case_id
stringlengths 12
14
| gender
stringclasses 4
values | age
int8 0
98
| case_text
stringlengths 216
57.5k
| keywords
stringlengths 8
843
⌀ | image_file
imagewidth (px) 136
1.66k
⌀ | caption
stringclasses 584
values |
|---|---|---|---|---|---|---|
PMC8551644_01 | Male | 82 | An 82-year- old man was referred to our hospital with a complaint of a bulge in the left chest wall. On palpation, the cystic mass was soft and highly flexible, without redness or heat. The patient had a history of left pleural effusion developed one year prior, and thoracoscopic examination had been performed because the adenosine deaminase (ADA) level in the pleural effusion was high (97.4 U/L). Malignant pleural diseases and tuberculous pleuritis had been ruled out by bacteriological and histological examination. Six months after thoracoscopy, computed tomography showed that the pleural effusion had decreased in volume, but there were numerous small nodular shadows in the left upper lobe; the nodules had increased in size and showed a tree in bud appearance, and a cystic mass appeared under the left scapula (Fig. 1). The patient had undergone surgery for lumbar spinal canal stenosis 13 years earlier, and needed a walking frame because of the complications of postoperative leg paresis. In addition, there was an episode of rehabilitation of shoulder movement performed three times a week for one year after the last thoracoscopic examination; treatment was discontinued due to shoulder pain.
Ultrasonography showed that the cystic mass had a wall of approximately 5 mm and contained numerous hyperechoic deposits (Fig. 2). Magnetic resonance imaging showed that the cystic mass was 12 cm in size and located inside the serratus anterior muscle below the scapula, and there were many crystalline structures inside the cystic mass that showed low signal intensity on T2-weighted images, suggesting scapulothoracic bursitis (Fig. 2). The white blood cell count and C-reactive protein levels were 5800/mul and 0.2 mg/dL, respectively. The erythrocyte sedimentation rate was 13 mm at 1 h, and T-SPOT. TB test was negative. Biochemical and microbiological examination of the cyst contents by needle aspiration and histological examination of the cyst wall by needle biopsy were performed to diagnose the cystic mass. The fluid in the cyst was orange and slightly turbid, and the ADA level in the cyst fluid was elevated (99.1. The results of the biochemical examination of the fluid contents are presented in Table 1. Mycobacterium tuberculosis was detected by a PCR test from the contents, and multinucleated giant cell infiltration was observed in the cyst wall.
Since there were no malignant findings, the patient was diagnosed with tuberculous scapulothoracic bursitis, and antituberculous therapy (rifampicin 450 mg, isoniazid 300 mg, ethambutol 750 mg) was initially started. However, imaging evaluation after 3 months of antituberculosis drug treatment showed enlargement of the cystic mass. Therefore, we decided to perform surgical excision.
The operative team donned N 95 masks, considering the rupture of the cystic mass. Under general anesthesia in the right lower decubitus position, a skin incision was made along the anterior border of the latissimus dorsi muscle from the axilla to the caudal margin of the mass. The serratus anterior muscle was split along the muscle bundle at the caudal side of the mass to reach the mass. In most places, the cystic mass was loosely adhered to the surrounding tissue, but part of the craniodorsal region was adhered to the fourth intercostal muscles, so the surface layer of the periosteum and intercostal muscle was resected. The cystic mass was resected without rupture (Video 1).
Supplementary video related to this article can be found at https://doi.org/10.1016/j.rmcr.2021.101537
The following is the supplementary data related to this article:
The cystic mass was composed of a uniformly fibrous wall containing numerous coin-shaped chondroid bodies (Fig. 3). Histological findings showed inflammatory cell infiltration, including lymphocytes, histiocytes, and plasma cells, inside the fibrous cyst wall. A granulomatous lesion with clusters of multinucleated giant cells, which was not accompanied by necrosis but suggested tuberculosis infection, was observed (Fig. 4).
As postoperative adjuvant therapy, the three antituberculosis drugs mentioned in section 2.3 were administered for 6 months. The chest wall cyst did not recur, the small nodular shadow in the left upper lobe improved, and exacerbation of tuberculosis was not observed for more than one year postoperatively. | chest wall, scapulothoracic bursitis, tuberculosis | Not supported with pagination yet | null |
PMC3922799_01 | Male | 57 | A 57-year-old HIV positive man was referred to the HIV clinic of Imam Khomeini Hospital, Tehran, Iran, with chief complaint of bilateral slowly progressive hearing loss starting from two months ago. He had no previous cochleo-vestibular symptoms and the hearing loss was described without tinnitus, vertigo or balance changes. He had no history of head trauma prior to the beginning of the hearing loss. He was a known case of HIV infection following blood transfusion from 2 years ago. In his medical history, RA was diagnosed from 3 months ago when he was receiving HQ 200 mg and prednisolone 5 mg twice daily. He did not consume any antiretroviral supplements or herbal products.
His laboratory findings showed CD4 count of 107/L and CD4/CD8 ratio of 0.13. All the other routine laboratory parameters were within the normal range. Based on the patient clinical status and his CD4 count, antiretroviral regimen including lamivudine, zidovudine and efavirenz was started. Also sulfamethoxazole/trimethoprim and isoniazid was considered for prophylaxis of pneumocystis and tuberculosis respectively in this patient.
Otolaryngological consultation reported normal otoscopic and neurologic examinations for the patient. Pure-tone (air and bone conduction) and speech audiometry showed moderate to severe neuronal hearing loss and reduced speech recognition in his both ears (45 and 40 dB in the right and left ears respectively) (Figure 1). Absence of middle ear pathologic conditions was confirmed by pneumatic otoscopy and tympanometry. Furthermore, acoustic reflexes were latent in the patient.
With suspicious of HQ-induced hearing loss, the drug was discontinued and prednisolone was continued to control his RA symptoms. Two months later, his audiometric findings improved. Pure-tone and speech audiometry revealed mild to moderate hearing loss and slight to mild disability in speech recognition in the right and left ears, respectively (Figure 2). His acoustic reflexes were still latent. | null | Not supported with pagination yet | null |
PMC7365510_01 | Male | 22 | A 22-year-old male presented to the emergency department with high-grade fever and chills for 3 months' duration. Fever was associated with cough and expectoration for the last 11/2 month with occasional brownish-red sputum for 1 month. He had headache and progressive drowsiness for the last 2 days. There was no history of vomiting, photophobia, seizures, or loss of consciousness. He did not have any drug addictions or high-risk sexual behavior.
At presentation, he was conscious but disoriented with a Glasgow Coma Score of 12/15. He was febrile (102 F ) and had tachycardia with normal blood pressure. Systemic examination revealed mild pallor and reduced breath sounds at the right infrascapular region, and the liver was tender and enlarged till 15 cm below the right costal margin. Signs of meningeal irritation were present without any focal neurological deficit. Investigations revealed severe anemia (hemoglobin - 6.2 g/dL), neutrophilic leukocytosis (total leukocyte count [TLC] - 20,900/mm3 with 80% neutrophils), hypoalbuminemia (serum albumin 2.0 g/dL), and raised alkaline phosphatase (435 IU/L). Blood and urine cultures revealed no growth. His chest X-ray showed an elevated right hemidiaphragm with mild pleural effusion. Abdominal ultrasound and contrast-enhanced computed tomography (CECT) scan of the thorax and abdomen revealed a single large abscess of approximately 750 cc volume in the right lobe of the liver with evidence of rupture into the right subdiaphragmatic space [Figure 1]. The patient was started on broad-spectrum intravenous antibiotics including metronidazole since the day of admission. Subsequently, a pigtail catheter was inserted into the liver abscess which drained around 1.2 l of anchovy sauce-like pus over 2 days. Drained liver abscess pus on evaluation revealed TLC-full field (N - 70% and L - 30%), sterile for bacterial and fungal cultures and negative for amebic trophozoite and malignant cells on microscopic examination as well as negative for Mycobacterium tuberculosis-Gene-Xpert.
As patient orientation was not improved, magnetic resonance imaging (MRI) scan of the brain was done about 6 days later of initiation of antibiotics, which showed a large, ring-enhancing, intracranial, space-occupying lesion involving the bilateral frontal lobes with significant perilesional edema [Figure 2]. Keeping the possibility of primary brain tumor versus metastatic abscess, neurosurgical consultation was sought, and the patient was considered for drainage of abscess. Intraoperative findings revealed rusty, brown-colored, organized abscess extending into the third ventricle with bilateral anterior cerebral artery thrombosis. Microscopy of the pus from the liver and brain did not reveal any amebic trophozoite, Gram stain was negative, and bacterial cultures were sterile.
The patient responded well to the treatment with parenteral metronidazole and antibiotics along with drainage of liver and brain abscesses. He became afebrile, and leukocytosis resolved after 72 h of starting treatment. His sensorium was also improved, but he had persistent urinary incontinence and disorientation, which improved gradually over 3 weeks. His enzyme-linked immunosorbent assay test for Entamoeba histolytica immunoglobulin G was done with RIDASCREEN kit from r-Biopharm (Darmstadt, Germany), which was reported positive, suggesting amebic etiology of liver and brain abscesses. After 2 weeks of parenteral therapy, he was continued with oral metronidazole for another 2 weeks. Subsequently, MRI scan of the brain and CECT of the abdomen were repeated, which showed almost complete resolution of brain abscess and minimally organized residual abscess in the liver [Figures 3 and 4]. He was discharged after 5 weeks of hospital stay, and after 6 months of follow-up, he did not have any residual neurological symptoms. | amebiasis, entamoeba histolytica, brain abscess, hepatic abscess | Not supported with pagination yet | null |
PMC6528075_01 | Female | 34 | A 34-year-old woman suffered hyperemia and blurred vision in the right eye half a year ago and visited a local clinic. Multifocal choroiditis in the right eye was suspected, and she received topical corticosteroid and subconjunctival injection of triamcinolone. However, she developed visual field deterioration in both eyes and was referred to our clinic. Best-corrected visual acuity (BCVA) was 20/200 (OD) and 20/16 (OS). We detected bilateral conjunctival hyperemia, mild iridocyclitis in the right eye, and multiple atrophic retinal lesions with some exudative changes widespread from the posterior pole to peripheral retina in both eyes (Fig. 1a). Fundus autofluorescence presented hypoautofluorescent regions corresponding to the outer retinal atrophy (Fig. 1b), and fluorescein angiography (FA) demonstrated late staining in the foveal region, especially from the margins of the region and vascular leakage in peripheral region (Fig. 1c). Late hyperfluorescence of the discs in both eyes was also observed. By optical coherence tomography (OCT) in the right eye, subretinal fluid in the subfoveal region and hyperreflective materials in ellipsoid zone were detected. Hyperplasia of retinal pigment epithelium (RPE) and ellipsoid zone were also observed (Fig. 1d). Complete blood count, erythrocyte sedimentation rate, C-reactive protein, kidney function tests, and liver function test were normal, and serology for syphilis and HIV were negative. Normal chest computed tomography, negative purified-protein derivative reaction, and negative T-SPOT.TB excluded the diagnosis of sarcoidosis and tuberculosis. Diagnosis of multifocal choroiditis and uveitis was made. We prescribed oral prednisolone at 30 mg/day and 0.1% betamethasone eyedrops for the right eye 4 times a day. After retinal exudative changes were alleviated, we began tapering both medications.
One month after the first visit (oral prednisolone: 10 mg/day), chorioretinitis near the disc and peripheral fundus relapsed in the left eye, and we increased oral prednisolone to 25 mg/day which improved the condition, and gradual tapering was restarted. Twelve months after the initial visit (oral prednisolone: 7 mg/day), the recurrence with multiple exudative changes in the periphery was observed in both eyes. In consideration of the clinical course and appearance, we made a diagnosis of RPC. We increased oral prednisolone (15 mg/day) and added oral cyclosporine (200 mg/day). Nevertheless, relapse occurred over the next 5 months. Thus, 17 months after the initial treatment, subcutaneous administration of adalimumab (40 mg/2 weeks) was introduced. Following the introduction, the oral immunosuppressants were drastically tapered without recurrence or any drug complications related to adalimumab. Three months after adalimumab therapy was started, oral cyclosporine was terminated. One year after introduction of adalimumab, oral prednisolone was successfully terminated without recurrence. BCVA had recovered up to 20/16 in both eyes. OCT image demonstrated alleviation of RPE hyperplasia, turned into rarefaction of outer retina and ellipsoid zone (Fig. 1e). | acute posterior multifocal placoid pigment epitheliopathy, adalimumab, relentless placoid chorioretinitis, serpiginous choroiditis, uveitis | Not supported with pagination yet | null |
PMC6528075_02 | Male | 22 | A 22-year-old man was examined at a local clinic for visual deterioration in both eyes, and widespread multiple chorioretinal lesions were found in both fundi (Fig. 2a). Fundus autofluorescence demonstrated increase in central hypoautofluorescence within the lesions corresponding to the outer retinal atrophy and RPE hyperplasia (Fig. 2b). FA demonstrated hyperfluorescence of the lesions in late phase (Fig. 2c), and indocyanine green angiography showed hypofluorescence in the area coincide with the clinical legions (Fig. 2d). Similar to the previous case, laboratory work-up, including complete blood count, erythrocyte sedimentation rate, C-reactive protein, kidney function tests, and liver function test were within normal limits, and serology for syphilis and HIV were negative. Normal chest computed tomography, negative purified-protein derivative reaction, and negative T-SPOT.TB. denied sarcoidosis and tuberculosis. Oral prednisolone at 20 mg/day and oral cyclosporine at 300 mg/day were started. One month later, at the initial visit to our hospital, BCVA was 20/60 (OD) and 20/20 (OS). No inflammatory signs were observed. Thus, oral prednisolone prescription was gradually tapered.
Six months later (oral prednisolone: 11 mg/day, oral cyclosporine: 150 mg/day), relapse with new chorioretinal exudative changes occurred in the left eye. A diagnosis of RPC was made and oral prednisolone was increased to 15 mg/day. Once ocular inflammatory changes had subsided, adalimumab (40 mg/2 weeks) was started and cyclosporine was discontinued. Since then, no recurrence occurred over an 9-month period, and oral prednisolone was successfully tapered to 5 mg/day. No complications related to the use of adalimumab was noted. BCVA recovered to 20/20 (OD) and 20/16 (OS). Change in OCT findings are shown in Figure 3. Small amount of subretinal hyperreflective materials, focal outer retinal disruption, and subfoveal RPE hyperplasia were observed at the first visit (Fig. 3a). Nine months after the administration of adalimumab, the recession of RPE hyperplasia according to the inactivation of inflammation was detected, albeit partial hyperplasia remained. Ellipsoid zone was rarefied at the site of prior hyperplasia (Fig. 3b). | acute posterior multifocal placoid pigment epitheliopathy, adalimumab, relentless placoid chorioretinitis, serpiginous choroiditis, uveitis | Not supported with pagination yet | null |
PMC6877973_02 | Female | 42 | A 42-year-old female with a past medical history of rheumatoid arthritis diagnosed three months prior to admission, managed with methotrexate with poor adherence, was admitted due to psychomotor agitation without focal neurological deficits and fever (100.4 F) with neutrophilia.
Lumbar puncture showed a low glucose level in the cerebrospinal fluid (CSF) (glucose CSF 24.8 mg/dl, glucose serum: 78 mg/dl), 23 common germs in FilmArray (multiplex PCR system), as well as Gram and Chinese ink negative.
The patient lived in a tuberculosis endemic zone. Antibiotic therapy, antituberculosis drugs, and antifungal agents were initiated despite negative results.
The patient showed a sudden improvement in consciousness three days after starting treatment. However, she presented a new episode of altered mental status two days later, and it was associated with transaminases elevation 100 times above the reference value. Liver enzymes remained elevated despite discontinuation of antituberculosis agents. Brain CT scan of the brain showed ischemic areas in the corpus callosum and bilateral parietal lobes.
One day later, our patient presented severe hemodynamic decompensation with metabolic acidosis, acute respiratory failure, and pancytopenia. The patient was transferred to the MICU to provide mechanical ventilation and vasopressors.
Simultaneously, a progressive drop in hemoglobin was identified, so a bronchial tract lavage (not alveolar) was performed obtaining bloody secretions. Chest X-ray showed diffuse bilateral infiltrates. Patient's critical condition disabled him to undergo chest CT scan. Autoimmune markers were requested due to the suspicion of immune alveolar hemorrhage showing anti-cardiolipin antibodies IgM 0.3 MPL-U/ml (negative: <7 MPL-U/ml), IgG 100 MPL-U/ml (POSITIVE: >17 GPL-U/ml), Anti-DNA 29 IU/ml (positive: >20 IU/ml), and both positive anti-nuclear antibodies and lupus anticoagulant. Schistocytes were identified in peripheral blood smear. There was no evidence of lupus nephritis.
The patient met the criteria for definite CAPS associated with alveolar hemorrhage. Intravenous pulses of methylprednisolone 1 g daily IV and enoxaparin 60 mg daily SubQ to maintain isocoagulation state due to risk of hemorrhagic conversion of ischemic strokes were added to the already placed ventilatory support. The patient's critical condition prevented her from underwent bronchoscopy or pulmonary biopsy.
Despite the initial clinical improvement, the patient died in later days due to a new deterioration of respiratory function, renal failure, and encephalopathy. | null | Not supported with pagination yet | null |
PMC9482776_01 | Male | 74 | A 74-year-old man was admitted with fever, severe cough, and yellow sputum for 1 month. He was diagnosed with lung adenocarcinoma (cT4N2M0, IIIB) 3 months ago and received 2 cycles of pemetrexed-cisplatin adjuvant chemotherapy. He had a history of tuberculosis and a 10-year history of smoking but had quit for 4 years. He maintains a good oral hygiene. Chest Computed tomography (CT) scan showed: (1) multiple lesions in bilateral lobe of the lung; (2) enlarged hilar and mediastinal lymphadenopathy; (3) infection lesions in the lower lobe of the left lung. Repeated sputum acid-fast bacteria (AFB) smear staining was positive. Sputum GeneXpert MTB/RIF assay (Cepheid, Sunnyvale, CA) and culture were positive and sensitive to rifampicin. Considering the retreatment of pulmonary tuberculosis, isoniazid (H), rifampin (R), ethambutol (E), pyrazinamide (Z), moxifloxacin were used as the anti-tuberculosis regimen, and linezolid 600 mg once daily was added to strengthen the regimen. The patient's temperature returned to normal after 5 days of treatment, and cough was significantly resolved after 2 weeks of treatment. However, 12 days after the initiation of linezolid treatment, the patient complained of a black tongue without any other symptoms (Figure 1A). Tongue swab culture showed Enterobacter kobei. Considering that this side effect was related to linezolid, we discontinued linezolid and the tongue discoloration returned to normal within 17 days. | black-hairy tongue, linezolid, microorganism metabolism, side-effect, treatment, tuberculosis infection | Not supported with pagination yet | null |
PMC9482776_02 | Male | 67 | A 67-year-old man was admitted with dry cough and shortness of breath. He had no smoking history and oral hygiene was good. Chest CT revealed massive bilateral pleural effusion. Meanwhile, abdominal ultrasound and echocardiography showed moderate ascites and pericardial effusion. Pleural fluid T-SPOT.TB result was positive. The patient was considered to have tuberculous polyserositis and started HRZE diagnostic anti-TB treatment. However, the patient then developed weakness, loss of appetite, oliguria, decreased pulse pressure. Considering the signs of pericardial tamponade, an emergency pericardiectomy was performed. Thickened pericardium adhesions were seen during the operation, some of which were obviously calcified and narrowed, and some were cheese-like lesions. Histopathology of the pericardium showed fibrous tissue hyperplasia, collagenization with exudation of inflammatory necrosis, and a positive TB FISH result. A diagnosis of tuberculous constrictive pericarditis was confirmed after surgery. We adjusted the anti-tuberculosis regimen to meropenem, moxifloxacin, isoniazid, rifampin, he complained of worsening chest tightness, and large extensive pleural fluid was seen in chest CT after one month of treatment. Linezolid 600mg once daily along with steroids was then added to the anti-TB regimen. Thirteen days after intake of linezolid, asymptomatic black tongue was observed (Figure 1B), and tongue swab detected Escherichia coli. After completing 2 months of the anti-TB regimen containing linezolid, his tongue discoloration disappeared 10 days after discontinuation of linezolid. | black-hairy tongue, linezolid, microorganism metabolism, side-effect, treatment, tuberculosis infection | Not supported with pagination yet | null |
PMC9482776_03 | Male | 37 | A 37-year-old man presented with low-grade fever, persistent headache, and night sweats for a month duration. He had no smoking history and oral hygiene was good. Chest CT showed multiple nodules. Magnetic resonance imaging (MRI) of the brain showed multiple low-density lesions and small abscesses with surrounding edema. The sputum and cerebrospinal fluid GeneXpert MTB/RIF assay indicated positive and further culture proved TB infection. The patient was diagnosed with pulmonary tuberculosis with tuberculous meningitis. He was treated with isoniazid, rifampicin, pyrazinamide, ethambutol, and linezolid 600 mg daily in combination with steroids, and the patient's headache relieved within two weeks. Brain MRI was repeated after 4 weeks, which showed decreased abscesses and absorbed edema. However, after 28 days of the above anti-tuberculosis treatment, the patient experienced abnormal taste and tongue black discoloration (Figure 1C). Tongue swab culture showed Klebsiella pneumoniae. Upon cessation of linezolid for 15 days, his tongue returned to normal. The patient later met the criteria to be cured of tuberculosis. | black-hairy tongue, linezolid, microorganism metabolism, side-effect, treatment, tuberculosis infection | Not supported with pagination yet | null |
PMC6545640_01 | Female | 3 | A 3-year-7-month old female neutered domestic shorthair cat presented to the Queen's Veterinary School Hospital with a 2 day history of acute onset progressive ataxia, dullness and reduced appetite. Prior to presentation it had no medical history, had never been outside of the UK, was vaccinated against feline panleukopenia virus, feline herpes virus, feline calicivirus and feline leukaemia virus (FeLV), and received regular preventive antiparasitic medications (praziquantel and moxidectin/imidacloprid). No toxin exposure was reported; however, it was a mixed indoor/outdoor cat with a known history of hunting. No other clinical signs were reported by the owner at the time of presentation or in the preceding period.
On clinical examination the cat was depressed and poorly responsive. It weighed 2.97 kg, with a body condition score of 3/9. It was pyrexic (rectal temperature 40.0oC) with a normal heart rate (184 beats per min), with a normal respiratory rate (24 breaths per min). Oral examination, thoracic auscultation and abdominal palpation were unremarkable. No detectable peripheral lymphadenopathy was present, and no detectable changes in mucous membrane moistness or skin elasticity were noted to indicate significant dehydration. Direct ophthalmoscopic examination was unremarkable. Neurological examination was performed, which identified reduced mentation, absent menace response bilaterally, absent response to nasal planum stimulation and ataxia on all four limbs. The cat appeared visual, with normal pupillary light reflexes and response to moving objects. It had a wide-based stance with truncal sway. The remainder of the cranial nerve reflexes and the spinal reflexes and proprioceptive responses were all within normal limits.
Biochemistry revealed moderate increases in alanine aminotransferase (ALT) (194 IU/l; reference interval [RI] 17-62 IU/l), aspartate aminotransferase (AST; 150 IU/l [RI 0-51 IU/l]) and total bilirubin (20 micromol/l [RI 0-11micromol/l]). Alkaline phosphatase and gamma-glutamyl transferase were below the detectable limit on the assay. A mild hyperglycaemia (9.8 mmol/l [RI 3.9-5.8 mmol/l]) was reported; however, the remainder of the biochemistry, including urea, albumin and globulin, was unremarkable. Haematology identified a marked leukopenia (1.83 x109 /l [RI 5.5-19.5 x109 /l]) with neutropenia (1.17 x109 /l [RI 2.5-12.5]) with left shift and toxic change and lymphopenia (0.4 x109 /l [RI 1.5-7.0x109 /l]). All other white cell, red blood cell (RBC) and platelet parameters were within the RIs.
ELISA testing for feline immunodeficiency virus/FeLV was negative. Serology for toxoplasmosis (IgM and IgG) was performed on a single sample and was negative at 1:20 and 1:200, respectively. Urinalysis by cystocentesis identified an increase in urine protein:creatinine ratio (0.94 [RI 0.0-0.2]) and mild increase in RBC numbers 7/high-power field (RI 0-5). On urine dipstick, 3+ bilirubin was present. Urine specific gravity by refractometry was 1.023. Urine culture was negative. MRI of the brain was undertaken and identified no abnormalities. Cerebrospinal fluid (CSF) tap found an increased specific gravity 1.008 (RI 1.004-1.006) but was otherwise unremarkable, with no increased cellularity or protein. Toxoplasma PCR was performed on the CSF sample and was negative. MRI and CSF tap were performed under general anaesthetic, during which intravenous fluid therapy was provided and monitoring by a diploma-holding anaesthetist was undertaken.
The cat initially recovered well from anaesthesia; however, it showed a marked deterioration over the subsequent 24 h, after which time the biochemistry and haematology were repeated. This identified further moderate increases in ALT (265 IU/l), AST (205 IU/l) and total bilirubin (42.9 micromol/l). Abdominal ultrasound was performed under sedation with dexmedetomidine and methadone, and identified no abnormalities, with normal size and echotexture of the liver and no abdominal lymphadenomegaly. The pancreas and biliary tree were reported to be unremarkable. Cytology of the liver was performed by fine-needle aspiration and showed a marked, mixed, predominantly neutrophilic bacterial inflammation with intra- and extracellular rod-shaped bacteria. Smaller numbers of macrophages were also reported, potentially suggestive of a more chronic course.
Minimally invasive laparotomy using a small incision and ring retractor (Figure 1) was subsequently performed under general anaesthetic to acquire hepatic biopsies and bile aspirate. Three liver samples from different areas were taken into formalin and two samples were taken for fresh submission. The cat was placed on intravenous fluid therapy for the duration of the procedure and for the subsequent 3 days until adequate voluntary food intake was achieved and hydration status considered to be normal. During the postoperative period the cat received opioid analgesia (initially methadone 0.3 mg/kg IV q4h, reducing to buprenorphine 0.02 mg/kg q6h after 24 h). Coagulation testing prior to surgery would have been desirable; however, this was overlooked in the face of the marked deterioration in the cat's clinical status and the rapid progression to biopsy.
The gross appearance of the liver was suggestive of multifocal abscessation (Figure 1.) After sample acquisition the cat was placed on potentiated amoxicillin (20 mg/kg IV q8h) as broad-spectrum empiric treatment for a suspected bacterial hepatitis. Histology identified macroscopic focal lesions roughly 1-2 mm in diameter on the sample and cut surfaces. Microscopic examination identified severe (60% of assessed area) necrotising and pyogranulomatous hepatitis (Figure 2) with intralesional gram-negative bacterial microcolonies (rods). Toxoplasma PCR on liver tissue was negative. Samples were submitted to the reference laboratory for culture of the bile and fresh hepatic tissue. These were both positive for Yersinia pseudotuberculosis. Fluorescent in situ hybridisation for eubacteria, and including Salmonella, Campylobacter, Helicobacter and Leptospira species, was negative for all other bacteria.
The cultured Yersinia pseudotuberculosis was tested for sensitivity by disc diffusion and was found to be sensitive to amoxicillin, marbofloxacin and oxytetracycline (resistant to cephalexin, metronidazole and clindamycin). On the basis that Yersinia species are not typically sensitive to amoxicillin, and that previous reported cases had responded poorly to therapy, additional treatment with marbofloxacin was instituted (1.7 mg/kg IV q24h) alongside the potentiated amoxicillin. The cat was also started on combined s-adenosyl methionine (SAMe) and silybin (Denamarin; Protexin, 30 mg/kg PO q24h). The cat remained hospitalised for a further 6 days during which time it showed rapid improvement in all clinical signs, with return to partial voluntary calorie intake within 24 h, and subsequent return to full voluntary food intake within 3 days. Fluid therapy was continued at maintenance rates throughout this period. Pyrexia resolved within 48 h of institution of antimicrobial treatment. Intravenous medications were transitioned to orally administered enteral formulations 1 day prior to discharge.
Biochemistry was repeated at the time of discharge, at which point all clinical signs had resolved. This revealed a reduced ALT (201 IU/l), AST (50 IU/l) and total bilirubin (11.1 micromol/l). Haematology identified a moderate, left-shifted neutrophilia (22.03 x109 /l [RI 2.5-12.5 x109 /l]) that was considered likely due to postoperative inflammation. The remaining haematological parameters were unremarkable. Clinical and neurological examinations were repeated daily during hospitalisation and showed gradual improvement, and at the time of discharge the neurological abnormalities present at presentation had resolved in their entirety.
The cat remained on treatment with both potentiated amoxicillin (21 mg/kg PO q12h) and marbofloxacin (1.66 mg/kg PO q24h) for an initial 4 week course. At the time of the 4 week recheck, the ALT level was found to have increased mildly; therefore, these medication courses were extended for a further 4 weeks to a total of 8 weeks as a precaution. This decision was driven heavily by the reported poor prognosis in previous cases of hepatic yersiniosis. At the time of the recheck the cat was otherwise well and no other biochemical or haematological changes were found. After this extension, the marbofloxacin was withdrawn and the potentiated amoxicillin maintained for a further 4 weeks before this and the SAMe/silybin were withdrawn. The cat remained clinically well, with no changes in biochemical parameters and therefore it was considered that no further treatment was required.
The cat was seen for multiple rechecks over the following 14 months. At all appointments it was reported to be clinically normal, and clinical and neurological examinations identified no abnormalities. Biochemistry was monitored on each occasion (Table 1). All haematological parameters remained within normal limits from the time of discharge. The cat remains alive and free of clinical signs at 23 months post-diagnosis. | yersinia pseudotuberculosis, yersiniosis, hepatitis | Not supported with pagination yet | null |
PMC3399432_01 | Male | 29 | A 29 year old male presented to the Emergency Department with a one week history of painful jaundice, nausea, lethargy, fevers and rigors. He had latent tuberculosis but had otherwise been well and did not consume alcohol. Upon examination he was febrile, icteric and tender in the right upper quadrant with a temperature of 39 degrees Celsius. Liver function tests were abnormal as follows: bilirubin 212 mumol/L (RR 2-14 muumol/L), alkaline phosphatase 242 U/L (RR 40-130 U/L), alanine transaminase 75 U/L (RR 8-40 U/L), gamma glutamyl transferase 295 U/L (RR 0-50 U/L). International Normalised Ratio was 1.4. Full blood examination demonstrated anaemia with a haemoglobin of 119 g/L (RR 130-180 g/L) and thrombocytopenia with platelets 109 x 109/L (RR 150-400 x 109/L). Electrolytes were normal and serological tests for viral hepatitides, human immunodeficiency virus, schistosomiasis, strongyloides, malaria and fasciola were negative. An abdominal ultrasound showed gross biliary duct dilatation with sludge in the gallbladder. The portal vein was mildly dilated at 1.4 cm diameter but flow within the lumen was anterograde with no sign of portal venous obstruction or thrombosis.
A subsequent contrast-enhanced computed tomography (CT) scan of the abdomen showed dilatation of the portal vein in the region of the bifurcation, with collateral portal varices causing compression of the proximal common bile duct (CBD) (Fig. 1). A magnetic resonance cholangio-pancreatogram (MRCP) confirmed these findings and demonstrated intrahepatic bile duct dilatation with a beaded appearance, especially in the left lobe (Figs. 2 and 3). Splenic vein dilatation was also noted with concomitant splenomegaly, and the sludge previously visualised in the gallbladder was seen to extend into the CBD. A liver biopsy showed non specific changes consistent with biliary obstruction, periportal fibrosis and no cirrhosis.
This patient had cholangitis secondary to biliary tract obstruction. While biliary sludge likely contributed to the obstruction, this patient also exhibited radiological evidence of portal hypertension resulting in varicosed portal venous collaterals compressing adjacent intrahepatic and extrahepatic bile ducts:a rare phenomenon termed 'portal biliary ductopathy' (PBD). The cause of portal hypertension in this patient is believed to be idiopathic portal hypertension. He has undergone multiple placements of biliary stents via endoscopic retrograde cholangio-pancreatography (ERCP) since his initial presentation complicated by recurrent structuring, cholangitis and ERCP-related pancreatitis. Furthermore, as a result of portal hypertension, he has developed oesophageal varices necessitating endoscopic banding and internal haemorrhoids causing intermittent per-rectal bleeding. He is currently planned for insertion of a portosystemic shunt. | mrcp, biliary obstruction, biliary stenting yeoh, cholangitis, portal hypertension | Not supported with pagination yet | null |
PMC6224867_01 | Male | 73 | A 73-year-old man with several weeks of progressive dysphagia, cough, and hoarseness presented with difficulty tolerating oral intake, with coughing immediately after ingestion of solids and liquids. He denied hematemesis, hemoptysis, or weight loss. He had several hospitalizations for recurrent pneumonia, requiring intermittent antibiotics, inhalers, and steroids. He also had a large empyema requiring video-assisted thoracoscopic surgery several months prior to presentation. He was a former 10 pack-per-year smoker who quit 20 years prior; he had worked as a dental technician with significant exposure to silica. He served in the Navy and was stationed in Cuba for several years, where he worked in the shipyards. His medical history included obstructive lung disease requiring home oxygen, bronchiectasis, gastroesophageal reflux, and silicosis.
On physical exam, the patient was afebrile and in no acute respiratory distress. His vital signs were blood pressure 108/66 mm Hg, heart rate 107 beats per minute, respiratory rate 20 breaths per minute, with oxygen saturation 95% on 3 L nasal cannula. He was a slender, well-appearing male, with no oropharyngeal findings, halitosis, tracheal deviation, or elevated jugular venous pressure. He had a notably hoarse, soft-spoken voice, and rales were auscultated throughout both lung fields. Abdominal exam was unremarkable with no abdominal distension, tenderness on palpation, masses, or hepatosplenomegaly. The rest of the physical exam and labs were unremarkable. Tuberculosis and human immunodeficiency virus tests were also negative.
A swallowing evaluation was performed initially with a modified barium-swallow test, which showed moderate oropharyngeal dysphagia to solids. Aspiration occurred after the completed swallow, triggering cough and reflux of materials into the oral cavity. On chest radiograph, there were bilateral calcified hilar lymph nodes and opacities in the mid to upper lung fields consistent with his diagnosis of silicosis (Figure 1). Esophagogastroduodenoscopy revealed no esophageal abnormalities or a fistulous tract. A formal barium upper GI swallow study demonstrated a widely patent fistula between the mid-esophagus and bronchus intermedius, with contrast extending into the right lower-lobe bronchi (Figure 2). Mediastinal calcifications were also seen, consistent with silicosis. Chest computed tomography confirmed an 8-mm fistula extending from the subcarinal region into the esophagus, with progressive massive fibrosis and traction bronchiectasis in the upper lobes (Figure 3).
Esophageal stenting of the fistula was performed via endoscopy but was complicated by stent migration and eventual removal. An open partial esophagectomy was performed as definitive management. A month after surgery, the patient was tolerating small amounts of food by mouth without dysphagia or cough. | null | Not supported with pagination yet | null |
PMC7471824_01 | Female | 70 | A 70-year-old Japanese woman who was previously healthy developed progressive paraplegia without a history of injury in the last 2 months. She thus came to our hospital for evaluation. The neurologic findings showed bilateral lower extremity muscle weakness (American Spinal Injury Impairment Scale C level) and severe hypalgesia and paresthesia at the T6-7 level. Severe compression to the spinal cord by osteolytic destruction of spinal vertebrae at T6-7 was demonstrated by computed tomography (CT) and magnetic resonance imaging (MRI) (Figures 1(a) and 1(b)). There were no fevers, and the laboratory data showed no elevation in the white blood cell count (WBC; 5450/mul) or CRP (0.23 mg/dl). The patient accepted emergency surgery for the progressive paraplegia. A T4-9 posterior decompression and fusion with a T6-7 laminectomy were performed (Figure 1(c)). Although the pathology from the extirpated pedicle and lamina revealed inflammatory cell infiltrate without malignant tumor cells, the positron emission tomography-computed tomography (PET-CT) showed upregulation of the thyroid gland and aspiration cytology showed papillary adenocarcinoma of the thyroid. Thus, she was diagnosed with spinal metastases from a thyroid carcinoma. Although we explained the additional treatment of total spondylectomy (anterior and posterior) after the thyroidectomy, she declined additional surgery because the paraplegia improved significantly; however, 9 months after the primary surgery, she returned to our hospital with reprogressive paraplegia. Spinal cord compression by progression of osteolytic destruction of the T5-6-7 vertebrae with loosening of all pedicle screws was noted on MRI and CT (Figures 2(a) and 2(b)). The laboratory data showed elevation of CRP (11.64 mg/dl) without elevation of WBC (6470/mul). Furthermore, a coin lesion in the right lung was observed (Figure 2(c)). Tuberculosis was suspected, and a CT-guided needle biopsy and culture were performed by the radiologist. Although a polymerase chain reaction was negative, Mycobacterium tuberculosis was detected from tissue culture. As a result, spinal tuberculosis was diagnosed. Two-stage surgeries (posterior and anterior) were performed, and antituberculosis medications (isoniazid, rifampicin, pyrazinamide, and ethambutol) were administered. In the first stage, a T1-10 posterior decompression and fusion with posterior drainage were performed. In the second stage, a T6-7-8 corpectomy, anterior drainage, and reconstruction with an expandable cage were performed (Figure 3(a)). Both neurologic function and laboratory data gradually improved after surgery. At the final follow-up 1 year after surgery, she could walk with a crutch, the laboratory data had returned to a normal level (CRP: 0.07 mg/dl), and complete fusion of T5-9 was observed on CT that showed healing of the spinal tuberculosis (Figure 3(b)). | null | Not supported with pagination yet | null |
PMC7085867_01 | Female | 27 | A 27-year-old female presented to the urgent care with 3 days of fever, generalized myalgia, and sore throat. At the urgent care, she did not receive antibiotics and was symptomatically managed. Her sore throat improved in a day but developed neck pain and hematuria that prompted her to visit emergency department (ED) after 2 days. She denied any other symptoms or any significant past medical history.
On general examination, she was alert, oriented to time, place, and person. She was febrile 101 F, stable blood pressure, stable heart rate, and SaO2 of 98% on room air. The patient had nonexudative erythematous pharynx and lateral neck tenderness. On auscultation, a systolic flow at the left upper sternal border and bilateral diffuse crackles in the lungs were heard. Splenomegaly was absent. Neurological examination was intact.
On admission, the laboratory study showed a white cell count of 21.6 x 103 cells/microL with 89.5% neutrophils, positive left shift, platelet of 9 x 103/microL, and hemoglobin of 10.0 g/dL with normal mean corpuscular volume. The reticulocyte count was normal, lactate dehydrogenase (LDH) was 210 U/L, and haptoglobin was 306 mg/dL. A peripheral smear showed normal red blood cell morphology, toxic granulation, and few giant platelets. Renal function showed increased blood urea nitrogen (BUN) 57 mg/dl, increased creatinine 3.43 mg/dl, and decreased eGFR 16 ml/min/1.73 m2 and sodium 131 mEq/l. Urinalysis showed gross hematuria with no RBC cast and negative nitrite/esterase. Arterial blood gas analysis revealed respiratory alkalosis with pH 7.482, pCO2 30, normal bicarbonate, and anion gap.
Infectious workup includes blood culture positive for Fusobacterium nucleatum and negative rapid streptococcal test, throat culture, monospot test. Fecal leukocytes and ova/parasites tests were negative. A fungal workup was negative for histoplasma, blastomycosis, cryptococcus, and tuberculosis.
An initial chest X-ray is shown in Figure 1.
Positive findings on chest CT and MRI venogram are shown in Figures 2 and 3, respectively. CT abdomen/pelvis and transthoracic echocardiography findings were normal.
Venous imaging to see septic thrombophlebitis include upper extremity/neck venous duplex is shown in Figure 4.
Partial thromboplastin time was 26.4 seconds, D-dimer was 1223 ng/ml DDU, and fibrinogen was 752 mg/dL. The anticardiolipin antibody was positive, with an IgM level of 15.7 and low protein C with a level of 51 (normal 74-150%). An autoimmune workup for secondary causes of hypercoagulation was ruled out including lupus, factor-V Leiden mutation, and malignancy.
The patient was initially managed with fluids, broad-spectrum antibiotics such as meropenem and bridging mechanical ventilation in the intensive care unit. After imaging and blood culture were suggestive of Lemierre's syndrome, the patient was immediately started on piperacillin/tazobactam 4.5 gm IV 6 hourly and heparin drip with a goal aPTT of 60-80 seconds. The patient's symptoms significantly improved with this antibiotic regimen and anticoagulation. Heparin was switched to warfarin with a goal INR of 2-3, and piperacillin/tazobactam switched to clindamycin 300 mg q6hr with probiotic for 3 weeks for extended coverage of infection.
During the 2 months of follow-up, the patient had a complete resolution of symptoms, a positive beta-glycoprotein but normal IgM level. The patient was then scheduled for repeat MRI venogram in three months. | null | Not supported with pagination yet | null |
PMC6282426_01 | Male | 44 | A 44-year-old man with an active smoking history of 50 pack-years was referred to the local Department of Respiratory Medicine due to at least 1 year of declining general condition with recurrent episodes of acute respiratory worsening interpreted as pneumonias, weight loss of 10 kg, fatigue, dry cough, and progressive dyspnea. The patient had a noteworthy alcohol intake of approximate 49 units per week. He was working in an office environment and had, besides smoking, no other exposures. At physical examination finger clubbing was observed, and lung auscultation revealed bibasilar crackles.
Spirometry showed a forced expiratory ventilation in 1 sec (FEV1) of 2.79 l (69% of predicted) and a forced vital capacity (FVC) of 4.04 l (81% of predicted) with an index of 69%. The diffusion capacity (diffusion capacity of the lung for carbon monoxide, DLCO) and coefficient (KCO) was 22%/32%, respectively. At rest, oxygen saturation was between 84 and 90% on room air, and a 6 min walking test with a walking distance of 490 m caused a significant desaturation of nine percent points from 89 to 78%. Biochemistry showed elevation of lactate dehydrogenase (339 U/l; reference 105-205 U/l). Repetitive chest x-rays (CXR) showed a reticular pattern and bilateral infiltrates (Figure 1). High-resolution computed tomography (HRCT) of the thorax showed interlobular septal thickening with diffuse as well as interlobular ground glass opacities (GGOs) with fluctuating consolidation presenting in a 'crazy paving' pattern (Figure 2). A following bronchoalveolar lavage (BAL) revealed a milky white BAL fluid. Microbiological analyses of BAL were either normal or negative. Supplemental transbronchial biopsies (TBB) performed during bronchoscopy revealed intraalveolar accumulation of a proteinaceous material, which was consistent with the diagnosis PAP (Figure 3). A subsequent blood sample confirmed the diagnosis of autoimmune PAP due to positive anti-GM-CSF (granulocyte-macrophage colony-stimulating factor) antibodies. | gm-csf, hrct, pap, wll, crazy paving, granulocyte-macrophage colony-stimulating factor, pulmonary alveolar proteinosis, rare lung disease, whole lung lavage | Not supported with pagination yet | null |
PMC4769046_01 | Male | 13 | A 13 year-old Tunisian male was admitted in our department of paediatric nephrology on October 2009 with a week-history of fever and asthenia. He was suffering from end-stage renal failure attributed to a vesico-ureteral reflux discovered in 2003. In 2007, the patient had a pre-emptive renal transplant from a living donor. The post-operative course was characterised by an acute ischemia of the transplant due to a venous renal thrombosis that lead to a detransplantation. A regular peritoneal dialysis was initiated on June 2007. A second renal transplantation was performed on June 2009 from a 27 year-old deceased donor. The post operative course was uneventful. The patient was maintained on Prednisone 10 mg/day, mycophenolate mofetil 1500 mg/day, and Cyclosporine 75 mg twice per day with adequate renal function. Three months after transplantation, the patient was hospitalized in our department for fever with asthenia. The physical examination on admission revealed asthenic patient, with temperature of 38.5 C, blood pressure of 110/70 mm Hg, pulse rate of 90 /min, and inspiratory rhonchi with decreased breath sound over both bases. There were no peripheral lymph nodes or hepatosplenomegaly. Laboratory investigations revealed hematocrit of 38%, white blood cell count of 8300/mm3, platelet count of 220.000/mm3, blood urea nitrogen of 6.8 mmol/l, serum creatinine level of 75 micromol/l, C reactive protein serum level of 88.5mg/l and erythrocyte sedimentation rate of 51 mm/hour. Liver function tests and lipid profile were normal. The protein electrophoresis showed a total protein serum level of 65g/l, (Albumin 33.9g/l, alpha1 globulin 5.8g/l, alpha2 globulin 9.6g/l, beta1 globulin 3.9g/l, beta2 globulin 3.4g/l, gamma globulin 8.3g/l). The chest x-ray revealed opacity in the right middle zone and superior mediastinal enlargement (Figure 1). A thoracic CT scan showed cavitatory pneumonia of the right lower lobe and anterior mediastinal mass on right and left main stem bronchi corresponding to lymph nodes (Figure 2 and Figure 3). Regarding the clinical, biological and radiological findings, three diagnoses were suspected: pneumonia, pulmonary tuberculosis and pulmonary aspergillosis. By considering the history of the patient and the fact that our country is endemic, our diagnosis was quickly directed towards pulmonary tuberculosis despite the negativity of tuberculin skin test. The search of mycobacterium tuberculosis by gastric tubing was negative but the diagnosis was made by the study of sputum specimens aspirated during bronchoalveolar lavage that revealed the presence of mycobacterium tuberculosis. In vitro studies showed the organisms to be fully susceptible to all antituberculosis drugs. Four drugs, isoniazid (INH), Rifadine (RIF), Ethambutol(EMB) and pyazolin( PZA) were administered orally with the usual doses. The dose of corticosteroids was increased and that of cyclosporine was adjusted to maintain trough plasma levels in recommended therapeutic range. To prevent the neurological side effects of INH we prescribed a pyridoxine in dose of 50 mg per day. The Outcome under antitubercular therapy has so far been favourable, with prolonged apyrexia and regression of the pulmonary abnormalities. This regimen, maintained during 18 months, was well tolerated without any modification in liver tests and graft function. | pulmonary tuberculosis, child, renal failure, renal transplantation | Chest computed tomography: anterior mediastinal mass on right and left main stem bronchi. |
|
PMC4769046_01 | Male | 13 | A 13 year-old Tunisian male was admitted in our department of paediatric nephrology on October 2009 with a week-history of fever and asthenia. He was suffering from end-stage renal failure attributed to a vesico-ureteral reflux discovered in 2003. In 2007, the patient had a pre-emptive renal transplant from a living donor. The post-operative course was characterised by an acute ischemia of the transplant due to a venous renal thrombosis that lead to a detransplantation. A regular peritoneal dialysis was initiated on June 2007. A second renal transplantation was performed on June 2009 from a 27 year-old deceased donor. The post operative course was uneventful. The patient was maintained on Prednisone 10 mg/day, mycophenolate mofetil 1500 mg/day, and Cyclosporine 75 mg twice per day with adequate renal function. Three months after transplantation, the patient was hospitalized in our department for fever with asthenia. The physical examination on admission revealed asthenic patient, with temperature of 38.5 C, blood pressure of 110/70 mm Hg, pulse rate of 90 /min, and inspiratory rhonchi with decreased breath sound over both bases. There were no peripheral lymph nodes or hepatosplenomegaly. Laboratory investigations revealed hematocrit of 38%, white blood cell count of 8300/mm3, platelet count of 220.000/mm3, blood urea nitrogen of 6.8 mmol/l, serum creatinine level of 75 micromol/l, C reactive protein serum level of 88.5mg/l and erythrocyte sedimentation rate of 51 mm/hour. Liver function tests and lipid profile were normal. The protein electrophoresis showed a total protein serum level of 65g/l, (Albumin 33.9g/l, alpha1 globulin 5.8g/l, alpha2 globulin 9.6g/l, beta1 globulin 3.9g/l, beta2 globulin 3.4g/l, gamma globulin 8.3g/l). The chest x-ray revealed opacity in the right middle zone and superior mediastinal enlargement (Figure 1). A thoracic CT scan showed cavitatory pneumonia of the right lower lobe and anterior mediastinal mass on right and left main stem bronchi corresponding to lymph nodes (Figure 2 and Figure 3). Regarding the clinical, biological and radiological findings, three diagnoses were suspected: pneumonia, pulmonary tuberculosis and pulmonary aspergillosis. By considering the history of the patient and the fact that our country is endemic, our diagnosis was quickly directed towards pulmonary tuberculosis despite the negativity of tuberculin skin test. The search of mycobacterium tuberculosis by gastric tubing was negative but the diagnosis was made by the study of sputum specimens aspirated during bronchoalveolar lavage that revealed the presence of mycobacterium tuberculosis. In vitro studies showed the organisms to be fully susceptible to all antituberculosis drugs. Four drugs, isoniazid (INH), Rifadine (RIF), Ethambutol(EMB) and pyazolin( PZA) were administered orally with the usual doses. The dose of corticosteroids was increased and that of cyclosporine was adjusted to maintain trough plasma levels in recommended therapeutic range. To prevent the neurological side effects of INH we prescribed a pyridoxine in dose of 50 mg per day. The Outcome under antitubercular therapy has so far been favourable, with prolonged apyrexia and regression of the pulmonary abnormalities. This regimen, maintained during 18 months, was well tolerated without any modification in liver tests and graft function. | pulmonary tuberculosis, child, renal failure, renal transplantation | Chest computed tomography: cavitatory pneumonia of right lower lobe. |
|
PMC7873883_01 | Male | 42 | A 42-year-old Caucasian male was admitted to our Hospital referring a 4-month history of gradually increasing upper left quadrant pain. His medical history included bladder neck sclerosis, cholecystectomy, diabetes insipidus, hypogonadotropic hypogonadism, allergic asthma, and a smoking history until 10 months before this admission. The medical examination did not show any relevant features and, therefore, the subsequent diagnostic work-up continued with abdominal US.
Abdominal US showed multiple hypoechoic splenic and hepatic lesions ranging from 5 to 27 mm and, therefore, the patient underwent total body CT scan for a correct lesions characterization and staging. CT scan demonstrated bilateral hilar lymphadenopathies in the chest, pulmonary perilymphatic micronodules, enlarged retroperitoneal lymph nodes, and confirmed the hepatic and splenic lesions (Figures 1A,B). The first diagnostic hypothesis was the lymphoma and a 18F-Fludeoxyglucose (18F-FDG) PET/CT was performed, showing increased 18F-FDG uptake (standardized uptake value (SUV) max=17 at the chest hilar lymphadenopathies level) in all the lesions revealed on CT (Figure 1C). Moreover, a focal uptake was detected in left testis (Figure 1D). A brain MRI excluded central nervous system involvement. Lymphopenia was the only abnormal blood cell count value. Alpha-fetoprotein (AFP), Human chorionic gonadotropin (HCG), Aspartate aminotransferase (AST), Alkaline phosphatase (ALP) were within their normal ranges, while alanine aminotransferase (ALT) (55 U/L), gamma-glutamyl transferase (GGT) (60 U/L), C-reactive protein (CRP) (0.82 mg/dL) and Erythrocyte sedimentation rate (ESR) (20 mm) were mildly elevated. Moreover, Angiotensin Converting Enzyme (ACE) levels were elevated (95 U/L). He had no history or signs of tuberculosis (QuantiFERON -TB Gold Plus test was negative).
These findings raised the suspicion of lymphoma or sarcoidosis. An endobronchial ultrasound-guided transbronchial needle aspiration (EBUS-TBNA) was performed on the chest hilar lymphadenopathies, showing non-caseating granulomas, consistent with sarcoidosis. Stains for acid-fast bacilli and polymerase chain reaction (PCR) in specimens were negative. The final diagnosis was sarcoidosis with multiorgan involvement. A testicular US evaluation was carried out using a Canon-Toshiba Aplio 500TM (Otawara, Kanto, Japan) with a high frequency (4-14 MHz) linear transducer. The US demonstrated, using the B-mode evaluation, a hypoechoic lesion of 20 mm with ill-defined margins in the left testis (Figure 2A) corresponding to the lesion identified on PET-CT; moreover, differently from the latter technique, the US identified a smaller and well-shaped hypoechoic lesion also in the right testis (6 mm). The Color Doppler demonstrated the presence of vascular flow within the lesions (Figure 2B). Therefore, it was decided to perform CEUS, conducted with the administration of 4.8 ml of second-generation contrast media (SonoVue , Bracco, Milano, Italy) followed by 10 mL of 0.9% saline solution. Both the testicular lesions demonstrated the same pattern on CEUS. In particular, during the arterial phase, the masses showed a hypovascular appearance as compared to the surrounding testicular tissue (Figure 2C), maintaining the hypo-enhancement in the late phase. This CEUS pattern was not typical of the most frequent testicular tumors such as seminomas, which usually are arterialized appearing hyperechoic on CEUS. Finally, the imaging diagnosis was testicular sarcoidosis, based principally on bilateral involvement of testes on CEUS and on the CEUS pattern (hypoenhancement). Testicular sarcoid involvement was confirmed by surgical biopsy of both testicular masses that demonstrated non-caseating granulomas.
The patient was treated with corticosteroids and then with a second-line therapy (methotrexate), thus achieving a reduction of the SUVmax in all of the sarcoid lesions (SUVmax = 2.6 at the testicular level) at 6- and 12-month PET/CT follow-up.
According to our review (Table 1), from 2004 until now we have identified 20 cases (including the present one) of testicular sarcoidosis. Finally, to date, the total number of histologically proven testicular sarcoidosis published in literature account for 48 cases. | andrology, contrast media, sarcoidosis, ultrasonography, urology | Not supported with pagination yet | null |
PMC7596014_01 | Female | 61 | The patient granted permission for the publication of this case report.
A 61-year-old woman was referred to our hospital 3 years after undergoing surgery for a left trimalleolar fracture of the ankle due to a road traffic accident. She underwent immediate open reduction and internal fixation at a local hospital. Left ankle pain persisted and about 10 months after the primary surgery she developed numbness along the medial aspect of the left ankle and over the sole of the foot. The implants were removed at about 1 year after the primary surgery, but the left ankle pain did not improve and the numbness worsened. She was referred to us for further investigation.
Her main complaint was a tingling/reduced sensation and paresthesia on the plantar and medial aspects of the forefoot to the middle foot area along the main distribution of the medial plantar nerve. There was tenderness and swelling over the ankle joint and the proximal posterior aspect of the medial malleolus (Fig. 1). Tinel's-sign was positive over the proximal posterior aspect of the medial malleolus. No motor deficit or deformity of the toes was detected. Plain radiographs revealed severe joint space narrowing between the tibia and talus, indicating osteoarthritic change in the left ankle in the standing position on anterior-posterior view (Fig. 2a) and lateral view (Fig. 2b). Computed tomography (CT) images showed an osteophyte of the posteromedial aspect of the distal tibia on coronal view (Fig. 3a) and axial view (Fig. 3b) and on three-dimensional (3D) CT imaging (Fig. 3c). Magnetic resonance (MR) images showed the osteophyte impinging on the tibial nerve on T1-weighted (Fig. 4a), T2-weighted (Fig. 4b), and short T1 inversion recovery (STIR) images (Fig. 4c) on coronal view, and on T2 (Fig. 4d) and STIR (Fig. 4e) images on axial view.
We diagnosed TTS with traumatic osteoarthritis of the ankle. Therefore, we opted to perform excision of the osteophyte to decompress the tibial nerve and ankle arthroscopic arthrodesis because endoscopic techniques can accelerate recovery and reduce morbidity compared with the open procedure. The preoperative Japanese Society for Surgery of the Foot (JSSF) score was 30/100 points (pain 0/40, function 20/50, alignment 10/10).
The patient was positioned supine with the affected limb in a stirrup and traction in place. Two standard portals (anterolateral and anteromedial) were used. Fibrous tissue was seen filling the ankle joint space (Fig. 5a) and synovitis was severe. The fibrous tissue was removed and synovectomy was performed with an arthroscopic shaver. Cartilage was almost completely denuded and subchondral bone was exposed at the articular surface of the tibial plafond and talar trochlea (Fig. 5b). Using a surgical abrader, we denuded all remaining articular cartilage and established beds of bleeding cancellous bone (Fig. 5c). A curvilinear incision was then placed along the course of the tibial nerve posterior to the medial malleolus. Fixation between the distal tibia and talus was established using 3 cannulated partially threaded screws. After fixation, the flexor retinaculum was released, exposing the osteophyte in the posteromedial side of the distal tibia pushing the tibial nerve from the anterior aspect (Fig. 6a). Scarring around the nerve was also noted with redness and swelling of the nerve. The osteophyte was removed (Fig. 6b). CT images soon after surgery confirmed successful removal of the osteophyte on coronal view (Fig. 7a) and axial view (Fig. 7b) and on a 3D CT image (Fig. 7c).
A non-weightbearing below-knee cast was applied for 2 weeks for immobilization. This immobilization was maintained for another 2 weeks but with weightbearing permitted. After a total of 4 weeks of immobilization with the lower leg cast, the cast was removed and an ankle brace was attached to the left foot and ankle. The patient started a mobilization protocol with progressive passive and active range of motion exercises at 4 weeks after surgery. Bony union of the ankle was achieved about 6 weeks after surgery.
Two years after decompression of the right tarsal tunnel and neurolysis of the tibial nerve, the patient reported major improvements in the dysesthesia along the entire plantar surface of the foot. She was not taking any medication, as radiographs showed complete union between the tibia and the talus on weightbearing on antero-posterior view (Fig. 8a) and lateral view (Fig. 8b). There was no tenderness or swelling over the ankle joint or the proximal posterior level of the medial malleolus (Fig. 9). Tinel's sign was negative over the proximal posterior level of the medial malleolus. At that time, The JSSF score had improved to 89/100 points (pain 40/40, function 39/50, alignment 10/10). | ankle, arthroscopic arthrodesis, osteoarthritis, osteophyte, tarsal tunnel syndrome | Not supported with pagination yet | null |
PMC6381925_01 | Female | 75 | 75-year-old female patient, with no significant comorbidities or family history of cancer, presented to the Emergency Department with severe abdominal pain and progressive weight loss. Computed Tomography (CT) revealed multiple hepatic lesions, omental nodules and pancreatic mass. CA19-9 was 918 u/mL. Liver biopsy revealed poorly differentiated pancreatic carcinoma, mismatch repair (MMR) proficient, without BRCA1/2 mutations. Surprisingly, tumor mutation testing using next-generation-sequencing (NGS) panel discovered wildtype KRAS and pathogenic BRAF c.1799T>A (V600E) mutation. The patient received a single cycle of Oxaliplatin-based chemotherapy and decided not to pursue additional cycles due to poor tolerability. The case was presented at a multidisciplinary tumor board (MTB) and combination targeted therapy using Dabrafenib and Trametinib was suggested. The patient was given full dose therapy with Dabrafenib 150 mg twice daily with Trametinib 2 mg once a day. During treatment the patient had no apparent side effects. CA19-9 declined within a week from 2,774 to 1,687 u/mL. After 19 days on treatment schedule, the patient has arrived to the Emergency Department with severe abdominal pain. CT showed intra-peritoneal free air without obvious anatomic pathology involving the intestines. Disease extent evaluation was difficult due to lack of oral and intravenous contrast media. Sadly, the patient refused to undergo exploratory surgery and deceased within several hours. | braf, kras, pancreatic adenocarcinoma, ret, targeted therapy | Not supported with pagination yet | null |
PMC6381925_02 | Male | 56 | 56-year-old male was admitted for evaluation of prolonged abdominal pain and severe weight loss. He has congestive heart failure and no family history of cancer. CT scan revealed pancreatic mass, omental implants and multiple hepatic lesions. CA19-9 was within normal limits (18.5 u/mL). Liver biopsy exhibited poorly differentiated carcinoma, suitable for pancreatic origin. Again, the tumor was MMR-proficient, wild-type sequences of BRCA1/2. Due to low performance status and intermediate cardiac function, the patient started monotherapy with gemcitabine. Meanwhile, NGS panel discovered wildtype KRAS and BRAF c.1799_1801delTGA mutation, likely pathogenic according to ClinVar database. The case was discussed on MTB and the patient was advised to receive BRAF and MEK inhibitors on first sign of disease progression. Close cardiac monitoring was offered. As expected, metastatic progression was recorded and the patient started full dose Dabrafenib and Trametinib. After two weeks of treatment the patient developed severe unilateral interstitial lung disease. He received high dose steroids and all drugs except Dabrafenib were discontinued. The patient has recovered and resumed low dose Trametinib. The tumor was stable (per CT and CA19-9) for 3 months. However, after 3 additional months, just before his next evaluation the patient arrived to the Emergency Department in severe shock (probably septic) and passed away within minutes (post mortem analysis was not done). | braf, kras, pancreatic adenocarcinoma, ret, targeted therapy | Not supported with pagination yet | null |
PMC9890191_01 | Female | 53 | A 53-year-old Chinese female presented to the Emergency Department of our hospital for persistent abdominal pain and distension for over two months. Two months ago, the patient went to a local hospital and obtained a transvaginal ultrasound that revealed thickened bilateral fallopian, suggesting adnexitis. She was treated with antibiotics, but the pain persisted. The serum CA125 and CA724 levels were elevated (469U/ml and 33.4U/ml, respectively). Abdomen and pelvis computed tomography (CT) showed heterogeneous stomach and bilateral adnexal masses, suggesting adnexal lesions or the Krukenberg tumor. She was then referred to the emergency room of our hospital.
In our hospital, she received thorough examinations. A gynecological examination revealed an abdominopelvic mass with an unclear boundary. The transvaginal ultrasound showed a 3.9x2.3cm solid pelvic mass with ascites ( Figure 1A ; Supplemental Figures S1A, B ). The abdominal and pelvic enhanced CT, the pelvic magnetic resonance imaging (MRI), and the positron emission computed tomography (PET-CT) all revealed irregular, heterogeneous, and plump bilateral adnexal masses with diffusely thickened peritoneum, omentum, and mesangium, multiple soft-tissue nodules, slightly thickened intestinal wall, abdominal and pelvic effusion, and multiple enlarged lymph nodes ( Figures 1B-E ; Supplemental Figures S1C-F ). The serum CA125 level was 439U/mL. The chest X-ray showed no abnormality. The patient underwent bilateral tubal sterilization more than 20 years ago and was found with a Helicobacter pylori infection two months ago. She went into natural menopause for one year and gave birth to two children. Personal and family history were unremarkable.
Considering the possibility of ovarian or gastrointestinal malignancies, the patient was admitted to our hospital. After admission, the patient developed aggravated abdominal distension with an increase in body temperature to 39C. After four days of intravenous anti-inflammatory, the patient underwent diagnostic laparoscopy with omentum and peritoneum biopsies in a stable condition, which suggested poorly differentiated carcinoma according to intraoperative consultation. About 2 liters of tawny ascites were drained for cytology confirmation during the operation, which revealed no tumor cells. The surgical findings showed multiple white granular tumor implants studding the omentum, peritoneum, and the surface of the diaphragm, liver, intestine, and uterus. A 9x9x3cm omental cake enclosed part of the intestine and was fixed. The omentum and intestine obscured bilateral ovaries and fallopian tubes. Combined with laboratory, imaging, and surgical findings, the possibility of advanced (stage IV) ovarian cancer was considered. Given the difficulty in performing satisfactory cytoreductive surgery, the patient was treated with three cycles of neoadjuvant chemotherapy with Paclitaxel-albumin, Carboplatin, and Bevacizumab.
After chemotherapy, the patient's serum CA125 level was reduced to 107 U/mL. Imaging examination showed reduced abdominal and pelvic effusion, while abdominopelvic lesions were roughly the same as before ( Supplemental Figure S2 ). The pathological findings of the previous operation excluded the common types of epithelial ovarian carcinoma, breast carcinoma, and neuroendocrine neoplasm. Still, the diagnosis could not be confirmed due to the poor differentiation characteristics of the tumor cells. Upper GI endoscopy and colonoscopy were performed to distinguish gastrointestinal tumors, but no mucosal lesions were identified ( Supplemental Figure S3 ). The patient further underwent cytoreductive surgery, which showed a 20x10x4cm extensive gritty nodular omental cake densely adhered to the pelvic wall and part of the intestine and mesentery ( Supplemental Figure S4A ). The mesostenium and mesocolon were extensively thickened with contracture and stiff morphology. A heterogeneous mass about 2.5cm in diameter was found on the surface of the small intestine. The posterior wall of the uterus closely adhered to the rectum, and bilateral ovaries were enlarged with a solid nodular appearance ( Supplemental Figure S4B ). Total hysterectomy and bilateral salpingo-oophorectomy were performed. The omentum, small intestinal mass, and left pelvic lymph nodes were also removed. All specimen was submitted for pathological confirmation. It was an unsatisfactory cytoreductive surgery (R2), with the postoperative residuals being the diffuse thickened malignancy lesions in the mesentery. The patient recovered in a stable condition without any complications and was discharged home 13 days after surgery.
Microscopic examination showed malignancy infiltration in bilateral ovaries involving the omentum, peritoneum, mass on the small intestine surface, and the serosa of the uterus and bilateral fallopian tubes. The tumor cells were uniform monotonous medium-sized round and oval with small-to-moderate eosinophilic cytoplasm, enlarged nuclei, high nuclear/cytoplasmic ratio, and uneven chromatin ( Figure 2A ). Lymphatic vascular involvement and lymph node metastases were frequently observed ( Figure 2B ). Solid sheets and nests of typically undifferentiated cells infiltrating surrounding normal omental tissue were present, with no abrupt keratinization ( Figure 2C ). Comparing the two surgical specimens, there was no significant regression of tumor cells after neoadjuvant chemotherapy ( Figures 2C, D ). Malignancy infiltration was found on the serosa of the uterus, while typical structures of the endometrium and myometrium remained, suggesting that it was not a primary uterine neoplasm ( Figure 2E ). It is noteworthy that although the malignancies significantly infiltrated the ovary, most of the ovarian cortical and corpus albicans were intact. The lesions were mainly close to the ovarian hilus and surrounded by large blood vessels ( Figure 2F ), so the possibility of secondary ovarian malignancy cannot be excluded.
IHC was conducted to help confirm the diagnosis ( Table 1 ). Tumor cells positively expressed monoclonal ER, INI1(SMARCB1), BRG1(SMARCA4), and ARID1a, with patchy expressions of monoclonal PR, P16, Syn, SATB2, and CK8/18. The beta-Catenin and P120 were positive in the cytoplasm. The Ki-67 labeling index was approximately 30%. There was no expression of CK pan ( Figure 2G ), p40 ( Figure 2H ), p63 ( Figure 2I ), and other IHC markers (i.e., CD56, CK7, WT-1, TTF-1, Desmin, C-myc, CgA, CDX2, INSM1, SSTR2, SSTR5). Details of all the IHC results were listed in Table 1 . Based on the morphological and IHC features, 14 malignancies with similar morphology were compared, including ovarian serous carcinoma, ovarian clear cell carcinoma, ovarian germ cell neoplasms, ovarian sex cord-stromal neoplasms, neoplasms associated with the SWI/SNF complex, colorectal carcinoma, invasive lobular carcinoma of the breast, poorly differentiated hepatic cholangiocarcinoma, low grade endometrial stromal sarcoma, high grade endometrial stromal sarcoma, rhabdomyosarcoma, malignant peripheral nerve sheath tumors, histiocytic sarcoma, and plasmacytoma ( Table 2 ). Additionally, to distinguish it from Ewing sarcoma, dual-color break-apart FISH was conducted to test for EWSR1 gene rearrangements, which revealed a negative result.
Finally, we conducted NUT immunostaining (clone C52B1) and revealed diffusely positive expression in the nucleus of tumor cells ( Figure 2J ). However, the FISH experiment found no disruption or translocation of the NUTM1 gene locus ( Figure 2K ). We subsequently identified the gene fusion of MXI1 exon 5 (NM_130439.3) to NUTM1 exon 3 (NM_175741.3) via a targeted RNA-based NGS platform (DA8600, Daan Gene, Guangzhou, China) on tissue samples, which finally confirmed NUT carcinoma two months after cytoreductive surgery ( Figure 2L ). Besides, we also identified the gene fusion of MTMR3 exon 5 (NM_021090.4) to SFI1 exon 3 (NM_001007467.3).
One week after diagnosis, the patient developed fever and an increased burden of malignancy, with imaging of advanced diffusely thickened peritoneum, omentum, and mesangium, progressed multiple metastatic lymph nodes, and newly developed abdomino pelvic effusion. Unfortunately, although the patient was adequately informed and the potential feasibility of antitumor therapy was introduced, the patient refused further treatment due to financial difficulties and decided to be discharged to a local hospital for symptomatic relief and supportive treatment. She developed systemic symptoms and passed away four months and 18 days after cytoreductive surgery ( Figure 3 ). | nut carcinoma, nut rearrangement, case report, ovarian neoplasms, undifferentiated pelvic neoplasms | Not supported with pagination yet | null |
PMC8627817_01 | Male | 78 | A 78-year-old man non-smoker presented with a 1-week history of cough and blood-tinged sputum. There was no history of tuberculosis. A physical examination was unremarkable. The arterial blood pressure was 100/70 mm Hg, pulse 86/min, respiratory rate 20/min, temperature 37.7C, and SpO2 (arterial oxygen saturation) 95%. The laboratory data at admission: hemoglobin 13.8 g/dL, white blood cell 7.16x109/L, platelets 204x109/L, and high-sensitive C-reactive protein 0.8 mg/L (<3.0 mg/L).
Chest computed tomography (CT) showed nodularity, irregularity, and stenotic changes in the mucosa with areas of ossification throughout the tracheal lumen as well as in both main bronchi (Fig. 1). Emphysematous changes were observed throughout the lung. Faint ground-glass opacity (GGO), mild reticulation, and honeycombing cystic changes were observed in the subpleural area of both lower lobes (Fig. 2A). Two years later, follow-up CT showed interval increased extent of honeycombs, subpleural reticulation, and GGO in both lower lobes, indicating progression of ILD (Fig. 2B).
Flexible bronchoscopy was performed for a tracheal biopsy and to evaluate ILD. The biopsy findings for the trachea showed calcification in the mucosa and ossification in the submucosa (Fig. 3A). The histological examination was consistent with TPO. An analysis of the BAL fluid showed a total white blood cell area of 220 mm3, including 13% neutrophils, 13% lymphocytes and 71% macrophages.
For the diagnosis, we performed a surgical lung biopsy, and the results showed diffuse interstitial fibrosis with focal fibroblastic proliferation and lymphocytic infiltration, suggesting possible usual interstitial pneumonia. Four years after the initial presentation, the patient was re-admitted with symptoms of cough. The previously noted multifocal honeycombs and subpleural reticulations were aggravated on chest CT. We performed flexible bronchoscopy again. There were no microorganisms identified. Compared with the previous findings, the lesions of TPO throughout the tracheal lumen had also progressed (Fig. 3B). | fibrotic interstitial lung disease, pathogenesis, tracheobronchopathia osteochondroplatica, transforming growth factor beta | At the time of the diagnosis, CT showed mild subpleural reticulation, ground-glass opacity and bronchiectasis in the left lower lobe medial basal segment (A). |
|
PMC8627817_01 | Male | 78 | A 78-year-old man non-smoker presented with a 1-week history of cough and blood-tinged sputum. There was no history of tuberculosis. A physical examination was unremarkable. The arterial blood pressure was 100/70 mm Hg, pulse 86/min, respiratory rate 20/min, temperature 37.7C, and SpO2 (arterial oxygen saturation) 95%. The laboratory data at admission: hemoglobin 13.8 g/dL, white blood cell 7.16x109/L, platelets 204x109/L, and high-sensitive C-reactive protein 0.8 mg/L (<3.0 mg/L).
Chest computed tomography (CT) showed nodularity, irregularity, and stenotic changes in the mucosa with areas of ossification throughout the tracheal lumen as well as in both main bronchi (Fig. 1). Emphysematous changes were observed throughout the lung. Faint ground-glass opacity (GGO), mild reticulation, and honeycombing cystic changes were observed in the subpleural area of both lower lobes (Fig. 2A). Two years later, follow-up CT showed interval increased extent of honeycombs, subpleural reticulation, and GGO in both lower lobes, indicating progression of ILD (Fig. 2B).
Flexible bronchoscopy was performed for a tracheal biopsy and to evaluate ILD. The biopsy findings for the trachea showed calcification in the mucosa and ossification in the submucosa (Fig. 3A). The histological examination was consistent with TPO. An analysis of the BAL fluid showed a total white blood cell area of 220 mm3, including 13% neutrophils, 13% lymphocytes and 71% macrophages.
For the diagnosis, we performed a surgical lung biopsy, and the results showed diffuse interstitial fibrosis with focal fibroblastic proliferation and lymphocytic infiltration, suggesting possible usual interstitial pneumonia. Four years after the initial presentation, the patient was re-admitted with symptoms of cough. The previously noted multifocal honeycombs and subpleural reticulations were aggravated on chest CT. We performed flexible bronchoscopy again. There were no microorganisms identified. Compared with the previous findings, the lesions of TPO throughout the tracheal lumen had also progressed (Fig. 3B). | fibrotic interstitial lung disease, pathogenesis, tracheobronchopathia osteochondroplatica, transforming growth factor beta | Two years later, follow-up CT showed an interval increased extent of subpleural fine reticulations, honeycomb and bronchiectasis in both lower lobe basal segments, suggesting the progression of underlying idiopathic pulmonary fibrosis (B). |
|
PMC3014793_01 | Male | 27 | A healthy 27-year-old man with normal phenotype was referred for the evaluation of infertility. In his physical examination, right testis was 10 cc, left testis was 8 cc with grade 1 varicocele. Vasa deferentia were palpable on both sides. Consecutive two semen analyses of the patient revealed azoospermia with normal ejaculate volume. His serum FSH was 24.29 mIU/mL (1.6-12.4 mIU/mL) and total testosterone was 495 ng/dL (260-1600 ng/dL). The patient with the diagnosis of nonobstructive azoospermia (NOA) had a history of allogeneic bone marrow transplantation (BMT) from his sister due to chronic myeloid leukemia (CML). Karyotyping and Y chromosome microdeletion analysis, which are necessary for the evaluation of NOA, were done with peripheral blood leucocytes and buccal mucosa samples because of the probable change in peripheral blood leucocytes after allogeneic bone marrow transplantation. There was no family history of infertility.
The patient, who had the diagnosis of CML with positive Philadelphia (Ph) translocation in February 1999, was treated with Hydroxyurea 500 mg/day for two years. The patient was conditioned with cyclophosphamide 60 mg/kg for two days and TBI with a total dose of 12 Gy in 3 fractionated doses before BMT. In 2001, allogeneic BMT was performed. After allogeneic BMT, the patient was treated with 26 mg methotrexate and 30 gr IVIG. In cytogenetic analysis performed on cultured cells from bone marrow material before allogeneic BMT, no metaphases were examined. After BMT, cytogenetic analysis revealed 6 metaphases examined by trypsin GTG banding, and 4 of them had 46,XX chromosomal constitution. | null | Not supported with pagination yet | null |
PMC5422832_01 | Male | 82 | An 82-year-old Japanese man complained of a 1-month history of otherwise asymptomatic papules and nodules distributing on the abdomen, shoulders, and extremities. Some of the abdominal skin lesions corresponded with the sites of subcutaneous insulin injection therapy for uncontrollable type 2 diabetes mellitus. Of note, the skin nodules clustering on the forearms tended to overlie exclusively the median basilica, cubital, or cephalic veins (Fig. 1a, b). These lesions showed fluctuation during his clinical course, irrespective of the skin sites of periodic blood sampling and insulin injection, and further extended along the peripheral venous lines of his forearm skin (Fig. 1c, d). Transcutaneous ultrasonography of the forearm lesions revealed demarcated, homogeneous, hypoechoic areas surrounding superficial veins, suggestive of peri-/intravascular granuloma (Fig. 1e, f). Laboratory tests showed elevated levels of ESR (39 mm/h), CRP (1.07 mg/dL), sIL-2R (1,803 U/mL), and HbA1c (7.3%), without increase in serum calcium and ACE levels. The QuantiFERON-TB and tuberculin skin tests were negative. Owing to the refusal to obtain the skin biopsy from his forearm lesions, the skin sampling was undertaken from the abdominal lesion. The histopathology showed a nonnecrotic, noncaseating epithelioid granuloma with a relatively lower infiltration of inflammatory cells in the lower dermis and adipose tissue (Fig. 2). Bilateral hilar lymphadenopathy (BHL) and a solitary mass in the left gluteus minimus muscle were detected on positron emission tomography screening (Fig. 3a, b, respectively). Ophthalmological and cardiovascular examinations did not show any granulomatous lesions. Based on these findings, we made a diagnosis of sarcoidosis involving the skin, skeletal muscle, and BHL. During 1 year of follow-up, his abdominal skin lesion almost diminished with topical steroid therapy (Fig. 4a), but the forearm skin lesions often recurred along the venous lines (Fig. 4b, c). His blood test revealed improvement of the sIL-2R level (677 U/mL) but BHL remained unchanged. | subcutaneous sarcoidosis, ultrasonography, venous tropism | Not supported with pagination yet | null |
PMC7732862_01 | Female | 80 | An 80-year-old woman presented with a 1-month history of fever and appetite loss. Her chest computed tomography (CT) showed multiple miliary nodular shadows and some small cavitary lesions in all lung fields bilaterally (Fig. 1). Acid-fast bacteria staining of sputum was smear-positive, and tuberculosis was demonstrated in polymerase chain reaction (PCR) testing. The patient was diagnosed as having miliary tuberculosis and pulmonary tuberculosis. She was referred to our hospital and admitted to the isolation ward. She had mild mental retardation and a past history of an ovarian cyst.
On examination, her height was 152.1 cm, her weight was 42.0 kg, her temperature was 36.5 C, her blood pressure was 115/74 mmHg, her pulse rate was 91 beats/min, and her oxygen saturation was 93%. She had anemic conjunctivae and purpura of the right inguinal region and left elbow joint, but no enlarged lymph nodes.
Chest and abdominal examinations showed no specific findings. Laboratory findings showed a normal white blood cell count, anemia (Hb 7.1 g/dl), marked thrombocytopenia (Plt 3000/muL), and elevated CRP (Table 1). Coagulation, liver function, and renal function tests were normal. There was no elevation of bilirubin, urinary urobilinogen. The urine and blood cultures for acid-fast bacteria were negative. Standard anti-tuberculosis treatment (isoniazid 300 mg, rifampicin 450 mg, ethambutol 500 mg, pyrazinamide 1200 mg) was started, along with platelet transfusion after bone marrow puncture at the time of admission. There was no increase of platelets (9000/muL) despite transfusion of 10 units of platelets for two days. In her myelogram, total nucleated cell counts were normal (184,750/muL), differential counts of granulocyte and erythroblast were normal, the megakaryocyte counts were almost normal (111/muL) and no blastoid cells were found. Bone marrow findings showed normal hematopoietic capacity and some epithelioid granulomas with caseating necrosis (Fig. 2). Acid-fast bacteria staining and culture of bone marrow were both negative. Immune thrombocytopenia (ITP) was diagnosed on the basis of the lack of efficacy of platelet transfusion and normal hematopoietic capacity. Anemia improved after transfusion 2 units of RCC. Anti-Helicobacter pylori (HP) antibody, anti-nuclear antibody, and hepatitis C antibody were all negative. Platelet-associated IgG was positive (53.9 ng/107 cells). Therefore, it was considered that the thrombocytopenia was secondary ITP due to miliary tuberculosis.
There was no increase of platelets despite initiation of prednisolone 20 mg on the third day. High-dose IVIG (20,000 mg/day, 476 mg/kg) was given for 5 days because anti-tuberculosis drugs and prednisolone 20 mg were ineffective. Laboratory findings showed temporary improvement of the platelet counts (56,000/muL) on the day 11, but the platelet counts dropped to less than 10,000/muL again in several days. Eltrombopag 12.5 mg, recommended initial dose in Japan, was then added on day 17. However, no platelet increase was achieved, and the eltrombopag dose was then increased by 12.5 mg every two weeks. After prednisolone 20 mg was given for 4 weeks, the dose of prednisolone was decreased to 10 mg for three weeks. Sufficient elevation of the platelets (44,000/muL) was seen when the dose of eltrombopag reached 50 mg on day 65 (Fig. 3). The patient had no bleeding complications and no thrombotic diseases during hospitalization. During the treatment of tuberculosis, the major side effects, including liver dysfunction and rash, were not observed. The respiratory condition gradually improved in the initial two weeks. The drug sensitivity test for Mycobacterium tuberculosis showed that it was sensitive to all anti-tuberculosis drugs. The anti-tuberculosis drugs were decreased to the two drugs isoniazid and rifampicin on day 68. The sputum smear staining showed negative conversion at 5 weeks. A chest X-ray showed improvement of the miliary nodular shadows. She was discharged to her house on day 71. It was planned to give the patient standard anti-tuberculosis treatment for an extra 3 months (total 9 months) because of steroid use and the presence of miliary tuberculosis. | eltrombopag, immune thrombocytopenia, tuberculosis | Chest CT on admission. . Chest CT shows multiple miliary nodular shadows and some small cavitary legions in all lung fields bilaterally. The arrows indicate some small cavitary lesions. |
|
PMC4748620_01 | Female | 20 | A 20-year-old girl, born in Pakistan and living in Italy for 8 years, presented to the emergency room for fatigue, fever, and dry cough, lasting for 1 week. The medical history of the patient revealed coeliac disease. She was never-smoker. On physical examination, the patient was cachectic without any other pathological findings, in particular, no superficial lymphoadenopathies were appreciable. Blood examination showed leukocytosis (15,240/mmc), microcytic anaemia (hemoglobin [Hb] 10.4 g/dL), thrombocytosis (593,000/mmc), increased levels of C-reactive protein and erythrocyte sedimentation rate. Chest X-ray [Figure 1] displayed micronodular interstitial disease, with diffuse interstitial-alveolar infiltrates. In the suspect of miliary tuberculosis (TB), the patient was admitted to the Division of Infectious Diseases and it was started immediately anti-TB therapy: Rifampin, isoniazid, ethambutol, and pyrazinamide, firstly intravenous and then per os. Blood exams were repeated and showed normal leukocytes count with a slight monocytosis (12%) and confirmed microcytic iron deficiency anemia (Hb: 9.3 g/dL, ferritin: 7 ng/mL, iron: 25 mcg/dL) and thrombocytosis (485,000/mmc). Moreover, other laboratory tests confirmed cachexia (low levels of triglycerides, cholesterol, albumin, and creatine kinase).
Despite the prompt beginning of antitubercular therapy, the clinical condition worsened day by day. Persistent fever was present and after 5 days since admission, respiratory failure developed requiring oxygen-therapy. Blood culture for Gram-positive and negative bacteria resulted negative.
To clarify the involvement of the lung, it was performed a bronchoscopy with bronchial washing. The evaluation at the microscope on this specimen resulted negative for mycobacterium. Furthermore also QuantiFERON-TB resulted negative. Chest CT [Figure 2] displayed lung hilar and mediastinal lymphadenopathies (up to 3 cm) associated to diffuse parenchymal opacities (ground glass) and small nodules. The radiological features were not typical for miliar TB, but could be an expression of other diseases, such as lymphoproliferative disorders.
Fifteen days after the admission, patient's clinical condition worsened further with respiratory failure, hypotension, and tachycardia, and she was moved to the Intensive Care Unit. Despite the continuous positive airway pressure (CPAP) with inspiratory oxygen fraction 80% applied, PaO2 was lower than 50 mmHg. Clinical and echocardiographic parameters required to make a diagnosis of ARDS were satisfied. Intravenous therapies with methylprednisolone 20 mg twice a day and levofloxacin 500 mg twice a day were started. Bronchoscopy was repeated one more time performing bronchoalveolar lavage (BAL) and transbronchial biopsies (TBBs).
After the onset of the therapy, respiratory and cardiovascular parameters improved abruptly. CPAP treatment was discontinued the day after, dyspnea got better progressively. On serological examinations human immunodeficiency virus-test and lymphocyte typing were negative. Instead angiotensin conversion enzyme and lactic dehydrogenase were slightly increased. These results and the clinical response to steroid therapy suggested sarcoidosis.
This diagnosis was confirmed by BAL fluid examination which revealed lymphocytic alveolitis with CD4/CD8 ratio 1.2 and TBB was positive for nonnecrotizing granulomas consistent with sarcoidosis [Figure 3]. Antitubercular therapy and levofloxacin were stopped, and methylprednisolone was continued.
After 6 days, the patient was discharged from the Intensive Care Unit in good clinical condition and without oxygen support. A chest X-ray of control showed a reduction of the lung infiltrates bilaterally.
The patient was finally discharged with a diagnosis of ARDS in pulmonary sarcoidosis (Stage II) and the prescription of prednisone 25 mg a day.
The patient was followed in our interstitial lung diseases surgery. Chest X-ray and CT scan, performed 6 and 16 months after the discharge respectively, demonstrated almost complete regression of lymphadenopathies and pulmonary abnormalities [Figure 4]. During this period also the symptoms progressively improved, and steroid therapy (prednisone) could be tapered to a dose of 5 mg once a day. | acute respiratory distress syndrome, acute respiratory failure, sarcoidosis | Computed tomography images demonstrate subcarinal adenopathy (asterisk) and diffuse ground-glass opacities with small nodules (arrows) which tend to be confluent in some areas of the lung (box). |
|
PMC3936947_01 | Male | 31 | A 31-year-old Hispanic male without significant past medical history or medications prior to admission complained of sudden onset of watery, non-bloody diarrhea associated with mucus and crampy abdominal pain. Three days later the diarrhea became more frequent and the patient started to experience severe, sharp, constant, substernal chest pain associated with nausea and shortness of breath. He was brought to our institution, where an ECG showed ST-segment elevation in the infero-lateral leads, with troponin I level of 8.25 ng/ml and CK-MB level of 44.6 ng/ml. Urgent cardiac catheterization revealed normal coronary arteries and the patient was diagnosed with myopericarditis. The echocardiogram results were within normal limits, with 65%ejection fraction and no evidence of wall motion abnormalities. Initial workup showed an elevated erythrocyte sedimentation rate and C-reactive protein, with normal complete blood count. Stool analysis was positive for occult blood but negative for Clostridium difficile toxin, ova, and parasites on 3 separate stool samples. Further polymerase chain reaction (PCR) workup revealed negative blood and stool cultures and negative serological tests for human immunodeficiency virus, viral hepatitis, Cytomegalovirus, Coxsackie A & B viruses, Echovirus, rubella, mumps, Adenovirus, and Enterovirus. Colonoscopy showed macroscopically congested mucosa in the descending colon, sigmoid colon, and rectum, with scattered petechiae indicative of nonspecific colitis (Figure 1), with normal ascending and transverse colon. Microscopic examination of obtained biopsies revealed evidence of acute mucosal inflammation without ulceration, granulomas, or ischemia, suggestive of nonspecific colitis; acid-fast stains for tuberculosis and immune-stains for cytomegalovirus were negative. The patient was started on Naproxen 250 mg twice daily and chest pain started to improve gradually. Troponin I levels trended up during the first 3 days of hospitalization to a peak of 32.6 ng/ml and then started to trend down. The patient continued to have diarrhea for the first 3 days of hospitalization, followed by spontaneous resolution on day 4 with supportive care. The patient was discharged on Naproxen and was followed up in clinic 2 weeks after discharge, where he was found to be completely asymptomatic, with troponin I level <0.015 ng/ml. | chest pain, colitis, myopericarditis, pericarditis | Not supported with pagination yet | null |
PMC3303584_01 | Female | 43 | We present the case of a 43-year-old female. Shortly after birth, she presented a spontaneous right hip fracture. From then, until now, she has had multiple fractures of both arms and legs, which have required several interventions for correction, needing on the left humerus to be fixed with a medullary locking (Figure 1). The last fracture episode happened 3 years ago. OI type 2 was diagnosed, 20 years ago. For moving at home, she walks with difficulty with a cane, and, on the street, she is moved by wheelchair. She presents a significant growth delay (High = 1'14 m) and weighed 65 kg, presenting a picture of morbid obesity, with an increased body mass index (BMI = 45.4 kg/m2).
She relates that for about 2 years, and she has slow digestion, accompanied by marked abdominal bloating, accompanied by heartburn and reflux. The major alteration in her bowel habit was an alternating pattern with diarrhea and constipation. The patient had also bilateral hearing loss, requiring hearing aids for ten years.
Currently, the CBC was normal. Blood glucose was elevated (230 mg/dL) with increased glucosuria (4+). The rest of biochemical analysis was normal. She underwent a gastroscopy that showed a moderate reflux oesophagitis (grade B Angeles classification) without associated hiatal hernia. Duodenal biopsies showed an increased intraepithelial lymphocytosis (45%) corresponding to stage I of affordable Marsh. Genetic markers of CD type DQ2 were positive in homozygosis, and antibodies to tissue transglutaminase (tTG) were normal (0.6 U/mL). Antinuclear antibodies were negative. Vitamin D deficiency was excluded.
She was started on a gluten-free diet (GFD) and an oral antibiotic drug, type Metformine-850 mg/twice daily was given, having lost 6 kg of weight in 6 months with good control of DM-II and presenting a significantly improvement related to the presence of prior digestive problem. A recently completed study of bone mineral density (BMD) has been reported as normal. | null | Not supported with pagination yet | null |
PMC3033068_01 | Male | 58 | A 58-year-old man was seen at the Postgraduate Institute of Medical Education and Research, Chandigarh, India, on August 17, 2001, with two nonhealing, punched-out ulcers near the right lateral malleolus. The ulcers were approximately 2 cm x 2.5 cm in size, with necrotic margins, purulent exudate, and a foul odor. On the second day, temperature of 39.4 C and gangrene of the right leg developed. The patient also had alcoholic liver disease and non-Hodgkin lymphoma, for which he had been receiving chemotherapy for last 6 months, and he had had a 6 months' course of antitubercular combination therapy for pulmonary tuberculosis 2 years earlier.
Peripheral blood showed a leukocyte count of 10,000/mm3 with 80% neutrophils, 11% lymphocytes, and 9% monocytes. The fasting blood glucose level was 400 mg/dL with normal electrolytes and renal function test results. Liver function tests showed a serum glutamic oxalacetic transaminase level of 80 IU/L and a serum glutamic pyruvic transaminase level of 75 IU/L. Sputum microscopy showed no acid-fast bacilli. Microscopy of necrotic tissue showed gram-positive bacilli (1-1.5 mum x 5-6 mum) with frequent oval terminal spores. Aerobic blood culture was sterile. Insulin was given to control his blood glucose level. Antimicrobial therapy included intravenous metronidazole, vancomycin, and imipenem. Skin and subcutaneous tissue debridement and fasciotomy were also undertaken. | null | Not supported with pagination yet | null |
PMC6556823_01 | Female | 53 | 53-year-old female patient with a history of latent tuberculosis infection in prophylactic treatment with isoniazid, previous surgery of tonsillectomy, appendectomy and cholecystectomy. Family history negative for neoplastic diseases. Hospitalised at another institute in April 2016 with clinical manifestation of intestinal obstruction with evidence for CT scan of a solid occluding mass of a distal ileus of 5 cm maximum diameter localised in the right iliac fossa. Multiple nodular neoformations at the peritoneal level, the largest of 2 cm maximum diameter with associated free fluid in the abdomen and multiple lymphadenopathies of the ileal mesentery and some enlarged lymph nodes of the right anterior heart-phrenic angle. The latest was the unique finding of extra-abdominal disease spread. So the patient underwent surgery for ileal resection and ileostomy, with a peritoneal nodule biopsy.
The definitive histological examination of the ileal mass (free surgical resection margins) characterization showed positive reactions for histiocytic markers (CD163 and CD68); negative reactions for lymphoid markers (CD45 / LCA, CD20 / L26, CD79a, CD3, CD2, CD5, CD7, CD8, CD56, CD30 / BERH2 and ALK1) and myeloperoxidase. The reaction for cNPM is negative. Negative reactions for cytokeratins (MoAB MNF116, CK8,18, AE1 + AE3), desmin, caldesmon, ML actin, CD34, CD117, DOG1, S100 protein, melanA, CD21, CD1a. Cytoproliferative activity (MIB1-LI) in 15-20% of cells. Biopsy histological examination on the major of the peritoneal nodularity confirms the diagnosis of HS peritoneal localisation. The patient evaluation was performed with Esophagogastroduodenoscopy and Colonoscopy that excluded the involvement of other gastrointestinal tracts, bone marrow biopsy to confirm the absence of concomitant lymphoproliferative diseases. PET-CT showed multiple uptakes at the ileal mesentery, right and left colon, lymph node uptake also at the thoracic level at the phrenic heart angle, a finding already known in previous exams. The patient then performed six cycles of CHOEP chemotherapy. After adjuvant therapy, the PET-CT described a partial response to treatment with regression of uptake areas at thoracic level and persistence of abdominal uptake of already knows localisations (Fig. 1). After a multidisciplinary evaluation, was indicated the CRS: at the exploration of the abdominal cavity was established the disease recurrence from 15 cm to ileostomy, in the pelvis and along the left colonic mesentery and parietal peritoneum until homolateral hypochondrium, near the spleen. So the decision it was to perform an ileal en-bloc resection of the previous ileostomy, total colectomy, hysterectomy and bilateral oophorectomy, bilateral obturator lymphadenectomy, omentectomy, splenectomy, peritonectomy of all four abdominal quadrants removing multiple peritoneal nodules of the ileal mesentery. The spleen was removed to guarantee the radicality of surgery considering the presence of nodular lesions on the diaphragmatic peritoneal surface where the spleen leans. Peritoneal Cancer index was 13; at the end of the procedure, Cytoreduction score was CC-0.
Post-operative course was characterised by close monitoring in ICU up to the 3rd postoperative day and then transferred to our ordinary ward, the onset of infectious pneumonia resolved with antibiotic therapy. Discharge of the patient at home on the 20th postoperative day. Histological examination confirmed the diagnosis of HS with ileal relapse, multiple peritoneal, small bowel mesentery, colic and omental localisation, negative for HS localisation the other tissues removed. The postoperative CT scan showed a complete resection of abdominal HS localisation such as CT-scan at three and six mounths-follow-up. During the same period the patient underwent a second-line chemotherapy treatment with four cycles according to DHAP scheme (Dexamethasone, Cisplatin, Aracytin). The subsequent CT-scan performed at ten months from cytoreductive surgery (17 months from diagnosis) highlighted a disease relapse with multiple abdominal and thoracic localisations. Exitus at 21 months after diagnosis due to progressive decay of the general performance status. | histiocytic sarcoma, peritoneal metastases, peritonectomy | Not supported with pagination yet | null |
PMC10312336_01 | Male | 68 | A 68 years old male patient came to the orthopedics department because of pain and swelling of the left shoulder joint. The patient developed left shoulder joint pain without obvious incentive 6 months prior, and there was no obvious shoulder joint swelling or limited shoulder joint movement at that time. He received more than 15 irregular intraarticular steroid injections in the shoulder joint at a local private hospital. The pain was significantly relieved within 1 week after each injection, but it recurred. One month prior to presentation, the patient had aggravated pain in the left shoulder joint, and the joint gradually swelled with obvious limitations of abduction and internal rotation. He had a history of fracture in his left shoulder 20 years earlier. Due to the age of the injury, the details could not be traced. No surgical treatment was performed at that time, and he recovered well. Physical examination found local swelling and tenderness in the shoulder, with limited range of motion. The patient had no fever, rheumatic disease, tuberculosis, or immunosuppressive drugs. The blood test indicated a white blood cell count of 5.43*109/L, a C-reactive protein (CRP) level of 3.27 mg/L, an erythrocyte sedimentation rate of 17 mm/h, a rheumatoid factor less than 20 IU/mL, and positive results from T-spot and TB-Ab tests.
Plain radiography (Figure 1A and B) and CT scan (Figure 1D-F) showed bone erosion at the humeral head, the subchondral portion of the glenoid and the acromion. MRI (1.5) showed uneven signal increases in the humeral head, acromion and glenoid, articular cartilage wear, massive tears of the supraspinatus, subacromial space communication with the glenohumeral joint, and subdeltoid bursa communication with the glenohumeral joint cavity. The synovium of the joint was thickened and swollen, and there were extensive "rice body-like" low T2 signal shadows filling (Figure 1G-I). The enhanced gadopentetate with meglumine scan showed obvious enhancement of the synovium in the T1 sequence, but no enhancement was found in the rice body formation inside the bursa (Figure 1J-L).
Considering that infectious diseases needed to be ruled out and discussions about surgical procedures such as rotator cuff repair and shoulder joint replacement would have to wait, arthroscopic removal of rice bodies and subtotal bursectomy were performed. The observation channel was placed through the posterior approach, and a lot of rice bodies in yellow bursa fluid were observed to flow out (Figure 2A and B). After the lens was placed, rice bodies with a diameter of approximately 1-5 mm filled the joint cavity (Figure 2C and D). Placing the shaver through the lateral approach, the field of vision became clear after removing most of the rice bodies. We found a spontaneous rupture of the long head tendon of the biceps brachii and a large rupture in the supraspinatus; the subacromial space was connected to the joint through this rupture. Three arthroscopic approaches (posterior approach, anterior approach and lateral approach) were used to monitor and operate and to fully explore the subacromial bursal, subdeltoid bursal, the periglenoid and the anterior spaces of the subscapularis. The rice body and denatured synovial tissue were fully shaved. Postoperative MRI showed that although the swelling around the joint was obvious, there was no remaining rice body (Figure 2G and H).
The histopathological examination of the rice body showed that it was mainly composed of fibrin without a clear tissue structure, with some small amount of tissue and cell coagulation (Figure 2E and F). A PCR test for the detection of Mycobacterium tuberculosis DNA suggested negative results, and bacterial and fungal cultures of synovial fluid suggested Candida parapsilosis infection performed by Vitek-2 (BioMerieux, France) automated system. However, peripheral blood culture showed no bacterial or fungal proliferation. Drug sensitivity test (DST) indicated that voriconazole, itraconazole, fluconazole, 5-flucytosine, and amphotericin are susceptible. Therefore, the patient received fluconazole (400 mg/qd) intravenously for 1 week, and then oral administration (200 mg/bid) to sequential therapy for 8 weeks as planned.
However, the shoulder swelled again after two weeks of oral administration (Figure 3E). MRI revealed a lot of fluid accumulation in the subacromial-subdeltoid region with necrotic synovial tissue floating (Figure 3A and B). In view of the large amount of fluid accumulation in the joint cavity, the joint cavity puncture was performed, and about 100 mL of yellow turbid liquid was extracted. The fungus culture showed that there was still Candida parapsilosis. Then the joint cavity was punctured for many times due to repeated swelling of the shoulder joint. Ultrasound examination showed joint cavity effusion, synovial hyperplasia, and some synovium looked like "floating weeds" (Figure 3C and D). In view of the recurring symptoms, arthroscopic surgery was performed again to clean the joint and a catheter was placed for irrigation and drainage (1 for irrigation and 1 for drainage). Under arthroscopy, there is no obvious rice body formation in the joint cavity, but a large amount of necrotic synovial tissue floating as seen in ultrasound (Figure 3F). A large amount of necrotic tissue flows out from the drainage tube and was pulled out due to blockage 10 days later. After operation, 400mg voriconazole was given intravenously, and 200mg bid was taken orally after three consecutive negative cultures. At present, the patient has received oral treatment for 8 weeks and change to the fluconazole (200 mg/bid) 4 weeks for the damage of liver function, without swelling again, and the subsequent culture is negative. The patient has been treated for 6 months and has not recurred. | candida parapsilosis, corticosteroids, fungal arthritis, intraarticular injection, rice body formation | Not supported with pagination yet | null |
PMC4205938_02 | Male | 30 | John was a 30-year-old, single, African American medical student seeking treatment at an outpatient BDD clinic. John presented with concerns about short height, a protruding stomach, his body build, which he felt was not sufficiently muscular, and his skin color, which he believed was too dark. He reported spending 1-3 hours per day thinking about these appearance concerns. To decrease anxiety about these concerns, John spent two to three hours per day, six days per week, at the gym (formerly, he had spent as many as four hours a day at the gym). He took prohormones, a legal alternative to anabolic-androgenic steroids, to increase muscular growth. He also compared his body to others', measured his body parts of concern, and compulsively checked his appearance in mirrors. Due to his BDD symptoms, John also avoided leaving home and socializing with friends, did not have a romantic partner, and had increasing academic difficulties.
John discussed early in treatment that he grew up as "one of the few Black kids in a predominately White neighborhood." He reported that as a child his parents had encouraged him to associate with his White classmates, but not his Black classmates. In high school, he was involved in extracurricular activities, such as the speech and debate team, in which he was the only Black member, while the majority of his Black classmates participated on the football team. However, he reported that he was frequently the target of teasing from his White peers. By avoiding associating with his Black classmates and being teased by his White classmates, John felt that he did not fit in with either group, and therefore did not develop a strong personal identity as an adolescent.
John also described a preoccupation with exercising and building muscle starting in early adulthood, as an attempt to fit in with the African American community in a way he was not able to in middle school and high school. However, because John believed that society viewed African American males as inherently unattractive, he felt he had to become extremely physically fit in order to be regarded as merely acceptably attractive. Thus, John's exercise served two purposes: to help him establish a place in the African American community and to overcompensate for what he believed was society's opinion of him, as inherently unattractive because of his race.
At his baseline assessment, John received a diagnosis of BDD with comorbid severe Major Depressive Disorder (MDD), which was secondary to his BDD. He had no family history of BDD and was not taking any psychiatric medications. John's baseline BDD-YBOCS score was a 37, indicating severe BDD symptoms. His BABS score was a 17, which indicates poor insight of BDD-related beliefs, and his BDI-II score was a 20, indicating moderate depressive symptoms. | bdd, body dysmorphic disorder, cultural adaptation, cognitive behavioral therapy, treatment | Not supported with pagination yet | null |
PMC6614923_03 | Female | 8 | His sister, female, 8 years old, weighed 19.0 kg (3th percentile), 115.2 cm tall (3th percentile), and low bone density (11th percentile). Main clinical manifestations consist of intellectual disability, severely impaired speech (can only call dad and mom), high-arched palate, dental abnormalities (crowding and abnormal shape), small jaw, short tongue strap (received surgery), hypotonia, poor appetite, and salivation. She started walking at the age of 2. She started showing epilepsy since 6 years of age, even though her head MRI showed normal results at the age of 6. Her intellectual abilities were below an average 7 years old.
The karyotype analysis of G-banding in the peripheral blood of two siblings and parents showed a standard chromosomal pattern (data not shown). CMA result of both the proband and his sister using CytoScan HD whole genome SNP array (Affymetrix, USA) showed two copy number variations (CNVs): arr[hg19] 2q33.1(200,192,328-200,197,269)x1,2q35(218,105,663-218,816,675)x3. They have a 4.9-kb deletion in the 2q33.1 region of chromosome 2 (Figure S1). The deletion spans the exon 9 of the SATB2 (OMIM: 608148) gene. They also have a 711-kb duplication (arr[hg19] 2q35(218,105,663-218,810,908)x3) in the 2q35 region, which contains DIRC3 (OMIM: 608262) and TNS1 (OMIM: 600076) genes. There has been no clear disease-related report on the duplication of this fragment or on these two genes. The mother's CMA result: arr[hg19] 5q31.3q33.1 (141,383,108-151,756,016)x2 hmz. The father's CMA results: arr[hg19] 2q35 (218,105,663-218,810,908)x3. The couple did not carry the 4.9-kb deletion at 2q33.1, while the 711-kb duplication at 2q35 of the children should have been inherited from their father. However, the possibility of a low-level somatic or gonadal mosaicism was not excluded. Meanwhile, the exact breakpoints were yet to be determined.
The pregnant woman received amniocentesis at 19 weeks of gestation. The karyotype of the fetus was normal, but CMA result was the same as those of the affected children. In addition, the B-ultrasound showed that the fetus had ventricular septal defect. After genetic counseling and through consideration, the couple chose to terminate the pregnancy at 23 weeks of gestation.
This study was carried out in accordance with the recommendations of the Ethics Committee of Women's Hospital, School of Medicine Zhejiang University. All subjects gave written informed consent in accordance with the Declaration of Helsinki, and written informed consent was also obtained from the guardians of the two affected siblings for the publication of this case report. The protocol was approved by the Ethics Committee of Women's Hospital, School of Medicine Zhejiang University.
Peripheral blood samples were collected from the family members including the husband's father (I1), the couple (II1 and II2), and their two children bearing SAS (III1 and III2) ( Figure 1A ). Genomic DNA was extracted from peripheral blood samples using the QIAGEN spin columns on a QIACube (QIAGEN GmbH) according to the manufacturer's instructions. All DNA samples were dissolved in water and stored at -20 C.
Gap-PCR was chosen for locating exact breakpoints of the deletion. Three sets of primers (Gap2500-F/R, Gap1000-F/R, Gap500-F/R, Table 1 ) were designed according to the CMA results. Gap2500-F/R primer set worked well using TaKaRa LA Taq (TaKaRa Bio Inc.) and two-step procedure. The procedure of the PCR was as follows: 94 C for 1 min followed by 30 cycles at 98 C for 10 s, 68 C for 8 min, and a final extension step at 72 C for 10 min. Based on this result, another four primer sets (6666-F/R, 5335-F/R, 4334-F/R, 3442-F/R, Table 1 ) were designed to amplify more suitable size of fragments for sequencing. The procedure of the PCR was as follows: 94 C for 1 min followed by 30 cycles at 98 C for 10 s, 68 C for 4 min, and a final extension step at 72 C for 10 min.
The semen sample of the father was obtained by masturbation following 5 days of sexual abstinence and then was allowed to liquefy for 60 min at 37 C before processing. Semen sample was diluted 1:2 in Earle's solution, centrifuged at 500xg for 5 min. Then sperm pellets were washed twice with Earle's solution, and the final pellets were preserved immediately in liquid nitrogen for DNA extraction. Pellets were homogenized, and genomic DNA was extracted using the QIAGEN spin columns on a QIACube (QIAGEN GmbH) according to the manufacturer's instructions.
Three pairs of primers ( Figure 2A ) were designed to detect potential deletions in this family, including two primer sets outside the deletion region and one primer set inside the deletion. The design of primers is in accordance with the following standard: the length of the amplified product is less than 300 bp, and annealing temperature is close to 60 C. The three pairs of primers were designed by Primer-BLAST software () (see Table 2 ). Specificity and effectiveness have been examined in preliminary experiment. Furthermore, beta-globin was chosen as reference gene (forward primer: 5'-ACACAACTGTGTTCACTAGC-3'; reverse primer: 5'-CAACTTCATCCACGTTCACC-3'). The reaction was performed on a LightCycler 480 II real-time PCR system (Roche) in a final volume of 20 microl containing 10 microl of SYBR Premix Ex Taq Polymerase (TaKaRa), 0.4 microl each of the forward and reverse primers (10 micromol/l), and 2 microl of the genomic DNA (20 ng). Each sample was tested in triplets. The procedure of the PCR was as follows: 95 C for 10 s, followed by 40 cycles at 95 C for 5 s, 58 C for 30 s, and a final extension step at 72 C for 10 min. The dosage ratio of the tested samples was calculated by the DeltaDeltaCt method for each test sample according to.
The somatic and gonadal mosaicism levels of the father were estimated using the Pilot Droplet Digital PCR system [Pilot Gene Technologies (Hangzhou) Co., Ltd. China]. The primer set SATB2Del-F: CAGAAAGTATCTGGGCCTATCAT/SATB2Del-R: GTACAAAAGAGCTGAAAACAAATACA, which was located on each side of the breakpoint, were used along with the 6-carboxyl-x-rhodamine (ROX)-labeled fluorescence probe SATB2Del-P: ROX-AGGTGACTTCTGCTTGTT-MGB, which spanned the deletion region to detect the copy number of the mutation. Another primer-probe set PARP2-F: GCGGAGGGAAGCTCATCAGTG/PARP2-R: CCCTAGTCTCAGACCTTCCCAA/PARP2-P: 6-FAM-ACATGGGAGTGGAGTGACAGG-BHQ1 was employed to detect the single copy reference gene Poly (ADP-ribose) polymerase 2 (PARP2) in this study. The mosaic ratio was calculated as the copy number of mutation/the copy number of the reference gene.
The droplet generation, PCR amplification, and chip scanning were performed according to the manufacturer's instructions. Briefly, 20 microl of PCR mixture containing 1x PCR buffer, 1 microl each of the genomic DNA, 150 nM of 6-FAM-labeled probe, 600 nM of ROX-labeled probe, and 600 nM of each primer were loaded into Pilot droplet chips. Droplets were automatically generated in the Pilot droplet generator. Chips were then transferred into the Pilot iThermal1.0, and samples were amplified using the following cycling settings: initial denaturation at 95 C for 10 min, followed by 40 cycles of 95 C for 30 s, and 55 C for 60 s. Post-PCR chips were scanned using Pilot iScanner5 chip scanner, and results were analyzed using the GenePMSv1.1 software. | satb2-associated syndrome, chromosome microarray analysis, droplet digital pcr, gap-pcr, mosaicism | Not supported with pagination yet | null |
PMC8072212_02 | Female | 16 | A 16-year-old girl presented with a 2-year history of remitted focal seizures and memory deficits. She was diagnosed with thyroiditis at 11 years old, and her father had hyperthyroidism. Initial brain MRI revealed bilateral hippocampal hyperintensity in T2-weighted sequences and FLAIR sequences (Figures 1C,D). CSF analysis demonstrated pleocytosis (310 white blood cells per cubic millimeter), but the cytopathology was unremarkable. EEG revealed a slowed theta rhythm with bilateral temporal spike-wave discharges. The thyroid peroxidase (TPO) antibody titer was increased to 149.10 IU/ml (normal 0-60 IU/ml). Five months after onset, screening for autoimmune encephalitis-associated antibodies showed that the patient's serum and CSF were both positive for GAD65-Abs at a titer of 1:10 (TBA, by EUROIMMUN), OCB was positive, and the Ig index was increased to 1.34 (normal: 0.3-0.7). The patient's symptoms and memory were transiently improved after IVIG (2 g/kg) and methylprednisolone (20 mg/kg.d x 3 d) were given. Fifteen months after onset, she developed autonomic imbalance, including dysrhythmia, hypothermia/hyperthermia, and hyperhidrosis. Repeat brain MRI showed abnormalities in the bilateral frontal lobe, left parietal lobe, right temporal lobe, and insular cortex as well as the subcortical white matter and bilateral hippocampus (Figures 1E,F). Both serum and CSF were still positive for GAD65-Abs, with titers of 1:10 and 1:32, respectively. However, the symptoms of refractory focal motor seizures and dysautonomia did not respond to treatment with antiepileptic drugs, methylprednisolone, immunoglobulins, and one cycle of rituximab (375 mg/m2 x 4 times). Twenty-five months after onset, the patient developed persistent depression and was given sertraline. For economic reasons, she was irregularly receiving IVIG and steroid immunotherapy at the local hospital. At the last follow-up, 5 years after onset, she had persistent memory impairment and refractory focal seizures. Repeat brain MRI showed parenchymal atrophy (Figures 1G,H).
A girl aged 4 years and 9 months presented with a 1-day history of fever, vomiting, headache, and diplopia followed by coma. Her personal history and family history were unremarkable. Neurologic examination showed coma (Glasgow Coma Scale score 8), hyperactive deep tendon reflexes, and a positive Babinski sign. Brain MRI showed multiple diffuse abnormalities in the brainstem, thalamus, basal ganglia, and bilateral cerebral and cerebellar hemispheres on T2-weighted FLAIR imaging without enhancement (Figures 1I-L). A 2-h VEEG recording showed a slowed theta rhythm. CSF analysis revealed 11 white blood cells per cubic millimeter, along with normal glucose and protein. CSF cytopathology was unremarkable. Both serum and CSF were positive for GAD65-Abs, with titers of 1:100 and 1:320, respectively (Figure 2). OCB was positive. Screenings for paraneoplastic antibodies, anti-myelin oligodendrocyte glycoprotein (MOG) antibodies, and tumors were all negative. The patient was treated with methylprednisolone (20 mg/kg.d x 3 d) and IVIG (2 g/kg) and made a full recovery. After 2 weeks, she had no remaining symptoms and was discharged. A follow-up MRI after 1 month showed that the scope of the lesions was narrowed, the signal intensity was decreased, and the CSF GAD65-Ab titer was reduced to 1:32. At the last follow-up, 13 months after diagnosis, the patient had no symptoms, and MRI was normal. | anti-glutamic acid decarboxylase 65, autoimmune encephalitis, extralimbic encephalitis, limbic encephalitis, pediatric | Not supported with pagination yet | null |
PMC8352853_01 | Male | 18 | An 18-year-old Qatari male, presented in with fever of two weeks duration, not associated with chills, rigors or night sweats. He also complained of left sided neck swelling, decrease oral intake and nausea for the past 2 weeks. No complaints of cough, sore throat and no shortness breath. He denied history of contact with sick patient, recent travel, or contact with animals. He reports receiving the first dose SARS CoV2 vaccine (BNT162b2) 10 days before the start of his symptoms. His past history was remarkable for steroid dependent minimal change renal disease diagnosed in 2015. He was treated initially with prednisolone and cyclosporine for more than two years. He also received rituximab three times during 2018 and 2019 for relapse of his disease, however he was in remission for the last two years and not receiving any medications. He was non-smoker and non-alcohol drinker and works as a policeman. Physical examination on admission was unremarkable except for a temperature of 39 C and the presence of multiple tender enlarged left cervical lymph nodes of varying size with the largest about 1.5 cm in diameter.
Laboratory investigation on admission revealed, white blood cells (WBC) 2400/microL ( Neutrophils 1400 /microL, Lymphocytes 800 /microL, monocyte 200 /microL), hemoglobin (HB) 12.9 gm/dL, platelets 102,000 /microL, creatinine 70 micromol/L, CRP 38.4 mg/L, procalcitonin 0.46 ng/ml, ALT 64 U/L, AST 72 U/L, LDH 432 U/L, ferritin 699 microg/L, with negative ANA and normal C3, C4. Serology for HBV and HCV viruses were negative. HIV combo test and HIV PCR were negative. PCR for CMV and EBV were all negative. Blood and urine cultures were also negative. QuantiFERON TB Gold Plus was negative. Nasopharyngeal swab for SARS CoV 2 PCR was negative. Computed tomographic scan for chest and neck revealed multiple left cervical and axillary lymph nodes the largest one in the left supraclavicular region measuring around 10 x 11 mm (Fig. 1). Patient was initially treated with ceftriaxone however it was discontinued later on when the results of blood and urine were reported negative. He received symptomatic treatment with paracetamol and NSAIDS to control his fever. Excisional lymph node biopsy was done. Sections from the lymph node show effaced lymph node architecture by diffuse polymorphic lymphohistiocytic infiltrate with multiple foci of necrosis (Fig. 2). Many immunoblasts and numerous apoptotic bodies were present. Neutrophils were not seen within the necrosis. By immunohistochemical stains, the lymphoid cells are mostly T lymphocytes that are positive for CD3 (Fig. 3) with no apparent marker expression. CD30 is positive in scattered immunoblasts. The residual of B lymphocytes are positive for CD20 (Fig. 4) and other B-cell markers with no apparent marker expression. Ki-67 is positive in approximately 70% of cells. The histiocytes are highlighted by CD163 and myeloperoxidase. Scattered plasma cells are present and highlighted by CD138. Viral immunostains for EBV, HSV-1, HSV-2 and CMV are all negative. Flow cytometry is negative for monotypic B or T cells. T-cell receptor gene rearrangement showed no clonal T-cell receptor rearrangement. These features were consistent with the diagnosis of Histocytic necrotizing lymphadenitis. The patient was discharged home on in good condition. | covid 19 vaccine, fujimoto, kikuchi, lymphadenopathy, sars cov 2 | Not supported with pagination yet | null |
PMC4173215_02 | Female | 23 | A 23-year-old female presented with spastic paraplegia and bowel and bladder involvement of 7 days duration. This was preceded by pain in the dorsal spine, radiating to both lower limbs for 2 months, and progressive weakness and spasticity in the lower limbs for 2 weeks. On examination, she had spastic quadriplegia and loss of all sensory modalities below the D5 dermatome. An urgent MRI of the thoracic spine showed an extradural en plaque spinal lesion located posterolateral to the spinal cord, pushing the dura anteriorly [Figure 2]. The lesion was hypointense on T1-weighted MR, isointense on T2-weighted MR, and intensely enhancing on contrast administration. It arose primarily from the left posterolateral corner of the spinal canal, and extended predominantly dorsally but also ventrally in relation to the cord [Figure 2a-c]. The lesion was traversing the D4-D5 intervertebral foramen up to its outer limit. In view of the extradural location in the spine, the differentials were metastases, lymphoma, or a granulomatous infection like tuberculosis.
The patient underwent emergency D3-D5 laminectomy and decompression of the lesion. Intraoperative findings revealed a vascular and fleshy lesion present over the dura. Unfortunately, frozen section was not done at the first surgery, as this case was taken up as an emergency during the night. Histopathology was unequivocal for meningioma [Figure 3b].
Although the patient improved after decompression, the benign nature of the pathology prompted us to re-explore with a wider left posterolateral approach and perform a total excision of the tumor. At surgery, the tumor could be peeled off the dura, enabling a total excision [Figure 3a]. The patient improved in the postoperative period and has regained grade 5/5 power in both lower limbs, sensations, and bowel and bladder function at 3 months follow-up. Follow-up MRI showed no evidence of residual or recurrent lesion [Figure 2d and h]. | en plaque meningiomas, extradural spinal lesions, spinal meningiomas | Not supported with pagination yet | null |
PMC6791014_01 | Male | 37 | A 37-year-old african-american male was referred to the endocrinology department of the Federal Hospital of Lagoa for evaluation of adrenal insufficiency due to chronic and irregular use of steroids (Prednisone 20 to 40 mg/day) for 10 years. He had history of use of anabolic drugs and intramuscular mineral oil (hydrogel) injections in the upper and lower limbs for 15 years for muscle hypertrophy. Three months prior to the referral he developed intense headache, fever, night sweats, weight loss and limb pain. No other systemic comorbidities.
During hospitalization, intramuscular purulent collections were diagnosed by imaging tests and he presented daily fever (maximum of 38 C or 100 F). Treatment with piperacillin/tazobactam 2.25 g IV q6hr and vancomycin 500 mg IV q6hr was initiated and laboratory tests collected. The blood tests showed 11,900 leukocytes (90% neutrophils), high level of C reactive protein, negative blood culture, culture of the intramuscular purulent material negative, negative serology for HIV and syphilis. Chest and cranial computed tomography scans were normal. The cerebrospinal fluid showed the presence of 330 cells (60% mononuclear), 239 mg/dL proteins, 49 mg/dL glucose, negative Nanquin test, negative latex fixation test, negative bacterioscopy, negative cytomegalovirus serology. The polymerase chain reaction (PCR) result for Koch's bacillus was in process at this time. Drainage of right thigh abscess was performed and material sent to culture.
Ophthalmology Service was then requested for evaluation. Visual acuity was 20/20 in both eyes, anterior biomicroscopy and intra-ocular pressure were normal. Fundus examination revealed subretinal, elevated, rounded, yellowish lesions in the nasal region in the right eye and superior to the macula in the left eye (Fig. 1).
On fluorescein angiography (FA), these lesions showed punctate leakage (Fig. 2). The optical coherence tomography (OCT) revealed choroidal lesions causing elevation of the retinal pigment epithelium (RPE) and subretinal fluid (Fig. 3).
Considering systemic symptoms, suggestive laboratory and retinal lesions, the hypothesis of systemic tuberculosis with choroidal granuloma was assumed. After 14 days of treatment with piperacillin/tazobactam and vancomycin without clinical or laboratory response, the therapy was switched to rifampicin, isoniazid, pyrazinamide and ethambutol. At this point, several cultures of the material drained from the abscess were negative.
After 4 weeks of treatment for tuberculosis, the patient maintained the symptoms and no improvement of laboratory tests. The possibility of fast growing atypical mycobacteria was considered and the empirical treatment for mycobacteria with amikacin and clarithromycin was added to previous tuberculosis treatment.
Posteriorly to the change on the treatment, the patient presented clinical improvement and leukocytes progressively reduced from 16,500 to 7800 after 2 days. Then, one of the cultures collected from the left thigh confirmed the growth of non-tuberculous mycobacteria and the agent Mycobacterium Fortuitum was isolated. It was susceptible to the following antibiotics: amikacin, ciprofloxacin, doxycycline and moxifloxacin. At this time, the antibiotic therapy was replaced by doxycycline 200 mg/day and ciprofloxacin 1 g/day, oral administration.
After 6 months of targeted treatment, the fundus exam revealed a significant regression of the lesions (Fig. 4). The FA still showed discrete leakage (Fig. 5) and the OCT demonstrated regression of the choroidal lesion and subretinal fluid, which were replaced by areas of retinal atrophy (Fig. 6). | choroidal granuloma, mycobacteria, mycobacteria fortuitum | Not supported with pagination yet | null |
PMC9114295_01 | Female | 37 | A 37-year-old female patient, with previous diagnosis of rheumatoid arthritis, was under well tolerated therapy with adalimumab (40 mg twice a month since December 2018). She had no other relevant medical, surgical or familial history. She was in her usual state of health when she has received the second dose of BNT162b2 mRNA COVID-19 vaccine (June 2021). Seven days later, she started reporting intense thirst and polyuria and consulted her family physician. She denied headache, polyphagia, weight loss, foamy urine, macroscopic hematuria, peripheral or periorbital edema. On physical examination: blood pressure 120/80 mmHg, heart rate 70 bpm, weight 60 kg and height 165 cm; cardiac and pulmonary auscultation were normal and she had no relevant abnormalities. She was then referred to the Nephrology Department of her local hospital.
Blood analysis: creatinine 0.7 mg/dL, glucose 95 mg/dL, Na+ 141mEq/L, K+ 3.9 mEq/L, Calcium 8.9 mg/dL, Albumin 42 g/dL, TSH 3.8 mcUI/L (0.38-5.33), FT4 0.9 ng/dL (0.6-1.1), cortisol (8 am) 215.4 nmol/L (185-624), ACTH 21.9 pg/mL (6-48), osmolality 298.2 mOs/Kg (250-325); Urine analysis: volume 10200 mL/24h, osmolality 75 mOs/Kg (300-900), density 1.002.
Due to these findings, diabetes insipidus was suspected and she was then admitted to the Nephrology ward to perform a water deprivation test. This test is based on an indirect assessment of AVP activity using urine concentration capacity measurements during a lengthy period of dehydration and again after injection of desmopressin. Hourly measurements of body weight and urine osmolality are taken during water restriction until 2-3 samples differ by less than 30 mOsm/kg, or the patient loses more than 3% of his or her body weight, or plasma Na+ surpasses 145 mEq/L. Desmopressin is then injected. The osmolality of the urine is tested 60 minutes later. CDI and nephrogenic DI are distinguished by their responses to desmopressin treatment. Complete nephrogenic DI is diagnosed when urine osmolality remains below 300 mOsm/kg after thirst and does not increase by more than 50% following desmopressin administration. If the urine osmolality rises by more than 50% following desmopressin administration, complete CDI is identified. Urinary concentration rises to 300-800 mOsm/kg in partial CDI and primary polydipsia, with increments of >9% (in partial CDI) and 9% (in primary polydipsia) after desmopressin injection.
The water deprivation test started at 08.00 a.m. of the day after admission. The results showed: serum basal Na+ 141 mEq/L; serum basal osmolality of 308.8 mOsm/Kg; serum basal AVP below detection limit of 0.8 pg/mL; basal urine osmolality: 68.0 mOsm/Kg; At 60 min. Na+ 147 mEq/L and urine osmolality 61 mOsm/Kg; 1 h after 2 mcg of intravenous desmopressin: urine osmolality was 511 mOsm/Kg and Na+ 139 mEq/L. ( Figure 1 ) The Endocrinology Department was contacted for clinical guidance. Further hormonal analysis showed: FSH 4.76 UI/L, LH 5.62 UI/L, estradiol 323 pmol/L, IGF1 74.8 ng/mL (88-209), PRL 24.7 mcg/L (3.3-26.7). MRI of the pituitary gland revealed loss of the posterior pituitary bright spot on T1 weighted imaging. ( Figure 2 ) Diagnosis of CDI was assumed, and she started therapy with oral desmopressin 0.06 mg twice a day. Although pituitary biopsy was not conducted, other probable causes of CDI were ruled out - serum levels of iron, IgG4, angiotensin-converting enzyme and beta2-microglobulin were normal. Infection by mycobacterium tuberculosis was also ruled out. A report of this potential adverse effect from BNT162b2 mRNA COVID-19 vaccine was addressed to national health authorities. On the last appointment (December 2021), she was under oral desmopressin 0.06 mg three times a day, had no polydipsia or polyuria, blood pressure was 110/80 mmHg, and analytical results showed a serum osmolality of 297.2 mOsm/kg, and urine osmolality of 148.0 mOsm/kg. Desmopressin was then titrated to 0.12 mg twice a day. Reevaluation of anterior pituitary function was normal: TSH 2.62 mcUI/L, FT4 0.89 ng/dL, cortisol 8 a.m. 302 nmol/L, IGF1 78 ng/mL, FSH 5.7 UI/L, LH 5.8 UI/L, estradiol 412 pmol/L. | covid-19, case report, diabetes insipidus, mrna, vaccine | Not supported with pagination yet | null |
PMC4900027_01 | Female | 16 | This 16-year-old woman, an avid basketball player, suffered a noncontact injury resulting in rupture of the ACL of her left knee. This was repaired using a bone-patellar tendon bone (BPTB) autograft harvested from the same knee. The graft was attached firmly to a metal endobutton and pulled up through the tibial and femoral tunnels. The endobutton was then positioned securely across the upper opening of the femoral tunnel. The distal end of the graft was secured to the tibial tunnel using a bio-asbsorble interference screw.
The patient was seen for followup 18 days following the surgery, and radiographs of the left knee were obtained (Fig. 1). These radiographs demonstrated detachment of the femoral bone plug from the endobutton, and migration inferiorly into the femoral notch. | acl, anterior cruciate ligament, bptb, bone-patellar tendon-bone, mri, magnetic resonance imaging | Not supported with pagination yet | null |
PMC9389837_01 | Male | 36 | Our patient, an Italian 36-year-old male spent 5 days in Spain from 16 to 20 June 2022 (Fig. 1 ). Nine days after, he developed fever (up to 39 C), accompanied by sore throat, fatigue, headache and right inguinal lymphadenomegaly. On 2 July he resulted positive for SARS-CoV-2. On the afternoon of the same day a rash started to develop on his left arm. The following day small, painful vesicles surrounded by an erythematous halo appeared on the torso, lower limbs, face and glutes. On 5 July, due to a progressive and uninterrupted spread of vesicles that began to evolve into umbilicated pustules, he went to the emergency department of the Policlinico "G. Rodolico - San Marco" University Hospital in Catania, Italy, and was subsequently transferred to the Infectious Diseases Unit.
On admission, the patient reported being treated for syphilis in 2019. In September 2021, he performed an HIV test with a negative result. He suffered from bipolar disorder, for which he regularly took carbamazepine 200 mg daily. He was vaccinated for SARS-CoV-2 with two doses of Pfizer's BNT162b2 mRNA vaccine (the last in December 2021) and had already contracted COVID-19 in January 2022. He also reported of having condomless intercourse with men during his stay in Spain. Fever (37.5 C), pharyngodynia, fatigue, headache were still present. On physical examination his body was dotted, including the palm of the right hand and the perianal region, with skin lesions in various stages of progression, ranging from small vesicles (Fig. 2, Panel A) to reddened haloed pustules (Fig. 2, Panel B and Panel C) and umbilicated plaques (Fig. 2, Panel D). The oral mucosa was normal, except for bilateral tonsillar hypertrophy. A modest hepatosplenomegaly and an enlarged (2 cm), hypomobile and painful lymph node in the right inguinal region were found. Laboratory tests showed elevated C-reactive protein (69 mg/L, normal values 0.0 - 5.0 mg/L), fibrinogen (713 mg/dL, normal values 170 - 400 mg/dL) and prothrombin time (1.21, normal values 0.8 - 1.2). Chest X-ray revealed a parenchymal hypodiaphany in the right parailary region.
On the second day of admission (July 6, 2022), given the high suspicion of monkeypox supported by suggestive skin lesions and a recent trip to Spain, swabs of pustule exudate and nasopharynx secretions were sent to the Regional Reference Laboratory hosted at the University Hospital "P. Giaccone" of Palermo (Italy) for monkeypox orthopoxvirus detection and SARS-CoV-2 sequencing. To this purpose, monkeypox virus DNA was extracted using Quick-DNA Miniprep Plus extraction kit (Zymo Research), whereas SARS-CoV-2 RNA was extracted using QIAamp Viral RNA extraction kit (QIAGEN). Eluted DNA/RNA was stored immediately at -80 C until further use or analysed by means of rt-PCR assays. Three different singleplex rt-PCR assays targeting the TNF receptor gene of monkeypox were used: a monkeypox generic assay and two further rt-PCR assays specifically designed to differentiate monkeypox Congo Basin and West African strains. All rt-PCR assays were performed with a QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems, Carlsbad, USA) and a test was considered positive when its cycle threshold value was <40. SARS-CoV-2 genome was generated by next-generation sequencing on an Ion GeneStudio S5 System (Applied Biosystems, Carlsbad, USA) using the Ion Ampliseq SARS-CoV-2 Research Panel and virus lineage was designated using the Pangolin dynamic nomenclature system. SARS-CoV-2 genome included in the study was submitted to the Global Initiative on Sharing All Influenza Data (GISAID) repository (https://www.gisaid.org).
The specimens were confirmed positive to monkeypox virus and SARS-CoV-2. The first belonged to the West African clade, the variant responsible for the Spanish outbreak, while SARS-CoV-2 genome classified by Pangolin as lineage BA.5.1 (GISAID Accession ID: EPI_ISL_13876417). Serology tests for viral hepatitis, herpes simplex, gonorrhoea, chlamydia and lymphogranuloma venereum were negative. However, HIV-1 resulted positive with a viral load of 234,000 copies/mL. The CD4+ lymphocyte count was unaltered with 812 cells/muL (normal values within 410-1590 cells/muL).
The third day almost all skin lesions began to turn to crusts. Sotrovimab 500 mg was infused intravenously. On day 5 (July 9, 2022), almost all constitutional symptoms were resolved and previously altered laboratory test values normalized. On day 6 (July 11, 2022), nasopharyngeal swabs for SARS-CoV-2 and monkeypox virus were still positive, despite the absence of new skin lesions. Since symptoms had resolved, the patient was discharged to home isolation. On 19 July 2022 he returned to our institute to underwent a new oropharyngeal swab for monkeypox virus, which was still positive. The crusts had healed almost completely, leaving a small scar (Fig. 2 , Panels E to H). A triple combination of dolutegravir, abacavir and lamivudine was initiated for HIV treatment.
This case highlights how monkeypox and COVID-19 symptoms may overlap, and corroborates how in case of co-infection, anamnestic collection and sexual habits are crucial to perform the correct diagnosis. SARS-CoV-2 BA.4 and BA.5 subvariants are currently responsible for more than 1 million COVID-19 cases per day worldwide. Hence, clinicians should be aware of the possibility of SARS-CoV-2 and monkeypox virus co-infection, particularly in subjects with a recent history of travel to monkeypox-outbreak areas. If monkeypox is suspected, an oropharyngeal swab should be performed even in the absence of cutaneous manifestations as the skin may be spared, but the oral or rectal mucosa may be involved.
Our case emphasises that sexual intercourse could be the predominant way of transmission. Therefore, complete STI screening is recommended after a diagnosis of monkeypox. In fact, our patient tested positive for HIV-1 and, given his preserved CD4+ lymphocyte count, we could assume that the infection was relatively recent. To note, the monkeypox oropharyngeal swab was still positive after 20 days, suggesting that these individuals may still be contagious for several days after clinical remission. Consequently, physicians should encourage appropriate precautions. As this is the only reported case of monkeypox virus, SARS-CoV-2 and HIV co-infection, there is still not enough evidence supporting that this combination may aggravate patient's condition. Given the current SARS-CoV-2 pandemic and the daily increase of monkeypox cases, healthcare systems must be aware of this eventuality, promoting appropriate diagnostic tests in high-risk subjects, which are essential to containment as there is no widely available treatment or prophylaxis.
Written informed consent was obtained from the patient for publication of this case report and any accompanying images.
All authors contributed equally to this work. | covid-19, hiv, monkeypox, sars-cov-2, sexually transmitted infections | Not supported with pagination yet | null |
PMC9678970_01 | Male | 16 | A 16-year-old boy admitted to our institution with history of right shoulder pain and limitation of movement following a fall while playing football. He was seen in the Emergency Department and clinical examination showed tenderness around lateral half of clavicle. An A-P radiograph was taken (Fig. 1) and subsequently reassured and discharged. One month later the patient re-presented due to continued pain around lateral clavicle with small palpable lump. During this visit, further radiograph of clavicle obtained (Fig. 2), which showed a displaced physeal injury to lateral end of clavicle. Subsequently, a magnetic resonance imaging scan was performed to assess the extent of the injury (Fig. 3). Given that this case was missed and presented late, a multidisciplinary team meeting decision was made to accept the deformity and treat non-operatively. | clavicle, fracture, oblique views | Not supported with pagination yet | null |
PMC6107083_01 | Male | 14 | Participant TB01 was a 14-year-old male with a clinical diagnosis of TBI and right hemiparesis. For the barefoot condition, at initial contact, the right ankle was in 13 (1.57 ) of plantar flexion (Figure 2 and 3). This significantly improved to an ankle angle at initial contact of 1 (0.79 , p <0.01) of dorsiflexion with the addition of the AAFO. The right knee angle at initial contact changed from 6 (2.19 ) of flexion in the barefoot condition to 12 (1.92 , p=0.01) of flexion in the braced condition. Right peak knee extension angle during stance significantly improved from 5 (0.77 ) of extension for the barefoot condition to 0.5 (0.91 , p<0.01) of extension for the braced condition (Figure 3). The right peak internal knee flexor moment during stance was 0.90 Nm/kg (0.11) for the barefoot condition and reduced to 0.71Nm/kg (0.12, p=0.11) for the braced condition (Figure 2 and 3). The right internal knee flexor moment integral during stance was 0.30Nm.s/kg (0.01) Nm/kg for the barefoot condition and significantly improved to 0.17Nm.s/kg (0.03, p<0.01) with the addition of the AAFO (Table 2). | articulated ankle foot orthosis, gait analysis, genu recurvatum gait, traumatic brain injury | Not supported with pagination yet | null |
PMC6107083_02 | Female | 12 | Participant TB02 was a 12-year-old female with a clinical diagnosis of TBI and left hemiparesis. For the barefoot condition, the left ankle at initial contact was 20 (1.21 ) of plantar flexion, which significantly improved to 7 (1.22 , p<0.01) of dorsiflexion with the application of the AAFO (Figure 3). The left knee at initial contact was in 11 (0.67 ) of extension for the barefoot condition and significantly improved to 0.8 (4.62 , p=0.01) of extension for the braced condition. Left peak knee extension during stance significantly improved from 23 (0.65 ) of extension for the barefoot condition to 11 (1.24 , p<0.01) of extension for the braced condition (Figure 3). The left peak internal knee flexor moment during stance was 0.88 Nm/Kg (0.05) for the barefoot condition and significantly reduced to 0.21Nm/Kg (0.04, p<0.00) for the braced condition (Figure 3). The left knee flexor moment integral in stance was 0.63 Nm.s/Kg (0.10) for the barefoot condition and significantly improved to 0.02 Nm.s/Kg (0.01, p <0.00) with the addition of the AAFO (Figure 2). | articulated ankle foot orthosis, gait analysis, genu recurvatum gait, traumatic brain injury | Not supported with pagination yet | null |
PMC9424047_01 | Female | 50 | A 50-year-old woman (XY) presented to the emergency department (ED) at a national health service (NHS) hospital trust in England, following several days of shortness of breath, which had suddenly worsened over the previous hour with the patient having increased palpitations. The patient was admitted as she was dyspneic, using accessory muscles of respiration, respiratory rate was 17 breaths per minute, and oxygen saturation was 99% in air. The trachea was central, but on auscultation, breath sounds were absent in the left upper zone. Her body temperature was not raised. She was hemodynamically stable; her blood pressure was 115/74 mmHg, and her pulse rate was 56 bpm. Of note, the patient was double vaccinated against COVID-19 and had also received a booster. XY had been discharged from another NHS hospital trust 10 days prior, after a similar episode of chest pain and dyspnea, diagnosed as myopericarditis with pericardial effusion. This was attributed to a recent COVID-19 infection, three months before her first admission. The past medical history was significant for complex post-traumatic stress disorder, mixed depression and anxiety, drug-induced lupus erythematosus, and recent calculus cholecystitis.
An initial chest radiograph demonstrated a left upper zone pneumothorax, which occupied about 20% of the volume of the left hemithorax. There was no mediastinal shift or signs of tension. There were however some consolidative changes at the base of the left lung, believed to be related to the preceding COVID-19 infection (Figure 1).
The full blood count was largely unremarkable, no neutrophilia, and normal hemoglobin and platelets. Electrolytes were normal as were the liver function tests (GGT of 58 mumol/L). Coagulation screen was also normal. Troponin T was slightly raised at 26 ng/L; C-reactive protein level was measured on 3rd day of admission and was marginally raised at 6 mg/L. Measurements for Complement components 3 and 4 (C3/C4), anti-dsDNA and ESR were within normal ranges. The patient was negative for HIV, hepatitis B/C, and TB. A computed tomography (CT) thorax confirmed the X-ray findings of pneumothorax and consolidation (Figures 2(a) and 2(b)). There were a few small cysts in the right upper and lower lobes but no generalized bullae. A small pericardial effusion was seen (Figures 2(c) and 2(d)). There was no evidence of cardiomegaly.
An ECG revealed normal sinus rhythm with frequent ectopic beats. An echocardiogram demonstrated normal heart anatomy and filling dynamics. XY displayed the unique butterfly rash associated with SLE. | null | Not supported with pagination yet | null |
PMC8350049_01 | Female | 0 | Mariam, Namaganda's eldest daughter and firstborn, was just 2 months old when she began to have convulsions, and the family tried to look for medications but not much treatment was found. It was only when Mariam was seven to 10 years of age, that the community members warned Namaganda to not "neglect that daughter, because you may think it is convulsion, but when it is not convulsion, it may even result into epilepsy." The fear of it becoming epilepsy immediately prompted Namaganda and her husband to seek care at a neighboring health facility and start taking medication. However, soon the medication ran out and they didn't get her another dosage; eventually they resorted to traditional help:"Fortunately she recovered but it remained on her eyes and could attack her eyes; maybe when she is talking and she keeps quiet." | uganda, caregivers, epilepsy, help-seeking behavior, low middle income country, mental health, pathways to care, qualitative research | Not supported with pagination yet | null |
PMC9226341_01 | Male | 47 | A 47-year-old man was admitted to the Department of Pulmonary and Critical Care Medicine, Beijing Luhe Hospital, Capital Medical University (Beijing, China) with a 3-month history of mucopurulent expectoration and dyspnea. He was initially diagnosed with bronchitis at a health center in the local town and did not undergo chest radiography and laboratory tests. He received intravenous antibiotics for 14 days, but his symptoms were not relieved. Three days before admission, he started having a fever with a maximum temperature of 39.0 C. He did not report chest pain, hemoptysis, headache, vomiting, and other symptoms. His past medical history was unremarkable with no exposure to chronic diseases, infectious diseases or allergy. The patient was a worker and lived in an urban setting. No data on major epidemic, family history, toxic habits, or occupational exposure was reported. He was married and denied any sexually transmitted infections or drug abuse. He had a 30-year smoking history (20 cigarettes per day on average) and a 20-year history of alcohol intake of a 150 mL daily.
At admission, the patient was febrile with a temperature of 38.9 C, tachycardiac (107 beats/min), and tachypneic (22 breaths/min). His blood pressure (110/80 mmHg) and oxygen saturation (99%, measured by pulse oximetry while breathing ambient air) were normal. Examination of the oral cavity showed poor hygiene. There were wet rales in the right lung. The auscultation of the heart revealed regular rhythm without murmur. The abdomen was tender, and there was no organomegaly. No abnormal findings were found in the neurologic examination.
The laboratory data was as follows: the peripheral blood white cell count was 8,740 cells/mul with 78.40% neutrophils, and 14.10% lymphocytes, and 6.70% monocytes; hemoglobin 110 g/L, the hematocrit 34%, the platelet count 447,000 per cubic millimeter. The C-reactive protein (71.67 mg/L), and erythrocyte sedimentation rate (100 mm/h) were significantly elevated. The PCT was mildly increased (0.13 ng/ml). Biochemical analysis of liver and renal showed normal range except slightly decreased albumin (32.1 g/L). Coagulation profile was normal and the serum tumor markers were negative. The results for possible connective tissue disease, such as antinuclear antibody, extractable nuclear antigen, and antineutrophil cytoplasmic antibody, were also negative. The serum IgM antibodies specific for respiratory pathogens, including Legionella pneumophila antibody, Mycoplasma pneumoniae antibody, Chlamydia pneumoniae antibody, influenza A virus antibody, and influenza B virus antibody, revealed no abnormality. The serum (1,3)-beta-D-glucan test (G test), the galactomannan test (GM test), and the serum TB test (T-SPOT) were all negative. The results of two blood cultures were negative. No pathological findings were detected in repeated sputum smears and cultures. A chest computed tomography (CT) scan showed a consolidation shadow in the upper and middle lobes of right lung with foci of necrosis (Figure 1).
Initially, We considered pneumonia as a possible diagnosis, which needed to be identified with lung cancer or pulmonary tuberculosis, and Antibiotic therapy with intravenous piperacillin-sulbactam was initiated. To make a definitive diagnosis, we performed a flexible bronchoscopy (Figures 2A-C), revealing purulent secretions in the medial and lateral segments of the right middle lobe (RML), drastically obstructing the lumen. After suction, the purulent secretions of the medial segment were reduced and the lateral segment was unobstructed. Then, bronchial brushing (BB), bronchial biopsy, and bronchoalveolar lavage were performed in the medial segment of the RML. Bronchial mucosal biopsy and BB specimens revealed only non-specific inflammation of the mucosa, and no pathogens were observed in the bronchoalveolar lavage fluid (BALF) through routine specimen smear and culture. On the third day after admission, the patient had no fever and continued to receive intravenous piperacillin-sulbactam therapy. To reduce secretions and search pathogens, we performed a second flexible bronchoscopy (Figures 2D-F), showing purulent secretions in the medial segment of the RML and the anterior segment of the right upper lobe (RUL). The BALF sample of the second time was sent for microbiological analysis. We took an appropriate amount of BALF samples for Gram staining, which is blue-purple (Figure 3). The BALF specimen was vortexed and shaken for 30-60 s. We used a sterile tool to spread a 10 muL calibration sample on the surface of the blood plate. The inoculated blood plate was incubated at 35 C for 48 h in a carbon dioxide incubator (5-10% CO2). The colony growing on the culture medium was smeared on a target plate. After drying, it was covered using a 1 muL Bruker matrix solution. When it was dry, the target plate was loaded into the machine: Microflex LT (Bruker Daltonics, Bremen, Germany). Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF/MS) for the identification of pathogens was performed, and Actinomyces graevenitzii was identified from the BALF. These results indicated that the pulmonary lesion of our patient was caused by A. graevenitzii. After administration of antibiotic treatment with piperacillin-sulbactam for ten days, the clinical condition of the patient improved obviously, and the CRP dropped to 29.34 mg/L, though the pulmonary lesions on the chest CT scan (Figures 4A-D) were not significantly absorbed. The patient was discharged with oral amoxicillin-clavulanate. A timeline with all relevant data from this clinical case is available in Figure 5. At the 7-month follow-up, the clinical condition of the patient was getting better and the chest CT scans (Figure 4) revealed that the consolidation shadow of the right lung was gradually absorbed. | actinomyces graevenitzii, bronchoscopy, consolidation, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry, pulmonary actinomycosis (pa) | Chest computed tomography images at admission. A consolidation shadow in the right upper and middle lobes, with necrosis containing foci of air. lung window. |
|
PMC9226341_01 | Male | 47 | A 47-year-old man was admitted to the Department of Pulmonary and Critical Care Medicine, Beijing Luhe Hospital, Capital Medical University (Beijing, China) with a 3-month history of mucopurulent expectoration and dyspnea. He was initially diagnosed with bronchitis at a health center in the local town and did not undergo chest radiography and laboratory tests. He received intravenous antibiotics for 14 days, but his symptoms were not relieved. Three days before admission, he started having a fever with a maximum temperature of 39.0 C. He did not report chest pain, hemoptysis, headache, vomiting, and other symptoms. His past medical history was unremarkable with no exposure to chronic diseases, infectious diseases or allergy. The patient was a worker and lived in an urban setting. No data on major epidemic, family history, toxic habits, or occupational exposure was reported. He was married and denied any sexually transmitted infections or drug abuse. He had a 30-year smoking history (20 cigarettes per day on average) and a 20-year history of alcohol intake of a 150 mL daily.
At admission, the patient was febrile with a temperature of 38.9 C, tachycardiac (107 beats/min), and tachypneic (22 breaths/min). His blood pressure (110/80 mmHg) and oxygen saturation (99%, measured by pulse oximetry while breathing ambient air) were normal. Examination of the oral cavity showed poor hygiene. There were wet rales in the right lung. The auscultation of the heart revealed regular rhythm without murmur. The abdomen was tender, and there was no organomegaly. No abnormal findings were found in the neurologic examination.
The laboratory data was as follows: the peripheral blood white cell count was 8,740 cells/mul with 78.40% neutrophils, and 14.10% lymphocytes, and 6.70% monocytes; hemoglobin 110 g/L, the hematocrit 34%, the platelet count 447,000 per cubic millimeter. The C-reactive protein (71.67 mg/L), and erythrocyte sedimentation rate (100 mm/h) were significantly elevated. The PCT was mildly increased (0.13 ng/ml). Biochemical analysis of liver and renal showed normal range except slightly decreased albumin (32.1 g/L). Coagulation profile was normal and the serum tumor markers were negative. The results for possible connective tissue disease, such as antinuclear antibody, extractable nuclear antigen, and antineutrophil cytoplasmic antibody, were also negative. The serum IgM antibodies specific for respiratory pathogens, including Legionella pneumophila antibody, Mycoplasma pneumoniae antibody, Chlamydia pneumoniae antibody, influenza A virus antibody, and influenza B virus antibody, revealed no abnormality. The serum (1,3)-beta-D-glucan test (G test), the galactomannan test (GM test), and the serum TB test (T-SPOT) were all negative. The results of two blood cultures were negative. No pathological findings were detected in repeated sputum smears and cultures. A chest computed tomography (CT) scan showed a consolidation shadow in the upper and middle lobes of right lung with foci of necrosis (Figure 1).
Initially, We considered pneumonia as a possible diagnosis, which needed to be identified with lung cancer or pulmonary tuberculosis, and Antibiotic therapy with intravenous piperacillin-sulbactam was initiated. To make a definitive diagnosis, we performed a flexible bronchoscopy (Figures 2A-C), revealing purulent secretions in the medial and lateral segments of the right middle lobe (RML), drastically obstructing the lumen. After suction, the purulent secretions of the medial segment were reduced and the lateral segment was unobstructed. Then, bronchial brushing (BB), bronchial biopsy, and bronchoalveolar lavage were performed in the medial segment of the RML. Bronchial mucosal biopsy and BB specimens revealed only non-specific inflammation of the mucosa, and no pathogens were observed in the bronchoalveolar lavage fluid (BALF) through routine specimen smear and culture. On the third day after admission, the patient had no fever and continued to receive intravenous piperacillin-sulbactam therapy. To reduce secretions and search pathogens, we performed a second flexible bronchoscopy (Figures 2D-F), showing purulent secretions in the medial segment of the RML and the anterior segment of the right upper lobe (RUL). The BALF sample of the second time was sent for microbiological analysis. We took an appropriate amount of BALF samples for Gram staining, which is blue-purple (Figure 3). The BALF specimen was vortexed and shaken for 30-60 s. We used a sterile tool to spread a 10 muL calibration sample on the surface of the blood plate. The inoculated blood plate was incubated at 35 C for 48 h in a carbon dioxide incubator (5-10% CO2). The colony growing on the culture medium was smeared on a target plate. After drying, it was covered using a 1 muL Bruker matrix solution. When it was dry, the target plate was loaded into the machine: Microflex LT (Bruker Daltonics, Bremen, Germany). Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF/MS) for the identification of pathogens was performed, and Actinomyces graevenitzii was identified from the BALF. These results indicated that the pulmonary lesion of our patient was caused by A. graevenitzii. After administration of antibiotic treatment with piperacillin-sulbactam for ten days, the clinical condition of the patient improved obviously, and the CRP dropped to 29.34 mg/L, though the pulmonary lesions on the chest CT scan (Figures 4A-D) were not significantly absorbed. The patient was discharged with oral amoxicillin-clavulanate. A timeline with all relevant data from this clinical case is available in Figure 5. At the 7-month follow-up, the clinical condition of the patient was getting better and the chest CT scans (Figure 4) revealed that the consolidation shadow of the right lung was gradually absorbed. | actinomyces graevenitzii, bronchoscopy, consolidation, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry, pulmonary actinomycosis (pa) | Chest computed tomography images at admission. A consolidation shadow in the right upper and middle lobes, with necrosis containing foci of air. mediastinal window. |
|
PMC9226341_01 | Male | 47 | A 47-year-old man was admitted to the Department of Pulmonary and Critical Care Medicine, Beijing Luhe Hospital, Capital Medical University (Beijing, China) with a 3-month history of mucopurulent expectoration and dyspnea. He was initially diagnosed with bronchitis at a health center in the local town and did not undergo chest radiography and laboratory tests. He received intravenous antibiotics for 14 days, but his symptoms were not relieved. Three days before admission, he started having a fever with a maximum temperature of 39.0 C. He did not report chest pain, hemoptysis, headache, vomiting, and other symptoms. His past medical history was unremarkable with no exposure to chronic diseases, infectious diseases or allergy. The patient was a worker and lived in an urban setting. No data on major epidemic, family history, toxic habits, or occupational exposure was reported. He was married and denied any sexually transmitted infections or drug abuse. He had a 30-year smoking history (20 cigarettes per day on average) and a 20-year history of alcohol intake of a 150 mL daily.
At admission, the patient was febrile with a temperature of 38.9 C, tachycardiac (107 beats/min), and tachypneic (22 breaths/min). His blood pressure (110/80 mmHg) and oxygen saturation (99%, measured by pulse oximetry while breathing ambient air) were normal. Examination of the oral cavity showed poor hygiene. There were wet rales in the right lung. The auscultation of the heart revealed regular rhythm without murmur. The abdomen was tender, and there was no organomegaly. No abnormal findings were found in the neurologic examination.
The laboratory data was as follows: the peripheral blood white cell count was 8,740 cells/mul with 78.40% neutrophils, and 14.10% lymphocytes, and 6.70% monocytes; hemoglobin 110 g/L, the hematocrit 34%, the platelet count 447,000 per cubic millimeter. The C-reactive protein (71.67 mg/L), and erythrocyte sedimentation rate (100 mm/h) were significantly elevated. The PCT was mildly increased (0.13 ng/ml). Biochemical analysis of liver and renal showed normal range except slightly decreased albumin (32.1 g/L). Coagulation profile was normal and the serum tumor markers were negative. The results for possible connective tissue disease, such as antinuclear antibody, extractable nuclear antigen, and antineutrophil cytoplasmic antibody, were also negative. The serum IgM antibodies specific for respiratory pathogens, including Legionella pneumophila antibody, Mycoplasma pneumoniae antibody, Chlamydia pneumoniae antibody, influenza A virus antibody, and influenza B virus antibody, revealed no abnormality. The serum (1,3)-beta-D-glucan test (G test), the galactomannan test (GM test), and the serum TB test (T-SPOT) were all negative. The results of two blood cultures were negative. No pathological findings were detected in repeated sputum smears and cultures. A chest computed tomography (CT) scan showed a consolidation shadow in the upper and middle lobes of right lung with foci of necrosis (Figure 1).
Initially, We considered pneumonia as a possible diagnosis, which needed to be identified with lung cancer or pulmonary tuberculosis, and Antibiotic therapy with intravenous piperacillin-sulbactam was initiated. To make a definitive diagnosis, we performed a flexible bronchoscopy (Figures 2A-C), revealing purulent secretions in the medial and lateral segments of the right middle lobe (RML), drastically obstructing the lumen. After suction, the purulent secretions of the medial segment were reduced and the lateral segment was unobstructed. Then, bronchial brushing (BB), bronchial biopsy, and bronchoalveolar lavage were performed in the medial segment of the RML. Bronchial mucosal biopsy and BB specimens revealed only non-specific inflammation of the mucosa, and no pathogens were observed in the bronchoalveolar lavage fluid (BALF) through routine specimen smear and culture. On the third day after admission, the patient had no fever and continued to receive intravenous piperacillin-sulbactam therapy. To reduce secretions and search pathogens, we performed a second flexible bronchoscopy (Figures 2D-F), showing purulent secretions in the medial segment of the RML and the anterior segment of the right upper lobe (RUL). The BALF sample of the second time was sent for microbiological analysis. We took an appropriate amount of BALF samples for Gram staining, which is blue-purple (Figure 3). The BALF specimen was vortexed and shaken for 30-60 s. We used a sterile tool to spread a 10 muL calibration sample on the surface of the blood plate. The inoculated blood plate was incubated at 35 C for 48 h in a carbon dioxide incubator (5-10% CO2). The colony growing on the culture medium was smeared on a target plate. After drying, it was covered using a 1 muL Bruker matrix solution. When it was dry, the target plate was loaded into the machine: Microflex LT (Bruker Daltonics, Bremen, Germany). Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF/MS) for the identification of pathogens was performed, and Actinomyces graevenitzii was identified from the BALF. These results indicated that the pulmonary lesion of our patient was caused by A. graevenitzii. After administration of antibiotic treatment with piperacillin-sulbactam for ten days, the clinical condition of the patient improved obviously, and the CRP dropped to 29.34 mg/L, though the pulmonary lesions on the chest CT scan (Figures 4A-D) were not significantly absorbed. The patient was discharged with oral amoxicillin-clavulanate. A timeline with all relevant data from this clinical case is available in Figure 5. At the 7-month follow-up, the clinical condition of the patient was getting better and the chest CT scans (Figure 4) revealed that the consolidation shadow of the right lung was gradually absorbed. | actinomyces graevenitzii, bronchoscopy, consolidation, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry, pulmonary actinomycosis (pa) | Chest computed tomography images at admission. A consolidation shadow in the right upper and middle lobes, with necrosis containing foci of air. lung window. |
|
PMC9226341_01 | Male | 47 | A 47-year-old man was admitted to the Department of Pulmonary and Critical Care Medicine, Beijing Luhe Hospital, Capital Medical University (Beijing, China) with a 3-month history of mucopurulent expectoration and dyspnea. He was initially diagnosed with bronchitis at a health center in the local town and did not undergo chest radiography and laboratory tests. He received intravenous antibiotics for 14 days, but his symptoms were not relieved. Three days before admission, he started having a fever with a maximum temperature of 39.0 C. He did not report chest pain, hemoptysis, headache, vomiting, and other symptoms. His past medical history was unremarkable with no exposure to chronic diseases, infectious diseases or allergy. The patient was a worker and lived in an urban setting. No data on major epidemic, family history, toxic habits, or occupational exposure was reported. He was married and denied any sexually transmitted infections or drug abuse. He had a 30-year smoking history (20 cigarettes per day on average) and a 20-year history of alcohol intake of a 150 mL daily.
At admission, the patient was febrile with a temperature of 38.9 C, tachycardiac (107 beats/min), and tachypneic (22 breaths/min). His blood pressure (110/80 mmHg) and oxygen saturation (99%, measured by pulse oximetry while breathing ambient air) were normal. Examination of the oral cavity showed poor hygiene. There were wet rales in the right lung. The auscultation of the heart revealed regular rhythm without murmur. The abdomen was tender, and there was no organomegaly. No abnormal findings were found in the neurologic examination.
The laboratory data was as follows: the peripheral blood white cell count was 8,740 cells/mul with 78.40% neutrophils, and 14.10% lymphocytes, and 6.70% monocytes; hemoglobin 110 g/L, the hematocrit 34%, the platelet count 447,000 per cubic millimeter. The C-reactive protein (71.67 mg/L), and erythrocyte sedimentation rate (100 mm/h) were significantly elevated. The PCT was mildly increased (0.13 ng/ml). Biochemical analysis of liver and renal showed normal range except slightly decreased albumin (32.1 g/L). Coagulation profile was normal and the serum tumor markers were negative. The results for possible connective tissue disease, such as antinuclear antibody, extractable nuclear antigen, and antineutrophil cytoplasmic antibody, were also negative. The serum IgM antibodies specific for respiratory pathogens, including Legionella pneumophila antibody, Mycoplasma pneumoniae antibody, Chlamydia pneumoniae antibody, influenza A virus antibody, and influenza B virus antibody, revealed no abnormality. The serum (1,3)-beta-D-glucan test (G test), the galactomannan test (GM test), and the serum TB test (T-SPOT) were all negative. The results of two blood cultures were negative. No pathological findings were detected in repeated sputum smears and cultures. A chest computed tomography (CT) scan showed a consolidation shadow in the upper and middle lobes of right lung with foci of necrosis (Figure 1).
Initially, We considered pneumonia as a possible diagnosis, which needed to be identified with lung cancer or pulmonary tuberculosis, and Antibiotic therapy with intravenous piperacillin-sulbactam was initiated. To make a definitive diagnosis, we performed a flexible bronchoscopy (Figures 2A-C), revealing purulent secretions in the medial and lateral segments of the right middle lobe (RML), drastically obstructing the lumen. After suction, the purulent secretions of the medial segment were reduced and the lateral segment was unobstructed. Then, bronchial brushing (BB), bronchial biopsy, and bronchoalveolar lavage were performed in the medial segment of the RML. Bronchial mucosal biopsy and BB specimens revealed only non-specific inflammation of the mucosa, and no pathogens were observed in the bronchoalveolar lavage fluid (BALF) through routine specimen smear and culture. On the third day after admission, the patient had no fever and continued to receive intravenous piperacillin-sulbactam therapy. To reduce secretions and search pathogens, we performed a second flexible bronchoscopy (Figures 2D-F), showing purulent secretions in the medial segment of the RML and the anterior segment of the right upper lobe (RUL). The BALF sample of the second time was sent for microbiological analysis. We took an appropriate amount of BALF samples for Gram staining, which is blue-purple (Figure 3). The BALF specimen was vortexed and shaken for 30-60 s. We used a sterile tool to spread a 10 muL calibration sample on the surface of the blood plate. The inoculated blood plate was incubated at 35 C for 48 h in a carbon dioxide incubator (5-10% CO2). The colony growing on the culture medium was smeared on a target plate. After drying, it was covered using a 1 muL Bruker matrix solution. When it was dry, the target plate was loaded into the machine: Microflex LT (Bruker Daltonics, Bremen, Germany). Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF/MS) for the identification of pathogens was performed, and Actinomyces graevenitzii was identified from the BALF. These results indicated that the pulmonary lesion of our patient was caused by A. graevenitzii. After administration of antibiotic treatment with piperacillin-sulbactam for ten days, the clinical condition of the patient improved obviously, and the CRP dropped to 29.34 mg/L, though the pulmonary lesions on the chest CT scan (Figures 4A-D) were not significantly absorbed. The patient was discharged with oral amoxicillin-clavulanate. A timeline with all relevant data from this clinical case is available in Figure 5. At the 7-month follow-up, the clinical condition of the patient was getting better and the chest CT scans (Figure 4) revealed that the consolidation shadow of the right lung was gradually absorbed. | actinomyces graevenitzii, bronchoscopy, consolidation, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry, pulmonary actinomycosis (pa) | Chest computed tomography images at admission. A consolidation shadow in the right upper and middle lobes, with necrosis containing foci of air. mediastinal window. |
|
PMC7590635_01 | Male | 63 | This case study was approved by the relevant institutional review board and informed written consent was obtained from the patient for publication of this case report and accompanying images.
A 63-year-old man was admitted to the spine department with intractable back pain as the main symptom, and diagnosed with infectious spondylitis with discitis on MRI. He underwent more than three months of conservative treatment with antibiotics and orthosis in a local clinic. The patient had progressed to a collapsing disc space, and infectious spondylitis at the L3-4 level with an epidural abscess (Fig. 1).
Epidural abscess drainage through posterior decompression and morselized interbody bone graft with pedicle screw fixation was performed (Fig. 2). The first day after surgery, the patient presented with restlessness and disorientation without neurological symptoms. We consulted the psychiatric department and the patient was scheduled for oral medication. Thirty minutes later, the patient suddenly showed a mental change; he fell into a semi-comatose mental state without seizure-like activity and asphyxia. He was unresponsive to any voice or pain stimulation, except for voluntary lower extremity movement (hip, knee, and ankle contractions). The skin of the whole body was reddish and warm, but afebrile. The pupil light reflex was intact. Hemoglobin was 10.4 g/dL; blood pressure was approximately 108/67 mmHg; self-respiratory rate was 30-40 times per minute; heart rate, 120 beats/min. Oxygen saturation of 96% in room air. A finger-stick blood sugar level was 128 mg/dL. The intravenous parenteral fluid was normal saline.
We urgently consulted a neurologist and examined the emergent brain computed tomography (CT) and perfusion brain CT. There was no infarction or hemorrhage in the brain from the radiologic results, and we were informed that semi-comatose mentality was not the cause of brain disease. However, the neurologist did not rule out a silent seizure, and recommended aspirin and statin administration under Levine tube insertion. A lorazepam injection was performed due to suspected silent stroke and prevention of transient ischemic stroke. Arterial Boold Gas Analysis (ABGA) and laboratory results showed an increase in lactic acid, CK, and anion gap with a decrease in pCO2. As for the result of CK-MB, the possibility of cardiac origin was low. The respiratory rate was 30-40 times per minute in the state of compensatory hyperventilation due to lactic acidosis. Systolic blood pressure was maintained at around 100 mmHg, and urine output was below 50cc/Hr. However, there was a possibility of transition to a septic condition. An infection specialist recommended the prescription of cefazolin with vancomycin and ceftriaxone prior to obtaining the intraoperative culture results. The patient's inputs and outputs were monitored and balanced, as was ABGA, and frequently followed up. The patient's status was conferred to his family and we admitted him to the Surgical Intensive Care Unit (SICU) for observation.
The patient stabilized, and 10 h later started waking from the semi-comatose mental state. Upon regaining full consciousness, he stated that he had drunk half of a bottle of hand sanitizer (70% ethanol, 3 M Health care, St. Paul, MN) which had been placed at the foot of the bed to assist in the prevention of infection transmission during the COVID-19 pandemic. We confirmed the amount to be approximately 300-400 mL. The patient did not have a history of alcohol consumption or psychiatric medication and had no dependence. The blood alcohol level was slightly elevated at 100 mg/100 mL.
The patient complained of heartburn in the epigastric area; a gastroscopy was performed and a duodenal ulcer was diagnosed. He was treated for the ulcer with proton pump inhibitor medication, without gastric lavage. Delirium was controlled with haloperidol through psychiatric consultation.
After discharge, there were no adverse problems at the operation site of the infectious spondylitis. After seven months he had achieved complete bone union (Fig. 2), resolved the inflammatory reaction, and independent ambulation. | ck, creatinine kinase, ck-mb, creatinine kinase myocardial band, ct, computed tomography, delirium, ethanol sanitizer intoxication, infectious spondylitis, mri, magnetic resonance imaging, postoperative spine surgery | Not supported with pagination yet | null |
PMC7567047_01 | Female | 46 | A 46-year-old female patient with a history of chronic cough and sputum emission since the age of fourteen was admitted for right chest pain with purulent sputum. She had no history of tobacco smoking or noxious fume exposure. No past history of tuberculosis was found. On physical examination, she had bilateral crackles at the lower field of both lungs. The chest x-ray showed dilation of the tracheal clarity and bilateral bronchiectatic lesions in the bases (Fig. 1). The routine blood analysis and blood gas analysis were within normal rates. The pulmonary functions tests were within normal limits (FVC = 2.45L (85%), FEV1 = 2.22L (90%) and FEV1/FVC = 91%). For further investigation, a thoracic Computed Tomography was ordered. It disclosed dilation in the trachea and in the main bronchi along with cystic bronchiectasis in both lung bases. Bronchoscopy confirmed the presence of an irregular dilation of the bronchial wall of the trachea and stem bronchi with exaggerated collapsibility upon cough or expiration along with abundant secretions. There was no growth on culture tests of the aspirated bronchial secretions. The diagnosis of tracheabronchomegaly was made. The patient was treated with antibiotics (amoxicillin-clavulanic acid) and chest physiotherapy. She was advised Pneumococcal and Influenza vaccination. The course was marked by the occurrence of moderate infectious episodes that did not requiring hospitalization. After twelve years of follow up, a control CT scan revealed multiple tracheal diverticulain addition to the dilation of the trachea (42 mm) and the main bronchi (Right = 22 mm, Left = 24 mm) and the pre-existent bronchiectasis (Fig. 2. The pulmonary function showed a mild obstructive ventilatory deficit was found FVC = 1.89L (73%), FEV1 = 1.34L (62%) and FEV1/FVC = 71%. Otherwise, the patient was clinically stable. | bronchoscopy, computed tomography, mounier-kuhn syndrome, tracheal diverticulum, tracheobronchomegaly | Not supported with pagination yet | null |
PMC3775673_01 | Female | 37 | A 37-year-old female with retroviral disease was brought to casualty by caregivers because she was confused. The confusion was preceded by severe headache for 3 weeks. She had no history of vomiting or neck stiffness. She had started antiretroviral drugs 2 months earlier and subsequently defaulted.
On initial clinical examination, the patient was confused (not orientated to time, place, or person), pyrexial, and pale. She was normotensive (108/80 mmHg) but had a tachycardia of 107 beats per minute. The cardiac examination was otherwise normal. She was tachypneic with a respiratory rate of 22 breaths per minute and crackles throughout both lung fields. Neurologic examination identified neck stiffness without localizing signs.
Blood tests, microbiology, lumbar puncture analysis, and a chest film were done (Tables 1-6 and Figure 1). The patient had normocytic normochromic anemia, hyponatremia, and a slightly raised alanine transaminase. Her viral load was raised (678,233 copies/mL) and her CD4 count was low (155.28 x 106/L). Cerebrospinal fluid analysis showed an increase in lymphocytes, a raised protein level, and decreased glucose (Table 4). India ink staining and a Cryptococcus latex antigen test were both negative (Table 4). Sputum analysis and blood cultures were negative for Mycobacteria (Table 7).
The anterior-posterior supine chest film with the patient rotated to the right (Figure 1) showed bilateral nodular infiltrates with hilar and mediastinal lymphadenopathy not excluded. A veiling pleural effusion was noted on the left, and the left cardiac border was obscured by confluent opacification in the lingular segment of the left upper lobe.
The patient was initially assessed as having disseminated tuberculosis with central nervous system involvement, specifically meningitis. She was admitted to the medical ward and started on antituberculosis therapy, glucocorticosteroids, and supportive care.
On day 2, the patient developed both inspiratory and expiratory stridor and her initial respiratory distress worsened, with the respiratory rate increasing to 46 breaths per minute. The patient was started on adrenalin nebulization. The patient was intubated in theater and then transferred to the high care ward with a T-piece attached to the endotracheal tube. The glottis appeared normal during endotracheal intubation. At this point she was normotensive (113/73 mmHg), tachycardiac (152 beats per minute), and tachypneic (54 breaths per minute). Her oxygen saturation was 94% on 40% oxygen via a T-piece. A computed tomography (CT) scan of her brain and chest were requested. Unfortunately, the CT scanner at the base hospital was not working and the patient was deemed too unstable for transport to a CT scanner 2 hours away. High-dose cotrimoxazole, piperacillin/tazobactam, and amikacin were initiated. The patient remained pyrexial with a temperature of 38 C.
On day 4, the patient's oxygen saturation dropped to 92% and her arterial oxygen was 59 mmHg on 40% oxygen. Her chest film suggested a left-sided pleural effusion. Her blood pressure was also decreasing and central venous pressure was low (0 cm H2O). The central venous pressure was optimized and inotropic cardiac support was initiated. The patient's level of consciousness improved.
On day 7, she developed worsening hepatic impairment so her treatment was changed to a "liver-friendly" tuberculosis regimen. Clinical improvement was noted (improved level of consciousness, pulse 104 per minute, blood pressure 94/68 mmHg, oxygen saturation 100% on 60% T-piece oxygen, central venous pressure 8 cm H2O, respiratory rate 36 breaths per minute) and it was decided to taper her inotropic support.
On day 12, the patient extubated herself. Her vitals at this point were as follows: pulse 102 per minute, oxygen saturation 98% on 40% face mask oxygen, respiratory rate 30 breaths minute, and blood pressure 147/71 mmHg. Vesicular lesions with a dermatomal distribution were noted on her buttock and the patient developed diarrhea. The endotracheal tube and stool were sent for microbiologic analysis (Table 7). Approximately 9 hours later, the patient desaturated and was reintubated. The patient then underwent a tracheostomy.
The following day she suffered a cerebrovascular accident with left hemiplegia. The patient died later that day, approximately 2 weeks after admission. | human immunodeficiency virus, acquired immune deficiency syndrome, meningitis, stridor, tuberculosis | Not supported with pagination yet | null |
PMC3105561_01 | Male | 31 | A 31-year-old male presented with features of remaining aloof, sad, having prominent guilt ideas and entertaining thoughts of causing self-harm. The symptoms had developed insidiously when his wife learnt about his extramarital affair with a known relative. After his wife left him, the feelings of low mood became more intense and he started to entertain suicidal thoughts. While driving his motorcycle in the night, he met with an accident and started to bleed profusely. He tasted his own blood and liked the smell and taste of it. Thus, the frequent incidences of wrist cutting started so that he could suck his own blood. The act would be preceded by a mounting tension and arousal and subsequent relief would be noted later. He would break bottles and, with the glass pieces, would slash his palm, wrist and feet to see and feel the blood. He would also chew the glass pieces and the hurt caused by the glass pieces to his cheek and lips would actually be enjoyed by the individual. He even resorted to head banging so that the injuries caused to the scalp would produce more blood. As his unusual behavior was noted, he was admitted to the psychiatric center. While he was admitted to the hospital, he remained symptomatic. He was noted to remain quiet and aloof only to be shattered with episodic outbursts of intense anger and aggression. He assaulted other inpatients and derived pleasure from this fact. The episode lasted from 15 to 30 min and subsided on its own. The individual would remember the incident, but would give no reasonable explanation for his acts of violence.
He even consumed dettol solution with the intent to taste it after there was insurmountable anxiety before the act. He denied history of seizures, head injury or amnesia. There was no history suggestive of psychoses. He denied having any guilt ideas for his acts of aggression and denied a past history of similar episodes. He accepted consuming alcohol on several occasions but denied the relation of carrying out his episodic outbursts of violence to alcohol intake. Detailed premorbid history revealed him to be a rebellious student who had made violent protests during student election campaigning and even stabbed an opponent leader. He was also rusticated from school for several months. He had one broken love affair in college.[ ]
A detailed medical evaluation and central nervous system evaluation were not significant. All hematological and biochemical parameters were within normal limits. Computed tomography (CT) scan and electroencephalogram (EEG) were normal. Mental state e xamination revealed him to be a depressed individual who had passive suicidal ideations with deranged biodrives. No thought disorder or perceptual anomalies were noted. Psychometric tests were carried out, which revealed the following:
Rorschach test revealed impulsivity, poor ego strength, no paranoid traits but low productivity.
Personality inventory showed him to be irritable, with impulsive traits, and a cyclothymic mood.
Bender Gestalt test : Organizational disturbances and poor visuomotor sequencing were noted.
BDRS score of 16, which showed mild to moderate depression.
He was managed with behavioral therapy, individual therapy, selective serotonin reuptake inhibitors that included Cap. Fluoxetine 20 mg OD and mood stabilizers that included Tab. Divalproex 1 g BD and Tab. Lamotrigine 50 mg BD. A typical antipsychotic that included Tab. Largectil 1800 mg/day was added along with Tab. Propanolol 40 mg BD. Gradually, his spouse also agreed and was initiated in the therapy, which proved beneficial. After 6 months of follow-up, the individual remained asymptomatic and there were no incidents of episodic outbursts or undirected aggression. There was no evidence of prominent depressive cognitions. | gratification, intermittent explosive episodes, relief | Not supported with pagination yet | null |
PMC10203041_01 | Male | 46 | A 46-year-old man was transferred to our hospital due to an unexpandable lung after a closed thoracostomy for his spontaneous pneumothorax (Fig. 1A and B). It had occurred 4 days before the visit of the other hospital. He had a history of recurrent pneumonia. He had a gout without receiving corticosteroid therapy and was a 30 pack-year current smoker. His chest computed tomography (CT) scans showed a cavitary consolidation in the left upper lobe and micronodules in the right upper lobe (Fig. 1C). His left lung showed structural changes including emphysema and hypoplasia (Fig. 1C). Incidentally, left pulmonary artery agenesis was noticed in his CT scans (Fig. 1D). We inserted an additional chest tube. We did acid fast bacilli stains (AFB), mycobacterial cultures, and M. tuberculosis PCR test in his sputa and pleural fluid. We also did a bronchoscopy test for further evaluation of TB due to negative results of AFB stain and Mycobacterium tuberculosis PCR test in his sputa and pleural fluid. His bronchoscopic specimens also showed negative results of AFB stain and M. tuberculosis PCR test. We removed his chest tubes after confirmation of fully expended his left lung on a chest radiography. He discharged from our hospital.
One month after his discharge, he revisited to our emergency department due to dyspnea. We found out a recurrent pneumothorax in his left lung and inserted a chest tube. NTM was isolated from all mycobacterial cultures in his sputa, bronchoscopic specimen, and pleural fluid, and M. intracellulare was identified from all positive NTM cultures. We started azithromycin (250 mg/day), rifampin (600mg/day), and ethambutol (800mg/day), and amikacin (1g intravenous tree times per week) for treating his M. intracellulare pulmonary disease and pleural infection. His lung was expanded well after a closed thoracostomy and discharged after chest tube removal.
We achieved a culture conversion after 4 months of treatment initiation. We stopped the intravenous amikacin after 6 months due to a development of hearing loss. We maintained the regimen for 16 months, and culture conversion maintained at the end of treatment. There was no recurrence at 6 months after treatment completion. | host factor, nontuberculous mycobacterial pulmonary disease, structural lung disease | Not supported with pagination yet | null |
PMC5601955_01 | Female | 70 | Twelve non-amputees (five males and seven females, ages 23-30) and two amputees participated in the study. One amputee had a unilateral transfemoral amputation (70 years old and 35 years after amputation), whereas the other had a unilateral, transtibial amputation (72 years old and 22 years after amputation). The transfemoral amputee was trained in using the MPR system, while the transtibial amputee was a novice.
UMC (Figure 1A): a circumferential electrode made of conductive fabric (silver-plated knitted fabric) was dampened with a small amount of water to decrease skin-electrode impedance and tied around the most proximal third of the thigh. Sixteen Ag/AgCl adhesive electrodes (disposable, pre-gelled Ag/AgCl, 1-cm diameter) were placed below the band (more distally on the leg) and equally spaced around the thigh. The gap between the electrodes and the band was approximately 4 cm. Differential measurements were recorded between each of the electrodes and the common circumferential electrode (CCE) (Figure 1D). The configuration is monopolar, due to the use of the CCE as a reference for the other adhesive electrodes.
TBC (Figure 1B): eight pairs of pre-gelled electrodes were placed over the following eight muscles at an inter-electrode distance of 4 cm: sartorius, tensor fasciae latae, vastus medialis, rectus femoris, vastus lateralis, gracilis, the long head of the biceps femoris, and semitendinosus. The stump of the transfemoral subject was long enough to identify all the muscles.
TMC (Figure 1C): for each pair of electrodes in the TBC, a third electrode was placed in between. The CCE was dampened and tied around the proximal third of the thigh. We recorded differentially between each of the eight electrodes and the average potential of the area covered by the CCE.
Non-amputees sat on a raised seat, allowing their feet to hang freely. This precaution was taken to ensure that patterns used for discriminating movements of the foot (ankle plantarflexion/dorsiflexion) were not generated by ground reaction forces. In one experimental session, sEMG signals using a targeted bipolar configuration (TBC) and a targeted monopolar configuration (TMC) were simultaneously acquired. In a different session, an untargeted monopolar configuration (UMC) was used (Figure 1). Amputees participated in both experimental sessions on two different days, and non-amputees were randomly divided into the two sessions (six each). Figure 1 shows the recording configurations as follows:
A reference electrode used for all recording configurations was placed on the contralateral wrist over the distal end of the ulna (Figure 1E).
The system used for sEMG acquisition was developed in-house and based on the RHA2216 chip (Intan Technologies, USA), with embedded filter (a third-order, Butterworth, low-pass filter with cutoff at 750 Hz and a first-order, high-pass filter with cutoff at 1 Hz). The system amplified the myoelectric signals from 16 channels with a gain of 200 times, and digitalized them with 16 bits of resolution at a 2-kHz sampling rate. Before proceeding to data acquisition, sEMG signals from all channels were checked to ensure the devise was functioning correctly. The data acquisition, signal treatment, pattern recognition, and real-time evaluation all used an open-source software (BioPatRec) for decoding motor volition using MPR.
The participants were instructed to follow a graphical user interface showing the movements to be performed (Figure 2), along with a progress bar signaling the duration of each contraction. The recorded movements were as follows: knee flexion/extension, ankle plantarflexion/dorsiflexion, hip rotation medial/lateral, and tibial rotation medial/lateral. The amputees were asked to execute the movements as naturally as possible, focusing on their phantom leg. All participants were also instructed to perform the movements at a comfortable speed, avoiding abrupt contractions or jerks, as these would introduce motion artifacts in the signals. Once participants reached the end of their range of motion, they held the position for the remaining part of the contraction time, and then relaxed. For each movement, sEMG signals were collected in three consecutive repetitions of 4 s each, in which each repetition was followed by 4 s of rest. The subjects were asked to execute the movements at approximately 70% of their maximal voluntary contraction (according to their subjective estimation) to prevent premature fatigue. Before proceeding with the actual data collection, each subject executed one preparatory recording session to become familiar with the system. The recordings are available online in the repository of bioelectric signals of BioPatRec, under the name 8mov16chLowerLimb.
Data recorded during the contraction time usually contain absent or transient sEMG signals due to a delay between the movement prompt and the actual execution, or anticipatory relaxation of the muscles. We reduced the impact of ambiguous information by discarding 15% of the signal at the beginning and at the end of the contraction time. This yielded trimmed contraction periods of 2.8 s each, which were then concatenated resulting in 8.4 s of total contraction signal. The signal obtained was subsequently divided, or segmented, into time windows of 200 ms, with 50 ms time increment. The segmentation produced 163 time windows for each movement, and from each time window four sEMG signal features were extracted per channel (mean absolute value, wave length, slope changes, and zero crossings). The features extracted from all channels in a given time window formed a feature vector. The 163 features vectors corresponding to each time window were then randomly assigned to the classifiers' training, validation, and testing sets in the following respective proportions: 40, 20, and 40%.
Selection time: time elapsed between the first prediction different from rest and the first correct prediction. The shortest selection time possible was 211 ms (200 ms of the first time window plus the processing time before the prediction is available).
Completion time: time elapsed between the first prediction different from rest (as in the selection time) and the 20th correct prediction. The shortest completion time possible was 1.16 s.
Completion percentage: the percentage of motions that were completed; or the motions that reached 20 correct predictions before the 10 s timeout.
Real-time accuracy: only calculated for completed motions and accounts for the number of predictions needed to obtain 20 correct predictions. For example, if the completion time took 25 time windows, the real-time accuracy would be 80%.
The "rest" condition was considered as a movement or class, resulting in a classification task of nine patterns. Linear Discriminant Analysis in a One-Vs-One topology (LDA-OVO) was used for classification. Immediately after the classifier was trained, the real-time performance in each electrode configuration was evaluated with the Motion Test, as it is implemented in BioPatRec. The Motion Test asks subjects to execute the trained movements that are presented to the user in random order Subjects performed the test twice. The following metrics were then evaluated:
The order in which Motion Tests were performed was randomized within the TBC and TMC groups. Two conditions were evaluated in random order with the UMC session: all 16 channels; and a subset of equally spaced 8 channels.
We investigated the real-time performance of two alternative electrode configurations (TMC and UMC) to the conventional, TBC. Testing for statistical significance was conducted only on the non-amputees owing to the small sample size of the amputee group, in which case-only descriptive statistics were used. The TBC and TMC configurations were investigated on the same subjects, and the classifier for the real-time classification task was trained using data collected within the same recording session. Consequently, the two groups were compared by using the Wilcoxon signed-rank test. The UMC configuration was analyzed on a different set of subjects. The comparison between TBC and UMC with 8 channels (UMC-8 ch), and the one between UMC-8 ch and TMC were performed with Wilcoxon rank sum test for independent samples. In addition, UMC was investigated in two variants, with 8 and 16 channels, to determine if additional channels could improve performance, as tested with Wilcoxon signed-rank. Statistical significance was considered at p < 0.05 with Bonferroni correction. | electromyography, myoelectric control, neurorehabilitation, pattern recognition, phantom limb pain, phantom motor execution, virtual reality | Not supported with pagination yet | null |
PMC7175444_01 | Male | 7 | We present the case of a 7-year-old boy who was diagnosed with plurimalformative syndrome at birth, presenting clinical features that could not be included in a specific syndrome. He was born at term after an uneventful pregnancy (mother followed isotretinoin therapy in the first two weeks of pregnancy), spontaneous delivery, birth weight = 3380 grams, APGAR score 10. A craniofacial dysmorphism was discovered: agenesis of the right auricle, severe dysplasia of the left auricle, bilateral external auditory canal atresia, microretrognathia, broad nose implantation - hypertelorism, mongoloid palpebral fissures, severe hypoplasia of the right and moderate hypoplasia of the left upper jaw, palpebral fissures asymmetry (left < right), lagophthalmia (2-3 mm bilaterally), nasolabial asymmetry (more significant on the right), oculomotricity deficiency (right eye abduction paralysis), clinodactyly of the fifth finger, bilateral flat foot.
Temporal bone computed tomography scan revealed dysplastic ossicles, unidentifiable stapes, and oval window, hypopneumatization of mastoid cells, hypoplasia of the tympanic cavity, without changes in the internal ear. The contour of the facial nerve in the mastoid segment was not clearly defined.
Following the investigations, the diagnosis of moderate conductive hearing loss in the left ear and severe mixed hearing loss in the right ear was established. On auditory brainstem response, the V wave was present at 70 dB HL in the right ear and 80 dB HL in the left ear. From 1 month and a half, hearing rehabilitation was made with bilateral BAHA Softband. Audiological reevaluation at age 4 revealed the following audiological profile: Auditory brainstem responses (ABR) on bone conduction - V-wave present at 10 and 20 dB HL in the left ear (LE) and at 20 and 30 dB HL in the right ear (RE), auditory steady-state response (ASSR) - between 60 and 70 dB HL in the LE and 80 and 90 dB HL in the RE.
SmartEP Intelligent Hearing System (IHS) equipment (Miami, Florida, USA) was used for ABR and ASSR. Air conduction was tested with headphones, for atretic ears, and with a B-71 transducer for bone conduction, held by one finger on the mastoid.
At 6 years and 8 months, a BAHA Attract was implanted on the left ear and three months later on the right ear. At 7 years and one month, we recorded the cortical auditory evoked potentials on the aided condition to quantify the maturation of the central auditory pathways.
The P1 CAEP records were obtained after 90 minutes of testing in a soundproofed room. The patient was placed on a chair, and he watched cartoons without sound during the procedure. The patient was using a bilateral BAHA Attract implantable prosthesis. The electrodes were placed according to the norms of the International Electrode System 10-20: the active Cz electrode was connected to the positive input of the amplifier, the reference electrode was positioned on the mastoid of the ear, and the ground electrode was placed at Fpz. To minimize the ocular artifacts, a supraorbital electrode was used, paired with an infraorbital reference electrode placed ipsilaterally. The level of impedance of the electrodes was maintained between 1-3 kOhms. A calibrated loudspeaker placed at 1 m distance in 0 angle emitted a speech stimulus, the "ba" syllable, at 70 dB nHL intensity. The stimulus rate was 1.10/s, duration 114875 microsec, for 512 sweeps, artifact rejection criterion at +- 100 microV. The stimulus CAEPSs recorded in response was analyzed by a SmartEP USB software from the Intelligent Hearing System.
The check-up audiogram performed at 7 years and 4 months of age showed hearing thresholds between 20 and 30 dB HL for the RE.
Neuropsychological functioning was performed at the age of 7 years and one month, by a clinical neuropsychologist using the Wechsler Intelligence Scale for Children - Fourth Edition (WISC-IV), adapted in Romania in 2012.
The assessment was based on oral/acoustic modality, which refers to the use of spoken language with auditory amplification (Baha Attract System), without visual instructions; the administration was possible without modifications, and all the tests were applied according to a standard procedure. The patient was administered ten subtests of the Wechsler Intelligence Scale for Children - Fourth Edition (WISC IV). WISC-IV measures general intelligence and specific indexes, including verbal comprehension, perceptual reasoning, working memory, and processing speed.
Verbal Comprehension Index (VCI) measures verbal concept formation. The subtests included are Similarities, Vocabulary and Comprehension.
Perceptual Reasoning Index (PRI) measures non-verbal and fluid reasoning. The subtests included are Block Design, Picture Concepts, and Matrix Reasoning.
Working Memory Index (WMI) measures working memory. The subtests included are Digit Span and Letter-Number Sequencing.
Processing Speed Index (PSI) measures the speed of information processing. The subtests included are Coding and Symbol Search.
The P1 wave was observed with normal morphology and a delayed latency (175 ms) for this age (Figure 1). No artifacts caused by BAHA were observed, as described by Rahne et al.. This latency value indicates that there is a delay in the maturation of the central auditory pathways. | baha system, children, cortical auditory evoked potentials (caeps), cortical auditory function, hearing loss | Not supported with pagination yet | null |
PMC8377557_01 | Female | 8 | A thirty eight years old female was diagnosed with SLE with mucocutaneous, musculoskeletal, haematological and renal involvement in April 2020. She is a dedicated kindergarten teacher who frequently involved in gardening work in the kindergarten compound for the past 15 years. The antinuclear antibody (ANA) and double-stranded DNA antibodies were positive. The ANA showed homogenous pattern with the titre of 1:1280. She was started on hydroxychloroquine 200 mg OD and prednisolone 40 mg OD upon diagnosis of SLE. She was treated as active lupus nephritis in view of heavy proteinuria of 3.39 g/24 h. Intravenous (IV) cyclophosphamide 500 mg was then given to treat her active lupus nephritis. 1 month after her first dose of IV cyclophosphamide treatment, she presented with high grade fever and altered consciousness with Glasgow Coma Scale of 14/15. On physical examination, she had left hemiparesis with 2/5 strength in both upper and lower extremities. There was neck stiffness but all the cranial nerves function were intact. Crepitations were heard over the right lung and a few rounded erythematous subcutaenous nodules were found over the forearms which may represent septic nodules. Abdominal examination was unremarkable. She was initially treated as meningoencephalitis with IV ceftriaxone 2 g BD and IV acyclovir 500 mg TDS.
The initial laboratory tests result were as shown in Fig. 1a. Hepatitis C virus, Hepatitis B virus and human immunodeficiency virus (HIV) screening were all negative. The sputum samples were negative for tuberculosis. Plain computed tomography (CT) brain was done which showed hypodensities at the right frontal region and right parieto-occipital region which may represents infective cerebritis or lupus cerebritis. Lumbar puncture was performed with an opening pressure of 15cmH2O and the cerebrospinal fluid (CSF) results were as shown in Fig. 1b. Her antibiotic was subsequently escalated to IV meropenem 2 g TDS and IV immunoglobulin 0.4 g/kg was given for 5 days in view of worsening sepsis.
Subsequent Magnetic Resonance Imaging (MRI) of the brain revealed more than two multifocal rim-enhancing intraaxial brain lesions with the largest lesion measured at 1.5 cm x 1.4 cm. Serial chest radiographs (CXRs) showed pulmonary nodules of varying sizes with upper lobe predominance and bilateral moderate pleural effusion. Contrast enhanced CT thorax demonstrated scattered clusters of lung nodules, mostly peripherally located, a few cavitations with air-fluid levels, suspicious of infective cavitating nodules. One liver and multiple splenic hypodense lesions were seen in the visualised upper abdomen, suspicious of microabscesses. Given the progressive imaging findings and lack of clinical improvement, anti-tuberculous agents were started empirically.
5 days later, both the blood and CSF cultures grew Burkholderia Pseudomallei. Her diagnosis was revised to disseminated melioidosis with CNS, pulmonary, spleen, bone and cutaneous involvement and the anti-tuberculous agents were discontinued. 2 weeks later, the full sensitivity report showed susceptible B. Pseudomallei towards trimethoprim/sulfamethoxazole, ceftazidime and meropenem with minimum inhibitory concentration of 2 ug/mL, 2 ug/mL and 1.5 ug/mL respectively. The antibiotics was then de-escalated to IV ceftazidime 2 g QID based on the sensitivity report. Blood cultures were repeated 1 week and 2 weeks post treatment which showed clearance of bacteraemia. MRI brain 3 weeks post treatment demonstrated treatment response as evidenced by reduction in the size of the largest brain lesion from 1.5 cm x 1.4cm to 0.9 cm x 0.8 cm. The number of intraaxial brain lesions was also reduced. However, new C2 and C3 vertebrae marrow osteomyelitis were observed. She completed 10 weeks of intensive therapy (2 weeks of IV meropenem and 8 weeks of IV ceftazidime) and was started on single strength trimethoprim/sulphamethoxazole (80 mg/400 mg) three tablets twice a day as eradication therapy. The strength of the left upper and lower extremities improved to 3/5 upon discharge.
The liver and spleen microabscesses resolved based on the repeated imaging. MRI brain and cervical was performed 20 weeks post treatment to decide on the duration of eradication therapy. MRI brain demonstrated a small residual right frontal lobe enhancing focus measuring 0.4 cm with no new cerebral lesion. MRI cervical showed improved osteomyelitis changes at C2 vertebrae. The strength of the left upper and lower extremities improved to 4/5 at this time. The eradication therapy was extended to 12 months in view of presence of cervical vertebral osteomyelitis and residual cerebral lesion. Currently, the strength of her left upper and lower extremities further improved to 5/5 and she is ambulating independently. Her SLE activity was well controlled with hydroxychloroquine 200 mg OD, azathioprine 50 mg OD and prednisolone 10 mg OD. | central nervous system melioidosis, systemic lupus erythematosus | Not supported with pagination yet | null |
PMC6626106_01 | Female | 92 | A 92-year-old Caucasian HIV-negative female presented with a 6-month history of a cough with yellow to brown sputum, involuntary loss of 2 kg with a generally slender body type, but no fever. The patient did not suffer from any other chronic condition and was HIV-negative. A chest radiograph showed a cavern in the right upper pulmonary lobe (Fig. 1A). In a CT scan the cavern had a 4.5 cm diameter in the right upper pulmonary lobe with accompanying infiltrations (Fig. 1B). Moreover, lymphadenopathy was found in the upper right hilum and in the mediastinum. Laboratory analyses revealed mildly elevated C-reactive protein (CRP) levels (41.3mg/L) and normal blood leukocytes. In the 1940's and 50's the patient was employed as a pediatric nurse and was exposed to patients with tuberculosis.
Indeed, microscopy analysis showed acid-fast bacilli in the sputum as well as in the bronchoalveolar lavage. However, the patient tested negative for a tuberculosis screening test, the interferon gamma release assay (T-SPOT) and M. tuberculosis complex DNA was not detected using amplification/PCR methods and culture analysis. Microbiological cultures revealed a Mycobacterium spp. infection and molecular genetic testing (GenoType Mycobacterium AS VER 1.0 , Hain-Lifescience) identified M. celatum.
Based on the above findings a standard antibiotic therapy of atypical mycobacteriosis including rifabutin, ethambutol and clarithromycin was started. Despite of the antibiotic treatment the patient is treatment patient's condition aggravated as she developed fever and fatigue. Additionally, CRP concentration in blood was rising. Drug susceptibility testing revealed a resistance against rifabutin (Table 1). Consequently, antibiotic therapy was adjusted using protionamid instead of rifabutin. Within two weeks, a clinical improvement was observed: the fever subsided and CRP levels decreased. The patient was therefore dismissed from the hospital. Antibiotic therapy was scheduled to continue for one year after sputum conversion. Unfortunately, the patient died at home ten weeks after the proper treatment was initiated. An autopsy was not performed due to the advanced age of the patient. | atypical mycobacterial infection, cavity, mycobacterium celatum, resistance, rifabutin | Not supported with pagination yet | null |
PMC9149543_01 | Female | 39 | A 39-year-old woman with a history of Stage IA breast cancer (ER weakly positive, PR negative, HER-2 negative) treated with bilateral nipple-sparing mastectomies 3 years prior, presented to the emergency department with 3 weeks of progressive dyspnea on exertion. Pulse was 108 and oxygen saturation (SpO2) on room air was 91% and 84% with ambulation requiring up to 3 L of supplemental oxygen via nasal canula. Physical exam was notable for a decrease in SpO2 while sitting upright which improved with lying in the supine position. Laboratory values were notable for platelet count of 89,000 K, calcium 11.2 mg/dL, alkaline phosphatase 627 U/L, aspartate aminotransferase 148 U/L, and alanine aminotransferase 143 U/L. Computed tomography of the chest with intravenous contrast pulmonary embolism protocol was negative for pulmonary embolism, but revealed numerous hepatic lesions and numerous sclerotic osseous lesions. Transthoracic echocardiogram (TTE) with saline contrast and bubble study revealed lack of bubbles in the left ventricle after cough and the presence of bubbles after 7 heartbeats, suggestive of a transpulmonary shunt (as shown in Fig. 1, 2). The patient underwent an ultrasound-guided biopsy of a liver lesion and was diagnosed with metastatic breast cancer (ER weakly positive, PR negative, HER-2 negative). She was started on chemotherapy with weekly paclitaxel at a dose of 60 mg/m2. After completion of a 3-week cycle of treatment, her hypoxia and supplemental oxygen needs resolved, and she had a significant reduction in her transaminases (as shown in Table 1). | hepatopulmonary syndrome, liver metastasis, metastatic breast cancer | Not supported with pagination yet | null |
PMC10404896_01 | Female | 15 | A 15-year-old girl was admitted to our hospital due to intermittent chest pain occurring for more than 2 months and cough and wheezing for 10 days. The patient was a student, and her family denied a history of malignancy. Chest examination revealed solid sounds obtained during percussion and low breath sounds over the left thorax.
The laboratory tests showed increased procalcitonin (26.59 ng/ml), elevated interleukin-6 (15.2 pg/ml), and a slightly high erythrocyte sedimentation rate of 28 mm/h. The patient underwent transcatheter thoracic drainage to determine the features of the pleural effusion, and a routine examination showed bloody turbid pleural effusion without tumor cells (Figure 1). However, the levels of carcinoembryonic antigen and lactic dehydrogenase in the pleural effusion were more than three times the normal upper limit. Acid-fast staining and tuberculosis gene sequencing of the pleural effusion were normal, helping us rule out the possibility of tuberculous pleural effusion.
A chest computed tomography (CT) scan showed a large soft tissue mass (15.7 x 11.7 x 10.5 cm) near the left mediastinum with multiple nodules and masses in the left pleura, and the fluid could be seen on the same side of the thorax (Figure 2a and b). Moderately heterogeneous enhancement with multiple small vessel shadows could be seen in the aforementioned mass and nodules after the injection of a contrast agent (Figure 2a and b). A radiological examination of the abdomen and brain revealed no other lesions.
A percutaneous puncture biopsy was performed to clarify the properties of this mass. Pathological examination showed a population of small, round, deeply stained tumor cells. The tumor cells formed clusters. Immunohistochemical results demonstrated strong positivity for CD99, FLI-1, and NKX2, which are the markers of EES. The cells were also positive for Ki-67 (approximately 30%). The tumor cells were negative for MPO, GFAP, CD30, EMA, CgA, desmin, and WT-1 (Figure 3). The negativity for these markers excluded lymphoma and glioma. After discussion by a multidisciplinary treatment (MDT) team, the mass was initially identified as ES derived from the mediastinum. Fluorescence in situ hybridization (FISH) suggested EWSR1 gene breakage and rearrangement (Figure 4). Based on the aforementioned results, the patient was diagnosed with left mediastinum ES with pleural effusion.
Considering the age, tumor size and properties, and the consensus from the MDT meeting, the patient received treatment with cyclophosphamide (1.8 g), adriamycin (doxorubicin) (75 mg), and vincristine (2 mg) (VDC) for the first cycle. After finishing one cycle of chemotherapy, a CT scan of the chest revealed that the tumor was approximately half its size before treatment, and the pleural effusion had decreased (Figure 2c and d). After approximately 3 weeks, the patient received cyclophosphamide (1.6 g), adriamycin (doxorubicin) (67.5 mg), and vincristine (1.8 mg) for the second cycle. After six cycles of treatment, the tumor was hard to observe, and no pleural effusion was observed (Figure 2e and f). The patient felt no chest pain and did not cough or wheeze. For the ongoing treatment plan, a regular chemotherapy will be continued, and the patient is advised to follow up. | extraskeletal ewing’s sarcoma, mediastinum ewing’s sarcoma, pleural effusion | Not supported with pagination yet | null |
PMC3959067_01 | Female | 12 | We report the case of a 12-year-old girl; she had a medical history of FH like her brother with tendon xanthomas of the upper and lower extremities [Figure 1]. She was operated two years previously for aortic stenosis associated with mitral valve regurgitation grade 3 without coronary artery disease [Figure 2]. She had a Ross intervention with mitral annuloplasty with positive results. Currently, she was admitted in emergency for acute coronary syndrome with negative ST and positive troponin I with initially stable hemodynamic constants. A transthoracic echocardiography was done which showed a dilated left ventricle with an ejection fraction of 61%, mitral regurgitation grade 2, absence of aortic insufficiency, and a good functioning of a Contegra tube in pulmonary position. The patient was directly sent to the catheterization laboratory where angiography showed stenosis of the distal left main trunk, subocclusive stenosis of the proximal circumflex coronary, a stenosis of the second and distal parts of the interventricular coronary, and proximal subocclusive stenosis of the right coronary artery [Figure 3]; it also showed stenosis of both left and right subclavian arteries [Figure 4]. She was hospitalized in the surgical intensive care unit and antianginal treatment was initiated. Her hospital course was complicated by the deterioration of hemodynamic status with several outbreaks of left heart failure related to mitral regurgitation grade 3-4 with a low ejection fraction of 35%, requiring the introduction of vasoactive drugs in gradually high doses.
The patient was operated and three aortocoronary grafts using the two saphenous veins taken at the thigh because of the presence of stenosis of subclavian arteries, in addition to the replacement of the mitral valve by a mechanical prosthesis. The postoperative course and medium-term follow-up were excellent with improved hemodynamic status and the disappearance of angina and dyspnea. | coronary artery bypass graft, hypercholesterolemia, pediatric | Not supported with pagination yet | null |
PMC6387706_01 | Female | 53 | A 53-year-old woman with small stature and dysmorphic features consistent with TS, not previously diagnosed with diabetes, presented to the endocrinology clinic for evaluation of episodes of hypoglycemia <20mg/dl with transient loss of consciousness. She was admitted to the inpatient service and underwent a controlled 72h fast. After 64h, she developed hypoglycemia to the low 30s mg/dl with mild neuroglycopenic symptoms (emotional outbursts). Biochemical workup showed unsuppressed insulin levels (1.2mIU/L), markedly elevated proinsulin (30 pmol/L), and BOHB levels (6500mumol/L).
MR and multiphase CT (Figure 1) showed a solid, hyperenhancing 2.5cm pancreatic tail mass with slow washout. 111In-pentetreotide (Octreoscan) study (Figure 2) demonstrated absence of radiotracer uptake ruling out a splenule. CT guided fine needle biopsy of the mass confirmed neuroendocrine etiology. Since Octreoscan sensitivity is not high, hepatic vein blood sampling after intra-arterial calcium stimulation was further performed and showed robust increase of insulin (9.4 to 17.8mIU/L) and proinsulin (7pmol/L to 20pmol/L) and high c-peptide levels at the distal splenic artery, consistent with insulinoma of the tail of the pancreas.
Surgical excision of the mass resulted in complete resolution of symptoms up to 3 years postop. Histologic examination confirmed a well differentiated neuroendocrine tumor with immunostainings positive for chromogranin and synaptophysin and a KI index of <2%. | null | Not supported with pagination yet | null |
PMC5403006_01 | Male | 28 | A 28-year-old man was referred to our hospital with a 2-week history of uveitis in his right eye. The best corrective visual acuity (BCVA) was 20/25 and ocular pressure was within normal range. Ophthalmoscopic examination of the right eye revealed fine keratoprecipitates and moderate cell infiltration into the anterior chamber and vitreous. No obvious retinal lesion was observed. However, fundus fluorescein angiography (FA) showed hyperfluorescence in the optic disc and a petaloid pattern of fluorescence pooling in the macula indicating cystoid ME. Despite initiation of topical corticosteroids, optic disc swelling, extensive preretinal and intraretinal hemorrhages developed a few weeks later. Vascular tortuosity associated with CRVO was observed in the right eye, and BCVA decreased to 2/200 due to ME and hemorrhage (Figure 1A). No systemic symptoms associated with Behcet's disease and no laboratory tests or chest CT scans suggesting sarcoidosis were found. Although there was no family history suggestive of TB and systemic source of TB infection was not identified on physical examination, TB-associated uveitis was diagnosed based on a positive TST and IGRA in addition to the ocular findings. Anti-TB therapy with rifampin, isoniazid, pyrazinamide, and ethambutol, together with monthly IVR and systemic corticosteroids (0.5 mg/kg), was initiated. After two IVR sessions, fundus findings associated with CRVO improved markedly, and ME was resolved except for persistent serous retinal detachment (Figure 1B). BCVA recovered to 20/25. However, before the fourth IVR session, severe retinal hemorrhage on the nasal side and VH were found in the right eye, with exacerbation of ME (Figure 2A). Although FA was required to evaluate non-perfusion area and the activity of ocular inflammation, it could not be performed since pruritus and nausea were observed at the first FA. In spite of continuation of IVR, VH progressed to obscure fundus observation, and BCVA decreased to hand motion. Therefore, vitrectomy and panretinal photocoagulation were performed. After surgery, iridocyclitis was observed, but it was controlled by topical corticosteroid, and anti-TB therapy was continued for 6 months and was suspended. Since a second vitrectomy with cataract surgery was given for recurrence of VH at 5 months after the first surgery, ocular inflammation in the right eye was resolved. However, BCVA remains at 20/200 due to disruption of retinal outer layers in the macula besides retinal ischemic region presented by hyperreflective image in retinal inner layers (Figure 2B). | vegf, central retinal vascular occlusion, ranibizumab, tuberculosis, uveitis | Not supported with pagination yet | null |
PMC10311070_01 | Female | 14 | The proband was a 14-year-old female who presented with a two-year history of reduced tolerance to physical exertion and subsequently experienced severe dyspnea, respiratory distress, and fatigue following exertion. The patient suffered a sudden cardiac arrest 2 h before arrival at the hospital, during which carotid pulsation and respiratory movement were absent. CPR and defibrillation were promptly administered by first-aid personnel, resulting in the return of heartbeats after 15 min and restoration of sinus rhythm. Nevertheless, the patient remained unconscious and exhibited no spontaneous breathing. The patient was transferred to the emergency department while receiving laryngeal mask ventilation and subsequently underwent tracheal intubation, positive pressure ventilation, fluid infusion, sedation, and analgesia. The patient was later transferred to the cardiac intensive care unit one hour after the cardiac arrest. The patient's parents denied any history of illness, especially cardiovascular disorders, and any family history of cardiac arrest or cardiovascular disease. Notably, no family member had a history of hypertension or coronary artery disease.
Upon arrival at the cardiac intensive care unit, the patient's blood pressure was approximately 92/63 mmHg, and arterial oxygen saturation was maintained at 97% through mechanical ventilation. Physical examination revealed the patient to be comatose with significant cardiac enlargement, thoracolumbar scoliosis, and muscle weakness.
The results of the blood gas analysis indicated extremely severe respiratory alkalosis (pH = 7.52, PCO2 = 24 mmHg, PO2 = 155 mmHg), electrolyte disturbance (K+ = 4.0 mmol/L, Na+ = 136 mmol/L, Cl- = 104 mmol/L, and Ca2+ = 0.99 mmol/L), and high lactate levels (4.8 mmol/L). Peripheral blood counts revealed an increased leukocyte count of 13.2 x 109/L. Blood biochemical tests demonstrated an elevated level of lactic dehydrogenase [494 U/L; normal range (NR) 109-245 U/L], while other renal and hepatic function parameters showed no apparent abnormalities. Thyroid function test results showed a decreased free triiodothyronine level at 3.2 pmol/L (NR > 4.3 pmol/L). Myocardial markers revealed significantly increased levels of troponin I (0.791 microg/L; NR < 0.2 microg/L), creatine kinase MB isoenzyme (11.75 microg/L; NR < 5 microg/L), and b-type natriuretic peptide (>5,000.00 pg/ml; NR < 100 pg/ml).
The electrocardiogram (ECG) revealed right axis deviation, biventricular hypertrophy, and ventricular escape beats (Figure 1A). Transthoracic echocardiography revealed significant hypertrophy of the left ventricular wall, particularly the interventricular septum (IVS) and left posterior ventricular wall (LVPW) (Figure 1C). In addition, cardiac magnetic resonance imaging (CMR) demonstrated diffuse hypertrophy of the ventricular myocardium. The thickness of each part during the diastolic period was as follows: LVPW, 28.3 mm; right ventricular anterior wall (RVAW), 8.3 mm; and IVS, 32.2 mm (Figure 1B, left panel). Additionally, the left ventricular ejection fraction (LVEF) measured by CMR was decreased (40.2%). Furthermore, the T2-weighted image revealed an abnormal signal intensity of the left ventricular subendocardial myocardium indicating myocardial ischemia (Figure 1B, right panel). It is noteworthy that the parents of the patient also underwent physical examinations and echocardiographic assessments conducted by cardiologists, revealing no indications associated with HCM.
We obtained a peripheral blood sample in an EDTA anticoagulant blood sample tube from the patient and stored it at 4 C for less than 6 h. DNA extraction was performed using the Blood Genome Column Medium Extraction Kit (Tiangen Biotech, Beijing, China) according to the instruction. Protein-coding exome enrichment was performed using the xGen Exome Research Panel v1.0. WES was performed using the Illumina NovaSeq 6000 platform (Illumina, San Diego, CA, USA), while primary quality control was performed using FastP, comprising process of the raw data and removement of filter low-quality reads. Variants were annotated in accordance with database-sourced minor allele frequencies (MAFs) and practical guidelines on pathogenicity issued by the American College of Medical Genetics. The sequencing data have been deposited in GSA database (http://ngdc.cncb.ac.cn/gsub/). MutationTaster software and combined annotation dependent depletion (CADD) scaled c-scores were used to predict the pathogenicity of variants, while GRCh37 reference genome was used for alignment. We searched database including gnomAD, ExAC and 1000G to identify prevalence of variants. Effects of genetic variants on protein structure were evaluated via PROVEAN protein batch software with Provean score. As there is no available protein crystal structure for ALPK3, AlphaFold database (https://alphafold.ebi.ac.uk/) tool is used to predict protein crystal structure. Within the structure, three important domains have been revealed with analyzed crystal structure. PyMOL software was used to annotate domains and variant sites of the protein. Then we performed modeling analysis and compared three domains with the 6c6m.2.A, 3uto.2.A, and 1ia9.1.A template via SWISS-MODEL database (https://swissmodel.expasy.org/), to visualize and analyze the altered amino acid sequence and stability of ALPK3. And other identified variants had been presented in Supplementary Table S1.
Based on the clinical manifestations and laboratory analyses, HCM induced by genetic anomaly was strongly suspected. Thus, WES was performed, which identified a novel compound heterozygous variant of c.3907_3922del (p.G1303Lfs*28) and c.2200A>T (p.R734*) in ALPK3 gene, while genomic coordinates of these two variants are chr15:85401269-85401285delGGCCTCCTGGGGGCCT and chr15:85384104A>T (depth of coverage is 236.34, percent of exome captured is 98.34%). The patient's parents presented normal cardiac morphology, thus, we employed Sanger sequencing to validate the genotypes of the parents of the patient (forward primer "agcccacacactccttgacc" and reverse primer "tacatcagagctgctgctgg" for c.2200A>T and forward primer "ctgtacctcccgccgcctca" and reverse primer "tcccctgggaacttctcctc" for c.3907_3922del), which revealed that each parent carries a heterozygous variant of the ALPK3 gene. The variant of c.3907_3922del was maternal inherit, and the variant of c.2200A>T was paternal inherit (Figures 2A,B). According to the American College of Medical Genetics, both variants have pathogenicity as PVS1+PM2_Supporting+PM3 (Trans), and both were related to familial HCM. According to updated data in gnomAD, ExAC and 1000G, these two variants have not been reported in any populations, that means it is the first report of these variants (Figure 2C). Analysis performed with MutationTaster revealed that variant of c.3907_3922del in ALPK3 was considered pathogenic (probability 1.000) due to nonsense-mediated mRNA decay (NMD), amino acid sequence changed, frameshift, protein features affected and splice site changes, while c.2200A>T was also considered pathogenic because of NMD, acid sequence changed, and protein features affected (probability 1.000). Besides, CADD scaled c-scores of variant c.2200A>T is 36, which implies that the predicted pathogenicity of the variant is extremely high. PROVEAN protein batch software indicated that the p.R734* protein was deleterious with the PROVEAN score of -4.79, due to frameshift and NMD of p.G1303Lfs*28, PROVEAN and SIFT prediction were not applicable. While all the reported variants of ALPK3 had been listed in Figure 2D.
The entire amino acid sequence crystal structure was predicted by AlphaFold and assigned the name AF-Q96L96-F1 (Figure 3A). Although the predicted protein covered the entire length of the amino acid sequence, only three domains demonstrated high confidence (pLDDT >70). These domains were labeled red, green, and orange (Figure 3B). Other regions displayed low confidence in the crystal structure. While all potential templates were searched, only partial parts of the protein had been analyzed previously. We picked structures with the highest predictive value, which may cause several parts do not have a specific folding. In a word, the AlphaFold-predicted structure was the only model that could be utilized. The c.2200A>T and c.3907_3922del variants would result in a protein-truncating variant, typically leading to protein denaturation. The sites of truncated sequences caused by variants were labeled in yellow (Figures 3C,D). SWISS-MODEL was then employed to present the crystal structures of the variant's three domains, including two immunoglobulin-like (Ig-like) domains and an alpha-type protein kinase domain (Figure 3B). An ig-like domain superfamily is a heterogeneous group of proteins that play the role of cell recognition. The alpha-kinase domain is an atypical protein kinase catalytic domain that exhibits no detectable similarity to conventional protein serine/threonine kinases. This protein kinase recognizes protein sequences that adopt an alpha-helical conformation by its initial members, which act as the final link and effector of intracellular information transmission. The identified ALPK3 variants, c.3907_3922del and c.2200A>T would cause truncated protein, leading to the loss of an Ig-like domain and an alpha-type protein kinase domain, resulting in the dysfunction of the ALPK3 molecule. The aforementioned analyses suggested that both newly identified variants could alter the transcription of the ALPK3 gene and damage the protein structures. Therefore, the compound heterozygous variant of ALPK3 was considered to be genetically associated with HCM in this patient. In addition, several heterozygous variants were identified by WES, such as c.4639A>G in the FBN1 gene, c.3791G>A in ANKRD26, and c.1123G>T in DPYS. However, all three genes were considered to exhibit recessive inheritance, and the pathogenicity predictions for these variants were uncertain. Furthermore, all of these variants were inherited from one of her parents, unaffected by associated diseases. Consequently, they were not considered to be associated with HCM.
Following comprehensive laboratory and echocardiographic assessments, the patient was diagnosed with HCM. A 6-week hospitalization period was instituted, during which the patient received a range of medical interventions, including invasive and noninvasive mechanical ventilation, myocardial protection, anti-arrhythmia, cerebral protection, anti-infection, anti-inflammatory, diuresis, and blood transfusion. Although there was residual muscle weakness, the patient was discharged from the hospital after partial recovery from her major concerns with respect to heart rhythm control and cardiac function. However, two weeks after discharge, the patient experienced recurrent cardiac arrest during rehabilitation training and subsequently regained consciousness. The patient was subsequently readmitted to our department, where mechanical ventilation and gastrointestinal decompression were provided to alleviate symptoms. Anti-infective therapy was initiated with cefoperazone and sulbactam, while captopril and metoprolol were prescribed to address HCM and inhibit potentially lethal arrhythmias. Nutritional and rehabilitation therapies were also administered. After a month of comprehensive medical management, including fluid infusion, diuretic therapy, and vitamin supplementation, the patient was discharged with improved symptoms. However, due to the prolonged duration of the condition and recurrent cardiac arrest, the patient had not regained consciousness and experienced severe cognitive and neurological impairment. Oral medication administration and continuous follow-up and evaluation were regularly conducted, with clinic visits scheduled every two weeks in the first month and every three months thereafter. | alpk3, case report, hypertrophic cardiomyopathy, novel variant, whole-exome sequencing | Not supported with pagination yet | null |
PMC3580894_01 | Male | 60 | The patient was a 60-year-old male Iraqi refugee in treatment for chronic PTSD and depression in the psychiatric out-patient clinic for PTSD and Transcultural Psychiatry in Aarhus, Denmark.
The patient had arrived in Denmark in 1993 and reported a history of persecution, arrest, detention, imprisonment, and torture in Iraq. He had been imprisoned for several months each time, including once the 1970s, once the 1980s and once in 1990s. Soon after his release from the last imprisonment, he left Iraq with his family. He reported having been subjected to various forms of torture, including severe beatings, flogging, electric shock, blindfolding, deprivation of food, water, and sleep, verbal abuse, mockery/humiliation, being stripped naked, and being deprived of medical care.
His reexperiencing symptoms included nightmares and intrusive images of the torture he had experienced under his imprisonment in the 1970s, 1980s, and 1990s. He showed substantial distress when faced with reminders of the torture and the imprisonment (e.g., residential areas, because it reminded him about the secret prison in Baghdad where he was imprisoned as a political prisoner). Moreover his nightmares about being tortured were very vivid, including smell and bodily sensations. After awakening he felt a painful sensation in the area where he had been whipped. The patient described, "Every morning, I feel the same pain as I did back then".
He displayed fear of having nightmares and his sleep pattern was severely disrupted. The patient avoided thinking or talking about the event, avoiding people of Arab descent and residential areas because it reminded him of his imprisonment. He reported significant levels of anger outbursts, difficulty in concentrating, and an exaggerated startle response. Pretreatment, the patient fulfilled the criteria for PTSD related to the torture, as well as having a major depressive disorder. In the period just before starting at the clinic, the patient had attempted to reduce his anxiety and irritability by using alcohol, though at the time he started treatment he had stopped this behaviour. The patient was reassured about confidentiality by emphasizing that information would not be made available to a third party without his permission, and that it would only be used for publication in professional journals. The patient gave informed consent for publication.
The treatment manual was developed with in the theoretical framework of the emotional processing theory according to Foa and Kozak, the cognitive model of posttraumatic stress disorder according to Ehlers and Clark, and narrative exposure therapy according to Schauer et al.. Foa and Kozak developed the emotional processing theory as a theoretical framework for the development of PTSD pathology and ways to correct this pathology in treatment. In this theory, it is assumed that the memory of the traumatic incident is stored in the memory as a fear structure designed as a programme to avoid danger in the future. For treatment to be effective, the pathological elements of the fear structure must be corrected, which can only be achieved if the fear structure is activated and if new information that is incompatible with the existing information in the fear structure is introduced. In addition to the emotional processing theory, cognitive models of PTSD have also emphasized the role of fear activation in effective treatment. For example, Ehlers and Clark underscore the need to relive the trauma in recollection so that elaboration and contextualization of the trauma memory can take place and negative assumptions about recalling the trauma can be tested. Schauer et al. emphasize that patients with PTSD often fail to integrate traumatic experiences into the narrative of their lives. Hence the patient cannot report the traumatic experience in a consistent, chronological order and thus has no explicit link between the various events, life experiences, and context within which the events occurred. The treatment conducted in this case study was individual, the sessions lasted for 60 minutes, and were scheduled once a week for a total treatment period of 10 months. In this 10-month period the patient attended 20 sessions and cancelled six sessions due to sickness.
Sessions 1 to 3 were a combination of initial interview and diagnostic assessment. During these sessions the patient identified the events which were most traumatic in his lifetime and identified the trauma that seemed to be causing him the most distress. This traumatic experience was then selected to be the primary focus of treatment.
Imagine that our memory is like this bookcase in my office. We have recollections of past experiences, and these recollections are chronologically stored in our autobiographical memory like the books in this bookcase. We have a recollection about our first day at school (the therapist takes a book from the bookshelf).
In this recollection the book has stored all the information about what was happening that day, what we experienced and what we felt at that place at that time in our life. Like this book, we can bring forward the recollection about the event and generate images and emotions from that day. As with reading from the book, and we can put it back where it belongs in our autobiographical memory (the therapist puts back the book on the bookshelf).
We can bring forward another recollection from our life for example, our last day at school, and look at it, and we have then the feeling that this recollection is closer to the present.
Unprocessed traumatic memories are not properly stored in our autobiographical memory as they are with this book (the therapist takes a book and places it on top of the other books in the bookcase).
Your brain is trying to integrate this memory, but every time it appears you try to avoid thinking about it because it gives you the same feeling as when it happened. As a result, you throw the book back on top of the other books in the bookcase, thus preventing yourself from processing the traumatic memory and storing it in its proper place in your autobiographical memory.
In this treatment, we will give you the opportunity to look at your life, especially with this book. This will give you an opportunity to view your life, particularly in relation to the traumatic event and its meaning from your perspective today, knowing that you are safe here, rather than from the perspective of the past when it was still terrifying.
So the goal of revisiting the past is to enable you to have thoughts and feelings about the past and about the trauma, to talk and think about it without getting so upset or anxious that it disrupts your life. In this way, we will help you to make sense of the terrible experiences and process the trauma.
Session 4-5 were psychoeducation about PTSD and the rationale for the treatment. The patient was told that PTSD symptoms are a common response to extreme and harmful experiences and that imprisonment and torture causes not only injuries to the body, but also to the mind and soul. The patient was told that his memory of the traumatic incident was stored in his memory as a programme to help avoid danger in the future, and that this programme was not an integrated part of his autobiographical memory. Additionally the patient was also told that this unintegrated memory produced the symptoms of PTSD. To make this rationale tangible and visual for the patient, the therapist used the following explanation:
The psycho-education about PTSD and the rationale for the treatment were recorded on an mp3 player, and the patient was instructed to listen to the recording at home one to two times every week during the treatment. In Session 6, a Subjective Units of Discomfort scale (SUD) was constructed in order to monitor how much discomfort or anxiety revisiting of the past was causing the patient in the present. In Session 7, the patient started the construction of a detailed chronological narrative of his biography in cooperation with the therapist. The patient's testimony was written down by the therapist, and in the subsequent sessions, the narrative was read aloud to the patient, who was asked to correct it and add any missing details. During the reading of the narrative to the patient, the therapist asked the patient how much distress, upon hearing the narrative, was causing the patient according to the SUD scale. The SUD ratings were recorded by the therapist in the written testimony, in order to help the therapist better monitor the patient's level of discomfort in subsequent sessions. The SUD ratings during the narration and reading of the narrative were also used to ground the patient in the present, thereby preventing avoidance, dissociation, or flashbacks. Before proceeding with the testimony, the patient and therapist discussed whether any new information had come forward and whether there had been any habituation to the patient's discomfort. During the narration, the patient was asked questions about the contents of his fear structure, on the cognitive, emotional, and physiological levels, to reassure that the traumatic fear structure was activated, so that traumatic experience could be emotionally processed and new information incompatible with the existing information in the fear structure could be introduced. The procedure was repeated across Sessions 7 to 20 until a final version of the patient's trauma narrative was reached. The sessions revealed a long history of persecution of the patient, which included many potentially traumatic events.
After the final version of the narrative was created in Session 20, the trauma part of the narrative was translated into Arabic and the patient was instructed to read the trauma narrative at home every other day. He was told to read it three times so that the combined reading of the trauma narrative had a time-related length of 45 minutes. During the reading the patient was instructed to record his SUD level in preprinted fields upon the receipt of the Arabic translation. The preprinted fields were placed in the text in such a way that it was estimated that it would take five minutes to read the section before the next SUD level register-field came into the translation. In the translation, three days' worth of preprinted fields, including three fields per day, were given with instructions to record the SUD level each day. The patient's self-reported SUD level can be found in Table 4.
Sessions 21 to 26 were used to discuss the homework exposure and recorded SUD level. How it was for the patient to revisit the traumatic event, whether there was any habituation of the anxiety level during reading, whether there was some new information that should be added to the trauma narrative, and whether there was some new understanding of the traumatic event.
The patient was at the beginning of treatment medicated with Paroxetin and Mirtazapin. After 2 month the patient discontinued this medication due to side effects. He did subsequently not receive any pharmacological treatment for his PTSD or depression. During treatment the patient also received 6 session of physiotherapy with focus on pain management.
Psychiatric status was assessed using the Mini-International Neuropsychiatric Interview (M.I.N.I.), which is a short structured diagnostic interview developed by psychiatrists and clinicians in the United States and Europe for DSM-IV and ICD-10 psychiatric disorders. It was designed to meet the need for a short but accurately structured psychiatric interview for multicentre clinical trials and epidemiology studies and has an administration time of approximately 15 minutes.
For assessor rating, the revised version of the Harvard Trauma Questionnaire (HTQ-R), Section IV, 16 symptoms corresponding to the criteria for PTSD according to the DSM-III, was used as a structured interview for the symptom severity of PTSD.
Data on the psychometric properties of the HTQ are reported in Mollica et al.. Data on the psychometric properties of the HTQ-R have not been published, but based on the changes made from the HTQ to the HTQ-R, it can be assumed that they will be highly similar. In the HTQ-R, the 16 PTSD symptoms remain unchanged. The HTQ have a sensitivity of 93% (i.e., 93% of patients with PTSD were correctly classified by the HTQ) and a specificity of 84% (i.e., 84% of patients without PTSD were correctly classified by the HTQ).
For self-report ratings, the following was used: PTSD Symptom Scale-Self Report (PSS-SR), Beck Anxiety Inventory (BAI), and Major Depression Inventory (MDI). The PSS-SR consist of 17 questions that correspond to PTSD the Diagnostic and Statistical Manual of Mental Disorders (3rd ed., rev., DSM-III-R; American Psychiatric Association, 1987). Each symptom is rated on a four-point scale ranging from 0 (not at all) to 3 (very much). PSS-SR has been found to be internally consistent (Cronbach's alpha = .91) and stable over a period of one month (r = .74). Subscales assessing re-experiencing, avoidance, and arousal were also internally consistent and stable. The BAI is a 21-item inventory measure for trait anxiety. It has a good internal consistency, an acceptable reliability, and an acceptable convergent and discriminate validity. The MDI has been developed to measure DSM-IV and ICD-10 diagnoses of major (moderate to severe) depression by self-reported symptoms. The MDI can be used as both a measuring instrument and a diagnostic instrument with algorithms leading to the DSM-IV or ICD-10 categories of major or moderate to severe depression.
All self-report scales were translated into Arabic by a team of interpreters and clinicians, and were back-translated to check its accuracy. The translation team consisted of two male Arab immigrant from Middle Eastern countries, one from Egypt and one from Iraq, who had an average of approximately 25 years of experience providing written and verbal Arabic translations to local health and social services. The translated forms were compared and satisfied both the interpreters and clinicians. The goal of the translation was a loyalty of meaning and an equal familiarity and colloquialness in Danish, English, and Arabic.
Results from pre- to post-treatment and the 3-, 6-, 12-month follow-up on individual measures can be found in Tables 1 and 2. Results of the ongoing monitoring during treatment can be found in Table 3. The HTQ-R score decreased 54% from pre- to post-treatment, from a total score of 3.44 to a total score of 1.56. A score of 1.56 on the HTQ-R is below the threshold, whereas individuals with an HTQ-R score of 2.5 or higher are considered symptomatic for PTSD. During the follow-up period the score of the HTQ-R stayed below the threshold at the 3-, 6-, and 12-month follow-up.
The PSS-SR score decreased 66% from pre- to post-treatment, from a total score of 44 in the extremely severe range of 41 to 51, to a total score of 14 in the subclinical to mild range from 11 to 15. At the 3-month follow-up, there was an increase in the PSS-SR to a total score of 20 in the mild range from 16 to 20. At the 6-month follow-up there was a decrease in the PSS-SR to a total score of 10 in the below threshold range from 0 to10, and to a total score af 4 in the 12-month follow-up.
The BAI score decreased 63% from pre- to post-treatment, from a score of 46, indicating a high anxiety to a score of 17, indicating a very low anxiety. During the follow-up period the score of the BAI stayed under 21, thus indicating a very low anxiety. The MDI score decreased 41% from pre- to post-treatment, from a score of 39 in the range of severe depression of 30 to 50, to a score of 23 in the range of mild depression from 20 to 24. At the 3-month follow-up, there was an increase in the MDI to a score of 25 in the range of moderate depression from 25 to 29. At the 6-month follow-up there was a decrease in the MDI to a score of 19 in the below threshold range from 0 to 19, while at 12-month followup there was a score of 9, indicating no depression. | null | Not supported with pagination yet | null |
PMC7080855_01 | Male | 7 | A 7-year-old neutered male Domestic Shorthair cat weighing 3.71 kg (8.2 lb), was presented to the Companion Animal Clinic at Midwestern University College of Veterinary Medicine (MWU-CVM) (day 1) with a 4-month history of sneezing, intermittent bilateral epistaxis and mucopurulent nasal discharge, progressive vision loss, as well as a 24-h onset of difficulty breathing, anorexia, and marked weakness. The cat was housed indoors only and had no contact with other animals. There was no known trauma or access to rodenticide. Two days before presentation, the primary care veterinarian performed coagulation testing (PT and PTT), serum biochemistry, and urinalysis, which were unremarkable. A complete blood count performed at that time revealed thrombocytopenia (23 x 103/muL; reference interval 151-600 x 103/muL) and a hematocrit within the reference interval (39%; reference interval 30-52%). A slide review with manual platelet count was not performed. In addition, the cat tested negative for feline leukemia virus (FeLV) antigen and feline immunodeficiency virus (FIV) antibody (IDEXX Laboratories, Inc., Westbrook, ME, USA). The cat also had a mean indirect systolic blood pressure measurement performed by Doppler ultrasonography that was unremarkable (149 mmHg; reference <160 mmHg).
Pertinent physical examination findings on day 1 included a rectal temperature of 103.5 F (39.7 C), heart rate of 220 beats per minute with a grade 2/6 systolic left parasternal heart murmur, respiratory rate of 35 breaths per minute with open mouth breathing as well as stertor and pale- pink oral mucous membranes. Ophthalmic examination performed by a boarded-small animal internist revealed bilaterally mydriatic pupils, intact pupillary light and palpebral reflexes, and an absent menace response. There was no evidence of intraocular or ocular surface inflammation. Intraocular pressure measurements performed with a tonometer (Icare TONOVET tonometer TV01, Vantaa, Finland) were unremarkable (OD: 15 mmHg, OS: 18 mmHg; reference range 10-25 mmHg). Indirect ophthalmoscopy was performed using a condensing lens and Finhoff transilluminator and revealed bilaterally swollen optic discs and prominent retinal vessels; there was no evidence of retinal detachment. There was a moderate amount of serosanguinous to mucoid nasal discharge and absent airflow bilaterally. The remainder of the physical examination revealed no additional abnormalities.
Clinically important complete blood cell count abnormalities performed at MWU-CVM were anemia (13%; reference interval 29-48%), reticulocytosis (81,200/muL; reference interval <45,000/muL), thrombocytopenia (57 x 103/muL reference interval 200-500 x 103/muL), leukocytosis (36.9 x 103/muL; reference interval 3.5-16 x 103/muL), neutrophilia (26.57 x 103/muL; reference interval 2.5-8.5 x 103/muL), with increased band neutrophils (1.1 x 103 /muL; reference interval 0.0-0.15 x 103/muL), monocytosis (5.2 x 103/muL; reference interval 0.0-0.60 x 103/muL), and total solids (5.8 g/dL; reference interval 5.2-8.8 g/dL). A blood smear reviewed by a boarded-clinical pathologist revealed an estimated manual platelet count of ~70 x 103/muL and infectious organisms were not identified. A biochemical profile was not performed at that time.
Based on the age of the cat, chronicity of bilateral epistaxis that coincided with the development of progressive vision loss, absence of nasal airflow, and severe anemia, the cat was suspected to have an aggressive infiltrative nasal disease process with secondary blood loss anemia. Differential diagnoses considered most likely at that time included primary nasal neoplasia (e.g., adenocarcinoma, squamous cell carcinoma, lymphoma), abcessation, or fungal rhinitis. Initial treatment consisted of a blood transfusion to address the severe anemia. The cat was blood typed (type A) and was administered 9.4 mL/kg of type A packed red blood cell transfusion IV over 4 h. An hour after the completed blood transfusion, PCV and total solids increased to 21% and 6.4 g/dL, respectively.
Computed tomography (CT; CT scanner, Syngo VC 40 16-slice, Siemens Healthcare, Germany) imaging of the skull was performed on day 2. Helical images of the skull were acquired with a slice thickness of 1.00 mm and a pitch of 0.85. Soft tissue filled the majority of the nasal passages bilaterally, was non-contrast enhancing, and caused displacement of gas. The non-contrast enhancing soft tissue contoured to the shape of the turbinates. There was diffuse contrast enhancement of the soft tissue that lined the osseous scrolls (Figure 1A). The nasal soft tissue extended from the nares caudally to the ethmoid turbinates and into the frontal sinuses and sphenoidal sinus (Figure 1B). The soft tissue within the frontal sinuses collected in the dependent portion with fluid wicking along the margins (Figures 1B,C). The choanae were filled with soft tissue obstructing the patency of the nasopharyngeal upper airway (Figures 1A-C). There was no lysis of the paranasal bones or nasal septum. There was focal enhancement within the posterior ocular globes within the region of the optic disc and the optic nerve heterogeneously contrast enhanced (Figures 1C,D). Rigid rhinoscopy (Karl Storz multi-purpose rigid scope 30 , Segundo, CA, USA) was then performed, which demonstrated hyperemic, vascular, and edematous nasal mucosa with moderate hemorrhage and mucus in both nasal cavities. No obvious mass lesions or fungal plaques were identified. Copious amounts of mucopurulent material and blood were visualized in the nasopharynx using a flexible endoscope (Karl Storz Flexible Silver Scope Small Flexible Gastrointestinal scope, Segundo, CA, USA). Importantly, a nasal foreign body was not identified. Moist laparotomy sponges were placed in the caudal pharynx and 60 mL of chilled sterile 0.9% sodium chloride was used to flush each nasal cavity (120 mL total).
Blind biopsies were obtained from each nasal cavity for cytology (tissue impression smear preparations), histopathology, and aerobic/anaerobic bacterial and fungal culture with antimicrobial susceptibility. Cytology results described the nasal samples as containing numerous degenerative neutrophils frequently containing intracellular bacterial rods of varying morphology with rare bacterial cocci noted (Figure 2A). Subsequent management consisted of ampicillin with sulbactam (30.5 mg/kg, IV, q 8 h), enrofloxacin (Baytril, Bayer HealthCare Animal Health, Shawnee Mission, KS, USA; 5.0 mg/kg, IV, q 24 h), Yunnan Baiyo (Yunnan Baiyao Group Corp. Ltd, Kunming, China; 1 capsule, PO, q 24 h), nebulization with 0.9% saline (q 6 h), dexamethasone-sodium phosphate (0.1 mg/kg IV, administered once), and Lactated Ringer's solution (5.4 mL/kg IV q 1 h) with 20 mEq/L potassium chloride.
The next day (day 3), the cat was no longer febrile 100.7 F (38.1 C), but a marked anemia returned with a PCV and total solids of 12% and 4.8 g/dL, respectively. The cat was administered 11.1 mL/kg of type A packed red blood cells over 4 h following identification of a compatible cross-match donor. An hour after the completed blood transfusion, the PCV and total solids increased to 21% and 6.4 g/dL, respectively. On the day of discharge (day 4), the cat was bright, alert, responsive, afebrile, and had a normal appetite. The anemia persisted but remained static 24 h after the blood transfusion (PCV: 22%; total solids: 6.8 g/dL). Medical management at the time of discharge included prednisolone (0.7 mg/kg, PO, q 24 h), Yunnan Baiyo (1 capsule, PO, q 24 h), pradofloxacin (Veraflox, Bayer HealthCare Animal Health, Shawnee Mission, KS, USA; 7.4 mg/kg, PO, q 24 h), and nebulization with 3 mls of 0.9% saline (q 12 h). Histopathologic sections revealed dense sheets of an almost pure population of neutrophils in which there were a myriad of bacterial colonies that appeared to have a short rod and thin filamentous morphology (Figures 2B,C). Aerobic/anaerobic bacterial culture results returned on day 6 and indicated the presence of E. coli and Actinomyces spp. (Supplemental Table 1) with an absence of fungal growth (confirmed on day 33). The cat was diagnosed with severe bacterial CRS and presumed optic neuritis associated loss of vision. Based on the antimicrobial susceptibility panel, the antimicrobial spectrum was expanded to include amoxicillin-clavulanic acid (Clavamox, Zoetis Inc., Kalamazoo, MI, USA; 16.9 mg/kg, PO, q 12 h) in addition the previously prescribed pradofloxacin (7.4 mg/kg, PO, q 24 h) on day 6.
The cat was presented on day 17 and had an improved appetite, energy, as well as decreased frequency of sneezing and epistaxis. Physical examination revealed unchanged ophthalmic abnormalities, absence of nasal discharge, and improved stertor. A complete blood count was performed and revealed resolution of anemia (HCT: 37%). Medical management with prednisolone, amoxicillin-clavulinic acid, pradofloxacin, Yunnan-Baiyo, and nebulization with 0.9% saline remained unchanged. By day 30 the owner reported that the sneezing persisted but had decreased in frequency and the epistaxis had ceased. The cat's vision was reported to be improved but not yet normal. Physical examination revealed a lack of nasal discharge and normal airflow bilaterally. Ophthalmic examination showed bilaterally mydriatic pupils, intact pupillary light reflexes, and a menace response could be elicited from both eyes. Indirect ophthalmoscopy was performed using a condensing lens and Finhoff transillumintor and revealed unremarkable optic discs and retinal vessels. Due to the improvement of clinical signs, the amoxicillin-clavulinic acid, pradofloxacin, and Yunnan Baiyo were discontinued. Therapy with prednisolone (0.7 mg/kg, PO, q 24 h) and nebulization with 0.9% sodium chloride (q 12 h) was continued.
On day 70, the cat was presented for evaluation and the owner reported complete resolution of sneezing, nasal discharge, and continued improvement of vision. The frequency of prednisolone administration was decreased and subsequently discontinued along with nebulization of saline. Follow-up with the owner by phone at the time of this writing (day 330) revealed that the cat had no sneezing, nasal discharge, and had improved, but not yet normal vision. | actinomyces spp, escherichia coli, epistaxis, feline, optic neuritis, rhinitis, rhinosinusitis | Not supported with pagination yet | null |
PMC8606665_01 | Male | 67 | In October 2019, a 67-year-old man was admitted to our hospital due to left flank pain. He was initially diagnosed with a left renal tumor based on ultrasound examination. The patient had a history of controlled hypertension for approximately 10 years, but no personal or family history of other systemic disorders. Contrast-enhanced computed tomography (CT) revealed the presence of a malignant mass (5.2 cm x 4.3 cm) ( Figures 1A, B ). Chest CT revealed multiple nodules in the right lower lung, indicating metastasis ( Figure 1C ). Whole-body bone scanning by emission CT suggested vertebral (T12) metastasis ( Figure 1D ). The Eastern Cooperative Oncology Group score of the patient was 1. Routine blood and blood biochemistry tests did not yield abnormal findings. Based on these findings, the patient was diagnosed with advanced left renal carcinoma graded cT2NxM1.
According to the criteria established by the International Metastatic Renal Cell Carcinoma Database Consortium (IMDC), the prognostic risk associated with one risk factor was intermediate. Thus, cytoreductive nephrectomy was recommended, and pathological examination confirmed CDC ( Figure 2A ). Immunohistochemistry was used to examine the presence of several key markers: paired box 8-negative (PAX8; positive), p63 (negative), CD10 (negative), and vinculin (positive) ( Figures 2B-E ). Immunohistochemistry was positive for programmed cell death 1 ligand 1 (PD-L1) ( Figure 2F ). Next, we performed genetic profiling using a customized panel consisting of 618 genes to investigate potential actionable somatic and pathogenic germline variants ( Supplemental Table 1 ). Sequencing analysis did not identify pathogenic or likely pathogenic germline variants in this sample. However, four somatic alterations with uncertain clinical significance were detected: ERBB receptor feedback inhibitor 1 (ERRFI1) S138fs; speckle type BTB/POZ protein (SPOP) S55fs; E1A binding protein p300 (EP300) S457I; and TEK receptor tyrosine kinase (TEK) R673H. However, none of these findings supported the potential response to any of the therapies approved by the Food and Drug Administration. We recommended a treatment strategy involving the combination of a targeted agent and ICI, which has shown excellent therapeutic results in the treatment of ccRCC. The patient was fully informed and aware of the off-label use of the drugs. Pazopanib (400 mg, per os, once daily) and the PD-1 monoclonal antibody camrelizumab (200 mg, intravenous gtt, once every 3 weeks) were administered. Following one cycle of therapy, the patient experienced a reduction in appetite and developed severe drug-induced hepatic injury. However, chest CT showed remarkable shrinkage of the metastases, indicating a partial response ( Figures 3A, B ). Subsequently, glucocorticosteroid therapy was administered. Liver function recovered three weeks later. Immunotherapy was discontinued, and monotherapy with pazopanib was initiated.
Five months later, the patient presented with cough, dyspnea, and lumbar pain. Chest CT showed malignant pleural effusion and pleural metastasis ( Figure 3C ); this was confirmed by the cytological examination of pleural effusion. Considering the response of the patient to the previous combination strategy, axitinib (5 mg, per os, twice daily) and the PD-1 monoclonal antibody sintilimab (200 mg, intravenous gtt, once every 3 weeks) were duly administered. The symptoms of the patient were gradually alleviated and completely disappeared after five cycles of treatment. Except for hypertension, there was no occurrence of obvious adverse reactions. Chest CT revealed a marked reduction of pleural effusion ( Figure 3D ). In April 2021, after 11 months of treatment, examinations confirmed the complete disappearance of the metastatic lesion in the lung. The last follow-up examination was performed in July 2021. Chest and abdomen CT did not reveal the presence of abnormal lesions ( Figure 3E ) and demonstrated improvement in the osteogenic structure at the site of vertebral metastasis ( Figure 3E ). The patient had an excellent physical status that was similar to that of a healthy person. Thereafter, the patient remained tumor-free for >14 months after receiving the combination therapy ( Figure 4 ). | collecting duct carcinoma, immune checkpoint inhibitor, immunotherapy, kidney cancer, targeted therapy | Radiological examination at initial visit. (C) Chest CT scan showing metastatic nodules in the right lower lung. |
|
PMC6010554_01 | Female | 35 | A 35-year-old female was admitted to our hospital complaining of an intermittent headache for 5 years, menopause for more than 2 months, and blurred vision and lactation for more than 1 month. Five years prior, the patient began suffering from intermittent and gradually deteriorating occipital and frontal headaches. One month prior to admission, she had impaired vision and an absent right temporal view and simultaneous bilateral galactorrhea, without purulent or bloody secretions. Since the onset of symptoms, the patient experienced no nausea or vomiting, sleepiness, chills, hair loss, or fatigue. Computed tomography (CT) showed an irregular cystic solid mass in the suprasellar area. The size of the mass was 1.4*1 cm and could be markedly enhanced. The CT value of the solid part of the lesion on plain CT was 40 Hounsfield units (HU); in the enhancement, the value was 74 HU, and the cystic part showed no enhancement. The boundary of the lesion was less clear, the density was not uniform, and no obvious calcification was observed. The cavernous sinus was involved. There were no abnormalities in the ventricular system, sulcus, brain split and pool. Moreover, there was no shift in the midline structure, and no abnormalities were found in the skull structure. The sinuses exhibited no obvious abnormalities. Magnetic resonance imaging (MRI) of the brain and pituitary showed an irregular cystic solid mass in the suprasellar area, involving in the pituitary stalk, and the boundary between the lesion and pituitary was unclear. In addition, the mass pressed on the optic chiasm, and the solid part of the lesion was significantly enhanced, while the cystic part showed no enhancement. There was no abnormal signal in the brain or paranasal sinuses nor signs of calcification (Figure 1). Auxiliary examinations revealed that the patient's urine volume and specific gravity were within the normal range (urine volume: 1,800 mL/day; urine specific gravity: 1.015). A pituitary function evaluation showed hyperprolactinemia (45.47 mug/L, normal range for female: 2.8-29.2 U/L) and intact growth hormone (GH) and gonadotropin function. The insulin-like growth factor 1 (IGF-1) level was 120 ng/ml (109-284 ng/ml). The pituitary-thyroid and pituitary-adrenal axis were intact (Tables 1-4). The blood sedimentation and CRP level were normal, and indicators related to tuberculosis and other infections were negative. Because of the thickening of the pituitary stalk, CSF analysis was performed to identify the nature of the mass lesion before any invasive procedures were performed. The results of CSF analysis were normal except for a significantly increased human HCG (18.54 U/L, normal range: 0-5 U/L) level. However, the serum HCG and alpha-fetoprotein (AFP) levels were normal. A biopsy was recommended to clarify the diagnosis, but the patient declined. Considering the possibility of a germinoma, radiotherapy was recommended. No regression of the intracranial mass and no resolution of the headache were observed after 10 radiotherapy treatments (total 10 Gy). Therefore, the patient was admitted a second time. Apart from a deficiency in GH and hypogonadotropic hormones, the other axes were intact (Tables 5-7). The IGF-1 level was 89 ng/ml (109-284 ng/ml). A repeated CSF analysis indicated there was no obvious decrease in the HCG level in the CSF (17.41 U/L, normal range: 0-5 U/L). An MRI showed no signs of shrinkage of the mass (Figure 2). Due to the enlarged intracranial mass, the patient was transferred to the neurosurgical department for total resection of the mass. The pathological analysis was indicative of a craniopharyngioma (Figure 3).
Under a microscope, the lateral fissure was separated at the saddle area, and CSF was released. The brain tissue collapsed, and a portion of the temporal lobe was removed. The tumor was located in the suprasellar area. The tumor was removed from the second gap along the longitudinal axis of the pituitary stalk and was frozen for analysis. The tumor and hypothalamus were closely related. Hemostasis was achieved, and the gauze inventory was correct. The surgery was complete following strict closure of the dura mater, bone flap reduction and fixation, suturing of the temporalis muscle and scalp, and placement of an external dura mater drain. The tumor specimens were sent for pathological analysis.
After surgery, the patient did well and had no complaints of headache, vomiting, polyuria, polydipsia, sleepiness, or anorexia. She did not receive any hormone replacement. One year later, she was admitted to our endocrinology department for re-evaluation. Her urine volume and specific gravity were within the normal range (urine volume: 1,500 mL/day; urine specific gravity: 1.017). The urine osmotic pressure was 752 mOsm/L (0-1,000 mOsm/L), the blood osmolality was 292 mOsm/L, and a pituitary stimulation test revealed normal frontal lobe function except for an impaired GH level (Tables 8, 9). The IGF-1 level was 92 ng/ml. HCG levels in the serum and CSF were within normal limits (serum HCG: 0.1 U/L; CSF HCG: 0.31 U/L). The slightly increased prolactin detected preoperatively had decreased to within the normal range. Cranial and pituitary MRI showed no expansion of the sellar region, no signs of a local tumor, no abnormal enhancement, a clear boundary of the optic chiasm, and no signs of tumor recurrence (Figure 4). | cranial tumors, craniopharyngioma, germinoma, human chorionic gonadotrophin, pituitary neoplasms | Not supported with pagination yet | null |
PMC9843462_01 | Female | 40 | We present a case of a 40-year-old female patient who was admitted to the Eye Clinic, Clinical Center of Montenegro (Podgorica, Montenegro) in April 2021. The patient's main complaint was vision impairment in the left eye, which occurred 14 days after a positive polymerase chain reaction (PCR) test result for SARS-CoV-2 infection. Vision impairment occurred suddenly, four days prior to admission. The only COVID-19 symptoms preceding the vision impairment were an irritating cough and severe headache. These symptoms started a day prior to the diagnosis of COVID-19 and lasted until changes in visual acuity occurred. The patient had hypertension controlled by ramipril (Zdravlje AD, Leskovac, Serbia) with no signs of complications in the kidneys, eyes, or cardiovascular system. In addition, she was diagnosed with Hashimoto thyroiditis 10 years prior to admission, which was successfully treated with levothyroxine (Merck KGaA, Darmstadt, Germany).
A complete eye examination was performed, followed by optical coherence tomography (OCT), fundus photography (FP), fundus autofluorescence (FAF), and fluorescein angiography (FA) tests. Best corrected visual acuity in the left and right eyes was 0.1 and 1.0, respectively. The affected eye showed a mild relative afferent pupillary defect (RAPD). Biomicroscopic examination showed normal findings. The anterior chamber was transparent with a normal iridocorneal angle. Intraocular pressure was within the normal range. Fundoscopic examination of the right eye was normal, but the fundus of the left eye showed several white dots located around the optic disc and scattered throughout the posterior pole of the retina. The fovea was yellowish with granularity (figure 1). FAF test showed hypofluorescent spots and dots throughout the posterior pole of the retina. The OCT examination of the right eye showed a normal configuration of the macula, but the left eye showed pathological findings - appearing as a multifocal nodular thickening in deep layers of the retina as well as areas of disruption of the ellipsoid zone (EZ) throughout the posterior pole (figure 2). FA test showed early punctate hyperfluorescence in a rim-like pattern and late staining in areas corresponding to the white dots (figure 3).
Following an initial diagnosis of multiple evanescent white dot syndrome (MEWDS), we requested additional tests to determine the cause of these abnormalities to provide optimal treatment. Complete blood count (CBC), erythrocyte sedimentation rate (ESR), c-reactive protein (CRP), fibrinogen, blood glucose, urea, creatinine, aspartate aminotransferase (AST), alanine aminotransferase (ALT), lipid panel, and urine analyses were all within normal range. Serum immunoglobulin levels as well as complement components C3 and C4 were also within normal range. Rheumatologic tests for antinuclear antibodies (ANAs), anti-Ro antibodies, antineutrophil cytoplasmic antibodies (ANCA), rheumatoid factor (RF), cyclic citrullinated peptide (CCP) antibodies, anti-smooth muscle antibodies (ASMA), anticardiolipin antibodies, and anti-beta 2 glycoproteins 1 and 2 were all negative. Tests for herpes simplex virus type 1 and 2 (HSV1 and HSV2), herpes zoster virus (HZV), Epstein-Barr virus (EBV), cytomegalovirus (CMV), Borrelia burgdorferi, Treponema pallidum, and Toxoplasma gondii were also negative. The QuantiFERON-TB Gold (QFT) test was false-positive. To rule out tuberculosis, we performed a purified protein derivative (PPD) skin test, which was negative. To exclude pneumonia and related complications, multi-slice computed tomography (MSCT) of the chest was performed, which was normal.
The patient was prescribed nepafenac solution 1 mg/mL (Alcon pharmaceuticals Ltd, Belgrade, Serbia) and acetazolamide (Remedica Ltd, Limassol, Cyprus) to reduce inflammation and edema. After one week of treatment, a follow-up examination showed a decrease in edema and improvement in the corrected visual acuity in the left eye (0.8). A fundus examination of the left eye showed complete resorption of the chorioretinal infiltration. An OCT examination of the eye showed thickening of the choroid, subtle discontinuity of the photoreceptor layer, and scarring of the retinal pigment epithelium.
Written informed consent was obtained from the patient for the publication of this case report. | covid-19, immunity, vasculitis, visual acuity, white dot syndromes | Not supported with pagination yet | null |
PMC7609154_01 | Male | 37 | A 37-year-old middle-age gentleman, who was otherwise fit and well, presented with persistent high-grade fever for more than ten days duration associated with intermittent productive cough of whitish sputum. He also had arthralgia and myalgia. He denied any hemoptysis, night sweats, shortness of breath, or pleuritic chest pain. He did not have any constitutional symptoms such as loss of weight or appetite. He was previously diagnosed with smear-positive pulmonary tuberculosis (PTB) where he completed a total duration of 9 months of anti-TB therapy. During this course of therapy, he had recurrent admissions for empyema thoracic, where a chest tube drainage and prolonged antibiotic therapy were needed. He was a nonsmoker and was doing a rural job, in the form of farming for a living. He denied alcohol consumption and the usage of recreational drugs.
On examination, he appeared tachypneic with a respiratory rate of 24 breaths/minute. His other vital signs were normal. There were reduced air entry and vocal resonance with the presence of stony dullness on examination on the lower zone of the right lung. There was a skin lesion over the face and scalp which resembles seborrhoeic dermatitis. Other systemic examinations were unremarkable.
In terms of blood investigations, he had leucocytosis (WCC of 14.9 x 109/L) and thrombocytosis (platelet count of 609 x 109/L), with significantly raised inflammatory markers (ESR of 102 and CRP of 137.4). A sputum acid-fast bacillus was scanty 1+, and the sputum mycobacterium culture was negative. Hepatitis and HIV screenings were negative. Chest radiography showed consolidative changes with mild to moderate pleural effusion on the right side (Figure 1). The pleural analysis shows the exudative picture with protein ratio (pleural protein) : (serum protein) = (3.3 g/L : 77 g/L) and lactate dehydrogenase (LDH) ratio (pleural LDH) : (serum LDH) = (3317 U/L : 315 U/L). Cytology was sent and no malignancy detected, and an acid-fast bacillus was also negative. Skin biopsy was taken and showed Paecilomyces species. CT thorax was performed and revealed a multiloculated collection within the right hemithorax depicting a thickened enhancing wall which joins at the margins of the collection to form the split pleura sign. This is associated with the compression atelectasis surrounding it (Figure 2).
The patient was referred to a cardiothoracic surgeon, and right thoracotomy and decortications were done in February 2016. The findings from the operation are thickened cortex measuring 0.8 cm plastered to the surface of the right lung with small pus collection. Tissue culture and sensitivity were sent and reported as Gram-positive and thin branching filaments. Modified Ziehl-Neelsen staining reported as many branching of acid-fast bacilli which is consistent with the morphology of Nocardia species. And it is sensitive to sulfamethoxazole-trimethoprim (Bactrim). He was started on IV imipenem 500 mg QID and oral Bactrim 4/4/3 tablets TDS total for 4 months. After completed treatment, the patient was getting better and no more shortness of breath and cough. Repeated CT thorax noted no more pleural effusion or empyema (Figure 3). | null | Not supported with pagination yet | null |
PMC8085411_01 | Female | 8 | Current work aims to present a case of an 8-years old girl with a history of chemosis of the conjunctiva with fevers. These symptoms appeared from full health and were followed by maculopapular exanthema the next day, which progressed to a vesicular exanthema. Moreover, enanthema of the oral cavity appeared, together with the elevation of inflammatory markers with thrombocytopenia. The patient's medical history showed that patient underwent adenotomy and an even of bronchitis of streptococcal origin (Streptococcus pneumoniae) within 1 year (2014). Except for the above two conditions, the patient had been healthy, without a record of idiopathic or any known allergies, as well as without a history of prolonged use of medications. Anamnesis did not reveal any history of severe medical conditions in the family. No aetiological association between the development of the disease and the use of any drugs according to the ALDEN criteria was found. The repeated serological examination did not detect any antibodies against infectious agents (herpes simplex virus 1,2, varicella-zoster virus, cytomegalovirus, parvovirus, Mycoplasma pneumoniae, Chlamydia pneumoniae, Legionella pneumophila, HIV 1,2, hepatitis viruses).
After the hospitalization, an exfoliative disease was suspected and corticosteroid therapy initiated immediately. Highly suspicious clinical signs of TEN (Figures 1A,C,D) were confirmed by biopsy (Figure 1B). Despite the corticosteroid and (newly initiated) intravenous immunoglobulin (IVIG) therapy, the disease progressed and the patient was transferred on Day 8 from the Pediatric Intensive Care Unit of the local hospital to the Burn Intensive Care Unit (BICU) of the University Hospital Brno. The BICU is a specialized center with experience and expertise in the management and surgical therapy of TEN patients who opted for this type of treatment. On admission to the BICU, the patient was breathing spontaneously. Sixty per cent of the Total Body Surface Area (TBSA) was exfoliated (face, neck, thorax, upper extremities and proximal parts of lower extremities; Figure 1A). Moreover, a symblepharon of both anterior segments of the eyeball was found. Due to the relatively high damage to the mucosal surfaces of the upper respiratory tract, the patient needed intubation during the introduction to general anesthesia, along with the placement of central venous and permanent urinary catheters. Bronchoscopy revealed a fragile and bleeding mucosa; therefore, the decision was made to keep the patient intubated. After the surgery, a girl was transferred to the Department of Pediatric Anaesthesiology and Resuscitation of the University Hospital Brno (PARU) for further intensive care.
In the PARU the patient was administered intravenous methyl-prednisolone (starting on Day 5, 80-40-40 mg every 8 h), antimicrobial therapy consisting of oxacillin (800 mg every 6 h), cefotaxime (1.5 g every 8 h) and, due to the increase of ss-D-glucan level (155 pg/ml), fluconazole (150 mg every 24 h) was added into the therapy. The IVIG therapy continued (0.2 g/kg/day, 5 days administration/25 g cumulative dose) and was supplemented with cyclosporin (2.5 mg/kg/day divided into 2 doses, 5 days administration). Immunological blood tests showed a significant decrease of CD3+ lymphocytes (in subpopulations of CD4+ and CD8+) but no immunoparalysis was proven (expression of CD14+ at monocytes was around 100%).
Despite the above therapy, a patient has developed delirium, which complicated extubation (microaspiration) and caused a need for a re-intubation (9th day of hospitalization). Considering the above and perspective of long-term mechanical ventilation, surgical tracheostomy was performed (11th day of hospitalization). After the patient's condition improved, mechanical ventilation was discontinued without any problems and she was transferred back to the Paediatric Intensive Care Unit of the local hospital for further alimentation and rehabilitation (19th day of hospitalization).
Additionally to the systemic therapy, the patient received specialized surgical management of the vast skin defects, comprising of the surgical debridement, wound dressing and stimulation of regeneration. We have decided to us a unique combination of synthetic (cosmetically nonprivileged areas) and biological (cosmetically privileged area) dressings in addition to the standard of wound care. For the very first time as a part of TEN therapy, we have used as a biological dressing a novel material - lyophilized amniotic membrane (Amnioderm ). Amnioderm was used in the facial area. The remaining exfoliated skin defects were covered using a combination of synthetic dressings (Aquacel Ag + Extra , ConvaTec, Princeton, NJ, USA and Mepilex Ag , MolnlyckeHealth Care AB, Gothenburg, Sweden). The bandages were replaced 3 times a week under general anesthesia. After the application of Amnioderm , we observed a rapid re-epithelization within 48 h (Figure 2). All skin defects were healed by re-epithelization within 3 weeks after admission to the BICU. We observed no scar formation in the area of AM application. During the 3 months follow-up period, we observed a total regeneration of the skin with no signs of pigmentation or scaring at the area of Amnioderm application (Figure 3). The area treated with the synthetic dressings was regenerating slower. Compared to the area where AM was applied, healing was extended by 4-5 days to complete wound closure. During the following period, post-exercise hyperaemia without and signs of hyperpigmentation persisted in the areas treated with synthetic dressings. | amniotic membrane, infection control, lyophilised amniotic membrane, reepithelization, toxic epidermal necrolysis | Not supported with pagination yet | null |
PMC8068479_01 | Male | 29 | A 29-year-old Taiwanese man presented to the outpatient clinic at the Taipei Municipal Wanfang Hospital, Taipei City, Taiwan, having experienced a chronic productive cough and yellowish sputum for five months. Prior consultations with local medical doctors left the symptoms unresolved. He reported frequent travel to Southeast Asian countries. On visit, chest auscultation revealed scattered bilateral coarse crepitations, which were more prominent on the right side; his physical findings were otherwise unremarkable. Chest radiography revealed a right upper lung cavity. The computed tomography scan showed multiple enhancement of lymphadenopathies in the mediastinum. Three sputum smears were negative for acid-fast bacilli (AFB); however, sputum culture was positive for Mtb. The GenoType MTBDRplus assay (Hain LifeScience GmBH, Nehren, Germany) revealed rifampicin resistance (rpoB gene H526D mutation) and susceptibility to isoniazid.
The patient was treated with moxifloxacin, kanamycin, isoniazid, ethambutol, and pyrazinamide. The treatment course was uneventful and sputum culture was converted to negative on the second month of treatment. The patient was cured after 20 months of treatment, and serial follow-ups for two years showed no recurrence of TB (Figure 1). | ltbi, acquired drug resistance, case report, drug-resistant tb, latent tuberculosis infection, subclinical tb, treatment | Not supported with pagination yet | null |
PMC8068479_02 | Female | 36 | His wife, a 36-year-old Vietnamese woman without underlying co-morbidities, underwent TB contact investigation. She reported no respiratory or constitutional symptoms. Physical examination revealed no abnormality, and previous medical history was unremarkable. The IGRA test was positive, and chest radiography was normal (Figure 2A), thus she was diagnosed with LTBI. She was prescribed nine months' isoniazid monotherapy 300mg once daily, directly observed by trained public health personnel. On the fourth month of treatment, she reported numbness and pain in her fingertips, which improved with vitamin B6 supplementation.
A progressive cough developed in the ninth month of treatment. She reported no fever, chills, hemoptysis, or night sweating. Chest auscultation was unremarkable, with a smooth breathing pattern and no lymphadenopathy. Physical examination was otherwise normal. Laboratory data on haemoglobin, blood count, liver and kidney function and laboratory tests were within normal results. Chest radiography revealed an opacity in the left upper lung (Figure 2B). Three consecutive sputum smear examinations were negative for AFB. The sputum GeneXpert test (Cepheid, California, United States) was positive for rifampicin-resistant Mtb. The phenotypic drug susceptibility testing and GenoType MTBDRplus assay later confirmed resistance to isoniazid (katG deletion) and rifampicin (rpoB gene H526D mutation). Based on these findings, the patient was diagnosed as having active pulmonary TB with resistance to isoniazid and rifampicin. Further sequencing revealed susceptibility to fluoroquinolones, aminoglycosides, and pyrazinamide.
The wife was treated with an individualized anti-TB regimen comprising of moxifloxacin, kanamycin, prothionamide, ethambutol, and pyrazinamide, based on the results of the drug-susceptibility test. Following treatment, the sputum culture converted to negative after two weeks. Early on in the treatment course, she reported vertigo, blurred vision, pain on injection site, and gastrointestinal discomfort, thus ethambutol was later replaced with cycloserine. Following 20 months of anti-TB treatment, follow-up revealed no radiological or clinical evidence of recurrence up to a year later. Genotyping of the causative Mtb by the spacer oligonucleotide typing (spoligotyping) and Mycobacterial Interspersed Repetitive Units-Variable Number Tandem Repeats revealed that the Mtb strains from the two cases had identical genotypes. | ltbi, acquired drug resistance, case report, drug-resistant tb, latent tuberculosis infection, subclinical tb, treatment | Not supported with pagination yet | null |
PMC8195647_01 | Female | 58 | A 58-year-old female patient with no pertinent past medical history presented to the emergency department as a transfer from an outside hospital for computerized tomography (CT) findings of retroperitoneal lymphadenopathy with nodularity and stranding of the omental fat, concerning for malignancy/metastatic disease requiring higher level of care for malignancy workup. The patient stated she experienced increasing fatigue, a decrease in appetite, and an unmeasured amount of weight loss over the past month. The patient stated that over the past two weeks, her symptoms had worsened significantly. She endorsed increased thirst, but denied fevers, chills, headache, cough, dyspnea, night sweats, chest pain, or sick contacts. She denied recent travel, stating she had only travelled to Thailand greater than 10 years previously.
On physical exam, the patient was afebrile with stable vital signs. She had clear lung sounds bilaterally, was nontender to abdominal palpation with a negative Murphy's sign, and had an unremarkable cardiac exam. A 2 cm mass in the 4 o'clock position of the left breast was palpated on clinical breast exam.
Laboratory analysis was remarkable for leukocytosis of 13.9x10e9/L, alkaline phosphatase of 310 U/L, and aspartate aminotransferase of 78 U/L. Malignancy workup was obtained: cancer antigen 19-9 and carcinoembryonic antigen were elevated to 301.4 U/mL and 9.0 ng/mL, respectively, with alpha-fetoprotein tumor marker within normal limits. Evaluation for acute and chronic liver pathology was positive solely for hepatitis A, with kidney microsomal antibodies, mitochondrial antibodies, antinuclear antibodies, alpha-1-antitrypsin, and ceruloplasmin all being negative. An iron panel demonstrated findings consistent with anemia of chronic disease (ferritin 2410.3 ng/mL, total iron 47 mcg/dL, and total iron binding capacity 80 mcg/dL). Blood cultures and urine cultures demonstrated no growth. Interferon-gamma release assay (IGRA) for tuberculosis was indeterminate.
The patient received extensive imaging. A CT abdomen/pelvis demonstrated retroperitoneal lymphadenopathy, nodularity and stranding in the omental fat, thickened ring along the periphery of the liver, and cholelithiasis. A CT chest demonstrated mediastinal lymphadenopathy, multiple small nodules scattered in the lungs bilaterally, and a small left pleural effusion. Cardiac bedside ultrasound showed no apparent focal wall motion abnormality and demonstrated adequate systolic left ventricular systolic function with an ejection fraction greater than 60%. Abdominal bedside ultrasound demonstrated multiple gallstones within an enlarged gallbladder measuring approximately 10 cm. Formal right upper quadrant ultrasound demonstrated cholelithiasis with sludge and gallbladder wall thickening as well as a nodular hepatic contour. Magnetic resonance cholangiopancreatography (MRCP) was unable to be obtained due to a history of a bullet wound to the left breast with retained metal fragments. The patient's hepatobiliary iminodiacetic acid (HIDA) scan demonstrated nonvisualization of the bladder supporting cystic duct obstruction and acute cholecystitis. Mammogram showed a 2.5 x 2.7 cm breast mass of the left breast.
The patient was started on Zosyn for cholecystitis and underwent an esophagogastroduodenoscopy (EGD) and colonoscopy which demonstrated nodular gastric mucosa and duodenal erosions. During her hospital course, she underwent multiple biopsies, including an ultrasound-guided core biopsy of her left breast mass, a colon biopsy, a retroperitoneal node biopsy, and a gastric mucosa biopsy. Throughout her hospital course, consultants from hematology/oncology, general surgery, and surgical oncology services informed the patient of the high likelihood of a cancer diagnosis upon pathologic examination of biopsied tissue. However, the patient left the hospital against medical advice before the biopsy results were available.
Upon outpatient hematology/oncology follow-up, the patient received her biopsy results. Her colon biopsy and gastric mucosa biopsy demonstrated no abnormalities. However, her left breast biopsy demonstrated a new diagnosis of cT2N0 grade-2 estrogen receptor-positive, progesterone receptor-positive, and her2-negative invasive carcinoma of no special time with lobular features with a minor component of ductal carcinoma in situ. Her retroperitoneal node biopsy demonstrated lymphoid tissue with necrotizing giant-cell granulomas, positive for mycobacteria on acid-fast bacilli staining. Treatment of the abdominal tuberculosis was to be coordinated by infectious disease and hematology/oncology before undergoing surgical treatment for the breast mass. Upon phone call to confirm an appointment, the patient's husband informed medical staff that the patient had passed away, less than two weeks after her discharge. | null | Not supported with pagination yet | null |
PMC10323813_01 | Male | 45 | A 45-year-old male presented to the hospital with complaints of hemoptysis for the last 3 weeks. He also had a cough with mucoid expectoration for 3 weeks. He denied a history of fever/loss of weight and appetite. The patient had a past history of sputum-positive pulmonary tuberculosis 20 years back for which he had taken AKT for 6 months. A suspicion of reactivation of pulmonary tuberculosis was made and sputum was sent for AFB (acid fast bacilli) and Nucleic Acid Amplification Test (NAAT) which was negative. On further investigation high-resolution computed tomography (HRCT) was done which revealed an irregularly shaped large cavitatory lesion
in the left upper lobe. The cavity was filled with large soft tissue surrounded by air crescent suggestive of fungal ball formation (aspergilloma). This HRCT revealed a classic "air crescent sign" (marked by an arrow) seen in aspergilloma but is also found in pulmonary tuberculosis, hydatid cyst, and pulmonary abscess. In aspergilloma, this mass usually moves within the cavity when the patient changes position and the sign is called "Monod sign". Aspergilloma most commonly occurs in the cavity formed secondary to tuberculosis and is a common sequelae of pulmonary tuberculosis. Most aspergilloma are asymptomatic and hemoptysis secondary to reactive vascular granulation tissue is the most common presentation. For this patient bronchial artery embolization (BAE) was done and he was started on antifungal treatment. Though in patients with recurrent or massive hemoptysis, surgical resection remains the gold standard. In our case, the patient did not have any more episodes of hemoptysis after BAE and was discharged in stable condition with the advice of regular follow-up. | aspergilloma, air crescent sign, monod sign | Not supported with pagination yet | null |
PMC8131959_01 | Male | 79 | A 79-year-old man was hospitalized for 6 weeks with L4-L5 spondylodiscitis in September 2019. His medical history consisted principally of membranoproliferative glomerulonephritis treated with rituximab several years ago (currently in remission), hypertension, alcoholic liver disease with chronic cholestasis without signs of portal hypertension, and elastometry fibrosis score estimated at F3. Hepatitis-C serology was negative. In August 2019, he developed sudden-onset low back pain with a marked inflammatory syndrome. Lumbar magnetic resonance imaging (Fig. S1 in the Supplement) showed what appeared to be infectious L4-L5 spondylodiscitis with a mm infiltration in the adjacent right psoas, circumferential epiduritis and bilateral, but predominantly right, posterior L4-L5 articular arthritis. At this stage, renal function and a complete liver work-up were normal, with prothrombin time (PT) at 91 %. Factor V was not determined.
We performed two puncture disco-vertebral biopsies, but no pathogen could be isolated from them. Brucella, Bartonella and Coxiella serologies were negative. Assuming methicillin-sensitive Staphylococcus because of the radiographic appearance, or of non-hemolytic streptococci because of the poor oral hygiene of the patient, cefazolin was started at 2 g every 8 h, after the sampling of the different biopsies. However, histological examination of the two disco-vertebral biopsies found a granulomatous appearance with necrotic micro-foci, which led to the priority search for a mycobacterium, notably tuberculosis. His neurological deterioration led to emergency laminectomy on hospitalization day 5. Cultures of intra-operative samples remained sterile after prolonged incubation in enriched media and mycobacterial cultures. Histology of intra-operative samples showed necrotic micro-foci as well.
Because the diagnosis of infectious spondylodiscitis was certain, because of the negativity of standard and prolonged cultures, because of the presence of features compatible with both types of infections (classical bacteria and mycobacteria), and because of a high risk of complications, a multidisciplinary discussion (between internists and specialists in infectious diseases) led to cefazolin continuation for a total of 6 weeks combined with anti-tuberculous quadritherapy (isoniazid, rifampicin, ethambutol and pyrazinamide) for 2 months, followed by a dual therapy for a further 4 months.
On day 24 of cefazolin administration and day 7 of quadritherapy, the patient developed abundant hematemesis. Cefazolin was temporarily withdrawn. The laboratory work-up found PT at 5 %, normal factor V (76 %) and factors II, VII and X severely collapsed (respectively, 28 %, 2 % and 7 %). After intravenous (IV) vitamin-K (10 mg) supplementation and human pro-coagulation complex, endoscopy identified necrotic esophagitis of the lower two-thirds of the esophagus and a necrotic bulbar ulcer. Proton-pump inhibitors administered by electric syringe achieved rapid improvement; the control endoscopy 48 h later found the peptic esophagitis appearance markedly attenuated. No carcinomatous- or lymphomatous-like cellular infiltration was seen during histological examination of esophagus samples.
Determination of serum cefazolin concentrations did not indicate an overdose (continuous concentration of 33.4 mg/L for a targeted value of 20-40 mg/L). After vitamin-K supplementation, cefazolin was restarted for a total duration of 6 weeks, with close monitoring of hemostasis. The anti-tuberculous regimen reintroduced combined ethambutol, moxifloxacin, isoniazid and pyrazinamide. | null | Not supported with pagination yet | null |
PMC5217606_01 | Female | 65 | A 65-year-old Caucasian lady was referred to our Ataxia Clinic because of a 6-year history of progressive unsteadiness and a 2-year history of slurred speech. Past medical history included arterial hypertension. The patient was a non-smoker was not consuming alcohol excessively. There was no family history of ataxia.
Neurological examination revealed prominent gaze-evoked nystagmus, heel to shin ataxia, gait ataxia, reduced reflexes and loss of vibration sensation in the legs.
Routine blood tests included full blood count, erythrocyte sedimentation rate, urea, creatinine, electrolytes, liver function tests, thyroid function tests, random glucose, Vitamin B12, folate, Vitamin E and folate, were all normal.
Extensive immunology screening included immunoglobulins and serum electrophoresis, antinuclear antibodies (ANA), anti-double stranded DNA (anti-dsDNA) antibodies, GAD antibodies, anti-neutrophil cytoplasmic antibodies (ANCA), thyroid peroxidase (TPO) antibodies, endomysium antibodies, transglutaminase antibodies and gliadin antibodies. From those, the IgA and IgM titer were low (IgA 0.63 g/L, normal values 0.8-4.0 and IgM 0.22 g/L, normal values 0.5-2.0), with no electrophoretic abnormality noted. C-ANCA antibodies were positive but PR3 antibodies were negative. Interestingly, the patient had the DQ8 human leukocyte antigen (HLA) serotype, which is commonly linked to autoimmune diseases, including coeliac disease.
The MRI of the brain was unremarkable for the patient's age, with no evidence of cerebellar atrophy in particular. However, the magnetic resonance spectroscopy (MRS) of the cerebellar vermis revealed a low N-acetyl aspartate (NAA) to Creatine (Cr) area ratio (NAA/Cr 0.95, normal values > 1.0) (Fig. 1A). Low NAA/Cr ratio implies abnormal metabolic activity within the area of interest (voxel). It can be used as an indicator to cerebellar dysfunction.
Sensory conduction studies of the right median, right ulnar, right radial and both sural nerves showed attenuated amplitudes, when the motor conduction studies of the right median, right ulnar and right peroneal nerves were within normal limits. The electrically elicited blink reflex was tested bilaterally and revealed an asymmetric involvement of the trigeminal/facial nerve pathways, suggesting a diagnosis of sensory ganglionopathy.
As the combination of cerebellar ataxia with sensory ganglionopathy can be seen as part of hereditary ataxias, including mitochondrial diseases, the patient was initially tested and was negative for the common genetic ataxias (Fridriech's ataxia, SCA1, SCA2, SCA3, SCA6 and SCA7). Subsequent further genetic testing using new generation sequencing was also negative and included the following genes; ABCB7, AFG3L2, APTX, ATM, ATP1A2, ATP1A3, ATP7B, C10orf2, CACNA1A, CACNB4, CYP2U1, CYP27A1, DDHD2, EEF2, FGF14, FTL, FXN, GBA, GBA2, IFRD1, ITPR1, KCNA1, KCNC3, KCND3, MTPAP, PDYN, PRKCG, PRRT2, SACS, SCN1A, SETX, SIL1, SLC16A2, SLC1A3, SLC2A1, SPG7, SPTBN2, TGM6, TTBK2, TTPA, VAMP1, ZFYVE26 (Additional file 1).
The patient has been followed-up on a 6 monthly basis and remained relatively stable. Thirty months after the initial presentation to our clinic repeat nerve conduction studies and repeat MRI and MRS were arranged. The nerve conduction studies showed further deterioration of the sensory ganglionopathy. The MRI of the brain showed is mild to moderate atrophy of the vermis (grade 2) and mild atrophy (grade 1) of the hemispheres (Fig. 2), when the MRS showed further deterioration of the NAA/Cr ratios of the cerebellum (Fig. 1B).
In order to rule out mitochondrial disease the common mitochondrial mutations (MELAS, MERRF, NARP, POLG1) were tested and were negative and a muscle biopsy was arranged. Transmission electron microscopy of glutaraldehyde fixed muscle revealed the presence of endomysial amyloid. Histologically, no inflammation, necrosis, or inclusions were seen (Fig. 3). Urinalysis confirmed the presence of light chains. A bone marrow biopsy was performed confirming the diagnosis of light chain multiple myeloma. Scintigraphy showed predominantly cardiac involvement and the patient was referred for further treatment.
Table 1 summarizes the nerve conduction tests and the MRS findings across the clinical course of the patient. | amyloid, ataxia, cerebellar, myeloma, paraneoplastic, sensory ganglionopathy | Not supported with pagination yet | null |
PMC5318682_01 | Female | 56 | A 56-year-old woman had suffered from abdominal fullness for three months. She had had poor appetite, general malaise, nausea and vomiting two weeks earlier, but denied tarry stool or diarrhea. She had lost about 6 kg over 3 months. Abdominal sonography revealed ascites. Laboratory data showed normocytic anemia, with hemoglobin 10.3 g/dL (normal range, 12-16 g/dL), and CA-125 level elevated to 188.6 U/mL (normal range, <35 U/mL). Abdominopelvic CT revealed multiloculated ascites in her abdomen and pelvis, thickened peritoneum, strandings in the omentum, small mesenteric nodules, enlarged mesenteric and paraaortic lymph nodes, prominent ovaries, and dilated fallopian tubes (Figure 1(Fig. 1)). There was no evidence of soft tissue in the ileocecal region. Under the initial diagnosis of ovarian cancer with carcinomatosis peritonei, she was admitted and exploratory laparotomy was performed. The operative findings included small nodules in the peritoneum, omentum, small bowel loops, uterus, and fallopian tubes and severe adhesions between bowel loops, the left ovary, and the pelvic side wall. The tentative diagnosis was carcinomatosis peritonei, so left salpingo-oophorectomy, enterolysis and peritoneum biopsy was performed.
The final diagnosis from the biopsy was tuberculosis peritonitis. Microscopic sections showed granulomatous inflammation with central caseous necrosis, epithelioid histiocytes and Langhans giant cells in the ovary, fallopian tube, and peritoneum (Figure 2A(Fig. 2)). Mycobacterial bacilli were also demonstrated by acid-fast stain (Figure 2B(Fig. 2)). | carcinomatosis peritonei, computed tomography (ct), ovarian cancer, peritoneum, tuberculosis | Not supported with pagination yet | null |
PMC9950848_02 | Female | 4 | The patient was started on piperacillin-tazobactam, assuming bacterial abscess. Complete needle aspiration of the collection plus axillary core biopsies were performed, and Mycobacterium tuberculosis (Mt) was actively sought, due to the scrofulous appearance of the skin. The serohematic aspirate was negative for acid-fast bacteria in the Ziehl-Neelsen stain, as were culture and polymerase chain reaction (PCR) with cartridge-based nucleic acid amplification test for Mt. The biopsy showed fibroadipose tissue and necrotic material without granulomas. The biopsy's culture was positive for Mt in both Lowenstein-Jensen medium and BACTECTM MGITTM, showing no drug resistance in Middlebrook 7H10, thereby indicating a diagnosis of BTB. Lung TB was ruled out, with bronchial secretions and bronchoalveolar lavage being negative for Mt in Lowenstein-Jensen, BACTECTM MGITTM, and PCR. The patient's four-year-old son, whom she had breastfed for one year, had a negative TB screening.
The patient was started on daily weight-adjusted isoniazid (H) 300 mg, rifampin (R) 600 mg, pyrazinamide (Z) 1000 mg, and ethambutol (E) 800 mg, plus pyridoxine 40 mg. After consulting with the surgery team, we prioritized minimally invasive procedures, to reduce additional trauma to an already severe keloid scarring process, reserving surgery in case of refractoriness.
Her condition significantly improved in the first month of treatment with HRZE, with remission of fever and night sweats, ceasing of fistula drainage, and breast size reduction. Her anemia improved and ESR and CRP returned to normal levels (9 mm/h and 0.17 mg/dL, respectively). She completed 12 months of antituberculosis regimen (two months of HRZE followed by 10 months of HR), with complete resolution of symptoms, the disappearance of liver lesions, and the return of spleen size to normal; her lymph nodes decreased in size, despite maintaining a necrotic center. | breast abscess, breast cancer differential diagnosis, breast tuberculosis, mastitis, mycobacterium tuberculosis, scrofula | Not supported with pagination yet | null |
PMC4405082_01 | Female | 63 | A 63-year-old Hispanic woman, who was born and raised in the Dominican Republic, first presented to the emergency department with complaints of generalized weakness, fatigue, unintended weight loss, anorexia, progressively worsening abdominal pain, and fever of 5 days' duration. She had sought medical care in the Dominican Republic for similar symptoms 2 months before the index admission when she was found to have biliary obstruction due to compression from infiltrative liver lesions of unclear etiology. She underwent endoscopic retrograde cholangiopancreatography (ERCP) with placement of a plastic stent within the common bile duct (CBD) at the time. Later, the patient underwent a laparoscopic liver biopsy, and a diagnosis of granulomatous hepatitis secondary to tuberculosis (TB) was made. She refused anti-TB therapy. She subsequently moved to the United States and had an admission at another institution, a week before our index admission, during which the plastic stent within the CBD was exchanged with a full-covered metal stent. She also had a history of essential hypertension and diabetes mellitus. On examination, vital parameters were as follows: a temperature of 101.2 F, pulse rate of 107 beats/minute, blood pressure of 86/51 mmHg. The patient was confused, not able to follow commands. Precordial examination showed normal heart sounds with no murmur, rub, or gallop. Examination of lungs showed bilateral air entry with no adventitious sounds. Abdomen was soft, with firm hepatomegaly and diffuse abdominal tenderness. Patient underwent endotracheal intubation with initiation of mechanical ventilation, broad-spectrum intravenous antibiotics, and vasopressor therapy.
Complete blood count showed hemoglobin of 7.7 g/dL, white cell count of 24.9 K/muL, and platelet count of 188 K/muL. Comprehensive metabolic panel showed the following results: sodium 133 mEq/L, potassium 3.3 mEq/L, bicarbonate 18 mEq/L, chloride 94 mEq/L, glucose 185 mg/dL, and serum creatinine 3.8 mg/dL. Liver function tests revealed 231 international units (IU)/L of alanine transaminase, 447 IU/L of aspartate transaminase, 373 IU/L of alkaline phosphatase (ALP), and 2.4 mg/dL of total bilirubin with a direct fraction of 2.1 mg/dL. Additional workup done for evaluation of abnormal liver enzymes, including viral hepatitis panels (hepatitis A, B, and C), antinuclear antibody, anti-smooth muscle antibody, anti-liver-kidney microsomal antibodies, anti-mitochondrial antibody were negative. A computed tomography (CT) scan of the abdomen showed cholelithiasis, an ill-defined soft tissue density within the porta hepatis surrounding the pancreatic head, celiac axis, and common hepatic artery (Fig. 1A), along with multiple hypodense lesions within the liver and spleen (Fig. 1B).
The patient underwent an urgent ERCP that revealed an inwardly migrated metallic biliary stent. The CBD was cannulated through the biliary stent and balloon sweeps were performed with removal of sludge (Fig. 2A). Resolution of biliary obstruction with flow of dark-colored bile was noted. A subsequent occlusion cholangiogram did not reveal any intrahepatic biliary strictures or dilation (Fig. 2B). Hemodynamic status of the patient improved significantly post-ERCP, at which time point she was weaned off both vasopressor therapy and mechanical ventilation. Jaundice resolved and liver enzymes, barring ALP, gradually normalized. ALP remained persistently elevated at levels >250 IU/L. A CT-guided targeted needle biopsy of liver lesions revealed mild to moderate ductular reaction without cholestasis, broad areas of perivenular fibrosis, and scattered foci of lobular necroinflammation. No definitive diagnosis could be made with the biopsy specimen.
The patient was discharged from the hospital and was subsequently admitted a few weeks later for an elective laparoscopic cholecystectomy. Laparoscopy revealed multiple, discrete pale-colored well-circumscribed lesions in the hepatic parenchyma (Fig. 3A). A wedge biopsy of the liver lesion was performed at the same time. The biopsy specimen revealed numerous nonnecrotizing granulomas with epitheloid cells, multinucleated giant cells, and lymphocytes (Fig. 3B). Culture and staining for acid fast bacilli (AFB) were negative. Significant perivenular (zone 3) congestion and fibrosis were seen again (Fig. 3C). Patient was diagnosed as having extrapulmonary sarcoidosis with predominant hepatic involvement causing extrahepatic biliary obstruction and subsequent biliary sepsis. | cholangitis in sarcoidosis, hepatic granulomas, hepatic sarcoidosis, jaundice in sarcoidosis, sarcoidosis of liver | Not supported with pagination yet | null |
PMC7273619_01 | Female | 86 | An 86-year-old woman admitted in our geriatric inpatient unit exhibited frequent episodes of involuntary, uncontrolled, particularly disturbing outbursts of crying and, less frequently, uncontrolled episodes of laughing. She also had episodes of wandering at night. The situation was becoming untenable and could not be managed by her husband anymore. Past medical history was positive for hypertension, osteoporosis, gait abnormality, nocturnal urinary incontinence, and Alzheimer's disease (AD) with related behavioral problems. Her medications included amlodipine (2.5 mg daily), venlafaxine (75 mg daily), quetiapine (25 mg at bedtime), and calcium/vitamin D (500 mg/400 units daily). Parkinsonism was present on physical examination.
The initial workup included biochemical and laboratory investigation to exclude metabolic, inflammatory, hormonal, and toxic causes for dementia. All results were within normal limits. This patient had an obvious adverse impact on activities of daily living and, as she had a progressive and severe multi-domain cognitive decline, she could not perform an MMSE (Mini-Mental State Examination). Brain computerized tomography (CT) scan performed 4 years earlier showed mild cerebral atrophy and leukoaraiosis in the white matter regions of the brain (Figure 1). An electromyogram was performed to rule out motoneuron disease, which was negative. Magnetic resonance imaging (MRI) revealed nonspecific subcortical signal abnormalities of the white matter associated with subcortical ischemic changes and a left-sided cerebellar lacuna (Figure 2). Brain positron emission tomography (PET) with fluoro-2-deoxy-d-glucose (FDG) was in favor of a mixed neurodegenerative disorder, showing an altered metabolic pattern suggestive of AD dementia or/and dementia with Lewy bodies (DLB). DLB could explain the parkinsonism symptoms observed in the patient. She was seen by a psychiatrist who diagnosed dysregulation of affective expression without evidence of significant depressive or anxious symptoms. Following evaluation by a neurologist, PBA secondary to a mixed neurodegenerative disorder was considered the likely diagnosis. Imaging with dopamine transporter agents would have been helpful to obtain a more precise diagnosis, but it is not available at our center.
Venlafaxine was stopped to try different medications. Table 1 describes the medication trials received by the patient during her hospitalization in order to reduce her crying and laughing symptoms. DM/Q was determined to be the most effective medication. A mild improvement was observed by the husband following 3 days of treatment. After 1 week, the effect was more apparent, as crying episodes were less frequent and of shorter duration. After 2 weeks, the crying episodes were reduced by 50% and wandering at night was less disturbing. At that point, the patient was discharged home with DM/Q and then 1 year later moved to a nursing home, where she died a few weeks after admission. | pseudobulbar affect, alternative nuedexta®, compounded quinidine capsules, crying, dextromethorphan cough syrup, geriatrics, laughing, neurodegenerative disorder | Not supported with pagination yet | null |
PMC5328703_01 | Female | 60 | In September 2015, a 60 year-old woman with known history of rheumatoid arthritis (rheumatoid factor >20, cyclic citrullinated peptide antibodies >300, elevated c-reactive protein and erythrocyte sedimentation rate, synovitis in 8 small joints) and co-existing pulmonary fibrosis with chronic type 1 respiratory failure was urgently transferred to the Respiratory Intensive Care Unit (RICU) due to life-threatening hypoxia. Assessment of vital signs revealed a respiratory rate of 35 breaths/min, a heart rate of 110 bpm and a saturation of 85%, receiving maximal flow of oxygen through a non-rebreather mask. Blood gas analysis showed pH of 7.47, pO2 of 50 mm Hg, and PCO2 of 36 mm Hg. Physical examination revealed crackles on both lungs, a prominent pulmonic compound of the second heart sound, and leg edema. Electrocardiogram showed right axis deviation, pulmonary P waves, and rSR' in V1. Hematological and biochemical tests showed: leukocytosis (16.02 k/muL -80% neutro), Hct at 49.9%, Hb of 16.6 g/dL, normal procalcitonin but elevated C-reactive protein of 3.250 mg/dl, normal troponin, and elevated b-type natriuretic peptide levels. Heart echocardiography revealed right heart enlargement, tricuspid valve regurgitation, and an estimated right ventricular systolic pressure (RVSP) of 68 mm Hg. The left heart maintained normal dimensions and systolic function, but the intraventricular septum was flattened forming a D-shaped left ventricle. The patient underwent pulmonary function tests indicating moderate restrictive lung disease with a FVC of 63% pred, TLC of 50.6% pred and a diffusing capacity for carbon monoxide (DLCO) of 19% pred. Thoracic high resolution CT revealed modest honeycombing, ground-glass opacities with fibrotic compound, traction bronchiectasis, and thickening of interlobular septa (illustrated in Image 1). A ventilation perfusion scan was urgently performed and showed normal perfusion. A right heart catheterization confirmed precapillary pulmonary hypertension [PAP (s/d/m):74/35/51 mm Hg, PAWP: 12 mm Hg, Right Atrial Pressure: 11 mm Hg, Cardiac Index: 1.6 L/min/m2, SvO2: 64%, PVR: 13 Wood units, SaO2: 89%]. Early upfront combination therapy was planned for the patient and she was immediately treated with inhaled iloprost six times a day and tb sildenafil 20 mg tqd combined with her previous treatment of iv furosemide and per os methylprednisolone. Her oxygenation status gradually improved. By Day 10, she was able to maintain a pO2 of 58 mm Hg with 5 lt/min through nasal cannula. She was discharged on Day 15 with further improvement of oxygenation. At the one-year follow up she was stable under oxygen therapy in functional class NYHA III [New York Heart Association class III]. | 6mwt, 6-min walking test, ctd, connective tissue disease, dlco, diffusing capacity for carbon monoxide, pawp, pulmonary arterial wedge pressure, ph, pulmonary hypertension, pulmonary hypertension, pulmonary vasodilators, ra, rheumatoid arthritis, ricu, respiratory intensive care unit, rvsp, right ventricular systolic pressure, rheumatoid arthritis, mpap, mean pulmonary artery pressure | Not supported with pagination yet | null |
PMC8592917_01 | Male | 0 | This 5-month-old male infant was born at term to asymptomatic, non-consanguineous emirati parents who belonged to the same tribal descent. The pregnancy and delivery were uneventful. His birth weight was 2.75 kg. He had received the BCG vaccine in the upper left arm at birth (0.05 mL, intradermal injection; manufactured by Serum Institute of India Pvt. Ltd., India). He had a healthy 16-month-old sibling, who had an oozing discharge from the BCG vaccine site for 2 months; he was currently asymptomatic. Otherwise, the family history is negative for any type of IEI.
His growth and development were normal. He was never genuinely febrile during the entire course of this illness; his temperatures were always <= 37.2 C. At 31/2 months of age, he developed a tender swelling in the right lower forearm (Figure 1). Abdominal examination revealed massive hepatosplenomegaly. The skin examination was remarkable for a prominent BCG scar (Figure 1), and skin-colored soft nodules such as the one in the lateral chest cage (Figure 1). He had mild cough; but on examination, he had no shortness-of-breath and his breath sounds and oxygen saturation were normal.
His complete blood counts were remarkable for profound lymphopenia (mean +- SD lymphocyte count = 84 +- 55 per muL (median = 70; range = 20-210; n = 18). His serum IgA level was 0.08 g/L (normal, 0.1-0.83), IgG 1.94 g/L (normal, 2.27-13.8), IgM 0.16 g/L (normal, 0.10-1.45), and IgE 3.0 (normal, <= 15). Lymphocyte subset analysis was requested, but the test failed due to inadequate lymphocytes. His serum C-reactive protein (CRP) was 7.5 +- 3.5 mg/L (n = 8), erythrocyte sedimentation rate (ESR) 26 mm/hr, ferritin 87 +- 8 mug/L (n = 3), and triglyceride 1.54 +- 0.41 mmol/L (normal, 0.25-0.85). Urinalysis, coagulation profile, renal function, and hepatic function were normal. Blood cultures were negative. Bronchoalveolar lavage culture showed normal upper respiratory flora; the Grocott-Gomori's methenamine silver (GMS) stain for fungal elements was suspicious for Pneumocystis jiroveci, while the acid-fast bacillus (AFB) stain was negative.
Radiograph and magnetic resonance imaging (MRI) of the right forearm showed areas of bone destruction (resorption) in the distal ulnar, surrounded by a soft tissue mass (Figure 2). Chest radiograph and chest CT showed nodular lesions in the lungs (Figure 2). Ultrasound and computed tomography (CT) scan of the abdomen showed organomegaly with two focal hypodense splenic lesions (Figure 2).
Biopsies of the right forearm soft tissue mass and the ulnar bone lesion revealed "reactive lymphohistiocytic proliferation," as a part of infection such as the administered live vaccine BCG. Morphologically, the specimens showed infiltrating lymphohistiocytic proliferations by small-to-medium size mature/activated B cells [PD1 (programmed cell death protein 1) positive] of non-germinal center origin intermixed with normal histiocytes (Figures 3A-E). For both specimens, fluorescence in-situ hybridization (FISH) panel for B cell lymphoma [detects rearrangements involving IGH (immunoglobulin heavy chain; MIM#146910), C-MYC (MYC protooncogene, bHLH transcription factor; MIM#190080), BCL2 (B-cell lymphoma 2; MIM#603167), BCL6 (B-cell lymphoma 6; MIM#109565), CCND1 (cyclin D1; MIM#168461), and MALT1 (mucosa-associated lymphoid tissue lymphoma translocation gene 1 paracaspase; MIM#604860)] was negative. Immunohistochemical stains of CD10, BCL6, CD30, C-MYC, CD34, TdT, myeloperoxidase, Cyclin D1, AE1/AE3 (bind to cytokeratins and serve as a marker of carcinomas), S100 proteins, CD99, myogenin, desmin, and MyoD1 were also negative. The Ki-67 stain was positive in about 50% of the cells. In-situ hybridization with EBV encoded mRNA was negative.
Biopsy of a skin nodule revealed dermal histiocytic infiltrate forming granuloma (Figure 3F).
Acid-fast bacillus (AFB) stain was negative for mycobacterium tuberculosis, and Grocott-Gomori's methenamine silver (GMS) stain was negative for fungal elements. Bone marrow biopsy showed cellular marrow (>90%) with trilineage hematopoiesis, adequate maturation, and T cell depletion.
Diagnostic exome sequencing revealed the hemizygous, pathogenic, novel non-sense variant of exon 6 of IL2RG (interleukin 2 receptor, gamma; MIM#308380): NM_ 000206.2(IL2RG):c.820_823dup, p.Ser275Asnfs*29. This novel variant causes "severe combined immunodeficiency, X-linked" (SCIDX1 or XSCID; MIM#300400). This IL2RG variant was not detected in the mother's blood sample. Thus, the variant was assumed de novo in the affected infant. Germline mosaicism, however, could not be excluded. It is also important to note that the only significant variant reported on his diagnostic exome sequencing test was that involving the IL2RG gene. In addition, there was no clinically relevant copy number variant by NGS-CNV (copy number variation detection by next generation sequencing read counts) analysis.
His management included intravenous immunoglobulin, sulfamethoxazole-trimethoprim, isoniazid, rifampin, vancomycin, piperacillin/tazobactam, azithromycin, and amphotericin B liposomal. He continued breastfeeding and occasionally required oxygen supplementation by nasal cannula. He had no human leukocyte antigen (HLA) identical match. Thus, he was transferred to a transplant center for parental donor haploidentical hematopoietic stem cell transplantation (HSCT). | bcg vaccine, iei, il2rg, mendelian susceptibility to mycobacterial disease (msmd), scid, hemophagocytic lymphohistiocytosis (hlh), lymphohistiocytic proliferation, lymphoid proliferation | Not supported with pagination yet | null |
PMC3806709_01 | Female | 70 | A 70-year-old woman was referred to our gastroenterology clinic for colon cancer screening. She denied abdominal pain, nausea, vomiting, heartburn, irregular bowel habits or hematochezia. She had undergone colonoscopy 10 years prior at an outside facility which according to her had been unremarkable. Her past medical history included migraine, hypertension, coronary artery disease and osteopenia. Her home medications included aspirin, hydrochlorothiazide, metoprolol, simvastatin, calcium, vitamin D and alendronate. Her family history was significant for stomach cancer in a sister, lung cancer in a brother and thyroid cancer in a daughter. She denied any family history of neurological tumors and cutaneous neurofibromas. She had a 40-pack-year smoking history, which she quit for 12 years. Physical examination revealed an overweight woman with a body mass index of 29. Her abdomen was soft with no tenderness or palpable masses. She did not have any skin lesions or pigmented/hypopigmented spots. Abdominal and neurological exams were within normal limits. Laboratory data revealed a hemoglobin level of 13.9 g/dl, a white blood cell count of 8,100/mul, a platelet count of 251,000/mul and a serum creatinine of 0.9 mg/dl. Basic metabolic panel, liver function tests and coagulation profile were within normal limits. Hepatitis serology was negative.
As part of routine screening, colonoscopy was performed up to the cecum. Findings included a 20-mm pedunculated polyp with a stalk measuring 0.6 cm in length and 0.4 cm in diameter in the ascending colon (fig. 1), and an 8-mm polyp in the transverse colon removed with polypectomy and a 3-mm polyp in the ascending colon removed with biopsy forceps. Other findings were diverticulosis of the entire colon and internal hemorrhoids. The 8-mm transverse colon polyp revealed tubular adenoma on histopathology, and the 3-mm ascending colon polyp revealed colonic mucosa. Histologically, the pedunculated ascending colon polyp revealed bland spindle cell proliferation in the submucosa (fig. 2, fig. 3). Immunohistochemical stains showed that the tumor cells were immunoreactive to S100 protein (fig. 4) and were non-reactive to CD117, SMA and desmin antibodies. These findings were consistent with a diagnosis of colonic submucosal neurofibroma. The patient continued to be followed up in our outpatient clinic. She remains asymptomatic without any systemic signs of neurofibromatosis even after 9 months of follow-up. | colonic polyps, intestinal, neurofibroma, neurofibromatosis | Not supported with pagination yet | null |
PMC9579323_01 | Male | 10 | A boy who was 10 years and 6 months old was admitted to the hospital due to abdominal pain that persisted for 4 days. The patient also vomited three times without concomitant fever or diarrhea. He was found to have jaundice when referred to a local hospital. The biochemical tests showed exceptionally high levels of alanine aminotransferase [(ALT) 2330 U/L], aspartate aminotransferase [(AST) 1326 U/L], and total bilirubin [(TB) 74.2 mumol/L]. The patient received no intervention or treatment before being transferred to our hospital. He was previously in good health, denied taking any medications or having a history of exposure to patients with COVID-19, and received the second dose of inactivated COVID-19 vaccine 3 months before admission. At admission, the physical examination revealed that the child had scleral icterus, jaundice, hepatosplenomegaly, upper abdominal tenderness, and a positive Murphy's sign.
The patient underwent infectious pathogen screening. Evidence of hepatitis A, B, C, and E viruses, CMV, HSV, and EBV infection is not found by serology (Hepatitis A, B, C, and E virus, CMV, and EBV), immunohistochemical (EBV), and PCR (HSV and EBV) analyses. The autoimmune hepatitis-related antibodies (17 common antibodies including ANA, SSA, AMA M2, and ss-DNA) and metabolism disease-related tests (including blood glucose, blood ammonia, lactate, alpha-fetoprotein, and ceruloplasmin) were also negative. Abdominal ultrasound indicated hepatosplenomegaly, pericholecystic edema, and thickening of the gallbladder wall. Magnetic resonance cholangiopancreatography (MRCP) showed edema of the first porta hepatis, the periportal region, and the gallbladder, as well as stenosis of the choledoch (Figures 1A-C,G). To further clarify the potential cause, the patient underwent trio-based next-generation sequencing (Trio-NGS) and liver biopsy. Trio-NGS did not detect any abnormalities, while liver biopsy showed mild interfacial hepatitis and fibrosis of portal area (G1S1) (Figures 2A,B), and further classification of the intrahepatic lymphocytes predominantly suggested CD8 + cells (Figure 2C). Tests for HBsAg, HBcAg, CMV, IgG4, and EBER in liver tissue remained negative. Although some interlobular bile ducts were very small, the number of intrahepatic bile ducts was normal. Finally, torque teno virus (TTV) sequences were detected by metagenomic NGS (mNGS) in whole blood sample (Figure 3A) and liver tissue (Figure 3B). The result of electron microscopy (Figure 2D) indicated chronic active hepatitis, which was shown as follows: hepatic cells were swollen, rough endoplasmic reticulum and smooth endoplasmic reticulum were slightly expanded, and lipid droplets were observed in hepatocytes (upper image), as well as lymphocytosis were observed in hepatic sinusoidal (lower image). However, no viral inclusions were found.
After hospitalization, the patient received ceftazidime (based on cholecystitis), lipid-soluble vitamins, and reduced glutathione treatment. Unfortunately, the patient's situation deteriorated with rapid progressive jaundice (peak TB: 173 mumol/L), underwent plasmapheresis once, and was administered methylprednisolone. The patient's liver function was improved after the administration of steroids (Figures 4A-C). MRCP tests showed that the narrow bile duct was not relieved, but the hepatosplenomegaly and gallbladder edema had disappeared (Figures 1D-F,H). The patient was discharged after one month of treatment. Two weeks post-discharge, he revisited the hospital. He was clinically stable without any adverse and unanticipated events. The biochemical tests showed that ALT was 163 U/L, AST was 60 U/L, and TB was 11.6 mumol/L.
As a whole, this case report follows the CARE Case Report Guidelines. Our adherence to these reporting guidelines has been listed in the Supplementary material. | case report, immune injury, methylprednisolone, torque teno virus, unexplained acute hepatitis | Not supported with pagination yet | null |
PMC4395945_01 | Male | 4 | A 4-year-old male child born by nonconsanguineous marriage presented to pediatric OPD with complaint of abdominal distension, poor weight gain, and short stature. No history of polyuria or polydipsia was present. He had no previous history of trauma or operation. He was born by normal vaginal delivery at term and was vaccinated as per national immunization programme of India. He had no past history of tuberculosis or chronic illness. He was examined and found to have 8 kg weight (below 5th percentile), 82 cm height (below 5th percentile) and diagnosed as failure to thrive. He was admitted in our hospital for further evaluation. Central nervous system, cardio-respiratory system and per abdominal examination were normal. His visual acuity was 6/6 in both eyes with normal funduscopy study of eyes. His vitals were within normal limit for age. Complete hemogram and urine examination were normal. Urine specific gravity and urine osmolality (670 mOsm/kg) were normal. Mantoux and HIV ELISA test were negative. Ultrasonography study of abdomen and chest radiograph study was normal. Magnetic resonance imaging (MRI) of brain and pituitary was advised to rule out hypothalamo-pituitary dysfunction. Contrast enhanced MRI revealed normal size sella turcica, thinned out enhancing pituitary gland (2 mm height) in the bottom of sella, midline infundibulum, and nonvisualization of T1-weighted bright spot of posterior pituitary gland. Rest of sella turcica was filled with CSF signal. No intra sellar herniation of optic chiasma or no hydrocephalus was seen. Visualized brain parenchyma was normal [Figures 1 and 2]. Radiological diagnosis of ESS was given. Serum hormonal assay revealed low level of FT3 (66.86 pg/mL, FT4 (2.77 ng/mL), thyroid - stimulating hormone (2.67 mIU/mL), and low level of serum cortisol (3.4 ugm/dL). Growth hormone level was low (2.8 ng/L) on insulin tolerance test. Posterior pituitary hormone such antidiuretic hormone assay (1.3 pg/ml) and serum osmolality (260 mOsm/kg) were normal. He developed one episode of generalized tonic-clonic seizure with hyponatremia on 2nd day of hospitalization for which he was shifted to intensive care unit and treated conservatively with antiepileptic and hormone supplements. Serum glucose, calcium, phosphorus, albumin and alkaline phosphate were within normal limit. The patient was asymptomatic and discharged on 10th day of hospitalization. On follow-up examination, the patient gradually gained weight and revealed normal hormonal levels with hormonal supplements. | empty sella syndrome, empty sella turcica, failure to thrive | Not supported with pagination yet | null |
PMC3180750_01 | Female | 35 | This case is of a 35 year old multiparous woman who was first seen in gynecological Clinic with a 5 months history of unprovoked irregular vaginal bleeding associated with passage of blood clots which necessitated blood transfusion and had 3 units of blood. There was no previous history of post-coital bleeding prior the onset of symptoms. Her last menstrual period dated back to prior to her last child birth two years earlier. She also observed that she was losing weight but no history of pelvic pain, chronic cough or contact with a case of pulmonary tuberculosis. On examination the cervix appeared hyperemic ad irregular in outline, ulcerated, with vegetations. She had bilateral inguinal lymphadenopathies.
Antibody tests for HIV and VDRL infections were negative and the chest x-ray was normal. Pelvic ultrasonography revealed a small uterus and bilateral adnexae devoid of masses or collection. Sputum, urine and cervical secretions were negative for acid-fast bacilli and culture was unhelpful. The erythrocyte sedimentation rate (ESR) at 2 hours was 85 and Mantoux test was 12mm. A diagnosis of cervical cancer was entertained and punch biopsy of the lesion was performed.
Histological examination showed an ulcerated endocervical epithelium overlying a lesion composed of granulomata with central areas of caseous necrosis which are composed of epithelioid cells with surrounding lymphocytes and plasma cells.
There are numerous Langhan's giant cells. A special stain for mycobacterium was negative. Tuberculosis was considered as the most probable diagnosis. She had six months of anti tuberculosis therapy and after completion there was complete response. There was general improvement of physical condition and the cervix had a normal appearance. She is currently on follow up. | null | Not supported with pagination yet | null |
PMC10203193_01 | Female | 35 | A 35-year-old woman who had comorbid bipolar II and borderline personality disorders began her psychotherapy 3 years ago after transferring care from her resigned psychiatrist. In the past, there were a few unsuccessful medications to contain her emotional dysregulation, impulsivity, and suicidal behaviors. These included mood stabilizers such as lithium, sodium valproate, and even atypical antipsychotics. She often plugged into the depressive phase, thinking she was not achieving, unlike her siblings, and was highly self-critical. While she was in the hypomanic stage, it would be fused with her drive to improve her life.
Before we met, I had heard stories of her repeatedly arguing with the clinic nurse over some appointment matters. This narrative gave me the impression that she could be a difficult patient. I could remember the first time we saw each other; she was very wary as I was of how each other would be. During the discussion to lay out our treatment's direction, she wanted psychotherapy and wanted to continue her medications. Initially, I informed her that I could provide psychotherapy, but I would prefer her to see another psychiatrist whose role was primarily to take care of her medications. She found it very hard to understand the justifications for my suggestion. At that time, she must have experienced me as difficult to negotiate.
Previously, she had attended a course in cognitive behavior therapy, which she felt was not helpful. In her words, the treatment just wanted her to change and that was described as relatively rigid on how it set out to be. We currently work in the frame of psychoanalytically informed psychotherapy. She, too, found the weekly fixed schedules rigid. During our initial contact, she wanted psychotherapy to improve her relationships with others, especially with her boyfriend. She described him as immature, inexperienced, not educated, and stubborn. Despite how frequently she had tried to advise or guide him to change to be a better person for their future, she still failed to see any improvements. Instead, they were in a relationship filled with arguments whenever her expectations for him met with disappointments. However, she failed to acknowledge that he was there to support her emotionally and offer respite each time she had trouble with others.
In addition to her intimate relationship, the patient quickly entered arguments with others when she perceived them as crossing her boundaries or intimidating her. She constantly felt there was a need to speak up and defend herself. She attributed this defensive mode to the period when she had enough taken in people's defamation, which, while working for a corporate company, had led to her numerous mistreatments from her superiors and customers, eventually plugging her into depression. Since her resignation, she dared not to hold up any occupation that required her to come directly or frequently encounter people. She worried this could trigger her emotional instability and anger outbursts.
Part of her depressive symptoms was this incredible guilt feeling each time she lashed out her anger at others. These outbursts could lead her to repeatedly experience herself as being a bad person. As she became intolerable with these thoughts, she would commit multiple acts of self-harm and attempted suicide, such as cutting or overdosing on medications. The patient had countless attempts of such behavior, the last one was carried out when her boyfriend proposed a breakoff when she felt he was not taking their future seriously. Even though a minor life event triggered it, she lashed out her anger and frustration toward him and subsequently cut herself and ingested multiple pills of medications. She was then found by her boyfriend and was admitted to the hospital. Although her responses were impulsive and damaging, she believed she had thought about others' feelings enough. She often had to keep an eye on others' demeanor and analyze people's motives, as this became her mental default mode. She needed to make sure that they did not cross her boundary, and at the same time, she was constantly cautious of not offending anyone too. Her inner world is filled with a constant fear of despise by people because of her weaknesses and inadequacy.
She thought that she had inherited her father's stormy temperament. The difference was that he would never feel guilty after demonstrating his anger. She recalled growing up in a traditional Asian Chinese environment where her father emphasized a lot on achievements, was demanding, and allowed no room for emotional sharing. He was strict and fierce and would use physical punishment at home whenever he regarded his children were misbehaving. Her mother was even scolded by him for the children's wrongdoings. Thus, she was unhappy with her childhood, feeling that there was no one to protect her and that she needed to be hypervigilant at home. She had spent much time observing her father's reactions every moment. Even up to date, their relationship was strained. The experience, as she thought, had contributed to her sensitivity within the context of interpersonal contacts. She admitted that she could be easily provoked by others, picking up cues that they were stepping over her, and therefore, she needed to act very fast to protect herself. She also thought that her emotional instability was primarily contributed by those around her who were insensitive, mistreating her, and even looking down upon her.
It was a rescheduled session as the patient had requested to change her previous appointment, informing me that she felt unwell. Before we started, I, too, noticed that she had been unusually late for her current session. The presence of these unfamiliar demeanors made me ponder on a hindrance to the progress of our therapeutic work. She started by telling me that she had attempted suicide again because of her anger and disappointment toward her boyfriend.
Therapist: I see you are frustrated, but I'm wondering if it's easy for him, too.
Patient: No, but he needs to improve.
Therapist: Let's stop and think about it for a moment. When you talked about hurting yourself, I think he was in a difficult position too. How does that make you feel?
Patient: I also need to deal with him a lot. It's very tough. You keep thinking I'm bullying him, but you don't understand how he tortures me inwardly.
I started to discern that she was feeling a sense of being attacked by me. To a certain extent, she could be sensible for having that feeling. Using the approach of defining the affected focus in our therapeutic relationship, I attempted to move the implicit process to explicit mentalizing so that the unspoken could be spoken and it was safe to share further.
Therapist: When you said so, I feel that whatever I'm trying to point out to you here, I'm siding with him and neglecting you. Am I right?
Patient: Yup. After so many sessions we had, yes, I have that feeling.
Therapist: It seems like we have different views about something right now. And you sounded pretty upset with me too.
Patient: In our sessions, I feel you are taking a side on him. The very reason is both of you are guys. Imagine you have a girlfriend who's slightly superior to you in many ways, so your partner will feel inferior. If a mature person, he will try to grow up and improvise himself. But in my case, he is not. So, I think most guys don't like their girlfriends to be so aggressive and vocal. They prefer to have a submissive girlfriend so that they can be the hero to protect her.
The patient had this psychic equivalence of non-mentalizing mode that a male therapist would quickly be not siding with her. From a traditional psychoanalytic perspective, the male therapist could represent an object of transference enactment. I now observed a very crucial point that she had talked about here. Although upset with her boyfriend, she looked up to him to protect her, the inner sense of a child. However, she struggled to moderate the extent of aggression or submission to him. By being aggressive, on the one hand, she would risk destroying the object that could offer her refuge. By being submissive, on the other hand, she would fear the loss of autonomy and face the resultant self-object, which is deemed vulnerable. In our therapeutic relationship, was she too struggling to moderate the extent to which she should surrender her mind to me (submissive and weak) or stay attacking me for not listening to her (aggressive but wishing for protection)?
Therapist: Let's pause and rewind a bit to the discussion earlier. I know what you are trying to let me understand here is the feeling that I'm siding with your boyfriend and not acknowledging how difficult it is for you to live with him.
Patient: Yup, I understand that not many guys prefer a girlfriend like me.
The capacity of her thinking had not been eased thus far. Instead, she had reverted to a critical state of mind about herself, as she proclaimed no guy would love a girl like her. The apparent invaluable self-object seemed to take over, including her fear that she was not likable to the therapist.
Therapist: That sounds harsh when you said that to yourself. What runs through your mind when you think I'm siding with him? What makes you have that feeling?
Patient: An example was when I narrated a situation about him, then the advice you give is, have I stand on his side to think and see why he acted that way? It gave me a perception of what I should do then. Do I need to think about others every time in those situations? It's like I'm being blamed for everything that happened. I don't see how this therapy is going to be able to help me. How can I apply this in my life? I remember you told me just keep thinking. So, when I heard of that, it confused me as my mind was already full of many things. Worse, I do not know how to differentiate whose faults. So, instead, I chose to self-blame and dislike myself.
Quite clearly, the client had difficulty thinking about others or even withstanding the thought that "I need to think about others" in her mind. The thinking process in this realm forced her to deal with the gap that her inner needs conflicted with the demand of external reality.
Therapist: I did not know that asking you to consider others' perspectives and feelings is causing you to feel so bad toward yourself.
Patient: Yes, as if no one can understand me. Of course, besides stepping onto their shoes, I'm also making it hard for them to cross mine.
In this sense, the patient talked about how important it was to protect her inner needs, even at the expense of being left alone. So, apart from these, what had caused her such inhibitions of thoughts for others? I reflected that it is a need for protection. The patient elaborated on how she was dumb as she could not derive any improvements or changes from the therapy. She continued to be harsh and critical toward herself. There is a more overt manifestation of the superego harshness. The superego, according to Freud, is the internalized parental figure carrying the parental prohibitions, which becomes a structure in our unconscious mind. This internal authority had forbidden her thought. | core conflict, dysfunctional mental processing, inhibition of thinking, mentalizing, psychoanalysis, suicide | Not supported with pagination yet | null |
PMC8247189_02 | Female | 68 | A 68-year-old Japanese woman who developed fatigue and fever (maximum: 38.8 C) was diagnosed with COVID-19. There had been an outbreak at her swimming club, which was the same club to which the patient in Case 1 belonged. She was diagnosed with mild disease without pneumonia upon arrival. She had two aggravation risk factors: age > 65 years and hypertension.
Her temperature was 37.1 C and SpO2 97 % upon admission. She was started on favipiravir (3600 mg on day 1, 1800 mg from day 2 onwards) and dexamethasone (6 mg on days 1-10). Her temperature was normal on the next day, and her fatigue gradually improved. On the morning of day 5, the nurse pointed out a change in her face color. There was no rash on her trunk, and a red color was localized in her face. She did not feel heat on her cheeks, had no other symptoms, and her SpO2 level was 99 %. Her vital signs were stable, and she did not complain of any other symptoms, so we simply observed her. A few hours later, her SpO2 suddenly dropped from 98 % to 94 %. Although she did not complain of any new symptoms, we performed CT. CT revealed a new lesion of pneumonia. She was switched from favipiravir to remdesivir (200 mg/day on day 1, 100 mg from day 2 onwards) and from dexamethasone to methylprednisolone (1000 mg/day on days 1-3, 125 mg/day on days 4-5). Her SpO2 dropped to 90 % at the lowest during the night, and she was started on oxygen. The next morning, she had recovered from the hypoxia (SpO2: 98 %), and oxygen was stopped. Her red face disappeared at that time. Her pneumonia had resolved and she was discharged 12 days later. | covid-19, cytokine storm, pneumonia, red face, sars-cov-2 alpha variant | Not supported with pagination yet | null |
PMC3505913_01 | Male | 24 | A 24-year-old, Vietnamese male, living in Switzerland for the last three years, consulted our unit for unremitting pain in his right knee. He had a right knee contusion two months ago. On history, he related occasional night sweats with chills since that accident accompanied with a weight loss of 5 kg. Otherwise, he is in good health, does not smoke, and takes no medications.
Clinical examination showed a painful red nonulcerating indurations measuring 3 x 4 cm in surface at the level of the right fibular head. It is fluctuating and seems to be adherent to the deep subcutaneous plane. Right knee mobilisation was complete, and neurovascular examination was normal. Blood analysis revealed a marked microcytic anaemia (haemoglobin: 76 g/L, VGM: 61 fl), no leukocytosis, and a CRP of 4 mg/L. Knee radiography showed a lytic lesion with ill-defined margin in the proximal right fibula measuring 1 x 1 cm and breaking through the outer cortex (Figure 1(a)). We reserved the differential diagnosis of focal osteomyelitis versus a tumoral process since the radiography showed that progressive lesion (Figure 1(b)). MRI examination demonstrated a hypersignal on T2 images of the proximal right fibular head with breakage through the outer cortical bone and an abscess extension in the surrounding soft tissues. This excluded the tumoral process as a causal agent and oriented us to a focal osteomyelitis with local infiltration of peripheral tissues (Figure 2). Surgical debridement was done through a centred lateral incision and tissue fragments sent for bacteriology and path anatomy analysis with a special request to look for tuberculous infection. This atypical request was based on the ethnical origin of the patient and the lytic lesion on radiography. Antibiotic therapy has been started empirically with Augmentin (amoxicillin and clavulanic acid) at a dose of 2, 2 g intravenous three times a day. The path anatomical analysis revealed the presence of an acid-alcohol resistant bacillus within an inflammatory process. Bacteriological results were noncontributive. A mycobacterium infection as the source of the osteomyelitis is suggested, but the IDR (intradermal reaction to tuberculin) tuberculosis test came out negative after 72 hours.
Locally, scar adhesion developed, a second surgical debridement was done, and new bone and tissue fragments were sent for bacteriology and molecular biology for analysis in order to identify the type of mycobacterium.
In the meanwhile, we completed and widened our investigations looking for any signs of immunodepression. Our results confirmed the presence of an HIV infection diagnosed as AIDS with a CD4 count less than 65/mm3 and a CD4/CD8 ratio of 0.035. It also revealed the presence of a viral hepatitis C infection. An antipneumocystic prophylaxis with Bactrim Forte (1 pill three times a week) was started. PCR (polymerase chain reaction) results of the last fragments analysed show the presence of an atypical nontuberculous mycobacterium identified as Mycobacterium haemophilum. Antimycobacterial treatment with Clarithromycin (500 mg/day), Moxifloxacine (400 mg/day), and Rifabutin (300 mg/day) was started for a minimum of 12 months. Secondarily, an antiretroviral treatment was started 2 weeks later. Locally, the patient is doing now well and is treated by our infectious disease department team for further followup and control. | null | Not supported with pagination yet | null |
PMC8249757_01 | Female | 0 | A 6-month-old girl presented to our clinic with bilateral hip joint pain, which began 1 year prior to her admission. The pain drastically affected her physical activity and was more evident in the morning. No other symptoms were presented. She then received Plain MRI and enhanced scanning of the hip joints, which revealed a small amount of effusion within the bilateral joints. Both colored ultrasound examination of retroperitoneum and Plain CT scanning of the chest and abdomen showed no evident abnormalities; thus, no special treatment was given to the child at that time.
The child still complained of recurrent hip pain, and her parents treated her with physical therapy, with no significant improvement. In September 2019, the girl was admitted to our clinic for the first time, and the Plain MRI and enhanced scanning showed a small amount of bilateral hip joint effusion. Cytological examinations of the bone marrow were normal. However, her parents treated the child with irregular traditional Chinese medicine and still did not see any significant improvement.
In December 2019, the girl was admitted to another hospital and diagnosed with JIA. At that time, EBV-DNA quantification was normal. From then on, she received oral administration of methotrexate (MTX, 14 mg/m2, once per week), methylprednisolone pills (0.75 mg/kg/d), and subcutaneous injections of Recombinant Human Tumor Necrosis Factor-alpha Receptor II; lgG Fc Fusion Protein (0.8 mg/kg, once per week). The pain was relieved after 4 weeks of continuous treatment. Two months later, the child did not follow-up and stopped all treatment. On May 12, 2020, the pain in the bilateral hip joints became more severe and was accompanied by occasional headaches. The patient was then admitted to our hospital on May 14 for further examinations. No other symptoms were present (Figure 1).
The girl was diagnosed with immune thrombocytopenia (PLT: 87 x 109/L) in 2017. At that time, cytological examination of the bone marrow showed active bone marrow hyperplasia, maturation disorders of megakaryocytes, and diffused distribution of platelets. The platelet count returned to a normal level after venous infusion of immunoglobulin. No history of organ transplantation or repeated infection was reported. In addition, no remarkable family history was reported.
Upon physical examination, her vital signs were in a normal range with a body weight of 16 kg. The examination of her chest and abdomen showed no obvious abnormalities. No swelling or pressing pain was found in the joints of limbs. However, the 4-shaped sign showed positive results.
During routine laboratory and blood examinations: C-reactive protein (CRP), IL-6, serum ferritin, ASO, and rheumatoid factors (RF) were all within a normal range. Autoimmune antibody (ANCA, ANA, ANA spectrum, PR3-IgG, MPO-IgG, GBM-IgG, and anti-CCP) and pathogenic examination (tuberculosis antibody, tuberculosis infection-specific T cells, mycoplasma antibody, HIV, and fungi) were all negative. EB-VCA-IgG and EB-NA-IgG levels were elevated; EB-VCA-IgM and EB-EA-IgG levels were normal. EBV-DNA quantification showed normal results. Examination of HBsAg, HBeAg, and HBcAb showed positive, and serum quantification of HBV-DNA was 3.38 x 107 IU/ml. The levels of immunoglobulins (A, E, G, and M) and complements C3 and C4 were all within a normal range (Table 1). Lymphocyte subsets were normal.
Colored ultrasound examination of the retroperitoneum showed no masses or abnormalities. Plain CT scanning of the lungs showed multiple nodules and stripe-shaped shadows bilaterally in the lungs. The largest was 0.63 x 0.74 cm. Plain and enhanced MRI scanning of the knee and hip joints revealed that the synovium of the bilateral knee and hip joints were slightly thickened and enhanced, with a small amount of effusion in the joints. Plain and enhanced CT scanning of the lumbar vertebrae showed the adnexa area left to the L2 vertebral body had osteolytic bone destruction and was accompanied by soft tissue masses. Plain and enhanced MRI scanning of the skull, pituitary, and spine showed nodular lesions at the parasellar and meninges of the right parietal lobe and bone mass destruction of the L2 vertebral body and left vertebral pedicle (Figure 2). Electromyography (EMG) of bilateral lower limbs showed no abnormalities in nerve conduction or muscle contraction.
Bone marrow biopsy examination showed active bone marrow hyperplasia, substantially reduced erythroid hyperplasia, and elevated lymphocytes. Biopsy of the inguinal lymphocytes revealed that the microscopy and immunohistochemistry findings agreed with the changes of reactive hyperplasia of the lymph node.
So far, the diagnosis of the child is still not clear. Two biopsies were performed within the L2 vertebral lesion tissues. The first biopsy was not diagnosed because EBER in-situ hybridization was not performed. The diagnosis was not made until after the second biopsy of a positive EBER in-situ hybridization was performed (Figure 3).
The girl's pathological examination showed EBER (+); thus, she was diagnosed with EBV-SMT. However, she was not previously infected with HIV or had any organ transplantation. In addition, the girl had no history of immunodeficiency-related diseases. In order to clarify the possibility of undiagnosed immunodeficiency or other causes, blood was obtained for whole-exome sequencing. The results showed no related pathogenic genes.
The patient was admitted to the hospital for arthritis. The imaging examinations after admission showed multiple lesions in the skull, lungs, and vertebral body. Other hematological tumors or Langerhans cell histiocytosis were considered during the diagnosis, which was not in agreement with the pathological and other examination results. Biopsy of the L2 vertebral body was then performed to clarify the diagnosis. Finally, the in-situ hybridization of the tumor of the lumbar vertebrae suggested non-HIV/transplantation-related EBV-SMT. The patient then received surgery (lumbar lesions resection + fusion bone grafting and internal fixation) without chemo or radiotherapy. The hip pain improved except for occasional headache. The patient is still under regular follow-up now. | children, epstein barr virus, hip joint, juvenile idiopathic arthritis, smooth muscle tumor | Imaging examination. (B) Plain CT scanning of lungs showed multiple nodules and stripe-shaped shadows in bilateral lungs, and the size of the largest shadow was 0.63 x 0.74 cm. |
|
PMC7119401_01 | Female | 38 | The first patient was a 38-year-old woman who suffered from probable SARS during a nosocomial outbreak in Taiwan. She developed fever and chills on April 20, 2003. Her chest radiograph showed bilateral pneumonic patches. Because SARS was suspected, she was admitted to our hospital on April 28. She was intubated and given midazolam and succinylcholine for respiratory failure. Fever of up to 39 C was noted on the same day. Repeat blood, urine, and sputum cultures did not yield any pathogens. Vero cells from a throat swab yielded a coronavirus. SARS-associated coronavirus infection was confirmed by detection of coronavirus ribonucleic acid by real-time reverse transcription polymerase chain reaction tests from sputum. Serum creatine kinase level increased from 21 to 13,834 U/L from May 2 to 3, while serum creatinine level increased to 3.27 mg/dL. By May 6, serum creatine kinase level had increased to a peak value of 339,750 U/L, even after hydration and alkalization, while serum myoglobin level had increased to 167 ng/mL (normal, <70 ng/mL). Rhabdomyolysis was diagnosed clinically. Acute renal failure developed on May 4 and the patient went into a deep coma. She died 3 weeks later due to secondary bacterial infection despite mechanical ventilatory support, hemodialysis, and antibiotic treatment. A skeletal muscle biopsy specimen showed necrotic muscle fibers, basophilic change of sarcoplasm, enlarged vesicular nuclei, and centrally located nuclei. | null | Not supported with pagination yet | null |
PMC7119401_02 | Male | 52 | The second patient was a 52-year-old-man who suffered from probable SARS during a nosocomial outbreak at the same hospital. He started to have fever and chills since April 21, with myalgia and headache. A dry cough developed since April 24 and a chest radiograph revealed a pneumonia patch over the right lower lung field. Acute respiratory distress syndrome and hypotension developed on April 26. Initial microbiologic workup that included blood, urine, and sputum cultures was negative, except for Vero cells from a throat swab, sputum, and stool that were positive for coronavirus. Indirect fluorescent antibody to SARS-associated coronavirus was also positive. Serum creatine kinase level increased from 378 to 7659 U/L from April 24 to 30, and renal failure developed. Serum myoglobin level on May 7 was 989 ng/mL. The patient died on May 15 because of multiple organ failure. No autopsy was performed. | null | Not supported with pagination yet | null |
PMC8690251_01 | Male | 47 | A 47-year-old man was admitted to our hospital for progressive cognitive decline and apathy for 10 months. History taking revealed no infection, vaccination, or significant weight loss within 6 weeks and no other medical history. His family had no history of auto-immune and hereditary diseases. Further general and neurological examination of the body revealed no abnormalities except for cognitive decline and active tendon reflexes in limbs. The long-term and short-term memory, the ability of calculation, as well as temporal and spatial perception were found to be impaired.
In further elaboration, 10 months ago (September 3, 2019), the patient was admitted to the first hospital for memory loss in 4 days. The symptoms of the patient started with the inability to remember what happened just now, unresponsive, and apathy. But the ability of daily living was not significantly impaired. Intracranial infection and acute cerebrovascular disease were suspected, but initial brain MRI (Figure 1A) and lumbar puncture were normal. The autoantibodies and paraneoplastic antibodies in serum and CSF were not performed in the hospital. The scores of the Geriatric Depression Scale were 12, accordingly, the patient was treated with flupenthixol/melitracen and escitalopram.
About 2 months later (October 28, 2019), he was admitted to the second hospital because of his worsened short-term memory, temporal, and spatial perception. The examination of Mini-Mental State Examination (MMSE) scores was 22/30. Normal findings of routine blood tests included neutrophil/hemoglobin/platelet counts, liver and renal function tests. Other investigations included thyroid function, erythrocyte sedimentation rate, antinuclear antibody, anti-neutrophil cytoplasmic antibody, anti-beta2 glycoprotein antibody, anti-cardiolipin antibody, extractable nuclear antigen, complement levels, serum protein electrophoresis, porphyria screen, tumor biomarkers, organic acid, poison screening were within normal limits. Hepatitis B virus serology, HIV serology, treponema pallidum serology, tuberculosis, and CD4 T cell count were negative. CSF analysis was normal, including cells, protein, glucose, oligoclonal bands, herpes simplex virus 1 and 2, varicella-zoster virus, enterovirus, meningococcus, parasites, treponema pallidum. The metagenomic next-generation sequencing (mNGS) was also conducted in the CSF sample but no pathogen (detection ranging from viruses to bacteria, fungi, and parasites) was identified. A repeat MRI brain was normal. Video electroencephalogram (EEG) showed low-amplitude fast waves. Even though the MRI brain and CSF of the patient were normal, autoimmune or paraneoplastic encephalitis was suspected based on the clinical presentation. Further ultrasonography examination of the abdominal organs, thyroid gland, and CT scan of the thorax showed no evidence of malignancy. Screening tests were also negative for autoimmune encephalitis antibody (NMDA-R, CASPR2, AMPA1-R, AMPA2-R, and LGI1), paraneoplastic antibody (Hu, Yo, Ri, PNMA2, CRMP5, and amphiphysin), and myelin-related antibodies (MBP-Ab, MOG-Ab, AQP4-Ab). No special treatment was given due to an unclear diagnosis. While in hospital, he developed rapidly progressive memory deficits, abnormal behavior like teasing children and making funny faces, and personality changes with apathy. He was easy to get lost, in addition to confusion and fatigue. Based on the results of the preliminary physical examination and progression of the disease, autoimmune/viral encephalitis was suspected. Accordingly, the patient was treated with intravenous injection of methylprednisolone 1 g daily, halved every 3 days, and tapered over 12 days and at the same time with antiviral drug acyclovir. Oral prednisolone (70 mg/day) was initiated on day 13, and then gradually tapered to a maintaining dose (10 mg/day). The condition of the patient gradually improved, and he could come back to normal life and work.
In July 2020, the patient was admitted to our hospital for a relapse characterized by memory loss and agitation. Repeat brain MRI showed high signal changes on T2 and fluid-attenuated inversion recovery sequences predominantly affecting the bilateral medial temporal lobe combined with some parts of the temporal cortex (Figure 1B). CSF neural-specific antibodies detection via cell-based assay (further details around the laboratory were provided in Supplementary Materials) found antibodies against AMPA1R (titer, 1:1) and AMPA2R (titer, 1:10); serum also showed the presence of anti-AMPA2R (1:32), but anti-AMPA1R was undetected. EEG showed diffuse slow waves. CT scan of thorax/abdomen/pelvis was negative for neoplasia. The diagnosis of autoimmune encephalitis prompted immediate treatment with a second course of methylprednisolone for 12 days (methylprednisolone 1 g daily, halved every 3 days, and tapered over 12 days). A repeat brain MRI showed the increased signal in temporal lobes had improved and there was atrophy of the medial temporal lobe (Figure 1C). The memory of the patient improved, and he could take care of himself with the assistance of family members when discharged.
After 4 months (November 3, 2020), the patient was admitted to our hospital again for a relapse characterized by confusion, dramatic memory deficit, personality changes with irritability, and episodes of aggressive behavior. Antibodies against AMPAR1 and AMPAR2 were detected both in the serum and CSF of the patient. The titer of AMPAR1 is 1:10 in CSF (Figure 1E) and serum (Figure 1G), and the titer of AMPAR2 is 1:100 in CSF (Figure 1F), 1:1000 in serum (Figure 1H). Owing to the recurrence, the patient was treated with intravenous injection of immunoglobulin (IVIG) combined with a repeat course of methylprednisolone and oral immunosuppressive drug (mycophenolate mofetil). He responded well to the treatment with the improvement of abnormal and aggressive behavior. Repeat MRI brain 3 weeks after admission showed significant atrophy of bilateral medial temporal lobe and temporal cortex (Figure 1D). Mycophenolate mofetil (3 g/day) was maintained when discharged. During the follow-up of a half year, he has had no further relapses and returned to work (MMSE 27 and mRS 1).
The timeline of the case was summarized in Figure 2. | anti-ampa receptor, autoimmune encephalitis, brain atrophy, case report, relapse | Not supported with pagination yet | null |
PMC362879_01 | Male | 16 | This 16-year-old boy, from a village in Fars Province, Southern Iran, developed left paraumblical (sometimes epigastric)abdominal pain with moderate intensity about five months prior to admission. The pain subsided after three months. However, 20 days later, the patient developed right-sided shoulder and chest pain accompanied with dyspnea. The patient's severe shoulder pain was mismanaged by a physician who considered it musculoskeletal pain. The patient then referred to Nemazee Hospital, the main hospital of southern Iran. His chest X-ray showed massive right-sided pleural effusion and thoracentesis revealed a dark red bloody effusion with: amylase: 8840 U/L (serum amylase: 3318 U/L), protein: 2.5 mg/dL (serum albumin: 4.1 mg/dL), lactate dehydrogenase (LDH): 227 U/L (serum LDH: 335 U/L), cell count: 590000 cells/mm3 with 2500 WBC/mm3 which has 73% segment, 2% lymphocyte and 6% mesothelial cell. Acid fast staining ofpleural fluid was negative three times. The results of pleural biopsy and pleural fluid culture for Tuberculosis were negative as well.
Important peripheral blood laboratory values were as follows: hemoglobin: 9.2 g/dL; white blood cell count: 7700/mm3; platelet count: 421000/mm3; mean corpuscular volume: 63.3 fl; mean corpuscular hemoglobin: 18.7 g; fasting blood sugar: 96 mg/dL; lactate dehydrogenase:335 U/L (nl: 120-230 U/L); serum glutamic-oxaloacetic transferase (SGOT):40 U/L; serum glutamic-pyruvic transaminase (SGPT): 15 U/L; alkaline phosphatase: 119 U/L; total bilirubin: 0.4 mg/dL; direct bilirubin: 0.2 mg/dL; prothrombin time: 13_ (control: 13_); partial thromboplastin time: 50_ (control: 35-45_); total calcium: 9.2 mg/dL; albumin: 4.1 mg/dL; triglyceride: 89 mg/dL (nl: 60-160 mg/dL); erythrocyte sedimentation rate (Westergen): 18 mm/hr; serum C-reactive protein: 12 mg/L (nl: <8 mg/L); serum fibrinogen: 215 mg/dL (nl: 200-400 mg/dL); fibrin split products: 9 g/mL (nl: <10 g/mL). Pleural fluid cytology (three times) and bronchial washing cytology were also negative. Due to markedly elevated serum and pleural fluid amylase abdominal CT scan was done 2 days after insertion of chest tube at the 8th day of hospitalization. The imaging showed a cystic structure measuring about 5 x 2 cm in the head of pancreas, highly suggestive of a pancreatic pseudocyst (Fig. 1). Also, abdominal ultrasonography revealed a small septated cystic structure in the head of the pancreas which was edematous and suggestive of pseudocyst of acute pancreatitis. Hepatobiliary tract and gall bladder were devoid of any gall bladder lesions, including stones. The patient had no history of drug and alcohol intake or abdominal trauma. His sweat chloride concentration was 21 meq/L.
Chest tube was inserted for three weeks, during this period the clinical symptoms such as dyspnea and chest pain improved but not completely. Thedaily drain output was about 1500 cc at the first day of chest tube insertion but it decreased gradually. After this period of conservative therapy another abdominal CT scan showed a mass measuring 3 4 cm in the head of pancreas with possibility of pseudocyst. No evidence of pancreatic duct dilatation or common bile duct dilatation was seen. Therefore external psendocyst drainage was done with mushroom insertion. Mushroom was removed after one week when no drainage was seen. Finally the patient was discharged after 40 days of hospitalization. The cause of pancreatitis could not be identified. | null | Not supported with pagination yet | null |
PMC8847199_01 | Female | 54 | A 54-year-old female patient was admitted to Lanzhou University Second Hospital on October 31, 2016 because of "intermittent upper abdominal pain and discomfort for 1 month." Symptoms became worse after eating greasy food. She did not receive any treatment before the admission. Because the above symptoms gradually worsened, the patient went to the local clinic. CT of the abdomen reveals space-occupying liver lesions, which was considered more as hepatic hydatid disease. For further diagnosis, the patient visited our hospital. The patient has been a carrier of HBV since childhood and has not been tested for HBV DNA or received antiviral treatment. At the same time, her mother and siblings are both HBV carriers, and she has a history of life in a pastoral area in her childhood. Appendectomy was performed because of acute appendicitis in 2009, and postoperative recovery was fine.
Laboratory examination results were as follows: white blood cells (WBC) 3.7 x 10 9 per L, red blood cells (RBC) 4.32 x 1012 per L, platelet (PLT) 119 x 109 per L, T bilirubin (TBiL) 11.7 mumol/L (normal range: 3.8-25.8 mumol/L), direct bilirubin (DBiL) 5.4 mumol/L (0-6.8 mumol/L), alanine aminotransferase (ALT) 359 U/L (0-50 U/L), aspartate aminotransferase (AST) 200U/L (0-50 U/L). Alpha-fetoprotein (AFP) was 1,210 ng/ml (0-7 ng/ml). Test of HBsAg, HBeAg, Anti-HBe and Anti-HBc were positive, while test of Anti-HBs was negative. Level of HBV DNA was 5.32 x 103 IU/ml (Normal <1.0 x 102 IU/ml). Casoni test was positive. Enhanced CT of the abdomen (Figures 1A,B) suggested malignant liver tumor and hepatic hydatid disease, but no abnormalities were found in gastroscopy and colonoscopy.
The patient had a history of HBV infection and did not receive regular antiviral treatment, and AFP was significantly increased. Combined with imaging enhancement mode, she was diagnosed as having HCC and chronic HBV infection. In addition, considering the facts that the patient had a life history in a pastoral area, the Casoni test was positive, and the abdominal CT showed obvious calcification in the liver-occupying space, she was diagnosed as having hepatic hydatid disease.
She underwent an operation on November 10, 2016. During the surgery, we found that the liver indicated signs of cirrhosis, and that the tumor and hydatid cysts were located in the right anterior lobe, adjacent to the right and middle hepatic veins. Therefore, hepatic Segment 5, 8 segment resection, hepatic hydatid internal capsule removal, and cholecystectomy (Figures 2a-d) were performed. She was discharged 8 days after the operation. Pathological results were infiltrating moderately differentiated hepatocellular carcinoma of the liver, with tumor thrombus in the vessel, accompanied by hydatid infection. Chronic cholecystitis was found without cancer invasion (Figures 3a,b). After being discharged from the hospital, she received long-term oral entecavir (0.5 mg/day) antiviral therapy and oral albendazole (0.4 g/day) for 6 months.
She underwent re-examination every 3 months after the surgery. In May 2017, the level of AFP increased to 895.5 ng/ml, and the first cycle of transcatheter arterial chemoembolization (TACE) treatment (oxaliplatin 150 mg + epirubicin 30 mg) was given. TACE was performed 3 times on June 27, August 7, and September 20, 2017, and AFP dropped to 3.73 ng/ml. In August 2019, AFP rose to 122.5 and 246.3 ng/ml in October 2019, but there was no evidence of recurrence of HCC in magnetic resonance imaging (MRI). The fifth TACE treatment was performed in October 2019, and there were no obvious signs of tumor staining during the TACE. AFP decreased to 182.7 ng/ml 1 month later. In March 2020, AFP elevated to 204.3 ng/ml, and the patient was advised to continue treatment, but she refused further treatment because of economic factors. In December 2020, AFP rose to 700.7 ng/ml. The recent follow-up was done in September 2021, and the patient was fine and received oral entecavir only. | alpha-fetoprotein, case report, hepatic hydatid disease, hepatitis b virus, hepatocellular carcinoma | Not supported with pagination yet | null |
PMC5831313_01 | Male | 18 | An 18-year-old boy immigrant from Guinea was admitted to our hospital because of fever and abdominal pain starting about three weeks before. His past medical history was unremarkable. Physical examination revealed diminished lung breath sounds consistent with pleural effusion and hepatomegaly. Lab tests showed abnormal blood count (PLT 741 x 103/mm3), high erythrocyte sedimentation rate (ESR:87 mm/h), C-reactive protein (CRP:10.22 mg/dl), and gamma globulins (25.3%, n.v. 11.1-18.8%), while procalcitonin (PCT) was 0.9 ng/ml (n.v. < 0.5 ng/ml). All these findings suggested an inflammatory/infectious disease.
Ultrasound examination showed fluid in the abdominal cavity together with bladder wall thickening (Figure 1), hepatomegaly, and pleural and pericardial effusion. Computed tomography confirmed all these findings (Figure 2).
Within few days the patient experienced worsening fatigue and dyspnea. Significant jugular venous distension and hepatomegaly were present on physical examination. Blood pressure was 100/60 mm Hg without evidence of pulsus paradoxus. However, echocardiography showed a large pericardial effusion (>5 cm) with significant respiratory variations (i.e., >25%) of mitral inflow and inferior vena cava plethora (Figure 3). All these findings were considered consistent with an incipient cardiac tamponade and the patient was treated with an urgent echo-guided subxiphoid pericardiocentesis (1500 mL of serohematic fluid), without complications. A pericardial drainage catheter was left in situ up to 48 h in order to promote adherence of pericardial layers and prevent further accumulation of fluid. The analysis of pericardial fluid was unremarkable (e.g., serology negative for Mycobacterium tuberculosis). The patient was empirically treated with Ibuprofen (600 mg tid) and Doxycycline (100 mg bid), until further microbiological tests (faeces and urine) revealed an Ancylostoma duodenale/Necator americanus infection. The patient was thus successfully treated with mebendazole (100 mg bid). His clinical conditions progressively improved, despite the persistence of abdominal discomfort. A new echocardiogram after 6 weeks showed an evolution to constrictive pericarditis (Figures 4 and 5).
At this point, due to the lack of a definite aetiology for the polyserositis with effusive-constrictive pericarditis we suspected an IgG4-related disease. Our diagnostic hypothesis was confirmed by elevated serum IgG4 concentrations (3.050 g/L, n.v. 0.011-1040). The patient was thus treated with prednisolone at a dose of 75 mg per day for 2 weeks. The echocardiogram showed a progressive resolution of the pericardial disorder without constrictive physiology. The prednisolone was tapered to 25 mg per day and the patient was discharged. Last follow-up echocardiogram (three weeks later) showed an almost complete resolution of the pericardial disease with mild residual thickening of both layers and residual deposits of fibrin (Figure 6). | null | Not supported with pagination yet | null |
PMC4753743_01 | Female | 51 | A 51-year-old female was diagnosed to have essential hypertension since 12 years and CKD since last 4 years. She progressed to end-stage renal disease 2 years back and was initiated on maintenance hemodialysis. For initial 1-year, she was on twice-weekly hemodialysis, which was subsequently increased to thrice weekly. She presented to us with complaints of progressive painless abdominal distension of 8-month duration along with anorexia and weight loss. There was no history of abdominal pain, altered bowel habits, pedal edema, fever, jaundice and no history to suggest hypothyroidism or connective tissue disease. There was no history of diabetes mellitus, jaundice, abdominal surgery and anti-tubercular treatment in past. Her medication included prazosin 10 mg/day, amlodipine 10 mg/day, calcium carbonate 1500 mg/day, twice weekly subcutaneous erythropoietin, oral iron and multivitamin. On examination, she had normal sensorium with blood pressure of 180/120 mm of Hg, pulse rate - 110/min, respiratory rate - 20/min, was afebrile and pale. Her abdomen was symmetrically distended with fluid thrill. There were no visible veins; hernial sites were normal with no cutaneous stigmata of chronic liver disease. Patient had hemoglobin of 7.7 g/dl, total leukocyte count (TLC) of 10400/mm3, with normal differential, platelet count 2.50 lakh/mm3, mean corpuscular volume 90.8 fl, mean corpuscular hemoglobin 30.1 pg/cell, mean corpuscular hemoglobin concentration 33.2 g/dl, normal coagulogram, urea 197 mg/dl, creatinine 9.4 mg/dl, sodium 144 mEq/L, potassium 6.1 mEq/L, chloride 110 mEq/L, aspartate aminotransferase, alanine aminotransferase and alkaline phosphatase were 27, 15 and 254 IU/L respectively, bilirubin 0.8 mg/dl, total protein and albumin 6.5 and 2.7 g/dl, calcium 9.7 mg/dl, phosphorous 9.3 mg/dl, and intact parathyroid hormone 346.8 pg/mL. The serology was negative for hepatitis B, hepatitis C and human immunodeficiency virus. On tapping, the ascitic fluid was hemorrhagic and showed TLC of 70/mm3 with 70% polymorphonuclear cells, protein was 3.8 g/dl, sugar 83 mg/dl, with adenosine deaminase of 32 IU/L, and serum ascites albumin gradient of 0.8. The Ziehl-Neelsen stain and Gram-stain were negative, as was the culture for Mycobacterium tuberculosis, and pyogenic organisms. The TB polymerase chain reaction and ascitic fluid for malignant cytology were also negative. Other cancer markers such as cancer antigen (CA) 125, CA 19-9, and carcinoembryonic antigen were also normal. Her electrocardiogram revealed left ventricular hypertrophy with strain pattern, while echocardiography revealed mild mitral regurgitation, left ventricular ejection fraction of 45-50% with no evidence of systolic or diastolic dysfunction. An ultrasound abdomen performed showed gross ascites, bilateral contracted kidneys and cholelithiasis while other abdominal organs were normal. Subsequently, a contrast-enhanced computed tomography (CECT) abdomen was performed which revealed gross ascites with peritoneal enhancement and hyper-densities within fluid, in addition to the finding of contracted kidneys and cholelithiasis [Figure 1]. Suspecting inadequate dialysis, the patient was subjected to daily dialysis. However, there was no improvement in her ascites, and it required repeated therapeutic aspiration. To ascertain the cause of refractory ascites, the patient was subjected to exploratory laparotomy, which showed hemorrhagic ascitic fluid, thickened peritoneum and dense adhesions in-between the bowel loops and bowel loops with the abdominal wall. Keeping the possibility of cocoon abdomen, an intra-operative peritoneal biopsy was taken, which showed hyalinized fibrocollagenous tissue devoid of any lining epithelium with fibrin deposition and inflammatory cell infiltrate. There was no evidence of granulomatous inflammation or malignancy in biopsy specimen [Figure 2]. A diagnosis of cocoon abdomen secondary to uremia was made, and the patient was managed with daily intensive hemodialysis. Over next 1-month, there was gradual improvement in her symptoms along with decrease in ascites. | chronic kidney disease, cocoon abdomen, maintenance hemodialysis | Not supported with pagination yet | null |
Subsets and Splits