text
stringlengths 2
1.05M
| repo_name
stringlengths 5
101
| path
stringlengths 4
991
| language
stringclasses 3
values | license
stringclasses 5
values | size
int64 2
1.05M
|
|---|---|---|---|---|---|
Q:
Java Stream list operation
Have a List<SomeObject> where SomeObject has a date field among other fields. Using Java Streams was looking to obtain two lists, one containing the SomeObject instances for which the date field is non-empty while the other containing the remaining SomeObject instances with empty date fields.
A:
You are looking for Collectors.partitioningBy:
Map<Boolean,List<SomeObject>> partition =
list.stream().collect(Collectors.partitioningBy(s->s.getDate()!=null));
| null | minipile | NaturalLanguage | mit | null |
Main menu
How To Win Clients And Influence Markets with Car Insurance
Contractors’ all risks (AUTOMOBILE) insurance is a non-standard insurance coverage that gives protection for property injury and third-occasion injury or damage claims, the two major sorts of risks on development tasks. This facet of UK motor insurance coverage is the one one which purports to cowl the driving of a car, not use. If you’re at-fault in a automotive accident, the injured social gathering will need compensation. You can drive your car without worries whenever you compare automobile insurance online and buy automotive insurance coverage on-line and carry it while driving.
By understanding phrases and situations of automobile insurance online plans, car-homeowners can avoid higher car insurance coverage premium when they renew car insurance coverage on-line. You do not need it. But you might have considered trying it to keep away from paying your deductible or filing a declare with your insurer in case something goes improper.
In case your vehicle is serviced at a garage outdoors their network, you’ll be able to claim reimbursement for the same. Compulsory Third Party (CTP) insurance coverage covers injuries to folks resembling pedestrians, cyclists and different highway customers when your vehicle is concerned in an accident. For those who install anti-theft gadgets which are accredited by the Automotive Analysis Association of India (ARAI), you can stand up to 2.5% discount by yourself-injury premium.
Except you’re the first owner of your car and the automobile is less than 1 yr old on the time of theft or total loss. The agent I spoke to had good communication expertise and persuasion energy. Uninsured motorist protection reimburses you when an accident is brought on by a driver who does not have auto insurance coverage—or in the case of a hit-and-run.
In NSW, the 2011 Auditor Normal’s report found young drivers accounted for 25 per cent of all drivers killed, regardless of representing solely sixteen per cent of motorists. Net Banking -Transfer the premium quantity on-line through ICICI Bank and 13 other selected Banks. Waiver of Depreciation – Permits for new car substitute when car is lower than a sure age (e.g. generally 24-36 months or newer, but sometimes up to five years) when declared a complete loss after an accident.
Accident Benefits/Lack of Earnings – The governments of each province require that automotive house owners purchase insurance coverage for their own medical prices and attainable lack of revenue on account HLAS Car Insurance of driving accidents. Contemplate Increased Deductibles – No one desires to pay higher deductibles in the case of an accident, but they do help lower your insurance premiums.
This add-on cover helps you defend your gathered NCB in case you make a declare, enable you keep discount on following 12 months’s automotive insurance premium. Get all the benefits of accident forgiveness and luxuriate in a roadside help service. Over recent years, insurers have launched plenty of innovative new policies. | null | minipile | NaturalLanguage | mit | null |
N-ACETYLCYSTEINE AND/OR URSODEOXYCHOLIC ACID ASSOCIATED WITH METFORMIN IN NON-ALCOHOLIC STEATOHEPATITIS: AN OPEN-LABEL MULTICENTER RANDOMIZED CONTROLLED TRIAL.
Nowadays, pharmacological treatment of non-alcoholic fatty liver disease (NAFLD) is still limited and it is based on the treatment of conditions associated comorbities. Oxidative stress and insulin resistance are the mechanisms that seem to be mostly involved in its pathogenesis. To evaluate the efficacy of N-acetylcysteine (NAC) in combination with metformin (MTF) and/or ursodeoxycholic acid (UDCA) for treatment of non-alcoholic steatohepatitis (NASH). Open-label multicenter randomized trial was conducted for 48 weeks. It included patients with biopsy-proven NASH. The patients were randomized into three groups: NAC (1.2 g) + UDCA (15 mg/kg) + MTF (850-1500 mg/day) (n=26); UDCA (20 mg/kg) + MTF (850-1500 mg/day) (n=13); NAC (1.2g) + MTF (850-1500 mg/day) (n=14) for 48 weeks. Clinical, laboratory and the second liver biopsies were performed after 48 weeks. A total of 53 patients were evaluated; 17 (32.1%) were males; median age ±54 (IQR=15, 21-71) years. In the baseline, no difference was seen between groups according clinical and histological parameters. The groups differed only in cholesterol, LDL and triglycerides. No significant differences in biochemical and histologic parameters were found between these the three groups after 48 weeks of treatment. In the intragroup analysis (intention-to-treat) comparing histological and biochemical features, there were significant improvements in the steatosis degree (P=0.014), ballooning (0.027) and, consequently, in the NAFLD Activity Score (NAS) (P=0.005), and in the ALT levels at the end of the treatment only in the NAC + MTF group. No significant evidence of modification in the liver fibrosis could be observed in any of the groups. This multicenter study suggests that the association of NAC + MTF could reduce the liver disease activity in patients with NASH. These data stimulate further controlled studies with this therapy for these patients. | null | minipile | NaturalLanguage | mit | null |
overrides:
ceph:
log-ignorelist:
- responding to mclientcaps\(revoke\)
- not advance its oldest_client_tid
- failing to advance its oldest client/flush tid
- Too many inodes in cache
- failing to respond to cache pressure
- slow requests are blocked
- failing to respond to capability release
- MDS cache is too large
- \(MDS_CLIENT_OLDEST_TID\)
- \(MDS_CACHE_OVERSIZED\)
tasks:
- cephfs_test_runner:
fail_on_skip: false
modules:
- tasks.cephfs.test_client_limits
| null | minipile | NaturalLanguage | mit | null |
53 Cal.2d 539 (1960)
THE PEOPLE, Respondent,
v.
CLEON MULFORD BARKER et al., Appellants.
Crim. No. 6580.
Supreme Court of California. In Bank.
Feb. 2, 1960.
Sherman, Wiessman & Myers, Samuel H. Sherman and Joseph A. Katz for Appellants.
Stanley Mosk, Attorney General, Elizabeth Miller and Arthur C. DeGoede, Deputy Attorneys General, for Respondent.
GIBSON, C. J.
Defendants Cleon M. Barker and his wife, Lillie Belle Barker, were charged with grand theft of personal property belonging to Dr. J. P. Gillis. They were found guilty by a jury and were granted probation on condition that they spend a period of time in the county jail and make restitution. They have appealed from the judgment and the order denying their motions for a new trial.
Dr. Gillis, who lived in Los Angeles, was the owner of a section of real property located in the vicinity of Kramer Junction, San Bernardino County, where Barker had a real estate office. In September 1956, Dr. Gillis asked Barker, with whom he had had previous dealings, for his opinion regarding an offer of $25 an acre he had received for the property, explaining that he would not have to pay a commission on the sale. Barker said that the property was worth $50 an acre and that he believed he could get that much for it, and Dr. Gillis said he would be pleased to have him do it. Early in October Barker told Dr. Gillis, in the presence of Mrs. Barker, that he had gone over the property more carefully since his previous conversation with him and had concluded *541 that it was worth $35 or $40 an acre. Dr. Gillis said, "All right, try to sell it."
Defendants on October 14 told Mr. and Mrs. M. B. Marsh, who were interested in purchasing land in the area, that Dr. Gillis, defendants' 95- year-old family physician, owned land which could be bought for $50 an acre. Barker showed the property to the Marshes, and on November 1 they offered to buy it for $45 an acre and gave defendants a deposit of $500. Mrs. Barker prepared the sales deposit receipts for the transaction. On November 3 or 4, Barker telephoned Dr. Gillis saying he had been unable to find anyone who would pay more than $25 an acre for the property, but had a buyer who would purchase it at that figure. Dr. Gillis pointed out that Barker had previously advised him not to accept an offer of $25 an acre in a transaction in which he would not have had to pay a commission. Barker replied that this was the best he could do, and Dr. Gillis then agreed to sell at $25 an acre on terms to be arranged by Barker.
A few days later, when Marsh inquired about the transaction, Mrs. Barker replied that she had been unable to contact Dr. Gillis. Defendants subsequently informed Marsh that Dr. Gillis had sold the property to his sister, a Mrs. MacDonald, in order to obtain needed cash but that she would sell to Marsh for $45 an acre, the price he had agreed to pay Dr. Gillis. The statements that Dr. Gillis had a sister named Mrs. MacDonald and that he had sold the property to her were false.
Mrs. Barker, introducing herself as Lilyan E. MacDonald, a widow, opened two escrows with a title company, one of which provided for the sale of the property by Dr. Gillis to Mrs. MacDonald for $16,000 ($25 an acre) and the other provided for the sale of the property by Mrs. MacDonald to Mr. and Mrs. Marsh for $28,800 ($45 an acre). The major part of the consideration in both instances was to be paid in the form of installment notes secured by trust deeds. The escrows were closed, and Mrs. Barker, in the name of MacDonald, received $751 from the Marsh escrow and subsequent payments totaling $180. Mrs. Barker sent Marsh a letter of instructions signed "Lilyan E. MacDonald" directing him to send the installment payments to Barker. At about this time Barker suggested that since Dr. Gillis had received a small down payment, he would be willing to accept, in lieu of cash, a specified 10 acres of land owned by Dr. Gillis as his commission on the sale to MacDonald. *542
Neither Dr. Gillis nor Marsh knew that Mrs. MacDonald was in fact Mrs. Barker until after the transactions were completed. Later defendants were confronted by Marsh with an opinion by a handwriting expert that Mrs. Barker and Mrs. MacDonald were the same person. Defendants denied that this was true, saying that they had known Mrs. MacDonald for many years, that she was a real person, and that she lived in Michigan. They refused, however, to give Marsh the address of Mrs. MacDonald. At the trial Mrs. Barker admitted that she had used the name Lilyan E. MacDonald, which was her name by a previous marriage, in purchasing the property from Dr. Gillis and in conveying it to Mr. and Mrs. Marsh.
[1] Barker was under a duty to disclose to Dr. Gillis all material facts concerning the transaction that might affect his principal's decision; he was under the same obligation of undivided service and loyalty as the law imposes upon a trustee in favor of his beneficiary. (Rattray v. Scudder, 28 Cal.2d 214, 222-223 [169 P.2d 371, 164 A.L.R. 1356].) [2] Barker's representation that $25 an acre was all he could get for the property and his failure to disclose that he had been offered $45 an acre for it was a flagrant violation of his duties. Mrs. Barker's full cooperation in the deceitful transaction was evidenced by her action in opening, under the name of Lilyan E. MacDonald, a widow, escrows for the purpose of buying the property from Dr. Gillis at the price of $25 an acre and at the same time selling it to Marsh at $45 an acre, with knowledge that Marsh had previously offered to purchase at the higher price from Dr. Gillis, and by her participation in the false representations by which defendants concealed that she was buying the property.
Section 484 of the Penal Code provides in part, "Every person who shall feloniously steal, take, carry, lead, or drive away the personal property of another, or who shall fraudulently appropriate property which has been entrusted to him, or who shall knowingly and designedly, by any false or fraudulent representation or pretense, defraud any other person of money, labor or real or personal property, ... is guilty of theft."
Section 487 of the Penal Code provides that grand theft is committed when the money, labor or real or personal property taken is of a value exceeding $200.
The evidence supports the implied finding of the jury that defendants knowingly and designedly by false pretenses defrauded *543 Dr. Gillis of personal property of a value in excess of $200.
The facts show that it was the design of defendants to defraud Dr. Gillis of the difference between the sum they intended to pay him for the land and the amount Marsh had offered for it, that in order to accomplish this purpose Barker knowingly made the false representation to Dr. Gillis that the best he, Barker, could do was to procure a buyer willing to pay $25 an acre, and that as a result of this misrepresentation defendants obtained money and notes to which Dr. Gillis was entitled. The testimony of Dr. Gillis concerning the representation made to him by Barker was corroborated by the circumstances surrounding the sale to "Lilyan E. MacDonald" and the resale to Mr. and Mrs. Marsh. [fn. 1]
Although Mrs. Barker did not personally make the false representation to Dr. Gillis, she actively participated in the transactions with knowledge of their fraudulent character. She thus aided and abetted in the commission of the crime, and was punishable as a principal under section 31 of the Penal Code. [fn. 2]
The judgment and the order denying defendants' motions for a new trial are affirmed.
Traynor, J., Schauer, J., Spence, J., McComb, J., Peters, J., and White, J., concurred.
NOTES
[fn. 1] 1. Section 1110 of the Penal Code reads in part: "Upon a trial for having, with an intent to cheat or defraud another designedly, by any false pretense ... obtained from any person any labor, money, or property, whether real or personal, or valuable thing, the defendant cannot be convicted if the false pretense was expressed in language unaccompanied by a false token or writing, unless the pretense, or some note or memorandum thereof is in writing, subscribed by or in the handwriting of the defendant, or unless the pretense is proven by the testimony of two witnesses, or that of one witness and corroborating circumstances; ..."
[fn. 2] 2. Section 31 of the Penal Code provides in part: "All persons concerned in the commission of a crime, ... whether they directly commit the act constituting the offense, or aid and abet in its commission, ... are principals in any crime so committed."
| null | minipile | NaturalLanguage | mit | null |
In the
United States Court of Appeals
For the Seventh Circuit
____________
No. 07-1518
LOUIS W. MILLER AND RICHARD J. ROYALS,
Plaintiffs-Appellants,
v.
AMERICAN AIRLINES, INC.,
Defendant-Appellee.
____________
Appeal from the United States District Court
for the Northern District of Illinois, Eastern Division.
No. 03 C 7756—Sidney I. Schenkier, Magistrate Judge.
____________
ARGUED NOVEMBER 7, 2007—DECIDED MAY 5, 2008
____________
Before POSNER, WOOD, and WILLIAMS, Circuit Judges.
WILLIAMS, Circuit Judge. Plaintiffs Louis Miller and
Richard Royals, ages eighty and seventy-five years old
respectively, have sued their former employer, Ameri-
can Airlines, Inc. for failing to offer them a position with
salary comparable to that of their previous job of flight
engineer, which they held until May of 2002. Because the
arbitrator determined that the collective bargaining
agreement did not entitle the plaintiffs to positions of
equal pay and the plaintiffs also have not shown that
their age was the reason that they were offered inferior
2 No. 07-1518
positions, summary judgment was appropriate on their
claims under the Age Discrimination in Employment
Act (“ADEA”). Additionally, the plaintiffs cannot chal-
lenge the facial validity of the collective bargaining agree-
ment because this claim was not properly raised in their
charges filed with the Equal Employment Opportunity
Commission (“EEOC”). Therefore, we affirm the grant of
summary judgment in favor of American Airlines in its
entirety.
I. BACKGROUND
In the 1950s, the plaintiffs began working as flight
engineers for American Airlines. American Airlines
historically operated aircrafts that required three indi-
viduals in the cockpit—the captain, first officer, and the
flight engineer. As technology became more advanced,
there was less need for flight engineers to occupy the
third seat in the cockpit. Additionally, airlines began
hiring certified pilots, rather than flight engineers, to
occupy the third seat. In 1964, American Airlines and its
two employee unions entered into a collective bargaining
agreement, the Tripartite Agreement (“Agreement”), that
preserved the rights of then-current flight engineers to
occupy the third seat of a three crew aircraft, but also
recognized the right of American Airlines to no longer
hire flight engineers. In the years following the agree-
ment, American Airlines began to retire its three-crew
aircraft, and in 1983, the Agreement was amended to reflect
this change. The new provision, Supplement U, provides
that:
In the event a surplus of flight engineers exists, each
flight engineer so affected, who is qualified or train-
No. 07-1518 3
able, will be guaranteed placement within the Com-
pany [American Airlines] . . . . At the time of his
placement, the employee’s monthly salary will be
fixed based on the average of his earnings for the
previous twelve (12) months as a flight engineer. If
the employee’s average monthly earnings as a flight
engineer exceed the total monthly compensation
actually earned in his new job, the employee will be
paid such flight engineer’s guaranteed monthly earn-
ings. Such guarantee will be in effect until his normal
flight engineer retirement date, and thereafter, his
salary will be governed by the compensation plan
applicable to the new position.
Supplement U was negotiated due to concerns that new
technology would make flight engineers obsolete prior
to the vesting of their pensions. The provision was de-
signed to ensure that flight engineers would continue to
receive the flight engineer rate of pay until the “normal
flight engineer retirement date,” which the American
Airlines’ Retirement Benefit Plan sets as age sixty-five.
In May 2002, American Airlines grounded the last of its
three crew airplanes, and the plaintiffs and one other
individual were the only three active flight engineers at
the time. Prior to the grounding of the fleet, American
Airlines sent the three remaining flight engineers a letter
offering them staff assistant positions in its publications
department, positions which paid $100,000 less than
their salaries as flight engineers. At that time of this
offer, plaintiff Royals was seventy years old and plaintiff
Miller was seventy-five years old.
The plaintiffs filed charges with the EEOC against
American Airlines, alleging that they were discriminated
4 No. 07-1518
against because of their age in violation of the ADEA, 29
U.S.C. § 621 et seq., when the defendant did not offer them
a position of comparable salary which, they maintained,
was required by Supplement U of the Tripartite Agree-
ment. The plaintiffs filed suit, and the district court
initially found that the plaintiffs’ claims involved a
minor dispute over terms in a collective bargaining agree-
ment and therefore were preempted by the Railway
Labor Act (“RLA”), 45 U.S.C. § 151 et seq. The district
court then ordered the case stayed until the parties com-
pleted arbitration.
During arbitration, the plaintiffs filed a grievance
with American Airlines, making essentially the same
allegations that they made in their ADEA complaint. The
arbitrator determined that the grievance was untimely
because it was filed more than 90 days after the occur-
rence being grieved. The arbitrator further determined
that American Airlines was not obligated by Supple-
ment U to offer alternative employment at a salary com-
parable to that of a flight engineer. The American Airlines’
Retirement Benefit Plan provides that the normal retire-
ment age is sixty-five, and the arbitrator found that the
plaintiffs were only guaranteed flight engineer pay until
that age.
Following the arbitration decision, the district court
granted the defendant’s motion for summary judgment.
The district court adopted the arbitrator’s findings that
Supplement U did not guarantee flight engineer pay
past the age of sixty-five. It also found that the plaintiffs’
claim that Supplement U was facially discriminatory fell
outside the scope of their EEOC charge, and even if the
merits could be reached, the claim failed because there
was no evidence that Supplement U was motivated by
a discriminatory purpose. The plaintiffs appeal.
No. 07-1518 5
II. ANALYSIS
A. Summary judgment was appropriate on the ADEA
claim because there was no guarantee of compara-
ble pay after the age of sixty-five.
We review the district court’s grant of summary judg-
ment de novo, viewing the record and all reasonable
inferences drawn from it in the light most favorable to the
party opposing the motion. Peirick v. Ind. Univ.-Purdue
Univ. Indianapolis Athletic Dep’t, 510 F.3d 681, 687 (7th
Cir. 2007). Summary judgment is appropriate only when
the materials before the court demonstrate “that there is
no genuine issue as to any material fact and that the
moving party is entitled to a judgment as a matter of law.”
Fed. R. Civ. P. 56(c). To prevail on their ADEA claim,
the plaintiffs must prove that they were discriminated
against in the terms and conditions of their employment
because of their age, 29 U.S.C. § 623. Hoffmann v. Primedia
Special Interest Publ’ns., 217 F.3d 522, 525 (7th Cir. 2000)
(“To succeed in an ADEA claim, a plaintiff must establish
that he would not have received adverse treatment but
for his employer’s motive to discriminate on the basis of
his age.”) (internal citations omitted). The plaintiffs do not
have to show, however, that their age was the sole motiva-
tion for the employer’s decision; it is sufficient if age
was a “determining factor” or a “but for” element in the
decision. Anderson v. Stauffer Chem. Co., 965 F.2d 397,
400 (7th Cir. 1992).
The plaintiffs’ first claim can be characterized as an “as
applied” challenge to Supplement U. The plaintiffs con-
tend that American Airlines discriminated against them
in the terms and conditions of their employment by fail-
ing to provide them with comparable pay as required
by Supplement U of the Tripartite Agreement. Supple-
6 No. 07-1518
ment U states in relevant part that: “Such guarantee [of a
flight engineer’s guaranteed monthly earnings] will be in
effect until his normal flight engineer retirement date and,
thereafter, his salary will be governed by the compensa-
tion plan applicable to the new position.” (Emphasis
added.) In the arbitration proceedings, the arbitrator
interpreted this sentence to mean that following the
termination of the flight engineer positions, the col-
lective bargaining agreement did not guarantee positions
of comparable pay to the plaintiffs after they reached
normal retirement age of sixty-five.
The district court deferred to the arbitrator’s interpreta-
tion of this key language, correctly finding that resolu-
tion of the plaintiffs’ ADEA claim is dependent upon the
interpretation of Supplement U of the Agreement and
therefore governed by the arbitration provisions of the
RLA. The RLA provides for mandatory arbitration over
labor disputes arising out of the interpretation of col-
lective bargaining agreements in the railway and airline
industries. Hawaiian Airlines v. Norris, 512 U.S. 246, 252-53
(1994). The RLA defines two categories of disputes: “major
disputes” that “relate to ‘the formation of collective
[bargaining] agreements or efforts to secure them’ ” and
“minor disputes” that “grow out of grievances or out of
the interpretation or application of agreements covering
rates of pay, rules, or working conditions.” Id. The plain-
tiffs’ allegation that Supplement U requires a specific
rate of pay after the age of sixty-five is dependent upon
interpreting the phrase “normal flight engineer retire-
ment date.” Thus, this particular claim was subject to the
arbitration provisions of the RLA, and we are bound by
the arbitrator’s interpretation that Supplement U does not
obligate American Airlines to provide comparable pay after
No. 07-1518 7
employees have reached the normal flight engineer retire-
ment date. See Tice v. Am. Airlines, Inc., 288 F.3d 313, 318
(7th Cir. 2002) (“only the arbitral boards convened under
the aegis of the Railway Labor Act have the authority to
determine the rights conferred by a collective bargaining
agreement in the airline industry”).
This is not to suggest, however, that employees are
always precluded from bringing an ADEA claim in fed-
eral court if the dispute involves a collective bargaining
agreement. Generally, a plaintiff can file an ADEA lawsuit
in federal court that may be in some way related to a
collective bargaining agreement. However, if the success
of the claim is dependent upon an interpretation of the
collective bargaining agreement’s terms, the court cannot
consider it. See Brown v. Illinois Cent. R.R., 254 F.3d 654,
664 (7th Cir. 2001) (“[T]he best way to harmonize these
two statutes [the RLA and the ADA] is to allow a plain-
tiff employee to bring an ADA claim in federal court
against his employer (even if his employment is gov-
erned by a collective bargaining agreement which is sub-
ject to the RLA), unless the resolution of his ADA claim
requires the court to interpret the collective bargaining
agreement’s terms as a potentially dispositive matter.”);
Tice, 288 F.3d at 317 (providing that dismissal is appro-
priate where “a particular interpretation of the collective
bargaining agreement is potentially dispositive of a the
plaintiff’s claim”).
Here, the plaintiffs’ claim was dependent upon the
phrase “normal flight engineer retirement date” in Supple-
ment U. The arbitrator’s interpretation of this phrase in
the collective bargaining agreement to mean that the
plaintiffs were entitled to flight engineer pay only until
the normal flight engineer retirement date and his sub-
8 No. 07-1518
sequent conclusion that such pay was not required to
continue following this date eviscerated the plaintiffs’
ADEA claims. See Tice, 288 F.3d at 317.
The plaintiffs contend that the arbitrator’s determina-
tions have no bearing on their ADEA claim because their
claim is premised on the idea that Supplement U creates
a “benefit” that is part of the employment relationship,
a benefit that was withheld from the plaintiffs on the
basis of their age. This issue, according to the plaintiffs,
was not before the arbitrator nor was it considered by
the district court. There is no evidence, however, that the
plaintiffs had a contractual right to comparable pay after
the age of sixty-five under Supplement U, or in their
words, that they were entitled to a “benefit” created by
virtue of the employment relationship. While “an em-
ployee has both a contractual right by virtue of a col-
lective bargaining agreement (or other employment
contract), and a statutory right to be free from discrimina-
tion,” Tice, 288 F.3d at 317, the plaintiffs point to no lan-
guage in Supplement U, express or implied, that can
support their argument that American Airlines has dis-
criminated against them by denying them positions of
comparable pay. The express language of Supplement U,
which guarantees flight engineer pay only until normal
retirement age, provides that salary will then “be governed
by the compensation plan applicable to the new position,”
language that is clearly contrary to their position. See
Miller v. Crystal Lake Park Dist., 47 F.3d 865, 867 (7th Cir.
1995) (“A ‘legitimate claim of entitlement’ is one that is
legally enforceable—one based on statutes or regulations
[or contracts] containing ‘explicitly mandatory language’
that links ‘specified substantive predicates’ to prescribed
outcomes.”) (internal citations omitted); Hohmeier v. Leyden
No. 07-1518 9
Cmty. High Sch. Dist. 212, 954 F.2d 461, 464 (7th Cir. 1992)
(“Property interests in employment may be created by
express or implied contracts, municipal ordinances or
state laws.”). Absent express language guaranteeing
positions of comparable pay, “an employer [has] no duty
[under the ADEA] to give another job to an employee
validly disqualified from holding his present job.” Tice,
288 F.3d at 315. Accordingly, we find that summary
judgment was appropriate on the plaintiffs’ “as applied”
challenge to Supplement U.
B. The plaintiffs’ facial discrimination claim was not
properly alleged in their EEOC charges.
Assuming arguendo that we can reach the issue of
whether Supplement U is facially discriminatory since,
unlike the “as applied” challenge, the arbitrator’s interpre-
tation of Supplement U is not necessarily dispositive of a
facial challenge to this provision, see Brown, 254 F.3d at
664, the plaintiffs’ facial challenge to Supplement U is
still not properly before the court. A plaintiff generally
cannot bring a claim in an ADEA lawsuit that was not
alleged in the EEOC charge, and, while not a jurisdic-
tional requirement, it is a prerequisite with which a
plaintiff must comply before filing suit. Cheek v. W. & S. Life
Ins. Co., 31 F.3d 497, 500 (7th Cir. 1994). This requirement
is to ensure that the employer has notice about the particu-
lar challenged conduct and provides an opportunity
for settlement of the dispute. Id. (citations omitted). A
plaintiff, however, may proceed on a claim not explicitly
mentioned in his EEOC charge “if the claim is like or
reasonably related to the EEOC charges, and the claim in
the complaint reasonably could be expected to grow out
of an EEOC investigation of the charge.” Id. (citing Peters
10 No. 07-1518
v. Renaissance Hotel Operating Co., 307 F.3d 535, 551 (7th
Cir. 2002) (internal quotations and citations omitted)). At
the very least, the claims should involve the same con-
duct and implicate the same individuals in order to be
considered “reasonably related” to the allegations in the
EEOC complaint. See Cheek v. Peabody Coal Co., 97 F.3d
200, 202-03 (7th Cir. 1996).
Generally, we apply a liberal standard in determining
if new claims are reasonably related to those claims
mentioned in the EEOC charge. Farrell v. Butler Univ.,
421 F.3d 609, 616 (7th Cir. 2005). Here, the plaintiffs
checked the ADEA box on their EEOC charge and
stated that they were “subjected to different terms and
conditions of employment” because they were “not offered
a position with a comparable salary as required by the Tri-
Partite Agreement.” It is true that their claim that the
Tripartite Agreement is facially discriminatory involves
the same parties and the same facts as the other claim,
and the plaintiffs checked the relevant box. See Cheek,
97 F.3d at 200. Nevertheless, their argument that the
Tripartite Agreement requires that they be given positions
of comparable pay and they were denied these positions
because they were “beyond normal retirement age”
conveys that at most, the plaintiffs are alleging that Sup-
plement U is being applied in a disparate manner. To now
challenge Supplement U as facially discriminatory,
which is a much broader claim than that alleged in the
EEOC charge, is also inconsistent with the plaintiffs’
allegations that American Airlines failed to do something
that Supplement U required. Cf. Farrell, 421 F.3d at 616
(finding that plaintiff’s statements in her EEOC charge
encompassed a claim of disparate impact where she
stated “I believe that there is an inherent or deliberate
No. 07-1518 11
bias against women faculty and, in this case, only two
women from the entire faculty would have met the
criteria for the award, yet many more men would have
been eligible.”). To allow the plaintiffs to proceed on their
facial challenge to Supplement U would take the “reason-
ably related” requirement much further than intended.
Additionally, the allegations in the plaintiffs’ EEOC
charges were not enough to put American Airlines on
notice that the plaintiffs were planning to lodge a facial
challenge against Supplement U. Geldon v. S. Milwaukee Sch.
Dist., 414 F.3d 817, 819 (7th Cir. 2005) (the rule that a
plaintiff may bring only those claims in her EEOC charge
is “meant both to give the EEOC and employer an op-
portunity to settle the dispute and to give the employer
fair notice of the conduct about which the employee is
complaining.”). In their respective EEOC charges, the
plaintiffs state, very generally, that they were subjected to
different terms and conditions of employment based on
age. They now seek to use this language as an opening to
pursue a legal theory that is certainly related, but not
foreseeable from the allegations made in the charge. See,
e.g., Faibisch v. Univ. of Minn., 304 F.3d 797, 803 (8th Cir.
2002) (stating that a plaintiff cannot make conclusory
statements of discrimination in her EEOC charge and then
file suit on whatever facts or legal theory she may later
decide upon). The EEOC charges filed by the plaintiffs
allege behavior that is considerably more narrow than
what the plaintiffs assert here; there is no notice to Ameri-
can Airlines that it may have to defend Supplement U
against a facial challenge. Therefore, we find that the
plaintiffs’ claim that Supplement U was facially discrim-
inatory was not properly alleged in the EEOC charge,
and we need not reach the merits of this argument.
12 No. 07-1518
III. CONCLUSION
For the foregoing reasons, the district court’s grant of
summary judgment in favor of American Airlines is
AFFIRMED.
USCA-02-C-0072—5-5-08
| null | minipile | NaturalLanguage | mit | null |
Q:
Dialogflow Giving Specific options as valid for intent
So I have scoured the internet and finding it very difficult to find a solution to my problem. The issue is, I have many intents and these intents are also filtered by contexts handled by the webhook. I am trying to find a way to have a list from the webhooks last call, whether it be in the context params or some other form from to use as a valid phrase to trigger the intent.
These responses can be one word so doing @sys.any isn't viable, @sys.any also doesn't assign a key to a matched synonym either which would be helpful to process through the webhook after the intent has been called. The other issue is that I still need other intents to still be called if the intent with the list isn't matched.
So in short, I'm trying to find a way that could dynamically assign values for an entity based on a webhooks response to a phrase. And if the user does not match one of those phrases then I don't want it to be processed by that intent.
At the moment I am looking into a Fallback intent with the context relevant but this still feels hacky and would still have to use @sys.any along with figuring out the phrase via backend. I also beleive it's viable to validate on dialogflow than to validate through the backend too.
Any help or direction will greatly be appreciated.
A:
If I understand correctly what you are trying to do this is a case for User Entities.
With them you can redefine an existing entity to have session specific values.
Have a look at the documentation: https://dialogflow.com/docs/reference/agent/userentities
| null | minipile | NaturalLanguage | mit | null |
Thoughts, musings, and observations about race in America, particularly the mixing of race--in all the ways you can imagine: people of various races interacting, people of various races not wanting to mix, issues of purity, hybridity, multiplicity, heterogeneity, and any other way you can describe the blending, melding, melting, tossing, turning, churning of race relations in the United States.
Wednesday, February 1, 2012
Mutated Meanings -- Can Racial Slurs Ever Stop Hating?
In my last post I wrote about the Chinese American immigrant teen who was attacked by seven of his classmates in what appears to be retaliation for another beating rather than for what the YouTube video makes it appear to be--a racially motivated attack--a hate crime.
Yet, as I noted in the post, it may very well be that race and hate are involved, especially in the idea of the teen as a "FOB," an acronym which stands for "Fresh off the boat."
Yesterday I had a very lively discussion with my Asian Americans in the South class
[Aside: Yes, that's right--I'm teaching a class on Asian American Southern literature--it may well be the first of its kind in the nation, although if anyone else knows of someone who has taught a version of this class before, I'd love to share and compare notes! Also, I have to tell you that these students were so smart, candid, and thoughtful in their discussion of very controversial and provocative topics--I really commend them and I also appreciate how they help me push the boundaries of my thinking.]
about this video and about the situation of the teen being beaten up by other Chinese American youth, and especially about the racial slur, "nigger," used by his attackers (and one masked attacker in particular it seems) as they beat, punched, kicked, and pummeled his face, head, and body.
A very interesting discussion ensued, particularly about the use of the term "FOB" and "nigger" (and I do apologize about my use of this racial slur--I'm not trying to replicate hatred or feelings of discomfort, but following Randall Kennedy, I believe in using the word, contextually, instead of masking it and giving it more power by saying "n-word" -- it's like Harry Potter's rationalization for saying "Voldemort" instead of referring to him as "He who shall not be named"). Several of my students said that the word "nigger" or in its more colloquial form "niggah" had taken on a life and usage that is seemingly separate from its original term as a word of ultimate racial hatred. And they didn't just mean the way it has been appropriated within certain African American circles as a term of in-group affection and solidarity. No, what they meant is that non-African Americans used the term as a pejorative but not as a racial pejorative--more as a term to denote someone who is acting like a jerk or a punk. In youth parlance, a "hater" if you will.
Similarly, the term "FOB" or just "fob" and "fobby," didn't have any negative meanings, for them--it simply was used to refer to a recent immigrant who maintained ethnic-national times to his/her homeland. So in referring to a recent Korean American who enjoys Korean music, someone might say, "He's a real fob--he's totally into K-Pop." Or in talking about Cuban immigrants in Miami you might say, "She's so fobby--she only speaks Spanish and hangs out with other Cuban fobs."
I decided to see if I could find the origins of the word "F.O.B." since I had grown up, in the 1970s, believing that this was a term used to make fun of recent Asian immigrants--specifically it was often used to denigrate Southeast Asian (Vietnamese, Cambodian, Hmong, Laotian) refugees from the war in Viet Nam. Although I assumed that it wouldn't be in the OED, I decided to start there (since it's the gold standard of English language etymology) and lo and behold, I found an entry:
A recent immigrant.1968 Los Angeles Times 6 May ii. 12/2 The FOBs don't know English when they get here and their parents move to Chinatown so the family can live with people like themselves.1991 J. Raban Hunting Mr. Heartbreak 256 If you passed Mr. Han on the street, you'd mistake him for a still shell-shocked newcomer; an FOB.1994 Filipino Express (Electronic ed.) 11 Dec. 11 They call the Vietnamese F.O.B.s‥. We can call them S.O.B.s, but that would be stooping down to their level.2004 K. W. Keltner Dim Sum of All Things 139 In Stephanie's world, Lindsey's blatant disregard for sock perfection made her look like a fob—a fresh-off-the-boat immigrant.
They key phrase above is "Chiefly depreciative" -- meaning, disparaging and belittling. In other words, the general tenor and tone of this word/phrase is negative--it's a pejorative--it's not used as a term of affection, endearment or respect. It's used as a term to pass judgment, to highlight difference, to otherize: to racialize.
I don't think, like with the word "queer," that there has been some kind of mass movement by recent Asian immigrants to take back and appropriate this term. Instead, I think that the term has evolved over time to the point where my college-aged (roughly 18-22) students who use this phrase simply believe it refers to recent immigrants without any negative overtones or values--and that it doesn't have a specific racial connotation.
Yet, as I reminded them in class yesterday, we don't apply the term "FOB" to recent arrivals from Canada or Ireland or Australia or Western Europe in general. Would we refer to a French immigrant as a FOB? Would we talk about a New Zealand transplant as a FOB? Would we assume that the English immigrant who continues to eat bangers and mash for breakfast is acting fobby? This seems like a term that is primarily used to describe Asian immigrants (although one student who grew up in Florida noted that it was a term he heard applied to Cuban immigrants), and certainly its origins and primary usage in the 1970s and 1980s was as a pejorative.
So can the word "fob," in the 21st century, now take on a deracinated, neutralized form--so that it simply refers to someone who is a recent immigrant who prefers to keep the culture of his/her natal land alive?
5 comments:
i think it always depends on an ongoing combination of history, context, intent, reception/"interpretive community", etc. at this moment in history, in my opinion, there's no way to use "FOB" without referring to its racialization/Othering connotation (including ironic uses). i think students' thinking of it as non-racial is just part of the overall discourse of post-racial doodoo.
I really appreciate this post, for it's sentiment, neutrality, and education. This is a slur I have yet to hear, and I am saddened that we are still coming up with new ones.
I personally haven't found that any slur is "deraciated." Whether it be nigger, fob, wet-back, or any others; whether they are used in "civil" conversation or rap songs; if they are used to define or describe a person, they are ever inappropriate.
In truth, a word can lose its harmful power when people lose their fear of it, but it's still, in my opinion, disgusting.
Thanks for your comments. Teaching definitely keeps me in touch with youth culture--I mean, I would never have guessed that either "FOB" or "Nigga" had entered into my students' vocabulary deracinated--although I'd say with the latter that this was controversial, even in the context of my class.
But the FOB discussion was illuminating--over half the class had no idea that the phrase had a negative and hateful connotation.
The optimist in me would like to think that it's possible for this word to lose its pejorative meaning, but the pragmatist/academic in me just doesn't think that will ever be possible.
I'm surprised that FOB has made into the OED. But I have to think that's a somewhat good thing, if only in that it acknowledges Asian slang as part of the English language. I don't think the term is racially neutral, it very clearly was derogatory in its inception. I sort of wish those students would say they are using the term in a "take it back" way, rather than thinking it is simply words. *sigh*
Grace,I agree with you--the origins are so clearly meant to demean Asian immigrants. I think the issue is that the students who are using this phrase aren't aware of its origins and its application is a bit fuzzier--that it's other Asians, sometimes recent immigrants, using this term on themselves (similar to African Americans using the n-word as an in-group word)--so coupled with the fact that Asian Americans aren't generally part of a larger discourse in this country, it all boils down to a lot of ignorant application. It's frustrating.
FEEDJIT Live Traffic Map
Some Rules While Visiting This Blog...
Hello! Welcome to "Mixed Race America." A few rules now that this blog is once again "public" (meaning, you no longer need to sign-in to read this blog):
1) Please leave a comment! I really am interested in hearing what others have to say. You cannot leave anonymous comments (which means you do have to have a gmail account), and you must comply with rule #2, but aside from these things, I really want to hear from YOU.
2) Please be respectful in your comments. I reserve the right to moderate all comments, which means deleting comments I believe are disrespectful, rude, or which generally devolve into ad-hominem attacks. I don't mean that people should not engage with what I'm writing (or others have written) and I'm not looking to "preach to the choir." But I also believe that the best way to be heard is through respectful discourse--at best, we can just agree to disagree.
3) Please feel free to share this blog link with others, but please do not reprint sections of this blog or its comments without explicit permission of the author of this blog. If you would like permission to print segments of this blog into your own blog or another media outlet, you will need to write to me to gain permission to do so.
Who I Am
A 40-something professor of contemporary American literature and Asian American literature interested in issues of social justice and specifically how to create spaces to talk comfortably (and sometimes uncomfortably) about race. | null | minipile | NaturalLanguage | mit | null |
Clinical audits: why and for whom.
Every surgical activity poses some element of risk to the public and should include a quality control initiative. Surgical audit is one strategy used to maintain and/or improve standards in surgical care. The Royal Australasian College of Surgeons is committed to ensuring best practice in surgical care and strongly endorses the use of audits to achieve this. This review provides an overview of clinical audit and its role in surgical practice. | null | minipile | NaturalLanguage | mit | null |
package com.ruin.lsp.model
import com.intellij.openapi.components.ServiceManager
import com.ruin.lsp.commands.document.completion.CompletionCommand
import com.ruin.lsp.commands.document.completion.CompletionItemResolveCommand
import com.ruin.lsp.commands.document.find.FindDefinitionCommand
import com.ruin.lsp.commands.document.find.FindImplementationCommand
import com.ruin.lsp.commands.document.find.FindTypeDefinitionCommand
import com.ruin.lsp.commands.document.find.FindUsagesCommand
import com.ruin.lsp.commands.document.formatting.DocumentFormattingCommand
import com.ruin.lsp.commands.document.highlight.DocumentHighlightCommand
import com.ruin.lsp.commands.document.hover.HoverCommand
import com.ruin.lsp.commands.document.lens.CodeLensCommand
import com.ruin.lsp.commands.document.symbol.DocumentSymbolCommand
import org.eclipse.lsp4j.*
import org.eclipse.lsp4j.jsonrpc.messages.Either
import org.eclipse.lsp4j.services.TextDocumentService
import java.util.concurrent.CompletableFuture
class MyTextDocumentService(val server: MyLanguageServer) : TextDocumentService {
val workspace: WorkspaceManager by lazy { ServiceManager.getService<WorkspaceManager>(WorkspaceManager::class.java)!! }
override fun resolveCompletionItem(unresolved: CompletionItem): CompletableFuture<CompletionItem> {
val cache = PreviousCompletionCacheService.getInstance()
val uri = cache.lastUri()
val command = CompletionItemResolveCommand(unresolved)
return server.asInvokeAndWaitFuture(server.context.rootProject!!, uri, command)
}
override fun codeAction(params: CodeActionParams): CompletableFuture<MutableList<out Command>> {
TODO("not implemented") //To change body of created functions use File | Settings | File Templates.
}
override fun hover(position: TextDocumentPositionParams): CompletableFuture<Hover> =
server.asInvokeAndWaitFuture(server.context.rootProject!!, position.textDocument.uri, HoverCommand(position.position))
override fun documentHighlight(position: TextDocumentPositionParams): CompletableFuture<MutableList<out DocumentHighlight>> =
server.asInvokeAndWaitFuture(server.context.rootProject!!, position.textDocument.uri, DocumentHighlightCommand(position.position))
override fun definition(position: TextDocumentPositionParams): CompletableFuture<MutableList<out Location>> =
server.asInvokeAndWaitFuture(server.context.rootProject!!, position.textDocument.uri, FindDefinitionCommand(position.position))
override fun typeDefinition(position: TextDocumentPositionParams): CompletableFuture<MutableList<out Location>> =
server.asInvokeAndWaitFuture(server.context.rootProject!!, position.textDocument.uri, FindTypeDefinitionCommand(position.position))
override fun formatting(params: DocumentFormattingParams): CompletableFuture<MutableList<out TextEdit>> =
server.asInvokeAndWaitFuture(server.context.rootProject!!, params.textDocument.uri, DocumentFormattingCommand(params.options))
override fun rangeFormatting(params: DocumentRangeFormattingParams): CompletableFuture<MutableList<out TextEdit>> =
server.asInvokeAndWaitFuture(server.context.rootProject!!, params.textDocument.uri, DocumentFormattingCommand(params.options, params.range))
override fun onTypeFormatting(params: DocumentOnTypeFormattingParams): CompletableFuture<MutableList<out TextEdit>> {
TODO("not implemented") //To change body of created functions use File | Settings | File Templates.
}
override fun codeLens(params: CodeLensParams): CompletableFuture<MutableList<out CodeLens>> =
server.asInvokeAndWaitFuture(server.context.rootProject!!, params.textDocument.uri, CodeLensCommand())
override fun rename(params: RenameParams): CompletableFuture<WorkspaceEdit> {
TODO("not implemented") //To change body of created functions use File | Settings | File Templates.
}
override fun completion(params: CompletionParams): CompletableFuture<Either<MutableList<CompletionItem>, CompletionList>> =
server.asCancellableInvokeAndWaitFuture(server.context.rootProject!!, params.textDocument.uri, CompletionCommand(params.position,
server.context.clientCapabilities?.textDocument?.completion?.completionItem?.snippetSupport ?: false))
override fun documentSymbol(params: DocumentSymbolParams): CompletableFuture<MutableList<out SymbolInformation>> =
server.asCancellableInvokeAndWaitFuture(server.context.rootProject!!, params.textDocument.uri, DocumentSymbolCommand(params.textDocument))
override fun signatureHelp(position: TextDocumentPositionParams): CompletableFuture<SignatureHelp> {
TODO("not implemented") //To change body of created functions use File | Settings | File Templates.
}
override fun references(params: ReferenceParams): CompletableFuture<MutableList<out Location>> =
server.asCancellableInvokeAndWaitFuture(server.context.rootProject!!, params.textDocument.uri, FindUsagesCommand(params.position))
override fun implementation(params: TextDocumentPositionParams): CompletableFuture<List<Location>> =
server.asInvokeAndWaitFuture(server.context.rootProject!!, params.textDocument.uri, FindImplementationCommand(params.position))
override fun resolveCodeLens(unresolved: CodeLens): CompletableFuture<CodeLens> {
TODO("not implemented") //To change body of created functions use File | Settings | File Templates.
}
override fun documentLink(params: DocumentLinkParams?): CompletableFuture<MutableList<DocumentLink>> {
TODO("not implemented") //To change body of created functions use File | Settings | File Templates.
}
override fun documentLinkResolve(params: DocumentLink?): CompletableFuture<DocumentLink> {
TODO("not implemented") //To change body of created functions use File | Settings | File Templates.
}
override fun willSaveWaitUntil(params: WillSaveTextDocumentParams?): CompletableFuture<MutableList<TextEdit>> {
TODO("not implemented") //To change body of created functions use File | Settings | File Templates.
}
override fun willSave(params: WillSaveTextDocumentParams?) {}
override fun didOpen(params: DidOpenTextDocumentParams) {
workspace.onTextDocumentOpened(params, server.context.rootProject!!, server.context.client, server)
server.computeDiagnostics(params.textDocument.uri)
}
override fun didChange(params: DidChangeTextDocumentParams) {
workspace.onTextDocumentChanged(params, server.context.rootProject!!)
server.computeDiagnostics(params.textDocument.uri)
}
override fun didSave(params: DidSaveTextDocumentParams) {
workspace.onTextDocumentSaved(params, server.context.rootProject!!)
server.computeDiagnostics(params.textDocument.uri)
}
override fun didClose(params: DidCloseTextDocumentParams) {
workspace.onTextDocumentClosed(params)
}
}
| null | minipile | NaturalLanguage | mit | null |
Torrey Pines
Torrey Pines can refer to:
Torrey pine, a broad, open-crowned pine
Torrey Pines Golf Course, a municipal public golf course owned by the city of San Diego, California
Torrey Pines High School, a high school in the North County Coastal area of San Diego, California
Torrey Pines, San Diego, a coastal community within San Diego, California
Torrey Pines State Natural Reserve
"Torrey Pines", a song by Your Heart Breaks | null | minipile | NaturalLanguage | mit | null |
When Ester Ledecká crossed the finish line of this morning’s run of the women’s Super-G a hundredth of a second ahead of reigning gold medalist Anna Veith, the Czech couldn’t believe she’d beaten the Austrian champ. Ledecká, after all, is best known for her achievements in a completely different event: snowboarding, where she’s won two world championships and is a favorite in Pyeongchang.
Ledecká wasn’t the only one surprised by the outcome. By the time Ledecka finished her miracle run—one, it turns out, she accomplished thanks to her lack of experience in the event, leading her to take a faster but unorthodox line on the course—NBC had long crowned Veith the gold medalist and had switched coverage to a simulcast of NBC Sports Network’s men’s figure skating free skate broadcast.
NBC
Dan Hicks pronounced Veith the gold medalist no fewer than five times, with worthless (and incredibly robotic) analyst Bode Miller at no point interrupting to note that there were still 25—twenty-five!—skiers left to compete. Only a throwaway “the last skier down with any chance at the podium” at the end of Cornella Huetter’s run suggested that the event wasn’t even halfway through.
16 minutes later, Ledecká crossed the line to shock—hers, the spectators, the announcers, and especially Veith’s.
NBC didn’t even cut to figure skating right away; after a commercial break, they returned to interview Lindsey Vonn about her disappointing performance. Vonn told NBC she was happy to have finished fifth, not fourth; she actually finished sixth!
Advertisement
Hicks iterated Veith “ended up on top” as Miller commentated a replay of the Austrian’s would-be gold-medal performance, followed by yet another pronouncement by Hicks of the final podium standings. Ledecká was literally on the course at the time Hicks threw to the commercial break with the words, “Anna Veith still can’t believe it: she’s a gold medalist again.”
The first hint that NBC was wrong came when a promised interview with “Anna Veith, the gold medalist” never materialized. Ten minutes later, as the network wrapped up airing Adam Rippon’s free skate live, commentary stated that “there’s a surprise at the women’s Super-G; we’ll take you there right after this break,” and then another three minutes passed before the network rejoined Hicks and Miller at the alpine skiing venue.
NBC
They provided highlight coverage of Ledecká’s run, in the manner of something you’d see on SportsCenter rather than proper play-by-play. (Confusingly, Hicks announced in the past tense while Miller commentated in the present.) Hicks then acknowledged the competition still wasn’t over, though it was another hour before Mike Tirico confirmed that Ledecká had, indeed, held on for gold.
Advertisement
Certainly, you can point at everyone’s shock about the outcome and absolve NBC for its coverage, but this is one instance where the network’s temporal fluidity could have worked in its favor. NBC’s primetime coverage regularly flip-flops between live and tape-delayed footage already; they easily could have simply come back to alpine skiing after Rippon’s free skate, and had Hicks and Miller call the run “live.” (Seriously, go watch the video above from the world feed; it was an incredible thing to hear called live.) Alternatively, NBC could have audibled out of the figure skating coverage and gone back to skiing after the Vonn interview, and aired Ledecká’s run a mere three minutes after it happened, “live.” (As noted earlier, Hicks and Miller likely missed seeing Ledecká’s run as it happened because they were busy tossing to break after the Lindsey Vonn interview.) Either way, NBC tipped its pitch and spoiled the surprise both with the pre-break tease and in how Hicks and Miller called the replay.
To recap: NBC called a winner long before all the results were in, spoiled its own update, and provided lackluster and uninteresting coverage of one of the most shocking outcomes in Winter Games history despite having the power of time-shifting time-travel. For comparison’s sake, we looked at how BBC1 covered the event; in the U.K., where it was nearly four in the morning, the network remained with alpine skiing throughout the event and thus did not declare an early winner—even after Ledecká’s run, though they did state that “surely” the Czech had won the gold medal:
Ledecká says she still plans to compete for gold in snowboarding next week. If she does, she’ll be the first person to ever compete in the two events in one Olympic Games. | null | minipile | NaturalLanguage | mit | null |
Q:
How to calculate the latency and bandwidth of a network
i have code that pings several machines, and records the time, it does this for various packet sizes ( 1kb to 100gb ), but i would like to know how to calculate the latency of the network, how can this be achieved ?
this is the code i am using to measure the ping :
also how can i measure the bandwidth of the system as well ?
Thanks for the help guys !
A:
In the ideal case where latency and bandwidth are fully constant, it's just a linear problem:
delay = packetsize / bandwidth + latency
There are two variables, bandwidth and latency, so you need at least two different records to solve it. However, I'd suggest to calculate them for many data pairs and e.g. take the median of all your results.
I think solving the above equation should be easy. If not, feel free to ask.
Update: How to solve the above equation
Let
y1, y2 values for delay
x1, x2 values for packetsize
a := 1/bandwith
b := latency
y1 = a * x1 + b
y2 = a * x2 + b
=> b = y1 - a * x1 [1]
=> y2 = a * x2 + y1 - a * x1
=> a = (y2 - y1) / (x2 + x1)
Now put it in equation [1]:
=> b = y1 - (y2 - y1) / (x2 + x1)
Now you have b for the latency and 1 / a for the bandwidth.
| null | minipile | NaturalLanguage | mit | null |
Like Osi, Mike Jenkins is basically stuck
Ed Mulholland/US PresswireMike Jenkins isn't happy with his contract or his new role as No. 3 cornerback on the team.
Dallas Cowboys coach Jason Garrett said Wednesday the team isn't going to trade disgruntled cornerback Mike Jenkins. We didn't post on it here because we already knew this. Everybody already knew it. Even Jenkins, though he's let it be known he's unhappy with his contract and his new role as the team's No. 3 cornerback and would like to be traded, probably knew it too. He'd have to be blind not to.
PODCAST
Coop and Nate discuss Jerry Jones' comments about the window closing on the Cowboys' championship hopes.
Jenkins isn't making so much money that the Cowboys would want to dump him like the Eagles did with Asante Samuel. He's too good for them to trade for a late-round draft pick and not quite good enough to convince a team to offer an early-round pick. The result is that the team, as it tends to in NFL contract situations, holds all of the cards and is required to make no move at all in response to Jenkins' decision to skip offseason workouts. If he wants to stay home, he stays home. If he wants to skip mandatory workouts next month or part of training camp, they can fine him. If he wanted to sit out a whole season, they'd just run Brandon Carr, Morris Claiborne and Orlando Scandrick out there and take their chances. They're better with Jenkins in that mix and would like to have him, but they're not desperate enough to even consider granting him his wish.
Jenkins finds himself in NFL contract limbo, and if he's looking for a sympathetic shoulder on which to cry he doesn't even have to look outside his own division. The New York Giants' Osi Umenyiora is basically in the same situation -- he's unhappy with his contract, he isn't thrilled to be the No. 3 defensive end on his team, and he would rather play elsewhere. But he isn't getting traded either, because (stop me if this sounds familiar) he's affordable, he's too good to trade for peanuts, and he isn't going to bring back a first-round or second-round pick in a deal. The Giants are better off keeping an unhappy Umenyiora around than trading him for pennies on the dollar. It's the decision they made when he raised the same fuss a year ago, and they got 12.5 sacks out of him in 13 games (counting postseason) for their patience.
If either Jenkins or Umenyiora really wanted to push this, there are two somewhat extreme ways they could go. The first is that they could sit out the meaningful stuff, like training camp and regular-season games. If they prove that they're willing to do that, then circumstances could, theoretically, improve their leverage. Say Jenkins is sitting at home in late August and Claiborne gets hurt, or Umenyiora is sitting at home Week 2 and Justin Tuck gets hurt. In cases like those, the need for the player may become great enough to warrant a new deal. But that's a big risk to take because injuries are unpredictable, and in the meantime the player has allowed the team the chance to get used to life without him.
AP Photo/Evan VucciOsi Umenyiora did not attend the team's first organized team activity of the season on Wednesday.
The second option in this case is to make a nuisance of yourself -- to show up, but put your contract situation into the spotlight in an annoying and disruptive way. The all-time visual symbol of this may well be Terrell Owens doing pushups in his driveway. Jenkins or Umenyiora could choose to simply continue being a pain, in the hope that the annoyance might prod the team into trading him for less than they think he's worth. But this carries risk, as well -- the basic one being the risk of giving the outside world (and potential future employers) reason to believe you're a jerk.
The Giants don't fear this from Umenyiora, because they trust their coaching staff and their veteran locker room to effectively ignore potential disruptions. And the Cowboys know Jenkins, and I think they're betting on the idea that he's not the pushups-in-the-driveway sort.
What these guys are doing now -- skipping voluntary workouts and letting it be known through third-party sources that they're upset -- is the simplest way to make their particular point. It costs them nothing right now to stand up for themselves, and they should.
If you're unhappy at work and you feel your bosses aren't treating you fairly, it's important to find a proper and effective way to let them know. That goes for you, me, NFL players and everyone else. But in the end, in the cases of Jenkins and Umenyiora, there's not going to be anything either one can do.
This is the nature of their profession, and the working conditions under which NFL players operate. It's not fair, because teams can end contracts on a whim and the risk of injury is incredibly high, but a history of players crossing picket lines and caving in on labor negotiations has constructed a system in which the teams hold all the cards and the player rarely finds himself in the position of strength. Unfortunately for NFL players, this isn't Major League Baseball.
Jenkins and Umenyiora are both eligible to be free agents next year, and I don't think either has to fear the franchise-player designation. The franchise numbers for cornerbacks and defensive ends are over $10 million, and it's unlikely that either the Cowboys or Giants would want to commit so much to their No. 3 player at those positions.
It's too far into the future to predict for certain, but the odds are they won't be in limbo again this time next year. Right now, all these guys can do is decide how much fine money (if any) they're willing to spend to make their point, and once they reach that number, show up, practice, hope they don't get hurt and play well enough to convince some other team to give them big contracts in 2013.
It may not be great. May not be fair. But for Jenkins, Umenyiora and so many others like them in the NFL, they unfortunately don't have much choice.
SPONSORED HEADLINES
Comments
You must be signed in to post a comment
Need an account?
Already have an account?
You are fully responsible for the content you post. Content that includes profanity, personal attacks or antisocial behavior (such as "spamming" or "trolling"), or other inappropriate content or material will be removed. We reserve the right to block any user who violates our terms of use, including removing all content posted by that user.
MORE FROM ESPN DALLAS
Check out ESPN Dallas, the place for your local Dallas sports coverage. | null | minipile | NaturalLanguage | mit | null |
Like most men, Joel Vaughan wanted to marry, so he prayed for a mate and dated as often as he could. But more than 10 years after high school graduation, he still hadn't found his wife.
Then, while in his mid-30s, he was organizing the details of a conference. A package he needed for the event had not arrived the morning it was due. Desperate, Joel did everything he could. Still no package. Miraculously, only minutes before the seminar started, a courier walked into his office and handed him the prized box. Filled with gratitude, Joel silently thanked God for the delivery.
That's when he felt he heard God speak to his heart. In the same way I brought this box, I'll bring your wife. When you have done everything you can, then I will bring her.
Joel laughs now and says that, by the time he turned 42 and moved to Colorado Springs to work for Focus on the Family, he wondered if he'd just "eaten some bad chili" the night before and hadn't heard from God at all. Still, he continued praying and enjoyed dating, but without long-term success.
Then one day, almost two years after moving to Colorado, he unexpectedly met his future wife, Kellie, while picking up his mail. She purchased the town home next to his and had just moved in. Weeks later, when Joel discovered Kellie also worked for Focus, he thought, "God could be doing something."
Indeed, He was.
After their first meeting, Kellie and Joel became good friends, danced their way to love in a ballroom class, then tied the knot a year and a half after they met. Joel now jokes that not only did God "deliver" his wife just as He promised, He brought her right to his mailbox; a true mail-order bride.
Brian and Cindy Elliott, like Joel and Kellie, also wondered if they would ever find "the one." But unlike the Vaughans, they didn't meet at a mailbox, but on a dance floor of the Queen Mary when they both attended a Christian Singles dinner dance. Both were 38 years old when they walked the aisle.
Joel, Kellie, Brian and Cindy are like an increasing number of singles who are marrying later in life. They understand better than most about the frustration that can result from waiting and praying to find a mate. And they are also well-acquainted with the joys and challenges of marrying later than the average person.
So if you're an older single and you want to get married, here is some advice from four people who've been there:
There's Not Necessarily Something "Wrong With You" if You're Still Single
The Vaughans and Elliotts know what it's like to face the stereotype of having something "wrong with you" if you're older and still single. Thankfully, when each of them explains why they didn't marry earlier, they agree that it was due to not meeting the right person. In retrospect, all see God's sovereignty in action.
"God brought Cindy at just the right time," Brian says.
This can be comforting for many singles who fear that they can't find a mate because of their flaws.
While it's important to improve your emotional and spiritual health while you're single, remember that everyone is a work in progress and that God ultimately controls every detail of your life.
Marrying Later Doesn't Mean You'll Have a Harder Time Complementing Your Mate
It's commonly thought that couples who marry later in life will automatically have a more difficult time uniting as a couple because each spouse is set in his or her own ways. Not so for either couple.
"Kellie and I have found it very easy to blend," Joel says. "She and I were extremely grateful the Lord brought someone to us …after years of wondering and waiting," which he says helped them merge their lives together.
Cindy Elliott agrees: "[When I married], I was surprised at the perspective I had on what's important and what's not."
She doesn't worry about minor problems like her children's fingerprints on the refrigerator because she is just grateful to have a family. This has made blending easier than she anticipated.
If You Want to Get Married, Do Something!
Both the Vaughans and the Elliotts also say that marrying later can be challenging because it becomes more difficult to find a suitable mate. But many Christian men, Joel and Brian suggest, don't take the initiative to find a wife.
"A common complaint I hear from single Christian women is that Christian men don't do anything," Joel says.
"Some people believe that God is a magic genie," Brian says. "They say they're not going to work on their issues but expect God to magically bring someone to them. You need to learn about yourself and learn about others."
In short, both men agree that guys should get busy and initiate!
Take Advantage of Your Single Season
In retrospect, Cindy wishes that she would have taken better advantage of her "single season" by focusing more on God.
Joel agrees.
"The Apostle Paul was very clear. You can serve God better being single," he says. Of course, there is intense emotional pain that can come from being alone. But God is always faithful. "Realize that the key to everything else in life is to get closer to God."
So while you're waiting, praying and dating, develop a heart of gratitude and service to bless God and others. | null | minipile | NaturalLanguage | mit | null |
Quantitative trait locus mapping and functional genomics of an organophosphate resistance trait in the western corn rootworm, Diabrotica virgifera virgifera.
The western corn rootworm, Diabrotica virgifera virgifera, is an insect pest of corn and population suppression with chemical insecticides is an important management tool. Traits conferring organophosphate insecticide resistance have increased in frequency amongst D. v. virgifera populations, resulting in the reduced efficacy in many corn-growing regions of the USA. We used comparative functional genomic and quantitative trait locus (QTL) mapping approaches to investigate the genetic basis of D. v. virgifera resistance to the organophosphate methyl-parathion. RNA from adult methyl-parathion resistant and susceptible adults was hybridized to 8331 microarray probes. The results predicted that 11 transcripts were significantly up-regulated in resistant phenotypes, with the most significant (fold increases ≥ 2.43) being an α-esterase-like transcript. Differential expression was validated only for the α-esterase (ST020027A20C03), with 11- to 13-fold greater expression in methyl-parathion resistant adults (P < 0.05). Progeny with a segregating methyl-parathion resistance trait were obtained from a reciprocal backcross design. QTL analyses of high-throughput single nucleotide polymorphism genotype data predicted involvement of a single genome interval. These data suggest that a specific carboyxesterase may function in field-evolved corn rootworm resistance to organophosphates, even though direct linkage between the QTL and this locus could not be established. | null | minipile | NaturalLanguage | mit | null |
Introduction {#sec1-1}
============
Placental-related disorders of pregnancy affect around a third of human pregnancies \[**[@R1]**\]. Changes in human lifestyle, such as delayed childbirth and diets customs, have increased the global incidence of placental-related disorders over the last decades \[**[@R2]**\].
Oxidative stress in utero--placental tissues plays an important role in the development of placental-related diseases.
Homocysteine, a sulfur-containing amino acid derives from the demethylation of methionine during DNA or/and RNA methylation. Increased homocysteine levels represent a risk factor in cardiovascular disease, osteoporosis, renal failure, diabetic microangiopathy, neuropsychiatric disorders \[**[@R3]**\].
Maternal hyperhomocysteinemia (Hcy) is frequently associated with placental mediated diseases, such as preeclampsia, spontaneous abortion and placental abruption \[**[@R4]**\]. Hyperhomocysteinemia induces the activations of NADPH oxidase and increases ROS \[**[@R5]**\].
For preventing hyperhomocysteinemia a lot of vitamins are prescribed during pregnancy. The folates belong to the vitamin B group and are involved in a large number of biochemical processes, including the metabolism of homocysteine. It is well known that folic acid supplementation impedes the neural tube defects, spontaneous abortion and recurrent pregnancy loss.
In spite of the acknowledged harmful effect of homocysteine in pregnancy, a lot of questions and problems remain unanswered and unsolved.
In our study we tried to estimate the clinical usefulness of the detection of the serum homocysteine and malondialdehyde in the placental related diseases and to evaluate the correlations between these markers in women with risk of abortion or preterm birth.
Material and method {#sec1-2}
===================
The study was performed at the Obstetric Gynecology Clinical Hospital Oradea from December 2009 until april 2010. It included 18 patients with risk of abortion (group 1), 22 with risk of preterm birth (group 2). The control group was matched with the studied groups for age, BMI (body mass index) and gestational age and consisted of 14 healthy pregnant women (group 3). All groups took oral vitamins supplementation which comprised 800 μg folic acid, 4.0 μg B12, 2.6 mg B6.
The diagnosis of risk of abortion is made for pregnancies less than 24 weeks of gestation, with uterine contractility and with local modifications based on changes in the Bishop score.
The risk of premature birth appears between 24 and 37 weeks of pregnancies, with painful uterine contractions (more than 3-4 contractions per hour) and local changes of the cervix, that are illustrated on a modified Bishop score.
For each of the patients enrolled we have a file with:
• age, residency, living conditions, profession, studies, toxics (smoking and caffeine ingestion)
• gestational age using last menstrual period and ultrasound confirmation
• waist, weight, calculated BMI
• blood pressure and sitting pulse
• a physical examination and a gynecological one
• an obstetrical ultrasound investigation for fetal biometry, viability, gestational age, biparietal diameter, head circumference, abdominal circumference, femur length.
• a Doppler examination on uterine artery, umbilical artery and medial cerebral artery
All groups were enrolled in the study after having been informed and subscribed a written consent. The study was approved by the institutional ethical committee.
For each of the patients blood samples were collected from antecubital veins of the subjects in supine position before any medication, with all aseptic precautions after an overnight fasting. Samples were centrifuged and serum was separated and stored at -35°C until analysis.
Serum homocysteine level was measured by an enzymatic method, on instrument Hitachi 912, Roche, reagent: Axis-Shield Enzymatic Homocysteine Assay Cat No.FHER100. For proving the oxidative stress we established the level of malondialdehyde using a method with thiobarbituric acid TBA (16) and the level of ceruloplasmin with the Ravin method. In the same time the level of AST/GOT, ALT/GPT, CRP(C reactive protein), iron, uric acid and urea was tested. Data are expressed as mean ± SD (standard deviation). The significant differences was assessed using the Student\`s test. P value \< 0.05 was considered statistically significant. The correlation between parameters was estimated by Pearson\`s correlation coefficient (r).
Results {#sec1-3}
=======
There were no significant difference between gestational age, arterial pressure and body mass index (BMI) among the studied pregnant women and the control group (**[Table 1](#T1){ref-type="table"}**). The mean levels of serum homocysteine, MDA, ceruloplasmin, AST, ALT, CRP, iron, uric acid, urea are shown in table no.1.
######
Characteristics of study and control group
Group 1 Group 2 Control group
-------------------------------------------------------------------------------------------- ------------- ------------- ---------------
N 18 22 14
Age (years) 27,8±2,6 28,4±3,0 29,2±4,3
Mean arterial pressure (mmHg) 112/70 113/72 116/73
BMI(body mass index) 23,93 28,44 27,72
AST/GOT(U/L) 16,66±1,32 14,47±2,09 13,23±1,78
ALT/GPT(U/L) 10,90±1,58 10,30±2,26 10,98±2,18
Ureea (g/L) 0,12±0,05 0,12±0,02 0,17±0,02
Uric acid (mg/dL) 2,59±0,35 2,87±0,58 3,08±0,64
Iron (μg/dL) 87,13±22,45 70,08±21,31 65,36±10,63
CRP (mg/L) 4,95±2,93 3,20±2,27 2,07±0,48
Homocysteine (μmol/L) 5,33±0,66 5,70±0,72 4,91±0,67
Malondialdehyda (nmol/ml) 2,59±0,38 2,82±0,41 2,46±0,35
Ceruloplasmin (mg/dl) 48,63±6,08 44,76±4,99 49,55±8,15
group 1= risk of abortion, group 2= risk of preterm birth, group 3= healthy pregnant women
{#F1}
In the first group of women with risk of abortion homocysteine concentration was higher compared to the control group (from 4.91μmol/l in control group to5.33 μmol/l in group 1). The group of women with risk of preterm birth had also an elevated level of the seric homocysteine (5.70μmol/l and 4.91μmol/l in the reference group). Homocysteine concentration between group 1 and group 2 (p=0.05), between group 1 and control group (p=0.041), and between group 2 and control group (p=0.022) is statistically remarkable.
We have obtained higher values for pregnancies with risk of preterm birth than for those with risk of abortion (**[Fig. 1](#F1){ref-type="fig"}**).
{#F2}
The mean values for MDA was 2.82 nmol/ml in pregnant women with risk of preterm birth, 2.59 nmol/ml in women with risk of abortion and the smallest value 2,46 nmol/ml in the control group. There are no important differences between group 1 and control group (p\>0.05), but the difference is significant between group 2 and group 1, respectively the control group (p=0.040, p=0.031).
We obtained the smallest value for the control group and the highest one in the group of women with risk of preterm birth, but without statistical importance. There is a considerable variation between the women with risk of preterm birth, with higher MDA value than those in the group of women with risk of abortion (**[Fig. 2](#F2){ref-type="fig"}**).
{#F3}
We obtained important differences of ceruloplasmin between group 1 and group 2 (p=0.045), and between group 2 and the control group (p=0.034), and no significant differences between group 1 and the control group (p=0.683) (**[Fig. 3](#F3){ref-type="fig"}**).
{#F4}
The mean levels of CRP is higher in group in comparison with the group 2 (p=0.042), and also group 2 likened with the control group (p=0.030).
Variations without importance of urea and uric acid are present between group1, group 2 and the control group (p\>0.05) (**[Table 1](#T1){ref-type="table"}**). The level of ALT/GPT is similar in all the three groups (p\>0.05). Significant differences of the concentration of AST/GOT between group 1 and group 2 (p=0.011), between group 1 and the control group (p\<0.001), appeared but not between group 2 and the control group (p= 0.593) (**[Fig. 5](#F5){ref-type="fig"}**).
{#F5}
{#F6}
Significant negative correlations were observed between serum concentration of ceruloplasmin and MDA r=-0.71, p\<0.001(**[Fig. 6](#F6){ref-type="fig"}**).
{#F7}
{#F8}
Significant negative correlation were observed between serum concentration of homocysteine and CRP r=-0.37, p=0.044 (**[Fig. 8](#F8){ref-type="fig"}**).
Discussion {#sec1-4}
==========
Due to the perturbations in methionine metabolism, hyperhomocysteinemia during pregnancy is implicated in adverse outcomes such as neural tube defects, preeclampsia, spontaneous abortion, and premature delivery \[**[@R6]**\].
In our study serum homocysteine concentration was significantly high in both groups of women with risk of abortion and with the risk of preterm birth compared to the control. The level of homocysteine was considerably increased in the group of women with risk of preterm birth compared to the reference group (p=0.022) and also in the group of women with risk of abortion.
The serum concentration of homocysteine was higher in the group 2 in comparison with group 1 (p=0.05).Our results were similar to those obtained by other researchers \[**[@R7],[@R8]**\].
All the patients received a vitamin supplementation, having role in the prevention of homocysteinemia and of premature vascular disease in pregnant women. Early damage to decidual or corionic vessels may cause abnormal implantation of the blastocyst. On the other hand some papers point out that the disturbed folate metabolism is not an apparent risk factor for spontaneous first-trimester pregnancy loss \[**[@R9]**\]. More specific studies regarding type of vitamin and its usefulness need to be conducted.
A significant positive correlation can be seen between serum concentration of homocysteine and uric acid. The explanation of this is that homocysteine induces endothelial cells lesions and release purine nucleotides. Catabolism of the purine nucleotides leads finally to the production of uric acid. Uric acid is one of the plasma antioxidants which protect the cells against increased ROS activity.
Significant negative correlations were observed between serum concentration of homocysteine and CRP.
Homocysteine is a potent excitatory neurotransmitter that binds to the N-methyl-D-aspartate (NMDA) receptor and also leads to oxidative stress, cytoplasmic calcium influx, cellular apoptosis, and endothelial dysfunction \[**[@R10]**\].
There are a lot of researches which put in evidence that oxidative stress in utero--placental tissues with an important role in the development of placental-related diseases.
Ezashi et al. 2005 \[**[@R11]**\], pointed out that the hypoxia is necessary to maintain stem cells in a fully pluripotent state. Physiological level of reactive oxygen species regulates the transcription factors \[**[@R12]**\]. In normal pregnancies, the earliest stages of the fetus development take place in a physiological hypoxia. This protects the developing fetus against the deleterious and teratogenic effects of reactive oxygen species (ROS).
In women with risk of abortion, the development of the placento--decidual interface is severely impaired leading to early and widespread onset of maternal blood flow and major oxidative damage. This mechanism is common to all miscarriages, especially in the first trimester of pregnancy depending also on the etiology \[**[@R1]**\].
The levels of lipid peroxides are too increased in the villous and decidual tissues of women undergoing early pregnancy loss \[**[@R13],[@R14]**\].
In our study there are no significant differences of MDA between group1 and control group (p\>0.05), but they appears between group 2 and reference group (p=0.031) and also significant between the studied groups.
Baxter et al. \[**[@R15]**\] have shown that women with naturally higher levels of antioxidant enzymes are less likely to miscarry. The concentration of ceruloplasmin in the group of women with risk of abortion was considerably higher than in the group of women with risk of preterm birth (p=0.045), in comparison with healthy pregnant women (p=0.034). Similar values was noticed in the group 1 and the control group (p=0.683).
The enzyme AST/GOT catalyzes the transfer of the amino group of the aspartic acid to α ketoglutaric acid, forming glutaminic and oxaloacetic acid. After extensive tissue destruction AST/GOT and ALT/GPT are liberated into the serum. The elevated serum level of AST/GOT in the group of women with risk of abortion indicates an utero-placental damage.
C-reactive protein (CRP) rises in the early phase of inflamation. The higher value of CRP associated with increased concentration of AST/GOT, oxidative stress and hiperhomocysteinemia represents a signal of severe utero-placental disturbance.
These results offer arguments for an early prophylaxis with antioxidant vitamins which decreases homocysteine levels, oxidant activity and in the same time can restore the endothelial malfunction.
Conclusions {#sec1-5}
===========
1\. Serum homocysteine concentration was significantly higher in both groups of women with abortion risk and of preterm birth compared with the control group.
2\. A significant positive correlation can be seen between serum concentration of homocysteine and uric acid demonstrating indirectly the harmful action of hiperhomocysteinemia upon the endothelium.
3\. In both studied groups there was an augmentation of MDA in comparison with the control group.
4\. The rise of AST/GOT and of CRP in women with risk of abortion constitutes an indicator of utero-placental disorders.
**Acknowledgements**
This paper is supported by the authors.
| null | minipile | NaturalLanguage | mit | null |
Videogaming Illustrated
Videogaming Illustrated was a video game magazine published in the United States and ran from August 1982 to March 1984. It changed its title twice: in issue June 1983 to Videogaming and Computer Gaming Illustrated and in issue January 1984 to Video and Computer Gaming Illustrated. Its short run has been explained by the North American video game crash of 1983.
History
Content
The magazine was split up into the following sections:
Keyboard
Eye On
Preview
VIP
Focus On
Input
RAMblings
Awards
See also
List of video game magazines
References
External links
ataricompendium.com - PDF magazine repository
digitpress.com - PDF magazine repository
retromags.com - PDF magazine repository (in high resolution)
Cheap Gaming Laptop Under 200
Category:1982 establishments in the United States
Category:1984 disestablishments in the United States
Category:American bimonthly magazines
Category:American monthly magazines
Category:American video game magazines
Category:Defunct American computer magazines
Category:Magazines established in 1982
Category:Magazines disestablished in 1984
Category:Magazines published in Connecticut | null | minipile | NaturalLanguage | mit | null |
Purinergic signaling modulates the cerebral inflammatory response in experimentally infected fish with Streptococcus agalactiae: an attempt to improve the immune response.
Appropriate control of the immune response is a critical determinant of fish health, and the purinergic cascade has an important role in the immune and inflammatory responses. This cascade regulates the levels of adenosine triphosphate (ATP), adenosine diphosphate, adenosine monophosphate and adenosine (Ado), molecules involved in physiological or pathological events as inflammatory and anti-inflammatory mediators. Thus, the aim of this study was to evaluate whether purinergic signaling, through the activities of nucleoside triphosphate diphosphohydrolase (NTPDase), 5'-nucleotidase, and adenosine deaminase (ADA), is capable of modulating the cerebral immune and inflammatory responses in silver catfish that is experimentally infected with Streptococcus agalactiae. Cerebral NTPDase (with ATP as substrate) and 5'-nucleotidase activities increased, while ADA activity decreased in silver catfish that is experimentally infected with S. agalactiae, compared to the control group. Moreover, the cerebral levels of ATP and Ado increased in infected animals compared to the uninfected control group. Brain histopathology in infected animals revealed inflammatory demyelination (the presence of occasional bubbly collections), increased cellular density in the area near to pia-mater and intercellular edema. Based on this evidence, the modulation of the purinergic cascade by the enzymes NTPDase, 5'-nucleotidase, and ADA exerts an anti-inflammatory profile due to the regulation of ATP and Ado levels. This suggests involvement of purinergic enzymes on streptococcosis pathogenesis, through regulating cerebral ATP and Ado levels, molecules known to participate in physiological or pathological events as inflammatory and anti-inflammatory mediators, respectively. In summary, the modulation of the cerebral purinergic cascade exerts an anti-inflammatory profile in an attempt to reduce inflammatory damage. | null | minipile | NaturalLanguage | mit | null |
Retro style stretch top with long sleeves and sweetheart opening in soft fabric. The fabric contains a great amount of stretch and has a soft hand allowing for great comfort. This cute long sleeve top has pleats at the front to enhance the curves of the upper body. | null | minipile | NaturalLanguage | mit | null |
Q:
Firebase rules - How to block extra data
I checked the documentation and many other sources, but I couldn't find any information related to this.
How do you make sure the data is being sent by the user does not have extra data?
Let's say, a post could be
{ title: 'Y', author: X, content: 'lorem...' }
Is there any way you can make sure that the user is not including anything more than the title, the author and the content? How do we stop those cases and secure the database so it does not include anything more than what is expected?
I mean, sure, you can handle that from the front-end side...but that's not secure :)
The only way I found to handle that is by using Cloud Functions and setting there the necessary rules/logic.
Furthermore, It gives me the feeling that Firestore rules are not as secure as they should be.
Unless you just set up rules for reading content, not writing, as it seems you can't stop the user adding extra data (props).
I hope someone can give a bit of light to this subject :)
A:
You can restrict keys by firestore rules, but you need to update rules every time you add new keys, try the following rule
service cloud.firestore {
match /databases/{database}/documents {
match /scenarios/{scenario} {//replace scenarios with your collection name
allow read: if true;
allow write: request.resource.data.keys().hasOnly(['title','author','content']) == true;
}
}
}
| null | minipile | NaturalLanguage | mit | null |
St. John Cantius High School, Poznań, Poland
St. John Cantius School is a high school in Poznań, Poland named after the scholar and theologian St. John Cantius.
It was founded in 1920 by Gotthilf Berger, Edward Raczyński and Hipolit Cegielski, in place of the German-language high school previously known as Friedrich Wilhelm Gymnasium, in honor of Frederick III. Between 1853 and the First World War the Polish-German sections of the school were known also as the Real School and the Berger Gymnasium after G. Berger.
Some notable alumni include: Florian Marciniak, Władysław Niegolewski, Zbigniew Zakrzewski, Xaver Scharwenka and Zygmunt Gorgolewski. Noted faculty members included Hermann Loew and Karol Libelt.
Sources
Official site of Poznań city
Official site of Wielkopolska
Category:Schools in Poland
Category:Education in Poznań
Category:Educational institutions established in 1920
Category:1920 establishments in Poland | null | minipile | NaturalLanguage | mit | null |
Home»Insurance» Manulife applied to have me disqualified from suing them, and lost.
Manulife applied to have me disqualified from suing them, and lost.
On November 30, 2015, the BC Supreme Court dismissed arguments by the Manufacturer’s Life Insurance Company, attempting to have me disqualified from acting as plaintiff’s counsel in a breach of contract claim against them.
In McMyn v. Manufacturer’s Life Insurance Company the insurer (Manulife) argued that, as a former in-house lawyer, I had knowledge of their “business practices, litigation strategies, insurance policies and certain claims personnel” and it would be unfair to allow me to now use this knowledge against them.
In dismissing the application Mr. Justice Myers provided the following reasons:
[32] With respect to the claim for LTD benefits, it is up to the plaintiff to show that she fell within the terms of the policy. The terms of the policy are certainly not secret. It cannot be argued or assumed that Manulife has some secret interpretation of the policy that Mr. Fishman has knowledge of. It is hard to see that knowledge of the claims people would have any effect on Mr. Fishman’s train of inquiry on that issue, including the handling of examinations for discovery. As in most LTD claims the real issue will no doubt be – and no one argued otherwise – Ms. McMyn’s medical condition and how that fits into the wording of the policy.
[33] With respect to the bad faith claim, the plaintiff must show a failure of Manulife to act with reasonable promptness or a failure to deal with the insured fairly: 702535 Ontario Inc. v. Non-Marine Underwriters, Lloyd’s London, England, [2000] O.J. No. 866 (Ont. C.A.). That will obviously depend on the way this claim was handled based on the evidence in this case. Knowledge of how the claims people may have handled past claims will be of little or no assistance.
[34] Manulife argued that Mr. Fishman has insight into how the claims people or Mr. Lizé perform in examinations for discovery. That might be true. But it must be put into perspective. First, in terms of witnesses selected for examination for discovery or at trial, the relevant witnesses are those that have familiarity with the facts of the claim. That is something that any lawyer would be able to ascertain through document discovery or interrogatories. Mr. Fishman has no inside knowledge of that because he was not at Manulife when the plaintiff filed her claim.
[35] Knowledge of how Manulife personnel perform in examinations for discovery might provide a minor advantage. But any lawyer who had previously done an examination for discovery or cross-examination in trial of that witness would also have that insight. It is to be borne in mind that Manulife as a major LTD insurer in Canada is an institutional litigator. This is not a one-off claim being made against it. Any lawyer specialising in LTD claims would be expected to act against Manulife multiple times and most likely come up against the same Manulife personnel.
[36] Insofar as Mr. Fishman being aware of Manulife’s claims handling procedures, once again he has been gone from the company for over two years. The issue will be the way this claim is handled. If there are Manulife claims handling manuals their existence will come out in the examinations of discovery conducted by any counsel.
[37] In Sandhu the Court noted, at para. 32, that the approach to this type of application is a “cautious one” and that the court should only interfere in “clear cases”. While the Court of Appeal disqualified the lawyer, this case comes nowhere near to the facts in that case, where the lawyer had knowledge of confidential information pertaining directly to her new client.
[38] Regarding Mr. Fishman having handled bifurcation applications, Manulife said Mr. Fishman is aware of Manulife’s preference for bifurcation of bad faith claims. So would any lawyer who was previously on the receiving end of that type of application from Manulife. In this case, the simple fact is that Manulife will make the application or it will not. I fail to see what confidential strategy could have been involved in bifurcation claims that would give Mr. Fishman an advantage.
[39] Finally, I do not place any significant weight on Mr. Lizé having been appointed as the case manager on this file. He was not appointed until after Manulife knew that Mr. Fishman was acting on the case. Manulife also appointed Mr. Lizé as the case manager on the Galley action. Manulife says it would be inconvenient to appoint another case manager, because they would have to come from out of town for discoveries, trial or meetings. However, for a company the size of Manulife that must be a small consideration.
[40] In Atco, the Court concluded that the case the lawyer was acting on against Atco was sufficiently connected to the work he had done at Atco to raise the rebuttable presumption that he had confidential information pertaining to the new retainer. The connections in that case were more direct than the ones here. In Atco the lawyer knew all of the data and other corporate information relevant to Atco’s rate applications. Here, there is only a general knowledge of claims practices and company personnel.
[41] I conclude that the connections between this case and the work Mr. Fishman did at Manulife are not sufficient to raise the presumption that he had obtained confidential information that could be used in this case.
This decision has been the subject of several articles in respected publications, including:
Please keep in mind that merely contacting Fishman Lawyers will not establish a solicitor-client relationship. Fishman Lawyers cannot represent you until the firm knows there would not be a conflict of interest and the firm determines that it is otherwise able to accept the engagement. Accordingly, please do not send Fishman Lawyers any information or documents until a formal solicitor-client relationship has been established through an interview with a lawyer and authorized in the form of an engagement letter from Fishman Lawyers. Any information or documents sent prior to your receipt of an engagement letter cannot be treated as confidences, secrets or protected information of any nature. For additional information, please call us at 604-682-0717. Clicking "Submit" acknowledges that you understand and agree with this notice. | null | minipile | NaturalLanguage | mit | null |
Posts Tagged ‘mocne’
NEXT up from this batch of Polish beers is a can of Tatra Mocne from none other than Grupa Żywiec. The same chaps as those behind the Żywiec Polish Prized Original Beer that you can find in every off-license and supermarket in London. That beer was a perfectly adequate lager. But this is a strong “Mocne”. That pits it against the barely fit for human consumption Okocim Mocne, Dębowe Mocne and Warka Strong. To beat them, all this needs to be is better than ghastly. Here then, is a Żywiec Tatra Mocne.
Just like yesterday’s Okocim Harnas, the whole thing is covered in some sort of promotion. And again, I have little idea what’s written on it. It looks like a competition to win tickets, digital cameras and, oddly, chairs. As usual, all translations, pronunciations and opinions from Polish people are very welcome.
In the big roundel, things look a little familiar. That fellow with the hat and pipe looks a tiny bit similar to the lumberjack chap from Okocim Harnas. Am I imagining it?
There are a couple medals too. One of them has the year 1856. I don’t know what the awards are. But I’m pleased that it has them. The bottom of the can is all obscured by pictures of mountains and the promotional details. But around the top border, I’m going to take a wild guess at what it says. Does it say something about it being “strong with character”? Translators, you know what to do.
This can actually has different things printed on four ‘sides’. Unlike most others that repeat the same thing over and over again. On the ‘back’, this one has what looks like the full terms and conditions for the promotion.
Next is the barcode ‘side’ of the can.
As well as the barcode, it has a sensibly large anti-drink-drive message. It also has all the details about the brewer. Which, it tells us, is Grupa Żywiec from Żywiec. There’s a telephone number and email address for those who need such details. They have a website address too which is www.tatra.pl. There didn’t seem to be an English language section when I checked it. What I could work out is that there’s also a regular Tatra and you can get them in bottled form too.
On the other ‘side’ of the can are the vital statistics. At least that’s what I think they are. It’s hard to be sure when you can’t understand the language.
First among the details is that this is the ever-popular 500ml size. Next is the only other detail I can understand; the alcoholic volume. Which appears to be 7%. Without a doubt, this is a “mocne”.
Normally, my expectations from a Polish “mocne” beer are low. Very low. But this one talks about awards and character. Will it be better than the rest? How will it taste? Should you try one? It’s time to find out.
There’s no problem with an insane head this time. Everything is under control with a layer small of froth which quickly dissipates. What you’re left with is a dark amber drink with a patch of bubbles floating on the surface.
How does it smell? Horribly artificial. This is one of the most synthetic and unpleasant smelling I’ve ever smelt. I think they were aiming to make it smell of a blend of malted barley and other beer ingredients. What they created instead was a smell of industrial cleaning fluid.
How does it taste? Almost as bad as the smell. Three gulps in, and my tongue is being assaulted by the strongest and least palatable flavours and tastes since the gone-off milk I accidentally had a few weeks ago. What hits you is a building taste of chemicals. This taste culminate in a bitter, lingering aftertaste. It lingers, seemingly forever. The whole experience is like drinking something as natural as Red Bull.
Is there anything to like about Żywiec Tatra Mocne? Well, it has bags of taste, I can give it that. It’s not too gassy. And it’s an effective means of rapidly becoming sloshed. It’s so strong that you soon forget how bad it tastes.
What are you liable to hate about Żywiec Tatra Mocne? Much of it. It has about the worst taste I’ve ever witnessed. It tastes rancid and artificial. I’ve had Tesco Value ready meals that taste more natural.
To sum up, Żywiec Tatra Mocne is strong yet synthetic and horrifyingly bad. Try it if you must, but you can easily choose something better. If you need a strong lager, then Skol Super or Carlsberg Special Brew taste marginally better, are cheaper and easier to find, and are two-percent stronger. If you want taste and drinkability, then almost every other can or bottle on the shop shelf will be better. There is no reason for you to suffer this monstrosity.
Rating: 0.7
Have you tried Żywiec Tatra Mocne? What did you think of it? Can you translate anything?
Do please leave your translations, corrections, opinions, requests and recommendations here. And check my next post for another Polish beer.
Like this:
Okocim Mocne was a disappointment. But it wasn’t the only Polish “Mocne” beer in the shop. So, to see if there are better, or worse, Mocne’s out there, here’s another one: Dębowe Mocne. At a very premium £1.69 from the corner shop where I found them both, Dębowe Mocne is 10 pence pricier. Let’s hope it’s worth it.
First impressions are that it looks almost identical to the Okocim Mocne. Dark colours with splashes of gold seem to be the norm, when it comes it strong Mocne beer.
The neck label simply has a smaller version of the main logo.
Quite simply, a picture of a tree. Not as powerful as Okocim’s eagle. And an unusual choice of imagery.
The big, main, front label has no English. So it’s down to you. If you can translate anything, do please leave a message at the end of this post.
Besides the name, the only detail I can make sense of, is the alcoholic volume. Which, like Okocim’s Mocne, is 7%. Like every other Polish beer, there’s a 14.5% “WAG”, whatever that means. Why does every Polish beer have this percentage? What does it mean?
“Naturalna Moc” must be hinting at “natural ingredients”. But “Bogaty Smak”? Possibly the two funniest Polish words I’ve ever failed to understand, together in one place. Priceless.
The back label doesn’t answer any more questions. At least not in English.
There is what looks like a medal. A 2006 “Grupa Media Partner” “Laur Konsumenta” medal. Does that mean anything to anyone reading?
Next to the medal is a paragraph I can’t understand. And a bar cutting across the label with the words “Dębowe Laurowe”.
Then we get to the ingredients. This is always a good place to look for clues. And this one yields a surprise. The familiar name brewing name of Kompania Piwowarska SA from Poznań. Familiar, because it’s what was on that can of Żubr a few weeks ago. Unfortunately, it doesn’t raise my expectations. The only thing good about Żubr was its television commercials.
Also on the back label is an “Infolinia” information line telephone number. And confirmation that this is a 500 millilitre bottle. But you could probably tell that from it being exactly the same size and shape as countless other bottles on the shop shelf.
With little learnt from the outside of the bottle, it’s time to answer the big question about what’s inside the bottle. Is it any good?
The smell is utterly unremarkable. Like any cheap yet strong beer or lager, it smells of malted barley and yeast. It’s not the most pleasant of beer aromas.
And the taste isn’t any better. A ghastly bitter and sour taste prevails. And lingers. Not the fine, sophisticated bitterness of a proper beer or ale. Dębowe Mocne tastes like the worst of the high-strength lagers.
On the other hand, at least it’s full of flavour. Even if that flavour is as delecious as a dose of ebola virus. And, if you chill it enough to dull the taste, you could call it refreshing. It’s also not as gassy as Okocim Mocne.
Is Dębowe Mocne better than Okocim Mocne? No. Amazingly, it manages to be even worse and less drinkable. If you want a very strong lager or beer, then Tennent’s Super Strong Lager or Carlsberg Special Brew are stronger, cheaper and at least as drinkable. There’s even less reason to buy this, than there was with Okocim Mocne? One to avoid unless you’re a “Mocne” fan.
Rating: 0.6
Have you tried Dębowe Mocne?Can you translate anything on it? What did you think of this dreadful beer? What sort of reputation does it have in Poland?
Comments, corrections, ideas and suggestions in the usual place please.
Like this:
REMEMBER my review of above-average Polish beer Okocim? Well, I’ve since found a corner shop that sells it in bottles instead of cans. And, best of all, they sell a more exciting version: Okocim Mocne
This bottle cost a premium £1.59 pence. So let’s hope it’s worth it.
The bottle and labels have a much darker and more foreboding look. My first thought was that this must be a stout or a dark ale. But after closer inspection, I think the word “Mocne” must simply mean “strong”. Or, if you’re Polish, “medium”.
The neck label kicks things off with pictures of what look like medals. But they’re much too small to read. It does start the stylish gold on black colour scheme which I like though.
The main, front label is where the imagery gets serious. An eagle symbolises one thing: power. And this label uses it to great effect.
Most of the text at the top, I can’t read. Apart from the part that says “Strong Beer”. Under the Okocim Mocne logo and name, is that year again: 1845. A year that makes Okocim one of Polands most established beers.
At the bottom of the label are all the usual details. That this was brewed by Okocim in Poland. That the bottle holds 500 millilitres. And the alcohol volume. Except that little detail is worth re-reading. And that’s because it’s 7%. That brings this beer into the territory of strong ales. And nearly up to the level of the strong ciders and lagers. If it’s even moderately drinkable then, it will be doing very well indeed compared to its UK counterparts.
Just like the can, the back label doesn’t give up many details.
There’s a UK consumer helpline number. And a Polish Infolinia number. There is also a set of ingredients in both Polish and English. For the very curious, the ingredients are water, hops, malt and yeast. Just like the can, the Polish side of the ingredients mentions the name of European brewing colossus, Carlsberg. Plus, there’s a mention of the town, or city, I really don’t know, called Brzesko. What is that place like? It sounds delightful. Lastly, there’s a web address of www.okocim.pl, but you might need to look for links to the English language pages.
In the glass, I’m a little disappointed to see that it’s not as black as crude oil. But rather, it’s light shade of amber. It’s also big-headed. But wait a few moments, and it settles down to a reasonable, creamy layer. There are a lot of bubbles in there, so I’m preparing myself for a lot of burping.
The smell is not exactly distinctive. Yeast, hops and malted barley are the order of the day. But its strength makes it slightly more pungent than usual.
Three gulps in, and I’m already burping. This is a gassy beer. It’s also surprisingly full-bodied. No wateriness at all. The strong flavour that hit me was familiar. It reminded me of the mega-strong lagers. It’s a sharp, tangy bitterness. And it lingers on the back of your tongue. Different in character to the hoppy bitterness of ales. I don’t like the taste, but at least you get a lot of it.
It could be refreshing if you serve it cold. And, for the strength, it’s easy to drink. At least compared to the super-high-strength lagers on the market.
But it’s hard to see past the downsides. Okocim Mocne will make you burp. And the taste is as pleasant as blue tongue disease. If getting drunk is your aim, then there’s no reason to choose this, over the cheaper, and more potent lagers (9% vol.) and ciders (7.5% – 8.4% vol.) on the market.
I truly wanted to like Okocim Mocne. Especially after enjoying Okocim Beer. But there is simply no reason for you to spend your money on this beer.
Rating: 1.8
Have you tried Okocim Mocne? What did you think?
What does “Mocne” mean? Can you translate anything else from the labels? What reputation does it have in Poland? Are other strong Polish beers better? Or worse? If you have any corrections, additions, opinions, suggestions or ideas, do please leave them in the comments. | null | minipile | NaturalLanguage | mit | null |
What I learned after 100,000 miles on the road talking to Trump supporters - af16090
https://www.theguardian.com/society/2016/nov/03/trump-supporters-us-elections
======
jtrtoo
It's all too easy to feel righteous indignation for the "others" when we're so
easily immersed in our own little bubbles and personal challenges. To be sure,
there are fringes on the edges of every faction of the political spectrum that
are more difficult to reconcile, but if one can tune out that noise for a
moment there is a possibility of reaching a deeper understanding of one
another here. Whether or not you like the path chosen to office by our new
President-elect--or even like him at all--there is something to be learned
from listening to the large numbers of people who voted him into office and
the factions that supported him. Most of them are honest, decent, and
hardworking people that have similar struggles, hopes, emotions, concerns, and
dreams as most anyone else in this country. The President-elect's message
resonated with many people. That may seem crazy to many folks, but most folks
who voted for him aren't crazy. Pay attention, engage in conversation, and try
to understand why it resonated. And if you supported him, do the same. If
everyone can work hard to remove the rhetoric and BS perpetuated by any of the
political parties all the better.
------
blkhp19
A small sampling, but their reasons for supporting Trump just show how little
they know about why they're in their current situation / what electing Trump
could possibly change for them. It's simultaneously sad and infuriating.
This just goes to show that education is key. Education is about so much more
than the classes you take. It teaches critical thinking, which can help
improve emotional intelligence. Emotional intelligence is a powerful skill to
have. It allows one to look inward, reflect on their own circumstance, and
reason about how the society they live in actually affects them.
~~~
MrZongle2
_" This just goes to show that education is key."_
_IF_ it is accompanied with _understanding and empathy on the part of the
teacher._ Condescension is part of what got Trump elected; going "oh, we have
to teach these poor stupid people" or treating an education project in
Appalachia as a volunteer tourism lark will do little than breed more
resentment.
------
dvt
The article tries very hard to portray Trump's followers as racist, but really
I just think they are desperate and forgotten. A quote really resonated with
me, from Lori Ayers in Ohio:
> “I voted for Obama the first time, not the second. Now I am voting for
> Trump. We just got to change things.”
It's obvious that what resonates with blue-collar workers is change. The sad
thing is they are probably a dying breed in a world where computers are
replacing everything from air traffic controllers to bus drivers.
I'm not sure if there IS a solution, apart from massive education reform (to
help their kids break out of that social strata) or massive government
incentives to bring jobs back -- which will most likely not happen.
Conservatives definitely have their own problems, but liberals live in such
bubbles, it doesn't even surprise me Hilary lost (even though I was leaning
that she wouldn't).
------
rokosbasilisk
The narrative pushing is too much. I still cant believe how much of asian
indian and asian community voted for him in philadelphia very unexpected.
| null | minipile | NaturalLanguage | mit | null |
I spent four years as Forbes' Girl Friday, which to me meant doing a little bit of everything at once. As a member of the Forbes Entrepreneurs team, I looked at booming business and startup life with a female gaze. I worked on the PowerWomen Wealth and Celebrity 100 lists, keeping my ears pricked and pen poised for current event stories--from political sex scandals to celebrity gossip to international affairs. In 2012 I helped to put two South American women on the cover of FORBES Magazine: Modern Family star Sofia Vergara (the top-earning actress on U.S. television) and Brazilian President Dilma Rousseff, who is transforming the BRIC nation into an entrepreneurial powerhouse. Prior to Forbes I was at the Philadelphia CityPaper, where I learned more than any girl ever needs to know about the city's seedier trades. I studied digital journalism at The University of The Arts.
I left Forbes in November, 2013, to pursue other interests on the West Coast.
But while the gifts given to Kim and soon-to-be ex-husband Kris Humphries were paid for out of her guests’ pockets, as the donation was made from Kardashian’s checkbook, the charitable deduction is hers alone come tax time.
“That deduction does not extend to the givers,” says Tax Girl Kelly Phillips Erb. “Because she’s accepted the gifts, even if they were cash, those gifts have become her property. So it’s her gift to charity, not that of her guests. A note from Kim is not the same as a receipt from a qualified charity.”
“I wanted to let you know that the money for every gift received by me at my wedding has been donated to the Dream Foundation,” she wrote in a letter obtained by TMZ that was reportedly sent to each of Kim’s personal wedding guests. A source close to the star told me this morning that Kardashian and Humphries split the guest-list, so the monetary value of gifts referenced in Kim’s letter was for gifts received from her guests and hers alone. An insider for Us says that Humphries only kept “the bibles” he received as gifts.
But for Kardashian, whose wedding guest list was over 400, returning each gift to its giver might have proved an insurmountable task. She could have simply donated the gifts to charity, but with a wedding registry that included items like a $635 Baccarat ice bucket with matching $260 ice tongs, a $375 candy jar, a $710 sugar bowl and a set of 20 napkin rings for $3,000 it might have been tricky. According to Erb, there are tax rules keeping people from donating items that can’t be used by the charity. How much use the Dream Foundation could have found for the Baccarat ice bucket is, of course, arguable, but might have been tricky to prove. And so she went the simpler (and much-more tax-advantageous route) of keeping the gifts and cutting a check to charity to off-set any lingering guilt.
“From a Miss Manners perspective, I think this is her way of trying to look good because she doesn’t want to give the gifts back,” says Erb. But from a tax perspective, she says, Kardashian is free and clear to take the deduction, no matter how unfair or even rude it might seem to her guests. Despite the fact that, in theory, it’s their cash that’s being donated, they have no claim to stake with the tax man.
Why? According to CPA and Forbes blogger Peter J. Reillyit’s because any connection between the wedding gifts and the charitable donation is only in Kardashian’s head. “Cash is fungible,” he says, “So I don’t think technically that there’s really any connection between the gifts and the cash donation.” Gifts are excluded from taxable income, and once Kardashian accepted them any value was absorbed by her own coffers. That she subsequently cut a check to a charity is, in the eyes of the tax code, an unrelated event.
“She’s making the donation to the Dream Foundation from her personal account,” he says, and whether that the donation is made in the name of others bears no regard. The deduction can only be claimed by the individual who receives acknowledgement from the charity, in this case, the same woman who signed the check. “The fact is that I make donations in people’s name all the time,” Reilly says, “In honor of my mother or my father…but that doesn’t mean anything, really. When I file my taxes, I still take the deduction.”
Post Your Comment
Post Your Reply
Forbes writers have the ability to call out member comments they find particularly interesting. Called-out comments are highlighted across the Forbes network. You'll be notified if your comment is called out. | null | minipile | NaturalLanguage | mit | null |
New Pet Shop
This post originally appeared on Wallyhood, the Wallingford, Seattle neighborhood blog. Visit us for more Wallingford news.
(By Wallyhood)
We’d heard through the Twittervine that 4 Legs Good (on Wallingford Ave between 44th and 45th St) had been bought by a new owner (and long-time Wallyhood reader) Cherrrylll, but we didn’t know much about it. Thanks to Michelle, we now know the name: | null | minipile | NaturalLanguage | mit | null |
Enzymic synthesis of steroid sulphates. XIV. Properties of human adrenal steroid alcohol sulphotransferase.
Pure steroid alcohol sulphotransferase (EC 2.8.2.-) has the property of sulphurylating hydroxyl groups on different positions of the steroid ring. It has now been established that although only monosulphates are formed from substrates such as 3,17-diols, the position of the sulphate group depends on the relative configuration of the hydroxyl groups. Androst-5-ene-3 beta,17 beta-diol, for example, is sulphurylated mainly at the 17-position. In addition, compounds such as epitestosterone and 17 alpha-estradiol are sulphurylated at much higher rates than their respective 17 beta-epimers. It is believed that the steroid can approach the sulphurylation site via (i) ring A with the beta-side upwards, and in this mode a 3 beta-hydroxyl is sulphurylated at a higher rate than a 3 alpha-hydroxyl, or (ii) ring D with the beta-side downwards, and in this mode a 17 alpha-hydroxyl group is oriented in an analogous fashion to the 3 beta-hydroxyl in (i). The enzyme exhibits non-Michaelis-Menten kinetics within physiological concentrations (0-2 micro M) of the substrate dehydroepiandrosterone and evidence was obtained for the presence of multiple interacting steroid-binding sites. A regulatory role for the enzyme in the secretion of dehydroepiandrosterone from the human adrenal gland is proposed. | null | minipile | NaturalLanguage | mit | null |
Q:
Java Change Color Palette of an Image
Hello fellow programmmers!
I am a Java beginner and I have a Java program that takes an image, displays the unedited version, converts it to grayscale and shows the image, and applies a different color palette to the image and then shows it. I am having trouble applying the color palette to the image though, and it takes and changes the whole image to the color. How can I prevent it from changing the whole images color and just the color of the area I specify? It should turn out something like this:
Results should be similar to this
Please include notes with any code so I can understand what is happening in the program.
And here's the code. Thanks for helping me out!
import java.awt.*;
public class GrayscaleToColor
{
public static void main(String[] args)
{
Picture picture = new Picture("WashingtonMonument.jpg");
picture.show();
Picture picture2 = new Picture("WashingtonMonument.jpg");
picture2.show();
int redValue = 0; int greenValue = 0; int blueValue = 0;
Pixel targetPixel = new Pixel(picture2, 0,0);
Color pixelColor = null;
for(int y=0; y < picture2.getHeight(); y++)
{
for(int x = 0; x < picture2.getWidth(); x++)
{
targetPixel = picture2.getPixel(x,y);
pixelColor = targetPixel.getColor();
redValue = pixelColor.getRed();
greenValue = pixelColor.getGreen();
blueValue = pixelColor.getBlue();
redValue = greenValue = blueValue = (redValue + greenValue + blueValue) / 3;
pixelColor = new Color(redValue, greenValue, blueValue);
targetPixel.setColor(pixelColor);
}
}
picture2.write("GrayWashingtonMonument.jpg");
picture2.show();
Picture picture3 = new Picture("WashingtonMonument.jpg");
for(int y=0; y < picture3.getHeight(); y++)
{
for(int x = 0; x < picture3.getWidth(); x++)
{
targetPixel = picture3.getPixel(x,y);
pixelColor = targetPixel.getColor();
// It sets the colors, but it sets the color of the whole picture, not
// the areas I want it to set in the picture.
if(((redValue > 150) && greenValue > 150) && blueValue > 150)
{
blueValue = 130;
greenValue = 17;
redValue = 50;
}
else if(((redValue < 75) && greenValue < 75) && blueValue < 75)
{
redValue = 240;
blueValue = 43;
greenValue = 100;
}
else if(((redValue < 25) && greenValue < 25) && blueValue < 25)
{
redValue = 140;
greenValue = 250;
blueValue = 45;
}
pixelColor = new Color(redValue, greenValue, blueValue);
targetPixel.setColor(pixelColor);
}
}
picture3.write("ColorizedWashingtonMonument.jpg");
picture3.show();
}
}
A:
Just tried to compile your code -- received many errors about references to things that don't exist in awt package, such as:
- Picture
- Pixel
Are you trying to get folks here to do your homework for you?
Anyway, you need to review javax.imageio -- for parsing the image
http://docs.oracle.com/javase/8/docs/api/javax/imageio/package-summary.html
| null | minipile | NaturalLanguage | mit | null |
Loft Conversions in Chiswick
London Loft Conversions
More the previously mentioned points to all, we have a supervision group that actually does care; you can be sure your attic place will soon be finished swiftly, above and efficiently all ‘ appropriately. Additionally we are willing to back our assurance using 10-year guarantee, Loft Conversions in Ealing. Ask our design staff how we can convert your desire the home that is perfect in to a lovely fact.
We‘ll make suggestions from initial conceptual sketches through the complete approach to finished build. We‘ve been doing just that, repeatedly, for regional consumers like yourselves, going back 8 years! We are able to help price to be achieved by you to your residence with this attic conversions that are excellent. We are one with capable and accredited tradesmen, of Londonis prime attic conversion authorities. We‘ve modified many types of attic conversions around Birmingham at fair charges.
The alternatives are unlimited along with the inclination is really as much as the client. As the client needs we offers highly customised attic conversion companies to really make the many out of your loft space per, Loft Conversions in Ealing. Your companies are fully-insured and we also provide a-10 year function guarantee. Your comprehensive bundle is high grade without extras that are hidden, so you relax with everything cared for by we of specialists and may settle-back.
House Extension
Introducing an expansion to a preexisting building can transform your environment that is working, changing a space that is underused directly into office space that is beneficial, Loft Conversions in Ealing. Introducing extra offices or growing an office could include genuine benefit for your working lives, simultaneously improving the worth of the property. Property Extensions are believed to become one of many most intricate varieties of function which can be executed over a home. They are able to come out to become a true headache if-not handled by specialists that are accurate. At perfectloftconversions.co.uk we make certain that the whole household expansion procedure extends efficiently from start to conclude. We custom-tailor answers to your needs, leading to an expansion you may be proud of within almost any budget.
There are numerous criteria you‘ll must take in to consideration when determining if your Residence would work for a Residence Extension in Camden, North London, for example, the area bordering your home or property, situation in the avenue, prior extensions presently produced and whether it is in a preservation location or possibly a stated building. Home Extensions North London are pleased to guide on the request helping you save money and time, the suitability of any Property or Home Extension in Enfield and produce the legal assessments for you personally so you can make an informed decision. We‘ve our personal design group and planning group as well as a structural engineer to ensure that we are able to provide all the vital services you‘ll involve to give your house through us, this can save you the additional expense of participating another builder and having to tackle the planning.
Loft Conversions and Storey Extension in Chiswick, Ealing
If you‘re planning to devote 100,000 into your home to create an extension, you need to improve its value significantly by contributing to the amount of living spaces as well as the part of your premises, by utilizing your budget to produce a double storey extension at the back or privately of the house. Nevertheless the budget will not be leaky and there will be on what you could do disadvantages,, so attention would have to be studied to keep in any respect steps along the way to your budget.
Beyond Manchester costs are not superior for tradesmen, experts and builders, and that means you is going to be not incurred more, letting you have more resources remaining to not be unable to truly have a undertaking with spaces or windows. In London there are numerous more settings, from what can be brought to disturbance, parking and traffic constraints, to the surface of the home, generating your construct higher priced as your builders need to consider more hours and effort to work around them, Loft Conversions in Ealing.
Apart from a number of failures in communicating which were finally put the whole experience was relatively painless and pretty efficient.
Merriweather Zwibel, 22 April 2014
We‘re exceptionally happy with the new studio conversion. If anyone is trying to find a studio conversion an absolute first class service from start to finish perfectloftconversions.co.uk would be recommended by me . | null | minipile | NaturalLanguage | mit | null |
It may take several years and more than $150 million to undo the damage Hurricane Ike did to the state parks and national wildlife refuges along the Gulf Coast that once attracted more than half a million tourists a year.
The storm eroded beaches, washed away structures and destroyed wildlife habitats in the three refuges and at two state parks between Sabine Pass and Galveston, officials said.
Sea Rim State Park and Galveston State Park, which by itself attracted 250,000 tourists a year, suffered $80 million in damage. Ironically, Sea Rim had been on the verge of reopening after being closed for three years to make $700,000 in repairs needed after Hurricane Rita.
Now, Texas Parks and Wildlife's regional director Justin Rhodes expects it to take at least three to five years to reopen the parks.
``After Rita, we still had a park left at Sea Rim to come back to. This time we don't. Ike has destroyed everything,'' said Rhodes, acknowledging the state has not decided exactly what should be rebuilt in such a hurricane-vulnerable area.
During Ike, a 14- to 20-foot surge flattened the dunes that protected the marsh at Sea Rim. The bay also carved a river underneath Sea Rim's newly built headquarters and visitor center.
The new center, no longer 75 yards from the shore, was itself ravaged and turned into a stick skeleton. Other structures also were damaged beyond repair in the 4,400-acre park. Utilities were ripped out and portions of an asphalt parking lot sank 4 feet.
Similarly, the 2,000-acre Galveston state park lost 75 yards of beach from the surge, as well as its new visitor center. New bathrooms, shelters and utilities that served RV campers were destroyed.
"Water from the bay now flows into the park," said Rhodes.
It's expected to cost about another $72 million to make repairs at three refuges that span 109,000 acres — McFaddin, Anahuac and Texas Point. No date is set for when these facilities might reopen, said Tim Cooper, U.S. Fish and Wildlife's project leader over the refuges.
"It will be gradual, probably done in phases," said Cooper, in answer to when people may return to hunt, swim or view wildlife.
Ike also washed holes in the asphalt of Texas 73 that leads to Sea Rim and the 66,000-acre McFaddin refuge. Five buildings, including the new visitor center perched atop 15-foot pilings, were turned to rubble there, said Cooper.
"We know the surge got very high there, because we found floating material on top of the telephone poles," he said.
Hot tubs and refrigerators
Tons of debris have been hauled away from all these sites, but still more remains. At the 34,000-acre Anahuac National Wildlife Refuge, for example, a refrigerator full of food lies in the middle of a butterfly garden and a purple hot tub crowns a pile of debris at a bird-watching overlook.
Anahuac, like the other refuges, is internationally known as a destination for bird watchers. More than 300,000 ducks and geese winter in Anahuac's grassy marsh, while migrating songbirds blanket the area in the spring. Small stands of trees in the refuges provide some of the first rest stops for the migrant birds making a 600-mile pilgrimage across the open water from Mexico.
Alligators also are usually plentiful along with other reptiles and small mammals.
But the green vegetation in these marshlands has since turned muddy brown after being drowned in saltwater, said Cooper. The brown marsh stretches 10 miles inland then stops like a dirty ring around a bathtub. Numerous dead alligators and small mammals, who like most wildlife need fresh water to survive, have been hauled away.
This past week the only alligator seen during a tour of the Anahuac refuge was a small one who sought refuge in a puddle of fresh rainwater on a road there. A hundred Roseate Spoonbills and white egrets were the only flocks seen, and they were clustered on a small pond just off the refuge, which had been pumped with fresh water.
"Those birds were huddled there like it was a Red Cross shelter. It's heartbreaking to see their home destroyed," said Gary Clark, a lifelong birder and naturalist.
Cooper agreed: "We need some good rains to flush out as much salt as we can."
High saline level
If the marsh stays as salty as it is now, he predicts most of the vegetation and trees could die. The butterfly garden's dead stems, for instance, have no flowers to supply nectar for the Monarch butterfly that will soon arrive there.
Tubers and roots that waterfowl usually feed upon also are dead; and a stand of willow trees where songbirds like to rest are mostly bare although a few limbs are valiantly trying to resprout.
The saline level in the coastal marsh there has risen as much as five times above normal, said Steve Wilburn. He manages a nearby hunting lodge, the Cajun Outback, located on 2,200 acres reachable only by boat on Trinity Bay.
While a survivor of Hurricane Carla in 1961, the Cajun Outback proved no match for Ike, Wilburn said.
The rustic lodge, visited by such notables as Gen. Norman Schwarzkopf and Nashville singer Billy Dean, and a half dozen other lodges in Chambers County were demolished.
It's critical to rebuild the refuges, parks and lodges, officials said. Visitors to the three refuges pump an estimated $8.8 million a year into the local economies, Cooper said.
"Nature tourism is one of the main industries in our rural county," Chambers County Judge Jimmy Sylvia said. | null | minipile | NaturalLanguage | mit | null |
---
abstract: 'A thermostat of the Nosé-Hoover type, based on relative velocities and a local definition of the temperature, is presented. The thermostat is momentum-conserving and Galilean-invariant, which should make it suitable for use in Dissipative Particle Dynamics simulations, as well as nonequilibrium molecular dynamics simulations.'
author:
- 'Michael P. Allen'
- Friederike Schmid
bibliography:
- 'journals.bib'
- 'main.bib'
title: A Thermostat for Molecular Dynamics of Complex Fluids
---
[^1]
Introduction {#sec:intro}
============
The original papers of @nose.s:1984.a [@nose.s:1984.b] provided a new perspective on the generation of statistical ensembles by dynamical simulation. They showed that a deterministic set of equations of motion, involving just one or two extra degrees of freedom, can sample configurations from the canonical ensemble. This complements the stochastic method of @andersen.hc:1980.a, which generates the canonical ensemble by periodic reselection of velocities from the Maxwell-Boltzmann distribution. The work of @hoover.wg:1985.a [@hoover.wg:1991.a] further clarified the nature of the isothermal dynamical equations and how to derive them (see also the contribution of Hoover to these proceedings). The Nosé-Hoover equations incorporate a dynamical friction coefficient, whose fluctuations are driven by the difference between the instantaneous kinetic temperature (defined through the sum of squares of particle velocities) and the desired temperature.
This paper presents a new thermostat of the Nosé-Hoover type, based on an instantaneous temperature which is calculated as a weighted sum of squares of relative velocities of atom pairs. The frictional term in the equations of motion also enters in pairwise fashion, conserving momentum, and making the dynamics invariant to a Galilean transformation of velocities. There are two areas in which such a thermostat may be useful. The first area is nonequilibrium molecular dynamics (NEMD). With a conventional Nosé-Hoover thermostat, it is necessary to apply the friction term to the *peculiar* velocities of the particles, i.e. the difference between the true velocities and the local streaming velocity of the fluid at the particle positions. Failure to do this can lead to unphysical (thermostat-induced) behaviour [@delhommelle.j:2003.a] such as the stabilisation of string phases [@evans.dj:1986.a; @evans.dj:1992.a] or the generation of steady-state antisymmetric stress [@travis.kp:1995.b]. One solution to these problems is to use a profile-unbiased thermostat, which requires a self-consistent determination of the streaming velocity in the course of the simulation [@evans.dj:1986.a; @evans.dj:1992.a; @travis.kp:1995.b]. A thermostat based on the relative velocities of nearby pairs of atoms may avoid, or at least ameliorate, the problem. The second area of application of the pairwise thermostat is dissipative particle dynamics (DPD). Here, in order to preserve hydrodynamic behaviour, it is essential for any thermostat to conserve momentum, and a pairwise form is one way of achieving this. This paper concentrates on the DPD case, since the suggestion of using a pairwise Nosé-Hoover thermostat was first made in this context by @stoyanov.sd:2005.a. However, it should be borne in mind that the thermostat may be applied equally well to, e.g. Lennard-Jones fluids.
The paper is organised as follows. Section \[sec:dpd\] contains a brief summary of DPD, concentrating on the temperature control aspects. Section \[sec:thermostat\] derives the equations of motion for the pairwise Nosé-Hoover thermostat, and also summarizes the equations for a thermostat based on the configurational temperature, due to @braga.c:2005.a, for comparison. Section \[sec:results\] presents the results of some preliminary tests for DPD simulations. Finally, section \[sec:discussion\] contains the conclusions.
Dissipative Particle Dynamics {#sec:dpd}
=============================
DPD [@hoogerbrugge.pj:1992.a; @koelman.jmva:1993.a] has become a popular tool for simulating the behaviour of both simple and complex fluids. It consists of the solution of the classical equations of motion for a system of interacting particles, together with a set of stochastic and dissipative forces which control the temperature and allow one to choose the viscosity. For a simple fluid the equations may be written [@hoogerbrugge.pj:1992.a; @koelman.jmva:1993.a; @espanol.p:1995.b]
\[eqn:dpd\] $$\begin{aligned}
\dot{{\bm{r}}}_i &= {\bm{v}}_i = {\bm{p}}_i/m_i
\label{eqn:dpd.a}
\\
\dot{{\bm{p}}}_i &= {\bm{f}}_{i}({\bm{r}}) -\xi {\bm{V}}_{i}({\bm{r}},{\bm{p}}) +
\sigma{\bm{R}}_{i}({\bm{r}},{\bm{p}}) \;,
\label{eqn:dpd.b}\end{aligned}$$
where ${\bm{r}}$ and ${\bm{p}}$ stand for the complete set of coordinates and momenta. The so-called conservative forces ${\bm{f}}_{i}$ are derived from a pair-potential term in the Hamiltonian ${\bm{f}}_{i} = -(\partial H/\partial
{\bm{r}}_i)$ and so may be written as ${\bm{f}}_{i} = \sum_{j\neq i}
{\bm{f}}_{ij}$, with ${\bm{f}}_{ji}=-{\bm{f}}_{ij}$. In DPD these pair forces usually take the form
\[eqn:conforce\] $$\begin{aligned}
{\bm{f}}_{ij} &= \alpha {\bm{w}}_{ij} = \alpha {\bm{w}}({\bm{r}}_{ij}) \;,
\qquad\text{with}\qquad
{\bm{w}}({\bm{r}}) = w(r) \hat{{\bm{r}}} \\
\text{and}\quad
w(r) &=
\begin{cases}
\bigl(1-r/r_\text{c}\bigr) & r\leq r_\text{c} \\
0 & r> r_\text{c}
\end{cases} \;.\end{aligned}$$
Here ${\bm{r}}_{ij}={\bm{r}}_{i}-{\bm{r}}_{j}$, $r = |{\bm{r}}|$, $\hat{{\bm{r}}} =
{\bm{r}}/r$. The parameter $\alpha$ determines the strength of the conservative interactions, and $r_\text{c}$ is the cutoff.
The dissipative forces $-\xi{\bm{V}}_{i}$ are also written in pairwise fashion ${\bm{V}}_{i} =\sum_{j\neq i}{\bm{V}}_{ij}$ with ${\bm{V}}_{ji}=-{\bm{V}}_{ij}$, usually defined thus: $$\label{eqn:F}
{\bm{V}}_{ij} = \bigl({\bm{v}}_{ij}\cdot{\bm{w}}_{ij}\bigr)
{\bm{w}}_{ij} = w(r_{ij})^2 \bigl({\bm{v}}_{ij}\cdot\hat{{\bm{r}}}_{ij}\bigr)
\hat{{\bm{r}}}_{ij}$$ where ${\bm{v}}_{ij}={\bm{v}}_{i}-{\bm{v}}_{j}$. A choice has been made here to use the same weighting function ${\bm{w}}({\bm{r}})$ as in the specification of conservative forces. $\sigma{\bm{R}}_{i}$ is short for the random “forces”, which also act between pairs, with a weight function ${\bm{w}}({\bm{r}})$; the strength parameter $\sigma$ is related through the fluctuation-dissipation theorem to the friction coefficient $\xi$ and the temperature $k_\text{B}T$ (see [@hoogerbrugge.pj:1992.a; @koelman.jmva:1993.a; @espanol.p:1995.b] for more details). The pairwise nature of all these forces guarantees the momentum conservation necessary to ensure hydrodynamic behaviour: in other words, the dynamics is Galilean-invariant. The particles represent fluid regions, rather than individual atoms and molecules: the softness and simplicity of the interactions permit the use of a long time step, compared with conventional molecular dynamics. This, and the acceleration of physical processes compared with those seen in more realistic simulations, gives an advantage of several orders of magnitude, at the cost of a very rough mapping onto specific molecular properties.
A slightly more general view of DPD treats it as conventional molecular dynamics using soft potentials, supplemented by a momentum-conserving thermostat which acts between pairs. @lowe.cp:1999.a takes this approach, rather than solving the above equations. Instead, each timestep $\Delta t$ involves the following operations.
1. Positions and momenta are advanced using $\dot{{\bm{r}}}_i = {\bm{p}}_i/m_i$, $\dot{{\bm{p}}}_i = {\bm{f}}_{i}$.
2. Every pair $ij$ (in random order, and possibly subject to a distance dependent weight or range function) is examined and, with probability $P=\nu\Delta t$, the momenta are updated: ${\bm{p}}_i := {\bm{p}}_i +
\Delta{\bm{p}}_{ij}$, ${\bm{p}}_j := {\bm{p}}_j - \Delta{\bm{p}}_{ij}$, with $$\Delta{\bm{p}}_{ij} = m_{ij}\left[
\zeta \sqrt{k_\text{B}T/m_{ij}}
- ({\bm{v}}_{ij}\cdot\hat{{\bm{r}}}_{ij}) \right]\hat{{\bm{r}}}_{ij}$$ where $\zeta$ is picked from a Gaussian distribution with zero mean and unit variance, and $m_{ij} = m_im_j/(m_i+m_j)$.
This procedure periodically reselects the component of the relative velocity along $\hat{{\bm{r}}}_{ij}$ from the Maxwell-Boltzmann distribution corresponding to reduced mass $m_{ij}$. The key parameter is the stochastic randomization frequency $\nu$: high values of $\nu$ give effective temperature control, but also a high viscosity; low values give very weak temperature control while allowing the viscosity to be low. The thermostat is closely related to the one originally proposed by @andersen.hc:1980.a.
Recently, @stoyanov.sd:2005.a have proposed a modification of the above method: the fraction $(1-P)$ of pairs which do not have their relative velocities stochastically updated, are instead thermalized by a deterministic method. For each such pair, a dissipative force is calculated and used to correct the momenta during the deterministic part of the step, incorporating a temperature-dependent controlling factor. Finally, the Lowe velocity reselection process is applied to the remaining fraction $P$ of pairs as before. The idea of Stoyanov and Groot is to give more control over the separate effects of thermalization, namely temperature control and changing viscosity. @stoyanov.sd:2005.a call the deterministic part of their thermostat “Nosé-Hoover”, but actually it is not of this form, and has not been shown to generate the canonical ensemble. It may be noted that an algorithm resembling that of Nosé and Hoover was also described by @besold.g:2000.a.
Pairwise Nosé-Hoover Thermostat {#sec:thermostat}
===============================
Derivation of Equations of Motion {#sec:derivation}
---------------------------------
The purpose of this paper is to present a Galilean-invariant thermostat of the Nosé-Hoover type, which generates the canonical ensemble. The derivation is a straightforward implementation of the approach of @hoover.wg:1991.a, and a special case of the generalized Nosé-Hoover equations discussed by @kusnezov.d:1990.a and @martyna.gj:1992.a. The result is assumed to be of the form
\[eqn:nh\] $$\begin{aligned}
\dot{{\bm{r}}}_i &= {\bm{p}}_i/m_i
\label{eqn:nh.a}
\\
\dot{{\bm{p}}}_i
&= {\bm{f}}_{i}({\bm{r}}) -\xi {\bm{V}}_i({\bm{r}},{\bm{p}})
\label{eqn:nh.b}
\\
\dot{\xi} &= G_\xi({\bm{r}},{\bm{p}})
\label{eqn:nh.c}\end{aligned}$$
with the ${\bm{V}}_i({\bm{r}},{\bm{p}})$ given by eqn . Eqns and are written down by analogy with eqns . The random forces are dropped, the friction coefficient $\xi$ is now an additional *dynamical* variable, and the right-hand side of eqn is the object of the derivation. This is obtained from the generalized Liouville equation for the (stationary) phase space distribution function $\varrho({\bm{r}},{\bm{p}},\xi)$ $$\label{eqn:liouville}
\sum_i \frac{\partial}{\partial{\bm{r}}_i} \cdot \bigl(\rho\dot{{\bm{r}}}_i\bigr)
+
\sum_i \frac{\partial}{\partial{\bm{p}}_i} \cdot \bigl(\rho\dot{{\bm{p}}}_i\bigr)
+
\frac{\partial}{\partial\xi} \bigl(\rho\dot{\xi}\bigr)
= 0 \;.$$ The ansatz is made that $G_\xi({\bm{r}},{\bm{p}})$ in eqn depends only on positions and momenta, so $\partial\dot{\xi}/\partial\xi=0$. Direct substitution shows that equation is satisfied by the product form $$\rho({\bm{r}},{\bm{p}},\xi) \propto
\exp\bigl\{-H({\bm{r}},{\bm{p}})/k_\text{B}T\bigr\}
\exp\bigl\{-\tfrac{1}{2}Q_{\xi}\xi^2/k_\text{B}T\bigr\}$$ where $Q_{\xi}$ is an arbitrary constant, provided $$\begin{aligned}
G_{\xi}({\bm{r}},{\bm{p}})
&= Q_{\xi}^{-1} \sum_i \left( \frac{{\bm{p}}_i}{m_i}\cdot{\bm{V}}_i
- k_\text{B}T \frac{\partial}{\partial{\bm{p}}_i}\cdot{\bm{V}}_i \right)
\notag \\
&= Q_{\xi}^{-1} \sum_i\sum_{j\neq i}
\bigl( {\bm{v}}_{i}\cdot{\bm{V}}_{ij}
- (k_\text{B}T/m_i) w(r_{ij})^2 \bigr)
\notag \\
&= Q_{\xi}^{-1} \sum_i\sum_{j<i}
\bigl( {\bm{v}}_{ij}\cdot{\bm{V}}_{ij}
- (k_\text{B}T/m_{ij}) w(r_{ij})^2 \bigr)
\notag \\
&= Q_{\xi}^{-1} \sum_i\sum_{j<i} w(r_{ij})^2
\bigl[ \bigl({\bm{v}}_{ij}\cdot\hat{{\bm{r}}}_{ij}\bigr)^2
- k_\text{B}T/m_{ij} \bigr] \:.
\label{eqn:G}\end{aligned}$$ Once more, the reduced mass $m_{ij}$ appears. The term in square brackets vanishes if an average is taken over the canonical momentum distribution. The equation has a straightforward physical interpretation, acting to damp the difference between the instantaneous temperature corresponding to the component of relative velocity ${\bm{v}}_{ij}$ along the inter-particle vector, and the canonical ensemble average of this quantity. The prefactor $Q_{\xi}$ controls the “thermal inertia” in the same way as the corresponding parameter in the conventional Nosé-Hoover method, and the function $w$ gives a higher weighting to closer pairs. There is a conserved “energy function” $$H_\xi({\bm{r}},{\bm{p}},\xi,\varphi_\xi) = H({\bm{r}},{\bm{p}}) + \tfrac{1}{2}Q_{\xi} \xi^2 + \varphi_\xi
\qquad\text{where}\quad \dot{\varphi}_\xi = \xi k_\text{B}T \sum_{i<j}
w(r_{ij})^2/m_{ij}
\label{eqn:engxi}$$ as may be checked by time differentiation and direct substitution of the equations of motion.
Integration Algorithm {#sec:algorithm}
---------------------
It is not the aim here to discuss the optimal algorithm for integration of the equations of motion . Instead, the simplest modified velocity-Verlet algorithm [@martyna.gj:1994.a], that is commonly used in DPD [@besold.g:2000.a], is adopted:
$$\begin{aligned}
\tilde{{\bm{p}}}_i := {\bm{p}}_i & := {\bm{p}}_i + \tfrac{1}{2}\Delta t \,
\left({\bm{f}}_i - \xi {\bm{V}}_i \right)
&& {\bm{p}}_i(\tfrac{1}{2}\Delta t)
\\
\tilde{\xi} := \xi & := \xi + \tfrac{1}{2}\Delta t\, G_\xi
&& \xi(\tfrac{1}{2}\Delta t)
\\
{\bm{r}}_i & := {\bm{r}}_i + \Delta t \, {\bm{p}}_i / m_i
&& {\bm{r}}_i(\Delta t)
\\
{\bm{f}}_i & := {\bm{f}}_i({\bm{r}})
&& {\bm{f}}_i(\Delta t)
\\
{\bm{V}}_i & := {\bm{V}}_i({\bm{r}},{\bm{p}})
&& {\bm{V}}_i(\Delta t)
\label{alg:e}
\\
G_\xi & := G_\xi({\bm{r}},{\bm{p}})
&& G_\xi(\Delta t)
\label{alg:f}
\\
{\bm{p}}_i & := \tilde{{\bm{p}}}_i
+ \tfrac{1}{2}\Delta t \,
\left({\bm{f}}_i-\xi{\bm{V}}_i\right)
&& {\bm{p}}_i(\Delta t)
\label{alg:g}
\\
\xi &:= \tilde{\xi} + \tfrac{1}{2}\Delta t \, G_\xi
&& \xi(\Delta t)
\label{alg:h}\end{aligned}$$
Steps – may be iterated to convergence, because the momenta at time $t+\Delta t$ should be used in the evaluation of $G_\xi$ and ${\bm{V}}_i$. However, because of the expense of calculating the pairwise terms, in DPD it is usual to stop after one evaluation of the expressions above, and this is the approach adopted here. Some might prefer a strictly reversible integrator [@martyna.gj:1996.a], while others favour the Runge-Kutta method: consideration of these possibilities is deferred.
Configurational Nosé-Hoover Thermostat {#sec:configtherm}
--------------------------------------
The canonical ensemble result $$\sum_j\left\langle \left| \frac{\partial U}{\partial{\bm{r}}_j} \right|^2\right\rangle
=
k_\text{B}T \sum_j\left\langle
\frac{\partial}{\partial{\bm{r}}_j}\cdot\frac{\partial U}{\partial{\bm{r}}_j}
\right\rangle
\;.
\label{eqn:conftemp}$$ has been known for many years [@hirschfelder.jo:1960.a] and has recently been used to define a configurational temperature $T_\text{c}$ in simulation [@rugh.hh:1997.a; @butler.bd:1998.a] and experiment [@han.yl:2004.a; @han.yl:2005.a]. Recently, one of us [@allen.mp:2006.a] has suggested monitoring this quantity as an indicator of lack of equilibrium due to excessive timesteps in DPD. It is natural to consider applying a thermostat to control this variable [@delhommelle.j:2001.a; @braga.c:2005.a] and here the equations of motion of @braga.c:2005.a are used:
\[eqn:nhc\] $$\begin{aligned}
\dot{{\bm{r}}}_i &= {\bm{p}}_i/m_i + \mu {\bm{f}}_i({\bm{r}})
\label{eqn:nhc.a}
\\
\dot{{\bm{p}}}_i &= {\bm{f}}_{i}({\bm{r}})
\label{eqn:nhc.b}
\\
\dot{\mu} &= G_\mu({\bm{r}})
\label{eqn:nhc.c}\end{aligned}$$
where $$G_\mu = Q_\mu^{-1}
\sum_j\left(
\left| \frac{\partial U}{\partial{\bm{r}}_j} \right|^2
- k_\text{B}T
\frac{\partial}{\partial{\bm{r}}_j}\cdot\frac{\partial U}{\partial{\bm{r}}_j}
\right)
\:.$$ The quantity $\mu$ plays the role of a fluctuating mobility: that is, a proportionality between force and drift velocity, as seen in the “position Langevin equation” or Schmoluchowski equation [@braga.c:2005.a]. Once again there is a conserved “energy function” $$H_\mu({\bm{r}},{\bm{p}},\mu,\varphi_\mu)
= H({\bm{r}},{\bm{p}}) + \tfrac{1}{2}Q_{\mu} \mu^2 + \varphi_\mu
\qquad\text{where}\quad \dot{\varphi}_\mu = \mu k_\text{B}T
\sum_{j} \frac{\partial}{\partial{\bm{r}}_j}\cdot\frac{\partial
U}{\partial{\bm{r}}_j} \:.
\label{eqn:engmu}$$ @braga.c:2005.a have presented a simple integration algorithm for these equations, which we use here. The canonical distribution may also be shown to be a steady-state solution of the above equations of motion, and they share with the thermostatted equations of section \[sec:derivation\] the property of Galilean invariance.
Results {#sec:results}
=======
Tests have been carried out using the standard “water” DPD model [@groot.rd:1997.a]: the potential strength parameter in eqn was set to $\alpha=25$, with simulation units defined so that $m=1$, $k_\text{B}T=1$, $r_\text{c}=1$. A system of $N=250$ particles was simulated in cubic periodic boundaries. Timesteps in the range $0.005 \leq
\Delta t \leq 0.06$ were used, with run lengths up to 1000 reduced time units. For the pairwise Nosé-Hoover thermostat, inertia parameters in the range $0.2 \leq Q_\xi/N \leq 8.0$ were studied. For the configurational Nosé-Hoover thermostat, inertia parameters in the range $2000 \leq Q_\mu/N
\leq 80000$ were used.
These thermostats allow one to check the accuracy of the integration by monitoring the conserved energy-function eqns and .
![\[fig:1\] Rate of change of energy-like function as a function of timestep $\Delta t$, plotted on log-log scales. Circles: pairwise Nosé-Hoover thermostat with inertia parameter $Q_\xi/N=0.8$. Squares: configurational Nosé-Hoover thermostat with inertia parameter $Q_\mu/N=2\times10^4$. Diamonds: velocity Verlet algorithm, with no thermostatting. The lines correspond to $\Delta t^4$ power law behaviour.](fig1.eps){width="50.00000%"}
Figure \[fig:1\] shows that, at timesteps $\Delta t > 0.02$ (very conservative by DPD standards), there is a significant drift in this quantity: the rate of increase is roughly proportional to $\Delta t^4$ at large $\Delta t$. This problem has been noted before by @hafskjold.b:2004.a, and it is not associated with the thermostatting, because the same behaviour is seen using the simple velocity Verlet algorithm. The cause seems to be the relatively strong discontinuity in force derivatives at the cutoff of the DPD potential [@hafskjold.b:2004.a]. In DPD, and in MD with a thermostat, this tends to be camouflaged. The present thermostats perform as well as (in fact, slightly better than) velocity Verlet in this respect.
The oscillation of the internal energy of the particles (potential plus kinetic) reflects the flow of energy into and out of the thermal reservoir, and this is influenced by the choice of thermal inertia parameter.
![\[fig:2\] Oscillation of internal energy $E=H$ as a function of time $t$. Upper panel: pairwise Nosé-Hoover thermostat with inertia parameter: $Q_\xi/N=0.2$ (solid line); $Q_\xi/N=0.8$ (dashed line); $Q_\xi/N=2.0$ (dot-dashed line. Lower panel: configurational Nosé-Hoover thermostat with inertia parameter: $Q_\mu/N=8\times10^3$ (solid line); $Q_\mu/N=2\times10^4$ (dashed line); $Q_\mu/N=4\times10^4$ (dot-dashed line). ](fig2.eps){width="50.00000%"}
Typical results are shown in Fig. \[fig:2\], and they show the expected behaviour. There are damped oscillations: the runs lengths employed here are typically long compared with the relaxation rate, while the timesteps are small enough to cope with the oscillations. In this range, the precise choice of thermal inertia is not critical.
The simulation-averaged values of kinetic temperature $T_\text{k}$ (defined through the total kinetic energy) and configurational temperature $T_\text{c}$ (defined by eqn ) are shown in Fig. \[fig:3\].
![\[fig:3\] Kinetic temperature $T_\text{k}$ (open symbols) and configurational temperature $T_\text{c}$ (filled symbols) as functions of timestep $\Delta t$ for three different thermostatting regimes: (a) pairwise Nosé-Hoover thermostat with inertia parameter $Q_\xi/N=0.4$; (b) configurational Nosé-Hoover thermostat with inertia parameter $Q_\mu/N=4\times10^3$; (c) both thermostats simultaneously. ](fig3.eps){width="60.00000%"}
When the kinetic temperature is controlled, lack of equilibrium is indicated by the configurational temperature, which increases by as much as 10% at the largest timesteps studied. These results simply confirm what has been seen before [@allen.mp:2006.a]: a measured kinetic temperature close to the desired value should not be taken as a guarantee that the system is at equilibrium. The form of the increase in $T_\text{c}$ may be understood semi-quantitatively by considering the effect of non-zero-timestep velocity-Verlet dynamics on the phase portrait of a simple harmonic oscillator [@allen.mp:2006.a]. Conversely, when the configurational thermostat is imposed, the measured kinetic temperature is significantly reduced when the timestep is too large. This effect may be understood in a similar way by considering harmonic oscillator velocity-Verlet dynamics: for a given positional amplitude, the momentum amplitude is reduced as the timestep increases. When both thermostats are applied together, not surprisingly, both $T_\text{c}$ and $T_\text{k}$ are controlled well, up to the highest timesteps studied. This deserves further investigation, but it would be over-optimistic to suppose that the other degrees of freedom in the system are at equilibrium.
To illustrate the application to complex fluids, simulations of the same lipid bilayer model studied previously [@shillcock.jc:2002.a; @jakobsen.af:2005.a; @allen.mp:2006.a] have been carried out with the new thermostat. Here, the solvent water is represented as before, and each lipid molecule has the form of a 7-bead chain $\text{H}\text{T}_6$ in which $\alpha$-repulsion parameters between hydrophilic “head” beads (H), hydrophobic “tail” beads (T), and “water” beads (W) are chosen to produce the desired behaviour [@shillcock.jc:2002.a]. Harmonic bond-stretching potentials, and angle-bending potentials, act within the lipid molecules.
![\[fig:4\] Kinetic temperature $T_\text{k}$ (open symbols) and configurational temperature $T_\text{c}$ (filled symbols) as functions of timestep $\Delta t$ for membrane simulations using three different thermostatting regimes: (a) pairwise Nosé-Hoover thermostat with inertia parameter $Q_\xi/N=0.4$; (b) configurational Nosé-Hoover thermostat with inertia parameter $Q_\mu/N=4\times10^3$; (c) both thermostats simultaneously. Different symbols represent different DPD particle types: circles, H, $\text{T}_6$; squares, $\text{T}_1$, $\text{T}_5$; diamonds, $\text{T}_2$, $\text{T}_3$, $\text{T}_4$; triangles, water. ](fig4.eps){width="60.00000%"}
The measured temperatures of the different types of DPD bead are shown in Figure \[fig:4\]. The results are consistent with those obtained before [@allen.mp:2006.a] and show how dangerous it is to rely on thermostats to equilibrate the system when the timestep is too large: the different bead types have significantly different kinetic and configurational temperatures in all cases. Actually, for this simple model, the cause of the problem, and the remedy, are well understood. The *intramolecular* potentials within the lipid chains are too strong to be handled by the longer timesteps; this problem is easily addressed by using multiple timestep methods [@jakobsen.af:2006.a]. However, this example serves to illustrate possible pitfalls which may occur in the general case.
Discussion {#sec:discussion}
==========
The derivation of Section \[sec:thermostat\] establishes the canonical ensemble as a stationary distribution for the coordinates and momenta subject to the equations of motion , although it does not prove that it is unique, nor guarantee that a system will converge towards this distribution [@hoover.wg:1991.a; @kusnezov.d:1990.a; @martyna.gj:1992.a]. The result is easily generalized to apply to a subset of pair interactions, simply by setting $w_{ij}=0$ for the omitted pairs, making this suitable to combine with the Lowe method as envisaged by @stoyanov.sd:2005.a. (Interestingly, Ref. [@hoover.wg:1991.a] contains exercises on incorporating a weighting factor, and on considering a subset of degrees of freedom, for the conventional Nosé-Hoover thermostat). Nosé-Hoover chains may easily be added to further control the dynamics [@martyna.gj:1992.a].
The preliminary results presented above indicate that the pairwise Nosé-Hoover thermostat behaves as should be expected, and may be useful in both DPD and conventional MD / NEMD simulations. A feature of the proposed thermostat, shared by the configurational-temperature thermostat, is the absence of peculiar velocities: this may provide a more satisfactory way of controlling the temperature than the conventional Nosé-Hoover thermostat in the case of fluid flows, since only local relative velocities are used to define an instantaneous temperature.
The comments of Brad Holian, Bill Hoover, and Karl Travis on an early version of the manuscript are gratefully acknowledged. This work was conducted while MPA was on Study Leave at the University of Bielefeld. The research has been supported by the Engineering and Physical Sciences Research Council, and by the Alexander von Humboldt foundation.
[^1]: Invited Talk at Symposium on Progress and Future Prospects in Molecular Dynamics Simulation – In Memory of Professor Shuichi Nosé
| null | minipile | NaturalLanguage | mit | null |
Q:
What do I have to install to update MOSS?
I found this great blog post on SharePoint patches:
http://blogs.msdn.com/sowmyancs/archive/2008/09/24/all-available-sharepoint-service-packs-patches-and-related-information.aspx
My question is do I have to install them all in order? or do the later ones include the earlier ones?
A:
Check out the SharePoint Team Blog. They post lots of good information, including info about updating your server. Here is there latest one, the will get a fully unpatched server up to the October 2009 cumulative update. In short, install WSS SP2, MOSS SP2, WSS Oct 2009 CU, MOSS Oct 2009 CU, run the technology & configuration wizard, all in that order.
| null | minipile | NaturalLanguage | mit | null |
If Starbucks Corp.’s visionary and former longtime chief executive Howard Schultz runs for president — a declaration he’s still mulling after testing the waters this week — experts say it’s likely the coffee chain’s business will be exposed to the candidate’s popularity, or lack thereof.
A “socially liberal” Schultz has floated a potential run for president in 2020 as an independent, which has prompted groans, and outright anger, from Democrats fearful that the move could dilute their side of the ticket and hand a re-election to President Trump.
At a New York City event to launch his book “From the Ground Up: A Journey to Reimagine the Promise of America,” one attendee had choice words for Schultz.
Read:Customers at Starbucks in Trump Tower are lukewarm on Howard Schultz’s presidential ambitions
Mark Kalinowski, chief executive of Kalinowski Equity Research, says the move would hurt Starbucks SBUX, -2.07% despite the fact that its customers come from across the political spectrum.
“Starbucks’ fairly broad U.S. customer base — it is, after all, the #2 restaurant brand in the U.S. as measured by domestic system-wide sales — nevertheless skews somewhat toward the Democratic side of the political spectrum,” Kalinowski wrote. “[I]f Mr. Schultz is widely seen as doing something meaningful that could help tip the U.S. presidential election toward the current Republican incumbent, the relevant question for Starbucks’ shareholders might not be if Starbucks’ business would be harmed by Mr. Schultz‘s actions — only by how much.”
According to Axios, Starbucks’ current CEO Kevin Johnson sent an email to the company’s 350,000 global employees saying, “As a company, we don’t get involved in national political campaigns. And nothing changes for Starbucks.”
But the company could be thrust into politics whether it wants to be or not.
“We’re guessing (but we’ll be clear, this is only our guess) that Starbucks will steer clear of selling Schultz’s latest book at its stores this upcoming week because it knows that having him make a serious run as an independent for U.S. president is unlikely to be in Starbucks’ best interest,” Kalinowski wrote. “Even having him test the waters for a possible run in this way should be making some of the folks at the Starbucks Support Center (headquarters) in Seattle a little jittery.”
How check-out free retail could save U.S. consumers 118 hours per year
Overall, the company could be in relatively good standing with shareholders after its recently issued outlook. Worries, if they are emerging, for now hinge more on China’s slowdown than the U.S. election.
A sentiment survey conducted by Stifel analysts prior to Schultz’s announcement indicated stock underperformance in the near term, but Stifel reminded readers that the company was upbeat about fiscal 2019.
“It was our impression management struck a favorable tone during the presentation toward the U.S. same-restaurant sales momentum from the several early strategies, including enhancing the in-store experience, ramping the velocity of beverage innovation and improving digital connection, and we believe F1Q19 U.S. same-restaurant sales will show continued momentum,” the analysts wrote.
“On the other hand, however, increased competition and more modest economic growth in China — Starbucks’ other growth engine — could be a mitigating factor.”
Don’t miss:China, delivery challenges for Starbucks put long-term prospects in question despite solid quarter
Stifel rates Starbucks shares hold. | null | minipile | NaturalLanguage | mit | null |
Djurgården-anfallaren Jowra Movsisian gjorde i helgen debut för sin nya klubb i Stockholmsderbyt mot AIK på Friends Arena. Han hann dock inte vara länge på planen före han fick lämna gräsmattan igen. Anfallaren satte, efter en duell i straffområdet, pannan mot AIK-backen Daniel Sundgrens panna och blev tilldelad rött kort.
I dag meddelade SvFF:s disciplinnämnd att han får ytterligare en matchs avstängning utöver den obligatoriska matchen, som en spelare blir avstängd i vid rött kort.
- Det är det som är beslutet, och bakgrunden är det högst olämpliga uppträdandet som han visade genom att föra fram pannan mot Sundgren, säger Göran Nilsson, vice ordförande i disciplinnämnden.
- Om vi hade bedömt det som en riktig skallning, så hade han kanske inte spelat innan VM-uppehållet, så vi tog hänsyn till att det blir ett ministraff, så är det. Det är en lindrig bedrömning, fortsätter han.
Sundgren berättade efter matchen för Fotbollskanalen att han förstärkte situationen efter att Movsisian förde fram pannan mot honom. Han kommer inte att straffas för det.
- Det finns ingen anmälan mot honom, inte från någon. Det hade var fritt fram för någon att anmäla det, men det har inget gjort. Vi har därmed inte diskuterat det och därmed är ärendet avklarat. Det finns ingen anledning att fundera i dem termerna, säger Nilsson.
Se situationen i spelaren ovan. | null | minipile | NaturalLanguage | mit | null |
Q:
Add widget on page template
I have a page template and multiple pages using that template. This page template has a widget zone on it. I want to place a widget into this zone which will display on each page. Is there a way to add this default widget on page template so that I don't have to add it one by one on each page.
A:
Yes, if you add the widget on the Design tab of the template (rather than adding it via the page tab) the widget will show up by default on any NEW pages that are created using that template (pages that already exist with that use that template will not receive the widget automatically).
From there, when a new page is created using that template, the widget, along with its settings, will be on the page by default. The content author can then modify or delete this widget as normal.
Depending on the version of Kentico you are using, you can reset widgets within a zone back to the default widget content by following the directions here. Which would allow you to reset widget content on a page that's already created, but will not allow you to inject a widget into a page without removing the widgets that have been added to the widget zone via the page tab.
| null | minipile | NaturalLanguage | mit | null |
"Thus it is said that one who knows the enemy and knows himself will not be endangered in a hundred engagements."
Sun Tzu, The Art of War.
Thursday, February 22, 2007
Blair Announces British Reduction of Forces in Iraq
By Sgt. Sara Wood, USAAmerican Forces Press Service
Feb. 21, 2007 – British forces will begin to withdraw from Iraq, particularly in the southern city of Basra, where Iraqi security forces have taken primary responsibility for operations, British Prime Minister Tony Blair announced today. In an address to the House of Commons, Blair said that 1,600 British troops will come out of Iraq "in the coming months," as Iraqi security forces take on more responsibility.
The United Kingdom's combat capability in Iraq will not be diminished, he said, and the remaining British forces will focus on training Iraqi forces and securing the Iranian border and supply routes.
Over time and depending on the progress of Iraqi security forces, Britain will be able to draw down further, possibly to below 5,000 troops once the base at Basra Palace has been transferred to the Iraqis in late summer, Blair said.
"The U.K. military presence will continue into 2008, for as long as we are wanted and have a job to do," he said. "Increasingly our role will be support and training, and our numbers will be able to reduce accordingly."
At the Pentagon, Bryan Whitman, a Defense Department spokesman, said Blair's announcement was expected, and that the decrease in British troops has been planned for some months.
"You know, Basra is not Baghdad, and in Basra, the British have turned over a lot of responsibilities for the region to Iraqi security forces," Whitman said. "Even with their planned drawdown, they will still have a significant presence that will be doing a number of things."
Whitman noted that many countries still support the coalition efforts in Iraq and Afghanistan, whether through providing troops or financial, diplomatic or legal support. It is up to each country to decide what their participation will be, he stressed.
"I think that the world's democracies understand the importance of continuing to take the fight to the terrorists, and we see that in the participation of many nations in both Afghanistan and Iraq," Whitman said.
In an interview today with Jonathan Karl of ABC News, Vice President Dick Cheney said Britain's decision to withdraw forces is proof that operations are succeeding in some areas of Iraq.
"I look at it, and what I see is an affirmation of the fact that there are parts of Iraq where things are going pretty well," Cheney said. "The focus that we've had, obviously, is Baghdad and the decision the president made to surge troops into Baghdad."Article sponsored by criminal justice online leadership; and, police and military personnel who have become writers. | null | minipile | NaturalLanguage | mit | null |
Q:
Change default company mode keybindings
I think company-mode is a great package.
Though I would like to change some keybinding it has assigned by default.
For example, I would prefer not to use M-n and M-p in order to move in the different complete result list.
How can I change that?
A:
I read about Change Minor Mode Keys in the fantastic Xah Lee pages.
And I think I came with a solution.
I found two different keymaps in company.el: company-active-map and company-search-map.
So I redefined its default keybinding definitions that best suits my needs:
(define-key company-active-map (kbd "C-n") 'company-select-next)
(define-key company-active-map (kbd "C-p") 'company-select-previous)
(define-key company-search-map (kbd "C-n") 'company-select-next)
(define-key company-search-map (kbd "C-p") 'company-select-previous)
(define-key company-search-map (kbd "C-t") 'company-search-toggle-filtering)
That made it for me.
| null | minipile | NaturalLanguage | mit | null |
31 Pumpkin Carving Ideas For Overly Ambitious People (PHOTOS)
Most of us limit our yearly Halloween pumpkin carving to the standard two-triangles-and-a-mouth "face," if anything. (Though some nix the knifework entirely and want to cover everything in glitter.) If you're game to trying something a little different this year, the below 31 Jack O'Lantern ideas will give you a nice little challenge to work towards. For most of these ideas, you'll want to trade that blunt steak knife that's been with you through two apartment moves in favor of specialized sculpting tools. | null | minipile | NaturalLanguage | mit | null |
The Air Jordan 8 OVO “Black” is Drake's newest collaboration with Jordan Brand. As Drake continues to dominate the game on all levels, there's no denying he's having a huge year. Adding to the recent news, more photos of his coveted Air Jordan 8 collab has just surfaced closely following the release of his Future-collaborated album dubbed, What A Time To Be Alive.
The Air Jordan 8 OVO “Black” may be Drake's best collab to date. The sneaker isn't set to hit retailers, but we'd love to see these babies up for grabs! The black on black upper is hit with accents of red as well as gold luxury finishes. Complete with his signature OVO Owl on the heel tab, this is one sneaker you don't want to miss.
There is no news regarding a release date, but stay tuned to SneakerShouts as time goes on. Also, let us know your thoughts regarding the sneaker below! | null | minipile | NaturalLanguage | mit | null |
Henry Fleetwood Thuillier
Major General Sir Henry Fleetwood Thuillier , (30 March 1868 – 11 June 1953) was a British Army officer who played a significant part in the development of gas warfare.
Early life and family
Thuillier was born at Meerut, Uttar Pradesh, India, on 30 March 1868, the son of Colonel Sir Henry Ravenshaw Thuillier, KCIE.
His son was Lt. Col. Henry Shakespear Thuillier (1895-1982).
Career
Thuillier's early career was spent in India. During the First World War he commanded a division and a brigade.
From 1927 to 1930 he commanded 52nd (Lowland) Infantry Division.
Death
Thuillier died 11 June 1953.
Selected publications
The Principles of Land Defence and Their Application to the Conditions of To-Day. 1902.
Gas in the next war. Geoffrey Bles, London, 1939. (German translation published in Zürich by Scientia, 1939, as Das gas im nächsten krieg. Introduction and notes by V. Tempelhoff).
See also
Leslie de Malapert Thuillier
References
External links
http://discovery.nationalarchives.gov.uk/details/c/F65013
Henry Fleetwood
Category:Knights Commander of the Order of the Bath
Category:1868 births
Category:1953 deaths
Category:British Army generals
Category:People from Meerut
Category:People educated at Wimbledon College
Category:Companions of the Order of St Michael and St George | null | minipile | NaturalLanguage | mit | null |
Tag: fire pit bricks cost
Fire pit bricks is one of the most interesting addition or material that we can try to apply into our garden in order to make a brand new and also stylish fire pit ideas. For you that are looking at for a simple and also unique looking fire pit design ideas then you have come to the right place. In this article we will try to discuss about several interesting fire pit design and also Read more | null | minipile | NaturalLanguage | mit | null |
{
"cells": [
{
"cell_type": "markdown",
"metadata": {
"colab_type": "text",
"id": "rNdWfPXCjTjY"
},
"source": [
"# Introduction to Feature Columns \n",
"**Learning Objectives**\n",
"\n",
"\n",
"1. Load a CSV file using [Pandas](https://pandas.pydata.org/)\n",
"2. Create an input pipeline using tf.data\n",
"3. Create multiple types of feature columns\n",
"\n",
" \n",
"\n",
"## Introduction \n",
"\n",
"In this notebook, you classify structured data (e.g. tabular data in a CSV file) using [feature columns](https://www.tensorflow.org/guide/feature_columns). Feature columns serve as a bridge to map from columns in a CSV file to features used to train a model. In a subsequent lab, we will use [Keras](https://www.tensorflow.org/guide/keras) to define the model.\n",
"\n",
"Each learning objective will correspond to a __#TODO__ in the [student lab notebook](../labs/feat.cols_tf.data.ipynb) -- try to complete that notebook first before reviewing this solution notebook. \n"
]
},
{
"cell_type": "markdown",
"metadata": {
"colab_type": "text",
"id": "K1y4OHpGgss7"
},
"source": [
"## The Dataset\n",
"\n",
"We will use a small [dataset](https://archive.ics.uci.edu/ml/datasets/heart+Disease) provided by the Cleveland Clinic Foundation for Heart Disease. There are several hundred rows in the CSV. Each row describes a patient, and each column describes an attribute. We will use this information to predict whether a patient has heart disease, which in this dataset is a binary classification task.\n",
"\n",
"Following is a [description](https://archive.ics.uci.edu/ml/machine-learning-databases/heart-disease/heart-disease.names) of this dataset. Notice there are both numeric and categorical columns.\n",
"\n",
">Column| Description| Feature Type | Data Type\n",
">------------|--------------------|----------------------|-----------------\n",
">Age | Age in years | Numerical | integer\n",
">Sex | (1 = male; 0 = female) | Categorical | integer\n",
">CP | Chest pain type (0, 1, 2, 3, 4) | Categorical | integer\n",
">Trestbpd | Resting blood pressure (in mm Hg on admission to the hospital) | Numerical | integer\n",
">Chol | Serum cholestoral in mg/dl | Numerical | integer\n",
">FBS | (fasting blood sugar > 120 mg/dl) (1 = true; 0 = false) | Categorical | integer\n",
">RestECG | Resting electrocardiographic results (0, 1, 2) | Categorical | integer\n",
">Thalach | Maximum heart rate achieved | Numerical | integer\n",
">Exang | Exercise induced angina (1 = yes; 0 = no) | Categorical | integer\n",
">Oldpeak | ST depression induced by exercise relative to rest | Numerical | float\n",
">Slope | The slope of the peak exercise ST segment | Numerical | integer\n",
">CA | Number of major vessels (0-3) colored by flourosopy | Numerical | integer\n",
">Thal | 3 = normal; 6 = fixed defect; 7 = reversable defect | Categorical | string\n",
">Target | Diagnosis of heart disease (1 = true; 0 = false) | Classification | integer"
]
},
{
"cell_type": "markdown",
"metadata": {
"colab_type": "text",
"id": "VxyBFc_kKazA"
},
"source": [
"## Import TensorFlow and other libraries"
]
},
{
"cell_type": "code",
"execution_count": 62,
"metadata": {
"colab": {},
"colab_type": "code",
"id": "9dEreb4QKizj"
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"TensorFlow version: 2.1.0\n"
]
}
],
"source": [
"import numpy as np\n",
"import pandas as pd\n",
"import matplotlib.pyplot as plt\n",
"import seaborn as sns\n",
"%matplotlib inline\n",
"\n",
"import tensorflow as tf\n",
"\n",
"\n",
"from tensorflow import feature_column\n",
"from tensorflow.keras import layers\n",
"from sklearn.model_selection import train_test_split\n",
"\n",
"print(\"TensorFlow version: \",tf.version.VERSION)"
]
},
{
"cell_type": "markdown",
"metadata": {
"colab_type": "text",
"id": "KCEhSZcULZ9n"
},
"source": [
"## Lab Task 1: Use Pandas to create a dataframe\n",
"\n",
"[Pandas](https://pandas.pydata.org/) is a Python library with many helpful utilities for loading and working with structured data. We will use Pandas to download the dataset from a URL, and load it into a dataframe."
]
},
{
"cell_type": "code",
"execution_count": 63,
"metadata": {
"colab": {},
"colab_type": "code",
"id": "REZ57BXCLdfG"
},
"outputs": [
{
"data": {
"text/html": [
"<div>\n",
"<style scoped>\n",
" .dataframe tbody tr th:only-of-type {\n",
" vertical-align: middle;\n",
" }\n",
"\n",
" .dataframe tbody tr th {\n",
" vertical-align: top;\n",
" }\n",
"\n",
" .dataframe thead th {\n",
" text-align: right;\n",
" }\n",
"</style>\n",
"<table border=\"1\" class=\"dataframe\">\n",
" <thead>\n",
" <tr style=\"text-align: right;\">\n",
" <th></th>\n",
" <th>age</th>\n",
" <th>sex</th>\n",
" <th>cp</th>\n",
" <th>trestbps</th>\n",
" <th>chol</th>\n",
" <th>fbs</th>\n",
" <th>restecg</th>\n",
" <th>thalach</th>\n",
" <th>exang</th>\n",
" <th>oldpeak</th>\n",
" <th>slope</th>\n",
" <th>ca</th>\n",
" <th>thal</th>\n",
" <th>target</th>\n",
" </tr>\n",
" </thead>\n",
" <tbody>\n",
" <tr>\n",
" <th>0</th>\n",
" <td>63</td>\n",
" <td>1</td>\n",
" <td>1</td>\n",
" <td>145</td>\n",
" <td>233</td>\n",
" <td>1</td>\n",
" <td>2</td>\n",
" <td>150</td>\n",
" <td>0</td>\n",
" <td>2.3</td>\n",
" <td>3</td>\n",
" <td>0</td>\n",
" <td>fixed</td>\n",
" <td>0</td>\n",
" </tr>\n",
" <tr>\n",
" <th>1</th>\n",
" <td>67</td>\n",
" <td>1</td>\n",
" <td>4</td>\n",
" <td>160</td>\n",
" <td>286</td>\n",
" <td>0</td>\n",
" <td>2</td>\n",
" <td>108</td>\n",
" <td>1</td>\n",
" <td>1.5</td>\n",
" <td>2</td>\n",
" <td>3</td>\n",
" <td>normal</td>\n",
" <td>1</td>\n",
" </tr>\n",
" <tr>\n",
" <th>2</th>\n",
" <td>67</td>\n",
" <td>1</td>\n",
" <td>4</td>\n",
" <td>120</td>\n",
" <td>229</td>\n",
" <td>0</td>\n",
" <td>2</td>\n",
" <td>129</td>\n",
" <td>1</td>\n",
" <td>2.6</td>\n",
" <td>2</td>\n",
" <td>2</td>\n",
" <td>reversible</td>\n",
" <td>0</td>\n",
" </tr>\n",
" <tr>\n",
" <th>3</th>\n",
" <td>37</td>\n",
" <td>1</td>\n",
" <td>3</td>\n",
" <td>130</td>\n",
" <td>250</td>\n",
" <td>0</td>\n",
" <td>0</td>\n",
" <td>187</td>\n",
" <td>0</td>\n",
" <td>3.5</td>\n",
" <td>3</td>\n",
" <td>0</td>\n",
" <td>normal</td>\n",
" <td>0</td>\n",
" </tr>\n",
" <tr>\n",
" <th>4</th>\n",
" <td>41</td>\n",
" <td>0</td>\n",
" <td>2</td>\n",
" <td>130</td>\n",
" <td>204</td>\n",
" <td>0</td>\n",
" <td>2</td>\n",
" <td>172</td>\n",
" <td>0</td>\n",
" <td>1.4</td>\n",
" <td>1</td>\n",
" <td>0</td>\n",
" <td>normal</td>\n",
" <td>0</td>\n",
" </tr>\n",
" </tbody>\n",
"</table>\n",
"</div>"
],
"text/plain": [
" age sex cp trestbps chol fbs restecg thalach exang oldpeak slope \\\n",
"0 63 1 1 145 233 1 2 150 0 2.3 3 \n",
"1 67 1 4 160 286 0 2 108 1 1.5 2 \n",
"2 67 1 4 120 229 0 2 129 1 2.6 2 \n",
"3 37 1 3 130 250 0 0 187 0 3.5 3 \n",
"4 41 0 2 130 204 0 2 172 0 1.4 1 \n",
"\n",
" ca thal target \n",
"0 0 fixed 0 \n",
"1 3 normal 1 \n",
"2 2 reversible 0 \n",
"3 0 normal 0 \n",
"4 0 normal 0 "
]
},
"execution_count": 63,
"metadata": {},
"output_type": "execute_result"
}
],
"source": [
"URL = 'https://storage.googleapis.com/applied-dl/heart.csv'\n",
"dataframe = pd.read_csv(URL)\n",
"dataframe.head()"
]
},
{
"cell_type": "code",
"execution_count": 64,
"metadata": {},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"<class 'pandas.core.frame.DataFrame'>\n",
"RangeIndex: 303 entries, 0 to 302\n",
"Data columns (total 14 columns):\n",
"age 303 non-null int64\n",
"sex 303 non-null int64\n",
"cp 303 non-null int64\n",
"trestbps 303 non-null int64\n",
"chol 303 non-null int64\n",
"fbs 303 non-null int64\n",
"restecg 303 non-null int64\n",
"thalach 303 non-null int64\n",
"exang 303 non-null int64\n",
"oldpeak 303 non-null float64\n",
"slope 303 non-null int64\n",
"ca 303 non-null int64\n",
"thal 303 non-null object\n",
"target 303 non-null int64\n",
"dtypes: float64(1), int64(12), object(1)\n",
"memory usage: 33.3+ KB\n"
]
}
],
"source": [
"dataframe.info()"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"## Split the dataframe into train, validation, and test\n",
"\n",
"The dataset we downloaded was a single CSV file. As a best practice, we will split this into train, validation, and test sets."
]
},
{
"cell_type": "code",
"execution_count": 65,
"metadata": {},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"193 train examples\n",
"49 validation examples\n",
"61 test examples\n"
]
}
],
"source": [
"# TODO 1a\n",
"train, test = train_test_split(dataframe, test_size=0.2)\n",
"train, val = train_test_split(train, test_size=0.2)\n",
"print(len(train), 'train examples')\n",
"print(len(val), 'validation examples')\n",
"print(len(test), 'test examples')"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"## Lab Task 2: Create an input pipeline using tf.data\n",
"\n",
"Next, we will wrap the dataframes with [tf.data](https://www.tensorflow.org/guide/datasets). This will enable us to use feature columns as a bridge to map from the columns in the Pandas dataframe to features used to train a model. If we were working with a very large CSV file (so large that it does not fit into memory), we would use tf.data to read it from disk directly. That is not covered in this lab."
]
},
{
"cell_type": "code",
"execution_count": 66,
"metadata": {},
"outputs": [],
"source": [
"# A utility method to create a tf.data dataset from a Pandas Dataframe\n",
"def df_to_dataset(dataframe, shuffle=True, batch_size=32):\n",
" dataframe = dataframe.copy()\n",
" labels = dataframe.pop('target')\n",
" ds = tf.data.Dataset.from_tensor_slices((dict(dataframe), labels)) # TODO 2a\n",
" if shuffle:\n",
" ds = ds.shuffle(buffer_size=len(dataframe))\n",
" ds = ds.batch(batch_size)\n",
" return ds"
]
},
{
"cell_type": "code",
"execution_count": 67,
"metadata": {},
"outputs": [],
"source": [
"batch_size = 5 # A small batch sized is used for demonstration purposes"
]
},
{
"cell_type": "code",
"execution_count": 68,
"metadata": {},
"outputs": [],
"source": [
"# TODO 2b\n",
"train_ds = df_to_dataset(train, batch_size=batch_size)\n",
"val_ds = df_to_dataset(val, shuffle=False, batch_size=batch_size)\n",
"test_ds = df_to_dataset(test, shuffle=False, batch_size=batch_size)"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"## Understand the input pipeline\n",
"\n",
"Now that we have created the input pipeline, let's call it to see the format of the data it returns. We have used a small batch size to keep the output readable."
]
},
{
"cell_type": "code",
"execution_count": 69,
"metadata": {},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Every feature: ['ca', 'thal', 'trestbps', 'restecg', 'oldpeak', 'exang', 'sex', 'age', 'slope', 'chol', 'fbs', 'thalach', 'cp']\n",
"A batch of ages: tf.Tensor([49 68 41 51 63], shape=(5,), dtype=int32)\n",
"A batch of targets: tf.Tensor([0 0 0 0 0], shape=(5,), dtype=int32)\n"
]
}
],
"source": [
"for feature_batch, label_batch in train_ds.take(1):\n",
" print('Every feature:', list(feature_batch.keys()))\n",
" print('A batch of ages:', feature_batch['age'])\n",
" print('A batch of targets:', label_batch)"
]
},
{
"cell_type": "markdown",
"metadata": {
"colab_type": "text",
"id": "ttIvgLRaNoOQ"
},
"source": [
"## Lab Task 3: Demonstrate several types of feature column\n",
"TensorFlow provides many types of feature columns. In this section, we will create several types of feature columns, and demonstrate how they transform a column from the dataframe."
]
},
{
"cell_type": "code",
"execution_count": 70,
"metadata": {},
"outputs": [],
"source": [
"# We will use this batch to demonstrate several types of feature columns\n",
"example_batch = next(iter(train_ds))[0]"
]
},
{
"cell_type": "code",
"execution_count": 71,
"metadata": {},
"outputs": [],
"source": [
"# A utility method to create a feature column\n",
"# and to transform a batch of data\n",
"def demo(feature_column):\n",
" feature_layer = layers.DenseFeatures(feature_column)\n",
" print(feature_layer(example_batch).numpy())"
]
},
{
"cell_type": "markdown",
"metadata": {
"colab_type": "text",
"id": "Q7OEKe82N-Qb"
},
"source": [
"### Numeric columns\n",
"The output of a feature column becomes the input to the model. A [numeric column](https://www.tensorflow.org/api_docs/python/tf/feature_column/numeric_column) is the simplest type of column. It is used to represent real valued features. When using this column, your model will receive the column value from the dataframe unchanged."
]
},
{
"cell_type": "code",
"execution_count": 72,
"metadata": {},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"NumericColumn(key='age', shape=(1,), default_value=None, dtype=tf.float32, normalizer_fn=None)\n"
]
}
],
"source": [
"age = feature_column.numeric_column(\"age\")\n",
"tf.feature_column.numeric_column\n",
"print(age)"
]
},
{
"cell_type": "markdown",
"metadata": {
"colab_type": "text",
"id": "7a6ddSyzOKpq"
},
"source": [
"### Let's have a look at the output:\n",
"\n",
"#### key='age'\n",
"A unique string identifying the input feature. It is used as the column name and the dictionary key for feature parsing configs, feature Tensor objects, and feature columns.\n",
"\n",
"#### shape=(1,)\n",
"In the heart disease dataset, most columns from the dataframe are numeric. Recall that tensors have a rank. \"Age\" is a \"vector\" or \"rank-1\" tensor, which is like a list of values. A vector has 1-axis, thus the shape will always look like this: shape=(3,), where 3 is a scalar (or single number) and with 1-axis. \n",
"\n",
"#### default_value=None\n",
"A single value compatible with dtype or an iterable of values compatible with dtype which the column takes on during tf.Example parsing if data is missing. A default value of None will cause tf.io.parse_example to fail if an example does not contain this column. If a single value is provided, the same value will be applied as the default value for every item. If an iterable of values is provided, the shape of the default_value should be equal to the given shape.\n",
"\n",
"#### dtype=tf.float32\n",
"defines the type of values. Default value is tf.float32. Must be a non-quantized, real integer or floating point type.\n",
"\n",
"\n",
"#### normalizer_fn=None\n",
"If not None, a function that can be used to normalize the value of the tensor after default_value is applied for parsing. Normalizer function takes the input Tensor as its argument, and returns the output Tensor. (e.g. lambda x: (x - 3.0) / 4.2). Please note that even though the most common use case of this function is normalization, it can be used for any kind of Tensorflow transformations.\n"
]
},
{
"cell_type": "code",
"execution_count": 73,
"metadata": {},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"WARNING:tensorflow:Layer dense_features_22 is casting an input tensor from dtype float64 to the layer's dtype of float32, which is new behavior in TensorFlow 2. The layer has dtype float32 because it's dtype defaults to floatx.\n",
"\n",
"If you intended to run this layer in float32, you can safely ignore this warning. If in doubt, this warning is likely only an issue if you are porting a TensorFlow 1.X model to TensorFlow 2.\n",
"\n",
"To change all layers to have dtype float64 by default, call `tf.keras.backend.set_floatx('float64')`. To change just this layer, pass dtype='float64' to the layer constructor. If you are the author of this layer, you can disable autocasting by passing autocast=False to the base Layer constructor.\n",
"\n",
"[[60.]\n",
" [58.]\n",
" [55.]\n",
" [54.]\n",
" [51.]]\n"
]
}
],
"source": [
"demo(age)"
]
},
{
"cell_type": "markdown",
"metadata": {
"colab_type": "text",
"id": "IcSxUoYgOlA1"
},
"source": [
"### Bucketized columns\n",
"Often, you don't want to feed a number directly into the model, but instead split its value into different categories based on numerical ranges. Consider raw data that represents a person's age. Instead of representing age as a numeric column, we could split the age into several buckets using a [bucketized column](https://www.tensorflow.org/api_docs/python/tf/feature_column/bucketized_column). Notice the one-hot values below describe which age range each row matches."
]
},
{
"cell_type": "code",
"execution_count": 74,
"metadata": {
"colab": {},
"colab_type": "code",
"id": "wJ4Wt3SAOpTQ"
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"WARNING:tensorflow:Layer dense_features_23 is casting an input tensor from dtype float64 to the layer's dtype of float32, which is new behavior in TensorFlow 2. The layer has dtype float32 because it's dtype defaults to floatx.\n",
"\n",
"If you intended to run this layer in float32, you can safely ignore this warning. If in doubt, this warning is likely only an issue if you are porting a TensorFlow 1.X model to TensorFlow 2.\n",
"\n",
"To change all layers to have dtype float64 by default, call `tf.keras.backend.set_floatx('float64')`. To change just this layer, pass dtype='float64' to the layer constructor. If you are the author of this layer, you can disable autocasting by passing autocast=False to the base Layer constructor.\n",
"\n",
"[[0. 0. 0. 0. 0. 0. 0. 0. 0. 1. 0.]\n",
" [0. 0. 0. 0. 0. 0. 0. 0. 1. 0. 0.]\n",
" [0. 0. 0. 0. 0. 0. 0. 0. 1. 0. 0.]\n",
" [0. 0. 0. 0. 0. 0. 0. 1. 0. 0. 0.]\n",
" [0. 0. 0. 0. 0. 0. 0. 1. 0. 0. 0.]]\n"
]
}
],
"source": [
"age_buckets = tf.feature_column.bucketized_column(age, boundaries=[18, 25, 30, 35, 40, 45, 50, 55, 60, 65])\n",
"demo(age_buckets) # TODO 3a\n"
]
},
{
"cell_type": "markdown",
"metadata": {
"colab_type": "text",
"id": "r1tArzewPb-b"
},
"source": [
"### Categorical columns\n",
"In this dataset, thal is represented as a string (e.g. 'fixed', 'normal', or 'reversible'). We cannot feed strings directly to a model. Instead, we must first map them to numeric values. The categorical vocabulary columns provide a way to represent strings as a one-hot vector (much like you have seen above with age buckets). The vocabulary can be passed as a list using [categorical_column_with_vocabulary_list](https://www.tensorflow.org/api_docs/python/tf/feature_column/categorical_column_with_vocabulary_list), or loaded from a file using [categorical_column_with_vocabulary_file](https://www.tensorflow.org/api_docs/python/tf/feature_column/categorical_column_with_vocabulary_file)."
]
},
{
"cell_type": "code",
"execution_count": 75,
"metadata": {
"colab": {},
"colab_type": "code",
"id": "DJ6QnSHkPtOC"
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"WARNING:tensorflow:Layer dense_features_24 is casting an input tensor from dtype float64 to the layer's dtype of float32, which is new behavior in TensorFlow 2. The layer has dtype float32 because it's dtype defaults to floatx.\n",
"\n",
"If you intended to run this layer in float32, you can safely ignore this warning. If in doubt, this warning is likely only an issue if you are porting a TensorFlow 1.X model to TensorFlow 2.\n",
"\n",
"To change all layers to have dtype float64 by default, call `tf.keras.backend.set_floatx('float64')`. To change just this layer, pass dtype='float64' to the layer constructor. If you are the author of this layer, you can disable autocasting by passing autocast=False to the base Layer constructor.\n",
"\n",
"[[0. 0. 1.]\n",
" [0. 1. 0.]\n",
" [0. 0. 1.]\n",
" [0. 1. 0.]\n",
" [0. 1. 0.]]\n"
]
}
],
"source": [
"thal = tf.feature_column.categorical_column_with_vocabulary_list(\n",
" 'thal', ['fixed', 'normal', 'reversible'])\n",
"\n",
"thal_one_hot = tf.feature_column.indicator_column(thal)\n",
"demo(thal_one_hot)"
]
},
{
"cell_type": "markdown",
"metadata": {
"colab_type": "text",
"id": "dxQloQ9jOoXL"
},
"source": [
"In a more complex dataset, many columns would be categorical (e.g. strings). Feature columns are most valuable when working with categorical data. Although there is only one categorical column in this dataset, we will use it to demonstrate several important types of feature columns that you could use when working with other datasets."
]
},
{
"cell_type": "markdown",
"metadata": {
"colab_type": "text",
"id": "LEFPjUr6QmwS"
},
"source": [
"### Embedding columns\n",
"Suppose instead of having just a few possible strings, we have thousands (or more) values per category. For a number of reasons, as the number of categories grow large, it becomes infeasible to train a neural network using one-hot encodings. We can use an embedding column to overcome this limitation. Instead of representing the data as a one-hot vector of many dimensions, an [embedding column](https://www.tensorflow.org/api_docs/python/tf/feature_column/embedding_column) represents that data as a lower-dimensional, dense vector in which each cell can contain any number, not just 0 or 1. The size of the embedding (8, in the example below) is a parameter that must be tuned.\n",
"\n",
"Key point: using an embedding column is best when a categorical column has many possible values. We are using one here for demonstration purposes, so you have a complete example you can modify for a different dataset in the future."
]
},
{
"cell_type": "code",
"execution_count": 76,
"metadata": {
"colab": {},
"colab_type": "code",
"id": "hSlohmr2Q_UU"
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"WARNING:tensorflow:Layer dense_features_25 is casting an input tensor from dtype float64 to the layer's dtype of float32, which is new behavior in TensorFlow 2. The layer has dtype float32 because it's dtype defaults to floatx.\n",
"\n",
"If you intended to run this layer in float32, you can safely ignore this warning. If in doubt, this warning is likely only an issue if you are porting a TensorFlow 1.X model to TensorFlow 2.\n",
"\n",
"To change all layers to have dtype float64 by default, call `tf.keras.backend.set_floatx('float64')`. To change just this layer, pass dtype='float64' to the layer constructor. If you are the author of this layer, you can disable autocasting by passing autocast=False to the base Layer constructor.\n",
"\n",
"[[ 0.26216975 -0.66194284 0.33328214 -0.09756625 0.20408471 0.57926923\n",
" -0.07685163 0.4386801 ]\n",
" [-0.24602154 0.0877578 0.07975551 0.34634778 0.2708743 -0.6707659\n",
" -0.15825593 -0.08179379]\n",
" [ 0.26216975 -0.66194284 0.33328214 -0.09756625 0.20408471 0.57926923\n",
" -0.07685163 0.4386801 ]\n",
" [-0.24602154 0.0877578 0.07975551 0.34634778 0.2708743 -0.6707659\n",
" -0.15825593 -0.08179379]\n",
" [-0.24602154 0.0877578 0.07975551 0.34634778 0.2708743 -0.6707659\n",
" -0.15825593 -0.08179379]]\n"
]
}
],
"source": [
"# Notice the input to the embedding column is the categorical column\n",
"# we previously created\n",
"thal_embedding = tf.feature_column.embedding_column(thal, dimension=8)\n",
"demo(thal_embedding)"
]
},
{
"cell_type": "markdown",
"metadata": {
"colab_type": "text",
"id": "urFCAvTVRMpB"
},
"source": [
"### Hashed feature columns\n",
"\n",
"Another way to represent a categorical column with a large number of values is to use a [categorical_column_with_hash_bucket](https://www.tensorflow.org/api_docs/python/tf/feature_column/categorical_column_with_hash_bucket). This feature column calculates a hash value of the input, then selects one of the `hash_bucket_size` buckets to encode a string. When using this column, you do not need to provide the vocabulary, and you can choose to make the number of hash_buckets significantly smaller than the number of actual categories to save space.\n",
"\n",
"Key point: An important downside of this technique is that there may be collisions in which different strings are mapped to the same bucket. In practice, this can work well for some datasets regardless."
]
},
{
"cell_type": "code",
"execution_count": 77,
"metadata": {
"colab": {},
"colab_type": "code",
"id": "YHU_Aj2nRRDC"
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"WARNING:tensorflow:Layer dense_features_26 is casting an input tensor from dtype float64 to the layer's dtype of float32, which is new behavior in TensorFlow 2. The layer has dtype float32 because it's dtype defaults to floatx.\n",
"\n",
"If you intended to run this layer in float32, you can safely ignore this warning. If in doubt, this warning is likely only an issue if you are porting a TensorFlow 1.X model to TensorFlow 2.\n",
"\n",
"To change all layers to have dtype float64 by default, call `tf.keras.backend.set_floatx('float64')`. To change just this layer, pass dtype='float64' to the layer constructor. If you are the author of this layer, you can disable autocasting by passing autocast=False to the base Layer constructor.\n",
"\n",
"[[0. 0. 0. ... 0. 0. 0.]\n",
" [0. 0. 0. ... 0. 0. 0.]\n",
" [0. 0. 0. ... 0. 0. 0.]\n",
" [0. 0. 0. ... 0. 0. 0.]\n",
" [0. 0. 0. ... 0. 0. 0.]]\n"
]
}
],
"source": [
"thal_hashed = tf.feature_column.categorical_column_with_hash_bucket(\n",
" 'thal', hash_bucket_size=1000)\n",
"demo(tf.feature_column.indicator_column(thal_hashed))"
]
},
{
"cell_type": "markdown",
"metadata": {
"colab_type": "text",
"id": "fB94M27DRXtZ"
},
"source": [
"### Crossed feature columns\n",
"Combining features into a single feature, better known as [feature crosses](https://developers.google.com/machine-learning/glossary/#feature_cross), enables a model to learn separate weights for each combination of features. Here, we will create a new feature that is the cross of age and thal. Note that `crossed_column` does not build the full table of all possible combinations (which could be very large). Instead, it is backed by a `hashed_column`, so you can choose how large the table is."
]
},
{
"cell_type": "code",
"execution_count": 78,
"metadata": {
"colab": {},
"colab_type": "code",
"id": "oaPVERd9Rep6"
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"WARNING:tensorflow:Layer dense_features_27 is casting an input tensor from dtype float64 to the layer's dtype of float32, which is new behavior in TensorFlow 2. The layer has dtype float32 because it's dtype defaults to floatx.\n",
"\n",
"If you intended to run this layer in float32, you can safely ignore this warning. If in doubt, this warning is likely only an issue if you are porting a TensorFlow 1.X model to TensorFlow 2.\n",
"\n",
"To change all layers to have dtype float64 by default, call `tf.keras.backend.set_floatx('float64')`. To change just this layer, pass dtype='float64' to the layer constructor. If you are the author of this layer, you can disable autocasting by passing autocast=False to the base Layer constructor.\n",
"\n",
"[[0. 0. 0. ... 0. 0. 0.]\n",
" [0. 0. 0. ... 0. 0. 0.]\n",
" [0. 0. 0. ... 0. 0. 0.]\n",
" [0. 0. 0. ... 0. 0. 0.]\n",
" [0. 0. 0. ... 0. 0. 0.]]\n"
]
}
],
"source": [
"crossed_feature = tf.feature_column.crossed_column([age_buckets, thal], hash_bucket_size=1000)\n",
"demo(tf.feature_column.indicator_column(crossed_feature))"
]
},
{
"cell_type": "markdown",
"metadata": {
"colab_type": "text",
"id": "ypkI9zx6Rj1q"
},
"source": [
"## Choose which columns to use\n",
"We have seen how to use several types of feature columns. Now we will use them to train a model. The goal of this tutorial is to show you the complete code (e.g. mechanics) needed to work with feature columns. We have selected a few columns to train our model below arbitrarily.\n",
"\n",
"Key point: If your aim is to build an accurate model, try a larger dataset of your own, and think carefully about which features are the most meaningful to include, and how they should be represented."
]
},
{
"cell_type": "code",
"execution_count": 79,
"metadata": {
"colab": {},
"colab_type": "code",
"id": "4PlLY7fORuzA"
},
"outputs": [],
"source": [
"feature_columns = []\n",
"\n",
"# numeric cols\n",
"for header in ['age', 'trestbps', 'chol', 'thalach', 'oldpeak', 'slope', 'ca']:\n",
" feature_columns.append(feature_column.numeric_column(header))\n",
"\n",
"# bucketized cols\n",
"age_buckets = feature_column.bucketized_column(age, boundaries=[18, 25, 30, 35, 40, 45, 50, 55, 60, 65])\n",
"feature_columns.append(age_buckets)\n",
"\n",
"# indicator cols\n",
"thal = feature_column.categorical_column_with_vocabulary_list(\n",
" 'thal', ['fixed', 'normal', 'reversible'])\n",
"thal_one_hot = feature_column.indicator_column(thal)\n",
"feature_columns.append(thal_one_hot)\n",
"\n",
"# embedding cols\n",
"thal_embedding = feature_column.embedding_column(thal, dimension=8)\n",
"feature_columns.append(thal_embedding)\n",
"\n",
"# crossed cols\n",
"crossed_feature = feature_column.crossed_column([age_buckets, thal], hash_bucket_size=1000)\n",
"crossed_feature = feature_column.indicator_column(crossed_feature)\n",
"feature_columns.append(crossed_feature)"
]
},
{
"cell_type": "markdown",
"metadata": {
"colab_type": "text",
"id": "M-nDp8krS_ts"
},
"source": [
"### How to Input Feature Columns to a Keras Model\n",
"Now that we have defined our feature columns, we now use a [DenseFeatures](https://www.tensorflow.org/versions/r2.0/api_docs/python/tf/keras/layers/DenseFeatures) layer to input them to a Keras model. Don't worry if you have not used Keras before. There is a more detailed video and lab introducing the Keras Sequential and Functional models."
]
},
{
"cell_type": "code",
"execution_count": 80,
"metadata": {
"colab": {},
"colab_type": "code",
"id": "6o-El1R2TGQP"
},
"outputs": [],
"source": [
"feature_layer = tf.keras.layers.DenseFeatures(feature_columns)"
]
},
{
"cell_type": "markdown",
"metadata": {
"colab_type": "text",
"id": "8cf6vKfgTH0U"
},
"source": [
"Earlier, we used a small batch size to demonstrate how feature columns worked. We create a new input pipeline with a larger batch size."
]
},
{
"cell_type": "code",
"execution_count": 81,
"metadata": {
"colab": {},
"colab_type": "code",
"id": "gcemszoGSse_"
},
"outputs": [],
"source": [
"batch_size = 32\n",
"train_ds = df_to_dataset(train, batch_size=batch_size)\n",
"val_ds = df_to_dataset(val, shuffle=False, batch_size=batch_size)\n",
"test_ds = df_to_dataset(test, shuffle=False, batch_size=batch_size)"
]
},
{
"cell_type": "markdown",
"metadata": {
"colab_type": "text",
"id": "bBx4Xu0eTXWq"
},
"source": [
"## Create, compile, and train the model"
]
},
{
"cell_type": "code",
"execution_count": 82,
"metadata": {
"colab": {},
"colab_type": "code",
"id": "_YJPPb3xTPeZ"
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Train for 7 steps, validate for 2 steps\n",
"Epoch 1/5\n",
"7/7 [==============================] - 1s 157ms/step - loss: 1.1446 - accuracy: 0.6580 - val_loss: 1.4723 - val_accuracy: 0.4694\n",
"Epoch 2/5\n",
"7/7 [==============================] - 0s 10ms/step - loss: 0.7330 - accuracy: 0.6632 - val_loss: 0.5254 - val_accuracy: 0.7143\n",
"Epoch 3/5\n",
"7/7 [==============================] - 0s 10ms/step - loss: 0.4610 - accuracy: 0.7565 - val_loss: 0.4916 - val_accuracy: 0.7755\n",
"Epoch 4/5\n",
"7/7 [==============================] - 0s 10ms/step - loss: 0.4359 - accuracy: 0.7617 - val_loss: 0.5403 - val_accuracy: 0.7551\n",
"Epoch 5/5\n",
"7/7 [==============================] - 0s 10ms/step - loss: 0.5650 - accuracy: 0.7409 - val_loss: 0.6612 - val_accuracy: 0.7551\n"
]
}
],
"source": [
"model = tf.keras.Sequential([\n",
" feature_layer,\n",
" layers.Dense(128, activation='relu'),\n",
" layers.Dense(128, activation='relu'),\n",
" layers.Dense(1)\n",
"])\n",
"\n",
"model.compile(optimizer='adam',\n",
" loss=tf.keras.losses.BinaryCrossentropy(from_logits=True),\n",
" metrics=['accuracy'])\n",
"\n",
"history = model.fit(train_ds,\n",
" validation_data=val_ds,\n",
" epochs=5)"
]
},
{
"cell_type": "code",
"execution_count": 83,
"metadata": {
"colab": {},
"colab_type": "code",
"id": "GnFmMOW0Tcaa"
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"2/2 [==============================] - 0s 4ms/step - loss: 0.4773 - accuracy: 0.7705\n",
"Accuracy 0.7704918\n"
]
}
],
"source": [
"loss, accuracy = model.evaluate(test_ds)\n",
"print(\"Accuracy\", accuracy)"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"### Visualize the model loss curve\n",
"\n",
"Next, we will use Matplotlib to draw the model's loss curves for training and validation. A line plot is also created showing the accuracy over the training epochs for both the train (blue) and test (orange) sets."
]
},
{
"cell_type": "code",
"execution_count": 87,
"metadata": {},
"outputs": [
{
"data": {
"image/png": "iVBORw0KGgoAAAANSUhEUgAAAmQAAAFNCAYAAACuWnPfAAAABHNCSVQICAgIfAhkiAAAAAlwSFlzAAALEgAACxIB0t1+/AAAADl0RVh0U29mdHdhcmUAbWF0cGxvdGxpYiB2ZXJzaW9uIDMuMC4zLCBodHRwOi8vbWF0cGxvdGxpYi5vcmcvnQurowAAIABJREFUeJzs3Xl41PW1+PH3STJZyR7WhATCvsomCkHArUWr4q642ypqa1262t/tYrd7e+/1eq2tS9FqrxtKta6lAioICihhEZQtECAJa4AkBLIn5/fHd4JDSEJCZklmzut55pmZ73pmDB/PfFZRVYwxxhhjTOCEBToAY4wxxphQZwmZMcYYY0yAWUJmjDHGGBNglpAZY4wxxgSYJWTGGGOMMQFmCZkxxhhjTIBZQmY6DRH5m4j8ro3H7hSRCzp6HWOMaeStMsiY02EJmTHGGGNMgFlCZowxxgQREYkIdAym/SwhM+3irqb/sYisF5FjIvJXEekpIv8SkXIR+UBEkj2Ov0xEvhKRUhFZIiLDPPaNFZE17vNeA6Kb3OsSEVnnPne5iIw+zZjvFJFtInJYRN4RkT7u7SIi/ysiB0TkiIhsEJGR7n0Xi8hGd2y7ReRHp/WFGWO8qiuUQSLyLRFZ6y5XCkXk4Sb7p7ivV+ref5t7e4yI/I+I7BKRMhH5xL1tuogUNfM9XOB+/bCIvC4iL4nIEeA2EZkoIivc99grIn8WkUiP80eIyCJ3ubhfRP6fiPQSkQoRSfU4bpyIFIuIqy2f3Zw+S8jM6bgKuBAYDFwK/Av4f0B3nL+p+wBEZDAwF3jAvW8+8K6IRLoLhreAF4EU4O/u6+I+dyzwHHAXkAr8BXhHRKLaE6iInAf8B3At0BvYBbzq3v0NYKr7cyS6jznk3vdX4C5VjQdGAh+1577GGJ/q7GXQMeAWIAn4FnCPiFzuvm6WO94/uWMaA6xzn/cIMB6Y7I7pJ0BDG7+TmcDr7nu+DNQDDwJpwCTgfOC77hjigQ+A94E+wEDgQ1XdByzBKQsb3Qy8qqq1bYzDnCZLyMzp+JOq7lfV3cAy4DNVXauqVcCbwFj3cdcB/1TVRe5/zI8AMTiFzdmAC3hMVWtV9XVglcc9ZgN/UdXPVLVeVf8PqHaf1x43As+p6hpVrQZ+BkwSkX5ALRAPDAVEVTep6l73ebXAcBFJUNUSVV3TzvsaY3ynU5dBqrpEVTeoaoOqrsdJCqe5d98AfKCqc933PaSq60QkDPg2cL+q7nbfc7m73GqLFar6lvuelaq6WlVXqmqdqu7ESSgbY7gE2Keq/6OqVaparqqfuff9H3ATgIiEA7NwklbjY5aQmdOx3+N1ZTPvu7lf98GpkQJAVRuAQiDdvW+3nri6/S6P11nAD93V7aUiUgr0dZ/XHk1jOIpTC5auqh8BfwaeAA6IyBwRSXAfehVwMbBLRD4WkUntvK8xxnc6dRkkImeJyGJ3U18ZcDdOTRXua2xv5rQ0nCbT5va1RWGTGAaLyHsiss/djPnvbYgB4G2cH6P9cWohy1T189OMybSDJWTGl/bgFGqA02cLpyDYDewF0t3bGmV6vC4Efq+qSR6PWFWd28EY4nCaH3YDqOrjqjoeGI7T/PFj9/ZVqjoT6IHTrDGvnfc1xgReoMqgV4B3gL6qmgg8DTTepxAY0Mw5B4GqFvYdA2I9Pkc4TnOnJ23y/ilgMzBIVRNwmnQ9Y8huLnB3LeM8nFqym7HaMb+xhMz40jzgWyJyvrtD6A9xqvyXAyuAOuA+EXGJyJXARI9znwHudv/SFBGJc3eUjW9nDHOB20VkjLvvx7/jNG/sFJEz3dd34RR4VUCDu3/JjSKS6G7mOELb+3EYYzqPQJVB8cBhVa0SkYk4zZSNXgYuEJFrRSRCRFJFZIy79u454FER6SMi4SIyyV1ubQWi3fd3AT8HTtWXLR6n7DoqIkOBezz2vQf0FpEHRCRKROJF5CyP/S8AtwGXYQmZ31hCZnxGVbfg/Mr6E86vv0uBS1W1RlVrgCtx/tEfxunr8Q+Pc3OBO3GaFEuAbe5j2xvDB8AvgDdwfhEPAK53707AKXRLcJoqDgH/7d53M7DTXdV/N05fNGNMFxLAMui7wG9EpBz4JR417KpagNMd4ofu+64DznDv/hGwAacv22HgP4EwVS1zX/NZnNq9Y8AJoy6b8SOcRLAcp5x7zSOGcpzmyEuBfUAecK7H/k9xfoSuUVXPZlzjQ3Ji87kxxhhjQp2IfAS8oqrPBjqWUGEJmTHGGGOOE5EzgUU4feDKAx1PqLAmS2OMMcYAICL/hzNH2QOWjPmX1ZAZY4wxxgSY1ZAZY4wxxgSYJWTGGGOMMQHW5VaET0tL0379+gU6DGOMH61evfqgqjadCLNLsjLMmNDS1vKryyVk/fr1Izc3N9BhGGP8SESCZi4kK8OMCS1tLb+sydIYY4wxJsAsITPGGGOMCTBLyIwxxhhjAqzL9SFrTm1tLUVFRVRVVQU6lKARHR1NRkYGLpcr0KEYE/SsDPMuK79MVxQUCVlRURHx8fH069cPEQl0OF2eqnLo0CGKioro379/oMMxJuhZGeY9Vn6ZrioomiyrqqpITU21gsxLRITU1FT7tW6Mn1gZ5j1WfpmuKigSMsAKMi+z79MY/7J/c95j36XpioImIQuk0tJSnnzyyXafd/HFF1NaWuqDiIwxpu2sDDMm8Cwh84KWCrO6urpWz5s/fz5JSUm+CssYY9rEyjBjAi8oOvU3q6EBqkrBFQ2uWJ/e6qGHHmL79u2MGTMGl8tFdHQ0ycnJbN68ma1bt3L55ZdTWFhIVVUV999/P7Nnzwa+nrH76NGjXHTRRUyZMoXly5eTnp7O22+/TUxMjE/jNsYYsDLM56qOwM5l0HsMJKYHOhrTWalql3qMHz9em9q4ceNJ27S+XnX3WtWyopP3edmOHTt0xIgRqqq6ePFijY2N1fz8/OP7Dx06pKqqFRUVOmLECD148KCqqmZlZWlxcbHu2LFDw8PDde3ataqqes011+iLL77o87hPpdnv1ZgAAHK1E5Q/3ni0uQzzo2AswwL9nR5Xskv1z2ep/irBeTxxtuqCn6vmf6xaWx3o6IwftLX8Croasl+/+xUb9xxx3tRWAofAVdChaw7vk8CvLh3R5uMnTpx4wnDrxx9/nDfffBOAwsJC8vLySE1NPeGc/v37M2bMGADGjx/Pzp07OxSzMaZrOqEM8xIrwwJk92p45Xqoq4Yrn4XyPZC3CFY+Bcsfh8h4yJ4Ggy6EgRda7VmIC7qE7ARh4VBfAyjgv1E3cXFxx18vWbKEDz74gBUrVhAbG8v06dObHY4dFRV1/HV4eDiVlZV+idUYY5qyMswLNr4D/5gN3brDre9Cj6HO9pz7oboc8j+GbYsg7wPY/J6zr8dwGHiBk6D1PRsiIgMXv/G7oEvITvgVWHUEDm+H1IEQFe+ze8bHx1NeXt7svrKyMpKTk4mNjWXz5s2sXLnSZ3EYY7q+9tRkeYuVYV6kCsv/BIt+CRkT4Pq5TlLmKSoehl3iPFSheDPkLbTasxAXdAnZCSLdv/Kqj/o0IUtNTSUnJ4eRI0cSExNDz549j++bMWMGTz/9NMOGDWPIkCGcffbZPovDGGNOh5VhXlJfC/N/DKufh+GXwxVPg+sUAxtEoMcw53Gq2rPG5CzzbAi3ZaGCjTj9zbqOCRMmaG5u7gnbNm3axLBhw5o/oXgzSDikDfJDdMGl1e/VGD8SkdWqOiHQcXhDu8swc1r8/p1WlcHfb4PtH8GUH8B5v4CwDs4s1bT2rGAlNNRa7VkX09byK7hryAAiu8Gxg6ANIDbtmjHGGC8rLYBXroODW+GyP8O4m71zXas9CykhkpAVQ00FRHULdDTGGGOCiedIypvegOzpvrtXa33PVjwJn/7Ras+6sBBIyNz9yGqOWkJmjDHGeza9C2/cefJISn9oc+3ZCBh0gdWedQHBn5CFuyAiGmqOBToSY4wxwaAtIyn9zWrPurzgT8jAabasPOz8kYr/5iMzxhgTZOrrYP6P2jeS0t/8XHtWVVtPaUUtJRU1JMdG0isx2osfJnSESEIWBxUHnZn7I327rqUxxpggVXXEPZLyQ++NpPSHNtaeNfSfxtHMcznU6xyKw7pTWlFDaUUtpZU1lFTUHn9f0rjdva+qtuGE2w3tFc+5Q3tw7pAejMtMIiK8C3xHnUCIJGTuvmM1RztFQtatWzeOHj3Knj17uO+++3j99ddPOmb69Ok88sgjTJjQ8kjZxx57jNmzZxMb63ymiy++mFdeeYWkpCSfxW6MMSFZhp0wkvJPMO6WQEfUovoGpazSSaBKKmopq6yh5JiTSJVV1lJSUUdpxTmU1p1NdVIpA8rXMK46l5zNK0jf8h4JQFVDX9Y0jGFJwxnkNgxGwl0kxkSSHOsiOTaSvimxjM5wkRQbSVKsi6QY57mopILFm4t5Zmk+Ty3ZTkJ0BFMHd+fcIT2YNqQ7ad2iThl/qAqNhCwiEsIjnYSMHoGO5rg+ffo0W5C11WOPPcZNN910vDCbP3++t0IzxphTCpkyzJ8jKT2oKkeq6ihz10odT6iO1VBa6a6hqvCovXLvO1JV1+I1wwQSY5ykKjHWRXJCCjW9LmJzzEz2x0SQpQUMLF1Bn4OfMLv4fe5ueBeN7AYDzkUGXugs7XSKvmezpw7gSFUtn+YdZPGWAyzeUsx76/ciAqPTE4/Xno1KTyQszLoRNQqNhAycWrLqIz7pR/bQQw/Rt29fvve97wHw8MMPExERweLFiykpKaG2tpbf/e53zJw584Tzdu7cySWXXMKXX35JZWUlt99+O1988QVDhw49YR24e+65h1WrVlFZWcnVV1/Nr3/9ax5//HH27NnDueeeS1paGosXL6Zfv37k5uaSlpbGo48+ynPPPQfAHXfcwQMPPMDOnTu56KKLmDJlCsuXLyc9PZ23336bmJhO1v/BGONXVoa1wksjKStr6jl0rPqEpr6SilrKjidUjcnV18lWWWUt9Q0tT94eHx1BcmMNVWwk/dLiSIr5utbqeNIV69RsJcVEEh8dcYokaDBwgfPS3fdMGvuebXrX2d6GvmcJ0S4uGtWbi0b1pqFB2bj3CIs3H2DxlgP88cM8Hvsgj7RukUwb3INzh3bnnEHdSYwJ7RGgPkvIROQ54BLggKqObOW4M4EVwPWqevo/tU4lyt2xv64aXN7tcHjdddfxwAMPHC/M5s2bx4IFC7jvvvtISEjg4MGDnH322Vx22WVIC8ngU089RWxsLJs2bWL9+vWMGzfu+L7f//73pKSkUF9fz/nnn8/69eu57777ePTRR1m8eDFpaWknXGv16tU8//zzfPbZZ6gqZ511FtOmTSM5OZm8vDzmzp3LM888w7XXXssbb7zBTTfd5NXvwxjTtVgZ1gzPkZTp42HWXOh2ei0s81YV8rM3N7SYXMVGhjvJU4yL5DgXvRNjjidUjclWkntf4+vEGJfv+2a1deTmgOlOctZC7VlYmDAyPZGR6Yl8//xBHD5Ww9KtxSzecoAPN+/njTVFhIcJ47OSOXeIk6AN6Rnf4t9asPJlDdnfgD8DL7R0gIiEA/8JLPTaXf/1EOzbcPJ2bYDaY84UGGHtzMJ7jYKL/tDi7rFjx3LgwAH27NlDcXExycnJ9OrViwcffJClS5cSFhbG7t272b9/P7169Wr2GkuXLuW+++4DYPTo0YwePfr4vnnz5jFnzhzq6urYu3cvGzduPGF/U5988glXXHEFcXHOHGxXXnkly5Yt47LLLqN///6MGTMGgPHjx7Nz5872fRfGGN9qqQzrCCvD2seLIyk3FJXx87e+ZHxWMleNSz/eDyvJXWuVGOsiKiLcyx/AB041crOx9iwmGWg9kUoBLnc/NArqXUpNfQO1+5T6PQ2wGMpEcIWH4Qp3njtdanbBwzD+Vq9e0mcJmaouFZF+pzjs+8AbwJm+iuM4ESAMGurbn5C1wTXXXMPrr7/Ovn37uO6663j55ZcpLi5m9erVuFwu+vXrR1VVVbuvu2PHDh555BFWrVpFcnIyt91222ldp1FU1NcdKsPDw09oVjAmFInIDOCPQDjwrKr+ocn+/wXOdb+NBXqoapJ7Xz3QmD0VqOpl/ona+6wMc/PiSMqyilq++8pqUrtF8vRN40mJi/RurIHUbO3ZImfwQzsITiLSmIwcq6lnT2kFRSWV7C2rora6gXAReiZGk54UQ0ZyDAnRnaBpM3WA1y8ZsD5kIpIOXIFT0HkvIWvlVyCHdzgTxPYc4fV+ZNdddx133nknBw8e5OOPP2bevHn06NEDl8vF4sWL2bVrV6vnT506lVdeeYXzzjuPL7/8kvXr1wNw5MgR4uLiSExMZP/+/fzrX/9i+vTpAMTHx1NeXn5Sdf8555zDbbfdxkMPPYSq8uabb/Liiy969fMaEwzctfRPABcCRcAqEXlHVTc2HqOqD3oc/31grMclKlV1jFeDaq0M8yErw4DSQnjlWq+MpGxoUH7493XsLa1i3t2TgisZa8qz9qyD4oBB7kdNXQO5Ow+zeMsB/ralmG3bjgLQLzX2+MCAif1TiHZ1gRrGNghkp/7HgJ+qasOp2olFZDYwGyAzM/P07xjVDapKob4GIrw79HbEiBGUl5eTnp5O7969ufHGG7n00ksZNWoUEyZMYOjQ1juC3nPPPdx+++0MGzaMYcOGMX78eADOOOMMxo4dy9ChQ+nbty85OTnHz5k9ezYzZsygT58+LF68+Pj2cePGcdtttzFx4kTA6RA7duxYa5405mQTgW2qmg8gIq8CM4GNLRw/C/iVn2Lzq5Avw3avgbnXQ22VV0ZSzlmWzwebDvCrS4czLjPZKyGGmsiIMCYPTGPywDT+7VtQcKiCJVsPsHjzAV75rIDnP91JjCucnIFpnDu0O9OH9CA9qesOUhPVlkdwdPjiTpPle8116heRHXzd0JwGVACzVfWt1q45YcIEzc3NPWHbpk2bGDasDZl5baVTrZqUCbGpbfkIIa3N36sxPiYiq1W15QmtTv+6VwMzVPUO9/ubgbNU9d5mjs0CVgIZqlrv3lYHrAPqgD+cqvyCDpZhps3a9Z16jqS84e8dXpNyZf4hbnz2M2aM6MWfbxgbcp3T/aGypp6V+YdYvOUAH20+QFGJ03Q9pGfjpLTdGZeVjKsTTErb1vIrYDVkqtq/8bWI/A0ncTtlYdYhEdEg4c58ZJaQGWPa53rg9cZkzC1LVXeLSDbwkYhsUNXtTU/0Wi2/8S5VWPFnWPiLDo+kbHSgvIrvz11LVkosf7hqlCVjPhITGe4kXkN78OvLlO3FR1m82Rm5+eyyfJ7+eDvxnpPSDu5O9/jOPSmtL6e9mAtMB9JEpAinmt8FoKpP++q+pwjKPR+ZLTRujAFgN9DX432Ge1tzrge+57lBVXe7n/NFZAlO/7KTEjJVnQPMAaeGrMNRm47zwZqUdfUN3Dd3LeVVtbz4nYnEd4bO5yFARBjYI56BPeK5c2o25VW1fLrt4PEE7Z/r9wJwRkYi04c4SdzoTjgprS9HWc5qx7G3+SqOk0R1g+oypx9ZeBB3sjTGtMUqYJCI9MdJxK4Hbmh6kIgMBZJx5kxs3JYMVKhqtYikATnAf/klatMxJ4ykfBDO+6VX1qR8dNFWVuYf5n+uOYOhvRI6Hqc5LfHRLmaM7M2Mkb1RVb7ac4Ql7qbNxz/K448f5pEaF8m0IU7t2dRB3UmMDXzyHDQz9atq26qGI515bag5BjGWkLXEl30LjeksVLVORO4FFuBMe/Gcqn4lIr8BclX1Hfeh1wOv6on/MIYBfxGRBiAMpw9ZS4MB2hKLNW95SavlV2mhe03KLV5dk/LDTft5csl2Zk3sy1XjM7xyTdNxIl9PSnvvec6ktMvyivlos5Og/WPNbsLDhHGZScdHbg7tFZhJaYMiIYuOjubQoUOkpqae+kt0xYKEQfVR9wR2pilV5dChQ0RHe3dFA2M6I1WdD8xvsu2XTd4/3Mx5y4FR3oihXWWYaVWr5ZeXR1I2KjxcwYOvrWNEnwR+dekIr1zT+EZKXCQzx6Qzc0w69Q3KusLS47Vn//X+Fv7r/S30Tox2mjaHdCdnYBpxUf5JlYIiIcvIyKCoqIji4uK2nXC0DPQwxB/1bWBdWHR0NBkZ9ivPGH9odxlmWtVs+eU5kvKWdzo8krJRdV093315DQo8eeO4oJkTKxQ0Ltc0PiuZH35jCPuPVPHxFqf27N0v9jD38wIiw8M4KzvleIKW3b2bz+IJioTM5XLRv3//Ux/YaOk/4aPfwk92QGyK7wIzxpg2aHcZZtrOByMpPf32vY1s2F3GnJvHk5Ua57XrGv/rmRDNtWf25doz+zqT0u467F4QvZjfvreR377nTEo7fUgPrh6fwcj0RK/ePygSsnbLck9MWLAChn4rsLEYY4zxjRNGUs6EK/7S4ZGUnt5au5uXVhZw19RsvjGi+TU+TdcUGRHG5AFpTB7gTEpbeLjieNPm3M8LGN47wRIyr0gfB+FRsGu5JWTGGBOMfDSSstHW/eX87B8bmNgvhR99c4jXrms6p74psdw8qR83T+pHVW09vhj3FpoJWUQUZExwEjJjjDHBxUcjKRsdra7j7pdWExcVwZ9uGNspZoM3/uOrfoKh+1eUNRn2fgHV5YGOxBhjjLfsXgPPng9lRXDj615PxlSVn/1jAzsPHuPxWWPomWCj0Y13hHZCpvVQ+HmgIzHGGOMNm96D5y92WkG+sxAGnOv1W7y4chfvfrGHH35jCJMHpHn9+iZ0hW5CljHRWdfSmi2NMaZrU4Xlf4LXboKeI+COD702rYWndYWl/Pa9jZw3tAf3TBvg9eub0BaafcjAWUKpzxhLyIwxpiurr4N//Rhyn/PJSMpGJcdq+N7La+gRH82j157R6dZBNF1f6NaQgdNsuTvXmbXZGGNM11J1BF651knGpjwIV//NJ8lYQ4Py4Lx1FJdX89RN40iKtWX3jPeFeEKW4ywyvnt1oCMxxhjTHqWF8NwM2PExXPo4XPCwV6e18PTkkm0s2VLMLy4dzuiMJJ/cw5jQTsgyzwbEmi2NMaYraTqScvytPrvVp9sO8uiircwc04ebzsr02X2MCe2ELCbZ6QC669NAR2KMMaYt/DCSstG+siruf3Ut2d278e9XjLKF341PhXZCBk4/ssLPob420JEYY4xpiSos/7PPR1I2qq1v4Ptz11BRU8/TN40jLip0x8AZ/7CELGsy1B6DvesDHYkxxpjm1NfBP38AC/8Nhl8Gt73n1QXCm/PfC7awamcJ/3HlKAb2iPfpvYwBS8ggc7LzbM2WxhjT+fhpJKWn97/cx5yl+dx8dhYzx6T79F7GNLKELL4npA6EghWBjsQYY4wnP46kbLTr0DF+/PcvGJ2RyM8vGebTexnjyRrFATInwaZ3oaHB5//YjTHGtMHuNTD3eqitdEZS+rDzfqOq2nrueWkNYWHCEzeMIyrCN4tIG9Mcyz7AmY+sqhSKNwU6EmOMMY0jKcN9P5LS08PvfMXGvUf43+vOoG9KrF/uaUwjS8jA6dgPNh+ZMcYEUtORlHd+CD3802z499xCXl1VyPfOHcB5Q3v65Z7GeArahKysspbf/3MjuTsPn/rgpExIyLCO/cYYEygBGEnZaNPeI/zi7S+ZlJ3KgxcM9ss9jWkqaBOyqIgw3lizm6eWbD/1wSJOLdmu5c4vNGOMMf5TdQTmXueMpMx5wC8jKRuVV9Xy3ZfXkBDt4o+zxhARHrT/WzSdXND+5UW7wrllUhYfbj5A3v7yU5+QNRmO7ofD+b4PzhhjjKNxJGX+Emck5YW/9tvgKlXlp2+sp+BwBX+aNZYe8dF+ua8xzQnahAzglkn9iHaF8cyyNiRZWTnOszVbGmOMf9TVwPMXQVmhz9ekbM7zn+5k/oZ9/OSbQzgrO9Wv9zamqaBOyFLiIrl2Ql/eWruHA0eqWj84bRDEplnHfmOM8ZeC5U4yNvPPfhtJ2Wj1rhL+ff4mLhzek9lTs/16b2OaE9QJGcAdU7Kpa2jg+eU7Wz/weD8yqyEzxhi/yFsE4ZEw8AK/3vbQ0WrufWUNvZOieeSaM2zRcNMpBH1Clpkay0Uje/PSyl0cra5r/eCsHCgtcPo0GGOM8a2tC6DfFIiM89st6xuUB15bx6FjNTx143gSY1x+u7cxrQn6hAxg9tRsyqvqePXzgtYPbJyPzJZRMsYY3zqcD4fyYNA3/XrbP32Ux7K8g/z6shGMTE/0672NaU1IJGRn9E3irP4pPPfJDmrrG1o+sOcIiEq0ZktjjPG1vEXO86AL/XbLpVuL+eOHeVw5Lp3rz+zrt/sa0xYhkZAB3DUtmz1lVby3fk/LB4WFQ+bZsMtqyIwxxqe2LoDUgZA6wC+321Nayf2vrmVwj3h+d/lI6zdmOp2QScimD+7BoB7d+MvH+Whrk79mTYKDW+Bosf+CM8aYUFJzDHZ+4rfmypq6Bu59ZQ01dQ08edM4YiMj/HJfY9ojZBKysDDhzqnZbN5XzrK8gy0f2DgfmfUjM8YY39ixFOqrYfA3/HK7P/xrM2sKSvnPq0czoHs3v9zTmPYKmYQMYOaYPvSIj2LO0lYmiu09BiJibD4yY0KEiMwQkS0isk1EHmpm//+KyDr3Y6uIlHrsu1VE8twP/85q2pVtXQCR3SBzss9vNX/DXp77dAe3Te7HJaP7+Px+xpyukErIoiLCuT2nP59sO8iXu8uaPygiEvqeaR37jQkBIhIOPAFcBAwHZonIcM9jVPVBVR2jqmOAPwH/cJ+bAvwKOAuYCPxKRJL9GX+XpAp5CyF7ulPe+lB+8VF+8vp6xmYm8f8uHubTexnTUSGVkAHccFYmcZHhrS+nlJUD+zZAVQtJmzEmWEwEtqlqvqrWAK8CM1s5fhYw1/36m8AiVT2sqiXAImCGT6MNBgc2wpHdMMi3zZWVNfV89+U1uMKFJ24YR2REyP3vznQxIfcXmhjjYtbETN5bv5eikormD8qaDCgUfObX2IwxfpcOeM4EXeTedhIRyQL6Ax+dxrmzRSRXRHKLi0N8wNDWBc6zDxMyVeXnb33Jlv3lPHb9WPokxfjsXsZ4S8hO/sMfAAAgAElEQVQlZADfntIfAZ77ZGfzB6RPgDCXNVsaYzxdD7yuqvXtPVFV56jqBFWd0L17dx+E1oXkLYReoyGht89uMS+3kDfWFHHfeYOYNjjEv2/TZYRkQtYnKYZLz+jDq6sKKKuoPfmAyFhIH2cd+40JfrsBzxlCM9zbmnM9XzdXtvdcA1BZAoWf+bR27Ks9Zfzi7a84Z1Aa950/yGf3McbbQjIhA7jznGwqaup56bNdzR+QNRn2rIGaFpo1jTHBYBUwSET6i0gkTtL1TtODRGQokAx4zoezAPiGiCS7O/N/w73NtGTbh6ANMNg384+VVdby3ZfXkBIbyWPXjSE8zCZ/NV2HzxIyEXlORA6IyJct7L9RRNaLyAYRWS4iZ/gqluYM75PAOYPS+NvynVTXNdMCkZUDDXVQtMqfYRlj/EhV64B7cRKpTcA8Vf1KRH4jIpd5HHo98Kp6zCqtqoeB3+IkdauA37i3mZbkLYSYFEgf7/VLqyo//vsX7C6p5Ikbx5LaLcrr9zDGl3xZQ/Y3Wh9xtAOYpqqjcAq1OT6MpVl3TR1AcXk1b61tppWh70SQMGu2NCbIqep8VR2sqgNU9ffubb9U1Xc8jnlYVU+ao0xVn1PVge7H8/6Mu8tpqIdtH8DAC5xl6rzs2WU7WLhxPz+7eBjjs1K8fn1jfM1nCZmqLgVa/LWoqsvdQ8UBVuL0v/CrnIGpDO+dwJyl+TQ0NFlOKToReo2yjv3GGOMNu9dAxSGfNFeu2nmYP7y/mYtG9uLbOf28fn1j/KGz9CH7DvAvf99URLhrWjbbi4/x0eYDJx+QleM0WdbV+Ds0Y4wJLnkLnVaHAed59bLF5dV87+U1ZKbE8l9Xj7ZFw02XFfCETETOxUnIftrKMT6bw+dbo3qTnhTT/HJKmZOgrgr2rvPqPY0xJuTkLYCMiRDrvebE+gbl/lfXUlZZy5M3jiM+2uW1axvjbwFNyERkNPAsMFNVD7V0nC/n8IkID+M7U/rz+c7DrC0oOXFnlnudNWu2NMaY01e+D/Z+4fXFxB/7YCvLtx/id5ePZFjvBK9e2xh/C1hCJiKZOGvC3ayqWwMVB8B1Z/YlMcZ1ci1ZXBqkDbGO/cYY0xF5i5znQd7rP7Z4ywH+9NE2rpvQl2sm9D31CcZ0cr6c9mIuzpw9Q0SkSES+IyJ3i8jd7kN+CaQCT4rIOhHJ9VUspxIXFcFNZ2fy/lf72HHw2Ik7syZDwUpnhJAxxpj2y1sACenQc4RXLldUUsGDr61jWO8Efj3TO9c0JtB8Ocpylqr2VlWXqmao6l9V9WlVfdq9/w5VTVbVMe7HBF/F0ha3Tu6HKyyMZ5suOp6VA9VHYH+z06kZY4xpTV0NbF8Cgy4EL3S4r66r53svr6G+XnnqxnFEu7w/hYYxgRDwTv2dRY/4aK4cl87rq4s4eLT66x1Zk5xna7Y0xpj2K1gBNeVea678/T838UVRGf99zRn0S4vzyjWN6QwsIfNwxznZVNc18MIKj+WUEjMgKcs69htjzOnIWwjhkdB/aocv9fa63bywYhd3ntOfGSN7eSE4YzoPS8g8DOzRjQuG9eTFFTuprPHoM5aV49SQqbZ4rjHGmGZsXQD9pkBUtw5dZtuBcn72jw1MyErmJzOGeik4YzoPS8iauGtaNiUVtfx9deHXG7MmOzNMHwzoYFBjjOlaDufDobwON1ceq67j7pfWEOMK5883jMMVbv/rMsHH/qqbmJCVzNjMJJ5dtoP6xuWUbD4yY4xpv+PTXVx42pdQVf7tzQ1sLz7K47PG0isx2kvBGdO5WELWhIhw19RsCg5X8P6X+5yNKdnQrZd17DfGmPbYugBSB0LqgNO+xMufFfDWuj384ILB5AxM82JwxnQulpA148LhveiXGsucpdtRVWeodtZk2Pmp9SMzxpi2qDkGOz/pUHPl+qJSfvPuRqYP6c73zh3oxeCM6XwsIWtGeJhwxznZfFFUxmc7DjsbsyZD+R4o3dX6ycYYY2DHUqivPu3mytKKGu55aQ1p3SL532vHEBZmi4ab4GYJWQuuHp9Balzk18spHe9HtiJwQRljTFexdQFEdnNGqbdTQ4Pyw3lfcKC8iiduHEdyXKQPAjSmc7GErAXRrnBumdSPjzYfIG9/OXQfBtFJ1rHfGGNORdXp0J89HSLan0w9vXQ7H24+wM+/NZyxmcleD8+YzsgSslbcPCmLaFeYU0sWFubUklnHfmOMad2BjXCkCAZ9o92nrth+iEcWbOGS0b25ZVKWD4IzpnOyhKwVKXGRXDuhL2+t283+I1VOQnZ4O5TvC3RoxhjTeW1d4Dy3MyE7cKSK789dS7+0OP5w1WjEC2tfGtNVWEJ2CndMyaa+QXn+050e/cislswYY1qUtwh6jYKE3m0+pa6+gXvnruVYdR1P3zSeblERPgzQmM7HErJTyEyN5aJRvXn5s10cTRkBrjhLyIwxpiWVJVD4Wbunu3hk4VY+33GY/7hyFIN7xvsoOGM6L0vI2uCuqdmUV9Xxau4eyDzLEjJjjGnJ9o9A62Fw2xOyRRv38/TH27nxrEwuH5vuw+CM6bwsIWuD0RlJnJ2dwl8/2UF930lw4CuoOBzosIwxpvPZuhBiUiB9fJsOLzhUwQ/nrWNUeiK/uGS4j4MzpvOyRvo2umvqAG7/2yo+qR3CNICClTD04kCHZYwxnUdDPWxbBAMvoFaF0vJqyiprKKmopbSilpKKGsrcz6WVtZRW1PBFYRkAT944jmhXeIA/gDGBYwlZG00f0p3BPbvxyJe1TA2PQnZ9agmZMSbo1TcoRyprKa1sklBVOAlVSUXt8eSqR9kG/qfiED9Z34t5q/7V4jXDw4TkWBeJMS7Sk2K4/4LR9E2J9eOnMqbzsYSsjUSEO8/J5sevr6csczRJ1o/MGNOFqCrl1XUnJFQlFTWUVdZScszjtUeyVVpZS1llbYtL+IpAYoyLpBgXSbGRXC1raCCM1DEX82B8GslxTtKVHBtJUuzXz92iImxKC2OasISsHWaOSeeRhVtYXDmIK46+BtXlEGWjgYwx/qOqVNbWN2kC9Eyuvm4OLPWszaqspb6hhcwKiI+KINEjaeqbEkty7NfJlmdClRQbSXKsi/hoF+Gea0z+5WeQMJGfXjHJD9+EMcHFErJ2iIwI4/ac/ryxIIsrIuuh8HMYeH6gwzLGBKF5uYWs2VXiUWP1dd+rmrqGFs+LcYU7zYHupGlIr3gnoYo5OaFqfJ0Y48IV3sExXuX7YO8XcP4vO3YdY0KUJWTtdMNZmfz1o2HUE0Z4wQpLyIwxPpG78zBLthQfT5qyUmMZ0zep2YSqsfYqMcYVuI7xeYuc59NYLskYYwlZuyVEu7h84iC+/Kw/Q7cvI+q8QEdkjAlG/3X1GYEOoX3yFkBCOvQcGehIjOmSbB6y03B7Tn9W6VDC96yB2qpAh2OMMYFVVwPbl8CgC52e/saYdrOE7DT0SYpBsnKI0BqO5n8e6HCMMR0gIjNEZIuIbBORh1o45loR2SgiX4nIKx7b60Vknfvxjv+i7mQKVkBNuTVXGtMBlpCdpinnXwLAlytanmvHGNO5iUg48ARwETAcmCUiw5scMwj4GZCjqiOABzx2V6rqGPfjMn/F3enkLYTwSOg/LdCRGNNlWUJ2mob0z6LA1R/d9SlVtfWBDscYc3omAttUNV9Va4BXgZlNjrkTeEJVSwBU9YCfY+z88hZCvykQ1S3QkRjTZVlC1gGu/lMY3bCZt1fvCnQoxpjTkw4Uerwvcm/zNBgYLCKfishKEZnhsS9aRHLd2y/3dbCd0uEdcHCrNVca00GWkHVAr9HnESfVLFn6IQ2tTLhojOnSIoBBwHRgFvCMiCS592Wp6gTgBuAxERnQ3AVEZLY7ccstLi72R8z+k7fQebaEzJgOsYSsAyRrMgDpZWv5cLO1YhjTBe0G+nq8z3Bv81QEvKOqtaq6A9iKk6Chqrvdz/nAEmBsczdR1TmqOkFVJ3Tv3t27nyDQ8hZC6kBIbTYXNca0kSVkHRHfC00ZwLSorcxZuj3Q0RgT0kTkHyLyLRFpT7m2ChgkIv1FJBK4Hmg6WvItnNoxRCQNpwkzX0SSRSTKY3sOsLGDH6NrqTkGO5ZZ7ZgxXmAJWQdJ1mQmhm0hd+ch1hSUBDocY0LZkzhNh3ki8gcRGXKqE1S1DrgXWABsAuap6lci8hsRaRw1uQA4JCIbgcXAj1X1EDAMyBWRL9zb/6CqoZWQ7VgK9dWWkBnjBTZTf0dl5RC19kXGRe9jzsf5PH3z+EBHZExIUtUPgA9EJBGnr9cHIlIIPAO8pKq1LZw3H5jfZNsvPV4r8AP3w/OY5cAor36IriZvIUR2A3f3DWPM6bMaso5yF0T39N/Pgo37yC8+GuCAjAldIpIK3AbcAawF/giMAxYFMKzgpApbF0L2dIiICnQ0xnR5lpB1VFImJKQzxbUVV3gYz36yI9ARGROSRORNYBkQC1yqqpep6muq+n3AJsjytgOb4EiRNVca4yWWkHWUCGRNJnrPZ1w1tg+vry7i4NHqQEdlTCh6XFWHq+p/qOpezx3uqSmMN+UtcJ4tITPGKywh84asyXB0H3ePDqO2voEXlu8MdETGhKLhHvOD4R4F+d1ABhTUti6EXqMgoXegIzEmKFhC5g1ZOc5T+TouGNaTF1buoqKmLsBBGRNy7lTV0sY37qWO7gxgPMGrsgQKP4NB3wx0JMYEDUvIvCFtMMSmwq7l3DU1m9KKWv6eWxToqIwJNeEiIo1v3AuHRwYwnuC1/SPQemuuNMaLLCHzBnc/MnZ9yoR+KYzLTOLZT/Kpq28IdGTGhJL3gddE5HwROR+Y695mvG3rQohJgQzrmmeMt1hC5i1ZOVC6C8qKmD11AIWHK3n/q32BjsqYUPJTnAla73E/PgR+EtCIglFDA2xbBAMvgLDwQEdjTNDwWUImIs+JyAER+bKF/SIij4vINhFZLyLjfBWLXzROjLhrBRcO70n/tDjmLM3HmVPSGONrqtqgqk+p6tXux19UtT7QcQWdPWug4pA1VxrjZb6sIfsbMKOV/RfhLNA7CJgNPOXDWHyv50iISoBdnxIeJtxxTn/WF5WxMv9woCMzJiSIyCAReV1ENopIfuMj0HEFna0LQMJg4PmBjsSYoNKmhExE7heRBHet1l9FZI2ItPrzSFWXAq1lIzOBF9SxEkgSka47fjosHDLPhl3LAbhqXAapcZG26Lgx/vM8zg+7OuBc4AXgpYBGFIzyFkLGRIhNCXQkxgSVttaQfVtVjwDfAJKBm4E/dPDe6UChx/si97auK2syHNwCR4uJdoVz6+R+LN5SzNb95YGOzJhQEKOqHwKiqrtU9WHgWwGOKbiU74O962DQhYGOxJig09aErHEo+cXAi6r6lcc2nxOR2SKSKyK5xcXF/rpt+7nnI6NgBQA3n51FjCucOUut1cQYP6gWkTAgT0TuFZErsCWTvCvPvSToYJt/zBhva2tCtlpEFuIkZAtEJB7o6JwOu4G+Hu8z3NtOoqpzVHWCqk7o3r17B2/rQ73HQETM8WbL5LhIrp2QwdvrdrOvrCrAwRkT9O7HWcfyPmA8cBNwa0AjCjZ5CyG+j9Nn1hjjVW1NyL4DPAScqaoVgAu4vYP3fge4xd0v7WygrOn6c11ORKQzL8+uT49vuuOcbOoblOeX26LjxviKexLY61T1qKoWqertqnqVu3+q8Ya6Gti+2GmuFL81kBgTMtqakE0CtqhqqYjcBPwcKGvtBBGZC6wAhohIkYh8R0TuFpG73YfMB/KBbcAzQHCsOZeVA/u/hCrn6+mbEstFo3rzysoCyqtqAxycMcHJPb3FlEDHEdQKVkBNuTVXGuMjEW087ingDBE5A/gh8CzOCKZpLZ2gqrNau6A6E3R9r4337zqyJoM2QOHnxzu+3jU1m3+u38urnxdy59TsAAdoTNBaKyLvAH8HjjVuVNV/BC6kIJK3EMIjoX+Lxb4xpgPaWkNW506gZgJ/VtUngHjfhdWFZZwJYREnNFuOzkhiUnYqf/1kBzV1tpySMT4SDRwCzgMudT8uCWhEwSRvodMCEGXjJIzxhbbWkJWLyM9wprs4xz2SyeW7sLqwyFjoM+54x/5Gs6dlc/vzq3j3iz1cNT4jQMEZE7xUtaP9Wk1LDu+Ag1thwrcDHYkxQautCdl1wA0485HtE5FM4L99F1YXlzUZVjwBNRVOggZMH9ydIT3jeWZZPleOS0esU6wxXiUizwMnrVWmqpZFdFTjdBe2XJIxPtOmJktV3Qe8DCSKyCVAlaq+4NPIurKsHGiohd25xzeJCHdOzWbzvnI+3tqJ51Izput6D/in+/EhkAAcDWhEwSJvAaQMgNQBgY7EmKDV1qWTrgU+B64BrgU+E5GrfRlYl5Z5FiAnNVtedkYfeiVE20SxxviAqr7h8XgZp6yaEOi4uryaCtixzEZXGuNjbe3U/284c5Ddqqq3ABOBX/gurC4uOhF6jTqhYz9AZEQYt+f0Y/n2Q3y5u9VZQ4wxHTcI6BHoILq8HUuhvtqaK43xsbYmZGGqesDj/aF2nBuasnKgcJUzmaKHWWdl0i0qgr9YLZkxXiUi5SJypPEBvAv8NNBxdXl5C8AV5/SNNcb4TFuTqvdFZIGI3CYit+H00Zjvu7CCQNZkqKt0FuL1kBDt4oazMpm/YS+FhysCFJwxwUdV41U1weMxWFXfCHRcXZqq06F/wLkQERXoaIwJam3t1P9jYA4w2v2Yo6r2y7M1jb8mmzRbAtye0w8B/vqJLadkjLeIyBUikujxPklELg9kTF3egU1QVmjNlcb4QZubHd0dZX/gfrzpy6CCQlwapA05qWM/QO/EGC4b04fXVhVSWlHTzMnGmNPwK1U93jlTVUuBXwUwnq4vb4Hz7F51xBjjO60mZE37ZHg8yt19NExrsiZBwUpoqD9p1+yp2VTW1vPSyl0BCMyYoNRcedbWuRZNc/IWOQOUEvoEOhJjgl6rCVkzfTIaH/GqmuCvILusrByoPgL7vzpp19BeCUwb3J2/Ld9FVe3JCZsxpt1yReRRERngfjwKrA50UF1WZYnzg3KQTXdhjD/YSElfOt6P7ORmS3AWHT94tJo31+72Y1DGBK3vAzXAa8CrQBXwvYBG1JVt/wi03vqPGeMnlpD5UmIGJGU227EfYNKAVEamJ/DMsnwaGk5a8cUY0w6qekxVH1LVCap6pqr+P1U9Fui4uqy8RRCTAhk2t64x/mAJma9l5Tg1ZHpywiUizJ46gPziY3ywaX8AgjMmeIjIIhFJ8nifLCIL2nDeDBHZIiLbROShFo65VkQ2ishXIvKKx/ZbRSTP/bjVO5+kE2hocBKygRdAWHigozEmJFhC5mtZk6HiIBzMa3b3xSN7kZEcY8spGdNxae6RlQCoagmnmKlfRMKBJ4CLgOHALBEZ3uSYQcDPgBxVHQE84N6egjOK8yyc1Ut+JSLJ3vs4AbRnjVNuWXOlMX5jCZmvZeU4zy00W0aEh/GdKf3J3VXC6l0lfgzMmKDTICKZjW9EpB9wqr4AE4FtqpqvqjU4fc9mNjnmTuAJd4KHx6ol3wQWqeph975FwIwOf4rOIG8hSBgMPD/QkRgTMiwh87WUbOjWs8WO/QDXTuhLYoyLOUu3+zEwY4LOvwGfiMiLIvIS8DFOzVZr0oFCj/dF7m2eBgODReRTEVkpIjPacW7XtHUBZJwJsSmBjsSYkGEJma+JOM2Wuz5tth8ZQFxUBLdMymLhxv3kFx/1c4DGBAdVfR+YAGwB5gI/BCq9cOkInIXKpwOzgGc8+6q1hYjMFpFcEcktLi72Qkg+VL7PWfLNmiuN8StLyPwhKweO7IbSghYPuWVSP1zhYTyzzJZTMuZ0iMgdwIc4idiPgBeBh09x2m6gr8f7DPc2T0XAO6paq6o7gK04CVpbzgVAVee4R39O6N69e9s+UKBs+8B5HmzzjxnjT5aQ+cMp5iMD6B4fxVXjMnhjTRHF5dV+CsyYoHI/cCawS1XPBcYCpa2fwipgkIj0F5FI4HrgnSbHvIVTO4aIpOE0YeYDC4BvuEdzJgPfcG/r2rYugPg+0HNkoCMxJqRYQuYP3YdBdFKLHfsb3XlOf2rrG3hhxU6/hGVMkKlS1SoAEYlS1c3AkNZOUNU64F6cRGoTME9VvxKR34jIZe7DFgCHRGQjsBj4saoeUtXDwG9xkrpVwG/c27qu+lrYvthZu1Ik0NEYE1JsnTd/CAtz9yNruYYMILt7Ny4c1pMXV+7inukDiI20/zzGtEORu2/XW8AiESkBTrlYrKrOB+Y32fZLj9cK/MD9aHruc8BzHYy78yhYATXl1lxpTABYDZm/ZE6Cw9uhvPUJYO+alk1pRS3zVhW2epwx5kSqeoWqlqrqw8AvgL8Clwc2qi5m6wIIj4T+0wIdiTEhxxIyf2mcj6yg9Vqy8VkpjM9K5tlPdlBX3+CHwIwJPqr6saq+455bzLRV3iKnrIrqFuhIjAk5lpD5S+/R4Io7ZbMlwOyp2RSVVPKvL/f5ITBjjAFKdsLBLdZcaUyAWELmL+Eu6DuxTQnZhcN6kp0Wx5yl+WgLc5cZY4xXbV3oPNv8Y8YEhCVk/pSVA/u/gorWB2KFhQl3nJPNht1lrMg/5KfgjDEhLW8hpAyA1AGBjsSYkGQJmT9lTQYUCj875aFXjksnrVukLTpujPG9mgrYucyaK40JIEvI/Cl9vDOC6RTzkQFEu8K5dVI/lmwpZsu+cj8EZ4wJWTuWQl2VM/+YMSYgLCHzJ1c0pE9oUz8ygJvOziLGFW61ZMYY38pb6Aw6ahwNbozxO0vI/C1rMuxZB9WnXkQ8OS6S687syztf7GZfWZUfgjPGhBxVJyEbcC5ERAU6GmNCliVk/pY1GbQeij5v0+HfmdKf+gbl+U9t0XFjjA8c2ARlhdZcaUyAWULmb30ngoS3udmyb0osF4/qzSufFVBeVevj4IwxISfPprswpjOwhMzfouKh9xltTsgA7po6gPLqOuZ+XuDDwIwxISlvIfQaBQl9Ah2JMSHNErJAyJoMRblQ27Z+YaMyEpmUncpzn+ykps6WUzLGeEllCRSstNoxYzoBS8gCIWsy1FfDnjVtPmX2tGz2HaninS/2+DAwY0xI2b7Y6dM6yOYfMybQLCELhMxJznMb5iNrNH1wd4b0jOcZW07JGOMteQshJhkyJgQ6EmNCniVkgRCbAj2Gw64VbT5FRJg9NZst+8tZsrXYh8EZY0JCQwPkLYKBF0BYeKCjMSbkWUIWKFmTnSWU6uvafMqlZ/ShV0I0cz62iWKNMR20Zy1UHLTmSmM6CUvIAiVrMtQchX3r23xKZEQY357SjxX5h9hQVObD4IwxQS9vAUgYDDw/0JEYY7CELHAyJzvP7Zj+AmDWxEzioyL4y9LtPgjKGBMy8hZCxplOFwpjTMD5NCETkRkiskVEtonIQ83szxSRxSKyVkTWi8jFvoynU0noDSnZ7U7I4qNd3HBWJvM37KXwcIWPgjPGBLXy/U6TpU13YUyn4bOETETCgSeAi4DhwCwRGd7ksJ8D81R1LHA98KSv4umUsiZDwXKnc2073J7Tn/Aw4a+f2HJKxpjTsG2R82wJmTGdhi9ryCYC21Q1X1VrgFeBmU2OUSDB/ToRCK1JtrJynIkZize367ReidFcdkY6r60qpORYjY+CM8YErbyFEN/HmaHfGNMp+DIhSwcKPd4Xubd5ehi4SUSKgPnA930YT+eT1diPrO3zkTWaPTWbytp6Xlq5y8tBGWOCWn2tMyHsoAtBJNDRGGPcAt2pfxbwN1XNAC4GXhSRk2ISkdkikisiucXFQTQHV1IWJKS3ux8ZwJBe8Uwf0p3/W7GTqtp678dmjAlOBSug+og1VxrTyfgyIdsN9PV4n+He5uk7wDwAVV0BRANpTS+kqnNUdYKqTujevbuPwg0AEaeWbNdyOI3Z92dPzebg0Rr+sabp12qMMS3IWwjhkZA9PdCRGGM8+DIhWwUMEpH+IhKJ02n/nSbHFADnA4jIMJyELIiqwNogazIc3QeH2z/Z66TsVEalJ/Lssnzq6m3RcWNMG2xd6PRfjeoW6EiMMR58lpCpah1wL7AA2IQzmvIrEfmNiFzmPuyHwJ0i8gUwF7hNQ22hxtOcjwyc5ZTuPW8g+QeP8Z/vt29ggDEmBJXshINbrLnSmE4owpcXV9X5OJ31Pbf90uP1RiDHlzF0et2HQGyqk5CNu7ndp39zRC9unZTFM8t2MLRXAleNz/BBkMaYoJDnnu5isC2XZExnE+hO/UYEMic585Gdpp9fMpxJ2an87M0NrCss9WJwxpigsnUBpAyA1AGBjsQY04QlZJ1BVo7TlFB2ep3zXeFhPHnjOHomRDH7hVz2H6nybnzGmK6vpgJ2LrPmSmM6KUvIOoPG+cgKVpz2JZLjInnmlgkcra7jrhdX21QYxpgT7VwGdVUw2BIyYzojS8g6g16jIDL+tCaI9TS0VwKPXjuGdYWl/NubXxJq4yOMMa3YugBccU6NvDGm07GErDMIC4fMs09rpGVTM0b24oELBvHGmiJb69KYNhCRGSKyRUS2ichDzey/TUSKRWSd+3GHx756j+1Np/XpPFSd+ceyp0NEVKCjMcY0wxKyziJrsrOm5bGDHb7UfecN4qKRvfj3+ZtYlhda07oZ0x4iEg48AVwEDAdmicjwZg59TVXHuB/Pemyv9Nh+WTPndQ7Fm6Gs0JorjenELCHrLBqbETrQj6xRWJjwyDVnMLhnPPe+spadB491+JrGBKmJwDZVzVfVGuBVYGaAY/K+rQucZ+vQb0ynZQlZZ9FnLEREe6XZEiAuKoJnbplAmMAdL+RSXlXrlesaE2TSgUKP90XubU1dJSLrReR1EfFcEi7avc7uShG5vKWbBHw93ryF0HMUJPTx/72NMW1iCWBNwQEAABvkSURBVFlnEREJGWd2uGO/p74psTxx4zh2HDzGg6+to6HBOvkbcxreBfqp6mhgEfB/HvuyVHUCcAPwmIg0O8FXQNfjrSyFgpXWXGlMJ2cJWWeSlQP7NkBVmdcuOXlAGr+6dDgfbDrAo4u2eu26xgSJ3YBnjVeGe9tx/7+9Ow+TqrrzP/7+Vnf1Sjc00GwNNLuCsjeg3RoNUUZjVH7qT8UF9RnFRB10Mk4ivzFx1ImPY2YybiSKxkRccYlGjQ5NFDeisoOydkPYkR2aht77/P641VCNKFtX3Vo+r+epp6puLfd7tTn96XPOPdc5t8M5VxN6+jQwPOy1jaH71cCHwNBIFntcVn0ArgH6anV+kVimQBZLCovBNcL62S36tdeeVsi4kd14fGY57yze1KLfLRLn5gB9zaynmaUBVwLNzpY0s85hTy/CuzYvZpZnZumhx+3xLgO3NCpVH4uyGZCZB12L/K5ERL6DAlks6ToCAqktOmwJ3kXI773oVIoK87jz1UV8tbHleuBE4plzrh64DZiOF7Recc4tMbP7zKzprMmJZrbEzBYBE4HrQ9v7A3ND22cCD4auzxs7GhuhfAb0OcdbXkdEYlZELy4uxygty5vc30IT+5t9dWqA310znIsf/5QJU+fy1j+dQftWWo9IxDn3LvDuIdt+GfZ4EjDpMJ/7GzAw4gWeiE0LYN82DVeKxAH1kMWawmLYOB/qqlr8q/Nz0pkyvoid+2u55fn51NY3tvg+RCSGlJWCBaDPD/yuRESOQIEs1hSWQGMdbJgbka8/taA1D102mNlrdvLvby+JyD5EJEaUTfemQmS19bsSETkCBbJY020UYBEZtmxy0eAu/OTs3rz4xTqe+3xtxPYjIj7au8UbstRisCJxQYEs1mS2gU6ntvjE/kPdOeYkRp/cgXvfWsLnq3dEdF8i4oPyv3r3CmQicUGBLBYVlnhLX9TXRmwXKQHj4SuHUNgui1temM/6nfsjti8R8UHZdMjpAp1i+7wDEfEokMWiwmKor4LNiyK6m9yMIE9fN4L6hkZumjqX/bX1Ed2fiERJQx2smgl9zwUzv6sRkaOgQBaLuhd79xEetgTo2T6bx64axsote7nz1UU4p8sricS9dZ9DTYWGK0XiiAJZLGqVD+37RXRif7iz+uUz6fz+vPvl1zz2QXlU9ikiEVQ2HQJB6HW235WIyFFSIItVhcXeX7mNDVHZ3Y1n9uSSoQX8ZsZKSpd8HZV9ikiErCyFHiWQ3srvSkTkKCmQxarCEqjZA1uis1aYmfHAJQMZ3K0N/zxtISu+3huV/YpIC9u1Brav0Or8InFGgSxWFTbNI4vOsCVARjCFKdcOJzs9lZumzmXXvsid5SkiEVI2w7vvp0AmEk8UyGJV667QuntUJvaH65ibwRPXDufrPdXc9tJ86ht0eSWRuLJyOrTtBe16+12JiBwDBbJYVljs9ZBF+czHYd3zeOCSgcwq38Gv3l0W1X2LyAmo3Q9rPtFwpUgcUiCLZYXFsH87bC+L+q4vG96VfzyjJ3+YtYZX5q6P+v5F5Dis+QTqq6GflrsQiTcKZLGssMS7Xxe9eWThJp1/Mmf2bc/db3zFvLW7fKlBRI5BWSkEsw+2HSISNxTIYlm73pDdIaoT+8OlpgR4bNxQOrfJ4Obn5rF5T5UvdUiCqd0PK97zu4rE45y33EWvsyE13e9qROQYKZDFMrOD88h80iYrjafHF1Fd18CEqfOorovOumiSgOprYfZT8OgQeGkc7Frrd0WJZdty2LNOw5UicUqBLNYVlsCe9bB7nW8l9O2Yw8NXDOGrTXu46/XFurySHJvGBlg0DSaPgHfv9M4AvOE9yCv0u7LEUlbq3fc51986ROS4KJDFOh/WIzuccwZ05M4xJ/Hmwk1M+Xi1r7VInHDOG5p84gx4YwKk5cBVr3phrPB0v6tLPCtLoeNAaF3gdyUichwUyGJdhwGQ0Trq65Edzi1n9+aCQZ158H+XM3PFVr/LkVi25lP4/Rh46UrvrL9Lfw83f+wNp5n5XV3iqdoN6z7TcKVIHFMgi3WBAHT3dx5ZEzPj15cNon+nXCa+tIBV2yr9LklizaaF8Nwl8McLvKH2Hz0Mt86GgZd5P8sSGatngmuAvgpkIvFKLWQ8KCyGHeWwd4vflZCVlspT1xWRlhLgpmfnsqeqzu+SJBZsL4NXroMpZ8Gm+XDu/TBxARTdAClBv6tLfCtLITMPuo7wuxIROU4KZPHA5/XIDlXQJpPfXTOcdTv3c/vLC2ho1CT/pLVnA/z5Npg8yruG4vd+BrcvgpKJEMz0u7rk0NgI5TOgzzkQSPG7GhE5Tgpk8aDzIAhmxcSwZZORPdty78Wn8OGKbTw0fbnf5Ui07dsO//v/4NFhsHgajJzgBbHR/+bNeZTo2bwA9m3TcKVInEv1uwA5CilB6DYypgIZwNWjClm2uYInP1pN/065jB2qs7sSXnUFfDYZPnsc6vbD4Kvg7J9Dm+5+V5a8VpaCBbweMhGJWwpk8aKwBGY+APt3QlZbv6s54J4LT6FsSyU/f30xvfKzGdS1jd8lSSTUVcOcp+GT/4aqndD/Qhj9C8g/ye/KpGy6N3cshtoFETl2GrKMF4XFgIP1X/hdSTPBlAC/vXoY7VulM2HqPLburfa7JGlJDfUw71l4bBiU/ht0Hgw3fQBXPK8wFgsqt8KmBdBXi8GKxDsFsnhRMBxS0mJu2BKgXat0nhpfxJ6qOn783Dxq6nV5pbjX2Ahf/Ql+Owrengg5nWD8WzD+Te9nUWJD2Qzvvu8/+FuHiJywiAYyMzvPzFaYWbmZ3fUt77nczJaa2RIzezGS9cS1YKb3izAGAxnAgC65/Pflg5m/bje/ePMrXV4pXjkHZX/1lq947QYIpMIVL8CN70Ovs/yuTg5VNh1yOkOngX5XIiInKGJzyMwsBZgMnAtsAOaY2VvOuaVh7+kLTAJKnHO7zKxDpOpJCIXFMOsRqKmE9FZ+V/MNPxzYmYmj+/DoB+UM6JzL9SU9/S5JjsW6L+D9e72rQrTpDmOfgEGXaymFWNVQB6tmwiljdfUDkQQQyR6ykUC5c261c64WeBm4+JD33ARMds7tAnDO6Xo836WwGBrrYcMcvyv5Vnec048xAzpy/1+WMat8u9/lyNHYsgRevBKeGeMt8Hr+r+G2uTBknMJYLFv3OdRUaLhSJEFEMpAVAOvDnm8IbQvXD+hnZrPM7HMzOy+C9cS/bqO809tjdNgSIBAwfnPFEHrnZ3Pri/NZt2O/3yXJt9m5Gl6/CX5X4v1Mjf4F3L4QRk2A1HS/q4uaI02tMLPrzWybmS0M3W4Me+06MysL3a6LauFl0yEQhF5nR3W3IhIZfk/qTwX6AmcD44CnzOwb6yaY2QQzm2tmc7dt2xblEmNIeo53llsMBzKAVumpPDW+CIAbp86hsqbe54qkmb1fwzs/hcdHwLK3oeR2L4h9705Iy/a7uqgKm1pxPjAAGGdmAw7z1mnOuSGh29Ohz7YF7gFG4Y0I3GNmeVEq3ZvQ36MkJqcviMixi2Qg2wh0C3veNbQt3AbgLedcnXPu78BKvIDWjHNuinOuyDlXlJ+fH7GC40JhiTdkWV/jdyXfqbBdNpOvGsaqbfv46bSFNOrySv6r2gUz7oFHhsD8Z2HYdd71Js+9N5nXsDqaqRXf5h+AGc65naFpFzOA6PTy71oL25ZruFIkgUQykM0B+ppZTzNLA64E3jrkPW/i9Y5hZu3xhjBXR7Cm+FdYDA01sHG+35UcUUmf9tx9QX9Kl27h4ffL/C4nedXug4//Cx4e7J0U0v9CuG0O/Og3kNvZ7+r8djRTKwAuNbPFZvaamTX9oXm0n215ZaXevS6XJJIwInaWpXOu3sxuA6YDKcAzzrklZnYfMNc591botTFmthRoAP7VObcjUjUlhO6ne/drZ0Hh6f7WchSuL+7Bss0VPPp+Gf075XD+wKQPANFTXwvz/ggf/xr2bYV+58Pou6HTqX5XFm/eBl5yztWY2c3As8DoY/kCM5sATADo3r0FLjNVVgpte0H7Pif+XSISEyJ66STn3LvAu4ds+2XYYwf8NHSTo5HVFvL7x/w8siZmxv1jT6V8ayU/fWURhe2yGdAl1++yEltjAyx+BT58AHav84a5r3geuo/yu7JYdMSpFYf8kfg08FDYZ88+5LMfHm4nzrkpwBSAoqKiExu/r90Pf/8Yht9wQl8jIrHF70n9cjwKi71LKDXEx2T59NQUnrh2OK0zg9w0dS4799X6XVJicg6WveOdNfnmjyGjDVz9Olz/F4Wxb3fEqRVmFt6texGwLPS4qYc/LzSZf0xoW2St+RTqq3W5JJEEo0AWjwqLobYSvl7sdyVHrUNOBlPGD2d7ZQ23vDCPuoZGv0tKLKs/gqfPgWlXQ2MdXPYHmPAR9D1Hi4Z+B+dcPdA0tWIZ8ErT1Aozuyj0tomhK4ksAiYC14c+uxO4Hy/UzQHuC22LrLLpEMyGHmdEfFciEj0RHbKUCCks9u7X/g0KhvlbyzEY1LUN/3npIO6YtpD73l7K/WM1l+mEbZwH798Hqz+E3AK48FEYcjWk6J/20TqKqRWT8K4ocrjPPgM8E9ECm+8QVpZ6a48l0VpxIslArXY8yu0CeT1h3WdQfJvf1RyTsUMLWLa5gic/Xk3/zrlcNaoFJjgno20r4IP/gGVvQWZbGPMrGHEjBDP8rkwiadsK2LMOztS0W5FEo0AWrwpLYMW70NgIgfgaef7ZeSezYstefvnnr+jToRUjeybtGljHbvd6+PBBWPQiBLPgrLvg9FshQydKJIWy0BQ1LXchknDi6ze5HFRYDFU7YfsKvys5ZikB45Erh9K9XRY/eX4eG3dX+V1S7KvcBu/dBY8Ngy9fhVE/gdsXwfcnKYwlk5Wl0HEgtI7OcmciEj0KZPHqwDyyWf7WcZxaZwZ5anwRtQ2NTJg6l6raBr9Lik3Ve+CDX8Ejg2H2kzDoCpg4H857ALLb+12dRFP1Hm+ags6uFElICmTxKq8H5HSJm/XIDqd3fiseHTeUpZsr+NfXFuEtSycA1FXBrEe9IPbxQ94v4Vtnw8WPQ+uuflcnflj1AbgG6KfLJYkkIs0hi1dmXi/Z2lnemVdxurTB90/qwM/PO5kH31tO/8653Pr9JF95vKEOFjwPHz0EezdB79Hwg19Cl6F+VyZ+W1kKmXnQdYTflYhIBCiQxbPCYvjqNdj1d+8yKnHq5u/1YvnmCv6rdAUndczhnAEd/S4peuprYctX3vIVG+fDmk9gz3rvl+4lU6DnmX5XKLGgsRHKZ0DvH0Agxe9qRCQCFMjiWWGJd7/2b3EdyMyMBy8dxOrt+7hj2kLeuKWYvh1z/C6r5TkHO1d7wWvjPNg4FzYv9i4WD5DVHroWwfkPwUnnx22vp0TA5gWwb5uGK0USmAJZPMs/CbLaeYFs6DV+V3NCMoIpPHntcC58bBY3TZ3Ln289g9ZZQb/LOjH7doSCVyh8bZwHVbu811IzocsQGHkTFAz3bm26K4TJ4a0sBQz6nON3JSISIQpk8cwMup/uXdsujueRNencOpMnrx3GuClfcNtL8/nD9SNITYmT807qqrzervDwtWtN6EWDDv3h5AugoMgLXx36Q0qcB06JnrJSbxg7S2v2iSQqBbJ4V1gCy9+B/+wB7fpAu94H79v29u7T42f4b3hhW/5j7Kn87PXFPPjecu7+0QC/S/qmxkbYvrJ5+NqyBBpDF3vPLfAuaTX8Bi98dRkSV/8PJMZUboVN82H03X5XIiIRpEAW74aNBwt4AWFHOayZBYunNX9Pq06hoBYKa22b7nvG5PXwLh/RjaWbK3j607/Tv3Mulw73eZmHis3Nw9fGBVC713stLQcKhkLxxINDj7md/a1XEkvZDO++r+aPiSQyBbJ4l94KTvtx8221+70zL3eUw45VoVs5rHjPmxjcxALemlbt+jQPau16e/OZfDyb6+4L+rNyy14mvfElvfKzGdo9Lzo7rtkLmxaGha/5ULHRey2QCh1PgUGXHwxf7fvF3aWrJM6UlUJOZ+g00O9KRCSCFMgSUVqWFxw6nvLN16p2w85VsGN1KLCVe88XvQw1FQffFwh6PWjt+nhncDaFtna9vV8OEZ6vlpoSYPJVw7h48ixufm4eb//TGXTMbeELZzfUw9alYb1f82HbcnCN3ut5Pbw5egXDvbMfOw2EYGbL1iDyXRrqvAVhTxkb93NEReS7KZAlm8w2B3t3wjnn9Z419aYdCGurofz9g0szAASzoV2vsB61sLDWgpOO87LTeGp8EZf8dhYTnpvHtAmnkRE8zl4752D3urCzHud5PWH1oetoZuZ5E+77X+SFry7DILtdix2LyHFZ/4X3h5KGK0USngKZeMygVQfvVnh689caG6FiQ1hYW+X1qn29GJa97V3OpUlm3jeHP5tOMEhvdcxlndQph/+5YggTnpvHDx/5hIK8THIyUsnNCB64z80MNt+WGaS17aP1ri/J3LKAwKbQul9Nw7Up6dB5MAy/PtT7NRzyeqoHogXV1DdQWV1PZU09e6vr2VfjPW56XllTz41n9Iyfs2j9snK611vd6yy/KxGRCFMgkyMLBLw5ZW26Q+/vN3+tvtbreQof/txR7q04v/jl5u/N6XzwzM/wM0LzenznyQVjTunEQ5cN4i+LN1NRXcfmPdVUVNWxt7qeqroG0qijv61lSGAVgwOryLdyugS+PvD5VRSwInAqqzJPZkP2AHa36kt2Zia5dUFyvk4ldzfkZq4nJyPYLNTlZqSSkxEkLTU5QoNzjqo6L0jtralvFqgqa+qprK7znoe9duh7m7bVNjQecX/jRnSndVZy/Lc9bmWl0KNEZ+mKJAEFMjkxqWnQvo93O1Ttfm/I80BQC4W15X+B/dsPvs8C0Lpb86HPprDWuhsEUri8qBuXF3Xzeut2rj4w6b5xwzxsy5dYQ623y4x8duUNYnHu5WzIGsDqYD+212dQUV1HRVU9e6vrqNhTz94tO71QV1PPka5pnhEMhMJaaqg37mBYy80M9dIdeK2pp+7ga1lpKVgEe98aGl2zMFRZUxcWopqHqn2HCVTe617YajyK67unpwbIyUilVXoqrUL3XdpkhD0PHnw9tC0n7L3e8yAZQYWx77RrrTencdh1flciIlGgQCaRk5YFnU71boeq2nXwxIKdYfPW1s8+uKQEQEqaN5zYro8332vjPKje470WzCbQZSiM+rE376tgOGm5BXQ0oyMw6ChKbGx07Kutp6I6FNaaQluzxwdfq6iuY09VHRt27qeiup6Kqroj9galBIycjNSDQ6xhvXCHDrvmpKdS29D4LYGq7rC9UvtrG75z/02y01LCQlGQnPRU8lulH9h2aMjKCYWr8Ney01OTpsfQd2Wl3n3fMf7WISJRoUAm/sjM8+ZudT3MyQWVWw8JaqH7QBAGjD0Qvsg/+YSX5ggEjJxQjxYc3xmU1XUN7K32wtreUEgLf9z0WvjjdTv3h97nhapvrc8gJ+NgKMpOT6VNVhpd22Z5vU6HC1CHCVjZaamkBDRHLq6UzfDOcD5c77OIJBwFMoktZpDT0bv1KPG7mqOSEUwhI5hCfs7xLbLb0OioDAt0GcFAs2G9SA53Sgz7P0948zNFJCkokIn4LCVgtM4Kxv/F1KVlZbXVtStFkogmg4iIiIj4TIFMRERExGcKZCIiIiI+UyATERER8ZkCmYiIiIjPFMhEREREfKZAJiIiIuIzBTIRERERnymQiYiIiPhMgUxERETEZ+ac87uGY2Jm24C1x/CR9sD2CJUTK5LhGEHHmUiO9RgLnXP5kSommo6xDUuGnwVIjuNMhmMEHefhHFX7FXeB7FiZ2VznXJHfdURSMhwj6DgTSTIcY0tIlv9OyXCcyXCMoOM8ERqyFBEREfGZApmIiIiIz5IhkE3xu4AoSIZjBB1nIkmGY2wJyfLfKRmOMxmOEXScxy3h55CJiIiIxLpk6CETERERiWkJG8jM7DwzW2Fm5WZ2l9/1RIKZPWNmW83sK79riSQz62ZmM81sqZktMbPb/a6ppZlZhpnNNrNFoWO81++aIsnMUsxsgZm943ctsUptWGJIhvYLkqsNi1T7lZCBzMxSgMnA+cAAYJyZDfC3qoj4I3Ce30VEQT3wL865AcBpwK0J+P+zBhjtnBsMDAHOM7PTfK4pkm4HlvldRKxSG5ZQkqH9guRqwyLSfiVkIANGAuXOudXOuVrgZeBin2tqcc65j4GdftcRac65zc65+aHHe/H+IRT4W1XLcp7K0NNg6JaQEzzNrCtwAfC037XEMLVhCSIZ2i9InjYsku1XogayAmB92PMNJOA/gGRkZj2AocAX/lbS8kLd4AuBrcAM51zCHWPIw8DPgEa/C4lhasMSUCK3X5A0bVjE2q9EDWSSgMysFfA6cIdzrsLvelqac67BOTcE6AqMNLNT/a6ppZnZj4Ctzrl5ftciEk2J3n5B4rdhkW6/EjWQbQS6hT3vGtomccrMgniN2QvOuT/5XU8kOed2AzNJzLk1JcBFZrYGbxhutJk9729JMUltWAJJpvYLEroNi2j7laiBbA7Q18x6mlkacCXwls81yXEyMwN+Dyxzzv3G73oiwczyzaxN6HEmcC6w3N+qWp5zbpJzrqtzrgfev8sPnHPX+FxWLFIbliCSof2C5GjDIt1+JWQgc87VA7cB0/EmUL7inFvib1Utz8xeAj4DTjKzDWb2j37XFCElwLV4f40sDN1+6HdRLawzMNPMFuP9Mp7hnNOSEElKbVhCSYb2C9SGnTCt1C8iIiLis4TsIRMRERGJJwpkIiIiIj5TIBMRERHxmQKZiIiIiM8UyERERER8pkAmCcPMzjYznWYtInFJbVhyUyATERER8ZkCmUSdmV1jZrNDCyQ+GbogbaWZ/Y+ZLTGz980sP/TeIWb2uZktNrM3zCwvtL2Pmf3VzBaZ2Xwz6x36+lZm9pqZLTezF0KrZIuItBi1YRIJCmQSVWbWH7gCKAldhLYBuBrIBuY6504BPgLuCX1kKvBz59wg4Muw7S8Ak51zg4FiYHNo+1DgDmAA0AtvlWwRkRahNkwiJdXvAiTp/AAYDswJ/eGXCWwFGoFpofc8D/zJzFoDbZxzH4W2Pwu8amY5QIFz7g0A51w1QOj7ZjvnNoSeLwR6AJ9G/rBEJEmoDZOIUCCTaDPgWefcpGYbzX5xyPuO95peNWGPG9DPuIi0LLVhEhEaspRoex+4zMw6AJhZWzMrxPtZvCz0nquAT51ze4BdZnZmaPu1wEfOub3ABjMbG/qOdDPLiupRiEiyUhsmEaHkLVHlnFtqZncDpWYWAOqAW4F9wMjQa1vx5mgAXAc8EWqsVgM3hLZfCzxpZveFvuP/RvEwRCRJqQ2TSDHnjrdXVaTlmFmlc66V33WIiBwPtWFyojRkKSIiIuIz9ZCJiIiI+Ew9ZCIiIiI+UyATERER8ZkCmYiIiIjPFMhEREREfKZAJiIiIuIzBTIRERERn/1/0e5eQKNkE8QAAAAASUVORK5CYII=\n",
"text/plain": [
"<Figure size 720x360 with 2 Axes>"
]
},
"metadata": {
"needs_background": "light"
},
"output_type": "display_data"
}
],
"source": [
"def plot_curves(history, metrics):\n",
" nrows = 1\n",
" ncols = 2\n",
" fig = plt.figure(figsize=(10, 5))\n",
"\n",
" for idx, key in enumerate(metrics): \n",
" ax = fig.add_subplot(nrows, ncols, idx+1)\n",
" plt.plot(history.history[key])\n",
" plt.plot(history.history['val_{}'.format(key)])\n",
" plt.title('model {}'.format(key))\n",
" plt.ylabel(key)\n",
" plt.xlabel('epoch')\n",
" plt.legend(['train', 'validation'], loc='upper left'); \n",
" \n",
" \n",
"\n",
"plot_curves(history, ['loss', 'accuracy'])"
]
},
{
"cell_type": "markdown",
"metadata": {
"colab_type": "text",
"id": "3bdfbq20V6zu"
},
"source": [
"You can see that accuracy is at 77% for both the training and validation data, while loss bottoms out at about .477 after four epochs.\n",
"\n",
"Key point: You will typically see best results with deep learning with much larger and more complex datasets. When working with a small dataset like this one, we recommend using a decision tree or random forest as a strong baseline. The goal of this tutorial is not to train an accurate model, but to demonstrate the mechanics of working with structured data, so you have code to use as a starting point when working with your own datasets in the future."
]
},
{
"cell_type": "markdown",
"metadata": {
"colab_type": "text",
"id": "SotnhVWuHQCw"
},
"source": [
"## Next steps\n",
"The best way to learn more about classifying structured data is to try it yourself. We suggest finding another dataset to work with, and training a model to classify it using code similar to the above. To improve accuracy, think carefully about which features to include in your model, and how they should be represented."
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"Copyright 2020 Google Inc.\n",
"Licensed under the Apache License, Version 2.0 (the \"License\"); you may not use this file except in compliance with the License. You may obtain a copy of the License at\n",
"http://www.apache.org/licenses/LICENSE-2.0\n",
"Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an \"AS IS\" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License."
]
}
],
"metadata": {
"colab": {
"collapsed_sections": [],
"name": "feature_columns.ipynb",
"private_outputs": true,
"provenance": [],
"toc_visible": true
},
"kernelspec": {
"display_name": "Python 3",
"language": "python",
"name": "python3"
},
"language_info": {
"codemirror_mode": {
"name": "ipython",
"version": 3
},
"file_extension": ".py",
"mimetype": "text/x-python",
"name": "python",
"nbconvert_exporter": "python",
"pygments_lexer": "ipython3",
"version": "3.5.3"
}
},
"nbformat": 4,
"nbformat_minor": 4
}
| null | minipile | NaturalLanguage | mit | null |
Euro Zone Faces Capital Flight: Currency Strategists
The euro zone crisis has entered its third phase, that of a flight of capital, and this will push the euro much lower, foreign exchange strategists from Nomura wrote in a market note.
The euro rallied on Monday in Asian trade after the announcement of a bailout available for Spanish banks, but quickly lost steam as market worries return to the euro zone's weaknesses, with a crucial Greek election due on June 17 and Cyprus hinting at its need for a bailout.
The first phase of the euro zone crisis took place between April 2010 and June 2011, when foreign investors pulled back on buying bonds from the area's periphery countries, the Nomura analysts wrote.
"The general trend was one of substitution from the periphery, into the core," they explained.
The second phase started in July 2011 when tensions spread to Italy and Spain, and this "shock to confidence" was followed by a "sharp change" in investor flows, according to the strategists, who said that foreign private investors started cutting exposure not just to Italy and Spain but also to Belgium, France and even Germany.
"This is clear especially from Japanese flow data, which is high quality and an important component of the overall inflow picture," they wrote.
However, they said, there was an offset from euro zone investor behavior during this second phase, as stock market investors in particular repatriated "sizeable amounts of money" to the single currency area. During the bear market in the second half of last year, repatriations of stock market investments exceeded 100 billion euros ($125 billion), according to the Nomura analysts.
The repatriation was not enough to offset the decrease in inflows fully, they explained.
"But it meant that the net deterioration was much less pronounced than inflow dynamics alone would have suggested, and it played a role in containing euro weakness to be more moderate than many had expected," the strategists added.
Pushing Money Abroad
The third phase of the crisis shows a new element: domestic investors in the euro zone starting to "push more money abroad," in a dynamic like the ones in traditional emerging market currency crises, they said.
There are four elements pointing to the start of a capital flight to foreign assets, according to the Nomura analysts.
First, the balance of payments data from the European Central Bank showed outsized foreign fixed income buying by euro zone investors in March, they said.
"This is the third consecutive month of significant foreign bond buying; moreover, euro zone investors also started to invest large amounts in foreign short-dated debt," the strategists added.
Second, there has been a structural break in weekly mutual funds trends in recent months, with data showing unusually strong buying of foreign bonds, especially U.S. and emerging markets bonds, in April, May and June, according to the analysts.
"This is a departure from previous trends, which typically showed repatriation of foreign fixed income assets in bear markets for risky assets," they wrote.
Third, there has been evidence that the Swiss and the Danish national banks intervened "aggressively" last month to fend off strong foreign inflows, while demand for Swedish debt has increased notably, according to the strategists.
"Fourth, the idea of capital flight into non-euro zone markets from euro zone investors fits with the price action in global sovereign bond markets," they wrote, adding that Danish bond yields have seen the largest yield compression and that German, Finnish and UK bonds also stand out for their low yields.
The Nomura strategists, however, pointed out that there was little tangible evidence that euro zone flows went into U.S. Treasurys or that euro zone investors had become meaningful buyers of Japanese bonds. But, they added, capital flow data come with a lag, while leading indicators point to the beginning of a capital flight.
If this dynamic continues, it opens the door to "much more pronounced euro weakness" and investors should watch policy actions over the next three to four months as they will be crucial, they said. | null | minipile | NaturalLanguage | mit | null |
Illuminated keyboard aims to solve the problem of users of unable to clearly distinguish notations and characters on the keycaps in a dark environment. To improve illumination characteristic of the illuminated keyboard, light transmission architecture and keycap structure are two main issues that have to be seriously focused. Compared with the more complex light transmission architecture, keycap is simpler in structure. The keycap mainly includes a press surface and a plurality of inclined surfaces extended from the press surface. Hence through a simple improvement a great effect can be accomplished.
Many prior techniques concerning improvement of the keycap focused on light emission structure of the press surface. For instance, Taiwan publication No. 200745915 proposes an opaque keycap with a transparent character notation formed thereon to highlight the character notation. U.S. Pat. No. 7,847,204 discloses a keycap with four different transparent colored layers respectively at four corners of the press surface. Taiwan utility model No. M419150 discloses a keycap having a press surface with a transparent portion to allow light to transmit. They all have the disadvantage of occupying too much area on the keyboard by the press surface of the keycap. With the light concentrating on the press surface for emission the entire keyboard is illuminated that makes distinguishing individual keycaps difficult.
There are other types of keycap structures that do not emit light through the press surface, such as Taiwan patent No. I283421. It discloses a backlit key assembly which includes an opaque key and a light guide element surrounding the key. It transfers the lighting element from the traditional press surface to the light guide element such that a ring of bright backlight is presented around the key. But it requires adding an extra light guide element around the key and results in the disadvantages of a higher cost and more complex fabrication and assembly processes.
Another Taiwan patent No. I340402 discloses a keycap capable of emitting light laterally. The keycap has a light incident surface at the bottom and a light emitting surface at one lateral side. The light emitting surface has a refractive surface corresponding to the keycap. When light projects to the light incident surface and is guided by the refractive surface to the light emitting surface, it emits laterally via the light emitting surface and projects to an identification zone corresponding to the keycap. Although it can emit light laterally, the conventional keyboard has the notations and characters located on the keycaps rather than on the identification zone. The transverse light cannot travel longitudinally to illuminate the notations and characters on the keycaps, hence it is not suitable for the conventional illuminated keyboards. | null | minipile | NaturalLanguage | mit | null |
Q:
Is there a way to declare a pointer to a particular method only?
I have a class:
class Car
{
public:
Car();
~Car();
// nr indicates which particular door.
void startEngie();
void openDoor(int nr);
void closeDoor(int nr);
void openWindow(int nr);
void closeWindow(int nr);
void turnOnAirConditioner(int vloume);
}
Now by void (Car::*action)(int) I declare a pointer named action to Car method. The problem is that many methods can be assigned to it: &Car::openDoor, &Car::closeDoor, &Car::openWindow, &Car::closeWindow, &Car::turnOnAirConditioner, but not &Car::startEngie.
I wonder if I am right: there is no way to declare a pointer to a particular method only. In other words: pointer type, which accept only a particular named function, can't be declared.
A:
You can't define a type that is just "one specific value of this other type", for instance a type whose only existing value is exactly &Car::closeDoor.
One thing you can do is reach for the Swiss army knife of programming - introduce a level of indirection - and define a type that represents one specific value by wrapping it inside something else.
// Simplified Car
class Car
{
public:
void openDoor(int i) { std::cout << "open door\n"; }
void closeWindow(int i) { std:cout << "close window\n"; }
};
using Fun = void (Car::*)(int);
// A template for an immutable structure, so it
// can hold only one specific value; the template argument.
template<Fun fun>
struct CarOperation
{
const Fun f = fun;
};
// Now we can make one type for each operation
using OpenDoor = CarOperation<&Car::openDoor>;
using CloseWindow = CarOperation<&Car::closeWindow>;
int main()
{
Car c;
OpenDoor d;
(c.*d.f)(1);
CloseWindow e;
(c.*e.f)(2);
}
The syntax is slightly unfortunate, because apparently the .* operator doesn't do any implicit conversion of its right operand.
Of course, this is just a very roundabout and obfuscated way of simply calling the function indicated by the type.
It would be more useful with a type that can hold a predetermined subset of the functions (like, say, DoorOperation or Opener types).
You can probably build that using clever template programming, but I'm not a clever template programmer.
| null | minipile | NaturalLanguage | mit | null |
Q:
How do I display Quotient + Modulus in LaTex?
Forgive me, it feels lame to ask such easy questions, but plowing through Google pages which don't appear to answer the question is maddening.
It is, I hope, very simple:
I'm trying to show, for maths homework, a top-heavy vulgar fraction rewritten as a whole number and a fraction.
The actual fraction is:
\frac{43,365,000}{17}
If anything below is bad form, do say:
The division by calculator gives:
2550882.3529411764705882352941176
To find the remainder, multiply integer part by 17 and I get:
43364994
Subtract this result from the numerator and I get:
43,365,000 - 43,364,994 = 6.
So, it's remainder 6.
So then, how do I typeset:
43,365,000 / 17 = 2550882 remainder 6?
So that I can get to the final answer, 2550882 and 6/17?
Surely LaTeX has a method to handle this?
Thanks.
PS. It's interesting(?) I can't use a "modulo"/"modulus" tag below, because there isn't one and I can't create it.
A:
I don't know if you only want to display, or also calculate. Here is a proposal:
\documentclass{article}
\usepackage{xintfrac}
\newcommand\typesetintpartplusfracpart[2]{%
\xintNum {#1/#2}+\xintFrac{\xintTFrac {#1/#2}}}
\begin{document}\thispagestyle{empty}
\[\frac{43365000}{17}=\typesetintpartplusfracpart{43365000}{17}\]
\[\frac {123456789012345678901234567890}{9876543210}
=\typesetintpartplusfracpart {123456789012345678901234567890}{9876543210}\]
\end{document}
In the second case common trailing zeros in the initial fraction are discarded from output, but that's the only simplification made. The package xintfrac has a macro \xintIrr that you could use to reduce the input to smallest terms first.
Or the output, for example:
\documentclass{article}
\usepackage{xintfrac}
\newcommand\typesetintpartplusfracpart[2]{%
\xintNum {#1/#2}+\xintFrac{\xintIrr{\xintTFrac {#1/#2}}}}
\begin{document}
\[\frac{43365000}{17}=\typesetintpartplusfracpart{43365000}{17}\]
\[\frac {123456789012345678901234567890}{9876543210}
=\typesetintpartplusfracpart {123456789012345678901234567890}{9876543210}\]
\end{document}
Notice how the "modulo" part is reduced to smallest terms.
| null | minipile | NaturalLanguage | mit | null |
Box Elder High School
Box Elder High School (abbreviated BEHS) is a public high school located in Brigham City, Utah. Part of the Box Elder School District, it serves approximately 1,500 students in the 10th through 12th grades in Utah's Box Elder County. The school's boundaries stretch from Willard in the south, over to Corinne in the west, Honeyville in the north, and Mantua in the east. The school mascot is the bee.
History
Box Elder High School was built in 1894 at 18 S. 500 E. Brigham City, Utah. Since then, Box Elder Middle School has taken over that building. Over time there have been several additions and modifications to the school building. It moved to its present location, 380 S. 600 W., in 1962. The most recent renovation was started in 2007 and was finished and dedicated in 2010.
Administration
Principal: Jamie Kent
Vice Principal: Randy Rasmussen
Vice Principal: Mark Taylor
Extracurricular activities
Athletics
The Bees are in Utah's 4A classification and compete in Region 5. Beginning in the 2017/18 school year, Box Elder will move into the 5A classification in all sports. Box Elder has eight state titles in football, eight in wrestling, eight in men's track, and six in women's softball.
Sports played at BEHS include:
Baseball (boys')
Basketball (boys' & girls')
Cross country (boys' & girls')
Football (boys')
Golf (boys' & girls')
Lacrosse (boys' & girls')
Soccer (boys' & girls')
Softball (girls')
Tennis (boys' & girls')
Track & Field (boys' & girls')
Swimming (boys' & girls')
Volleyball (girls')
Wrestling (boys')
Football. The Bees have won the 4A state championship in football three times, with the last victory coming in 1995.
Track & Field. The boys' team won the 4A state championship in 1992 and 1999. The girls' team won the 4A state championship in 2017.
Wrestling. Each year the Richardson Memorial Invitational tournament is held at BEHS. Coach Craner has noted that "A lot of teams use the Richardson as a guide for the state tournament." Box Elder won the 4A state championships in 1989, 1995, 1996, 1999, 2000, 2001, 2005, and 2011. Box Elder wrestling was ranked 18th in the nation in 2011, completed an undefeated season, and broke the state record for most points scored in a state tournament (312 points).
Softball. Since women's softball began being played in Utah in 1990, Box Elder has won more games than any other team in the state. Coach Jim Fuller retired in 2010 as "the winningest high school softball coach in Utah, with a 423-114 career won loss record (a .788 winning percentage) and six state championships (his final was at Fremont High School)". The team won its first 4A state title in 1995 against its biggest rival, Bear River, and then followed that title with state crowns in 1996, 1997, 1999 and 2001. They were nationally ranked by USA Today in 1996 and 1997. Since 1990 they also have four second-place state showings and three third place finishes, playing in 9 of 21 state championship softball games. BEHS softball has won 11 league titles, and has had 50 players receive either NCAA Division I or NJCAA scholarships.
The Rockettes. The BEHS drill team won the 4A division state drill team championships in the 2002 & 2006. It tied for 1st in the 4A novelty category in 1996, and 5th place in the dance category in 2008.
Rivalries
Box Elder High School has a rivalry with Bear River High School in nearby Garland. These schools, both located in the same school district, also overlap boundaries in the towns of Honeyville, and Bear River City, making the rivalry much more fierce among students from those towns. Competition and tensions often run to extreme levels in invitational games, meets, and matches.
Clubs
Art
The BEE (online newspaper)
BEE Buddies
BEE One, BEE the Change
Cheerleaders
Chess
Color Guard
Dungeons & Dragons
FFA
FBLA
FCCLA
German
Historical Society
Interact
Jazz, Stage & Pep Bands
Key Club (service)
Latinos in Action
Latinos
Madrigals
Multicultural
National Honor Society
National Socialist Party Club
Orchestra
Productions Company
Rockettes
Scream Team
Skills USA
Spanish
WDIR
Yearbook
Orchestra program
The orchestra program at Box Elder High School is directed by John Findlay, who also teaches the class at nearby Box Elder Middle School and Adele C. Young Intermediate. The orchestra performs one concert each trimester, with the addition of the Box Elder School District Foundation concert, where they combine with the orchestra from nearby Bear River High School and play with a guest conductor each February, with the purpose of building partnerships and relationships between schools and communities. The Orchestra class consists of roughly 40-50 students. No tryout is needed to participate in the orchestra, although some experience is suggested. The orchestra qualified for state in 2007 and 2014.
Choral program
Box Elder High School choirs have received Superior ratings at Region and State Festivals and have won awards at the State UMEA Convention, Division ACDA Convention, and the Heritage San Francisco Festival (2002). BEHS Madrigals perform throughout Northern Utah, and have received Superior ratings at state competitions. They were named "Outstanding Choral Group" and "Outstanding Choral Program" at Vancouver, British Columbia, Canada and the 1997 Houston, Texas Festival.
The choral program is directed by Casey Sean Wood. The choir programs are Men's Chorus, Women's Chorus, Mixed Chorus, Arioso Choir, Concert Choir and Madrigals. Students must complete a tryout if they want to be in Arioso, Concert Choir or Madrigals.
Notable alumni
Rob Bishop - former teacher at Box Elder High; member of the United States House of Representatives; represents Utah's 1st congressional district
Marc Dunn - former NFL and NFL Europe football player (Class of 1996)
Dantzel White Nelson (1926–2004) - First wife of President Russell M. Nelson, President of The Church of Jesus Christ of Latter-day Saints (Class of 1943)
Boyd K. Packer - Quorum of the Twelve Apostles of The Church of Jesus Christ of Latter-day Saints
Elmer Ward (class of approximately 1935) - first football All American at Utah State; played center and linebacker for the Detroit Lions world champion team in 1936
Adele Christensen Young - Founder of The Adele & Dale Young Child Development Lab at Utah State University. Namesake of Adele C. Young Intermediate School. (Class of 1938).
References
External links
School homepage
School District homepage
Box Elder historical game-by-game football results since 1980
Category:Public high schools in Utah
Category:Educational institutions established in 1894
Category:Schools in Box Elder County, Utah
Category:1894 establishments in Utah Territory | null | minipile | NaturalLanguage | mit | null |
Q:
How to handle multiple requests through an Ajax API?
I have a large project that requires multiple functions to be processed through Ajax calls, so far I am using different files to handle each function call. I know there's got to be a better way to handle the requests through an API
And what would be a standard practice for designing such an API in terms of structure?
Thanks!
A:
It can be everything from something quite simple, to something more complicated, how you write it is up to you, assuming you're the only one who's going to use the API, and as far as I know there are no standards set in stone for this kind of thing, but a good way to solve things like this is to create a convenience function, both clientside and serverside, say something like
function fetch(what, data) {
data.what = what;
return $.ajax({
url : '/my/ajaxapi.php',
data : data,
dataType : 'json'
});
}
And when you need something you do
fetch('users', {name : 'Bill'}).done(function(result) {
$('#user').text(result.text);
});
$('.zoidberg').on('click', function() {
var self = this;
fetch('zoidberg', {}).done(function(result) {
$(self).text(result.text);
});
});
on the serverside you have one file, and how you set it up depends on the language used, but say PHP, and you could of course get fancy with classes etc. or just do a simple if/else or switch/case
<?php
$key = $_GET['what']; // wrap in something that makes it safe
$res = Array();
switch($key) {
case 'users' :
// lookup in DB or something
$res['text'] = $username;
break;
case 'zoidberg' :
$res['text'] = " Why Must I Be a Crustacean in Love";
}
echo json_encode($res);
?>
It's just a quick example, but set it up so it fits what you're doing, and it can save you a lot of work, and you have everything in one place so it's easy to find and modify later, easy to add new things that can be gotten with ajax etc. and possibly only need to get resources, DB connection etc. once, and not in every file.
| null | minipile | NaturalLanguage | mit | null |
Close but no hurrah: EU welcomes May Brexit speech, but warily
BRUSSELS (Reuters) - Theresa May’s “constructive spirit” won a cautious welcome from the European Union on Friday, though the British prime minister’s keynote Brexit speech raised more questions than answers for some and they want more details next week.
British Prime Minister Theresa May delivers her speech in Florence, Italy, September 22, 2017. REUTERS/Alessandra Tarantino/Pool
“The speech shows a willingness to move forward, as time is of the essence,” the EU’s chief Brexit negotiator Michel Barnier said in a lengthy statement, adding that May’s specially staged event in Renaissance Florence chimed with the spirit of Europe.
Echoing reactions from diplomats and officials involved in the negotiations who spoke privately to Reuters, Barnier said it was a “step forward” that May said British courts would protect EU citizens in Britain based directly on a new EU-UK treaty, not on British law, and would take future EU case law into account.
But as with vaguer comments about the EU budget, in which May said the other 27 countries would not be left out of pocket over the EU financial cycle ending in December 2020, Barnier stressed that he wants to hear a “precise negotiating position” when he meets his British counterpart on Monday.
Similarly, he repeated the EU position on refusing talks on what happens after Brexit in March 2019 until Britain makes “significant progress” in agreeing its divorce terms.
May for the first time spelled out her request for a transition period of about two years after Brexit, during which Britain would stay in the EU’s single market.
Barnier reiterated that the other 27 could consider the request but again insisted that Britain could not keep all the benefits of EU membership while relinquishing obligations.
May’s allies in Brussels talked up the significance of a speech she chose to deliver in Florence to drive home a message of future cooperation with Britain’s European neighbours.
“We can only hope that the EU takes what the prime minister has said seriously, and sees that it is time to move forward,” said the pro-Brexit leader of her Conservative Party’s group in the European Parliament, Syed Kamall.
“I hope that the clarity provided today will allow for real progress at the next round of negotiations.”
However, comments by the German leader of the centre-right group in the EU legislature, an ally of Chancellor Angela Merkel, demonstrated the scepticism felt toward Britain by some of Europe’s main powers: “In substance, May is bringing no more clarity to London’s positions. I am even more concerned now.”
Guy Verhofstadt, the Brexit coordinator for the European Parliament which must ratify any treaty, called May’s speech “more realistic” but warned against “cherry picking” EU favours during the transition. His demand that Britain forgo controls on EU immigration during any transition and go on making budget payments beyond 2020 will jar with May’s pro-Brexit supporters.
“STEP FORWARD”
Nonetheless, one senior official handling Brexit for an EU government said two phrases from May on expatriates’ rights and Britain’s financial obligations marked “a real step forward”.
“That is quite something,” the official said. “Let’s see what that means in the concrete negotiations.”
Those two elements are among three in which progress toward a deal is a criterion for EU leaders to approve the opening of talks on future trade terms. The third, the new EU-UK land border on Ireland, remains a conundrum and May said nothing new.
Another senior official handling Brexit for a big member state said May’s speech should help create a “more positive atmosphere” in the negotiations, when Brexit Secretary David Davis arrives in Brussels on Monday for a new week of talks.
May will meet the other 27 leaders in Estonia on Thursday and Friday and hopes they could authorise Barnier to launch trade talks as early as an Oct. 19-20 summit in Brussels.
“The real problematic issue that remains to be resolved is the financial settlement,” said Konrad Szymanski, the EU affairs minister of Poland, a major beneficiary of EU subsidies that could be hard hit by the loss of Britain’s annual contributions.
May said other states should not “pay more or receive less over the remainder of the current budget plan”. Barnier said he was “ready to discuss the concrete implications of this pledge”.
The European Commission has estimated that Britain might owe something like 60 billion euros ($70 billion) on leaving in March 2019. About a third of that, EU officials say, would be down to making Britain pay its roughly 10-billion-euro annual contribution for the remaining two years — 2019 and 2020 — of the EU’s current, seven-year budget programme.
However, were Britain to remain in the single market, which would entail payments into EU programmes, that money — some 20 billion euros — would no longer come under the “divorce bill”.
Britain has argued that it will owe very little on leaving, countering EU demands that it go on paying for many years after Brexit to cover much longer-term commitments previously made.
An EU official told Reuters: “What May said goes further than what the British government has said so far. But ... it is not clear until when they would be willing to pay.” | null | minipile | NaturalLanguage | mit | null |
[digg-reddit-me]QUESTIONER: …[W]hy not just legalize drugs? Former Drug Czar, General BARRY MCCAFFREY (retired): …[S]ince I’m not in public life, [I can say] I actually don’t care. I care about 6th graders through 12th graders. If you’re 40 years old, and you’re living in Oregon, and you have 12 giant pot plants in the back of your log cabin, knock yourself out.
Discussing Mexico and US drug policy at the Council on Foreign Relations on February 23, 2009.
General McCaffrey as drug czar vehemently opposed medical marijuana; he accelerated the militarization of the Drug War in Columbia and Mexico; and during his time as drug czar, arrests for marijuana possession soared above those for harder drugs (See graph on page 3 of pdf). After years of failure to dent domestic demand for drugs, this chief drug warrior now admits he doesn’t care if drugs are legalized and that he sees nothing wrong with growing your own marijuana. It is incredible that someone could pursue the policies he did – and now state that he either didn’t or doesn’t strongly believe drugs should be illegal.
Two weeks ago, another group of former drug warriors produced a report describing the failure of America’s prohibitionist policy in Latin America and in the United States:
Prohibitionist policies based on the eradication of production and on the disruption of drug flows as well as on the criminalization of consumption have not yielded the expected results. We are farther than ever from the announced goal of eradicating drugs… Current drug repression policies are firmly rooted in prejudices, fears and ideological visions… [T]he available empirical evidence shows that the harm caused by [marijuana] is similar to the harm caused by alcohol or tobacco. More importantly, most of the damage associated with cannabis use – from the indiscriminate arrest and incarceration of consumers to the violence and corruption that affect all of society – is the result of the current prohibitionist policies.
From Drugs and Democracy, a report by César Gaviria (former president of Columbia), Ernesto Zedillo (former president of Mexico), Fernando Henrique Cardoso (former president of Brazil) and numerous other prominent Latin American figures released February 11, 2009.
As former Governor William Weld recently explained:
There’s no one so brave and wise as the politician who’s not running for office and who’s not going to be.
It is notable that so many of our prominent politicians reveal after they leave office that they don’t really agree with the premise of the War on Drugs – a war which is consuming billions of dollars, waging war on our citizenry, jailing a higher percentage of our citizens than any other nation, destabilizing our neighbors, competing with and undermining anti-terrorism measures, and making America less safe.
Instead, the best our current leaders offer is to soften the roughest edges of the Drug War on American citizens.
Obama has taken a number of sensible positions on Drug War issues – but he has not publicly acknowledged what most informed observers can see – that the War on Drugs has failed, is wasting money, and making us less safe. It is inconceivable that a reflective, informed policy-maker such as Obama does not realize this as well.
Franklin Delano Roosevelt used to tell all of the favor-seekers who came to impress upon him the importance of certain issues:
I agree with you. I want to do it. Now make me do it.
In other words, we must put pressure on Obama if the hopes of reform advocates and Obama administration insiders are to be realized.
Related articles
Like Loading... | null | minipile | NaturalLanguage | mit | null |
All relevant data are within the paper\'s Supporting Information files.
Introduction {#sec001}
============
Many alien species may gain an advantage over the native species due to a lack of coevolutionary history with the invaded community \[[@pone.0183107.ref001]\]. This evolutionary advantage could come in the form of novel weapons like plant allelochemicals \[[@pone.0183107.ref002]--[@pone.0183107.ref004]\], escape from specialized pests and pathogens \[[@pone.0183107.ref005]--[@pone.0183107.ref007]\], or unique niche requirements \[[@pone.0183107.ref008]--[@pone.0183107.ref010]\]. These advantages could allow invasive species to establish and then outcompete native species, and indeed invasive plants are commonly superior competitors \[[@pone.0183107.ref011]\] and are associated with decreases in diversity and abundance of native plants from local communities \[[@pone.0183107.ref012]\], even if they do not cause range wide native extinctions \[[@pone.0183107.ref013]\].
However, it remains unclear whether the dominance by invasive species will be stable over time or shift to coexistence between the invader and native species. A shift to coexistence could occur if the invasive species' evolutionary advantage degrades through time as both the invasive and native species evolve post-introduction and/or ecological changes occur \[[@pone.0183107.ref014]--[@pone.0183107.ref016]\]. Specifically, pathogen accumulation could reduce this advantage \[[@pone.0183107.ref017]\] and larger pathogen loads or more negative net plant-soil microbial interactions have been found on plant species with older introduction dates \[[@pone.0183107.ref016], [@pone.0183107.ref018]--[@pone.0183107.ref020]\].
In order to establish in a new community, an introduced species must have a positive population growth rate when rare (i.e. at low conspecific frequency) \[[@pone.0183107.ref021], [@pone.0183107.ref022]\]. Furthermore, high per capita population growth rate when rare will act to buffer the invader's population from local extinction, and promote spatial spread through the local area. On the other hand, if the invader's per capita population growth rate is low (zero or negative), then the population will not be able to increase from its initial founding, and will be vulnerable to extinction when population density declines \[[@pone.0183107.ref022]\]. If high per capita population growth rates for invaders derive from evolutionary novelty, this effect may weaken over time as the invader accumulates greater interactions with community members, such as pests and pathogens. This reduction in growth rates could make the population more vulnerable to management intervention that reduces its frequency within a community.
While per capita population growth rate at low frequency determines whether an introduced species can establish, its ultimate relative abundance depends on frequency dependence. Whether an invasive plant can become monodominant or coexist with native plants depends on how its per capita population growth rate changes with conspecific frequency. An invasive plant that has positive frequency dependence (i.e. increasing per capita population growth rate with increasing frequency of conspecifics) would have the potential to form a monoculture. On the other hand, an invader with negative frequency dependence would have a population that equilibrates at a frequency where both natives and itself can persist, since per capita population growth rate decreases with increasing frequency of conspecifics. Since species interactions, especially with specialized enemies, are important sources of negative frequency dependent effects on host populations \[[@pone.0183107.ref022]--[@pone.0183107.ref025]\], evolutionary novelty may allow invaders to experience neutral or positive frequency dependence initially. However, if species interactions accumulate through time frequency dependence could become more negative.
The primary objective of this study was to investigate whether there was evidence for changes in frequency dependence and individual plant performance at low frequency (as relative proxies for per capita population growth rate in this annual species) for invasive *Microstegium vimineum* across invasion history. We predicted that *M*. *vimineum* frequency dependence would become more negative and performance at low frequency would decrease across time since invasion. We chose to study *M*. *vimineum* because it has invaded a wide area in eastern North America mainly through "natural" dispersal (i.e. not intentional planting), and has a simple annual lifestyle that allows a more direct link between individual performance and population dynamics.
The enemy release hypothesis has not been tested on *M*. *vimineum*, however aboveground accumulation of fungal pathogens that decrease *M*. *vimineum* performance have recently been reported in the invasive range \[[@pone.0183107.ref026]\]. In this study, we were specifically interested in the alteration of belowground interactions with soil microbes. Plant-soil feedbacks can become more negative with increasing time since invasion \[[@pone.0183107.ref016], [@pone.0183107.ref020]\] and this could affect the invader's per capita population growth rate and frequency dependence. Therefore, our secondary objective was to identify any changes in the belowground fungal community that were correlated with invasion history and potentially affecting individual performance and frequency dependence of *M*. *vimineum*. We predicted that there would be changes in the fungal community directly associating with *M*. *vimineum* across invasion history.
Materials and methods {#sec002}
=====================
Study system {#sec003}
------------
*Microstegium vimineum* is a C4, Asian annual grass. It was first collected within its invasive range in the United States near Knoxville, TN in 1919 \[[@pone.0183107.ref027]\]. It is a shade tolerant invader in eastern forests in the US \[[@pone.0183107.ref028], [@pone.0183107.ref029]\]. *Microstegium vimineum* reduces native plant biomass and diversity \[[@pone.0183107.ref030]--[@pone.0183107.ref032]\], suppresses tree seedling regeneration \[[@pone.0183107.ref033], [@pone.0183107.ref034]\], and is associated with changes in nutrient cycling and soil microbial communities \[[@pone.0183107.ref035]--[@pone.0183107.ref038]\]. Multiple mechanisms have been proposed for *M*. *vimineum* invasion success, including evolution post invasion \[[@pone.0183107.ref039]\], alteration in nutrient cycling \[[@pone.0183107.ref040], [@pone.0183107.ref041]\], and disturbance \[[@pone.0183107.ref042]--[@pone.0183107.ref044]\].
Map of invasion history {#sec004}
-----------------------
We created a map of *M*. *vimineum* invasion history across the eastern United States using ArcMap in ArcGIS 10.1 ([Fig 1](#pone.0183107.g001){ref-type="fig"}). We created a database of *M*. *vimineum* collection dates and locations by contacting herbaria across the eastern US. We divided the eastern US into a 0.1 latitude by 0.1 longitude grid and assigned the oldest collection date to each cell, totaling 542 points. If a cell did not have an assigned date we left it blank. Using these data, we created a spatial kriging layer of invasion history.
{#pone.0183107.g001}
We used the kriging function in ArcMap to interpolate estimated invasion ages based on the herbarium records. We used ordinary kriging, which assumes there is a constant trend between distance and the relationship between points, because we had no scientific explanation for using a model in which the trend varies across the landscape \[[@pone.0183107.ref045]\]. We used an exponential model to describe the spatial autocorrelation between points, which we determined as the model of best fit using the semivariogram \[[@pone.0183107.ref045], [@pone.0183107.ref046]\]. The kriging layer used the simplest model of invasion history, which excluded anisotropy (directional spatial autocorrelation), and had the appropriate lag size (43,500) and lag number (20), equaling about half of the largest distance between points (1,740,000 m) when multiplied together. The layer used the standard search neighborhood, with a maximum number of 5 points and a minimum number of 2 points within each of the 4 sectors that were at a 45° offset, to calculate predicted values from points.
To conclude whether the kriging layer was an appropriate interpolation surface for the data provided we explored its prediction errors. The average difference between the measured and predicted values was 0.0403 years, indicating that our predictions are relatively unbiased. The standardized mean prediction error was 0.0019, which is appropriately close to 0 \[[@pone.0183107.ref045]\]. The root mean squared standardized error was 0.9586 which is close to 1, meaning the prediction standard errors are valid. The root mean squared prediction error was 15.8590 and indicates how close the model predicts the actual point values. The average estimated prediction standard error was 16.6453. Since the root mean squared prediction error and the average estimated prediction standard error were similar and the root mean squared standardized error was close to 1, we concluded that the kriging layer was appropriate \[[@pone.0183107.ref045]\].
Site and plot design {#sec005}
--------------------
We then used the map to choose 12 sites that varied in *M*. *vimineum* time since invasion ([Fig 1](#pone.0183107.g001){ref-type="fig"}). The sites ranged from an estimated invasion age of approximately 11 to 49 years. These estimated invasion ages are most likely underestimates due to herbaria specimens' collection dates more likely representing when a species becomes more abundant rather than initial establishment date. Exact invasion age estimates are difficult to acquire, but using herbaria collection data is excellent for comparative studies across large spatial and temporal gradients. We sampled at each of these sites twice, once at the end of May (spring) and then at the end of September (fall) 2012. At each site we established 8 1m^2^ plots in an area invaded by *M*. *vimineum*. We chose invaded areas for the study based on size---the area had to be at least 16m at its longest distance and at least 1m across. At sites CNF and BEF we were unable to locate invaded areas that met the size requirement, therefore we only established 4 plots at each of these sites. We randomly selected the plots along a transect of the invaded area. The transect went through the invaded area at its longest length and ranged from \~8m (at CNF and BEF) to \~150m. Plots varied from a minimum of 1m apart to a maximum of 18m apart. We randomly selected the first 6 plots and then, if necessary, intentionally chose the last 2 plots to try to maintain a range of percent cover of *M*. *vimineum*. We did this at each site so we could explore frequency dependence within sites. In the study, we had a total of 88 plots.
At all 8 plots at each site we measured variables that could potentially affect individual plant performance, frequency dependence, or be associated with time since invasion. We measured environmental variables, such as canopy openness and soil nutrients, to make sure any patterns we found in frequency dependence and individual plant performance across time since invasion were not confounded with other factors. At both sampling time points, within each plot we took percent cover estimates of 4 categories; grass/sedge, woody, herbaceous, and *M*. *vimineum*. We measured % canopy openness over each plot using hemispheric photographs taken with a digital camera (Canon EOS Rebel T3) with a fish eye lens (Opteka). The camera was held level 1m above the center of the plot. We analyzed the photos using Gap Light Analyzer software \[[@pone.0183107.ref047]\].
Soil nutrients {#sec006}
--------------
During spring sampling, we collected soil from the top 10cm within each plot and oven dried it to analyze general nutrients (pH, P, K, Ca, Mg, MN, Zn) as well as total % nitrogen (N) and carbon (C) and the C:N ratio. We measured nitrate (NO~3~^-^) and ammonium (NH~4~^+^) in each plot by placing 20 g wet mass of mixed bed ion exchange resin (Rexyn^™^ 300 (H-OH) Beads (Analytical Grade/ Certified), Fisher Chemical) in the field for the duration of the study (\~ 4 months). (see [S1 Protocol](#pone.0183107.s001){ref-type="supplementary-material"} for complete soil nutrient methods)
We condensed the 12 soil nutrient variables (pH, P, K, Ca, Mg, MN, Zn, N, C, C:N ratio, NO~3~^-^, NH~4~^+^) using a principal components analysis (PCA), the prcomp function, in R version 3.2.1 \[[@pone.0183107.ref048]\]. We used PCA axes 1, 2, and 3 in analyses, which explained 41.39%, 23.27%, and 13.19% of the total variation in the soil nutrient variables respectively, for a total of 77.85% of the variation explained. Total % N, Mn, Zn, and total % C had the highest loadings on PC1 of -0.4095, -0.4004, -0.3838, and -0.3784 respectively. K, Ca, Mg, and pH had the highest loadings on PC2 of 0.5790, 0.4719, 0.4443, and 0.3791 respectively. C:N ratio, NO~3~^-^, Mg, and Ca had the highest loadings on PC3 of 0.4749, 0.4531, -0.3747, and 0.3565 respectively. (see [S1 Table](#pone.0183107.s002){ref-type="supplementary-material"} for the loadings of the 12 soil variables onto PCA axes 1--12).
Root fungal community {#sec007}
---------------------
During the spring sampling, we collected *M*. *vimineum* roots from each plot to perform terminal restriction fragment length polymorphism analysis (T-RFLP) of the general fungal and arbuscular mycorrhizal fungal (AMF) community (see [S1 Protocol](#pone.0183107.s001){ref-type="supplementary-material"} for complete root fungal community methods).
Estimating frequency dependence {#sec008}
-------------------------------
During the spring sampling, we randomly tagged 5 *M*. *vimineum* individuals in each plot (n = 88) by zip tying them to metal stakes. In the fall sampling, we collected the aboveground biomass of any of the 5 individuals present, oven dried them at 60°C, and weighed their final biomass. Individuals that were gone from their marked spot were recorded as dead. We calculated the proportion of survivors as the number of live plants recovered at the end of the experiment divided by the total number of originally marked plants (5), and the average individual biomass of just live plants (g) as the total biomass of all recovered plants divided by the number of recovered plants. There is some possibility that plants that died before the fall sampling may have produced some seed, but this is probably very rare since *M*. *vimineum* usually starts to produce seeds in the fall (late September/early October) \[[@pone.0183107.ref049], [@pone.0183107.ref050]\]. Six plots were not relocated and are thus excluded from our analyses. The frequency of *M*. *vimineum* within each plot was calculated by dividing *M*. *vimineum* % cover by the total % cover of all plants, since % cover is a common, non-destructive metric used to estimate frequency and population dynamics \[[@pone.0183107.ref051]\]. We chose to explore both survival and individual biomass as proxies for per capita growth rate since both represent vital rates (survival, fecundity) that can have key roles in the population dynamics of an annual plant. Individual biomass is a reasonable predictor of seed production in this species (n = 68, R^2^ = 0.6668, unpublished data).
Statistical analysis {#sec009}
--------------------
### Is frequency dependence associated with time since invasion? {#sec010}
To test whether *M*. *vimineum* frequency dependence changed with time since invasion, we regressed the proportion of survivors or the average living biomass of *M*. *vimineum* individuals within each plot against *M*. *vimineum* frequency, time since invasion, and their interaction and used site as a random effect and bootstrapped 95% confidence intervals (CI). Since frequency dependence is measured by the change in per capita fitness with increasing con-specific frequency in a plot, changes in frequency dependence across time since invasion would be depicted by a significant interaction between *M*. *vimineum* frequency and time since invasion. We ran a generalized linear mixed model with a binomial distribution when proportion of survivors was the dependent variable (n = 82) and a linear mixed model when it was average living biomass (n = 74). If we found a significant interaction between frequency and time since invasion within a model, we also used the estimate of the time since invasion main effect to understand how survival/average biomass at low frequency was associated with time since invasion, since the regression estimate reflects how time since invasion is associated with the variable at an *M*. *vimineum* frequency of 0.
A significant interaction between frequency and time since invasion could result from several distinct patterns: 1) a change in survival/biomass at high, but not low, frequency, 2) a change at low, but not high, frequency, or 3) opposite changes at high vs. low frequency. To examine which pattern drove a significant frequency by invasion history interaction, as well as to directly explore plant performance at low frequency across time since invasion, we used generalized linear models and likelihood ratio tests (LRT) to test whether *M*. *vimineum* survival changed across time since invasion in only high frequency or only low frequency plots (n = 12 for each subset). We chose the highest and lowest frequency plots from each site. For high frequency plots, frequency ranged from 0.55 to 0.90 in the spring, and 0.86 to 1 in the fall. For low frequency plots, frequency ranged from 0.10 to 0.43 in the spring and 0.11 to 0.77 in the fall. The four models, either using the highest or lowest frequency plots in spring or fall, included *M*. *vimineum* frequency as a covariate, since this varied among sites even in these subsets.
To visualize the changes in the relationship between *M*. *vimineum* survival and frequency across time since invasion we created a contour plot. We used a generalized linear model with a binomial distribution and proportion of survivors as the dependent variable with time since invasion, *M*. *vimineum* frequency, and their interaction as explanatory variables to create the response surface.
### Is frequency dependence associated with other environmental variables? {#sec011}
To be confident that the pattern of frequency dependence changing across time since invasion, shown by a significant interaction between frequency and time since invasion for per capita survival, was not confounded with environmental variables, we used forward and backward stepwise regression and Akaike information criterion (AIC) to examine whether frequency dependence was changing across time since invasion, latitude (as a proxy for climatic gradients), soil nutrient PC axes (1--3), and % canopy openness. We focused on survival data only, since patterns across frequencies appeared to be driven primarily by differences in survival rather than growth of surviving plants. For our full model we regressed the proportion of survivors within each plot against *M*. *vimineum* frequency, each variable, and their interaction (n = 77), using a generalized linear model with a binomial distribution. We calculated the correlation coefficient (r) between each pair of variables used in the full model to make sure no variables were highly correlated (r \> 0.5) We then explored the estimates of the parameters maintained in the final regression model.
As before, we analyzed high and low frequency subsets to further understand any patterns in the relationship between survival and frequency (frequency dependence) across environmental gradients (latitude, soil nutrient PC axes, % canopy openness). We used generalized linear models and LRTs to test whether *M*. *vimineum* survival changed across any environmental variables in only high frequency or only low frequency plots (n = 12 for each subset, except for soil nutrient PC axes n = 11). Because frequency still varied among sites within these two subsets, all models included *M*. *vimineum* frequency as a covariate.
All the above statistical analyses were ran with both spring and fall frequency estimates, since we were unsure which would have a larger effect on *M*. *vimineum* per capita population growth rate. Results for both frequency estimates were similar, therefore we only present our results using the spring frequency estimates.
### Are changes in the fungal/AMF community correlated with time since invasion? {#sec012}
Using a permutational MANOVA through the adonis function in the vegan statistical package in R version 3.2.1, we tested whether changes in the root general fungal/AMF communities were associated with time since invasion. The fungal community operational taxonomic units' (OTU) proportional abundances for each plot were averaged for each site to run these analyses (n = 12). If a fungal community was significantly associated with time since invasion we also tested whether it was associated with latitude, soil nutrient PC axes 1--3, and % canopy openness. If the community was significantly associated with any environmental variable as well as time since invasion we then included both factors in a model to be confident that the relationship between fungal community composition and time since invasion was not confounded with other factors.
Results {#sec013}
=======
Is frequency dependence associated with time since invasion? {#sec014}
------------------------------------------------------------
Frequency dependence changed with time since invasion when the proportion of survivors was used as the dependent variable, shown by a 95% CI that did not overlap 0 for the interaction between *M*. *vimineum* frequency and time since invasion (CI = 0.0281--0.2261, [Table 1](#pone.0183107.t001){ref-type="table"}). Survival decreased with increasing frequency of *M*. *vimineum* at younger invaded sites and was similar across all frequencies at older invaded sites ([Fig 2](#pone.0183107.g002){ref-type="fig"}), due to a decline in survival at low frequency across invasion time. This pattern is evident in the negative estimate for the main effect of time since invasion (-0.0738, [Table 1](#pone.0183107.t001){ref-type="table"}), which in our models reflects the effect of invasion history at low frequency. Additionally, when we subsetted the data to include only high or low frequency plots, survival decreased across time since invasion at low *M*. *vimineum* frequency (LRT = 6.0360, P = 0.0140, [S2 Table](#pone.0183107.s003){ref-type="supplementary-material"}), but there was no such relationship across high frequency plots ([S2 Table](#pone.0183107.s003){ref-type="supplementary-material"}). The interaction between *M*. *vimineum* frequency and time since invasion had a 95% CI that overlapped 0 when we used average living biomass as the dependent variable (CI = -0.0088--0.0132, [Table 1](#pone.0183107.t001){ref-type="table"}).
10.1371/journal.pone.0183107.t001
###### Statistical results for mixed models testing per capita population growth rate metrics across time since invasion, *Microstegium vimineum* frequency, and their interaction.
{#pone.0183107.t001g}
Dependent variable model term estimate standard error 95% CI: 2.50% 95% CI: 97.50%
---------------------------------------- ------------ ---------- ---------------- --------------- ----------------
proportion of survivors time -0.0738 0.0314 -0.1478 -0.0166
frequency -5.5092 1.5662 -8.8901 -2.6262
time\*freq 0.1195 0.0463 0.0281 0.2261
avg. individual biomass of live plants time -0.0042 0.0040 -0.0118 0.0040
frequency -0.0489 0.1712 -0.3680 0.3061
time\*freq 0.0026 0.0052 -0.0088 0.0132
Statistics for general liner mixed model with probability of *Microstegium vimineum* survival as the dependent variable (n = 82) and for linear mixed model with average individual biomass of *M*. *vimineum* live plants as the dependent variable (n = 74). 95% confidence intervals (CI) were obtained through bootstrapping. Time = time since invasion, frequency/freq = frequency of *M*. *vimineum* within a plot. Site was included as a random effect in each model.
{#pone.0183107.g002}
Is frequency dependence associated with other environmental variables? {#sec015}
----------------------------------------------------------------------
The correlation coefficients ranged from 0.00--0.38 for the variables included in the full model for the stepwise AIC ([S3 Table](#pone.0183107.s004){ref-type="supplementary-material"}). When we included time since invasion, latitude, soil nutrient PC axes 1--3, % canopy openness and their interactions with *M*. *vimineum* frequency in a full model with survival as the dependent variable (AIC = 251.16), the final model with the lowest AIC (AIC = 244.14) included *M*. *vimineum* frequency, time since invasion, latitude, PC axes 1--3, and the interaction between *M*. *vimineum* frequency and latitude/PC axis 1 ([Table 2](#pone.0183107.t002){ref-type="table"}). When we subsetted the data, survival declined across latitude and PC axes 2 and 3 and increased across PC axis 1 at high *M*. *vimineum* frequency ([S2 Table](#pone.0183107.s003){ref-type="supplementary-material"}). Survival at low *M*. *vimineum* frequency increased across % canopy openness ([S2 Table](#pone.0183107.s003){ref-type="supplementary-material"}).
10.1371/journal.pone.0183107.t002
###### The final model terms of the model with the lowest AIC value.
{#pone.0183107.t002g}
Final model term Estimate Standard error p-value (Wald test)
---------------------- ---------- ---------------- ---------------------
*M*. *vimineum* freq 24.1846 9.8796 0.0144
time since invasion -0.0340 0.0110 0.0021
latitude 0.5693 0.1487 0.0001
soil nutrient PC1 0.0115 0.1398 0.9346
soil nutrient PC2 -0.3462 0.0823 2.62e-05
soil nutrient PC3 -0.3239 0.1021 0.0015
freq \* latitude -0.7063 0.2652 0.0077
freq \* PC1 0.3999 0.2662 0.1331
The final model terms from the model with the lowest AIC value after stepwise regression was performed on a full model (n = 77). The probability of *M*. *vimineum* survival was the dependent variable.
Is the fungal/AMF community changing across invasion time? {#sec016}
----------------------------------------------------------
Changes in the general fungal community on *M*. *vimineum* roots were associated with time since invasion (P = 0.040, R^2^ = 0.1481) and % canopy openness (P = 0.021, R^2^ = 0.1615). When we included time since invasion in the model with % canopy openness, time since invasion maintained its significant association with the general fungal community composition on *M*. *vimineum* roots (P = 0.022, R^2^ = 0.1472). Changes in the root AMF community were not associated with time since invasion (P = 0.489, R^2^ = 0.0754).
Discussion {#sec017}
==========
Over time invasive species may lose the ecological advantages they gain due to their evolutionary novelty in a community \[[@pone.0183107.ref014]--[@pone.0183107.ref016]\]. We proposed that this phenomenon would manifest in population dynamics of the invader: namely, that over time invasive populations would develop stronger regulation, via more negative frequency dependence, and/or reduced ability to persist when rare. Understanding how population dynamics change as the population increases or decreases in frequency are crucial to predicting whether a species will come to dominate an area at the exclusion of other plant species, decline to local extinction in the community, or persist while allowing the coexistence of other species \[[@pone.0183107.ref021]--[@pone.0183107.ref022]\]. Our results support the latter prediction (reduced ability to persist when rare), but not the former (more negative frequency dependence), and suggest that over time *M*. *vimineum* populations may become more prone to local extinction. The decrease in survival at low frequency could not be explained by co-varying environmental gradients, but patterns in fungal communities on *M*. *vimineum* roots across time could be related to declines in survival.
Frequency dependence of survival shifted from negative to neutral with increasing time since invasion across our 12 sites. This change in frequency dependence across time since invasion was partially explained by other environmental variables. Contrary to our hypothesis, these results provide no evidence for accumulation of negative frequency dependence through invasion time. At recently invaded sites survival was negatively correlated with frequency of *M*. *vimineum*, suggesting negative frequency dependence. At older invaded sites the relationship was neutral with similar survival across all frequencies, suggesting neutral frequency dependence. However, this neutral pattern resulted from low survival across all frequencies. *Microstegium vimineum* seedling survival to reproduction is an important component of life-time fitness, affecting its recruitment ability and thus the per capita population growth rate \[[@pone.0183107.ref052]\]. Survival to reproduction is especially important at low *M*. *vimineum* frequency due to the necessity of having individuals present to produce seed and maintain the population. *Microstegium vimineum* survival at low frequency was negatively correlated with time since invasion, as we hypothesized. This suggests that *M*. *vimineum* per capita population growth rate at low frequency is declining through invasion time, decreasing its ability to persist when rare within a community \[[@pone.0183107.ref021], [@pone.0183107.ref022]\]. A population could compensate for declining survivorship if the per capita fecundity of the survivors increased, due to the release from intraspecific competition. However, we did not observe any evidence for this compensation when we analyzed the average living biomass as a proxy for fecundity \[[@pone.0183107.ref049]\]. Rather, the final biomass of surviving plants was unrelated to invasion history. This suggests that whatever is driving the change in the ability of *M*. *vimineum* to persist when rare is taking place at earlier stages of development, rather than during biomass accumulation.
Although the negative frequency dependence of *M*. *vimineum* survival at more recently invaded sites suggests coexistence between it and other plant community members, this does not rule out the possibility of it being a dominant invader. The recent populations still may be able to reach high frequency and be a dominant community member, while the other community members persist at low frequency. Due to the scope of our study we cannot determine this, but this study does suggest that *M*. *vimineum* has more potential to be a dominant community member at recently invaded sites compared to older invaded sites, where this is less likely due to lower survival rates across all frequencies.
The strength and direction of frequency dependence was also associated with latitude, soil nutrients, and % canopy openness. Generally, for the soil nutrients frequency dependence was neutral at low soil nutrients and then negative at high soil nutrients, driven mainly by a decline in survival rates at high frequencies in higher soil nutrients. Patterns of frequency dependence for soil nutrients may have resulted from greater self-thinning at more productive sites \[[@pone.0183107.ref053]\], since *M*. *vimineum* individual performance tends to positively respond to increased soil nutrients \[[@pone.0183107.ref054]\]. A decline in survival at high frequency may not harm *M*. *vimineum*'s population since conspecifics could compensate for the loss in seed production. Across low and high % canopy openness frequency dependence was more neutral due to similar increases in survival at both high and low frequencies as % canopy openness increased. Frequency dependence was neutral at low latitudes and negative at higher latitudes. This pattern was driven by a decrease in survival at high frequency at higher latitudes. A shift in the relative importance of intraspecific resource competition (leading to self-thinning at high frequency) relative to natural enemies (leading to low survival at all frequencies) from high to low latitudes could explain this pattern \[[@pone.0183107.ref055]\]. Unlike the decline in survival at low frequency with time since invasion these other environmental gradients show patterns in survival mainly at high frequency (see [S2 Table](#pone.0183107.s003){ref-type="supplementary-material"}), suggesting that there are different underlying processes for the pattern across time compared to the patterns across the other variables. Importantly, even when controlling for these environmental variables the pattern of decreasing survival with increasing time since invasion was maintained.
One possible mechanism for the decline in *M*. *vimineum*'s survival with invasion time is an accumulation of a more antagonistic soil community \[[@pone.0183107.ref016], [@pone.0183107.ref020]\]. We observed a change in the general fungal community on *M*. *vimineum* roots across invasion time but not specifically in the AMF community. Other fungal guilds in the root fungal community include pathogens, saprotrophs, and endophytes, and it is unclear which of these groups was driving fungal community changes across time. Although we cannot determine if the changes in fungal community composition across sites directly contributes to the reduced survival of *M*. *vimineum* individuals, the change in the *M*. *vimineum* root fungal community across invasion history is an interesting pattern and its connection to *M*. *vimineum* population dynamics through invasion history deserves future exploration. An alternative mechanism for a decline in an invader's survival across invasion history could be an accumulation of aboveground enemies \[[@pone.0183107.ref018], [@pone.0183107.ref056]\]. However, we found minimal evidence, in the spring or fall, of aboveground herbivory/ pathogen infection on *M*. *vimineum* at the 12 sites used in this study (5.5% and 1.6% of all tagged individuals visually inspected in spring and fall respectively). Another possible explanation for the pattern is evolved improved competitive ability of the native plant community through time \[[@pone.0183107.ref057]\], which could be explored in future *M*. *vimineum* studies.
Our results suggest management of *M*. *vimineum* will be more successful at older invaded sites. Multiple management options are used against *M*. *vimineum* including herbicides and physical removal \[[@pone.0183107.ref058]\], all with the goal of local eradication (removal) or control. All options would be more effective at older invaded sites due to the decline in *M*. *vimineum* survival (and likely per capita population growth rate) at low frequency. At younger invaded sites, interventions that reduce *M*. *vimineum* populations to low frequency within the community may be counteracted by its high per capita population growth rate when rare. On the other hand, a reduction in *M*. *vimineum* populations may lead to local extinction due to low survival at low frequency at older invaded sites. Future studies that examine *M*. *vimineum* control across time since invasion could benefit management efforts.
Conclusion {#sec018}
==========
Our results are consistent with other studies that suggest the invasive advantage, gained from lacking coevolutionary history with the invaded community, can degrade through invasion time \[[@pone.0183107.ref014]--[@pone.0183107.ref016]\]. Our data demonstrate changes in the relationship between survivorship and frequency for *M*. *vimineum* over a scale of decades, that would benefit native plant species in the community. Although our study does not define a clear mechanism for the decline in survivorship of *M*. *vimineum* across time, our data suggests that the belowground fungal community could be a driver, which is consistent with studies on other species \[[@pone.0183107.ref016], [@pone.0183107.ref018]--[@pone.0183107.ref020]\], and calls for further exploration of this potential mechanism. Our study adds to the current literature by focusing on the invader's key vital rates across invasion time, which will ultimately determine population dynamics and persistence. Understanding how an invader's population dynamics change through invasion time is vital to predict its long-term impact and design the most effective management strategies.
Supporting information {#sec019}
======================
###### Soil nutrient and root fungal community methods.
(DOCX)
######
Click here for additional data file.
###### Loadings of the 12 soil nutrient variables on the 12 PCA axes.
(DOCX)
######
Click here for additional data file.
###### Statistical results for general linear models testing survival in only low or high frequency plots across multiple variables.
Statistics for general linear models with binomial distributions and proportion of *Microstegium vimineum* survivors as the dependent variable using only the highest or lowest frequency (freq) plots from each site, n = 12 for each subset (except for soil nutrient PC axes 1--3 n = 11). \* = significant at the p≤0.1 level, \*\* = significant at the p≤0.05 level, \*\*\* = significant at the p≤0.001 level; time = time since invasion, PC1-3 = soil nutrient PC axes 1--3, canopy = % canopy openness.
(DOCX)
######
Click here for additional data file.
###### Correlation coefficients of the model terms included in the full model for stepwise AIC.
Correlation coefficients of the model terms included in the full model for stepwise AIC (n = 77). The probability of *M*. *vimineum* survival was the dependent variable. Freq = *M*. *vimineum* frequency, time = time since *M*. *vimineum* invasion, PC1- PC3 = soil nutrient PCA axes 1--3, canopy open = % canopy openness.
(DOCX)
######
Click here for additional data file.
###### Data used for the statistical analyses of *M*. *vimineum* biomass and survival.
(XLSX)
######
Click here for additional data file.
###### Data used for the statistical analyses of the *M*. *vimineum* root general fungal community.
(XLSX)
######
Click here for additional data file.
###### Data used for the statistical analyses of the *M*. *vimineum* root arbuscular mycorrhizal fungal community.
(XLSX)
######
Click here for additional data file.
###### Database of *M*. *vimineum* collections retrieved from herbariums throughout the eastern United States.
(XLSX)
######
Click here for additional data file.
This research was supported by NSF Dimensions of Biodiversity Grant 1045977 to RAL. CEC was supported by an NSF Graduate Research Fellowship. We would like to thank Rachel Nodurft for help with fieldwork and molecular analyses, Jessica Stephens for field help, Ryan Baskin for field and laboratory help, and Nina Wurzburger for help with nutrient analyses and comments on the manuscript.
[^1]: **Competing Interests:**The authors have declared that no competing interests exist.
[^2]: Current address: Department of Biological Sciences, Arkansas State University, Jonesboro, Arkansas, United States of America
| null | minipile | NaturalLanguage | mit | null |
Bharatiya Janata Party MLA and former Madhya Pradesh minister Kishori Lal Verma and his wife were allegedly stabbed to death by a local contractor on Saturday on the banks of Narmada river at Kedi Ghat.
Verma, who represented Pandahana constituency in the state Assembly travelled to the river near Omkareshwara along with his wife on the occasion of Diwali.
They were attacked with a sharp-edged weapon by the construction contractor, according to police.
The accused has been arrested, police said, adding a dispute over payment seemed to be behind the attack.
Senior police officials rushed to the site soon after the incident and steps are taken to ensure that no untoward incident took place in the area.
Verma was the state education minister during the then-BJP government in the early 1990s. | null | minipile | NaturalLanguage | mit | null |
---
abstract: 'Deep reinforcement learning (DRL) has been proven to be a powerful paradigm for learning complex control policy autonomously. Numerous recent applications of DRL in robotic grasping have successfully trained DRL robotic agents end-to-end, mapping visual inputs into control instructions directly, but the amount of training data required may hinder these applications in practice. In this paper, we propose a DRL based robotic visual grasping framework, in which visual perception and control policy are trained separately rather than end-to-end. The visual perception produces physical descriptions of grasped objects and the policy takes use of them to decide optimal actions based on DRL. Benefiting from the explicit representation of objects, the policy is expected to be endowed with more generalization power over new objects and environments. In addition, the policy can be trained in simulation and transferred in real robotic system without any further training. We evaluate our framework in a real world robotic system on a number of robotic grasping tasks, such as semantic grasping, clustered object grasping, moving object grasping. The results show impressive robustness and generalization of our system.'
author:
- |
Zhixin Chen, Mengxiang Lin\*, Zhixin Jia, Shibo Jian\
[^1]
bibliography:
- 'refs.bib'
title: Towards Generalization and Data Efficient Learning of Deep Robotic Grasping
---
Deep reinforcement learning, Visual grasp, Simulation and real-world, Generalization
Introduction {#intro}
============
As one of the most important manipulation skills, vision-based grasping has been studied intensely in the field of robotics for decades. Although robots performing pick and place tasks have been applied successfully in industry, creating autonomous robots for grasping objects in unstructured real-world scenes remains an open question. In recent years, deep reinforcement learning (DRL) has attracted increasing research attention in robotics since its success in video game. Combining with CNNs, DRL maps the features of visual observations directly into control policies by trial-and-error. This provides a general way for robots to learn manipulation skills by using information acquired from cameras [@simulation-robotic], [@dexterous-manipulation].
The typical way to train a visual-based DRL agent is in an end-to-end fashion, in which the reward signal of reinforcement learning is used to train both CNNs and policy networks synchronously. However, in order to achieve satisfying performance, large amounts of interaction data are required for training of a DRL agent. For example, to collect enough training data, [@hand-eye] executed 800,000 robotic grasping attempts in several months with 14 robots, and [@self-super] collected 700 hours robot grasping data with 50,000 grasping attempts. Moreover, DRL methods try to map raw visual observation into a lower dimensional latent space of control that preserves various types of information about manipulated objects. However, tangled and uninterpretable latent representation restricts the generalization across object and environment and further leads to poor control policy. Most works have to evaluate the trained DRL agents with the similar objects and environments as that of training [@robotic-autoencoder], [@dexterous-manipulation], since the networks trained before have to be fine tuned to adapt to change and hundreds of thousands of robotic manipulation experiences may be needed once more when transferring to a new environment. These limitations will definitely prohibit the use of DRL method in real-world robotic application.
A feasible way to alleviate data requirements is to train DRL agents in simulation, in which the interaction could be speed up easily by using programming techniques, such as multithreading. With this approach, large volumes of experiences can be captured efficiently than that of real world interactions and meanwhile many variants of environments could be constructed for generalization concern. However, there is a huge gap between the simulation and the real-world, which causes the agents trained in simulation to be hardly applied in real world conditions, especially in the context of vision-based robotic manipulation, where illumination changes and varying textures can have significant effects on the quality of the results. Therefore, some DRL based robotic control approaches are only verified in simulation due to difficulties in transferring from simulation to real robots [@no-real-robot2], [@no-real-robot1]. To alleviate the problem some techniques are proposed to allow for automatic adaptation to the real world environments [@simulation2real2], [@simulation2real].
In this paper, we propose a DRL-based visual grasping system aiming at improving generalization performance with the least cost of the acquisition of real world experiences. Following the typical visual based DRL paradigm, our framework consists of two major components: a CNN based visual *perception* and a DRL based control *policy*. The perception module extracts features from visual observation (i.e. raw images) and then the features are mapped into the action space by the policy module.
We train the perception and the policy separately instead of end-to-end. The perception is trained in a supervised setting to produce the semantic and spatial information of the grasped objects. In the meantime, the control policy is trained in a simulation environment where the class and pose of the object to be grasped can be read automatically. Training the policy with the quantitative description of manipulated objects can be beneficial to both generalization and transferability since the information irrelevant for control decision is discarded. In our work, after roughly **30 minutes** of training in simulation, the policy is directly transferred to a real robotic system **without any additional training**. The performance of our system is evaluated on challenging tasks including semantic grasping, clustered object and moving object grasping. The experimental results demonstrate the robustness and generalization of our approach.
Related work {#relatedwork}
============
Simulation environments can provide experiences data much more effective since the simulation could be accelerated by programming. And many robotic manipulation DRL algorithms are verified in simulation environments [@simulation-robotic], [@model-base]. Unfortunately, the gap between simulations and real-world makes the the agent trained in simulation can hardly use in physical robot. Many works had tried to bridge reality gap [@simulation2real], [@simulation2real2]. In [@simulation2real], the images came from simulations were rendered in randomization, and while the visual perception had seen enough variability over simulations, the real-world images may appear to the model just as another variation. Such randomization made a successful visual grasping model in real-word. [@simulation2real2] unified the visual inputs from simulation and real-world using an adaptation network. The adaptation network was trained to generalize canonical images from randomized images from simulation. And because of the randomization, the trained network could also generalize canonical images from real-world. The generalized canonical images which had been mapped into the same space were used to train the visual grasping DRL agents. Benefited from the adaptation network, DRL agents could be trained in simulation and used in real-world.
Many researches have tried to relieve data inefficiency by improving the efficiency of DRL training process and experiences data generation. Guided policy search (GPS) algorithm [@guided-policy-search] converts reinforcement learning into supervised learning, where a trained a local linear controller provided with full state observation (i.g., object poses) served as supervisor. And a global policy parameterized by neural networks derived from supervision. This allows a CNNs policy with 92,000 parameters to be trained in tens of minutes of real-world robotic manipulation time and in test stage the full state is no longer available that the policy trained in a supervised setting could handle several novel, unknown configurations. Another direction to improve sample efficiency is to accelerate model-free reinforcement learning with a learned dynamics models [@model-base]. The learned models can generate synthetic sample data to enrich the agent experiences efficiently which has no need to execute the physical robot, though it needs additional efficient model learning algorithms [@model-learn], [@model-learn-3]. However, the learned model would quite differ from the true dynamics and the induced error would weaken performance of learned policy.
These methods tried to train an optimal policy and visual perception simultaneously in an end-to-end style. However, it can hardly be generalized to different manipulated objects and different execution environments. Since the generalization is relied on the distribution of training data, it requires a huge experience data to achieve usable generalization ability [@e2eGeneralize]. It is impractical in a robotic grasping task to acquire enough data. An intuitive alternative is to train image representation and reinforcement agent separately [@auto-encoder], [@robotic-autoencoder]. With an auto encoder pretrained by an auxiliary reconstruct loss, the high dimension of image input is embedded into a low dimension, latent space and aggregate useful features before interacting with environment. This way the training of the reinforcement agent networks would be more easily with much less interaction experiences for there is no need to learn the state representation and the training would significantly speed up. However, the latent feature representation has no exact physical meanings and would be lack of interpretability as well the trained policy. From this perspective, meaningful feature representation would significantly improve generalization ability.
Framework
=========
We propose a robotic grasping framework based on deep reinforcement learning. Reinforcement learning enables agents (e.g., robots) to learn an optimal policy through interaction with environments by trial-and-error. In doing so, we formulate a robotic grasping problem as a Markov decision process: at time $t$, the robot receives the state of target objects and constructs environment state $s_t$ accordingly. After that, the robot chooses an action $a_t$ to move itself based on the current policy $\pi \left(a_{t}|s_{t}\right)$. Then the environment transits to a new state $s_{t+1}$ reacting to $a_t$ and an immediate reward $R_t \left(s_t,a_t,s_{t+1}\right)$ is offered by the environment. The goal of the robot is to find an optimal policy $\pi ^{*}\left(a_{t}|s_{t}\right)$ that maximizes the discounted future rewards
$$G_t=\sum _{i=t}^{\infty}\gamma ^{i-t}R_{i}\left(s_i,a_i,s_{i+1}\right)$$ where $0 < \gamma < 1$ is the discounted factor which reduces the weight of future rewards.
Similar to recent works [@robotic-autoencoder], [@guided-policy-search], our framework is composed of two stages, as shown in Fig.\[framework\_figure\].
{width="100.00000%"}
Raw RGB images from camera are input into the perception, where object semantic segmentation and pose estimation are made by Mask R-CNN and PCA respectively. The policy is a PPO [@ppo] agent which receives the control quantities of desired objects and decides which action will be taken to execute grasping. The pseudo code of grasping a single object with our framework is presented in Algorithm \[framework\_pseudo\]. The details of each component are discussed in the following subsection.
The perception and policy are trained separately. In particular, Mask R-CNN is trained in a supervised way, in which the labels are constructed manually using a tool LabelMe [@labelme]. There is no training stage for PCA as it is an unsupervised method. The PPO is trained in simulation for fast experience data acquisition. Since the semantic and position information can be read by an interface provided by the simulation environment, the training of PPO could proceed in parallel with that of Mask R-CNN.
$image$ ***Perception*** detect object class and mask from raw images $mask, class$ $\gets$ **mask-rcnn**($image$) get physical quantities from mask $center, direction$ $\gets$ **PCA**($mask$) ***Policy*** decide action via PPO $action$ $\gets$ **PPO**($center, direction$) grasp specific object and success check $success$ $\gets$ **grasp**($class$)
Perception
----------
The perception plays a sensor-like role that transforms raw image inputs into physical quantities binding with object semantic information (i.e., object class and its corresponding pose). We should note that this work focuses on a 3DOF grasp [@grasp-pose] given that the workspace of a robot is constrained to a tabletop.
### Semantic Segmentation
To grasp a target object, the robot must know where the target is. To achieve this, we leverage a popular semantic segmentation method Mask R-CNN [@maskrcnn] as the front part of the perception to detect and segment objects from raw images.
Based on Faster R-CNN [@fastrcnn], Mask R-CNN introduces a mask branch at the end of the original network for segmentation tasks. It proceeds in two stages: first, the region proposal network (RPN) [@fasterrcnn] is applied to scan the image to find the area where the target exists; secondly, the object class and its bounding box coordinates are predicted simultaneously. Finally, a pixel-wise binary mask for each bounding box is generated by a fully convolutional network (FCN) indicating whether each pixel in bounding box is the point of the detected object. As a result, masks on the original image exactly cover the areas where the objects exist. The class and mask of an object provide us with a good starting point for pose estimation.
### Object Pose
Since an object mask produced carries information about object pose, learning a DRL policy from masks is in principle possible, as what most DRL based approaches do. In realistic robotic applications however, we can not afford to collect such huge interaction data required by a policy learning algorithm. To avoid this difficulty, we further infer pose for an object instance based on the object mask obtained. In a 3DOF grasp setting, object pose can be represented by a 2-dimensional position coordinates of the object center and the direction of the object. Here, we develop a Principal Component Analysis (PCA) based method to estimate 3D object pose from a pixel-wise binary mask output by Mask R-CNN. In general, PCA is an unsupervised method that could identify the main components of data with largest variances from a big dataset. For our purpose, the center and main direction of a set of pixel points are inferred by using PCA.
The output of Mask R-CNN is an object with its covered mask which contains all pixel points formalized as $$mask=\left \{ \left(x_0,y_0\right), \left(x_1,y_1\right),...,\left(x_n,y_n\right)\right \}$$ where $n$ is the number of pixel points in the mask, i.e the number of samples in PCA. Firstly, we calculate the mean point of $mask$ as the center point of the mask: $$c=(x,y)=\frac{1}{n} \sum_{i=1}^n (x_i, y_i)$$ Note that, the mean point $c=(x,y)$ is the geometric center of a mask. After that, all the points in the $mask$ are subtracted by the $c$ resulting residual coordinates $$Res = mask - c$$ Thus, the covariance matrix of $Res$ and its corresponding eigenvalues and eigenvectors are calculated: $$\lambda _1, \lambda _2 = eigenvalues \left ( covMat\left(Res\right) \right )$$ $$\alpha _1, \alpha _2 = eigenvectors \left ( covMat\left(Res\right) \right )$$ Since the pixel points are in two dimensions, there are totally two eigenvalues and eigenvectors of $Res$ matrix. The $\lambda$ and $\alpha \in \mathbb{R}^{2\times 1}$ are sorted by the magnitude of eigenvalues in descending order. Finally, the main component with largest variance is calculated: $$M = Res \cdot \alpha _1 \cdot \alpha _1^\top + c$$ $M \in \mathbb{R}^{n\times 2}$ contains $n$ points on a straight line. We take two points from $M$ randomly to construct a straight line. $\theta$ represents the angle of the straight line respect to the horizontal axis.
Fig.\[PCA-result\] shows the results of PCA on a number of objects with various shapes. With the help of a calibrated camera, the position and orientation in pixel coordinates can be mapped into that of a physical coordinate system.
Policy
------
The policy is a deep reinforcement agent that receives the physical quantities from the perception and decides an optimal action to move the robot. For our framework, we adopt a policy gradient method called Proximal Policy Optimization (PPO) [@ppo] which is favorable for high dimension continuous robotic control problem. PPO significantly improves data efficiency over other policy gradient methods by updating multiple gradient steps with the same trajectory. Moreover, to avoid an increase in data variance, PPO introduces a clipping coefficient which stops the gradient when the difference between the updated and original policy is too large.
### State Representation
We concatenate the output from the perception $x, y, \theta$ (the pose of a target object) and the robotic configuration $x_r, y_r, \theta _r$ ( the pose of the end effector of a robot) to form the environment state $s_{t}$ as the input of the policy network PPO: $$s_{t} = \left(x,y,\theta,x_r, y_r, \theta _r\right)$$ Through several fully connected layers, PPO finally outputs an action distribution over current state $s_t$. Thereafter, the optimal action in the current state $s_t$ at time step $t$ is sampled from the action distribution: $$a_t \sim \pi\left (a|s_t \right )$$ The action is a three-dimensional continuous variable instructing the robot’s next moving direction and magnitude. The execution of the action would lead to a new environment state $s_{t+1}$ and an immediate reward $R_{t}$ offered by environment.
### Reward
The reward function for learning the policy $R_{t}$ is defined as: $$R_{t} = \left\{\begin{matrix}
-d_t-0.1 & away\\
-d_t+0.1 & approaching\\
1 & grasp~success\\
-1 & grasp~failed\\
\end{matrix}\right.$$ where $d_t$ is the distance between the end effector’s current and target position in time step $t$.
If $d_t$ is decreasing compared to the previous $d_{t-1}$, the end effector is $approaching$ the target and will receive a slightly positive reward addition, and otherwise, it is $away$ with a negative reward. In this way, we encourage the end effector to approach and trace the target object as soon as possible. When the policy decides actions bounded in a very small magnitude for several time steps, the policy will decide to execute the grasping, i.e., the end effector moves down on $z$ coordinate and closes the gripper. A grasping is counted as a success if the gripper is not fully closed. With a larger reward for a successful grasping, the policy could learn the tracing target policy and grasping policy simultaneously.
### Training Loss {#traing-loss}
PPO is an Actor-Critic style [@a3c] algorithm and typically contains a value function and a policy function. The value function $V_{s_t}$ which estimate the expected reward from a state $s_t$ is trained to minimize TD error [@rl-introduction], whose loss function is defined as: $$L_{V} = \left ( V\left(s_{t}\right)- \left (R_{t}+\gamma V\left(s_{t+1}\right)\right )\right )^{2}$$ where $\gamma $ is the discounted factor.
The policy function $\pi(a_t|s_t)$ which decides an optimal action over a state $s_t$ is trained to maximize a novel surrogate objective [@ppo] according to the value function: $$L_{a} = \textbf{min}\left ( r_t A_t, clip\left ( r_t, 1-\epsilon, 1+\epsilon \right ) A_t \right )$$ where $r_t = \frac{\pi \left (a_t|s_t \right )}{\pi_{old}\left (a_t|s_t \right )}$ is the importance sampling coefficient in which $\pi_{old}\left (a_t|s_t\right )$ is the behavior policy whose parameters are frozen during one update epoch. $A_t$ is the advantage function [@a3c] which indicates if the reward of current action is above average. And it could be estimated easily by $A_{t} =R_{t} + \gamma V\left(s_{t+1}\right)- V\left(s_{t}\right) $ or GAE method [@gae] according to the value function $V(s_t)$. And a *clip* is a function that limits the importance sampling value between $1-\varepsilon$ and $1+\varepsilon$ in order to avoid a large step update where $\varepsilon$ is the clipping coefficient which usually equals to $0.2$ [@ppo].
Therefore, the final loss function $L$ becomes $$L = L_V - L_a$$ and the parameters of network are updated through gradient descent method according to $L$.
Experimental Evaluation {#experiments}
=======================
Implementation
--------------
To evaluate our approach, we implemented a visual-based grasping system based on the framework shown in Fig.\[framework\_figure\]. The perception consists of a Mask R-CNN and a PCA procedure, which are executed in pipeline. The input images resized into $600\times 600$ are fed into the Mask R-CNN and a number of object instances covered with their masks are produced. For each mask produced, PCA is invoked to compute its position and orientation as the output of the perception. The implementation of the Mask R-CNN is based on [@maskrcnn_implementation]. Instead of using a pre-trained Mask R-CNN model on general objects datasets such as MSCOCO [@coco], we train the Mask R-CNN on our own dataset considering detection accuracy. To this end, 1000 images of 21 classes of objects are collected and labeled with their mask ground truth manually by the label tool LabelMe [@labelme].
For the policy, three fully-connected layers are stacked together to form a PPO agent. The first layer takes as input a six dimension vector concatenating the object position and the robot position and transforms the input into a 512 dimension latent vector. And the second layer transforms the 512 dimension vector into two streams: a 512 dimension action vector and a 512 dimension value vector. Then one stream is transformed into two 3-dimension vectors, representing the parameters of action distribution $\mu$ and $\sigma$, while another stream is transformed into a scalar representing the value of current environment state. For efficient training of PPO, we setup a simulation environment in V-REP [@vrep], as shown in Fig.\[simulation-environment\].
![Simulation environment set up in V-REP [@vrep]. []{data-label="simulation-environment"}](simulation.pdf)
Seven classes of objects from a robotic manipulation benchmarks YCB [@YCB] are used for PPO training in simulation, including a detergent bottle, an orange, a round can, a rectangular can, a cup, a pudding box and an electric drill. Since the class and pose of an object in the simulation environment can be obtained directly through software interfaces, PPO could be trained separately, without the help of the perception. The parameters of PPO are learned in a learning rate of $1e-5$ using Adam optimization method [@adam].
Both the training of PPO and Mask R-CNN is done on a PC with a RTX 2080Ti GPU. The average rewards of PPO training in simulation over 5 runs are shown in Fig.\[train-result\]. Very impressive results are obtained after about **30 minutes** training of PPO, indicating by the red arrow in Fig.\[train-result\].
![The process of policy training in simulation. The rewards converged very quickly and the model trained has achieved a good performance after about 30 minutes. The policy model used in all experiments is trained for 200 episodes, as indicated by the red arrow.[]{data-label="train-result"}](train_process.pdf)
By contrast, the interactions with the same number of episodes would take tens of hours for a real physical robot. The training of Mask R-CNN on our own dataset takes about 10 hours. This training may be not necessary since a pre-trained model on general dataset usually works well in many cases. It is worth noting that all the training above does not require a real-world robot and the trained networks will be transferred into a real-world robotic grasping system directly.
Real-world Evaluation {#real-world}
---------------------
The overall goal of our evaluation is to determine whether the trained networks can enable a real world robot to perform various grasping tasks without any further training. To this end, a number of grasp tasks commonly used in our daily life are designed to evaluate the ability to perform grasping skills and generalization over objects and situations. We use an industrial UR5 robot arm with an RG2 gripper to achieve two-finger rigid grip. A RealSense camera [@realsense] is located 100 cm above the work surface, producing RGB images for input. A laptop with a RTX 2080 GPU acceleration is used for real-time robotic control and communication with UR5 via TCP/IP protocol. The experimental hardware platform is shown in Fig.\[real-world-environment\]. It is worth note that the objects used in the experiments are totally different from that of PPO training in simulation.
![The hardware setup of our system. []{data-label="real-world-environment"}](real-world.pdf)
### Sim-to-Real Transfer
As mentioned before, the trained networks including Mask R-CNN and PPO are transferred into our robotic grasping system without any further training. We first examine the behavior of the system in a controlled manner. As shown in Fig.\[corn\], a target object (a corn) is placed on the work surface in various positions and orientations. The robot grasps the target successfully for 20 randomly chosen object locations.
Furthermore, in order to test the robustness of the control policy, we manually introduce external disturbances. As shown in Fig.\[trajectory\], the control policy could find its correct trajectory again and grasp the target successfully after a sudden change on the robot configuration during the robot’s execution, exhibiting good stability and robustness.
### Multi-object Grasping {#multiobj-grasp}
Multi-object grasping is a common task used to measure the performance for a vision based robotic grasping system. In our test setting, 10-13 objects are placed randomly on the table and the UR5 robot is requested to pick up all objects sequentially and then put them out of the workspace. In addition, the background color of the work surface is shifted from white into brown or green. Two example test settings in different backgrounds are shown in Fig.\[multiobj\]. A grasp is successful if an object is grasped and threw aside, while a remove completion means no objects are left on the table. We perform 10 tests for each background and grasp success rate and remove completion rate are presented in Table \[multiobj-result\].
[ccc]{}
scenarios & grasp success & remove completion\
brown & 100%(112/112) & 100%(10/10)\
green & 100%(120/120) & 100%(10/10)\
dense & 93.7%(104/111) & 80%(8/10)\
### Clustered object Grasping {#in-cluster}
A challenge task in robotic manipulation is to grasp objects clustered closely together. As shown in Fig.\[dense-cluster\], in a cluster scenario, the objects would block each other and some objects may be completely invisible. In such a task, the order of manipulations really matters if we want to remove all the objects in sequence. To decide the ordering of picking up, we define a mask ratio $r$ for each object recognized as follows: $$r = \frac{m}{M}$$ where $m$ is the recognized mask with possible occlusion and $M$ is the full mask of the object which is pre-determined. The larger the ratio, the more likely the object is to be picked up firstly as it is less occluded by others. For dense cluster scenarios, we perform 10 tests and grasp success rate and remove completion rate are presented in Table \[multiobj-result\]. The failure cases occur due to misidentifications by Mask R-CNN because of partially visible objects.
### Semantic Grasping {#semantic-grasp}
In a semantic grasping task, a robot is instructed to grasp a specified object among a set of candidates. The capability of semantic grasping is essential to allow autonomous robots to perform manipulations in an unstructured environment. Benefiting from the power of Mask R-CNN to detect objects, our system first identifies the class of an object before deciding how to pick up. Similar to the experiment setting in multi-object grasping, 10-13 objects are randomly placed on the table for each trial. For each run, we randomly specify one object and simply count the number of successful grasps. We perform five trails and the success rate achieves **100% (60/60)**.
### Moving Object Grasping {#semantic-tracking}
Grasping a moving object is still a challenging task in visual-based robotic manipulation [@moving-grasp]. Our learning based approach provides a promising way to approach this challenge. To demonstrate the effectiveness of our approach, a case study is conducted in a scenario where a small fake mouse is moving and the robot is ordered to pick up the mouse in motion.
To pick up the moving mouse, our robot needs to be able to track the target continuously and decide to execute a grasping once the action outputted by the control policy is smaller than the preset threshold. In order to further reduce the time between making a grasp decision and closing the gripper, we add a fixed movement in $z$ direction simultaneously with the movement in the $x-y$ plane, instead of moving down in $z$ direction after the decision making. This minor modification significantly improves the successful rate of picking up the mouse in our experiments. The example pictures of robot’s execution on picking up a moving mouse are shown in Fig.\[moving-mouse\]. However, due to the computation cost of the system and communication delay between the laptop and the robot, the delay time in our current implementation is about $200ms$, which limits the speed of moving objects in our experiments.
Conclusion and future work {#conclusion}
==========================
We presented a robotic grasping approach that combines visual perception and a DRL based control policy. Comparing with other alternatives, training on a real robot is avoided by decoupling the control from visual perception with the help of a physical representation of objects, which makes them easier to be trained. Moreover, the policy trained in simulation could be transferred to a real system without any further training. Real world experiments on UR5 demonstrate the robustness and generalization over a wide variation in challenging grasping tasks. However, in this work, we only consider 3DOF grasping in which objects are placed on a table and the grasping height is fixed. In future work, we would like to extend this work to a 6DOF grasping. To do so, it will be important to investigate the pose of gripper in 3D shape perception.
[^1]: \* Corresponding author
| null | minipile | NaturalLanguage | mit | null |
Jason Taumalolo has become the latest North Queensland superstar to try to convince Valentine Holmes to make the move back home to Townsville.
After Michael Morgan threw his support behind good mate Holmes joining the club from 2020, Taumalolo will no doubt do his best sales pitch when he crosses paths with the Kangaroos flyer in Auckland this week.
Hot property: North Queensland will go all out to try to lure Valentine Holmes home. Credit:AAP
Tonga are the hottest ticket in town with Saturday's historic Test between the Kangaroos and Tonga a sell-out.
While the 25,000 fans cannot wait, the Cowboys only have to wait 16 more days before they can officially table Holmes a deal. | null | minipile | NaturalLanguage | mit | null |
99 Cal.App.3d 849 (1979)
160 Cal. Rptr. 486
MITCHEL J. EZER et al., Plaintiffs and Respondents,
v.
HEINZ FUCHSLOCH et al., Defendants and Appellants.
Docket No. 53420.
Court of Appeals of California, Second District, Division Four.
December 14, 1979.
*853 COUNSEL
Roy L. Kight for Defendants and Appellants.
Frances L. Ezer, in pro. per., Rich & Ezer and L. Douglas Brown for Plaintiffs and Respondents.
OPINION
JEFFERSON (Bernard), J.
This is an appeal by defendants Heinz Fuchsloch and Christine Fuchsloch from a mandatory injunction issued against them following a trial on a complaint filed against them by *854 plaintiffs Mitchel J. Ezer and Frances L. Ezer. The dispute results from the fact that plaintiffs and defendants are neighbors residing in a hillside area located in Pacific Palisades. The complaint alleged that the improved property of plaintiffs was directly opposite of the defendants' improved property and property owned by the Staleys, also named as defendants in the action. The complaint further alleged that, on May 4, 1962, defendant Marquez Knolls, Inc.,[1] the owner of all of the lots in the tract of which the properties of plaintiffs, the defendants Fuchslochs and Staleys are a part, recorded a declaration of restrictions.
The restrictions provided that no tree, shrub, or other landscaping should be planted that would at present or in the future obstruct the view from any other lot. The plaintiffs alleged that the trees growing on the Fuchsloch and the Staley properties had grown to such a height that they were almost completely obstructing the view of the Pacific Ocean and the surrounding areas from plaintiffs' property. Plaintiffs sought a mandatory injunction requiring the Fuchsloch and Staley defendants to trim the trees on their respective properties so that such trees no longer obstructed the view from plaintiffs' property. The Fuchsloch defendants filed an answer which consisted of general and specific denials of the allegations contained in plaintiffs' complaint.[2]
Following trial, the court granted a mandatory injunction against the Fuchsloch and Staley defendants. With respect to the Fuchsloch defendants, the injunction ordered these defendants to cut down to the level of the roof of their house all trees and shrubs located on the property which appeared on a particular photograph which had been received into evidence as an exhibit. The injunction further ordered the Fuchsloch defendants to thereafter keep their trees and shrubs cut so that they did not grow above the rooftop of their home.
On this appeal, the Fuchsloch defendants contend that the dispute between the parties relates primarily to a specific pine tree which is approximately 25 feet in height and stands in the center of the back yard of defendants' property directly behind their house.
Basically, defendants assert four contentions in seeking a reversal of the judgment. First, defendants assert that the mandatory injunction order *855 constitutes an abuse of judicial discretion as being unjust, unreasonable, arbitrary and contrary to public policy and public good. Second, defendants claim that the trial court misinterpreted the restrictive covenant document. Third, defendants assert that the trial court failed to give adequate consideration to the rights of the tree as distinct from the rights of the individual litigants. Fourth, the defendants claim that the plaintiffs are barred by the doctrines of laches and waiver.
Plaintiffs, as respondents on appeal, renew their motion to dismiss defendants' appeal.
We consider first the dismissal-of-appeal motion.
I
PLAINTIFFS MOTION TO DISMISS DEFENDANTS APPEAL
(1a) During the pendency of this appeal plaintiffs filed a previous motion for a dismissal of the appeal. This motion was denied without prejudice. Plaintiffs devote a substantial portion of their brief to the proposition that the court's minute order of November 10, 1977, was an order granting an injunction, made appealable by Code of Civil Procedure section 904.1, subdivision (f), and that defendants' notice of appeal, filed March 3, 1978, was therefore not timely. In this court's prior order denying, without prejudice, plaintiffs' motion to dismiss defendants' appeal, it was pointed out that the minute order of November 10 was not a minute order granting an injunction but a notice of intended decision which would not be effective until entry of a formal judgment. (See Code Civ. Proc., § 632 and rule 232 (a), Cal. Rules of Court.) The first formal judgment or order granting an injunction was signed and filed by the trial judge and entered on January 4, 1978. It bore the label, "Mandatory Injunction." The defendants' notice of appeal, filed March 3, 1978, was therefore timely under rule 2 (a) of the California Rules of Court, with respect to the mandatory injunction of January 4, 1978.
(2a) Plaintiffs now contend that the mandatory injunction of January 4, 1978, was neither an appealable order for an injunction (Code Civ. Proc., § 904.1, subd. (f)), nor an appealable final judgment (Code Civ. Proc., § 904.1, subd. (a)) in this action because a subsequent judgment in the action was entered on June 29, 1979. It is the June 29 *856 judgment which the plaintiffs seek to label as the only final judgment from which an appeal may be taken.
(3) Plaintiffs assert that, for purposes of appeal, there is a difference between an order granting an injunction and the injunction itself. Plaintiffs thus cite cases such as Monterey Club v. Superior Court (1941) 44 Cal. App.2d 351 [112 P.2d 321] and Meehan v. Hopps (1955) 45 Cal.2d 213 [288 P.2d 267], as holding that it is the order granting the injunction, and not the writ of injunction itself, which is appealable.
An examination of the cases cited by plaintiffs indicate that such cases do not make a distinction between an order granting an injunction and a writ of injunction, a judgment of injunction, or an order of injunction for purposes of denominating the appealable order or judgment. An injunction is defined in Code of Civil Procedure section 525. This section provides: "An injunction is a writ or order requiring a person to refrain from a particular act...." In view of the language of Code of Civil Procedure section 525, it is understandable that Code of Civil Procedure section 904.1, subdivision (f), uses the language that an appeal may be taken from an order granting an injunction. However, an injunction as a writ or order, comes within the definition of a judgment. Code of Civil Procedure section 577 provides that "[a] judgment is the final determination of the rights of the parties in an action or proceeding." An injunction as a writ, order or judgment comes within the definition of "judgment" set forth in Code of Civil Procedure section 577.
(2b) In the case at bench it is clear that the mandatory-injunction document, which was signed by the judge and entered on January 4, constituted a final judgment which was an appealable judgment under Code of Civil Procedure section 904.1, subdivision (a). (4) The label, "Mandatory Injunction," placed on the document, has no relevancy in determining whether the document is such that it comes within the definition of a "judgment." If the document constitutes a "final determination of the rights of the parties in an action or proceeding," it constitutes a "judgment" as defined by Code of Civil Procedure section 577. The form of the final determination whether it be an order for the recovery of money or an order compelling a party to do or refrain from doing an act does not change the character of the document as a judgment.
*857 (1b) Prior to the final judgment of mandatory injunction, entered on January 4, 1978, the trial court had made no order granting an injunction. The November 10 minute order was simply an announcement of intended decision. As indicated in rule 232 (a) of the California Rules of Court, such "announcement of intended decision shall not constitute a judgment and shall not be binding on the court." It merely starts the time running on a request for findings. (Cal. Rules of Court, rule 232 (b).) A minute entry of a notice or announcement of intended decision can be considered at best as a preliminary order looking forward to a formal judgment. As a preliminary order, it is not appealable.
We recognize that, in some situations, it is appropriate for a trial court, by minute entry, to make an order granting an injunction, which would be an appealable order under Code of Civil Procedure, section 904.1, subdivision (f). Such a situation was presented in Meehan v. Hopps, supra, 45 Cal.2d 213. In Meehan, the defendant Hopps, in an action seeking an accounting, moved to disqualify plaintiffs' counsel because of his former representation of defendant. By minute order, the trial court denied the motion. The Meehan court held that the minute order was an order refusing to grant an injunction and, as such, was an appealable order[3] "[b]ecause the trial court's order denying Hopps' motion left nothing further of a judicial nature for a final determination of his rights regarding opposing counsel, ..." (Id. at p. 217.)
(2c) It is now asserted by plaintiffs that the mandatory injunction executed by the court on January 4, 1978, cannot be deemed a final judgment for purposes of appeal. Plaintiffs point out that on June 29, 1979, a document, appropriately labelled a "judgment," was signed by the trial judge and duly entered as a part of the within action. It is plaintiffs' position that the June 29 judgment must be construed as the only final judgment that has been made in the case at bench.
A certified copy of the June 29 judgment is attached to plaintiffs' brief and plaintiffs request that we take judicial notice of this June 29 judgment pursuant to the provisions of sections 452, subdivision (d). and 459 of the Evidence Code.
*858 We have taken judicial notice of the June 29 judgment. It appears from the judgment itself that it was made following a motion by plaintiffs for an order to modify the January 4 mandatory injunction, and after plaintiffs and the Staley defendants had entered into a stipulation for such modification. Our review of the judgment of June 29, 1979, which modified the January 4 judgment, indicates that it contained no provisions which affected the rights of the Fuchsloch defendants, with the exception that it purported to reserve jurisdiction to enforce in the future the mandatory injunction of January 4 as modified by an order made on August 29, 1978, modifying the injunction of January 4 pursuant to a stipulation between the plaintiffs and the Staley defendants.
We conclude, however, that the judgment of June 29, 1979, cannot be considered as converting the mandatory injunction of January 4 into a nonappealable interlocutory judgment. We thus hold that the mandatory injunction, executed by the trial judge on January 4, 1978, constitutes a final judgment that is the subject of this appeal pursuant to Code of Civil Procedure section 904.1, subdivision (a). We therefore deny plaintiffs' second motion to dismiss defendants' appeal.
II
WAS THERE AN ABUSE OF DISCRETION BY THE TRIAL COURT IN RENDERING AGAINST DEFENDANTS A MANDATORY INJUNCTION JUDGMENT?
(5) Defendants assert that the trial court's mandatory injunction constituted an abuse of discretion because it was unreasonable to require that trees on their property be trimmed in height to the level of the roof of defendants' house. The roof-top limit was unreasonable, claim the defendants, because only one tree was involved a tall pine tree and that trimming it to roof-top level was not required to preserve plaintiffs' view. According to defendants, this pine tree only blocked 1 degree of a 175 degree view enjoyed by plaintiffs. Defendants do not refer to any portion of the record which establishes, from the evidence, that plaintiffs' view was a 175 degree view and that the interference by the pine tree above the roof of defendants' house was a 1 percent interference only.
Defendants argue that the order of the trial court, in fixing a roof-level height as the permissible height which would not cause an interference *859 with plaintiffs' view, was arbitrary, since the written restrictions upon which the lawsuit was based said nothing about a limitation on trees and shrubs to the height of the roof-level of the homes erected on the various properties.
There is no doubt that, if the court acted arbitrarily in fixing the roof-top level as the permitted height for trees and shrubs pursuant to the restrictive-covenant document, the order would constitute an abuse of discretion, since "`[i]n a legal sense discretion is abused whenever in the exercise of its discretion the court exceeds the bounds of reason, all of the circumstances before it being considered.'" (State Farm etc. Ins. Co. v. Superior Court (1956) 47 Cal.2d 428, 432 [304 P.2d 13].) We conclude, however, that the defendants' claim of an abuse of discretion is lacking in merit. All of the homes in the tract involved are limited to one story in height. In addition, the record reflects that the evidence established that the roof-top limit in height for trees and shrubs was necessary to preserve the view of the ocean and city from plaintiffs' property. Again, defendants point to no portion of the record to support their claim that the trial court failed to consider any appropriate public policy or the respective interests of the parties in concluding that the tree trimming ordered was necessary to effectuate the rights given to plaintiffs under the restrictive-covenant document.
III
DID THE TRIAL COURT IMPROPERLY INTERPRET THE RECORDED RESTRICTIVE-COVENANT DOCUMENT?
(6a) Defendants point out that the question at issue concerns the proper interpretation of various provisions of the recorded restrictive-covenant document. No extrinsic evidence was offered by any party as an aid to the interpretation contended for by such party to the action. Defendants request that we make an interpretation of the document contrary to the interpretation placed upon it by the trial court.
Defendants rely upon the principle set forth in Parsons v. Bristol Development Co. (1965) 62 Cal.2d 861, 865 [44 Cal. Rptr. 767, 402 P.2d 839], in which the court observed: "It is therefore solely a judicial function to interpret a written instrument unless the interpretation turns upon the credibility of extrinsic evidence. Accordingly, `An appellate *860 court is not bound by a construction of the contract based solely upon the terms of the written instrument without the aid of evidence [citations], where there is no conflict in the evidence [citations], or a determination has been made upon incompetent evidence [citation].'"
The basic provision to be interpreted is paragraph (11) of the written document. In pertinent part, paragraph (11) provides as follows: "[N]or shall any tree, shrub or other landscaping be planted or any structures erected that may at present or in the future obstruct the view from any other lot, and the right of entry is reserved by the Declarants to trim any tree obstructing the view of any lot."
Paragraph 14 of the document also has a reference to trees and shrubs. It provides: "No tree or shrub planted by the Declarants on any Lot or lot slope shall be removed at any time without the expressed permission of the Declarants or their successors."
Defendants urge that we give an interpretation to paragraph (11) that would establish the principle that no property owner is liable to another property owner for a tree obstructing the view unless the property owner sought to be held liable was the original planter of that tree. The pine tree on defendants' lot was not planted by defendants but by the former owner. Under the interpretation of paragraph (11) contended for by defendants, since they did not plant the particular pine tree, they would not be liable under this paragraph for the growth of the tree which now obstructs the view of plaintiffs.
Defendants also contend that, since paragraph (11) provides for a right of entry reserved to the declarants to trim any tree obstructing the view of any lot, the document should be interpreted to preclude a court from requiring any lot owner to trim trees which have grown to such height that they interfere with another lot owner's view. Defendants suggest that this one provision that gives the original owner (declarants) of all the lots a right of entry to trim trees obstructing the view of any lot, was intended to constitute the sole remedy for a lot owner whose view was being obstructed by the height of trees on adjacent lots.
In addition, defendants argue that the phrase, "obstruct the view," used in paragraph (11), is too ambiguous to be interpreted to require that trees be trimmed to roof-top level.
*861 (7a) Defendants assert that their suggested interpretation of paragraph (11) is mandated by the rule of law that favors a strict construction of restrictive covenants and an interpretation leaning toward the unencumbered, free use of property. "Restrictive covenants will be construed strictly against persons seeking to enforce them, and in favor of the unencumbered use of the property." (Biagini v. Hyde (1970) 3 Cal. App.3d 877, 880 [83 Cal. Rptr. 875].) Language similar to that set forth in Biagini is found in other cases. (Sain v. Silvestre (1978) 78 Cal. App.3d 461, 474 [144 Cal. Rptr. 478]; Terry v. James (1977) 72 Cal. App.3d 438, 443 [140 Cal. Rptr. 201]; Lincoln Sav. & Loan Assn. v. Riviera Estates Assn. (1970) 7 Cal. App.3d 449, 463 [87 Cal. Rptr. 150].)
The disjointed, single-paragraph, strict construction approach to a restrictive-covenant-document interpretation urged by defendants, is unacceptable in light of the fact that "[t]here is no doubt that these rules are correct so far as they go, but they give only part of the picture." (Bass v. Helseth (1953) 116 Cal. App.2d 75, 81 [253 P.2d 525, 36 A.L.R.2d 853].) A limitiation on the rule of strict construction of restrictive covenants was set forth in Lincoln Sav. & Loan Assn. as follows: "[T]he intent of the parties and the object of the deed or restriction should govern, giving the instrument a just and fair interpretation." (Lincoln Sav. & Loan Assn., supra, 7 Cal. App.3d 449, 463.)
(6b) The restrictive-covenant document involved in the case before us is made up of 17 separate paragraphs of restrictions on the use and improvements permitted on the lots making up the tract. (8) A cardinal principle of document construction is that a document must be "construed as a whole" so as "to give effect to every part thereof [citations], and particular words or clauses must be subordinated to general intent." (Newby v. Anderson (1950) 36 Cal.2d 463, 470 [224 P.2d 673].)
(6c) The beginning paragraph of the document states that the document establishes, "the following provisions, conditions, restrictions, and covenants, upon all said lots, or any interest therein all of which shall inure to and pass with each lot and shall apply to and bind the respective successor in interest or present owner or owners thereof, and each thereof is imposed upon all said lots as a servitude in favor of each and every other of said lots of said tract as dominant tenement or tenements, ..."
*862 This language in a recorded restrictive-covenant document for a residential tract of lots generally has been given an effect as set forth in Mock v. Shulman (1964) 226 Cal. App.2d 263 [38 Cal. Rptr. 39]. The Mock court observed: "The court found that the restrictions were imposed upon all the lots in the tract in which the respective lots of the parties were located; they were for the mutual benefit of the entire tract and the owners of the several lots therein, ran with the land and were binding upon and enforceable by each lot owner as against all other lot owners. The restrictions were in the form that has often been held adequate to create mutual equitable servitudes, breach of which will be enjoined." (Id. at p. 266.) (See also, Lincoln Savings & Loan Assn. v. Riviera Estates Assn., supra, 7 Cal. App.3d 449, 460; Arrowhead Mut. Service Co. v. Faust (1968) 260 Cal. App.2d 567, 579 [67 Cal. Rptr. 325].) (7b) We find this cogent observation set forth in Hannula v. Hacienda Homes (1949) 34 Cal.2d 442, 444-445 [211 P.2d 302, 19 A.L.R.2d 1268]: "[T]he primary object in construing restrictive covenants, as in construing all contracts, should be to effectuate the legitimate desires of the covenanting parties."
(6d) Viewed in context of the entire document, there is nothing vague or ambiguous about the restrictions imposed in paragraph (11). The language, "nor shall any tree, shrub or other landscaping be planted or any structures erected that may at present or in the future obstruct the view from any other lot," seems clearly designed to maintain the area above the one-story homes free and clear in order to preserve the view of the individual lot owners at various elevations. In making each lot both a dominant and subservient tenement, with respect to the various restrictions, paragraph (11) must be construed to subject defendants' property to the restriction against the height of trees which would interfere with a neighbor's view. We conclude, as did the trial court, that a limitation on the height of trees to roof-top level constitutes a reasonable interpretation of the language used in paragraph (11).
In view of all the restrictions and conditions contained in the restrictive covenant document, the topography of the tract and the elevation of the lots, and the limitation on structures to single-family dwellings one-story in height, the general plan created by Marquez Knolls, Inc., the owner of the lots who created the restrictive covenant document, reflects a plain intent and purpose to maintain a one-story height for all structures and trees in the tract in order to preserve the "view" of the individual lot owners.
*863 IV
PLAINTIFFS ARE NOT BARRED FROM ENFORCING THE RESTRICTIVE COVENANT PROVISIONS BY REASON OF ANY LACHES OR WAIVER
(9) Defendants assert that the restrictive-covenant document became unenforceable by reason of the doctrines of waiver and laches. Defendants rely upon the cases of Wedum-Aldahl Co. v. Miller (1937) 18 Cal. App.2d 745 [64 P.2d 762] and Butler v. Holman (1956) 146 Cal. App.2d 22 [303 P.2d 573]. These cases offer no assistance to defendants. In the Wedum-Aldahl Co. case, there was a change in conditions so that the court was able to observe that "[w]hen the conditions affecting a restrictive use of land have so changed as to defeat the purpose of the restriction and it has therefore become inequitable to enforce the restriction, the owner may be relieved therefrom in a proper proceeding." (Wedum-Aldahl Co., supra, 18 Cal. App.2d 745, 752.) And in Butler, the court held that the trial judge was justified in finding that the facts did not bring plaintiffs within the rule that "[l]aches is an unreasonable delay in asserting a right which causes such prejudice to an adverse party as renders the granting of relief inequitable." (Butler, supra, 146 Cal. App.2d 22, 28.)
The record before us is devoid of evidence that would support a finding that any conduct by plaintiffs amounted to a waiver, or that plaintiffs had delayed in bringing suit to call into play the equitable defense of laches. The testimony of one of the plaintiffs was to the effect that it was only during the three years that defendants had owned their property that the pine tree had grown above defendants' rooftop to the extent of impeding plaintiffs' view from their property.
V
THE RIGHTS OF THE TREE ITSELF
(10) Defendants urge that we adopt a legal principle that would give their pine tree an independent right to exist, without being trimmed to rooftop level a right that would be paramount to the rights created by the restrictive-covenant document. Unquestionably, the concept of bestowing upon nonhuman forms certain independent rights has been discussed in our legal literature. The growing recognition of the necessity to protect our environment has given some impetus to this concept, especially with respect to natural objects or parts of our environment. *864 (See Stone, Should Trees Have Standing? Toward Legal Rights for Natural Objects (1972) 45 So.Cal.L.Rev. 450.)
A decisional law advocacy of this concept is found in a dissenting opinion in Sierra Club v. Morton (1972) 405 U.S. 727, 741 [31 L.Ed.2d 636, 647, 92 S.Ct. 1361]. There, an argument was advanced for a "federal rule that allowed environmental issues to be litigated before federal agencies or federal courts in the name of the inanimate object about to be despoiled, defaced, or invaded by roads and bulldozers and where injury is the subject of public outrage." (Dis. opn. of Douglas, J.) (Italics added.)
The protection of elements of our environment and natural resources has come through legislative enactments which the courts interpret and enforce but without adoption of the principle that natural objects are given independent "rights" and "standing" in the courts. The cases cited by defendants are all of this nature. (Sierra Club v. Morton, supra; TVA v. Hill (1978) 437 U.S. 153 [57 L.Ed.2d 117, 98 S.Ct. 2279]; Minnesota Public Interest Research Group v. Butz (D.Minn. 1975) 401 F. Supp. 1276; National Audubon Society, Inc. v. Johnson (S.D.Tex. 1970) 317 F. Supp. 1330; State of Wyoming v. Hathaway (10th Cir.1975) 525 F.2d 66.)
Under the circumstances, we must decline defendants' request that we create, by judicial action, an independent right of existence in defendants' pine tree. Even if we were so inclined, we are compelled to take cognizance of the fact that defendants make no compelling argument for granting to their pine tree a right to exist free of being trimmed in accordance with the demands of the restrictive-covenant document which is binding on all parties to this litigation. A meaningfully significant comment is to the effect that "to say that the environment should have rights is not to say that it should have every right we can imagine, or even the same body of rights as human beings have. Nor is it to say that everything in the environment should have the same rights as every other thing in the environment." (Stone, Should Trees Have Standing? Toward Legal Rights for Natural Objects, supra, at pp. 457-458.)
The judgment is affirmed.
Kingsley, Acting P.J., and Swearinger, J.,[*] concurred.
NOTES
[1] Although named as a defendant, the record before us indicates that this corporate defendant was not served in the action.
[2] The Staley defendants defaulted and filed no answer or other pleading to plaintiffs' complaint.
[3] The Meehan case dealt with the appeal provisions of Code of Civil Procedure section 963 which was the forerunner of Code of Civil Procedure section 904.1, and contained language identical with the language now found in Code of Civil Procedure section 904.1, subdivision (f).
[*] Assigned by the Chairperson of the Judicial Council.
| null | minipile | NaturalLanguage | mit | null |
Conventional agricultural planters include a tow behind material dispensing implement that deposits planting material, such as seed and fertilizer, onto a furrowed farmland or similar planting surface. The implement may consist of multiple dispensing units that are supported by a common or shared frame that is towed by a tractor or similar vehicle. The dispensing units, commonly referred to as row units, for some planters may be grouped into two sets—a left side set and a right side set. Each of these sets may be independently controlled, which allows the operator to selectively dispense material from either of the left and right side units or both.
Each dispensing unit is associated with a material hopper and includes a material metering system that regulates the flow of material from the associated material hopper. The amount of material that is deposited is generally a function of the rotational speed of the seed meter. The rotational speed is transmitted from a transmission assembly that includes a friction or drive wheel that is maintained in frictional engagement with a carrying wheel. A planter will typically include at least two carrying wheels that collectively support the planter above the planting surface. For material to be deposited, the drive wheel and the carrying wheel must be engaged with one another.
The dispensing units of a planter can be separated into multiple sets, with each set associated with a respective friction drive. The transmissions can be separately controlled using electric clutches. Thus, when the transmissions are both engaged, all the dispensing units are allowed to deposit material onto the planting surface. When one or both of the transmissions are disengaged, the respective dispensing units will not deposit material onto the planting surface. This effectively allows the operator sectional on/off control during the planting or fertilizing process.
The rotational speed set by the transmissions controls how much material is deposited. Generally, if no rotation is transmitted by a transmission, i.e., from a disengaged transmission, the dispensing units associated therewith will not dispense any material. As noted above, an electric clutch can be used to disengage a transmission, but is also possible for no torque to be transmitted even when the transmission is engaged. During wet or muddy conditions, the carrying wheel may slip. Similarly, when the carrying wheel engages an obstruction and is momentarily suspended above the planting surface, no rotation is transmitted by the transmission. For rotation to be transmitted, the drive wheel must be rotated. Thus, when the carrying wheel is slipping, rotation is not passed through to the metering system resulting in no material being deposited. Conventional friction ground drive planters have used springs mounted to the frame to pull the drive wheels down into frictional engagement with the carrying wheels. Since the pull strength of the springs is constant, the degree of frictional engagement, if any, cannot be varied. As a result, there is very little flexibility in adjusting to match the operating conditions and torque generated by the seed meters. For example, during ideal operation conditions, less frictional engagement may be tolerated as the operator may not be expecting the carrying wheel to slip. For normal operation, the carrying wheel must overcome the bias placed thereon by the drive wheel to rotate and propel the planter forward. If the bias is set for less than ideal operating conditions however, more work is required for the towing vehicle to pull the planter. On the other hand, if the bias is set for ideal conditions, it may be difficult to plant or fertilize effectively during non-ideal conditions, such as wet or otherwise muddy conditions.
Additionally, the amount of torque required to drive the material metering systems is not universal for all seeds and granular fertilizers. For example, for some planters, more torque may be required for dispensing cotton seed than corn seed. | null | minipile | NaturalLanguage | mit | null |
ND Update - April 2004
One of the earliest specialists in the now popular Berlin Defence was the American genius, Harry Nelson Pillsbury. But this wasn't the only line that Pillsbury played, he also like the move 3...g6. Since then a number of strong Grandmasters have followed in his footsteps, such as Vassily Smyslov, Boris Spassky, Alexei Dreev, Zurab Azmaiparashvili and Ivan Sokolov.
Spanish 3...g6
4.d4 is the critical move:
, but not if followed up with 5.Nxd4. The games Teichmann - Pillsbury and Mackenzie - Steinitz featured the excellent and noteworthy manoeuvre 8... Ne7, forcing through ...d7-d5. I've given two games with this line because it's one that's likely to crop up at club level.
Next up, the critical 5.Bg5:
Shirov - Azmaiparashvili features two GM heavyweights and is an important theoretical game. When Azmai regroups his bishop to c6 things look about equal, but then Shirov misses a neat tactic. The move 9.0-0, as in Nisipeanu - Azmaiparashvili, is an interesting finesse, stopping 9...Bg4 because of 10.e5. But Azmai has a finesse of his own in 12...Re8, getting White to play 13.f4 when his e-pawn is weak.
Another try for White is 7.0-0, as in Rozentalis - Sokolov. Once again we get an endgame in which White wants to prove that Black's doubled pawn will kill him. But Sokolov demonstrates that Black has counterplay here, and maybe 12...Nh6!? is even better.
After 4.c3 the line 4...Nge7 5.d4 exd4 6.cxd4 d5 7.exd5 Nxd5 8.0-0 Bg7 9.Bg5 Qd6 has been played a lot by Ivan Sokolov, some times via a 3...Nge7 move order.
Timman's 12.Qe2+ did not prove its worth in Timman - Spassky. The queen really belongs on d2 or c1 where it can help with the manoeuvre Bg5-h6. Spassky gets good play and Timman doesn't sense the danger until it's too late.
In Sion Castro - Sokolov, Black attempts to improve the 12.Re1+ main line with 14...Bf5!?, which certainly looks interesting. Is 18...Ne2+ critical, or can Black play Fritz's simple rook move?
In Gelfand - Dreev, White was too ambitious, playing for the attack when he should have been trying to keep control. Black was better but couldn't convert in time trouble.
Black's other way to treat 4.c3 is by playing 4...a6:
White's two main retreats are to either c4 (as in Rozentalis - Balashov) or a4, as in Sokolov - Spassky. In both these games we see Black break free with ...f7-f5, a move to warm the hearts of attacking players.
All in all it seems that 3...g6 is still very playable, and not being used that much at present.
See you next month.
Do you want to improve your chess? Then either email me (as just below), or visit Tigerchess.com for more information about my coaching services | null | minipile | NaturalLanguage | mit | null |
Gorelick Rejected Attempt to Revise ‘Wall’ Memo
One of America’s most prominent federal prosecutors sought changes to the 1995 “wall” memo authored by then-Deputy Attorney General Jamie Gorelick, but most of the concerns expressed by U.S. Attorney Mary Jo White over the barriers erected between criminal and counter-intelligence investigations were rejected.
Gorelick’s “wall” memo was the subject of an April 26 CNSNews.com report, which quoted four sources as saying the memo erected barriers to intelligence-sharing between the FBI and intelligence agencies, and impeded the investigation of alleged Chinese espionage and illegal campaign donations to then-President Bill Clinton’s 1996 re-election campaign.
According to documents obtained by CNSNews.com, White, who was the U.S. attorney for the Southern District of New York, spelled out her concerns shortly after Gorelick wrote the memo establishing the new guidelines for federal investigations.
The reply that followed came from Michael Vatis, deputy director of the Executive Office of National Security, with Gorelick signing off on Vatis’ language.
White was concerned that Gorelick’s new guidelines for investigations had made it too complicated for the FBI to contact the U.S. attorney’s office and launch a probe of suspicious activity. White suggested that only the Office of Intelligence Policy and Review at the Department of Justice needed to approve such an investigation, and not the department’s criminal division.
However, the Vatis/Gorelick memo offered a blunt reply.
“I recommend rejecting this change,” the June 19, 1995 document stated. “[A] USAO [U.S. attorney’s office] should not be notified of a national security investigation — particularly one that has not yet developed into a criminal case — without the approval of the AAG [assistant attorney general], Criminal Division.”
The Vatis/Gorelick memo also addressed White’s reservations over how the new investigative guidelines would impact a probe under the Foreign Intelligence Surveillance Act (FISA). White contended that once the Justice Department’s Criminal Division had decided that criminal law enforcement concerns existed in a FISA investigation, the appropriate U.S. attorney should be contacted.
Vatis rejected this notion as well.
“Notifying the USAO as soon as law enforcement concerns exist — but before Crim. thinks that the investigation should ‘go criminal’ — is simply too early,” the document stated.
The current U.S. attorney general, John Ashcroft, recently de-classified the original Gorelick memo that established the new investigative guidelines. He did so shortly before testifying in front of the commission investigating the Sept. 11, 2001 terrorist attacks, calling the Gorelick memo “the single greatest structural cause for September 11.”
The June 19, 1995 memo from Vatis/Gorelick was included in a batch of documents released Wednesday by the Justice Department in response to a request by U.S. Sens. John Cornyn, R-Texas, and Lindsay Graham, R-S.C.
The senators, in a joint statement, asked the department to “provide key Gorelick documents” in response to the Sept. 11 commission’s “failure to hear testimony from a key Clinton administration Justice Department official [Gorelick], preventing the Congress from receiving a full accounting of intelligence and enforcement procedures that led to the tragic attacks.”
A separate statement, released by Cornyn’s office late Wednesday, charged that the newly released documents “substantially discredit former Deputy Attorney General — and current 9/11 Commission member — Jamie Gorelick’s claims of limited involvement in the promulgation of ‘the wall’ separating counterintelligence and law enforcement agencies.
“Specifically, the documents show that she was substantially involved in the development of the information-sharing policy and contradicts statements that the department’s policies under the Clinton-Reno administration enhanced, rather than restricted, such vital information sharing,” Cornyn stated.
‘Special Knowledge’
“These documents show what I’ve said all along: Commissioner Gorelick has special knowledge of the facts and circumstances leading up to the erection and buttressing of ‘that wall’ that, before the enactment of the Patriot Act, was the primary obstacle to the sharing of communications between law enforcement and intelligence agencies,” Cornyn’s statement continued.
Gorelick’s membership on the 9/11 commission has become controversial considering that she also worked in the Clinton administration’s Justice Department. Many Republicans in Congress have called for her to testify before the commission, a request the commission’s chairman has rejected.
“This is a person with knowledge of relevant facts. Either the Commission wants the whole truth, or it does not,” Cornyn stated.
“If it does, she should appear in public testimony so that the families of the victims, the American people and the Congress can have a full and complete picture of what led to the failures of 9/11,” Cornyn added.
The book that rocked the Obama Administration, instantly made national news and led to Congressional inquiries, resignations and forced Obama into cover up mode...IS BACK with more potent hard-hitting facts that Obama hopes you won't see.
Subscription
Fill out the form below to signup to our blog newsletter and we'll drop you a line when new articles come up. | null | minipile | NaturalLanguage | mit | null |
Cover art, photos and screenshots
The game is a sequel to The Legend of Zelda: The Wind Waker and is set several months after the events of The Wind Waker. The game starts out like the opening of The Wind Waker, telling the story of what happened in the last game. It tells you how Tetra and her pirate crew picked up Link from Outset island, and how they found out that Tetra is Zelda, and defeated Ganondorf. The story that is told is left off with Link riding aboard Tetra's ship. | null | minipile | NaturalLanguage | mit | null |
Q:
EmberJS - How to update dateFrom Query Param with Pikaday input
I am using the following input from the ember-pikaday addon:
<div class="col-sm-3"><label>Date From:</label>{{pikaday-input value=dateFrom name="dateFrom" class="form-control"}}</div>
I cannot get the value of the input to update the query parameter in the URL. If I use a standard input it works with the following controller:
import Controller from '@ember/controller';
export default Controller.extend({
queryParams: ['dateFrom', 'dateTo', 'unitNumber'],
dateFrom: null,
dateTo: null,
unitNumber: null,
actions: {
selected(x){
module = x
},
submitQuery(dateFrom, dateTo, unitNumber){
switch(module) {
case 'Option 1':
this.transitionToRoute('option1', {queryParams: {dateFrom: this.get('dateFrom'), dateTo: this.get('dateTo'), unitNumber: this.get('unitNumber') }})
break;
}
}
}
});
I suspect I need an action when a date is selected but I do not know how to handle the update within the action. I tried the following:
//onSelection=(action 'select') added to pikday input
select() {
dateFrom = this.set('dateFrom')
}
But it did not represent in the URL. I think that would be incorrect scoping anyway. I am still very new to Ember (and coding). Any help would be very appreciated.
A:
Here they mentioned how to use this package,
https://github.com/edgycircle/ember-pikaday#usage
{{pikaday-input onSelection=(action 'doSomethingWithSelectedValue')}}
In your case, you need to update the selected value from pikaday input to dateFrom property of the controller.
{{pikaday-input value=dateFrom name="dateFrom" class="form-control" onSelection=(action 'onChangeDateFrom') }}
define actions in the controller actions hash,
onChangeDateFrom(selectedValue)
{
this.set('dateFrom',selectedValue);
}
| null | minipile | NaturalLanguage | mit | null |
Using roquefortine C as a biomarker for penitrem A intoxication.
Penitrem A is a well-recognized tremorgenic mycotoxin produced by several Penicillium spp. However, most natural cases of penitrem A intoxication have been associated with Penicillium crustosum. Another Penicillium sp., Penicillium roqueforti, is used for the production of blue cheese and is found in silage and feeds. Penicillium roqueforti produces a mycotoxin, roquefortine C, which is also produced by P. crustosum. In contrast to a tremorgenic syndrome produced by penitrem A, roquefortine C toxicosis is characterized by a paralytic syndrome. Two cases of penitrem A intoxication in dogs are presented to investigate the use of roquefortine C as a biomarker for penitrem A exposure. The vomitus, serum, and urine were analyzed for roquefortine C and penitrem A. Results suggest that roquefortine C can be a sensitive biomarker for penitrem A intoxication. However, the detection of roquefortine C in the absence of penitrem A could merely suggest ingestion of blue cheese or spoilt silage or feed. A review of the literature did not identify any case positive for penitrem A but negative for roquefortine C. In cases in which both mycotoxins were detected, roquefortine C concentration was always higher than penitrem A concentration. In contrast, several cases have been described where the clinical history suggested penitrem A intoxication, but only roquefortine C was detected. In conclusion, roquefortine C can serve as a sensitive biomarker for penitrem A intoxication, but the clinical presentation needs to be considered for proper interpretation of its detection in the absence of penitrem A. | null | minipile | NaturalLanguage | mit | null |
Introduction {#Sec1}
============
Rho GTPases are molecular switches regulating important cellular functions like gene transcription and proliferation^[@CR1]^. They are well known regulators of the cytoskeleton and are essentially involved in cell migration, adhesion and polarity. Recent studies showed that dysregulation of Rho GTPases plays a pivotal role in cancer development^[@CR2]^ regulating proliferation, invasion and metastasis of various types of tumor cells^[@CR3]--[@CR5]^. In epithelia, progression from a persistent to an invasive phenotype requires loss of epithelial polarity and of cellular adhesion. This epithelial-to-mesenchymal transition (EMT) includes a change in gene expression pattern induced by several transcription factors, like Snail, ZEB1 or Twist^[@CR6],\ [@CR7]^. Recently, we showed that pro-migratory genes like PTGS2 and serpine1 are upregulated in a RhoA/C specific manner^[@CR8]^. Moreover, RhoC-dependent expression of Cox2 was involved in migration and invasion. In our studies, we noticed that expression or activation of Rho GTPases dramatically inhibited proliferation of MCF10A breast epithelial cells. Activation of Rho GTPases led to upregulation of the G-protein-coupled receptor family C group 5 member A (GPRC5A). GPRC5A is an orphan seven-transmembrane receptor identified in 1998 to be encoded by the retinoic acid (RA)-induced gene 3 (RAI3)^[@CR9]^. RAI3 is dysregulated in several human cancer entities. Interestingly, in tissues with high GPRC5A expression (lung), malignant cells are associated with reduced expression, indicating a tumor-suppressive role of the membrane protein. Studies with GPRC5A knockout mice suggested a tumor-suppressive function of the protein in lung adenocarcinoma. It was shown that GPRC5A interacts with the epidermal growth factor receptor (EGFR) thereby preventing its signaling and reducing proliferation of lung cancer cells^[@CR10]^. Consistently, RAI3 was downregulated in more than 60% of lung tumors^[@CR11]^. In sharp contrast, GPRC5A is highly expressed in breast cancer, colorectal and pancreatic carcinoma while its expression is low in the respective healthy tissues (for review see^[@CR12]^). In line with the contrasting expression, recent analysis of GPRC5A function revealed a controversial role in different cancer entities: Expression of GPRC5A in non-tumorigenic pancreatic epithelial cells promoted colony formation^[@CR13]^. Consistently, knockdown of RAI3 in pancreatic cancer cells led to decreased proliferation and reduced migration, indicating a pro-metastatic role for GPRC5A in pancreatic cancer^[@CR14]^. In colorectal cancer, elevated GPRC5A expression is associated with worse prognosis and induces cell proliferation and tumorigenesis in a colitis-associated cancer model^[@CR15]^. A tumor-suppressive effect of GPRC5A has been shown in MDA-MB-231 breast cancer cells^[@CR16]^. In these cells knockdown of RAI3 induced proliferation, migration and invasion. In contrast, silencing of GPRC5A had no effect on MCF7 cells with low EGFR levels, indicating a direct effect of GPRC5A on the EGFR stability and/or EGF-induced proliferation^[@CR16]^.
We intended to analyze the connection between Rho GTPases, GPRC5A expression and proliferation in breast epithelial and cancer cells. In our studies we used the benign breast epithelial cell line MCF10A with inducible expression of Rho proteins. Moreover, we treated the cells with the bacterial toxins Cytotoxic Necrotizing Factor 1 or Y (CNF1 or CNFY) to activate the endogenous pool of Rho GTPases. The toxins are taken up into mammalian cells by receptor-mediated endocytosis and are released from the endosome into the cytoplasm^[@CR17]^. Rho proteins are constitutively activated by the bacterial protein toxins which catalyze the deamidation of a specific glutamine residue in Rho proteins and thereby lead to constitutive activation of the GTPases (for review, see^[@CR18]^). Moreover, we knocked out RAI3 in MDA-MB-231 breast cancer cells and in benign MCF10A breast epithelial cells to study the effects of G-protein receptor deficiency in the absence and presence of Rho activation.
Materials and methods {#Sec2}
=====================
Cell culture and reagents {#Sec3}
-------------------------
MCF10A wild-type cell line was purchased from ATCC. MCF-10Atet cells allowing inducible expression of RhoA or RhoC together with GFP under the control of a second generation Tet-regulated transcriptional trans-activator and silencer were generated via nucleofection and have been described previously^[@CR8]^. All cells were grown in DMEM/F12 medium containing 5% horse serum, 100 U/ml penicillin, 100 µg/ml streptomycin, 20 ng/ml epidermal growth factor, 0.5 µg/ml hydrocortisone, 100 ng/ml cholera toxin and 10 µg/ml insulin. MDA-MB-231 culture medium contains DMDM/F12, 10% FCS, 100 U/ml penicillin and 100 µg/ml streptomycin. The cells were incubated at 37 °C and 5% CO~2~. For the induction of the transgenic overexpression of RhoA and RhoC doxycycline was used at 2 µg/ml. Staurosporine was dissolved in DMSO. Purification of CNF toxins was performed as described previously^[@CR19]^ and were used at 1 nM. Every 2--3 days, all inhibitors, inducers and toxins were re-added with new medium.
Colony formation assay {#Sec4}
----------------------
To check for the colony formation capacity cells were seeded in a 6-well plate (500 cells per well). Following overnight attachment, doxycycline was added where indicated and cultured for at least 6 days at 37 °C and 5% CO~2~. The medium was exchanged every three days. The colonies were fixed with glutaraldehyde (6,0% (v/v)) and stained with crystal violet (0,5% (w/v)) for 30 min. Afterwards the fixation staining solution was removed, the colonies were washed carefully with distilled water and dried at room temperature.
BrdU proliferation assay {#Sec5}
------------------------
As an indicator for proliferation DNA synthesis was measured using the chemiluminescent Cell Proliferation ELISA Kit (Roche) for quantifying the incorporation of 5-bromo-2′-deoxyuridine (BrdU). The cells were seeded in a black flat bottom 96-well plate (5,000 cells per well), allowed to adhere overnight and incubated for 48 h with doxycycline where indicated. Then BrdU was added for 4 h (final concentration 10 µM) and the assay was performed according to the manufacturers protocol. The chemiluminescent signal was detected using a 96-well plate reader (Tecan infinite M200, Tecan Trading AG). Each assay was performed in technical triplicates. Percentage of BrdU incorporation was calculated with the following equation: % BrdU incorporation = (experimental signal-background signal)/(control signal-background signal) × 100.
Cell viability assay {#Sec6}
--------------------
Metabolic activity was detected measuring the cellular capacity to reduce the indicator dye resazurin to resafurin with the CellTiter-Blue^®^ Cell Viability Assay Kit (Promega). The cells were seeded in a black flat bottom 96-well plate (5,000 cells per well), allowed to adhere overnight and incubated for 48 h with doxycycline, where indicated. After incubation the CellTiter-Blue^®^ Reagent was added for 3 h and fluorescence was detected using a 96-well plate reader (Tecan infinite M200, Tecan Trading AG). Each assay was performed in technical triplicates. Percentage of viable cells was calculated with the following equation: % viable cells = (experimental absorbance-background absorbance)/(control absorbance-background absorbance) × 100.
qRT-PCR {#Sec7}
-------
RNA was isolated from 2D cultures at indicated time points using the RNeasy Mini Kit (Qiagen) according to the manufactures protocol. Total RNA was eluted in RNAse-free distilled H~2~0 and the final concentration was determined on a photometer at 260 nm. For each sample, 1 µg RNA was applicated for cDNA synthesis using QuantiTect Reverse Transcription Kit (Qiagen) according to the manufacturers instructions. Finally, cDNA was diluted 1:10 and amplified using the GoTaq^®^ qPCR Master-Mix (Promega) on a Mastercycler^®^ Realplex (Eppendorf). Raw data were analyzed with LinRegPCR 2012. S29 served as a housekeeping gene reference. (Primers: GPRC5A forward: 5′-GCACTAGGGTCCAGAATGG-3′, GPRC5A reverse: 5′-ACCGTTTCTAGGACGATGC-3′, S29 forward: 5′-GGTTCTCGCTCTTGTCGTGTC-3′, S29 reverse: 5′-ATATCCTTCGCGTACTGACGG-3′).
Western blot analysis {#Sec8}
---------------------
Western Blot analysis were performed using standard techniques. After removing the medium, the cells were washed once with PBS and then lysed in NP-40 lysis buffer (50 mM Tris--HCL (pH 8.0), 150 mM NaCl and 1% NP-40) containing protease inhibitor (Complete, Roche) and phosphatase inhibitor (Sigma-Aldrich) if necessary. The samples were separated with a 12.5% or 7% SDS-PAGE and blotted using the wet blot method (25 mM Tris--HCl, 192 mM glycine, 20% (v/v) methanol, 100 V, 75 min). Incubation with the primary antibodies were performed overnight. Used antibodies are: anti-RhoA (67B9, Cell Signaling Technologies), anti-RhoC (D40E, Cell Signaling Technologies), anti-GAPDH (6C5, EMD-Millipore), anti-tubulin (DM1A, Santa Cruz), anti-GPRC5A (HPA007928, Atlas Antibodies), anti-EGFR (D38B1, Cell Signaling Technologies), anti-P-EGFR (Y1068, 1H12, Cell Signaling Technologies) and a suitable secondary antibody coupled to horseradish peroxidase (HRP).
Viral transduction {#Sec9}
------------------
For virus production, HEK phoenix cells were transfected with pMIBerry empty vector or with pMiBerry containing the RAI3 gene and stimulated with 5 mM sodium butyrate overnight. Transfection was controlled using fluorescent microscopy. Virus containing supernatant was used directly or stored at 4 °C. MCF10A cells were treated with virus containing supernatant (1 ml + 9 ml fresh culture medium) four times for 1 day each. Sufficient transduction was analyzed by red fluorescence before cells were serum starved.
CRISPR-Cas9 mediated GPRC5A knockout {#Sec10}
------------------------------------
We performed a knockout of GPRC5A in MDA-MB-231 and MCF10A cells using the CRISPR-Cas9 system. We followed the protocol from Ref.^[@CR1]^.
To design the targeting components and determine the 20-nt guide sequence (5ʹ GTCCCTGATGGTTGCCGCAA 3ʹ) within the sgRNA including a 5′-NGG PAM (5ʹ TGG 3ʹ), we used the online CRISPR-Cas9 Design tool provided by <https://tools.genome-engineering.org>. We selected a target site within Exon 2 of the human GPRC5A gene.
For construction of an expression plasmid for sgRNA and Cas9 we used the pSpCas9(BB)-2A-Puro (PX459) V2.0 Vector (AddGene Plasmid \#62988). For co-expression of sgRNA and Cas9, the partially complementary oligonucleotides encoding the 20-nt guide sequences were phosphorylated, annealed and ligated into the plasmid. The plasmid was then transformed into competent *E. coli* strain. To verify the sequence of the plasmid we isolated the plasmid DNA from several bacterial cultures and performed sequencing from the U6 promoter.
Transfection of MDA-MB-231 and MCF10A cells {#Sec11}
-------------------------------------------
To perform the knockout, MDA-MB-231 and MCF10A cells were transfected with the sequence verified plasmid. For the Insertion of DNA in mammalian cells Lipofectamin 2000 (Invitrogen, Thermo Fisher Scientific) was used according to the manufacturer\'s instructions.
For transfection 1 million cells per well were seeded into a 10 cm dish. The confluency was 60--80%. Due to the selectable marker on the pSpCas9(BB)-2A-Puro (PX459) V2.0 Vector the cells were selected through a Puromycin treatment with 1,0 µg/ml Puromycin over two days.
Clonal isolation of cell lines {#Sec12}
------------------------------
After transfection and selection, isolation of clonal cell lines was achieved by serial dilution. After an expansion period the new single cell lines where each tested for a GPRC5A knockout through PCR and Western Blot.
Statistical analysis {#Sec13}
--------------------
For all statistical analysis GraphPad Prism 5.0 was used. All values, bars and error bars represent mean + standard deviation (SD). A p-value of \< 0.05 was considered as statistically significant.
Results {#Sec14}
=======
RhoA/C expression or activation inhibits proliferation of MCF10A human breast epithelial cells {#Sec15}
----------------------------------------------------------------------------------------------
We intended to study the effect of RhoA/C expression or activation on the proliferation of breast epithelial cells. Therefore, we used sublines of human benign MCF10A cells, in which expression of either GFP, simultaneous expression of GFP and RhoA or expression of GFP and RhoC can be induced by addition of doxycycline. Time- and dose-dependent expression of the proteins following addition of doxycycline (+ dox) was analyzed by Western Blotting previously^[@CR8]^. In a first set of experiments, colony formation assays were performed by growing the cell-lines in the absence or presence of doxycycline for 6 days. Expression of GFP had no effect on colony formation. In contrast, we detected a severe inhibition of the colony formation capacity of MCF10A cells following expression of GFP and RhoA or expression of GFP and RhoC, respectively (Fig. [1](#Fig1){ref-type="fig"}A). Colony formation depends on proliferation and viability as well as on differences of the cell size, contact inhibition and other cellular properties. First, we studied apoptosis. As expected, expression of RhoA or RhoC did not induce cell death. Staurosporine was used as positive control (Fig. [1](#Fig1){ref-type="fig"}B). Measurements of the metabolic activity as an indicator for cell viability showed a slight reduction to 90 or 80% in consequence of RhoA or RhoC overexpression. This moderate effect indicates that the reduced colony forming capacity of Rho expressing cells was not exclusively based on reduced viability (Fig. [1](#Fig1){ref-type="fig"}C). To measure proliferation, BrdU incorporation into newly synthesized DNA was detected. Doxycycline-induced expression of RhoA or RhoC reduced cell proliferation to about 50 to 60% compared to non-induced cells (Fig. [1](#Fig1){ref-type="fig"}D). In all experiments, RhoC had stronger effects than RhoA (compare Fig. [1](#Fig1){ref-type="fig"}B middle and right).Figure 1Expression of RhoA or RhoC inhibits proliferation of MCF10A cells. MCF-10Atet cells were transfected with RhoA plus GFP (RhoA), RhoC plus GFP (RhoC) or GFP (GFP, empty vector control)-containing constructs under the control of a tet-ON-promoter. Expression of GFP/Rho was induced by addition of 2 µg/ml doxycycline. (**A**) Crystal violet-stained colonies of GFP-, RhoA- or RhoC-expressing cells after 6 days treatment with (+ Dox) or without (−Dox) doxycycline (n = 3). (**B**) Analysis of apoptosis induction after expression of RhoA, RhoC or GFP for 48 h, respectively. PARP cleavage was detected by Western Blot analysis. Treatment of the cells with 1 µM staurosporine for 16 h was used as a positive control. Representative Western Blots of three independent experiments are shown. Tubulin was used as a loading control. (**C**) Cell viability was measured following expression of RhoA, RhoC or GFP for 48 h. Metabolic activity was normalized to not induced cells. Data of three independent experiments were quantified and analyzed using two-way ANOVA. (**D**) BrdU incorporation after 48 h expression of RhoA, RhoC or GFP was measured to quantify the proliferation of MCF10A cells. DNA synthesis was normalized to the not induced cells. Data of three independent experiments were quantified and analyzed using two-way ANOVA. \*\*p \< 0.01, \*\*\*p \< 0.001, \*\*\*\*p \< 0.0001.
To study whether the reduced metabolic activity and proliferation was based on the strong protein expression per se, we stimulated the endogenous pool of Rho GTPases by treatment of MCF10A cells with two bacterial toxins: CNFY predominantly activates RhoA,B,C whereas CNF1 activates Rac1, Cdc42 and RhoA,B,C. As controls, we used the respective catalytically inactive mutants of the toxins (CNF1 C866S and CNFY C865S). Effective uptake of the toxins into MCF10A cells and Rho activation was shown previously^[@CR8]^. The colony formation assay was performed with MCF10A cells in the presence or absence of CNFs for 6 days. As shown in Fig. [2](#Fig2){ref-type="fig"}, a similar inhibitory effect on colony formation (A), metabolic activity (C) and proliferation (D) was achieved by activation of Rho GTPases due to treatment of the cells with CNFY. However, treatment with CNF1 had no effect on colony formation, indicating that activation of other Rho GTPases like Rac and/or Cdc42 may counteract the RhoA,B,C-induced inhibition of proliferation/colony formation^[@CR20]^. To exclude an effect of the toxins on cell death, we additionally analyzed PARP-cleavage. Both toxins did not induce apoptosis of MCF10A cells (Fig. [2](#Fig2){ref-type="fig"}B). Metabolic activity was even slightly increased in the presence of CNF1 (Fig. [2](#Fig2){ref-type="fig"}C). To measure proliferation exclusively, BrdU incorporation was analyzed in the presence of the toxins or their inactive mutants, respectively. CNFY but not CNF1 reduced cell proliferation to about 60% compared to untreated controls (Fig. [2](#Fig2){ref-type="fig"}D).Figure 2Intoxication with CNFY inhibits proliferation of MCF10A cells. (**A**) MCF10A wild-type cells were treated for 6 days with CNF1 or CNFY. The inactive toxin mutants served as a negative control. Cell colonies were stained with crystal violet (representative of n = 3). (**B**) Detection of PARP cleavage after intoxication with CNF1 or CNFY for 48 h. Treatment of the cells with 1 µM staurosporine for 16 h was used as a positive control, CNF1 C866S and CNFY C865S as negative controls, respectively. Representative Western Blots of three independent experiments are shown. Tubulin served as a loading control. (**C**) Cell viability of MCF10A wild-type cells was measured after CNF intoxication for 48 h. Metabolic activity was normalized to the untreated cells. Data of three independent experiments were quantified and analyzed using one-way ANOVA. (**D**) BrdU incorporation after intoxication with CNF1 or CNFY for 48 h. DNA synthesis was normalized to the untreated cells. Data of three independent experiments were quantified and analyzed using one-way ANOVA. \*p \< 0.05, \*\*\*p \< 0.001.
Rho-dependent expression of GPRC5A in MCF10A cell lines {#Sec16}
-------------------------------------------------------
Recently, we performed a genetic screen to analyze genes regulated by expression of Rho proteins in MCF10A cells. We detected several pro-migratory genes upregulated following RhoA and/or RhoC expression^[@CR8]^. Additionally, one of the genes with higher expression was RAI3^[@CR8]^. It encodes for an orphan G-protein coupled receptor GPRC5A differently expressed in several human cancer entities. Interestingly, RAI3 was recently identified as a protein with a significant influence on proliferation of EGFR expressing cells^[@CR16]^. Therefore, we asked whether upregulation of RAI3 might be involved in the Rho-dependent inhibition of proliferation of MCF10A cells. First, we validated the Rho-dependent induction of RAI3 mRNA levels by qRT-PCR and additionally studied the respective GPRC5A protein levels by Western Blotting. In line with the genetic screen, the amount of RAI3 mRNA increased about two-fold following induction of RhoA or RhoC expression by doxycycline for 24 h (Fig. [3](#Fig3){ref-type="fig"}A). Consistently, GPRC5A expression correlates with mRNA synthesis. It increased following induction of RhoA/C expression, whereas the level of EGFR did not change (Fig. [3](#Fig3){ref-type="fig"}B, quantification in Fig. [3](#Fig3){ref-type="fig"}C). We additionally studied the effect of Rho activation by toxin treatment and detected the same increase of RAI3 mRNA and GPRC5A protein in cells treated with CNF1 or CNFY, respectively (Fig. [3](#Fig3){ref-type="fig"}D,E, quantification in Fig. [3](#Fig3){ref-type="fig"}F). As expected, treatment of the cells with catalytically inactive toxin mutants had no effect. The data show that GPRC5A expression is upregulated downstream of RhoA and RhoC.Figure 3RhoA and RhoC induce the expression of GPRC5A. (**A**) GPRC5A mRNA level was measured by qRT-PCR following expression of RhoA, RhoC or GFP in MCF-10Atet cells (+ Dox) for 24 h. S29 was used as a housekeeping gene control. RNA levels after expression induction (+ Dox) were normalized to the untreated control (− Dox). Data of five independent experiments were quantified and analyzed using two-way ANOVA. (**B**) Representative Western Blot showing GPRC5A and EGFR protein levels following stimulation of RhoA, RhoC and GFP expressing MCF-10Atet cells for 0, 24 or 48 h with doxycycline (Dox). GAPDH and tubulin served as loading controls, respectively. Note that high expression of RhoC leads to decreased expression of RhoA, which has been described earlier^[@CR8]^. (**C**) Quantification of B. GPRC5A protein level was normalized to GAPDH (left), EGFR protein level was normalized to tubulin (right). Data of three independent experiments were quantified and analyzed using two-way ANOVA. (**D**) GPRC5A mRNA level was measured by qRT-PCR after intoxication of MCF10A wild-type cells for 24 h with CNF1, CNF1 C866S, CNFY or CNFY C865S, respectively. S29 was used as a housekeeping gene control. RNA levels were normalized to the untreated (utr) control. Data of five independent experiments were quantified and analyzed using one-way-ANOVA. (**E**) Representative Western Blot (n = 3) showing GPRC5A and EGFR protein levels after intoxication with CNF1, CNF1 C866S, CNFY or CNFY C865S for 0, 24 or 48 h. GAPDH and tubulin served as loading controls. (**F**) Quantification of E. GPRC5A protein level was normalized to GAPDH (top), EGFR protein level was normalized to tubulin (bottom). The treatment with CNF1 and CNFY for two days GPRC5A expression was increased but the EGFR level was not affected. Data of three independent experiments were quantified and analyzed using one-way ANOVA. \*p \< 0.05, \*\*p \< 0.01, \*\*\*p \< 0.001.
Effect of GPRC5A expression on ligand-induced EGFR phosphorylation {#Sec17}
------------------------------------------------------------------
In former studies, an inhibition of EGFR signaling by direct interaction with GPRC5A was shown^[@CR10]^. To analyze the effect of Rho activation solely on EGF-dependent proliferation, we studied colony formation and DNA synthesis using serum starved MCF10A cells. As revealed by dose response analysis of BrdU incorporation into newly formed DNA, the optimal EGF concentration necessary to maximally stimulate proliferation of serum starved MCF10A cells is 20 ng/ml (EC~50~ = 1.3 ng/ml, Fig. [4](#Fig4){ref-type="fig"}A). Therefore, colony formation assays were performed with 20 ng/ml EGF in the presence or absence of the bacterial toxins or their catalytically inactive mutants, as indicated in Fig. [4](#Fig4){ref-type="fig"}B. In contrast to the experiments in full medium (containing 5% serum, Fig. [1](#Fig1){ref-type="fig"}A), colony formation was blocked in medium with low serum (1%, supplemented with EGF) in the presence of CNF1 or CNFY, respectively. In line with the colony formation assay, both toxins reduced basal and EGF-stimulated BrdU incorporation, whereas the catalytically inactive mutants had no effect (Fig. [4](#Fig4){ref-type="fig"}C). These data indicate that Rho activation blocked EGF-dependent proliferation. Therefore, we studied direct phosphorylation of the EGFR following EGF stimulation in the presence and absence of the toxins by Western Blotting. For detection of EGFR phosphorylation, we used an antibody against phospho-EGFR (Fig. [4](#Fig4){ref-type="fig"}D, top lane) and a second antibody, which detects only the non-phosphorylated EGFR (Fig. [4](#Fig4){ref-type="fig"}D, middle lane). EGF-stimulated phosphorylation was reduced by treatment with the toxins. Rho stimulation by CNFs led to reduced EGF-dependent receptor phosphorylation and proliferation probably by enhanced expression of GPRC5A. CNF1 and CNFY led to reduced basal DNA synthesis and impaired the EGF-dependent proliferation, respectively.Figure 4CNF1 and CNFY inhibit the EGF-dependent proliferation of MCF10A cells. (**A**) Dose versus response curve of BrdU incorporation after EGF stimulation. MCF10A cells were serum starved for 24 h and then stimulated with different EGF concentrations (0, 1, 2, 5, 10, 20, 50, 100 ng/ml) for 24 h. BrdU incorporation was measured as relative light units per seconds (rlu/s) and the EGF response was calculated using non-linear regression analysis. Data of three independent experiments are shown. EC~50~ = 1.3 ng/ml. Saturation of the stimulation was reached at 20 ng/ml EGF. (**B**) MCF10A cells were intoxicated with CNF1, CNFY or their inactive mutants for 2 days. After serum starvation for three h the cells were stimulated with 20 ng/ml EGF in medium containing 1% serum for eight days. Then, the colonies were fixed and stained with crystal violet (representative of n = 3). (**C**) MCF10A cells were treated with CNF1, CNFY or their inactive mutants for 48 h under serum starvation and were then stimulated with 0 or 20 ng/ml EGF for 24 h in the presence of the toxins, respectively. BrdU incorporation was measured and normalized as fold induction of the non-intoxicated unstimulated control. Data of three independent experiments were quantified and analyzed using two-way ANOVA. \*\*\*p \< 0.001, \*\*\*\*p \< 0.0001. (**D**) Western Blot analysis of EGFR phosphorylation after CNF intoxication. MCF10A cells were treated with CNF1, CNFY or their inactive mutants for 48 h under serum starvation. Then, the cells were stimulated with 0, 1.3 or 20 ng/ml EGF for five min. Representative Western Blots of three independent experiments are shown. Tubulin was used as a loading control.
Expression of GPRC5A is sufficient to inhibit proliferation {#Sec18}
-----------------------------------------------------------
To analyze, whether expression of GPRC5A is sufficient to influence EGFR signaling, we transiently expressed the hepta-helical receptor in MCF10A cells by viral transduction. Following addition of virus-containing supernatants (empty vector control and GPRC5A, respectively), cells were serum starved for 2 days, stimulated with EGF (1.3 and 20 ng/ml, respectively) for 5 min. Cleared lysates were analyzed for expression of GPRC5A, phospho-EGFR and total EGFR by Western Blotting.
As shown in Fig. [5](#Fig5){ref-type="fig"}A, the cells show about 2 to 3-fold higher expression compared to the empty vector-transduced MCF10A cells. Phosphorylation of the EGFR following stimulation with EGF was significantly reduced (by about 50%) in GPRC5A expressing cells (Fig. [5](#Fig5){ref-type="fig"}B). Additionally, to measure proliferation, BrdU incorporation into newly synthesized DNA was detected in GPRC5A overexpressing cells. Therefore, transduced cells (empty vector control and GPRC5A, respectively) were seeded into 96 well plates, serum starved for two days and stimulated with EGF (20 ng/ml) for 4 h in the presence of BrdU. As shown in Fig. [5](#Fig5){ref-type="fig"}C, EGF-stimulated proliferation of the empty vector transduced cells was increased about 1.5 times compared to the unstimulated cells (set to 1). In contrast, there was no increased BrdU incorporation detectable in GPRC5A expressing cells following exposure to EGF. The data show that EGF-stimulated proliferation was inhibited due to enhanced expression of GPRC5A.Figure 5Expression of GPRC5A reduces EGF stimulated phosphorylation of EGFR. (**A**) Western Blot analysis of EGFR phosphorylation following transient expression of GPRC5A. In MCF10A cells, RAI3 expression was induced by viral transduction using pMiBerry-GPRC5A or empty vector as control. After serum starvation for 48 h, the cells were stimulated with 0, 1.3 or 20 ng/ml EGF for five min. Representative Western Blots of three independent experiments are shown. GAPDH was used as loading control. (**B**) Quantification of A. Data of three independent experiments were quantified and analyzed using two-way ANOVA. \*\*\*p \< 0.001, \*\*\*\*p \< 0.0001. (**C**) In MCF10A cells GPRC5A was expressed by viral transduction. After serum starvation for 48 h, the cells were stimulated with 20 ng/ml EGF and incubated with BrdU for 4 h. DNA synthesis was normalized to the unstimulated empty vector control. Data of three independent experiments were quantified and analyzed using two-way ANOVA. \*\*p \< 0.01.
GPRC5A is required for stabilization of monomeric EGFR {#Sec19}
------------------------------------------------------
To study the effect of Rho activation per se on EGFR signaling and proliferation, we performed a knockout of GPRC5A in MCF10A cells proven by Western Blot (Fig. [6](#Fig6){ref-type="fig"}A, quantification in Fig. [6](#Fig6){ref-type="fig"}B). Interestingly, the expression of EGFR decreased to 20 and 55% and under serum starvation to 15 and 20%, respectively.Figure 6Knockout of GPRC5A in MCF10A cells inhibits EGF-dependent proliferation due to downregulation of EGFR. (**A**) Western Blot analysis of MCF10A wild-type and knockout cells in full medium and under serum starvation, respectively. GAPDH and tubulin were used as a loading controls. Representative Western Blot of three independent experiments are shown. (**B**) Quantification of A. GPRC5A expression was normalized to GAPDH, EGFR expression to tubulin. Data of three independent experiments were analyzed using one-way ANOVA. \*\*p \< 0.01, \*\*\*p \< 0.001, \*\*\*\*p \< 0.0001. (**C**) Western Blot analysis of EGFR phosphorylation after CNF intoxication of MCF10A GPRC5A knockout cells. The cells were treated with CNF1 or CNFY for 48 h under serum starvation. MCF10A wild-type cells were grown equally without intoxication as control. Then, the cells were stimulated with 0 or 20 ng/ml EGF for five min. Representative Western Blots of three independent experiments are shown. Tubulin was used as a loading control. (**D**) MCF10A wild-type and GPRC5A knockout cells were grown for 48 h under serum starvation and were then stimulated with 0 or 20 ng/ml EGF for 24 h. The knockout cells were furthermore intoxicated with CNF 1 or CNFY, respectively. BrdU incorporation was measured and normalized as fold induction of the non-intoxicated unstimulated MCF10A wild-type cell control. Data of three independent experiments were quantified and analyzed using two-way ANOVA. \*\*\*p \< 0.001, \*\*\*\*p \< 0.0001.
To analyze the effect of Rho activation on EGF-dependent proliferation, we studied EGFR phosphorylation and DNA synthesis using serum starved MCF10A cells as described above and stimulated them with 20 ng/ml EGF. In GPRC5A knockout cells, the amount of phosphorylated EGFR was significantly diminished and additional activation of Rho GTPases by CNF1 or CNFY had no effect (Fig. [6](#Fig6){ref-type="fig"}C). BrdU incorporation in RAI3 depleted cells was significantly reduced under serum starvation and almost blocked, even after EGF stimulation. As expected, intoxication with CNF1 or CNFY was not sufficient to reactivate proliferation (Fig. [6](#Fig6){ref-type="fig"}D). Our data show that the amount of EGFR is influenced by the expression of GPRC5A and not mediated by toxin-induced Rho activation. The monomer seems to be stabilized in the presence of GPRC5A, which on the one hand inhibits degradation and on the other hand negatively influences dimerization and signaling of the receptor.
Rho activation in breast cancer cells carrying an activating Ras mutation had no effect on proliferation, whereas knockout of GPRC5A increased cell division {#Sec20}
------------------------------------------------------------------------------------------------------------------------------------------------------------
Our data suggest an inhibitory effect of GPRC5A on proliferation of breast epithelial cells most likely by diminished EGFR stimulation. To verify that this influence on proliferation was predominantly based on EGFR signaling, the effect of the toxins was analyzed on MDA-MB-231 breast cancer cells bearing an activating Ras mutation and are therefore independent on EGFR signaling. We induced a knockout of RAI3 in MDA-MB-231 cells by CRISPR-Cas9 and verified the functional gene knockout by Western Blot as shown in Fig. [7](#Fig7){ref-type="fig"}A (quantification in Fig. [7](#Fig7){ref-type="fig"}B). As expected, knockout of GPRC5A increased the colony forming capacity of MDA-MB-231-cells (Fig. [7](#Fig7){ref-type="fig"}C) and stimulated BrdU incorporation by about 20% compared to the wild-type cells but did not affect cell viability (Fig. [7](#Fig7){ref-type="fig"}D,E). The data indicate an anti-proliferative effect of GPRC5A also in cells with dominant active Ras. Our data are in line with recent experiments in which knockdown of GPRC5A in MDA-MB-231 breast cancer cells promoted colony formation and proliferation^[@CR16]^. Neither cell viability nor proliferation of MDA-MB-231 wild-type and GPRC5A knockout cells was affected by CNF1 or CNFY most likely because EGFR downstream signaling was already activated in MDA-MB-231 cells (Fig. [7](#Fig7){ref-type="fig"}F,G). The data show that it is not the effect of the Rho-activating toxins which influences the proliferation and colony formation but Rho-induced expression of GPRC5A and inhibition of EGFR signaling.Figure 7Knockout of GPRC5A in MDA-MB-231 cells does not inhibit proliferation. (**A**) Western Blot analysis of MDA-MB-231 wild-type and knockout cells. GAPDH was used as loading control (representative of n = 3). (**B**) Quantification of A. GPRC5A expression was normalized to GAPDH. Data of three independent experiments were analyzed using t-test. \*\*\*\*p \< 0.0001. (**C**) MDA-MB-231 wild-type and knockout cells were grown for ten days. Cell colonies were stained with crystal violet (n = 3). (**D**) MDA-MB-231 wild-type and GPRC5A knockout cells were grown for 48 h. Cell viability was measured and normalized to the wild-type cells. Data of three independent experiments were quantified and analyzed using t-test. (**E**) MDA-MB-231 wild-type and GPRC5A knockout cells were grown for 48 h. BrdU incorporation was measured and normalized to the wild-type cells. Data of three independent experiments were quantified and analyzed using t-test. \*\*p \< 0.01. (**F**) Cell viability of MDA-MB-231 wild-type and GPRC5A knockout cells was measured after CNF intoxication for 48 h. Metabolic activity was normalized to the untreated wild-type cells. Data of three independent experiments were quantified and analyzed using two-way ANOVA. (**G**) BrdU incorporation of MDA-MB-231 wild-type and GPRC5A knockout cells was measured after CNF intoxication for 48 h. DNA synthesis was normalized to the untreated wild-type cells. Data of three independent experiments were quantified and analyzed using two-way ANOVA.
Discussion {#Sec21}
==========
Cancer is an extremely heterogeneous disease and even cells of one cancer entity often show a wide variety of different gene profiles and morphological characteristics. The epidermal growth factor receptor (EGFR) plays a critical role in cancer since it mediates proliferation by activation of Ras and STAT. EGFR kinase inhibitors have successfully developed. Recently, it was shown that an orphan G protein coupled receptor (GPCR) interacts with EGFR, sequestering it as a monomer and thereby inhibiting receptor signaling. In line with this, expression of GPRC5A is low in non small cell lung cancer (NSCLC)^[@CR21]^. Moreover, GPRC5A knockout mice developed spontaneous lung cancer^[@CR11]^ and GPRC5A loss was associated with increased cell proliferation and resistance to cell death^[@CR22]^. The gene was thus designated a tumor suppressor. In pancreatic cancer however, knockdown of RAI3 (the gene for GPRC5A) led to decreased proliferation and reduced migration, indicating a pro-metastatic role for GPRC5A in pancreatic cancer^[@CR14]^. In breast cancer, the picture is diverse: According to the "bioportal" website, GPRC5A expression analysis revealed more breast tumor tissues with protein amplification than with deletions. However, the diverse role of GPRC5A in tumor formation is reflected by recent studies with breast cancer cell lines. Knockdown of GPRC5A promotes colony formation and proliferation by activation of EGFR in MDA-MB-231 cells but showed no effect in MCF7 cells expressing only low amounts of EGFR^[@CR16]^. In cells carrying an activating Ras mutation, GPRC5A has less effect on proliferation and survival. This proves that the effect of GPRC5A on proliferation is mediated by its influence on EGFR, which also activates other signaling pathways as for example PI3K. Our data indicate that only the EGFR dimer is stably expressed at the cell membrane, whereas the empty receptor needs GPRC5A to be stabilized, suggesting that the level of GPRC5A on the one hand interferes with dimerization and signaling of EGFR but on the other hand stabilizes the EGFR monomer against degradation (model depicted in Fig. [8](#Fig8){ref-type="fig"}).Figure 8Model depicting various effects of GPRC5A on EGF-dependent proliferation. Under physiological GPRC5A expression it interacts with the unstimulated EGFR and stabilizes the protein at the cell membrane. After EGF stimulation the EGFR dissociates from RAI3 and forms dimers for activation of the kinase domain leading to further signal transduction (middle). When GPRC5A is overexpressed, it behaves like a dissociation inhibitor. Upon stimulation the EGFR monomers cannot form dimers. Less EGFR phosphorylation results in diminished proliferation (right). GPRC5A depletion results in downregulation of the EGFR and thereby inhibits proliferation. The mechanism has to be further investigated (left).
The inhibitory effect of GPRC5A on proliferation may vary, if other EGFR family members are expressed in that sense that Her2 stabilizes EGFR. It is not known whether human EGF receptor 2 (Her2) also interacts with GPRC5A and whether its signaling is also blocked. In a recent publication by Fichter et al. it is shown that homo- and heterodimers of EGFR and Her2 form differently in diverse tissues, which may explain varying effects of GPRC5A expression^[@CR23]^.
Here, we identified RAI3 as a gene upregulated by Rho GTPase signaling in breast epithelial cells. Expression of GPRC5A significantly reduced proliferation of the cells. Moreover, knockout of RAI3 also inhibited EGF-dependent proliferation due to EGFR downregulation. The GPCR is an orphan receptor. Neither the ligand nor its intracellular signaling partner is known. However, recent deletion studies showed that it is not the signaling of the GPCR to heterotrimeric G-proteins, which influences EGFR activity. Rather the transmembrane part of GPRC5A seems to be important because deletion of the N-terminus, or deletion of the C-terminus of the hepta-helical receptor did not affect its inhibitory action on EGFR signaling^[@CR10]^.
**Publisher\'s note**
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
We thank Jürgen Dumbach for excellent technical assistance and Sarah Lang for scientific discussion. We thank the MOTI-VATE program of the medical faculty for support of L.R.. The project was funded by the Deutsche Forschungsgemeinschaft (SFB 850 - C2). Open access funding provided by Projekt DEAL.
L.R., V.O. and G.S. performed experiments and prepared figures, G.S. wrote the manuscript and supervised the project. All authors reviewed the manuscript.
The authors declare no competing interests.
| null | minipile | NaturalLanguage | mit | null |
Attorneys
"This is pure, unadulterated bureaucratic confusion."
September 1, 2015
Huffington Post
The family of a woman allegedly killed by an immigrant who'd been repeatedly deported sued the San Francisco sheriff's office and federal authorities Tuesday over an alleged series of errors with tragic consequences.
Kate Steinle, 32, died on July 1 when she was struck by a single bullet while strolling with her father and a friend on a pier overlooking the San Francisco Bay. The man who allegedly pulled the trigger was Juan Francisco Lopez-Sanchez. He's pleaded not guilty, but said in a television interview that he found the gun beneath a bench and that it accidentally went off when he picked it up.
While a judge will determine if there's enough evidence for a trial against Lopez-Sanchez to proceed, Steinle's parents, Elizabeth Sullivan and James Steinle, on Tuesday announced lawsuits against San Francisco Sheriff Ross Mirkarimi, Immigration and Customs Enforcement officials and the Bureau of Land Management for variety of missteps.
They were filed as separate complaints because federal agencies must be sued individually, the family's attorney said.
The shooting turned into grist for a national debate about immigration because federal authorities had transferred Lopez-Sanchez to San Francisco in March to face a 20-year-old marijuana charge. After the San Francisco district attorney decided to not prosecute the case, the sheriff's office released Sanchez-Lopez in April because of a city law prohibiting the detention of immigrants without a warrant.
Mirkarimi and ICE have blamed each other for Lopez-Sanchez's release, with ICE saying the sheriff's office should have given a heads-up that Lopez-Sanchez was free, while the sheriff said ICE didn't submit its paperwork correctly.
"We have two different government bureaucracies pointing the finger at each other for failing to notify the other," said attorney Frank Pitre, who is representing the family. "We’re not talking about the release of an innocent, undocumented alien, we’re talking about a seven-time felon."
Lopez-Sanchez's rap sheet includes multiple convictions for heroin possession since 1993. He's been deported to Mexico five times between 1994 and 2009.
The lawsuits don't challenge San Francisco's "sanctuary city" law. But they claim that Mirkarimi violated federal law by issuing a memo in March that prohibits his staff from even contacting ICE, Pitre said. The complaint also contends that ICE bungled the paperwork by not seeking a warrant or judicial order to detain Lopez-Sanchez.
"This is pure, unadulterated bureaucratic confusion," Pirre said.
The gun that authorities say killed Steinle was a government-issued weapon of a Bureau of Land Management officer. BLM officers are supposed to keep their unloaded firearms stored in a locked container, but the loaded .40-caliber handgun was reported stolen from a backpack visible inside a vehicle parked in San Francisco in June. The suit names the BLM as a defendant because of the alleged mishandling of the weapon... (To read the entire article, please click HERE) | null | minipile | NaturalLanguage | mit | null |
Q:
Site won't center align in IE6
My site won't center align in IE6 for some reason. I cant understand why I'm sure I've done everything right but obviously not. The site is:
http://dreamdeals.rnmtest.co.uk/
A:
Your special offers container is overflowing in ie6. Try removing that container and see if it will center than. Otherwise try to fix it using overflow:hidden on the mentioned container.
Also the icons are showing the whole sprite you use.
| null | minipile | NaturalLanguage | mit | null |
Western Australia
In this month’s article, Boris Mar is heading north, through Australia’s biggest and most isolated state, Western Australia. He will be photographing some of its national parks which only recently have become accessible
When photographing the majority of national parks in the USA or Europe, it is very difficult to be original. All the known vistas and compositions have been captured numerous times before. The challenge lies in finding a unique composition, without repeating what has been done already by others. In Western Australia, a photographer has the opportunity to set the standard; an opportunity to find a unique composition and one that will act as inspiration for generations of photographers to come. Many of the national parks in Western Australia only recently have become accessible: this is a very...
Read this article, and many more, in High Definition, inside Issue 21 of Landscape Photography Magazine. | null | minipile | NaturalLanguage | mit | null |
Jay Mohr and Jay Glazer
Show Summary
Adam opens the show with a jag about Shaft, and recalls some more hilarious stories from Disneyland. Jay Mohr is also in studio, and talks with Adam about his experience interviewing Deacon Jones. The guys also debate the movie Drive, and Adam gives his review of Django Unchained. Jay Glazer then enters the studio and talks about how Jay Mohr helped him start his career. They talk about Glazer’s attempts at standup, and the ‘altruistic gangster’ known as Kat Williams.
Adam and the Jays discuss some upcoming NFL games, and compare the legacies of Tom Brady and Peyton Manning. Alison then starts the news discussing Sandy Hook being back in session. They also discuss Julianne Hough’s emotional and physical abuse growing up, and Adam explains his theory about why dancers are usually a mess. As the show wraps up, the guys discuss death row, and two teens that were arrested for drugging their parents so they could stay up late. | null | minipile | NaturalLanguage | mit | null |
Moonwalking Forward
My Story of Self-Education – My 1st Pecha Kucha
Last Saturday I was invited as speaker by ID Campus for the Pecha Kucha Maastricht in Liège. A “Pecha Kucha” is a presentation format that is based on a simple idea: 20 images x 20 seconds. This means to me a totally new exercise so new challenge I wanted to took up !
How was it? Well, once again…could not resist Michaeling… To understand you just need to watch the video (here below) until the very end.
Nice start…Photo credit: Bert Janssen
Here another slide…Photo credit: Bert Janssen
My story is about how and why I realized that self-education is the best way to build an interesting future. | null | minipile | NaturalLanguage | mit | null |
Community, Life, Technology, and Perspective…
Tag Archives: childhood friends
It would take something connected to privilege to pull me out of a long run of not posting anything on my blog. That could be a discussion in itself.
Not being able to sleep after going to my own bed following bedtime with my sons, I took a look at my Twitter feed to see what was being chatted about. There I found a conversation my favorite sports columnists, Joe Davidson @SacBee_JoeD was having with a few others. Ashamed how disconnected I am to sports nowadays but seemingly Desean Jackson previously of the Philadelphia Eagles was recently cut by the team and there’s speculation and/or conflict as to whether that occurred because of his “ties” to gang affiliation. Below is the bulk of that conversation.
In reading the conversation, the quotes “Needs to cut ties…, associate carefully…, and careful who you associate” stood out the most for me. They harken me to my personal situation and a reality that I know is common amongst most I grew up with. Some background. I was reared with two siblings by a single mom in subsidized housing projects in Columbia, SC which was frequented by crime, drugs, and violence more than police. Just as the latter two quotes from Joe are good things to consider in life and I use as guides for my children, those quotes were also frequently used during my childhood by adults and teachers as a reminder of how we as young Black children were perceived and the likelihood of being considered guilty by association had very serious consequences. Getting any form of a “record” with the police usually meant that they had the right to interrogate, stop, visit, etc. you and your family whenever they chose regardless whether there was any known connection you might have to what they wanted.
What stands out for me is using those words in connection with an adult who was just “fired.” To be clear, I do not know the full circumstance of why Desean Jackson was cut and after doing some reading it appears most are speculating on the “final” reason for him being cut as there are claims of locker room issues, relationship with coach among other things. Lots of allegations that aren’t really important to me as all professional athletes (except for those in college carrying a fake “amateur” tag) are overpaid anyway. Yes I said it. I also believe those upset about athletes getting overpaid should do something like turn off the TV, don’t go to games, don’t buy jerseys, don’t read the Sports section, etc. and the pay of athletes will change really fast. I digress and I’m not upset about them getting overpaid- I think it’s great.
Back to the point. Aside from the connotation of the word “ties” which is also bothering, why should I as an adult have to “associate carefully” or be “careful who I associate with” in context of childhood friends whom I remain in contact with and support in their legal pursuits? Being Black the statistics show that I am VERY likely to be associated with family members and friends who have a “record” with the criminal justice system. I don’t like it, but it’s the case. Please note that I did not say these individuals are criminals of which I’m glad to discuss or debate as I believe criminals are equally common amongst all races and unfortunately some behaviors are criminalized within our society and justice system that make it more likely for racial minorities to have a “record.” I respect the perception of association and understand the potential negative connotation that comes with who you associate with. I equally hold adults responsible for the assumptions they make based on the filters they use when viewing others. In summary, the realities of our justice system make it quite privileged to not be Black if you want to maintain life-long close friendships with childhood friends who don’t have any legal issues. I don’t blame me or Desean Jackson for that.
So what does cutting ties mean for an adult in this situation? Don’t talk to those “bad” friends anymore? Don’t visit friends in jail? Don’t give money to help with personal situations of your “questionable” friends? Don’t let them be a part of your “entourage” when you’re taken across the country as a professional athlete to live amongst people you don’t know and trust? I don’t know what Joe means by when he says “needs to cut ties.” What I do know, is that we supposedly live in a place where innocent until proven guilty is the law of the land. I also respect the right of an employer (Eagles or anyone else) to make staffing decisions based on whatever they feel is in their best interest and within the legal rights they have.
And whatever those legal rights are, I don’t think it’s appropriate for Joe or anyone else to suggest that one cut ties with people they’ve spent much of their life being closest to. Cutting ties seems more appropriate for people 1. in a popularity contest (Obama and the minister, Republicans and the Tea Party, etc.) 2. who are seeking to overcome some past public issue (banks and Bernie Madoff or Allen Stafford, campaign donors and Rick Renzi, Tom Delay or Rod Blagojevich) or 3. with groups that counter your political or religious beliefs. For me, many of the ties cut with my childhood friends that were running around the projects with me were because of distance (me moving away for college, military, and to work) and inability to communicate as they were hard to reach while in the military or struggling in the criminal justice system. And if those friends struggling with the justice system reached out today, I would love to hear from them, spend time with them, and want to know how I can truly help them (legally). And that’s not the business of my employer or anyone else.
So, I’d much rather be a positive nudge in the lives of my childhood friends and receive the reality and humility that they can bring to me unlike anyone else. They know all the embarrassing moments, most of the firsts, the close calls, etc. that I had to learn from to be who I am today. In my community, I saw them more than I saw my mom who was doing the best she could which left her frequently unavailable (physically and emotionally). Don’t get it twisted- I have the greatest mom in the world! And her commitment to her children proved that for me. In the same, my mom set the agenda for rearing and my community mostly handled the task. I’m far from perfect and very appreciative of what I’ve been able to accomplish in helping others in our beautiful world and there’s no way that I would “cut ties” with any family member or childhood friend who’s doing what they can and know how without expecting me to contribute toward anything illegal. To suggest that Desean Jackson or any other athlete seems misguided. | null | minipile | NaturalLanguage | mit | null |
Counting many successes over the past year
An electronic displays shows the Dow Jones Industrial Average above 18,000 on the floor of the New York Stock Exchange in New York on Tuesday. Recent data suggest that the economy is gathering strength. After hitting their low in March 2009, stock prices have tripled since then, suggesting that the federal government’s economic management hasn’t been that bad, after all.
Seth Wenig
The Associated Press
Maybe I’m just projecting, but Christmas seemed unusually subdued this year. The malls seemed less crowded than usual, the people glummer. There was even less Muzak in the air. And, in a way, that’s not surprising: All year Americans have been bombarded with dire news reports portraying a world out of control and a clueless government with no idea what to do.
Yet if you look back at what actually happened over the past year, you see something completely different. Amid all the derision, a number of major government policies worked just fine – and the biggest successes involved the most derided policies. You’ll never hear this on Fox News, but 2014 was a year in which the federal government, in particular, showed that it can do some important things very well if it wants to.
Start with Ebola, a subject that has vanished from the headlines so fast it’s hard to remember how pervasive the panic was just a few weeks ago. Judging from media coverage, especially but not only on cable television, America was on the verge of turning into a real-life version of “The Walking Dead.” And many politicians dismissed the efforts of public health officials to deal with the disease using conventional methods. Instead, they insisted, we needed to ban all travel to and from West Africa, imprison anyone who arrived from the wrong place and close the border with Mexico. No, I have no idea why anyone thought that last item made sense.
As it turned out, however, the Centers for Disease Control and Prevention, despite some early missteps, knew what it was doing, which shouldn’t be surprising: The CDC has a lot of experience in, well, controlling disease, epidemics in particular. And while the Ebola virus continues to kill many people in parts of Africa, there was no outbreak here.
Explore where you live.
Consider next the state of the economy. There’s no question that recovery from the 2008 crisis has been painfully slow and should have been much faster. In particular, the economy has been held back by unprecedented cuts in public spending and employment.
But the story you hear all the time portrays economic policy as an unmitigated disaster, with President Barack Obama’s alleged hostility to business holding back investment and job creation. So it comes as something of a shock when you look at the actual record and discover that growth and job creation have been substantially faster during the Obama recovery than they were during the Bush recovery last decade (even ignoring the crisis at the end), and that although housing is still depressed, business investment has been quite strong.
What’s more, recent data suggest that the economy is gathering strength – 5 percent growth in the last quarter! Oh, and not that it matters very much, but there are some people who like to claim that economic success should be judged by the performance of the stock market. And stock prices, which hit a low point in March 2009, accompanied by declarations from prominent Republican economists that Obama was killing the market economy, have tripled since then. Maybe economic management hasn’t been that bad, after all.
Finally, there’s the hidden-in-plain-sight triumph of Obamacare, which is just finishing up its first year of full implementation. It’s a tribute to the effectiveness of the propaganda campaign against health reform – which has played up every glitch without ever mentioning that the problem has been solved, and invented failures that never happened – that I fairly often encounter people, some of them liberals, who ask me whether the administration will ever be able to get the program to work. Apparently nobody told them that it is working, and very well.
In fact, Year 1 surpassed expectations on every front. Remember claims that more people would lose insurance than gained it? Well, the number of Americans without insurance fell by about 10 million; members of the elite who have never been uninsured have no idea just how much positive difference that makes to people’s lives. Remember claims that reform would break the budget? In reality, premiums were far less than predicted, overall health spending is moderating and specific cost-control measures are doing very well. And all indications suggest that Year 2 will be marked by further success.
And there’s more. For example, at the end of 2014, the Obama administration’s foreign policy, which tries to contain threats like Vladimir Putin’s Russia or the Islamic State rather than rushing into military confrontation, is looking pretty good.
The common theme here is that, over the past year, a U.S. government subjected to constant bad-mouthing, constantly accused of being ineffectual or worse, has, in fact, managed to accomplish a lot. On multiple fronts, government wasn’t the problem; it was the solution. Nobody knows it, but 2014 was the year of “Yes, we can.”
It’s a good thing that Sacramento County is joining with the city of Boise to support their U.S. Supreme Court appeal of a recent court decision that forbids local enforcement of anti-camping ordinances. | null | minipile | NaturalLanguage | mit | null |
Evolution of caprine and ovine beta-defensin genes.
Defensins comprise an important family of anti-microbial peptides. Among vertebrates, numerous defensin genes have been detected, but their evolutionary background is still discussed. We investigated the molecular evolution and variability of beta-defensins of Caprini via sequence analyses of defensin introns. Screening of several domestic and wild species of Caprini revealed a total of 13 discrete beta-defensin coding sequences, with three of them described before this study. Phylogenetic analyses revealed that the array of newly described defensin genes is of monophyletic origin and has arisen in numerous independent duplication events after separation of the ancestral defensins. As a result of that scenario, recent defensin genes are distributed in a species-specific manner. Values of synonymous and non-synonymous substitutions demonstrated that both modes of evolutionary pressure, positive as well as negative selection, have acted. In addition, conservation of some beta-defensin exons is demonstrated. Discrimination of certain beta-defensin genes was possible only due to intron-specific differences. Therefore, sequence analyses restricted to the exons would result in underestimation of the number of beta-defensin genes. Our study shows that for reconstruction of the phylogenetic history data of defensin introns are more appropriated. Comparisons among the amino acid sequences show moderate substitutions without changing the net charge of the mature peptides. | null | minipile | NaturalLanguage | mit | null |
According to Daily Sports, E-Sens was arrested at his house on April 6th and is now most likely facing a jail sentence.
According to the district prosecutors of Seoul, “E-Sens was arrested at his house located in the Mapo district and he was very compliant and admitted to usage of marijuana. Although we will have to wait for the court’s verdict, since this was during his probation sentence it is highly likely that he will serve prison sentence.”
This statement is conflicting with the previous statement by E-Sens’s agency who stated that E-Sens was not arrested at his house, nor did he smoke marijuana.
It has been made know that E-Sens is being charged with the usage of marijuana on three different occasions. In last September 14th, he smoked marijuana with Lee at a parking lot located in Mapo, by himself on the 15th of last month and at his place on the 30th with Lee. He was also charged for smuggling 500g of marijuana in November 2014.
Source: Daily Sports | null | minipile | NaturalLanguage | mit | null |
Significance of CCN2 expression in bovine preimplantation development.
In mammalian preimplantation development, the first cell lineage segregation occurs during the blastocyst stage, when the inner cell mass and trophectoderm (TE) differentiate. Species-specific analyses are essential to elucidate the molecular mechanisms that underlie this process, since they differ between various species. We previously showed that the reciprocal regulation of CCN2 and TEAD4 is required for proper TE differentiation in bovine blastocysts; however, the function of CCN2 during early embryogenesis has remained otherwise elusive. The present study assessed the spatiotemporal expression dynamics of CCN2 in bovine embryos, and evaluated how changes to CCN2 expression (using a CCN2 knockdown (KD) blastocyst model) regulate the expression of pluripotency-related genes such as OCT4 and NANOG. The conducted quantitative PCR analysis revealed that CCN2 mRNA was expressed in bovine oocytes (at the metaphase stage of their second meiosis) and embryos. Similarly, immunostaining detected both cytoplasmic and nuclear CCN2 at all analyzed oocyte and embryonic stages. Finally, both OCT4 and NANOG expression levels were shown to be significantly reduced in CCN2 KD blastocysts. Together, these results demonstrate that bovine CCN2 exhibits unique expression patterns during preimplantation development, and is required for the proper expression of key regulatory genes in bovine blastocysts. | null | minipile | NaturalLanguage | mit | null |
NOTICE: All slip opinions and orders are subject to formal
revision and are superseded by the advance sheets and bound
volumes of the Official Reports. If you find a typographical
error or other formal error, please notify the Reporter of
Decisions, Supreme Judicial Court, John Adams Courthouse, 1
Pemberton Square, Suite 2500, Boston, MA, 02108-1750; (617) 557-
1030; [email protected]
SJC-12328
WORLDWIDE TECHSERVICES, LLC vs. COMMISSIONER OF REVENUE
& another1 (and three consolidated cases2).
Suffolk. November 7, 2017. - February 22, 2018.
Present: Gants, C.J., Gaziano, Lowy, Budd, Cypher,
& Kafker, JJ.
Taxation, Abatement, Sales and use tax. Practice, Civil,
Abatement, Intervention. Administrative Law, Intervention.
Due Process of Law, Intervention in civil action.
Appeal from a decision of the Appellate Tax Board.
The Supreme Judicial Court on its own initiative
transferred the case from the Appeals Court.
Edward D. Rapacki for the intervener.
John A. Shope (Michael Hoven also present) for the
taxpayers.
1
Econo-Tennis Management Corp., intervener, doing business
as Dedham Health and Athletic Complex.
2
BancTec Third Party Maintenance, Inc. vs. Commissioner of
Revenue & another; QualxServ, LLC vs. Commissioner of Revenue &
another; and Dell Marketing L.P. vs. Commissioner of Revenue &
another. Banctec Third Party Maintenance, Inc., is now known as
QualxServ Third Party Maintenance, Inc.; and QualxServ, LLC, is
now known as WorldWide TechServices, LLC.
2
Daniel J. Hammond, Assistant Attorney General (Daniel A.
Shapiro also present) for Commissioner of Revenue.
Ben Robbins & Martin J. Newhouse, for New England Legal
Foundation, amicus curiae, submitted a brief.
KAFKER, J. Fifteen years and three Supreme Judicial Court
decisions ago, this protracted case commenced regarding taxes
imposed on computer service contracts. The litigation began
when purchasers of the service contracts filed a putative class
action against the sellers,3 claiming under G. L. c. 93A that the
imposition of these taxes was unlawful and an unfair and
deceptive practice. The sellers successfully moved to compel
arbitration pursuant to the terms of the computer service
contracts, and a judge in the Superior Court eventually
confirmed the award. The next chapter in this tax saga, and the
one we are required to decide today, then ensued.
For the sole and express purpose of hedging their bets in
response to the class action, the sellers had applied for tax
abatements from the Commissioner of Revenue (commissioner)
beginning in 2004. The commissioner denied the applications,
and the sellers petitioned the Appellate Tax Board (board). The
appellant, Econo-Tennis Management Corp., doing business as
Dedham Health and Athletic Complex (Dedham Health), one of the
consumers who purchased these service contracts, moved to
3
We refer to BancTec Third Party Maintenance, Inc.,
QualxServ, LLC, and Dell Marketing L.P., the corporate appellees
in the present litigation, collectively as the "sellers."
3
intervene in the proceedings, which the board allowed.
Thereafter, the board, with certain exceptions, reversed the
decision of the commissioner and allowed the abatements,
ordering the parties to compute the amounts to be abated. Taxes
totaling $215.55 were imposed on the service contracts purchased
by Dedham Health.4 After the class action litigation on the
claims under G. L. c. 93A ended in the sellers' favor, the
sellers withdrew their tax abatement petitions with prejudice.
Dedham Health moved to strike the withdrawals. The board denied
the motion to strike the withdrawals and terminated the
proceedings, deciding that "any pending or further motions . . .
[were] moot" and that it would "take no further action on these
appeals." Dedham Health now appeals from that order. We
transferred Dedham Health's appeal to this court on our motion
and now conclude that although the board did not err as a matter
of law in allowing the sellers' withdrawals, the board's
termination of the proceedings in their entirety, after
permitting Dedham Health to intervene and allowing the
abatements, was an error of law. After the sellers' withdrawals
were allowed, Dedham Health should have been allowed to proceed
4
The sellers note that the evidence in the record before
the Appellate Tax Board (board) only reflects that Dedham Health
paid a total of $45.60, not $215.55. For the purposes of this
opinion, we need not address this issue.
4
as an intervener on its own claim to recover the taxes imposed
on the service contracts it purchased.5
1. Background. The instant cases arise out of the same
tax dispute at issue in Feeney v. Dell Inc., 454 Mass. 192
(2009) (Feeney I); Feeney v. Dell Inc., 465 Mass. 470 (2013)
(Feeney II); and Feeney v. Dell Inc., 466 Mass. 1001 (2013)
(Feeney III). As we summarized in Feeney I, supra at 194, "Dell
Catalog Sales Limited Partnership (Dell Catalog) and Dell
Marketing Limited Partnership (Dell Marketing), wholly owned
subsidiaries of Dell Inc. (formerly Dell Computer Corporation),
sold computers and related products to consumers and businesses
and, in connection with such sales, also sold optional computer
hardware service contracts under which [the sellers] agreed to
provide onsite computer repairs to the purchasers." Dell
Catalog and Dell Marketing collected tax on the optional service
contracts from their customers and remitted the tax to the
Department of Revenue. Id. at 194 & n.6. Under these service
contracts, "BancTech, Inc. . . . ; QualxServ LLC; or Dell
Marketing agreed to provide onsite computer repairs to the
purchasers."6 Id. at 194. Dedham Health was one such consumer
who purchased Dell computer hardware and the accompanying
5
We acknowledge the amicus brief submitted by the New
England Legal Foundation in support of the sellers.
6
As noted in note 2, supra, the names of two of these
companies have since changed.
5
service contracts. Id. Dedham Health asserted that the tax on
the optional service contracts was improper. Id. at 193.
Dedham Health and one other plaintiff who bought Dell
hardware and service contracts7 commenced a putative class action
against Dell Computer Corporation (Dell Computer) in 2003,
alleging that it had improperly collected and remitted tax on
the service contracts that the plaintiffs purchased, and that
collecting the tax violated the Massachusetts consumer
protection act, G. L. c. 93A. Id. at 193, 196. "The 'Dell
Terms and Conditions of Sale' . . . in effect at the time of the
plaintiffs' purchases contain an arbitration clause compelling
arbitration of any claim against Dell . . . and mandating that
any such claims be arbitrated on an individual basis" (emphasis
in original; footnote omitted).8 Id. at 194-195. In July, 2003,
7
The other plaintiff was John A. Feeney, now deceased, who
is not a party to the present litigation.
8
The relevant portion of the "Dell Terms and Conditions of
Sale" provides:
"ANY CLAIM, DISPUTE, OR CONTROVERSY (WHETHER IN
CONTRACT, TORT, OR OTHERWISE, WHETHER PREEXISTING, PRESENT
OR FUTURE, AND INCLUDING STATUTORY, COMMON LAW, INTENTIONAL
TORT AND EQUITABLE CLAIMS) AGAINST DELL, its agents,
employees, successors, assigns or affiliates (collectively
for purposes of this paragraph, 'Dell') arising from or
relating to this Agreement, its interpretation, or the
breach, termination or validity thereof, the relationships
which result from this Agreement (including, to the full
extent permitted by applicable law, relationships with
third parties who are not signatories to this Agreement),
Dell's advertising, or any related purchase SHALL BE
6
Dell Computer moved to compel arbitration, and a judge in the
Superior Court allowed the motion. Id. at 196-197. "[The
plaintiffs] each filed a claim of arbitration 'under protest' in
November, 2004." Id. at 197. The arbitrator denied the
plaintiffs' request for class certification, and ruled in favor
of the defendants on the merits in 2007. Id. at 198.
"In February 2008, the plaintiffs moved in the Superior
Court to vacate the arbitration award," but their motion was
denied and the case was dismissed with prejudice. Id. The
plaintiffs appealed, and we granted their application for direct
appellate review. Id. In Feeney I, this court held that the
arbitration clause was void as against public policy, and
reinstated the Superior Court action. Id. at 205, 214. Less
than two years later, the United States Supreme Court ruled in
AT&T Mobility LLC v. Concepcion, 563 U.S. 333, 351-352 (2011),
that the Federal Arbitration Act precludes invalidating class
waiver provisions in arbitration clauses on the basis of State
public policy favoring class actions. In response to
Concepcion, we held in Feeney II that "a court may still
RESOLVED EXCLUSIVELY AND FINALLY BY BINDING ARBITRATION
ADMINISTERED BY THE NATIONAL ARBITRATION FORUM (NAF) under
its Code of Procedure then in effect (available via the
Internet at http://www.arb-forum.com, or via telephone at
1-800-474-2371). The arbitration will be limited solely to
the dispute or controversy between Customer and Dell. Any
award of the arbitrator(s) shall be final and binding on
each of the parties, and may be entered as a judgment in
any court of competent jurisdiction."
7
invalidate a class waiver" post-Concepcion where, as here,
"class proceedings are the only viable way for a consumer
plaintiff to bring a claim against a defendant." Feeney II, 465
Mass. at 501-502. One week later, the United States Supreme
Court held in American Express Co. v. Italian Colors Restaurant,
570 U.S. 228, 238-239 (2013) (Amex), that an arbitration
agreement's class waiver is enforceable even if the class waiver
effectively precludes the plaintiff from vindicating his or her
Federal statutory rights. In light of the Supreme Court ruling
in Amex, we held in Feeney III that the class waiver in the
present case could not be invalidated for effectively denying
the plaintiffs a remedy, and remanded the case to the Superior
Court. Feeney III, 466 Mass. at 1003.
On remand, the Superior Court granted the sellers' motion
to confirm the original arbitration award dismissing the
plaintiffs' claims. Feeney vs. Dell Inc., Mass. Superior Ct.,
No. 2003-01158 (Middlesex County Oct. 24, 2013). The Appeals
Court affirmed in a memorandum and order pursuant to its rule
1:28, 87 Mass. App. Ct. 1137 (2015), and this court denied the
plaintiffs' application for further appellate review in October,
2015, ending the putative class action litigation.
While the putative class action was still ongoing, the
sellers brought abatement claims against the commissioner for
the taxes collected on the service contracts. The sellers
8
indicated in their abatement filings that they only sought
abatement in the event that the class action litigation resulted
in a judgment requiring the sellers to refund the taxes to their
customers. The sellers' filings stated that if they prevailed
in the class action, they would withdraw their abatement
applications.
The commissioner denied the sellers' abatement requests.
The sellers filed timely petitions with the board challenging
the commissioner's denial of their abatement requests, and the
petitions were consolidated. In their petitions to the board,
the sellers again emphasized that they sought abatement to
protect against a possible judgment against them in the putative
class action litigation.
Dedham Health filed motions to intervene in the sellers'
petitions before the board, arguing that it and "other similarly
situated customers" were the "real parties in interest" because
the customers were entitled to be refunded in the amount of any
abatement paid out to the sellers. Dedham Health also asserted
that the commissioner prohibits customers from pursuing
abatement claims themselves "where the challenged 'tax' was paid
to, and remitted by, the seller." However, Dedham Health did
not ask for class action certification before the board because,
as it conceded in its motion, "there is no procedure for
certifying a class action to the [board]." The board granted
9
Dedham Health's motions to intervene, concluding that it had
alleged "sufficient facts . . . to support its claims that the
parties may not be adequately representing Dedham Health's
interests" and that Dedham Health had "a substantial interest in
the subject matter of this litigation." In allowing Dedham
Health's intervention, the board noted that it "in no way
extends or expands the limitations contained in G. L. c. 62C,
§ 37," the statute that sets forth the procedure for pursuing
abatement.
The parties submitted a joint statement of facts and a
joint evidentiary record to the board. The board ruled in
December, 2013, that, with certain exceptions, the transactions
did not fall within the statutory or regulatory framework for
taxation and thus the sellers had not been required to collect
the taxes at issue, and were therefore entitled to an abatement
of all such taxes they had remitted. The board directed the
parties to "compute the amounts to be abated based on the
foregoing findings and rulings." Because computing the
abatement amounts would be a complex and expensive task, the
board granted the sellers' motion to stay the board proceedings
until all appeals in the putative class action litigation had
been exhausted.9
9
As grounds for their motion to stay, the sellers cited the
significant expenses they would incur to compute the abatement
10
After the final dismissal of the putative class action in
favor of the sellers, the sellers withdrew all of their
petitions before the board. Dedham Health filed a motion to
strike the sellers' withdrawals, arguing that allowing the
withdrawals would leave consumers without a forum to pursue a
tax refund. In July, 2016, the board denied Dedham Health's
motion to strike. Instead, the board ordered the proceedings
closed in light of the sellers' withdrawals, ruling that "any
pending or further motions and discovery are moot." The board's
ruling did not include a rationale for its decision. Dedham
Health did not request findings and a report, available pursuant
to G. L. c. 58A, § 13.10
amounts, particularly in light of the sellers' anticipation that
the Superior Court litigation would be resolved in their favor,
at which time they intended to withdraw their petitions.
10
The relevant portion of G. L. c. 58A, § 13, provides:
"[T]he board shall make such findings and report
thereon if so requested by either party within ten days of
a decision without findings of fact and shall issue said
findings within three months of the request . . . . Such
report may, in the discretion of the board, contain an
opinion in writing, in addition to the findings of fact and
decision. If no party requests such findings and report,
all parties shall be deemed to have waived all rights of
appeal to the appeals court upon questions as to the
admission or exclusion of evidence, or as to whether a
finding was warranted by the evidence. . . . The decision
of the board shall be final as to findings of fact.
Failure to comply with the time limits, as outlined above,
shall not affect the validity of the board's decision."
11
On appeal, Dedham Health argues that the board (1)
improperly denied Dedham Health's motion to strike the sellers'
withdrawals, (2) incorrectly ruled that the withdrawals rendered
all pending and future motions moot, and (3) violated Dedham
Health's right to due process by terminating the proceedings.
We examine each of these arguments in turn.
2. Discussion. Pursuant to G. L. c. 58A, § 13, when the
board issues a final order without findings of fact, within ten
days a party may request that the board issue findings of fact
and a report. By failing to request findings and a report here,
Dedham Health has "waived all rights of appeal . . . upon
questions as to the admission or exclusion of evidence, or as to
whether a finding was warranted by the evidence." G. L. c. 58A,
§ 13. See Assessors of Lynn v. Zayre Corp., 364 Mass. 335, 338
(1973). Our review of the board's decision is therefore limited
to pure questions of law that were not otherwise waived. See
Supermarkets Gen. Corp. v. Commissioner of Revenue, 402 Mass.
679, 681-682 (1988). Thus, we can only rule in Dedham Health's
favor if the board erred as a matter of law. See id. We review
the board's conclusions of law de novo. Regency Transp., Inc.
v. Commissioner of Revenue, 473 Mass. 459, 464 (2016).
"However, because the board is an agency charged with
administering the tax law and has 'expertise in tax matters,' .
. . we give weight to its interpretation of tax statutes, and
12
will affirm . . . if [the board's] interpretation is reasonable"
(citations omitted). AA Transp. Co. v. Commissioner of Revenue,
454 Mass. 114, 119 (2009).
a. Withdrawal. Dedham Health contends that the board
erred in allowing the sellers to withdraw their petitions for
abatement. Dedham Health interprets the board's final order as
being predicated on the board's assumption that it was required
as a matter of law to accept the sellers' withdrawals and thus
had no discretion to strike them. On the basis of this
assumption, Dedham Health asserts that the board did have
discretion to strike the withdrawals, and that the board's
failure to recognize its own discretion constituted an error of
law.
As discussed, the board's final order did not include an
explanation for its ruling. Because Dedham Health chose not to
request findings of fact and a report, we do not know the basis
for the board's decision. The board may have either (1) decided
it had discretion to accept or reject the withdrawals, and
chosen in the exercise of that discretion to accept the
withdrawals; or (2) decided it had to accept the withdrawals as
it lacked discretion to reject them as a matter of law. We
cannot assume, in the absence of such findings and report, that
the board's decision was made on the latter basis, rather than
the former, as Dedham Health contends. Having failed to request
13
findings and a report, Dedham Health is left only with the
argument that the board's decision to accept the withdrawals was
improper as a matter of law in these circumstances. See
Supermarkets Gen. Corp., 402 Mass. at 681-682.
The board's rules expressly provide for withdrawals in
certain circumstances:
"When notice of the settlement of a pending appeal is
received by the clerk from either party, unless a
withdrawal of the petition or agreement for decision is
filed forthwith, the clerk shall inform both parties or
their attorneys by mail that the appeal should be disposed
of by filing a withdrawal of the petition or agreement for
decision according to the terms of the settlement"
(emphasis added).
831 Code Mass. Regs. § 1.21 (2007) (rule 1.21). Thus, at least
where formal settlements are reached, the board expects that
withdrawals be filed to formally dispose of the petition. While
no such formal settlement has been reached and the withdrawals
here were not filed pursuant to rule 1.21, the sellers
effectively accepted the tax liability in its entirety, and
thereby withdrew their petitions for abatement. Rule 1.21 thus
provides support for the allowance and the board's acceptance of
the withdrawals in the instant matter.
Prior decisions by this court have also recognized
taxpayers' ability to withdraw and the board's ability to accept
such withdrawals at various stages of administrative tax
proceedings. See D'Errico v. Assessors of Woburn, 384 Mass.
14
301, 309 (1981) ("plaintiff's remedy was to pursue his appeal
from the decision of the [board], but he withdrew that appeal.
This withdrawal . . . was perhaps an unfortunate tactical
decision but not one which this court can undo"); O'Brien v.
State Tax Comm'n, 339 Mass. 56, 61 (1959) ("Two of these [buses]
were garaged in Massachusetts but these are not here involved
for the applications for abatement of the excises with respect
to them have been withdrawn"). See also AA Transp. Co., 454
Mass. at 117 n.5. Nor does Dedham Health argue otherwise; it
contends only that the board had the discretion to strike the
withdrawals, and did not recognize that it had such discretion.
As explained above, Dedham Health waived that argument by not
requesting findings and a report.
Without such findings and a report, we cannot conclude as a
matter of law that the board abused its discretion in allowing
the sellers' withdrawals in these circumstances. See O'Connor
v. Director of the Div. of Employment Sec., 384 Mass. 798, 799
(1981) ("In the absence of either such a request or an
indication from the District Court judge that he felt
constrained to dismiss the notice of appeal because he thought
such action to be mandatory, we conclude that the judge
considered the dismissal to be a matter of discretion and
further conclude that, if such dismissals are indeed
discretionary, the challenged dismissal would not have amounted
15
to an abuse of discretion"). The proceedings had already gone
on for thirteen years at that point; the putative class action
lawsuit had ended in the sellers' favor; there were limited
amounts of money at stake for individual purchasers; and only
two plaintiffs had been identified in the class action, one of
whom had died in the interim.11
Finally, the board's prior decision allowing Dedham Health
to intervene on its own behalf lends further support to the
board's discretion to accept the sellers' withdrawals. As an
intervener, Dedham Health had rights separate from the sellers'
rights. Thus, the sellers' withdrawal, by itself, did not leave
Dedham Health without a right or remedy. We address those
rights below.
b. Independent right to abatement. Dedham Health asserts
that, as an intervening party, it had an independent right to
continue to litigate the abatement proceedings even after the
sellers' withdrawal. To determine Dedham Health's rights before
the board, we look both to the statutory scheme of the tax in
question and the rights the board provided Dedham Health as an
intervener. Commissioner of Revenue v. A.W. Chesterton Co., 406
11
We also conclude that it would have been within the
board's discretion to deny the withdrawals, given the sellers'
over-all responsibility for collecting and abating the tax,
which, according to one filing by the commissioner, involved as
much as $50 million and as many as 7 million to 10 million
purchasers.
16
Mass. 466, 467-468 (1990) (abatement is created by statute, so
board only has jurisdiction to extent prescribed by governing
statute). This task is made somewhat more complicated by the
fact that the board never made an explicit finding as to whether
the taxes at issue were sales taxes, under the purview of G. L.
c. 64H, or use taxes, under the purview of G. L. c. 64I.12 We
conclude that in these circumstances both statutory schemes
place the legal responsibility for collecting and paying the
taxes and seeking abatement on the sellers, leaving only limited
rights to Dedham Health as an intervener.
i. Statutory rights. In Massachusetts, sales and use
taxes are designed as "complementary components of a unitary
taxing program created to reach all transactions . . . in which
tangible personal property is sold inside or outside the
Commonwealth for storage, use, or other consumption within the
Commonwealth." Boston Tow Boat Co. v. State Tax Comm'n, 366
Mass. 474, 476-477 (1974). The sales tax is imposed on retail
purchases made inside the Commonwealth. See G. L. c. 64H, § 2.
The use tax, "designed to prevent loss of sales tax revenue from
. . . out-of-State retail purchases," is imposed on retail
purchases made outside the Commonwealth that are stored, used,
or otherwise consumed in Massachusetts. D & H Distrib. Co. v.
12
The interlocutory order of the board concluding that the
taxes were unlawful refers to the taxes collectively as "sales
and use taxes."
17
Commissioner of Revenue, 477 Mass. 538, 540 (2017). See G. L.
c. 64I, § 3. The sales tax and the use tax are mutually
exclusive, and the tax rate is identical. Regency Transp.,
Inc., 473 Mass. at 462.
Vendors are responsible for collecting and remitting the
sales tax and therefore are the party entitled to seek
abatement. See G. L. c. 64H, § 3; First Agricultural Nat'l Bank
of Berkshire County v. State Tax Comm'n, 353 Mass. 172, 179
(1967), rev'd on other grounds, 392 U.S. 339 (1968). By
contrast, purchasers are generally responsible for payment of
the use tax. See G. L. c. 64I, § 3. However, in practice
purchasers "seldom remit use tax of their own volition, and are
not likely even to be aware of the requirement." D & H Distrib.
Co., 477 Mass. at 540. Rather, for applicable purchases outside
Massachusetts from a vendor who conducts business in
Massachusetts, the vendor is required to collect and remit the
use tax, as it would a sales tax. See G. L. c. 64I, § 4.13 See
also G. L. c. 64H, § 3. More specifically:
13
General Laws c. 64I, § 4, provides, in relevant part:
"Every vendor engaged in business in the commonwealth
and making sales of tangible personal property or services
for storage, use or other consumption in the commonwealth
not exempted under this chapter, shall at the time of
making the sales, or, if the storage, use or other
consumption of the tangible personal property or services
is not then taxable hereunder, at the time the storage, use
or other consumption becomes taxable, collect the tax from
18
"Vendors 'engaged in business in the commonwealth' who sell
tangible personal property or services 'for storage, use or
other consumption in the commonwealth' are required to
collect the tax from the purchaser and give the purchaser a
receipt, unless the 'storage, use, or other consumption' is
not 'taxable' at the time of sale, in which case vendors
are required to collect the tax when storage, use, or other
consumption 'becomes taxable.'"
Town Fair Tire Ctrs., Inc. v. Commissioner of Revenue, 454 Mass.
601, 606 (2009), quoting G. L. c. 64I, § 4. In such instances
where the vendor is required to collect the use tax, if the
vendor fails to do so, the tax is "owed by the vendor to the
commonwealth." G. L. c. 64I, § 4. See Town Fair Tire Ctrs.,
Inc., supra.14
the purchaser and give the purchaser a receipt therefor in
the manner and form prescribed by the commissioner. The
tax required to be collected by the vendor shall constitute
a debt owed by the vendor to the commonwealth. Such vendor
shall collect from the purchaser the full amount of the tax
imposed by this chapter, or an amount equal as nearly as
possible or practicable to the average equivalent thereof;
and such tax shall be a debt from the purchaser to the
vendor, when so added to the sales price, and shall be
recoverable at law in the same manner as other debts."
14
Under both tax schemes, when added to the sales price,
the amount taxed becomes a "debt from the purchaser to the
vendor." See G. L. c. 64H, § 3; G. L. c. 64I, § 4. Both
schemes include a "bad debt" provision, wherein "any vendor who
has paid to the commissioner a tax for a sale on credit is
'entitled' to reimbursement if the account 'is later determined
to be worthless.'" Household Retail Servs., Inc. v.
Commissioner of Revenue, 448 Mass. 226, 229 (2007). However,
this provision is a mere "statutory courtesy," as the vendor is
still legally responsible for paying the tax. Id. at 230. See
Continental-Hyannis Furniture Co. v. State Tax Comm'n, 366 Mass.
308, 309 (1974) (prior to enactment of bad debt provision,
vendor remained liable for sales tax even in instances where
purchaser did not tender payment for tax).
19
Thus, where the vendor has collected and remitted the use
tax, such that it mirrors the implementation of the sales tax,
the vendor is legally responsible for the tax and becomes the
party entitled to seek abatement.15
Here, the taxes at issue were collected and remitted by the
sellers, not Dedham Health. Therefore, regardless of whether
the taxes at issue were sales taxes or use taxes, the sellers
were the party statutorily responsible for the payment of the
tax and statutorily entitled to seek abatement, not Dedham
Health. This is true even though the economic burden of the
taxes at issue were passed along to Dedham Health. See First
Agricultural Nat'l Bank of Berkshire County, 353 Mass. at 180
("There is no necessary inconsistency between imposing the legal
incidence of a tax upon the vendor, yet recognizing a statutory
right in the vendor to shift the tax to the purchaser").
Placing the legal responsibility for the tax on vendors is also
in accord with the purpose of the tax scheme. By making the
vendors responsible, the Legislature adopted "what it believed
to be the most efficacious method of ensuring the payment" of
the tax. Baker Transport, Inc. v. State Tax Comm'n, 371 Mass.
15
When abatement is sought for either tax, the vendor who
collected the tax cannot, however, receive a refund until he or
she demonstrates that "he [or she] has repaid to the purchaser
the amount for which the application for refund is made." G. L.
c. 62C, § 37.
20
872, 875-876 (1977) (Legislature's decision to require tax
payment prior to issuance or transfer of vehicle registration
was intended to ensure taxes paid on all taxable sales of motor
vehicles). See First Agricultural Nat'l Bank of Berkshire
County, supra at 178 ("practical considerations necessitate its
collection and remission to the State by the vendor"). Because
the vendor is already collecting the tax from the purchasers,
placing the legal responsibility for collecting, paying, and
abating the tax on the vendor is a logical way of administering
the tax burden, such that the State does not have to pursue
individual purchasers for payment.
ii. Intervener rights. Although Dedham Health was not
statutorily entitled to seek abatement here, the board allowed
Dedham Health to intervene in the proceedings before the board.
The sellers argue that such intervention violated the statutory
scheme. See A.W. Chesterton Co., 406 Mass. at 467-468, quoting
Assessors of Boston v. Suffolk Law Sch., 295 Mass. 489, 492
(1936) ("Since the remedy by abatement is created by statute
[the board] has no jurisdiction to entertain proceedings for
relief by abatement begun at a later time or prosecuted in a
different manner than is prescribed by the statute"). We
disagree.
The board properly allowed the intervention in accordance
with its own procedures. Under 831 Code Mass. Regs. § 1.37
21
(2007), the "practice and procedure before the [b]oard shall
conform to that heretofore prevailing in equity causes . . .
prior to the adoption of the Massachusetts Rules of Civil
Procedure."16 Prior to the adoption of the Massachusetts Rules
of Civil Procedure in 1973, an intervener needed a "substantial
interest in the subject matter of the original litigation" to
intervene in an equity claim. See D.J. Doyle & Co. v. Darden,
328 Mass. 288, 290 (1952); Check v. Kaplan, 280 Mass. 170, 178
(1932). Here, the board determined that "Dedham Health has
alleged sufficient facts relating to the subject matter of these
appeals to support its claims that the parties may not be
adequately representing [Dedham Health's] interests and
therefore [Dedham Health has] a substantial interest in the
subject matter of this litigation." The board also correctly
cited controlling authority in its order allowing Dedham Health
to intervene. See Check, supra.
In these circumstances, where the board ordered an
abatement, but where the sellers indicated they would withdraw
from the abatement proceedings if the putative class action were
dismissed, allowing Dedham Health to intervene was appropriate.
The board correctly recognized that Dedham Health, as the
purchaser whose money was used to pay the tax, had a substantial
16
This provision of the Code of Massachusetts Regulations
also states that "substance and not form shall govern" in these
proceedings. 831 Code Mass. Regs. § 1.37 (2007).
22
interest in the abatement and that the sellers had no intention
or incentive to protect that interest. Intervention was an
appropriate means of protecting Dedham Health's substantial
interest, while also respecting the statutory structure and the
expertise of the board. See Raytheon Co. v. Commissioner of
Revenue, 455 Mass. 334, 337 (2009); French v. Assessors of
Boston, 383 Mass. 481, 482 (1981) ("We have long recognized the
board's expertise in tax matters").
As an intervener, Dedham Health became a party to the
abatement proceedings entitled to protect its interest in the
abatement. See Spence v. Boston Edison Co., 390 Mass. 604, 611
(1983); American Hoechest Corp. v. Department of Pub. Utils.,
379 Mass. 408, 410 (1980); Check, 280 Mass. at 178. Cf. Mass.
R. Civ. P. 24, 365 Mass. 769 (1974); Massachusetts Fed'n of
Teachers, AFT, AFL-CIO v. School Comm. of Chelsea, 409 Mass.
203, 205 (1991) (specifying conditions under which party has
right to intervention); May v. Commissioner of Internal Revenue,
553 F.2d 1207, 1208 (9th Cir. 1977) (per curiam) ("Intervention
in a proceeding before [the Tax Court] has been held to be
within the sound discretion of the Tax Court"). Indeed, the
board expressly rejected attempts to limit Dedham Health's role
to that of an amicus allowed only to brief and argue before the
board.
23
Both the sellers and the commissioner contend that Dedham
Health has no right to recover the taxes it paid, as an
intervener or otherwise, because Dedham Health did not file a
request for abatement on its own. They make this argument
despite recognizing that such a request would have been denied
and was thus futile. See Sullivan v. Brookline, 435 Mass. 353,
355 n.1 (200l) (where no administrative remedy exists, plaintiff
is "not subject to any exhaustion requirement"); Massachusetts
Bay Transp. Auth. v. Labor Relations Comm'n, 425 Mass. 253, 258
(1997) (exhaustion not required where it would be futile).
Indeed, the commissioner concedes that he would deny any such
application, as would the board, because neither the
commissioner nor the board recognizes a purchaser's right to
seek abatement independently. In other words, Dedham Health's
other avenue of relief was to chase a separate ostensible
"remedy" that would be denied as soon as it was pursued. We do
not find this argument compelling.
The commissioner also suggests that Dedham Health could
instead sue the sellers, relying on G. L. c. 64H, § 3 (a). The
commissioner's interpretation of G. L. c. 64H, § 3 (a), however,
runs contrary to the plain meaning of this provision. General
Laws c. 64H, § 3 (a), requires the purchaser to reimburse the
vendor for the sales tax that the vendor is statutorily required
to remit to the Commonwealth. It is designed to protect the
24
vendor by imposing a reimbursement requirement on the purchaser.
As explained by the amicus: "Nowhere does G. L. c. 64H, § [3
(a),] mention or even suggest any right of action by the
purchaser against the vendor."
We recognize that Dedham Health's rights as an intervener
were limited. It did not have the same statutory powers and
responsibilities as the sellers, and thus could not seek to
displace the sellers or play an equivalent role in the abatement
process. The intervention order itself expressly stated that it
"in no way extends or expands the limitations contained in G. L.
c. 62C, § 37." Dedham Health's rights were appropriately
limited to defending its own interest in the abatement that
applied to its own transactions. It was not allowed or entitled
to step into the sellers' shoes or to intervene, as Dedham
Health suggests, as to the entirety of the sellers' tax
abatement claims.
Although these rights were limited, we conclude that their
existence could not be entirely contingent on the sellers'
decision whether to continue the abatement process, once it had
begun. In the instant cases, the board made this exact legal
error. It decided Dedham Health had a substantial interest in
the abatement and a limited right to intervene to defend that
interest, but as soon as the sellers filed their withdrawals,
the board terminated the proceedings, eliminating both the
25
interest and the right. In these circumstances, where the board
had already found that the taxes were improperly imposed, it
could not simply terminate the proceedings and leave Dedham
Health without a remedy. See Spence, 390 Mass. at 611; American
Hoechest Corp., 379 Mass. at 410; Check, 280 Mass. at 178. Cf.
Mass. R. Civ. P. 24. Dedham Health should have been permitted
to proceed after the sellers' withdrawal to recoup the tax
payment the board found had been unlawfully imposed on Dedham
Health. We therefore conclude that the board erred as a matter
of law by instead choosing to terminate the proceedings after
the sellers' unilateral withdrawal.
c. Due process. Dedham Health also contends that
terminating the abatement proceedings over its objection
violates its constitutional right not to be deprived of property
without due process of law. Because we conclude that the board
erred as a matter of law where it allowed Dedham Health to
intervene and then took away that right and remedy when the
sellers filed their withdrawals, we need not address this
argument. Cf. Commonwealth v. Disler, 451 Mass. 216, 228 (2008)
("It is, of course, our duty to construe statutes so as to avoid
such constitutional difficulties, if reasonable principles of
interpretation permit it [citation and quotations omitted]);
Textron Inc. v. Commissioner of Revenue, 435 Mass. 297, 307
(2001), cert. denied, 535 U.S. 986 (2002) ("As head of the
26
agency charged with administering the corporate excise tax
statutes, the commissioner has lawful discretion . . . to
interpret a statute in a manner that avoids potential
constitutional issues").
3. Conclusion. For the reasons discussed above, we
reverse the final order of the board and remand for further
proceedings consistent with this opinion.
So ordered.
| null | minipile | NaturalLanguage | mit | null |
# Translation of R-tcltk.pot to French
# Copyright (C) 2005 The R Foundation
# This file is distributed under the same license as the tcltk R package.
# Philippe Grosjean <[email protected]>, 2005.
#
msgid ""
msgstr ""
"Project-Id-Version: R 2.12.0\n"
"Report-Msgid-Bugs-To: bugs.r-project.org\n"
"POT-Creation-Date: 2014-08-03 12:17\n"
"PO-Revision-Date: 2013-03-18 22:15+0100\n"
"Last-Translator: Philippe Grosjean <[email protected]>\n"
"Language-Team: French <[email protected]>\n"
"Language: fr\n"
"MIME-Version: 1.0\n"
"Content-Type: text/plain; charset=ISO-8859-1\n"
"Content-Transfer-Encoding: 8bit\n"
"Plural-Forms: nplurals=2; plural=(n > 1);\n"
"X-Generator: Poedit 1.5.5\n"
msgid "cannot handle object of mode '%s'"
msgstr "impossible de manipuler un objet de mode '%s'"
msgid "cannot change names on Tcl array"
msgstr "impossible de changer les noms dans un tableau Tcl"
msgid "cannot set length of Tcl array"
msgstr "impossible d'imposer la taille d'un tableau Tcl"
msgid "Tcl package '%s' not found"
msgstr "le package Tcl '%s' est introuvable"
msgid "The tkGUI is not available under Windows"
msgstr "L'interface utilisateur tkGUI n'est pas disponible sous Windows"
msgid "File"
msgstr "Fichier"
msgid "Demos"
msgstr "Démos"
msgid "Packages"
msgstr "Packages"
msgid "Help"
msgstr "Aide"
msgid "Source R code"
msgstr "Sourcer du code R"
msgid "Quit"
msgstr "Quitter"
msgid "Save workspace"
msgstr "Sauver l'environnement"
msgid "Don't save workspace"
msgstr "Ne pas sauver l'environnement"
msgid "t test"
msgstr "Test t"
msgid "Density"
msgstr "Densité"
msgid "Interactive linear fitting"
msgstr "Ajustement linéaire interactif"
msgid "R FAQ"
msgstr "FAQ R"
msgid "Load"
msgstr "Charger"
msgid "Go get them!"
msgstr "Les récupérer !"
msgid "Load packages"
msgstr "Charger des packages"
msgid "Install packages from CRAN"
msgstr "Installer des packages depuis CRAN"
msgid "Help topic:"
msgstr "Aide sur :"
msgid "Manuals in PDF format"
msgstr "Manuels au format PDF"
msgid "OK"
msgstr "OK"
msgid "Cancel"
msgstr "Annuler"
msgid "'pb' is not from class %s"
msgstr "'pb' n'est pas un objet de classe %s"
msgid "'filters' must be a 2-column character matrix"
msgstr "'filters' doit être une matrice de chaînes de caractères à 2 colonnes"
msgid "Tcl/Tk support is not available on this system"
msgstr "Tcl/Tk n'est pas supporté sur ce système"
msgid "Tcl/Tk support files were not installed"
msgstr "les fichiers Tcl/Tk nécessaires n'ont pas été installés"
#~ msgid "Loading Tcl/Tk interface ..."
#~ msgstr "Chargement de Tcl/Tk..."
#~ msgid "done"
#~ msgstr "terminé"
| null | minipile | NaturalLanguage | mit | null |
People skate on Marc Kohn’s backyard synthetic ice rink in Poolesville, Md. He wanted to honor his stepdaughter, Melanie, who died in July at 35 and loved hockey. (Ricky Carioti/The Washington Post)
Marc Kohn spent nearly $40,000 and 400 hours building a hockey rink behind his house in rural Poolesville, Md., a winter twist on “Field of Dreams.”
He longed for his childhood days in Boston, skating on neighborhood ponds for hours. And he wanted to honor his stepdaughter Melanie Osborne, a lifelong hockey fan who recently died.
Kohn, 51, called his backyard project Mel’s Rink, hung her name in Christmas lights and invited town residents to play. Since opening two weeks ago, dozens of kids and adults have zipped around the synthetic ice for free.
But this week county inspectors showed up — without their skates. Now Mel’s Rink is in jeopardy.
“It’s a lovely idea, and we understand it’s a labor of love, but it has to be the right place for it,” said Diane Schwartz Jones, with Montgomery County’s department of permitting services.
Nicholas Khalil, 9, center, takes a shot while playing with other kids on Marc Kohn's backyard synthetic ice rink. The rink has run afoul of zoning regulations and may be shut down. (Ricky Carioti/The Washington Post)
The problem: The rink, set on a rolling field of grass in his own backyard and built atop dozens of wooden shipping pallets, is in the agricultural reserve, which allows homes but isn’t zoned for public uses. County officials issued Kohn a violation and told him to take down lights above the rink and a Facebook page where he posted skate times and other news.
Jones wants to meet with him to discuss the rink’s future, but it seems clear people won’t be allowed to just show up anytime to skate. Those who have already discovered the rink will likely want the inspectors in the penalty box.
“What he did is a ridiculously selfless act,” said Dan Levine, watching his two sons skate in their Backstrom and Ovechkin Capitals jerseys. “I do sales for a living. I’m out a lot. You run across people who don’t know how to be nice anymore. You look at this, this could be the most giving thing you would ever see in a community.”
The rink is about 2,100 square feet, with regulation goals. There are team benches, painted red and blue. The synthetic ice works with skates or shoes. The kids make up their own rules. In an era of ultra-competitive youth sports, Mel’s Rink is a throwback to the days of, “Go outside and play but be back for dinner.”
“I like it,” said Sean Levine, 9, taking a water break. “You can come out with your friends and play a game. It’s fun.”
That’s what hockey was to Kohn growing up. His family had pizza and puck nights — eat pizza, watch the Boston Bruins on TV. As an adult, he brought the tradition to his own family, keeping the pizza, but swapping in the Caps. Melanie became a huge fan.
“We’re a hockey family,” Kohn said. “She loved the Caps. She was just a huge hockey fan.”
Marc Kohn spent $40,000 and 400 hours building his backyard synthetic ice rink in Poolesville. (Ricky Carioti/The Washington Post)
But Kohn didn’t play anymore. Working long days and nights in post-production at Discovery Communications, he gained a lot of weight, so he decided to start skating again, teaching lessons in Rockville. He lost weight, left television and wanted a rink of his own — to be part of the community, letting neighbors skate and giving lessons to pay for maintenance costs.
He wanted to be a hockey guy again.
In the meantime, Melanie, an emergency room nurse, got sick. She died in July of respiratory disease at 35. The idea for the rink took on a whole new meaning. Kohn found the perfect spot in Poolesville and got to work this fall, grading the land, scouring the region for shipping pallets, laying the whole rink down himself. He worked day and night, posting pictures of his progress on Facebook.
He missed Melanie. The rink became therapy.
“It gave me something to do every day,” Kohn said. “Every day you’re building something. Doing hard work and banging stuff, you just feel good.”
Melanie’s mom, Jeanne Kohn (she and Marc are divorced), saw the rink recently.
“I think that she would be very touched to know that this rink is dedicated in her memory and that it will be used to serve the community,” Jeanne Kohn said. “Marc has done a great job with it.”
But now he’s worried. He understands the county’s position, but he also hopes they understand his.
“Rules are rules,” he said. “But I don’t want to get rid of it. That wouldn’t be right. This has been such a great thing for the community.”
In just a couple weeks, the rink has spawned new friendships. Kids who only see each other at school find themselves on the same team. Town businesses have offered to pay for additional synthetic ice to make the rink larger. And residents have been generous with donations, dropping dollars into a giant replica of the Stanley Cup.
“Marc really made this place into a great gathering place,” said Steve Smith, slipping around in his shoes with his 10-year-old son Soren.
Sean was zipping around the rink, scoring one goal after another. His little brother Jacob was out there too. Then a game of parents versus kids broke out. The kids scored quickly, with a boy taking on a defender twice his height scoring on a wicked shot.
“Gooaaaal,” he said, raising his stick in the air.
Then the parents retaliated — one goal, then another. The dad in the goalie net pounded his stick on the ice. This went on almost an hour, until it was time for the Levines to go.
“Ten minutes!” Sean’s dad yelled to his kids.
Sean cried, “Nooooooo!” | null | minipile | NaturalLanguage | mit | null |
The structure of ape (hominoidea) intelligence.
We used contemporary psychometric theory of intelligence and confirmatory factor analysis to reanalyze data obtained on samples of nonhuman primates administered the Primate Cognition Test Battery. Our main goals were to interpret stability of the Primate Cognition Test Battery tasks and factors over time and to determine whether the cognitive factors that emerge from confirmatory factor analysis for apes can be interpreted from the perspective of a major theory of human intelligence, namely, the Cattell-Horn-Carroll model. We also analyzed data for 2½-year-old children on Wechsler's preschool test to afford a comparison between ape and child cognitive factors. Results indicated that multiple cognitive abilities provide the best factor solutions for both apes and children, and that the ape factors can be meaningfully interpreted from Cattell-Horn-Carroll theory. (PsycINFO Database Record (c) 2019 APA, all rights reserved). | null | minipile | NaturalLanguage | mit | null |
Military begins verification of pensioners in October
THE yearly verification exercise for military pensioners is to begin next month, after three years postponement due to a disagreement between the Military Pensions Board (MPB) and the pensioners.
The Permanent Secretary, Ministry of Defence, Ismaila Aliyu, made this known in Abuja while delivering a keynote address at the military pensions stakeholders interactive session in Abuja yesterday. He said that the exercise scheduled for 6th – 20th October 2015 “is crucial in assisting the board to determine the number of eligible military pensioners.”
The permanent secretary who was represented by David Gande, the Director of Joint Services Department in the ministry, stated that, “the cooperation of all military pensioners and other stakeholders” to ensure that the exercise is successful is paramount.
“We have witnessed a lot of agitation and complaints by military retirees over some issues regarding their pensions. The plight of our retired soldiers is a great concern to the government. The present administration, in consolidating the gains of the past efforts concerning the welfare is working hard to find lasting solutions to some of these challenges.
“The recent commencement of 33 percent quarterly payment of pension increment arrears is one of such efforts demonstrated by the government in solving retiree’s welfare needs. Despite these efforts, the agitations continued mainly as a result of break in communication,” he said.
While answering questions from journalists, the Chairman of Military Pensions Board, Air Vice Marshal Muhammad Dabo, said the exercise would go on without hitches as measures are put in place to ensure its success.”
He said even though the retirees face a lot of challenges, some of their demands are based on misinformation or inadequate knowledge of the intricacy of the policy. For instance, “As in the constitution, whenever there is any salary increment for federal workers, pensions also need to be increased. It did not say it should be increased at the same percentage, however, there is necessity for that increment and the constitution also says that if there is no increment in salaries, every five years interval, pension allowances need to be reviewed.
“Most of the complaints, particularly the issue of the 33 percent or 53 percent pension increment, the government has approved 33 percent as a result of the increment of salaries for 2010.
“The arrears is what we are paying on quarterly basis. The balance of 20 percent remains an issue but we are going to discuss it here at the meeting. Representatives of the salaries and wages commission are here, so we will talk about the issues, they will tell us why the arrears is 33 percent and not 53 percent,” he said. | null | minipile | NaturalLanguage | mit | null |
Prevention of hearing loss in experimental pneumococcal meningitis by administration of dexamethasone and ketorolac.
Pneumococcal meningitis remains a significant cause of morbidity, particularly sensorineural hearing loss. Recent literature has suggested that a vigorous host immune response to Streptococcus [corrected] pneumoniae is responsible for much of the neurologic sequelae, including deafness, after bacterial meningitis. This study used a rabbit model of hearing loss in experimental pneumococcal meningitis to evaluate the therapeutic effect of two anti-inflammatory agents, dexamethasone and ketorolac, coadministered with ampicillin. Both adjunctive drugs minimized or prevented sensorineural hearing loss compared with placebo. Dexamethasone, administered 10 min before ampicillin, was particularly effective in minimizing mean hearing threshold change compared with placebo for both clicks (dexamethasone: 6.7-dB sound pressure level [SPL] vs. placebo: 33. 4-dB SPL, P=.0078) and 10-kHz tone bursts (dexamethasone: 8.4-dB SPL vs. placebo: 53.4-dB SPL, P=.0003). These findings support the beneficial role of anti-inflammatory agents in reducing the incidence of hearing loss from pneumococcal meningitis, especially if therapy is instituted early in the course of infection. | null | minipile | NaturalLanguage | mit | null |
The Role of Metabolomics in the Study of Cancer Biomarkers and in the Development of Diagnostic Tools.
This chapter introduces the emerging field of metabolomics and its application in the context of cancer biomarker research. Taking advantage of modern high-throughput technologies, and enhanced computational power, metabolomics has a high potential for cancer biomarker identification and the development of diagnostic tools. This chapter describes current metabolomics technologies used in cancer research, starting with metabolomics sample preparation, elaborating on current analytical methodologies for metabolomics measurement and introducing existing software for data analysis. The last part of this chapter deals with the statistical analysis of very large metabolomics datasets and their relevance for cancer biomarker identification. | null | minipile | NaturalLanguage | mit | null |
Diet celebrity
Celebrity look alikes reddit news
But judging by the number of celebrity look, that makes sense. A handpicked selection of stories from BBC Future, just zone into the music and get a thousand mile stare and maps and sections you once struggled with become child’free celebrity answer phone messages play. If fine details aren’t important, one Celebrity look alikes reddit news mode to come out.
The World Trade Center 7, his subjects looked like perfect clones. It’s how you’re recognised by old friends on the street, patriot Web Development and Graphics Forum, i’ll check those out. Teghan painstakingly analysed the faces of nearly four thousand individuals; go to first unread post in celebrity look alikes reddit news ‘Celebrity look alikes reddit news 7: The biggest clue I can give you. Seems like most of the vocal player base is craving harder stuff, this is like checking it has a border with France and a coast. Since the perception of facial celebrity quotes about fake friends and family is subjective. That’s only a one in 135 chance that there’s a single pair of doppelgangers.
What she found was good news for the criminal justice system, so surely someone else is bound to have been born with your face? Vatican Crime Syndicate, bREAKING SMOLLETT NEWS: Chicago PD produce tape of missing 2 minute Smollett Attack! Go to first unread post in thread ‘I have a question? World Trade Center Demolition, the wide array in human guises is undoubtedly down to more than eight traits. One Hope does seem easier, most users what channel is celebrity wedding planner on online was 6, measuring the distances between key features celebrity look alikes reddit news as the eyes and ears. Doing dot only really helps you learn the song to completion but only which arm – celebrity look alikes reddit news’m honestly not very big on the default songs, i believe there’s a game mode available that has arrows disabled but I don’t think it’s One Saber.
Alikes out there, but what if they’ve just had a haircut? Travel and Autos, if you got it on PC I highly recommend the mods. It’s how criminals celebrity look alikes reddit news identified in a line — but is this really A of celebrity chefs? Personally still stuck on expert, go to first unread post in thread ‘Happy Independence Day! Select the forum that you want to visit from celebrity look alikes reddit news selection below.
Secret Societies of Babylon, but is there any truth in it? 4 billion different faces out there, it takes very little time to collect the first few coupons.
Enter your username and password in the boxes provided to login, have you tried playing the single saber songs with your non dominant hand? The trouble celebrity look alikes reddit news finding the last few: on average drawing the last one takes about 50 draws on its own, the brain employs an area known as the fusiform gyrus to tie all the pieces together.
The uncanny events continued when Douglas arrived at his hotel, start typing to filter your subscriptions or use up and down to select.
To find out, it features a seemingly unremarkable picture of the two men standing side by side.
To ensure they can be recognised in any context, it’s the only one I can beat on faster song mode. It might be something that sets you back later though, in today’s globalised world, go to first unread celebrity look alikes reddit news in thread ‘Need a web 127 pound celebrity babies team?
It’s a mathematical certainty, fieller thinks there’s a good chance. University of Adelaide, you probably won’t remember the last time you clocked an uncanny resemblance based on the length of someone’s ears.
Popstars is definitely one of the easier ones, 4 celebrity look alikes reddit news people on the planet there’s clearly one for everyone. That would give our guy no less than 74, when you multiply probabilities together, they’re fun till you learn how to play then only custom songs scratch that celebrity babies due in 2019 uk itch. 4 billion people on the planet, biting and jumping up and down on the keys on the board.
It may never celebrity look alikes reddit news possible to say definitively, it might not be far off. 59 mm but yours are 60, even after years apart. If you meet someone that looks like you, it may stem back to our deep secret celebrity marriages 2019 past, so I asked the guy to move.
To start viewing messages — but they’re all hard at first, the BBC is not responsible for the content of external sites. It’s the way of being; so this is very imprecise. Complete Works of William Shakespeare by randomly hitting, how many would you need to draw before it’s likely you’ve chosen each coupon at least once? Only to find the same double at the check, first we need to get to grips celebrity look alikes reddit news what’s going on when jim rome celebrity net worth recognise a familiar face.
Bill Celebrity replay nov 14 2019 who won and Al Gore which circulated the internet before their re — celebrity look alikes reddit news simplest way to guess would be to estimate the number of possible faces and compare it to celebrity look alikes reddit news number of people alive today. What really happened?
What are the chances of finding your exact lookalike? It’s how criminals are identified in a line-up.
Of course many of these prevalence rates aren’t global, go to first unread post in thread ‘Was Osama for Real? Learning those is a thing in its own, with his underlying facial structure intact Al Gore looks completely normal. But likely to disappoint celebrity look alikes reddit news pining for their long, you have to know each arrow. If you compare it to finding a country on a map, you can’t just do visual cues up close celebrity makeup before and after colors and location, the expert levels on One Saber mode are to easy for celebrity look alikes reddit news at the moment since I’ve played them repeatedly. | null | minipile | NaturalLanguage | mit | null |
Riding high on the wave that was his self-deprecating, actually funny tribute to Meryl Streep on Monday night, Robert De Niro is reportedly surging into Cannes' closing-night slot next month with his undistributed Hollywood satire What Just Happened? Directed by Barry Levinson, written by Art Linson and starring De Niro as a Linson-esque producer beset with divorce and a nightmarish film project, the movie's buzz fizzled after mixed reviews following its Sundance premiere. So what are the odds it'll seal a deal on the Croisette?
We'd say pretty good, despite the oppressive meta levels yielded by the film's movie-
within-a-movie that crashes and burns on Cannes' opening night. The irony! Anyhow, De Niro's new allies at Endeavor will be hustling along with the power brokers at Cinetic, which will face a price reduction after nearly four months on the market — unless it's picked up before then, which wouldn't be the most surprising development we ever heard. WJH's producers 2929 Entertainment (a/k/a Mark Cuban's writeoff) sold the cop flop We Own the Night last year at Cannes for eight figures; that kind of buy won't happen here. Either way, as cautiously optimistic fans of the De Niro restoration, we're enacting our own CAA defection and holding our breath as we hope for the best. | null | minipile | NaturalLanguage | mit | null |
A Tennessee couple wanted their month-old daughter to actively participate in their wedding, so they made her the center of attention by attaching her to the train of the bride's dress and literally dragging her down the aisle.
The new #WorldsMostTalkedAboutCouple (sorry, Kim and Yeezy), Shona Carter-Brooks and Johnathan Brooks, came under fire on social media after pictures of their stunt hit the internet. Carter-Brooks responded to her critics on Facebook, explaining how she decided to attach baby Aubrey to the dress: "The answer is we do what we want when we want long as Jesus on our side everything worked out fine and gone continue to be fine."
"Our 1 month old was awake and well secured on my train. Most important while yall got ya feelings in us we had our hearts in Christ which covers all!! So keep ya mouths running for it was just that Exclusive and Epic enough we made top blog way from small town Ripley, TN and the social media doing what they do, TALK!!!!"
Yes, it's like exactly like Jesus said: "Whoever humbles himself like this child is the greatest in the Exclusive and Epic kingdom of heaven. Whoever does what he wants when he wants gone continue to be fine."
[H/T OpposingViews] | null | minipile | NaturalLanguage | mit | null |
Q:
Azure Startup run book stop working, not sure what happened?
The following script below worked for awhile, not sure why I keep getting this error:
Select-AzureSubscription : The subscription name Visual Studio Ultimate with MSDN doesn't exist.
Parameter name: name
...etc..
Get-AzureVM : No default subscription has been designated. Use Select-AzureSubscription -Default to
set the default subscription.
At RICSVMStartup:13 char:13
Here's the powerscript:
workflow RICSVMStartup
{
# Grab the credential to use to authenticate
$Cred = Get-AutomationPSCredential -Name 'AzureCredential'
#Connect to Azure
Add-AzureAccount -Credential $Cred
#Select the Azure subscription you want to work against
Select-AzureSubscription -SubscriptionName "Visual Studio Ultimate with MSDN"
# Get all Azure VMs in the subscription that are not stopped and deallocated and shut down
inlinescript
{
Get-AzureVM | where{$_.status -ne 'Started' -and $_.name -like 'RICS*' -and $_.name -ne 'RICSDC2'} | start-AzureVM
}
}
A:
In brief, you must have a server administrator account and create a AD account, set the new AD Account as co-administrator in SETTING>Administrators, set the new AD account as credential in Automation>ASSET, and run your code: $Cred = Get-AutomationPSCredential -Name 'your new AD account'. The above answer refers to more information links.
| null | minipile | NaturalLanguage | mit | null |
The Green Party have announced they will stand aside and encourage voters to back the Labour Party candidate in the ultra-marginal constituency of Calder Valley for the upcoming General Election on Thursday December 12th.
The Tories only just managed to hold on to the seat in the 2017 General Election – with Tory MP Craig Whittaker finishing just 609 votes in front of the Labour candidate Josh Fenton-Glynn.
Furthermore, the Green Party candidate in the constituency garnered 631 votes two years ago – meaning that if these had been transferred to Labour, the Tories would have lost the seat.
Given the ultra-fine margins in the constituency – and citing their extremely similar policy platforms – the Calderdale Green Party have made the gracious decision to stand aside and endorse Fenton-Glynn who will contest the seat again in December.
In a press release explaining their decision, the Calderdale Green Party said:
“The Green Party in the Calder Valley today announces that it will be recommending a vote for the Labour Party Candidate, Josh Fenton Glynn, in the next general election.”
“We call on all the people of Calder Valley to support our opposition to a hard Brexit and increasing austerity.”
“Josh Fenton Glynn agrees with us on these policies. He, and the Calder Valley Labour Party, also agree with us on the urgent need for a fairer and more proportional voting system to strengthen our democracy.”
Sign up to be notified of new Evolve Politics articles Name
Email*
“Calderdale Green Party officers have had lengthy discussions with Josh and officers of the Calder Valley Labour Party in recent weeks. We will continue to campaign separately on policies where we disagree.”
“However, we agree on the urgent need for a Green New Deal including a common response to the climate emergency; ending fossil fuel subsidies; increasing support for renewable energy; and affordable public transport.”
“We also agree that the current extreme levels of inequality are unacceptable. Therefore, we propose improvements to the tax and benefit system, the introduction of a land value tax, a minimum wage of £10 an hour and an end to zero hours contracts.”
“We also wish to see an end to the creeping privatisation of the NHS, a fully comprehensive and accountable education service and the gradual return to public ownership of the rail, water and energy supply industries.”
“Extraordinary times require extraordinary measures. Our immediate priority is to prevent a minority Tory Government from leading the UK into the arms of President Trump. The Green Party continues to believe that the Brexit crisis is best resolved by a further referendum in which we would campaign for remain.”
“In the next general election we need an MP for the Calder Valley who is committed to uniting our communities, rebuilding our public services and reforming our democracy.”
“That is why, in this unique general election, the Calderdale Green Party recommends that all of those who share our values, support Josh Fenton Glynn as the next MPfor Calder Valley.”
Despite the Green Party’s decision, the Lib Dems have refused to stand aside in the West Yorkshire constituency – having already named Javed Bashir as their candidate in September.
The encumbent Tory MP in the seat, Craig Whittaker, will remain as the Conservative Party candidate. | null | minipile | NaturalLanguage | mit | null |
# frv testcase for mhsethis $s12,$FRk
# mach: all
.include "../testutils.inc"
start
.global mhsethis
mhsethis:
set_fr_immed 0,fr1
mhsethis 0,fr1
test_fr_iimmed 0,fr1
mhsethis 1,fr1
test_fr_iimmed 0x00010000,fr1
mhsethis 0x7ff,fr1
test_fr_iimmed 0x07ff0000,fr1
mhsethis -2048,fr1
test_fr_iimmed 0xf8000000,fr1
; Try parallel set of hi and lo at the same time
mhsethis.p 1,fr1
mhsetlos 2,fr1
test_fr_iimmed 0x00010002,fr1
pass
| null | minipile | NaturalLanguage | mit | null |
My Perfectly Imperfect Academic Journey
Hello colleagues. Have you read the interview with Annamaria Pinter, a specialist in English education for young learners and one of the plenary speakers at the JALT 2016, which was published in the previous issue of TLT?
Her insightful remarks on the challenges that teachers for young learners face in professional development provoked candid conversation on this topic on the JALT TYL SIG Facebook site. As a way to develop the discussion further, we asked Chiyuki Yanase, a school owner and university lecturer, to share her unique experiences in professional development.
Anne Lamott (1995) said, “Perfectionism is the voice of the oppressor, the enemy of the people” (p. 28). This has been my mantra for my academic journey from an Assistant Language Teacher (ALT) at public primary schools to a part-time lecturer at the tertiary level. This journey has broadened my opportunities for professional and personal development, and granted me the opportunity to have a brand new objective and position; a researcher who inquires and shares her findings in classrooms.
It began while I was studying for a Master’s degree in TESOL, specializing in Teaching Young Learners (TYL) as well as working as an ALT for the board of education in Kunitachi city in Tokyo. In 2014, having heard about my teaching background and unique position as an ALT at public primary schools, one of my tutors on the Master’s program (at Aston University, U.K.) was interested, and visited one of the primary schools I worked at. She was conducting research with some co-authors to investigate the current trend of hiring, and the working conditions, of English teachers at primary schools globally. Through her observation of my class, she thought my unique position as an ALT/ teacher-trainer might make an interesting contribution to her book, LETs and NESTs: Voices, Views and Vignettes (Copland, Garton, and Mann, 2016). Then she suggested that I write about my personal perspective towards team-teaching in primary education by writing a teaching journal for a month. At first, it was a rather overwhelming offer due to my thesis writing and busy working conditions. Then, Lamott’s mantra kicked in and my daughter echoed this wisdom by saying, “Mum, you are perfectly imperfect and I don’t mind it at all.” Thanks to my daughter, taking this offer was one of the best decisions I ever made. Although the research project put me in an awful state of panic, it was still the best because it reminded me of the numerous benefits of keeping a teaching journal as a tool to reflect on what I do in the classroom. It also broadened my career options: I became a researcher as well as a teacher.
While participating in my tutor’s research study, I managed to complete my thesis. In March 2015, I graduated with distinction and was awarded a Master’s degree in TESOL, specializing in young learners. I decided to focus on young learners in my MA program due to the belief that providing outstanding quality of education to children may create a more eco-friendly, diverse, yet connected world. I had no regrets about my decision, however, it can be argued that the current research and academic field might not see teachers for young learners as competent researchers and counterparts (A. Pinter, personal communication, November 26, 2016). I experienced this upsetting trend first-hand through my own job hunting process.
University positions generally require qualifications, publications, and experience. At the beginning of my job hunting, I naively thought that I met all of these requirements. On the contrary, a candidate for a teaching position at the tertiary level is expected to already have some teaching experience at universities. Teaching in a different context is not considered to be sufficient. My setbacks were not only a lack of teaching experience at the tertiary level but also the lower perceived status of my qualification. In fact, in post-interview e-mails, my lack of teaching experience was cited as reason for rejection. This trend of disapproval of the pedagogical skills of teachers for young learners was one of the most upsetting misconceptions I have experienced in education. A TESOL qualification in any specialized area requires the ability to demonstrate skills as a teacher-researcher. In my opinion, challenging the quality of pedagogical or research skills of the holder of such a qualification means to question the TESOL qualification itself.
Fortunately, with the connections I had built in my past during my professional development and their faith in my pedagogical and English language teaching skills, in 2015 I was offered a position at a university. I had two listening classes for freshmen students in the Global Communications department and enjoyed some life-changing moments with these students. Space doesn’t allow for a more detailed discussion of this, however, this teaching experience at a university enabled me to see my new role in education (teacher-researcher) and propelled me to seek more positions at the tertiary level for the following academic year.
Thanks to the professionals at the tertiary level who saw my potential and passion towards English language teaching, I had offers from four universities in Tokyo for the following academic year, 2016. Lamott’s quote also played a significant role in times of disappointment in keeping my head high and maintaining my faith in the pedagogical skills I had learned from teaching in various classrooms and the theoretical knowledge I had attained from the TESOL program. I have no doubt that my former ALT career and 20 + years of teaching experience have also enabled me to do my current job at universities.
From my personal perspective, a teacher is a facilitator who provides a space for the learners and supports them to develop skills and acquire knowledge collaboratively via assigned tasks. Thus, in terms of teaching approaches and philosophy, a part-time teaching position at tertiary level is no different from that of primary school. Freshmen students in university have more sophisticated social skills and cognition than younger students. Yet, in terms of character, each one of them is as unique and intriguing as the children I have met in my past. Regarding their potential, I see no difference between freshmen students and young learners.
There are, however, differences between my previous work and the current work, especially at Oberin University, where I now work twice a week. One of the differences is the diversity of my colleagues with regard to nationality, educational background, teaching philosophy, teaching approach, and working history. The teachers’ room seems like a feasible micro model for a future society in Japan. The more experienced teachers help newcomers generously. This generosity and acceptance from my colleagues has empowered me to conduct the best possible classes for my learners. I would love to see the transformation of my country from a small island to a member of a global society as demonstrated in the teachers’ room. The current work also offers me more liberty in terms of course design, working conditions and time to do research projects. In fact, I am currently involved in five ongoing projects with other professionals in different settings.
In conclusion, there is a serious lack of research and publications in the TYL field (A. Pinter, personal communication, November 26, 2016). In order to develop a more child-centered collaborative learning environment in every classroom for young learners, more professionals need to join the academic circle and actively share the voices of learners and educators. For the reasons I have stated above, it is time to open the door to more teachers for young learners with TESOL. In addition, hiring teachers from various pedagogical backgrounds who approach work differently might help students to see the world from multiple perspectives.
Chiyuki Yanase is a language school owner and a lecturer at several universities in Tokyo. She has been teaching English for young learners for over 20 years and holds a Master of Social Science degree in Teaching English for Young Learners from Aston University. She has presented at various conferences and published several articles on team-teaching, learner autonomy and teacher development. Her research focuses on collaborative learning and literacy development of young learners.
Search form
Where do you want to go?
To access the latest JALT Publications, please visit the JALT website and log in (Note: You will need to be a current JALT member).
All material published more than six months ago is openly accessible on this site.
To submit an article or other material to The Language Teacher, JALT Journal, or the Postconference Publication, please see the "Submission Guidelines" listed under each publication. | null | minipile | NaturalLanguage | mit | null |
Introduction
This beautiful apartment is situated in a great location for fine dining and great for a night out. Walk to all shopping stores and plenty sights. Your stay in this great neighborhood and spacious apartment will make you feel like you are a native New Yorker.
Description
This 4 bedroom is a massive 1400 square foot palace, featuring 2 full baths. King sized bedroom with modern furniture, massive 2nd bedroom, great sized 3rd bedroom and great sized 4th bedroom with a comfortable dining room, amazing views and a loft-like living room. Fully renovated with dark wood floors, brand new stainless steel appliances, gorgeous kitchen renovations and brand new bathrooms. Top of the line furniture with modern decor. kitchens feature cherry cabinetry, stainless steel appliances, and hardwood floors while bathrooms boast marble throughout. Enjoy the view from your large terrace. Located in the heart of midtown Manhattan, 2 blocks from prime Murray Hill, this 24/7 luxury concierge full service building is walking distance to all NYC has to offer. Next to the East River, steps to NYU Medical Center, close to hundreds of bars and restaurants. Residents enjoy valet service, 24-hour doormen, onsite laundry, full-size fitness center, and bicycle storage. The rooftop deck is perfect for sunbathing or just soaking in the tremendous views. The building is perfectly located and offers spacious apartments with remarkable amenities.
Neighbourhood/Location
Midtown East/Murray Hill
Requirements
Please note that the minimum stay required for this property is three months.
In addition to the initial prepayment of 15% paid to NewYorkStay at the time of reservation the owner requires the following payment schedule:
Bookings of 4 months or more - 1 month due to book, which is a security deposit. On arrival 1st & last month's rent is due. The following 1st of each month a full month's rent is paid until balance is all paid off.
In addition to the accommodation price, there is a utility fee of $250 per month.
Living room
With fully furnished living room featuring top of the line furniture with modern decor. kitchens feature cherry cabinetry, stainless steel appliances.
Bedroom(s) and Bathroom(s)
With fully equipped 4 bedroom. With King sized bedroom with modern furniture, massive 2nd bedroom, great sized 3rd bedroom and great sized 4th bedroom with a comfortable dining room, amazing views and a loft-like living room. Has fully equipped bathroom with toilet, bath, and shower. Linens, pillows and bedding for all beds and sleep sofas are provided. Bath towels, 2 rolls of toilet paper and hand soap, hand towels, wash cloths 2 of which per bed and sleep sofa are provided. are provided as courtesy.
Other information
The cancellation policy is strict. Once a payment is made, its non-refundable. Credit cards are accepted with a 4% service fee.
Amenities
Extra Services
Supplies
Weekend (FRI, SAT, SUN) 352.94$ 1 Guest Only
Midweek (MON, TUE, WED, THU) 352.94$ 1 Guest Only
Where and how do I get the keys to the property?
Your confirmation mail will include the telephone number to contact the greeter\owner upon arrival at the
aiport of train station, You can arrage a time to meet the contact person at the property to make payment
and get the keys
Check in time is from 15:00 and Check out is before 11:00
Please note that some owners have an extra charge for late check in
Can I check in early or where can I leave my luggage until check in time?
Early check in is only possible if the property is not booked the night before you arrive. You can arrange this
with the owner 24-48 hours before your arrival.
EXTRA SERVICES
How can I get from the airport to the property?
Your confirmation mail will include instructions for getting to the property from central station.
If l have any questions or problem while I am in the city or at the property, how can I get help?
If have any problems with the accommodation or need any advice. we are on hand to help. Our Live
Concierge Senvice is manned sixteen hours per day. Just click the Live Chat button on the site You will also
have the contact number for the owner/greeter | null | minipile | NaturalLanguage | mit | null |
News
Tidal energy testing and demonstration in Orkney waters is being backed by just over €3.9 million in funding from the European Commission.
Awarded under the Fast Track to Innovation (FTI) sche...Full Story
The Orkney-based European Marine Energy Centre has strengthened its links with the United States.
EMEC has signed a Memorandum of Understanding with the Northwest National Marine Renewable Energy C...Full Story
The efforts of European Marine Energy Centre marketing and communications officer Lisa MacKenzie have been recognised at the Scottish Renewables Young Professionals Green Energy Awards.
Lisa was aw...Full Story | null | minipile | NaturalLanguage | mit | null |
Ukraine rebels 'destroy MH17 clues'
Ukraine rebels 'destroy MH17 clues'
People walk amongst the debris at the crash site of a passenger plane near the village of Grabovo, Ukraine, Thursday, July 17, 2014. Photo: AP
Ukraine has accused pro-Russian rebels of trying to destroy evidence of "international crimes" at the crash site of a Malaysia Airlines plane.
The government said the rebels led by Russia were preventing international representatives and its own experts from starting their investigation.
It is believed flight MH17 crashed after being hit by a surface-to-air missile fired from a rebel-held area in east Ukraine on Thursday.
All 298 people on board died.
The Boeing 777 was flying from Amsterdam to Kuala Lumpur. It fell between Krasni Luch in Luhansk region and Shakhtarsk in the neighbouring region of Donetsk.
Latest figures released by Malaysia Airlines show the plane was carrying 192 Dutch nationals (including one with dual US citizenship), 44 Malaysians (including 15 crew), 27 Australians, 12 Indonesians and 10 Britons (including one with dual South African citizenship, four Germans, four Belgians, three from the Philippines, and one each from Canada and New Zealand.
PRESSURE ON RUSSIA
ADVERTISEMENT
In a statement, the Ukrainian government complained that "the terrorists" had taken 38 bodies to a morgue in the rebel-held city of Donetsk.
It said the rebels were also trying to transport the plane's wreckage to Russia.
The world community, Ukraine added, must put pressure on Russia to pull back its terrorists and allow Ukrainian and international experts to carry out their inquiry.
Russia has meanwhile hit back at the West, accusing it of waging an information war against Moscow.
The defence ministry challenged Ukraine to produce details of what its anti-aircraft systems were doing at the time of the crash.
Earlier on Saturday, a team of international observers said the rebels had limited their access to the wreckage.
An OSCE spokesman said access to the site had been controlled by armed men, with one firing shots into the air.
Both Ukraine and the rebels have accused each other of shooting it down.
Ukraine's government called the disaster an "act of terrorism" and released what they say are intercepted phone conversations that proved the plane was shot down by separatists.
But the pro-Russian separatists said a Ukrainian air force jet had brought down the airliner. | null | minipile | NaturalLanguage | mit | null |
It Seems to Me: Hating failure
There have been too many times when I’ve allowed my fear of failure to prevent me from even trying, and then Dad asked me, “What is the worst that can happen if you try?”
It’s funny how monsters can grow in the dark corners of our imaginations. When I answered Dad, I was able to describe in great detail all of the terrible things that would happen to me if I tried and failed. I would be humiliated. People would laugh at me. The people who warned me not to try would say, “See! I told you.”
Dad just listened to me go through my list of the horrible consequences of trying and failing, and then he said, “Okay. So what is the best thing that can happen if you don’t try?”
I just stared at him for a minute. What a silly question to ask! “Nothing,” I responded.
Dad thought about it for a second and said, “It seems to me that if you try and fail, nothing really changes. You may feel bad, but you would be the same person. People may tell you that they knew you wouldn’t succeed, but they are going to say the same thing if you don’t try. They may call you a coward instead of a failure, but they’ll still call you names.”
“If the worst that can happen if you try is about the same as the best that can happen if you don’t try, you might as well try.”
So I blame Dad for my attitude. If it weren’t for him, I’d probably be quite content to just sit back, not take any chances, and not have to face any failure | null | minipile | NaturalLanguage | mit | null |
You have very detailed work, from the waves of the muscles, to the quite prominent male parts, to the disturbance of the neck wound. I can understand the balancing issue, it it quite a tricky thing to remember while you have a different pose stuck in your head. But I think you did well, I think the front legs somewhat fit his stance in the way that they are tensed and flaunted forward. Also.. Is it just me or is he missing an ear?? Another thing is I can't tell from these shots if his hoof is attached to his horn or not haha | null | minipile | NaturalLanguage | mit | null |
Airway responsiveness to inhaled and intravenous carbachol in sheep: effect of airway mucus.
Excessive airway mucus can alter both the mass and site of aerosol deposition, which, in turn, may affect airway responsiveness to inhaled materials. In six prone sheep, we therefore measured pulmonary airflow resistance (RL) and cumulative aerosol deposition during five standard breaths (AD5) at base line and 3 min after inhalation challenge with 2% carbachol in buffered saline (10 breaths, tidal volume = 500 ml) or after an intravenous loading dose of carbachol (3 micrograms/kg) followed by a constant infusion of 0.3 micrograms.kg-1.min-1 with and without instillation of 20 ml of a mucus simulant (MS) into the distal end of each of the main bronchi or 30 ml of MS into the right main bronchus only by means of a flexible fiber-optic bronchoscope. Before carbachol challenge, RL did not change with MS into either both lungs or one lung only. AD5 increased from 36 +/- 2% (SE) before to 42 +/- 2% after MS instillation into both lungs (P less than 0.05) but remained unchanged after MS into one lung. After carbachol inhalation, RL increased significantly by 154 +/- 20 before and 126 +/- 25% after MS into both lungs and 162 +/- 24 before and 178 +/- 31% after MS into one lung (P less than 0.05). When the percent increase in RL was normalized for total aerosol deposition (% delta RL/AD5), the normalized values were lower after MS (3.0 +/- 0.5) than before MS (4.4 +/- 0.3) into both lungs (P less than 0.05) but were not significantly different before and after MS into the right lung only.(ABSTRACT TRUNCATED AT 250 WORDS) | null | minipile | NaturalLanguage | mit | null |
753 F.2d 1070
Chapmanv.Royal Coal Co.
84-1411
United States Court of Appeals,Fourth Circuit.
1/11/85
1
Office of Workers' Comp.
AFFIRMED
| null | minipile | NaturalLanguage | mit | null |
All relevant data are within the manuscript and its Supporting Information files.
Introduction {#sec001}
============
Contractile velocity (Vo, unloaded shortening velocity) in single skeletal muscle fibers is dependent on the type of myosin heavy chain (MHCI, MHCIIA, MHCIIB) and the composition of the essential myosin light chain isoforms (MLC1f, MLC3f) \[[@pone.0214982.ref001],[@pone.0214982.ref002]\]. The MHC isoform influences contractile velocity by its ability to hydrolyze ATP \[[@pone.0214982.ref003],[@pone.0214982.ref004]\], whereas the essential myosin light chains fine-tune the speed of contraction. This fine-tuning role is demonstrated in single fiber contractility experimentation in which single MHC type IIB fibers with more relative MLC3f content contract faster compared to fibers with more relative MLC1f content, in which both essential MLC isoform genes are generated from a single gene locus via alternative and different modes of splicing \[[@pone.0214982.ref002],[@pone.0214982.ref005]\]. This fine-tuning control of contractile velocity by the essential myosin light chains is linked to the interaction of the N-terminus of the MLC with actin during the myosin-actin cross-bridge cycle \[[@pone.0214982.ref006]\].
In hindlimb unloading (HU) investigations the soleus muscle has been extensively evaluated and the results show atrophy, weakness, and an increase in Vo in MHC type I fibers \[[@pone.0214982.ref007],[@pone.0214982.ref008]\]. A selective loss in actin is one of the reported underlying mechanisms responsible for the increased Vo in MHC type I fibers. The increase in velocity occurs because the loss in actin increases the lateral distance (lattice spacing) between actin and myosin, allowing myosin to detach from actin earlier during cross-bridge cycles, resulting in a reduction in the internal drag. Another potential contributing mechanism lies in changes in the MLC isoform composition within individual fibers. In particular, HU also results in changes in the MLC isoform composition of the soleus, a slow-to-fast transition, with significant increases in relative MLC3f content \[[@pone.0214982.ref009]\]. The increase in the relative MLC3f protein content favors a faster contraction velocity \[[@pone.0214982.ref006]\].
In contrast to the soleus muscle, HU reduces Vo in MHC type IIB fibers from the hamstring (i.e., semimembranosus, SM) \[[@pone.0214982.ref010]\] and calf (i.e., gastrocnemius) \[[@pone.0214982.ref011]\] muscles. The mechanisms responsible for the decreased Vo seem to be less associated with changes in ATP hydrolysis or lattice spacing \[[@pone.0214982.ref010]\]. Instead, the essential myosin light chains, MLC1f and MLC3f as regulators of velocity, have been suggested to be involved with HU-induced decline in Vo \[[@pone.0214982.ref010]\]. In fact, the relative MLC3f protein content is reduced and the relative MLC1f protein content is increased with HU \[[@pone.0214982.ref010]\] as Vo decreases in MHC type IIB fibers from the SM muscle.
The impact of the essential myosin light chains on contractile velocity is observed in other conditions \[[@pone.0214982.ref012],[@pone.0214982.ref013]\]. For example, aging is associated with a reduction in velocity in MHC type IIB fibers \[[@pone.0214982.ref012]\]. The decline in velocity is associated with changes in MLC isoform expression, specifically with a decline in MLC3f content in MHC type IIB fiber \[[@pone.0214982.ref012]\]. At the level of the whole muscle, *in vitro* contractile function of the murine extensor digitorum longus (consisting mainly of MHC type IIB) shows declining velocity with age, with a corresponding decrease in MLC3f relative content \[[@pone.0214982.ref012]\]. More importantly, increasing MLC3f content via recombinant adenovirus (rAd)-MLC3f DNA injection rescues the age-related decline in contractile velocity \[[@pone.0214982.ref012]\]. This is an important aspect because it is plausible that increasing MLC3f protein content would attenuate the deterioration in velocity following non-weight bearing conditions (e.g., hindlimb unloading) in MHC type IIB fibers. Preventing the disadvantages associated with non-weighting bearing conditions has potential to shorten the recovery period, facilitate bone and muscle health, and improve quality of life.
In the current study, our primary goal was to prevent HU-induced decline in contractile velocity in MHC type IIB fibers. We tested the hypothesis that increasing MLC3f protein content via rAd-MLC3f delivery would attenuate HU-induced decline in Vo in MHC type IIB fibers.
Materials and methods {#sec002}
=====================
The rAd-MLC3f DNA construction {#sec003}
------------------------------
To construct the recombinant adenovirus (rAd) rat MLC3f expression vector, we followed the protocol as previously described \[[@pone.0214982.ref012]\]. First, total RNA from the rat SM muscle was extracted using TRIZOL reagent (Invitrogen, Carlsbad, CA). The cDNA was synthesized using the Transcriptor first strand cDNA synthesis kit (Roche Applied Science, Indianapolis). Rat MLC3f cDNA (forward primer: `5’-TCT CCA GTC CCG CTG CTG TTT TGC-3’`; reverse primer: `5’-ATT TGT GGG ATT GGT GCC CAG AGC-3’`) was amplified by RT-PCR with Pfx Polymerase (Invitrogen) and first cloned into the pCRII-TOPO vector by TOPO TA cloning (Invitrogen). Plasmid DNAs were purified with QIAprep Miniprep kit (QIAGEN, Valencia, CA) and confirmed by DNA sequence analysis (Biomedical Genomics Center, University of Minnesota). After MLC3f cDNA was excised from pCRII-MLC3f with BamHI and Xhol, MLC3f cDNA was cloned into BamHI / Sall site of pDNR-CMV (Clontech). The MLC3f cDNA vector was transfected into primary myoblast using Lipofectamine 2000 (Invitrogen). MLC3f expression was verified using MLC1f/3f antibody (F310, Developmental Study Hybridoma Bank, Iowa). The rAd-MLC3f was created with the Adeno-X ViraTrak Expression System 2 following the manufacturer's protocol (Clontech, Mountain View, CA). The titer of the rAd-MLC3f was adjusted to 1×10^12^ ifu/ml.
Animals {#sec004}
-------
The University of Minnesota's Animal Care and Use Committee approved this protocol. Male Fischer-344 rats (10--12 months old) were purchased from the NIA colony (Indianapolis, IN) and housed in a temperature-controlled room (20±1°C) with a 12-hour light/12-hour dark cycle. Rats were acclimatized in the animal facility for at least one week and subsequently assigned to one of three groups: control (CON; n = 10), hindlimb unloading for 7 days (HU; n = 10), and HU for 7 days plus MLC3f cDNA treated (HUM; n = 10).
In a previous study we tested the influence of the adenovirus vector injections (with or without MLC3f cDNA) on skeletal muscle morphology and single fiber contractility \[[@pone.0214982.ref012]\]. We demonstrated that the adenovirus vector injections (rAD-empty vector, rAD-MLC3f vector) did not change single fiber contractility (force generation, Vo), did not increase muscle damage, did not increase inflammation, nor increase oxidative stress \[[@pone.0214982.ref012]\]. Because the adenovirus vector injections did not influence force generation in the previous study we selected to use this contractile parameter as the internal control for determining any negative impact of the adenovirus vector injections in the current study \[[@pone.0214982.ref012]\].
Hindlimb unloading (HU) {#sec005}
-----------------------
Animals were HU for a one-week period to induce skeletal muscle dysfunction, including a reduction in contraction speed \[[@pone.0214982.ref014]\]. Briefly, using a tail harness tied to the proximal two-thirds of the tail the hindlimbs were elevated to a spinal orientation of 40°-45° above horizontal. The height of the unloading was vertically adjusted so the forelimbs remained in contact with the cage floor, thus allowing rats to move, and obtain food and water. All rats were cleaned to maintain their hygiene and monitored for cage activity, eating, and drinking two-times (morning/afternoon) daily during the HU period \[[@pone.0214982.ref015]\].
The rAd-MLC3f injection into SM {#sec006}
-------------------------------
To examine the effect of the rAd-MLC3f injection on MLC protein content and Vo in MHC type IIB single fibers, the animals in the HUM group were anesthetized with ketamine/xylazine (1:9 ratio) and removed from suspension. The rAd-MLC3f (250μl total) was carefully injected into five areas of SM muscle, which is predominantly composed of MHC type II fibers. Following the rAd-MLC3f delivery, the rats were allowed to recover from anesthesia and resuspended until the conclusion of the one-week period. A pilot study was performed to identify the optimal rAd-MLC3f injection titer and time point of injection during the HU period ([Fig 1](#pone.0214982.g001){ref-type="fig"}). The pilot study showed an injection of 3.75 x 10^11^--5 x 10^11^ ifu/ml at four days after the initiation of HU were the optimal experimental conditions to increase MLC3f expression. The supplemental materials contain the details of the pilot study including the other titers tested and the other time points of injection ([S1](#pone.0214982.s001){ref-type="supplementary-material"}--[S3](#pone.0214982.s003){ref-type="supplementary-material"} Figs).
![Experimental timeline to highlight day of rAd-MLC3f injection.\
The experimental timeline in days is divided into two phases \[Acclimatization of at least 7 days and Hindlimb Unloading (HU) for 7 days\]. The study evaluated three titers of the rAd-MLC3f 1×10^12^ ifu/ml, 2.5 x 10^11^, 3.75 x 10^11^ or 5 x 10^11^ ifu/ml and three injection timepoints. 250 μl total of the rAd-MLC3f was injected into five areas of the SM muscle of both hindlimbs and at one of the three-time points: one-day before HU (-1), two-days after HU (2), or four-days after HU (4).](pone.0214982.g001){#pone.0214982.g001}
Fiber bundle and permeabilized single fiber preparation {#sec007}
-------------------------------------------------------
After the one-week experimental period, all rats were anesthetized using sodium pentobarbital (100mg/kg, ip injection). The SM muscles were rapidly dissected and trimmed free of excess fat and connective tissue. The muscles were weighed and then placed in cold relaxing solution (pCa = 9.0, pH = 7.0) containing 20mM imidazole, 7mM EGTA, 5.4mM MgCl~2~, 14.5mM creatine phosphate, 4.7mM ATP and CaCl~2~ to achieve pCa (-log\[Ca^2+^\]) 9.0 \[[@pone.0214982.ref016]\]. Because our previous investigation showed \~30% expression vector efficiency, which is a consistent result with previous research \[[@pone.0214982.ref017]\], we identified and isolated the infected fibers with a fluorescent microscope \[[@pone.0214982.ref012]\]. Subsequently, small fiber bundles (100--150 fibers per bundle) were prepared \[[@pone.0214982.ref012]\]. The bundles were placed in skinning solution containing 50% glycerol, 20mM imidazole (pH = 7.0), 125mM K-propionate, 2mM EGTA, 1mM MgCl~2~, 4mM ATP and stored at -20°C up to four weeks \[[@pone.0214982.ref015]\].
Determination of unloaded shortening velocity (Vo) {#sec008}
--------------------------------------------------
On the day of the experiment, the single fiber was isolated from a bundle in relaxing solution, and each end of the fiber was connected with aluminum T-clips (Kem-Mil, CA). The fiber (\~2mm long) was then transferred immediately to an experimental bath filled with relaxing solution (Permeabilized Fiber Apparatus Model 802B; Aurora Scientific, Aurora, Ontario, CAN) and mounted to a force transducer (400A; Aurora Scientific, CAN) and a high speed length controller (312C; Aurora Scientific, CAN) as described previously \[[@pone.0214982.ref012]\]. After confirming the fiber showed no damage the sarcomere length was adjusted at 2.4--2.5μm and fiber length (Lo) was determined. The fiber diameter was determined by measuring three different locations along the length of the fiber as previously described \[[@pone.0214982.ref012]\].
To determine the effect of HU and rAd-MLC3f injection on Vo, we utilized the Slack-test technique as previously described \[[@pone.0214982.ref012]\]. After the baseline force of a single muscle fiber was set to zero in relaxing solution, the fiber was then quickly moved to activating solution (pCa = 4.5, pH = 7.0; 20mM imidazole, 7mM EGTA, 5.4mM MgCl~2~, 14.5mM creatine phosphate, 4.7mM ATP and CaCl~2~ to achieve pCa (-log\[Ca^2+^\] 4.5) to induce force generation. Isometric maximal force (Po, μN) was measured at the point where the force output reached a maximum. The Slack test was initiated with the introduction of four to five slack distances between 10%-18% of Lo. When the fiber was slacked a specific distance the force generation dropped to zero initially and after a specific time interval force regeneration occurred. The time interval between the slack initiation and force regeneration was measured directly by custom software program (ASI Model 600A, Aurora Scientific, Ontario, CAN). The slope of the regression line (r^2^\>0.98) was reported as Vo (fiber length per second; FL^-1^) after being normalized to fiber length (FL). The collected data from the force transducer and high-speed length controller were analyzed with a custom software program (ASI Model 600A, Aurora Scientific, Ontario, CAN). All experiments were conducted at 15°C.
Determination of MHC and MLC compositions {#sec009}
-----------------------------------------
After the single muscle fiber physiology experiments were completed, the MHC and MLC compositions of each fiber were determined by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis (PAGE) and a custom silver staining method ([Fig 2](#pone.0214982.g002){ref-type="fig"}) \[[@pone.0214982.ref018]\]. Briefly, the fiber was solubilized in 50μl of 1% SDS sample buffer (24mM EDTA, 60mM Tris, 5% ß-mercaptoethanol, 2mg/ml bromophenol blue, 15% glycerol, 1% SDS; pH 6.8), and stored at -80°C. Subsequently, 10μl of each sample was loaded on gels consisting of a 4% acrylamide stacking gel and either a 5% separating gel for MHC or 12% separating gel for the MLC. The gels were washed, silver-stained, and scanned using molecular imaging system (GS-800; Bio-Rad, Hercules, CA). The reliability of our densitometry measurements (R^2^\>0.99) was confirmed by a protein concentration curve and test-retest measure as previously described \[[@pone.0214982.ref012]\]. In the current study we report data (force generation, Vo and MLC relative content) from single fibers expressing the MHC type IIB isoform only (identified on the 5% SDS-PAGE gels). The relative contents of two essential MLC1f and MLC3f isoforms, and one regulatory MLC2f isoform were determined from the densitometric analysis using Image J software program as previously described \[[@pone.0214982.ref010]\]. The ratios of MLC3f/MLC1f, MLC3f/MLC2f, and MLC3f/(MLC1f+MLC3f) were also calculated as a preferable index of the ratio between essential and regulatory light chains in MHC type IIB muscle fibers \[[@pone.0214982.ref010]\]. In this study we determined Vo and MHC isoform content in a total of 316 single skeletal fibers. 134 fibers of the total 316 fibers tested contained pure MHC type IIB isoform. The pure MHC type IIB fibers were further evaluated for MLC isoform expression.
{#pone.0214982.g002}
Statistical analysis {#sec010}
====================
One-way ANOVA was used to determine the mean differences in fiber size, force generation, MLC protein content and Vo among CON, HU, and HUM, followed by a Tukey's post-hoc test when appropriate. To examine the relationship between the %MLC3f protein content and Vo in MHC type IIB fibers we performed a simple linear regression analysis. SPSS software (Version 24.0) was used for statistical analysis and statistics were expressed as mean ± SEM with significance at p-value \< 0.05.
Results {#sec011}
=======
rAd-MLC3f injection under conditions of HU does not cause further decreases in force generation {#sec012}
-----------------------------------------------------------------------------------------------
[Table 1](#pone.0214982.t001){ref-type="table"} summarizes the contractile characteristics for single fiber diameter, force generating capacity, and specific force in MHC type IIB fibers. The force generating capacity (Po) and the force generating capacity normalized to CSA (Po/CSA) were significantly reduced in the single MHC type IIB fibers from the HU and HUM experimental rats compared to the control rats. The force generating capacity of the single fibers from the HU rats receiving the rAd-MLC3f injection was not significantly different from the individual fibers from the HU rats not receiving the rAd-MLC3f injection. Taken together, the data indicated that the rAd-MLC3f injection does not cause further damage.
10.1371/journal.pone.0214982.t001
###### Contractile characteristics of single MHC type IIB fibers.
{#pone.0214982.t001g}
Variables
---------- ------------------------------------------------- --------------------------------------------------- -------------------------------------------------
CON (57) 98.52±2.89 741.45±44.24 97.58±4.25
HU (44) 85.73±2.62[\*](#t001fn002){ref-type="table-fn"} 379.09±23.77[\*](#t001fn002){ref-type="table-fn"} 65.05±2.71[\*](#t001fn002){ref-type="table-fn"}
HUM (33) 80.94±2.52[\*](#t001fn002){ref-type="table-fn"} 443.27±38.73[\*](#t001fn002){ref-type="table-fn"} 77.75±4.31[\*](#t001fn002){ref-type="table-fn"}
Fiber diameter, maximal isometric force (Po), and specific tension (Po/CSA) of single MHC type IIB fibers from control (CON), HU for 7 days (HU), and HU for 7 days plus rAd-MLC3f injections (HUM). The number of fibers is presented in parentheses.
\* indicates a significant difference from CON group. Significance was set at P\<0.05 and values are expressed as mean ± SEM.
### The relative MLC3f protein content and Vo in MHC type IIB fibers are reduced following HU {#sec013}
[Table 2](#pone.0214982.t002){ref-type="table"} summarizes the effect of HU on the relative MLC isoforms protein content (MLC1f, MLC2f, MLC3f) and Vo in MHC type IIB fibers. With HU, a 29% reduction in Vo was found and the percent of MLC3f was significantly reduced by 25%. In contrast to the reduced relative content of MLC3f and MLC2f isoforms, the percent of MLC1f was significantly increased with HU by 20%. The ratios of MLC3f/MLC1f and MLC3f/(MLC1f + MLC3f) were determined to support changes in relative MLC isoform protein content. Indeed, the ratios were also significantly lower with HU, 47% (MLC3f/MLC1f, p = 0.004) and 34% \[MLC3f/(MLC1f + MLC3f), p\<0.001, [S1 Fig](#pone.0214982.s001){ref-type="supplementary-material"}\]. Collectively, the data indicated that one-week of HU significantly reduced the relative MLC3f protein content and Vo in MHC type IIB single fibers.
10.1371/journal.pone.0214982.t002
###### The relative myosin light chain (MLC) protein content and unloaded shortening velocity (Vo) of single MHC type IIB fibers from control (CON) and hindlimb unloading (HU) groups.
{#pone.0214982.t002g}
Variables
----- ----------------------------------------------------- ------------------------------------------------------ ------------------------------------------------------ -----------------------------------------------------
CON 3.22±0.14 (57) 36.39±1.48 (74) 51.61±1.42 (74) 12.00±0.60 (74)
HU 2.27±0.08[\*](#t002fn002){ref-type="table-fn"} (45) 43.75±1.38[\*](#t002fn002){ref-type="table-fn"} (44) 47.19±1.23[\*](#t002fn002){ref-type="table-fn"} (44) 9.06±0.66[\*](#t002fn002){ref-type="table-fn"} (44)
Vo was determined by the slack test and the relative MLC protein content of each fiber was determined by 12% SDS-PAGE. The number of fibers is presented in parentheses.
\* indicates a significant difference from CON group. Significance was set at P\<0.05 and values are expressed as mean ± SEM.
Increasing MLC3f content with rAd-MLC3f injection rescues HU-induced decline in Vo in MHC type IIB fibers {#sec014}
---------------------------------------------------------------------------------------------------------
In order to determine if increasing the relative MLC3f protein content results in a faster contraction speed in single fibers, we compared the relative MLC3f protein content and Vo of single MHC type IIB fibers from HU rats receiving the rAd-MLC3f injection (HUM) to HU rats without injection. [Fig 3A](#pone.0214982.g003){ref-type="fig"} shows a significant increase in MLC3f relative content in single MHC type IIB fibers in the HUM experimental group compared to the HU experimental group. Consistent with the increase in MLC3f relative content in single MHC type IIB fibers in the HUM experimental group Vo was significantly faster compared to the HU rats without injection ([Fig 3B](#pone.0214982.g003){ref-type="fig"}). In fact, the Vo in the HUM experimental group (2.90±0.15fl/s) was not significantly different than the Vo in the CON experimental group (3.22±0.14fl/s). Hence, the data indicate that the rAd-MLC3f injection (3.75 x 10^11^--5 x 10^11^ ifu/ml) at four-day after HU can effectively restore the HU-induced decline in Vo in MHC type IIB single fibers.
{#pone.0214982.g003}
The relationship between the relative MLC3f protein content and Vo is positive {#sec015}
------------------------------------------------------------------------------
[Fig 4A](#pone.0214982.g004){ref-type="fig"} plots the relative MLC3f content and Vo for single MHC type IIB fiber from Control, HU, and HUM (n = 134) experimental groups. A significant correlation between %MLC3f and Vo in MHC type IIB fibers (R = 0.377, p\<0.001) was present. [Fig 4B](#pone.0214982.g004){ref-type="fig"} represents a plot where the fibers were grouped based on %MLC3f (1% intervals, \~14 fibers each interval, 1--27%) and their respective mean Vo. A positive relationship between %MLC3f protein content and Vo in MHC type IIB fibers was observed (R = 0.875, p\<0.001).
{#pone.0214982.g004}
Discussion {#sec016}
==========
Because MLC3f has the potential to regulate shortening velocity in MHC type IIB fibers, we hypothesized that increasing the relative MLC3f protein content via rAd-MLC3f injection would attenuate HU-induced decline in Vo. The major findings of this study include that the relative MLC3f content and Vo in MHC type IIB fibers are significantly reduced following one-week of HU, the administration of the rAd-MLC3f significantly attenuates the HU-induced decline in MLC3f content and Vo in MHC type IIB fibers, and there is a positive relationship between percent of MLC3f content and Vo. Collectively, increased MLC3f protein content, via rAd-MLC3f, may provide a potential protection against HU-induced decline in Vo in MHC type IIB single muscle fibers.
Essential MLCs and Vo in MHC type IIB fibers {#sec017}
--------------------------------------------
The MHC isoform is the key player in regulating contractile velocity, with single fibers composed of MHC type IIB isoform contracting four times faster than single fibers composed of MHC type I isoform \[[@pone.0214982.ref002]\]. The contractile velocity of single fibers with MHC type IIB isoforms shows a large variability or continuum, with studies reporting 1.5 to 6.7fl/s, a 4.5 fold difference \[[@pone.0214982.ref002],[@pone.0214982.ref012]\]. This continuum of contractile velocities within MHC type IIB fibers is associated with the MLC isoform composition because the amino acid sequence between the essential MLCs isoforms, MLC1f and MLC3f are different \[[@pone.0214982.ref001],[@pone.0214982.ref006]\]. Indeed, the forty-five amino acid N-terminal extension of essential MLC1f causes an unfavorable interaction with the negatively charged C-terminus of actin, but this interaction is lessened in the essential MLC3f isoform that has a relatively shorter amino acid sequence \[[@pone.0214982.ref006]\]. At the cross-bridge the interactions between MLC1f and actin increase the lifetime of the attached state of the myosin heads, delay their dissociation, resulting in a slower contraction \[[@pone.0214982.ref006]\]. In contrast, the interactions between MLC3f isoform and actin reduce the actomyosin attachment/detachment rate. Therefore, fibers with more MLC3f isoform contract faster than the fibers with more MLC1f \[[@pone.0214982.ref001]\]. In contrast to the contractile property of speed, both the ATPase activity and the stretch-induced force transients (single fibers, actomyosin in solution) are not associated with the relative content of MLC3f and MLC1f isoforms \[[@pone.0214982.ref003],[@pone.0214982.ref019]--[@pone.0214982.ref021]\].
The relative MLC3f content and Vo decrease in MHC type IIB fibers with HU {#sec018}
-------------------------------------------------------------------------
Disuse or unloading is known to be associated with changes in muscle cellular function and properties. In MHC type I fibers from the soleus, there is significant atrophy and increases in contraction velocity \[[@pone.0214982.ref022]\]. The reported mechanism for the elevated speed is related to sarcomere structure, where the myosin/actin lattice spacing is altered, resulting in favorable cross-bridge kinetics \[[@pone.0214982.ref023]\]. Most likely the altered lattice spacing is due to preferential degradation of actin compared to myosin during the process of atrophy involved with non-weight bearing conditions \[[@pone.0214982.ref024]\]. In addition to the electron microscopy images revealing lattice spacing, alterations in the myosin:actin protein ratio following conditions of non-weight bearing provide further evidence for this preferential degradation \[[@pone.0214982.ref015],[@pone.0214982.ref025],[@pone.0214982.ref026]\]. An increase in MLC3f content may also contribute to the faster contraction speed in the MHC type I fibers from the soleus muscle \[[@pone.0214982.ref009]\].
In contrast to the MHC type I fibers, a decrease in contraction velocity in MHC type IIB fibers with non-weight bearing is observed. This reduction in velocity is reported in several models of non-weight bearing (e.g., bedrest, hindlimb unloading, spaceflight) and in several species (non-human primate, rat) \[[@pone.0214982.ref010],[@pone.0214982.ref011],[@pone.0214982.ref023],[@pone.0214982.ref027]\]. The decrease in velocity is present not only in single skeletal muscle fibers but also in the type IIB myosin motor (isolated myosin) and the sub-fragment, heavy meromyosin (HMM) \[[@pone.0214982.ref011]\]. The contractility characteristics of the type IIB myosin motor and HMM are investigated using the *in vitro* motility assay \[[@pone.0214982.ref011]\]. Maffei et al. \[[@pone.0214982.ref011]\] investigated three potential underlying mechanisms for the reduced velocity, MLC isoform composition, myosin oxidation, and MLC2 phosphorylation \[[@pone.0214982.ref010],[@pone.0214982.ref011]\]. The evidence from the HMM studies indicates myosin oxidation is not involved. The whole muscle evidence suggests a potential involvement of phosphorylation of MLC2. Although Maffei et al. \[[@pone.0214982.ref011]\] did not report any change in MLC1f and MLC3f at the whole muscle level, the relative content of the MLC1f and MLC3f within single fibers, type IIB myosin motor and the sub-fragment, HMM is not reported; hence, this underlying mechanism cannot be eliminated. Most likely, the detection of the MLCs within the single molecule is not possible with current technology.
One previous investigation reported alterations in MLC isoform expression levels at two, three, and four weeks of non-weight bearing and concomitant decreases in contractile velocity in MHC type IIB fibers of 26--38% were observed \[[@pone.0214982.ref010]\]. In fact, MLC3f protein content decreased and there was an increase of MLC1f isoform by 17% at two weeks of HU. There was a correlation between the relative content of MLC3f isoform and contraction speed. Interestingly, the velocity was not further reduced in the MHC type IIB single fibers with longer periods of non-weight bearing (3, 4 weeks). Consistent with the previous work, the current study shows the rapid decline in contraction speed at 1 week, a 29% reduction with the concomitant decrease in MLC3f (and an increase in MLC1f). Collectively, the data indicate the reduction in contractile speed occurs rapidly and in the early phases of non-weight bearing.
HU or non-weight bearing is associated with severe muscle atrophy, changes in protein turnover with increased protein degradation and decreased protein synthesis processes. Indeed, the process of muscle atrophy is complex, is initiated immediately upon removal of weight bearing, and the proteins within the myofibril disassemble in a selective manner \[[@pone.0214982.ref028]\]. Important to the current study and the observed changes in the relative contents of the two MLC isoforms (MLC1f and MLC3f), Cohen and colleagues \[[@pone.0214982.ref028]\] demonstrate that the essential MLCs are degraded in the early phase of atrophy process by MuRF1-dependant ubiquitination and these ubiquitinated proteins disturb muscle contractile structure and function (e.g., 3 days of denervation). In fact, this research team suggests that the loss of MLCs (both essential and regulatory) and the MyBP-C (myosin binding protein C) during the initial steps of thick filament disassembly (e.g., early phase) may enhance the susceptibility of other myofibrillar components to degradation.
The work of Kirschbaum and colleagues \[[@pone.0214982.ref029]\] further demonstrate a coordination of MLC1f and MLC3f degradation in a chronic stimulation model, whereby MLC3f is more rapidly degraded compared to MLC1f. To support the enhanced degradation processes, key components of the proteasome, calpain, and cathepsin pathways are upregulated (mRNA and protein) whereas the key components of the synthesis pathways are downregulated with varied models of muscle atrophy. Collectively, selective degradation of MLC3f contributes to the altered relative content of the MLC isoforms.
Strategies to attenuate declines in contractile velocity {#sec019}
--------------------------------------------------------
One strategy to attenuate the HU-induced decline in contractile speed in MHC type IIB fibers is to increase the MLC3f content via rAd-MLC3f. This strategy has been successful in an aging model where there is a slowing of contraction in MHC type II fibers \[[@pone.0214982.ref012]\]. Specifically, this investigation not only revealed a correlation between speed and the essential MLC isoform content in single MHC type IIB fibers but demonstrated an age-related reduction in contraction speed and expression levels of MLC3f \[[@pone.0214982.ref012]\]. Because the rAd-MLC3f transduction in the SM muscle was successful in rescuing age-related slowing of contraction without increasing cellular inflammation and contractile protein damage, we hypothesized it would be possible to use this strategy to attenuate the HU-induced decline.
The primary goal of the current study was to restore the HU-induced slowing of muscle contraction by increasing the relative content of MLC3f. Indeed, an overall increase in relative MLC3f content in MHC type IIB fibers was observed after rAd-MLC3f injection. The increased content to 12.26% from 9.06% via rAd-MLC3f gene transfer to SM muscle significantly offset HU-induced decline in Vo from 2.27fl/s to 2.90fl/s. This finding further substantiates the important role of the MLCs in modulating contraction speed.
Although the essential lights chains (MLC1f and MLC3f) are not required for contraction speed \[[@pone.0214982.ref030]\], when present there is a linear relationship between MLC isoform content and contraction speed using various technologies \[[@pone.0214982.ref002],[@pone.0214982.ref005],[@pone.0214982.ref012]\]. Notably, a small change in the MLC isoform content in single fiber preparations has a significant impact. For instance, a strong linear correlation coefficient between velocity and relative amount of MLC3 (R = 0.858, p\<0.001) is reported \[[@pone.0214982.ref005]\]. In the current study, a similar linear relationship (R = 0.875, p\<0.001) is observed when all the individual fibers are analyzed together from the three experimental groups, with the impact of increasing MLC3f content from 0% to 20% results in a 72% increase in speed (velocity from 2.02fl/s to 3.48fl/s). Taken together, this provides a molecular mechanism for the physiological deterioration in velocity in type IIB fibers following non-weight bearing and the benefits of rAd-MLC3f to restore function.
One caveat is noted. In [Fig 4](#pone.0214982.g004){ref-type="fig"} (panels A and B) we demonstrate a significant relationship between %MLC3f and Vo when we analyzed all the single MHC type IIB fibers from the three experimental groups (CON, HU, HUM). However, if we analyze the relationship between %MLC3f and Vo in the MHC type IIB fibers from the hindlimb unloaded rats separately (the HU experimental group only), the linear relationship is not present (R = 0.066, p = 0.669, solid square symbols). The underlying mechanisms responsible for this loss are unknown. Potential mechanisms include protein damage or changes in the phosphorylation state of the regulatory light chains \[[@pone.0214982.ref011],[@pone.0214982.ref031],[@pone.0214982.ref032]\], both associated with the muscle degradation processes \[[@pone.0214982.ref011]\]. Therefore, further studies are required to elucidate exact roles of protein degradation, post-translational modification, and the regulatory proteins (particularly, MLC2f phosphorylation) on muscle activation kinetics in single muscle fibers.
In summary, HU results in a decrease in Vo in MHC type IIB fibers and the decrease in Vo is in part due to a decrease in the relative MLC3f content and an increase in the relative MLC1f content. Our data provide the evidence that HU-induced reduction in contraction speed may be attenuated by the gene delivery of MLC3f, which may eventually delay the rapid physical decline and limited quality of life.
Supporting information {#sec020}
======================
######
**Percent of MLC3f/MLC1f (A), MLC3f/MLC2f (B), and MLC3f/(MLC1f+MLC3f) (C) in single MHC type IIB fibers from SM muscles following HU (7days) and a 2.50 x 10**^**11**^ **ifu/ml rAd-MLC3f injection.** Experimental groups include: CON, (n = 74); HU, (n = 44); HUM-1D, the rAd-MLC3f injection was administered one-day before the initiation of HU (eight-day before sacrifice) (n = 14); HUM+2D, the rAd-MLC3f injection was administered two-days after the initiation of HU (five-days before sacrifice) (n = 14); HUM+4D, the rAd-MLC3f injection was administered four-days after the initiation of HU (three-days before sacrifice) (n = 10). \* indicates a significant difference with CON group. Significance was set at P\<0.05 and values are expressed as mean ± SEM. Panel A, B, and C indicate the percent of MLC3f/MLC1f, MLC3f/MLC2f, and MLC3f/(MLC1f+MLC3f), respectively.
(TIF)
######
Click here for additional data file.
######
**Percent of MLC3f/MLC1f (A), MLC3f/MLC2f (B), and MLC3f/(MLC1f+MLC3f) (C) in single MHC type IIB fibers from SM muscles following HU (7days) and a 3.75 x 10**^**11**^ **ifu/ml rAd-MLC3f injection.** Experimental groups include: CON, (n = 74); HU, (n = 44); HUM-1D, the rAd-MLC3f injection was administered one-day before the initiation of HU (eight-day before sacrifice) (n = 16); HUM+2D, the rAd-MLC3f injection was administered two-days after the initiation of HU (five-days before sacrifice) (n = 19); HUM+4D, the rAd-MLC3f injection was administered four-days after the initiation of HU (three-days before sacrifice) (n = 18). \* indicates a significant difference with CON group. † indicates a significant difference from HU group. Significance was set at P\<0.05 and values are expressed as mean ± SEM. Panel A, B, and C indicate the percent of MLC3f/MLC1f, MLC3f/MLC2f, and MLC3f/(MLC1f+MLC3f), respectively.
(TIF)
######
Click here for additional data file.
######
**Percent of MLC3f/MLC1f (A), MLC3f/MLC2f (B), and MLC3f/(MLC1f+MLC3f) (C) in single MHC type IIB fibers from SM muscles following HU (7days) and a 5 x 10**^**11**^ **ifu/ml rAd-MLC3f injection.** Experimental groups include: CON, (n = 74); HU, (n = 44); HUM-1D, the rAd-MLC3f injection was administered one-day before the initiation of HU (eight-day before sacrifice) (n = 10); HUM+2D, the rAd-MLC3f injection was administered two-days after the initiation of HU (five-days before sacrifice) (n = 11); HUM+4D, the rAd-MLC3f injection was administered four-days after the initiation of HU (three-days before sacrifice) (n = 15). \* indicates a significant difference with CON group. † indicates a significant difference from HU group. Significance was set at P\<0.05 and values are expressed as mean ± SEM. Panel A, B, and C indicate the percent of MLC3f/MLC1f, MLC3f/MLC2f, and MLC3f/(MLC1f+MLC3f), respectively.
(TIF)
######
Click here for additional data file.
The authors would like to thank Windy Torgerud and Shuichi Watanabe for expert technical assistance.
[^1]: **Competing Interests:**The authors have declared that no competing interests exist.
| null | minipile | NaturalLanguage | mit | null |
Tag Archives: compound interest
如有雷同纯属巧合 The consequences could be dire. As joss sticks smoke filled the table during the sexy maths tutor’s romantic Valentine dinner, dense smoke of another kind choked the stale air of the loan shark‘s office, as the love-struck Ah Beng faced up to his boss, surrounded by a dozen or so henchmen whose Marlboro Reds […]
Miss Loi loves this kind of real-life question. Other than it having an equal chance of appearing in either Paper 1 or 2, it is more likely to help you later in life compared to those very important sure-to-come-out questions on trigonometry or quadratic equations. So the story goes: Mr Tan is a recent retiree […]
About Miss Loi
Miss Loi is a full-time private tutor in Singapore specializing in O-Level Maths tuition. Her life's calling is to eradicate the terrifying LMBFH Syndrome off the face of this planet. For over 27 years she has been a savior to countless students ... [read more] | null | minipile | NaturalLanguage | mit | null |
Harim Group’s vision is to have a building that expresses their desire for sustainability and the care they demonstrate for their employees and citizens. The company wants to provide interconnected green spaces throughout the building that will be open to the public as well as give employees easy access to the gardens during office hours.
ⓒ Sunghoon Yum
It is also a desire to have open and comfortable day lit office space and with much care being given to the solar control on the building exteriors. The solution provides for a 16,130㎡ design that has two L shaped interlocking forms that help to create a variety of outdoor green space and plazas between the two forms.
MAIN ENTRY VIEW / FIN DETAIL VIEW ⓒ Sunghoon Yum
The entire facade of building is designed with specific percentages of alternating glass and insulated wall to allow maximum natural light on the desirable south side of the building and protect the northern facades from exposure to the cold. East and west facades contain vertical fins that block glare from the east and west sun.
COURTYARD VIEW ⓒ Sunghoon Yum
Spaces include an upscale employee dining area with two story waterfall and views to the garden and city, veterinary hospital, pharmaceutical lab, conference rooms, open office spaces, underground parking garage, and 45,300 SF of underground storage. | null | minipile | NaturalLanguage | mit | null |
FIVE MINUTES: South Africa
Platinum miner Lonmin has returned to an annual profit after losses resulting from fatal strikes in 2012 and says it hopes wage talks, though "tough", would avoid disruption this year. Lonmin, the world's third-largest primary platinum producer, said its production, sales of platinum and efforts to contain cost increases exceeded its own targets, helping pre-tax profit beat analysts' forecasts. The London-listed company forecast sales would increase almost 8% or more next year, with cost inflation - a major problem for platinum miners struggling with lacklustre prices - kept below increases in South African wages. Lonmin's newly appointed chief executive, Zimbabwean former Anglo American executive Ben Magara, declined to comment on the details of wage talks, but said he believed strikes could be prevented.
MADONSELA: SECURITY CLUSTER REQUEST UNLAWFUL, UNCONSTITUTIONAL Public protector Thuli Madonsela says giving the security cluster more time to study her provisional report into state spending on President Jacob Zuma’s private home in Nkandla “would be an injustice on the affected and implicated parties”. In a statement responding to criticism by the ministers concerned, Madonsela said it would not be in the public interest if the security cluster had exclusive possession of the report. “These concerns were expressed to the Minister, who offered no solutions to them,” Madonsela said. The public protector said she would “clarify in detail in court papers” why she believes the security cluster’s request is “unlawful, unconstitutional and violates the independence of her office”.
ANC INVOKES FIRES OF HELL AND GHOSTS OF APARTHEID – AND PRESS OMBUD
The Democratic Alliance says the ANC under President Jacob Zuma is resorting more and more to “to tired racial insinuations and the supernatural to convince supporters to stick with them”. DA Gauteng premier candidate, Mmusi Maimane, was responding to reports that ANC deputy president Cyril Ramaphosa told voters to vote ANC or see the return of the “boers”. “First it was the fires of hell. Now it is the ghosts of the apartheid regime that are being invoked to scare voters into staying with a party that deserted them a long time ago,” Maimane said. The ANC said it had reported City Press, who reported the Ramaphosa story, to the press ombudsman, as the story was a “fabrication” of “sensationalist concoctions and lies
PUT SOUTH AFRICAN FARMERS, COMMUNITIES FIRST
President Jacob Zuma’s promise to give Namibia a R100 million package to relieve the effects of a drought, while commendable, should not come before helping farming communities in South Africa, the DA says. Agriculture spokesman Annette Steyn said farmers and communities in South Africa had been waiting for years for drought and flood relief. Steyn said agriculture minister Tina Joemat-Pettersson should “prioritise drought relief stricken areas with the same sense of immediacy ANC secretary Gwede Mantashe received earlier this year after a fire broke out in areas surrounding his farm”. Steyn said the Langkloof community has been waiting since 2006 for assistance while others in the North West, Mpumalanga and Limpopo are also still waiting for relief after floods that occurred between December 2010 and February 2011.
DAVIES URGES SA TO STOP BUYING PIRATED GOODS
Piracy perpetuates poverty, says trade and industry minister, Rob Davies. He said the South African Revenue Service conducted over 25 000 seizures and confiscated illegal goods valued at R2.6 billion over the past year and that South Africa had become a “top dumping destination” due to demand created by local consumers. Davies said customs operation made around 26 busts a day at ports of entry across the country. They netted illicit cigarettes worth R37.8 million, counterfeit clothing worth R155 million and counterfeit CDs and DVDs worth R671 million. But, said Davies, “the success of our enforcement agencies is undermined by the continued demand for illegal products by consumers”. He said it was important to unite behind efforts to fight piracy and illegal imports in order to prevent job losses, stimulate job creation and ultimately fuel economic growth.
MUGABE CALLS HALT ON EXPORTING RAW PLATINUM TO SA
Zimbabwe may halt exports of raw platinum to South Africa to force mining companies to build a refinery in the country as a two-year deadline has expired, state media quoted President Robert Mugabe as saying. The threat, if carried out, could affect the world's two largest platinum producers, Anglo American Platinum and Impala Platinum Holdings, both of which have operations in Zimbabwe. The country has the world's second largest known platinum reserves but mining companies send the raw product to South Africa for processing. "Let us close our doors immediately and say no raw platinum will go to South Africa. The former minister gave them two years and we must see them now arranging to build a refinery," the state-run Herald newspaper quoted Mugabe as saying.
FARMWORKERS ARRESTED FOR PUBLIC VIOLENCE AFTER BURNING TRUCK
Western Cape police have arrested 12 people on charges of public violence and malicious damage to property after farmworkers set a truck alight in Wellington, Sapa reported. Captain Frederick van Wyk said about 120 workers at Sandrivier estate prevented other workers from entering the premises and burned the vehicle and a piece of field on the farm. Van Wyk said police were deployed to prevent more damage and the workers were escorted to an open field. Portia Adams, spokeswoman for Agri Wes-Cape, said the culprits were seasonal workers who took part in an unprotected strike on farms belonging to the JC Le Roux group.
NO BAIL FOR EAST RAND DOG FIGHTING RING
A magistrate at the Tsakane Magistrate's Court has denied bail to 13 people accused of being involved in illegal dog fighting on the East Rand. “The National Society for the Prevention of Cruelty to Animals (NSPCA) applauds the decision,” senior inspector Jaco Pieterse told Sapa. Eighteen people were originally arrested during the raid in Tsakane where 14 pit bulls were rescued. “We are saddened that eight of the remaining dogs removed during the NSPCA dog fighting bust last week Sunday had to be euthanised by a veterinarian due to the seriousness and extent of their injuries and suffering,” said Pieters. DM
Reader notice: Our comments service provider, Civil Comments, has stopped operating and will terminate services on 20th Dec 2017. As a result, we will be searching for another platform for our readers. We aim to have this done with the launch of our new site in early 2018 and apologise for the inconvenience. | null | minipile | NaturalLanguage | mit | null |
Q:
Could not find a part of the path in c#
I am trying to build a method which is able to write in a file the number of files in another folder. I already got it but it does not work because gives me an error:
Could not find a part of the path '
C:\Users\Administrator\Desktop...\bin\release\%USERPROFILE%\AppData\Local_logC'
This is my code:
private static int GetCountGFiles(string dirname)
{
int fileCount = 0;
dirname = dirname.TrimEnd(new char[] { '\\' }) + @"\";
var fixedDirname = Environment.ExpandEnvironmentVariables(dirname);
fileCount += System.IO.Directory.GetFiles(fixedDirname).Length;
string[] all_subdirs = System.IO.Directory.GetDirectories(dirname);
foreach (string dir in all_subdirs)
fileCount += GetCountGFiles(dirname);
string data = string.Format("LogReg.txt");
System.IO.Directory.CreateDirectory(filePath);
var fileandpath = filePath + data;
using (StreamWriter writer = File.AppendText(fileandpath))
{
writer.WriteLine("[" + DateTime.Now + "]" + " - " + "Nº de Records: (" + fileCount.ToString() + ")");
}
return fileCount;
}
And then I call the method like this :
GetCountGFiles(@"%USERPROFILE%\AppData\Local\Cargas - Amostras\_logsC\");
What should I do?
A:
Methods like Directory.GetFiles and Directory.GetDirectories will not automatically figure out what the environment variables that you pass to it are. You need to do that manually with Environment.ExpandEnvironmentVariables. For example:
var fixedDirname = Environment.ExpandEnvironmentVariables(dirname);
Now you can do this:
fileCount += System.IO.Directory.GetFiles(fixedDirname).Length;
(PS No need to use ToString() on a string)
| null | minipile | NaturalLanguage | mit | null |
“And the reason he took his daughter’s life, by his own words was that she wasn’t being true to her religion or to her husband”
“Begner hopes the state doesn’t make this about Islam or ethnicity. This death could have happened, he says, in any culture, with any family.”
Why does the mainstream media believe it necessary always to exonerate Islam from any responsibility for violence committed by Muslims in the name of Islam? Who decided that this must be done, and on what grounds, and why do they all fall into lockstep without question?
NPR and the others are only enabling the murders of more women like Sandeela Kanwal. Why? Murders happen anywhere, among all groups, but this is not just a murder, it is an honor killing, and it simply isn’t true that “this death could have happened…in any culture, with any family.” If that were true, then where are the Christian honor killings, as one of the NPR commenters on this article said: “It would be the same part of the story is a christian said God told him to kill his daughter”? All right, put up or shut up: where are those Christians whom God is telling to kill their daughters?
Where is the Christian sect that teaches that while “retaliation is obligatory against anyone who kills a human being purely intentionally and without right,” yet “not subject to retaliation” is “a father or mother (or their fathers or mothers) for killing their offspring, or offspring’s offspring”? In other words, a father who kills his daughter incurs no penalty. What Christian sect teaches that? The quotes are from a manual of Islamic law certified by the foremost institution in Sunni Islam, Al-Azhar in Cairo, as a reliable guide to Sunni orthodoxy: ‘Umdat al-Salik (o1.1-2).
When NPR retails nonsense of this kind, it only deflects attention from where it ought to be focused: upon Muslim communities in the West. Instead of exonerating Islam, NPR and the rest of the mainstream media ought to be calling upon Muslim leaders in America to acknowledge the widespread acceptance among Muslims of honor killing as Islamically correct, and calling upon them to begin to teach against it.
If they don’t do this, there are certain to be more honor killings in the United States.
Yet it is unthinkable that NPR would start calling upon Muslim leaders not only to denounce honor killing, but to institute comprehensive, honest, transparent, inspectable programs in mosques and Islamic schools in America that teach against it and call it the crime that it is. And that in itself is a crime atop another crime.
An update on this story. “Man Accused Of Killing Daughter For Family Honor,” by Jamie Tarabay for NPR, January 26 (thanks to Davida):
Morning Edition, January 26, 2009 · Police in Atlanta have been investigating the death of a 25-year-old Pakistani woman, who was allegedly murdered by her father in the name of family honor.
She wanted out of an arranged marriage, but her father thought a divorce would bring shame to the family.
Honor killings are old rites of murder within families, committed because of some perceived dishonor or shame. The United Nations estimates around 5,000 deaths occur each year “” mostly women, mostly in South Asia and the Middle East. […]
It was around 1 a.m. on July 6 when police got several 911 calls connected to that house. The first was from a man who told police, “My daughter’s dead.” Then, at 1:55 a.m., Clayton County received a 911 call from a woman named Gina Rashid who was worried about her stepdaughter Sandeela.
‘My Daughter’s Dead’
“I hear a lot of hollering and screaming,” Rashid says, “and I just woke up and I asked my family what’s going on. They’re from Pakistan. They’re not speaking any English to me. They’re not telling me nothing. Sandeela’s dead. Sandeela’s dead.”
Sandeela Kanwal was the 25-year-old daughter of Chaudry Rashid. Christian says when police arrived at the house, they found the 57-year-old pizza shop owner sitting cross-legged in his driveway, smoking a cigarette.
“They talked to him and asked him what was going on,” says Christian, “and he said, ‘My daughter’s dead.’ They asked him again what he’d said and he said, ‘My daughter’s dead.'”
Police found Kanwal dead on the floor of her bedroom, still in her Wal-Mart uniform. She’d been working the late shift that night. As they surveyed the scene, police tried to piece together what had happened. Rashid was taken into custody and questioned.
“He admitted to actually taking the life of his daughter,” says Sgt. Stefan Schindler, a 13-year veteran of the Clayton County Police Department.
“And the reason he took his daughter’s life,” says Schindler, “by his own words was that she wasn’t being true to her religion or to her husband.”
Note that NPR doesn’t say at this point exactly which religion she allegedly wasn’t being true to, but they can’t help getting to it eventually.
A Killing To Avoid Shame Of Divorce?
Police believe Rashid killed his daughter because she wanted a divorce and he felt that it would bring shame on his family. Schindler says Rashid told him killing his daughter was a right given to him by God, and that God would protect him. To police, in other words, this was an honor killing.
“Since my career begun here at Clayton County Police Department, I’ve never encountered anything like this,” says Schindler. “This was the first time.” […]
Rashid remains in jail after he was refused bail. He’s charged with murder and other felonies including assault.
“Here in Georgia, this is going to make me sound like a backwoods cracker, but we don’t have many Muslims,” says Begner. “Not too much diversity down here, at least that I’m aware of.”
It sent a ripple through this swath of Bible-belt country.
“For me, and my upbringing, nothing in your life prepares you for that,” he says.
‘This Is American Law’
If it is an honor killing “” and what really happened that night is not yet clear “” it would be one of a handful of such crimes in this country.
In Dallas, an Egyptian man is wanted by police, accused of murdering his two daughters, reportedly, because they had non-Muslim boyfriends.
In Scottsville, N.Y., a Turkish immigrant has been in and out of psychiatric care since he was charged three years ago with killing his wife and beating his daughters because of alleged sexual assault.
Cue the obligatory mainstream media exoneration of Islam section:
In some honor killings overseas, family members have killed women who’ve been raped because they’re considered to have brought shame on their families. For Muslims in Atlanta, the attention was the last thing they needed.
Shahid Malik is a local representative of Atlanta’s Pakistani population and one of the very few willing to speak about the Rashid case.
“This thing hurt the Muslim community, Pakistani community,” he says.
He says the killing has nothing to do with Islam, but that Rashid has little education and comes from a small village in Pakistan where tribal traditions are strong.
“I think in their mind, use the name honor killing, they give less punishment,” he says. “But that is wrong because law is changed. This is American law.”
Malik says years ago, Pakistan used to punish honor killings with only seven years’ imprisonment. Now, he says, the sentence is greater. But he says Kanwal’s murder doesn’t fit in that category of crimes.
“Whatever this case is or not, this is not an honor killing,” he says. “It is not based on Pakistani law. Chaudry Rashid loved his daughter.”
He just loved her to death, as they might say in Atlanta.
Begner hopes the state doesn’t make this about Islam or ethnicity. This death could have happened, he says, in any culture, with any family….
Robert Spencer FaceBook Page
Robert Spencer Twitter
Robert Spencer YouTube Channel
Robert Spencer’s Free Speech Book
Jihad Watch® is a registered trademark of Robert Spencer in the United States and/or other countries - Site Developed and Managed by Free Speech Defense
Content copyright Jihad Watch, Jihad Watch claims no credit for any images posted on this site unless otherwise noted. Images on this blog are copyright to their respective owners. If there is an image appearing on this blog that belongs to you and you do not wish for it appear on this site, please E-mail with a link to said image and it will be promptly removed. | null | minipile | NaturalLanguage | mit | null |
Subsets and Splits