SentenceTransformer based on BAAI/bge-base-en-v1.5
This is a sentence-transformers model finetuned from BAAI/bge-base-en-v1.5. It maps sentences & paragraphs to a 768-dimensional dense vector space and can be used for semantic textual similarity, semantic search, paraphrase mining, text classification, clustering, and more.
Model Details
Model Description
- Model Type: Sentence Transformer
- Base model: BAAI/bge-base-en-v1.5
- Maximum Sequence Length: 512 tokens
- Output Dimensionality: 768 tokens
- Similarity Function: Cosine Similarity
Model Sources
- Documentation: Sentence Transformers Documentation
- Repository: Sentence Transformers on GitHub
- Hugging Face: Sentence Transformers on Hugging Face
Full Model Architecture
SentenceTransformer(
(0): Transformer({'max_seq_length': 512, 'do_lower_case': True}) with Transformer model: BertModel
(1): Pooling({'word_embedding_dimension': 768, 'pooling_mode_cls_token': True, 'pooling_mode_mean_tokens': False, 'pooling_mode_max_tokens': False, 'pooling_mode_mean_sqrt_len_tokens': False, 'pooling_mode_weightedmean_tokens': False, 'pooling_mode_lasttoken': False, 'include_prompt': True})
(2): Normalize()
)
Usage
Direct Usage (Sentence Transformers)
First install the Sentence Transformers library:
pip install -U sentence-transformers
Then you can load this model and run inference.
from sentence_transformers import SentenceTransformer
# Download from the 🤗 Hub
model = SentenceTransformer("kr-manish/bge-base-raw_pdf_finetuned_vf1")
# Run inference
sentences = [
'~ " \'"-\'-en 25000 1 ,.,,µ,· ,, · .,-,.. •~h • 1 (1) ,\\ II J } 7; . \\ \\(9,i, .,u, 4\\:',
'en 25000 I \' \'lJVL\' • -. • . .,.. ""~" \'\' \' I Q) l!J "667 7 ..._7 ... -,',
'80, 85, or 95% identity to SEQ ID NO',
]
embeddings = model.encode(sentences)
print(embeddings.shape)
# [3, 768]
# Get the similarity scores for the embeddings
similarities = model.similarity(embeddings, embeddings)
print(similarities.shape)
# [3, 3]
Evaluation
Metrics
Information Retrieval
- Dataset:
dim_768
- Evaluated with
InformationRetrievalEvaluator
Metric | Value |
---|---|
cosine_accuracy@1 | 0.0 |
cosine_accuracy@3 | 0.0769 |
cosine_accuracy@5 | 0.0769 |
cosine_accuracy@10 | 0.2308 |
cosine_precision@1 | 0.0 |
cosine_precision@3 | 0.0256 |
cosine_precision@5 | 0.0154 |
cosine_precision@10 | 0.0231 |
cosine_recall@1 | 0.0 |
cosine_recall@3 | 0.0769 |
cosine_recall@5 | 0.0769 |
cosine_recall@10 | 0.2308 |
cosine_ndcg@10 | 0.1016 |
cosine_mrr@10 | 0.0623 |
cosine_map@100 | 0.0814 |
Information Retrieval
- Dataset:
dim_512
- Evaluated with
InformationRetrievalEvaluator
Metric | Value |
---|---|
cosine_accuracy@1 | 0.0 |
cosine_accuracy@3 | 0.0769 |
cosine_accuracy@5 | 0.0769 |
cosine_accuracy@10 | 0.2308 |
cosine_precision@1 | 0.0 |
cosine_precision@3 | 0.0256 |
cosine_precision@5 | 0.0154 |
cosine_precision@10 | 0.0231 |
cosine_recall@1 | 0.0 |
cosine_recall@3 | 0.0769 |
cosine_recall@5 | 0.0769 |
cosine_recall@10 | 0.2308 |
cosine_ndcg@10 | 0.096 |
cosine_mrr@10 | 0.0566 |
cosine_map@100 | 0.0745 |
Information Retrieval
- Dataset:
dim_256
- Evaluated with
InformationRetrievalEvaluator
Metric | Value |
---|---|
cosine_accuracy@1 | 0.0 |
cosine_accuracy@3 | 0.0769 |
cosine_accuracy@5 | 0.0769 |
cosine_accuracy@10 | 0.2308 |
cosine_precision@1 | 0.0 |
cosine_precision@3 | 0.0256 |
cosine_precision@5 | 0.0154 |
cosine_precision@10 | 0.0231 |
cosine_recall@1 | 0.0 |
cosine_recall@3 | 0.0769 |
cosine_recall@5 | 0.0769 |
cosine_recall@10 | 0.2308 |
cosine_ndcg@10 | 0.0982 |
cosine_mrr@10 | 0.059 |
cosine_map@100 | 0.0828 |
Information Retrieval
- Dataset:
dim_128
- Evaluated with
InformationRetrievalEvaluator
Metric | Value |
---|---|
cosine_accuracy@1 | 0.0769 |
cosine_accuracy@3 | 0.2308 |
cosine_accuracy@5 | 0.2308 |
cosine_accuracy@10 | 0.3846 |
cosine_precision@1 | 0.0769 |
cosine_precision@3 | 0.0769 |
cosine_precision@5 | 0.0462 |
cosine_precision@10 | 0.0385 |
cosine_recall@1 | 0.0769 |
cosine_recall@3 | 0.2308 |
cosine_recall@5 | 0.2308 |
cosine_recall@10 | 0.3846 |
cosine_ndcg@10 | 0.2194 |
cosine_mrr@10 | 0.1701 |
cosine_map@100 | 0.1861 |
Information Retrieval
- Dataset:
dim_64
- Evaluated with
InformationRetrievalEvaluator
Metric | Value |
---|---|
cosine_accuracy@1 | 0.0 |
cosine_accuracy@3 | 0.0769 |
cosine_accuracy@5 | 0.1538 |
cosine_accuracy@10 | 0.3077 |
cosine_precision@1 | 0.0 |
cosine_precision@3 | 0.0256 |
cosine_precision@5 | 0.0308 |
cosine_precision@10 | 0.0308 |
cosine_recall@1 | 0.0 |
cosine_recall@3 | 0.0769 |
cosine_recall@5 | 0.1538 |
cosine_recall@10 | 0.3077 |
cosine_ndcg@10 | 0.13 |
cosine_mrr@10 | 0.0763 |
cosine_map@100 | 0.1002 |
Training Details
Training Dataset
Unnamed Dataset
- Size: 111 training samples
- Columns:
positive
andanchor
- Approximate statistics based on the first 1000 samples:
positive anchor type string string details - min: 2 tokens
- mean: 124.53 tokens
- max: 512 tokens
- min: 3 tokens
- mean: 11.15 tokens
- max: 60 tokens
- Samples:
positive anchor ply C Tris pH8.0 Dextran Trehalose dNTPS Na2SO4 Triton X-100 DTT TABLE 3 GAS Lyophilization Mix -Reagent Composition vl.0 v2.0 Strep A (Target) Lyo Conditions 500 nM F30 500 nM F30b.5om 100 nM R41m 100 nM R41m.lb.5om 200 nM MB4 FAM 200 nM MB4_ Fam 3.0. ug 5.0 ug 30U 0.7 ug 1 ug 1 ug 50mM 50 mM Dextran 150 Dextran 500 5% in 2x Iyo 5% in 2x Iyo 100 mM in 2x Iyo 100 mM in 2x Iyo 0.3 mM 0.3 mM 15 mM 22.5 mM 0.10% 0.10% 2mM 2mM Strep A (IC) Lyo Conditions
NE
CTGTTTG (SEQ ID NO, 5) To confirm that the targeted sequence was conserved among all GAS cepA sequences found in the public domain as well as unique to GAS, multiple sequence alignments and BLAST analyses were performed. Multiple alignment analysis of these sequences showed complete homology for the region of the gene targeted by the 3062 assay. Further, there are currently 24 complete GAS genomes (including whole genome shotgun sequence) available for sequence analysis in NCBI Genome. The cepA gene is present in all 24 genomes, and the 3062 target region within cepA is conserved among all 24 genomes. Upon BLAST analysis, it was confirmed that no other species contain significant homology to the 3062 target sequence. Assay Development As a reference, the reagent mixtures discussed below are
GCAATCTGAGGAGAGGCCATACTTGTTC
AGATTGC (SEQ ID NO, 4)
CAAACAGGAACAAGTATGGCCTCTCCTC
- Loss:
MatryoshkaLoss
with these parameters:{ "loss": "MultipleNegativesRankingLoss", "matryoshka_dims": [ 768, 512, 256, 128, 64 ], "matryoshka_weights": [ 1, 1, 1, 1, 1 ], "n_dims_per_step": -1 }
Training Hyperparameters
Non-Default Hyperparameters
eval_strategy
: epochper_device_train_batch_size
: 16per_device_eval_batch_size
: 16gradient_accumulation_steps
: 32num_train_epochs
: 15lr_scheduler_type
: cosinewarmup_ratio
: 0.1fp16
: Trueload_best_model_at_end
: Trueoptim
: adamw_torch_fused
All Hyperparameters
Click to expand
overwrite_output_dir
: Falsedo_predict
: Falseeval_strategy
: epochprediction_loss_only
: Trueper_device_train_batch_size
: 16per_device_eval_batch_size
: 16per_gpu_train_batch_size
: Noneper_gpu_eval_batch_size
: Nonegradient_accumulation_steps
: 32eval_accumulation_steps
: Nonelearning_rate
: 5e-05weight_decay
: 0.0adam_beta1
: 0.9adam_beta2
: 0.999adam_epsilon
: 1e-08max_grad_norm
: 1.0num_train_epochs
: 15max_steps
: -1lr_scheduler_type
: cosinelr_scheduler_kwargs
: {}warmup_ratio
: 0.1warmup_steps
: 0log_level
: passivelog_level_replica
: warninglog_on_each_node
: Truelogging_nan_inf_filter
: Truesave_safetensors
: Truesave_on_each_node
: Falsesave_only_model
: Falserestore_callback_states_from_checkpoint
: Falseno_cuda
: Falseuse_cpu
: Falseuse_mps_device
: Falseseed
: 42data_seed
: Nonejit_mode_eval
: Falseuse_ipex
: Falsebf16
: Falsefp16
: Truefp16_opt_level
: O1half_precision_backend
: autobf16_full_eval
: Falsefp16_full_eval
: Falsetf32
: Nonelocal_rank
: 0ddp_backend
: Nonetpu_num_cores
: Nonetpu_metrics_debug
: Falsedebug
: []dataloader_drop_last
: Falsedataloader_num_workers
: 0dataloader_prefetch_factor
: Nonepast_index
: -1disable_tqdm
: Falseremove_unused_columns
: Truelabel_names
: Noneload_best_model_at_end
: Trueignore_data_skip
: Falsefsdp
: []fsdp_min_num_params
: 0fsdp_config
: {'min_num_params': 0, 'xla': False, 'xla_fsdp_v2': False, 'xla_fsdp_grad_ckpt': False}fsdp_transformer_layer_cls_to_wrap
: Noneaccelerator_config
: {'split_batches': False, 'dispatch_batches': None, 'even_batches': True, 'use_seedable_sampler': True, 'non_blocking': False, 'gradient_accumulation_kwargs': None}deepspeed
: Nonelabel_smoothing_factor
: 0.0optim
: adamw_torch_fusedoptim_args
: Noneadafactor
: Falsegroup_by_length
: Falselength_column_name
: lengthddp_find_unused_parameters
: Noneddp_bucket_cap_mb
: Noneddp_broadcast_buffers
: Falsedataloader_pin_memory
: Truedataloader_persistent_workers
: Falseskip_memory_metrics
: Trueuse_legacy_prediction_loop
: Falsepush_to_hub
: Falseresume_from_checkpoint
: Nonehub_model_id
: Nonehub_strategy
: every_savehub_private_repo
: Falsehub_always_push
: Falsegradient_checkpointing
: Falsegradient_checkpointing_kwargs
: Noneinclude_inputs_for_metrics
: Falseeval_do_concat_batches
: Truefp16_backend
: autopush_to_hub_model_id
: Nonepush_to_hub_organization
: Nonemp_parameters
:auto_find_batch_size
: Falsefull_determinism
: Falsetorchdynamo
: Noneray_scope
: lastddp_timeout
: 1800torch_compile
: Falsetorch_compile_backend
: Nonetorch_compile_mode
: Nonedispatch_batches
: Nonesplit_batches
: Noneinclude_tokens_per_second
: Falseinclude_num_input_tokens_seen
: Falseneftune_noise_alpha
: Noneoptim_target_modules
: Nonebatch_eval_metrics
: Falsebatch_sampler
: batch_samplermulti_dataset_batch_sampler
: proportional
Training Logs
Epoch | Step | Training Loss | dim_128_cosine_map@100 | dim_256_cosine_map@100 | dim_512_cosine_map@100 | dim_64_cosine_map@100 | dim_768_cosine_map@100 |
---|---|---|---|---|---|---|---|
0 | 0 | - | 0.0747 | 0.0694 | 0.0681 | 0.1224 | 0.0705 |
1.0 | 1 | - | 0.0750 | 0.0694 | 0.0681 | 0.1224 | 0.0705 |
2.0 | 2 | - | 0.1008 | 0.0724 | 0.0696 | 0.0719 | 0.0710 |
3.0 | 3 | - | 0.1861 | 0.0828 | 0.0745 | 0.1002 | 0.0814 |
4.0 | 4 | - | 0.1711 | 0.0968 | 0.0825 | 0.0861 | 0.1001 |
5.0 | 6 | - | 0.1505 | 0.1140 | 0.1094 | 0.1534 | 0.1502 |
6.0 | 7 | - | 0.1222 | 0.1143 | 0.1108 | 0.1528 | 0.1520 |
7.0 | 8 | - | 0.1589 | 0.1536 | 0.1512 | 0.1513 | 0.1516 |
8.0 | 9 | - | 0.1561 | 0.1550 | 0.1531 | 0.1495 | 0.1520 |
9.0 | 10 | 1.8482 | 0.1565 | 0.1558 | 0.1544 | 0.1483 | 0.1522 |
10.0 | 12 | - | 0.1562 | 0.1551 | 0.1557 | 0.1416 | 0.1531 |
11.0 | 13 | - | 0.1561 | 0.1558 | 0.1562 | 0.1401 | 0.1533 |
12.0 | 14 | - | 0.1559 | 0.1559 | 0.1562 | 0.1402 | 0.1533 |
13.0 | 15 | - | 0.1861 | 0.0828 | 0.0745 | 0.1002 | 0.0814 |
- The bold row denotes the saved checkpoint.
Framework Versions
- Python: 3.10.12
- Sentence Transformers: 3.0.1
- Transformers: 4.41.2
- PyTorch: 2.3.0+cu121
- Accelerate: 0.32.1
- Datasets: 2.20.0
- Tokenizers: 0.19.1
Citation
BibTeX
Sentence Transformers
@inproceedings{reimers-2019-sentence-bert,
title = "Sentence-BERT: Sentence Embeddings using Siamese BERT-Networks",
author = "Reimers, Nils and Gurevych, Iryna",
booktitle = "Proceedings of the 2019 Conference on Empirical Methods in Natural Language Processing",
month = "11",
year = "2019",
publisher = "Association for Computational Linguistics",
url = "https://arxiv.org/abs/1908.10084",
}
MatryoshkaLoss
@misc{kusupati2024matryoshka,
title={Matryoshka Representation Learning},
author={Aditya Kusupati and Gantavya Bhatt and Aniket Rege and Matthew Wallingford and Aditya Sinha and Vivek Ramanujan and William Howard-Snyder and Kaifeng Chen and Sham Kakade and Prateek Jain and Ali Farhadi},
year={2024},
eprint={2205.13147},
archivePrefix={arXiv},
primaryClass={cs.LG}
}
MultipleNegativesRankingLoss
@misc{henderson2017efficient,
title={Efficient Natural Language Response Suggestion for Smart Reply},
author={Matthew Henderson and Rami Al-Rfou and Brian Strope and Yun-hsuan Sung and Laszlo Lukacs and Ruiqi Guo and Sanjiv Kumar and Balint Miklos and Ray Kurzweil},
year={2017},
eprint={1705.00652},
archivePrefix={arXiv},
primaryClass={cs.CL}
}
- Downloads last month
- 5
Inference Providers
NEW
This model is not currently available via any of the supported Inference Providers.
Model tree for kr-manish/bge-base-raw_pdf_finetuned_vf1
Base model
BAAI/bge-base-en-v1.5Evaluation results
- Cosine Accuracy@1 on dim 768self-reported0.000
- Cosine Accuracy@3 on dim 768self-reported0.077
- Cosine Accuracy@5 on dim 768self-reported0.077
- Cosine Accuracy@10 on dim 768self-reported0.231
- Cosine Precision@1 on dim 768self-reported0.000
- Cosine Precision@3 on dim 768self-reported0.026
- Cosine Precision@5 on dim 768self-reported0.015
- Cosine Precision@10 on dim 768self-reported0.023
- Cosine Recall@1 on dim 768self-reported0.000
- Cosine Recall@3 on dim 768self-reported0.077