removeSet(Set elements) {\n Set toWaitlist = new LinkedHashSet();\n int i=0;\n for (ARGState ae : elements) {\n if(ae.getParents()!=null){\n for (ARGState parent : ae.getParents()) {\n if (!elements.contains(parent)) {\n toWaitlist.add(parent);\n }\n }\n if(ae.getChildren()!=null)\n ae.removeFromARG();\n else\n ae.setDestroyed(true);\n }\n\n // ae.setNull();\n }\n return toWaitlist;\n }","public void clearBalls();","public ZYSet difference(ZYSet otherSet){\n ZYSet result = new ZYArraySet();\n for(ElementType e :this){\n if(!otherSet.contains(e)){\n result.add(e);\n }\n }\n return result;\n }","Set remove();","public void asteroidCol()\n\t{\n\t\t//collision can only occur if at least 2 asteroids are spawned\n\t\tif(gameObj[0].size() >=2)\n\t\t{\n\t\t\tint ast = new Random().nextInt(gameObj[0].size());\n\t\t\tgameObj[0].remove(ast);\n\t\t\tast = new Random().nextInt(gameObj[0].size());\n\t\t\tgameObj[0].remove(ast);\n\t\t\tSystem.out.println(\"2 asteroids have collided and been removed from the world\");\n\t\t}else\n\t\t\tSystem.out.println(\"2 asteroids are not spawned\");\n\t}"],"string":"[\n \"private void checkForGroundCollisions(Set droneSet) {\\n\\t\\tfor(Drone drone: droneSet){\\n\\t\\t\\t//if so, delete the drone from the set\\n\\t\\t\\tif(drone.checkCrash()){\\n\\t\\t\\t\\tthis.removeDrone(drone);\\n\\t\\t\\t\\tdroneSet.remove(drone);\\n\\t\\t\\t}\\n\\t\\t}\\n\\t}\",\n \"private Set collisionDetection(Set droneSet){\\n\\t\\t//convert the set of drones to an array list\\n\\t\\tList droneList = new ArrayList<>(droneSet);\\n\\t\\tSet crashedDrones = new HashSet<>();\\n\\n\\t\\tint nbDrones = droneList.size();\\n\\t\\t//cycle trough all the drones and check if they have crashed\\n\\t\\tfor(int i = 0; i != nbDrones; i++){\\n\\t\\t\\t//get the current drone\\n\\t\\t\\tDrone drone1 = droneList.get(i);\\n\\t\\t\\t//check if the drone hasn't already crashed\\n\\t\\t\\tif(crashedDrones.contains(drone1)){\\n\\t\\t\\t\\t//if so, we do not need to check it\\n\\t\\t\\t\\tcontinue;\\n\\t\\t\\t}\\n\\t\\t\\tVector posDrone1 = drone1.getPosition();\\n\\t\\t\\tfor(int j = i+1; j < nbDrones; j++){\\n\\t\\t\\t\\tDrone drone2 = droneList.get(j);\\n\\t\\t\\t\\tVector posDrone2 = drone2.getPosition();\\n\\t\\t\\t\\tfloat distance = posDrone2.distanceBetween(posDrone1);\\n\\t\\t\\t\\tif(distance <= CRASH_DISTANCE){\\n\\t\\t\\t\\t\\tcrashedDrones.add(drone1);\\n\\t\\t\\t\\t\\tcrashedDrones.add(drone2);\\n\\t\\t\\t\\t\\t//because the upper drone has crashed so we do not need to check\\n\\t\\t\\t\\t\\tbreak;\\n\\t\\t\\t\\t}\\n\\t\\t\\t}\\n\\t\\t}\\n\\n\\t\\treturn crashedDrones;\\n\\t}\",\n \"private void checkForCrashes(Set droneSet){\\n\\t\\t//first check if the drones have crashed with the ground\\n\\t\\tcheckForGroundCollisions(droneSet);\\n\\t\\t//then if they have collided with each other\\n\\t\\tcheckForDroneCollisions(droneSet);\\n\\n\\t}\",\n \"@Test\\n public void collidableRemoved() {\\n radar.loop();\\n assertTrue(radar.getObjectsSeenByRadar().stream().anyMatch(t -> t.getId().equals(\\\"tree_3\\\")));\\n radar.loop();\\n assertFalse(radar.getObjectsSeenByRadar().stream().anyMatch(t -> t.getId().equals(\\\"tree_3\\\")));\\n }\",\n \"public void romperEnlaces(Red red) {\\r\\n\\t\\tfor (CanalOptico canal : canales) {\\r\\n\\t\\t\\tNodo vecino = canal.getOtroExtremo(this);\\r\\n\\r\\n\\t\\t\\t/* Se elimina el enlace del vecino al nodo */\\r\\n\\t\\t\\tCanalOptico canalInverso = vecino.romperEnlace(this);\\r\\n\\r\\n\\t\\t\\t/* Se elimina el enlace del nodo al vecino */\\r\\n\\t\\t\\tcanales.remove(canal);\\r\\n\\r\\n\\t\\t\\t/* Se elimina ambos enlaces de la red */\\r\\n\\t\\t\\tred.removeCanal(canal);\\r\\n\\t\\t\\tred.removeCanal(canalInverso);\\r\\n\\t\\t}\\r\\n\\t}\",\n \"private void removeDrone(Drone drone){\\n\\t\\tthis.getDroneSet().remove(drone);\\n\\t}\",\n \"private void setHoleUNr(Hole hole, Set holeSet){\\n for (Hole uniqueHole:holeSet) {\\n if (hole.equals(uniqueHole)) {\\n hole.setUNr(uniqueHole.getUNr());\\n return;\\n }\\n }\\n }\",\n \"@Test\\n public void highlightedElementsCleared() {\\n radar.loop();\\n radar.loop();\\n radar.loop();\\n radar.loop();\\n radar.loop();\\n MovingWorldObject obj = radar.getNearestCollideableElement();\\n assertFalse(world.getWorldObjects().stream().anyMatch(WorldObject::isHighlightedWhenRadarIsOn));\\n assertFalse(world.getDynamics().stream().anyMatch(WorldObject::isHighlightedWhenRadarIsOn));\\n }\",\n \"private void cleanWorldsAndRegions() {\\n Set usedRegions = new HashSet<>();\\n Set usedWorlds = new HashSet<>();\\n\\n List entities = new ArrayList<>();\\n entities.addAll(getGroups().values());\\n entities.addAll(getPlayers().values());\\n\\n for (PermissionEntity entity : entities) {\\n for (Entry entry : entity.getPermissions()) {\\n if (entry.getRegion() != null)\\n usedRegions.add(entry.getRegion());\\n if (entry.getWorld() != null)\\n usedWorlds.add(entry.getWorld());\\n }\\n }\\n\\n // Determine what needs to be deleted\\n Set regionsToDelete = new HashSet<>(getRegions().values());\\n regionsToDelete.removeAll(usedRegions);\\n Set worldsToDelete = new HashSet<>(getWorlds().values());\\n worldsToDelete.removeAll(usedWorlds);\\n\\n // Re-build lists\\n getRegions().clear();\\n for (PermissionRegion region : usedRegions) {\\n getRegions().put(region.getName(), region);\\n }\\n getWorlds().clear();\\n for (PermissionWorld world : usedWorlds) {\\n getWorlds().put(world.getName(), world);\\n }\\n\\n // Tell underlying DAO about deleted regions/worlds\\n if (!regionsToDelete.isEmpty())\\n deleteRegions(regionsToDelete);\\n if (!worldsToDelete.isEmpty())\\n deleteWorlds(worldsToDelete);\\n }\",\n \"public void killDragonsAround(ArrayList dragons){\\n\\t\\tfor (int i = 0;i < dragons.size(); i++){\\n\\t\\t\\tdragon dragao = dragons.get(i);\\n\\t\\t\\t\\n\\t\\t\\tif ((pos_x + 1 == dragao.getPos_x() && pos_y == dragao.getPos_y())\\n\\t\\t\\t\\t\\t|| (pos_x - 1 == dragao.getPos_x() && pos_y == dragao.getPos_y())\\n\\t\\t\\t\\t\\t|| (pos_y + 1 == dragao.getPos_y() && pos_y == dragao.getPos_x())\\n\\t\\t\\t\\t\\t|| (pos_y - 1 == dragao.getPos_y() && pos_x == dragao.getPos_x()))\\n\\t\\t\\t\\tdragons.get(i).changeState();\\n\\t\\t}\\n\\t}\",\n \"public void clearDomainMarks(){\\n for (int i = 0 ; i < getBoardSize(); i++)\\n for (int j = 0 ; j < getBoardSize(); j++){\\n getPoint(i, j).setHolder(GoPlayer.UNKNOWN);\\n }\\n }\",\n \"public void moveAllDrones() {\\n for (Pieces d : drones) {\\n d.tryToMove(this);\\n }\\n }\",\n \"public static void removeShot(Set set){\\n\\n Deadwood deadwood = Deadwood.getInstance();\\n for(Shot shot : set.getShotList()){\\n if(shot.getIcon() != null){\\n bPane.remove(shot.getIcon());\\n bPane.revalidate();\\n bPane.repaint();\\n shot.setIcon(null);\\n break;\\n }\\n }\\n }\",\n \"private void unloadPackages(Set drones){\\n\\t\\t//loop trough all the drones, check if they carry any packages\\n\\t\\tfor(Drone drone: drones){\\n\\t\\t\\tif(drone.isDelivering()){\\n\\t\\t\\t\\t//check if the drone can deliver the package\\n\\t\\t\\t\\tif(canDeliverPackage(drone)){\\n\\t\\t\\t\\t//unload the package\\n\\t\\t\\t\\tdrone.unloadPackage();\\n\\t\\t\\t\\t}\\n\\t\\t\\t}\\n\\t\\t}\\n\\n\\t\\t//all the packages are unloaded\\n\\t}\",\n \"private void conformCorridors() {\\n for (int rowView = 0; rowView < rowViewMax; rowView++) {\\r\\n for (int colView = 0; colView < colViewMax; colView++) {\\r\\n if (getCell(rowView, colView) != Cell.wall)\\r\\n setCell(rowView, colView, Cell.corridor);\\r\\n }\\r\\n }\\r\\n }\",\n \"public Set getDroneSet(){\\n\\t\\treturn new HashSet(this.drones.values());\\n\\t}\",\n \"public int removeStones(int[][] stones) {\\n DSet ds = new DSet(20000);\\n for(int[] stone: stones){\\n ds.union( stone[0], stone[1] + 10000);\\n }\\n Set parents = new HashSet<>();\\n for(int[] stone: stones){\\n parents.add( ds.find(stone[0]));\\n }\\n return stones.length - parents.size();\\n }\",\n \"public void resetObjects() {\\n if (wind1.isOffScreen()) {\\n wind1.reset(wind3.getBoundingRectangle().y - buffer - rand.nextInt(AssetHandler.SCREEN_HEIGHT / 4));\\n }\\n if (wind2.isOffScreen()) {\\n wind2.reset(wind1.getBoundingRectangle().y - buffer - rand.nextInt(AssetHandler.SCREEN_HEIGHT / 4));\\n }\\n if (wind3.isOffScreen()) {\\n wind3.reset(wind2.getBoundingRectangle().y - buffer - rand.nextInt(AssetHandler.SCREEN_HEIGHT / 4));\\n }\\n\\n //Again, check if the clouds go off the screen and then reset them.\\n cloudBuffer = rand.nextInt(AssetHandler.SCREEN_HEIGHT / 4) + AssetHandler.SCREEN_HEIGHT / 4;\\n if (cloud1.isOffScreen()) {\\n cloud1.reset(cloud4.y - cloudBuffer);\\n }\\n if (cloud2.isOffScreen()) {\\n cloud2.reset(cloud1.y - cloudBuffer);\\n }\\n if (cloud3.isOffScreen()) {\\n cloud3.reset(cloud2.y - cloudBuffer);\\n }\\n if (cloud4.isOffScreen()) {\\n cloud4.reset(cloud3.y - cloudBuffer);\\n }\\n\\n //Check if birds (drones) go above the screen and reset them\\n birdBuffer = rand.nextInt(AssetHandler.SCREEN_HEIGHT / 2 + AssetHandler.SCREEN_HEIGHT / 3) + AssetHandler.SCREEN_HEIGHT / 2;\\n if (drone1.isOffScreen()) {\\n drone1.reset(drone2.y - birdBuffer);\\n }\\n birdBuffer = rand.nextInt(AssetHandler.SCREEN_HEIGHT / 2 + AssetHandler.SCREEN_HEIGHT / 3) + AssetHandler.SCREEN_HEIGHT / 2;\\n if (drone2.isOffScreen()) {\\n drone2.reset(drone1.y - birdBuffer);\\n }\\n\\n }\",\n \"public void updateDeletions() {\\r\\n for (Lane l : lanes) {\\r\\n Vehicle[] vehArray = l.getVehicles().toArray(new Vehicle[0]);\\r\\n for (Vehicle v : vehArray) {\\r\\n if (v.getHeadSegment().equals(l.getLastSegment())) {\\r\\n l.getVehicles().remove(v);\\r\\n numberOfVehicles--;\\r\\n if (v instanceof Car) {\\r\\n SimulationStats.incrementCars();\\r\\n SimulationStats.addEvent(SimulationStats.createVehicleLeavingEvent(v));\\r\\n } else if (v instanceof Truck) {\\r\\n SimulationStats.incrementTrucks();\\r\\n SimulationStats.addEvent(SimulationStats.createVehicleLeavingEvent(v));\\r\\n }\\r\\n }\\r\\n }\\r\\n }\\r\\n }\",\n \"protected void removeLane()\\n {\\n if (lane == 1)\\n {\\n\\n MyWorld.Lane1Monsters.remove(this);\\n getWorld().removeObject(this);\\n\\n }\\n\\n else if (lane == 2)\\n {\\n MyWorld.Lane2Monsters.remove(this);\\n getWorld().removeObject(this);\\n\\n }\\n\\n else if (lane == 3)\\n {\\n MyWorld.Lane3Monsters.remove(this);\\n getWorld().removeObject(this);\\n\\n }\\n\\n else if (lane == 4)\\n {\\n MyWorld.Lane4Monsters.remove(this);\\n getWorld().removeObject(this);\\n\\n }\\n\\n else if (lane == 5)\\n {\\n MyWorld.Lane5Monsters.remove(this);\\n getWorld().removeObject(this);\\n\\n }\\n MyWorld.monsterAdded();\\n }\",\n \"private void removeTerritoriesOfPlayerFromSpecificTime(Player player,RoundHistory roundHistory) {\\n List mapsToClear = player.getTerritoriesID();\\n while(!mapsToClear.isEmpty()){\\n Integer territoryID = mapsToClear.get(0);\\n getTerritoryFromSpecificTime(roundHistory,territoryID).eliminateThisWeakArmy();\\n mapsToClear.remove(0);\\n }\\n }\",\n \"public void removeAllPartOfSet() {\\r\\n\\t\\tBase.removeAll(this.model, this.getResource(), PARTOFSET);\\r\\n\\t}\",\n \"void retract()\\n\\t\\t{\\n\\t\\t\\tsides = sides-1;\\n\\t\\t\\t\\n\\t\\t\\tDimension[] dime2 = new Dimension[d.length - 1];\\n\\t\\t\\t\\n\\t\\t\\tfor (int i=0; i< d.length-1; i++)\\n\\t\\t\\t{\\n\\t\\t\\t\\tdime2[i]= d[i];\\n\\t\\t\\t}\\n\\t\\t\\t\\n\\t\\t\\td = new Dimension[d.length - 1];\\n\\t\\t\\tfor(int i = 0; i< dime2.length; i++)\\n\\t\\t\\t{\\n\\t\\t\\t\\td[i] = dime2[i];\\n\\t\\t\\t}\\n\\t\\t\\t\\t\\n\\t\\t}\",\n \"public static void clearWorld() {\\n\\t\\t// Complete this method.\\n\\t\\tfor(Critter i: population){\\n\\t\\t\\tpopulation.remove(i);\\n\\t\\t}\\n\\t\\tfor(Critter j: babies){\\n\\t\\t\\tbabies.remove(j);\\n\\t\\t}\\n\\t\\tpopulation.clear();\\n\\t\\tbabies.clear();\\n\\n\\n\\t}\",\n \"protected void doDeleteBoth() {\\r\\n\\t\\tif (renderer.surface != null) {\\r\\n\\t\\t\\tUndoableMapEdit undo = new UndoableMapEdit(renderer.surface);\\r\\n\\t\\t\\tdeleteEntitiesOf(renderer.surface.basemap, renderer.selectedRectangle, false);\\r\\n\\t\\t\\tdeleteEntitiesOf(renderer.surface.buildingmap, renderer.selectedRectangle, true);\\r\\n\\t\\t\\tundo.setAfter();\\r\\n\\t\\t\\taddUndo(undo);\\r\\n\\t\\t\\trepaint();\\r\\n\\t\\t}\\r\\n\\t}\",\n \"@Test\\n public void collidableObjects() {\\n radar.loop();\\n assertTrue(radar.getObjectsSeenByRadar().stream().anyMatch(t -> t.getId().equals(\\\"roadsign_speed_40_1\\\")));\\n assertFalse(radar.getObjectsSeenByRadar().stream().anyMatch(t -> t.getId().equals(\\\"parking_2\\\")));\\n }\",\n \"public void setDeadZones(double leftStick, double rightStick){\\n \\tdeadZoneLeft=leftStick * leftStick;\\n \\tdeadZoneRight=rightStick * rightStick;\\n }\",\n \"public void removeEffectFromSpecialBrick(){\\r\\n\\t\\t\\t// return everything to the original\\r\\n\\t\\t\\tColor origColor = (specialBrickId.equals(\\\"Rect0\\\"))? discsColors[0]:(specialBrickId.equals(\\\"Rect1\\\"))? discsColors[1]:\\r\\n\\t\\t\\t\\t\\t\\t (specialBrickId.equals(\\\"Rect2\\\"))? discsColors[2]:(specialBrickId.equals(\\\"Rect3\\\"))? discsColors[3]:\\r\\n\\t\\t\\t\\t\\t\\t (specialBrickId.equals(\\\"Rect4\\\"))? discsColors[4]:(specialBrickId.equals(\\\"Rect5\\\"))? discsColors[5]:\\r\\n\\t\\t\\t\\t\\t\\t (specialBrickId.equals(\\\"Rect6\\\"))? discsColors[6]:(specialBrickId.equals(\\\"Rect7\\\"))? discsColors[7]:null; \\r\\n\\t\\t\\tint origWidth = (specialBrickId.equals(\\\"Rect0\\\"))? 30:(specialBrickId.equals(\\\"Rect1\\\"))? 60:\\r\\n\\t\\t\\t\\t\\t\\t\\t(specialBrickId.equals(\\\"Rect2\\\"))? 90:(specialBrickId.equals(\\\"Rect3\\\"))? 120:\\r\\n\\t\\t\\t\\t\\t\\t\\t(specialBrickId.equals(\\\"Rect4\\\"))? 150:(specialBrickId.equals(\\\"Rect5\\\"))? 180:\\r\\n\\t\\t\\t\\t\\t\\t\\t(specialBrickId.equals(\\\"Rect6\\\"))? 210:(specialBrickId.equals(\\\"Rect7\\\"))? 240:null;\\r\\n\\t\\t\\tRectangle rect = new Rectangle(origWidth,20, origColor);\\r\\n\\t\\t\\trect.setId(specialBrickId);\\r\\n\\t\\t\\trect.setStroke(Color.BLACK);\\r\\n\\t\\t\\trect.setStrokeWidth(3);\\r\\n\\t\\t\\t\\t\\t\\t\\r\\n\\t\\t\\tswitch(specialBrickTower){\\r\\n\\t\\t\\t\\tcase \\\"firstTower\\\":\\r\\n\\t\\t\\t\\t\\tfor(int i=0; i {\\n this.game.getAsteroids().forEach(asteroid -> { // Check collision with any of the asteroids.\\n if (asteroid.collides(bullet)) {\\n asteroid.destroy();\\n bullet.destroy();\\n }\\n });\\n for (Spaceship ship : game.getPlayers().values()) {\\n\\n if (ship.collides(bullet)) { // Check collision with ship.\\n bullet.destroy();\\n ship.destroy();\\n }\\n }\\n });\\n // Next check for collisions between asteroids and the spaceship.\\n this.game.getAsteroids().forEach(asteroid -> {\\n for (Spaceship ship : game.getPlayers().values()) {\\n\\n if (asteroid.collides(ship)) {\\n ship.destroy();\\n asteroid.destroy();\\n }\\n }\\n if (KESSLER_SYNDROME) { // Only check for asteroid - asteroid collisions if we allow kessler syndrome.\\n this.game.getAsteroids().forEach(secondAsteroid -> {\\n if (!asteroid.equals(secondAsteroid) && asteroid.collides(secondAsteroid)) {\\n asteroid.destroy();\\n secondAsteroid.destroy();\\n }\\n });\\n }\\n });\\n }\",\n \"public void disperse() {\\t\\t\\n\\t\\tfor (int r = 0; r < rows; r++){\\n\\t\\t\\tfor (int c = 1; c < cols; c++){\\n\\t\\t\\t\\tint sum = values[r+1][c-1] + values[r+1][c] + values[r+1][c+1];\\n\\t\\t\\t\\tif(r < rows - fireLevel + 14){\\n\\t\\t\\t\\t\\tvalues[r][c] = (sum / 3) - 1;\\n\\t\\t\\t\\t}\\n\\t\\t\\t\\telse {\\n\\t\\t\\t\\t\\tvalues[r][c] = (int)((sum / 3.0) - 0.0); \\n\\t\\t\\t\\t}\\n\\t\\t\\t\\t\\n\\t\\t\\t\\tif (values[r][c] < 0) values[r][c] = 0;\\n\\t\\t\\t\\tg2.setColor(colors[values[r][c]]);\\n\\t\\t\\t\\tif(values[r][c] > 5){\\n\\t\\t\\t\\t\\tg2.fillRect(c*res,r*res,res,res);\\n\\t\\t\\t\\t}\\n\\t\\t\\t}\\n\\t\\t}\\n\\t}\",\n \"public void removeAll()\\r\\n {\\r\\n if (level ==2)\\r\\n {\\r\\n removeObjects(getObjects(Platforms.class));\\r\\n removeObjects(getObjects(Ladder.class));\\r\\n removeObjects(getObjects(SmallPlatform.class));\\r\\n removeObjects(getObjects(Door.class)); \\r\\n removeObjects(getObjects(Tomato.class)); \\r\\n removeObjects(getObjects(Bullet.class));\\r\\n removeObjects(getObjects(DeadTomato.class));\\r\\n player.setLocation();\\r\\n }\\r\\n if (level == 3)\\r\\n {\\r\\n removeObjects(getObjects(Tomato.class));\\r\\n removeObject(door2);\\r\\n removeObjects(getObjects(Canon.class));\\r\\n removeObjects(getObjects(CanonBullet.class));\\r\\n removeObjects(getObjects(Bullet.class));\\r\\n removeObjects(getObjects(Pedestal.class));\\r\\n removeObjects(getObjects(Platforms.class));\\r\\n removeObjects(getObjects(DeadTomato.class));\\r\\n }\\r\\n if (level == 4)\\r\\n {\\r\\n removeObjects(getObjects(Platforms.class));\\r\\n removeObjects(getObjects(Text.class));\\r\\n removeObjects(getObjects(Bullet.class));\\r\\n removeObjects(getObjects(Ladder.class));\\r\\n removeObjects(getObjects(Door.class)); \\r\\n removeObjects(getObjects(Boss.class)); \\r\\n removeObjects(getObjects(Thorns.class));\\r\\n player.setLocation();\\r\\n }\\r\\n }\",\n \"public void checkRockets() {\\n for (Rocket rocket : rockets) {\\n for (Ufo ufo : ufos) {\\n if (ufo.intersects(rocket)) {\\n ufo.die();\\n rocket.die();\\n }\\n }\\n\\n if (rocket.getY() <= 0)\\n rocket.die();\\n }\\n }\",\n \"void removeNearbyPixels(Stroke theStroke){\\n\\t\\tint index;\\n\\t\\tint CurvIndex;\\n\\t\\tint SpeedIndex;\\n\\t\\tVector ptList = theStroke.getM_ptList();\\n\\t\\tfor(index=0; index < CommonSegmentPts.size(); index++){\\n\\t\\t\\tPoint CommonPt = (PixelInfo)ptList.get((Integer)CommonSegmentPts.get(index));\\n\\t\\t\\tfor(CurvIndex = 0; CurvIndex < CurvVector.size(); CurvIndex++){\\n\\t\\t\\t\\tPoint CurvPt = (PixelInfo)ptList.get((Integer)CurvVector.get(CurvIndex));\\n\\t\\t\\t\\tif(CommonPt.distance(CurvPt) <= TolerantDistance){\\n\\t\\t\\t\\t\\tCurvVector.remove(CurvIndex--);\\n\\t\\t\\t\\t}\\n\\t\\t\\t}\\n\\t\\t\\tfor(SpeedIndex = 0; SpeedIndex < SpeedVector.size(); SpeedIndex++){\\n\\t\\t\\t\\tPoint SpeedPt = (PixelInfo)ptList.get((Integer)SpeedVector.get(SpeedIndex));\\n\\t\\t\\t\\tif(CommonPt.distance(SpeedPt) <= TolerantDistance){\\n\\t\\t\\t\\t\\tSpeedVector.remove(SpeedIndex--);\\n\\t\\t\\t\\t}\\n\\t\\t\\t}\\n\\t\\t}\\n\\t}\",\n \"public final Set findRemoved(Set set, List list) {\\n ArrayList arrayList = new ArrayList(CollectionsKt__IterablesKt.collectionSizeOrDefault(list, 10));\\n for (Control control : list) {\\n arrayList.add(control.getControlId());\\n }\\n return SetsKt___SetsKt.minus(set, arrayList);\\n }\",\n \"private void removeDestroyedObjects ()\\n {\\n Collection newAsteroids = new ArrayList<>(this.game.getAsteroids().size() * 2); // Avoid reallocation and assume every asteroid spawns successors.\\n this.game.getAsteroids().forEach(asteroid -> {\\n if (asteroid.isDestroyed()) {\\n this.increaseScore();\\n newAsteroids.addAll(asteroid.getSuccessors());\\n }\\n });\\n this.game.getAsteroids().addAll(newAsteroids);\\n // Remove all asteroids that are destroyed.\\n this.game.getAsteroids().removeIf(GameObject::isDestroyed);\\n // Remove any bullets that are destroyed.\\n this.game.getBullets().removeIf(GameObject::isDestroyed);\\n }\",\n \"public void removeRobotsAndRubble() {\\n\\t\\tfor(Player p : playerList) {\\n\\t\\t\\tif(p.getType() != PlayerType.Agent) {\\n\\t\\t\\t\\tremovePosition(p.getPosition());\\n\\t\\t\\t\\tremovePlayer(p.getName());\\n\\t\\t\\t}\\n\\t\\t\\telse \\n\\t\\t\\t\\tp.resetRobotsFollowing();\\n\\t\\t}\\n\\t}\",\n \"public OrderedSet difference (OrderedSet set) {\\n if (set == null)\\n return null;\\n boolean oldshow = show;\\n boolean oldshowErro = showErro;\\n show = false;\\n showErro = false;\\n for (DoubleLinkedList p=first; p!=null; p=p.getNext()) {\\n Object info = p.getInfo();\\n if (set.dictionary.get(info) != null)\\n\\tremove(info);\\n }\\n show = oldshow;\\n showErro = oldshowErro;\\n return this;\\n }\",\n \"public void eliminarSoldados(List eliminados) {\\n for (Soldado soldado : eliminados) {\\n if (soldado.getTipoSoldado() == TipoSoldado.LEGION) {\\n destruirLegion(soldado);\\n }\\n this.soldados.remove(soldado);\\n }\\n }\",\n \"private static Point avoidNoFlyZones(Point droneCurr, Point droneNextDes, List>> noFlyZonesCoords, List dronePositions, String port) throws IOException, InterruptedException {\\r\\n\\t\\tvar intersectingLines = linesWhichIntersect(droneCurr, droneNextDes, noFlyZonesCoords);\\r\\n\\t\\tvar numCoords = intersectingLines.size();\\r\\n\\t\\t\\r\\n\\t\\tvar droneGrad = getGradient(droneCurr, droneNextDes);\\r\\n\\t\\tvar droneYint = getYint(droneCurr, droneNextDes);\\r\\n\\t\\tvar droneNext = droneNextDes; //in the case that there are no intersections with any lines\\r\\n\\t\\t\\r\\n\\t\\tPoint previous1 = null;\\r\\n\\t\\tPoint previous2 = null;\\r\\n\\t\\tvar lastIndex = dronePositions.size()-1;\\r\\n\\t\\tif(lastIndex>1) { //checks that drone has been in at least 3 positions\\r\\n\\t\\t\\tprevious1 = dronePositions.get(lastIndex-1); //previous position of drone\\r\\n\\t\\t\\tprevious2 = dronePositions.get(lastIndex-2); //position before previous position\\r\\n\\t\\t}\\r\\n\\t\\t\\r\\n\\t\\t//in the case that the drone intersects with one line\\r\\n\\t\\tif(numCoords == 2) {\\r\\n\\t\\t\\tvar coord1 = intersectingLines.get(0);\\r\\n\\t\\t\\tvar coord2 = intersectingLines.get(1); \\r\\n\\t\\t\\tvar buildingInd = buildingIndex(coord1, port);\\r\\n\\t\\t\\tif(buildingInd != 100) { //index initialised as 100 in buildingIndex function- if coordinate not found in list, 100 is returned\\r\\n\\t\\t\\t\\tvar buildingCentre = buildingCentres(port).get(buildingInd);\\r\\n\\t\\t\\t\\tvar buildingSideGrad = getGradient(coord1, coord2);\\r\\n\\t\\t\\t\\tdroneNext = chooseNextPos(droneCurr, droneNextDes, coord1, coord2, buildingSideGrad, buildingCentre, noFlyZonesCoords, previous1, previous2);\\r\\n\\t\\t\\t}\\r\\n\\t\\t\\t\\r\\n\\t\\t}\\r\\n\\t\\t//in the case that the drone intersects with two lines\\r\\n\\t\\telse if(numCoords == 4) {\\r\\n\\t\\t\\tvar coord1 = intersectingLines.get(0);\\r\\n\\t\\t\\tvar coord2 = intersectingLines.get(1);\\r\\n\\t\\t\\tvar coord3 = intersectingLines.get(2);\\r\\n\\t\\t\\tvar coord4 = intersectingLines.get(3);\\r\\n\\t\\t\\t\\r\\n\\t\\t\\tvar buildingSide1Grad = getGradient(coord1, coord2);\\r\\n\\t\\t\\tvar buildingSide1Yint = getYint(coord1, coord2);\\r\\n\\t\\t\\tvar intersection1 = getIntersection(droneYint, buildingSide1Yint, droneGrad, buildingSide1Grad);\\r\\n\\t\\t\\tvar dist1 = euclidDist(intersection1, droneCurr);\\r\\n\\t\\t\\t\\r\\n\\t\\t\\tvar buildingSide2Grad = getGradient(coord3, coord4);\\r\\n\\t\\t\\tvar buildingSide2Yint = getYint(coord3, coord4);\\r\\n\\t\\t\\tvar intersection2 = getIntersection(droneYint, buildingSide2Yint, droneGrad, buildingSide2Grad);\\r\\n\\t\\t\\tvar dist2 = euclidDist(intersection2, droneCurr);\\r\\n\\t\\t\\t\\r\\n\\t\\t\\tvar buildingInd1 = buildingIndex(coord1, port); //in case the two lines which the drone intersects with are from 2 different buildings\\r\\n\\t\\t\\tvar buildingInd2 = buildingIndex(coord3, port);\\r\\n\\t\\t\\tif(buildingInd1 !=100 && buildingInd2 !=100) { \\r\\n\\t\\t\\t\\tvar buildingCentre1 = buildingCentres(port).get(buildingInd1);\\r\\n\\t\\t\\t\\tvar buildingCentre2 = buildingCentres(port).get(buildingInd2);\\r\\n\\t\\t\\t\\t\\r\\n\\t\\t\\t\\tif(dist1();\\n }\",\n \"private CVizAbstractDiagram setShading(CVizAbstractDiagram d) {\\n\\t\\tSet z_all = d.getZones();\\n\\t\\tSet z_shaded = new HashSet();\\n\\t\\tfor (CVizZone z : z_all) {\\n\\t\\t\\tfor (String l : z.getIn()) {\\n\\t\\t\\t\\t// spiders\\n\\t\\t\\t\\tif (showSpiders) {\\n\\t\\t\\t\\t\\tif (indMap.containsKey(l)) {\\n\\t\\t\\t\\t\\t\\tList>> sps = indMap.get(l);\\n\\t\\t\\t\\t\\t\\tlog.info(\\\"Spiders in \\\" + l + \\\": \\\" + sps);\\n\\t\\t\\t\\t\\t\\tfor (Pair> spInfo : sps) {\\n\\t\\t\\t\\t\\t\\t\\tspInfo.snd.add(z);// add this zone to the habitat\\n\\t\\t\\t\\t\\t\\t}\\n\\t\\t\\t\\t\\t} /*else if (!isDisjoint(getInfo(childrenInfo, l), indMap.keySet())) {\\n\\t\\t\\t\\t\\t\\tfor(String child: getInfo(childrenInfo, l)) {\\n\\t\\t\\t\\t\\t\\t\\tlog.info(l+\\\" has child \\\"+child);\\n\\t\\t\\t\\t\\t\\t\\tif(indMap.containsKey(child)) {\\n\\t\\t\\t\\t\\t\\t\\t\\tList>> sps = indMap.get(child);\\n\\t\\t\\t\\t\\t\\t\\t\\tlog.info(\\\"Spiders in \\\" + child + \\\": \\\" + sps);\\n\\t\\t\\t\\t\\t\\t\\t\\tfor (Pair> spInfo : sps) {\\n\\t\\t\\t\\t\\t\\t\\t\\t\\tspInfo.snd.add(z);// add this zone to the habitat\\n\\t\\t\\t\\t\\t\\t\\t\\t}\\n\\t\\t\\t\\t\\t\\t\\t}\\n\\t\\t\\t\\t\\t\\t}\\n\\t\\t\\t\\t\\t}*/\\n\\t\\t\\t\\t}\\n\\t\\t\\t\\t// shading\\n\\t\\t\\t\\tif (inconsistentClasses.contains(l)) {\\n\\t\\t\\t\\t\\tz_shaded.add(z);\\n\\t\\t\\t\\t\\tbreak;\\n\\t\\t\\t\\t}\\n\\t\\t\\t\\tboolean shadeMe = false;\\n\\t\\t\\t\\tif (equivsInfo.containsKey(l)) {\\n\\t\\t\\t\\t\\tfor (OWLClass e : equivsInfo.get(l)) {\\n\\t\\t\\t\\t\\t\\tif (!z.getIn().contains(classMap.get(render(e)).fst)) {\\n\\t\\t\\t\\t\\t\\t\\tshadeMe = true;\\n\\t\\t\\t\\t\\t\\t\\tbreak;\\n\\t\\t\\t\\t\\t\\t}\\n\\t\\t\\t\\t\\t}\\n\\t\\t\\t\\t\\tif (shadeMe) {\\n\\t\\t\\t\\t\\t\\tz_shaded.add(z);\\n\\t\\t\\t\\t\\t\\tbreak;\\n\\t\\t\\t\\t\\t}\\n\\t\\t\\t\\t}\\n\\t\\t\\t\\tif (unionsInfo.containsKey(l)) {// if l is a union of classes,\\n\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t// S, regions containing l but\\n\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t// not S should be shaded\\n\\t\\t\\t\\t\\tSet unions = unionsInfo.get(l);\\n\\t\\t\\t\\t\\tshadeMe = true;\\n\\t\\t\\t\\t\\tfor (OWLClass u : unions) {\\n\\t\\t\\t\\t\\t\\tString uNm = render(u);\\n\\t\\t\\t\\t\\t\\tif (!classMap.containsKey(uNm) /* lowest level class */\\n\\t\\t\\t\\t\\t\\t\\t\\t|| z.getIn().contains(uNm)) {\\n\\t\\t\\t\\t\\t\\t\\tshadeMe = false;\\n\\t\\t\\t\\t\\t\\t\\tbreak;\\n\\t\\t\\t\\t\\t\\t}\\n\\t\\t\\t\\t\\t}\\n\\t\\t\\t\\t\\tif (shadeMe) {\\n\\t\\t\\t\\t\\t\\tz_shaded.add(z);\\n\\t\\t\\t\\t\\t\\tbreak;\\n\\t\\t\\t\\t\\t}\\n\\t\\t\\t\\t}\\n\\t\\t\\t}\\n\\t\\t\\tif (showSpiders) {\\n\\t\\t\\t\\t// individuals.put(z, spiders);\\n\\t\\t\\t}\\n\\t\\t}\\n\\t\\treturn new CVizAbstractDiagram(z_all, z_shaded, null);\\n\\t}\",\n \"void removeWalls(Map percentages, int totalPlayerArrows)\\r\\n throws UnsupportedOperationException,\\r\\n IllegalArgumentException, PlayerKilledException;\",\n \"public void retract(){\\n\\t\\tsolenoid1.set(false);\\n\\t\\tsolenoid2.set(false);\\n\\t}\",\n \"public void removeVehicles() {\\r\\n numberOfVehicles = 0;\\r\\n for (Lane lane : lanes) {\\r\\n lane.removeVehicles();\\r\\n }\\r\\n }\",\n \"public int removeStones(int[][] stones) {\\n int len = stones.length;\\n int[] parent = new int[len];\\n Arrays.fill(parent, -1);\\n Map xmap = new HashMap<>();\\n Map ymap = new HashMap<>();\\n for(int i = 0; i < len; i++) {\\n int[] stone = stones[i];\\n int x = stone[0];\\n if(!xmap.containsKey(x)){\\n xmap.put(x, i);\\n } else {\\n parent[x] = xmap.get(x);\\n }\\n int y = stone[1];\\n if(!ymap.containsKey(y)){\\n ymap.put(y, i);\\n } else {\\n parent[y] = ymap.get(y);\\n }\\n\\n union(x, y, xmap, ymap, parent);\\n }\\n int count = 0;\\n for(int i : parent){\\n if(i == -1) count++;\\n }\\n return len - count;\\n }\",\n \"public void checkForRemoval()\\n {\\n if (life <= 0)\\n {\\n SideScrollingWorld world = (SideScrollingWorld) getWorld(); \\n \\n world.isPacmanDead = true;\\n getWorld().removeObject(this);\\n }\\n }\",\n \"protected void cleanBullets() {\\n Set recyclable = new HashSet();\\n for (Bullet bullet : this.bullets) {\\n bullet.update();\\n if (bullet.getPositionY() < SEPARATION_LINE_HEIGHT\\n || bullet.getPositionY() > this.height)\\n recyclable.add(bullet);\\n }\\n this.bullets.removeAll(recyclable);\\n //BulletPool.recycle(recyclable);\\n }\",\n \"public void removeDead() {\\n for (BaseObject object : new ArrayList(bombs)) {\\n if (!object.isAlive())\\n bombs.remove(object);\\n }\\n\\n for (BaseObject object : new ArrayList(rockets)) {\\n if (!object.isAlive())\\n rockets.remove(object);\\n }\\n\\n for (BaseObject object : new ArrayList(ufos)) {\\n if (!object.isAlive())\\n ufos.remove(object);\\n }\\n }\",\n \"void nuke() {\\n\\t\\tfor (int a = 0; a < height; a++) {\\n\\t\\t\\tfor (int b = 0; b < width; b++) {\\n\\t\\t\\t\\tif (FWorld[a][b] != null) {\\n\\t\\t\\t\\t\\tEZ.removeEZElement(FWorld[a][b]);\\n\\t\\t\\t\\t}\\n\\t\\t\\t}\\n\\t\\t}\\n\\n\\t\\tEZ.removeEZElement(background);\\n\\t\\tEZ.removeEZElement(explosion);\\n\\t\\tturtle.kill();\\n\\t}\",\n \"@Override\\n\\tpublic void setDeltarijAndDeltarkj(GVector coords3d) {\\n\\n\\t\\tchangedCoordinates = 0;\\n\\t\\t//logger.debug(\\\"Setting Deltarij and Deltarkj\\\");\\n\\t\\tfor (int i=0; i < changeAtomCoordinates.length; i++) {\\n\\t\\t\\tthis.changeAtomCoordinates[i] = false;\\n\\t\\t}\\n\\t\\tthis.moleculeCurrentCoordinates.sub(coords3d);\\n\\n\\t\\tfor (int i = 0; i < this.moleculeCurrentCoordinates.getSize(); i++) {\\n\\t\\t\\t//logger.debug(\\\"moleculeCurrentCoordinates \\\" + i + \\\" = \\\" + this.moleculeCurrentCoordinates.getElement(i));\\n\\t\\t\\tif (Math.abs(this.moleculeCurrentCoordinates.getElement(i)) > 0) {\\n\\t\\t\\t\\tchangeAtomCoordinates[i/3] = true;\\n\\t\\t\\t\\tchangedCoordinates = changedCoordinates + 1;\\n\\t\\t\\t\\t//logger.debug(\\\"changeAtomCoordinates[\\\" + i/3 + \\\"] = \\\" + changeAtomCoordinates[i/3]);\\n\\t\\t\\t\\ti = i + (2 - i % 3);\\n\\t\\t\\t}\\n\\t\\t}\\n\\n\\t\\tfor (int i = 0; i < ab.angleNumber; i++) {\\n\\t\\t\\tif ((changeAtomCoordinates[ab.angleAtomPosition[i][0]] == true) |\\n\\t\\t\\t\\t\\t(changeAtomCoordinates[ab.angleAtomPosition[i][1]] == true))\\t\\t{\\n\\n\\t\\t\\t\\trij[i] = ForceFieldTools.distanceBetweenTwoAtomsFrom3xNCoordinates(coords3d, ab.angleAtomPosition[i][1], ab.angleAtomPosition[i][0]);\\n\\t\\t\\t\\tdeltarij[i] = rij[i] - r0IJ[i];\\n\\t\\t\\t\\t//logger.debug(\\\"deltarij[\\\" + i + \\\"] = \\\" + deltarij[i]);\\n\\t\\t\\t}\\n\\t\\t\\t//else {System.out.println(\\\"deltarij[\\\" + i + \\\"] was no recalculated\\\");}\\n\\t\\t\\tif ((changeAtomCoordinates[ab.angleAtomPosition[i][1]] == true) |\\n\\t\\t\\t\\t\\t(changeAtomCoordinates[ab.angleAtomPosition[i][2]] == true))\\t\\t{\\n\\n\\t\\t\\t\\trkj[i] = ForceFieldTools.distanceBetweenTwoAtomsFrom3xNCoordinates(coords3d, ab.angleAtomPosition[i][1], ab.angleAtomPosition[i][2]);\\n\\t\\t\\t\\tdeltarkj[i] = rkj[i] - r0KJ[i];\\n\\t\\t\\t\\t//logger.debug(\\\"deltarkj[\\\" + i + \\\"] = \\\" + deltarkj[i]);\\n\\t\\t\\t}\\n\\t\\t}\\n\\n\\t\\tmoleculeCurrentCoordinates.set(coords3d);\\n\\t}\",\n \"public static void mazeUnion(){\\n\\n\\t\\tint n = 10;\\t\\n\\n\\t\\tdsf S = new dsf(n*n);\\n\\t\\tMaze one = new Maze(n);\\n\\n\\t\\tRandom random;\\n\\t\\tint sets = n*n;\\t//number of sets in the DSF\\n\\t\\tint randomNumber;\\n\\t\\tint randomDirection;\\n\\t\\tint row;\\n\\t\\tint col;\\n\\n\\t\\tchar upperRight; \\t//bottom or right\\n\\n\\t\\tS.print();\\n\\n\\t\\twhile(sets > 1){\\n\\t\\t\\trandom = new Random();\\n\\t\\t\\trandomNumber = random.nextInt((n*n) - 1);\\n\\t\\t\\tSystem.out.println(\\\"RANDOM NUMBER: \\\"+randomNumber);\\n\\t\\t\\trow = randomNumber /n;\\t//SWITCHED\\n\\t\\t\\tcol = randomNumber %n;\\t//SWITCHED\\n\\t\\t\\trandomDirection = random.nextInt(2);\\n\\t\\t\\tString direct;\\n\\t\\t\\tif(randomDirection == 0)\\n\\t\\t\\t\\tdirect = \\\"upper\\\";\\n\\t\\t\\telse\\n\\t\\t\\t\\tdirect = \\\"right\\\";\\n\\t\\t\\tSystem.out.println(\\\"RANDOM DIRECTI0N: \\\"+direct);\\n\\t\\t\\tupperRight = one.direction(randomDirection);\\n\\n\\t\\t\\tif(upperRight == 'u'){\\n\\t\\t\\t\\tif((randomNumber) < ((n*n)-n)){\\n\\t\\t\\t\\t\\tSystem.out.println(\\\"Sets: \\\"+sets);\\n\\t\\t\\t\\t\\tif(S.find(randomNumber+n) != S.find(randomNumber)){\\n\\t\\t\\t\\t\\t\\tS.union(randomNumber+n, randomNumber);\\n\\t\\t\\t\\t\\t\\tone.remove_wall(col, row, 'u');\\n\\t\\t\\t\\t\\t\\tS.print();\\n\\t\\t\\t\\t\\t\\tsets--;\\n\\t\\t\\t\\t\\t}\\n\\t\\t\\t\\t}\\n\\t\\t\\t}\\n\\n\\t\\t\\tif(upperRight == 'r'){\\n\\t\\t\\t\\tif(((randomNumber)%(n*n)) != n-1){\\n\\t\\t\\t\\t\\tif(S.findAndCompress(randomNumber) != S.findAndCompress(randomNumber+1)){\\n\\t\\t\\t\\t\\t\\tS.union(randomNumber, randomNumber+1);\\n\\t\\t\\t\\t\\t\\tone.remove_wall(col, row, 'r');\\n\\t\\t\\t\\t\\t\\t//S.print();\\n\\t\\t\\t\\t\\t\\tsets--;\\n\\t\\t\\t\\t\\t}\\n\\t\\t\\t\\t}\\n\\t\\t\\t}\\n\\t\\t}\\n\\n\\t\\tStdDraw.show(0);\\n\\t\\tone.draw();\\n\\t\\tone.printCellNumbers();\\n\\t\\t\\n\\t\\tbuildAdjacencyList(one, n);\\n\\t\\tuserSelection_SolveMaze(n);\\n\\n\\t}\",\n \"private void checkPlayerCollisions() {\\r\\n\\t\\tGObject left = getElementAt(player.getX() - 1, player.getY() + player.getHeight() / 2.0);\\r\\n\\t\\tGObject right = getElementAt(player.getX() + player.getWidth() + 1, player.getY() + player.getHeight() / 2.0);\\r\\n\\t\\tif(dragon1 != null && (left == dragon1 || right == dragon1)) {\\r\\n\\t\\t\\tremove(lifeBar);\\r\\n\\t\\t\\tlifeBar = null;\\r\\n\\t\\t}\\r\\n\\t\\tif(dragon2 != null && (left == dragon2 || right == dragon2)) {\\r\\n\\t\\t\\tremove(lifeBar);\\r\\n\\t\\t\\tlifeBar = null;\\r\\n\\t\\t}\\r\\n\\t}\",\n \"private void clean() {\\n Iterable v = vertices();\\n Iterator iter = v.iterator();\\n while (iter.hasNext()) {\\n Long n = iter.next();\\n if (world.get(n).adj.size() == 0) {\\n iter.remove();\\n }\\n }\\n }\",\n \"public void resetWorld() {\\n \\t\\tmyForces.clear();\\n \\t\\t\\n \\t\\tfor (CollidableObject obj : myObjects) {\\n \\t\\t\\tobj.detach();\\n \\t\\t}\\n \\t\\tmyObjects.clear();\\n \\t\\t\\n \\t\\taddHalfspaces();\\n \\t}\",\n \"void removeNeighbors();\",\n \"public void markDangerTiles() {\\n List dangerTiles = this.gb.nearByTiles(this.enemy_head_x, this.enemy_head_y);\\n if (dangerTiles.contains(this.gb.get(this.us_head_x, this.us_head_y)))\\n return; // Don't force fill if our head is there\\n for (Tile t : dangerTiles)\\n t.setForceFilled(true);\\n }\",\n \"static void wipeLocations(){\\n\\t \\tfor (int i= 0; i < places.length; i++){\\n\\t\\t\\t\\tfor (int j = 0; j < places[i].items.size(); j++)\\n\\t\\t\\t\\t\\tplaces[i].items.clear();\\n\\t\\t\\t\\tfor (int k = 0; k < places[i].receptacle.size(); k++)\\n\\t\\t\\t\\t\\tplaces[i].receptacle.clear();\\n\\t \\t}\\n\\t \\tContainer.emptyContainer();\\n\\t }\",\n \"void removeRoadside(int i);\",\n \"@Override\\n public void onRemoval() {\\n try {\\n if (eOutputHatches != null) {\\n for (GT_MetaTileEntity_Hatch_ElementalContainer hatch_elemental : eOutputHatches) {\\n hatch_elemental.id = -1;\\n }\\n for (GT_MetaTileEntity_Hatch_ElementalContainer hatch_elemental : eInputHatches) {\\n hatch_elemental.id = -1;\\n }\\n for (GT_MetaTileEntity_Hatch_OutputData hatch_data : eOutputData) {\\n hatch_data.id = -1;\\n hatch_data.q = null;\\n }\\n for (GT_MetaTileEntity_Hatch_InputData hatch_data : eInputData) {\\n hatch_data.id = -1;\\n }\\n for (GT_MetaTileEntity_Hatch_Uncertainty hatch : eUncertainHatches) {\\n hatch.getBaseMetaTileEntity().setActive(false);\\n }\\n for (GT_MetaTileEntity_Hatch_Param hatch : eParamHatches) {\\n hatch.getBaseMetaTileEntity().setActive(false);\\n }\\n }\\n cleanOutputEM_EM();\\n if (ePowerPass && getEUVar() > V[3] || eDismantleBoom && mMaxProgresstime > 0 && areChunksAroundLoaded_EM()) {\\n explodeMultiblock();\\n }\\n } catch (Exception e) {\\n if (DEBUG_MODE) {\\n e.printStackTrace();\\n }\\n }\\n }\",\n \"public void cover ()\\n {\\n unlinkLR(); // remove the column header\\n for (DancingNode i=this.D; i!=this; i=i.D) // go down the column\\n {\\n for (DancingNode j=i.R; j!=i; j=j.R) // go right across the row from the current node. your stopping condition is j!=i because you do not want to \\n // break the UD links between the nodes of the condition column that you are removing\\n {\\n j.unlinkUD(); // the rows are intact but removed. this works because if there IS a node in the row, then it must be a 1 value and must eliminate\\n // all rows except the solution row that have a 1 in that column. Plus, you end up removing the condition column as well because each of the nodes \\n // in it are removed along with the rows that they belong to. ALL OF THESE CAN BE ACCESSED BY THE *THIS* COLUMN NODE!\\n j.C.size--; \\n }\\n }\\n }\",\n \"private void removeCastle(PieceColor color, boolean kingSide) {\\n \\tif(color == PieceColor.White) {\\n \\t\\tif(kingSide) castle[0] = false;\\n \\t\\telse castle[1] = false;\\n \\t}\\n \\telse if(color == PieceColor.Black) {\\n \\t\\tif(kingSide) castle[2] = false;\\n \\t\\telse castle[3] = false;\\n \\t}\\n }\",\n \"public void moveTrojans() {\\n if (bigTrojan == null) {\\n for (Trojan trojan : trojans) {\\n //set X & Y to bigTrojan's death point.\\n\\n trojan.getBounds().setPosition(trojan.getX() - trojan.getxSpeed(), trojan.getY() - trojan.getySpeed());\\n trojan.setY(trojan.getY() - trojan.getySpeed());\\n trojan.setX(trojan.getX() + trojan.getxSpeed());\\n trojan.getSprite().setPosition(trojan.getX(), trojan.getY());\\n //if trojan collides with player remove player and worm section\\n if (trojan.getBounds().overlaps(player.getBounds())) {\\n score += trojan.getPoints() / 2;\\n for (int i = 0; i < 10; i++) {\\n int p = particles.spawn(ParticleManager.Type.DATA, trojan);\\n particles.x[p] = (trojan.getX() + trojan.getSprite().getWidth() / 2);\\n particles.y[p] = trojan.getY() + trojan.getSprite().getHeight() / 2;\\n }\\n int p = particles.spawn(ParticleManager.Type.EXPLOSION, trojan);\\n particles.x[p] = (trojan.getX() + trojan.getSprite().getWidth() / 2);\\n particles.y[p] = trojan.getY() + trojan.getSprite().getHeight() / 2;\\n sfx.playSound(SoundFXManager.Type.DEATH);\\n removeTrojan = trojan;\\n player.setHp(player.getHp() - (trojan.getDamage() * 5));\\n }\\n }\\n if (removeTrojan != null) {\\n spawnFiles(removeTrojan.getFileDropCount(), removeTrojan.getX() + (removeTrojan.getSprite().getWidth() / 2), removeTrojan.getY() + removeTrojan.getSprite().getHeight() / 2);\\n trojans.remove(removeTrojan);\\n }\\n }\\n //Move big trojan\\n else {\\n bigTrojan.getBounds().setPosition(bigTrojan.getX() - bigTrojan.getxSpeed(), bigTrojan.getY() - bigTrojan.getySpeed());\\n bigTrojan.setY(bigTrojan.getY() - bigTrojan.getySpeed());\\n bigTrojan.setX(bigTrojan.getX() + bigTrojan.getxSpeed());\\n bigTrojan.getSprite().setPosition(bigTrojan.getX(), bigTrojan.getY());\\n trojanWidth = (int) bigTrojan.getX() - 150;\\n trojanHeight = (int) bigTrojan.getY();\\n if (bigTrojan.getBounds().overlaps(player.getBounds())) {\\n score += bigTrojan.getPoints() / 2;\\n player.setHp(player.getHp() - (bigTrojan.getDamage() * 10));\\n for (int i = 0; i < 10; i++) {\\n int p = particles.spawn(ParticleManager.Type.DATA, bigTrojan);\\n particles.x[p] = (bigTrojan.getX() + bigTrojan.getSprite().getWidth() / 2);\\n particles.y[p] = bigTrojan.getY() + bigTrojan.getSprite().getHeight() / 2;\\n }\\n int p = particles.spawn(ParticleManager.Type.EXPLOSION, bigTrojan);\\n particles.x[p] = (bigTrojan.getX() + bigTrojan.getSprite().getWidth() / 2);\\n particles.y[p] = bigTrojan.getY() + bigTrojan.getSprite().getHeight() / 2;\\n sfx.playSound(SoundFXManager.Type.DEATH);\\n bigTrojan = null;\\n //Sets baby trojans to where big trojan died\\n for (Trojan trojan : trojans) {\\n trojan.setY(trojanHeight);\\n\\n trojan.setX(trojanWidth);\\n trojan.getSprite().setPosition(trojan.getX(), trojan.getY());\\n\\n //Creates Bounding box\\n trojan.setBounds(new Rectangle(trojan.getX(), trojan.getY(), trojan.getSprite().getWidth(), trojan.getSprite().getHeight()));\\n trojanWidth += 200;\\n }\\n }\\n }\\n }\",\n \"public static void removeIceAndFire(){\\r\\n for(int i = 0; i < board.length; i++) {\\r\\n for (int j = 0; j < board[i].length; j++) {\\r\\n if(board[i][j].isOnFireForTheNextNTurns == currentTurn){\\r\\n board[i][j].isOnFire = false;\\r\\n }\\r\\n if(board[i][j].isFrozenForTheNextNTurns == currentTurn){\\r\\n board[i][j].isFrozen = false;\\r\\n }\\r\\n }\\r\\n }\\r\\n }\",\n \"public void createMaze(int rows, int cols) {\\n\\t\\t\\n\\t\\tint total = rows*cols;\\n\\t\\tDisjSets ds = new DisjSets(total); //Create an object of the disjoint set class\\n\\t\\t \\n\\t\\tList> maze = new ArrayList>();\\n\\t\\t \\n\\t\\tmaze = initializeMaze(rows, cols, maze); //Initialize the maze\\n\\t\\t \\n\\t\\tRandom rand = new Random();\\n\\t\\t \\n\\t\\twhile(ds.find(0) != ds.find(total - 1)) {\\n\\t\\t\\t \\n\\t\\t\\tint currRow = rand.nextInt(rows); //Random row number\\n\\t\\t\\tint currCol = rand.nextInt(cols); //Random column number\\n\\t\\t\\tNode currNode = maze.get(currRow).get(currCol); //Current node(cell)\\n\\t\\t\\tint currValue = currNode.value;\\n\\t\\t\\t \\n\\t\\t\\tint root1 = ds.find(currValue); //Find on current node(cell)\\n\\t\\t\\tint root2;\\n\\t\\t\\tboolean removeHorizontal = false;\\n\\t\\t\\t \\n\\t\\t\\tif(currValue == total - 1) {\\n\\t\\t\\t\\tcontinue; //Don't do anything if the current cell is the bottom-rightmost cell\\n\\t\\t\\t}\\n\\t\\t\\t \\n\\t\\t\\tif(currRow == rows - 1) {\\n\\t\\t\\t\\t//Last row -- can only break the right wall, can't break the wall to the bottom \\n\\t\\t\\t\\troot2 = ds.find(currValue + 1);\\n\\t\\t\\t} else if(currCol == cols - 1) {\\n\\t\\t\\t\\t//Last column -- can only break the wall to the bottom, can't break the right wall \\n\\t\\t\\t\\troot2 = ds.find(currValue + cols);\\n\\t\\t\\t\\tremoveHorizontal = true;\\n\\t\\t\\t} else {\\n\\t\\t\\t\\t//Neither last row nor last column\\n\\t\\t\\t\\t//Randomly select either right wall or wall to the bottom to break\\n\\t\\t\\t\\tboolean selectRight;\\n\\t\\t\\t\\tselectRight = rand.nextBoolean();\\n\\t\\t\\t\\t \\n\\t\\t\\t\\tif(selectRight) {\\n\\t\\t\\t\\t\\troot2 = ds.find(currValue + 1);\\n\\t\\t\\t\\t} else {\\n\\t\\t\\t\\t\\troot2 = ds.find(currValue + cols);\\n\\t\\t\\t\\t\\tremoveHorizontal = true;\\n\\t\\t\\t\\t}\\n\\t\\t\\t}\\n\\t\\t\\t\\n\\t\\t\\t//Finds resulted in different sets\\n\\t\\t\\tif(root1 != root2) {\\n\\t\\t\\t\\t \\n\\t\\t\\t\\tds.union(root1, root2); //Take union of the two sets\\n\\t\\t\\t\\t \\n\\t\\t\\t\\tif(removeHorizontal) {\\n\\t\\t\\t\\t\\tcurrNode.horizontal = false; //Break the horizontal wall\\n\\t\\t\\t\\t} else {\\n\\t\\t\\t\\t\\tcurrNode.vertical = false; //Break the vertical wall\\n\\t\\t\\t\\t}\\n\\t\\t\\t}\\n\\t\\t}\\n\\t\\t\\n\\t\\t//Leave the bottom right corner open\\n\\t\\tNode destination = maze.get(rows - 1).get(cols - 1);\\n\\t\\tdestination.horizontal = false;\\n\\t\\tdestination.vertical = false;\\n\\t\\t \\n\\t\\tprintMaze(rows, cols, maze); //Print the final maze\\n\\t}\",\n \"private void collision() {\\n\\t\\tfor(int i = 0; i < brownMeteors.length; i++) {\\n\\t\\t\\tif( distance(brownMeteors[i].getLayoutX() + ENTITIES_SIZE/2, brownMeteors[i].getLayoutY() - ENTITIES_SIZE/2, \\n\\t\\t\\t\\t\\tplayer.getLayoutX() + ENTITIES_SIZE/2, player.getLayoutY() - ENTITIES_SIZE/2) <= ENTITIES_SIZE) {\\n\\t\\t\\t\\tsetNewElementPosition(brownMeteors[i]);\\n\\t\\t\\t\\t\\n\\t\\t\\t\\t//Update score -\\n\\t\\t\\t\\tsc.score -= 3 * sc.collisionCounter; \\n\\t\\t\\t\\tsc.collisionCounter++;\\n\\t\\t\\t}\\n\\t\\t}\\n\\t\\t//player vs grey Meteor\\n\\t\\tfor(int i = 0; i < greyMeteors.length; i++) {\\n\\t\\t\\tif( distance(greyMeteors[i].getLayoutX() + ENTITIES_SIZE/2, greyMeteors[i].getLayoutY() - ENTITIES_SIZE/2, \\n\\t\\t\\t\\t\\tplayer.getLayoutX() + ENTITIES_SIZE/2, player.getLayoutY() - ENTITIES_SIZE/2) <= ENTITIES_SIZE) {\\n\\t\\t\\t\\tsetNewElementPosition(greyMeteors[i]);\\n\\n\\t\\t\\t\\t//Update score -\\n\\t\\t\\t\\tsc.score -= 3 * sc.collisionCounter;\\n\\t\\t\\t\\tsc.collisionCounter++;\\n\\t\\t\\t}\\n\\t\\t}\\n\\t\\t\\n\\t\\t\\n\\t\\t//laser vs brown Meteor\\n\\t\\tfor(int i = 0; i < lasers.size(); i++) {\\n\\t\\t\\tfor(int j = 0; j < brownMeteors.length; j++) { // 0 - 2 -> 3elem\\n\\t\\t\\t\\tif(lasers.get(i).getBoundsInParent().intersects(brownMeteors[j].getBoundsInParent())) {\\t// bounds of a node in it's parent coordinates\\n\\t\\t\\t\\t\\tsetNewElementPosition(brownMeteors[j]);\\n\\t\\t\\t\\t\\tgamePane.getChildren().remove(lasers.get(i));\\n\\t\\t\\t\\t\\tlasers.remove(i);\\n\\t\\t\\t\\t\\tSystem.out.println(lasers.size());\\n\\t\\t\\t\\t\\t\\n\\t\\t\\t\\t\\t//Update score +\\n\\t\\t\\t\\t\\tsc.score += 1; \\n\\t\\t\\t\\t\\tbreak; //kein fehler mehr durch index out of bounds verletzung\\n\\t\\t\\t\\t}\\n\\t\\t\\t}\\n\\t\\t}\\t\\n\\t\\t\\n\\t\\tfor(int i = 0; i < lasers.size(); i++) {\\n\\t\\t\\tfor(int j = 0; j < greyMeteors.length; j++) { // 0 - 2 -> 3elem\\n\\t\\t\\t\\tif(lasers.get(i).getBoundsInParent().intersects(greyMeteors[j].getBoundsInParent())) {\\t// bounds of a node in it's parent coordinates\\n\\t\\t\\t\\t\\tsetNewElementPosition(greyMeteors[j]);\\n\\t\\t\\t\\t\\tgamePane.getChildren().remove(lasers.get(i));\\n\\t\\t\\t\\t\\tlasers.remove(i);\\n\\t\\t\\t\\t\\tSystem.out.println(lasers.size());\\n\\t\\t\\t\\t\\t\\n\\t\\t\\t\\t\\t//Update score +\\n\\t\\t\\t\\t\\tsc.score += 1; \\n\\t\\t\\t\\t\\tbreak; //kein fehler mehr durch index out of bounds verletzung\\n\\t\\t\\t\\t}\\n\\t\\t\\t}\\n\\t\\t\\t\\n\\t\\t}\\t\\t\\n\\t}\",\n \"public void removeBalls() {\\r\\n for (Ball ball : this.ballsList) {\\r\\n ball.removeFromGame(this);\\r\\n }\\r\\n this.ballsList.clear();\\r\\n }\",\n \"public void removeAllSeconderyColorsFromBoard() {\\n\\t\\tArrayList boardTiles= getAllBoardTiles();\\n\\t\\tif(!this.coloredTilesList.isEmpty()) {\\n\\t\\t\\tboardTiles.retainAll(coloredTilesList);\\n\\t\\t\\tfor(Tile t :boardTiles) {\\n\\t\\t\\t\\tTile basicTile= new Tile.Builder(t.getLocation(), t.getColor1()).setPiece(t.getPiece()).build();\\n\\t\\t\\t\\treplaceTileInSameTileLocation(basicTile);\\t\\t\\t\\t\\t\\t\\n\\t\\t\\t}\\n\\t\\t}\\n\\t\\tthis.coloredTilesList=null;\\n\\t\\tthis.coloredTilesList=new ArrayList();\\n\\t\\tthis.orangeTiles=null;\\n\\t\\tthis.orangeTiles=new ArrayList();\\n\\n\\t}\",\n \"private void removeSpeciesUnmatching(int optionselected) {\\n for (String s : speciesLeft) {\\n if (!(criteriaList.get(currentCriteria).getOptionList().get(optionselected).getEntities().contains(s)))\\n speciesLeft.remove(s);\\n }\\n }\",\n \"public void collided() {\\n this.collided = true;\\n }\",\n \"private void removeDeadModels(List dead)\\n\\t{\\n\\t\\tfor (Organism org : dead)\\n\\t\\t{\\n\\t\\t\\tSystem.out.println(\\\"REMOVING \\\" + org + \\\" FROM VIEW.\\\");\\n\\t\\t\\trootNode.getChild(org.toString()).removeFromParent();\\n\\t\\t\\torganismViewData.removeOrganism(org);\\n\\t\\t}\\n\\t}\",\n \"public void andNot(BitSet set){\\n for(int i=Math.min(wordsInUse,set.wordsInUse)-1;i>=0;i--)\\n words[i]&=~set.words[i];\\n recalculateWordsInUse();\\n checkInvariants();\\n }\",\n \"public Set removeRooms(Set rooms){\\n Set result=new HashSet<>();\\n for(Room r: rooms){\\n try{\\n removeRoom(r);\\n }\\n catch(RemoveRoomException ex){\\n result.add(r);\\n }\\n }\\n return result;\\n }\",\n \"void collide() {\\n for (Target t : this.helicopterpieces) {\\n if (!t.isHelicopter && ((t.x == this.player.x && t.y == this.player.y)\\n || (t.x == this.player2.x && t.y == this.player2.y))) {\\n this.collected--;\\n t.isCollected = true;\\n }\\n if (t.isHelicopter && this.collected == 1\\n && ((t.x == this.player.x && t.y == this.player.y) || (t.isHelicopter\\n && this.collected == 1 && t.x == this.player2.x && t.y == this.player2.y))) {\\n this.collected = 0;\\n this.helicopter.isCollected = true;\\n }\\n }\\n }\",\n \"private void move(boolean aller, Road[][] BoarderRoad){\\n \\n int q=(int)((hour*60+minute)/5)-1;//je pense que le int prend l'arrondi et pas la partie entière\\n Iterator iter= this.allInhabDeparture.get(q).iterator();\\n while (iter.hasNext()){\\n Inhabitant curin = (Inhabitant)iter.next();\\n this.onTheRoadAgain.add(curin);\\n curin.testChemin(aller);\\n }\\n Iterator it = this.onTheRoadAgain.iterator();\\n while (it.hasNext()) {\\n Inhabitant curin = (Inhabitant)it.next();\\n if(curin.MovingPath(boardRoad.BoardRoad)==true){\\n onTheRoadAgain.remove(curin);\\n }\\n \\n\\n }\\n }\",\n \"private TreeSet getNeightborSets(DisjointSets ds, int root)\\n {\\n return null; //TODO: remove and replace this line\\n }\",\n \"public void unifyAdjacentChests(World par1World, int par2, int par3, int par4) {\\n\\t\\tif (!par1World.isRemote) {\\n\\t\\t\\tBlock l = par1World.getBlock(par2, par3, par4 - 1);\\n\\t\\t\\tBlock i1 = par1World.getBlock(par2, par3, par4 + 1);\\n\\t\\t\\tBlock j1 = par1World.getBlock(par2 - 1, par3, par4);\\n\\t\\t\\tBlock k1 = par1World.getBlock(par2 + 1, par3, par4);\\n\\t\\t\\tBlock l1;\\n\\t\\t\\tBlock i2;\\n\\n\\t\\t\\tbyte b0;\\n\\t\\t\\tint j2;\\n\\n\\t\\t\\tif (l != this && i1 != this) {\\n\\t\\t\\t\\tif (j1 != this && k1 != this) {\\n\\t\\t\\t\\t\\tb0 = 3;\\n\\n\\t\\t\\t\\t\\tif (l.func_149730_j() && !i1.func_149730_j()) {\\n\\t\\t\\t\\t\\t\\tb0 = 3;\\n\\t\\t\\t\\t\\t}\\n\\n\\t\\t\\t\\t\\tif (i1.func_149730_j() && !l.func_149730_j()) {\\n\\t\\t\\t\\t\\t\\tb0 = 2;\\n\\t\\t\\t\\t\\t}\\n\\n\\t\\t\\t\\t\\tif (j1.func_149730_j() && !k1.func_149730_j()) {\\n\\t\\t\\t\\t\\t\\tb0 = 5;\\n\\t\\t\\t\\t\\t}\\n\\n\\t\\t\\t\\t\\tif (k1.func_149730_j() && !j1.func_149730_j()) {\\n\\t\\t\\t\\t\\t\\tb0 = 4;\\n\\t\\t\\t\\t\\t}\\n\\t\\t\\t\\t} else {\\n\\t\\t\\t\\t\\tl1 = par1World.getBlock(j1 == this ? par2 - 1 : par2 + 1, par3, par4 - 1);\\n\\t\\t\\t\\t\\ti2 = par1World.getBlock(j1 == this ? par2 - 1 : par2 + 1, par3, par4 + 1);\\n\\t\\t\\t\\t\\tb0 = 3;\\n\\n\\t\\t\\t\\t\\tif (j1 == this) {\\n\\t\\t\\t\\t\\t\\tj2 = par1World.getBlockMetadata(par2 - 1, par3, par4);\\n\\t\\t\\t\\t\\t} else {\\n\\t\\t\\t\\t\\t\\tj2 = par1World.getBlockMetadata(par2 + 1, par3, par4);\\n\\t\\t\\t\\t\\t}\\n\\n\\t\\t\\t\\t\\tif (j2 == 2) {\\n\\t\\t\\t\\t\\t\\tb0 = 2;\\n\\t\\t\\t\\t\\t}\\n\\n\\t\\t\\t\\t\\tif ((l.func_149730_j() || l1.func_149730_j()) && !i1.func_149730_j() && !i2.func_149730_j()) {\\n\\t\\t\\t\\t\\t\\tb0 = 3;\\n\\t\\t\\t\\t\\t}\\n\\n\\t\\t\\t\\t\\tif ((i1.func_149730_j() || i2.func_149730_j()) && !l.func_149730_j() && !l1.func_149730_j()) {\\n\\t\\t\\t\\t\\t\\tb0 = 2;\\n\\t\\t\\t\\t\\t}\\n\\t\\t\\t\\t}\\n\\t\\t\\t} else {\\n\\t\\t\\t\\tl1 = par1World.getBlock(par2 - 1, par3, l == this ? par4 - 1 : par4 + 1);\\n\\t\\t\\t\\ti2 = par1World.getBlock(par2 + 1, par3, l == this ? par4 - 1 : par4 + 1);\\n\\t\\t\\t\\tb0 = 5;\\n\\n\\t\\t\\t\\tif (l == this) {\\n\\t\\t\\t\\t\\tj2 = par1World.getBlockMetadata(par2, par3, par4 - 1);\\n\\t\\t\\t\\t} else {\\n\\t\\t\\t\\t\\tj2 = par1World.getBlockMetadata(par2, par3, par4 + 1);\\n\\t\\t\\t\\t}\\n\\n\\t\\t\\t\\tif (j2 == 4) {\\n\\t\\t\\t\\t\\tb0 = 4;\\n\\t\\t\\t\\t}\\n\\n\\t\\t\\t\\tif ((j1.func_149730_j() || l1.func_149730_j()) && !k1.func_149730_j() && !i2.func_149730_j()) {\\n\\t\\t\\t\\t\\tb0 = 5;\\n\\t\\t\\t\\t}\\n\\n\\t\\t\\t\\tif ((k1.func_149730_j() || i2.func_149730_j()) && !j1.func_149730_j() && !l1.func_149730_j()) {\\n\\t\\t\\t\\t\\tb0 = 4;\\n\\t\\t\\t\\t}\\n\\t\\t\\t}\\n\\n\\t\\t\\tpar1World.setBlockMetadataWithNotify(par2, par3, par4, b0, 3);\\n\\t\\t}\\n\\t}\",\n \"void unsetRoadTerrain();\",\n \"public fillCylinders() {\\n addParallel(new SetSolenoid(RobotMap.fillOne, false)); \\n addParallel(new SetSolenoid(RobotMap.fillTwo, false));\\n addParallel(new SetSolenoid(RobotMap.fillThree, false));\\n addParallel(new SetSolenoid(RobotMap.fillFour, false));\\n }\",\n \"public void deleteDoubles() {\\r\\n\\t for (int j = 0; j < this.size()-1; j++) {\\r\\n\\t for (int i = j+1; i < this.size(); i++) {\\r\\n\\t if (this.get(i).equals(this.get(j))) {\\r\\n\\t this.remove(i);\\r\\n\\t i--;\\r\\n\\t }\\r\\n\\t }\\r\\n\\t }\\r\\n\\t }\",\n \"@Test\\n\\tpublic void testEliminationByColumn(){\\n\\t\\tsetBoardUp();\\n\\t\\tColumn col = new Column(board, 1);\\n\\t\\tint[] toBeRemoved = {1, 3, 4};\\n\\t\\tint[] fromCesll = {1, 2, 3, 5, 6, 8};\\n\\t\\talgorithm.applyEliminationInColumn(col);\\n\\t\\tboolean condition = true;\\n\\t\\tfor(int i = 0; i < toBeRemoved.length; i++)\\n\\t\\t\\tfor(int j = 0; j < fromCesll.length; j++)\\n\\t\\t\\t\\tcondition &= !col.cell[fromCesll[j]].possibilities.contains(toBeRemoved[i]);\\t\\t\\n\\t\\tassertTrue(condition);\\n\\t}\",\n \"private void removeNoMoreExistingOriginalEdges() {\\n for (MirrorEdge mirrorEdge : directEdgeMap.values()) {\\n if (!originalGraph.has(mirrorEdge.original)) {\\n for (Edge segment : mirrorEdge.segments) {\\n mirrorGraph.forcedRemove(segment);\\n reverseEdgeMap.remove(segment);\\n }\\n for (Node bend : mirrorEdge.bends) {\\n mirrorGraph.forcedRemove(bend);\\n reverseEdgeMap.remove(bend);\\n }\\n directEdgeMap.remove(mirrorEdge.original);\\n }\\n }\\n }\",\n \"public void reset() {\\n for (int i = 0; i < numberOfRows; i++ ) {\\n for (int j =0; j < numberOfColumns; j++) {\\n if (grid[i][j] == LASER) {\\n this.Remove(i,j);\\n }\\n }\\n }\\n }\",\n \"public void removeAllConductor() {\\r\\n\\t\\tBase.removeAll(this.model, this.getResource(), CONDUCTOR);\\r\\n\\t}\",\n \"public final void unHideObjects() {\\n for (DodlesActor actor : all.values()) {\\n ((Actor) actor).setVisible(true);\\n }\\n }\",\n \"public void removeAll() {\\n\\t\\tsynchronized (mNpcs) {\\n\\t\\t\\tmNpcs = Collections.synchronizedList(new ArrayList());\\n\\t\\t\\tmDemonCount = 0;\\n\\t\\t\\tmHumanCount = 0;\\n\\t\\t}\\n\\t}\",\n \"public void handleDominoes() {\\r\\n int n = 0;\\r\\n List aux = new ArrayList<>();\\r\\n for (Player player : this.players) {\\r\\n player.setDominoes(shuffledDominoes.subList(n, n += 7), true);\\r\\n }\\r\\n\\r\\n if (n < shuffledDominoes.size()) {\\r\\n stack.addAll(shuffledDominoes.subList(n, shuffledDominoes.size()));\\r\\n System.out.println(\\\"LAST DOMINO OF STACK\\\" + stack.get(stack.size() - 1));\\r\\n }\\r\\n }\",\n \"public void divideDomain(){\\n \\tfor (int i = 0 ; i < getBoardSize() ; i++)\\n \\t\\tfor (int j = 0 ; j < getBoardSize() ; j++){\\n\\t\\t\\tgetPoint(i, j).setHolder(GoPlayer.UNKNOWN);\\n\\t\\t}\\n\\n \\t\\tfor (int i = 0 ; i < getBoardSize() ; i++)\\n \\t\\tfor (int j = 0 ; j < getBoardSize() ; j++){\\n if (getPoint(i, j).getHolder() == GoPlayer.UNKNOWN){\\n \\tif (getPoint(i, j).getState() == GoPoint.BLACK){\\n getPoint(i, j).setHolder(GoPlayer.BLACK);\\n \\t}\\n \\telse if (getPoint(i, j).getState() == GoPoint.WHITE){\\n getPoint(i, j).setHolder(GoPlayer.WHITE);\\n \\t}\\n \\telse {\\n \\t\\tVector v = getBody(i,j);\\n \\t\\tfindSpaceHolder(v);\\n \\t}\\n }\\n\\t\\t}\\n }\",\n \"public int checkCollisions() {\\r\\n\\t\\tArrayList comets = Comet.getCometList();\\r\\n\\r\\n\\t\\tfor (int i = 0; i < comets.size(); i++) {\\r\\n\\t\\t\\tComet tempComet = comets.get(i);\\r\\n\\r\\n\\t\\t\\tif (getBounds().intersects(tempComet.getBounds())) {\\r\\n\\t\\t\\t\\tComet.removeComet(tempComet);\\r\\n\\t\\t\\t\\tcol++;\\r\\n\\t\\t\\t}\\r\\n\\t\\t}\\r\\n\\t\\treturn col;\\r\\n\\t}\",\n \"public void mixDominoes() {\\r\\n\\r\\n if (shuffledDominoes.isEmpty()) {\\r\\n for (int i = 0; i <= 6; i++) {\\r\\n for (int j = i; j <= 6; j++) {\\r\\n Domino res = new Domino(i, j);\\r\\n shuffledDominoes.add(res);\\r\\n }\\r\\n }\\r\\n }\\r\\n\\r\\n Collections.shuffle(shuffledDominoes);\\r\\n }\",\n \"public void trimBarrier(){\\n game.setBarrierNumOfParties(game.getPlayersConnected());\\n }\",\n \"public ReducedCellInfo[] EliminateEntries( ReducedCellInfo[] possibilities, \\r\\n String[] latticeTypes,\\r\\n String[] CenteringTypes)\\r\\n {\\r\\n return possibilities;\\r\\n }\",\n \"private void remove_opposite_end(Line workingSet, boolean direction) {\\n\\t\\tif (direction == LEFT) {\\n\\t\\t\\t// Erase the end of the working set\\n\\t\\t\\tworkingSet.getAllPoints().remove(\\n\\t\\t\\t\\t\\tworkingSet.getAllPoints().size() - 1);\\n\\t\\t} else {\\n\\t\\t\\t// Erase the beginning of the working set\\n\\t\\t\\tworkingSet.getAllPoints().remove(0);\\n\\t\\t}\\n\\t\\tworkingSet.setNum_points(workingSet.getNum_points() - 1);\\n\\t}\",\n \"@Override\\n\\tpublic void move(List collidedTiles) \\n\\t{\\t\\t\\t \\n\\t\\tfor (TileCollision tc : collidedTiles)\\n\\t\\t{\\n\\n\\t\\t\\tint tileType = tc.theTile.getTileType();\\n\\n\\t\\t\\tisWall = false;\\n\\t\\t\\t// 11 and 12 are the only tiles that are not walls.\\n\\t\\t\\tfor (int i = 0; i < 11; i++)\\n\\t\\t\\t{\\n\\t\\t\\t\\tif (tileType == i) isWall = true;\\n\\t\\t\\t}\\n\\n\\t\\t\\tif (tileType == 13 && tc.collisionSide == 0)\\n\\t\\t\\t{\\n\\t\\t\\t\\tmoveUpToTileSide(tc);\\n\\t\\t\\t\\tsetDirection(Direction.RIGHT.getValue());\\n\\t\\t\\t\\treturn;\\n\\t\\t\\t}\\n\\t\\t\\tif (isWall)\\n\\t\\t {\\n\\t\\t\\t\\tmoveUpToTileSide(tc);\\n\\t\\t\\t\\tsetDirection(randomDirection());\\n\\t\\t\\t\\treturn;\\n\\t\\t }\\n\\n\\t\\t\\t// Only gets executed when pacman is in it normal state, and not in\\n\\t\\t\\t// hunter mode.\\n\\t\\t\\tif(!pacman.isHunter())\\n\\t\\t\\t{\\n\\t\\t\\t if(isPacmanToClose() && !inToCloseZone)\\n\\t\\t\\t {\\n\\t\\t\\t \\tinToCloseZone = true;\\n\\n\\t\\t\\t \\tif (pacman.movesUp() || pacman.movesDown())\\n\\t\\t\\t \\t{\\n\\t\\t\\t \\t\\treverseVerticalDirection();\\n\\t\\t\\t \\t}\\n\\t\\t\\t \\tif (pacman.movesLeft() || pacman.movesRight())\\n\\t\\t\\t \\t{\\n\\t\\t\\t \\t\\treverseHorizontalDirection();\\t\\t\\t \\n\\t\\t\\t \\t}\\n\\t\\t\\t\\t}\\n\\t\\t\\t else \\n\\t\\t\\t\\t{\\n\\t\\t\\t\\t\\tinToCloseZone = false;\\n\\t\\t\\t\\t}\\n\\t\\t\\t}\\n\\n\\n\\t\\t\\t// Only gets executed when pacman eat a power up and is the hunter.\\n\\t\\t\\telse if(pacman.isHunter())\\n\\t\\t {\\n\\t\\t\\t if (isWall)\\n\\t\\t\\t { \\n\\t\\t\\t\\t\\tmoveUpToTileSide(tc);\\n\\t\\t\\t\\t\\tif (getDirection() == Direction.UP.getValue())\\n\\t\\t\\t\\t\\t{\\n\\t\\t\\t\\t\\t\\tif(collided)\\n\\t\\t\\t\\t\\t\\t{\\t\\t\\t\\t\\t\\t\\t \\n\\t\\t\\t\\t\\t\\t\\tsetDirection(Direction.DOWN.getValue());\\t\\t\\t\\t\\t \\n\\t\\t\\t\\t\\t\\t}\\n\\t\\t\\t\\t\\t\\telse\\n\\t\\t\\t\\t\\t\\t{\\n\\t\\t\\t\\t\\t\\t\\tsetDirection(Direction.RIGHT.getValue());\\n\\t\\t\\t\\t\\t\\t\\tcollided = true;\\n\\t\\t\\t\\t\\t\\t}\\n\\t\\t\\t\\t\\t}\\n\\n\\t\\t\\t\\t\\t else if (getDirection() == Direction.RIGHT.getValue())\\n\\t\\t\\t\\t\\t {\\n\\t\\t\\t if(collided)\\n\\t\\t\\t {\\n\\t\\t\\t \\t setDirection(Direction.DOWN.getValue());\\t\\t\\t \\t \\n\\t\\t\\t }\\n\\t\\t\\t else\\n\\t\\t\\t {\\n\\t\\t\\t\\t\\t\\t\\t setDirection(Direction.UP.getValue()); \\n\\t\\t\\t\\t\\t\\t\\t collided = true;\\n\\t\\t\\t }\\n\\t\\t\\t\\t\\t }\\n\\n\\t\\t\\t\\t\\t else if (getDirection() == Direction.LEFT.getValue())\\n\\t\\t\\t\\t\\t {\\n\\t\\t\\t\\t\\t\\t if(collided)\\n\\t\\t\\t\\t\\t\\t {\\n\\t\\t\\t \\t setDirection(Direction.RIGHT.getValue());\\n\\t\\t\\t\\t\\t\\t }\\n\\t\\t\\t\\t\\t\\t else\\n\\t\\t\\t\\t\\t\\t {\\n\\t\\t\\t\\t\\t\\t\\t setDirection(Direction.UP.getValue()); \\n\\t\\t\\t\\t\\t\\t\\t collided = true;\\n\\t\\t\\t\\t\\t\\t }\\n\\t\\t\\t\\t\\t }\\n\\n\\t\\t\\t\\t\\t else if (getDirection() == Direction.DOWN.getValue())\\n\\t\\t\\t\\t\\t {\\n\\t\\t\\t\\t\\t\\t if(collided)\\n\\t\\t\\t\\t\\t\\t {\\n\\t\\t\\t\\t\\t\\t\\t\\t setDirection(Direction.LEFT.getValue()); \\t \\n\\t\\t\\t\\t\\t\\t }\\n\\t\\t\\t\\t\\t else\\n\\t\\t\\t\\t\\t {\\n\\t\\t\\t\\t\\t\\t\\t setDirection(Direction.RIGHT.getValue()); \\n\\t\\t\\t\\t\\t\\t\\t collided = true;\\n\\t\\t\\t\\t\\t } \\n\\t\\t\\t\\t\\t }\\t\\t\\t\\t\\t\\t \\n\\t\\t\\t } \\n\\t\\t\\t else\\n\\t\\t\\t {\\n\\t\\t\\t collided = false;\\t\\t\\t\\t\\t \\n\\t\\t\\t }\\n\\t\\t }\\n\\t }\\n\\t}\",\n \"private void setAtomsToUnPlaced(IMolecule molecule) {\\n\\t\\tfor (int i = 0; i < molecule.getAtomCount(); i++) {\\n\\t\\t\\tmolecule.getAtom(i).setFlag(CDKConstants.ISPLACED, false);\\n\\t\\t}\\n\\t}\",\n \"private static Set removeSet(Set elements) {\\n Set toWaitlist = new LinkedHashSet();\\n int i=0;\\n for (ARGState ae : elements) {\\n if(ae.getParents()!=null){\\n for (ARGState parent : ae.getParents()) {\\n if (!elements.contains(parent)) {\\n toWaitlist.add(parent);\\n }\\n }\\n if(ae.getChildren()!=null)\\n ae.removeFromARG();\\n else\\n ae.setDestroyed(true);\\n }\\n\\n // ae.setNull();\\n }\\n return toWaitlist;\\n }\",\n \"public void clearBalls();\",\n \"public ZYSet difference(ZYSet otherSet){\\n ZYSet result = new ZYArraySet();\\n for(ElementType e :this){\\n if(!otherSet.contains(e)){\\n result.add(e);\\n }\\n }\\n return result;\\n }\",\n \"Set remove();\",\n \"public void asteroidCol()\\n\\t{\\n\\t\\t//collision can only occur if at least 2 asteroids are spawned\\n\\t\\tif(gameObj[0].size() >=2)\\n\\t\\t{\\n\\t\\t\\tint ast = new Random().nextInt(gameObj[0].size());\\n\\t\\t\\tgameObj[0].remove(ast);\\n\\t\\t\\tast = new Random().nextInt(gameObj[0].size());\\n\\t\\t\\tgameObj[0].remove(ast);\\n\\t\\t\\tSystem.out.println(\\\"2 asteroids have collided and been removed from the world\\\");\\n\\t\\t}else\\n\\t\\t\\tSystem.out.println(\\\"2 asteroids are not spawned\\\");\\n\\t}\"\n]"},"negative_scores":{"kind":"list like","value":["0.7201494","0.7066727","0.6351003","0.6123763","0.5727197","0.5655017","0.5653279","0.55904317","0.55435395","0.5497836","0.53741","0.53493136","0.53155446","0.5310197","0.5291823","0.5273596","0.52574515","0.521238","0.52042514","0.5197962","0.51648426","0.51504564","0.5132098","0.50641453","0.5053148","0.504755","0.5047245","0.5047093","0.50465995","0.5033914","0.5033194","0.50325966","0.50060886","0.4974965","0.49642766","0.49493936","0.49434403","0.4939902","0.49199677","0.4918756","0.49181253","0.49058563","0.49057055","0.49005133","0.48860264","0.4879811","0.48762035","0.48721975","0.4870887","0.48702693","0.48628008","0.48558292","0.48525184","0.48410243","0.48381305","0.48275948","0.48260462","0.4810635","0.4806995","0.48054954","0.47995692","0.47993532","0.47992787","0.47975788","0.47941953","0.47886425","0.4787025","0.4781651","0.47793114","0.47739986","0.47678077","0.4767469","0.47663417","0.4765538","0.4764647","0.4763563","0.4760371","0.47482017","0.47441494","0.47387823","0.47368696","0.47338298","0.47273165","0.47246978","0.47227886","0.47226182","0.47195676","0.47177657","0.4715815","0.47148296","0.4710113","0.4709885","0.47095868","0.47047576","0.4703257","0.47027028","0.46997496","0.46889827","0.46862143","0.46856573"],"string":"[\n \"0.7201494\",\n \"0.7066727\",\n \"0.6351003\",\n \"0.6123763\",\n \"0.5727197\",\n \"0.5655017\",\n \"0.5653279\",\n \"0.55904317\",\n \"0.55435395\",\n \"0.5497836\",\n \"0.53741\",\n \"0.53493136\",\n \"0.53155446\",\n \"0.5310197\",\n \"0.5291823\",\n \"0.5273596\",\n \"0.52574515\",\n \"0.521238\",\n \"0.52042514\",\n \"0.5197962\",\n \"0.51648426\",\n \"0.51504564\",\n \"0.5132098\",\n \"0.50641453\",\n \"0.5053148\",\n \"0.504755\",\n \"0.5047245\",\n \"0.5047093\",\n \"0.50465995\",\n \"0.5033914\",\n \"0.5033194\",\n \"0.50325966\",\n \"0.50060886\",\n \"0.4974965\",\n \"0.49642766\",\n \"0.49493936\",\n \"0.49434403\",\n \"0.4939902\",\n \"0.49199677\",\n \"0.4918756\",\n \"0.49181253\",\n \"0.49058563\",\n \"0.49057055\",\n \"0.49005133\",\n \"0.48860264\",\n \"0.4879811\",\n \"0.48762035\",\n \"0.48721975\",\n \"0.4870887\",\n \"0.48702693\",\n \"0.48628008\",\n \"0.48558292\",\n \"0.48525184\",\n \"0.48410243\",\n \"0.48381305\",\n \"0.48275948\",\n \"0.48260462\",\n \"0.4810635\",\n \"0.4806995\",\n \"0.48054954\",\n \"0.47995692\",\n \"0.47993532\",\n \"0.47992787\",\n \"0.47975788\",\n \"0.47941953\",\n \"0.47886425\",\n \"0.4787025\",\n \"0.4781651\",\n \"0.47793114\",\n \"0.47739986\",\n \"0.47678077\",\n \"0.4767469\",\n \"0.47663417\",\n \"0.4765538\",\n \"0.4764647\",\n \"0.4763563\",\n \"0.4760371\",\n \"0.47482017\",\n \"0.47441494\",\n \"0.47387823\",\n \"0.47368696\",\n \"0.47338298\",\n \"0.47273165\",\n \"0.47246978\",\n \"0.47227886\",\n \"0.47226182\",\n \"0.47195676\",\n \"0.47177657\",\n \"0.4715815\",\n \"0.47148296\",\n \"0.4710113\",\n \"0.4709885\",\n \"0.47095868\",\n \"0.47047576\",\n \"0.4703257\",\n \"0.47027028\",\n \"0.46997496\",\n \"0.46889827\",\n \"0.46862143\",\n \"0.46856573\"\n]"},"document_score":{"kind":"string","value":"0.77290463"},"document_rank":{"kind":"string","value":"0"}}},{"rowIdx":136188,"cells":{"query":{"kind":"string","value":"Remove a given drone from the world object set"},"document":{"kind":"string","value":"private void removeDrone(Drone drone){\n\t\tthis.getDroneSet().remove(drone);\n\t}"},"metadata":{"kind":"string","value":"{\n \"objective\": {\n \"self\": [],\n \"paired\": [],\n \"triplet\": [\n [\n \"query\",\n \"document\",\n \"negatives\"\n ]\n ]\n }\n}"},"negatives":{"kind":"list like","value":["public void removeFromWorld(World world);","public void remove(){\n Api.worldRemover(getWorld().getWorldFolder());\n }","void remove(GeometricalObject object);","public void remove(GeometricalObject object);","public void removeByObject()\r\n\t{\n\t}","public void removeWorld(String name){\n worlds.remove(getWorld(name));\n }","void remover(Object o);","protected void removeLane()\n {\n if (lane == 1)\n {\n\n MyWorld.Lane1Monsters.remove(this);\n getWorld().removeObject(this);\n\n }\n\n else if (lane == 2)\n {\n MyWorld.Lane2Monsters.remove(this);\n getWorld().removeObject(this);\n\n }\n\n else if (lane == 3)\n {\n MyWorld.Lane3Monsters.remove(this);\n getWorld().removeObject(this);\n\n }\n\n else if (lane == 4)\n {\n MyWorld.Lane4Monsters.remove(this);\n getWorld().removeObject(this);\n\n }\n\n else if (lane == 5)\n {\n MyWorld.Lane5Monsters.remove(this);\n getWorld().removeObject(this);\n\n }\n MyWorld.monsterAdded();\n }","public abstract void removeTurtle(int turtleID);","public abstract void removeCreature(Point p);","public void removeObstacle(Coord obstacleCoord);","public void removeGlobalObject(String uniqueId) {\n\t\tfor (int index = 0; index < objects.size(); index++) {\n\t\t\tif (objects.get(index).doorUniqueId.equals(uniqueId)) {\n\t\t\t\tobjects.remove(index);\n\t\t\t\tindex--;\n\t\t\t}\n\t\t}\n\t}","boolean removeObject(Circle circle, String id);","Object remove();","void removeBall(Coordinates at);","public void Remove(Floor obj) {\n floorList.remove(obj);\n }","private void eliminatePlayer(Player loser){\n players.remove(loser);\n }","void removeRobot(Position pos);","public boolean remove(RealObject o);","public void remove(RWDCar car) {\n game.removePlayer(car);\n }","public void enemyoff(){\n getWorld().removeObject(this);\n }","Object removeFirst();","public void removeAIObject(String id) {\n aiObjects.remove(id);\n }","public void removeGameObj(GameObject obj){\n display.getChildren().remove(obj.getDisplay());\n }","void removeRoadside(int i);","public Object remove();","public void remove();","public void remove();","public void remove();","public void remove();","public void remove();","void removeFullHadith(Object oldFullHadith);","boolean removeObject(PointLatLng point, String id);","boolean removeObject(String id);","public void die()\n {\n World world;\n world=getWorld();\n world.removeObject(this);\n }","public synchronized void removeTheWarrior(){\n charactersOccupiedTheLocation[0]=null;\n notifyAll();\n }","public void remove(GameObject object) {\n\t\tgameObjects.remove(object);\t\n\t}","public void removePlayer(Person user) {\r\n\t\trooms[user.getY()][user.getX()].removeOccupant(user);\r\n\t}","public void removeFromPlanet() {\n this.currentPlanet = null;\n }","void removeSameAs(Object oldSameAs);","public void removeAgent(Agent a)\n/* 81: */ {\n/* 82:132 */ this.mapPanel.removeAgent(a);\n/* 83: */ }","public void removeObject(java.lang.Object object) {}","public void removePerson(Person object)\n\t{\n\t\tthis.peopleList.remove(object);\n\t}","public void removePerson(Person p);","public void remove () {}","public boolean remove(New object);","void removeRegion(Region region);","public void remove() {\n\n\t\t\tsuprimirNodo(anterior);\n\n\t\t}","public void removeObject(String id) {\n\taddCollisionObject(CollisionObjectWrapper.removeObject(id));\n }","public boolean remove(objectType obj);","void removeHasLatitude(Object oldHasLatitude);","void removeRocket(RocketDTO rocket);","void remove();","void remove();","void remove();","void remove();","void remove();","public void maybeRemove(RemoveRandom r, ObjectContainer container, ClientContext context);","int removeHabit(Habit habit);","public void remove(World var1, int var2, int var3, int var4)\n {\n Utils.preDestroyBlock(var1, var2, var3, var4);\n super.remove(var1, var2, var3, var4);\n }","public void method_1896(@NotNull EntityOtherPlayerMP var1) {\n if (Minecraft.getMinecraft().world != null) {\n Minecraft.getMinecraft().world.removeEntityFromWorld(var1.getEntityId());\n }\n\n field_1241.remove(var1);\n field_1242.remove(var1);\n }","public void removeActor(int index) { ActorSet.removeElementAt(index); }","public void removeTile(){\n\t\toccupied = false;\n\t\tcurrentTile = null;\n\t}","public void removeVehicle() {\n\t\tmVehicles.removeFirst();\n\t}","public void eliminar(DetalleArmado detallearmado);","public void remove(PraiseDiary diary) {\n\t\tdao.remove(diary);\n\t}","public void removeAgent(String layer, Agent a)\n/* 175: */ {\n/* 176:247 */ this.mapPanel.removeAgent(layer, a);\n/* 177: */ }","public void removeTile(Tile tile) {\n ownedTiles.remove(tile);\n }","private void removeStudy(int studyID) {\n\t}","boolean removeObject(RectangleLatLng rectangle, String id);","public void removeUnit(){\r\n tacUnit = null;\r\n }","public void remove()\n {\n this.morphs.remove(this.index);\n this.clamp();\n }","private void remove(String d){\r\n\t\tfor (int i = 0; i < vehicleList.size(); i++) {\r\n\t\t\tif (d == vehicleList.get(i).getModelName()) {\r\n\t\t\t\tvehicleList.remove(i);\r\n\t\t\t\r\n\t\t\t}\r\n\t\t}\r\n\t}","public void checkForRemoval()\n {\n if (life <= 0)\n {\n SideScrollingWorld world = (SideScrollingWorld) getWorld(); \n \n world.isPacmanDead = true;\n getWorld().removeObject(this);\n }\n }","boolean removeObject(int ID) throws DatabaseNotAccessibleException;","public void removeFightsystem( Fightsystem fightsystem )\r\n {\n\r\n }","public void remove(Element e) {\n\t\tlistLiving.remove(e);\n\t\tmapContains.put(e.getPosition(), null);\n\t}","public boolean remove(Object obj);","public void removeTownFromWorldMap(String town) {\n map.get(town).forEach((direction, townInDirection) -> {\n map.get(townInDirection).remove(directionsInverter.get(direction));\n });\n map.remove(town);\n }","public static void removeTower(Tower t)\n\t{\n\t\ttowers.remove(t);\n\t}","public void remove(DBObject dbObjectQuery);","void remover(Long id);","void remover(Long id);","public boolean removeElement(Object obj);","void unsetRoadTerrain();","public void remove() {\n super.remove();\n if (this.caughtEntity != null) {\n this.caughtEntity.noClip = false;\n }\n if (this.angler != null) {\n this.angler.fishingBobber = null;\n this.angler.noClip = false;\n }\n if(this.rod.getItem() == Items.ITEM_GRAB_HOOK){\n this.rod.getOrCreateTag().putBoolean(\"cast\", false);\n }\n }","public void remove(World var1, int var2, int var3, int var4)\r\n {\r\n int var5 = var1.getData(var2, var3, var4);\r\n\r\n if (var5 > 0)\r\n {\r\n var1.applyPhysics(var2, var3, var4, this.id);\r\n var1.applyPhysics(var2, var3 - 1, var4, this.id);\r\n }\r\n\r\n TileEntityMTPPlate var6 = (TileEntityMTPPlate)var1.getTileEntity(var2, var3, var4);\r\n\r\n if (var6 != null)\r\n {\r\n byte var7 = -1;\r\n\r\n switch (var6.getMetaValue())\r\n {\r\n case 0:\r\n var7 = 0;\r\n break;\r\n\r\n case 1:\r\n var7 = 1;\r\n break;\r\n\r\n case 2:\r\n var7 = 2;\r\n }\r\n\r\n if (var7 > -1)\r\n {\r\n ItemStack var8 = new ItemStack(MTPCore.mtPPlate, 1, var7);\r\n EntityItem var9 = new EntityItem(var1, (double)((float)var2), (double)((float)var3), (double)((float)var4), new ItemStack(var8.id, 1, var8.getData()));\r\n var1.addEntity(var9);\r\n }\r\n }\r\n }","void removeRide(String name, String park);","public void remove() {\r\n\tif (kingdom != null && currentEffect != null)\r\n\t currentEffect.removeFrom(kingdom);\r\n\tcurrentEffect = null;\r\n }","@Override\n\tpublic void removeInUse() {\n\t\theldObj.removeInUse();\n\t}","private void removeAt(Coord c) {\n\t\tElement e = getAt(c);\n\t\tif(e != null) {\n\t\t\tlistLiving.remove(e);\n\t\t}\n\t\tmapContains.put(c, null);\n\t}","public void removeObjectOnlyFromCanvas(int ID) {\n super.removeObject(ID);\n }","public void removeDinosaur(Dinosaur remDino) {\r\n\t\tint i;\r\n\t\tfor ( i = 0; i < this.aDinosaurs.size(); i++) {\r\n\t\t\tif (this.aDinosaurs.get(i).getDinoName().equals(remDino.getDinoName()) ) {\r\n\t\t\t\tthis.aDinosaurs.remove(i);\r\n\t\t\t}\r\n\t\t}\r\n\t}","private void removeSquadron(final Nation nation) {\n log.debug(\"Remove {}\", selectedAirfieldSquadron);\n\n if (selectedAirfieldSquadron.get(nation) != null) {\n Squadron squadron = selectedAirfieldSquadron.get(nation);\n view.clearSquadronRange(nation);\n airfieldViewModelMap.get(nation).remove(squadron);\n regionViewModelMap.get(nation).refresh();\n view.getAirfieldSquadrons().get(nation).getSelectionModel().selectFirst();\n }\n }","public abstract void remove(Class entity, Object paramObject);","void removeMember(final PartyMember member);","public void gerak() \n {\n setLocation(getX(),getY()-5);\n if(getY()<20){\n getWorld().removeObject(this);\n }else\n cek_kena();\n \n }","public void removeAnimal(Entity e){\r\n\t\tSet farmers = plugin.getAnimalData().getConfigurationSection(\"Farmer\").getKeys(false);\r\n\t\tfor(String farmer : farmers){\r\n\t\t\tSet farmeranimals = plugin.getAnimalData().getConfigurationSection(\"Farmer.\" + farmer + \".Animals\").getKeys(false);\r\n\t\t\t\r\n\t\t\tfor(String farmanimal : farmeranimals){\r\n\t\t\t\tif(farmanimal.equalsIgnoreCase(e.getUniqueId().toString())){\r\n\t\t\t\t\tLivingEntity le = (LivingEntity) e;\r\n\t\t\t\t\tplugin.getAnimalData().set(\"Farmer.\" + farmer +\".Animals.\"+ farmanimal, null);\r\n\t\t\t\t\tPlayer[] p = Bukkit.getOnlinePlayers();\r\n\t\t\t\t\tfor(Player online : p){\r\n\t\t\t\t\tif(online.getUniqueId().toString().equalsIgnoreCase(farmer)){\r\n\t\t\t\t\tonline.sendMessage(ChatColor.GRAY + \"Your \" + e.getType().toString() + \" \" + le.getCustomName() + \" has \" + ChatColor.DARK_RED + \"died.\");\r\n\t\t\t\t\t}\r\n\t\t\t\t\t}\r\n\t\t\t\t\tif(plugin.getAnimalData().contains(\"AnimalCoolDown.\" + farmanimal)){\r\n\t\t\t\t\t\tplugin.getAnimalData().set(\"AnimalCoolDown.\" + farmanimal, null );\r\n\t\t\t\t\t}\r\n\t\t\t\t\tplugin.saveAnimalData();\r\n\t\t\t\t\t}\r\n\t\t\t\t}\r\n\t\t\t}\r\n\t\t}","public void removeSword() {\n \tthis.sword =null;\n \tthis.UIsword().set(false);\n \tdungeon.swordLeft().set(\"Sword Hits Left: 0\\n\");\n }","public void remove(GObject object);"],"string":"[\n \"public void removeFromWorld(World world);\",\n \"public void remove(){\\n Api.worldRemover(getWorld().getWorldFolder());\\n }\",\n \"void remove(GeometricalObject object);\",\n \"public void remove(GeometricalObject object);\",\n \"public void removeByObject()\\r\\n\\t{\\n\\t}\",\n \"public void removeWorld(String name){\\n worlds.remove(getWorld(name));\\n }\",\n \"void remover(Object o);\",\n \"protected void removeLane()\\n {\\n if (lane == 1)\\n {\\n\\n MyWorld.Lane1Monsters.remove(this);\\n getWorld().removeObject(this);\\n\\n }\\n\\n else if (lane == 2)\\n {\\n MyWorld.Lane2Monsters.remove(this);\\n getWorld().removeObject(this);\\n\\n }\\n\\n else if (lane == 3)\\n {\\n MyWorld.Lane3Monsters.remove(this);\\n getWorld().removeObject(this);\\n\\n }\\n\\n else if (lane == 4)\\n {\\n MyWorld.Lane4Monsters.remove(this);\\n getWorld().removeObject(this);\\n\\n }\\n\\n else if (lane == 5)\\n {\\n MyWorld.Lane5Monsters.remove(this);\\n getWorld().removeObject(this);\\n\\n }\\n MyWorld.monsterAdded();\\n }\",\n \"public abstract void removeTurtle(int turtleID);\",\n \"public abstract void removeCreature(Point p);\",\n \"public void removeObstacle(Coord obstacleCoord);\",\n \"public void removeGlobalObject(String uniqueId) {\\n\\t\\tfor (int index = 0; index < objects.size(); index++) {\\n\\t\\t\\tif (objects.get(index).doorUniqueId.equals(uniqueId)) {\\n\\t\\t\\t\\tobjects.remove(index);\\n\\t\\t\\t\\tindex--;\\n\\t\\t\\t}\\n\\t\\t}\\n\\t}\",\n \"boolean removeObject(Circle circle, String id);\",\n \"Object remove();\",\n \"void removeBall(Coordinates at);\",\n \"public void Remove(Floor obj) {\\n floorList.remove(obj);\\n }\",\n \"private void eliminatePlayer(Player loser){\\n players.remove(loser);\\n }\",\n \"void removeRobot(Position pos);\",\n \"public boolean remove(RealObject o);\",\n \"public void remove(RWDCar car) {\\n game.removePlayer(car);\\n }\",\n \"public void enemyoff(){\\n getWorld().removeObject(this);\\n }\",\n \"Object removeFirst();\",\n \"public void removeAIObject(String id) {\\n aiObjects.remove(id);\\n }\",\n \"public void removeGameObj(GameObject obj){\\n display.getChildren().remove(obj.getDisplay());\\n }\",\n \"void removeRoadside(int i);\",\n \"public Object remove();\",\n \"public void remove();\",\n \"public void remove();\",\n \"public void remove();\",\n \"public void remove();\",\n \"public void remove();\",\n \"void removeFullHadith(Object oldFullHadith);\",\n \"boolean removeObject(PointLatLng point, String id);\",\n \"boolean removeObject(String id);\",\n \"public void die()\\n {\\n World world;\\n world=getWorld();\\n world.removeObject(this);\\n }\",\n \"public synchronized void removeTheWarrior(){\\n charactersOccupiedTheLocation[0]=null;\\n notifyAll();\\n }\",\n \"public void remove(GameObject object) {\\n\\t\\tgameObjects.remove(object);\\t\\n\\t}\",\n \"public void removePlayer(Person user) {\\r\\n\\t\\trooms[user.getY()][user.getX()].removeOccupant(user);\\r\\n\\t}\",\n \"public void removeFromPlanet() {\\n this.currentPlanet = null;\\n }\",\n \"void removeSameAs(Object oldSameAs);\",\n \"public void removeAgent(Agent a)\\n/* 81: */ {\\n/* 82:132 */ this.mapPanel.removeAgent(a);\\n/* 83: */ }\",\n \"public void removeObject(java.lang.Object object) {}\",\n \"public void removePerson(Person object)\\n\\t{\\n\\t\\tthis.peopleList.remove(object);\\n\\t}\",\n \"public void removePerson(Person p);\",\n \"public void remove () {}\",\n \"public boolean remove(New object);\",\n \"void removeRegion(Region region);\",\n \"public void remove() {\\n\\n\\t\\t\\tsuprimirNodo(anterior);\\n\\n\\t\\t}\",\n \"public void removeObject(String id) {\\n\\taddCollisionObject(CollisionObjectWrapper.removeObject(id));\\n }\",\n \"public boolean remove(objectType obj);\",\n \"void removeHasLatitude(Object oldHasLatitude);\",\n \"void removeRocket(RocketDTO rocket);\",\n \"void remove();\",\n \"void remove();\",\n \"void remove();\",\n \"void remove();\",\n \"void remove();\",\n \"public void maybeRemove(RemoveRandom r, ObjectContainer container, ClientContext context);\",\n \"int removeHabit(Habit habit);\",\n \"public void remove(World var1, int var2, int var3, int var4)\\n {\\n Utils.preDestroyBlock(var1, var2, var3, var4);\\n super.remove(var1, var2, var3, var4);\\n }\",\n \"public void method_1896(@NotNull EntityOtherPlayerMP var1) {\\n if (Minecraft.getMinecraft().world != null) {\\n Minecraft.getMinecraft().world.removeEntityFromWorld(var1.getEntityId());\\n }\\n\\n field_1241.remove(var1);\\n field_1242.remove(var1);\\n }\",\n \"public void removeActor(int index) { ActorSet.removeElementAt(index); }\",\n \"public void removeTile(){\\n\\t\\toccupied = false;\\n\\t\\tcurrentTile = null;\\n\\t}\",\n \"public void removeVehicle() {\\n\\t\\tmVehicles.removeFirst();\\n\\t}\",\n \"public void eliminar(DetalleArmado detallearmado);\",\n \"public void remove(PraiseDiary diary) {\\n\\t\\tdao.remove(diary);\\n\\t}\",\n \"public void removeAgent(String layer, Agent a)\\n/* 175: */ {\\n/* 176:247 */ this.mapPanel.removeAgent(layer, a);\\n/* 177: */ }\",\n \"public void removeTile(Tile tile) {\\n ownedTiles.remove(tile);\\n }\",\n \"private void removeStudy(int studyID) {\\n\\t}\",\n \"boolean removeObject(RectangleLatLng rectangle, String id);\",\n \"public void removeUnit(){\\r\\n tacUnit = null;\\r\\n }\",\n \"public void remove()\\n {\\n this.morphs.remove(this.index);\\n this.clamp();\\n }\",\n \"private void remove(String d){\\r\\n\\t\\tfor (int i = 0; i < vehicleList.size(); i++) {\\r\\n\\t\\t\\tif (d == vehicleList.get(i).getModelName()) {\\r\\n\\t\\t\\t\\tvehicleList.remove(i);\\r\\n\\t\\t\\t\\r\\n\\t\\t\\t}\\r\\n\\t\\t}\\r\\n\\t}\",\n \"public void checkForRemoval()\\n {\\n if (life <= 0)\\n {\\n SideScrollingWorld world = (SideScrollingWorld) getWorld(); \\n \\n world.isPacmanDead = true;\\n getWorld().removeObject(this);\\n }\\n }\",\n \"boolean removeObject(int ID) throws DatabaseNotAccessibleException;\",\n \"public void removeFightsystem( Fightsystem fightsystem )\\r\\n {\\n\\r\\n }\",\n \"public void remove(Element e) {\\n\\t\\tlistLiving.remove(e);\\n\\t\\tmapContains.put(e.getPosition(), null);\\n\\t}\",\n \"public boolean remove(Object obj);\",\n \"public void removeTownFromWorldMap(String town) {\\n map.get(town).forEach((direction, townInDirection) -> {\\n map.get(townInDirection).remove(directionsInverter.get(direction));\\n });\\n map.remove(town);\\n }\",\n \"public static void removeTower(Tower t)\\n\\t{\\n\\t\\ttowers.remove(t);\\n\\t}\",\n \"public void remove(DBObject dbObjectQuery);\",\n \"void remover(Long id);\",\n \"void remover(Long id);\",\n \"public boolean removeElement(Object obj);\",\n \"void unsetRoadTerrain();\",\n \"public void remove() {\\n super.remove();\\n if (this.caughtEntity != null) {\\n this.caughtEntity.noClip = false;\\n }\\n if (this.angler != null) {\\n this.angler.fishingBobber = null;\\n this.angler.noClip = false;\\n }\\n if(this.rod.getItem() == Items.ITEM_GRAB_HOOK){\\n this.rod.getOrCreateTag().putBoolean(\\\"cast\\\", false);\\n }\\n }\",\n \"public void remove(World var1, int var2, int var3, int var4)\\r\\n {\\r\\n int var5 = var1.getData(var2, var3, var4);\\r\\n\\r\\n if (var5 > 0)\\r\\n {\\r\\n var1.applyPhysics(var2, var3, var4, this.id);\\r\\n var1.applyPhysics(var2, var3 - 1, var4, this.id);\\r\\n }\\r\\n\\r\\n TileEntityMTPPlate var6 = (TileEntityMTPPlate)var1.getTileEntity(var2, var3, var4);\\r\\n\\r\\n if (var6 != null)\\r\\n {\\r\\n byte var7 = -1;\\r\\n\\r\\n switch (var6.getMetaValue())\\r\\n {\\r\\n case 0:\\r\\n var7 = 0;\\r\\n break;\\r\\n\\r\\n case 1:\\r\\n var7 = 1;\\r\\n break;\\r\\n\\r\\n case 2:\\r\\n var7 = 2;\\r\\n }\\r\\n\\r\\n if (var7 > -1)\\r\\n {\\r\\n ItemStack var8 = new ItemStack(MTPCore.mtPPlate, 1, var7);\\r\\n EntityItem var9 = new EntityItem(var1, (double)((float)var2), (double)((float)var3), (double)((float)var4), new ItemStack(var8.id, 1, var8.getData()));\\r\\n var1.addEntity(var9);\\r\\n }\\r\\n }\\r\\n }\",\n \"void removeRide(String name, String park);\",\n \"public void remove() {\\r\\n\\tif (kingdom != null && currentEffect != null)\\r\\n\\t currentEffect.removeFrom(kingdom);\\r\\n\\tcurrentEffect = null;\\r\\n }\",\n \"@Override\\n\\tpublic void removeInUse() {\\n\\t\\theldObj.removeInUse();\\n\\t}\",\n \"private void removeAt(Coord c) {\\n\\t\\tElement e = getAt(c);\\n\\t\\tif(e != null) {\\n\\t\\t\\tlistLiving.remove(e);\\n\\t\\t}\\n\\t\\tmapContains.put(c, null);\\n\\t}\",\n \"public void removeObjectOnlyFromCanvas(int ID) {\\n super.removeObject(ID);\\n }\",\n \"public void removeDinosaur(Dinosaur remDino) {\\r\\n\\t\\tint i;\\r\\n\\t\\tfor ( i = 0; i < this.aDinosaurs.size(); i++) {\\r\\n\\t\\t\\tif (this.aDinosaurs.get(i).getDinoName().equals(remDino.getDinoName()) ) {\\r\\n\\t\\t\\t\\tthis.aDinosaurs.remove(i);\\r\\n\\t\\t\\t}\\r\\n\\t\\t}\\r\\n\\t}\",\n \"private void removeSquadron(final Nation nation) {\\n log.debug(\\\"Remove {}\\\", selectedAirfieldSquadron);\\n\\n if (selectedAirfieldSquadron.get(nation) != null) {\\n Squadron squadron = selectedAirfieldSquadron.get(nation);\\n view.clearSquadronRange(nation);\\n airfieldViewModelMap.get(nation).remove(squadron);\\n regionViewModelMap.get(nation).refresh();\\n view.getAirfieldSquadrons().get(nation).getSelectionModel().selectFirst();\\n }\\n }\",\n \"public abstract void remove(Class entity, Object paramObject);\",\n \"void removeMember(final PartyMember member);\",\n \"public void gerak() \\n {\\n setLocation(getX(),getY()-5);\\n if(getY()<20){\\n getWorld().removeObject(this);\\n }else\\n cek_kena();\\n \\n }\",\n \"public void removeAnimal(Entity e){\\r\\n\\t\\tSet farmers = plugin.getAnimalData().getConfigurationSection(\\\"Farmer\\\").getKeys(false);\\r\\n\\t\\tfor(String farmer : farmers){\\r\\n\\t\\t\\tSet farmeranimals = plugin.getAnimalData().getConfigurationSection(\\\"Farmer.\\\" + farmer + \\\".Animals\\\").getKeys(false);\\r\\n\\t\\t\\t\\r\\n\\t\\t\\tfor(String farmanimal : farmeranimals){\\r\\n\\t\\t\\t\\tif(farmanimal.equalsIgnoreCase(e.getUniqueId().toString())){\\r\\n\\t\\t\\t\\t\\tLivingEntity le = (LivingEntity) e;\\r\\n\\t\\t\\t\\t\\tplugin.getAnimalData().set(\\\"Farmer.\\\" + farmer +\\\".Animals.\\\"+ farmanimal, null);\\r\\n\\t\\t\\t\\t\\tPlayer[] p = Bukkit.getOnlinePlayers();\\r\\n\\t\\t\\t\\t\\tfor(Player online : p){\\r\\n\\t\\t\\t\\t\\tif(online.getUniqueId().toString().equalsIgnoreCase(farmer)){\\r\\n\\t\\t\\t\\t\\tonline.sendMessage(ChatColor.GRAY + \\\"Your \\\" + e.getType().toString() + \\\" \\\" + le.getCustomName() + \\\" has \\\" + ChatColor.DARK_RED + \\\"died.\\\");\\r\\n\\t\\t\\t\\t\\t}\\r\\n\\t\\t\\t\\t\\t}\\r\\n\\t\\t\\t\\t\\tif(plugin.getAnimalData().contains(\\\"AnimalCoolDown.\\\" + farmanimal)){\\r\\n\\t\\t\\t\\t\\t\\tplugin.getAnimalData().set(\\\"AnimalCoolDown.\\\" + farmanimal, null );\\r\\n\\t\\t\\t\\t\\t}\\r\\n\\t\\t\\t\\t\\tplugin.saveAnimalData();\\r\\n\\t\\t\\t\\t\\t}\\r\\n\\t\\t\\t\\t}\\r\\n\\t\\t\\t}\\r\\n\\t\\t}\",\n \"public void removeSword() {\\n \\tthis.sword =null;\\n \\tthis.UIsword().set(false);\\n \\tdungeon.swordLeft().set(\\\"Sword Hits Left: 0\\\\n\\\");\\n }\",\n \"public void remove(GObject object);\"\n]"},"negative_scores":{"kind":"list like","value":["0.73667926","0.7136338","0.6736631","0.67249596","0.65017205","0.64143443","0.62439233","0.61957824","0.6182204","0.61703944","0.6170011","0.6159048","0.61285186","0.61025953","0.6067281","0.6040079","0.6015921","0.60109925","0.60035396","0.5986597","0.5984361","0.5980068","0.59500587","0.5947773","0.59459025","0.59362227","0.59289086","0.59289086","0.59289086","0.59289086","0.59289086","0.5925981","0.5915817","0.59032595","0.5893134","0.5866515","0.58520406","0.5846574","0.584038","0.5826747","0.5811025","0.57985187","0.5782839","0.5766438","0.575989","0.57574","0.5746228","0.57454354","0.5745272","0.57330066","0.5731952","0.5728817","0.57284933","0.57284933","0.57284933","0.57284933","0.57284933","0.5727436","0.5721306","0.5719342","0.5718058","0.5715171","0.57142264","0.5714002","0.57139766","0.5695207","0.5678715","0.56746817","0.56669664","0.56661296","0.5657471","0.5653563","0.5647546","0.56431246","0.5641962","0.5639335","0.5638365","0.5630417","0.5627738","0.5624072","0.5615453","0.5611667","0.5611667","0.5609308","0.5606792","0.5603595","0.55948174","0.559355","0.5591475","0.5590832","0.55860484","0.5585947","0.5581019","0.55803174","0.5580118","0.55793136","0.55771035","0.55742824","0.55736375","0.5570906"],"string":"[\n \"0.73667926\",\n \"0.7136338\",\n \"0.6736631\",\n \"0.67249596\",\n \"0.65017205\",\n \"0.64143443\",\n \"0.62439233\",\n \"0.61957824\",\n \"0.6182204\",\n \"0.61703944\",\n \"0.6170011\",\n \"0.6159048\",\n \"0.61285186\",\n \"0.61025953\",\n \"0.6067281\",\n \"0.6040079\",\n \"0.6015921\",\n \"0.60109925\",\n \"0.60035396\",\n \"0.5986597\",\n \"0.5984361\",\n \"0.5980068\",\n \"0.59500587\",\n \"0.5947773\",\n \"0.59459025\",\n \"0.59362227\",\n \"0.59289086\",\n \"0.59289086\",\n \"0.59289086\",\n \"0.59289086\",\n \"0.59289086\",\n \"0.5925981\",\n \"0.5915817\",\n \"0.59032595\",\n \"0.5893134\",\n \"0.5866515\",\n \"0.58520406\",\n \"0.5846574\",\n \"0.584038\",\n \"0.5826747\",\n \"0.5811025\",\n \"0.57985187\",\n \"0.5782839\",\n \"0.5766438\",\n \"0.575989\",\n \"0.57574\",\n \"0.5746228\",\n \"0.57454354\",\n \"0.5745272\",\n \"0.57330066\",\n \"0.5731952\",\n \"0.5728817\",\n \"0.57284933\",\n \"0.57284933\",\n \"0.57284933\",\n \"0.57284933\",\n \"0.57284933\",\n \"0.5727436\",\n \"0.5721306\",\n \"0.5719342\",\n \"0.5718058\",\n \"0.5715171\",\n \"0.57142264\",\n \"0.5714002\",\n \"0.57139766\",\n \"0.5695207\",\n \"0.5678715\",\n \"0.56746817\",\n \"0.56669664\",\n \"0.56661296\",\n \"0.5657471\",\n \"0.5653563\",\n \"0.5647546\",\n \"0.56431246\",\n \"0.5641962\",\n \"0.5639335\",\n \"0.5638365\",\n \"0.5630417\",\n \"0.5627738\",\n \"0.5624072\",\n \"0.5615453\",\n \"0.5611667\",\n \"0.5611667\",\n \"0.5609308\",\n \"0.5606792\",\n \"0.5603595\",\n \"0.55948174\",\n \"0.559355\",\n \"0.5591475\",\n \"0.5590832\",\n \"0.55860484\",\n \"0.5585947\",\n \"0.5581019\",\n \"0.55803174\",\n \"0.5580118\",\n \"0.55793136\",\n \"0.55771035\",\n \"0.55742824\",\n \"0.55736375\",\n \"0.5570906\"\n]"},"document_score":{"kind":"string","value":"0.77663654"},"document_rank":{"kind":"string","value":"0"}}},{"rowIdx":136189,"cells":{"query":{"kind":"string","value":"Checks if all the packages are delivered"},"document":{"kind":"string","value":"private boolean allPackagesDelivered(){\n\t\tPackageService service = this.getPackageService();\n\t\tSet packages = service.getAllUndeliveredWorldDeliveries();\n\t\tfor(WorldDelivery delivery : packages){\n\t\t\tif(!delivery.isDelivered()){\n\t\t\t\treturn false;\n\t\t\t}\n\t\t}\n\n\t\t//TODO uncomment if packages are implemented\n\t\treturn false;\n\t}"},"metadata":{"kind":"string","value":"{\n \"objective\": {\n \"self\": [],\n \"paired\": [],\n \"triplet\": [\n [\n \"query\",\n \"document\",\n \"negatives\"\n ]\n ]\n }\n}"},"negatives":{"kind":"list like","value":["public abstract boolean isDelivered();","boolean isUseAllLatestPacks();","@Override\n\tpublic boolean isDeliverable() {\n\t\treturn true;\n\t}","public boolean isMixPackagesPresent()\n\t{\n\t\ttry\n\t\t{\n\t\t\tArrayList versions = new ArrayList();\n\t\t\t\n\t\t\tif(PackageInformation.getInstance().collectPkgInfoFromUPM())\n\t\t\t{\n\t\t\t\tVector firmwareInfo = PackageInformation.getInstance().getAppVersionsFromSpot();\n\t\t\t\tif(firmwareInfo != null && !firmwareInfo.isEmpty())\n\t\t\t\t{\n\t\t\t\t\tversions.clear();\n\t\t\t\t\tint buildVersion = getBuildVersion(firmwareInfo);\n\t\t\t\t\t\n\t\t\t\t\tif(buildVersion != 0)\n\t\t\t\t\t{\n\t\t\t\t\t\tif(buildVersion == Version.DELTA_F.getVersion())\n\t\t\t\t\t\t{\n\t\t\t\t\t\t\tversions.add(Version.DELTA_C.getVersion());\n\t\t\t\t\t\t\treturn isOtherPackages(versions, firmwareInfo);\n\t\t\t\t\t\t}\n\t\t\t\t\t\telse if(buildVersion == Version.DELTA_E.getVersion())\n\t\t\t\t\t\t{\n\t\t\t\t\t\t\tversions.add(Version.DELTA_C.getVersion());\n\t\t\t\t\t\t\treturn isOtherPackages(versions, firmwareInfo);\n\t\t\t\t\t\t}\n\t\t\t\t\t\telse if(buildVersion == Version.DELTA_C.getVersion())\n\t\t\t\t\t\t{\n\t\t\t\t\t\t\tversions.add(Version.DELTA_F.getVersion());\n\t\t\t\t\t\t\tversions.add(Version.DELTA_E.getVersion());\n\t\t\t\t\t\t\treturn isOtherPackages(versions, firmwareInfo);\n\t\t\t\t\t\t}\n\t\t\t\t\t}\n\t\t\t\t}\n\t\t\t}\n\t\t\telse\n\t\t\t{\n\t\t\t\tlogger.error(\"Failed to collect package information\");\n\t\t\t}\n\t\t}\n\t\tcatch(InterruptedException e)\n\t\t{\n\t\t\tlogger.error(e.getMessage());\n\t\t}\n\t\treturn false;\n\t}","private boolean canDeliverPackage(Drone drone){\n\t\t//check first if drone has the required velocity, if not skip the rest of the calc\n\t\tVector droneVelocity = drone.getVelocity();\n\n\t\tif(droneVelocity.getSize() > MAX_LANDING_VELOCITY){\n\t\t\treturn false;\n\t\t}\n\t\t//check if the drone is currently at the airport where the package needs to be delivered\n\t\tWorldDelivery delivery = drone.getDeliveryPackage();\n\t\t//first get the package\n\t\tint destinationAirportID = delivery.getDestinationAirport();\n//\t\tint destinationGateNumber = delivery.getDestinationAirportGate();\n\t\t//get the position of the gate\n\t\tMap airports = this.getAirportMap();\n\t\tWorldAirport airport = airports.get(destinationAirportID);\n\t\treturn airport.isAtGateZone(drone.getPosition());\n//\t\tVector dronePos = drone.getPosition();\n//\t\tfloat distanceToGate = airport.distanceToGate(destinationGateNumber, dronePos);\n//\t\treturn distanceToGate <= MAX_TRANSFER_DISTANCE;\n\t}","boolean hasPakringFree();","boolean hasPakringFree();","public boolean maybeAllSent() {\n\t\tif(blockSendsPending == 0 && _unsent.size() == 0 && getNumSent() == _prb._packets) {\n\t\t\ttimeAllSent = System.currentTimeMillis();\n\t\t\tif(logMINOR)\n\t\t\t\tLogger.minor(this, \"Sent all blocks, none unsent on \"+this);\n\t\t\t_senderThread.notifyAll();\n\t\t\treturn true;\n\t\t}\n\t\tif(blockSendsPending == 0 && _failed) {\n\t\t\ttimeAllSent = System.currentTimeMillis();\n\t\t\tif(logMINOR)\n\t\t\t\tLogger.minor(this, \"Sent blocks and failed on \"+this);\n\t\t\treturn true;\n\t\t}\n\t\tif(logMINOR) Logger.minor(this, \"maybeAllSent: block sends pending = \"+blockSendsPending+\" unsent = \"+_unsent.size()+\" sent = \"+getNumSent()+\" on \"+this);\n\t\treturn false;\n\t}","private boolean finish(boolean releaseAll) {\n/* 485 */ close();\n/* */ try {\n/* 487 */ checkException();\n/* 488 */ return (isNotEmpty(this.inboundMessages) || isNotEmpty(this.outboundMessages));\n/* */ } finally {\n/* 490 */ if (releaseAll) {\n/* 491 */ releaseAll(this.inboundMessages);\n/* 492 */ releaseAll(this.outboundMessages);\n/* */ } \n/* */ } \n/* */ }","@java.lang.Override\n public boolean hasDeliver() {\n return stepInfoCase_ == 12;\n }","@Override\n public boolean hasMessageAvailable() {\n return !priorityQueue.isEmpty() && priorityQueue.peekN1() <= clock.millis();\n }","@java.lang.Override\n public boolean hasDeliver() {\n return stepInfoCase_ == 12;\n }","boolean hasReceived();","public boolean isDelivered() {\n return !getMode().isCollection() && !isCarried();\n }","boolean hasUnReceived();","private boolean checkBrokers ()\n {\n if (game.getAgentMap().size() < 1) {\n log.info(String.format(\"Game: %s (round %s) reports no brokers \"\n + \"registered\",\n game.getGameId(), game.getRound().getRoundId()));\n return false;\n }\n\n for (Agent agent: game.getAgentMap().values()) {\n Broker broker = agent.getBroker();\n // Check if any broker is disabled in the interface\n if (!MemStore.getBrokerState(broker.getBrokerId())) {\n log.info(String.format(\"Not starting game %s : broker %s is disabled\",\n game.getGameId(), broker.getBrokerId()));\n return false;\n }\n\n // Check if any broker is already running the maxAgent nof agents\n if (!broker.hasAgentsAvailable(game.getRound())) {\n log.info(String.format(\"Not starting game %s : broker %s doesn't have \"\n + \"enough available agents\",\n game.getGameId(), broker.getBrokerId()));\n return false;\n }\n\n brokers += broker.getBrokerName() + \"/\" + agent.getBrokerQueue() + \",\";\n }\n brokers = brokers.substring(0, brokers.length() - 1);\n return true;\n }","boolean hasPackageName();","public boolean isSettled()\n {\n synchronized (_amqpConnection)\n {\n return _delivery.isSettled() || ((_delivery instanceof DeliveryImpl && ((DeliveryImpl)_delivery).remotelySettled()));\n }\n }","private boolean isAllTestsRun() {\n Collection pkgs = getTestPackages();\n for (TestPackage pkg : pkgs) {\n if (!pkg.isAllTestsRun()) {\n return false;\n }\n }\n return true;\n }","public default boolean needsReagents()\r\n\t{\r\n\t\tfor(ItemStack stack : getReagents()) if(!stack.isEmpty()) return true;\r\n\t\treturn true;\r\n\t}","public boolean isAllBurntUp() {\n return (flammableItemCount == itemsOnFire);\n }","private void checkProductAvailability()\n\t{\n\n\t\tprodMsg = \"\";\n\t\tcartIsEmpty = false;\n\n\t\tMap products = getProducts();\n\n\t\tint qtyRequested, qtyAvailable;\n\n\t\t// Check for unavailable products\n\t\tfor ( Product p : shoppingCart.getProducts().keySet() )\n\t\t{\n\t\t\tfor ( String s : products.keySet() )\n\t\t\t{\n\t\t\t\tif ( products.get(s).getName().equals(p.getName()) )\n\t\t\t\t{\n\t\t\t\t\t// Modify product to write to file\n\t\t\t\t\tqtyRequested = shoppingCart.getProducts().get(p);\n\t\t\t\t\tqtyAvailable = products.get(s).getQtyAvailable();\n\n\t\t\t\t\tif ( qtyAvailable < qtyRequested )\n\t\t\t\t\t\tunavailableProds.put(p, new ArrayList <>(Arrays.asList(qtyRequested, qtyAvailable)));\n\t\t\t\t}\n\t\t\t}\n\t\t}\n\n\t\t// Show warning\n\t\tif ( !unavailableProds.isEmpty() )\n\t\t{\n\t\t\tprodMsg = \"The cart products were not available anymore in the requested quantity, only the available quantity has been bought:\\n\\n\";\n\n\t\t\tfor ( Product p : unavailableProds.keySet() )\n\t\t\t{\n\t\t\t\tprodMsg += p.getName() + \": requested: \" + unavailableProds.get(p).get(0) + \", available: \"\n\t\t\t\t\t\t+ unavailableProds.get(p).get(1) + \"\\n\";\n\n\t\t\t\tif ( unavailableProds.get(p).get(1) == 0 )\n\t\t\t\t\tshoppingCart.removeProduct(p);\n\t\t\t\telse\n\t\t\t\t\tshoppingCart.getProducts().replace(p, unavailableProds.get(p).get(1));\n\t\t\t}\n\n\t\t\tif ( shoppingCart.getProducts().size() == 0 )\n\t\t\t{\n\t\t\t\tcartIsEmpty = true;\n\t\t\t\tprodMsg = \"All of your products were not available anymore for purchase: payment cancelled.\\nPlease select some new products.\";\n\t\t\t}\n\t\t}\n\t}","private boolean allReady() {\n PlayerModel[] playersInLobby = this.lobbyModel.getPlayersInLobby();\n if (playersInLobby.length <= 1)\n return false;\n for (PlayerModel pl : playersInLobby) {\n if (!pl.isReady() && !(pl instanceof ClientPlayerModel))\n return false;\n }\n return true;\n }","synchronized public static boolean isInstalled() {\n return installed > 0;\n }","public boolean needAnnounce() {\n\t\tint peersPerThread = Config.getConfig().getInt(\"peer-max_connecting\") / Config.getConfig().getInt(\"peer-max_concurrent_connecting\");\n\t\tboolean needEnoughPeers = peersWanted() >= peersPerThread;\n\t\tboolean notExceedMaxPendingPeers = peers.size() < peerManager.getMaxPendingPeers(torrentStatus);\n\t\tboolean hasConnectingSpace = getFreeConnectingCapacity() > 0;\n\t\treturn needEnoughPeers && notExceedMaxPendingPeers && hasConnectingSpace;\n\t}","private boolean canPickUpPackage(Drone drone, WorldDelivery delivery){\n\t\t//check if the drone ID and the delivery drone ID match\n\t\tString droneID = drone.getDroneID();\n\t\tString deliveryDroneID = delivery.getDeliveryDroneID();\n\t\t//if not return false\n\t\tif(!droneID.equals(deliveryDroneID)){\n\n\t\t\treturn false;\n\t\t}\n\t\t//get the package source airport and position\n\t\tint sourceAirportID = delivery.getSourceAirport();\n//\t\tint sourceGateNumber = delivery.getSourceAirportGate();\n\t\t//get the position of the gate\n\t\tMap airports = this.getAirportMap();\n\t\tWorldAirport airport = airports.get(sourceAirportID);\n//\t\tVector dronePos = drone.getPosition();\n//\t\tfloat distanceToGate = airport.distanceToGate(sourceGateNumber, dronePos);\n//\n//\t\treturn distanceToGate <= MAX_TRANSFER_DISTANCE\n//\t\tif(drone.getDroneID().equals(\"0\")){\n//\t\t\tSystem.out.println(\"drone is at gate zone: \" + airport.isAtGateZone(drone.getPosition(), drone.getDroneID()));\n//\t\t}\n\t\treturn airport.isAtGateZone(drone.getPosition());\n\t}","private void warnNotAllSquadronsDeployed() {\n warnDialogProvider.get().show(\"Not all squadrons have been deployed. Squadrons not deployed are lost.\");\n }","private boolean checkForAction(){\n IndividualAction thisAction = checkTriggers();\n if(thisAction.getTriggers() == null){\n return false;\n }\n if(!checkSubjects(thisAction.getSubjects())){\n return false;\n }\n doConsumed(thisAction.getConsumed());\n doProduce(thisAction.getProduced());\n results.add(thisAction.getNarration());\n\n return true;\n }","public boolean hasBytesToSend() {\n\t\treturn !byteBufferQueue.isEmpty();\n\t}","protected boolean isAvailable() {\r\n\t\treturn true;\r\n\t}","public boolean runAllPendingScripts() {\n if (LOG.isInfoEnabled()) {\n LOG.info(\"Running all pending update deployment scripts.\");\n }\n return this.runAllPendingScriptsInAllExtensions(false);\n }","private void loadPackages(Set drones, Set packages) {\n\t\t//get the map of all drones\n\t\tMap droneMap = this.getDroneMap();\n\t\t//cycle trough all the packages, filter for all the packages that are not\n\t\t//delivered yet\n//\t\tSet unDelivered = packages.stream().filter(p -> !p.isDelivered()).collect(Collectors.toSet());\n\n\t\t//maps used during the algorithm to speed up the process\n\n\t\t//the map containing the (temporary) package to deliver by the drone\n\t\tMap deliverySequenceMap = new HashMap<>();\n\t\t//the map containing the lowest sequence number encountered for the drone\n\t\tMap lowestSequenceNumberMap = new HashMap<>();\n\t\t//both of the above maps are used to check if the package may be loaded onto the drone\n\n\t\t//map used to look into if the drone can deliver, string --> drone ID and boolean to indicate if it can deliver\n\t\tMap ableToDeliverMap = new HashMap<>();\n\t\t//start iterating trough all the elements\n\t\tfor (WorldDelivery delivery : packages) {\n\n\t\t\t//checks done to skip the loop if able\n\t\t\tif(delivery.isDelivered()){\n\t\t\t\tcontinue;\n\t\t\t}\n\n\t\t\tString deliveryDroneID = delivery.getDeliveryDroneID();\n\t\t\tif(deliveryDroneID == null){\n\t\t\t\tcontinue;\n\t\t\t}\n\t\t\t//get the drone\n\t\t\tDrone drone = droneMap.get(deliveryDroneID);\n\n\t\t\t//first check the delivery map to see if drone can deliver\n\t\t\tBoolean readyToPickUp = ableToDeliverMap.get(deliveryDroneID);\n\t\t\t//if no entry was found add it\n\t\t\tif (readyToPickUp == null) {\n\t\t\t\treadyToPickUp = readyToPickUp(drone);\n\t\t\t\tableToDeliverMap.put(deliveryDroneID, readyToPickUp);\n\t\t\t}\n\n\n\t\t\tif (readyToPickUp) {\n//\t\t\t\tif (delivery.getDeliveryDroneID().equals(\"0\")) {\n//\t\t\t\t\tSystem.out.println();\n//\t\t\t\t\tSystem.out.println(\"Delivery: seq nb: \" + delivery.getSequenceNumber() + \", source: \" + delivery.getSourceAirport() + \", dest: \" + delivery.getDestinationAirport());\n//\t\t\t\t\tSystem.out.println(\"lowest seq nb: \" + lowestSequenceNumberMap.get(\"0\"));\n//\t\t\t\t\tSystem.out.println(\"assignedDelivery: \" + deliverySequenceMap.get(\"0\"));\n//\t\t\t\t}\n\t\t\t\t//first check the lowest encountered so far map, if the sequence number of the package is higher, ignore\n\t\t\t\tLong lowestSequenceSoFar = lowestSequenceNumberMap.get(deliveryDroneID);\n\t\t\t\tlong deliverySequenceNumber = delivery.getSequenceNumber();\n\n\t\t\t\t//update if necessary\n\t\t\t\tif (lowestSequenceSoFar == null || deliverySequenceNumber < lowestSequenceSoFar) {\n\t\t\t\t\tlowestSequenceNumberMap.put(deliveryDroneID, deliverySequenceNumber);\n\t\t\t\t\t//also remove the current entry from the delivery sequence map, regardless from\n\t\t\t\t\t//the fact if we can deliver the current package. Only the lowest sequence number should be\n\t\t\t\t\t//delivered\n\t\t\t\t\tWorldDelivery removedDelivery = deliverySequenceMap.remove(deliveryDroneID);\n//\t\t\t\t\tif (delivery.getDeliveryDroneID().equals(\"0\")) {\n//\t\t\t\t\t\tSystem.out.println(\"removed delivery: \" + removedDelivery);\n//\t\t\t\t\t}\n\t\t\t\t} else {\n\t\t\t\t\t//if the sequence number is not lower than the lowest so far, we may not deliver the package, continue\n\t\t\t\t\tcontinue;\n\t\t\t\t}\n\n\t\t\t\t//then check if the package can be picked up\n\t\t\t\tif (canPickUpPackage(drone, delivery)) {\n\t\t\t\t\t//if so, put the package in the map\n//\t\t\t\t\tif(delivery.getDeliveryDroneID().equals(\"0\"))\n//\t\t\t\t\t\tSystem.out.println(\"added delivery: \" + delivery);\n\n\t\t\t\t\tdeliverySequenceMap.put(deliveryDroneID, delivery);\n\t\t\t\t}\n\t\t\t\t//if not we continue\n\n\t\t\t}\n\n\t\t}\n//\t\tSystem.out.println(\"all drones that will load a package: \" + deliverySequenceMap.keySet());\n\t\t//after the loop, load the packages for all the drones\n\t\tfor (String deliveryID : deliverySequenceMap.keySet()) {\n\t\t\t//get the corresponding drone\n\t\t\tWorldDelivery delivery = deliverySequenceMap.get(deliveryID);\n\t\t\tString deliveryDroneID = delivery.getDeliveryDroneID();\n\t\t\tDrone drone = droneMap.get(deliveryDroneID);\n\t\t\tdrone.loadPackage(delivery);\n\t\t}\n\t}","public void checkAuctions() {\n\n checkDutchAuctions();\n checkSecondPriceAuctions();\n }","private void checkUpdateCheckTriggered(PackageVersions packageVersions) {\n // Assert the PackageTracker attempted to trigger an update.\n mFakeIntentHelper.assertUpdateTriggered();\n\n // If an update check was triggered reliability triggering should always be enabled to\n // ensure that it can be completed if it fails.\n mFakeIntentHelper.assertReliabilityTriggerScheduled();\n\n // Check the expected storage state.\n checkPackageStorageStatus(PackageStatus.CHECK_STARTED, packageVersions);\n }","void check_and_send(){\r\n\t\twhile(not_ack_yet <= WINDOW_SIZE){\r\n\t\t\tif(covered_datagrams >= total_datagrams)\r\n\t\t\t\treturn;\r\n\t\t\t//send one data more\r\n\t\t\tcovered_datagrams++;\r\n\t\t\tbyte[] data_to_send = Helper.get_bytes(data_send,(covered_datagrams-1)*BLOCK_SIZE,BLOCK_SIZE);\r\n\t\t\tDataDatagram send = new DataDatagram((short)the_connection.session_num,\r\n\t\t\t\t\t(short)(covered_datagrams),data_to_send,the_connection);\r\n\t\t\tsend.send_datagram();\r\n\t\t\tput_and_set_timer(send);\r\n\t\t}\r\n\t}","private boolean checkDependenciesSatisfied() {\n\t\tLOGGER.trace(\"CheckDependenciesSatisfied: Start Checking\");\n\t\tfinal Collection moduleDependencies = selfModule.getDependencies();\n\t\tif (moduleDependencies == null) {\n\t\t\treturn true;\n\t\t}\n\t\tfor (final ModuleDependency moduleDependency : moduleDependencies) {\n\t\t\tif (!peerDiscoveryService.getPeerRegistry().containsPeerWithType(moduleDependency.getModuleTypeId(), true)) {\n\t\t\t\treturn false;\n\t\t\t}\n\t\t}\n\t\treturn true;\n\t}","boolean isAllInDownloadedArea();","private void unloadPackages(Set drones){\n\t\t//loop trough all the drones, check if they carry any packages\n\t\tfor(Drone drone: drones){\n\t\t\tif(drone.isDelivering()){\n\t\t\t\t//check if the drone can deliver the package\n\t\t\t\tif(canDeliverPackage(drone)){\n\t\t\t\t//unload the package\n\t\t\t\tdrone.unloadPackage();\n\t\t\t\t}\n\t\t\t}\n\t\t}\n\n\t\t//all the packages are unloaded\n\t}","public boolean needsRepairing() {\n boolean returner = false;\n for (Pouch pouch : pouchesUsed) {\n returner = returner || pouch.needsRepair();\n }\n return returner;\n }","public boolean isToDeploy() {\r\n\t\treturn attachUpdates>0 || catUpdates>0 || catTransUpdates>0 || prodUpdates>0 || prodTransUpdates>0 || menuUpdates>0;\r\n\t}","@Override\r\n\tpublic boolean isAllHit() {\r\n\t\treturn priorityElements.isEmpty();\r\n\t}","public boolean isAvailable(){\r\n return blockingQueue.size() < maxWorkQueueSize;\r\n }","public boolean allPlayersReady() {\r\n for (Player player : players) {\r\n if (!player.isReady()) {\r\n return false;\r\n }\r\n }\r\n return true;\r\n }","public boolean isInflated() {\n // TODO(cgavidia): This rule needs to be improved!\n\n boolean fixIsDelayed = false;\n\n if (this.isReportedSevere()) {\n fixIsDelayed = isFixDelayed(MAXIMUM_RELEASES_FOR_SEVERE);\n }\n\n if (this.isReportedDefault()) {\n fixIsDelayed = isFixDelayed(MAXIMUM_RELEASES_FOR_DEFAULT);\n }\n\n boolean fixIsRejected = isFixRejected();\n boolean issueIsIgnored = isIssueIgnored();\n\n return fixIsDelayed || fixIsRejected || issueIsIgnored;\n }","public void checkNotificationBroadcastSupport() {\n int i = 0;\n this.mShouldBroadcastNotifications = false;\n WallpaperManager wallpaperManager = (WallpaperManager) this.mContext.getSystemService(WallpaperManager.class);\n if (wallpaperManager != null) {\n WallpaperInfo wallpaperInfo = wallpaperManager.getWallpaperInfo();\n if (wallpaperInfo != null) {\n ComponentName component = wallpaperInfo.getComponent();\n String packageName = component.getPackageName();\n if (NOTIFYABLE_PACKAGES.contains(packageName)) {\n this.mWallpaperPackage = packageName;\n String className = component.getClassName();\n String[] strArr = NOTIFYABLE_WALLPAPERS;\n int length = strArr.length;\n while (true) {\n if (i >= length) {\n break;\n } else if (className.startsWith(strArr[i])) {\n this.mShouldBroadcastNotifications = true;\n break;\n } else {\n i++;\n }\n }\n }\n }\n }\n }","public void ondemandSetupIsDone();","public boolean isDeliverable() {\n if (getMode().isCollection() || !isCarried()) return false;\n return Map.isSameLocation(plan.cdst, carrier.getLocation());\n }","@Override\n\t\tpublic boolean deliverSelfNotifications() {\n\t\t\treturn super.deliverSelfNotifications();\n\t\t}","private boolean isPackValid() {\n\t\treturn (logData != null\n\t\t\t\t&& logData.entries != null\n\t\t\t\t&& logData.entries.size() > 1);\n\t}","@Test\r\n\tpublic void testDeliveryChuteFull() {\r\n\t\tdcListen.chuteFull(vend.getDeliveryChute());\r\n\t\tassertTrue(vend.getDeliveryChute().isDisabled());\r\n\t}","@Override\r\n\tpublic void makeDeliveryFree() {\n\t\t\r\n\t}","protected final boolean anyMsg() {\n\t\tDoorPulseCriterion dpc = new DoorPulseCriterion(this.getPulse() - 1);\n\t\treturn this.existMessage(dpc);\n\t}","public synchronized boolean checkFileCompletion()\n/* */ {\n/* 49 */ int totalsize = 0;\n/* */ \n/* 51 */ for (FileSubContent subContent : this.downloadManager.getSUB_CONTENTS())\n/* */ {\n/* 53 */ if ((subContent != null) && (subContent.isIsDownloaded()) && (subContent.getContent().length == this.downloadManager.getSUB_SIZE()))\n/* */ {\n/* 55 */ totalsize++;\n/* */ }\n/* */ }\n/* */ \n/* 59 */ if (totalsize == this.downloadManager.getSUB_CONTENTS().size())\n/* */ {\n/* 61 */ System.out.println(\"FileDownloadChecker: got all of the subParts.\");\n/* 62 */ return true;\n/* */ }\n/* */ \n/* */ \n/* 66 */ return false;\n/* */ }","@Override\n public void deliveryComplete(IMqttDeliveryToken imdt) {\n System.out.println(\"在完成消息传递并收到所有确认后调用。\");\n }","public boolean isPushAvailable() {\n checkUsbLibState();\n return listDevices().size() > 0;\n }","public boolean canLCBdeliver(Message message) {\n\n\t\tboolean canLCBdeliver = true;\n\n\t\tArrayList messageVC = message.getVectorClock();\n\t\tArrayList processVC = p.getVectorClock();\n\n\t\tif (processVC.get(message.getSender() - 1) != message.getId() - 1) {\n\t\t\tcanLCBdeliver = false;\n\t\t}\n\t\tfor (Integer i = 0; i < messageVC.size(); i++) {\n\t\t\tif (messageVC.get(i) > processVC.get(i)) {\n\t\t\t\tcanLCBdeliver = false;\n\t\t\t\tbreak;\n\t\t\t}\n\t\t}\n\n\t\treturn canLCBdeliver;\n\t}","public boolean hasRequests(){\n return (tradeRequests.size() > 0 || userRequests.size() > 0);\n }","public boolean isComplete() {\n /* first a simple check */\n if(number_of_frags_recvd < fragments.length)\n return false;\n\n /* then double-check just in case */\n for(Message msg: fragments) {\n if(msg == null)\n return false;\n }\n return true;\n }","public boolean availableServer(){\n for(int i = 0; i < cntServer; i++){\n if(serverArray[i].busy == false){return true;}\n }\n return false;\n }","public void msgKitIsGood(AgentKit kit) {\n\t\tfor(MyKit mk: myKits){\n\t\t\tif(mk.kit.equals(kit)){\n\t\t\t\tmk.status = KitStatus.Ready_For_Delivery;\n\t\t\t\tstateChanged();\n\t\t\t\treturn;\n\t\t\t}\n\t\t}\n\t}","public boolean isComplete() {\n return addedFrontWork.size() == 0 && addedBackWork.size() == 0 && sawAllDone.get();\n }","private void check() {\n ShedSolar.instance.haps.post( Events.WEATHER_REPORT_MISSED );\n LOGGER.info( \"Failed to receive weather report\" );\n\n // check again...\n startChecker();\n }","protected void checkNotifications() {\n List polled;\n boolean onlyOne;\n\n // Leave this mutually exclusive section as fast as possible...\n lock.lock();\n try {\n if (stopped) {\n LOGGER.debug(\"Push notification service stopped. Aborting polling of queue...\");\n return;\n }\n\n PushNotification first = submittedNotifcations.poll();\n if (null == first) {\n // Queue has no notification with an expired delay\n LOGGER.debug(\"Queue has no notification with an expired delay and holds {} buffered notifications\", I(submittedNotifcations.size()));\n return;\n }\n\n // Check for more\n PushNotification notification = submittedNotifcations.poll();\n if (notification != null) {\n polled = new LinkedList<>();\n polled.add(first);\n LOGGER.debug(\"Polled notification \\\"{}\\\" for user {} in context {} from queue\", first.getTopic(), I(first.getUserId()), I(first.getContextId()));\n do {\n polled.add(notification);\n LOGGER.debug(\"Polled notification \\\"{}\\\" for user {} in context {} from queue\", notification.getTopic(), I(notification.getUserId()), I(notification.getContextId()));\n notification = submittedNotifcations.poll();\n } while (null != notification);\n onlyOne = false;\n } else {\n polled = Collections.singletonList(first);\n LOGGER.debug(\"Polled notification \\\"{}\\\" for user {} in context {} from queue\", first.getTopic(), I(first.getUserId()), I(first.getContextId()));\n onlyOne = true;\n }\n\n if (submittedNotifcations.isEmpty()) {\n cancelTimerTask();\n LOGGER.debug(\"Dropped polling timer task since queue is currently empty\");\n }\n } finally {\n lock.unlock();\n }\n\n if (onlyOne) {\n // There was only a single one available\n PushNotification first = polled.get(0);\n NotificationsHandler task = new NotificationsHandler(first);\n if (tryExecuteTask(task, first.getUserId(), first.getContextId())) {\n LOGGER.debug(\"Submitted delivery of polled notification with topic \\\"{}\\\" to user {} in context {}\", first.getTopic(), I(first.getUserId()), I(first.getContextId()));\n } else {\n // Processor rejected task execution. Perform with current thread.\n task.run();\n }\n } else {\n // Handle them all\n Map>> polledNotificationsPerContextAndTopic = new LinkedHashMap<>();\n for (PushNotification notification : polled) {\n put(notification, polledNotificationsPerContextAndTopic);\n }\n for (Map.Entry>> entry : polledNotificationsPerContextAndTopic.entrySet()) {\n ContextAndTopicKey key = entry.getKey();\n Map> notificationsPerUser = entry.getValue();\n NotificationsHandler task = new NotificationsHandler(key.contextId, key.topic, notificationsPerUser);\n if (tryExecuteTask(task, -1, key.contextId)) {\n if (LOGGER.isDebugEnabled()) {\n int[] userIds = Coll2i(notificationsPerUser.keySet());\n Object sUserIds = userIds.length <= 10 ? toStringObjectFor(userIds) : null;\n userIds = null;\n if (sUserIds == null) {\n LOGGER.debug(\"Submitted delivery of polled notifications with topic \\\"{}\\\" to users in context {}\", key.topic, I(key.contextId));\n } else {\n LOGGER.debug(\"Submitted delivery of polled notifications with topic \\\"{}\\\" to users {} in context {}\", key.topic, sUserIds, I(key.contextId));\n }\n }\n } else {\n // Processor rejected task execution. Perform with current thread.\n task.run();\n }\n }\n }\n }","private boolean dateAvailable(List dateGroups) {\n final int NOT_AVAILABLE = 0;\n return dateGroups.size() > NOT_AVAILABLE;\n }","@Override\n\tpublic boolean done() {\n\t\tfor(Task t : details.getPendingTasks()){\n\t\t\tif(!t.isComplete())\n\t\t\t\treturn false;\n\t\t}\n\t\treturn true;\n\t}","public boolean isDeployed(){\n return !places.isEmpty();\n }","private void checkForShutdown() {\n\t\tif (0==(0xFFF&iteration++)) {\n\t\t\t///////we have no work and we are not blocked.\n\t\t\t//must check for shutdown case\n\t\t\tint i = requestInputs.length;\n\t\t\twhile (--i>=0) {\n\t\t\t\tPipe p = requestInputs[i];\n\t\t\t\tif (!Pipe.peekMsg(p,-1)) {\n\t\t\t\t\treturn;//this one was not shut down yet\n\t\t\t\t}\t\t\t\n\t\t\t}\n\t\t\tint j = responseInputs.length;\n\t\t\twhile (--j>=0) {\n\t\t\t\tPipe p = responseInputs[j];\n\t\t\t\tif (!Pipe.peekMsg(p,-1)) {\n\t\t\t\t\treturn;//this one was not shut down yet\n\t\t\t\t}\t\t\t\n\t\t\t}\n\t\t\t//all the pipes have now requested shutdown\n\t\t\tif (Pipe.hasRoomForWrite(output)) {\n\t\t\t\tPipe.publishEOF(output); //tell downstream to shutdown\n\t\t\t\trequestShutdown(); //shutdown myself\t\t\t\n\t\t\t} else {\n\t\t\t\treturn;//try again later\n\t\t\t}\n\t\t}\n\t}","@Override\n public boolean isReady() {\n return (running && !opening) || packetQueue.size() > 0;\n }","public boolean isAvailable() throws KKException\r\n {\r\n return isAvailable(MODULE_PAYMENT_CYBERSOURCESA_STATUS);\r\n }","private void movePackages(){\n\t\t//get the package set\n\t\tSet droneSet = this.getDroneSet();\n\t\tPackageService packageService = this.getPackageService();\n\t\t//get all the packages that need to be delivered and are assigned a drone (these are the only\n\t\t//ones that need to be loaded and unloaded\n//\t\tSet packages = packageService.getAllUndeliveredAssignedWorldDeliveries();\n\t\tSet packages = packageService.getSubmittedWorldDeliveries();\n\t\t//first check if all the drones can unload their packages\n\n\t\tunloadPackages(droneSet);\n\t\t//then load all the packages\n\t\tloadPackages(droneSet, packages);\n\n\t}","boolean isAvailable();","boolean isAvailable();","boolean isAvailable();","boolean isAvailable();","public boolean allSunken() {\n\t\tfor (Ship s : ships) {\n\t\t\tif (!s.isSunk()) {\n\t\t\t\treturn false;\n\t\t\t}\n\t\t}\n\t\treturn true;\n\t}","public void checkEvents()\n\t{\n\t\t((MBoxStandalone)events).processMessages();\n\t}","@Override\n\t\tboolean needsAck() {\n\t\t\treturn byteChunks.length > 0; // don't retry empty ack\n\t\t}","private boolean hasServerRemovedAllElements() {\n return getNumElementsRemoved() >= getNumElementsToRemove();\n }","private void check() {\r\n\t\tif(isEmpty()){\r\n\t\t\tthrow new RuntimeException(\"Queue is empty\");\r\n\t\t}\r\n\t}","boolean isSetupDone();","public boolean isPackageInstalled(String packageName) {\n boolean flag = false;\n List packageInfoList = mPackageManager.getInstalledPackages(0);\n for (int i = 0; i < packageInfoList.size(); i++) {\n if (packageName.equals(packageInfoList.get(i).packageName)) {\n flag = true;\n break;\n }\n }\n\n if (isregister) {\n mContext.unregisterReceiver(mReceiver);\n isregister = false;\n }\n\n return flag;\n }","public void testParse_empty() {\n DumpsysPackageReceiver parser = new DumpsysPackageReceiver();\n assertEquals(0, parser.getPackages().size());\n }","boolean hasHasDeployedAirbag();","protected boolean rebootAllWithDNS() throws Throwable {\n return (pingFromMaster(hostname) &&\n rebootAndWait(\"all\") &&\n pingFromMaster(hostname));\n }","public boolean hasPackageName() {\n return ((bitField0_ & 0x00000002) == 0x00000002);\n }","protected void deliverMessages()\n {\n Set envelopes = messengerDao.getEnvelopes();\n\n Map> peerEnvelopesMap = Maps.newHashMap();\n int maxTimeToLive = 0;\n //distribute envelops to peers\n for ( Envelope envelope : envelopes )\n {\n if ( envelope.getTimeToLive() > maxTimeToLive )\n {\n maxTimeToLive = envelope.getTimeToLive();\n }\n Set peerEnvelopes = peerEnvelopesMap.get( envelope.getTargetPeerId() );\n if ( peerEnvelopes == null )\n {\n //sort by createDate asc once more\n peerEnvelopes = new TreeSet<>( new Comparator()\n {\n @Override\n public int compare( final Envelope o1, final Envelope o2 )\n {\n return o1.getCreateDate().compareTo( o2.getCreateDate() );\n }\n } );\n peerEnvelopesMap.put( envelope.getTargetPeerId(), peerEnvelopes );\n }\n\n peerEnvelopes.add( envelope );\n }\n\n\n //try to send messages in parallel - one thread per peer\n try\n {\n for ( Map.Entry> envelopsPerPeer : peerEnvelopesMap.entrySet() )\n {\n Peer targetPeer = messenger.getPeerManager().getPeer( envelopsPerPeer.getKey() );\n if ( targetPeer.isLocal() )\n {\n completer.submit(\n new LocalPeerMessageSender( messenger, messengerDao, envelopsPerPeer.getValue() ) );\n }\n else\n {\n completer.submit(\n new RemotePeerMessageSender( messengerDao, targetPeer, envelopsPerPeer.getValue() ) );\n }\n }\n\n //wait for completion\n try\n {\n for ( int i = 0; i < peerEnvelopesMap.size(); i++ )\n {\n Future future = completer.take();\n future.get();\n }\n }\n catch ( InterruptedException | ExecutionException e )\n {\n LOG.warn( \"ignore\", e );\n }\n }\n catch ( PeerException e )\n {\n LOG.error( e.getMessage(), e );\n }\n }","private boolean queueFullError() {\n\t\tSystem.out.println(\"Queue Full!!!\");\n\t\treturn false;\n\t}","boolean hasQos();","boolean isPendingToRead();","private void checkBuyCard(PropertyCard card) {\n\t\tboolean almostComplete = checkCollection(this, card);\n\t\tif(almostComplete) {\n\t\t\tboolean boughtCard = buyCard(card);\n\t\t\tif(!boughtCard) {\n\t\t\t\tboolean madeChanges = checkPayment(card.getPrice());\n\t\t\t\tif(madeChanges) {\n\t\t\t\t\tbuyCard(card);\n\t\t\t\t}\n\t\t\t}\n\t\t}\n\t\telse {\n\t\t\tboolean opponentAlmostComplete = false;\n\t\t\tfor(Player p: getPlayers()) {\n\t\t\t\tif(checkCollection(p,card)) {\n\t\t\t\t\topponentAlmostComplete = true;\n\t\t\t\t\tbreak;\n\t\t\t\t}\n\t\t\t}\n\t\t\tif(opponentAlmostComplete) {\n\t\t\t\tbuyCard(card);\n\t\t\t}\n\t\t\telse {\n\t\t\t\tif(getMoney()-card.getPrice()>=100) {\n\t\t\t\t\tbuyCard(card);\n\t\t\t\t}\n\t\t\t}\n\t\t}\n\t}","boolean needsAck() { return true; }","@Override\r\n public boolean checkAllDecksEmpty(int plDeckPosition) {\r\n // Are all the decks empty\r\n boolean flag = true;\r\n \r\n // Loop through all decks at deck position for each player\r\n for (Player player : this.players) {\r\n if (!player.isDeckEmpty(plDeckPosition)) {\r\n flag = false;\r\n }\r\n }\r\n \r\n // Return the value\r\n return flag;\r\n }","public boolean isAvailable(){\n\t\ttry{\n\t\t\tgetPrimingsInternal(\"Test\", \"ATGATGATGATGATGATGATG\");\n\t\t}\n\t\tcatch(IOException e){\n\t\t\treturn false;\n\t\t}\n\t\tcatch(InterruptedException e){\n\t\t\treturn false;\n\t\t}\n\t\treturn true;\n\t}","private boolean queueFirstServerIfDown(List allServers) {\n if (allServers.size() < 2) {\n return false;\n }\n URI uri = allServers.get(0);\n HttpGet httpGet = new HttpGet(uri);\n\n RequestConfig config = RequestConfig.custom()\n .setConnectTimeout((int) PING_REQUEST_TIMEOUT.toMillis())\n .setConnectionRequestTimeout((int) PING_REQUEST_TIMEOUT.toMillis())\n .setSocketTimeout((int) PING_REQUEST_TIMEOUT.toMillis()).build();\n httpGet.setConfig(config);\n\n try (CloseableHttpResponse response = client.execute(httpGet)) {\n if (response.getStatusLine().getStatusCode() == 200) {\n return false;\n }\n\n } catch (IOException e) {\n // We ignore this, if server is restarting this might happen.\n }\n // Some error happened, move this server to the back. The other servers should be running.\n Collections.rotate(allServers, -1);\n return true;\n }","protected void checkTransmissionRequirements()\n {\n if (isOutOfBandAlert())\n { // Out-of-band (OOB) transmission requirements\n if (this.alert_text == null && this.details_OOB_source_ID == 0)\n { // [SCTE 18] 6-3\n if (log.isInfoEnabled())\n {\n log.info(formatLogMessage(\"SCTE-18: OOB alert requires alert text or a details source ID\"));\n }\n }\n else if (this.alert_priority > EASMessage.ALERT_PRIORITY_HIGH)\n {\n if (this.details_OOB_source_ID == 0)\n { // [SCTE 18] 6-5\n if (log.isInfoEnabled())\n {\n log.info(formatLogMessage(\"SCTE-18: OOB maximum priority alert requires a details source ID\"));\n }\n }\n else if (this.alert_text != null && this.audio_OOB_source_ID == 0)\n { // [SCTE 18] 6-7\n if (log.isInfoEnabled())\n {\n log.info(formatLogMessage(\"SCTE-18: OOB maximum priority alert with alert text requires an audio source ID\"));\n }\n }\n }\n }\n else\n { // In-band (IB) transmission requirements\n if (this.alert_text == null && this.details_major_channel_number == 0\n && this.details_minor_channel_number == 0)\n { // [SCTE 18] 6-2\n if (log.isInfoEnabled())\n {\n log.info(formatLogMessage(\"SCTE-18: IB alert requires alert text or a details channel\"));\n }\n }\n else if (this.alert_priority > EASMessage.ALERT_PRIORITY_HIGH && this.details_major_channel_number == 0\n && this.details_minor_channel_number == 0)\n { // [SCTE 18] 6-4\n if (log.isInfoEnabled())\n {\n log.info(formatLogMessage(\"SCTE-18: IB maximum priority alert requires a details channel\"));\n }\n }\n }\n }","private void checkUpdateCheckSuccessful(PackageVersions packageVersions) {\n mFakeIntentHelper.assertReliabilityTriggerNotScheduled();\n\n // Assert the storage was updated.\n checkPackageStorageStatus(PackageStatus.CHECK_COMPLETED_SUCCESS, packageVersions);\n\n // Peek inside the package tracker to make sure it is tracking failure counts properly.\n assertEquals(0, mPackageTracker.getCheckFailureCountForTests());\n }","boolean hasSender();","boolean hasSender();","boolean hasSender();","boolean hasSender();"],"string":"[\n \"public abstract boolean isDelivered();\",\n \"boolean isUseAllLatestPacks();\",\n \"@Override\\n\\tpublic boolean isDeliverable() {\\n\\t\\treturn true;\\n\\t}\",\n \"public boolean isMixPackagesPresent()\\n\\t{\\n\\t\\ttry\\n\\t\\t{\\n\\t\\t\\tArrayList versions = new ArrayList();\\n\\t\\t\\t\\n\\t\\t\\tif(PackageInformation.getInstance().collectPkgInfoFromUPM())\\n\\t\\t\\t{\\n\\t\\t\\t\\tVector firmwareInfo = PackageInformation.getInstance().getAppVersionsFromSpot();\\n\\t\\t\\t\\tif(firmwareInfo != null && !firmwareInfo.isEmpty())\\n\\t\\t\\t\\t{\\n\\t\\t\\t\\t\\tversions.clear();\\n\\t\\t\\t\\t\\tint buildVersion = getBuildVersion(firmwareInfo);\\n\\t\\t\\t\\t\\t\\n\\t\\t\\t\\t\\tif(buildVersion != 0)\\n\\t\\t\\t\\t\\t{\\n\\t\\t\\t\\t\\t\\tif(buildVersion == Version.DELTA_F.getVersion())\\n\\t\\t\\t\\t\\t\\t{\\n\\t\\t\\t\\t\\t\\t\\tversions.add(Version.DELTA_C.getVersion());\\n\\t\\t\\t\\t\\t\\t\\treturn isOtherPackages(versions, firmwareInfo);\\n\\t\\t\\t\\t\\t\\t}\\n\\t\\t\\t\\t\\t\\telse if(buildVersion == Version.DELTA_E.getVersion())\\n\\t\\t\\t\\t\\t\\t{\\n\\t\\t\\t\\t\\t\\t\\tversions.add(Version.DELTA_C.getVersion());\\n\\t\\t\\t\\t\\t\\t\\treturn isOtherPackages(versions, firmwareInfo);\\n\\t\\t\\t\\t\\t\\t}\\n\\t\\t\\t\\t\\t\\telse if(buildVersion == Version.DELTA_C.getVersion())\\n\\t\\t\\t\\t\\t\\t{\\n\\t\\t\\t\\t\\t\\t\\tversions.add(Version.DELTA_F.getVersion());\\n\\t\\t\\t\\t\\t\\t\\tversions.add(Version.DELTA_E.getVersion());\\n\\t\\t\\t\\t\\t\\t\\treturn isOtherPackages(versions, firmwareInfo);\\n\\t\\t\\t\\t\\t\\t}\\n\\t\\t\\t\\t\\t}\\n\\t\\t\\t\\t}\\n\\t\\t\\t}\\n\\t\\t\\telse\\n\\t\\t\\t{\\n\\t\\t\\t\\tlogger.error(\\\"Failed to collect package information\\\");\\n\\t\\t\\t}\\n\\t\\t}\\n\\t\\tcatch(InterruptedException e)\\n\\t\\t{\\n\\t\\t\\tlogger.error(e.getMessage());\\n\\t\\t}\\n\\t\\treturn false;\\n\\t}\",\n \"private boolean canDeliverPackage(Drone drone){\\n\\t\\t//check first if drone has the required velocity, if not skip the rest of the calc\\n\\t\\tVector droneVelocity = drone.getVelocity();\\n\\n\\t\\tif(droneVelocity.getSize() > MAX_LANDING_VELOCITY){\\n\\t\\t\\treturn false;\\n\\t\\t}\\n\\t\\t//check if the drone is currently at the airport where the package needs to be delivered\\n\\t\\tWorldDelivery delivery = drone.getDeliveryPackage();\\n\\t\\t//first get the package\\n\\t\\tint destinationAirportID = delivery.getDestinationAirport();\\n//\\t\\tint destinationGateNumber = delivery.getDestinationAirportGate();\\n\\t\\t//get the position of the gate\\n\\t\\tMap airports = this.getAirportMap();\\n\\t\\tWorldAirport airport = airports.get(destinationAirportID);\\n\\t\\treturn airport.isAtGateZone(drone.getPosition());\\n//\\t\\tVector dronePos = drone.getPosition();\\n//\\t\\tfloat distanceToGate = airport.distanceToGate(destinationGateNumber, dronePos);\\n//\\t\\treturn distanceToGate <= MAX_TRANSFER_DISTANCE;\\n\\t}\",\n \"boolean hasPakringFree();\",\n \"boolean hasPakringFree();\",\n \"public boolean maybeAllSent() {\\n\\t\\tif(blockSendsPending == 0 && _unsent.size() == 0 && getNumSent() == _prb._packets) {\\n\\t\\t\\ttimeAllSent = System.currentTimeMillis();\\n\\t\\t\\tif(logMINOR)\\n\\t\\t\\t\\tLogger.minor(this, \\\"Sent all blocks, none unsent on \\\"+this);\\n\\t\\t\\t_senderThread.notifyAll();\\n\\t\\t\\treturn true;\\n\\t\\t}\\n\\t\\tif(blockSendsPending == 0 && _failed) {\\n\\t\\t\\ttimeAllSent = System.currentTimeMillis();\\n\\t\\t\\tif(logMINOR)\\n\\t\\t\\t\\tLogger.minor(this, \\\"Sent blocks and failed on \\\"+this);\\n\\t\\t\\treturn true;\\n\\t\\t}\\n\\t\\tif(logMINOR) Logger.minor(this, \\\"maybeAllSent: block sends pending = \\\"+blockSendsPending+\\\" unsent = \\\"+_unsent.size()+\\\" sent = \\\"+getNumSent()+\\\" on \\\"+this);\\n\\t\\treturn false;\\n\\t}\",\n \"private boolean finish(boolean releaseAll) {\\n/* 485 */ close();\\n/* */ try {\\n/* 487 */ checkException();\\n/* 488 */ return (isNotEmpty(this.inboundMessages) || isNotEmpty(this.outboundMessages));\\n/* */ } finally {\\n/* 490 */ if (releaseAll) {\\n/* 491 */ releaseAll(this.inboundMessages);\\n/* 492 */ releaseAll(this.outboundMessages);\\n/* */ } \\n/* */ } \\n/* */ }\",\n \"@java.lang.Override\\n public boolean hasDeliver() {\\n return stepInfoCase_ == 12;\\n }\",\n \"@Override\\n public boolean hasMessageAvailable() {\\n return !priorityQueue.isEmpty() && priorityQueue.peekN1() <= clock.millis();\\n }\",\n \"@java.lang.Override\\n public boolean hasDeliver() {\\n return stepInfoCase_ == 12;\\n }\",\n \"boolean hasReceived();\",\n \"public boolean isDelivered() {\\n return !getMode().isCollection() && !isCarried();\\n }\",\n \"boolean hasUnReceived();\",\n \"private boolean checkBrokers ()\\n {\\n if (game.getAgentMap().size() < 1) {\\n log.info(String.format(\\\"Game: %s (round %s) reports no brokers \\\"\\n + \\\"registered\\\",\\n game.getGameId(), game.getRound().getRoundId()));\\n return false;\\n }\\n\\n for (Agent agent: game.getAgentMap().values()) {\\n Broker broker = agent.getBroker();\\n // Check if any broker is disabled in the interface\\n if (!MemStore.getBrokerState(broker.getBrokerId())) {\\n log.info(String.format(\\\"Not starting game %s : broker %s is disabled\\\",\\n game.getGameId(), broker.getBrokerId()));\\n return false;\\n }\\n\\n // Check if any broker is already running the maxAgent nof agents\\n if (!broker.hasAgentsAvailable(game.getRound())) {\\n log.info(String.format(\\\"Not starting game %s : broker %s doesn't have \\\"\\n + \\\"enough available agents\\\",\\n game.getGameId(), broker.getBrokerId()));\\n return false;\\n }\\n\\n brokers += broker.getBrokerName() + \\\"/\\\" + agent.getBrokerQueue() + \\\",\\\";\\n }\\n brokers = brokers.substring(0, brokers.length() - 1);\\n return true;\\n }\",\n \"boolean hasPackageName();\",\n \"public boolean isSettled()\\n {\\n synchronized (_amqpConnection)\\n {\\n return _delivery.isSettled() || ((_delivery instanceof DeliveryImpl && ((DeliveryImpl)_delivery).remotelySettled()));\\n }\\n }\",\n \"private boolean isAllTestsRun() {\\n Collection pkgs = getTestPackages();\\n for (TestPackage pkg : pkgs) {\\n if (!pkg.isAllTestsRun()) {\\n return false;\\n }\\n }\\n return true;\\n }\",\n \"public default boolean needsReagents()\\r\\n\\t{\\r\\n\\t\\tfor(ItemStack stack : getReagents()) if(!stack.isEmpty()) return true;\\r\\n\\t\\treturn true;\\r\\n\\t}\",\n \"public boolean isAllBurntUp() {\\n return (flammableItemCount == itemsOnFire);\\n }\",\n \"private void checkProductAvailability()\\n\\t{\\n\\n\\t\\tprodMsg = \\\"\\\";\\n\\t\\tcartIsEmpty = false;\\n\\n\\t\\tMap products = getProducts();\\n\\n\\t\\tint qtyRequested, qtyAvailable;\\n\\n\\t\\t// Check for unavailable products\\n\\t\\tfor ( Product p : shoppingCart.getProducts().keySet() )\\n\\t\\t{\\n\\t\\t\\tfor ( String s : products.keySet() )\\n\\t\\t\\t{\\n\\t\\t\\t\\tif ( products.get(s).getName().equals(p.getName()) )\\n\\t\\t\\t\\t{\\n\\t\\t\\t\\t\\t// Modify product to write to file\\n\\t\\t\\t\\t\\tqtyRequested = shoppingCart.getProducts().get(p);\\n\\t\\t\\t\\t\\tqtyAvailable = products.get(s).getQtyAvailable();\\n\\n\\t\\t\\t\\t\\tif ( qtyAvailable < qtyRequested )\\n\\t\\t\\t\\t\\t\\tunavailableProds.put(p, new ArrayList <>(Arrays.asList(qtyRequested, qtyAvailable)));\\n\\t\\t\\t\\t}\\n\\t\\t\\t}\\n\\t\\t}\\n\\n\\t\\t// Show warning\\n\\t\\tif ( !unavailableProds.isEmpty() )\\n\\t\\t{\\n\\t\\t\\tprodMsg = \\\"The cart products were not available anymore in the requested quantity, only the available quantity has been bought:\\\\n\\\\n\\\";\\n\\n\\t\\t\\tfor ( Product p : unavailableProds.keySet() )\\n\\t\\t\\t{\\n\\t\\t\\t\\tprodMsg += p.getName() + \\\": requested: \\\" + unavailableProds.get(p).get(0) + \\\", available: \\\"\\n\\t\\t\\t\\t\\t\\t+ unavailableProds.get(p).get(1) + \\\"\\\\n\\\";\\n\\n\\t\\t\\t\\tif ( unavailableProds.get(p).get(1) == 0 )\\n\\t\\t\\t\\t\\tshoppingCart.removeProduct(p);\\n\\t\\t\\t\\telse\\n\\t\\t\\t\\t\\tshoppingCart.getProducts().replace(p, unavailableProds.get(p).get(1));\\n\\t\\t\\t}\\n\\n\\t\\t\\tif ( shoppingCart.getProducts().size() == 0 )\\n\\t\\t\\t{\\n\\t\\t\\t\\tcartIsEmpty = true;\\n\\t\\t\\t\\tprodMsg = \\\"All of your products were not available anymore for purchase: payment cancelled.\\\\nPlease select some new products.\\\";\\n\\t\\t\\t}\\n\\t\\t}\\n\\t}\",\n \"private boolean allReady() {\\n PlayerModel[] playersInLobby = this.lobbyModel.getPlayersInLobby();\\n if (playersInLobby.length <= 1)\\n return false;\\n for (PlayerModel pl : playersInLobby) {\\n if (!pl.isReady() && !(pl instanceof ClientPlayerModel))\\n return false;\\n }\\n return true;\\n }\",\n \"synchronized public static boolean isInstalled() {\\n return installed > 0;\\n }\",\n \"public boolean needAnnounce() {\\n\\t\\tint peersPerThread = Config.getConfig().getInt(\\\"peer-max_connecting\\\") / Config.getConfig().getInt(\\\"peer-max_concurrent_connecting\\\");\\n\\t\\tboolean needEnoughPeers = peersWanted() >= peersPerThread;\\n\\t\\tboolean notExceedMaxPendingPeers = peers.size() < peerManager.getMaxPendingPeers(torrentStatus);\\n\\t\\tboolean hasConnectingSpace = getFreeConnectingCapacity() > 0;\\n\\t\\treturn needEnoughPeers && notExceedMaxPendingPeers && hasConnectingSpace;\\n\\t}\",\n \"private boolean canPickUpPackage(Drone drone, WorldDelivery delivery){\\n\\t\\t//check if the drone ID and the delivery drone ID match\\n\\t\\tString droneID = drone.getDroneID();\\n\\t\\tString deliveryDroneID = delivery.getDeliveryDroneID();\\n\\t\\t//if not return false\\n\\t\\tif(!droneID.equals(deliveryDroneID)){\\n\\n\\t\\t\\treturn false;\\n\\t\\t}\\n\\t\\t//get the package source airport and position\\n\\t\\tint sourceAirportID = delivery.getSourceAirport();\\n//\\t\\tint sourceGateNumber = delivery.getSourceAirportGate();\\n\\t\\t//get the position of the gate\\n\\t\\tMap airports = this.getAirportMap();\\n\\t\\tWorldAirport airport = airports.get(sourceAirportID);\\n//\\t\\tVector dronePos = drone.getPosition();\\n//\\t\\tfloat distanceToGate = airport.distanceToGate(sourceGateNumber, dronePos);\\n//\\n//\\t\\treturn distanceToGate <= MAX_TRANSFER_DISTANCE\\n//\\t\\tif(drone.getDroneID().equals(\\\"0\\\")){\\n//\\t\\t\\tSystem.out.println(\\\"drone is at gate zone: \\\" + airport.isAtGateZone(drone.getPosition(), drone.getDroneID()));\\n//\\t\\t}\\n\\t\\treturn airport.isAtGateZone(drone.getPosition());\\n\\t}\",\n \"private void warnNotAllSquadronsDeployed() {\\n warnDialogProvider.get().show(\\\"Not all squadrons have been deployed. Squadrons not deployed are lost.\\\");\\n }\",\n \"private boolean checkForAction(){\\n IndividualAction thisAction = checkTriggers();\\n if(thisAction.getTriggers() == null){\\n return false;\\n }\\n if(!checkSubjects(thisAction.getSubjects())){\\n return false;\\n }\\n doConsumed(thisAction.getConsumed());\\n doProduce(thisAction.getProduced());\\n results.add(thisAction.getNarration());\\n\\n return true;\\n }\",\n \"public boolean hasBytesToSend() {\\n\\t\\treturn !byteBufferQueue.isEmpty();\\n\\t}\",\n \"protected boolean isAvailable() {\\r\\n\\t\\treturn true;\\r\\n\\t}\",\n \"public boolean runAllPendingScripts() {\\n if (LOG.isInfoEnabled()) {\\n LOG.info(\\\"Running all pending update deployment scripts.\\\");\\n }\\n return this.runAllPendingScriptsInAllExtensions(false);\\n }\",\n \"private void loadPackages(Set drones, Set packages) {\\n\\t\\t//get the map of all drones\\n\\t\\tMap droneMap = this.getDroneMap();\\n\\t\\t//cycle trough all the packages, filter for all the packages that are not\\n\\t\\t//delivered yet\\n//\\t\\tSet unDelivered = packages.stream().filter(p -> !p.isDelivered()).collect(Collectors.toSet());\\n\\n\\t\\t//maps used during the algorithm to speed up the process\\n\\n\\t\\t//the map containing the (temporary) package to deliver by the drone\\n\\t\\tMap deliverySequenceMap = new HashMap<>();\\n\\t\\t//the map containing the lowest sequence number encountered for the drone\\n\\t\\tMap lowestSequenceNumberMap = new HashMap<>();\\n\\t\\t//both of the above maps are used to check if the package may be loaded onto the drone\\n\\n\\t\\t//map used to look into if the drone can deliver, string --> drone ID and boolean to indicate if it can deliver\\n\\t\\tMap ableToDeliverMap = new HashMap<>();\\n\\t\\t//start iterating trough all the elements\\n\\t\\tfor (WorldDelivery delivery : packages) {\\n\\n\\t\\t\\t//checks done to skip the loop if able\\n\\t\\t\\tif(delivery.isDelivered()){\\n\\t\\t\\t\\tcontinue;\\n\\t\\t\\t}\\n\\n\\t\\t\\tString deliveryDroneID = delivery.getDeliveryDroneID();\\n\\t\\t\\tif(deliveryDroneID == null){\\n\\t\\t\\t\\tcontinue;\\n\\t\\t\\t}\\n\\t\\t\\t//get the drone\\n\\t\\t\\tDrone drone = droneMap.get(deliveryDroneID);\\n\\n\\t\\t\\t//first check the delivery map to see if drone can deliver\\n\\t\\t\\tBoolean readyToPickUp = ableToDeliverMap.get(deliveryDroneID);\\n\\t\\t\\t//if no entry was found add it\\n\\t\\t\\tif (readyToPickUp == null) {\\n\\t\\t\\t\\treadyToPickUp = readyToPickUp(drone);\\n\\t\\t\\t\\tableToDeliverMap.put(deliveryDroneID, readyToPickUp);\\n\\t\\t\\t}\\n\\n\\n\\t\\t\\tif (readyToPickUp) {\\n//\\t\\t\\t\\tif (delivery.getDeliveryDroneID().equals(\\\"0\\\")) {\\n//\\t\\t\\t\\t\\tSystem.out.println();\\n//\\t\\t\\t\\t\\tSystem.out.println(\\\"Delivery: seq nb: \\\" + delivery.getSequenceNumber() + \\\", source: \\\" + delivery.getSourceAirport() + \\\", dest: \\\" + delivery.getDestinationAirport());\\n//\\t\\t\\t\\t\\tSystem.out.println(\\\"lowest seq nb: \\\" + lowestSequenceNumberMap.get(\\\"0\\\"));\\n//\\t\\t\\t\\t\\tSystem.out.println(\\\"assignedDelivery: \\\" + deliverySequenceMap.get(\\\"0\\\"));\\n//\\t\\t\\t\\t}\\n\\t\\t\\t\\t//first check the lowest encountered so far map, if the sequence number of the package is higher, ignore\\n\\t\\t\\t\\tLong lowestSequenceSoFar = lowestSequenceNumberMap.get(deliveryDroneID);\\n\\t\\t\\t\\tlong deliverySequenceNumber = delivery.getSequenceNumber();\\n\\n\\t\\t\\t\\t//update if necessary\\n\\t\\t\\t\\tif (lowestSequenceSoFar == null || deliverySequenceNumber < lowestSequenceSoFar) {\\n\\t\\t\\t\\t\\tlowestSequenceNumberMap.put(deliveryDroneID, deliverySequenceNumber);\\n\\t\\t\\t\\t\\t//also remove the current entry from the delivery sequence map, regardless from\\n\\t\\t\\t\\t\\t//the fact if we can deliver the current package. Only the lowest sequence number should be\\n\\t\\t\\t\\t\\t//delivered\\n\\t\\t\\t\\t\\tWorldDelivery removedDelivery = deliverySequenceMap.remove(deliveryDroneID);\\n//\\t\\t\\t\\t\\tif (delivery.getDeliveryDroneID().equals(\\\"0\\\")) {\\n//\\t\\t\\t\\t\\t\\tSystem.out.println(\\\"removed delivery: \\\" + removedDelivery);\\n//\\t\\t\\t\\t\\t}\\n\\t\\t\\t\\t} else {\\n\\t\\t\\t\\t\\t//if the sequence number is not lower than the lowest so far, we may not deliver the package, continue\\n\\t\\t\\t\\t\\tcontinue;\\n\\t\\t\\t\\t}\\n\\n\\t\\t\\t\\t//then check if the package can be picked up\\n\\t\\t\\t\\tif (canPickUpPackage(drone, delivery)) {\\n\\t\\t\\t\\t\\t//if so, put the package in the map\\n//\\t\\t\\t\\t\\tif(delivery.getDeliveryDroneID().equals(\\\"0\\\"))\\n//\\t\\t\\t\\t\\t\\tSystem.out.println(\\\"added delivery: \\\" + delivery);\\n\\n\\t\\t\\t\\t\\tdeliverySequenceMap.put(deliveryDroneID, delivery);\\n\\t\\t\\t\\t}\\n\\t\\t\\t\\t//if not we continue\\n\\n\\t\\t\\t}\\n\\n\\t\\t}\\n//\\t\\tSystem.out.println(\\\"all drones that will load a package: \\\" + deliverySequenceMap.keySet());\\n\\t\\t//after the loop, load the packages for all the drones\\n\\t\\tfor (String deliveryID : deliverySequenceMap.keySet()) {\\n\\t\\t\\t//get the corresponding drone\\n\\t\\t\\tWorldDelivery delivery = deliverySequenceMap.get(deliveryID);\\n\\t\\t\\tString deliveryDroneID = delivery.getDeliveryDroneID();\\n\\t\\t\\tDrone drone = droneMap.get(deliveryDroneID);\\n\\t\\t\\tdrone.loadPackage(delivery);\\n\\t\\t}\\n\\t}\",\n \"public void checkAuctions() {\\n\\n checkDutchAuctions();\\n checkSecondPriceAuctions();\\n }\",\n \"private void checkUpdateCheckTriggered(PackageVersions packageVersions) {\\n // Assert the PackageTracker attempted to trigger an update.\\n mFakeIntentHelper.assertUpdateTriggered();\\n\\n // If an update check was triggered reliability triggering should always be enabled to\\n // ensure that it can be completed if it fails.\\n mFakeIntentHelper.assertReliabilityTriggerScheduled();\\n\\n // Check the expected storage state.\\n checkPackageStorageStatus(PackageStatus.CHECK_STARTED, packageVersions);\\n }\",\n \"void check_and_send(){\\r\\n\\t\\twhile(not_ack_yet <= WINDOW_SIZE){\\r\\n\\t\\t\\tif(covered_datagrams >= total_datagrams)\\r\\n\\t\\t\\t\\treturn;\\r\\n\\t\\t\\t//send one data more\\r\\n\\t\\t\\tcovered_datagrams++;\\r\\n\\t\\t\\tbyte[] data_to_send = Helper.get_bytes(data_send,(covered_datagrams-1)*BLOCK_SIZE,BLOCK_SIZE);\\r\\n\\t\\t\\tDataDatagram send = new DataDatagram((short)the_connection.session_num,\\r\\n\\t\\t\\t\\t\\t(short)(covered_datagrams),data_to_send,the_connection);\\r\\n\\t\\t\\tsend.send_datagram();\\r\\n\\t\\t\\tput_and_set_timer(send);\\r\\n\\t\\t}\\r\\n\\t}\",\n \"private boolean checkDependenciesSatisfied() {\\n\\t\\tLOGGER.trace(\\\"CheckDependenciesSatisfied: Start Checking\\\");\\n\\t\\tfinal Collection moduleDependencies = selfModule.getDependencies();\\n\\t\\tif (moduleDependencies == null) {\\n\\t\\t\\treturn true;\\n\\t\\t}\\n\\t\\tfor (final ModuleDependency moduleDependency : moduleDependencies) {\\n\\t\\t\\tif (!peerDiscoveryService.getPeerRegistry().containsPeerWithType(moduleDependency.getModuleTypeId(), true)) {\\n\\t\\t\\t\\treturn false;\\n\\t\\t\\t}\\n\\t\\t}\\n\\t\\treturn true;\\n\\t}\",\n \"boolean isAllInDownloadedArea();\",\n \"private void unloadPackages(Set drones){\\n\\t\\t//loop trough all the drones, check if they carry any packages\\n\\t\\tfor(Drone drone: drones){\\n\\t\\t\\tif(drone.isDelivering()){\\n\\t\\t\\t\\t//check if the drone can deliver the package\\n\\t\\t\\t\\tif(canDeliverPackage(drone)){\\n\\t\\t\\t\\t//unload the package\\n\\t\\t\\t\\tdrone.unloadPackage();\\n\\t\\t\\t\\t}\\n\\t\\t\\t}\\n\\t\\t}\\n\\n\\t\\t//all the packages are unloaded\\n\\t}\",\n \"public boolean needsRepairing() {\\n boolean returner = false;\\n for (Pouch pouch : pouchesUsed) {\\n returner = returner || pouch.needsRepair();\\n }\\n return returner;\\n }\",\n \"public boolean isToDeploy() {\\r\\n\\t\\treturn attachUpdates>0 || catUpdates>0 || catTransUpdates>0 || prodUpdates>0 || prodTransUpdates>0 || menuUpdates>0;\\r\\n\\t}\",\n \"@Override\\r\\n\\tpublic boolean isAllHit() {\\r\\n\\t\\treturn priorityElements.isEmpty();\\r\\n\\t}\",\n \"public boolean isAvailable(){\\r\\n return blockingQueue.size() < maxWorkQueueSize;\\r\\n }\",\n \"public boolean allPlayersReady() {\\r\\n for (Player player : players) {\\r\\n if (!player.isReady()) {\\r\\n return false;\\r\\n }\\r\\n }\\r\\n return true;\\r\\n }\",\n \"public boolean isInflated() {\\n // TODO(cgavidia): This rule needs to be improved!\\n\\n boolean fixIsDelayed = false;\\n\\n if (this.isReportedSevere()) {\\n fixIsDelayed = isFixDelayed(MAXIMUM_RELEASES_FOR_SEVERE);\\n }\\n\\n if (this.isReportedDefault()) {\\n fixIsDelayed = isFixDelayed(MAXIMUM_RELEASES_FOR_DEFAULT);\\n }\\n\\n boolean fixIsRejected = isFixRejected();\\n boolean issueIsIgnored = isIssueIgnored();\\n\\n return fixIsDelayed || fixIsRejected || issueIsIgnored;\\n }\",\n \"public void checkNotificationBroadcastSupport() {\\n int i = 0;\\n this.mShouldBroadcastNotifications = false;\\n WallpaperManager wallpaperManager = (WallpaperManager) this.mContext.getSystemService(WallpaperManager.class);\\n if (wallpaperManager != null) {\\n WallpaperInfo wallpaperInfo = wallpaperManager.getWallpaperInfo();\\n if (wallpaperInfo != null) {\\n ComponentName component = wallpaperInfo.getComponent();\\n String packageName = component.getPackageName();\\n if (NOTIFYABLE_PACKAGES.contains(packageName)) {\\n this.mWallpaperPackage = packageName;\\n String className = component.getClassName();\\n String[] strArr = NOTIFYABLE_WALLPAPERS;\\n int length = strArr.length;\\n while (true) {\\n if (i >= length) {\\n break;\\n } else if (className.startsWith(strArr[i])) {\\n this.mShouldBroadcastNotifications = true;\\n break;\\n } else {\\n i++;\\n }\\n }\\n }\\n }\\n }\\n }\",\n \"public void ondemandSetupIsDone();\",\n \"public boolean isDeliverable() {\\n if (getMode().isCollection() || !isCarried()) return false;\\n return Map.isSameLocation(plan.cdst, carrier.getLocation());\\n }\",\n \"@Override\\n\\t\\tpublic boolean deliverSelfNotifications() {\\n\\t\\t\\treturn super.deliverSelfNotifications();\\n\\t\\t}\",\n \"private boolean isPackValid() {\\n\\t\\treturn (logData != null\\n\\t\\t\\t\\t&& logData.entries != null\\n\\t\\t\\t\\t&& logData.entries.size() > 1);\\n\\t}\",\n \"@Test\\r\\n\\tpublic void testDeliveryChuteFull() {\\r\\n\\t\\tdcListen.chuteFull(vend.getDeliveryChute());\\r\\n\\t\\tassertTrue(vend.getDeliveryChute().isDisabled());\\r\\n\\t}\",\n \"@Override\\r\\n\\tpublic void makeDeliveryFree() {\\n\\t\\t\\r\\n\\t}\",\n \"protected final boolean anyMsg() {\\n\\t\\tDoorPulseCriterion dpc = new DoorPulseCriterion(this.getPulse() - 1);\\n\\t\\treturn this.existMessage(dpc);\\n\\t}\",\n \"public synchronized boolean checkFileCompletion()\\n/* */ {\\n/* 49 */ int totalsize = 0;\\n/* */ \\n/* 51 */ for (FileSubContent subContent : this.downloadManager.getSUB_CONTENTS())\\n/* */ {\\n/* 53 */ if ((subContent != null) && (subContent.isIsDownloaded()) && (subContent.getContent().length == this.downloadManager.getSUB_SIZE()))\\n/* */ {\\n/* 55 */ totalsize++;\\n/* */ }\\n/* */ }\\n/* */ \\n/* 59 */ if (totalsize == this.downloadManager.getSUB_CONTENTS().size())\\n/* */ {\\n/* 61 */ System.out.println(\\\"FileDownloadChecker: got all of the subParts.\\\");\\n/* 62 */ return true;\\n/* */ }\\n/* */ \\n/* */ \\n/* 66 */ return false;\\n/* */ }\",\n \"@Override\\n public void deliveryComplete(IMqttDeliveryToken imdt) {\\n System.out.println(\\\"在完成消息传递并收到所有确认后调用。\\\");\\n }\",\n \"public boolean isPushAvailable() {\\n checkUsbLibState();\\n return listDevices().size() > 0;\\n }\",\n \"public boolean canLCBdeliver(Message message) {\\n\\n\\t\\tboolean canLCBdeliver = true;\\n\\n\\t\\tArrayList messageVC = message.getVectorClock();\\n\\t\\tArrayList processVC = p.getVectorClock();\\n\\n\\t\\tif (processVC.get(message.getSender() - 1) != message.getId() - 1) {\\n\\t\\t\\tcanLCBdeliver = false;\\n\\t\\t}\\n\\t\\tfor (Integer i = 0; i < messageVC.size(); i++) {\\n\\t\\t\\tif (messageVC.get(i) > processVC.get(i)) {\\n\\t\\t\\t\\tcanLCBdeliver = false;\\n\\t\\t\\t\\tbreak;\\n\\t\\t\\t}\\n\\t\\t}\\n\\n\\t\\treturn canLCBdeliver;\\n\\t}\",\n \"public boolean hasRequests(){\\n return (tradeRequests.size() > 0 || userRequests.size() > 0);\\n }\",\n \"public boolean isComplete() {\\n /* first a simple check */\\n if(number_of_frags_recvd < fragments.length)\\n return false;\\n\\n /* then double-check just in case */\\n for(Message msg: fragments) {\\n if(msg == null)\\n return false;\\n }\\n return true;\\n }\",\n \"public boolean availableServer(){\\n for(int i = 0; i < cntServer; i++){\\n if(serverArray[i].busy == false){return true;}\\n }\\n return false;\\n }\",\n \"public void msgKitIsGood(AgentKit kit) {\\n\\t\\tfor(MyKit mk: myKits){\\n\\t\\t\\tif(mk.kit.equals(kit)){\\n\\t\\t\\t\\tmk.status = KitStatus.Ready_For_Delivery;\\n\\t\\t\\t\\tstateChanged();\\n\\t\\t\\t\\treturn;\\n\\t\\t\\t}\\n\\t\\t}\\n\\t}\",\n \"public boolean isComplete() {\\n return addedFrontWork.size() == 0 && addedBackWork.size() == 0 && sawAllDone.get();\\n }\",\n \"private void check() {\\n ShedSolar.instance.haps.post( Events.WEATHER_REPORT_MISSED );\\n LOGGER.info( \\\"Failed to receive weather report\\\" );\\n\\n // check again...\\n startChecker();\\n }\",\n \"protected void checkNotifications() {\\n List polled;\\n boolean onlyOne;\\n\\n // Leave this mutually exclusive section as fast as possible...\\n lock.lock();\\n try {\\n if (stopped) {\\n LOGGER.debug(\\\"Push notification service stopped. Aborting polling of queue...\\\");\\n return;\\n }\\n\\n PushNotification first = submittedNotifcations.poll();\\n if (null == first) {\\n // Queue has no notification with an expired delay\\n LOGGER.debug(\\\"Queue has no notification with an expired delay and holds {} buffered notifications\\\", I(submittedNotifcations.size()));\\n return;\\n }\\n\\n // Check for more\\n PushNotification notification = submittedNotifcations.poll();\\n if (notification != null) {\\n polled = new LinkedList<>();\\n polled.add(first);\\n LOGGER.debug(\\\"Polled notification \\\\\\\"{}\\\\\\\" for user {} in context {} from queue\\\", first.getTopic(), I(first.getUserId()), I(first.getContextId()));\\n do {\\n polled.add(notification);\\n LOGGER.debug(\\\"Polled notification \\\\\\\"{}\\\\\\\" for user {} in context {} from queue\\\", notification.getTopic(), I(notification.getUserId()), I(notification.getContextId()));\\n notification = submittedNotifcations.poll();\\n } while (null != notification);\\n onlyOne = false;\\n } else {\\n polled = Collections.singletonList(first);\\n LOGGER.debug(\\\"Polled notification \\\\\\\"{}\\\\\\\" for user {} in context {} from queue\\\", first.getTopic(), I(first.getUserId()), I(first.getContextId()));\\n onlyOne = true;\\n }\\n\\n if (submittedNotifcations.isEmpty()) {\\n cancelTimerTask();\\n LOGGER.debug(\\\"Dropped polling timer task since queue is currently empty\\\");\\n }\\n } finally {\\n lock.unlock();\\n }\\n\\n if (onlyOne) {\\n // There was only a single one available\\n PushNotification first = polled.get(0);\\n NotificationsHandler task = new NotificationsHandler(first);\\n if (tryExecuteTask(task, first.getUserId(), first.getContextId())) {\\n LOGGER.debug(\\\"Submitted delivery of polled notification with topic \\\\\\\"{}\\\\\\\" to user {} in context {}\\\", first.getTopic(), I(first.getUserId()), I(first.getContextId()));\\n } else {\\n // Processor rejected task execution. Perform with current thread.\\n task.run();\\n }\\n } else {\\n // Handle them all\\n Map>> polledNotificationsPerContextAndTopic = new LinkedHashMap<>();\\n for (PushNotification notification : polled) {\\n put(notification, polledNotificationsPerContextAndTopic);\\n }\\n for (Map.Entry>> entry : polledNotificationsPerContextAndTopic.entrySet()) {\\n ContextAndTopicKey key = entry.getKey();\\n Map> notificationsPerUser = entry.getValue();\\n NotificationsHandler task = new NotificationsHandler(key.contextId, key.topic, notificationsPerUser);\\n if (tryExecuteTask(task, -1, key.contextId)) {\\n if (LOGGER.isDebugEnabled()) {\\n int[] userIds = Coll2i(notificationsPerUser.keySet());\\n Object sUserIds = userIds.length <= 10 ? toStringObjectFor(userIds) : null;\\n userIds = null;\\n if (sUserIds == null) {\\n LOGGER.debug(\\\"Submitted delivery of polled notifications with topic \\\\\\\"{}\\\\\\\" to users in context {}\\\", key.topic, I(key.contextId));\\n } else {\\n LOGGER.debug(\\\"Submitted delivery of polled notifications with topic \\\\\\\"{}\\\\\\\" to users {} in context {}\\\", key.topic, sUserIds, I(key.contextId));\\n }\\n }\\n } else {\\n // Processor rejected task execution. Perform with current thread.\\n task.run();\\n }\\n }\\n }\\n }\",\n \"private boolean dateAvailable(List dateGroups) {\\n final int NOT_AVAILABLE = 0;\\n return dateGroups.size() > NOT_AVAILABLE;\\n }\",\n \"@Override\\n\\tpublic boolean done() {\\n\\t\\tfor(Task t : details.getPendingTasks()){\\n\\t\\t\\tif(!t.isComplete())\\n\\t\\t\\t\\treturn false;\\n\\t\\t}\\n\\t\\treturn true;\\n\\t}\",\n \"public boolean isDeployed(){\\n return !places.isEmpty();\\n }\",\n \"private void checkForShutdown() {\\n\\t\\tif (0==(0xFFF&iteration++)) {\\n\\t\\t\\t///////we have no work and we are not blocked.\\n\\t\\t\\t//must check for shutdown case\\n\\t\\t\\tint i = requestInputs.length;\\n\\t\\t\\twhile (--i>=0) {\\n\\t\\t\\t\\tPipe p = requestInputs[i];\\n\\t\\t\\t\\tif (!Pipe.peekMsg(p,-1)) {\\n\\t\\t\\t\\t\\treturn;//this one was not shut down yet\\n\\t\\t\\t\\t}\\t\\t\\t\\n\\t\\t\\t}\\n\\t\\t\\tint j = responseInputs.length;\\n\\t\\t\\twhile (--j>=0) {\\n\\t\\t\\t\\tPipe p = responseInputs[j];\\n\\t\\t\\t\\tif (!Pipe.peekMsg(p,-1)) {\\n\\t\\t\\t\\t\\treturn;//this one was not shut down yet\\n\\t\\t\\t\\t}\\t\\t\\t\\n\\t\\t\\t}\\n\\t\\t\\t//all the pipes have now requested shutdown\\n\\t\\t\\tif (Pipe.hasRoomForWrite(output)) {\\n\\t\\t\\t\\tPipe.publishEOF(output); //tell downstream to shutdown\\n\\t\\t\\t\\trequestShutdown(); //shutdown myself\\t\\t\\t\\n\\t\\t\\t} else {\\n\\t\\t\\t\\treturn;//try again later\\n\\t\\t\\t}\\n\\t\\t}\\n\\t}\",\n \"@Override\\n public boolean isReady() {\\n return (running && !opening) || packetQueue.size() > 0;\\n }\",\n \"public boolean isAvailable() throws KKException\\r\\n {\\r\\n return isAvailable(MODULE_PAYMENT_CYBERSOURCESA_STATUS);\\r\\n }\",\n \"private void movePackages(){\\n\\t\\t//get the package set\\n\\t\\tSet droneSet = this.getDroneSet();\\n\\t\\tPackageService packageService = this.getPackageService();\\n\\t\\t//get all the packages that need to be delivered and are assigned a drone (these are the only\\n\\t\\t//ones that need to be loaded and unloaded\\n//\\t\\tSet packages = packageService.getAllUndeliveredAssignedWorldDeliveries();\\n\\t\\tSet packages = packageService.getSubmittedWorldDeliveries();\\n\\t\\t//first check if all the drones can unload their packages\\n\\n\\t\\tunloadPackages(droneSet);\\n\\t\\t//then load all the packages\\n\\t\\tloadPackages(droneSet, packages);\\n\\n\\t}\",\n \"boolean isAvailable();\",\n \"boolean isAvailable();\",\n \"boolean isAvailable();\",\n \"boolean isAvailable();\",\n \"public boolean allSunken() {\\n\\t\\tfor (Ship s : ships) {\\n\\t\\t\\tif (!s.isSunk()) {\\n\\t\\t\\t\\treturn false;\\n\\t\\t\\t}\\n\\t\\t}\\n\\t\\treturn true;\\n\\t}\",\n \"public void checkEvents()\\n\\t{\\n\\t\\t((MBoxStandalone)events).processMessages();\\n\\t}\",\n \"@Override\\n\\t\\tboolean needsAck() {\\n\\t\\t\\treturn byteChunks.length > 0; // don't retry empty ack\\n\\t\\t}\",\n \"private boolean hasServerRemovedAllElements() {\\n return getNumElementsRemoved() >= getNumElementsToRemove();\\n }\",\n \"private void check() {\\r\\n\\t\\tif(isEmpty()){\\r\\n\\t\\t\\tthrow new RuntimeException(\\\"Queue is empty\\\");\\r\\n\\t\\t}\\r\\n\\t}\",\n \"boolean isSetupDone();\",\n \"public boolean isPackageInstalled(String packageName) {\\n boolean flag = false;\\n List packageInfoList = mPackageManager.getInstalledPackages(0);\\n for (int i = 0; i < packageInfoList.size(); i++) {\\n if (packageName.equals(packageInfoList.get(i).packageName)) {\\n flag = true;\\n break;\\n }\\n }\\n\\n if (isregister) {\\n mContext.unregisterReceiver(mReceiver);\\n isregister = false;\\n }\\n\\n return flag;\\n }\",\n \"public void testParse_empty() {\\n DumpsysPackageReceiver parser = new DumpsysPackageReceiver();\\n assertEquals(0, parser.getPackages().size());\\n }\",\n \"boolean hasHasDeployedAirbag();\",\n \"protected boolean rebootAllWithDNS() throws Throwable {\\n return (pingFromMaster(hostname) &&\\n rebootAndWait(\\\"all\\\") &&\\n pingFromMaster(hostname));\\n }\",\n \"public boolean hasPackageName() {\\n return ((bitField0_ & 0x00000002) == 0x00000002);\\n }\",\n \"protected void deliverMessages()\\n {\\n Set envelopes = messengerDao.getEnvelopes();\\n\\n Map> peerEnvelopesMap = Maps.newHashMap();\\n int maxTimeToLive = 0;\\n //distribute envelops to peers\\n for ( Envelope envelope : envelopes )\\n {\\n if ( envelope.getTimeToLive() > maxTimeToLive )\\n {\\n maxTimeToLive = envelope.getTimeToLive();\\n }\\n Set peerEnvelopes = peerEnvelopesMap.get( envelope.getTargetPeerId() );\\n if ( peerEnvelopes == null )\\n {\\n //sort by createDate asc once more\\n peerEnvelopes = new TreeSet<>( new Comparator()\\n {\\n @Override\\n public int compare( final Envelope o1, final Envelope o2 )\\n {\\n return o1.getCreateDate().compareTo( o2.getCreateDate() );\\n }\\n } );\\n peerEnvelopesMap.put( envelope.getTargetPeerId(), peerEnvelopes );\\n }\\n\\n peerEnvelopes.add( envelope );\\n }\\n\\n\\n //try to send messages in parallel - one thread per peer\\n try\\n {\\n for ( Map.Entry> envelopsPerPeer : peerEnvelopesMap.entrySet() )\\n {\\n Peer targetPeer = messenger.getPeerManager().getPeer( envelopsPerPeer.getKey() );\\n if ( targetPeer.isLocal() )\\n {\\n completer.submit(\\n new LocalPeerMessageSender( messenger, messengerDao, envelopsPerPeer.getValue() ) );\\n }\\n else\\n {\\n completer.submit(\\n new RemotePeerMessageSender( messengerDao, targetPeer, envelopsPerPeer.getValue() ) );\\n }\\n }\\n\\n //wait for completion\\n try\\n {\\n for ( int i = 0; i < peerEnvelopesMap.size(); i++ )\\n {\\n Future future = completer.take();\\n future.get();\\n }\\n }\\n catch ( InterruptedException | ExecutionException e )\\n {\\n LOG.warn( \\\"ignore\\\", e );\\n }\\n }\\n catch ( PeerException e )\\n {\\n LOG.error( e.getMessage(), e );\\n }\\n }\",\n \"private boolean queueFullError() {\\n\\t\\tSystem.out.println(\\\"Queue Full!!!\\\");\\n\\t\\treturn false;\\n\\t}\",\n \"boolean hasQos();\",\n \"boolean isPendingToRead();\",\n \"private void checkBuyCard(PropertyCard card) {\\n\\t\\tboolean almostComplete = checkCollection(this, card);\\n\\t\\tif(almostComplete) {\\n\\t\\t\\tboolean boughtCard = buyCard(card);\\n\\t\\t\\tif(!boughtCard) {\\n\\t\\t\\t\\tboolean madeChanges = checkPayment(card.getPrice());\\n\\t\\t\\t\\tif(madeChanges) {\\n\\t\\t\\t\\t\\tbuyCard(card);\\n\\t\\t\\t\\t}\\n\\t\\t\\t}\\n\\t\\t}\\n\\t\\telse {\\n\\t\\t\\tboolean opponentAlmostComplete = false;\\n\\t\\t\\tfor(Player p: getPlayers()) {\\n\\t\\t\\t\\tif(checkCollection(p,card)) {\\n\\t\\t\\t\\t\\topponentAlmostComplete = true;\\n\\t\\t\\t\\t\\tbreak;\\n\\t\\t\\t\\t}\\n\\t\\t\\t}\\n\\t\\t\\tif(opponentAlmostComplete) {\\n\\t\\t\\t\\tbuyCard(card);\\n\\t\\t\\t}\\n\\t\\t\\telse {\\n\\t\\t\\t\\tif(getMoney()-card.getPrice()>=100) {\\n\\t\\t\\t\\t\\tbuyCard(card);\\n\\t\\t\\t\\t}\\n\\t\\t\\t}\\n\\t\\t}\\n\\t}\",\n \"boolean needsAck() { return true; }\",\n \"@Override\\r\\n public boolean checkAllDecksEmpty(int plDeckPosition) {\\r\\n // Are all the decks empty\\r\\n boolean flag = true;\\r\\n \\r\\n // Loop through all decks at deck position for each player\\r\\n for (Player player : this.players) {\\r\\n if (!player.isDeckEmpty(plDeckPosition)) {\\r\\n flag = false;\\r\\n }\\r\\n }\\r\\n \\r\\n // Return the value\\r\\n return flag;\\r\\n }\",\n \"public boolean isAvailable(){\\n\\t\\ttry{\\n\\t\\t\\tgetPrimingsInternal(\\\"Test\\\", \\\"ATGATGATGATGATGATGATG\\\");\\n\\t\\t}\\n\\t\\tcatch(IOException e){\\n\\t\\t\\treturn false;\\n\\t\\t}\\n\\t\\tcatch(InterruptedException e){\\n\\t\\t\\treturn false;\\n\\t\\t}\\n\\t\\treturn true;\\n\\t}\",\n \"private boolean queueFirstServerIfDown(List allServers) {\\n if (allServers.size() < 2) {\\n return false;\\n }\\n URI uri = allServers.get(0);\\n HttpGet httpGet = new HttpGet(uri);\\n\\n RequestConfig config = RequestConfig.custom()\\n .setConnectTimeout((int) PING_REQUEST_TIMEOUT.toMillis())\\n .setConnectionRequestTimeout((int) PING_REQUEST_TIMEOUT.toMillis())\\n .setSocketTimeout((int) PING_REQUEST_TIMEOUT.toMillis()).build();\\n httpGet.setConfig(config);\\n\\n try (CloseableHttpResponse response = client.execute(httpGet)) {\\n if (response.getStatusLine().getStatusCode() == 200) {\\n return false;\\n }\\n\\n } catch (IOException e) {\\n // We ignore this, if server is restarting this might happen.\\n }\\n // Some error happened, move this server to the back. The other servers should be running.\\n Collections.rotate(allServers, -1);\\n return true;\\n }\",\n \"protected void checkTransmissionRequirements()\\n {\\n if (isOutOfBandAlert())\\n { // Out-of-band (OOB) transmission requirements\\n if (this.alert_text == null && this.details_OOB_source_ID == 0)\\n { // [SCTE 18] 6-3\\n if (log.isInfoEnabled())\\n {\\n log.info(formatLogMessage(\\\"SCTE-18: OOB alert requires alert text or a details source ID\\\"));\\n }\\n }\\n else if (this.alert_priority > EASMessage.ALERT_PRIORITY_HIGH)\\n {\\n if (this.details_OOB_source_ID == 0)\\n { // [SCTE 18] 6-5\\n if (log.isInfoEnabled())\\n {\\n log.info(formatLogMessage(\\\"SCTE-18: OOB maximum priority alert requires a details source ID\\\"));\\n }\\n }\\n else if (this.alert_text != null && this.audio_OOB_source_ID == 0)\\n { // [SCTE 18] 6-7\\n if (log.isInfoEnabled())\\n {\\n log.info(formatLogMessage(\\\"SCTE-18: OOB maximum priority alert with alert text requires an audio source ID\\\"));\\n }\\n }\\n }\\n }\\n else\\n { // In-band (IB) transmission requirements\\n if (this.alert_text == null && this.details_major_channel_number == 0\\n && this.details_minor_channel_number == 0)\\n { // [SCTE 18] 6-2\\n if (log.isInfoEnabled())\\n {\\n log.info(formatLogMessage(\\\"SCTE-18: IB alert requires alert text or a details channel\\\"));\\n }\\n }\\n else if (this.alert_priority > EASMessage.ALERT_PRIORITY_HIGH && this.details_major_channel_number == 0\\n && this.details_minor_channel_number == 0)\\n { // [SCTE 18] 6-4\\n if (log.isInfoEnabled())\\n {\\n log.info(formatLogMessage(\\\"SCTE-18: IB maximum priority alert requires a details channel\\\"));\\n }\\n }\\n }\\n }\",\n \"private void checkUpdateCheckSuccessful(PackageVersions packageVersions) {\\n mFakeIntentHelper.assertReliabilityTriggerNotScheduled();\\n\\n // Assert the storage was updated.\\n checkPackageStorageStatus(PackageStatus.CHECK_COMPLETED_SUCCESS, packageVersions);\\n\\n // Peek inside the package tracker to make sure it is tracking failure counts properly.\\n assertEquals(0, mPackageTracker.getCheckFailureCountForTests());\\n }\",\n \"boolean hasSender();\",\n \"boolean hasSender();\",\n \"boolean hasSender();\",\n \"boolean hasSender();\"\n]"},"negative_scores":{"kind":"list like","value":["0.6258956","0.6219398","0.6125592","0.6048389","0.602688","0.59318316","0.59318316","0.58981454","0.58689976","0.5848269","0.5836706","0.5832282","0.5829562","0.582522","0.5823706","0.57344985","0.56778383","0.56734735","0.5609354","0.5607837","0.559741","0.55384016","0.55374455","0.55341613","0.5532018","0.5530861","0.5518211","0.55178756","0.55059737","0.5504106","0.55038464","0.5490774","0.54713225","0.546925","0.5462336","0.5462007","0.5449267","0.54428977","0.54312164","0.54240626","0.5423758","0.5416089","0.5363156","0.5356562","0.53537995","0.5347903","0.534706","0.5338566","0.53086996","0.53056437","0.53027713","0.53023654","0.5298491","0.5298125","0.5286424","0.52776873","0.5276542","0.5275001","0.52659744","0.5259605","0.5257385","0.52405244","0.5235637","0.52314687","0.5230712","0.52268654","0.5224412","0.52221125","0.5209167","0.520609","0.5200226","0.5200226","0.5200226","0.5200226","0.51998544","0.5189998","0.5185988","0.5181262","0.5177093","0.51725554","0.5171321","0.51602566","0.51559675","0.51558924","0.5154809","0.5146026","0.514578","0.514368","0.51373196","0.5129983","0.5122129","0.51205295","0.5113866","0.5109179","0.51041883","0.51030546","0.50985986","0.50985986","0.50985986","0.50985986"],"string":"[\n \"0.6258956\",\n \"0.6219398\",\n \"0.6125592\",\n \"0.6048389\",\n \"0.602688\",\n \"0.59318316\",\n \"0.59318316\",\n \"0.58981454\",\n \"0.58689976\",\n \"0.5848269\",\n \"0.5836706\",\n \"0.5832282\",\n \"0.5829562\",\n \"0.582522\",\n \"0.5823706\",\n \"0.57344985\",\n \"0.56778383\",\n \"0.56734735\",\n \"0.5609354\",\n \"0.5607837\",\n \"0.559741\",\n \"0.55384016\",\n \"0.55374455\",\n \"0.55341613\",\n \"0.5532018\",\n \"0.5530861\",\n \"0.5518211\",\n \"0.55178756\",\n \"0.55059737\",\n \"0.5504106\",\n \"0.55038464\",\n \"0.5490774\",\n \"0.54713225\",\n \"0.546925\",\n \"0.5462336\",\n \"0.5462007\",\n \"0.5449267\",\n \"0.54428977\",\n \"0.54312164\",\n \"0.54240626\",\n \"0.5423758\",\n \"0.5416089\",\n \"0.5363156\",\n \"0.5356562\",\n \"0.53537995\",\n \"0.5347903\",\n \"0.534706\",\n \"0.5338566\",\n \"0.53086996\",\n \"0.53056437\",\n \"0.53027713\",\n \"0.53023654\",\n \"0.5298491\",\n \"0.5298125\",\n \"0.5286424\",\n \"0.52776873\",\n \"0.5276542\",\n \"0.5275001\",\n \"0.52659744\",\n \"0.5259605\",\n \"0.5257385\",\n \"0.52405244\",\n \"0.5235637\",\n \"0.52314687\",\n \"0.5230712\",\n \"0.52268654\",\n \"0.5224412\",\n \"0.52221125\",\n \"0.5209167\",\n \"0.520609\",\n \"0.5200226\",\n \"0.5200226\",\n \"0.5200226\",\n \"0.5200226\",\n \"0.51998544\",\n \"0.5189998\",\n \"0.5185988\",\n \"0.5181262\",\n \"0.5177093\",\n \"0.51725554\",\n \"0.5171321\",\n \"0.51602566\",\n \"0.51559675\",\n \"0.51558924\",\n \"0.5154809\",\n \"0.5146026\",\n \"0.514578\",\n \"0.514368\",\n \"0.51373196\",\n \"0.5129983\",\n \"0.5122129\",\n \"0.51205295\",\n \"0.5113866\",\n \"0.5109179\",\n \"0.51041883\",\n \"0.51030546\",\n \"0.50985986\",\n \"0.50985986\",\n \"0.50985986\",\n \"0.50985986\"\n]"},"document_score":{"kind":"string","value":"0.8266159"},"document_rank":{"kind":"string","value":"0"}}},{"rowIdx":136190,"cells":{"query":{"kind":"string","value":"Getter for the approximated cube path, each cube lies within a probability sphere of 5 meters from the indicated location"},"document":{"kind":"string","value":"public Path getApproxPath() {\n\t\treturn approxPath;\n\t}"},"metadata":{"kind":"string","value":"{\n \"objective\": {\n \"self\": [],\n \"paired\": [],\n \"triplet\": [\n [\n \"query\",\n \"document\",\n \"negatives\"\n ]\n ]\n }\n}"},"negatives":{"kind":"list like","value":["public Polygon getPolygon(double eyeDistance){\n //define the front two verticies of the currentTrack\n Point3D track_vertex0 = currentTrack.getVertex(0);\n Point3D track_vertex1 = currentTrack.getVertex(1);\n //use center point to define the center of the sphape\n int cubeSize = 3;\n\n Point3D front_up_left = new Point3D (centerPoint.x-cubeSize, centerPoint.y-cubeSize, centerPoint.z-cubeSize);\n Point3D front_down_left = new Point3D (centerPoint.x-cubeSize, centerPoint.y+cubeSize, centerPoint.z-cubeSize);\n Point3D front_down_right = new Point3D (centerPoint.x+cubeSize, centerPoint.y+cubeSize, centerPoint.z-cubeSize);\n Point3D front_up_right = new Point3D (centerPoint.x+cubeSize, centerPoint.y-cubeSize, centerPoint.z-cubeSize);\n\n Point3D back_up_left = new Point3D (front_up_left.x, front_up_left.y, centerPoint.z+cubeSize);\n Point3D back_down_left = new Point3D (front_down_left.x, front_down_left.y, centerPoint.z+cubeSize);\n Point3D back_down_right = new Point3D (front_down_right.x, front_down_right.y, centerPoint.z+cubeSize);\n Point3D back_up_right = new Point3D (front_up_right.x, front_up_right.y, centerPoint.z+cubeSize);\n\n //aranges verticies in the order they will be drawn\n Point3D[] cube_verticies = {front_up_left, front_down_left, front_down_right, front_up_right,\n front_up_left, back_up_left, back_up_right, front_up_right,\n front_down_right, back_down_right, back_up_right, back_down_right,\n back_down_left, back_up_left, back_down_left, front_down_left};\n\n int[] x_points = new int[16];\n int[] y_points = new int[16];\n //convert 3D points to 2D points\n for(int i=0;i<16;i++){\n if(cube_verticies[i].z <= 200){ //same fix as for the track positioning\n x_points[i] = (int) -cube_verticies[i].projectPoint3D(eyeDistance).getX();\n y_points[i] = (int) cube_verticies[i].projectPoint3D(eyeDistance).getY();\n }\n else{\n x_points[i] = (int) cube_verticies[i].projectPoint3D(eyeDistance).getX();\n y_points[i] = (int) cube_verticies[i].projectPoint3D(eyeDistance).getY();\n }\n }\n Polygon polygon = new Polygon(x_points, y_points, 16);\n return polygon;\n }","static void trial4() {\n ModelBuilder modelBuilder = new ModelBuilder();\n Model cubeModel = modelBuilder.createBox(\n 5f,\n 5f,\n 5f,\n new Material( ColorAttribute.createDiffuse(Color.GREEN) ),\n Usage.Position);\n Mesh cubeMesh = cubeModel.meshes.get(0);\n\n // There are 36 vertex indices\n // I take it this is because there are 2 triangle per face\n // 3 x 2 x 6 = 36\n System.err.println(cubeMesh.getNumIndices());\n\n short[] cubeIndices = new short[36];\n cubeMesh.getIndices(cubeIndices);\n for (int i = 0; i < 36; i+=3) {\n for (int j = 0; j <= 2; j++) {\n System.err.printf(\"%3d \", cubeIndices[i+j]);\n }\n System.err.println();\n }\n\n }","public void computeFractal(){\n\t\tint deltaX =p5.getX()-p1.getX();\n\t\tint deltaY =p5.getY()- p1.getY();\n\t\tint x2= p1.getX()+ (deltaX/3);\n\t\tint y2= p1.getY()+ (deltaY/3);\n\t\tdouble x3=((p1.getX()+p5.getX())/2)+( Math.sqrt(3)*\n\t\t\t\t(p1.getY()-p5.getY()))/6;\n\t\tdouble y3=((p1.getY()+p5.getY())/2)+( Math.sqrt(3)*\n\t\t\t\t(p5.getX()-p1.getX()))/6;\n\t\tint x4= p1.getX()+((2*deltaX)/3);\n\t\tint y4= p1.getY()+((2*deltaY)/3);\n\t\tthis.p2= new Point(x2,y2);\n\t\tthis.p3= new Point((int)x3,(int)y3);\n\t\tthis.p4= new Point(x4,y4);\n\t}","private double solveQuadraticInside(Location location) {\n\t\tint iPlus = imposeBorder(location.i + 1, _iSize);\r\n\t\tint iMinus = imposeBorder(location.i - 1, _iSize);\r\n\t\tint jPlus = imposeBorder(location.j + 1, _iSize);\r\n\t\tint jMinus = imposeBorder(location.j - 1, _iSize);\r\n\t\t//\r\n\t\tdouble ux1 = -_levelSet[iPlus][location.j];\r\n\t\tdouble ux2 = -_levelSet[iMinus][location.j];\r\n\t\tdouble uy1 = -_levelSet[location.i][jPlus];\r\n\t\tdouble uy2 = -_levelSet[location.i][jMinus];\r\n\t\t//\r\n\t\tdouble ux = Math.min(ux1, ux2);\r\n\t\tdouble uy = Math.min(uy1, uy2);\r\n\t\t// TODO pre-compute\r\n\t\tdouble f = _dx / F;\r\n\t\t//\r\n\t\t// solve the quadratic equation\r\n\t\tdouble a = 2;\r\n\t\tdouble b = -2 * (ux + uy);\r\n\t\tdouble c = ScalarMath.square(ux) + ScalarMath.square(uy)\r\n\t\t\t\t- ScalarMath.square(f);\r\n\t\tdouble delta = ScalarMath.square(b) - 4 * a * c;\r\n\t\t// extraordinary solutions\r\n\t\tdouble u;\r\n\t\tif (Double.isInfinite(ux) | Double.isInfinite(uy) | delta < 0) {\r\n\t\t\tif (Double.isInfinite(ux))\r\n\t\t\t\tu = uy;\r\n\t\t\telse if (Double.isInfinite(uy))\r\n\t\t\t\tu = ux;\r\n\t\t\telse\r\n\t\t\t\t// the case where (delta < 0), which produces a\r\n\t\t\t\t// imaginary root\r\n\t\t\t\tu = Math.min(ux, uy);\r\n\t\t\treturn -(u + f);\r\n\t\t}\r\n\t\tdouble sol1 = (-b + Math.sqrt(delta)) / (2 * a);\r\n\t\tdouble sol2 = (-b - Math.sqrt(delta)) / (2 * a);\r\n\t\treturn -(Math.max(sol1, sol2));\r\n\t}","private static ArrayList geoPath1() {\n return new ArrayList() {\n {\n add(new Coordinates(\"-122.19170793,47.77509422,5.156\"));\n add(new Coordinates(\"-122.19171484,47.77509255,5.476\"));\n add(new Coordinates(\"-122.19172476,47.77509815,5.583\"));\n add(new Coordinates(\"-122.19172741,47.77510382,6.077\"));\n add(new Coordinates(\"-122.19172688,47.77510897,6.424\"));\n add(new Coordinates(\"-122.19172704,47.77511101,6.121\"));\n add(new Coordinates(\"-122.19172543,47.77511046,6.235\"));\n add(new Coordinates(\"-122.19172222,47.77511072,6.225\"));\n add(new Coordinates(\"-122.19172067,47.77510953,5.974\"));\n add(new Coordinates(\"-122.19171935,47.77511130,6.508\"));\n add(new Coordinates(\"-122.19171873,47.77511341,6.090\"));\n add(new Coordinates(\"-122.19171924,47.77511293,5.968\"));\n add(new Coordinates(\"-122.19171637,47.77511664,5.461\"));\n add(new Coordinates(\"-122.19171588,47.77511801,5.518\"));\n add(new Coordinates(\"-122.19171639,47.77511835,5.652\"));\n add(new Coordinates(\"-122.19171667,47.77511857,5.647\"));\n add(new Coordinates(\"-122.19171678,47.77511865,5.648\"));\n add(new Coordinates(\"-122.19172518,47.77511628,6.074\"));\n add(new Coordinates(\"-122.19173954,47.77511533,5.472\"));\n add(new Coordinates(\"-122.19175207,47.77511346,5.836\"));\n add(new Coordinates(\"-122.19176251,47.77510782,5.669\"));\n add(new Coordinates(\"-122.19177163,47.77510015,2.049\"));\n add(new Coordinates(\"-122.19177831,47.77509499,2.910\"));\n add(new Coordinates(\"-122.19178524,47.77509168,2.794\"));\n add(new Coordinates(\"-122.19179816,47.77509009,3.440\"));\n add(new Coordinates(\"-122.19181022,47.77508805,3.016\"));\n add(new Coordinates(\"-122.19182115,47.77508458,5.258\"));\n add(new Coordinates(\"-122.19182976,47.77508305,5.820\"));\n add(new Coordinates(\"-122.19183812,47.77508189,5.615\"));\n add(new Coordinates(\"-122.19184640,47.77507857,3.568\"));\n add(new Coordinates(\"-122.19185497,47.77506742,2.922\"));\n add(new Coordinates(\"-122.19186602,47.77506459,3.923\"));\n add(new Coordinates(\"-122.19187867,47.77506429,3.785\"));\n add(new Coordinates(\"-122.19188979,47.77506426,5.388\"));\n add(new Coordinates(\"-122.19190159,47.77506575,4.811\"));\n add(new Coordinates(\"-122.19191428,47.77506995,3.867\"));\n add(new Coordinates(\"-122.19192458,47.77507421,3.806\"));\n add(new Coordinates(\"-122.19193359,47.77507565,5.697\"));\n add(new Coordinates(\"-122.19194828,47.77507599,6.091\"));\n add(new Coordinates(\"-122.19196187,47.77507556,6.160\"));\n add(new Coordinates(\"-122.19197799,47.77507586,5.827\"));\n add(new Coordinates(\"-122.19199669,47.77507708,6.263\"));\n add(new Coordinates(\"-122.19201547,47.77507900,5.519\"));\n add(new Coordinates(\"-122.19203652,47.77508125,5.318\"));\n add(new Coordinates(\"-122.19205394,47.77508798,4.972\"));\n add(new Coordinates(\"-122.19206817,47.77509514,5.112\"));\n add(new Coordinates(\"-122.19208170,47.77510678,5.183\"));\n add(new Coordinates(\"-122.19209617,47.77511995,6.227\"));\n add(new Coordinates(\"-122.19211126,47.77512566,6.331\"));\n add(new Coordinates(\"-122.19212836,47.77513235,6.249\"));\n add(new Coordinates(\"-122.19214476,47.77513787,7.192\"));\n add(new Coordinates(\"-122.19215712,47.77514375,6.008\"));\n add(new Coordinates(\"-122.19216472,47.77514855,5.879\"));\n add(new Coordinates(\"-122.19217137,47.77514377,6.426\"));\n add(new Coordinates(\"-122.19217457,47.77513335,7.248\"));\n add(new Coordinates(\"-122.19217502,47.77511706,7.483\"));\n add(new Coordinates(\"-122.19218040,47.77510219,10.228\"));\n add(new Coordinates(\"-122.19218656,47.77509117,10.560\"));\n add(new Coordinates(\"-122.19219800,47.77508689,10.466\"));\n add(new Coordinates(\"-122.19221646,47.77507476,11.119\"));\n add(new Coordinates(\"-122.19223178,47.77505389,12.674\"));\n add(new Coordinates(\"-122.19223875,47.77504801,14.667\"));\n add(new Coordinates(\"-122.19224629,47.77504536,13.339\"));\n add(new Coordinates(\"-122.19224798,47.77504041,13.908\"));\n add(new Coordinates(\"-122.19224916,47.77503913,14.065\"));\n add(new Coordinates(\"-122.19225069,47.77503675,14.247\"));\n add(new Coordinates(\"-122.19224858,47.77502843,14.488\"));\n add(new Coordinates(\"-122.19224608,47.77502116,15.172\"));\n add(new Coordinates(\"-122.19224071,47.77501315,15.223\"));\n add(new Coordinates(\"-122.19223317,47.77500694,14.840\"));\n add(new Coordinates(\"-122.19222227,47.77500383,13.775\"));\n add(new Coordinates(\"-122.19221226,47.77499910,12.827\"));\n add(new Coordinates(\"-122.19220317,47.77499372,13.307\"));\n add(new Coordinates(\"-122.19219567,47.77498511,13.107\"));\n add(new Coordinates(\"-122.19219183,47.77497813,13.144\"));\n add(new Coordinates(\"-122.19218998,47.77497165,14.620\"));\n add(new Coordinates(\"-122.19219011,47.77496235,9.166\"));\n add(new Coordinates(\"-122.19218887,47.77495353,8.299\"));\n add(new Coordinates(\"-122.19218520,47.77494321,9.052\"));\n add(new Coordinates(\"-122.19218124,47.77493245,9.915\"));\n add(new Coordinates(\"-122.19218070,47.77492023,9.391\"));\n add(new Coordinates(\"-122.19217970,47.77490970,10.372\"));\n add(new Coordinates(\"-122.19217945,47.77490501,7.722\"));\n add(new Coordinates(\"-122.19217823,47.77489981,8.715\"));\n add(new Coordinates(\"-122.19218090,47.77489589,8.714\"));\n add(new Coordinates(\"-122.19218635,47.77488849,11.030\"));\n add(new Coordinates(\"-122.19219339,47.77487849,13.062\"));\n add(new Coordinates(\"-122.19219717,47.77486996,13.102\"));\n add(new Coordinates(\"-122.19219654,47.77486340,13.562\"));\n add(new Coordinates(\"-122.19219260,47.77485669,14.090\"));\n add(new Coordinates(\"-122.19218765,47.77484862,12.973\"));\n add(new Coordinates(\"-122.19218777,47.77484328,13.137\"));\n add(new Coordinates(\"-122.19218893,47.77483642,13.518\"));\n add(new Coordinates(\"-122.19218715,47.77483230,13.557\"));\n add(new Coordinates(\"-122.19218676,47.77482973,13.560\"));\n add(new Coordinates(\"-122.19218203,47.77482544,12.554\"));\n add(new Coordinates(\"-122.19217214,47.77482073,12.209\"));\n add(new Coordinates(\"-122.19216229,47.77481373,12.975\"));\n add(new Coordinates(\"-122.19215766,47.77481203,10.715\"));\n add(new Coordinates(\"-122.19214837,47.77480695,10.188\"));\n add(new Coordinates(\"-122.19213505,47.77480208,9.988\"));\n add(new Coordinates(\"-122.19212451,47.77479761,10.080\"));\n add(new Coordinates(\"-122.19211571,47.77479427,11.799\"));\n add(new Coordinates(\"-122.19210976,47.77478996,12.827\"));\n add(new Coordinates(\"-122.19211063,47.77478275,12.455\"));\n add(new Coordinates(\"-122.19210867,47.77477966,11.972\"));\n add(new Coordinates(\"-122.19209880,47.77477701,11.224\"));\n add(new Coordinates(\"-122.19208860,47.77477571,11.174\"));\n add(new Coordinates(\"-122.19208772,47.77477829,10.066\"));\n add(new Coordinates(\"-122.19208174,47.77477082,9.116\"));\n add(new Coordinates(\"-122.19207288,47.77476146,6.540\"));\n add(new Coordinates(\"-122.19206631,47.77474937,5.343\"));\n add(new Coordinates(\"-122.19206107,47.77474020,7.509\"));\n add(new Coordinates(\"-122.19205903,47.77473648,7.923\"));\n add(new Coordinates(\"-122.19206261,47.77474166,6.203\"));\n add(new Coordinates(\"-122.19206450,47.77474194,5.918\"));\n add(new Coordinates(\"-122.19205951,47.77473670,4.994\"));\n add(new Coordinates(\"-122.19204892,47.77472567,2.787\"));\n }\n };\n }","public float[][] getPath() {\n/* 825 */ COSBase base = getCOSObject().getDictionaryObject(COSName.PATH);\n/* 826 */ if (base instanceof COSArray) {\n/* */ \n/* 828 */ COSArray array = (COSArray)base;\n/* 829 */ float[][] pathArray = new float[array.size()][];\n/* 830 */ for (int i = 0; i < array.size(); i++) {\n/* */ \n/* 832 */ COSBase base2 = array.getObject(i);\n/* 833 */ if (base2 instanceof COSArray) {\n/* */ \n/* 835 */ pathArray[i] = ((COSArray)array.getObject(i)).toFloatArray();\n/* */ }\n/* */ else {\n/* */ \n/* 839 */ pathArray[i] = new float[0];\n/* */ } \n/* */ } \n/* 842 */ return pathArray;\n/* */ } \n/* 844 */ return (float[][])null;\n/* */ }","private void generateCube() {\n\t\tverts = new Vector[] {new Vector(3), new Vector(3), new Vector(3), new Vector(3), new Vector(3), new Vector(3), new Vector(3), new Vector(3)};\n\t\tverts[0].setElement(0, -1);\n\t\tverts[0].setElement(1, -1);\n\t\tverts[0].setElement(2, -1);\n\t\t\n\t\tverts[1].setElement(0, 1);\n\t\tverts[1].setElement(1, -1);\n\t\tverts[1].setElement(2, -1);\n\t\t\n\t\tverts[2].setElement(0, -1);\n\t\tverts[2].setElement(1, -1);\n\t\tverts[2].setElement(2, 1);\n\t\t\n\t\tverts[3].setElement(0, 1);\n\t\tverts[3].setElement(1, -1);\n\t\tverts[3].setElement(2, 1);\n\t\t\n\t\tverts[4].setElement(0, -1);\n\t\tverts[4].setElement(1, 1);\n\t\tverts[4].setElement(2, -1);\n\t\t\n\t\tverts[5].setElement(0, 1);\n\t\tverts[5].setElement(1, 1);\n\t\tverts[5].setElement(2, -1);\n\t\t\n\t\tverts[6].setElement(0, -1);\n\t\tverts[6].setElement(1, 1);\n\t\tverts[6].setElement(2, 1);\n\t\t\n\t\tverts[7].setElement(0, 1);\n\t\tverts[7].setElement(1, 1);\n\t\tverts[7].setElement(2, 1);\n\t\t\n\t\tfaces = new int[][] {{0, 3, 2}, {0, 1, 3}, {0, 4, 5}, {0, 5, 1}, {0, 2, 6}, {0, 6, 4}, {2, 7, 6}, {2, 3, 7}, {3, 1, 5}, {3, 5, 7}, {4, 7, 5}, {4, 6, 7}}; // List the vertices of each face by index in verts. Vertices must be listed in clockwise order from outside of the shape so that the faces pointing away from the camera can be culled or shaded differently\n\t}","public interface PathCalculationStrategy {\n\t\n\t/**\n\t * Returns the shortest path for a Journey.\n\t * \n\t * @param grid the traffic grid.\n\t * @param src the source location.\n\t * @param dest the destination location.\n\t * \n\t * @return a List containing the path for the Journey.\n\t */\n\tList getPath(int grid[][], Point src, Point dest);\n}","@Override\n public float getCube() {\n\n int wart = 0;\n if (!roomList.isEmpty()){\n for (Room room : roomList){\n if (room instanceof Localization){\n wart += room.getCube();\n }\n }\n }\n return wart;\n }","private void estimateFlatEarthPolynomial() {\n int minLine = 0;\n int maxLine = sourceImageHeight;\n int minPixel = 0;\n int maxPixel = sourceImageWidth;\n \n Rectangle rectangle = new Rectangle();\n rectangle.setSize(maxPixel, maxLine);\n \n // int srpPolynomialDegree = 5; // for flat earth phase\n int numberOfCoefficients = numberOfCoefficients(srpPolynomialDegree);\n \n double[][] position = distributePoints(srpNumberPoints, rectangle);\n \n // setup observation and design matrix\n DoubleMatrix y = new DoubleMatrix(srpNumberPoints);\n DoubleMatrix A = new DoubleMatrix(srpNumberPoints, numberOfCoefficients);\n \n double masterMinPi4divLam = (-4 * Math.PI * Constants.lightSpeed) / masterMetadata.radar_wavelength;\n double slaveMinPi4divLam = (-4 * Math.PI * Constants.lightSpeed) / slaveMetadata.radar_wavelength;\n \n // Loop throu a vector or distributedPoints()\n for (int i = 0; i < srpNumberPoints; ++i) {\n \n double line = position[i][0];\n double pixel = position[i][1];\n \n // compute azimuth/range time for this pixel\n final double masterTimeRange = pix2tr(pixel, masterMetadata);\n \n // compute xyz of this point : sourceMaster\n Point3d xyzMaster = lp2xyz(line, pixel, masterMetadata, masterOrbit);\n \n final Point2d slaveTimeVector = xyz2t(xyzMaster, slaveMetadata, slaveOrbit);\n final double slaveTimeRange = slaveTimeVector.x;\n \n // observation vector\n y.put(i, (masterMinPi4divLam * masterTimeRange) - (slaveMinPi4divLam * slaveTimeRange));\n \n // set up a system of equations\n // ______Order unknowns: A00 A10 A01 A20 A11 A02 A30 A21 A12 A03 for degree=3______\n double posL = normalize(line, minLine, maxLine);\n double posP = normalize(pixel, minPixel, maxPixel);\n \n int index = 0;\n \n for (int j = 0; j <= srpPolynomialDegree; j++) {\n for (int k = 0; k <= j; k++) {\n // System.out.println(\"A[\" + i + \",\" + index + \"]: \"\n // + Math.pow(posL, (float) (j - k)) * Math.pow(posP, (float) k));\n A.put(i, index, (Math.pow(posL, (double) (j - k)) * Math.pow(posP, (double) k)));\n index++;\n }\n }\n }\n \n // Fit polynomial through computed vector of phases\n DoubleMatrix Atranspose = A.transpose();\n DoubleMatrix N = Atranspose.mmul(A);\n DoubleMatrix rhs = Atranspose.mmul(y);\n \n // TODO: validate Cholesky decomposition of JBLAS: see how it is in polyfit and reuse!\n \n // this should be the coefficient of the reference phase\n flatEarthPolyCoefs = Solve.solve(N, rhs);\n \n /*\n System.out.println(\"*******************************************************************\");\n System.out.println(\"_Start_flat_earth\");\n System.out.println(\"*******************************************************************\");\n System.out.println(\"Degree_flat:\" + polyDegree);\n System.out.println(\"Estimated_coefficients_flatearth:\");\n int coeffLine = 0;\n int coeffPixel = 0;\n for (int i = 0; i < numberOfCoefficients; i++) {\n if (flatEarthPolyCoefs.get(i, 0) < 0.) {\n System.out.print(flatEarthPolyCoefs.get(i, 0));\n } else {\n System.out.print(\" \" + flatEarthPolyCoefs.get(i, 0));\n }\n \n System.out.print(\" \\t\" + coeffLine + \" \" + coeffPixel + \"\\n\");\n coeffLine--;\n coeffPixel++;\n if (coeffLine == -1) {\n coeffLine = coeffPixel;\n coeffPixel = 0;\n }\n }\n System.out.println(\"*******************************************************************\");\n System.out.println(\"_End_flat_earth\");\n System.out.println(\"*******************************************************************\");\n */\n \n // TODO: test inverse : when cholesky is finished\n // // ______Test inverse______\n // for (i=0; i .01)\n // {\n // ERROR << \"Deviation too large. Decrease degree or number of points?\";\n // PRINT_ERROR(ERROR.get_str())\n // throw(some_error);\n // }\n // else if (maxdev > .001)\n // {\n // WARNING << \"Deviation quite large. Decrease degree or number of points?\";\n // WARNING.print();\n // }\n // else\n // {\n // INFO.print(\"Deviation is OK.\");\n // }\n // // ______Some other stuff, scale is ok______\n // matrix y_hat = A * rhs;\n // matrix e_hat = y - y_hat;\n }","@Override\n \tpublic void globe(int M, int N) {\n\t\tvertices = new double[][] { { 1, 1, 1, 0, 0, 1 },\n\t\t\t\t{ 1, -1, 1, 0, 0, 1 }, { -1, -1, 1, 0, 0, 1 },\n\t\t\t\t{ -1, 1, 1, 0, 0, 1 }, { 1, 1, -1, 0, 0, -1 },\n\t\t\t\t{ 1, -1, -1, 0, 0, -1 }, { -1, -1, -1, 0, 0, -1 },\n\t\t\t\t{ -1, 1, -1, 0, 0, -1 }, { 1, 1, 1, 1, 0, 0 },\n\t\t\t\t{ 1, -1, 1, 1, 0, 0 }, { 1, -1, -1, 1, 0, 0 },\n\t\t\t\t{ 1, 1, -1, 1, 0, 0 }, { -1, 1, 1, -1, 0, 0 },\n\t\t\t\t{ -1, -1, 1, -1, 0, 0 }, { -1, -1, -1, -1, 0, 0 },\n\t\t\t\t{ -1, 1, -1, -1, 0, 0 }, { 1, 1, 1, 0, 1, 0 },\n\t\t\t\t{ -1, 1, 1, 0, 1, 0 }, { -1, 1, -1, 0, 1, 0 },\n\t\t\t\t{ 1, 1, -1, 0, 1, 0 }, { 1, -1, 1, 0, -1, 0 },\n\t\t\t\t{ -1, -1, 1, 0, -1, 0 }, { -1, -1, -1, 0, -1, 0 },\n\t\t\t\t{ 1, -1, -1, 0, -1, 0 }, };\n \t\tfaces = new int[6][4];\n \t\tfor (int i = 0; i < faces.length; i++) {\n \t\t\tfaces[i] = new int[] { i * 4, i * 4 + 1, i * 4 + 2, i * 4 + 3 };\n \t\t}\n \n \t\tthis.m.identity();\n \t}","@Override\r\n\t\tpublic int cube() {\n\t\t\treturn width*width*width;\r\n\t\t}","public void makeCube (int subdivisions)\r\n {\r\n \tfloat horz[] = new float[subdivisions + 1];\r\n \tfloat vert[] = new float[subdivisions + 1];\r\n \t\r\n \t\r\n \t// Front face\r\n \tPoint p1 = new Point(-0.5f, -0.5f, 0.5f);\r\n \tPoint p2 = new Point(0.5f, -0.5f, 0.5f);\r\n \tPoint p3 = new Point(0.5f, 0.5f, 0.5f);\r\n \tPoint p4 = new Point(-0.5f, 0.5f, 0.5f);\r\n \t\r\n \tfloat h = p1.x;\r\n \tfloat v = p1.y;\r\n \t\r\n \tfor( int i = 0; i <= subdivisions; i++ )\r\n \t{\r\n \t\thorz[i] = h;\r\n \t\th = h + (float)(1/(float)subdivisions);\r\n \t}\r\n \t\r\n \tfor( int i = 0; i <= subdivisions; i++)\r\n \t{\r\n \t\tvert[i] = v;\r\n \t\tv = v + (float)(1/(float)subdivisions);\r\n \t}\r\n \t\r\n \tfor( int j = 0; j < vert.length - 1; j ++)\r\n \t\tfor( int k = 0; k < horz.length - 1; k ++)\r\n \t\t{\r\n \t\t\tPoint tempP1 = new Point(horz[k], vert[j], 0.5f);\r\n \t\t\tPoint tempP2 = new Point(horz[k + 1], vert[j], 0.5f);\r\n \t\t\tPoint tempP3 = new Point(horz[k + 1], vert[j + 1], 0.5f);\r\n \t\t\tPoint tempP4 = new Point(horz[k], vert[j + 1], 0.5f);\r\n \t\t\t\r\n \t\t\taddTriangle(tempP1.x, tempP1.y, tempP1.z, tempP3.x, tempP3.y, tempP3.z, tempP4.x, tempP4.y, tempP4.z);\r\n \t\t\taddTriangle(tempP1.x, tempP1.y, tempP1.z, tempP2.x, tempP2.y, tempP2.z, tempP3.x, tempP3.y, tempP3.z);\r\n \t\t\t\r\n \t\t}\r\n \t\r\n \t// Back face\r\n \tp1.y = p1.z = -0.5f;\r\n \tp1.x = 0.5f;\r\n \tp2.x = p2.y = p2.z = -0.5f;\r\n \tp3.x = p3.z = -0.5f;\r\n \tp3.y = 0.5f;\r\n \tp4.x = p4.y = 0.5f;\r\n \tp4.z = -0.5f;\r\n \t\r\n \th = p1.x;\r\n \tv = p1.y;\r\n \t\r\n \t\r\n \tfor( int i = 0; i <= subdivisions; i++ )\r\n \t{\r\n \t\thorz[i] = h;\r\n \t\th = h - (float)(1/(float)subdivisions);\r\n \t}\r\n \t\r\n \tfor( int i = 0; i <= subdivisions; i++)\r\n \t{\r\n \t\tvert[i] = v;\r\n \t\tv = v + (float)(1/(float)subdivisions);\r\n \t}\r\n \t\r\n \tfor( int j = 0; j < vert.length - 1; j ++)\r\n \t\tfor( int k = 0; k < horz.length - 1; k ++)\r\n \t\t{\r\n \t\t\tPoint tempP1 = new Point(horz[k], vert[j], -0.5f);\r\n \t\t\tPoint tempP2 = new Point(horz[k + 1], vert[j], -0.5f);\r\n \t\t\tPoint tempP3 = new Point(horz[k + 1], vert[j + 1], -0.5f);\r\n \t\t\tPoint tempP4 = new Point(horz[k], vert[j + 1], -0.5f);\r\n \t\t\t\r\n \t\t\taddTriangle(tempP1.x, tempP1.y, tempP1.z, tempP3.x, tempP3.y, tempP3.z, tempP4.x, tempP4.y, tempP4.z);\r\n \t\t\taddTriangle(tempP1.x, tempP1.y, tempP1.z, tempP2.x, tempP2.y, tempP2.z, tempP3.x, tempP3.y, tempP3.z);\r\n \t\t\t\r\n \t\t}\r\n \t\r\n \t// Left face\r\n \tp1.x = p1.y = p1.z = -0.5f;\r\n \tp2.x = p2.y = -0.5f;\r\n \tp2.z = 0.5f;\r\n \tp3.x = -0.5f;\r\n \tp3.y = p3.z = 0.5f;\r\n \tp4.y = 0.5f;\r\n \tp4.x = p4.z = -0.5f;\r\n \t\r\n \th = p1.z;\r\n \tv = p1.y;\r\n \t\r\n \t\r\n \tfor( int i = 0; i <= subdivisions; i++ )\r\n \t{\r\n \t\thorz[i] = h;\r\n \t\th = h + (float)(1/(float)subdivisions);\r\n \t}\r\n \t\r\n \tfor( int i = 0; i <= subdivisions; i++)\r\n \t{\r\n \t\tvert[i] = v;\r\n \t\tv = v + (float)(1/(float)subdivisions);\r\n \t}\r\n \t\r\n \tfor( int j = 0; j < vert.length - 1; j ++)\r\n \t\tfor( int k = 0; k < horz.length - 1; k ++)\r\n \t\t{\r\n \t\t\tPoint tempP1 = new Point(-0.5f, vert[j], horz[k]);\r\n \t\t\tPoint tempP2 = new Point(-0.5f, vert[j], horz[k + 1]);\r\n \t\t\tPoint tempP3 = new Point(-0.5f, vert[j + 1], horz[k + 1]);\r\n \t\t\tPoint tempP4 = new Point(-0.5f, vert[j + 1], horz[k]);\r\n \t\t\t\r\n \t\t\taddTriangle(tempP1.x, tempP1.y, tempP1.z, tempP3.x, tempP3.y, tempP3.z, tempP4.x, tempP4.y, tempP4.z);\r\n \t\t\taddTriangle(tempP1.x, tempP1.y, tempP1.z, tempP2.x, tempP2.y, tempP2.z, tempP3.x, tempP3.y, tempP3.z);\r\n \t\t\t\r\n \t\t}\r\n \t\r\n \t// Right face\r\n \tp1.x = p1.z = 0.5f;\r\n \tp1.y = -0.5f;\r\n \tp2.y = p2.z = -0.5f;\r\n \tp2.x = 0.5f;\r\n \tp3.x = p3.y = 0.5f;\r\n \tp3.z = -0.5f;\r\n \tp4.x = p4.y = p4.z = 0.5f;\r\n \t\r\n \t\r\n \th = p1.z;\r\n \tv = p1.y;\r\n \t\r\n \t\r\n \tfor( int i = 0; i <= subdivisions; i++ )\r\n \t{\r\n \t\thorz[i] = h;\r\n \t\th = h - (float)(1/(float)subdivisions);\r\n \t}\r\n \t\r\n \tfor( int i = 0; i <= subdivisions; i++)\r\n \t{\r\n \t\tvert[i] = v;\r\n \t\tv = v + (float)(1/(float)subdivisions);\r\n \t}\r\n \t\r\n \tfor( int j = 0; j < vert.length - 1; j ++)\r\n \t\tfor( int k = 0; k < horz.length - 1; k ++)\r\n \t\t{\r\n \t\t\tPoint tempP1 = new Point(0.5f, vert[j], horz[k]);\r\n \t\t\tPoint tempP2 = new Point(0.5f, vert[j], horz[k + 1]);\r\n \t\t\tPoint tempP3 = new Point(0.5f, vert[j + 1], horz[k + 1]);\r\n \t\t\tPoint tempP4 = new Point(0.5f, vert[j + 1], horz[k]);\r\n \t\t\t\r\n \t\t\taddTriangle(tempP1.x, tempP1.y, tempP1.z, tempP3.x, tempP3.y, tempP3.z, tempP4.x, tempP4.y, tempP4.z);\r\n \t\t\taddTriangle(tempP1.x, tempP1.y, tempP1.z, tempP2.x, tempP2.y, tempP2.z, tempP3.x, tempP3.y, tempP3.z);\r\n \t\t\t\r\n \t\t}\r\n \t\r\n \t// Top face\r\n \tp1.x = -0.5f;\r\n \tp1.y = p1.z = 0.5f;\r\n \tp2.x = p2.y = p2.z = 0.5f;\r\n \tp3.x = p3.y = 0.5f;\r\n \tp3.z = -0.5f;\r\n \tp4.x = p4.z = -0.5f;\r\n \tp4.y = 0.5f;\r\n \t\r\n \t\r\n \th = p1.x;\r\n \tv = p1.z;\r\n \t\r\n \t\r\n \tfor( int i = 0; i <= subdivisions; i++ )\r\n \t{\r\n \t\thorz[i] = h;\r\n \t\th = h + (float)(1/(float)subdivisions);\r\n \t}\r\n \t\r\n \tfor( int i = 0; i <= subdivisions; i++)\r\n \t{\r\n \t\tvert[i] = v;\r\n \t\tv = v - (float)(1/(float)subdivisions);\r\n \t}\r\n \t\r\n \tfor( int j = 0; j < vert.length - 1; j ++)\r\n \t\tfor( int k = 0; k < horz.length - 1; k ++)\r\n \t\t{\r\n \t\t\tPoint tempP1 = new Point(horz[k], 0.5f, vert[j]);\r\n \t\t\tPoint tempP2 = new Point(horz[k + 1], 0.5f, vert[j]);\r\n \t\t\tPoint tempP3 = new Point(horz[k + 1], 0.5f, vert[j + 1]);\r\n \t\t\tPoint tempP4 = new Point(horz[k], 0.5f, vert[j + 1]);\r\n \t\t\t\r\n \t\t\taddTriangle(tempP1.x, tempP1.y, tempP1.z, tempP3.x, tempP3.y, tempP3.z, tempP4.x, tempP4.y, tempP4.z);\r\n \t\t\taddTriangle(tempP1.x, tempP1.y, tempP1.z, tempP2.x, tempP2.y, tempP2.z, tempP3.x, tempP3.y, tempP3.z);\r\n \t\t\t\r\n \t\t}\r\n \t\r\n \t// Bottom face\r\n \tp1.x = p1.y = p1.z = -0.5f;\r\n \tp2.y = p2.z = 0.5f;\r\n \tp2.x = 0.5f;\r\n \tp3.x = p3.z = 0.5f;\r\n \tp3.y = -0.5f;\r\n \tp4.x = p4.y = -0.5f;\r\n \tp4.z = 0.5f;\r\n \t\r\n \t\r\n \th = p1.x;\r\n \tv = p1.z;\r\n \t\r\n \t\r\n \tfor( int i = 0; i <= subdivisions; i++ )\r\n \t{\r\n \t\thorz[i] = h;\r\n \t\th = h + (float)(1/(float)subdivisions);\r\n \t}\r\n \t\r\n \tfor( int i = 0; i <= subdivisions; i++)\r\n \t{\r\n \t\tvert[i] = v;\r\n \t\tv = v + (float)(1/(float)subdivisions);\r\n \t}\r\n \t\r\n \tfor( int j = 0; j < vert.length - 1; j ++)\r\n \t\tfor( int k = 0; k < horz.length - 1; k ++)\r\n \t\t{\r\n \t\t\tPoint tempP1 = new Point(horz[k], -0.5f, vert[j]);\r\n \t\t\tPoint tempP2 = new Point(horz[k + 1], -0.5f, vert[j]);\r\n \t\t\tPoint tempP3 = new Point(horz[k + 1], -0.5f, vert[j + 1]);\r\n \t\t\tPoint tempP4 = new Point(horz[k], -0.5f, vert[j + 1]);\r\n \t\t\t\r\n \t\t\taddTriangle(tempP1.x, tempP1.y, tempP1.z, tempP3.x, tempP3.y, tempP3.z, tempP4.x, tempP4.y, tempP4.z);\r\n \t\t\taddTriangle(tempP1.x, tempP1.y, tempP1.z, tempP2.x, tempP2.y, tempP2.z, tempP3.x, tempP3.y, tempP3.z);\r\n \t\t\t\r\n \t\t}\r\n \t\r\n }","public static List drawCube(Location location1, Location location2, Float density, boolean isBlock) {\n Location loc1 = location1.clone(), loc2 = location2.clone();\n\n loc1.setX(Math.min(location1.getX(),location2.getX()));\n loc1.setY(Math.min(location1.getY(),location2.getY()));\n loc1.setZ(Math.min(location1.getZ(),location2.getZ()));\n loc2.setX(Math.max(location1.getX(),location2.getX()));\n loc2.setY(Math.max(location1.getY(),location2.getY()));\n loc2.setZ(Math.max(location1.getZ(),location2.getZ()));\n\n if (isBlock) {\n loc1 = loc1.getBlock().getLocation();\n loc2 = loc2.getBlock().getLocation();\n loc2.add(1, 1, 1);\n }\n\n double deltaX = Math.abs(loc1.getX() - loc2.getX());\n double deltaY = Math.abs(loc1.getY() - loc2.getY());\n double deltaZ = Math.abs(loc1.getZ() - loc2.getZ());\n\n int dx = (int) Math.ceil(deltaX / density);\n int dy = (int) Math.ceil(deltaY / density);\n int dz = (int) Math.ceil(deltaZ / density);\n\n List collection = new ArrayList<>();\n int[][] var1 = {{0, 0}, {1, 0}, {0, 1}, {1, 1}};\n for (int[] i : var1) {\n Location locx = loc1.clone().add(i[0] * deltaX, 0, i[1] * deltaZ);\n collection.addAll(drawline(locx, locx.clone().add(0, deltaY, 0),dy));\n\n locx = loc1.clone().add(0, i[0] * deltaY, i[1] * deltaZ);\n collection.addAll(drawline(locx, locx.clone().add(deltaX, 0, 0),dx));\n\n locx = loc1.clone().add(i[0] * deltaX, i[1] * deltaY, 0);\n collection.addAll(drawline(locx, locx.clone().add(0, 0, deltaZ),dz));\n }\n return collection;\n }","public Cube[][] getCubeGrid() {\n return cubeGrid;\n }","@Test\n\tpublic void testGetPathIntegral() throws GeoTessException\n\t{\n\t\tdouble[] pointA = new double[3];\n\t\tdouble[] pointB = new double[3];\n\t\t\n\t\tVectorGeo.getVectorDegrees(0., 0., pointA);\n\t\tVectorGeo.getVectorDegrees(0., 30., pointB);\n\n\t\tGreatCircle greatCircle = new GreatCircle(pointA, pointB);\n\t\t\n\t\tArrayList rayPath = greatCircle.getPoints(31, false);\n\n\t\t// radii will the radius of each of the points along the rayPath.\n\t\tdouble[] radii = new double[rayPath.size()];\n\t\tArrays.fill(radii, 6300.);\n\t\t\n\t\tdouble dkm = model.getPathIntegral(-1, rayPath, radii, null,\n\t\t\t\tInterpolatorType.NATURAL_NEIGHBOR, InterpolatorType.LINEAR);\n\t\t\n\t\tassertEquals(greatCircle.getDistance()*6300., dkm, 0.1);\n\t\n\t\tdouble tt = model.getPathIntegral(0, rayPath, radii, null,\n\t\t\t\tInterpolatorType.NATURAL_NEIGHBOR, InterpolatorType.LINEAR);\n\t\t\n\t\tassertEquals(408.216, tt, 0.1);\n\t\n\t}","private double calculateSpiralDistanceFromCentre(double phi)\n\t{\n\t\treturn a*Math.exp(b*phi);\n\t}","@Override\n protected void interpolate(double frac) {\n ray.project(dist * frac);\n // set the sphere to ray position\n s.setTranslateX(ray.getPosition().getX());\n s.setTranslateY(ray.getPosition().getY());\n s.setTranslateZ(ray.getPosition().getZ());\n\n }","public RMPath getPath() { return RMPath.unitRectPath; }","private void setPath(){\r\n // get the reversed path\r\n ArrayList reversedPath = new ArrayList<>();\r\n int index = _endIndex;\r\n reversedPath.add(_map.get_grid(index));\r\n while(index != _startIndex){\r\n index = _map.get_grid(index).get_parent();\r\n reversedPath.add(_map.get_grid(index));\r\n }\r\n\r\n // get the final path in the correct order\r\n int length = reversedPath.size();\r\n for(int i=length-1;i>=0;i--){\r\n _path.add(reversedPath.get(i));\r\n }\r\n }","public ArrayList findPath() {\n \n //if we've already been through findPath, then just return it\n if (solutionCalculated) {\n return solution;\n }\n \n //instantiate path\n solution = new ArrayList();\n \n //create boolean array of visited nodes (default: false)\n boolean[] visited = new boolean[arrayOfVertices.length];\n \n //(for testing)\n NavigateMaze.drawMaze(getVertices());\n \n //call dfs\n dfs(visited, arrayOfVertices[0], \n arrayOfVertices[arrayOfVertices.length - 1]);\n \n //update solutionCalculated to true\n solutionCalculated = true;\n \n //return solution\n return solution;\n \n }","public T getPath() {\n\tif (path == null) path = newSplinePath2D();\n\tint cpsize = cplist.size();\n\tif (cpsize > 0) {\n\t CPoint[] array = new CPoint[cpsize];\n\t cplist.toArray(array);\n\t appendAux(array);\n\t cplist.clear();\n\t}\n\treturn path;\n }","List getPath(int grid[][], Point src, Point dest);","public ArrayList getPath() {\n\t\treturn path;\n\t\t\n\t}","public abstract double getSurfacearea();","public void evaluate_surface() {\n if (surface_type != 2) {\n double epsilon = 0.001;\n\n for (int i = 0; i < nr_of_segments; i++) {\n for (double u = 0.0; u < 1.0 - epsilon; u = u + step) {\n for (int j = 0; j < points_per_segment; j++) {\n for (double v = 0.0; v < 1.0 - epsilon; v = v + step) {\n evaluated_points[(int) (((i + u) / step) + epsilon)][(int) (((j + v) / step)\n + epsilon)] = evaluate_point_on_surface(i, j, u, v);\n }\n }\n }\n }\n }\n\n }","public interface BoundedObject {\n public BoundedCube getBounds();\n\n public static class BoundedCube implements Comparable {\n public long lx, ty, iz = 0;\n public long rx, by, oz = 0;\n\n public BoundedCube() {\n super();\n }\n\n public BoundedCube(long lx, long rx, long ty, long by, long iz, long oz) {\n super();\n this.lx = lx;\n this.rx = rx;\n this.ty = ty;\n this.by = by;\n this.iz = iz;\n this.oz = oz;\n }\n\n public BoundedCube(long[] coords, long radius) {\n super();\n this.lx = coords[0] - radius;\n this.rx = coords[0] + radius;\n this.ty = coords[1] - radius;\n this.by = coords[1] + radius;\n this.iz = coords[2] - radius;\n this.oz = coords[2] + radius;\n }\n\n public BoundedCube(BoundedCube l) {\n super();\n set(l);\n }\n\n public void set(BoundedCube l) {\n this.lx = l.lx;\n this.rx = l.rx;\n this.ty = l.ty;\n this.by = l.by;\n this.iz = l.iz;\n this.oz = l.oz;\n }\n\n public void union(BoundedCube l) {\n if (l.lx < lx)\n lx = l.lx;\n if (l.rx > rx)\n rx = l.rx;\n if (l.ty < ty)\n ty = l.ty;\n if (l.by > by)\n by = l.by;\n if (l.iz < iz)\n iz = l.iz;\n if (l.oz > oz)\n oz = l.oz;\n }\n\n public long radius() {\n return Math.round(Math.sqrt(((rx - lx) * (rx - lx))\n + ((by - ty) * (by - ty))\n + ((oz - iz) * (oz - iz))));\n }\n\n public BoundedCube expand(double[] direction, long distance) {\n final BoundedCube cube = new BoundedCube(this);\n final double x1 = Math.cos(direction[0]) * Math.sin(direction[1]);\n final double y1 = Math.sin(direction[0]) * Math.sin(direction[1]);\n final double z1 = Math.cos(direction[1]);\n final long[] oldCenter = new long[]{((lx + rx) / 2), ((ty + rx) / 2), ((iz + oz) / 2)};\n final long[] newCenter = new long[]{\n oldCenter[0] + Math.round(CMath.mul(distance, x1)),\n oldCenter[1] + Math.round(CMath.mul(distance, y1)),\n oldCenter[2] + Math.round(CMath.mul(distance, z1))};\n if (newCenter[0] > oldCenter[0])\n cube.rx += newCenter[0] - oldCenter[0];\n else\n cube.lx += newCenter[0] - oldCenter[0];\n if (newCenter[1] > oldCenter[1])\n cube.ty += newCenter[1] - oldCenter[1];\n else\n cube.by += newCenter[1] - oldCenter[1];\n if (newCenter[2] > oldCenter[2])\n cube.iz += newCenter[2] - oldCenter[2];\n else\n cube.oz += newCenter[2] - oldCenter[2];\n return cube;\n }\n\n public boolean intersects(BoundedCube two) {\n if (two == null)\n return false;\n return (\n ((lx <= two.lx && two.lx <= rx) || (two.lx <= lx && lx <= two.rx))\n && ((ty <= two.ty && two.ty <= by) || (two.ty <= ty && ty <= two.by))\n && ((iz <= two.iz && two.iz <= oz) || (two.iz <= iz && iz <= two.oz))\n );\n }\n\n public boolean contains(long x, long y, long z) {\n return ((x >= lx)\n && (x <= rx)\n && (y >= ty)\n && (y <= by)\n && (z >= iz)\n && (z <= oz));\n }\n\n public long width() {\n return rx - lx;\n }\n\n public long height() {\n return by - ty;\n }\n\n public long depth() {\n return oz - iz;\n }\n\n @Override\n public int compareTo(BoundedCube o) {\n if (lx < o.lx)\n return -1;\n if (lx > o.lx)\n return 1;\n if (rx < o.rx)\n return -1;\n if (rx > o.rx)\n return 1;\n if (ty < o.ty)\n return -1;\n if (ty > o.ty)\n return 1;\n if (by < o.by)\n return -1;\n if (by > o.by)\n return 1;\n if (iz < o.iz)\n return -1;\n if (iz > o.iz)\n return 1;\n if (oz < o.oz)\n return -1;\n if (oz > o.oz)\n return 1;\n return 0;\n }\n }\n}","public Point3d sampleHemisphere();","public float getSphereRadius();","@Test\n\tpublic void testGetGridOffsetValues() {\n\t\tAssert.assertEquals(13.68, Geoid.getGridOffset(90.0, 0.0), EPSILON);\n\t\tAssert.assertEquals(-29.79, Geoid.getGridOffset(-90.0, 0.0), EPSILON);\n\n\t\t// random grid params from EGM.complete.txt.gz\n\t\t// 89.74 5.75 13.89\n\t\t// 86.5 217.25 11.76\n\t\t// 71.25 8.0 43.56\n\t\t// 54.0 182.25 2.35\n\t\t// 35.5 186.0 -12.91\n\t\t// 14.75 213.5 -8.07\n\t\t// -22.25 221.5 -10.18\n\t\t// -37.5 13.0 25.61\n\t\t// -51.75 157.25 -17.88\n\t\t// -70.5 346.0 5.18\n\t\t// -74.5 22.0 17.5\n\t\t// -84.5 306.25 -25.71\n\t\t// -86.75 328.75 -21.81\n\n\t\tAssert.assertEquals(13.89, Geoid.getGridOffset(89.74, 5.75), EPSILON); \n\t\tAssert.assertEquals(11.76, Geoid.getGridOffset(86.5, 217.25), EPSILON);\n\t\tAssert.assertEquals(43.56, Geoid.getGridOffset(71.25, 8.0), EPSILON);\n\t\tAssert.assertEquals(2.35, Geoid.getGridOffset(54.0, 182.25), EPSILON);\n\t\tAssert.assertEquals(-12.91, Geoid.getGridOffset(35.5, 186.0), EPSILON);\n\t\tAssert.assertEquals(-8.07, Geoid.getGridOffset(14.75, 213.5), EPSILON);\n\t\tAssert.assertEquals(-10.18, Geoid.getGridOffset(-22.25, 221.5), EPSILON);\n\t\tAssert.assertEquals(25.61, Geoid.getGridOffset(-37.5, 13.0), EPSILON);\n\t\tAssert.assertEquals(-17.88, Geoid.getGridOffset(-51.75, 157.25), EPSILON);\n\t\tAssert.assertEquals(5.18, Geoid.getGridOffset(-70.5, 346.0), EPSILON);\n\t\tAssert.assertEquals(17.5, Geoid.getGridOffset(-74.5, 22.0), EPSILON);\n\t\tAssert.assertEquals(-25.71, Geoid.getGridOffset(-84.5, 306.25), EPSILON);\n\t\tAssert.assertEquals(-21.81, Geoid.getGridOffset(-86.75, 328.75), EPSILON);\n\t\tAssert.assertEquals(-29.79, Geoid.getGridOffset(-90.0, 0.0), EPSILON);\n\t}","static private void npcPath() {\n\n if (Time.secondsPassed % 45 == 44) {\n Random picker = new Random();\n while (true) {\n if (josephSchnitzel.getCurrentRoom().equals(mountain)) {\n String[] newRoomString = {\"south\"};\n int index = picker.nextInt(newRoomString.length);\n Room next = josephSchnitzel.getCurrentRoom().getExit(newRoomString[index]);\n josephSchnitzel.setCurrentRoom(next);\n break;\n }\n\n if (josephSchnitzel.getCurrentRoom().equals(beach)) {\n String[] newRoomString = {\"north\"};\n int indexOfNewRoomString = picker.nextInt(newRoomString.length);\n Room nextRoom = josephSchnitzel.getCurrentRoom().getExit(newRoomString[indexOfNewRoomString]);\n josephSchnitzel.setCurrentRoom(nextRoom);\n break;\n }\n\n if (josephSchnitzel.getCurrentRoom().equals(jungle)) {\n String[] newRoomString = {\"north\", \"south\"};\n int indexOfNewRoomString = picker.nextInt(newRoomString.length);\n Room nextRoom = josephSchnitzel.getCurrentRoom().getExit(newRoomString[indexOfNewRoomString]);\n josephSchnitzel.setCurrentRoom(nextRoom);\n break;\n }\n }\n }\n }","Vec3 getHomeCoords(IGeneticMob geneticMob);","public CubeGL2(double width, double height, double depth) {\n // Define points for a cube.\n // X, Y, Z\n mCubeVertexData = new float[]\n {\n // Front face\n -1.0f, 1.0f, 1.0f,\n -1.0f, -1.0f, 1.0f,\n 1.0f, 1.0f, 1.0f,\n -1.0f, -1.0f, 1.0f,\n 1.0f, -1.0f, 1.0f,\n 1.0f, 1.0f, 1.0f,\n // Right face\n 1.0f, 1.0f, 1.0f,\n 1.0f, -1.0f, 1.0f,\n 1.0f, 1.0f, -1.0f,\n 1.0f, -1.0f, 1.0f,\n 1.0f, -1.0f, -1.0f,\n 1.0f, 1.0f, -1.0f,\n // Back face\n 1.0f, 1.0f, -1.0f,\n 1.0f, -1.0f, -1.0f,\n -1.0f, 1.0f, -1.0f,\n 1.0f, -1.0f, -1.0f,\n -1.0f, -1.0f, -1.0f,\n -1.0f, 1.0f, -1.0f,\n // Left face\n -1.0f, 1.0f, -1.0f,\n -1.0f, -1.0f, -1.0f,\n -1.0f, 1.0f, 1.0f,\n -1.0f, -1.0f, -1.0f,\n -1.0f, -1.0f, 1.0f,\n -1.0f, 1.0f, 1.0f,\n // Top face\n -1.0f, 1.0f, -1.0f,\n -1.0f, 1.0f, 1.0f,\n 1.0f, 1.0f, -1.0f,\n -1.0f, 1.0f, 1.0f,\n 1.0f, 1.0f, 1.0f,\n 1.0f, 1.0f, -1.0f,\n // Bottom face\n 1.0f, -1.0f, -1.0f,\n 1.0f, -1.0f, 1.0f,\n -1.0f, -1.0f, -1.0f,\n 1.0f, -1.0f, 1.0f,\n -1.0f, -1.0f, 1.0f,\n -1.0f, -1.0f, -1.0f,\n };\n\n for (int i = 0; i < mCubeVertexData.length; i += 3) {\n mCubeVertexData[i] = mCubeVertexData[i] * (float) width;\n }\n for (int i = 1; i < mCubeVertexData.length; i += 3) {\n mCubeVertexData[i] = mCubeVertexData[i] * (float) height;\n }\n for (int i = 2; i < mCubeVertexData.length; i += 3) {\n mCubeVertexData[i] = mCubeVertexData[i] * (float) depth;\n }\n\n // R, G, B, A\n mCubeColourData = new float[]\n {\n // Front face\n 1.0f, 0.0f, 0.0f, 1.0f,\n 1.0f, 0.0f, 0.0f, 1.0f,\n 1.0f, 0.0f, 0.0f, 1.0f,\n 1.0f, 0.0f, 0.0f, 1.0f,\n 1.0f, 0.0f, 0.0f, 1.0f,\n 1.0f, 0.0f, 0.0f, 1.0f,\n // Right face\n 0.0f, 1.0f, 0.0f, 1.0f,\n 0.0f, 1.0f, 0.0f, 1.0f,\n 0.0f, 1.0f, 0.0f, 1.0f,\n 0.0f, 1.0f, 0.0f, 1.0f,\n 0.0f, 1.0f, 0.0f, 1.0f,\n 0.0f, 1.0f, 0.0f, 1.0f,\n // Back face\n 0.0f, 0.0f, 1.0f, 1.0f,\n 0.0f, 0.0f, 1.0f, 1.0f,\n 0.0f, 0.0f, 1.0f, 1.0f,\n 0.0f, 0.0f, 1.0f, 1.0f,\n 0.0f, 0.0f, 1.0f, 1.0f,\n 0.0f, 0.0f, 1.0f, 1.0f,\n // Left face\n 1.0f, 1.0f, 0.0f, 1.0f,\n 1.0f, 1.0f, 0.0f, 1.0f,\n 1.0f, 1.0f, 0.0f, 1.0f,\n 1.0f, 1.0f, 0.0f, 1.0f,\n 1.0f, 1.0f, 0.0f, 1.0f,\n 1.0f, 1.0f, 0.0f, 1.0f,\n // Top face\n 0.0f, 1.0f, 1.0f, 1.0f,\n 0.0f, 1.0f, 1.0f, 1.0f,\n 0.0f, 1.0f, 1.0f, 1.0f,\n 0.0f, 1.0f, 1.0f, 1.0f,\n 0.0f, 1.0f, 1.0f, 1.0f,\n 0.0f, 1.0f, 1.0f, 1.0f,\n // Bottom face\n 1.0f, 0.0f, 1.0f, 1.0f,\n 1.0f, 0.0f, 1.0f, 1.0f,\n 1.0f, 0.0f, 1.0f, 1.0f,\n 1.0f, 0.0f, 1.0f, 1.0f,\n 1.0f, 0.0f, 1.0f, 1.0f,\n 1.0f, 0.0f, 1.0f, 1.0f\n };\n // X, Y, Z\n mCubeNormalData = new float[]\n {\n // Front face\n 0.0f, 0.0f, 1.0f,\n 0.0f, 0.0f, 1.0f,\n 0.0f, 0.0f, 1.0f,\n 0.0f, 0.0f, 1.0f,\n 0.0f, 0.0f, 1.0f,\n 0.0f, 0.0f, 1.0f,\n // Right face\n 1.0f, 0.0f, 0.0f,\n 1.0f, 0.0f, 0.0f,\n 1.0f, 0.0f, 0.0f,\n 1.0f, 0.0f, 0.0f,\n 1.0f, 0.0f, 0.0f,\n 1.0f, 0.0f, 0.0f,\n // Back face\n 0.0f, 0.0f, -1.0f,\n 0.0f, 0.0f, -1.0f,\n 0.0f, 0.0f, -1.0f,\n 0.0f, 0.0f, -1.0f,\n 0.0f, 0.0f, -1.0f,\n 0.0f, 0.0f, -1.0f,\n // Left face\n -1.0f, 0.0f, 0.0f,\n -1.0f, 0.0f, 0.0f,\n -1.0f, 0.0f, 0.0f,\n -1.0f, 0.0f, 0.0f,\n -1.0f, 0.0f, 0.0f,\n -1.0f, 0.0f, 0.0f,\n // Top face\n 0.0f, 1.0f, 0.0f,\n 0.0f, 1.0f, 0.0f,\n 0.0f, 1.0f, 0.0f,\n 0.0f, 1.0f, 0.0f,\n 0.0f, 1.0f, 0.0f,\n 0.0f, 1.0f, 0.0f,\n // Bottom face\n 0.0f, -1.0f, 0.0f,\n 0.0f, -1.0f, 0.0f,\n 0.0f, -1.0f, 0.0f,\n 0.0f, -1.0f, 0.0f,\n 0.0f, -1.0f, 0.0f,\n 0.0f, -1.0f, 0.0f\n };\n // X, Y\n // Texture coordinate data.\n mCubeTextureCoordinateData = new float[]\n {\n // Front face\n 0.0f, 0.0f,\n 0.0f, 1.0f,\n 1.0f, 0.0f,\n 0.0f, 1.0f,\n 1.0f, 1.0f,\n 1.0f, 0.0f,\n // Right face\n 0.0f, 0.0f,\n 0.0f, 1.0f,\n 1.0f, 0.0f,\n 0.0f, 1.0f,\n 1.0f, 1.0f,\n 1.0f, 0.0f,\n // Back face\n 0.0f, 0.0f,\n 0.0f, 1.0f,\n 1.0f, 0.0f,\n 0.0f, 1.0f,\n 1.0f, 1.0f,\n 1.0f, 0.0f,\n // Left face\n 0.0f, 0.0f,\n 0.0f, 1.0f,\n 1.0f, 0.0f,\n 0.0f, 1.0f,\n 1.0f, 1.0f,\n 1.0f, 0.0f,\n // Top face\n 0.0f, 0.0f,\n 0.0f, 1.0f,\n 1.0f, 0.0f,\n 0.0f, 1.0f,\n 1.0f, 1.0f,\n 1.0f, 0.0f,\n // Bottom face\n 0.0f, 0.0f,\n 0.0f, 1.0f,\n 1.0f, 0.0f,\n 0.0f, 1.0f,\n 1.0f, 1.0f,\n 1.0f, 0.0f\n };\n // Initialize the buffers.\n mCubeVertices = ByteBuffer.allocateDirect(mCubeVertexData.length * 4)\n .order(ByteOrder.nativeOrder()).asFloatBuffer();\n mCubeVertices.put(mCubeVertexData).position(0);\n mCubeColours = ByteBuffer.allocateDirect(mCubeColourData.length * 4)\n .order(ByteOrder.nativeOrder()).asFloatBuffer();\n mCubeColours.put(mCubeColourData).position(0);\n mCubeNormals = ByteBuffer.allocateDirect(mCubeNormalData.length * 4)\n .order(ByteOrder.nativeOrder()).asFloatBuffer();\n mCubeNormals.put(mCubeNormalData).position(0);\n mCubeTextureCoordinates = ByteBuffer.allocateDirect(mCubeTextureCoordinateData.length * 4)\n .order(ByteOrder.nativeOrder()).asFloatBuffer();\n mCubeTextureCoordinates.put(mCubeTextureCoordinateData).position(0);\n Matrix.setIdentityM(mModelMatrix, 0);\n }","private double solveQuadraticOutside(Location location) {\n\t\tint iPlus = imposeBorder(location.i + 1, _iSize);\r\n\t\tint iMinus = imposeBorder(location.i - 1, _iSize);\r\n\t\tint jPlus = imposeBorder(location.j + 1, _iSize);\r\n\t\tint jMinus = imposeBorder(location.j - 1, _iSize);\r\n\t\t//\r\n\t\tdouble ux1 = _levelSet[iPlus][location.j];\r\n\t\tdouble ux2 = _levelSet[iMinus][location.j];\r\n\t\tdouble uy1 = _levelSet[location.i][jPlus];\r\n\t\tdouble uy2 = _levelSet[location.i][jMinus];\r\n\t\t//\r\n\t\tdouble ux = Math.min(ux1, ux2);\r\n\t\tdouble uy = Math.min(uy1, uy2);\r\n\t\t// TODO pre-compute\r\n\t\tdouble f = _dx / F;\r\n\t\t//\r\n\t\t// solve the quadratic equation\r\n\t\tdouble a = 2;\r\n\t\tdouble b = -2 * (ux + uy);\r\n\t\tdouble c = ScalarMath.square(ux) + ScalarMath.square(uy)\r\n\t\t\t\t- ScalarMath.square(f);\r\n\t\tdouble delta = ScalarMath.square(b) - 4 * a * c;\r\n\t\t// extraordinary solutions\r\n\t\tdouble u;\r\n\t\tif (Double.isInfinite(ux) | Double.isInfinite(uy) | delta < 0) {\r\n\t\t\tif (Double.isInfinite(ux))\r\n\t\t\t\tu = uy;\r\n\t\t\telse if (Double.isInfinite(uy))\r\n\t\t\t\tu = ux;\r\n\t\t\telse\r\n\t\t\t\t// the case where (delta < 0), which produces a\r\n\t\t\t\t// imaginary root\r\n\t\t\t\tu = Math.min(ux, uy);\r\n\t\t\treturn u + f;\r\n\t\t}\r\n\t\tdouble sol1 = (-b + Math.sqrt(delta)) / (2 * a);\r\n\t\tdouble sol2 = (-b - Math.sqrt(delta)) / (2 * a);\r\n\t\treturn Math.max(sol1, sol2);\r\n\t}","public final AstValidator.cube_clause_return cube_clause() throws RecognitionException {\n AstValidator.cube_clause_return retval = new AstValidator.cube_clause_return();\n retval.start = input.LT(1);\n\n\n CommonTree root_0 = null;\n\n CommonTree _first_0 = null;\n CommonTree _last = null;\n\n CommonTree CUBE119=null;\n AstValidator.cube_item_return cube_item120 =null;\n\n\n CommonTree CUBE119_tree=null;\n\n try {\n // /home/hoang/DATA/WORKSPACE/trunk0408/src/org/apache/pig/parser/AstValidator.g:296:2: ( ^( CUBE cube_item ) )\n // /home/hoang/DATA/WORKSPACE/trunk0408/src/org/apache/pig/parser/AstValidator.g:296:4: ^( CUBE cube_item )\n {\n root_0 = (CommonTree)adaptor.nil();\n\n\n _last = (CommonTree)input.LT(1);\n {\n CommonTree _save_last_1 = _last;\n CommonTree _first_1 = null;\n CommonTree root_1 = (CommonTree)adaptor.nil();\n _last = (CommonTree)input.LT(1);\n CUBE119=(CommonTree)match(input,CUBE,FOLLOW_CUBE_in_cube_clause1282); if (state.failed) return retval;\n if ( state.backtracking==0 ) {\n CUBE119_tree = (CommonTree)adaptor.dupNode(CUBE119);\n\n\n root_1 = (CommonTree)adaptor.becomeRoot(CUBE119_tree, root_1);\n }\n\n\n match(input, Token.DOWN, null); if (state.failed) return retval;\n _last = (CommonTree)input.LT(1);\n pushFollow(FOLLOW_cube_item_in_cube_clause1284);\n cube_item120=cube_item();\n\n state._fsp--;\n if (state.failed) return retval;\n if ( state.backtracking==0 ) \n adaptor.addChild(root_1, cube_item120.getTree());\n\n\n match(input, Token.UP, null); if (state.failed) return retval;\n adaptor.addChild(root_0, root_1);\n _last = _save_last_1;\n }\n\n\n if ( state.backtracking==0 ) {\n }\n }\n\n if ( state.backtracking==0 ) {\n\n retval.tree = (CommonTree)adaptor.rulePostProcessing(root_0);\n }\n\n }\n\n catch(RecognitionException re) {\n throw re;\n }\n\n finally {\n \t// do for sure before leaving\n }\n return retval;\n }","public Path setLevel1() {\n\t\tint xVal = (LAND_X_COUNT/2);//5\n\t\tint yVal = 0;\n\t\t\n\t\t//pixel width/height for grid coordinate\n\t\tfloat xPx = (float) (PIXEL_WIDTH*(xVal));\n\t\tfloat yPx = (float) (PIXEL_HEIGHT*(yVal));\n\t\t\n\t\tsPath.moveTo(xPx, yPx); //LANDWIDTH MIDDLE X\n\t\tPosition prevPos = new Position(xVal,yVal);\n\t\tPosition newPos;// = new Position(5,2);\n\n\t\tLevelOne one = new LevelOne(); //level one contains more information, just path details\n\t\t\n\t\tsetPathLine(prevPos,prevPos); //first point\n\n\t\tfor (Position pos : one.getLevelPositions())\n\t\t{\n\t\t\tnewPos = pos;\n\t\t\tsetPathLine(prevPos,newPos);\n\t\t\tprevPos = newPos;\n\t\t}\n\t\n\t\tnewPos = new Position(LAND_X_COUNT/2,LAND_Y_COUNT-1); //middle of the bottom of the screen\n\t\tsetPathLine(prevPos,newPos);\n\t\tendPosition = newPos; //store end position\n\t\tnewPos = new Position(LAND_X_COUNT/2,LAND_Y_COUNT);\n\t\tsPath.lineTo((float) (PIXEL_WIDTH*newPos.getX()), (float) (PIXEL_HEIGHT*newPos.getY()));//END POINT\n\t\treturn sPath;\t\n\t}","protected void mapToSimulationCube() {\n\t\t/* Map the system into the simulation cube, by scaling, translation, and\n\t\t by applying the periodic boundary conditions */\n\t\tdouble xo,yo,zo;\n\t\tVectorD3 mapBox;\n\t\t/* Loop over lattices: */\n\t\tfor ( int ilatt = 0; ilatt < 2; ilatt++ ) {\n\t\t\t/* Loop over spheres: */\n\t\t\tfor ( int in = 0; in < n; in++ ) {\n\t\t\t\tif( ilatt == 0 || (in < phaseIndex())) {\n\t\t\t\t\tmapBox = boxes[ilatt];\n\t\t\t\t} else {\n\t\t\t\t\tmapBox = boxT;\n\t\t\t\t}\n\t\t\t\t/* Copy vector from lattice array */\n\t\t\t\txo = latt[ilatt][in].x;\n\t\t\t\tyo = latt[ilatt][in].y;\n\t\t\t\tzo = latt[ilatt][in].z;\n\t\t\t\t\n\t\t\t\t/*Scale and translate: */\n\t\t\t\txo = ( xo/mapBox.x ) - 0.5;\n\t\t\t\tyo = ( yo/mapBox.y ) - 0.5;\n\t\t\t\tzo = ( zo/mapBox.z ) - 0.5;\n\t\t\t\t\n\t\t\t\t/*Apply periodic boundary conditions: */\n\t\t\t\txo = xo - ( (int) ( xo+xo ) );\n\t\t\t\tyo = yo - ( (int) ( yo+yo ) );\n\t\t\t\tzo = zo - ( (int) ( zo+zo ) );\n\t\t\t\t\n\t\t\t\t/* Copy modified vector back into the lattice array */\n\t\t\t\tlatt[ilatt][in].x = xo;\n\t\t\t\tlatt[ilatt][in].y = yo;\n\t\t\t\tlatt[ilatt][in].z = zo;\n\t\t\t\t\n\t\t\t}\n\t\t}\t\t\n\t}","public RubiksCube(){\n\t\tString[] c = {\n\t\t\t\t\"W\",\"W\",\"W\",\"W\",\"W\",\"W\",\"W\",\"W\",\"W\",\n\t\t\t\t\"R\",\"R\",\"R\",\"R\",\"R\",\"R\",\"R\",\"R\",\"R\",\n\t\t\t\t\"B\",\"B\",\"B\",\"B\",\"B\",\"B\",\"B\",\"B\",\"B\",\n\t\t\t\t\"G\",\"G\",\"G\",\"G\",\"G\",\"G\",\"G\",\"G\",\"G\",\n\t\t\t\t\"O\",\"O\",\"O\",\"O\",\"O\",\"O\",\"O\",\"O\",\"O\",\n\t\t\t\t\"Y\",\"Y\",\"Y\",\"Y\",\"Y\",\"Y\",\"Y\",\"Y\",\"Y\",\n\t\t};\n\t\tthis.cube = c;\n\t}","private void setGeometryData() {\n // allocate vertices\n final int factorK = (innerRadius == 0 ? 1 : 2);\n final int verts = factorK * ((zSamples - 2) * (radialSamples) + 2); // rs + 1\n setVertexCoordsSize (verts);\n setNormalCoordsSize (verts);\n\n // generate geometry\n final double fInvRS = 1.0 / (radialSamples);\n final double fZFactor = 1.0 / (zSamples - 1); // 2.0 / (zSamples - 1);\n\n // Generate points on the unit circle to be used in computing the mesh\n // points on a sphere slice.\n final double[] afSin = new double[(radialSamples + 1)];\n final double[] afCos = new double[(radialSamples + 1)];\n for ( int iR = 0; iR < radialSamples; iR++ ) {\n final double fAngle = phi0 + dPhi * fInvRS * iR;\n afCos[iR] = Math.cos (fAngle);\n afSin[iR] = Math.sin (fAngle);\n }\n // afSin[radialSamples] = afSin[0];\n // afCos[radialSamples] = afCos[0];\n\n double radDiff = Math.abs (outerRadius - innerRadius);\n\n for ( int icnt = 0; icnt < 2; icnt++ ) {\n radius = (icnt == 0 ? innerRadius : outerRadius);\n if ( radius == 0.0 ) {\n continue;\n }\n double zNP = centerZ; // 0.0;\n double zSP = centerZ; // 0.0;\n\n // generate the sphere itself\n int i = 0;\n Vector3D tempVa;\n Vector3D kSliceCenter;\n\n for ( int iZ = 1; iZ < (zSamples - 1); iZ++ ) { // -1\n //final double fAFraction = 0.5 * Math.PI * (-1.0f + fZFactor * iZ); // in (-pi/2, pi/2)\n final double fAFraction = theta1 - iZ * fZFactor * dTheta;\n final double fZFraction = Math.sin (fAFraction); // in (-1,1)\n final double fZ = radius * fZFraction;\n\n // compute center of slice\n kSliceCenter = new Vector3D (\n center.getX (),\n center.getY (),\n center.getZ () + fZ\n );\n\n // compute radius of slice\n final double fSliceRadius = Math.sqrt (\n Math.abs (\n radius * radius - fZ * fZ\n )\n );\n\n // compute slice vertices with duplication at end point\n Vector3D kNormal;\n final int iSave = i;\n for ( int iR = 0; iR < radialSamples; iR++ ) {\n final double fRadialFraction = iR * fInvRS; // in [0,1)\n final Vector3D kRadial = new Vector3D (\n afCos[iR],\n afSin[iR],\n 0\n );\n tempVa = new Vector3D (\n fSliceRadius * kRadial.getX (),\n fSliceRadius * kRadial.getY (),\n fSliceRadius * kRadial.getZ ()\n );\n\n zNP = Math.\n max (kSliceCenter.getZ (), zNP);\n zSP = Math.\n min (kSliceCenter.getZ (), zSP);\n\n putVertex (\n (kSliceCenter.getX () + tempVa.getX ()),\n (kSliceCenter.getY () + tempVa.getY ()),\n (kSliceCenter.getZ () + tempVa.getZ ())\n );\n tempVa = getVertexCoord (i);\n\n kNormal = new Vector3D (\n tempVa.getX () - center.getX (),\n tempVa.getY () - center.getY (),\n tempVa.getZ () - center.getZ ()\n );\n double mag = Math.sqrt (\n Math.pow (kNormal.getX (), 2) +\n Math.pow (kNormal.getY (), 2) +\n Math.pow (kNormal.getZ (), 2)\n );\n kNormal = new Vector3D (\n kNormal.getX () / mag,\n kNormal.getY () / mag,\n kNormal.getZ () / mag\n );\n if ( !viewInside ) {\n putNormal (\n kNormal.getX (),\n kNormal.getY (),\n kNormal.getZ ()\n );\n } else {\n putNormal (\n -kNormal.getX (),\n -kNormal.getY (),\n -kNormal.getZ ()\n );\n }\n i++;\n }\n\n// setVertexCoord(i, getVertexCoord(iSave));\n// setNormalCoord(i, getNormalCoord(iSave));\n putVertex (getVertexCoord (iSave));\n putNormal (getNormalCoord (iSave));\n i++;\n }\n\n // south pole\n if ( theta0 == -0.5 * Math.PI ) {\n putVertex (new Vector3D (\n center.getX (),\n center.getY (),\n (center.getZ () - radius)\n ));\n setVertexCount (i + 1);\n if ( !viewInside ) {\n putNormal (new Vector3D (0, 0, -1));\n } else {\n putNormal (new Vector3D (0, 0, 1));\n }\n setNormalCount (i + 1);\n i++;\n }\n\n // north pole\n if ( theta1 == 0.5 * Math.PI ) {\n putVertex (new Vector3D (\n center.getX (),\n center.getY (),\n center.getZ () + radius\n ));\n setVertexCount (i + 1);\n if ( !viewInside ) {\n putNormal (new Vector3D (0, 0, 1));\n } else {\n putNormal (new Vector3D (0, 0, -1));\n }\n setNormalCount (i + 1);\n i++;\n }\n }\n\n }","private void generateSphere() {\n\t\tint segments = 14;\n\t\tint rings = 15; // Use an odd number of rings of faces so that halfway up the sphere is the middle of a ring and not a loop of edges\n\t\tverts = new Vector[segments * (rings - 1) + 2]; // There are rings + 1 rings of vertices, but the first and last of these are each a single vertex\n\t\tfaces = new int[2 * segments * (rings - 1)][3]; // Apart from the first and last, each ring has segments number of square faces, so 2 * segments triangular faces. The first and last each have segments triangular faces\n\t\tverts[0] = new Vector(3);\n\t\tverts[0].setElement(1, -1); // The lowest point of the sphere\n\t\tfor (int i = 0; i < segments; i++) {\n\t\t\tif (i == segments - 1) {\n\t\t\t\tfaces[i] = new int[] {0, i + 1, 1}; // The last face involves the last vertex in the second ring and loops back to the first vertex in the second ring\n\t\t\t} else {\n\t\t\t\tfaces[i] = new int[] {0, i + 1, i + 2}; // Triangles involving the lowest vertex and two consecutive vertices in the second ring of vertices\n\t\t\t}\n\t\t}\n\t\tdouble pitchIncrement = Math.PI / rings; // The increment in pitch (angle above horizontal) between rings of vertices\n\t\tdouble pitch = pitchIncrement - Math.PI / 2; // The lowest point had a pitch of -pi/2\n\t\tdouble headingIncrement = Math.PI * 2.0 / segments; // The increment in heading between segments\n\t\tdouble heading = -Math.PI;\n\t\tfor (int r = 0; r < rings - 1; r++) { // Last ring is a single point and must be treated separately\n\t\t\tdouble y = Math.sin(pitch); // The y co-ordinate for each vertex in this ring\n\t\t\tdouble modulus = Math.cos(pitch); // The radius of the circle which this ring lies on\n\t\t\tfor (int s = 0; s < segments; s++) {\n\t\t\t\tdouble x = modulus * Math.cos(heading); // x co-ordinate for the next vertex\n\t\t\t\tdouble z = modulus * Math.sin(heading); // z co-ordinate for the next vertex\n\t\t\t\tverts[segments * r + s + 1] = new Vector(3);\n\t\t\t\tverts[segments * r + s + 1].setElements(new double[] {x, y, z});\n\t\t\t\theading += headingIncrement;\n\t\t\t}\n\t\t\t// Make faces between the vertices just added and the next ring of vertices to be added\n\t\t\tif (r != rings - 2) { // The second to last ring doesn't make faces with the next ring up in the same way because the last ring is a single vertex\n\t\t\t\tfor (int i = 0; i < segments; i++) {\n\t\t\t\t\tif (i == segments - 1) { // The last two faces make use of the first vertex in the next ring by looping back to the start\n\t\t\t\t\t\t// Two faces in the same plane\n\t\t\t\t\t\tfaces[i * 2 + segments * (2 * r + 1)] = new int[] {segments * r + i + 1, (segments * r + i + 1) + segments, segments * r + 1 + segments};\n\t\t\t\t\t\tfaces[i * 2 + segments * (2 * r + 1) + 1] = new int[] {segments * r + i + 1, segments * r + 1 + segments, segments * r + 1};\n\t\t\t\t\t} else {\n\t\t\t\t\t\t// Two faces that are in the same plane and appear as a quadrilateral\n\t\t\t\t\t\tfaces[i * 2 + segments * (2 * r + 1)] = new int[] {segments * r + i + 1, (segments * r + i + 1) + segments, (segments * r + i + 1) + segments + 1};\n\t\t\t\t\t\tfaces[i * 2 + segments * (2 * r + 1) + 1] = new int[] {segments * r + i + 1, (segments * r + i + 1) + segments + 1, (segments * r + i + 1) + 1};\n\t\t\t\t\t}\n\t\t\t\t}\n\t\t\t}\n\t\t\tpitch += pitchIncrement;\n\t\t}\n\t\tverts[verts.length - 1] = new Vector(3);\n\t\tverts[verts.length - 1].setElement(1, 1); // The last and highest vertex\n\t\tfor (int i = 0; i < segments; i++) {\n\t\t\tif (i == segments - 1) { // Last face completes the ring and includes the last vertex of the second to last ring\n\t\t\t\tfaces[2 * segments + segments * (2 * rings - 5) + i] = new int[] {segments * (rings - 2) + 1 + i, segments * (rings - 1) + 1, segments * (rings - 2) + 1};\n\t\t\t} else { // Faces involving the last vertex and two consecutive vertices in the second to last ring\n\t\t\t\tfaces[2 * segments + segments * (2 * rings - 5) + i] = new int[] {segments * (rings - 2) + 1 + i, segments * (rings - 1) + 1, segments * (rings - 2) + 1 + i + 1};\n\t\t\t}\n\t\t}\n\t}","public int getSquareLocation()\n\t\t{\n\t\t\treturn location; // return location of square\n\t\t}","protected void calculatePathfindingGrid(Tile[] tiles) {\n \n if(tiles == null) {\n return;\n }\n \n /**\n * Problem:\n * Because the tile size used by the path finding engine will most likely be\n * different from that of the visual effect size, we have to\n * look at all the visual tiles and judge whether they are blocking of\n * particular kinds of unit.\n * \n * Algorithm:\n * For land, air and sea take a look at the number of blocking/non-blocking\n * tiles there are and if there is over 50% either way then that will be the\n * PathTiles result.\n */\n \n // First get the size of the map in PathTile(s)\n int rows = getActualHeightInTiles();\n int cols = getActualWidthInTiles();\n \n // Calculate the number of tiles to a PathTile\n int tilesPerActualTilesX = getActualTileWidth() / getTileWidth();\n int tilesPerActualTilesY = getActualTileHeight() / getTileHeight();\n int tileCount = tilesPerActualTilesX * tilesPerActualTilesY;\n \n int tileCols = getWidthInTiles();\n \n // Create an array\n mPathTiles = new PathTile[ rows * cols ];\n \n // Iterate through these tiles\n for(int x = 0; x < cols ; x++) {\n for(int y = 0; y < rows; y++) {\n \n // Setup some variables\n int blockSea, blockAir, blockLand;\n blockAir = blockLand = blockSea = 0;\n \n // Figure out the percentage of each block\n for(int tx = 0; tx < tilesPerActualTilesX; tx++) {\n for(int ty = 0; ty < tilesPerActualTilesY; ty++) {\n \n int tileX = (x * tilesPerActualTilesX) + tx;\n int tileY = (y * tilesPerActualTilesY) + ty;\n \n Tile thisTile = tiles[ (tileY * tileCols) + tileX ];\n \n if(thisTile.blockAir()) {\n blockAir++;\n }\n \n if(thisTile.blockLand()) {\n blockLand++;\n }\n \n if(thisTile.blockSea()) {\n blockSea++;\n }\n \n }\n }\n \n // Calculate percentage\n float a,b,c;\n a = (float)blockAir / (float)tileCount;\n b = (float)blockLand / (float)tileCount;\n c = (float)blockSea / (float)tileCount;\n \n // Set the new tile\n mPathTiles[ (y * cols) + x ] = new PathTile( (a >= .5f), (b >= .5f), (c >= .5f) );\n \n // System.out.println(\"Grid \" + ((y * cols) + x) + \" (\" + x + \", \" + y + \") Air: \" + a + \" Land: \" + b + \" Sea: \" + c);\n \n }\n }\n \n }","public GridLocation getLocation();","private DPoint m2833m() {\r\n IPoint iPoint = new IPoint();\r\n this.f1769m.mo353a(this.f1761e.latitude, this.f1761e.longitude, iPoint);\r\n IPoint iPoint2 = new IPoint();\r\n this.f1769m.mo353a(this.f1762f.latitude, this.f1762f.longitude, iPoint2);\r\n IPoint iPoint3 = new IPoint();\r\n this.f1769m.mo353a(this.f1763g.latitude, this.f1763g.longitude, iPoint3);\r\n double d = (double) iPoint.f3639x;\r\n double d2 = (double) iPoint.f3640y;\r\n double d3 = (double) iPoint2.f3639x;\r\n double d4 = (double) iPoint2.f3640y;\r\n double d5 = (double) iPoint3.f3639x;\r\n double d6 = (double) iPoint3.f3640y;\r\n double d7 = (((d6 - d2) * ((((d4 * d4) - (d2 * d2)) + (d3 * d3)) - (d * d))) + ((d4 - d2) * ((((d2 * d2) - (d6 * d6)) + (d * d)) - (d5 * d5)))) / (((2.0d * (d3 - d)) * (d6 - d2)) - ((2.0d * (d5 - d)) * (d4 - d2)));\r\n double d8 = (((d5 - d) * ((((d3 * d3) - (d * d)) + (d4 * d4)) - (d2 * d2))) + ((d3 - d) * ((((d * d) - (d5 * d5)) + (d2 * d2)) - (d6 * d6)))) / (((2.0d * (d4 - d2)) * (d5 - d)) - ((2.0d * (d6 - d2)) * (d3 - d)));\r\n this.f1773q = Math.sqrt(((d - d7) * (d - d7)) + ((d2 - d8) * (d2 - d8)));\r\n this.f1774r = m2830a(d7, d8, d, d2);\r\n d = m2830a(d7, d8, d3, d4);\r\n this.f1775s = m2830a(d7, d8, d5, d6);\r\n if (this.f1774r < this.f1775s) {\r\n if (d <= this.f1774r || d >= this.f1775s) {\r\n this.f1775s -= 6.283185307179586d;\r\n }\r\n } else if (d <= this.f1775s || d >= this.f1774r) {\r\n this.f1775s += 6.283185307179586d;\r\n }\r\n return new DPoint(d7, d8);\r\n }","@Override\n public String toString() {\n String msg;\n int i;\n double mm[];\n\n mm = getMinMax();\n Vector3D p;\n\n msg = \"- QuadMesh ------------------------------------------------------------\\n\";\n msg += \" - Number of quads:\" + getNumQuads() + \"\\n\";\n msg += \" - Number of vertexes:\" + getNumVertices() + \"\\n\";\n p = new Vector3D(mm[0], mm[1], mm[2]);\n msg += \" - MINMAX: \" + p;\n p = new Vector3D(mm[3], mm[4], mm[5]);\n msg += \" - \" + p + \"\\n\";\n msg += \"---------------------------------------------------------------------------\\n\";\n return msg;\n }","public PVector cohesion (ArrayList boids) {\n float neighbordist = 90.0f;\n PVector steer = new PVector(0,0); // Start with empty vector to accumulate all locations\n int count = 0;\n for (Boid other : boids) {\n float d = PVector.dist(location,other.location);\n if ((d > 0) && (d < neighbordist)) {\n steer.add(other.location); // Add location\n count++;\n }\n }\n if (count > 0) {\n steer.div((float)count);\n return seek(steer); // Steer towards the location\n }\n return steer;\n }","public interface Path {\n\tVector2D [] getPointsAsArray();\n\n\tList getPointsAsList();\n}","public ViewerCube getCube() {\n return cube;\n }","@Override\n\tpublic String toString() {\n\t\treturn \"Cube(\" + this.nom + \")@(\" + this.centre.getX() + \", \" + this.centre.getY() + \", \" + this.centre.getZ() + \") ar�te : \"+this.arete;\n\t}","void setupGrid() {\n\n // create a Switch for the spheres, allow switch changes\n gridSwitch = new Switch(Switch.CHILD_NONE);\n gridSwitch.setCapability(Switch.ALLOW_SWITCH_WRITE);\n\n // Set up an appearance to make the square3s with red ambient,\n // black emmissive, red diffuse and black specular coloring\n Material material = new Material(red, black, red, black, 64);\n Appearance appearance = new Appearance();\n appearance.setMaterial(material);\n\n // create a grid of quads\n int gridSize = 20; // grid is gridSize quads along each side\n int numQuads = gridSize * gridSize;\n int numVerts = numQuads * 4; // 4 verts per quad\n // there will be 3 floats per coord and 4 coords per quad\n float[] coords = new float[3 * numVerts];\n // All the quads will use the same normal at each vertex, so\n // allocate an array to hold references to the same normal\n Vector3f[] normals = new Vector3f[numVerts];\n Vector3f vertNormal = new Vector3f(0.0f, 0.0f, 1.0f);\n float edgeLength = 5.0f; // length of each edge of the grid\n float gridGap = 0.03f; // the gap between each quad\n // length of each quad is (total length - sum of the gaps) / gridSize\n float quadLength = (edgeLength - gridGap * (gridSize - 1)) / gridSize;\n\n // create a grid of quads in the z=0 plane\n // each has a TransformGroup to position the sphere which contains\n // a link to the shared group for the sphere\n float curX, curY;\n for (int y = 0; y < gridSize; y++) {\n curY = y * (quadLength + gridGap); // offset to lower left corner\n curY -= edgeLength / 2; // center on 0,0\n for (int x = 0; x < gridSize; x++) {\n // this is the offset into the vertex array for the first\n // vertex of the quad\n int vertexOffset = (y * gridSize + x) * 4;\n // this is the offset into the coord array for the first\n // vertex of the quad, where there are 3 floats per vertex\n int coordOffset = vertexOffset * 3;\n curX = x * (quadLength + gridGap); // offset to ll corner\n curX -= edgeLength / 2; // center on 0,0\n // lower left corner\n coords[coordOffset + 0] = curX;\n coords[coordOffset + 1] = curY;\n coords[coordOffset + 2] = 0.0f; // z\n // lower right corner\n coords[coordOffset + 3] = curX + quadLength;\n coords[coordOffset + 4] = curY;\n coords[coordOffset + 5] = 0.0f; // z\n // upper right corner\n coords[coordOffset + 6] = curX + quadLength;\n coords[coordOffset + 7] = curY + quadLength;\n coords[coordOffset + 8] = 0.0f; // z\n // upper left corner\n coords[coordOffset + 9] = curX;\n coords[coordOffset + 10] = curY + quadLength;\n coords[coordOffset + 11] = 0.0f; // z\n for (int i = 0; i < 4; i++) {\n normals[vertexOffset + i] = vertNormal;\n }\n }\n }\n // now that we have the data, create the QuadArray\n QuadArray quads = new QuadArray(numVerts, QuadArray.COORDINATES\n | QuadArray.NORMALS);\n quads.setCoordinates(0, coords);\n quads.setNormals(0, normals);\n\n // create the shape\n Shape3D shape = new Shape3D(quads, appearance);\n\n // add it to the switch\n gridSwitch.addChild(shape);\n }","private void setCofR() {\n\t\t\n Vector3f pos_vec = new Vector3f();\n Point3f pos = new Point3f();\n Vector3f dir = new Vector3f();\n\t\tMatrix4f view_mtx = new Matrix4f();\n\t\tMatrix4f nav_mtx = new Matrix4f();\n Point3f cor = new Point3f();\n\t\t\n\t\tnavigationTransform.getTransform(nav_mtx);\n\t\t\n\t\tdata.viewpointTransform.getTransform(view_mtx);\n\t\tview_mtx.get(pos_vec);\n\t\t\n\t\t// the eye point\n\t\tpos.set(pos_vec);\n\t\t\n\t\t// the eye direction\n\t\tdir.x = view_mtx.m02;\n\t\tdir.y = view_mtx.m12;\n\t\tdir.z = view_mtx.m22;\n\t\tdir.negate();\n\t\tdir.normalize();\n\t\t\n\t\t// transform into world space\n\t\tnav_mtx.transform(pos);\n\t\tnav_mtx.transform(dir);\n\t\t\n\t\tArrayList pickResults = new ArrayList();\n\t\tPickRequest pickRequest = new PickRequest();\n\t\tpickRequest.pickGeometryType = PickRequest.PICK_RAY;\n\t\tpickRequest.pickSortType = PickRequest.SORT_ORDERED;\n\t\tpickRequest.pickType = PickRequest.FIND_GENERAL;\n\t\tpickRequest.useGeometry = false;\n\t\tpickRequest.foundPaths = pickResults;\n\t\t\n\t\t// initialize the pick request\n\t\tpickRequest.origin[0] = pos.x;\n\t\tpickRequest.origin[1] = pos.y;\n\t\tpickRequest.origin[2] = pos.z;\n\t\t\n\t\tpickRequest.destination[0] = dir.x;\n\t\tpickRequest.destination[1] = dir.y;\n\t\tpickRequest.destination[2] = dir.z;\n\t\t\n\t\trootGroup.pickSingle(pickRequest);\n\t\t\n\t\tif (pickRequest.pickCount > 0) {\n\t\t\t\n \tPoint3f intersectPoint = new Point3f();\n \tVector3f intersectVector = new Vector3f();\n\t\t\n\t\t\tfloat min_distance = Float.MAX_VALUE;\n\t\t\t// sort through the bounds intersections\n\t\t\tint num_pick = pickResults.size();\n\t\t\tfor (int i = 0; i < num_pick; i++) {\n\t\t\t\t\n\t\t\t\tSceneGraphPath sgp = (SceneGraphPath)pickResults.get(i);\n\t\t\t\tsgp.getTransform(view_mtx);\n\t\t\t\t\n\t\t\t\tShape3D shape = (Shape3D)sgp.getTerminalNode();\n\t\t\t\tVertexGeometry geom = (VertexGeometry)shape.getGeometry();\n\t\t\t\t\n\t\t\t\t//determine if there was an actual geometry intersection\n\t\t\t\tboolean intersect = iutils.rayUnknownGeometry(\n\t\t\t\t\tpos,\n\t\t\t\t\tdir,\n\t\t\t\t\t0,\n\t\t\t\t\tgeom,\n\t\t\t\t\tview_mtx,\n\t\t\t\t\tintersectPoint,\n\t\t\t\t\tfalse);\n\t\t\t\t\n\t\t\t\tif (intersect) {\n\t\t\t\t\tintersectVector.set(\n\t\t\t\t\t\tintersectPoint.x - pos.x,\n\t\t\t\t\t\tintersectPoint.y - pos.y,\n\t\t\t\t\t\tintersectPoint.z - pos.z);\n\n\t\t\t\t\tfloat distance = intersectVector.length();\n\t\t\t\t\tif (distance < min_distance) {\n\t\t\t\t\t\tmin_distance = distance;\n\t\t\t\t\t\tcor.set(intersectPoint);\n\t\t\t\t\t}\n\t\t\t\t}\n\t\t\t} \n\t\t\tnav_mtx.invert();\n\t\t\tnav_mtx.transform(cor);\n\t\t}\n\t\tcenterOfRotation.set(cor);\n\t}","@Override\n public String toString() {\n return this.area + \"/\" + this.aisle + \"/\" + this.x + \"/\" + this.y + \"/\" + this.z;\n }","public CubeGL2() {\n // Define points for a cube.\n // X, Y, Z\n mCubeVertexData = new float[]\n {\n // Front face\n -1.0f, 1.0f, 1.0f,\n -1.0f, -1.0f, 1.0f,\n 1.0f, 1.0f, 1.0f,\n -1.0f, -1.0f, 1.0f,\n 1.0f, -1.0f, 1.0f,\n 1.0f, 1.0f, 1.0f,\n // Right face\n 1.0f, 1.0f, 1.0f,\n 1.0f, -1.0f, 1.0f,\n 1.0f, 1.0f, -1.0f,\n 1.0f, -1.0f, 1.0f,\n 1.0f, -1.0f, -1.0f,\n 1.0f, 1.0f, -1.0f,\n // Back face\n 1.0f, 1.0f, -1.0f,\n 1.0f, -1.0f, -1.0f,\n -1.0f, 1.0f, -1.0f,\n 1.0f, -1.0f, -1.0f,\n -1.0f, -1.0f, -1.0f,\n -1.0f, 1.0f, -1.0f,\n // Left face\n -1.0f, 1.0f, -1.0f,\n -1.0f, -1.0f, -1.0f,\n -1.0f, 1.0f, 1.0f,\n -1.0f, -1.0f, -1.0f,\n -1.0f, -1.0f, 1.0f,\n -1.0f, 1.0f, 1.0f,\n // Top face\n -1.0f, 1.0f, -1.0f,\n -1.0f, 1.0f, 1.0f,\n 1.0f, 1.0f, -1.0f,\n -1.0f, 1.0f, 1.0f,\n 1.0f, 1.0f, 1.0f,\n 1.0f, 1.0f, -1.0f,\n // Bottom face\n 1.0f, -1.0f, -1.0f,\n 1.0f, -1.0f, 1.0f,\n -1.0f, -1.0f, -1.0f,\n 1.0f, -1.0f, 1.0f,\n -1.0f, -1.0f, 1.0f,\n -1.0f, -1.0f, -1.0f,\n };\n // R, G, B, A\n mCubeColourData = new float[]\n {\n // Front face\n 1.0f, 0.0f, 0.0f, 1.0f,\n 1.0f, 0.0f, 0.0f, 1.0f,\n 1.0f, 0.0f, 0.0f, 1.0f,\n 1.0f, 0.0f, 0.0f, 1.0f,\n 1.0f, 0.0f, 0.0f, 1.0f,\n 1.0f, 0.0f, 0.0f, 1.0f,\n // Right face\n 0.0f, 1.0f, 0.0f, 1.0f,\n 0.0f, 1.0f, 0.0f, 1.0f,\n 0.0f, 1.0f, 0.0f, 1.0f,\n 0.0f, 1.0f, 0.0f, 1.0f,\n 0.0f, 1.0f, 0.0f, 1.0f,\n 0.0f, 1.0f, 0.0f, 1.0f,\n // Back face\n 0.0f, 0.0f, 1.0f, 1.0f,\n 0.0f, 0.0f, 1.0f, 1.0f,\n 0.0f, 0.0f, 1.0f, 1.0f,\n 0.0f, 0.0f, 1.0f, 1.0f,\n 0.0f, 0.0f, 1.0f, 1.0f,\n 0.0f, 0.0f, 1.0f, 1.0f,\n // Left face\n 1.0f, 1.0f, 0.0f, 1.0f,\n 1.0f, 1.0f, 0.0f, 1.0f,\n 1.0f, 1.0f, 0.0f, 1.0f,\n 1.0f, 1.0f, 0.0f, 1.0f,\n 1.0f, 1.0f, 0.0f, 1.0f,\n 1.0f, 1.0f, 0.0f, 1.0f,\n // Top face\n 0.0f, 1.0f, 1.0f, 1.0f,\n 0.0f, 1.0f, 1.0f, 1.0f,\n 0.0f, 1.0f, 1.0f, 1.0f,\n 0.0f, 1.0f, 1.0f, 1.0f,\n 0.0f, 1.0f, 1.0f, 1.0f,\n 0.0f, 1.0f, 1.0f, 1.0f,\n // Bottom face\n 1.0f, 0.0f, 1.0f, 1.0f,\n 1.0f, 0.0f, 1.0f, 1.0f,\n 1.0f, 0.0f, 1.0f, 1.0f,\n 1.0f, 0.0f, 1.0f, 1.0f,\n 1.0f, 0.0f, 1.0f, 1.0f,\n 1.0f, 0.0f, 1.0f, 1.0f\n };\n // X, Y, Z\n mCubeNormalData = new float[]\n {\n // Front face\n 0.0f, 0.0f, 1.0f,\n 0.0f, 0.0f, 1.0f,\n 0.0f, 0.0f, 1.0f,\n 0.0f, 0.0f, 1.0f,\n 0.0f, 0.0f, 1.0f,\n 0.0f, 0.0f, 1.0f,\n // Right face\n 1.0f, 0.0f, 0.0f,\n 1.0f, 0.0f, 0.0f,\n 1.0f, 0.0f, 0.0f,\n 1.0f, 0.0f, 0.0f,\n 1.0f, 0.0f, 0.0f,\n 1.0f, 0.0f, 0.0f,\n // Back face\n 0.0f, 0.0f, -1.0f,\n 0.0f, 0.0f, -1.0f,\n 0.0f, 0.0f, -1.0f,\n 0.0f, 0.0f, -1.0f,\n 0.0f, 0.0f, -1.0f,\n 0.0f, 0.0f, -1.0f,\n // Left face\n -1.0f, 0.0f, 0.0f,\n -1.0f, 0.0f, 0.0f,\n -1.0f, 0.0f, 0.0f,\n -1.0f, 0.0f, 0.0f,\n -1.0f, 0.0f, 0.0f,\n -1.0f, 0.0f, 0.0f,\n // Top face\n 0.0f, 1.0f, 0.0f,\n 0.0f, 1.0f, 0.0f,\n 0.0f, 1.0f, 0.0f,\n 0.0f, 1.0f, 0.0f,\n 0.0f, 1.0f, 0.0f,\n 0.0f, 1.0f, 0.0f,\n // Bottom face\n 0.0f, -1.0f, 0.0f,\n 0.0f, -1.0f, 0.0f,\n 0.0f, -1.0f, 0.0f,\n 0.0f, -1.0f, 0.0f,\n 0.0f, -1.0f, 0.0f,\n 0.0f, -1.0f, 0.0f\n };\n // X, Y\n // Texture coordinate data.\n mCubeTextureCoordinateData = new float[]\n {\n // Front face\n 0.0f, 0.0f,\n 0.0f, 1.0f,\n 1.0f, 0.0f,\n 0.0f, 1.0f,\n 1.0f, 1.0f,\n 1.0f, 0.0f,\n // Right face\n 0.0f, 0.0f,\n 0.0f, 1.0f,\n 1.0f, 0.0f,\n 0.0f, 1.0f,\n 1.0f, 1.0f,\n 1.0f, 0.0f,\n // Back face\n 0.0f, 0.0f,\n 0.0f, 1.0f,\n 1.0f, 0.0f,\n 0.0f, 1.0f,\n 1.0f, 1.0f,\n 1.0f, 0.0f,\n // Left face\n 0.0f, 0.0f,\n 0.0f, 1.0f,\n 1.0f, 0.0f,\n 0.0f, 1.0f,\n 1.0f, 1.0f,\n 1.0f, 0.0f,\n // Top face\n 0.0f, 0.0f,\n 0.0f, 1.0f,\n 1.0f, 0.0f,\n 0.0f, 1.0f,\n 1.0f, 1.0f,\n 1.0f, 0.0f,\n // Bottom face\n 0.0f, 0.0f,\n 0.0f, 1.0f,\n 1.0f, 0.0f,\n 0.0f, 1.0f,\n 1.0f, 1.0f,\n 1.0f, 0.0f\n };\n // Initialize the buffers.\n mCubeVertices = ByteBuffer.allocateDirect(mCubeVertexData.length * 4)\n .order(ByteOrder.nativeOrder()).asFloatBuffer();\n mCubeVertices.put(mCubeVertexData).position(0);\n mCubeColours = ByteBuffer.allocateDirect(mCubeColourData.length * 4)\n .order(ByteOrder.nativeOrder()).asFloatBuffer();\n mCubeColours.put(mCubeColourData).position(0);\n mCubeNormals = ByteBuffer.allocateDirect(mCubeNormalData.length * 4)\n .order(ByteOrder.nativeOrder()).asFloatBuffer();\n mCubeNormals.put(mCubeNormalData).position(0);\n mCubeTextureCoordinates = ByteBuffer.allocateDirect(mCubeTextureCoordinateData.length * 4)\n .order(ByteOrder.nativeOrder()).asFloatBuffer();\n mCubeTextureCoordinates.put(mCubeTextureCoordinateData).position(0);\n Matrix.setIdentityM(mModelMatrix, 0);\n }","@GetMapping(\"ElementWebService/getAllCoords\")\n\tpublic String getAllHQCoords() {\n\t\tList elementList = elementService.getAll();\n\t\tList coordList = new ArrayList();\n\t\tfor(Element element: elementList) {\n\t\t\tcoordList.add(element.getLocation());\n\t\t}\n\t\treturn Tools.toJsonString(coordList);\n\t}","public MasonGeometry getGeometry() {return agentLocation;}","CubeModel() {\n r = 0;\n c = 0;\n s = 4;\n grid = new boolean [4][4];\n the_cube = new boolean[6];\n moves = 0;\n\n }","public Vector3f getInterpolatedPhysicsLocation(Vector3f location) {\n if (location == null) {\n location = new Vector3f();\n }\n rBody.getInterpolationWorldTransform(tempTrans);\n return Converter.convert(tempTrans.origin, location);\n }","@Test\n void contains() {\n Cuboid cuboid1 = new Cuboid(4, 4, 4);\n Point3D point1 = new Point3D(0,0,0);\n assertEquals(true, cuboid1.contains(point1));\n\n Point3D point2 = new Point3D(0,0,2);\n assertEquals(true, cuboid1.contains(point2));\n\n Point3D point3 = new Point3D(0,0,-2);\n assertEquals(true, cuboid1.contains(point3));\n\n Point3D point4 = new Point3D(0,2,0);\n assertEquals(true, cuboid1.contains(point4));\n\n Point3D point5 = new Point3D(0,-2,0);\n assertEquals(true, cuboid1.contains(point5));\n\n Point3D point6 = new Point3D(2,0,0);\n assertEquals(true, cuboid1.contains(point6));\n\n Point3D point7 = new Point3D(-2,0,0);\n assertEquals(true, cuboid1.contains(point7));\n\n Point3D point8 = new Point3D(-2,-2,-2);\n assertEquals(true, cuboid1.contains(point8));\n\n Point3D point9 = new Point3D(-2,-2,-3);\n assertEquals(false, cuboid1.contains(point9));\n\n\n //Arbitary orientation\n Cuboid cuboid2 = new Cuboid(4, 5, 7, new Ray(new Point3D(-2,-2,-2), new Vector3D(1,1,1)));\n Point3D point21 = new Point3D(-1,-1,-1);\n assertEquals(true, cuboid2.contains(point21));\n\n Cuboid cuboid3 = new Cuboid(4, 5, 6, new Ray(new Point3D(-2,-2,-2), new Vector3D(1,1,1)));\n Point3D point31 = new Point3D(0,0,0);\n assertEquals(false, cuboid3.contains(point31));\n\n Cuboid cuboid4 = new Cuboid(4, 5, 6, new Ray(new Point3D(0,0,0), new Vector3D(1,1,1)));\n Point3D point41 = new Point3D(2.5,2.5,2.5);\n assertEquals(false, cuboid4.contains(point41));\n\n Cuboid cuboid5 = new Cuboid(4, 5, 6, new Ray(new Point3D(-2,-2,-2), new Vector3D(0,0,1)));\n Point3D point51 = new Point3D(-2,-2,3.5);\n assertEquals(false, cuboid5.contains(point51));\n }","public static void main(String[] args){\n Mesh3D box = Mesh3D.box(10, 20, 60);\n \n Line3D lineX = box.getLineX();\n Line3D lineY = box.getLineY();\n Line3D lineZ = box.getLineZ();\n lineX.show();\n lineY.show();\n lineZ.show();\n box.translateXYZ(100, 0.0, 0.0); \n box.show();\n Line3D line = new Line3D(); \n List intersects = new ArrayList();\n \n for(int p = 0; p < 100; p++){\n double r = 600;\n double theta = Math.toRadians(90.0);//Math.toRadians(Math.random()*180.0);\n double phi = Math.toRadians(Math.random()*360.0-180.0);\n line.set(0.0,0.0,0.0, \n Math.sin(theta)*Math.cos(phi)*r,\n Math.sin(theta)*Math.sin(phi)*r,\n Math.cos(theta)*r\n );\n intersects.clear();\n box.intersectionRay(line, intersects);\n System.out.println(\"theta/phi = \" + Math.toDegrees(theta) + \" \"\n + Math.toDegrees(phi) + \" intersects = \" + intersects.size());\n \n }\n }","private static void setQui(){\n int mX, mY;\n for (Integer integer : qList) {\n mY = (int) (Math.floor(1.f * integer / Data.meshRNx));\n mX = integer - Data.meshRNx * mY;\n if (Data.densCells[mX][mY] > Data.gwCap[mX][mY] * .75) {\n for (int j = 0; j < Data.densCells[mX][mY]; j++) {\n Cell cell = (Cell) cells.get(Data.idCellsMesh[mX][mY][j]);\n cell.vState = true;\n cell.quiescent = Data.densCells[mX][mY] >= Data.gwCap[mX][mY];\n }\n }\n }\n }","public float magnitude() {\r\n \r\n return (float)Math.sqrt(x*x + y*y + z*z);\r\n }","public List getSquareGrid();","public Position[] getPath() {\n\t\treturn path;\n\t}","public double[] getSolutionsInRadius(){\n\t\t\n\t\t\n\t}","@Override\n\tpublic double getZLoc() {\n\t\tdouble side = Math.sqrt(getMySize())/2;\n\t\treturn z-side;\n\t}","public float[] calibrate(Base mBase, Sensor mSensor) {\n final double metersPerLatitude;\n final double metersPerLongitude;\n\n\n\n //Fetching the cisco position for the robot, which returns\n float ciscoLong = (float) 8.57617285865058;\n float ciscoLat = (float) 58.33447638466072;\n\n\n metersPerLongitude = distanceCalculator.calculateDistance(ciscoLong, ciscoLat, ciscoLong + 1.0, ciscoLat);\n\n metersPerLatitude= distanceCalculator.calculateDistance(ciscoLong, ciscoLat, ciscoLong, ciscoLat + 1.0);\n\n\n float originCiscoPositionx = ciscoLong * (float) metersPerLongitude;\n float originCiscoPositiony = ciscoLat * (float) metersPerLatitude;\n\n\n //Driving 1 meter forward test\n //mBase.addCheckPoint(1, 0);\n\n\n //GetCiscoPosition()\n //These are the actual coordinates of x2 and y2 in latitude and longitude.\n\n\n\n //If Loomo was already headed east, we would expect these coordinates in meters:\n float expectedCiscoPositionx2 = (originCiscoPositionx + 1);\n\n float newCiscoPointlon = (float) 8.57617413279317;\n float newCiscoPointlat = (float) 58.334468102336245;\n\n\n float actualCiscoPositionx2 = newCiscoPointlon * (float) metersPerLongitude;\n float actualCiscoPositiony2 = newCiscoPointlat * (float) metersPerLatitude;\n\n\n\n //Defining 3 vectors that make up a triangle abc\n double[] aVector = {expectedCiscoPositionx2 - originCiscoPositionx, originCiscoPositiony - originCiscoPositiony};\n double[] bVector = {actualCiscoPositionx2 - originCiscoPositionx, actualCiscoPositiony2 - originCiscoPositiony};\n double[] cVector = {expectedCiscoPositionx2 - actualCiscoPositionx2, originCiscoPositiony - actualCiscoPositiony2};\n\n\n\n //Calculating the length of each vector / side of the triangle with the pythagorean therm.\n double aVectorLengthSquared = Math.pow(aVector[0], 2.0) + Math.pow(aVector[1], 2.0);\n double bVectorLengthSquared = Math.pow(bVector[0], 2.0) + Math.pow(bVector[1], 2.0);\n double cVectorLengthSquared = Math.pow(cVector[0], 2.0) + Math.pow(cVector[1], 2.0);\n\n System.out.println(\"Length a = \" + sqrt(aVectorLengthSquared));\n System.out.println(\"Length b = \" + sqrt(bVectorLengthSquared));\n System.out.println(\"Length c = \" + sqrt(cVectorLengthSquared));\n System.out.println(\" \");\n\n //Calculating the angle between the vector from the expected points and the vector from the\n // real points using the cosine law. This gives us an angle ∈ [0,PI].\n float angle = (float) acos((aVectorLengthSquared + bVectorLengthSquared - cVectorLengthSquared)\n / (2 * sqrt(aVectorLengthSquared) * sqrt(bVectorLengthSquared)));\n\n\n\n //If the y-element of the b-vector is negative, that means loomo has been driving\n // southwards. This means, if we are to rotate the coordinates to fit loomo,\n // they will need to be rotated in the positive direction, or against the clock. -> angle = angle\n // If the y-element is positive, then loomo has been driving north, and the coordinates will\n // need to be rotated with the clock. Then \"angle\" will be the negative value\n // found with the cosine law.\n\n if (bVector[1] < 0) {\n angle = angle;\n } else if (bVector[1] > 0) {\n angle = -angle;\n }\n\n System.out.println(\"The angle between the reference systems are: \" + angle + \", which equals \" + angle / PI + \"*PI\\n\" );\n\n mBase.cleanOriginalPoint();\n\n //Setting Fetching the original point where Loomo stands.\n mBase.cleanOriginalPoint();\n Pose2D pose2D = mBase.getOdometryPose(-1);\n mBase.setOriginalPoint(pose2D);\n\n //Driving North: \t58.334512491588754, 8.576253530218082 to 58.33452608839093, 8.576253888068521\n //Driving East: 58.33452608839093, 8.576253888068521 to 58.33452618178464, 8.576285073219395\n //Driving West: 58.33452618178464, 8.576285073219395 to 58.33452693486112, 8.576258173706947\n //Driving South: 58.33452693486112, 8.576258173706947 to 58.33451544969185, 8.576258890746544\n\n float[] calibInfo = {angle, (float) metersPerLongitude, (float) metersPerLatitude};\n return calibInfo;\n }","public float getMagnitude() {\n return (float) Math.sqrt(Math.pow(latComponent, 2) + Math.pow(longComponent, 2));\n }","private QuadTree[] findChild(QuadTree parent) {\n double point1_lon = parent.ullon;\n double point1_lat = parent.ullat;\n double point2_lon = (parent.lrlon + parent.ullon) / 2;\n double point2_lat = parent.ullat;\n double point3_lon = parent.ullon;\n double point3_lat = (parent.ullat + parent.lrlat) / 2;\n double point4_lon = (parent.lrlon + parent.ullon) / 2;\n double point4_lat = (parent.ullat + parent.lrlat) / 2;\n double point5_lon = (parent.lrlon + parent.ullon) / 2;\n double point5_lat = parent.lrlat;\n double point6_lon = parent.lrlon;\n double point6_lat = parent.lrlat;\n double point7_lon = parent.lrlon;\n double point7_lat = (parent.ullat + parent.lrlat) / 2;\n QuadTree ul, ur, ll, lr;\n if (parent.name.equals(\"root\")) {\n ul = new QuadTree(\"1\", point1_lon, point1_lat, point4_lon, point4_lat, parent.depth + 1);\n ur = new QuadTree(\"2\", point2_lon, point2_lat, point7_lon, point7_lat, parent.depth + 1);\n ll = new QuadTree(\"3\", point3_lon, point3_lat, point5_lon, point5_lat, parent.depth + 1);\n lr = new QuadTree(\"4\", point4_lon, point4_lat, point6_lon, point6_lat, parent.depth + 1);\n } else {\n ul = new QuadTree(parent.name + \"1\", point1_lon, point1_lat, point4_lon, point4_lat, parent.depth + 1);\n ur = new QuadTree(parent.name + \"2\", point2_lon, point2_lat, point7_lon, point7_lat, parent.depth + 1);\n ll = new QuadTree(parent.name + \"3\", point3_lon, point3_lat, point5_lon, point5_lat, parent.depth + 1);\n lr = new QuadTree(parent.name + \"4\", point4_lon, point4_lat, point6_lon, point6_lat, parent.depth + 1);\n }\n QuadTree[] child = new QuadTree[4];\n child[0] = ul;\n child[1] = ur;\n child[2] = ll;\n child[3] = lr;\n return child;\n }","int cubeRow() {\n return r;\n }","public void zeichneQuadrate(){\n for (int i=0; i<10;i++)\n rect (50+i*25,50,25,25);\n }","@Override\n public ArrayList solveMaze() {\n\n\n try {\n Client client = new Client(InetAddress.getLocalHost(), 5401, new IClientStrategy() {\n @Override\n public void clientStrategy(InputStream inFromServer, OutputStream outToServer) {\n try {\n ObjectOutputStream toServer = new ObjectOutputStream(outToServer);\n ObjectInputStream fromServer = new ObjectInputStream(inFromServer);\n toServer.flush();\n toServer.writeObject(maze); //send maze to server\n toServer.flush();\n Solution mazeSolution = (Solution) fromServer.readObject(); //read generated maze (compressed with MyCompressor) from server\n\n ArrayList mazeSolutionSteps = mazeSolution.getSolutionPath();\n solutionArray = new ArrayList<>();\n for (AState mazeSolutionStep : mazeSolutionSteps) {\n\n String[] dimensions = mazeSolutionStep.toString().split(\"[{},]\");\n int[] position = new int[2];\n position[0] = Integer.parseInt(dimensions[1]);\n position[1] = Integer.parseInt(dimensions[2]);\n\n solutionArray.add(position);\n }\n } catch (Exception e) {\n e.printStackTrace();\n }\n }\n });\n client.communicateWithServer();\n } catch (UnknownHostException e) {\n e.printStackTrace();\n }\n\n\n return solutionArray;\n }","protected final String look(int direction, boolean steps) {\r\n \t\r\n \t//pay the LOOK_ENERGY_COST\r\n \tenergy = energy - Params.LOOK_ENERGY_COST;\r\n \tint look;\r\n \t//get the x and y coordinates of the critter\r\n \tint xCoord = this.x_coord;\r\n \tint yCoord = this.y_coord;\r\n \t\r\n \tif(steps == true)\r\n \t\tlook = 2; //look 2 steps\r\n \telse \r\n \t\tlook = 1; //look 1 step\r\n \t\r\n \t//get the coordinate position of the location to look\r\n \tswitch(direction) {\r\n \tcase 0:\r\n \t\txCoord += look; //straight right \r\n \t\tbreak;\r\n \t\t\r\n \tcase 1:\r\n \t\txCoord += look; //diagonally up and to the right\r\n \t\tyCoord -= look;\r\n \t\tbreak;\r\n \t\t\r\n \tcase 2:\r\n \t\tyCoord -= look; //straight up\r\n \t\tbreak;\r\n \t\t\r\n \tcase 3: \r\n \t\txCoord -= look; //diagonally up and to left\r\n \t\tyCoord -= look;\r\n \t\tbreak;\r\n \t\t\r\n \tcase 4:\r\n \t\txCoord -= look; //straight left\r\n \t\tbreak;\r\n \t\r\n \tcase 5:\r\n \t\txCoord -= look; //diagonally down and to left\r\n \t\tyCoord += look; \r\n \t\tbreak;\r\n \t\t\r\n \tcase 6:\r\n \t\tyCoord += look; //diagonally down\r\n \t\tbreak;\r\n \t\t\r\n \tcase 7:\r\n \t\txCoord += look; //diagonally down and to right\r\n \t\tyCoord += look;\r\n \t\tbreak;\r\n \t}\r\n \t\r\n \t//wrap-around world, need to correct coordinates\r\n \tif(xCoord > (Params.WORLD_WIDTH - 1))\r\n \t\txCoord %= Params.WORLD_WIDTH;\r\n \telse if(xCoord < 0)\r\n \t\txCoord += Params.WORLD_WIDTH;\r\n \tif(yCoord > (Params.WORLD_HEIGHT - 1))\r\n \t\tyCoord %= Params.WORLD_HEIGHT;\r\n \telse if(yCoord < 0)\r\n \t\tyCoord += Params.WORLD_HEIGHT;\r\n \r\n \t//Iterate through population hashMap\r\n \tIterator positionIter = population.keySet().iterator();\r\n \t//Iterate through all of the position keys\r\n \twhile(positionIter.hasNext()) {\r\n \t\t//get the position key\r\n \t\tString position = positionIter.next();\r\n \t\t//get the critter list in that position\r\n \t\tArrayList critterList = population.get(position);\r\n \t\t//iterate through the critters \r\n \t\tListIterator currCritter = critterList.listIterator();\r\n \t\twhile(currCritter.hasNext()) {\r\n \t\t\t//get a critter\r\n \t\t\tCritter c = currCritter.next();\r\n \t\t\t//check whether each critter is in the position\r\n \t\t\tif(c.x_coord == xCoord && c.y_coord == yCoord) {\r\n \t\t\t\tif(c.getEnergy() >= 0) {\r\n \t\t\t\t\treturn c.toString();\r\n \t\t\t\t}\r\n \t\t\t}\r\n \t\t}\r\n \t}\r\n \t\r\n \t//return null if the position is unoccupied\r\n \treturn null;\r\n }","protected long travel() {\n\n return Math.round(((1 / Factory.VERTEX_PER_METER_RATIO) / (this.speed / 3.6)) * 1000);\n }","private List getPath(int index) {\n\t\t \n\t \n\t\t Node fromNode = oEdge.fromNode;\n\t\t Node toNode = oEdge.toNode;\n\t\t float x1 = fromNode.longitude;\n\t\t float x2 = toNode.longitude;\n\t\t float y1 = fromNode.latitude;\n\t\t float y2 = toNode.latitude;\n\t\t double slope, angle;\n\t\t if(x1!=x2) {\n\t\t\t slope = (y2-y1)/(x2-x1);\n\t\t\t \tangle = Math.atan(slope);\n\t\t\t \t} else {\n\t\t\t \t\tangle = Math.PI/2;\n\t\t\t \t}\n\t\t Double L = Math.sqrt((x1-x2)*(x1-x2)+(y1-y2)*(y1-y2));\n\t\t float offsetPixels=0;\n\t\t if(Math.toDegrees(angle)>Math.toDegrees(90)) {\n\t\t\t if (index==0){\n\t\t\t\t offsetPixels=roadWidth*6/10;\n\t\t\t }\n\t\t\t else if(index==1){\n\t\t\t\t offsetPixels=roadWidth*11/10;\n\t\t\t }\n\t\t\t else if(index==-1){\n\t\t\t\t offsetPixels=roadWidth*1/10;\n\t\t\t }\n\t\t\t \n\t\t } else {\n\t\t\t \n\t\t\t if (index==0){\n\t\t\t\t offsetPixels=-roadWidth*6/10;\n\t\t\t }\n\t\t\t else if(index==1){\n\t\t\t\t offsetPixels=-roadWidth*11/10;\n\t\t\t }\n\t\t\t else if(index==-1){\n\t\t\t\t offsetPixels=-roadWidth*1/10;\n\t\t\t }\n\t\t }\n\t\t \n\t\t // This is the first parallel line\n\t\t float x1p1 = x1 + offsetPixels * (y2-y1) / L.floatValue();\n\t\t float x2p1 = x2 + offsetPixels * (y2-y1) / L.floatValue();\n\t\t float y1p1 = y1 + offsetPixels * (x1-x2) / L.floatValue();\n\t\t float y2p1 = y2 + offsetPixels * (x1-x2) / L.floatValue();\n//\t\t if(oEdge.edgeID==16) {\n//\t\t\t System.out.println(\"testing\");\n//\t\t }\n\t\t \n\t\t Point P1 = new Point(x1p1,y1p1);\n\t\t Point P2 = new Point(x2p1,y2p1);\n\t\t List gP = GetPoints(P1, P2);\n\t\t return gP;\n\t \n\t}","public abstract List getInterpolatedPoints();","public float[] getLocation() {\n return llpoints;\n }","public void getNeighbors(){\n // North \n if(this.row - this.value>=0){\n this.north = adjacentcyList[((this.row - this.value)*col_size)+col];\n }\n // South\n if(this.row + value=0){\n this.west = adjacentcyList[((this.row*col_size)+(this.col - this.value))];\n }\n }","public List getInterpolatedPositions()\n {\n return interpolatedPositions;\n }","public interface Paths {\n String svg_path=\"M 1024.00,0.00\\n\"+\n \"C 1024.00,0.00 1024.00,1024.00 1024.00,1024.00\\n\"+\n \"1024.00,1024.00 0.00,1024.00 0.00,1024.00\\n\"+\n \"0.00,1024.00 0.00,0.00 0.00,0.00\\n\"+\n \"0.00,0.00 1024.00,0.00 1024.00,0.00 Z\\n\"+\n \"M 471.00,82.00\\n\"+\n \"C 471.00,82.00 436.00,86.46 436.00,86.46\\n\"+\n \"402.29,92.53 363.11,105.02 332.00,119.31\\n\"+\n \"212.66,174.10 124.94,279.73 93.13,407.00\\n\"+\n \"93.13,407.00 84.32,449.00 84.32,449.00\\n\"+\n \"84.32,449.00 83.71,459.00 83.71,459.00\\n\"+\n \"83.71,459.00 82.04,468.00 82.04,468.00\\n\"+\n \"82.04,468.00 82.04,477.00 82.04,477.00\\n\"+\n \"81.41,483.79 80.02,482.44 80.00,493.00\\n\"+\n \"80.00,493.00 80.00,531.00 80.00,531.00\\n\"+\n \"80.02,541.55 81.41,540.19 81.91,547.00\\n\"+\n \"83.59,569.87 87.15,592.72 92.74,615.00\\n\"+\n \"100.84,647.21 115.95,687.81 132.22,716.80\\n\"+\n \"132.22,716.80 151.28,747.23 151.28,747.23\\n\"+\n \"151.28,747.23 165.74,768.69 165.74,768.69\\n\"+\n \"165.74,768.69 170.22,773.74 170.22,773.74\\n\"+\n \"170.22,773.74 180.37,787.49 180.37,787.49\\n\"+\n \"180.37,787.49 189.63,797.04 189.63,797.04\\n\"+\n \"189.63,797.04 195.01,804.24 195.01,804.24\\n\"+\n \"195.01,804.24 221.76,830.99 221.76,830.99\\n\"+\n \"221.76,830.99 228.24,835.74 228.24,835.74\\n\"+\n \"228.24,835.74 235.76,842.99 235.76,842.99\\n\"+\n \"235.76,842.99 249.49,853.14 249.49,853.14\\n\"+\n \"249.49,853.14 255.31,858.26 255.31,858.26\\n\"+\n \"255.31,858.26 271.58,869.13 271.58,869.13\\n\"+\n \"291.22,882.33 311.33,894.77 333.00,904.45\\n\"+\n \"333.00,904.45 341.00,907.55 341.00,907.55\\n\"+\n \"367.84,919.54 388.74,925.41 417.00,932.47\\n\"+\n \"417.00,932.47 449.00,938.71 449.00,938.71\\n\"+\n \"449.00,938.71 457.00,939.29 457.00,939.29\\n\"+\n \"462.41,939.99 463.86,940.92 470.00,941.08\\n\"+\n \"470.00,941.08 480.00,941.08 480.00,941.08\\n\"+\n \"487.10,941.88 487.04,942.99 496.00,943.00\\n\"+\n \"496.00,943.00 532.00,943.00 532.00,943.00\\n\"+\n \"540.96,942.99 540.90,941.88 548.00,941.00\\n\"+\n \"548.00,941.00 558.00,941.00 558.00,941.00\\n\"+\n \"558.00,941.00 567.00,939.29 567.00,939.29\\n\"+\n \"567.00,939.29 575.00,938.71 575.00,938.71\\n\"+\n \"600.22,935.42 641.23,924.46 665.00,915.29\\n\"+\n \"704.92,899.89 742.59,878.10 776.69,852.26\\n\"+\n \"776.69,852.26 793.76,837.74 793.76,837.74\\n\"+\n \"793.76,837.74 800.24,832.99 800.24,832.99\\n\"+\n \"800.24,832.99 815.67,817.67 815.67,817.67\\n\"+\n \"815.67,817.67 830.99,802.24 830.99,802.24\\n\"+\n \"830.99,802.24 836.37,795.04 836.37,795.04\\n\"+\n \"836.37,795.04 843.63,787.49 843.63,787.49\\n\"+\n \"843.63,787.49 853.78,773.74 853.78,773.74\\n\"+\n \"853.78,773.74 858.80,768.26 858.80,768.26\\n\"+\n \"858.80,768.26 865.22,758.47 865.22,758.47\\n\"+\n \"865.22,758.47 883.32,731.61 883.32,731.61\\n\"+\n \"912.11,682.93 931.69,628.01 939.70,572.00\\n\"+\n \"939.70,572.00 940.29,564.00 940.29,564.00\\n\"+\n \"940.29,564.00 941.83,554.00 941.83,554.00\\n\"+\n \"941.83,554.00 943.09,532.00 943.09,532.00\\n\"+\n \"943.09,532.00 944.00,520.00 944.00,520.00\\n\"+\n \"944.09,461.78 934.76,408.42 913.76,354.00\\n\"+\n \"913.76,354.00 903.46,328.00 903.46,328.00\\n\"+\n \"903.46,328.00 888.10,299.00 888.10,299.00\\n\"+\n \"848.42,227.81 787.58,169.24 716.00,130.54\\n\"+\n \"697.75,120.67 678.43,112.81 659.00,105.63\\n\"+\n \"633.52,96.22 601.90,88.14 575.00,84.30\\n\"+\n \"575.00,84.30 567.00,83.71 567.00,83.71\\n\"+\n \"557.81,82.51 560.60,82.12 550.00,82.00\\n\"+\n \"550.00,82.00 530.00,80.14 530.00,80.14\\n\"+\n \"530.00,80.14 487.00,80.14 487.00,80.14\\n\"+\n \"478.45,81.70 480.15,81.95 471.00,82.00 Z\\n\"+\n \"M 621.75,530.91\\n\"+\n \"C 622.02,527.46 613.08,514.77 610.99,510.91\\n\"+\n \"610.99,510.91 582.50,458.00 582.50,458.00\\n\"+\n \"582.50,458.00 574.45,440.00 574.45,440.00\\n\"+\n \"574.45,440.00 562.02,415.00 562.02,415.00\\n\"+\n \"562.02,415.00 558.45,406.00 558.45,406.00\\n\"+\n \"558.45,406.00 547.55,384.00 547.55,384.00\\n\"+\n \"547.55,384.00 544.45,376.00 544.45,376.00\\n\"+\n \"544.45,376.00 537.55,362.00 537.55,362.00\\n\"+\n \"537.55,362.00 534.45,354.00 534.45,354.00\\n\"+\n \"534.45,354.00 519.54,322.00 519.54,322.00\\n\"+\n \"519.54,322.00 513.96,306.00 513.96,306.00\\n\"+\n \"513.96,306.00 490.85,254.00 490.85,254.00\\n\"+\n \"487.38,245.70 482.11,237.17 482.00,228.00\\n\"+\n \"482.00,228.00 482.00,224.00 482.00,224.00\\n\"+\n \"482.15,213.62 490.05,209.14 496.26,213.13\\n\"+\n \"504.24,218.27 512.34,230.36 517.45,238.42\\n\"+\n \"517.45,238.42 565.14,314.91 565.14,314.91\\n\"+\n \"565.14,314.91 597.99,367.28 597.99,367.28\\n\"+\n \"597.99,367.28 627.99,417.28 627.99,417.28\\n\"+\n \"627.99,417.28 633.72,427.83 633.72,427.83\\n\"+\n \"633.72,427.83 642.04,442.99 642.04,442.99\\n\"+\n \"642.04,442.99 647.01,451.09 647.01,451.09\\n\"+\n \"647.01,451.09 662.50,482.00 662.50,482.00\\n\"+\n \"665.34,487.69 671.71,498.69 670.27,504.91\\n\"+\n \"668.95,510.57 661.64,511.99 657.23,514.72\\n\"+\n \"657.23,514.72 636.00,526.23 636.00,526.23\\n\"+\n \"636.00,526.23 629.08,529.26 629.08,529.26\\n\"+\n \"624.38,531.87 623.04,535.59 618.00,538.00\\n\"+\n \"619.10,535.68 621.58,532.97 621.75,530.91 Z\\n\"+\n \"M 436.60,334.30\\n\"+\n \"C 436.60,334.30 449.66,322.96 449.66,322.96\\n\"+\n \"449.66,322.96 454.84,315.00 454.84,315.00\\n\"+\n \"458.55,309.64 464.74,303.48 471.00,301.36\\n\"+\n \"483.14,297.26 496.23,303.73 504.96,312.09\\n\"+\n \"507.66,314.67 511.26,318.44 512.30,322.09\\n\"+\n \"513.68,326.94 513.16,338.17 511.62,343.00\\n\"+\n \"511.62,343.00 508.00,352.00 508.00,352.00\\n\"+\n \"497.67,351.97 498.41,349.50 489.97,344.58\\n\"+\n \"489.97,344.58 465.96,330.58 465.96,330.58\\n\"+\n \"463.47,329.14 453.27,323.10 450.91,325.36\\n\"+\n \"449.58,326.64 451.17,328.37 452.10,329.27\\n\"+\n \"454.46,331.55 459.05,334.01 462.00,335.50\\n\"+\n \"462.00,335.50 492.91,352.99 492.91,352.99\\n\"+\n \"496.07,354.74 503.04,358.49 503.71,362.18\\n\"+\n \"504.12,364.49 503.07,371.74 501.40,373.40\\n\"+\n \"500.07,374.73 498.69,374.72 497.00,375.00\\n\"+\n \"497.00,375.00 498.00,384.00 498.00,384.00\\n\"+\n \"489.25,387.43 489.12,391.54 488.00,400.00\\n\"+\n \"488.00,400.00 484.56,402.29 484.56,402.29\\n\"+\n \"484.56,402.29 476.00,415.76 476.00,415.76\\n\"+\n \"474.01,415.99 471.15,416.11 469.28,415.76\\n\"+\n \"469.28,415.76 450.91,405.14 450.91,405.14\\n\"+\n \"450.91,405.14 431.28,393.99 431.28,393.99\\n\"+\n \"428.52,392.33 417.78,384.60 414.91,387.36\\n\"+\n \"413.58,388.64 415.17,390.37 416.10,391.27\\n\"+\n \"418.75,393.84 423.68,396.31 426.99,398.00\\n\"+\n \"426.99,398.00 436.04,403.42 436.04,403.42\\n\"+\n \"436.04,403.42 459.09,416.86 459.09,416.86\\n\"+\n \"464.58,420.20 469.84,421.09 466.87,429.00\\n\"+\n \"464.69,434.81 460.98,439.65 458.04,445.01\\n\"+\n \"458.04,445.01 434.58,486.04 434.58,486.04\\n\"+\n \"434.58,486.04 412.58,524.04 412.58,524.04\\n\"+\n \"412.58,524.04 406.75,535.74 406.75,535.74\\n\"+\n \"406.75,535.74 403.11,540.22 403.11,540.22\\n\"+\n \"403.11,540.22 399.78,546.77 399.78,546.77\\n\"+\n \"399.78,546.77 390.27,562.01 390.27,562.01\\n\"+\n \"390.27,562.01 377.78,584.77 377.78,584.77\\n\"+\n \"377.78,584.77 355.78,622.77 355.78,622.77\\n\"+\n \"352.15,628.93 347.72,634.90 346.00,642.00\\n\"+\n \"346.00,642.00 342.00,642.00 342.00,642.00\\n\"+\n \"327.89,641.76 309.68,627.91 297.00,621.34\\n\"+\n \"292.74,619.14 282.33,612.37 282.23,607.00\\n\"+\n \"282.16,602.98 286.67,598.03 288.56,594.40\\n\"+\n \"288.56,594.40 293.73,585.99 293.73,585.99\\n\"+\n \"293.73,585.99 309.28,558.77 309.28,558.77\\n\"+\n \"309.28,558.77 322.22,535.23 322.22,535.23\\n\"+\n \"322.22,535.23 331.85,522.00 331.85,522.00\\n\"+\n \"331.85,522.00 360.15,472.00 360.15,472.00\\n\"+\n \"360.15,472.00 378.42,441.00 378.42,441.00\\n\"+\n \"378.42,441.00 399.85,404.00 399.85,404.00\\n\"+\n \"399.85,404.00 404.19,396.00 404.19,396.00\\n\"+\n \"404.19,396.00 412.07,386.00 412.07,386.00\\n\"+\n \"417.87,375.86 412.46,368.80 422.00,368.00\\n\"+\n \"419.91,356.08 424.78,360.59 428.99,351.99\\n\"+\n \"432.09,345.64 427.65,342.70 436.00,342.00\\n\"+\n \"436.00,340.05 435.83,335.96 436.60,334.30 Z\\n\"+\n \"M 497.00,467.00\\n\"+\n \"C 497.00,467.00 566.00,467.00 566.00,467.00\\n\"+\n \"566.00,467.00 577.46,468.74 577.46,468.74\\n\"+\n \"577.46,468.74 589.72,489.83 589.72,489.83\\n\"+\n \"589.72,489.83 600.58,509.96 600.58,509.96\\n\"+\n \"600.58,509.96 609.14,524.91 609.14,524.91\\n\"+\n \"609.14,524.91 615.84,535.28 615.84,535.28\\n\"+\n \"615.84,535.28 618.75,542.68 618.75,542.68\\n\"+\n \"618.75,542.68 633.00,569.00 633.00,569.00\\n\"+\n \"627.03,570.70 618.38,570.00 612.00,570.00\\n\"+\n \"612.00,570.00 575.00,570.00 575.00,570.00\\n\"+\n \"575.00,570.00 454.00,570.00 454.00,570.00\\n\"+\n \"454.00,570.00 413.00,570.00 413.00,570.00\\n\"+\n \"407.25,570.00 401.16,571.61 398.00,566.00\\n\"+\n \"398.00,566.00 408.22,549.23 408.22,549.23\\n\"+\n \"408.22,549.23 411.73,543.99 411.73,543.99\\n\"+\n \"411.73,543.99 415.53,536.16 415.53,536.16\\n\"+\n \"415.53,536.16 423.49,522.17 423.49,522.17\\n\"+\n \"423.49,522.17 445.49,484.17 445.49,484.17\\n\"+\n \"445.49,484.17 454.00,468.00 454.00,468.00\\n\"+\n \"454.00,468.00 497.00,467.00 497.00,467.00 Z\\n\"+\n \"M 702.17,542.80\\n\"+\n \"C 702.17,542.80 690.97,518.40 690.97,518.40\\n\"+\n \"690.97,518.40 685.92,508.73 685.92,508.73\\n\"+\n \"685.92,508.73 681.54,501.83 681.54,501.83\\n\"+\n \"681.54,501.83 678.58,494.04 678.58,494.04\\n\"+\n \"678.58,494.04 669.98,476.71 669.98,476.71\\n\"+\n \"668.90,474.57 667.26,470.96 669.00,468.74\\n\"+\n \"670.65,466.63 675.55,467.00 678.00,467.00\\n\"+\n \"678.00,467.00 771.00,467.00 771.00,467.00\\n\"+\n \"781.99,467.02 780.02,468.61 780.00,479.00\\n\"+\n \"780.00,479.00 780.00,540.00 780.00,540.00\\n\"+\n \"780.00,547.62 780.84,564.52 779.00,571.00\\n\"+\n \"779.00,571.00 755.00,570.00 755.00,570.00\\n\"+\n \"755.00,570.00 714.00,570.00 714.00,570.00\\n\"+\n \"712.50,563.82 705.24,548.95 702.17,542.80 Z\\n\"+\n \"M 244.00,544.00\\n\"+\n \"C 244.00,544.00 244.00,491.00 244.00,491.00\\n\"+\n \"244.00,491.00 244.00,475.00 244.00,475.00\\n\"+\n \"244.00,475.00 245.60,469.02 245.60,469.02\\n\"+\n \"245.60,469.02 253.00,468.00 253.00,468.00\\n\"+\n \"253.00,468.00 316.00,468.00 316.00,468.00\\n\"+\n \"316.00,468.00 348.00,469.00 348.00,469.00\\n\"+\n \"348.00,469.00 332.15,498.00 332.15,498.00\\n\"+\n \"332.15,498.00 320.46,519.00 320.46,519.00\\n\"+\n \"320.46,519.00 313.40,533.58 313.40,533.58\\n\"+\n \"313.40,533.58 305.83,546.80 305.83,546.80\\n\"+\n \"305.83,546.80 295.75,563.57 295.75,563.57\\n\"+\n \"295.75,563.57 291.45,569.18 291.45,569.18\\n\"+\n \"291.45,569.18 284.00,570.00 284.00,570.00\\n\"+\n \"284.00,570.00 245.00,571.00 245.00,571.00\\n\"+\n \"245.00,571.00 244.00,544.00 244.00,544.00 Z\\n\"+\n \"M 661.20,520.16\\n\"+\n \"C 665.01,518.10 669.48,513.82 674.00,513.69\\n\"+\n \"681.26,513.49 682.77,525.02 684.72,529.96\\n\"+\n \"685.98,533.16 687.84,534.10 689.23,536.51\\n\"+\n \"689.23,536.51 696.79,554.00 696.79,554.00\\n\"+\n \"702.32,565.71 706.00,565.74 706.00,580.00\\n\"+\n \"702.00,581.07 691.45,588.05 687.27,590.48\\n\"+\n \"677.93,595.93 672.90,598.00 662.00,598.00\\n\"+\n \"660.73,593.28 659.36,593.20 657.39,589.19\\n\"+\n \"657.39,589.19 654.74,583.08 654.74,583.08\\n\"+\n \"654.74,583.08 650.68,577.53 650.68,577.53\\n\"+\n \"650.68,577.53 640.75,561.49 640.75,561.49\\n\"+\n \"638.20,556.85 631.85,545.01 628.00,542.00\\n\"+\n \"628.00,542.00 628.00,536.00 628.00,536.00\\n\"+\n \"638.41,533.51 651.47,525.40 661.20,520.16 Z\\n\"+\n \"M 692.01,597.78\\n\"+\n \"C 692.01,597.78 700.77,593.28 700.77,593.28\\n\"+\n \"702.28,592.35 703.63,591.04 705.32,590.24\\n\"+\n \"707.11,589.89 710.07,590.01 712.00,590.24\\n\"+\n \"713.02,593.79 722.45,606.09 725.33,610.47\\n\"+\n \"725.33,610.47 749.32,646.47 749.32,646.47\\n\"+\n \"749.32,646.47 752.72,652.77 752.72,652.77\\n\"+\n \"752.72,652.77 761.84,667.20 761.84,667.20\\n\"+\n \"767.44,677.57 774.05,684.01 772.83,697.00\\n\"+\n \"772.00,705.79 771.20,707.97 765.00,714.14\\n\"+\n \"757.05,722.05 757.74,721.35 747.00,722.09\\n\"+\n \"743.86,722.30 742.31,722.92 739.00,722.68\\n\"+\n \"736.09,722.46 727.83,722.05 725.76,720.75\\n\"+\n \"718.69,716.32 714.23,704.93 710.57,697.60\\n\"+\n \"710.57,697.60 683.66,634.91 683.66,634.91\\n\"+\n \"680.50,626.27 674.27,614.84 674.00,606.00\\n\"+\n \"682.86,604.87 685.11,601.59 692.01,597.78 Z\\n\"+\n \"M 256.13,712.00\\n\"+\n \"C 256.13,712.00 264.84,685.00 264.84,685.00\\n\"+\n \"264.84,685.00 273.95,642.00 273.95,642.00\\n\"+\n \"273.95,642.00 277.26,627.00 277.26,627.00\\n\"+\n \"277.26,627.00 278.99,620.65 278.99,620.65\\n\"+\n \"278.99,620.65 284.00,618.00 284.00,618.00\\n\"+\n \"291.29,628.23 310.06,636.13 321.09,642.80\\n\"+\n \"327.01,646.39 330.75,645.36 334.00,652.00\\n\"+\n \"334.00,652.00 320.96,664.24 320.96,664.24\\n\"+\n \"320.96,664.24 315.04,668.38 315.04,668.38\\n\"+\n \"315.04,668.38 281.67,701.67 281.67,701.67\\n\"+\n \"281.67,701.67 263.48,719.19 263.48,719.19\\n\"+\n \"263.48,719.19 256.13,720.00 256.13,720.00\\n\"+\n \"256.13,720.00 256.13,712.00 256.13,712.00 Z\";\n}","public Location3D getRallyPoint () {\n return myRallyPoint;\n }","public static int hg_step5(int step, int[][] mask, int[] rowCover,\r\n\t\t\tint[] colCover, int[] zero_RC) {\n\r\n\t\tint count = 0; // Counts rows of the path matrix.\r\n\t\tint[][] path = new int[(mask[0].length * mask.length)][2]; // Path\r\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t// matrix\r\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t// (stores\r\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t// row and\r\n\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t// col).\r\n\t\tpath[count][0] = zero_RC[0]; // Row of last prime.\r\n\t\tpath[count][1] = zero_RC[1]; // Column of last prime.\r\n\r\n\t\tboolean done = false;\r\n\t\twhile (done == false) {\r\n\t\t\tint r = findStarInCol(mask, path[count][1]);\r\n\t\t\tif (r >= 0) {\r\n\t\t\t\tcount = count + 1;\r\n\t\t\t\tpath[count][0] = r; // Row of starred zero.\r\n\t\t\t\tpath[count][1] = path[count - 1][1]; // Column of starred zero.\r\n\t\t\t} else {\r\n\t\t\t\tdone = true;\r\n\t\t\t}\r\n\r\n\t\t\tif (done == false) {\r\n\t\t\t\tint c = findPrimeInRow(mask, path[count][0]);\r\n\t\t\t\tcount = count + 1;\r\n\t\t\t\tpath[count][0] = path[count - 1][0]; // Row of primed zero.\r\n\t\t\t\tpath[count][1] = c; // Col of primed zero.\r\n\t\t\t}\r\n\t\t}// end while\r\n\r\n\t\tconvertPath(mask, path, count);\r\n\t\tclearCovers(rowCover, colCover);\r\n\t\terasePrimes(mask);\r\n\r\n\t\tstep = 3;\r\n\t\treturn step;\r\n\r\n\t}","public final AstValidator.cube_item_return cube_item() throws RecognitionException {\n AstValidator.cube_item_return retval = new AstValidator.cube_item_return();\n retval.start = input.LT(1);\n\n\n CommonTree root_0 = null;\n\n CommonTree _first_0 = null;\n CommonTree _last = null;\n\n AstValidator.rel_return rel131 =null;\n\n AstValidator.cube_by_clause_return cube_by_clause132 =null;\n\n\n\n try {\n // /home/hoang/DATA/WORKSPACE/trunk0408/src/org/apache/pig/parser/AstValidator.g:320:2: ( rel ( cube_by_clause ) )\n // /home/hoang/DATA/WORKSPACE/trunk0408/src/org/apache/pig/parser/AstValidator.g:320:4: rel ( cube_by_clause )\n {\n root_0 = (CommonTree)adaptor.nil();\n\n\n _last = (CommonTree)input.LT(1);\n pushFollow(FOLLOW_rel_in_cube_item1386);\n rel131=rel();\n\n state._fsp--;\n if (state.failed) return retval;\n if ( state.backtracking==0 ) \n adaptor.addChild(root_0, rel131.getTree());\n\n\n // /home/hoang/DATA/WORKSPACE/trunk0408/src/org/apache/pig/parser/AstValidator.g:320:8: ( cube_by_clause )\n // /home/hoang/DATA/WORKSPACE/trunk0408/src/org/apache/pig/parser/AstValidator.g:320:10: cube_by_clause\n {\n _last = (CommonTree)input.LT(1);\n pushFollow(FOLLOW_cube_by_clause_in_cube_item1390);\n cube_by_clause132=cube_by_clause();\n\n state._fsp--;\n if (state.failed) return retval;\n if ( state.backtracking==0 ) \n adaptor.addChild(root_0, cube_by_clause132.getTree());\n\n\n if ( state.backtracking==0 ) {\n }\n }\n\n\n if ( state.backtracking==0 ) {\n }\n }\n\n if ( state.backtracking==0 ) {\n\n retval.tree = (CommonTree)adaptor.rulePostProcessing(root_0);\n }\n\n }\n\n catch(RecognitionException re) {\n throw re;\n }\n\n finally {\n \t// do for sure before leaving\n }\n return retval;\n }","public void calculate() {\n\t\t\n\t\tHashMap vertices = triangulation.getVertices();\n\t\tHashMap faces = triangulation.getFaces();\n\n\t\tHashMap chords = new HashMap();\n\t\tList onOuterCircle = new LinkedList();\n\t\tList outerCircle = new LinkedList();\n\n\t\tfor (Vertex v : vertices.values()) {\n\t\t\tchords.put(v.getId(), 0);\n\t\t\tchildren.put(v.getId(), new LinkedList());\n\t\t}\n\n\t\t// determine outer face (randomly, use the first face)\n\t\tFace outerFace = null;\n\t\tfor (Face f : faces.values()) {\n\t\t\touterFace = f;\n\t\t\tbreak;\n\t\t}\n\t\tif (outerFace == null) {\n\t\t\t// there are no faces at all in the embedding\n\t\t\treturn;\n\t\t}\n\n\t\tEdge e = outerFace.getIncidentEdge();\n\t\tvertexOrder[1] = e.getSource();\n\t\tvertexOrder[0] = e.getTarget();\n\t\tonOuterCircle.add(e.getTarget());\n\t\tonOuterCircle.add(e.getNext().getTarget());\n\t\tonOuterCircle.add(e.getSource());\n\t\touterCircle.add(e.getNext().getNext().getTwin());\n\t\touterCircle.add(e.getNext().getTwin());\n\t\t\n\t\t//System.out.println(\"outerCircle 0 \" + outerCircle.get(0).getId() + \" - source: \" + outerCircle.get(0).getSource().getId() + \" - target: \" + outerCircle.get(0).getTarget().getId());\n\t\t//System.out.println(\"outerCircle 1 \" + outerCircle.get(1).getId() + \" - source: \" + outerCircle.get(1).getSource().getId() + \" - target: \" + outerCircle.get(1).getTarget().getId());\n\t\t\n\n\t\tfor (int k=vertexOrder.length-1; k>1; k--) {\n\t\t\t//System.out.println(\"k: \" + k + \" - outerCircle size: \" + outerCircle.size());\n\t\t\t// chose v != v_0,v_1 such that v on outer face, not considered yet and chords(v)=0\n\t\t\tVertex nextVertex = null;\n\t\t\tint nextVertexId = -1;\n\t\t\tfor (int i=0; i childrenNextVertex = children.get(nextVertexId);\n\t\t\t\n\t\t\t// update edges of outer circle\n\t\t\tint index = 0;\n\t\t\t\n\t\t\twhile (outerCircle.get(index).getTarget().getId() != nextVertexId) {\n\t\t\t\tindex++;\n\t\t\t}\n\t\t\tEdge outofNextVertex = outerCircle.remove(index+1);\n\t\t\t\n\t\t\t\n\t\t\t//System.out.println(\"outOfNextVertex \" + outofNextVertex.getId() + \" - source: \" + outofNextVertex.getSource().getId() + \" - target: \" + outofNextVertex.getTarget().getId());\n\t\t\tEdge intoNextVertex = outerCircle.remove(index);\n\t\t\t//System.out.println(\"intoNextVertex \" + intoNextVertex.getId() + \" - source: \" + intoNextVertex.getSource().getId() + \" - target: \" + intoNextVertex.getTarget().getId());\n\t\t\tEdge current = intoNextVertex.getNext();\n\t\t\t//System.out.println(\"current \" + current.getId() + \" - source: \" + current.getSource().getId() + \" - target: \" + current.getTarget().getId());\n\t\t\t\n\t\t\tint endIndex = index;\n\t\t\t\n\t\t\twhile (current.getId() != outofNextVertex.getId()) {\n\t\t\t\tEdge onCircle = current.getNext().getTwin();\n\t\t\t\touterCircle.add(endIndex, onCircle);\n\t\t\t\t\n\t\t\t\tchildrenNextVertex.add(0, onCircle.getSource().getId());\n\t\t\t\t\n\t\t\t\tendIndex++;\n\t\t\t\tcurrent = current.getTwin().getNext();\n\t\t\t\tonOuterCircle.add(onCircle.getTarget());\n\t\t\t}\n\t\t\t\n\t\t\tEdge lastEdge = outofNextVertex.getNext().getTwin();\n\t\t\touterCircle.add(endIndex, lastEdge);\n\t\t\t\n\t\t\tchildrenNextVertex.add(0, lastEdge.getSource().getId());\n\t\t\tchildrenNextVertex.add(0, lastEdge.getTarget().getId());\n\n\t\t\t// update chords\n\t\t\tfor (Vertex v : onOuterCircle) {\n\t\t\t\tEdge incidentEdge = v.getOutEdge();\n\t\t\t\tint firstEdgeId = incidentEdge.getId();\n\t\t\t\tint chordCounter = -2; // the 2 neighbours are on the outer circle, but no chords\n\t\t\t\tdo {\n\t\t\t\t\tif (onOuterCircle.contains(incidentEdge.getTarget())) {\n\t\t\t\t\t\tchordCounter++;\n\t\t\t\t\t}\n\t\t\t\t\tincidentEdge = incidentEdge.getTwin().getNext();\n\t\t\t\t} while (incidentEdge.getId() != firstEdgeId);\n\t\t\t\tchords.put(v.getId(), chordCounter);\n\t\t\t}\n\t\t}\n\t}","private Square[] returnPath(Vertex v, GameBoard b) {\n // because we're starting at the end point,\n // we need build the path in 'reverse'\n Stack path = new Stack();\n\n // while we're not at the start point\n while ( v.dist != 0 ) {\n path.push(vertexToSquare(v,b));\n v = v.path;\n }\n\n // place the locations in the proper order\n Square[] road = new Square[path.size()];\n for ( int i = 0; i < path.size(); i++ )\n road[i] = path.pop();\n\n return road;\n }","public ArrayList destinations()\n {\n ArrayList arr = new ArrayList();\n for(int i = 0; i < 360; i += 45)\n {\n sweep(arr, i);\n }\n return arr;\n }","public Double[][] getPaths(){\n return paths;\n }","public Point3D getLocation() {\n\t\treturn p;\n\t}","public Shape getPath()\n {\n if (getRadius() < 0.0001) return super.getPath();\n return new RoundRect(0, 0, getWidth(), getHeight(), getRadius());\n }","@NonNull\n public static Cube buildGoalRootCube() {\n Cube rootCube = new Cube(MARKER_SIZE);\n Material m = new Material(true);\n m.setColor(Color.RED);\n rootCube.setMaterial(m);\n rootCube.setRenderChildrenAsBatch(true);\n // Root cube floats in space at position (0, 0, 0) due to having no position set.\n // Since we want only its children to be visible, set this root cube to be invisible.\n rootCube.setVisible(false);\n\n return rootCube;\n }","public int stepFive(int step)\n\t{\n\t\tboolean over;\n\t\tint rows1=-1;\n\t\tint cols1=-1;\n\t\t\n\t\tpathCount=1;\n\t\tpath[pathCount-1][0]=path_row_0;\n\t\tpath[pathCount-1][1]=path_col_0;\n\t\tover=false;\n\t\t\n\t\twhile(!over)\n\t\t{\n\t\t\trows1=getStarInCol(path[pathCount-1][1],rows1);\n\t\t\tif(rows1>-1)\n\t\t\t{\n\t\t\t\tpathCount++;\n\t\t\t\tpath[pathCount-1][0]=rows1;\n\t\t\t\tpath[pathCount-1][1]=path[pathCount-2][1];\n\t\t\t}\n\t\t\telse\n\t\t\t{\n\t\t\t\tover=true;\n\t\t\t}\n\t\t\tif(!over)\n\t\t\t{\n\t\t\t\tcols1=getPrimeInRow(path[pathCount-1][0],cols1);\n\t\t\t\tpathCount++;\n\t\t\t\tpath[pathCount-1][0]=path[pathCount-2][0];\n\t\t\t\tpath[pathCount-1][1]=cols1;\n\t\t\t}\n\t\t}\n\t\t\n\t\taugmentPath();\n\t\tclearLabels();\n\t\tremovePrimes();\n\t\tstep=3;\n\t\t\n\t\treturn step;\n\t}","public Block[][][] getCubes(){ return cubes; }","public abstract ScaledPathArray getPathList();","private void traversePath()\n\t{\n\t\trobot.forward(50);\n\t\trobot.right(90);\n\t\trobot.forward(50);\n\t\trobot.right(90);\n\t\trobot.forward(50);\n\t\trobot.left(90);\n\t\trobot.forward(50);\n\t\trobot.left(90);\n\t}","public final AstValidator.cube_by_expr_return cube_by_expr() throws RecognitionException {\n AstValidator.cube_by_expr_return retval = new AstValidator.cube_by_expr_return();\n retval.start = input.LT(1);\n\n\n CommonTree root_0 = null;\n\n CommonTree _first_0 = null;\n CommonTree _last = null;\n\n CommonTree STAR146=null;\n AstValidator.col_range_return col_range144 =null;\n\n AstValidator.expr_return expr145 =null;\n\n\n CommonTree STAR146_tree=null;\n\n try {\n // /home/hoang/DATA/WORKSPACE/trunk0408/src/org/apache/pig/parser/AstValidator.g:340:2: ( col_range | expr | STAR )\n int alt39=3;\n switch ( input.LA(1) ) {\n case COL_RANGE:\n {\n alt39=1;\n }\n break;\n case BIGDECIMALNUMBER:\n case BIGINTEGERNUMBER:\n case CUBE:\n case DIV:\n case DOLLARVAR:\n case DOUBLENUMBER:\n case FALSE:\n case FLOATNUMBER:\n case GROUP:\n case IDENTIFIER:\n case INTEGER:\n case LONGINTEGER:\n case MINUS:\n case NULL:\n case PERCENT:\n case PLUS:\n case QUOTEDSTRING:\n case TRUE:\n case BAG_VAL:\n case BIN_EXPR:\n case CASE_COND:\n case CASE_EXPR:\n case CAST_EXPR:\n case EXPR_IN_PAREN:\n case FUNC_EVAL:\n case INVOKER_FUNC_EVAL:\n case MAP_VAL:\n case NEG:\n case TUPLE_VAL:\n {\n alt39=2;\n }\n break;\n case STAR:\n {\n int LA39_3 = input.LA(2);\n\n if ( (LA39_3==DOWN) ) {\n alt39=2;\n }\n else if ( (LA39_3==EOF||LA39_3==UP||LA39_3==BIGDECIMALNUMBER||LA39_3==BIGINTEGERNUMBER||LA39_3==CHUNKSIZE||LA39_3==CUBE||LA39_3==DIV||LA39_3==DOLLARVAR||LA39_3==DOUBLENUMBER||LA39_3==FALSE||LA39_3==FLOATNUMBER||LA39_3==GROUP||LA39_3==IDENTIFIER||LA39_3==INTEGER||LA39_3==LONGINTEGER||LA39_3==MINUS||LA39_3==NULL||LA39_3==PERCENT||(LA39_3 >= PIVOT && LA39_3 <= PLUS)||LA39_3==QUOTEDSTRING||LA39_3==STAR||LA39_3==TRUE||(LA39_3 >= BAG_VAL && LA39_3 <= BIN_EXPR)||(LA39_3 >= CASE_COND && LA39_3 <= CASE_EXPR)||(LA39_3 >= CAST_EXPR && LA39_3 <= EXPR_IN_PAREN)||LA39_3==FUNC_EVAL||LA39_3==INVOKER_FUNC_EVAL||(LA39_3 >= MAP_VAL && LA39_3 <= NEG)||LA39_3==TUPLE_VAL) ) {\n alt39=3;\n }\n else {\n if (state.backtracking>0) {state.failed=true; return retval;}\n NoViableAltException nvae =\n new NoViableAltException(\"\", 39, 3, input);\n\n throw nvae;\n\n }\n }\n break;\n default:\n if (state.backtracking>0) {state.failed=true; return retval;}\n NoViableAltException nvae =\n new NoViableAltException(\"\", 39, 0, input);\n\n throw nvae;\n\n }\n\n switch (alt39) {\n case 1 :\n // /home/hoang/DATA/WORKSPACE/trunk0408/src/org/apache/pig/parser/AstValidator.g:340:4: col_range\n {\n root_0 = (CommonTree)adaptor.nil();\n\n\n _last = (CommonTree)input.LT(1);\n pushFollow(FOLLOW_col_range_in_cube_by_expr1483);\n col_range144=col_range();\n\n state._fsp--;\n if (state.failed) return retval;\n if ( state.backtracking==0 ) \n adaptor.addChild(root_0, col_range144.getTree());\n\n\n if ( state.backtracking==0 ) {\n }\n }\n break;\n case 2 :\n // /home/hoang/DATA/WORKSPACE/trunk0408/src/org/apache/pig/parser/AstValidator.g:340:16: expr\n {\n root_0 = (CommonTree)adaptor.nil();\n\n\n _last = (CommonTree)input.LT(1);\n pushFollow(FOLLOW_expr_in_cube_by_expr1487);\n expr145=expr();\n\n state._fsp--;\n if (state.failed) return retval;\n if ( state.backtracking==0 ) \n adaptor.addChild(root_0, expr145.getTree());\n\n\n if ( state.backtracking==0 ) {\n }\n }\n break;\n case 3 :\n // /home/hoang/DATA/WORKSPACE/trunk0408/src/org/apache/pig/parser/AstValidator.g:340:23: STAR\n {\n root_0 = (CommonTree)adaptor.nil();\n\n\n _last = (CommonTree)input.LT(1);\n STAR146=(CommonTree)match(input,STAR,FOLLOW_STAR_in_cube_by_expr1491); if (state.failed) return retval;\n if ( state.backtracking==0 ) {\n STAR146_tree = (CommonTree)adaptor.dupNode(STAR146);\n\n\n adaptor.addChild(root_0, STAR146_tree);\n }\n\n\n if ( state.backtracking==0 ) {\n }\n }\n break;\n\n }\n if ( state.backtracking==0 ) {\n\n retval.tree = (CommonTree)adaptor.rulePostProcessing(root_0);\n }\n\n }\n\n catch(RecognitionException re) {\n throw re;\n }\n\n finally {\n \t// do for sure before leaving\n }\n return retval;\n }","private void arretes_fY(){\n\t\tthis.cube[49] = this.cube[46]; \n\t\tthis.cube[46] = this.cube[48];\n\t\tthis.cube[48] = this.cube[52];\n\t\tthis.cube[52] = this.cube[50];\n\t\tthis.cube[50] = this.cube[49];\n\t}","private void findPath1(List path) {\n\n // records the start coordinate in a specific sequence.\n ArrayList starts = new ArrayList<>();\n // records the end coordinate in a specific sequence.\n ArrayList ends = new ArrayList<>();\n // records the total cost of the path in a specific sequence.\n ArrayList cost = new ArrayList<>();\n\n for (Coordinate o1 : originCells) {\n for (Coordinate d1 : destCells) {\n Graph graph = new Graph(getEdge(map));\n graph.dijkstra(o1);\n graph.printPath(d1);\n starts.add(o1);\n ends.add(d1);\n cost.add(graph.getPathCost(d1));\n }\n }\n int index = getMinIndex(cost);\n\n Graph graph = new Graph(getEdge(map));\n graph.dijkstra(starts.get(index));\n graph.printPath(ends.get(index));\n for (Graph.Node node : graph.getPathReference()) {\n path.add(node.coordinate);\n }\n setSuccess(path);\n }","protected abstract void getAllUniformLocations();","@Test\n public void testFind_East() {\n\n double lat1 = 0.0;\n double lon1 = 0.0;\n double lat2 = 0.0;\n double lon2 = 10.0;\n double expResult = Math.toRadians(90);\n double result = Azimuth.find(lat1, lon1, lat2, lon2);\n assertEquals(expResult, result, 0.0);\n }","public static double squareToCosineHemispherePdf(Tuple3d v) {\n // TODO: Fill in this method.\n return 0;\n }","@Override\r\n public String toString() {\r\n return String.format(\"%s:\\n%s\", \"Coordinates of Quadrilateral are\", getCoordinatesAsString());\r\n }"],"string":"[\n \"public Polygon getPolygon(double eyeDistance){\\n //define the front two verticies of the currentTrack\\n Point3D track_vertex0 = currentTrack.getVertex(0);\\n Point3D track_vertex1 = currentTrack.getVertex(1);\\n //use center point to define the center of the sphape\\n int cubeSize = 3;\\n\\n Point3D front_up_left = new Point3D (centerPoint.x-cubeSize, centerPoint.y-cubeSize, centerPoint.z-cubeSize);\\n Point3D front_down_left = new Point3D (centerPoint.x-cubeSize, centerPoint.y+cubeSize, centerPoint.z-cubeSize);\\n Point3D front_down_right = new Point3D (centerPoint.x+cubeSize, centerPoint.y+cubeSize, centerPoint.z-cubeSize);\\n Point3D front_up_right = new Point3D (centerPoint.x+cubeSize, centerPoint.y-cubeSize, centerPoint.z-cubeSize);\\n\\n Point3D back_up_left = new Point3D (front_up_left.x, front_up_left.y, centerPoint.z+cubeSize);\\n Point3D back_down_left = new Point3D (front_down_left.x, front_down_left.y, centerPoint.z+cubeSize);\\n Point3D back_down_right = new Point3D (front_down_right.x, front_down_right.y, centerPoint.z+cubeSize);\\n Point3D back_up_right = new Point3D (front_up_right.x, front_up_right.y, centerPoint.z+cubeSize);\\n\\n //aranges verticies in the order they will be drawn\\n Point3D[] cube_verticies = {front_up_left, front_down_left, front_down_right, front_up_right,\\n front_up_left, back_up_left, back_up_right, front_up_right,\\n front_down_right, back_down_right, back_up_right, back_down_right,\\n back_down_left, back_up_left, back_down_left, front_down_left};\\n\\n int[] x_points = new int[16];\\n int[] y_points = new int[16];\\n //convert 3D points to 2D points\\n for(int i=0;i<16;i++){\\n if(cube_verticies[i].z <= 200){ //same fix as for the track positioning\\n x_points[i] = (int) -cube_verticies[i].projectPoint3D(eyeDistance).getX();\\n y_points[i] = (int) cube_verticies[i].projectPoint3D(eyeDistance).getY();\\n }\\n else{\\n x_points[i] = (int) cube_verticies[i].projectPoint3D(eyeDistance).getX();\\n y_points[i] = (int) cube_verticies[i].projectPoint3D(eyeDistance).getY();\\n }\\n }\\n Polygon polygon = new Polygon(x_points, y_points, 16);\\n return polygon;\\n }\",\n \"static void trial4() {\\n ModelBuilder modelBuilder = new ModelBuilder();\\n Model cubeModel = modelBuilder.createBox(\\n 5f,\\n 5f,\\n 5f,\\n new Material( ColorAttribute.createDiffuse(Color.GREEN) ),\\n Usage.Position);\\n Mesh cubeMesh = cubeModel.meshes.get(0);\\n\\n // There are 36 vertex indices\\n // I take it this is because there are 2 triangle per face\\n // 3 x 2 x 6 = 36\\n System.err.println(cubeMesh.getNumIndices());\\n\\n short[] cubeIndices = new short[36];\\n cubeMesh.getIndices(cubeIndices);\\n for (int i = 0; i < 36; i+=3) {\\n for (int j = 0; j <= 2; j++) {\\n System.err.printf(\\\"%3d \\\", cubeIndices[i+j]);\\n }\\n System.err.println();\\n }\\n\\n }\",\n \"public void computeFractal(){\\n\\t\\tint deltaX =p5.getX()-p1.getX();\\n\\t\\tint deltaY =p5.getY()- p1.getY();\\n\\t\\tint x2= p1.getX()+ (deltaX/3);\\n\\t\\tint y2= p1.getY()+ (deltaY/3);\\n\\t\\tdouble x3=((p1.getX()+p5.getX())/2)+( Math.sqrt(3)*\\n\\t\\t\\t\\t(p1.getY()-p5.getY()))/6;\\n\\t\\tdouble y3=((p1.getY()+p5.getY())/2)+( Math.sqrt(3)*\\n\\t\\t\\t\\t(p5.getX()-p1.getX()))/6;\\n\\t\\tint x4= p1.getX()+((2*deltaX)/3);\\n\\t\\tint y4= p1.getY()+((2*deltaY)/3);\\n\\t\\tthis.p2= new Point(x2,y2);\\n\\t\\tthis.p3= new Point((int)x3,(int)y3);\\n\\t\\tthis.p4= new Point(x4,y4);\\n\\t}\",\n \"private double solveQuadraticInside(Location location) {\\n\\t\\tint iPlus = imposeBorder(location.i + 1, _iSize);\\r\\n\\t\\tint iMinus = imposeBorder(location.i - 1, _iSize);\\r\\n\\t\\tint jPlus = imposeBorder(location.j + 1, _iSize);\\r\\n\\t\\tint jMinus = imposeBorder(location.j - 1, _iSize);\\r\\n\\t\\t//\\r\\n\\t\\tdouble ux1 = -_levelSet[iPlus][location.j];\\r\\n\\t\\tdouble ux2 = -_levelSet[iMinus][location.j];\\r\\n\\t\\tdouble uy1 = -_levelSet[location.i][jPlus];\\r\\n\\t\\tdouble uy2 = -_levelSet[location.i][jMinus];\\r\\n\\t\\t//\\r\\n\\t\\tdouble ux = Math.min(ux1, ux2);\\r\\n\\t\\tdouble uy = Math.min(uy1, uy2);\\r\\n\\t\\t// TODO pre-compute\\r\\n\\t\\tdouble f = _dx / F;\\r\\n\\t\\t//\\r\\n\\t\\t// solve the quadratic equation\\r\\n\\t\\tdouble a = 2;\\r\\n\\t\\tdouble b = -2 * (ux + uy);\\r\\n\\t\\tdouble c = ScalarMath.square(ux) + ScalarMath.square(uy)\\r\\n\\t\\t\\t\\t- ScalarMath.square(f);\\r\\n\\t\\tdouble delta = ScalarMath.square(b) - 4 * a * c;\\r\\n\\t\\t// extraordinary solutions\\r\\n\\t\\tdouble u;\\r\\n\\t\\tif (Double.isInfinite(ux) | Double.isInfinite(uy) | delta < 0) {\\r\\n\\t\\t\\tif (Double.isInfinite(ux))\\r\\n\\t\\t\\t\\tu = uy;\\r\\n\\t\\t\\telse if (Double.isInfinite(uy))\\r\\n\\t\\t\\t\\tu = ux;\\r\\n\\t\\t\\telse\\r\\n\\t\\t\\t\\t// the case where (delta < 0), which produces a\\r\\n\\t\\t\\t\\t// imaginary root\\r\\n\\t\\t\\t\\tu = Math.min(ux, uy);\\r\\n\\t\\t\\treturn -(u + f);\\r\\n\\t\\t}\\r\\n\\t\\tdouble sol1 = (-b + Math.sqrt(delta)) / (2 * a);\\r\\n\\t\\tdouble sol2 = (-b - Math.sqrt(delta)) / (2 * a);\\r\\n\\t\\treturn -(Math.max(sol1, sol2));\\r\\n\\t}\",\n \"private static ArrayList geoPath1() {\\n return new ArrayList() {\\n {\\n add(new Coordinates(\\\"-122.19170793,47.77509422,5.156\\\"));\\n add(new Coordinates(\\\"-122.19171484,47.77509255,5.476\\\"));\\n add(new Coordinates(\\\"-122.19172476,47.77509815,5.583\\\"));\\n add(new Coordinates(\\\"-122.19172741,47.77510382,6.077\\\"));\\n add(new Coordinates(\\\"-122.19172688,47.77510897,6.424\\\"));\\n add(new Coordinates(\\\"-122.19172704,47.77511101,6.121\\\"));\\n add(new Coordinates(\\\"-122.19172543,47.77511046,6.235\\\"));\\n add(new Coordinates(\\\"-122.19172222,47.77511072,6.225\\\"));\\n add(new Coordinates(\\\"-122.19172067,47.77510953,5.974\\\"));\\n add(new Coordinates(\\\"-122.19171935,47.77511130,6.508\\\"));\\n add(new Coordinates(\\\"-122.19171873,47.77511341,6.090\\\"));\\n add(new Coordinates(\\\"-122.19171924,47.77511293,5.968\\\"));\\n add(new Coordinates(\\\"-122.19171637,47.77511664,5.461\\\"));\\n add(new Coordinates(\\\"-122.19171588,47.77511801,5.518\\\"));\\n add(new Coordinates(\\\"-122.19171639,47.77511835,5.652\\\"));\\n add(new Coordinates(\\\"-122.19171667,47.77511857,5.647\\\"));\\n add(new Coordinates(\\\"-122.19171678,47.77511865,5.648\\\"));\\n add(new Coordinates(\\\"-122.19172518,47.77511628,6.074\\\"));\\n add(new Coordinates(\\\"-122.19173954,47.77511533,5.472\\\"));\\n add(new Coordinates(\\\"-122.19175207,47.77511346,5.836\\\"));\\n add(new Coordinates(\\\"-122.19176251,47.77510782,5.669\\\"));\\n add(new Coordinates(\\\"-122.19177163,47.77510015,2.049\\\"));\\n add(new Coordinates(\\\"-122.19177831,47.77509499,2.910\\\"));\\n add(new Coordinates(\\\"-122.19178524,47.77509168,2.794\\\"));\\n add(new Coordinates(\\\"-122.19179816,47.77509009,3.440\\\"));\\n add(new Coordinates(\\\"-122.19181022,47.77508805,3.016\\\"));\\n add(new Coordinates(\\\"-122.19182115,47.77508458,5.258\\\"));\\n add(new Coordinates(\\\"-122.19182976,47.77508305,5.820\\\"));\\n add(new Coordinates(\\\"-122.19183812,47.77508189,5.615\\\"));\\n add(new Coordinates(\\\"-122.19184640,47.77507857,3.568\\\"));\\n add(new Coordinates(\\\"-122.19185497,47.77506742,2.922\\\"));\\n add(new Coordinates(\\\"-122.19186602,47.77506459,3.923\\\"));\\n add(new Coordinates(\\\"-122.19187867,47.77506429,3.785\\\"));\\n add(new Coordinates(\\\"-122.19188979,47.77506426,5.388\\\"));\\n add(new Coordinates(\\\"-122.19190159,47.77506575,4.811\\\"));\\n add(new Coordinates(\\\"-122.19191428,47.77506995,3.867\\\"));\\n add(new Coordinates(\\\"-122.19192458,47.77507421,3.806\\\"));\\n add(new Coordinates(\\\"-122.19193359,47.77507565,5.697\\\"));\\n add(new Coordinates(\\\"-122.19194828,47.77507599,6.091\\\"));\\n add(new Coordinates(\\\"-122.19196187,47.77507556,6.160\\\"));\\n add(new Coordinates(\\\"-122.19197799,47.77507586,5.827\\\"));\\n add(new Coordinates(\\\"-122.19199669,47.77507708,6.263\\\"));\\n add(new Coordinates(\\\"-122.19201547,47.77507900,5.519\\\"));\\n add(new Coordinates(\\\"-122.19203652,47.77508125,5.318\\\"));\\n add(new Coordinates(\\\"-122.19205394,47.77508798,4.972\\\"));\\n add(new Coordinates(\\\"-122.19206817,47.77509514,5.112\\\"));\\n add(new Coordinates(\\\"-122.19208170,47.77510678,5.183\\\"));\\n add(new Coordinates(\\\"-122.19209617,47.77511995,6.227\\\"));\\n add(new Coordinates(\\\"-122.19211126,47.77512566,6.331\\\"));\\n add(new Coordinates(\\\"-122.19212836,47.77513235,6.249\\\"));\\n add(new Coordinates(\\\"-122.19214476,47.77513787,7.192\\\"));\\n add(new Coordinates(\\\"-122.19215712,47.77514375,6.008\\\"));\\n add(new Coordinates(\\\"-122.19216472,47.77514855,5.879\\\"));\\n add(new Coordinates(\\\"-122.19217137,47.77514377,6.426\\\"));\\n add(new Coordinates(\\\"-122.19217457,47.77513335,7.248\\\"));\\n add(new Coordinates(\\\"-122.19217502,47.77511706,7.483\\\"));\\n add(new Coordinates(\\\"-122.19218040,47.77510219,10.228\\\"));\\n add(new Coordinates(\\\"-122.19218656,47.77509117,10.560\\\"));\\n add(new Coordinates(\\\"-122.19219800,47.77508689,10.466\\\"));\\n add(new Coordinates(\\\"-122.19221646,47.77507476,11.119\\\"));\\n add(new Coordinates(\\\"-122.19223178,47.77505389,12.674\\\"));\\n add(new Coordinates(\\\"-122.19223875,47.77504801,14.667\\\"));\\n add(new Coordinates(\\\"-122.19224629,47.77504536,13.339\\\"));\\n add(new Coordinates(\\\"-122.19224798,47.77504041,13.908\\\"));\\n add(new Coordinates(\\\"-122.19224916,47.77503913,14.065\\\"));\\n add(new Coordinates(\\\"-122.19225069,47.77503675,14.247\\\"));\\n add(new Coordinates(\\\"-122.19224858,47.77502843,14.488\\\"));\\n add(new Coordinates(\\\"-122.19224608,47.77502116,15.172\\\"));\\n add(new Coordinates(\\\"-122.19224071,47.77501315,15.223\\\"));\\n add(new Coordinates(\\\"-122.19223317,47.77500694,14.840\\\"));\\n add(new Coordinates(\\\"-122.19222227,47.77500383,13.775\\\"));\\n add(new Coordinates(\\\"-122.19221226,47.77499910,12.827\\\"));\\n add(new Coordinates(\\\"-122.19220317,47.77499372,13.307\\\"));\\n add(new Coordinates(\\\"-122.19219567,47.77498511,13.107\\\"));\\n add(new Coordinates(\\\"-122.19219183,47.77497813,13.144\\\"));\\n add(new Coordinates(\\\"-122.19218998,47.77497165,14.620\\\"));\\n add(new Coordinates(\\\"-122.19219011,47.77496235,9.166\\\"));\\n add(new Coordinates(\\\"-122.19218887,47.77495353,8.299\\\"));\\n add(new Coordinates(\\\"-122.19218520,47.77494321,9.052\\\"));\\n add(new Coordinates(\\\"-122.19218124,47.77493245,9.915\\\"));\\n add(new Coordinates(\\\"-122.19218070,47.77492023,9.391\\\"));\\n add(new Coordinates(\\\"-122.19217970,47.77490970,10.372\\\"));\\n add(new Coordinates(\\\"-122.19217945,47.77490501,7.722\\\"));\\n add(new Coordinates(\\\"-122.19217823,47.77489981,8.715\\\"));\\n add(new Coordinates(\\\"-122.19218090,47.77489589,8.714\\\"));\\n add(new Coordinates(\\\"-122.19218635,47.77488849,11.030\\\"));\\n add(new Coordinates(\\\"-122.19219339,47.77487849,13.062\\\"));\\n add(new Coordinates(\\\"-122.19219717,47.77486996,13.102\\\"));\\n add(new Coordinates(\\\"-122.19219654,47.77486340,13.562\\\"));\\n add(new Coordinates(\\\"-122.19219260,47.77485669,14.090\\\"));\\n add(new Coordinates(\\\"-122.19218765,47.77484862,12.973\\\"));\\n add(new Coordinates(\\\"-122.19218777,47.77484328,13.137\\\"));\\n add(new Coordinates(\\\"-122.19218893,47.77483642,13.518\\\"));\\n add(new Coordinates(\\\"-122.19218715,47.77483230,13.557\\\"));\\n add(new Coordinates(\\\"-122.19218676,47.77482973,13.560\\\"));\\n add(new Coordinates(\\\"-122.19218203,47.77482544,12.554\\\"));\\n add(new Coordinates(\\\"-122.19217214,47.77482073,12.209\\\"));\\n add(new Coordinates(\\\"-122.19216229,47.77481373,12.975\\\"));\\n add(new Coordinates(\\\"-122.19215766,47.77481203,10.715\\\"));\\n add(new Coordinates(\\\"-122.19214837,47.77480695,10.188\\\"));\\n add(new Coordinates(\\\"-122.19213505,47.77480208,9.988\\\"));\\n add(new Coordinates(\\\"-122.19212451,47.77479761,10.080\\\"));\\n add(new Coordinates(\\\"-122.19211571,47.77479427,11.799\\\"));\\n add(new Coordinates(\\\"-122.19210976,47.77478996,12.827\\\"));\\n add(new Coordinates(\\\"-122.19211063,47.77478275,12.455\\\"));\\n add(new Coordinates(\\\"-122.19210867,47.77477966,11.972\\\"));\\n add(new Coordinates(\\\"-122.19209880,47.77477701,11.224\\\"));\\n add(new Coordinates(\\\"-122.19208860,47.77477571,11.174\\\"));\\n add(new Coordinates(\\\"-122.19208772,47.77477829,10.066\\\"));\\n add(new Coordinates(\\\"-122.19208174,47.77477082,9.116\\\"));\\n add(new Coordinates(\\\"-122.19207288,47.77476146,6.540\\\"));\\n add(new Coordinates(\\\"-122.19206631,47.77474937,5.343\\\"));\\n add(new Coordinates(\\\"-122.19206107,47.77474020,7.509\\\"));\\n add(new Coordinates(\\\"-122.19205903,47.77473648,7.923\\\"));\\n add(new Coordinates(\\\"-122.19206261,47.77474166,6.203\\\"));\\n add(new Coordinates(\\\"-122.19206450,47.77474194,5.918\\\"));\\n add(new Coordinates(\\\"-122.19205951,47.77473670,4.994\\\"));\\n add(new Coordinates(\\\"-122.19204892,47.77472567,2.787\\\"));\\n }\\n };\\n }\",\n \"public float[][] getPath() {\\n/* 825 */ COSBase base = getCOSObject().getDictionaryObject(COSName.PATH);\\n/* 826 */ if (base instanceof COSArray) {\\n/* */ \\n/* 828 */ COSArray array = (COSArray)base;\\n/* 829 */ float[][] pathArray = new float[array.size()][];\\n/* 830 */ for (int i = 0; i < array.size(); i++) {\\n/* */ \\n/* 832 */ COSBase base2 = array.getObject(i);\\n/* 833 */ if (base2 instanceof COSArray) {\\n/* */ \\n/* 835 */ pathArray[i] = ((COSArray)array.getObject(i)).toFloatArray();\\n/* */ }\\n/* */ else {\\n/* */ \\n/* 839 */ pathArray[i] = new float[0];\\n/* */ } \\n/* */ } \\n/* 842 */ return pathArray;\\n/* */ } \\n/* 844 */ return (float[][])null;\\n/* */ }\",\n \"private void generateCube() {\\n\\t\\tverts = new Vector[] {new Vector(3), new Vector(3), new Vector(3), new Vector(3), new Vector(3), new Vector(3), new Vector(3), new Vector(3)};\\n\\t\\tverts[0].setElement(0, -1);\\n\\t\\tverts[0].setElement(1, -1);\\n\\t\\tverts[0].setElement(2, -1);\\n\\t\\t\\n\\t\\tverts[1].setElement(0, 1);\\n\\t\\tverts[1].setElement(1, -1);\\n\\t\\tverts[1].setElement(2, -1);\\n\\t\\t\\n\\t\\tverts[2].setElement(0, -1);\\n\\t\\tverts[2].setElement(1, -1);\\n\\t\\tverts[2].setElement(2, 1);\\n\\t\\t\\n\\t\\tverts[3].setElement(0, 1);\\n\\t\\tverts[3].setElement(1, -1);\\n\\t\\tverts[3].setElement(2, 1);\\n\\t\\t\\n\\t\\tverts[4].setElement(0, -1);\\n\\t\\tverts[4].setElement(1, 1);\\n\\t\\tverts[4].setElement(2, -1);\\n\\t\\t\\n\\t\\tverts[5].setElement(0, 1);\\n\\t\\tverts[5].setElement(1, 1);\\n\\t\\tverts[5].setElement(2, -1);\\n\\t\\t\\n\\t\\tverts[6].setElement(0, -1);\\n\\t\\tverts[6].setElement(1, 1);\\n\\t\\tverts[6].setElement(2, 1);\\n\\t\\t\\n\\t\\tverts[7].setElement(0, 1);\\n\\t\\tverts[7].setElement(1, 1);\\n\\t\\tverts[7].setElement(2, 1);\\n\\t\\t\\n\\t\\tfaces = new int[][] {{0, 3, 2}, {0, 1, 3}, {0, 4, 5}, {0, 5, 1}, {0, 2, 6}, {0, 6, 4}, {2, 7, 6}, {2, 3, 7}, {3, 1, 5}, {3, 5, 7}, {4, 7, 5}, {4, 6, 7}}; // List the vertices of each face by index in verts. Vertices must be listed in clockwise order from outside of the shape so that the faces pointing away from the camera can be culled or shaded differently\\n\\t}\",\n \"public interface PathCalculationStrategy {\\n\\t\\n\\t/**\\n\\t * Returns the shortest path for a Journey.\\n\\t * \\n\\t * @param grid the traffic grid.\\n\\t * @param src the source location.\\n\\t * @param dest the destination location.\\n\\t * \\n\\t * @return a List containing the path for the Journey.\\n\\t */\\n\\tList getPath(int grid[][], Point src, Point dest);\\n}\",\n \"@Override\\n public float getCube() {\\n\\n int wart = 0;\\n if (!roomList.isEmpty()){\\n for (Room room : roomList){\\n if (room instanceof Localization){\\n wart += room.getCube();\\n }\\n }\\n }\\n return wart;\\n }\",\n \"private void estimateFlatEarthPolynomial() {\\n int minLine = 0;\\n int maxLine = sourceImageHeight;\\n int minPixel = 0;\\n int maxPixel = sourceImageWidth;\\n \\n Rectangle rectangle = new Rectangle();\\n rectangle.setSize(maxPixel, maxLine);\\n \\n // int srpPolynomialDegree = 5; // for flat earth phase\\n int numberOfCoefficients = numberOfCoefficients(srpPolynomialDegree);\\n \\n double[][] position = distributePoints(srpNumberPoints, rectangle);\\n \\n // setup observation and design matrix\\n DoubleMatrix y = new DoubleMatrix(srpNumberPoints);\\n DoubleMatrix A = new DoubleMatrix(srpNumberPoints, numberOfCoefficients);\\n \\n double masterMinPi4divLam = (-4 * Math.PI * Constants.lightSpeed) / masterMetadata.radar_wavelength;\\n double slaveMinPi4divLam = (-4 * Math.PI * Constants.lightSpeed) / slaveMetadata.radar_wavelength;\\n \\n // Loop throu a vector or distributedPoints()\\n for (int i = 0; i < srpNumberPoints; ++i) {\\n \\n double line = position[i][0];\\n double pixel = position[i][1];\\n \\n // compute azimuth/range time for this pixel\\n final double masterTimeRange = pix2tr(pixel, masterMetadata);\\n \\n // compute xyz of this point : sourceMaster\\n Point3d xyzMaster = lp2xyz(line, pixel, masterMetadata, masterOrbit);\\n \\n final Point2d slaveTimeVector = xyz2t(xyzMaster, slaveMetadata, slaveOrbit);\\n final double slaveTimeRange = slaveTimeVector.x;\\n \\n // observation vector\\n y.put(i, (masterMinPi4divLam * masterTimeRange) - (slaveMinPi4divLam * slaveTimeRange));\\n \\n // set up a system of equations\\n // ______Order unknowns: A00 A10 A01 A20 A11 A02 A30 A21 A12 A03 for degree=3______\\n double posL = normalize(line, minLine, maxLine);\\n double posP = normalize(pixel, minPixel, maxPixel);\\n \\n int index = 0;\\n \\n for (int j = 0; j <= srpPolynomialDegree; j++) {\\n for (int k = 0; k <= j; k++) {\\n // System.out.println(\\\"A[\\\" + i + \\\",\\\" + index + \\\"]: \\\"\\n // + Math.pow(posL, (float) (j - k)) * Math.pow(posP, (float) k));\\n A.put(i, index, (Math.pow(posL, (double) (j - k)) * Math.pow(posP, (double) k)));\\n index++;\\n }\\n }\\n }\\n \\n // Fit polynomial through computed vector of phases\\n DoubleMatrix Atranspose = A.transpose();\\n DoubleMatrix N = Atranspose.mmul(A);\\n DoubleMatrix rhs = Atranspose.mmul(y);\\n \\n // TODO: validate Cholesky decomposition of JBLAS: see how it is in polyfit and reuse!\\n \\n // this should be the coefficient of the reference phase\\n flatEarthPolyCoefs = Solve.solve(N, rhs);\\n \\n /*\\n System.out.println(\\\"*******************************************************************\\\");\\n System.out.println(\\\"_Start_flat_earth\\\");\\n System.out.println(\\\"*******************************************************************\\\");\\n System.out.println(\\\"Degree_flat:\\\" + polyDegree);\\n System.out.println(\\\"Estimated_coefficients_flatearth:\\\");\\n int coeffLine = 0;\\n int coeffPixel = 0;\\n for (int i = 0; i < numberOfCoefficients; i++) {\\n if (flatEarthPolyCoefs.get(i, 0) < 0.) {\\n System.out.print(flatEarthPolyCoefs.get(i, 0));\\n } else {\\n System.out.print(\\\" \\\" + flatEarthPolyCoefs.get(i, 0));\\n }\\n \\n System.out.print(\\\" \\\\t\\\" + coeffLine + \\\" \\\" + coeffPixel + \\\"\\\\n\\\");\\n coeffLine--;\\n coeffPixel++;\\n if (coeffLine == -1) {\\n coeffLine = coeffPixel;\\n coeffPixel = 0;\\n }\\n }\\n System.out.println(\\\"*******************************************************************\\\");\\n System.out.println(\\\"_End_flat_earth\\\");\\n System.out.println(\\\"*******************************************************************\\\");\\n */\\n \\n // TODO: test inverse : when cholesky is finished\\n // // ______Test inverse______\\n // for (i=0; i .01)\\n // {\\n // ERROR << \\\"Deviation too large. Decrease degree or number of points?\\\";\\n // PRINT_ERROR(ERROR.get_str())\\n // throw(some_error);\\n // }\\n // else if (maxdev > .001)\\n // {\\n // WARNING << \\\"Deviation quite large. Decrease degree or number of points?\\\";\\n // WARNING.print();\\n // }\\n // else\\n // {\\n // INFO.print(\\\"Deviation is OK.\\\");\\n // }\\n // // ______Some other stuff, scale is ok______\\n // matrix y_hat = A * rhs;\\n // matrix e_hat = y - y_hat;\\n }\",\n \"@Override\\n \\tpublic void globe(int M, int N) {\\n\\t\\tvertices = new double[][] { { 1, 1, 1, 0, 0, 1 },\\n\\t\\t\\t\\t{ 1, -1, 1, 0, 0, 1 }, { -1, -1, 1, 0, 0, 1 },\\n\\t\\t\\t\\t{ -1, 1, 1, 0, 0, 1 }, { 1, 1, -1, 0, 0, -1 },\\n\\t\\t\\t\\t{ 1, -1, -1, 0, 0, -1 }, { -1, -1, -1, 0, 0, -1 },\\n\\t\\t\\t\\t{ -1, 1, -1, 0, 0, -1 }, { 1, 1, 1, 1, 0, 0 },\\n\\t\\t\\t\\t{ 1, -1, 1, 1, 0, 0 }, { 1, -1, -1, 1, 0, 0 },\\n\\t\\t\\t\\t{ 1, 1, -1, 1, 0, 0 }, { -1, 1, 1, -1, 0, 0 },\\n\\t\\t\\t\\t{ -1, -1, 1, -1, 0, 0 }, { -1, -1, -1, -1, 0, 0 },\\n\\t\\t\\t\\t{ -1, 1, -1, -1, 0, 0 }, { 1, 1, 1, 0, 1, 0 },\\n\\t\\t\\t\\t{ -1, 1, 1, 0, 1, 0 }, { -1, 1, -1, 0, 1, 0 },\\n\\t\\t\\t\\t{ 1, 1, -1, 0, 1, 0 }, { 1, -1, 1, 0, -1, 0 },\\n\\t\\t\\t\\t{ -1, -1, 1, 0, -1, 0 }, { -1, -1, -1, 0, -1, 0 },\\n\\t\\t\\t\\t{ 1, -1, -1, 0, -1, 0 }, };\\n \\t\\tfaces = new int[6][4];\\n \\t\\tfor (int i = 0; i < faces.length; i++) {\\n \\t\\t\\tfaces[i] = new int[] { i * 4, i * 4 + 1, i * 4 + 2, i * 4 + 3 };\\n \\t\\t}\\n \\n \\t\\tthis.m.identity();\\n \\t}\",\n \"@Override\\r\\n\\t\\tpublic int cube() {\\n\\t\\t\\treturn width*width*width;\\r\\n\\t\\t}\",\n \"public void makeCube (int subdivisions)\\r\\n {\\r\\n \\tfloat horz[] = new float[subdivisions + 1];\\r\\n \\tfloat vert[] = new float[subdivisions + 1];\\r\\n \\t\\r\\n \\t\\r\\n \\t// Front face\\r\\n \\tPoint p1 = new Point(-0.5f, -0.5f, 0.5f);\\r\\n \\tPoint p2 = new Point(0.5f, -0.5f, 0.5f);\\r\\n \\tPoint p3 = new Point(0.5f, 0.5f, 0.5f);\\r\\n \\tPoint p4 = new Point(-0.5f, 0.5f, 0.5f);\\r\\n \\t\\r\\n \\tfloat h = p1.x;\\r\\n \\tfloat v = p1.y;\\r\\n \\t\\r\\n \\tfor( int i = 0; i <= subdivisions; i++ )\\r\\n \\t{\\r\\n \\t\\thorz[i] = h;\\r\\n \\t\\th = h + (float)(1/(float)subdivisions);\\r\\n \\t}\\r\\n \\t\\r\\n \\tfor( int i = 0; i <= subdivisions; i++)\\r\\n \\t{\\r\\n \\t\\tvert[i] = v;\\r\\n \\t\\tv = v + (float)(1/(float)subdivisions);\\r\\n \\t}\\r\\n \\t\\r\\n \\tfor( int j = 0; j < vert.length - 1; j ++)\\r\\n \\t\\tfor( int k = 0; k < horz.length - 1; k ++)\\r\\n \\t\\t{\\r\\n \\t\\t\\tPoint tempP1 = new Point(horz[k], vert[j], 0.5f);\\r\\n \\t\\t\\tPoint tempP2 = new Point(horz[k + 1], vert[j], 0.5f);\\r\\n \\t\\t\\tPoint tempP3 = new Point(horz[k + 1], vert[j + 1], 0.5f);\\r\\n \\t\\t\\tPoint tempP4 = new Point(horz[k], vert[j + 1], 0.5f);\\r\\n \\t\\t\\t\\r\\n \\t\\t\\taddTriangle(tempP1.x, tempP1.y, tempP1.z, tempP3.x, tempP3.y, tempP3.z, tempP4.x, tempP4.y, tempP4.z);\\r\\n \\t\\t\\taddTriangle(tempP1.x, tempP1.y, tempP1.z, tempP2.x, tempP2.y, tempP2.z, tempP3.x, tempP3.y, tempP3.z);\\r\\n \\t\\t\\t\\r\\n \\t\\t}\\r\\n \\t\\r\\n \\t// Back face\\r\\n \\tp1.y = p1.z = -0.5f;\\r\\n \\tp1.x = 0.5f;\\r\\n \\tp2.x = p2.y = p2.z = -0.5f;\\r\\n \\tp3.x = p3.z = -0.5f;\\r\\n \\tp3.y = 0.5f;\\r\\n \\tp4.x = p4.y = 0.5f;\\r\\n \\tp4.z = -0.5f;\\r\\n \\t\\r\\n \\th = p1.x;\\r\\n \\tv = p1.y;\\r\\n \\t\\r\\n \\t\\r\\n \\tfor( int i = 0; i <= subdivisions; i++ )\\r\\n \\t{\\r\\n \\t\\thorz[i] = h;\\r\\n \\t\\th = h - (float)(1/(float)subdivisions);\\r\\n \\t}\\r\\n \\t\\r\\n \\tfor( int i = 0; i <= subdivisions; i++)\\r\\n \\t{\\r\\n \\t\\tvert[i] = v;\\r\\n \\t\\tv = v + (float)(1/(float)subdivisions);\\r\\n \\t}\\r\\n \\t\\r\\n \\tfor( int j = 0; j < vert.length - 1; j ++)\\r\\n \\t\\tfor( int k = 0; k < horz.length - 1; k ++)\\r\\n \\t\\t{\\r\\n \\t\\t\\tPoint tempP1 = new Point(horz[k], vert[j], -0.5f);\\r\\n \\t\\t\\tPoint tempP2 = new Point(horz[k + 1], vert[j], -0.5f);\\r\\n \\t\\t\\tPoint tempP3 = new Point(horz[k + 1], vert[j + 1], -0.5f);\\r\\n \\t\\t\\tPoint tempP4 = new Point(horz[k], vert[j + 1], -0.5f);\\r\\n \\t\\t\\t\\r\\n \\t\\t\\taddTriangle(tempP1.x, tempP1.y, tempP1.z, tempP3.x, tempP3.y, tempP3.z, tempP4.x, tempP4.y, tempP4.z);\\r\\n \\t\\t\\taddTriangle(tempP1.x, tempP1.y, tempP1.z, tempP2.x, tempP2.y, tempP2.z, tempP3.x, tempP3.y, tempP3.z);\\r\\n \\t\\t\\t\\r\\n \\t\\t}\\r\\n \\t\\r\\n \\t// Left face\\r\\n \\tp1.x = p1.y = p1.z = -0.5f;\\r\\n \\tp2.x = p2.y = -0.5f;\\r\\n \\tp2.z = 0.5f;\\r\\n \\tp3.x = -0.5f;\\r\\n \\tp3.y = p3.z = 0.5f;\\r\\n \\tp4.y = 0.5f;\\r\\n \\tp4.x = p4.z = -0.5f;\\r\\n \\t\\r\\n \\th = p1.z;\\r\\n \\tv = p1.y;\\r\\n \\t\\r\\n \\t\\r\\n \\tfor( int i = 0; i <= subdivisions; i++ )\\r\\n \\t{\\r\\n \\t\\thorz[i] = h;\\r\\n \\t\\th = h + (float)(1/(float)subdivisions);\\r\\n \\t}\\r\\n \\t\\r\\n \\tfor( int i = 0; i <= subdivisions; i++)\\r\\n \\t{\\r\\n \\t\\tvert[i] = v;\\r\\n \\t\\tv = v + (float)(1/(float)subdivisions);\\r\\n \\t}\\r\\n \\t\\r\\n \\tfor( int j = 0; j < vert.length - 1; j ++)\\r\\n \\t\\tfor( int k = 0; k < horz.length - 1; k ++)\\r\\n \\t\\t{\\r\\n \\t\\t\\tPoint tempP1 = new Point(-0.5f, vert[j], horz[k]);\\r\\n \\t\\t\\tPoint tempP2 = new Point(-0.5f, vert[j], horz[k + 1]);\\r\\n \\t\\t\\tPoint tempP3 = new Point(-0.5f, vert[j + 1], horz[k + 1]);\\r\\n \\t\\t\\tPoint tempP4 = new Point(-0.5f, vert[j + 1], horz[k]);\\r\\n \\t\\t\\t\\r\\n \\t\\t\\taddTriangle(tempP1.x, tempP1.y, tempP1.z, tempP3.x, tempP3.y, tempP3.z, tempP4.x, tempP4.y, tempP4.z);\\r\\n \\t\\t\\taddTriangle(tempP1.x, tempP1.y, tempP1.z, tempP2.x, tempP2.y, tempP2.z, tempP3.x, tempP3.y, tempP3.z);\\r\\n \\t\\t\\t\\r\\n \\t\\t}\\r\\n \\t\\r\\n \\t// Right face\\r\\n \\tp1.x = p1.z = 0.5f;\\r\\n \\tp1.y = -0.5f;\\r\\n \\tp2.y = p2.z = -0.5f;\\r\\n \\tp2.x = 0.5f;\\r\\n \\tp3.x = p3.y = 0.5f;\\r\\n \\tp3.z = -0.5f;\\r\\n \\tp4.x = p4.y = p4.z = 0.5f;\\r\\n \\t\\r\\n \\t\\r\\n \\th = p1.z;\\r\\n \\tv = p1.y;\\r\\n \\t\\r\\n \\t\\r\\n \\tfor( int i = 0; i <= subdivisions; i++ )\\r\\n \\t{\\r\\n \\t\\thorz[i] = h;\\r\\n \\t\\th = h - (float)(1/(float)subdivisions);\\r\\n \\t}\\r\\n \\t\\r\\n \\tfor( int i = 0; i <= subdivisions; i++)\\r\\n \\t{\\r\\n \\t\\tvert[i] = v;\\r\\n \\t\\tv = v + (float)(1/(float)subdivisions);\\r\\n \\t}\\r\\n \\t\\r\\n \\tfor( int j = 0; j < vert.length - 1; j ++)\\r\\n \\t\\tfor( int k = 0; k < horz.length - 1; k ++)\\r\\n \\t\\t{\\r\\n \\t\\t\\tPoint tempP1 = new Point(0.5f, vert[j], horz[k]);\\r\\n \\t\\t\\tPoint tempP2 = new Point(0.5f, vert[j], horz[k + 1]);\\r\\n \\t\\t\\tPoint tempP3 = new Point(0.5f, vert[j + 1], horz[k + 1]);\\r\\n \\t\\t\\tPoint tempP4 = new Point(0.5f, vert[j + 1], horz[k]);\\r\\n \\t\\t\\t\\r\\n \\t\\t\\taddTriangle(tempP1.x, tempP1.y, tempP1.z, tempP3.x, tempP3.y, tempP3.z, tempP4.x, tempP4.y, tempP4.z);\\r\\n \\t\\t\\taddTriangle(tempP1.x, tempP1.y, tempP1.z, tempP2.x, tempP2.y, tempP2.z, tempP3.x, tempP3.y, tempP3.z);\\r\\n \\t\\t\\t\\r\\n \\t\\t}\\r\\n \\t\\r\\n \\t// Top face\\r\\n \\tp1.x = -0.5f;\\r\\n \\tp1.y = p1.z = 0.5f;\\r\\n \\tp2.x = p2.y = p2.z = 0.5f;\\r\\n \\tp3.x = p3.y = 0.5f;\\r\\n \\tp3.z = -0.5f;\\r\\n \\tp4.x = p4.z = -0.5f;\\r\\n \\tp4.y = 0.5f;\\r\\n \\t\\r\\n \\t\\r\\n \\th = p1.x;\\r\\n \\tv = p1.z;\\r\\n \\t\\r\\n \\t\\r\\n \\tfor( int i = 0; i <= subdivisions; i++ )\\r\\n \\t{\\r\\n \\t\\thorz[i] = h;\\r\\n \\t\\th = h + (float)(1/(float)subdivisions);\\r\\n \\t}\\r\\n \\t\\r\\n \\tfor( int i = 0; i <= subdivisions; i++)\\r\\n \\t{\\r\\n \\t\\tvert[i] = v;\\r\\n \\t\\tv = v - (float)(1/(float)subdivisions);\\r\\n \\t}\\r\\n \\t\\r\\n \\tfor( int j = 0; j < vert.length - 1; j ++)\\r\\n \\t\\tfor( int k = 0; k < horz.length - 1; k ++)\\r\\n \\t\\t{\\r\\n \\t\\t\\tPoint tempP1 = new Point(horz[k], 0.5f, vert[j]);\\r\\n \\t\\t\\tPoint tempP2 = new Point(horz[k + 1], 0.5f, vert[j]);\\r\\n \\t\\t\\tPoint tempP3 = new Point(horz[k + 1], 0.5f, vert[j + 1]);\\r\\n \\t\\t\\tPoint tempP4 = new Point(horz[k], 0.5f, vert[j + 1]);\\r\\n \\t\\t\\t\\r\\n \\t\\t\\taddTriangle(tempP1.x, tempP1.y, tempP1.z, tempP3.x, tempP3.y, tempP3.z, tempP4.x, tempP4.y, tempP4.z);\\r\\n \\t\\t\\taddTriangle(tempP1.x, tempP1.y, tempP1.z, tempP2.x, tempP2.y, tempP2.z, tempP3.x, tempP3.y, tempP3.z);\\r\\n \\t\\t\\t\\r\\n \\t\\t}\\r\\n \\t\\r\\n \\t// Bottom face\\r\\n \\tp1.x = p1.y = p1.z = -0.5f;\\r\\n \\tp2.y = p2.z = 0.5f;\\r\\n \\tp2.x = 0.5f;\\r\\n \\tp3.x = p3.z = 0.5f;\\r\\n \\tp3.y = -0.5f;\\r\\n \\tp4.x = p4.y = -0.5f;\\r\\n \\tp4.z = 0.5f;\\r\\n \\t\\r\\n \\t\\r\\n \\th = p1.x;\\r\\n \\tv = p1.z;\\r\\n \\t\\r\\n \\t\\r\\n \\tfor( int i = 0; i <= subdivisions; i++ )\\r\\n \\t{\\r\\n \\t\\thorz[i] = h;\\r\\n \\t\\th = h + (float)(1/(float)subdivisions);\\r\\n \\t}\\r\\n \\t\\r\\n \\tfor( int i = 0; i <= subdivisions; i++)\\r\\n \\t{\\r\\n \\t\\tvert[i] = v;\\r\\n \\t\\tv = v + (float)(1/(float)subdivisions);\\r\\n \\t}\\r\\n \\t\\r\\n \\tfor( int j = 0; j < vert.length - 1; j ++)\\r\\n \\t\\tfor( int k = 0; k < horz.length - 1; k ++)\\r\\n \\t\\t{\\r\\n \\t\\t\\tPoint tempP1 = new Point(horz[k], -0.5f, vert[j]);\\r\\n \\t\\t\\tPoint tempP2 = new Point(horz[k + 1], -0.5f, vert[j]);\\r\\n \\t\\t\\tPoint tempP3 = new Point(horz[k + 1], -0.5f, vert[j + 1]);\\r\\n \\t\\t\\tPoint tempP4 = new Point(horz[k], -0.5f, vert[j + 1]);\\r\\n \\t\\t\\t\\r\\n \\t\\t\\taddTriangle(tempP1.x, tempP1.y, tempP1.z, tempP3.x, tempP3.y, tempP3.z, tempP4.x, tempP4.y, tempP4.z);\\r\\n \\t\\t\\taddTriangle(tempP1.x, tempP1.y, tempP1.z, tempP2.x, tempP2.y, tempP2.z, tempP3.x, tempP3.y, tempP3.z);\\r\\n \\t\\t\\t\\r\\n \\t\\t}\\r\\n \\t\\r\\n }\",\n \"public static List drawCube(Location location1, Location location2, Float density, boolean isBlock) {\\n Location loc1 = location1.clone(), loc2 = location2.clone();\\n\\n loc1.setX(Math.min(location1.getX(),location2.getX()));\\n loc1.setY(Math.min(location1.getY(),location2.getY()));\\n loc1.setZ(Math.min(location1.getZ(),location2.getZ()));\\n loc2.setX(Math.max(location1.getX(),location2.getX()));\\n loc2.setY(Math.max(location1.getY(),location2.getY()));\\n loc2.setZ(Math.max(location1.getZ(),location2.getZ()));\\n\\n if (isBlock) {\\n loc1 = loc1.getBlock().getLocation();\\n loc2 = loc2.getBlock().getLocation();\\n loc2.add(1, 1, 1);\\n }\\n\\n double deltaX = Math.abs(loc1.getX() - loc2.getX());\\n double deltaY = Math.abs(loc1.getY() - loc2.getY());\\n double deltaZ = Math.abs(loc1.getZ() - loc2.getZ());\\n\\n int dx = (int) Math.ceil(deltaX / density);\\n int dy = (int) Math.ceil(deltaY / density);\\n int dz = (int) Math.ceil(deltaZ / density);\\n\\n List collection = new ArrayList<>();\\n int[][] var1 = {{0, 0}, {1, 0}, {0, 1}, {1, 1}};\\n for (int[] i : var1) {\\n Location locx = loc1.clone().add(i[0] * deltaX, 0, i[1] * deltaZ);\\n collection.addAll(drawline(locx, locx.clone().add(0, deltaY, 0),dy));\\n\\n locx = loc1.clone().add(0, i[0] * deltaY, i[1] * deltaZ);\\n collection.addAll(drawline(locx, locx.clone().add(deltaX, 0, 0),dx));\\n\\n locx = loc1.clone().add(i[0] * deltaX, i[1] * deltaY, 0);\\n collection.addAll(drawline(locx, locx.clone().add(0, 0, deltaZ),dz));\\n }\\n return collection;\\n }\",\n \"public Cube[][] getCubeGrid() {\\n return cubeGrid;\\n }\",\n \"@Test\\n\\tpublic void testGetPathIntegral() throws GeoTessException\\n\\t{\\n\\t\\tdouble[] pointA = new double[3];\\n\\t\\tdouble[] pointB = new double[3];\\n\\t\\t\\n\\t\\tVectorGeo.getVectorDegrees(0., 0., pointA);\\n\\t\\tVectorGeo.getVectorDegrees(0., 30., pointB);\\n\\n\\t\\tGreatCircle greatCircle = new GreatCircle(pointA, pointB);\\n\\t\\t\\n\\t\\tArrayList rayPath = greatCircle.getPoints(31, false);\\n\\n\\t\\t// radii will the radius of each of the points along the rayPath.\\n\\t\\tdouble[] radii = new double[rayPath.size()];\\n\\t\\tArrays.fill(radii, 6300.);\\n\\t\\t\\n\\t\\tdouble dkm = model.getPathIntegral(-1, rayPath, radii, null,\\n\\t\\t\\t\\tInterpolatorType.NATURAL_NEIGHBOR, InterpolatorType.LINEAR);\\n\\t\\t\\n\\t\\tassertEquals(greatCircle.getDistance()*6300., dkm, 0.1);\\n\\t\\n\\t\\tdouble tt = model.getPathIntegral(0, rayPath, radii, null,\\n\\t\\t\\t\\tInterpolatorType.NATURAL_NEIGHBOR, InterpolatorType.LINEAR);\\n\\t\\t\\n\\t\\tassertEquals(408.216, tt, 0.1);\\n\\t\\n\\t}\",\n \"private double calculateSpiralDistanceFromCentre(double phi)\\n\\t{\\n\\t\\treturn a*Math.exp(b*phi);\\n\\t}\",\n \"@Override\\n protected void interpolate(double frac) {\\n ray.project(dist * frac);\\n // set the sphere to ray position\\n s.setTranslateX(ray.getPosition().getX());\\n s.setTranslateY(ray.getPosition().getY());\\n s.setTranslateZ(ray.getPosition().getZ());\\n\\n }\",\n \"public RMPath getPath() { return RMPath.unitRectPath; }\",\n \"private void setPath(){\\r\\n // get the reversed path\\r\\n ArrayList reversedPath = new ArrayList<>();\\r\\n int index = _endIndex;\\r\\n reversedPath.add(_map.get_grid(index));\\r\\n while(index != _startIndex){\\r\\n index = _map.get_grid(index).get_parent();\\r\\n reversedPath.add(_map.get_grid(index));\\r\\n }\\r\\n\\r\\n // get the final path in the correct order\\r\\n int length = reversedPath.size();\\r\\n for(int i=length-1;i>=0;i--){\\r\\n _path.add(reversedPath.get(i));\\r\\n }\\r\\n }\",\n \"public ArrayList findPath() {\\n \\n //if we've already been through findPath, then just return it\\n if (solutionCalculated) {\\n return solution;\\n }\\n \\n //instantiate path\\n solution = new ArrayList();\\n \\n //create boolean array of visited nodes (default: false)\\n boolean[] visited = new boolean[arrayOfVertices.length];\\n \\n //(for testing)\\n NavigateMaze.drawMaze(getVertices());\\n \\n //call dfs\\n dfs(visited, arrayOfVertices[0], \\n arrayOfVertices[arrayOfVertices.length - 1]);\\n \\n //update solutionCalculated to true\\n solutionCalculated = true;\\n \\n //return solution\\n return solution;\\n \\n }\",\n \"public T getPath() {\\n\\tif (path == null) path = newSplinePath2D();\\n\\tint cpsize = cplist.size();\\n\\tif (cpsize > 0) {\\n\\t CPoint[] array = new CPoint[cpsize];\\n\\t cplist.toArray(array);\\n\\t appendAux(array);\\n\\t cplist.clear();\\n\\t}\\n\\treturn path;\\n }\",\n \"List getPath(int grid[][], Point src, Point dest);\",\n \"public ArrayList getPath() {\\n\\t\\treturn path;\\n\\t\\t\\n\\t}\",\n \"public abstract double getSurfacearea();\",\n \"public void evaluate_surface() {\\n if (surface_type != 2) {\\n double epsilon = 0.001;\\n\\n for (int i = 0; i < nr_of_segments; i++) {\\n for (double u = 0.0; u < 1.0 - epsilon; u = u + step) {\\n for (int j = 0; j < points_per_segment; j++) {\\n for (double v = 0.0; v < 1.0 - epsilon; v = v + step) {\\n evaluated_points[(int) (((i + u) / step) + epsilon)][(int) (((j + v) / step)\\n + epsilon)] = evaluate_point_on_surface(i, j, u, v);\\n }\\n }\\n }\\n }\\n }\\n\\n }\",\n \"public interface BoundedObject {\\n public BoundedCube getBounds();\\n\\n public static class BoundedCube implements Comparable {\\n public long lx, ty, iz = 0;\\n public long rx, by, oz = 0;\\n\\n public BoundedCube() {\\n super();\\n }\\n\\n public BoundedCube(long lx, long rx, long ty, long by, long iz, long oz) {\\n super();\\n this.lx = lx;\\n this.rx = rx;\\n this.ty = ty;\\n this.by = by;\\n this.iz = iz;\\n this.oz = oz;\\n }\\n\\n public BoundedCube(long[] coords, long radius) {\\n super();\\n this.lx = coords[0] - radius;\\n this.rx = coords[0] + radius;\\n this.ty = coords[1] - radius;\\n this.by = coords[1] + radius;\\n this.iz = coords[2] - radius;\\n this.oz = coords[2] + radius;\\n }\\n\\n public BoundedCube(BoundedCube l) {\\n super();\\n set(l);\\n }\\n\\n public void set(BoundedCube l) {\\n this.lx = l.lx;\\n this.rx = l.rx;\\n this.ty = l.ty;\\n this.by = l.by;\\n this.iz = l.iz;\\n this.oz = l.oz;\\n }\\n\\n public void union(BoundedCube l) {\\n if (l.lx < lx)\\n lx = l.lx;\\n if (l.rx > rx)\\n rx = l.rx;\\n if (l.ty < ty)\\n ty = l.ty;\\n if (l.by > by)\\n by = l.by;\\n if (l.iz < iz)\\n iz = l.iz;\\n if (l.oz > oz)\\n oz = l.oz;\\n }\\n\\n public long radius() {\\n return Math.round(Math.sqrt(((rx - lx) * (rx - lx))\\n + ((by - ty) * (by - ty))\\n + ((oz - iz) * (oz - iz))));\\n }\\n\\n public BoundedCube expand(double[] direction, long distance) {\\n final BoundedCube cube = new BoundedCube(this);\\n final double x1 = Math.cos(direction[0]) * Math.sin(direction[1]);\\n final double y1 = Math.sin(direction[0]) * Math.sin(direction[1]);\\n final double z1 = Math.cos(direction[1]);\\n final long[] oldCenter = new long[]{((lx + rx) / 2), ((ty + rx) / 2), ((iz + oz) / 2)};\\n final long[] newCenter = new long[]{\\n oldCenter[0] + Math.round(CMath.mul(distance, x1)),\\n oldCenter[1] + Math.round(CMath.mul(distance, y1)),\\n oldCenter[2] + Math.round(CMath.mul(distance, z1))};\\n if (newCenter[0] > oldCenter[0])\\n cube.rx += newCenter[0] - oldCenter[0];\\n else\\n cube.lx += newCenter[0] - oldCenter[0];\\n if (newCenter[1] > oldCenter[1])\\n cube.ty += newCenter[1] - oldCenter[1];\\n else\\n cube.by += newCenter[1] - oldCenter[1];\\n if (newCenter[2] > oldCenter[2])\\n cube.iz += newCenter[2] - oldCenter[2];\\n else\\n cube.oz += newCenter[2] - oldCenter[2];\\n return cube;\\n }\\n\\n public boolean intersects(BoundedCube two) {\\n if (two == null)\\n return false;\\n return (\\n ((lx <= two.lx && two.lx <= rx) || (two.lx <= lx && lx <= two.rx))\\n && ((ty <= two.ty && two.ty <= by) || (two.ty <= ty && ty <= two.by))\\n && ((iz <= two.iz && two.iz <= oz) || (two.iz <= iz && iz <= two.oz))\\n );\\n }\\n\\n public boolean contains(long x, long y, long z) {\\n return ((x >= lx)\\n && (x <= rx)\\n && (y >= ty)\\n && (y <= by)\\n && (z >= iz)\\n && (z <= oz));\\n }\\n\\n public long width() {\\n return rx - lx;\\n }\\n\\n public long height() {\\n return by - ty;\\n }\\n\\n public long depth() {\\n return oz - iz;\\n }\\n\\n @Override\\n public int compareTo(BoundedCube o) {\\n if (lx < o.lx)\\n return -1;\\n if (lx > o.lx)\\n return 1;\\n if (rx < o.rx)\\n return -1;\\n if (rx > o.rx)\\n return 1;\\n if (ty < o.ty)\\n return -1;\\n if (ty > o.ty)\\n return 1;\\n if (by < o.by)\\n return -1;\\n if (by > o.by)\\n return 1;\\n if (iz < o.iz)\\n return -1;\\n if (iz > o.iz)\\n return 1;\\n if (oz < o.oz)\\n return -1;\\n if (oz > o.oz)\\n return 1;\\n return 0;\\n }\\n }\\n}\",\n \"public Point3d sampleHemisphere();\",\n \"public float getSphereRadius();\",\n \"@Test\\n\\tpublic void testGetGridOffsetValues() {\\n\\t\\tAssert.assertEquals(13.68, Geoid.getGridOffset(90.0, 0.0), EPSILON);\\n\\t\\tAssert.assertEquals(-29.79, Geoid.getGridOffset(-90.0, 0.0), EPSILON);\\n\\n\\t\\t// random grid params from EGM.complete.txt.gz\\n\\t\\t// 89.74 5.75 13.89\\n\\t\\t// 86.5 217.25 11.76\\n\\t\\t// 71.25 8.0 43.56\\n\\t\\t// 54.0 182.25 2.35\\n\\t\\t// 35.5 186.0 -12.91\\n\\t\\t// 14.75 213.5 -8.07\\n\\t\\t// -22.25 221.5 -10.18\\n\\t\\t// -37.5 13.0 25.61\\n\\t\\t// -51.75 157.25 -17.88\\n\\t\\t// -70.5 346.0 5.18\\n\\t\\t// -74.5 22.0 17.5\\n\\t\\t// -84.5 306.25 -25.71\\n\\t\\t// -86.75 328.75 -21.81\\n\\n\\t\\tAssert.assertEquals(13.89, Geoid.getGridOffset(89.74, 5.75), EPSILON); \\n\\t\\tAssert.assertEquals(11.76, Geoid.getGridOffset(86.5, 217.25), EPSILON);\\n\\t\\tAssert.assertEquals(43.56, Geoid.getGridOffset(71.25, 8.0), EPSILON);\\n\\t\\tAssert.assertEquals(2.35, Geoid.getGridOffset(54.0, 182.25), EPSILON);\\n\\t\\tAssert.assertEquals(-12.91, Geoid.getGridOffset(35.5, 186.0), EPSILON);\\n\\t\\tAssert.assertEquals(-8.07, Geoid.getGridOffset(14.75, 213.5), EPSILON);\\n\\t\\tAssert.assertEquals(-10.18, Geoid.getGridOffset(-22.25, 221.5), EPSILON);\\n\\t\\tAssert.assertEquals(25.61, Geoid.getGridOffset(-37.5, 13.0), EPSILON);\\n\\t\\tAssert.assertEquals(-17.88, Geoid.getGridOffset(-51.75, 157.25), EPSILON);\\n\\t\\tAssert.assertEquals(5.18, Geoid.getGridOffset(-70.5, 346.0), EPSILON);\\n\\t\\tAssert.assertEquals(17.5, Geoid.getGridOffset(-74.5, 22.0), EPSILON);\\n\\t\\tAssert.assertEquals(-25.71, Geoid.getGridOffset(-84.5, 306.25), EPSILON);\\n\\t\\tAssert.assertEquals(-21.81, Geoid.getGridOffset(-86.75, 328.75), EPSILON);\\n\\t\\tAssert.assertEquals(-29.79, Geoid.getGridOffset(-90.0, 0.0), EPSILON);\\n\\t}\",\n \"static private void npcPath() {\\n\\n if (Time.secondsPassed % 45 == 44) {\\n Random picker = new Random();\\n while (true) {\\n if (josephSchnitzel.getCurrentRoom().equals(mountain)) {\\n String[] newRoomString = {\\\"south\\\"};\\n int index = picker.nextInt(newRoomString.length);\\n Room next = josephSchnitzel.getCurrentRoom().getExit(newRoomString[index]);\\n josephSchnitzel.setCurrentRoom(next);\\n break;\\n }\\n\\n if (josephSchnitzel.getCurrentRoom().equals(beach)) {\\n String[] newRoomString = {\\\"north\\\"};\\n int indexOfNewRoomString = picker.nextInt(newRoomString.length);\\n Room nextRoom = josephSchnitzel.getCurrentRoom().getExit(newRoomString[indexOfNewRoomString]);\\n josephSchnitzel.setCurrentRoom(nextRoom);\\n break;\\n }\\n\\n if (josephSchnitzel.getCurrentRoom().equals(jungle)) {\\n String[] newRoomString = {\\\"north\\\", \\\"south\\\"};\\n int indexOfNewRoomString = picker.nextInt(newRoomString.length);\\n Room nextRoom = josephSchnitzel.getCurrentRoom().getExit(newRoomString[indexOfNewRoomString]);\\n josephSchnitzel.setCurrentRoom(nextRoom);\\n break;\\n }\\n }\\n }\\n }\",\n \"Vec3 getHomeCoords(IGeneticMob geneticMob);\",\n \"public CubeGL2(double width, double height, double depth) {\\n // Define points for a cube.\\n // X, Y, Z\\n mCubeVertexData = new float[]\\n {\\n // Front face\\n -1.0f, 1.0f, 1.0f,\\n -1.0f, -1.0f, 1.0f,\\n 1.0f, 1.0f, 1.0f,\\n -1.0f, -1.0f, 1.0f,\\n 1.0f, -1.0f, 1.0f,\\n 1.0f, 1.0f, 1.0f,\\n // Right face\\n 1.0f, 1.0f, 1.0f,\\n 1.0f, -1.0f, 1.0f,\\n 1.0f, 1.0f, -1.0f,\\n 1.0f, -1.0f, 1.0f,\\n 1.0f, -1.0f, -1.0f,\\n 1.0f, 1.0f, -1.0f,\\n // Back face\\n 1.0f, 1.0f, -1.0f,\\n 1.0f, -1.0f, -1.0f,\\n -1.0f, 1.0f, -1.0f,\\n 1.0f, -1.0f, -1.0f,\\n -1.0f, -1.0f, -1.0f,\\n -1.0f, 1.0f, -1.0f,\\n // Left face\\n -1.0f, 1.0f, -1.0f,\\n -1.0f, -1.0f, -1.0f,\\n -1.0f, 1.0f, 1.0f,\\n -1.0f, -1.0f, -1.0f,\\n -1.0f, -1.0f, 1.0f,\\n -1.0f, 1.0f, 1.0f,\\n // Top face\\n -1.0f, 1.0f, -1.0f,\\n -1.0f, 1.0f, 1.0f,\\n 1.0f, 1.0f, -1.0f,\\n -1.0f, 1.0f, 1.0f,\\n 1.0f, 1.0f, 1.0f,\\n 1.0f, 1.0f, -1.0f,\\n // Bottom face\\n 1.0f, -1.0f, -1.0f,\\n 1.0f, -1.0f, 1.0f,\\n -1.0f, -1.0f, -1.0f,\\n 1.0f, -1.0f, 1.0f,\\n -1.0f, -1.0f, 1.0f,\\n -1.0f, -1.0f, -1.0f,\\n };\\n\\n for (int i = 0; i < mCubeVertexData.length; i += 3) {\\n mCubeVertexData[i] = mCubeVertexData[i] * (float) width;\\n }\\n for (int i = 1; i < mCubeVertexData.length; i += 3) {\\n mCubeVertexData[i] = mCubeVertexData[i] * (float) height;\\n }\\n for (int i = 2; i < mCubeVertexData.length; i += 3) {\\n mCubeVertexData[i] = mCubeVertexData[i] * (float) depth;\\n }\\n\\n // R, G, B, A\\n mCubeColourData = new float[]\\n {\\n // Front face\\n 1.0f, 0.0f, 0.0f, 1.0f,\\n 1.0f, 0.0f, 0.0f, 1.0f,\\n 1.0f, 0.0f, 0.0f, 1.0f,\\n 1.0f, 0.0f, 0.0f, 1.0f,\\n 1.0f, 0.0f, 0.0f, 1.0f,\\n 1.0f, 0.0f, 0.0f, 1.0f,\\n // Right face\\n 0.0f, 1.0f, 0.0f, 1.0f,\\n 0.0f, 1.0f, 0.0f, 1.0f,\\n 0.0f, 1.0f, 0.0f, 1.0f,\\n 0.0f, 1.0f, 0.0f, 1.0f,\\n 0.0f, 1.0f, 0.0f, 1.0f,\\n 0.0f, 1.0f, 0.0f, 1.0f,\\n // Back face\\n 0.0f, 0.0f, 1.0f, 1.0f,\\n 0.0f, 0.0f, 1.0f, 1.0f,\\n 0.0f, 0.0f, 1.0f, 1.0f,\\n 0.0f, 0.0f, 1.0f, 1.0f,\\n 0.0f, 0.0f, 1.0f, 1.0f,\\n 0.0f, 0.0f, 1.0f, 1.0f,\\n // Left face\\n 1.0f, 1.0f, 0.0f, 1.0f,\\n 1.0f, 1.0f, 0.0f, 1.0f,\\n 1.0f, 1.0f, 0.0f, 1.0f,\\n 1.0f, 1.0f, 0.0f, 1.0f,\\n 1.0f, 1.0f, 0.0f, 1.0f,\\n 1.0f, 1.0f, 0.0f, 1.0f,\\n // Top face\\n 0.0f, 1.0f, 1.0f, 1.0f,\\n 0.0f, 1.0f, 1.0f, 1.0f,\\n 0.0f, 1.0f, 1.0f, 1.0f,\\n 0.0f, 1.0f, 1.0f, 1.0f,\\n 0.0f, 1.0f, 1.0f, 1.0f,\\n 0.0f, 1.0f, 1.0f, 1.0f,\\n // Bottom face\\n 1.0f, 0.0f, 1.0f, 1.0f,\\n 1.0f, 0.0f, 1.0f, 1.0f,\\n 1.0f, 0.0f, 1.0f, 1.0f,\\n 1.0f, 0.0f, 1.0f, 1.0f,\\n 1.0f, 0.0f, 1.0f, 1.0f,\\n 1.0f, 0.0f, 1.0f, 1.0f\\n };\\n // X, Y, Z\\n mCubeNormalData = new float[]\\n {\\n // Front face\\n 0.0f, 0.0f, 1.0f,\\n 0.0f, 0.0f, 1.0f,\\n 0.0f, 0.0f, 1.0f,\\n 0.0f, 0.0f, 1.0f,\\n 0.0f, 0.0f, 1.0f,\\n 0.0f, 0.0f, 1.0f,\\n // Right face\\n 1.0f, 0.0f, 0.0f,\\n 1.0f, 0.0f, 0.0f,\\n 1.0f, 0.0f, 0.0f,\\n 1.0f, 0.0f, 0.0f,\\n 1.0f, 0.0f, 0.0f,\\n 1.0f, 0.0f, 0.0f,\\n // Back face\\n 0.0f, 0.0f, -1.0f,\\n 0.0f, 0.0f, -1.0f,\\n 0.0f, 0.0f, -1.0f,\\n 0.0f, 0.0f, -1.0f,\\n 0.0f, 0.0f, -1.0f,\\n 0.0f, 0.0f, -1.0f,\\n // Left face\\n -1.0f, 0.0f, 0.0f,\\n -1.0f, 0.0f, 0.0f,\\n -1.0f, 0.0f, 0.0f,\\n -1.0f, 0.0f, 0.0f,\\n -1.0f, 0.0f, 0.0f,\\n -1.0f, 0.0f, 0.0f,\\n // Top face\\n 0.0f, 1.0f, 0.0f,\\n 0.0f, 1.0f, 0.0f,\\n 0.0f, 1.0f, 0.0f,\\n 0.0f, 1.0f, 0.0f,\\n 0.0f, 1.0f, 0.0f,\\n 0.0f, 1.0f, 0.0f,\\n // Bottom face\\n 0.0f, -1.0f, 0.0f,\\n 0.0f, -1.0f, 0.0f,\\n 0.0f, -1.0f, 0.0f,\\n 0.0f, -1.0f, 0.0f,\\n 0.0f, -1.0f, 0.0f,\\n 0.0f, -1.0f, 0.0f\\n };\\n // X, Y\\n // Texture coordinate data.\\n mCubeTextureCoordinateData = new float[]\\n {\\n // Front face\\n 0.0f, 0.0f,\\n 0.0f, 1.0f,\\n 1.0f, 0.0f,\\n 0.0f, 1.0f,\\n 1.0f, 1.0f,\\n 1.0f, 0.0f,\\n // Right face\\n 0.0f, 0.0f,\\n 0.0f, 1.0f,\\n 1.0f, 0.0f,\\n 0.0f, 1.0f,\\n 1.0f, 1.0f,\\n 1.0f, 0.0f,\\n // Back face\\n 0.0f, 0.0f,\\n 0.0f, 1.0f,\\n 1.0f, 0.0f,\\n 0.0f, 1.0f,\\n 1.0f, 1.0f,\\n 1.0f, 0.0f,\\n // Left face\\n 0.0f, 0.0f,\\n 0.0f, 1.0f,\\n 1.0f, 0.0f,\\n 0.0f, 1.0f,\\n 1.0f, 1.0f,\\n 1.0f, 0.0f,\\n // Top face\\n 0.0f, 0.0f,\\n 0.0f, 1.0f,\\n 1.0f, 0.0f,\\n 0.0f, 1.0f,\\n 1.0f, 1.0f,\\n 1.0f, 0.0f,\\n // Bottom face\\n 0.0f, 0.0f,\\n 0.0f, 1.0f,\\n 1.0f, 0.0f,\\n 0.0f, 1.0f,\\n 1.0f, 1.0f,\\n 1.0f, 0.0f\\n };\\n // Initialize the buffers.\\n mCubeVertices = ByteBuffer.allocateDirect(mCubeVertexData.length * 4)\\n .order(ByteOrder.nativeOrder()).asFloatBuffer();\\n mCubeVertices.put(mCubeVertexData).position(0);\\n mCubeColours = ByteBuffer.allocateDirect(mCubeColourData.length * 4)\\n .order(ByteOrder.nativeOrder()).asFloatBuffer();\\n mCubeColours.put(mCubeColourData).position(0);\\n mCubeNormals = ByteBuffer.allocateDirect(mCubeNormalData.length * 4)\\n .order(ByteOrder.nativeOrder()).asFloatBuffer();\\n mCubeNormals.put(mCubeNormalData).position(0);\\n mCubeTextureCoordinates = ByteBuffer.allocateDirect(mCubeTextureCoordinateData.length * 4)\\n .order(ByteOrder.nativeOrder()).asFloatBuffer();\\n mCubeTextureCoordinates.put(mCubeTextureCoordinateData).position(0);\\n Matrix.setIdentityM(mModelMatrix, 0);\\n }\",\n \"private double solveQuadraticOutside(Location location) {\\n\\t\\tint iPlus = imposeBorder(location.i + 1, _iSize);\\r\\n\\t\\tint iMinus = imposeBorder(location.i - 1, _iSize);\\r\\n\\t\\tint jPlus = imposeBorder(location.j + 1, _iSize);\\r\\n\\t\\tint jMinus = imposeBorder(location.j - 1, _iSize);\\r\\n\\t\\t//\\r\\n\\t\\tdouble ux1 = _levelSet[iPlus][location.j];\\r\\n\\t\\tdouble ux2 = _levelSet[iMinus][location.j];\\r\\n\\t\\tdouble uy1 = _levelSet[location.i][jPlus];\\r\\n\\t\\tdouble uy2 = _levelSet[location.i][jMinus];\\r\\n\\t\\t//\\r\\n\\t\\tdouble ux = Math.min(ux1, ux2);\\r\\n\\t\\tdouble uy = Math.min(uy1, uy2);\\r\\n\\t\\t// TODO pre-compute\\r\\n\\t\\tdouble f = _dx / F;\\r\\n\\t\\t//\\r\\n\\t\\t// solve the quadratic equation\\r\\n\\t\\tdouble a = 2;\\r\\n\\t\\tdouble b = -2 * (ux + uy);\\r\\n\\t\\tdouble c = ScalarMath.square(ux) + ScalarMath.square(uy)\\r\\n\\t\\t\\t\\t- ScalarMath.square(f);\\r\\n\\t\\tdouble delta = ScalarMath.square(b) - 4 * a * c;\\r\\n\\t\\t// extraordinary solutions\\r\\n\\t\\tdouble u;\\r\\n\\t\\tif (Double.isInfinite(ux) | Double.isInfinite(uy) | delta < 0) {\\r\\n\\t\\t\\tif (Double.isInfinite(ux))\\r\\n\\t\\t\\t\\tu = uy;\\r\\n\\t\\t\\telse if (Double.isInfinite(uy))\\r\\n\\t\\t\\t\\tu = ux;\\r\\n\\t\\t\\telse\\r\\n\\t\\t\\t\\t// the case where (delta < 0), which produces a\\r\\n\\t\\t\\t\\t// imaginary root\\r\\n\\t\\t\\t\\tu = Math.min(ux, uy);\\r\\n\\t\\t\\treturn u + f;\\r\\n\\t\\t}\\r\\n\\t\\tdouble sol1 = (-b + Math.sqrt(delta)) / (2 * a);\\r\\n\\t\\tdouble sol2 = (-b - Math.sqrt(delta)) / (2 * a);\\r\\n\\t\\treturn Math.max(sol1, sol2);\\r\\n\\t}\",\n \"public final AstValidator.cube_clause_return cube_clause() throws RecognitionException {\\n AstValidator.cube_clause_return retval = new AstValidator.cube_clause_return();\\n retval.start = input.LT(1);\\n\\n\\n CommonTree root_0 = null;\\n\\n CommonTree _first_0 = null;\\n CommonTree _last = null;\\n\\n CommonTree CUBE119=null;\\n AstValidator.cube_item_return cube_item120 =null;\\n\\n\\n CommonTree CUBE119_tree=null;\\n\\n try {\\n // /home/hoang/DATA/WORKSPACE/trunk0408/src/org/apache/pig/parser/AstValidator.g:296:2: ( ^( CUBE cube_item ) )\\n // /home/hoang/DATA/WORKSPACE/trunk0408/src/org/apache/pig/parser/AstValidator.g:296:4: ^( CUBE cube_item )\\n {\\n root_0 = (CommonTree)adaptor.nil();\\n\\n\\n _last = (CommonTree)input.LT(1);\\n {\\n CommonTree _save_last_1 = _last;\\n CommonTree _first_1 = null;\\n CommonTree root_1 = (CommonTree)adaptor.nil();\\n _last = (CommonTree)input.LT(1);\\n CUBE119=(CommonTree)match(input,CUBE,FOLLOW_CUBE_in_cube_clause1282); if (state.failed) return retval;\\n if ( state.backtracking==0 ) {\\n CUBE119_tree = (CommonTree)adaptor.dupNode(CUBE119);\\n\\n\\n root_1 = (CommonTree)adaptor.becomeRoot(CUBE119_tree, root_1);\\n }\\n\\n\\n match(input, Token.DOWN, null); if (state.failed) return retval;\\n _last = (CommonTree)input.LT(1);\\n pushFollow(FOLLOW_cube_item_in_cube_clause1284);\\n cube_item120=cube_item();\\n\\n state._fsp--;\\n if (state.failed) return retval;\\n if ( state.backtracking==0 ) \\n adaptor.addChild(root_1, cube_item120.getTree());\\n\\n\\n match(input, Token.UP, null); if (state.failed) return retval;\\n adaptor.addChild(root_0, root_1);\\n _last = _save_last_1;\\n }\\n\\n\\n if ( state.backtracking==0 ) {\\n }\\n }\\n\\n if ( state.backtracking==0 ) {\\n\\n retval.tree = (CommonTree)adaptor.rulePostProcessing(root_0);\\n }\\n\\n }\\n\\n catch(RecognitionException re) {\\n throw re;\\n }\\n\\n finally {\\n \\t// do for sure before leaving\\n }\\n return retval;\\n }\",\n \"public Path setLevel1() {\\n\\t\\tint xVal = (LAND_X_COUNT/2);//5\\n\\t\\tint yVal = 0;\\n\\t\\t\\n\\t\\t//pixel width/height for grid coordinate\\n\\t\\tfloat xPx = (float) (PIXEL_WIDTH*(xVal));\\n\\t\\tfloat yPx = (float) (PIXEL_HEIGHT*(yVal));\\n\\t\\t\\n\\t\\tsPath.moveTo(xPx, yPx); //LANDWIDTH MIDDLE X\\n\\t\\tPosition prevPos = new Position(xVal,yVal);\\n\\t\\tPosition newPos;// = new Position(5,2);\\n\\n\\t\\tLevelOne one = new LevelOne(); //level one contains more information, just path details\\n\\t\\t\\n\\t\\tsetPathLine(prevPos,prevPos); //first point\\n\\n\\t\\tfor (Position pos : one.getLevelPositions())\\n\\t\\t{\\n\\t\\t\\tnewPos = pos;\\n\\t\\t\\tsetPathLine(prevPos,newPos);\\n\\t\\t\\tprevPos = newPos;\\n\\t\\t}\\n\\t\\n\\t\\tnewPos = new Position(LAND_X_COUNT/2,LAND_Y_COUNT-1); //middle of the bottom of the screen\\n\\t\\tsetPathLine(prevPos,newPos);\\n\\t\\tendPosition = newPos; //store end position\\n\\t\\tnewPos = new Position(LAND_X_COUNT/2,LAND_Y_COUNT);\\n\\t\\tsPath.lineTo((float) (PIXEL_WIDTH*newPos.getX()), (float) (PIXEL_HEIGHT*newPos.getY()));//END POINT\\n\\t\\treturn sPath;\\t\\n\\t}\",\n \"protected void mapToSimulationCube() {\\n\\t\\t/* Map the system into the simulation cube, by scaling, translation, and\\n\\t\\t by applying the periodic boundary conditions */\\n\\t\\tdouble xo,yo,zo;\\n\\t\\tVectorD3 mapBox;\\n\\t\\t/* Loop over lattices: */\\n\\t\\tfor ( int ilatt = 0; ilatt < 2; ilatt++ ) {\\n\\t\\t\\t/* Loop over spheres: */\\n\\t\\t\\tfor ( int in = 0; in < n; in++ ) {\\n\\t\\t\\t\\tif( ilatt == 0 || (in < phaseIndex())) {\\n\\t\\t\\t\\t\\tmapBox = boxes[ilatt];\\n\\t\\t\\t\\t} else {\\n\\t\\t\\t\\t\\tmapBox = boxT;\\n\\t\\t\\t\\t}\\n\\t\\t\\t\\t/* Copy vector from lattice array */\\n\\t\\t\\t\\txo = latt[ilatt][in].x;\\n\\t\\t\\t\\tyo = latt[ilatt][in].y;\\n\\t\\t\\t\\tzo = latt[ilatt][in].z;\\n\\t\\t\\t\\t\\n\\t\\t\\t\\t/*Scale and translate: */\\n\\t\\t\\t\\txo = ( xo/mapBox.x ) - 0.5;\\n\\t\\t\\t\\tyo = ( yo/mapBox.y ) - 0.5;\\n\\t\\t\\t\\tzo = ( zo/mapBox.z ) - 0.5;\\n\\t\\t\\t\\t\\n\\t\\t\\t\\t/*Apply periodic boundary conditions: */\\n\\t\\t\\t\\txo = xo - ( (int) ( xo+xo ) );\\n\\t\\t\\t\\tyo = yo - ( (int) ( yo+yo ) );\\n\\t\\t\\t\\tzo = zo - ( (int) ( zo+zo ) );\\n\\t\\t\\t\\t\\n\\t\\t\\t\\t/* Copy modified vector back into the lattice array */\\n\\t\\t\\t\\tlatt[ilatt][in].x = xo;\\n\\t\\t\\t\\tlatt[ilatt][in].y = yo;\\n\\t\\t\\t\\tlatt[ilatt][in].z = zo;\\n\\t\\t\\t\\t\\n\\t\\t\\t}\\n\\t\\t}\\t\\t\\n\\t}\",\n \"public RubiksCube(){\\n\\t\\tString[] c = {\\n\\t\\t\\t\\t\\\"W\\\",\\\"W\\\",\\\"W\\\",\\\"W\\\",\\\"W\\\",\\\"W\\\",\\\"W\\\",\\\"W\\\",\\\"W\\\",\\n\\t\\t\\t\\t\\\"R\\\",\\\"R\\\",\\\"R\\\",\\\"R\\\",\\\"R\\\",\\\"R\\\",\\\"R\\\",\\\"R\\\",\\\"R\\\",\\n\\t\\t\\t\\t\\\"B\\\",\\\"B\\\",\\\"B\\\",\\\"B\\\",\\\"B\\\",\\\"B\\\",\\\"B\\\",\\\"B\\\",\\\"B\\\",\\n\\t\\t\\t\\t\\\"G\\\",\\\"G\\\",\\\"G\\\",\\\"G\\\",\\\"G\\\",\\\"G\\\",\\\"G\\\",\\\"G\\\",\\\"G\\\",\\n\\t\\t\\t\\t\\\"O\\\",\\\"O\\\",\\\"O\\\",\\\"O\\\",\\\"O\\\",\\\"O\\\",\\\"O\\\",\\\"O\\\",\\\"O\\\",\\n\\t\\t\\t\\t\\\"Y\\\",\\\"Y\\\",\\\"Y\\\",\\\"Y\\\",\\\"Y\\\",\\\"Y\\\",\\\"Y\\\",\\\"Y\\\",\\\"Y\\\",\\n\\t\\t};\\n\\t\\tthis.cube = c;\\n\\t}\",\n \"private void setGeometryData() {\\n // allocate vertices\\n final int factorK = (innerRadius == 0 ? 1 : 2);\\n final int verts = factorK * ((zSamples - 2) * (radialSamples) + 2); // rs + 1\\n setVertexCoordsSize (verts);\\n setNormalCoordsSize (verts);\\n\\n // generate geometry\\n final double fInvRS = 1.0 / (radialSamples);\\n final double fZFactor = 1.0 / (zSamples - 1); // 2.0 / (zSamples - 1);\\n\\n // Generate points on the unit circle to be used in computing the mesh\\n // points on a sphere slice.\\n final double[] afSin = new double[(radialSamples + 1)];\\n final double[] afCos = new double[(radialSamples + 1)];\\n for ( int iR = 0; iR < radialSamples; iR++ ) {\\n final double fAngle = phi0 + dPhi * fInvRS * iR;\\n afCos[iR] = Math.cos (fAngle);\\n afSin[iR] = Math.sin (fAngle);\\n }\\n // afSin[radialSamples] = afSin[0];\\n // afCos[radialSamples] = afCos[0];\\n\\n double radDiff = Math.abs (outerRadius - innerRadius);\\n\\n for ( int icnt = 0; icnt < 2; icnt++ ) {\\n radius = (icnt == 0 ? innerRadius : outerRadius);\\n if ( radius == 0.0 ) {\\n continue;\\n }\\n double zNP = centerZ; // 0.0;\\n double zSP = centerZ; // 0.0;\\n\\n // generate the sphere itself\\n int i = 0;\\n Vector3D tempVa;\\n Vector3D kSliceCenter;\\n\\n for ( int iZ = 1; iZ < (zSamples - 1); iZ++ ) { // -1\\n //final double fAFraction = 0.5 * Math.PI * (-1.0f + fZFactor * iZ); // in (-pi/2, pi/2)\\n final double fAFraction = theta1 - iZ * fZFactor * dTheta;\\n final double fZFraction = Math.sin (fAFraction); // in (-1,1)\\n final double fZ = radius * fZFraction;\\n\\n // compute center of slice\\n kSliceCenter = new Vector3D (\\n center.getX (),\\n center.getY (),\\n center.getZ () + fZ\\n );\\n\\n // compute radius of slice\\n final double fSliceRadius = Math.sqrt (\\n Math.abs (\\n radius * radius - fZ * fZ\\n )\\n );\\n\\n // compute slice vertices with duplication at end point\\n Vector3D kNormal;\\n final int iSave = i;\\n for ( int iR = 0; iR < radialSamples; iR++ ) {\\n final double fRadialFraction = iR * fInvRS; // in [0,1)\\n final Vector3D kRadial = new Vector3D (\\n afCos[iR],\\n afSin[iR],\\n 0\\n );\\n tempVa = new Vector3D (\\n fSliceRadius * kRadial.getX (),\\n fSliceRadius * kRadial.getY (),\\n fSliceRadius * kRadial.getZ ()\\n );\\n\\n zNP = Math.\\n max (kSliceCenter.getZ (), zNP);\\n zSP = Math.\\n min (kSliceCenter.getZ (), zSP);\\n\\n putVertex (\\n (kSliceCenter.getX () + tempVa.getX ()),\\n (kSliceCenter.getY () + tempVa.getY ()),\\n (kSliceCenter.getZ () + tempVa.getZ ())\\n );\\n tempVa = getVertexCoord (i);\\n\\n kNormal = new Vector3D (\\n tempVa.getX () - center.getX (),\\n tempVa.getY () - center.getY (),\\n tempVa.getZ () - center.getZ ()\\n );\\n double mag = Math.sqrt (\\n Math.pow (kNormal.getX (), 2) +\\n Math.pow (kNormal.getY (), 2) +\\n Math.pow (kNormal.getZ (), 2)\\n );\\n kNormal = new Vector3D (\\n kNormal.getX () / mag,\\n kNormal.getY () / mag,\\n kNormal.getZ () / mag\\n );\\n if ( !viewInside ) {\\n putNormal (\\n kNormal.getX (),\\n kNormal.getY (),\\n kNormal.getZ ()\\n );\\n } else {\\n putNormal (\\n -kNormal.getX (),\\n -kNormal.getY (),\\n -kNormal.getZ ()\\n );\\n }\\n i++;\\n }\\n\\n// setVertexCoord(i, getVertexCoord(iSave));\\n// setNormalCoord(i, getNormalCoord(iSave));\\n putVertex (getVertexCoord (iSave));\\n putNormal (getNormalCoord (iSave));\\n i++;\\n }\\n\\n // south pole\\n if ( theta0 == -0.5 * Math.PI ) {\\n putVertex (new Vector3D (\\n center.getX (),\\n center.getY (),\\n (center.getZ () - radius)\\n ));\\n setVertexCount (i + 1);\\n if ( !viewInside ) {\\n putNormal (new Vector3D (0, 0, -1));\\n } else {\\n putNormal (new Vector3D (0, 0, 1));\\n }\\n setNormalCount (i + 1);\\n i++;\\n }\\n\\n // north pole\\n if ( theta1 == 0.5 * Math.PI ) {\\n putVertex (new Vector3D (\\n center.getX (),\\n center.getY (),\\n center.getZ () + radius\\n ));\\n setVertexCount (i + 1);\\n if ( !viewInside ) {\\n putNormal (new Vector3D (0, 0, 1));\\n } else {\\n putNormal (new Vector3D (0, 0, -1));\\n }\\n setNormalCount (i + 1);\\n i++;\\n }\\n }\\n\\n }\",\n \"private void generateSphere() {\\n\\t\\tint segments = 14;\\n\\t\\tint rings = 15; // Use an odd number of rings of faces so that halfway up the sphere is the middle of a ring and not a loop of edges\\n\\t\\tverts = new Vector[segments * (rings - 1) + 2]; // There are rings + 1 rings of vertices, but the first and last of these are each a single vertex\\n\\t\\tfaces = new int[2 * segments * (rings - 1)][3]; // Apart from the first and last, each ring has segments number of square faces, so 2 * segments triangular faces. The first and last each have segments triangular faces\\n\\t\\tverts[0] = new Vector(3);\\n\\t\\tverts[0].setElement(1, -1); // The lowest point of the sphere\\n\\t\\tfor (int i = 0; i < segments; i++) {\\n\\t\\t\\tif (i == segments - 1) {\\n\\t\\t\\t\\tfaces[i] = new int[] {0, i + 1, 1}; // The last face involves the last vertex in the second ring and loops back to the first vertex in the second ring\\n\\t\\t\\t} else {\\n\\t\\t\\t\\tfaces[i] = new int[] {0, i + 1, i + 2}; // Triangles involving the lowest vertex and two consecutive vertices in the second ring of vertices\\n\\t\\t\\t}\\n\\t\\t}\\n\\t\\tdouble pitchIncrement = Math.PI / rings; // The increment in pitch (angle above horizontal) between rings of vertices\\n\\t\\tdouble pitch = pitchIncrement - Math.PI / 2; // The lowest point had a pitch of -pi/2\\n\\t\\tdouble headingIncrement = Math.PI * 2.0 / segments; // The increment in heading between segments\\n\\t\\tdouble heading = -Math.PI;\\n\\t\\tfor (int r = 0; r < rings - 1; r++) { // Last ring is a single point and must be treated separately\\n\\t\\t\\tdouble y = Math.sin(pitch); // The y co-ordinate for each vertex in this ring\\n\\t\\t\\tdouble modulus = Math.cos(pitch); // The radius of the circle which this ring lies on\\n\\t\\t\\tfor (int s = 0; s < segments; s++) {\\n\\t\\t\\t\\tdouble x = modulus * Math.cos(heading); // x co-ordinate for the next vertex\\n\\t\\t\\t\\tdouble z = modulus * Math.sin(heading); // z co-ordinate for the next vertex\\n\\t\\t\\t\\tverts[segments * r + s + 1] = new Vector(3);\\n\\t\\t\\t\\tverts[segments * r + s + 1].setElements(new double[] {x, y, z});\\n\\t\\t\\t\\theading += headingIncrement;\\n\\t\\t\\t}\\n\\t\\t\\t// Make faces between the vertices just added and the next ring of vertices to be added\\n\\t\\t\\tif (r != rings - 2) { // The second to last ring doesn't make faces with the next ring up in the same way because the last ring is a single vertex\\n\\t\\t\\t\\tfor (int i = 0; i < segments; i++) {\\n\\t\\t\\t\\t\\tif (i == segments - 1) { // The last two faces make use of the first vertex in the next ring by looping back to the start\\n\\t\\t\\t\\t\\t\\t// Two faces in the same plane\\n\\t\\t\\t\\t\\t\\tfaces[i * 2 + segments * (2 * r + 1)] = new int[] {segments * r + i + 1, (segments * r + i + 1) + segments, segments * r + 1 + segments};\\n\\t\\t\\t\\t\\t\\tfaces[i * 2 + segments * (2 * r + 1) + 1] = new int[] {segments * r + i + 1, segments * r + 1 + segments, segments * r + 1};\\n\\t\\t\\t\\t\\t} else {\\n\\t\\t\\t\\t\\t\\t// Two faces that are in the same plane and appear as a quadrilateral\\n\\t\\t\\t\\t\\t\\tfaces[i * 2 + segments * (2 * r + 1)] = new int[] {segments * r + i + 1, (segments * r + i + 1) + segments, (segments * r + i + 1) + segments + 1};\\n\\t\\t\\t\\t\\t\\tfaces[i * 2 + segments * (2 * r + 1) + 1] = new int[] {segments * r + i + 1, (segments * r + i + 1) + segments + 1, (segments * r + i + 1) + 1};\\n\\t\\t\\t\\t\\t}\\n\\t\\t\\t\\t}\\n\\t\\t\\t}\\n\\t\\t\\tpitch += pitchIncrement;\\n\\t\\t}\\n\\t\\tverts[verts.length - 1] = new Vector(3);\\n\\t\\tverts[verts.length - 1].setElement(1, 1); // The last and highest vertex\\n\\t\\tfor (int i = 0; i < segments; i++) {\\n\\t\\t\\tif (i == segments - 1) { // Last face completes the ring and includes the last vertex of the second to last ring\\n\\t\\t\\t\\tfaces[2 * segments + segments * (2 * rings - 5) + i] = new int[] {segments * (rings - 2) + 1 + i, segments * (rings - 1) + 1, segments * (rings - 2) + 1};\\n\\t\\t\\t} else { // Faces involving the last vertex and two consecutive vertices in the second to last ring\\n\\t\\t\\t\\tfaces[2 * segments + segments * (2 * rings - 5) + i] = new int[] {segments * (rings - 2) + 1 + i, segments * (rings - 1) + 1, segments * (rings - 2) + 1 + i + 1};\\n\\t\\t\\t}\\n\\t\\t}\\n\\t}\",\n \"public int getSquareLocation()\\n\\t\\t{\\n\\t\\t\\treturn location; // return location of square\\n\\t\\t}\",\n \"protected void calculatePathfindingGrid(Tile[] tiles) {\\n \\n if(tiles == null) {\\n return;\\n }\\n \\n /**\\n * Problem:\\n * Because the tile size used by the path finding engine will most likely be\\n * different from that of the visual effect size, we have to\\n * look at all the visual tiles and judge whether they are blocking of\\n * particular kinds of unit.\\n * \\n * Algorithm:\\n * For land, air and sea take a look at the number of blocking/non-blocking\\n * tiles there are and if there is over 50% either way then that will be the\\n * PathTiles result.\\n */\\n \\n // First get the size of the map in PathTile(s)\\n int rows = getActualHeightInTiles();\\n int cols = getActualWidthInTiles();\\n \\n // Calculate the number of tiles to a PathTile\\n int tilesPerActualTilesX = getActualTileWidth() / getTileWidth();\\n int tilesPerActualTilesY = getActualTileHeight() / getTileHeight();\\n int tileCount = tilesPerActualTilesX * tilesPerActualTilesY;\\n \\n int tileCols = getWidthInTiles();\\n \\n // Create an array\\n mPathTiles = new PathTile[ rows * cols ];\\n \\n // Iterate through these tiles\\n for(int x = 0; x < cols ; x++) {\\n for(int y = 0; y < rows; y++) {\\n \\n // Setup some variables\\n int blockSea, blockAir, blockLand;\\n blockAir = blockLand = blockSea = 0;\\n \\n // Figure out the percentage of each block\\n for(int tx = 0; tx < tilesPerActualTilesX; tx++) {\\n for(int ty = 0; ty < tilesPerActualTilesY; ty++) {\\n \\n int tileX = (x * tilesPerActualTilesX) + tx;\\n int tileY = (y * tilesPerActualTilesY) + ty;\\n \\n Tile thisTile = tiles[ (tileY * tileCols) + tileX ];\\n \\n if(thisTile.blockAir()) {\\n blockAir++;\\n }\\n \\n if(thisTile.blockLand()) {\\n blockLand++;\\n }\\n \\n if(thisTile.blockSea()) {\\n blockSea++;\\n }\\n \\n }\\n }\\n \\n // Calculate percentage\\n float a,b,c;\\n a = (float)blockAir / (float)tileCount;\\n b = (float)blockLand / (float)tileCount;\\n c = (float)blockSea / (float)tileCount;\\n \\n // Set the new tile\\n mPathTiles[ (y * cols) + x ] = new PathTile( (a >= .5f), (b >= .5f), (c >= .5f) );\\n \\n // System.out.println(\\\"Grid \\\" + ((y * cols) + x) + \\\" (\\\" + x + \\\", \\\" + y + \\\") Air: \\\" + a + \\\" Land: \\\" + b + \\\" Sea: \\\" + c);\\n \\n }\\n }\\n \\n }\",\n \"public GridLocation getLocation();\",\n \"private DPoint m2833m() {\\r\\n IPoint iPoint = new IPoint();\\r\\n this.f1769m.mo353a(this.f1761e.latitude, this.f1761e.longitude, iPoint);\\r\\n IPoint iPoint2 = new IPoint();\\r\\n this.f1769m.mo353a(this.f1762f.latitude, this.f1762f.longitude, iPoint2);\\r\\n IPoint iPoint3 = new IPoint();\\r\\n this.f1769m.mo353a(this.f1763g.latitude, this.f1763g.longitude, iPoint3);\\r\\n double d = (double) iPoint.f3639x;\\r\\n double d2 = (double) iPoint.f3640y;\\r\\n double d3 = (double) iPoint2.f3639x;\\r\\n double d4 = (double) iPoint2.f3640y;\\r\\n double d5 = (double) iPoint3.f3639x;\\r\\n double d6 = (double) iPoint3.f3640y;\\r\\n double d7 = (((d6 - d2) * ((((d4 * d4) - (d2 * d2)) + (d3 * d3)) - (d * d))) + ((d4 - d2) * ((((d2 * d2) - (d6 * d6)) + (d * d)) - (d5 * d5)))) / (((2.0d * (d3 - d)) * (d6 - d2)) - ((2.0d * (d5 - d)) * (d4 - d2)));\\r\\n double d8 = (((d5 - d) * ((((d3 * d3) - (d * d)) + (d4 * d4)) - (d2 * d2))) + ((d3 - d) * ((((d * d) - (d5 * d5)) + (d2 * d2)) - (d6 * d6)))) / (((2.0d * (d4 - d2)) * (d5 - d)) - ((2.0d * (d6 - d2)) * (d3 - d)));\\r\\n this.f1773q = Math.sqrt(((d - d7) * (d - d7)) + ((d2 - d8) * (d2 - d8)));\\r\\n this.f1774r = m2830a(d7, d8, d, d2);\\r\\n d = m2830a(d7, d8, d3, d4);\\r\\n this.f1775s = m2830a(d7, d8, d5, d6);\\r\\n if (this.f1774r < this.f1775s) {\\r\\n if (d <= this.f1774r || d >= this.f1775s) {\\r\\n this.f1775s -= 6.283185307179586d;\\r\\n }\\r\\n } else if (d <= this.f1775s || d >= this.f1774r) {\\r\\n this.f1775s += 6.283185307179586d;\\r\\n }\\r\\n return new DPoint(d7, d8);\\r\\n }\",\n \"@Override\\n public String toString() {\\n String msg;\\n int i;\\n double mm[];\\n\\n mm = getMinMax();\\n Vector3D p;\\n\\n msg = \\\"- QuadMesh ------------------------------------------------------------\\\\n\\\";\\n msg += \\\" - Number of quads:\\\" + getNumQuads() + \\\"\\\\n\\\";\\n msg += \\\" - Number of vertexes:\\\" + getNumVertices() + \\\"\\\\n\\\";\\n p = new Vector3D(mm[0], mm[1], mm[2]);\\n msg += \\\" - MINMAX: \\\" + p;\\n p = new Vector3D(mm[3], mm[4], mm[5]);\\n msg += \\\" - \\\" + p + \\\"\\\\n\\\";\\n msg += \\\"---------------------------------------------------------------------------\\\\n\\\";\\n return msg;\\n }\",\n \"public PVector cohesion (ArrayList boids) {\\n float neighbordist = 90.0f;\\n PVector steer = new PVector(0,0); // Start with empty vector to accumulate all locations\\n int count = 0;\\n for (Boid other : boids) {\\n float d = PVector.dist(location,other.location);\\n if ((d > 0) && (d < neighbordist)) {\\n steer.add(other.location); // Add location\\n count++;\\n }\\n }\\n if (count > 0) {\\n steer.div((float)count);\\n return seek(steer); // Steer towards the location\\n }\\n return steer;\\n }\",\n \"public interface Path {\\n\\tVector2D [] getPointsAsArray();\\n\\n\\tList getPointsAsList();\\n}\",\n \"public ViewerCube getCube() {\\n return cube;\\n }\",\n \"@Override\\n\\tpublic String toString() {\\n\\t\\treturn \\\"Cube(\\\" + this.nom + \\\")@(\\\" + this.centre.getX() + \\\", \\\" + this.centre.getY() + \\\", \\\" + this.centre.getZ() + \\\") ar�te : \\\"+this.arete;\\n\\t}\",\n \"void setupGrid() {\\n\\n // create a Switch for the spheres, allow switch changes\\n gridSwitch = new Switch(Switch.CHILD_NONE);\\n gridSwitch.setCapability(Switch.ALLOW_SWITCH_WRITE);\\n\\n // Set up an appearance to make the square3s with red ambient,\\n // black emmissive, red diffuse and black specular coloring\\n Material material = new Material(red, black, red, black, 64);\\n Appearance appearance = new Appearance();\\n appearance.setMaterial(material);\\n\\n // create a grid of quads\\n int gridSize = 20; // grid is gridSize quads along each side\\n int numQuads = gridSize * gridSize;\\n int numVerts = numQuads * 4; // 4 verts per quad\\n // there will be 3 floats per coord and 4 coords per quad\\n float[] coords = new float[3 * numVerts];\\n // All the quads will use the same normal at each vertex, so\\n // allocate an array to hold references to the same normal\\n Vector3f[] normals = new Vector3f[numVerts];\\n Vector3f vertNormal = new Vector3f(0.0f, 0.0f, 1.0f);\\n float edgeLength = 5.0f; // length of each edge of the grid\\n float gridGap = 0.03f; // the gap between each quad\\n // length of each quad is (total length - sum of the gaps) / gridSize\\n float quadLength = (edgeLength - gridGap * (gridSize - 1)) / gridSize;\\n\\n // create a grid of quads in the z=0 plane\\n // each has a TransformGroup to position the sphere which contains\\n // a link to the shared group for the sphere\\n float curX, curY;\\n for (int y = 0; y < gridSize; y++) {\\n curY = y * (quadLength + gridGap); // offset to lower left corner\\n curY -= edgeLength / 2; // center on 0,0\\n for (int x = 0; x < gridSize; x++) {\\n // this is the offset into the vertex array for the first\\n // vertex of the quad\\n int vertexOffset = (y * gridSize + x) * 4;\\n // this is the offset into the coord array for the first\\n // vertex of the quad, where there are 3 floats per vertex\\n int coordOffset = vertexOffset * 3;\\n curX = x * (quadLength + gridGap); // offset to ll corner\\n curX -= edgeLength / 2; // center on 0,0\\n // lower left corner\\n coords[coordOffset + 0] = curX;\\n coords[coordOffset + 1] = curY;\\n coords[coordOffset + 2] = 0.0f; // z\\n // lower right corner\\n coords[coordOffset + 3] = curX + quadLength;\\n coords[coordOffset + 4] = curY;\\n coords[coordOffset + 5] = 0.0f; // z\\n // upper right corner\\n coords[coordOffset + 6] = curX + quadLength;\\n coords[coordOffset + 7] = curY + quadLength;\\n coords[coordOffset + 8] = 0.0f; // z\\n // upper left corner\\n coords[coordOffset + 9] = curX;\\n coords[coordOffset + 10] = curY + quadLength;\\n coords[coordOffset + 11] = 0.0f; // z\\n for (int i = 0; i < 4; i++) {\\n normals[vertexOffset + i] = vertNormal;\\n }\\n }\\n }\\n // now that we have the data, create the QuadArray\\n QuadArray quads = new QuadArray(numVerts, QuadArray.COORDINATES\\n | QuadArray.NORMALS);\\n quads.setCoordinates(0, coords);\\n quads.setNormals(0, normals);\\n\\n // create the shape\\n Shape3D shape = new Shape3D(quads, appearance);\\n\\n // add it to the switch\\n gridSwitch.addChild(shape);\\n }\",\n \"private void setCofR() {\\n\\t\\t\\n Vector3f pos_vec = new Vector3f();\\n Point3f pos = new Point3f();\\n Vector3f dir = new Vector3f();\\n\\t\\tMatrix4f view_mtx = new Matrix4f();\\n\\t\\tMatrix4f nav_mtx = new Matrix4f();\\n Point3f cor = new Point3f();\\n\\t\\t\\n\\t\\tnavigationTransform.getTransform(nav_mtx);\\n\\t\\t\\n\\t\\tdata.viewpointTransform.getTransform(view_mtx);\\n\\t\\tview_mtx.get(pos_vec);\\n\\t\\t\\n\\t\\t// the eye point\\n\\t\\tpos.set(pos_vec);\\n\\t\\t\\n\\t\\t// the eye direction\\n\\t\\tdir.x = view_mtx.m02;\\n\\t\\tdir.y = view_mtx.m12;\\n\\t\\tdir.z = view_mtx.m22;\\n\\t\\tdir.negate();\\n\\t\\tdir.normalize();\\n\\t\\t\\n\\t\\t// transform into world space\\n\\t\\tnav_mtx.transform(pos);\\n\\t\\tnav_mtx.transform(dir);\\n\\t\\t\\n\\t\\tArrayList pickResults = new ArrayList();\\n\\t\\tPickRequest pickRequest = new PickRequest();\\n\\t\\tpickRequest.pickGeometryType = PickRequest.PICK_RAY;\\n\\t\\tpickRequest.pickSortType = PickRequest.SORT_ORDERED;\\n\\t\\tpickRequest.pickType = PickRequest.FIND_GENERAL;\\n\\t\\tpickRequest.useGeometry = false;\\n\\t\\tpickRequest.foundPaths = pickResults;\\n\\t\\t\\n\\t\\t// initialize the pick request\\n\\t\\tpickRequest.origin[0] = pos.x;\\n\\t\\tpickRequest.origin[1] = pos.y;\\n\\t\\tpickRequest.origin[2] = pos.z;\\n\\t\\t\\n\\t\\tpickRequest.destination[0] = dir.x;\\n\\t\\tpickRequest.destination[1] = dir.y;\\n\\t\\tpickRequest.destination[2] = dir.z;\\n\\t\\t\\n\\t\\trootGroup.pickSingle(pickRequest);\\n\\t\\t\\n\\t\\tif (pickRequest.pickCount > 0) {\\n\\t\\t\\t\\n \\tPoint3f intersectPoint = new Point3f();\\n \\tVector3f intersectVector = new Vector3f();\\n\\t\\t\\n\\t\\t\\tfloat min_distance = Float.MAX_VALUE;\\n\\t\\t\\t// sort through the bounds intersections\\n\\t\\t\\tint num_pick = pickResults.size();\\n\\t\\t\\tfor (int i = 0; i < num_pick; i++) {\\n\\t\\t\\t\\t\\n\\t\\t\\t\\tSceneGraphPath sgp = (SceneGraphPath)pickResults.get(i);\\n\\t\\t\\t\\tsgp.getTransform(view_mtx);\\n\\t\\t\\t\\t\\n\\t\\t\\t\\tShape3D shape = (Shape3D)sgp.getTerminalNode();\\n\\t\\t\\t\\tVertexGeometry geom = (VertexGeometry)shape.getGeometry();\\n\\t\\t\\t\\t\\n\\t\\t\\t\\t//determine if there was an actual geometry intersection\\n\\t\\t\\t\\tboolean intersect = iutils.rayUnknownGeometry(\\n\\t\\t\\t\\t\\tpos,\\n\\t\\t\\t\\t\\tdir,\\n\\t\\t\\t\\t\\t0,\\n\\t\\t\\t\\t\\tgeom,\\n\\t\\t\\t\\t\\tview_mtx,\\n\\t\\t\\t\\t\\tintersectPoint,\\n\\t\\t\\t\\t\\tfalse);\\n\\t\\t\\t\\t\\n\\t\\t\\t\\tif (intersect) {\\n\\t\\t\\t\\t\\tintersectVector.set(\\n\\t\\t\\t\\t\\t\\tintersectPoint.x - pos.x,\\n\\t\\t\\t\\t\\t\\tintersectPoint.y - pos.y,\\n\\t\\t\\t\\t\\t\\tintersectPoint.z - pos.z);\\n\\n\\t\\t\\t\\t\\tfloat distance = intersectVector.length();\\n\\t\\t\\t\\t\\tif (distance < min_distance) {\\n\\t\\t\\t\\t\\t\\tmin_distance = distance;\\n\\t\\t\\t\\t\\t\\tcor.set(intersectPoint);\\n\\t\\t\\t\\t\\t}\\n\\t\\t\\t\\t}\\n\\t\\t\\t} \\n\\t\\t\\tnav_mtx.invert();\\n\\t\\t\\tnav_mtx.transform(cor);\\n\\t\\t}\\n\\t\\tcenterOfRotation.set(cor);\\n\\t}\",\n \"@Override\\n public String toString() {\\n return this.area + \\\"/\\\" + this.aisle + \\\"/\\\" + this.x + \\\"/\\\" + this.y + \\\"/\\\" + this.z;\\n }\",\n \"public CubeGL2() {\\n // Define points for a cube.\\n // X, Y, Z\\n mCubeVertexData = new float[]\\n {\\n // Front face\\n -1.0f, 1.0f, 1.0f,\\n -1.0f, -1.0f, 1.0f,\\n 1.0f, 1.0f, 1.0f,\\n -1.0f, -1.0f, 1.0f,\\n 1.0f, -1.0f, 1.0f,\\n 1.0f, 1.0f, 1.0f,\\n // Right face\\n 1.0f, 1.0f, 1.0f,\\n 1.0f, -1.0f, 1.0f,\\n 1.0f, 1.0f, -1.0f,\\n 1.0f, -1.0f, 1.0f,\\n 1.0f, -1.0f, -1.0f,\\n 1.0f, 1.0f, -1.0f,\\n // Back face\\n 1.0f, 1.0f, -1.0f,\\n 1.0f, -1.0f, -1.0f,\\n -1.0f, 1.0f, -1.0f,\\n 1.0f, -1.0f, -1.0f,\\n -1.0f, -1.0f, -1.0f,\\n -1.0f, 1.0f, -1.0f,\\n // Left face\\n -1.0f, 1.0f, -1.0f,\\n -1.0f, -1.0f, -1.0f,\\n -1.0f, 1.0f, 1.0f,\\n -1.0f, -1.0f, -1.0f,\\n -1.0f, -1.0f, 1.0f,\\n -1.0f, 1.0f, 1.0f,\\n // Top face\\n -1.0f, 1.0f, -1.0f,\\n -1.0f, 1.0f, 1.0f,\\n 1.0f, 1.0f, -1.0f,\\n -1.0f, 1.0f, 1.0f,\\n 1.0f, 1.0f, 1.0f,\\n 1.0f, 1.0f, -1.0f,\\n // Bottom face\\n 1.0f, -1.0f, -1.0f,\\n 1.0f, -1.0f, 1.0f,\\n -1.0f, -1.0f, -1.0f,\\n 1.0f, -1.0f, 1.0f,\\n -1.0f, -1.0f, 1.0f,\\n -1.0f, -1.0f, -1.0f,\\n };\\n // R, G, B, A\\n mCubeColourData = new float[]\\n {\\n // Front face\\n 1.0f, 0.0f, 0.0f, 1.0f,\\n 1.0f, 0.0f, 0.0f, 1.0f,\\n 1.0f, 0.0f, 0.0f, 1.0f,\\n 1.0f, 0.0f, 0.0f, 1.0f,\\n 1.0f, 0.0f, 0.0f, 1.0f,\\n 1.0f, 0.0f, 0.0f, 1.0f,\\n // Right face\\n 0.0f, 1.0f, 0.0f, 1.0f,\\n 0.0f, 1.0f, 0.0f, 1.0f,\\n 0.0f, 1.0f, 0.0f, 1.0f,\\n 0.0f, 1.0f, 0.0f, 1.0f,\\n 0.0f, 1.0f, 0.0f, 1.0f,\\n 0.0f, 1.0f, 0.0f, 1.0f,\\n // Back face\\n 0.0f, 0.0f, 1.0f, 1.0f,\\n 0.0f, 0.0f, 1.0f, 1.0f,\\n 0.0f, 0.0f, 1.0f, 1.0f,\\n 0.0f, 0.0f, 1.0f, 1.0f,\\n 0.0f, 0.0f, 1.0f, 1.0f,\\n 0.0f, 0.0f, 1.0f, 1.0f,\\n // Left face\\n 1.0f, 1.0f, 0.0f, 1.0f,\\n 1.0f, 1.0f, 0.0f, 1.0f,\\n 1.0f, 1.0f, 0.0f, 1.0f,\\n 1.0f, 1.0f, 0.0f, 1.0f,\\n 1.0f, 1.0f, 0.0f, 1.0f,\\n 1.0f, 1.0f, 0.0f, 1.0f,\\n // Top face\\n 0.0f, 1.0f, 1.0f, 1.0f,\\n 0.0f, 1.0f, 1.0f, 1.0f,\\n 0.0f, 1.0f, 1.0f, 1.0f,\\n 0.0f, 1.0f, 1.0f, 1.0f,\\n 0.0f, 1.0f, 1.0f, 1.0f,\\n 0.0f, 1.0f, 1.0f, 1.0f,\\n // Bottom face\\n 1.0f, 0.0f, 1.0f, 1.0f,\\n 1.0f, 0.0f, 1.0f, 1.0f,\\n 1.0f, 0.0f, 1.0f, 1.0f,\\n 1.0f, 0.0f, 1.0f, 1.0f,\\n 1.0f, 0.0f, 1.0f, 1.0f,\\n 1.0f, 0.0f, 1.0f, 1.0f\\n };\\n // X, Y, Z\\n mCubeNormalData = new float[]\\n {\\n // Front face\\n 0.0f, 0.0f, 1.0f,\\n 0.0f, 0.0f, 1.0f,\\n 0.0f, 0.0f, 1.0f,\\n 0.0f, 0.0f, 1.0f,\\n 0.0f, 0.0f, 1.0f,\\n 0.0f, 0.0f, 1.0f,\\n // Right face\\n 1.0f, 0.0f, 0.0f,\\n 1.0f, 0.0f, 0.0f,\\n 1.0f, 0.0f, 0.0f,\\n 1.0f, 0.0f, 0.0f,\\n 1.0f, 0.0f, 0.0f,\\n 1.0f, 0.0f, 0.0f,\\n // Back face\\n 0.0f, 0.0f, -1.0f,\\n 0.0f, 0.0f, -1.0f,\\n 0.0f, 0.0f, -1.0f,\\n 0.0f, 0.0f, -1.0f,\\n 0.0f, 0.0f, -1.0f,\\n 0.0f, 0.0f, -1.0f,\\n // Left face\\n -1.0f, 0.0f, 0.0f,\\n -1.0f, 0.0f, 0.0f,\\n -1.0f, 0.0f, 0.0f,\\n -1.0f, 0.0f, 0.0f,\\n -1.0f, 0.0f, 0.0f,\\n -1.0f, 0.0f, 0.0f,\\n // Top face\\n 0.0f, 1.0f, 0.0f,\\n 0.0f, 1.0f, 0.0f,\\n 0.0f, 1.0f, 0.0f,\\n 0.0f, 1.0f, 0.0f,\\n 0.0f, 1.0f, 0.0f,\\n 0.0f, 1.0f, 0.0f,\\n // Bottom face\\n 0.0f, -1.0f, 0.0f,\\n 0.0f, -1.0f, 0.0f,\\n 0.0f, -1.0f, 0.0f,\\n 0.0f, -1.0f, 0.0f,\\n 0.0f, -1.0f, 0.0f,\\n 0.0f, -1.0f, 0.0f\\n };\\n // X, Y\\n // Texture coordinate data.\\n mCubeTextureCoordinateData = new float[]\\n {\\n // Front face\\n 0.0f, 0.0f,\\n 0.0f, 1.0f,\\n 1.0f, 0.0f,\\n 0.0f, 1.0f,\\n 1.0f, 1.0f,\\n 1.0f, 0.0f,\\n // Right face\\n 0.0f, 0.0f,\\n 0.0f, 1.0f,\\n 1.0f, 0.0f,\\n 0.0f, 1.0f,\\n 1.0f, 1.0f,\\n 1.0f, 0.0f,\\n // Back face\\n 0.0f, 0.0f,\\n 0.0f, 1.0f,\\n 1.0f, 0.0f,\\n 0.0f, 1.0f,\\n 1.0f, 1.0f,\\n 1.0f, 0.0f,\\n // Left face\\n 0.0f, 0.0f,\\n 0.0f, 1.0f,\\n 1.0f, 0.0f,\\n 0.0f, 1.0f,\\n 1.0f, 1.0f,\\n 1.0f, 0.0f,\\n // Top face\\n 0.0f, 0.0f,\\n 0.0f, 1.0f,\\n 1.0f, 0.0f,\\n 0.0f, 1.0f,\\n 1.0f, 1.0f,\\n 1.0f, 0.0f,\\n // Bottom face\\n 0.0f, 0.0f,\\n 0.0f, 1.0f,\\n 1.0f, 0.0f,\\n 0.0f, 1.0f,\\n 1.0f, 1.0f,\\n 1.0f, 0.0f\\n };\\n // Initialize the buffers.\\n mCubeVertices = ByteBuffer.allocateDirect(mCubeVertexData.length * 4)\\n .order(ByteOrder.nativeOrder()).asFloatBuffer();\\n mCubeVertices.put(mCubeVertexData).position(0);\\n mCubeColours = ByteBuffer.allocateDirect(mCubeColourData.length * 4)\\n .order(ByteOrder.nativeOrder()).asFloatBuffer();\\n mCubeColours.put(mCubeColourData).position(0);\\n mCubeNormals = ByteBuffer.allocateDirect(mCubeNormalData.length * 4)\\n .order(ByteOrder.nativeOrder()).asFloatBuffer();\\n mCubeNormals.put(mCubeNormalData).position(0);\\n mCubeTextureCoordinates = ByteBuffer.allocateDirect(mCubeTextureCoordinateData.length * 4)\\n .order(ByteOrder.nativeOrder()).asFloatBuffer();\\n mCubeTextureCoordinates.put(mCubeTextureCoordinateData).position(0);\\n Matrix.setIdentityM(mModelMatrix, 0);\\n }\",\n \"@GetMapping(\\\"ElementWebService/getAllCoords\\\")\\n\\tpublic String getAllHQCoords() {\\n\\t\\tList elementList = elementService.getAll();\\n\\t\\tList coordList = new ArrayList();\\n\\t\\tfor(Element element: elementList) {\\n\\t\\t\\tcoordList.add(element.getLocation());\\n\\t\\t}\\n\\t\\treturn Tools.toJsonString(coordList);\\n\\t}\",\n \"public MasonGeometry getGeometry() {return agentLocation;}\",\n \"CubeModel() {\\n r = 0;\\n c = 0;\\n s = 4;\\n grid = new boolean [4][4];\\n the_cube = new boolean[6];\\n moves = 0;\\n\\n }\",\n \"public Vector3f getInterpolatedPhysicsLocation(Vector3f location) {\\n if (location == null) {\\n location = new Vector3f();\\n }\\n rBody.getInterpolationWorldTransform(tempTrans);\\n return Converter.convert(tempTrans.origin, location);\\n }\",\n \"@Test\\n void contains() {\\n Cuboid cuboid1 = new Cuboid(4, 4, 4);\\n Point3D point1 = new Point3D(0,0,0);\\n assertEquals(true, cuboid1.contains(point1));\\n\\n Point3D point2 = new Point3D(0,0,2);\\n assertEquals(true, cuboid1.contains(point2));\\n\\n Point3D point3 = new Point3D(0,0,-2);\\n assertEquals(true, cuboid1.contains(point3));\\n\\n Point3D point4 = new Point3D(0,2,0);\\n assertEquals(true, cuboid1.contains(point4));\\n\\n Point3D point5 = new Point3D(0,-2,0);\\n assertEquals(true, cuboid1.contains(point5));\\n\\n Point3D point6 = new Point3D(2,0,0);\\n assertEquals(true, cuboid1.contains(point6));\\n\\n Point3D point7 = new Point3D(-2,0,0);\\n assertEquals(true, cuboid1.contains(point7));\\n\\n Point3D point8 = new Point3D(-2,-2,-2);\\n assertEquals(true, cuboid1.contains(point8));\\n\\n Point3D point9 = new Point3D(-2,-2,-3);\\n assertEquals(false, cuboid1.contains(point9));\\n\\n\\n //Arbitary orientation\\n Cuboid cuboid2 = new Cuboid(4, 5, 7, new Ray(new Point3D(-2,-2,-2), new Vector3D(1,1,1)));\\n Point3D point21 = new Point3D(-1,-1,-1);\\n assertEquals(true, cuboid2.contains(point21));\\n\\n Cuboid cuboid3 = new Cuboid(4, 5, 6, new Ray(new Point3D(-2,-2,-2), new Vector3D(1,1,1)));\\n Point3D point31 = new Point3D(0,0,0);\\n assertEquals(false, cuboid3.contains(point31));\\n\\n Cuboid cuboid4 = new Cuboid(4, 5, 6, new Ray(new Point3D(0,0,0), new Vector3D(1,1,1)));\\n Point3D point41 = new Point3D(2.5,2.5,2.5);\\n assertEquals(false, cuboid4.contains(point41));\\n\\n Cuboid cuboid5 = new Cuboid(4, 5, 6, new Ray(new Point3D(-2,-2,-2), new Vector3D(0,0,1)));\\n Point3D point51 = new Point3D(-2,-2,3.5);\\n assertEquals(false, cuboid5.contains(point51));\\n }\",\n \"public static void main(String[] args){\\n Mesh3D box = Mesh3D.box(10, 20, 60);\\n \\n Line3D lineX = box.getLineX();\\n Line3D lineY = box.getLineY();\\n Line3D lineZ = box.getLineZ();\\n lineX.show();\\n lineY.show();\\n lineZ.show();\\n box.translateXYZ(100, 0.0, 0.0); \\n box.show();\\n Line3D line = new Line3D(); \\n List intersects = new ArrayList();\\n \\n for(int p = 0; p < 100; p++){\\n double r = 600;\\n double theta = Math.toRadians(90.0);//Math.toRadians(Math.random()*180.0);\\n double phi = Math.toRadians(Math.random()*360.0-180.0);\\n line.set(0.0,0.0,0.0, \\n Math.sin(theta)*Math.cos(phi)*r,\\n Math.sin(theta)*Math.sin(phi)*r,\\n Math.cos(theta)*r\\n );\\n intersects.clear();\\n box.intersectionRay(line, intersects);\\n System.out.println(\\\"theta/phi = \\\" + Math.toDegrees(theta) + \\\" \\\"\\n + Math.toDegrees(phi) + \\\" intersects = \\\" + intersects.size());\\n \\n }\\n }\",\n \"private static void setQui(){\\n int mX, mY;\\n for (Integer integer : qList) {\\n mY = (int) (Math.floor(1.f * integer / Data.meshRNx));\\n mX = integer - Data.meshRNx * mY;\\n if (Data.densCells[mX][mY] > Data.gwCap[mX][mY] * .75) {\\n for (int j = 0; j < Data.densCells[mX][mY]; j++) {\\n Cell cell = (Cell) cells.get(Data.idCellsMesh[mX][mY][j]);\\n cell.vState = true;\\n cell.quiescent = Data.densCells[mX][mY] >= Data.gwCap[mX][mY];\\n }\\n }\\n }\\n }\",\n \"public float magnitude() {\\r\\n \\r\\n return (float)Math.sqrt(x*x + y*y + z*z);\\r\\n }\",\n \"public List getSquareGrid();\",\n \"public Position[] getPath() {\\n\\t\\treturn path;\\n\\t}\",\n \"public double[] getSolutionsInRadius(){\\n\\t\\t\\n\\t\\t\\n\\t}\",\n \"@Override\\n\\tpublic double getZLoc() {\\n\\t\\tdouble side = Math.sqrt(getMySize())/2;\\n\\t\\treturn z-side;\\n\\t}\",\n \"public float[] calibrate(Base mBase, Sensor mSensor) {\\n final double metersPerLatitude;\\n final double metersPerLongitude;\\n\\n\\n\\n //Fetching the cisco position for the robot, which returns\\n float ciscoLong = (float) 8.57617285865058;\\n float ciscoLat = (float) 58.33447638466072;\\n\\n\\n metersPerLongitude = distanceCalculator.calculateDistance(ciscoLong, ciscoLat, ciscoLong + 1.0, ciscoLat);\\n\\n metersPerLatitude= distanceCalculator.calculateDistance(ciscoLong, ciscoLat, ciscoLong, ciscoLat + 1.0);\\n\\n\\n float originCiscoPositionx = ciscoLong * (float) metersPerLongitude;\\n float originCiscoPositiony = ciscoLat * (float) metersPerLatitude;\\n\\n\\n //Driving 1 meter forward test\\n //mBase.addCheckPoint(1, 0);\\n\\n\\n //GetCiscoPosition()\\n //These are the actual coordinates of x2 and y2 in latitude and longitude.\\n\\n\\n\\n //If Loomo was already headed east, we would expect these coordinates in meters:\\n float expectedCiscoPositionx2 = (originCiscoPositionx + 1);\\n\\n float newCiscoPointlon = (float) 8.57617413279317;\\n float newCiscoPointlat = (float) 58.334468102336245;\\n\\n\\n float actualCiscoPositionx2 = newCiscoPointlon * (float) metersPerLongitude;\\n float actualCiscoPositiony2 = newCiscoPointlat * (float) metersPerLatitude;\\n\\n\\n\\n //Defining 3 vectors that make up a triangle abc\\n double[] aVector = {expectedCiscoPositionx2 - originCiscoPositionx, originCiscoPositiony - originCiscoPositiony};\\n double[] bVector = {actualCiscoPositionx2 - originCiscoPositionx, actualCiscoPositiony2 - originCiscoPositiony};\\n double[] cVector = {expectedCiscoPositionx2 - actualCiscoPositionx2, originCiscoPositiony - actualCiscoPositiony2};\\n\\n\\n\\n //Calculating the length of each vector / side of the triangle with the pythagorean therm.\\n double aVectorLengthSquared = Math.pow(aVector[0], 2.0) + Math.pow(aVector[1], 2.0);\\n double bVectorLengthSquared = Math.pow(bVector[0], 2.0) + Math.pow(bVector[1], 2.0);\\n double cVectorLengthSquared = Math.pow(cVector[0], 2.0) + Math.pow(cVector[1], 2.0);\\n\\n System.out.println(\\\"Length a = \\\" + sqrt(aVectorLengthSquared));\\n System.out.println(\\\"Length b = \\\" + sqrt(bVectorLengthSquared));\\n System.out.println(\\\"Length c = \\\" + sqrt(cVectorLengthSquared));\\n System.out.println(\\\" \\\");\\n\\n //Calculating the angle between the vector from the expected points and the vector from the\\n // real points using the cosine law. This gives us an angle ∈ [0,PI].\\n float angle = (float) acos((aVectorLengthSquared + bVectorLengthSquared - cVectorLengthSquared)\\n / (2 * sqrt(aVectorLengthSquared) * sqrt(bVectorLengthSquared)));\\n\\n\\n\\n //If the y-element of the b-vector is negative, that means loomo has been driving\\n // southwards. This means, if we are to rotate the coordinates to fit loomo,\\n // they will need to be rotated in the positive direction, or against the clock. -> angle = angle\\n // If the y-element is positive, then loomo has been driving north, and the coordinates will\\n // need to be rotated with the clock. Then \\\"angle\\\" will be the negative value\\n // found with the cosine law.\\n\\n if (bVector[1] < 0) {\\n angle = angle;\\n } else if (bVector[1] > 0) {\\n angle = -angle;\\n }\\n\\n System.out.println(\\\"The angle between the reference systems are: \\\" + angle + \\\", which equals \\\" + angle / PI + \\\"*PI\\\\n\\\" );\\n\\n mBase.cleanOriginalPoint();\\n\\n //Setting Fetching the original point where Loomo stands.\\n mBase.cleanOriginalPoint();\\n Pose2D pose2D = mBase.getOdometryPose(-1);\\n mBase.setOriginalPoint(pose2D);\\n\\n //Driving North: \\t58.334512491588754, 8.576253530218082 to 58.33452608839093, 8.576253888068521\\n //Driving East: 58.33452608839093, 8.576253888068521 to 58.33452618178464, 8.576285073219395\\n //Driving West: 58.33452618178464, 8.576285073219395 to 58.33452693486112, 8.576258173706947\\n //Driving South: 58.33452693486112, 8.576258173706947 to 58.33451544969185, 8.576258890746544\\n\\n float[] calibInfo = {angle, (float) metersPerLongitude, (float) metersPerLatitude};\\n return calibInfo;\\n }\",\n \"public float getMagnitude() {\\n return (float) Math.sqrt(Math.pow(latComponent, 2) + Math.pow(longComponent, 2));\\n }\",\n \"private QuadTree[] findChild(QuadTree parent) {\\n double point1_lon = parent.ullon;\\n double point1_lat = parent.ullat;\\n double point2_lon = (parent.lrlon + parent.ullon) / 2;\\n double point2_lat = parent.ullat;\\n double point3_lon = parent.ullon;\\n double point3_lat = (parent.ullat + parent.lrlat) / 2;\\n double point4_lon = (parent.lrlon + parent.ullon) / 2;\\n double point4_lat = (parent.ullat + parent.lrlat) / 2;\\n double point5_lon = (parent.lrlon + parent.ullon) / 2;\\n double point5_lat = parent.lrlat;\\n double point6_lon = parent.lrlon;\\n double point6_lat = parent.lrlat;\\n double point7_lon = parent.lrlon;\\n double point7_lat = (parent.ullat + parent.lrlat) / 2;\\n QuadTree ul, ur, ll, lr;\\n if (parent.name.equals(\\\"root\\\")) {\\n ul = new QuadTree(\\\"1\\\", point1_lon, point1_lat, point4_lon, point4_lat, parent.depth + 1);\\n ur = new QuadTree(\\\"2\\\", point2_lon, point2_lat, point7_lon, point7_lat, parent.depth + 1);\\n ll = new QuadTree(\\\"3\\\", point3_lon, point3_lat, point5_lon, point5_lat, parent.depth + 1);\\n lr = new QuadTree(\\\"4\\\", point4_lon, point4_lat, point6_lon, point6_lat, parent.depth + 1);\\n } else {\\n ul = new QuadTree(parent.name + \\\"1\\\", point1_lon, point1_lat, point4_lon, point4_lat, parent.depth + 1);\\n ur = new QuadTree(parent.name + \\\"2\\\", point2_lon, point2_lat, point7_lon, point7_lat, parent.depth + 1);\\n ll = new QuadTree(parent.name + \\\"3\\\", point3_lon, point3_lat, point5_lon, point5_lat, parent.depth + 1);\\n lr = new QuadTree(parent.name + \\\"4\\\", point4_lon, point4_lat, point6_lon, point6_lat, parent.depth + 1);\\n }\\n QuadTree[] child = new QuadTree[4];\\n child[0] = ul;\\n child[1] = ur;\\n child[2] = ll;\\n child[3] = lr;\\n return child;\\n }\",\n \"int cubeRow() {\\n return r;\\n }\",\n \"public void zeichneQuadrate(){\\n for (int i=0; i<10;i++)\\n rect (50+i*25,50,25,25);\\n }\",\n \"@Override\\n public ArrayList solveMaze() {\\n\\n\\n try {\\n Client client = new Client(InetAddress.getLocalHost(), 5401, new IClientStrategy() {\\n @Override\\n public void clientStrategy(InputStream inFromServer, OutputStream outToServer) {\\n try {\\n ObjectOutputStream toServer = new ObjectOutputStream(outToServer);\\n ObjectInputStream fromServer = new ObjectInputStream(inFromServer);\\n toServer.flush();\\n toServer.writeObject(maze); //send maze to server\\n toServer.flush();\\n Solution mazeSolution = (Solution) fromServer.readObject(); //read generated maze (compressed with MyCompressor) from server\\n\\n ArrayList mazeSolutionSteps = mazeSolution.getSolutionPath();\\n solutionArray = new ArrayList<>();\\n for (AState mazeSolutionStep : mazeSolutionSteps) {\\n\\n String[] dimensions = mazeSolutionStep.toString().split(\\\"[{},]\\\");\\n int[] position = new int[2];\\n position[0] = Integer.parseInt(dimensions[1]);\\n position[1] = Integer.parseInt(dimensions[2]);\\n\\n solutionArray.add(position);\\n }\\n } catch (Exception e) {\\n e.printStackTrace();\\n }\\n }\\n });\\n client.communicateWithServer();\\n } catch (UnknownHostException e) {\\n e.printStackTrace();\\n }\\n\\n\\n return solutionArray;\\n }\",\n \"protected final String look(int direction, boolean steps) {\\r\\n \\t\\r\\n \\t//pay the LOOK_ENERGY_COST\\r\\n \\tenergy = energy - Params.LOOK_ENERGY_COST;\\r\\n \\tint look;\\r\\n \\t//get the x and y coordinates of the critter\\r\\n \\tint xCoord = this.x_coord;\\r\\n \\tint yCoord = this.y_coord;\\r\\n \\t\\r\\n \\tif(steps == true)\\r\\n \\t\\tlook = 2; //look 2 steps\\r\\n \\telse \\r\\n \\t\\tlook = 1; //look 1 step\\r\\n \\t\\r\\n \\t//get the coordinate position of the location to look\\r\\n \\tswitch(direction) {\\r\\n \\tcase 0:\\r\\n \\t\\txCoord += look; //straight right \\r\\n \\t\\tbreak;\\r\\n \\t\\t\\r\\n \\tcase 1:\\r\\n \\t\\txCoord += look; //diagonally up and to the right\\r\\n \\t\\tyCoord -= look;\\r\\n \\t\\tbreak;\\r\\n \\t\\t\\r\\n \\tcase 2:\\r\\n \\t\\tyCoord -= look; //straight up\\r\\n \\t\\tbreak;\\r\\n \\t\\t\\r\\n \\tcase 3: \\r\\n \\t\\txCoord -= look; //diagonally up and to left\\r\\n \\t\\tyCoord -= look;\\r\\n \\t\\tbreak;\\r\\n \\t\\t\\r\\n \\tcase 4:\\r\\n \\t\\txCoord -= look; //straight left\\r\\n \\t\\tbreak;\\r\\n \\t\\r\\n \\tcase 5:\\r\\n \\t\\txCoord -= look; //diagonally down and to left\\r\\n \\t\\tyCoord += look; \\r\\n \\t\\tbreak;\\r\\n \\t\\t\\r\\n \\tcase 6:\\r\\n \\t\\tyCoord += look; //diagonally down\\r\\n \\t\\tbreak;\\r\\n \\t\\t\\r\\n \\tcase 7:\\r\\n \\t\\txCoord += look; //diagonally down and to right\\r\\n \\t\\tyCoord += look;\\r\\n \\t\\tbreak;\\r\\n \\t}\\r\\n \\t\\r\\n \\t//wrap-around world, need to correct coordinates\\r\\n \\tif(xCoord > (Params.WORLD_WIDTH - 1))\\r\\n \\t\\txCoord %= Params.WORLD_WIDTH;\\r\\n \\telse if(xCoord < 0)\\r\\n \\t\\txCoord += Params.WORLD_WIDTH;\\r\\n \\tif(yCoord > (Params.WORLD_HEIGHT - 1))\\r\\n \\t\\tyCoord %= Params.WORLD_HEIGHT;\\r\\n \\telse if(yCoord < 0)\\r\\n \\t\\tyCoord += Params.WORLD_HEIGHT;\\r\\n \\r\\n \\t//Iterate through population hashMap\\r\\n \\tIterator positionIter = population.keySet().iterator();\\r\\n \\t//Iterate through all of the position keys\\r\\n \\twhile(positionIter.hasNext()) {\\r\\n \\t\\t//get the position key\\r\\n \\t\\tString position = positionIter.next();\\r\\n \\t\\t//get the critter list in that position\\r\\n \\t\\tArrayList critterList = population.get(position);\\r\\n \\t\\t//iterate through the critters \\r\\n \\t\\tListIterator currCritter = critterList.listIterator();\\r\\n \\t\\twhile(currCritter.hasNext()) {\\r\\n \\t\\t\\t//get a critter\\r\\n \\t\\t\\tCritter c = currCritter.next();\\r\\n \\t\\t\\t//check whether each critter is in the position\\r\\n \\t\\t\\tif(c.x_coord == xCoord && c.y_coord == yCoord) {\\r\\n \\t\\t\\t\\tif(c.getEnergy() >= 0) {\\r\\n \\t\\t\\t\\t\\treturn c.toString();\\r\\n \\t\\t\\t\\t}\\r\\n \\t\\t\\t}\\r\\n \\t\\t}\\r\\n \\t}\\r\\n \\t\\r\\n \\t//return null if the position is unoccupied\\r\\n \\treturn null;\\r\\n }\",\n \"protected long travel() {\\n\\n return Math.round(((1 / Factory.VERTEX_PER_METER_RATIO) / (this.speed / 3.6)) * 1000);\\n }\",\n \"private List getPath(int index) {\\n\\t\\t \\n\\t \\n\\t\\t Node fromNode = oEdge.fromNode;\\n\\t\\t Node toNode = oEdge.toNode;\\n\\t\\t float x1 = fromNode.longitude;\\n\\t\\t float x2 = toNode.longitude;\\n\\t\\t float y1 = fromNode.latitude;\\n\\t\\t float y2 = toNode.latitude;\\n\\t\\t double slope, angle;\\n\\t\\t if(x1!=x2) {\\n\\t\\t\\t slope = (y2-y1)/(x2-x1);\\n\\t\\t\\t \\tangle = Math.atan(slope);\\n\\t\\t\\t \\t} else {\\n\\t\\t\\t \\t\\tangle = Math.PI/2;\\n\\t\\t\\t \\t}\\n\\t\\t Double L = Math.sqrt((x1-x2)*(x1-x2)+(y1-y2)*(y1-y2));\\n\\t\\t float offsetPixels=0;\\n\\t\\t if(Math.toDegrees(angle)>Math.toDegrees(90)) {\\n\\t\\t\\t if (index==0){\\n\\t\\t\\t\\t offsetPixels=roadWidth*6/10;\\n\\t\\t\\t }\\n\\t\\t\\t else if(index==1){\\n\\t\\t\\t\\t offsetPixels=roadWidth*11/10;\\n\\t\\t\\t }\\n\\t\\t\\t else if(index==-1){\\n\\t\\t\\t\\t offsetPixels=roadWidth*1/10;\\n\\t\\t\\t }\\n\\t\\t\\t \\n\\t\\t } else {\\n\\t\\t\\t \\n\\t\\t\\t if (index==0){\\n\\t\\t\\t\\t offsetPixels=-roadWidth*6/10;\\n\\t\\t\\t }\\n\\t\\t\\t else if(index==1){\\n\\t\\t\\t\\t offsetPixels=-roadWidth*11/10;\\n\\t\\t\\t }\\n\\t\\t\\t else if(index==-1){\\n\\t\\t\\t\\t offsetPixels=-roadWidth*1/10;\\n\\t\\t\\t }\\n\\t\\t }\\n\\t\\t \\n\\t\\t // This is the first parallel line\\n\\t\\t float x1p1 = x1 + offsetPixels * (y2-y1) / L.floatValue();\\n\\t\\t float x2p1 = x2 + offsetPixels * (y2-y1) / L.floatValue();\\n\\t\\t float y1p1 = y1 + offsetPixels * (x1-x2) / L.floatValue();\\n\\t\\t float y2p1 = y2 + offsetPixels * (x1-x2) / L.floatValue();\\n//\\t\\t if(oEdge.edgeID==16) {\\n//\\t\\t\\t System.out.println(\\\"testing\\\");\\n//\\t\\t }\\n\\t\\t \\n\\t\\t Point P1 = new Point(x1p1,y1p1);\\n\\t\\t Point P2 = new Point(x2p1,y2p1);\\n\\t\\t List gP = GetPoints(P1, P2);\\n\\t\\t return gP;\\n\\t \\n\\t}\",\n \"public abstract List getInterpolatedPoints();\",\n \"public float[] getLocation() {\\n return llpoints;\\n }\",\n \"public void getNeighbors(){\\n // North \\n if(this.row - this.value>=0){\\n this.north = adjacentcyList[((this.row - this.value)*col_size)+col];\\n }\\n // South\\n if(this.row + value=0){\\n this.west = adjacentcyList[((this.row*col_size)+(this.col - this.value))];\\n }\\n }\",\n \"public List getInterpolatedPositions()\\n {\\n return interpolatedPositions;\\n }\",\n \"public interface Paths {\\n String svg_path=\\\"M 1024.00,0.00\\\\n\\\"+\\n \\\"C 1024.00,0.00 1024.00,1024.00 1024.00,1024.00\\\\n\\\"+\\n \\\"1024.00,1024.00 0.00,1024.00 0.00,1024.00\\\\n\\\"+\\n \\\"0.00,1024.00 0.00,0.00 0.00,0.00\\\\n\\\"+\\n \\\"0.00,0.00 1024.00,0.00 1024.00,0.00 Z\\\\n\\\"+\\n \\\"M 471.00,82.00\\\\n\\\"+\\n \\\"C 471.00,82.00 436.00,86.46 436.00,86.46\\\\n\\\"+\\n \\\"402.29,92.53 363.11,105.02 332.00,119.31\\\\n\\\"+\\n \\\"212.66,174.10 124.94,279.73 93.13,407.00\\\\n\\\"+\\n \\\"93.13,407.00 84.32,449.00 84.32,449.00\\\\n\\\"+\\n \\\"84.32,449.00 83.71,459.00 83.71,459.00\\\\n\\\"+\\n \\\"83.71,459.00 82.04,468.00 82.04,468.00\\\\n\\\"+\\n \\\"82.04,468.00 82.04,477.00 82.04,477.00\\\\n\\\"+\\n \\\"81.41,483.79 80.02,482.44 80.00,493.00\\\\n\\\"+\\n \\\"80.00,493.00 80.00,531.00 80.00,531.00\\\\n\\\"+\\n \\\"80.02,541.55 81.41,540.19 81.91,547.00\\\\n\\\"+\\n \\\"83.59,569.87 87.15,592.72 92.74,615.00\\\\n\\\"+\\n \\\"100.84,647.21 115.95,687.81 132.22,716.80\\\\n\\\"+\\n \\\"132.22,716.80 151.28,747.23 151.28,747.23\\\\n\\\"+\\n \\\"151.28,747.23 165.74,768.69 165.74,768.69\\\\n\\\"+\\n \\\"165.74,768.69 170.22,773.74 170.22,773.74\\\\n\\\"+\\n \\\"170.22,773.74 180.37,787.49 180.37,787.49\\\\n\\\"+\\n \\\"180.37,787.49 189.63,797.04 189.63,797.04\\\\n\\\"+\\n \\\"189.63,797.04 195.01,804.24 195.01,804.24\\\\n\\\"+\\n \\\"195.01,804.24 221.76,830.99 221.76,830.99\\\\n\\\"+\\n \\\"221.76,830.99 228.24,835.74 228.24,835.74\\\\n\\\"+\\n \\\"228.24,835.74 235.76,842.99 235.76,842.99\\\\n\\\"+\\n \\\"235.76,842.99 249.49,853.14 249.49,853.14\\\\n\\\"+\\n \\\"249.49,853.14 255.31,858.26 255.31,858.26\\\\n\\\"+\\n \\\"255.31,858.26 271.58,869.13 271.58,869.13\\\\n\\\"+\\n \\\"291.22,882.33 311.33,894.77 333.00,904.45\\\\n\\\"+\\n \\\"333.00,904.45 341.00,907.55 341.00,907.55\\\\n\\\"+\\n \\\"367.84,919.54 388.74,925.41 417.00,932.47\\\\n\\\"+\\n \\\"417.00,932.47 449.00,938.71 449.00,938.71\\\\n\\\"+\\n \\\"449.00,938.71 457.00,939.29 457.00,939.29\\\\n\\\"+\\n \\\"462.41,939.99 463.86,940.92 470.00,941.08\\\\n\\\"+\\n \\\"470.00,941.08 480.00,941.08 480.00,941.08\\\\n\\\"+\\n \\\"487.10,941.88 487.04,942.99 496.00,943.00\\\\n\\\"+\\n \\\"496.00,943.00 532.00,943.00 532.00,943.00\\\\n\\\"+\\n \\\"540.96,942.99 540.90,941.88 548.00,941.00\\\\n\\\"+\\n \\\"548.00,941.00 558.00,941.00 558.00,941.00\\\\n\\\"+\\n \\\"558.00,941.00 567.00,939.29 567.00,939.29\\\\n\\\"+\\n \\\"567.00,939.29 575.00,938.71 575.00,938.71\\\\n\\\"+\\n \\\"600.22,935.42 641.23,924.46 665.00,915.29\\\\n\\\"+\\n \\\"704.92,899.89 742.59,878.10 776.69,852.26\\\\n\\\"+\\n \\\"776.69,852.26 793.76,837.74 793.76,837.74\\\\n\\\"+\\n \\\"793.76,837.74 800.24,832.99 800.24,832.99\\\\n\\\"+\\n \\\"800.24,832.99 815.67,817.67 815.67,817.67\\\\n\\\"+\\n \\\"815.67,817.67 830.99,802.24 830.99,802.24\\\\n\\\"+\\n \\\"830.99,802.24 836.37,795.04 836.37,795.04\\\\n\\\"+\\n \\\"836.37,795.04 843.63,787.49 843.63,787.49\\\\n\\\"+\\n \\\"843.63,787.49 853.78,773.74 853.78,773.74\\\\n\\\"+\\n \\\"853.78,773.74 858.80,768.26 858.80,768.26\\\\n\\\"+\\n \\\"858.80,768.26 865.22,758.47 865.22,758.47\\\\n\\\"+\\n \\\"865.22,758.47 883.32,731.61 883.32,731.61\\\\n\\\"+\\n \\\"912.11,682.93 931.69,628.01 939.70,572.00\\\\n\\\"+\\n \\\"939.70,572.00 940.29,564.00 940.29,564.00\\\\n\\\"+\\n \\\"940.29,564.00 941.83,554.00 941.83,554.00\\\\n\\\"+\\n \\\"941.83,554.00 943.09,532.00 943.09,532.00\\\\n\\\"+\\n \\\"943.09,532.00 944.00,520.00 944.00,520.00\\\\n\\\"+\\n \\\"944.09,461.78 934.76,408.42 913.76,354.00\\\\n\\\"+\\n \\\"913.76,354.00 903.46,328.00 903.46,328.00\\\\n\\\"+\\n \\\"903.46,328.00 888.10,299.00 888.10,299.00\\\\n\\\"+\\n \\\"848.42,227.81 787.58,169.24 716.00,130.54\\\\n\\\"+\\n \\\"697.75,120.67 678.43,112.81 659.00,105.63\\\\n\\\"+\\n \\\"633.52,96.22 601.90,88.14 575.00,84.30\\\\n\\\"+\\n \\\"575.00,84.30 567.00,83.71 567.00,83.71\\\\n\\\"+\\n \\\"557.81,82.51 560.60,82.12 550.00,82.00\\\\n\\\"+\\n \\\"550.00,82.00 530.00,80.14 530.00,80.14\\\\n\\\"+\\n \\\"530.00,80.14 487.00,80.14 487.00,80.14\\\\n\\\"+\\n \\\"478.45,81.70 480.15,81.95 471.00,82.00 Z\\\\n\\\"+\\n \\\"M 621.75,530.91\\\\n\\\"+\\n \\\"C 622.02,527.46 613.08,514.77 610.99,510.91\\\\n\\\"+\\n \\\"610.99,510.91 582.50,458.00 582.50,458.00\\\\n\\\"+\\n \\\"582.50,458.00 574.45,440.00 574.45,440.00\\\\n\\\"+\\n \\\"574.45,440.00 562.02,415.00 562.02,415.00\\\\n\\\"+\\n \\\"562.02,415.00 558.45,406.00 558.45,406.00\\\\n\\\"+\\n \\\"558.45,406.00 547.55,384.00 547.55,384.00\\\\n\\\"+\\n \\\"547.55,384.00 544.45,376.00 544.45,376.00\\\\n\\\"+\\n \\\"544.45,376.00 537.55,362.00 537.55,362.00\\\\n\\\"+\\n \\\"537.55,362.00 534.45,354.00 534.45,354.00\\\\n\\\"+\\n \\\"534.45,354.00 519.54,322.00 519.54,322.00\\\\n\\\"+\\n \\\"519.54,322.00 513.96,306.00 513.96,306.00\\\\n\\\"+\\n \\\"513.96,306.00 490.85,254.00 490.85,254.00\\\\n\\\"+\\n \\\"487.38,245.70 482.11,237.17 482.00,228.00\\\\n\\\"+\\n \\\"482.00,228.00 482.00,224.00 482.00,224.00\\\\n\\\"+\\n \\\"482.15,213.62 490.05,209.14 496.26,213.13\\\\n\\\"+\\n \\\"504.24,218.27 512.34,230.36 517.45,238.42\\\\n\\\"+\\n \\\"517.45,238.42 565.14,314.91 565.14,314.91\\\\n\\\"+\\n \\\"565.14,314.91 597.99,367.28 597.99,367.28\\\\n\\\"+\\n \\\"597.99,367.28 627.99,417.28 627.99,417.28\\\\n\\\"+\\n \\\"627.99,417.28 633.72,427.83 633.72,427.83\\\\n\\\"+\\n \\\"633.72,427.83 642.04,442.99 642.04,442.99\\\\n\\\"+\\n \\\"642.04,442.99 647.01,451.09 647.01,451.09\\\\n\\\"+\\n \\\"647.01,451.09 662.50,482.00 662.50,482.00\\\\n\\\"+\\n \\\"665.34,487.69 671.71,498.69 670.27,504.91\\\\n\\\"+\\n \\\"668.95,510.57 661.64,511.99 657.23,514.72\\\\n\\\"+\\n \\\"657.23,514.72 636.00,526.23 636.00,526.23\\\\n\\\"+\\n \\\"636.00,526.23 629.08,529.26 629.08,529.26\\\\n\\\"+\\n \\\"624.38,531.87 623.04,535.59 618.00,538.00\\\\n\\\"+\\n \\\"619.10,535.68 621.58,532.97 621.75,530.91 Z\\\\n\\\"+\\n \\\"M 436.60,334.30\\\\n\\\"+\\n \\\"C 436.60,334.30 449.66,322.96 449.66,322.96\\\\n\\\"+\\n \\\"449.66,322.96 454.84,315.00 454.84,315.00\\\\n\\\"+\\n \\\"458.55,309.64 464.74,303.48 471.00,301.36\\\\n\\\"+\\n \\\"483.14,297.26 496.23,303.73 504.96,312.09\\\\n\\\"+\\n \\\"507.66,314.67 511.26,318.44 512.30,322.09\\\\n\\\"+\\n \\\"513.68,326.94 513.16,338.17 511.62,343.00\\\\n\\\"+\\n \\\"511.62,343.00 508.00,352.00 508.00,352.00\\\\n\\\"+\\n \\\"497.67,351.97 498.41,349.50 489.97,344.58\\\\n\\\"+\\n \\\"489.97,344.58 465.96,330.58 465.96,330.58\\\\n\\\"+\\n \\\"463.47,329.14 453.27,323.10 450.91,325.36\\\\n\\\"+\\n \\\"449.58,326.64 451.17,328.37 452.10,329.27\\\\n\\\"+\\n \\\"454.46,331.55 459.05,334.01 462.00,335.50\\\\n\\\"+\\n \\\"462.00,335.50 492.91,352.99 492.91,352.99\\\\n\\\"+\\n \\\"496.07,354.74 503.04,358.49 503.71,362.18\\\\n\\\"+\\n \\\"504.12,364.49 503.07,371.74 501.40,373.40\\\\n\\\"+\\n \\\"500.07,374.73 498.69,374.72 497.00,375.00\\\\n\\\"+\\n \\\"497.00,375.00 498.00,384.00 498.00,384.00\\\\n\\\"+\\n \\\"489.25,387.43 489.12,391.54 488.00,400.00\\\\n\\\"+\\n \\\"488.00,400.00 484.56,402.29 484.56,402.29\\\\n\\\"+\\n \\\"484.56,402.29 476.00,415.76 476.00,415.76\\\\n\\\"+\\n \\\"474.01,415.99 471.15,416.11 469.28,415.76\\\\n\\\"+\\n \\\"469.28,415.76 450.91,405.14 450.91,405.14\\\\n\\\"+\\n \\\"450.91,405.14 431.28,393.99 431.28,393.99\\\\n\\\"+\\n \\\"428.52,392.33 417.78,384.60 414.91,387.36\\\\n\\\"+\\n \\\"413.58,388.64 415.17,390.37 416.10,391.27\\\\n\\\"+\\n \\\"418.75,393.84 423.68,396.31 426.99,398.00\\\\n\\\"+\\n \\\"426.99,398.00 436.04,403.42 436.04,403.42\\\\n\\\"+\\n \\\"436.04,403.42 459.09,416.86 459.09,416.86\\\\n\\\"+\\n \\\"464.58,420.20 469.84,421.09 466.87,429.00\\\\n\\\"+\\n \\\"464.69,434.81 460.98,439.65 458.04,445.01\\\\n\\\"+\\n \\\"458.04,445.01 434.58,486.04 434.58,486.04\\\\n\\\"+\\n \\\"434.58,486.04 412.58,524.04 412.58,524.04\\\\n\\\"+\\n \\\"412.58,524.04 406.75,535.74 406.75,535.74\\\\n\\\"+\\n \\\"406.75,535.74 403.11,540.22 403.11,540.22\\\\n\\\"+\\n \\\"403.11,540.22 399.78,546.77 399.78,546.77\\\\n\\\"+\\n \\\"399.78,546.77 390.27,562.01 390.27,562.01\\\\n\\\"+\\n \\\"390.27,562.01 377.78,584.77 377.78,584.77\\\\n\\\"+\\n \\\"377.78,584.77 355.78,622.77 355.78,622.77\\\\n\\\"+\\n \\\"352.15,628.93 347.72,634.90 346.00,642.00\\\\n\\\"+\\n \\\"346.00,642.00 342.00,642.00 342.00,642.00\\\\n\\\"+\\n \\\"327.89,641.76 309.68,627.91 297.00,621.34\\\\n\\\"+\\n \\\"292.74,619.14 282.33,612.37 282.23,607.00\\\\n\\\"+\\n \\\"282.16,602.98 286.67,598.03 288.56,594.40\\\\n\\\"+\\n \\\"288.56,594.40 293.73,585.99 293.73,585.99\\\\n\\\"+\\n \\\"293.73,585.99 309.28,558.77 309.28,558.77\\\\n\\\"+\\n \\\"309.28,558.77 322.22,535.23 322.22,535.23\\\\n\\\"+\\n \\\"322.22,535.23 331.85,522.00 331.85,522.00\\\\n\\\"+\\n \\\"331.85,522.00 360.15,472.00 360.15,472.00\\\\n\\\"+\\n \\\"360.15,472.00 378.42,441.00 378.42,441.00\\\\n\\\"+\\n \\\"378.42,441.00 399.85,404.00 399.85,404.00\\\\n\\\"+\\n \\\"399.85,404.00 404.19,396.00 404.19,396.00\\\\n\\\"+\\n \\\"404.19,396.00 412.07,386.00 412.07,386.00\\\\n\\\"+\\n \\\"417.87,375.86 412.46,368.80 422.00,368.00\\\\n\\\"+\\n \\\"419.91,356.08 424.78,360.59 428.99,351.99\\\\n\\\"+\\n \\\"432.09,345.64 427.65,342.70 436.00,342.00\\\\n\\\"+\\n \\\"436.00,340.05 435.83,335.96 436.60,334.30 Z\\\\n\\\"+\\n \\\"M 497.00,467.00\\\\n\\\"+\\n \\\"C 497.00,467.00 566.00,467.00 566.00,467.00\\\\n\\\"+\\n \\\"566.00,467.00 577.46,468.74 577.46,468.74\\\\n\\\"+\\n \\\"577.46,468.74 589.72,489.83 589.72,489.83\\\\n\\\"+\\n \\\"589.72,489.83 600.58,509.96 600.58,509.96\\\\n\\\"+\\n \\\"600.58,509.96 609.14,524.91 609.14,524.91\\\\n\\\"+\\n \\\"609.14,524.91 615.84,535.28 615.84,535.28\\\\n\\\"+\\n \\\"615.84,535.28 618.75,542.68 618.75,542.68\\\\n\\\"+\\n \\\"618.75,542.68 633.00,569.00 633.00,569.00\\\\n\\\"+\\n \\\"627.03,570.70 618.38,570.00 612.00,570.00\\\\n\\\"+\\n \\\"612.00,570.00 575.00,570.00 575.00,570.00\\\\n\\\"+\\n \\\"575.00,570.00 454.00,570.00 454.00,570.00\\\\n\\\"+\\n \\\"454.00,570.00 413.00,570.00 413.00,570.00\\\\n\\\"+\\n \\\"407.25,570.00 401.16,571.61 398.00,566.00\\\\n\\\"+\\n \\\"398.00,566.00 408.22,549.23 408.22,549.23\\\\n\\\"+\\n \\\"408.22,549.23 411.73,543.99 411.73,543.99\\\\n\\\"+\\n \\\"411.73,543.99 415.53,536.16 415.53,536.16\\\\n\\\"+\\n \\\"415.53,536.16 423.49,522.17 423.49,522.17\\\\n\\\"+\\n \\\"423.49,522.17 445.49,484.17 445.49,484.17\\\\n\\\"+\\n \\\"445.49,484.17 454.00,468.00 454.00,468.00\\\\n\\\"+\\n \\\"454.00,468.00 497.00,467.00 497.00,467.00 Z\\\\n\\\"+\\n \\\"M 702.17,542.80\\\\n\\\"+\\n \\\"C 702.17,542.80 690.97,518.40 690.97,518.40\\\\n\\\"+\\n \\\"690.97,518.40 685.92,508.73 685.92,508.73\\\\n\\\"+\\n \\\"685.92,508.73 681.54,501.83 681.54,501.83\\\\n\\\"+\\n \\\"681.54,501.83 678.58,494.04 678.58,494.04\\\\n\\\"+\\n \\\"678.58,494.04 669.98,476.71 669.98,476.71\\\\n\\\"+\\n \\\"668.90,474.57 667.26,470.96 669.00,468.74\\\\n\\\"+\\n \\\"670.65,466.63 675.55,467.00 678.00,467.00\\\\n\\\"+\\n \\\"678.00,467.00 771.00,467.00 771.00,467.00\\\\n\\\"+\\n \\\"781.99,467.02 780.02,468.61 780.00,479.00\\\\n\\\"+\\n \\\"780.00,479.00 780.00,540.00 780.00,540.00\\\\n\\\"+\\n \\\"780.00,547.62 780.84,564.52 779.00,571.00\\\\n\\\"+\\n \\\"779.00,571.00 755.00,570.00 755.00,570.00\\\\n\\\"+\\n \\\"755.00,570.00 714.00,570.00 714.00,570.00\\\\n\\\"+\\n \\\"712.50,563.82 705.24,548.95 702.17,542.80 Z\\\\n\\\"+\\n \\\"M 244.00,544.00\\\\n\\\"+\\n \\\"C 244.00,544.00 244.00,491.00 244.00,491.00\\\\n\\\"+\\n \\\"244.00,491.00 244.00,475.00 244.00,475.00\\\\n\\\"+\\n \\\"244.00,475.00 245.60,469.02 245.60,469.02\\\\n\\\"+\\n \\\"245.60,469.02 253.00,468.00 253.00,468.00\\\\n\\\"+\\n \\\"253.00,468.00 316.00,468.00 316.00,468.00\\\\n\\\"+\\n \\\"316.00,468.00 348.00,469.00 348.00,469.00\\\\n\\\"+\\n \\\"348.00,469.00 332.15,498.00 332.15,498.00\\\\n\\\"+\\n \\\"332.15,498.00 320.46,519.00 320.46,519.00\\\\n\\\"+\\n \\\"320.46,519.00 313.40,533.58 313.40,533.58\\\\n\\\"+\\n \\\"313.40,533.58 305.83,546.80 305.83,546.80\\\\n\\\"+\\n \\\"305.83,546.80 295.75,563.57 295.75,563.57\\\\n\\\"+\\n \\\"295.75,563.57 291.45,569.18 291.45,569.18\\\\n\\\"+\\n \\\"291.45,569.18 284.00,570.00 284.00,570.00\\\\n\\\"+\\n \\\"284.00,570.00 245.00,571.00 245.00,571.00\\\\n\\\"+\\n \\\"245.00,571.00 244.00,544.00 244.00,544.00 Z\\\\n\\\"+\\n \\\"M 661.20,520.16\\\\n\\\"+\\n \\\"C 665.01,518.10 669.48,513.82 674.00,513.69\\\\n\\\"+\\n \\\"681.26,513.49 682.77,525.02 684.72,529.96\\\\n\\\"+\\n \\\"685.98,533.16 687.84,534.10 689.23,536.51\\\\n\\\"+\\n \\\"689.23,536.51 696.79,554.00 696.79,554.00\\\\n\\\"+\\n \\\"702.32,565.71 706.00,565.74 706.00,580.00\\\\n\\\"+\\n \\\"702.00,581.07 691.45,588.05 687.27,590.48\\\\n\\\"+\\n \\\"677.93,595.93 672.90,598.00 662.00,598.00\\\\n\\\"+\\n \\\"660.73,593.28 659.36,593.20 657.39,589.19\\\\n\\\"+\\n \\\"657.39,589.19 654.74,583.08 654.74,583.08\\\\n\\\"+\\n \\\"654.74,583.08 650.68,577.53 650.68,577.53\\\\n\\\"+\\n \\\"650.68,577.53 640.75,561.49 640.75,561.49\\\\n\\\"+\\n \\\"638.20,556.85 631.85,545.01 628.00,542.00\\\\n\\\"+\\n \\\"628.00,542.00 628.00,536.00 628.00,536.00\\\\n\\\"+\\n \\\"638.41,533.51 651.47,525.40 661.20,520.16 Z\\\\n\\\"+\\n \\\"M 692.01,597.78\\\\n\\\"+\\n \\\"C 692.01,597.78 700.77,593.28 700.77,593.28\\\\n\\\"+\\n \\\"702.28,592.35 703.63,591.04 705.32,590.24\\\\n\\\"+\\n \\\"707.11,589.89 710.07,590.01 712.00,590.24\\\\n\\\"+\\n \\\"713.02,593.79 722.45,606.09 725.33,610.47\\\\n\\\"+\\n \\\"725.33,610.47 749.32,646.47 749.32,646.47\\\\n\\\"+\\n \\\"749.32,646.47 752.72,652.77 752.72,652.77\\\\n\\\"+\\n \\\"752.72,652.77 761.84,667.20 761.84,667.20\\\\n\\\"+\\n \\\"767.44,677.57 774.05,684.01 772.83,697.00\\\\n\\\"+\\n \\\"772.00,705.79 771.20,707.97 765.00,714.14\\\\n\\\"+\\n \\\"757.05,722.05 757.74,721.35 747.00,722.09\\\\n\\\"+\\n \\\"743.86,722.30 742.31,722.92 739.00,722.68\\\\n\\\"+\\n \\\"736.09,722.46 727.83,722.05 725.76,720.75\\\\n\\\"+\\n \\\"718.69,716.32 714.23,704.93 710.57,697.60\\\\n\\\"+\\n \\\"710.57,697.60 683.66,634.91 683.66,634.91\\\\n\\\"+\\n \\\"680.50,626.27 674.27,614.84 674.00,606.00\\\\n\\\"+\\n \\\"682.86,604.87 685.11,601.59 692.01,597.78 Z\\\\n\\\"+\\n \\\"M 256.13,712.00\\\\n\\\"+\\n \\\"C 256.13,712.00 264.84,685.00 264.84,685.00\\\\n\\\"+\\n \\\"264.84,685.00 273.95,642.00 273.95,642.00\\\\n\\\"+\\n \\\"273.95,642.00 277.26,627.00 277.26,627.00\\\\n\\\"+\\n \\\"277.26,627.00 278.99,620.65 278.99,620.65\\\\n\\\"+\\n \\\"278.99,620.65 284.00,618.00 284.00,618.00\\\\n\\\"+\\n \\\"291.29,628.23 310.06,636.13 321.09,642.80\\\\n\\\"+\\n \\\"327.01,646.39 330.75,645.36 334.00,652.00\\\\n\\\"+\\n \\\"334.00,652.00 320.96,664.24 320.96,664.24\\\\n\\\"+\\n \\\"320.96,664.24 315.04,668.38 315.04,668.38\\\\n\\\"+\\n \\\"315.04,668.38 281.67,701.67 281.67,701.67\\\\n\\\"+\\n \\\"281.67,701.67 263.48,719.19 263.48,719.19\\\\n\\\"+\\n \\\"263.48,719.19 256.13,720.00 256.13,720.00\\\\n\\\"+\\n \\\"256.13,720.00 256.13,712.00 256.13,712.00 Z\\\";\\n}\",\n \"public Location3D getRallyPoint () {\\n return myRallyPoint;\\n }\",\n \"public static int hg_step5(int step, int[][] mask, int[] rowCover,\\r\\n\\t\\t\\tint[] colCover, int[] zero_RC) {\\n\\r\\n\\t\\tint count = 0; // Counts rows of the path matrix.\\r\\n\\t\\tint[][] path = new int[(mask[0].length * mask.length)][2]; // Path\\r\\n\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t// matrix\\r\\n\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t// (stores\\r\\n\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t// row and\\r\\n\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t\\t// col).\\r\\n\\t\\tpath[count][0] = zero_RC[0]; // Row of last prime.\\r\\n\\t\\tpath[count][1] = zero_RC[1]; // Column of last prime.\\r\\n\\r\\n\\t\\tboolean done = false;\\r\\n\\t\\twhile (done == false) {\\r\\n\\t\\t\\tint r = findStarInCol(mask, path[count][1]);\\r\\n\\t\\t\\tif (r >= 0) {\\r\\n\\t\\t\\t\\tcount = count + 1;\\r\\n\\t\\t\\t\\tpath[count][0] = r; // Row of starred zero.\\r\\n\\t\\t\\t\\tpath[count][1] = path[count - 1][1]; // Column of starred zero.\\r\\n\\t\\t\\t} else {\\r\\n\\t\\t\\t\\tdone = true;\\r\\n\\t\\t\\t}\\r\\n\\r\\n\\t\\t\\tif (done == false) {\\r\\n\\t\\t\\t\\tint c = findPrimeInRow(mask, path[count][0]);\\r\\n\\t\\t\\t\\tcount = count + 1;\\r\\n\\t\\t\\t\\tpath[count][0] = path[count - 1][0]; // Row of primed zero.\\r\\n\\t\\t\\t\\tpath[count][1] = c; // Col of primed zero.\\r\\n\\t\\t\\t}\\r\\n\\t\\t}// end while\\r\\n\\r\\n\\t\\tconvertPath(mask, path, count);\\r\\n\\t\\tclearCovers(rowCover, colCover);\\r\\n\\t\\terasePrimes(mask);\\r\\n\\r\\n\\t\\tstep = 3;\\r\\n\\t\\treturn step;\\r\\n\\r\\n\\t}\",\n \"public final AstValidator.cube_item_return cube_item() throws RecognitionException {\\n AstValidator.cube_item_return retval = new AstValidator.cube_item_return();\\n retval.start = input.LT(1);\\n\\n\\n CommonTree root_0 = null;\\n\\n CommonTree _first_0 = null;\\n CommonTree _last = null;\\n\\n AstValidator.rel_return rel131 =null;\\n\\n AstValidator.cube_by_clause_return cube_by_clause132 =null;\\n\\n\\n\\n try {\\n // /home/hoang/DATA/WORKSPACE/trunk0408/src/org/apache/pig/parser/AstValidator.g:320:2: ( rel ( cube_by_clause ) )\\n // /home/hoang/DATA/WORKSPACE/trunk0408/src/org/apache/pig/parser/AstValidator.g:320:4: rel ( cube_by_clause )\\n {\\n root_0 = (CommonTree)adaptor.nil();\\n\\n\\n _last = (CommonTree)input.LT(1);\\n pushFollow(FOLLOW_rel_in_cube_item1386);\\n rel131=rel();\\n\\n state._fsp--;\\n if (state.failed) return retval;\\n if ( state.backtracking==0 ) \\n adaptor.addChild(root_0, rel131.getTree());\\n\\n\\n // /home/hoang/DATA/WORKSPACE/trunk0408/src/org/apache/pig/parser/AstValidator.g:320:8: ( cube_by_clause )\\n // /home/hoang/DATA/WORKSPACE/trunk0408/src/org/apache/pig/parser/AstValidator.g:320:10: cube_by_clause\\n {\\n _last = (CommonTree)input.LT(1);\\n pushFollow(FOLLOW_cube_by_clause_in_cube_item1390);\\n cube_by_clause132=cube_by_clause();\\n\\n state._fsp--;\\n if (state.failed) return retval;\\n if ( state.backtracking==0 ) \\n adaptor.addChild(root_0, cube_by_clause132.getTree());\\n\\n\\n if ( state.backtracking==0 ) {\\n }\\n }\\n\\n\\n if ( state.backtracking==0 ) {\\n }\\n }\\n\\n if ( state.backtracking==0 ) {\\n\\n retval.tree = (CommonTree)adaptor.rulePostProcessing(root_0);\\n }\\n\\n }\\n\\n catch(RecognitionException re) {\\n throw re;\\n }\\n\\n finally {\\n \\t// do for sure before leaving\\n }\\n return retval;\\n }\",\n \"public void calculate() {\\n\\t\\t\\n\\t\\tHashMap vertices = triangulation.getVertices();\\n\\t\\tHashMap faces = triangulation.getFaces();\\n\\n\\t\\tHashMap chords = new HashMap();\\n\\t\\tList onOuterCircle = new LinkedList();\\n\\t\\tList outerCircle = new LinkedList();\\n\\n\\t\\tfor (Vertex v : vertices.values()) {\\n\\t\\t\\tchords.put(v.getId(), 0);\\n\\t\\t\\tchildren.put(v.getId(), new LinkedList());\\n\\t\\t}\\n\\n\\t\\t// determine outer face (randomly, use the first face)\\n\\t\\tFace outerFace = null;\\n\\t\\tfor (Face f : faces.values()) {\\n\\t\\t\\touterFace = f;\\n\\t\\t\\tbreak;\\n\\t\\t}\\n\\t\\tif (outerFace == null) {\\n\\t\\t\\t// there are no faces at all in the embedding\\n\\t\\t\\treturn;\\n\\t\\t}\\n\\n\\t\\tEdge e = outerFace.getIncidentEdge();\\n\\t\\tvertexOrder[1] = e.getSource();\\n\\t\\tvertexOrder[0] = e.getTarget();\\n\\t\\tonOuterCircle.add(e.getTarget());\\n\\t\\tonOuterCircle.add(e.getNext().getTarget());\\n\\t\\tonOuterCircle.add(e.getSource());\\n\\t\\touterCircle.add(e.getNext().getNext().getTwin());\\n\\t\\touterCircle.add(e.getNext().getTwin());\\n\\t\\t\\n\\t\\t//System.out.println(\\\"outerCircle 0 \\\" + outerCircle.get(0).getId() + \\\" - source: \\\" + outerCircle.get(0).getSource().getId() + \\\" - target: \\\" + outerCircle.get(0).getTarget().getId());\\n\\t\\t//System.out.println(\\\"outerCircle 1 \\\" + outerCircle.get(1).getId() + \\\" - source: \\\" + outerCircle.get(1).getSource().getId() + \\\" - target: \\\" + outerCircle.get(1).getTarget().getId());\\n\\t\\t\\n\\n\\t\\tfor (int k=vertexOrder.length-1; k>1; k--) {\\n\\t\\t\\t//System.out.println(\\\"k: \\\" + k + \\\" - outerCircle size: \\\" + outerCircle.size());\\n\\t\\t\\t// chose v != v_0,v_1 such that v on outer face, not considered yet and chords(v)=0\\n\\t\\t\\tVertex nextVertex = null;\\n\\t\\t\\tint nextVertexId = -1;\\n\\t\\t\\tfor (int i=0; i childrenNextVertex = children.get(nextVertexId);\\n\\t\\t\\t\\n\\t\\t\\t// update edges of outer circle\\n\\t\\t\\tint index = 0;\\n\\t\\t\\t\\n\\t\\t\\twhile (outerCircle.get(index).getTarget().getId() != nextVertexId) {\\n\\t\\t\\t\\tindex++;\\n\\t\\t\\t}\\n\\t\\t\\tEdge outofNextVertex = outerCircle.remove(index+1);\\n\\t\\t\\t\\n\\t\\t\\t\\n\\t\\t\\t//System.out.println(\\\"outOfNextVertex \\\" + outofNextVertex.getId() + \\\" - source: \\\" + outofNextVertex.getSource().getId() + \\\" - target: \\\" + outofNextVertex.getTarget().getId());\\n\\t\\t\\tEdge intoNextVertex = outerCircle.remove(index);\\n\\t\\t\\t//System.out.println(\\\"intoNextVertex \\\" + intoNextVertex.getId() + \\\" - source: \\\" + intoNextVertex.getSource().getId() + \\\" - target: \\\" + intoNextVertex.getTarget().getId());\\n\\t\\t\\tEdge current = intoNextVertex.getNext();\\n\\t\\t\\t//System.out.println(\\\"current \\\" + current.getId() + \\\" - source: \\\" + current.getSource().getId() + \\\" - target: \\\" + current.getTarget().getId());\\n\\t\\t\\t\\n\\t\\t\\tint endIndex = index;\\n\\t\\t\\t\\n\\t\\t\\twhile (current.getId() != outofNextVertex.getId()) {\\n\\t\\t\\t\\tEdge onCircle = current.getNext().getTwin();\\n\\t\\t\\t\\touterCircle.add(endIndex, onCircle);\\n\\t\\t\\t\\t\\n\\t\\t\\t\\tchildrenNextVertex.add(0, onCircle.getSource().getId());\\n\\t\\t\\t\\t\\n\\t\\t\\t\\tendIndex++;\\n\\t\\t\\t\\tcurrent = current.getTwin().getNext();\\n\\t\\t\\t\\tonOuterCircle.add(onCircle.getTarget());\\n\\t\\t\\t}\\n\\t\\t\\t\\n\\t\\t\\tEdge lastEdge = outofNextVertex.getNext().getTwin();\\n\\t\\t\\touterCircle.add(endIndex, lastEdge);\\n\\t\\t\\t\\n\\t\\t\\tchildrenNextVertex.add(0, lastEdge.getSource().getId());\\n\\t\\t\\tchildrenNextVertex.add(0, lastEdge.getTarget().getId());\\n\\n\\t\\t\\t// update chords\\n\\t\\t\\tfor (Vertex v : onOuterCircle) {\\n\\t\\t\\t\\tEdge incidentEdge = v.getOutEdge();\\n\\t\\t\\t\\tint firstEdgeId = incidentEdge.getId();\\n\\t\\t\\t\\tint chordCounter = -2; // the 2 neighbours are on the outer circle, but no chords\\n\\t\\t\\t\\tdo {\\n\\t\\t\\t\\t\\tif (onOuterCircle.contains(incidentEdge.getTarget())) {\\n\\t\\t\\t\\t\\t\\tchordCounter++;\\n\\t\\t\\t\\t\\t}\\n\\t\\t\\t\\t\\tincidentEdge = incidentEdge.getTwin().getNext();\\n\\t\\t\\t\\t} while (incidentEdge.getId() != firstEdgeId);\\n\\t\\t\\t\\tchords.put(v.getId(), chordCounter);\\n\\t\\t\\t}\\n\\t\\t}\\n\\t}\",\n \"private Square[] returnPath(Vertex v, GameBoard b) {\\n // because we're starting at the end point,\\n // we need build the path in 'reverse'\\n Stack path = new Stack