id
int64 7
5.24k
| url
stringlengths 48
63
| content
stringlengths 567
149k
|
|---|---|---|
10 | https://bio-protocol.org/exchange/protocoldetail?id=10&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Colony PCR Using Yeast Spheroplasted Cells
Bio-protocol Editor
Published: Jan 5, 2011
DOI: 10.21769/BioProtoc.10 Views: 14271
Download PDF
Ask a question
Favorite
Cited by
Abstract
The first part of this protocol involves the removal of yeast cell walls using the Zymolase enzyme. The resulting spheroplast cells can then be used as template for PCR. This quick and easy to implement protocol describes how to prepare spheroplasted yeast cells for colony PCR.
Materials and Reagents
Spheroplasted yeast cells
Zymolase 20 T [AMS Biotechnology (Europe)]
Sorbitol
Sodium phosphate
Zymolyase solution (see Recipes)
Equipment
Sterile pipette tips
Standard laboratory PCR machine
Wooden toothpicks
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Molecular Biology > DNA > PCR
Microbiology > Microbial genetics > DNA
Cell Biology > Cell structure > Cell surface
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
100 | https://bio-protocol.org/exchange/protocoldetail?id=100&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Scratch Wound Healing Assay
YC Yanling Chen
Published: Vol 2, Iss 5, Mar 5, 2012
DOI: 10.21769/BioProtoc.100 Views: 121829
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
The scratch wound healing assay has been widely adapted and modified to study the effects of a variety of experimental conditions, for instance, gene knockdown or chemical exposure, on mammalian cell migration and proliferation. In a typical scratch wound healing assay, a “wound gap” in a cell monolayer is created by scratching, and the “healing” of this gap by cell migration and growth towards the center of the gap is monitored and often quantitated. Factors that alter the motility and/or growth of the cells can lead to increased or decreased rate of “healing” of the gap (Lampugnani, 1999). This assay is simple, inexpensive, and experimental conditions can be easily adjusted for different purposes. The assay can also be used for a high-throughput screen platform if an automated system is used (Yarrow and Perlman, 2004).
Materials and Reagents
Human MDA-MB-231 cell line (ATCC, catalog number: HTB-26 ™)
Dulbecco's modified eagle medium (DMEM) (Life Technologies, Invitrogen™, catalog number: 10313-021 )
Fetal bovine serum (FBS) (ATCC, catalog number: 30-2020 ™)
Phosphate buffered saline (PBS) (Life Technologies, Invitrogen™, catalog number: 14190-144 )
Glutaraldehyde (Sigma-Aldrich, catalog number: G6257 )
Ethanol (Sigma-Aldrich, catalog number: 459836 )
Crystal violet (Sigma-Aldrich, catalog number: C3886 )
Equipment
BD Falcon 24-well tissue culture plate (Fisher Scientific, catalog number: 08-772-1H; BD Biosciences, catalog number: 353226 )
Rainin pipet tips (1 ml) (Mettler-Toledo, catalog number: GPS-L1000 )
Cell culture incubator: 37 °C and 5% CO2
Software
Photoshop or ImageJ (http://rsb.info.nih.gov/ij/download.html)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chen, Y. (2012). Scratch Wound Healing Assay. Bio-protocol 2(5): e100. DOI: 10.21769/BioProtoc.100.
Download Citation in RIS Format
Category
Cancer Biology > Invasion & metastasis > Cell biology assays
Cell Biology > Cell movement > Cell migration
Cell Biology > Cell viability > Cell proliferation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,000 | https://bio-protocol.org/exchange/protocoldetail?id=1000&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
ImmunoFISH for Mice and Baboons Frozen Sections
FR Francesca Rossiello
MF Marzia Fumagalli
FF Fabrizio d’Adda di Fagagna
Published: Vol 3, Iss 24, Dec 20, 2013
DOI: 10.21769/BioProtoc.1000 Views: 8845
Edited by: Lin Fang
Original Research Article:
The authors used this protocol in Apr 2012
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2012
Abstract
This protocol is optimized for immunoFISH staining of OCT section of mouse tissues. It combines immunofluorescence for DNA damage response factors (e.g. 53BP1) (Le et al., 2010) and FISH against telomeric DNA.
Keywords: ImmunoFISH DNA damage response Telomeres Baboon tissues
Materials and Reagents
Tissue
OCT
4% formaldehyde
PBS
Triton
Goat serum
BSA
Primary antibody: 53BP1 #NB 100-304 rabbit from Novus
Second antibody: goat anti-rabbit Alexa Fluor® 488 Dye
Triton
Glycine
Mowiol 4-88 reagent (Calbiochem®)
Formamide
Tris HCl, pH 7.4
Telomeric PNA probe (TelC-Cy3 from PANAGENE, catalog number: F1002-5 )
Tween-20
DAPI
Hybridization mixture (see Recipes)
Blocking reagent (Roche Diagnostics, catalog number: 11096176001 ) (see Recipes)
Wash solution I (see Recipes)
Wash solution II (see Recipes)
Equipment
Glass slide
Metal thermoblock
Humidified chamber
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2013 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cell Biology > Cell imaging > Fluorescence
Cell Biology > Tissue analysis > Tissue isolation
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,001 | https://bio-protocol.org/exchange/protocoldetail?id=1001&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
EMS Mutagenesis of Clostridium difficile to Identify Strains with Germination-null Phenotypes
M Michael B. Francis
JS Joseph A. Sorg
Published: Vol 3, Iss 24, Dec 20, 2013
DOI: 10.21769/BioProtoc.1001 Views: 10956
Original Research Article:
The authors used this protocol in May 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2013
Abstract
Clostridium difficile is a Gram-positive, spore-forming, strict anaerobe and the leading cause of antibiotic-associated diarrhea (McFarland, 2008). Germination by C. difficile spores is the first step in pathogenesis. Thus, identifying mechanisms of C. difficile spore germination may lead to novel anti-germination therapies. This protocol describes a method for identifying germination-null phenotypes for C. difficile spores by introducing random mutations into actively growing C. difficile using ethyl methanesulfonate (EMS) as a mutagen (Francis et al., 2013).
Keywords: Clostridium difficile Germination Spore Mutagenesis
Materials and Reagents
A petri plate of viable C. difficile cells
Ethyl methanesulfonate (EMS)
Rifampin
Sterile water
Sucrose
10% (w/v) taurocholic acid
Thioglycollate
Lysozyme
Brain Heart Infusion (BD BactoTM, catalog number: 237500 )
Yeast Extract (BD DifcoTM, catalog number: 212750 )
0.1% (w/v) L-cysteine (Sigma-Aldrich, catalog number: C7352 )
BHIS medium (see Recipes)
BHIS agar medium (see Recipes)
Equipment
15 ml conical screw cap tubes
50 ml conical screw cap tubes
Anaerobic chamber
Spectrophotometer or microplate reader
Biosafety cabinet
Bench-top microcentrifuge
Swinging-bucket centrifuge
65 °C heat block
50 °C water bath
37 °C water bath
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Francis, M. B. and Sorg, J. A. (2013). EMS Mutagenesis of Clostridium difficile to Identify Strains with Germination-null Phenotypes. Bio-protocol 3(24): e1001. DOI: 10.21769/BioProtoc.1001.
Francis, M. B., Allen, C. A., Shrestha, R. and Sorg, J. A. (2013). Bile acid recognition by the Clostridium difficile germinant receptor, CspC, is important for establishing infection. PLoS Pathog 9(5): e1003356.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > Mutagenesis
Microbiology > Microbial cell biology > Cell isolation and culture
Molecular Biology > DNA > Mutagenesis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,002 | https://bio-protocol.org/exchange/protocoldetail?id=1002&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Virulence Studies of Clostridium difficile
M Michael B. Francis
JS Joseph A. Sorg
Published: Vol 3, Iss 24, Dec 20, 2013
DOI: 10.21769/BioProtoc.1002 Views: 7960
Original Research Article:
The authors used this protocol in May 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2013
Abstract
Clostridium difficile (a Gram-positive, spore-forming, strict anaerobe) can colonize antibiotic-treated hosts (McFarland, 2008). Antibiotics alter the composition of the normal, benign microbial flora which leads to loss of colonization resistance (Wilson and Perini, 1988; Antonopoulos et al., 2009). C. difficile spores germinate to actively growing bacteria which secrete toxins that damage the colonic epithelium (Voth and Ballard, 2005). The use of animal models of C. difficile disease have allowed the identification of mechanisms of colonization and virulence factors (Lyras et al., 2009; Kuehne et al., 2010; Francis et al., 2013; Aubry et al., 2012; Carter et al., 2011). This protocol describes virulence studies of C. difficile in the hamster model of C. difficile infection (Bartlett et al., 1978; Sambol et al., 2001).
Keywords: Clostridium difficile Spore Virulence Hamster Animal model
Materials and Reagents
Institutional Animal Care and Use Committee (IACUC)-approved animal use protocol
C. difficile spores
Female Syrian golden hamsters (80 g–120 g)
Clindamycin Injection, USP (150 mg/ml) (Hospira, catalog number: 0409-4052 )
Dulbecco’s Modified Eagle Medium (DMEM)
Equipment
Animal feeding needles (gavage needles)
1 ml syringe
Dedicated BSL2 animal facility
Scale
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2013 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbe-host interactions > In vivo model
Immunology > Host defense > General
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,003 | https://bio-protocol.org/exchange/protocoldetail?id=1003&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Adult Mouse Muscle Stem Cells
JL Ju Li
Published: Vol 3, Iss 24, Dec 20, 2013
DOI: 10.21769/BioProtoc.1003 Views: 10262
Edited by: Lin Fang
Original Research Article:
The authors used this protocol in Apr 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2013
Abstract
Muscle stem cells are adult stem cells responsible for muscle development, growth and regeneration. Current knowledge suggests those cells are heterogeneous population shared their position between the sarcolemma and basal lamina of muscle fibers. This protocol describes the technique to dissociate and collect the stem cells from skeletal muscle of adult mice, and separate them from other cells found in muscle (e.g. fat, connective tissue). To purify and preserve those myofiber associated muscle stem cells, we use two steps of enzyme digestion followed by cell pre-plating procedures.
Materials and Reagents
Collagenase type II (Sigma-Aldrich, catalog number: C6885 )
Penicillin Streptomycin (Gibco®)
HEPES
Dulbecco’s Modified Eagle Medium (DMEM)
Dispase II (STEMCELL Technologies)
Bovine Growth Serum (Hyclone)
Collagenase type II solution (see Recipes)
Collagenase/Dispase solution (see Recipes)
Growth medium (see Recipes)
Equipment
Scissor
50 ml conical tube
Microscope
100 mm cell culture dish
40 μm filter
Fluorescence Activated Cell Sorter (FACS)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Li, J. (2013). Preparation of Adult Mouse Muscle Stem Cells. Bio-protocol 3(24): e1003. DOI: 10.21769/BioProtoc.1003.
Download Citation in RIS Format
Category
Stem Cell > Adult stem cell > Muscle stem cell
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,004 | https://bio-protocol.org/exchange/protocoldetail?id=1004&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Influenza Virus-cell Fusion Inhibition Assay
Mayo Yasugi
Kazuyoshi Ikuta
Published: Vol 3, Iss 24, Dec 20, 2013
DOI: 10.21769/BioProtoc.1004 Views: 10570
Original Research Article:
The authors used this protocol in Feb 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2013
Abstract
During viral infection to host cells, several viruses undergo the process of endocytosis and pH-dependent fusion. By fusion of viral membrane with host cellular membrane, the viral core invades to host cytoplasm. A part of monoclonal antibodies against viral membrane protein have potential to inhibit the viral fusion step. Here we describe in vitro influenza virus-cell fusion inhibition assay. The infected cells expressing viral membrane protein, such as hemagglutinin (HA), on cellular surface are incubated with monoclonal antibodies targeting viral membrane protein. Then the cells are incubated under low pH condition. If the antibody does not inhibit the fusion step, we can see multinucleated giant cells.
Keywords: Endocytosis PH-dependent fusion Viral entry Hemagglutinin Influenza virus
Materials and Reagents
Monkey kidney cell line CV-1 cells
MDCK-propagated Influenza B viruses (B/Florida/4/2006 and B/Malaysia/2506/2004) provided by the National Institute of Infectious Diseases, Japan
Minimal Essential Medium (MEM) (Sigma-Aldrich, catalog number: M4655 )
Fetal Bovine Serum (FBS) (MP Biomedicals, catalog number: 2917054 )
Phosphate buffered saline without Ca2+ and Mg2+ (PBS)
Dulbecco’s Modified Eagle’s Medium F12 (DMEMF12) (Life Technologies, catalog number: 11320-033 )
Acetylated trypsin (Sigma-Aldrich, catalog number: T6763 )
Giemsa stain solution (Wako Pure Chemical Industries, catalog number: 079-04391 )
Methanol (Nacalai tesque, catalog number: 21915-93 )
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A9576 )
Specific pathogen
Monoclonal antibody
MEM powder (Nisshin EM, catalog number: 05901 )
HEPES (Sigma-Aldrich, catalog number: H3375 )
MES (Wako Pure Chemical Industries, catalog number: 344-08351 )
Fusion medium (see Recipes)
Equipment
96-well cell culture plate (Corning, catalog number: 3596 )
CO2 incubator (37 °C, 5% CO2)
Light microscope
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2013 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Host defense > General
Immunology > Antibody analysis > Antibody function
Cell Biology > Cell-based analysis > Cytosis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
hello! I had some questions during my experiments similar with you guys.
1 Answer
41 Views
May 13, 2024
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,005 | https://bio-protocol.org/exchange/protocoldetail?id=1005&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Neutralizing Antibody
Mayo Yasugi
Kazuyoshi Ikuta
Published: Vol 3, Iss 24, Dec 20, 2013
DOI: 10.21769/BioProtoc.1005 Views: 9536
Original Research Article:
The authors used this protocol in Feb 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2013
Abstract
Use of monoclonal antibodies (MAbs) is an established laboratory strategy for characterization of specific pathogens and their antigenicity. Especially, Human MAbs (HuMAbs) with neutralizing activity against specific virus could have potential therapeutic application, and provide significant information on human epitopes that could be important for developing the next generation of universal vaccines against the virus. In addition to the classical method for murine MAb preparation, several methods for the preparation of HuMAbs have been developed. Here, we describe the development of neutralizing HuMAbs against specific virus. HuMAbs are established by fusion of the peripheral blood mononuclear cells of vaccinated volunteers or patients with the fusion partner cell line, named SPYMEG. Then each of prepared HuMAbs is confirmed whether it can neutralize the specific virus by in vitro neutralization assay.
Keywords: Influenza Hemagglutinin Monoclonal antibody Neutralization Vaccine
Materials and Reagents
Human blood immunized by vaccination or natural infection against specific pathogen
Human fusion partner SPYMEG cells (product of the Medical & Biological Laboratories Corporation, Ltd, Nagoya, Japan)
Madin-Darby canine kidney (MDCK) cells provided from RIKEN cell bank
MDCK-propagated Influenza B viruses (B/Florida/06/2004 and B/Malaysia/2506/2006) by the National Institute for Infectious Diseases, Japan
Phosphate-buffered saline without Ca2+ and Mg2+ (PBS)
HetaSep (STEMCELL Technologies, catalog number: 07906 )
Ficoll-Paque PLUS (GE, catalog number: 17-1440-03 )
Dulbecco’s Modified Eagle’s Medium (DMEM) (Life Technologies, catalog number: 11995 )
Polyethylene glycol #1500 (PEG) (Roche Diagnostics, catalog number: 00-783-641-00 )
Fecal Bovine Serum (FBS) (MP Biomedicals, catalog number: 2917054 )
HAT supplement (Life Technologies, catalog number: 21060 )
Antibody against the specific pathogen
HT supplement (Life Technologies, catalog number: 11067 )
Minimal Essential Medium (MEM) (Sigma-Aldrich, catalog number: M4655 )
Ethanol (Nacalai Tesque, catalog number: 14713-53 )
Hybridoma SFM (Life Technologies, catalog number: 12045-084 )
HiTrap Protein G HP (GE, catalog number: 17-0404-01 )
BM condimed (Roche Diagnostics, catalog number: 10-663-573-001 )
Heparin 5,000 units per 5 ml (Novo-Heparin, Mochida Phrrmaceutical)
FITC-conjugated anti-human IgG (Jackson ImmunoResearch Laboratories, catalog number: 109-096-097 )
DMEM-FBS medium (see Recipes)
DMEM-HAT medium (see Recipes)
DMEM-HT medium (see Recipes)
PBS (see Recipes)
Equipment
75 cm2 cell culture flask (T-75 flask) (IWAKI PUMPS, catalog number: 3110-075 )
15- and 50-ml plastic tube (BD Biosciences,, catalog number: 352096 and 352070 )
6- and 10-cm culture dish (IWAKI PUMPS, catalog number: 3010-060 and 3020-100 )
6-, 12-, 24-, 48- and 96-well cell culture plate (IWAKI PUMPS, catalog number: 3810-006 , 3815-012 , 3820-024 , 3830-048 and 3860-096 )
Light microscope
Fluorescent microscope
CO2 incubator (5% CO2, 37 °C)
Incubator
Peristaltic pump (Perista BioMini Pump; ATTO Corporation)
Slide A Lyzer Dialysis Cassetes (MW = 10 K) (Thermo Fisher Scientific, model: 2160728 )
Beaker
Stirrer
Stirrer bar
Millex-HV Filter Unit 0.45 μm (EMD Millipore, model: SLHVJ13SL )
2.5-ml syringe
Floater
21 G needle
Centrifuge (TOMY DIGITAL BIOLOGY, model: LC-121 ; TS-7 rotor )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Yasugi, M. and Ikuta, K. (2013). Isolation of Neutralizing Antibody. Bio-protocol 3(24): e1005. DOI: 10.21769/BioProtoc.1005.
Yasugi, M., Kubota-Koketsu, R., Yamashita, A., Kawashita, N., Du, A., Sasaki, T., Nishimura, M., Misaki, R., Kuhara, M., Boonsathorn, N., Fujiyama, K., Okuno, Y., Nakaya, T. and Ikuta, K. (2013). Human monoclonal antibodies broadly neutralizing against influenza B virus. PLoS Pathog 9(2): e1003150.
Download Citation in RIS Format
Category
Immunology > Antibody analysis > Antibody function
Microbiology > Antimicrobial assay > Killing assay
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,006 | https://bio-protocol.org/exchange/protocoldetail?id=1006&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Surface Plasmon Resonance Analysis of Antigen-Antibody Interaction
Mitsuhiro Nishimura
Kazuyoshi Ikuta
Published: Vol 3, Iss 24, Dec 20, 2013
DOI: 10.21769/BioProtoc.1006 Views: 12828
Original Research Article:
The authors used this protocol in Feb 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2013
Abstract
Molecular interaction between monoclonal antibodies (MAbs) and their recognized antigen is a fundamental event leading to the neutralization activity. Estimation of their binding affinity gives beneficial information to characterize the MAbs and to develop more effective MAbs. Surface plasmon resonance (SPR) analysis is a powerful tool to analyze the molecular interaction, enabling rapid and repetitive estimation with relatively small amount of sample. Here we describe a general protocol about SPR analysis on the interaction between viral antigen and human MAb (HuMAb) IgG. Anti-human Fcγ is first covalently crosslinked on the sensor chip by amine coupling, and then HuMAb of interest is immobilized via anti-Fcγ MAb IgG interaction as ligand. Antigen injected on the sensor chip causes the SPR change in time course as the result of association and dissociation. By analyzing the kinetics, association rate, dissociation rate, and dissociation constant are obtained.
Keywords: Molecular interaction Monoclonal antibody IgG Viral antigen Neutalization activity
Materials and Reagents
Purified HuMAb (IgG)
Purified antigen
2-[4-(2-hydroxyethyl)-1-piperazinyl]ethanesulfonic acid (HEPES) (Nacalai tesque, catalog number: 17514-15 )
Sodium hydroxide (Wako Pure Chemical Industries, catalog number: 198-13765 )
2 mol/L sodium hydroxide solution (Nacalai Tesque, catalog number: 37441-45 )
Sodium acetate, anhydrous (Wako Pure Chemical Industries, catalog number: 192-01075 )
Ethylenediamine-N,N,N',N'-tetraacetic acid, disodium salt, dihydrate (EDTA.2Na) (Dojindo Molecular Technologies, catalog number: 345-01865 )
Polyoxyethylene (20) sorbitan monolaurate (Wako Pure Chemical Industries, catalog number: 167-11515 )
Goat Anti-Human Fcγ (Jackson ImmunoResearch Laboratories INC., catalog number: 109-005-008 )
1-Ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) (Thermo Fisher Scientific, catalog number: 22980 )
N-hydroxysulfosuccinimide (NHS) (Thermo Fisher Scientific, catalog number: 24500 )
Acetic acid (Wako Pure Chemical Industries, catalog number: 017-00256 )
2-ethanolamine (Nacalai tesque, catalog number: 23405-42 )
Hydrochloric acid (Wako Pure Chemical Industries, catalog number: 080-01066 )
Magnesium chloride hexahydrate (Wako Pure Chemical Industries, catalog number: 135-00165 )
Sodium Chloride (Nacalai tesque, catalog number: 321319-45 )
Glycine (Nacalai tesque, catalog number: 17109-35 )
EDC/NHS solution
0.5 M HEPES buffer (pH 7.4) (see Recipes)
0.5 M EDTA (pH 8.0) (see Recipes)
20% (v/v) polysorbate 20 (see Recipes)
10x HBS-E (see Recipes)
1x HBS-EP (see Recipes)
400 mM EDC (see Recipes)
100 mM NHS (see Recipes)
1 M 2-ethanolamine (pH 8.5) (see Recipes)
50 mM NaOH (see Recipes)
10 mM Acetate buffer (pH 4.0, 4.5, 5.0, 5.5) (see Recipes)
Glycine buffer 10 mM (pH 1.8, 2.0 2.2, 2.4) (see Recipes)
1 M NaCl (see Recipes)
3 M MgCl2 (see Recipes)
Equipment
Instrument for SPR analysis, e.g. Biacore T200 (GE) or ProteOn XPR36 (Bio-Rad Laboratories)
Sensor chip (with carboxyl groups available for the amine coupling reaction), e.g. Series S Sensor Chip CM5 (GE, catalog number: BR-1005-30 ) for Biacore T200 or ProteOn GLM Sensor Chip (Bio-Rad Laboratories, catalog number: 176-5012 ) for ProteOn XPR36
Vacuum pump
0.22 μm PES PLUS bottom top filter (IWAKI PUMPS, catalog number: 8024-045 )
0.22 μm Millex-GV syringe filter unit (Millipore, catalog number: SLGV033RS )
20 ml syringe (Thermo Fisher Scientific, catalog number: SS-20ESZ )
Centrifuge
1.5 ml centrifuge tube (Ina-optika corporation, catalog number: CF-0150 )
Spectra/Por 3 Dialysis trial kit (SPECTRUM® LABORATORIES, catalog number: 132720T )
Stir bar and stirrer
UV spectrometer
pH meter
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Nishimura, M. and Ikuta, K. (2013). Surface Plasmon Resonance Analysis of Antigen-Antibody Interaction. Bio-protocol 3(24): e1006. DOI: 10.21769/BioProtoc.1006.
Yasugi, M., Kubota-Koketsu, R., Yamashita, A., Kawashita, N., Du, A., Sasaki, T., Nishimura, M., Misaki, R., Kuhara, M., Boonsathorn, N., Fujiyama, K., Okuno, Y., Nakaya, T. and Ikuta, K. (2013). Human monoclonal antibodies broadly neutralizing against influenza B virus. PLoS Pathog 9(2): e1003150.
Download Citation in RIS Format
Category
Immunology > Antibody analysis > Antibody-antigen interaction
Biochemistry > Protein > Interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,007 | https://bio-protocol.org/exchange/protocoldetail?id=1007&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Acetylcholine from Cell Lines
JL Jamie K. Lau
KB Kathleen C. Brown
Piyali Dasgupta
Published: Vol 3, Iss 24, Dec 20, 2013
DOI: 10.21769/BioProtoc.1007 Views: 10261
Edited by: Lin Fang
Reviewed by: Fanglian He
Original Research Article:
The authors used this protocol in Feb 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2013
Abstract
Cigarette smoking is the leading risk factor for the development of lung cancer. It is estimated that smoking is associated with 80-90% of lung cancer cases throughout the world (see References 1 and 2). The addictive component of cigarette smoke is nicotine. Our published data shows that nicotine promotes the production of acetylcholine (ACh) in human bronchioalveolar carcinoma cells (BACs) (Lau et al., 2013). ACh functions as a growth factor in human BACs. The following protocol is based on a published protocol by (Song et al., 2003), with some modifications (Lau et al., 2013; Song et al., 2008; Song et al., 2003; Sekhon et al., 2003). An important point to remember is that fetal bovine serum (FBS) contains a high amount of acetylcholine (ACh). Therefore, cells must be cultured in serum-free medium to measure ACh in the culture supernatant. Two aliquots of the culture supernatant are used for analysis. This protocol measures the total choline in the cell supernatent under two conditions: 1) After treatment with acetylcholinesterase (AChE), which converts the ACh to choline (also called the total choline sample) and 2) after measuring the amount of free choline in the sample. The concentration of ACh in the sample calculated by subtracting the free choline from the total choline.
Materials and Reagents
A549 cells (American Type Culture Collection)
Human Epidermal Growth Factor (EGF) (Sigma Chemical, catalog number: E9644 )
100x Insulin Transferrin Selenium (ITS) (Life Technologies, catalog number: 41400-045 )
Rosewell Park Memorial Institute (RPMI) Medium -1640 (ATCC, catalog number: 41400-045)
50 μM Hydrocortisone (Sigma-Aldrich, catalog number: H6909 )
Boveine serum albumin (BSA) (US Biochem, catalog number: 10857 )
Disposable sterile tissue culture filters (Corning, catalog number: 431161 )
Choline/acetylcholine Quantification Kit (BioVision, catalog number: K615-100 )
Liquid nitrogen
Serum-Free RPMI (SF-RPMI) (see Recipes)
Neostigmine (Sigma Chemical, catalog number: N2001 ) (see Recipes)
Equipment
60 mm cell culture dishes (Corning, catalog number: 353002 )
Microfuge tube
ELISA Reader
Lyophilizer (Labonco)
Centrifuge
CO2 cell culture incubator
-80 °C freezer
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2013 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cancer Biology > Cellular energetics > Cell biology assays
Cell Biology > Cell metabolism > Other compound
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,008 | https://bio-protocol.org/exchange/protocoldetail?id=1008&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Observation of Chloroplast-actin Filaments in Leaves of Arabidopsis
Sam-Geun Kong
M Masamitsu Wada
Published: Vol 3, Iss 24, Dec 20, 2013
DOI: 10.21769/BioProtoc.1008 Views: 10141
Edited by: Ru Zhang
Original Research Article:
The authors used this protocol in Feb 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2013
Abstract
Chloroplast-actin (cp-actin) filaments play a pivotal role in chloroplast photorelocation movement. This protocol describes observation of cp-actin filaments in intact palisade cells of Arabidopsis leaves (Kong et al., 2013). The live cell imaging of cp-actin filaments is taken on moving chloroplasts, so that this protocol is useful for analysis of cp-actin dynamics that are induced by blue light.
Keywords: Actin Arabidopsis Blue light Chloroplast Organelle
Materials and Reagents
Plant materials
Arabidopsis thaliana transgenic plants expressing GFP-TALIN in wild-type or mutant plants (Kong et al., 2013). Actin probe lines such as LIFEACT-YFP and GFP-fABD2, THRUMIN1-GFP transgenic lines are also useful.
Young and fully expanded rosette leaves of 3-4-week-old plants grown under 100 μmol/m2/s white light (16 h)/dark (8 h) cycles at 23 °C.
Note: Plants grown on soil are better than those in the plate of MS medium. The reason is that the leaves of the plants grown in the plate are more susceptible to wither during sample handling than those grown on soil.
Red cellophane film (TokyoButaiShowmei, catalog number: No. 20 )
(Optional) 2,3-butanedione monoxime (BDM) (Sigma-Aldrich, catalog number: B0753 ) as an inhibitor of myosin ATPase that inhibits actin dynamics
Evacuation solution containing Silwet L-77 (Bristol-Myers Squibb Company, catalog number: BMS-SL7755 ) (see Recipes)
Equipment
Syringe (10 ml)
Confocal microscope (Leica Microsystems, model: SP5 equipped with a 63x/1.20 W objective lens and multi-line 100 mW argon laser)
Plant growth room or chamber
Red safe-light (red LED or fluorescent lamp filtered with red films)
Forceps
Razor blade
Scissors
A custom-made cuvette system and ring holder: this system is composed of two steel rings mating each other with complementary threads, two round cover glasses (22 mm in diameter, No. 1 and No. 5), and a silicon ring (100 μm in thickness) (Wada and Kong, 2011; see Video 1)
Software
Open source software ImageJ (http://rsbweb.nih.gov/ij/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kong, S. and Wada, M. (2013). Observation of Chloroplast-actin Filaments in Leaves of Arabidopsis. Bio-protocol 3(24): e1008. DOI: 10.21769/BioProtoc.1008.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell structure
Cell Biology > Cell imaging > Live-cell imaging
Biochemistry > Protein > Structure
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,009 | https://bio-protocol.org/exchange/protocoldetail?id=1009&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Colony Forming Assay for HCV-Replicon Cell Line
Chang Ho Lee
Seong-Wook Lee
Published: Vol 3, Iss 24, Dec 20, 2013
DOI: 10.21769/BioProtoc.1009 Views: 9402
Original Research Article:
The authors used this protocol in Jun 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2013
Abstract
Hepatitis C virus (HCV) is the main causative agent of chronic hepatitis, liver cirrhosis, and hepatocellular carcinoma. Since the HCV genome is present exclusively in RNA form during replication, a number of anti-HCV drugs show appearance of rapid drug-resistant viruses. Therefore, it is important to test generation of drug-escape mutant viruses by developed antiviral drugs for their validity. Here, we describe a colony formation assay-based method to observe appearance of drug-resistant viruses against nucleic acid based anti-HCV drugs in genotype 1b based subgenomic replicon cell culture system (Lee et al., 2013).
Keywords: HEPATITIS C VIRUS REPLICON Colony forming assay
Materials and Reagents
Cell line: HCV-replicon Huh-7 human hepatoma cell line (HCV genotype 1b subgenomic replicon pFKI389neo/NS3–3’/5.1 containing the neomycin resistant gene, provided by R. Bartenschlager, Heidelberg University, German) (Lohmann et al., 1999; Krieger et al., 2001)
0.1% Trypsin-EDTA (WELGENE, catalog number: LS015-01 )
Fetal Bovine Serum (FBS) (Thermo Fisher Scientific, HycloneTM, catalog number: SH30919.03 )
100x Penicillin/Streptomycin solution (Thermo Fisher Scientific, HycloneTM, catalog number: 3V30010 )
Lipofectamine 2000 (Life Technology, catalog number: 11668-019 )
NaCl (Sigma-Aldrich, catalog number: S5886 )
KCl (Sigma-Aldrich, catalog number: P5405 )
Na2HPO4 (Sigma-Aldrich, catalog number: S3264 )
KH2PO4 (Sigma-Aldrich, catalog number: P9791 )
NaOH (Sigma-Aldrich, catalog number: S5881 )
1x Phosphate Buffered Saline (PBS) (see Recipes)
Complete Dulbecco’s modified Eagle medium with high glucose (DMEM) (Thermo Fisher Scientific, HycloneTM, catalog number: SH30243.01 ) (see Recipes)
50 mg/ml G418 (Merck KGaA, catalog number: 345810 ) (see Recipes)
2% Paraformaldehyde solution (Sigma-Aldrich, catalog number: 158127 ) (see Recipes)
1% Methylene blue (Duksan Scientific, catalog number: MEE0-22002 ) (see Recipes)
Equipment
35 mm cell culture plate (Corning, catalog number: 430165 )
100 mm cell culture plate (BD Bioscience, catalog number: 353003 )
5% CO2, 37 °C Incubator (Thermo Fisher Scientific, catalog number: 311 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Lee, C. H. and Lee, S. (2013). Colony Forming Assay for HCV-Replicon Cell Line. Bio-protocol 3(24): e1009. DOI: 10.21769/BioProtoc.1009.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > Mutagenesis
Microbiology > Microbial cell biology > Cell viability
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
101 | https://bio-protocol.org/exchange/protocoldetail?id=101&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Tumor Cell Invasion Assay
YC Yanling Chen
Published: Feb 5, 2012
DOI: 10.21769/BioProtoc.101 Views: 39214
Download PDF
Ask a question
Favorite
Cited by
Abstract
Cell invasion assays have been used to study the interactions between tumor cells and the extracellular matrix (ECM), which not only provides a structural scaffold for the cell, but also contains various biological factors for the survival and growth of the cell. ECM gel contains the basic components of the ECM that provides a structural support for the cell to grow and move. Cells can secrete enzymes that degrade certain components of the ECM to move towards chemoattractants, or to simply establish niches for growth. Metastatic tumor cells often show more invasiveness to the ECM gel due to their higher motility and/or enzymatic activity for degrading ECM components. This protocol describes a tumor cell invasion assay to study the interactions between tumor cells and the ECM.
Materials and Reagents
ECM gel (Sigma-Aldrich, catalog number: E1270 )
Human MDA-MB-231 cell line (ATCC, catalog number: HTB-26 ™)
Dulbecco's modified eagle medium (DMEM) (Life Technologies, Invitrogen™, catalog number: 10313-021 )
Fetal bovine serum (FBS) (ATCC, catalog number: 30-2020 ™)
Trypsin-EDTA (Life Technologies, Invitrogen™, catalog number: 25200-056 )
Phosphate buffered saline (PBS) (Life Technologies, Invitrogen™, catalog number: 14190-144 )
Glutaraldehyde (Sigma-Aldrich, catalog number: G6257 )
Ethanol (Sigma-Aldrich, catalog number: 459836 )
Crystal violet (Sigma-Aldrich, catalog number: C3886 )
Equipment
Cell culture incubator: 37 °C and 5% CO2
Millicell cell culture inserts of 12 mm diameter 8 μm pores (Merck KGaA, catalog number: PI8P01250 )
Cotton swabs
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cancer Biology > General technique > Cell biology assays
Cancer Biology > Invasion & metastasis > Cell biology assays
Cell Biology > Cell movement > Cell motility
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,010 | https://bio-protocol.org/exchange/protocoldetail?id=1010&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Intestinal Differentiation of Human ESCs
SO Soichiro Ogaki
SK Shoen Kume
Published: Vol 3, Iss 24, Dec 20, 2013
DOI: 10.21769/BioProtoc.1010 Views: 7774
Original Research Article:
The authors used this protocol in Jun 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2013
Abstract
ES cells (ESCs) are pluripotent and offer a good tool to study early embryonic development. Intestinal cells are derived from the definitive endoderm. In contrast to adult tissue stem cells, embryonic development and differentiation from ES cells have not been as well investigated in the intestine. There are four differentiated cell types of non-proliferative epithelial cells: enterocytes, goblet cells, enteroendocrine cells, and Paneth cells. Intestinal stem cells (ISCs) and progenitor cells reside in crypts, proliferate vigorously, and function as the source of differentiated epithelial cells. Here, we describe a protocol, in which differentiated cell types of the intestine are derived from human ESCs. In this protocol, we describe a protocol to differentiate mouse ES cells into Cdx2-expressing intestinal endoderm efficiently by co-culturing with M15, a mouse mesonephric cell line, and treatment with two chemical compounds. The chemical compounds used are BIO and DAPT. BIO is a Gsk3 inhibitor, that activate Wnt signaling pathway, and DAPT is a-secretase inhibitor that inhibit Notch signaling pathway. BIO and DAPT treatment yielded all representative cell lineages, enterocytes, goblet cells, enteroendocrine cells and paneth cells, to be derived from human ESCs. The protocol for human ESCs is principally very similar with that for the mouse ESCs, with some modifications.
Keywords: Intestine Embryonic stem cells differentiation endoderm human
Materials and Reagents
Human embryonic stem cells (ESCs)
M15 cells (ECACC, catalog number: 95102517 )
Mouse embryonic fibroblast (MEF)
0.1% gelatin
PBS
Dulbecco’s Modified Eagle Medium (DMEM) high glucose (Gibco®, catalog number: 11995-075 )
DMEM low glucose (Gibco®, catalog number: 11885-084 )
KnockOut DMEM/F12 (Gibco®, catalog number: 12660-012 )
RPMI1640 (Gibco®, catalog number: 11875-093 )
Fetal Bovine Serum (FBS) (Hyclone, catalog number: SH30310.03 )
200 mM L-glutamine (L-Gln) (Nacalai Tesque, catalog number: 16948-04 )
5,000 units/ml mixture of penicillin and streptomycin (PS) (Nacalai Tesque, catalog number: 26252-94 )
10 mM MEM Non-Essential Amino Acids Solution (NEAA) (Gibco®, catalog number: 11140-050 )
2-mercaptoethanol (2-ME) (Sigma-Aldrich, catalog number: M7522 )
D-(+)-Glucose (Sigma-Aldrich, catalog number: G5146 )
KnockOut Serum Replacement (KSR) (Gibco®, catalog number: 10828 )
B27 supplements (Gibco®, catalog number: 17504044 )
Recombinant human Activin A (R&D Systems, catalog number: 338-AC )
Recombinant human bFGF (Pepro Tech, catalog number: 100-18B )
BIO (Calbiochem®, catalog number: 361550 )
DAPT (Wako Pure Chemical Industries, catalog number: 041-30983 )
Y-27432 (Wako Pure Chemical Industries, catalog number: 688000 )
Mitomycin C (MMC) (Sigma-Aldrich, catalog number: M4287 )
0.05% Trypsin-EDTA (Life Technologies, catalog number: 2014-11 )
0.25% Trypsin-EDTA (Life Technologies, catalog number: 25200-072 )
EF medium (see Recipes)
hESC Medium (see Recipes)
EB medium (see Recipes)
hESCs Endoderm Medium (see Recipes)
Intestinal Medium (see Recipes)
Equipment
24 well plate (Corning, catalog number: 3526 )
10 mm dish (Corning, catalog number: 430167 )
60 mm dish (BD Biosciences, Falcon®, catalog number: 353004 )
Centrifuge
37 °C 5% CO2 Cell culture incubator
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2013 The Authors; exclusive licensee Bio-protocol LLC.
Category
Stem Cell > Embryonic stem cell > Maintenance and differentiation
Cell Biology > Cell isolation and culture > Cell differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,011 | https://bio-protocol.org/exchange/protocoldetail?id=1011&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Intestinal Differentiation of Mouse ESCs
SO Soichiro Ogaki
SK Shoen Kume
Published: Vol 3, Iss 24, Dec 20, 2013
DOI: 10.21769/BioProtoc.1011 Views: 7937
Reviewed by: Salma HasanLin Fang
Original Research Article:
The authors used this protocol in Jun 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2013
Abstract
ES cells (ESCs) are pluripotent and offer a good tool to study early embryonic development. Intestinal cells are derived from the definitive endoderm. In contrast to adult tissue stem cells, embryonic development and differentiation from ES cells have not been as well investigated in the intestine. There are four differentiated cell types of non-proliferative epithelial cells: enterocytes, goblet cells, enteroendocrine cells, and Paneth cells. Intestinal stem cells (ISCs) and progenitor cells reside in crypts, proliferate vigorously, and function as the source of differentiated epithelial cells. Here, we describe a protocol, in which differentiated cell types of the intestine are derived from mouse ESCs. In this protocol, we describe a protocol to differentiate mouse ES cells into Cdx2-expressing intestinal endoderm efficiently by co-culturing with M15, a mouse mesonephric cell line, and treatment with two chemical compounds. The chemical compounds used are BIO and DAPT. BIO is a Gsk3 inhibitor, that activate Wnt signaling pathway, and DAPT is a-secretase inhibitor that inhibit Notch signaling pathway. BIO and DAPT treatment yielded all representative cell lineages, enterocytes, goblet cells, enteroendocrine cells and paneth cells, to be derived from mouse ESCs.
Materials and Reagents
Mouse embryonic stem cells (ESCs)
M15 cells (ECACC: catalog number: 95102517 )
Mouse embryonic fibroblast (MEF)
0.1% gelatin
PBS
Dulbecco’s Modified Eagle Medium (DMEM) high glucose (Gibco®, catalog number: 11995-075)
DMEM low glucose (Gibco®, catalog number: 11885-084 )
Fetal Bovine Serum (FBS) (Hyclone, catalog number: SH30310.03 )
200 mM L-glutamine (L-Gln) (Nacalai Tesque, catalog number: 16948-04 )
5,000 units/ml mixture of penicillin and streptomycin (PS) (Nacalai Tesque, catalog number: 26252-94 )
10 mM MEM Non-Essential Amino Acids Solution (NEAA) (Gibco®, catalog number: 11140-050 )
2-mercaptoethanol (2-ME) (Sigma-Aldrich, catalog number: M7522 )
D-(+)-Glucose (Sigma-Aldrich, catalog number: G5146 )
KnockOut Serum Replacement (KSR) (Gibco®, catalog number: 10828 )
Recombinant human LIF (Wako Pure Chemical Industries, catalog number: 129-05601 )
Recombinant human Activin A (R&D Systems, catalog number: 338-AC )
Recombinant human bFGF (Pepro Tech, catalog number: 100-18B )
BIO (Calbiochem®, catalog number: 361550 )
DAPT (Wako Pure Chemical Industries, catalog number: 041-30983 )
Mitomycin C (MMC) (Sigma-Aldrich, catalog number: M4287 )
0.05% Trypsin-EDTA (Life Technologies, catalog number: 2014-11)
0.25% Trypsin-EDTA (Life Technologies, catalog number: 25200-072 )
EF medium (see Recipes)
Maintenance Medium (see Recipes)
EB medium (see Recipes)
Endoderm Medium (see Recipes)
Intestinal Medium (see Recipes)
Equipment
6 well plate (Corning, catalog number: 3516)
100 mm dish (Corning, catalog number: 430167 )
60 mm dish (BD Biosciences, Falcon®, catalog number: 353004 )
Centrifuge
37 °C 5% CO2 Cell culture incubator
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2013 The Authors; exclusive licensee Bio-protocol LLC.
Category
Stem Cell > Embryonic stem cell > Maintenance and differentiation
Cell Biology > Cell isolation and culture > Cell differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,012 | https://bio-protocol.org/exchange/protocoldetail?id=1012&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Autophagy Assays (LC3B immunofluorescence, LC3B western blot, acridine orange assay)
XZ Xin Zhang
QL Qingsong Liu
Published: Vol 3, Iss 24, Dec 20, 2013
DOI: 10.21769/BioProtoc.1012 Views: 27364
Edited by: Lin Fang
Original Research Article:
The authors used this protocol in Apr 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2013
Abstract
Autophagy is a dynamic cellular event that is involved in the degradation of long lived proteins and organelles in cells. Biochemical methods such as western blot to measure autophagic proteins have been increasingly used in autophagy studies because it is convenient and objective. Among them, the total amount of Microtubule-associated protein light chain 3 (LC3), the mammalian homologue of the autophagy-related Atg8 in yeast, is a very useful and most commonly used tool in autophagy studies. Other methods such as electron microscopy and immunofluorescence are also available to measure autophagy. The following protocol describes three simple and commonly used protocols for measuring autophagy in cells: LC3B immunofluorescence, western blot and acridine orange assay. Although these three methods are frequently used to provide basic information about autophagy, people should keep in mind that they are not enough to give the exact details about the autophagy flux due to the complexity of this dynamic process. In addition, acridine orange assay is only a supplementary method to detect autophagy because it also has high affinity to other organelles such as lysosomes. For further investigation about a compound’s effect on autophagy flux, additional and more complicated assays are recommended. Protocols here provide a starting point for people to get a snapshot of whether a compound can affect autophagy in tissue culture cells.
Keywords: Autophagy LC3 Acridine orange Immunofluorescence Western blot
Materials and Reagents
70% ethanol
DMEM or other medium for tissue-culture cells
Bovine Serum Albumin (BSA) (Sigma-Aldrich)
Formaldehyde
100% Methanol
PBS
Rabbit antiLC3B antibody (LC3B (D11) XP® Rabbit mAb) (Cell Signaling Technology, catalog number: 3868 )
HRP-conjugated secondary antibody
Fluorescently labeled anti-rabbit secondary antibody (Molecular Probes, Life Technologies, catalog number: A-11008 )
ProLong® Gold Antifade Reagent with DAPI (Life Technologies, catalog number: P36935 )
M-PER lysis buffer (Pierce Antibodies, catalog number: 78501 )
5% Non-fat dry milk
cOmplete ULTRA Protease inhibitor cocktail tablets (Roche Diagnostics, catalog number: 0 5892970001 )
PhosSTOP phosphatase inhibitor cocktail tablets (Roche Diagnostics, catalog number: 0 4906837001 )
Sample buffer (Bio-Rad Laboratories, catalog number: 161-0737 )
Enhanced chemiluminescence (ECL)
Acridine orange (Sigma-Aldrich, catalog number: A8097 )
4-15% Mini-PROTEAN TGX Precast Gel (Bio-Rad Laboratories, catalog number: 456-1085 )
E64d/pepstatin A (Sigma-Aldrich, catalog number: E8640/P5318 )
TBS (see Recipes)
TBS-Tween (see Recipes)
AbDil-Tw (see Recipes)
TBS-Tx (see Recipes)
AbDil-Tx (see Recipes)
Running buffer (see Recipes)
Transfer buffer (see Recipes)
Equipment
24-well plate
12-well plate (or 6-well plate)
1.5 ml tube
Round microscope coverslips (Fisher Scientific, catalog number: 12-545-81 ) (these coverslips are ready to use and do not require extra coating procedure)
Slides
Tweezer with fine tips
Transfer pipette
Humid chamber (can be homemade from a 15 cm plate, parafilm, foil and wet kimwipes)
Vacuum pump with a liquid bottle and pipe attached to remove washing solution
Fluorescent microscope
Western Blotting apparatus (SDS-PAGE running cassette, power supply, shaker, transfer cassette, PVDF membrane, etc.)
Tissue culture apparatus (CO2 incubator, tissue culture hood, etc.)
Software
MetaMorph
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zhang, X. and Liu, Q. (2013). Autophagy Assays (LC3B immunofluorescence, LC3B western blot, acridine orange assay). Bio-protocol 3(24): e1012. DOI: 10.21769/BioProtoc.1012.
Download Citation in RIS Format
Category
Cell Biology > Cell imaging > Fluorescence
Cell Biology > Cell signaling > Autophagy
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,013 | https://bio-protocol.org/exchange/protocoldetail?id=1013&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Library Construction for Genome-wide Bisulfite Sequencing in Plants
DA David Moraga Amador
CW Chenggang Wang
KH Kevin H. Holland
ZM Zhonglin Mou
Published: Vol 3, Iss 24, Dec 20, 2013
DOI: 10.21769/BioProtoc.1013 Views: 13886
Edited by: Feng Li
Original Research Article:
The authors used this protocol in Feb 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2013
Abstract
DNA methylation is the most studied epigenetic modification, which involves the addition of a methyl group to the carbon-5 position of cytosine residues in DNA. DNA methylation is important for the regulation of gene expression. Bisulfite sequencing is the gold standard technique for determining genome-wide DNA methylation profiles in eukaryotes. This protocol describes how to prepare libraries of genomic DNA for whole-genome bisulfite sequencing in Arabidopsis, which could be adapted for use in other plant species.
Materials and Reagents
DNA LoBind 1.5 and 2.0 ml centrifuge tubes (Eppendorf, catalog number: 22431021 and 22431048 , respectively)
AMPure magnetic beads (Beckman Coulter, catalog number: A63881 )
Ethanol (70% v/v, ethanol/water)
TruSeq DNA sample preparation kit (Illumina, catalog number: FC-121-2001 )
SYBR Safe (Life Technologies, catalog number: S33102 )
50 bp ladder (Thermo Fisher Scientific, catalog number: SM0373 )
Disposable sterile scalpels (Thermo Fisher Scientific catalog number 12-460--452 )
FalconTM 15 ml conical centrifuge tubes (Thermo Fisher Scientific, catalog number: 14-959-49B )
QIAquick gel extraction kit (QIAGEN, catalog number: 28704 )
Qubit dsDNA HS assay kit (Life Technologies, catalog number: Q32851 )
EpiTect bisulfite kit (QIAGEN, catalog number: 59104 )
MinElute PCR purification kit (QIAGEN, catalog number: 28004 )
PfuTurbo Cx hotstart DNA polymerase (Agilent, catalog number: 600410-51 )
KAPA library quantification kit (Kapa Biosystems, catalog number: KK4824 )
TE buffer (see Recipes)
Elution buffer (see Recipes)
Equipment
S2 adaptive focus acoustic disruptor (Covaris)
Microtubes with AFA fiber with pre-slit snap-caps (Covaris, catalog number: 520045 )
Refrigerated water bath circulator (Thermo Fisher Scientific, model: SC100-A10 )
Thermomixer R (Eppendorf, catalog number: 022670107 )
MiniSpin PlusTM centrifuge (Eppendorf, catalog number 0 22620100 )
Magnetic stand (Life Technologies, catalog number 4457858 )
Vortex mixer (Thermo Fisher Scientific, catalog number 02-215-365 )
2100 BioAnalyzer (Agilent, catalog number G2943CA )
Qubit 2.0 fluorometer (Life Technologies, catalog number Q32866 )
Horizon 11-14, horizontal gel electrophoresis system (Apogee Designs, model: 11068020 )
Safe Imager 2.0 blue light transilluminator (Life Technologies, model: G6600 )
ABI7900HT real-time PCR system (Life Technologies)
Thermal cycler (C1000 Touch) (Bio-Rad Laboratories, model: 185-1196EDU )
Pipettors (RAININ, various models)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Amador, D. M., Wang, C., Holland, K. H. and Mou, Z. (2013). Library Construction for Genome-wide Bisulfite Sequencing in Plants. Bio-protocol 3(24): e1013. DOI: 10.21769/BioProtoc.1013.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > DNA
Molecular Biology > DNA > DNA modification
Systems Biology > Epigenomics > DNA methylation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,014 | https://bio-protocol.org/exchange/protocoldetail?id=1014&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Membrane Preparation, Sucrose Density Gradients and Two-phase Separation Fractionation from Five-day-old Arabidopsis seedlings
HY Haibing Yang
AM Angus Murphy
Published: Vol 3, Iss 24, Dec 20, 2013
DOI: 10.21769/BioProtoc.1014 Views: 24842
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Apr 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2013
Abstract
Membrane preparation has been widely used for characterization the membrane proteins. Membrane fractions can be separated by a combination of differential and density-gradient centrifugation techniques (Hodges et al., 1972; Leonard and Vanderwoude, 1976). Here we firstly describe a method to isolate total microsomal fractions including plasma membrane, intracellular vesicles, Golgi membranes, endoplasma reticulum, and tonoplast (vacuolar membrane) from 5-7 days old seedlings, which is often analyzed for auxin transporters in Arabidopsis (Leonard and Vanderwoude, 1976; Titapiwatanakun, et al., 2009; Yang et al., 2013; Blakeslee et al., 2007). After homogenization, plant debris including cell walls, chloroplasts and nucleus were removed by low speed centrifugation (8,000 x g), then total microsomal membranes were pelleted by high speed centrifugation (10,000 x g) and separated from soluble fractions. We secondly describe a method to separate microsomal fractions according to size or density in a sucrose density-gradient system by centrifugation. The linear sucrose gradient from 20%-55% (1.09-1.26 g cm-3) were used to separate membranes with different densities: tonoplast, 1.10-1.12 cm-3, Golgi membranes, 1.12-1.15 cm-3, rough endoplasmic reticulum 1.15-1.17 cm-3, thylakoids, 1.16-1.18 cm-3, plasma membrane, 1.14-1.17 g cm-3, and mitochondrial membranes, 1.18-1.20 cm-3 (Leonard and Vanderwoude, 1976; Larsson et al., 1987; Briskin and Leonard, 1980). However, the plasma membrane can also be isolated according to its outer surface properties which are very different from intracellular membrane surfaces. Thus, the right-side-out plasma membrane vesicles can be separated in an aqueous Dextran-polyethylene glycol two-phase system. The plasma membranes can be purified to > 90% in the upper phase (Larsson et al., 1987; Alexandersson et al., 2008). Two-phase systems for Arabidopsis seedlings were described in the section 3. Sucrose density gradient membrane fractionation followed by western blot is often used to analyze the distribution of certain membrane protein, while Two-phase separation is used when high purity of plasma membrane or intracellular membrane is required.
Keywords: Plant membrane preparation Sucrose density gradients Two-phase separation Arabidopsis
Materials and Reagents
Note: All chemicals were purchased from Sigma-Aldrich (http://www.sigmaaldrich.com/united-states.html) unless otherwise specified.
Arabidopsis seedlings or mature tissue
Ice
Sucrose (Molecular Biology, Sigma-Aldrich, catalog number: 84097 )
HEPES (Sigma-Aldrich, catalog number: H-3375 )
EDTA (Research Products International, catalog number: E57020 )
PVP (40,000) (Fisher Scientific, catalog number: BP431 )
BSA (Sigma-Aldrich, catalog number: A-7906 )
DTT (Sigma-Aldrich, catalog number: D0632 )
Leupeptin (Sigma-Aldrich, catalog number: L2884 )
PMSF (Sigma-Aldrich, catalog number: P-7626 )
Benzamidine (Sigma-Aldrich, catalog number: B-6506 )
Pepstatin A (Sigma-Aldrich, catalog number: P5318 )
Aprotinin (Sigma-Aldrich, catalog number: A1153 )
BTP-MES (BIS-TRIS propane, Sigma-Aldrich, catalog number: B6755 ; MES, Research Products International, catalog number: M22040 )
Glycerol (Sigma-Aldrich, catalog number: G5516 )
Dextran (GE, catalog number: 17-0320-01 )
Polyethylene glycol 3350 (Union Carbide Corporation, catalog number: Carbowax 3350 )
EGTA (Sigma-Aldrich, catalog number: E3889 )
Protease inhibitor cocktail (Sigma-Aldrich, catalog number: P8340 )
Grinding buffer (see Recipes)
Resuspension buffer (see Recipes)
Stock solutions (see Recipes)
Phase mixture (see Recipes)
Phase system (see Recipes)
Equipment
Hermle Labnet Z383 centrifuge (Labnet International)
OptimaTM-L-90K ultracentrifuge (Beckman Coulter)
TLX centrifuge (TLA 100.3 rotor) (Beckman Coulter)
Waring blender jar (Waring Pro model: PBB212 )
Mortar and pestle
SW-28 rotor
Nylon SS-34 tube
SW-38 tube
3.5 ml polycarbonate TLA 100.3 tube
2 ml screwcap tubes
10, 15 and 50 ml Falcon tubes
Polyallomer ultracentrifuge tube (Beckman Coulter)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2013 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Yang, H. and Murphy, A. (2013). Membrane Preparation, Sucrose Density Gradients and Two-phase Separation Fractionation from Five-day-old Arabidopsis seedlings. Bio-protocol 3(24): e1014. DOI: 10.21769/BioProtoc.1014.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Cell Biology > Organelle isolation > Membrane
Biochemistry > Protein > Isolation and purification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,015 | https://bio-protocol.org/exchange/protocoldetail?id=1015&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection of piggyBac-mediated Transposition by Splinkerette PCR in Transgenic Lines of Strongyloides ratti
HS Hongguang Shao
JL James B. Lok
Published: Vol 4, Iss 1, Jan 5, 2014
DOI: 10.21769/BioProtoc.1015 Views: 14345
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in Aug 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2012
Abstract
Splinkerette PCR (spPCR) is a newly developed and efficient method to ascertain and characterize genomic insertion sites of transgenes. The method described in this protocol was successfully applied to confirm piggyBac transposon-mediated integration of transgenes into chromosomes of the parasitic nematode Strongyloides ratti. This work is described in detail in Shao et al. (2012) and presented here in a simplified diagram (Figure 1). Using this method, chromosomal loci of integration were determined based on target site and 5’- and 3’ flanking sequences. Therefore, spPCR can be a useful method to confirm integrative transgenesis in functional genomic studies of parasitic nematodes. Potter and Luo (2010) contains a protocol for use of spPCR to detect and map piggyBac transposon-mediated chromosomal integrations in Drosophila, and was the source of our method for Strongyloides. The splinkerette- and piggyBac-specific oligos described in that reference could be used without modification in Strongyloides. For interested readers, a general review of the biology of parasitic nematodes in the genus Strongyloides may be found in Viney and Lok (2007), and a methods-based article on S. stercoralis as an experimental model, with information on transgenesis, may be found in Lok (2007).
Keywords: Strongyloides Transgenesis Chromosomal integration Transposon Splinkerette PCR
Figure 1. Diagrammatic representation of protocol for mapping transgene integrations in Strongyloides by splinkerette PCR (adapted from Potter and Luo, 2010)
Materials and Reagents
Free-living adult worms
Genomic DNA extraction
Gentra Puregene Tissue Kit (QIAGEN), including
Cell lysis solution (catalog number: 8304295 )
Protein precipitation solution (catalog number: 8273807 )
DNA hydration solution (catalog number: 8274043 )
Enzymes for digestion and treatment
Restriction enzymes include BstY I, BamH I and Bgl II (New England Biolabs)
Others include Shrimp Alkaline Phosphatase (United State Biological, catalog number: P4071-05 ) and Exonuclease I (New England Biolabs, catalog number: M0293S )
Ligation reagents
10x Ligase buffer and T4 Ligase (New England Biolabs, catalog number: M0202S )
PCR reagents
5x Phusion High-Fidelity Buffer, Phusion HF DNA Polymerase (New England Biolabs, catalog number: M0530S )
Oligonucleotides and primers
The oligonucleotides detailed in Table 1 must be synthesized
All sequences are from Potter and Luo (2010), Table S13
TE buffer (New England Biolabs, catalog number: E6293 )
10x NEB Buffer 2
1% agarose gel
Table 1. Oligonucleotides and primers for splinkerette PCR mapping of piggyBac transposon-mediated transgene integrations
Oligo or Primer
Sequence
SPLNK-BOT
5’-CGAAGAGTAACCGTTGCTAGGAGAGACCGTGGCTGAATGAGACTGGTGTCGACACTAGTGG-3’
SPLNK-GATC-TOP
5’-GATCCCACTAGTGTCGACACCAGTCTCTAATTTTTTTTTTCAAAAAAA-3’
SPLNK#1
5’-CGAAGAGTAACCGTTGCTAGGAGAGACC-3’
SPLNK#2
5’-GTGGCTGAATGAGACTGGTGTCGAC-3’
3’SPLNK-PB#1
5’-GTTTGTTGAATTTATTATTAGTATGTAAG-3’
5’SPLNK-PB#1
5’-ACCGCATTGACAAGCACG-3’
3’SPLNK-PB#2
5’-CGATAAAACACATGCGTC-3’
5’SPLNK-PB#2
5’-CTCCAAGCGGCGACTGAG-3’
3’SPLNK-PB-SEQ
5’-ACGCATGATTATCTTTAAC-3’
5’SPLNK-PB-SEQ
5’-CGACTGAGATGTCCTAAATGC-3’
Equipment
PCR Thermal Cyclers (Mastercycler Personal, Eppendorf)
Gel electrophoresis
Gel documentation (FOTODYNE, model: FOTO/Analyst FX )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Shao, H. and Lok, J. B. (2014). Detection of piggyBac-mediated Transposition by Splinkerette PCR in Transgenic Lines of Strongyloides ratti. Bio-protocol 4(1): e1015. DOI: 10.21769/BioProtoc.1015.
Shao, H., Li, X., Nolan, T. J., Massey, H. C., Jr., Pearce, E. J. and Lok, J. B. (2012). Transposon-mediated chromosomal integration of transgenes in the parasitic nematode Strongyloides ratti and establishment of stable transgenic lines. PLoS Pathog 8(8): e1002871.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > DNA
Molecular Biology > DNA > PCR
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,016 | https://bio-protocol.org/exchange/protocoldetail?id=1016&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Nematode Infection on Potato Plant
Demosthenis Chronis
Shiyan Chen
Ping Lang
Tien Tran
DT David Thurston
Xiaohong Wang
Published: Vol 4, Iss 1, Jan 5, 2014
DOI: 10.21769/BioProtoc.1016 Views: 13948
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Apr 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2013
Abstract
Potato cyst nematodes (PCNs; Globodera rostochiensis and G. pallida) are devastating pests that infect potato root. We describe an in vitro assay for PCN infection on potato plantlet in tissue culture. This method is useful for studying nematode parasitism on potato and for investigating responses of potato clones/lines to PCN infection.
Keywords: Potato cyst nematode Globodera rostochiensis Nematode infection Potato plantlet
Materials and Reagents
Potato plant (Solanum tuberosum cv. Désirée)
Potato cyst nematode (G. rostochiensis) cysts
Sodium azide (RICCA Chemical, catalog number: 7144-16 )
Mercuric chloride (RICCA Chemical, catalog number: 4650-16 )
Sterile distilled water
Gentamycin (Fisher Scientific, catalog number: 61398-0010 )
Nystatin (Sigma-Aldrich, catalog number: N-3503 )
Agarose (Fisher Scientific, catalog number: BP160-100 )
Timentin (PhytoTechnology Laboratories®, catalog number: T869 )
Micropore tape (Fisher Scientific, catalog number: 19-027-761 )
Sterilization solution (0.004% mercuric chloride/0.004% sodium azide)
Hoagland's solution (Sigma-Aldrich, catalog number: H2395 )
Amberlite XAD-4 resin (Fisher Scientific, catalog number: AC20223 )
MS salt (Caisson Laboratories, catalog number: MSP01-50LT )
Inositol (Fisher Scientific, catalog number: AC122261000 )
Thiamine HCl (Sigma-Aldrich, catalog number: T1270 )
Gelrite (Fisher Scientific, catalog number: CAS 71010-52-1 )
Potato root diffusate (PRD) (see Recipes)
Propagation medium (see Recipes)
0.1% agarose (see Recipes)
Equipment
Sieves No. 60 (250 μm), No. 200 (75 μm) and No. 500 (25 μm) (Endecotts, catalog number: 683927 , 681837 , 691131 )
Sterile nematode egg hatching chamber (stainless steel metal pan cover and collection pan may be purchased from Vollrath Products, size six inches; the metal screened pan cover with wire-screen in the central area as shown in Figure 3 was custom made)
Sterile 6-well plates (Greiner Bio-One GmbH, catalog number: 657185 )
Stirplate
Sterile forceps and scalpel
Growth incubator
30-μm mesh (Small Parts, catalog number: 7050-1220-000-12 )
Tissue culture biosafety cabinet
Centrifuge
Incubator shaker (New Brunswick Scientific, model: C24KC )
S. tuberosum growth chambers (we use several types of growth chambers such as I-66LLVL from Percival)
Rubber stopper (size no. 1) (Fisher Scientific, catalog number: 14-130C )
Beaker
Aluminum foil
Dissecting microscope
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chronis, D., Chen, S., Lang, P., Tran, T., Thurston, D. and Wang, X. (2014). In vitro Nematode Infection on Potato Plant. Bio-protocol 4(1): e1016. DOI: 10.21769/BioProtoc.1016.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease bioassay
Cell Biology > Cell isolation and culture > Cell growth
Plant Science > Plant physiology > Plant growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,017 | https://bio-protocol.org/exchange/protocoldetail?id=1017&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Potato Transformation
Demosthenis Chronis
Shiyan Chen
Ping Lang
Tien Tran
DT David Thurston
Xiaohong Wang
Published: Vol 4, Iss 1, Jan 5, 2014
DOI: 10.21769/BioProtoc.1017 Views: 18387
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Apr 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2013
Abstract
This is a protocol to produce stable transgenic potato plants (Solanum tuberosum cv. Désirée) by Agrobacterium-mediated genetic transformation, which is established based on a method described by (Jung et al., 2005) with some modifications. Agrobacterium tumefaciens strain LBA4404 carrying the desired construct is used to infect internodal explants to produce stable transgenic potato plants. Plantlet screening and molecular analyses are employed to confirm the expression of transgene in generated transgenic potato lines.
Keywords: Agrobacterium-mediated transformation Agrobacterium tumefaciens strain LBA4404 Potato plantlet
Materials and Reagents
Potato (S. tuberosum cv. Désirée) tissue culture plantlets
70% ethanol
Bleach (6% sodium hypochlorite)
Tween 20
Acetosyringone (Fisher Scientific, catalog number: AC11554 )
Timentin (PhytoTechnology Laboratories®, catalog number: T869 )
Selective antibiotics
Mannitol (Fisher Scientific, catalog number: M120 )
Glycine
Nicotinic acid (Sigma-Aldrich, catalog number: N0761 )
Pyridoxine HCl (Sigma-Aldrich, catalog number: P6280 )
Thiamine HCl (Sigma-Aldrich, catalog number: T1270 )
Folic acid (Fisher Scientific, catalog number: BP2519 )
Biotin (Fisher Scientific, catalog number: BP232 )
MS salt (Caisson Laboratories, catalog number: MSP01-50LT )
Inositol (Fisher Scientific, catalog number: AC122261000 )
Sucrose
6-benzylamino purine (BAP) (Sigma-Aldrich, catalog number: B3408 )
1-naphthalene-acetic acid (NAA) (Sigma-Aldrich, catalog number: N0640 )
3-indoleacetic acid (IAA) (Sigma-Aldrich, catalog number: I2886 )
Trans-zeatin-riboside (Sigma-Aldrich, catalog number: Z0876 )
YM medium (see Recipes)
MSVI vitamins (see Recipes)
JHMS vitamins (see Recipes)
3R vitamins (see Recipes)
CIM medium (see Recipes)
3C5ZR plates with selective agent (see Recipes)
Propagation medium (see Recipes)
TPS buffer (see Recipes)
Equipment
Sterile magenta boxes (sterilized by autoclaving)
Sterile petri dishes (Fisher scientific, catalog number: FB0875712 )
Sterile forceps and scalpel (sterilized by heat treatment using a Bunsen burner)
Sterile glass tubes with caps (sterilized by autoclaving) (tubes, Fisher Scientific, catalog number: 14-961-34 ; caps, Fisher Scientific, catalog number: 14-957-91D )
Sterile inoculating loop (Fisher Scientific, catalog number: 22-363-604 )
Tissue grinders
Glass culture tubes (sterilized by autoclaving)
3M Micropore tape (Fisher Scientific, catalog number: 1530-0 and 1530-1 )
Agrobacterium glycerol stock
50 ml conical centrifuge tubes
Tissue culture biosafety cabinet
Incubator shaker (New Brunswick Scientific, model: C24KC )
Centrifuge
S. tuberosum growth chambers (we use several types of growth chambers such as I-66LLVL from Percival)
Hot block or water bath
PCR thermal cycler (Bio-Rad Laboratories, model: C1000 touch)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chronis, D., Chen, S., Lang, P., Tran, T., Thurston, D. and Wang, X. (2014). Potato Transformation. Bio-protocol 4(1): e1017. DOI: 10.21769/BioProtoc.1017.
Download Citation in RIS Format
Category
Plant Science > Plant transformation > Agrobacterium
Molecular Biology > DNA > Transformation
Plant Science > Plant physiology > Tissue analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,018 | https://bio-protocol.org/exchange/protocoldetail?id=1018&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Subcellular Localization Experiments and FRET-FLIM Measurements in Plants
ML Malgorzata Lichocka
ES Elmon Schmelzer
Published: Vol 4, Iss 1, Jan 5, 2014
DOI: 10.21769/BioProtoc.1018 Views: 16934
Original Research Article:
The authors used this protocol in Apr 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2013
Abstract
Determining the localization of proteins within living cells may be very essential for understanding their biological function. Usually for analysis of subcellular localization, a construct encoding the translational fusion of a cDNA of interest with a fluorescent protein (FP) is engineered, transiently expressed in plant cells and examined with confocal microscopy.
In co-localization and interaction studies, two plasmids, each encoding one of the potential interacting/binding partners tagged with an appropriate pair of fluorescence proteins (for instance CFP/YFP) are co-expressed in plant cells. If proteins co-localize in certain cellular compartments it does not necessarily mean that they bind/interact to each other, therefore an additional technique should be applied for in vivo verification of putative interaction, e.g. Fluorescence Lifetime Imaging (FLIM) to detect Fluorescence Resonance Energy Transfer (FRET).
The protocol describes in detail the method that has been used to verify interaction between the bacterial effector HopQ1 and a 14-3-3a host protein and additionally to check the necessity of the central serine in the canonical 14-3-3 binding site within HopQ1 (Giska et al., 2013) for this association.
Materials and Reagents
3 – 4 weeks old Nicotiana benthamiana plants grown in a greenhouse
Agrobacterium tumefaciens strain GV3101
For co-localization and FRET-FLIM measurement selected pGWB (Gateway) binary vectors were used (Nakagawa et al., 2007):
pGWB454 encoding Protein1 (here HopQ1-mRFP) -mRFP
pGWB441 encoding Protein2 (here 14-3-3a-YFP) -YFP
pGWB444 encoding unfused, free CFP
pGWB441 encoding unfused, free YFP
pGWB444 encoding CFP fused to YFP
pGWB441 encoding Protein1- (here HopQ1-YFP) -YFP
pGWB441 encoding Protein1a-YFP (e.g. mutated variant of Protein1)
pGWB444 encoding Protein2 (here 14-3-3a-CFP) -CFP
Equipment
For Microscopic evaluation
Nikon Stereomicroscope SMZ 1500 with epi-fluorescence equipment (optional)
Nikon Eclipse TE2000-E inverted C1 confocal laser scanning microscope, equipped with PlanApo 63x immersion oil objective, solid-state Coherent Sapphire 488-nm laser, Helium-Neon (HeNe) 543 nm laser, detector unit with three photomultiplier
Useful link, http://www.microscopyu.com/
For FRET-FLIM measurement
FRET-FLIM experimental procedure is optimized for a Zeiss LSM 510 META confocal laser scanning microscope equipped with a FLIM module SPC730 (Becker and Hickl) for time correlated single photon counting (TCSPC). Single photons were detected with a photomultiplier MCP-PMT, R3809U-52, Hamamatsu Photonics. For excitation of photons, an ultrafast oscillating multiphoton excitation laser (titanium-sapphire, Chameleon, Coherent) was used (Chameleon XS, Coherent)
Microscope slides (Gerhard Menzel GmbH, Menzel-GlaserTM, catalog number: AA00000112E )
Microscope Cover Slips no. 1 (Gerhard Menzel GmbH, Menzel-GlaserTM, catalog number: BB024060A1 )
Software
EZ C1 for Nikon C1 confocal – image acquisition
EZ C1 Viewer for Nikon C1 confocal – image analysis
LSM 510 for Zeiss Meta 510 Confocal – image acquisition
Zeiss LSM Image Browser – image analysis
SPC operation software for FLIM measurement (Becker & Hickl GmbH)
SPC-Image 2.9.1 software (Becker & Hickl GmbH, http://www.becker-hickl.de/pdf/flim-zeiss-man37.pdf) – image analysis
ImageJ freeware (http://rsbweb.nih.gov/ij/) – image analysis
MS Excel
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Lichocka, M. and Schmelzer, E. (2014). Subcellular Localization Experiments and FRET-FLIM Measurements in Plants. Bio-protocol 4(1): e1018. DOI: 10.21769/BioProtoc.1018.
Giska, F., Lichocka, M., Piechocki, M., Dadlez, M., Schmelzer, E., Hennig, J. and Krzymowska, M. (2013). Phosphorylation of HopQ1, a type III effector from Pseudomonas syringae, creates a binding site for host 14-3-3 proteins. Plant Physiol 161(4): 2049-2061.
Download Citation in RIS Format
Category
Plant Science > Plant cell biology > Cell imaging
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,019 | https://bio-protocol.org/exchange/protocoldetail?id=1019&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Biolistic Bombardment for Co-expression of Proteins Fused to YFP and mRFP in Leaf Epidermal Cells of Phaseolus vulgaris ‘Red Mexican’
ML Malgorzata Lichocka
Published: Vol 4, Iss 1, Jan 5, 2014
DOI: 10.21769/BioProtoc.1019 Views: 12758
Original Research Article:
The authors used this protocol in Apr 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2013
Abstract
Biolistic bombardment is based on coating of tungsten or gold particles with DNA and delivery of these “biobullets” into living plant cells under high pressure (Sudowe and Reske-Kunz, 2013). This method enables transient expression of a DNA construct encoding fusion of the protein of interest to a fluorescence protein e.g. GFP for microscopic approaches. Usually it is performed for plants for which infiltration with Agrobacterium tumefaciens does not work efficiently e.g. model plant Arabidopsis thaliana (Ueki et al., 2009). Although transfection rate is relatively low, it is still sufficient to analyze subcellular localization of the protein of interest under a fluorescence microscope. Here we present the protocol that was optimized for Nicotiana benthamiana and also successfully applied to Phaseolus vulgaris (Giska et al., 2013).
Materials and Reagents
Upper leaves from 2 to 4 weeks old bean plants grown in a greenhouse
Plasmid DNA 2-4 μg
2.5 M CaCl2 (Sigma-Aldrich, catalog number: C3306-500G ) (optional other chlorides e.g. ZnCl2, MgCl2 can be used if it is necessary to avoid calcium ions)
0.1 mM Spermidine (Sigma-Aldrich, catalog number: S0266-1G )
75% , 96% and 100% ethanol
Sterile miliQ water
1 M spermidine stock solution (see Recipes)
0.1 mM spermidine working solution (see Recipes)
Equipment
Microcentrifuge (Eppendorf MiniSpin)
Rupture disks 1,100 psi (Bio-Rad Laboratories, catalog number: 165-2329 ) (available selection form 450 to 2,000 psi)
Microcarriers: Tungsten M17 (Bio-Rad Laboratories, catalog number: 165-2267 )
Macrocarriers (Bio-Rad Laboratories, catalog number: 165-2257 )
Stopping Screens (Bio-Rad Laboratories, catalog number: 165-2336 )
Vacuum pump (Bio-Rad Laboratories) (according to Bio-Rad technical recommendation)
Vortex
Forceps
1.5 ml microfuge tube (Eppendorf)
Parafilm
Petri dishes with wet filter paper at the bottom
Biolistic PDS-1000/He Particle Delivery System (Bio-Rad Laboratories; www.bio-rad.com)
Stereomicroscope (Nikon Corporation, model: SMZ 1500 ) with epi-fluorescence equipment (optional)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant transformation > Bombardment
Plant Science > Plant cell biology > Cell imaging
Molecular Biology > DNA > Transformation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
102 | https://bio-protocol.org/exchange/protocoldetail?id=102&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Amplification of HIV-1 Infectious Virus in BL3 Lab
Xin Wang
Published: Vol 2, Iss 5, Mar 5, 2012
DOI: 10.21769/BioProtoc.102 Views: 12441
Download PDF
Ask a question
How to cite
Favorite
Cited by
Abstract
This method is used for making high titer human immunodeficiency virus type-1 (HIV-1) virus stock for subsequent infection assays. The amplification of T-tropic HIV-1 virus (IIIB strain) uses the CD4+ T cell line H9.
Materials and Reagents
CD4+ T cell line H9 cells (ATCC HTB-176 )
Fetal bovine serum (FBS) (Thermo Fisher Scientific, catalog number: SH30071.03 HI )
Note: This particular FBS has been tested by the author, but may be substituted with FBS from different suppliers as desired by users.
Penicillin-Streptomycin liquid (Life Technologies, Gibco®, catalog number: 15070-063 )
Cell culture media: RPMI1640 (Life Technologies, Gibco®, catalog number: 11875-093 ) (see Recipes)
Equipment
Bench-top centrifuges
CO2 incubator
-80 °C freezer
50 ml conical tubes (BD Biosciences, Falcon®, catalog number: 35-2070 )
5, 10, 25-ml pipet (BD Biosciences, Falcon®, catalog number: 35-7501 , 35-7554 , 35-7556 )
T-75, T-175 cell culture flask (BD Biosciences, Falcon®, catalog number: 35-3136 , 35-3112 )
CryoTube Vials (NUNC, 377267)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2012 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wang, X. (2012). Amplification of HIV-1 Infectious Virus in BL3 Lab. Bio-protocol 2(5): e102. DOI: 10.21769/BioProtoc.102.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Virus
Microbiology > Microbial cell biology > Cell isolation and culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,020 | https://bio-protocol.org/exchange/protocoldetail?id=1020&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cell Surface Protein-protein Binding on COS-7 Cells
KC Kae-Jiun Chang
MR Matthew N. Rasband
Published: Vol 4, Iss 1, Jan 5, 2014
DOI: 10.21769/BioProtoc.1020 Views: 10410
Edited by: Xuecai Ge
Original Research Article:
The authors used this protocol in May 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2013
Abstract
Examination of interactions between a transmembrane protein and a soluble protein by pull-down or immunoprecipitation assays can be tricky and complicated due to the detergent extraction of membrane proteins during the lysate preparation step. The choice and concentration of detergents must be determined empirically and the procedure can be burdensome. Here, we describe a simplified binding assay by expressing the membrane protein of interest in COS-7 cells and applying detergent-free solutions containing an extracellular protein to be tested. The binding is then examined by immunocytochemistry.
Keywords: Membrane protein Protein-protein interaction Surface binding
Materials and Reagents
COS-7 cells (ATCC, catalog number: CRL-1651 TM)
A mammalian expression plasmid encoding a membrane protein of interest
A plasmid encoding an extracellular protein fused to the Fc portion of the human IgG [for example, pFUSE series by InvivoGen and pSXFc in Eshed et al. (2005) are options for cloning vectors to make this fusion construct]
Dulbecco's modified Eagle Medium (DMEM), high glucose, no glutamine (Life Technologies, catalog number: 11960-044 )
FetalClone III serum (Thermo Fisher Scientific, catalog number: SH30109.03 )
100x GlutaMAX-I (Life Technologies, catalog number: 35050-061 )
Lipofectamine 2000 (Life Technologies, catalog number: 11668-019 )
Dulbecco's phosphate-buffered saline (DPBS) (no calcium, no magnesium) (Life Technologies, catalog number: 14190-144 )
Virus production serum-free medium (VP-SFM) (Life Technologies, catalog number: 11681-020 )
4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid (HEPES) (Sigma-Aldrich, catalog number: H4034 )
Protein Concentrators (9K MWCO, 7 ml) (Thermo Fisher Scientific, catalog number: 87748 )
Goat anti-human IgG, Fcγ fragment specific, conjugated with a fluorophore (e.g. Jackson ImmunoResearch Laboratories, catalog number: 109-545-098 for Fluorescein and 109-585-098 for Texas Red)
COS-7 culture medium (see Recipes)
0.2 M PB (see Recipes)
4% PFA (see Recipes)
PBS (see Recipes)
Equipment
6-well cell culture plates (Corning Incorporated, catalog number: 3516 )
Glass coverslips (VWR International, catalog number: 48366-227 )
10-cm dish
Centrifuge
37 °C/5% CO2 cell culture incubator
A regular fluorescence microscope
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chang, K. and Rasband, M. N. (2014). Cell Surface Protein-protein Binding on COS-7 Cells. Bio-protocol 4(1): e1020. DOI: 10.21769/BioProtoc.1020.
Download Citation in RIS Format
Category
Biochemistry > Protein > Immunodetection
Cell Biology > Cell structure > Cell surface
Molecular Biology > Protein > Protein-protein interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,021 | https://bio-protocol.org/exchange/protocoldetail?id=1021&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
T Follicular Helper Cell Coculture Assay
RC Rafael A. Cubas
EH Elias K. Haddad
Published: Vol 4, Iss 1, Jan 5, 2014
DOI: 10.21769/BioProtoc.1021 Views: 15737
Original Research Article:
The authors used this protocol in Apr 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2013
Abstract
T follicular helper (Tfh) cells constitute a distinct subset of CD4+ T cells specialized in providing help to B cells in germinal centers. Phenotypically, Tfh cells are characterized by their high expression of the chemokine receptor CXCR5 that allows their migration into B cell follicles as well as high expression of PD-1, BTLA, the co-stimulatory molecules ICOS and SLAM and the transcription factors BCL6 and cMaf. Tfh cells are the main producers of IL-21 as well as other cytokines like IL-4 and IL-10 critical for B cell survival and differentiation. Tfh cells drive somatic hypermutation and the generation of long-lived memory B cells and plasma cells having an essential role in the development of protective immunity. Developing a coculture system to measure the effects of Tfh-cell mediated B cell help is of great interest to further our understanding of Tfh-B cell interaction and to allow for the manipulation of culture conditions to investigate the potential effect different microenvironment signals or ligand/receptor interactions could have on Tfh cell function.
Materials and Reagents
Lymph node mononuclear cells (LMNCs)
Benzonse® Nuclease (EMD Millipore, catalog number: 70664 )
LIVE/DEAD® Fixable Aqua Dead Cell Stain Kit (Life Technologies, catalog number: L34957 )
Staphylococcal enterotoxin B (Toxin Technology Inc, catalog number: BT202 )
RPMI 1640 Medium 1x with L-Glutamine (Fischer Scientific, catalog number: 10-040-CV )
100x Penicillin-Streptomycin solution (5000 units) (Life Technologies, catalog number: 15070063 )
Fetal Bovine Serum (FBS) (Access Cell Culture)
RPMI 1640 Medium 1x with L-Glutamine and no Phenol red (Gibco®, Life Technologies, catalog number: 11835-030 )
HEPES solution (1 M) (Sigma-Aldrich, catalog number: H0887 )
Antibodies:
anti-CD3 (clone: HIT3a ) (BioLegend)
anti-CD4 (clone: RPA-T4 ) (BioLegend)
anti-CD45RA (clone: IM2711U ) (Beckman Coulter)
anti-CXCR5 (clone: RF8B2 ) (BD Biosciences)
anti-CD19 (clone: HIB19 ) (BioLegend)
anti-IgD (clone: IA6-2 ) (BD Biosciences)
anti-CD38 (clone: HIT2 ) (BioLegend)
Complete media (see Recipes)
Sorting buffer (see Recipes)
Equipment
Centrifuge (SorvallTM LegendTM XTR, Thermo Fisher Scientific)
15 ml Falcon tube
BD FACSAria II cell sorter (BD Biosciences)
37 °C 5% CO2 incubator
96-well sterile V-bottom plates (Thermo Fisher Scientific, catalog number: 249935 )
5 ml polystyrene round-bottom tubes with cell-strainer cap (BD FalconTM, catalog number: 352235 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Cubas, R. A. and Haddad, E. K. (2014). T Follicular Helper Cell Coculture Assay. Bio-protocol 4(1): e1021. DOI: 10.21769/BioProtoc.1021.
Download Citation in RIS Format
Category
Immunology > Immune cell isolation > Lymphocyte
Cell Biology > Cell isolation and culture > Cell growth
Immunology > Immune cell function > Lymphocyte
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,022 | https://bio-protocol.org/exchange/protocoldetail?id=1022&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Agrobacterium-mediated Transformation of Strawberry
JS Jan G. Schaart
Published: Vol 4, Iss 1, Jan 5, 2014
DOI: 10.21769/BioProtoc.1022 Views: 13065
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Jan 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2013
Abstract
Traditional breeding for improvement of strawberry (Fragaria x ananassa) is difficult because strawberry is an octoploid, hybrid species. Genetic modification of strawberry would though be a promising alternative for obtaining the desired improvements in existing elite strawberry cultivars (Schaart et al., 2011). The availability of suitable genes for trait improvements in strawberry has however been a rate-limiting step until recently, but with the completion of the sequencing of the genome of woodland strawberry (F. vesca) (Shualev et al., 2011), we now have access to a treasure chest with valuable candidate genes. For strawberry, methods for genetic transformation have originally been described by Nehra et al. (1990) and James et al. (1990) and success of transformation was shown to be highly cultivar dependent. The latest progress in strawberry transformation is reviewed by Husaini et al. (2011). In our lab transformation of strawberry is based on the method for shoot regeneration described by Passey et al. (2003) and the use of the supervirulent Agrobacterium strain AGL0 (Lazo et al., 1991). We mainly make use of the strawberry transformation as a tool for functional analysis of candidate genes. For this the cultivar Calypso is a very suitable genotype because of its high transformation efficiencies (up to 100%) and ever-bearing fruiting characteristic, which provides a continuous supply of strawberry fruits once the plants start flowering.
Keywords: Strawberry Agrobacterium Transformation Genetic modification
Materials and Reagents
Sucrose (Duchefa Biochemie BV, catalog number: S0809 )
Daishin agar (Duchefa Biochemie BV, catalog number: D1004 )
6-Benzylaminopurine (BAP) (Duchefa Biochemie BV, catalog number: B0904 ) Indole-3-butyric acid (IBA) (Duchefa Biochemie BV, catalog number: I0902 )
Murashige and Skoog salts including vitamins (MS) (Duchefa Biochemie BV, catalog number: M0221 )
Gelrite (Duchefa Biochemie BV, catalog number: G1101 )
3’,5’Dimethoxy-4’-hydroxy-acetophenone (Acetosyringone) (Sigma-Aldrich, catalog number: D134406 )
LB broth (LB) (Sigma-Aldrich, catalog number: L3022 )
Rifampicin (Duchefa Biochemie BV, catalog number: R0146 )
Dimethyl sulfoxide (DMSO) (Merck KGaA, catalog number: 802912 )
MN615 filter paper 82 mm (MACHEREY-NAGEL GmbH & Co. KG, catalog number: MN615)
Thidiazuron (TDZ) (Duchefa Biochemie BV, catalog number: T0916 )
1-Naphthalene acetic acid (NAA) (Duchefa Biochemie BV, catalog number: N0903 )
Cefotaxime sodium salt (cefotaxime) (Duchefa Biochemie BV, catalog number: C0111 )
Kanamycin monosulphate monohydrate (kanamycin) (Duchefa Biochemie BV, catalog number: K0126 )
D-glucose monohydrate (glucose) (Duchefa Biochemie BV, catalog number: G0802 )
Shoot multiplication medium (SMM) (see Recipes)
Shoot propagation medium (SPM) (see Recipes)
Shoot regeneration medium (SRM) (gluc.) (see Recipes)
SRM + AS (see Recipes)
SRM SEL (see Recipes)
MS-liquid + AS (see Recipes)
1 mg/ml NAA (see Recipes)
0.22 mg/ml TDZ (see Recipes)
1 mg/ml IBA (see Recipes)
1 mg/ml BAP (see Recipes)
100 mM AS (see Recipes)
125 mM Cefotaxime (see Recipes)
50 mg/ml Kanamycin (see Recipes)
50 mg/ml Rifampicin (see Recipes)
30 g/100 ml Glucose (see Recipes)
Equipment
50 ml tube (Greiner Bio-One GmbH, catalog number: 210261 )
Petri dish (Greiner Bio-One GmbH, catalog number: 633180 )
Rotary shaker (C24 incubator shaker, New Brunswick Scientific)
Centrifuge Multifuge 3LR (Heraeus Holding)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant transformation > Agrobacterium
Molecular Biology > DNA > Transformation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,023 | https://bio-protocol.org/exchange/protocoldetail?id=1023&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Biochemical Assays for MTase Activity
Yu Chen
DG Deyin Guo
Published: Vol 4, Iss 2, Jan 20, 2014
DOI: 10.21769/BioProtoc.1023 Views: 9793
Original Research Article:
The authors used this protocol in Jun 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2013
Abstract
Methyltransferase (MTase) transfers a methyl group (-CH3) from the donor S-adenosyl-L-methionine (AdoMet or SAM) to biologically active molecules such as hormones, neurotransmitters, lipids, proteins and nucleic acids. The addition of a methyl group causes a change in the physicochemical properties of the molecules. The mRNA cap structure is essential for cell and virus. Guanine-N7-methyltransferase (N7-MTase) methylates the GpppN cap at the N7 position of guanine, resulting in cap-0 structure (m7GpppN), and Ribose 2'-O-MTase further methylates the first nucleotide of higher eukaryotic cellular and viral mRNAs at the ribose 2'-OH position to form cap-1 (m7GpppNm) structures. Here, we describe a biochemical assay to detect the activities of mRNA capping MTases.
Keywords: Methyltransferase S-adenosyl-L-methionine RNA capping Cap structure
Materials and Reagents
Bodicon m7G capping system (Bodicon, catalog number: CS0130 )
S-adenosyl methionine (SAM) (involved in Bodicon m7G capping system) (Bodicon, catalog number: CS0130)
Bodicon Capping Enzyme (10 U/µl) (involved in Bodicon m7G capping system) (Bodicon, catalog number: CS0130)
Note: Because the sale of this kit was low, the previous companies which provided this capping kit were out of service. This capping kit was provided by a new company in China as custom-made products (contact e-mail: [email protected], phone:+86-13628662011). In fact the similar capping kit from any other companies (such as EPICENTRE biotechnologies, ScriptCap m7G capping system, catalog number: SCCE0610 ) is suitable for this experiment, and people can also contact with us to get the related protein or kit.
Inorganic pyrophospatase (YIPP) (New England Biolabs, catalog number: M2403S )
S-adenosyl [methyl-3H] methionine ([3H]-SAM) (PerkinElmer, catalog number: NET155H001MC )
DEAE Sephadex (GE Healthcare, catalog number: 17-0170-01 )
GTP (Thomas Scientific, catalog number: R0461 )
RNase inhibitor (Thomas Scientific, catalog number: EO0381 )
RNase free water
Phenol-chloroform (pH 4.8-5.2 for RNA only)
Ethanol (RNase free)
RNase free water
Sodium Dodecyl Sulfonate (SDS)
Ethylene Diamine Tetraacetic Acid (EDTA)
NH4HCO3
NaCl
10x MTase Buffer (see Recipes)
Cap-0 cap structure (m7GpppN-RNA) (see Recipes)
Non-methylated Cap-0 cap structure (GpppN-RNA) (see Recipes)
MTase assay reaction mix (see Recipes)
Equipment
Bechtop
Water bath
Centrifuge
Liquid scintillation counter
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Chen, Y. and Guo, D. (2014). Biochemical Assays for MTase Activity. Bio-protocol 4(2): e1023. DOI: 10.21769/BioProtoc.1023.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,024 | https://bio-protocol.org/exchange/protocoldetail?id=1024&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Monocular Deprivation in Mice
Ya-tang Li
XC Xiao-lin Chou
H Huizhong Whit Tao
Published: Vol 4, Iss 2, Jan 20, 2014
DOI: 10.21769/BioProtoc.1024 Views: 9347
Edited by: Xuecai Ge
Original Research Article:
The authors used this protocol in Jul 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2013
Abstract
Monocular deprivation is an experimental technique to study the ocular dominance plasticity during critical period (Hubel and Wiesel, 1963). Generally one eye of an animal is sutured during critical period, and the sutured eye is re-opened after either less than three days (short term) or more than three days (long term). Here we describe a detailed protocol for short-term and long-term monocular deprivation in mouse (Ma et al., 2013).
Materials and Reagents
Cotton
75% Ethanol
Ketamine hydrochloride (100 mg/ml) (Ketaject, Phoenix Pharmaceuticals, NDC number: 57319-542-02 )
Xylazine hydrochloride (100 mg/ml) (AnaSed Injection, LLOYD, NADA number: 139-236 )
Xylocaine (lidocaine hydrochloride) 2% Jelly (AstraZeneca, NDC number: 0186-0330-01 )
Bacitracin zinc ointment (USP 500 U/g) (Fougera Pharmaceuticals, NDC number: 0168-0011-31 )
Saline (0.9% sodium chloride injection USP)
Equipment
Hood
Autoclave
Aluminum foil
Dumont #5 forcep (Fine Science Tools, catalog number: 11254-20 )
Dumont #3c forcep (Fine Science Tools, catalog number: 11231-20 )
Cohan-Vannas spring scissor (Fine Science Tools, catalog number: 15000-02 )
Fine scissor (Fine Science Tools, catalog number: 14060-09 )
UNIFY Silk surgical suture [small (P-3) 13 mm, reverse cutting 3/8 circle needle. 4-0 18"/45 cm thread] (AD Surgical)
Alcohol pad (PDI, catalog number: B603 )
Gloves
Microscope
Illuminator (AmScope, catalog number: Model HL250-AY )
Heating pad (Harvard Apparatus, catalog number: 507220F )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Li, Y., Chou, X. and Tao, H. W. (2014). Monocular Deprivation in Mice. Bio-protocol 4(2): e1024. DOI: 10.21769/BioProtoc.1024.
Ma, W. P., Li, Y. T. and Tao, H. W. (2013). Downregulation of cortical inhibition mediates ocular dominance plasticity during the critical period. J Neurosci 33(27): 11276-11280.
Download Citation in RIS Format
Category
Neuroscience > Sensory and motor systems
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,025 | https://bio-protocol.org/exchange/protocoldetail?id=1025&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Preparation of Bacillus subtilis Cell Lysates and Membranes
JB Juri Niño Bach
MB Marc Bramkamp
Published: Vol 4, Iss 2, Jan 20, 2014
DOI: 10.21769/BioProtoc.1025 Views: 15708
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in Jun 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2013
Abstract
A common feature of every eukaryotic and prokaryotic cell is that they exhibit a plasma membrane. In Bacillus subtilis (B. subtilis) roughly 25% of all proteins are putative trans- or membrane associated proteins. Here we describe a relatively simple method to separate and prepare membrane and cytosolic proteins by ultra-centrifugation.
Materials and Reagents
Bacillus subtilis (B. subtilis)
Glycerol (Carl Roth, catalog number: 7530.4 )
Tris (J.T.Baker®, catalog number: 1414 )
NaCl (AppliChem GmbH, catalog number: A3597.5000 )
MgCl2 (Merck KGaA, catalog number: 1.05833.1000 )
Proteinase inhibitor (Roche Diagnostics, catalog number: 0 4693159001 )
DNAse I (Roche Diagnostics, catalog number: 10104159001 )
Lysozyme (Roche Diagnostics, catalog number: 10153516103 )
Casein hydrolysate (Oxoid Limited, catalog number: LP0041 )
Buffer A (see Recipes)
Casein Hydrolysate (CH-medium) (see Recipes)
Solution G (see Recipes)
Equipment
Glass beads (diameter 0.2-0.3 mm) (Sigma-Aldrich, catalog number: G1277 )
French press homogenizer (Glen Mills, French press G-MTM )
Ultra-centrifuge (Beckman Coulter, model: optimaTM XPN-100 )
Ti-70 Rotor (Beckman Coulter)
FastPrep tissue homogenizer (MP Biomedicals, model: 116004500 )
Refrigerated centrifuge (e.g. Beckman Coulter, model: Avanti-J25 )
Acrodisc® syringe filters (a pore size of 0.2 µm) (Pall, catalog number: 4652 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Bach, J. N. and Bramkamp, M. (2014). Preparation of Bacillus subtilis Cell Lysates and Membranes. Bio-protocol 4(2): e1025. DOI: 10.21769/BioProtoc.1025.
Download Citation in RIS Format
Category
Cell Biology > Organelle isolation > Membrane
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,026 | https://bio-protocol.org/exchange/protocoldetail?id=1026&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of the Secretome from Bacillus subtilis
JB Juri Niño Bach
MB Marc Bramkamp
Published: Vol 4, Iss 2, Jan 20, 2014
DOI: 10.21769/BioProtoc.1026 Views: 10622
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in Jun 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2013
Abstract
Bacteria are commonly known to secret proteins in large amounts into the surrounding environment in high concentrations via various pathways. These proteins can be involved in numerous processes like cell-cell communication, exopolymer formation but also metabolic active enzymes are secreted that are interesting for industrial production of proteins. One of the most regularly used organisms for industrial protein production is the Gram-positive bacterium Bacillus subtilis (B. subtilis). Here we describe a protocol that can be used to quantitatively and qualitatively analyze secreted proteins from B. subtilis.
Materials and Reagents
B. subtilis
Trichloroacetic acid (Merck KGaA, catalog number: 1.00.807.0250 )
Acetone (J.T.Baker®, catalog number: 9006-01 )
BCA-assay (Pierce Antibodies, catalog number: 23225 )
Casein Hydrolysate (Oxoid Limited, catalog number: LP0041 )
(CH)-medium (see Recipes)
Solution G (see Recipes)
Resuspension Buffer (see Recipes)
Equipment
50 ml flasks with baffles
Acrodisc® syringe filters with a pore size of 0.2 µm (Pall, catalog number: 4652 )
Refrigerated centrifuge (e.g. Eppendorf, model: 5810R )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial biochemistry > Protein
Systems Biology > Proteomics > Secretome
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,027 | https://bio-protocol.org/exchange/protocoldetail?id=1027&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Protocol for Measurement of Intracellular pH
Iman Saramipoor Behbahan
Matthew A. McBrian
Siavash K. Kurdistani
Published: Vol 4, Iss 2, Jan 20, 2014
DOI: 10.21769/BioProtoc.1027 Views: 22310
Edited by: Lin Fang
Reviewed by: Fanglian He
Original Research Article:
The authors used this protocol in Jan 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2013
Abstract
Intracellular pH (pHi) is an important physiological determinant of enzyme activity and cellular function (Kurkdjian and Guern, 1989). All proteins depend on a tightly regulated pH to maintain their structure and function. Protonation–deprotonation events can dictate the charge of biological surfaces and are integral steps in many metabolic reactions (Casey et al., 2010). Moreover, the proton gradient across the mitochondrial membrane is used to generate cellular energy and support other mitochondrial processes. As a result, cells have developed multiple mechanisms to maintain a narrow range of pHi in response to extra- and intracellular fluctuations in pH (Orij et al., 2012). Here, we describe a protocol for pHi measurement in live cells that uses fluorescent microscopy and the pH sensitive dye 2’,7’-Bis-(2-Carboxyethyl)-5-(and-6-)-Carboxyfluorescein Acetoxymethyl Ester (BCECF-AM). This method was recently used to determine the effects of intracellular pH changes on global histone acetylation levels (McBrian et al., 2013).
Materials and Reagents
Hela cells
Nigericin (Sigma-Aldrich, catalog number: N7143 )
Prepare 10 mM nigericin (1:10,000 ) stock in ethanol (store aliquots at -20 °C and keep on ice during experiment)
DMSO (Sigma-Aldrich, catalog number: D2650 )
BCECF-AM (Life Technologies, catalog number: B1170 )
Glucose
1% Antibiotic-Antimycotic (Gibco®, catalog number: 15240 )
DMEM (Mediatech, Cellgro®, catalog number: 10-013-CV )
10% FBS
Paraffin wax
Calibration solution (see Recipes)
10x Earle’s balanced salt solution (EBSS) stock without glucose and without sodium bicarbonate (see Recipes)
Loading solution (see Recipes)
Cell culture medium (see Recipes)
Equipment
Perfusion inserts for 35 mm Dishes (Warner Instruments, catalog number: RC-33DM )
35 mm poly-lysine coated glass bottom culture dishes (MatTek, catalog number: P35GC-1.0-14-C )
50 ml conical tube
Needles
Aluminum foil
Axiovert 200 M Zeiss florescent microscope equipped with a high-resolution video camera (ZEISS, Axio CAM MRm)
BCECF filter set (Chroma Technology Corporation, catalog number: 71001a )
Neutralize density filter (ND 1.0 A - 10.0% transmission-25mm; this is custom-designed for a given microscope) (Chroma Technology Corporation)
Tubing and connections for perfusion
Flow pump (Rainin Peristaltic pump Dynamax RP-1. 4-channel; catalog number is different based on supplier)
5% CO2 tank
37 °C Water bath
5% CO2 incubator (make sure it is calibrated regularly; variations in CO2 concentration can have dramatic effects on pH, generating noise in the experiment)
Software
AxioVision 4.8
Slidebook 4.2
SigmaPlot
Excel or any spreadsheet analysis software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Behbahan, I. S., McBrian, M. A. and Kurdistani, S. K. (2014). A Protocol for Measurement of Intracellular pH. Bio-protocol 4(2): e1027. DOI: 10.21769/BioProtoc.1027.
Download Citation in RIS Format
Category
Biochemistry > Other compound > Ion
Cell Biology > Cell-based analysis > Ion analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,028 | https://bio-protocol.org/exchange/protocoldetail?id=1028&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Proteasome Assay in Cell Lysates
Pamela Maher
Published: Vol 4, Iss 2, Jan 20, 2014
DOI: 10.21769/BioProtoc.1028 Views: 12559
Edited by: Xuecai Ge
Original Research Article:
The authors used this protocol in Jun 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2013
Abstract
The ubiquitin-proteasome system (UPS) mediates the majority of the proteolysis seen in the cytoplasm and nucleus of mammalian cells. As such it plays an important role in the regulation of a variety of physiological and pathophysiological processes including tumorigenesis, inflammation and cell death (Ciechanover, 2005; Kisselev and Goldberg, 2001). A number of recent studies have shown that proteasome activity is decreased in a variety of neurological disorders including Parkinson's disease, Alzheimer's disease, amyotrophic lateral sclerosis and stroke as well as during normal aging (Chung et al., 2001; Ciechanover and Brundin, 2003; Betarbet et al., 2005). This decrease in proteasome activity is thought to play a critical role in the accumulation of abnormal and oxidized proteins. Protein clearance by the UPS involves two sequential reactions. The first is the tagging of protein lysine residues with ubiquitin (Ub) and the second is the subsequent degradation of the tagged proteins by the proteasome. We herein describe an assay for the second of these two reactions (Valera et al., 2013). This assay uses fluorogenic substrates for each of the three activities of the proteasome: chymotrypsin-like activity, trypsin-like activity and caspase-like activity. Cleavage of the fluorophore from the substrate by the proteasome results in fluorescence that can be detected with a fluorescent plate reader.
Keywords: Nerve cells Fluorescence Protein degradation
Materials and Reagents
Cells
HEPES (Sigma-Aldrich, catalog number: H3375 )
MgCl2 (Sigma-Aldrich, catalog number: M2670 )
EDTA (Sigma-Aldrich, catalog number: E5134 )
EGTA (Sigma-Aldrich, catalog number: E4378 )
Sucrose (MP Biomedicals, catalog number: 821713 )
DTT (Life Technologies, catalog number: 15508013 )
Proteasome substrates [dissolved in DMSO (Sigma-Aldrich, catalog number: D8418 ) to a final concentration of 10 mM and stored frozen at -20 °C]
Suc-LLVY-AMC (chymotrypsin-like activity substrate) (Enzo Life Sciences, catalog number: P802 )
Z-ARR-AMC (trypsin-like activity substrate) (EMD Millipore, catalog number: 539149 )
Z-LLE-AMC (caspase-like activity substrate) (EMD Millipore, catalog number: 539141 )
PBS without Ca2+ and Mg2+ (Sigma-Aldrich, catalog number: P802)
Coomassie Protein Assay Reagent (Thermo Fisher Scientific, catalog number: 1856209 )
BSA protein standard (Thermo Scientific, catalog number: 23209 )
ATP (Sigma-Aldrich, catalog number: A3377 )
Proteasome Lysis/Assay Buffer (see Recipes)
Equipment
60 mm tissue culture dishes
Rubber policeman or other type of cell scraper
1.7 ml microcentrifuge tube
Black walled 96 well plates (Corning, Costar®, catalog number: 3603 )
Clear 96 well plates (Greiner Bio-One GmbH, catalog number: 655101 )
Sonicator (GlobalSpec, model: W-380 )
Microcentrifuge
Fluorescent plate reader
Visible plate reader
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Maher, P. (2014). Proteasome Assay in Cell Lysates. Bio-protocol 4(2): e1028. DOI: 10.21769/BioProtoc.1028.
Valera, E., Dargusch, R., Maher, P. A. and Schubert, D. (2013). Modulation of 5-lipoxygenase in proteotoxicity and Alzheimer's disease. J Neurosci 33(25): 10512-10525.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,029 | https://bio-protocol.org/exchange/protocoldetail?id=1029&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
ADCC Assay Protocol
VS Vikram Srivastava
ZY Zheng Yang
IH Ivan Fan Ngai Hung
JX Jianqing Xu
BZ Bojian Zheng
MZ Mei-Yun Zhang
Published: Vol 4, Iss 2, Jan 20, 2014
DOI: 10.21769/BioProtoc.1029 Views: 42236
Reviewed by: Lin FangFanglian He
Original Research Article:
The authors used this protocol in May 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2013
Abstract
Antibody-dependent cell-mediated cytotoxicity (ADCC) bridges innate and adaptive immunity, and it involves both humoral and cellular immune responses. ADCC has been found to be a main route of immune protection against viral infections and cancers in vivo. Here we developed a flow cytometry based protocol for ADCC assay using human peripheral blood mononuclear cells (PBMCs) as effector cells. Using this protocol, we determined the ADCC activity of convalescent plasma IgGs from six H1N1-infected human subjects in China, and identified two dominant ADCC epitopes, designated E1 [amino acid (AA) 92-117] and E2 (AA 124-159), on haemagglutinin of pandemic H1N1 influenza virus by epitope mapping of the convalescent plasma IgGs with different levels of ADCC activity. Our study may aid in designing immunogens that can elicit antibodies with high ADCC activity. Vaccine immunogens designed to include the structural determinants of potent broadly neutralizing antibodies and ADCC epitopes may confer a comprehensive immune protection against viral infections.
Keywords: ADCC Influenza Virus Flowcytometry 7AAD Viability Staining Membrane labeling
Materials and Reagents
Raji cells (ATCC)
A/California/04/2009 (H1N1) influenza virus (Reference Laboratory)
Turkey red blood cells (from animal)
Tissue culture medium with serum (complete medium) RPMI 1640 (Life Technologies) containing 10% heat-inactivated fetal calf serum (FCS) and 2% L-glutamine
Serum, albumin, or other system-compatible protein (FBS) (Life Technologies, catalog number: 10099141 )
PKH67 cell labelling dye (Sigma-Aldrich, catalog number: MIDI67 )
7-AAD Stain (Life Technologies, catalog number: A1310 )
PBS (Calcium Magnesium free) (Life Technologies, catalog number: 10010-023 )
RPMI 1640 media (Life Technologies, catalog number: 12633-020 )
Pen/Strep (Life Technologies, catalog number: 10378016 )
Triton X-100 (Sigma-Aldrich, catalog number: T8787 )
Equipment
Round bottomed 96-well plate
Temperature controlled centrifuge
Polypropylene conical bottom centrifuge tubes (4-15 ml)
Bio-safety Cabinet
Haemocytometer or cell counter
Slides and coverslips
Instrument (s) for fluorescence analysis (Flow cytometer)
37 °C, 5% CO2 incubator
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Srivastava, V., Yang, Z., Hung, I. F. N., Xu, J., Zheng, B. and Zhang, M. (2014). ADCC Assay Protocol. Bio-protocol 4(2): e1029. DOI: 10.21769/BioProtoc.1029.
Download Citation in RIS Format
Category
Immunology > Immune cell function > Cytotoxicity
Cell Biology > Cell-based analysis > Flow cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
103 | https://bio-protocol.org/exchange/protocoldetail?id=103&type=1 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Pulsed-field Gel Electrophoresis Typing of Gram-negative Bacteria (E.coli)
ZL Zhenying Liu
Published: Aug 5, 2011
DOI: 10.21769/BioProtoc.103 Views: 12975
Download PDF
Ask a question
Favorite
Cited by
Materials and Reagents
Chromosomal low melting agarose (Lonza InCert Agarose or Bio-Rad Laboratories)
Restriction enzymes (New England Biolabs)
Proteinase K (Promega Corporation)
10x Tris-borate EDTA (TBE) buffer (Promega Corporation)
Agarose for pulsed field gel (Bio-Rad Laboratories)
Lamda ladder for pulsed field gel (Bio-Rad Laboratories)
Ethidium bromide (10 mg/ml) (Life Technologies, Invitrogen™)
Agar media
TE
NaCl
EDTA
Sarkosy l
Sma I
Xba I
Restriction enzyme buffer
Running buffer (0.5x TBE)
Suspension buffer (see Recipes)
Lysis buffer (see Recipes)
Equipment
CHEF-MapperTM apparatus (Bio-Rad Laboratories)
Spectrophotometer (Bio-Rad Laboratories)
UV light and photograph
Water bath
Glass rod
1.5 ml Eppendorf tube
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2011 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial genetics > DNA
Molecular Biology > DNA > Electrophoresis
Molecular Biology > DNA > DNA quantification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,030 | https://bio-protocol.org/exchange/protocoldetail?id=1030&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Binding to Secreted Bone Matrix in vitro
AT Aurélie Jeanne Tormo
CB Christian Beauséjour
JG Jean-François Gauchat
Published: Vol 4, Iss 4, Feb 20, 2014
DOI: 10.21769/BioProtoc.1030 Views: 9146
Original Research Article:
The authors used this protocol in Mar 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2013
Abstract
This method examines the bone matrix binding capacity of proteins. Using osteogenic differentiation medium, multipotent stromal cells (MSC) are induced to differentiate into osteocytes in vitro and to secrete bone matrix. The latter is confirmed using Alizarin red S staining, which detects the presence of calcific deposits (hydroxyapatite). These calcific deposits are used to test the bone binding properties of proteins. The binding to the calcific deposits is assessed by Western blot analysis.
Materials and Reagents
Multipotent stromal cells (MSC) isolated from mouse bone marrow [see protocol “Isolation of Multipotent Stromal Cells from Mouse Bone Marrow” (Tormo et al., 2014)]
Dulbecco’s Modified Eagle’s Medium High glucose with stable L-glutamine (DMEM) (Wisent, catalog number: 319-015-CL )
Penicillin/Streptomycin solution (Wisent, catalog number: 450-201-EL )
Fetal Bovine Serum (FBS) (Life Technologies, Gibco®, catalog number: 12483 )
0.53 mM 0.05% Trypsin/EDTA (Wisent, catalog number: 325-042-EL )
PBS without Ca2+ and Mg2+ (Wisent, catalog number: 311-01-CL )
HEPES (Wisent, catalog number: 330-050-EL )
10 nM Dexamethasone (Sigma-Aldrich, catalog number: D4902 )
50 μM Ascorbic acid-2 phosphate (vitamin C) (Sigma-Aldrich, catalog number: A4403 )
50 nM Cholecalciferol (Vitamin D3) (Sigma-Aldrich, catalog number: C9756 )
10 mM B-glycerophosphate (Sigma-Aldrich, catalog number: G9891 )
100x Protease and phosphatase inhibitors (Thermo Fisher Scientific, Pierce, catalog number: PI78447 )
IL-27 (1 μg) (R&D Systems, catalog number: 2799-ML-010/CF ) or any recombinant protein to be tested
Bicinchoninic acid assay (BCA) (Thermo Fisher Scientific, Pierce, catalog number: PI23225 )
Distilled water
Ethanol
Anti-IL-27 p28 biotinylated antibody (R&D Systems, catalog number: BAF1834 ) or biotinylated antibody specific for the protein to be tested
Streptavidin-HRP (Thermo Fisher Scientific, Pierce, catalog number: PI21130 )
SDS-PAGE loading buffer without bromophenol blue or DTT
Urea buffer (Fisher Scientific, catalog number: BP169-10 )
1 M Sodium phosphate monobasic (Fisher Scientific, catalog number: BP330-1 )
1 M Sodium phosphate dibasic (Fisher Scientific, catalog number: BP332-1 )
TBS-Tween
3% BSA
Dexamethasone solution (see Recipes)
10x Glycerophosphate solution (see Recipes)
1,000x Vitamin C solution (see Recipes)
Osteogenic differentiation medium (50 ml) (see Recipes)
Alizarin red S (Sigma-Aldrich, catalog number: A5533 ) (see Recipes)
Urea/Phosphate lysis buffer (see Recipes)
Equipment
15 ml tube
Centrifuge for cell culture
6 well tissue culture plates (BD Biosciences, catalog number: DL-353046 )
96 well tissue culture plates with flat bottoms (BD Biosciences, catalog number: DL-353072 )
Inverted phase-contrast microscope
37 °C, 5% CO2 cell culture incubator
Cell scrapers (Corning, catalog number: 3010 )
Microplate reader for BCA (562 nm)
SDS-PAGE Equipment
Western blot Equipment
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Protein > Interaction
Cell Biology > Cell isolation and culture > Cell differentiation
Stem Cell > Adult stem cell > Stromal cell
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,031 | https://bio-protocol.org/exchange/protocoldetail?id=1031&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Multipotent Stromal Cells from Mouse Bone Marrow
AT Aurélie Jeanne Tormo
MR Moutih Rafei
JG Jean-François Gauchat
Published: Vol 4, Iss 4, Feb 20, 2014
DOI: 10.21769/BioProtoc.1031 Views: 9311
Original Research Article:
The authors used this protocol in Mar 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2013
Abstract
Generating mouse multipotent stromal cells (MSC) from bone-marrow cells is usefull for a wide range of applications. Effectively, these MSC can differentiate into adipocytes, osteocytes [See “Binding to Secreted Bone Matrix in vitro” (Tormo et al., 2014)] or chondrocytes upon culture in specific differentiation medium.
Materials and Reagents
6-8 weeks old mouse
PBS without Ca2+ and Mg2+ (Wisent, catalog number: 311-01-CL )
Dulbecco's Modified Eagle's Medium High glucose with stable L-glutamine (DMEM) (Wisent, catalog number: 319-015-CL )
Fetal bovine serum (FBS) (Life Technologies, Gibco®, catalog number: 12483 )
Penicillin/Streptomycin solution (Wisent, catalog number: 450-201-EL )
Trypan blue (Life Technologies, Gibco®, catalog number: 15250-061 )
Trypsin 0.05%/EDTA 0.53 mM (Wisent, catalog number: 325-042-EL )
APC-conjugated anti-CD31 antibody (clone MEC13.3) (BD Biosciences, catalog number: 551262 )
FITC-conjugated anti-CD45 antibody (clone 30-F11) (BD Biosciences, catalog number: 553080 )
APC-conjugated anti-CD44 antibody (clone IM7) (BD Biosciences, catalog number: 559250 )
PE-conjugated anti-CD105 antibody (clone MJ7/18) (BD Biosciences, catalog number: 562759 )
FITC-conjugated anti-CD90 antibody (clone 5E10) (BD Biosciences, catalog number: 555595 )
Equipment
Scissors and forceps
Syringe 1cc with 27 Gauge x 1-½ needle (BD, catalog numbers: BD-309659 and BD-305109 )
Petri dishes 100 x 20 mm (BD, catalog number: DL-353003 )
50 ml conical tubes (Progene®, catalog number: 71-5000-B )
Table top centrifuge
Culture hood
Hemocytometer
T-25 flask (BD, catalog number: 353108 )
37 °C, 5% CO2 Cell culture incubator
Flow cytometer (e.g. BD LSRFortessa)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Immune cell isolation > Maintenance and differentiation
Cell Biology > Cell isolation and culture > Cell isolation
Stem Cell > Adult stem cell > Stromal cell
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,032 | https://bio-protocol.org/exchange/protocoldetail?id=1032&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Retinal Explant Culture
CJ Christine Jolicoeur
Michel Cayouette
Published: Vol 4, Iss 2, Jan 20, 2014
DOI: 10.21769/BioProtoc.1032 Views: 21049
Edited by: Xuecai Ge
Original Research Article:
The authors used this protocol in Nov 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2012
Abstract
A particularly powerful culture method for the retina is the explant assay, which consists in culturing a small piece of retina on an organotypic filter. Retinal explants can be prepared any time between embryonic day 13 (E13) and postnatal day 4 (P4). Although retinal ganglion cells tend to degenerate shortly after they are generated in explants, and photoreceptor cells do not grow extended outer segments, the explants will develop very similarly to a retina in vivo and generate all the different retinal cell types that will migrate to the appropriate layer. The retinal explant culture assay is particularly useful in cases where a mouse mutant is embryonic lethal and its retinal development cannot be studied in vivo. Because retinal explants can be prepared from embryonic animals and electroporated or infected with viral vectors, it is also a useful approach for the study of gene function at embryonic stages. Here, we present a retinal explant culture method that we have used extensively in various publications (Kechad et al., 2012; Cayouette et al., 2003; Cayouette and Raff, 2003; Elliott et al., 2008).
Keywords: Cell lineage Neural progenitor Asymmetric division Organotypic culture Differentiation
Materials and Reagents
Animals
We typically use retinas from albino Sprague Dawley rats or mice. Explants can be prepared from animals aged between embryonic day 12 to post-natal day 4.
DPBS (Life Technologies, catalog number: 14040 )
DMEM (Life Technologies, catalog number: 10569-010 )
Fetal bovine serum (FBS) (Wisent, catalog number: 080-450 )
Penicillin/streptomycin (Life Technologies, catalog number: 15070 )
70% ethanol
Fungizone antimycotic (Life Technologies, catalog number: 15290026 )
Sucrose (Sigma-Aldrich, catalog number: S0389 )
O.C.T. compound (Somagen, catalog number: 4583 )
Explant medium
4% Paraformadehyde (PFA) solution (Electron Microscopy Sciences, catalog number: 15710 ) (see Recipes)
20% sucrose/OCT (1:1) (see Recipes)
20% sucrose solution (see Recipes)
Equipment
Millicell organotypic insert (EMD Millipore, catalog number: PICMORG50 )
35 mm dish or 6 well plates
37 °C and 5% CO2 incubator
100 mm dish
150 mm dish
Straight forcep
FIne forcep (Fine Science Tools, catalog number: 11252-23 )
Curved forcep (Fine Science Tools, catalog number: 91197-00 )
Sharp scissor
Sharp scapel (Fine Science Tools, catalog number: 10315-12 )
Razor blade
P1000 pipette
CO2 chamber
Cryomold 15 x 15 x 5 mm (VWR International, catalog number: CA60872-016 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Jolicoeur, C. and Cayouette, M. (2014). Retinal Explant Culture. Bio-protocol 4(2): e1032. DOI: 10.21769/BioProtoc.1032.
Kechad, A., Jolicoeur, C., Tufford, A., Mattar, P., Chow, R. W., Harris, W. A. and Cayouette, M. (2012). Numb is required for the production of terminal asymmetric cell divisions in the developing mouse retina. J Neurosci 32(48): 17197-17210.
Download Citation in RIS Format
Category
Neuroscience > Development > Retinal culture
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,033 | https://bio-protocol.org/exchange/protocoldetail?id=1033&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Dissociated Retinal Cell Culture
CJ Christine Jolicoeur
Michel Cayouette
Published: Vol 4, Iss 2, Jan 20, 2014
DOI: 10.21769/BioProtoc.1033 Views: 15277
Edited by: Xuecai Ge
Original Research Article:
The authors used this protocol in Nov 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2012
Abstract
The retina is a relatively simple and accessible part of the central nervous system, making it a powerful model to study cell fate specification mechanisms. Multipotent retinal progenitor cells (RPCs) give rise to seven major classes of retinal cell types. Mechanisms regulating cell fate choice in the retina depend on both cell intrinsic and environmental factors, but their relative contribution to specific cell fate decisions remains unclear. Dissociated retinal cell cultures provide a great assay to study this problem. RPCs are cultured in serum-free and extract-free medium, providing the investigator with a control over the environment to address questions related to the effects of a particular molecule on the development of retinal neurons. In addition, dissociated cell cultures can be used to study the importance of cell intrinsic mechanisms by isolating RPCs from their normal environment (Cayouette et al., 2003; Jensen and Raff, 1997). The method described below is suitable for the clonal-density culture of RPCs. In such cultures, RPCs are isolated from each other and from the postmitotic neurons. They divide and differentiate into different retinal cell types to form small colonies, or “clones”. In a recent study, we found that these clones are indistinguishable from the clones that develop in situ in the retina, both in terms of cell number and cell type composition, suggesting that intracellular mechanisms play a key role in retinal development (Cayouette et al., 2003).
Keywords: Retina Primary culture Retinal neuron Retinal progenitor cells Clonal density
Materials and Reagents
Animals
We typically use retinas from albino Sprague Dawley rats. This method works for culturing rat retinas aged between embryonic day 17 to post-natal day 1. Younger and older retinal cells or retinal cells from mouse retinas do not seem to survive as well under these conditions, but can also be cultured.
DPBS (Life Technologies, catalog number: 14040 )
Neurobasal medium (Life Technologies, catalog number: 21103-049 )
DMEM/F12 medium (Life Technologies, catalog number: 10565-018 )
B27 supplement (Life Technologies, catalog number: 17504-044 )
Pen/Strep (P/S) (Life Technologies, catalog number: 15140-122 )
Poly L-lysine (PLL) (Sigma-Aldrich, catalog number: P-4707 )
Mouse Laminin (Life Technologies, catalog number: 23017-015 )
Papain (Worthington Biochemical, catalog number: LS003126 )
L-cystein crystal (Sigma-Aldrich, catalog number: C-7352 )
Trypsin Inhibitor (Roche Diagnostics, catalog number: 109878 )
0.45 µm and 0.22 µm filters (Fisher Scientific, catalog number: SLHV033RS and SLGP033RS )
Hoechst 33342 (Life Technologies, Molecular Probes®, catalog number : H3570 )
“Incomplete” RGM medium
Growth factors (see Recipes)
bFGF (Pepro Tech, catalog number: 100-18B )
EGF (Pepro Tech, catalog number: 315-09 )
NT-3 (Pepro Tech, catalog number: 450-03 )
BDNF (Pepro Tech, catalog number: 450-02 )
10x Lo Ovomucoid (see Recipes)
20x 4% BSA (Sigma-Aldrich, catalog number: A-4161 ) (see Recipes)
0.4% DNase (Worthington Biochemical, catalog number: LS002007 ) (see Recipes)
Insulin (2.5 mg/ml) (Sigma-Aldrich, catalog number: I-6634 ) (see Recipes)
cpt-cAMP (Sigma-Aldrich, catalog number: C-3912 ) (see Recipes)
N-acetyl cysteine (NAC) (Sigma-Aldrich, catalog number: A-9165 ) (see Recipes)
Forskolin (Sigma-Aldrich, catalog number: D-2438 ) (see Recipes)
N2 Supplement (see Recipes)
4% Paraformaldehyde (Electron Microscopy Science, catalog number: 15710 ) (see Recipes)
Apo-Transferrin (Sigma-Aldrich, catalog number: T-1147 ) (see Recipes)
Progesterone (Sigma-Aldrich, catalog number: P-8783 ) (see Recipes)
Putrescine (Sigma-Aldrich, catalog number: P-5780 ) (see Recipes)
Sodium Selinite (Sigma-Aldrich, catalog number: S-5261 ) (see Recipes)
Equipment
35 mm petri dish (BD Biosciences, Falcon®, catalog number: 353001 )
50 ml conical tube
CO2 incubator
15 ml conical tube
100 mm petri dish
CO2 chamber
Straight forcep
Fine forcep (Fine Science Tools, catalog number: 11252-23 )
Curved forcep (Fine Science Tools, catalog number: 91197-00 )
Sharp scissor
Laminar flow hood
Water bath
P1000 pipette
Microscope
Hemacytometer
Centrifuge
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Jolicoeur, C. and Cayouette, M. (2014). Dissociated Retinal Cell Culture. Bio-protocol 4(2): e1033. DOI: 10.21769/BioProtoc.1033.
Kechad, A., Jolicoeur, C., Tufford, A., Mattar, P., Chow, R. W. Y., Harris, W. A. and Cayouette, M. (2012). Numb is required for the production of terminal asymmetric cell divisions in the developing mouse retina. J Neurosci 32(48): 17197-17210.
Download Citation in RIS Format
Category
Neuroscience > Development > Retinal culture
Cell Biology > Cell isolation and culture > Cell isolation
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,034 | https://bio-protocol.org/exchange/protocoldetail?id=1034&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Monoclonal Antibody Purification (Nicotiana benthamiana Plants)
Adam Husk
Krystal Teasley Hamorsky
Nobuyuki Matoba
Published: Vol 4, Iss 2, Jan 20, 2014
DOI: 10.21769/BioProtoc.1034 Views: 14278
Reviewed by: Pinchas Tsukerman
Original Research Article:
The authors used this protocol in May 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2013
Abstract
Plant-based expression systems provide an alternative biomanufacturing platform for recombinant proteins (Matoba et al., 2011). In particular, plant virus-based vectors can overexpress proteins within days in the leaf tissue of Nicotiana benthamiana (N. benthamiana). To overcome the issues of genetic instability and limited infectivity of recombinant viruses, Agrobacterium-mediated delivery of “deconstructed” virus vectors has become the mainstay for the production of large and/or multicomponent proteins, such as immunoglobulin (Ig)G monoclonal antibodies (mAbs). Here, we describe a method of producing human IgG mAbs in N. benthamiana using the tobamoviral replicon vector magnICON®. The vector can express up to a few hundred mg of a mAb per kg of leaf material in 7 days. A representative case for the broadly neutralizing anti-HIV and anti-influenza mAbs, VRC01 and CR6261 respectively, is shown (Hamorsky et al., 2013). Leaf tissue is homogenized and the extract is clarified by filtration and centrifugation. The mAb is purified by fast protein liquid chromatography (FPLC) using Protein A affinity and Phenyl HP hydrophobic interection resins.
Keywords: Monoclonal antibody Nicotiana benthamiana Plant virus vector
Materials and Reagents
Agrobacterium tumefaciens electrocompetent cells (strain GV3101)
MagnICON® plasmid (Icon Genetics GmbH, catalog number: pICH38099 ) (Marillonnet et al., 2004; Giritch et al., 2006)
Rifampicin (Sigma-Aldrich, catalog number: R3501 )
Gentamicin (Sigma-Aldrich, catalog number: G1264 )
Kanamycin (Sigma-Aldrich, catalog number: K1876 )
Yeast Extract (Fisher Scientific, catalog number: BP1422 )
Nutrient Broth (BD, catalog number: 231000 )
UV/Vis cuvette (VWR International, catalog number: 77776-745 )
MES (EMD Millipore, catalog number: 475894 )
Magnesium sulfate (EMD Millipore, catalog number: MX0070-3 )
Sodium phosphate (EMD Millipore, catalog number: SX0710-1 )
Sodium chloride (Sigma-Aldrich, catalog number: S9888 )
Sodium hydroxide
Ascorbic acid (Fisher Scientific, catalog number: BP351 )
1M Tris buffer (pH 8.0)
Glycine (Fisher Scientific, catalog number: BP381-5 )
L-Arginine (Sigma-Aldrich, catalog number: A5006 )
Dulbecco’s Phosphate Buffered Saline (DPBS) (Gibco®, catalog number: 14190-144 )
LB agar plate (see Recipes)
YenB media (see Recipes)
Infiltration buffer (see Recipes)
Extraction buffer (see Recipes)
Protein A Elution buffer (see Recipes)
Protein A Equilibration/Wash buffer (see Recipes)
Phenyl HP Equilibration/Wash buffer (see Recipes)
Phenyl HP Elution buffer (see Recipes )
Equipment
Amicon Ultra centrifugal filter, 30 K (EMD Millipore, catalog number: UFC903024 )
Electroporation cuvette (USA Scientific, catalog number: 9104-1050 )
Bottle top filter unit (VWR International, catalog number: 73520-986 )
Beveled flask (VWR International, catalog number: 4446-500 )
Centrifuge bottles (Thermo Fisher Scientific, catalog number: 3141-0250 )
HiTrap Protein A HP column (General Electric Company, catalog number: 17-0403-03 )
Phenyl HP column (General Electric Company, catalog number: 17-5195-01 )
Multiporator (Eppendorf, Bacteria module, catalog number: 4308 805.005 )
28 °C Incubator (Fisher Scientific)
Benchtop orbital shaker (Thermo Fisher Scientific, catalog number: SHKE4450 )
UV/Vis spectrophotometer (Beckman Coulter, catalog number: DU800 )
Avanti® J-26 XP Centrifuge (Beckman Coulter, catalog number: 393124 )
Infiltration apparatus (Bel-Art Products, catalog number: F420250000 )
Vacuum pump (William H. Welch Medical Library, catalog number: 8890A-75 )
Growth chamber
Blender (Waring Pro, catalog number: 7011HS )
AKTA purifier (General Electric Company, catalog number: 28-4062-66 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Husk, A., Hamorsky, K. T. and Matoba, N. (2014). Monoclonal Antibody Purification (Nicotiana benthamiana Plants). Bio-protocol 4(2): e1034. DOI: 10.21769/BioProtoc.1034.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Isolation and purification
Immunology > Antibody analysis > Antibody detection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,035 | https://bio-protocol.org/exchange/protocoldetail?id=1035&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Neuron Culture from Mouse Superior Cervical Ganglion
MJ Marisa Jackson
WT Warren Tourtellotte
Published: Vol 4, Iss 2, Jan 20, 2014
DOI: 10.21769/BioProtoc.1035 Views: 13940
Edited by: Xuecai Ge
Original Research Article:
The authors used this protocol in Mar 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2013
Abstract
The rodent superior cervical ganglion (SCG) is a useful and readily accessible source of neurons for studying the mechanisms of sympathetic nervous system (SNS) development and growth in vitro. The sympathetic nervous system (SNS) of early postnatal animals undergoes a great deal of remodeling and development; thus, neurons taken from mice at this age are primed to re-grow and establish synaptic connections after in situ removal. The stereotypic location and size of the SCG make it ideal for rapid isolation and dissociation. The protocol described here details the requirements for the dissection, culture and differentiation of SCG neurons. The protocol is suitable for culturing neurons from late embryonic gestation to approximately postnatal day 3. The culture technique discussed below utilizes glass coverslips for the microscopic examination of fixed cells.
Materials and Reagents
Female mouse at desired gestational stage or early postnatal pups
Sterile PBS (Corning Cellgro®, catalog number: 21-040-CV )
L15 Leibovitz media (Corning Cellgro®, catalog number: 10-045-CV )
Collagenase, Type 4 (1 mg) (Worthington Biochemical, catalog number: LS004182 )
Collagenase enzyme solution (10 mg/ml in L15, filter-sterilized)
Trypsin, 0.25% EDTA, Mg2+ Ca2+-free (Corning Cellgro®, catalog number: 25-053-Cl )
Dulbecco’s Modified Eagle Medium (DMEM) (Corning Cellgro®, catalog number: 10-013-CV )
Fetal bovine serum (FBS) (Equitech-Bio)
Poly-D-lysine(PDL) (50 mg) (Sigma-Aldrich, catalog number: P0296 )
Boric acid (Sigma-Aldrich, catalog number: B7660 )
Sodium Tetraborate (Sigma-Aldrich, catalog number: B9876 )
Laminin (1 mg) (BD Biosciences, catalog number: 354232 )
2.5 s Nerve Growth Factor (100 μg) (BD Biosciences, catalog number: 356004 )
Concentrated nitric acid (Fisher Scientific, catalog number: A200-212 )
Penicillin/streptomycin mix (Life Technologies, catalog number: 15140-122 )
Sterile, deionized water
Cytosine arabinoside (AraC) (Sigma-Aldrich, catalog number: C6645 )
0.1 M borate buffer (pH 8.5) (see Recipes)
Regular plating medium (see Recipes)
Equipment
Tissue culture incubator
35 mm or 6-well TC plates
35 mm tissue culture treated Petri dishes
100 mm Petri dishes
150 mm plastic Petri dish
German glass coverslips, 25 mm (Electron Microscopy Sciences, catalog number: 72196-25 )
Ceramic racks (Thomas Scientific, catalog number: 8542E40 )
Basic gravity convection oven (VWR International, catalog number: 414005-108 )
Silicon rubber dissection plates
Scissors
Fine tipped forceps
26 gauge needles
Fire-polished, cotton-plugged, siliconized Pasteur pipets or Barrier tip 200
Reduced bore siliconized Pasteur pipets
Serological pipet
Stereoscopic microscope
Fume hood
Water bath
37 °C incubator
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Jackson, M. and Tourtellotte, W. (2014). Neuron Culture from Mouse Superior Cervical Ganglion. Bio-protocol 4(2): e1035. DOI: 10.21769/BioProtoc.1035.
Quach, D. H., Oliveira-Fernandes, M., Gruner, K. A. and Tourtellotte, W. G. (2013). A sympathetic neuron autonomous role for Egr3-mediated gene regulation in dendrite morphogenesis and target tissue innervation. J Neurosci 33(10): 4570-4583.
Download Citation in RIS Format
Category
Neuroscience > Development > Neuron
Neuroscience > Cellular mechanisms > Cell isolation and culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,036 | https://bio-protocol.org/exchange/protocoldetail?id=1036&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Biomineralization Assay
Kyunghee Lee
Minsuk Kwon
Daewon Jeong
Published: Vol 4, Iss 3, Feb 5, 2014
DOI: 10.21769/BioProtoc.1036 Views: 18267
Original Research Article:
The authors used this protocol in Feb 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2013
Abstract
Biomineralization in vertebrates has both physiological and pathological aspects. Physiological mineralization is essential for proper development and function of hard tissues, such as bone, teeth, and growth plate cartilage, but it does not occur in soft tissues. Pathological ectopic mineralization, in contrast, occurs in soft tissues, including blood vessels, kidney, articular cartilage, and cardiovascular tissue. Here, we describe the simple method for detecting and measuring the presence of mineralized nodules in cardiac ventricular fibroblasts by using von Kossa and alizarin red S staining, and a colorimetric method for calcium quantification, respectively.
Keywords: Calcification Osteoblast Vascular smooth muscle cell
Materials and Reagents
Cardiac ventricular fibroblasts isolated from neonatal Sprague-Dawley rats by enzymatic dissociation (Lee et al., 2013)
Note: Our protocol can be used with various cell types such as osteoblasts and vascular smooth muscle cells.
Dulbecco’s Modified Eagle’s Medium (DMEM) with high glucose and 4 mM L-glutamine (Hyclone, catalog number: SH 30243.01 )
Fetal Bovine Serum (FBS) (Hyclone, catalog number: SH 30919.03 )
Inorganic phosphate (Pi) (pH 7.4)
DPBS without Ca2+ and Mg2+ (Hyclone, catalog number: SH 30028.02 )
Trypsin/EDTA (Hyclone, catalog number: SH 30042.01 )
70% ethanol
Distilled deionized water (DDW)
0.6 N HCl solution
Lysis solution
0.1 N NaOH
0.1% sodium dodecyl sulphate (SDS)
QuantiChrome Calcium Assay Kit (BioAssay Systems, catalog number: DICA-500 )
Working reagent (refer to QuantiChrome Calcium Assay Kit manual for detail) (BioAssay Systems, catalog number: DICA-500) (see Reference 2)
Bio-Rad DC protein assay kit (Bio-Rad Laboratories, catalog number: 500-0016 )
Diluted protein standards (e.g., 0, 2, 4, 6, 8, 12, 16 and 20 mg/dl)
100 ng/ml receptor activator of NF-kB ligand (RANKL) (Sigma-Aldrich, catalog number: R0525 )
5% Aqueous silver nitrate solution (Sigma-Aldrich, catalog number: S7279 ) (see Recipes)
5% sodium thiosulfate (Sigma-Aldrich, catalog number: S7026 ) (see Recipes)
2% alizarin red S solution (Sigma-Aldrich, catalog number: A5533 ) (see Recipes)
1 M NaH2PO4 (pH 7.4) (Sigma-Aldrich, catalog number: S6566 ) (see Recipes)
Equipment
48-well plate
96-well plate
Spectrophotometer or 96-well reader
37 °C, 5% CO2 cell culture incubator
Inverted microscope
Aspirator
UV-visualizer
High-watt lamp (60-100 watt)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Lee, K., Kwon, M. and Jeong, D. (2014). In vitro Biomineralization Assay. Bio-protocol 4(3): e1036. DOI: 10.21769/BioProtoc.1036.
Download Citation in RIS Format
Category
Immunology > Immune cell staining
Biochemistry > Other compound > Ion
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,037 | https://bio-protocol.org/exchange/protocoldetail?id=1037&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Assays for Determination of Acetylesterase Activity and Specificity Using pNP-acetyl and Acetylated Polysaccharides as Substrates
GP Gennady Pogorelko
OZ Olga A. Zabotina
Published: Vol 4, Iss 3, Feb 5, 2014
DOI: 10.21769/BioProtoc.1037 Views: 10091
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in May 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2013
Abstract
The acetylesterases are hydrolytic enzymes which in plants cleave acetyl groups from acetylated cell wall components, primarily polysaccharides. To estimate acetylesterase activity in plant apoplast, two assays can be used. First assay is a direct measurement of the acetylesterase activity in protein extract using synthetic substrate, pNP-acetyl. In this assay, amount of pNP released after hydrolysis of pNP-acetyl is determined by measuring the intensity of developed yellow color using spectrophotometer. The absorbance of reaction mixture is directly proportional to the activity of acetylesterases in the reaction mixture. Second assay is a determination of acetylesterase activity and its specificity towards natural polysaccharides and based on interaction between ferric perchlorate and acetyl residues resulting in ferric acetohydroxamic complex that can be quantified using spectrophotometer. In this assay, commercially available acetylated polysaccharides (xylan from Birchwood for acetylxylan esterase; pectin from citrus fruit for rhamnogalacturonan acetylesterase; or any other available polysaccharide of interest) incubated with apoplastic extract and amount of acetyl residues released from this polysaccharide is estimated using ferric perchlorate reagent (protocol was modified from McComb and McCready, 1957). The absorbance of produced colored complex is directly proportional to the amount of acetyls released from acetylated polysaccharide.
Keywords: Cell wall Acetyl esterase activity Polysaccharide acetylation Apoplast
Materials and Reagents
Plant material
4-Nitrophenyl acetate (Sigma-Aldrich, catalog number: N8130 )
4-Nitrophenyl (Sigma-Aldrich, catalog number: N1048 )
Tris-HCl
EDTA
MgCl2
Xylan from Birchwood (Sigma-Aldrich, catalog number: X4252 )
Pectin from citrus fruit (Sigma-Aldrich, catalog number: P9436 )
Sodium phosphate
Sodium hydroxide
Hydroxylamine hydrochloride (Acros Organics, catalog number: 5470-11-1 )
Perchloric acid (Sigma-Aldrich, catalog number: 311421-50ML )
Absolute methanol
Glucose-penta-acetate (Sigma-Aldrich, catalog number: G2354-25G )
Deionized water
Bio-Rad Protein Assay (Bio-Rad Laboratories, catalog number: 500-0006 ) (optional)
Extraction/reaction buffer (see Recipes)
Re-suspension buffer (see Recipes)
Acid-alcohol solution (see Recipes)
Ferric Perchlorate reagent (MP Biomedicals, catalog number: 215875 ) (see Recipes)
Equipment
Sharp razor blade
pH meter
Microtiter plate reader
Microcentrifuge
Centrifuge compatible with 15 ml vials
96-well microtiter plate
Parafilm
Sharp razor blade
10 ml syringe
Light water flow laboratory vacuum
SpeedVac dryer
Vortex
NanoDrop spectrophotometer (optional)
Shaker for microtubes
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Pogorelko, G. and Zabotina, O. A. (2014). Assays for Determination of Acetylesterase Activity and Specificity Using pNP-acetyl and Acetylated Polysaccharides as Substrates . Bio-protocol 4(3): e1037. DOI: 10.21769/BioProtoc.1037.
Pogorelko, G., Lionetti, V., Fursova, O., Sundaram, R. M., Qi, M., Whitham, S. A., Bogdanove, A. J., Bellincampi, D. and Zabotina, O. A. (2013). Arabidopsis and Brachypodium distachyon transgenic plants expressing Aspergillus nidulans acetylesterases have decreased degree of polysaccharide acetylation and increased resistance to pathogens. Plant Physiol 162(1): 9-23.
Download Citation in RIS Format
Category
Plant Science > Plant biochemistry > Protein
Biochemistry > Protein > Activity
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,038 | https://bio-protocol.org/exchange/protocoldetail?id=1038&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Microsome Isolation from Tissue
MB Maria Bodero
Jose Francisco Abisambra
Published: Vol 4, Iss 3, Feb 5, 2014
DOI: 10.21769/BioProtoc.1038 Views: 12068
Edited by: Xuecai Ge
Reviewed by: Hong-guang Xia
Original Research Article:
The authors used this protocol in May 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2013
Abstract
This protocol details the extraction of microsomes from frozen tissue in order to further examine the protein-protein interactions occurring within the endoplasmic reticulum. This protocol was adapted from Abisambra et al. (2013) with modifications made in order to optimize for subsequent use.
Keywords: Endoplasmic reticulum Microsomes Sub-cellular fractionation
Materials and Reagents
Sucrose
Protease Inhibitor cocktail, EDTA free (Merck KGaA, Calbiochem, catalog number: 539134 )
Phosphatase inhibitor cocktail II
Phosphatase inhibitor cocktail III
PMSF at 10 mM in DMSO or 1.74 mg/ml (Thermo Fisher Scientific, catalog number: 36978 )
Phosphatase Arrest II cocktail (Geno Technology, catalog number: 786-451 )
Phosphatase Arrest III cocktail (Geno Technology, catalog number: 786-452 )
M-PER Mammalian Protein Extraction Reagent (Thermo Fisher Scientific, catalog number: 78501 )
Equipment
Sterile bottle filter
Glass Dounce homogenizer
Refrigerated centrifuge
Microfuge tubes rated for at least 25,000 x g centrifugation
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Bodero, M. and Abisambra, J. F. (2014). Microsome Isolation from Tissue. Bio-protocol 4(3): e1038. DOI: 10.21769/BioProtoc.1038.
Abisambra, J. F., Jinwal, U. K., Blair, L. J., O'Leary, J. C., 3rd, Li, Q., Brady, S., Wang, L., Guidi, C. E., Zhang, B., Nordhues, B. A., Cockman, M., Suntharalingham, A., Li, P., Jin, Y., Atkins, C. A. and Dickey, C. A. (2013). Tau accumulation activates the unfolded protein response by impairing endoplasmic reticulum-associated degradation. J Neurosci 33(22): 9498-9507.
Download Citation in RIS Format
Category
Cell Biology > Organelle isolation > Microsome
Biochemistry > Protein > Interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,039 | https://bio-protocol.org/exchange/protocoldetail?id=1039&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Phosphoinositides Coated Beads Binding Assay
MG Manuel Gálvez-Santisteban
AR Alejo E. Rodriguez-Fraticelli
FM Fernando Martin-Belmonte
Published: Vol 4, Iss 3, Feb 5, 2014
DOI: 10.21769/BioProtoc.1039 Views: 11854
Edited by: Lin Fang
Reviewed by: Fanglian He
Original Research Article:
The authors used this protocol in Aug 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2012
Abstract
The PIs coated beads assay or “PIP-Beads” developed by Echelon Biosciences (Salt Lake City, USA) is a quick assay to recognize which PIs are able to bind to a given protein domain, in a quantitative way. It is much faster and cheaper than liposomes and more reproducible than PIP-strip assays. The “PIP-Beads” assay is a biochemical assay that basically involves an incubation of a purified protein or protein domain with the appropriate PI-coated set of beads. After washing, drying and resuspending the samples, they can be easily analyzed by SDS-PAGE separation. Phosphoinositides (PIs) have been characterized as important determinants of cell membrane domains, such as the apical and basolateral domains in epithelial polarized cells (Martin-Belmonte and Mostov, 2007), controlling membrane trafficking (Szentpetery et al., 2010) or determining the presynaptic or postsynaptic terminal in neurons, among other functions (Di Paolo and De Camilli, 2006). These phosphoinositides enriched membranes bring the proteomic machinery together, confers to these membrane their different identities and functions. This protein-PIs interaction in many cases involves direct binding of specific protein membrane domains with certain PIs. Some of these domains are characterized such as PH domains from phospholipase-C- or synaptotagmin-like C2 domains (Galvez-Santisteban et al., 2012), while some of them are not. To determine which PI is binding to a given protein domain, it is important to have a quick and efficient assay. The liposome binding assays are very good to establish the kinetic properties of binding, but they are expensive and permit only to test a few PIs per experiment. On the other hand, PIP-strip (phosphatidil-inositol-phosphate) based analysis is easy and fast, however the PIs are presented in a flat surface and the reproducibility is sometimes limited.
Materials and Reagents
PIP-Beads (Echelon) with the corresponding phosphoinositide of interest. Echelon provides a wide range of PI and other phospholipid coated beads on demand, including a sample pack that has a wide range of PIP-coated beads (P-B00S).
2 µg of purified GST-tagged protein per tube of beads and GST alone for control
The protein can be produced and purified by standard methods of GST-tagged protein purification by glutathione-sepharose beads. For the present assay, it is recommended to elute the protein from glutathione-sepharose beads and quantify it before use. Moreover, it is important to use high concentrations of protein, in order to use the smallest possible volume.
HEPES
Lgepal CA630
SDS
Glycerol
Tris-HCl
β-mercaptoethanol
Bromophenol blue
Wash/binding buffer (see Recipes)
2x Reducing Laemmli Sample Buffer (see Recipes)
Equipment
Refrigerated centrifuge
Oscillatory or gyratory shaker
Aspiration pump
Needles 0.7 x 30 mm
1.5 ml Tubes
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Gálvez-Santisteban, M., Rodriguez-Fraticelli, A. E. and Martin-Belmonte, F. (2014). Phosphoinositides Coated Beads Binding Assay. Bio-protocol 4(3): e1039. DOI: 10.21769/BioProtoc.1039.
Download Citation in RIS Format
Category
Biochemistry > Lipid > Lipid-protein interaction
Biochemistry > Protein > Interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,040 | https://bio-protocol.org/exchange/protocoldetail?id=1040&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In situ Chemotaxis Assay in Caenorhabditis elegans (for the Study of Circadian Rhythms)
Martha Merrow
Maria Olmedo
Published: Vol 4, Iss 3, Feb 5, 2014
DOI: 10.21769/BioProtoc.1040 Views: 13702
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in Dec 2012
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Dec 2012
Abstract
Olfaction is a well-studied sensory mechanism in Caenorhabditis elegans (C. elegans). The nematodes respond to a wide range of chemicals by either attraction, repulsion or a mixture thereof (Bargmann et al., 1993). We have used olfaction to characterize behavioural and molecular circadian rhythms in C. elegans. The circadian clock is a biological oscillator that provides an endogenous temporal structure that approximately matches the 24-hour periodicity in the environment (due to the rotational movement of the Earth). Circadian rhythms are present in most organisms from cyanobacteria to humans and they typically regulate sensory functions among many other processes. Olfaction is under circadian control in many animals (Granados-Fuentes et al., 2006; Granados-Fuentes et al., 2011; Tanoue et al., 2008; Krishnan et al., 1999). This protocol was designed to allow the assessment of olfaction for a population of worms within a short time interval, in the same plate where the worms grew (to avoid washing steps that may disturb the rhythms), and in the presence of food.
Keywords: Circandian Olfaction C. elegans Behaviour Rhythms
Materials and Reagents
Egg preparation
100 eggs are used for each petri dish. Assays are performed in triplicate.
LB broth
Cholesterol
Ethanol
CaCl2
MgSO4
KPO4
3.7% (v/v) 1-octanol (Merck KGaA, catalog number: 820931 ) in Ethanol
This concentration was established after a titration assay to find the lowest concentration needed for a fast response (within the minutes range) (Olmedo et al., 2012)
NGM plates (see Recipes)
Note: For one experiment, always use plates that were poured from the same batch and were allowed to dry for the same amount of time.
Escherichia coli (E. coli) OP50 culture at 100 g wet bacterial weight/liter (see Recipes)
Equipment
Template for labeling plate (Figure 1)
Figure 1. Template for plate labeling. On a piece of paper or plastic, draw a 5 cm-diameter circle in which to place the petri dish and a concentric 1 cm-diameter circle to mark the spot for the E. coli drop. Mark the center of this circle (A) with a dot. Draw another dot (B) at 0.8 cm from the center of the circle.
5 cm Petri plates
Stereomicroscope equipped for picture acquisition (we use a Stereo Discovery V8 from Zeiss at a 10x magnification.)
Centrifuge
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Neuroscience > Behavioral neuroscience > Chemotaxis
Developmental Biology > Morphogenesis > Motility
Neuroscience > Sensory and motor systems
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,041 | https://bio-protocol.org/exchange/protocoldetail?id=1041&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of Water Use Efficiency for Arabidopsis thaliana
Weronika Wituszynska
SK Stanisław Karpiński
Published: Vol 4, Iss 3, Feb 5, 2014
DOI: 10.21769/BioProtoc.1041 Views: 23193
Edited by: Ru Zhang
Original Research Article:
The authors used this protocol in Apr 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2013
Abstract
Water use efficiency (WUE) is a quantitative measurement of how much biomass or yield is produced per amount of water used. It is an important physiological factor for agriculture, especially in areas with a limited accessibility of water. It is also crucial in a better understanding of drought tolerance and drought resistance. The most common method to measure the WUE of individual plants is to weigh each pot or container to monitor the water loss and to harvest and measure biomass or yield at the end of the experiment. Since water can be lost from the soil surface through evaporation, there is a need to perform WUE measurements in a closed system. Here, we describe a simple method for WUE determination for Arabidopsis thaliana.
Keywords: Water use efficiency (WUE) Arabidopsis thaliana Biomass Plants Falcon tubes
Materials and Reagents
Arabidopsis seeds
Soil
Perlite
Tap water
Aluminium foil
Equipment
50 ml Falcon tubes
Tweezers
Burner
Milligram balance with a resolution of minimum 3 decimal place (0.001 g) readability
Transparent, tight container with a cover
Cold room/fridge
Growing chamber/phytotron
Incubator (with a possibility to set temperature 105 °C or above)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Wituszynska, W. and Karpiński, S. (2014). Determination of Water Use Efficiency for Arabidopsis thaliana. Bio-protocol 4(3): e1041. DOI: 10.21769/BioProtoc.1041.
Wituszynska, W., Slesak, I., Vanderauwera, S., Szechynska-Hebda, M., Kornas, A., Van Der Kelen, K., Muhlenbock, P., Karpinska, B., Mackowski, S., Van Breusegem, F. and Karpinski, S. (2013). Lesion simulating disease1, enhanced disease susceptibility1, and phytoalexin deficient4 conditionally regulate cellular signaling homeostasis, photosynthesis, water use efficiency, and seed yield in Arabidopsis. Plant Physiol 161(4): 1795-1805.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Abiotic stress
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,042 | https://bio-protocol.org/exchange/protocoldetail?id=1042&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Optical Clearing Using SeeDB
MK Meng-Tsen Ke
SF Satoshi Fujimoto
Takeshi Imai
Published: Vol 4, Iss 3, Feb 5, 2014
DOI: 10.21769/BioProtoc.1042 Views: 27510
Edited by: Xuecai Ge
Original Research Article:
The authors used this protocol in Aug 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2013
Abstract
We describe a water-based optical clearing agent, SeeDB (See Deep Brain), which clears fixed brain samples in a few days without quenching many types of fluorescent dyes, including fluorescent proteins and lipophilic neuronal tracers. SeeDB is a saturated solution of fructose (80.2% w/w) in water with 0.5% α-thioglycerol. In standard SeeDB optical clearing procedure, we treat paraformaldehyde-fixed embryo and brain samples with increasing concentrations of aqueous fructose solutions, and finally equilibrate them in SeeDB. The entire procedure takes approximately three days. Unlike previous methods, this method maintains a constant sample volume during the clearing procedure, an important factor to keep cellular morphology intact. After optical clearing, we can reach > 1,000 μm under confocal microscopy. When combined with two-photon microscopy, SeeDB allows us to image fixed mouse brains at millimeters-scale level. This method facilitates comprehensive and quantitative analyses for understanding neuronal circuitry, both in the adult and developing mouse brain. A SeeDB variant (SeeDB37) and optimized procedures (SeeDBp and SeeDB37ht protocols) are also supplied for specific requirements.
Keywords: Tissue clearing Fluorescence imaging Connectome SeeDB Fructose
Materials and Reagents
Phosphate-buffered saline (PBS)
4% paraformaldehyde (PFA) in PBS
D(-)-Fructose (≥99%) (e.g., Sigma-Aldrich, catalog number: F0127-500G )
α-thioglycerol (≥95%) (e.g., Sigma-Aldrich, catalog number: M1753-100ML )
2,2’-thiodiethanol (≥99%) (e.g., Sigma-Aldrich, catalog number: 166782-500G ) (optional)
Glycerol (≥99%) (e.g., Sigma-Aldrich, catalog number: G9012-500ML ) (optional)
Low melting point agarose (e.g., Life Technologies, catalog number: 16520 -100) (optional)
SeeDB (see Recipes)
SeeDBp (see Recipes)
Immersion solution (for commercial objective lenses) (see Recipes)
Immersion solution (for customized objective lens for SeeDB) (see Recipes)
Equipment
50 ml conical centrifuge tube (e.g., BD Biosciences, Falcon®) (for whole- and hemi-brain samples)
Culture dish (30 or 60 mm diameter) (e.g., BD Biosciences, Falcon®) (for slice preparation and fragile samples)
Overhead tube rotator (recommended for clearing large samples) (Figure 1A)
Seesaw shaker (for fragile samples) (Figure 1B)
Figure 1. Equipment used for optical clearing. For efficient optical clearing, it is important to shake samples in fructose solutions. We recommend using 50 ml conical centrifuge tube and overhead rotator for clearing large samples (e.g., whole- or hemi-brain samples). Fragile samples (e.g., brain slices) can be cleared in culture dishes and seesaw shaker. A. Overhead tube rotator, B. Seesaw shaker
Air incubator (optional, for SeeDB37 and SeeDB37ht protocols)
Coverslips (24 mm x 60 mm for small preparation and slices; 50 mm x 70 mm for whole-mount samples) (e.g., Matsunami Glass, catalog number: C050701 )
Handmade glass bottom Petri dish (100 mm diameter) or a commercial glass bottom dish (MatTek, catalog number: P100G-1.5-30-F )
Figure 2. Imaging chambers for fluorescence microscopy. A. An imaging chamber for inverted microscopes. B. An imaging chamber for upright microscopes with short working distance objective lenses. C. An imaging chamber for upright microscopes with long working distance objective lenses. We use glass bottom Petri dish to keep immersion solutions.
Silicone rubber sheet (optimal thickness should be chosen. For example, 6-mm-thick silicone sheet is recommended for 6-mm thick adult mouse brain.) (e.g., TOGAWA RUBBER, catalog number: K-125 )
Note: Silicone rubber sheets adhere to the coverslips and Petri dishes without any adhesives.
Thermo plate (optional, only for samples cleared with SeeDB37 or SeeDB37ht) (e.g., Tokai Hit)
Fluorescence microscope
Confocal microscope (for imaging up to 1-2 mm depth)
Multiphoton microscope (recommended for deeper imaging)
Objective lenses (examples)
10x air (NA=0.4, WD=3.1 mm) (OLYMPUS, model: UPLSAPO10X2 )
10x water immersion (NA=0.3, WD=3.5 mm) (OLYMPUS, model: UMPLFLN10xW )
25x water immersion (NA=1.05, WD=2 mm) (OLYMPUS, model: XLPLN25XWMP )
25x scale immersion (NA=1.0, WD=4 mm) (OLYMPUS, model: XLPLN25SVMP )
Water-immersion lenses perform much better than air-immersion objective lenses because spherical aberrations are smaller (Figure 5). In the two-photon microscopy, we also use a custom-made objective lens that performs best under the refractive index of SeeDB (~1.49). Please contact Olympus for its availability.
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Ke, M., Fujimoto, S. and Imai, T. (2014). Optical Clearing Using SeeDB. Bio-protocol 4(3): e1042. DOI: 10.21769/BioProtoc.1042.
Download Citation in RIS Format
Category
Neuroscience > Neuroanatomy and circuitry > Animal model
Cell Biology > Tissue analysis > Tissue isolation
Cell Biology > Cell imaging > Confocal microscopy
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,043 | https://bio-protocol.org/exchange/protocoldetail?id=1043&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Intracellular Staining for Phosphorylated STAT4 and STAT5 in Mouse Splenocytes
AV Ana Villegas-Mendez
JS J. Brian de Souza
SL Seen-Wai Lavelle
EF Emily Gwyer Findlay
TS Tovah N. Shaw
CS Christiaan J. Saris
CH Christopher A. Hunter
E Eleanor M. Riley
KC Kevin N. Couper
Published: Vol 4, Iss 3, Feb 5, 2014
DOI: 10.21769/BioProtoc.1043 Views: 12031
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in Apr 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2013
Abstract
The Stat (Signal Transducer and Activator of Transcription) family of proteins are critical signal transducers involved in fundamental cellular processes, including cell growth and differentiation, development, apoptosis, immune responses and inflammation. In here, we describe a simple and reproducible flow cytometry protocol to measure Stat protein phosphorylation in splenocyte preparations from malaria infected mice.
Materials and Reagents
C57BL/6 mice
RBC lysing buffer (BD Biosciences, catalog number: 555899 )
FACS buffer: Hanks balance salt solution (HBSS) with 2% foetal calf serum (FCS)
Trypan blue (Sigma-Aldrich, catalog number: T8154 )
AIM V® Medium (Life Technologies, catalog number: 31035025 )
Recombinant IL-2 (eBioscience) (stock solutions prepared as recommended by manufacturer)br />
Recombinant IL-12 (R&D Systems) (stock solutions prepared as recommended by manufacturer)
4% paraformaldehyde
90% ice-cold methanol
CD4 antibody (GK1.5) (eBioscience)
CD44 antibody (IM7) (eBioscience)
CD62L antibody (MEL-14) (eBioscience)
T-bet (4B10) antibody (eBioscience)
Phosphorylated STAT4 antibody (at residue Y693, clone 38) (BD Biosciences)
Phosphorylated STAT5 antibody (at residue Y694, clone 47) (BD Biosciences)
Equipment
6-well plates
70 μm cell strainer (BD Biosciences)
Haemocytometer
Refrigerated table top centrifuge
LSR II (BD Systems)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Villegas-Mendez, A., de Souza, J. B., Lavelle, S., Findlay, E. G., Shaw, T. N., Saris, C. J., Hunter, C. A., Riley, E. M. and Couper, K. N. (2014). Intracellular Staining for Phosphorylated STAT4 and STAT5 in Mouse Splenocytes. Bio-protocol 4(3): e1043. DOI: 10.21769/BioProtoc.1043.
Villegas-Mendez, A., de Souza, J. B., Lavelle, S. W., Gwyer Findlay, E., Shaw, T. N., van Rooijen, N., Saris, C. J., Hunter, C. A., Riley, E. M. and Couper, K. N. (2013). IL-27 receptor signalling restricts the formation of pathogenic, terminally differentiated Th1 cells during malaria infection by repressing IL-12 dependent signals. PLoS Pathog 9(4): e1003293.
Download Citation in RIS Format
Category
Immunology > Immune cell staining > Flow cytometry
Biochemistry > Protein > Immunodetection
Biochemistry > Protein > Modification
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,044 | https://bio-protocol.org/exchange/protocoldetail?id=1044&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
A Surface Plasmon Resonance Method to Study HCV NS5B Inhibitors
Melanie Wong
Giuseppe A. Papalia
Published: Vol 4, Iss 4, Feb 20, 2014
DOI: 10.21769/BioProtoc.1044 Views: 8537
Original Research Article:
The authors used this protocol in Feb 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2013
Abstract
Surface Plasmon Resonance (SPR) technology is a well-established platform used to evaluate the kinetic parameters of protein-small molecule interactions. Below, we describe the use of the ProteOn XPR36 biosensor from Bio-Rad (Hercules, CA) to evaluate the binding of small molecule inhibitors to recombinant NS5B protein. The high pI (> 9) of this construct allows for chemical immobilization using HEPES-buffered saline at pH 7.5. This is in contrast to traditional biosensor protocols that use both low pH and ionic strength. The use of a more physiological buffer to immobilize this enzyme leads to improved surface activity.
Keywords: Surface Plasmon Resonance (SPR) ProteOn XPR36 BIosensor NS5B Small molecule inhibitor
Materials and Reagents
HCV NS5B inhibitors
Purified recombinant HCV NS5B ΔC21 soluble protein [cloned and purified according to Boyce et al. (2014) and Hung et al. (2011)]
ProteOn GLH Sensor Chip (Bio-Rad Laboratories, catalog number: 176-5013 )
HEPES solution (1 M) (Sigma-Aldrich, catalog number: H3537-1L )
MgCl2 (1 M) (Sigma-Aldrich, catalog number: M1028-100ML )
EDTA (0.5 M) (Sigma-Aldrich, catalog number: E7889-100ML )
NaCl (5 M) (Sigma-Aldrich, catalog number: S6546-1L )
KCl (2 M) (Life Technologies, Ambion®, catalog number: AM9640G )
Tris (2-carboxyethyl) phosphine hydrochloride (TCEP) (Sigma-Aldrich, catalog number: C4706-10G )
Surfactant P20 (10% v/v) (General Electric Company, catalog number: BR-1000-54 )
DMSO (Sigma-Aldrich, catalog number: 472301-100ML )
ProteOn Amine Coupling Kit (Bio-Rad Laboratories, catalog number: 176-2410 ) containing 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDAC or EDC), sulfo-N-hydroxysuccinimide (Sulfo-NHS) and ethanolamine-HCl
Preconditioning Reagents (see Recipes)
Immobilization Buffer (see Recipes)
Running Buffer (see Recipes)
Running Buffer with 5% DMSO (see Recipes)
Equipment
ProteOn Standard & Deep-Well Microplates (Bio-Rad Laboratories, catalog numbers: 176-6020 and 176-6023 )
ProteOn Microplate Sealing Film (Bio-Rad Laboratories, catalog number: 176-6040 )
Nalgene Rapid-Flow Filter Units and Bottle Top Filters, PES Membrane, Sterile (VWR International, catalog number: 16211-056 ) (for the 1 L size)
ProteOn XPR36 instrument (Bio-Rad Laboratories)
BenchTop Centrifuge for microfuge tubes
BenchTop Centrifuge to spin ProteOn 96-well assay plate
Software
ProteOn Manager Software Version 3.1.0.6
Scrubber software designed for ProteOn data analysis (BioLogic Software)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > Protein > Interaction
Microbiology > Microbial biochemistry > Protein
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,045 | https://bio-protocol.org/exchange/protocoldetail?id=1045&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Limiting Dilution Assays to Determine Frequencies of Lymphohematopoietic Progenitors
Takafumi Yokota
Yusuke Satoh
Published: Vol 4, Iss 4, Feb 20, 2014
DOI: 10.21769/BioProtoc.1045 Views: 9687
Reviewed by: Omar Akil
Original Research Article:
The authors used this protocol in Jun 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2013
Abstract
This protocol is useful to determine the frequencies of lymphohematopoietic progenitors in tested samples. To effectively support the growth and differentiation of primitive lymphohematopoietic progenitors, complex signals from stromal cells are important. Several stromal cell lines are known to support both lymphoid and myeloid cells simultaneously in mouse. In this protocol, we introduce two stromal co-culture systems for murine lymphohematopoietic progenitors and their application for limiting dilution assays.
Materials and Reagents
Stromal cells (MS5 cells or OP9 cells)
Growth factors
a. rm SCF (10 ng/ml) (e.g. R&D systems, catalog number: 455-MC-010 )
b. rm Flt3-ligand (20 ng/ml) (e.g. R&D systems, catalog number: 427-FL-025 )
c. rm IL-7 (1 ng/ml) (e.g. R&D systems, catalog number: 407-ML-005 )
Antibodies
a. Anti-mouse Mac1 (BD Biosciences, catalog number: 557396 )
b. Gr1 (BD Biosciences, catalog number: 553128 )
c. CD19 (BD Biosciences, catalog number: 557399 )
d. CD45R/B200 (BD Biosciences, catalog number: 553092 )
e. CD45 (BD Biosciences, catalog number: 550994 )
Trypsin/EDTA solution (Nacalai Tesque, catalog number: 35554-64 )
EDTA solution (Nacalai Tesque, catalog number: 14367-74 )
Alpha Modification of Eagle’s Medium (Corning, cellgro®, catalog number: 50-012 )
Minimum Essential Medium Alpha Medium (Gibco®, catalog number: 41061-029 )
FCS (MP Biomedicals, catalog number: 2916754 )
L-glutamine (Corning, cellgro®, catalog number: 61-030 )
Penicillin-Streptomycin (Nacalai Tesque, catalog number: 26253-84 )
MS-5 growth media (see Recipes)
OP-9 growth media (see Recipes)
Equipment
Cell sorting machines (BD Biosciences, FACSAriaTM) with the automated cell deposition system
96-well flat bottom plates
10 cm plastic dishes
CO2 incubators
Flow cytometry system
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Stem Cell > Adult stem cell > Stromal cell
Immunology > Immune cell isolation > Lymphocyte
Immunology > Immune cell isolation > Maintenance and differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,046 | https://bio-protocol.org/exchange/protocoldetail?id=1046&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
DNA PCR Assays for Igh Rearrangement
Yusuke Satoh
TS Takao Sudo
Takafumi Yokota
Published: Vol 4, Iss 4, Feb 20, 2014
DOI: 10.21769/BioProtoc.1046 Views: 9863
Reviewed by: Omar Akil
Original Research Article:
The authors used this protocol in Jun 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2013
Abstract
This protocol is used for the detection of immunoglobulin heavy (H) chain rearrangements. This PCR-based assay enables detection of DH-JH recombination in cultured hematopoietic cells (Schlissel et al., 1991; Satoh et al., 2013) [e.g. ES-derived cells (Satoh et al., 2013)].
Materials and Reagents
Mouse spleen cells or ES-derived hematopoietic cells
DNA extraction Kit: PerfectPure DNA Cultured Cell Kit (5 PRIME, catalog number: 2302000 )
10x PCR Buffer with KCl (Life Technologies, Applied Biosystems®, catalog number: 4338856 )
MgCl2 (Life Technologies, Applied Biosystems®, catalog number: 4338856)
Taq DNA polymerase (Life Technologies, Applied Biosystems®, catalog number: 4338856)
dNTPs (Life Technologies, Applied Biosystems®, catalog number: 4338856)
Primers (FASMAC)
The sequence of primers are as follows.
a. DHL(5’): GGAATTCG(AorC)TTTTTGT(CorG)AAGGGATCTACTACTGTG
b. Mu0(5’): CCGCATGCCAAGGCTAGCCTGAAAGATTACC
c. J3(3’): GTCTAGATTCTCACAAGAGTCCGATAGACCCTGG
Agarose (UltraPureTM Agarose) (Life Technologies, InvitrogenTM, catalog number: 16500-100 )
Ethidium bromide (Wako Pure Chemical Industries, catalog number: 315-90051 )
Equipment
PCR Thermal Cycler (Veriti Thermal Cycler) (Life Technologies, Applied Biosystems®)
Centrifuges (TOMY SEIKO, model: MX-150 )
Electrophoresis apparatus (ADVANCE, Mupid-exU)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Antibody analysis > Antibody function
Molecular Biology > DNA > PCR
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,047 | https://bio-protocol.org/exchange/protocoldetail?id=1047&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
An ex vivo Model of HIV-1 Infection in Human Lymphoid Tissue and Cervico-vaginal Tissue
Andrea Introini
CV Christophe Vanpouille
JG Jean Charles Grivel
Leonid Margolis
Published: Vol 4, Iss 4, Feb 20, 2014
DOI: 10.21769/BioProtoc.1047 Views: 14628
Original Research Article:
The authors used this protocol in Feb 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2013
Abstract
Human tissue explants are a valuable tool to study the interactions between host and infectious agents. They reliably mimic many important aspects of tissue cytoarchitecture and functions and allow us the investigation of the mechanisms of microbial pathogenesis under controlled laboratory conditions. One of the advantages of this system is that, unlike isolated cells, infection of tissue blocks with HIV-1 does not require exogenous stimulation with mitogens or activating factors. Here we describe a protocol to infect with HIV-1 human lymphoid tissue from tonsils and cervico-vaginal tissue and maintain them in culture in a non-polarized setting. These ex vivo infected tissues can be used as fruitful models to study HIV-1 pathogenesis and HIV-1 vaginal transmission, respectively, as well as an efficient platform for testing anti-HIV therapeutic and preventative strategies.
Materials and Reagents
Tonsillar tissue obtained from routine tonsillectomy (Age range of patients: 2-10)
Cervico-vaginal tissue obtained from routine hysterectomy (Age range of patients: 35-55)
Gelfoam 12-7 mm adsorbable gelatin sponge (Pfizer, NDC: 0009-0315-08 )
RPMI 1640 (Life Technologies, Gibco®, catalog number: 31870-025 )
100x Modified Eagle's medium (MEM)-nonessential amino acids (10 mM) (Life Technologies, Gibco®, catalog number: 11140-035 )
100x MEM sodium-pyruvate (100 mM) (Life Technologies, Gibco®, catalog number: 11360-070 )
1,000x Gentamicin (50 mg/ml) (Corning, cellgro®, catalog number: 30-005-CR )
100x Fungizone (250 μg/ml, amphotericin B) (Life Technologies, Gibco®, catalog number: 15290-018 )
Fetal bovine serum (FBS) (Gemini Bio-products, catalog number: 100-106 )
Note: We advise testing several lots of serum for culture optimization and use the same lot of FBS for an entire series of experiments. We always test several serum lots on tissues from several donors and select the lot that gives the highest HIV-1 replication. Also, FBS can affect the ability of tissue to secrete cytokines in culture medium.
Phosphate Buffered Saline (PBS) (pH 7.4) (Life Technologies, Gibco®, catalog number: 10010-023 )
Sterile water, cell culture grade (Quality Biological, catalog number: 118-162-101 )
HIV-1 viral preparation(s)
Note: For most of our experiments we use the following viral preparations: HIV-1BaL and HIV-1LAI.04 obtained from the Virology Quality Assurance Laboratory at Rush University (Chicago, IL). Viral stocks were obtained from the clarified culture medium of peripheral blood mononuclear cell cultures inoculated with either HIV-1BaL or HIV-1LAI.04, originally received from the NIH AIDS Reagent Program. HIV-1 p24gag concentrations were 49 ± 3 ng/ml and 53 ± 3 ng/ml for HIV-1BaL and HIV-1LAI.04 stock, respectively. For more viral preparations used in our experimental setting see Introini et al., 2013 and Vanpouille et al., 2012.
Timentin (GlaxoSmithKline, NDC: 0029-6571-26 ) (see Recipes)
Note: Timentin is the commercial name of a mix of the antibiotics ticarcillin and clavulanate that are commercially available as individual reagents. These antibiotics efficiently prevent growth of bacteria that can occasionally contaminate tissue samples after surgery. Penicillin and streptomycin can be used instead of Timentin, although they have different properties. For example, Timentin displays low stability at room temperature or 37 °C (about 24 h) therefore, once added to culture medium, it remains active only for the first day of culture.
Culture medium (CM) (see Recipes)
Equipment
Petri dish (100 mm x 20 mm) (BD, Falcon®, catalog number: 353003 )
Petri dish (150 mm x 25 mm) (BD, Falcon®, catalog number: 353025 )
6-well plates (Corning, Costar®, catalog number: 3506 )
12-well plates (Corning, Costar®, catalog number: 3513 )
5, 10-ml pipettes (BD, Falcon®)
Sealed screw-cap 1.5/2-ml tubes (SARSTEDT AG)
Thermomixer with block for 1.5 ml-tubes (Eppendorf)
Forceps or tweezers
Scalpels and blades nos. 10 and 23
Scissors
Flat weighing metallic spatula
37 °C, 5% CO2 incubator set at 90% humidity
Water bath
10, 50-ml syringe plunger
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Introini, A., Vanpouille, C., Grivel, J. C. and Margolis, L. (2014). An ex vivo Model of HIV-1 Infection in Human Lymphoid Tissue and Cervico-vaginal Tissue. Bio-protocol 4(4): e1047. DOI: 10.21769/BioProtoc.1047.
Introini, A., Vanpouille, C., Lisco, A., Grivel, J. C. and Margolis, L. (2013). Interleukin-7 facilitates HIV-1 transmission to cervico-vaginal tissue ex vivo. PLoS Pathog 9(2): e1003148.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > Ex vivo model
Immunology > Host defense > Human
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,048 | https://bio-protocol.org/exchange/protocoldetail?id=1048&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Lysosomal Amino Acid Efflux Assay
Chunlei Cang
DR Dejian Ren
Published: Vol 4, Iss 4, Feb 20, 2014
DOI: 10.21769/BioProtoc.1048 Views: 9531
Edited by: Lin Fang
Reviewed by: Fanglian He
Original Research Article:
The authors used this protocol in Feb 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2013
Abstract
As the cellular “recycling” organelle, lysosomes break down proteins into amino acids, which are then transported into cytosol for reuse by various amino acid transporters. The transport rate of an amino acid is presumably regulated by cellular conditions such as organelle pH, membrane potential and metabolic states. Because of their intracellular localization and the relative inaccessibility, lysosomal amino acid transporters have been studied largely via indirect measurements. Using lysosome purification and 14C-labeled amino acids, this protocol provides a method to measure the efficiency of specific amino acid transporters on lysosomes.
Materials and Reagents
Mouse liver
14C-labeled amino acids (PerkinElmer) (select the amino acid of your interest)
3 N methanolic HCl (Sigma-Aldrich, catalog number: 33051 )
Anhydrous methanol (Sigma-Aldrich, catalog number: 322415 )
Sucrose
HEPES
MOPS
Na2EDTA
KCl
MgCl2
ATP-Mg
Phosphate buffered saline (PBS)
Scintillation cocktail (Research Products International, catalog number: 111175 )
Protein assay kit (Bio-Rad Laboratories, catalog number: 500-0112 )
Homogenization buffer (HB) (see Recipes)
High sucrose buffer (see Recipes)
Uptake buffer (see Recipes)
Efflux buffer (see Recipes)
Equipment
Nitrogen gas tank (with regulator and connecting tube)
25-ml glass conical flask
1.5 ml and 15 ml tubes
30 G needles
Dounce homogenizer
High speed centrifuge (up to 25,000 x g) with temperature control
Glassfiber filters (Grade GF/F) (Whatman, catalog number: 1825-025 )
Vacuum filtration manifold (EMD Millipore, model: 1225 )
Liquid scintillation counter (Beckman Coulter, model: LS6500 )
Personal protective equipment for working with radioactive materials
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Cang, C. and Ren, D. (2014). Lysosomal Amino Acid Efflux Assay. Bio-protocol 4(4): e1048. DOI: 10.21769/BioProtoc.1048.
Download Citation in RIS Format
Category
Cell Biology > Organelle isolation > Lysosome
Cell Biology > Cell-based analysis > Transport
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,049 | https://bio-protocol.org/exchange/protocoldetail?id=1049&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Chikungunya ELISA Protocol
CB Caitlin Mattos Briggs
AP Amanda Piper
Raquel Hernandez
Published: Vol 4, Iss 4, Feb 20, 2014
DOI: 10.21769/BioProtoc.1049 Views: 9707
Original Research Article:
The authors used this protocol in Jun 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2013
Abstract
This protocol will result in the accurate qualitative measurement of anti-Chikungunya virus antibody (Ab) from infected mouse tissue or serum. This assay was developed by Dr. Caitlin Briggs, Arbovax, Inc. Chikungunya is a BL3 agent and should be handled in a biosafety level 3 laboratory under BL3 conditions. This protocol was used in the publication “Chikungunya virus host range E2 transmembrane deletion mutants induce protective immunity against challenge in C57BL/6J mice” (Piper et al., 2013).
Materials and Reagents
Baby hamster kidney (BHK) cells (ATCC, catalog number: CCL-10 )
Chikungunya Virus (CHIKV)
Potassium tartrate
15% potassium tartrate in Dulbecco’s phosphate buffered saline (PBS-D) (Sigma-Aldrich)
35% potassium tartrate in PBS-D (Sigma-Aldrich)
Micro BCA protein assay kit (Pierce, catalog number: 23235 )
Goat anti-mouse IgG HRP (Sigma-Aldrich, catalog number: A5278 )
ABTS Peroxidase Substrate System (KPL, Kirkegaard & Perry Laboratories, catalog number: 50-62-00 )
Cavicide disinfectant
Bleach
MEM (Life Technologies, catalog number: 11095 )
Sodium carbonate (Sigma-Aldrich)
Sodium bicarbonate (Sigma-Aldrich)
Tween-20 (Fisher Scientific)
Heat Inactivated Fetal Calf Serum (FCS)
Sodium Dodecyl Sulfate (SDS) (Sigma-Aldrich)
Gentamicin sulfate (Life Technologies, catalog number: 15710 )
Potassium chloride (Sigma-Aldrich)
Potassium phosphate (monobasic) (Sigma-Aldrich)
Sodium chloride (Sigma-Aldrich)
Sodium phosphate (dibasic) (Sigma-Aldrich)
Completed 1x MEM (see Recipes)
PBS-D (see Recipes)
Wash Buffer (see Recipes)
Blocking Buffer (see Recipes)
Carbonate Buffer (pH 9.5) (see Recipes)
Equipment
Laminar flow biosafety cabinet
37 °C incubator with 5% CO2
96-well plate reader (405 nm absorbance filter)
96-well Nunc MaxiSorp plate (Thermo Scientific, catalog number: 44-2404 -2)
Microscope
T-75 vented tissue culture flasks (Corning, catalog number: 430641 )
Serological pipettes
Pipet-aid
50 ml conical tubes
Test tube rack
Benchtop centrifuge with removable buckets with gaskets
Weigh scale with 0.01 g sensitivity
Ultra Centrifuge
SW28 rotor and 38 ml and 17 ml buckets
Beckman Ultra Clear centrifuge tubes (25 x 89 mm) (Beckman Coulter, catalog number: 344058 )
Seton centrifuge tubes (16 x 102 mm) (Seton Scientific, catalog number: 7076 )
Small hand held light/flash light
Parafilm
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Briggs, C. M., Piper, A. and Hernandez, R. (2014). Chikungunya ELISA Protocol. Bio-protocol 4(4): e1049. DOI: 10.21769/BioProtoc.1049.
Download Citation in RIS Format
Category
Immunology > Antibody analysis > Antibody-antigen interaction
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,050 | https://bio-protocol.org/exchange/protocoldetail?id=1050&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Mammary Epithelial Cells and Fibroblasts From Mouse Tumor
Shiva Kazerounian
Published: Vol 4, Iss 4, Feb 20, 2014
DOI: 10.21769/BioProtoc.1050 Views: 19907
Edited by: Lin Fang
Reviewed by: Kate HannanFanglian He
Original Research Article:
The authors used this protocol in Jan 2001
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2001
Abstract
Developing cancer therapeutics requires the ability to investigate their effects using in vitro models of a specific type of tumor. This protocol provides a method for the isolation and adoption to growth in culture of cells from primary tumors. This is particularly valuable for studying mouse models where original tumor cells can be evaluated, for example for gene modifications, and subsequently injected back to the same background mice to create more tumors for in vivo efficacy studies.
Keywords: Cell isolation Tumor cell Fibroblast Primary cells
Materials and Reagents
Mouse mammary tumor
DMEM (Life Technologies, Gibco®)
2.5 mg/ml trypsin (0.06 g/25 ml) (Sigma-Aldrich, catalog number: T4799-10G )
5 mg/ml albumin (125 mg/25 ml) (Thermo Fisher Scientific, catalog number: BP1600-100 )
850 units/ml of collagenase type II (0.064 g/25 ml) (Worthington Biochemical, catalog number: 46J8959-A or 4176)
EGF (Pepro Tech, Catalog number: 100-15 )
Penicillin/Streptomycin (Pen/Strep) (Life Technologies, Gibco®)
F12 (Life Technologies, Gibco®)
Gentamycin (50 μg/ml)
Fetal Bovine Serum (Life Technologies, Gibco®)
Insulin (Sigma-Aldrich, catalog number: I1882 )
Hydrocortisone (Sigma-Aldrich, catalog number: H0135 )
Gentamycin (Sigma-Aldrich, catalog number: G1397 )
Digestion buffer (Collagenase solution) (see Recipes)
Wash buffer (see Recipes)
Growth Media (see Recipes)
Equipment
100 mm or 60 mm cell culture plate
Sterile single edged razor blade
Sterile scissors and tweezers
10 ml beaker/flask with a sterile small stirrer bar
Cell strainers (BD, FalconTM Cell Strainers for 50 ml Conical Tubes, 100 μm)
Centrifuge 250 x g
15 ml centrifuge tube
Tissue culture freezer
37 °C with 5% CO2 incubator
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Kazerounian, S. (2014). Isolation of Mammary Epithelial Cells and Fibroblasts From Mouse Tumor. Bio-protocol 4(4): e1050. DOI: 10.21769/BioProtoc.1050.
Download Citation in RIS Format
Category
Cancer Biology > General technique > Animal models
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,051 | https://bio-protocol.org/exchange/protocoldetail?id=1051&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vivo Extravasation Assay
Elisa Penna
Daniela Taverna
Published: Vol 4, Iss 4, Feb 20, 2014
DOI: 10.21769/BioProtoc.1051 Views: 13959
Edited by: Lin Fang
Reviewed by: Fanglian He
Original Research Article:
The authors used this protocol in Jul 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2013
Abstract
Tumor metastases develop when disseminated intravascular cancer cells acquire the ability to arrest by adhering to the capillary walls of distant organs, actively extravasate into their parenchyma, proliferate and establish secondary colonies. The extravasation assay described here is an in vivo technique aimed to analyze the ability of tumor cells to achieve early colonization of the lungs following tail vein injection in mice. Importantly, tumor cells need to be easily visible, therefore either they are fluorescent (e.g. expressing RFP or GFP) or they have to be pre-labelled with a fluorescent tracker prior to injection. Lungs are analyzed at different time points, experimentally determined by the researcher, depending on cell features and malignancy. Generally, an early time point is required to check equal lodging in the pulmonary vasculature for the various cells injected. At one or more later time points (from 6 to 48 h) extravasated cells dispersed in the lung parenchyma are quantitated. With our protocol extravasation is directly evaluated in the whole lungs ex vivo considering cell fluorescence. However, immunofluorescence stainings for endothelial markers and microscopic analyses of lung sections are recommended to evaluate positioning and status of tumor cells (i.e. inside, outside the vessels or associated to them; single cells or clusters). Since extravasation is not only influenced by tumor cell motility but also by their survival ability, the results obtained with this technique should be complemented with proliferation and apoptosis analyses.
Keywords: Metastasis Endothelial cells Tumor cells Melanoma Breast cancer
Materials and Reagents
Tumor cells (in particular, this protocol was set up for A375P, MC-1, MA-2, WK-Mel and B16 melanoma cells and for MDA-MB-231 breast cancer cells)
CD1 athymic nude female mice (6 to 9 week-old)
Phosphate buffered saline (PBS)
Trypsin-EDTA (Life Technologies, Gibco®, catalog number: 15400-054 )
DMSO (Sigma-Aldrich, catalog number: 41648 )
CellTrackerTM Orange CMRA (Life Technologies, Molecular Probes®, catalog number: C34551 ); alternatively tumor cells themselves are required to express red fluorescent protein (RFP)
4% Paraformaldehyde (PFA) in PBS
30% Sucrose in PBS
Freezing resin (Killik, Bio-Optica Milano SpA, catalog number: 05-9801B )
Isopentane
Dry ice
Anti-CD31 antibody (BD Biosciences, catalog number: 550274 ) or alternatively anti-Von Willebrandt Factor antibody (Dako, catalog number: A0082 ) to stain blood vessels
Anti-rat or anti-rabbit Alexa-Fluor-488 secondary antibody (Life Technologies, Molecular Probes®, catalog numbers: A11006 and A11008 )
FBS (Beromed, GmbH)
Serum-free medium (see Recipes)
Complete medium (Life Technologies, Gibco®) (see Recipes)
Equipment
Cell culture set up, laminar flow hood, centrifuge, cell counting chamber
50 ml tubes
P1000 and P200 tips
Mouse housing and handling set up
U-100 syringe with 29 G x 1/2 inch needle
Scissor-handle straight Kelly hemostatic forceps
Fluorescence stereomicroscope (e.g. Leica Microsystems, model: MZ16F )
Cryostat
Fluorescence microscope (e.g. ZEISS AxioObserver with ApoTome Module)
Burker counting chamber (Marienfeld-superior)
Software
Image analysis software (e.g. ImageJ, http://rsbweb.nih.gov/ij/)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cancer Biology > Invasion & metastasis > Animal models
Cell Biology > Cell movement > Cell motility
Cell Biology > Cell imaging > Fixed-tissue imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,052 | https://bio-protocol.org/exchange/protocoldetail?id=1052&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation and Culture of Peritoneal Cell-derived Mast Cells
KV Krisztina V. Vukman
MM Martin Metz
MM Marcus Maurer
SO Sandra M. O’Neill
Published: Vol 4, Iss 4, Feb 20, 2014
DOI: 10.21769/BioProtoc.1052 Views: 15772
Original Research Article:
The authors used this protocol in Mar 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2013
Abstract
The generation of mast cells for in vitro studies comes from a variety of sources including mast cell lines (MC/9) (McCurdy et al., 2001), bone marrow-derived mast cells (BMMCs) (Supajatura et al., 2001), skin-derived mast cells (FSMCs) (Matsushima et al., 2004), peritoneal-derived mast cells (PMCs) (Hochdorfer et al., 2011) and peritoneal cell-derived cultured mast cells (PCMCs) (Vukman et al., 2012). PCMCs are generally used for in vitro studies because they are a more mature source of mast cells when compared to mast cells generated or obtained from other sources. They can differ, for example, in their pro-inflammatory responses to bacterial antigens and toll like receptors (TLRs) ligands (Mrabet-Dahbi et al., 2009). In comparison to BMMCs [see the protocol “Isolation and Culture of Bone Marrow-derived Mast Cells” (Vukman et al., 2014)] or mast cell lines they express a wider range of TLRs, and secrete significantly more cytokines when stimulated with TLR ligands (Mrabet-Dahbi et al., 2009). Therefore, when examining pro-inflammatory responses, mast cells generated from cells obtained from the peritoneal cavity give stronger responses. PCMCs can also be generated from knockout and transgenic mice making them a good source to examine specific factors important for mast cell function. However, due to the low yield of cells generated using this method (1 million per mouse) their use is restricted and therefore in most studies more than one source of mast cells may be required. The different sources of mast cells can display phenotypical and functional differences and therefore it is important that when designing an experiment, the correct cellular source is obtained. Here, we describe a protocol for the isolation and culture of murine mast cells from peritoneal cavity cells.
Keywords: Mast cells Peritoneal cavity Peritoneal lavage Cell culture
Materials and Reagents
C57BL/6 mice or mouse model of choice (Harlan Laboratories, catalog number: 057 ; Charles River Laboratories International, catalog number: BLCSIFE49D )
Industrial methylated spirit (IMS) (Lennox Laboratory Supplies, catalog number: CRTS10330716 )
Sterile phosphate buffered saline (PBS) (Life Technologies, Gibco®, catalog number: 14190 )
RPMI 1640 medium (Life Technologies, Gibco®, catalog number: 31870 )
Fetal calf serum (FCS) (Life Technologies, Gibco®, catalog number: 10270 )
Penicillin/streptomycin (Life Technologies, Gibco®, catalog number: 15140 )
2-Mercapto-ethanol (Sigma-Aldrich, catalog number: M3148 )
L-glutamine (Sigma-Aldrich, catalog number: G7513 )
Recombinant stem cell factor (SCF) (Sigma-Aldrich, catalog number: S9915 )
Recombinant mouse interleukin-3 (IL-3) (Merck KGaA, catalog number: 407631 )
Trypan blue stain (Sigma-Aldrich, catalog number: T8154 )
APC-conjugated c-kit (eBioscience, catalog number: 17-1171 )
Fitc congugted-FcεRI (eBioscience, catalog number: 11-5898 )
Complete RPMI (see Recipes)
Growth factors (see Recipes)
Kimura dye (see Recipes)
Toluidine blue solution (see Recipes)
Saturated saponin (see Recipes)
NaH2PO4 solution (see Recipes)
Equipment
Sterile forceps
Sterile scissors
Sterile pipette
Syringe (10 ml)
Needle (19-gauge)
Falcon tube (15 or 50 ml)
Water bath
pH meter
Centrifuge
37 °C, 5% CO2 incubator
T25 Cell culture flask (SARSTEDT AG, catalog number: 83.1810.502 )
Haemocytometer
Safety cabinet
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Vukman, K. V., Metz, M., Maurer, M. and O’Neill, S. M. (2014). Isolation and Culture of Peritoneal Cell-derived Mast Cells. Bio-protocol 4(4): e1052. DOI: 10.21769/BioProtoc.1052.
Download Citation in RIS Format
Category
Immunology > Immune cell isolation > Mast cell
Cell Biology > Cell isolation and culture > Cell isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,053 | https://bio-protocol.org/exchange/protocoldetail?id=1053&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation and Culture of Bone Marrow-derived Mast Cells
KV Krisztina V. Vukman
MM Martin Metz
MM Marcus Maurer
SO Sandra M. O’Neill
Published: Vol 4, Iss 4, Feb 20, 2014
DOI: 10.21769/BioProtoc.1053 Views: 21655
Original Research Article:
The authors used this protocol in Mar 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Mar 2013
Abstract
The generation of mast cells for in vitro studies comes from a variety of sources including mast cell lines (MC/9) (McCurdy et al., 2001), bone marrow-derived mast cells (BMMCs) (Supajatura et al., 2001), skin-derived mast cells (FSMCs) (Matsushima et al., 2004), peritoneal-derived mast cells (PMCs) (Hochdorfer et al., 2011) and peritoneal cell-derived cultured mast cells (PCMCs) (Vukman et al., 2012). BMMCs are generally used for in vitro studies because of the high yield of mast cells generated and also because they can be generated from knockout and transgenic mice making this a good source to examine specific factors important for mast cell function. Due to the large yield of cells generated they are the cells of choice for reconstitution studies in mast cell knockout mice (Sur et al., 2007). Furthermore, they are more responsive to both allergic and non-allergic stimuli when compared to mast cell lines. The major disadvantage of BMMCs is that they are not fully matured when compared to mast cells generated or obtained from other sources. For example, compared to PCMCs [see the protocol “Isolation and Culture of Peritoneal Cell-derived Mast Cells” (Vukman et al., 2014)], BMMCs express a restricted range of TLRs and cytokines when stimulated with TLR ligands (Mrabet-Dahbi et al., 2009). The different sources of mast cells can display phenotypical and functional differences and therefore it is important that when designing an experiment the correct cellular source is obtained. Here, we describe a protocol for the isolation and culture of murine mast cells from mouse bone marrow.
Keywords: Mast cells Cell culture Primary cells Bone marrow WEHI-3
Materials and Reagents
C57BL/6 mice or mouse model of choice (Harlan Laboratories, catalog number: 057 ; Charles River Laboratories International, catalog number: BLCSIFE49D )
Industrial methylated spirit (IMS) (Lennox Laboratory Supplies, catalog number: CRTS10330716 )
WEHI-3 conditioned medium generated from WEHI-3 cell line (ATCC, catalog number: TIB68 )
Sterile phosphate buffered saline (PBS) (Life Technologies, Gibco®, catalog number: 14190 )
IL-3 (BioLegend, catalog number: 432101 )
IMDM with L-glutamine (Life Technologies, Gibco®, catalog number: 12440 )
Fetal calf serum (FCS) (Life Technologies, Gibco®, catalog number: 10270 )
Penicillin/streptomycin (Life Technologies, Gibco®, catalog number: 15140 )
Mercapto-ethanol (Sigma-Aldrich, catalog number: M3148 )
Trypan blue stain (Sigma-Aldrich, catalog number: T8154 )
Complete IMDM (see Recipes)
Growth factors (see Recipes)
Kimura dye (see Recipes)
Equipment
Sterile forceps
Sterile scissors
Sterile pipette
Syringe (10 ml)
Needle (19-, 21- and 27-gauge)
Falcon tube (50 ml)
Cell scraper (SARSTEDT AG, catalog number: 83.183 0)
Filtropur S 0.45 filter (SARSTEDT AG, catalog number: 83.1826 )
Petri dishes (100 x 20 mm)
PD100 petri dish
Water bath
Centrifuge
T75 Cell culture flask (SARSTEDT AG, catalog number: 83.1813.502 )
T175 Cell culture flask (SARSTEDT AG, catalog number: 83.1812.502 )
Haemocytometer
Safety cabinet
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Vukman, K. V., Metz, M., Maurer, M. and O’Neill, S. M. (2014). Isolation and Culture of Bone Marrow-derived Mast Cells. Bio-protocol 4(4): e1053. DOI: 10.21769/BioProtoc.1053.
Download Citation in RIS Format
Category
Immunology > Immune cell isolation > Mast cell
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,054 | https://bio-protocol.org/exchange/protocoldetail?id=1054&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Detection of Transposable Element Insertion Site Polymorphisms by Sequence-Specific Amplification Polymorphism (SSAP)
VS Véronique Sarilar
PP Paulina Martinez Palacios
KA Karine Alix
Published: Vol 4, Iss 5, Mar 5, 2014
DOI: 10.21769/BioProtoc.1054 Views: 10656
Edited by: Tie Liu
Original Research Article:
The authors used this protocol in Apr 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2013
Abstract
Transposable elements represent a major part of any eukaryotic genomes. Notably in plants they can account for more than 80% of the whole genomic sequence (such as in maize). Due to their mobility across the genome, they can act as mutagens but can also be considered as an important source of genetic diversity. It has been shown that they may be activated following various stresses, and it has been assumed that they may contribute to genome evolution and adaptation. Molecular methods have thus been proposed to allow identification of new transposition events, or more generally to tag transposable element insertion site polymorphisms. Sequence-Specific Amplification Polymorphism (SSAP) is a high throughput method derived from AFLP, which has been first tested on the barley genome (Waugh et al., 1997). Its efficiency in tagging TEs in comparison to AFLP is based on the use of specific primers anchored in the TE sequences of interest, requiring the TEs under survey to be previously characterized. SSAP can thus be used to identify any genomic reorganization in the vicinity of TE insertion sites, and still represents an efficient approach to analyse evolutionary dynamics of TEs.
Keywords: Allopolyploidy Transposon PCR-based polymorphism LTR-retrotransposon
Materials and Reagents
Restriction of genomic DNA using endonucleases
Genomic DNAs from the samples to be analysed at concentrations of 100 ng/µl.
Endonuclease enzyme insensitive to DNA methylation, generating cohesive ends
Note: TE sequence ends have to be devoid of any corresponding restriction sites.
Adapter ligation
Two oligonucleotides which form a double-stranded adapter, with an overhang complementary to the overhang left by the restriction enzyme used. In the case of EcoRI (Thermo Fisher Scientific, Fermentas) the 5’ overhang is AATT and the oligonucleotide sequences are 5’-CTCGTAGACTGCGTACC-3’ and 5’-AATTGGTACGCAGTCTAC-3’. Annealing of the two oligonucleotides will constitute the adapter (purple rectangles in Figure 1).
T4 DNA ligase (1-3 U/μl) with the corresponding ligase buffer (Promega Corporation, catalog number: M1801 )
Sterile ultrapure water
Pre-amplification
PCR reagents
Homemade Taq DNA polymerase is of sufficient quality for the PCR reactions but Taq Promega has also been used (Promega corporation, catalog number: M8301 ) with the corresponding Taq polymerase buffer.
25 mM MgCl2
dNTPs (10 µM each)
Pre-amplification primers (10 μM each)
One primer is anchored in the adapter: 5’-GACTGCGTACCAATTC-3’ (primer P1 in Figure 1).
The other primer is anchored in the TE of interest, close to its end to limit the size of amplicon (primer P2 in Figure 1).
Selective amplification
PCR reagents (see pre-amplification step)
Selective amplification primers (10 μM each)
One primer is anchored in the adapter, with the addition of 3 nucleotides at the 3’ end (primer P3 in Figure 1) to limit the number of bands to be visualized and analyzed by gel electrophoresis. Several combinations of A, T, G and C should be used to target different genomic localizations of TE insertion sites.
The other primer is defined to perform a nested PCR in comparison with the pre-amplification step (primer P4 in Figure 1); this primer is labelled with a 5’-IRDye. DNA labelled with IRDye (infrared dye) has to be stored in the dark at -20 °C. To minimize exposure to light, wrap the tube in aluminium foil.
Acrylamide gel for SSAP profile analysis
Kimwipes
Urea (Merck KGaA, catalog number: 1.08488.1000 )
Long Ranger Acrylamide (50%) (Lonza, catalog number: 50611 )
APS (Bio-Rad Laboratories, catalog number: 161-0700 )
Temed (Bio-Rad Laboratories, catalog number: 161-0801 )
Absolute ethanol
Formamide (Sigma-Aldrich, catalog number: F9037 )
10x TBE buffer (Tris/Borate/EDTA) (see Recipes)
5.5% acrylamide gel (see Recipes)
Loading buffer (see Recipes)
Equipment
1.5 ml Eppendorf tubes
Centrifuge
Parafilm
Incubator or oven
Water bath
96-well PCR plates
0.45 μm filters
LI-COR DNA analyzer (LI-COR) and corresponding equipment (plates, combs, spacers...)
Thermal cycler
Horizontal shaker
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Plant Science > Plant molecular biology > DNA
Systems Biology > Genomics > Transposons
Molecular Biology > DNA > Genotyping
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,055 | https://bio-protocol.org/exchange/protocoldetail?id=1055&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cyclic Nucleotide (cAMP and cGMP) Assays and Capture ELISA for Quantitative Analysis of Plasmodium falciparum Blood-stage Egress
FH Fiona Hackett
CC Christine R Collins
MS Malcolm Strath
Michael J Blackman
Published: Vol 4, Iss 5, Mar 5, 2014
DOI: 10.21769/BioProtoc.1055 Views: 10282
Original Research Article:
The authors used this protocol in May 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2013
Abstract
Upon rupture of Plasmodium falciparum (P. falciparum) schizonts in vitro (an event known as egress), merozoites are released into the culture medium. The merozoites invade fresh red blood cells, a process that involves shedding of a microneme protein called apical membrane antigen-1 (AMA1) from the merozoite surface. This shedding, which takes place even in the absence of invasion, is therefore a surrogate marker for the degree of egress taking place in a culture, and can be measured using a specific capture ELISA to quantify AMA1 levels in culture supernatants (Collins et al., 2013). The assay uses a monoclonal antibody specific for AMA1 (called 4G2dc1) (Kocken et al., 1998; Collins et al., 2009) to capture and immobilize the protein from culture supernatants, then uses a specific rabbit polyclonal antiserum to detect the immobilized antigen. A phosphatase-conjugated goat anti-rabbit antibody is finally used to quantify the binding of the second antibody. Egress is absolutely dependent upon the activity of a parasite cGMP-dependent protein kinase, PKG, and so is influenced by levels of intracellular cGMP (Collins et al., 2013). This is regulated by the interplay between guanylate cyclases and phosphodiesterases. The latter enzymes may also degrade cAMP, so it may also be informative to measure intracellular cAMP levels.
Materials and Reagents
Plasmodium falciparum schizonts
DetectX Direct cGMP or cAMP immunoassay kit (Arbor Assays, catalog number: K020-H1 or K019-H1 )
Protein-free RPMI 1640 (Life Technologies, InvitrogenTM)
Albumax
Zaprinast (Sigma-Aldrich, catalog number: Z0878 )
Note: Make up as a 50 mM stock solution in DMSO and stored at -20 °C.
PKG inhibitor compound 1 {4-[2-(4-fluorophenyl)-5-(1-methylpiperidine-4-yl)-1H-pyrrol-3-yl] pyridine} (Merck KGaA)
Note: Make up as a 10 mM stock solution in DMSO and stored at -20 °C.
Anti-AMA1 monoclonal antibody (clone 4G2dc1) (Kocken et al., 1998)
Complete RPMI 1640 culture medium (Blackman, 1994)
Tween 20
Rabbit polyclonal anti-AMA1 serum (Collins et al., 2009)
Phosphatase-conjugated goat anti-rabbit IgG (whole molecule) (Sigma-Aldrich, catalog number: A3687 )
Phosphatase substrate (Sigma-Aldrich, catalog number: S0942 )
Phosphate-buffered saline (PBS)
Sodium azide [10% (w/v) stock solution in water]
Dry ice-ethanol mix for freezing
Gelatine-tween stock solution (blocking buffer) (see Recipes)
0.1 M Sodium carbonate/bicarbonate (pH 9.6) (see Recipes)
Diethanolamine buffer (pH 9.8) (see Recipes)
Equipment
Centrifuge
96-well Immulon plates (Nunc®)
ELISA reader
Incubator
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Immunodetection
Biochemistry > Other compound > cAMP
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,056 | https://bio-protocol.org/exchange/protocoldetail?id=1056&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
TRIPLE (Insulin, Glucagon and EGFP) Immunofluorescence Staining Protocol in Pancreas
WC Woogyun Choi
Randal J. Kaufman
Sung Hoon Back
Published: Vol 4, Iss 5, Mar 5, 2014
DOI: 10.21769/BioProtoc.1056 Views: 15065
Edited by: Lin Fang
Reviewed by: Fanglian He
Original Research Article:
The authors used this protocol in May 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2013
Abstract
This protocol aims to introduce methods for immunostaining two endogenous proteins insulin and glucagon and one exogenous transgene driven EGFP in mouse pancreatic islet. The immunostaining results of insulin and glucagon indirectly tell functionality of pancreatic beta cells and alpha cells respectively. Furthermore, the protocol provides immunostaining steps for the third protein which can be applicable to any other endogenous proteins with a specific antibody generated in mouse.
Materials and Reagents
Mouse pancreas
Ethanol (100%, 95%, 85%, 70%, 50%)
0.85% NaCl
ddH2O
99.5% Xylene (Sigma-Aldrich, catalog number: 534056 )
10% Formalin solution (neutral buffered) (Sigma-Aldrich, catalog number: HT501128 )
Bovine Serum Albumin (BSA) (Sigma-Aldrich, catalog number: A7906 )
Tween 20 (Sigma-Aldrich, catalog number: P9416 )
Triton-X 100 (Sigma-Aldrich, catalog number: T8787 )
Guinea pig anti-insulin antibody (Millipore, catalog number: 4011-01F )
Rabbit anti-glucagon antibody (Millipore, catalog number: 4030-01F )
Mouse anti-EGFP antibody (Clonetech, catalog number: 632381 )
Texas Red conjugated donkey anti-guinea pig antibody (Jackson ImmunoResearch Laboratories, catalog number: 106-075-003 )
Alexa 350 conjugated goat anti-rabbit antibody (Life Technologies, InvitrogenTM, catalog number: A-21068 )
FITC conjugated goat anti-mouse antibody (Jackson ImmunoResearch Laboratories, catalog number: 715-095-166 )
ProLong Gold Antifade Reagent (Life Technologies, InvitrogenTM, catalog number: P36935 )
10x PBS (Gibco®, catalog number: 70011-044 )
Blocking solution (see Recipes)
Equipment
Glass jar
Humidified chamber
Confocal microscope
Tissue cassette
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Cell Biology > Cell imaging > Fluorescence
Biochemistry > Protein > Immunodetection
Cell Biology > Cell staining > Protein
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,057 | https://bio-protocol.org/exchange/protocoldetail?id=1057&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
VIGS Assays
HZ Haili Zhang
Yule Liu
Published: Vol 4, Iss 5, Mar 5, 2014
DOI: 10.21769/BioProtoc.1057 Views: 28061
Edited by: Feng Li
Original Research Article:
The authors used this protocol in Apr 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2013
Abstract
Virus-induced gene silencing (VIGS) is a powerful method to study gene function in plants. Tobacco rattle virus (TRV)-based VIGS vector is the most efficient VIGS vector so far. This method was originally developed by the Dinesh-Kumar's group (Liu et al., 2002) . Here, we describe a rapid and high efficient TRV-based VIGS method for knocking down genes in Nicotiana benthamiana. For TRV-based VIGS, Agrobacterium culture containing pTRV1 and Agrobacterium culture containing pTRV2 with plant target gene fragment are mixed and infiltrated into the lower leaves of plant. After 2-3 weeks post infiltration, plant target gene will be silenced.
Materials and Reagents
6-leaf-stage Nicotiana benthamiana plants
Note: Nicotiana benthamiana can be obtained from our lab (Figure 1).
Figure 1. 6-leaf-stage Nicotiana benthamiana plant
Bacteria strains
a. Escherichia coli strains, such as DH5α
b. Agrobacterium strains, such as GV3101
Note: All strains were obtained from our lab.
pTRV1 and pTRV2-LIC based expression vectors (Dong et al., 2007)
pTRV1: a T-DNA vector containing duplicated CaMV 35S promoter, NOS terminator and cDNA clone of TRV RNA1 of Ppk20 strain.
pTRV2-LIC: a T-DNA vector containing duplicated CaMV 35S promoter, NOS terminator and cDNA clone of TRV RNA2, of which non-structural genes were replaced by a multiple cloning site (MCS).
pTRV2-NbPDS: gene fragement of NbPDS was inserted at MCS into pTRV2-LIC. This construct was usually used as a control to show the successful gene silencing.
pTRV1 (ABRC, catalog number: CD3-1039 ) and pTRV2-LIC (ABRC, catalog number: CD3-1042 ) could be ordered at http://www.arabidopsis.org/abrc/catalog/vector_3.html.
Media for Agrobacteria
Liquid Luria-Bertani (LB) medium
Solid LB plates with 0.12% agar
Note: LB medium is autoclaved under 120 °C for 20 min.
Antibiotics
a. Kanamycin
b. Rifampicin
c. Gentamicin
Easy Taq DNA polymerase (Beijing TransGen Biotech)
dNTP (Roche)
TIANprep Mini Plasmid Kit (Beijing TransGen Biotech)
MgCl2 (Sigma-Aldrich)
MES (AMRESCO)
Acetosyringone (Sigma-Aldrich)
DMSO (AMRESCO)
Infiltration buffer (see Recipes)
Equipment
Centrifuge tubes
Plant growth chamber (24 °C, 16 h photoperiod conditions, 50% huminity)
Sterile 1 ml syringe without needle
Sterile bacterial culture tubes
Centrifuge
PCR instrument
37 °C and 28 °C incubators with shaking
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zhang, H. and Liu, Y. (2014). VIGS Assays. Bio-protocol 4(5): e1057. DOI: 10.21769/BioProtoc.1057.
Download Citation in RIS Format
Category
Plant Science > Plant molecular biology > RNA
Molecular Biology > RNA > RNA interference
Plant Science > Plant immunity > Disease bioassay
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,058 | https://bio-protocol.org/exchange/protocoldetail?id=1058&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Protein Sample Preparation for Proteomic Analysis in Leishmania donovani
Alexandros Alexandratos
DS Despina Smirlis
Published: Vol 4, Iss 5, Mar 5, 2014
DOI: 10.21769/BioProtoc.1058 Views: 10522
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in Jun 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2013
Abstract
Leishmania is a genus of trypanosomatid protozoa and is the parasite responsible for the disease leishmaniasis. These protozoa, regulate their gene expression in an atypical way, compared to other higher eukaryotes. The regulation of gene expression is characterized by a predominance of post-transcriptional over pre-transcriptional regulatory mechanisms (Clayton, 2002). Thus proteomic analysis has proven an essential tool for understanding pathways implicated in Leishmania infectivity, host-parasite interactions, drug resistance and others. When employing a comparative proteomics analysis between different parasitic cell lines, it is essential that these lines are cultivated in exactly the same way, in the same cell density and growth phase. More importantly when cell-cycle defects are suspected, it is essential to synchronize cell-lines in the same cell-cycle phase so as to eliminate possible artifacts. This protocol describes the preparation of whole-protein samples for proteomic analysis in Leishmania donovani (L. donovani).
Keywords: Leishmania Proteomics Sample preparation
Materials and Reagents
Leishmania donovani (L. donovani) parasites
Glucose (Sigma-Aldrich, catalog number: G8270 )
Hydroxyurea (Sigma-Aldrich, catalog number: H8627 )
RPMI-1640 (Life Technologies, catalog number: 21875-034 )
Fetal Bovine Serum heat inactivated (HIFBS) (Life Technologies, catalog number: 10270-106 )
Penicillin/Streptomycin (Life Technologies, catalog number: 15140-122 )
HEPES buffer (Life Technologies, catalog number: 15630-056 )
Dry ice
Ethanol
E-64 (Sigma-Aldrich, catalog number: E3132 )
CHAPS (Sigma-Aldrich, catalog number: 26680 )
ASB-14 (Sigma-Aldrich, catalog number: A1346 )
DTT (Sigma-Aldrich, catalog number: 43815 )
Bio-Lyte® 3/10 Ampholyte (Bio-Rad Laboratories, catalog number: 163-2094 )
Urea (Sigma-Aldrich, catalog number: U5378 )
Thiourea (Sigma-Aldrich, catalog number: T7875 )
Bromophenol blue (Bio-Rad Laboratories, catalog number: 161-0404 )
Phosphate Buffered Saline (PBS) (see Recipes)
Lysis Buffer (see Recipes)
Rehydration Buffer (see Recipes)
Fully supplemented medium (see Recipes)
Equipment
Pipette
Centrifuge
Spiramix
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Alexandratos, A. and Smirlis, D. (2014). Protein Sample Preparation for Proteomic Analysis in Leishmania donovani. Bio-protocol 4(5): e1058. DOI: 10.21769/BioProtoc.1058.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Systems Biology > Proteomics > Whole organism
Microbiology > Microbial proteomics > Whole organism
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,059 | https://bio-protocol.org/exchange/protocoldetail?id=1059&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
IP-Kinase Assay
PC Pearl A. Campbell
Published: Vol 4, Iss 5, Mar 5, 2014
DOI: 10.21769/BioProtoc.1059 Views: 21454
Original Research Article:
The authors used this protocol in Jun 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2013
Abstract
Immunoprecipitation (IP)- Kinase assays are an invaluable tool to assess the activation status of intracellular signaling cascades within a specific cellular state and also to confirm the enzymatic activity of a specific kinase towards a putative substrate of interest. Intracellular signal transduction cascades play an important role in modulating the localization of transcription factors and thus impact the cellular transcriptome. This in turn regulates key cell fate decisions including cell survival, apoptosis, proliferation, and differentiation. Here we describe an in vitro non-radioactive method to assess kinase activity towards a specific substrate. In this protocol we outline the method for Akt, however the basic protocol may be applied to any kinase and putative substrate of interest.
Keywords: Pluripotency Kinase In-vitro assay Akt Stem cells
Materials and Reagents
Recombinantly produced substrate of interest
For this study, full-length murine Oct4 was cloned into a mammalian expression vector containing a T3 promoter sequence and a carboxy-terminal 6X His – TEV – 3X FLAG epitope tage.
TnT Coupled Reticulocyte Lysate Systems (Promega Corporation, catalog number: L5010 )
Expression vector (with Sp6, T3, or T7 promoter sequence) containing protein of interest (Test Substrate) wild-type, putative mutant, empty vector control. You will also need a vector containing a previously confirmed (and published) target substrate if one is not commercially available to use as a control for the kinase assay.
Transcend tRNA (Promega Corporation, catalog number: L5061 )
RNaseOUT (Life Technologies, catalog number: 10777019 )
Cell line which exhibits activity for kinase of interest
SDS polyacrylamide gel
Polyvinyl difluoride membrane (PVDF) (Bio-Rad Laboratories, catalog number: 162-0177 )
Primary Antibody to Test and Control Substrates
Akt (total) (Cell Signaling Technology, catalog number: 4685 )
Phospho-Akt Substrate Antibody (Cell Signaling Technology, catalog number: 10001 )
Gsk3 (total) (Cell Signaling Technology, catalog number: 5676 )
Kinase agonist (if required) to augment kinase activity
This protocol uses Ro-31-8220 (Sigma-Aldrich, catalog number: R136-5MG ) as an Akt agonist
Non-radioactive Akt Kinase Assay Kit (Cell Signaling Technology, catalog number: 9840 )
Immobilized Phospho-Akt (Ser473) (D9E) Rabbit mAb (Bead Conjugate)
Phospho-GSK-3 (Ser21/9) (37F11) Rabbit mAb
GSK-3 Fusion Protein at 0.5 mg/ml
10 mM ATP (50 µl)
Bead conjugated primary antibody or primary antibody and Protein A/G Agarose (Pierce Antibodies)
Phenyl methlsulfonyl fluoride (PMSF) (Sigma-Aldrich)
1x Cell Lysis Buffer (see Recipes)
1x Kinase Buffer (see Recipes)
3x SDS Sample Buffer (see Recipes)
Equipment
Mini-Western/Transfer Apparatus (Bio-Rad Laboratories)
10 cm plates
Cell scraper
1.5 ml microfuge tube
Refrigerated microfuge
Microfuge tube rotator
Heat blocks set to 30 and 95 °C
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Campbell, P. A. (2014). IP-Kinase Assay. Bio-protocol 4(5): e1059. DOI: 10.21769/BioProtoc.1059.
Download Citation in RIS Format
Category
Cell Biology > Cell signaling > Phosphorylation
Biochemistry > Protein > Immunodetection
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,060 | https://bio-protocol.org/exchange/protocoldetail?id=1060&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Alkaline Phosphatase Staining
PC Pearl A. Campbell
Published: Vol 4, Iss 5, Mar 5, 2014
DOI: 10.21769/BioProtoc.1060 Views: 29799
Original Research Article:
The authors used this protocol in Jun 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2013
Abstract
Two main features characterize pluripotent cells; self-renewal (unlimited cell division) and the ability to give rise to all cells of the adult organism. Given the recent impact of induced pluripotent stem cells (iPSCs) and ongoing use of pluripotent embryonic stem cells ESCs (ESCs) in basic discovery, drug development, and potential use for stem cell therapy and regenerative medicine, methods to definitively distinguish pluripotent cells from their differentiated derivatives are required. This will allow us to better understand the factors that promote their survival, self-renewal, and lineage-specific differentiation.
Undifferentiated embryonic stem cells (ESCs) and induced pluripotent stem cells (iPSCs) may be identified through the use of biomarker and functional assays. Biomarker assays include those for transcript and protein expression of important pluripotency transcription factors (OCT4, SOX2, and NANOG), cell surface markers (SSEA-1, -3, and -4; TRA-1-60, TRA-1-81), and Alkaline Phosphatase (AP) activity (Brambrink et.al., 2008; Ginis et al., 2004). Functional assays include: (1) the ability to generate teratomas consisting of cells from all three germ layers (endoderm, ectoderm, and mesoderm) when transplanted into immunodeficient mice or upon in vitro differentiation; (2) the ability to generate a chimera; and (3) germline transmission (Marti et al., 2013; Buehr et al., 2008). The latter two tests are ethically feasible only for mouse and other non-human pluripotent cells.
In this protocol (Campbell and Rudnicki, 2013) we describe a rapid method to screen for pluripotent cells by AP activity. AP, also known as Basic Phosphatase catalyzes the dephosphorylation of many molecules including nucleotides and proteins. AP activity is high in pluripotent cells but is greatly decreased in more differentiated cell types. The technique described herein may be used to enumerate pluripotent cells during differentiation in the presence or absence of specific genetic manipulations or small chemical modulators. It may also be used to monitor induced pluripotency using defined factors from more differentiated cell types.
Keywords: Pluripotency Oct4 Stem cells Alkaline phosphatase In vitro assay
Materials and Reagents
Mouse ESCs (mESCs)
0.1% gelatin (Sigma-Aldrich, catalog number: G1393 )
Murine embryonic fibroblast (MEF) feeder cells
Alkaline Phosphatase Staining Kit (Stemgent, catalog number: 00-0009 )
Fixation Solution
AP Staining Solution A
AP Staining Solution B
1x PBS (see Recipes)
1x PBS-T (see Recipes)
1x PBS-glycerol (see Recipes)
Equipment
6-well plate or 24-well plate
Aluminum foil
Light microscope with 10x objective
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Campbell, P. A. (2014). Alkaline Phosphatase Staining . Bio-protocol 4(5): e1060. DOI: 10.21769/BioProtoc.1060.
Download Citation in RIS Format
Category
Stem Cell > Embryonic stem cell > Cell staining
Cell Biology > Cell staining > Whole cell
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,061 | https://bio-protocol.org/exchange/protocoldetail?id=1061&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Co-immunoprecipitation of Flag-TLR3 or Myc-MSR1 with HCV RNA
DY Daisuke Yamane
HD Hiromichi Dansako
SL Stanley M. Lemon
Published: Vol 4, Iss 5, Mar 5, 2014
DOI: 10.21769/BioProtoc.1061 Views: 9704
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in May 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2013
Abstract
Co-immunoprecipitation assay of TLR3-Flag or Myc-MSR1 with HCV RNA is used to identify direct interaction of viral RNA with host proteins that recognize viral RNA to initiate interferon (IFN) signaling, a crucial antiviral response of the host cells. Both Toll-like receptor 3 (TLR3) and class-A scavenger receptor type 1 (MSR1) proteins recognize viral double-stranded RNA (dsRNA) which may be released into the extracellular milieu or spread from HCV-infected cells to uninfected neighbor cells via cell-to-cell contact, resulting in IFN-β activation that restricts viral propagation. We have found that MSR1 binds extracellular dsRNA, mediating its endocytosis and transport toward the endosome where it is engaged by TLR3, thereby triggering IFN responses in both infected and uninfected cells. We used this assay to demonstrate the pivotal role of MSR1 in mediating TLR3-recognition of the HCV RNA. The assay described in this protocol is based on the conventional protein immunoprecipitation protocol with conditioned buffers that prevent nonspecific RNA degradation by RNase present in the lysate. RNA molecules associated with the Flag-tagged protein were trapped by a specific antibody followed by Protein G capture, extracted and detected quantitatively by RT-PCR assay, followed by agarose-gel electrophoresis for visualization. This method can also be applied to detection of other protein-RNA interactions.
Keywords: PAMP receptor Toll-like receptor Viral RNA Interferon signaling adaptor molecule Scavenger receptor
Materials and Reagents
Huh-7.5 cells (obtained from Apath, LLC) expressing TLR3-Flag (or other cells stably/transiently expressing Flag/Myc-tagged protein)
DMEM (Life Technologies, catalog number: 11995065 )
10% heat-inactivated FBS (Life Technologies, catalog number: 26140079 )
Penicillin-streptomycin (Life Technologies, catalog number: 15140-148 )
L-Glutamine (Life Technologies, catalog number: 25030-081 )
Non-essential amino acids (Life Technologies, catalog number: 11140050 )
HCV strain HJ3-5 stock prepared in cell culture medium (see Reference 2)
DPBS (Life Technologies, catalog number: 14190-144 )
RNase inhibitor (RNaseOUT) (Life Technologies, catalog number: 10777-019 )
Protease inhibitor (Complete Protease Inhibitor Cocktail Tablets) (Roche Diagnostics, catalog number: 1697498 )
Triton X-100 (Sigma-Aldrich, catalog number: T9284 )
Anti-Flag (M2) and anti-Myc (9E10) monoclonal antibodies (Sigma-Aldrich, catalog numbers: F1804 and M4439 ) and mouse IgG control (Life Technologies, catalog number: 02-6502 )
Protein G sepharose (General Electric Company , catalog number: 17-0618-01 )
TRIzol (Life Technologies, catalog number: 15596-026 )
Molecular biology grade water (Corning, catalog number: 46-000-CM )
Agarose (GenePure LE Agarose) (BioExpress, GeneMate, catalog number: E-3120-500 )
Protein Assay Dye Reagent Concentrate (Bio-Rad Laboratories, catalog number: 500-0006 )
Platinum® Taq DNA Polymerase (Life Technologies)
Culture medium (see Recipes)
Lysis buffer (see Recipes)
Equipment
100 mm plates (FalconTM, catalog number: 353003 )
Cell scraper (FalconTM, catalog number: 353085 )
Electrophoresis Gel Box
Tube Rotator (Fisher Scientific, catalog number: 05-450-200 )
Centrifuge (Eppendorf, catalog number: 5415R )
Superscript III One-step RT-PCR system (Life Technologies, catalog number: 12574-018 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > RNA > RNA-protein interaction
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,062 | https://bio-protocol.org/exchange/protocoldetail?id=1062&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of Haemolysin Activities in Vibrio vulnificus
HL Hyun-Jung Lee
JK Jeong-A Kim
ML Mi-Ae Lee
SP Soon-Jung Park
KL Kyu-Ho Lee
Published: Vol 4, Iss 5, Mar 5, 2014
DOI: 10.21769/BioProtoc.1062 Views: 7940
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in May 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2013
Abstract
VvhA produced by Vibrio vulnificus exhibits cytolytic activity to human cells including erythrocytes. Since haemolysis by VvhA may provide iron for bacterial growth and pathogenicity, we investigated the expression of VvhA to elucidate the regulatory roles of Fur, a major transcription factor controlling iron-homeostasis. Fur repressed the transcription of vvhBA operon via binding to the promoter region. However, haemolysin content and haemolytic activity were lowered in cell-free supernatant of fur mutant. This discrepancy between the levels of vvhA transcript and VvhA protein in fur mutant was caused by exoproteolytic activities of the elastase VvpE and another metalloprotease VvpM, which were also regulated by Fur. vvpE gene expression was repressed by Fur via binding to the Fur-box homologous region. Regulation of VvpM expression by Fur did not occur at the level of vvpM transcription. In vitro proteolysis assays showed that both proteases efficiently degraded VvhA. In addition, the extracellular levels of VvhA were higher in culture supernatants of vvpE or vvpM mutants than in the wild type. Thus this study demonstrates that Fur regulates haemolysin production at the transcription level of the vvhBA operon and at the post-translation level by regulating the expressions of two VvhA-degrading exoproteases, VvpE and VvpM.
This protocol can be applied to other Vibrio strains with haemolysin activities, such as Vibrio parahaemolyticus (V. parahaemolyticus) or other human pathogen strains with similar heamolysin activities.
Keywords: Haemolysin VvhA Fur mutant Vibrio vulnificus
Materials and Reagents
Bacterial strains
Wild type (Vibrio vulnificus MO6-24/O, Clinical isolate: biosafety level 2) with pRK415 plasmid (vector control)
fur mutant with pRK415
fur mutant with pRK415-fur
1% human red blood cells (RBCs) (from healthy person who is a volunteer and diluted with PBS buffer to make a 1% RBC solution)
Tetracycline (3 mg/ml) (Sigma-Aldrich)
PBS buffer (Sigma-Aldrich, catalog number: P5368 )
0.02% Triton X-100 (TritonTM X-100 for molecular biology) (Sigma-Aldrich, catalog number: T8787 )
LB broth (see Recipes)
Equipment
Shaking incubator
Centrifuge (14,000 rpm or 21,000 x g)
Spectrophotometry (540 and 600 nm)
0.22 micron filter
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Lee, H., Kim, J., Lee, M., Park, S. and Lee, K. (2014). Measurement of Haemolysin Activities in Vibrio vulnificus. Bio-protocol 4(5): e1062. DOI: 10.21769/BioProtoc.1062.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Activity
Cell Biology > Cell viability > Cell lysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,063 | https://bio-protocol.org/exchange/protocoldetail?id=1063&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Electrical Penetration Graph Recording (Whitefly)
BL Baiming Liu
XZ Xuguo Zhou
YZ Youjun Zhang
Published: Vol 4, Iss 5, Mar 5, 2014
DOI: 10.21769/BioProtoc.1063 Views: 11971
Original Research Article:
The authors used this protocol in May 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2013
Abstract
Electrical penetration graph (EPG) was first developed by Mclean and Kinsey (1964) and later modified by Tjallingii (1978 and 1985). The EPG system turns a phloem-sucking insects and its host plant into part of an electrical circuit that is completed when the insect’s mouthparts penetrate the plant. The electrical signal is amplified by an amplifier and digitized by a converter. Fluctuations in voltage and electrical resistance are recorded and can be matched to specific feeding events. Current protocol is an efficient use of the EPG system to record whitefly feeding behavior on plants.
Materials and Reagents
Plant (e.g., 2-3 true leaf stage)
Newly-emerged (e.g., 2-5 d old) female whiteflies
Equipment
Ice-bag or box
Glass dish (Diameter = 6 cm)
Gold wire (Diameter = 12.5 μm, http://www.epgsystems.eu/products.php)
Silver glue (Vial of 2ml glue, http://www.epgsystems.eu/products.php)
Faraday cage (self-made cage with10 mesh wire net, length = 60 cm, width = 60 cm, height = 70 cm)
Insect-proof cage (self-made cage with 80 mesh nylon screening, length = 40 cm, width = 40 cm, height = 60 cm)
Transparent tubes (self-made tube with bottle, 3 cm long, inner diameter = 5 mm)
Small ice-chilled glass dish
Giga-8 DC-EPG system with 109 Ohm input resistance (Wageningen University, http://www.epgsystems.eu/products.php)
DI710-UL analogue-to-digital converter (DATAQ Instruments, http://www.epgsystems.eu/products.php)
Computer
Dissecting microscope
Software
PROBE 3.4 software (Wageningen University, advanced version can be downloaded from http://www.epgsystems.eu/downloads.php)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Liu, B., Zhou, X. and Zhang, Y. (2014). Electrical Penetration Graph Recording (Whitefly). Bio-protocol 4(5): e1063. DOI: 10.21769/BioProtoc.1063.
Download Citation in RIS Format
Category
Plant Science > Plant immunity > Disease bioassay
Plant Science > Plant physiology > Tissue analysis
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,064 | https://bio-protocol.org/exchange/protocoldetail?id=1064&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
X-gal Staining on Adult Mouse Brain Sections
HK Hiroshi Kokubu
Janghoo Lim
Published: Vol 4, Iss 5, Mar 5, 2014
DOI: 10.21769/BioProtoc.1064 Views: 17608
Edited by: Xuecai Ge
Reviewed by: Hui Zhu
Original Research Article:
The authors used this protocol in May 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2013
Abstract
Knowing expression patterns of given proteins is very important to understand their functions. Immunostaining analysis with specific antibodies is commonly used to identify cells or tissues expressing proteins of interest. Although this technique is regularly used, it requires high quality of specific antibodies and there is no good quality of antibody available for certain proteins. Alternatively, X-gal staining is also used to analyze protein expression pattern. It is simple and routinely used to detect expression pattern of any proteins of interest in vivo. In this method, genetically modified animals that express beta-galactosidase under the control of certain regulatory elements will be used to reveal the expression pattern of proteins that use the same regulatory elements.
Keywords: Adult mouse brain X-gal staining Expression
Materials and Reagents
Adult mouse brain
Paraformaldehyde (PFA) (Sigma-Aldrich, catalog number: P6148 )
Phosphate buffered saline (PBS)
Sucrose
Magnesium chloride, 6-Hydrate (MgCl2.6H2O) (Mallinckrodt Baker, catalog number: 2444-01 )
Sodium deoxycholate (Sigma-Aldrich, catalog number: D6750 )
NP-40 (Sigma-Aldrich, catalog number: I3021 )
Potassium Ferricyanide (ACROS ORGANICS, catalog number: 196785000 )
Potassium Ferrocyanide (Mallinckrodt Baker, catalog number: 6932-04 )
Permount (Fisher Scientific, catalog number: SP15-100 )
O.C.T. compund (Sakura, catalog number: 4583 )
Ethanol (Decon Labs, catalog number: 2716 )
X-gal (American Bioanatycal, catalog number: AB00450-00005 )
1 M MgCl2 (see Recipes)
10% Sodium deoxycholate (see Recipes)
20% NP-40 (see Recipes)
50 mM Potassium Ferricyanide (see Recipes)
50 mM Potassium Ferrocyanide (see Recipes)
Staining buffer (see Recipes)
Equipment
Cryomold (Sakura, catalog number: 4557 )
Cryostat
37 °C incubator
10-20 Slide Staining Dish with Cover (VWR International, catalog number: 900203 ) or equivalent
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Kokubu, H. and Lim, J. (2014). X-gal Staining on Adult Mouse Brain Sections. Bio-protocol 4(5): e1064. DOI: 10.21769/BioProtoc.1064.
Ju, H., Kokubu, H., Todd, T. W., Kahle, J. J., Kim, S., Richman, R., Chirala, K., Orr, H. T., Zoghbi, H. Y. and Lim, J. (2013). Polyglutamine disease toxicity is regulated by Nemo-like kinase in spinocerebellar ataxia type 1. J Neurosci 33(22): 9328-9336.
Download Citation in RIS Format
Category
Neuroscience > Neuroanatomy and circuitry > Animal model
Biochemistry > Protein > Expression
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,065 | https://bio-protocol.org/exchange/protocoldetail?id=1065&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Generation and Screening of a Non-typeable Haemophilus influenzae Tn-seq Mutant Library
Jeroen D. Langereis
Published: Vol 4, Iss 5, Mar 5, 2014
DOI: 10.21769/BioProtoc.1065 Views: 11246
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in Jun 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2013
Abstract
The genome-wide screen Tn-seq (van Opijnen et al., 2009) is very valuable tools to identify bacterial genes with a conditionally essential function, for instance genes involved in bacterial virulence. These techniques are based on the generation of a random mutant library, which is grown in a control of challenge situation (Figure 1). The advantage of using a mariner transposon for the generation of a random transposon mutant library is its insertion into TA sites, which makes the insertion in the genome highly random. In addition, an MmeI restriction site can be introduced in the inverted repeat of the transposon, without affecting the recognition by HimarC9 transposase.
Keywords: Haemophilus influenzae Transposon sequencing Tn-seq
Figure 1. Schematic representation of the non-typeable Haemophilus influenzae tn-seq mutant library screen for survival and growth in environmental air
Materials and Reagents
1 U/μl Calf Intestinal Alkaline Phoshatase (CIAP) (New England Biolabs, catalog number: M0290S )
Chloroform: isoamyl alcohol
Phenol: chloroform: isoamayl alcohol
Milli-Q water
10 mM dNTP mix (New England Biolabs, catalog number: N0447S )
1 mM dNTP mix
Absolute ethanol
70 % Ethanol
10 mg/ml Glycogen
2 U/μl MmeI restriction enzyme (New England Biolabs, catalog number: R0637S )
10x NEBuffer 4
32 mM S-denosylmethionine
3 M NaAc (pH 5.3)
5 M NaCl
2 U/μl Phusion DNA polymerase (New England Biolabs, catalog number: M0530S )
5x Phusion HF buffer
10 U/μl T4 DNA ligase (New England Biolabs, catalog number: M0202S )
20 U/μl T4 DNA ligase
10x T4 DNA ligase buffer
2.5 U/μl T4 DNA polymerase (New England Biolabs, catalog number: M0203S )
10x T4 DNA polymerase buffer
T4 polynucleotide kinase (3' phosphatase minus) (New England Biolabs, catalog number: M0236S )
100x TE buffer
1 M NaOH
50 % Glycerol
1 mM DTT
5 M NaCl
1 M MgCl2
10 mg/ml BSA
5 U/ml E.coli DNA ligase (New England Biolabs, catalog number: M0205S )
10x E.coli DNA ligase buffer
1 M Hepes (pH 7.9)
HimarC9 transposase
M-IV medium (Herriott et al., 1970)
1 mg/ml Hemin (Sigma-Aldrich, catalog number: H9039 )
10 mg/ml Nicotinamide adenine dinucleotide (NAD) (Sigma-Aldrich, catalog number: N7004 )
Brain heart infusion medium (BHI) (BD Biosciences, catalog number: 237500 )
Supplemented BHI, BHI medium containing 10 μg/ml Hemin and 2 μg/ml NAD
Bacto-agar (BD Biosciences, catalog number: 212030 )
Supplemented BHI plates, sBHI containing 1.5% bacto agar
PBS
100 mg/ml RNase A (Roche Diagnostics, catalog number: 10109142001 )
Qiagen Genomic-tip 20/G columns (QIAGEN, catalog number: 10223 )
Qiagen Genomic DNA buffer set (QIAGEN, catalog number: 19060 )
Minelute Reaction Cleanup Kit (QIAGEN, catalog number: 28204 )
Qubit dsDNA BR assay (Life technologies, catalog number: Q32850 )
Acceptor DNA
Any type of DNA can serve as acceptor for in vitro mariner transposition. The most common types of acceptor DNA are: Chromosomal DNA of the target strain (High quality DNA is required, preferably isolated with Qiagen Genomic Tip columns) or PCR products of target genes or regions.
Donor DNA
Any type of DNA that carries a mariner transposon with MmeI restriction site in the inverted repeat can serve as donor for transposon in the in vitro mariner transposition reaction. Used pGSF8 plasmid, carrying transposon with spectinomycin resistance cassette, suitable for GAF and TnSeq (Langereis et al., 2013).
Primers used for sequence adapters ligation and PCR amplification (see Appendixes)
Equipment
Pipet tips: 0.5-10 μl, 2-20 μl, 20-200 μl 100-1000 μl
15 cm dishes
Heating block for incubations ranging from 16 °C and 75 °C (Grant QBD2)
Microcentrifuge for 1.5 ml tubes (Eppendorf, model: 5417R )
Centrifuge for 50 ml tubes (Eppendorf, model: 5810 )
T100 thermal cycler (Bio-Rad Laboratories)
Nanodrop spectrophotometer (Thermo Fisher Scientific, Nanodrop, model: ND1000 )
Incubator with 5% CO2 (BINDER GmbH, model: CB 150 )
Qubit Fluorometer (Life Technologies)
Bioanalyser (Agilent Technologies)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial genetics > Mutagenesis
Molecular Biology > DNA > Mutagenesis
Systems Biology > Genomics > Transposons
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
Size of the small pieces of the mince process?
1 Answer
100 Views
Jun 24, 2022
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,066 | https://bio-protocol.org/exchange/protocoldetail?id=1066&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Generation of Non-typeable Haemophilus influenzae Directed Gene Deletion Mutants
Jeroen D. Langereis
Published: Vol 4, Iss 5, Mar 5, 2014
DOI: 10.21769/BioProtoc.1066 Views: 10519
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in Jun 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2013
Abstract
Directed deletion mutants in non-typeable Haemophilus influenzae can be made by allelic exchange of the target gene with an artificial DNA construct in which an antibiotic resistance cassette is placed between two ~1,000 bp DNA sequences that are identical to the 5' and 3' flanking regions of the target gene. The artificial DNA construct that is required for this mutagenesis is synthesized by the so-called Megaprimer PCR method (Figure 1).
Keywords: Haemophilus influenzae Gene deletion Mutants Mutagenesis Molecular microbiology
Figure 1. Schematic representation of the Megaprimer PCR method. Step A1. The flanking regions (~1,000 bp) of the target gene are amplified by PCR (Primer pair L1 + L2 and R1 + R2). The L2 and R2 primers have extensions with homology to the antibiotic resistance cassette. Step A2. The antibiotic resistance cassette is amplified by PCR (primer pair L + R). Step B. The three PCR products of the first PCR reactions are combined. The flanking regions anneal to the antibiotic resistance cassette and one large PCR product is formed.
Materials and Reagents
Amplitaq DNA polymerase including 25 mM MgCl2 and 10x reaction buffer (Applied Biosystems®, catalog number: N8080171 )
PWO DNA polymerase including 25 mM MgSO4 and 10x reaction buffer (Roche Diagnostics, catalog number: 11644955001 )
10 mM dNTP mix
Sterile Milli-Q water
QIAquick PCR purification kit (QIAGEN, catalog number: 28104 )
Agarose
Ethidium bromide
0.5x TBE
100 bp perfect DNA ladder (Merck Millipore, catalog number: 70539 )
1 kb perfect DNA ladder (Merck Millipore, catalog number: 70537 )
1x PBS
Bacto-agar (BD Biosciences, catalog number: 212030 )
Bacto-Brain Heart Infusion medium (BD Biosciences, catalog number: 237500 )
Glycerol
M-IV competent non-typeable Haemophilus influenzae (Herriott et al., 1970), for protocol see below.
Equipment
T100 thermal cycler (Bio-Rad Laboratories)
Nanodrop spectrophotometer (Thermo Fisher Scientific, Nanodrop, model: ND1000 )
Centrifuge (Eppendorf, model: 5810 )
Microcentrifuge (Eppendorf, model: 5417R )
Shaker (New Brunswick Scientific, model: Innova 4000 )
37 °C, 5% CO2 incubator (BINDER GmbH, model: CB 150 )
DNA gel electrophoresis equipment
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Langereis, J. D. (2014). Generation of Non-typeable Haemophilus influenzae Directed Gene Deletion Mutants. Bio-protocol 4(5): e1066. DOI: 10.21769/BioProtoc.1066.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > Mutagenesis
Molecular Biology > DNA > Mutagenesis
Molecular Biology > DNA > PCR
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,067 | https://bio-protocol.org/exchange/protocoldetail?id=1067&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
LT-HSC Methylcellulose Assay
MK Marc A. Kerenyi
Published: Vol 4, Iss 5, Mar 5, 2014
DOI: 10.21769/BioProtoc.1067 Views: 25414
Reviewed by: Hui Zhu
Original Research Article:
The authors used this protocol in Jul 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2013
Abstract
Hematopoietic differentiation is a highly complex process originating from an extraordinary population of cells called long-term repopulating hematopoietic stem cells (LT-HSCs). The unique feature of all stem cells, including HSCs, is their exceptional ability to divide asymmetrically giving rise to two different kinds of offspring. One daughter cell becomes an LT-HSC itself (self-renews) to maintain the LT-HSC pool, whereas the second daughter cell pursues a differentiation fate to ultimately give rise to terminally differentiated mature blood cells (Orkin and Zon, 2008). Quantification of phenotypic LT-HSCs can be performed by multi-color flow cytometry and the gold standard for assessment of LT-HSC self-renewal and function is competitive bone marrow transplantation (Miller et al., 2008). Although these methods are irreplaceable to determine LT-HSC abundance and functionality, they have their disadvantages and limitations. For example, competitive bone marrow transplantation is typically monitored as a function of peripheral blood donor contribution over 12-16 weeks. While reduced peripheral blood donor contribution by itself signifies impairment in the stem/progenitor cells compartment, it cannot unambiguously discriminate between reduced LT-HSC self-renewal, impaired LT-HSC differentiation or compromised progenitor cell differentiation. Here we describe an LT-HSCs methylcellulose colony-forming assay, as a fast complementary in vitro method to directly assess LT-HSC differentiation capacity. As described in Kerenyi et al. (2013), this technique acts as a powerful tool to differentiate between LT-HSC or progenitor cell differentiation defects.
Keywords: HSC Stem Cell Colony Assay Methylcellulose
Materials and Reagents
Mice (C57BL/6, 12-16 weeks)
Bone marrow cells from experimental mice
7-amino-actinomycin D (7AAD) (BD, catalog number: 559925 )
CD150 Alexa488 antibody (BioLegend, catalog number: 115916 )
CD48 APC antibody (eBiosciences, catalog number: 17048182 )
cKit APC-efluor 780 antibody (eBiosciences, catalog number: 47117182 )
DynaBeads Biotin Binder (Life Technologies, InvitrogenTM, catalog number: 11047 )
EDTA (0.5 M, pH 8.0) (Boston BioProducts, catalog number: BM-150 )
Fetal Bovine Serum (FBS) (Gemini Bio-Products, catalog number: 100106 )
Ficoll-Paque Premium (General Electric Company, catalog number: 17544202 )
Iscove’s Modified Dulbecco’s Medium (IMDM) (Gibco®, catalog number: 12440053 )
L-Glutamine (Gibco®, catalog number: 25030081 )
MethoCult GF M 3434 methylcellulose-based medium (STEMCELL Technologies, catalog number: 3434)
Mouse Hematopoietic Lineage Biotin Panel (eBiosciences, catalog number: 88777475 )
Phosphate buffered saline (PBS) without Ca2+ and Mg2+ (Mediatech, Cellgro®, catalog number: 21031CM )
Penicillin/Streptomycin Solution (Gibco®, catalog number: 15140122 )
Purified Anti CD16/CD32 antibody (FC Block) (BD, catalog number: 553142 )
Recombinant mouse interferon (IFN) alpha A (R&D Systems, catalog number: 121001 )
Sca-1 PE-Cy7 antibody (eBiosciences, catalog number: 25598182 )
Streptavidin PerCP (BD, catalog number: 554064 )
Staining Medium for FACS (see Recipes)
IMDM for methylcellulose colony assays (see Recipes)
Equipment
Mortar and pestle
Easy Grip 35 mm petri dish (BD Biosciences, Falcon®, catalog number: 351008 )
6 well plate
1.5 ml Eppendorf Protein LoBind Tube (Eppendorf, catalog number: 022431081 )
1.5 ml Eppendorf Safe-Lock Tubes (Eppendorf, catalog number: 0030120086 )
2.0 ml Eppendorf Safe-Lock Tubes (Eppendorf, catalog number: 0030120094 )
40 µM BD Cell stainer (BD Biosciences, Falcon®, catalog number: 352340 )
15 ml BD Falcon Conical (BD Biosciences, Falcon®, catalog number: 352095 )
50 ml BD Falcon Conical (BD Biosciences, Falcon®, catalog number: 1443222 )
10 cm BD Falcon Tissue culture dish (BD Biosciences, Falcon®, catalog number: 353003 )
5 ml BD Polystyrene Tubes (FACS tubes) (BD Biosciences, Falcon®, catalog number: 352054 )
BD PrecisionGlide Needle (16 gauge) (BD Biosciences, Falcon®, catalog number: 305198 )
3 ml BD Syringe Luer-Lok Tip (BD Biosciences, Falcon®, catalog number: 309657 )
BD FACS Aria I (BD Biosciences, special order product)
Inverted Light Microscope (OLYMPUS, catalog number: CKX31 )
DynaMag-2 Magnet (Life Technologies, InvitrogenTM, catalog number: 12321D )
Procedure
Day 0
Thaw sufficient numbers of 3 ml MethoCult GF M3434 aliquots overnight (one 3 ml aliquot per mouse) at 4 °C.
Day 1
Euthanize mice according to the method of choice, e.g., cervical dislocation, CO2.
Disinfect mice with 70% ethanol. Open skin on top of the femur medially (on the interior side of hindlegs). Using small scissors and forceps, dissect out ilii (hip bones), femora and tibiae from mice and place them in one well of a 6 well plate containing 2 ml ice-cold PBS/2% FBS 2 mM EDTA (= staining medium).
Isolate bone marrow (BM) using autoclaved mortar and pestle: Put femora, tibiae, iliii of one mouse into mortar and add 5 ml staining medium and grind until bones are not red anymore. Filter cell suspension into a 50 ml conical tube through a 40 µM nylon mesh and use the plunger of a 5 ml syringe to push cells trough the mesh which are held back by bone marrow fat. Repeat at least 2 more times.
Fill 50 ml conical tube up to 40 ml with staining medium and spin down at 300 x g at 4 °C.
Resuspend BM cells in 5 ml staining medium.
Fill 5 ml Ficoll at room temperature (!) into a 15 ml conical tube.
Slowly overlay 5 ml of the bone marrow cell suspension onto the Ficoll.
Spin down cells for 15 min at 400 x g at room temperature, with the brake off (or low). This will get rid of the bulk of erythroid and myeloid cells.
Using a pasteur pipette transfer the interface, containing mononuclear cells, into another 15 ml tube.
Note: The interface may not appear if Ficoll is not at room temperature or if the centrifuge chamber is chilled.
Wash the bone marrow mononuclear cells with 15 ml staining medium.
Spin down cells for 7 min at 300 x g at 4 °C and resuspend again in 10 ml staining medium. At this point a small aliquot can be drawn to enumerate the cell number.
Spin down cells for 7 min at 300 x g at 4 °C. Aspirate supernatant completely. Resuspend pellet in 50 µl staining buffer.
Add 1 µl of purified anti CD16/CD32 antibody (FC-Block) to keep FC-receptors from capturing antibodies, which would result in false positive staining. Incubate for 15 min in the fridge.
Add 50 µl of biotinylated lineage marker antibody cocktail (Mouse Hematopoietic Lineage Flow Panel):
1x lineage marker cocktail:
Biotinylated anti-Ter-119 (2 µl/1 x 107 cells)
Biotinylated anti-Gr-1 (2 µl/1 x 107 cells)
Biotinylated anti-Mac-1 (2 µl/1 x 107 cells)
Biotinylated anti-B220 (2 µl/1 x 107 cells)
Biotinylated anti-CD3 (2 µl/1 x 107 cells)
Up to 50 µl with staining buffer
Incubate cells in fridge for 30 min.
Wash cells once with 5 ml of staining buffer and spin down for 5 min at 300 x g at 4 °C.
Resuspend cells in 1.5 ml staining medium (in 2 ml Eppendorf tube).
Preparation for DynaBeads Biotin Binder for lineage depletion:
a. Resuspend the Dynabeads in the vial.
b. Transfer the desired volume of Dynabeads to a 1.5 ml tube.
c. Add the same volume of staining buffer.
d. Place the tube in a magnet for 3 min and discard the supernatant.
e. Repeat steps c and d twice.
f. Remove tubes from magnet and resuspend washed Dynabeads in the same volume of staining buffer as the starting volume of beads was.
Add ~300 µl DynaBeads Biotin Binder (or 4 Dynabeads per target cell) per mouse and incubate cells rotating at 2-8 °C for 30 min.
Put tubes containing the cells in magnet for 3 min. Transfer supernatant into FACS tube.
Wash cells once with 10 ml of staining buffer and resuspend in 50 µl staining buffer.
Add 50 µl of HSC staining cocktail and stain 30 min at 4 °C. Flick sample every 10 min to mix.
1x HSC staining cocktail:
Streptavidin PerCP (0.125 µg/1 x 107 cells)
CD150-Alexa488 (0.5 µg/1 x 107 cells)
CD48-APC (0.125 µg/1 x 107 cells)
cKit-APC-eFluor780 (0.125 µg/1 x 107 cells)
Sca1-PE-Cy7 (0.125 µg/1 x 107 cells)
Biotinylated anti-Ter-119 Ab (2 µl/1 x 107 cells)
Biotinylated anti-Gr-1 Ab (2 µl/1 x 107 cells)
Biotinylated anti-Mac-1 Ab (2 µl/1 x 107 cells)
Biotinylated anti-B220 Ab (2 µl/1 x107 cells)
Biotinylated anti-CD3 Ab (2 µl/1 x 107 cells)
Up to 50 µl with staining buffer
Wash cells once with 3 ml staining buffer, spin down for 5 min at 300 x g at 4 °C and resuspend in 300 µl staining buffer.
Add 3 µl 7-AAD and incubate 10 min at room temperature.
Note: The LT-HSC isolation part of this protocol has been adapted and modified from Ema et al. (2006).
Sort cells on a BD FACS ARIA I (or comparable Cell Sorter). To achieve over 95% purity of LT-HSCs, perform 2 rounds of sorting! See Figure 1 for gating strategy.
1st sort: Sort at least 5000 LT-HSCs (i.e. lineage negative Sca-1+ c-Kit+ CD150+CD48- cells) into 250 µl of IMDM 2% FCS + 1% P/S in a low protein binding 1.5 ml Eppendorf tube. Using a low protein binding tube at this step will maximize your LT-HSC recovery.
2nd sort: Sort exactly 1000 LT-HSCs into 500 µl of IMDM 2% FCS + 1% P/S in a low protein binding 1.5 ml Eppendorf tube. You will now have 200 LT-HSCs/100 µl.
Optional: If using Mx1Cre BM you can either delete your floxed allele in vivo with pIpC (not described here) or in vitro using 1,000 U/ml recombinant mouse Interferon alpha (IFNα). In vitro deletion may be desirable in cases in which knock out of your gene of interest results in altered cell surface immunophenotypes.
Note: The specific activity of IFNα varies from Lot to Lot. Final volume of IFNα to obtain 3,000 U/3 ml Methocult aliquots will have to be adjusted for every lot.
Figure 1. Gating strategy for the isolation of CD150+ LT-HSCs. A. Bone marrow cells were stained with indicated antibodies and sorted by flow cytometry to isolate CD150+ LT-HSCs.
A total of 300 µl volume can be added to 3 ml Methocult M3434 aliquot:
60 µl HSCs (from 200 LT-HSCs/100 µl) = about 40 LT-HSCs/ml Methocult M3434
30 µl Pen/Strep
Optional: x µl IFNα (Lot dependent–but a total of 3,000 U)
Up to 300 µl with IMDM 2% FCS 1% Pen/Strep 1% L-Glut
Mix well by vortex, and let methylcellulose settle at least for 5 min to allow air bubbles to dissipate.
Plate 2 x 1.1 ml of Methocult M3434 including your LT-HSCs per 35 mm petri dish using a 3 CC syringe with a 16 gauge needle. You now have technical duplicates of your colony assay.
Note: You have to use a petri dish not a tissue culture dish!
Place the two dishes into a 100 mm petri dish. Add a third, uncovered 35 mm dish containing 3 ml of sterile water. Replace lid of 100 mm petri dish.
Transfer the duplicate samples and your petri dish filled with water into a 10 cm tissue culture grade dish and put the lid on it. This installation will keep your methylcellulose from drying out. Transfer to tissue culture incubator and incubate for 10-12 days at 37 °C.
Day 10-12
Using an inverted light microscope, count and score the number of colonies according to the instructions found in Miller et al. (2008). You should largely obtain large multipotential CFU-GEMM (Colony Forming Unit–granulocyte, erythrocyte, monocyte, megakaryocyte) colonies (Figure 2A). When seeding 40 wild type LT-HSCs we typically observe ~20 CFU-GEMM colonies. If desired, cells can be harvested from methylcellulose and either subjected to cytospin analysis to determine cell morphologies (Figure 2B) or to flow cytometry, to obtain quantitative cell type distribution enumeration.
Figure 2. Microphotographs of CFU-GEMM Colonies. A. Microphotograph if a single CFU-GEMM colony (scale bar = 500 µM). B. Microphotograph of a cytospun CFU-GEMM colony stained with hematoxylin and eosin (scale bar = 40 µM).
Recipes
Staining Medium for FACS (for 500 ml)
488 ml PBS (without Ca2+ or Mg2+)
10 ml FBS (final concentration: 2% FBS)
2 ml 0.5 M EDTA pH 8 (final concentration: 2 mM EDTA)
IMDM for methylcellulose colony assays (for 500 ml)
480 ml IMDM
10 ml FBS (final concentration: 2% FBS)
5 ml Pen/Strep (final concentration: 1% Pen/Strep)
5 ml L-Glutamine (final concentration: 1% L-Glut)
Acknowledgments
This protocol was originally described in and adapted from Kerenyi et al. (2013). This work was supported by the NIH National Heart, Lung and Blood Institute, R01HL075735 and Austrian Science Fund (FWF), J 2948-B19. I would like to thank my mentor Stuart Orkin for giving me the opportunity to conceive, design and author this protocol.
References
Ema, H., Morita, Y., Yamazaki, S., Matsubara, A., Seita, J., Tadokoro, Y., Kondo, H., Takano, H. and Nakauchi, H. (2006). Adult mouse hematopoietic stem cells: purification and single-cell assays. Nat Protoc 1(6): 2979-2987.
Kerenyi, M. A., Shao, Z., Hsu, Y. J., Guo, G., Luc, S., O'Brien, K., Fujiwara, Y., Peng, C., Nguyen, M. and Orkin, S. H. (2013). Histone demethylase Lsd1 represses hematopoietic stem and progenitor cell signatures during blood cell maturation. Elife 2: e00633.
Miller, C. L., Dykstra, B. and Eaves, C. J. (2008). Characterization of mouse hematopoietic stem and progenitor cells. Curr Protoc Immunol Chapter 22: Unit 22B 22.
Orkin, S. H. and Zon, L. I. (2008). Hematopoiesis: an evolving paradigm for stem cell biology. Cell 132(4): 631-644.
Copyright: Kerenyi. This article is distributed under the terms of the Creative Commons Attribution License (CC BY 4.0).
Category
Stem Cell > Adult stem cell > Maintenance and differentiation
Biochemistry > Carbohydrate > Polysaccharide
Cell Biology > Cell-based analysis > Flow cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,068 | https://bio-protocol.org/exchange/protocoldetail?id=1068&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Cellular Translational Reporter Assay
TK Taishi Kimura
KT Kiyoshi Takeda
Published: Vol 4, Iss 6, Mar 20, 2014
DOI: 10.21769/BioProtoc.1068 Views: 10747
Original Research Article:
The authors used this protocol in Sep 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2013
Abstract
The method described here allows measuring the effect of exogenously introduced modifications to in vitro-transcribed mRNA on the translation in cells. Using cells derived from knockout mice and control littermates, this method enables to compare the results in the presence or absence of specific gene products. In our lab, we used this protocol to check whether the exogenous addition of 5’ capping and 2’-O methylation to in vitro-mRNA affects the translational efficiency. Here we describe the details of our experiments.
Materials and Reagents
Mouse embryonic fibroblasts (prepared from day 14.5 embryos)
Vector pGL4.14 (Luc2 encoding vector) (Promega Corporation, catalog number: E6691 )
Primers (Invitrogen custom DNA primers)
5’-TAATACGACTCACTATAGGCCACCATGGAAGATGCCAAAAA-3’ (The T7 class III promoter sequence is underlined.)
5’-TACCACATTTGTAGAGGTTTTACTTGCTTT-3’
rTaq DNA polymerase (TOYOBO, catalog number: TAP-211 )
Agarose gel
Ethidium bromide
Illustra GFX PCR and Gel Band Purification Kit (GE, catalog number: 28-9034-71 )
MEGAScript In vitro transcription Kit (Life Technologies, Ambion®, catalog number: AM1333 )
Note: Nuclease-free Water and LiCl Precipitation Solution are included in the kit.
80% ethanol
ScriptCap m7G capping system (EpiCentre, catalog number: SCCE0610 )
ScriptCap 2’-O-Methyltransferase Kit (EpiCentre, catalog number: SCMT0610 )
RNeasy Mini Kit (QIAGEN, catalog number: 74104 )
Opti-MEM I reduced serum medium (Life Technologies, Gibco®, catalog number: 31985-070 )
D-PBS(-) (Nacalai Tesque, catalog number: 14249-95 )
Lipofectamine 2000 DNA Transfection Reagent (Life Technologies, catalog number: 11668-019 )
Dual-luciferase reporter assay system (Promega Corporation, catalog number: E1960 )
BCA protein assay reagent (Thermo Fisher Scientific, catalog number: 23227 )
Equipment
Cell scraper
GeneAmp PCR system 9700 (Applied Biosystems®)
Centrifugal Concentrator CC105 (TOMY)
Lumat LB 9507 Luminometer (Berthold Technologies)
Model 680 Microplate Reader (Bio-Rad Laboratories)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > RNA > mRNA translation
Microbiology > Microbial biochemistry
Molecular Biology > RNA > mRNA translation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,069 | https://bio-protocol.org/exchange/protocoldetail?id=1069&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Synthesis of the Adenosine A2A Receptor Fluorescent Agonist MRS5424
Kenneth A. Jacobson
Francisco Ciruela
Published: Vol 4, Iss 6, Mar 20, 2014
DOI: 10.21769/BioProtoc.1069 Views: 7796
Edited by: Cheng Zhang
Original Research Article:
The authors used this protocol in Nov 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2012
Abstract
MRS5424 is a functional fluorescent agonist for the adenosine A2A receptor (A2AR) in which the fluorescent dye Alexa Fluor 532 is covalently attached to the A2AR agonist 2-[[2-[4-[2-(2-aminoethyl)-aminocarbonyl]ethyl]phenyl]ethylamino]-5'-N-ethyl-carboxamidoadenosine (APEC). This easy-to-synthesize new A2AR fluorescent ligand was shown to be extremely useful for determining the binding kinetic constants of A2AR in a real-time mode (Fernandez-Duenas et al., 2012). In addition, this fluorescent A2AR ligand is compatible with ligand-receptor interaction studies using fluorescent plate readers. Finally, it is important to mention that even though the sensitivity of this A2AR fluorescent ligand may not be as high as that observed for the marketed A2AR radioactive compounds, the use of such fluorescent derivative may have some advantages over radioactive probes, for example its safe delivery, manipulation and disposal, the short signal acquisition times, the feasibility to automate and to miniaturize, and finally its cost.
Keywords: Fluorescent ligand Adenosine receptor APEC MRS5424 A2AR
Materials and Reagents
Alexa Fluor 532 carboxylic acid, N-succinimidyl ester (Life Technologies, InvitrogenTM)
Anhydrous dimethylformamide (DMF; HPLC grade) (Alfa Aesar)
Sodium tetraborate labeling buffer (0.1 M, pH 8.5)
2-[[2-[4-[2-(2-aminoethyl)-aminocarbonyl]ethyl]phenyl]ethylamino]-5'-N-ethyl-carboxamidoadenosine (APEC) (NIMH Chemical Synthesis and Drug Supply Program, http://nimh-repository.rti.org/)
Triethylammonium acetate (TEAA)-CH3CN (BioUltra grade) (Sigma-Aldrich)
Tetrabutylammonium dihydrogenphosphate-CH3CN (TBAP) [puriss. ≥99.0% (T)] (Sigma-Aldrich)
Equipment
RP-C18(2) semipreparative column (250 x 10.0 mm) (Phenomenex)
Hewlett-Packard 1100 HPLC equipped with a Luna 5 µm RP-C18(2) semipreparative column (250 x 10.0 mm) (Figure 1B) (Phenomenex) or a Zorbax SB-Aq 5 µm analytical column (50 x 4.6 mm) (Agilent) (Figure 1A)
Figure 1. Picture of the Luna 5 µm RP-C18(2) semipreparative column (250 x 10.0 mm) (B) and the Zorbax SB-Aq 5 µm analytical column (50 x 4.6 mm) (A)
Diode array detector
POLARstar Optima plate-reader (BMG LABTECH)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Jacobson, K. A. and Ciruela, F. (2014). Synthesis of the Adenosine A2A Receptor Fluorescent Agonist MRS5424 . Bio-protocol 4(6): e1069. DOI: 10.21769/BioProtoc.1069.
Download Citation in RIS Format
Category
Biochemistry > Protein > Interaction
Biochemistry > Protein > Fluorescence
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,070 | https://bio-protocol.org/exchange/protocoldetail?id=1070&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Adenosine A2A Receptor Ligand Binding Experiments by Using Real-time Single-cell FRET
VF Víctor Fernández-Dueñas
Kenneth A. Jacobson
Francisco Ciruela
Published: Vol 4, Iss 6, Mar 20, 2014
DOI: 10.21769/BioProtoc.1070 Views: 10165
Edited by: Cheng Zhang
Original Research Article:
The authors used this protocol in Nov 2012
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Nov 2012
Abstract
We designed a fluorescence resonance energy transfer (FRET)-based approach to study the ligand binding constants of the adenosine A2A receptor (A2AR). Our assay is based in the interaction of a fluorescent A2AR agonist ligand (MRS5424) with an A2AR tagged with the cyan fluorescent protein (CFP) at the N-terminus (i.e. A2ARCFP) and expressed in living cells. Thus, upon fast superfusion of the A2ARCFP expressing cells with MRS5424, the ligand-receptor interaction is determined by single-cell FRET in a real-time mode. Accordingly, our approach allowed immediate ‘real-time’ readout of the ligand-receptor interaction, thus allowing kinetic binding experiments, a feature impossible to achieve using conventional radioisotope-labelled ligands. In addition, since our assay permitted the visual confirmation of receptor localization it also allowed localized saturation binding experiments.
Keywords: FRET Fluorescent ligands GPCR Real-time binding Kinetics
Materials and Reagents
Cell line (i.e. HEK-293 cells)
Dulbecco’s modified Eagle’s medium (DMEM) (Sigma-Aldrich)
Sodium pyruvate
L-glutamine
Antibiotics: streptomycin and penicillin
Fetal bovine serum
TransFectinTM Lipid Reagent (Bio-Rad Laboratories)
Hank’s balanced salt solution (HBSS) (see Recipes)
Cell culture medium (see Recipes)
Equipment
18 mm diameter glass coverslips
Attofluor holder
Inverted Axio Observer microscope (ZEISS) equipped with a 63x oil immersion objective
Polychrome V (TILL Photonics)
Avalanche photodiodes (TILL Photonics)
Focal drug application system (ALA Scientific Instruments, OCTAFLOWTM)
Digidata 1440A analog/digital converter (Molecular Devices)
Software
pCLAMP (Molecular Devices)
GraphPad Prism (GraphPad Software)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Fernández-Dueñas, V., Jacobson, K. A. and Ciruela, F. (2014). Adenosine A2A Receptor Ligand Binding Experiments by Using Real-time Single-cell FRET. Bio-protocol 4(6): e1070. DOI: 10.21769/BioProtoc.1070.
Download Citation in RIS Format
Category
Neuroscience > Cellular mechanisms > Receptor-ligand binding
Biochemistry > Protein > Interaction
Cell Biology > Single cell analysis > Cell carrier
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,071 | https://bio-protocol.org/exchange/protocoldetail?id=1071&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Western Blotting for Staphylococcus aureus AgrA
CK Chikara Kaito
KS Kazuhisa Sekimizu
Published: Vol 4, Iss 6, Mar 20, 2014
DOI: 10.21769/BioProtoc.1071 Views: 12577
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in Apr 2012
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Apr 2012
Abstract
Staphylococcus aureus has a quorum sensing system to regulate the expression of various virulence factors, which is exerted by the agr locus that encodes agrBDCA and a regulatory RNA called RNAIII. AgrB, AgrD, and AgrC proteins are involved in producing and recognizing extracellular quorum sensing molecules and transduce the signal by altering the phosphorylation status of AgrA, which is a positive transcription factor, to regulate cytolysin genes as well as the RNAIII gene. RNAIII regulates the expression of various virulence genes. Expression of the agr locus has been examined in depth at the transcriptional level, but investigations of translational expression are limited, because immunoglobulin G used to detect a specific protein highly reacts to S. aureus protein A. Here, we report a method to detect AgrA that is the transcription factor encoded by the agr regulatory system. Although this is a specific protocol for western blotting of S. aureus AgrA protein, it can also be used for other S. aureus proteins by using the appropriate antibody.
Keywords: AgrA Immunoglobulin G Protein A Western blot analysis
Materials and Reagents
agr-positive S. aureus strains
BactoTM Tryptic Soy Broth (BD, catalog number: 211825 )
Lysostaphin (Wako Chemicals USA, catalog number: 120-04313 )
15% sodium dodecyl sulfate (SDS)-polyacrylamide gel
N-Cyclohexyl-3-aminopropanesulfonic acid (CAPS) (Dojindo Molecular Technologies, catalog number: 343-08321 )
Methanol
Immobilon-P (EMD Millipore, catalog number: IPVH304F0 )
Tris(hydroxymethyl)aminometane (Nacalai Tesque, catalog number: 35434-34 )
EDTA.2Na (Dojindo Molecular Technologies, catalog number: 345-01865 )
Hydrochloric acid
Coomassie Plus Protein Assay Reagent (Thermo Fisher Scientific, catalog number: 23236 )
Easy Blocker (GeneTex, catalog number: GTX425858 )
Anti-AgrA IgG that was made in our laboratory (Kaito et al., 2013)
Anti-rabbit IgG conjugated with alkaline phosphatase (Promega Corporation, catalog number: S3731 )
Nitro blue tetrazolium/5-bromo-4-chloro-3’-indolyphosphate (NBT/BCIP) (Roche Diagnostics, catalog number: 1681451 )
PVDF membrane
TE buffer (see Recipes)
Lysis buffer (see Recipes)
Staining buffer (see Recipes)
10x SDS sample buffer (see Recipes)
10x TBS (see Recipes)
TBST (see Recipes)
Equipment
Sonicator (Branson, model: Sonifier 450) with double stepped microtip (3 mm) (Branson, part number: 101-063-212 )
Plastic container
Centrifuge machine
Electrophoresis apparatus
Power supply
Wet/Tank Blotting Systems (Bio-Rad Laboratories)
Software
Image J (1.45 s, NIH)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial biochemistry > Protein
Microbiology > Microbial signaling > Quorum sensing
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,072 | https://bio-protocol.org/exchange/protocoldetail?id=1072&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Catalase Activity Assay in Candida glabrata
Emmanuel Orta-Zavalza
MB Marcela Briones-Martin-del-Campo
I Irene Castano
AP Alejandro De Las Penas
Published: Vol 4, Iss 6, Mar 20, 2014
DOI: 10.21769/BioProtoc.1072 Views: 18768
Edited by: Fanglian He
Original Research Article:
The authors used this protocol in Jun 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2013
Abstract
Commensal and pathogenic fungi are exposed to hydrogen peroxide (H2O2) produced by macrophages of the host. Pathogenic fungi counteract the harmful effects of H2O2 with the enzyme catalase (EC 1.11.1.6), which decomposes two molecules of H2O2 to two molecules of H2O and O2. Contribution of antioxidant systems on fungal virulence is actively studied. Measurement of catalase activity can contribute to the elucidation of the factors that influence the regulation of this pivotal enzyme. Here we describe a simple spectrophotometric method in which the activity of catalase is measured in total yeast extracts. Decomposition of H2O2 by the yeast extract is followed by the decrease in absorbance at 240 nm. The difference in absorbance through time (ΔA240) is inferred as the measure of catalase activity.
Keywords: Catalase Candida Glabrata Yeast CTA1
Materials and Reagents
Yeast strains
Note: BG14 was used as the C. glabrata parental strain. The hst1Δ and the cta1Δ null mutants were used as a positive and the negative controls, respectively.
Catalase from bovine liver (Sigma-Aldrich, catalog number: C9322 )
Bradford reagent (Sigma-Aldrich, catalog number: B6916 )
Bovine serum albumin - fraction V (Sigma-Aldrich, catalog number: 85040C )
Zirconia/silica beads (0.5 mm diameter) (Bio Spec Products, catalog number: 11079105z )
Sterile water
Ice
One tablet of protease inhibitors cOmplete ULTRA Mini EASYpack is used in 10 ml of phosphate buffer (Roche Diagnostics, catalog number: 05 892 970 001 )
H2O2 (Sigma-Aldrich, catalog number: 349887 )
Catalase lyophilized powder (Sigma-Aldrich, catalog number: C9322)
YPD broth (see Recipes)
50 mM Phosphate buffer (PB) (pH 7.0) (see Recipes)
30 mM H2O2 (see Recipes)
Catalase solution (see Recipes)
Equipment
Orbital incubator shaker
Microfuge tubes
50 ml conical tubes
Corning 96 well clear flat bottom (Corning, catalog number: 3595 )
Standard 10 mm light path quartz cuvette with PTFE cover
UV/Vis Spectrophotometer (Shimadzu, model: UV-1700 , catalog number: 206-55401-92)
Microplate spectrophotometer system (Benchmark Plus Microplate reader) (Bio-Rad Laboratories, catalog number: 170-6931 )
Centrifuge (Beckman Coulter, model: Allegra® 25R, catalog number: 369464 )
Microfuge
Stopwatch
Parafilm
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Orta-Zavalza, E., Briones-Martin-del-Campo, M., Castano, I. and Penas, A. D. L. (2014). Catalase Activity Assay in Candida glabrata. Bio-protocol 4(6): e1072. DOI: 10.21769/BioProtoc.1072.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Activity
Biochemistry > Other compound > Reactive oxygen species
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,073 | https://bio-protocol.org/exchange/protocoldetail?id=1073&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measuring Genetic Robustness in Vesicular Stomatitis Virus
Isabel S. Novella
Published: Vol 4, Iss 6, Mar 20, 2014
DOI: 10.21769/BioProtoc.1073 Views: 8504
Original Research Article:
The authors used this protocol in May 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2013
Abstract
Genetic robustness is the ability of a genome to incorporate mutations with the result of no fitness changes. Thus, more robust viruses have an increased neutral mutation rate. This property is particularly important in RNA viruses due to their high mutation rates. The most direct way of measuring robustness in vesicular stomatitis virus (VSV) is to carry out clonal analysis of populations: randomly isolating individual VSV strains (plaques), measuring the fitness of each one and generating fitness distributions (Novella et al., 2010). A second possibility is to carry out multiple replicates of repeated plaque-to-plaque passages, determining fitness in progeny populations and generating fitness distributions (Novella et al., 2010). Depending on the expected differences, the former may require hundreds of determinations, while the latter may require tens of determinations. A third approach consists of increasing the mutation rate of populations under analysis to magnify any differences that may exist and, instead of measuring fitness, measuring survival (Novella et al., 2013). One caveat of this method is that changes in survival can also be explained by changes in polymerase fidelity. For that reason, it is important to perform complementary experiments, in this case quantifying mutant frequency.
Materials and Reagents
Test and reference VSV strains
Note : The former is the strain under investigation, the latter is the control (typically the progenitor).
Baby hamster kidney cells (BHK-21)
10x Trypsin/EDTA (Life Technologies, Gibco®, catalog number: 15400 )
I1 Monoclonal antibody (I1Mab) hybridoma (Holland et al., 1991) (ATCC, catalog number: CRL-2700 )
Note: This antibody recognizes the G glycoprotein of VSV.
I14 Mab (Holland et al., 1991) (https://www.kerafast.com/p-172-hybridoma-ie9f9-i14.aspx)
Note: This antibody recognizes the G glycoprotein of VSV.
Proteose peptone No. 3 (PP3) (BD DifcoTM, catalog number: 212230 ) (12 g/L in dH2O, autoclaved)
Bovine Calf Serum (BCS) (Life Technologies, Gibco®, catalog number: 16170-078 )
Note: BCS is a good choice to carry out plaque assays and it is a lot cheaper than FBS.
Fetal Bovine Serum (FBS) (Life Technologies, Gibco®, catalog number: 10437 )
10% CO2
5-Fluorouracyl (5-FU) (Sigma-Aldrich, catalog number: F-6627 ) (10 mg/ml in ethanol, filtered)
Agarose (Lonza, SeqplaqueTM GTGTM, catalog number: 50111 ) (40 g/L in dH2O, autoclaved)
4.2% bicarbonate
Penicillin/streptomycin mixture (Mediatech, Cellgro®, catalog number: 30-004-Cl )
Saline solution (see Recipes)
Minimal Essential Medium with Hank’s salts (MEM-H) (Mediatech, Cellgro®, catalog number: 50-019-PB ) (see Recipes)
Crystal violet solution (see Recipes)
Equipment
T25 plug-seal flasks (CytoOne®, catalog number: CC7682-4325)
5 ml and 25 ml pipetes
Plugged Pasteur pipetes
1.5 ml tubes
Type II biosafety hood
37 °C, CO2 cell culture incubator
Transilluminator (optional)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Novella, I. S. (2014). Measuring Genetic Robustness in Vesicular Stomatitis Virus. Bio-protocol 4(6): e1073. DOI: 10.21769/BioProtoc.1073.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > Mutagenesis
Molecular Biology > RNA > RNA sequencing
Microbiology > Microbial cell biology > Cell isolation and culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,074 | https://bio-protocol.org/exchange/protocoldetail?id=1074&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Fitness Determinations in Vesicular Stomatitis Virus
Isabel S. Novella
Published: Vol 4, Iss 6, Mar 20, 2014
DOI: 10.21769/BioProtoc.1074 Views: 7126
Original Research Article:
The authors used this protocol in May 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2013
Abstract
Fitness is defined as the overall replicative ability. Testing whether a mutation (or combination of mutations) has an effect on fitness often relays on determining virus production as a surrogate measurement. However, viruses do not usually replicate in a void, and evolutionary speaking, it is key to determine replicative ability compared to other viruses, e.g. the relative fitness. John Holland developed a method for vesicular stomatitis virus based on the use of a neutral genetic marker that allows to distinguish two competitors and to measure accurately the relative ratio between the two during competition (Holland et al., 1991). The marker is a mutation in the external G glycoprotein that has no effect on the virus other than conferring resistance to a monoclonal antibody, I1. To measure fitness a marked test strain is mixed with a reference unmarked strain and the mixture is allowed to infect a cell monolayer. Ratios before and after competition are measured by plaque assay in the presence and absence of I1 antibody, and changes in ratio give the fitness value.
Materials and Reagents
Test and reference VSV strains
Any neutral mutation that confers resistance to the monoclonal antibody used in the test is appropriate. For I1, which recognizes the A1 epitope of the G glycoprotein, mutation 3853 is our preferred choice. Mutation 3846 is not a good choice because it seems to be beneficial. Mutations indicate the nucleotide number of wild type Indiana serotype, Mudd-Summers strain. Mutant can be isolated by plaque-picking or by reverse genetics. Either way, the resulting population must be fully sequenced to ensure that no other mutations have been incorporated during the process.
Baby hamster kidney cells (BHK-21)
10x Trypsin/EDTA (Life Technologies, Gibco®, catalog number: 15400 )
I1 Monoclonal antibody (I1Mab) hybridoma (ATCC, catalog number: CRL-2700 )
Proteose peptone No. 3 (PP3) (BD DifcoTM, catalog number: 0 12207 ) (12 g/L in dH2O, autoclaved)
Bovine Calf Serum (BCS) (Life Technologies, Gibco®, catalog number: 16170-078 )
Fetal Bovine Serum (FBS) (Life Technologies, Gibco®, catalog number: 10437 )
NaCl
10% CO2
Agarose (Lonza, SeqplaqueTM GTGTM, catalog number: 50111 ) (40 g/L in dH2O, autoclaved)
Glutamine (Life Technologies, InvitrogenTM, catalog number: 25030-081 )
Minimal Essential Medium with Hanks salts (MEM-H) (Mediatech, Cellgro®, catalog number: 50-019-PB )
Sodium bicarbonate (4.2 g/L in dH2O, autoclaved)
Penicillin/streptomycin solution (Mediatech, Cellgro®, catalog number 30-004-Cl )
Saline solution (see Recipes)
Minimal Essential Medium with Earl’s salts (MEM-E) (Mediatech, Cellgro®, catalog number: 51-10-PB ) (see Recipes)
Crystal violet solution (see Recipes)
Equipment
1.5 ml tubes
T25 filtered-cap flasks (Cyto-One®, catalog number: CC7682-4825 )
T-25 plug seal (if MEM-Hanks is used) (Cyto-One®, catalog number: CC7682-4325 )
5 ml and 25 ml pipettes
Pasteur pipettes
Type II biosafety hood
37 °C cell culture incubator
Transilluminator (optional)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Microbiology > Microbial cell biology > Cell isolation and culture
Microbiology > Microbial genetics > Mutagenesis
Microbiology > Microbial genetics > RNA
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,075 | https://bio-protocol.org/exchange/protocoldetail?id=1075&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
In vitro Regulatory T cells Differentiation From Naïve T Cells
Tomás Dalotto-Moreno
GR Gabriel A. Rabinovich
Marian Salatino
Published: Vol 4, Iss 6, Mar 20, 2014
DOI: 10.21769/BioProtoc.1075 Views: 22796
Edited by: Lin Fang
Reviewed by: Omar AkilFanglian He
Original Research Article:
The authors used this protocol in Feb 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Feb 2013
Abstract
In the past years, a subset of regulatory T cells (Tregs) expressing CD4, CD25 and the transcription factor FoxP3 has gained considerable attention as key regulators of T-cell tolerance and homeostasis (Sakaguchi, 2004). This population of T cells is specifically engaged in the maintenance of immune self-tolerance and the control of aberrant immune responses to foreign antigens. Remarkably, regulatory T cells have been implicated in tumor cell evasion of immune responses (Curiel et al., 2004; Zou, 2006) by suppressing T cell mediated antitumor immunity. The study of the signals that promote the differentiation of this suppressive population in the tumor microenvironment has become a central issue. Here we described a detailed method to in vitro differentiate Tregs using tumor cells conditioned media from mouse naïve T cells and to identify them based on their specifics markers (Dalotto-Moreno et al., 2013).
Keywords: Regulatory T cell Isolation Breast cancer T cells Naive T cells
Materials and Reagents
Splenocyte suspension
Eight- to twelve-week old Balb/c mice strain
RPMI 1640 (Life Technologies, Gibco®, catalog number: 22400-089 )
Phosphate buffer saline (PBS) (see Recipes)
Sterile red blood lysis buffer (ACK buffer) (see Recipes)
Cell lines
4T1 cell line (ATCC)
4T1 is a highly metastatic stage IV murine breast cancer cell line that lacks estrogen and progesterone nuclear receptors and that spontaneously metastasizes to lung, brain and bone.
RPMI 1640
Heat-inactivated fetal bovine serum (FBS) (Life Technologies, Gibco®, catalog number: 10438-026 )
100x Antibiotic-antimycotic (Life Technologies, InvitrogenTM, catalog number: 15240062 )
Determination and purification of CD4+ Treg and naïve T cells
Allophycocyanin (APC)-conjugated anti-CD4 antibody (clone GK1.5) (eBioscience, catalog number: 17-0041 )
Alexa Fluor 488-conjugated anti-CD25 antibody (clone PC61.5) (eBioscience, catalog number: 53-0251 )
Phycoerythrin (PE) -conjugated anti-CD62L antibody (clone MEL-14) (eBioscience, catalog number: 12-0621 )
PE-conjugated anti-Foxp3 antibody (clone FJK-16s) (eBioscience, catalog number: 12-5773 )
Fix/Perm buffer (eBioscience, catalog number: 00-5123 , 00-5223 )
10x Permeabilization Buffer (eBioscience, catalog number: 00-8333 )
Dynal® Mouse CD4 Cell Negative Isolation Kit (Life Technologies, InvitrogenTM, catalog number: 114-15D )
Heat-inactivated fetal bovine serum (FBS) (Life Technologies, Gibco®, catalog number: 10438-026)
FACS buffer (see Recipes)
Sorted cells collection medium (see Recipes)
Differentiation of Treg in vitro
NA/LE Hamster anti-mouse CD3ε monoclonal antibody (clone 145-2C11) (BD, catalog number: 553057 )
NA/LE Hamster anti-mouse CD28 monoclonal antibody (clone 37.51) (BD, catalog number: 553294 )
Antibiotic-antimycotic (Life Technologies, InvitrogenTM, catalog number: 15240062)
RPMI 1640 supplemented with 50 µM β-mercaptoethanol and antibiotic-antimycotic (Life Technologies, InvitrogenTM, catalog number: 15240062)
Recombinant hTGFβ1 (R&D Systems, catalog number: 100-B ) (see Recipes)
Recombinant mIL-2 (R&D Systems, catalog number: 402-ML ) (see Recipes)
Equipment
One milliliter syringe (BD, catalog number: 309628 )
Sterile scissors
P60 petri dishes (Greiner Bio-One GmbH, catalog number: 628160 )
Sterile 70-μm filter (BD, catalog number: 352350 )
Syringe filter (0.22 μm) (Corning, catalog number: 431219 )
FACSAria cell sorter
FACSAria II (BD, catalog number: 642510 )
Airstream Class II BSC (ESCO Corporation)
15 ml conical tubes (BD, catalog number: 352095 )
5 ml polystyrene round bottom tubes (BD, catalog number: 352052 )
Twenty four well plates (Greiner Bio-One GmbH, catalog number: 662160 )
Centrifuge 5810R (Eppendorf, catalog number: 5811 000,622 )
Dynal MCP-L (Life Technologies, InvitrogenTM, catalog number: 120.21D )
CO2 incubator
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Dalotto-Moreno, T., Rabinovich, G. A. and Salatino, M. (2014). In vitro Regulatory T cells Differentiation From Naïve T Cells. Bio-protocol 4(6): e1075. DOI: 10.21769/BioProtoc.1075.
Download Citation in RIS Format
Category
Cancer Biology > Tumor immunology > Cell biology assays
Cell Biology > Cell viability > Cell proliferation
Immunology > Immune cell isolation > Lymphocyte
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
Hello, why you did not add anti-mouse IFNG and anti-mouse IL4? could you help me figure out it?
1 Answer
4 Views
Sep 3, 2024
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,076 | https://bio-protocol.org/exchange/protocoldetail?id=1076&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Determination of Mutation Frequency During Viral DNA Replication
Modesto Redrejo-Rodríguez
JR Javier M. Rodríguez
Cristina Suárez
MS María L. Salas
Published: Vol 4, Iss 6, Mar 20, 2014
DOI: 10.21769/BioProtoc.1076 Views: 8669
Original Research Article:
The authors used this protocol in Sep 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2013
Abstract
This protocol is a simple method for evaluating mutation frequency during African swine fever virus (ASFV) replication, although it could be used also for other DNA viruses (poxvirus, herpesvirus, mimivirus, etc) with minor modifications. In the original Carrascosa et al. (1982), the protocol was carried out with two cloned viruses, BA71Vc (a purified clone from BA71V wild type strain) and vΔpolX (lacking the reparative polymerase, pol X, gene), and two different cell types that can be infected by ASFV, Vero cells and swine macrophages. To facilitate the sequence comparison, a genome fragment containing the B646L gene was amplified by PCR and blunt-end cloned. This gene codes for the major capsid protein (p72) and multiple sequences can be found in the database, so the mutations found could be compared with natural gene variations. The cloned fragment can be either sequenced directly from bacteria colonies or from miniprep purified DNA.
Keywords: DNA replication DNA repair Fidelity Oxidative DNA damage Nucleo-citoplasmatic large DNA virus
Materials and Reagents
Virus supernatants (previously titrated)
XL-1 Blue competent bacterial cells (Stratagene, catalog Number: 200249 )
Dulbecco modified Eagle medium (DMEM) (Sigma-Aldrich, catalog number: D5523 )
Fetal Bovine Serum (Sigma-Aldrich, catalog number: F7524 )
Vero Cells (ATCC, catalog number: CCL-81 TM)
Alveolar swine macrophages (Carrascosa et al., 1982)
Swine serum (obtained during the macrophages purification)
Kapa HiFi polymerase (Kapa Biosystems, catalog number: KK2101 )
Note: This polymerase kit includes buffer and dNTPs.
Primer B646L forward (Sigma-Aldrich)
5’ATGGCATCAGGAGGAGCTTTTTGTCTTATT
Primer B646L reverse (Sigma-Aldrich)
5’TTAGGTACTGTAACGCAGCACAGCTGAACCG
CloneJet PCR Cloning Kit (Thermo Fisher Scientific, catalog number: K1231 )
Note: This kit includes the pJET plasmid, DNA ligase and reaction buffer.
Agarose for DNA electrophoresis (Lonza, SeaKem® LE Agarose, catalog number: 50000 )
TAE buffer (Sambrook and Russell, 2001)
TE buffer (pH 8.0) (Sambrook and Russell, 2001)
5x Agarose Gel loading dye (QIAGEN, catalog number: 239901 )
QIAquick gel extraction kit (QIAGEN, catalog number: 28704 )
LB-agar plates (Sambrook and Russell, 2001)
Ampicillin (Sigma-Aldrich, catalog number: A0166 )
Double-distillated or Milli-Q water
Equipment
MW24 plates (BD Biosciences, Falcon®, catalog number: 353047 )
1.5 ml Eppendorf tubes
Cell culture incubator
Refrigerated benchtop centrifuge (e.g. Hettich 200 R)
Thermal-cycler for PCR
Electrophoresis system for agarose gels and UV-documentation device to visualize the DNA bands
Waterbath
Software
Diverse bioinformatics software (e.g., Geneious or CLC Genomics Workbench) (optional)
MS Excel, Prism Graph Pad or SPSS (optional)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Redrejo-Rodríguez, M., Rodríguez, J. M., Suárez, C. and Salas, M. L. (2014). Determination of Mutation Frequency During Viral DNA Replication. Bio-protocol 4(6): e1076. DOI: 10.21769/BioProtoc.1076.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > DNA
Molecular Biology > DNA > Mutagenesis
Molecular Biology > DNA > PCR
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,077 | https://bio-protocol.org/exchange/protocoldetail?id=1077&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
RNA Isolation and Northern Blot Analysis
YL Ying Liao
TF To Sing Fung
MH Mei Huang
SF Shouguo Fang
YZ Yanxin Zhong
Dingxiang Liu
Published: Vol 4, Iss 6, Mar 20, 2014
DOI: 10.21769/BioProtoc.1077 Views: 32089
Original Research Article:
The authors used this protocol in Jul 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2013
Abstract
The northern blot is a technique used in molecular biology research to study gene expression by detection of RNA in a sample. With northern blotting it is possible to observe particular gene expression levels during differentiation, morphogenesis, as well as abnormal or diseased conditions. Here, we examine ATF3, ATF4, and GADD153 gene expression profiles by northern blot in Vero cells and H1299 cells after IBV infection. RNA was extracted in IBV (infectious bronchitis virus) infected cells and electrophoresis was used to separate the RNA sample. RNA was transferred from the electrophoresis gel to the blotting membrane by capillary transfer. Specific mRNA was detected with hybridization probes complementary to part of target sequence. The probes were prepared by RT-PCR and labeled by digoxigenin (DIG) using DIG labeling kit.
Materials and Reagents
Vero cells (kidney epithelial cells extracted from an African green monkey) (ATCC, catalog number: CCL-81 TM)
H1299 cells (human lung carcinoma cell line) (ATCC, catalog number: CRL-5803 TM)
The egg-adapted Beaudette strain of IBV (ATCC, catalog number: VR-22 )
Dulbecco modified Eagle medium (DMEM) (Life Technologies, Gibco®, catalog number: 11960-044 )
Note: It contains more vitamins and more glucose, as well as iron and is suitable for most types of cells.
Roswell Park Memorial Institute medium (RPMI) 1640 (Life Technologies, Gibco®, catalog number: 21870-076 )
Note: This medium contains a great deal of phosphate and is formulated for use in a 5% carbon dioxide atmosphere.
Trypsin/EDTA (Life Technologies, Gibco®, catalog number: 25200-072 )
TRIzol reagent (Life Technologies, Gibco®, catalog number: 15596-018 )
Chloroform (Thermo Fisher Scientific, catalog number: C/4960/17 )
Isopropanol (Thermo Fisher Scientific, catalog number: P/7507/17 )
Ethanol (Merck KGaA, catalog number: 1.00983.2500 )
RNase free water
Reverse transcriptase AMV (Roche Diagnostics, catalog number: 10109118001 )
Oligo (dT) (1st Base Biochemicals)
RNasin® ribonuclease inhibitor (Promega Corporation, catalog number: N2511 )
Primers (1st Base Biochemicals)
DIG labeling kit (Roche, catalog number: 11175025910 )
RNA loading buffer (New England Biolabs, catalog number: B0363S )
Agarose (1st Base Biochemicals, catalog number: BIO-100-500G )
Formaldehyde (Thermo Fisher Scientific, catalog number: F75P1GAL ))
Ethidium bromide (Bio-Rad Laboratories, catalog number: 1610433 )
HybondTM-N+ membrane (Amersham Biosciences, catalog number: RPN303B )
DIG Wash and Block Buffer Set (Roche Diagnostics, catalog number: 11585762001 )
DIG easy Hyb (Roche Diagnostics, catalog number: 11603558001 )
Anti-digoxigenin-AP fab fragments (Roche Diagnostics, catalog number: 11093274910 )
CDP-Star (Roche Diagnostics, catalog number: 12041677001 )
Amersham hyperfilm ECL (Amersham Biosciences, catalog number: 28906837 )
70% RNase-free ethanol
Tris(hydroxymethyl)aminomethane (Tris base) (Promega Corporation, catalog number: H5135 )
Acetic acid (Glacial) (Merck KGaA, catalog number: 1.00063.2500 )
3-(4-morpholino) propane sulfonic acid (MOPS) (Thermo Fisher Scientific, catalog number: BP308-500 )
Sodium acetate.3H2O (Thermo Fisher Scientific, catalog number: S207-10 )
Sodium Citrate (Thermo Fisher Scientific, catalog number: S25545 )
10x TAE Electrophoresis Buffer (1 L) (see Recipes)
10x MOPS buffer (1 L) (see Recipes)
1x MOPS buffer (1 L) (see Recipes)
1.3% Formaldehyde Agarose gel (see Recipes)
20x SSC buffer (1 L) (see Recipes)
2x SSC, 0.1% SDS (1 L) (see Recipes)
0.1x SSC, 0.1% SDS (see Recipes)
Equipment
100 mm cell culture dishes (Corning, catalog number: 430167 )
0.2 ml thin-wall Gene-Amp PCR tube (Corning, Axygen®, catalog number: PCR-02-C )
FormaTM Steri-CycleTM CO2 Incubators (Thermo Fisher Scientific, catalog number: 201370 )
OLYMPUS CKX31 microscope
Eppendorf centrifuge 5415R
NanoDrop (Thermo Fisher Scientific, model: ND-1000 spectrophotometer )
Power Pac and electrophoresis tank (Bio-Rad Laboratories)
Tray
Glass plate
Tissue paper
CL-1000, ultraviolet crosslinker (UVP)
Hybaid Maxi 14 Hybridization Oven (Thermo Fisher Scientific)
Hybridization tubes
Kodak Biomax cassette (Eastman Kodak Company)
Kodak X-OMAT 2000 processor (Eastman Kodak Company)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Liao, Y., Fung, T. S., Huang, M., Fang, S., Zhong, Y. and Liu, D. (2014). RNA Isolation and Northern Blot Analysis. Bio-protocol 4(6): e1077. DOI: 10.21769/BioProtoc.1077.
Download Citation in RIS Format
Category
Microbiology > Microbial genetics > RNA
Molecular Biology > RNA > RNA extraction
Molecular Biology > RNA > RNA detection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,078 | https://bio-protocol.org/exchange/protocoldetail?id=1078&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Human Astrovirus Propagation, Purification and Quantification
SM Shauna Marvin
VM Victoria Meliopoulos
SS Stacey Schultz-Cherry
Published: Vol 4, Iss 6, Mar 20, 2014
DOI: 10.21769/BioProtoc.1078 Views: 11049
Original Research Article:
The authors used this protocol in Jul 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2013
Abstract
Astrovirus are small, nonenveloped, single-stranded RNA viruses that cause diarrhea in a wide variety of mammals and birds. Here, we describe astrovirus propagation, purification and titration. The Caco-2 human intestinal adenocarcinoma cell line is most widely used for studying astrovirus, although other cell lines, such as 293, T84 and LLC-MK2 can be used for propagation. However, Caco2 cells are desirable for their ability to form a differentiated intestinal epithelium, mimicking the human intestine and providing a realistic model for astrovirus growth and propagation.
Keywords: Astrovirus Propagation Purification Titration Intestine
Materials and Reagents
Caco2 cell line (ATCC, catalog number: HTB-37 )
MEM (Mediatech, Cellgro®, catalog number: 10-010-CV , or equivalent)
Glutamax (Life Technologies, Gibco®, catalog number: 35050-061 , or equivalent),
Sodium pyruvate (Life Technologies, Gibco®, catalog number: 11360-070 , or equivalent)
10% heat-inactivated FBS
Porcine type 1x trypsin (Sigma-Aldrich, catalog number: T-0303 , or equivalent)
MgCl2
Sucrose
Phosphate buffered saline (PBS)
Bovine serum albumin Fraction V (BSA) (Life Technologies, Gibco®, catalog number: 15260-037 )
Formaldehyde (Polysciences, catalog number: 18814 )
TritonX-100 (Sigma-Aldrich, catalog number: 9002-93-1 )
Normal goat serum (Sigma-Aldrich, catalog number: 191356 )
4',6-diamidino-2-phenylindole (DAPI) (Life Technologies, Molecular Probes®, catalog number: D1306 )
Astrovirus 8E7 mouse monoclonal antibody (hybridoma cell line) (ATCC, catalog number: HB-11945 , or equivalent)
Fluorescent-conjugated anti-mouse IgG antibody [Life Technologies, Alexa Fluor® 488 Goat Anti-Mouse (H+L) Antibody, catalog number: A11001 , or equivalent]
Astrovirus (not commercially available)
Bleach (clorox or stored brand equivalent)
Virkon S (DuPont)
Caco2 cell culture medium (see Recipes)
Serum-free (SF) Caco2 medium (see Recipes)
TN buffer (see Recipes)
Equipment
Biosafety cabinet
Gloves
Labcoat
Beckman ultracentrifuge tubes (ultra-clear 9/16 x 3 ½ in) (Beckman Coulter, catalog number: 344059 )
Beckman ultracentrifuge (that can reach 34,000 rpm and 4 ºC)
SW41 rotor
Pierce Extra-Strength Slide-A-Lyzer 10K molecular weight cassette (Pierce, catalog number: 66383 or 66380 )
Laminar flow hood
Syringe
Liquid nitrogen
Water bath
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Marvin, S., Meliopoulos, V. and Schultz-Cherry, S. (2014). Human Astrovirus Propagation, Purification and Quantification. Bio-protocol 4(6): e1078. DOI: 10.21769/BioProtoc.1078.
Download Citation in RIS Format
Category
Microbiology > Microbial cell biology > Cell isolation and culture
Cell Biology > Cell isolation and culture > Cell growth
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
1 Q&A
Question about the detaching of caco-2 cells from the 96-well plate during the HAstV-1 FFA process
0 Answer
11 Views
Jan 15, 2023
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,079 | https://bio-protocol.org/exchange/protocoldetail?id=1079&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Helicase Assays
XW Xin Wang
JL Jing Li
JD Jason Diaz
JY Jianxin You
Published: Vol 4, Iss 6, Mar 20, 2014
DOI: 10.21769/BioProtoc.1079 Views: 14616
Original Research Article:
The authors used this protocol in Aug 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2013
Abstract
Helicases are a class of enzymes which are motor proteins using energy derived from ATP hydrolysis to move directionally along a nucliec acid phosphodiester backbone (such as DNA, RNA and DNA-RNA hybrids) and separate two annealed nucleic acid strands. Many cellular processes, such as transcription, DNA replication, recombination and DNA repair involve helicase activity. Here, we provide a protocol to analyze helicase activities in vitro. In this protocol, the DNA helicase protein Merkel cell polyomavirus large T-antigen was expressed in the mammalian cell line HEK293 and immoblized on an IgG resin. The helicase assay is performing while the protein is immoblized on IgG resin.
Keywords: Helicase assay Large T-antigen MCV
Materials and Reagents
HEK293
Dulbecco’s modified eagle medium high glucose (DMEM) (Life Technologies, catalog number: 11965-084 )
Fetal bovine serum (FBS) (Hyclone, catalog number: SH30071.03 )
DPBS without Ca2+ and Mg2+ (Life Technologies, catalog number: 14190136 )
Trypsin/EDTA (Life Technologies, catalog number: 25300054 )
IgG sepharose6 fast flow (GE, catalog number : 17-0969-01 )
M13mp18 DNA (New England Biolab, catalog number: N4040S )
DNA oligo: CCAGGGTTTTCCCAGTCACGACGTTGTAAAC
DNA polymerase I klenow fragment (New England Biolab, catalog number: M0210S )
100 mM dCTP (Promega Corporation, atalog number: U1221 )
100 mM dGTP (Promega Corporation, catalog number: U1211 )
100 mM dATP (Promega Corporation, catalog number: U1201 )
100 mM ATP (Roche Diagnostics, catalog number: 11140965001 )
[gamma-32P] dATP
DNA loading dye
Polyacrylamide gel
1 M Tris (pH 7.6) (see Recipes)
0.1 M Tris (pH 7.6) (see Recipes)
5 M NaCl stock (see Recipes)
1 M MgCl2 stock (see Recipes)
10 mM MgCl2 (see Recipes)
0.1 M PMSF (Sigma-Aldrich, catalog number: 78830 ) (see Recipes)
0.1 M DTT (Sigma-Aldrich, catalog number: 43819 ) (see Recipes)
1 mg/ml Aprotinin (Roche Diagnostics, catalog number: 10236624001 ) (see Recipes)
1 mg/ml Leupeptin (Roche Diagnostics, catalog number: 11017101001 ) (see Recipes)
1 mg/ml Pepstatin A (Roche Diagnostics, catalog number: 10253286001 ) (see Recipes)
10% NP40 stock (see Recipes)
1% Bovine serum albumin (BSA) (Sigma-Aldrich) (see Recipes)
10 mg/ml BSA (see Recipes)
10x TBE buffer (see Recipes)
IPP400 buffer (see Recipes)
Helicase assay buffer (see Recipes)
Stop buffer (see Recipes)
Acrylamide gel (see Recipes)
Equipment
20 G needle (BD, catalog number: 305175 )
PowerPac basic power supply (Bio-Rad Laboratories, catalog number: 164-5050 )
Mini-Protean tetra cell (Bio-Rad Laboratories, catalog number: 165-8000 )
Sorvall RC 6 plus centrifuge and Sorvall SA-600 rotor (Thermo Fisher Scientific)
37 °C, 5% CO2 cell culture incubator
Typhoon 9410 variable mode Imager
Storage phosphor screens and cassettes (GE)
Fisher Vortex Genie 2 (Thermo Fisher Scientific, catalog number: 12-812 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Wang, X., Li, J., Diaz, J. and You, J. (2014). Helicase Assays. Bio-protocol 4(6): e1079. DOI: 10.21769/BioProtoc.1079.
Download Citation in RIS Format
Category
Microbiology > Microbial biochemistry > Protein
Biochemistry > Protein > Activity
Biochemistry > Protein > Expression
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,080 | https://bio-protocol.org/exchange/protocoldetail?id=1080&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Transpharyngeal Exposure of GnRH Neurons
Stephanie Constantin
AH Allan E. Herbison
Published: Vol 4, Iss 6, Mar 20, 2014
DOI: 10.21769/BioProtoc.1080 Views: 8983
Edited by: Xuecai Ge
Original Research Article:
The authors used this protocol in May 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2013
Abstract
The neurons secreting gonadotropin-releasing hormone (GnRH) control fertility in all mammalian species. However, investigations of this neuronal population are difficult as the cell bodies of the approximately 800 GnRH neurons are scattered through the basal forebrain ranging from the olfactory bulbs through to the base of the hypothalamus. While acute brain slice preparations enable the electrophysiological characteristics of these cells to be determined in vitro, their topography has made investigations in vivo extremely difficult. We detail here a surgical approach that allows GnRH neurons at the base of the hypothalamus to be assessed in vivo in the anesthetized mouse (Figure 1). This procedure enables electrical recordings to be made from neurons located on the ventral surface of the mouse brain (Constantin et al., 2013).
Keywords: GnRH neurons In vivo Electrophysiology
Figure 1. Exposure of AHA-GnRH neurons
Materials and Reagents
GnRH-GFP mice (Spergel et al., 1999; Suter et al., 2000)
Pentobarbital
CaCl2
MgCl2
HEPES
NaHCO3
D-glucose
Sucrose
O2 Medical Grade
5% CO2 Carbogen
Artificial cerebrospinal fluid (aCSF) (see Recipes)
Equipment
Set Up
Metal plate 200 x 200 x 1 mm
Binocular microscope (Leica Microsystems, model: M80 )
Cold light source (Leica Microsystems, model: CLS 150X )
Upright microscope (OLYMPUS, model: BX51 )
Long working distance objective (20x M Plan Apo NA 0.42) (Mitutuyo, catalog number: 378-804-2 )
Blue fluorescence illumination (OLYMPUS, model: U-MGGFPHQ ) (excitation wavelength centered at 470 nm with high pass emission filtered at 517 nm)
AC/DC bioamplifier (CWE, model: BMA-200 )
Analogic-to-digital converter (Molecular Devices, model: Digidata 1332A )
Subcutaneous electrodes (platinum ~20 G) hooked to the bioamplifer
Ventilator (CWE, model: SAR-830/P) with the following parameters: 100 breaths/min, with constant pressured cycles set at 1.4 cm H2O, 0.3 s/inspiration, O2 90–80 ml/min
Body temperature controller (CWE, model: CT-1000) with heat pad and rectal probe, set at 37 °C
Surgery
Stainless steel blocks (L x W x H: 60 x 40 x 10 mm)
Home-made block, inclinable with 2 screw = “pillow” (Figure 2)
Figure 2. Pillow
Home-made block, inclinable with 2 screw and holding a stainless steel spatula narrowed down to 3 mm wide with a fine file to fit in the mouth of a mouse, bent into hook (about 0.80 cm diameter) = central separator (Figure 3)
Figure 3. Central separator
Syringe (26 G needle) for intraperitoneal and intramuscular injections
Syringe (23 G needle) for chilled aCSF
Forceps Dumont No 5
Small scissors
Spring scissors 8 mm blades (Fine Science Tools, catalog number: 15024-10)
Bone scissors Bone Cutting Spring Scissors (Fine Science Tools, catalog number: 16144-13)
Agricola retractor 3.5 cm spread (Fine Science Tools, catalog number: 17005-04)
Micro-drill (GEBR Brasseler; Ideal Micro-Drill) (PW Stoelting, catalog number: 58610)
Round burr tip (o.d. 0.5 mm)
Bone wax (Johnson & Johnson, Ethicon, model: W810)
Syringe body holding a 23 G needle taped into a hook = needle hook
Dental vacuum connected with 1-ml syringe body holding a cut 23 G needle (23 G-needle dental vacuum) or 1-ml insulin syringe holding a cut 30 G needle (30 G-needle dental vacuum)
50-ml syringe for inflow (gravity) with 1 home-made magnetic holder
Peristaltic pump for outflow with a cut 23 G needle held by home-made magnetic holder (Figure 4)
Figure 4. Magnetic holder
Cotton balls
Tissue paper, separated before use
Lab tape
Cotton sewing thread No 50
Super glue with brush
Polyethylene catheter (o.d. 0.96 x i.d. 0.58 mm)
Lighter
Software
ClampEx pCLAMP 10 Electrophysiology Data Acquisition and Analysis Software
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite： Readers should cite both the Bio-protocol article and the original research article where this protocol was used:
Constantin, S. and Herbison, A. E. (2014). Transpharyngeal Exposure of GnRH Neurons. Bio-protocol 4(6): e1080. DOI: 10.21769/BioProtoc.1080.
Constantin, S., Iremonger, K. J. and Herbison, A. E. (2013). In vivo recordings of GnRH neuron firing reveal heterogeneity and dependence upon GABAA receptor signaling. J Neurosci 33(22): 9394-9401.
Download Citation in RIS Format
Category
Neuroscience > Neuroanatomy and circuitry > Animal model
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,081 | https://bio-protocol.org/exchange/protocoldetail?id=1081&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation and Culture of Neurospheres for the Study of Pathogenesis of Prion Disease
YI Yoshifumi Iwamaru
TT Takato Takenouchi
HK Hiroshi Kitani
Published: Vol 4, Iss 6, Mar 20, 2014
DOI: 10.21769/BioProtoc.1081 Views: 21622
Reviewed by: Oneil G. Bhalala
Original Research Article:
The authors used this protocol in Aug 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2013
Abstract
Neurosphere contains neural stem cells that are capable of self-renewal and multilineage differentiation including neurons, astrocytes, and oligodendrocytes (Gage, 2000). Cell culture model using differentiated neurosphere cultures are suggested to be a valuable tool for studying the pathogenesis of prion disease at the cellular level (Iwamaru et al., 2013). This protocol describes the procedure for a culture of whole brain-derived neurospheres from newborn mouse brains. Neurosphere formation steadily occurs within a week from the cultures of neonatal whole brains and these cells have stem cell properties.
Keywords: Neural stem cell Isolation and culture Neurosphere Neonatal mouse brain Prion protein
Materials and Reagents
Newborn mice (age at one day after birth)
Present culture method can be applied to any mouse strains, regardless of sex. We used prion protein overexpressing transgenic mouse and prion protein-deficient mouse for our present study (Iwamaru et al., 2013).
Dulbecco's phosphate buffered saline without Ca and Mg (D-PBS) (Nacalai Tesque, catalog number: 14249-95 )
Di‐sodium dihydrogen ethylenediamine tetraacetate dihydrate (EDTA) (Nacalai Tesque, catalog number: 151-11 )
Hank's balanced salt solution (HBSS) (Sigma-Aldrich, catalog number: H8264 )
Dulbecco's modified Eagle's medium/nutrient mixture F-12 Ham (DMEM/F12 Ham) (Sigma-Aldrich, catalog number: D8437 )
N-2 supplement (Life Technologies, catalog number: 17502-048 )
Penicillin-Streptomycin (Sigma-Aldrich, catalog number: P0781 )
Fetal bovine serum (FBS) (Hyclone, catalog number: SH30070.03 )
Accutase (Innovative Cell Technologies, catalog number: AT104 )
Trypsin (Sigma-Aldrich, catalog number: T8003 ) (see Recipes)
Deoxyribonuclease I (DNase I) (Worthington Biochemical Corporation, catalog number: LS002139 ) (see Recipes)
Epidermal growth factor human (EGF) (Sigma-Aldrich, catalog number: E9644 ) (see Recipes)
Fibroblast growth factor-basic human (bFGF) (Sigma-Aldrich, catalog number: F0291 ) (see Recipes)
Bovine serum albumin (BSA) (Sigma-Aldrich, catalog number: A9576 ) (see Recipes)
Neurosphere basal medium (see Recipes)
Equipment
Falcon 15 ml conical centrifuge tube (Corning, catalog number: 352096 )
Falcon 100 mm cell culture dish (Corning, catalog number: 353003 )
Nunc 60 mm dish with HydroCell surface (Thermo Fisher Scientific, catalog number: 174912 )
Disposable micro homogenizer (TaKaRa Bio, TaKaRa BioMasher Standard, catalog number: 9791A )
Aerosol resistant tip (ART 1000 REACH tips) (Thermo Fisher Scientific, model: 2079 )
Membrane filter (EMD Millipore, Millex-GV 0.22 μm, 33 mm)
Dissecting microscope (Olympus, model: SZH10 )
Centrifuge (KUBOTA, model: 5220 )
CO2 incubator (set at 37 °C and 5% CO2-95% air)
Reciprocal shaker (TAITEC, model: NR-1 )
Laminar flow hood (W800 x H1050 x D500 mm) (Panasonic Corporation, SANYO, model: MCV-710ATS )
Scissors (NAPOX B-5H, 154 mm; NAPOX B-1112H, 110 mm), fine forceps (NAPOX A-5, 110 mm; NAPOX MA-45, 110 mm), spatula (Laboran 9-891-03, 180 mm)
Ice bucket
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Neuroscience > Development > Neuron
Stem Cell > Adult stem cell > Neural stem cell
Cell Biology > Cell isolation and culture > Cell differentiation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,082 | https://bio-protocol.org/exchange/protocoldetail?id=1082&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Neural Stem Cell Differentiation and Prion Infection
YI Yoshifumi Iwamaru
TT Takato Takenouchi
HK Hiroshi Kitani
Published: Vol 4, Iss 6, Mar 20, 2014
DOI: 10.21769/BioProtoc.1082 Views: 10918
Reviewed by: Oneil G. Bhalala
Original Research Article:
The authors used this protocol in Aug 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2013
Abstract
Prion diseases are transmissible, fatal, neurodegenerative diseases in human and animals. The molecular basis of neurodegeneration in prion diseases is largely unclear. Developing a cellular model capable of monitoring prion-induced cytotoxicity would be a promising approach for better understanding the prion pathogenesis. One candidate cellular assay is a model based on neurospheres, which contains neural stem cells (NSCs). Both undifferentiated and differentiated NSCs have been demonstrated to be permissive to prion infection, and prion-induced cytopathic changes in differentiated neruosphere cultures were reported (Iwamaru et al., 2013). This protocol describes the procedure to induce differentiation of NSCs from transgenic mice overexpressing prion protein (tga20 mice) into cultures susceptible for prion infection.
Keywords: Neural stem cell Differentiation culture Prion infection Cellular pathogenesis
Materials and Reagents
Mouse-adapted prion infected mice brains (terminally ill CD-1 female mice intracerebrally inoculated with mouse adapted scrapie, at ca. 6 months of age)
Ethanol (99.5% EtOH) (Nacalai Tesque, catalog number: 14713-95 )
Dulbecco's phosphate buffered saline without Ca and Mg (D-PBS) (Nacalai Tesque, catalog number: 14249-95 )
Hank's balanced salt solution (HBSS) (Sigma-Aldrich, catalog number: H8264 )
Dulbecco's modified Eagle's medium/nutrient F-12 Ham (DMEM/F12 Ham) (Sigma-Aldrich, catalog number: D8437 )
N-2 supplement (Life Technologies, catalog number: 17502-048 )
Bovine serum albumin solution (30% BSA in D-PBS) (Sigma-Aldrich, catalog number: A9576 )
Accutase (Innovative Cell Technologies, catalog number: AT-104 )
99% Acetone (Nacalai Tesque, catalog number: 00310-95 )
Water for embryo transfer (sterile-filtered) (Sigma-Aldrich, catalog number: W1503 )
35% hydrochlolic acid (HCl) ( Nacalai Tesque, catalog number: 18321-05 )
Penicillin-Streptomycin (Sigma-Aldrich, catalog number: P0781 )
Epidermal growth factor human (EGF) (Sigma-Aldrich, catalog number: E9644 ) (see Recipes)
Fibroblast growth factor-basic human (bFGF) (Sigma-Aldrich, catalog number: F0291 ) (see Recipes)
Neurosphere basal medium (see Recipes)
Fibronectin (Sigma-Aldrich, catalog number: F4759 ) (see Recipes)
Glass wash solution (see Recipes)
Differentiation-inducing medium (see Recipes)
Equipment
Falcon 15 ml conical centrifuge tubes (Corning, catalog number: 352096 )
Falcon 50 ml conical centrifuge tubes (Corning, catalog number: 352070 )
Corning primaria 6 well clear multiwell plate (Corning, catalog number: 353846 )
Nunc 60mm dish with HydroCell surface (Thermo Fisher Scientific, catalog number: 174912 )
Glass coverslips (22 x 22 mm) (Asahi Techno Glass Corporation, catalog number: 2918 )
ART 1000 REACH tips (Thermo Fisher Scientific, catalog number: 2079 )
Multi-beads shocker cell disruptor (Yasui Kikai Corporation)
2 ml screw-cap micro centrifuge tubes-freestanding (Sarstedt K.K., catalog number: 72.664.002 )
Zirconia ball (1 mm diameter) (As One YTZ1)
Plastic square dishes (Eiken Chemical, model: AW2000 )
1.5 ml screw-cap micro centrifuge tubes (Sarstedt K.K., catalog number: 72.687 .028J)
Sealed sonicator (Biorupter®, model: UCD250 )
Centrifuge (Kubota Corporation, model: 5220 )
CO2 incubator (set at 37 °C and 5% CO2-95% air)
Reciprocal shaker (Taitec, model: NR-1 )
Bio-safety cabinet (ORIENTAL GIKEN, model: LAD-1300XB3 )
Deep freezer (set at -80 °C)
Fine forceps (NAPOX A-5, 110 mm; NAPOX MA-45, 110 mm)
C-Chip disposable hemocytometer (iN CYTO, DHC-N01 Neubauer Improved)
Electric balance (Mettler Toledo, model: AB104-S )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Iwamaru, Y., Takenouchi, T. and Kitani, H. (2014). Neural Stem Cell Differentiation and Prion Infection. Bio-protocol 4(6): e1082. DOI: 10.21769/BioProtoc.1082.
Download Citation in RIS Format
Category
Neuroscience > Development > Neuron
Stem Cell > Adult stem cell > Neural stem cell
Cell Biology > Cell signaling > Stress response
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,083 | https://bio-protocol.org/exchange/protocoldetail?id=1083&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measurement of CD8 and CD4 T Cell Responses in Mouse Lungs
CF Craig Fett
JZ Jincun Zhao
SP Stanley Perlman
Published: Vol 4, Iss 6, Mar 20, 2014
DOI: 10.21769/BioProtoc.1083 Views: 15918
Original Research Article:
The authors used this protocol in Jun 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2013
Abstract
Study of the adaptive immune response to a viral challenge in an animal model often includes analysis of the T cell response. Here we discuss in detail the methods that are used to characterize the CD8 and CD4 T cell response following viral challenge in the lung.
Keywords: CD4 T cells CD8 T cells Coronavirus Lung infection Lung preparation
Materials and Reagents
Mice (NCI) (BALB/c or C57BL/6, 4 weeks to 18+ months)
Isofluorane (USP inhalation vapour, liquid) ( NDC: 57319-559-06 )
Dulbecco’s modified eagle medium high glucose (DMEM) (Life Technologies, Gibco®, catalog number: 11965092 )
Ketaset III ketamine HCl injection (USP 100 mg/ml) (DEA Schedule II Drug) (NDC: 0856-2013-01 )
100 mg/ml AnaSed injection xylazine (Lloyd Laboratories, NADA number: 139-236 )
0.9% sodium chloride irrigation (USP) (Baxter, catalog number: 2F7124 )
1x Dulbecco’s phosphate buffered saline (DPBS) (Life Technologies, Gibco®, catalog number: 14190-144 )
Collagenase D (Roche Diagnostics, catalog number: 11088882001 )
DNase I (Roche Diagnostics, catalog number: 10104159001 )
Hank’s balanced salt solution (HBSS) (Life Technologies, Gibco®, catalog number: 14025 )
L-Glutamine (200 mM) (Life Technologies, Gibco®, catalog number: 25030-081 )
Hepes (1 M) (Life Technologies, Gibco®, catalog number: 15630-080 )
Penicillin streptomycin (Life Technologies, Gibco®, catalog number: 15140-122 )
RPMI medium 1640 (Life Technologies, Gibco®, catalog number: 11875-093 )
2-Mercaptoethanol (Sigma-Aldrich, catalog number: M6250-100ML )
BD Golgi PlugTM (BD, catalog number: 554722 )
Normal rat serum (Life Technologies, InvitrogenTM, catalog number: 10710C )
FITC Anti-mouse CD8a clone 53-6.7 (0.5 mg/ml) (BD, catalog number: 553031 )
PerCP-cyanine5.5 Anti-mouse CD4 clone RM4-5 (eBioscience, catalog number: 45-0042-82 )
Fetal bovine serum (FBS) (Atlanta Biologicals, catalog number: S11150 )
Sodium azide (AMRESCO, catalog number: 0639 )
BD Cytofix/CytopermTM fixation and permeabilization solution (BD, catalog number: 554722)
BD Perm/WashTM buffer (BD, catalog number: 554722)
APC Anti-mouse IFNγ clone XMG1.2 (eBioscience, catalog number: 17-7311-82 )
Ketamine solution (see Recipes)
Digestion buffer (see Recipes)
RP10 (see Recipes)
FACS buffer (see Recipes)
Cell surface staining mixture (see Recipes)
Intracellular staining mixture (see Recipes)
Equipment
Dessicator (Narang Medical, catalog number: P37.1517P )
Precision glide needle (25 G x 5/8) (BD, catalog number: 305122 )
Gauze sponges (4 x 4 inch) (Pro Advantage® by NDC, catalog number: P157118 )
1 ml syringe (BD, catalog number: 309659 )
3 ml syringe (BD, catalog number: 309657 )
Cell strainer (70 µm nylon) (BD, catalog number: 352350 )
Tissue culture dishes (60 x 15 mm) (BD Biosciences, Falcon®, catalog number: 353002 )
96 well cell culture cluster (round bottom with Lid) (Corning, Costar®, catalog number: 3799 )
5 ml polystyrene round bottom tube (BD Biosciences, Falcon®, catalog number: 352054 )
Absorbent pads (Covidien, catalog number: 949 )
10 ml syringe (BD, catalog number: 309604 )
12 well cell culture cluster (flat bottom with lid) (Corning, Costar®, catalog number: 3513 )
1 ml graduate transfer pipette (Research Products International, catalog number: 147501-1S )
15 ml screw cap tube conical (Sarstedt AG, catalog number: 62.554.002 )
50 ml screw cap tube conical (Sarstedt AG, catalog number: 62.547.004 )
Biosafety hood
Spray bottle with 70% ethanol
Surgical scissors
Polystyrene foam
Pipetman p10
Pipetman p200
Pipetman p1000
CO2 incubator
Pipet aid
Small metal weighing spatula
Tweezers
Vortexer
Shaker rotisserie
Refrigerated tabletop centrifuge
Hemocytometer
Flow cytometer
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Fett, C., Zhao, J. and Perlman, S. (2014). Measurement of CD8 and CD4 T Cell Responses in Mouse Lungs. Bio-protocol 4(6): e1083. DOI: 10.21769/BioProtoc.1083.
Download Citation in RIS Format
Category
Immunology > Animal model > Mouse
Immunology > Immune cell function > Lymphocyte
Microbiology > Microbe-host interactions > Virus
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,084 | https://bio-protocol.org/exchange/protocoldetail?id=1084&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Virus Infection and Titration of SARS-CoV in Mouse Lung
CF Craig Fett
JZ Jincun Zhao
SP Stanley Perlman
Published: Vol 4, Iss 6, Mar 20, 2014
DOI: 10.21769/BioProtoc.1084 Views: 12679
Original Research Article:
The authors used this protocol in Jun 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2013
Abstract
Two critical steps when investigating an animal model of a virus infection are consistently successfully infecting animals and accurately determining viral titers in tissue throughout the course of infection. Here we discuss in detail how to infect mice with SARS-CoV and then quantify the titer of virus in the lung.
Keywords: SARS-CoV Virus titration Virus infection Lung preparation
Materials and Reagents
Mice (NCI) (Balb/c or C57BL/6, 4 weeks to 18+ months)
Vero E6 cells (ATCC, catalog number: CRL-1586 )
Isofluorane (USP inhalation vapour; liquid) ( NDC: 57319-559-06 )
Dulbecco’s modified eagle medium high glucose (DMEM) (Life Technologies, Gibco®, catalog number: 11965092 )
100 mg/ml ketaset III ketamine HCl injection (USP) (DEA Schedule II Drug) (NDC: 0856-2013-01 )
100 mg/ml AnaSed injection xylazine (Lloyd Laboratories, NADA number: 139-236 )
0.9% sodium chloride irrigation (USP) (Baxter, catalog number: 2F7124 )
1x Dulbecco’s phosphate buffered saline (DPBS) (Life Technologies, Gibco®, catalog number: 14190-144 )
Formaldehyde solution (Sigma-Aldrich, catalog number: 252549 ) (37 wt.% in H2O)
Crystal violet (Sigma-Aldrich, catalog number: C0775 )
25 mM DMEM with hepes (Life Technologies, Gibco®, catalog number: 32430 )
200 mM L-Glutamine (Life Technologies, Gibco®, catalog number: 25030-081 )
Fetal bovine serum (FBS) (Atlanta Biologicals, catalog number: S11150 )
MEM non-essential amino acids (Life Technologies, Gibco®, catalog number: 11140-050 )
50 mg/ml gentamicin sulfate (Lonza, catalog number: 17-518Z )
Penicillin streptomycin (Life Technologies, Gibco®, catalog number: 15140-122 )
DMEM (Life Technologies, Gibco®, catalog number: 12100-046 )
Agarose (optimized grade) (Research Products International, catalog number: A20090 )
Ketamine solution (see Recipes)
Culture media (see Recipes)
Overlay media (see Recipes)
Equipment
Biosafety hood in a biosafety level 3 facility
Absorbent pads (Covidien, catalog number: 949)
2 ml micro tube (Sarstedt AG, catalog number: 72.694.006 )
5 ml syringe (BD, catalog number: 309646 )
75 cm2 cell culture flask (canted neck, 0.2 µM vent cap) (Corning, catalog number: 430641 )
12 well cell culture cluster (flat bottom with lid) (Corning, Costar®, catalog number: 3513 )
48 well cell culture cluster (flat bottom with lid) (Corning, Costar®, catalog number: 3548 )
10 ml stripette (Corning, Costar®, catalog number: 3548)
35 ml closed tissue grinder system (Fisher Scientific, catalog number: 02-542-08 )
Dessicator (Narang Medical, catalog number: P37.1517P )
Gauze Sponges (4 x 4 inch) (Pro Advantage® by NDC, catalog number: P157118 )
1 ml syringe (BD, catalog number: 309659 )
Precision glide needle (25 G x 5/8) (BD, catalog number: 305122 )
Spray bottle with 70% ethanol
Surgical scissors
Polystyrene foam
Pipetman P200 micropipette
Pipetman P1000 micropipette
CO2 incubator
Pipet aid
Small metal weighing spatula
Tweezers
-80 °C freezer
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Fett, C., Zhao, J. and Perlman, S. (2014). Virus Infection and Titration of SARS-CoV in Mouse Lung. Bio-protocol 4(6): e1084. DOI: 10.21769/BioProtoc.1084.
Download Citation in RIS Format
Category
Microbiology > Microbe-host interactions > In vivo model
Microbiology > Microbe-host interactions > Virus
Cell Biology > Tissue analysis > Tissue isolation
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,085 | https://bio-protocol.org/exchange/protocoldetail?id=1085&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Individual-nucleotide-resolution UV Cross-linking and Immunoprecipitation (iCLIP) of UPF1
David Zünd
Oliver Mühlemann
Published: Vol 4, Iss 7, Apr 5, 2014
DOI: 10.21769/BioProtoc.1085 Views: 14047
Original Research Article:
The authors used this protocol in Aug 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2013
Abstract
The fate of mRNA, in particular its stability, localization and rate of translation is regulated by RNA binding proteins assembling to messenger ribonucleoprotein (mRNP) complexes. To investigate the transcriptome-wide RNA binding sites of UPF1, the core factor of nonsense-mediated mRNA decay (NMD), we performed individual-nucleotide-resolution UV cross-linking and immunoprecipitation (iCLIP) (Zund et al., 2013) followed by high-throughput sequencing. The presented protocol is optimized to investigate the RNA-binding sites of UPF1 and is based on previously described studies (Konig et al., 2010; Konig et al., 2011; Hafner et al., 2010). We want to thank the Group of Mihaela Zavolan (Swiss Institute of Bioinformatics, Basel, Switzerland) and Jernej Ule (Medical Research Council Laboratory of Molecualar Biology, Cambridge, UK) for technical support in setting up these experiments.
Materials and Reagents
Hela cells
DMEM (powder, high glucose) (Life Technologies, catalog number: 52100-039 )
Fetal Calf Serum (FCS) (BioConcept, Amimed, catalog number: 2-01F30-I )
Penicillin-Streptomycin solution (P/S) (1 unit/ml) (BioConcept, Amimed, catalog number: 4-01F00-H )
Ice
Trypsin-EDTA (T/E) (BioConcept, Amimed, catalog number: 5-5iF00-H )
Liquid nitrogen
DEPC BioChemica (AppliChem GmbH, catalog number: A0881, 0250 )
100x HaltTM Protease Inhibitor Cocktail (Thermo Fisher Scientific, catalog number: 1861279 )
RNase I (cloned) (100 U/µl) (Life Technologies, Ambion®, catalog number: AM2294 )
NaCl
Turbo DNase (Life Technologies, Ambion®, catalog number: AM2238 )
Goat anti-RENT1 antibody (Bethyl Laboratories, catalog number: A300-038A ) (UPF1 is also named RENT1.)
Phenol
Chloroform
Isoamyl alcohol
Dynabeads® Protein G (Life Technologies, catalog number: 10004D )
Alkaline Phosphatase Calf Intestinal (CIP) (New England Biolabs, catalog number: M0290S )
T4 RNA Ligase (10 U/µl) (Thermo Fisher Scientific, catalog number: EL0021 )
RNasin (Dundee Cell Products, catalog number: RS3100 )
3’ RNA linker (5'-P-UGAGAUCGGAAGAGCGGUUCAG-Puromycin-3') (Microsynth AG; http://www.microsynth.ch/)
Note: The RNA is delivered as 5 nmol aliquots, stored at -80 °C and dissolved in 25 µl MQ-water before usage.
γ-P32-ATP (10 µCi/µl) (HARTMANN ANALYTIC GmbH, catalog number: SCP-401 )
T4 Polynucleotide Kinase (10 U/µl) (Thermo Fisher Scientific, catalog number: EK0031 )
4x NuPAGE® LDS Sample Buffer (Life Technologies, catalog number: NP0007 )
20x NuPAGE® MOPS SDS Running Buffer (Life Technologies, catalog number: NP0001 )
Prestained Protein Ladder (broad range) (New England Biolabs, catalog number: P7710S )
GlycoBlueTM Coprecipitant (15 mg/ml) (Life Technologies, catalog number: AM9515 )
Proteinase K (recombinat PCR grade) (Roche Diagnostics, catalog number: 03 115 887 001 )
RT-primer (Microsynth AG)
Oligo sequence: 5'-P-NNNNAACAGATCGGAAGAGCGTCGTGGATCCTGAACCGC-3'
dNTP mix (10 mM each) (Thermo Fisher Scientific, catalog number: R0192 )
AffinityScriptTM Multi-Temp RT (Agilent, catalog number: 600109-51 )
40% Acrylamide-Solution (mix 19:1, molecular biology grade) (AppliChem GmbH, catalog number: A3658 )
Tetramethylethylendiamin (TEMED) (Sigma-Aldrich, catalog number: T22500-100ML )
Ammonium persulfate (APS) (Sigma-Aldrich, catalog number: A3678-100G )
PlusOne Repel-Silane ES (GE Healthcare, catalog number: 17-1332-01 )
Low Molecular Weight DNA Ladder (New England Biolabs, catalog number: N3233L )
SYBR® Gold Nucleic Acid Gel Stain (Life Technologies, catalog number: S11494 )
CircLigaseTM II ssDNA Ligase (EpiCentre, catalog number: CL9025K )
Cut-Oligo (5'- GTTCAGGATCCACGACGCTCTTCAAAA-3') (Microsynth AG)
BamHI (New England Biolabs, catalog number: R0136S )
P5_Solexa primer (Microsynth AG)
Oligo sequence: 5'-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3'
P3_Solexa primer (Microsynth AG)
Oligo sequence: 5'-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT-3'
Maximo Taq DNA 2X-Mastermix (GeneOn, catalog number: S114 )
DMEM-/- (per 900 ml) (see Recipes)
DMEM+/+ (per 500 ml) (see Recipes)
Phosphate-bufferd saline (PBS) (pH 7.4) (see Recipes)
Hypotonic gentle lysis buffer (pH 7.5) (RNase-free) (see Recipes)
IP-wash buffer (RNase-free) (see Recipes)
High salt wash buffer (pH 7.5) (RNase-free) (see Recipes)
PNK buffer (pH 7.5) (RNase-free) (see Recipes)
PNK buffer w/o DTT (pH 7.5) (RNase-free) (see Recipes)
Proteinase K buffer (pH 7.5) (RNase-free) (see Recipes)
TE buffer (pH 7.5) (RNase-free) (see Recipes)
10x Tris-borate buffer (TBE) (pH 8.0) (RNase-free) (see Recipes)
Acidic phenol (see Recipes)
Solution A (RNase-free) (see Recipes)
Solution B (RNase-free) (see Recipes)
Loading buffer for PAA-urea gel (pH 8.0) (RNase-free) (see Recipes)
10x DNA loading buffer (see Recipes)
DEPC treated water/buffer (see Recipes)
3 M NaOAc (pH 4.6 and 5.5) (RNAse-free) (see Recipes)
RNA ligation mix (see Recipes)
Kinase mix (see Recipes)
CircLigation mix (see Recipes)
Oligo annealing mix (see Recipes)
PCR master mix (see Recipes)
Equipment
Pure water system: PURELAB Priama (Prima 7) and PURELABULTRA (Ultra Genetic) (ELGA LabWater)
Note: In this protocol pure water from the ELGA system is referred to as MQ-water.
CO2 incubator (BINDER GmbH, model: 9140-0047 )
Clear-viewTM Snap-Cap microtubes (1.5 ml, natural, low retention) (Sigma-Aldrich, catalog number: T4816-250EA )
Multiply®-Pro 0.2 ml Biosphere® (Sarstedt AG, model: 72.727 )
Filter tips (10 µl, 20 µl and 200 µl) (Axon Lab AG, catalog number: AL60X10 , AL60X20 , AL60X200 )
Filter tips (1,250 µl) (Greiner Bio-One GmbH, catalog number: 7.750.261 )
15 cm tissue culture dishes (TPP Techno Plastic Products, catalog number: 93150 )
Stratalinker 2400 (254 nm) (Stratagene®, catalog number: 400076 )
PCR tube
Cell lifter (TPP Techno Plastic Products, model: 99010 )
Saran wrap
Scotch
GP Millipore Express® PLUS membrane (0.22 µm) (500 ml Funnel, 45 mm Neck Size) (EMD Millipore, catalog number: SCGPT05RE )
DynaMagTM-2 magnet (Life Technologies, catalog number: 12321D )
Water bath (temperature adjustable)
Eppendorf centrifuge 5415R with rotor F45-24-11 (Eppendorf, model: 022621459 and 022636502 )
CriterionTM Cell (Bio-Rad Laboratories, catalog number: 165-6001 )
NuPAGE® Novex® 4-12% Bis-Tris Midi Gels (1.0 mmx, 12 + 2 well) (Life Technologies, catalog number: WG1401BOX )
Midi Gel Adaptor (Life Technologies, model: WA0999 )
iBlot® Gel Transfer Devise (EU) (Life Technologies, model: IB1001EU )
iBlot® Transfer Stack (nitrocellulose, regular size) (Life Technologies, catalog number: IB3010-01 )
10 ml serological pipette
POWER PAC 3000 (Bio-Rad Laboratories)
Lab cycler gradient equipped with Thermoblock 96 (SensoQuest GmbH, models: 011-101 and 012-103 )
Blotting paper (Genentech, catalog number: BP 002 46579 )
FUJI screen
FUJIFILM FLA-3000 phosphorimager
Costar Spin-X® centrifugation column (Corning, model: 8161 )
Vertical PAA-gel running apparatus for 180 x 120 mm gels with 1 mm thick spacers and combs (home made)
Paper clips foldback (51 mm) (Lyreco, catalog number: 161.791 )
Aluminium plate (90 x 175 mm, thickness 3 mm)
UV desk (365 nm) (home made)
1 ml syringe (BD, PlastipakTM, catalog number: 300013 )
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Zünd, D. and Mühlemann, O. (2014). Individual-nucleotide-resolution UV Cross-linking and Immunoprecipitation (iCLIP) of UPF1. Bio-protocol 4(7): e1085. DOI: 10.21769/BioProtoc.1085.
Download Citation in RIS Format
Category
Biochemistry > RNA > RNA-protein interaction
Molecular Biology > RNA > mRNA translation
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,086 | https://bio-protocol.org/exchange/protocoldetail?id=1086&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
UPF1 RNA Immunoprecipitation from Mini-μ Construct–expressing Cells
David Zünd
Oliver Mühlemann
Published: Vol 4, Iss 7, Apr 5, 2014
DOI: 10.21769/BioProtoc.1086 Views: 10608
Original Research Article:
The authors used this protocol in Aug 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Aug 2013
Abstract
UPF1, an RNA helicase and a core factor of nonsense-mediated mRNA decay (NMD), interacts with RNA independently of the sequence context. To investigate the influence of translation on the association of UPF1 with specific reporter transcripts, UPF1 RNA immunoprecipitations (RIPs) are performed from Hela cells that either express a normally translated immunoglobulin-µ (Ig-µ) reporter (mini µ) or a version with a stable stem loop in the 5' UTR (SL mini µ) that efficiently inhibit translation initiation (Zund et al., 2013). Both the cloning of the SL mini µ reporter construct and the UPF1 RIP experiment are described in detail.
Keywords: RNA-IP RIP NMD Nonsense-mediated mRNA decay RNA helicase UPF1
Materials and Reagents
Hela cells
XL-10 Gold Ultracompetent Cells (Agilent Technologies, Stratagene, catalog number: 200315 )
Dulbecco’s Modified Eagle Media (DMEM) (powder, high glucose) (Life Technologies, catalog number: 52100-039 )
MQ-water (pure water from the ELGA system)
Fetal Calf Serum (FCS) (BioConcept, Amimed, catalog number: 2-01F30-I )
Penicillin-Streptomycin solution (P/S) (1 unit/ml) (BioConcept, Amimed, catalog number: 4-01F00-H )
Trypsin-EDTA (T/E) (BioConcept, Amimed, catalog number: 5-51F00-H )
DreamFectTM (OZ Biosciences, catalog number: DF45000 )
KpnI (New England Biolabs, catalog number: R0142S )
SL Oligo 1 (Microsynth AG)
Oligo sequence: 5'-CGGGTTCCGTCCAAGCACTGTTGAAGCAGGAAACCCGGGTTGCTAGTCGATCGACTAG-CAACCCGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACCCCGATCGTAC-3'
SL Oligo 2 (Microsynth AG)
Oligo sequence: 5'-GATCGGGGTTCCGTCCAAGCACTGTTGAAGCAGGAAACCCGGGTTGCTAGTCGATCG-ACTAGCAACCCGGGTTTCCTGCTTCAACAGTGCTTGGACGGAACCCGGTAC-3'
T4 DNA Ligase (New England Biolabs, catalog number: M0202S )
T4 Polynucleotide Kinase (PNK) (New England Biolabs, catalog number: M0201L )
Alkaline phosphatase calf intestinal (CIAP) (Promega Corporation, catalog number: M182A )
100x HaltTM Protease Inhibitor Cocktail (Thermo Fisher Scientific, catalog number: 1861279 )
RiboLock RI RNase Inhibitor (40 U/µl) (Thermo Fisher Scientific, catalog number: EO0381 )
RNase I (cloned, 100 U/µl) (Life Technologies, Ambion®, catalog number: AM2294 )
Turbo DNase (Life Technologies, Ambion®, catalog number: AM2238 )
Glycogen for molecular biology (Roche Diagnostics, catalog number: 10 901 393 001 )
Pre-stained Protein Ladder (broad range) (New England Biolabs, catalog number: P7710S )
Goat anti-UPF1 Antibody (G-α-RENT1) (Bethyl Laboratories, catalog number: A300-038A )
Goat anti-rabbit IgG (polyclonal) (Bio-Rad Laboratories, catalog number: 172-1053 )
Rabbit anti-actin (polyclonal) (Sigma-Aldrich, catalog number: A5050 )
AffiniPure Goat Anti-mouse IgM (µ chain specific) (Jackson ImmunoResearch Laboratories, catalog number: 115-005-020 )
IRDye 800CW Donkey anti-Rabbit (LI-COR, catalog number: 926-32213 )
IRDye 800CW Donkey anti-Goat (LI-COR, catalog number: 926-32214 )
Dynabeads® Protein G (Life Technologies, catalog number: 10004D )
Wizard® SV Gel and PCR Clean-Up System (Promega Corporation, catalog number: A9282 )
Affinity Script Multi-Temp Reverse Transcriptase (Agilent, catalog number: 600105 )
Random hexamer primers (Microsynth AG)
Brilliant III Ultra-Fast qPCR Master mix (Agilent, catalog number: 600880 )
Chloroform
Isopropanol
DMEM-/- (see Recipes)
DMEM+/+ (see Recipes)
Phosphate-bufferd saline (PBS) (pH 7.4) (see Recipes)
Hypotonic gentle lysis buffer (pH 7.5) (RNase-free) (see Recipes)
Wash buffer (pH 7.5) (RNase-free) (see Recipes)
Net-2 buffer (pH 7.5) (RNase-free) (see Recipes)
Hybridization buffer (pH 7.5) (see Recipes)
2x SDS loading buffer (pH 6.8) (see Recipes)
TRI-reagent (see Recipes)
Tris buffered saline (pH 7.6) (TBS) (see Recipes)
TBS-Tween milk (see Recipes)
Bjerrum transfer buffer (see Recipes)
DEPC treated water/buffer (see Recipes)
Turbo DNase mix (see Recipes)
Equipment
Pure water system: PURELAB Priama (Prima 7) and PURELABULTRA (Ultra Genetic) (ELGA LabWater)
CO2 incubator (BINDER GmbH, model: 9140-0047 )
Clear-viewTM Snap-Cap microtubes (1.5 ml, natural, low retention) (Sigma-Aldrich, catalog number: T4816-250EA )
Multiply®-Pro 0.2Ml Biosphere® (Sarstedt AG, catalog number: 72.727 )
Filter Tips (10 µl, 20 µl and 200 µl) (Axon Lab AG, catalog numbers: AL60X10 , AL60X20 , AL60X200 )
Filter Tips (1,250 µl) (Greiner Bio-One GmbH, catalog number: 7.750.261 )
CountessTM automated cell counter (Life Technologies, model: C10227 )
CountessTM cell counting chamber slides (Life Technologies, catalog number: C10283 )
15 cm tissue culture dishes (TPP Techno Plastic Products, catalog number: 93150 )
GP Millipore express® PLUS Membrane (0.22 µm) (500 ml Funnel, 45 mm Neck Size) (EMD Millipore, catalog number: SCGPT05RE )
NanoDrop 2000 (Thermo Fisher Scientific)
Heat block, Thermomixer® compact (Eppendorf)
DynaMagTM-2 magnet (Life Technologies, catalog number: 12321D )
Eppendorf centrifuge 5415R with rotor F45-24-11 (Eppendorf, catalog numbers: 022621459 and 022636502 )
Lab cycler gradient equipped with Thermoblock 96 (SensoQuest GmbH, models: 011-101 and 012-103 )
Blotting paper (ALBET Lab Science, catalog number: BP 002 46579 )
Corbett Rotor-Gene® 6000 (QIAGEN)
Corbett CAS-1200 (QIAGEN)
SE260 Mighty Small II Deluxe Mini vertical electrophoresis unit (Hoefer, model: SE260-10A-1.5 )
Optitran BA-S 85 reinforced nitrocellulose membrane (GE Healthcare, Whatman, catalog number: 10 439 196 )
Semi-dry transfer unit with built-in power supply TE77XP (Hoefer, model: TE77XP )
Odyssey® infrared imaging system (LI-COR)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Biochemistry > RNA > RNA-protein interaction
Molecular Biology > RNA > RNA detection
Biochemistry > Protein > Immunodetection
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,087 | https://bio-protocol.org/exchange/protocoldetail?id=1087&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
3D Mammary Colony-Forming Cell Assay
Giusy Tornillo
Sara Cabodi
Published: Vol 4, Iss 7, Apr 5, 2014
DOI: 10.21769/BioProtoc.1087 Views: 16351
Reviewed by: Vanesa Olivares-Illana
Original Research Article:
The authors used this protocol in Jul 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
Jul 2013
Abstract
The mammary epithelium consists of multiple phenotypically and functionally distinct cell populations, which are organized as a hierarchy of stem cells, progenitors and terminally differentiated cells.
Identification of the mechanisms regulating the growth and differentiation of mammary stem and progenitor cells is of great interest not only to better understand the mammary gland development but also to clarify the origins of breast cancer, as these cells seem to be the likely targets of malignant transformation within the mammary epithelium. Hence, a variety of approaches have been developed for quantifying and studying these specific mammary cell subsets.
Given their high proliferative capacity, mammary progenitor cells are able to form colonies in vitro in low-density cultures. Here we describe how to perform a three dimensional (3D) Mammary Colony-Forming Cell (Ma-CFC) Assay, an in vitro functional assay suitable for the detection and analysis of mammary progenitor cells in feeder-free culture conditions.
Briefly, this protocol involves the seeding of mammary single cells, at clonal density, onto a semi-solid matrix (Matrigel), thus allowing mammary progenitors to proliferate and give rise to discrete 3D colonies. The number and the cell composition of the resulting colonies will vary according to the frequency and the differentiation potential of the progenitors, respectively.
Keywords: Mammary Progenitor 3D Matrigel Colony
Materials and Reagents
Single-cell suspension of primary mouse mammary cells [see Debnath et al. (2003) for details about the dissociation of mouse mammary glands into single cells]
EpiCult®-B Basal Medium Mouse (STEMCELL Technologies, catalog number: 05611 )
EpiCult®-B Proliferation Supplements (STEMCELL Technologies, catalog number: 05612 )
Trypan blue
Recombinant human Epidermal Growth Factor (EGF) (Sigma-Aldrich, catalog number: E9644 )
Recombinant human basic Fibroblast Growth Factor (bFGF) (Life Technologies, catalog number: PHG0023 )
Heparin sodium salt (Sigma-Aldrich, catalog number: H3149 )
Fetal Bovine Serum (FBS) (heat-inactivated) (Life Technologies, catalog number: 10270-106 )
Penicillin-Streptomycin (Pen/Strep) (Life Technologies, catalog number: 15070-063 )
Growth Factor Reduced (GFR) BD MatrigelTM Matrix [protein concentration > 8 mg/ml, endotoxin levels < 2 Endotoxin Units (EU)/ml] (BD Biosciences, catalog number: 354230 )
Note: BD MatrigelTM Matrix is supplied as a frozen solution. Thaw it on ice overnight and stored as 1 ml aliquots at -20 °C. Leave Matrigel aliquots to thaw on ice for 2 h before use.
Complete EpiCult-B Medium (see Recipes)
Equipment
BD Falcon 8-well culture slides (BD Biosciences, catalog number: 354108 )
Refrigerated centrifuge with swinging bucket rotor
Humidified 37 °C, 5% CO2 cell culture incubator
Inverted tissue culture microscope
Zeiss Observer Z.1 microscope (5x/0.12 objective)
Software
AxioVision Rel 4.8 software
ImageJ
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Stem Cell > Adult stem cell > Maintenance and differentiation
Cell Biology > Cell isolation and culture > 3D cell culture
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,088 | https://bio-protocol.org/exchange/protocoldetail?id=1088&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
α2β1-integrin Clustering and Internalization Protocol
VM Varpu Marjomäki
MK Mikko Karjalainen
PU Paula Upla
ES Elina Siljamäki
NR Nina Rintanen
PT Paula Turkki
Published: Vol 4, Iss 7, Apr 5, 2014
DOI: 10.21769/BioProtoc.1088 Views: 8958
Original Research Article:
The authors used this protocol in Sep 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Sep 2013
Abstract
α2β1-integrin clustering experiment can be used to trigger internalization of α2β1-integrin. When clustering is performed with sequential administration of primary and fluorescent secondary antibodies, the entry kinetics of integrin can be followed into the cell. The idea is first to allow binding of primary antibodies (recognizing the extracellular epitope) to the α2β1-integrins and then to cluster the α2β1-integrin-bound primary antibodies together by the means of the secondary antibody. Binding is done on ice so that the α2β1-integrins will not internalize before both sets of antibodies are bound. Clustering is known to trigger α2β1-integrin internalization efficiently from the cell surface to the cytoplasm. In this protocol we used antibody-induced clustering of α2β1-integrin in order to quantitate the amount of internalized α2β1-integrins in comparison to cell surface-associated α2β1-integrin.
Keywords: integrin collagen binding enterovirus internalization clustering
Materials and Reagents
Adherent Cells (e.g. A549, Hela, SAOS) (on small rounded coverslips, grown to subconfluency)
Ice
Fraction V (Sigma-Aldrich, catalog number: 85040C )
Primary antibody (binds to the α2-integrin ectodomain) (e.g. AbD Serotec, catalog number: MCA2025 ) (diluted in medium containing 1 % serum; use: 4-5 µg/ml)
Two different secondary antibodies that recognize the primary antibody (example: goat anti mouse Alexa- 488 and 555; Life Technologies, catalog numbers: A-11001 and A-21424 ) (diluted in medium containing 1 % serum; use: 1.3 µg/ml)
Serum (Life Technologies, catalog number: 10270-106 )
DAPI prolong gold mounting media (Life Technologies, catalog number: P36935 ) or any other mounting media
Phosphate buffered saline (PBS)
Culture medium with 0-10% serum (see Recipes)
4% paraformaldehyde (PFA) (Sigma-Aldrich, catalog number: P-6148 ) (see Recipes)
Equipment
Coverslip (Thermo Fisher Scientific, Menzel-Gläzer)
CO2 incubator
Confocal fluorescence microscope
Software
Data analysis by BioImage XD (open-source, http://www.bioimagexd.net/)
ImageJ
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Marjomäki, V., Karjalainen, M., Upla, P., Siljamäki, E., Rintanen, N. and Turkki, P. (2014). α2β1-integrin Clustering and Internalization Protocol. Bio-protocol 4(7): e1088. DOI: 10.21769/BioProtoc.1088.
Download Citation in RIS Format
Category
Immunology > Antibody analysis > Antibody-antigen interaction
Biochemistry > Protein > Immunodetection
Cell Biology > Cell structure > Cell surface
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,089 | https://bio-protocol.org/exchange/protocoldetail?id=1089&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Fluorescence Microscopy Analysis of Drug Effect on Autophagosome Formation
MS Metodi Stankov
Diana Panayotova-Dimitrova
ML Martin Leverkus
Georg Behrens
Published: Vol 4, Iss 7, Apr 5, 2014
DOI: 10.21769/BioProtoc.1089 Views: 10863
Original Research Article:
The authors used this protocol in Jan 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2013
Abstract
The autophagy protein, LC3 represents a reliable characteristic marker for autophagosomal structures. The initial LC3 is processed by the cysteine protease autophagy-related gene 4 (Atg4) at its C terminus in order to create LC3-I generally localized in the cytoplasm. Afterwards LC3-I is conjugated with phosphatidylethanolamine (PE) to become LC3-PE or LC3-II predominantly localised on the autophagosomal membranes (outer and inner). Autolysosomal content of LC3-II is very low as upon autophago/lysosomal fusion it is either cleaved off from the outer membrane by Atg4 or degraded together with the inner membrane by the lysosomal activity. Therefore GFP-LC3 and mCherry-GFP-LC3 might be visualized by conventional or confocal fluorescence microscopy (FM). In this situation mCherry-GFP-LC3 or GFP-LC3 cytoplasmic pool is visualized as a homogeneously dispersed signal and mCherry-GFP-LC3-II or GFP-LC3-II containing autophagosomes are detected as punctae formations. The number of punctae may be used as marker of autophagosomal abundance. In general we recommend counting the average number of GFP-LC3 punctae per cell.
Keywords: Autophagy MCherry-GFP-LC3 GFP-LC3 Fluorescence Microscopy Autophagic flux
Materials and Reagents
Cell lines of interest (HepG2, HUH7, CMK, K562 etc.) stably expressing GFP-LC3
We recommend the following commercially available plasmids: pBABEpuro GFP-LC3 (plasmid 22405) and pBABE-puro mCherry-EGFP-LC3B (plasmid 22418) generated by Jayanta Debnath from Addgene to be inserted into retroviral constructs and used for cell transduction
Eagle's minimal essential medium (EMEM) (ATCC, catalog number: 30-2003 ) containing 10% fetal bovine serum (FBS) with 100 U/100 μg/ml penicillin/streptomycin (Life Technologies, Gibco®, catalog number: 15140-122 )
RPMI 1640 with L-glutamine (Lonza, catalog number: BE12-702F ) containing 10% fetal bovine serum (FBS) with 100 U/100 μg/ml penicillin/streptomycin
Fetal Bovine Serum (FBS) (Biochrom, catalog number: S0615 )
Dulbecco’s Phosphate Buffered Saline (PBS) (Biochrom, catalog number: L1825 )
1x 0.05% Trypsin-EDTA (phenol red) (Life Technologies, catalog number: 25300 )
Hanks Balanced Salt Solution (HBSS) (Life Technologies, Gibco®, catalog number: 14025 ) containing 6 mM glucose (starvation medium)
Rapamycin from Streptomyces hygroscopicus (1-5 µmol/L) (Sigma-Aldrich, catalog number: R0395 )
PP242 hydrate (1-5 µmol/L) (Sigma-Aldrich, catalog number: P0037 )
3-methyladenine (3-MA) (3-10 mmol/L) (Sigma-Aldrich, catalog number: M9281 )
Wortmannin (30-100 nmol/L) (Sigma-Aldrich, catalog number: W3144 )
LY294002 (7-20 µmol/L) (Sigma-Aldrich, catalog number: L9908 )
Nocodazole (12-50 µmol/L) (Sigma-Aldrich, catalog number: M1404 )
Vinblastine (12-50 µmol/L) (Sigma-Aldrich, catalog number: V1377 )
Ammonium chloride (NH4Cl) (10-20 mmol/L) (Sigma-Aldrich, catalog number: A0171 )
Hydrohychloroquine sulphate (HCQ) (5-10 µmol/L) (Sigma-Aldrich, catalog number: H0915 )
Chloroquine (CQ) (5-10 µmol/L) (Sigma-Aldrich, catalog number: C6628 )
Dimethyl sulfoxide DMSO (Sigma-Aldrich, catalog number: D8418 )
Equipment
37 °C, 5% CO2 humidified incubator
Centrifuge
Olympus IX81 instrument and analySIS (Soft Imaging System GmbH) or analogous equipment
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Stankov, M., Panayotova-Dimitrova, D., Leverkus, M. and Behrens, G. (2014). Fluorescence Microscopy Analysis of Drug Effect on Autophagosome Formation. Bio-protocol 4(7): e1089. DOI: 10.21769/BioProtoc.1089.
Download Citation in RIS Format
Category
Microbiology > Antimicrobial assay > Autophagy assay
Cell Biology > Cell imaging > Fluorescence
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,090 | https://bio-protocol.org/exchange/protocoldetail?id=1090&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Flow Cytometric Analysis of Autophagic Activity with Cyto-ID Staining in Primary Cells
MS Metodi Stankov
Diana Panayotova-Dimitrova
ML Martin Leverkus
Jan-Henning Klusmann
Georg Behrens
Published: Vol 4, Iss 7, Apr 5, 2014
DOI: 10.21769/BioProtoc.1090 Views: 26128
Original Research Article:
The authors used this protocol in Jan 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2013
Abstract
Flow cytometry allows very sensitive and reliable high-throughput analysis of autophagic flux. This methodology permits to screen cells in flow and capture multi-component images. Using this technology autophagic flux may be analysed accurately in both suspension as well as adherent cells upon trypsinization independent of how heterogeneous the autophagosomal content might be. The method is based on Cyto-ID staining of autophagic compartments (pre-autophagosomes, autophagosomes, and autophagolysosomes) in live cells using Cyto-ID® Autophagy Detection Kit. Autophagic compartments are intermediate constituents of a dynamic lysosomal degradation process and their intracellular abundance at a particular time point is a function of the established equilibrium between their generation and degradation. Determination of autophagic flux facilitates the discrimination between early induction of autophagosome formation and late inhibition of autophagosome maturation as both results in an ultimate increase in autophagosomal presence. Cyto-ID assay is based on the usage of a specific dye that selectively stains autophagic compartments and therefore allows determination of autophagic flux as accumulation of stained compartments in basic or activated conditions [rapamycin (1-5 µmol/L), PP242 (1-5 µmol/L) or Hanks’ Balanced Salt Solution containing 6 mmol/L glucose (starvation medium)] after blockage of autophagolysosomal degradation using lysosomotropic compounds such as ammonium chloride (NH4Cl) (10-20 mmol/L) or chloroquine (CQ) (5-10 µmol/L). ΔMFI Cyto-ID = MFI Cyto-ID (+CQ/NH4Cl) - MFI Cyto-ID (-CQ/NH4Cl).
Keywords: Autophagy Primary Cells Cyto-ID Autophagic flux Flow Cytometry
Materials and Reagents
Cells lines of interest (HepG2, HUH7, CMK, K562 etc.) or primary cells [for example: murine bone marrow-derived dendritic cells (BMDCs)]
Cyto-ID® Autophagy Detection Kit (Enzo Life Sciences, catalog number: ENZ-51031-K200 )
Eagle's minimal essential medium (EMEM) (ATCC, catalog number: 30-2003 ) containing 10% fetal bovine serum (FBS) (Biochrom, catalog number: S0615 ) with 100 U/100 μg/ml penicillin/streptomycin (Life Technologies, Gibco®, catalog number: 15140-122 )
RPMI 1640 with L-glutamine (Lonza, catalog number: BE12-702F ) containing 10% FBS with 100 U/100 μg/ml penicillin/streptomycin
DMEM (low glucose, pyruvate, no glutamine, no phenol red) (Life Technologies, Gibco®, catalog number: 11880-028 )
Dulbecco’s Phosphate Buffered Saline (DPBS) (Biochrom, catalog number: L1825 )
1x 0.05% Trypsin-EDTA (phenol red) (Life Technologies, catalog number: 25300 )
Hanks Balanced Salt Solution (HBSS) (Life Technologies, Gibco®, catalog number: 14025 ) containing 6 mM glucose (starvation medium)
Rapamycin from Streptomyces hygroscopicus (1-5 µmol/L) (Sigma-Aldrich, catalog number: R0395 )
PP242 hydrate (1-5 µmol/L) (Sigma-Aldrich, catalog number: P0037 )
3-methyladenine (3-MA) (3-10 mmol/L) (Sigma-Aldrich, catalog number: M9281 )
Wortmannin (30-100 nmol/L) (Sigma-Aldrich, catalog number: W3144 )
LY294002 (7-20 µmol/L) (Sigma-Aldrich, catalog number: L9908 )
Nocodazole (12-50 µmol/L) (Sigma-Aldrich, catalog number: M1404 )
Vinblastine (12-50 µmol/L) (Sigma-Aldrich, catalog number: V1377 )
Ammonium chloride (NH4Cl) (10-20 mmol/L) (Sigma-Aldrich, catalog number: A0171 )
Hydrohychloroquine sulphate (HCQ) (5-10 µmol/L) (Sigma-Aldrich, catalog number: H0915 )
Chloroquine (CQ) (5-10 µmol/L) (Sigma-Aldrich, catalog number: C6628 )
Dimethyl sulfoxide DMSO (Sigma-Aldrich, catalog number: D8418 )
Equipment
37 °C, 5% CO2 humidified incubator
Centrifuge
FACSCalibur, LSR II (BD) or analogous equipment
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Stankov, M., Panayotova-Dimitrova, D., Leverkus, M., Klusmann, J. and Behrens, G. (2014). Flow Cytometric Analysis of Autophagic Activity with Cyto-ID Staining in Primary Cells. Bio-protocol 4(7): e1090. DOI: 10.21769/BioProtoc.1090.
Download Citation in RIS Format
Category
Microbiology > Antimicrobial assay > Autophagy assay
Cell Biology > Cell-based analysis > Flow cytometry
Cell Biology > Cell imaging > Live-cell imaging
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,091 | https://bio-protocol.org/exchange/protocoldetail?id=1091&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Flow Cytometric Analyses of Autophagic Activity using LC3-GFP fluorescence
MS Metodi Stankov
Diana Panayotova-Dimitrova
ML Martin Leverkus
Georg Behrens
Published: Vol 4, Iss 7, Apr 5, 2014
DOI: 10.21769/BioProtoc.1091 Views: 12967
Original Research Article:
The authors used this protocol in Jan 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jan 2013
Abstract
Flow cytometry allows very sensitive and reliable high-throughput analysis of autophagic flux. This methodology permits to screen cells in flow and capture multi-component images. Using this technology autophagic flux may be analysed accurately in both suspension as well as adherent cells upon trypsinization independent of how heterogeneous the LC3 punctae content might be. The method is based on the fact that intra-cellularly expressed LC3-GFP serves as a potential autophagic substrate for degradation. Therefore changes in total intracellular LC3-GFP fluorescence intensity is used as an indicator of cellular autophagic activity in living cells. Increased autophagic flux is expected to result in a progressive delivery of LC3-GFP to autolysosome where this substrate undergoes degradation. Therefore, enhanced autophagic flux is detected as a decreased total cellular GFP signal. On the other hand an inhibition of autophagic flux independent of the stage (autophagosome formation, maturation or acidification) leads to accumulation of undegraded LC3-GFP and may be detected as an enhanced intracellular GFP signal. (Caution: This methodology is based on the assumption that LC3-GFP is expressed constitutively by the model system. Data from analysis of substances or conditions influencing cellular LC3-GFP expression should be interpreted with care.)
Materials and Reagents
Cell lines of interest (HepG2, HUH7, CMK, K562 etc.) stably expressing LC3-GFP
We recommend the following commercially available plasmids: pBABEpuro GFP-LC3 (plasmid 22405) and pBABE-puro mCherry-EGFP-LC3B (plasmid 22418) generated by Jayanta Debnath from Addgene to be inserted into retroviral constructs and used for cell transduction
Eagle's minimal essential medium (EMEM) (ATCC, catalog number: 30-2003 ) containing 10% fetal bovine serum (FBS) with 100 U/100 μg/ml penicillin/streptomycin (Life Technologies, Gibco®, catalog number: 15140-122 )
RPMI 1640 with L-glutamine (Lonza, catalog number: BE12-702F ) containing 10% FBS with 100 U/100 μg/ml penicillin/streptomycin
FBS (Biochrom, catalog number: S0615 )
Dulbecco’s Phosphate Buffered Saline (DPBS) (Biochrom, catalog number: L1825 )
1x 0.05% Trypsin-EDTA (phenol red) (Life Technologies, catalog number: 25300 )
Hanks Balanced Salt Solution (HBSS) (Life Technologies, Gibco®, catalog number: 14025 ) containing 6 mM glucose (starvation medium)
Rapamycin from Streptomyces hygroscopicus (1-5 µmol/L) (Sigma-Aldrich, catalog number: R0395 )
PP242 hydrate (1-5 µmol/L) (Sigma-Aldrich, catalog number: P0037 )
3-methyladenine (3-MA) (3-10 mmol/L) (Sigma-Aldrich, catalog number: M9281 )
Wortmannin (30-100 nmol/L) (Sigma-Aldrich, catalog number: W3144 )
LY294002 (7-20 µmol/L) (Sigma-Aldrich, catalog number: L9908 )
Nocodazole (12-50 µmol/L) (Sigma-Aldrich, catalog number: M1404 )
Vinblastine (12-50 µmol/L) (Sigma-Aldrich, catalog number: V1377 )
Ammonium chloride (NH4Cl) (10-20 mmol/L) (Sigma-Aldrich, catalog number: A0171 )
Hydrohychloroquine sulphate (HCQ) (5-10 µmol/L) (Sigma-Aldrich, catalog number: H0915 )
Chloroquine (CQ) (5-10 µmol/L) (Sigma-Aldrich, catalog number: C6628 )
Dimethyl sulfoxide DMSO (Sigma-Aldrich, catalog number: D8418 )
Equipment
37 °C, 5% CO2 humidified incubator
Centrifuge
FACSCalibur, LSR II (BD) or analogous equipment
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Stankov, M., Panayotova-Dimitrova, D., Leverkus, M. and Behrens, G. (2014). Flow Cytometric Analyses of Autophagic Activity using LC3-GFP fluorescence. Bio-protocol 4(7): e1091. DOI: 10.21769/BioProtoc.1091.
Download Citation in RIS Format
Category
Microbiology > Antimicrobial assay > Autophagy assay
Cell Biology > Cell-based analysis > Flow cytometry
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,092 | https://bio-protocol.org/exchange/protocoldetail?id=1092&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Isolation of Cells from Human Intestinal Tissue
Heli Uronen-Hansson
EP Emma Persson
PN Petra Nilsson
WA William Agace
Published: Vol 4, Iss 7, Apr 5, 2014
DOI: 10.21769/BioProtoc.1092 Views: 16936
Reviewed by: Ivan ZanoniSavita Nair
Original Research Article:
The authors used this protocol in May 2013
Download PDF
Ask a question
Favorite
Cited by
Original research article
The authors used this protocol in:
May 2013
Abstract
The intestinal lamina propria contains a dense network of T cells, dendritic cells (DCs) and macrophages, which play an important role in local innate and adaptive immune responses. We have recently identified distinct subsets of DCs (Persson et al., 2013) and macrophages (Bain et al., 2013) in the human intestine. In addition, we have studied T cells in healthy and diseased intestine. Here, we describe two methods for isolating these cell populations: 1) enzymatic treatment and 2) migration based isolation. The enzymatic method can be used to isolate T cells, DC and macrophages, whereas the migration based ‘walk-out’ protocol is suitable for DC isolation, as these cells migrate out from the tissues.
Materials and Reagents
Tissue specimens of small (terminal ileum) and large intestine
RPMI 1640 (Life Technologies, catalog number: 21875-034 )
Fetal Bovine Serum (FBS) (Sigma-Aldrich, catalog number: F7424 )
HEPES (Life Technologies, Gibco®, catalog number: 15630-080 )
Penicillin and Streptomycin (Life Technologies, catalog number: 15140-122 )
HBSS (Life Technologies, catalog number: 14180-046 )
EDTA (Life Technologies, catalog number: AM9261 )
Liberase TM (Roche Diagnostics, catalog number: 05401127001 )
DNase I (Sigma-Aldrich, catalog number: D4263 )
Collagenase 1A (0.2 μm-filtered) (Sigma-Aldrich, catalog number: C9891 )
FACS antibodies
T cells
CD3-PE-Cy7 (SK7) (BD biosciences)
Pacific blue (PB)-CD8 (RPA-T8) (BD biosciences)
Quantum dot (QD) 605-CD4 (S3.5) (Life Technologies, InvitrogenTM)
LIVE/DEAD® Fixable Near IR Dead Cell Stain Kit (Life Technologies, InvitrogenTM)
DC/macrophages
CD3-PE-Cy5 (UCHT1) (eBioscience)
CD19-PE-Cy5 (HIB19) (eBioscience)
CD11c-PE-Cy7 (3.9) (eBioscience)
CD103-PE (Ber-ACT8) or CD103-eFluor647 (B-Ly7) (eBioscience)
CD14-eFluor450 (61D3) (eBioscience)
HLA-DR-APCeFluor780 (L43) (eBioscience)
CD20 PE-Cy5 (2H7) (BioLegend)
TCRab-PE-Cy5 (IP26) (BioLegend)
Biotin-or PE-Cy7 CD172a (SE5A5) (BioLegend)
CD56-PE-Cy5 (Alpha Diagnostic Intl)
Biotin- or FITC-CD11c (MJ4-27G12) (Miltenyi Biotec)
CD141-PE (AD5-14H12) (Miltenyi Biotec)
CD45 V500 (HI30) (BD Biosciences)
Biotinylated antibodies were detected using streptavidin conjugated to PE-Cy7 (eBiosicence) or QDot605 (Life Technologies, InvitrogenTM).
Dead cells were excluded from analysis using propidium iodide PI (Life Technologies, Molecular Probes®).
R10 medium (see Recipes)
Equipment
Cell strainer (100 μm) (Thermo Fisher Scientific, catalog number: 22363549 )
50 ml Falcon tube
Polyester filters cut in 10 x 10 cm squares (mesh count 27 threads/cm, mesh opening 250 μm, thread diameter 120 μm) (Tekniska Precisionsfilter JR AB)
Petri dish (SARSTEDT AG, catalog number: 82.1473 )
Ultra low attachment 24-well culture plate (Sigma-Aldrich, catalog number: CLS3473 )
Pipette
Needle/forceps
Surgical scissor/scalpel
Beakers with lid (VWR International, catalog number: 216-2694 )
37 °C, 5% CO2 cell culture incubator
Shaker
Centrifuge
Microscope
Multicolour FACS analyser (BD Lsr II flow cytometer)
Software
FlowJo software (Tree Star Inc)
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
Category
Immunology > Immune cell isolation > Maintenance and differentiation
Cell Biology > Cell isolation and culture > Cell isolation
Cell Biology > Cell movement > Cell migration
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,093 | https://bio-protocol.org/exchange/protocoldetail?id=1093&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
DNA Damage Sensitivity Assays with Arabidopsis Seedlings
Marisa Rosa
OS Ortrun Mittelsten Scheid
Published: Vol 4, Iss 7, Apr 5, 2014
DOI: 10.21769/BioProtoc.1093 Views: 10486
Edited by: Ru Zhang
Reviewed by: Masahiro Morita
Original Research Article:
The authors used this protocol in Jun 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2013
Abstract
We describe fast and reproducible sensitivity assays to quantify the response of Arabidopsis seedlings of different genotypes to a wide range of DNA damaging agents. We apply (1) γ-irradiation, which produces DNA breaks, (2) bleocin, a radiomimetic drug, (3) mitomycin C, a DNA intrastrand cross-linker, (4) hydroxyurea, an inhibitor of DNA synthesis and (5) UV-C, which causes mainly photoproducts. The “true leaf assay” and the “UV resistance assay” are based on easily determined phenotypes as readouts. Using a set of diverse damaging agents combined with different readouts allows establishing relative sensitivity/resistance compared to a reference line, e.g. wild type, determining the most effective type of induced damage and the potential repair pathway affected.
Keywords: DNA damage Arabidopsis Genotoxic stress Sensitivity assay
Materials and Reagents
Arabidopsis thaliana seeds [Wild type and T-DNA insertion lines of arp6-3, swc6-1 and sensitive ku70-2 (Rosa et al., 2013) are used as examples. All mutants are in the Columbia-0 background.]
Sodium hypochlorite (Sigma-Aldrich, catalog number: 425044 )
Tween-80 (Sigma-Aldrich, catalog number: 4780 )
Sterile H2O
Solid growth medium
Liquid plant growth medium (same as solid growth media but without agar)
Hydroxyurea (Sigma-Aldrich, catalog number: H8627 )
70% ethanol
Seed sterilization solution (see Recipes)
Bleocin (commercial name for bleomycin) (EMD Millipore, catalog number: 203408 ) (see Recipes)
Mitomycin C (Duchefa Biochemie BV, catalog number: M0133 ) (see Recipes)
Equipment
Sterile hood, preferably a biological safety cabinet to avoid exposure to the genotoxins
Bench top block shaker (e.g. Eppendorf, Thermomixer®)
UV crosslinker (254-nm UV light bulbs, 15 watts each) (Stratagene, model: Stratalinker 2400 )
Gamma-irradiation source (Nordion, model: Co-60- Gamma-cell 220 )
Forceps
Box or aluminum foil
Petri dishes for plant culture with solid growth medium (see Notes) (round 200 x 15 mm and 55 x 15 mm, and square 100 x 100 x 15 mm)
1.5 ml Eppendorf tubes
Plant growth facilities with 16-h-light/8-h-dark cycles, at 21 °C
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Rosa, M. and Scheid, O. M. (2014). DNA Damage Sensitivity Assays with Arabidopsis Seedlings. Bio-protocol 4(7): e1093. DOI: 10.21769/BioProtoc.1093.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Tissue analysis
Molecular Biology > DNA > DNA damage and repair
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
1,094 | https://bio-protocol.org/exchange/protocoldetail?id=1094&type=0 | # Bio-Protocol Content
Improve Research Reproducibility
A Bio-protocol resource
Peer-reviewed
Measuring Homologous Recombination Frequency in Arabidopsis Seedlings
Marisa Rosa
OS Ortrun Mittelsten Scheid
Published: Vol 4, Iss 7, Apr 5, 2014
DOI: 10.21769/BioProtoc.1094 Views: 12194
Edited by: Ru Zhang
Reviewed by: Masahiro Morita
Original Research Article:
The authors used this protocol in Jun 2013
Download PDF
Ask a question
How to cite
Favorite
Cited by
Original research article
The authors used this protocol in:
Jun 2013
Abstract
Somatic homologous recombination (SHR) is a major pathway of DNA double-strand break (DSB) repair, in which intact homologous regions are used as a template for the removal of lesions. Its frequency in plants is generally low, as most DSB are removed by non-homologous mechanisms in higher eukaryotes. Nevertheless, SHR frequency has been shown to increase in response to various chemical and physical agents that cause DNA damage and/or alter genome stability (reviewed in March-Díaz and Reyes, 2009). We monitor the frequency of SHR in transgenic Arabidopsis seedlings containing recombination substrates with two truncated but overlapping parts of the β-glucuronidase (GUS) reporter gene (Orel et al., 2003; Schuermann et al., 2005). Upon an SHR event, a functional version of the transgene can be restored (Figure 1A). A histochemical assay applicable to whole plantlets allows the visualization of cells in which the reporter is restored, as the encoded enzyme converts a colorless substrate into a blue compound. This type of reporter has been extensively used to identify gene products required for regulating SHR levels in plants. We analyze plants stimulated for SHR by treatments with DNA damaging agents (bleocin, mitomycin C and UV-C) and compare them to non-treated plants.
Keywords: Homologous recombination DNA repair Genotoxic stress Arabidopsis
Materials and Reagents
Arabidopsis thaliana seeds of reporter lines IU.GUS-8 and DGU.US-1 (Figure 1) (Orel et al., 2003) [introgressed into various genetic backgrounds and genotyped for homozygosity of reporters and mutations (Rosa et al., 2013). As an example, we use wild type Columbia-0, and mutants arp6-3 and swc6-1. Both mutants lack subunits of the Arabidopsis homolog of the SWR1 complex and, additional to being sensitive to DNA damaging agents (Rosa et al., 2013), have pleiotropic developmental defects (for more information see Schuermann et al., 2005)]
Sodium hypochlorite (Sigma-Aldrich, catalog number: 425044 )
Tween-80 (Sigma-Aldrich, catalog number: 4780 )
Sterile H2O
Solid growth medium
Liquid plant growth medium (same as solid growth medium but without agar)
Hydroxyurea
70% ethanol
Seed sterilization solution (see Recipes)
Bleocin (commercial name for bleomycin) (EMD Millipore, catalog number: 203408 ) (see Recipes)
Mitomycin C (Duchefa Biochemie BV, catalog number: M0133 ) (see Recipes)
GUS staining solution (see Recipes)
1 M Sodium Phosphate Buffer (see Recipes)
Equipment
Plastic petri dishes for plant culture (see Notes) (round 200 x 15 mm, with 20 ml of solid growth medium)
Sterile hood, preferably a biological safety cabinet to avoid exposure to the genotoxins
Bench top block shaker (e.g. Eppendorf, Thermomixer®)
UV crosslinker (254-nm UV light bulbs, 15 watts each) (Stratagene, model: Stratalinker 2400 )
Forceps
Box or aluminum foil
Parafilm
1.5 ml Eppendorf tubes
50 and 15 ml Falcon tubes
Vacuum applicator (e.g. desiccator)
Plant growth facilities with 16-h-light/8-h-dark cycles, at 21 °C
Incubator at 37 °C
Stereomicroscope
Procedure
Please login or sign up for free to view full text
Log in
/
Sign up
Copyright: © 2014 The Authors; exclusive licensee Bio-protocol LLC.
How to cite：Rosa, M. and Scheid, O. M. (2014). Measuring Homologous Recombination Frequency in Arabidopsis Seedlings. Bio-protocol 4(7): e1094. DOI: 10.21769/BioProtoc.1094.
Download Citation in RIS Format
Category
Plant Science > Plant physiology > Tissue analysis
Plant Science > Plant molecular biology > DNA
Molecular Biology > DNA > DNA recombination
Do you have any questions about this protocol?
Post your question to gather feedback from the community. We will also invite the authors of this article to respond.
Write a clear, specific, and concise question. Don’t forget the question mark!
0/150
Tips for asking effective questions
+ Description
Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.
Tags (0/5):
Post a Question
0 Q&A
Request a Protocol (RaP)
Request a detailed protocol from the "Materials and Methods" section of any research article.
Learn More
Protocol Collections
Comprehensive collections of detailed, peer-reviewed protocols focusing on specific topics
See all
About
About Us
Editors
Ambassadors
FAQs
Contact Us
For Preprint Authors
Submit a Protocol
Preprint Author Guidelines
Preprint Protocol Preparation Guidelines
For Advertisers
Advertising Integrity Board
Advertising Policy
Advertising Terms and Conditions
Other Resources
Bio-protocol Journal
Bio-protocol Preprint Repository
Bio-protocol Webinars
Request a Protocol (RaP)
© 2025 Bio-protocol LLC. ISSN: 2331-8325
Terms of Service Privacy Policy |
Subsets and Splits