Split (1)

train · 474k rows

id stringlengths 36 40	text stringlengths 50 3.89M	source stringclasses 1 value	added stringdate 2025-04-07 03:56:57 2025-04-07 04:04:00	created stringlengths 0 16	metadata dict
00a6a373-fd58-400b-bd1a-e87d014d5110.16	4. Discussion Diabetic retinopathy causes both neural and vascular defects, with neural deficits preceding vascular changes [6,39–42]. Even before the onset of clinically detectable retinopathy, diabetic patients have a reduced ERG implicit time [43] and high-frequency flicker amplitude [44]. Later, they experience decreased vascular density [45]. In this study, we have shown that HFD feeding results in a suitable model of prediabetes, with the HFD cohort exhibiting insulin resistance and hypercholesterolemia without hyperglycemia. The retinopathy that is exhibited occurs over a slower time course than in T2D models, where both hyperglycemia and hyperinsulinemia exist. The HFD mouse has previously been described as a model for T2D [7,46], as C57BL/6J mice fed HFD develop obesity and insulin resistance [47,48], but as we show in this study, this model has a distinct timeline and different characteristics than those seen in T2D. We show that HFD mice have hypercholesterolemia and insulin resistance but the absence of hyperglycemia, which is typical of T2D models. In agreemen<sup>t</sup> with the literature, our study shows that mice fed a HFD have a sustained increase in body weight [6,49,50]. As confirmed by EchoMRI, the increase in body weight is primarily due to elevated body fat mass. After 12 weeks of feeding, HFD mice showed a two-fold increase in body fat mass over control LFD mice. Despite the marked increase in fat mass, HFD mice did not develop overt hyperglycemia. Glycated hemoglobin levels measured at 6 months and 12 months showed that both groups had normal glycated hemoglobin, thus indicating a key difference between the HFD model and other T2D rodent models, many of which are genetic. However, HFD mice develop hyperinsulinemia (Figure 1E,F), and their insulin production is sufficient to maintain euglycemia, as indicated by their glycated hemoglobin levels. The marked hyperinsulinemia we observed is supported by the literature [6,51–54]. In contrast, T2D in humans is characterized by not only insulin resistance but also the presence of sustained hyperglycemia and elevated HbA1c levels. When only insulin resistance is present, individuals are described as prediabetics [55,56]. Insulin resistance is believed to play a key role in diabetic neuropathy by increasing oxidative stress and mitochondrial dysfunction [57,58], and may also drive the early neural retinal dysfunction that we observed in our HFD mice. Thus, the HFD mice secrete sufficiently elevated insulin to maintain a normal glucose level, and as such the HFD model may be better characterized as a prediabetes model. Importantly, the incidence of prediabetes is often higher than that of diabetes [59]. The prevalence of prediabetes is also increasing; it is estimated that more than 470 million people worldwide will be suffering from prediabetes by 2030 [60]. Most importantly, the three classical microvascular complications, retinopathy, neuropathy, and nephropathy, have all been documented in individuals with prediabetes [61]. While classifications of diabetes remain "glucose-centric", our study draws attention to the importance of earlier events, when glucose levels are still normal. Thus, in our model, hyperinsulinemia with hypercholesterolemia will likely lead to the retinal pathology observed. Not surprisingly, these pathologies take a longer time to develop than those typically seen when hyperglycemia is also present. Systemic and retinal lipid abnormalities have been shown to promote retinal damage [16,62,63]. Previously, we demonstrated that diabetes-induced disruption of the LXR axis results in abnormal lipid metabolism, inadequate vascular repair, and localized and systemic inflammation [16,64]. The LXRs (LXR α and LXRβ) play important roles in cholesterol homeostasis [65]. They regulate the expression of reverse cholesterol transporters [12]. Activation of LXRs using pharmacological agents repress inflammatory genes such as TNFα and IL-1β [66], inhibit the expression of pro-apoptotic factors [67], and prevent the development of DR [12]. We showed that use of GW3965, an LXR agonist, resulted in normalization of cholesterol homeostasis and repression of inflammatory genes, such as iNOS, IL-1β, ICAM-1, and CCL2 in the retina [16]. We found that inadequate cholesterol removal due to deficiency in LXR and reduced oxysterol production in the retina due to loss of cytochromes p450 27A1 and 46A1 resulted in widespread retinal pathology [68]. In the current study, we showed that concentrations of 40% fat in the diet were su fficient to reduce expression of LXR in the inner and outer nuclear layers. Our study showed that HFD mice develop neural retinal deficits after 6 months of feeding, as both a-waves and b- waves were reduced under scotopic conditions. Unexpectedly, the a- and b- wave responses for LFD mice was significantly less after 12 months compared to the response after 6 months of feeding (p < 0.01 for both scotopic and photopic conditions), which suggests that the LFD may have detrimental e ffects on the neural retina. Because the composition of the diets must be isocaloric, when the amount of fat is reduced, some other dietary component needs to be increased to compensate. Inn the LFD, the amount of sucrose increases from 72 g to 354 g and 315 g of corn starch is also added so that the LFD can be isocaloric with the HFD. However, this largely occurs at the expense of making the diet high in carbohydrates. The literature supports that LFD may be detrimental [69–71]. While we were unable to find literature supporting the impact of LFD specifically on ERGs, the systemic consequences of LFD may indirectly a ffect the retina, for example by reduced availability of fat-soluble vitamins or changing retinal cholesterol metabolism. Moreover, the increased sucrose and cornstarch in the LFD may have direct deleterious e ffects [72,73]. LFDs promote insulin resistance, and while most of the research has been performed in humans, these findings may have relevance to murine studies. LFD, typically considered a high carbohydrate diet, is known to promote inflammation [74–76]. A recent study compared ERGs in HFD fed rats, Streptozotocin (STZ) rats and type 2 diabetes (T2D) rats at 6 months to controls. Kowluru found di fferences between the diabetic ERGs and controls, but no di fferences between the ERGs of the HFD rats compared to controls; however, Kowluru did not look at 12 month tests and the study was performed in rats, not in mice [77]. Thus, it is di fficult to compare these findings with our results. While neural damage was detected at 6 months, the vascular damage was not observed until much later. This is in agreemen<sup>t</sup> with Rajagopal et al. [6], who demonstrated that vascular damage was not observed at 6 months of HFD feeding. However, despite the absence of vascular damage after 6 months of HFD, we observed the presence of "lipid-laden like" lesions, and also neural infarcts similar to what is described in humans as "cotton-wool" spots. These lesions, which appeared to increase as the retinopathy progressed in the HFD mice, could become a useful measure of retinal damage and may be sensitive enough to use as a novel endpoint for the preclinical investigation of therapeutic agents. GFAP is normally expressed in retinal astrocytes in rodents; however, during stress and inflammation, Muller cells [37] respond by increasing GFAP expression. In this study, we show that WD induces GFAP expression in selective Muller cells, supporting the presence of increased stress and inflammation in the retina of these mice. Kim et al. have reported increased inflammation in other tissues such as adipose tissue and intestines [78]. Lee et al. showed increased numbers of activated macrophages in the retina of HFD mice [79]. In both humans and rodents, obesity-induced diabetes is associated with hypoxia in tissues such adipose tissue, and suppression of HIF-1 α mitigates tissue-specific pathological changes associated with HFD [80]. The liver, brain, kidney, and heart display tissue-specific regulation of HIF-1 α under systemic hypoxia [81]. After 6 months, but not after 3 months, we observed that HIF-1 α expression is increased in the WD retinas compared to LFD controls. Similar to our observation in the retina of 3-month-old mice on WD, Prasad et al. showed the absence of pimonidazole staining in the kidneys of 10–11-week old db/db mice [82], also indicating the absence of hypoxia response in the kidneys at this time point.	doab	2025-04-07T03:56:59.504372	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 16 }
00a6a373-fd58-400b-bd1a-e87d014d5110.17	5. Conclusions Our study demonstrates that HFD feeding generates a useful prediabetes model. Specifically, the combination of hypercholesterolemia and insulin resistance are su fficient to induce retinal dysfunction with a slower time course of development compared to T2D models such as the db/db mouse. In agreemen<sup>t</sup> with reports describing diabetes models, we show that neural functional deficits are the earliest indicator of damage in the retina of this prediabetes model before vascular changes. Key molecular targets such as HIF-1 α and the LXRs provide insights into the retinal pathobiology observed in this hypercholesterolemic, hyperinsulinemic model. The appearance and frequency of neural infarcts or "lipid-laden lesions" in the retina of HFD mice could represent a novel endpoint for evaluation of therapeutic interventions. Supplementary Materials: The following are available online at http://www.mdpi.com/2073-4409/9/2/464/s1, Table S1: Detailed Composition of high-fat diet (HFD), Western diet (WD), and low-fat diet (LFD). Author Contributions: Conceptualization, M.L., P.R.N., and M.B.G.; data curation, B.A.-B. and S.K.N.; formal analysis, B.A.-B., S.K.N., B.A.J., and M.B.G.; funding acquisition, M.B.G.; investigation, B.A.-B., S.K.N., S.L.C., B.A., C.P.V., Y.A.-A., M.D., B.A.J., X.X.W., D.C., and M.B.G.; methodology, B.A.-B., S.K.N., P.R.N., and M.B.G.; project administration, P.R.N. and M.B.G.; resources, M.L., P.R.N., and M.B.G.; supervision, M.L. and P.R.N.; validation, B.A.-B. and S.L.C.; visualization, B.A.-B.; writing—original draft, B.A.-B., S.K.N., P.R.N., and M.B.G.; writing—review and editing, B.A.-B., S.K.N., S.L.C., B.A., C.P.V., Y.A.-A., B.A.J., M.L., P.R.N., and M.B.G. All authors have read and agreed to the published version of the manuscript. Funding: M.G is supported by NIH funding (EY012601, EY028037, and EY028858). P.R.N is supported by NIH funding (HL122505, HL137799); M.L is supported by NIH funding (DK116567). BAJ is supported by the National Center for Advancing Translational Sciences of the NIH under award number TL1TR001431. Conflicts of Interest: The authors declare no conflict of interest.	doab	2025-04-07T03:56:59.504870	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 17 }
00a6a373-fd58-400b-bd1a-e87d014d5110.19	Lack of Overt Retinal Degeneration in a K42E Dhdds Knock-In Mouse Model of RP59 ### Sriganesh Ramachandra Rao 1,2,†, Steven J. Fliesler 1,2,†, Pravallika Kotla 3, Mai N. Nguyen 3 and Steven J. Pittler 3,\* Received: 17 February 2020; Accepted: 4 April 2020; Published: 7 April 2020 Abstract: Dehydrodolichyl diphosphate synthase (DHDDS) is required for protein <sup>N</sup>-glycosylation in eukaryotic cells. A K42E point mutation in the DHDDS gene causes an autosomal recessive form of retinitis pigmentosa (RP59), which has been classified as a congenital disease of glycosylation (CDG). We generated K42E Dhdds knock-in mice as a potential model for RP59. Mice heterozygous for the Dhdds K42E mutation were generated using CRISPR/Cas9 technology and crossed to generate DhddsK42E/K42E homozygous mice. Spectral domain-optical coherence tomography (SD-OCT) was performed to assess retinal structure, relative to age-matched wild type (WT) controls. Immunohistochemistry against glial fibrillary acidic protein (GFAP) and opsin (1D4 epitope) was performed on retinal frozen sections to monitor gliosis and opsin localization, respectively, while lectin cytochemistry, plus and minus PNGase-F treatment, was performed to assess protein glycosylation status. Retinas of DhddsK42E/K42E mice exhibited grossly normal histological organization from 1 to 12 months of age. Anti-GFAP immunoreactivity was markedly increased in DhddsK42E/K42E mice, relative to controls. However, opsin immunolocalization, ConA labeling and PNGase-F sensitivity were comparable in mutant and control retinas. Hence, retinas of DhddsK42E/K42E mice exhibited no overt signs of degeneration, ye<sup>t</sup> were markedly gliotic, but without evidence of compromised protein <sup>N</sup>-glycosylation. These results challenge the notion of RP59 as a DHDDS loss-of-function CDG and highlight the need to investigate unexplored RP59 disease mechanisms. Keywords: retinitis pigmentosa; knock-in mouse model; congenital disorder of glycosylation; retina	doab	2025-04-07T03:56:59.505012	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 19 }
00a6a373-fd58-400b-bd1a-e87d014d5110.20	1. Introduction Retinitis pigmentosa (RP) represents a group of hereditary retinal degenerative disorders of diverse genetic origins that have as their common trait the progressive, irreversible dysfunction, degeneration, and demise of retinal photoreceptor cells, with rods initially undergoing these pathological changes followed eventually by cones [1,2]. Relatively recently, a K42E point mutation in the dehydrodolichyl diphosphate synthase (DHDDS) gene was shown to cause a rare, recessive form of RP (RP59; OMIM #613861) [3–5]. DHDDS catalyzes cis-prenyl chain elongation in the synthesis of dolichyl diphosphate (Dol-PP), which is required for protein <sup>N</sup>-glycosylation [6,7]. DHDDS catalyzes the condensation of multiple units of isopentenyl pyrophosphate (IPP, also called isopentenyl diphosphate) to farnesyl pyrophosphate (FPP, also called farnesyl diphosphate) to produce Dol-PP [8,9]. This is used as the "lipid carrier" onto which oligosaccharide chains are built that are ultimately transferred to specific asparagine (N) residues on nascent polypeptide chains in the lumen of the endoplasmic reticulum (ER) to form N-linked glycoproteins [10]. The monophosphate (Dol-P) is used as a sugar carrier, transferring sugars from their corresponding sugar-nucleotide adducts (e.g., UDP-glucose, GDP-mannose, etc.) to the growing Dol-PP-linked oligosaccharide chains in the ER. Mutations in rhodopsin that block its glycosylation have been shown to cause retinal degeneration in vertebrate animals [11,12]. In addition, pharmacological inhibition of protein <sup>N</sup>-glycosylation with tunicamycin has been shown to disrupt retinal photoreceptor outer segmen<sup>t</sup> (OS) disc membrane morphogenesis in vitro [13], as well as to cause retinal degeneration with progressive shortening and loss of photoreceptor OSs in vivo [14]. In the present study, we created a DHDDS K42E homozygous knock-in mouse model (hereafter called DhddsK42E/K42E) of RP59—since K42E is the most prevalent point mutation in the RP59 patient population [3–5]—to study its underlying pathological mechanism, with the working hypothesis that defective protein <sup>N</sup>-glycosylation underlies the retinal dysfunction and degeneration observed in human RP59. Herein, we present a description of the generation and initial characterization of the phenotypic features of the DhddsK42E/K42E mouse model. Surprisingly, although we expected to observe an early onset, progressive, and potentially severe retinal degeneration, this was not the case. The retina appeared histologically intact and normal according to spectral domain optical coherence tomography (SD-OCT) analysis for up to at least one year of age. However, there was evidence of gliotic reactivity (glial fibrillary acidic protein (GFAP) immunostaining), despite the lack of obvious neuronal degeneration or cell death/loss. Also, despite the homozygous mutation in Dhdds, we found no evidence of compromised protein <sup>N</sup>-glycosylation in mutant mouse retinas.	doab	2025-04-07T03:56:59.505259	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 20 }
00a6a373-fd58-400b-bd1a-e87d014d5110.22	2.1. Animals Heterozygous (K42E/+) Dhdds knock-in (KI) mice were generated on a C57Bl/6J background by Applied StemCell (Milipitas, CA, USA). Briefly, CRISPR guide RNA (5-TCGCTATGCCAAGAAGTGTC-3 with PAM site AGG) was generated using in vitro transcription and was used to create a double strand break in the murine Dhdds locus to promote introduction of a single-stranded oligodeoxynucleotide (SSO) carrying the K42E mutation and a second silent DNA polymorphism to eliminate the PAM recognition site required for cleavage by CAS9 (5-ATTATCTGTTCTCTTCTACAGGCTGGCCCAGTACCCAAACATATCGCGTTCATAATGGACGGC AACCGTCGCTATGCCAAGGAGTGTCAAGTGGAGCGCCAGGAGGGCCACACACAGGGCTTCA ATAAGCTTGCTGAGGTGGGTGCGGGTGACAGAGCCTAGA-3). Mouse zygotes were injected with 100, 100, and 250 ng/μ<sup>L</sup> of Cas9 enzyme, guide RNA, and SSO, respectively, which were then transferred into pseudo pregnan<sup>t</sup> CD-1 females. Three potential founder (F0) pups were identified out of 13 mice tested, and an F0 founder was verified by DNA sequence analysis. Sequence-validated heterozygous (DhddsK42E/+) mice were crossed to generate homozygous (DhddsK42E/K42E) mice, as confirmed by PCR and DNA sequencing (see below). C57Bl/6J wild type (WT) mice, age- and sex-matched, were used as controls. All procedures conformed to the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research, and were approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Alabama at Birmingham. All animals were maintained on a standard 12/12 h light/dark cycle (20–40 lux ambient room illumination), fed standard rodent chow, provided water ad libitum, and housed in plastic cages with standard rodent bedding. ### 2.2. PCR Genotyping and DNA Analysis PCR primers were designed that spanned the targeted region (forward primer, 5-TCTAGGCTCTGTCACCCGCA-3 and reverse primer 5-TCTAGGCTCTGTCACCCGCA-3) amplifying a 292 bp segmen<sup>t</sup> of DNA in both WT and DhddsK42E/K42E mice. For initial verification of the knock-in, PCR products were sequenced in the UAB Heflin Center for Genomic Sciences. The presence of the knock-in sequence was confirmed in subsequent generations by restriction enzyme digestion with StyI, which cleaves the knock-in allele only (data not shown). Knock-in alleles were independently verified by Transnetyx, Inc. (Cordova, TN, USA) using proprietary technology. While the analysis was set up to recognize and differentiate the knock-in mutation and the PAM site polymorphism, only the knock-in mutation was maintained in all subsequent breeding. ### 2.3. Spectral Domain Optical Coherence Tomography (SD-OCT) In vivo retinal imaging was performed as previously described in detail by DeRamus et al. [15], using a Bioptigen Model 840 Envisu Class-R high-resolution SD-OCT instrument (Bioptigen/Leica, Inc.; Durham, NC, USA). Data were collected from DhddsK42E/K42E and WT mice at postnatal day (PN) 1 (KI, n = 5; WT, n = 9), 2 (KI, n = 4; WT, n = 8), 3 (KI, n = 5; WT n = 3), 8 (KI, n = 4; WT n = 5), and 12 months (mos) (KI, n = 3; WT n = 3) to assess retinal structure. Layer thicknesses were determined manually using Bioptigen InVivoVue® and Bioptigen Diver® V. 3.4.4 software and the data were analyzed and graphed using Microsoft Excel software.	doab	2025-04-07T03:56:59.505451	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 22 }
00a6a373-fd58-400b-bd1a-e87d014d5110.23	2.4. Immunohistochemistry (IHC) Procedures utilized for fixation, O.C.T. embedment, and sectioning of mouse eyes were as described in detail previously by Ramachandra Rao et al. [16]. In brief, eyes were immersion fixed overnight in phosphate-buffered saline (PBS) containing freshly prepared paraformaldehyde (4% v/v), appropriately cryopreserved, embedded in O.C.T., and cryosectioning was performed on a Leica Model CM3050 S Cryostat (Leica Biosystems, Wetzlar, Germany). Retinal sections were first "blocked" with 0.1% BSA, 0.5% serum (species corresponding to secondary antibody host) in Tris-buffered saline containing 0.1% Tween-20 (TBST), then incubated for 1 h at room temperature with a rabbit polyclonal antibody against glial fibrillary acidic protein (GFAP;, DAKO/Agilent, Santa Clara, CA, USA; 1:500 dilution in TBST) and a mouse monoclonal antibody against the C-terminal epitope of opsin (1D4; Novus Biologicals, Littleton, CO, USA; 1:500 dilution in TBST), followed by incubation with fluor-conjugated secondary antibodies (AlexaFluor®-488 conjugated anti-mouse IgG, AlexaFluor®-568 conjugated anti-rabbit IgG; Thermo Fisher Scientific, Waltham, MA, USA; 1:500 dilution in TBST). Sections were then counterstained with DAPI and cover slipped with anti-fade mounting medium (Vectashield®; Vector Laboratories, Burlingame, CA, USA) and viewed with a Leica TCS SPEII DMI4000 scanning laser confocal microscope (Leica Biosystems). Images were captured using a 40X oil immersion (RI 1.518) objective under normal laser intensity (10% of laser power source), arbitrary gain (850 V) and offset (–0.5) values, to optimize signal-to-noise ratio. Digital images were captured and stored as TIFF files on a PC computer.	doab	2025-04-07T03:56:59.505677	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 23 }
00a6a373-fd58-400b-bd1a-e87d014d5110.24	2.5. Lectin Cytochemistry Paraformaldehyde-fixed eyes (as described above) were processed for paraffin embedment. Paraffin sections of mouse eyes were then incubated (45 min at room temperature) with biotinylated Concanavalin-A (ConA, B-1005; Vector Laboratories; 1:200 dilution in PBS), followed by incubation with AlexaFluor®-488 conjugated streptavidin (Thermo Fisher Scientific; 1:500 dilution in PBS) and AlexaFluor®-647-conjugated peanut agglutinin (PNA, L32460; Thermo Fisher Scientific; 1:250 dilution in PBS), with or without pre-treatment (37 ◦C, overnight) with peptide:N-glycosidase F (PNGase-F, 200 U, P0704S; New England Biolabs, Inc., Ipswich, MA, USA). Sections were DAPI-stained and mounted using Vectashield mounting media, and digital images obtained using scanning laser confocal microscopy as described above [16].	doab	2025-04-07T03:56:59.505809	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 24 }
00a6a373-fd58-400b-bd1a-e87d014d5110.25	3. Results ### 3.1. Generation and Validation of K42E DHDDS Knock-In Mutation K42E knock-in mice were generated commercially using CRISPR-Cas9 technology. The K42E knock-in mutations in both heterozygous and homozygous mice were confirmed by DNA sequence for one of the heterozygous F0 founder mice, which is shown in Figure 1. Both the A-to-G and G-to-A transitions that lead to the K42E mutation and the Q44Q silent polymorphism, respectively, are heterozygous (arrows). Intra-litter mating was done to establish at least fourth generation homozygous mice that were used for all subsequent analyses. Heterozygous mice were initially characterized by SD-OCT and histology and found not to differ from WT (not shown). Figure 1. DNA sequence analysis of a tail DNA from a K42E/+ founder mouse. Tail DNA was amplified with primers that cover a 292 bp segmen<sup>t</sup> spanning the target region. The sequence analysis confirmed the presence (arrows) of the K42E (A-to-G) mutation and the Q44Q (G-to-A) polymorphism that was included to eliminate the CRISPR-related PAM site. ### 3.2. SD-OCT Analysis Reveals No Evidence for Retinal Degeneration in DhddsK42E/K42E Mice SD-OCT provides a non-invasive means of assessing retinal morphology in vivo. Qualitative SD-OCT images obtained from wild type (WT) and DhddsK42E/K42E mice are presented in Figure 2. From these images, it is clear that the gross morphology of the retina in the homozygous knock-in animals, from PN 1 to 12 months of age, are comparable to that observed in fully mature, age-matched WT control mice. All retinal histological layers were intact and of normal appearance. Hence, there was no evidence of retinal degeneration, even up to one year of age. We used SD-OCT to perform quantitative analysis of retinal morphology to compare ocular tissue layer thicknesses in WT and knock-in mice. Figure 3 compares data obtained at PN 1, 2, 3, 8, and 12 mos for DhddsK42E/K42E mice, compared to age-matched WT control littermates. The data are shown both with respect to outer nuclear layer (ONL) thickness (yellow and gray lines) as well as total neural retina thickness (blue and orange lines) as a function of distance from the optic nerve head (ONH, point 4 in each graph) along the vertical meridian, for both the inferior and superior hemispheres. No differences in these quantitative metrics of retinal morphology were observed with respect to genotype, consistent with the representative OCT images shown in Figure 2. Figure 2. Representative averaged SD-OCT images of retinas from (left panels: A,C,E,G,I) 1-, 2-, 3-, 8- and 12-months (mos) old wild type (WT), and (right panels: B,D,F,H,J) 1-, 2-, 3-, 8-, and 12-months old DhddsK42E/K42E mice. Abbreviations: IPL, inner plexiform layer; ONL, outer nuclear layer; ROS, rod outer segmen<sup>t</sup> layer. No changes were observed at any age in retinas of DhddsK42E/K42E mice compared to WT mice. Figure 3. Analysis of the ONL thickness (yellow and gray lines) and total retinal thickness (blue and orange lines) in WT and DhddsK42E/K42E mice ranging in age from PN 1 to 12 months. (A) 1 month, (B) 2 months, (C) 3 months, (D) 8 months, (E) 12 months. Outer nuclear layer (ONL) thickness and total retina thickness measurements (in microns), as a function of genotype and distance from the optic nerve head (ONH) along the vertical meridian in both the inferior and superior hemispheres. Genotypes: WT and DhddsK42E/K42E mice. No significant differences were observed between the groups. ### 3.3. Gliotic Reactivity, Despite Lack of Overt Neural Retina Degeneration, in DhddsK42E/K42E Mice We performed immunohistochemical analysis on frozen sections of fixed, O.C.T.-embedded WT and DhddsK42E/K42E mouse eyes at PN 2 months of age, probing with antibodies against GFAP (polyclonal) and a C-terminal epitope of rod opsin (1D4 monoclonal). As shown in Figure 4, whereas WT control retinas only exhibited GFAP immunoreactivity (pseudocolored red) along the vitreoretinal interface, corresponding to astrocytes and Müller glia "end feet", retinas from DhddsK42E/K42E mice exhibited extensive, robust anti-GFAP labeling in a radial pattern. This extended throughout the inner retinal layers to the outer plexiform layer (OPL), in addition to intense labeling along the vitreoretinal interface. The latter results are indicative of massive gliotic activation, which is remarkable considering the lack of overt retinal degeneration or loss of retinal neurons (per the SD-OCT data; see Figures 2 and 3). Gliosis in DhddsK42E/K42E mouse retinas was also detected at PN one month and persisted even at PN six months of age (data not shown). Anti-opsin immunolabeling (pseudocolored green) was comparable in both WT and DhddsK42E/K42E retinas. Notably, the label was confined to the OS layer; there was no mislocalization of opsin to the plasma membrane of the cell in the IS or ONL layer—unlike what is often observed in degenerating photoreceptor cells in various animal models—suggesting normal trafficking of opsin to the outer segment, and consistent with a lack of overt photoreceptor degeneration. It is worth noting that the green labeling in a few cells in the inner retina in Figure 4 is due to mouse-on-mouse binding of the monoclonal antibody to endogenous IgG in blood vessels. It does not represent true anti-opsin immunolabeling. Figure 4. Laser confocal microscopy images of (A) WT control and (B) DhddsK42E/K42E mouse retina frozen sections at PN 2 months of age, stained with antibodies to GFAP (pseudocolor: red) and rod opsin (pseudocolor: green), and counterstained with DAPI (blue). Scale bar (both panels) is 20 μm. Abbreviations: OS, outer segmen<sup>t</sup> layer; IS, inner segmen<sup>t</sup> layer; ONL, outer nuclear layer; OPL, outer plexiform layer; INL, inner nuclear layer; IPL, inner plexiform layer; GCL, ganglion cell layer. Scale bar (both panels) is 20 μm. ### 3.4. Lack of Defective Protein Glycosylation in DhddsK42E/K42E Mouse Retinas The N-linked oligo-saccharides of glycoproteins contain alpha-linked mannose residues as constituents, which are cognate ligands for the lectin concanavalin A (Con A) [17]. Hence, ConA lectin cytochemistry offers a reliable means of detecting the presence (or absence) of N-linked oligo-saccharides in tissue sections of DhddsK42E/K42E mice, and a way to directly test the current hypothesis that RP59 is driven by lack of glycosylation. This is because the synthesis of oligosaccharide chains in cells and tissues obligatorily depends upon the presence of Dol-PP and Dol-P (which requires upstream DHDDS activity). Furthermore, N-linked oligosaccharide chains are selectively susceptible to hydrolysis by peptide:N-glycosidase F (PNGase-F) [18]; hence, tissue sections treated with PNGase-F should exhibit a marked loss of Con A binding (serving as a true negative control), thereby mimicking the scenario where upstream DHDDS activity may be lacking. We performed ConA lectin cytochemical analysis on retinal sections from WT control and DhddsK42E/K42E mice at PN six months of age, with and without pre-treatment with PNGase-F. The results are shown in Figure 5. Figure 5. ConA lectin cytochemical analysis of retinas from (A,B) WT control and (C,D) DhddsK42E/K42E mice at PN 6 months of age, with (B,D) or without (A,C) pretreatment with PNGase-F. ConA binding (green); PNA binding (magenta); DAPI counterstain (blue). Abbreviations are the same as in the Figure 4 legend. Scale bar (all panels): 20 μm. Normally, N-linked glycoproteins are present throughout the retina, being notably enriched in photoreceptor cells and the synaptic endings of neurons (IPL, OPL). Hence, the inner and outer segmen<sup>t</sup> layers (IS and OS, respectively), including the glycoconjugate-rich interphotoreceptor matrix (IPM), as well as the inner and outer plexiform layers (IPL and OPL, respectively) were robustly labeled with fluor-tagged ConA in untreated WT retinal sections (Figure 5 A). As expected, treatment of WT retinal tissue sections with PNGase-F dramatically reduced the level of ConA binding throughout the retina (Figure 5B). Notably, retinal sections from DhddsK42E/K42E mice also exhibited robust, pan-retinal ConA binding (Figure 5C), comparable to that of WT controls. Upon treatment with PNGase-F, most of the ConA staining was lost (Figure 5D). These results obviate any significant DHDDS loss-of-function in DhddsK42E/K42E mice. Peanut agglutinin (PNA) binds to the disaccharide Gal-β(1-3)-GalNAc in glycoproteins and glycolipids [17]. Oligosaccharides containing this disaccharide are highly enriched in the extracellular matrix surrounding cone photoreceptor outer segments (the "cone matrix sheath") [19,20]. Thus, PNA binding can be used to selectively label cone photoreceptors in retinal tissue sections, since rod photoreceptors and their associated "rod matrix sheath" lack such glycan chains [21]. Furthermore, oligosaccharides containing Gal-β(1-3)-GalNAc are generally O-linked (e.g., through Ser or Thr residues), rather than N-linked, and their synthesis is not dolichol-dependent in mammalian cells [22]. Furthermore, the PNA-binding disaccharide epitope is not susceptible to PNGase-F hydrolysis [17]. Hence, we expected to observe no appreciable di fferences in the binding of PNA to retinal tissue sections from DhddsK42E/K42E retinas vs. WT controls, nor e ffects of PNGase-F treatment on PNA binding, either with regard to labeling intensity or distribution. These expectations were realized, as illustrated in Figure 5 (magenta staining, all four panels). Both DhddsK42E/K42E and control retinas exhibited comparable distribution of PNA-positive cone matrix sheaths, suggesting persistence of viable cone photoreceptors in the K42E mutants.	doab	2025-04-07T03:56:59.505871	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 25 }
00a6a373-fd58-400b-bd1a-e87d014d5110.26	4. Discussion Here, we have presented the generation and initial characterization of a novel mouse model of RP59, where we have achieved global homozygous knock-in of the K42E Dhdds mutation specifically associated with RP59 [3–5]. Based upon the clinical presentation of RP59 in human patients [3–5], as well as the demonstrable importance of dolichol-dependent protein glycosylation in maintaining the normal structure and function of the vertebrate retina [11–14], we expected to observe retinal degeneration and retinal thinning in DhddsK42E/K42E mice, particularly in mice homozygous for the K42E mutation. This expectation was also predicated on a preliminary report [23], using a similar K42E mouse knock-in model, that claimed nearly 50% loss of OS length and reduction in ONL thickness by about two-thirds at PN 3 months of age, compared to WT mouse retinas. However, we observed no evidence of retinal degeneration in DhddsK42E/K42E mice up to one year of age. Furthermore, despite the confirmed mutation of Dhdds, we found no evidence for defective protein <sup>N</sup>-glycosylation in the retinas of these mice. The retinas were labeled robustly with fluor-tagged ConA lectin, irrespective of genotype. These findings are in good agreemen<sup>t</sup> with observations made by Sabry et al. [24] who found normal mannose incorporation into N-linked oligosaccharides using either siRNA silencing of DHDDS in a HepG2 cell line or in RP59 (severe mutation) patient fibroblasts. The ConA binding observed in our study is further consistent with observations made by Wen et al., who observed that rather than any loss in dolichols, there was an alteration in dolichol chain lengths (increased D17:D18 ratio) in RP59 patients compared to normal human subjects, but without obvious hypoglycosylation of serum transferrin [25]. These findings collectively sugges<sup>t</sup> hypoglycosylation-independent retinal degeneration in RP59, the mechanism of which still remains to be elucidated. Understanding the pathophysiological and biochemical mechanisms underlying RP59 remains limited due to the lack of a validated vertebrate animal model that faithfully mimics the key hallmarks of the disease. Heretofore, only a zebrafish model of RP59 has been documented, using global knock-down of DHDDS expression by injection of morpholino oligonucleotides at the one-cell embryo stage [26]. In that case, the fish exhibited defective photoresponses and their cone outer segments (as assessed indirectly by PNA staining) were dramatically shortened, if not nearly absent. It should be noted that zebrafish have a highly cone-rich retina, unlike humans or mice (which have highly rod-dominant retinas). Also, the reduction and loss of PNA binding in the zebrafish knock-down retinas most likely reflects degeneration and death of cone photoreceptors, with concomitant degeneration and loss of their outer segments, due to their requirement for dolichol. Unlike the zebrafish Dhdds knock-down model, the murine RP59 model generated in the present study exhibits robust PNA staining in the outer retina, suggesting persistence of viable cone photoreceptors. In a parallel study (Ramachandra Rao et al., unpublished), we have observed Dhdds transcript distribution in all retinal nuclear layers by in situ hybridization, consistent with the fact that all cells require dolichol derivatives to support protein <sup>N</sup>-glycosylation. Taken together, these findings sugges<sup>t</sup> that the K42E Dhdds mutation does not a ffect cone photoreceptor viability. Recently (Ramachandra Rao et al., manuscript submitted for publication), we also generated a conditional Dhdds knockout mouse model, with targeted ablation of Dhdds in retinal rod photoreceptors, using a Cre-lox approach; however, unlike the K42E knock-in model, the rod-specific Dhdds knockout model exhibits profound, rapid retinal degeneration, with almost complete loss of photoreceptors by PN 6 weeks. Yet, there was no evidence of compromised protein <sup>N</sup>-glycosylation prior to the onset of photoreceptor degeneration. In addition, as reported in a companion article in this Special Issue of Cells [27], targeted ablation of Dhdds in retinal pigment epithelium, (RPE) cells in mice also results in a progressive, but somewhat slower, retinal degeneration. As pointed out by Zelinger et al. [4], the phenotype of RP59 only involves the retina; there is no observable dysfunction or pathology in other tissues and organs in RP59 patients. Hence, those authors speculated that the K42E mutation, "alters, rather than abolishes, enzymatic function, perhaps either by reducing the level of DHDDS protein or by preventing requisite interactions between DHDDS and a photoreceptor-specific protein" [4]. They also suggested, alternatively, that mutation of DHDDS might result in, "a toxic accumulation of isoprenoid compounds," such as occurs in various forms of neuronal ceroid lipofuscinosis (e.g., Batten disease). While such speculations may turn out to be true, there is no direct empirical evidence extant to support this hypothesis. It is also entirely possible, however, that mutations (whether K42E or others) in DHDDS may a ffect its interactions with its enzymatic partner, Nogo-B receptor (NgBR, encoded by the Nus1 gene) [8,9], with concomitant alterations in dolichol synthesis and protein <sup>N</sup>-glycosylation [28,29]. At present, nothing is known about the expression of Nogo-B receptor or its interactions with DHDDS, specifically in the retina. Our DhddsK42E/K42E mouse line and retinal cell type-specific conditional DHDDS knockout mice o ffer potentially valuable model systems in which to pursue further investigations along these lines. In addition, we are currently pursuing studies employing dual, targeted ablation of DHDDS and NgBR in the retina. (See also the article by DeRamus et al., in this Special Issue of Cells, regarding an RPE-specific DHDDS knockout mouse model [27].) Our findings bring into question the current concept that RP59 is a member of a large and diverse class of diseases known as "congenital disorders of glycosylation" (CDGs) [30,31]. While, in principle, it would be reasonable to consider RP59 as a CDG, due to the associated mutation(s) in DHDDS, there is no direct evidence to demonstrate a glycosylation defect in the human retinal disease or in any animal model of RP59 generated to date. The mechanism underlying the DHDDS-dependent retinal degeneration in human arRP patients remains to be elucidated, but is more complex than simply loss-of-function of DHDDS. Author Contributions: Conceptualization, S.J.P. and S.J.F.; methodology, S.J.P., S.J.F., S.R.R., P.K.; M.N.N.; validation, S.R.R., M.N.N., P.K., S.J.P. and S.J.F.; formal analysis, M.N.N., S.J.P., S.J.F. and S.R.R.; investigation, S.J.P., S.R.R., P.K.; resources, S.J.P. and S.J.F.; data curation, S.J.P. and S.J.F.; writing—original draft preparation, S.J.F.; writing—review and editing, S.J.F., S.J.P., P.K., M.N.N. and S.R.R.; visualization, S.J.F., S.R.R. and S.J.P.; supervision, S.J.P. and S.J.F.; project administration, S.J.P. and S.J.F.; funding acquisition, S.J.P. and S.J.F. All authors have read and agreed to the published version of the manuscript. Funding: This research was supported by U.S. Department of Health and Human Services (National Institutes of Health (NIH)/National Eye Institute (NEI)) gran<sup>t</sup> R01 EY029341 to S.J.P. and S.J.F., and NIH/NEI core gran<sup>t</sup> P30 003039 to S.J.P.; a Fight for Sight Summer Student Fellowship to S.R.R.; a Career-Starter Research Grant from the Knights Templar Eye Foundation to S.R.R.; as well as support from the UAB Vision Science Research Center (S.J.P., M.N.N., P.K.) and facilities and resources provided by the VA Western NY Healthcare System (S.J.F., S.R.R.). Acknowledgments: We thank Isaac Cobb for technical assistance with OCT and genotyping. The opinions expressed herein do not reflect those of the Department of Veteran A ffairs or the U.S. Government. Conflicts of Interest: The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.	doab	2025-04-07T03:56:59.506396	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 26 }
00a6a373-fd58-400b-bd1a-e87d014d5110.28	Selective Ablation of Dehydrodolichyl Diphosphate Synthase in Murine Retinal Pigment Epithelium (RPE) Causes RPE Atrophy and Retinal Degeneration Marci L. DeRamus 1, Stephanie J. Davis 1, Sriganesh Ramachandra Rao 2, Cyril Nyankerh 1, Delores Stacks 1, Timothy W. Kraft 1, Steven J. Fliesler 2 and Steven J. Pittler 1,\* Received: 12 February 2020; Accepted: 17 March 2020; Published: 21 March 2020 Abstract: Patients with certain defects in the dehydrodolichyl diphosphate synthase (DHDDS) gene (RP59; OMIM #613861) exhibit classic symptoms of retinitis pigmentosa, as well as macular changes, suggestive of retinal pigment epithelium (RPE) involvement. The DHDDS enzyme is ubiquitously required for several pathways of protein glycosylation. We wish to understand the basis for selective ocular pathology associated with certain DHDDS mutations and the contribution of specific ocular cell types to the pathology of mutant Dhdds-mediated retinal degeneration. To circumvent embryonic lethality associated with Dhdds knockout, we generated a Cre-dependent knockout allele of murine Dhdds (Dhddsflx/flx). We used targeted Cre expression to study the importance of the enzyme in the RPE. Structural alterations of the RPE and retina including reduction in outer retinal thickness, cell layer disruption, and increased RPE hyper-reflectivity were apparent at one postnatal month. At three months, RPE and photoreceptor disruption was observed non-uniformly across the retina as well as RPE transmigration into the photoreceptor layer, external limiting membrane descent towards the RPE, and patchy loss of photoreceptors. Functional loss measured by electroretinography was consistent with structural loss showing scotopic a- and b-wave reductions of 83% and 77%, respectively, at three months. These results indicate that RPE dysfunction contributes to DHDDS mutation-mediated pathology and suggests a more complicated disease mechanism than simply disruption of glycosylation. Keywords: retinal degeneration; retinitis pigmentosa; retinal pigment epithelium dystrophy; RPE transmigration; Cre-Lox technology; mouse models	doab	2025-04-07T03:56:59.507003	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 28 }
00a6a373-fd58-400b-bd1a-e87d014d5110.29	1. Introduction Retinitis pigmentosa (RP) and related disorders are characterized by degeneration and loss of photoreceptors, attenuation of retinal blood vessels, pigment deposits, and a waxy pallor of the optic disc that result in impaired night vision and peripheral and central vision loss [1]. Defective protein glycosylation in the retinal pigment epithelium (RPE) has been associated with retinal degeneration elicited by photoreceptor abnormalities and impaired phagocytosis of aging photoreceptor outer segmen<sup>t</sup> (OS) membranes [2–5]. One such example, dehydrodolichyl diphosphate synthase (DHDDS; OMIM #608172), is an essential enzyme in the mevalonate pathway where it functions ubiquitously in isoprenoid chain elongation to form dolichols that comprise 17–20 isoprene units. The phosphorylated form of dolichol, dolichol pyrophosphate is necessary for N-glycosylation at specific residues in many membrane proteins [6]. There is no known unique function for DHDDS in the retina, or in any other ocular tissue. There are numerous N-glycosylated proteins in the retina and photoreceptors, such as rhodopsin [7] and the cGMP-gated cation channel in rods. Additionally, in the RPE, there are several glycosylated structural proteins, ion channels and transport proteins that contribute to the transepithelial potential of the polarized RPE monolayer [8–10]. Mutations in the gene encoding DHDDS lead to a recessive form of RP called RP59 (OMIM #613861, DHDDS, K42E), which was first identified in several families of Ashkenazi Jewish origin [11–13]. RP59 is considered to belong to the family of human genetic diseases known as "congenital disorders of glycosylation" (CDGs) [14]. Two other mutations in the DHDDS gene (T206A and R98W), which occur heterozygously with the K42E mutation, were also reported, but have not been studied in detail [15,16]. Patients with the K42E mutation in DHDDS exhibit all the cardinal features of RP as well as macular changes [12], suggesting possible RPE involvement. While the K42E, T206A, and R98W mutations are only associated with known RP symptoms, another mutation in the DHDDS gene has led to infant morbidity at seven months of age [17]. As a first step to assess the role of DHDDS in specific retinal cell types and to understand the molecular mechanism of RP59, we created a Cre-lox dependent line of mice that allows targeted, cell type-specific deletion of Dhdds in cells of interest. Using a conditional knockout was necessary to circumvent embryonic lethality associated with global knockout of Dhdds [18,19]. Here, we describe the generation and characterization of a Dhddsflx/flx CreRPE mouse line (i.e., RPE-specific Dhdds knockout) and its validation as a model of RPE atrophy and retinal degeneration. We show that RPE-specific deletion of Dhdds induces structural and functional deficits in the RPE and the photoreceptors, which suggests that RPE pathology may be a significant contributor to the retinal degeneration observed in patients with RP59 mutations.	doab	2025-04-07T03:56:59.507149	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 29 }
00a6a373-fd58-400b-bd1a-e87d014d5110.30	2. Materials and Methods ### 2.1. Generation of Dhddsflx/flx CreRPE Mice A construct containing lacZ flanked by FLP-FRT and Dhdds exon 3 flanked by loxP sites from the Knockout Mouse Project (KOMP, UC Davis, Davis, CA, USA) was linearized and introduced into mouse ES cells (C57Bl/6J background) at the Roswell Park Cancer Institute (RPCI) Gene Targeting and Transgenic Facility (Bu ffalo, NY, USA) using standard technology. To confirm the correctly targeted cells, polymerase chain reaction (PCR) was performed with the primers listed below (see PCR Genotyping, below). The lacZ cassette was excised with FLP-FRT recombinase, and excision was confirmed by PCR. Mouse lines that carried the Dhdds loxP conditional knockout allele were crossed to generate homozygotes and the latter were also crossed to a mouse line (on a C57Bl/6J background) carrying a homozygous transgene expressing Cre recombinase under the control of the RPE-specific VMD2 (vitelliform macular degeneration 2) promoter [20,21]. RPE-specific expression of Cre in the VMD2 promoter-driven mouse line was confirmed by crossing those mice with a ZsGreen reporter mouse line (B6.Cg-Gt(ROSA)26Sortm6(CAG-ZsGreen1)Hze/J, The Jackson Laboratory, Bar Harbor, ME, USA) and examining the retinas by confocal fluorescence microscopy. Genotypes of o ffspring were confirmed by PCR with Dhdds- and Cre RPE-specific primer pairs. All mice used in this study were treated following the ARVO Statement on the Use of Animals in Ophthalmic and Vision Research and the policies of the University of Alabama at Birmingham (UAB) Institutional Animal Care and Use Committee (IACUC). This project was approved for animal use on April 2019 by the UAB IACUC and requires updated approvals each year (protocol number IACUC-21270). All animals were maintained on a standard 12/12-h light/dark cycle, fed standard rodent chow, provided water ad libitum, and housed in plastic cages with standard rodent bedding.	doab	2025-04-07T03:56:59.507349	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 30 }
00a6a373-fd58-400b-bd1a-e87d014d5110.31	2.2. PCR Genotyping Mouse genomic DNA samples obtained from tail snips were verified by PCR using primers Dhdds-FWD: 5-GTGTCATCCCCTGCTGCAGAT-3 and Dhdds-REV: 5-TGGGTGTAGTG-GCTCAGGTC-3 for genotype identification of floxed Dhdds alleles designed in a region which was conserved in both wild type (WT) and floxed alleles and also in the region flanking the loxP sites. The expected PCR product sizes for the WT and floxed alleles are 393 and 517 bp, respectively, thus differentiating WT, heterozygous floxed, and homozygous floxed alleles. PCR verification of Cre transgene modification was carried out using the following forward and reverse primer sets for Cre RPE 5-AGGTGTAGAGAAGGCACTTAGC-3 and 5-CTAATCGCCATCT-TCCAGCAGG-3, respectively, yielding a 411 bp product. RPE specific expression and activity of Cre-recombinase in VMD2-RPE Cre was verified by breeding these mouse lines against an ZsGreen reporter mouse strain (B6.Cg-Gt(ROSA)26Sortm6(CAG-ZsGreen1)Hze/J, Stock# 007906; The Jackson Laboratory, Bar Harbor, ME, USA) and monitoring ZsGreen expression in the retina.	doab	2025-04-07T03:56:59.507499	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 31 }
00a6a373-fd58-400b-bd1a-e87d014d5110.32	2.3. Spectral-Domain Optical Coherence Tomography Spectral-domain optical coherence tomography (SD-OCT) (840 nm; Bioptigen, Inc./Leica, Durham, NC, USA) was used to obtain in vivo images of the retina at one, two, and three months of age. OCT images were collected with Bioptigen InVivoVue® 1.4 software and Bioptigen Diver® 2.0 software was used to analyze outer nuclear layer (ONL) thickness and full retinal thickness (F.R.T.) across all retinal layers at five eccentricities spanning two-thirds of the retina centered at the optic nerve head. A detailed description of this procedure has been reported previously [22]. F.R.T. was calculated from the difference of markers 1 and 10 and ONL thickness was calculated from the difference between 5 and 6. ### 2.4. Fundus Examination and Fluorescein Angiography Fundus examination was performed with a Micron IV digital fundus microscope (Phoenix Technology Group, Pleasanton, CA, USA), using the mouse objective and hydroxypropylmethyl cellulose 2.5% on the surface of the cornea. Digital images of the fundus were captured with dedicated StreamPix® 6 digital software (NorPix, Inc., Montreal, Quebec, Canada) and processed using Adobe® Photoshop® 6 (Adobe Systems, Inc., San Jose, CA, USA).	doab	2025-04-07T03:56:59.507842	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 32 }
00a6a373-fd58-400b-bd1a-e87d014d5110.33	2.5. Visual Function Testing Full-field scotopic and photopic electroretinograms (ERGs) were obtained as described in detail previously using an OcuScience® HMsERG instrument (OcuScience, Henderson, NV, USA) [22]. Response amplitudes and implicit times of a-waves and b-waves representing the activity of photoreceptors and bipolar cells, respectively, were quantified. In brief, mice were dark-adapted overnight, anesthetized, and then placed on a heating pad to maintain body temperature. Following pupil dilation with 2.5% phenylephrine and 1% tropicamide ophthalmic solutions, a thin silver wire electrode was placed on the cornea (interfaced with methylcellulose and covered with a specially designed contact lens) and referenced to a needle ground electrode in the cheek. The responses to Ganzfeld flash stimuli, spanning a range of five log units, were measured and recorded; following light adaptation to background illumination, cone-driven responses also were recorded.	doab	2025-04-07T03:56:59.507946	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 33 }
00a6a373-fd58-400b-bd1a-e87d014d5110.34	2.6. Histology/Immunohistochemistry The methodologies used in this study have been described in detail previously [23]. Briefly, for conventional histology, eyes (n ≥ 4 per condition) were fixed by immersion in freshly prepared 4% paraformaldehyde in 0.125 M Na-phosphate buffer, pH 7.4, at 4 ◦C overnight, embedded in paraffin, and tissue sections (toluidine blue-stained) were viewed with an Olympus BH2 photomicroscope equipped with a Nikon digital camera. Digitized images were collected and further analyzed with ImagePro Plus ® software, Version 4.1 (Media Cybernetics; Rockville, MD, USA). For immunohistochemistry, frozen sections of retinal tissue (embedded in Tissue-Plus ™ Optimal Cutting Temperature (O.C.T.) compound; Thermo Fisher Scientific, Waltham, MA, USA), obtained with a cryostat and collected on glass microscope slides were incubated with suitable primary antibodies, with detection by application of species-specific, fluor-conjugated secondary antibodies, counterstaining nuclei with DAPI, followed by laser confocal immunofluorescence microscopy (Leica TCS SPE scanning confocal microscope; Leica Microsystems Inc., Bu ffalo Grove, IL, USA), as previously reported [24].	doab	2025-04-07T03:56:59.508041	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 34 }
00a6a373-fd58-400b-bd1a-e87d014d5110.35	2.7. Fluorescein Angiography Fluorescein angiography was performed following intraperitoneal injection (i.p., 10 μL/gram body weight) of a 10 mg/mL solution of AK-Fluor 10% (Sigma Pharmaceuticals; Liberty, IA, USA) in PBS. Uptake of fluorescein and fundus imaging was monitored with a Micron IV Retinal Imaging Microscope (Phoenix Technology Group, Inc., Pleasanton, CA, USA).	doab	2025-04-07T03:56:59.508131	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 35 }
00a6a373-fd58-400b-bd1a-e87d014d5110.36	2.8. Electron Microscopy Mouse eyes were processed for plastic embedment, ultramicrotomy, and EM analysis essentially as described in detail previously [23]. Immediately after sacrifice, eyes were orientated by marking the superior hemisphere along the vertical meridian at the limbus with a hot needle, before starting the dissection. A cut was made in the superior cornea and the eyes were fixed for 2 h at 4 ◦C in fresh 0.1 M sodium phosphate bu ffer (pH 7.4), containing 2.5% (v/v) glutaraldehyde, 2.0% formaldehyde and 0.025% CaCl2. After a 20–30 min primary fixation, the superior cornea and lens were removed, and fixation was continued overnight. The fixed eyes were then rinsed with 0.1 M sodium cacodylate bu ffer (pH 7.4) containing 0.025% CaCl2, and then post-fixed for 1 h in 1% osmium tetroxide in 0.1 M sodium cacodylate bu ffer. After post-fixation, the eyes were rinsed twice in 0.1 M sodium cacodylate bu ffer and once in distilled water, then dehydrated in graded ethanol series followed by propylene oxide and infiltration overnight in Spurr's resin. The eyes were then embedded in resin-filled BEEM ® capsules (Polysciences, Warrington, PA, USA) and allowed to polymerize in a 70 ◦C oven for 48 h. Tissue sections were obtained with a Reichert–Jung Ultracut E ® microtome using a diamond knife. Thin (60–80 nm thickness) sections were collected on copper 75/300 mesh grids and stained with 2% (v/v) uranyl acetate and Reynolds' lead citrate. Sections were viewed with a JEOL 100CX electron microscope at an accelerating voltage of 60 keV. ### 2.9. Serial Block-Face Scanning Electron Microscopy (SBF-SEM) Samples prepared for TEM as described above were further processed by Thermo Fisher Scientific (Waltham, MA, USA) using an Apreo VolumeScope ™ serial block-face scanning electron microscope (SBF-SEM). Excess resin was removed from the tissue using a Leica ultramicrotome. The trimmed blocks were then glued to a SEM stub (Agar Scientific, AGG1092450) using a two-component silver conductive epoxy, H20E EPO-TEK (Ted Pella, Inc.; Redding, CA, USA). To minimize charging of the block by the electron beam, the bottom and sides of the block were sputter-coated with a 30 nm thick gold film layer. The samples were then imaged on the VolumeScope ™ operating in low vacuum mode at 50 Pa and using a lens mounted backscattered detector. All of the data sets were imaged with an accelerating voltage of 2.2 kV and a beam current of 100 pA using 1-μs dwell time combined with two-line integration. Two regions of interest (ROIs) were acquired on the knock-out sample (KO-148). For ROI1, 738 sections were collected with the internal microtome set to a 40 nm cutting thickness (z resolution) with an area of 92.9 μm × 89.1 μm at 10 nm/pixel. For ROI2, 745 sections were collected with an area of 97.6 μm × 96.3 μm using the same imaging condition as ROI1. For the wild type sample (WT-146), an area of 92.9 μm × 89.1 μm was imaged at 10 nm/pixel using a cutting thickness (z resolution) of 40 nm. The acquired data sets were finally aligned and visualized using 3D volume rendering to highlight the RPE anomalies using Amira software (Thermo Fisher Scientific).	doab	2025-04-07T03:56:59.508174	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 36 }
00a6a373-fd58-400b-bd1a-e87d014d5110.37	2.10. Statistical Analysis For ERG analyses, we evaluated differences between genetically modified vs. WT control mice across flash intensities by performing repeated measures two-way ANOVA with Holm–Sidak post-hoc analysis at each time point. To evaluate functional (visual acuity, a-wave and b-wave amplitudes and implicit times) and structural (SD-OCT retinal layer thickness) parameters across time, we used a two-way repeated measures ANOVA (time X treatment conditions) with Holm–Sidak post-hoc analysis. For biochemical and quantitative immunohistochemical data, binary statistical comparisons between specific genetically modified vs. WT control group data were analyzed using an unpaired Student's t-test.	doab	2025-04-07T03:56:59.508390	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 37 }
00a6a373-fd58-400b-bd1a-e87d014d5110.38	3. Results ### 3.1. Generation of a Floxed Dhdds Mouse Line The scheme used for the generation of a Dhdds conditional allele, employing a validated Dhdds construct (from KOMP) and mouse embryonic stem cells (ESCs), is shown in Figure 1 (see Materials and Methods, above). Clones from confirmed flippase recognition target (FRT)-excised alleles were used to generate Dhdds heterozygous and homozygous mouse lines on a C57Bl/6J background. Figure 1. Generation of Cre-dependent Dhdds conditional knockout (KO) mice. (A) A validated Dhdds construct from the Knockout Mouse Project (KOMP) (U.C. Davis) was linearized and introduced into mouse ESCs. (B) Transformed cells were treated with FLP-FRT recombinase and PCR was used to verify lacZ cassette excision. (C) Clones from confirmed FRT-excised alleles were used to generate Dhddsflx/flx- mice. (D) Pups carrying the Dhdds floxed allele were identified by coat appearance. ### 3.2. Validation of Retinal Cell Type-Specific Cre-Expressing Mouse Lines To assess the specificity and efficiency of the Cre recombinase in the RPE, we cross-bred transgenic mice expressing Cre recombinase (bred to homozygosity) with a ZsGreen Ai6 reporter mouse line, and then evaluated ZsGreen expression in the retina by confocal fluorescence microscopy. As expected, WT mouse retinas (a negative control) did not exhibit ZsGreen expression (Figure 2A). However, ZsGreen fluorescence was detected in Cre recombinase-positive mice specifically in the RPE layer by 1 postnatal (PN) month (Figure 2B), with >90% of the RPE cells being labeled. We subsequently confirmed that Cre recombinase continued to be expressed robustly and specifically in the RPE for >3 months (data not shown). Figure 2. Cre recombinase-dependent ZsGreen expression (green) in mouse retina. (A) Retina from a postnatal (PN) one-month old CreRPE × ZsGreen reporter mouse, demonstrating ZsGreen expression specifically in retinal pigment epithelium (RPE) cells. (B) Retina from an age-matched, wild type (WT) mouse retina, demonstrating lack of ZsGreen expression. Nuclei counterstained with DAPI (blue). Abbreviations: IS, photoreceptor inner segmen<sup>t</sup> layer; OS, photoreceptor outer segmen<sup>t</sup> layer; ONL, outer nuclear layer; OPL, outer plexiform layer. Scale bars (both panels): 20 μm. 3.3. RPE-Specific Ablation of Dhdds Causes a Geographic Atrophy-Like Phenotype and Retinal Degeneration, Involving Photoreceptors In vivo retinal imaging using SD-OCT (Figure 3) showed comparable normal layer stratification in WT, CreRPE and Dhdds+/flx CreRPE age-matched mice in each group. However, Dhddsflx/flx CreRPE mice showed altered hyper-reflectivity at all ages (indicated by red arrows, Figure 3), indicative of pathologic changes and a reduction in outer retinal layer thickness. Figure 3. SD-OCT revealed structural changes in Dhddsflx/flx CreRPE mice at all ages. OCT scans were performed at 1, 2, and 3 months (m) postnatal for each genotype. (A) WT, (B) CreRPE, (C) Dhdds+/flx CreRPE all showed normal layer stratification. (D) Dhddsflx/flx CreRPE showed alterations of hyper-reflectivity at all ages, indicative of pathologic changes (red arrows) and reduction in layer thickness, particularly in the outer retina. IPL, inner plexiform layer, ROS, rod outer segment. Scale bar (shown in WT 1 m panel): 50 μm, applies to all panels. "Spidergram" plots of average thickness values (in mm) vs. retinal eccentricity (distance from the optic nerve head (ONH) along with vertical meridian) for the outer nuclear layer (ONL) and FRT are shown in Figure 4. No significant differences were observed when comparing WT, heterozygous, or Cre-only mice for both ONL and FRT measurements. However, Dhddsflx/flx CreRPE mice showed a significant reduction (vs. WT) in ONL and F.R.T. values at all ages analyzed (n ≥ 4, all p < 0.001). Histologically, at PN 3 months, light micrograph images revealed that all retina layers in mice lacking Cre expression appeared normal (Figure 5A and Supplementary Materials, Figure S1A). In contrast, the age-matched Dhddsflx/flx Cre RPE mice displayed a geographic atrophy-like RPE appearance with the most degeneration observed mid-centrally throughout the retina (Supplementary Materials, Figure S1B). There were regions of well-preserved Dhddsflx/flx Cre RPE retina that showed severe RPE pathology (Figure 5B). Notably, the descent of the external limiting membrane (ELM) [25] towards Bruch's membrane was also observed (Figure 5C,E). There was a near-total loss of photoreceptors and RPE within the most affected regions (Figure 5D). Very well-preserved regions were also observed in the periphery (Figure 5F). Figure 4. Quantitative morphometric analysis of WT, CreRPE, Dhdds+/flx CreRPE, and Dhddsflx/flx CreRPE mice SD-OCT data. Average OCT measurements at each eccentricity revealed no significant differences when comparing WT, CreRPE and Dhdds+/flx CreRPE mice for both outer nuclear layer (ONL) and F.R.T. thickness measurements (n = 4 for all genotypes, except for WT at one month (1 m; n = 8) and two months (2 m; n = 5). However, significant changes were observed when comparing WT and Dhddsflx/flx CreRPE mice at any age with respect to both ONL and F.R.T. values. Figure 5. Pathology observed in Dhddsflx/flx Cre RPE mouse retina. (A) Dhddsflx/flx retina without Cre expression appears normal. (B–F) Five regions of a retina from a Dhddsflx/flx CreRPE mouse expressing Cre in RPE are shown. (B,F) Relatively well-preserved peripheral retina with some photoreceptor loss, outer segmen<sup>t</sup> (OS) shortening, and differing severity of RPE pathology are shown (arrow in panel B points to severely compromised RPE. (C,E) Transition zones of severe to mild retinal pathology showing loss of photoreceptors, severe compromise of RPE and external limiting membrane (ELM) descent (arrows). (D) A more central region of the retina showing severe cell loss in both the retina and RPE. Scale bars (all panels, except F): 20 μm; scale bar, panel F: 10 μm. ROS, rod outer segments; ONL, outer nuclear layer, INL, inner nuclear layer; IPL, inner plexiform layer, GCL, ganglion cell layer. Additional pathology was revealed by higher magnification EM analysis (Figure 6, panels C–O). In contrast, Dhddsflx/flx retinas without Cre expression were indistinguishable from WT retinas (Figure 6A,B). The two areas most affected showed severe RPE dystrophy with concomitant degeneration and loss of photoreceptor cells (Figure 6C,D,F,G,J,M–O). ELM descent was apparent in areas where there was a transition from milder to more severe pathology (\* in panels D–F,J). RPE cell transmigration was apparent in the outer retina (arrows, panels G,J,O,L). Thus, compared to WT neural retina and RPE, the observed RPE anomalies including migration of nucleus and RPE melanosomes, displacement of the ELM, and shortened misshaped outer segments throughout the retina were seen in the Dhddsflx/flx CreRPE mice. Figure 6. High magnification observation of Dhddsflx/flx CreRPE retina. EM images of 3m (A,B) Dhddsflx/flx and (C–O) Dhddsflx/flx CreRPE mice. Mice homozygous for the floxed Dhdds allele (Dhddsflx/flx) are not distinguishable from WT. (A) Rod outer segments are properly aligned and all retinal layers are intact (only rod inner and outer segments and the outer nuclear layer are shown). (B) The RPE shows normal thickness and melanin distribution. (C–O) Examples of mildly and severely compromised RPE and retina in Dhddsflx/flx CreRPE mice. Severe RPE and outer retina degeneration is concentrated mid-centrally on both sides of the optic nerve head (see histology, Figure 5, and Supplementary Materials, Figure S1). Severe RPE/PR atrophy is observed in the most affected central regions (C–F,I,J,O). External limiting membrane (ELM) descent (\) towards the RPE is apparent in the transition regions from severely affected to more intact regions (D–F,J). Transmigration of RPE cellular material into the ROS space (arrows) is also seen (G,J,L,O). Extended RPE basal fenestrations (arrowheads, I) are apparent in the most affected regions (D,I). Outside of the central region of severe degeneration are regions with compromised but still apparent retinal and RPE layers (K–N). Scale bars (all panels, except I): 10 μm; panel I, 2.5 μm. To further examine the effects of Dhdds* deletion in the RPE, serial block face-scanning electron microscopy was used to examine a ~100 μ3 region of the Dhddsflx/flx retina across an area of transition from milder to more severe pathology (Supplementary Materials, Videos S1–3). In WT mice, the retina appeared normal in all layers across the entire block. Examination of two regions of the Dhddsflx/flx Cre RPE retina showed areas of severe compromise as well as areas where retinal histology was more well-preserved. Transmigration of RPE nuclei and melanosomes into the photoreceptor region (subretinal space and photoreceptor outer segmen<sup>t</sup> layer, and even deeper, into the ONL) was also apparent. ### 3.4. Altered Scotopic and Photopic ERG Amplitudes in Dhddsflx/flx CreRPE Mice Analysis by ERG (Figure 7) showed that both homozygous and heterozygous Dhddsflx/flx CreRPE mice exhibited reduced scotopic ERG a- and b-wave responses. At PN 1 month, scotopic a-wave responses (289 ± 42 μV; n = 5) were significantly reduced in Dhddsflx/flx CreRPE mice compared to WT mice (395 ± 14 μV; n = 8; p < 0.05). Scotopic b-wave responses also were reduced for both Dhdds+/flx CreRPE (772 ± 42 μV; n = 20) and Dhddsflx/flx CreRPE (479 ± 69 μV; n = 5) mice, compared to WT mice (934 ± 38 μV; n = 8; p < 0.01). At PN 2 months of age, Dhddsflx/flx CreRPE scotopic ERG a-wave (223 ± 48 μV; n = 10) and b-wave (477 ± 88 μV; n = 10) responses and Dhdds+/flx CreRPE a-wave (305 ± 19 μV; n = 10) and b-wave (557 ± 64 μV; n = 10) responses were significantly reduced compared to the WT a-wave (366 ± 10 μV; n = 15) and b-wave (935 ± 27 μV; n = 15) responses (p < 0.005 for all comparisons). At PN 3 months, scotopic a-wave amplitudes were reduced only in Dhddsflx/flx CreRPE (60 ± 48 μV; n = 6) compared to WT mice (354 ± 16 μV; n = 18; p < 0.001); b-wave responses were reduced in both Dhdds+/flx CreRPE (662 ± 88 μV; n = 6) and Dhddsflx/flx CreRPE (150 ± 105 μV; n = 6) mice compared to WT mice (914 ± 35 μV; n = 18) p < 0.05 and p < 0.01, respectively). Figure 7. Scotopic ERG analysis of WT, Dhdds+/flx CreRPE, Dhddsflx/flx CreRPE mice. Maximum responses to saturating light stimuli showed significant decreases in ( A) a-wave and (B) b-wave amplitudes for Dhdds+/flx CreRPE and Dhddsflx/flx CreRPE when compared to WT mice at 1, 2 and 3 postnatal months. Statistical significance: \* p < 0.05, \\ p < 0.01, \\\* p < 0.001. The photopic a-wave and b-wave responses (Figure 8) at PN 1 month were not di fferent when comparing WT (n = 5) and Dhdds+/flx CreRPE (n = 13) mice, however the photopic responses of Dhddsflx/flx CreRPE mice (n = 4) were significantly lower. Photopic ERG responses were significantly di fferent only for Dhdds+/flx CreRPE a-wave (29 ± 2 μV; n = 4; p < 0.01), but not b-wave, responses at PN 2 months of age. In Dhddsflx/flx CreRPE mice, b-wave (86 ± 19 μV; n = 6) amplitudes were significantly reduced (p < 0.01), compared to WT mice (n = 13), but not the a-wave responses. At PN 3 months, Dhddsflx/flx CreRPE mice exhibited significant functional impairment in the photopic a-wave (2 ± 1 μV; n = 4) and b-wave (7 ± 1 μV; n = 4) responses compared to WT a-wave (14 ± 1 μV; n = 9) and b-wave responses (144 ± 8 μV; n = 9; p < 0.001 for all comparisons). Optokinetic reflex (OKR) analysis (Supplementary Materials, Figure S3), a measure of retina-tobrain transmission (i.e., visual capacity), showed reductions in photopic (4–31%) and scotopic (8–29%) contrast sensitivity over the range of 0.031 to 0.272 c/d in PN 3-month old Dhddsflx/flx CreRPE mice (p < 0.05), compared to WT controls of the same age. However, no di fferences in spatial frequency (a measure of visual acuity) were observed between the di fferent mouse lines. This is partly evident in the OKR scotopic and photopic plots, which show a similar high-frequency cut-o ff for all three mouse lines examined. Figure 8. Photopic ERG analysis of WT, CreRPE Dhdds+/flx, CreRPE Dhddsflx/flx mice. (A) a-wave responses were significantly lower in CreRPE Dhdds-/- at 1 (n = 4) and 3 (n = 4) months postnatal compared to WT (one month (1 m), n = 5; three months (3 m), n = 9) mice. (B) Photopic b-wave amplitudes for Dhdds+/flx CreRPE mice showed no statistically significant differences when compared to WT mice at 1 (n = 13) and 2 (n = 4) postnatal months, but were reduced by 3 months (n = 4). In contrast, the responses of Dhddsflx/flx CreRPE mice (two months (2 m), n = 6) were significantly lower when compared to WT mice at all postnatal ages examined. Statistical significance: \* p < 0.05, \\ p < 0.01, \\\* p < 0.001.	doab	2025-04-07T03:56:59.508452	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 38 }
00a6a373-fd58-400b-bd1a-e87d014d5110.39	4. Discussion Studies involving genetic screening of families with autosomal recessive retinitis pigmentosa have implicated a founder missense mutation (K42E) in the gene encoding DHDDS [12,26]. DHDDS is required for N-glycosylation of proteins by adding multiple copies of isopentenyl pyrophosphate (IPP) to farnesyl pyrophosphate (FPP) to produce dehydrodolichyl diphosphate (Dedol-PP), a precursor of dolichol, which is utilized as a sugar carrier in protein glycosylation in the endoplasmic reticulum [6]. Even though the generation of isoprenoid chains is complex, involving multiple enzymes and enzyme complexes [27], only DHDDS and Nogo-B receptor are required for long-chain isoprenoid synthesis (C70-C120) [28]. Previous studies have reported that mutations in the opsin gene that abolish N-linked glycosylation cause retinal degeneration [28–30]. To understand the basis for the ocular pathology associated with DHDDS mutation, we utilized a Cre recombinase conditional knockout (Dhddsflx/flx CreRPE) driven under the control of the RPE-specific VMD2 promoter to achieve RPE-targeted excision of the loxP-modified Dhdds gene, which renders the enzyme non-functional. The VMD2 construct was originally generated to be conditional on the presence of doxycycline; however, we found that the mice displayed a phenotype in the absence of doxycycline induction. While we cannot rule out the presence of some level of doxycycline in the standard chow mouse diet, it is more likely that Cre expression was due to "leaky" expression, which bypassed doxycycline control, as confirmed in Figure 2. Since the promoters used for cell-specific targeting of Cre expression turn on after development is complete, developmental changes that would otherwise preempt retina/RPE development were not observed. The expression of Cre recombinase in the Cre lines was confirmed using a ZsGreen reporter strategy. The Dhddsflx/flx CreRPE mice exhibited about 90% coverage of Cre expression by PN 1 month (Figure 2) which persisted up to 3 months at least. We crossed the conditional Dhddsflx/flx lines with heterozygous VMD2 Cre lines to generate homozygous Dhddsflx/flx mice with RPE-specific knockout of DHDDS expression as the model for our study. In vivo imaging suggested that ONL thickness and F.R.T. were comparable between age-matched WT and Dhdds+/flx CreRPE mice, but significantly reduced in Dhddsflx/flx CreRPE mice. While the specific pathology is observed in much greater detail in the histological (light microscopy; Figure 5) and ultrastructural (electron microscopy; Figure 6) images provided, it is clear that the pathology indicated in the SD-OCT tomograms (Figure 3D) is consistent with the histological observations. This altered structural integrity of Dhddsflx/flx CreRPE retinas also corresponded to a significant decrease in a-wave and b-wave compared to age-matched WT at all flash intensities. Unexpectedly, the scotopic a- and b-waves also were reduced in Dhdds+/flx CreRPE mice, which may sugges<sup>t</sup> a functional change that occurs prior to any obvious retinal structural changes and suggests that 50% DHDDS activity is insu fficient in the RPE to maintain the required enzymatic activity level. Thus, carriers of Dhdds mutations also may develop visual defects, depending on the nature of the mutation, and other factors, such as genetic background and environment. This agrees with the rod-cone dystrophy reported in patients with autosomal recessive RP [16]. However, we cannot rule out the expression of a truncated protein that leads to a gain of function. This could explain the significant attenuation of the photoresponse in mice heterozygous for the floxed allele (Figures 7 and 8). It could also possibly explain the manifestation of the disease only in ocular tissues, if the gain of function is due to specific targeting of retina-specific protein complexes. Further experimentation will be required to sort this out. We carried out further experiments to examine the fundus of older Dhddsflx/flx CreRPE mice at 6, 8 and 10 months PN. These fundus images obtained with fluorescein angiography showed the classical signs of RP including abnormal pigmentation in 8-month old Dhddsflx/flx CreRPE mice; vascular changes, including microaneurysms, increased vessel tortuosity and attenuation, were also observed by 6 months of age (Supplementary Materials, Figure S2). Originally it was proposed that the cause of the pathology in DHDDS-related RP patients (RP59) is defective glycosylation of rod opsin because of reduced DHDDS enzyme activity [12,26]. While this assumption may explain the classic RP symptoms observed, it fails to explain the AMD-like macular involvement. Interestingly, Lam and colleagues [11] found no N-glycosylation deficiency in RP59 patients, based upon isoelectric focusing gel analysis of plasma transferrin (a systemic glycoprotein). In addition, in a related study (Rao et al., manuscript submitted for publication), utilizing a rod photoreceptor-specific knockout of Dhdds in mice, we found no evidence for a resulting lack of protein glycosylation in the retina; yet, there was a rapidly progressing photoreceptor degeneration, resulting in complete loss of photoreceptors by PN 6 weeks of age. Also, in a companion article in this Special Issue [31], we generated a mouse model harboring the global K42E homozygous Dhdds mutation associated with RP59 patients, but observed no retinal degeneration, even out to 9 postnatal months of age. Clearly, mutations that only partially diminish enzymatic activity would be far less severe than a complete ablation of the gene encoding the enzyme.	doab	2025-04-07T03:56:59.509191	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 39 }
00a6a373-fd58-400b-bd1a-e87d014d5110.40	5. Conclusions From these observations, we conclude that targeted ablation of Dhdds selectively in RPE cells results in perturbation of DHDDS-dependent processes, resulting in structural and functional deficits in both the RPE and photoreceptors, in a manner resembling geographic atrophy. The degeneration progresses relatively slowly (compared to the rod-specific Dhdds ablation model) over the course of a few months, rather than weeks. Supplementary Materials: The following are available online at http://www.mdpi.com/2073-4409/9/3/771/s1, Figure S1: Stitched images of Dhddsflx/flx and Dhddsflx/flx Cre RPE mouse retina, Figure S2: Fundus imaging and fluorescein angiography (FA), Figure S3: Contrast sensitivity and spatial frequency assessment in WT, Dhddsflx/flx, and Dhddsflx/flx Cre RPE mice, Video S1: Serial Block-Face Scanning Electron Microscopy of WT Dhddsflx/flx, Video S2: Serial Block-Face Scanning Electron Microscopy of region 1 of Dhddsflx/flx Cre RPE, Video S3: Serial Block-Face Scanning Electron Microscopy of region 2 of Dhddsflx/flx Cre RPE. Author Contributions: Conceptualization, S.J.P., S.R.R., S.J.F. and M.L.D.; methodology, S.J.D., M.L.D., S.J.F., and S.J.P.; software, S.J.P., M.L.D., and T.W.K; validation, S.J.D., M.L.D., D.S., S.R.R., and S.J.P.; data curation, M.L.D., C.N., S.R.R., S.J.F. and S.J.P.; writing—original draft preparation, M.L.D., C.N., and S.J.P.; writing—review and editing, S.J.F., S.J.P., S.R.R., M.L.D., and D.S., visualization, S.J.P., S.R.R., and S.J.F.; supervision, T.W.K., S.J.F., and S.J.P.; project administration, S.J.F. and S.J.P.; funding acquisition, S.J.P. and S.J.F. All authors have read and agreed to the published version of the manuscript. Funding: This research was supported by U.S.P.H.S. (National Institutes of Health/National Eye Institute) gran<sup>t</sup> R01 EY029341 to S.J.P. and S.J.F., support from the UAB Vision Science Research Center, and a core gran<sup>t</sup> P30 EY003039 to SJP, as well as facilities and resources provided by the VA Western NY Healthcare System (S.J.F., S.R.R.). Acknowledgments: We thank Jeffrey Messinger for expert technical assistance with light level histology and TEM, Isaac Cobb for technical assistance with some of the experiments, Amy Stablewski (Roswell Park Cancer Institute (RPCI) Gene Targeting and Transgenic Facility) for the generation of Dhddsflx/flx mice, and Yun Le (University of Oklahoma Health Sciences Center) for generously providing the CreRPE mouse line. The opinions expressed herein do not reflect those of the Department of Veteran Affairs or the U.S. Government. Conflicts of Interest: The authors declare no conflict of interest. The funders of this study had no role in the design; in the collection, analyses, or interpretation of data; in the writing of the manuscript; or in the decision to publish the results.	doab	2025-04-07T03:56:59.509521	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 40 }
00a6a373-fd58-400b-bd1a-e87d014d5110.42	Article Diurnal Rhythmicity of Autophagy Is Impaired in the Diabetic Retina Xiaoping Qi 1, Sayak K. Mitter 1, Yuanqing Yan 2, Julia V. Busik 3, Maria B. Grant 1 and Michael E. Boulton 1,\* Received: 1 March 2020; Accepted: 2 April 2020; Published: 7 April 2020 Abstract: Retinal homeostasis is under both diurnal and circadian regulation. We sought to investigate the diurnal expression of autophagy proteins in normal rodent retina and to determine if this is impaired in diabetic retinopathy. C57BL/6J mice and Bio-Breeding Zucker (BBZ) rats were maintained under a 12h/12h light/dark cycle and eyes, enucleated over a 24 h period. Eyes were also collected from diabetic mice with two or nine-months duration of type 1 diabetes (T1D) and Bio-Breeding Zucker diabetic rat (BBZDR/wor rats with 4-months duration of type 2 diabetes (T2D). Immunohistochemistry was performed for the autophagy proteins Atg7, Atg9, LC3 and Beclin1. These autophagy proteins (Atgs) were abundantly expressed in neural retina and endothelial cells in both mice and rats. A di fferential staining pattern was observed across the retinas which demonstrated a distinctive diurnal rhythmicity. All Atgs showed localization to retinal blood vessels with Atg7 being the most highly expressed. Analysis of the immunostaining demonstrated distinctive diurnal rhythmicity, of which Atg9 and LC3 shared a biphasic expression cycle with the highest level at 8:15 am and 8:15 pm. In contrast, Beclin1 revealed a 24-h cycle with the highest level observed at midnight. Atg7 was also on a 24-h cycle with peak expression at 8:15 am, coinciding with the first peak expression of Atg9 and LC3. In diabetic animals, there was a dramatic reduction in all four Atgs and the distinctive diurnal rhythmicity of these autophagy proteins was significantly impaired and phase shifted in both T1D and T2D animals. Restoration of diurnal rhythmicity and facilitation of autophagy protein expression may provide new treatment strategies for diabetic retinopathy. Keywords: diurnal rhythm; autophagy; retina; diabetes; diabetic retinopathy	doab	2025-04-07T03:56:59.509710	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 42 }
00a6a373-fd58-400b-bd1a-e87d014d5110.43	1. Introduction Macroautophagy (hereafter referred to as autophagy) is an evolutionarily conserved cellular catabolic mechanism that facilitates the degradation of damaged cellular organelles and proteins, by targeting them to the lysosomes and recycling the macromolecules for the rebuilding of cellular machinery [??? ]. Autophagy undergoes rhythmic variation in accordance with circadian patterns of rest/activity and feeding in adult mammals [? ]. Dysregulated autophagy has been implicated in several neurodegenerative disorders, hepatitis, cancer, aging associated diseases and in the general aging process [????? ]. Recently, a growing body of evidence indicates that dysregulated autophagy is also linked to diabetes [???? ]. The disruption of circadian rhythm has a profound negative impact on health and is associated with elevated risk for several diseases [? ]. The physiological relevance of an altered circadian rhythm in diabetes is evidenced by the observation of a high incidence of myocardial dysfunction, acute coronary syndrome, sudden cardiac death, and ischemic stroke in diabetics during the night, compared to a higher frequency during the day in non-diabetics [???? ]. In diabetic conditions, Bmal1 and Clock are inactivated, causing deregulated glucose homeostasis and suppressed diurnal variation in glucose and triglycerides, along with reduced gluconeogenesis [? ]. Streptozotocin (STZ)-induced type 1 diabetes (T1D) in mice exhibits altered phase of the circadian clock in the heart [? ] and a significant reduction of circadian sensitivity to low-intensity light in the retina [? ]. Furthermore, STZ-mice develop a deficiency in their ability to re-entrain the circadian rhythm when subjected to a phase advance of the 12L/12D cycle [? ]. Bio-Breeding Zucker diabetic rat (BBZDR/Wor) and Goto-Kakizaki rat type 2 diabetes (T2D) models also show impairment of the molecular clock, suggesting that the disruption of the circadian clock is a common phenomenon in both T1D and T2D [? ? ]. Several hallmarks of diabetic retinopathy can be recapitulated in rodent retina deficient of clock genes [? ? ]. Reduced tube formation and increased senescence of endothelial cells coupled with impaired progenitor-mediated repair is observed in Per2 mutant mice, emphasizing the importance of the circadian clock in retinal homeostasis [? ]. Recent studies on autophagy in the retina have shed light on the association of key molecules of the autophagic pathway with phagocytosis of photoreceptor outer segments (POS) by the retinal pigmented epithelium (RPE) [? ? ]. Photoreceptor disk shedding has been widely reported to exhibit diurnal rhythmicity in the retina [? ? ] and the tight coupling of phagocytic ingestion and autophagic degradation of the POS to this diurnal rhythm is a critical aspect of retinal homeostasis [? ? ]. The role of the peripheral clock and diurnal variation on the regulation of autophagy in the normal and diabetic rodent retinas and the fate of autophagy in the diabetic retina remain unexplored. Understanding these control mechanisms may help find e ffective treatments for diabetic retinopathy. In this study, we demonstrate that the spatial distribution and temporal expression of autophagy proteins show a diurnal rhythm and that this is depressed and phase shifted in the diabetic retina.	doab	2025-04-07T03:56:59.509853	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 43 }
00a6a373-fd58-400b-bd1a-e87d014d5110.45	2.1. Experimental Animals All animal procedures were performed in accordance with a) protocols approved by the Institutional Animal Care and Use Committees at University of Florida, Gainesville, FL, USA (#CR-201106001), Michigan State University, Lansing, MI, USA (#Busik09/14-160-00, and Indiana University, Indianapolis, IN, USA (#10574 MD/R), b, the National Institutes of Health Guide for Care and Use of Laboratory Animals and c) the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Male C57BL/6J mice were purchased from Jackson Labs at 6 weeks of age and male BBZDR/wor T2D rats and lean heterozygote nondiabetic control littermates were obtained from biomedical research models (BRM, Inc.) Worcester, Massachusetts at 5 months of age. C57BL/6J mice (n = 240) and BBZ rats (n = 75) were maintained on a standard 12/12 h light/dark cycle (6.00 am lights on/6.00 pm lights o ff). T1D was induced in eight-week-old C57BL/6 mice (n = 120) by five consecutive intraperitoneal injection of freshly prepared streptozotocin (STZ) solution with the concentration of 40mg/kg body weight in 0.1M/citrate bu ffer, pH 4.5 as previously described [? ? ]. The control group received sodium citrate bu ffer (vehicle) alone. Diabetes was confirmed by two consecutive blood glucose levels >240 mg/dl, using the AlphaTrak ® blood glucose monitor and test strip system (Abbot laboratories, Irvine, CA, USA), according to the manufacturer's instruction. No animal used in this study required insulin injections. Eyes from one group were collected at 2 months following establishment of diabetes and the second cohort 9 months after diabetes induction (the age of the animals at these time points being 4 and 11 months, respectively). We also investigated inbred Bio-Breeding Zucker (BBZDR)/wor T2D rats (n = 37) and age-matched controls (n = 38) [? ]. BBZDR/wor rats spontaneously became diabetic at ~10 weeks of age and were maintained for 4 months after the onset of diabetes. A second group of C57BL/6J mice (n = 24) were dark adapted for 48 h before sacrifice and referred to as being on the dark/dark cycle. In all groups, animals were euthanized by deep anesthesia with isoflurane followed by cervical dislocation and eyes were immediately enucleated every 2 or 3 h over a 24 h period and prepared for immunofluorescence staining. For animals in the dark cycle, euthanasia and enucleation were performed in a dark room under a red safe light. For each set of experiments, all animals were started at the same time point to clearly identify any phase shift in peak or trough of ATG expression. The number of biological replicates of the enucleated eyes at each time point is n = 10 for mice and n = 3 for rats. Only one eye from each animal was used in the assessment.	doab	2025-04-07T03:56:59.510076	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 45 }
00a6a373-fd58-400b-bd1a-e87d014d5110.46	2.2. Immunofluorescence Microscopy Eyes were processed for standard para ffin embedding and 4 μm sections were prepared. Rodent Decloaker (Biocare Medical LLC, Concord, CA, USA Catalog# RD913L) was used to unmask antigens and non-specific binding was blocked with 10% normal goa<sup>t</sup> sera and 5% BSA for 1 h at room temperature. Sections received either mouse monoclonal anti-Beclin1 (BD Transduction Lab, San Jose, CA, USA, Cat#612112), or rabbit polyclonal antibodies against Atg7, Atg9 and LC3 (provided by Dr. Dunn, Department of Anatomy and Cell Biology, University of Florida, Gainesville, FL, USA), diluted in phosphate bu ffered saline (PBS) with 1% normal goa<sup>t</sup> sera plus 1% bovine serum albumin (BSA) (Beclin1 1:20; Atg7- 1:300; Atg9 and LC3 - 1:100). After washing, sections were incubated with an appropriate FITC-conjugated secondary antibody for 1 h. In some sections, colocalization of autophagy proteins within the retinal vasculature was confirmed by dual staining with the endothelial cell marker, TRITC-agglutinin (Vector Labs, Burlingame, CA, USA, Cat#RCA120). Sections were covered with Vectashield mounting medium/DAPI (Vector Labs, Inc.). Sections were viewed using a Zeiss Axioplan 2 Upright Fluorescence Microscope with Qimage/QCapture software Version 8 (QImaging Corporate, Surrey, British Columbia, Canada). Omission of the primary antibody was the baseline control and all the fluorescence photographs were obtained under the same scaled conditions.	doab	2025-04-07T03:56:59.510278	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 46 }
00a6a373-fd58-400b-bd1a-e87d014d5110.47	2.3. Grading of Immunostaining Three independent masked observers, using a previously described grading system [? ? ], graded the intensity of the immunoreactivity for each antibody in transverse retinal sections. The intensity of labeling was graded qualitatively as: 10, strong bright intense immunoreactivity, 9, bright intense; 8, uniformly intense; 7, patchy and intense; 6, uniform and moderate; 5, patchy and moderate; 4, uniform and weak; 3, patchy and weak; 2, uniform and very weak; 1, patchy and very weak; and 0, none. A mean score ±SEM for each group was determined from the scores of all graders for each retina structure. ### 2.4. Trypsin Digestion and the Detection of Superoxide The retinal vasculature was prepared as previously described [? ]. Briefly, mouse eyes were fixed overnight in 4% paraformaldehyde, freshly made in PBS. The retinas were dissected from the eye cups, kept in water overnight, and digested in 3% trypsin (Invitrogen-Gibco, Grand Island, NY, USA) for 3 h at 37 ◦Celcius. The tissue was mounted carefully on a glass slide under a dissection microscope. The tissue was stained with PAS-H&E (periodic acid Schi ff–hematoxylin and eosin; Gill No.3; Sigma-Aldrich), according to the instruction manual. The images were taken using a Zeiss light microscope equipped with a digital camera (AxioCam MRC5, Axiovert 200; Carl Zeiss Meditec, Inc., Dublin, CA, USA), using 20X objective lenses. Eight to ten representative fields from each quadrant of the retina were imaged and the number of acellular capillaries per square millimeter of retina were quantified. For detecting the reactive oxygen species (ROS), the superoxide indicator, hydroethidine, was used to detect the production of superoxide radicals, as previously described [? ]. Superoxide oxidizes hydroethidine to yield a red fluorescent signal at approximately 600 nm. Mice received two intraperitoneal injections, 15 min apart, of freshly prepared hydroethidine (20 mg/kg; Invitrogen) and were euthanized 18 h after injection. The fluorescence intensity was measured in the neural retina using a fluorescent plate reader (BioTek, Winooski, VT, USA) and a spectrofluorometer (FLUOstar Optima; BMG Labtechnologies, Cary, NC, USA). The relative fluorescence intensity was calculated by normalizing to protein concentration.	doab	2025-04-07T03:56:59.510388	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 47 }
00a6a373-fd58-400b-bd1a-e87d014d5110.48	2.5. Statistical Analysis The diurnal data are time series data, and single cosine analysis was employed to fit the data. The data was considered as diurnal oscillation by a zero-amplitude test, with a p-value less than 0.05. All experiments were assessed by comparing two groups mean scores from control animals and diabetic animals using a Student's t-test, plus ANOVA for multiple comparisons by using Prism® statistical software ver. 5 (GraphPad, La Jolla, CA, USA) with differences of p value < 0.05 were considered statistically significant. Results are expressed as mean ± SEM.	doab	2025-04-07T03:56:59.510550	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 48 }
00a6a373-fd58-400b-bd1a-e87d014d5110.49	3. Results ### 3.1. Autophagy Proteins Exhibit Diurnal Expression/Localization in Normal Mouse Neural Retina To determine if autophagic protein expression in the neural retina had an intrinsic diurnal rhythm, we assessed the expression and localization of four autophagy proteins, Atg7, LC3, Atg9 and Beclin1 in the normal retinas of young mice (age = 3 months) that were maintained under standard 12 h light/12 h dark conditions. When we examined the tissue at two-hour intervals over a 24 h period, these proteins exhibited not only a distinct diurnal rhythm, but remarkably showed distinct staining patterns across the layers of the neural retina in mice (????). Atg9 and LC3 exhibited a biphasic 12/12 h circadian cycle with zenith at 8:15 AM and 8:15 PM and nadir at 2:15 AM and 2:15 PM (p < 0.05) (Figure ??A–D). By contrast, Atg7 and Beclin1 expression showed a monophasic rhythm and the overall expression of these proteins was much lower than either Atg9 or LC3 (Figure ??E–H). The expression of Atg7 started to rise at 4:15 AM, peaked at 8:15 AM and gradually decreased until 10:15 AM (p < 0.05) (Figure ??E–G). Beclin1 expression was highest at around midnight and reached lowest levels at midday (p < 0.05) (Figure ??F–H). Omission of the primary antibody showed no staining in mouse retina (Figure ??D). An assessment of the staining pattern of the proteins at zenith revealed that Atg9 and LC3 were localized throughout the retina, predominantly within the retinal ganglion cell (RGC) layer, inner (INL) and outer nuclear layer (ONL) (Figure ??A,B). Atg7 was only weakly localized to the neural retina in both the inner and outer nuclear layers and showed stronger localization in the photoreceptor outer segment. Beclin1 staining was detected throughout the retina, with highest intensity in the inner and outer plexiform layers and in the photoreceptors. Closer observation of the retina revealed that ATG7 and 9 showed remarkably strong association within the inner retinal vasculature (Figure ??C). Using dual staining for endothelial cells and autophagy proteins, we confirmed that Atg9, LC3, Atg7 and Beclin1 were all expressed in both the inner and outer retinal plexus of the retinal vasculature (Figure ??C). Figure 1. Autophagy proteins exhibited diurnal expression/localization in normal mouse neural retina. Retina were harvested every 2 h over a 24 h time period. Antibodies for autophagy proteins (ATGs) ATG9, Microtubule-associated protein 1A/1B-light chain 3 (LC3), ATG7 and Beclin1 (BECN) were used to detect respective protein expression (green) in the retina, Tetramethylrhodamine (TRITC) agglutinin for vessels (red) and DAPI (blue) shows nuclear staining. Distinct diurnal rhythmic patterns of the autophagic proteins Atg9 and LC3 expressions (A,B) revealed a biphasic diurnal cycle (12/12 h), with peaks at 8:15 AM and 8:15 PM and lowest levels at 2:15 AM and 2:15 PM (C,D). Atg7 and Beclin1 (BECN) expressions (E,F) were on a monophasic 24 h cycle. Atg7 expression peaked at 8:15 AM and lowest levels were at 10:15 AM. The peak of Beclin1 expression was at midnight and lowest levels were observed during the late morning (H). All animals were maintained in a standard 12/12 h light/dark phase with lights ON at 6:00 AM and lights OFF at 6:00 PM. The error bars in the diurnal plots represent the mean+SEM and diurnal oscillation had a p-value less than 0.05. Figure 2. Localization of autophagy proteins in normal mouse retina and vasculature. Animals were kept in tight 12/12-h light/dark cycle before the experiment. Antibodies for ATG9, LC3, ATG7 and Beclin1 (BECN) were used to detect respective protein expression (green) in the retinas with different staining patterns and DAPI was used to stain nuclei (blue) (A). Agglutinin, an endothelial cell marker, conjugated with TRITC (red) was used to co-localize with antibodies specific to individual autophagy proteins (FITC) in the retinal vasculature (B). High magnification images demonstrated autophagy protein localization to the endothelial cells and pericytes of the retinal vasculature (C). No fluorescence was observed with omission of the primary antibody in the mouse retina. Using agglutinin staining, the section displayed retinal vascular patterns with normal architecture (D). Omitted autophagy primary antibody in rat retina also was negative (E). The arrows indicate autophagy protein localization to retinal vessels. RGC, retina ganglion cell; IPL, inner plexiform layer; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer; IS, inner segment; OS, outer segment; RPE, retinal pigment epithelium. ### 3.2. Autophagic Activity in the Retina Is Tightly Entrained by Light We repeated immunohistochemistry of ATG9, ATG7, LC3 and Beclin1 in the retina (and the retinal vasculature) of 48 h dark adapted mice and compared the results to those of 12/12 h light/dark adapted mice. The immunohistochemistry data indicated that the periodic oscillations, as well as overall levels of the autophagic proteins ATG9 and LC3, were attenuated in the 48 h dark adapted mice retina when compared to the 12/12 h dark/dark controls, both in the retina and the vasculature (Figure ??A). Similarly, peaks in Atg7 and Beclin1 were phase shifted compared to the light/dark controls and overall expression levels were reduced (Figure ??B). We concluded that diurnal oscillations in autophagic activity in the murine retina depend, at least in part, on light-effected entrainment. Figure 3. Immunohistochemistry confirmed alterations in diurnal patterns of autophagic gene expression upon light cycle disruption. Mice were separated into two groups. One group was kept under 12/12-h light/dark cycle and the other group was kept in the dark for 48-h (dark/dark), before being euthanized. Samples were collected every 3 h for 24 h and were analyzed by immunohistochemistry for autophagic markers ( A) ATG9 (B) LC3 ( C) ATG7 and ( D) Beclin1 (BECN). Autophagy protein expression is green, TRITC agglutinin for vessels red and DAPI nuclear staining blue. The arrows indicate autophagy protein localization to retinal vessels. RGC, retina ganglion cell; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer; RPE, retinal pigment epithelium. The error bars in the circadian plots represent the mean + SEM and diurnal oscillation had a p-value less than 0.05. ### 3.3. Diurnal Rhythmicity of Expression of Autophagic Proteins Is Dampened in T1D Having established that autophagy in the retina possesses a diurnal rhythm, we next examined the rhythmicity of autophagy proteins in T1D. We chose mice from 2- and 9-months duration of diabetes to assess the expression of autophagic proteins. To confirm that our T1D mice exhibited the expected retinopathy features [? ? ], we performed trypsin-digests of the retina from nondiabetic C57BL/6J (Figure ??A, left) and T1D (Figure ??A, right). T1D mice exhibited an increase in the number of acellular capillaries per unit area. Quantitative measurements of acellular capillaries suggested a dramatic 4-fold increase, in contrast to the age-matched nondiabetic mouse of retinas that showed a normal vascular pattern (Figure ??B). These eyes showed significantly higher levels of superoxide anions in the neural retina, typical of retinopathy in this model (Figure ??C). Figure 4. Evaluation of acellular capillary formation and superoxide anion generation in T1D mice. Representative images of trypsin-digested retinal vascular preparations from 4-month old control mice and 4-month old mice with 2-month duration of T1D ( A) The arrow indicates an acellular capillary. Quantitative measurement of acellular capillaries was significantly increased in diabetic eyes (n = 6). (B) STZ-induced diabetic retina showed >1.5 fold increase in superoxide anion levels, p < 0.01 ( C) The errors bars represent SEM. While immunohistochemistry results from 4-month old normal control mice corresponded with the respective results shown in ????, we observed a dramatic attenuation of diurnal rhythmicity (amplitudes), as well as overall levels of the autophagic proteins in the T1D mice retina (Figure ??). This loss of amplitude was noted for ATG9, LC3 and Beclin1 expression in the diabetic retina, in either duration of diabetes group when compared to the respective age-matched controls (????). ATG7 exhibited a shift in phase in both the retina and the vasculature of mice with 2-month duration of diabetes while in mice with 9-months duration of diabetes the phase-shift was prominent in the retina and there was no significant variation in expression between time-points in the retinal vasculature (Figures ??B and ??B). Figure 5. Impairment of diurnal rhythmicity of autophagy in T1D mice with two-months duration of diabetes. Retinas were collected from C57Bl/6J mice with two-months duration of T1D and age-matched control mice. Immunostaining and intensity analyses of retina and retinal vasculature demonstrated a dramatic loss of oscillatory amplitude of autophagic protein expression in the diabetic animals compared to normal mice (A,B). Autophagy protein expression is green, TRITC agglutinin for vessels red and DAPI nuclear staining blue. The arrows indicate autophagy protein localization to retinal vessels. RGC, retina ganglion cell; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer; RPE, retinal pigment epithelium. Loss and phase-shifting of diurnal rhythmicity in diabetic retinopathy is demonstrated in single cosine plots, with ordinary least square fitted (p < 0.01, n = 10). All animals were maintained in a standard 12/12-h light/dark phase with lights ON at 6:00 AM and lights OFF at 6:00 PM. The error bars in the circadian plots represent the mean+SEM and diurnal oscillation had a p-value less than 0.05. Figure 6. Impairment of diurnal rhythmicity of autophagy in T1D mice with nine-months duration of diabetes. Retinas were collected from C57Bl/6J mice with nine-months duration of T1D and age-matched control mice. Immunostaining and intensity analyses of retina and retinal vasculature demonstrated a dramatic loss of oscillatory amplitude of autophagic protein expression in the diabetic animals compared to normal mice (A.B). Autophagy protein expression is green, TRITC agglutinin for vessels red and DAPI nuclear staining blue. The arrows indicate autophagy protein localization to retinal vessels. RGC, retina ganglion cell; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer; RPE, retinal pigment epithelium. Loss and phase-shifting of diurnal rhythmicity in diabetic retinopathy is demonstrated in single cosine plot with ordinary least square fitted (p < 0.01, n = 10). All animals were maintained in a standard 12/12-h light/dark phase with lights ON at 6:00 AM and lights OFF at 6:00 PM. The error bars in the circadian plots represent the mean+SEM and diurnal oscillation had a p-value less than 0.05. ### 3.4. Autophagy Proteins Were Suppressed Severely in T2D Rats We next examined autophagy in the retina of T2D rats following 4-months duration of diabetes (Figure ??). The normal age-matched rats selected as controls demonstrated a similar staining pattern of immunohistochemistry across the retina as were observed in normal mice (Figure ??A–D). Atg9 (Figure ??A) and LC3 (Figure ??B) were mainly present in the ganglion cell layer, inner and outer nuclear layers in the normal rat retina, similar to what was observed in normal mice (Figure ??) but their expression was dramatically decreased in the retinas of the diabetic animals by 49% to 58%, respectively. For better demonstration of changes in autophagic protein levels in the vasculature of diabetic retinas, we showed higher magnification images. Both Atg9 and LC3 clearly distributed within the retinal endothelia of normal rats but were completely absent from the endothelia of the diabetic retinas (Figure ??E,F). Atg7 was strongly expressed in normal retinal vessels near the ganglion cells layer, meanwhile the small vessels in inner and outer plexus layers were also stained (Figure ??C). Semi-quantitative analysis revealed that the level of Atg7 was deceased by 52%, p < 0.05 in diabetic retinas. Diabetic retina also displayed pathologic changes in retina vessels, which appeared to be abnormally protruded toward the intravitreous cavity. Beclin1 staining was detected across the retina, including retinal vessels in the plexus and photoreceptors, however, Beclin1 staining was diminished in diabetic retinas by 53%, p < 0.01 (Figure ??D). Quantitative analyses of autophagic proteins in the retina of control and diabetic mice demonstrated, not only suppressed levels, but also revealed impairment in diurnal rhythmicity in T2D rats. Expression of Atg9 and LC3 were severely suppressed with insignificant biphasic oscillatory pattern and ATG7 and Beclin1 were phase-shifted by approximately for 4–6 h. We concluded that disruption in autophagy is a characteristic phenomenon of both T1D and T2D. Figure 7. Impairment of diurnal rhythmicity of autophagy in T2D rats. Eyes were collected from 6.5-month old BBZDR/wor type 2 diabetic rats with 4-month duration of diabetes and the normal age-matched rats selected as controls. Immunostaining demonstrated a dramatic decrease in amplitude of diurnal rhythmicity of autophagic protein expression in the retina of the diabetic animals compared to normal rats. Representative micrographs of immunostained sections at 8:15 am are shown for (A) ATG9, (B) LC3 (C) ATG7 (D) Beclin1 (BECN). Autophagy protein expression is green, TRITC agglutinin for vessels red and DAPI nuclear staining blue. The arrows indicate autophagy protein localization to retinal vessels. RGC, retina ganglion cell; INL, inner nuclear layer; OPL, outer plexiform layer; ONL, outer nuclear layer; RPE, retinal pigment epithelium. ATG7 and Beclin1 displayed phase-shifting in the diurnal oscillation (C) and (D) respectively. Loss and phase-shifting of diurnal rhythmicity in diabetic retinopathy is demonstrated in single cosine plot with ordinary least square fitted (p < 0.01, n = 10). High magnification images confirmed the loss of autophagy proteins ATG9 and LC3 in the retinal vasculature (E). All animals were maintained in a standard 12/12-h light/dark phase with lights ON at 6:00 AM and lights OFF at 6:00 PM. The error bars in the circadian plots represent the mean + SEM and diurnal oscillation had a p-value less than 0.05.	doab	2025-04-07T03:56:59.510609	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 49 }
00a6a373-fd58-400b-bd1a-e87d014d5110.50	4. Discussion Autophagy is a critical and indispensable housekeeping process in the cells of the retina. Numerous reports support the functional relevance of autophagy in specific cells of the retina and how dysregulated autophagy contributes to retinal malfunction and degeneration [?????? ]. While acute short-term noxious stimuli (e.g., nutrient deprivation; hypoxia and endoplasmic reticulum (ER) stress; oxidative stress arising from light, lipofuscin, POS phagocytosis by RPE or mitochondrial ROS generated in retinal cells (which have a generally high metabolic rate)) can stimulate autophagy as a generally cytoprotective mechanism, it must be acknowledged that diurnal basal autophagic modulation is a critical factor in abrogating the unavoidable regular cellular damage that occurs during the basic functioning of retinal cells. An efficient regulatory molecular circuit is required in the retina, that would modulate both the intensity and duration of basal autophagic activity in specific cell types and thus meet their regular housekeeping demands [? ]. Previous studies have suggested the existence of autophagic rhythm in rodent heart muscles and liver, as well as kidney proximal tubules [??? ]. In this study, we establish the existence of diurnal regulation of autophagic activity, in both the neural and vascular cells of the retina. We show evidence that certain autophagic markers like Beclin1, ATG9 and LC3 are highly expressed across the retina, while ATG7 shows preferential staining patterns and is enriched only in certain layers (????). The first report on diurnal rhythmicity in autophagy in the retina recorded increased autophagosome formation following outer disk shedding in rat photoreceptors [? ]. Our results regarding the biphasic oscillation of diurnal rhythmicity of LC3 expression agree with the findings in a report by Yao et al. 2014, who also observed two peaks of elevated autophagic activity [? ]. Our results in Figure ?? make a strong argumen<sup>t</sup> in favor of the influence of external stimuli such as light for the entrainment and maintenance of healthy amplitudes of oscillation of autophagic protein expression in the retina. However, we observed that even in the absence of light entrainment, the retina continued to display rhythmicity in ATG7, ATG9, LC3 and BECN, but were lower in amplitude and out of phase, suggesting that there may be an intrinsic diurnal rhythm of autophagy in the retina not dependent on light entrainment. Our study encompasses autophagy in aging and diabetic conditions. We successfully demonstrate that perturbed autophagy is a characteristic feature of aging. It has been suggested that macroautophagy suffers a decline with aging and is replaced partly by other forms of autophagy [? ]. It remains to be determined if other forms of autophagy i.e., the chaperone mediated autophagy and microautophagy are also under regulation by the circadian system and, if so, whether their rhythmicity is affected in aging and disease. In addition to the above, our study reveals that the level of disruption in T1D and T2D is significant, not only in younger mice, but also in older animals (????). Compared to age-matched control mouse retinas, the dramatic deviations in the oscillatory patterns or the overall levels of one or more Atgs in both two- and nine-month old diabetic mouse retina could be an indication of faulty housekeeping and pathological outcomes, such as the accumulation of damaged mitochondria and ROS production [???? ]. A limitation of this study is that it relies on immunohistochemistry to determine changes in the expression of autophagy proteins throughout the neural retina. We did not attempt to confirm our findings by assessing gene expression or protein levels using Western blot. Neither did we assess autophagic flux by determining the LC3II:LC3I ratio. The reasons for this were a combination of the large number of animals needed; regional/cell-specific changes would be masked in whole retinal preps and the non-canonical role of LC3 in retinal and immune cell phagocytosis [? ] could complicate the analysis of the autophagic flux. Furthermore, based on our data, there is a need to determine the mechanistic link between diurnal changes and autophagy in the neural retina. There is considerable evidence that diurnal/circadian rhythm is associated with the induction of autophagy [? ? ], a key regulator of autophagy; the mechanistic target of rapamycin (mTOR) is regulated by the circadian clock [? ] and the circadian regulation of metabolism is mediated through reciprocal signaling between the clock and metabolic regulatory networks such as autophagy [? ]. Recently, Ryzhikov and colleagues reported that diurnal rhythms spatially and temporarily organize autophagy [? ]. They reported that basal autophagy rhythms could be resolved into two antiphase clusters that were distinguished by the subcellular location of targeted proteins. Daytime autophagy was directed towards cytosolic proteins and proteosomal degradation, while nighttime autophagy was directed towards ER and mitochondrial removal. There is now a need to better understand the mechanistic control of these processes. As mentioned above, autophagy in diabetes and related diseases has become an area of intense research, with focus on how this pathway may be targeted in synergy, with other therapeutic approaches to encourage a better clinical outcome. Our study, along with other recent reports, adds a novel extension to the mammalian diurnal rhythmicity in its relevance in regulation of biological processes. It provides a novel link between dysregulated autophagy and disrupted diurnal rhythm in the aging and diabetic retina and suggests that our analyses of myriad biological processes in the retina should be reconsidered from a diurnal perspective, in order to better comprehend age-related vision loss and disease pathology. Author Contributions: Conceptualization, M.E.B., M.B.G. and J.V.B; Data curation, X.Q., S.K.M; Formal analysis, X.Q., Y.Y.; Investigation, X.Q., S.K.M., M.E.B. Resources, M.E.B., J.V.B., M.B.G.; Project administration: M.E.B., J.V.B., M.B.G. Writing—original draft preparation, X.Q., M.E.B.; Writing—review and editing, X.Q., S.K.M., Y.Y., J.V.B., M.B.G., M.E.B. All authors have read and agreed to the published version of the manuscript. Funding: M.E.B. is supported by NIH funding (EY019688, EY021626) and an unrestricted gran<sup>t</sup> from Research to Prevent Blindness. J.V.B. is supported by NIH funding (EY01EY028049, R01EY016077; R01EY025383). Acknowledgments: The animal experiments were performed over a period of time when MEB, MBG, XQ and SKM were at University of Florida and then Indiana University, before moving to UAB. All data were analyzed at UAB. Conflicts of Interest: The authors declare no conflict of interest.	doab	2025-04-07T03:56:59.511361	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 50 }
00a6a373-fd58-400b-bd1a-e87d014d5110.52	Innate and Autoimmunity in the Pathogenesis of Inherited Retinal Dystrophy T. J. Hollingsworth 1,2 and Alecia K. Gross 2,3,\* Received: 28 January 2020; Accepted: 3 March 2020; Published: 5 March 2020 Abstract: Inherited retinal dystrophies (RDs) are heterogenous in many aspects including genes involved, age of onset, rate of progression, and treatments. While RDs are caused by a plethora of different mutations, all result in the same outcome of blindness. While treatments, both gene therapy-based and drug-based, have been developed to slow or halt disease progression and prevent further blindness, only a small handful of the forms of RDs have treatments available, which are primarily for recessively inherited forms. Using immunohistochemical methods coupled with electroretinography, optical coherence tomography, and fluorescein angiography, we show that in rhodopsin mutant mice, the involvement of both the innate and the autoimmune systems could be a strong contributing factor in disease progression and pathogenesis. Herein, we show that monocytic phagocytosis and inflammatory cytokine release along with protein citrullination, a major player in forms of autoimmunity, work to enhance the progression of RD associated with a rhodopsin mutation. Keywords: retinal degeneration; immunity; autoimmunity; rhodopsin; citrullination; retinitis pigmentosa	doab	2025-04-07T03:56:59.511850	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 52 }
00a6a373-fd58-400b-bd1a-e87d014d5110.53	1. Introduction Inherited retinal dystrophies (RDs) are the result of mutations in genes associated with cells of the outer retina, primarily rod and cone photoreceptors and retinal pigment epithelium (RPE) [1]. RDs are often highly heterogenous in every aspect of the disease, from the age of onset to the rate of progression, to the very mechanisms underlying the pathogenesis [2]. In order to study the molecular mechanisms of pathogenesis underlying retinal disease, numerous animal models, mostly in mouse, have been generated, carrying genetic defects in several genes causing the disease. A major cause of RDs, specifically, autosomal dominant retinitis pigmentosa (RP), is the presence of dominantly inherited mutations in the gene for the rod photoreceptor protein rhodopsin [2]. While most rhodopsin mutations cause protein misfolding and subsequent apoptosis, the more severe mutations result in improper rhodopsin trafficking and can lead to a subsequent loss of outer segmen<sup>t</sup> formation [2]. These mutations result in improper localization of both normal and mutant rhodopsin to the cellular membrane of the inner segment, nuclear, and axonal regions of the rod photoreceptor cells [1]. Two rhodopsin mutations resulting in the earliest onset of retinal degeneration, rhodopsin Ter349Glu and Gln344Ter, behave in this manner [2]. In recent years, many studies have shown the involvement of the immune system in the pathogenesis of many retinal diseases including glaucoma, age-related macular degeneration (AMD), RP, and others [3,4]. Also brought to light is the role of autoimmunity in RDs including AMD and RP [3,5–8]. While the eye is immune-privileged, the homeostatic disruptions caused by the progression of RDs can allow for a loss of this immune-privileged status, mainly due to the breakdown of the blood retinal barrier and choroidal neovascularization. In this study, we show the involvement of pro-inflammatory pathways in the progression of rhodopsin-mediated RD using the Ter349Glu rhodopsin knock-in mouse model of the disease, including monocytic phagocytosis and activation of the Janus Kinase/Signal Transducer and Activator of Transcription (JAK/STAT) pathway. We also show the presence of known autoimmunity proteins and protein modifications in the rhodopsin Ter349Glu mutant mouse.	doab	2025-04-07T03:56:59.511976	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 53 }
00a6a373-fd58-400b-bd1a-e87d014d5110.54	2. Materials and Methods ### 2.1. Measuring Electrical Function in the Ter349Glu Rhodopsin Knock-in Mouse by Electroretinogram (ERG) Wild-type (+/+, WT), Ter349Glu rhodopsin heterozygous and homozygous mice at one month of age were dark-adapted overnight (O/N). The following day, the mice were anesthetized using ketamine/xylazine (14.3 mg/mL ketamine/2.8 mg/mL xylazine in PBS, pH7.4), and ERGs were performed. Dark-adapted flashes (505 nm stimulus) of varying intensities were achieved using neutral density (ND) filters of nominal optical densities (OD) 4.8, 1.4, 3.6, 2.4, 1.8, 1.2, 0.6, and 0.0. A dark-adapted green camera flash performed with no attenuation. Data were analyzed using Labview and IgorPro software. ### 2.2. Monitoring the Ter349Glu Rhodopsin Knock-in Mouse Retina for Vascular and Laminar Abnormalities WT and Ter349Glu homozygous mice at 4 weeks of age were anesthetized using ketamine/xylazine (14.3 mg/mL ketamine/2.8 mg/mL xylazine in PBS, pH7.4). The mice were subsequently examined by optical coherence tomography (OCT) (Bioptigen 840 nm Spectral Domain-OCT, Durham, NC, USA) to measure retinal thickness and assess for structural anomalies. After OCT, the mice were injected intraperitoneally with 100 μL of 4% fluorescein, and the retinas were imaged approximately 1 to 2 minutes post-fluorescein injection by fluorescein angiography (FA), using a 488 nm lamp co-equipped with a Micron III digital microscope (Phoenix Laboratories, Mukilteo, WA, USA) to assess the retinal vasculature for abnormalities including neovascularization, retinal hemorrhage, and vessel alterations. ### 2.3. Immunohistochemical Survey for Inflammatory Markers in the C-Terminal Mutant Rhodopsin Knock-in Mouse Retina Whole eyes from WT, Ter349Glu rhodopsin heterozygous and homozygous mice 4, 8, and/or 12 weeks of age were fixed in 4% paraformaldehyde (PFA) in PBS, pH 7.4, overnight at 4 ◦C, cryoprotected in 30% sucrose in PBS, pH 7.4, frozen in optimal cutting temperature medium, and cryosectioned into 10 μm-thick sections. After washing away the medium, sections were prepped for immunolabeling using heat-mediated antigen retrieval in 10 mM sodium citrate, pH 6.0, with 0.05% Tween-20 for 1 h. After cooling, the slides were washed in PBS and subsequently blocked in 10% goa<sup>t</sup> serum/5% BSA/0.5% Triton X-100 in PBS for 1 h at RT. Following blocking, labeling for markers of retinal inflammation including activated macrophages (F4/80), phosphorylated STAT3 (pSTAT3), and suppressor of cytokine signaling 3 (SOCS3) was performed using fluorescent immunohistochemistry. For both pSTAT3 (Cell Signaling Technology, Danvers, MA, USA) and SOCS3 (abcam, Cambridge, United Kingdom) labeling, a goa<sup>t</sup> anti-rabbit IgG secondary antibody conjugated to horseradish peroxidase (HRP) was allowed to bind the primary antibodies, and Cy3-Tyramide Signal Amplification (TSA, Perkin Elmer, Waltham, MA, USA) was used to visualize the proteins. Briefly, TSA uses the peroxidase activity of HRP to generate reactive oxygen species from peroxide. These reactive oxygen species then oxidize and covalently bind the Cy3-conjugated tyramide molecule to the nearby proteins including the antigen/antibody complex, thus amplifying the signal. Macrophage labeling was performed using an antibody to F4/80-antigen (Bio-Rad, Hercules, CA, USA) followed by a goa<sup>t</sup> anti-rat IgG secondary antibody conjugated to AlexaFluor488 (Invitrogen, Carlsbad, CA, USA). All sections were co-labeled for rhodopsin using B6-30N or K62-82 (provided by W. Clay Smith, University of Florida, Gainesville, FL, USA) and goa<sup>t</sup> anti-mouse IgG1 or IgG3 conjugated to AlexaFluor488 (Invitrogen). Labeling for Müller cells was performed using an antibody against glial fibrillary acidic protein (GFAP, EMD Millipore, Burlington, MA, USA) followed by goa<sup>t</sup> anti-mouse secondary IgG1 conjugated to AlexaFluor647 (Invitrogen). All images were captured as Z-stacks and expressed as maximum intensity projections. ### 2.4. Analysis of Retinal Citrullination in the Ter349Glu/Ter349Glu Rhodopsin Mouse Retina by Fluorescent Immunohistochemistry Whole eyes from 10- to 12-week-old mice were fixed in 4% PFA in PBS, pH 7.4, overnight at 4 ◦C, cryoprotected in 30% sucrose in PBS, pH 7.4, frozen in optimal cutting temperature medium, and cryosectioned into 10 μm-thick sections. After washing away the medium, the sections were treated using heat-mediated antigen retrieval by boiling in 10 mM sodium citrate, pH 6.0, with 0.05% Tween-20 for 1 h. After cooling, the slides were washed in PBS and subsequently blocked in 10% goa<sup>t</sup> serum/5% BSA/0.5% Triton X-100 in PBS for 1 h at RT. Following blocking, the sections were incubated with primary antibodies against peptidyl arginine deiminase 4 (PAD4, ProteinTech, Rosemont, IL, USA) and citrullinated peptides (Clone F95, EMD Millipore, Burlington, MA, USA) O/N at 4 ◦C. After washing in PBS, the slides were probed using goa<sup>t</sup> anti-rabbit IgG conjugated to AlexaFluor488 (Invitrogen) and goa<sup>t</sup> anti-mouse IgM conjugated to AlexaFluor555 (Invitrogen), and the nuclei were labeled with DAPI (Invitrogen). After washing in PBS, the slides were mounted using Prolong Diamond Anti-Fade Mountant (Invitrogen) and imaged using a Zeiss 710 Laser Scanning Confocal Microscope (Zeiss, Oberkochen, Germany). All images were captured as Z-stacks and expressed as maximum intensity projections.	doab	2025-04-07T03:56:59.512142	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 54 }
00a6a373-fd58-400b-bd1a-e87d014d5110.55	3. Results ### 3.1. Loss of Functional ERG in Early-Onset RD Patients expressing the Ter349Glu mutant rhodopsin experience a loss of photoreceptor function earlier in life, resulting in early and rapid central vision loss, when compared to other mutants of rhodopsin [9]. We tested if the Ter349Glu knock-in mouse displayed a similar early-onset (4 weeks of age) loss of visual capacity by ERG (Figure 1). Compared to +/+ mice (n = 5), the Ter349Glu/Ter349Glu mice (n = 5) showed an increase in the threshold of the dark-adapted b-wave by three orders of magnitude, with a maximum amplitude about 25% that of +/+ mice, while the maximum a-wave amplitude was only about 6% that of +/+ mice. This indicated a drastic loss of rod photoreceptor function. Interestingly, when compared to +/+ and Ter349Glu/Ter349Glu mice, Ter349Glu/+ mice (n = 4) appeared to have a gain of function with an increase in sensitivity and a decrease in response latency without significant changes in amplitudes. ### 3.2. Effects of RD-Associated Photoreceptor Loss on Retinal Vasculature and Laminar Architecture In cases of RP, retinal degeneration exerts e ffects on both retinal vasculature and laminar architecture in the forms of attenuated vessels and outer nuclear layer (ONL) thinning, respectively [10]. To examine the Ter349Glu/Ter349Glu retina for such abnormalities, FA and OCT were performed on 4-week-old +/+ and Ter349Glu/Ter349Glu animals in triplicate (Figure 2). Using FA, when compared to +/+ mice, Ter349Glu/Ter349Glu mice exhibited heterogeneous types and degrees of vascular abnormalities. The most common anomalies included attenuated vessels, tortuous vessels indicating hyperoxia, and reduced retinal venous and arterial vessel numbers. Using OCT, Ter349Glu/Ter349Glu mice exhibited the expected thinning of the ONL; however, at the interfaces between choroid, RPE, and rod outer segments (ROS)/ rod inner segments (RIS) layers the mice also exhibited a possible edema, likely due to loss of contacts between the RPE and the photoreceptors, associated with the lack of ROS. This edema was observed extending to varying degrees both inferiorly and superiorly to the optic nerve. Representative images were taken from the retina inferior to the optic nerve. Figure 1. Electroretinogram (ERG) responses decline in mice expressing Ter349Glu rhodopsin. Using ERG to record extracellular potential differences across the retina, the electrophysiological function of +/+, Ter349Glu/+, and Ter349Glu/Ter349Glu mice was monitored by measuring a-, b-waves, and response latencies (Time-to-Peak, TTP) under increasing stimulus intensities (A,C,E). Graphs compare maximum average wave amplitudes and TTP (B,D,F) under dark-adapted conditions. Data analyzed using two-tailed T-test and expressed as the mean ± S.E.M. \, p* < 0.05; \\, p < 0.01; \\\, p* < 0.001; ns, not significant. Figure 2. Ter349Glu rhodopsin knock-in mouse retina exhibits both vascular and laminar abnormalities. (A–D) Utilizing fluorescein angiography (FA), the state of the retinal vasculature of 4-week-old +/+ (A,B) and Ter349Glu/Ter349Glu (C,D) mice was examined. Abnormal phenotypes varied in severity among mice, with overall attenuated retinal vessels and tortuous retinal vessels (arrowheads) being commonplace amongs<sup>t</sup> all mice examined. (E,F) Optical coherence tomography (OCT) was used to examine the retinas of 4-week-old +/+ (E) and Ter349Glu/Ter349Glu mice (F) for architectural abnormalities. Ter349Glu/Ter349Glu mice exhibited thinning of the outer nuclear layer (ONL) and patches of varying degrees of separation among the choroid, retinal pigment epithelium (RPE), and photoreceptors (block arrow), indicative of edema. Retinal thickness (red calipers) = 240 μm (E) and 180 μm (F); ONL (green calipers) = 60 μm (E) and 50 μm (F). ### 3.3. Activated Monocytes Are Present in RD Retinas from Rhodopsin Mutant Knock-in Mice The retina contains resident macrophages similarly to the cortex, known as microglia, and these cells remain in the inner retinal layers under normal physiological conditions. Here, they remain in an inactivated state unless triggered by cytokine signaling or apoptotic signals [11]. Other types of leukocytes are typically not resident in the retina, and evidence of these cells in ocular tissues is indicative of retinal inflammation. Damage to retinal and choroidal vessels can allow leakage of not only blood-borne macrophages into the retina, but also cytokines, antibodies, and a plethora of other inflammatory factors [12]. Unfortunately, no method exists to differentiate between microglia and blood-borne macrophages; however, due to the observation of abnormal vasculature and retinal edemas, we chose to monitor the +/+ and Ter349Glu/Ter349Glu retinas for activated macrophages as a whole, using an antibody against F4/80 antigen, a cell surface glycoprotein expressed upon macrophage maturation (Figure 3). F4/80-positive macrophages were found in multiple animals from the Ter349Glu/Ter349Glu cohort at 12 weeks of age, with the most labeling observed in sections from Ter349Glu/Ter349Glu animals where nearly the whole retina was degenerated. Macrophages remained in the outer retina after almost total rod cell death (12 weeks). These macrophages were not observed in +/+ sections from any animal (n = 3 at all ages). Figure 3. Retinas from retinal dystrophy (RD) mice exhibit monocyte activation. Using fluorescent immunohistochemistry, the presence of activated macrophages was examined in +/+ (A–C) and Ter349Glu/Ter349Glu (D–F) mice at 12 weeks of age. Retinal sections were labeled with anti-F4/80 antigen (green) and K62-82 (rhodopsin, red) antibodies. Nuclei were labeled with DAPI (blue). Autofluorescence in the choroid was observed in the red channel. CC, choriocapillaris; ROS, rod outer segments; RIS, rod inner segments; OPL, outer plexiform layer. Scale bars = 20 μm. ### 3.4. Activation of the Pro-Inflammatory JAK/STAT Pathway and Its Inhibitor SOCS3 in RD STAT3 is a downstream signaling partner of JAK. In inflammatory conditions, STAT3 is activated when cytokines such as IL-6, ciliary neurotrophic factor, leukemia inhibitory factor, and others bind to and activate the glycoprotein 130 (gp130) receptor [13]. Gp130 activates JAK, which in turn phosphorylates STAT proteins (pSTAT). Upon phosphorylation, pSTATs form both homo- and heterodimers, allowing nuclear entry and activation of gene transcription. The protein SOCS3 works as a negative regulator of the JAK/STAT pathway by binding the gp130 receptor and JAK together and blocking active sites involved in phosphorylation of STAT3, thus prohibiting further signal transduction [14]. In instances where inflammatory signaling needs to be slowed or stopped, SOCS3 works to perform this task. To examine the Ter349Glu knock-in mouse retina for inflammatory cytokine signaling, retinas from both +/+, Ter349Glu/+, and Ter349Glu/Ter349Glu mice were labeled with an antibody against pSTAT3 (Figure 4). We found that +/+ retinas showed no STAT3 activation across all ages, while the Ter349Glu/+ and Ter349Glu/Ter349Glu mice exhibited increasing activation with age, beginning at 8 weeks and 4 weeks, respectively (n = 3 for all ages). Early pSTAT3 activation began in the inner nuclear layer (INL) and, by 12 weeks, extended to the RPE. The location of the activated nuclei in the INL suggested the nuclei belonged to Müller cells. Indeed, co-labeling for GFAP, a marker of gliosis in Müller cells, showed Müller cells to be pSTAT3-positive (Figure 5). Figure 4. JAK/STAT pathway is activated in Ter349Glu rhodopsin knock-in mouse retina. Activation of the JAK/STAT pathway was examined using fluorescent immunohistochemistry on retinas from WT (+/+, A–C), Ter349Glu heterozygous (Ter349Glu/+, D–F), and Ter349Glu homozygous (Ter349Glu/Ter349Glu, G–H) mice. Retinal sections were treated for antigen retrieval and labeled for phosphorylated STAT3 (pSTAT3, red) and rhodopsin (green). Nuclei were labeled with DAPI (blue). Arrowheads (>), areas of JAK/STAT activation; OS, outer segments; IS, inner segments; INL, inner nuclear layer. Scale bar = 20 μm. Since Müller cells maintain retinal homeostasis, this finding suggests they may act to respond to inflammatory cytokines, as STAT3 activation indicates the presence of pro-inflammatory cytokines in the neural retina, likely being released from activated macrophages within the retina. It should be noted that in these images, labeling for rhodopsin can be seen in the ONL even though rhodopsin is not normally localized in large amounts in this region. This is likely an artifact due to a heightened number of anti-rhodopsin epitopes following the antigen retrieval process. Labeling for SOCS3 revealed minimal expression in +/+ retinas while, similarly to pSTAT3, Ter349Glu/+ and Ter349Glu/Ter349Glu mice began expressing SOCS3 in the neural retina and RPE at 4 weeks of age; with time, the expression increased in Ter349Glu/Ter349Glu mice and decreased in Ter349Glu/+ mice (Figure 6, n = 3 at all ages). Figure 5. Identification of Müller cell nuclei as INL centers for STAT3 activation. To assess which retinal cells exhibited STAT3 phosphorylation, labeling was performed on +/+ (A,B) and Ter349Glu/Ter349Glu (C,D) animals for glial fibrillary acidic protein (purple), a marker of astrocytes and gliotic Müller cells, rhodopsin (green), and pSTAT3 (red). Nuclei were labeled with DAPI (blue). Arrows show red nuclei surrounded by purple. Scale bar = 20 μm. Figure 6. The JAK/STAT antagonist SOCS3 is expressed in Ter349Glu rhodopsin knock-in mouse retina. Using fluorescent immunohistochemistry, the expression of SOCS3, an antagonist to the JAK/STAT pathway, was examined in retinas from wild-type (WT, +/+, A–C), Ter349Glu heterozygous (Ter349Glu/+, D–F), and Ter349Glu homozygous (Ter349Glu/Ter349Glu, G–I) mice. Retinal sections were treated for antigen retrieval and labeled for SOCS3 (red) and rhodopsin (green). Nuclei were labeled with DAPI (blue). GCL, ganglion cell layer; arrowheads (<), SOCS3 labeling. Scale bar = 20 μm. ### 3.5. Cell-Specific Expression of PAD4 and Heightened Citrullination in Early-Onset RD Recent studies have shown an increase in the expression of the deiminating enzyme PAD4 and increased citrullination in the event of ocular insult of the anterior segmen<sup>t</sup> [15]. Due to the inherent ability of citrullinated proteins to cause autoimmunity [16–22] and our previous finding that PAD4 is the primary retinal PAD in mouse [23], we tested the Ter349Glu retina for changes in PAD4 expression and citrullination compared with WT retina at 10 to 12 weeks of age (Figure 7). WT retina exhibited expression of PAD4 and exhibited INL nuclear citrullination, as shown previously [23]; however, the Ter349Glu retina exhibited higher levels of citrullination, much of it spanning the entire retina. This was observed in parallel with PAD4 expression increases, especially in the photoreceptors. Figure 7. Expression of PAD4 and citrullination of retinal proteins in normal and degenerated states. WT (+/+, A–C) and Ter349Glu/Ter349Glu (D–F) mice at 10 to 12 weeks of age were labeled for PAD4 (green) and citrullinated peptides (red). Nuclei were labeled with DAPI (blue). Arrowheads (<), areas of increased citrullination in ONL; OS/IS, photoreceptor outer and inner segments; IPL, inner plexiform layer; Scale bar = 20 μm.	doab	2025-04-07T03:56:59.512462	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 55 }
00a6a373-fd58-400b-bd1a-e87d014d5110.56	4. Discussion Increasing amounts of evidence linking the immune system to ocular disease has emerged in the last decade. Studies focusing on glaucoma, AMD, RP, and other RDs have continued to show increased presence of many immune components including monocytes (blood-borne and resident), pro- and anti-inflammatory cytokines, and autoantibodies in many models of these diseases [24–26]. While all of these diseases present an initial insult of genetic and/or environmental origins, these findings overwhelmingly implicate the immune system in the pathogenesis of RDs. For example, the prevalence of single-nucleotide polymorphisms in the genes coding for complement factor H, complement factor I, as well as many other components of the innate immune system bolster the chances of developing AMD in otherwise normal patients [27,28]. In addition, models of glaucoma have shown the presence of macrophages and T-lymphocytes in the eye along with autoantibodies to proteins of the retina [3,4,29,30]. Models of RP have also shown similar features, including monocytic phagocytosis of both diseased and healthy retinal cells as well as numerous cytokines such as interleukin-1, interleuken-6, vascular endothelial growth factor, and others [4,31,32]. While the molecular mechanisms of the primary genetic assault have been teased out by copious amounts of work using cell culture and animal models for many RDs (i.e., loss of outer segmen<sup>t</sup> formation, disrupted visual cycle, etc.) [1,2,33], the full mechanisms of pathogenesis and progression of RDs still need thorough investigation before we fully understand them. In our findings, the Ter349Glu/Ter349Glu mice exhibited an almost complete loss of photoreceptor function by ERG; however, the Ter349Glu/+ mice had heightened a and b waves while also showing a decrease in b wave latency compared to the +/+ animals. This phenomenon might be explained by the expression levels of mutant rhodopsin compared to WT rhodopsin, as Ter349Glu rhodopsin expression levels are less than half of the WT levels [2]. This lower level of expression while still having 50% WT rhodopsin could result in a somewhat thinner outer segmen<sup>t</sup> with less rhodopsin protein in the discs, thus allowing for faster rates of di ffusion of the phototransduction cascade components, decreasing the response latency, while normal WT rhodopsin activates the cascade, enhancing the signal. We also showed that animals with more advanced RD had significant numbers of macrophages, a feature found in many RDs, as well as activation of a known pro-inflammatory pathway (JAK/STAT). Interestingly, the Ter349Glu/+ mice showed SOCS3 expression in the inner retinal layers early in life (4 weeks of age), with a dramatic decrease in expression with age, while the +/+ mice had minimal SOCS3 expression, which peaked at 8 weeks of age, and the Ter349Glu/Ter349Glu mice exhibited a somewhat constant SOCS3 expression in the outer retina and RPE. While the relatively stable SOCS3 expression in the Ter349Glu/Ter349Glu mice is explainable when compared to the levels of STAT3 phosphorylation which was present throughout the first 3 months of the animals' life, the stark di fference in SOCS 3 expression the Ter349Glu/+ mice remains to be elucidated. More experiments examining the activation and deactivation of the proinflammatory JAK/STAT pathway are needed to better understand these expression di fferences. Further work will aim at pinning down the cytokines responsible for pathway activation; experiments inhibiting the pathway activation using antagonists to the JAK/STAT pathway and/or those inhibiting specific cytokine(s) will better underpin this pathway's role in RD. Due to the nature of STAT3 role in numerous developmental pathways [13], a more targeted approach to delivering inhibitory compounds directly to the eye would be necessary. Future experiments will also work to decrease the number of activated macrophages in RD models to attempt to rescue some photoreceptor degeneration due to excessive phagocytosis and/or macrophage-derived cytokines. Work is already underway testing the inhibition of PAD4 in RD models to rescue retinal cells, retinal function, or both [34]. This work will be achieved using PAD4-deficient mice as well as inhibitors of the enzyme. Due to the excessive citrullination observed in Ter349Glu/Ter349Glu mice, it is not far-fetched to think that lowering or preventing this post-translation modification from occurring could lead to a slower rate of disease progression, allowing for not only longer lasting vision in patients a ffected but also an extended opportunity to correct the genetic insult, thus preventing further retinal degeneration. In all, our work further contributes to the increasing volume of studies indicating a role of the immune system in RDs as well as provides possible targets forthetreatmentofthesedebilitatingblindingdiseases. Author Contributions: Conceptualization, A.K.G. and T.J.H.; methodology, A.K.G. and T.J.H.; investigation, A.K.G. and T.J.H.; resources, A.K.G. and T.J.H.; data curation, A.K.G. and T.J.H.; writing—original draft preparation, T.J.H.; writing—review and editing, A.K.G. and T.J.H.; visualization, A.K.G. and T.J.H.; project administration, A.K.G.; funding acquisition, A.K.G. All authors have read and agreed to the published version of the manuscript. Funding: This research was funded by the NIH R01EY019311 and the E. Matilda Ziegler Foundation. Center support for the project was provided by NIH P30EY003039. Acknowledgments: We thank Brian Simms and Meredith Hubbard for technical assistance and W. Clay Smith for the K62-82 rhodopsin antibody. Conflicts of Interest: The authors declare no conflicts of interest.	doab	2025-04-07T03:56:59.513224	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 56 }
00a6a373-fd58-400b-bd1a-e87d014d5110.58	Single-Cell RNA Sequencing in Human Retinal Degeneration Reveals Distinct Glial Cell Populations Andrew P. Voigt 1,2, Elaine Binkley 1,2, Miles J. Flamme-Wiese 1,2, Shemin Zeng 1,2, Adam P. DeLuca 1,2, Todd E. Scheetz 1,2, Budd A. Tucker 1,2, Robert F. Mullins 1,2 and Edwin M. Stone 1,2,\* Received: 19 December 2019; Accepted: 10 February 2020; Published: 13 February 2020 Abstract: Degenerative diseases a ffecting retinal photoreceptor cells have numerous etiologies and clinical presentations. We clinically and molecularly studied the retina of a 70-year-old patient with retinal degeneration attributed to autoimmune retinopathy. The patient was followed for 19 years for progressive peripheral visual field loss and pigmentary changes. Single-cell RNA sequencing was performed on foveal and peripheral retina from this patient and four control patients, and cell-specific gene expression di fferences were identified between healthy and degenerating retina. Distinct populations of glial cells, including astrocytes and Müller cells, were identified in the tissue from the retinal degeneration patient. The glial cell populations demonstrated an expression profile consistent with reactive gliosis. This report provides evidence that glial cells have a distinct transcriptome in the setting of human retinal degeneration and represents a complementary clinical and molecular investigation of a case of progressive retinal disease. Keywords: autoimmune retinopathy; retinal degeneration; Müller cell; single-cell	doab	2025-04-07T03:56:59.513833	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 58 }
00a6a373-fd58-400b-bd1a-e87d014d5110.59	1. Introduction Photoreceptor cells are highly specialized, terminally di fferentiated neurons that detect photons of light and transmit this information to bipolar cells in the retina. Unfortunately, their exacting structural and metabolic requirements make them very susceptible to a large number of acquired and genetic sources of injury, leading to irreversible vision loss [1]. Degenerative diseases a ffecting photoreceptor cells have multiple etiologies. For example, genetic variants in over 100 genes have been shown to cause heritable photoreceptor degeneration [2]. However, photoreceptor degeneration can also be immune mediated, as in the case of autoimmune retinopathy (AIR), where circulating retinal autoantibodies lead to inflammation and downstream photoreceptor destruction [3]. Photoreceptor loss can also occur secondary to damage or dysfunction of adjacent cells and extracellular structures; for example, diseases a ffecting the retinal pigment epithelium (RPE), Bruch's membrane, or choroid can lead to increased oxidative stress and decreased metabolic support to the outer retina [4]. One approach for studying retinal degeneration is to characterize transcriptomic changes within diseased retina using microarrays or, more recently, next-generation sequencing of cDNA libraries (RNA sequencing, or RNA-Seq). Conventional gene expression studies with RNA-Seq have analyzed pools of retinal RNA from numerous cell types [5,6]. However, the high degree of cellular complexity and diversity in the human retina can prevent detection of even large gene expression changes that are restricted to specific classes of cells that are relatively unrepresented in the pool [7]. This concern has been largely obviated by the development of single-cell RNA sequencing, which has recently been employed to characterize the transcriptome of individual retinal cell populations. The neural retina is well suited for dissociation into single-cells, and protocols for recovery of viable, singlet cells are well established [8,9]. Such protocols facilitated the exploration of the murine retina transcriptome in the first report of Drop-Seq single-cell RNA sequencing [10]. Since this initial investigation, several additional studies have described the transcriptome of murine retina [10–12] and more recently, human retina [13–15] at the single-cell level. In this report, we describe the clinical course of a 70-year-old patient with progressive photoreceptor degeneration attributed to AIR. We perform single-cell RNA sequencing on paired foveal and peripheral retinal samples from this patient and four una ffected control patients to investigate how di fferent populations of retinal cells respond to photoreceptor degeneration. A total of 23,429 cells were recovered in this experiment, including 7189 cells from the AIR patient. This study provides insight into the responses of the retina to a blinding inflammatory condition at the cellular and transcriptional levels.	doab	2025-04-07T03:56:59.513953	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 59 }
00a6a373-fd58-400b-bd1a-e87d014d5110.60	2. Materials and Methods Human Donor Eyes: Eyes from the human donors utilized for this study were acquired from the Iowa Lions Eye Bank in accordance with the Declaration of Helsinki and following full consent of the donors' next of kin. The Institutional Review Board at the University of Iowa has judged that experiments performed on the donated eyes of deceased individuals does not fall under human subjects rules. All of the experiments in present paper were on the eyes of deceased individuals donated to science by the donors' next of kin. The work we performed in this paper was not human subjects research. Donor information is presented in Table 1. All tissue was received in the laboratory within 7 h post-mortem and processed immediately. A 2 mm foveal centered punch and an 8 mm peripheral retinal punch from the inferotemporal region centered on the equator were acquired with a disposable trephine from each donor. For the AIR donor, the OS was used for single-cell RNA sequencing and the OD was preserved in freshly generated 4% paraformaldehyde in phosphatidylcholine bu ffer solution. Frozen sections from the macula and peripheral retina were prepared as described previously [16]. Sections were stained with hematoxylin-eosin stain. Table 1. Sample information from the donor eyes utilized in this study. Note that donor eyes 1–3 serve as controls for the current study and have been previously published [13]. Dissociation for single-cell analysis: The overlying retinal tissue was peeled o ff of the retinal pigment epithelium and choroid. Retinal tissue was subsequently dissociated in 20 units/mL of papain with 0.005% DNase I (Worthington Biochemical Corporation, Lakewood NJ) for 1.25 h on a shaker at 37 ◦C. Dissociated cell suspensions were frozen in DMSO-based Recovery Cell Culture Freezing Media (Life Technologies Corporation, Grand Island NY) in a Cryo-Safe cooler (CryoSafe, Summerville SC) to cool at 1 ◦C/min at −80 ◦C for 3–8 h before storage in liquid nitrogen. Sample Preparation: Cryopreserved retinal samples were rapidly thawed and resuspended in phosphatidylcholine bu ffer solution with 0.04% non-acetylated bovine serum albumin (New England Biolabs, Ipswich, MA, USA) at a concentration of 1000 cells/μL. Viability analysis was performed with the Annexin V/Dead Cell Apoptosis Kit (Life Technologies Corporation, Eugene, OR, USA), with viability >90% using the Countess II FL Automated Cell Counter (ThermoFisher Scientific, Waltham, MA, USA). Next, single cells were captured and barcoded using the Chromium system v3.0 chemistry kit (10X Genomics, Pleasanton, CA, USA). Barcoded libraries were pooled before sequencing on the HiSeq 4000 platform (Illumina, San Diego, CA, USA), generating 150 base pair paired-end reads. Immunohistochemistry: Immunohistochemical experiments were performed on frozen tissue sections from donor eyes fixed in 4% paraformaldehyde. Sections were blocked with 1 mg/mL of bovine serum albumin before one-hour incubation with anti-ANXA1 (1:1.7, Developmental Studies Hybridoma Bank, Iowa City, IA) or Blue Cone Opsin (1:200, Millipore, AB5407), Red/Green Cone Opsin (1:200, Millipore, AB5405), and RetP1 (1:1000, Thermo Scientific). Sections were subsequently washed and incubated with Alexa-546-conjugated anti-mouse IgG (1:200, Invitrogen) or Alexa-488-conjugated anti-mouse IgG (1:200, Invitrogen) and Alexa-546-conjugated anti-rabbit IgG (1:200, Invitrogen). Each secondary antibody was supplemented with 100 μg/mL diamidino-phenyl-indole (DAPI, Sigma). Sections were incubated for 30 min before washing and cover slipping. Negative controls were included by omitting each primary antibody. Sections were photographed with an epifluorescent microscope (Olympus BX41) equipped with a digital camera (SPOT-RT; Diagnostic Instruments). Computational Analysis: In addition to the two new donors sequenced for this study, we recently reported single-cell RNA sequencing on paired foveal (2 mm) and peripheral neural retina isolated from three human donors [13] with identical sample processing. FASTQ files from the previous experiment (n = 3 paired samples, donors 1-3; GSE130636) and the current experiment (n = 2 paired samples, donors 4–5) were utilized for downstream analysis. Briefly, FASTQ files were generated from basecalls with the bcl2fastq software (Illumina, San Diego, CA, USA) by the University of Iowa Institute of Human Genetics. Next, FASTQ files were mapped to the hg19 genome with CellRanger (v3.0.1) [17]. Cells with unique gene counts fewer than 200 were filtered, and cells with greater than 7000 unique genes per cell were removed to eliminate potential doublets. Libraries were aggregated to the same e ffective sequencing depth, and log-normalization of aggregated reads was performed with Seurat (v2.3.4) using a scale factor of 10,000 [18]. All raw and processed data have been deposited in NCBI's Gene Expression Omnibus (GSE142449).	doab	2025-04-07T03:56:59.514149	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 60 }
00a6a373-fd58-400b-bd1a-e87d014d5110.62	3.1. Patient Description The patient initially presented to the neuro-ophthalmology service at the age of 51 for evaluation of decreased peripheral visual fields and photopsias in both eyes. He had no family history of inherited retinal degeneration. At presentation, his visual acuity was 20/20 in each eye, but he was found to have peripheral visual field loss. Ophthalmoscopic examination early in his disease course showed granular juxtapapillary pigmentary changes and mild vascular attenuation in both eyes. Electroretinogaphy (ERG) at presentation was consistent with widespread retinal dysfunction a ffecting both rods and cones. He experienced relatively rapid progression of his visual field loss and was seen by the inherited retinal degeneration service with concern for retinitis pigmentosa versus autoimmune retinopathy (AIR). Cancer-associated retinopathy was also considered, but his workup for malignancy was negative and his ERG was felt to be inconsistent with a paraneoplastic process at that time. He ultimately developed peripheral bone-spicule-like pigmentary changes in both eyes (Figure 1A,B, 7 years after initial presentation) and progressive visual field constriction (Figure 1C,D, 8 years after initial presentation). Molecular evaluation for an inherited retinal degeneration, including whole exome sequencing, was performed but failed to identify a genetic etiology for his condition (for methods see [2]). He developed colon cancer several years after presentation, but this was thought to be unrelated to his ocular disease. He was given a presumed diagnosis of autoimmune retinopathy and ultimately required treatment for cystoid macular edema with intravitreal steroids. Figure 1. Clinical findings in a patient with retinal degeneration. (A,B): Montage color fundus photographs of the right (A) and left (B) eyes. There was granular, retinal pigment epithelial atrophy in the mid-periphery of both eyes, in addition to peripheral bone-spicule-like pigmentary changes and pigment clumps in both eyes. Arteriolar attenuation was notable in both eyes. (C,D): Goldman visual fields of the right (C) and left (D) eyes. There was severe constriction of the peripheral visual field in both eyes. At the time of his last follow up with the retina service at the age of 69, his visual acuity was 20/40 + 1 in the right eye and 20/100 in the left eye with stable peripheral pigmentary changes in both eyes, and no cystoid macular edema. At age 70, the patient expired and donated his eyes for ophthalmic research. Evaluation of the patient's serum with Western blotting revealed the presence of antibodies that reacted with a 23 kilodalton protein in human retina.	doab	2025-04-07T03:56:59.514479	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 62 }
00a6a373-fd58-400b-bd1a-e87d014d5110.63	3.2. Histological Findings Sections from an eye with normal ocular history (Figure 2A), from the macula of the AIR donor (in the OD, the eye with better visual acuity) (Figure 2B), and from the periphery of the AIR donor (Figure 2C,D) were acquired. The macula of the AIR donor showed a loss of rod photoreceptors with only a single layer of attenuated cone cells remaining. In spite of the photoreceptor cell loss, the RPE was confluent and the inner retina appeared intact, with discrete inner nuclear layers and ganglion cell layers. In the periphery, the AIR donor showed complete loss of inner and outer segments and of the outer nuclear layer (Figure 2C). Considerable pigment migration into the inner retina was also observed in the periphery of the AIR donor (Figure 2D). Figure 2. Histological and immunohistochemical investigation of the autoimmune retinopathy (AIR) and control donors. (A–D). Hematoxylin and eosin staining of the AIR and control donors. Sections from the periphery of a control donor (donor 2) (A), the macula (OD) of the AIR donor (B), and the periphery of the AIR donor (C,D). The AIR macula demonstrates intact ganglion cell and inner nuclear layers with attenuated cone photoreceptor outer segments. In contrast, in the periphery of the AIR donor complete loss of the outer nuclear layer (C) and retinal pigment epithelium (RPE) pigment migration into the inner retina (D) is observed (\). (E,F): Cone opsins (blue cone opsin and red/green cone opsins) are labeled in red while RetP1 is labeled in green. (E): A macula from a donor with normal ocular history demonstrates abundant labeling of cone opsins and rhodopsin. Of note, the RPE below the photoreceptors is out of frame. (F) The macula from the AIR donor demonstrates a complete lack of rod photoreceptors with rare, extremely attenuated cone photoreceptors (arrows). Autofluorescent lipofuscin from the RPE appears below the photoreceptor cells. Scalebar (100 microns) for all subpanels is provided in (E). Cone and rod photoreceptor cells were also visualized with fluorescent immunohistochemistry (IHC). Within the macula of a donor with normal ocular history, abundant cone opsin and rhodopsin labeling was observed (Figure 2E). In contrast, the AIR donor demonstrates complete loss of the rod specific opsin rhodopsin as well as extreme attenuation of cone photoreceptors (Figure 2F). ### 3.3. Single-Cell Gene Profiling of Diseased Cell Populations* Paired foveal and peripheral retinal punches were acquired from each of the five donors. While the four control donors had grossly normal retinas upon examination in the laboratory (Figure 3A), the donor with AIR had abundant peripheral pigmentation with a mostly unaffected macula (Figure 3B). After gentle dissociation, single-cell RNA sequencing was performed on each foveal and peripheral sample, and a total of 23,429 cells were recovered after filtering (Figure 3C). A total of 23 clusters were identified, and expression profiles were used to assign each cluster to its corresponding retinal cell type (Figure 3D). All major populations of retinal neurons, as well as supporting retinal endothelial cells, pericytes, glial cells, and microglia, were identified. Next, the distribution of recovered cell types was compared between the AIR donor and the four control donors (Table S1). As the cellular composition of the retina varies between the fovea and periphery, comparisons were stratified by region. Within the fovea, cone photoreceptor cells are more abundant than rod photoreceptor cells, and cone photoreceptor cells synapse one-to-one with bipolar cells and upstream retinal ganglion cells (Figure 4A). The fovea centralis comprises the central 0.65-0.70 mm of the retina, consisting exclusively of cone photoreceptor cells and excluding vascular elements [19]. Our use of 2 mm foveal centered punches completely captures the fovea centralis but also includes some central rod photoreceptors and retinal endothelial cells. In the four control donors, all major populations of inner retinal neurons were recovered from the fovea (Figure 4B). No RPE cells were detected, suggesting that the foveal retinal punch was well separated from the underlying RPE and choroid. Unlike the control donors, no rod photoreceptor cells were detected in the foveal punch from the donor with AIR. However, a similar proportion of foveal cone photoreceptor cells were recovered in the AIR donor and the control donors. In addition, the AIR donor demonstrated a moderate increase in the proportion of recovered foveal bipolar and Müller cells. In the periphery, rod photoreceptor cells were predominant, and peripheral bipolar cells receive input from multiple rod photoreceptor cells (Figure 4D). In the four control donors, peripheral rod photoreceptor cells were much more abundant than cone photoreceptor cells, and relatively few microglia or astrocytes were detected (Figure 4E). In contrast, only a single rod photoreceptor cell was recovered from the periphery of the AIR donor while microglia and astrocyte cells were recovered in much higher frequency. In addition, a small proportion of RPE cells were recovered from the periphery of the AIR donor, consistent with the histological observation of peripheral RPE migration into the retina (Figure 2D). Next, the transcriptomic consequences of photoreceptor degeneration in the AIR donor were investigated. For each cell type, gene expression was compared between cells originating from the AIR donor and the control donors, and the proportion of significantly differentially expressed genes (adjusted p-value < 0.05) that exhibited an absolute log fold-change in expression greater than 0.5 was calculated. As gene expression within a single cell type can vary between the fovea and the periphery [13], this analysis was again stratified by region. Within the fovea, Müller cells and horizontal cells demonstrated modest expression differences, with a total of 1.1% and 1.2% of assayed genes significantly enriched in the AIR Müller cell and horizontal cell populations, respectively (Figure 4C). A greater proportion of differentially expressed genes between the AIR and control donors were identified in the periphery (Figure 4F). Müller and astrocyte glial cells both demonstrated a modest proportion of genes significantly enriched in the periphery of the AIR donor (1.3% and 2.1%, respectively), as did microglia and horizontal cells (2.2% and 2.6%, respectively). Differential expression results for each comparison are shown in detail in Table S2. Figure 3. Single-cell RNA sequencing of the AIR donor. (A,B): Five human donor eyes were used for this study. A gross image of a control eye (donor 4) (A) and the AIR eye (donor 5) (B) are included. From each eye, a 2 mm foveal centered punch (red) and an 8 mm peripheral punch isolated from the inferotemporal region (blue) were acquired and gently dissociated. Scalebar (A) is 5 mm. (C): Single-cell RNA sequencing of retinal cells from the AIR donor and four control patients. A total of 23,429 cells were recovered after filtering. Unsupervised clustering of cells resulted in 23 clusters, which are visualized with uniform manifold approximation and projection (UMAP) dimensionality reduction, where each point represents the multidimensional transcriptome of a single-cell and each cluster of cells is depicted in a different color. (D): Violin plots depict the expression of cell-type specific genes across the 23 identified clusters. Per = peripheral retina. AIR = autoimmune retinopathy. RPE = retinal pigment epithelium. RGC = retinal ganglion cell. Figure 4. Library composition of recovered cells. (A): In the fovea, cone photoreceptor cells synapse with one bipolar cell, which synapse with one retinal ganglion cell. (B): The proportion of each cell type recovered from the fovea of the four control donors and the autoimmune retinopathy donor. No foveal rods were recovered from the AIR donor. (C): In order to visualize the degree of gene expression differences within each population of cells between the AIR and control donors, differential expression analysis was performed. In each cell type, the number of differentially expressed genes that were enriched in the AIR donor and the control donors were enumerated and divided by the total number of expressed genes (in at least 10% of cells). For example, 1.09% of foveal Müller cell genes were significantly enriched in the AIR donor (dark grey), while 0.57% of foveal Müller cell genes were significantly enriched in the control donors (light grey). (D): In the periphery, multiple rod photoreceptor cells synapse with a single bipolar cell. (E): The proportion of each cell type recovered from the periphery of the four control donors and the periphery of the AIR donor. (F): As in (C), the proportion of differentially expressed genes between the AIR and control donors was performed in each cell type. More genes were differentially expressed in the periphery compared to the fovea (C). As no RPE cells originated from control donors, differential expression could not be performed in the periphery for this cell type. While most clusters contained cells from each of the five donors, Clusters 4–6 were comprised predominantly of cells from the periphery of the AIR patient (each cluster possessing >85% of cells from the AIR donor) (Figure 5A). Therefore, gene expression patterns from these clusters were further investigated. Cluster 4 was classified as astrocytes (Figure 5C,D). Cells in this cluster demonstrated high expression of the glial fibrillary acid protein (GFAP), which is widely expressed in astrocytes responding to neuronal injury [20], and the astrocyte-specific inflammatory cytokine IFITM3 [21]. A total of 624 cells were recovered in Cluster 4 and 551 of them (88%) originated from the periphery of the AIR donor. Differential expression analysis was performed to investigate if astrocytes from the AIR donor demonstrated a reactive gene expression profile (Figure S1). Astrocytes from the AIR donor were enriched for SOCS3 [22], SLPI [23], and CH25H [24], genes that have all been previously found to be expressed in astrocytes responding to CNS injury. In addition, reactive glial cells are involved in inflammatory responses, and have been shown to increase the production of pro-inflammatory chemokines [25]. The chemokine CXCL2 was highly enriched (logFC = 1.47) in peripheral astrocytes from the AIR donor. Cluster 5, with 98% of cells originating from the periphery of the AIR donor, was interpreted as Müller glial cells. Cells in this cluster highly expressed the Müller cell genes RLBP1 and CRALBP1 (Figure 5E). Six additional clusters of Müller glia were identified, which largely separated Müller cells of peripheral (Clusters 6–10) and foveal (Clusters 11–2) origin (Figure 5A). As previously shown in monkey [26] and human [13] retina, foveal and peripheral Müller cells have distinct gene expression profiles (Figure 5G). Interestingly, foveal Müller cells from the AIR donor clustered with foveal Müller cells from the other four donors, and differential expression analysis yielded relatively few expression differences (log fold-change greater than 1.25) (Figure 5H). NFKBAI, which has been previously associated with glial cell degeneration, [27] was the most upregulated gene in the AIR donor's foveal Müller cells. In contrast, the majority of peripheral Müller cells from the AIR donor formed their own cluster (Cluster 5). Differential expression revealed numerous expression differences between peripheral Müller cells from the AIR donor versus peripheral Müller cells from other donors (Figure 5I). Among the first hallmarks of reactive gliosis is the increased expression of intermediate filament proteins [28]. The intermediate filament gene GFAP (logFC = 2.54) was the most enriched gene in Müller cells from the AIR donor, which was also observed to be more abundant in the AIR donor at the protein level (Figure S2). In addition, peripheral Müller cells from the AIR donor were enriched for ANXA1 and ANXA2, which have been shown to be upregulated in reactive glial populations in the brain [29]. Immunofluorescent IHC also demonstrates increased ANXA1 labeling in cells of the AIR donor (Figure 5B), which co-localizes with GFAP expression (Figure S3). Cluster 6, with 99% of cells originating from the periphery of the AIR donor, was interpreted as retinal pigment epithelium (RPE) cells (Figure 5F). Cells in this cluster demonstrated high expression of SERPINF1 (the gene encoding PEDF) and RLBP1 (the gene encoding cellular retinaldehyde binding protein). Although retinal samples were dissected away from the underlying RPE and choroid, the recovery of RPE cells suggests that either some RPE cells migrated into the inner retina or remained adhered to the outer retina after dissection, consistent with both the clinical observation of bone spicule like pigmentation in the patient's neurosensory retina (Figure 1A–B) and the morphological finding of pigment migration into the inner retina (Figure 2D). Figure 5. Exploration of autoimmune retinopathy dominant clusters. (A): The library composition of each cluster is displayed, with cells originating from the control foveas represented in shades of blue while cells originating from the control peripheries are in shades of green. Cells originating from the AIR donor are colored light red (fovea) or dark red (periphery). Three clusters (Cluster 4–6) consist predominantly of cells from the periphery of the AIR donor. (B): Immunofluorescent labeling of ANXA1 in the retina of a control donor (left) and the AIR donor (right). The AIR donor demonstrates increased ANXA1-labeling of the inner retina. Scale bar = 100 microns. (C): Violin plots of SOCS3, GFAP, RLBP1, and SERPINF1 expression are used to classify the cell types of clusters 4–6. (D): Cluster 4 specifically expressed SOCS3, which is enriched in reactive astrocytes. (E): Cluster 5 and Clusters 7-12 express the Müller cell specific gene RLBP1. (F): Cluster 6 expresses the RPE-specific gene SERPINF1. (G): Healthy foveal and peripheral Müller cells have distinct gene expression profiles. The variable delta percent along the x-axis represents the proportion of foveal Müller cells that express the gene of interest minus the proportion of peripheral Müller cells that express that gene. (H): Foveal Müller cells originating from the control donors have similar gene expression profiles to foveal Müller cells originating from the AIR donor. (I): In contrast, peripheral Müller cells from control versus the AIR donor demonstrated more transcriptomic differences. Genes with a log fold-change greater than 1.0 and a delta percent greater than 0.35 are labeled in (G–I).	doab	2025-04-07T03:56:59.514666	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 63 }
00a6a373-fd58-400b-bd1a-e87d014d5110.64	4. Discussion Autoimmune retinopathy (AIR) is a blinding, immune-mediated inflammatory condition in which anti-retinal antibodies result in retinal cell destruction. In most cases, photoreceptor cells are the primarily targeted cell type, although antibodies against bipolar cells have also been reported [30]. The clinical presentation of the patient in this report follows the classical trajectory of sudden, bilateral loss of peripheral vision, consistent with rod photoreceptor cell dysfunction [31]. The etiology of AIR is broadly subdivided into paraneoplastic and non-paraneoplastic disease. Identifying anti-retinal antibodies can support a diagnosis of AIR, however una ffected individuals may also have circulating anti-retinal antibodies, limiting the specificity of this diagnostic assay [32,33]. Consistent with the clinical history of peripheral visual deterioration, histological examination of the AIR patient revealed a profound loss of both cone and rod photoreceptor cells and destruction of the inner and outer photoreceptor segments in the periphery (Figure 2C). However, in the macula, rare attenuated cone photoreceptor cells were still present (Figure 2F). Single-cell RNA sequencing supported these clinical and histological findings. Only a single rod photoreceptor cell was recovered from the periphery of the AIR donor while numerous foveal cones were recovered. In addition, single-cell RNA sequencing identified the presence of RPE cells in the periphery of the AIR donor, as was observed on histological examination (Figure 2D). Gene expression comparisons between the AIR donor and the four control donors were remarkably similar for most cell types. However, peripheral astrocytes and Müller glial cells were more abundant and demonstrated unique expression signatures in the AIR patient. Collectively, these expression data corroborate the clinical and histologic findings and provide evidence that single-cell RNA sequencing can be a complementary tool for investigating the molecular features of a human retinal disease. The retina contains two major classes of glial cells: Müller cells and astrocytes. Müller cells are elongated cells that extend from the external limiting membrane (apical end) to the internal limiting membrane (basal feet). Müller cells provide metabolic and structural support to retinal neurons, ensheathing neural somas and comprising an important part of the blood retina barrier. Astrocytes also metabolically support the retina, however astrocytes do not originate from the embryonic retinal neuroepithelium but rather enter the retina by migrating along the developing optic nerve [34]. As opposed to Müller cells, astrocytes are star-shaped cells with radiating processes located in the nerve fiber and ganglion cell layers. Both astrocytes and Müller glial cells are capable of responding to retinal injury and exerting neuroprotective e ffects on the retina in a process known as reactive gliosis [35]. In this wound response process, glial cells proliferate and undergo changes in gene expression for improved neuronal protection and repair [36,37]. In the donor with AIR, the transcriptional response of the glial cells can likely be attributed to their interactions with degenerating retina. Within the fovea, where the retina clinically and histologically was most intact, Müller cells from the AIR donor were transcriptionally similar to foveal Müller cells from the control patients. Yet in the peripheral retina, where the AIR donor experienced progressive visual field loss and a complete loss of the outer nuclear layer, peripheral Müller cells segregated into a distinct cluster and demonstrated a reactive gliotic phenotype (Figure 5I). Likewise, many astrocytes were recovered from the periphery of the AIR donor that expressed genes implicated in reactive gliosis (Figure S1). Reactive astrogliosis is marked by astrocyte proliferation and migration, which may have led to an increased number of peripherally localized astrocytes available for recovery in the AIR donor, consistent with recent single-cell RNA sequencing studies characterizing microglial proliferation in response to retinal damage in mice [38]. Collectively, the gliotic injury response induced by Müller cells and astrocytes has many neuroprotective benefits, ye<sup>t</sup> chronic gliotic activation can further injure retinal neurons and disrupt the blood–retinal barrier, leading to worsening vision [39,40]. In the setting of chronic retinal injury, interventions that modulate gliotic activation may optimize preservation of remaining retinal function [41]. While glial cells from the AIR donor demonstrated reactive transcriptional changes, most inner retinal cell populations from this donor had remarkably similar gene expression profiles to the control donors (Figure 4C,F). Likewise, histological examination revealed preserved inner retinal morphology with discrete inner nuclear and ganglion cell layers (Figure 2B,C). Collectively, these findings sugges<sup>t</sup> that even in the setting of photoreceptor cell degeneration, the inner retinal wiring remains largely undamaged. The presence of morphologically and transcriptomically normal inner retinal cells is promising for prospective photoreceptor degeneration treatments, including autologous retinal cellular replacement strategies [42]. There are several limitations to this study. First, AIR is a rare retinal disease, preventing us from including multiple patients with this condition in this investigation. As a result, gene expression differences between the AIR donor and the four control donors are valuable for hypothesis generation but should be interpreted with caution. Second, while all samples had identical sample processing, certain cell types might have a selective advantage in cellular recovery for single-cell RNA sequencing. Recovered proportions of cells at the single-cell level (Figure 4B,E) should not be interpreted as the true cellularity of the retina. This study provides a complementary investigation of the clinical and molecular response of the retina in AIR. Clinical, histologic, and transcriptomic evidence identify the loss of cone and rod photoreceptor cells with relative preservation of inner retinal cell types. The gliotic transcriptional profile of astrocyte and Müller glial populations observed in this case provides some new insight into the retina's response to photoreceptor degeneration. Supplementary Materials: The following are available online at http://www.mdpi.com/2073-4409/9/2/438/s1, Figure S1: AIR astrocytes demonstrate a reactive gene expression profile. Figure S2: Increased GFAP in the AIR donor versus a healthy control donor. Figure S3 ANXA1 and GFAP co-localization in the AIR donor. Table S1: Library Composition, Table S2: Differential expression between the AIR donor versus four control donors. Author Contributions: Conceptualization, R.F.M. and E.M.S.; methodology, A.P.V., E.B., R.F.M., E.M.S.; software, A.P.V., A.P.D., T.E.S.; validation, E.B., M.J.F.-W., S.Z.; formal analysis, A.P.V., A.P.D., T.E.S.; investigation, A.P.V., E.B., M.J.F.-W., S.Z., A.P.D., T.E.S., B.A.T., R.F.M., E.M.S.; resources, T.E.S., B.A.T., R.F.M., E.M.S. data curation, A.P.V., E.B., T.E.S., R.F.M.; writing—original draft preparation, A.P.V., E.B., B.A.T., R.F.M., E.M.S.; writing—review and editing, M.J.F.-W., S.Z., A.P.D., T.E.S.; visualization, A.P.V., E.B., R.F.M.; supervision, T.E.S., B.A.T., R.F.M., E.M.S.; project administration, E.M.S.; funding acquisition, T.E.S., B.A.T., R.F.M., E.M.S. All authors have read and agreed to the published version of the manuscript. Funding: This research was funded by NIH grants T32 GM007337, R21 EY027038, and P30 EY025580 with support from Research to Prevent Blindness and the Elmer and Sylvia Sramek Charitable Foundation. Acknowledgments: We wish to thank the Iowa Lions Eye Bank, the donors, and their families for the generous role in this research. The ANXA1 monoclonal antibody developed by the Clinical Proteomics Technologies for Cancer and was obtained from the Developmental Studies Hybridoma Bank, created by the National Institute of Child Health and Human Development of the NIH and maintained at the Department of Biology, The University of Iowa (Iowa City, IA). Conflicts of Interest: The authors declare no conflict of interest.	doab	2025-04-07T03:56:59.515581	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 64 }
00a6a373-fd58-400b-bd1a-e87d014d5110.67	Role of FGF and Hyaluronan in Choroidal Neovascularization in Sorsby Fundus Dystrophy Alyson Wolk 1,2, Dilara Hatipoglu 1, Alecia Cutler 1, Mariya Ali 1, Lestella Bell 1,3, Jian Hua Qi 1, Rupesh Singh 1, Julia Batoki 1, Laura Karle 1, Vera L. Bonilha 1,2,3, Oliver Wessely 2,4, Heidi Stoehr 5, Vincent Hascall 6 and Bela Anand-Apte 1,2,3,\* Received: 11 January 2020; Accepted: 28 February 2020; Published: 4 March 2020 Abstract: Sorsby's fundus dystrophy (SFD) is an inherited blinding disorder caused by mutations in the tissue inhibitor of metalloproteinase-3 (TIMP3) gene. The SFD pathology of macular degeneration with subretinal deposits and choroidal neovascularization (CNV) closely resembles that of the more common age-related macular degeneration (AMD). The objective of this study was to gain further insight into the molecular mechanism(s) by which mutant TIMP3 induces CNV. In this study we demonstrate that hyaluronan (HA), a large glycosaminoglycan, is elevated in the plasma and retinal pigment epithelium (RPE)/choroid of patients with AMD. Mice carrying the S179C-TIMP3 mutation also showed increased plasma levels of HA as well as accumulation of HA around the RPE in the retina. Human RPE cells expressing the S179C-TIMP3 mutation accumulated HA apically, intracellularly and basally when cultured long-term compared with cells expressing wildtype TIMP3. We recently reported that RPE cells carrying the S179C-TIMP3 mutation have the propensity to induce angiogenesis via basic fibroblast growth factor (FGF-2). We now demonstrate that FGF-2 induces accumulation of HA in RPE cells. These results sugges<sup>t</sup> that the TIMP3-MMP-FGF-2-HA axis may have an important role in the pathogenesis of CNV in SFD and possibly AMD. Keywords: sorsby's fundus dystrophy; hyaluronan; neovascularization; retina	doab	2025-04-07T03:56:59.516104	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 67 }
00a6a373-fd58-400b-bd1a-e87d014d5110.68	1. Introduction Sorsby's fundus dystrophy (SFD) is a dominantly inherited, degenerative disease of the macula that is characterized by bilateral loss of central vision as a consequence of choroidal neovascularization (CNV) [1–6]. Specific mutations in the tissue inhibitor of metalloproteinase 3 (TIMP3) gene involving exon 5, exon 1 or the intron 4-exon 5 boundary have been shown to be causative [7–14]. In comparative studies using TIMP3 deficient mice, S179C-TIMP3 transgenic mice and in vitro culture experiments we have determined that TIMP3 partially inhibits angiogenesis by blocking the binding of vascular endothelial growth factor (VEGF) to VEGF Receptor 2 (VEGFR2). We have also demonstrated that the S179C-TIMP3 mutant protein induces angiogenesis via VEGF and fibroblast growth factor 2 (FGF-2) [15–21]. TIMP3 is produced constitutively by the retinal pigment epithelium (RPE) and choroidal endothelial cells [2,20]. It is a normal component of Bruch's membrane [22] and binds to sulfated glycosaminoglycans of the extracellular matrix (ECM) [23,24]. Hyaluronan (HA) is a large glycosaminoglycan that is a significant component of peri-cellular and extracellular matrices. HA is essential for numerous physiological functions that are dependent on its chain size and its interactions with various effector proteins and receptors [25]. HA has been implicated in the regulation of neovascularization and endothelial barrier function [26]. While studies have demonstrated that signaling via HA and its cell surface receptor CD44 accentuates CNV in mice using a laser-induced model [27], the exact molecular mechanism by which HA regulates tissue remodeling and neovascularization is unknown. We have recently reported that RPE cells expressing mutant TIMP3 secrete increased amounts of FGF-2 [28] and that this contributes to increased angiogenesis. FGF-2 has been shown to be important in tumor angiogenesis, but its role in CNV has been less well studied. The most direct evidence for a role of FGF-2 in CNV comes from studies in which Flk1-Cre or Tie2-Cre mediated deletions of FGF receptor 1 (FGFR1) and FGF receptor 2 (FGFR2) in endothelial cells resulted in reduced laser-induced CNV in mice [29]. Extracellular matrix components such as heparan sulfate proteoglycans (HSPGs) bind and regulate the activity of growth factors such as FGF-2 [30] and have a critical role in the regulation of neovascularization [31]. In addition, the observation that activation of the FGFR-STAT3 pathway can induce a hyaluronan-rich microenvironment that can affect tumor growth [32] led us to test the hypothesis that in addition to VEGF, FGF-2 and hyaluronan also have critical roles in the increased neovascularization induced by mutant TIMP3 in Sorsby's fundus dystrophy.	doab	2025-04-07T03:56:59.516245	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 68 }
00a6a373-fd58-400b-bd1a-e87d014d5110.70	2.1. Human Samples Patients with AMD and controls (without AMD or any other retinal disease) were recruited from the eye clinics at Cole Eye Institute under Cleveland Clinic Foundation approved IRB protocols. Plasma samples were prepared and stored at −80 ◦C. Samples from patients (n = 49, with 26 males and 23 females) given a clinical diagnosis of geographic atrophy or CNV and age-matched controls (n = 59 with 28 males and 31 females) were included in this pilot study to evaluate HA in the plasma. Normal and/or AMD post-mortem eyes were obtained from the Cleveland Eye Bank, the National Disease Research Interchange (Philadelphia, PA, USA) or from the Cole Eye Institute Eye Tissue Repository through the Foundation Fighting Blindness (FFB) Eye Donor Program (Columbia, MD, USA). All post-mortem tissue were obtained in accordance with the policies of the Eye Bank Association of America and the Institutional Review Board of the Cleveland Clinic Foundation (IRB#14-057). Eye bank records accompanying the donor eyes indicated whether the donor had AMD or no known eye diseases. The analyzed tissue included FFB donations #714 (82 y.o.), #781 (80 y.o.), #711 (83 y.o.), #722 (90 y.o.), #716 (80 y.o.) and #739 (90 y.o.), identified as AMD. Postmortem eyes from a 95 (#784), 92 (#979) and a 91 year-old donor without a history of retinal disease were used as controls. Eyes were enucleated 4 to 22 h postmortem and fixed in 4% paraformaldehyde and 0.5% glutaraldehyde in phosphate buffer. The globes were stored in 2% paraformaldehyde in D-PBS.	doab	2025-04-07T03:56:59.516438	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 70 }
00a6a373-fd58-400b-bd1a-e87d014d5110.71	2.2. Mice All mice utilized in this study were housed in the Cole Eye Institute vivarium under approved Institutional Animal Care and Use Committee (IACUC) protocols. All procedures on the mice were in accordance with ARVO statement for the Use of Animals in Ophthalmic and Vision Research and conformed to the National Institutes of Health Guide for the Care and Use of Animals in Research and to the ARVO statement for the use of animals in ophthalmic and vision research. Timp3+/S179C mice were generated in the laboratory of Dr. Bernhard Weber using site-directed mutagenesis and homologous recombination in embryonic stem (ES) cells to generate mutant ES cells carrying the Timp3S179C allele. Heterozygous breeding of Timp3+/S179C [33] produced homozygous Timp3S179C/S179C mice and age-matched littermate controls in a C57BL6 background. Similarly, heterozygous Timp3+/- mice [34] were bred to generate Timp3-/- knockouts and TIMP3+/+ littermate controls. Eyes were enucleated following euthanasia and fresh frozen in tissue-plus optical cutting temperature embedding medium (Scigen, #4583) for sectioning and histology. Blood samples were collected via cardiac puncture and plasma prepared via standard protocols. ### 2.3. Hyaluronan Enzyme-Linked Immunosorbent Assay (ELISA) Plasma from human patients with and without AMD and from SFD mouse models were measured for HA contents by solid-phase sandwich ELISA in 96-well plates (Costar, #9018) using the Hyaluronan Duo-Set ELISA kit (R&D Systems, #DY3614-05).	doab	2025-04-07T03:56:59.516570	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 71 }
00a6a373-fd58-400b-bd1a-e87d014d5110.72	2.4. Immunofluorescence Retina sections and flat-mounted ARPE-19 cells grown on polyester trans-wells were fixed for 5 min in 4% paraformaldehyde and blocked in 1% bovine serum albumin with 0.1% Triton X-100 in phosphate-bu ffered saline. Human sections were processed with melanin bleaching kit to remove autofluorescence (Polysciences, Inc., Warrington, PA, USA, #24883A-B). Samples were incubated overnight with biotinylated HA binding protein, (Millipore Sigma, #385911) or primary antibodies (anti-ezrin, clone 3C12, Invitrogen, Carlsbad, CA, USA #MA5-13862) in humidified chambers at 4 ◦C. Subsequently, secondary antibodies (anti-mouse AlexaFluor 594, streptavidin-AlexaFluor 488, streptavidin-AlexaFluor 647, all from ThermoFisher Scientific, Waltham, MA, USA) were incubated with samples at room temperature for one hour in the dark. Rhodamine-phalloidin (Thermo Fisher Scientific, R415) was incubated together with secondary antibodies. Then, <sup>4</sup>,6-diamidino-2-phenylindole (DAPI) was used to stain nuclei of murine sections and cell culture mounts and SYTOX green (ThermoFisher Scientific, #S7020) was used to stain nuclei in human sections. Imaging by confocal microscopy was performed (Leica TCS-SP8, Exton, PA, USA). The localization of Bruch's membrane was determined by its autofluorescence at 405 nm. ### 2.5. Hyaluronidase Treatment of Retina Sections Hyaluronidase from Streptomyces hyalurolyticus (Millipore Sigma, Burlington, MA USA, #H1136) was used to treat retina sections as described previously [35]. Streptomyces hyaluronidase was resuspended in 0.1 M sodium acetate bu ffer, pH 5.0, at 100 U/mL. To prevent any nonspecific digestion, the following protease inhibitors were added to the sodium acetate bu ffer: 1 mM iodoacetic acid, 1 mM phenylmethyl sulfonylfluoride, 1 mM EDTA, 1 μg/mL pepstatin A, 250 μg/mL ovomucoid. Hyaluronidase solution (100 mU/mL of hyaluronidase in PBS with CaCl2 (0.1 g/L) and MgCl2 (0.1 g/L)) was applied onto the sections for 3 h at 37 ◦C. Slides were subsequently fixed in 4% paraformaldehyde and examined by fluorescence microscopy.	doab	2025-04-07T03:56:59.516796	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 72 }
00a6a373-fd58-400b-bd1a-e87d014d5110.73	2.6. Cells and Reagents ARPE-19 cells stably expressing S179C-TIMP3, wild-type-TIMP3 (WT), or vector alone were reported previously [19]. Cells were expanded in DMEM-F12 with 10% FBS before transfer to polyester inserts coated with mouse laminin (Corning Inc., Corning, NY, USA, #23017). 720,000 cells and 100,000 cells were plated per well in each well of a 12-well plate or 24-well plate, respectively using a previously published protocol [36]. Essentially, ARPE-19 cells were cultured for at least 2 weeks in nicotinamide-supplemented media with 1% FBS. Media were replaced twice per week. Cells were serum-starved for 24 h before treatment with the FGF Receptor inhibitor BGJ-398 (Selleckchem, Houston, TX, USA, #S2183) for 48 h. Similarly, cells were treated with FGF-2 (Gibco from Thermo Fisher Scientific, #13256-029) with the required cofactor heparin sodium salt (1 μg/mL, Sigma Aldrich, #H3149) for 48 h after serum starving for 24 h. ### 2.7. Quantitation of Immunofluorescence by Integrated Density Analysis Fluorescence intensity of HABP staining was quantified using integrated density analysis as previously described [37,38]. For all the RPE cell culture confocal microscopy images, fluorescence was quantitated using a standard measure of integrated density, which is the product of area and mean gray value. A custom written automated image analysis code was developed using Matlab (MATLAB 2019a, The MathWorks, Inc., Natick, MA, USA) for separating the desired color channel from the image, thereby obtaining the total area (in pixels), the mean gray value, and the integrated density. ### 2.8. In Vivo Imaging and Laser Injury Model Laser mediated CNV was induced as described previously [28]. Briefly, mice were anesthetized with 65–68 mg/kg sodium pentobarbital delivered intra-peritoneally. Topical 0.5% procaine solution was applied for cornea anesthesia. Following anesthesia, pupils were dilated with 0.5% topical tropicamide/phenylephrine combination drops (Santen Pharmaceuticals, Osaka, Japan). Four laser spots were placed in the superior, superior-temporal, or superior-nasal quadrants of the fundus using a green solid-state laser (Oculight by Iridex Corp., Mountain View, CA, USA) (532 nm; 2500 mW; 0.50 s pulse duration; 50 μm spot size) using a slit lamp delivery system and a microscope coverslip placed and a ffixed to the cornea with a drop of Systane Ultra artificial tears (Alcon, Ft Worth, TX, USA). All animals were scanned immediately after laser injury with optical coherence tomography (Envisu R2210 UHR Leica Microsystems Inc., Wetzlar, Germany) to confirm successful RPE-Bruch's membrane rupture, an endpoint in laser-induced CNV models.	doab	2025-04-07T03:56:59.516949	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 73 }
00a6a373-fd58-400b-bd1a-e87d014d5110.74	2.9. Statistical Analysis All parameters in the study were distributed normally. Data are expressed as mean ± SEM. Di fferences were tested by unpaired t-test (Figure 1, Figure 2 and Figure 3) or by using multiple t-tests employing two-stage linear step-up procedure of Benjamini, Krieger and Yekutieli, with a false discovery rate set to 1% (Figure 4 and Figure 5). Each group was analyzed separately without the assumption of consistent standard deviation. p < 0.05 values were considered statistically significant. Statistical analysis was performed with GraphPad Prism 7.03 (GraphPad Software, Inc., San Diego, CA, USA).	doab	2025-04-07T03:56:59.517139	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 74 }
00a6a373-fd58-400b-bd1a-e87d014d5110.75	3. Results ### 3.1. Hyaluronan is Elevated in Plasma and RPE/Choroid of Patients with AMD Age-related macular degeneration (AMD) is usually seen as two main types. "Dry" AMD where deposits called drusen develop in the macular region that ultimately progress to a late stage in which there is atrophy of the macula (geographic atrophy). "Wet" AMD describes AMD in which patients develop abnormal growth and leakage of the choroid vessels beneath and into the retina, termed choroidal neovascularization (CNV). HA contents were measured in plasma from patients with late stage AMD (geographic atrophy or choroidal neovascularization) and from age-matched controls without the disease. ELISA analysis (Figure 1A) indicates that HA contents were significantly increased in the plasma of patients with late-stage AMD (mean ± SEM: 111.8 ± 5.78 ng/mL) compared with plasma of controls without AMD (32.91 ± 5.75). Figure 1. Hyaluronan HA is increased in circulation and in the RPE of age-related macular degeneration (AMD) patients. (A) HA was increased in plasma from patients with late-stage AMD (GA or CNV) compared to age-matched, normal controls. Data are presented as mean ± SEM (B–J) Representative human retina sections stained with HA binding protein (HABP) (B) Human retina section stained with streptavidin-AlexaFluor 647 in the absence of HA binding protein serves as a specificity control. (C–J) Human retina sections stained with streptavidin-AlexaFluor 647 in the presence of HA binding protein. HA is increased in the RPE in patients with dry AMD (D,H), wet AMD (E,I), and around drusen (F,J) compared to the RPE from an aged-match normal control (C,G). 40× images (B–F), 63× images (G–J). Green: HA; red: Bruch's membrane determined by its autofluorescence at 405 nm; blue: DAPI. Asterisks indicate drusen (F,J). GA—geographic atrophy; CNV—choroidal neovascularization; ONL—outer nuclear layer; RPE—retinal pigment epithelium; Ch—choroid; DAPI—4,6-diamidino-2-phenylindole. To evaluate the distribution of HA in the retina under physiological and pathological conditions, sections from post-mortem human donor eyes from 3 controls and 6 AMD (4 dry and 2 wet AMD) patients were stained for HA using biotinylated HA binding protein (HABP). HA was found to be localized predominantly in the choroid of normal eyes (Figure 1C) as described previously [39,40]. Increased deposition of HA was seen around the RPE in AMD eyes (both in the dry (Figure 1D,H) and wet AMD specimens (Figure 1E,I)). HA was particularly enhanced in drusen and in areas of atrophy (Figure 1F,J) in AMD specimens. The sections stained with secondary antibody alone serves as a specificity control and shows minimal staining compared with sections stained with HABP (Figure 1B). ### 3.2. Increased Plasma HA and Accumulation of HA in the RPE of SFD Mice We utilized two mouse models to study the potential role of TIMP3 in the regulation of HA in the retina: mice lacking TIMP3 [34] and mice carrying the S179C-TIMP3 SFD mutation [33]. Plasma from S179C-TIMP3 and TIMP3-KO mice at 4–6 weeks of age was collected and HA contents were analyzed by ELISA. HA content of plasma was significantly increased in mice lacking TIMP3 as well as in mice carrying the S179C-TIMP3 mutation (Figure 2A), suggesting that TIMP3 may be important in regulating HA. Figure 2. HA is increased in circulation and in the RPE and choroid in mouse models of Sorsby's fundus dystrophy. (A) HA was increased in plasma from S179C-TIMP3 knockin mice (Timp3S179C6/S179C) and TIMP3-KO (Timp3-/-) mice compared to wild-type (WT) littermates. (n ≥ 5). Data are presented as mean ± SEM. (B) Mouse retina sections stained with biotinylated HA binding protein (HABP) in the absence (upper panel) or presence (lower panel) of hyaluronidase to detect HA. HABP staining is specific for HA as shown by the absence of staining in sections treated with hyaluronidase (lower panel). Green: HA; blue: DAPI. (C–H) Representative images of HA staining of mouse sections from wild-type (WT) mice (C,F), S179C-TIMP3 mutant mice (D,G) and TIMP3-KO mice (E,H). HA is increased in the RPE and choroid of S179C-TIMP3 (D) and TIMP3-KO (E) mice compared to wild-type (WT) littermate controls (C). HA (green) is predominantly localized to the basal surface of the RPE (\\) (F–H) and not to the apical surface (\) as shown by co-staining with ezrin, a marker for the apical microvilli of RPE (red). 40× images (C–E); 63× images (F–H). n ≥ 3 for all immunohistochemistry data. To determine if there was a similar correlation between the plasma HA levels and the accumulation of HA in the RPE as observed in human sections with AMD, we evaluated accrual of HA in the retinas of mice (8 weeks of age) lacking TIMP3 or carrying the SFD mutation. Cryosections of retina from mice of each specific genotype and wild-type littermates were stained for HA content with HABP. To ascertain that HABP binds HA specifically, sections were treated with hyaluronidase prior to staining with HABP. Indeed, pre-treatment with hyaluronidase resulted in absence of staining with HABP (Figure 2B, lower panel). S179C-TIMP3 mice (Figure 2D) and TIMP3-KO mice (Figure 2E) show increased accumulation of HA beneath the RPE and in the choroid compared to that seen in wildtype littermates (Figure 2C). Staining with antibodies to ezrin served as a marker for RPE apical microvilli (Figure 2C–H), and the higher magnification images (Figure 2F–H) confirmed the RPE localization of HA to the basal surface of the cells. To identify the potential mechanism by which S179C-TIMP3 regulates HA we utilized stable human RPE lines (ARPE-19) expressing S179C-TIMP3 [20]. ARPE-19 cells (expressing S179C-TIMP3, wildtype TIMP3 (WT-TIMP3) and empty vector (Vector)) were cultured for 2–6 weeks in 1% serum on trans-well inserts and stained for HA. Increased accumulation of HA was observed in RPE cells expressing S179C-TIMP3 (Figure 3C,G) compared with cells transfected with empty vector (Figure 3A,G) or expressing wildtype TIMP3 (Figure 3B,G). The accumulation was predominantly intracellular and apical in the RPE (Figure 3D–F). There appear to be multiple layers of S179C-TIMP3 RPE cells on the transwell compared with a single monolayer for WT-TIMP3 and vector cells, which might sugges<sup>t</sup> epithelial-mesenchymal transition. Figure 3.* HA is increased in S179C-TIMP3 RPE cells in culture. (A–C) ARPE-19 cells expressing S179C-TIMP3 grown in culture for at least 2 weeks on trans-well inserts have increased HA (C) compared to WT-TIMP3 expressing cells (B) or vector only controls (A).(D–F) Z-plane images of HA in RPE monolayers grown on trans-well inserts show increased intracellular HA in S179C-TIMP3 cells. Green: HA; blue: DAPI. (G) Fluorescence intensity was quantitated by integrated density measurement (n ≥ 4, for each cell line). Data are presented as mean ± SEM. ### 3.3. FGF-2 Contributes to HA Accumulation in the RPE We have recently reported that RPE cells expressing S179C-TIMP3 secrete higher amounts of FGF-2 compared with control cells [28]. Previous studies have suggested that FGF signaling has the propensity to increase HA accumulation [32]. To experimentally test this hypothesis in RPE cells, we evaluated the ability of FGF-2 to induce HA accumulation in primary porcine RPE cells. Cells cultured for 3 weeks on trans-well inserts in 1% serum were treated with 0 ng/mL, 10 ng/mL, 25 ng/mL, or 100 ng/mL of FGF-2 in the presence of 1 μg/mL heparin, a cofactor for FGF receptor signaling. FGF-2 induced HA accumulation in a dose-dependent manner (Figure 4A–I) with maximum HA deposits being observed with a dose of 25 and 100 ng/mL (Figure 4D,H). This was confirmed by quantitation of fluorescence by integrated density measurements (Figure 4I). The FGF-2 induced accumulation of HA was seen predominantly on the apical surface of the RPE with increased basal and peri-cellular accumulation at higher doses (Figure 4E–H). Figure 4. FGF-2 induces HA accumulation in primary RPE cells. (A–D) FGF-2 induced HA accumulation in primary porcine RPE cells in a dose-dependent manner (A) 0 ng/mL, (B) 10 ng/mL, (C) 25 ng/mL, (D) 100 ng/mL. Fluorescence intensity was quantitated by integrated density measurement (I) (n ≥ 4, for each cell line). Data are presented as mean ± SEM (E–H) Z-plane images show that increased concentrations of FGF-2 induce increased apical accumulation of HA in addition to some peri-cellular and basal deposits of HA at high doses of FGF-2. Green: HA, red: phalloidin; blue: DAPI. To determine if the accumulation of HA seen in RPE cells expressing S179C-TIMP3 was a consequence of increased FGF signaling, cells (RPE cells expressing S179C-TIMP3, wildtype TIMP3 or empty vector) were treated with BGJ-398, an FGF receptor inhibitor. 10 μM BGJ-398 decreased HA content in RPE cells expressing S179C-TIMP3 (Figure 5C,F,H,I) and WT-TIMP3 (Figure 5B,E,I) but not vector only transfected cells (Figure 5A,D,I) when compared with their respective untreated cells that served as controls (Figure 5A: vector, 5B: WT-TIMP3 and 5C,G: S179C-TIMP3). Quantitation of fluorescence by integrated density analysis revealed that 10 μM BGJ-398 decreased HA accumulation in S179C-TIMP3 cells 63.1% (SD = 0.241) and only 43.4% (SD = 0.291) in wildtype cells (Figure 5I). Quantitation confirmed that BGJ-398 had no significant effect on vector only cells (Figure 5I), suggesting an FGF-specific mechanism for HA accumulation in S179C-TIMP3 cells. Figure 5. Inhibition of FGF signaling decreases HA accumulation in S179C-TIMP3 RPE cells. Vector only (A), WT-TIMP3 (B), and S179C-TIMP3 (C) expressing ARPE-19 cells were grown on trans-well inserts for 4 weeks before treatment with FGF receptor inhibitor BGJ-398. Treatment with BGJ-398 decreased HA accumulation in S179C-TIMP3 expressing RPE cells (F,H,I) and to a lesser extent in WT-TIMP3 expressing cells (E,I) but has no effect on control vector RPE cells (A,D,I). (I) Control (Black Bar) indicates respective untreated cells compared with BGJ-398 treated cells (Grey bar). (G,H) Z-plane images of S179C-TIMP3 cells in the absence (G) and presence (H) of 10 μM BGJ-398 S179C-TIMP3 cells show an overall reduction in HA accumulation, including intracellular HA, after treatment with BGJ-398. Green: HA; blue: DAPI. (I) data are presented as mean ± SEM (n ≥ 6). ### 3.4. Increased HA is Associated with CNV in AMD and SFD Sections of post-mortem eyes from a patient with CNV showed significant HA deposition around the RPE (Figure 6C,D) when compared with control eyes (Figure 6A,B). While S179C-TIMP3 mice do not demonstrate a florid SFD phenotype as seen in humans, they do have increased susceptibility to experimental laser-induced CNV [28] as do the TIMP3-KO mice [41]. We have previously shown that FGF-2 from S179C-TIMP3 RPE cells can stimulate angiogenesis [28]. Since FGF-2 contributes to HA accumulation in the RPE and to angiogenesis, we evaluated if HA content and distribution was altered in laser-induced CNV lesions in S179C-TIMP3 mice. As described previously lesions in S179C-TIMP3 mice were larger and leakier compared to controls [28]. Increased HA accumulation was observed in CNV in S179C-TIMP3 mice (Figure 6H–J) when compared to lesions in control mice (Figure 6E–G) which appears to be a consequence of altered distribution to the CNV lesions in S179C-TIMP3 mice. Figure 6. HA is increased in choroidal neovascular lesions in AMD patients and in S179C-TIMP3 mice. (A–D) HA is increased in the RPE in a patient with CNV (C,D) and in the CNV lesion compared to the RPE of a normal patient (A,B). Green: HA; blue: nuclei; red: Bruch's membrane. Arrows indicate RPE, double asterisks indicate CNV lesion. (E–G) HA is increased in laser-induced CNV lesions in S179C-TIMP3 mice compared to wild-type (WT) littermates 5 days post injury. (E,H) Arrows indicate CNV lesion. (F,I) Brightfield image overlaid on fluorescent image shows disruption of RPE and Bruch's membrane. (G,J) HA accumulation is diffuse and appears predominantly in the borders of the lesion in WT (E–G) compared to dense mass within the lesions of S179C-TIMP3 mice (H–J). Green: HA; blue: nuclei.	doab	2025-04-07T03:56:59.517205	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 75 }
00a6a373-fd58-400b-bd1a-e87d014d5110.76	4. Discussion Sorsby's fundus dystrophy (SFD) is a rare macular dystrophy characterized by vision loss due to persistent choroidal neovascularization [1–6]. SFD is an autosomal dominant, fully penetrant degenerative disease of the macula and is notable for its similarity in histopathological features to AMD [3–6]. The majority of SFD patients develop CNV, as well as confluent, 20–30 μm thick, amorphous deposits between the basement membrane of the RPE and Bruch's membrane. TIMP3 and/or its downstream substrates have been postulated to have a role in the pathogenesis of both SFD and AMD, because accumulation of TIMP3 has been observed in subretinal deposits in SFD [42] as well as in AMD drusen [43–45]. In this study, we show that hyaluronan accumulates around the RPE in AMD as well as in CNV lesions of mice expressing S179C-TIMP3. One interesting observation from our studies was the increase in HA in the plasma of patients with AMD as well as in mice lacking TIMP3 or carrying the S179C-TIMP3 mutation. Although we observe significant di fferences in the plasma levels of HA in patients with advanced AMD (GA and CNV), the number of patients analyzed (n = 49 controls) and n = 59 (AMD) is not su fficient to determine if this is of prognostic value. In addition, we did not have access to samples from patients at di fferent degrees of severity to be able to draw conclusions with this or the rate of progression of the disease. Future studies are warranted to address this question. While patients with SFD generally demonstrate disease localized to the retina, our results may be a consequence of ubiquitous expression of TIMP3 in a variety of tissues in the body [46] which could potentially explain the systemic increase in HA. Whether there is accumulation of HA in other tissues in S179C TIMP3 mice has not been evaluated. Our studies with RPE cells sugges<sup>t</sup> that the increase in HA in these cells is likely a consequence of increased FGF. A recent study [47] suggests that TIMP proteins can control FGF-2 bioavailability in skeletal tissue and the same might be true of multiple tissues leading to systemic increase in HA in the plasma. The exact mechanism by which TIMP3 regulates FGF bioavailability in the RPE is currently unknown, but it is highly likely that the TIMP-metalloproteinase axis likely has a key role. The extracellular matrix (ECM) serves as a high capacity reservoir for FGF-2 and early studies have demonstrated that matrix metalloproteases (MMPs) have the ability to mobilize FGF-2 to a soluble phase that results in receptor activation [48]. Additional studies identifying the molecular mechanisms by which TIMP3 regulates FGF-2 bioavailability will provide insight into the pathophysiology of the disease. FGF-2 is su fficient to increase HA accumulation and distribution in the RPE, and blocking FGF signaling in S179C-TIMP3 RPE cells brings HA levels back to normal. The mechanism by which FGF-2 increases HA accumulation is not understood. HA is endogenously synthesized by a family of membrane-integrated glycosyltransferases, called hyaluronan synthases (HAS 1-3) and is exported directly into the ECM [49,50]. Hyaluronidases (HYAL1-2) are a class of enzymes that degrade HA [51]. A balance between HA synthesizing and degrading activity keeps HA at physiological levels. In order to determine the mechanism of accumulation of HA in the RPE in SFD, we performed quantitative PCR analysis of HAS1-3 and HYAL1-2 from RPE isolated from S179C-TIMP3, TIMP3-KO mice and wildtype littermate controls. Interestingly, we observed no changes in gene expression of any of these enzymes in the mutant mice (Supplementary Figure S1). Therefore, at least in the RPE in SFD mice, the di fferences in HA content are not due to increased expression of the synthases nor decreased expression of canonical degradation enzymes. However, there are other possibilities that need to be explored in the future. HA production could be modulated by decreasing enzyme recycling from endosomes back to the cell surface as seen in keratocytes [52]. Additionally, there is a possibility that other non-canonical hyaluronidases such as KIAA1199 [53] and Tmem2 [54] could be involved. Alternatively, as previously reported degradation might be prevented by increased binding proteins on HA and leading to net accumulation [55]. HA has been shown to exhibit a diverse array of biological functions including a role in the response to tissue damage and inflammation [56]. Our studies demonstrating accumulation of HA in laser-induced CNV lesions corroborates previous studies [27]. This study also reported an increase in CD44 and HAS2 mRNA following laser injury [27]. It is possible that the increased accumulation of HA in laser-induced CNV lesions in S179C-TIMP3 mice might result from similar increases in mRNA transcription. Chronic low-grade inflammation has been suggested to contribute to age-related macular degeneration [57]. In the laser-induced mouse model of CNV, inflammatory processes have been shown to play a role in the development and regression of the lesions. A number of reports link HA remodeling to the modulation of neuroinflammation with low-molecular weight HA being pro-inflammatory and high molecular weight HA being anti-inflammatory [58–60]. While we see increased deposition of HA in and around the RPE, we have not determined its physical properties such as size and molecular weight distribution in the tissue. The receptor engagemen<sup>t</sup> of HA in the retina or it's downstream signaling under physiological or pathological conditions has not ye<sup>t</sup> been identified and will be important as we determine its exact role in the pathology of macular degenerative disease. In our study we demonstrate that primary porcine RPE cells deposited HA predominantly on the apical surface under physiological conditions similar to what had been previously reported for human RPE cells [61]. Our data revealed that FGF-2 induced HA accumulation apically as well as between cells and on the basal surface, suggesting that in addition to increased total HA content, the distribution of HA may be important for disease pathogenesis and warrants further investigation. We have recently reported that the secretion of FGF-2 by RPE cells expressing S179C-TIMP3 led to increased angiogenesis [28]. Whether HA is modified in the endothelial glycocalyx as a consequence of FGF-2 has not been studied and might provide further insight into the pathogenesis of CNV in AMD and SFD leading to the identification of novel therapeutic approaches. Supplementary Materials: The following are available online at http://www.mdpi.com/2073-4409/9/3/608/s1, Figure S1: RNA was isolated from mouse RPE using the Simultaneous RPE cell Isolation and RNA Stabilization method (SRIRS method) using the RNA Plus Mini Kit (Qiagen). Quantitative PCR was performed following reverse transcription using TaqMan probes for the mouse genes Has1 (A), Has2 (B), Has3 (No signal), Hyal1 (C), Hyal2 (D), and 18S ribosomal RNA (rRNA) (Applied Biosystems). 18S rRNA was used as endogenous control for each gene tested. mRNA expression was calculated using 2-ΔΔCt method and shown relative to expression in wildtype littermate mice. Author Contributions: Conceptualization, A.W., O.W., V.H. and B.A.-A.; data curation, A.W.; formal analysis, B.A.-A.; funding acquisition, B.A.-A.; methodology, A.W., D.H., A.C., M.A., L.B., J.H.Q., R.S., J.B. and L.K.; project administration, B.A.-A.; resources, V.L.B., O.W. and H.S.; software, R.S.; supervision, B.A.-A.; validation, A.W.; writing—original draft, A.W.; writing—review and editing, A.W., H.S., V.H. and B.A.-A. All authors have read and agreed to the published version of the manuscript. Funding: This work was supported in part by US National Institute of Health EY027083 (BA-A), EY026181 (BA-A), P30EY025585(BA-A), T32EY024236 (AW), EY022768 (JHQ), EY027750 (VLB), Research to Prevent Blindness (RPB) Challenge Grant and RPB Lew Wasserman award to BA-A, Cleveland Eye Bank Foundation Grant and funds from Cleveland Clinic Foundation. Acknowledgments: The authors thank the retina specialists at Cole Eye Institute from whose clinics patients with or without AMD were recruited. The authors are grateful for the generous gift of TIMP-3 null mice from Rama Khokha at the Princess Margaret Cancer Centre-Ontario Cancer Institute, Toronto, Canada and to Emma Lessieur who served as the research coordinator at the time the blood samples were collected from patients The authors also acknowledge the support of Foundation Fighting Blindness in setting up the Eye Tissue Repository. We wish to extend a sincere apology to colleagues whose work was not cited due to space limitations. Conflicts of Interest: The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.	doab	2025-04-07T03:56:59.517798	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 76 }
00a6a373-fd58-400b-bd1a-e87d014d5110.78	Mouse Models of Inherited Retinal Degeneration with Photoreceptor Cell Loss ### Gayle B. Collin 1,†, Navdeep Gogna 1,†*, Bo Chang 1, Nattaya Damkham 1,2,3, Jai Pinkney 1, Lillian F. Hyde 1, Lisa Stone 1, Jürgen K. Naggert 1, Patsy M. Nishina 1,\ and Mark P. Krebs 1,\* Received: 29 February 2020; Accepted: 7 April 2020; Published: 10 April 2020 Abstract: Inherited retinal degeneration (RD) leads to the impairment or loss of vision in millions of individuals worldwide, most frequently due to the loss of photoreceptor (PR) cells. Animal models, particularly the laboratory mouse, have been used to understand the pathogenic mechanisms that underlie PR cell loss and to explore therapies that may prevent, delay, or reverse RD. Here, we reviewed entries in the Mouse Genome Informatics and PubMed databases to compile a comprehensive list of monogenic mouse models in which PR cell loss is demonstrated. The progression of PR cell loss with postnatal age was documented in mutant alleles of genes grouped by biological function. As anticipated, a wide range in the onset and rate of cell loss was observed among the reported models. The analysis underscored relationships between RD genes and ciliary function, transcription-coupled DNA damage repair, and cellular chloride homeostasis. Comparing the mouse gene list to human RD genes identified in the RetNet database revealed that mouse models are available for 40% of the known human diseases, suggesting opportunities for future research. This work may provide insight into the molecular players and pathways through which PR degenerative disease occurs and may be useful for planning translational studies. Keywords:** visual photoreceptor cell loss; mouse genetic models; retinitis pigmentosa; Leber congenital amaurosis; ciliopathies	doab	2025-04-07T03:56:59.518342	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 78 }
00a6a373-fd58-400b-bd1a-e87d014d5110.79	1. Introduction Inherited forms of retinal degeneration (RD) encompass a genetically and clinically heterogeneous group of disorders estimated to cause vision impairment and loss in more than 5.5 million individuals worldwide [1,2], with 282 mapped and identified retinal degenerative disease genes documented in the RetNet human database [3]. Animal models, such as non-human primates [4], dogs [5], mice [6,7], zebrafish [8], and fruit flies [9], have been used to identify candidates for human retinal disease genes, to elucidate pathological mechanisms, and to serve as a resource for exploring therapeutic approaches. As potential therapies for retinal diseases are investigated, the need for animal models increases. Information about the disease onset and rate of progression, the pathogenic pathways involved, and the genetic background in which the disrupted genes are situated are all factors that must be considered when selecting appropriate models for testing therapeutics. These factors will also play a role in interpreting the outcome of treatment studies. The purpose of this review is to compile a searchable list of mouse models of inherited retinal diseases caused by single gene mutations that specifically lead to the post-developmental rod and/or cone photoreceptor (PR) cell loss. To identify these models, we reviewed mouse-specific data available in the Mouse Genome Informatics (MGI) and National Center for Biotechnology Information (NCBI) databases at The Jackson Laboratory (JAX) and National Institutes of Health (NIH), respectively. We recorded, when available, PR cell loss data from publications describing mutant alleles of the genes identified. We also included representative fundus photographs and optical coherence tomography (OCT) images of selected mouse models from the Eye Mutant Resource (EMR) and the Translational Vision Research Models (TVRM) programs at JAX as examples of the retinal phenotypes found among mouse models that fit our criteria. We attempted to cluster genes based on the function and then compared the progression of PR cell loss among these clusters to provide potential insights into disease mechanisms. We also compared our list of mouse genes associated with PR cell loss with the RetNet gene list, to highlight mouse models for specific retinal diseases, to reveal opportunities to create novel models, and to identify candidate genes within human loci for which a causative gene is currently unknown. Finally, we coordinated with the MGI team to incorporate our annotations into the MGI database, which will allow future analyses using tools available through that platform. It is hoped that our work will be useful as a resource for investigators to assist in the selection of appropriate mouse models within and across functional clusters in new studies to understand and develop treatments for human retinal degenerative disease. In the three decades since the genes linked to PR loss phenotype were first identified in the mouse and human [10–12], rapid progress in understanding the genetic basis of inherited RD has been summarized in many excellent reviews. Many of the topics presented in the current article have been discussed previously in reviews of mouse RD models [6,7,13,14] and in summaries of our work at JAX [15–21]. Although we have made every e ffort to acknowledge the many contributions to this field, we note that there is a large body of relevant literature and apologize in advance to authors whose reviews or articles we may have inadvertently overlooked.	doab	2025-04-07T03:56:59.518589	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 79 }
00a6a373-fd58-400b-bd1a-e87d014d5110.81	2.1. Photoreceptor (PR) Cell Structure PR cells are sensory neurons within the retina that detect light and signal this event to other cells. Since PR cells are essential for vision, their loss can dramatically and negatively a ffect the quality of life. PR cells include rod and cone cells (Figure 1a,b) that occupy the outermost layers of the neurosensory retina. Although intrinsically photosensitive retinal ganglion cells have also been described as photoreceptors [22], we did not include them in this review, as their contribution to RD is unknown. Rod and cone photoreceptors possess unique structures that serve to compartmentalize processes that are critical for cell function and maintenance. these structures represent a modified primary cilium that encompasses an extensive network of protein complexes that transport proteins and lipids and shares characteristics with primary cilia in many other cell types. The ciliary networks also function to prevent the flow of OS components to other parts of the cell and may associate with the intracellular trafficking apparatus to ensure the directed movement of needed components to the OS. Figure 1. Retinal tissue organization emphasizing cell types and subcellular structures that may be sites of pathological processes in mouse models of photoreceptor (PR) cell loss. (a) A radial section of the posterior eye stained with hematoxylin and eosin shows the layered structure of the retina. CH, choroid; RPE, retinal pigment epithelium; IS, inner segment; OS, outer segment; ONL, outer nuclear layer; OPL, outer plexiform layer; INL, inner nuclear layer; IPL, inner plexiform layer; GCL, ganglion cell layer; NFL, nerve fiber layer. (b) Two PR cell types (rods and cones) and additional cell types that may be the target of processes implicated in PR cell loss. Dashed lines indicate alignment with retinal layers in (a). A columnar unit consisting of one cone and one Müller cell and roughly 20 rod cells is shown. (<sup>c</sup>–f) Details of PR and RPE cells. (c) PR cell OSs contain flattened discs (rod, left) or incomplete discs (cone, right) where the light sensing apparatus is located. OS tips engulfed by RPE cell apical processes are digested in phagolysosomes (Ph). (d) The base of the OS, the connecting cilium, and the apical portion of a rod cell IS (adapted with permission from [24]). The axoneme (Ax) and rootlet provide physical stability to the cilium. BB, basal bodies; CC-TZ, connecting cilium-transition zone; PCM, pericentriolar matrix; PCC/CP, periciliary complex/ciliary pocket; RER, rough endoplasmic reticulum. (e) The PR cell soma is largely occupied by the nucleus. (f) Rod and cone synaptic termini include presynaptic ribbons and associated neurotransmitter vesicles. • The PR cell terminus contains ribbon synapses close to the presynaptic membrane loaded with vesicles containing the excitatory neurotransmitter glutamate (Figure 1f). In the dark, a steady-state level of glutamate is released at the synapse, which is reduced when the cells are hyperpolarized in the light. Changes in glutamate levels at the synapse signal postsynaptic secondary neurons in the inner nuclear layer, which communicate with ganglion cells on the vitreal surface of the retina that connect through long axons to the visual cortex of the brain.	doab	2025-04-07T03:56:59.518850	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 81 }
00a6a373-fd58-400b-bd1a-e87d014d5110.82	2.2. Neighboring Cells Müller glia are radial cells that span much of the neurosensory retina, reaching from the internal limiting membrane at the vitreal surface of the retina to the external limiting membrane on the scleral edge of the ONL [25]. Within the ONL, fine Müller cell extensions appear to ensheath the PR cell soma. As they also interact with vascular layers within the retina, Müller cells may provide essential nutrients to PR cells, which do not directly contact the circulation. They also regulate extracellular volume, ion and water homeostasis, serve to modify neuronal activity through release of neuroactive compounds, and modulate immune and inflammatory responses [26]. At the external limiting membrane, Müller cell endfeet engage rod and cone cell ISs in intercellular adhesion interactions, including tight junctions, which create a di ffusion barrier. Notably, the arrangemen<sup>t</sup> of an Müller cell, rods, and a cone cell has been proposed to form a columnar unit (Figure 1b), which may result in physiological and functional coordination of these cell types. RPE cells (Figure 1b,c) constitute an epithelial monolayer that lies between the retina and a capillary bed, the choriocapillaris. The flow of water, ions, small molecules, and metabolites from the blood to the outer retina is thus regulated by RPE cells. Their apical surface features microvilli and microplicae (Figure 1b,c) that contact roughly the outermost third of OSs and play important roles in recycling molecules needed for PR renewal. These apical processes also mediate initial steps in the daily phagocytosis of OS tips. As an epithelium with high-resistance intercellular junctions [27], the RPE performs an important barrier function, disruption of which may cause PR degeneration. Microglial cells form ramified networks within the same retinal layers as the retinal vasculature, which includes the superficial, intermediate and deep vascular beds. Microglia at the level of the outer plexiform layer in healthy retinas extend dendritic arms into the ONL (Figure 1b), where they contact PR soma as part of a dynamic survey process. During development and in rare events that occur in healthy retinas, these cells engulf and phagocytose PR soma, presumably in response to a defect in PR function. PRs form synaptic connections in the outer plexiform layer with secondary neurons, including bipolar and horizontal cells. Although these connections are critical for signal transmission, they are not as extensive as the contacts made between PRs and Müller glia, RPE cell apical processes, or the dynamic extensions on microglial cells, and were therefore omitted from the summary diagram in Figure 1. Nevertheless, perturbation of the interactions among these cells may lead to PR degeneration, conceivably due to an alteration of signal transmission. ### 2.3. Inherited Diseases that Cause PR Cell Loss Major monogenic inherited RDs in which PR cells are lost include: retinitis pigmentosa [28], Leber congenital amaurosis [29], and syndromic disorders that manifest disease in multiple organs, including the eye, particularly ciliopathies, such as Joubert [30], Bardet–Biedl [31], or Usher [32] syndrome. The remarkable success of gene augmentation therapy for a form of Leber congenital amaurosis has invigorated research e fforts to treat these diseases [33].	doab	2025-04-07T03:56:59.519121	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 82 }
00a6a373-fd58-400b-bd1a-e87d014d5110.83	3. Methods ### 3.1. Public Database and Literature Searches The search strategy employed in this review is summarized in Figure 2. Initially, the MGI database [34] was queried to identify mutant protein-coding genes associated with a mammalian disease phenotype indicating a loss of PR cells. MGI is a curated database that includes expert annotation based on full-text searching of 148 selected journals, which is limited compared to literature databases, such as PubMed. Typically, only the first paper describing a new allele is fully curated for phenotype data in the database due to resource constraints. Although our analysis yielded 159 mutant genes that were associated with PR cell loss, a number of mutant genes known to cause this phenotype were absent or not annotated, possibly due to these aforementioned limitations. Figure 2. Flow chart depicting the progression of the search strategy utilized in this review. The number of records or genes identified from them is indicated at each stage of the process. The dashed line indicates that some genes were identified from records that remain to be systematically screened. To expand the search, we used NCBI databases, including PubMed [35] and Gene. We refined a PubMed query by searching with keyword phrases to generate article lists, using the Gene option of Find Related Data to yield mouse genes linked to the articles, and then assessing whether these genes were on our MGI list. The goal was to develop a broad query that included as many genes from the MGI list as possible but also included additional hits. The most successful was: (ONL OR "outer nuclear layer" OR retina\* OR PR OR rod OR rods OR cone\) AND (degener\ OR loss OR thin\* OR thick\*) AND (mouse OR mice OR murine), which captured >97% of the MGI list. Restricting this query to entries posted to PubMed on or before October 15, 2019, yielded 9535 articles. To review these articles efficiently we tried two approaches, the first generating a spreadsheet containing hyperlinks in which each linked gene symbol was combined with the Boolean query, and the second using mouse gene identification numbers corresponding to the linked genes and applying an Entrez script that accessed the Gene and PubMed databases to find all articles satisfying the Boolean query for each linked gene.	doab	2025-04-07T03:56:59.519360	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 83 }
00a6a373-fd58-400b-bd1a-e87d014d5110.84	3.2. Search Strategy Each MGI database-derived entry was curated manually or automatically to identify candidate models that reported PR degeneration as a phenotype, as described above. In the case of PubMed entries, although the automated approaches were useful for quickly identifying genes that satisfied our criteria, neither was comprehensive, and additional candidate models were identified by review of the title and abstract from some of the remaining articles in the full collection of 9535 articles. Subsequently, an independent coauthor identified an original publication for each candidate gene and determined if PR cell loss was reported. If su fficient evidence for PR cell loss was obtained, the gene and mouse model was assigned to one of 11 categories. Genes within each category were curated further by coauthors who identified alternate alleles and extracted information regarding the disease phenotype induced by the disruption of a gene. Each entry in Table S1 is the result of the examination of an original article (indicated by PubMed ID numbers, PMIDs) and data from MGI to capture information such as mutation type, associated human diseases, and disease onset and progression. ### 3.3. Comparative Analysis and Updating the MGI Database Once our final list was completed, we used tools in Excel to compare it to a list constructed from online tables downloaded on 8 December 2019, from RetNet, a public compilation of human genes linked to inherited RD. We also provided our data to the MGI team at JAX, who assigned allele nomenclature, added strain information for newly described mutants, and updated phenotype data for alleles that were present in the MGI database but not ye<sup>t</sup> annotated with respect to PR cell loss. This review has been referenced at MGI so that the alleles documented in the article can be examined using MGI tools or downloaded in tabular format for analysis with other software. The collaborative approach between mouse phenotyping experts and the MGI team may be attractive for ensuring that this useful resource remains current in the face of limited funding, personnel, and time.	doab	2025-04-07T03:56:59.519616	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 84 }
00a6a373-fd58-400b-bd1a-e87d014d5110.85	3.4. Inclusion/Exclusion Criteria Monogenic models generated from a variety of sources were included in Table S1. However, in the case of conditional models, only those for which a germline null allele was reported in the MGI database that resulted in embryonic, prenatal, or postnatal lethality were included. We excluded the following models from Table S1: those for which a causative gene had ye<sup>t</sup> to be identified and for which complementation tests were unavailable; those requiring multiple genes for the presentation of the disease phenotype; those based on overexpressing transgenes; and those in which PR degeneration depended on experimental interventions, such as an altered diet, drug treatment, or exposure to bright illumination. Environmental influences on retinal diseases are very important and may a ffect the progression of PR cell loss, but models that depend on environmental conditions are challenging to compare because of the significant variation among the types of environmental perturbations and the methods used to apply them. We also excluded models that exhibited a reduction in the PR cell number during development but not a progressive loss with age, and those where IS and/or OS dysmorphology or reduction in length was observed without a loss of PR cells, as indicated by a reduction in nuclei number or ONL thickness within the time frame reported in the papers. Although these models were excluded from Table S1, examples are included in the Results.	doab	2025-04-07T03:56:59.519787	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 85 }
00a6a373-fd58-400b-bd1a-e87d014d5110.86	3.5. Heterogeneity of Data The type and frequency of data gathered varied greatly among the studies reviewed. In some papers, only one figure with one retinal section was o ffered as evidence for PR degeneration, while other papers showed extensive quantitation of their data. To document potential sources of variability in the data, we indicate the method by which the degree of degeneration was determined, either by measuring ONL thickness or by count of nuclei in the ONL, typically the number of rows of nuclei spanning the ONL but sometimes a total count of ONL nuclei in a fixed area of a retinal micrograph. In some instances, when data was quantified in spider plots or bar graphs, mean values obtained from the central retina were used in estimating the PR loss. We normalized the data among studies by recording the percent degeneration as determined by dividing the mutant values by the corresponding values from age-matched controls as reported in each publication. ### 3.6. Comparison of Progressive PR Cell Loss To compare progressive PR cell loss among models, we fit normalized data from each article to an exponential decay that includes a delay, or o ffset [36]. Ranges of either age or photoreceptor numbers, if reported, were averaged. Fitting was performed in Excel Visual Basic using a piecewise equation that modeled the delay with a straight line at 100% and the remaining points with a monoexponential decay to 0%. Two adjustable parameters, the delay and the decay rate constant, were optimized. We calculated the age at which PR cell numbers reached 50% of control values (D50) as a measure of progression. Roughly one third of the datasets contained only a single point within the exponential regime, which was insu fficient to calculate D50. In these cases, D50 was calculated at the extremes of zero delay and infinite rate, and the mean of these values was used as a D50 estimate. ### 3.7. Generation of Primary Data Using Fundus Imaging and OCT Scans Fundus photographs of EMR mutants were taken in unanesthetized mice treated with 1% cyclopentolate to dilate or enlarge the pupil with an in vivo bright field retinal imaging microscope equipped with image-guided OCT capabilities (Micron III; Phoenix Laboratories, Inc., Pleasanton, CA, USA) as previously described [20]. This system allows for the visualization of the location of the OCT scan using the real-time Micron III bright-field image. A superimposed line placed directly on the image over the retinal feature being examined delivers precise cross-sectional information, allowing for the assessment of changes in layer thickness and morphological alterations. Fundus photodocumentation for TVRM mutants and C57BL/6J control mice was performed using a Micron III or IV retinal camera (Phoenix Laboratories, Inc., Pleasanton, CA, USA) as described [37], except that 1% cyclopentolate or 1% atropine was used as a dilating agent, and in some cases, mice were anesthetized with isoflurane. OCT imaging to assess retinal layer thickness in Nmnat1tvrm113, Ctnna1Tvrm5, and C57BL/6J control mice was performed using a Bioptigen ultrahigh-resolution (UHR) Envisu R2210 spectral domain OCT (SDOCT) imaging system for volume scanning as described [37,38] with ketamine/xylazine (1.6 mL ketamine (100 mg/mL), 1.6 mL xylazine (20 mg/mL), and 6.8 mL sodium chloride (0.9% w/v)) as an anesthetic. A representative B-scan through the optic nerve head was derived from the OCT volume dataset. Rpgrip1nmf247 and Alms1Gt(XH152)Byg were assessed on the same OCT system by obtaining a linear B-scan with the following parameters: length, 1.9 mm; width, 1.9 mm; angle, 0 degrees; horizontal o ffset, 0 mm; vertical o ffset, 0 mm; A-scans/B-scan, 1000 lines; B-scans, 1 line; frames/B-scan, 20 frames; and inactive A-scans/B-scan, 80 lines. Linear scans were registered and averaged in the InVivoVue program to merge the 20 frames into a single image.	doab	2025-04-07T03:56:59.519900	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 86 }
00a6a373-fd58-400b-bd1a-e87d014d5110.87	4. Results ### 4.1. Summary of Studies that Report PR Cell Loss The combined searches of MGI and PubMed databases yielded a total of 230 genes associated with PR cell loss. Ultimately, 3834 reports at MGI and 3325 at PubMed, which most typically characterized one mutant gene but on rare occasions described more than one, were used in the present review. The distribution of retrieved publications sorted by functional categories is summarized in Table S1. The genes identified in these models are summarized in Figure 3. Descriptions of gene and protein symbols used in the text, figures, and Table S1 are provided in Table S2. Figure 3. Genes associated with PR cell loss in monogenic mouse models of retinal degeneration (RD). Genes identified by combined review of the Mouse Genome Informatics (MGI) database and articles from a PubMed query were assigned to the indicated functional categories as described in the text. Genes for which mutant alleles are available only in the conditional form are displayed in red. Conditional alleles were included only in instances where germline null alleles resulted in embryonic, prenatal or postnatal lethality. For additional details on inclusion/exclusion criteria, see Section 3.4. ### 4.1.1. PR Cell Loss Models The mouse models described in Table S1 were either spontaneous (12%) or chemically induced mutants (11%), or those produced through genetic engineering approaches (77%). This latter group, which was by far the largest, utilized standard homologous recombination, gene-traps, nuclease mediated approaches such as CRISPR/Cas9, and conditionals to mediate genomic changes. Additionally, four models of inadvertent transgene insertion into a unique gene, whose disruption led to PR degeneration, were included within this group. Interesting examples of differences in the disease onset or rate of progression were demonstrated in different models of the same gene (e.g., Aipl1) that may be related to allelic differences, null versus missense mutations, or genetic background effects [21,39,40]. Most of the genetically engineered models in Table S1 tended to be in mixed, segregating genetic backgrounds that might impact phenotypic expression (discussed below). Within the genetically engineered category, a relatively large group of models, 16%, were conditional models, representing 39 genes (Figure 3; red). Generation of conditional mutants is based on the Cre-Lox recombination approach, which requires a floxed gene and a cre-driver to excise the targeted genomic region in a spatial (e.g., cell/tissue specific) or temporal manner (e.g., induction by chemicals such as doxycycline). Since 30% of all null mutations lead to embryonic lethality, as they represent genes that are essential during development, conditionals are often used to examine the adult function of genes [41]. This was the case in 92% of the conditional models described here, as standard organism-wide removal of the genes was reported to be embryonic, perinatal, or postnatal lethal. Thus, conditionals allow us to learn the function of a gene post-developmentally. Conditionals are also sometimes used to determine the cellular contributions to a disease phenotype. If a gene is expressed in multiple retinal cell types, by removing them systematically and examining the consequent phenotype, one can learn how the loss of function of the gene within particular cell types affects the disease phenotype. For example, removal of Arl3 from rod PRs using a Rho-icre driver shows a later and slower rate of degeneration than that found with Six3-cre, a Cre driver that expresses in early retinal development. This suggests that Arl3 in rods is necessary for PR survival but that Arl3 function in other retinal cell types also affects PR survival [42]. The most widely used Cre models include: for targeting retinal progenitor cells, Tg(rx3-icre)1Mjam, Tg(Six3-cre)69Frty, Tg(Chx10-EGFP/cre,-ALPP)2Clc, Tg(Crx-cre)1Tfur, and Tg(Pax6-cre,GFP)2Pgr; for targeting rods, Tg(Rho-icre)1Ck, Tg(RHO-cre)8Eap, and Pde6gtm1(cre/ERT2)Eye; for targeting M-cone PRs, Tg(OPN1LW-cre)4Yzl (also known as HRGP-cre); for targeting PRs, Tg(Rbp3-cre)528Jxm (also known as IRBP-cre); for targeting RPE, Tg(BEST1-cre)1Jdun, Tg(BEST1-rtTA,tetO-cre)1Yzl and Foxg1tm1(cre)Skm; and for targeting adult tissues using tamoxifen, Tg(CAG-cre/Esr1\)5Amc. ### 4.1.2. Mouse Models from Phenotyping Programs The models listed in Table S1 come from many sources. In addition to individual investigator-initiated efforts, currently the largest contributor to ocular models is the International Mouse Phenotyping consortium, in which 19 phenotyping centers from 11 countries participate to systematically characterize knockout mice generated in a standardized manner [41,43]. All centers do some eye phenotyping, thus providing a window into potential models. Although only a few models from this program are included in Table S1, as most are not ye<sup>t</sup> fully characterized, it is anticipated that this consortium will provide a wealth of models for individual laboratories to study. For example, in the MGI database, 39 IMPC models were identified with "reduced retinal thickness" that with further characterization may reveal PR degeneration. At The Jackson Laboratory, the Eye Mutant Resource (EMR) and the Translational Vision Research Models (TVRM) programs are dedicated to screen for or generate mouse models with ocular diseases. The EMR has been screening retired breeders by slit lamp biomicroscopy, indirect ophthalmoscopy, and electroretinography since 1988. Retired breeders from the production and genetic resources colonies are screened. Heritable mutants are phenotypically and genetically characterized and the spontaneous mutants are distributed worldwide. The TVRM program arose from the JAX Neuromutagenesis Facility. Mice for this program are generated by chemical mutagenesis or genetic engineering. Carefully characterized mutants are also distributed. Examples of mutants from the EMR and TVRM programs are shown in Figures 4 and 5, respectively. (a) (b) Figure 4.* Cont. (c) Figure 4. (a) Characterization of mouse models from the Eye Mutant Resource (EMR) program at JAX. Example optical coherence tomography (OCT) and fundus images were taken from rapid RD models: Pde6brd1 (B6.C3-Pde6brd1 Hps4le/J, Stock No: 000002), Pde6brd1-2J (C57BL/6J-Pde6brd1-2J/J, Stock No: 004766), Pde6brd10 (B6.CXB1-Pde6brd10/J, Stock No: 004297), Rd4/+ (STOCK In(4)56Rk/J, Stock No: 001379) and Cep290rd16 (B6.Cg-Cep290rd16/Boc, Stock No: 012283) (b) Example images from slower RD models: Prph2Rd2 (C3A.Cg-Pde6b+ Prph2Rd2/J, Stock No: 001979), Rd3rd3 (B6.Cg-Rd3rd3/Boc, Stock No: 008627), Lpcat1rd11 (B6.Cg-Lpcat1rd11/Boc, Stock No: 006947), Rpe65rd12 (B6(A)-Rpe65rd12/J, Stock No: 005379) and Prom1rd19 (B6.BXD83-Prom1rd19/Boc, Stock No: 026803). (c) Examples from slow and very slow RD models: Mfrprd6 (B6.C3Ga-Mfrprd6/J, Stock No: 003684), Nr2e3rd7 (B6.Cg-Nr2e3rd7/J, Stock No: 004643), Crb1rd8 (STOCK Crb1rd8/J, Stock No: 003392), RpgrRd9 (C57BL/6J-RpgrRd9/Boc, Stock No: 003391), and Gnat1rd17 (B6.Cg-Gnat1irdr/Boc, Stock No: 008811). Yellow bars indicate full retinal thickness. Values correspond to the mouse age at the time of imaging (weeks).	doab	2025-04-07T03:56:59.520439	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 87 }
00a6a373-fd58-400b-bd1a-e87d014d5110.88	5. Analysis ### 5.1. Progression of PR Cell Loss While a host of effects can occur as a result of disruptions in genes expressed in PRs and ancillary cell types that functionally impair vision, such as night blindness, or color vision defects, the focus of the models described here are those that bear single gene mutations that lead to actual PR cell loss. From a review of the models in Table S1, significant PR cell loss is reported as early as postnatal day 7 (P7) and can extend throughout the lifetime of animals examined. The progression of PR cells loss is also highly variable and includes models that progress rapidly with complete ablation within several weeks to models with extremely slow progression where only <10% PR cell loss is noted over the span of time in which animals were examined. Generally, while rapid to moderate progression led to almost complete PR ablation, slow and very slow progression, or degeneration in models that primarily affect cone PRs left a substantial number of PR cells intact. Figure 5. Characterization of mouse models from the Translational Vision Research Models (TVRM) program at JAX. A fundus image (circular panels) and corresponding OCT B-scan are shown for homozygous (a) Rpgrip1nmf247, at one month of age; (b) Nmnat1tvrm113, at two months; (c) Alms1Gt(XH152)Byg, at one year; and (d) Ctnna1Tvrm5, at two years. Age-matched OCT and fundus images for C57BL6/J control mice are shown to the right of the mutant images. PR cell loss is indicated by a decreased ONL thickness. Fundus images were acquired using a Micron III or IV retinal camera. The vertical dimension of OCT images was doubled to emphasize changes in retinal layer thicknesses. To compare cell loss among functionally similar genetic models, models in each category of Table S1 were sorted based on the estimated age at which the PR cell population had degenerated by 50% compared to control values, defined as D50 (Figure 6). This quantity represents neither the rate of PR cell loss nor the delay before loss commences, although both parameters are used to calculate it. Rather, D50 provides a common measure of progression that allows both complete and sparse datasets to be evaluated. With sufficient data, delay, and exponential decay constants were calculated and are reflected by the shaded bars in Figure 6. Many datasets with fewer measurements, some containing a single point, allowed only an estimate of D50 (Figure 6; filled circles, range lines indicate estimated limits). Figure 6 may be used to identify models in which overall PR cell loss progresses at an earlier age (lower D50), proceeds at a higher rate once initiated (shorter bar), or is accompanied by a substantial delay (bar starts farther to the right), which may aid in experimental design. Values for D50, the exponential decay constant k, and the delay, when available, are also included in Table S1. We relate qualitative descriptions of progression to D50 as follows: rapid, <2 months; moderate, 2 to <6 months; slow, 6 to <12 months; and very slow, ≥12 months. Figure 6. Cont. Figure 6. Progression of PR cell loss in mouse models by functional category. Models in each category were sorted by the age at which the estimated number of PR cells reached 50% of wild-type (D50) as determined by fitting reported data to an exponential decay function combined with a delay. Models are identified by gene symbol, MGI allele symbol, and PMID. Models are homozygous except as indicated by \* (heterozygous) or by the presence of two allele symbols (compound heterozygous). Left- and right-hand margins of shaded bars represent the delay and D50 values, respectively. Bars with a delay value of ≤0.1 month derive from datasets in which no values at 100% of wild type were reported. The midpoint and range of estimated D50 values for datasets with only one point in the 5–95% range is indicated by closed circles and range lines, respectively. In cases where the dataset consisted of a single point at 50%, no estimate was needed. Figure 6 does not include models in which the age of the animal at the time of measurements was not provided, or was reported as "adult", although these models were included in Table S1. We also omitted models where only cone PR cell degeneration was reported, as limited data and a lack of cone nuclei counts made mathematical modeling of cell loss unreliable. Finally, we omitted all conditional alleles from Figure 6, as the efficiency and specificity of inactivation of genes, as well as the temporal expression of different transgenic Cre drivers utilized varies, making comparison of these alleles difficult. ### 5.2. Biological Processes Affected by Mutations Categorization of PR cell loss genes (Figure 3) relied on current functional knowledge, similarity to other genes, and localization, if known. Genes are often expressed in multiple cell types and serve different functions within the retina. We placed genes in categories that were most pertinent to their roles in the PR or effect on PR survival. The data in Table S1 can be explored after reassigning models to different categories if desired. In the descriptions below, we provide an overview for the first three categories and then a detailed description of the effect of gene disruptions on biological functions included in these categories. Subsequent categories are described without overview. ### 5.2.1. Category 01: Ciliary Function and Trafficking Overview. Disruptions in a vast number of genes associated with PR sensory cilia result in RD [24,44]. The onset and rate of PR cell loss may vary depending on the role of a given gene in maintaining ciliary structural integrity and function during early PR development and maintenance in adulthood. Retinal defects within any one of the key ciliary structures and/or processes such as ciliogenesis, OS morphogenesis, or PR homeostasis may result in the loss of rod and cone PR cells. Understanding the pathophysiological mechanisms involved in PR cell loss requires a detailed examination of the components and functionalities of the PR sensory cilium. The mouse PR sensory cilium is a specialized structure comprised of a tubulin-rich axoneme with a symmetrical "9+0" arrangemen<sup>t</sup> of microtubular doublets [45]. The connecting cilium (CC) is akin to the transition zone (TZ) of primary cilia [46,47] and serves as a passageway for the movement of proteins from the organelle-rich IS to the photosensory OS. The OS is composed of an elongated distal axoneme with adjacent stacked membranous discs decorated with proteins necessary for phototransduction. It has been hypothesized that extension of the PR plasma membrane towards the apical RPE provides a convenient sink in the OS for the storage of a large number of membrane proteins [48]. In the CC-TZ, axonemal microtubule doublets interconnect the distal axoneme and basal body, and also connect to the periciliary membrane via Y-linkers. The CC-TZ harbors membrane-associated and soluble proteins that coordinate as gatekeepers to regulate the entry, retention, and exit of proteins in and out of the OS [47,49,50]. At the axonemal base, the ciliary membrane is anchored by the nine microtubular triplets of the basal body and its associated appendages. In developing murine PRs, the connecting cilium and OSs assemble through a series of coordinated events. Shortly after cell cycle exit of retinal progenitor cells, the mother centriole docks to a primary ciliary vesicle initiating its expansion and fusion with the plasma membrane. Concurrently, the microtubular axoneme elongates towards the apical end of the neuroblastic layer [51]. In rod PRs, ciliogenesis typically begins shortly after birth with the appearance of a mature centriolar-bound ciliary vesicle at around P4 [52]. Subsequently, OS biogenesis occurs asynchronously between P8 and P14 [52–54] while axoneme and PM extension continue until OS maturation around P19–25 [52,53]. During this process, intraflagellar transport (IFT) provides an efficient mechanism for the movement and delivery of crucial proteins to the developing OS [55,56], as discussed in greater detail below. Over the past several decades, two disparate mechanisms of rod disc morphogenesis have been debated, a vesicular fusion model [57,58], which postulates that membrane discs originate from rhodopsin bearing vesicles that undergo intracellular membrane fusion, and the classic evagination model [59], which proposes that new discs result from the evagination of the plasma membrane at the base of the OS. Recent ultrastructural studies in mouse rod PRs have provided compelling evidence that support the classic evagination model. By high resolution microscopy, several groups demonstrated the plasma membrane origin of the evaginated rod disc membranes [60], which subsequently flatten, elongate, and become enclosed [52,60,61]. OS membranous discs undergo a rapid and continuous turnover with approximately 75 rod discs being shed daily, corresponding to 10% of the OS [53,62]. At the ciliary tip, aged discs are removed by the adjacent RPE through phagocytosis. Consequently, OS renewal requires a continuous flow of new proteins from IS to the OS through the connecting cilium, a process that requires careful regulation. For the CC-TZ gate to function properly, e fficient mechanisms are needed to prevent the entry of undesired proteins and to remove the non-OS proteins improperly targeted to the OS. At the base of the CC-TZ lie transition fibers, which act as a barrier in conjunction with other CC-TZ components, such as the membrane-associated Meckel syndrome (MKS) complex. The BBSome, an octameric coat complex, is thought to coordinate the delivery and removal of proteins from the OS during ciliary formation and maturation [63,64]. Finally, protein tra fficking through the CC-TZ is important for PR development and maintenance [51,65,66]. The movement of protein cargo from the IS to the OS requires a highly regulated passage of vesicles along microtubules that dock and fuse with the periciliary membrane to deliver their cargo at the CC base. Movement of targeted proteins through the cilia to the OS may be facilitated by IFT transport machinery [65] or by a lipidated protein tra fficking system [67,68]. During IFT, protein cargo associate with IFT particles that attach to kinesin and dynein motors and move along the axonemal microtubules in both anterograde and retrograde directions, respectively. The BBSome is known to associate with IFT particles and may provide a mechanism for the removal of non-targeted protein accumulation in the OS [69]. Ciliogenesis. As the ciliary axoneme serves as an important conduit for the IFT movement of signaling molecules, it comes as no surprise that the disruption of ciliogenesis genes may result in significant developmental abnormalities causing early lethality and/or rapid PR degeneration. Genes essential for the elongation of the proximal axoneme (A and B tubules) include Kif3a [70], which encodes a subunit of kinesin 2, Iqcb1 [71], Arl3 [42], and Arl13b [72]. While patients with missense mutations in ARL13B present with Joubert-associated features [73], a null mutation, Arl13bhnn, results in embryonic lethality in mice [74]. Axonemal disturbances and a failure to form OS discs are observed in developing retinas with conditional Arl13b disruption [72]. Axonemal and ciliary membrane extension. Disruptions in genes that a ffect ciliary extension include Rp1/Rp1l1/Spata7 (distal axoneme), Mak, and Pcare (C2orf71; ciliary membrane). Mice with knockout alleles of Rp1 (Rp1tm1Eap and Rp1tm1Jnz) and Spata7 (Spata7tm1Mrd) show a progressive, moderate loss in PR cells through the first year of life. Rp1m1Jdun mice homozygous for a Leu66Pro missense mutation experience a much slower degeneration with 30% of PRs left at 26 months of age. Conditional ablation studies of Spata7 in PRs and in the RPE have shown that the disruption of SPATA7 in rod and cone PRs, but not in the RPE, is the molecular basis of the retinal degenerative phenotype [75]. Ciliary Gate and the CC-TZ. Sensory/primary cilia and their gatekeepers (CC-TZ) are found abundantly in most cell types [76]. Thus, the disease spectrum of ciliary proteins is extensive given their roles in ciliary tra fficking, signaling, and development. Disruptions in CC-TZ genes may result in isolated cases of inherited retinal dystrophies such as Leber congenital amaurosis or in multisystemic, ciliopathies such as Joubert, Meckel, or Senior-Løken Syndrome. Such syndromic ciliopathies may include a multitude of disease phenotypes such as brain malformations, renal cysts, nephronophthisis, and retinal dystrophy. Within the CC-TZ reside MKS and NPHP modules that closely interact and form multiple distinct protein complexes [47,50,77–79]. The MKS complex includes membrane-associated proteins, such as MKS1 and TMEM67, while NPHP complex proteins, such as NPHP1 and NPHP4, associate in closer proximity to the ciliary axoneme.Mice harboring mutations in genes coding for these complex-associated proteins form normal cilia, however, display early abnormalities in OS morphogenesis. After ciliary biogenesis, retinas in these mutant mice quickly degenerate, eliminating most PRs by 3–4 weeks of age. Genes whose disruptions a ffect the ciliary gate functions of the CC-TZ and cause rapid degeneration include Nphp1, Nphp4, Ahi1, Iqcb1, Tmem67, and Cep290. In humans, mutations in CEP290 can lead to primarily single-organ diseases such, as retinitis pigmentosa and nephronophthisis, or pleiotropic diseases, such as the Joubert, Meckel, and Bardet–Biedl syndromes. The most studied allele is rd16, which harbors a 297 basepair in-frame deletion in Cep290. Compared to Cep290tm1.1Jgg knockout mice, which show a rapid 78% loss at P14, Cep290rd16 homozygotes have a longer disease progression with a 60% ONL loss at three weeks of age. Basal bodies and associated pericentriolar material (PCM). The basal body is a structure derived from the mother centriole and resides at the base of the cilium along with the daughter centriole, neighboring centriolar satellites and other related PCM. Proteins positioned at the ciliary base can also be seen in centrosomes of dividing cells (ALMS1, CEP250, and C8ORF37). Specifically, ALMS1 and CEP250 (CNAP1) localize in close proximity to each other at the proximal ends of centrioles [80]. ALMS1 encodes a 460kDa protein that when disrupted results in the Alström syndrome (ALMS) [81,82]. Mice with a gene trap, frameshift, and nonsense mutations recapitulate human ALMS disease features such as obesity, diabetes, and neurosensory deficits [21,83,84]. The proper formation of the connecting cilium and the slow progression of PR cell loss in Alms1Gt(XH152)Byg [83], Alms1foz [84], and Alms1tvrm102 [21] models suggests that ALMS1 is not essential for ciliary biogenesis but necessary for overall PR homeostasis. The ciliary base contains supportive structures necessary for the proper docking of cargo to the ciliary membrane. Targeted Macf1 null mutants fail to develop the ciliary vesicle needed for basal body docking while conditional ablation of Macf1 in the developing retina disrupts retinal lamination and maturation [85]. Mutations in Cdcc66, which encodes a component of centriolar satellites and Sdccag8, which encodes a recruiter of PCM, result in an early onset but slow-moderately progressive disease [86,87]. The slower RD makes these alleles attractive models for therapeutic investigations. Genetic mutations in CC2D2A, which encodes a component of the subdistal appendages of mother centrioles and basal bodies [88], have been observed in patients with Meckel Syndrome [89], Joubert Syndrome [90], and non-syndromic rod-cone dystrophy [91]. Mice with null mutations in Cc2d2a experience embryonic lethality due to the absence of subdistal appendages and nodal cilia [88]. The retinas of adult mice with tamoxifen-induced deletion of Cc2d2a in PRs have a significantly diminished ONL (2–3 layers) 12 weeks post-injection [92], suggesting that CC2D2A is necessary for ciliary homeostasis. Periciliary membrane complex. At the periciliary membrane complex of PRs lies an Usher protein interactome complex that provides a scaffold for the anchoring of fibers to the periciliary membrane [93]. Mutations in genes encoding members of this complex, Ush1c, Whrn, and Ush2a, result in Usher syndrome, a disease that results in progressive hearing and vision loss. Multiple forms of Usher syndrome exist resulting in different degrees of the onset and severity of disease symptoms. In the mouse, targeted mutations in Usher genes results in a late-onset and very slow progression of PR degeneration. Homozygous Ush2atm1Tili mice have normal retinas at 10 months of age and lose 70% of their PRs by 20 months of age [94]. PR degeneration in Whrntm1Tili retinas is protracted with only 30% loss observed at 28 months of age [95]. Disc morphogenesis. Although the molecular mechanisms involved in OS disc morphogenesis are not completely understood, there has been considerable progress within the past decade with the emergence of refined ultrastructural methods. The OS protein, peripherin-2 (PRPH2), localizes to the rims of rod and cone discs and functions to establish and maintain the membrane rim curvature during disc formation and maintenance [96,97]. Recent investigations using the Prph2Rd2 (rds) mouse model [10] have suggested another role for PRPH2 during disc morphogenesis [52]. Using transmission electron microscopy, Salinas et al. [52] demonstrated that like other forms of cilia [98,99], PR sensory cilia have an innate ability to spew off ectosomes at the OS base. During normal development of the OS, ectosome release is inhibited and the retained membrane at the CC-TZ is transformed into discs upon membrane evagination. In the homozygous Prph2Rd2 mice, discs fail to form resulting in the accumulation of ectosomes at the OS base. This finding led the authors to propose that PRPH2 may play a role in inhibiting ectosome release during normal rim formation [52]. Knock-in mice carrying heterozygous alleles of Prph2 (Tyr141Cys [100] and Lys153Δ [101], mimic the dominant RP disease observed in human patients. It is interesting that PR degeneration rates vary among Prph2 mutant alleles. While homozygous Prph2Rd2 mice gradually lose their PRs within the first year [102,103], mice harboring a homozygous null mutation, Prph2tm1Nmc undergo a faster degeneration with most PRs lost by 4 months of age [104]. Heterozygous Prph2tm1Nmc mice also experience PR loss, however the rate of decline is much slower [104]. Comparative studies of Prph2Rd2 with rhodopsin double-knockout mice have suggested that abnormal accumulation of mislocalized rhodopsin may contribute to PR degeneration in Prph2Rd2 [105]. Hence, the zygosity differences in degeneration rates may be a result of varying rhodopsin: PRPH2 ratios. In addition, the onset and severity of the disease may be influenced by the location of the mutation, as different PRPH2 domains have been implicated in dual roles during disc morphogenesis, the tetraspanin core in rim membrane curvature, and the C-terminal domain in ectosome release suppression [52]. ROM1 is thought to be involved in the regulation of OS disc formation. PRPH2 and ROM1 are closely associated at the disc rims in the OS. In humans, a double heterozygous disruption in both ROM1 (a PRPH2-interacting protein) and PRPH2 results in digenic RP [106]. While it is not clear whether defects in ROM1 alone causes RP in humans, mice with a monogenic Rom1 disruption show signs of dominant RP. At one month of age, Rom1 knockout OS discs are visible but appear enlarged and slightly disorganized [107]. PRs slowly degenerated, reducing the ONL by 34% at 1 year of age. In contrast, Rom1Rgsc1156 mice with a heterozygous missense mutation, p.W182R, show a 55% loss of PRs at 35 weeks of age [108]. Furthermore, RD was more pronounced in homozygous mice. The degeneration in Rom1Rgsc1156 mice may be a consequence of an early reduction in endogenous PRPH2 and ROM1 levels, which may interfere with PRPH2-mediated stabilization of disc outer rims. PRCD, progressive rod-cone degeneration, is a rhodopsin-binding protein [109] that localizes to the OS disc rims [110]. Patients and canines with PRCDC2Y mutations have a slowly progressive form of rod-cone degeneration [111]. The Cys2Tyr mutation results in mislocalization of PRCD from the OS to the ONL where it is actively degraded [109]. In the PRs of mice with homozygous Prcdtm1Vya mutations, loss of PRCD results in the formation of bulging discs that do not properly flatten and in the accumulation of extracellular vesicles that originate at the OS base [112]. Interestingly, mutant PRs are able to form membrane discs and the distribution of OS proteins and light response do not appear to be perturbed. While activated microglia infiltrate the interphotoreceptor space to remove extracellular vesicles and debris, removal is insufficient and PRs undergo a very slow degeneration. Homozygous Prcdtm1Vya mice show only 36% ONL loss at 17 months [112] while in Prcdtm1(KOMP)Mbp homozygotes a similar loss is observed at 30 weeks of age [110]. Both models are knockout alleles that target the 5 end of Prcd but are on different genetic backgrounds. Further investigations are necessary to determine whether gene modifiers affect progressive PR cell loss in these two models. IFT trafficking. IFT is essential for ciliogenesis in mammals [113] and disruption of this process often leads to abnormalities in embryonic development. In the mouse, null mutations in genes encoding subunits of the IFT-A (Ift122 [114], Ift88 [115], and Ttc21b [116]) and IFT-B (Ift172 [117], Ift80 [118], and Traf3ip1 [119]) complexes result in embryonic lethalities, many of which are attributable to ciliary-related disturbances in hedgehog signaling [120,121]. These findings further highlight the integral role of cilia and IFT machinery during embryogenesis. Hypomorphic and conditional alleles have been useful for elucidating the roles of IFT components in retinal disease. The hypomorphic allele, Ift88Tg737Rpw, contains a transgenic insertion resulting in a 2.7 kb intronic deletion. Homozygous Ift88Tg737Rpw mice exhibit disorganized OSs as early as P10 and a progressive degeneration of PRs that reduces the ONL to one layer at P77 [66]. Rod-specific ablation of Ift172 [122] leads to mislocalization of rhodopsin, RP1, and TTC21B (IFT139) and rapid degeneration of PRs. Conditional depletion of Ift20 in M cones and mature rods both results in opsin mislocalization suggesting that proper opsin trafficking hinges on functional IFT components [123]. To gain a clearer understanding of the roles that IFT molecules play in both rod and cone PRs, additional studies using conditional models are warranted to elucidate the contributions of impaired IFT components to PR cell loss. Lipidated protein trafficking. Lipid modification of proteins, such as prenylation or acylation, helps direct intracellular protein targeting and regulates protein activity [124]. These hydrophobic modifications help tether their protein partners to the surface of specific membranes throughout the cell, such as the ER, Golgi, transport vesicles, or plasma membranes. Improper trafficking of lipidated proteins can result in RD. RP2 is a GTPase activating protein that interacts with ARL3 to regulate assembly and movement of membrane-associated protein complexes [125]. Homozygous mice with mutations in the gene encoding RP2 exhibit a slowly progressive rod-cone degeneration [126,127]. ARL3, a small GTPase, tra ffics lipidated membrane-associated proteins to the rod OS [128]. Although Arl3 knockout mice exhibit early postnatal lethality and Joubert-like features [42], mice with hypomorphic mutations survive to post-wean and display OS abnormalities as early as P9 [129]. Conditional ablation of Arl3 in the developing retina results in the absence of cilia, and therefore PR cells are rapidly lost [42]. In contrast, depletion of Arl3 in mature rods leads to mislocalization of lipidated OS proteins, shortened OS, and a moderate progressive PR loss. These results are consistent with roles for ARL3 in ciliogenesis during development and cargo displacement during lipidated protein tra fficking. The ciliary TZ-associated protein, RPGR, binds and directs the ciliary targeting of INPP5E [130], a phosphoinositide phosphatase that is important for ciliogenesis [131]. Ciliary localization of RPGR itself requires modification with a prenyl group, which interacts with PDE6D [130], a prenyl-binding protein first discovered as a copurifying component of cGMP phosphodiesterase 6 (PDE6) [132]. Like Rpgrrd9 [133] and Rpgrtm1Tili knockout mice [134], mice with Pde6dtm1.1Wbae null mutations [135] undergo a very slow degeneration with at least 50% of PR cells remaining at 20 months of age. Rao et al. have demonstrated reduction of INPP5E in RPGR-deficient axonemal OSs [130]. Altogether, these observations validate RPGRs role in ciliary tra fficking and homeostasis and sugges<sup>t</sup> that other players may be involved in ciliary targeting of INPP5E. Mutations in Aipl1 result in early and rapid loss of PR cells (Table S1). D50 < 0.55 months for the four germline alleles shown in Figure 6, Aipl1tm1Mad, Aipl1tvrm127, Aipl1tm1Visu, and Aipl1tvrm119 [21,39,136]. AIPL1 is a protein chaperone that mediates the folding of phosphodiesterase 6 (PDE6), a key component of the visual transduction pathway that regulates cGMP levels (see Section 5.2.2. below) [137]. AIPL1 binding is promoted by prenylation of PDE6 subunits [137]. In Aipl1 mutants, PDE6 subunits are greatly diminished [136], providing further evidence for the importance of lipid modification in PR viability and vision. BBSome assembly and regulation. Disruptions in the octameric BBSome complex or associated chaperonins may cause syndromic ciliopathies such as the Bardet–Biedl syndrome and McKusick– Kaufman syndrome. In mice, most gene disruptions that a ffect the BBSome [138] (BBS1, BBS2, BBS4, BBS7, BBIP1, TTC8, and ARL6), and its regulators (LZTFL1, MKKS, BBS10, and BBS12) result in a moderate degeneration of PRs. For instance, PRs in homozygous mice harboring gene trap or null mutations of Bbs4, Bbs4Gt1Nk [139], and Bbs4tm1Vcs [140] appear to progressively decline after maturation with >90% loss at 7 months of age. The delay and lack of ciliogenesis defects suggests that there may be some functional redundancy amongs<sup>t</sup> components of the BBSome.	doab	2025-04-07T03:56:59.520988	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 88 }
00a6a373-fd58-400b-bd1a-e87d014d5110.89	5.2.2. Category 02: Visual Transduction Overview. Mutant alleles of genes encoding proteins responsible for light detection comprise a second category of models (Category 02: Visual Transduction; Figure 1c, Table S1). The multistep phototransduction process that detects light and amplifies this signal is similar in rod and cone cells, but the specific proteins that catalyze many of the steps are often unique to each cell type [141]. Phototransduction is initiated by the response of opsin-based light-sensitive G protein coupled receptors that are covalently linked to vitamin A retinal as a cofactor. The receptor rhodopsin (RHO) is expressed exclusively in rod cells and is optimized to detect dim green light. Cone pigments that detect short or medium wavelength visible light (OPN1SW and OPN1MW, respectively) are exclusively expressed in cone cells, in some retinal regions coordinately within the same cell. These receptors constitute >90% of OS protein and are localized to the disc membranes. Light activation of RHO or cone pigments causes the bound retinal to isomerize from an 11-cis to an all-trans configuration, ultimately leading to its release from the receptor by hydrolysis. Isomerization results in a conformational change in the protein that alters its interaction with a bound heterotrimeric G protein, transducin, activating the exchange of GTP for GDP bound to the α subunit of this protein. In turn, activated α transducin-GTP binds the inhibitory γ subunits of phosphodiesterase 6, releasing it from the α and β subunits of this complex, which are thereby activated to catalyze the conversion of cGMP to GMP. The ensuing reduction in cGMP levels in the OS closes the cGMP-gated cation channel, slowing the influx of Na<sup>+</sup> and Ca2+ ions, which hyperpolarizes the plasma membrane of the OS and, ultimately, the entire cell. Hyperpolarization causes Ca2+ channels to close at the cell synapse, which leads to a decrease in the calcium-dependent release of glutamate-containing vesicles into the synapse and activates postsynaptic bipolar neurons. The process is regulated to ensure the highest sensitivity to illumination. Following its activation, rhodopsin is quenched by the action of arrestin, which binds to bleached opsin molecules that are phosphorylated by rhodopsin kinase. Resetting of the cell following the light flash requires the formation of cGMP from GTP, catalyzed by a membrane-bound guanylate cyclase, the subsequent closing of the cGMP-gated cation channel, and the restoration of electrolyte distribution across the plasma membrane as achieved by ion pumps and transporters. Hydrolyzed retinal is passed from the OS to the RPE as part of the visual cycle (see below), where it is re-isomerized and returned to the PR cell to regenerate bleached opsin. An additional visual cycle involving Müller cells contributes to the regeneration of cone pigments. Visual pigments. Profound e ffects on PR viability are observed due to mutations that a ffect rod cells, which represent 97% of the PR population. Mouse models bearing Rho alleles exhibit semidominant and recessive rod cell loss phenotypes that vary greatly in the onset and rate, consistent with the variety of possible disease mechanisms that have been proposed for RHO mutations over decades of study. For example, some missense alleles in Table S1, such as those that encode the Pro23His, Cys110Tyr, Tyr178Cys, and Cys185Arg variants [21,142–146] may support a hypothesis that excessive RHO misfolding in the endoplasmic reticulum induces cellular stress pathways that lead to PR cell loss [147]. Although the pathways linking misfolded RHO to cell death are not fully resolved, recent studies of the Pro23His variant in cultured cells and in rats [148] or mice [145,146] sugges<sup>t</sup> that stress pathways induced by the unfolded protein response are protective, and raise the possibility that increased intracellular calcium due to ER stress may cause cell death [146]. Misfolding may also explain the partial mislocalization of RHO Glu150Lys to the IS [149]. However, in this mutant, much of the protein appears to be correctly exported to the OS, where it leads to irregularly shaped and disorganized discs, possibly due to a defect in higher-order RHO organization [149]. Pro23His RHO also disrupts the orientation of discs during their morphogenesis, possibly through similar e ffects on higher-order structure [150]. By contrast, the e ffect of the Gln344Ter variant (Table S1), which is correctly folded but includes sequence extensions at the C-terminus that interfere with export to the OS [151], as well as the graded effect of heterozygous or homozygous knockout alleles Rhotm1Jlem and Rhotm1Phm [152,153] or the premature truncation mutant Arg107Ter (Table S1), provides evidence that a steady flow of RHO to the OS is essential for PR cell viability. These observations fit an emerging view that a proteostasis network, incorporating not only cellular stress pathways but also protein tra fficking and degradation, regulates the cellular protein balance to ensure viability [147,154]. According to this view, a failure to sort vesicles bearing RHO from the Golgi to the periciliary membrane, or a partial or complete loss of the protein, leads to protein imbalance in the IS. This imbalance may induce cellular stress responses and also a ffect the tra fficking of other molecules destined for the OS, such as other phototransduction proteins, lipids, and vitamin A, resulting in cellular toxicity. Finally, the RHO Asp190Asn variant (Table S1) appears to tra ffic properly to the OSs but may have structural defects that lead to constitutive signaling [155], which has been linked to PR degeneration [156]. The same mechanism may account for the e ffect of Rho mutants that result in rapid degeneration upon bright illumination [157] but were not included in Table S1 due to the dependence of the mutant phenotype on an environmental perturbation (see Discussion). Future studies of these and other models may resolve or converge the many proposed hypotheses to explain RHO-associated RD. Based on the often profound e ffect of Rho variants on rod cell viability, it might be expected that cone pigment variants would similarly cause cone PR cell loss. However, cones remain viable for more than 1.5 years in homozygous Opn1swtm1Pugh mice, which show a 1000-fold decrease in transcript and produce no detectable OPN1SW by immunoblotting, histochemistry, or single-cell recording of light responses [158]. Likewise, cones are viable for at least 10 months in homozygous Opn1mwtm1a(EUCOMM)Wtsi knockout mice, despite an absence of OPN1MW in immunoblotting and immunohistochemical studies [159]. These studies sugges<sup>t</sup> fundamental di fferences in the cellular sensitivity of rod and cone cells to visual pigment deficiency. They also highlight the concern that reactivity to antibodies against cone opsins or other cone cell markers may be abolished even though the cells remain viable, and therefore may not be as reliable as counting cone nuclei [160] to assess cell loss. Transducins. Rod transducin subunits α, β, and γ (encoded by Gnat1, Gnb1, and Gngt1, respectively) form the heterotrimeric G protein complex that is essential for propagating the signal from light-activated rhodopsin. Gnat1 knockout mice have attenuated rod responses and model congenital stationary night blindness (CSNB) [161]. Although slow PR loss was reported for this model, our measurement of ONL thickness at four weeks of age based on reported images yielded a value of 90% of wild type, matching the author's value at 13 weeks [161] and suggesting an early developmental di fference rather than progressive cell loss. In support of this finding, others using the same strain reported ONL thickness was 85% of wild type at eight weeks of age with no evidence of significant cell loss up to 52 weeks of age [162]. By contrast, IRD2 mice, which are homozygous for a Gnat1irdr allele predicted to yield a prematurely truncated polypeptide, exhibit significant rod PR cell loss (Table S1) accompanied by late cone cell loss and reduced rod-specific ERG responses [163]. Homozygous Gnat1irdr mice may recapitulate recessive rod-cone dystrophy, which has recently been linked to human GNAT1 variants predicted to encode prematurely truncated proteins [164–166]. The Gnat1irdr allele was discovered independently in rd17 mice at JAX, suggesting a founder e ffect [167,168]. Gnb1 knockout mice have not been studied due to embryonic and perinatal lethality. However knockout alleles of the gene encoding rod γ transducin, Gngt1tm1Dgen and Gngt1tm1Ogk, result in PR loss that is more rapid than in Gnat1 mutants [169,170]. In these strains, GNGT1 deficiency is accompanied by a 6- to 50-fold post-translational reduction of GNAT1 and GNB1, indicating a key role of the transducin γ subunit in complex assembly. Gngt1tm1Dgen-associated degeneration is rescued by heterozygous Gnb1Gt(prvSStrap)4B8Yiw mice [171], which express retinal GNB1 at 50% of wild type levels. This result suggests that the toxicity of GNGT1-deficiency is due to an excess of improperly assembled GNB1, which is targeted for degradation but exceeds the capacity of the proteasome [171]. This observation supports the proteostasis network model of PR degeneration [154]. Among genes encoding cone transducin subunits α, β, and γ (Gnat2, Gnb3, and Gngt2), only Gnat2 alleles have been reported to cause PR loss. A progressive reduction of cone cell ERG responses and a 27% decrease in PNA-positive cells at 12 months of age in homozygous Gnat2tm1Erica mice (Table S1) is consistent with cone PR loss [172]. However, cone nuclei were not counted directly, so it is possible that cone cell loss is less pronounced than reported. The predicted GNAT2 Asp173Gly substitution in this model may alter guanine nucleotide binding [172], although how this change might cause cell loss is unresolved. Interestingly, mislocalized cone opsin OPN1MW in this model suggests endoplasmic reticulum stress, which is often associated with PR degeneration. Gnat2cpfl3 mice (Table S1) show no cone cell loss for at least 14 weeks but exhibit a slow loss of rod cells [173]. In contrast to these models, a recently developed Gnat2 knockout strain abolishes GNAT2 function without PR loss or dysmorphology in the oldest mice examined at 9 months of age [174]. Although human GNAT1-variants are a rare cause of achromatopsia [175], a stationary congenital colorblindness, the clinical presentation is variable and some cases are associated with a reduction in visual acuity with age [176] that may sugges<sup>t</sup> progressive cone cell loss. The available mouse alleles may help to identify disease mechanisms that contribute to this phenotypic variability. Phosphodiesterase 6. Rod phosphodiesterase 6 consists of a catalytic αβ complex encoded by Pde6a and Pde6b and two inhibitory γ subunits encoded by Pde6g. The control of cGMP levels by this enzyme is expected to a ffect both PR function and viability, as cGMP has a central role in the phototransduction cascade and PR cell metabolism [177], and elevated cGMP levels have been linked to PR cell loss [178]. Indeed, Pde6a and Pde6b mutants show depressed ERG responses at an early age and rapid PR loss with D50 values of 11–30 days (Figure 6, Table S1). A study of Pde6a mutations on the same strain background made use of an allelic series that varied in disease severity [179]. The order of disease progression due to the alleles reported in this study, nmf282 (Val685Met; fastest) > tm1.1Bewi (Arg562Trp) > nmf363 (Asp670Gly; slowest), is the same as assessed by D50 (Figure 6). This allelic series led to a correlation of more rapid PR degeneration with an increased number of cGMP-positive PR cells [179]. The same trend in the progression of disease in Pde6anmf282 and Pde6anmf363 mice was found earlier [180], but an opposite cGMP result was obtained, possibly due to the assessment of total retinal cGMP rather than a count of cGMP-positive PR cells [179] (a 0.1-month di fference in the D50 of Pde6anmf363 mice measured in the two studies may reflect strain di fferences that might also contribute to the di fference in findings). The later study also combined two alleles that matched human PDE6A variants to create a compound heterozygote [179], mirroring the more typical situation in human genetic disease. Further, the allelic series highlighted a non-apoptotic cell death mechanism involving calpain rather than the expected caspase-mediated apoptotic process [179]. Both elevated cGMP and calpain activation have been observed in other mouse RD models [181]. Thus, allelic series as used in these studies are informative for assessing disease mechanisms and identifying potential di fferences in treatment e fficacy that may reflect disease severity. Of the Pde6b alleles described, Pde6brd1 and Pde6brd10 have been used most extensively as PR degeneration models. Pde6brd10 disease develops later, providing a longer window of opportunity to test therapeutic e fficacy (Figure 6). The Pde6batrd1 model has an even slower progression (D50 = 0.71) than Pde6brd10 mice (D50 = 0.65), which may make it more attractive for assessing the variation in treatment with disease severity (Figure 6, Table S1). Finally, loss of the inhibitory subunit in homozygous Pde6gtm1Goff mice did not lead to an expected increase in catalytic activity; instead PDE6G was found to be essential for activation and possibly stable assembly of the holoenzyme [182]. Cone phosphodiesterase 6 includes two catalytic α subunits encoded by Pde6c and two inhibitory γ subunits encoded by Pde6h. The Pde6ccpfl1 mutation leads to severely reduced cone ERG response at three weeks and progressive cone PR loss with age [15] as determined by counting cone nuclei (Bo Chang, unpublished data, presented in Table S1). This model mimics achromatopsia in humans, which is sometimes accompanied by cone PR cell loss [183]. Surprisingly, Pde6h knockout mice show no detectable functional cone loss or degeneration, likely due to the expression of the Pde6g subunit in mouse cones, which may compensate for PDE6H loss [184]. Variants in human PDE6H cause achromatopsia [185,186] but cone cell loss has not been reported. Cyclic nucleotide gated channels and cation exchanger. The decrease in cGMP levels resulting from PDE6 activation leads to the closing of cyclic nucleotide cation channels in the OS plasma membrane of both rods and cones. Channel closing diminishes the inward flux of Na<sup>+</sup> and Ca2+ ions that maintain the PR cell in a hyperpolarized state. The rod protein encoded by Cnga1 and Cngb1 is an <sup>α</sup>3β1 heterotetramer, in which the β subunit is a long isoform, CNGB1a [187,188]. Cnga1 mutations have not ye<sup>t</sup> been described. Rod OSs of homozygous Cngb1tm1.1Biel mice yield no detectable CNGB1a or CNGA1, and rapid PR loss is observed [189]. Together with evidence that CNGA1, but not CNGB1a, is capable of self-oligomerizing in heterologous expression systems, this result suggests that CNGB1 plays a critical role in stabilizing CNGA1 for channel assembly during synthesis in the secretory pathway and/or subsequent transport to the OS. Although the mechanisms leading to PR cell loss are unknown, low intracellular Ca2+ may overactivate guanylyl cyclase and cause toxicity due to elevated cGMP [189]. The cone channel encoded by Cnga3 and Cngb3 functions as an <sup>α</sup>2β2 tetramer. Due to the absence of downstream synaptic signaling associated with channel defects, mutations in both genes result in a loss of cone ERG responses modeling achromatopsia. In addition, the alleles included in Table S1, Cnga3cpfl5, Cnga3tm1Biel, Cngb3cpfl10, and Cngb3tm1Dgen result in cone PR degeneration as assessed by marker analysis, although confirmation of cell loss by a direct nuclear count was lacking in some studies. The mechanism of cell death is unknown in these models, but by analogy may involve elevated cGMP as hypothesized in rods. A critical component of phototransduction is SLC24A1 (also called NCKX1), which exports sodium and calcium ions in exchange for potassium. This activity is responsible for the decrease in intracellular Ca2+ upon closing of the cGMP-gated channels. Homozygous Slc24a1tm1Xen mice exhibit slow degeneration, possible due to malformation of OS discs [190]. Guanylyl cyclase and activating proteins. Photoreceptor guanylyl cyclases function as homodimers encoded by two genes in mice, Gucy2e, and Gucy2f. In the homozygous Gucy2etm1Gar model, D50 was >12 months (Figure 6), indicating very slow rod PR cell loss, while cone cell numbers decreased rapidly to 33% of controls in 5 weeks [191]. Cone loss with rod preservation has been observed in Leber congenital amaurosis cases linked to variants of the human Gucy2e ortholog, GUCY2D [192]. However, Gucy2etm1Gar mice are not considered to model this disease because rod ERG function, though diminished, is still detectable [191]. Although Gucy2f knockout did not cause PR cell loss, double knockout of both guanylyl cyclase genes resulted in moderate degeneration [193]. Rod and cone ERG responses were abolished in this model, suggesting that the residual function in Gucy2etm1Gar mice was due to compensatory activity expressed from Gucy2f. The mechanism of PR cell loss in these models is unlikely to involve elevated cGMP as the enzymes needed for its production are ablated. The post-translational downregulation of other phototransduction proteins in double-knockout mice [193] may indicate a disruption of the proteostasis network that could explain PR cell loss. Guanylyl cyclase activator proteins provide a feedback loop to restore cGMP levels. When intracellular Ca2+ is high, these proteins inhibit guanylyl cyclase; when Ca2+ levels are low, they switch to an activating Mg<sup>2</sup>+-bound conformation that promotes cGMP synthesis. This Ca2<sup>+</sup>-sensitive regulation permits PR cells to reestablish cGMP levels following light exposure due to lowered intracellular Ca2+, thereby resetting the cell for another stimulus. Double knockout of Guca1a and Guca1b, which encode the activator proteins in both rods and cones, had no detectable effect on retinal morphology up to eight months of age [194]. However, homozygous Guca1atm1.1Hunt mice, which have a Glu155Gly missense substitution identical to one found associated with a severe dominant cone dystrophy [195], result in rapid loss of cones and subsequently rods (Figure 6, Table S1). This mutation, like others associated with the human disease, may constitutively activate guanylyl cyclase due to a defect in calcium sensing [196], leading to cytotoxic accumulation of cGMP. Recovery from light stimuli. Mechanisms to terminate the phototransduction cascade and recover the PR cell for additional stimuli include the phosphorylation of activated RHO by a Grk1-encoded kinase and the binding of Sag-encoded arrestin to the phosphorylated RHO. The binding of SAG limits transducin access to RHO and thereby prevents further activation of transducin and downstream processes. Significantly, defects in either gene induce photoreceptor cell loss, likely due to the accumulation of excess cGMP arising from unregulated active RHO. Early studies aimed at elaborating the role of the SAG or GRK1 proteins used mice raised in the dark [197,198], as typical vivarium cyclic light–dark rearing conditions were described as leading to rapid degeneration. Subsequent studies of homozygous Sagtm1Jnc [199] or homozygous Grk1tvrm207 mice [200] reveal slow PR cell loss with D50 > 10 months under normal rearing conditions.	doab	2025-04-07T03:56:59.522652	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 89 }
00a6a373-fd58-400b-bd1a-e87d014d5110.90	5.2.3. Category 03: Metabolism Overview. Inborn errors of metabolism constitute a heterogeneous group of disorders that affect metabolic pathways due to underlying genetic defects [201] and result in abnormalities in the synthesis or catabolism of biomolecules [201,202]. Many such inborn errors of metabolism are known to be associated with PR cell loss, manifested either as a primary ocular defect or as part of a systemic disease [201]. PR cells, with their high metabolic activity, are particularly vulnerable to defects in metabolism of biomolecules such as lipids, carbohydrates, nucleotides, and proteins, which provide energy and serve many other functions described below. Additionally, since organelles such as mitochondria and lysosomes are the major sites for cellular energy production and homeostasis, defects in organellar metabolism and function are also known to cause PR degeneration. The PR cell loss associated with different metabolic diseases varies in the age of onset, severity, and rate of progression (Figure 6, Table S1) and the underlying genetic defects can be categorized based on the type of biomolecular metabolism or the subcellular location of the pathways affected. Biomolecular metabolism: lipids. PRs are extremely rich in lipids, which make up to 15% of their cellular wet weight as compared to 1% in most other cell types [203,204]. Phospholipids and cholesterol represent 90–95% and 4–6% (w/w) of total lipids, respectively [205]. The major phospholipids in rod outer segments include phosphatidylethanolamine, phosphatidylcholine, large amounts of phosphatidylserine, along with small amounts of sphingomyelin, phosphatidylinositol, and phosphatidic acid [205]. It has been suggested that the phospholipids in OS membranes are metabolically active and involved in generation of physiological mediators, and changes in metabolism of glycerolipids have been associated with transduction of visual stimuli [205]. Cholesterol has been reported to modulate the function of rhodopsin, a major protein of the OS membranes, by influencing membrane lipid properties [206]. Low-density lipoproteins (LDLs) are reported to be significant suppliers of PR lipids, especially cholesteryl esters [207,208]. The OSs of PRs are particularly rich in very-long-chain polyunsaturated fatty acids (PUFA), such as docasohexaenoic acid (DHA), which is considered to be essential for visual function [209], and phospholipid-containing DHA is suggested to help in isomerization of 11-cis-retinal to the all-trans form, which is further reduced for its entry into the visual cycle [210]. Recently, DHA has also been implicated in the maintenance of OS homeostasis [211] and mediating PR cell survival [212,213]. Thus, it is not surprising that disorders of lipid metabolism cause inherited PR degeneration. For example, mouse models for mutations in the elongation of very-long-chain fatty acids-like 4 (Elovl4) gene are reported to show features resembling Stargardt-like macular dystrophy in humans with cone degeneration preceding that of rods [214,215]. Mutations in genes involved in phospholipid metabolism such as Lpcat1 cause rapid PR degeneration (90% and 75% degeneration in Lpcat1rd11 and Lpcat1rd11-2J alleles, respectively by 47 days) [216]. Similarly, mutations in genes involved in cholesterol biosynthesis such as Nsdhl [217] or in the biosynthesis and regulation of DHA-containing phospholipids, such as Agpat3 and Adipor1, respectively [210], also cause PR degeneration, confirming the importance of lipids in preserving PR integrity. Since membrane phospholipid asymmetry is critical to performing various biological functions, mutations in genes important for its generation and maintenance, also lead to PR degeneration. For example, mutations in Atp8a2, a type of P4-ATPase that translocates and maintains phospholipid asymmetry show a 30–40% PR degeneration by two months of age [218]. Similarly, conditional inactivation of Tmem30a, known to be required for folding and transport of several P4-ATPases to their plasma membrane destination [219,220], also results in severe PR degeneration [221]. Tmem30a knockout mice exhibit a more severe phenotype compared to Atp8a2 knockout mice, possibly because Tmem30a binds multiple P4-ATPases [221]. Biomolecular metabolism: carbohydrate and nucleotide energy metabolism. The retina, and in particular PRs, have a high metabolic rate [222,223] to support functions that are energetically demanding, such as phototransduction during constant illumination, maintenance of ion gradients in darkness, and performing anabolic metabolism to replace the approximately 10% of OSs that are lost every day to phagocytosis by RPE cells [223]. RPE cells also perform many energy demanding functions, such as maintenance of appropriate ionic and fluid composition in the subretinal space, uptake and conversion of all-trans-retinol to 11-cis-retinal and its transport back to photoreceptor cells, and OS phagocytosis. This high energy requirement makes the retina and RPE particularly vulnerable to functional deficits induced by deficits in energy metabolism [222]. The retina relies on blood-derived glucose and oxygen for its energy requirements. Additionally, PR cells use excess lactate obtained from Müller glial cells and convert it to pyruvate to provide energy via oxidative phosphorylation [222]. In addition to carbohydrates, the retina uses fatty acids [224] and nucleotides for its energy requirements [223]. Thus, neuronal activity and energy metabolism are tightly coupled and any mutations at the level of glucose, fatty acid or nucleotide biosynthesis can lead to PR degeneration. For example, mice lacking Hkdc1, which encodes a kinase found in the IS that phosphorylates glucose to glucose-6-phosphate, show 40% PR degeneration by 17 months [225]. Mice mutant for Vldlr, which encodes the receptor facilitating the uptake of triglyceride-derived fatty acids, show reduced cellular uptake and availability of fatty acids for energy production [224]. For some alleles of Vldlr (Vldlrm1Btlr and Vldlrtm1Her), more than 50% of PRs are lost by 12–14 months [226,227], with cones being affected more significantly than rods [228]. The decrease in net available energy may lead to greater cone loss, as cones have been reported to require three times more energy than rods [222]. Similarly, while in some cases, mutations in genes involved in nucleotide metabolism such as Nampt, show embryonic lethality [229], others such as mutation in Nmnat1, show severe PR degeneration by 4–6 months [230]. Biomolecular metabolism: hormones. The physiology of eye is also dependent on the action of several hormones [231]. Mouse models mutant for thyroid hormone metabolizing genes, such as Dio3, which is important for local amplification of triiodothyronine (T3), show selectively detrimental effects on cone cells [232]. This confirms the proposed role of thyroid hormone signaling in regulating cone viability and cone opsin expression [232,233]. Melatonin, a hormone that plays a role in sleep patterns, is known to have protective role against oxidative stress and apoptosis, and regulates retinal circadian rhythms [234]. A mouse model, mutant for the melatonin hormone receptor Mtnr1a, shows very slow PR degeneration (25% in 18 months) [235]. Biomolecular metabolism: oxidative stress. The eye is constantly subjected to oxidative stress due to daily exposure to light, atmospheric oxygen, and high metabolic activities [236]. Reactive oxygen species (ROS) are derived from diatomic oxygen and processes such as mitochondrial respiration that form superoxide anion radicals, toxic bis-retinoids that undergo photo-oxidation, and lipids, such as PUFAs, that undergo peroxidation [237]. Having unpaired electrons confers a grea<sup>t</sup> degree of ROS reactivity that can damage biomolecules such as DNA, lipids and proteins, and organelles including mitochondria and lysosomes [238,239], thereby impairing their biological functions [203,236]. Compared to other cells, non-proliferative postmitotic cells such as PRs and RPE cells are particularly sensitive to oxidative damage due to the apparent absence of a DNA damage detection system [240–242]. Under physiological conditions, cellular redox homeostasis is maintained by a balance between ROS generation and antioxidant systems [236]. Antioxidant enzymes such as Sod1, Sod2, and Gpx4 are known to play a major role in ROS scavenging and changes in their expression or activity or both are reported to cause increased oxidative stress and are associated with diseases such as age-related macular degeneration (AMD) [243]. For example, mutations in the Sod1 gene, encoding a cytosolic Cu-Zn superoxide dismutase that catalyzes the conversion of superoxide to hydrogen peroxide, are known to cause PR degeneration [244]. Sod2, which encodes a mitochondrial Mn superoxide dismutase, is required for survival and mutations in this gene lead to embryonic lethality [244,245]. Genes such as Nxnl1 and Nxnl2, known as rod-derived cone viability factors are also suggested to have antioxidant function and show cone degeneration when mutated [246,247], with Nxnl1 also showing a progressive rod cell loss [246]. Similarly, a mouse model for loss of Ttpa, coding for a protein that transports vitamin E, which is known to have antioxidant function, also shows 40% PR degeneration by 20 months [248]. Organellar metabolism: lysosomes. The lysosome, a subcellular organelle is critical for performing several vital functions such as degradation of extracellular and intracellular material, nutrient sensing, energy metabolism, and maintaining cellular homeostasis [249]. Lysosomes contain a wide variety of hydrolytic enzymes that enzymatically degrade biomolecules such as polysaccharides, lipids, etc. [250]. Defects in lysosomal function results in lysosomal storage disorders, a group of inherited metabolic disorders sharing a common biochemical feature of accumulating incompletely degraded metabolites within the lysosomes. Lysosomal storage disorders are generally classified by the composition of the material accumulated within them and often di ffer depending on the lysosomal proteins a ffected, which reflect di fferent cell biological processes that are a ffected but terminating in a similar pathology of reduced clearance of metabolic aggregates. RD is an early consequence of lysosomal storage diseases, especially in neuronal ceroid lipofuscinoses (NCL) [251], also called Batten disease, an early-onset neurodegenerative disease with other systemic features such as dementia and epilepsy [252]. NCL may be caused by disruption of genes encoding lysosomal enzymes (Ppt1 and Cln5) and membrane proteins (Mfsd8) as well as ER membrane (Cln6 and Cln8) and secretory pathway (Grn) proteins, and is characterized by a common lysosomal accumulation of ceroid. Similar to the early retinal phenotype reported for most human NCLs, most mouse models for NCL disease show an early onset of PR degeneration, beginning at 1 month of age and showing greater than 60% degeneration by 6–9 months [253–256]. Additionally, similar to the adult-onset reported for mutations in human GRN, the mouse model for loss of Grn also shows a late onset PR degeneration by 12 months [257]. Mouse models for other lysosomal disorders, namely, mucopolysaccharidosis and mucolipidosis due to mutations in lysosomal proteins required for the breakdown of glycosaminoglycans and enzymes required for phosphorylation of glycoproteins, respectively, also develop PR degeneration. For example, mouse models for mucopolysaccharidosis with a mutation in Naglu present with a slowly progressive rod-cone degeneration [258], and for mucolipidosis with a mutation in Gnptab develop a severe PR degeneration with complete PR loss by 10 months [259]. The lysosome receives materials for degradation via two major pathways, autophagy and phagocytosis. Phagocytosis has an important function in maintaining retinal health since 10% of the OSs are phagocytosed daily by the RPE cells to dispose of waste such as photo-oxidative products while retaining and recycling useful contents back to the PR cells [260]. Phagocytosis by RPE requires its own machinery for processes such as recognition (e.g., Cd36), engulfment (e.g., Mertk), and degradation (lysosomal enzymes) of the extracellular material. Disruption of the phagocytic machinery due to absence/mutations in proteins involved in the phagocytic pathway, therefore, have severe consequences for PRs and can lead to PR cell death. Mouse models for mutations in genes involved in phagocytosis such as Mertk, Cd36, and Rab28 show PR degeneration with the loss of Mertk showing a more severe phenotype (>80% degeneration by 60 days for Mertktm1Grl and Mertktm1Gkm) [261,262] than loss of Cd36 (17% degeneration at 12 month) [263], and the model for Rab28 loss showing a more cone-specific response [264]. Autophagy is another lysosome-mediated degradation process essential for maintaining cellular homeostasis [265]. Autophagic flux, the complete dynamic process of autophagy, includes multiple steps involving the formation of phagosomes and autophagosomes, autophagosome fusion with lysosomes, the degradation of the intra-autophagosomal contents, and recycling [266]. Thus, both lysosomal function and autophagy are interconnected wherein disruption of the hydrolytic functions of lysosomes impairs autophagic flux and, conversely, lysosomal function requires normal flux through autophagy [267,268]. In the retina, autophagy plays a dual role: promoting cell survival against harmful stress, and cell death. High basal autophagic levels are maintained in RPE and PR cells. RPE cells being post-mitotic phagocytes are not self-renewing; the autophagy of intracellular components is therefore essential for a normal cellular function of the RPE [265]. In PR cells, autophagy occurs during various cellular activities such as OS degeneration [269], rhodopsin protein expression [270], visual cycle function, and PR apoptosis [271]. Mouse models of conditional inactivation of autophagy genes such as Atg5, Atg7, and Rb1cc1 in RPE cells show that these genes are indeed important for survival of the animal and show PR degeneration. Organellar metabolism: mitochondria. Mitochondria, often referred to as "the powerhouse of the cell", are the major site for cellular energy production in the form of ATP via oxidative phosphorylation. They also perform other important functions such as ROS generation and scavenging, calcium regulation, steroid, and nucleotide metabolism, regulation of intermediary metabolism, and initiation of apoptosis [272]. Oxidative phosphorylation is carried out by the mitochondrial respiratory chain, which consists of five complexes located along the inner mitochondrial membrane. These complexes, in an intricately organized series of biochemical events, synthesize ATP from ADP in response to cellular energy demands. A large number of mitochondria are present in the rod and cone IS and in RPE cells. The total surface area of the inner mitochondrial membrane in cones is 3-fold greater than in rods, presumably accommodating more respiratory chain enzymes to generate more ATP. Cones require more ATP than rods as they do not saturate in bright light and use more ATP/sec for light transduction and phosphorylation [222]. Defective cellular energy production due to abnormal oxidative phosphorylation in mitochondria can therefore lead to PR degeneration. A mouse model for the Leu122Pro mutation of OPA3, a protein hypothesized to be important for maintaining the inner mitochondrial membrane, is reported to cause a multisystemic disease characterized by severely reduced vision, loss of ganglion cells and PR degeneration (by 50%) at 3–4 months of age, a much more severe progression than observed in humans [273]. Similarly, a mouse model for a mutation in the gene for NAD-specific mitochondrial enzyme isocitrate dehydrogenase 3 (Idh3a), catalyzing the rate limiting step of TCA cycle, also causes an early and severe PR degeneration (more than 90%) by 90 days [274]. Extra-mitochondrial components of the tricarboxylic acid cycle and oxidative phosphorylation machinery have been localized to the rod OS [275]. It has been hypothesized that perturbation of this machinery results in excess ROS production, leading to PR cell death due to oxidative stress [275–277]. Mutations in a subset of mouse RD models in Table S1 alter genes (Mpc1, Opa3, Idh3a, Impdh1, and Oat) that encode mouse homologs of mitochondria-associated proteins identified in bovine rod OS [275]. Of these, only IDH3A is directly involved in cellular energy production [274]; the others may influence oxidative phosphorylation or the TCA cycle indirectly, possibly altering the generation of ROS. It may be of interest to determine whether PR cell loss in these mouse models correlates with an altered distribution of extra-mitochondrial oxidative phosphorylation proteins in the rod OS [278], or an increased ROS production, which can be measured in retinal explants [279]. Organellar metabolism: peroxisomes. Peroxisomes are subcellular organelles with various catabolic and anabolic functions such as catabolism of long chain fatty acids and biosynthesis of DHA and bile acids [280]. Several childhood multisystem disorders with prominent ophthalmological manifestations have been ascribed to the malfunction of the peroxisomes, either at the level of peroxisomal biogenesis (PBD) or single enzyme deficiencies [281]. While little is known about the metabolic role of these organelles in retina, studies have shown the presence of peroxisomes in nearly all layers of retina and RPE, albeit with differential expression of lipid metabolizing enzymes, suggesting different functions in different cell types [282]. For example, Zellweger spectrum disorder (ZSD) is a disease continuum known to result from inherited defects in Pex genes essential for normal peroxisome assembly. Mice homozygous for the G844D point mutation in Pex1 show a decreased ERG response and loss of cone PRs (up to 80%) by 22 weeks, recapitulating the abnormal retinal function phenotype in ZSD patients with mild disease [283]. The retinal pathology in such disorders suggests the importance of peroxisomes in maintaining retinal homeostasis and function. ### 5.2.4. Category 04: Visual Cycle and Retinoids The visual cycle reisomerizes vitamin A retinal that has been released from visual pigments in PR cells, allowing regeneration of the bleached pigments and the subsequent detection of additional light stimuli. The process is catalyzed by enzymes located in PR and RPE cells, so the retinoid intermediates in the process must be transported between them. Mutation of genes involved in the visual cycle pathway cause PR degeneration, in most instances with a moderate to slow progression depending on the allele and the genetic background. Most Rpe65 mutant alleles show moderately slow PR cell loss (D50 = 7–11 months) [284–288]. Allelic effects are observed in models bearing missense mutations, Rpe65tm1Lrcb [289] or Rpe65tm1.1Kpal [290], which cause slower progression than observed in Rpe65tm1Tmr knockout mice [285–288]. Abca4tm1Ght on the BALB/c strain, which also carries a homozygous Rpe65 Leu450Met mutation, show a late-onset PR degeneration with 40% loss by 11 months of age [291]. By contrast, the same Abca4tm1Ght mutation on a 129S4/SvJae background results in abnormal thickening of Bruch's membrane but normal ONL nuclei count and thickness [292]. Several visual cycle mutant alleles have other retinal abnormalities but normal ONL nuclei/thickness. For example, Abca4tm1.1Rsmy causes only autofluorescence and A2E accumulation [293] and Abca4tm2.1Kpal on C57BL/6\129Sv leads to a RPE defect but normal ONL nuclei count and thickness [294]. In addition, PR degeneration in Abca4* mutants can be induced by light exposure [295] or through interaction with other genes such as Rdh8 [296–298]. The Lrattm1Kpal mutation on a 129S6/SvEvTac\C57BL/6J background results in mild PR degeneration, with <10% loss at 4–5 months [299]. However, a 35% decrease in rod OS length was also reported in this model, indicating the importance of the visual cycle for OS maintenance. Another allele, Lrattm1.1Bok, showed a similar loss of rod OS length and 18% PR degeneration at 6 months of age [300]. The Rbp3tmGil* mutation results in the most rapid PR cell loss in this category (D50 = 0.79 months), possibly attributable to an early developmental role of the protein [301]. The Rbp4tm2Zhel congenic mutation on C57BL/6J showed 20% PR cell loss in some peripheral areas and 10% in the central retina an age of 40 weeks [302]. Mutations in two genes that play a role in retinoid uptake in the eye also result in PR cell loss. The Rtbdntm1.1Itl allele causes a slow degeneration with a 20% and 37% loss of PR nuclei at 240 days of age in heterozygotes and homozygotes, respectively. Stra6tm1Nbg mice exhibit a normal number of rod PR nuclei but significant cone PR cell loss as detected by the cone-specific marker peanut agglutinin [303]. PR cell loss in Stra6tm1.1Jvil mice was more pronounced with vitamin A restriction [304].	doab	2025-04-07T03:56:59.524048	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 90 }
00a6a373-fd58-400b-bd1a-e87d014d5110.91	5.2.5. Category 05: Synapse PRs absorb light that passes through the anterior portion of the eye and convert the light to electrochemical signals that are transmitted through the neuroretina via synaptic connections to the optic nerve and visual cortex [305]. Thus, synapses, necessary for proper cell-to-cell communication, are critical for vision. Discussion of the complexity of PR synaptic development and function is reviewed in [306–308], and is beyond the scope of this review. Suffice to say that mutations in many of the components of synapses, such as presynaptic exocytotic proteins, endocytic proteins, calcium channels, postsynaptic receptors, and associated elements, must be properly organized to mediate transmission of signals, or can lead to visual problems [307]. It is interesting to note that disruption of some synaptic components of the secondary neurons (e.g., GRM6, GPR179, TRPM1, NYX, GNAO1, GNB5, and GNB3), while affecting function as assessed by ERG response, does not normally lead to PR degeneration [309]. This is also true of some presynaptic proteins, such as dystrophin [310] or dystroglycan [311]. However, disruption of some synaptic genes such as Ache, Cabp4, Cacna1f, Cacna2d4, and Unc119 does lead to PR degeneration. For example, a null allele of Ache [312], causes a 50% loss of PR nuclei between 1.5 and 2 months and >80% by 6–8 months. Although it was initially determined that the ACHE protein played an important role in hydrolyzing acetylcholine at synapses, its isoforms are now recognized to have far reaching structural functions [313]. Additionally, it has been shown that the loss of secondary neurons in the null allele model is likely to cause secondary PR cell loss [312]. Null or spontaneous alleles of synaptic genes that encode subunits of calcium channels that regulate the release of neurotransmitters, and the development and maturation of exocytic function of PR ribbon synapses, Cacna1f [314] and Cacna2d4 [315,316], respectively, show a slower rate of degeneration. By two months, there are approximately 10–25% of PR nuclei that have degenerated. CABP4, a protein that regulates calcium levels and neurotransmitter release at PR synapses, and modulates CACNA1F and other calcium channel activity shows a similar rate of PR degeneration of 10–25% loss at 2 months [317]. UNC119, which localizes to PR synapses (and IS) and is hypothesized to play a role in neurotransmitter release, also leads to a relatively late onset, slower rate of PR degeneration [318]. Interestingly, Haeseleer has described an interaction between synaptic genes Cabp4 and Unc119 [319]. It is likely that other synaptic proteins will also lead to PR degeneration through either a primary or secondary effect and that the interactions among the synaptic proteins will play a significant role in determining the relative rate of the degenerative process. ### 5.2.6. Category 06: Channels and Transporters Ions such as sodium, potassium, and chloride, play important roles in the visual circuitry [320]. Their intracellular concentrations and movements within the cell, and between cells and the environment are exquisitely regulated by channels and transporters. Due to the importance of maintaining appropriate levels of these ions for proper function and maintenance of PRs, it is not surprising that disruption of these genes can lead to PR degeneration. Members of the ClC family of chloride channels, such as Clcn2, Clcn3, and Clcn7, show particularly early and significant PR degeneration. Compared to other channels in this section, they appear to have an enriched expression in the RPE. A 50% PR cell loss can be seen as early as 14–16 days in certain models with disruptions in these genes [231,321–323]. Indeed, rapid progression of PR cell loss is observed in mice carrying any of the following alleles: Clcn2nmf240, Clcn2tm1Tjj, Clcn3tm1Lamb, Clcn3tm1Tjj, Clcn7tm1Tjj, Clcn7tm2Tjj, and Clcn7tm4.1Tjj [231,321,322,324–327]. A similar rapid and complete loss of PRs is seen when Atp1b2, a Na+/K<sup>+</sup>-ATPase thought to play a role in cell adhesion, is inactivated [328]. A targeted mutation in Slc6a6, which encodes a taurine/beta-alanine transporter, also leads to rapid, complete degeneration [329]. In contrast, inactivation of the bicarbonate, amino acid transporters, and Na+/H<sup>+</sup> exchangers, Slc4a7, Slc7a14, and Slc9a8 results in a later onset, but still severe PR degeneration [330–332]. Mouse models bearing mutations affecting BSG, a protein that has a role in targeting monocarboxylate transporters such as SLC16A1 to the plasma membrane, or REEP6, which mediates trafficking of clathrin-coated vesicles from the ER to the plasma membrane at outer plexiform layer sites enriched for synaptic ribbon protein STX3, also fall in this latter late onset/severe category [333,334]. Asic3, an acid sensing Na<sup>+</sup> channel, Clcc1, an intracellular chloride channel, and Slc7a14, an intracellular arginine transporter, all cause moderately slow degeneration when mutated [331,335,336]. Slowly progressive PR cell loss is also caused by mutation of Mfsd2a, which encodes a sodium-dependent lipid transporter responsible for maintaining a high DHA concentration in the retina is important for OS homeostasis, as discussed in Category 03 [337]. More data are needed to see if sensing and intracellular channels/transporters generally have milder phenotypes. ### 5.2.7. Category 07: Adhesion and Cytoskeletal Proper structure of the retina is developed through protein interactions between cells and within cells. The spatial and laminar organization of the retina is maintained through junctional interactions between cells that impart mechanical support to maintain retinal architecture, a means for bidirectional communication (e.g., extracellular changes to the cell and from the cell to its environment), and together can form diffusion barriers. Within cells, cytoskeletal architecture is maintained through interactions of proteins with actin, intermediate filaments, and microtubules that serve to maintain cell morphology and polarity, and as discussed elsewhere, intracellular trafficking, contractility, motility, and cell division. Examples of disrupted proteins that lead to gaps between cell layers, presumably through aberrant adhesion, are mutations in Adam9 and Rs1. The null allele of Adam9, a single pass transmembrane protein with disintegrin and metalloprotease domains that has been shown to interact with a number of integrins [338], leads to aberrant adhesion between the apical processes of the RPE and OS and to late onset PR degeneration [339]. Likewise, mutations in RS1, a protein with a discoid domain, which has been implicated in cell adhesion and cell–cell interactions [340] lead to a splitting of the inner retinal layer and progressive PR loss [341–343]. RS1 binding to phospholipids on the membrane surface, together with other proteins [340] may provide a stabilizing scaffold that is important in cell–matrix, cell–cell, and cytoskeletal organization. CRB1 and its interacting partners, such MPP3, MPP5, and PARD6A, have been shown to be important in establishing proper retinal lamination presumably through their essential roles in establishing cellular apical basal polarity [344]. A primary defect of a disruption in CRB1 is the fragmentation of the outer limiting membrane [345,346]. As reviewed previously [344,347], the outer limiting membrane consists of adherens/tight junctions formed in part by the CRB1 complexes between Müller glia and the rod or cone IS that form a diffusion barrier. Loss of components of the CRB1 complexes (CRB1-MPP5-PATJ, CRB1-MPP5-MPDZ, and CRB1-PARD6A-MPP5-MPP3/MPP4) leads to lamination defects with formation of rosettes and a progressive loss of PRs. Although ye<sup>t</sup> to be reported, it is likely that mutations in PATJ, PARD3, MPDZ, and MPP4 will lead to similar disease phenotypes, as a reduction in ERG response in MPDZ mutants [348] and a reduced ERG with abnormal retinal morphology have been indicated for PARD3 mutants [41,43]. Equally important to the function and maintenance of the retina are the intracellular components that make up the cytoskeletal cell structure. Disruption of proteins that interact with actin intracellularly have been shown to lead to PR degeneration. For example, CDC42, a small GTPase that is a key regulator of actin dynamics [349] leads to an early onset, progressive PR degeneration when disrupted. Models caused by mutations in FSCN2, an actin crosslinking protein [350,351], and by a hypomorphic variant of CTNNA1, a protein that coordinates cell surface cadherins with the intracellular actin filament network [352], show slow-paced PR cell loss. The proper localization of organelles within the cell is also mediated by the cytoskeletal architecture and can have an untoward e ffect when disrupted. For example, SYNE2, a nuclear outer membrane protein that binds to F-actin, tethers the nucleus to the cytoskeleton and is necessary for the structural integrity of the nucleus [353,354]. Without it, early onset, moderately paced PR cell loss occurs.	doab	2025-04-07T03:56:59.525413	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 91 }
00a6a373-fd58-400b-bd1a-e87d014d5110.92	5.2.8. Category 08: Signaling Molecules such as growth factors/cytokines, hormones, neurotransmitters, and extracellular matrix proteins, or alternatively, mechanical stimuli, are examples of signals used to communicate environmental changes to the cell. Surface or intracellular (e.g., nuclear) receptors recognize the signals and e ffect changes within the cell, often setting in motion amplifying transduction cascades that mediate responses such as activation or inhibition of protein activity or migration to di fferent cellular localizations. Further, signals can also be transmitted from the cell to other cells, for example, through neurotransmitters. Since intra- and intercellular communication is crucial for the proper development or function of cells, it is not surprising that a large number of mutations in cellular signaling lead to defects in retinal development, which in turn a ffects PR survival. For example, vascular development is a ffected in mutants bearing disruptions in Fzd5, Lrp5, Ndp, and Tspan12—all components of the Wnt signaling pathway. Integral membrane frizzled receptors, of which they are 10, together with coreceptors, LRP5 and LRP6, mediate canonical Wnt signaling [355]. Thus, conditional Fzd5 null mutants develop microphthalmia, coloboma and persistent fetal vasculature, and late-onset progressive RD [356] and Lrp5 mutants exhibit similar vascular and retinal phenotypes [357]. Mice that are null for NDP, a ligand for FZD4, exhibit delayed retinal vasculature development, retrolental masses, disorganization of the ganglion cell layer, and occasionally focal areas of ONL absence at later stages of the disease [358]. TSPAN12, mediates NDP-FZD4-LRP5 signaling in the retinal vasculature, where it localizes, and a mutation leads to vascular defects that phenocopies disruptions in Ndp, Fzd4, and Lrp5, and at 3 months exhibits a 50% loss of PRs [359]. In all of these models, it is likely that the loss of PRs is caused by the aberrant retinal vasculature having secondary e ffects on PRs. A review by Hackam suggests that Wnt signaling may a ffect the apoptotic pathway and neurotrophin release, dysregulation of which may a ffect PR survival [360]. MFRP, which bears a CRD domain shared by all frizzled proteins, also leads to PR degeneration when disrupted [361,362], as does the human knock-in allele, p.S163R, of its bicistronic partner, CTRP5 [363]. The exact role or function of either protein has ye<sup>t</sup> to be fully elucidated. Like the frizzled-associated proteins whose pathological e ffects on PRs are likely to be mediated through an aberrant retinal vasculature, other signaling molecules, Ptpn11 and Fyn, appear to mediate their e ffects on PRs through another cell type as well, in this case, Müller glia cells, and PRKQ through the RPE. A Six3-cre mediated conditional knockout of Ptnp11 [364] leads to altered ERK and MAPK signaling in Müller glia and alteration in their adhesive capabilities. FYN, a Src-kinase membrane associated tyrosine kinase, localizes to Müller glia cells, and FYN deficiency leads to altered adhesion properties of Müller cells and retinal dysmorphology [365]. PRKCQ, a serine threonine protein kinase, which localizes to the lateral surface of the RPE cells, causes a reduction in adhesion between the apical processes of the RPE and OSs when it is disrupted. The reduction in adhesion may be responsible for the retinal detachment and subsequent PR loss observed in this model [366]. The family of PI3Ks or phosphoinositide 3-kinases, made up of catalytic and regulatory subunits, function to phosphorylate the inositol ring of phosphatidylinositol and thereby regulate growth, proliferation, di fferentiation, motility, survival, and intracellular tra fficking. For example, it mediates insulin-stimulated increase in glucose uptake and glycogen synthesis and responds to signals such as FGFRs and PDGFRs. Conditional knockouts of Pik3cb, encoding a catalytic subunit [367] and Pik3r1, encoding a regulatory subunit [368], using the cone-specific CRE, Tg(OPN1LW-cre)4Yzl, lead to progressive cone PR loss. IRS2, necessary for the integration of signals from insulin and IGF1 receptors, causes an early-onset, moderately paced PR loss [369]. Additionally, a targeted conditional allele of PDGFRB developed diabetic retinopathy like features with angiogenesis, proliferative DR-like lesions, pericyte drop out, and eventual PR loss [370]. Disruption of MAP3K1, a serine/threonine kinase, which participates in the ERK, JNK, and NF-κB signaling pathways, leads to retinal laminar and vascular defects, aberrant RPE, and PR cell death [371]. SEMA4A, a transmembrane protein, also causes PR loss, most probably through its e ffects on endosomal sorting [372]. ### 5.3. Category 09: Transcription Factors In mice, cone and rod PRs are born and develop between approximately E12 and P0, and approximately E13.5 and P7, respectively, from the same multipotent retinal progenitor cell (RPC) pool [373]. PR development, orchestrated by a network of transcription factors, is divided into five phases: proliferation of multipotent RPCs, restriction of RPC competence, cell fate specification, expression of genes important for PR function, and finally, PR structural maturation [374,375]. RB1 and E2F1 function by controlling the G1 to S phase transition in the cell cycle; RB1 plays an inhibitory role until activated by phosphorylation, balancing cell proliferation and cell fate specification [376]. OTX2 is critical for fate determination, while CRX is necessary for terminal PR di fferentiation and acts at di fferent steps in PR development. Transcriptional factors important for rod PR subtype specification include RORβ, NRL, and NR2E3, and for generation of the cone subtypes, TRβ2 and RXRγ [374,375]. Further, transcription factors regulate the expression of other transcription factors in the network (e.g., CRX interacts with Nrl, Rorb, and Mef2d, to name a few, to mediate rod di fferentiation, cone di fferentiation, and proteins necessary for the maturation of the PR, respectively). The importance of transcription factors in retinal development has been explored in many studies resulting in a number of mouse models with di fferent disease phenotypes (MGI JAX). In many cases, disruption of transcription factors, especially those a ffecting earlier phases of PR development lead to a reduction in the total number of retinal cells generated. We have only included within this category those disrupted transcription factors that eventually lead to PR degeneration. Interestingly, the onset of degeneration of the PR transcription factor models is highly variable—14 days to 2 months of age—and appears to be dependent upon the method used to generate the model and possibly background strain, as variation of severity and onset di ffers among di fferent models of the same gene. Interestingly, the Crx models provide a series that recapitulate the clinical diagnoses of autosomal dominant cone-rod dystrophy, Leber congenital amaurosis, and late-onset dominant retinitis pigmentosa. CrxRip heterozygotes showed 34% degeneration at five weeks, compared to mice homozygous for the mutation, which reached 55% degeneration at the same age [377]. Crxtm1.1Smgc was also noted to have a heterozygous disease presentation more similar to a cone-rod dystrophy, while the homozygous mutant presented with a disease phenotype similar to Leber congenital amaurosis with 70% loss of PRs at one month of age [378]. Other transcriptional factors necessary for the proper maturation of the PRs, such as, MEF2D, shown to be important in regulating transcription of OS and synaptic proteins [379], or NRF1 [380], important in mitochondrial biogenesis also develop PR degeneration when disrupted. Finally, there are transcriptional factors that are important in the development or function of supporting cells such as ONECUT1 for horizontal cells [381] and MITF for RPE and/or choroidal melanocytes [382], which affect PR survival when disrupted. ### 5.4. Category 10: DNA Repair, RNA Biogenesis, and Protein Modification Among the many disrupted genes that lead to PR degeneration, several instances have been documented in genes necessary for producing fully functional proteins, from transcription through post-translational modification. Defects in these genes are likely to impact the function of many other genes that they act upon, and hence, have a greater effect. Since they play a central and basic role, when disrupted they often lead to prenatal lethality in mice, and the adult phenotype is unknown unless a conditional knockout or hypomorphic allele is generated. For example, disruption of DNA repair genes such as Ercc1, RNA splicing genes such as Prpf3, Prpf6, Prpf8, Prpf31, and Bnc2, and miRNA processing genes, Dicer1 and Dgcr8 are prenatal lethal in a homozygous state [34,383]. In contrast, homozygous null alleles of Bmi1 [384] and Msi1 [385], both involved in repression of regulatory genes in embryonic development, are viable, suggesting potential compensatory mechanisms for the functional loss of these genes. Thus, germline, conditional or hypomorphic models were considered in this category. Review of genes in this category suggested that a DNA damage response network to ensure transcription in the face of DNA lesions might be required for PR cell maintenance. DNA lesions, such as pyrimidine dimers, interstrand crosslinks, or double-strand breaks (DSBs), are induced by many mechanisms that include UV radiation or free radicals. Repair of such damage is essential for DNA replication and, of particular importance for long-lived post-mitotic neuronal cells, transcription [386–388]. Proteins encoded by Bmi1, Dgcr8, Dicer1, Elp1, Ercc1, Ercc6, Msi1, Sirt6, Top2b, Ubb, and Uchl3 are known to participate in the DNA damage response [387,389–398], some in transcription-coupled DNA repair. For example, BMI1 represses transcription at sites of UV-induced DNA damage to allow repair [389]; ELP1 is a required component of the Elongator complex [399], which couples RNA polymerase II to an alkyladenine glycosylase that initiates base excision repair [392]; ERCC6 promotes DSB repair in actively transcribed regions by displacing RNA polymerase from the lesion site [387], and DGCR8 interacts with both RNA polymerase II and ERCC6 to mediate transcription-coupled nucleotide excision repair of UV-induced DNA lesions [390]. Intriguingly, topoisomerase TOP2B, which creates DSBs during transcriptional activation [396], has been identified as a key regulator of transcription during the last stages of postnatal PR development [400]. Thus, DSBs in PR cells may arise in part from transcriptional activation of genes that encode components destined for the OS. Additionally supporting the importance of DNA repair to PR maintenance, Category 01 gene Atr encodes a master regulator of the DNA damage response that has surprisingly been linked to retinal degenerative disease and localized to the cilium [401]. Further, Category 03 gene Nmnat1 encodes an enzyme that synthesizes nicotinamide adenine dinucleotide in the nucleus, which may regulate the large-scale polyADP-ribosylation of protein targets at sites of DNA damage [402]. Mutations in the genes encoding these proteins all result in PR cell loss [230,384,385,400,401,403–411]. Mutations in five of these genes as included in Figure 6 (Cwc27, Ercc1, Ercc6, Sirt6, and Ubb) caused moderate to slow progression of PR cell loss (D50 ≥ 2 months), consistent with a steady accumulation of unresolved DNA damage with age. The rapid PR cell loss observed in Atrtm1Ofc mice (D50 = 13 days) may reflect its direct involvement in OS development [401] in addition to the DNA damage response. Due to the high percentage of alternatively spliced genes in the human retina [412,413], it is not surprising that mutations in mRNA splicing genes: PRPF3, PRPF4, PRPF6, PRPF8, PRPF31, PDAP1, and BNC2 have been shown to lead to PR degeneration in humans [3]. In fact, in human retinal disease, 14% of disease genes are categorized as playing a role in RNA metabolism [383]. Interestingly, heterozygous humanized alleles of PRPF3 and PRPF8 and the null allele of Prpf31 in mice do not recapitulate PR degeneration observed in humans but rather exhibit late-onset RPE degeneration [414]. In contrast, a hypomorphic allele of the mRNA splicing gene, Cwc27, with reduced viability, does lead to moderate onset PR degeneration [415]. The differences observed among species require additional studies to unravel the complexities that govern genetic interactions. Post-translational modification, which occurs by adding modifying molecules to amino acids or removing or altering these modified amino acids, is important for proper folding, transport/trafficking, localization, function, regulation, and/or degradation of proteins. Examples of post-translational modifications include phosphorylation, glycosylation, acetylation, ubiquitination, sumoylation, methylation, and lipidation [416]. Kinases that affect activity by mediating phosphorylation states are described elsewhere, however, post-translational modification genes affecting glycosylation and lipidation/prenylation are prominent among those that lead to PR degeneration. For example, the encoded proteins of Fkrp, Large1, Pomt1, and PomgnT1, necessary for the glycosylation of alpha-dystroglycan, essential for formation of the dystroglycan complex and for proper retinal lamination, lead to moderate rates of PR degeneration when disrupted. Prenylation is critical for proper trafficking and localization of retinal proteins. Of the three genes important in the prenylation and postprenylation processes, conditional loss of Rce1 leads to an absence of phosphodiesterase subunits PDE6A, PDE6B, and PDE6C from the rod OS, probably due to a failure to prenylate one or more of these proteins [417]. By contrast, ablation of Icmt does not appear to affect phosphodiesterase transport but rather results in lowered levels of prenylated proteins GNAT1, PDE6G, and GRK1 [418], which are essential PR proteins. The null mutation of farnesyl-diphosphate farnesyltransferase 1, which adds a farnesyl group to the cysteine of the CAAX amino acid motif is prenatal lethal, but as a conditional tissue specific knockout may result in the same PR effects. Two additional types of post-translational modification involve glycylation and glutamylation of proteins essential for normal connecting cilia function. Disruption of Ttll3, encoding a protein-glycine ligase necessary for glycylation of tubulin, results in an absence of glycylation in PR cells, shortening of the connecting cilia, and slow PR cell loss [419]. Interestingly, PR tubulin glutamylation increased in Ttll3 mutant mice. TTLL5, tubulin tyrosine ligase like 5, adds glutamate residues on proteins. Sun et al. [420] reported that Ttll5 disruption leads to late onset, slowly progressive PR cell loss that phenocopied retinal disease observed in Rpgr mutants. Perhaps this is not surprising as these investigators determined that TTLL5 glutamylates RPGR, a modification that is necessary for normal RPGR function in the PR cilium. Agtpbp1 encodes a metallocarboxypeptidase that deglutamylates target proteins. Its disruption in pcd mutants leads to abnormal tubulin glutamylation [419] and an accumulation of vesicles in the interphotoreceptor space [421], indicating the importance of proper post-translational modification for PR survival. ### 5.5. Category 11: Immune Response As resident immune cells, microglia survey the retina constantly, presumably with the goal of removing unwanted debris and responding to damage arising from environmental and/or genetic stressors. They respond to damage by eliciting various responses that can range from regenerative to inflammatory depending on the type of injury. Thus, although microglia are unlikely to be instigators in RD, it may well be the case that microglia influence the severity of responses to ocular damage depending on mutations. Mutations in several genes central to the immune system lead to PR degeneration in mouse models. Airetm1.1Doi show early onset PR degeneration with 20% of ONL thickness loss at 10 weeks with rapid progression to 60% ONL thickness loss by 18 weeks [422]. C3ar1tm1Cge mutants show very slow PR degeneration with about 20% loss at 14 months [423]. Cd46tm1Atk show different rates of PR nuclei loss in male and female mice with 23% and 31% at 12 months of age, respectively [424]. Mutations in Cx3cr1, normally expressed in immune cells including microglia, were associated with PR cell loss. Homozygous Cx3cr1tm1Litt [425] and Cx3cr1tm1Zm [426] mice on the same C57BL/6J background showed similar rates of PR degeneration with 30% and 40% loss, respectively, at 16–18 months of age. However, Cx3cr1tm1Zm mice on the BALB/cJ background show complete nuclei loss at 4 months of age [426]. Cxcr5tm1Lipp causes late onset PR degeneration with 20% loss of ONL thickness at 17 months of age and RPE disorganization [427], whereas ablation of Irf3 and Igfbp3 showed mild PR degeneration at 2–4 months of age, about 10–14% [428,429]. Ccl2 and Ccr2 mutations also led to PR degeneration and fundus lesions, ONL loss in some areas and development of neovascular lesions, resembling phenotypes of AMD [430]. Cfhtm1Mbo was shown to have an impairment of rod and cone function by ERG and 29% decreased thickness of Bruch's membrane; however, rod opsin was distributed normally and no significant reduction in the number of PR cells was observed [431]. Cfhtm1.1Song demonstrated retinal whitening and cotton wool spots by fundus imaging [432]. Other genes involved in immune function that also showed PR degeneration as conditional knockouts encode transforming growth factor beta receptor II (Tgfbr2) [433] and aryl hydrocarbon receptor (Ahr) [434]. ### 5.6. Omitted Models with PR Abnormalities that May be of Interest Based on the exclusion criteria described in the Methods section, a number of models with PR abnormalities caused by single gene mutations were not included in our final Table S1. Since we narrowly defined PR degeneration models as post-developmental loss of PR nuclei, some models, which were described with only OS alterations or ERG di fferences, were not included. For example, mice bearing a spontaneous point mutation in the Ttc26hop [435] that leads to the generation of a stop codon, Tyr430Ter, were reported to show OS shortening at one year of age with no PR loss. Likewise, ectopic expression of cone opsins in rod OSs led to scotopic ERG abnormalities but not PR degeneration in Samd7tmlTFur mice at 12 months of age [436]. The many allelic variants that cause ERG abnormalities without PR cell loss are listed in the MGI database and can be accessed through a phenotype query. ### 5.7. Factors Leading to Phenotypic Variability ### 5.7.1. E ffects of Allelic Heterogeneity Allelic heterogeneity is frequently a cause of phenotypic variability. For mouse models, this is often encountered when comparing a knockout model with spontaneous or induced mutations that still allow a protein to be produced. The latter would primarily be hypomorphic alleles due to amino acid substitutions, some splicing mutations that leave alternate splice forms intact and some C-terminal truncating mutations, which may retain some protein function. Often the knockout allele will be the more severe, presumably because in addition to the loss of protein function, the loss of the protein itself may cause secondary defects such as the failure to form a molecular complex that normally needs the native protein to form. Mutations in the voltage gated calcium channel, Cacna1f, cause congenital stationary night blindness in humans due to abnormal neurotransmitter release in PR synapses. A null mutation in the Cacna1f gene ( ΔEx14–17) leads to an absent b-wave, abnormal PR synapses, lack of Ca2+ response in PR terminals and PR degeneration to 8 rows in the ONL at 8 months [314]. In contrast, an Ile756Thr amino acid substitution found in human patients and introduced into mouse, led to a di fferent phenotype with reduced b-wave, some intact ribbon synapses, a strong abnormal Ca2+ response, and a more severe degeneration (3–4 rows at 8 months of age [314]). Here the human allele represents a gain-of-function mutation that in addition to the loss of the original enzyme activity results in a new activity, or causes cell stress, which then induces additional phenotypes and makes the disease presentation more severe. Within an allelic series of amino acid substitutions there are also frequently gradations of phenotypic severity. If a protein has several functional domains, mutations in di fferent domains may lead to distinct phenotypes. In addition, some mutations can lead to an abnormal tertiary structure of the protein. Such structural changes can lead to a failure to interact with binding partners or substrates/ligands or change the nature of such interactions [437]. Structural changes can also a ffect export of the protein from the endoplasmic reticulum (ER) and result in ER stress and eventually apoptosis of the cell [438]. One of the larger allelic series available is for human PRPH2 with more than 150 disease causing mutations reported [439]. Although only the secondary structure of the protein is available, some clustering of disease phenotypes is apparent. For example, the area around amino acids 190–220 on the intradiscal loop 2 is enriched for mutations causing autosomal dominant retinitis pigmentosa. This area is thought to interact with ROM1. Mutations leading to macular degeneration are more frequently present between amino acids 142 and 172. However, some macular degeneration and autosomal dominant retinitis pigmentosa mutations are also found elsewhere in the protein [439,440]. Once a 3D structure is available, we may find that the disease specific mutations may well be in spatial proximity and a clearer picture of the genotype-phenotype relation may be revealed. Allelic heterogeneity can also arise from the intron/exon structure of the gene itself. Many genes produce several distinct transcripts through alternative splicing of their exons [441]. These differing transcripts can each produce proteins, which possess unique functions. For example, the Rpgrip1 gene produces two splice variants that code for proteins that differ at their C-terminus, a full-length transcript and a shorter transcript encompassing exons 1–13 plus three additional C-terminal amino acids. An insertion between exons 14 and 15 of the full-length transcript leads to PRs with vertically stacked OS discs [442], whereas, a chemically induced mutation in the splice acceptor site in intron 6 that leads to a loss of both splice variant forms results in a failure to develop OSs altogether [443]. Despite the promise of genotype–phenotype correlation analyses to aid in the functional annotation of retinal proteins as well as in the diagnosis and prognosis of retinal degenerative diseases, few allelic series are ye<sup>t</sup> available. In humans the analysis is complicated by the fact that environment and genetic background effects can confound the allelic effect. In animal models, large allelic series are not ye<sup>t</sup> available. Until recently allelic heterogeneity posed a problem for the generation of mouse models for human retinal diseases because only transgenesis and the generation of knockout models by homologous recombination were available. The removal of the gene products using knockouts can only model recessive or haploinsufficiency diseases, and often the complete lack of the protein will lead to embryonic lethality. Transgenic models are associated with their own set of problems. Depending on the transgene integration site, the expression of the transgene can be reduced or cellularly restricted. Integration into an unrelated gene can disrupt expression of that gene and cause a phenotype that is not related to the transgene. The use of directed transgene insertion into safe sites, such as the Rosa26 locus (Gt(ROSA)26Sor) provides a workaround for some of these problems, although the choice of a promoter that faithfully mimics the native expression is still a difficult process. For these reasons, transgenic mouse models were not included in this review. With the advent of CRISPR/Cas9 technology to produce precise cuts in genomic DNA, and the ability to perform gene editing through homology directed repair, it is now feasible to recreate human mutations in the mouse and directly probe for the phenotypic effects of allelic heterogeneity [444]. Comitato et al. present an interesting phenotype comparison of transgenic and knock-in rhodopsin P23H models [445]. ### 5.7.2. Effects of Genetic Interactions Gene interaction, or epistasis, is frequently observed during genetic analysis when two or more alleles at different loci combine to alter the onset, type, or severity of disease phenotypes. Such phenotype altering interactions arise from the organization of proteins and RNAs into macromolecular complexes and/or biochemical and regulatory pathways and networks. For example, consider hypomorphic mutations in two proteins that are components of a linear enzymatic pathway. Individually the reduced activity may not greatly impact the flux through the pathway, but combined in the same cell, the pathway flux may be reduced and become severe enough to induce a disease phenotype due to a lack of sufficient pathway product. Alternatively, a mutation may impair Pathway A, so that a disease phenotype arises. A second mutation may arise in a Pathway B that allows it to compensate for the malfunction in Pathway A and thus reduce the severity of the original disease phenotype. Mutations of this latter type of interacting mutations are called suppressor mutations and are extremely useful because they directly identify potential drug targets whose manipulation may be used to treat disease. In general, identification of genetic interactors can be useful for placing the primary mutated gene in a biological context and help to define its cellular and organismal function. Often, the known function of a gene and its biology can sugges<sup>t</sup> candidate interacting genes. Similar to the first hypothetical interaction case above, mutations in two proteins involved in iron homeostasis, ceruloplasmin (CP), a ferroxidase associated with transferrin transport across the plasma membrane, and hephaestin (HEPH), implicated in iron transport across cells, individually do not show obvious PR degeneration. Combined in a double mutant mouse model, however, they lead to iron overload in the retina and subsequent RPE abnormalities and PR degeneration [446]. Another example involves two proteins necessary for retinoid recycling, ABCA4 and RDH8. Mutations in each alone do not show any phenotype; combined they cause all-trans-retinoid accumulation and PR degeneration [296]. Since previous studies had suggested that activation of TLR3 may lead to inflammation and mediating apoptosis [447], the authors explored the role of Tlr3 in their Abca4/Rdh8 double mutant model. Importantly, adding a targeted mutation of Tlr3 to make a triple mutant mouse resulted in rescue of PR cells [448]. Here then the Tlr3 mutation acts as a suppressor of the degenerative phenotype of the Abca4/Rdh8 double mutant. Additional interacting gene pairs have been found that affect PR degeneration, among them MertktmlGrl; Tyro3tmlGrl [449], Cep290rd16; Bbs4tm1Vcs [450], Cep290rd16; Mkkstm1Vcs [451], Rpgrtm1Tili; Cep290rd16 [452], Cngb1tm1.1Biel; Cnga3tm1Biel; Hcn1tm2Kndl [453], Crb1tm1.1Wij; Crb2tm1.1Wij [454], Dio3tm1Stg; Dio2tm1Vag [455], and Ercc6tm1Gvh; and Xpatm1Hvs [456]. In addition to testing candidate interacting genes, methods have been developed to identify such interactors in an unbiased fashion that is illustrated below. Effects of genetic background. For the calcium channel gene Cacna1f mentioned above, there is a third allele available. Chang et al. [457] reported the phenotype of the nob2 mutation, an out-of-frame insertion of a transposable element into the Cacna1f gene, which is predicted to cause a truncation after 32 amino acids. The authors demonstrated by western blot that this is a null mutation and no protein is detected. Compared to the ΔEx14–17 null mutation, however, the phenotype of nob2 is much milder with no apparent PR degradation [457]. The most likely explanation for this discrepancy can be deduced from the fact that the nob2 mutation arose on the AxB6 recombinant inbred strain, a strain whose DNA is composed of alternate segments derived from C57BL/6J and A/J. It is likely that the A/J strain carries one or more modifier loci that suppress the PR degeneration induced by a Cacna1f null mutation. Upon outcrossing an inbred strain carrying a mutation that leads to a particular phenotype with a different inbred strain, it is frequently observed that the phenotype of the offspring differs from that of the parents. This was often encountered in the past when knockout alleles were created in embryonic stem cells derived from strain 129/Sv and the founder animals were then made congenic on the C57BL/6 background. An early example is a study of a homozygous Rho knockout that was shown to lose PR nuclei significantly faster on the 129Sv background than on the C57BL/6 background [458]. Corresponding differences were also found in the number of apoptotic nuclei and in ERG responses. It was concluded that the B6 strain carries protective alleles of modifier genes that lead to a slower rate of PR degeneration [458]. Alternatively, it is also possible that 129Sv carries modifier alleles that accelerate degeneration. Other inbred strains have also been reported to modify retinal phenotypes. For example, a targeted mutation of Rp1 (Rp1tm1Eap) only showed moderate PR degeneration as an incipient congenic (N6) on the A/J strain background, but not on C57BL/6J or DBA/1J backgrounds [459]. ONL dysplasia and excess blue cone formation caused by loss of Nr2e3 in C57BL/6J are suppressed by the genetic backgrounds of CAST/EiJ, AKR/J, and NOD.NON-H2nb1 strains [460]. In principle, all inbred strains will carry modifier alleles. However, which strain modifies a particular mutation will depend on the primary mutation. It should be emphasized that an inbred strain represents a single genotype. In order to model the phenotypic spectrum of a human disease-causing mutation, many inbred strain backgrounds would have to be examined. Recently, advanced genetically diverse mouse populations have become available, such as the collaborative cross (CC) or the diversity outcross (DO) populations, that allow for more e fficient modeling of human populations compared to the classical inbred strains [461,462]. Modifier screens. Modifier screens are a tool to identify genes that modify phenotypic traits caused by a particular mutation. The disease modifying properties of inbred strains have been used for many decades to identify the underlying modifier genes by using genetic crosses, marker assisted genetic mapping of modifying loci, and positional cloning or more recently high throughput whole exome or whole genome sequencing approaches. For example, when B6.Cg-Nr2e3rd7 homozygotes are outcrossed to CAST/EiJ, AKR/J, or NOD.NON-H2nb1 and then the F1 mice intercrossed, homozygous Nr2e3rd7 mice of the F2 generation are found that unlike the parental B6.Cg-Nr2e3rd7 homozygotes have fewer spots on fundus examination and no PR layer dysplasia in histological sections [460]. This phenotypic variability is caused by the genetic interaction between the Nr2e3rd7 disease allele and variants of so-called modifier genes that are specific to the outcross partner strain. Several quantitative trait loci (QTL) on chromosomes 7, 8, 11, and 19 were mapped [460]. Generation of a congenic line carrying the Chr11 modifier, along with further fine mapping, reduced the critical genomic interval to 3.3 cM. Several candidate genes were sequenced and a single nucleotide polymorphism was found in a nuclear receptor gene, Nr1d1, that is predicted to lead to an Arg409Gln amino acid change. Causality was confirmed by phenotypic rescue of the rd7-associated phenotypes by in vivo electroporation of a wild-type Nr1d1 expression construct [463]. Several other modifiers have been mapped and identified based on inbred strain di fferences. For example, mapping crosses have been carried out for rd3 (BALB/cJ and C57BL/6J, [464]), rd1 (C3H/HeOu and FVB/N, [465]), Crb1 (C57BL/6N and C57BL/6JOlaHsd, Chr15, [466]), Mfrp (B6.C3Ga and CAST/EiJ, Chr 1, 6, and 11 [467]), and Tub and Tulp1 (C57BL/6J and AKR/J, Mtap1a, [468]). Although not ye<sup>t</sup> widely used as a means to explore retinal biology, a very e fficient way to identify modifier genes is the use of a sensitized mutagenesis screen in which a male mouse carrying a mutation of interest is given a chemical mutagen and its o ffspring are examined for any change in the original phenotype. O ffspring carrying a potential mutation is backcrossed to the unmutagenized parental inbred strain to test for heritability and to reduce the mutational load. Mutations are identified using whole exome sequencing of the pheno-deviant mouse. This approach avoids the limited genetic diversity of inbred strains since in principle all genes can be mutated. An example of the utility of mutagenesis to search for modifier genes is the identification of a suppressor mutation in Frmd4b that prevents the PR dysplasia and external limiting membrane fragmentation observed in Nr2e3rd7 mutant mice [469]. ### 5.7.3. E ffects of Environment on PR Degeneration PR cell loss has been shown to be induced by a number of environmental factors such as light, diet, and smoking in combination with particular genotypes. Perhaps not surprisingly, light exposure in some models bearing mutations in genes that function directly or in an ancillary fashion in the visual transduction pathway trend toward hastening PR degeneration [470,471]. For example, transgenic mice bearing the rhodopsin VPP mutation, widely used in visual transduction studies, is susceptible to light-exacerbated PR degeneration [472]. Likewise, mice carrying a homozygous Prom1 null mutation are particularly susceptible to light-induced degeneration. At eye opening, with exposure to light, degeneration initiates at P14, and all PRs are gone by P20, whereas dark rearing from P8 to P30 leads to significant preservation of PRs [471]. Dark-rearing has also been demonstrated to delay PR degeneration in Slc6a6tm1Dhau (10% loss vs. 90% loss in normal vivarium lighting at three weeks of age) [473] or have no e ffect in C57BL/6-Mitfmi-vit/J homozygotes [474]. In some situations, light may actually trigger the disease phenotype, as is the case in Sag knockout mice [198,199], with three Class B1 Rhodopsin missense mutations, Tvrm1 and Tvrm4 [157] or Tvrm144 [18], and in null mutation models of Rdh12 [475], Asic2 [476], Myo7a [477], Whrn [478], or Akt2 [479]. Sag mutants must be reared in the dark to observe any PR cells. Under normal vivarium lighting conditions, the other light-sensitive mouse models do not show PR degeneration or only a slight shortening of OS at one year of age, as in the those carrying Rho alleles Tvrm1, Tvrm4, or Tvrm144, and in retinol dehydrogenase (Rdh12) mutant mice. However, exposure to bright light or rearing under cyclic moderate-lighting, even subjecting mice to fundus examination, leads to PR degeneration. A comprehensive list of animal models and the effects of dark-rearing or light exposure can be found in reference [470]. Like light exposure, smoking and high fat intake have been proposed to have a negative impact on retinal function by increasing oxidative stress and inflammation in PR and RPE cells [480]. Smoking has been implicated as a major risk factor in the development of age-related macular degeneration in humans [481,482], and the results have been replicated in mouse models as well. Smoking leads to increased oxidative stress and inflammation in B6 mice [483] and in the presence of Nfe2l2 deficiency [484]. Likewise, combinations of smoking and high fat intake in the presence of an ApoB mutation that promotes production of the APOB100 isoform [485] leads to significant loss of PRs [484]. Further, high-fat diet intake for certain genotypes, such as mutations of Ldlr [486] or certain alleles of Apoe [487], has been shown to compromise PR integrity in mice. The majority of pharmacological or dietary interventions that have been reported in the relationship to PR degeneration in mouse models are associated with the goal of increasing vitamin A derivative availability [488–490] or reducing oxidative stress [491,492] in the retina. Heritable mutations in enzymes, such as LRAT or RPE65, required for processing of vitamin A within the retina are known to cause early onset RD due a deficiency of the 11-cis-retinal chromophore. E fficacy of treatment with 9-cis-retinal derivatives of mice with null mutations in Lrat and Rpe65 mice is thoroughly discussed in a review by Perusek and Maeda [488,489]. Administration of antioxidants has in some cases improved PR survival. Rs1tm1Web homozygous females or hemizygous males fed a diet high in DHA [493] or Pde6brd10 mice fed lutein and zeaxanthin [494] showed a significant PR preservation. Further, injections of a mixture of antioxidants—alpha tocopheral, ascorbic acid, alpha-lipoic acid, and/or Mn(III)tetrakis porphyrin—were able to slow the loss of cone/rod PRs in Pde6brd1 [495], and Pde6brd10 mice and in mice with a rhodopsin Q344ter mutation [492]. Environmental enhancement of Pde6brd10 mice was able to significantly reduce PR loss presumably by reducing retinal oxidative stress [496]. ### 5.8. Relationship to Human Disease Genes Of the 273 retinal degenerative disease genes in RetNet [3] for which mouse homologs exist, mouse models are available for 110 or 40% of them, including both germline and conditional mutants (Figure 7). Through our survey, we found 120 additional genes, in which mutations lead to PR degeneration. These genes could serve as candidates for ye<sup>t</sup> to be identified human retinal diseases. The available mouse models, for the most part, recapitulate the human disease phenotype well and permit mechanistic and therapeutic studies. However, apparent failures of mouse models do occur. When mutations in MFRP were first identified in humans [497], mice were thought to be a poor model because unlike humans [498], mice were previously reported to develop PR degeneration [499], and the microphthalmia and hyperopia found in human patients had not been reported in homozygous Mfrprd6 mice. In subsequent years, numerous human patients have been identified that do show a degenerative phenotype [500] and hyperopia was detected both in a mouse model carrying a human MFRP c.498\_499insC allele [501] and the original Mfrprd6 mouse (our unpublished observations). An important family of deaf–blindness diseases, Usher syndrome, was also thought to be poorly recapitulated in mice, because early models like the shaker-1 mouse had only the characteristic hearing loss, but no retinal degeneration [502]. Later, however, it was found that moderate light exposure does result in photoreceptor degeneration in shaker-1 mice [477]. In addition, a knock-in of the Acadian USH1C c.216G>A mutation into the mouse Ush1c gene recapitulates both deafness and retinal degeneration phenotypes [503]. In many cases, discordance between the human and mouse phenotypes can be attributed to insu fficient information about variation in the human disease, or to allelic e ffects (knockout vs. hypomorph or gain of function, expression of alternatively splice isoforms), or strain background (modifier genes) in the mouse models. Such shortcomings in mouse models can often be addressed by testing multiple models, including human disease alleles, and by using multiple genetic backgrounds. Figure 7. Comparison of the number of RD genes identified in human (RetNet) and mouse as listed in Table S1 and summarized in Figure 3. The total number of genes in the RetNet database that cause monogenic disease and have mouse homologs is indicated, as is the total for which conditional or germline mutations have been associated with PR cell loss in mice, as described in this review. Numbers within the overlapping areas of the diagram represent genes present in both RetNet and Table S1; the remaining numbers represent genes that are unique to the indicated category. Although humans and mice share about 98% of their genes, species differences do exist and need to be considered when selecting a model. Examples of vision-related genes that mice lack are EYS, ARMS2, and CETP. Species differences are the result of different evolutionary histories; humans and mice have encountered different pathogens, resulting in adaptations of our respective immune systems. Mice have different nutritional requirements, resulting in differences in lipid metabolism. Additionally, mouse eyes are adapted to a nocturnal life, resulting in a rod dominated retina with no macula. Nevertheless, mice possess all of the same retinal cell types necessary for vision and the vast majority of the same genes, and even when missing genes are introduced into mice they result in relevant phenotypes. For example, in a transgenic mouse model for Stargardt-like macular degeneration 3 due to a mutation in Elovl4, PR cell loss occurs in the central retina in a pattern that resembles the human disease [504]. For the many retinal diseases still in need of models, including complex diseases such as AMD or diabetic retinopathy, it remains the case that valuable new insights into disease mechanism and basic eye biology can still be obtained from mouse studies.	doab	2025-04-07T03:56:59.526241	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 92 }
00a6a373-fd58-400b-bd1a-e87d014d5110.93	6. Discussion ### 6.1. Variability in Measuring PR Cell Loss We noted an extremely large variability in PR cell loss data presented in the various reports, which were based on several different types of measures, such as ONL thickness obtained from toluidine-stained plastic sections, hematoxylin and eosin-stained paraffin sections, or DAPI-stained cryosections; counts of rows of ONL nuclei in the same preparations; counts of the total number of ONL nuclei in a fixed retinal area; spider plots assessing ONL thickness over the full perimeter; ONL thickness from OCT B-scans. Cone numbers were assessed in sections or whole mounts stained with cone opsins, peanut agglutinin lectin, or cone arrestin. Methods to count cone cell nuclei efficiently might benefit from studies that examine the effect of mutations in genes that specifically affect cones. Perhaps more challenging is that many studies provided insufficient sample sizes or number of time points to assess the progression of PR cell loss. Some of this variability reflects the evolution of methods and quantitative approaches over several decades, and some may be attributed to the different choices each laboratory makes depending on what works best given resources and interests. However, to aid future efforts to compare PR cell loss between studies, we recommend that at least three ages be assessed, one prior to the onset of PR cell loss, and at least two within the age range where PR cells are declining exponentially (that is, between 95% and 5% of wild-type values), and that the data be quantified relative to gender-matched controls at these same ages. Although a decrease in PR cell numbers as estimated above is widely accepted as evidence for RD, an alternative explanation may apply in some instances. Mcoln1tm1Sasl homozygotes exhibit an apparent decrease in PR cells to 54% of wild-type at one month of age, a value that remained unchanged at two and six months [505]. TUNEL analysis revealed no increase in apoptosis at any age compared to controls, and both histology and OCT indicated a decrease in total retinal thickness. It is possible that the rapid initial decrease to a stable value may result from retinal thinning as the eye enlarges due to myopia during postnatal development, an occasionally observed feature of MCOLN1-associated disease in humans [506]. Methods are available to measure axial length in mice [507], which might be used to determine whether the observed change in nuclear layer thickness is due to ocular enlargement. Models in Table S1 with a similar phenotype include Guca1atm1.1Hunt and Ctnna1Tvrm5. ### 6.2. Correlation of PR Cell Loss with Gene Function As a fortuitous consequence of our inquiry, in some cases, the progress of PR cell loss could be correlated with gene function within categories. For example, in the ciliary function and tra fficking section we see trends in the onset and progression of RD depending on the role and location of gene products within the PR. Mice with mutations in genes involved in ciliogenesis or in transition zone protein complexes, typically result in a PR degeneration that begins at 2 weeks during OS biogenesis and progresses rapidly through OS maturation. Null mutations in genes that encode components of the IFT machinery tend to result in premature death or embryonic lethality, and conditional ablation of these genes in the retina typically leads to early and rapid PR loss. Models with disruptions in protein complexes with roles in BBSome assembly or regulation, protein/lipid tra fficking, axoneme extension, or disc morphogenesis tend to have a moderate to slow degeneration. Lastly, mice with mutations that disturb basal body and pericentriolar anchoring and integrity such as the Usher periciliary membrane complex undergo a very slow form of RD, which results in partial PR function throughout the life of the mouse. It remains possible that the slower progression of PR cell loss, especially when associated with members of protein complexes, may be the result of genetic redundancy where multiple genes encode proteins that have similar biochemical functions. It was also interesting to note that disruption of chloride channels appeared to be particularly deleterious to PR survival. Many of the models we identified with early and rapid progression of PR cell loss, including those a ffecting a subset of the ciliary genes discussed above or the OS components Prom1, Prph2, and Rho, appear to be required for OS assembly. Chloride channel defects resulted in similar progression, raising the possibility that chloride homeostasis is important for OS development. This idea is supported by evidence that chloride transport by the chloride channel ANO1 is required for ciliogenesis [508] and that control of intracellular chloride ion levels by this channel regulates the membrane organization of phosphatidylinositol 4,5-bisphosphate [509], a prominent lipid that regulates ciliary development [131,510]. Characterization of early OS development in mouse models defective in chloride channels CLCN2, CLCN3, or CLCN7 may provide mechanistic clues on the role of intracellular chloride in ciliogenesis. Finally, our analysis revealed links between PR cell loss and a network of 13 genes known to participate in the cellular response to DNA damage, four of which have been directly associated with transcription-coupled DNA repair. Based on canonical indicators of DNA repair, such as the colocalization of phosphorylated histone H2AX and TRP53BP1 (also known as 53BP1) at DSBs, it has been reported that rod PR cells in mice lack a robust canonical DNA damage response, [241,511]. An attenuated response may reflect an adaptation to improve rod cell survival [241,511]. Nevertheless, mechanisms are present in rod cells to repair DNA damage, as evidenced by the robust levels of DNA repair factors [241] and by our results indicating that a network of DNA damage response genes is required for maintaining PR cell viability. Together, these results support the idea that a non-canonical DNA damage response pathway exists in rod PR cells [512]. Further study of the DNA damage response genes linked to PR cell loss in mice may be useful for elucidating this pathway.	doab	2025-04-07T03:56:59.529025	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 93 }
00a6a373-fd58-400b-bd1a-e87d014d5110.94	7. Conclusions This review highlights mouse models of monogenic retinal degenerative diseases that cause rod or cone PR cell loss. The models include germline mutations and conditional alleles, in which characterization of retinal phenotypes in germline mutations was not possible due to embryonic or perinatal lethality. By providing an extensive list of these models as well as a means of comparing their progression, we hope to benefit researchers who seek to optimize their experimental approaches. Supplementary Materials: The following are available online at http://www.mdpi.com/2073-4409/9/4/931/s1, Figure S1: OCT and fundus images of C57BL/6J control mice at various ages, Table S1: Monogenic mouse RD models with PR cell loss, Table S2: Description of gene/protein symbols used in the text and figures. Author Contributions: Conceptualization, P.M.N., M.P.K.; methodology, M.P.K., B.C., P.M.N.; software, M.P.K.; formal analysis, M.P.K.; investigation, G.B.C., N.G., N.D., J.P., L.F.H., L.S., J.K.N., M.P.K., P.M.N.; resources, B.C., J.K.N., P.M.N.; data curation, G.B.C., N.G., N.D., J.P., L.F.H., L.S., J.K.N., M.P.K., P.M.N.; writing—original draft preparation, G.B.C., N.G., N.D., J.P., L.H., J.K.N., M.P.K., P.M.N.; writing—review and editing, G.B.C., N.G., J.K.N., M.P.K., P.M.N.; visualization, B.C., M.P.K.; supervision, J.K.N., P.M.N.; project administration, P.M.N.; funding acquisition, M.P.K., B.C., J.K.N., P.M.N. All authors have read and agree to the published version of the manuscript. Funding: This work was funded in part by National Institutes of Health grants 5R01EY011996, 5R01EY027860, R01EY027305 (to P.M.N), 5R01EY028561 (to J.K.N.), 5R01EY019943 (to B.C.), and 5R21EY027894 (to M.P.K). N.D. was supported by the gran<sup>t</sup> from the Royal Golden Jubilee (RGJ) Scholarship (PHD/0102/2559), Thailand Research Fund. Acknowledgments: The authors thank James Kadin and Grace Stafford for help with scripts to filter PubMed data, Cynthia Smith for her contributions to Table S1 and for coordinating our efforts with those at MGI, Melissa Berry for assistance with nomenclature, Bernard Fitzmaurice and Wanda Hicks for fundus and/or OCT imaging, and Jane Cha for drawing Figure 1. Conflicts of Interest: The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.	doab	2025-04-07T03:56:59.529486	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 94 }
00a6a373-fd58-400b-bd1a-e87d014d5110.96	Review Large Animal Models of Inherited Retinal Degenerations: A Review ### Paige A. Winkler, Laurence M. Occelli and Simon M. Petersen-Jones \* Department of Small Animal Clinical Sciences, Veterinary Medical Center, Michigan State University, East Lansing, MI 48824, USA; [email protected] (P.A.W.); [email protected] (L.M.O.) \* Correspondence: [email protected]; Tel.: +1-517-353-3278 Received: 1 March 2020; Accepted: 31 March 2020; Published: 3 April 2020 Abstract: Studies utilizing large animal models of inherited retinal degeneration (IRD) have proven important in not only the development of translational therapeutic approaches, but also in improving our understanding of disease mechanisms. The dog is the predominant species utilized because spontaneous IRD is common in the canine pet population. Cats are also a source of spontaneous IRDs. Other large animal models with spontaneous IRDs include sheep, horses and non-human primates (NHP). The pig has also proven valuable due to the ease in which transgenic animals can be generated and work is ongoing to produce engineered models of other large animal species including NHP. These large animal models offer important advantages over the widely used laboratory rodent models. The globe size and dimensions more closely parallel those of humans and, most importantly, they have a retinal region of high cone density and denser photoreceptor packing for high acuity vision. Laboratory rodents lack such a retinal region and, as macular disease is a critical cause for vision loss in humans, having a comparable retinal region in model species is particularly important. This review will discuss several large animal models which have been used to study disease mechanisms relevant for the equivalent human IRD. Keywords: large animal model; inherited retinal disease; progressive retinal atrophy; retinitis pigmentosa; Leber congenital amaurosis; achromatopsia; congenital stationary night blindness	doab	2025-04-07T03:56:59.529776	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 96 }
00a6a373-fd58-400b-bd1a-e87d014d5110.97	1. Introduction Large animal models for inherited retinal degenerations (IRDs) have been identified within populations of dogs, cats, sheep, horses and, more recently, non-human primates (NHP). Many different IRDs have been identified in pedigree dogs, most of which mimic retinitis pigmentosa (RP) or Leber congenital amaurosis (LCA). The term "progressive retinal atrophy" (PRA) is used to describe this group of photoreceptor degenerations. In some instances, more detailed descriptive terms such as rod–cone dysplasia or progressive rod cone degeneration have been used. Common dog breeding practices have tended to bring out recessive conditions and have made the pedigree dog a rich source of models for inherited disease, including IRDs. Engineered large animal IRD models such as transgenic pigs have also been produced [1]. With advances in gene editing technologies, further models are likely to be produced in species such as pigs and NHPs and possibly even cats and dogs. The advantages of large animal models over laboratory rodent models of IRDs include the similarity in the size of the eye to that of man [2]. This is of particular importance for the development of translational therapies because it allows identical surgical delivery approaches to be used in the animal model to those that will be eventually used in human patients. NHPs are obviously close relatives to humans, making them attractive models. However, only a few spontaneous IRDs in primates have been identified [3,4], although steps are being taken to identify more animals with disease-causing mutations and to use genome editing to generate additional models with mutations in genes of importance, either for germline transmission (see [5] for a review) or somatic gene knockout [6]. Another major advantage of large animal models is the presence of a retinal region equivalent to the macula. Laboratory mice and rats are nocturnal rodents that do not have a macula equivalent. The macula is of major importance for high acuity vision and some conditions specifically or differentially affect that retinal region compared to the peripheral retina. Macular dystrophies have been associated with mutations in a number of different genes (see [7,8] for reviews), some of which have relevant large animal models which are discussed below, including Stargardt Disease (ABCA4 mutations), Best Disease (BEST1 mutations) and in some patients with RDH5 mutations. Age-related macular degeneration (AMD) is a major cause of vision loss and has genetic and environmental contributors [9,10]. Screening of primate colonies for animals with lesions comparable to AMD have been performed [11] (for a review, including primate models, see Pennesi et al. [12]). The large animal model species considered here have an area centralis with high photoreceptor density, including, importantly, cones that are equivalent to the human macula [13]. While NHP also have a fovea, most of the other model species do not, although the dog has been reported to have a small concentration of cones in the center of the area centralis, referred to as a "bouquet" of cones [14]. There are several important instances where laboratory rodent engineered models fail to recapitulate the human disease; important examples including ABCA4-Stargardt disease, RDH5-retinopathy, or where the gene involved is not present in the mouse or rat genome e.g., EYS [15]. The disadvantages of the large animal model species tend to be cost, generation of sufficient animals due to the slower reproduction, and because of the longer lifespan (compared to laboratory rodents), the disease course may be longer. Large animal models have also been important in therapy development. The first proof-of-concept gene augmentation therapy that eventually led to the FDA approval of the first gene therapy product, Luxturna, for the treatment of LCA due to RPE65 mutations, was performed in a dog model [16]. Table 1 shows a list of IRDs in large animal models and their identified mutations. Retinal layers and the genes discussed in detail within the text are shown in Figure 1. This review will cover the models in which the studies have contributed to the understanding of the mechanism of disease and/or protein structure and function in greater detail. Table 1. Cont. development STK38L\* dog c.299\_300ins [218;285\_299]; p.Lys63\_Glu103del Table 1. Cont. Figure 1. Schematic of retinal layers and associated genes discussed within this review. The left image shows a histologic section of a feline retina (with comparable anatomy to the human retina). The right panel depicts a schematic showing the genes detailed in this review and their site of expression, grouped per biological process. Inner limiting membrane (ILM), nerve fiber layer (NFL), ganglion cell layer (GCL), inner plexiform layer (IPL), inner nuclear layer (INL), outer plexifom layer (OPL), outer nuclear layer (ONL), external limiting membrane (ELM), photoreceptor inner segmen<sup>t</sup> (IS), connecting cilium (CC), photoreceptor outer segmen<sup>t</sup> (OS), retinal pigmentary epithelium (RPE). Ganglion cell (GC), amacrine cell (AC), bipolar cell (BC), horizontal cell (HC), rod (R), cone (C).	doab	2025-04-07T03:56:59.529925	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 97 }
00a6a373-fd58-400b-bd1a-e87d014d5110.98	2. Mutations in Phototransduction Genes There are spontaneously occurring large animal models with mutations in the genes of the phototransduction cascade, and rhodopsin (RHO) transgenic pig models have been generated. Studies of these models have contributed to the understanding of how the mutation of these genes leads to photoreceptor death.	doab	2025-04-07T03:56:59.530256	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 98 }
00a6a373-fd58-400b-bd1a-e87d014d5110.99	2.1. RHO Mutations in RHO can result in a range of phenotypes, most commonly autosomal dominant RP (adRP), but also autosomal recessive RP (arRP) and congenital stationary night blindness (CSNB). Animal models and in vitro studies have allowed RHO mutations to be divided into seven classes (see [17] for a recent review).	doab	2025-04-07T03:56:59.530299	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 99 }
00a6a373-fd58-400b-bd1a-e87d014d5110.100	2.1.1. Dog Model A spontaneous dog model of RHO adRP has been identified [18]. The c.11C>G, p.Thr4Arg mutant dog (RhoT4R) develops a retinal degeneration that is greatly exacerbated by light exposure [19]. The phenotype of this dog model closely resembles that of the human p.Thr4Lys RHO mutation which results in dominant RP [20]. Studies of the RhoT4R dog have advanced the understanding of the disease mechanism underlying class four RHO mutations (those with altered post-translational modification and stability [17]). RHO has seven transmembrane loops with intradiscal and cytoplasmic loops and in the dark-adapted state is combined with the chromophore 11-cis-retinal. The N-terminal of the protein, which is affected by the p.Thr4Lys mutation, is positioned within the lumen of the outer segmen<sup>t</sup> discs and creates a "cap" over one of the extracellular loops. This cap contributes towards thermal stability and receptor activation of the protein; it also protects the chromophore to opsin protein covalent bond from hydrolysis. Important for the cap role of the N-terminal is glycosylation at N2 and N15. The p.Thr4Arg mutation interferes with glycosylation at the N2 site, altering the cap role. The monoglycosylated rhodopsin is expressed and is trafficked to the outer segment; however, it loses the chromophore faster than the normal meta-rhodopsin II and interacts poorly with the G-protein [21]. The RhoT4R dog has light dependent degeneration similar to the sector RP seen with some rhodopsin mutations. In sector RP, the inferior retina is more severely affected as this region gets more light exposure [22]. There is increasing awareness of the need to reduce light exposure to patients with certain RHO mutations [23]. Studies suggested that the unliganded form of the mutant opsin has a detrimental effect because of the loss of its structural integrity. Further evidence to support this was provided by cross breeding RhoT4R dogs with the Rpe65−/− dog to produce RhoT4R/+ Rpe65−/− dogs which lack 11-cis-retinal chromophore (due to the lack of Rpe65 function) and thus have only unliganded mutant rod opsin (i.e., have a lack of rod opsin combined with 11-cis-retinal) and show a greatly accelerated rate of retinal degeneration compared to RhoT4R/+Rpe65+/+ dogs (see details on the Rpe65−/− dog below) [21].	doab	2025-04-07T03:56:59.530341	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 100 }
00a6a373-fd58-400b-bd1a-e87d014d5110.101	2.1.2. Pig Models A number of Rho transgenic pigs have been generated, representing different human mutations: p.Pro23His [24], p.Pro347Leu [25] and p.Pro347Ser [26]. Studies using the p.Pro347Leu pigs showed the development of ectopic cone to rod bipolar cell synapses [27] and also interference with the cone to OFF-bipolar cell connection maturation [28]. The potential contribution of oxidative stress to cone death was demonstrated in the model [29]. The light responses of single rod photoreceptors of p.Pro347Leu and p.Pro347Ser transgenic pigs have been studied by suction pipette recording. The recording revealed protracted recovery of the photoresponse and a progressive reduction in the time to peak of the response with reduced sensitivity. This work suggests that the mutant rhodopsin reaches the outer segmen<sup>t</sup> and that the substitution at Pro347 interferes with inactivation of the activated form of Rho. The resulting hypothesis was that the carboxyl end of Rho may be involved in the binding of rhodopsin kinase. Mutations at Pro347 may reduce the stability of the carboxyl end attachment to rhodopsin kinase, potentially slowing phosphorylation and the subsequent binding of arrestin [30]. The p.Pro23His pig model has been used to study factors associated with cones developing dormancy and whether they can be reactivated. There are stages of retinal degeneration where the degenerating cones lose inner and outer segments. The remaining cell bodies are described as dormant cones. One hypothesis is that a lack of glucose supply to the cones as a result of loss of surrounding rods leads to cone dormancy. Experiments to either introduce rod precursors or to supply glucose to the subretinal space resulted in reactivation of the dormant cones suggesting mechanisms for the treatment of later-stage IRDs [31].	doab	2025-04-07T03:56:59.530511	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 101 }
00a6a373-fd58-400b-bd1a-e87d014d5110.102	2.2. Phosphodiesterase 6 Genes Mutations in genes encoding for the subunits forming the rod specific cyclic guanosine monophosphate (cGMP) phosphodiesterase (PDE) holoenzyme cause about 36,000 cases of autosomal recessive RP worldwide in humans, leading to the early onset of night blindness and retinal degeneration [32]. The rod PDE heteromeric holoenzyme has a catalytic core made of PDE6A and PDE6B subunits combined with two inhibitory gamma subunits [33]. Mutation in the gene encoding the alpha subunit of cGMP-PDE (Pde6a) causes PRA in the Cardigan Welsh corgi dog [34,35] and is a model of RP43 in humans, which accounts for 3% to 4% of recessive RP in North America [36,37]. Mutations in the gene encoding the beta subunit of cGMP-PDE (Pde6b) have been identified in a few dog breeds (see below), including the Irish setter dog [38], which is a model for RP40 in humans and represents about 3% to 5% of the recessive forms of RP [39,40]. Disease mechanisms for these canine models are detailed below.	doab	2025-04-07T03:56:59.530646	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 102 }
00a6a373-fd58-400b-bd1a-e87d014d5110.103	2.2.1. PDE6A A dog model with a null mutation in the gene encoding for Pde6a has been identified. It has a relatively severe phenotype and is a model for RP43 in humans [34,35]. This form of PRA was given the name rod–cone dysplasia type 3 (rcd3). The frameshift mutation, c.1939delA. p.Asn616ThrfsTer39, results in the absence of Pde6a in the a ffected dog retina (Pde6a−/−) [35]. Western blot analysis shows the absence of all Pde6 subunits, showing the requirement of Pde6a for stability and normal tra fficking of Pde6b [35]. In the absence of the Pde6 holoenzyme, the cGMP hydrolyzing activity is absent and cGMP accumulates in the rod photoreceptors [41]. Increased cGMP is a well-established cause of photoreceptor cell death, likely due to the increased influx of calcium ions into the outer segmen<sup>t</sup> [42], triggering apoptosis [43]. The rod outer segments fail to mature in Pde6a−/− dogs and the genetically una ffected cones have stunted outer segments, which is reflected in a reduction in cone electroretinogram (ERG) a-waves early in the disease process [35]. Following the death of rod photoreceptors, there is a progressive loss of cones, which is reflected in the declining cone ERG amplitudes which eventually become undetectable at about one year of age (SMPJ unpublished data). Adeno-associated gene therapy was able to rescue rod function and promote cone function, as well as preserve retinal morphology [41,44].	doab	2025-04-07T03:56:59.530744	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 103 }
00a6a373-fd58-400b-bd1a-e87d014d5110.104	2.2.2. PDE6B The catalytic beta subunit (PDE6B) of the cGMP-PDE heteromeric holoenzyme is another essential component of the rod photoreceptor phototransduction cascade located in the outer segments [33]. Mutations in the gene encoding for Pde6b causes PRA (rod–cone dysplasia type 1, rcd1) in the Irish Setter dog [38,45,46] which is a model for RP40 in humans. RP40 is one of the most common autosomal recessive RPs leading to blindness in midlife in humans. As with the Pde6a−/− dog, rod photoreceptors are a ffected first, then cones later in the disease [47,48]. The Pde6b−/− dog phenotype has an autosomal recessive mode of inheritance and is caused by a nonsense mutation (c.2420G>A, p.Trp807Ter) [38,45]. This truncated protein would lack the C-terminal domain that is required for posttranslational processing and membrane association. The failure of phosphodiesterase activity due to a lack of function in Pde6b leads to elevated cGMP levels from an early age [47,49]. The elevation of cGMP in rods as they develop outer segments results in the halting of outer segmen<sup>t</sup> elongation followed by rod degeneration, starting in the central retina first, then spreading to the entire retina following the same pattern of rod maturation. The cone outer segmen<sup>t</sup> development is also halted and, with the loss of the rods, the genetically una ffected cone photoreceptors also progressively degenerate [46,47]. Interestingly, in contrast to the Pde6a−/− dog retina where the lack of Pde6a leads to the absence of both alpha and beta Pde6 subunits, the Pde6b−/− dog retina has a detectable Pde6a subunit in Western blot, prior to rod degeneration [38]. Therefore, it appears that the alpha subunit is necessary for the beta subunit to be maintained, while the beta subunit is not essential for the maintenance of the alpha subunit. Adeno-associated gene therapy has been shown to halt retinal degeneration in the rcd1 dog [50]. Mutations in Pde6b have been identified in at least two other breeds of dogs (Sloughi and American Sta ffordshire terriers; see Table 1 for mutation information) [51,52].	doab	2025-04-07T03:56:59.530864	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 104 }
00a6a373-fd58-400b-bd1a-e87d014d5110.105	2.2.3. PDE6C Recently, a NHP spontaneous achromatopsia model was identified with a missense mutation in a cone phosphodiesterase subunit gene (Pde6c; c.1694G>A, p.Arg565Gln) [4]. A ffected animals had behavioral changes, reflecting the photophobia seen in human subjects. They also had macula changes including foveal thinning and a subtle bullseye maculopathy. In vitro studies suggested that the mutant protein was expressed and colocalized with its chaperones, Aipl1 and P. However, the mutation alters the catalytic domain, meaning that the mutant protein fails to hydrolyze cGMP.	doab	2025-04-07T03:56:59.531013	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 105 }
00a6a373-fd58-400b-bd1a-e87d014d5110.107	3.1. ABCA4 Stargardt disease is an inherited macular dystrophy which affects one in 8,000–10,000 people. It is the most common inherited macular dystrophy and there is currently no cure. It results from mutations in the gene ABCA4. Mutations in ABCA4 also result in cone–rod dystrophies and RP. ABCA4 is an ATP-dependent flippase expressed in the photoreceptor disc membrane and is necessary in the visual cycle for its transport of N-retinylidene-phosphatidylethanolamine and phosphatidylethanolamine out of the lumen into the cytoplasm [53]. A 1 bp insertion in Abca4 was identified in a family group of Labrador retriever dogs resulting in a frameshift and premature stop codon [54]. This mutation causes a decrease in the mRNA transcript and the loss of the full-length protein. As seen in humans, there is an accumulation of lipofuscin in the RPE cells. Cone and rod photoreceptors both had abnormal function and were decreased in number in older affected dogs (10+ years). The development of a colony of these dogs as a model for therapy will have a substantial impact on the treatment of humans with Stargardt disease because mouse Abca4−/− models lack a phenotype [54,55]. The phenotype in the dog appears to be milder than that seen in human subjects, with ABCA4 mutations reflecting species differences [56]. Early biomarkers of retinal changes in the affected dogs will facilitate the use of the Abca4 mutant dog as a model for human Stargardt disease.	doab	2025-04-07T03:56:59.531073	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 107 }
00a6a373-fd58-400b-bd1a-e87d014d5110.108	3.2. RPE65 Large animal models with visual cycle gene mutations include the Rpe65−/− dog. This is a model for LCA2. This model was crucial in the development of translational gene augmentation therapy which led to the first FDA-approved gene therapy product. The first animal injected with a therapeutic vector for LCA2 was an Rpe65−/− dog. Therapies were developed by three independent groups and consisted in each instance of recombinant adeno-associated virus vectors packaged with RPE65 cDNA. The precise details of promoters and other features such as polyadenylation signals and enhancers differed between the groups. Four groups with colonies of Rpe65−/− dogs reported successful restoration of rod and cone function [16,57–59]. Loss of rod photoreceptors in the Rpe65−/− dog was slow and gene therapy showed ERG rescue even in middle-age [60]. Studies showed that S-cones were sensitive to the lack of normal 11-cis-retinal supply and s-cone opsin immunoreactivity was lost at an early age [61]. There were some phenotypic differences between the Rpe65−/− dog colonies, with one showing early photoreceptor degeneration in the area centralis (canine equivalent of the human macula) [62]. Trials in human subjects have not resulted in the same restoration of function shown by the dramatic improvement in ERG responses seen in dog and mouse models. A possible explanation for this species difference in therapy efficacy was provided by a comparison of the Rpe65 function of primates and dogs. This suggested that primates require a higher level of Rpe65 than dogs for the function of the visual cycle and that the current therapy might not result in adequate levels of enzymatic function in humans [63].	doab	2025-04-07T03:56:59.531182	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 108 }
00a6a373-fd58-400b-bd1a-e87d014d5110.109	3.3. RDH5 Recently, a cat model with a mutation in another visual cycle gene, Rdh5, has been identified by our group [64]. Rdh5 functions to convert 11-cis-retinol to 11-cis-retinal for transport to photoreceptors for reforming the visual pigments. In humans, RDH5 mutations cause a variety of phenotypes. Fundus albipuncatatus is the predominant phenotype [65] but a subset of patients have macular atrophy [66–69] or cone dystrophy [70]. The Rdh5-mutant cat promises to be a valuable model because the Rdh5−/− mouse lacks a phenotype and does not recapitulate RDH5-retinopathy in human patients [71]. In contrast, the cat model, similar to a ffected humans, shows a very delayed recovery of photoreceptor function following light exposure and recapitulates the RDH5-macular atrophy phenotype.	doab	2025-04-07T03:56:59.531311	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 109 }
00a6a373-fd58-400b-bd1a-e87d014d5110.110	4. Channelopathies/Channel-Related Mutations Mutations that a ffect channel protein structure and function resulting in disease are termed channelopathies. Spontaneously occurring retinal channelopathies have been identified in dogs resulting from mutations in the cyclic nucleotide-gated ion channels (CNG) of the rod and cone photoreceptors and the anion channel bestrophin 1 (BEST1). CNG channels in the rod and cone photoreceptors are directly involved in phototransduction. The CNG channels expressed in the rod photoreceptor consist of four subunits: three CNGA1 and one CNGB1 [72–74]. The CNG channel in cone photoreceptors consists of CNGA3 and CNGB3 proteins, in a 3:1 or 2:2 ratio (the stoichiometry of the CNGA3/CNGB3 channel is under debate) [72]. Damaging mutations in the rod CNG channels result in RP, while mutations in cone CNG channels result in achromatopsia. BEST1 is a homopentameric channel expressed in the retinal pigment epithelium (RPE) and involved in anion transport and intracellular calcium homeostasis [75]. Mutations in BEST1 result in a collection of retinal diseases. Mutations in BEST1 often result in Best Vitelliform Macular Dystrophy, but the age of onset, mode of inheritance, disease characteristics and prognosis can vary [75].	doab	2025-04-07T03:56:59.531377	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 110 }
00a6a373-fd58-400b-bd1a-e87d014d5110.111	4.1. CNGA1 In humans, damaging mutations in CNGA1 result in RP49 representing 1% or less of arRP cases [39]. A 4 bp deletion in Cnga1 was identified in Shetland Sheepdogs with PRA. The mutation causes a frameshift and a premature stop codon in a highly conserved region of the protein [76].	doab	2025-04-07T03:56:59.531567	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 111 }
00a6a373-fd58-400b-bd1a-e87d014d5110.112	4.2. CNGB1 There are three splice variants of CNGB1 expressed in the retina, glutamic acid rich proteins (GARPs) GARP1, GARP2 and CNGB1a. The full-length protein, CNGB1a, is part of the heterotetrameric CNG channel of the rod photoreceptor [72]. A complex mutation in Cngb1 was identified in Papillon dogs with PRA. The mutation identified in these dogs is a 6 bp insertion accompanied by a 1 bp deletion, predicted to result in a frameshift and a premature stop codon, six amino acids downstream [77]. Upon further analysis of the Cngb1a transcript in the Cngb1−/− dogs, it was found that the mutation led to the skipping of exon 26, resulting in a premature stop codon early in exon 27. A truncated Cngb1a protein is produced, but does not form channels with Cnga1 and remains in the inner segments of the rod photoreceptors [78]. Mutations in CNGB1 cause RP45 in humans, which represents less than 4% of arRP cases [39]. Human RP45 patients with mutations downstream of the GARP splice variants, the mouse knockout model (Cngb1-X26) and the Cngb1−/− dog have similar phenotypes [78,79]. The canine model shows a slow loss of rod photoreceptors and the relative preservation of cones, particularly in the area centralis and visual streak. Cone function decreases as the disease progresses, as assessed by ERG, but cone-led vision remains normal, at least up to four years [77]. Preliminary gene therapy trials have shown that treatment at 3.5–6.5 months of age in a ffected dogs rescues vision and slows the progression of the disease in the treated areas [78]. Both the slow disease progression and the large treatment window (in dogs and anticipated in humans [80]) make the Cngb1−/− dog an ideal model for studying therapies and outcome measures.	doab	2025-04-07T03:56:59.531608	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 112 }
00a6a373-fd58-400b-bd1a-e87d014d5110.113	4.3. CNGA3 About 25% of human achromatopsia cases are caused by damaging mutations in the alpha subunit of the cone CNG channel (CNGA3) [81]. Two canine models of achromatopsia were identified with mutations in CNGA3. The mutations, p.Arg424Trp and p.Val644del (R424W and V644del, respectively), provided intriguing mutation sites for in vitro testing. Modeling of these mutations lead to further insights into CNG channel gating and subunit interactions [82]. The residue R424 is located in the S6 transmembrane helix and forms a salt bridge with the residue E306 in the S4–S5 linker. Protein modeling of the canine R424W mutation found the disruption of this salt bridge plays an important role in protein folding, subunit assembly and channel gating. In vitro expression studies of the R424W mutation showed increased mislocalization of the mutant CNGA3 protein and the mutant channels did not produce cyclic nucleotide-activated currents [82]. The canine V644del mutation is in the C-terminal leucine zipper (CLZ) domain, which is involved in channel assembly and stability. The one amino acid deletion shifts all subsequent residue interactions within the domain. In vitro studies in a heterologous expression system showed evidence of mislocalization and a decrease in the total number of active channels, but some mutant channels (~60%) reached the cell membrane and had normal cyclic nucleotide-activated currents [82]. Two spontaneous sheep models of Cnga3 achromatopsia have been identified [83]. The first identified has a nonsense mutation (p.Arg236Ter) and the second a missense mutation (p.Gly540Ser) [84]. Adeno-associated virus gene therapy was able to restore cone function in both models [84,85].	doab	2025-04-07T03:56:59.531738	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 113 }
00a6a373-fd58-400b-bd1a-e87d014d5110.114	4.4. CNGB3 Two unique mutations were identified in the canine Cngb3 gene—a genomic deletion that removes the entire Cngb3 gene (Cngb3−/−) and a missense mutation (p. Asp262Asn; D262N). The missense mutation was identified in German Shorthaired Pointers, while the genomic deletion was initially found in Alaskan Malamutes and later found in other breeds [86,87]. Mutations in CNGB3 are responsible for at least 50% of achromatopsia cases in humans, making it an ideal target for therapies [87,88]. The D262N mutation in Cngb3 inspired investigation into the Tri-Asp motif that is conserved in CNG channels [89]. When this mutation was introduced to heterologously expressed CNGA3, it abolished homomeric channel function and was responsible for mislocalization of the protein. When the mutation was introduced in CNGB3 in coexpression studies with CNGA3, the response to cyclic nucleotides was reduced but still present and consistent with CNGA3 homomeric channel function. These experiments show the Tri-Asp motif is necessary for proper cone CNG channel formation, but raises the question why mutations in CNGB3 result in the loss of cone function and achromatopsia when CNGA3 can form a functioning homomeric channel in the absence of CNGB3. Further work in retinal tissue and/or cone photoreceptors will be needed to elucidate this [89]. Delivery of a human CNGB3 gene via rAAV5 vector to both Cngb3−/− and the D262N mutant dogs showed that the vector could be targeted to the medium and long wavelength (M/L) cones via a human red cone opsin promoter and the rescue was dependent on the age of the dog and the promotor, not on the mutation type [90].	doab	2025-04-07T03:56:59.531853	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 114 }
00a6a373-fd58-400b-bd1a-e87d014d5110.115	4.5. BEST1 Best vitelliform macular dystrophy (Best disease, BVMD) has autosomal dominant inheritance and is the most common disease associated with mutations in the gene BEST1. Four other disease phenotypes have been described in association with BEST1 mutations: adult onset vitelliform macular dystrophy, autosomal recessive bestrophinopathy, autosomal dominant vitreoretinochoroidopathy and retinitis pigmentosa. BVMD is characterized by at least one vitelliform lesion in the macula but can present with multiple lesions. The disease slowly progresses to degenerate the RPE and retina in the a ffected regions, resulting in vision impairment [75]. In dogs, a similar disease has been described, termed canine multifocal retinopathy (CMR) and is caused by mutations in the Best1 gene. In contrast to the BVMD in humans, CMR due to Best1 mutations is an autosomal recessive disease and has a consistent and predictable disease phenotype. This consistency and the detailed natural history of the disease lends well to measuring the outcomes of translatable therapies. Initially, two Best1 mutations were identified in dogs: p.Arg25Ter (Great Pyrenees and masti ff-related breeds, cmr1) and p.Gly161Asp (Coton de Tulear, cmr2), with the former resulting in a premature stop codon and, presumably, a lack of Best1 protein [91]. Analysis of additional breeds with CMR identified another breed (Lapponian herder, cmr3) with two deleterious mutations in exon 10, a 1 bp deletion leading to a frameshift and premature stop codon (p.Pro463fs) and a missense mutation (p.Gly489Val) [92]. Interestingly, the phenotype resulting from the three mutations in dogs is indistinguishable. The dogs present with multifocal regions of retinal separation with a pink or tan-colored subretinal fluid, which eventually leads to retinal degeneration. Using optical coherence tomography to image eyes from cmr1/cmr1, cmr3/cmr3 and cmr1/cmr3 dogs in vivo, the earliest detectable sign of the disease is at ~11 weeks of age in which there is a retinal elevation in the fovea-like region of the area centralis. As the disease progresses, this retinal elevation becomes a macrodetachment, surrounded by microdetachments. Rates of progression, detachment location and number varied, but the disease was typically localized to the more cone-rich regions of the retina [93]. Immunohistochemistry of CMR canine tissues showed a lack of RPE apical microvilli at the cone photoreceptor/RPE interface along with accumulated lipofuscin within the RPE. The loss of the RPE apical processes results in a loss of all direct contact of the cones to the RPE, severely impacting the physiological role the RPE has on retinal maintenance. It is hypothesized that the lack of RPE apical processes and subsequent weakened interphotoreceptor matrix is instrumental in the characteristic detachments and lesions observed in diseases caused by BEST1 mutations [93,94]. Interestingly, microdetachments were identified in response to light exposure in pre-clinical CMR dogs. The detachments occurred between the photoreceptor inner/outer segments and the RPE/tapetum interface. These light-induced detachments occurred within minutes and increased in response to time of light exposure and would resolve within 24 h. Using a rAAV2 vector delivered subretinally, CMR dogs were treated by gene augmentation with wildtype canine or human BEST1. Macro and microdetachments were resolved and RPE microvilli ensheathment of cone photoreceptors returned within the treatment area. This positive outcome was retained in the dogs for as long as 207 weeks post injection. The same outcome was present regardless of age of treatment (within 27–69 weeks of age), the stage of detachments or mutation (cmr1/cmr1, cmr3/cmr3 or cmr1/cmr3). These results show promise for the treatment of human patients with BEST1 mutations [93].	doab	2025-04-07T03:56:59.531984	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 115 }
00a6a373-fd58-400b-bd1a-e87d014d5110.116	5. Cilia-Related Proteins (Ciliopathies) Photoreceptors are non-motile sensory ciliated cells. The connecting cilium between inner and outer segmen<sup>t</sup> is critical for the transport of proteins to and from the outer segment. Many proteins are expressed in this region of photoreceptors and act to control the tra fficking of proteins. Ciliopathies is a general term used to group conditions resulting from mutations in cilia proteins. As cilia are present in many cell types, mutations in cilia proteins can cause syndromic disease where retinal degeneration is present, accompanied by disorders in other organ systems. Mutations that have a milder e ffect on function may result in a photoreceptor-only phenotype such as LCA or RP. A number of large animal models with mutations in cilia related genes have been identified (Table 1).	doab	2025-04-07T03:56:59.532232	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 116 }
00a6a373-fd58-400b-bd1a-e87d014d5110.117	5.1. BBS4 A mutation in the Bbs4, (Bardet–Biedl syndrome 4) gene, was identified in Hungarian Puli dogs with PRA. This mutation (c.58A>T, p.Lys20Ter) is predicted to result in nonsense mediated decay of the Bbs4 transcript. BBS4 is one of the BBS genes involved in cilia function. These dogs showed a typical PRA phenotype along with noted obesity and abnormal sperm, although more a ffected dogs may need to be examined before confirming that this is a syndromic BBS model [95].	doab	2025-04-07T03:56:59.532303	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 117 }
00a6a373-fd58-400b-bd1a-e87d014d5110.118	5.2. BBS7 An NHP model of Bardet–Biedl syndrome has been recently described. A mutation in exon 3 of the Bbs7 gene c.160delG (p.Ala54GlnfsTer18) that is predicted to produce a truncated non-functional protein was identified. As with BBS4, BBS7 is involved in cilia function. Typically in humans, mutations in BBS genes cause a syndromic condition. The a ffected NHPs had several features of BBS, including retinal atrophy, which was most severe centrally; the a ffected animals had smaller brains, renal disease, and the males had small testes. This is the first described model of BBS in NHP and shares many characteristics with BBS patients with truncating mutations [3].	doab	2025-04-07T03:56:59.532349	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 118 }
00a6a373-fd58-400b-bd1a-e87d014d5110.119	5.3. CEP290 This cat model, rdAc (retinal degeneration, Abyssinian cat) has been studied in detail for many years. Compared to most CEP290 (centrosomal protein 290) mutations in other species, the cat model has a mild phenotype. The onset and rate of photoreceptor degeneration in the cat with the sparing of the area centralis makes it a model for RP [96,97]. In humans, CEP290 mutations can result in a spectrum of phenotypes including lethality, severe syndromic disease (e.g., Joubert syndrome) and most commonly LCA; see [98] for a review. Milder phenotypes such as RP are less common. In the cat, an intronic mutation (c.6966+9T>G) leads to the introduction of a stronger splice acceptor site (the wildtype splice acceptor is a GC rather than the much more commonly used GT). The mutation strengthens an adjacent GT, which, when used, adds 4 bps to the exon 50 sequence, the resulting frameshift introduces a premature stop codon [99]. The truncated protein escapes nonsense mediated decay and is expressed. In addition, the wildtype acceptor site is still used for a percentage of the transcripts (unpublished data). The combination of a truncated protein with some remaining function combined with a low-level production of full-length transcripts explains the mild phenotype. CEP290 is too large to be packaged in an adeno-associated virus vector and one therapeutic approach being investigated is the use of a truncated transcript so that a miniprotein may have partial function and convert a severe phenotype into a milder phenotype similar to that of the cat.	doab	2025-04-07T03:56:59.532750	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 119 }
00a6a373-fd58-400b-bd1a-e87d014d5110.120	5.4. NPHP4 Wire-haired dachshunds have a cone–rod dystrophy resulting from a truncating mutation in Nphp4. The identified Nphp4 mutation was a deletion involving exon 5/intron 5 that led to skipping of exon 5 and a premature truncation in exon 6 of 30 (c.462\_526del, p.Leu155LysfsTer2) [100]. A colony was established from a single founder male [101]. Puppies had miotic pupils and cone-mediated ERGs were reduced prior to retinal maturation. Furthermore, they did not show the normal increase in amplitudes with retinal maturation and further declined in amplitude rapidly. The amplitudes of the rod-driven responses were less severely a ffected, but were lost with age [102,103]. Interestingly, the condition is non-syndromic in dogs, just presenting as a cone–rod dystrophy. Human patients with NPHP4 mutations do not always develop a retinal phenotype, but typically have nephronophthisis, with some patients having Senior–Løken syndrome, which combines the renal phenotype with a retinal dystrophy (see for [104] a review). This phenotype di fference may represent a species di fference, with Nphp4−/− mice also only having an ocular phenotype with no renal abnormalities, but also showing male infertility [105].	doab	2025-04-07T03:56:59.532875	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 120 }
00a6a373-fd58-400b-bd1a-e87d014d5110.121	5.5. NPHP5 (IQCB1) A mutation was identified in the NPHP5 gene (aka IQCB1) resulting in a cone–rod dystrophy in American pit bull terrier dogs (crd2) modeling non-syndromic LCA. This mutation (c.952-953insC, p.Ser319IlefsTer13) results in a frameshift and a premature stop codon [52]. At 6 weeks of age, the crd2 dogs had no cone function and abnormal rod function. Morphologically, the cones completely lacked outer segments, while the rods developed disorganized outer segments. Despite the lack of cone function, the cones are retained within the central retina up to 33 weeks of age [106]. Adeno-associated gene therapy restores and improves photoreceptor function and preserves the outer retina layer [107].	doab	2025-04-07T03:56:59.532971	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 121 }
00a6a373-fd58-400b-bd1a-e87d014d5110.122	5.6. RPGR Retinitis pigmentosa GTPase regulator (RPGR) localizes to the connecting cilium and mutations within the RPGR gene account for >80% of X-linked RP (XLRP). There are two major retinal isoforms, one encoded by exons 1–19 and a second isoform that consists of exons 1–15 and a retained portion of intron 15 (ORF15; see [108] for a summary). ORF15 is a mutation hotspot [109]. Three different Rpgr mutations cause X-linked retinal degeneration in dogs. One is caused by a genomic deletion [110] and two are due to microdeletions in ORF15 and provide two distinct mechanistic models for RPGR-XLRP [111]. The first, known in the dog as XLPRA1, has a 5 bp deletion and a premature stop codon [111]. This is a relatively late onset and slowly progressive degeneration [112]. The second form, XLPRA2, has a 2 bp deletion with a frameshift resulting in the addition of 34 basic residues. In vitro studies showed that the mutant protein aggregated in the endoplasmic reticulum and is hypothesized to have a toxic effect [111]. The phenotype presents as an early onset degeneration with early changes being outer segmen<sup>t</sup> disruption and opsin (rod and cone) mislocalization. Photoreceptor cell death was shown to occur in a biphasic manner with two distinct phases of cell death with evidence of remodeling occurring [113]. Studies of the heterozygous females revealed that there are patches of diseased retina, presumably resulting from regions where random X-inactivation has resulted in expression of the mutant allele and patches of unaffected retina (where the wildtype allele is expressed). In the earlier onset XLPRA2 migration of adjacent photoreceptors into regions where rod photoreceptors died occurs, showing retinal plasticity in the younger animals. This remodeling was not described in the XLPRA1, where patches of degeneration occur at a later age [114].	doab	2025-04-07T03:56:59.533036	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 122 }
00a6a373-fd58-400b-bd1a-e87d014d5110.123	5.7. RPGRIP1 Retinitis pigmentosa GTPase regulator-interacting protein 1 (RPGRIP1) localizes to the connecting cilium, where it interacts with RPGR. Mutations in RPGRIP1 are associated with autosomal recessive LCA. A cone–rod dystrophy form of PRA in a colony of miniature longhaired Dachshunds was reported to be due to an insertion in Rpgrip1 [115] and the rescue of the phenotype by gene therapy was achieved [116]. When miniature longhaired Dachshunds in pet homes were investigated, the Rpgrip1 insertion did not appear to segregate with disease status [117]. Further studies have shown that two other loci influence the development of the phenotype [118–120]. This is an example of the potential effect of modifying loci on phenotype.	doab	2025-04-07T03:56:59.533168	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 123 }
00a6a373-fd58-400b-bd1a-e87d014d5110.125	6.1. CRX The CRX gene encodes an OTX-like homeodomain transcription factor which is essential for photoreceptor development, maturation and survival [121–124]. Transcription factors are essential for control of the maturation of progenitor cells [123–126]. Only one spontaneously occurring large animal model of a retinal transcription factor homeobox mutation has been described, the CrxRdy cat [127,128]. The heterozygous animal has a severe phenotype of cone-led retinal dystrophy and is a model for one form of severe early childhood onset blindness (LCA7). While most mutations in CRX result in LCA7, other phenotypes including cone–rod dystrophy, RP and macular degeneration have been described [129–131]. CRX mutations have been reported to account for between 0.6% and 2.35% of LCA [131–134]. As with other transcription factors, CRX has a characteristic structure with a DNA binding domain (homeodomain) near its N-terminal and a transactivation domain at the C-terminal. The CrxRdy/+ mutant cat models Class III CRX mutations, which are antimorphic frameshift/nonsense mutations with intact DNA binding, but a lack of target gene transactivation [135]. The CrxRdy/+ cat mutation is caused by a 1 bp deletion (c.546delC; p.Pro185LysfsTer2) in the final exon of the Crx gene [127]. This mutant mRNA avoids nonsense mediated decay and produces a truncated Crx protein with an intact DNA-binding domain but disrupted transactivation domain [128]. Both the mutant transcript and protein accumulate at higher levels than the wildtype versions, possibly due to increased stability of the mutant mRNA compared to the wildtype. In vitro studies showed that the mutant mRNA fails to activate its own promoter [128]. This suggests that the mutant protein has a dominant negative effect by binding promoter recognition sites, but fails in its transactivation function. The result is misregulated gene expression; for example, Rho and cone arrestin (Arr3) mRNA levels are severely decreased. Truncated photoreceptor outer segments are produced, but the photoreceptors fail to fully mature [128]. A decreased rod ERG is detectable, which shows evidence of partial maturation before this is halted and the ERG amplitudes decline, paralleling rod degeneration. Cone function is more severely affected, with no cone ERG responses being detectable [128].	doab	2025-04-07T03:56:59.533231	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 125 }
00a6a373-fd58-400b-bd1a-e87d014d5110.126	6.2. STK38L An early retinal degeneration was described in Norwegian Elkhounds in 1987 [136] in which the dogs present with vision impairment in low light as early as 6 weeks of age. The causal mutation was found to be a short interspersed element (SINE) insertion in exon 4 of Stk38l, a gene that had not been associated with retinal degenerations before its discovery in the Norwegian Elkhounds [137]. The mRNA transcript is produced in the affected dog but does not contain exon 4. Interestingly, at ~6 weeks of age, the expression of the mutant Stk38l transcript is similar to control dogs, but expression increases at ~8 and ~12 weeks [138]. Detailed histological experiments were performed on affected canine retina to understand the role of Stk38l in retinal development and how the lack of the functional protein results in retinal degeneration. The retina in ~4 week old Stk38l-affected dogs is normal, but by ~8 weeks of age the rod photoreceptors begin to show mislocalization of Rho, irregularities in the outer segments and increased TUNEL labeling. However, this increase in apoptotic cells is not accompanied by a thinning of the outer nuclear layer (ONL), as would be expected from loss of rod photoreceptors. The maintenance of ONL thickness is a result of proliferation of rod-like photoreceptors which express both Rho and cone S-opsin. After ~14 weeks of age, this proliferation ceases and the ONL begins to thin as the photoreceptors die, resulting in the loss of at least 50% of the ONL rows by 48 weeks [138]. The Stk38l-affected dogs provide an interesting and unique model of retinal degeneration in which differentiated photoreceptors either apoptose or proliferate for a short amount of time before retinal degeneration progresses. ### 7. Photoreceptor to Bipolar Cell Signaling	doab	2025-04-07T03:56:59.533376	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 126 }
00a6a373-fd58-400b-bd1a-e87d014d5110.127	7.1. LRIT3 Recently, a dog model of recessively inherited CSNB has been identified due to a mutation in leucine-rich-repeat, immunoglobulin-like transmembrane-domain 3 gene (LRIT3). Mutations in LRIT3 in humans causes a form of CSNB [139]. The ERG of the affected dogs shows a lack of ON-bipolar cell function with preservation of cone OFF-bipolar contributions [140–142]. There is currently debate about the positioning of the LRIT3 protein which had been described as being in the synaptic tips of the bipolar cells; however, a recent publication showed that it was presynaptic, being present in photoreceptors, but bridged the synapse to influence the positioning of post-synaptic glutamate signaling proteins [143]. The new availability of a large animal model may facilitate further investigations.	doab	2025-04-07T03:56:59.533504	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 127 }
00a6a373-fd58-400b-bd1a-e87d014d5110.128	7.2. TRPM1 Studies of Appaloosa horses with CSNB contributed to the identification of the role of transient receptor potential cation channel subfamily M, member 1 (Trpm1) in bipolar cell signaling [144,145]. The night-blind Appaloosa horse was first recognized as an animal model for the Schubert–Bornschein type of CSNB in the 1970s [146]. The study published at that time reported a lack of an ERG b-wave and night blindness but no retinal degeneration or obvious morphological abnormality of the photoreceptor synapses with second order neurons [146]. The correlation of CSNB in the Appaloosa with the Leopard complex spotting coat color was recognized [147]. This coat color is governed at a single gene locus with animals homozygous for the Leopard complex spotting associated allele (LP) also having CSNB [147]. When the LP locus was mapped, Trpm1, which is also expressed in melanocytes, was identified as a positional candidate gene and showed markedly reduced expression in retina and skin from a ffected animals [148]. Investigation of TRPM1 in humans with complete CSNB identified mutations in TRPM1 [149–151] and its role in ON-bipolar cell signaling was identified. The LP mutation was identified as a retroviral insertion in intron 1 of equine Trpm1 that disrupts gene transcription by causing premature polyadenylation [152]. ### 7.3. Whippet Dog Model of Incomplete CSNB with Retinal Degeneration A dog model of cone–rod synaptic dysfunction, which has been described by some authors as a form of incomplete CSNB, has been identified [153]. The a ffected dogs lack an ERG b-wave and also lack cone OFF-bipolar cell attributable ERG components [154]. Interestingly, the dog model develops a progressive retinal degeneration, which is not reported as a feature of the condition in humans [155].	doab	2025-04-07T03:56:59.533574	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 128 }
00a6a373-fd58-400b-bd1a-e87d014d5110.129	8. Structural/Other Retinal degenerations can occur due to mutations in genes involved in the structure or maintenance of the retina.	doab	2025-04-07T03:56:59.533791	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 129 }
00a6a373-fd58-400b-bd1a-e87d014d5110.130	8.1. ADAM9 ADAM9 (a disintegrin and metalloprotease domain, family member 9) mutations are associated with cone–rod dystrophies in humans and dogs. A genomic deletion in Adam9 was identified in Irish Glen of Imaal Terriers, resulting in a premature stop codon and the loss of the full-length protein. Similar to the mouse model, histological sections show that the RPE cells do not invest in the outer segments of the photoreceptors. This mutation e ffects both the rod and cone photoreceptors, but the cones are more severely a ffected throughout the course of the disease [156,157]. Further work is needed to understand the role of ADAM9 in the retinal structure and RPE maintenance of photoreceptors.	doab	2025-04-07T03:56:59.533826	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 130 }
00a6a373-fd58-400b-bd1a-e87d014d5110.131	8.2. AIPL1 Mutations in the gene encoding aryl hydrocarbon receptor-interacting protein-like 1 (AIPL1) causes LCA4 accounting for about 3% to 7% of autosomal recessive LCA [132,134,158–160]. The AIPL1 gene encodes for a protein expressed in the photoreceptor and pineal gland [161]. In photoreceptors, AIPL1 is concentrated in the tip of the inner segmen<sup>t</sup> in proximity to the connecting cilia, acting as a co-chaperone involved in the folding, assembly and transport of the retinal cGMP phosphodiesterase (PDE6) heteromeric holoenzyme within photoreceptor outer segments [162–166]. One spontaneous occurring feline large animal model of LCA4 currently exists, the Persian cat [167]. This feline model, similar to human patients with LCA4, presents as an autosomal recessive severe retinal dystrophy. The disease is characterized by a very early photoreceptor loss, progressing to severe retinal degeneration before adulthood. This leads to very early blindness [167]. The feline phenotype is caused by a nonsense mutation at position c.577C>T producing a stop codon (p.Arg193Ter), leading to the production of a truncated non-functional protein [168]. The precise mechanisms of the severe phenotype in the feline model are ye<sup>t</sup> to be investigated. The feline model represents a valuable large animal model for mechanistic studies underlying AIPL1-LCA in humans.	doab	2025-04-07T03:56:59.533890	1-5-2021 17:32	{ "license": "Creative Commons - Attribution - https://creativecommons.org/licenses/by/4.0/", "book_id": "00a6a373-fd58-400b-bd1a-e87d014d5110", "url": "https://mdpi.com/books/pdfview/book/2654", "author": "", "title": "The Molecular and Cellular Basis of Retinal Diseases", "publisher": "MDPI - Multidisciplinary Digital Publishing Institute", "isbn": "9783039366545", "section_idx": 131 }

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.