id
int64 639
78.1M
| url
stringlengths 32
214
| title
stringlengths 1
184
| abstract
stringlengths 0
54.8k
| date_created
timestamp[s]date 2001-01-29 10:13:49
2024-10-10 00:38:07
| text
stringlengths 284
544k
|
|---|---|---|---|---|---|
12,923,756 |
https://en.wikipedia.org/wiki/Urera_expansa
|
Urera expansa
|
Urera expansa is a species of plant in the family Urticaceae. It is endemic to Jamaica.
| 2021-11-15T16:06:28 |
# Urera expansa
***Urera expansa*** is a species of plant in the family Urticaceae. It is endemic to Jamaica.
## InfoBox
| *Urera expansa* | |
| --- | --- |
| Conservation status | |
| <br>Near Threatened (IUCN 2.3) | |
| Scientific classification | |
| Kingdom: | Plantae |
| *Clade*: | Tracheophytes |
| *Clade*: | Angiosperms |
| *Clade*: | Eudicots |
| *Clade*: | Rosids |
| Order: | Rosales |
| Family: | Urticaceae |
| Genus: | *Urera* |
| Species: | ***U. expansa*** |
| Binomial name | |
| ***Urera expansa***<br>(Sw.) Griseb. | |
|
|
74,656,961 |
https://en.wikipedia.org/wiki/Vandalianism
|
Vandalianism
|
Vandalianism was the Polish paranational concept based on the belief that the Poles descended from the Vandals. The term was coined by Wojciech Paszyński in 2022 for the similarity to Sarmatism and for the attempt to avoid confusion with the term 'vandalism' as well. The concept of the Vandal origin of Poles was initiated in Poland by Vincent Kadlubek. It has achieved the peak of popularity in the middle of the 16th century. After that it has been mostly forgotten and replaced by Sarmatism, once again gaining some popularity in the 21st century Poland.
| 2024-03-08T18:10:18 |
# Vandalianism
**Vandalianism** was the Polish paranational concept based on the belief that the Poles descended from the Vandals. The term was coined by Wojciech Paszyński in 2022 for the similarity to Sarmatism and for the attempt to avoid confusion with the term 'vandalism' as well.
The concept of the Vandal origin of Poles was initiated in Poland by Vincent Kadlubek (between 1190 and 1208). It has achieved the peak of popularity in the middle of the 16th century. After that it has been mostly forgotten and replaced by Sarmatism, once again gaining some popularity in the 21st century Poland.
## Further reading
* Paszyński W., *Sarmatia and Vandalia. Introduction to the Polish Paranational Concepts*, \[in:\] *Słowiańszczyzna dawniej i dziś – język, literatura, kultura. Monografia ze studiów slawistycznych*, vol. 5, A. Kołodziej, M. Ślawska, A. Ursulenko, B. Juszczak (Eds.), Wrocław 2022, pp. 371–377.
* Paszyński W., *Wandalia. Najstarsza wizja pradziejów Polski* \[Vandalia. The Oldest Vision of Poland's Prehistory\], Sandomierz 2019.
* Paszyński W., *Polska jako Wandalia. Koncepcja wandalska w dziejopisarstwie polskim wieków średnich* \[Poland as Vandalia. Vandalian Concept in the Polish Historiography of Medieval Times\], „Orbis Linguarum” vol. 51/2018, pp. 357–390.
|
29,398,466 |
https://en.wikipedia.org/wiki/Campbell_Crest
|
Campbell Crest
|
Campbell Crest is a peak rising to 1,670 metres (5,500 ft) at the west end of the Bowditch Crests, Bermel Peninsula, on the Bowman Coast of Graham Land on the Antarctic Peninsula. The feature is the highest point in the Bowditch Crests and appears in aerial photographs taken by Sir Hubert Wilkins in 1928 and Lincoln Ellsworth in 1935. It was roughly mapped from the Ellsworth photographs by W.L.G. Joerg in 1937, and later photographed from the air by the United States Antarctic Service in 1940 and the U.S. Navy in 1966. It was surveyed by the Falkland Islands Dependencies Survey in 1958. It was named by the UK Antarctic Place-Names Committee in 1993 after Jon C. Campbell. Campbell was a geographer with the U.S. Geological Survey (USGS) from 1981, a USGS member in the International GPS Campaign at McMurdo Station, Byrd Station, and South Pole Station from 1991-92, and the secretary for the Advisory Committee on Antarctic Names under the U.S. Board on Geographic Names since 1993
| 2022-04-29T03:04:27 |
# Campbell Crest
**Campbell Crest** (68°30′S 65°27′W / 68.500°S 65.450°W / -68.500; -65.450) is a peak rising to 1,670 metres (5,500 ft) at the west end of the Bowditch Crests, Bermel Peninsula, on the Bowman Coast of Graham Land on the Antarctic Peninsula. The feature is the highest point in the Bowditch Crests and appears in aerial photographs taken by Sir Hubert Wilkins in 1928 and Lincoln Ellsworth in 1935. It was roughly mapped from the Ellsworth photographs by W.L.G. Joerg in 1937, and later photographed from the air by the United States Antarctic Service in 1940 and the U.S. Navy in 1966. It was surveyed by the Falkland Islands Dependencies Survey in 1958. It was named by the UK Antarctic Place-Names Committee in 1993 after Jon C. Campbell. Campbell was a geographer with the U.S. Geological Survey (USGS) from 1981, a USGS member in the International GPS Campaign at McMurdo Station, Byrd Station, and South Pole Station from 1991-92 (he conducted developmental GPS geodetic surveys from USCGC *Polar Sea* at Mount Siple and Pine Island Bay), and the secretary for the Advisory Committee on Antarctic Names under the U.S. Board on Geographic Names since 1993
* This article incorporates public domain material from "Campbell Crest". *Geographic Names Information System*. United States Geological Survey.
|
29,334,309 |
https://en.wikipedia.org/wiki/Cape_Burd
|
Cape Burd
|
Cape Burd is a low rock cliff forming the southwest extremity of the Tabarin Peninsula, at the northeast end of the Antarctic Peninsula. It was charted by the Falkland Islands Dependencies Survey (FIDS) in 1946 and named for Oliver Burd, a FIDS meteorologist who lost his life when the base hut at Hope Bay burned on November 9, 1948. Neighbouring Cape Green commemorates Michael Green, a FIDS geologist who lost his life in the same fire.
| 2019-10-04T10:27:27 |
# Cape Burd
**Cape Burd** (63°39′S 57°9′W / 63.650°S 57.150°W / -63.650; -57.150) is a low rock cliff forming the southwest extremity of the Tabarin Peninsula, at the northeast end of the Antarctic Peninsula. It was charted by the Falkland Islands Dependencies Survey (FIDS) in 1946 and named for Oliver Burd, a FIDS meteorologist who lost his life when the base hut at Hope Bay burned on November 9, 1948. Neighbouring Cape Green commemorates Michael Green, a FIDS geologist who lost his life in the same fire.
* This article incorporates public domain material from "Burd, Cape". *Geographic Names Information System*. United States Geological Survey.
|
70,005,303 |
https://en.wikipedia.org/wiki/Bagayarich
|
Bagayarich
|
Bagayarich was an ancient locality in the northwestern part of Armenia in the district of Daranali. The site is located near the village of Çadırkaya in Turkey's Erzincan Province, c. 91.6 kilometers west of the modern city of Erzurum. In ancient times, it housed the cult centre of the divinity Mihr, the god of fire.
| 2023-03-21T16:08:59 |
# Bagayarich
**Bagayarich** (also spelled **Bagayarič**, **Bagarich** or **Bagarinch**) was an ancient locality in the northwestern part of Armenia in the district of Daranali (or Daranałi\[k\]). The site is located near the village of Çadırkaya (formerly Pekeriç) in Turkey's Erzincan Province, c.91.6 kilometers west of the modern city of Erzurum (ancient Karin). In ancient times, it housed the cult centre of the divinity Mihr (Mithra i.e. Mithras), the god of fire.
## Name
The name of Bagayarich is attested in Greek by the ancient geographer and historian Strabo (died c.24 AD) as **\*Bagaris** and **Basgoidariza**, and by Ptolemy (died c.170 AD), likewise in Greek, as **\*Bagarizaka**. The modern Turkish name is **Pekeriç**, and its new official name of **Cadırkaya** means "tent-rock".
## Geography
Bagayarich is located near the northeastern corner of the Pekeriç plain. This plain is separated from the Vican plain downstream on the Tuzla Su by a series of low hills. Bagayarich itself is located at the base of a large conical rock which historically was the site of the town's fortress. The village consists of two distinct "lobes".
In ancient times, the locality of Bagayarich was situated on the primary road passing through northern Armenia that linked the town of Sebastaea (present-day Sivas) in the Roman Empire with Ecbatana (present-day Hamadan) in Media through Satala, Bagayarich, Karin (present-day Erzurum) and Artaxata (Artashat).
## History
The locality was known for being the site of the important temple of Mihr (i.e. Mithra, Mithras), that is, one of the eight main pagan shrines of pre-Christian Armenia. It was traditionally held to have been built by King Tigranes the Great (r.95-56 BC). The site first appears in Armenian historiography in late antique works. Within this context, according to Agathangelos, the temple of Mihr at Bagayarich was destroyed by Gregory the Illuminator. The modern historian Robert H. Hewsen explains that the entire surrounding district of Daranali may have been part of the domain of the aforementioned Mihr temple, as, after it was destroyed during the conversion of Armenia to Christianity, the district of Daranali was turned into the property of the Armenian church.
Bagayarich was historically the capital of the district of Derzene. It has since been superseded by the town of Tercan, which perhaps took place in the early Ottoman period.
By the 20th century, Bagayarich was composed of two adjoining villages by the name of Verin ("upper") and Nerkin ("lower") Bagayarich, which respectively consisted of 80 and 130 homes. Half of these homes were inhabited by Armenians and the other half by local Muslims. The two villages of Verin and Nerkin Bagayarich together formed the larger village in the *caza* ("district") of Derjan. At the time, the remains of what may have been the temple as well as an old castle could still be viewed at Bagayarich.
## Present status
The site's main focus in the present day is a conical hill. A simple radio tower is located at the peak of the site including some remnants of rough stone-and-mortar masonry dating back to the 19th or 20th century.
## Sources
|
12,630,649 |
https://en.wikipedia.org/wiki/Fort_DuPont_State_Park
|
Fort DuPont State Park
|
Fort DuPont State Park is a Delaware state park located in Delaware City, Delaware. Fort DuPont itself, named after Rear Admiral Samuel Francis duPont, was used as a military base from the Civil War through World War II, and was part of a three fort defense system along with Fort Delaware and Fort Mott, with the purpose of protecting the Delaware River and the city of Philadelphia from naval attacks from 1897 through 1942. Fort DuPont State Park is situated along the Delaware River and Chesapeake and Delaware Canal.
| 2022-08-18T23:20:43 |
# Fort DuPont State Park
**Fort DuPont State Park** is a Delaware state park located in Delaware City, Delaware. Fort DuPont itself, named after Rear Admiral Samuel Francis duPont, was used as a military base from the Civil War through World War II, and was part of a three fort defense system along with Fort Delaware and Fort Mott, with the purpose of protecting the Delaware River and the city of Philadelphia from naval attacks from 1897 through 1942. Fort DuPont State Park is situated along the Delaware River and Chesapeake and Delaware Canal.
## Leisure and historical interpretation
Fort DuPont State Park contains the home field of the Diamond State Base Ball Club, a vintage base ball team. The Diamond State Base Ball Club typically plays 4-6 games there per year. The Diamond State Base Ball Club also plays at least once per year at Fort Delaware on Pea Patch Island and also at nearby Port Penn, Delaware. The Diamond State Base Ball Club is a non-profit amateur organization created for the purposes of providing physical fitness to its members, educating the public on the history of baseball and local history, and serving as a point of public pride.
## InfoBox
| Fort DuPont State Park | |
| --- | --- |
| Parade grounds at Fort DuPont | |
| Location | New Castle, Delaware, United States |
| Coordinates | 39°34′17″N 75°35′01″W / 39.57139°N 75.58361°W / 39.57139; -75.58361 |
| Area | 322 acres (130 ha) |
| Elevation | 3 ft (0.91 m) |
| Established | 1992 |
| Named for | Fort DuPont, which is named for Samuel Francis duPont |
| Governing body | Delaware Department of Natural Resources and Environmental Control |
| Website | Fort DuPont State Park |
|
27,901,546 |
https://en.wikipedia.org/wiki/Chubra_Peak
|
Chubra Peak
|
Chubra Peak is the peak rising to 1541 m east of Temple Glacier and south of Kasabova Glacier in Korten Ridge on Davis Coast in Graham Land, Antarctic. The peak is named after the settlement of Chubra in eastern Bulgaria.
| 2021-10-19T11:41:25 |
# Chubra Peak
**Chubra Peak** (Bulgarian: връх Чубра, romanized: *vrah Chubra*, IPA: \[ˈvrɤx ˈt͡ʃubrɐ\]) is the peak rising to 1541 m east of Temple Glacier and south of Kasabova Glacier in Korten Ridge on Davis Coast in Graham Land, Antarctic.
The peak is named after the settlement of Chubra in eastern Bulgaria.
## Location
Chubra Peak is located at 63°58′13″S 59°54′52″W / 63.97028°S 59.91444°W / -63.97028; -59.91444, which is 2.6 km southeast of the head of Lanchester Bay, 6.9 km south-southeast of Milkov Point and 6.1 km southwest of Sredorek Peak. German-British mapping in 1996.
## Map
* Trinity Peninsula. Scale 1:250000 topographic map No. 5697. Institut für Angewandte Geodäsie and British Antarctic Survey, 1996.
*This article includes information from the Antarctic Place-names Commission of Bulgaria which is used with permission.*
|
32,485,209 |
https://en.wikipedia.org/wiki/Black_Island_(Wilhelm_Archipelago)
|
Black Island (Wilhelm Archipelago)
|
Black Island is an island 0.4 km (0.2 nmi) long, lying close southwest of Skua Island in the Argentine Islands, Wilhelm Archipelago. It was charted and named descriptively in 1935 by the British Graham Land Expedition under John Rymill.
| 2022-04-29T03:11:01 |
# Black Island (Wilhelm Archipelago)
**Black Island** is an island 0.4 km (0.2 nmi) long, lying close southwest of Skua Island in the Argentine Islands, Wilhelm Archipelago. It was charted and named descriptively in 1935 by the British Graham Land Expedition under John Rymill.
This article incorporates public domain material from "Black Island". *Geographic Names Information System*. United States Geological Survey.
## InfoBox
Black Island
| Black IslandLocation in Antarctica | |
| --- | --- |
| Geography | |
| Location | Antarctica |
| Coordinates | 65°15′S 64°17′W / 65.250°S 64.283°W / -65.250; -64.283 |
| Archipelago | Wilhelm Archipelago |
| Administration | |
| Administered under the Antarctic Treaty System | |
| Demographics | |
| Population | Uninhabited |
|
55,289,107 |
https://en.wikipedia.org/wiki/Wolfgang_R._Wasow
|
Wolfgang R. Wasow
|
Wolfgang R. Wasow was an American mathematician known for his work in asymptotic expansions and their applications in differential equations.
| 2023-10-07T08:04:49 |
# Wolfgang R. Wasow
**Wolfgang R. Wasow** (25 July 1909 – 11 September 1993) was an American mathematician known for his work in asymptotic expansions and their applications in differential equations.
## Early life
Wasow was born as Wolfgang Richard Thal in Vevey, Switzerland, to Jewish parents, Alma Thal and Max Richard Kleineibst, who had met in Paris. Alma Thal was from Jelgava in Latvia, a part of Czarist Russia at the time. Her family had sent her to Switzerland to put an end to her political activities. Richard Kleineibst was also a political activist and later gained prominence as a leftwing social democrat in the Weimar Republic. He became a founding member of Socialist Workers' Party of Germany in 1931 and was the first editor in chief of Sozialistische Arbeiter-Zeitung, its main organ.
Alma Thal moved to Germany in 1910 and then several more times within Germany. And so Wolfgang grew up first in Munich, and then in Freiburg, Heidelberg and Berlin. When Alma Thal married the Munich photographer Eduard Wasow, Wolfgang took his name. In 1921, Wolfgang Wasow was sent to a boarding school, the Freie Schul- und Werkgemeinschaft Letzlingen, founded by Bernhard Uffrecht, located in the Magdeburg district of Prussia. He passed the Abitur exam and graduated from the school in 1928. After studies at Humboldt and Sorbonne, he enrolled at Göttingen and passed the Staatsexamen (a government licensing examination for future teachers) in mathematics, physics and geology in 1933.
## Emigration
Wasow left Germany in 1933 and spent time in Paris and Cambridge before taking a job as a teacher at boarding schools for children of (predominantly Jewish) German emigrants in Italy, first in Florence (1935–37) and then in Lana in Alto Adige (1937–38). After the closure of the latter school in 1938 due to the passage of the Italian Racial Laws, Wasow emigrated to England and then to the United States in 1939.
## Academic career
Wasow taught at Goddard College (1939–1941) and Connecticut College (1941–42) and was at the same time a PhD student in mathematics under the supervision of Kurt Otto Friedrichs at New York University. He received his PhD in 1942 and stayed to work as an instructor for mathematics until 1946.
He then held academic and research positions at Swarthmore, UCLA and University of Wisconsin–Madison 1946–1957, interrupted by a Fulbright Fellowship in Rome (1954–55). He was appointed full professor of mathematics in 1957 at Madison and Rudolf E. Langer Professor of Mathematics in 1973. He was department chair 1970–72. He retired in 1980.
Wolfgang Wasow's main research area was singular perturbation theory. A classical application is the thin boundary layer that forms on a solid surface as a fluid flows over it. Above the boundary layer, the fluid behaves approximately like a perfect fluid. But within the boundary layer, the velocity of the flow changes rapidly from the high velocity above the boundary layer to a velocity of 0 at the solid surface. Many technical problems can be modeled this way, including the flow of a liquid through a pipe and the flow of air over an airplane wing. Boundary layer problems are instances of a more general class of problems that today is part of the field of singular perturbations.
Starting with his 1941 PhD thesis, Wasow was one of the main contributors to developing a mathematical theory of the boundary layer problem and singular perturbations. The organizers of a symposium in his honor at the Mathematics Research Center at Madison write:
> In May 1980, the Mathematics Research Center organized a successful Advanced Seminar on Singular Perturbations and Asymptotics in honor of the retirement of a colleague, Wolfgang R. Wasow. His fundamental research is responsible for many other rapid developments in this field since 1940, and continues to play a vital role in modern theory and current applications. Wasow's Ph.D. dissertation (N.Y.U., 1941) ... represents the starting point of this important flourish of modern applicable research. ... MRC is printing his 1941 thesis in its entirety ... Readers will note that the name "singular perturbations" (which was only coined several years later by K. O. Friedrichs or W. Wasow or possibly jointly, but neither is now able to recall the details) does not appear anywhere explicitly!
Wasow was "a substantial contributor to the study of singular perturbations for over twenty years". His textbook "Asymptotic expansions for ordinary differential equations" was the first "authoritative treatment" of the subject.
The Wolfgang Wasow Memorial Lecture, an annual lecture at the University of Wisconsin–Madison, was established in Wasow's honor by his children in 1993.
## Personal life
Wasow had three sons: Tom Wasow (linguist), Bernard Wasow (economist), and Oliver Wasow (artist). He also had two step-children.
Wolfgang Wasow self-published an autobiography for his family in 1986.
## InfoBox
| Wolfgang R. Wasow | |
| --- | --- |
| Born | (1909-07-25)July 25, 1909<br>Vevey, Switzerland |
| Died | September 11, 1993(1993-09-11) (aged 83)<br>Madison, Wisconsin |
| Nationality | American |
| Alma mater | New York University |
| Known for | Singular Perturbation Theory |
| **Scientific career** | |
| Fields | Applied Mathematics |
| Institutions | University of Wisconsin–Madison |
| Doctoral advisor | Kurt Otto Friedrichs |
| | |
|
76,499,557 |
https://en.wikipedia.org/wiki/Bombing_of_Stralsund_in_World_War_II
|
Bombing of Stralsund in World War II
|
The German Hanseatic City of Stralsund was bombed several times during World War II by the U.S. Air Force. The heaviest air raid took place on October 6, 1944.
| 2024-04-19T07:37:02 |
# Bombing of Stralsund in World War II
The German Hanseatic City of Stralsund was bombed several times during World War II by the U.S. Air Force. The heaviest air raid took place on October 6, 1944.
## Bombing on October 6, 1944
The attack was carried out by the Eighth Air Force flown with the order number 8AF 667 which conducted their operation from Great Britain. At 10 and 11 a.m. the first warnings were sent by the air traffic control command. The first is that the bomber groups are over the North Sea and the second is that the group is over Schleswig-Holstein. At 11:55 the air raid alarm was sounded in Stralsund. The message “Attention Stralsund flashlight” was broadcast on the radio, which is a code word for the population to go to the air raid shelters.
The flying squadron then approached from the southeast.
The attack began at 12:30 and ended at 2 p.m. where 1,400 explosive bombs (367 tons) were dropped.
The first wave of attacks was carried out by 37 aircraft from the 361st Bomb Group. The power station and the waterworks were destroyed. The Rügendamm, the port area, the Frankenvorstadt and the city center were also bombed in the first wave.
|
13,113,592 |
https://en.wikipedia.org/wiki/Customer_acquisition_management
|
Customer acquisition management
|
Customer acquisition management is a set of techniques used to manage customer prospects and inquiries generated by marketing. Customer acquisition management can be considered the connection between advertising and customer relationship management to acquire new customers. Customer acquisition management has similarities to lead management. Sometimes missing from lead management definitions, but always included in customer acquisition management, is a closed-loop reporting system. Such a reporting system typically allows the organization to quantify the effectiveness of results of various promotional activities. This allows organizations to realize improvements in both promotional activities and customer acquisition systems. Like lead management, customer acquisition management creates an orderly architecture for managing large volumes of customer inquiries, or leads.
| 2024-02-12T11:07:29 |
# Customer acquisition management
**Customer acquisition management** is a set of techniques used to manage customer prospects and inquiries generated by marketing. Customer acquisition management can be considered the connection between advertising and customer relationship management to acquire new customers.
Customer acquisition management has similarities to lead management. Sometimes missing from lead management definitions, but always included in customer acquisition management, is a closed-loop reporting system. Such a reporting system typically allows the organization to quantify the effectiveness of results of various promotional activities. This allows organizations to realize improvements in both promotional activities and customer acquisition systems. Like lead management, customer acquisition management creates an orderly architecture for managing large volumes of customer inquiries, or leads.
|
66,105,307 |
https://en.wikipedia.org/wiki/Dana_Glacier_(Antarctica)
|
Dana Glacier (Antarctica)
|
Dana Glacier is a glacier about 30 nautical miles long on the east side of Palmer Land. It drains the slopes at the southeast side of the Welch Mountains and flows east then northeast to discharge into the head of Lehrke Inlet just north of Parmelee Massif. Mapped by United States Geological Survey (USGS) in 1974. Named by Advisory Committee on Antarctic Names (US-ACAN) for Commander John B. Dana, U.S. Navy, Commanding Officer of U.S. Navy Squadron VXE-6 in Antarctica during Operation Deep Freeze, 1973; he was squadron Executive Officer, 1972, and Operations Officer, 1971.
| 2023-01-18T03:44:31 |
# Dana Glacier (Antarctica)
**Dana Glacier** (70°55′S 62°23′W / 70.917°S 62.383°W / -70.917; -62.383) is a glacier about 30 nautical miles (60 km) long on the east side of Palmer Land. It drains the slopes at the southeast side of the Welch Mountains and flows east then northeast to discharge into the head of Lehrke Inlet just north of Parmelee Massif. Mapped by United States Geological Survey (USGS) in 1974. Named by Advisory Committee on Antarctic Names (US-ACAN) for Commander John B. Dana, U.S. Navy, Commanding Officer of U.S. Navy Squadron VXE-6 in Antarctica during Operation Deep Freeze, 1973; he was squadron Executive Officer, 1972, and Operations Officer, 1971.
This article incorporates public domain material from "Dana Glacier (Antarctica)". *Geographic Names Information System*. United States Geological Survey.
|
52,048,266 |
https://en.wikipedia.org/wiki/Hatchet_ribozyme
|
Hatchet ribozyme
|
Background: The hatchet ribozyme is an RNA structure that catalyzes its own cleavage at a specific site. In other words, it is a self-cleaving ribozyme. Hatchet ribozymes were discovered by a bioinformatics strategy as RNAs Associated with Genes Associated with Twister and Hammerhead ribozymes, or RAGATH. Subsequent biochemical analysis supports the conclusion of a ribozyme function, and determined further characteristics of the chemical reaction catalyzed by the ribozyme. Nucleolytic ribozymes are small RNAs that adopt compact folds capable of site-specific cleavage/ligation reactions. 14 unique nucleolytic ribozymes have been identified to date, including recently discovered twister, pistol, twister-sister, and hatchet ribozymes that were identified based on application of comparative sequence and structural algorithms. The consensus sequence and secondary structure of this class includes 13 highly conserved and numerous other modestly conserved nucleotides inter-dispersed among bulges linking four base-paired substructures. A representative hatchet ribozyme requires divalent cations such as Mg2+ to promote RNA strand scission with a maximum rate constant of ~4/min. As with all other small self-cleaving ribozymes discovered to date, hatchet ribozymes employ a general mechanism for catalysis consisting of a nucleophilic attack of a ribose 2′-oxygen atom on the adjacent phosphorus center. Kinetic characteristics of the reaction demonstrate that members of this ribozyme class have an essential requirement for divalent metal cations and that they have a complex active site which employs multiple catalytic strategies to accelerate RNA cleavage by internal phosphoester transfer.
| 2024-02-22T12:19:07 |
# Hatchet ribozyme
**Background:** The **hatchet ribozyme** is an RNA structure that catalyzes its own cleavage at a specific site. In other words, it is a self-cleaving ribozyme. Hatchet ribozymes were discovered by a bioinformatics strategy as RNAs Associated with Genes Associated with Twister and Hammerhead ribozymes, or RAGATH.
Subsequent biochemical analysis supports the conclusion of a ribozyme function, and determined further characteristics of the chemical reaction catalyzed by the ribozyme.
Nucleolytic ribozymes are small RNAs that adopt compact folds capable of site-specific cleavage/ligation reactions. 14 unique nucleolytic ribozymes have been identified to date, including recently discovered twister, pistol, twister-sister, and hatchet ribozymes that were identified based on application of comparative sequence and structural algorithms.
The consensus sequence and secondary structure of this class includes 13 highly conserved and numerous other modestly conserved nucleotides inter-dispersed among bulges linking four base-paired substructures. A representative **hatchet ribozyme** requires divalent cations such as Mg<sup>2+</sup> to promote RNA strand scission with a maximum rate constant of ~4/min. As with all other small self-cleaving ribozymes discovered to date, **hatchet ribozymes** employ a general mechanism for catalysis consisting of a nucleophilic attack of a ribose 2-oxygen atom on the adjacent phosphorus center. Kinetic characteristics of the reaction demonstrate that members of this ribozyme class have an essential requirement for divalent metal cations and that they have a complex active site which employs multiple catalytic strategies to accelerate RNA cleavage by internal phosphoester transfer.
## Mechanism
Nucleolytic ribozymes like the **Hatchet Ribozyme** adopt an SN2-like mechanism that results in site-specific phosphodiester bond cleavage. An activated 2-OH of the ribose 5 to the scissile phosphate adopts an in-line alignment to target the adjacent to-be-cleaved P-O5 phosphodiester bond, resulting in formation of 2,3-cyclic phosphate and 5-OH groups. X-ray crystallographic structural studies on the hammerhead, hairpin, GlmS, hepatitis delta virus (HDV), Varkud satellite, and pistol ribozymes have defined the overall RNA fold, the catalytic pocket arrangement, the in-line alignment, and the key residues that contribute to the cleavage reaction. The cleavage site is located at the 5' end of its consensus secondary motif.
In addition, the removal of the nucleophilic hydroxyl renders the ribozyme inactive as it is not able to create the cleavage site. More specifically, if the 2'-ribose or 2'-OH is replaced with a 2'-deoxyribose or 2'-H, there are no electrons available to perform the nucleophilic attack on the adjacent phosphate group. This results in no phosphoester bond being formed, which again inactivates the ribozyme's enzymatic cleavage ability.
## Secondary Structure
In 2019, researchers crystallized a 2.1 Å product of the **Hatchet Ribozyme.** The consensus sequence is depicted in the image to the right. Most **hatchet ribozymes** and ribozymes in general adopt a P0 configuration. P0 is an additional hairpin loop located at the 5' end of the cleavage site, though it does not contribute to catalytic activity or functionality unlike Hammerhead ribozymes which have a short consensus sequence near P1, or the 5' end, that promotes high speed catalytic activity. About 90% of the sequence is conserved and similar to other ribozymes in this class.
Based on the RNA sequence, the resulting DNA sequence which ends up coding for the Hatchet Ribozyme is as follows from 5'-3' because in DNA uracil is replaced by thymine.
TTAGCAAGAATGACTATAGTCACTG TTTGTACACCCCGAATAGATTAGAA GCCTAATCATAATCACGTCTGCAAT TTTGGTACA
Due to this sequence construct, after self catalyzed cleavage, it leaves an 8 nucleotide residue upstream on the 3'-end of the RNA.
## Tertiary Structure
Each ribozyme may have different motifs and thus different tertiary structures:
The Tertiary structure of the **Hatchet Ribozyme** with the motif of HT-UUCG is through dimerization. The dimer is formed through the swapping of the 3' ends of the pairing strands which is also in equilibrium with the dimer formed product of HT-GAAA. Therefore, the RNA sequence shifts between monomer and dimer configurations. To view the 3-D shape of the ribozyme see Figure S1A and B. Two molecules of the HT-GAAA ribozyme can actually form a pseudosymmetric dimer with both monomers of the ribozyme exhibiting relatively well-defined electron density. The tertiary fold consists of four stem substructures which covalently stack upon each other forming the helical and loop structures, called P1, P2, P3, and P4, L1, L2 and L3 respectively (though not shown in the figure above). The actual cleavage site is positioned between the junction of P1 and P2 adjacent to P3 and L2. P1 is composed of three or six base pairs roughly 40% and 60% of the time respectively in its natural state, suggesting that length corresponds to catalytic function.
There is also a conserved palindromic sequencing between base U70' and A67', which likely triggers the formation of the dimer due to Watson-Crick base pair interactions.
The tertiary structure also has long range implications within itself based on interactions between its loops.
## Effect of pH and Mg<sup>2+</sup>
Ribozyme catalysis experiments were done by the addition of MgCl<sub>2</sub> and stopped for measurement at each time point by the addition of a stop solution containing urea and EDTA.
A plot of the *k*obs values measured at pH 7.5 with increasing concentrations of Mg<sup>2+</sup>. There is a sharp increase in ribozyme function that plateaus as the concentration approaches 10 mM. The steep slope observed at lower Mg<sup>2+</sup> concentrations suggests that more than one metal ion is necessary for each RNA to achieve maximal ribozyme activity. Moreover, this suggests that the construct requires higher than normal physiological concentrations of Mg<sup>2+</sup> to become completely saturated with Mg<sup>2+</sup> as the cofactor. It is possible that native unimolecular constructs, also carrying P0, might achieve saturation at concentrations of Mg<sup>2+</sup> that are closer to normal physiological levels.
The effect of pH on ribozyme rate constant in reactions containing 10 mM Mg<sup>2+</sup> was also experimentally measured. pH-dependent ribozyme activity increases linearly with a slope of 1 until reaching a *k*obs, of a Michaelis-Menten plot, plateau of ~4/min near a pH value of 7.5. Any higher pH has the same catalytic effect and more acidic pH's begin denaturing the ribozyme and thus reducing catalytic function. Both the pH dependency and the maximum rate constant have interesting implications for the possible catalytic strategies used by this ribozyme class.
### The effects of various mono- and divalent metal ions on hatchet ribozyme activity
The **Hatchet ribozyme** construct remains completely inactive when incubated in the absence of Mg<sup>2+</sup> in reactions containing only other monovalent cations at 1 M (Na<sup>+</sup>, K<sup>+</sup>, Rb<sup>+</sup>, Li<sup>+</sup>, Cs<sup>+</sup>), 2.5 M (Na<sup>+</sup>, K<sup>+</sup>), or 3 M (Li<sup>+</sup>). In contrast, other divalent metal ions such as Mn<sup>2+</sup>, Co<sup>2+</sup>, Zn<sup>2+</sup>, and Cd<sup>2+</sup> support ribozyme function with varying levels of efficiency. Furthermore, two metal ions (Zn<sup>2+</sup>, Cd<sup>2+</sup>) function only at low concentrations, and three metal ions (Ba<sup>2+</sup>, Ni<sup>2+</sup>, and Cu<sup>2+</sup>) inhibit activity at 0.5 mM, even when Mg<sup>2+</sup> is present. These results indicate that hatchet ribozymes are relatively restrictive in their use of cations to promote catalysis, perhaps indicating that one or more specialized binding sites that accommodate a limited number of divalent cations are present in the RNA structure or perhaps even at the active site. Inhibition by certain divalent metal ions could be due to the displacement of critical Mg<sup>2+</sup> ions or by general disruption of RNA folding.
## Significance/Applications
One standard application is to use flanking self-cleaving ribozymes to generate precisely cut out sequences of functional RNA molecules (i.e. shRNA, saiRNA, sgRNA). This is especially useful for in vivo expression of gene editing systems (i.e. CRISPR/Cas sgRNA) and inhibitory systems.
Another method is for in vivo transcription of siRNA. This design uses multiple self-cleaving ribozymes, which are all transcribed from the same gene. After cleavage, both parts of the precursor siRNA (siRNA 1 and 2) can form a double strand and act as intended. To see the setup, see saiRNA graphic
Lastly, if you want to combine self-cleaving ribozymes with protein sequences, it is important to know that the self-cleaving mechanism of the ribozymes will modify the mRNA. A 5' ribozyme will modify the downstream 5' end of the pre-mRNA, disabling the cell from creating a 5' cap. This decreases the stability of the pre-mRNA and prevents it from being fully functional mature mRNA. On the other side, a 3' ribozyme would prevent polyadenylation of the upstream pre-mRNA, again decreasing stability and preventing maturation. Both interfere with translation as well.
1. Weinberg Z, Kim PB, Chen TH, Li S, Harris KA, Lünse CE, Breaker RR (2015). "New classes of self-cleaving ribozymes revealed by comparative genomics analysis". *Nat. Chem. Biol*. **11** (8): 606–10. doi:10.1038/nchembio.1846. PMC 4509812. PMID 26167874.
2. Li S, Lünse CE, Harris KA, Breaker RR (2015). "Biochemical analysis of hatchet self-cleaving ribozymes". *RNA*. **21** (11): 1845–51. doi:10.1261/rna.052522.115. PMC 4604424. PMID 26385510.
3. Li, Sanshu; Lünse, Christina E.; Harris, Kimberly A.; Breaker, Ronald R. (November 2015). "Biochemical analysis of hatchet self-cleaving ribozymes". *RNA*. **21** (11): 1845–1851. doi:10.1261/rna.052522.115. ISSN 1355-8382. PMC 4604424. PMID 26385510.
4. Zheng, Luqian; Falschlunger, Christoph; Huang, Kaiyi; Mairhofer, Elisabeth; Yuan, Shuguang; Wang, Juncheng; Patel, Dinshaw J.; Micura, Ronald; Ren, Aiming (2019-05-14). "Hatchet ribozyme structure and implications for cleavage mechanism". *Proceedings of the National Academy of Sciences*. **116** (22): 10783–10791. Bibcode:2019PNAS..11610783Z. doi:10.1073/pnas.1902413116. ISSN 0027-8424. PMC 6561176. PMID 31088965.
5. "Team:Hamburg/Contribution - 2020.igem.org". *2020.igem.org*. Retrieved 2021-11-24.
6. Gao, Yangbin; Zhao, Yunde (April 2014). "Self-processing of ribozyme-flanked RNAs into guide RNAs in vitro and in vivo for CRISPR-mediated genome editing". *Journal of Integrative Plant Biology*. **56** (4): 343–349. doi:10.1111/jipb.12152. ISSN 1672-9072. PMID 24373158.
7. "Content". *labs.biology.ucsd.edu*. Retrieved 2021-11-24.
## InfoBox
| Hatchet | |
| --- | --- |
| Consensus secondary structure and sequence conservation of Hatchet ribozyme | |
| Identifiers | |
| Symbol | Hatchet |
| Rfam | RF02678 |
| Other data | |
| RNA type | Gene; Ribozyme |
| GO | GO:0003824 |
| SO | SO:0000374 |
| PDB structures | PDBe |
|
29,972,324 |
https://en.wikipedia.org/wiki/Aubrey_Wentworth
|
Aubrey Wentworth
|
Aubrey Wentworth is a fictional character from the ABC daytime soap opera One Life to Live portrayed by Terri Conn from November 29, 2010, to December 29, 2011. After the cancellation of As the World Turns in 2010, Conn left her role as then Katie Peretti and joined the cast of One Life to Live as newly-created character Aubrey. Aubrey began her time in town as a smart and beautiful con artist but soon developed into a more caring person with a less criminal outlook on life.
| 2023-10-03T17:54:02 |
# Aubrey Wentworth
**Aubrey Wentworth** is a fictional character from the ABC daytime soap opera *One Life to Live* portrayed by Terri Conn from November 29, 2010, to December 29, 2011. After the cancellation of *As the World Turns* in 2010, Conn left her role as then Katie Peretti and joined the cast of *One Life to Live* as newly-created character Aubrey. Aubrey began her time in town as a smart and beautiful con artist but soon developed into a more caring person with a less criminal outlook on life.
## Casting and characterization
Terri Conn was offered the new role of Aubrey Wentworth following the cancellation and series finale of the CBS daytime drama *As the World Turns*, less than two months earlier. After having spent 12 years as Katie Peretti from 1998 until 2010 and a guest starring role on CBS' *The Young and the Restless* in 1995, Conn remained a part of the genre after the show contacted her agent after releasing a casting call for the character. After screen testing with *OLTL* star Erika Slezak (Victoria Lord) and David Fumero (Cristian Vega), Conn was hired for the role. Conn's continued career was considered a relief to the actress because of the difficult job market as well as the new direction she would be taking by playing a more mature role.
Conn commented on the development of the character and the difference between her *OLTL* and *ATWT* roles in an interview with *TV Guide* columnist Michael Logan:
> I love the name! It sounds so mature. I'm excited to play someone other than Katie, not that I didn't love her but I did play her for 12 years. It's time to spread my wings and try a different kind of character. Katie was so perky and I could never get away from that. Even toward the end they'd be going, 'Could you make her a little bit more...you know...Katie!' They never really let me grow up."
The casting coincided with the hirings of former *World Turns* co-star Tom Degnan (Joey Buchanan) and newcomer Josh Kelly (Cutter Wentworth). The arrivals would permit a love quadrangle between these three characters and Kelly Cramer, played by Gina Tognoni, who rejoined the show several months earlier after the cancellation of another long running CBS daytime drama, *Guiding Light*.
## Storylines
Aubrey Wentworth comes to town on a plane coming from London to visit her boyfriend Joey Buchanan in Llanview. She meets Joey's ex-wife Kelly Cramer, and both women are unaware of the other's feelings for Joey. Aubrey arrives and meets Joey's parents Clint Buchanan and Victoria Lord and accepts Joey's surprising marriage proposal, where Kelly learns the two were a couple. As Kelly and Aubrey's rivalry grows, Aubrey's real boyfriend Cutter Wentworth arrives and it is apparent that the pair are planning on conning Joey of his fortune after she marries him. As Cutter poses as her brother, they succeed in keeping her secret from being revealed by Kelly and her aunt Dorian Lord. However, their deception comes out when she and Joey take care of Ryder Ford, the son of Jessica Buchanan while she is under the influence of her alternate personality "Tess." Aubrey wants to be honest with Joey because she finally recognizes her feelings for him and tells him about her and Cutter's real plans, but Joey breaks up with her and Jessica soon regains custody of her son. After Cutter discovers that Aubrey has actual feelings for Joey, he shocks Aubrey by eloping with Tess/Jessica and blackmailing Clint for a piece of his fortune and ownership of The Buchanan Mansion in exchange for committing their daughter to St. Anne's. Cutter later loses his piece of the Buchanan fortune and the mansion when he discovers that Clint had a loophole in the mansion's deed that he could take back ownership of the mansion anytime he wants to. Clint gives the mansion to his long-lost son Rex Balsom after he blackmails him for his entire fortune so that his recently "deceased" fiancée Gigi Morasco can donate her heart to Clint after he suffered a major heart attack. It later turns out that he got the heart of Gigi's sister Stacy Morasco when it was later revealed that Gigi was still alive.
After Joey and Kelly reunite and leave town following his divorce from Aubrey, she shortly reunites with Cutter after they begin a life without crime. However, she breaks up with him again after learning his attempt to con Clint's other son, Rex after the "death" of his fiancée Gigi, following the reveal that Aubrey's real name was Kristine Karr and the real Aubrey Wentworth was Cutter's own sister Kimberly Andrews. Kristine took on the name so that she and Cutter could con rich men out of money under the disguise of brother and sister. Aubrey eventually becomes a confidant for Rex and his son Shane Morasco as Cutter tries to con them out of their family's money with the fact that Gigi was still alive and it was her sister Stacy who died. Cutter is eventually arrested and Kim leaves town. After Rex and Shane reunite with Gigi, Aubrey realizes she no longer has a place in anyone's lives and leaves town.
## InfoBox
| Aubrey Wentworth | |
| --- | --- |
| *One Life to Live* character | |
| | |
| Portrayed by | Terri Conn |
| Duration | 2010–2011 |
| First appearance | November 29, 2010 (2010-11-29) |
| Last appearance | December 29, 2011 (2011-12-29) |
| Classification | Past; regular |
| Created by | Ron Carlivati |
| Introduced by | Frank Valentini |
| In-universe information Other names Kristine Karr Occupation * Bartender * Con artist Spouse Joey Buchanan (2011) | |
|
62,523,739 |
https://en.wikipedia.org/wiki/Injustice_(professional_wrestling)
|
Injustice (professional wrestling)
|
Injustice was a professional wrestling stable in Major League Wrestling (MLW) between 2019 and 2021.
| 2023-11-04T09:38:44 |
# Injustice (professional wrestling)
**Injustice** was a professional wrestling stable in Major League Wrestling (MLW) between 2019 and 2021.
## History
On the February 16, 2019 episode of *Fusion*, Ace Austin defeated Rich Swann in a middleweight match. Swann was frustrated at the referee Doug Markham's biased officiating, which led to Swann attacking him and announcer Rich Bocchini in rage. As a result, the MLW management suspended Swann (in storyline). Swann appealed against the suspension but his appeal was rejected. Fellow middleweight Myron Reed protested against Swann's suspension and even wrote "Free Swann" with a tape on his mouth. On the March 23 episode of *Fusion*, Reed lost a match to Gringo Loco due to being distracted with his "Free Swann" movement and attacked the referee in response, which led to management suspending him as well for six weeks. Swann was reinstated a few days later and upon Reed's return, the two began a "Justice" movement in protest against biased officiating by the referees primarily Markham. Markham would accuse the two of harassment.
Shortly after, Swann left MLW while Reed formed an alliance with Jordan Oliver at Kings of Colosseum where Oliver helped Reed in defeating Rey Horus. The duo would soon be joined by Kotto Brazil, who also protested over biased officiating. On July 22, MLW.com announced that the three would be forming a group called "Injustice". They competed in their first match as a trio on the August 31 episode of *Fusion*, where they defeated Air Wolf, Gringo Loco and Zenshi in a six-man tag team match. They continued to feud with various middleweights over the next few months and defeated Gringo Loco, Puma King and Septimo Dragon in a trios match at MLW's first-ever pay-per-view event Saturday Night SuperFight.
On the November 11 episode of *Fusion*, Reed defeated Teddy Hart to win the World Middleweight Championship after Contra Unit member Josef Samael threw a fireball into Hart's face. Oliver and Brazil would defeat Gringo Loco and Zenshi in an elimination tag team match on the November 28 episode of *Fusion*. On the December 14 episode of *Fusion*, Injustice protested on not being selected into the Opera Cup tournament but were challenged by King Mo and the returning A. C. H. to a tag team match, which Oliver and Brazil lost.
The storyline between Injustice and the *luchadores* continued well into the new year. On the January 25, 2020 episode of *Fusion* (taped January 11), Drago and Puma King defeated Injustice, in a three-way match also involving Black Taurus and Low Rider. On the February 2 episode of *Fusion* (taped January 11), Oliver was ringside for Reed's middleweight title match with Drago, and interfered towards the end to help Reed retain the belt. At the same time, the stable also started feuding with Brian Pillman Jr., who made his presence known after Oliver and Brazil defeated Laredo Kid and Zenshi on the February 29 episode of *Fusion* (taped February 1). A singles match between Oliver and Pillman was scheduled on *Fusion*, but it was prevented from happening due to Injustice attacking Pillman. As a result, Injustice were suspended by MLW, and they returned on the May 2 episode of *Fusion* (taped March 13), unsuccessfully challenging *Los Jinetes del Aire* (El Hijo del Vikingo, Myzteziz Jr. and Octagon Jr.) for the AAA World Trios Championship.
Contra Unit attacked MLW at the end of the trios match with Brazil being taken out. Oliver, now a newly minted heavyweight, began calling out Contra Unit, specifically World Heavyweight Champion Jacob Fatu and Simon Gotch. On the August 6 episode of *Pulp Fusion*, Oliver was jumped by Gotch and put out with a chokehold. On the December 9 episode of *Fusion*, Oliver gained a measure of revenge, jumping Gotch during a schmoz ending to Contra Unit's World Tag Team Championship match against Marshall and Ross Von Erich. Although a grudge match between the two was scheduled for Kings of Colosseum, at the event it appeared that Gotch had no-showed and the match was postponed. However, this turned out to be a ruse, as later in the night and after Reed's latest title defense, Injustice were ambushed by Contra Unit. As a result, Injustice turned face, although on the January 20, 2021 episode of *Fusion*, Gotch defeated Oliver by referee's decision. Later in the episode, Oliver and Reed disguised themselves as flag bearers and attacked Fatu and Daivari, before being chased off by Gotch and Mads Krügger. On the February 3 episode of *Fusion*, Oliver squashed a nameless member of the Sentai Death Squad. His match was bookended by two promos: the first with Reed challenging Contra Unit to a tag team match, and the second with Oliver warning Fatu that he was coming for his title. On the February 10 episode of *Fusion*, the tag team match ended up not happening as Fatu jumped Injustice, but Oliver and Reed managed to isolate Fatu and hit him with a superkick-springboard cutter combination, before being dragged away by officials. On the March 3 episode of *Fusion*, Oliver was defeated by Fatu, and afterwards, he and Reed were prevented from being put in Contra Unit's trademark body bags as Calvin Tankman ran in to make the save. On the March 11 episode of *Fusion*, Injustice challenged Los Parks (L. A. Park and El Hijo de L.A. Park) for the World Tag Team Championship; this was changed to a triple threat match on the March 18 episode of *Fusion* when Contra Unit attacked Injustice. Los Parks retained over Injustice and Contra Unit, with Oliver taking the pin. On March 31, at Never Say Never, Oliver defeated Gotch in a rematch of their January encounter, ending his and Injustice's feud with Contra Unit.
Oliver was released from MLW on October 29, thus disbanding Injustice in the process.
## Championships and accomplishments
## InfoBox
| Injustice | |
| --- | --- |
| Stable | |
| Members | Jordan Oliver<br>Myron Reed<br>Rich Swann<br>Kotto Brazil<br>Saieve Al Sabah |
| Debut | July 25, 2019 |
| Disbanded | October 29, 2021 |
|
37,978,508 |
https://en.wikipedia.org/wiki/Fly-Fan_Shark
|
Fly-Fan Shark
|
The Fly-Fan Shark is a Slovak light aircraft designed by Frantisek Sustek and initially developed by Fly-Fan of Trenčín. Development continues under the new owner of the design, AENEA Services. The design was introduced at the AERO Friedrichshafen show in 2007 as a mock up and in 2011 as a flying aircraft. The aircraft first flew on 29 June 2011 and is intended to be supplied as a complete ready-to-fly-aircraft.
| 2022-12-07T03:57:30 |
# Fly-Fan Shark
The **Fly-Fan Shark** is a Slovak light aircraft designed by Frantisek Sustek and initially developed by Fly-Fan of Trenčín. Development continues under the new owner of the design, AENEA Services. The design was introduced at the AERO Friedrichshafen show in 2007 as a mock up and in 2011 as a flying aircraft. The aircraft first flew on 29 June 2011 and is intended to be supplied as a complete ready-to-fly-aircraft.
## Design and development
The Shark was designed with the goal of providing similar performance to other twin-engined light aircraft, but on 30% less power. It features a cantilever low-wing, a five-seat enclosed cabin, retractable tricycle landing gear and twin wing-mounted engines in tractor configuration.
The aircraft is made from Kevlar and carbon fibre. Its 11.4 m (37.4 ft) span wing employs a Jd 16 (40) 162 airfoil at the wing root, transitioning to a Jd 17 (40) 157 at mid-span and a Jd 15 (35) 136 at the wing tip. The wing has an area of 16.2 m<sup>2</sup> (174 sq ft) and mounts split flaps that can be extended 50°. The standard engines fitted are a pair of 160 hp (119 kW) Lycoming O-320-D1A four-stroke powerplants.
The aircraft has an empty weight of 1,221 kg (2,692 lb) and a gross weight of 1,500 kg (3,300 lb), giving a useful load of 279 kg (615 lb).
## Specifications (Shark)
*Data from* Bayerl and Fly-Fan
**General characteristics**
* **Crew:** one
* **Capacity:** four passengers
* **Length:** 8.9 m (29 ft 2 in)
* **Wingspan:** 11.4 m (37 ft 5 in)
* **Height:** 3.07 m (10 ft 1 in)
* **Wing area:** 16.2 m<sup>2</sup> (174 sq ft)
* **Airfoil:** wing root: Jd 16 (40) 162 airfoil, mid-span: Jd 17 (40) 157, wing tip: Jd 15 (35) 136
* **Empty weight:** 1,221 kg (2,692 lb)
* **Gross weight:** 1,500 kg (3,307 lb)
* **Powerplant:** 2 × Lycoming O-320-D1A four cylinder, air-cooled, four stroke aircraft engine, 120 kW (160 hp) each
* **Propellers:** 3-bladed MT-Propeller or Hartzell Propeller constant speed, 1.78 m (5 ft 10 in) diameter
**Performance**
* **Cruise speed:** 260 km/h (160 mph, 140 kn)
* **Stall speed:** 140 km/h (87 mph, 76 kn)
* **Never exceed speed:** 330 km/h (210 mph, 180 kn)
* **Range:** 1,600 km (990 mi, 860 nmi)
* **Endurance:** 8 hours
* **Maximum glide ratio:** 16:1 at 160 km/h (99 mph)
* **Rate of climb:** 10.6 m/s (2,090 ft/min)
* **Wing loading:** 92.6 kg/m<sup>2</sup> (19.0 lb/sq ft)
## InfoBox
| Shark | |
| --- | --- |
| | |
| Role | Light aircraft |
| National origin | Slovakia |
| Manufacturer | Fly-Fan, AENEA Services |
| Designer | Frantisek Sustek |
| First flight | 29 June 2011 |
| Status | Under development (2015) |
|
|
6,975,317 |
https://en.wikipedia.org/wiki/L%27amour_existe_encore
|
L'amour existe encore
|
"L'amour existe encore" is a song by Canadian singer Celine Dion from her tenth studio album, Dion chante Plamondon (1991). It was written by Luc Plamondon and Riccardo Cocciante, and produced by Jannick Top and Serge Perathoner. "L'amour existe encore" was released as a promotional single in Quebec in November 1991. Commercially, it was issued in France on 24 January 1994. The song reached number 16 on the airplay chart in Quebec and number 31 in France.
| 2024-03-20T07:54:31 |
# L'amour existe encore
"**L'amour existe encore**" (meaning "love still exists") is a song by Canadian singer Celine Dion from her tenth studio album, *Dion chante Plamondon* (1991). It was written by Luc Plamondon and Riccardo Cocciante, and produced by Jannick Top and Serge Perathoner. "L'amour existe encore" was released as a promotional single in Quebec in November 1991. Commercially, it was issued in France on 24 January 1994. The song reached number 16 on the airplay chart in Quebec and number 31 in France.
## Background and release
"L'amour existe encore" was written by Luc Plamondon and Riccardo Cocciante, and produced by Jannick Top and Serge Perathoner. It was included on Dion's tenth studio album, *Dion chante Plamondon* (1991). In November 1991, "L'amour existe encore" and "Des mots qui sonnent" were released simultaneously as the first promotional singles in Quebec. The commercial single was issued in France on 24 January 1994. Dion often performed "L'amour existe encore" during her concerts. In 2005, it was included on her greatest hits album, *On ne change pas*.
## Commercial performance
"L'amour existe encore" entered the airplay chart in Quebec on 18 November 1991 and reached number 16, staying on the chart for 20 weeks. In France, it entered the chart in early 1994 and peaked at number 31. The duet version with Éric Lapointe was released on his *Ailleurs - Volume 1* album (2009). It entered the charts in Canada in May 2009, peaking at numbers eight on the airplay chart in Quebec and 34 on the Canadian Adult Contemporary chart.
## Music video
The music video was filmed in December 1993 and directed by Alain DesRochers. It was released in January 1994. The music video was nominated for the Video of the Year at the Félix Awards in Quebec. In 2005, it was included on Dion's greatest hits DVD collection, *On ne change pas*.
## Spanish version
In 2002, Dion recorded a Spanish version of "L'amour existe encore", titled "Aún Existe Amor". It was included on her eighteenth studio album, *A New Day Has Come*. The Spanish lyrics were written by Ignacio Ballesteros-Diaz. Sony Music issued a promotional single in the United States in May 2022, and Dion performed "Aún Existe Amor" at the 2002 Latin *Billboard* Music Awards, where she received a special award for her hit "My Heart Will Go On", which became the first English-language song to top the *Billboard'*s Hot Latin Tracks chart.
## Track listing and formats
* **French 12-inch, cassette and CD single**
1. "L'amour existe encore" – 3:49
2. "Le monde est stone" – 3:41
## Charts
Chart performance for "L'amour existe encore"
| Chart (1991–2009) | Peak<br>position |
| --- | --- |
| Canada AC (*Billboard*) <br>*2009 duet with Éric Lapointe* | 34 |
| France (SNEP) | 31 |
| Quebec (ADISQ) | 16 |
| Quebec (BDS Radio)<br>*2009 duet with Éric Lapointe* | 8 |
## Release history
"L'amour existe encore" release history
| Region | Date | Format | Label | Ref. |
| --- | --- | --- | --- | --- |
| France | 24 January 1994 | | Columbia | |
## InfoBox
| "L'amour existe encore" | |
| --- | --- |
| 1994 French commercial single | |
| Single by Celine Dion | |
| from the album *Dion chante Plamondon* | |
| B-side | "Le monde est stone" |
| Released | 24 January 1994 (1994-01-24) |
| Recorded | 8 September – 6 October 1991 |
| Studio | Face B (Paris) |
| Genre | Pop |
| Length | 3:49 |
| Label | Columbia |
| Songwriter(s) | |
| Producer(s) | |
| Celine Dion singles chronology | |
| "The Power of Love" <br>(1993) "**L'amour existe encore**" <br>(1994) "Misled" <br>(1994) | |
| | |
| Music video | |
| "L'amour existe encore" on YouTube | |
| | |
|
62,517,941 |
https://en.wikipedia.org/wiki/2020_Chinese_FA_Super_Cup
|
2020 Chinese FA Super Cup
|
2020 Chinese FA Super Cup was the 18th Chinese FA Super Cup, an annual football match contested by the winners of the previous season's Chinese Super League and FA Cup competitions. The match was scheduled to be played between Guangzhou Evergrande Taobao, champions of the 2019 Chinese Super League, and Shanghai Greenland Shenhua, the winner of the 2019 Chinese FA Cup on 5 February 2020. On 25 January 2020, the match was postponed due to the COVID-19 pandemic.
| 2024-02-29T13:04:39 |
# 2020 Chinese FA Super Cup
**2020 Chinese FA Super Cup** (Chinese: 2020中国足球协会超级杯) was the 18th Chinese FA Super Cup, an annual football match contested by the winners of the previous season's Chinese Super League and FA Cup competitions. The match was scheduled to be played between Guangzhou Evergrande Taobao, champions of the 2019 Chinese Super League, and Shanghai Greenland Shenhua, the winner of the 2019 Chinese FA Cup on 5 February 2020. On 25 January 2020, the match was postponed due to the COVID-19 pandemic.
## Match
### Details
| Guangzhou Evergrande Taobao | Cancelled | Shanghai Greenland Shenhua |
| --- | --- | --- |
| | | |
Suzhou Olympic Sports Centre, Suzhou
## InfoBox
2020 Chinese FA Super Cup
| | |
| --- | --- |
| Venue | Suzhou Olympic Sports Centre, Suzhou |
|
|
146,126 |
https://en.wikipedia.org/wiki/739_BC
|
739 BC
| 2022-03-22T03:32:07 |
# 739 BC
739 BC in various calendars
| Gregorian calendar | 739 BC<br>*DCCXXXIX BC* |
| --- | --- |
| Ab urbe condita | 15 |
| Ancient Egypt era | XXV dynasty, 14 |
| *\- Pharaoh* | Piye, 14 |
| Ancient Greek era | 10th Olympiad, year 2 |
| Assyrian calendar | 4012 |
| Balinese saka calendar | *N/A* |
| Bengali calendar | −1331 |
| Berber calendar | 212 |
| Buddhist calendar | −194 |
| Burmese calendar | −1376 |
| Byzantine calendar | 4770–4771 |
| Chinese calendar | 辛丑年 (Metal Ox)<br>1959 or 1752<br>*to* <br>壬寅年 (Water Tiger)<br>1960 or 1753 |
| Coptic calendar | −1022 – −1021 |
| Discordian calendar | 428 |
| Ethiopian calendar | −746 – −745 |
| Hebrew calendar | 3022–3023 |
| Hindu calendars | |
| \- *Vikram Samvat* | −682 – −681 |
| \- *Shaka Samvat* | *N/A* |
| \- *Kali Yuga* | 2362–2363 |
| Holocene calendar | 9262 |
| Iranian calendar | 1360 BP – 1359 BP |
| Islamic calendar | 1402 BH – 1401 BH |
| Javanese calendar | *N/A* |
| Julian calendar | *N/A* |
| Korean calendar | 1595 |
| Minguo calendar | 2650 before ROC<br>民前2650年 |
| Nanakshahi calendar | −2206 |
| Thai solar calendar | −196 – −195 |
| Tibetan calendar | 阴金牛年<br>(female Iron-Ox)<br>−612 or −993 or −1765<br>*to* <br>阳水虎年<br>(male Water-Tiger)<br>−611 or −992 or −1764 |
## Events
## Births
## Deaths
## InfoBox
| Millennium: | 1st millennium BC |
| --- | --- |
| Centuries: | |
| Decades: | |
| Years: | |
|
|
54,327,794 |
https://en.wikipedia.org/wiki/1970_NCAA_University_Division_Tennis_Championships
|
1970 NCAA University Division Tennis Championships
|
The 1970 NCAA University Division Tennis Championships were the 25th annual tournaments to determine the national champions of NCAA University Division men's singles, doubles, and team collegiate tennis in the United States. UCLA captured the team championship, the Bruins' ninth such title. UCLA finished four points ahead of Rice and Trinity (TX) in the final team standings (26–22–22).
| 2022-09-15T03:27:52 |
# 1970 NCAA University Division Tennis Championships
The **1970 NCAA University Division Tennis Championships** were the 25th annual tournaments to determine the national champions of NCAA University Division men's singles, doubles, and team collegiate tennis in the United States.
UCLA captured the team championship, the Bruins' ninth such title. UCLA finished four points ahead of Rice and Trinity (TX) in the final team standings (26–22–22).
## Host site
This year's tournaments were contested at the Eccles Tennis Center at the University of Utah in Salt Lake City, Utah.
## Team scoring
Until 1977, the men's team championship was determined by points awarded based on individual performances in the singles and doubles events.
## InfoBox
| 1970 NCAA University Division Tennis Championships | |
| --- | --- |
| Date | May 1970 |
| Edition | 25th |
| Location | Salt Lake City, Utah |
| Venue | Eccles Tennis Center<br>University of Utah |
| Champions | |
| Men's singles | |
| Jeff Borowiak<br>(UCLA) | |
| Men's doubles | |
| Pat Cramer / <br>Luis-Augusto García<br>(Miami) | |
| | |
|
63,905,613 |
https://en.wikipedia.org/wiki/1992_NCAA_Women%27s_Golf_Championship
|
1992 NCAA Women's Golf Championship
|
The 1992 NCAA Women's Golf Championships were contested at the 11th annual NCAA-sanctioned golf tournament to determine the individual and team national champions of women's collegiate golf in the United States. Until 1996, the NCAA would hold just one annual women's golf championship for all programs across Division I, Division II, and Division III. The tournament was held at the Karsten Golf Course in Tempe, Arizona. San Jose State won the team championship, the Spartans' third win. Vicki Goetze, of Georgia, won the individual title.
| 2024-03-08T23:46:55 |
# 1992 NCAA Women's Golf Championship
The 1992 NCAA Women's Golf Championships were contested at the 11th annual NCAA-sanctioned golf tournament to determine the individual and team national champions of women's collegiate golf in the United States. Until 1996, the NCAA would hold just one annual women's golf championship for all programs across Division I, Division II, and Division III.
The tournament was held at the Karsten Golf Course in Tempe, Arizona.
San Jose State won the team championship, the Spartans' third win.
Vicki Goetze, of Georgia, won the individual title.
## Individual results
### Individual champion
## Team leaderboard
| Rank | Team | Score |
| --- | --- | --- |
| 1 | **San José State** | **1,171** |
| 2 | Arizona | 1,175 |
| 3 | Georgia | 1,181 |
| 4 | Stanford | 1,187 |
| 5 | UCLA (DC) | 1,193 |
| 6 | Texas | 1,198 |
| 7 | Oklahoma State | 1,200 |
| 8 | North Carolina | 1,203 |
| 9 | Arizona | 1,206 |
| 10 | Miami (FL) | 1,220 |
| 11 | Furman | 1,223 |
| 12 | Duke | 1,227 |
| 13 | Indiana | 1,229 |
| 14 | Florida State | 1,236 |
| T15 | SMU | 1,239 |
| | USC | |
| 17 | Kentucky | 1,246 |
* DC = Defending champion
* *Debut appearance*
## InfoBox
1992 NCAA Women's Golf Championship
| Tournament information | |
| --- | --- |
| Location | Tempe, Arizona, U.S.<br>33°25′41″N 111°55′19″W / 33.428°N 111.922°W / 33.428; -111.922 |
| Course(s) | ASU Karsten Golf Course |
| Statistics | |
| Par | 72 (288) |
| Field | 17 teams |
| Champion | |
| **Team:** San Jose State (3rd title)<br>**Individual:** Vicki Goetze, Georgia | |
| **Team:** 1,171 (+19)<br>**Individual:** 280 (−8) | |
| Location map | |
| ASU KarstenLocation in the United StatesASU KarstenLocation in Arizona | |
| | |
|
4,231,442 |
https://en.wikipedia.org/wiki/Kay_K-161_ThinTwin
|
Kay K-161 ThinTwin
|
The Kay K-161 ThinTwin is an electric guitar made from 1952 to 1959, was one of the longest produced guitars by Kay Musical Instrument Company. The K161 Thin-Twin was commonly referred to as the "Jimmy Reed" guitar. Introduced not long after Gibson's Les Paul, the ThinTwin was a semi-hollow body guitar and larger than its name "thin" implied. The guitar's body was 2+3⁄4 inches (70 mm) deep. "ThinTwin" was a reference to the unique appearance of the dual pickups, having a very slim profile. There was also a Silvertone-branded version of this guitar, with a slightly more 'regal' appointment in ts decorated pickguard and headstock logo, coupled with a deeply finished 'flamed' grain top and so-called 'sunburst' finish. Both the pickguard and the headstock's decorated laminate on early versions of this model sported a shield-type engraving and coloring, with later versions of the guitar losing the shield from the headstock of later models, but with the sky-blue-trimmed pickguard never losing the shield, which sat right in the middle of the strumming field. The earliest model of this guitar, the model #1381 had the shield device on both the pickguard and the headstock laminate. Later versions of that model would only have the gold filled free-form script "Silvertone' logo within an headstock edge-tracing blue border, much like the appearance in width and color of the blue line trimming the pickguard. The very last-produced of the 1381 guitars and into the versions sold as the model #1369, were topped with a thin metal script Silvertone set in a glossy black field. Model 1381/1369 "Thin Twin" Manufactured by Kay was available from the Spring/Summer Sears catalog of 1954 through the Fall/Winter version going into early 1958. In the Spring/Summer catalog of 1957, the model number changed to 1369, and that number lasted until the retirement of the model in early 1958, being available in the Fall/Winter 1957 catalog. Description of shield: A front view drawing of a crown ringed around the edge we can see with three fleur-de-lis-like tips. Across the face of the ring between the tips and the edge of the crown that would sit on the head when worn, are three round circles representing jewels. From left to right, the circles are colored red, blue, red. Under this drawing of a crown is a long shield just slightly narrower than the crown device. This shield is bisected from approximately 1/3 the way down on its right side, on a 45 degree angle line that has a width appropriate with extending the width of that line so as to reach the bottom third of the device on its left side. The fields this wide band separates are brown with a gold musical note within its borders on the top and bottom fields. Started in 1890 and based in Chicago, Illinois, the Kay Musical Instrument Company introduced, in 1957, the Gold "K" line of guitars. These included electric guitars as well as archtop and flattop acoustics. Before then, the company's guitars had been known mostly for student and department store grade instruments. They made instruments for many companies under different names; "Old Kraftsman", "Airline" and "Silvertone" were just a few of them used. They stopped making the "K" Gold line in 1962. Kay had got Barney Kessel, the top guitarist in the late 1950s, to endorse three models of the series. This only lasted for three years then Kessel left to join Gibson.
| 2023-04-06T09:17:19 |
# Kay K-161 ThinTwin
The **Kay K-161 ThinTwin** is an electric guitar made from 1952 to 1959, was one of the longest produced guitars by Kay Musical Instrument Company. The K161 Thin-Twin was commonly referred to as the "Jimmy Reed" guitar. Introduced not long after Gibson's Les Paul, the ThinTwin was a semi-hollow body guitar and larger than its name "thin" implied. The guitar's body was 2+34 inches (70 mm) deep. "ThinTwin" was a reference to the unique appearance of the dual pickups, having a very slim profile.
There was also a **Silvertone**-branded version of this guitar, with a slightly more 'regal' appointment in ts decorated pickguard and headstock logo, coupled with a deeply finished 'flamed' grain top and so-called 'sunburst' finish. Both the pickguard and the headstock's decorated laminate on early versions of this model sported a shield-type engraving and coloring, with later versions of the guitar losing the shield from the headstock of later models, but with the sky-blue-trimmed pickguard never losing the shield, which sat right in the middle of the strumming field. The earliest model of this guitar, the model **#1381** had the shield device on both the pickguard and the headstock laminate. Later versions of that model would only have the gold filled free-form script "Silvertone' logo within an headstock edge-tracing blue border, much like the appearance in width and color of the blue line trimming the pickguard. The very last-produced of the 1381 guitars and into the versions sold as the model **#1369**, were topped with a thin metal script Silvertone set in a glossy black field.
**Model 1381/1369** "Thin Twin" Manufactured by Kay was available from the Spring/Summer Sears catalog of 1954 through the Fall/Winter version going into early 1958. In the Spring/Summer catalog of 1957, the model number changed to 1369, and that number lasted until the retirement of the model in early 1958, being available in the Fall/Winter 1957 catalog.
Description of shield: A front view drawing of a crown ringed around the edge we can see with three fleur-de-lis-like tips. Across the face of the ring between the tips and the edge of the crown that would sit on the head when worn, are three round circles representing jewels. From left to right, the circles are colored red, blue, red. Under this drawing of a crown is a long shield just slightly narrower than the crown device. This shield is bisected from approximately 1/3 the way down on its right side, on a 45 degree angle line that has a width appropriate with extending the width of that line so as to reach the bottom third of the device on its left side. The fields this wide band separates are brown with a gold musical note within its borders on the top and bottom fields.
Started in 1890 and based in Chicago, Illinois, the Kay Musical Instrument Company introduced, in 1957, the Gold "K" line of guitars. These included electric guitars as well as archtop and flattop acoustics. Before then, the company's guitars had been known mostly for student and department store grade instruments. They made instruments for many companies under different names; "Old Kraftsman", "Airline" and "Silvertone" were just a few of them used. They stopped making the "K" Gold line in 1962. Kay had got Barney Kessel, the top guitarist in the late 1950s, to endorse three models (Jazz Special, Artist, and Pro) of the series. This only lasted for three years then Kessel left to join Gibson.
|
30,292,550 |
https://en.wikipedia.org/wiki/Ashava
|
Ashava
|
Ashava or Ashawa is a village and valley in Ghorband District, Parwan Province of Afghanistan. It is noted for its cheese, Ashava cheese (Panir-e-Ashawa). A road connects it to Towtamdarreh-ye `Olyā in the east where it joins the A76 highway.
| 2023-11-11T04:38:39 |
# Ashava
**Ashava** or **Ashawa** is a village and valley in Ghorband District, Parwan Province of Afghanistan. It is noted for its cheese, Ashava cheese (Panir-e-Ashawa). A road connects it to Towtamdarreh-ye \`Olyā in the east where it joins the A76 highway.
## InfoBox
| Ashava | |
| --- | --- |
| Village | |
| AshavaLocation in Afghanistan | |
| Coordinates: 35°7′5″N 69°6′28″E / 35.11806°N 69.10778°E / 35.11806; 69.10778 | |
| Country | Afghanistan |
| Province | Parwan Province |
| District | Ghorband District |
| Time zone | UTC+04:30 (AST) |
|
42,605,647 |
https://en.wikipedia.org/wiki/Arye_L._Hillman
|
Arye L. Hillman
|
Arye L. Hillman is an Israeli economist whose career has been at Bar Ilan University in Israel where he has been William Gittes Chair and Professor of Economics. His main research focus is on political economy, or the study of public policy as the interface between economic and political decisions. From 1994 to 2014 he was an editor of the European Journal of Political Economy for which he remained editorial advisor and editor of various special issues. He began in 1989 organizing the on-going Silvaplana Workshop in Political Economy with Heinrich Ursprung. The intent was to provide a forum for political economy when political economy was not yet popular. His research interests have intersected with the public-choice school in incorporating political self-interest into public-policy decisions. His book The Political Economy of Protection described the influence of politics on the conduct of international trade policy including his original contributions to understanding trade protectionism as motivated by distributional concerns. His textbook Public Finance and Public Policy describes the responsibilities and limitations of government combining traditional public finance and political-economy or public-choice perspectives. In conjunction with World Bank researchers, he studied the transition of formerly communist countries to market economies, again emphasizing the role of political decisions as a conduit for personal gain. Together with researchers from the Fiscal Affairs Department of the IMF, he studied the impediments to the poor in low-income countries being helped through development assistance provided to governments. He has been interested in 'rent seeking' or the social loss incurred when politically provided benefits are contestable so that time and initiative are diverted from alternative productive activities to seeking the benefits. He studied an economy with Nietzschean characteristics in which the weak have no defense against appropriation by the strong other than to pretend to be lazy and non-productive. He suggested that this described authoritarian low-income countries. He has been a visiting professor and has taught at UCLA, Princeton, and the Sorbonne, and has regularly been a visitor at universities in Australia. His undergraduate studies were at the University of Newcastle in Australia and graduate studies were at the University of Pennsylvania in the United States.
| 2023-09-23T00:56:56 |
# Arye L. Hillman
**Arye L. (Laib or Leo) Hillman** is an Israeli economist whose career has been at Bar Ilan University in Israel where he has been William Gittes Chair and Professor of Economics. His main research focus is on political economy, or the study of public policy as the interface between economic and political decisions. From 1994 to 2014 he was an editor of the *European Journal of Political Economy* for which he remained editorial advisor and editor of various special issues.
He began in 1989 organizing the on-going Silvaplana Workshop in Political Economy with Heinrich Ursprung. The intent was to provide a forum for political economy when political economy was not yet popular. His research interests have intersected with the public-choice school in incorporating political self-interest into public-policy decisions. His book *The Political Economy of Protection* (1989, reissued 2001 and 2013) described the influence of politics on the conduct of international trade policy including his original contributions to understanding trade protectionism as motivated by distributional concerns. His textbook (3rd edition 2019) *Public Finance and Public Policy* describes the responsibilities and limitations of government combining traditional public finance and political-economy or public-choice perspectives.
In conjunction with World Bank researchers, he studied the transition of formerly communist countries to market economies, again emphasizing the role of political decisions as a conduit for personal gain. Together with researchers from the Fiscal Affairs Department of the IMF, he studied the impediments to the poor in low-income countries being helped through development assistance provided to governments. He has been interested in 'rent seeking' or the social loss incurred when politically provided benefits are contestable so that time and initiative are diverted from alternative productive activities to seeking the benefits. He studied an economy with Nietzschean characteristics in which the weak have no defense against appropriation by the strong other than to pretend to be lazy and non-productive. He suggested that this described authoritarian low-income countries.
He has been a visiting professor and has taught at UCLA, Princeton, and the Sorbonne, and has regularly been a visitor at universities in Australia. His undergraduate studies were at the University of Newcastle in Australia and graduate studies were at the University of Pennsylvania in the United States.
## InfoBox
| Arye L. Hillman | |
| --- | --- |
| Born | (1947-01-13) January 13, 1947<br>Bad Wörishofen, Bavaria, Germany |
| Nationality | Israeli |
| | |
| Academic career | |
| Institution | Bar Ilan University |
| Field | Political economy |
| School or<br>tradition | Political economy |
| Alma mater | University of Pennsylvania |
| Awards | University Medal, University of Newcastle NSW (1967) Max-Planck-Prize for Humanities Sciences, awarded jointly with Heinrich W. Ursprung (1994)<br>Fellow of Japanese Society for Promotion of Science (2000)<br>Honorary Doctorate, University of Genoa (2016) |
| Information at IDEAS / RePEc | |
| | |
|
27,018,586 |
https://en.wikipedia.org/wiki/Kibiriraini
|
Kibiriraini
|
Kibiriraini is a settlement in Kenya's Central Province.
| 2023-01-30T05:05:13 |
# Kibiriraini
**Kibiriraini** is a settlement in Kenya's Central Province.
## History
The province is inhabited by the Kikuyu speaking community are part of the Kenya Eastern Bantu.
During Kenya's colonization by the British, much of the province was regarded as part of the 'White Highlands', for the exclusive use of the settler community. Therefore it saw political activity from the local communities who felt that they had an ancestral right to the land. This tension culminated in the 1950s with the Mau Mau rebellion; it saw the region placed under a state of emergency and the arrest of many prominent political leaders.
## InfoBox
| Kibiriraini | |
| --- | --- |
| KibirirainiLocation of Kibiriraini | |
| Coordinates: 1°17′S 37°00′E / 1.28°S 37°E / -1.28; 37 | |
| Country | Kenya |
| Province | Central Province |
| Time zone | UTC+3 (EAT) |
|
52,333,904 |
https://en.wikipedia.org/wiki/2003_NCAA_Division_I_Cross_Country_Championships
|
2003 NCAA Division I Cross Country Championships
|
The 2003 NCAA Division I Cross Country Championships were the 65th annual NCAA Men's Division I Cross Country Championship and the 23rd annual NCAA Women's Division I Cross Country Championship to determine the team and individual national champions of NCAA Division I men's and women's collegiate cross country running in the United States. In all, four different titles were contested: men's and women's individual and team championships. Held on November 24, 2003, the combined meet was hosted by the University of Northern Iowa at Irv Warren Golf Course in Waterloo, Iowa, near UNI's campus in Cedar Falls. The distance for the men's race was 10 kilometers while the distance for the women's race was 6 kilometers. The men's team championship was again won by Stanford, the Cardinal's second consecutive and fourth overall. This was the second best score in NCAA history and the lowest by a team of entirely American runners. UTEP's 17 point win in 1981 was accomplished with a team of African runners. Stanford placed 6 runners in the top 13 places. The women's team championship was also won by Stanford, the Cardinal's second and first since 1996. This was the third time that the same university won both team titles; Stanford accomplished this feat in 1996 and Wisconsin captured both in 1985. The two individual champions were, for the men, Dathan Ritzenhein and, for the women, Shalane Flanagan. It was Flanagan's second consecutive title.
| 2022-08-27T14:43:58 |
# 2003 NCAA Division I Cross Country Championships
The **2003 NCAA Division I Cross Country Championships** were the 65th annual NCAA Men's Division I Cross Country Championship and the 23rd annual NCAA Women's Division I Cross Country Championship to determine the team and individual national champions of NCAA Division I men's and women's collegiate cross country running in the United States. In all, four different titles were contested: men's and women's individual and team championships.
Held on November 24, 2003, the combined meet was hosted by the University of Northern Iowa at Irv Warren Golf Course in Waterloo, Iowa, near UNI's campus in Cedar Falls. The distance for the men's race was 10 kilometers (6.21 miles) while the distance for the women's race was 6 kilometers (3.73 miles).
The men's team championship was again won by Stanford (24 points), the Cardinal's second consecutive and fourth overall. This was the second best score in NCAA history and the lowest by a team of entirely American runners. UTEP's 17 point win in 1981 was accomplished with a team of African runners. Stanford placed 6 runners in the top 13 places. The women's team championship was also won by Stanford (120 points), the Cardinal's second and first since 1996. This was the third time that the same university won both team titles; Stanford accomplished this feat in 1996 and Wisconsin captured both in 1985.
The two individual champions were, for the men, Dathan Ritzenhein (Colorado, 29:14.1) and, for the women, Shalane Flanagan (North Carolina, 19:30.4). It was Flanagan's second consecutive title.
## Men's title
* **Distance:** 10,000 meters
## Women's title
* **Distance:** 6,000 meters
## InfoBox
| 2003 NCAA Division I Cross Country Championships | |
| --- | --- |
| Organisers | NCAA |
| Edition | 65th–Men<br>23rd–Women |
| Date | November 24, 2003 |
| Host city | Waterloo, IA |
| Venue | Irv Warren Golf Course |
| Distances | 10 km–Men<br>6 km–Women |
| Participation | 254–Men<br>252–Women<br>506–Total athletes |
| 2002 2004 | |
|
29,323,479 |
https://en.wikipedia.org/wiki/Lake_Boeckella
|
Lake Boeckella
|
Lake Boeckella is a small lake which lies 0.3 nautical miles (0.6 km) south of Hope Bay and drains by a small stream into Eagle Cove, at the northeast end of Antarctic Peninsula. It was discovered and named by the Swedish Antarctic Expedition, 1901–04, under Otto Nordenskjöld. Crustaceans from the genus Boeckella are found in this area. The Crest is located just east of the lake. This article incorporates public domain material from "Lake Boeckella". Geographic Names Information System. United States Geological Survey.
| 2022-02-21T20:37:10 |
# Lake Boeckella
**Lake Boeckella** (63°24′S 57°0′W / 63.400°S 57.000°W / -63.400; -57.000) is a small lake which lies 0.3 nautical miles (0.6 km) south of Hope Bay and drains by a small stream into Eagle Cove, at the northeast end of Antarctic Peninsula. It was discovered and named by the Swedish Antarctic Expedition, 1901–04, under Otto Nordenskjöld. Crustaceans from the genus Boeckella are found in this area.
The Crest is located just east of the lake.
This article incorporates public domain material from "Lake Boeckella". *Geographic Names Information System*. United States Geological Survey.
## InfoBox
| Lake Boeckella | |
| --- | --- |
| Lake Boeckella | |
| Location | Antarctica |
| Coordinates | 63°24′S 57°0′W / 63.400°S 57.000°W / -63.400; -57.000 |
| Type | lake |
|
3,556,157 |
https://en.wikipedia.org/wiki/AJK_TV
|
AJK TV
|
AJK TV is a television channel owned by the Pakistan Television Corporation, Pakistan's state-broadcaster. Subsequent to the resolution passed by the Azad Kashmir Legislative Assembly requesting for the establishment of new channel in Azad Jammu Kashmir, Gilgit Baltistan and directive from the President of Pakistan in 2002, it was decided to establish a new TV channel in those regions by early-2004. In pursuance finally a portion of Radio Pakistan building was selected by the chairman of the PTC to serve as AJK TV.
| 2023-06-09T06:36:12 |
# AJK TV
**AJK TV** is a television channel owned by the Pakistan Television Corporation, Pakistan's state-broadcaster. Subsequent to the resolution passed by the Azad Kashmir Legislative Assembly requesting for the establishment of new channel in Azad Jammu Kashmir, Gilgit Baltistan and directive from the President of Pakistan in 2002, it was decided to establish a new TV channel in those regions by early-2004. In pursuance finally a portion of Radio Pakistan building was selected by the chairman of the PTC to serve as **AJK TV**.
## History
The channel was launched on 5 February 2004 with its inauguration by the President of Pakistan.
## InfoBox
AJK Television (Pakistan) Kashmiri and Gilgiti Language
| | |
| --- | --- |
| Country | Pakistan |
| Broadcast area | Pakistan |
| Network | Pakistan Television Corporation |
| Headquarters | AJK TV CENTRE, CMH Road, Muzaffarabad |
| Programming | |
| Language(s) | Kashmiri<br>Urdu |
| Picture format | 16:9 (576i, SDTV) |
| Ownership | |
| Owner | Pakistan Television Corporation |
| Sister channels | PTV News<br>PTV Sports<br>PTV National<br>PTV Bolan<br>PTV Global<br>PTV Home<br>PTV World |
| History | |
| Launched | February 5, 2004 |
| Links | |
| Website | ptv.com.pk/ptvCorporate/ptvAJK |
|
1,490,582 |
https://en.wikipedia.org/wiki/British_Lung_Foundation
|
British Lung Foundation
|
The British Lung Foundation (BLF) was a British charity that promoted lung health and supported those affected by lung disease. In January 2020, it merged with Asthma UK, to become Asthma + Lung UK.
| 2024-03-15T17:03:43 |
# British Lung Foundation
The **British Lung Foundation** (**BLF**) was a British charity that promoted lung health and supported those affected by lung disease. In January 2020, it merged with Asthma UK, to become Asthma + Lung UK.
## History
The British Lung Foundation was established by Professor Sir Malcolm Green and a group of British lung specialists in 1984. It maintained strong links with the medical profession, as well as utilising the talents of people from all walks of life who share a determination to try to conquer lung disease in the 21st Century.
## Breathe Easy
Breathe Easy was the support network of the British Lung Foundation. The network included 150 support groups across the UK. Breathe Easy supported people through regular group meetings and offered help over the phone. There was also a pen-pal scheme, enabling people to make contact with others in the same situation. After a Breathe Easy campaign the Department of Health decided to undertake a complete review of the way oxygen was provided in England and Wales.
## Campaigns
The British Lung Foundation campaigned for improvements in all areas of lung health. Breathe Easy supporters and members of the general public had worked with the BLF to ensure that these issues remained on the agenda at Westminster – and in the political chambers of Northern Ireland, Scotland and Wales. The BLF also campaigned to raise public awareness of lung disease and the impact it had on so many lives through poster campaigns, events and by maintaining a media profile.
## Controversy
In June 2012 the British Lung Foundation released a report looking at the health impacts of smoking cannabis. (The report appeared to be subsequently withdrawn.) In one section, the report claimed "each cannabis cigarette increases the chances of developing lung cancer by as much as an entire packet of 20 tobacco cigarettes", and the claim received prominence in launch interviews with the then chief executive, Dame Helena Shovelton. The report supported the claim by reference to a 2008 study, "Cannabis use and risk of lung cancer: a case-control study" (Aldington et al.), published in the *European Respiratory Journal*. That study had been challenged within the year and in the same journal, long before the BLF's claim.
In a BBC radio interview on the day of the launch, Kevin Williamson, author of "Drugs and the Party line", said that there was "no scientific basis to the claim", citing an earlier study of 2200 people published in Cancer Epidemiological Biomarkers and Prevention that had found "that the association of these cancers with marijuana, even long-term or heavy use, is not strong and may be below practically detectable limits", asking the charity's representative to cite the research that supported the charity's claim. When he declined to do so, Williamson accused the charity of "putting out bogus information" for "headline grabbing". On the same day, online journalist Keelan Balderson accused the charity of peddling "a long debunked myth". He claimed that it was not the first such incident, citing an earlier BLF statement that "3 joints are equal to 20 cigarettes", taken from the BLF’s 2002 *Smoking Gun?* report. David Nutt criticised the Foundation for "scaremongering". Peter Reynolds, leader of the political party Cannabis Law Reform, described the report as a "dangerously irresponsible mix of conjecture, extremist opinion and scaremongering".
The British Lung Foundation responded by asserting that the report was based on sound research, and "references over 80 peer-reviewed research papers, is the most comprehensive report of its kind yet compiled, and has itself been peer-reviewed by independent experts".
## Research
On average, the British Lung Foundation invested one million pounds a year in research projects aiming to improve the diagnosis or treatment of lung conditions. As a direct result of research funded by the BLF, it claimed: it is now possible to measure lung capacity in infants; the benefits of pulmonary rehabilitation are demonstrable; and lung transplants are more likely to be successful.
## BLF COPD Project
The British Lung Foundation’s COPD Project was a three-year project which was set up in January 2007. The aims of the project were to:
* Raise awareness of chronic obstructive pulmonary disease (COPD) among the general public and health professionals.
* Facilitate the sharing of information and expertise among patients, carers, health and social care practitioners, managers, commissioners and others.
* Support the delivery of COPD campaigns and publications, developed and produced by the British Lung Foundation.
### National Service Framework for COPD
The Department of Health was due to launch a new National Service Framework (NSF) for Chronic obstructive pulmonary disease at the end of 2008. As Patient Advocate, the BLF’s Chief Executive, Helena Shovelton had been working closely with the Department of Health to support the development of the NSF for COPD. The BLF was due to support the implementation of the NSF for COPD.
|
53,901,935 |
https://en.wikipedia.org/wiki/Bygdebladet
|
Bygdebladet
|
Bygdebladet is a newspaper published in Sjøholt in Møre og Romsdal county, Norway. The newspaper is published in Nynorsk and is issued on Wednesdays and Saturdays in the municipalities of Vestnes, Ørskog, Stordal, Skodje, and Haram. The paper was started in 1972 by Kjell Opsal. Opsal edited the paper until 2015, when he was succeeded by Reidar Opsal.
| 2021-07-08T14:54:31 |
# Bygdebladet
***Bygdebladet*** (The Country Gazette) is a newspaper published in Sjøholt in Møre og Romsdal county, Norway. The newspaper is published in Nynorsk and is issued on Wednesdays and Saturdays in the municipalities of Vestnes, Ørskog, Stordal, Skodje, and Haram. The paper was started in 1972 by Kjell Opsal. Opsal edited the paper until 2015, when he was succeeded by Reidar Opsal.
## Circulation
According to the Norwegian Audit Bureau of Circulations (*Norsk Opplagskontroll*) and the National Association of Local Newspapers (*Landslaget for lokalaviser*), *Bygdebladet* has had the following annual circulation:
* 2006: 3,056
* 2007: 2,979
* 2008: 2,847
* 2009: 2,870
* 2010: 2,801
* 2011: 2,691
* 2012: 2,642
* 2013: 2,500
* 2014: 2,439
* 2015: 2,474
* 2016: 2,474
|
59,480,044 |
https://en.wikipedia.org/wiki/List_of_pipeline_accidents_in_the_United_States_in_2019
|
List of pipeline accidents in the United States in 2019
|
The following is a list of pipeline accidents in the United States in 2019. It is one of several lists of U.S. pipeline accidents. See also list of natural gas and oil production accidents in the United States.
| 2024-03-28T00:11:56 |
# List of pipeline accidents in the United States in 2019
The following is a **list of pipeline accidents in the United States in 2019**. It is one of several lists of U.S. pipeline accidents. See also list of natural gas and oil production accidents in the United States.
## Incidents
This is not a complete list of all pipeline accidents. **For natural gas alone**, the Pipeline and Hazardous Materials Safety Administration (PHMSA), a United States Department of Transportation agency, has collected data on more than 3,200 accidents deemed serious or significant since 1987.
A "significant incident" results in any of the following consequences:
* fatality or injury requiring in-patient hospitalization
* $50,000 or more in total costs, measured in 1984 dollars
* liquid releases of five or more barrels (42 US gal/barrel)
* releases resulting in an unintentional fire or explosion
PHMSA and the National Transportation Safety Board (NTSB) post incident data, and results of investigations, into accidents involving pipelines that carry a variety of products, including natural gas, oil, diesel fuel, gasoline, kerosene, jet fuel, carbon dioxide, and other substances. Occasionally pipelines are repurposed to carry different products.
* On January 17, a natural gas and oil explosion occurred, resulting in the loss of 1.4 million dollars worth of natural gas and oil and a fire lasting all day in Watford city, North Dakota. There were no injuries or deaths.
* On January 18, an Enbridge natural gas pipeline exploded in Noble County, Ohio, causing two people to be injured along with damage to two homes.
* On January 29, a pipeline ruptured near the town of Lumberport in Harrison County, West Virginia. The rupture was located at a girth weld of an elbow on the 12-inch interstate pipeline. The root cause investigation concluded that a landslide about 150 yards from the rupture moved the pipeline approximately 10 feet from its original location, causing excessive stress on the pipe that resulted in the rupture.
* On January 30, a crude oil spill caused by an apparent open valve occurred in Enid, Oklahoma. This incident resulted in the release of 750 barrels, or 31,500 gallons, of oil into the environment, which extended five miles down a creek.
* On February 2, a fire was intentionally set in Pittsylvania county, Virginia. This fire caused $500,000 worth of damage to mountain valley pipeline construction. There were no injuries or deaths.
* On February 6, a natural gas release caused a fire in San Francisco, California. This fire lead to the evacuation of approximately 100 people in the area.
* On February 6, an oil spill occurred in St. Charles County, Missouri. This oil spill resulted in the release of 43 barrels, or 1800 gallons.
* On March 3, an Energy Transfer Partners 30-inch natural gas pipeline exploded and burned, destroying a house that was under construction previously in Audrain County, Missouri. There were no deaths, and no one was injured. The cause was Stress Corrosion Cracking. After the failure, during hydrostatic testing of this pipeline, four other sections of pipeline failed. It is estimated that 91,719 cubic feet of natural gas were released during the incident.
* On March 4, an oil and natural gas pipeline explosion due to high pressure happened in Martin County, Texas. This explosion lead to the death of two employees.
* On March 18, an oil spill occurred due to a valve leak in Watford City, North Dakota. This occurrence resulted in 12,600 gallons of oil being released.
* On April 4, a natural gas pipeline explosion occurred, with officials unsure of the cause, in Longstreet, Louisiana. There were no injuries or deaths related to this incident.
* On April 24, a Magellan Midstream Partners pipeline was detected to be losing pressure. Investigation found a leak in the pipeline near Cottonwood, Minnesota. About 8,400 gallons of diesel fuel had leaked from the pipeline.
* On June 18, pipeline installation workers struck another gas pipeline near Highway 19 at County Road 1420 and County Street 2920 in Grady County, Oklahoma, causing a fire. One worker was injured.
* On June 23, a Crimson Pipeline line spilled about 45,000 gallons of diesel fuel in Ventura, California.
* On July 10, Phillips 66 Pipeline's 12.75-inch crude oil pipeline leaked north of Wichita Falls, Texas. The failure was in a longitudinal seam. An estimated 1,200 barrels (50,400 US gallons) were spilled.
* On August 1, an Enbridge 30-inch gas transmission pipeline exploded and burned in Stanford, Kentucky. One person was killed, and five others were injured. Five homes were destroyed and at least four were damaged in the Indian Camp mobile home park in Stanford, where the explosion occurred. Flames reached more than 300 feet and melted tar on nearby roads, officials said.
* On October 3, a pipeline that had just finished maintenance spilled between 420,000 and 630,000 gallons of diesel fuel into Turkey Creek in Miller Grove, Texas.
* On October 29, near Edinburg, North Dakota the Keystone Pipeline was shut down after leaking 190,000 gallons of crude oil onto about 4.81 acres of wetlands. The cause was defective pipe.
* On November 2, a scraper passage indicator assembly on a crude oil pipeline was noticed leaking, in Eddy County, New Mexico. During repair work, the pipe completely broke, spilling about 63,000 gallons of crude oil. There were no injuries.
* On November 15, a newly installed gas pipeline exploded and burned in Pepper Pike, Ohio. There were no injuries. The Public Utilities Commission of Ohio said that a preliminary investigation revealed that a welding failure caused the rupture, which caused the explosion and fire.
* On December 5, three workers suffered severe burns in multiple explosions and a fire at an EOG Resources gas pipeline compressor site near Carpenter, Wyoming.
* On December 19, a worker was injured in a pipeline incident near Douglas, Wyoming.
* On December 19, an explosion in Philadelphia killed two people and destroyed five houses.
* On December 19, three workers were injured during a pipeline explosion in Marshall, Texas.
* On December 21, a Williams Companies gas pipeline compressor plant in Ohio County, West Virginia exploded and burned. There were no injuries reported.
|
41,336 |
https://en.wikipedia.org/wiki/Long-term_stability
|
Long-term stability
|
In electronics, the long-term stability of an oscillator is the degree of uniformity of frequency over time, when the frequency is measured under identical environmental conditions, such as supply voltage, load, and temperature. Long-term frequency changes are caused by changes in the oscillator elements that determine frequency, such as crystal drift, inductance changes, and capacitance changes. This article incorporates public domain material from Federal Standard 1037C. General Services Administration. Archived from the original on 2022-01-22. (in support of MIL-STD-188).
| 2021-08-27T03:49:40 |
# Long-term stability
In electronics, the **long-term stability** of an oscillator is the degree of uniformity of frequency over time, when the frequency is measured under identical environmental conditions, such as supply voltage, load, and temperature. Long-term frequency changes are caused by changes in the oscillator elements that determine frequency, such as crystal drift, inductance changes, and capacitance changes.
This article incorporates public domain material from *Federal Standard 1037C*. General Services Administration. Archived from the original on 2022-01-22. (in support of MIL-STD-188).
|
25,334,815 |
https://en.wikipedia.org/wiki/Anuhea
|
Anuhea
|
Anuhea is Anuhea Jenkins' self-titled debut album. It was released on April 21, 2009.
| 2021-01-10T02:18:19 |
# Anuhea
***Anuhea*** is Anuhea Jenkins' self-titled debut album. It was released on April 21, 2009.
## Track listing
All songs written by Anuhea Jenkins.
1. "Charismatic SOB" – 10:58
2. "Right Love, Wrong Time" – 4:46
3. "Here I Go Again" – 3:26
4. "Ultimate Insult" – 3:28
5. "Big Deal" – 3:30
6. "No Words" – 3:36
7. "Endlessly" – 4:15
8. "Barista By Day" – 3:03
9. "Slow Down" – 3:34
10. "Fly" – 4:06
11. "I Just Want you Around" – 3:20
12. "Rumors" featuring DogBoy – 4:10
1. "Anuhea Jenkins | The Lowdown". Midweek.com. 2008-10-03. Archived from the original on 2011-09-27. Retrieved 2012-02-19.
2. "Anuhea - Anuhea Album". Artists.letssingit.com. 2009-05-23. Retrieved 2012-02-19.
## InfoBox
| Anuhea | |
| --- | --- |
| | |
| Studio album by Anuhea Jenkins | |
| Released | April 21, 2009 |
| Recorded | 2008 |
| Genre | Folk rock, R&B |
| Label | One Hawaii Music |
| Anuhea Jenkins chronology | |
| ***Anuhea***<br>(2009) *For Love*<br>(2012) | |
|
75,621,625 |
https://en.wikipedia.org/wiki/Climate_Change_in_Malawi
|
Climate Change in Malawi
|
Malawi is a land-locked country in southeastern Africa situated along the southernmost arm of the East African Rift-Valley System between latitudes 9°22’ and 17°03’ south of the equator, and longitudes 33°40’ and 35°55’ east of the Greenwich meridian. It shares borders with Tanzania in the north and northeast, Mozambique in the southwest, south, and east, and Zambia in the west. Malawi is highly vulnerable to the effects of climate change as the vast majority of Malawians rely on small-scale, rain-fed agriculture, making them highly dependent on weather patterns. Climate change increasingly exacerbates droughts, flooding, and inconsistent rainfall—contributing to food insecurity and threatening to derail progress toward Malawi’s goal of self-reliance.
| 2024-01-23T09:38:19 |
# Climate Change in Malawi
Malawi is a land-locked country in southeastern Africa situated along the southernmost arm of the East African Rift-Valley System between latitudes 9°22’ and 17°03’ south of the equator, and longitudes 33°40’ and 35°55’ east of the Greenwich meridian. It shares borders with Tanzania in the north and northeast, Mozambique in the southwest, south, and east, and Zambia in the west. Malawi is highly vulnerable to the effects of climate change as the vast majority of Malawians rely on small-scale, rain-fed agriculture, making them highly dependent on weather patterns. Climate change increasingly exacerbates droughts, flooding, and inconsistent rainfall—contributing to food insecurity and threatening to derail progress toward Malawi’s goal of self-reliance.
## Greenhouse Gas Emissions
Malawi emitted a total of 10.85 million metric tons of carbon dioxide equivalent (MtCO2e) in 2011, accounting for merely 0.02 percent of global greenhouse gas (GHG) emissions. The land-use change and forestry sector contributed 56 percent of Malawi's GHG emissions, followed by the agriculture, waste, and industrial processes sectors, which collectively contributed 40 percent, 2 percent, and 2 percent, respectively. Between 1990 and 2011, GHG emissions in Malawi witnessed a 14 percent increase, whereas the country's Gross Domestic Product (GDP) experienced a notable growth of 126 percent during the same time frame. However, despite the faster growth of GDP, Malawi's economy emitted approximately three times more GHGs relative to GDP compared to the global average in 2011, suggesting the potential for improvement. According to UNDP, Malawi had 0.04% Share of global GHG emissions, with 158 Climate Vulnerability Index ranking, 169 Human Development Index ranking, 51% Conditional emissions reduction target by 2040 as of July 2021.
Fossil Carbon Dioxide (CO2) emissions of Malawi.
| Year | Fossil CO2 Emissions ( tons ) | CO2 emisions change | CO2 emissions per capita | Population | Pop . change | Share of World's CO2 emissions |
| --- | --- | --- | --- | --- | --- | --- |
| 2016 | 1,815,598 | 3.26% | 0.1 | 17,405,624 | 2.76% | 0.01% |
| 2015 | 1,758,327 | 0.15% | 0.1 | 16,938,942 | 2.80% | 0.00% |
| 2014 | 1,755,703 | 6.17% | 0.11 | 16,477,966 | 2.83% | 0.00% |
| 2013 | 1,653,643 | 3.51% | 0.1 | 16,024,775 | 2.85% | 0.00% |
| 2012 | 1,597,618 | 1.98% | 0.1 | 15,581,251 | 2.87% | 0.00% |
| 2011 | 1,566,662 | 2.30% | 0.1 | 15,146,094 | 2.91% | 0.00% |
| 2010 | 1,531,406 | 7.80% | 0.1 | 14,718,422 | 2.93% | 0.00% |
| 2009 | 1,420,539 | -0.91% | 0.1 | 14,298,932 | 2.95% | 0.00% |
| 2008 | 1,433,560 | 6.27% | 0.1 | 13,889,423 | 2.92% | 0.00% |
| 2007 | 1,348,951 | 5.73% | 0.1 | 13,495,463 | 2.88% | 0.00% |
| 2006 | 1,275,876 | 3.44% | 0.1 | 13,118,307 | 2.84% | 0.00% |
| 2005 | 1,233,487 | 3.23% | 0.1 | 12,755,648 | 2.77% | 0.00% |
| 2004 | 1,194,937 | 3.97% | 0.1 | 12,411,342 | 2.68% | 0.00% |
| 2003 | 1,149,325 | 1.77% | 0.1 | 12,087,965 | 2.58% | 0.00% |
| 2002 | 1,129,387 | 2.24% | 0.1 | 11,784,498 | 2.48% | 0.00% |
| 2001 | 1,104,693 | 5.90% | 0.1 | 11,498,818 | 2.40% | 0.00% |
| 2000 | 1,043,156 | -3.30% | 0.09 | 11,229,387 | 2.33% | 0.00% |
| 1999 | 1,078,757 | 5.87% | 0.1 | 10,973,956 | 2.25% | 0.00% |
| 1998 | 1,018,990 | -10.92% | 0.09 | 10,732,456 | 2.09% | 0.00% |
| 1997 | 1,143,953 | 18.66% | 0.11 | 10,512,678 | 1.96% | 0.00% |
| 1996 | 964,064 | -0.68% | 0.09 | 10,310,528 | 1.96% | 0.00% |
| 1995 | 970,671 | 4.91% | 0.1 | 10,112,816 | -0.19% | 0.00% |
| 1994 | 925,247 | 18.76% | 0.09 | 10,131,799 | -1.22% | 0.00% |
| 1993 | 779,070 | -0.77% | 0.08 | 10,257,233 | 1.40% | 0.00% |
| 1992 | 785,137 | -0.12% | 0.08 | 10,115,420 | 2.89% | 0.00% |
| 1991 | 786,057 | 19.29% | 0.08 | 9,831,584 | 3.06% | 0.00% |
| 1990 | 658,919 | -8.82% | 0.07 | 9,539,665 | 3.98% | 0.00% |
| 1989 | 722,640 | 6.61% | 0.08 | 9,174,895 | 4.80% | 0.00% |
| 1988 | 677,845 | -2.54% | 0.08 | 8,754,781 | 5.53% | 0.00% |
| 1987 | 695,483 | 25.12% | 0.08 | 8,295,993 | 4.88% | 0.00% |
| 1986 | 555,847 | 3.79% | 0.07 | 7,909,819 | 3.73% | 0.00% |
| 1985 | 535,545 | 6.30% | 0.07 | 7,625,078 | 3.90% | 0.00% |
| 1984 | 503,812 | -4.74% | 0.07 | 7,339,002 | 3.98% | 0.00% |
| 1983 | 528,893 | -10.57% | 0.07 | 7,058,317 | 4.04% | 0.00% |
| 1982 | 591,389 | -7.92% | 0.09 | 6,784,347 | 4.06% | 0.00% |
| 1981 | 642,266 | -3.60% | 0.1 | 6,519,891 | 4.03% | 0.00% |
| 1980 | 666,247 | -6.64% | 0.11 | 6,267,369 | 3.95% | 0.00% |
| 1979 | 713,649 | 13.63% | 0.12 | 6,029,140 | 3.79% | 0.00% |
| 1978 | 628,052 | 14.78% | 0.11 | 5,808,810 | 3.51% | 0.00% |
| 1977 | 547,192 | -0.11% | 0.1 | 5,611,712 | 3.19% | 0.00% |
| 1976 | 547,811 | -5.55% | 0.1 | 5,438,226 | 2.98% | 0.00% |
| 1975 | 580,029 | 13.90% | 0.11 | 5,280,965 | 2.86% | 0.00% |
| 1974 | 509,239 | 3.53% | 0.1 | 5,134,199 | 2.76% | 0.00% |
| 1973 | 491,868 | 3.90% | 0.1 | 4,996,239 | 2.68% | 0.00% |
| 1972 | 473,413 | 0.41% | 0.1 | 4,865,978 | 2.60% | 0.00% |
| 1971 | 471,501 | 0.54% | 0.1 | 4,742,480 | 2.54% | 0.00% |
## Impact on the Natural Environment
### Temperature and weather changes
Malawi has encountered climate change and climate variability in recent decades, leading to a proliferation of severe climate-related shocks that have experienced an increase in frequency over the past few decades resulting in a series of devastating climate shocks that have become more frequent in recent years. These shocks include irregular rainfall, droughts, extended periods of dry weather, and powerful winds. The altering climate has had an impact on numerous sectors of the economy, including agriculture, health, water, energy, transportation, education, gender, forestry, wildlife, and infrastructure.
Malawi experiences two primary seasons: the cool, dry season, which occurs between May and October, with average temperatures of approximately 13 °C in June and July, and the hot, wet season, which takes place from November to April, with temperatures ranging from 30°- 35 °C. Precipitation levels vary depending on the altitude, with rift valley floors receiving approximately 600 mm of rainfall annually and mountainous regions experiencing around 1600 mm. Local variations in rainfall are influenced by the intricate topography, leading to the diversion of moisture-laden winds, ultimately causing precipitation and rain shadow effects in different terrains.
Köppen–Geiger present climate classification map for MalawiKöppen–Geiger future climate classification map for MalawiTemperature Bar Chart Africa-Malawi--1901-2020--2021-07-13
### Impact on water resource
Weather-related shocks are becoming increasingly frequent and devastating in the country, with notable examples being the major floods of 2015 and Cyclone Idai in 2019. Malawi is currently facing heightened surface run-off due to intensified rainfall, resulting in reduced water percolation and retention in groundwater supplies and surface water bodies. Many regions in the country are already observing a decline in the water table, with some perennial rivers transitioning into seasonal ones. The southern area, in particular, exhibits distinct hotspots for weather-related shocks attributed to the decline in annual rainfall and evapotranspiration.
### Impact on people
Droughts and floods, the most severe of these hazards, have exhibited an increase in frequency, intensity, and magnitude over the past two decades, consequently leading to grave implications on food and water security, water quality, energy resources, and sustainable livelihoods of rural communities. Within the period from 1979 to 2008, a total of 2,596 individuals lost their lives due to natural disasters, and nearly an additional 21.7 million people experienced adverse effects. Floods and droughts stand as the primary cause of chronic food security, which remains widespread across various regions within the country.
### Economic impacts
Climate change results in increased variability in crop yields, impacting agricultural productivity - a vital sector for the economy of Malawi. The heightened risk of flooding poses a significant threat to the road infrastructure of Malawi, leading to transportation and connectivity issues. In the absence of climate-informed economic development, the World Bank cautions that climate change could potentially diminish Malawi's GDP by 3 to 9 percent by 2030, 6 to 20 percent by 2040, and 8 to 16 percent by 2050.
### Agriculture and livestock
Drought and heavy rains pose challenges for Malawi, disrupting conventional farming practices and posing a threat to crop yields. As a response, farming families are implementing adaptive measures to address climate change, emphasizing the importance of resilience in the agriculture sector. Both droughts and floods have the potential to devastate crops and soil, which in turn jeopardizes farmers' harvests and agricultural sustainability. The rise in temperatures contributes to increased evapotranspiration and decreased soil moisture, having a detrimental impact on maize farming and food security. Climate change projections indicate that there will be changes in the suitability of crops, which will affect both staple and cash crops in Malawi. Moreover, Malawi is witnessing a rise in the frequency and intensity of climate-related events, further exacerbating the impact on the agriculture sector. Climate change results in a reduction in the availability of feed and forage, thereby impacting the nutritional resources for livestock. The Alterations in temperature and precipitation patterns give rise to water scarcity, thereby affecting the availability of water for livestock. The Escalating temperatures contribute to heat stress in livestock, thereby impacting their health and productivity. Climate change influences the prevalence of livestock diseases, thereby presenting additional challenges to animal health. In Malawi, climate change poses a significant threat to food security, necessitating farming families to adapt their production methods to mitigate the impacts of the changing climate.
## Mitigation and adaptations
In 2013, Malawi drafted a National Climate Change Policy intending to guide actions to reduce vulnerability to climate change for both humans and ecosystems. The policy focuses on adaptation and mitigation, technology transfer, and capacity building. In terms of mitigation, Malawi is committed to improving land use, implementing climate-smart agriculture, promoting renewable energy, utilizing the Clean Development Mechanism and voluntary carbon markets, as well as implementing REDD+.
1. "World Bank Climate Change Knowledge Portal". *climateknowledgeportal.worldbank.org*. Retrieved 2023-12-22.
2. "Malawi Climate Change Country Profile | Climate". *U.S. Agency for International Development*. 2023-11-28. Retrieved 2023-12-22.
3. "Greenhouse Gas Emissions Factsheet: Malawi". *www.climatelinks.org*. 2016-12-31. Retrieved 2023-12-22.
4. "Malawi". *UNDP Climate Promise*. Retrieved 2023-12-22.
5. "Malawi CO2 Emissions - Worldometer". *www.worldometers.info*. Retrieved 2023-12-22.
6. "MALAWI CLIMATE CHANGE FACT SHEET | Fact Sheet | Malawi | Archive - U.S. Agency for International Development". *2017-2020.usaid.gov*. 2016-09-26. Retrieved 2023-12-22.
7. Global Water, Partnerships; UNICEF (2022). "Malawi snapshot on water and climate" (PDF). *Global Water Parternships*.
8. "From climate risk to resilience: Unpacking the economic impacts of climate change in Malawi". *www.ifpri.org*. Retrieved 2023-12-22.
9. "From Climate Risk to Resilience: Unpacking the Economic Impacts of Climate Change in Malawi, November 2023 - Malawi | ReliefWeb". *reliefweb.int*. 2023-11-10. Retrieved 2023-12-22.
10. "Climate-Informed Economic Development Key to Malawi's Future Growth and Resilience". *World Bank*. Retrieved 2023-12-22.
11. "Feeding people and protecting forests: agriculture in a changing climate - Malawi | ReliefWeb". *reliefweb.int*. 2023-05-22. Retrieved 2023-12-22.
12. Kelly, Emma (2023-05-04). "Malawi: Fighting the ravages of climate change with smart agriculture". *Concern Worldwide*. Retrieved 2023-12-22.
13. Stevens, Tilele; Madani, Kaveh (2016-11-08). "Future climate impacts on maize farming and food security in Malawi". *Scientific Reports*. **6** (1): 36241. Bibcode:2016NatSR...636241S. doi:10.1038/srep36241. ISSN 2045-2322. PMC 5099946. PMID 27824092.
14. "What are the potential impacts of climate change on the agriculture sector in Malawi, and how can agribusinesses respond?". *iBAN*. Retrieved 2023-12-22.
15. Rahut, Dil Bahadur; Ali, Akhter (2018-10-01). "Impact of climate-change risk-coping strategies on livestock productivity and household welfare: empirical evidence from Pakistan". *Heliyon*. **4** (10): e00797. Bibcode:2018Heliy...400797R. doi:10.1016/j.heliyon.2018.e00797. ISSN 2405-8440. PMC 6197305. PMID 30364587.
|
1,416,728 |
https://en.wikipedia.org/wiki/Marlin_Camp_Carbine
|
Marlin Camp Carbine
|
The Marlin Camp Carbine is a self-loading carbine chambered for either 9mm Parabellum or .45 ACP, formerly manufactured by Marlin Firearms Company of North Haven, Connecticut. The carbine has been discontinued since 1999.
| 2023-04-15T12:25:47 |
# Marlin Camp Carbine
The **Marlin Camp Carbine** is a self-loading carbine chambered for either 9mm Parabellum or .45 ACP, formerly manufactured by Marlin Firearms Company of North Haven, Connecticut. The carbine has been discontinued since 1999.
## Description
As the name implies, it was designed as a utility firearm to be used around hunting camps for foraging or defense. It was made in 9mm Parabellum and .45 ACP calibers and can use the same magazines as popular handguns in those calibers, in keeping with a convenient American tradition of having a carbine and handgun using common ammunition. The carbine operates by direct blowback. Usually, the receiver is drilled and tapped for a scope mount. The stock was made of walnut-finished Maine birch.
The Camp Carbine uses a detachable magazine that inserts into the magazine well in front of the trigger guard. The Camp-45 rifle magazine is compatible with most Colt 1911-type magazines; and the Camp-9 rifle magazine can be replaced by magazines from 59-series S&W pistols. The Camp-9 magazine well is sized for 12-round magazines; magazines with higher capacities extend beyond the bottom of the well. A 20-round magazine was produced, but discontinued in 1989. Numerous aftermarket magazines and drums were produced for both models.
1. Fjestad, S.P. (2009). *Blue Book of Gun Values 2009*. Blue Book Publications. p. 798. ISBN 978-1-886768-87-1.
2. Warner, Ken (1999). *Gun Digest 2000, 54th Annual Edition*. Krause Publications. p. 306. ISBN 0-87341-752-6.
3. William S. Brophy. *Marlin Firearms: A History of the Guns and the Company That Made Them*. p. 319.
## InfoBox
| Marlin Camp Carbine | |
| --- | --- |
| Marlin Camp-45 | |
| Type | Hunting rifle |
| Place of origin | United States |
| Production history | |
| Manufacturer | Marlin Firearms Company |
| Produced | 1985–1999 |
| Variants | 9mm and .45 ACP Versions |
| Specifications | |
| Mass | 6¾ pounds |
| Length | 35½" |
| Barrel length | 16½" |
| --- | |
| Cartridge | .45 ACP<br>9mm Parabellum |
| Action | Direct blowback semi-automatic |
| Feed system | 4 or 7-round (Camp-45)<br>4, 12, or 20-round (Camp-9) Detachable pistol magazine |
| Sights | Fixed, drilled, and tapped for scope mounts |
|
31,076,361 |
https://en.wikipedia.org/wiki/Banuri,_Himachal_Pradesh
|
Banuri, Himachal Pradesh
|
Banuri (Palampur) is Ward No. 14 of MC Palampur which is situated in Dhauladhar Valley in Himachal Pradesh (India). It has around 4 km area and population around 3000. Banuri has many tea gardens. It has a small river (khad) named Oa at its one end. It is situated 4 km away from Palampur ISBT. Also near by is artists' colony Andretta, Himachal Pradesh.
| 2024-04-10T04:54:42 |
# Banuri, Himachal Pradesh
**Banuri (Palampur)** is Ward No. 14 of MC Palampur which is situated in Dhauladhar Valley in Himachal Pradesh (India). It has around 4 km area and population around 3000. Banuri has many tea gardens. It has a small river (khad) named Oa at its one end. It is situated 4 km away from Palampur ISBT. Also near by is artists' colony Andretta, Himachal Pradesh.
## Education
The literacy rate in Banuri is very high. It has four Senior Secondary schools:-
* Saheed Major Sudhir Walia Senior Secondary School.
* Jai Public School.
* Crescent Public School.
* Modern Public School.
* Sri Sai University, Palampur is situated 2 km away from here.
* Dr GC Negi College of Veterinary and Animal Sciences is situated 1 km away from here.
* CSIR-Institute of Himalayan Bioresource Technology is situated 1.5 km away from here.
* Aisect Computer Education Lower Banuri.
## Other Attractions
* Palampur Science centre
## InfoBox
| Banuri | |
| --- | --- |
| Suburb | |
| Banuri | |
| Coordinates: 32°06′00″N 76°33′18″E / 32.100°N 76.555°E / 32.100; 76.555 | |
| Country | India |
| State | Himachal Pradesh |
| District | Kangra |
| Time zone | UTC+5:30 (IST) |
| Pin Code | 176 061 |
|
28,913,754 |
https://en.wikipedia.org/wiki/Argentino_Channel
|
Argentino Channel
|
Argentino Channel, also known as Ferguson Channel, is a channel between Bryde Island and the west coast of Graham Land, connecting Paradise Harbor with Gerlache Strait. It was first roughly charted by the Belgian Antarctic Expedition, 1897–99; the name "Canal Argentino" appears on an Argentine government chart of 1950.
| 2021-01-29T22:54:36 |
# Argentino Channel
**Argentino Channel** (64°54′S 63°1′W / 64.900°S 63.017°W / -64.900; -63.017), also known as **Ferguson Channel**, is a channel between Bryde Island and the west coast of Graham Land, connecting Paradise Harbor with Gerlache Strait. It was first roughly charted by the Belgian Antarctic Expedition, 189799; the name "Canal Argentino" appears on an Argentine government chart of 1950.
* This article incorporates public domain material from "Argentino Channel". *Geographic Names Information System*. United States Geological Survey.
|
21,168,706 |
https://en.wikipedia.org/wiki/Mary_Knisely
|
Mary Knisely
|
Mary Knisely is a retired middle- and long-distance runner from the United States. She set her personal best (8:42.84) in the women's 3000-meter run on 13 July 1987 at a meet in Nice. Knisely is a two-time US national champion in the 3000 m, and was the marathon national champion in 2001. She competed as a student at Concord High School. In 2008, the Delaware Sports Hall of Fame inducted Knisely. She competed at the U.S. Olympic Trials three times, was a gold medalist in the 3000 meters at the 1987 Pan American Games, silver medalist in the IAAF World Cup 10,000 m, and was a member of the 1985 and 1987 gold medal winning U.S. teams at the IAAF World Cross Country Championships. She placed third in the 3000 m at the 1986 IAAF Grand Prix Final and second in the 5000 m at the 1987 IAAF Grand Prix Final. She holds personal records of: 2:02 min 4:05, 8:41, 15:12, 32:19, and 2:35:11 (marathon).
| 2024-02-27T21:32:55 |
# Mary Knisely
**Mary Knisely** (born **Schilly**; May 29, 1959) is a retired middle- and long-distance runner from the United States. She set her personal best (8:42.84) in the women's 3000-meter run on 13 July 1987 at a meet in Nice. Knisely is a two-time US national champion in the 3000 m (1986 and 1987), and was the marathon national champion in 2001. She competed as a student at Concord High School.
In 2008, the Delaware Sports Hall of Fame inducted Knisely.
She competed at the U.S. Olympic Trials three times, was a gold medalist in the 3000 meters at the 1987 Pan American Games, silver medalist in the IAAF World Cup 10,000 m, and was a member of the 1985 and 1987 gold medal winning U.S. teams at the IAAF World Cross Country Championships. She placed third in the 3000 m at the 1986 IAAF Grand Prix Final and second in the 5000 m at the 1987 IAAF Grand Prix Final.
She holds personal records of: 2:02 min (800 m) 4:05 (1500 m), 8:41 (3000 m), 15:12 (5000 m), 32:19 (10,000 m), and 2:35:11 (marathon).
|
12,532,713 |
https://en.wikipedia.org/wiki/McGuire_Programme
|
McGuire Programme
|
The McGuire Programme is a stammering or stuttering treatment programme/course run for people who stammer or stutter by people who stammer. There are no licensed speech therapists involved. It was founded in 1994 by American Dave McGuire in Holland.
| 2024-02-23T03:52:32 |
# McGuire Programme
The **McGuire Programme** is a stammering or stuttering treatment programme/course run for people who stammer or stutter (ages 14+) by people who stammer. There are no licensed speech therapists involved. It was founded in 1994 by American Dave McGuire in Holland.
## Notable Attendees
Scottish international rugby union captain, Kelly Brown, is a graduate of the course. Singer Gareth Gates attended the programme's workshops and subsequently qualified as a speech instructor himself. Stammering awareness activist Adam Black, also a graduate of the course, received a British Empire Medal in the 2019 New Year Honours list where his work raising awareness of stammering was recognised.
## InfoBox
McGuire Programme
| Founded | 1994 |
| --- | --- |
| Founder | Dave McGuire |
| Type | For-profit |
| Services | Membership-based courses |
|
35,058,184 |
https://en.wikipedia.org/wiki/Communal_dining
|
Communal dining
|
Communal dining is the practice of dining with others. The practice is centered on food and sharing time with the people who come together in order to share the meal and conversation. Communal dining can take place in public establishments like restaurants, college cafeterias, or in private establishments (home).
| 2024-04-17T12:39:07 |
# Communal dining
**Communal dining** is the practice of dining with others. The practice is centered on food and sharing time with the people who come together in order to share the meal and conversation. Communal dining can take place in public establishments like restaurants, college cafeterias, or in private establishments (home).
## History
Communal dining was an important part of ancient Rome's religious traditions.
There is a mention of communal dining in Chinese history.
|
12,174,331 |
https://en.wikipedia.org/wiki/Brahma_white-bellied_rat
|
Brahma white-bellied rat
|
The Brahma white-bellied rat is a species of rodent in the family Muridae. It is found in northeastern India, northern Myanmar, and southwestern China (Yunnan). It lives in various forest habitats at elevations of 2,000–2,800 m (6,600–9,200 ft) above sea level.
| 2023-02-28T10:45:46 |
# Brahma white-bellied rat
The **Brahma white-bellied rat** (***Niviventer brahma***) is a species of rodent in the family Muridae. It is found in northeastern India, northern Myanmar, and southwestern China (Yunnan). It lives in various forest habitats at elevations of 2,000–2,800 m (6,600–9,200 ft) above sea level.
## InfoBox
| Brahma white-bellied rat | |
| --- | --- |
| Conservation status | |
| <br>Least Concern (IUCN 3.1) | |
| Scientific classification | |
| Domain: | Eukaryota |
| Kingdom: | Animalia |
| Phylum: | Chordata |
| Class: | Mammalia |
| Order: | Rodentia |
| Family: | Muridae |
| Genus: | *Niviventer* |
| Species: | ***N. brahma*** |
| Binomial name | |
| ***Niviventer brahma***<br>(Thomas, 1914) | |
|
| | |
|
39,665,110 |
https://en.wikipedia.org/wiki/Berman_Jewish_Policy_Archive
|
Berman Jewish Policy Archive
|
The Berman Archive, housed at the Stanford University Graduate School of Education is a centralized electronic database of Jewish communal policy research. Its collection contains more than 20,000 documents, with holdings spanning from 1900 until today. It also is connected to the Jewish Survey Question Bank, a freely available repository of survey tools and questionnaires. The BJPA partners with the North American Jewish Data Bank; together they source the largest publicly available collection of Jewish policy research. The BJPA was established through the Mandell L. and Madeleine H. Berman Foundation, the Charles H. Revson Foundation, and continued with support from the Jim Joseph Foundation. The director and founder is Steven M. Cohen. The associate director is Ari Y. Kelman
| 2024-03-11T10:52:55 |
# Berman Jewish Policy Archive
The **Berman Archive** (previously the Berman Jewish Policy Archive), housed at the Stanford University Graduate School of Education is a centralized electronic database of Jewish communal policy research. Its collection contains more than 20,000 documents, with holdings spanning from 1900 until today. It also is connected to the Jewish Survey Question Bank, a freely available repository of survey tools and questionnaires. The BJPA partners with the North American Jewish Data Bank; together they source the largest publicly available collection of Jewish policy research. The BJPA was established through the Mandell L. and Madeleine H. Berman Foundation, the Charles H. Revson Foundation, and continued with support from the Jim Joseph Foundation.
The director and founder is Steven M. Cohen.
The associate director is Ari Y. Kelman
|
6,628,911 |
https://en.wikipedia.org/wiki/Mount_Quilmes
|
Mount Quilmes
|
Mount Quilmes is a mainly snow-covered mountain, standing northeast of Haddon Bay on Joinville Island. The name was given during the course of the Argentine Antarctic Expedition (1953–54) and commemorates the battle of the same name in which the Argentine squadron of Admiral Guillermo Brown was engaged.
| 2022-04-15T05:06:52 |
# Mount Quilmes
**Mount Quilmes** (715 m) (63°14′S 55°37′W / 63.233°S 55.617°W / -63.233; -55.617) is a mainly snow-covered mountain, standing northeast of Haddon Bay on Joinville Island. The name was given during the course of the Argentine Antarctic Expedition (1953–54) and commemorates the battle of the same name in which the Argentine squadron of Admiral Guillermo Brown was engaged.
West Antarctica
*
This article incorporates public domain material from "Mount Quilmes". *Geographic Names Information System*. United States Geological Survey.
|
42,507,255 |
https://en.wikipedia.org/wiki/Navayana_(publishing_house)
|
Navayana (publishing house)
|
Navayana is an independent anti-caste Indian publishing house based in New Delhi, strongly influenced by Ambedkarite ideas. It was founded by S. Anand and D. Ravikumar in 2003. The first book it published was Ambedkar: Autobiographical Notes priced at Rs 40. Since then it has published acclaimed fiction, non-fiction, graphic novels and poetry anthologies. From 2009 onwards, Navayana broadened its publishing outlook to include social issues other than caste because ‘the struggle against caste cannot happen in isolation from other struggles for justice and equality’ as a statement on the website reads. In Pali, the word "navayana" means "new vehicle". B. R. Ambedkar used the word in 1956 to describe the branch of Buddhism that wouldn't be mired in the Hinayana-Mahayana divide, but would help dalits gain equality in India.
| 2024-04-07T20:27:53 |
# Navayana (publishing house)
**Navayana** is an independent anti-caste Indian publishing house based in New Delhi, strongly influenced by Ambedkarite ideas. It was founded by S. Anand and D. Ravikumar in 2003. The first book it published was *Ambedkar: Autobiographical Notes* priced at Rs 40 (about $1 at that time). Since then it has published acclaimed fiction, non-fiction, graphic novels and poetry anthologies. From 2009 onwards, Navayana broadened its publishing outlook to include social issues other than caste because ‘the struggle against caste cannot happen in isolation from other struggles for justice and equality’ as a statement on the website reads.
In Pali, the word "navayana" means "new vehicle". B. R. Ambedkar used the word in 1956 to describe the branch of Buddhism that wouldn't be mired in the Hinayana-Mahayana divide, but would help dalits gain equality in India.
The logo of the publishing house is an ink sketch of two buffaloes kissing. The publisher S. Anand explains that the iconography comes from an excerpt from Aravind Malagatti’s autobiography in Kannada, *Government Brahmana*. It is a story about how the ideology of caste does not allow a dalit-owned she-buffalo in heat to mate with a he-buffalo owned by a landlord. For the cover art of the April 2003 issue of The Dalit, a journal run by the Dalit Media Network, Chennai, Anand approached the artist Chandru (G. Chandrasekaran) with this story. The logo is a close-up of the artist’s interpretation.
## Founders
### S. Anand
Anand has worked as a journalist with *Deccan Chronicle*, *Indian Express*, *The Hindu* and *Outlook*. At the time of the launch of Navayana, he was working for *Outlook* in Chennai. In 2007, he left his day job as a journalist and turned full-time to publishing. Today, he is the publisher of Navayana Publishing Pvt Ltd based in New Delhi.
### D. Ravikumar
Ravikumar is an activist in the civil rights movement in Tamil Nadu. At the time of the launch of Navayana, he was a bank employee. In 2006, he turned full-time to politics and became a member of the Viduthalai Chiruthaigal Katchi, and was elected to the Tamil Nadu Legislative Assembly.
## Annual lectures
Navayana hosted its first annual lecture where the Slovenian Marxist philosopher, Slavoj Žižek, spoke in New Delhi, Kochi and Hyderabad to packed audiences.
### 2011
The American feminist thinker and former Black Panther, Angela Yvonne Davis, delivered lectures in New Delhi and Pune.
### 2015
The aboriginal writer from Australia, Ali Cobby Eckermann, delivered the lectures in New Delhi and in Kolkata.
## Controversies
After the release of "The Doctor and The Saint" by Navayana, several anti-caste activists rejected her introduction to the book. They argued that Arundhati Roy had misrepresented Ambedkar's views on eugenics, tribal issues, capitalism, among other issues, for marketing purposes. At the time, Dalit Camera released interviews on their YouTube channel and an open letter to Arundhati Roy, clarifying rumours that threats from Dalit activists had been the reason for the stalling of a book launch in Hyderabad. In the letter, they make it clear that activists had only been prepared with several questions for Roy, and also attach the list of questions for her. Both the letter by Dalit Camera and Roy's response have been published in Hatred in the Belly.
In 2014, Ambedkar Age Collective (published by The Shared Mirror publishing house) released the book Hatred In The Belly critiquing the introduction to "The Doctor and the Saint" by Arundhati Roy. The title of the book is from a Telugu phrase that the poet Joopaku Subhadra uses in his essay, *"Ka dapulo kasi*". In this collection of essays & speeches by various Dalit activists and scholars, the authors write a scathing critique of how the introduction does not do justice to the seminal book that is Annihilation of Caste. Ambedkar Age Collective writes about the book that it will "unfurl before you a critical tapestry dissecting the hegemonic brahminic discourse which works towards delegitimizing the radical legacy of Ambedkarite thought". The larger criticism against the book and Navayana was that they did not consult experts of anti-caste narratives in writing the introduction to Annihilation of Caste, and questioned Roy's claim to expertise on the matter. The various authors included in the book are: Bojja Tharakam, Adv. Dr. Suresh Mane, Anoop Kumar, U. Sambashiva Rao, Sunny Kapicadu, K. K. Baburaj, Joopaka Subhadra, Dr. K. Satyanarayana, Anu Ramdas, Kuffir, Gurinder Azad, Shakyamuni, Dr. Sangeeta Pawar, Dr. O. K. Santhosh, Dr. B. Ravichandran, Dalit Camera: Through Un-Touchable Eyes, Karthik Navayan, Vaibhav Wasnik, Nilesh Kumar, Asha Kowtal, Nidhin Shobhana, Gee Imaan Semmalar, Syam Sundar, Murali Shanmugavelan, Praveena Thaali, Dr Karthick RM, Huma Dar, Joby Mathew, James Michael, Akshay Pathak, Vinay Bhat, Yogesh Maitreya, Thongam Bipin, Sruthi Herbert, Gaurav Somwanshi, Kadhiravan, Rahul Gaikwad, Joe D'Cruz.
## Awards
The founder of Navayana, S. Anand, won the International Young Publishing Entrepreneur Award in 2007.
## InfoBox
Navayana
| | |
| --- | --- |
| Founded | 2003 |
| Founder | S. Anand |
| Country of origin | India |
| Official website | navayana.org |
|
25,129,387 |
https://en.wikipedia.org/wiki/Navia_brachyphylla
|
Navia brachyphylla
|
Navia brachyphylla is a species of plant in the genus Navia. This species is endemic to Venezuela.
| 2021-04-24T21:14:46 |
# Navia brachyphylla
***Navia brachyphylla*** is a species of plant in the genus *Navia*. This species is endemic to Venezuela.
* Holst, Bruce K. (1 February 1994). "Checklist of Venezuelan Bromeliaceae with Notes on Species Distribution by State and Levels of Endemism". *Selbyana*. **15** (1). ISSN 2689-0682. JSTOR 41759858.
## InfoBox
| *Navia brachyphylla* | |
| --- | --- |
|
| Scientific classification | |
| Kingdom: | Plantae |
| *Clade*: | Tracheophytes |
| *Clade*: | Angiosperms |
| *Clade*: | Monocots |
| *Clade*: | Commelinids |
| Order: | Poales |
| Family: | Bromeliaceae |
| Genus: | *Navia* |
| Species: | ***N. brachyphylla*** |
| Binomial name | |
| ***Navia brachyphylla***<br>L.B.Sm. | |
|
|
7,022,360 |
https://en.wikipedia.org/wiki/Nelson_Wesley_Trout
|
Nelson Wesley Trout
|
Nelson Wesley Trout (1921–1996) was the first African-American bishop in the Evangelical Lutheran Church in America. Trout was born in Columbus, Ohio, USA. Trout was elected bishop of the South Pacific District of the American Lutheran Church (ALC) in 1983, a position he served through 1987. At the time of his election he was a professor and director of minority studies at Trinity Lutheran Seminary, Columbus, Ohio. Trout was renowned as a moving and powerful preacher throughout the church. During his earlier career, he served pastorates in Alabama, California and Wisconsin, and as Executive Director of Lutheran Social Services, Dayton, Ohio. On two occasions he served the ALC in executive capacities: as Associate Youth Director (1962–67) and Director of Urban Evangelism (1968–70). Trout died in 1996 at the age of 76. He is commemorated in the Calendar of Saints of the Evangelical Lutheran Church in America on September 20.
| 2023-09-16T01:34:02 |
# Nelson Wesley Trout
**Nelson Wesley Trout** (1921–1996) was the first African-American bishop in the Evangelical Lutheran Church in America. Trout was born in Columbus, Ohio, USA.
Trout was elected bishop of the South Pacific District of the American Lutheran Church (ALC) in 1983, a position he served through 1987. At the time of his election he was a professor and director of minority studies at Trinity Lutheran Seminary, Columbus, Ohio.
Trout was renowned as a moving and powerful preacher throughout the church. During his earlier career, he served pastorates in Alabama (where he became a friend and colleague of Martin Luther King Jr.), California and Wisconsin, and as Executive Director of Lutheran Social Services, Dayton, Ohio. On two occasions he served the ALC in executive capacities: as Associate Youth Director (1962–67) and Director of Urban Evangelism (1968–70).
Trout died in 1996 at the age of 76. He is commemorated in the Calendar of Saints of the Evangelical Lutheran Church in America on September 20.
|
26,254,379 |
https://en.wikipedia.org/wiki/Gifted_At-Risk
|
Gifted At-Risk
|
Gifted students are outstanding learners who are not usually considered at risk of academic failure or problems. However, gifted students can still underachieve. There are risks related to the student's giftedness. This concept was formally set forth in 1972 in the U.S. in the Marland Report:
| 2024-02-19T15:04:42 |
# Gifted At-Risk
Gifted students are outstanding learners who are not usually considered at risk of academic failure or problems. However, gifted students can still underachieve. There are risks related to the student's giftedness. This concept was formally set forth in 1972 in the U.S. in the Marland Report:
> Gifted and talented children are, in fact, deprived and can suffer psychological damage and permanent impairment of their abilities to function well which is equal to or greater than the similar deprivation suffered by any other population with special needs served by the Office of Education.
## Specific risks
However, the following risks are listed in *The Social and Emotional Development of Gifted Children*:
* frustration, irritability, anxiety, tedium, and social isolation
* intense social isolation and stress among those with IQ greater than 160
* difficulty making friends due to advanced concept of friendship, mostly among those less than age 10
* de-motivation, low self-esteem, and social rejection among the exceptionally gifted
* emotional awareness beyond their ability to control
* difficulty with peer relations proportional to their IQ
* loneliness, anxieties, phobias, interpersonal problems, fear of failure, and perfectionism
* underachievement for social acceptance
* lack of resilience reinforced by easy work and well-intentioned but misguided praise
* increasing perfectionism throughout school years among girls
* fear of failure and risk avoidance due to perfectionism
* depression among creatively gifted
There is a cause-and-effect relationship between the unmet learning needs of gifted students and the above risks. "Research indicates that many of the emotional and social difficulties gifted students experience disappear when their educational climates are adapted to their level and pace of learning."
Linda Kreger Silverman enumerates these additional risks:
* refusal to do routine, repetitive assignments
* inappropriate criticism of others
* lack of awareness of impact on others
* difficulty accepting criticism
* hiding talents to fit in with peers
* nonconformity and resistance to authority
* poor study habits
Further, there exists anecdotal evidence of truancy problems with gifted children, who sometimes miss school because of disengagement, and worse, fear of bullying. In 1999, legislation was introduced in Colorado to recognize gifted students as at-risk, with truancy as a factor, but the bill did not become law.
Lastly, meta-analysis from the paper "Gifted Students Who Drop Out—Who and Why: A Meta-Analytical Review of the Literature" shows two key points. First, 4.5% of high school dropouts are gifted, and they leave school in part because of school-related issues. One would expect a very few gifted children to drop out, given the ease with which they can excel in school. According to the *Achievement Trap*, this problem is even more pronounced among economically disadvantaged children.
### Notes
### Sources
* Neihart, Maureen; Reis, Sally M.; Robinson, Nancy M.; Moon, Sidney M., eds. (2002). *The Social and Emotional Development of Gifted Children: What Do We Know?*. National Association of Gifted Children (Prufrock Press). ISBN 9781882664771.
## Further reading
* Davidson, Jan; Davidson, Bob (2004). *Genius Denied: How to Stop Wasting Our Brightest Young Minds*. with Vanderkam, Laura. New York: Simon and Schuster. ISBN 9780743254601.
* Neihart, Maureen; Reis, Sally M.; Robinson, Nancy M.; Moon, Sidney M., eds. (2002). *The Social and Emotional Development of Gifted Children: What Do We Know?*. National Association of Gifted Children (Prufrock Press). ISBN 9781882664771.
* Silverman, Linda Kreger (1993). *Counseling the Gifted and Talented*. Denver: Love Publishing. ISBN 9780891082736.
|
12,463,375 |
https://en.wikipedia.org/wiki/Bougainville_monarch
|
Bougainville monarch
|
The Bougainville monarch is a species of bird in the family Monarchidae. It is endemic to Solomon Islands.
Its natural habitats are subtropical or tropical moist lowland forests and subtropical or tropical moist montane forests.
| 2023-12-15T17:07:26 |
# Bougainville monarch
The **Bougainville monarch** (***Monarcha erythrostictus***) is a species of bird in the family Monarchidae. It is endemic to Solomon Islands. Its natural habitats are subtropical or tropical moist lowland forests and subtropical or tropical moist montane forests.
## Taxonomy and systematics
The Bougainville monarch was originally described in the genus *Pomarea* and some authorities have classified it as a subspecies of the chestnut-bellied monarch.
## InfoBox
| Bougainville monarch | |
| --- | --- |
| | |
| Conservation status | |
| <br>Least Concern (IUCN 3.1) | |
| Scientific classification | |
| Domain: | Eukaryota |
| Kingdom: | Animalia |
| Phylum: | Chordata |
| Class: | Aves |
| Order: | Passeriformes |
| Family: | Monarchidae |
| Genus: | *Monarcha* |
| Species: | ***M. erythrostictus*** |
| Binomial name | |
| ***Monarcha erythrostictus***<br>(Sharpe, 1888) | |
|
| Synonyms | |
| * *Monarcha castaneiventris erythrostictus* * *Monarcha erythrosticta* * *Pomarea erythrosticta* | |
|
29,323,575 |
https://en.wikipedia.org/wiki/Bradley_Smith_(cricketer)
|
Bradley Smith (cricketer)
|
Bradley Smith is a former English cricketer. Smith was a right-handed batsman who bowled right-arm medium pace. He was born at Margate, Kent. Smith represented the Sussex Cricket Board in a single List A match against Hertfordshire in the 1999 NatWest Trophy. In his only List A match, he scored 16 runs and took a single catch in the field.
| 2023-05-24T04:12:39 |
# Bradley Smith (cricketer)
**Bradley Smith** (born 28 September 1969) is a former English cricketer. Smith was a right-handed batsman who bowled right-arm medium pace. He was born at Margate, Kent.
Smith represented the Sussex Cricket Board in a single List A match against Hertfordshire in the 1999 NatWest Trophy. In his only List A match, he scored 16 runs and took a single catch in the field.
## InfoBox
Bradley Smith
| Personal information | |
| --- | --- |
| Full name | Bradley Smith |
| Born | (1969-09-28) 28 September 1969<br>Margate, Kent, England |
| Batting | Right-handed |
| Bowling | Right-arm medium |
| Domestic team information | |
| Years | Team |
| 1999 | Sussex Cricket Board |
| | |
| Career statistics | |
| Competition LA Matches 1 Runs scored 16 Batting average 16.00 100s/50s / Top score 16 Balls bowled Wickets Bowling average 5 wickets in innings 10 wickets in match Best bowling Catches/stumpings 1/ | |
| | |
| Source: Cricinfo, 23 October 2010 | |
|
19,818,999 |
https://en.wikipedia.org/wiki/Heitor_TP_(album)
|
Heitor TP (album)
|
Heitor TP is the first long play studio solo album by the Brazilian musician Heitor Pereira, released in 1987.
| 2023-06-04T16:28:14 |
# Heitor TP (album)
***Heitor TP*** is the first long play studio solo album by the Brazilian musician Heitor Pereira, released in 1987.
## Track listing
1. Descaso
2. Assim Vejo Muito Mais
3. Sonho Blues...
4. Futuro?
5. Ballet
6. Sua História
7. Panô
8. Cidade Nua
9. Loura
10. CTI
## InfoBox
| Heitor TP | |
| --- | --- |
| Mónica Iturbe (Cover & Back Cover) | |
| Studio album by Heitor Pereira | |
| Released | 1987 |
| Recorded | 1986 |
| Genre | Instrumental hybrid music |
| Label | EMI |
| Producer | Mayrton Bahia |
| Heitor Pereira chronology | |
| ***Heitor TP***<br>(1987) *Heitor*<br>(1994) | |
|
30,087,943 |
https://en.wikipedia.org/wiki/Retizhe_Cove
|
Retizhe Cove
|
Retizhe Cove is the 5.8 km wide cove indenting for 6.2 km on the south coast of Trinity Peninsula in Graham Land, Antarctica. Part of Duse Bay, entered between Boil Point to the west and Garvan Point to the east. The cove is named after the Retizhe River in Pirin Mountain, Southwestern Bulgaria.
| 2020-06-09T23:38:33 |
# Retizhe Cove
**Retizhe Cove** (Bulgarian: залив Ретиже, ‘Zaliv Retizhe’ \\'za-liv re-ti-'zhe\\) is the 5.8 km wide cove indenting for 6.2 km on the south coast of Trinity Peninsula in Graham Land, Antarctica. Part of Duse Bay, entered between Boil Point to the west and Garvan Point to the east.
The cove is named after the Retizhe River in Pirin Mountain, Southwestern Bulgaria.
## Location
Retizhe Cove is centred at 63°28′10″S 57°25′30″W / 63.46944°S 57.42500°W / -63.46944; -57.42500. German-British mapping in 1996.
## Maps
* Trinity Peninsula. Scale 1:250000 topographic map No. 5697. Institut für Angewandte Geodäsie and British Antarctic Survey, 1996.
* Antarctic Digital Database (ADD). Scale 1:250000 topographic map of Antarctica. Scientific Committee on Antarctic Research (SCAR). Since 1993, regularly updated.
*This article includes information from the Antarctic Place-names Commission of Bulgaria which is used with permission.*
|
67,210,011 |
https://en.wikipedia.org/wiki/Fortress_Division_Warsaw
|
Fortress Division Warsaw
|
The Fortress Division Warsaw was a fortress division of the Army Group A of the German Wehrmacht in World War II. Ordered formed on 12 January 1945, the Fortress Division Warsaw was formed in Warsaw by converting a number of various units into the division. The division was destroyed in the fighting for the capture of Warsaw by the Soviets, its remains being either captured or fleeing back into Germany.
| 2023-09-29T18:45:38 |
# Fortress Division Warsaw
The **Fortress Division Warsaw** (German: *Festung-Division “Warschau”*) was a fortress division of the Army Group A of the German Wehrmacht in World War II.
Ordered formed on 12 January 1945, the Fortress Division Warsaw was formed in Warsaw by converting a number of various units into the division. The division was destroyed in the fighting for the capture of Warsaw by the Soviets, its remains being either captured or fleeing back into Germany.
## Divisional history
The division was set up in early January 1945 in the Polish capital Warsaw to defend the same against the Red Army as part of the strategy of permanent positions.
The dissolving division, subordinate to the 9th Army, was initially probably enclosed in Warsaw (on January 16, the defense consisted of only four battalions of the fortress division). and later, after the city was captured, on January 18, 1945, almost completely destroyed by the Red Army. Then the remnants of the Fortress Division Warsaw united with the 73rd Infantry Division to strengthen the defense of Festung Thorn. Previously, the commander of the 9th Army, *General der Panzertruppe* Smilo von Lüttwitz, had given up the defense of the city without a higher order, which dissolved the cohesion of the troops. *Generalleutnant* Friedrich Weber, the commander of the fortress division, was then transferred to the Führerreserve, sentenced to parole at the front and no longer received a military command.
The division was officially disbanded on February 27, 1945.
## Commander
*Generalleutnant* Friedrich Weber (January 1945).
## Organization
* Festungs-Regiment 8
+ 1. Bataillon (formerly Festungs-Infanterie-Bataillon 1401)
+ 2. / 3. Bataillon
+ 4. Bataillon (formerly Festungs-MG-Bataillon 24)
+ Panzerjäger-Kompanie 17
* Festungs-Regiment 88
+ 1. Bataillon (formerly Landesschützen-Bataillon 238)
+ 2. Bataillon (formerly Landeswehr-Bataillon Weckerle)
+ 3. Bataillon
+ 4. Bataillon (formerly Festungs-MG-Bataillon 25)
+ Panzerjäger-Kompanie 16
* Festungs-Regiment 183
+ 1. / 2. / 3. / 4. Bataillon
* Festungs-Artillerie-Regiment 1320
+ Festungs-Granatwerfer-Bataillon 22
+ Festungs-Granatwerfer-Bataillon 23
* Festungs-Pionier-Bataillon 67
* Nachrichtentruppe 1320
* Nachschubtruppen 1320
## Bibliography
* Hans Jürgen Pantenius: *Letzte Schlacht an der Ostfront: von Döberitz bis Danzig 1944/1945 : Erinnerung und Erfahrung eines jungen Regimentskommandeurs*. Mittler E.S. + Sohn GmbH, 2002, pg. 101.
* Mitcham, Samuel W., Jr. (2007). German Order of Battle. Volume Two: 291st – 999th Infantry Divisions, Named Infantry Divisions, and Special Divisions in WWII. PA; United States of America: Stackpole Books. pg. 235, ISBN 978-0-8117-3437-0.
## InfoBox
| Fortress Division Warsaw | |
| --- | --- |
| Active | January 1945 |
| Country | Nazi Germany |
| Branch | Army |
| Type | Infantry |
| Size | Division |
| Garrison/HQ | Warsaw |
| Engagements | World War II |
| Commanders | |
| Notable<br>commanders | Friedrich Weber |
|
43,519,338 |
https://en.wikipedia.org/wiki/Club_Social_y_Deportivo_Jalisco
|
Club Social y Deportivo Jalisco
|
The Club Social y Deportivo Jalisco was a former Mexican football team who played in the Primera Division Mexicana and Second Division Mexicana. The team played its games in the city of Guadalajara, Jalisco.
| 2020-07-24T16:07:47 |
# Club Social y Deportivo Jalisco
The **Club Social y Deportivo Jalisco** was a former Mexican football team who played in the Primera Division Mexicana and Second Division Mexicana. The team played its games in the city of Guadalajara, Jalisco.
## History
The team is founded in 1970, after Oro had economic problems, at the end of the season **Mexico 70**. Sugar entrepreneurs decided to buy the franchise and turned it into Club Social y Deportivo Jalisco.
The club played since its inception in Primera Division Mexicana for 10 years, since the 1970-71 season until its descent to Segunda Division Mexicana in the 1979-80 season.
In their debut season in 1970-71 they ended second place just 5 points below Toluca, who impeded them to reach the final against América. In 1971-72 season they ended 9 points away from qualifying to the playoffs, and in 1972-73 a 6th place in their group began to reflect a sluggish performance of the players. From the 1973-74 season to 1975-76 season they were unable to pass mid-table and occupied the last positions on several occasions.
For the 1976-77 season they came up short by 7 points from reaching the playoffs. Similarly in the 1977-78 season they were short by 4 points of Tigres UANL who eventually become champions. In 1978-79 and 1979–80, their last two seasons, they ranked last in their group, which made them have to contest a relegation playoffs with the Unión de Curtidores. They lost by an aggregate score of 4-3 and the team was relegated to Segunda Division Mexicana.
In 1984 Club Social y Deportivo Jalisco made it to the final for promotion to the Primera Division Mexicana against Zacatepec, however lost 3-1 on aggregate. They would never reach another final in order to return to first division.
In 2008, the team resurges with the original name in order to participate in Liga de Talentos de la Segunda División.
## Stadium
Club Social y Deportivo Jalisco always played in Estadio Jalisco, which belongs to the civil Clubs States of Jalisco with 25% of the shares, which were inherited with the purchase of the Oro , act that made them legal partner and part owner of the Estadio Jalisco.
## InfoBox
Club Jalisco
| Full name | Club Social y Deportivo Jalisco, A.C. |
| --- | --- |
| Nickname(s) | *Azucareros, Gallos, Arlequines* |
| Founded | 1970 |
| Ground | Estadio Jalisco<br>Guadalajara, México |
| Capacity | 56,713 |
| Chairman | Rodolfo Arias Covarrubias |
| League | Segunda División de México |
| | |
| | |
| | |
|
65,815,180 |
https://en.wikipedia.org/wiki/1995_NCAA_Division_I_Men%27s_Golf_Championship
|
1995 NCAA Division I Men's Golf Championship
|
The 1995 NCAA Division I Men's Golf Championships were contested at the 56th annual NCAA-sanctioned golf tournament for determining the individual and team national champions of men's collegiate golf at the Division I level in the United States. The tournament was held at the Ohio State University Golf Club in Columbus, Ohio. Oklahoma State won the team championship, the Cowboys' eighth NCAA title and first since 1991. Oklahoma State defeated defending champions Stanford in a play-off after the two teams finished tied atop the team standings (1,156–1,156). Chip Spratlin, from Auburn, won the individual title.
| 2024-03-06T19:06:50 |
# 1995 NCAA Division I Men's Golf Championship
The **1995 NCAA Division I Men's Golf Championships** were contested at the 56th annual NCAA-sanctioned golf tournament for determining the individual and team national champions of men's collegiate golf at the Division I level in the United States.
The tournament was held at the Ohio State University Golf Club in Columbus, Ohio.
Oklahoma State won the team championship, the Cowboys' eighth NCAA title and first since 1991. Oklahoma State defeated defending champions Stanford in a play-off after the two teams finished tied atop the team standings (1,156–1,156).
Chip Spratlin, from Auburn, won the individual title.
## Individual results
### Individual champion
## Team results
### Finalists
| Rank | Team | Score |
| --- | --- | --- |
| 1 | **Oklahoma State** | **1,156** |
| 2 | Stanford (DC) | 1,156 |
| 3 | Texas | 1,157 |
| 4 | Arizona State | 1,164 |
| 5 | USC | 1,165 |
| 6 | California | 1,166 |
| 7 | Florida State | 1,168 |
| T8 | NC State | 1,170 |
| | Ohio State | |
| 10 | Arizona | 1,171 |
| 11 | Tulsa | 1,176 |
| 12 | New Mexico | 1,182 |
| 13 | Florida | 1,184 |
| 14 | Houston | 1,186 |
| 15 | UNLV | 1,187 |
### Eliminated after 36 holes
| Rank | Team | Score |
| --- | --- | --- |
| T16 | Auburn | 592 |
| | Kansas | |
| | Tennessee | |
| 19 | North Carolina | 593 |
| 20 | Clemson | 594 |
| 21 | TCU | 595 |
| T22 | Oklahoma | 596 |
| | Wake Forest | |
| 24 | Augusta State | 598 |
| 25 | East Tennessee State | 599 |
| 26 | Iowa | 600 |
| 27 | Kent State | 603 |
| 28 | New Mexico State | 605 |
| 29 | Georgia Tech | 606 |
| 30 | UTEP | 608 |
* DC = Defending champions
* *Debut appearance*
## InfoBox
1995 NCAA Division I Men's Golf Championship
| Tournament information | |
| --- | --- |
| Location | Columbus, Ohio, U.S.<br>40°01′55″N 83°03′08″W / 40.031886°N 83.0523498°W / 40.031886; -83.0523498 |
| Course(s) | Ohio State University Golf Club |
| Statistics | |
| Field | 30 teams |
| Champion | |
| **Team:** Oklahoma State (8th title)<br>**Individual:** Chip Spratlin, Auburn | |
| **Team:** 1,156<br>**Individual:** 283 | |
| Location map | |
| OSU Golf ClubLocation in the United StatesOSU Golf ClubLocation in Ohio | |
| | |
|
54,022,377 |
https://en.wikipedia.org/wiki/2002_NCAA_Division_I_Women%27s_Tennis_Championships
|
2002 NCAA Division I Women's Tennis Championships
|
The 2002 NCAA Division I Women's Tennis Championships were the 21st annual championships to determine the national champions of NCAA Division I women's singles, doubles, and team collegiate tennis in the United States. Defending champions and hosts Stanford defeated Florida in the team final, 4–1, to claim their twelfth national title.
| 2023-06-02T23:32:29 |
# 2002 NCAA Division I Women's Tennis Championships
The **2002 NCAA Division I Women's Tennis Championships** were the 21st annual championships to determine the national champions of NCAA Division I women's singles, doubles, and team collegiate tennis in the United States.
Defending champions and hosts Stanford defeated Florida in the team final, 4–1, to claim their twelfth national title (and fourth in six years).
## Host
This year's tournaments were hosted by Stanford University at the Taube Tennis Center in Stanford, California.
The men's and women's NCAA tennis championships would not be held jointly until 2006.
* NCAA Division II Tennis Championships (Men, Women)
* NCAA Division III Tennis Championships (Men, Women)
## InfoBox
| 2002 NCAA Division I Women's Tennis Championships | |
| --- | --- |
| | |
| Date | May 2002 |
| Edition | 21st |
| Location | Stanford, California |
| Venue | Taube Tennis Center<br>Stanford University |
| Champions | |
| Women's singles | |
| Bea Bielik<br>(Wake Forest) | |
| Women's doubles | |
| Lauren Kalvaria / Gabriela Lastra<br>(Stanford) | |
| | |
|
63,227,323 |
https://en.wikipedia.org/wiki/2016_Iranian_Assembly_of_Experts_election_in_Tehran_Province
|
2016 Iranian Assembly of Experts election in Tehran Province
|
This is an overview of the 2016 Iranian Assembly of Experts election in Tehran Province. The voter turnout was 53.11% in the constituency.
| 2022-01-31T23:37:24 |
# 2016 Iranian Assembly of Experts election in Tehran Province
This is an overview of the 2016 Iranian Assembly of Experts election in Tehran Province.
The voter turnout was 53.11% in the constituency.
## Results
| # | Candidate | Lists | | | | Votes | % | Notes |
| --- | --- | --- | --- | --- | --- | --- | --- | --- |
| | | PE | FM | CCA | SST | | | |
| 1 | Akbar Hashemi Rafsanjani | | | | | 2,305,419 | 51.22 | Elected |
| 2 | Mohammed Emami-Kashani | | | | | 2,286,447 | 50.80 | |
| 3 | Hassan Rouhani | | | | | 2,243,687 | 49.85 | |
| 4 | Mohsen Qomi | | | | | 2,236,953 | 49.70 | |
| 5 | Mohammad-Ali Movahedi-Kermani | | | | | 2,134,963 | 47.43 | |
| 6 | Ghorbanali Dorri-Najafabadi | | | | | 2,059,246 | 45.75 | |
| 7 | Mohammad Reyshahri | | | | | 1,976,567 | 43.91 | |
| 8 | Abolfazl Mir-Mohammadi | | | | | 1,973,842 | 43.85 | |
| 9 | Ebrahim Amini | | | | | 1,907,332 | 42.38 | |
| 10 | Mahmoud Alavi | | | | | 1,712,970 | 38.06 | |
| 11 | Nasrallah Shah-Abadi | | | | | 1,449,313 | 32.20 | |
| 12 | Mohammad-Ali Taskhiri | | | | | 1,449,083 | 32.20 | |
| 13 | Mohsen Esmaeili | | | | | 1,424,375 | 31.65 | |
| 14 | Mohammad-Hassan Zali | | | | | 1,360,379 | 30.22 | |
| 15 | Hashem Bathaie Golpayegani | | | | | 1,331,056 | 29.57 | |
| 16 | Ahmad Jannati | | | | | 1,329,625 | 29.54 | |
| | | | | | | | | |
| 17 | Mohammad Yazdi | | | | | 1,250,082 | 27.77 | Defeated |
| 18 | Mohammad Sajjadi Ata-Abadi | | | | | 1,221,694 | 27.14 | |
| 19 | Mohammad-Taqi Mesbah-Yazdi | | | | | 1,020,605 | 22.68 | |
| 20 | Mohammad-Bagher Bagheri | | | | | 982,140 | 21.82 | |
| 21 | Ali Momenpour | | | | | 970,961 | 21.57 | |
| 22 | Gholamreza Mesbahi-Moghadam | | | | | 949,226 | 21.09 | |
| 23 | Alireza Arafi | | | | | 925,727 | 20.57 | |
| 24 | Abbas-Ali Akhtari | | | | | 911,289 | 20.25 | |
| 25 | Mohammad Reza Modarresi-Yazdi | | | | | 864,077 | 19.20 | |
| 26 | Mohammad-Ali Amin | | | | | 337,522 | 7.50 | |
| 27 | Hashem Hamidi | | | | | 223,260 | 4.96 | |
| 28 | Hamed Taheri | | | | | 136,678 | 3.04 | |
| | | | | | | | | |
| *Blank or Invalid Votes* | | | | | | 322,370 | 7.16 |
| Total Votes | | | | | | 4,500,894 | 100.0 |
| Sources: Official Results, Lists: PE FM CCA SST, Blank/invalid votes: BBC | | | | | | | | |
## Notes and references
## InfoBox
2016 Assembly of Experts election
| --- | |
| --- | --- |
| | |
| Turnout | 53.11% |
| Majority party Minority party Third party Leader Akbar Hashemi Rafsanjani Mohammad-Ali Movahedi-Kermani Mohammad Yazdi Party People's Experts Combatant Clergy Association Society of Seminary Teachers Leader's seat 1st 5th *Defeated* Seats won 15 / 16 11 / 16 9 / 16 | |
|
62,048,274 |
https://en.wikipedia.org/wiki/2019%E2%80%9320_Liga_IV_Prahova
|
2019–20 Liga IV Prahova
|
The 2019–20 Liga IV Prahova, commonly known as Liga A Prahova, was the 52nd season of the Liga IV Prahova, the fourth tier of the Romanian football league system. The season began on 17 August 2019 and was scheduled to end in June 2020, but was suspended in March because of the COVID-19 pandemic in Romania. Plopeni crowned as county champion.
| 2021-12-07T12:22:43 |
# 2019–20 Liga IV Prahova
The **2019–20 Liga IV Prahova**, commonly known as **Liga A Prahova**, was the 52nd season of the Liga IV Prahova, the fourth tier of the Romanian football league system. The season began on 17 August 2019 and was scheduled to end in June 2020, but was suspended in March because of the COVID-19 pandemic in Romania. Plopeni crowned as county champion.
## Team changes
### Other changes
## League table
| Pos | Team | Pld | W | D | L | GF | GA | GD | Pts | Qualification or relegation |
| --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- |
| 1 | Plopeni (C, Q) | 16 | 13 | 3 | 0 | 58 | 15 | +43 | 42 | Qualification to promotion play-off |
| 2 | Tricolorul Breaza | 16 | 13 | 0 | 3 | 40 | 22 | +18 | 39 | |
| 3 | Petrolistul Boldești | 16 | 12 | 2 | 2 | 48 | 11 | +37 | | 38 |
| 4 | Bănești-Urleta | 16 | 11 | 2 | 3 | 52 | 27 | +25 | | 35 |
| 5 | Petrolul '95 Ploiești | 16 | 10 | 1 | 5 | 43 | 26 | +17 | | 31 |
| 6 | Teleajenul Vălenii de Munte | 16 | 9 | 3 | 4 | 36 | 20 | +16 | | 30 |
| 7 | Cornu | 16 | 7 | 5 | 4 | 38 | 27 | +11 | | 26 |
| 8 | Păulești | 16 | 8 | 2 | 6 | 28 | 19 | +9 | | 26 |
| 9 | Brazi Negoiești | 16 | 7 | 0 | 9 | 23 | 33 | 10 | | 21 |
| 10 | Unirea Urlați | 16 | 6 | 1 | 9 | 32 | 39 | 7 | | 19 |
| 11 | Brebu | 16 | 6 | 1 | 9 | 23 | 34 | 11 | | 19 |
| 12 | Avântul Măneciu | 16 | 5 | 0 | 11 | 31 | 45 | 14 | | 15 |
| 13 | Petrolul Băicoi | 16 | 4 | 2 | 10 | 27 | 55 | 28 | | 14 |
| 14 | Măneşti 2013 Coada Izvorului | 16 | 1 | 3 | 12 | 19 | 49 | 30 | | 6 |
| 15 | Strejnic | 16 | 1 | 2 | 13 | 16 | 54 | 38 | | 5 |
| 16 | Tinerețea Izvoarele | 16 | 0 | 3 | 13 | 9 | 47 | 38 | | 3 |
Updated to match(es) played on 8 March 2020. Source: AJF Prahova
Rules for classification: 1) Points; 2) Head-to-head points; 3) Head-to-head goal difference; 4) Head-to-head goals scored; 5) Head-to-head away goals scored; 6) Goal difference; 7) Goals scored.
(C) Champions; (Q) Qualified for the phase indicated
## Promotion play-off
Champions of Liga IV – Prahova County face champions of Liga IV – Călărași County and Liga IV – Ilfov County.
### Region 6 (South)
#### Group A
| Pos | Team | Pld | W | D | L | GF | GA | GD | Pts | Promotion or relegation |
| --- | --- | --- | --- | --- | --- | --- | --- | --- | --- | --- |
| 1 | Oltenița (CL) (C, P) | 2 | 1 | 1 | 0 | 3 | 2 | +1 | 4 | Promotion to Liga III |
| 2 | Plopeni (PH) (P) | 2 | 1 | 1 | 0 | 3 | 2 | +1 | 4 | Possible promotion to Liga III |
| 3 | Viitorul Domnești (IF) (E) | 2 | 0 | 0 | 2 | 0 | 2 | 2 | 0 | |
Updated to match(es) played on 9 August 2020. Source: FRF (in Romanian)
Rules for classification: 1) Points; 2) Head-to-head points; 3) Head-to-head goal difference; 4) Head-to-head goals scored; 5) Head-to-head away goals scored; 6) Goal difference; 7) Goals scored 8) Penalty kicks.
(C) Champions; (E) Eliminated; (P) Promoted
| 1 August 2020 | Oltenița (CL) | **1–0** | Viitorul Domnești (IF) | Buzău |
| --- | --- | --- | --- | --- |
| 17:30 EEST (UTC+3) | Alexa 29' | | | Stadium: Municipal<br>Attendance: 0<br>Referee: Andrei Baciu (Botoșani) |
| 5 August 2020 | Plopeni (PH) | **2–2**<br>(**2–4** ) | Oltenița (CL) | Buzău |
| --- | --- | --- | --- | --- |
| 17:30 EEST (UTC+3) | Butufei 73'<br>Ciobanu 90+4' | | Alexa 37'<br>Udrea 85' | Stadium: Municipal<br>Attendance: 0<br>Referee: Sorin Costreie (Buftea) |
| 9 August 2020 | Viitorul Domnești (IF) | **0–1** | Plopeni (PH) | Buzău |
| --- | --- | --- | --- | --- |
| 17:30 EEST (UTC+3) | | | Iancu 64' | Stadium: Municipal<br>Attendance: 0<br>Referee: Andrei Chivulete (Bucharest) |
### Main Leagues
### County Leagues (Liga IV series)
## InfoBox
Liga IV Prahova
| Season | 2019–20 |
| --- | --- |
| 2018–19 2020–21 | |
|
37,865,608 |
https://en.wikipedia.org/wiki/Djibouti_at_the_Paralympics
|
Djibouti at the Paralympics
|
Djibouti made its Paralympic Games debut at the 2012 Summer Paralympics in London, sending one representative to compete in athletics.
| 2022-11-12T06:35:42 |
# Djibouti at the Paralympics
Djibouti made its Paralympic Games debut at the 2012 Summer Paralympics in London, sending one representative (Houssein Omar Hassan) to compete in athletics.
## InfoBox
| Djibouti at the<br>Paralympics | |
| --- | --- |
| | |
| IPC code | DJI |
| Medals | Gold 0 Silver 0 Bronze 0 Total 0 |
| Summer appearances | |
| | |
|
29,878,488 |
https://en.wikipedia.org/wiki/Acrocercops_euthycolona
|
Acrocercops euthycolona
|
Acrocercops euthycolona is a moth of the family Gracillariidae, known from Maharashtra, India, as well as Brunei Darussalam, Indonesia, Malaysia, the Solomon Islands, Sri Lanka, and Vanuatu. It was described by Edward Meyrick in 1931. The hostplants for the species include Anacardium occidentale, Madhuca indica, Madhuca latifolia, Mimusops elengi, and Mimusops elengi. They mine the leaves of their host plant. The mine has the form of a large ovate blotch mine under the upper cuticle of the leaf. It is pinkish, shining and opaque.
| 2020-12-30T12:10:37 |
# Acrocercops euthycolona
***Acrocercops euthycolona*** is a moth of the family Gracillariidae, known from Maharashtra, India, as well as Brunei Darussalam, Indonesia, Malaysia, the Solomon Islands, Sri Lanka, and Vanuatu. It was described by Edward Meyrick in 1931.
The hostplants for the species include *Anacardium occidentale*, *Madhuca indica*, *Madhuca latifolia*, *Mimusops elengi*, and *Mimusops elengi*. They mine the leaves of their host plant. The mine has the form of a large ovate blotch mine under the upper cuticle of the leaf. It is pinkish, shining and opaque.
## InfoBox
| *Acrocercops euthycolona* | |
| --- | --- |
|
| Scientific classification | |
| Domain: | Eukaryota |
| Kingdom: | Animalia |
| Phylum: | Arthropoda |
| Class: | Insecta |
| Order: | Lepidoptera |
| Family: | Gracillariidae |
| Genus: | *Acrocercops* |
| Species: | ***A. euthycolona*** |
| Binomial name | |
| ***Acrocercops euthycolona***<br>Meyrick, 1931 | |
|
|
5,523,345 |
https://en.wikipedia.org/wiki/KAUN-LD
|
KAUN-LD
|
KAUN-LD is a low-power television station in Sioux Falls, South Dakota, United States. The station is owned by Jim Simpson. KAUN-LD's transmitter is located on the campus of Sanford USD Medical Center near downtown Sioux Falls. KAUN-LD was an Ion Television affiliate until March 2008, when it switched to Retro TV. It later switched to Youtoo America. As of February 2023, the station is not broadcasting any programming, yet it is still licensed by the Federal Communications Commission (FCC).
| 2023-08-19T14:02:16 |
# KAUN-LD
**KAUN-LD** (channel 25) is a low-power television station in Sioux Falls, South Dakota, United States. The station is owned by Jim Simpson. KAUN-LD's transmitter is located on the campus of Sanford USD Medical Center near downtown Sioux Falls.
KAUN-LD (as KAUN-LP) was an Ion Television affiliate until March 2008, when it switched to Retro TV. It later switched to Youtoo America (now YTA TV). As of February 2023, the station is not broadcasting any programming, yet it is still licensed by the Federal Communications Commission (FCC).
## InfoBox
KAUN-LD
| | |
| --- | --- |
| Channels | |
| Ownership | |
| Owner | * Jim Simpson * (J.F. Broadcasting, LLC) |
| History | |
| Founded | November 6, 1991 |
| First air date | October 1, 2003 (2003-10-01) |
| Former call signs | K42CC (1987–July 2003)<br>KXWB-LP (July−October 1, 2003)<br>KWSD-LP (October 1−9, 2003)<br>KAUN-LP (October 9, 2003–2022) |
| Former channel number(s) | **Analog:**<br>42 (UHF, 1984–2020)<br>25 (UHF, 2020–2021) |
| Former affiliations | Pax/i/Ion (2003–2008)<br>Retro TV (2008–?) |
| Technical information | |
| Licensing authority | FCC |
| Facility ID | 26039 |
| Class | LD |
| ERP | 720 watts |
| HAAT | 53.6 m (176 ft) |
| Transmitter coordinates | 43°32′8″N 96°44′35″W / 43.53556°N 96.74306°W / 43.53556; -96.74306 |
| Links | |
| Public license information | LMS |
|
27,017,567 |
https://en.wikipedia.org/wiki/Kathekani
|
Kathekani
|
Kathekani is a dryland farming area in Kenya's Eastern Province. On November 29, 1976, Kathekani was the site of train derailment that killed 29 people. Initial reports were that several hundred people had died.
| 2023-01-30T05:01:40 |
# Kathekani
**Kathekani** is a dryland farming area in Kenya's Eastern Province.
On November 29, 1976, Kathekani was the site of train derailment that killed 29 people. Initial reports were that several hundred people had died.
## InfoBox
| Kathekani | |
| --- | --- |
| KathekaniLocation of Kathekani | |
| Coordinates: 2°37′S 38°09′E / 2.62°S 38.15°E / -2.62; 38.15 | |
| Country | Kenya |
| Province | Eastern Province |
| Time zone | UTC+3 (EAT) |
|
52,875,689 |
https://en.wikipedia.org/wiki/1969_NCAA_Indoor_Track_and_Field_Championships
|
1969 NCAA Indoor Track and Field Championships
|
The 1969 NCAA Indoor Track and Field Championships were contested March 14−15, 1969 at Cobo Arena in Detroit, Michigan at the fifth annual NCAA-sanctioned track meet to determine the individual and team national champions of men's collegiate indoor track and field events in the United States. Kansas topped the team standings, finishing eight-and-a-half points ahead of defending champions Villanova; it was the Jayhawks' second indoor team title.
| 2022-05-23T01:18:14 |
# 1969 NCAA Indoor Track and Field Championships
The **1969 NCAA Indoor Track and Field Championships** were contested March 14−15, 1969 at Cobo Arena in Detroit, Michigan at the fifth annual NCAA-sanctioned track meet to determine the individual and team national champions of men's collegiate indoor track and field events in the United States.
Kansas topped the team standings, finishing eight-and-a-half points ahead of defending champions Villanova; it was the Jayhawks' second indoor team title.
## Qualification
Unlike other NCAA-sponsored sports, there were not separate University Division and College Division championships for indoor track and field until 1985. As such, all athletes and teams from University and College Division programs were eligible to compete.
## Team standings
* **Note:** Top 10 only
* <sup>**(DC)**</sup> = Defending Champions
* Full results
| Rank | Team | Points |
| --- | --- | --- |
| | **Kansas** | **3513** |
| | Villanova <sup>**(DC)**</sup> | 25 |
| | San Jose State | 17 |
| 4 | USC<br>Tennessee | 1513 |
| 6 | Nebraska | 1213 |
| 7 | Harvard<br>Michigan State | 11 |
| 9 | BYU<br>Kansas State | 8 |
## InfoBox
| 1969 NCAA Indoor Track and Field Championships | |
| --- | --- |
| Dates | March 14−15, 1969 |
| Host city | Detroit, Michigan |
| Venue | Cobo Arena |
| 1968 1970 | |
|
76,709,518 |
https://en.wikipedia.org/wiki/Kadhal_Konjam_Thookala_(Upcoming_Film)
|
Kadhal Konjam Thookala (Upcoming Film)
|
Kadhal Konjam Thookala is an upcoming tamil film written and directed by Balaji Mohan. This movie is an adaptation of the novel Make it Two, by Sharadha Subramanian, following the life of a high-class urban guy and an Indian girl crossing paths. It stars Kalidas Jayaram, Dushara Vijayan, and Amala Paul, in lead roles, alongside, Nirmal Pillai, Dhanya Balakrishna, and others in pivotal roles. This film has music composed by Darbuka Siva and lyrics by Thamarai, Vivek, Madhan Karky, and Vishnu Edavan. It was shot in London, Pondicherry, and Chennai.
| 2024-04-22T23:18:30 |
# Kadhal Konjam Thookala (Upcoming Film)
Kadhal Konjam Thookala is an upcoming tamil film written and directed by Balaji Mohan. This movie is an adaptation of the novel Make it Two, by Sharadha Subramanian, following the life of a high-class urban guy and an Indian girl crossing paths. It stars Kalidas Jayaram, Dushara Vijayan, and Amala Paul, in lead roles, alongside, Nirmal Pillai, Dhanya Balakrishna, and others in pivotal roles. This film has music composed by Darbuka Siva and lyrics by Thamarai, Vivek, Madhan Karky, and Vishnu Edavan. It was shot in London, Pondicherry, and Chennai.
## Plot
Topsy turvy Karthik's life changes as he sees Sujitha, forgettting is past life with Priya.
## Cast
1. https://indianexpress.com/article/entertainment/tamil/amala-paul-comes-on-board-for-balaji-mohans-kaadhal-konjam-thookala-8169149/
|
76,709,518 |
https://en.wikipedia.org/wiki/Kadhal_Konjam_Thookala_(upcoming_film)
|
Kadhal Konjam Thookala (upcoming film)
|
Kadhal Konjam Thookala is an upcoming tamil film written and directed by Balaji Mohan. This movie is an adaptation of the novel Make it Two, by Sharadha Subramanian, following the life of a high-class urban guy and an Indian girl crossing paths. It stars Kalidas Jayaram, Dushara Vijayan, and Amala Paul, in lead roles, alongside, Nirmal Pillai, Dhanya Balakrishna, and others in pivotal roles. This film has music composed by Darbuka Siva and lyrics by Thamarai, Vivek, Madhan Karky, and Vishnu Edavan. It was shot in London, Pondicherry, and Chennai.
| 2024-04-22T23:18:30 |
# Kadhal Konjam Thookala (upcoming film)
Kadhal Konjam Thookala is an upcoming tamil film written and directed by Balaji Mohan. This movie is an adaptation of the novel Make it Two, by Sharadha Subramanian, following the life of a high-class urban guy and an Indian girl crossing paths. It stars Kalidas Jayaram, Dushara Vijayan, and Amala Paul, in lead roles, alongside, Nirmal Pillai, Dhanya Balakrishna, and others in pivotal roles. This film has music composed by Darbuka Siva and lyrics by Thamarai, Vivek, Madhan Karky, and Vishnu Edavan. It was shot in London, Pondicherry, and Chennai.
## Plot
Topsy turvy Karthik's life changes as he sees Sujitha, forgettting is past life with Priya.
## Cast
1. https://indianexpress.com/article/entertainment/tamil/amala-paul-comes-on-board-for-balaji-mohans-kaadhal-konjam-thookala-8169149/
|
23,048,820 |
https://en.wikipedia.org/wiki/No._658_Squadron_RAF
|
No. 658 Squadron RAF
|
No. 658 Squadron was a Royal Air Force air observation post squadron associated with the 21st Army Group during World War II. No.s 651 to 663 Squadrons of the RAF were air observation post units working closely with Army units in artillery spotting and liaison. A further three of these squadrons, Nos. 664 to 666, were manned with Canadian personnel.
| 2009-06-01T19:31:25 |
# No. 658 Squadron RAF
**No. 658 Squadron** was a Royal Air Force air observation post squadron associated with the 21st Army Group during World War II. No.s 651 to 663 Squadrons of the RAF were air observation post units working closely with Army units in artillery spotting and liaison. A further three of these squadrons, Nos. 664 to 666, were manned with Canadian personnel.
## History
### Formation and World War II
No. 658 Squadron was formed at RAF Old Sarum on 30 April 1943 with the Auster III and from March 1944 the Auster IV. The squadron role was to support the 21st Army Group and on 26 June 1944 it moved to France. Fighting in the break-out from Normandy it followed the army across the countries and into Germany. In October 1945 the squadron left for India, where it was disbanded on 15 October 1946.
The squadron number was transferred to the Army with the formation of the Army Air Corps (AAC) on 1 September 1957. No. 658 Squadron AAC uses the designation, badge and motto.
## Aircraft operated
Aircraft operated by No. 658 Squadron
| From | To | Aircraft | Variant |
| --- | --- | --- | --- |
| April 1943 | April 1944 | Auster | Mk.III |
| March 1944 | September 1945 | Auster | Mk.IV |
| August 1944 | September 1945 | Auster | Mk.V |
| November 1945 | January 1946 | Auster | Mk.V |
| June 1946 | October 1946 | Auster | Mk.V |
### Notes
### Bibliography
* Flintham, Vic; Thomas, Andrew (2003). *Combat Codes: A Full Explanation and Listing of British, Commonwealth and Allied Air Force Unit Codes since 1938*. Shrewsbury, Shropshire, UK: Airlife Publishing Ltd. ISBN 1-84037-281-8.
* Halley, James J. (1988). *The Squadrons of the Royal Air Force & Commonwealth, 1918–1988*. Tonbridge, Kent, UK: Air-Britain (Historians) Ltd. ISBN 0-85130-164-9.
* Jefford, C.G. (2001). *RAF Squadrons, a Comprehensive record of the Movement and Equipment of all RAF Squadrons and their Antecedents since 1912* (2nd ed.). Shrewsbury, Shropshire, UK: Airlife Publishing Ltd. ISBN 1-85310-053-6.
## InfoBox
| No. 658 Squadron RAF | |
| --- | --- |
| Active | 30 Apr 1943 – 15 Oct 1946 |
| Country | United Kingdom |
| Branch | Royal Air Force |
| Role | Air observation post squadron |
| Motto(s) | Latin: *Videmus Delemus*<br>(Translation: "We see and destroy") |
| Insignia | |
| Squadron Badge heraldry | On a bezant, an eagle's head couped |
| Squadron Codes | No code(s) known |
| Aircraft flown | |
| Reconnaissance | Auster Single-engined Army liaison monoplane |
|
22,995,016 |
https://en.wikipedia.org/wiki/No._660_Squadron_RAF
|
No. 660 Squadron RAF
|
No. 660 Squadron was a Royal Air Force air observation post squadron associated with the 21st Army Group during World War II. Numbers 651 to 663 Squadrons of the RAF were air observation post units working closely with Army units in artillery spotting and liaison. A further three of these squadrons, 664–666, were manned with Canadian personnel. Their duties and squadron numbers were transferred to the Army with the formation of the Army Air Corps on 1 September 1957.
| 2009-05-28T20:39:58 |
# No. 660 Squadron RAF
**No. 660 Squadron** was a Royal Air Force air observation post squadron associated with the 21st Army Group during World War II. Numbers 651 to 663 Squadrons of the RAF were air observation post units working closely with Army units in artillery spotting and liaison. A further three of these squadrons, 664–666, were manned with Canadian personnel. Their duties and squadron numbers were transferred to the Army with the formation of the Army Air Corps on 1 September 1957.
## History
### Formation and World War II
No. 660 Squadron was formed at RAF Old Sarum on 31 July 1943 with the Auster III and in February 1944 the Auster IV. From November 1943, it was based at Hammerwood Park, a country house in Sussex. However, as the squadron's role was to support the Second British Army, in July 1944 it moved to France. Fighting in the break-out from Normandy it followed the army across the low countries and into Germany. The squadron disbanded at Holtenau, Germany on 31 May 1946. The squadron today is represented by No. 660 Squadron AAC of the Army Air Corps, part of the (Defence Helicopter Flying School).
## Aircraft operated
Aircraft operated by no. 660 Squadron RAF, data from
| From | To | Aircraft | Variant |
| --- | --- | --- | --- |
| July 1943 | February 1944 | Auster | Mk.III |
| February 1944 | May 1946 | Auster | Mk.IV |
| September 1944 | May 1946 | Auster | Mk.V |
### Notes
### Bibliography
* Bowyer, Michael J.F.; Rawlings, John D.R. (1979). *Squadron Codes, 1937–56*. Cambridge, UK: Patrick Stephens Ltd. ISBN 0-85059-364-6.
* Flintham, Vic; Thomas, Andrew (2003). *Combat Codes: A Full Explanation and Listing of British, Commonwealth and Allied Air Force Unit Codes since 1938*. Shrewsbury, Shropshire, UK: Airlife Publishing Ltd. ISBN 1-84037-281-8.
* Halley, James J. (1988). *The Squadrons of the Royal Air Force & Commonwealth, 1918–1988*. Tonbridge, Kent, UK: Air-Britain (Historians) Ltd. ISBN 0-85130-164-9.
* Jefford, C.G. (2001). *RAF Squadrons, a Comprehensive record of the Movement and Equipment of all RAF Squadrons and their Antecedents since 1912* (2nd ed.). Shrewsbury, Shropshire, UK: Airlife Publishing Ltd. ISBN 1-85310-053-6.
## InfoBox
| No. 660 Squadron RAF | |
| --- | --- |
| Active | 31 Jul 1943 – 31 May 1946 |
| Country | United Kingdom |
| Branch | Royal Air Force |
| Role | Air observation post squadron |
| Motto(s) | No motto known |
| Insignia | |
| Squadron Badge heraldry | No badge known |
| Squadron Codes | **BG** (Aug 1945 – Apr 1946) |
| Aircraft flown | |
| Reconnaissance | Auster Single-engined Army liaison monoplane |
|
1,274,680 |
https://en.wikipedia.org/wiki/Jos%C3%A9_Dur%C3%A3o_Barroso
|
José Durão Barroso
|
José Manuel Durão Barroso is a Portuguese politician and law professor. He previously served as the 114th prime minister of Portugal and from 2004–2014 as the 11th president of the European Commission. He has been one of the revolving door cases at the EU, which received the most media attention because only two months after the cooling off period, Barroso accepted a position as "senior adviser " and "non-executive chairman" of Goldman Sachs International. and became subject of an ethics inquiry.
| 2004-12-14T00:48:42 |
# José Durão Barroso
**José Manuel Durão Barroso** (Portuguese: \[ʒuˈzɛ mɐˈnwɛl duˈɾɐ̃w bɐˈʁozu\]; born 23 March 1956) is a Portuguese politician and law professor. He previously served as the 114th prime minister of Portugal and from 2004–2014 as the 11th president of the European Commission.
He has been one of the revolving door cases at the EU, which received the most media attention because only two months after the cooling off period, Barroso accepted a position as "senior adviser " and "non-executive chairman" of Goldman Sachs International. and became subject of an ethics inquiry.
## Early life and education
José Barroso was born in Lisbon to Luís António Saraiva Barroso and his wife Maria Elisabete de Freitas Durão.
Durão Barroso (as he is known in Portugal) graduated from the Faculty of Law of the University of Lisbon. He subsequently obtained a Diploma in European Studies from the European University Institute, and received a MA degree with honours in both Political Science and Social Sciences from the University of Geneva in Switzerland.
Barroso became politically active in his late teens, during the Estado Novo regime in Portugal, before the Carnation Revolution of 25 April 1974. In his university days, he was one of the leaders of the underground Maoist MRPP (Re-Organized Movement of the Proletariat Party, later Portuguese Workers' Communist Party (PCTP/MRPP), Communist Party of the Portuguese Workers/Revolutionary Movement of the Portuguese Proletariat). In an interview with the newspaper *Expresso*, he said that he had joined MRPP to fight the only other student body movement, also underground, which was controlled by the Portuguese Communist Party. Despite this justification, there is a very famous political 1976 interview recorded by the Portuguese state-run television channel, RTP, in which Barroso, as a politically minded student during the post-Carnation Revolution turmoil known as PREC, criticises the bourgeois education system which "throws students against workers and workers against students."
## Career
His academic career began as an assistant professor in the Faculty of Law of the University of Lisbon. Barroso did PhD research at Georgetown University and Georgetown's Edmund A. Walsh School of Foreign Service in Washington, D.C., but his CV does not list any doctoral degree (except honorary). Back in Lisbon, Barroso became director of the Department for International Relations at Lusíada University (Universidade Lusíada).
In December 1980, Barroso joined the right-of-centre PPD (Democratic Popular Party, later PPD/PSD-Social Democratic Party), where he remains to the present day.
In 1985, under the PSD government of Aníbal Cavaco Silva, 113th prime minister of Portugal, Barroso was named Under-Secretary of State in the Ministry of Home Affairs. In 1987 he became a member of the same government as he was elevated to Secretary of State for Foreign Affairs and Cooperation (answering to the Minister of Foreign Affairs), a post he was to hold for the next five years. In this capacity, he was the driving force behind the Bicesse Accords of 1990, which led to a temporary armistice in the Angolan Civil War between the ruling MPLA and the opposition UNITA. He also supported independence for East Timor, a former Portuguese colony, then a province of Indonesia by force. In 1992, Barroso was promoted to the post of Minister of Foreign Affairs, and served in this capacity until the defeat of the PSD in the 1995 general election.
### Prime minister of Portugal, 2002–2004
In 1995, while in opposition, Barroso was elected to the Assembly of the Republic as a representative for Lisbon. He became chairman of the Foreign Affairs Committee. In 1998 he graduated from the Georgetown Leadership Seminar. In 1999 he was elected president of the PSD, succeeding Marcelo Rebelo de Sousa (a professor of law), and thus became Leader of the Opposition. Parliamentary elections in 2002 gave the PSD enough seats to form a coalition government with the right-wing Portuguese People's Party, and Barroso subsequently became Prime Minister of Portugal on 6 April 2002.
As prime minister, facing a growing budget deficit, he made a number of difficult decisions and adopted strict reforms. He vowed to reduce public expenditure, which made him unpopular among leftists and public servants.. His purpose was to lower the public budget deficit to a 3% target (according to the demands of EU rules), and official data during the 2002–2004 period stated that the target was being attained.
In March 2003, Barroso hosted U.S President George W. Bush, British Prime Minister Tony Blair, and Spanish Prime Minister José María Aznar in the Portuguese island of Terceira, in the Azores. The four leaders finalised the controversial US-led 2003 invasion of Iraq. Under Barroso's leadership, Portugal became part of the "coalition of the willing" for the invasion and occupation of Iraq, sending non-combat troops. On 30 January 2003, Barroso signed *The letter of the eight* supporting US. policy on Iraq.
Barroso did not finish his term as he had been nominated as president of the European Commission on 5 July 2004. Barroso arranged with Portuguese President Jorge Sampaio to nominate Pedro Santana Lopes as a substitute prime minister of Portugal. Santana Lopes led the PSD/PP coalition for a few months until early 2005, when new elections were called. When the Portuguese Socialist Party won the elections it produced an estimation that by the end of the year the budget deficit would reach 6.1%, which it used to criticise Barroso's and Santana Lopes's economic policies.
### President of the European Commission, 2004–2014
In 2004, the proposed European Constitution and now the Treaty of Lisbon included a provision that the choice of the president must take into account the result of Parliamentary elections and the candidate supported by the victorious Europarty in particular. That provision was not in force in the nomination in 2004, but the centre-right European People's Party (EPP), who won the elections, pressured for a candidate from its own ranks. In the end, Barroso, as EPP candidate, was chosen by the European Council. During his first presidency, the following issues were on the Commission's agenda: Turkey applying for EU membership, the reform of the institutions (Treaty of Lisbon), the Bolkestein directive, aimed at creating a single market for services within the EU, Lisbon Strategy, Galileo positioning system, Doha Development Agenda negotiations, European Institute of Innovation and Technology and an EU climate change package.
The EPP again endorsed Barroso for a second term during the 2009 European election campaign and, after the EPP again won the elections, was able to secure his nomination by the European Council on 17 June 2009. On 3 September 2009, Barroso unveiled his manifesto for his second term. On 16 September 2009, Barroso was re-elected by the European Parliament for another five years. Since he completed his second term he became only the second Commission president to serve two terms, after Jacques Delors. That Commission's term of office ran until 31 October 2014.
Barroso visited Ireland to persuade Irish citizens to approve the Treaty of Lisbon in the country's second referendum due to be held the following month. Barroso was greeted by Irish Minister for Defence Willie O'Dea and Peter Power, the Minister of State for Overseas Development, as he got off his plane at Shannon Airport on the morning of 19 September 2009 before briefly meeting with the joint committee of the Oireachtas and meeting and greeting people at functions in Limerick's City Hall, University of Limerick (UL) and the Savoy Hotel. He told *The Irish Times* in an interview referenced internationally by Reuters that he had been asked if Ireland would split from the European Union. He also launched a €14.8 million grant for former workers at Dell's Limerick plant, described as "conveniently opportune" by former Member of the European Parliament and anti-Lisbonite Patricia McKenna.
On 12 September 2012, Barroso called for the EU to evolve into a "federation of nation-states", necessary to combat the continent's economic crisis. He said he believed Greece would be able to stay in the eurozone if it stood by its commitments. Barroso also heralded the legislative proposal published the same day for European Banking Supervision.
He was once appointed Acting Commissioner for Inter-Institutional Relations and Administration in Maroš Šefčovič's stead, from 19 April 2014 – 25 May 2014 while he was on electoral campaign leave for the 2014 elections to the European Parliament. He ultimately decided to not take up his seat.
### Controversies
In 2005, *Die Welt* reported that Barroso had spent a week on the yacht of the Greek shipping billionaire Spiro Latsis. It emerged soon afterward that this had occurred only a month before the Commission approved 10 million euros of Greek state aid for Latsis's shipping company – though the state aid decision had been taken by the previous European Commission before Barroso took up his post. In response to this revelation, Nigel Farage MEP of the UK Independence Party persuaded around 75 MEPs from across the political spectrum to back a motion of no confidence in Barroso, so as to compel him to appear before the European Parliament to be questioned on the matter. The motion was tabled on 12 May 2005, and Barroso appeared before Parliament as required at a debate on 26 May 2005. The motion itself was heavily defeated.
In response to criticism for his choice of a less fuel efficient Volkswagen Touareg, amid EU legislation of targets drastically to reduce car CO<sub>2</sub> emissions, Barroso dismissed this as "overzealous moralism".
In April 2008, amid sharp food price rises and mounting food vs fuel concerns, Barroso insisted that biofuel use was "not significant" in pushing up food prices. The following month, he announced a study that would look into the issue. The backdoor approval of the GE potato, by President Barroso, has met a wave of strong opposition from EU member-states. The governments of Greece, Austria, Luxembourg, Italy, Hungary and France have all publicly announced that they will not allow the GE potato to be grown in their countries.
Barroso has expressed criticism of national governments arguing "Decisions taken by the most democratic institutions in the world are very often wrong."
In December 2013 Barroso said that Europe was not the cause of the problems for Ireland; Ireland caused a problem for Europe. Following the bailout exit, in December 2013, the Irish government's bid to get backdated funding for the banking sector was rejected as the head of the European Commission blamed the Irish banks, regulators, and government for the difficulties in the country. Barroso said the problems in the Irish banks caused a "major destabilisation" in the euro, rather than structural problems with the currency itself, "I am saying this because it would be wrong to give the impression that Europe has created a problem for Ireland and now Europe has to help Ireland. In fact, it was the banking sector in Ireland—it was one of the biggest problems in the world in terms of banking stability what happened in Ireland."
### Post Brussels, 2015-present
Barroso is a policy fellow at the Liechtenstein Institute on Self-Determination at Princeton University and the Frederick H. Schultz Class of 1951 Visiting Professor of International Economic Policy at Princeton's Woodrow Wilson School of Public and International Affairs Woodrow Wilson School, where he teaches with Wolfgang F. Danspeckgruber on the EU in International Affairs.
Barroso has been a professor at Portuguese Catholic University since 2015. He has taught at the Institute of Political Studies, at the Catholic Global School of Law, and at the Catholic Lisbon School of Business and Economics, and directs the Center for European Studies from the same institution. In February 2015, he was appointed visiting professor at the University of Geneva and taught at the Graduate Institute of International and Development Studies.
In July 2016, Barroso became senior adviser and non-executive chairman and senior adviser of London-based Goldman Sachs International (GSI), the bank's largest subsidiary. At the time of his appointments, this was regarded as quite controversial, and later led Barroso's successor Jean-Claude Juncker to launch an ethics investigation. Barroso was heavily criticised for taking the position only two months after the 18-month "cooling-off" period for EU officials after they leave their posts. Barroso's move was especially sensitive because Goldman Sachs played a questionable role in the Financial Crisis 2007–2009 that nearly broke the euro. Furthermore, Barroso announced his move to the London-based subsidiary of Goldman Sachs shortly after the Brexit referendum. The European Commission agreed to an unprecedented ethics inquiry into the move. The independent panel concluded there were "not sufficient grounds to establish a violation of the duty of integrity and discretion" and accepted Barroso's assurances that he would not be lobbying on behalf of the bank's clients.
In addition, Barroso has held several paid and unpaid positions, including:
## Personal life
In 1980 he married Maria Margarida Pinto Ribeiro de Sousa Uva, with whom he has three sons. Sousa Uva died from uterine cancer in August 2016, at the age of 60.
Apart from Portuguese, Barroso is fluent in French, speaks Spanish and English and has taken a course to acquire a basic knowledge of German.
## Honours
### National
### Foreign
### Other awards
Barroso holds over twenty decorations, including.
* Winner of the Casa da Imprensa prize in the area of politics in 1992
* Named Global Leader for Tomorrow by the World Economic Forum in 1993
* Chosen Personality of the Year in 1991 and 2004 by the Foreign Press Association in Portugal
* Given "Medalla de la Universidad de Alcala de Henares" and "Medalla de Oro de la Ciudad de Zamora", Spain, 2005
* Golden Medal: The Bell Celebration – Message to United Europe, from the Ferdinan Martinengo Company, Slovakia, 2006
* EFR-Business Week Award from Erasmus University Rotterdam, 2006.
* Honorary Citizen of Rio de Janeiro, June 2006.
* "European of the Year" award by European Voice newspaper, November 2006.
* Awarded Honorary HEC diploma, Paris, December 2006.
* Special Prize, Business Centre Club, Poland, February 2007; Gold Medal of the city of Lamego, Portugal, April 2007;
* Transatlantic Leadership Prize, European Institute, Washington DC, April 2007;
* Honorary Citizen of Delphi and Golden Medal of the "Amfiktyons", Delphi, Greece, July 2007;
* Academic Title EBAPE – FGV, for the relevant contribution and services towards the study and practice in Administration – Getulio Vargas Foundation, Rio de Janeiro, August 2007
* Conde de Barcelona International Prize from the Conde de Barcelona Foundation, Barcelona, November 2007.
* Honorary Medal and Honorary Diploma of the City of Nicosia, Nicosia, January 2008.
* Honorary Member, Academia Portuguesa da História, Lisbon, March 2008.
* State Medal "Stara Planina" I Degree, Bulgaria, March 2008.
* "Prémio Rotary da Paz", Rotary International Distrito 1960 Portugal, Lisbon, April 2008; "Chave de Honra da Cidade de Lisboa", Lisbon, May 2008.
* Confraria Queijo S. Jorge, Acores, May 2008.
* Ciudadino Andino Honorifico, Lima, Peru, May 2008.
* "Transatlantic Business Award", American Chamber of Commerce to the European Union, Brussels, May 2008.
* Confraria vinho do Porto, Porto, June 2008.
* Gold Medal of the Royal Institute of European Studies, Royal Institute of European Studies Madrid, March 2009.
* Gold Medal of the Hellenic Parliament, Athens, April 2009.
* Medal of Honour and Benefaction of the City of Athens, Athens, April 2009.
* European Excellence Award, by the Government Council of the Community of Madrid, May 2009.
* Prix European of the Year, The European Movement in Denmark, Copenhagen, May 2009.
* Laureate of the Quadriga Prize 2009 – United for the Better, Berlin, October 2009
* Medal of Merit from the Federação das Associações Portuguesas e Luso-brasileiras, Brazil, July 2010.
* "Man of the Year 2009 of Central and Eastern Europe", Krynica, September 2010.
* Golden Victoria "European of the Year 2010" award by the Union of German Magazine Publishers VDZ, Berlin, November 2010.
* Collier of the Fondation du Mérite européen, Luxembourg, November 2010.
* the "Steiger" Award 2011, Bochum, Germany, March 2011.
* Charles V Prize, awarded by the Fundación Academia Europea de Yuste, Spain, 2013
* Gold Medal for Outstanding Contribution to Public Discourse, the College Historical Society (CHS) of Trinity College Dublin.
* Gold Medal of the Jean Monnet Foundation for Europe, in 2014.
#### Honorary degrees
## InfoBox
| José Durão Barroso | |
| --- | --- |
| Barroso in 2013 | |
| | |
| President of the European Commission | |
| **In office**<br>22 November 2004 31 October 2014 | |
| Vice President | Günter Verheugen<br>Franco Frattini<br>Antonio Tajani<br>Jacques Barrot<br>Siim Kallas<br>Viviane Reding<br>Joaquín Almunia |
| First Vice-President | Margot Wallström<br>Catherine Ashton |
| Preceded by | Romano Prodi |
| Succeeded by | Jean-Claude Juncker |
| Prime Minister of Portugal | |
| **In office**<br>6 April 2002 17 July 2004 | |
| President | Jorge Sampaio |
| Preceded by | António Guterres |
| Succeeded by | Pedro Santana Lopes |
| President of the Social Democratic Party | |
| **In office**<br>2 May 1999 30 June 2004 | |
| Secretary-General | José Luís Arnaut |
| Preceded by | Marcelo Rebelo de Sousa |
| Succeeded by | Pedro Santana Lopes |
| Leader of the Opposition | |
| **In office**<br>2 May 1999 6 April 2002 | |
| Prime Minister | António Guterres |
| Preceded by | Marcelo Rebelo de Sousa |
| Succeeded by | Eduardo Ferro Rodrigues |
| Minister of Foreign Affairs | |
| **In office**<br>12 November 1992 28 October 1995 | |
| Prime Minister | Aníbal Cavaco Silva |
| Preceded by | João de Deus Pinheiro |
| Succeeded by | Jaime Gama |
| Member of the Assembly of the Republic | |
| **In office**<br>27 October 1995 22 November 2004 | |
| Constituency | Lisbon |
| **In office**<br>13 August 1987 26 October 1995 | |
| Constituency | Viseu |
| **In office**<br>4 November 1985 12 August 1987 | |
| Constituency | Lisbon |
| | |
| Personal details | |
| Born | José Manuel Durão Barroso<br>(1956-03-23) 23 March 1956<br>Lisbon, Portugal |
| Political party | Social Democratic Party (1980–present) |
| Other political<br>affiliations | Workers' Communist Party (1974–1977) |
| Spouses | * Maria Margarida Uva (m. 1980; died 2016) * Joana Gonçalves (m. 2023) |
| Children | 3 |
| Alma mater | University of Lisbon<br>University of Geneva<br>Georgetown University |
| Signature | |
| Website | Official website<br>Official Media Gallery |
| | |
|
338,523 |
https://en.wikipedia.org/wiki/Vaclav_Neumann
|
Vaclav Neumann
|
Václav Neumann is an Czech conductor, violinist, violist and opera director.
| 2003-10-11T02:25:41 |
# Vaclav Neumann
**Václav Neumann** (29 October 1920 – 2 September 1995) is an Czech conductor, violinist, violist and opera director.
## Discography
### Studio albums
| Year | Album details |
| --- | --- |
| 1995 | *Christoph Willibald Gluck: Orfeo Ed Euridice* |
| 1997 | *Schubert: Rosamunde D 797; Concert Piece D 345; Symphony No. 3 D 200** Release date: February 1, 1997 * Label: Arte Nova |
|
2,056,696 |
https://en.wikipedia.org/wiki/SoftwareValet
|
SoftwareValet
|
SoftwareValet is a software installer for BeOS, originally developed by Starcode Software. It has been included with BeOS since 1998, when Be Inc. purchased Starcode's assets. It was originally developed for web deployment of applications, where a user would click on an 'Install with SoftwareValet' link on a website, and the BeOS web browser at the time, NetPositive, would launch SoftwareValet. It also handled product registration and software updates through a centralised server, BeDepot (bedepot.com). SoftwareValet applications could also be distributed in non-web delivered upkg files, which are non-self executing, encapsulated installer files. Installation is based on direct file locations and shell scripts, and has very little chance of user manipulation; although a file format break in BeOS R4.5 allowed package makers to use non-direct paths, as a preparation for making the OS multi-user. The compression format is known to be based on zlib, but no tools other than SoftwareValet exist for manipulating packages. A companion application, PackageBuilder was also bundled with the BeOS developer tools, and was used for creating packages, or editing existing ones.
| 2005-06-16T13:27:46 |
# SoftwareValet
**SoftwareValet** is a software installer for BeOS, originally developed by Starcode Software. It has been included with BeOS since 1998, when Be Inc. purchased Starcode's assets.
It was originally developed for web deployment of applications, where a user would click on an 'Install with SoftwareValet' link on a website, and the BeOS web browser at the time, NetPositive, would launch SoftwareValet. It also handled product registration and software updates through a (now defunct) centralised server, BeDepot (bedepot.com).
SoftwareValet applications could also be distributed in non-web delivered **upkg** files, which are non-self executing, encapsulated installer files. Installation is based on direct file locations and shell scripts, and has very little chance of user manipulation; although a file format break in BeOS R4.5 allowed package makers to use non-direct paths, as a preparation for making the OS multi-user.
The compression format is known to be based on zlib, but no tools other than SoftwareValet exist for manipulating packages.
A companion application, **PackageBuilder** was also bundled with the BeOS developer tools, and was used for creating packages, or editing existing ones.
|
69,722,704 |
https://en.wikipedia.org/wiki/2021_Los_Angeles_Chargers%E2%80%93Las_Vegas_Raiders_game
|
2021 Los Angeles Chargers–Las Vegas Raiders game
|
{{Rcat shell|
{{Infobox NFL single game | name = 2021 Los Angeles Chargers–Las Vegas Raiders game
| image = Allegiant Stadium.jpg
| caption = The game was played at Allegiant Stadium in Paradise, Nevada.
| visitor = Los Angeles Chargers
| visitor_abbr = LAC
| visitor_coach = Brandon Staley
| visitor_place = | visitor_record = 9–7
| home = Las Vegas Raiders
| home_abbr = LV
| home_coach = Rich Bisaccia
| home_place = | home_record = 9–7
| visitor_qtr1 = 0
| visitor_qtr2 = 14
| visitor_qtr3 = 0
| visitor_qtr4 = 15
| visitor_qtr5 = 3
| visitor_total = 32
| home_qtr1 = 10
| home_qtr2 = 7
| home_qtr3 = 3
| home_qtr4 = 9
| home_qtr5 = 6
| home_total = 35
| date = January 9, 2022
| stadium = Allegiant Stadium
| city = Paradise, Nevada
| referee = Clete Blakeman
| attendance = 62,068
| odds = Chargers by 3
| network = NBC
| announcers = Al Michaels, Cris Collinsworth, Michele Tafoya and Terry McAulay
| radio station =
| radio announcers =
}} On January 9, 2022, during Week 18 of the 2021 NFL season, the Las Vegas Raiders defeated the Los Angeles Chargers by a score of 35–32 on NBC Sunday Night Football. The game was highly anticipated as the winner would advance to the 2021–22 NFL playoffs. Additionally, because of the result of two games earlier in the day, a rare situation occurred where both teams would also advance to the playoffs if they tied.
| 2022-01-10T18:05:08 |
# 2021 Los Angeles Chargers–Las Vegas Raiders game
{{Rcat shell| {{Infobox NFL single game
| name = 2021 Los Angeles Chargers–Las Vegas Raiders game | image = Allegiant Stadium.jpg | caption = The game was played at Allegiant Stadium in Paradise, Nevada. | visitor = Los Angeles Chargers | visitor\_abbr = LAC | visitor\_coach = Brandon Staley | visitor\_place = | visitor\_record = 9–7 | home = Las Vegas Raiders | home\_abbr = LV | home\_coach = Rich Bisaccia | home\_place = | home\_record = 9–7 | visitor\_qtr1 = 0 | visitor\_qtr2 = 14 | visitor\_qtr3 = 0 | visitor\_qtr4 = 15 | visitor\_qtr5 = 3 | visitor\_total = 32 | home\_qtr1 = 10 | home\_qtr2 = 7 | home\_qtr3 = 3 | home\_qtr4 = 9 | home\_qtr5 = 6 | home\_total = 35 | date = January 9, 2022 | stadium = Allegiant Stadium | city = Paradise, Nevada | referee = Clete Blakeman | attendance = 62,068 | odds = Chargers by 3 | network = NBC | announcers = Al Michaels, Cris Collinsworth, Michele Tafoya and Terry McAulay | radio station = | radio announcers = }}
On January 9, 2022, during Week 18 of the 2021 NFL season, the Las Vegas Raiders defeated the Los Angeles Chargers by a score of 35–32 on NBC Sunday Night Football. The game was highly anticipated as the winner would advance to the 2021–22 NFL playoffs. Additionally, because of the result of two games earlier in the day, a rare situation occurred where both teams would also advance to the playoffs if they tied.
## Background
Tied NFL games became uncommon after a 1974 rule change added one sudden death overtime period to regular-season games if they were tied after regulation. When the Detroit Lions and Pittsburgh Steelers played to a 16–16 tie earlier in the season on November 14, 2021, it became the 27th tied game since the 1974 rule change. This opened up the possibly of the Steelers or at least another team getting into the playoffs with a tie.
The unlikely scenario in which the Los Angeles Chargers and Las Vegas Raiders tying would send both teams to the playoffs was only possible because of two somewhat unlikely game results earlier in the day. First, the 2–14 Jacksonville Jaguars had to improbably beat the Indianapolis Colts. The Jaguars were heavy underdogs, but dominated the Colts to win, 26–11. If the Colts had won the game they would have clinched a playoff berth, leaving only one playoff spot remaining for the winner of the Chargers–Raiders showdown. In this scenario, the Chargers would have advanced with a tie because they had beaten the Raiders in Los Angeles, 28–14, earlier in the season on October 4.
The second event that had to happen was the Steelers beating the Baltimore Ravens, which they did, 16–13 in overtime, to finish the season with a 9–7–1 record. A Chargers–Raiders tie would have meant that both teams would finish the season with the same 9–7–1 record as the Steelers; both teams held the tie-breaker over the Steelers by virtue of defeating the Steelers earlier in the season. This meant that both teams would make the playoffs in the case of a tie, while the Steelers would be eliminated.
The possibility of both teams purposely tying to ensure they would both make the playoffs was entertained the days leading up to the game. However, Chargers head coach Brandon Staley confirmed in an interview to Rich Eisen they would play to win the game. The Raiders interim head coach Rich Bisaccia pledged the same the next day.
The NFL rule book, through rule 17, gives NFL commissioner Roger Goodell the authority "to investigate and take appropriate disciplinary and/or corrective measures if any club action, non-participant interference, or calamity occurs in an NFL game which the Commissioner deems so extraordinarily unfair or outside the accepted tactics encountered in professional football that such action has a major effect on the result of the game." This rule likely prevented the Raiders and the Chargers from outright agreeing to a tie.
Although both teams would have qualified for the playoffs with a tie, the Raiders actually had some incentive to win rather than tie to earn a higher playoff seed. The Raiders, by winning, would earn the #5 seed and a first-round matchup against #4 seed Cincinnati. A tie would have given the Raiders the #7 seed and a matchup against #2 seed Kansas City. Although Cincinnati would go on to defeat Kansas City and represent the AFC in the Super Bowl, at the time they were considered a weaker opponent, having a worse record and no playoff wins since 1990. Kansas City had been to two consecutive Super Bowls and soundly beaten the Raiders twice earlier in the season. The Chargers, on the other hand, would have earned the #6 seed either by tying or winning.
## Game summary
### First quarter
The Raiders received the first quarter kickoff and immediately drove down the field for a Daniel Carlson field goal. Both the Chargers and the Raiders punted on their next drives, however, during the Raiders punt Chargers return man Andre Roberts lost a fumble giving the Raiders great field positioning. The Raiders capitalized as Derek Carr threw a touchdown pass to Hunter Renfrow. The quarter ended with the Raiders leading 10–0.
### Second quarter
On the Chargers’ first drive of the second quarter, they reached the end zone on a 14 yard run by Austin Ekeler. The Raiders punted again on their next drive, while the Chargers scored another touchdown on a Justin Herbert pass to Ekeler. With less than two minutes to go in the second quarter, Carr led the Raiders on a drive that lasted 1 minute and 15 seconds; the Chargers notably allowed the Raiders to convert a 3rd and 23 on a Jalen Richard run before they finished the drive with a Josh Jacobs touchdown run following a questionable pass interference call on Chris Harris Jr. The Chargers and the Raiders both got the ball back prior to halftime, but neither got a first down, the Raiders led 17–14 at the break.
### Third quarter
Chargers’ kicker Dustin Hopkins missed a 41 yard field goal on their first drive of the second half. The Raiders punted on their next drive. The Chargers struggled to move the ball on the next drive but instead of punting on 4th and 1 at their own 18 yard line, they attempted to convert a first down. The attempt failed, and gave the ball to the Raiders with excellent field position. The Raiders could do little on this drive however, and were forced to settle for a Carlson field goal. The third quarter ended with the Raiders leading 20–14.
### Fourth quarter
On the Raiders first drive of the fourth quarter, Carr found Renfrow for a second touchdown, giving Las Vegas a 26–14 lead. However, they failed on a two point conversion attempt that would have increased the lead to 14. The Chargers’ next drive ended as Herbert would throw an interception to Casey Hayward, leading to another Carlson field goal to put the Raiders up, 29-14. On the Chargers next drive they were finally able to return to the end zone. To do so, they converted a fourth-and-6 and a fourth-and-21. Herbert found Josh Palmer in the end zone on the latter fourth down. The Chargers successfully converted the two-point attempt on Herbert's pass to Ekeler, cutting the Raiders lead to 29–22. The Raiders punted on their next drive holding onto a 7-point lead. This allowed the Chargers to finish off the fourth quarter with an improbable 19 play, 83 yard drive that involved the Chargers converting on three separate 4th and 10s. Herbert threw a touchdown pass to Mike Williams as the game clock expired, and a Hopkins extra point sent the game to overtime, tied at 29.
### Overtime
The Raiders won the coin toss and elected to receive the kick. They drove 53 yards but settled for a Carlson field goal. Similarly, the Chargers drove 52 yards and settled for a Hopkins field goal. The game was now tied 32–32 with 4:30 remaining in overtime.
On the Raiders’ final drive of overtime with the game still tied at 32, the Raiders drove to midfield and appeared poised to kneel out the clock and settle for a tie, which would have sent both the Chargers and the Raiders to the playoffs. However with 38 seconds left in overtime, with the Raiders facing a 3rd and 4 from the Chargers' 39 yard line, the Chargers called a timeout. According to Chargers head coach Brandon Staley, the timeout was called to change personnel to better defend what they assumed would be a run play. However, following the timeout, the Raiders still converted the third down with a ten-yard run, setting themselves up for a game winning 47-yard field goal from kicker Daniel Carlson.
## Aftermath
With the win, the Raiders earned the #5 seed in the AFC playoffs. However, they lost to the Cincinnati Bengals in the Wild Card round, 26–19.
After the game, Carr was asked by sideline reporter Michele Tafoya if the timeout changed their mindset on the final drive, he replied "It definitely did, obviously."
In a post game press conference, Raiders interim head coach Rich Bisaccia, when asked if the Raiders were playing to tie, said "We were talking about it. . . . We ran the ball there, and they didn’t call a timeout. So I think they were probably thinking the same thing. And then we had the big run. When we got the big run, it got us in advantageous field goal position. . . . We were certainly talking about it on the sideline. We wanted to see if they were gonna take a timeout or not on that run. They didn’t, so we thought they were thinking the same thing. And then we popped the run in there and gave us a chance to kick the field goal to win it. So, we were certainly talking about it.”
Chargers head coach Brandon Staley, when asked about the timeout by the Los Angeles Times said "We felt like they were going to run the ball. So we wanted to ... make that substitution so that we could get a play where we would deepen the field goal."
In Chargers quarterback Justin Herbert's post game press conference he said "I had never been rooting for a tie more in my life. That's the unfortunate part of being so close."
## Box score
**Week 18: Los Angeles Chargers at Las Vegas Raiders – Game summary**
| Period | 1 | 2 | 3 | 4 | OT | Total |
| --- | --- | --- | --- | --- | --- | --- |
| Chargers | 0 | 14 | 0 | 15 | 3 | **32** |
| **Raiders** | 10 | 7 | 3 | 9 | 6 | **35** |
*at Allegiant Stadium, Paradise, Nevada*
* **Date**: January 9
* **Game time**: 5:20 p.m. PST
* **Game weather**: None (indoor stadium)
* **Game attendance**: 62,068
* **Referee**: Clete Blakeman
* **TV announcers (NBC)**: Al Michaels, Cris Collinsworth, Michele Tafoya and Terry McAulay
* Recap, Game Book
| Game information |
| --- |
| |
1. "Sunday Night Football odds, spread, line: Chargers vs. Raiders prediction, NFL picks by expert who's 28-15". *Cbssports.com*. Retrieved 11 January 2022.
2. Western, Evan "Tex" (9 January 2022). "NFL Week 18 Sunday Schedule: Chargers & Raiders get winner-take-all game on SNF". *Acmepackingcompany.com*. Retrieved 11 January 2022.
3. Jonsson, Patrick (November 12, 2012). "First NFL tie since 2008, between Rams and 49ers: What is this, soccer?". *The Christian Science Monitor*. Archived from the original on January 30, 2013. Retrieved February 25, 2013.
4. Molski, Max (November 15, 2021). "Looking back at the most recent ties in NFL history". *NBC Sports Philadelphia*. Retrieved September 10, 2022.
5. "Colts in 'shock' after season ends in loss to Jags". *Espn.com*. 10 January 2022. Retrieved 11 January 2022.
6. "Raiders vs. Chargers - Game Summary - October 4, 2021". *Espn.com*. Retrieved 11 January 2022.
7. "With Steelers OT win, Raiders and Chargers could play for tie and both make NFL playoffs". *Sports.yahoo.com*. Retrieved 2022-01-10.
8. Berger, Cale (6 January 2022). "Chargers Coach Brandon Staley Says He Won't Intentionally Play for Tie vs. Raiders". *Steelersnow.com*. Retrieved 11 January 2022.
9. "Rich Bisaccia Dismisses Raiders Playing for Tie vs. Chargers to Clinch Playoff Spot". *Newsupdate.uk*. 7 January 2022. Retrieved 11 January 2022.
10. Kirshner, Alex (10 January 2022). "The Absolute Agony of Watching the Raiders and Chargers Not Play for a Tie". *Slate.com*. Retrieved 11 January 2022.
11. Barnwell, Bill (10 January 2022). "Raiders win in overtime to make NFL playoffs: Did the Chargers blow it? Should the teams have played for a tie? That wild ending explained". *ESPN.com*. Retrieved 24 November 2022.
12. Bailey, Analis. "Chargers coach Brandon Staley explains why he called timeout late in overtime loss vs. Raiders". *Usatoday.com*. Retrieved 11 January 2022.
13. "Derek Carr admitted the Chargers' mind-boggling timeout in final minute changed the game". *Ftw.usatoday.com*. 10 January 2022. Retrieved 11 January 2022.
14. "Raiders vs. Chargers: Raiders were this close to settling for a tie and bumping Steelers from playoffs". *Triblive.com*. 10 January 2022. Retrieved 11 January 2022.
15. Florio, Mike (10 January 2022). "Rich Bisaccia: We were talking about taking a tie". *Profootballtalk.nbcsports.com*. Retrieved 11 January 2022.
16. "Chargers' playoff hopes shattered in season-ending overtime loss to Raiders". *Los Angeles Times*. 10 January 2022. Retrieved 11 January 2022.
17. "Herbert's heroics not enough as Chargers fall, miss playoffs". *Apnews.com*. 10 January 2022. Retrieved 11 January 2022.
|
1,793,273 |
https://en.wikipedia.org/wiki/IMG_Models
|
IMG Models
|
IMG Models is an international modeling agency headquartered in New York City and with additional offices in London, Los Angeles, Milan, Paris and Sydney. It is a subsidiary of the talent management company International Management Group. The company merged with William Morris Endeavor in 2013. In 2015, the agency represented more than half of the highest paid supermodels. Ivan Bart is the current President, and Lisa Marie Benson is the Vice President.
| 2005-04-25T03:10:34 |
# IMG Models
**IMG Models** is an international modeling agency headquartered in New York City and with additional offices in London, Los Angeles, Milan, Paris and Sydney. It is a subsidiary of the talent management company International Management Group. The company merged with William Morris Endeavor in 2013. In 2015, the agency represented more than half of the highest paid supermodels. Ivan Bart is the current President, and Lisa Marie Benson is the Vice President.
## History
IMG Models was founded circa 1987 by sports agent Mark McCormack. In 1994, Ivan Bart joined the company as the creative director and later became IMG Models' president in 2013. Tyra Banks and Niki Taylor joined, followed by Angela Lindvall, Bridget Hall, Carolyn Murphy, Gisele Bündchen and Kate Moss.
In September 2012, IMG decided to reintroduce their men's division, after its dismantling in 2007.
In 2013, Bart decided to sign models without regard to traditional height, weight, race, or age requirements, or other factors that historically have prevented diversity in model casting.
In 2014, IMG Models began a scouting initiative on Instagram called #WLYG (We Love Your Genes). Models that have been discovered through this process include Lameka Fox, Alyssa Traoré, and Gizele Oliveira. They also have done online scouting via their website.
## InfoBox
IMG Models
|
| |
| Company type | Subsidiary |
| Industry | Modeling agency |
| Founder | Mark McCormack |
| Headquarters | New York City, U.S. |
| Area served | North America, Europe, Australia |
| Parent | IMG (company) |
| Website | imgmodels.com |
|
63,207,394 |
https://en.wikipedia.org/wiki/Ababacar_Sadikh_Soumar%C3%A9
|
Ababacar Sadikh Soumaré
|
Ababacar Sadikh Soumaré is a Senegalese taekwondo practitioner. At the 2018 African Taekwondo Championships held in Agadir, Morocco, he won the gold medal in the men's 80 kg event. In 2019, he represented Senegal at the African Games held in Rabat, Morocco and he won one of the bronze medals in the men's 80 kg event.
| 2023-06-03T20:30:03 |
# Ababacar Sadikh Soumaré
**Ababacar Sadikh Soumaré** (born 3 July 1994) is a Senegalese taekwondo practitioner.
At the 2018 African Taekwondo Championships held in Agadir, Morocco, he won the gold medal in the men's 80 kg event.
In 2019, he represented Senegal at the African Games held in Rabat, Morocco and he won one of the bronze medals in the men's 80 kg event.
## InfoBox
Ababacar Sadikh Soumaré
| Personal information | |
| --- | --- |
| Born | (1994-07-03) 3 July 1994 |
| Sport | |
| Country | Senegal |
| Sport | Taekwondo |
| Weight class | 80 kg |
| Medal record African Games 2019 Rabat 80 kg African Taekwondo Championships 2018 Agadir 80 kg 2021 Dakar 80 kg | |
|
40,541,642 |
https://en.wikipedia.org/wiki/Aluycia_Gradenigo
|
Aluycia Gradenigo
|
Aluycia Gradenigo was the Dogaressa of Venice by marriage to the Doge Marino Faliero. Aluycia was the daughter of Nicolo Gradenigo and related to doge Pietro Gradenigo. She was known for her beauty and her love life, and said to have had many affairs. She is known for her affair with Michele Steno, which was the catalyst for a failed coup d'etat by doge Faliero for which he was executed.
| 2024-03-07T22:17:34 |
# Aluycia Gradenigo
**Aluycia Gradenigo** (died 1387) was the Dogaressa of Venice by marriage to the Doge Marino Faliero (r. 13541355).
Aluycia was the daughter of Nicolo Gradenigo and related to doge Pietro Gradenigo. She was known for her beauty and her love life, and said to have had many affairs. She is known for her affair with Michele Steno, which was the catalyst for a failed coup d'etat by doge Faliero for which he was executed.
|
25,404,541 |
https://en.wikipedia.org/wiki/Black_Reel_Award_for_Best_Breakthrough_Performance
|
Black Reel Award for Best Breakthrough Performance
|
Here are the list of nominees and winners of the Black Reel Award for Best Breakthrough Performance. Jennifer Hudson, Lupita Nyong'o & Octavia Spencer are the only Black Reel Award winners to win an Academy Award for their breakthrough performances. Quvenzhané Wallis, Barkhad Abdi & Gabourey Sidibe earn Academy Award nominations. 2014 marked the first time that the category was split by gender.
| 2024-04-24T16:39:00 |
# Black Reel Award for Best Breakthrough Performance
Here are the list of nominees and winners of the Black Reel Award for **Best Breakthrough Performance**.
Jennifer Hudson, Lupita Nyong'o & Octavia Spencer are the only Black Reel Award winners to win an Academy Award for their breakthrough performances. Quvenzhané Wallis, Barkhad Abdi & Gabourey Sidibe earn Academy Award nominations.
2014 marked the first time that the category was split by gender.
## Winners and nominees
| Year | Winner | Nominees | Source |
| --- | --- | --- | --- |
| 2016 | Abraham Attah (*Beasts of No Nation*) (Breakthrough Actor) | | |
| | Kiersey Clemons (*Dope*) (Breakthrough Actress) | | |
| 2015 | Tyler James Williams (*Dear White People*) (Breakthrough Actor) | | |
| | Teyonah Parris (*Dear White People*) (Breakthrough Actress) | | |
| 2014 | Barkhad Abdi(*Captain Phillips*) (Breakthrough Actor) | | |
| | Lupita Nyong'o(*12 Years a Slave*) (Breakthrough Actress) | | |
| 2013 | Quvenzhané Wallis (*Beasts of the Southern Wild*) | | |
| 2012 | Adepero Oduye (*Pariah*) | | |
| 2011 | Tessa Thompson (*For Colored Girls*) | | |
| 2010 | Gabourey Sidibe (*Precious*) | | |
| 2008 | Dev Patel (*Slumdog Millionaire*) | | |
| 2007 | Jennifer Hudson (*Dreamgirls*) | | |
| 2006 | Brandon T. Jackson (*Roll Bounce*) | | |
| 2005 | Sharon Warren (*Ray*) | | |
| 2004 | Naomie Harris (*28 Days Later*) | | |
| 2003 | Derek Luke (*Antwone Fisher*) | | |
|
25,452,855 |
https://en.wikipedia.org/wiki/Black_Reel_Award_for_Best_Original_or_Adapted_Song
|
Black Reel Award for Best Original or Adapted Song
|
Here are the winners and nominees of the Black Reel Award for Best Original or Adapted Song. The award goes to the artist and the writers of the song. Most Wins: John Legend – 3 wins Most Nominations: Beyoncé, John Legend – 4 nominations
Henry Krieger, Ludacris, Alicia Keys – 3 nominations
Eminem, Joe Budden, Mary J. Blige, Jennifer Hudson, Randy Newman, Ne-Yo, Terry Lewis, Jimmy Jam, Snoop Dogg, Anika Noni Rose, R. Kelly, Raphael Saadiq, Luis Resto, Jay-Z, Kanye West, Pharrell Williams, Common, Ludwig Göransson – 2 nominations
| 2023-11-27T02:30:51 |
# Black Reel Award for Best Original or Adapted Song
Here are the winners and nominees of the **Black Reel Award for Best Original or Adapted Song**. The award goes to the artist and the writers of the song.
Most Wins:
1. John Legend – 3 wins
Most Nominations:
1. Beyoncé, John Legend – 4 nominations
2. Henry Krieger, Ludacris, Alicia Keys – 3 nominations
3. Eminem, Joe Budden, Mary J. Blige, Jennifer Hudson, Randy Newman, Ne-Yo, Terry Lewis, Jimmy Jam, Snoop Dogg, Anika Noni Rose, R. Kelly, Raphael Saadiq, Luis Resto, Jay-Z, Kanye West, Pharrell Williams, Common, Ludwig Göransson – 2 nominations
## Winners and nominees
Table key
| | Indicates the winner |
| --- | --- |
| Year | Performer | Title | Film | Writers | Ref. |
| --- | --- | --- | --- | --- | --- |
| 2000 <br>2nd Annual | Meshell Ndegeocello | "Fool of Me" | *Love & Basketball* | Meshell Ndegeocello and Federico Pena | |
| | Lucy Pearl | "Dance Tonight" | *Love & Basketball* | | Dawn Robinson and Raphael Saadiq |
| | Janet Jackson | "Doesn't Really Matter" | *Nutty Professor II: The Klumps* | | Janet Jackson, Jimmy Jam and Terry Lewis |
| | Destiny’s Child | "Independent Women" | *Charlie's Angels* | | Beyoncé, Sam Barnes, Jean-Claude Oliver and Cory Rooney |
| | Donell Jones | "I'll Go" | *Love & Basketball* | | Steve "Silk" Hurley and Rashaan Patterson |
| | R. Kelly | "Bad Man" | *Shaft* | | R. Kelly |
| 2001 <br>3rd Annual | Eric Benet | "Love Don't Love Me" | *The Brothers* | Eric Benet | |
| | Nelly | "#1" | *Training Day* | | Nelly and Waiel Yaghnam |
| | R. Kelly | "The World's Greatest" | *Ali* | | R. Kelly |
| | R.L. | "Good Love" | *The Brothers* | | R.L. |
| | Tyrese Gibson, Snoop Dogg and Mr. Tan | "Just a Baby Boy" | *Baby Boy* | | Battlecat, Snoop Dogg and Tyrese Gibson |
| 2002 <br>4th Annual | Erykah Badu & Common | "Love of My Life (An Ode to Hip-Hop)" | *Brown Sugar* | Erykah Badu, Maduwkwu Chinwah, Common, Robert Ozuna, James Poyser, Raphael Saadiq and Glenn Strandrige | |
| | Snoop Dogg, Mr. Kane, Bootsy Collins, Quaze and Fred Wesley | "Undercova Funk (Give Up the Funk)" | *Undercover Brother* | | George Clinton, Bootsy Collins, Snoop Dogg and Jerome Brailey |
| | Angie Stone | "Bring Me Your Heart" | *Brown Sugar* | | Hersholt Polk, Angie Stone and Homer Talbert |
| | Beyoncé | "Work It Out" | *Austin Powers in Goldmember* | | Beyoncé, Chad Hugo and Pharrell Williams |
| | Bow Wow, Fundisha, Fabolous and Jermaine Dupri | "Basketball" | *Like Mike* | | James Barlower, Kurt Blow, Full Force, Robert Ford, James Moore, Shirley Walker and William Waring |
| 2003 <br>5th Annual | Beyoncé and Walter Williams Sr. | "He Still Loves Me" | *The Fighting Temptations* | Big Jim Wright, Jimmy Jam and Terry Lewis | |
| | Joe Budden | "Pump It Up" | *2 Fast 2 Furious* | | Robert Bell, Just Blaze, George Brown, Joe Budden, Robert Mickens, Claydes Smith, Dennis Thomas and Richard Westfield |
| | Ludacris | "Act a Fool" | *2 Fast 2 Furious* | | Ludacris |
| | LL Cool J and Amerie | "Paradise" | *Deliver Us From Eva* | | Amerie, Samuel Barnes, Keni Burke, Allen Felder, LL Cool J, Jean-Claude Olivier, Norma Jean Wright and 50 Cent |
| | Tupac Shakur and Notorious B.I.G. | "Runnin' (Dying to Live)" | *Tupac: Resurrection* | | Eminem, Notorious B.I.G., Luis Resto, Tupac Shakur and Edgar Winter |
| 2006 <br>8th Annual | Jennifer Hudson | "And I'm Telling You (I'm Not Going)" | *Dreamgirls* | Henry Krieger and Tom Eyen | |
| | Beyoncé | "Listen" | *Dreamgirls* | | Beyoncé, Scott Cutler, Henry Krieger and Tom Eyen |
| | Jennifer Hudson | "I Am Changing" | *Dreamgirls* | | Henry Krieger and Tom Eyen |
| | OutKast | "Idlewild Blue (Don'tchu Worry 'Bout Me)" | *Idlewild* | | André 3000 |
| | Alicia Keys and Lyfe Jennings | "People Get Ready" | *Glory Road* | | Curtis Mayfield |
| 2009 <br>10th Annual | Anika Noni Rose | "Almost There" | *The Princess and the Frog* | Randy Newman | |
| | Anika Noni Rose | "Down in New Orleans" | *The Princess and the Frog* | | Randy Newman |
| | Ne-Yo | "Never Knew I Needed" | *The Princess and the Frog* | | Ne-Yo |
| | Stew, De'Adre Aziza and Daniel Breaker | "Keys" | *Passing Strange* | | Stew |
| | Mary J. Blige | "I Can Do Bad All By Myself" | *I Can Do Bad All By Myself* | | Mary J. Blige, Chuck Harmony and Ne-Yo |
| 2010 <br>11th Annual | John Legend | "Shine" | *Waiting for Superman* | John Legend | |
| | Justin Bieber and Jaden Smith | "Never Say Never" | *The Karate Kid* | | Justin Bieber, Kuk Harrell, Adam Messinger, Nasri, Omarr Rambert and Jaden Smith |
| | Leona Lewis | "I Know Who I Am" | *For Colored Girls* | | Greg Barnhill, Joanna Cotten and Melissa Manchester |
| | Queen Latifah | "Champion" | *Just Wright* | | Cool & Dre, Queen Latifah and Jazmine Sullivan |
| | Jay Z, Kanye West and Rihanna | "Run This Town" | *Just Wright* | | Jeff Bhasker, Jay Z, No I.D., Rihanna and Kanye West |
| 2011 <br>12th Annual | Mary J. Blige | "The Living Proof" | *The Help* | Mary J. Blige, Harvey Mason, Jr., Thomas Newman and Damon Thomas, | |
| | Ludacris and Slaughterhouse | "Furiously Dangerous" | *Fast Five* | | Kon Artis, Joe Budden, Crooked I, Eminem, Ludacris, Joell Ortiz, Luis Resto and Royce da 5'9" |
| | Nicole Beharie | "My Last Day Without You" | *My Last Day Without You* | | Scott Jacoby, Stefan Schaefer and Christoph Silber |
| | Cee-Lo Green and Kenny Wayne Shepherd | "Walkin' Blues" | *Footloose* | | R. L. Burnside |
| | Jamie Foxx | "Fly Love" | *Rio* | | Carlinhos Brown and Siedah Garrett |
| 2012 <br>13th Annual | John Legend | "Who Did That to You?" | *Django Unchained* | Paul Epworth and John Legend | |
| | John Legend and Ludacris | "Tonight (Best You Ever Had)" | *Think Like a Man* | | Allen Arthur, Keith Justice, John Legend, Ludacris, Miguel and Clayton Reilly |
| | Travis Barker, RZA, Raekwon and Tom Morello | "Carry It" | *The Man with the Iron Fists* | | Travis Barker, Tom Morello, Raekwon and RZA |
| | Jay Z, Kanye West and Frank Ocean | "No Church in the Wild" | *Safe House* | | James Brown, Mike Dean, Jay Z, Phil Manzanera, Frank Ocean, Joseph Roach, The-Dream, Kanye West, Gary Wright and 88-Keys |
| | Jordin Sparks and Whitney Houston | "Celebrate" | *Sparkle* | | R. Kelly |
| 2013 <br>14th Annual | Judith Hill | "Desperation" | *20 Feet from Stardom* | Judith Hill | |
| | Fantasia Barrino | "In the Middle of the Night" | *The Butler* | | Fantasia Barrino, Keith McMasters, Abel Terry and Kassim VonRico Washington |
| | Alicia Keys | "Queen of the Field (Patsey's Song)" | *12 Years a Slave* | | Alicia Keys |
| | Gladys Knight | "You & I Ain't No More" | *The Butler* | | Lenny Kravitz |
| | Pharrell Williams | "Happy" | *Despicable Me 2* | | Pharrell Williams |
| 2014 <br>15th Annual | Common and John Legend | "Glory" | *Selma* | Common, John Legend and Rhymefest | |
| | Questlove and Eliza Colby | "It Ain't Easy" | *Top Five* | | Eliza Colby and Questlove |
| | Janelle Monáe | "What is Love" | *Rio 2* | | Janelle Monáe, Nathaniel Irvin III and Roman Irvin |
| | Rita Ora | "Grateful" | *Beyond the Lights* | | Diane Warren |
| | Alicia Keys and Kendrick Lamar | "It's On Again" | *The Amazing Spider-Man 2* | | Pharrell Williams, Alicia Keys, Kendrick Lamar and Hans Zimmer |
| 2015 <br>16th Annual | Wiz Khalifa and Charlie Puth | "See You Again" | *Furious 7* | Andrew Cedar, DJ Frank E, Wiz Khalifa and Charlie Puth | |
| | Tessa Thompson | "Grip" | *Creed* | | Sam Dew, Ludwig Göransson and Tessa Thompson |
| | Childish Gambino, Vince Staples and Jhené Aiko | "Waiting for My Moment" | *Creed* | | Ryan Coogler, Donald Glover, Ludwig Göransson and Vince Staples |
| | The Weeknd | "Earned It" | *Fifty Shades of Grey* | | The Weeknd, Stephan Moccio, Jason Quenneville and Belly |
| | Dr. Dre | "Talking to My Diary" | *Straight Outta Compton* | | Dr. Dre, Russell Brown, Camille Clerc and François de Roubaix |
| 2018 <br>19th Annual | Kendrick Lamar & SZA | "All the Stars" | *Black Panther* | Kendrick Duckworth, Mark Spears, Al Shuckburgh, Solána Rowe, and Anthony Tiffith |
| | The Weeknd and Kendrick Lamar | "Pray for Me | *Black Panther* | Abel Tesfaye, Kendrick Lamar Duckworth, Adam Feeney, Jason Quenneville and Martin McKinney |
| | Arlissa | "We Won’t Move" | *The Hate U Give* | Arlissa Ruppert, Jessica Karpov, Kevin White and Mike Woods |
| | Khalid and Normani | "Love Lies" | *Love, Simon* | Khalid Robinson, Normani Kordei Hamilton, Jamil Chammas, Ryan Vojtesak, Tayla Parks |
| | Jennifer Hudson | "I’ll Fight" | *RBG* | Diane Warren |
|
25,404,670 |
https://en.wikipedia.org/wiki/Black_Reel_Award_for_Best_Supporting_Actress
|
Black Reel Award for Best Supporting Actress
|
This article lists the winners and nominees for the Black Reel Award for Best Supporting Actress in a Motion Picture. Academy Award-nominated or winning performances also honored with nominations or wins at the Black Reel Awards include Lupita Nyong'o, Queen Latifah (Chicago), Jennifer Hudson (Dreamgirls), Penélope Cruz, Taraji P. Henson, Viola Davis (Doubt), Mo'Nique (Precious), and Octavia Spencer .
| 2023-03-12T14:12:09 |
# Black Reel Award for Best Supporting Actress
This article lists the winners and nominees for the **Black Reel Award for Best Supporting Actress in a Motion Picture**. Academy Award-nominated or winning performances also honored with nominations or wins at the Black Reel Awards include Lupita Nyong'o (*12 Years a Slave*), Queen Latifah (*Chicago*), Jennifer Hudson (*Dreamgirls*), Penélope Cruz (*Vicky Cristina Barcelona*), Taraji P. Henson (*The Curious Case of Benjamin Button*), Viola Davis (*Doubt*), Mo'Nique (*Precious*), and Octavia Spencer (*The Help*).
## Winners and nominees
Winners are listed first and highlighted in **bold**.
† indicates an Academy Award–winning performance. ‡ indicates an Academy Award–nominated performance that same year.
### 2000s
| Year | Actress | Film | Ref |
| --- | --- | --- | --- |
| 2000 |
| | **Erykah Badu** | ***The Cider House Rules*** | |
| | Angela Bassett | | *Music of the Heart* |
| | Lisa Gay Hamilton | | *True Crime* |
| | Rebekah Johnson | | *Liberty Heights* |
| | Queen Latifah | | *The Bone Collector* |
| 2001 ||
| | **Gabrielle Union** | ***Bring It On*** | |
| | Lisa Bonet | | *High Fidelity* |
| | Eartha Kitt | | *The Emperor's New Groove* |
| | Nia Long | | *Boiler Room* |
| | Sheryl Lee Ralph | | *Deterrence* |
| 2002 ||
| | **Nona Gaye** | ***Ali*** | |
| | Marla Gibbs | | *The Visit* |
| | Adrienne-Joi Johnson | | *Baby Boy* |
| | Gabrielle Union | | *The Brothers* |
| | Kerry Washington | | *Save the Last Dance* |
| 2003 ||
| | **Queen Latifah** | ***Chicago*** | |
| | Halle Berry | | *Die Another Day* |
| | Joy Bryant | | *Antwone Fisher* |
| | Viola Davis | | *Solaris* |
| | Rosario Dawson | | *25th Hour* |
| 2004 ||
| | **Anna Deavere Smith** | ***The Human Stain*** | |
| | Mary Alice | | *The Matrix Revolutions* |
| | Gloria Foster | | *The Matrix Reloaded* |
| | Vivica A. Fox | | *Kill Bill: Volume 1* |
| | Michael Michele | | *Dark Blue* |
| 2005 ||
| | **Sharon Warren** | ***Ray*** | |
| | Joy Bryant | | *BAADASSSSS!* |
| | Kimberly Elise | | *The Manchurian Candidate* |
| | Nia Long | | *Alfie* |
| | Jada Pinkett Smith | | *Collateral* |
| 2006 ||
| | **Taraji P. Henson** | ***Hustle & Flow*** | |
| | Rosario Dawson | | *Sin City* |
| | Thandie Newton | | *Crash* |
| | Wanda Sykes | | *Monster-in-Law* |
| | Tracie Thoms | | *Rent* |
| 2007 ||
| | **Jennifer Hudson** | ***Dreamgirls*** | |
| | Clare-Hope Ashitey | | *Children of Men* |
| | Angela Bassett | | *Akeelah and the Bee* |
| | Shareeka Epps | | *Half Nelson* |
| | Kerry Washington | | *The Last King of Scotland* |
| 2008 ||
| | **Viola Davis** | ***Doubt*** | |
| | Alice Braga | | *Blindness* |
| | Penélope Cruz | | *Vicky Cristina Barcelona* |
| | Taraji P. Henson | | *The Curious Case of Benjamin Button* |
| | Sophie Okonedo | | *The Secret Life of Bees* |
### 2010s
| Year | Actress | Film | Ref |
| --- | --- | --- | --- |
| 2010 |
| | **Mo'Nique** | ***Precious*** | |
| | Mariah Carey | | *Precious* |
| | | | Paula Patton |
| | Zoe Saldana | | *Avatar* |
| | Alfre Woodard | | *American Violet* |
| 2011 ||
| | **Phylicia Rashad** | ***For Colored Girls*** | |
| | Viola Davis | | *Eat Pray Love* |
| | Shareeka Epps | | *Mother and Child* |
| | Janet Jackson | | *For Colored Girls* |
| | | | Kerry Washington |
| 2012 ||
| | **Octavia Spencer** | ***The Help*** | |
| | Angela Bassett | | *Jumping the Broom* |
| | Maya Rudolph | | *Bridesmaids* |
| | Pernell Walker | | *Pariah* |
| | | | Kim Wayans |
| 2013 ||
| | **Naomie Harris** | ***Skyfall*** | |
| | Octavia Spencer | | *Smashed* |
| | Lorraine Toussaint | | *Middle of Nowhere* |
| | Tamara Tunie | | *Flight* |
| | Kerry Washington | | *Django Unchained* |
| 2014 ||
| | **Lupita Nyong'o** | ***12 Years a Slave*** | |
| | Melonie Diaz | | *Fruitvale Station* |
| | Naomie Harris | | *Mandela: Long Walk to Freedom* |
| | Octavia Spencer | | *Fruitvale Station* |
| | Oprah Winfrey | | *The Butler* |
| 2015 ||
| | **Carmen Ejogo** | ***Selma*** | |
| | Viola Davis | | *The Disappearance of Eleanor Rigby* |
| | Teyonah Parris | | *Dear White People* |
| | Zoe Saldana | | *Guardians of the Galaxy* |
| | Octavia Spencer | | *Snowpiercer* |
| 2016 ||
| | **Tessa Thompson** | ***Creed*** | |
| | Angela Bassett | | *Chi-Raq* |
| | Zoë Kravitz | | *Dope* |
| | Gugu Mbatha-Raw | | *Concussion* |
| | Mya Taylor | | *Tangerine* |
| 2017 ||
| | **Viola Davis** | **Fences** | |
| | Naomie Harris | | *Moonlight* |
| | Janelle Monáe | | *Moonlight* |
| | *Hidden Figures* | |
| | Lupita Nyong'o | | *Queen of Katwe* |
| 2018 ||
| | **Tiffany Haddish** | **Girls Trip** | |
| | Mary J. Blige | | *Mudbound* |
| | Betty Gabriel | | *Get Out* |
| | Octavia Spencer | | *The Shape of Water* |
| | Tessa Thompson | | *Thor: Ragnarok* |
| 2019 ||
| | **Regina King** | **If Beale Street Could Talk** | |
| | Letitia Wright | | *Black Panther* |
| | | | Danai Gurira |
| | | | Lupita Nyong'o |
| | Simone Missick | | *Jinn* |
### 2020s
| Year | Actress | Film | Ref |
| --- | --- | --- | --- |
| 2020 |
| | **Da'Vine Joy Randolph** | ***Dolemite Is My Name*** | |
| | Shahadi Wright Joseph | | *Us* |
| | Janelle Monae | | *Harriet* |
| | Taylor Russell | | *Waves* |
| | Octavia Spencer | | *Luce* |
| 2021 ||
| | **Dominique Fishback** | ***Judas and the Black Messiah*** | |
| | Alexis Chikaeze | | *Miss Juneteenth* |
| | Kiki Layne | | *The Old Guard* |
| | Tracee Ellis Ross | | *The High Note* |
| | Gabourey Sidibe | | *Antebellum* |
| 2022 ||
| | **Aunjanue Ellis** | ***King Richard*** | |
| | Ariana DeBose | | *West Side Story* |
| | Regina King | | *The Harder They Fall* |
| | Rita Moreno | | *West Side Story* |
| | Ruth Negga | | *Passing* |
| 2023 ||
| | **Angela Bassett** | ***Black Panther: Wakanda Forever*** | |
| | Thuso Mbedu | | *The Woman King* |
| | Janelle Monáe | | *Glass Onion: A Knives Out Mystery* |
| | Keke Palmer | | *Nope* |
| | Gabrielle Union | | *The Inspection* |
## Multiple nominations and wins
### Multiple nominations
|
19,517,160 |
https://en.wikipedia.org/wiki/Florida_Commissioner_of_Agriculture
|
Florida Commissioner of Agriculture
|
The commissioner of agriculture is a constitutional officer in the executive branch of government of the U.S. state of Florida that heads the Florida Department of Agriculture and Consumer Services (FDACS). Elected for a four-year mandate that is limited to two consecutive terms of office, the commissioner of agriculture is charged with supporting and regulating Florida's agriculture industry, conserving soil and water resources, managing state forests, protecting consumers from unfair trade practices, and ensuring the safety and wholesomeness of food in the marketplace. In addition, the commissioner is one of four members of the Florida Cabinet and is fourth in the line of succession to the office of governor. The thirteenth and current commissioner is Republican Wilton Simpson, who took office on January 3, 2023.
| 2023-07-20T14:26:03 |
# Florida Commissioner of Agriculture
The **commissioner of agriculture** is a constitutional officer in the executive branch of government of the U.S. state of Florida that heads the Florida Department of Agriculture and Consumer Services (FDACS). Elected for a four-year mandate that is limited to two consecutive terms of office, the commissioner of agriculture is charged with supporting and regulating Florida's agriculture industry, conserving soil and water resources, managing state forests, protecting consumers from unfair trade practices, and ensuring the safety and wholesomeness of food in the marketplace. In addition, the commissioner is one of four members of the Florida Cabinet and is fourth (behind the lieutenant governor, attorney general, and chief financial officer, respectively) in the line of succession to the office of governor. The thirteenth and current commissioner is Republican Wilton Simpson, who took office on January 3, 2023.
## History
The Florida Constitution of 1868 created the *commissioner of immigration*, whose job was to encourage farmers to settle in Florida. An 1871 amendment created a *commissioner of lands and immigration* while eliminating the *surveyor general*.
The commissioner of lands and immigration became the *commissioner of agriculture* when the Florida Constitution was revised in 1885. The newly renamed post also included supervision of state prisons until the Division of Corrections was established in 1957.
The Agricultural Services Reorganization Act was passed in 1959 and took effect in 1961. It eliminated a number of independent bureaus and boards while transferring their duties and responsibilities to divisions under the commissioner of agriculture. The resulting divisions included administration, animal industry, chemistry, dairy industry, fruit and vegetable inspection, inspection and standards, marketing, and plant industry.
The Office of Consumer Services was established by the legislature in 1967 under the purview of the commissioner of agriculture. Two years later, it was renamed the Division of Consumer Services under the Executive Reorganization Act of 1969. The department officially became the Florida Department of Agriculture and Consumer Services, and the 1927 Board of Forestry moved to the FDACS as the Division of Forestry. The FDACS was reorganized again in 1992 along 13 functional divisions.
## List of Florida commissioners of agriculture
Commissioners of agriculture by party affiliation
| Party | | Commissioners<br>of agriculture |
| --- | --- | --- |
| Democratic | | 10 |
| Republican | | 3 |
| # | Name | Term of Service | Political Party |
| --- | --- | --- | --- |
| 1 | Lucius B. Wombwell | 1888–1900 | Democratic |
| | *Vacant* | 1900–1901 | |
| 2 | Benjamin E. McLin | 1901–1912 | Democratic |
| 3 | J. C. Luning | 1912 | Democratic |
| 4 | William Allen McRae | 1912–1923 | Democratic |
| 5 | Nathan Mayo | 1923–1960 | Democratic |
| 6 | Lee Thompson | 1960–1961 | Democratic |
| 7 | Doyle Conner | 1961–1991 | Democratic |
| 8 | Bob Crawford | 1991–2001 | Democratic |
| 9 | Terry L. Rhodes | 2001 | Democratic |
| 10 | Charles H. Bronson | 2001–2011 | Republican |
| 11 | Adam Putnam | 2011–2019 | Republican |
| 12 | Nikki Fried | 2019–2023 | Democratic |
| 13 | Wilton Simpson | 2023–present | Republican |
## InfoBox
| Commissioner of Agriculture of Florida | |
| --- | --- |
| Seal of the Department of Agriculture and Consumer Services | |
| **Incumbent<br>Wilton Simpson<br>**since January 3, 2023 | |
| Department of Agriculture and Consumer Services | |
| Term length | Four years, renewable once |
| Inaugural holder | Lucius B. Wombwell |
| Formation | 1885 |
| Website | fdacs.gov |
|
62,202,953 |
https://en.wikipedia.org/wiki/Emblem_of_Ladakh
|
Emblem of Ladakh
|
The Emblem of Ladakh is the symbol used to represent the government of Ladakh, a region in the northern part of the Indian subcontinent currently administered by India as a union territory. It was adopted following the creation of the union territory of Ladakh on 31 October 2019.
| 2024-03-20T05:30:07 |
# Emblem of Ladakh
The **Emblem of Ladakh** is the symbol used to represent the government of Ladakh, a region in the northern part of the Indian subcontinent currently administered by India as a union territory. It was adopted following the creation of the union territory of Ladakh on 31 October 2019.
## Autonomous hill development councils
Ladakh is divided into two districts which each elect an autonomous district council. The two districts are Kargil HDC and Leh HDC.
## Historical symbols
## Government banner
The administration of Ladakh can be represented by a blue banner displaying the emblem India in silver with the words "THE ADMINISTRATION OF" inscribed above in an arc and the words "UT LADAKH (INDIA)" inscribed on a straight line below both in gold.
## InfoBox
| Emblem of Ladakh | |
| --- | --- |
| | |
| Armiger | The Government of Ladakh |
| Adopted | 31 October 2019 |
| Shield | Emblem of India |
| Other elements | The Administration of Union Territory of Ladakh (sic) |
|
7,161,343 |
https://en.wikipedia.org/wiki/Greatest_Hits_(The_Bangles_video)
|
Greatest Hits (The Bangles video)
|
Greatest Hits is the 1990 video (VHS) containing the greatest hits of The Bangles. The video was also released on DVD in 2005; however, it is the same version with the same quality. The video contains all their music videos from the time they were signed to Columbia Records from 1984 to 1989, except for the video to "Hazy Shade of Winter".
| 2019-10-28T17:41:52 |
# Greatest Hits (The Bangles video)
**Greatest Hits** is the 1990 video (VHS) containing the greatest hits of The Bangles. The video was also released on DVD in 2005; however, it is the same version with the same quality. The video contains all their music videos from the time they were signed to Columbia Records from 1984 to 1989, except for the video to "Hazy Shade of Winter".
## Track listing
| # | Title |
| --- | --- |
| 1. | "Hero Takes a Fall" |
| 2. | "Going Down to Liverpool" |
| 3. | "Manic Monday" |
| 4. | "If She Knew What She Wants" |
| 5. | "Walk Like an Egyptian" |
| 6. | "Walking Down Your Street" |
| 7. | "In Your Room" |
| 8. | "Eternal Flame" |
| 9. | "Be with You" |
## InfoBox
| Greatest Hits | |
| --- | --- |
| | |
| Video by The Bangles | |
| Released | April 18, 1990 (VHS)<br>February 15, 2005 (DVD) |
| Recorded | 1980s |
| Genre | Rock, Pop |
| Length | 32 minutes |
| Label | Sony Music |
| The Bangles chronology | |
| ***Greatest Hits***<br>(1990) *Doll Revolution (Bonus DVD)*<br>(2003) | |
|
522,291 |
https://en.wikipedia.org/wiki/Internet_mail_standard
|
Internet mail standard
|
Internet e-mail functions through the use of Internet Standards. Although many more standards actually apply to e-mail, virtually all mail servers and e-mail clients support at least the following basic set: Simple Mail Transfer Protocol (SMTP) specifies the protocol by which e-mail is transmitted
RFC 5322 specifies the basic format for e-mail
MIME supplements the e-mail formatting rules to allow non-English text in both e-mail headers and bodies, and defines a mechanism for including non-textual attachments in e-mail bodies
POP3 and IMAP4 specify e-mail retrieval protocols used by e-mail clients
| 2024-03-22T23:29:08 |
# Internet mail standard
Internet e-mail functions through the use of Internet Standards. Although many more standards actually apply to e-mail, virtually all mail servers and e-mail clients support at least the following basic set:
* Simple Mail Transfer Protocol (SMTP) specifies the protocol (RFC 5321, see below) by which e-mail is transmitted
* RFC 5322 specifies the basic format for e-mail
* MIME supplements the e-mail formatting rules to allow non-English text in both e-mail headers and bodies, and defines a mechanism for including non-textual attachments in e-mail bodies
* POP3 and IMAP4 specify e-mail retrieval protocols used by e-mail clients
RFC 5321 Simple Mail Transfer Protocol
RFC 5322 Internet Message Format
|
29,719,322 |
https://en.wikipedia.org/wiki/Kenney_Glacier
|
Kenney Glacier
|
Kenney Glacier is a glacier 1 nmi long flowing northwest from The Pyramid and The Saddlestone into Depot Glacier, near the head of Hope Bay, Trinity Peninsula, Antarctica. It was mapped in 1945 and 1948 by the Falkland Islands Dependencies Survey (FIDS), was resurveyed by the FIDS in 1955, and was named for Richard Kenney, assistant surveyor at Hope Bay in 1954 and 1955, who made a detailed local survey of the area between Hope Bay and Duse Bay.
| 2023-03-29T22:29:52 |
# Kenney Glacier
**Kenney Glacier** (63°25′S 57°2′W / 63.417°S 57.033°W / -63.417; -57.033) is a glacier 1 nmi (2 km; 1 mi) long flowing northwest from The Pyramid and The Saddlestone into Depot Glacier, near the head of Hope Bay, Trinity Peninsula, Antarctica. It was mapped in 1945 and 1948 by the Falkland Islands Dependencies Survey (FIDS), was resurveyed by the FIDS in 1955, and was named for Richard Kenney, assistant surveyor at Hope Bay in 1954 and 1955, who made a detailed local survey of the area between Hope Bay and Duse Bay.
## InfoBox
| Kenney Glacier | |
| --- | --- |
| Location of Trinity Peninsula in the Antarctic Peninsula | |
| Location of Kenney in Antarctica | |
| Location | Trinity Peninsula |
| Coordinates | 63°25′S 57°02′W / 63.417°S 57.033°W / -63.417; -57.033 |
| Length | 1 nmi (2 km; 1 mi) |
| Thickness | unknown |
| Terminus | Depot Glacier |
| Status | unknown |
|
30,110,688 |
https://en.wikipedia.org/wiki/Kolobar_Nunatak
|
Kolobar Nunatak
|
Kolobar Nunatak is the rocky hill rising to 541 m in the southwest part of Cugnot Ice Piedmont on Trinity Peninsula in Graham Land, Antarctica. The nunatak is named after the settlement of Kolobar in Northeastern Bulgaria.
| 2023-06-25T12:56:33 |
# Kolobar Nunatak
**Kolobar Nunatak** (Bulgarian: Колобърски нунатак, ‘Kolobarski Nunatak’ \ko-'lo-b&r-ski 'nu-na-tak\\) is the rocky hill rising to 541 m in the southwest part of Cugnot Ice Piedmont on Trinity Peninsula in Graham Land, Antarctica.
The nunatak is named after the settlement of Kolobar in Northeastern Bulgaria.
## Location
Kolobar Nunatak is located at 63°41′31″S 58°13′46″W / 63.69194°S 58.22944°W / -63.69194; -58.22944, which is 3.59 km northeast of Panhard Nunatak, 4.29 km southeast of Chochoveni Nunatak and 5.66 km southwest of Levassor Nunatak. German-British mapping in 1996.
## Maps
* Trinity Peninsula. Scale 1:250000 topographic map No. 5697. Institut für Angewandte Geodäsie and British Antarctic Survey, 1996.
* Antarctic Digital Database (ADD). Scale 1:250000 topographic map of Antarctica. Scientific Committee on Antarctic Research (SCAR). Since 1993, regularly updated.
*This article includes information from the Antarctic Place-names Commission of Bulgaria which is used with permission.*
|
22,933,889 |
https://en.wikipedia.org/wiki/Libyan_Cup_2008%E2%80%9309_%E2%80%93_round_of_16
|
Libyan Cup 2008–09 – round of 16
| 2023-10-06T16:25:58 |
# Libyan Cup 2008–09 – round of 16
## Draw
The draw was made on May 23, 2009 at 22:00 EET. Matches will be settled by a penalty shootout immediately after the match should a tie end in a draw. The stadia were selected by the Libyan Football Federation.
Ties to be played week commencing May 31, 2009
| Tie no | Home team | Score | Away team | Stadium |
| --- | --- | --- | --- | --- |
| 1 | **Jazeera** | 2–1 | Wefaq Sabratha | GMR Stadium |
| 2 | Al Sweahly | 1–3 | **Ittihad Tripoli** | 9 July Stadium |
| 3 | Wahda Tripoli | 0–2 | **Hilal Benghazi** | GMR Stadium |
| 4 | **Tersanah** | 0–0 | Olomby | GMR Stadium |
| Tersanah won 3 - 1 on penalties | | | | |
| 5 | **Akhdar** | 2–0 | Ahly Benghazi | Al Bayda Stadium |
| 6 | **Madina** | 3–0 | Khaleej Sirte | 11 June Stadium |
| 7 | **Ahly Tripoli** | 2–0 | Nojom Ajdabiya | 11 June Stadium |
| 8 | Mahdeeya | 2–2 | **Shat** | Sabha Stadium |
| Shat won 5 - 4 on penalties | | | | |
|
## Fixtures and results
Fixtures announced on May 24, 2009
Division of each club in parentheses
| Jazeera (LPL) | 2–1 | Wefaq Sabratha (LPL) |
| --- | --- | --- |
| Mansour Al Borki 50' 90+1' | | |
GMR Stadium
| Al Mahdeeya (LSD) | 2–2<br>(4–5 pens.) | Al Shat (LPL) |
| --- | --- | --- |
| | | |
Sabha Stadium
| Tersanah (LPL) | 0–0<br>(3–1 pens.) | Olomby (LPL) |
| --- | --- | --- |
| | | |
GMR Stadium
---
| Akhdar (LPL) | 2–0 | Ahly Benghazi (LPL) |
| --- | --- | --- |
| Abdelhameed al Zidane 1'<sup>1</sup><br>Osama Abdesalam 25' | | Moataz Ben Amer 12' |
Al Bayda Stadium
| Sweahly (LPL) | 1–3 | Ittihad (LPL) |
| --- | --- | --- |
| Adil Diop 53'<br>Anees al Aziq 56'<br>Hassan Asmeadah 60'<br>Lutfi Sellami 71' | | Atef Hussein Abu Zaid 45+2'<br>Pierre Koulibaly 51' 61' (pen.)<br>Mohamed Zubya 69'<br>Ahmed Zuway 81' |
9 July Stadium
| Wahda (LPL) | 0–2 | Hilal (LPL) |
| --- | --- | --- |
| | | Naaji al Maqrhi <br>Fadhil al Ashaibi |
GMR Stadium
---
| Madina (LPL) | 3–0 | Khaleej Sirte (LPL) |
| --- | --- | --- |
| Omar Diop 10' 71'<br>Abdulwahaab Hassan 90+1' | | |
11 June Stadium
---
| Ahly Tripoli (LPL) | 2–0 | Nojom Ajdabiya (LSD) |
| --- | --- | --- |
| Mohammad al Maghrabi 38'<br>Anees Zghab 61' | | |
11 June Stadium
<sup>1</sup> Zidane's goal was timed at 20 seconds.
|
|
41,366,943 |
https://en.wikipedia.org/wiki/List_of_Research_Centers_in_Morocco
|
List of Research Centers in Morocco
| 2024-03-04T20:39:34 |
# List of Research Centers in Morocco
| Research Centers in Morocco | Field of activity |
| --- | --- |
| Laboratory for Research on Comparative Democratic Transition (LRCDT), Settat | Social Sciences |
| Laboratoire d'Etudes Politiques et de Sciences Humaines et Sociales (LEPOSHS) Archived 2018-08-03 at the Wayback Machine, Rabat | Humanities and Social Sciences |
| Center for Studies and Research in Humanities and Social Sciences (CERHSO), Oujda | Humanities and Social Sciences |
| Royal Institute for Strategic Studies (IRES), Rabat | Strategic Studies |
| Centre for Studies and Research on International Migration and Sustainable Development (CERMID), Casablanca Archived 2013-12-14 at the Wayback Machine | Migration and Development |
| Moroccan Center for Contemporary Studies and Research (CMERC), Rabat | Social Sciences & Humanities to Study Values |
| Centre for Studies and Research in Social Sciences (CERS), Rabat | Social Sciences |
| Centre d’Etudes Sociales, Economiques et Managériales (CESEM), Casablanca | Social Sciences |
| Centre Jacques Berque pour le Développement des Sciences Humaines et Sociales au Maroc (CJB), Rabat | Humanities & Social Sciences |
| Hillary Rodham Clinton Women’s Empowerment Center, Ifrane | Humanities & Social Sciences |
| Interdisciplinary Moroccan Center for Strategic and International Studies (CMIESI), Fez | International and Strategic Studies |
| Centre Marocain de Conjoncture (CMC), Rabat | Social Sciences |
| Research Institute for Development, Rabat | Development Studies |
|
|
| Center for Demographic Studies and Research(CERD), Rabat | Demographic Studies |
| Royal Institute for Research in the History of Morocco (IRRHM), Rabat | History of the Kingdom of Morocco |
| Center for Legal, Economic, and Social Studies (LINKS), Rabat | Social Sciences |
| Moroccan Center for Strategic Studies (CMES), Rabat | Strategic Studies |
| National Center for Scientific and Technical Research, Rabat | Scientific Research |
| National Institute for Agricultural Research (INRA), Rabat | Agricultural Research |
| Institute for African Studies, Rabat | African Studies |
| Moroccan Institute for Scientific and Technical Information (IMIST), Rabat | Research Information Technology |
| Pasteur Institute in Morocco, Casablanca | Medicine |
| Scientific Institute at Mohammed V University, Rabat Archived 2013-12-16 at the Wayback Machine | Natural Science |
| Institute for Research on Solar and new Energies (IRESEN), Rabat | Renewable Energy |
| National Institute Research for Fishery Research, Casablanca | Fishery |
| National Institute of Statistics and Applied Economics, Rabat | Statistics and Applied Economics |
| Moroccan Association for Research and Development, Casablanca | Research and Development |
| Moroccan Society of Rheumatology, Rabat | Medicine |
| Moroccan Association for Studies and Research on Migration, Rabat | Migration |
| National Institute for Urban Planning and Urbanism Archived 2018-06-12 at the Wayback Machine | Urbanism |
| Institute of Economic Analysis and Prospective Studies (IEAPS), Ifrane | Economic and Prospective Studies |
| Center for Business Ethics (CBE) Archived 2018-06-12 at the Wayback Machine, Ifrane | Training and Research |
| Social Science Research Institute (SSRI), Ifrane | Social Sciences |
| RESO Education Foundation | Education |
| Mominoun Without Borders, Rabat | Social Sciences |
| Social and Media Studies Institute (SMSI), Casablanca | Social Sciences and media studies |
|
|
71,411,846 |
https://en.wikipedia.org/wiki/MSGSU_Istanbul_Museum_of_Painting_and_Sculpture
|
MSGSU Istanbul Museum of Painting and Sculpture
|
The MSGSU Istanbul Museum Of Painting And Sculpture is a museum of the Mimar Sinan Fine Arts University at the Galataport complex in the Karaköy neighborhood of Beyoğlu district, Istanbul, Turkey. It is 17,700 sqm in size and is housed in a converted shipping warehouse. Sedad Hakkı Eldem of Emre Arolat Architecture executed the conversion and museum's design.
| 2023-11-25T13:18:22 |
# MSGSU Istanbul Museum of Painting and Sculpture
The **MSGSU Istanbul Museum Of Painting And Sculpture** is a museum of the Mimar Sinan Fine Arts University at the Galataport complex in the Karaköy neighborhood of Beyoğlu district, Istanbul, Turkey. It is 17,700 sqm in size and is housed in a converted shipping warehouse. Sedad Hakkı Eldem of Emre Arolat Architecture executed the conversion and museum's design.
## InfoBox
MSGSU Istanbul Museum of Painting and Sculpture
| Location | Turkey |
| --- | --- |
|
44,266,627 |
https://en.wikipedia.org/wiki/Mimostedes
|
Mimostedes
|
Mimostedes is a genus of longhorn beetles of the subfamily Lamiinae, containing the following species: subgenus Birmanostedes Mimostedes birmanus Breuning, 1958 subgenus Mimostedes Mimostedes basilewskyi Breuning, 1955
Mimostedes decellei Breuning, 1968
Mimostedes fuscosignatus Breuning, 1956
Mimostedes fuscus Breuning, 1967
Mimostedes mirei Breuning, 1977
Mimostedes sudanicus Breuning, 1955
Mimostedes trivittipennis Breuning, 1956
Mimostedes ugandicola Breuning, 1955
Mimostedes vagemaculatus Breuning, 1970 subgenus Nairobostedes Mimostedes meneghettii Breuning, 1958 subgenus Punjabostedes Mimostedes kashmirensis Breuning, 1957
Mimostedes punjabensis Breuning, 1957
| 2019-06-30T10:11:26 |
# Mimostedes
***Mimostedes*** is a genus of longhorn beetles of the subfamily Lamiinae, containing the following species:
subgenus *Birmanostedes*
subgenus *Mimostedes*
subgenus *Nairobostedes*
subgenus *Punjabostedes*
## InfoBox
| *Mimostedes* | |
| --- | --- |
|
| Scientific classification | |
| Kingdom: | Animalia |
| Phylum: | Arthropoda |
| Class: | Insecta |
| Order: | Coleoptera |
| Family: | Cerambycidae |
| Subfamily: | Lamiinae |
| Genus: | ***Mimostedes*** |
|
|
29,569,613 |
https://en.wikipedia.org/wiki/Mount_Medina
|
Mount Medina
|
Mount Medina is a prominent ice-covered mountain which rises to 1,845 metres (6,050 ft) from the northeastern part of Hadley Upland and overlooks the head of Gibbs Glacier in southern Graham Land, Antarctica. It was photographed by the Ronne Antarctic Research Expedition in November 1947, and was surveyed by the Falkland Islands Dependencies Survey in 1958. The mountain was named by the UK Antarctic Place-Names Committee after Pedro de Medina (1493–1567), Spanish Cosmographer Royal, who wrote Arte de Navegar, an important manual of navigation.
| 2022-04-15T05:06:27 |
# Mount Medina
**Mount Medina** (68°27′S 66°15′W / 68.450°S 66.250°W / -68.450; -66.250) is a prominent ice-covered mountain which rises to 1,845 metres (6,050 ft) from the northeastern part of Hadley Upland and overlooks the head of Gibbs Glacier in southern Graham Land, Antarctica. It was photographed by the Ronne Antarctic Research Expedition in November 1947 (trimetrogon air photography), and was surveyed by the Falkland Islands Dependencies Survey in 1958. The mountain was named by the UK Antarctic Place-Names Committee after Pedro de Medina (1493–1567), Spanish Cosmographer Royal, who wrote *Arte de Navegar* (Valladolid, 1545), an important manual of navigation.
This article incorporates public domain material from "Mount Medina". *Geographic Names Information System*. United States Geological Survey.
|
4,418,894 |
https://en.wikipedia.org/wiki/Himalaya_Kingdom
|
Himalaya Kingdom
|
The Himalaya kingdom was a mountainous country in the Himalayas, mentioned in the Puranas. In the puranas, Himavat was its ruler and his daughter Parvati was a princess from this kingdom. The Indian epic Mahabharata doesn't mention a kingdom named Himalaya, but mentions many kingdoms in the Himalaya mountains like the Kuninda, Parvata, Nepa, Kirata, Kimpurusha, and Kinnara.
| 2023-09-05T12:23:31 |
# Himalaya Kingdom
The **Himalaya kingdom** was a mountainous country in the Himalayas, mentioned in the Puranas. In the puranas, Himavat was its ruler and his daughter Parvati was a princess from this kingdom. The Indian epic Mahabharata doesn't mention a kingdom named Himalaya, but mentions many kingdoms in the Himalaya mountains like the Kuninda, Parvata, Nepa, Kirata, Kimpurusha, and Kinnara.
## References in Mahabharata
It was told that Arjuna made an expedition to the kingdoms in the mountainous Himalayan regions (2:27). Having conquered all the Himalayas and the Nishkuta mountains and arriving at the White mountains, he encamped on its breast (2:26). Pandavas saw with delight the extensive domains of Suvahu, situated on the Himalayas, abounding in horses and elephants, densely inhabited by the Kiratas and the Tanganas, and crowded by hundreds of Pulindas (3:140). Pandavas were mentioned as mining gold from the *gold mines of Himalayas* at (14:63,64).
|
2,554,383 |
https://en.wikipedia.org/wiki/Jarmo_Wasama_memorial_trophy
|
Jarmo Wasama memorial trophy
|
The Jarmo Wasama Memorial Trophy is an ice hockey award given by the Finnish Liiga to the best rookie of the season. The trophy is named in honor of Jarmo Wasama, a young Finnish defenseman who was killed in an automobile accident in 1966. In 2020 it was awarded to Matias Maccelli of Ilves.
| 2024-02-11T22:30:59 |
# Jarmo Wasama memorial trophy
The **Jarmo Wasama Memorial Trophy** is an ice hockey award given by the Finnish Liiga to the best rookie of the season. The trophy is named in honor of Jarmo Wasama, a young Finnish defenseman who was killed in an automobile accident in 1966. In 2020 it was awarded to Matias Maccelli of Ilves.
## Winners
1971-72: Seppo Ahokainen (Ilves)
1972-73: Jukka Alkula (Tappara)
1973-74: Matti Hagman (HIFK)
1974-75: Markus Mattsson (Ilves)
1975-76: Kari Makkonen (Ässät)
1976-77: Risto Siltanen (Ilves)
1977-78: Markku Kiimalainen (Kärpät)
1978-79: Kari Jalonen (Kärpät)
1979-80: Pekka Arbelius (Kärpät)
1980-81: Petri Skriko (SaiPa)
1981-82: Hannu Virta (TPS)
1982-83: Jukka Tammi (Ilves)
1983-84: Joel Paunio (HIFK)
1984-85: Jari Neuvonen (Ilves)
1985-86: Risto Kurkinen (JYP)
1986-87: Janne Ojanen (Tappara)
1987-88: Mika Nieminen (Ilves)
1988-89: Pekka Peltola (HPK)
1989-90: Vesa Viitakoski (SaiPa)
1990-91: Janne Grönvall (Tappara)
1991-92: Petri Varis (Ässät)
1992-93: Ville Peltonen (HIFK)
1993-94: Juha Lind (Jokerit)
1994-95: Joni Lehto (Lukko)
1995-96: Jani Hurme (TPS)
1996-97: Olli Jokinen (HIFK)
1997-98: Pasi Puistola (Ilves)
1998-99: Timo Pärssinen (HPK)
1999-00: Antero Niittymäki (TPS)
2000-01: Toni Dahlman (Ilves)
2001-02: Joonas Vihko (HIFK)
2002-03: Toni Söderholm (HIFK)
2003-04: Janne Pesonen (Kärpät)
2004-05: Simo Vidgren (Ilves)
2005-06: Perttu Lindgren (Ilves)
2006-07: Tuomas Suominen (TPS)
2007-08: Oskar Osala (Blues)
2008-09: Teemu Hartikainen (KalPa)
2009-10: Mikael Granlund (HIFK)
2010-11: Teemu Pulkkinen (Jokerit)
2011-12: Teuvo Teräväinen (Jokerit)
2012-13: Artturi Lehkonen (KalPa)
2013-14: Juuse Saros (HPK)
2014-15: Otso Rantakari (Blues)
2015-16: Patrik Laine (Tappara)
2016-17: Otto Koivula (Ilves)
2017-18: Petrus Palmu (TPS)
2018-19: Kaapo Kakko (TPS)
2019–20: Matias Maccelli (Ilves)
2020–21: Kasper Björkqvist (KooKoo)
2021-22: Joakim Kemell (JYP)
2022-23: Niko Huuhtanen (Jukurit)
Source:
|
15,298,045 |
https://en.wikipedia.org/wiki/Kazue_Sawai
|
Kazue Sawai
|
Kazue Sawai is a Japanese koto player noted for her performance of contemporary classical music and free improvisation. She began studying, at the age of eight, with Michio Miyagi. She later graduated from the Tokyo National University of Fine Arts and Music. She plays both the 13-string and 17-string kotos. As a soloist, as well as with her koto ensemble, she has performed and worked with John Cage, Toshi Ichiyanagi, Yuji Takahashi, Ayuo, Roberto Carnevale, Sofia Gubaidulina, David Behrman, Carl Stone, and many other composers. She has performed in Japan, North America, and Europe. She was married to the late Tadao Sawai, who was also a koto player and composer. The couple had a son Hikaru Sawai, who is also a koto player and composer. She operates a school in Japan, where she teaches both Japanese and foreign students. Her students include Michiyo Yagi, Elizabeth Falconer, Shoko Hikage, and Mei Han.
| 2023-04-29T13:43:58 |
# Kazue Sawai
**Kazue Sawai** (沢井 一恵, *Sawai Kazue*, born 1941 in Kyoto) is a Japanese *koto* player noted for her performance of contemporary classical music and free improvisation.
She began studying, at the age of eight, with Michio Miyagi. She later graduated from the Tokyo National University of Fine Arts and Music.
She plays both the 13-string and 17-string kotos. As a soloist, as well as with her koto ensemble, she has performed and worked with John Cage, Toshi Ichiyanagi, Yuji Takahashi, Ayuo, Roberto Carnevale, Sofia Gubaidulina, David Behrman, Carl Stone, and many other composers. She has performed in Japan, North America, and Europe.
She was married to the late Tadao Sawai, who was also a *koto* player and composer. The couple had a son Hikaru Sawai (b. 1964), who is also a *koto* player and composer.
She operates a school in Japan, where she teaches both Japanese and foreign students. Her students include Michiyo Yagi, Elizabeth Falconer, Shoko Hikage, and Mei Han.
|
50,808,086 |
https://en.wikipedia.org/wiki/Klokotnitsa_Ridge
|
Klokotnitsa Ridge
|
Klokotnitsa Ridge is the rounded ice-covered ridge extending 12 km in north-south direction, 4 km wide and rising to 1600 m on Trinity Peninsula in Graham Land, Antarctica. It is situated on the northwest side of Detroit Plateau, with two northerly offshoots of the ridge forming Dragor Hill and Borovan Knoll. The feature has steep and partly ice-free west, north and east E slopes surmounting Whitecloud Glacier to the west and McNeile Glacier to the east. The ridge is named after the settlement of Klokotnitsa in Southern Bulgaria.
| 2023-06-28T16:23:22 |
# Klokotnitsa Ridge
**Klokotnitsa Ridge** (Bulgarian: хребет Клокотница, ‘Hrebet Klokotnitsa’ \\'hre-bet klo-'kot-ni-tsa\\) is the rounded ice-covered ridge extending 12 km in north-south direction, 4 km wide and rising to 1600 m on Trinity Peninsula in Graham Land, Antarctica. It is situated on the northwest side of Detroit Plateau, with two northerly offshoots of the ridge forming Dragor Hill and Borovan Knoll. The feature has steep and partly ice-free west, north and east E slopes surmounting Whitecloud Glacier to the west and McNeile Glacier to the east.
The ridge is named after the settlement of Klokotnitsa in Southern Bulgaria.
## Location
Klokotnitsa Ridge is centred at 63°57′55″S 59°27′25″W / 63.96528°S 59.45694°W / -63.96528; -59.45694, which is 28.8 km southeast of Cape Kater and 26.7 km south of Cape Kjellman. German-British mapping in 1996.
## Maps
* Trinity Peninsula. Scale 1:250000 topographic map No. 5697. Institut für Angewandte Geodäsie and British Antarctic Survey, 1996.
* Antarctic Digital Database (ADD). Scale 1:250000 topographic map of Antarctica. Scientific Committee on Antarctic Research (SCAR), 1993–2016.
*This article includes information from the Antarctic Place-names Commission of Bulgaria which is used with permission.*
|
43,935,177 |
https://en.wikipedia.org/wiki/Kurdish_Canadians
|
Kurdish Canadians
|
Kurdish Canadians refers to people of Kurdish origin who are born in or living in Canada. The Kurdish community in Canada is 16,315 based on the 2016 Canadian Census, among which the Iraqi Kurds make up the largest group of Kurds in Canada, exceeding the numbers of Kurds from Turkey, Iran and Syria. In Canada, Kurdish immigration was largely the result of the Iran–Iraq War, the Gulf War and Syrian Civil War. Thus, many Iraqi Kurds immigrated to Canada due to the constant wars and suppression of Kurds and Shiites by the Iraqi government. Many Kurds arrived in Canada in the 1980s and the 1990s, most of whom were refugees resettled by the Government of Canada. However, smaller numbers of them also immigrated to Canada in the 1960s and 1970s. Like all Canadians with origins in West Asia, Kurdish Canadians are legally defined as a visible minority, irrespective of their appearance.
| 2024-02-23T10:31:34 |
# Kurdish Canadians
**Kurdish Canadians** refers to people of Kurdish origin who are born in or living in Canada.
The Kurdish community in Canada is 16,315 based on the 2016 Canadian Census, among which the Iraqi Kurds make up the largest group of Kurds in Canada, exceeding the numbers of Kurds from Turkey, Iran and Syria.
In Canada, Kurdish immigration was largely the result of the Iran–Iraq War, the Gulf War and Syrian Civil War. Thus, many Iraqi Kurds immigrated to Canada due to the constant wars and suppression of Kurds and Shiites by the Iraqi government. Many Kurds arrived in Canada in the 1980s and the 1990s, most of whom were refugees resettled by the Government of Canada. However, smaller numbers of them also immigrated to Canada in the 1960s and 1970s.
Like all Canadians with origins in West Asia, Kurdish Canadians are legally defined as a visible minority, irrespective of their appearance.
## 2011 census
| Provinces and territories | Kurdish as mother tongue |
| --- | --- |
| Ontario | 6,830 |
| Alberta | 1,465 |
| British Columbia | 1,435 |
| Quebec | 1,415 |
| Manitoba | 260 |
| Saskatchewan | 110 |
| Nova Scotia | 55 |
| New Brunswick | 40 |
| Prince Edward Island | 30 |
|
## 2016 census
| Province or territory | Number of Kurdish speakers |
| --- | --- |
| Ontario | 8,095 |
| British Columbia | 1,915 |
| Alberta | 1,680 |
| Quebec | 1,040 |
| Manitoba | 440 |
| Saskatchewan | 155 |
| Nova Scotia | 125 |
| New Brunswick | 55 |
| Newfoundland and Labrador | 10 |
| Nunavut | 5 |
| Northwest Territories | |
| Prince Edward Island | |
| Yukon | |
|
## InfoBox
Kurdish Canadians
| Total population | |
| --- | --- |
| 16,315 (2016 census) | |
| Regions with significant populations | |
| Toronto, Montreal, Vancouver, Calgary, Edmonton, Ottawa | |
| Languages | |
| Kurdish, Canadian English, Canadian French | |
| Religion | |
| Majority Islam (Sunni Muslim, Shia Islam)<br>with minorities of Kurdish Alevism, Yazidism, Yarsanism, Zoroastrianism, Judaism, Christianity | |
| Related ethnic groups | |
| Kurdish diaspora | |
|
29,551,339 |
https://en.wikipedia.org/wiki/Montgolfier_Glacier
|
Montgolfier Glacier
|
Montgolfier Glacier is a glacier situated between Rozier Glacier and Woodbury Glacier and flowing between Balis Ridge and Bacho Kiro Peak into Piccard Cove on the west coast of Graham Land, Antarctica. The glacier was mapped by the Falkland Islands Dependencies Survey from photos taken by Hunting Aerosurveys Ltd in 1956–57, and was named by the UK Antarctic Place-Names Committee in 1960 for brothers Joseph-Michel and Jacques-Étienne Montgolfier, French papermakers, inventors of the hot air balloon in 1782–83, and pioneer balloonists.
| 2022-08-31T14:43:03 |
# Montgolfier Glacier
**Montgolfier Glacier** (64°47′S 62°15′W / 64.783°S 62.250°W / -64.783; -62.250) is a glacier situated between Rozier Glacier and Woodbury Glacier and flowing between Balis Ridge and Bacho Kiro Peak into Piccard Cove on the west coast of Graham Land, Antarctica.
The glacier was mapped by the Falkland Islands Dependencies Survey from photos taken by Hunting Aerosurveys Ltd in 1956–57, and was named by the UK Antarctic Place-Names Committee in 1960 for brothers Joseph-Michel and Jacques-Étienne Montgolfier, French papermakers, inventors of the hot air balloon in 1782–83, and pioneer balloonists.
This article incorporates public domain material from "Montgolfier Glacier". *Geographic Names Information System*. United States Geological Survey.
|
11,294,705 |
https://en.wikipedia.org/wiki/List_of_political_parties_in_Central_America_by_country
|
List of political parties in Central America by country
|
This is a List of political parties in Central America by country, linking to the country list of parties and the political system of each country in the region.
| 2022-03-12T16:59:33 |
# List of political parties in Central America by country
This is a **List of political parties in Central America by country**, linking to the country list of parties and the political system of each country in the region.
## List of countries
| | Country | Multi party | Two party | Dominant party | Single party | No party |
| --- | --- | --- | --- | --- | --- | --- |
| | Belize | | | | | |
| | Costa Rica | | | | | |
| | El Salvador | | | | | |
| | Guatemala | | | | | |
| | Honduras | | | | | |
| | Nicaragua | | | | | |
| | Panama | | | | | |
|
29,433,194 |
https://en.wikipedia.org/wiki/Mount_Curl
|
Mount Curl
|
Mount Curl is the snow-covered summit of a ridge located 4 nautical miles (7 km) east-northeast of Gatlin Peak, just northeast of the Welch Mountains in Palmer Land. It was mapped by the U.S. Geological Survey in 1974, and named by the Advisory Committee on Antarctic Names for James E. Curl, a U.S. Antarctic Program glaciologist in the South Shetland Islands, 1971–72, 1972–73 and 1973–74.
| 2023-10-16T19:46:28 |
# Mount Curl
**Mount Curl** (70°48′S 63°7′W / 70.800°S 63.117°W / -70.800; -63.117) is the snow-covered summit of a ridge located 4 nautical miles (7 km) east-northeast of Gatlin Peak, just northeast of the Welch Mountains in Palmer Land. It was mapped by the U.S. Geological Survey in 1974, and named by the Advisory Committee on Antarctic Names for James E. Curl, a U.S. Antarctic Program glaciologist in the South Shetland Islands, 1971–72, 1972–73 and 1973–74.
This article incorporates public domain material from "Curl, Mount". *Geographic Names Information System*. United States Geological Survey.
|
39,306,785 |
https://en.wikipedia.org/wiki/2009_NCAA_Division_I_Men%27s_Golf_Championship
|
2009 NCAA Division I Men's Golf Championship
|
The 2009 NCAA Division I Men's Golf Championship was a golf tournament contested from May 26 to May 30, 2009 at the Inverness Club in Toledo, Ohio. It was the 71st NCAA Division I Men's Golf Championship. The team championship was won by the Texas A&M Aggies who won their first national championship by defeating the Arkansas Razorbacks in the championship match play round 3–2. This was the first tournament to feature a match play playoff to determine the national champion. The individual national championship was won by Matt Hill from North Carolina State University.
| 2024-03-06T19:07:00 |
# 2009 NCAA Division I Men's Golf Championship
The **2009 NCAA Division I Men's Golf Championship** was a golf tournament contested from May 26 to May 30, 2009 at the Inverness Club in Toledo, Ohio. It was the 71st NCAA Division I Men's Golf Championship. The team championship was won by the Texas A&M Aggies who won their first national championship by defeating the Arkansas Razorbacks in the championship match play round 3–2. This was the first tournament to feature a match play playoff to determine the national champion. The individual national championship was won by Matt Hill from North Carolina State University.
## Venue
This was the second NCAA Division I Men's Golf Championship held at the Inverness Club in Toledo, Ohio. The first was won by Notre Dame in 1944.
41°38′47″N 83°39′1″W / 41.64639°N 83.65028°W / 41.64639; -83.65028
## InfoBox
2009 NCAA Division I Men's Golf Championship
| Tournament information | |
| --- | --- |
| Dates | May 26–30, 2009 |
| Location | Toledo, Ohio, U.S.<br>41°39′07″N 83°39′04″W / 41.651848°N 83.650993°W / 41.651848; -83.650993 |
| Course(s) | Inverness Club |
| Statistics | |
| Par | 71 |
| Field | 156 players, 30 teams |
| Champion | |
| Team: Texas A&M<br>Individual: Matt Hill, NC State | |
| Team: 3–2 (def. Arkansas)<br>Individual: 207 (−6) | |
| Location map | |
| InvernessLocation in the United StatesInvernessLocation in Ohio | |
| | |
|
62,936,990 |
https://en.wikipedia.org/wiki/2009_NCAA_Division_I_Tennis_Championships
|
2009 NCAA Division I Tennis Championships
|
The 2009 NCAA Division I Tennis Championships were the 63rd annual men's and 27th annual women's championships to determine the national champions of NCAA Division I men's and women's singles, doubles, and team collegiate tennis in the United States. The tournaments were played concurrently during May 2009. USC defeated Ohio State in the men's championship, 4–1, to claim the Trojans' seventeenth team national title. Duke defeated California in the women's championship, 4–0, to claim the Blue Devils' first team national title.
| 2022-09-15T03:25:57 |
# 2009 NCAA Division I Tennis Championships
The **2009 NCAA Division I Tennis Championships** were the 63rd annual men's and 27th annual women's championships to determine the national champions of NCAA Division I men's and women's singles, doubles, and team collegiate tennis in the United States. The tournaments were played concurrently during May 2009.
USC defeated Ohio State in the men's championship, 4–1, to claim the Trojans' seventeenth team national title.
Duke defeated California in the women's championship, 4–0, to claim the Blue Devils' first team national title.
## Host sites
This year's tournaments were played at the Mitchell Tennis Center at Texas A&M University in College Station, Texas.
* NCAA Division II Tennis Championships (Men, Women)
* NCAA Division III Tennis Championships (Men, Women)
## InfoBox
| 2009 NCAA Division I Tennis Championships | |
| --- | --- |
| | |
| Edition | 63rd–Men<br>27th–Women |
| Location | College Station, Texas |
| Venue | Mitchell Tennis Center<br>Texas A&M University |
| Champions | |
| Men's singles | |
| Devin Britton<br>(Ole Miss) | |
| Women's singles | |
| Mallory Cecil<br>(Duke) | |
| Men's doubles | |
| Dominic Inglot / Michael Shabaz<br>(Virginia) | |
| Women's doubles | |
| Mari Andersson / Jana Juricová<br>(California) | |
| | |
|
1,673,309 |
https://en.wikipedia.org/wiki/Nevanas_affair
|
Nevanas affair
|
The Nevanas affair was a political scandal in Western Australia that was partly responsible for the downfall of John Scaddan's Labor government. Early in 1914, Scaddan and one of his ministers signed a contract with the London financier S. V. Nevanas, for the erection of a meat works in Wyndham at an estimated cost of £155,000. They did so without consulting the rest of the cabinet, and against the advice of officers of the Public Works Department, who felt that the price was unrealistically low. Shortly afterwards, the government cancelled the contract on the grounds that the company had not complied with the conditions of the contract. However Nevanas received substantial financial compensation for the cancellation. Many members of the Labor party were angered at the failure to call for public tenders, and the opposition were unsatisfied with the government's explanation for the cancellation. Eventually, a Select committee was set up to inquire into the matter. The committee's report revealed, amongst other findings, that Scaddan had written to Nevanas offering him management of the works. The report triggered an extensive and acrimonious debate in the Legislative Assembly in November 1915, during which the government was strongly opposed by three of its backbench members, Edward Heitmann, Bertie Johnston and George Taylor. The government survived a no-confidence vote by a single vote, and only by promising its backbench critics a leadership spill. Despite this promise, caucus subsequently voted to confirm the existing ministry. In response, Bertie Johnston resigned from the party and parliament. He then contested the subsequent by-election as an independent, and won. This left the government with only 24 seats in a house of 50, and shortly afterwards the Scaddan government was defeated and forced to resign.
| 2022-05-15T07:53:37 |
# Nevanas affair
The **Nevanas affair** was a political scandal in Western Australia that was partly responsible for the downfall of John Scaddan's Labor government.
Early in 1914, Scaddan and one of his ministers signed a contract with the London financier S. V. Nevanas, for the erection of a meat works in Wyndham at an estimated cost of £155,000. They did so without consulting the rest of the cabinet, and against the advice of officers of the Public Works Department, who felt that the price was unrealistically low. Shortly afterwards, the government cancelled the contract on the grounds that the company had not complied with the conditions of the contract. However Nevanas received substantial financial compensation for the cancellation.
Many members of the Labor party were angered at the failure to call for public tenders, and the opposition were unsatisfied with the government's explanation for the cancellation. Eventually, a Select committee was set up to inquire into the matter. The committee's report revealed, amongst other findings, that Scaddan had written to Nevanas offering him management of the works. The report triggered an extensive and acrimonious debate in the Legislative Assembly in November 1915, during which the government was strongly opposed by three of its backbench members, Edward Heitmann, Bertie Johnston and George Taylor. The government survived a no-confidence vote by a single vote, and only by promising its backbench critics a leadership spill.
Despite this promise, caucus subsequently voted to confirm the existing ministry. In response, Bertie Johnston resigned from the party and parliament. He then contested the subsequent by-election as an independent, and won. This left the government with only 24 seats in a house of 50, and shortly afterwards the Scaddan government was defeated and forced to resign.
* Black, David (1981). "Party Politics in Turmoil". In Charles Stannage (ed.). *A New History of Western Australia*. Nedlands, Western Australia: University of Western Australia Press. ISBN 0-85564-170-3.
* Oliver, Bobbie (1995). *War and Peace in Western Australia: The Social and Political Impact of the Great War*. Nedlands, Western Australia: University of Western Australia Press. ISBN 1-875560-57-2.
|
10,021,685 |
https://en.wikipedia.org/wiki/Meek_Channel
|
Meek Channel
|
The Meek Channel is a strait separating Galindez Island from Grotto Island and Corner Island in the Argentine Islands, Wilhelm Archipelago, Antarctica. It was charted in 1935 by the British Graham Land Expedition under John Rymill, and named for William McC. Meek, marine architect and surveyor, who was of assistance in preparing the expedition ship Penola for the voyage.
| 2023-10-27T10:49:43 |
# Meek Channel
The **Meek Channel** (65°15.5′S 64°15′W / 65.2583°S 64.250°W / -65.2583; -64.250) is a strait separating Galindez Island from Grotto Island and Corner Island in the Argentine Islands, Wilhelm Archipelago, Antarctica. It was charted in 1935 by the British Graham Land Expedition under John Rymill, and named for William McC. Meek, marine architect and surveyor, who was of assistance in preparing the expedition ship *Penola* for the voyage.
This article incorporates public domain material from "Meek Channel". *Geographic Names Information System*. United States Geological Survey.
|
75,631,713 |
https://en.wikipedia.org/wiki/Peach_Boxing
|
Peach Boxing
|
Peach Boxing is a boxing gym created by Isaac Peach and Alina Peach in 2013, based in Henderson Valley, New Zealand. The gym focuses on professional boxing, amateur boxing and corporate boxing, and currently trains boxers including IBO world champion Mea Motu, WBO World title contender David Light, Andrei Mikhailovich and Jerome Pampellone. The gym has multiple professional boxers who have signed with major promotions in Australia and New Zealand, such as No Limits Boxing promoted by Matt Rose and George Rose in Australia, and D&L Events promoted by Dean Lonergan in Australia and New Zealand.
| 2024-04-24T17:13:12 |
# Peach Boxing
**Peach Boxing** is a boxing gym created by Isaac Peach and Alina Peach in 2013, based in Henderson Valley, New Zealand. The gym focuses on professional boxing, amateur boxing and corporate boxing (internationally known as white-collar boxing), and currently trains boxers including IBO world champion Mea Motu, WBO World title contender David Light, Andrei Mikhailovich and Jerome Pampellone. The gym has multiple professional boxers who have signed with major promotions in Australia and New Zealand, such as No Limits Boxing promoted by Matt Rose and George Rose in Australia, and D&L Events promoted by Dean Lonergan in Australia and New Zealand.
## Boxers
### Amateur Boxers
* Asel Opata
* Baylee Macdonald
* Benjamin Stowers
* Brierley Auimatagi
* Dominic Pratt
* Joshua Tau
* Keanu Naden
* Keke Tinga
* Kwadjo Opoku
* Kyan Hand
* Matt Anirudh
* Noah Collier
* Oliver Firth
* Omid Azizi
* Parker Hales
* Sonny Morini
* Stevie Archer
### Professional Boxing
### Alumni
### Celebrity Boxing
## Awards
* New Zealand Boxing Awards
+ 2020 Gym of the year **(Won)**
+ 2021 Gym of the year **(Won)**
+ 2022 Gym of the year **(Won)**
## InfoBox
Peach Boxing
| Full name | Peach Boxing |
| --- | --- |
| Founded | 2013 |
| Location | West Auckland, New Zealand |
| Coach(es) | |
| Official website | |
| https://peachboxing.co.nz/ | |
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.