id
int64 0
8.19k
| input_1
stringlengths 76
2.05k
| instruction
stringclasses 1
value | output
stringclasses 3
values |
---|---|---|---|
1,000 |
These results are inconsistent with those of previous studies, which generally suggest that leptin is associated with sympathetic activation [11].
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
result
|
1,001 |
polycystic lesions showing extensive growth in the extracerebral CSF spaces and secondary invagination of the brain [13].
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,002 |
The 47 pixels whose NDVI values were greater than 0 and less than 0.2 were seen as non-vegetation pixels (Tsai et al., 2007; Noujdina and Ustin, 2008).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,003 |
) Botswana[102], Nigeria[87], South Africa[101], Zimbabwe[94] Comoro rousette (Rousettus oblivious) Comoros[107] House mouse (Mus musculus) Kenya[124], Madagascar[118] Pigs (Sus scrofa domesticus) South Africa[104, 122] Rusty-bellied brush-furred rat (Lophuromys sikapusi) Cameroon[109] L.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,004 |
Our algorithm extends the work [25] which addresses the traditional semi-supervised learning problem where labeled data is from a single source.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,005 |
Contrarily for the TRECVID 2010 dataset we have used linear SVM to learn from a suitable feature map (homogeneous kernel map) built by the histogram intersection kernel [137, 138].
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
method
|
1,006 |
The application that motivated the calculation of g J was the identification of dot-depth one languages [49] according to a natural hierarchy of plus-free languages introduced by Brzozowski [29].
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,007 |
To quantify habitat indication for each native and non-native species, we used an objective method that we developed in previous studies of effects of invasions, land management practices, or environmental conditions on plant species composition in a variety of ecosystems in MS (Brewer 2008; Brewer and Menzel 2009; Brewer 2011; Brewer et al. 2012).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
method
|
1,008 |
However, the reduction of GnRHR gene expression during inflammation in the PT may also result from the direct action of pro-inflammatory cytokines and stress, because both IL-1β and corticotropin-releasing hormone (CRH) were shown to suppress GnRHR expression [14,38,39].
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,009 |
The vast majority of the Dot/Icm T4S effectors that gain access to the host cell cytoplasm are not absolutely required for bacterial intracellular replication, as the individual effector mutants do not replicate to lower numbers than WT bacteria (91).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,010 |
However, there are inevitably errors or uncertainties in spatial data, which are used to represent reality world (Goodchild and Gopal, 1989; Guptill and Morrison, 1995 Burrough and Frank, 1996; Shi and Liu, 2000).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,011 |
5 (Duarte et al., 2004; Hamada et al., 1999; Hrabe de Angelis et al., 1997; Xue et al., 1999).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,012 |
Candida spp. has been reported as one of the most common pathogens that cause hospital-acquired bloodstream infections in patients undergoing surgical or chemotherapeutic interventions and/or with underlying immunological deficiencies (Wisplinghoff et al., 2004; Pfaller & Diekema, 2007).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,013 |
By Perron’s theorem [27], the eigenvalue 1 is of multiplicity 1 and is the unique eigenvalue with maximum magnitude.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,014 |
This would also be consistent we our earlier study showing a threshold effect in electric field sensitivity, as evidenced by a sigmoidal dose–response curve (Kindzelskii and Petty 2000), which is a widelyrecognized feature of systems exhibiting cooperativity.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
result
|
1,015 |
Two possible interpretations of these observations are (a) the spontaneous hydrolysis of PMSF (James 1978) and/ or (b) the existence of spontaneous reactivation (Estévez and Vilanova 2009).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
result
|
1,016 |
NC is thought to be the result of growth dysregulation affecting the mesodermal portion of the pilosebaceous unit (2), leading to a follicle-based hamartoma with imperfect differentiation in the epithelial portion (4).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,017 |
Greater scapular upward rotation was demonstrated in rotator cuff dysfunction [14, 40, 41] and anterior glenohumeral joint tightness [13].
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,018 |
Partial and total inbreeding coefficients were calculated with the ENDOG program (Gutierrez et al., 2003), that uses the algorithms described by Meuwissen et al. (1992) y Lacy et al. (1996).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
method
|
1,019 |
The thromboembolic complication was the first symptom of HIT preceding a subsequent platelet-count decrease in four patients [22, 25, 36].
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,020 |
unstructured in HSPB6 and predicted to have similar properties in HSPB1 (18), that is essential for this preferred association.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,021 |
Cyclin D1 protein is overexpressed in more than 50% of human BCs [28] and has been frequently detected early in breast pre-neoplasias [29].
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,022 |
The MEK inhibitor PD98059, prevented AR induced by LPC (de Lamirande and Gagnon, 2002) but not by A23187 and zona pellucida (du Plessis et al., 2002).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,023 |
GST-fusion proteins comprising the C-terminus of wild-type and mutant SERTs were used for pull-down experiments carried out with SEC24C and SEC24D.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
method
|
1,024 |
In all previous attempts [15, 30, 34, 8, 64, 43], the overlap problem is handled by partitioning the placement area and adding new constraints to the formulation to restrict the movement of the cells before solving another optimization problem.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,025 |
mutant embryos (Deng et al., 1994; Yamaguchi et al., 1994; Sun et al., 1999; Guo and Li, 2007).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,026 |
Metal concentrations were measured using an ELAN® 6000 ICP-MS (Perkin-Elmer, SCIEX, USA) (Maher et al. 2001).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
method
|
1,027 |
A recent storytelling task by Hendriks et al. (2014) confirmed this overall pattern but also highlighted that other factors can modulate this effect of the discourse stages.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,028 |
…did not use any chemical, biochemical or physiological characters, but in later taxomomic studies of Aspergillus physiological tests (Klich
& Pitt 1988) and secondary metabolites (for example Frisvad 1989; Frisvad et al. 1998a, 2004; Samson et al. 2004; Frisvad et al. 2007) have been introduced.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,029 |
During the uplift of the Tibetan Plateau, river captures and flow reversals caused regional extension of the Yangtze River basin to the eastern Tibetan Plateau (Clark et al. 2004; Fan et al. 2005).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,030 |
Nowadays, there are only a few studies that have a systemic view on these accidents (Bentley 2008) and which try, by using detailed analysis (Gao and Abeysekera 2004, Leclercq and Thouy 2004, Bentley et al.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,031 |
The authors proposed that partial repairs would restore the force couple of the humeral head and increase acromion-humeral distance, resulting in dramatic changes in pain and function [16-19].
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,032 |
Given that the angular spacings between adjacent views in golden angle acquisition are unevenly distributed, 610 views were used in the outermost region to fulfill the Nyquist criterion for a 240 240 image matrix (15).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
method
|
1,033 |
Insulin sensitivity was estimated by the insulin sensitivity index (SI) [6]; beta cell function was assessed as an index of the corrected insulinogenic response (CIR) [7] and disposition index (DI=CIR×SI) to adjust insulin secretion for SI.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
method
|
1,034 |
Neurotransmitter release at the NMJ is regulated by factors intrinsic to the motor neuron, including proteins that regulate intracellular signaling, as well as retrograde signals that convey postsynaptic activity levels to modulate neuronal properties (Collins and DiAntonio, 2007; Harris and Littleton, 2015; Menon et al., 2013).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,035 |
This indicates that GJIC is important for controlling the balance between proliferation and apoptosis of fibroblasts in the skin, as well as for managing the production of ECM [11].
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,036 |
While many genetic correlations between body parts in Drosophila are positive (Cowley and Atchley 1990; Norry et al. 1997), an exception appears to exist for the eyes and head.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,037 |
HA monomer, consisting of two linked subunits; HA1 (~324 amino acids) and HA2 (~222 amino acids, (Webster et al., 1992), totally weighs about 60 kDa in the unglycosylated form (Sriwilaijaroen et al.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,038 |
Duschek and Schandry (2007) reported recently that impaired brain perfusion in hypotension especially in middle cerebral arteries (MCA) can cause cognitive deficits and even depression.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,039 |
Thus, the Patient Health Questionnaire-9 (PHQ-9) (Kroenke et al. 2001)—already administered to students seeking services at the clinic—was chosen as the screening instrument for the study.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
method
|
1,040 |
Wadge has proposed in [112] a fragment of higher-order Horn logic called “definitional programs” as a meta-programming language “based on Church’s Simple Theory of Types” [112], that is, the Simply Typed Lambda Calculus or λ→ [28, 6].
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,041 |
[35] To document in-depth the effects that cognitive impairment has on women’s personal and professional lives.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,042 |
In particular, it has been noted that high levels of abdominal fat pose a particularly severe risk for progress to metabolic disease (12–18), whereas fat deposited subcutaneously is more benign (17,19) and may actually be protective (20).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,043 |
In a number of cases this resulted in a similar effect on transcription, namely activation of cryptic splice sites and exon skipping (Gardella et al, 1996; Posteraro et al, 1998; Terracina et al, 1998; Weil et al, 1988).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
result
|
1,044 |
…sample into two groups comparing those who displayed high levels of behavior problems as indexed by the Eyberg Problem or Intensity factor, using previously validated cut-off scores and mirroring the criteria applied during recruitment for the study (Burns and Patterson 2001; Dishion et al. 2008).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
method
|
1,045 |
Dominant and non-dominant breast categorisation was implemented by examining the magnitude of superioinferior breast displacement (the direction in which the greatest breast displacement occurred; Scurr et al., 2010) of each breast, within each participant, and assigning the breast with the greatest superioinferior displacement as the dominant breast and the least as the non-dominant breast.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
method
|
1,046 |
…River Capture
There is overwhelming evidence that the Indus, Brahmaputra, and Ganges Rivers, existed as separate river systems soon after the original India-Asia collision (~55–45 Million Years (MY) ago) and even before large-scale elevation of the Himalayan mountains (Clift and Blusztajn 2005).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,047 |
Group II anti-cryptococcal mAbs have been shown to enhance the function of effector cells (29, 44, 55) which likely have a primary role in host defense (56).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,048 |
For the MEC study, data for the three SNPs presented in this study were extracted from the GWA scan data generated using Illumina 660W.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
method
|
1,049 |
…remove excess copper and is observed by clinical symptoms such as hepatic abnormalities, neurological defects, more commonly psychiatric/behavioral symptoms (Hedera 2017), and eventually liver failure which can cause death when untreated (Chesi et al. 2016; DiDonato et al. 2002; Yu et al. 2017c).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,050 |
Comparison of Ptf1a regulation in the CNS and pancreas These findings parallel those recently reported in the pancreas, where the 2.3 kb 5 element is also active (Masui et al., 2008).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,051 |
found that about 74 % had no regrets about treatment choice although about half reported difficulty and distress in making the decision [4].
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,052 |
…turkey P450 1A and 3A orthologs with respect to AFB1 metabolism in liver microsomal and heterologously-expressed systems, which are, in fact closer to humans than those from either mice and rats (Rawal et al., 2010b; Gallagher et al., 1994, 1996; Ueng et al., 1995, 1997; Yip and Coulombe, 2006).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,053 |
functions as a molecular switch that both controls the duration of the NF-nB transcriptional response (20).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,054 |
On the whole, we had better results than Winslow and Brunt [31], perhaps because all the operations were performed by a single surgeon in our series.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
result
|
1,055 |
32 We note that our use of the term ‘blatant’ refers to the type (and not extent) of dehumanization perceptions (see also Kteily et al., 2015).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,056 |
Recent research has shown that features of interest in physiological signals such as electrocardiogram [5], [6] and photoplethysmogram [7] can be detected accurately from these sparse pulses.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,057 |
Inclusion criteria were having erosions detected by endoscopy at enrollment into this study or having a past history of RE, and having reflux symptoms at enrollment into this study, which could be evaluated using the 8-item Short-Form Health Survey (SF 8TM, Japanese translation) [12, 13] and the Frequency Scale for the Symptoms of GERD (FSSG) [14].
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
method
|
1,058 |
In addition, they are in keeping with reports that Ser19 phosphorylation is low in swine carotid arteries relaxed with forskolin (Meeks et al. 2008) as well as in a-toxin permeabilized mouse tail arteries relaxed with urocortin and cAMP (Lubomirov et al. 2006).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,059 |
In the domain of supply chain, logistics, and operations management, the approach has been popularized by Holmström et al. (2009),
leading to promising initial applications (e.g., Finne and Holmström, 2013; Schleper and Busse, 2013; Tanskanen et al., 2015).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,060 |
While quantitative changes in bacterial numbers in the soil surrounding the AMF are seldom reported, changes in bacterial composition may occur (Olsson et al., 1996; Andrade et al., 1997).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,061 |
Up to now, studies of brucine are mainly focused on reducing the central toxicity by transdermal administration and improving the efficacy through a novel drug carrier [3, 10].
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,062 |
On the other hand, phospho-GSK-3β has recently received attention as a common mediator in protective mechanisms activated by different interventions, including IPC and ischemic postconditioning (IPost-C) [3,4,11,12].
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,063 |
Given the tree and the MSA, the Rate4Site algorithm (16) is used to calculate positionspecific evolutionary rates under an empirical Bayesian methodology (17).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,064 |
It has previously been shown that members of the ADAM family of metalloproteinases are expressed in adult thymi [7,8,9,10,12,13] and that ADAM8 is expressed in fetal and adult thymi [12,13].
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,065 |
For PLP-based features, we used mixtures of 128 for baseline, SWCE and Multi-peak and mixture of 64 Gaussians for the Thomson_1 and Thomson_2 systems.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
method
|
1,066 |
The invaded range of the species
is well known (e.g. Brown et al. 2011), but the native
range of the species in Asia has until now been poorly
understood (Poutsma et al. 2008).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,067 |
Similar results were found in other restinga areas of the State of Rio de Janeiro, where Eugenia and Erythroxylum (Erythroxylaceae) were pointed out as super host plants (Maia, 2001; Oliveira and Maia, 2005).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
result
|
1,068 |
lingual phrase-based machine translation system with a reranking post-processing step8 (Wubben et al., 2012) and Hybrid, a model which first performs sentence splitting and deletion operations over discourse representation structures and then further simplifies sentences with PBMT-R (Narayan and Gardent, 2014).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
method
|
1,069 |
Sixteen other subjects took part in studies of lower intensity but more prolonged exercise comprising 45 min at 70% _ VO2peak then to fatigue at 90% _ VO2peak [3, 4].
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,070 |
This was surprising since sLex bearing LGALS3BP has been shown to be involved in the rolling of the ZR-75-1 breast cancer cell line on endothelial cells (8).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,071 |
2002) or by enforcing constitutive expression of Dnmt1 in cells (Feltus et al. 2003) or of the CpG-specific bacterial DNA methyltransferase SssI in isolated nuclei (Fatemi et al.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,072 |
But from the experimental results in Wang et al. [2014], we find that R1MP outperforms these algorithms.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
method
|
1,073 |
qRT-PCR of androgen regulated genes (TMPRSS2, KLK3), and DNA repair genes (PRKDC, POLE2, FANCI), were carried out as described previously (4) using the following primer pairs: GAPDH (F: GGAGCGAGATCCCTCCAAAAT, R: GGCTGTTGTCATACTTCTCATGG); TMPRSS2 (F: TACTCTGGAAGTTCATGGGC R: GTCATCCACTATTCCTTGGCT); KLK3 (F: TGAACCAGAGGAGTTCTTGAC R: TGACGTGATACCTTGAAGCA); PRKDC (F: AGCTGGCTTGCGCCTATTT R: GGGCACACCACTTTAACAAGA); POLE2 (F: CTGCTCCGTGGTGAAGCTAT, R: ATTCCTGGACTGCTGCTTCC); FANCI (F: TTCTCACTGCTCTTTTCAGGGAT, R: GCCCTGTTTCCTTTAGCTGC).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,074 |
Here we analyse the sustainability of the initiative over a 32-month period of operations, using a modified version of a framework developed by Sarriot et al. (2004a).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
method
|
1,075 |
…independent real factor analysis (or noisy ICA), together with the corresponding criteria for the number of independent factors (Xu, 1998b, 2000, 2001a); as well as (e) several extensions of LMSER learning and the corresponding criteria for the number of hidden units (Xu, 1993, 1998b, 2000, 2001a).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
method
|
1,076 |
8
To validate the quality of our categorization, the next section discusses series of experiments that compare the performance of the vector space categorization approach with one of the top classifiers, Naïve-Bayes (Friedman et al., 1997).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
result
|
1,077 |
Critically, however, our reliability results converge with other investigations in the literature using a variety of methodologies (e.g., Brown et al. 2014; Enock et al. 2014; Schmukle 2005; Staugaard 2009).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
result
|
1,078 |
On the other hand, there were reports showing that chewing rate and eating behavior did not differ between people with high and normal BMI [64, 65].
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,079 |
Modelled HO2 concentrations were generally found to agree with observations (Mao et al., 2009).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,080 |
Recent studies found that dynein which was involved in neuronal migration may play an important role in the function of BDNF (Tsai et al., 2007; Zhou et al., 2012).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
result
|
1,081 |
Twelve studies [3, 11, 15, 44, 50, 56, 60–62, 67, 69] reported incorporating some form of cultural adaptation salient to AAs including recruitment of only AA participants [60–62, 67], culturally specific diet and PA modifications [3, 11, 50, 56, 60, 61, 67], cultural sensitivity training for research staff [44, 56], employing AA case managers and interventionists [3, 11, 50, 60, 67], special attention to religion and spirituality [60, 62], AA community-focused field-trips to grocery stores, parks, and so forth [50], selection of study site in anAA community [67], and the formation of a minority implementation committee [56].
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,082 |
, 1993), and the nuclear mitotic apparatus (NuMA) proteins (Lydersen and Pettijohn, 1980; Compton et al., 1992; Yang and Snyder, 1992).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,083 |
This protein was essential for the maintenance of the kDNA during cell division (12).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,084 |
Periodic boundary conditions were applied and electrostatic interactions were treated using the smooth particle mesh Ewald method [41] with a grid spacing of 1 Å.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
method
|
1,085 |
The same 24 color pictures of Barbary macaques used in Pascalis et al. (2005) were used in this experiment to create 12 pairings (6 easy and 6 hard pairings).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
method
|
1,086 |
To understand the relationship between exercise intensity and affective responses research has focused on quantifying pre- to during and pre- to post-exercise changes in affective responses at different exercise intensities [3-14].
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,087 |
They have been identified as one of the major threats to the maintenance of biodiversity and ecosystem functioning (Ruiz et al., 1997; Mack et al., 2000).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,088 |
The Tsimane’ reported being healthy at the time of the study but, in the past, they might have suffered from otorhinolaryngological or other diseases impairing olfaction [19].
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,089 |
Imaging studies showed reduced activation of visual cortices during vestibular stimulation (Brandt et al., 1998; Brandt, 1999; Bense et al., 2001), and this was hypothesized to be a cortical mechanism contributing to stabilize visual images during self-motion, along with brainstem reflexes (such as the vestibulo-ocular reflex).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,090 |
The joint distribution differs significantly from the earlier distribution, developed in Forest et al. (2002) and used in Webster et al. (2003), because the model simulations for the twentieth century used by Forest et al. (2006, 2008) include several additional forcings.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
method
|
1,091 |
Our recent characterization of spike frequency adaptation intrinsic to VSMN led us to hypothesize that the duration of phase 2 should be positively correlated with increasing phase 3 frequency (Krans and Chapple 2005).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,092 |
Total IgA fractions from all sera were purified as previously described [13] and used in experiments at a concentration of 1 μg/ml.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
method
|
1,093 |
For example, Kawato et al. (1990) suggested that movement trajectories can be projected using critical via-points through which the trajectory has to pass at a certain time, rather than in terms of the moment-by-moment dynamics of the implemented movement trajectory. Optimal trajectories can then be learnt by applying local optimising principles for getting from one via-point to the next. In this way, impoverished predictions can be used to monitor rich implementations. In the same way, language users might predict particularly crucial aspects of an utterance, but the aspects that they predict will depend on the circumstances. More generally, Meyer & Hagoort question the value of predicting one’s own utterance. They argue that prediction is useful when it is likely to differ from the actual event. This is the case when predicting another person’s behaviour or when the result of one’s action is uncertain (e.g., moving in a strong wind). But they argue that people are confident about their own speech. Meyer & Hagoort admit that they will tend to be less confident in dialogue, and we agree. But more important, we argue that the behaviour of the production implementer is not fully determined by the production command, because the complex processes involved in production are subject to internal (“neural”) noise or priming (i.e., influences that may not be a result of the production command). Assuming that these sources of noise do not necessarily affect forward modelling as well, predicted speech may differ from actual speech. In addition, prediction is useful even if the behaviour is fully predictable, because it allows the actor to plan future behaviour on the basis of the prediction. In fact, we made such a proposal in relation to the order of heavy and light phrases (see sect. 3.1, target article). Hartsuiker claims that our account incorrectly predicts an early competitor effect in Huettig and Hartsuiker (2010). His claim is based on the assumption that Response/Pickering & Garrod: An integrated theory of...
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,094 |
These results are in agreement with those reported by Schmalz et al.(20), who did not observe any negative effect in the viability of fibroblastkeratinocyte cells cultured onto pure Pd during 24 h.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
result
|
1,095 |
Synaptic heterogeneity is not the only evidence for plasticity of several synaptic parameters: (1) Hebbian pairing of pre and postsynaptic neurons was shown to result in a selective increase in low frequency synaptic transmission (Markram and Tsodyks, 1996) which is due to a specific change in U (Tsodyks and Markram, 1997); (2) while presynaptic regulation of neurotransmitter release is typically considered as a mechanism to block or enhance transmission between neurons, this action rather serves to change the frequency dependence of transmission; (3) paired pulse experiments that demonstrated changes in paired pulse ratios rather demonstrated changes in frequency dependence; (4) we have recently found that an initial stage of LTDa is preceded by a selective loss of facilitation (LTDf) (A.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
result
|
1,096 |
This technique is also applied to chemoembolization of tumor-feeding extrahepatic collateral vessels that develop with an incidence of approximately 25% (5,7), and chemoembolization of these ves-
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
background
|
1,097 |
This antibody has been shown to detect a protein of 70 kDa when wild-type ChAT was expressed in COS cells (Ohno et al. 2001).
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
method
|
1,098 |
In this review article, we first briefly explain the steps of a well-performed SR/MA [1] and then apply them to the topic of VUR.
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
method
|
1,099 |
First and foremost, consistent with our previous work (Leonard and Baum, 1998; Leonard et al., 1997a, 1997b), the results of this study represent yet another demonstration of the ability of RHD individuals to use a given type of contextual information, even under conditions of increased
processing…
|
Citations can describe a {{answer_choices[0]}}, a {{answer_choices[2]}}, or {{answer_choices[1]}}.
What is the citation below describing?
"{{input_1}}"
|
result
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.