1279.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Other compound
Microbiology > Microbial metabolism > Nutrient transport
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
128 | https://bio-protocol.org/exchange/protocoldetail?id=128&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
PCR-RFLP Genotyping of Point Mutations in Caenorhabditis elegans
Peichuan Zhang
Published: Vol 2, Iss 6, Mar 20, 2012
DOI: 10.21769/BioProtoc.128 Views: 25005
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
This protocol describes the basic principle of PCR/restriction digest genotyping of point mutations in worms, based on the principle of Restriction Fragment Length Polymorphism (RFLP) analysis. This type of genotyping is, particularly, useful when phenotypic analysis of animals carrying point mutations is difficult (e.g., in a complex genetic background).
I will illustrate the general procedures, using an example of daf-2 gene, encoding the sole insulin/IGF-1 receptor of C. elegans. Gems et al.(1998) did a very elegant job and characterized a series of mutations of daf-2, including the following two temperature-sensitive hypomorphic alleles:
daf-2(e1370): Substitution C/T (wild type/mutant), amino acid change: Missense P to S
Flanking sequences:
5’-CTCTATGAAATGGTTACACTCGGTGCTCAGCATATATTGGTTTGAGTAATGAGGTGT
Intracellular kinase domain, Class I, strong phenotype.
daf-2(e1368): Substitution C/T (wild type/mutant), amino acid change: Missense S to L
Flanking sequences:
5’-TCCGGAATTTACGTATTGAGGCAAAGTACTGTTCAGAAATVTATATGCTATCACAGT
Extracellular ligand binding domain, Class II, weak phenotype.
Here I will show you how to design the primers for PCR-RFLP analysis.
daf-2(e1370): Designed by Seung-Jae Lee from the Kenyon lab
Forward primer: 5’-CGGGATGAGACTGTCAAGATTGGAGATTTCGG-3’
Reverse primer: 5’-CAACACCTCATCATTACTCAAACCAATCCATG-3’
On the (-) strand, the nucleotide next to the 3’ end of reverse primer is G in wild-type allele, which is mutated to T in daf-2(e1370). Thus, by introducing another mutation (double C here, highlighted) into the reverse primer, it creates an Nco I-restriction site (i.e., CCATGG) only for PCR products derived from wild-type but NOT daf-2(1370).
daf-2(e1368): Designed by Peichuan Zhang from the Kenyon lab
Forward primer: 5’-GTTCCGGAATTTACGACGTATTGAGGCAACG-3’
Reverse primer: 5’-CTATCGGATCGAGTGGTATATTTAAC-3’
Similarly, on the (+) strand, the nucleotides next to the 3’ end of forward primer are TC in wild-type allele, and TT in daf-2(e1368). Thus, by introducing another mutation (C here, highlighted) into the forward primer, a restriction site of Acl I (i.e., AACGTT) is generated in the presence of daf-2(1368) point mutation.
The key is to introduce new mutation(s) at the 3’ end of one of your primers. Since the difference of the sizes of digest products is just ~30-bp, the length of the primer, you have to pick the other primer to generate an amplicon of ~200-bp – 250-bp or so.
Here is a website that can help you design the primers with appropriate restriction site for genotyping: http://helix.wustl.edu/dcaps/dcaps.html (dCAPS Finder 2.0) (Neff et al., 2002).
Keywords: C. elegans PCR genotyping Point mutation
Materials and Reagents
PK lysis buffer
Proteinase K (Sigma-Aldrich, catalog number: P6556 )
Common PCR reagent (e.g., Invitrogen PCR kit – Life Technologies, Invitrogen™, catalog number: 10342-020 ; or home-made Taq and buffer)
Restriction enzymes (NEB)
Agarose gel
Ethidium bromide (Life Technologies, Invitrogen™, catalog number: 15585-011 )
Plus DNA Ladder (Life Technologies, Invitrogen™, catalog number: 10787-018 )
Equipment
MJ Research PTC-200 Thermo Cycler (MJ Research)
Thin-wall PCR tubes (USA Scientific, catalog numbers: 1402-2700 or 1405-8100 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zhang, P. (2012). PCR-RFLP Genotyping of Point Mutations in Caenorhabditis elegans. Bio-protocol 2(6): e128. DOI: 10.21769/BioProtoc.128.
Download Citation in RIS Format
Category
Molecular Biology > DNA > Genotyping
Molecular Biology > DNA > PCR
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,280 | https://bio-protocol.org/exchange/protocoldetail?id=1280&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Purification and Detection of a PDGA Depolymerase from Pusillimonas noertemannii
DN David Negus
PT Peter W. Taylor
Published: Vol 4, Iss 21, Nov 5, 2014
DOI: 10.21769/BioProtoc.1280 Views: 8684
Edited by: Fanglian He
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
The purification of a target protein from a complex mixture of proteins is a challenging undertaking. If the target protein has been previously characterised, then information such as subcellular location, function, molecular weight and pI can be used for the design of a purification strategy. However, if the target protein is uncharacterised or little information regarding its characteristics is available, a generic purification protocol can be employed that is optimised as additional characteristics of the target protein are determined during subsequent purification steps. Herein, we describe the protocol for the purification and detection of a poly-γ-D-glutamic acid (PDGA) depolymerase from a consortium culture of two Gram-negative bacteria using a combination of chromatography, 2D-electrophoresis and zymography.
Materials and Reagents
Pusillimonas noertemannii BS8 (isolated by soil enrichment)
Pseudomonas fluorescens BS2 (isolated by soil enrichment)
Poly-γ-D-glutamic acid >250 kDa [prepared in-house; protocol for production can be found in Negus and Taylor (2014)]
Protein assay dye reagent (Bio-Rad Laboratories, catalog number: 500-0006 )
1.5 ml Microcentrifuge tubes (Eppendorf, catalog number: 0030120086 )
Laemmli sample buffer (Sigma-Aldrich, catalog number: S3401-10VL )
IPG strips (immobilized pH 3-10, 7 cm) (Bio-Rad Laboratories, catalog number: 163-2000 )
Mineral oil (Bio-Rad Laboratories, catalog number: 163-2129 )
Rehydration trays (Bio-Rad Laboratories, catalog number: 165-4035 )
Acrylamide solution (Bio-Rad Laboratories, catalog number 161-0156 )
TEMED (Sigma-Aldrich, catalog number T9281 )
Agarose overlay solution (Bio-Rad Laboratories, catalog number 163-2111 )
Zymogram renaturation buffer (Bio-Rad Laboratories, catalog number: 161-0765 )
Zymogram development buffer (Bio-Rad Laboratories, catalog number: 161-0766 )
Molecular biology grade water (Merck KGaA, catalog number: H20MB05010 )
30% ethanol
50% ethanol
Minimal salts medium broth (see Recipes)
Anion exchange binding buffer (see Recipes)
Anion exchange elution buffer (see Recipes)
Equilibration buffer (see Recipes)
Non-reducing sample buffer (see Recipes)
SDS buffer (see Recipes)
Resolving gel buffer (see Recipes)
Stacking gel buffer (see Recipes)
10% SDS (see Recipes)
10% APS (see Recipes)
10x TGE running buffer (see Recipes)
Coomassie-based dye (see Recipes)
Coomassie destain solution (see Recipes)
Methylene blue stain (see Recipes)
70% ethanol (see Recipes)
Equipment
Universal tube (Sterilin®, catalog number: 128B/P )
Erlenmeyer conical flask narrow neck 2 L (Thermo Fisher Scientific, catalog number: 11577422 )
Cuvettes (1.6 ml semi-micro) (Thermo Fisher Scientific, catalog number: 10594175 )
Syringe driven filters (0.22 µm, polyethersulfone) (Millex®, catalog number: SLGP033RS )
Electrode paper wicks (Bio-Rad Laboratories, catalog number: 165-4071 )
Shaking incubator (Infors AG, model: Multitron standard )
Spectrophotometer (PerkinElmer, model: Lambda 25 )
Benchtop centrifuge (Sigma-Aldrich, model: 4-16K )
Sonicator (MSE, model: Soniprep 150 )
Exponential sonicator probe (MSE, catalog number: 38121-114A )
Centrifugal protein concentrators (Sartorious, model: Vivaspin 20, 3 kDa MWCO, catalog number: VS2092 )
Centrifugal protein concentrators (Sartorious, model: Vivaspin 6, 3 kDa MWCO, catalog number: VS0692 )
Static incubator (Unitemps, discontinued) (B&T)
ÄKTAprime plus chromatography system (GE Healthcare, Prime plus, catalog number: 11-0013-13 )
Anion-exchange chromatography column (GE Healthcare, model: Hi-Trap Q XL, catalog number: 17-5158-01 )
Orbital rocking platform (Stuart, model: SSM1 )
Thermal cycler (TECHNE, discontinued, model: FTGENE 2D )
Electrophoresis cell (Bio-Rad Laboratories, Mini-PROTEAN® Tetra Cell, catalog number: 165-8003 )
Isoelectric focusing cell (Bio-Rad Laboratories, Protean, catalog number: 165-4000 )
Vortex mixer (Appleton Woods, Clifton cyclone, catalog number: AA6500 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Negus, D. and Taylor, P. W. (2014). Purification and Detection of a PDGA Depolymerase from Pusillimonas noertemannii. Bio-protocol 4(21): e1280. DOI: 10.21769/BioProtoc.1280.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Electrophoresis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,281 | https://bio-protocol.org/exchange/protocoldetail?id=1281&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Accelerated Storage Stability Testing of a Potential Anti-Anthrax Therapeutic, EnvD
DN David Negus
PT Peter W. Taylor
Published: Vol 4, Iss 21, Nov 5, 2014
DOI: 10.21769/BioProtoc.1281 Views: 8108
Edited by: Fanglian He
Reviewed by: Kanika Gera
Original Research Article:
The authors used this protocol in Mar 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2014
Abstract
The purpose of stability testing is to determine how the properties of a particular therapeutic vary with time under the influence of specific environmental factors. Information regarding the long-term stability of therapeutics can be extrapolated by performing an accelerated storage stability study. Here, we describe an accelerated storage stability study for the potential anti-anthrax therapeutic, EnvD, a poly-γ-D-glutamic acid (PDGA) depolymerase. Storage conditions were based on those recommended by the International Conference on Harmonisation of Technical Requirements for Registration of Pharmaceuticals for Human Use (ICH). Owing to the high-molecular-weight and associated viscosity of PDGA in solution, loss of enzyme activity on storage can be determined as a reduction in the capacity of the depolymerase to reduce the viscosity of the polymer. This work supported by a Medical Research Council Capacity Building Studentship award.
Materials and Reagents
Poly-γ-D-glutamic acid [prepared in-house; protocol for production can be found in Negus and Taylor (2014)]
Recombinant EnvD enzyme (prepared in-house)
PBS (Thermo Fisher Scientific, catalog number: 12821680 )
Distilled water (prepared in-house)
Compressed air (prepared in-house)
70% ethanol (see Recipes)
Equipment
1.5 ml microcentrifuge tubes (Eppendorf, catalog number: 0030120086 )
Parafilm (Pechiney Plastic Packaging, catalog number: PM996 )
5 ml sterile plastic syringes (Terumo Medical Corporation, catalog number: SS-05S )
Static incubator (Unitemps, discontinued) (B&T)
Micro-viscometer (Anton Paar GmbH, model: AMVn, catalog number: 1569 )
Glass capillary for micro-viscometer (1.6 mm internal diameter) (Anton Paar GmbH, catalog number: 67605 )
Steel balls (1.5 mm diameter) (Anton Paar GmbH, catalog number: 73109 )
Capillary filling adapater (Anton Paar GmbH, catalog number: 63390 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,282 | https://bio-protocol.org/exchange/protocoldetail?id=1282&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation and in vitro Activation of Mouse Peyer’s Patch Cells from Small Intestine Tissue
CP Claudia Pastori
LL Lucia Lopalco
Published: Vol 4, Iss 21, Nov 5, 2014
DOI: 10.21769/BioProtoc.1282 Views: 19545
Reviewed by: Andrea IntroiniKathrin Sutter
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
The lumen of gastrointestinal tract is exposed to several potentially pathogenic microorganisms, thus it is extremely relevant to understand how immunosurveilance can be established. Peyer’s Patches (PPs) are oval or round lymphoid nodules that protrude from the outer wall of the ileum portion of small intestine. PPs contain a high percentage of B and T lymphocytes, macrophages and dendritic cells. Here we summarize a protocol for isolation and culture of mouse PP cells, which can be used to get a better insight into immunopathologies of microbes and to evaluate immune responses elicited by mucosal vaccines.
Keywords: Mucosae Peyer's Patch Intestine
Materials and Reagents
Mouse (e.g. Balb/c) 8-20 weeks old
Sterile PBS without Ca/Mg (Euroclone, catalog number: ECB4004L )
Pen/Strep: 100x solution of penicillin/streptomycin/fungizone (Life Technologies, Gibco®, catalog number: 15240-062 )
Gentamycin (50 mg/ml solution) (Life Technologies, Gibco®, catalog number: 15750-037 )
RPMI 1640 (with glutamine) (Lonza, catalog number: BE12-702F )
Fetal bovine serum (FBS) (heat inactivated) (Lonza, catalog number: DE14-801F )
0.4% trypan blue (Sigma-Aldrich, catalog number: T8154 )
Phorbol 12-Myristate 13-Acetate (PMA) (Sigma-Aldrich, catalog number: P8139 - follow the manufacturer's instructions to prepare stock solutions)
Ionomycin (Sigma-Aldrich, catalog number: I9657 - follow the manufacturer's instructions to prepare stock solutions)
Common disinfectant (i.e. 70-90% ethanol, tincture of iodine)
PBS + 2% Pen/Strep (see Recipes)
RPMI + 2% Pen/Strep (see Recipes)
Complete medium (see Recipes)
Equipment
Soft wood tablet and pins
Aluminium foils (or another smooth, non-absorbent surface)
Three sterile small thin surgical scissors
Note: In particular one for cutting the skin, the second one for cutting the muscular wall and the intestine, and the last one for removing PPs.
Four sterile small thin surgical tweezers, two straight and two curved (straight ones for cutting the skin, the muscular wall and the intestine; curved ones to expel faeces and to remove PPs)
70 µm cell strainer (BD Biosciences, Falcon®, catalog number: 352350 )
2.5 ml syringes
15 and 50 ml centrifuge tubes
24-well cell culture plates
Refrigerated centrifuge
Sterile flow hood
Thermostatic water bath
Inverted microscope for cell cultures
37 °C, 5% CO2 cell culture incubator
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Immune cell isolation > Lymphocyte
Immunology > Immune cell isolation > Macrophage
Microbiology > Microbe-host interactions > In vitro model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,283 | https://bio-protocol.org/exchange/protocoldetail?id=1283&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
An Experimental Model of Neonatal Nociceptive Stimulation in Rats
JM Jackeline Moraes Malheiros
CA Cristiane Amaral
AL Ana Teresa S Leslie
RG Ruth Guinsburg
Luciene Covolan
Published: Vol 4, Iss 21, Nov 5, 2014
DOI: 10.21769/BioProtoc.1283 Views: 9393
Edited by: Soyun Kim
Reviewed by: Antoine de Morree
Original Research Article:
The authors used this protocol in Apr 2014
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2014
Abstract
In order to survive, preterm and/or sick neonates need diagnostic and therapeutic measures that may cause discomfort, stress and pain during a critical period of intense growing and modeling of the central nervous system (Anand et al., 2013). Scientific interest in the long lasting effects of the Neonatal Intensive Care (NIC) experience, which provides a sensory experience completely different from the natural uterine environment, is growing (Jobe, 2014). The follow-up of critically ill newborn infants until adulthood indicated an association of early noxious stimuli with long lasting alterations in somatosensory and cognitive processing (Doesburg, 2013; Vinall et al., 2014; Vinall et al., 2013). However, one major limitation of the clinical studies is the difficulty to distinguish between long-term effects of pain suffered during neonatal intensive care and other confounding factors such as the presence of non-painful stress during hospital stay, the occurrence of acute and chronic morbidities, the post-natal environmental influences and family care. In this context, the understanding of the roles played by each factor and the interplay between these diverse variables require the use of animal models. The protocol described here is used to model the noxious stimulation in which premature newborns are subjected during treatment in the NIC. The current protocol models inflammatory nociceptive stimulation in neonatal rats, as previously demonstrated (Leslie et al., 2011; Lima et al., 2014; Malheiros et al., 2014). Complete Freund's adjuvant (CFA) is a solution of antigen emulsified in mineral oil and used as an immunopotentiator, causing a painful reaction that lasts 7-8 days after subcutaneous injection. It is effective in stimulating cell-mediated immunity. The rodent model of neonatal inflammatory stimulation with CFA is advantageous because at birth the formation of the central nervous system is incomplete in rat pups and corresponds to that of 24 week intra-uterine human preterm neonates (Anand et al., 1999), following similar patterns in the development of the pain system (Fitzgerald and Anand,1993). The first postnatal week in newborn rat pups corresponds to human premature infants from 24-36 weeks of gestation (Kim et al., 1996; Wilson, 1995), offering a suitable condition to model and compare preterm (rat pups on P1) to full term (rat pups on P8) infants subjected to noxious stimulation. In this paper, we present our methods to induce nociceptive inflammatory stimulation in neonatal rat pups as an attractive approach to study short- or long-term effects and the mechanisms underlying the behavioral repertoire of ex-premature infants or adolescents.
Keywords: Pain Neonatal pain Development Neurogenesis CFA
Materials and Reagents
Pregnant Wistar rats are acquired around the 14th day of gestation
Note: It is important to determine the P0 (postnatal day 0).
Complete Freund’s adjuvant (CFA) (25 µl) (Sigma-Aldrich, catalog number: F5881 )
Note: The CFA is diluted in 0,9% sterile saline just before use (2:1, CFA:saline).
Equipment
Plastic cages (for maintaining the animals)
Automatic temperature control system
Insulin Syringe Ultra-Fine 6 mm (15/64”) x 31 G needle
Electronic scale (sensitivity 0.1 g)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Malheiros, J. M., Amaral, C., Leslie, A. T. S., Guinsburg, R. and Covolan, L. (2014). An Experimental Model of Neonatal Nociceptive Stimulation in Rats. Bio-protocol 4(21): e1283. DOI: 10.21769/BioProtoc.1283.
Download Citation in RIS Format
Category
Neuroscience > Behavioral neuroscience > Animal model
Neuroscience > Nervous system disorders > Animal model
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
Subsets and Splits