Split (2)

member · 5k rows

text stringlengths 3.04k 31k
A 67-year-old male patient diagnosed with stage IV pulmonary adenocarcinoma was first treated with 6 cycles of carboplatin and pemetrexed followed by a maintenance regimen. Progression occurred within fourteen month after the start of the initial treatment. Consequently, second-line nivolumab was initiated at a dose of 3 mg/kg every two weeks.\nAfter thirteen doses of nivolumab, the patient complained of irritated red eyes without visual impairment. He did not exhibit skin involvement, arthralgia or urinary tract or digestive symptoms. The conjunctiva swab test was negative, and no improvement was observed with antibiotic ocular drops. The ophthalmologist’s examination revealed bilateral sterile conjunctivitis with no signs of uveitis or retinal lesions (Fig. a). The patient was treated with topical steroids with partial improvement.\nA few days later, he developed fatigue and progressive dysphagia which became severe after two months followed by rapid 10-kg weight loss without symptoms of associated colitis or gastritis. At that point, the main differential diagnosis was esophageal infection, tumor progression with gastrointestinal (GI) upper tract involvement, paraneoplastic syndrome [] or an atypical checkpoint inhibitor-related adverse event. Of note, the patient had no history of personal or familial autoimmune disease, conjunctivitis or upper digestive tract abnormality prior to nivolumab treatment. The oral examination initially revealed evidence for oral candidiasis, but treatment with a 7-day course of fluconazole did not improve dysphagia despite the resolution of the stomatitis. Bacterial culture of the oropharyngeal swab was negative, and PCR results for herpes simplex 1 and 2 infection were also negative. A blood sample revealed a discrete increase in the erythrocyte sedimentation rate (ESR) with no eosinophilia or leukocytosis. Liver and kidney function panel tests were normal. Thoracoabdominal CT scan reported no evidence of disease recurrence. Due to patient fatigue, a therapeutic break was implemented for one month with the introduction of prednisone at 30 mg per day with rapid tapering over 1 month. Although the patient initially experienced a partial resolution of dysphagia, a quick recurrence of symptoms was noticed as the prednisone dose was tapered. One month later, nivolumab was restarted, and the patient noticed a rapid deterioration of his dysphagia and mucositis. The clinical situation deteriorated despite the introduction of nystatin and steroid mouthwash, and the patient continued to lose weight. An esophagogastroduodenoscopy was done, which revealed diffuse mucositis with a scar-like stenosis immediately below the upper esophageal sphincter (Fig. b). Unlike the upper esophagus, the lower part and the stomach were of normal appearance.\nBiopsies of the oropharynx were performed, but esophageal dilatation was not performed due to the highly inflammatory mucosal status and patient anticoagulation. Faced with this significant loss of weight and the impossibility of an oral diet, a nasogastric tube was placed. Biopsies of the oropharynx displayed marked lymphocytic inflammation and several foci of monocellular necrosis in the squamous epithelium. Morphologic evidence of adenocarcinoma and signs of mycotic, bacterial or viral infection were not observed. Immunohistochemical stainings were performed in an automated stainer (Benchmark XT; Ventana Medical Systems, Tucson, AZ) using 3 μm-thick sections and the following antibodies: CD45 (monoclonal, clone 2B11 + PD7/26, Dako, Glostrup, Denmark), CD19 (monoclonal, clone BT51E, Novocastra, New Castle, UK), CD20 (monoclonal, clone L26, Novocastra), CD3 (monoclonal, 2GV6, Ventana), CD4 (monoclonal, SP35, Ventana), CD8 (monoclonal, C8/144B, Dako), CD68 (monoclonal, clone KP1, Dako), and PD-1 (polyclonal, R&D System, Inc., Minneapolis, MN, USA). Immunohistochemistry revealed a florid immune infiltrate, predominantly with T cells (90% CD45+CD19−CD20−CD3+), with only 10% of B cells (CD45+CD19+CD20+CD3−). Among T cells, the majority (80%) were CD4+. Few T cells expressed PD-1+. Rare macrophages were also observed (Fig. ).\nBased on these results, esophageal stenosis was considered a severe irAE secondary to an important mucosal inflammatory infiltrate. This severe dysphagia required enteral feeding, and nivolumab was permanently discontinued after seventeen doses. The patient was treated with 125 mg methylprednisolone followed by 1 mg/kg oral prednisone (total dose: 80 mg). After 3 days of treatment, the patient reported significant improvement, enabling him to eat solid food. Prednisone was tapered by 20 mg every two weeks until reaching a daily dose of 40 mg after 45 days of prednisone tapering, when he again presented increasing symptoms of severe dysphagia.\nThe patient was treated a second time with 125 mg methylprednisolone for 3 days followed by 1 mg/kg oral prednisone (total dose: 80 mg) with amelioration of dysphagia. Three weeks later, after the reduction of prednisone to 60 mg/daily, the patient noticed a new severe dysphagia deterioration, remaining aphagic. In this context, quick endoscopic esophageal dilatation was attempted. The laryngeal margin and hypopharyngeal mucosa appeared highly inflamed with fibrinous deposits on the direct laryngoscopy with no sign of salivary stasis or tumor invasion. Rigid esophagoscopy revealed erythema of the oropharynx with friable nonulcerative mucosa and an inflammatory aspect of the entire esophagus. Concomitant high-dose steroids at a dose of 125 mg of methylprednisolone for 3 days followed by 1 mg/kg prednisone again allowed transient symptomatic improvement.\nOne month later, recurrent dysphagia did not permit steroid tapering under 50 mg/d. Furthermore, the long course of high-dose corticosteroid treatment was complicated with severe osteoporosis and several spontaneous compression fractures of thoracolumbar vertebrae. Pathologic fracture due to metastases was ruled out by bone biopsy.An enlarged T10 to L5 vertebral cementoplasty was carried out. One month later due to a new episode of recurrent major dysphagia, the patient received a new bolus of 125 mg of methylprednisolone for 3 days followed by 1 mg/kg prednisone. The serum level of IL-6 was 3.10 pg/ml (normal range < 1.5 pg/ml), measured the same day before tocilizumab administration. Serum levels of IL-6 were assessed by electrochemiluminescence (ECL) Elecsys® IL-6 (Roche; Switzerland) according to the manufacturer instructions.\nAt this point, a second line of immunosuppressive treatment was considered. Based on the oropharynx biopsy, histological analysis and the presence of a predominantly T-cell infiltrate, a single intravenous administration of the interleukin 6 receptor (IL-6R) neutralizing antibody tocilizumab at a dose of 8 mg/kg was given. This led to rapid amelioration of the symptomatology, with successful prednisone tapering without recurrent dysphagia. At the present time, 3 months after the administration of tocilizumab, the patient has experienced no relapse of dysphagia. A recent rigid endoscopy confirmed complete resolution of orolaryngopharyngeal and upper esophageal inflammation (Fig. ).\nDuring immunosuppressive therapy we observed no tumor progression. Eight months after discontinuing nivolumab treatment, the patient remains in complete remission with no radiographic evidence of tumor relapse.
A 19-year-old female patient reported with a history of frequent episodes of difficulty in closing the mouth after wide mouth opening, for the past 6 months. This was associated with joint sounds which were bilateral. Characteristically, the patient experienced severe pain, 5–10 min after forceful closing of mouth. During every episode, the pain originated on the right side of the TMJ and lasted for 2 h. The nature of the pain was dull and aching and radiating to the right side ear, forehead, neck, and shoulder. The pain was aggravated by excessive jaw movements and relieved by rest and nonsteroidal anti-inflammatory drugs.\nThe patient's medical history did not reveal anything relevant to the clinical symptoms such as trauma to the joint, medication, or parafunctional habits.\nExtraoral clinical examination revealed the following: the maximal mouth opening was 52 mm with a deviation of the mandible toward the left side. Bilateral preauricular hollowing was noted on wide opening. On palpation, mild tenderness was appreciated on the right side of TMJ along with clicking during the late opening and early closing of the mouth. Intraoral examination revealed Class 1 occlusion and the maxillary dental midline coinciding with the mandibular dental midline. Based on the clinical features, a provisional diagnosis of subluxation of the joint was made.\nOrthopantomogram (OPG) was taken in two views with the mouth open and closed: closed mouth view demonstrated a slender and small condyle with shallow articular eminence on both sides of the TMJ and open mouth view showed bilateral dislocation of condyle anterior to the eminence []. Assessment of cone-beam computed tomography (CT) demonstrated the length of condyle on the right and left as 16.1 mm and 18.5 mm, respectively. The mediolateral width of the right condyle was 12.5 mm and the left condyle was 13.4 mm. The vertical dimensions of the articular eminence on the right and left side were 29.4 mm and 22.9 mm, respectively. Based on all the above investigations, a definitive diagnosis of bilateral subluxation of TMJ was made and planned for surgical management.\nUnder general anesthesia, vestibular incision was placed extending from the 2nd molar till the ascending ramus of the mandible. The ramus and coronoid were exposed after dissection of soft tissues. Osteotomy cut was marked using the following reference points: Point A was marked on the ramus of the mandible from the lower occlusal plane and Point B was marked 16 mm above the first point which was planned preoperatively using stereolithography model []. Osteotomy cut was made from the Point B to the base of the sigmoid notch. The osteotomy of coronoid was completed using a mallet and chisel. A trough was created on the lateral surface of the ramus to position the osteotomized coronoid. The coronoid was positioned inferiorly in the trough and was fixed with a 2-holed, 2-mm plate using 6-mm screws through the transbuccal approach. The surgical wound was closed with 3-0 vicryl in layers. Extraoral stab incision was also sutured with 3-0 vicryl suture. The mouth opening of the patient on the 1st postoperative period was 25 mm. Postoperatively, the length and thickness of the right temporalis and lateral pterygoid on both sides were assessed using ultrasonography which revealed appreciable increase in both the dimensions []. Postoperatively, the position of coronoid was confirmed with OPG and three-dimensional CT [Figures and ].\nThe patient was followed up for 6 months, during which the patient's mouth opening was 40 mm consistently, with no incidence of open lock, TMJ pain, or difficulty in jaw movements.
The patient is a 51 year old male who was struck by an automobile at 35 miles per hour while riding a bicycle. There was loss of consciousness in the field and he arrived to our level II trauma center in full spine precautions, as a tier one trauma code. His primary survey was intact and his initial vital signs were; BP 115/80, HR 84, RR 30, O2 saturation 89% on room air which improved to 98% on a non-rebreather mask at 100%. Pertinent findings on secondary survey revealed bilateral chest wall tenderness to palpation, diminished breath sounds bilaterally, upper thoracic spine tenderness to palpation, a complete loss of motor function in his lower extremities, a loss of sensory function below the level of T4 and a Glascow Coma Scale (GCS) of 15. His American Spine Injury Association Motor Score was 50. He also had a loss of his cremasteric reflex, and bulbar cavernous reflex, and had no sacral tone.\nWhile observing strict spine precautions, the patient had chest and pelvis x-rays taken, and was then transported for computed tomography scans of the head, cervical spine and torso. Positive findings from these studies revealed multiple bilateral rib fractures with associated hemothoraces (Figure ). He also sustained fractures and subluxation at the third and fourth thoracic levels (Figure ). The patient was started on spinal dose steroids and strict spine precautions were maintained for anticipated surgical stabilization. Bilateral chest tube thoracostomies were placed for the hemothoraces and a arterial blood gas was then obtained which documented adequate oxygenation and ventilation given this patient's significant pulmonary injury; (pH 7.33 pCO2 42 PaO2 91 HCO3 21, O2 saturation 97 BD-4, 2 liters nasal cannula).\nThe initial drainage from the left chest tube was 500 milliliters (ml) of blood and on his second hospital day it was noted that the chest tube output was 400 ml of milky white fluid suspicious for chyle. Biochemical analysis of the pleural fluid revealed triglycerides of 287 milligrams/decilitre (mg/dL), total protein of 2600 mg/dL, and LDH of 2823 units/L. These results confirmed a diagnosis of chylothorax.\nDue to the complexity of the case, a multidisciplinary team approach was taken to develop the appropriate treatment regimen for this patient. The decision to attempt treatment of the chyle leak with dietary manipulation was agreed upon and the patient was started on a very-low-fat oral diet consisting of mainly fresh fruits, vegetables and whole grains. The patient was also given a semi-elemental formula, Peptamen AF, 1 can with each meal which provided additional kilocalories, protein, and medium chain triglyceride (MCT) oil in order to facilitate wound healing. Two scoops of protein powder (beneprotein) were added to each meal as well. The patient was also started on octreotide, 200 mcg subcutaneous every 8 hours to aid in the reduction of lymph production. The patient tolerated the diet well and these measures led to a dramatic decrease in the chest tube output to less than 100 ml/day of serous fluid by the time he had operative repair and stabilization of his thoracic spine on hospital day seven. After the surgical procedure there was a transient increase in output from the chest tube to 200 ml per day which declined to 35 ml on hospital day 14. The chest tube was then removed without consequence, he was then started on a regular diet and follow up chest x-rays did not reveal any recurrent pleural effusions. The patient was discharged to an inpatient rehabilitation facility and was seen approximately two months after his injury in our clinic. He still had complete motor paralysis of the lower extremities with a T2 sensory loss. His upper extremity function remained unchanged from admission with his motor function intact. His pulmonary status remained stable as he had no ongoing acute pulmonary issues and saturated 98-100% on room air.
A 76-year-old woman with no prior significant medical or surgical problems was referred to the University of California San Diego Medical Center for evaluation of a 5-cm right solid renal mass diagnosed on computed tomography urogram (CTU) in the evaluation of new-onset gross painless hematuria. She denied any history of tobacco smoking or illicit drug misuse. The results of a clinical examination were unremarkable for any abdominal or flank masses, organomegaly, or lymphadenopathy. Hematological and biochemical laboratory values were within the normal range (blood urea nitrogen, 8 mg/dL; serum creatinine, 0.73 mg/dL; and glomerular filtration rate, >60).\nPreoperative CTU demonstrated a heterogeneous parenchymal right renal mass suspicious for RCC, along with right ureteral and renal pelvis filling defects (). Rigid urethrocystoscopy and a right retrograde pyelogram were performed and did not demonstrate any mucosal lesions or any filling defects in the bladder, ureter, or renal pelvis. Cytology of urine obtained during cystoscopy revealed epithelial cell clusters with atypia without overt features of malignancy. Some reactive urothelial cells were noted in the background. Further imaging showed no evidence of abdominal or retroperitoneal lymphadenopathy, organomegaly, or distant metastasis.\nGiven the clinical presentation and imaging findings, robotic-assisted laparoscopic right nephrectomy was offered. The risks, benefits, and potential complications were discussed thoroughly with the patient. Subsequently, robotic-assisted laparoscopic right nephrectomy was successfully performed with no complications. The patient had an uncomplicated postoperative recovery course. However, on postoperative day 4, she developed a low-grade fever and productive cough consistent with an upper respiratory tract infection (URTI) secondary to testing influenza A positive. This URTI completely resolved with an oral course of azithromycin. The patient was discharged home on postoperative day 6 in a comfortable and stable condition.\nPathologically, the right kidney specimen showed unclassified RCC with extensive extracellular but intraluminal mucin production with a maximum diameter of 5 cm and with renal sinus fat involvement consistent with pT3a with negative margins of resection. Grossly, the right kidney measured 12.5 cm×10 cm×5.5 cm and contained an upper pole solid mass that when bisected had a firm whitish yellow and glistening cut surface. The mass had ill-defined borders and was present in the superior pole and encroached upon the mid aspect of the kidney. The mass measured 5 cm×4.2 cm×4 cm. It involved mainly the cortex of the kidney and appeared to extend to the superior calices, the medullary pyramids, and the renal sinus fat. The renal pelvis appeared gray-white, glistening, and uninvolved by the tumor. One of the main branches of the main renal vein appeared to contain tumor; however, the renal vein margin was grossly clear of tumor. A smooth-lined unilocular cyst measuring 4 cm×3.5 cm×3.5 cm was found in the inferior to mid aspects of the kidney, which abutted the lateral aspect of the renal capsule and the perinephric adipose tissue. The cyst contained clear serous fluid and the lining was smooth without papillary excrescences. The wall thickness measured up to 0.1 cm. The remaining uninvolved parenchyma appeared tan-brown and smooth with a distinct corticomedullary junction, and the inferior calices appeared gray-white and glistening.\nHistologically, the tumor displayed variable architectural patterns including areas of compact alveoli of clear cells consistent with clear cell carcinoma (). However, islands of cribriform sheets of clear cells with glandular lumens predominated. Many of the gland lumens contained blue mucin that was positive on mucicarmine and periodic acid-Schiff diastase stains (, ). Other areas consisted of small clusters and acini of clear cells embedded in fibrous stroma. Additional microcystic areas lined by a single layer of cuboidal clear cells were noted.\nAfter 12 months of clinic follow-up, the patient remained clinically well and her abdominal wounds were well healed. Her renal function was preserved as indicated by blood urea nitrogen of 10 mg/dL and serum creatinine of 0.84 mg/dL. Follow-up computed tomography of the thorax, abdomen, and pelvis did not reveal any evidence of disease recurrence.
A 15-year-old female patient was admitted to the department of oral & maxillofacial surgery, complaining of gradually increasing swelling on her left side of mandible, started one year ago with severe and unusual pain at the related region. The patient declined to history of any previous toothache and trauma to the affected site. The review of systems was non-contributory. The past medical and dental histories were unremarkable. Upon examination the patient was moderately built and had a normal intellect.\nThe intraoral examinaton revealed a bony enlargement extending from median mandible to the retromolar region, and inferior border of the mandible to the crestal marginal level. The depth of the left vestibul sulcus was thoroughyl decreased due to hard bony expansion. The extraoral examination revealed hard uniform and large expansile mass in the left side of the mandible. Facial asymmetry was present. Left submandibular lymph nodes were impalpable and insensitive in palpation ().\nConventional radiographs and computerized tomographic scan showed diffuse increase of the lesion of mandible, with loss of normal trabecular pattern leading to classical ground glass pattern (). The CT scans were performed on a multislice spiral CT unit (Somatom Definition Edge; Siemens, Erlangen, Germany). The exposure parameters were tube voltage -120 kV, tube current -270 mA, and slice thickness -1mm. The axial section CT image of mandible showed expansion of the body of the mandible with few lytic areas bilaterally but greater in degree on the left side and expansion of the left ramus. Ground glass appearance of the bone was clearly appreciable. Laboratory investigations revealed slight rise in erythrocyte sedimentation rate (ESR) and mild change in the alkaline phosphotase level which was approximately 566 units.\nThe position of the mandibular canal was analyzed through the axial CT, which showed that the vertical distance between crestal margin and inferior alveolar nerve at mental foraminal level on the right and left side of the lesion was 19.06 and 23.50 mm respectively. The horizontal distance between alveolar inferior nerve and other cortex of the mandible at lower first molar region on the right and left side was 5.25 and 15.50 mm respectively.\nTwo separate interventions through incisional biopsy were made for histopathological examinations. The first histopathological specimen revealed increase in mitotic activity, presence of osteoblastic chain surrounding bone trabecules, which lead us to suspect the lesion as being ossifying fibroma. It also lead us to perform second incisional biopsy. A clinical and radiographic diagnosis of FD was confirmed with pathologic examinatons of the specimen examination ().\nThe crestal and sulcular incision was made extending from posterior edentulous area to the median mandible with vertical releasing incision in anterior mandible. Surgical shaving and recountering of mandible through delicate preservation of the mental nerve in the left side of the mandible was performed. Mucoperiosteal elevation was made with identification of the margin of mental nerve. The expanded bone was removed throughout the lesion excluding the bone surrounding the mental foramina. Then gradual osteotomy was performed by chiesel and mallets according to the anatomy of mantel foramina which was analysed via computerized tomography. Horizontally, 8-9mm of bone surgical shaving was performed symetrically with the reference of right mandibular region. CT displayed a vital role for identification of the mental foramina during osteotomy especially in the bone surrounding mental nerve bundle. The surgical technique included intersecting with oscilating saw, performing osteotomy by chiesels, recontouring with big round burs and rasping with a bone file. Mucosal healing was uneventful. Facial esthetic lines were obtained in the evaluation from the frontal aspect. In evaluation from the lateral profile, bone expansion at inferior border of the left mandible was not eliminated due to staying away from invasive technique (extraoral approach) during pubertal phase.\nNo paresthesia was seen during the early and late postoperative period. The patient was followed up for 12 months. The patient was satisfied with both aesthetic and functional results ( and ).
The case we present here is about a 10-year-old girl reported to the Department of Pedodontics in a Dental College in Kerala, India with the complaint of a missing upper left central incisor. She was a normal healthy child with a noncontributory medical history. However, she gave a dental history of trauma at the age of 4 years and loss of her left deciduous central incisor. She presented with a middle mixed dentition with normal overjet and overbite and an end-to-end molar relationship. Anterior incisor space was reduced due to the mesial drift of the erupted permanent left lateral incisor. The right central and lateral incisors had erupted at the appropriate time. Clinical examination, including labial and palatal palpation was performed. Intraoral radiographs were advised which revealed the presence of a mesiodens and a central incisor crown. For higher accuracy of localizing the position of the mesiodens and the root of the permanent tooth, vertical and horizontal shift radiographic views and a maxillary anterior occlusal radiograph were advised. These radiographic series indicated the presence of a well formed, labially placed mesiodens, with its long axis vertical in the alveolus, high in the anterior space. The root of the mesiodens was in close approximation to the permanent tooth crown. Placed high in the alveolar bone was a malformed central incisor, with a rudimentary root, placed at an angle to the crown. The unerrupted mesiodens showed a sufficiently long and straight root with a fairly flat crown favorably positioned for guiding into position ().\nConsidering the age of the patient, clinical and radiographic findings, and the following treatment was decided upon. Guiding the mesiodens to the edentulous area could provide a unique advantage of bridging the anterior space and prevention of the use of a prosthesis at such a young age. The procedure was explained to the parents and the patient, and their approval sought. After routine blood examination, using a labial approach, surgical exposure of the labial aspect of the supernumerary tooth was attempted. A closed exposure of the mesiodens was preferred to enable an orthodontic eruption along with its periodontal attachment. The mesiodens revealed a flat labial surface of mesiodistal width of approximately 6 mm, with 3-4 mammelon like structures at its incisal edge. Simultaneous bonding of an orthodontic bracket to the exposed labial aspect was found appropriate (). A surgical approach, at this juncture, for the removal of the permanent tooth, could jeopardize the root of the mesiodens and impede proper alignment and cause bone loss in that region. Using light traction with elastics, the mesiodens was gradually guided to the position of the missing central incisor (Figures and ). After the root of the mesiodens had descended, the child was subjected to surgical extraction of the malformed permanent tooth, under local anesthesia. As rightfully assessed in the radiographic series, the root of the permanent incisor was rudimentary and dilacerated and narrow with a possibility of cessation. Aesthetic restoration of the mesiodens was carried out with anterior composites (). The patient was extremely satisfied with her appearance after the treatment. After eruption of the permanent left canine, adjunctive procedures may be appropriate to distalize the left lateral incisor with fixed orthodontic therapy to accommodate a crown as large as the adjacent central incisor, for better aesthetics.
The patient (XY) is a single 23-year-old man, working as computer scientist in a technological company, who was admitted to our outpatient psychiatric clinic reporting a problematic use of alcohol and benzodiazepines (BDZ). In his past psychiatric history, he reported experiencing bullying at the beginning of the secondary school while showing very good marks at school. He started the use of substances (alcohol and tetrahydrocannabinoids on social occasions) at the age of 20 years old and rapidly moved to cocaine use, showing a fast progression, from a weekly use to a multiday use in less than a month. Cocaine use had been going on for six months without detrimental effect on social adaptation and stopped when the patient was uncovered by his parents. Subsequently, right after the interruption of the use of cocaine, he undertook gambling behaviors (scratch and win) with substantial loss of money. In that period he also presented a dysmorphic attitude and assumed anabolic steroids (testosterone, nandrolone). These episodes occurred during a period of six months predominantly characterized by elevated mood, which was followed, a few months later, by a clinical picture of internal tension and increased anxiety levels. For this reason, he was treated by his general practitioner with BDZ (delorazepam, bromazepam) which led to further mood swings complicated by the abuse of alcohol and high dose of BDZs.\nAt the age of 22 years old, the patient turned to a psychiatrist and started a psychopharmacological therapy, at first with antidepressants such as paroxetine and escitalopram, without benefits on both affective and addictive aspects. He was then prescribed valproic acid and disulfiram with partial improvement of the mood symptoms despite continuing binges of alcohol and benzodiazepines. Interestingly, he reported that he premeditated such binge episodes, which occurred every 15–20 days, not taking disulfiram.\nAt the age of 22 years old he was admitted to the Outpatient Unit of the Psychiatric Clinic of the University of Pisa (Italy), where he was diagnosed with BD type II in a patient with a problematic use of alcohol and a history of SUD. He received a psychopharmacological treatment based on mood stabilizers (lithium salts, valproic acid), disulfiram, clonazepam, and nalmefene, with a significant reduction of the mood fluctuations, cessation of alcohol consumption, and partial improvement of BDZ abuse. More recently he was admitted to the Inpatient Unit of the Psychiatric Clinic of the University of Pisa; consequently, an episode of diuretics (furosemide) and β-2 adrenergic agonists (clenbuterol) misuse lasted for two weeks, associated with an increase of the physical activity upon a period when he attended the local gym. He reported that diuretics self-administration would have served the increased concern about his physical appearance since his body dissatisfaction represented a limit in friendship. At the time of the admission, he showed underestimation of the medical risks to witch he was exposed.\nThe treatment strategy adopted led to a remarkable improvement in his clinical situation, including substantial mood stabilization, a reduction in anxiety, the prevention of withdrawal symptoms for alcohol and BDZ, cessation of alcohol use, reduction of craving for alcohol and BDZ, and improvements in social functioning. Relapses on fast-acting BDZ use continued to occur, but their frequency reduced. To date, the patient is still working as computer scientist in a technology company and has an optimum working adaptation, but he is poorly adapted to the social and leisure plan with no social circle and lack of confidence in social situations.\nThe patient was assessed by means of the Structured Clinical Interview for DSM-5 Disorders (SCID-5), the Ritvo Autism and Asperger Diagnostic Scale (RAADS-r) [], and the Adult Autism Subthreshold Spectrum (AdAS Spectrum) [].\nThe RAADS-r is a modified version of the Ritvo Autism Asperger's Diagnostic Scale [] including 80 items divided into four subdomains: language and communication (7 questions), social relatedness (39 questions), sensorimotor and stereotypies (20 questions), circumscribed interests (14 questions). The questions are designed for individuals with average IQ and above.\nThe AdAS Spectrum is a questionnaire developed within the framework of the international research network called Spectrum Project []. The instrument assesses the lifetime presence of the wide spectrum of manifestations associated with ASD, but which could be founded even in individuals who do not fulfill diagnostic criteria for a formal disease: in this regard, it was not developed to be a diagnostic instrument. The AdAS Spectrum allows evaluating a broader area of clinical and nonclinical traits. It includes 160 dichotomic questions (yes/no), grouped in seven domains: childhood/adolescence, verbal communication, nonverbal communication, empathy, inflexibility and adherence to routine, restricted interests and rumination, hyper/hyporeactivity to sensory input. The AdAS demonstrated an excellent reliability, with a Kuder–Richardson coefficient of 0.964 for the total score and above 0.80 for each single domain, except for the empathy and hyper/hyporeactivity to sensory input domains, which had, respectively, a coefficient of 0,762 and 0.794. The test-retest reliability was also demonstrated to be adequate (Intraclass Correlation Coefficients above 0.90). Moreover, AdAS total score was highly correlated with RAADS-14 and AQ total score, with a Pearson's r correlation coefficient, respectively, of 0.77 and 0.83, and each AdAS domain positively correlated with RAADS-14 and AQ (ranging from r = 0.58 to r = 0.79) [].\nBy means of the SCID upon DSM-5 criteria, a diagnosis of BD type II and SUD emerged, while just one out of two criteria of ASD was satisfied.\nA total score of 93 on 240 was reported at the RAADS-r as well as a total score of 88 on 160 at the AdAS Spectrum lifetime. Details on RAADS-r and AdAS are shown in .
A 52-year-old male with a past medical history of schizophrenia presented to the emergency room with complaints of cough with green blood-streaked sputum, fever of 103.3 °F, dyspnea, and fatigue of three weeks duration. He had been recently hospitalized for community-acquired pneumonia and myocardial infarction (MI) six weeks prior to the current presentation. At that time, he underwent cardiac catheterization which showed total occlusion of the right coronary artery. He was started on medical management for MI and pneumonia. Due to worsening of his dyspnea and cough, a computed tomography (CT) scan was performed and reported normal without any mediastinal or lung mass (Figure ). The patient was eventually discharged on antibiotic therapy after stabilization of his condition.\nAt current presentation, the patient appeared cachectic, had rales over the right side of the chest and decreased breath sounds in bilateral bases of the lungs. He had leukocytosis of 13000 per microliter and chest X-ray (CXR) showed a right mid-lung hazy opacity with trace pleural effusion. He was started on treatment for healthcare-associated pneumonia. His sputum cultures grew Staphylococcus aureus and workup for tuberculosis was negative. However, the patient’s medical condition worsened over the next two weeks and he subsequently went into respiratory failure requiring mechanical ventilation. CXR revealed new complete opacification of the right lung field, with ipsilateral tracheal deviation. An urgent bronchoscopy showed an obstructing endobronchial mass in the right mainstem bronchus. A biopsy of the mass was deferred due to ongoing antiplatelet therapy for a recent MI. A subsequent CT chest revealed encasement of the right upper and lower lobe bronchus with extensive mediastinal lymphadenopathy consistent with a neoplastic process (Figure ). The patient's condition continued to deteriorate over the next 24 hours and he died as a result of respiratory failure and pulmonary hemorrhage.\nThe autopsy confirmed the presence of a high-grade, poorly differentiated LCC of the lung, locally metastatic to paratracheal and mediastinal lymph nodes. Three large mediastinal lymph nodes were identified: paratracheal, subcarinal, and right hilar each measured up to 3.5 X 3 X 6 cm. On gross pathology, the cut surface was described as tanned, beige, and hemorrhagic, with extensive focal necrosis (Figure ). A large endobronchial polypoid cast-like soft lesion was identified, filling the entire lumen of the right main bronchus and extending into the right middle lobe and right lower lobe and upon removal of the mass/clot, it branched up to 10 cm in length.\nLight microscopy revealed large haphazard bronchial epithelial tumor cells with areas of extensive hemorrhage and vascularity. Large, irregular, poorly differentiated anaplastic cells with sheets or nests of large polygonal or giant multinuclear cells were noted (Figures -).\nThere was evidence of extensive lymph node metastasis invaded by sheets of large tumorous epithelial cells with no evidence of glandular, squamous, or neuroendocrine differentiation. The cross-section through the wall of the bronchus revealed foci of tumor involving the mucosa, extending through the bronchial wall beyond the cartilage. Immunohistochemistry on lymph node specimens was positive for CK7 and negative for CK20, BER EP4, TIF1, NAPSIN, P63, CK5/6. A diagnosis of high-grade, poorly differentiated carcinoma of lung origin most consistent with large cell variant was made. The neuroendocrine markers were negative.
A 63-year-old gentleman was found by his primary care physician to have a new right inguinal canal impulse bulge upon presentation for an unrelated symptom. The patient was referred to a general surgeon, to whom he reported a one year history of an asymptomatic groin mass and possible urinary changes. On physical examination, the abdomen was soft, slightly obese, nontender, and nondistended. There was mild right testicular tenderness with a right inguinal canal impulse bulge. The left testicle was normal and there was no left inguinal canal impulse bulge.\nUltrasound ordered to evaluate hernia contents and rule out testicular pathology demonstrated a mild, unilateral right-sided varicocele measuring 3 mm (). Otherwise, the exam was unremarkable: there were no focal lesions of either the right or left testicle and there was no definite bowel-containing hernia visualized on examination of the right scrotum.\nA CT abdomen/pelvis with intravenous contrast was performed in order to rule out a mass in the right retroperitoneum that could have been compressing the right gonadal vein and causing venous congestion. This CT demonstrated a 10.3 × 7.4 × 18.1 cm predominantly fat density lesion with small internal focal areas of soft tissue density in the right retroperitoneum extending into the right lower quadrant along the right paracolic gutter and anterior to the iliopsoas muscle (Figures and ). The retroperitoneal location and presence of soft tissue components made liposarcoma much more likely than a benign lipoma [].\nThe white arrow on highlights the right-sided inguinal hernia contents, which have the same homogenous hypointensity as the large fatty lesion in the retroperitoneum. The liposarcoma had likely extended through the inguinal rings resulting in indirect inguinal hernia appreciated on physical exam. Indicated by the white arrowhead in , a section of the right gonadal vein courses through the deep inguinal ring where it was likely compressed by the liposarcoma, causing the patient's right-sided varicocele. There is also a nonlipomatous nodular focus of intermediate signal density seen starred in Figures and consistent with soft tissue elements. Additionally, the retroperitoneal tumor was exerting mass effect with leftward displacement of bladder and anterolateral displacement of bowel.\nThe patient's metastatic workup (chest CT with IV contrast) was negative and he underwent tumor resection. Surgical exploration demonstrated an obvious large, palpable, lobulated mass encapsulated within regular adipose tissue of the right retroperitoneum. The mass was removed with wide margins. Frozen section of the 17 × 17 × 8 cm specimen demonstrated adipose tissue with scattered chronic inflammation and rare histiocytes, though low-grade liposarcoma was not ruled out. The patient's postoperative course was unremarkable and he was discharged from the hospital on postoperative day 7.\nPathology confirmed the diagnosis of well-differentiated liposarcoma (). The tumor was histologic grade 1 with a mitotic rate of 1/20 high-power fields in most cellular areas. No necrosis or lymphovascular invasion was identified. The superomedial, lateral, and inferomedial margins were positive on microscopy. The pathologic stage was T2bNxM0 and clinical stage 1 b, which is based on a deep tumor of size greater than 5 cm. Immunohistochemical stains performed on formalin fixed and paraffin embedded tissue showed that the highly atypical cells in the area of well-differentiated liposarcoma, inflammatory type, were negative for lymphoid marker CD45. Cytogenetic studies were attempted; however, the cells from the tumor specimen failed to proliferate in culture.\nDue to positive microscopic margins, the patient proceeded to resection of residual disease including right orchiectomy, omental flap, and appendectomy at an outside, regional sarcoma center six months after the initial surgery. One microscopically positive margin persisted. The patient did not undergo any radiation or chemotherapy as part of his treatment.\nNow two and a half years after his initial diagnosis, this gentleman continues to be monitored for local and distant recurrence of disease with biannual abdominal/pelvic CTs and annual chest X-rays.
A 35-year-old woman presented to us after an accident in which her back was impacted by an 80-kg-heavy-giant rubber tire with metal wheel hub. When the tire fell down from about 10 m high, the patient was standing right under it and the middle thoracic back was hit by the tire from above. She felt pain in her back and remained in place until emergency personnel arrived. After conservative management in the local hospital for 3 days, the patient was transferred to our hospital safely. During the 3 days in the local hospital, the patient received neurotrophic factors and antithrombotic reagent given by venous transfusion without any reduction treatment and she hesitated to accept a surgery. Upon examination, her blood pressure was 142/94 mmHg, pulse rate 60 per minute, respiratory rate 15 per minute, and body temperature 37 °C. She denied numbness and weakness in her extremities. Physical examination revealed that she was neurologically intact without focal sensory or motor deficits and had normal reflexes. Neurological examinations revealed a Frankel grade E. According to ASIA scoring system, the patient got 112 points for light touch sensation, 112 points for pain sensation, 50 points for the upper limb main muscles, and 50 points for the lower limb main muscles. No perianal sensory was lost. Normal anal contractility and sphincter reflex were observed. A severe tenderness point was found in the middle back. She had Medical Research Council (MRC) grade 5 power in both lower limbs. Associated injuries were pulmonary contusion resulting in right pleural effusion, which was treated by chest tube insertion in the local hospital. No neurogenic bladder or fecal incontinence was observed.\nSpine radiography revealed a burst fracture of T7 with complete fracture-dislocation and sagittal displacement of the T6-7 vertebrae (Fig. ). Spinal computed tomography revealed fractures involving the left pedicle of T4; spinous process, vertebral laminae, and bilateral pedicles of the T5 and T6; spinous process of T7; and both pedicles of the T8 vertebra. The fractures in the bilateral facet joints of the T6/7 vertebrae and T7 body burst fracture resulted in the dislocation between the T6 and T7 vertebrae. There was no retropulsion of bony fragments into the spinal canal, and spinal canal was expanded because of the fracture of pedicles (Fig. ). Magnetic resonance imaging showed spinal fracture-dislocation of T6 to T7 and no abnormal high signal intensity of T2 weight image (Fig. ). According to the records of the local hospital, 1.8 g methylprednisolone were administered at the local hospital about 2 h after admission and decompressive immobilized surgery was performed 3 days after arriving in our department.\nUnder general anesthesia, the patient was carefully placed in a prone position. A traumatic hematoma was evacuated on the fascia after a thoracic midline vertical incision. The erector muscle of the spine from T5 to T8, adjacent part of the latissimus dorsi, and corresponding skin and superficial fascia were found to be damaged severely. The fracture formed a spontaneous decompressive sparing canal containing the spinal cord. The vertebral body of T7 was broken almost vertically and the majority detached posteriorly. The bilateral superior facet of T7 was broken and dislocated behind the inferior facet of T6. No hematoma or dura membrane tear was found. After extensive decompression from T5 to T8 with a high-speed burr, the dura and spinal cord appeared as normal without tearing except for the displacement. Realignment of the spine was achieved with rods after placement of transpedicle screws in the T3, T4, T5, T8, and T9 vertebrae (Fig. ). During the reduction, two rods were placed in the screws firstly. The nuts of screws in T8 and T9 were tightened while the other nuts were not. A distractor was applied between T4 screw and a powerful plier biting on the proximal of rods. Then, the dislocated vertebrae were replaced with distraction between T4 and pliers. All the nuts were tightened after reduction of vertebrae. Finally, posterolateral bony fusion of T3 through T9 was performed. Intra-operative neurophysiological monitoring was applied throughout the operation. The massive blood loss from comminuted fracture of the vertebral body was solved by autologous blood transfusion.\nNo deteriorated neurological function was observed postoperatively. The patient was discharged on day 27 and could walk without assistance. At 6-and 12-month follow-up, the patient has recovered well. At 6 months after the injury, the patient returned for reexamination walking on foot without any brace. At the 12-month follow-up, the patient was able to walk 2 km a day continuously and returned to her job.
A 69-year-old female was referred to our clinic for an incidental finding of a large Morgagni hernia found on a recent CT chest scan for lung cancer screening. Patient reported occasional shortness of breath after prolonged ambulation but denied chest pain. She did have remote history of acid reflux symptoms but nothing recently. She denied issues with prematurity or issues with development as an infant, chest trauma, or MVA history. She did complain of occasional right shoulder pain but attributed this to arthritis. Denied history of heart attack, stroke, DVT, or PE. She had a 30-pack-year smoking history but quit a year prior. She was up-to-date on her colonoscopy, current within the past year. She denied hematochezia and melena, bowel habit changes or major body weight changes as well as any current abdominal pain. On examination her vitals were within normal parameters. Heart and lungs were unremarkable. Abdominal examination was soft with normal bowel sounds and nontender. Remainder of examination was unremarkable. Laboratory values included a normal CBC and BMP. A CT chest scan had demonstrated a large retroxyphoid hernia of Morgagni involving several loops of small bowel and transverse colon located in the right inferior hemithorax (Figs and ). No evidence of acute incarceration or strangulation were noted. A detailed discussion was undertaken with the patient regarding her hernia and she was consented for a laparoscopic repair with mesh.\nPatient underwent a laparoscopic approach in lithotomy positioning with the primary surgeon working between the legs. Three working ports were used, a 12 mm port at the umbilicus and two 5 mm ports; one in the LUQ and one in the RUQ. Upon initial laparoscopy multiple loops of small bowel were progressively reduced out of the hernia sac which also included the ascending colon and part of the transverse colon (Figs and ). All the small bowel and the colon appeared viable. The redundant parietal peritoneal hernia sac was excised out of the right inferior hemithorax utilizing a LigaSure (Covidien) (Fig. ). The falciform ligament was also taken down all the way to the diaphragm. The defect in the diaphragm measured to be approximately 9 cm by 4 cm. A section of Pariatex composite mesh was then trimmed to 2 cm in width by 9 cm in length. Three stay sutures of 0 Ethibond were placed laterally and in the middle of the mesh. This was placed into the peritoneal cavity after soaking it in vancomycin with local anesthetic. The sutures were then percutaneously brought through the diaphragm edge that was unattached to the anterior abdominal wall and then subsequently through the anterior abdominal wall. These were then tied thereby re-approximating the unattached edge of the diaphragm to the anterior abdominal wall near the xiphoid (Fig. ). Additional 0 Ethibond sutures were placed in between these initial ones percutaneously with a suture passer.\nAdditionally, another Pariatex composite mesh was then trimmed to 12 cm in width by 9 cm, soaked in vancomycin with local anesthetic and then placed into the abdominal cavity. It was positioned over the area of the repair and fixed into place with absorbable tacks around its caudad edge and centrally. Along the cephalad edge it was fixed with a running V-lock absorbable suture to the diaphragm. Fibrin glue was placed along this same edge (Fig. ). The ports were removed and incisions were closed.\nPatient’s postoperative course progressed well. She was monitored overnight and discharged the following day. She was seen for follow-up in 2 weeks out of surgery and did quite well. She was tolerating a regular diet and having bowel movements. A month after surgery another CT scan was obtained which demonstrated a postoperative seroma in the right inferior hemithorax (Fig. ). Currently, the patient is to be seen in a 6-month follow-up to have another CT scan at that time.
A 63-year-old female with history of end stage renal disease secondary to IgA nephropathy, who underwent a living related kidney transplantation in 1995, presented to our hospital with generalized malaise, dyspnea on exertion, and cough which started 6 months prior. Her other past medical history included type 2 diabetes mellitus and chronic kidney allograft dysfunction due to recurrent IgA nephropathy. Immunosuppressive regimen included cyclosporine 100 mg every 12 hours, azathioprine 50 mg daily, and prednisone 5 mg daily. On arrival to the hospital, the patient was hypotensive with a blood pressure of 75/48 mmHg and febrile with a temperature of 100.6 F. Norepinephrine drip and broad-spectrum antibiotics were initiated, although a source of infection was not obvious at that time. Laboratory testing was notable for anemia, thrombocytopenia, and elevated lactate dehydrogenase (LDH) and C-reactive protein (CRP). CMV viral load was positive with a titer of 3.6 log10 IU/ml and valganciclovir therapy was initiated as a result. Morning cortisol level was substantially suppressed at 0.6mcg/dL, and, due to concern for adrenal insufficiency, stress dose hydrocortisone was administered, followed by conversion to prednisone taper. Patient's hypotension and fever resolved within 24 hours from the initial presentation, and she was subsequently discharged in stable condition with a diagnosis of CMV infection, on appropriate dose of valganciclovir with plan for follow-up as an outpatient. Unfortunately, the patient was rehospitalized 4 times in the subsequent 2 months with fever, shock, and fatigue. During each admission she received stress dose hydrocortisone and vasopressor with or without empiric antibiotics. Every time, her symptoms resolved rapidly (within 24 hours of initiation of therapy) without a clear diagnosis. Initially CMV was considered to be the cause of recurrent fever and hematologic abnormalities, but she had recurrent severe symptoms despite resolution of CMV viremia in the setting of valganciclovir treatment (summary in ).\nOn the 5th admission, she presented again with hypotension and fever. The remainder of a review of symptoms was negative. Physical examination was unremarkable. Laboratory testing revealed a white blood cell count of 7,200/mm3, persistent anemia with a hemoglobin of 8.2 g/dl, and thrombocytopenia with a platelet count of 83,000/mm3. LDH and CRP were yet again elevated (410 IU/L and 153.0 mg/L, respectively). Alanine aminotransferase and aspartate aminotransferase were mildly elevated at 50 IU/L and 41 IU/L, respectively. The patient's serum triglyceride level was 547 mg/dl (normal range 0–149 mg/dl) and ferritin level was remarkably elevated at 3311 ng/ml (normal range 13–150 ng/ml). As outlined above, CMV viral load was undetectable. Vasopressor and stress dose hydrocortisone were administered. As patient's hypotension resolved, vasopressor was discontinued within 24 hours from the time of admission. A computed tomography scan of the chest, abdomen, and pelvis showed patchy ground glass opacities at the lung apices bilaterally. Bronchoscopy with broncho-alveolar lavage was performed, though it did not reveal any evidence of infection, including Pneumocystis jirovecii. Further testing was performed to exclude rheumatologic disease, macrophage activation syndrome, malignancy, and autoinflammatory syndromes. Complement levels were within normal limits; antinuclear antibodies and rheumatoid factor resulted as negative. Serum protein electrophoresis test showed normal levels of all immunoglobulins and no monoclonal component. EBV viral load was negative. Patient inevitably underwent a bone marrow biopsy, which revealed histiocytes with engulfed red cells, platelets, and neutrophils (), suggesting HLH. High dose intravenous methylprednisolone was started at 1 gram intravenously daily and continued for 5 days, after which she was continued on oral prednisone at 1 mg/kg/day. Soluble Interleukin 2 receptor (sIL-2R) was elevated (15490 pg/ml, normal range <1033). Based on this, patient was diagnosed with HLH and discharged on high dose oral prednisone.\nShe remained afebrile, but suffered from severe persistent weakness. Subsequent outpatient laboratory testing revealed reduction of the platelet count and increased ferritin, indicating ongoing macrophage activation. Patient underwent thorough and extensive genetic testing, which was not consistent with familial HLH. Torso imaging was repeated to rule out an underlying malignancy, with positron emission tomography, and a magnetic resonance imaging did not reveal any suspicious neoplastic lesion. Given clinical and laboratory signs concerning for HLH exacerbation, chemotherapy with etoposide was started. She received four doses of etoposide in combination with daily dexamethasone. Unfortunately, patient developed acute hypoxic respiratory failure due to aspiration pneumonia in the setting of progressive encephalopathy, combined with Enterococcal and Neisseria bacteremia, and ultimately passed away within 3 months of her initial presentation.
The patient was a 32-year old woman with a one-year history episodes of cholecystitis treated conservatively. She did not have any other disease history. After an abdominal magnetic resonance imaging that confirmed multiple gallbladder stones (Fig. a), an elective LC was performed without intra-operative complications. The recovery was uneventful and the patient was discharged two days after operation. On the second day after discharge, the patient developed severe right upper abdominal pain and she was sent to our emergency department at 8:30 pm. At arrival, her heart rate was 110 bpm and the blood pressure was 80/55 mmHg. The hemoglobin dropped to 86 g/l from 127 g/l. The CT scan showed a 10.9 × 12.5 × 6.6 cm ISH in the right liver without obvious free fluid in abdominal cavity (Fig. b). Two hours after fluid resuscitation including 2 U red blood cell, the hemoglobin further declined to 78 g/l and the hemodynamics remained unstable. The abdominal pain was not relieved, after intravenous analgesics. A Doppler ultrasound was performed, two hours later and it found the hematoma had increased in size. Active intrahepatic bleeding was suspected. We called radiologist for consultation, however, the interventional angiography and embolization was not available at mid night. We explained the potential risk of sudden rupture of hematoma during conservative methods which may cause sudden death, to the patient and her relatives. After careful consideration of the continuous decline of hemoglobin, unstable hemodynamics after fluid resuscitation, we explained our surgical plan to the patient and her relative. We planned to perform laparoscopic exploration at first, if the hematoma continued to expand, we would evacuate or drain it, if not, we would put a drainage tube under liver which could serve as an early warning of rupture. The patient requested surgical method to reduce the risk of sudden death. Therefore, an emergency laparoscopic exploration was performed under general anesthesia. The ISH was confirmed (Fig. c). Four U red blood cell and 400 ml fresh frozen plasma were transfused. After fluid resuscitation and blood transfusion, her hemodynamic became stable. During the 3-h intra-operative observation, the hematoma did not expand. Therefore, a non-sucking drainage tube was placed under the liver and she was sent to ICU ward. Next morning, she was transferred to the ordinary ward. The upper abdominal pain gradually relieved. Five days after the laparoscopic exploration, another CT scan showed that the hematoma was largely resolved and we removed drain tube (Fig. d). She was discharged, 10 days after readmission.\nTotally, 13 papers, including 16 cases of ISH after LC were reported from 1994 to 2015 (Table ). Nearly half of the patients had instability of hemodynamics. All of the cases were female patients. Age of patients ranged from 25 to 78. All hematomas were mainly located in the right lobe of liver, and some of them extended to the left lobe of liver. Only one case was ruptured at diagnosis. Hepatic capsule laceration was found in two cases, one of whom also took NSAIDS (non-steroids anti-inflammatory drugs) to control the pain after operation. Totally, 58.8% of patients took NSAIDS to control the post-operative pain, and most of them used Ketorolac, however, 35.3% of the patients still did not have definitive risk factors. The time interval to diagnose ISH after LC ranged from seven hours to six weeks. They were diagnosed most commonly (35.5%) within one day after LC. All patients had abdominal pain and 47.1% of the cases developed hypovolaemic shock.\nTreatment strategies included: conservative treatment (antibiotics, blood transfusion, strict bed-reset), percutaneous drainage under CT or B ultrasound guidance, selective embolization of the bleeding vessel, laparoscopic exploration and laparotomy. Eighteen percent of patients had stable condition without fever and underwent conservative treatments. The only case of angioembolization was complicate by infection and required percutaneous drainage. For the patients with stable condition, fever and serious compression of inferior venal cava (IVC) always were indications for percutaneous drainage under CT or B ultrasound guidance. In these 17 cases, 29.4% of the patients underwent percutaneous drainage. For the patients with hemodynamic instability, emergent reoperation was adopted. Totally, nine cases underwent reoperation, including two case of laparoscopic operation and seven cases of laparotomy. For our case, we only performed laparoscopic exploration and did not perform evacuation or drainage of the hematoma, since the hemodynamic became stable after plenty fluid resuscitation and the hematoma did not expand, during the 3 h of intra-operative observation. For another case, laparoscopic exploration found small capsule laceration, and hemostasis was performed. In the seven cases of laparotomy, six patients underwent evacuation and drainage of hematoma, only one case underwent only laparotomy without evacuation or drainage.\nAll patients survived. Most of patients stayed one to two weeks after readmission, however, the longest hospital stay was up to 31 days after reoperation.
In September 2014, an 18-year-old, non-smoking male was diagnosed with an open fracture of the right tibia, Gustilo’s classification grade IIIB [] following a traffic accident. The patient weighed 65 kg. Emergency debridement was performed at the local hospital following injury (Fig. a and b). The fracture and wound had not healed 3 months after injury. Copious pus was drained and the patient was transferred The Second People’s Hospital of Yunnan for further treatment.\nThe patient was admitted to The Second People’s Hospital of Yunnan 97 days after the injury. A physical examination of the patient’s right calf revealed a soft tissue defect and exposed tibia. A 4 × 10 cm incision was observed on the anterior medial side of the upper calf and a 3 × 12 cm-sized wound was seen on the anterior medial side of the lower leg. Significant foot drop was observed. The patient experienced hypoesthesia on the lateral side of right calf and the dorsal surface of the foot; however, normal sensation was felt on the plantar surface of the foot and the dorsalis pedis artery appeared normal. The range of motion of the knee was 0–80°, and ankle extension and flexion were 10 and 20°, respectively. Level III myodynamia was observed in the pretibial muscle and the triceps surae (Fig. ).\nFollowing discussion with the patient, a limb salvage protocol was adopted in favor of amputation. The treatment plan consisted of two stages. The first step was to treat the infection by performing repeated debridement, replacing the external fixation, vacuum sealing drainage (VSD) and local and systemic application of antibiotics. In the second stage, the bone transport technique was used to repair the bone defect, and rehabilitation exercise was performed to restore the function of the affected limb as much as possible. The patient was informed about the treatment plan and the associated risks. A series of examinations were performed to assess the tibial infection. An X-ray revealed necrosis and hyperplasia in the middle of tibia (Fig. ). Single-photon emission computed tomography showed radionucleotide accumulation in the midtibial region and computed tomography angiography confirmed that the anterior and posterior tibial arteries were normal. Laboratory investigations were as follows: i) C-reactive protein, 21.6 mg/l: ii) erythrocyte sedimentation rate, 35 mm/h; iii) white blood cell count, 16.47 × 109/l; and iv) Neutrophil percentage, 84.51[50–70]. The final diagnosis was an infected right tibial nonunion with a soft tissue defect.\nDebridement to completely remove the infected and devitalized bone, inflammatory and scar tissue was performed on the second day after admission (Fig. ). The debrided bone was replaced with a three-segment monolateral external fixator (Third Medical Instrument Company; Fig. ) followed by the implantation of vancomycin-impregnated cement beads (4 g vancomycin and 80 g cement) in the bone defects (Fig. ). The wound was partially closed and the dressing was changed regularly following surgery. The second debridement was performed 5 days after the initial procedure and involved the removal of inflammatory tissue and the antibiotic beads. VSD was used to cover the wound and to promote the growth of granulation tissue while simultaneously draining pus. The third debridement was performed 5 days after the second procedure, and involved the removal of the VSD. The wound appeared clean and was subsequently sutured. At this point, the bone defect measured 25 cm in length. Antibiotic sensitivity testing was performed following each of the three debridement procedures and Methicillin-resistant Staphylococcus aureus, Escherichia coli, Klebsiella pneumoniae and Enterococcus faecalis were identified. Vancomycin and meropenem through the veins were used to treat the infection. Wound healing and infection control marked the end of the first stage of the treatment plan.\nThe repair of the massive bone defect posed the biggest challenge during the second stage of the treatment plan. As bone transfer technology has a number of advantages, this technique was applied. Wound healing and infection control were assessed through relevant indicators and when satisfactory, a single osteotomy was performed 2 cm away from the ankle joint surface (Fig. ). Bone transport was initiated 1 week later at a rate of 1 mm per day (0.25 mm four times a day). The quality of the newly formed bone was assessed 2, 4 and 6 months after osteotomy using X-rays (Fig. ), which revealed satisfactory osteogenesis was occurring. A total of 15 months after osteotomy, the distracted bone had reached docking site, which resulted in skin invagination and axis deviation (Fig. ). The embedded soft tissue was removed and the axis was adjusted. To promote docking site union, the external fixation was loosened and increasing load across the site of osteogenesis were gradually added. The total length of transport was 24.5 cm. After 40 months, union was achieved and the consolidation of the newly formed bone was complete (Fig. ). The patient exhibited the following range of motion: i) Knee extension, 0°; ii) knee flexion, 110°; iii) ankle extension, 10°; and iv) knee flexion, 10° (Fig. ). A knee valgus deformity angle of 4° and a 10 mm shortening of the tibia were observed. The bone healing index was 1.6 months/cm. When the bone and soft tissue wound have healed, the patient was able to walk painlessly without ambulatory assistive devices and resumed daily activities successfully. The ASAMI [] was used to assess the limb function and bone healing, and revealed a good functional and bone repair result. Similarly, the KSS of functional outcome yielded good result [] and the LEFS [] was 65.\nEighteen months after the bone and soft tissue wound have healed, we performed a follow-up evaluation with Short Form-36 (SF-36) score [] and LEFS (Additional files , and ). The SF-36 score was 86, and the LEFS was 70. The overall treatment progress is briefly presented in Table .
A 63-year-old male with type 2 diabetes mellitus of 30 years duration, complicated by obstructive sleep apnea, hyperlipidemia, bilateral proliferative retinopathy, obesity, and prostate cancer presented to the emergency department with complaints of shortness of breath, weight gain of 20 lbs, and increased abdominal girth occurring over the course of two weeks.\nThe patient has a history of poorly controlled diabetes mellitus with hemoglobin A1c (HbA1c) greater than 9% with the use of insulin pump therapy for over 10 years. He suffers from bilateral diabetic retinopathy which is being followed by an ophthalmologist but does not have any history of peripheral neuropathy, angina, intermittent claudication, or transient ischemic attacks (TIAs). He also does not have any history of diabetic ketoacidosis.\nHe had visited his endocrinologist five months prior to the current presentation for a routine follow-up visit. He was using the Medtronic MiniMed 530G pump with U-200 lispro insulin with continuous glucose monitoring. Shortly after that visit, his insulin pump was upgraded to the Medtronic MiniMed 670G pump with Guardian 3 sensor without any changes in the pump settings or insulin formulation. The patient was instructed in the use of the “Auto Mode” feature and began using that feature more than 70% of the time.\nAbout 10 weeks later, due to formulary issues, the insulin type was changed to U-100 aspart and the pump settings were adjusted to reflect the change in concentration. After three weeks, the patient had another follow-up visit at which point his HbA1c was 8.3% showing remarkable improvement. He did not have any complaints of edema or shortness of breath at that time and his weight was at his baseline. He did complain of the need for frequent pump reservoir refills due to the high doses of daily insulin requirements and asked that his insulin be changed to a more concentrated formula. After a discussion of the potential risks of doing so and at his request he was switched to U-500 regular insulin and pump adjustments were again made accordingly.\nAbout two weeks after the initiation of U-500 regular insulin, the patient started noticing an increase in his weight and the development of bilateral lower extremity edema. Within two weeks increase in abdominal girth and shortness of breath ensued for which he eventually presented to the emergency department.\nLaboratory studies including comprehensive metabolic panel (albumin: 4.3 g/dl), troponin, pro-B-type natriuretic peptide (proBNP), thyroid stimulating hormone (TSH), and urinalysis as well as electrocardiogram were all unremarkable. He had mild microalbuminuria with urine microalbumin 32.2 mg/L and urine microalbumin/creatinine 18.7 µg/mg creatinine. Imaging studies including chest X-ray, CT angiography (CTA) scan thorax, and CT scan abdomen/pelvis did not show any pulmonary embolism, pleural effusion, or free pelvic fluid. Echocardiogram was done and did not reveal any findings suggestive of systolic or diastolic heart failure. The patient was discharged from the ED and advised to follow up with his primary care provider (PCP).\nDuring the follow-up visit with his PCP, he was diagnosed with insulin edema based on the exclusion of other causes of acute generalized edema. He was started on a 10-day course of spironolactone 50 mg/daily, advised on salt and fluid restriction, and asked to monitor his weight daily. He was also referred to his ophthalmologist for evaluation of the development of macular edema.\nA follow-up visit on week 21 post-pump change showed a decrease of 10 lbs in body weight with significant improvement in the edema and shortness of breath. The ophthalmology visit had ruled out macular edema (Table ).
The patient was a previously healthy 19-year-old Caucasian female college student who presented to the hospital with pain and swelling of the thighs bilaterally. Three nights prior to admission, she had attended a spinning class at a local gym for the first time. She stated that the session was intense and lasted 45 minutes, and although she exercised daily, the intensity of this class was outside of her normal level of activity. After the class, she noted swelling and pain in her thighs but did not seek medical attention until three nights later when she noticed that her urine was dark in color. Alarmed by the changes in her urine, the patient presented to the student health center, where she was noted to have rapid progression of thigh swelling accompanied by increasing pain. As a result of these findings, the patient was immediately transferred to the emergency department for further evaluation.\nInitial assessment revealed marked elevation of creatine kinase (CK) of 53,000 IU/L and leukocytosis of 11,260 white blood cells per microliter. The admitting team ordered an MRI of the lower extremities, which showed swelling in the anterior compartment with a feathery, high-intensity, fluid-sensitive signal within the vastus intermedius, lateralis, and medialis bilaterally (Figure ).\nThe pain grew worse overnight, and repeat labs showed a CK of 119,000 IU/L. Vascular surgery was consulted within 12 hours of admission for evaluation of possible compartment syndrome. The patient was found to have tight, painful thigh compartments with extreme tenderness on passive motion. She had normal distal pulses but had developed tingling and numbness in her right leg since admission. The compartment pressures of the right thigh were measured at the bedside and found to be 28 mmHg in the anterior compartment, 14 mmHg in the middle, and 8 mmHg in the posterior. Based on these findings, the patient was diagnosed with TCS.\nInformed patient consent was obtained prior to treatment. No identifying patient information is contained in this report.\nThe patient was then taken to the operating room (OR) for decompression fasciotomy. In the OR, pressures were measured again on both sides, and the patient was found to have anterior compartment pressures of 28 mmHg and 26 mmHg on the right and left sides, respectively. The middle compartment pressures were 15 mmHg on the right, 13 mmHg left, and the posterior compartment pressures were 8 mmHg on the right and 7 mmHg on the left. During the operation, a lateral approach was used to ensure entry and decompression of all three compartments (Figure ).\nIntraoperative findings included bulging muscle bellies, which appeared initially congested, but remained viable during the case. The muscles reacted to Bovie® electrical stimulation (Bovie Med Corp, Clearwater, FL) bilaterally, and no debridement was required. Wet to dry dressings were placed with a plan for interval wound checks and closure by Plastic Surgery. Postoperatively, her pain improved and her sensation of tingling and numbness resolved. Her repeat CK decreased to 83,000 IU/L, and she was placed on aggressive IV fluids for renal protection against myoglobinuria. Serial metabolic panels were checked while monitoring recovery from rhabdomyolysis. On postoperative day 3, her wounds were appropriate for closure and she was taken by Plastic and Reconstructive Surgery to the OR. Her wound appeared healthy (Figure ), and she was closed primarily without tension with several drains in place.\nFollowing closure, her recovery was uneventful. The patient recuperated in the rehabilitation facility and was discharged from the hospital approximately two weeks after admission.
A 50-year-old Caucasian female visited the regional dental office due to uncertain pain in the right mandibular region. No significant diseases were mentioned in the anamnesis. The patient was diagnosed with gingivitis, and treated with a non-steroid anti-inflammatory drug and oral rinsing with chlorhexidine. The condition of the patient did not improve significantly. When she returned a week later, she had no alleviation, but labial paresthesia on the right side of her lip. As the cause of the new symptom remained unidentified, she was referred to the oral surgery group. Initially, the paraesthesia affected only the right side of the lower lip, but by this time it had spread to the skin of the right side of her chin. The oral surgeons decided to extract the lower right wisdom tooth, but the labial paraesthesia still persisted. Since there was an extended composite restoration in the lower right first molar, and translucency around its apical region was visible, the lesion was diagnosed as periapical granuloma. The lesion on tooth 46 was not close to the mandibular canal; this can be seen on Fig. . Therefore, root canal treatment was carried out, despite the uncertain result of the percussion, palpation and sensibility test. The transparent lesion around the apex and the negative sensibility test lead to the decision of endodontic treatment. Diagnosis was made by a dentist who is not a staff member of our Department. The treatment revealed that the pulp was vital. Our oral diagnostic team examined the patient, and we diagnosed the case as cemento-osseous dysplasia based on the panoramic radiograph showing apical translucency lesions around the anterior teeth with vital pulp (Fig. ). The paraesthesia has been continually present ever since. Because the lesion around the lower right canine had already involved the cortical bone by CBCT scan (Fig. ), a root canal filling and removal of the apical lesion were performed. On the CBCT image the involvement of the entire periapical region can be seen including the lingual region and the buccal cortical (Fig. ). It became clear during the planning of the surgery that the blood vessels and nerves of tooth 43 would be injured.\nThe root canal treatment was carried out on the lower right canine in a single-visit treatment using local anaesthaesia. We explored the entire root canal length using a size #15 hand instrument. The working length was determined using an apex locator, (Woodpex III, Guilin,China), then the length was also confirmed with radiographic imaging. Following the length determination, the root canal was shaped using Wave One (Densply Maillefer, York, USA) rotary instrument. The root canal was obturated using guttapercha and AH Plus sealer (Dentsply DeTrey GmbH, Konstanz, Germany) with lateral condensation technique. Glass ionomer cement (Fuji IX GP, GC Co., Tokyo, Japan) was then applied to seal off the access cavity, while the permanent restoration was done.\nWe prepared an intraoral mucoperiostal flap using an L-shaped incision and the surgery was carried out by using a surgical microscope (Aspheron, Schmidt and Bender Hungaria, Budapest, Hungary).\nWe opened up the buccal cortical bone using a surgical bur, thereafter we removed the lesion surrounding the apex of the root. The root apex was resected and a retrograde root canal filling was placed using mineral trioxid aggregate (MTA+, Cerkamed, Stalowa Wola, Poland).\nThe area of the lesion was augmented using gentamicin impregnated BoneAlbumin (OrthoSera Dental Zrt., Gyor, Hungary). We seeked to lower the chance of osteomyelitis occuring with the use of gentamicin. Sutures were then carefully placed to achieve tensionfree closure of the flap for optimal healing.\nThe 19-year-old Caucasian woman is the daughter of the first patient. CBCT showed a radiolucent lesion around the root of the lower right incisor (Fig. ). She is presently asymptomatic after a one-year follow-up, but she occasionally felt tension and moderate pain in the right side of the mandibular region eradiating to her ear, approximately 2 years earlier. The symptoms had no dental background, and ceased gradually.\nPulp tests and periapical pathology diagnoses were made by authors on teeth 33,32,41,43 with the use of percussion, palpation and sensibility test.\nPanoramic radiograph and CBCT scans of the first patient showed radiolucent lesions located in the periapical bone, specifically on lower incisors and canines – in the premandibular, and in the right molar region of the mandible with radiopaque parts showing the lesions inside (Figs. and ). The affected teeth were asymptomatic, CBCT proved the presence of apical pathology. The buccal cortical involvement was discovered with the aid of CBCT, which also affected the treatment plan because 2D imaging methods provide no information on bucco-lingual dimension. Prior to the surgical intervention the use of CBCT was motivated by the fact that only 3D imaging could ascertain the precise shape, location and involvement of surrounding anatomical landmarks of the lesion.\nFigure shows the postoperative condition (Fig. ). At the 6-months periapical follow-up, the bone healing is being processed (Fig. ). 18 months later it can be seen on the CT image that the buccal cortical bone surrounding the root of tooth 43 has regenerated (Fig. ). In the case of the second patient, there were no notable changes in the radiographic status 1 year later, and she has no complaint at present.\nThe removed tissue pieces contained both connective tissue and calcified areas. In the calcified area, beside the irregular trabecular – lamellar bony formations, oval and globular cementum-like structures were present. In the non-calcified area connective tissue was found and connective tissue filled out the centre of another bony sample as well. No elements or remnants of a capsule were visible. The histological diagnosis was cemento-osseous dysplasia (Fig. ).
A 60-year-old man presented with sudden severe right shoulder and flank pain and numbness of the right hand. The patient had a history of working in his home garden every day. He had no subjective symptoms prior to the day of admission, and no past medical history other than hypertension, which was managed with medication. The patient called an ambulance 3 h after the onset of symptoms and was able to get into the ambulance unassisted. He was transported to a nearby hospital. At the hospital, he developed hemoptysis and hypoxemia with severe forced breathing and tachypnea. He was tracheally intubated and transferred to our emergency department by air ambulance helicopter 6 h after the onset of symptoms.\nOn examination in our emergency department, a coarse crackle with right lateral dominance was audible. A small volume of blood was continuously suctioned through the tracheal tube, although bronchoscopic examination did not reveal any source of bleeding. The patient’s blood pressure was 132/87 mmHg, pulse was 109 beats per minute and body temperature was 36.7 °C. He was mechanically ventilated with spontaneous breathing at a rate of 14 breaths per minute under sedation. No skin eruptions or lesions were observed.\nUpon examination of chest computed tomography (CT), we saw infiltration predominant in the right upper lobe and spreading to the right middle and lower lobe and left hilar area (Fig. ). Peripheral blood was collected for laboratory examination. Arterial blood gas analysis showed a pH of 7.174, with a partial pressure of carbon dioxide of 62.4 mmHg, a partial pressure of oxygen of 94.3 mmHg, a base deficit of − 7.4. under the condition of end-expiratory pressure at 10 cm H2O, and a fraction of inspired oxygen of 0.5, indicating acute respiratory failure. Other laboratory data were normal, including blood cell count, coagulation, and biochemistry, including inflammatory biomarkers, other than a slight elevation in serum creatinine level (1.37 mg/dL).\nElectrocardiography showed a sinus rate of 86 beats per minute, with an obvious ST segment elevation in the inferior leads. Echocardiography also showed severe hypokinesis of the cardiac inferior wall. The patient’s serum troponin T level was elevated (0.487 ng/mL).\nThe patient’s history was obtained from his family, and showed only hypertension. His current medications included enalapril, carvedilol, and amlodipine. He had no known allergies and no recent travel history. He did not smoke and there was no history of unusual ingestions. The Triage DOA® intoxication screening test result was negative.\nFrom the laboratory results and other tests, there were two contradictory clinical concerns: revascularization of the coronary artery and alveolar hemostasis. As the etiology of the alveolar hemorrhage was unknown, we were obliged to seek the pathogenesis under mechanical ventilation, with no obvious indicators for a hemostatic approach. Thus, after discussion, we decided to prioritize the revascularization of the coronary artery. After heparinization, coronary angiography confirmed 99% severe stenosis with a flow delay (thrombolysis in myocardial infarction grade 2 flow) of the mid right coronary artery at segment 2. Thrombus aspiration was performed, followed by implantation of a drug-eluting stent (DES). To minimize the bleeding risk, we delayed administration of antiplatelet drugs, aspirin and prasugrel, until the time of definite decision to implant the DES.\nNext, transcatheter arterial embolization was performed to treat the alveolar hemorrhage. Although we did not detect overt extravasation by angiography, we believed that the location of the hemorrhage was a branch of the right bronchial artery, which we embolized using a gelatin sponge. However, we were unable to control the alveolar hemorrhage, which increased and blew out from the tracheal tube, making it very difficult to maintain oxygenation and circulation. The patient died 12 h after the onset of symptoms. No antibiotics were administered during treatment.\nAutopsy was performed with the family’s consent immediately after the patient’s death.\nThe following day, additional laboratory blood exams revealed that negative for the anti-neutrophil cytoplasmic antibody, anti-nuclear antibody, and anti-glomerular basement membrane antibody. Levels of lung surfactant proteins A and D, as well as KL-6, were normal. Later, B. cereus was cultured from the sputum sample suctioned through the tracheal tube.\nImmunohistochemistry of B. cereus and real-time PCR for pXO1-like plasmid from lung tissue were performed to confirm that the bacterium was B. cereus and whether this bacterium produced anthrax-like toxin.\nThe lungs were fixed in 20% formalin for 24 h and embedded in paraffin, followed by pathological examination. B. cereus immunostaining was performed using anti-Bacillus cereus rabbit polyclonal antibody (Abcam, Cambridge, UK).\nNext, we performed DNA extraction and real-time PCR for B. anthracis toxin plasmid. Two pieces of 10 μm-thick Formalin fixed paraffin embedded (FFPE) sections were collected in Eppendorf tubes. DNA was extracted from these sections with the use of Nucleospin DNA FFPE XS kit (Macherey-Nagel, Düren, Germany), according to the manufacturer’s instruction. For detecting infection with B. cereus containing pXO1-like plasmid, lethal factor (LF) gene (Genbank M29081.1) and protective antigen gene (PAg) (Genbank AF268967.1) were amplified by real-time PCR. For amplifying LF, two primer sets were prepared.: LF1, 5′- CAGCTTTATGCACCGGAAGC-3′ (forward) and 5′- CGCTCCAGTGTTGATAGTGC-3′ (reverse), generating a product of 148 bp; and LF2, 5′- TCAGCTTAAGGAACATCCCACA -3′ (forward) and 5′- GCTTCCGGTGCATAAAGCTG-3′ (reverse), generating a product of 144 bp. PAg was amplified using the primers 5′- CAGGCTCGAACTGGAGTGAA -3′ (forward) and 5′- TCACTAGGATTAACCGCCGC -3′ (reverse), generating a product of 118 bp. PCR reactions were carried out in a 25-μL final volume containing 2 μL of sample DNA, 12.5 μl of 2× reaction mixture (QuantiTect SYBR Green PCR Kits; Qiagen, Hilden, Germany) and 0.2 μM primers. The real-time PCR was performed with Rotor Gene Q (Qiagen), with an initial holding step at 95 °C for 15 min, followed by 50 cycles of three-step PCR (94 °C for 15 s, 55 °C for 30 s, and 72 °C for 30 s) with SYBR Green fluorescence monitoring to detect amplification. The melting curve was examined to check for contamination. As a positive control, genomic DNA of Bacillus anthracis (JNBP01251) was provided by the Gifu Type Culture Collection, Graduate School of Medicine, Gifu University.\nHistologic sections of the lung, especially of the right upper lobe, demonstrated necrotizing hemorrhagic pneumonia similar to anthrax, with tremendous proliferation of gram-positive rods. The bacteria were diffusely gram-positive. Additionally, hemorrhagic diffuse alveolar damage within the hyaline membrane that was probably due to acute respiratory distress syndrome was also observed throughout the lungs. The bacteria reacted to the B. cereus antibody, and did not react to Pseudomonas aeruginosa and Escherichia coli antibodies. There was no infiltration of neutrophils. There was also no deposition of immunoglobulins or complements on the alveolar walls by immunofluorescence, excluding a diagnosis of vasculitis. B. cereus was also confirmed from the sputum culture. Therefore, B. cereus necrotizing pneumonia was confirmed pathologically (Fig. ).\nIn the real-time PCR, amplification was obtained in the positive control (B. anthracis DNA), but not in the patient sample or the negative control (no template).
An 81-year-old woman had a total hip arthroplasty for osteoarthritis of the hip joint at a different hospital. Her coagulation tests showed almost normal values. Activated partial thromboplastin time (APTT) was 37.7 sec, and prothrombin time international normalized ratio (PTINR) was 1.20. The implant was inserted using a posterolateral approach. The operation lasted 97 minutes, and the total bleeding during the operation was 520 grams. The patient experienced no problems with the surgery before leaving the operating room. In her hospital room at 3 hours postoperative, however, the outflow from the drain was 1290 grams, her blood pressure decreased, and she had disseminated intravascular coagulation (DIC). She was given a blood transfusion and was treated for DIC. After a few days, she recovered from the DIC, but she developed an infection on the prosthesis. Based on culture tests, she was diagnosed as having a pseudomonas infection. At this point, she was transferred to our hospital for treatment of the infection. In our hospital, we noted that her surgical wound appeared red and swollen. Her blood tests showed C-reactive protein at 7.5 mg/dL and a white blood cell count at 9.8 103/μ. Her coagulation tests did not show abnormal values with an activated partial thromboplastin time (APTT) at 31.2 sec and a prothrombin time international normalized ratio (PTINR) at 1.19. Since the infection continued and the risk of massive bleeding was low, we decided to remove the prosthesis to reduce the infection. At 41 days after the initial operation, a second operation was performed using a posterolateral approach (). The operation lasted 145 minutes and the total bleeding during the operation was 1000 grams. She received a blood transfusion of 2 units RCC-LR. When leaving the operating room, her blood pressure was 125 over 60 mmHg, her heart rate was 132 per minute, and she was conscious. Thirty minutes after arriving at her hospital room, she suddenly had low blood pressure. Her systolic blood pressure was 50 mmHg, the amount of lost blood in the drain bag was 400 grams, and blood oozed from the surgical wound through the bandage. In her hospital room, she received a blood transfusion of 2 units RCC-LR and 2 units fresh frozen plasma. At postoperative three hours, blood still oozed heavily from her surgical wound. Her systolic blood pressure was 70 mmHg and her heart rate was 150 per minutes. Her blood tests indicated that hemoglobin was 4.0 g/dL. In the function blood coagulation tests, APTT was 122 sec, PTINR was 2.77, and FDP was 228 μg/mL. Thus, she had disseminated intravascular coagulation (DIC) again. Because she had lost consciousness, we intubated her and used a mechanical ventilator. The next day, her hemoglobin was 9.2 g/dL and her blood platelet count was 8.9 104/μ. In the function blood coagulation tests, APTT was 45.8 sec, PTINR was 1.85, and FDP was 284.1 μg/mL. Her blood systolic pressure was 80 mmHg and her heart rate was 140 per minute. Since her condition did not improve, we gave her transfusions every day to stabilize her condition. However, we were not able to determine the cause of the bleeding based on her blood tests or on image diagnosis. At 44 days after the second operation, she resumed eating a normal diet since her general condition was improved. But the bleeding continued and the surgical wound was dehiscence and infected. By this time, she had received a total of 28 blood transfusions of RCC-LR, 8 units of fresh frozen plasma, and 20 units of platelet concentrate since the second operation. Unfortunately, we had not diagnosed the cause of the bleeding at this time. Because the surgical wound was dehiscence and the infection remained, we needed to perform a third operation on her. At 53 days after the second operation, we consulted a hematologist. He determined the cause of the bleeding as due to a decrease in coagulation factor XIII(13) and diagnosed her as having acquired coagulation factor XIII(13) deficiency. Her coagulation factor XIII(13) activity was 48% (normal value 70~140%). The treatment of acquired coagulation factor XIII(13) deficiency is replenishment of coagulation factor XIII(13) using fresh frozen plasma or a blood product. At day 65 after the second operation, we made plans for a third operation for irrigation and insertion of a cemented spacer mixed with antibiotics. As a countermeasure to the bleeding due to coagulation factor XIII(13) deficiency, we planned to give the blood product coagulation factor XIII(13) for five days after the surgery. At day 65 after the second operation, the third operation was performed using a posterolateral approach. The operation lasted 145 minutes, and the total bleeding during the operation was 470 grams. She had a blood transfusion of 4 units RCC-LR. When leaving the operation room, her blood pressure was 167 over 76 mmHg and her heart rate was 92 per minute. She was fully conscious. The amount of lost blood in the drain bag was 100 grams, and blood did not ooze from the wound through the bandage in the first 24 hours. Since the bleeding from the surgical wound was slight, we did not need to give an additional blood transfusion. Subsequently, she did not have low blood pressure and did not have signs of disseminated intravascular coagulation. In the third operation, no diastasis was noted in the surgical wound, and infection was absent. Her general condition stabilized, and she was transferred to the previous hospital for the next revision surgery. Unfortunately, a malignant tumor had developed in the pancreas and the planned surgery was cancelled.
A 35-year-old female patient reported to the clinic complaining of deviation of mandible to the left when closing her mouth and inability to bite properly, following mandibular surgery 18 months ago. Preoperative history and examination revealed that the patient was diagnosed with a follicular ameloblastoma involving the left side of the mandible. The patient had undergone surgical removal of the left half of mandible, i.e., segmental resection of the sub condylar region sparing the condyle and coronoid process to the midline. Postsurgical radiographs revealed no grafts were placed to reconstruct the defect, but the discontinuity of the mandible was restored using bone plate [].\nIntraoral examination revealed thick freely movable soft tissue scar formation, loss of alveolar ridge, and obliteration of buccal and lingual sulci on the left side. On opening, the mandible showed about 8-9 mm of deviation from midline toward the resected side due to the effect of normal right mandibular depressor muscle []. The patient was unable to achieve normal medio-lateral position of the mandible and repeat this position consistently for adequate mastication. On the basis of clinical and radiographic examination, the patient was classified as Class III (substantially compromised) according to prosthodontic diagnostic index resources for partial edentulous patients described by McGarry et al.[] No immediate treatment such as inter-maxillary fixation and/or physiotherapy program was provided to the patient.\nTherefore, dual purpose definitive metal guidance prosthesis was fabricated to provide the patient with proper function and esthetics and to re-educate the mandibular muscles into an acceptable occlusal relationship.\nA definitive cast partial denture with a metal guiding flange and acrylic teeth was planned. Fabrication began with the formation of suitable mandibular and maxillary casts. A wax interocclusal record was obtained by guiding the mandible into the best possible occlusal relationship. It was used to mount the diagnostic casts on a semi-adjustable articulator. The occlusal relationship of the casts was carefully examined. The diagnostic casts were surveyed and undercuts were blocked. The design of the partial denture framework was outlined to prevent the movement of the individual teeth.\nThe definitive mandibular guidance removable partial denture framework consisted of modified major connector i.e., lingual plate for the remaining anterior teeth and lingual bar for the posterior teeth, two embrasure clasps on posterior teeth on the nondefect side, and saddle type of minor connector []. The guide flange was extended 7-10 mm laterally and superiorly on the buccal aspects of the bicuspids and molars from the shoulder portion of the direct retainer on the nondefect side. This flange would engage the maxillary teeth during the mandibular closure, thereby directing the mandible into an appropriate intercuspal position.[] The angulations of the guiding ramp were fabricated using wax records of the posterior teeth with approximately 3 mm separation and mandible deflected maximally toward the un-resected side.\nIt was necessary to design a maxillary framework to prevent the maxillary teeth and gingiva from trauma when the patient closed her mouth. It also resisted the forces of arch contracture and maintained the maxillary teeth on the nondefect side in proper alignment until appropriate intercuspal position was achieved. The maxillary framework consisted of anteroposterior palatal strap and two Akers claps on right and left posterior teeth, respectively. After the designing, mouth preparation and final impression procedure, the partial denture framework was fabricated. The partial denture framework was verified in the mouth and adjusted using rouge and chloroform or disclosing wax [].\nAfter the metal framework try in, altered cast was made for the lower edentulous area. Following bite registration, casts were mounted onto a semi-adjustable articulator, and tooth set-up was carried out. Waxed removable partial denture was tried in and checked for occlusion and comfort in the patient mouth. The removable partial denture was processed in heat-polymerized acrylic resin (Dental Products of India, Mumbai, India) [] and checked for occlusion, the angle of the guiding flange and proper seating of the prostheses before the final insertion [].
A 40-year-old female presented with chronic headache with infrequent exacerbations. She presents with worsening headache for three months with associated vertigo, nausea, and vomiting not responding to analgesics or vestibular sedatives. Her symptoms initially started twelve years ago as a diffused mild headache, which persisted through the day. Gradually, the headache worsened to a severe headache episodically associated with vertigo, nausea, and vomiting. These episodes lasted for two to three days and got resolved. She was treated with flunarizine for suspected basilar migraine but did not show any response. From the last year, she had monthly exacerbations of headache associated with distressing vertigo, unsteadiness of gait, and right-sided body numbness. In between these episodes, she had a significant dull diffuse headache not responding to simple analgesia. She did not complain of fever or night sweats but had constitutional symptoms lasting for several months. All of these symptoms severely affected her daily activities and functionality.\nDuring the last 17 years, she had repeated episodes of neurological deficits. Even before the headache appeared, she has presented with visual impairment of the right eye and right lateral rectus palsy and was treated as retrobulbar neuritis with good response to methylprednisolone. One year later, she developed left-sided visual impairment, which fully responded to methylprednisolone. MRI imaging at that time revealed normal results. Few months after this event, she got admitted with right hemisensory loss with hemiplegia, and a demyelination disease or hemiplegic migraine was suspected. Second MRI was performed at this admission, and no abnormalities were detected again. Eight years ago, she had developed a left lower motor type facial nerve palsy, which was attributed to Bell's palsy. Within the last year, she was diagnosed to have depression and anxiety for which she was treated for few months. Other than the first two instances, she was not treated with steroids thereafter. She did not complain of weight loss and did not have constitutional symptoms or chest symptoms during these periods.\nOn examination, she is an averagely built female with a BMI of 23 kg/m2. She is afebrile, pale, and did not have lymphadenopathy. Her GCS was 15/15, and she was conscious and rational with normal pupillary response, visual acuity, visual field examination, and fundoscopy. There was no neck rigidity, and she had residual left lower motor VII palsy. She had an ataxic broad-based gait with unsteadiness. Upper and lower limb examination is clinically normal. Her respiratory, cardiovascular, and abdomen examinations were unremarkable.\nInvestigations revealed a hemoglobin count of 9 g/dL with normal white cells and platelets. ESR was elevated to 86 mm/1st hour. Renal- and liver-related biochemical investigations were normal with an alkaline phosphatase within the normal range. Initial MRI scans of the brain done 10 years ago did not reveal any abnormalities such as demyelination, optic nerve enhancement of focal lesions in the cerebrum, or cerebellum. CSF examination revealed an elevated protein level of 55 mg/dl with normal glucose and cells with negative oligoclonal bands or TB-PCR. Vasculitis investigations including ANA, ANCA (ELISA and Immunofluorescence), and RF were negative. Syphilis serology and HIV testing were also negative. Chest radiograph, ultrasound abdomen, and CT scan of chest and abdomen did not reveal any mediastinal lymphadenopathy or focal lesions in visceral organ or evidence of any malignancy. Serum ACE levels (19 µ/l) and ionized calcium levels were normal. We performed a new MRI scan of the brain with contrast, which revealed a diffuse and patchy meningeal thickening and enhancement mainly in the right frontoparietal and left occipital regions with a minor enhancement of bilateral optic sheaths (). Her NMO antibodies were normal, and the MRI did not show any areas of demyelination. Therefore, she underwent a dural biopsy from the thickened dura, which revealed large areas of caseous necrosis surrounded by epithelioid histiocytes and lymphoid cells with a few isolated giant cells in the adjacent vicinity (). There were no features of vasculitis or sarcoidosis. TB-PCR of tissue and acid-fast bacilli were negative. Final conclusion was necrotizing granulomatous inflammation suggestive of dural tuberculosis. This diagnosis was presumed by the presence of necrotizing granulomatous necrosis with caseation with a strongly positive Mantoux test of 25 mm (), and later was supported by a marked response to antituberculous medication.\nWe initiated her on antituberculous therapy (all four drugs for 3 months and 9 months of rifampicin and isoniazid) without streptomycin as she is already having vestibular symptoms. Steroids were added concurrently (1 mg/kg) and was continued for 6 weeks and was tailed off over a month. She experienced a marked improvement of her headache, and she could do her daily activities normally. After a year of anti-TB medication and follow-up, she did not complain of any worsening of symptoms.
A 56-year-old female patient from Tamil Nadu presented in October 2016 with generalized weakness, vomiting, and massive lymphedema of the left upper limb. She was in distress, unable to bear the weight of her arm, and was admitted in a cot with a specially designed contraption to rest her left upper limb weighing 31 kg. She had made a similar one at home for this purpose.\nHer history revealed that she had undergone modified radical mastectomy for carcinoma left breast in January 2002. Postoperatively, she underwent adjuvant chemotherapy and radiotherapy to her chest wall and axilla. She was seen in the Lymphedema Services of the Palliative Medicine Division and was taught the necessary precautions to be observed and exercises to be done. The risks involved in noncompliance were clearly communicated to her in her own language.\nSince June 2002, she developed edema of the left upper arm and pain in the anterior chest wall. She was on regular follow-up and was disease free. The size of the left upper limb increased progressively by the year 2012, along with pain. The pain was a concern for which she was forced to seek medical help and did get relief from local hospital close to her home. By February 2016, her affected arm measured 120 cm in circumference at elbow region. She was offered salvage surgery by several plastic surgeons necessitating 7 to 10 sittings. She declined the suggestions and continued her life as a hard-working homemaker. Married with two children, she never received support for her work or assistance for physiotherapy, and finally she neglected it. To supplement their family income, she worked as a full-time system analyst in a transport company where a customized table was made for her affected limb to rest and she used the affected hand to type. At home, she had similar contraptions to rest her arm while sitting and when on the bed. She used to climb stairs, dress, and cook all by herself.\nBy October 2016, she was at her wits end, reaching the dead end of endurance, and desperately wanted to get rid of her limb, and pleaded for the same, and this was the only means to improve her quality of life. She did not have any comorbidities and was scheduled for left shoulder disarticulation.\nShifting her to the theatre was a laborious process, and it necessitated two trolleys and a “team” to coordinate the process []. She was given uneventful general endotracheal anesthesia and interscalene brachial plexus block under ultrasound guidance []. Central venous pressure (CVP) was monitored in addition to standard ASA monitoring. Intravenous fluids were given to maintain CVP between 4 and 6 cm H2O. The intraoperative period was uneventful. The upper limb was completely removed through disarticulating at the left shoulder joint and it weighed 31 kg (40% of her initial weight).\nPostoperative analgesia was provided with a rather unique method. An elastomeric pump having a “Y-” shaped outlet tubing with two ports was used, each capable of delivering 1.04 ml/h 0.5% ropivacaine and administered to the brachial plexus (nerve sheath catheter analgesia) and the wound itself []. This infusion was continued for 5 days, and the patient was pain free throughout (mean numerical pain rating score 3). There was no requirement of additional analgesia. She was started on amitriptyline to preempt phantom limb pain. She was pain free and cheerful with a beaming smile during the postoperative period []. She was discharged on the 5th day. On follow-up 3 weeks later, the site had healed well by primary intention, with no stump or phantom pain and no phantom sensation either.
A 48-year-old male with a history of recurrent ulcers at the tip of his fingers for the past 3 years presented to his local ophthalmologist in North Bay, Ontario after noticing sudden onset vision loss in his right eye for 1 week. On exam, his visual acuity was recorded as 20/500 in the right eye and 20/20 in the left. Dilated fundus exam revealed an ischemic event of his right retina with cotton-wool spots but without any definite emboli. He was urgently sent to the emergency department for stroke workup. A CT scan of the brain was obtained, which showed no abnormalities. He was started on aspirin 81 mg po daily and subsequently referred to stroke prevention clinic and assessed by neurology. His blood work revealed a normal HbA1c and lipid panel. The only abnormality detected was mild macrocytosis, possibly secondary to alcohol intake. His carotid doppler scan was normal with no evidence of carotid artery stenosis. MRI imaging of the brain revealed only a small hyperintensity in the posterior cortex of the cerebellum that was confirmed to be an artifact on repeat single axial non 3-D FLAIR.\nOver the following months, he underwent extensive workup by internal medicine, dermatology, rheumatology and vascular surgery for his intermittent facial and upper extremity ulcerative lesions, which were worse in the winter time. He was also noted to have digital pitting and finger nail bed changes with dilated capillaries and dropout. Patient denied any Raynaud’s phenomena, with no noticeable skin colour changes when fingers were immersed in cold water. He also denied hematuria, renal disease, oral and genital ulcers. There was no previous history of scleritis, uveitis or symptoms suggestive of autoimmune disease. His social history was significant for cigarette smoking (½ - 1 pack per day; total of 20 pack/years) and daily alcohol intake (4–6 beers/day). There was no documented illicit drug use. The family history was significant for Raynaud’s disease, fibromyalgia and thyroid disease in his maternal aunt, and prostate cancer in his father.\nOn exam, no carotid, iliac, renal or femoral bruits, palpable purpura or tophaceous changes were appreciated. Blood pressure measurements showed no inter-arm difference or elevated systolic or diastolic pressure (100/80 right and 102/78 left, respectively). Laboratory investigations were significant only for decreased activated protein C and functional antithrombin III. Histologic analysis of his facial lesions revealed dermal telangiectasias, raising clinical suspicion of scleroderma. However, all immunological tests for rheumatic and vasculitic diseases were negative, including antinuclear antibody testing (× 3), anti-neutrophilic cytoplasmic autoantibodies (ANCA) and scleroderma-specific antibodies. A summary of all laboratory investigations conducted is provided in Table . Furthermore, computed tomography (CT) of the chest and abdomen with contrast showed no specific features of scleroderma or elements of CREST syndrome. Pulmonary functions tests were interpreted as normal with no evidence of chronic obstructive pulmonary disease (COPD) or restrictive lung disease. Upper limb arterial duplex scan showed abnormal photo-plethysomography in the upper extremity digits indicating possible small vessel occlusive disease and mild degree of reverse flow in the left ulnar artery. Repeat carotid doppler ultrasonography demonstrated normal peak systolic velocities with no evidence of any significant degree of carotid artery stenosis.\nIn light of all scleroderma/systemic sclerosis investigations being negative, a presumptive diagnosis of thromboangiitis obliterans with coagulation disorder (protein C and antithrombin III deficiency) was entertained. Patient was counselled on smoking cessation with the aid of varenicline and started on antihypertensive therapy amlopidine 2.5 mg po daily.\nA few months later and 1 year after the initial retinal ischemic event, the patient experienced sudden-onset severe vision loss in his left eye. He was assessed by his local ophthalmologist who noted a similar picture of ischemic retinopathy in the left eye without definite emboli. Patient was urgently referred to our tertiary eye care center in Ottawa for further evaluation. In view of his pro-thrombotic state and second retinal ischemic event, apixaban 5 mg po BID was prescribed by his internist and amlodipine was switched to nifedipine 30 mg po daily as an antihypertensive to enhance peripheral vascular blood flow. No prednisone was started given still the diagnostic concern over scleroderma and scleroderma-induced renal crisis.\nWhen examined by our service, visual acuity was counting fingers at 1 m in the right eye and 20/600 in the left eye. Intraocular pressures were 16 mmHg in both eyes. Slit lamp examination revealed no inflammation in the anterior chamber. Mild nuclear sclerotic cataract was present in both eyes. Dilated fundus examination showed significant retinal thinning in the macular region. Vascular loops were present with collateralization. A few nerve fiber layer infarcts were evident in the right eye along areas of occlusive retinopathy. Dot-blot and flame-shaped hemorrhages were noted in both eyes. The vessels showed arteriolar narrowing with venular dilation and sheathing (Fig. ).\nFluorescein angiography revealed early phase vessel wall staining involving veins and collateral arteries and mid/late phase leakage. The arm-retinal and arteriovenous transit times for the left eye were recorded as 16.8 s and 11.3 s, respectively. The foveal avascular zone (FAZ) was enlarged more in the right eye compared to left (Fig. ). Spectral domain optical coherence tomography (Spectralis OCT; Heidelberg Engineering, Heidelberg, Germany) imaging revealed areas of inner retinal atrophy with paracentral cystoid degeneration and edema in both eyes (Fig. ). Follow-up OCT imaging 3 months later showed no change in retinal thickness or cystoid degeneration morphology.
A 46-year-old male surgical pathologist presented to our clinic complaining of a 4-year history of increasing shortness of breath. He had been in good health until 20 years prior while in medical school, when he noted a pruritic, erythematous rash on the dorsal aspect of his hands whenever he wore latex gloves. He often applied steroid cream to the rash, but it usually did not resolve unless he refrained from using latex gloves. This rash, associated with latex glove use, persisted during his internal medicine residency. Approximately 14 years before presentation, at the beginning of his pathology residency, he noted that the rash involved his arms. He developed an episodic, nonproductive cough, wheezing, and occasional chest tightness, which occurred at work when he used powdered latex gloves. These symptoms were mild and did not interfere with his vigorous exercise program. He did not seek medical attention.\nAfter completing his residency, the patient worked as a hospital-based surgical pathologist. Typical daily activities involved cutting tissue and frozen sections and preparing slides. He changed gloves several times each day. He did reasonably well until 4 years before presentation (1993), when his symptoms worsened. He then experienced cough and dyspnea within 30 min of starting work. These symptoms, which continued throughout the workday and improved once he left work, seemed especially severe on the first day of the workweek and worsened as the week progressed. The use of xylene and formaldehyde exacerbated his symptoms. He noted an intermittent rash on his upper extremities and torso, occasional flushing with exposure to latex, postnasal drip, progressive dyspnea on exertion, and dyspnea and coughing when he laughed. He noted heavy breathing if he “flipped” his gloves off, and he described an episode of “passing out” 1 year earlier when he “flipped” his gloves off and placed his hands over his mouth and nose. He was taken to a local emergency department, where he was diagnosed as having had a vasovagal episode. He was returned to work without intervention.\nThe patient’s wife and co-workers started commenting on his cough, noting that he “breathed heavily.” He became self-conscious about his cough and about constantly having to clear his throat. There was no seasonal variation to his symptoms. The patient attempted to reduce his exposure to powdered natural rubber latex (NRL) gloves, formaldehyde, and xylene. For example, he switched to non-powdered latex gloves, although his co-workers continued to use the powdered form. He replaced eyecups on the microscope once he realized that they contained latex. He instructed his staff to allow an hour for drying slides fixed with formaldehyde and xylene before sending them to him to be read. His symptoms persisted, however, prompting him to seek medical attention.\nThe patient subsequently consulted with an allergist, an otorhinolaryngologist, and a dermatologist. Skin biopsy of his rash revealed changes consistent with acute urticaria. Latex skin prick tests were positive to latex glove extracts. Skin prick tests were positive to dust, cat dander, and mold antigens, and a computerized tomography (CT) scan of the sinuses revealed nasal polyps in the maxillary sinus. He was diagnosed with chronic sinusitis, asthma, and allergic rhinitis. Treatment included antibiotics and a steroid taper. The patient was started on Serevent (GlaxoSmithKline, Research Triangle Park, NC), Flovent (GlaxoSmithKline), and Proventil (Schering, Kenilworth, NJ) inhalers and returned to work with the recommendation that he use a surgical mask while at work. His symptoms continued to progress, and he presented to us 2 months later, by which time he was experiencing single-flight dyspnea.\nThe patient’s past medical history was remarkable for hypertension, nasal polyps, and near syncope. He denied any previous diagnosis of asthma, allergy, hives, or anaphylaxis. His family history was remarkable for asthma in a sister and a paternal uncle. He denied use of alcohol, cigarettes, or illegal drugs and denied allergies to medications or environmental substances. He gave a history of chest tightness when he ate fruit such as banana, avocado, and kiwi. His occupational history was remarkable for work in the medical field (). On physical examination, he was a well-nourished, well-developed white male in no acute distress whose vital signs were within normal limits. His examination was remarkable for a body mass index of 30, hyperemic conjunctivae, boggy nasal mucosa, an erythematous urticarial rash on his right shoulder, and diffuse expiratory wheezing.\nLaboratory evaluation revealed a normal electrocardiogram. Chest X ray showed poor inspiration; CT of the chest showed mild bronchial wall thickening consistent with mild airways disease; pulmonary function tests (PFTs) were remarkable for mild obstruction with acute bronchodilator response (); and a radioallergoimmuno-absorbent assay (RAST) test for latex IgE antibody was negative. His peak expiratory flow rate (PEFR) diary during an 11-day work period and a subsequent 6-day vacation period showed significant improvement (20% in the morning, 22% in the evening) while he was away from work () and progressive improvement during successive days of vacation ().\nThe provision of a latex-safe environment was explored with hospital administration and deemed not feasible at that time. A full-face dual-cartridge respirator was recommended and tried in consultation with a certified industrial hygienist. However, it interfered with the patient’s ability to communicate, and he was unable to tolerate wearing it for an 8-hr day. We felt that he was at risk for potentially fatal anaphylaxis, as well as irreversible and impending structural damage to his lungs, given his long history of exposure and disease severity. In order to eliminate exposure to NRL, the patient was removed from the work-place. He was advised to avoid contact with latex, carry injectable epinephrine, and wear a MedicAlert bracelet (MedicAlert Foundation International, Turlock, CA). Despite removal from the workplace shortly after presentation, the patient’s pulmonary status did not improve. He is maintained on steroids and immunosuppressive agents and has not been able to return to work as a surgical pathologist.
A 28-year-old Caucasian man living in London presented at a walk-in GP clinic reporting four episodes of hematospermia over 10 days. In the first three episodes, the patient reported the semen being brown in color. On the fourth episode, there were distinct streaks of red blood within the semen.\nThe man was heterosexual, and this was his first and only sexual partner. His partner had no history of sexually transmitted infections (STI). The couple was sexually active and using barrier method contraception for family planning reasons.\nThe patient was otherwise fit and well with no past medical history apart from mild childhood asthma. He had no headaches or changes in vision. He had no cardiac or respiratory symptoms. There was no history of recent trauma. There were no changes in urinary or bowel habits. He had no pain, fever, sweats, weight loss, or fatigue. He had not travelled abroad recently. The patient had never smoked or taken illicit substances. His diet was reasonably healthy, and he walked approximately 5 km a day. He consumed approximately 32 units of alcohol per week and recognized that this as in excess of medical guidelines. There was no family history of inheritable diseases.\nOn examination, he was comfortable at rest and clinically euvolemic. His abdomen was soft and nontender. His kidneys were not palpable. There were no renal bruits. There was no enlargement or masses in the scrotum. A digital rectal examination was normal with no enlargement or nodularity of the prostate. Respiratory examination revealed normal breath sounds. Examination of the central and peripheral nervous system was entirely normal.\nOn cardiovascular examination, heart sounds were normal. There was no peripheral edema, and the jugular venous pressure was not raised. There was no radio-femoral delay, and fundoscopy was normal. His blood pressure was note to be 228/135 mmHg, and his heart rate was 90 beats per minute and regular. Pulse volume and character were normal. His oxygen saturations were 98% on room air. There were no signs of acromegaly or Cushing's syndrome.\nUrinalysis was completely negative. His electrocardiogram (ECG) showed normal sinus rhythm. There was no left ventricular hypertrophy, axis deviation, or strain pattern.\nHis full blood count was as follows: hemoglobin 174 g/L, platelets 234 × 109/L, white blood count 5.9 × 109/L, and mean corpuscular volume was 85 fl. His CRP was <1 mg/L. His urea and electrolytes were sodium 142 mmol/L, potassium 4.3 mmol/L, urea 4.7 mmol/L, and creatinine 96 mmol/L. His estimated glomerular filtration rate was slightly reduced at 84 mL/min. His chest radiograph was normal. Ultrasound and computerized tomography of the urinary tract were normal.\nTwenty four-hour urinary metanephrines and a serum renin–aldosterone level were with normal range, ruling out pheochromocytoma and hyperaldosteronism as causes of hypertension, respectively. An echocardiogram was entirely normal. More specifically, there was no left ventricular hypertension nor diastolic dysfunction, which would be the expected findings in a case of chronic hypertensive heart disease.\nA diagnosis of hematospermia secondary to severe essential hypertension was made. There were no clinical signs of malignant hypertension. The absence of other urological symptoms made inflammation or infection of the urinary tract unlikely, and the lack of proteinuria or left ventricular hypertrophy on ECG implied that the hypertension was of recent rather than chronic onset.\nThe patient was treated with an angiotensin-converting enzyme inhibitor (ACE-i), per National Institute for Health and Care Excellence guidelines. A dosage of 2.5 mg of ramipril daily was sufficient to control his blood pressure.\nThe patient purchased a home blood pressure machine and monitors his blood pressure daily. His systolic pressure lowered steadily to an average of 165 mmHg. Normotension led to complete resolution of the hematospermia.
A 53-year-old Hispanic man with past medical history significant for coronary artery disease, habitual intravenous heroin abuse, chronic untreated hepatitis C without cirrhosis, bipolar disorder, tobacco abuse of 80 pack-year, and degenerative disc disease presented from home to our hospital with chief complaint of left scrotal pain, diffuse abdominal pain, back pain, and chest pain. Four days prior to presentation, he was seen in the emergency department for chronic back pain and was discharged with naproxen and instruction to follow up with his primary care physician. Since then, he developed acute onset of sharp constant pain of his left testicle and his abdomen. He admitted to using ten bags of heroin intravenously daily. He underwent an incision and drainage one month prior for a skin abscess. He reported no new sexual partner and is only sexually active with his current girlfriend. Family history was significant for heart disease in both his parents and maternal grandparents. His vital signs on admission were within the normal range. Physical exam revealed a man, with cachexia and temporal muscle wasting, in moderate distress from pain. He had jaundice with icteric sclera. His lungs were clear to auscultation. His heart sounds had regular rate and rhythm without any audible murmur. He had a soft abdomen that was mildly distended and tender in all four quadrants. His genitourinary exam was significant for bilateral scrotal erythema and swelling, which was worse on the left and was tender to light touch. He had diffuse tenderness to his back including paraspinal muscles, but no tenderness to the spinal processes. He was alert and oriented to person, time, and place and could answer questions appropriately. He had no facial asymmetry or deviated tongue, and he displayed normal proximal and distal strength. Laboratory findings were significant for WBC of 12.1 K/mm3 with a neutrophil predominance of 90%, microcytic anemia with hemoglobin 7.7 g/dL and MCV 75.6 fL, and thrombocytopenia of 47 K/mm3. His direct bilirubin level was elevated (3.0 mg/dL), as were his alkaline phosphatase (282 U/L), AST (87 U/L), ALT (33 U/L), and LDH (393 U/L). His albumin was 1.7 g/dL and lactic acid was normal at 1.2 mmol/L. His HIV-screening test was negative, as were his gonorrhea and chlamydia molecular amplification tests. He was subsequently admitted to internal medicine service/floor for further management.\nHis initial work up included a urinalysis that was significant for 10–20 RBC per HPF, 5–10 WBC per HPF, and positive urine nitrite; an EKG that showed normal sinus rhythm; and a chest X-ray which was negative for cardiomegaly, pleural effusions, or lung consolidations. A computed tomography (CT) of his head did not show any intracranial abnormalities. A CT of his abdomen and pelvis without contrast was performed which revealed hepatosplenomegaly with multiple large wedge-shaped areas of hypoperfusion in the spleen, concerning splenic infarctions (). The scrotal ultrasound showed no torsions, but revealed left epididymo-orchitis, large complex left scrotal hydrocele, and bilateral testicular microlithiasis. A limited bedside transthoracic echocardiogram by the emergency department physicians revealed a small pericardial effusion with no observable valvular vegetations. Blood and urine cultures were collected, and he was initially started on the broad-spectrum antibiotics of vancomycin, piperacillin-tazobactam, and azithromycin considering his risk factors and clinical presentation.\nOvernight, he remained afebrile, but his leukocytosis worsened to 14.6 K/mm3, and he developed dyspnea and tachypnea with 24 breaths per minute. He became disoriented and was not answering questions appropriately. On exam, new findings of splinter hemorrhages, toe infarctions, and subconjunctival hemorrhaging were noted. Urine culture grew Serratia marcescens 50,000–100,000 CFU. Blood cultures also later grew the same organism, susceptible to all tested antibiotics including amikacin, aztreonam, cefepime, ceftriaxone, ciprofloxacin, gentamicin, ertapenem, piperacillin/tazobactam, and trimethoprim/sulfamethoxazole. On hospital day 2, a formal transthoracic echocardiogram (TTE) revealed an ejection fraction of 60% (unchanged from three years prior) with a large echodensity on the aortic valve consistent with vegetation. Mild aortic regurgitation, mild mitral regurgitation, and mild tricuspid regurgitation were also noted. Antibiotics were subsequently changed toertapenem 1 g daily and ciprofloxacin 750 mg twice daily in consultation with infectious disease.\nThe patient continued to deteriorate the following day. He became more disoriented and agitated. He remained afebrile, but his tachypnea worsened to 30 breaths per minute, and new rales were now audible on lung auscultation. An arterial blood gas (pH 7.51; pCO2 21 mmHg; pO2 70 mmHg; HCO3 16 mmol/L; O2 saturation 93%) showed a respiratory alkalosis. A repeat chest X-ray showed new interstitial pulmonary edema and vascular congestion. A CT of the head without contrast was performed due to his altered mental status, which showed two areas concerning embolic infarcts in the left parietal lobe and the left cerebellum (), compared to the one obtained on admission. On hospital day 4, an urgent transesophageal echocardiogram (TEE) was performed which again demonstrated the large aortic valve vegetations (), but it now demonstrated acutely deteriorating moderate to severe aortic regurgitation, which was different from the TTE findings a few days prior that only showed mild-moderate aortic insufficiency. In addition, it also revealed a mildly dilated left ventricle. The aortic valve leaflet had prolapsed motion. Due to the presence of large aortic valve vegetations, multiple embolic phenomena, and a progressively worsening of his clinical condition, decision was made to perform an urgent aortic valve replacement.\nPostoperatively, he was managed in the surgical intensive care unit, where he developed a moderate-sized left pneumothorax requiring a chest tube placement. Slowly, his mental and clinical status began to improve. By hospital day 19, the patient was no longer agitated or disoriented. He displayed good appetite, and his chest tube was removed. His leukocytosis significantly improved to 8.0 K/mm3, and his repeat blood cultures did not grow any organisms for 5 days. Throughout his hospital course, he remained afebrile and did not receive any antipyretics. The lack of fever was concerning for an immunocompromised state, but he tested negative for HIV. He was ultimately discharged to a skilled nursing facility to complete his antibiotics, ertapenem 1 g daily with ciprofloxacin 750 mg twice daily, for a total course of 6 weeks, and to continue physical therapy.
A 68-year-old, right-handed male presented to his primary care physician with several months of gradually progressive cognitive changes, gait disturbance, and headache. Magnetic resonance imaging (MRI) of the brain revealed a heterogenously enhancing lesion in the anteromesial right frontal lobe which was associated with significant edema [Figure and ]. The patient was immediately referred for neurosurgical evaluation.\nThe patient’s past medical history was considered closely. The patient was diagnosed with a plasmacytoma of the left frontal skull 8 years prior to this presentation and was initially treated with radiation therapy to this isolated lesion. This treatment took place at an outside institution and involved conventional external beam radiation using a 20 MeV electron beam. The initial radiation treatment was delivered with a 10 cm × 10 cm cone, at 100 SSD, with the beam positioned perpendicular to the left frontal scalp and with a 0.5 cm wet bolus. The patient received 2.5 Gy per fraction for 7 fractions, followed by decreased dose of 2.0 Gy per fraction for additional 11 fractions. The total cumulative dose to this treatment field was 39.5 Gy. The treatment field was then coned down to 6 cm × 6 cm, with three more fractions of radiation treatment at 2.0 Gy per fraction. The total accumulated dose to the boost field was thus 45.5 Gy.\nShortly after the conclusion of radiation therapy, the patient developed additional sites of systemic disease and underwent an autologous stem cell transplant for multiple myeloma. He remained disease-free since that time and was treated with chronic immunosuppressive agents to prevent rejection.\nUpon neurosurgical evaluation, a radiographic differential diagnosis was formulated and included high-grade glioma, metastasis, abscess, radiation-induced malignancy, and radiation necrosis. Radiation necrosis was considered a relatively unlikely diagnosis due to the timing of the presentation. Additionally, the reported total radiation dose to the brain parenchyma was low and was divided into numerous small fractions and the plasmacytoma targeted with radiation was contralateral to the new intrinsic lesion. However, the detailed radiation plan from the original treating facility was destroyed, and without the ability to review this document, treatment error was considered possible. The use of additional imaging modalities such as MR spectroscopy or FDG-Positron Emission Topography (PET) was considered, but these results were considered unlikely to change the treatment recommendations. After a discussion with the patient and his family, the decision was made to proceed with a craniotomy for pathologic diagnosis and relief of mass effect without further preoperative workup.\nShortly after referral, the patient underwent a right frontal craniotomy for resection of the mass lesion. Frameless stereotaxy was used to localize the lesion which was resected with conventional microsurgical techniques. The lesion was noted to be firm and white and extended medially to the pial border of the interhemispheric fissure. A large central portion was delivered in its entirety and sent to neuropathology for frozen and permanent section. The frozen section was notable for hyalinized blood vessels, calcification, and an absence of gross cellular atypia. With a pathologic impression favoring radiation necrosis, the craniotomy was completed with a goal of internal debulking of the lesion for relief of mass effect.\nThe entire specimen, consisting of large fragments of tissue measuring approximately 4 cm in aggregate, was submitted for microscopic examination. This showed extensive bland, granular, coagulative necrosis, with smaller areas of viable, reactive brain tissue [Figure –]. Areas of necrosis contained hyalinized blood vessels [] and coarse calcium deposits []. Few macrophages were present. Viable brain tissue was gliotic but only modestly hypercellular, with moderately atypical cells [] and benign, perivascular chronic inflammation. Focal capillary proliferation resembling a telangiectasia was present. There was no evidence of malignancy or infection. A diagnosis of radiation-induced necrosis was made.\nPostoperatively, the patient returned to his neurologic baseline. A postoperative MRI demonstrated near-total resection of the lesion with some residual nodular enhancement. After a fall from standing, the patient developed a wound complication requiring exploration on postoperative day 2, in which a subgaleal hematoma was identified and evacuated. He subsequently recovered well and was discharged to a rehabilitation facility several days later.\nSince his craniotomy and diagnosis, the patient has been followed for 18 months. Follow-up MRI studies have demonstrated continued evolution of this process with initial extension of edema to involve the bilateral frontal lobes []. This correlated with increased symptoms of poor balance and cognitive difficulties and was managed with oral steroids. Alternative treatment strategies including anticoagulation were considered but not employed due to contraindications related to the patient’s systemic illness. At 1 year follow-up, imaging studies revealed stabilization of edema and decreased enhancement []. The patient’s clinical status has continued to improve and he remains functionally independent.
A 76-year-old man with a past medical history of hypertension, coronary artery disease (focal stenosis of the first obtuse marginal branch, which was medically treated), and non-tuberculous mycobacterial left lung infection complicated by chronic severe left bronchiectasis necessitating a left pneumonectomy was referred to our institution for the management of symptomatic persistent AF. He was first diagnosed with persistent AF about a year prior and required cardioversion to normal sinus rhythm. He remained in normal sinus rhythm for about six months, followed by recurrence of AF. At that time, he was started on sotalol therapy, which was discontinued due to excessive fatigue. He was not a candidate for amiodarone or other anti-arrhythmic drugs due to his chronic non-tubercular mycobacterial lung infection and potential drug interactions, notably QT prolongation, with his chronic antibiotic therapy. Therefore, the decision was made to proceed with AF ablation.\nAs part of routine pre-procedural planning, the patient underwent contrast computed tomography (CT) imaging of the heart, which excluded an intracardiac thrombus ( and demonstrated a left mediastinal shift due to his pneumonectomy (. Intracardiac echocardiography (ICE) was also performed to help define the anatomy of the interatrial septum and guide transseptal puncture. Transseptal puncture was more challenging in this patient due to the rotation of the heart, but imaging helped to overcome this challenge. Pre-interventional imaging also helped define the PV anatomy. The patient had a remnant left common PV stump as a result of his history of left pneumonectomy and two widely patent right-sided PVs. The length of the left common PV stump was noted to be around 30 mm. The size of the veins is given in . Anchoring the CBA catheter in the PV stump can be difficult if the length of the pulmonary stump is short. After carefully reviewing the anatomy, it was concluded that the length of the left common PV remnant was sufficient to attempt CBA.\nFor the CBA, the patient was placed under general anesthesia and an esophageal temperature probe was inserted for close monitoring. We first performed voltage mapping of the left atrium using the PentaRay® mapping catheter (Biosense Webster, Diamond Bar, CA, USA) and the CARTO® electroanatomic mapping system (Boston Scientific, Natick, MA, USA). The latter demonstrated electrical activity in the left common PV stump and the two right-sided PVs (. We then advanced the Achieve catheter (Medtronic, Minneapolis, MN, USA) to the left common PV stump. Thereafter, we were able to successfully occlude the left common PV stump using a 28-mm Arctic Front™/Achieve cryoballoon catheter system (Medtronic) and achieve electrical isolation. Then, we successfully performed CBA of the right-sided veins while monitoring the phrenic nerve function. Each of the PVs was frozen once if isolation was seen by 30 seconds, and, if not seen, the veins were frozen twice. Local temperature, esophageal temperature, time to −30°, and thawing were monitored during each isolation procedure. Post-CBA, voltage mapping of the left atrium demonstrated isolation of all three PVs (. He was in normal sinus rhythm after the procedure and was discharged home. Unfortunately, at the one-month follow-up visit, he was found to have recurrence of AF. The patient was unable to tolerate atrioventricular (AV) nodal blocking agents due to hypotension, and anti-arrhythmic drugs were contraindicated due to harmful interactions with chronic antibiotic therapy for non-tubercular mycobacterial infection. After patient-centered discussion, he was treated with an AV node ablation and permanent pacemaker implantation.
A 68-year-old man presented to us with complaints of a recurring cough and occasional blood-streaked sputum. The problem started after a dental procedure during which he had a choking episode and aspirated a dental drill, which was being used for a root canal treatment. He denied any fever, chest pain, or shortness of breath. He had no other medical problems of note beside the above. Clinical examination was essentially normal. The patient had brought with him an X-ray of the chest, which was normal, and CECT of the thorax with reconstructions in which the slender metallic FB was seen lodged in one of the basal sub-segments of the left lower lobe [Figures –]. A decision for bronchoscopic extraction was taken. After obtaining informed consent the patient was taken up for fiberoptic bronchoscopy under conscious sedation.\nA bronchoscopy for evaluation was done with a videobronchoscope, outer diameter 5.8 mm, under conscious sedation with intravenous midazolam. The trachea-bronchial tree was largely normal except for the left lower lobe lateral basal segment, where the tip of the FB, a dental drill, was seen pointing straight up. The plastic blunt end of the drill was lying distally embedded in the subsegmental bronchus. An attempt was made to hold this metallic sharp end with a rat tooth forceps but failed. Then, a snare was coiled around the tip, but it slipped through on account of it being too thin. A magnetic tip probe for extraction of metallic FBs also failed to pull out the FB. Finally, a thin fogarty catheter was pushed from the side of the FB with the intention of inserting it distal to the FB, inflating the balloon and then pulling it up to dislodge the FB. However, this attempt resulted in the FB getting pushed in with the catheter and then slipping out of sight into the distal subsegment.\nThe video bronchoscope was pulled out and in its place a thin pediatric fiberoptic bronchoscope, outer diameter 3.2 mm, was inserted. The FB was again located further down in the bronchial tree in a fourth order basal subsegment []. A thin dormia basket was inserted through the working channel of this bronchoscope to snare the FB. This attempt also failed because the distal end of the FB was impacted in the bronchus and, therefore, did not allow the dormia basket to open alongside. Taking into account the failure of the various instruments to extract the FB it was decided to attempt extraction with the rigid bronchoscope. The patient and the family were informed and counseled about the failure of the procedure so far, the need for rigid bronchoscopy under general anesthesia, and the possibility of needing surgery in case the rigid bronchoscopy also failed.\nThe next day the procedure was undertaken in the operation theater under general anesthesia. Initially, a 7.5 mm outer diameter, 43 cm barrel, rigid bronchoscope was inserted up to the left main bronchus. A zero degree Hopkins telescope was passed through it for visualizing the FB. However to our dismay, we found that the tip of the Hopkins telescope was too thick to enter the subsegment, and the FB could not be seen. Furthermore, the outer barrel of the rigid bronchoscope after entering the left main bronchus was at such an angle that maneuvering the Hopkins telescope towards the segment of interest was very difficult. The situation demanded that a short bronchoscope barrel be inserted only up to the proximal part of the left main bronchus so as not to restrict the maneuverability of the extraction instruments. Then a long thin telescope had to be passed through it to reach the FB and extract it with an optical forceps under vision.\nFor this purpose, a 5.5 mm outer diameter, 30 cm barrel, pediatric rigid bronchoscope was inserted just inside the left main bronchus. Since the adult Hopkins telescope was too thick and the pediatric telescope too short to reach the left lower lobe, a ureteroscope 6F, 3 mm outer diameter, length 45 cm, was selected to extract the FB. To our delight, this telescope indeed could be passed and maneuvered into the left lower lobe subsegment, and the FB glimpsed. However, another challenge confronted us. The flimsy bronchial walls of these narrow sub-segments, collapsed around the telescope making insertion and visualization difficult. Fortunately, this was averted with the jet venturi system connected to the rigid bronchoscope by which frequent, high velocity bursts of oxygen enriched air helped to keep the distal airway open and keep the tip of the FB in view. Finally, the FB could be extracted under vision with a tri-pronged 3F forceps passed through the ureteroscope. This prong is normally used for extracting stones from urinary passage, but here it served admirably to extract this sharp metallic FB from an almost inaccessible location [].\nA postprocedure check fiberoptic bronchoscopy revealed a normal bronchial tree. The patient remained well on follow-up with complete recovery of the symptoms.
A 31-year-old gravida 4 para 0 African American woman at 22-weeks gestation presented with vaginal bleeding to an outside hospital. Her obstetric history was significant for 2 therapeutic abortions and 1 spontaneous abortion. During prenatal care, the fetus was noted to have a unilateral dysplastic kidney. The patient’s family history was significant for two family members with cervical cancer and two family members with endometrial cancer. She was placed on bedrest with inpatient admission. 48 h after admission she developed pelvic pain and uterine contractions. She expelled a mass vaginally measuring 11 × 9 × 5 cm with no fetal contents. The pathology from the outside facility showed a showed a highly cellular tumor composed of spindle-shaped cells and bizarre multinucleated giant cells with focal myxomatous change with mitotic count is greater than 50 per 10 high power field (Positive for CD10, SMA, ER, PR, EMA) with the differential diagnosis including endometrial stromal sarcoma and undifferentiated uterine sarcoma. The patient underwent examination under anesthesia, demonstrating a 3 × 3 cm defect of the posterior vaginal wall with active bleeding, which was sutured for hemostasis. The cervix was long, closed, and high with no evidence of bleeding and the fetus was intact with normal heart tones. She was discharged in stable condition.\nAt 27-weeks, the patient was referred to our institution for maternal-fetal medicine, and gynecology oncology consultation. On initial evaluation, she reported no prior abnormal gynecology history and no history of infertility issues. She denied dyspareunia and bulk symptoms prior to or during pregnancy, and her periods before pregnancy were normal. A pap smear at 27-weeks gestation was normal and negative for human papilloma virus. Her intake physical exam at our institution revealed a normal pelvic exam with no evidence of residual vaginal mass, and an ultrasound revealed no intrauterine myomas.\nGiven the differential diagnosis included an endometrial stromal sarcoma, an undifferentiated uterine sarcoma, and a primary vaginal sarcoma, the patient underwent magnetic resonance imaging (MRI) without contrast of the chest, abdomen, and pelvis at 27 weeks. MRI findings were notable for a peri-centimeter cyst in the cervix consistent with a Nabothian cyst, a multiloculated cystic structure in the fetal abdomen consistent with dysplastic kidney, and an anterior placenta. There was no evidence of metastatic disease.\nDue to the inability to ascertain whether the cancer had originated in the uterus, cervix or vagina, the patient desired definitive management for possible uterine sarcoma. In consultation with maternal fetal medicine and gynecology oncology specialists, the decision was made to proceed with a cesarean hysterectomy at 36 weeks. Betamethasone 12 mg intramuscularly was given for two doses 24 h apart with the first dose at 35 weeks and 6 days gestational age.\nAt 36 weeks and 1 day, she underwent planned exam under anesthesia of the vaginal canal with cesarean hysterectomy, bilateral salpingectomy, and peritoneal biopsies. She delivered a male infant weighing 2520 g with Apgars of 9 and 9. Operative findings were notable for normal appearing pelvic organs. There were no palpable or visibly enlarged pelvic/periaortic lymph nodes or evidence of metastatic disease throughout the peritoneal cavity. The neonate was admitted to the NICU post-delivery for prematurity. Neonatal US confirmed a right multi-cystic dysplastic kidney. He was transferred out of NICU on day 2 of life, and discharged home with his mother.\nThe final surgical pathology report was benign: no malignant or neoplastic cells were seen. The patient was seen at her 6-week postpartum visit and was doing well with a normal pelvic exam. At a follow-up surveillance visit 3 months postpartum, she was noted to have a 1 cm posterior vaginal wall lesion; biopsy results showed a high-grade sarcoma. The tumor was estrogen receptor and progesterone receptor positive. Computer tomography (CT) with contrast of the chest, abdomen, and pelvis showed no evidence of metastatic disease. The patient underwent an upper vaginectomy and proctoscopy. Operative findings were notable for 1.5 cm polypoid lesion in the posterior vagina wall 5 cm distal to the posterior vaginal apex. A 1 cm surgical margin was obtained circumferentially around this lesion where feasible, and surgical pathology showed high-grade sarcoma () of the polyp lesion with negative surgical margins. The tissue removed from this excision showed residual sarcoma, morphologically similar to the original pathology from the outside hospital pathology. All other vaginal biopsies were also negative for malignancy. Marker seeds were placed in the proximal and distal margins of the areas where the sarcoma was excised. She was treated adjuvant high dose rate vaginal brachytherapy using a multi-channel vaginal cylinder. She received a biologically equivalent 2 Gy dose (EQD2) of 45 Gy to the whole length of the vagina and 60 Gy to the post-operative bed (). A CT scan 36 months after surgery continue to show no evidence of disease. She remains disease free 58 months after completion of vaginal brachytherapy.
A 52-year-old female with a history of admission to the hospital 5 times in the last 5 years because of frequent hypoglycemic attacks was admitted to our hospital.\nAt the age of 36, her urine examination showed excessive glucose levels but she did not receive further medical treatment. The following year, she consulted a doctor due to general malaise and bilateral lower leg edema. She was then diagnosed with diabetes mellitus and hypoalbuminemia of unknown cause. Glibenclamide was administered for the treatment of diabetes at age of 40, but poor control persisted. She was referred to our hospital for the first time at the age of 43 because of exacerbation of her lower leg edema. Protein-losing gastroenteropathy (PLGE) due to idiopathic gastrointestinal lymphangiectasia was diagnosed by functional and histopathological examinations. She had been treated with elemental diet and steroid therapy for her PLGE, but those treatments were not effective. At the same time, insulin therapy was started because of the poorly controlled diabetes (HbA1c, approximately 10%). After the age of 47, her average blood glucose levels were keeping consistently high (300 to 400 mg/dL) and even hypoglycemic attacks had been recognized. When she was hospitalized at the age of 48, the cause of the hypoglycemic attacks was unidentified (2004). Around the age of 50, the frequency of hypoglycemic attacks (defined as blood glucose level less than 70 mg/dL) had increased to about 40 times per month. The attacks occurred at postprandial and preprandial times. Her medication history suggested that hypoglycemia was not related to her insulin therapy. Precise examination of hypoglycemia was performed during the current hospitalization at the age of 52.\nOn admission, her body height was 137 cm and body weight was 44 kg (BMI, 23.4 kg/m2). Blood pressure was 128/78 mmHg and heart rate was 87. Physical examination revealed bilateral lower leg pitting edema, no Achilles tendon reflexes, and reduced sensation of vibration (C128 Hz, 4 s (rt.)/4 s (lt.)). Chest X-ray revealed no pleural effusions and no cardiomegaly. Diabetic complications were confirmed, that is, bilateral proliferative retinopathy, nephropathy (stage 2), and peripheral neuropathy. She was treated with a combination of rapid-acting and NPH insulin injection for her diabetes. The results of laboratory tests were as follows: total protein: 4.0 g/dL; serum albumin: 2.3 g/dL; total cholesterol: 172 mg/dL; triglyceride: 104 mg/dL; HDL-c: 47.4 mg/dL; LDL-c: 116.7 mg/dL; creatinine: 0.49 mg/dL; HbA1c: 15.5%; urinary C-peptide: 125 μg/day; anti-GAD and anti-IA-2 antibodies: negative; urinary microalbumin: 73.8 mg/g·Cre; creatinine clearance: 109.4 mL/min/m2. Blood glucose profiles appeared unstable, with periodic (2 to 3 days) alternation between hyperglycemia (>300 mg/dL) and hypoglycemia (<70 mg/dL). Representative blood glucose profiles are shown in , and the frequency of hypoglycemia is shown in . A glucagon loading/stimulation test revealed that the ability of insulin secretion was retained (ΔCPR = 4.8 ng/mL). No abnormalities were found in other endocrine hormones.\nBecause the hypoglycemic attacks occurred at a time after cessation of insulin injections sufficiently longer than the effective time of the insulin, we were convinced that hypoglycemia was not related to the injections. Therefore, we suspected that it was induced by an endogenous cause. The result of a fasting test was positive (). After a 17 h fast, hypoglycemia (plasma glucose 45 mg/dL) appeared and serum insulin concentration was 9.92 μU/mL (normal, <6.0), C-peptide level was 0.98 ng/mL (<0.6), and proinsulin level was 15.3 pmol/L (<5.0). Service's and Turner's criteria for diagnosing insulinoma were satisfied (Grunt 4.54 (positive, <2.5), Fajans 0.22 (>0.3), Turner 66.1 (>50), and Service 9.92 (>6)). Serum C-peptide and proinsulin levels at the time of hypoglycemia attack were significantly high, and the values satisfied the criteria for hyperinsulinism defined by Service []. Also, the proinsulin level was above 5 pmol/L, and this parameter and threshold level have been reported as the best criteria for diagnosis of endogenous hyperinsulinism during the fasting test []. Counterregulatory response to hypoglycemia was not impaired; before and at the time of hypoglycemia, testing showed the following respective levels: glucagon 150 pg/mL and 230 pg/mL; cortisol 6.09 μg/dL and 27.45 μg/dL; growth hormone 0.33 ng/mL and 11.70 ng/mL; adrenaline <10 pg/mL and 583 pg/mL. Tests for both anti-insulin antibody and anti-insulin receptor antibody were negative. We excluded the specific hypoglycemic conditions induced by medicines, insulin autoimmunity, factitious hypoglycemia, and other conditions/diseases such as renal failure or liver cirrhosis. We did not measure plasma sulfonylurea concentration as we were aware that the patient had not been taking the medicine. To investigate the possible involvement of glucose-dependent insulinotropic polypeptide (GIP) or glucagon-like peptide 1 (GLP-1) in the hypoglycemia, we measured serum concentrations of total GIP (Human GIP Assay Kit, Immuno-Biological Laboratories, Fujioka, Japan) and total GLP-1 (YK160 GLP-1 EIA Kit, Yanaihara Institute, Fujinomiya, Japan) by enzyme-linked immunosorbent assays in her fasting, postprandial, and hypoglycemic state. Serum concentrations of total GIP were 7.6, 30.2, and 6.0 pg/mL, whereas those of total GLP-1 were 4.7, 4.2, and 4.1 ng/mL in fasting, postprandial, and hypoglycemic state, respectively. Taken together, these results suggested that inappropriate endogenous hyperinsulinemia was responsible for her hypoglycemia, possibly due to insulinoma, nesidioblastosis, or β cell dysfunction.\nThus far, all efforts for obtaining diagnostic imaging of an insulinoma via CT scan, MRI scan, and endoscopic ultrasound were unsuccessful. SACI tests with calcium gluconate (Ca2+ 0.025 mEq/kg) were performed twice in 2004 (age 48) and 2008 (age 52). In keeping with other researchers, an increment in plasma immunoreactive insulin levels greater than 2-fold over prestimulation levels was considered indicative of a tumor or other responsive lesion in the vascular territory of the artery studied []. The results, confirmed twice, were positive only after stimulations of the supramesenteric artery (SMA) (2.53-fold increase in 2004 and 3.36 in 2008 versus before stimulation; Figures and , resp.). No anatomical variant was apparent on review of the angiogram, but there seemed to be backflow slightly in the gastroduodenal artery (GDA) on the examination only in 2008. Exploratory laparotomy was refused by the patient and her family.\nSince she had been suffering mostly from frequent hypoglycemic attacks, we focused primarily on the management of hypoglycemia by medication. We considered the use of octreotide (Sandostatin, Novartis, Basel, Switzerland), a long-acting somatostatin analog, because this medicine suppresses insulin secretion [] and has been reported to be effective for PLGE due to idiopathic gastrointestinal lymphangiectasia []. At first, we tried a single dose (50 μg) of octreotide to evaluate its effects on serum insulin and glucose levels (). As we observed no remarkable changes in glucose levels and suppression of insulin levels, we started her on octreotide (50 μg, twice a day) for 2 weeks, monitoring its tolerability. Since almost no side effects except for controllable constipation were determined, we switched to octreotide LAR (Sandostatin LAR, Novartis, 20 mg per month), which is a very long-acting octreotide. After using octreotide LAR for 4 months, although hyperglycemia was uncontrollable even with multiple insulin injections (), the frequency of hypoglycemic attacks was surprisingly reduced (). This effect was sustained for 20 months until her death from acute heart failure (54 years, 2010). On the other hand, serum albumin was slightly increased (2.3 g/dL and 3.0 g/dL; before and after treatment, resp.), but her leg edema was unchanged.
A 66-year-old woman with severe AD complicated by oral dyskinesia was referred for dental treatment by her neurologist. She was unable to eat any solid food because of limited mobility of her maxillary teeth as a result of severe periodontitis. Because of her oral condition and subsequent lack of food, her body weight had decreased by ~5 kg within 2 months. Her husband was concerned for her health and hoped that her oral function would improve with the extraction of her diseased teeth and replacement with a removable denture. Written informed consent was obtained from the patient's husband for publication of this case report following the Ethical Guidelines of Kyushu University Hospital.\nHer medical history revealed that she developed severe AD in 2004. Her medical condition suddenly worsened in 2006, resulting in severe cognitive impairment. Since 2011, she has been medicated with NMDA inhibitors and cholinesterase inhibitors. She has continued to receive regular medical treatment.\nHer dental history revealed that she routinely visited a local dental office for oral care and maintenance until July 2012. Her family dentist recommended extraction of all her remaining maxillary teeth and asked her husband to consent to extractions under IVS in hospital because of the difficulty of conducting the dental procedure while she was awake. The patient's neurologist wrote a referral for her, and her husband brought her to our department, the Special Patient Oral Care Unit, Kyushu University Hospital, in October 2012. When she presented at our department, she exhibited typical features of AD, such as aphasia, gait apraxia, and disorientation. Her height and weight were 151 cm and 46 kg, respectively. Her serum albumin was 3.8 g/dL. She could not walk by herself and needed her husband's assistance. Her cognitive function and activities of daily living using the functional independence measure [] were 26 points (maximum possible score: 126, minimum possible score: 18). She frequently vocalized meaningless words and could not speak any meaningful words or understand any of our instructions. As she could not sit still, it was impossible to take X-ray images of her teeth. We were able to see and touch inside her mouth only when her husband held her face and opened her mouth gently in semi-Fowler's position. If we tried to insert any instrument into her mouth by ourselves, she brushed our hands away. With her husband's help, we were able to briefly assess her oral condition and established the necessity for multiple extractions of her remaining maxillary teeth and fabrication of a complete denture. We initially planned to take impression before extraction to maintain her original maxilla-mandibular horizontal relationship under IVS. However, this was not possible as the horizontal position had collapsed from severe lateral mobility of the metal bridge between 13 and 17. To avoid accidents and the need for restraint and to maintain the patient's dignity during dental treatment, we decided to use IVS for oral examination and dental management, with the approval of her husband. In addition, her medical doctor checked her general health and approved the use of IVS.\nOn the first day of her dental treatment, we planned to undertake a complete examination, tooth scaling, multiple tooth extractions, and an impression for her denture under IVS. The IVS procedure involved initial administration of 4 mg midazolam, and once the patient was drowsy, we added propofol for maintenance. Under IVS, we first took X-rays and checked the probing depth and mobility of the remaining teeth. We observed severe periodontitis of all maxillary teeth (12, 13, 15, 17, 21, 22, and 23) and moderate periodontitis of all mandibular teeth (). We scaled the teeth and subsequently extracted the maxillary teeth. All sockets were sutured using bioabsorbable thread. Using alginate in a custom impression tray, we took impressions of the maxillary arch and the opposing mandibular teeth for a complete maxillary denture. We finished the dental treatment after confirming that there was no bleeding from the sockets. The duration of the dental treatment was 57 min, and the duration of the anesthesia was 1 h and 20 min. In total, 49 mg of propofol was used. There were no perioperative complications.\nTo help stop bleeding and as an imitation trial of the complete denture, we made a temporary base plate that covered her maxilla with tray resin and a plaster model, which duplicated for her teeth impression for the denture until recovery from IVS. After recovery from IVS, we tried fitting the base plate and relined with tissue conditioner. Surprisingly, she easily accepted it. Following this success, we sought to fabricate a new complete denture, as requested by her husband.\nOne day after extraction, there was no bleeding inside the patient's mouth, and she was still wearing the base plate without any signs of refusal. We removed the temporary base plate, checked to ensure that there was indeed no bleeding, washed her sockets with saline, and then refitted the base plate to her maxilla. We provided her husband with instructions for care, which included removing and washing the base plate after every meal and before the patient went to sleep. This was done as training before use of the complete denture.\nOne week after the extractions, we attempted to take a bite using Willis's method in semi-Fowler's position, opening the patient's mouth with her husband's help. Maxilla-mandibular horizontal position was achieved by moving the patient's chin forward using our hands. After a trial fitting, we fabricated her initial denture. To avoid instability caused by lateral cuspal interference because of her oral dyskinesia, we used zero-degree artificial teeth (). On inserting the new complete maxillary denture, we found that the mucosal surface of the denture was ill-fitting, because the impression had been taken immediately after multiple tooth extractions. To improve the fit, we relined the denture using low-flow tissue conditioner, COE-COMFORT™ (GC, Tokyo, Japan) and held her jaw gently for a while in semi-Fowler's position because of her oral dyskinesia. When we tried fitting the new denture, she initially hesitated to wear it; however, she accepted it soon after it was relined, similar as to when she wore the base plate to stop bleeding. After occlusal adjustment of the denture using articulating paper to remove lateral cuspal interference when she was awake, we instructed her husband on how to manage the denture, including insertion, removal, and cleaning, and the patient went home wearing the denture.\nOne week later, she visited our department for a denture adjustment. Her husband told us that she had not complained or indicated that the denture caused any pain or discomfort and had not tried to remove the denture once inserted. Her husband reported that she was able to eat soft solid food such as grilled fish, and her appetite had increased. She visited our unit 2 days per week for a denture adjustment and relining over several weeks. Three months after the extractions, the sockets were almost completely healed and bone had recovered. We performed dynamic impressions for a week using the same tissue conditioner and temporarily kept her denture for relining, choosing an indirect procedure in the dental laboratory to avoid a poor result because of her oral dyskinesia and to avoid accidental swallowing of the reline materials. After relining and occlusal adjustment of the denture, she was again happy to wear the denture ().\nThe patient has since visited the department for oral hygiene management and denture adjustment, including partial direct rebasing around the sockets several times. Currently, she routinely receives oral examinations and hygiene management. She can eat almost all foods such as vegetables, meat, and fish, and her body weight has increased by 5 kg (now up to 51 kg) and her serum albumin level has also improved (4.3 mg/dL). From discussion with the patient's husband's and examining a visual analogue scale drawn by him, it is apparent that her appetite and food intake have greatly improved ().
A 68-year-old female patient presented to the emergency department with refractory neuroglycopenic symptoms. In the emergency room, her glucose level was noted to be <50 mg/dL on multiple occasions despite repeated administrations of IV dextrose and PO intake. She described a 3-week history of episodes characterized by confusion, diaphoresis, and severe weakness which were improved with ingestion of food. She also described a weight loss of 30 pounds over the last 4-5 months despite normal appetite. She had no history of type 1 or type 2 diabetes mellitus and did not use insulin or antidiabetic medications. Medical history included hypertension and gastroesophageal reflux, and she did not endorse a history of smoking, alcohol, or recreational drug use. No pertinent family history was identified. On physical examination, she was found to have a palpable, mildly tender right upper quadrant mass and palpable hepatomegaly. A CT scan demonstrated evidence of an 18.6 cm mass projecting inferior to the liver and superior to the right kidney, in the approximate location of the right adrenal gland (). The mass was described as lobular and formed by 3 confluent mass lesions. No other suspicious lesions were described in the report. In addition, venogram showed severe extrinsic compression of the inferior vena cava secondary to the retroperitoneal mass.\nClinical workup of her hypoglycemia proceeded as follows (). Hypoglycemia was initially prevented with a maintenance dextrose drip; however, this was discontinued to allow clinical observation of hypoglycemic episodes ideally proving or disproving Whipple's triad. Whipple's triad includes a venous glucose level less than 55 mg/dL, symptoms of hypoglycemia, and resolution of symptoms after glucose administration. Dextrose drip was discontinued, her glucose level decreased to 47 mg/dL, and she became symptomatic. At that time, C-peptide, insulin, pro-insulin, and beta-hydroxybutyrate levels were measured and all were found to be low, suggesting IGF-2 secretion. IGF-2 was measured during that hypoglycemic episode but resulted within the normal range. This is classified as inappropriately normal because IGF-2 levels are expected to be suppressed in the setting of hypoglycemia (). The patient was given a 1 mg dose of glucagon, and her glucose level increased to 82 mg/dL with resolution of symptoms. Increase in glucose value of greater then 25 mg/dl represent adequate glycogen stores in the liver, yet repeated and persistent hypoglycemia infers that the patient's hepatocytes were not secreting glucose despite severe hypoglycemia. Dextrose drip was resumed to maintain safe glucose levels.\nScreening for use of oral hypoglycemic agents to rule out factitious hypoglycemia was negative. Antibodies to insulin were also undetectable. Our surgical colleagues recommended ruling out adrenal hypersecretion, as elevated precursor hormones are often seen in rapidly dividing adrenocortical carcinoma. Serum renin, aldosterone, 11-deoxycorticosterone, and 17-hydroxyprogesterone were all within normal limits. 5-HIAA and urine metanephrine levels were normal as well, which lessened suspicion for pheochromocytoma or neuroendocrine tumor. Although these conditions are not classically associated with hypoglycemia, we felt it would be useful to exclude additional causes of a large retroperitoneal mass.\nGiven the in-depth negative workup other than the abdominal mass, the decision was made to pursue resection. The gross pathology specimen () showed a mass weighing 2270 gm. Following removal, the patient's hypoglycemia resolved and 2 days later, IGF-2 was re-measured and found to be significantly lower than that measured preoperatively. During recovery, she had episodes of hyperglycemia, which could be explained by the sudden decrease in IGF-2 levels triggering a new equilibrium for glucose homeostasis.\nUnfortunately, IGF-1 level, which was drawn at the time of a hypoglycemic episode, could not be resulted because the sample was hemolyzed en route to the laboratory. By the time we were alerted, the patient was in pre-op for surgical resection. It would have been ideal to have this value, but this case highlights that clinical suspicion in the setting of appropriate imaging, low insulin, C-peptide, and beta-hydroxybutyrate, and an increase in glucose following glucagon injection point to an IGF-2-producing tumor. Finally, in the setting of an acutely ill patient, we anticipate a low/suppressed IGF-1 level.\nA follow-up CT scan one month after surgery demonstrated interval resection of the previously noted large, lobulated right suprarenal mass. There were no findings to suggest residual or recurrent disease.
In June 2011, a 56-year-old male was referred to our department by head and neck surgeon in order to improve his upper denture retention and stability. The patient was diagnosed with a squamous cell carcinoma of the maxillary gingiva (T4N0M0) in May 2005 and underwent an extended left maxillectomy, an anterior and middle cranial base resection, a left ophthalmectomy, and a flap reconstruction using the rectus abdominis muscle were performed. On physical examination, a recessed deformation on the left side of his face could be seen because of the left ophthalmectomy. The function of the left levator palpebrae muscle was eliminated to the level of a slight elevation by using the frontal muscle. A metal plate was anchored to the inferior wall of orbit. The left ethmoid bone, inferior nasal turbinate, the maxilla, alisphenoid, medial and lateral pterygoid muscle were already excised during the mesh titanium plate reconstruction of the anterior wall from the maxillary orbital region. Intraorally, the left maxilla had been excised from the midline, with the rectus abdominis muscle flap sutured directly to the soft palate. The peripheral mucous membrane around the left upper lip was already scarred, without the oral vestibule, and the flap margin had moved along with the surrounding soft tissue. The 70 × 50 mm flap was sagging from its weight and was in contact with the mandibular molars, reducing the volume of the oral cavity unless dentures were worn. The maxilla was removed from the midline to the maxillary tuberosity, while the mandible was removed from the anterior border of the ramus to the coronoid process. Dead space was eliminated because the abdominal rectus muscle was placed from the anterior cranial base to the oral cavity during reconstruction (Fig. ). No expiratory leakage or food reflux was observed, and the rhinopharyngeal closure was maintained. Prior to performing surgery, there was no tumor recurrence or metastasis. The patient had a mouth opening of 43 mm, which we judged operable and then conducted the flap reduction and elevation under general anesthesia in Dec 2008. Informed consent was obtained from the patient’s parents prior to study initiation, and all procedures were performed in accordance with the Declaration of Helsinki.\nSurgical reconstruction was performed as follows:An incision was made from the buccal side of the sutured edge (scar) in the abdominal rectus muscle flap (Fig. ). We can conduct a vestibular extension at the same time by incising this position. The adipose tissue was peeled from the buccal side to slightly beyond the skin flap center while maintaining approximately 5 mm thickness. The adipose tissue was reduced using a radio knife (8 g) (Fig. ). When we reduce fat tissue, we must avoid perforating of the skin. The skin was incised directly above the zygomatic bone, with tissue separation (avoiding exposure of the plate) to enable easy visibility of the zygomatic bone. Subsequently, the subcutaneous tissue was peeled from the zygomatic bone to the oral cavity for tunneling. Three mini QUICKANCHOR® (Depuy Mitek Surgical Products, Inc. Raynham, MA, USA) anchors were placed in the zygomatic bone, and anchor sutures were drawn through the subcutaneous tissue to lift the skin flap. A modeling compound was used to shape the margin of the celluloid splint (Fig. ). The advantage of flap suspension using Mitek anchors is the simple operability, less anchor positioning limitation, and easier length adjustment of the thread for suspension, which lead to easier fixation of soft tissue without slackness as well as clinically sufficient strength for fixation of ligament and tissue. On the other hand, less than 4 mm thickness of the cortical bone for suture anchor fixation causes insufficient fixation, therefore, determining placing position on the bone for fixation is necessary. Consequently, due to the versatility, the position that is considered optimal for stronger fixation and more efficient suspension can be selected as the anchor placing position, while the periosteum, corium, and scar tissue that are thought the most suitable for maintaining the strength can be chosen for the suture thread. Regarding the anchor placing position in this case, we determined 3 positions on the zygomatic bone and sutured flap corium taking into consideration a complete maxillectomy had been completed, which resulted in being able to lift the flap outward and upward.\nPostoperatively, the color of the skin flap was normal without congestion or necrosis. The celluloid splint was removed 10 days after the surgery with no infection or necrosis observed in the skin flap. We can find only fat, scar tissue, not carcinoma in the reduced fat tissure. At 3 months postoperatively, epithelialization and scarring were observed on the border of the skin flap and buccal mucosa, with no wound opening. Next, a denture that was stabilized to the right residual teeth with a clasp made. This prosthesis had two double Akers cast clasps unilaterally to retain the prosthesis by the four remaining molars. The major connector used anteria paratal plate. The patient was quite satisfied to be able to masticate, form an alimentary bolus, and swallow without any teeth falling out. No re-sagging of the skin flap or wound infection was observed at 3 years postoperatively. Patient follow-up will be continued at our department (Fig. ).
A 27-year-old man presented to the emergency room with a 12-hour history of pain, proptosis, and decreased vision in his left eye. The patient has a past medical history of hepatitis C and is an active intravenous heroin abuser who admitted to using heavily the prior evening. Upon returning home he and his family stated that the eye looked normal. He slept for 12 hours and woke up with extreme left eye pain. He did report being hit in the area around 2 weeks prior but denied any more recent trauma to the eye.\nOn initial examination the visual acuity was 20/20 in the right eye and light perception in the involved left eye and tonometry was 38 mm Hg. The left eyelids were erythematous and edematous. The globe was proptotic with limited motility. There were extensive chemosis and trace subconjunctival hemorrhage. The cornea was diffusely edematous without an epithelial defect. The anterior chamber had a complete hyphema. The right eye examination was normal.\nThe patient was afebrile and had no leukocytosis. HIV testing was negative. Initial CT orbits displayed periorbital soft tissue swelling without evidence of orbital fractures or sinus disease (). He received a dose of intravenous ampicillin and sulbactam and was discharged home on a course of topical prednisolone, atropine, dorzolamide, and timolol all twice a day. The following day the patient has no light perception in the left eye with a keratitis developing along with increasing pain, proptosis, and now almost complete ophthalmoplegia.\nA repeat CT of the orbits identified retrobulbar fat stranding and thickening of the posterior sclera (). There was also now a focus of soft tissue density in the vitreous (). At this time consultation with a retina physician was obtained and the option of tap and inject or vitrectomy with intravitreal antibiotics was discussed. Tap and inject or vitrectomy was not performed as it was clear that this was a panophthalmitis with severe corneal melting and NLP vision.\nDue to the keratitis and scleral involvement the patient was empirically started on intravenous vancomycin and started on fortified vancomycin and tobramycin ophthalmic drops every hour. MRI of the orbits, obtained less than 24 hours after initial presentation, demonstrated spontaneous dislocation of the native intraocular lens posteriorly into the vitreous with scleral enhancement along the inner walls of the left globe and enhancement was noted along the left optic nerve in the orbital apex extending through the optic canal to the prechiasmatic optic nerve (Figures and ). Neurosurgery was asked to evaluate the patient and felt there was no indication for intracranial surgery at that time.\nAfter 12 hours of intravenous and topical antibiotics a ring-shaped peripheral corneal abscess had developed. Due to the patient clinical worsening, cefepime was added with consultation from infectious disease. The following day the patient developed increased bloody drainage from the left eye. At this time the central cornea appeared ruptured. Cultures obtained grew Bacillus. Cefepime was discontinued and piperacillin/tazobactam was initiated. Enucleation was scheduled for the following day. Intraocular contents were cultured during the surgery and once again grew Bacillus.\nA transesophageal echocardiogram was ordered and there was a small fibrous strand on the ventricular surface of the aortic valve, which was felt to possibly represent early stages of endocarditis. He remained afebrile but did develop a mild leukocytosis. His original blood cultures had no growth, but follow-up blood cultures did grow Enterococcus faecalis. He has had a difficult course since enucleation with multiple admissions for treatment of his infective endocarditis but each time has left against medical advice prior to completion of antibiotic therapy.
A 35-year-old female in the 32nd week of pregnancy had presented at another center because of backache and difficulty walking. A burst fracture of L1 associated with a vertebral hemangioma was identified with an L3 compression fracture secondary to osteoporosis. Surgery and early birth were recommended, but the patient refused and left that center. Three months after delivery, she presented at our clinic as the complaints of back pain were increasing. The physical examination revealed an otherwise healthy individual with no history of disease before the pregnancy. She was 165 cm tall and weighed 63 kg, with a body mass index (BMI) of 23. It was understood from the patient history that, with weight loss after the birth, she had returned to her previous BMI. There was a Frankel D deficit in both lower extremities according to the Frankel classification, no ankle clonus and a negative Babinski reflex.\nPain increased on palpation of the back. The patient had difficulty standing and waking without support. Radiographs showed a burst fracture (the vertebral posterior complex was intact, but the fracture was in the anterior and middle compartment) of L1 associated with a vertebral hemangioma causing canal compression with expansion of the L1 body and a compression fracture of L3 secondary to postpartum osteoporosis (). The T score was −3.5 SD on bone densitometry. The local kyphosis angle between T12 and L2 was 27° (). Under general anesthesia, total decompression was performed with an L1 laminectomy and dural cut. During decompression, there was blood loss of approximately 500 mL, which was controlled by surgical packing at intervals. A total of 3 cc bone cement was injected with a vertebroplasty device (Kyphon, Sunnyvale, CA) to shrink the hemangioma of the L1 vertebra. The vertebra was stabilized with instrumentation with T11–L4 posterior pedicle screws without placing a screw in the L1 pedicle. Using the same system, the acute kyphotic deformity was corrected. Postoperatively, the measured T12–L2 local kyphotic angle was 9° (). Twelve hours postoperatively, oral nutrition was allowed, but she developed nausea and vomiting. The oral nutrition was stopped and supportive treatment was started with intravenous serum.\nTwenty-four hours postoperatively, an electrolyte imbalance developed and general surgery and gastroenterology consultations were requested. As the patient's general condition was poor, she was not mobilized with a thoracolumbar stabilization orthosis to allow mobilization. Blood pressure, pulse, temperature, electrolytes, and liver enzymes were monitored and serum was administered to restore the electrolyte balance. An endoscopic examination showed no ulcer, gastritis, or stenosis. On postoperative day 3, a psychiatric consultation evaluated her as normal, and the gastroenterology consultation was repeated. From the preoperative computed tomography (CT) images and postoperative contrast abdominal CT, it was determined that the angle of the SMA to the aorta had decreased from 41° to 29° () and the third section of the duodenum had undergone stenosis in the area of this bifurcation.\nPostoperatively, she was diagnosed with SMA syndrome. For 7 days, oral intake was halted and TPN was continued. The electrolytes were monitored daily. The blood urea nitrogen (65 mg/dL) and creatinine (1.8 mg/dL), which were high in the early postoperative period, started to decrease on postoperative day 7 and oral nutrition with liquid food was then allowed. The patient was discharged on postoperative day 10. At the 12-month follow-up, her general condition was good and the blood parameters were normal. With minimal back pain, there was no change in the early postoperative sagittal balance at the 12-month follow-up.
This girl was born at 39 weeks of gestation to a gravida I para I, 25-year-old healthy mother and 28-year-old healthy father, with no history of consanguinity and no remarkable family history. The mother was followed regularly during her pregnancy and had prenatal diagnosis of fetal hydrocephalus at 30 weeks of gestation. The female baby was delivered by cesarean delivery due to fetal distress and was born with Apgar scores 8 and 9 at 1 and 5 minutes, respectively. At birth, the baby was noticed to have skin lesion and so she was transferred, at day 1 of life, to the Pediatric Department at Makassed General Hospital for further management.\nUpon presentation, the baby had a weight of 3690 g, length of 49 cm, and macrocephaly with head circumference of 37.5 cm (above the 95th percentile for her age). She had flat areas of alopecia on the scalp and multiple small elevated nodules on the right side of the face. Nodular lesion at the outer canthus of right eye suggestive of dermoid and reddish lesion on the bulbar conjunctiva suggestive of epibulbar dermoid and aniridia of the right eye were also noted (-). She also had low-set ears with multiple soft subcutaneous masses over the back (). Fundus examination showed bilateral optic disc coloboma. Cardiovascular and respiratory system examinations were normal. There was full passive and active range of motion of the extremities on nervous system examination. Her reflexes and muscle tone were normal. Results of a radiography study of the chest and skeleton were unremarkable. A head computed tomography (CT) scan was performed, which demonstrated homogeneous low-density lesions in the cistern magna and right cerebellopontine angle indenting smoothly the brachium pontis. There was severe right lateral ventricular dilation. The patient underwent magnetic resonance imaging (MRI) of the head, which showed a lipomatus mass, measured at 25 × 12 mm, seen at the right cerebellopontine angle cistern, indenting smoothly the brachium pontis with no alteration of its signal, also with similar lesions noted in the posterior aspect of foramen magnum; cervical canal with no bleed, intact brain stem, with atrophic right cerebral hemisphere; and dilated lateral ventricle and prominent overlying subarachnoid spaces (-). The right periauricular cutaneous lesion was submitted to histopathological examination and showed that the dermis has rudimentary hair follicles surrounded by fibrous connective tissue interpreted by mature fat lobules. The patient was neurologically normal for her age, and no deficiency of the right upper extremity was appreciated during the course of the hospital admission. It was decided to follow the infant closely to observe for increase in her hydrocephalus and for development of any neurological deficit.\nThe patient began to show increase in her head circumference, and neuroimaging showed an increase in the size of her ventricles. At 9 months of age, the patient underwent ventriculoperitoneal shunt and had a significant improvement in motor skills over the following months. The size of her head circumference stabilized. The patient could stand independently and was beginning to formulate words at approximately 1 year of age. However, at the age of 1 year 10 months, the patient was admitted with staring, unresponsiveness, and tonic–clonic movements associated with weakness in her lower extremities. Her neurological examination revealed spasticity in her lower extremities and sustained left ankle clonus.\nDeep tendon reflexes were hyperactive without clonus (3+) in both the upper extremities and hyperactive with clonus (4+) in both the lower extremities, mainly in the left lower limb. No scoliosis of the back was observed.\nElectroencephalography (EEG) was done, which showed the presence of diffuse slow delta activity related to brain damage (encephalopathy). The patient was started on both phenobarbital and phenytoin, and her seizures were controlled. Ultrasound of both kidneys revealed 2 cm cortical cyst in the upper pole of the right kidney.\nRepeat MRI of the brain demonstrated no change. Magnetic resonance imaging angiography of the brain was normal. The MRI of the spine showed large subpialjuxtamedullary lipoma filling the entire spinal canal, which is widened, and engulfing the spinal cord. The spinal cord is tethered and is remarkably compressed at the thoracic level, displaced to the left and protruding into the left lateral foramina at the level of dorsolumbar junction. The vertebrae are of normal heights and signal, and normally aligned and the discs are unremarkable ( and ).
A 39 year old female patient presented to our institute with instability on the pubic symphysis. On examination there was a palpable gap in the region of symphysis pubis. Initial mechanism of trauma was a motorcycle accident three years ago before the last admission to hospital. Initial fracture was classified as a combined mechanism according to the Young and Burgess' classification. The patient had undergone fixation with an external fixator (). Four months after the initial trauma, she reported no complaint other than insignificant leg length discrepancy which did not affect her. One year following injury she became pregnant. Gestation period proceeded in an uneventful manner. After childbirth (by caesarean section), the patient complained of pain on long distance walking and instability when she rolled to the lying position. When she was asked whether she had the same complaints during the last trimester, she stated that she had not noticed among pregnancy-related changes. Furthermore, she reported to be experiencing urinary incontinence during some activities such as sudden forward bending. Standard anteroposterior (AP) X-ray examination revealed SPD (). Additional radiographic evaluation was performed using inlet, outlet pelvic radiographs and three-dimensional computed tomography scanning (). There was not any significant residual displacement in the axial and coronal plane, only in the sagittal plane.\nAfter radiographic evaluation an operation was planned to close the gap by fixing with internal fixation. Operation was performed through a midline vertical rectus-splitting anterior approach after transverse skin incision. During surgery, the gap in the pubic symphysis was confirmed and closed to some extent when only firm, steady lateral compression was applied on the iliac crests; nonetheless diastasis still existed. It was decided to use corticocancellous autograft to both fill the gap and help with potential bony/fibrous fixation of pubic symphysis. The residual distance of the gap after maximum side to side compression of pelvis was measured. The bone graft which was 2-3 mm larger than this distance (to allow for some compression between the graft and symphysis pubis joint surface) was harvested from the contra lateral iliac crest of the patient. The fibrous tissue, which filled the separated symphysis pubis distance, was removed and both surfaces of the joint were decorticated to enhance bone healing. While the bone graft was compressed between the two articular surfaces of the symphysis pubis, the space was kept closed with bone clamp placed on both sides of the joint. In this position, the graft was temporarily fixed with K wire, which would not interfere with the placement of the plate. The pubic symphysis was fixed using a nine-hole 3.5 mm reconstruction plate (). The patient was allowed touch-down weight bearing for three months postoperatively. However, she discarded crutches one month post-operatively as she felt well in herself. Immediately after operation the urinary incontinence complaint improved and the pain also resolved shortly after.\nAlmost three years post-operatively patient was reevaluated and informed consent was obtained. At the 3 years follow-up, pelvis was considered stable after clinical and radiographic examination. The patient expressed no sexual dysfunction, urinary incontinence or instability. There was no complaint related to the iliac crest from which autograft had been harvested. However she was suffering from occasional mild pain on the sacroiliac joint. Supine AP, inlet, outlet and single leg stance pelvic radiograph was obtained to evaluate pelvic instability, re-displacement of symphysis pubis and/or fixation failure (). Radiographs revealed that, although the reconstruction plate remained intact, some of the screws were broken ().
A 65-year-old male patient reported with a discharging ulcer, which was present over the lower part of the sternal region since 5 months previously. There was a history of pain and swelling in the lower sternal part of the chest in the preceding 6 months, which led to the formation of pus. The pain was dull and aching in nature and had started insidiously, which worsened with time. It was nonradiating and got relieved temporarily by anti-inflammatory medications. The patient underwent incision and drainage from a private practitioner, but there was no improvement and it led to the formation of ulcer with pus discharge. There was no history of trauma, loss of appetite, or weight loss. There were also no complaints of cough and fever. There was no history of diabetes mellitus, TB, or hypertension. The patient did not reveal any family history of TB. He had been a chronic smoker for 30 years.\nOn local examination, there was a 3×2 cm oval ulcer over the lower part of the sternum, with irregular margins. The floor was covered by granulation tissue with minimal slough and pus discharge (). It was fixed to the underlying structures. The surrounding skin was erythematous. The patient also had vitiligo over the chest. On palpation and percussion, tenderness was present over the sternum. However, there was no tenderness over the spine in the thoracic region. The movements of the spine were within normal limits. There was no lymphadenopathy. The abdomen was soft and nontender without any organomegaly. The remaining systemic examination was normal. His hemoglobin was 7.0 g/dL (normal range, 10-12 g/dL) with raised a erythrocyte sedimentation rate of 75 mm/h and the rest of the blood tests were normal. Mantoux and HIV tests were negative.\nOn chest radiography, the anteroposterior view was normal, while the sternum lateral view revealed irregular erosion with a fuzzy anterior cortex, suggestive of osteomyelitis of the lower part of the sternum (). Ultrasonography (USG) revealed a sinus track extending to the sternal region with erosion of the cortex. High-resolution CT of the chest showed erosion of the anterior cortex of the xiphisternum with thickened and inflamed overlying tissue, suggestive of chronic osteomyelitis of the sternum and sinus formation (). The lungs were normal and there was no lymphadenopathy. Based on radiologic findings and endemicity of TB, a provisional diagnosis of sternal TB was made. While performing the biopsy, two sinuses were seen over the sternal region, a distance of 1.6 cm from each other. Histopathologic examination revealed granulomatous infiltrate with epithelioid cells, lymphocytes, plasma cells, and Langhans type of giant cells (). A diagnosis was made of sternal TB and a Ziehl-Neelsen stain for AFB, and PCR including culture was positive. On trephine bone marrow biopsy, similar infiltrates were seen in the bone marrow, suggesting disseminated bone marrow TB (). The patient was given intravenous oflaxacin (100 mg twice per day) and amikacin (500 mg twice per day) for 7 days. The patient was also started on antitubercular drugs: isoniazid, rifampicin, ethambutol, and pyrazinamide. After 6 weeks of therapy, discharge and erythema decreased and his hemoglobin was increased to 9 g/dL. After 3 months, the sinus had healed completely. He was advised to complete his antitubercular course. After 3 months, thesmus had healed completely ().
An 80-year-old man with known cervical canal stenosis due to ossification of the cervical posterior longitudinal ligament was transferred to an emergency room soon after a falling accident. The patient was alert and had complete tetraplegia, sensory deficits below the C4 cervical sensory level, and progressive restrictive respiratory failure that required assisted ventilation, and, eventually, a tracheostomy. Cervical spine magnetic resonance imaging showed cervical cord compression that was worse at the C3–C4 intervertebral level, and an intramedullary high signal at C3 and C4 vertebral levels, and the patient was managed conservatively. During the conventional weaning process of trials of intermittent spontaneous breathing in the ICU, an unexpected cardiac arrest made both the patient and medical staff reluctant to proceed with further weaning. Fifty-eight days after cervical cord injury, the patient was transferred to our hospital for further rehabilitation. He was fully conscious and received pressure-support mechanical ventilation with back-up rates of 16 breaths. He had total tetraplegia below shoulder girdle muscles with a preserved sensation from C2 to C3 on both sides, and a urinary obstruction. The limbs and trunk were stiff with contracture, and muscle stretch reflexes of the limbs were abolished. Neurological level of injury was C3 according to the ISNCSCI, with a total sensory score of four. There was no sensory sacral sparing, while the deep anal pressure was preserved, and the American Spinal Injury Association scale graded B. Chest roentgenogram and computerized tomography showed bilateral, widespread atelectasis. The patient occasionally showed signs of pulmonary infection. Intensive pulmonary care and rehabilitation, including physical support for expectoration, mechanically assisted removal of tracheal secretions (CoughAssist E70®, Philips Japan, Tokyo), ventilator muscle training, and management of the spasticity of the abdominal wall, resulted in the improvement of the roentgenological findings. His expiratory tidal volume (VT) measured 150 mL.\nAlthough the neurological status according to the ISNCSCI was unchanged, the patient was willing to be weaned from mechanical ventilation as his general condition improved. After informed consent was given, we attempted automated weaning from mechanical ventilation using IntelliVent®-ASV on and after 131 days of injury. IntelliVent®-ASV (Hamilton Medical AG, Switzerland) is a closed-loop ventilation mode that adjusts the pressure support in terms of the percentage of the ideal minute volume (%MV). The ideal MV (100%MV) is calculated from the patient’s height and gender. Based on Otis’ equation [], adaptive support ventilation will select the best VT–respiratory rate (RR) coupling for the optimal work of breathing. IntelliVent®-ASV has interrelated functions: an auto-adjustment for carbon dioxide (CO2) elimination, an auto-adjustment for oxygenation, an auto-weaning tool named Quick Wean (QW), and a spontaneous breathing trial (SBT). The setting of the target %MV is automated based on either the monitored end-tidal CO2 or monitored spontaneous breathing rate. The auto adjustment of fraction of inspiratory oxygen or positive end-expiratory pressure is based on the monitored oxygen saturation fraction of hemoglobin with a pulse oximeter (SpO2) []. The QW mode is an optional automated weaning, and progressively reduces the pressure support, monitors for readiness-to-wean criteria, and provides the option to automatically conduct a fully controlled SBT. In the QW mode, when the spontaneous rate is less than the upper limit of the predicted target range, %MV is automatically decreased gradually to the selected level. To facilitate the recovery of VT by means of the loading work on respiratory muscles, we set the level of support to 70%MV for the QW mode. When spontaneous breathing satisfied the pre-determined conditions of oxygenation and ventilation for 1 min, the SBT mode was used. We operated the SBT mode during the day from 9:00 a.m. to 6:00 p.m.\nIn the QW mode, the duration of 70%MV and SBT time (25%MV) increased gradually (Figs. and ). Twenty-two days after the introduction of the QW and SBT modes in association with intensive pulmonary rehabilitation, SBT was running almost fully during the daytime. At this time, the expiratory VT was increased to 350 mL from 150 mL upon admission to our hospital. Thereafter, we withdrew the pressure support ventilation during the nighttime 39 days after the introduction of the auto-weaning mode, and the patient’s weaning process was completed.
The patient is a 68-year-old man who presents to the office following an injury to his right hand. He states that he was picking up a heavy suitcase when he felt a pop and a burning sensation in his right hand. He is right-hand dominant and this injury was severely impacting his activities of daily living.\nPhysical examination of the affected wrist revealed maximal tenderness over the dorsum of the wrist and with palpation, tenderness localized to the midcarpal joint. There was moderate swelling to the dorsum of the right wrist and a scaphoid shift test and scapholunate ballottement test were positive. Standard radiographic views of wrist demonstrated an increased scapholunate joint space and minimal rotatory subluxation of the scaphoid (Fig ). The scapholunate interval measured 4.3 mm, being significantly larger than the interval on the contralateral side, which measured 1.9 mm.\nEvaluation of the patient outcome was conducted using subjective and objective parameters. Pain levels were assessed on a numerical rating scale from 1 to 10 (1 being minimal pain and 10 being the worst possible pain). Measurements of the wrist active range of motion and strength were also used for this purpose.\nConventional diagnostic arthroscopy was performed to assess the degree of ligamentous damage and a scapholunate interosseous ligament tear was identified and subsequently, debridement of the ligament and synovium was conducted. Reduction of the scapholunate diastasis and stabilization of the scapholunate articulation were performed next to allow healing that would further improve or restore the carpal kinematics. A 1-mm K-wire was percutaneously delivered across the scaphoid starting with the distal pole of the bone. Using this K-wire as a joystick, the reduction of the rotatory subluxation of the scaphoid was performed and subsequently, advancement of the K-wire was continued into the lunate. At the point of skin contact of the K-wire, a small stab incision (5 mm) was performed to facilitate the insertion of the screw. Under fluoroscopic visualization, the cannulated screw (Fig ) (TwinFix, Stryker Leibinger, Kalamazoo, MI) was percutaneously delivered into the scaphoid and lunate, using the K-wire as a guidewire. Once the distal thread of the screw passed into the lunate and the proximal part of the screw was completely in the distal pole of the scaphoid, the proximal part of the screw was locked in place. Using the same screwdriver, isolated rotation only of the distal thread was performed, the distal part of the screw continuing to advance into the lunate, bringing the lunate closer to the scaphoid bone and permitting a dynamic and controlled reduction of the scapholunate diastasis. Rotation of the distal thread of the screw was carried out to the point where a suitable scapholunate interval reduction was attained (Fig ). A radiograph of the contralateral hand is usually useful for this purpose and a scapholunate interval similar to the left hand was attained. After the proper placement of the screw was obtained, the K-wire was removed.\nThe procedure was performed as outpatient surgery and a cock-up splint was used for 3 to 4 weeks after the surgery. The patient was permitted to perform activities of daily living but without excessive use of the affected hand. Two weeks postoperatively, occupational therapy was started to maximize early active motion of the wrist.\nPostoperative evaluation 9 months after the surgery revealed a decrease in the level of wrist pain from 7 to 1. The changes in the wrist active range of motion and strength with regard to the pre- and postoperative period are depicted in Table .
A 72-year-old female patient was referred from a local hospital because of a sudden cardiac arrest. Cardiopulmonary resuscitation (CPR) was performed for 7 min, and the patient was resuscitated. After being transferred, she was monitored at the intensive care unit and evaluated to determine the cause of the sudden cardiac arrest. Coronary angiography revealed a significant stenosis extending from the distal left main to the proximal left anterior descending (LAD) coronary artery (). The right coronary artery (RCA) showed a significant diffuse stenosis. The most severe discrete stenosis was present at the distal RCA to the posterior lateral (PL) branch lesion (). We performed PCI with stenting at the short segment of the distal RCA to the PL branch (). Then, we conducted an IVUS-guided PCI with stenting from the distal left main to the proximal LAD crossing over to the left circumflex (LCx) coronary artery (). The IVUS image showed an eccentric echodense plaque with severe luminal narrowing at the proximal LAD, and no severe stenosis or plaque rupture was seen at the proximal LCx coronary artery (). After the procedure, the patient’s blood pressure gradually decreased, and she suddenly developed an atrioventricular block. We inserted a temporary pacemaker and started vasopressor therapy. Another coronary angiography showed total occlusion of the proximal RCA, causing severe spasm (). We injected nicorandil, which partially resolved the spasm, and the patient’s blood pressure was elevated, and her heart rhythm was converted to sinus rhythm. IVUS of the RCA revealed diffuse intima and media thickening with a large amount of atheromatous plaque at the mid-RCA level. In the spasm portion of the proximal RCA, there was a large area of attenuated plaque and prominent intima thickening with rupture (). Therefore, we performed PCI with stenting at the proximal RCA plaque rupture lesion (). After stenting, the RCA flow was well maintained, and the patient was stabilized. We observed the patient for several minutes; however, her blood pressure suddenly decreased, and she again developed a pacing rhythm. We performed an RCA coronary angiography again, and the deployed stent remained patent and the flow was maintained well. We performed a left coronary angiography, which revealed total occlusion of the LCx coronary artery (). We injected nicorandil and the flow was fully resolved abruptly; however, the patient again developed a spasm(). Her blood pressure was continuously low, and she developed ventricular fibrillation. We performed CPR and applied PCPS, and the patient was stabilized thereafter. We conducted left coronary angiography to confirm the patency of the LCx coronary artery. However, coronary spasm again developed at the mid-RCA () and it could not be resolved despite multiple injections of nicorandil (). We deployed a stent at the mid-RCA to mechanically stop the spasm. The flow was recovered after stenting (). After 7 days, the patient could be weaned from the PCPS and she was discharged 1 month later. Three months later, she was admitted for a transient ischemic attack. During the hospital stay, she experienced a gastrointestinal bleeding event and heart failure aggravation. We stopped the diltiazem medication, which was the cause of reduced heart function. On the next day, she had a sudden cardiac arrest again and was resuscitated after a 5-min CPR. We intravenously injected nitrate and performed coronary angiography. All stents were patent, and no other lesion progression was found. The patient recovered and was discharged with prescriptions of clopidogrel, ramipril, statin, diltiazem, nicorandil, and isosorbide dinitrate.
This report presents the case of a 49-year-old Caucasian female with a past medical and surgical history significant for acute cholecystitis, for which she underwent a laparoscopic cholecystectomy in 2009, and symptomatic uterine fibroids, for which she underwent a laparoscopic supracervical hysterectomy and bilateral salpingectomy in 2012. At that time, evidence was noted of endometriosis at the left pelvic sidewall and posterior cul-de-sac. The patient also underwent colonoscopy in 2010, where a prominent appendiceal orifice was described. No additional medical conditions are reported.\nThe patient presented to the emergency department complaining of a 5-day history of intermittent throbbing abdominal pain, initially periumbilical, but migrating to the right lower quadrant on initial presentation, which was associated with nausea and increased stool frequency. Physical exam was significant for moderate tenderness to palpation in the right lower quadrant and positive Rovsing sign. Laboratory studies were all within normal limits. Contrast CT identified lobulated tubular soft tissue and inflammation adjacent to the terminal ileum/ileocecal valve did not identify an appendix () and questioned whether the patient had previously undergone appendectomy. Without prior history of appendectomy, acute appendicitis was suggested as a highly likely diagnosis.\nFor this diagnosis, the patient was started on broad-spectrum antibiotics and underwent diagnostic laparoscopy. Mild inflammatory changes of the terminal ileum and adhesions involving the cecum, right ovary, and abdominal wall were observed without evidence of Crohn’s disease, but no appendix was identified despite full mobilization of the cecum and a thorough running of the small bowel. A biopsy of the inflamed areas was taken and revealed acute inflammatory changes surrounding the fallopian tubes as well as focuses of endometriosis. Intraoperative consultation with the colorectal surgery team was performed, and it was decided at that time to avoid further surgical interventions and continue course with intravenous antibiotics. Postoperatively, the patient began to tolerate a solid diet and was discharged on postoperative day 2, with plans for interval diagnostic colonoscopy. The patient returned to the emergency department within two hours of discharge, complaining of sharp right lower quadrant pain, nausea and vomiting. Repeat labs were significant for a white blood cell count of 13.23. Repeat CT of the abdomen and pelvis was consistent with small bowel obstruction focused at the level of the terminal ileum, likely secondary to an adjacent pericecal soft tissue mass (). Differential diagnosis of the mass was inverted appendix versus neoplasm.\nGiven the negative findings on prior diagnostic laparoscopy, a laparoscopic ileocecectomy with primary anastomosis was performed. Intraoperative inspection on the back table revealed a large inverted appendix. Gross pathologic examination identified an area of induration and fibrosis having a dark brown nodular appearance and located between the cecum and the terminal ileum. Within the bowel, an intussuscepted portion of appendix measuring 2.2 cm in length and up to 1.4 cm in diameter was identified; the appendix was not inflamed (). Cut section through this projection showed fibrous cystic spaces filled with brown-tinged fluid. The remainder of the mucosal surface was tan with irregular, prominent, tightly spaced mucosal folds. Palpation revealed an area of induration that on cut section showed a thickened bowel wall measuring up to 0.7 cm in greatest dimension. Palpation of the underlying mesentery revealed palpable lymph nodes that were found to be negative for malignancy. Final pathologic diagnosis identified that the colonic wall was extensively involved by endometriosis, endosalpingiosis and endocervicosis ().\nThe patient recovered after a short ileus and was successfully discharged home on a regular diet and having normal bowel function on postoperative day 7 from the second surgery.
A 12-year-old boy with progressive trunk deformity and a huge subcutaneous tumor was referred to our department. At the age of three, the subcutaneous tumor was found in the back, and biopsy of the tumor indicated a diagnosis of cavernous hemangioma. During that biopsy, a massive hemorrhage occurred, and the patient required a blood transfusion (3000 ml). Scoliosis was diagnosed at age 11, and the patient underwent brace treatment. However, the scoliosis worsened progressively, and the patient was finally referred to our department. Upon physical examination, we found significant protrusion of the right back ribs. On the left back was a huge subcutaneous tumor, measuring approximately 15 cm in diameter, and a scar from a previous surgical wound that was approximately 5 cm long (Figure ). The mass was not tender or throbbing, and no neurological abnormalities were observed.\nFull-length, standing radiographs demonstrated a scoliosis of 85° at T6-L1 and a kyphosis of 58° at T4-T10. The Risser sign was grade zero, and the triradiate cartilages were open (Figure ). Traction radiography showed a correction rate of 6%, indicating extremely low flexibility. On the axial CT images, vertebral body atrophy was recognized at T7-T10, where the vertebral bodies were surrounded by the cavernous hemangioma (Figure ). No congenital deformity of the vertebral bodies was observed. MR images revealed that the hemangioma extended from the subcutaneous region to the paraspinal muscles and the retroperitoneal space at T6-L1, primarily on the left side. Invasion of the hemangioma into the spinal canal and compression of the dura by the hemangioma were recognized at the T8-T10 level (Figure ).\nThe diagnosis of severe progressive scoliosis associated with cavernous hemangioma was made. Prior to the surgery, we decided against the use of radiotherapy, which may reduce the size of the tumor or blood circulation through it, because irradiation of the spine can lead to pseudoarthrosis. In planning the surgery, an anterior approach was considered first, since the hemangioma was mainly located on the concave side of the curve. However, we abandoned this idea because damage to the hemangioma during disc removal or screw placement would have required us to manage the hemorrhage from inside the narrow thoracic cage, which might not have been successful. Although bleeding from hemangioma was inevitable if we used the posterior approach, we had the option of stopping the bleeding by the tamponade effect of closing the wound. Therefore, we used the posterior approach for correction surgery and fusion with pedicle screws at T2-L3.\nA midline skin incision was made on the patient's back. Soon after the incision was made, the hemangioma hemorrhaged massively, and hemostasis by coagulation failed using bipolar forceps, electrocautery, and ligation. Thus, the surgery was continued with gauze packing at the bleeding sites. The soft tissues were carefully detached from the spinous processes or laminae subperiosteally using a spatula to minimize damage to the pseudocapsule of the hemangioma, and consequently, the hemorrhage greatly decreased. Pedicle screws were placed segmentaly, except from T8 to T10, where the hemangioma invaded the spinal canal, to avoid spinal cord injury from intracanalar hemorrhage of the hemangioma. Since we encountered massive hemorrhage at T11, 12 and L1, we could not place pedicle screws at these levels, where we had hoped to place them to increase the number of anchor points. The correction force was applied carefully to avoid screw failure, since fewer screws could be placed than were needed and the flexibility of the curves was quite low. After the correction, abundant bone grafting was performed using the iliac crest and local bone. No drainage tube was placed inside the wound, since it could have increased the risk of postoperative hemorrhage by penetrating or damaging the surrounding hemangioma (figure ) during insertion of the tube. After surgery, the scoliosis was corrected to 59°, and kyphosis to 45°, with correction rates of 31% and 22%, respectively (Figure ). The intraoperative time was 314 minutes, and the intraoperative blood loss was 2800 ml.\nThe patient's hemodynamics stabilized with blood hemoglobin level of 9.2 mg/dl when the surgery finished at 7 pm after the transfusion of 400 ml of preoperative donated autologous blood and 1350 ml of intraoperative and postoperative cell saver autologous blood. The patient was admitted to intensive care unit at 8 pm. At 11 pm (four hours after surgery), his blood pressure was 92/52 mmHg with stable hemodynamics, and his blood hemoglobin level was 8.5 mg/dl. However, seven hours after surgery, after the administration of diazepam to control agitation, his blood pressure suddenly decreased to an unmeasurable level, and the patient became unconscious with apnea. At that time, the hemoglobin level was 5.9 mg/dl. Endotracheal intubation was immediately performed, along with blood transfusion, which resulted in his recovery from hypovolemic shock. The following day, however, the patient developed disseminated intravascular coagulation (fibrinogen degradation products [FDP] 32.3 μg/ml, platelet count 95,000/μl, prothrombin time international normalized ratio [PT-INR] 2.28), and received fresh frozen plasma and gabexate mesylate. Seven days after the surgery, when his general condition had stabilized, the patient was extubated. However, as the patient became conscious, a language disorder became apparent, and a head MRI revealed ischemic lesions in the bilateral frontal and temporal lobes. Sensory and conduction aphasia was diagnosed, caused by cerebral hypoxia during the hypovolemic shock on the day of the surgery (Figure ). The patient gradually recovered from the aphasia, and the ischemic lesions became smaller on MRI (Figure ). At present, two years after the surgery, although the patient has completely recovered from the aphasia.
A two-month-old female patient, transferred from a tertiary healthcare center, was referred for autopsy with signs of developmental delay and respiratory failure. The patient had a medical history of being the fifth birth out of six overall pregnancies, with the parents being blood relatives (second cousins). The mother had suffered from an acute respiratory infection (unspecified) in the seventh gestational month and was a heavy smoker. The patient had been delivered 10 days prematurely per via naturalis with a weight of 2,250 g, height of 48 cm, and an Apgar score of 6 on the first minute and 8 on the fifth minute.\nOn the second day postpartum, decreased reflexes and generalized muscular hypotension had been noted. Following 24 days in the neonatal intensive care unit, the patient had been de-hospitalized. Two weeks later, the patient had been hospitalized again after rejecting food, with the presence of a severe dry cough and muscle hypotension. Upon admission, no fever had been noted; radiology had shown lung consolidation, and the patient had been treated with antibiotics for bilateral pneumonia. After two weeks of treatment, the condition of the patient had not improved, and she had been referred to our hospital for further diagnostic tests and treatment. However, upon admission, the patient's condition was extremely poor and a lethal exit was registered, following extensive reanimation. The patient was referred for an autopsy to identify the underlying condition.\nBefore autopsy, the patient weighed 3,140 g, was 50 cm in height, and head circumference was 33 cm (microcephaly). Furthermore, mild facial dysmorphism was noted, with retrognathia, gothic palate, and bulged zygomatic bones. On section of the thorax, the lungs were deformed and retracted towards the hilus with subpleural hemorrhages. The left lung weighed 30 g and the right one 38 g. A floating probe was performed with both lungs sinking. On a section floating probe, only the upper lobes of the lungs were semi-emergent in the liquid, with both inferior lobes and the middle lobe of the right lung sinking. On cross-section, the lungs were airless and consolidated. Histology revealed subtotal atelectasis and subpleural hemorrhages (Figure ).\nThe atria of the hearth were dilated, and the cardiac weight was 28 g. On section, a persistent and dilated foramen ovale was observed. Histology revealed a granular change in the cardiomyocytes, predominantly in the atria (Figure ).\nCranial section showed undisturbed dural duplicatures. Following the section of the tentorium cerebelli and the extraction of the cerebrum, cerebellum, brainstem, and spinal cord, the brainstem and cerebellum were noted to be severely hypoplastic, with a lack of basal foliation of the cerebellar cortex. The combined weight of the cerebrum, cerebellum, brainstem, and spinal cord was 270 g, with the cerebellum weighing only 5 g (Figure ). On section of the CNS, the lateral ventricles were noted to be dilated, especially the occipital horns. Histology of the cerebellum revealed subtotal lack of tertiary foliations, large sections of only secondary and primary foliations, abortive mushroom-like foliations, complete lack of foliations on the basal surface, tangential Purkinje branching, disarrangement of the Purkinje cells, and a severe variation of the cortical layer thickness and neuronal count (Figure ).\nThe medulla oblongata revealed a narrowed central canal, decreased neuronal count in the olivary nuclei as well as severely hypoplastic spinocerebellar tract (Figure ). The spinal cord also showed decreased neuronal count in the anterior horns and central canal stenosis (Figure ).\nThe clinical manifestation of hypoventilation respiratory failure with a right-to-left cardiac shunt and the gross and morphological changes in the cerebellum, brainstem, and spinal cord, with combined microcephaly and internal hydrocephalus, were in concordance with the morphological substrate of PCH type 1B. Therefore, the protocol was finalized as PCH type 1B to be the main condition.
We herein report the case of a 76-year old menopaused multiparous female with a history of three normal vaginal deliveries, well-controlled hypertension and Type 2 diabetes mellitus, who presented to the emergency department for acute obstructive bilateral pyelonephritis having complained of sustained high-grade fever, left flank pain and severe acute storage low urinary tract symptoms. Physical exam revealed a high-grade fever with a grade 4 anterior and apical compartment prolapse with no urine leakage on prolapse reduction testing, and bilateral costovertebral angle tenderness.\nThe patient had undergone a laparoscopic sacrohysteropexy in early 2018 as a cure for her grade 4 debilitating anterior and apical compartment prolapse, also accountable for a bilateral hydronephrosis at the time. She started complaining a year later from a clinical relapse of her cystocele manifesting as a complete vaginal eversion and intermittent self-limiting macrohematuria.\nHer past surgical history also includes a left quadrantectomy and axillary lymph node dissection for a luminal A left breast cancer in 2008, followed by adjuvant radiotherapy, chemotherapy according to an AC-T regimen: 4 cycles of combined doxorubicin and cyclophosphamide followed by 4 cycles of paclitaxel (Taxol) and Tamoxifen-based hormonotherapy.\nFurthermore, she was treated for recurrent upper and lower urinary tract infections (UTIs). The last infectious episode occurred in January 2020 when she was treated for a community acquired nonobstructive pyelonephritis, incriminating a penicillin-resistant Escherichia coli. A renal and pelvic ultrasound performed in the aforementioned context showed no hydronephrosis and a 170 ml postvoid residue. A therapeutic trial by once daily tamsulosin was initiated in an attempt to improve voiding as a mean to reduce the frequency of UTIs. The patient was also instructed to perform clean intermittent catheterization of the bladder once daily but was never compliant.\nAbdominal and pelvic computed tomography (CT) scan without injection of intravenous contrast showed severe bilateral hydronephrosis (A), associated with bilateral hydroureters extending to the urogenital hiatus (B & C), where both of the ureters seem to be directly compressed between the uterine fundus and the pelvic diaphragm (D) due to POP (Stage 4 Ba prolapse and associated Stage 2 C prolapse according to POP-Q classification) (E). Diffuse thickening of the bladder wall could be seen as well, with no evidence of bladder overdistension. CT imaging was not in favor of the eventuality of a ureteral stone migration and revealed no peri-renal fat stranding, nor indirect signs of inflammation.\nBlood work revealed a white blood cell count of 8.0 × 103/dl, a mild anemia, a creatinine level of 0.81 mg/dl, C-reactive protein (CRP) level was 24.6 mg/l. Urinalysis showed combined hematuria and pyuria with urine culture demonstrating the growth of >10∧6 Klebsiella pneumoniae with extended-spectrum betalactames secretion. The patient was treated empirically then according to bacterial sensitivity with intravenous piperacillin-tazobactam (4.5 g intravenously perfused over 6 h, four-times daily). The patient was reluctant to undergo a bilateral emergent nephrostomy and thus 1 g of amikacin was administered once daily, intravenously, for 2 consecutive days due to the sustained high-grade fever with a preserved stable hemodynamic state. Vaginal pessary insertion was proposed but the patient could not find the prescribed device and, therefore, the POP was only reduced manually in a temporary fashion.\nFor the current context, a specialized infectious diseases consultation was sought and piperacillin-tazobactam was started empirically then adjusted according to culture. The patient was apyretic on day 2 of her admission. Due to the rapid recurrence of the prolapse, in the year following her laparoscopic sacrohysteropexy, and due to the patient’s preference, a shared decision was made to perform a transvaginal cure of the prolapse on day 3 of her admission. The surgery consisted of a vaginal hysterectomy, with cystocele repair through an anterior colporrhaphy (consisting of a suture-plication of the vesico-vaginal Halban's fascia – using nonabsorbable multifilament braided separate sutures) associated with Richter’s sacrospinous ligament fixation of the prolapsed vaginal vault using a vaginal flap for prevention of a subsequent vaginal vault prolapse.\nVaginal packing was left overnight, and the Foley bladder catheter was removed 48 h later. PVR was 300 ml, measured by ultrasound testing and the patient left with instructions to perform clean intermittent catheterization twice daily and ertapenem intramuscular injections for a total antibiotic treatment of 14 days.\nThe patient had no PVR on short term follow-up but manifested a new-onset stress urinary incontinence (SUI) and is posted for urodynamic evaluation.
In the 1998 report on the treatment of B, he was 20 years old. B had been a child with a classical gender dysphoric development and fulfilled the current criteria for GnRH analog treatment eligibility. He was interviewed shortly after his legal gender change. This meant that he had had puberty suppression, cross-sex hormone treatment, a mastectomy, ovariectomy, and uterus extirpation. From his assessment during the diagnostic phase, he appeared to be an intelligent person (IQ = 128) with excellent problem-solving capabilities with respect to emotional matters. Vulnerable aspects of his psychological functioning were his insecurity about himself and moderately depressed feelings. In all other areas, his scores on a broad range of measures were in the average range, as compared to Dutch normative samples. Shame concerning his transsexualism made him highly selective in his friendships and guarded in his contacts with new people. At the assessment, 1 year after his ovariectomy but prior to his metaidoioplasty, he no longer reported feelings of gender dysphoria. He had adjusted easily to the male role and expressed no doubts on the adequacy of his masculine behavior. After the development of his secondary male sex characteristics, nobody had ever approached him as a woman. He never felt any regrets about his decision and had never contemplated living as a girl again. Knowing what gender reassignment implied, he would do it all over again. B was happy with his life and did not feel lonely. He showed a significant pre-post treatment decrease in his feelings of inadequacy. At the time, he was attending medical school.\nB attended the pediatric endocrinology clinic for the first time when he was age 13.7 years. His medical history was uneventful. Puberty had started 1–2 years previously, but menarche had not occurred. On physical examination, a healthy girl was seen with a height of 157.3 cm and a Tanner pubertal stage of B3, P3. Bone age according to Tanner and Whitehouse was 13.5 years. Target height, as a female, was estimated at 171 cm, based on the parental height. Puberty suppression was induced by the GnRH analog Triptorelin, in a dose of 3.75 mg every 4 weeks intramuscularly. On this dosage, B steadily kept on growing.\nAt age 18.6 years, his height was 165.8 cm. Induction of male puberty and accompanying secondary male sex characteristics was initiated by administration of 100 mg testosterone-ester mixture intramuscularly every 2 weeks. This was, after 6 months, increased to 250 mg testosterone-ester mixture, every 2–3 weeks intramuscularly. At the start of the androgen treatment, the Triptorelin treatment was discontinued.\nWhen B was 20 years old, he had a subcutaneous mastectomy by way of an infra-areolar approach, a few months later followed by a hysterectomy and gonadectomy. Two years later, metaidoioplasty and testes implantation were performed.\nFifteen years after the first interview and testing session, at age 35, B was seen again at the clinic. He lived on his own and he worked as a family doctor in private practice with two colleagues. All family members knew about his transitioning as did some of his friends. He was very satisfied about his circle of friends and had never been treated negatively because of his transsexualism.\nB was still satisfied about his (minor) breast surgery, his ovariectomy, and his hysterectomy, but no longer about the metaidoioplasty he underwent one year after the first follow-up session. He did not like its size and shape and he could hardly urinate in a standing position. He was able to have orgasms, but he could not have sexual intercourse. Because of his desire to have more convincingly male appearing external genitals and his wish to be able urinate in a standing position, he considered having a phalloplasty. Despite his good looks and very masculine appearance, he had not had many steady girlfriends, which may have resulted from the guardedness he already had as an adolescent. At age 29, he had a serious relationship with a woman, which lasted for 5 years. However, he chose not to live together when the opportunity to do so arose. After his choice to continue living apart, his girlfriend ended the relationship, a few months before his interview at the clinic. This made him very much regret his lack of commitment. B considered it likely that his need to distance himself from her had been related to his shame about his genital appearance and his feelings of inadequacy in sexual matters. Additional factors, such as serious illness of his father and a suicide among his sisters’ in-laws, made him rather sad at the time of the interview. Although his psychoneuroticism score on the Symptom Checklist-90 (Arrindell & Ettema, ) was in the normal range, his depression subscore was high, indicating depressed feelings. However, on the Beck Depression Inventory, he scored in the “minimal range” (van der Does, ), indicating that he did not fulfill criteria for clinical depression. On the Adult Self-Report, assessing adaptive functioning and problems in adults aged 18-59 years (Achenbach & Rescorla, ), all his scores were in the normal range.\nIt seems, therefore, that B functioned well in most aspects of life, but that he was still struggling with the question, how to handle the dissatisfaction and shame about his genital appearance.\nAt age 35, on physical examination, we saw a healthy and well virilized person. Blood pressure was 120/85 mmHg, final height was 169.5 cm and weight was 73 kg, which resulted in a body mass index (BMI) of 25.4 kg/m2. Sitting height was 88 cm. Skull circumference was 55.5 cm. For a comparison of his anthropometrical measurements to the normal reference values of Dutch males and females, see Table .\nA fasting venous blood sample was drawn. General health markers, like hematological parameters (Hb, ht, erythrocytes), renal function, and liver enzymes, were all within the normal reference value ranges. His lipid profile showed a total cholesterol level of 228.3 mg/dl (<251.5 mg/dl), LDL-cholesterol 154.8 mg/dl (<193.5 mg/dl), HDL-cholesterol 55.0 mg/dl (>34.8 mg/dl), and triglycerides 97.4 mg/dl (<177 mg/dl). His glucose value was 97.3 mg/dl (<144.1 mmol/l) with an insulin level of 21 pmol/l (12–96 pmol/l for a fasting sample). His HbA1c was 5.4% (4.3–6.1%). These values were in the normal range.\nWith respect to the gonadal axis, a normal-low serum testosterone level of 236.6 ng/dl (231–866 ng/dl) was found. This relatively low level was probably due to the fact that the blood sample was taken just before the next testosterone-ester mixture injection. Gonadotropins were elevated as a consequence of the gonadectomy. LH and FSH were 16 U/l and 50 U/l, respectively. Additionally determined endocrine parameters, such as thyroid and adrenal function, were all within normal reference ranges.\nWith respect to bone mineral density (BMD), a dual energy X-ray absorptiometry (DEXA) scan was performed to determine B’s BMD in the lumbar spine, the non-dominant hip, and (further) total body. The observed values were related to the bone peak mass for white females and for white males, resulting in T-scores. For all values, the z-score was determined as well (see Table ).
A 27-year-old man underwent surgical intervention for right radial styloid fracture 6 years ago. Several months after the operation, the patient complained of intense and severe burning pain (visual analog scale: 8/10), edema, reduced strength, cold allodynia, and hyperalgesia in the right forearm. He was diagnosed with CRPS type I by a pain management specialist. He underwent a series of right stellate ganglion blocks, which provided minimal pain relief only for the duration of the local anesthetics. The patient was given various medications such as carbamazepine, pregabalin, gabapentin, oxycodone, and fentanyl to manage the pain, but none of medicines provided complete pain relief. Furthermore, treatment by a physical therapist and pain psychologist was also not effective. After struggling with CRPS for 6 years, he was referred to our pain management clinic for SCS insertion. This case report was approved by the Veterans Health Service medical center institutional review board (ID: 2018-09-014). The patient provided written informed consent to have his case details and accompanying images to be published.\nThe results of preoperative laboratory tests, chest radiography, and electrocardiogram were normal. A percutaneous lead trial was performed with a Vectris lead (8-lead array, Medtronics, Minneapolis, MN, USA). The electrode lead was inserted into the cervical epidural space by using the loss of resistance technique. The upper tip of the electrode was positioned to reach the top of the C3 body under continuous fluoroscopy. The lead of spinal neurostimulator was located at the midline of the C3 body (). In the testing of electrodes, complete coverage for the right arm was achieved with the stimulation of the second and third lead. After completing the first stimulation trial, the patient’s pain intensity improved from 8 to 4 on the visual analog scale. In addition to the pain relief, he could touch cold water without allodynia.\nOn postoperative day (POD) 1, his right arm pain aggravated and paresthesia from spinal cord stimulation was now experienced in the left instead of right arm. We tried stimulation of various electrodes to relieve the patient of his left-arm paresthesia, but to no avail. On cervical radiography, it was difficult to find the change in the lead location.\nAt POD 3, a second SCS trial was planned to relocate the lead. The permanent SCS lead was located to the right side of the C3 body to ensure right arm stimulation. The permanent lead was connected to an external pulse generator using an extension cable. After the second stimulation trial, the paresthesia from spinal cord stimulation was only achieved at the right arm of the patient from the stimulation of the second and third lead. At POD 4, he complained of minor inability to focus on nearby objects, but there was no specific problem observed in any physical and neurological examination. Further evaluation for myopia was postponed after SCS implantation. The effectiveness for pain relief between the first and second trial was similar.\nOn POD 6, a surgery for permanent implantation was performed under local anesthesia ( and ). The extension cable was removed, and a permanent lead was connected with implantable pulse generator (IPG, RestoreSensor SureScan MRI, Medtronics) buried under the skin of the right subclavicular area.\nOn POD 7, the patient developed right-sided meiosis and ptosis (). There was no other neurological abnormality such as mental change, headache, motor weakness, or sensory abnormality. He was hemodynamically stable. His pupil size was 3 mm (right) and 5 mm (left) with normal light reflexes. He was diagnosed with Horner’s syndrome based on his clinical examination findings.\nBased on the location of the stimulation lead (C3), the stimulation of superior cervical ganglion was suspected to be the cause of Horner’s syndrome. The stimulation lead was moved from the second and third to the third and fourth leads, respectively (). After stimulation lead change, Horner’s syndrome disappeared in 24 hours (). No further invasive evaluation was required. His final SCS program was 0.5–1 V for voltage, 130 Hz for frequency, and 330 µs for pulse width.
A 42-year-old lady presented to the emergency department with a three-day history of nausea, vomiting, fever, abdominal pain, and disturbed vision. She also complained of a three-week history of bilateral breast swelling and right-sided breast pain. On examination, she was apyrexial and had a pulse rate of 76 beats per minute. Both breasts were dense with no discrete palpable lumps; however, she was also noted to have enlarged left axillary lymph nodes. Her abdomen was very tender in the right lower quadrant. White cell count and C-reactive protein were within normal limits.\nA contrast CT scan of the abdomen and pelvis found increased attenuation with mild thickening of the appendix and a small amount of free fluid in the right paracolic gutter; an enlarged lymph node was also seen in the right iliac fossa (). A clinical diagnosis of appendicitis was made and the patient underwent an open appendicectomy. During the procedure, a morphologically inflamed appendix was found with abnormal thickening at the base; adjacent small bowel loops were also found to be adherent to the base. The postoperative recovery was uneventful and the patient was discharged home three days later with a planned outpatient breast clinic follow-up. Imaging of the left breast (mammograms and ultrasound scan) showed an ill-defined spiculate mass measuring 30 mm by 27 mm () and enlarged left axillary lymph nodes. Core biopsies of the breast mass and fine needle aspiration (FNA) cytology of the pathological nodes were performed.\nHistology of the appendix showed extensive infiltration of the wall by a tumour which was present in sheets of cells sometimes showing an “Indian filing” pattern. The tumour infiltration also involved the lumen, mesoappendix, and peritoneum. Areas of angiolymphatic invasion were also present (). These features were consistent with a metastatic adenocarcinoma of breast origin showing lobular differentiation. The breast core biopsies showed a grade 1 invasive ductal carcinoma with some lobular differentiation () and low grade ductal carcinoma in situ. The FNA of the left axillary lymph node confirmed the presence of metastatic carcinoma. Both tumours were CK7 positive, CK20 and CDX2 negative (the latter precluding a gastrointestinal origin). The tumours were also positive for GCDFP15 (which is consistent with a breast primary), ER positive (7/8), PR positive (8/8), and HER2 negative. Based on the immunohistochemistry results, a diagnosis of metastatic breast cancer was made.\nDuring the postoperative recovery period the patient noted a worsening of diplopia and left-sided headache. A head CT and contrast-enhanced MRI of the orbits were therefore performed. The MRI scan showed a left retroorbital, intraconal soft tissue mass between the medial and inferior recti muscles, suggestive of a metastatic deposit (: MRI orbits). No other significant brain lesions were noted.\nThe patient completed 6 cycles of chemotherapy (FEC: fluorouracil, epirubicin, and cyclophosphamide), each at 3-weekly interval, and was then started on tamoxifen 20 mg daily. Staging scans (CT and MRI) performed after the chemotherapy and endocrine therapy showed a partial response in all the tumour sites, with reduction of the size of the left breast mass, the axillary, peritoneal, and mesenteric nodes. The orbital metastasis had also reduced in size and the patient noticed an improvement in her vision. Repeat whole body staging CT scan 9 months later showed further marginal reduction of the previously noted left orbital mass and no overt intra-abdominal pathology. Given the noticeable improvement in her condition, she currently remains under close clinical follow-up with the oncology team.
In October 2012, a 46-year-old woman was referred to our center for the presence of a large mass (50 × 70 mm) in the superior lobe of the left lung with homolateral pleural effusion. The patient was never smoker, without family history of cancer and without comorbidity. The cytological diagnosis was made using a CT-guided fine needle aspiration of the primary tumor and revealed an adenocarcinoma of the lung (TTF1+, CK7+) with the EGFR ex19del mutation. A PET-CT demonstrated the presence of liver and bone metastases and a nodule in the right breast, confirmed as a metastasis by fine needle aspiration. The patient received zoledronic acid 4 mg every 28 days and gefitinib 250 mg daily since November 2012 obtaining a partial response (PR). In August 2013, a disease progression (PD) was documented, with an increase in size of the primary tumor and size and number of liver metastases. A brain MRI revealed the presence of two cortical nodules, which were treated with stereotactic radiotherapy. The patient was enrolled in the IMPRESS trial and received 6 cycles of cisplatin and pemetrexed plus gefitinib obtaining again a PR that lasted until June 2014. Thereafter, a new lung metastasis appeared in the superior lobe of the left lung and the mammary nodule increased in dimensions. From June 2014 to December 2014 the patient received erlotinib 150 mg daily obtaining an initial stabilization of the disease (SD); however, within 6 months, she experienced again a PD with the increase of the mammary nodule and the appearance of a new bone metastasis in the sacrum. In December 2014, EGFR ex19del and T790M mutations were detectable in a new needle biopsy of the primary tumor; only at this time a digital PCR-based method was available for the analysis of circulating tumor DNA (ctDNA). Briefly, the method was optimized in order to recover a suitable amount of ctDNA for molecular analysis from 3 ml of plasma using the QIAmp Circulating Nucleic Acid Kit (Qiagen®, Valencia, CA). ctDNA was examined using the Prime PCR Probe Assay on a QX100™ Droplet Digital™ PCR System (BioRad®, Hercules, CA) for EGFR mutations (ex19del, T790M, and C797S) []. The ctDNA sample was considered as EGFR mutant when at least one droplet was above the fluorescence intensity threshold of 3000 and results were reported as copies/ml. The first plasma specimen was obtained in December 2014 and confirmed the presence of ex19del and T790M mutations (480 and 260 copies/ml, respectively; Fig. ). The patient was treated with atezolizumab from March to May 2015 and received stereotactic radiotherapy on the lung primary tumor and on metastases of the left superior lobe, breast and bone (sacrum and D10). Due to PD, the patient was given afatinib 40 mg daily from June 2015 to September 2015, but she experienced a further PD with an increase in size of the primary tumor and lung nodules, the appearance of new multiple bilateral lung metastases, lymphangitic infiltration and liver metastases. At this time, the presence of ex19del and T790 M was again demonstrated in a biopsy of a liver metastasis. Since osimertinib was available, the patient was enrolled in the ASTRIS trial and given 80 mg daily starting from October 2015 with an immediate clinical benefit. At the first evaluation a PR was documented with disappearance of most of the lung nodules and lymphangitic infiltration, reduction of the primary tumor and of liver metastases as well. A disappearance of ex19del or T790M was demonstrated in ctDNA in a blood sample obtained in October 2016. However, in April 2017, ex19del appeared again (400 copies/ml) and in July 2017 it increased to 1000 copies/ml, while T790M was also detectable (330 copies/ml, Fig. ). Then, ex19del and T790 M continued to increase to, respectively, 1600 and 510 copies/ml in October 2017, 2100 and 550 copies/ml in November 2017, and 6900 and 1900 copies/ml in December 2017.\nA radiological progression was demonstrated with increase in size and number of liver metastases in December 2017. The patient underwent a new liver biopsy that confirmed the PD and the presence of ex19del and T790M, whereas the ctDNA showed also the appearance of C797S mutation (170 copies/ml), in addition to ex19del and T790M. The patient started chemotherapy with carboplatin and pemetrexed and in February 2018 she obtained an SD associated with a drop of ex19del (800 copies/ml), T790 M (380 copies/ml), and C797S (90 copies/ml) and then a PR in May 2018, with disappearance of C797S and reduction of ex19del (760 copies/ml) and T790M (90 copies/ml). In July 2018, however, ex19del strongly increased to 2200 copies/ml, even though T790M and C797S were undetectable. Finally, in October 2018, when a PD was documented, ex19del increased to 5100 copies/ml, while T790M and C797S appeared again in plasma with 600 and 180 copies/ml, respectively (Fig. ). At this time a NextSeq 550 NGS platform (Illumina®, San Diego, CA) was available to analyse ctDNA by the AVENIO ctDNA Expanded Kit (Roche®, Pleasanton, CA). A plasma sample collected in December 2018 and analysed by NGS confirmed the presence of the ex19del, T790M and C797S and found, in addition, EGFR and c-MET amplifications, which were not present in tissue in the last re-biopsy of December 2017.
A 17-year-old woman was brought to Psychiatry OPD with complaints of episodes of decreased sleep, irritability, and occasional aggressive and violent behavior. She was already on sodium valproate 600 mg/day for generalized tonic-clonic seizures, since the last 2 years from a primary health centre of Uttarakhand state. She had a history of 5–10 convulsions per day for 2–3 days and then seizure free period of 10–15 days. Her episodes of behavioral abnormalities had no correlation with onset of seizures. She reported insignificant improvement in her seizure disorder despite treatment. She accepted noncompliance to the regular treatment, thrice for 15–20 days duration each, during the last 2 years, and admitted that a further increase in seizure frequency during such breaks compelled her to resume the treatment subsequently.\nOn examination, her mental status was found to be normal and no psychiatric disorder was evident. She had history of frequent mood swings of mania and depression associated with episodic behavioral changes which was undoubtedly suggestive of bipolar affective disorder. Her general physical examination was unremarkable. All routine investigations were within normal limits. She was diagnosed as a case of bipolar affective disorder, currently in remission, with comorbid epilepsy. The patient was initiated on higher dose (800 mg) of sodium valproate which was further increased gradually to 1600 mg/day. At this stage, her seizure frequency was reduced to 1–2 convulsions/day on monthly intervals. A further increase in dose caused significant sedation and was intolerable. At this stage, she was referred to a neurologist which she refused to comply with.\nCBZ 200 mg once daily was added to her regimen of valproate 1600 mg/day in consultation with the hospital physician, which was increased to twice daily after 5 days and then three times daily after 10 days of initiation. She tolerated the treatment well until 19th day when she returned with high-grade fever, redness of eyes, swelling all over body, eruptions on lips, face in butterfly pattern [Figure , ] and was admitted in the dermatology ward. On examination, she appeared toxic. Her axillary temperature was 39°C, blood pressure was 90/60 mmHg, and the pulse rate was 70 per min and regular. The lymph nodes, liver, and spleen were not palpable. Next day she had multiple bullae formation all over the body in the symmetrical pattern which gradually increased to involve >60–65% of the body surface area. Epidermal detachment was not evident. She had severe pain during deglutition, generalized body edema, and bleeding per vagina. A mucopurulent discharge was present from oral, nasal, and conjunctival mucous membranes. She was unable to open her eyes because of matting with thick discharge. Her lips were swollen with hemorrhagic crusting. She was in the state of altered consciousness. Examination by a gynecologist revealed that she was in the menstruating phase and vaginal mucosa was found ulcerated.\nHer lab investigations showed that heamogloblin was 13 g/ dL, total leukocyte count 6000/mm3, platelets 1.5 lakhs/mm3, creatinine 0.9 mg/dL, urea 49 mg/dL, sodium 139 mEq/L, and potassium 4.8 mEq/L. Examination of urine revealed albumin (+) and full field RBCs, which correlated with her menstruation phase. Stool examination had RBCs and pus cells indicating mucosal involvement of the bowel. She was HIV and HBsAg negative. Biopsy was not done as her clinical presentation was compatible with diagnosis of erythema multiforme major which was confirmed with an opinion from the pharmacologist.\nHer antiepileptics were discontinued. She was treated with methylprednisolone, chlorpheniramine, and ceftriaxone parenterally, and clobetasol–gentamicin combination topically, along with IV fluids and other supportive measures. After about 2 weeks of intensive indoor management, her conditions started improving and during third week she was again put on oral valproate 200 mg with an incremental increase of 200 mg per day till it reached 1600 mg/day on eighth day of initiation. The patient again started feeling drowsy, which may have had a psychological component as the patient was already anticipating the effect due to past experience. She refused any other addition to her treatment for fear of similar reaction and agreed to bear the possibility of few convulsions per month.\nTwo months after discharge, the patient returned for review and the dose of sodium valproate was increased since the sedation was tolerable. Her dose was increased to 1800 mg and then to 2000 mg in the next month. With this dose she started having about 3–4 months of seizure free period and maintained on the same dose since the last 6 months.
A 1-year-old girl was presented to a hospital in the northeastern part of Ghana with a 1-week history of pustular rashes on her scalp and neck, which occasionally ruptured, along with discharge of yellowish purulent fluid. The child is of Mole-Dagbon ethnicity and hails from the northern part of Ghana. The patient had also experienced recurrent episodes of fever for 3 days, which had been controlled with the use of acetaminophen. The child had no known history of human immunodeficiency virus (HIV) infection, tuberculosis, or other underlying medical condition and lived with her parents, whose primary occupation was farming. The child lives in a rural area about 20 km from the hospital. On examination, the patient weighed 8 kg, was pale and febrile with a temperature of 39.7 °C, and well-hydrated. Her heart rate was 132 beats per minute, and her heart sounds were normal. Her lungs were clear, and her respiratory rate was 35 breaths per minute. A provisional diagnosis of sepsis and malaria was made.\nPending the results of laboratory tests of collected blood, urine, and stool samples, the patient was empirically treated with 270 mg of intravenous cefuroxime three times daily and 40 mg of intravenous gentamicin daily for 48 hours. Intravenous artesunate 24 mg was also administered for the first 24 hours (Table ).\nComplete blood count investigations showed a hemoglobin concentration of 6.6 g/dl and a total white blood cell count of 8800 cells/μl (lymphocytes 52.1%, neutrophils 37.4%). The result of a malaria rapid diagnostic test was positive for malaria. The patient was given a hemotransfusion of 240 ml of whole blood over a period of 4 hours.\nResults of both urine and stool cultures were negative for any bacterial growth. The blood culture sample was flagged as positive after 24 hours of incubation in an automated BD BACTEC 9050 blood culture system (BD Biosciences, San Jose, CA, USA), and a Gram stain of the culture broth revealed gram-negative rods. The broth was subcultured on blood agar, chocolate agar, and MacConkey agar (Oxoid Ltd, Basingstoke, UK) and incubated at 37 °C and 30 °C. Growth characteristics at 37 °C were poor, with grayish nonhemolytic colonies on blood agar and nonlactose fermentation on MacConkey agar. Plates incubated at 30 °C showed good pure growth on MacConkey agar and nonhemolytic colonies on blood agar. Results of biochemical investigations were negative for oxidase and urease and positive for citrate. The isolate was subjected to analytical profile index (API) 20NE and 20E (bioMérieux, Marcy-l’Étoile, France), which yielded unacceptable results.\nMolecular identification was performed by extracting deoxyribonucleic acid (DNA) from a pure culture of this bacterium using SpheroLyse DNA extraction kit (Hain Lifescience GmbH, Nehren, Germany) according to the manufacturer’s instructions. The 16S ribosomal DNA (rDNA) was amplified using the primer pair 8F and 1492R []. The polymerase chain reaction conditions and the subsequent steps of Sanger sequencing we used were based on those described by Liu et al. []. The resulting 16S rDNA sequence was checked using DECIPHER (version 2.2.0; R Foundation for Statistical Computing, Vienna, Austria) to verify that it was not a chimera [].\nThe procedure for molecular phylogenetic inference was based on that described by Ku et al. []. Briefly, the 16S rDNA sequence of the isolated strain was used as the query for sequence similarity search against the GenBank 16S rDNA sequence database. Highly similar sequences representing closely related species were selected for phylogenetic inference. All sequences were aligned using Multiple Sequence Comparison by Log-Expectation (MUSCLE) [], and the resulting multiple sequence alignment was used to infer a maximum likelihood phylogeny using PhyML (version 3.0) []. The bootstrap support values were inferred based on resampling 1000 iterations.\nThe isolated strain reported in this study was found to be most similar to Pseudomonas oryzihabitans IAM 158 [GenBank accession NR_115005] with nucleotide sequence identity of 1455/1460 (99.7%). The molecular phylogeny also indicated that the new sequence is clustered with other P. oryzihabitans strains, which strongly supports the findings displayed in Fig. . The purified bacterial strain has been assigned the strain name Agogo to reflect its geographic origin and the sequence deposited in the GenBank database [accession number KX812763].\nAntimicrobial susceptibility testing was done on the isolated bacteria using the Kirby-Bauer disk diffusion method following Clinical Laboratory Standards Institute guidelines []. The isolate was found to be susceptible to co-trimoxazole, chloramphenicol, ciprofloxacin, and gentamicin but resistant to ampicillin and cefuroxime. The rash on the patient’s scalp and skin, as well as her temperature spikes, resolved after continuous treatment with gentamicin, and her condition improved clinically. She was discharged on flucloxacillin and folic acid therapy 1 week after admission. A final diagnosis of septicemia secondary to bacterial skin infection with malaria coinfection was made.
This is a case of a 68-year-old female presented to the clinic for a 2-month history of recurrent left ankle pain, associated with swelling and edema. The patient had a history of thyroid follicular adenocarcinoma which was treated surgically with total thyroidectomy and postoperative iodine treatment 25 years prior to presentation. At 12 years post thyroidectomy, she was diagnosed with a calcaneal mass of the same pathology and diagnosed with delayed distant thyroid carcinoma metastasis to the calcaneus. 10 years after calcaneal mass excision, the patient was diagnosed with a proximal tibial mass that turned out to be also delayed metastasis of the same pathology.\nAt the first presentation 15 years ago, she initially presented complaining of mild edema of the left ankle with intermittent pain upon daily activity. Physical exam showed full range of motion of the ankle joint with intact motor power and intact neurovascular status. There were no cutaneous lesions.\nPlain radiographs of the left ankle showed a 3-centimeter oval lytic lesion in the anterior aspect of the calcaneum ().\nAn MRI of the left ankle showed a 3.2 cm well-defined benign-looking lytic lesion of the calcaneal neck reaching the cortex which appeared to be mildly irregular with mild degenerative disease of the posterior subtalar joint consistent with an intraosseous ganglion cyst of the calcaneus ().\nMedical treatment with NSAIDs and paracetamol was initiated, along with partial weight bearing and relative rest with no improvement at follow-up at 4 weeks. Surgical intervention was decided due to the persistent pain. The cyst was resected with a margin of surrounding fibro-osseous tissue and the bone grafted. Histopathological evaluation revealed a metastatic carcinoma of the thyroid gland. Immunostaining showed that the cells expressed cytokeratin, cytokeratin 7, and thyroglobulin, all of which confirm the diagnosis ().\nFor further confirmation, the recently excised cyst slides were compared to the pathology slides of the thyroid excision undertaken 12 years prior to the calcaneal presentation and were found out to be of the same pathology ().\nThe patient had a smooth postoperative hospital stay and clinical recovery from pain before discharge; postoperative follow-up showed necrosis of the upper part of the wound which healed by secondary intention.\nThe patient had a complete bone metastasis workup; chest X-ray showed a right upper lobe nodule for which an FNA biopsy under CT scan was done demonstrating the same pathology as for the calcaneus. A bone scan was ordered showing no definitive sign suggesting metastasis with no specific abnormality of the manubrium-sterni joint and the right proximal metaphysis of the right tibia which was nonspecific for distant metastasis according to the nuclear radiologist. After the discussion with the oncologist, decision for radioactive iodine therapy was made.\nAt 3-month postoperative follow-up, while the patient was undergoing chemotherapy, she recomplained of ankle pain upon ambulation, associated with edema. The patient had 5/5 motor strength, no numbness, and no sign of infection. A left ankle X-ray and MRI were ordered () to rule out any recurrence at the surgical site. The new investigations showed oval-shaped lytic lesion of 2.8 cm, and MRI showed increase in size of the calcaneal mass without pathologic fracture.\nThe patient was treated symptomatically; a follow-up MRI at 8 months showed postoperative enhancement in the surgical bed suggestive of viable tissue, and at 10 months, a follow-up MRI showed that there was near total healing of the calcaneal region.\nAfter 10 years post calcaneal mass excision, keeping in mind that the patient was symptom-free with respect to her ankle since the surgery, the patient presented to the clinic complaining of recurrent right knee pain. Investigation showed right proximal tibial metastasis with invasion of the patellar tendon. Surgical resection of the metastasis with repair of the patellar tendon was performed, and pathology was also consistent with thyroid follicular cell carcinoma (Figures and ).\nThe oncologist was consulted, and the decision for treatment with teroglobulin as well as adjuvant radiation therapy was made.
The patient was a man aged 43 years who had undergone a heart bypass surgery in 2009. He was reported to have developed initial symptoms of sore throat and cough on 27 January 2015. He consulted local city hospital 3 days later and Cefotaxime (3 g) was given intravenously at the Outpatient Department (OPD) of the hospital. However, his symptoms were not alleviated, and he was admitted into a provincial hospital on 3 February.\nA chest radiograph showed multi-node and patchy consolidation in the lower and middle lobe of both lungs on 4 February (), with rapid progression of ground-glass opacities and consolidation in both lungs on 6 February ().\nThe blood biochemistry tests are summarized in . The results show that the patient’s white blood cell count decreased during the early stages, which returned to normal levels after treatment, and abnormally increased in the later stages. Neutrophil count exhibited a trend similar to the white blood cell count. Lymphocyte count was consistently lower than normal. Coagulation index detected that D-dimer remained abnormally high, and the platelet count remained normal. Activated partial thromboplastin time and thrombin time were prolonged in the whole process. Arterial blood gas analysis showed that PO2, PCO2, , and SO2 levels remained below normal in all test. After testing for blood electrolytes, K+ levels were found to be normal while Na+ levels had persistently decreased. Liver and kidney were dysfunctional, as indicated by the increased levels of aspartate aminotransferase, creatinine, and blood urea nitrogen.\nThe patient’s condition persistently deteriorated and the patient developed shortness of breath, weakness, poor appetite, coma, and anuria because of progression to severe pneumonia with pleural effusion, and multiple organ dysfunction syndrome (MODS). He died of acute respiratory distress syndrome (ARDS) and MODS on 6 February despite the daily administration of broad-spectrum antibiotics (Meropenem 1 g, Vancomycin 1 g, and Tigecycline 300 mg by intravenously), antiviral drugs (Ganciclovir 450 mg by intravenously and Oseltamivir 150 mg by orally), cocorticoids (Meprednisone 80 mg by intravenously), and with mechanical ventilation at the provincial hospital.\nTranstracheal aspirate sample of the patient was collected on 4 February and H5N6 infection was confirmed by China National Center for Disease Control and Prevention (CDC) using real-time reverse transcription polymerase chain reaction (real-time RT-PCR). Tests for other respiratory agent, such as Middle East respiratory syndrome coronavirus (MERS-Cov), severe acute respiratory syndrome coronavirus (SARS-Cov), and other subtype influenza virus, were totally negative. Later on, the virus was isolated from embryonated chicken eggs. Homologous comparison in GenBank with BLAST showed the viral HA and NA genes are closely related to A/chicken/Shenzhen/552/2013(H5N6), and the HA had a multiple amino acid sequence, “LRERRRKRG,” at cleavage site, belonging to 2.3.4.4 clade (phylogenetic tree was declined to reproduce here by China national CDC). The six internal genes were from the avian influenza virus H9N2 subtypes.\nEpidemiological investigation showed that 2 days before the symptoms presented, the case had contact with wild birds, which were hunted from local city wetland. In addition, he had not contacted with live poultry or individuals with fever or influenza-like illness during 2 weeks before illness onset. The patient’s close contacts, totaling 117 persons, were all healthy following medical observation for 7 days after their last exposure to the case. Environment investigation showed that unusually large amount of death of wild birds or poultry was not found in local place during last 1 month. On 10 February, local CDC collected 13 wild bird feces samples from the wetland and 33 samples, including poultry feces, poultry cage surface swab, chicken lung tissue, and market sewage from local live poultry markets. Results showed no H5-positive sample from wetland, while 63% (21/33) of the samples from local live poultry markets were H5 positive.\nEthical approval for this case report was granted by the Ethics Committee of Yunnan Provincial Center for Disease Control and Prevention, China. Written consent was obtained from the patient’s wife for publication of information and photographs.
The patient was a 71-year old male with history of diabetes mellitus, hypertension, end- stage of renal disease on hemodialysis. He underwent cadaveric renal transplantation to the right lower abdomen without complications. The early postoperative course was uneventful. The patient maintained the adequate urine output. The creatinine level decreased to 1.0. However, on the ninth postoperative day, he experienced sudden pain and swelling in his scrotum, with a drop in a urine output to nearly zero. His creatinine levels abruptly climbed from a nadir of 0.9 to 3.4 over 4 days. The patient's scrotum was markedly dilated with scrotal cutaneous urine leaks. The patient underwent an ultrasound examination, showing the normal looking kidney in the right lower quadrant of the abdomen with normal perfusion and no evidence of hydronephrosis or a perinephric fluid collection. On the next day, the patient underwent Tc-99 m MAG3 radionuclide renography which showed normal renal flow and function with a complete drainage of activity from the renal collecting system to what looked like the urinary bladder. In addition, there was an evident urine leak and an accumulation of radiotracer activity in the pelvic floor extending below the pelvic floor. However, the exact location of the urine leak was unknown (Figure and ). SPECT/CT imaging of the pelvis was obtained to evaluate the exact location and extent of the urine leak. The low dose noncontrast CT was obtained for the purpose of anatomic co-registration with the SPECT images. The obtained SPECT/CT images showed diffuse extensive radiotracer activity extending from just below the transplant kidney to the right pelvic cavity next to the urinary bladder, presacral region, right prepubic region and the scrotum and penis which were markedly dilated as well as into the right abdominal wall (Figure and , Figure , Figure ). The urinary bladder was totally contracted with a Foley catheter, from which no radioactivity drained. The structure looked like the urinary bladder on planar renography was not the real urinary bladder after all, but an accumulation of urine next to the urinary bladder (Fig. ). An emergency operation was undergone. It revealed a ureteral leak secondary to ischemic necrosis of the distal transplanted ureter. A take-down ureteroneocystostomy and cystorrhaphy, right native ureteroureterostomy with insertion of a stent in the transplant ureter, and right native ureteroureterostomy to the transplant UVJ were performed. The postoperative course was uneventful.\nUreteral obstruction and extravasation of urine occur in less than 5% of renal transplants and are usually manifest more than one week after surgery [,]. A posttransplant urine leakage usually requires invasive treatment by either interventional radiology or early surgery []. Early surgical exploration with ureteral reimplantation is indicated for very early leaks, large leaks, or leaks that do not respond to conservative measures.\nThe most common cause of ureteral obstruction or a urinary leak is ischemia of the ureter or renal pelvis. Native ureters have a triple blood supply from blood vessels from the renal pedicle, the adjacent lumbar arteries and the urinary bladder. The last two vascular supplies are lost when the kidney is removed from the donor. The vascular supply to the ureter from the renal pedicle is tenuous, at best, and easily damaged. With ureteral ischemia the ureter becomes fibrotic and obstructed or breaks down and leaks.\nIt usually arises at the anastomotic site []. Causes other than ischemia include undue tension created by the short ureter and direct surgical trauma to the ureter (usually at the time of procurement). Symptoms include fever, pain, swelling at the graft site, increased creatinine level, decreased urine output, and a cutaneous urinary drainage.\nThe diagnosis of a urine leak after renal transplantation is often made by a combination of clinical findings and imaging studies []. The laboratory findings may not be specific because serum creatinine values do not provide a consistent indication of a leak, as they do in cases of obstruction. A leak may result in some systemic reabsorption of urine and hence elevated serum creatinine often mimicking obstruction. Given the difficulty of a clinical diagnosis, imaging studies are therefore necessary to substantiate the presence of urine leakage [,]. Sonography and nuclear renography are the most commonly used imaging studies to diagnose urine leaks [-]. Although sonography is excellent at suggesting the possibility of leakage, the detection of peritransplant fluid by sonography is not specific for a leakage. Although scintigraphic detection of urine leaks has been well documented and nuclear renography is more helpful in the diagnosis of larger leaks, it is dependent on good renal function and limited by poor excretion of the radionuclide in the cases of poor renal function [-].\nOur case showed normal renal flow and function of transplanted kidney with a definite urine leak just below the transplant kidney into the pelvic cavity on the renal scintigraphy. We interpreted a round lesion in the midline of pelvic cavity just below the transplanted kidney as a partial filling of the urinary bladder. The exact evaluation of the location of a urine leak was not possible. The obtained SPECT/CT images showed diffuse extensive radiotracer activity to suggest a urine leak just below the transplant kidney extending to the right pelvic cavity next to the urinary bladder, presacral region, right prepubic region, and the scrotum and penis which were markedly dilated as well as into the right abdominal wall. In other words, SPECT/CT images localized the anatomical location and extent of leaked urine accurately as well as its anatomical relationship with the transplant kidney. The extent of a urine leak was much greater on SPECT/CT images than that was considered on planar imaging. In addition, the structure mimicking the urinary bladder was not the urinary bladder, but an accumulation of urine located in the right pelvic cavity next to the urinary bladder and right inguinal region. We found that SPECT/CT imaging is very useful to localize the urine leak and its extent accurately in the case where it is not possible to see its exact anatomical relationship with the adjacent structures and location on planar renal scintigraphy.
An 81-year-old Japanese man complained of hematemesis and visited a doctor. He was referred to our hospital with the diagnosis of gastric cancer. Since he had not been seen by a doctor before, there are no special notes in his medical history, including the presence or absence of H. pylori infection. Esophagogastroduodenoscopy revealed an ulcer with irregular edges at the middle posterior part of the stomach body. Gastric poorly differentiated adenocarcinoma was diagnosed based on the pathological examination of the biopsy specimen. After making a radiological diagnosis of lymph node and lung metastasis, based on computed tomography findings, the patient was treated with 4 courses of tegafur gimeracil oteracil (S-1) therapy (80 mg/day for 4 weeks with a 2-week rest). After chemotherapy, total gastrectomy and lymph node dissection were performed for the treatment of gastric cancer after confirming that the size of the lymph nodes metastases had decreased and that the lung metastasis had disappeared.\nGrossly, a type 3 tumor of 83 × 50 mm in size was located in the middle posterior part of the stomach body (Fig. ). At the cut section, the tumor consisted of a white and solid part on the anal side of the tumor and flat and an elevated part on the oral side (Fig. a).\nHistologically, the white and solid part of the tumor consisted of poorly differentiated adenocarcinoma with dense lymphocytic infiltration, GC with lymphoid stroma (Fig. b). In contrast, the flat and elevated part was composed of poorly differentiated adenocarcinoma without prominent lymphocytic infiltration (Fig. c). These two histopathological components were clearly separated from each other (Fig. d). The tumor cells invaded up to the serosa in the gastric carcinoma with lymphoid stroma component. Lymphatic and venous invasion as well as lymph node metastasis were detected, all of which showed gastric carcinoma with lymphoid stroma histology. On EBER-ISH, the GC with lymphoid stroma component was positive, while the other component was negative (Fig. a, a–c). On EBER-ISH, tumor cells in the metastatic lymph nodes were positive.\nSince both the EBV-positive and -negative components immunohistochemically showed the overexpression of p53 (Fig. d–f), exons 5–9 of TP53 were sequenced using DNA extracted from formalin-fixed paraffin-embedded sections from these two components. The EBV-negative component showed a C→T transition at nucleotide position 477 (c. 477C>T) in exon 5, which gave rise to a synonymous mutation. In contrast, the EBV-positive component showed no mutations at this nucleotide position (Fig. ). In this study, non-synonymous mutations were not detected in exons 5–9 of TP53 in either component. These observations are in line with previous results from The Cancer Genome Atlas project, which showed that TP53 was less frequently mutated in EBV-positive GC []. However, it is possible that there may be mutations outside the region that was examined in this study or that mutations could not be detected in DNA extracted from EBV-positive GC because of the large number of lymphocytes and the small percentage of cancer cells.\nTargeted next generation sequencing (Oncomine™ Target Test, Thermo Fisher Scientific, Carlsbad, CA), which did not contain a TP53 test, was performed using DNA and RNA extracted from the EBV-positive component and the EBV-negative component, which revealed MYC amplification in the former and ERBB2 (HER2) amplification in the latter.\nImmunohistochemically, the EBV-positive component of the tumor was diffusely positive for C-MYC and negative for HER2, while the EBV-negative part was positive for HER2 and negative for C-MYC (Fig. g–l). Chromogenic in situ hybridization (CISH) showed high C-MYC amplification in the EBV-positive component (Fig. a) and no amplification in the EBV-negative part. On dual-color in situ hybridization (DISH) for HER2, the HER2/chromosome 17 (Chr17) signal count ratio was 3.9 in the EBV-negative component, which was scored as “amplified” (Fig. b). In contrast, the HER2/Chr17 signal count ratio was 1.4 and the average number of HER2 signals per cell was 2.8 in the EBV-positive part, which was scored as “not amplified”.
A 26 year-old man was identified to donate marrow for his brother. His height was 178 cm and his weight was 79.2 kg (Body mass index 25.0). He had no bleeding history or other medical problem. Bone marrow harvesting was performed under spinal anesthesia []. The patient was put in the prone position, and the bony landmarks of the posterior iliac crest and sacroiliac joint were palpated for the identification of a proper puncture site (Fig. ). Aspiration trocar and needle were pushed through the skin and subcutaneous tissue to the posterior iliac crest, and the cortical bone was punctured. Bone marrow aspiration was performed after positioning the needle tip within the cortical wall of the posterior crest []. There was no repositioing of the needle. The total surgery time was 62 min. A total of 900 cc of bone marrow(450 cc per site) was collected which yielded 1.46 × 108 CD34-positive cells from the two puncture sites shown in Fig. . No special problems occurred during the procedure. The donor was hospitalized one more day after bone marrow harvesting to check complications and to control the pain. There was no evidence of hematoma on the puncture sites. While in hospital, he suffered mild pelvic pain which had responded to an oral non-steroidal anti-inflammatory drug (NSAID).\nTwo days after the bone marrow harvesting, a pain of tingling and stabbing nature appeared on his left posterior thigh and calf. Pain score was noted at Visual Analogue Scale (VAS) 7 points on resting and aggravated with motion. Allodynia was present. Sensory of all dermatome was intact, and no muscle weakness was present. However, there was gait disturbance due to pain.\nWe conducted a pelvic magnetic resonance image (MRI), nerve conduction study (NCS), and electromyography (EMG) for evaluation. T1 and T2 weighted images of the pelvis magnetic resonance image (MRI) showed patchy edematous change with enhancement in the sacrum, retrosacral muscles, and subcutaneous layer, and the left S2 neural foramen (Fig. a, b). Imaging studies indicated that the left S2 nerve root was injured by mechanical damage when the puncture needle was inserted and that the nerve irritation and inflammation were the cause of the patient’s symptoms [, ].\nAfter 1 month since the pain developed, nerve conduction study (NCS) and electromyography (EMG) were performed. Nerve conduction study (NCS) revealed normal velocity and amplitude of the common peroneal nerve, tibial nerve, sural nerve, and superficial peroneal nerve. Hoffmann reflex, pudendal evoked potential were within normal limits. Electromyography (EMG) showed abnormal spontaneous activities, which are denervation potentials, in the S2-innervated intrinsic foot muscles and the S1-S2 nerve root innervated muscles such as the soleus, gastrocnemius, and lumbar paraspinalis muscle (Table ) [–]. The amplitude of the abnormal spontaneous activities were about 100 μV, indicating that the development of muscle membrane instability following neural injury occurred within 1 month [] (Fig. ). Electrodiagnostic results along with the patient’s clinical presentation and MRI findings led us to a diagnosis of left S2 radiculopathy.\nThe patient took pregabalin 75 mg two times per day to control the pain, and after 3 months of medication, the patient’s pain improved from VAS 7 to 5 []. A follow up nerve conduction study (NCS), electromyography (EMG) and pelvic magnetic resonance image (MRI) were performed 3 months after onset. Consistently, nerve conduction study (NCS) and Hoffmann reflex were within normal limits, and abnormal spontaneous activities were observed in S2 nerve root innervated muscles. In the pelvic magnetic resonance image (MRI), little residual enhancement was still present along the left S2 nerve root (Fig. c, d).\nAt 6 month follow up, visual analogue scale (VAS) further improved to VAS 3, and electromyography (EMG) showed motor unit action potentials (MUAPs) of re-innervation pattern instead of abnormal spontaneous activities, indicating recovery state (Table , Fig. ). The patient took pregabalin for a total of 8 months. After that, the patient stopped medication. One year later, the patient’s pain was reduced to a level that was not inconvenient, and we did not prescribe any further medication. Additional nerve conduction study (NCS), electromyography (EMG), and magnetic resonance image (MRI) were not performed.
A 40-year-old female patient reported with a complaint of pain and increased swelling on the right side of the face of 1-week duration. The swelling was first noticed by the patient on the right cheek region 4 years back and was not associated with any trauma or chronic irritation. The swelling had gradually increased in size and was asymptomatic until a week before reporting to us during which the patient claimed that the swelling exhibited rapid increase in size and was associated with continuous moderate pain which aggravated on manipulation. No meal time variation in size of swelling was noted and patient did not give history of dryness of mouth. The patient's medical history was otherwise noncontributory.\nClinical examination revealed a solitary diffuse extraoral swelling on the right cheek, measuring about 2 × 2 cm. The skin overlying the swelling was normal with no secondary changes. On palpation, the swelling was tender, with no local rise in temperature, soft to firm in consistency, and lobulated with a smaller hard nodule palpable at the inferior portion of the swelling (). The swelling was nonfluctuant, nonreducible, noncompressible, and nonpulsatile. The swelling was not fixed to any underlying or overlying structures and was freely mobile. There were no signs of altered sensations in the area involved. Intraorally a mild fullness of the right buccal mucosa was noted with no secondary changes with similar palpatory findings as performed extraorally ().\nSoft tissue radiograph of the lesion using puffed cheek technique revealed 3 well-defined radiopaque concentric calcifications which were also visible on posteroanterior skull view and on the panoramic radiograph they were superimposed over the right mandibular third molar region (Figures , , and ).\nUltrasonographic examination of the lesion revealed a fairly well-defined hypoechoic mass in the right cheek devoid of vascularity. Three foci of calcifications were noted within the right masseter muscle. The right parotid gland was normal in size and architecture (Figures , , and ).\nCT revealed a well-marginated round to oval iso to hyperdense lesion seen anterior to the right masseter muscle measuring 1.5 × 1.3 cm with well-defined planes and attenuation values of around 100 HU. The lesion was seen to have continuation with anterior aspect of the masseter muscle which also exhibited irregular hyperdense calcific foci (Figures , , and ).\nMRI revealed a well-defined isointense lesion adjacent to the anterior aspect of the right master muscle, appearing isointense on T2 and T1 sequences; also, hypointense foci with fatty infiltrations involving right masseter muscle were noted (Figures and ).\nFNAC yielded a thick brown material containing sheets of hemosiderin laden macrophages, many spindle cells, and degenerated erythrocytes.\nExcisional biopsy was performed under general anesthesia employing stringent aseptic conditions and endotracheal intubation. Considering the location of the lesion, that is, the muscular plane in relation to masseter muscle, an extra oral submandibular approach was chosen to perform the biopsy.\nRight submandibular incision measuring about 6 cm in length was marked to gain access to the masseteric area. Local anesthesia with adrenaline was infiltrated at the incision site. After the initial skin incision, parotidomasseteric fascia was then incised to gain access to the lesion within masseter muscle; care was taken not to involve any branches of facial nerve and blunt dissection was used. Once the masseter muscle was accessed, it was explored using blunt dissection and the masses of the lesion were localized. The lesion was found to have feeding blood vessels which were ligated before excision. The surgical site was checked for any residual bleeding keeping in mind the suspected nature of lesion. Upon achieving hemostasis, the surgical site was irrigated with povidone iodine solution and saline; suturing was done in layers using 3-0 vicryl and 4-0 prolene sutures ().\nThe excised lesion grossly 3 × 3 cm in size was reddish blue in colour and firm in consistency, with small feeding blood vessels ().\nHistopathological examination revealed a dilated vein with lumen showing papillary processes and anastomosing channels lined by benign endothelial cells. Fibrin deposits and areas of hemorrhage were also seen. No evidence of increased mitotic activity was observed and no atypia of the endothelial lining was evident (Figures and ).\nA final diagnosis of intravascular papillary endothelial hyperplasia/Masson's tumor was made.
A 42-year-old Caucasian woman was referred to our hospital for pain management by a neurologist specializing in the treatment of daily headaches. She had experienced daily intractable headaches since age 18 years. She also had chronic bilateral occipital neuralgia on the basis of the diagnostic criteria outlined in the second edition of The International Classification of Headache Disorders []. Her occipital neuralgia persisted for more than 15 days monthly and was distributed throughout the greater occipital nerves, beginning in the occipital region and radiating upward to the top of the head. When the occipital neuralgia occurred, her occipital area became very tender to palpation. Complete alleviation of her pain had been achieved for a limited time with diagnostic bilateral greater occipital nerve blocks.\nHer medical history included NF-1, which was first diagnosed in childhood. Several neurofibromas had been removed from her sacrum 10 years previously, as well as many from her upper extremities. She also had had problems with depression, anxiety, alcohol consumption, and smoking. She has been a housewife throughout her adult life. With regard to her family medical history, her mother had died at 68 years of age as a result of heart disease, and her father was alive at 72 years of age with a history of cancer. An older sister has rheumatoid arthritis but not NF-1.\nBefore her referral to our service, she had undergone extensive medical management with biofeedback training, physical therapy, massage, acupuncture, and pharmacological management with narcotic and non-narcotic pain medications. Her medications included sustained-release morphine (30 mg every 12 hours), hydrocodone and acetaminophen (10 mg and 325 mg, respectively, every four to six hours), and pregabaline (75 mg every eight hours). More recently, she had undergone three greater occipital nerve blocks that resulted in complete pain resolution that lasted from two to three days. Because she required an ever-increasing dose of morphine for pain relief, and because she had responded to the occipital nerve blocks, she was considered to be a good candidate for OPNS.\nAt her baseline office visit, the patient underwent a disability and quality-of-life assessment by completing a series of questionnaires (see "Quality-of-life assessment" section below) and was found to be a suitable candidate for a trial of OPNS. After the risks and benefits of the procedure were discussed with the patient and her informed consent was obtained, the trial of OPNS was carried out in October 2008 by using two percutaneous eight-contact leads (Octrode; St Jude Medical Neuromodulation Division, Plano, TX, USA). After a week-long successful trial with more than 80% symptom improvement, the patient was deemed a suitable candidate for permanent implantation and she underwent implantation of two permanent percutaneous eight-contact leads (Octrode) and a conventional implantable pulse generator (IPG) (Genesis; St Jude Medical Neuromodulation Division).\nOn the day of the procedure, which was carried out in an operating room, a slow intravenous infusion of 2 g of cefazolin was started, and the patient was placed in a prone position with pillows under her chest to augment neck flexion. Monitored anesthesia was administered by using intravenous fentanyl and midazolam at a level that allowed the patient to be comfortable but able to interact with medical personnel throughout the procedure. The patient's hair was shaved below a line connecting the external occipital protuberance to the mastoid processes, and her skin was treated with chlorhexidine. A sterilely draped C-arm was introduced to obtain a true anteroposterior image of the cervical spine at the C1-C2 interspace, and the overlying skin was marked with a sterile marker. Thereafter a portable ultrasound with a sterile linear array transducer of 5 MHz to 13 MHz frequency was placed to obtain images of the bilateral occipital fossae and the bilateral greater occipital nerves and arteries. The ultrasound probe was first placed at the midline just below the external occipital protuberance (Figure ). The probe was slowly advanced laterally at the same level until the greater occipital artery and nerve were visualized as two distinct structures: the artery as a hypoechogenic oval structure and the nerve as a hyperechogenic structure (Figures and ). The nerve could be traced from its exiting trunk into two distinct divisions within the substance of the trapezious muscle. The artery was identified by using Doppler ultrasound (Figure ). The locations of the nerve and the artery were marked bilaterally on the skin with a sterile marker. The depths of both the artery and the nerve were found to be consistent at 1.0 cm to 1.2 cm from the skin surface. The skin overlying the greater occipital protuberance was injected with 2 ml or 3 ml of 1% lidocaine as a local anesthetic, and the stimulating electrodes were introduced through a 14-gauge introducer needle (0.5 cm to 0.7 cm below the skin surface) in a mediolateral position. Positioning was guided by the skin markings and was verified by fluoroscopy to complement the ultrasonographic images (Figure ). The electrodes were tested intra-operatively by confirming adequate dermatomal paresthesia within the occipital nerve distribution. Implantation of the electrodes was performed by creating a mid-line subcutaneous pocket at the site of needle insertion. The implantable, programmable, rechargeable generator was permanently implanted in a subcutaneous pocket area in the left buttock. For the implantation, a local anesthetic (0.25% bupivacaine with epinephrine 1:200,000 to a total of 20 ml) was used for skin and tissue infiltration.\nTwo months after the implantation procedure, she developed an infection over the occipital implantation area, and the leads and the IPG were removed (Figure ). Bacterial cultures were not obtained during the removal procedure. Her recovery from the procedure was uneventful. After the infection resolved with antibiotic treatment, she underwent re-implantation of two permanent octapolar leads and a new IPG (Eon Mini; St Jude Medical Neuromodulation Division) in March 2009 without additional complications.\nThe patient's pain level and quality of life were assessed at baseline and again at one, three, and six months after implantation. The questionnaires used in these assessments were the short form McGill Pain Questionnaire [], the Visual Analogue Scale (VAS) [], the Oswestry Disability Questionnaire [], and the SF-36 Health Survey []. The data gathered from these questionnaires were plotted for comparison. Qualitative data were also collected from the patient's medical record.\nAfter the trial implantation, the patient experienced nearly an 80% reduction in headache severity. Although the initial implantation procedure was complicated by infection in the implantation site and the patient underwent reimplantation, she has experienced sustained benefit from the treatment and remains infection-free. Over time, the severity, frequency, and duration of her headaches have improved by more than 60%. She continued to use hydrocodone and pregabaline, but was able to discontinue use of morphine. All outcome measures of pain and quality of life were positively affected by the treatment. She reported improvement in her quality of life, which she characterized as "being more active and enjoying life," being able to exercise, working for longer hours, and having improved mood.
A 35-year-old male presented to a regional urban hospital two days following an assault-related blunt traumatic injury. The evening before arrival at the emergency department, he noticed swelling around his chest and neck. It was worse the next morning, precipitating his presentation to hospital. On initial assessment, the patient had a Glasgow Coma Scale of 15, and vital signs were BP 125/66, HR 92, and SpO2 95% on oxygen at 5 litres per minute via nasal cannulas. At the time of presentation, the patient displayed moderate subcutaneous emphysema on physical examination and subcutaneous emphysema on chest X-ray ().\nComputed tomography of the chest, abdomen, and pelvis revealed a left-sided pneumothorax and subcutaneous emphysema (Figures and ). Significant laryngeal swelling was also noted (). The patient was found to have multiple rib fractures, a lacerated scalp, and a Grade 1 liver laceration. A chest tube was not inserted at this time, after consultation with a thoracic surgeon at the nearby Level 1 trauma hospital. Upon reviewing the CT, it was suggested that the relatively small amount of pneumothorax for the degree of subcutaneous emphysema indicated potential pleural adhesions. The view of the thoracic surgery service and trauma was that an incorrectly placed chest tube at the regional centre may have risked entering the lung parenchyma. The patient was transferred to a Level 1 trauma centre 4 and 1/2 hours after presentation arriving 30 min later.\nThe extent of the subcutaneous emphysema was such that the patient could not be placed in a cervical spine collar for transport to the referral facility. His cervical spine was instead immobilized with towel rolls. Vital signs remained stable in transit, and the patient arrived at the trauma centre awake, alert, and breathing spontaneously on supplemental oxygen. The patient was assessed by the trauma service and thoracic surgery.\nOver the next two hours, the patient's condition deteriorated. While the patient had been ordered to get admitted to the trauma nursing unit, the emergency room physician wisely held the patient in the high observation area of the emergency department. Seven hours after initial presentation to the regional hospital and two hours after arrival at the trauma centre, the patient demonstrated altered phonation in addition to yet greater swelling around the neck. In order to obtain a definitive airway in a controlled environment, the patient was taken to the operating room for intubation with surgical standby.\nIn the operating room, the patient's oxygen requirements increased, with desaturation on 10 litres per minute, now via facemask. The patient was also becoming increasingly agitated. An attempt was made at awake fiber-optic intubation, but the posterior oropharyngeal anatomy, glottis, and larynx could not be visualized. Given the increasing oxygen demands and the challenging airway, after considering all options, an awake tracheostomy was performed with a Shiley XLT extended-length tracheostomy appliance. A left thoracostomy tube was then placed. Bronchoscopy in the OR did not reveal proximal tracheobronchial injury.\nThe patient was transferred to the intensive care unit where he remained for 21 days. He had complications of ventilator-associated pneumonia and delirium due to substance withdrawal. A repeat bronchoscopy on day 18 was normal, and he was successfully weaned from the ventilator that day.\nSubcutaneous decompression was achieved with continued suction via the thoracostomy tube inserted in the operating room at the time of the tracheostomy. Considerable subcutaneous air was also seen escaping from the tracheostomy incision. The subcutaneous emphysema had resolved by day 14. He was transferred to the trauma ward on day 21 and decannulated on day 22. A normal CXR was performed on day 23 (), and he was discharged on day 28.
The patient was a female in her thirties who visited her local clinic complaining chiefly of pain in the left occipital to temporal regions of the head, rotational vertigo, and vomiting. Although she had a history of depression and floating dizziness, her symptoms had subsided in recent years and were not a hindrance to her daily life. There was no family history of inheritance vascular wall disease.\nOn the morning of the day of symptom onset, she developed rotational vertigo of no apparent cause. In the afternoon, she developed pain in the left occipital to temporal regions of the head while driving and subsequently started vomiting in the night. Hence, she visited her local neurology clinic on the second day of symptom onset and underwent a computed tomography (CT) scan of the head and plain radiography of the neck; however, there were no obvious abnormal findings and a diagnosis of suspected herpes zoster was made. The woman was prescribed with valaciclovir, pregabalin, and acetaminophen but with no symptom improvement. Carbamazepine and aspirin that were added to the prescription were also ineffective and, hence, she was referred to our anesthesiology pain clinic for examination.\nThe patient had a severe headache during the examination, which she rated 100 mm on a visual analog scale (VAS). Every few hours, she developed throbbing, pulsatile pain that prevented her from sleeping and rendered her practically bedridden during the day. The associated vomiting also prevented her from eating. There was no allodynia of the head, trigeminal paresthesia, or motor symptoms in the region of the facial nerve. She also showed no other abnormal neurological findings in the spinal nerve region and had no skin rash over the left occipital to temporal regions of the head. There were no bulbar conjunctival congestion, fever, or symptoms of meningeal irritation. Her blood pressure was, however, elevated to 160/100 mmHg.\nHer symptoms were considered to be in line with the diagnostic criteria for migraine without aura according to the International Classification of Headache Disorders 3rd edition (Beta version) [], defined as severe unilateral, pulsatile headaches that come in cycles every few hours. The headaches were also accompanied by vomiting. Hence, she was prescribed with 2.5 mg of zolmitriptan. At this point, although the therapeutic effect was inadequate, another zolmitriptan dose of the same amount led to an improvement of her symptoms. Treatment was consequently commenced for migraine without aura. However, since the severe headache was sudden and unprecedented, a differential diagnosis of secondary headache was also simultaneously made.\nTreatment after hospitalization involved regular oral lomerizine with zolmitriptan and loxoprofen as needed. From day 2 after admission, the patient showed a decrease in her VAS score to 50 mm. She nonetheless continued to experience recurrent, severe headache attacks rated 100 mm on the VAS every few hours. Despite the partial efficacy of as-needed use of zolmitriptan, loxoprofen had both a better effect and longer duration of action. Finally, the persistent high blood pressure despite the apparent improvement in her symptoms led us to consult the department of cardiology on day 3, after which antihypertensive therapy with calcium antagonists was commenced. Furthermore, although secondary headache caused by intracranial disease had been ruled out because the patient had been referred to us by a neurology clinic and showed no abnormalities on cranial CT, we decided to perform magnetic resonance imaging (MRI) and magnetic resonance angiography (MRA) on day 8 because of the inadequate effect of zolmitriptan on the migraines and the atypically long duration of the headaches. Imaging revealed the findings of left VAD and occlusion, right VAD and an aneurysm related to dissection (Fig. ). There was absence of ischemic change in the brain on the imaging. Since she required specialist treatment for the VAD, she was transferred to the department of neurosurgery, where treatment with fluid replacement and oral antiplatelet drugs was commenced. The headache in the present case met the diagnostic criteria for headache caused by VAD in the International Classification of Headache Disorders 3rd edition (Beta version) []. The headaches subsequently subsided for a short time and her condition stabilized, although she once again presented with an increase in headaches on day 18, together with further vertigo, nausea, vomiting, motor ataxia (positive result in the finger-to-nose test), hiccups, hoarseness, dysphagia, and thermal hypoalgesia in the right upper and lower limbs, suggesting the development of Wallenberg syndrome. Repeat MRI examination revealed progression of the left VAD, occlusion of the left posterior inferior cerebellar artery, and findings suggestive of cerebral infarction in the left cerebellum and lateral medulla oblongata. She was treated conservatively with edaravone, argatroban, and glycerine, and was discharged home with ongoing rehabilitation and was reintegrated into society 6 months after symptom onset.
We present a 57 year old gentleman with CKD 5 who had an autogenous brachiocephalic fistula 4 months prior to presentation to us. During their last surgical clinical visit, the fistula was noted to be poorly maturing and then referred to interventional radiology for fistulogram and possible endovascular intervention to assist with fistula maturation.\nThe patient had a fistulogram which demonstrated a high grade juxta-anastomotic stenosis which was successfully balloon dilated. After a 6 week follow up clinic visit the fistula was still immature and a duplex scan, a second fistulogram with possible intervention were requested.\nFistulogram was performed via an antegrade approach from an access just proximal to the swing point. There was an “apparent” stenosis (Fig. ) which was angioplastied then followed by severe spasm (Fig. ). which was perceived by the operator to be recalcitrant stenosis. In the light of this perceived recalcitrant stenosis, a decision to stent the area was taken. After measuring the vessel diameter based on the immediate post-plasty images a 6 mm diameter × 5 cm length Viabahn stent (Gore & Associates, Flagstaff, AZ) was selected and deployed in the standard fashion.\nFollowing stent deployment, the stent migrated and stopped at the confluence of the cephalic vein and the subclavian vein (Fig. ). At the time the operator thought the stent was stable and unlikely to cause harm to the patient in this position. However, after reviewing the images with colleagues including vascular surgeons a decision was made to attempt to retract the stent into the arm which would be easier for the surgeon to retrieve the stent surgically, if required. The patient was subsequently brought back 24 h later to the interventional radiology suite.\nInitial fluoroscopic image of the left shoulder region demonstrated the stent was absent from the final position documented the previous day indicating the stent had migrated further (Fig. ). Fluoroscopic scanning of the chest identified the stent to overlie the left lower lobe (Fig. ).\nSubsequent Pulmonary angiogram confirmed the stent to lie within a segmental pulmonary artery of the left lower lobe (Fig. ).\nAfter discussion of the options, risks and benefits with the patient and a multidisciplinary team, a decision to attempt stent retrieval was made versus leaving the stent in situ.\nAfter appropriate informed written consent, the right groin was prepped and in the standard fashion. Right common femoral vein access was then upsized to accept a 16 F sheath (Cook, Bloomington. IN USA). Main pulmonary access was then performed with an APC pulmonary catheter (Cook, Bloomington. IN USA). The APC catheter was then removed over a Storq wire (Cook, Bloomington. IN USA) wire and subsequently a 12 F 70 cm braided sheath was advanced into the main pulmonary artery and then left lower lobe pulmonary artery. Pulmonary angiograms performed identified the optimal projection to identify the vessel to access. After accessing the appropriate vessel the 12F sheath was advanced just to the origin of the branch above the stent. Subsequently a 15 mm Amplatz Gooseneck snare (ev3, Plymouth MN, USA) was manipulated until the stent was lassoed at about half way along the stent. Given the flexibility and potential collapsibility of the Viabahn stent it was over-sheathed carefully collapsing and gently retracting the captured stent to minimize potential vessel injury (Fig. , Additional file ). Once the stent had been totally ensheathed, the 12F sheath was retracted through the outer 16F sheath coaxially. The stent was retrieved intact (Fig. ).\nThe procedure was performed under moderate sedation using Fentanyl and midazolam with continuous monitoring of the patient’s vitals by a dedicated nurse. Throughout the procedure the patient remained hemodynamically stable with normal respiratory function. Post procedure the patient was observed for 6 h post procedure before being discharged home in a stable condition.\nThe patient has so far been followed up for 3.5 years and has not developed any adverse pulmonary or cardiac condition. Interval CTPA done at an outside facility showed normal pulmonary vasculature with no evidence of pulmonary vessel injury.
An 18-year-old girl hailing from Kozhikode, South India, with no past history of any illness, visited our hospital with complaints of fever of 1 week duration. She also had headache that was increasing in intensity and aggravated in the early morning. She also had two episodes of vomiting. She complained of double vision on the third day of admission, which was followed by asymmetric weakness of both proximal distal muscles of all four limbs. There was no history of sensory disturbances and bladder or bowel dysfunction. On examination, her vitals were stable. There was no pallor, icterus, clubbing, lymphadenopathy, rashes or eschar on general examination. Neurological examination on admission revealed normal speech, intelligence and memory. There was no papilledema. She developed bilateral lateral rectus palsy (), with normal upgaze and papillary reflexes. Other cranial nerves were within normal limits. Motor system examination showed normal muscle bulk. Muscle groups in all limbs showed hypotonia with grade 3/5 power in the right lower limb, grade 2/5 power in the left lower limb and grade 4/5 power in both upper limbs. All deep tendon reflexes were sluggish. Sensory system examination was normal. There was neck stiffness with other signs of meningeal irritation. Rest of the systems were within normal limits. Her clinical course is summarized in .\nInitial investigations revealed normal hemogram, with an elevated erythrocyte sedimentation rate (ESR) of 95 mm in the first hour. Blood sugar, serum electrolytes and renal and liver function tests were within normal limits. Computerized tomography of brain was within normal limits.\nWith a history of fever and headache and findings of meningitis, lumbar puncture was done, which showed an opening pressure of 190 mm of cerebrospinal fluid (CSF). CSF analysis revealed a CSF total count of 30 cells with 80% lymphocytes. CSF sugar was normal, and protein was mildly elevated (60 mg/dL [normal 20–40 mg/dL]). Bacterial cultures were sterile. CSF adenosine deaminase and culture for Mycobacterium tuberculosis were negative. India ink stain for cryptococci was negative. Cytology did not show any malignant cells. CSF viral serology turned out to be positive for JE virus with positive IgM antibodies specific for the same insignificant titer. Autoimmune markers in CSF (NMDAR, LGI1, Caspr2, AMPAR [GluR1 and GluR2 subunits] and GABA-B-R) were negative.\nMagnetic resonance imaging (MRI) of the brain showed hyperintensities in bilateral thalami and in the limbic region, suggestive of limbic encephalitis (). MRI of the spine showed T2-weighted hyperintense signal intensities in the spinal cord caudally till the L1 level, predominantly involving the anterior horn cells, and rostrally, they extended upto pons, suggestive of longitudinal myelitis (). Electroencephalogram displayed slowing of delta waves in the frontotemporal region.\nThe patient was treated with supportive measures. However, she deteriorated with the development of altered sensorium and intermittent hypothermia. Oral, axillary, rectal temperature revealed a temperature <94°F on multiple occasions. Electrocardiogram at the time of hypothermia showed bradycardia, prolonged QT interval and Osborn wave (). Other causes of hypothermia such as hypothyroidism and hypoadrenalism were ruled out with normal thyroid function tests and fasting serum cortisol levels. Warm saline infusions and intermittent rewarming were given at the time of hypothermia. She developed intractable seizures and autonomic instability and succumbed to her illness after 2 weeks of hospital care.\nWritten informed consent was obtained from the parents of the patient for the publication of this report and accompanying images.
We report a case of 93 year old British lady, moderately built, living in a residential home. She was admitted for a few times in the past with a diagnosis of Major Depressive episode, Severe with Psychotic symptoms. She had been treated and stabilized with Mirtazapine 30 mg per day. She never smoked or consumed alcohol. She had no past history of chronic obstructive pulmonary disease.\nRecently, she was admitted to Functional Ward with a diagnosis of Major Depressive Disorder, Recurrent, Severe with Psychotic features (296.34). She presented to us with poor sleep, anergia, easy fatigability, poor concentration and low mood. She was noted to have psychomotor retardation with tear laden eyes and Veraguth's folds. She firmly believed that dead people were around her and trying to harm her. She also admitted hearing voices of dead people telling her to die. She appeared distressed and refused to accept food, drink and medications. She was apparently stable in her mood until a month prior to the current admission. She contracted lower respiratory tract infection a month ago, for which she was successfully treated with antibiotics. Despite this, her general condition deteriorated and she refused her medications, food and drink.\nHer general physical condition deteriorated further due to poor hydration and self neglect. On admission, her neurological examination was unremarkable. Her CT Brain showed age related generalized atrophic changes. There was no evidence of space occupying lesion, focal areas of hemorrhage or infarction in the brain. Since there was no history of seizures, focal neurological deficits and CT Brain scan showing age related changes, EEG was not performed.\nIt was felt in Multidisciplinary team that she would improve with a short term course of eight ECTs. As she was unable to consent, second opinion was sought and she was posted for bipolar ECT twice a week for four weeks. Pre-ECT investigations, ECG, Chest X Ray, Blood sugar were normal. The ECT was carried out in conjunction with anesthesia and muscle relaxant medications to produce a mild generalized seizure. Though urea and creatinine levels were deranged initially, they got stabilized once the hydration had improved.\nAfter the first two ECTs, she started accepting her food, drink and medications. Her general condition and hydration improved. She was cheerful and humorous. She started maintaining a good rapport, with appropriate conversation. She was more optimistic about her future.\nCouple of days after the second ECT, she complained of hearing musical notes and songs during most of the times in a day. She heard "Rose in a garden of weeds" which she pointed out to be her favorite song during her childhood. This musical hallucination persisted up to few days after the last ECT. Though she experienced the musical hallucinations, they were not distressing to her. The patient neither experienced the hallucinations nor could recall the song after the completion of the course of ECT. Her depressive symptoms improved. She was stabilized on Mirtazapine 30 mg per day again and discharged to the residential home.\nMusical hallucinations are not uncommon in many psychiatric illnesses, dementias, organic causes, drug induced problems etc; none has been reported to be associated with ECT therapy. Though Wengel SP et al reports that ECT is very effective in treating depression and musical hallucinations [], in our patient; ECT which was started for severe depression has shown a temporal association with the origin of musical hallucination during recovery from depression. Hearing loss is neither a necessary nor sufficient condition for the occurrence of musical hallucinations.
A 40-year-old female patient reported to our institution with a chief complaint of gradually enlarging, painless swelling of both the jaws of 1-year duration with difficulty in speech. The patient was apparently alright 1 year back when she noticed a swelling in the right mandibular region which was painless and caused no discomfort, except for unesthetic appearance. Subsequently, the patient had consulted an oral health care center and underwent radiological examination followed by excisional biopsy along with the extraction of 47. The mass was diagnosed histopathologically as a peripheral ossifying fibroma. However, 1 month after the mass was excised; patient had developed a swelling in the same region again.\nThe patient suffered from hypertension since past 12 years and was taking beta blockers ad aspirin 75 mg regularly for the same. In addition, she was suffering from chronic kidney disease and was undergoing regular dialysis since past 4 years. She also had a history of tuberculosis 7 years back for which she had taken dots therapy for 6 months. She had no habits, and her family history was unremarkable. On general examination, the patient had a small built and normal gait. On extra-oral examination, there was a gross expansion of the midface. The expansion in the maxilla was more pronounced than that in the mandibular region giving the impression of a cherubic face [].\nOn intraoral examination, a generalized bony hard, nontender expansion of maxilla and mandible arches was observed. No pulsations or fluctuant areas were noted. In the mandibular arch, severe buccolingual expansion was seen which was more pronounced in the lower right posterior segment in the 46, 47, and 48 region []. The maxilla revealed buccopalatal expansion which was more pronounced in the anterior part of hard palate [].\nThe mucosal coverage of maxilla, as well as mandible, was smooth, shiny and normal; except on the right side mandibular region where the opposing teeth had caused indentations [Figures and ].\nOn examination of the teeth, 46, 47, 48, 18, and 28 were found to be missing, and there was generalized Grade I mobility with increased interdental spacing in the remaining teeth.\nAfter clinical examination the following list of differential diagnosis was considered:\nCherubism Fibrous dysplasia Pagets disease Osteopetrosis.\nThe orthopantomogram (OPG) was taken 1 year back and on OPG, it was noted as the generalized loss of lamina dura with thinning of cortical outlines of maxilla and mandible [].\nOn histopathological diagnosis (H and E stained slide), proliferative stratified squamous epithelium with underlying fibrous connective tissue was observed. Lesional zones having multiple irregularly shaped bony spicules of woven bone in a fibrocellular stroma, as well as plump fibroblasts and occasional giant cells, were present in the surrounding fibrocellular connective tissue [].\nOn biopsy of parathyroid gland, hyperplasia of right and left inferior parathyroid glands was noted. Left inferior parathyroid gland was associated with focal metaplastic ossification and hyperplasia of right and left superior parathyroid gland was also seen. The radiological examination was performed again subsequently. On Maxillary occlusal radiograph, the loss of lamina dura with a displacement of anterior teeth was noted. Decreased trabecular density and blurring of bony trabeculae with multiple foci of radiolucencies in between were noted [].\nOn mandibular occlusal radiograph, similar findings with bone expansion being evident as a prominent feature was noted [].\nOn OPG, it were noted as the generalized loss of lamina dura, decreased trabecular density, and blurring of normal trabecular pattern causing ground glass appearance. Loss of cortication of superior and inferior border of the mandible was noted along with demineralization and thinning of cortical boundary of mandibular canal [].\nOPG also shows the generalized haziness of maxillary and mandibular arches and superio-inferior expansion of the mandible on right side. Cortication of lower border of mandible, inferior alveolar canal, and posterior wall of maxilla and floor of the maxillary sinus were not seen. A dome shaped radiopaque shadow was encroaching upon the left maxillary sinus was appreciated. On closer scrutiny, the cortices of the anterior border of the ramus and posterior border of the maxilla were not traceable on the right side and hence could not be delineated radiographically. On hand, wrist radiographs, signs of subperiosteal erosion, or any other bony changes were not seen []. Cone-beam computed tomography (CBCT) examination was performed [Figures –] and on CBCT, it was seen as the generalized osteoporosis involving maxilla, mandible, and visualized skull bones. Maxilla and mandible showed bicortical expansion; however the cortical outlines were hypocalcified.\nInternal of the lesion showed both the radiopacities and radiolucencies. Multilocular radiolucencies were seen in the posterior mandible. There was an expansile mass involving the floor and posterior wall of left maxillary sinus, and the mass was found to protrude into the antrum as dome shaped radiopacity in coronal and sagittal sections.\nAfter clinical and radiographic examination and correlating it with the history of patient (chronic kidney disease and dialysis), a provisional diagnosis of secondary HPT was made.\nOsteoporotic changes were noted in the long bones, spines, and chest radiograph [Figure –]. In Figure and it was noted as:\nBoth lobes of thyroid show uniform tracer uptake. Both lobes appear slightly elongated with left lobe extended slightly inferomedially.\nThere are foci of retention is seen in inferior pole region of both lobes of thyroid with normal washout of tracers from rest of the gland.\nThe foci of tracer retention in both lobes of thyroid localize to its anterio-inferior aspect with soft tissue nodularity on fused single-photon emission CT-CT images.\nBoth the lobes of thyroid appear normal in size and shape There is normal uptake of tracer in both lobes of the thyroid gland The salivary uptake is normal.\nThe following differential diagnosis was considered:\nCherubism: At the first impression, diagnosis of cherubism was considered but later ruled out as cherubism is more common in younger age, is familial, regresses after certain age and has no relation to kidney disease Fibrous dysplasia: Fibrous dysplasia will appear as localized radiopacity after maturation. Features such as generalized loss of lamina dura and cortical thinning are not seen. No association with systemic condition is seen Pagets disease: Pagets’ disease is a disease of elderly normally seen after 60 years. Radiographically it will appear as areas of increased radiopacity. Generalized loss of lamina dura is not seen.\nThe patient was subjected to following blood investigations [].\nThus, the laboratory investigations confirmed the changes in blood chemistry, which could be attributed to secondary HPT. The patient was referred to Endocrinology Department of a Government Institute for further management and follow-up was carried out after 1 month.\nPatient was prescribed a combination of sodium alendronate (bisphosphonate) 35 mg 1 tablet once a week, calcitriol 0.25 mcg once a day (OD), cinacalcet 30 mg OD, and sevelamer (phosphate binder) 400 mg three times a day by the endocrinologist and her alkaline phosphatase levels were reduced to 637 IU/L from 1047 IU/L after 1 month of starting the medications.
A 32-year-old female not on any medication was rushed to the emergency unit with severe dyspnea along with intense wheezing, pruritus, and swelling of face for ½ h following multiple bee-stings. She did not complain of any myalgia or muscle weakness of any part of the body or passage of dark colored urine. Examination revealed the presence of generalized urticarial rash, angioedema, nasal congestion, tachypnea, rapid thready pulse, and hypotension (blood pressure [BP]: 96/66 mmHg at admission). A clinical diagnosis of anaphylactic shock was made and patient was administered high flow oxygen, nebulization with levosalbutamol and intravenous fluids (crystalloids). As her respiratory distress was not being alleviated following 1 h of this treatment and epinephrine injection not being available locally, it was decided to administer corticosteroids to diminish her dyspnea. Hydrocortisone (100 mg) was injected intravenously in short push. Her urticaria and dyspnea responded remarkably and her angioedema started to resolve. Hypotension was promptly corrected within 20 min. However, 8 h after admission when her initial presenting complaints had subsided almost completely, the patient developed acute onset, rapidly progressive weakness first involving both lower limbs, mainly in the proximal aspects eventually progressing to proximal aspects of upper limbs within 1 h. She denied any pain or paresthesia and no prior history of fever or upper respiratory tract infection or spinal trauma or vaccination in the past 4-6 weeks was documented. She had no difficulty in urination or in passing bowels and possessed clear sensorium without any seizures. She had no significant personal history and she was not on any medications. There was no history of similar disorders or other endocrine or neurologic diseases in her family. However, she mentioned history of occasional irregular palpitation, heat intolerance, diaphoresis, irritability for the last 9 months following which she was diagnosed having primary hyperthyroidism resulting from diffuse toxic goitre by her local physician. She was admitted 5 months ago with similar presentation due to wasp bite. Both these episodes were controlled with oxygen, nebulization with levosalmutamol and IV fluids alone and did not require epinephrine or hydrocortisone administration. A rapid clinical examination revealed symmetrical flaccid weakness in both upper and lower extremities (lower >upper and proximal > distal; power 2/5 in all 4 limbs). Deep tendon reflexes were depressed in all limbs. Tests of sensorium, meningeal irritation, sensory examination, and cranial nerves revealed no abnormality. Her BP was 124/64 mm Hg and regular pulse rate of 112/min, which was collapsing in nature. Cardiovascular examination during this time showed apical impulse at left 6th intercostal space 0.5 cm lateral to the mid-clavicular line with forceful ill-sustained character. Together with a soft systolic murmur suggested hyperdynamic circulation. Diffuse enlargement of thyroid was noted. Rest of the systemic examination was normal.\nBased on the clinical scenario, a diagnosis of TPP due to hypokalemia was considered most likely with guillain-barre syndrome, segmental myelitis, rhabdomyolysis, hypophosphatemia being the probable differential diagnosis. Serum potassium was 2.3 mEq/L (normal 3.5-4.5 mEq/L). Serum electrolytes including sodium, chloride, calcium, phosphate, and magnesium levels were normal. Other clinical biochemistry was also within normal levels. Electro myography and Nerve conduction study done within 1 h of evolution of the complete weakness ruled out any evidence of myopathy or acute inflammatory demyelinating radiculopathy, respectively [Figures and ]. Electrocardiography showed evidence of hypokalemia in the form of large U wave. Heart rate was 108/min and QTc interval was 0.32 s. Urine sodium and potassium and serum aldosterone and renin levels were measured to rule out adrenal involvement and were found to be normal. Urine spot potassium: Creatinine was 1.4 (i.e. <1.5) and transtubular potassium gradient was 2.6 (i.e. <3), both suggesting the absence of inappropriate potassium loss in urine. Magnetic resonance imaging brainstem and cervical spinal cord revealed no demyelination or acute vascular event or features suggestive of acute transverse myelitis [Figures and ]. She was treated with potassium supplementation initially intravenously (potassium chloride) followed by oral route upon which patient recovered completely within 10 h. She received 140 mEq of potassium (oral and intravenous forms altogether) before complete recovery of weakness. Recovery of muscle power was first noted in lower limbs within 2 h (of initiating potassium supplementation) followed by upper limbs and was complete within 10 h with no residual deficit. Serum potassium at this time was 4.1 mEq/L. Thyroid profile was then obtained — Serum thyroxine (T4) of level 17.6 ng/dl (normal, 5.13-14.1 ng/dl) Serum-free T4 was 3.08 ng/dL (0.5-1.6); serum T3-2.9 ng/mL (0.7-2.1); serum thyroid-stimulating hormone: 0.1 mIU/L (0.14-4.1). Thyroid radioiodine uptake scan revealed a diffuse homogeneous uptake. A diagnosis of TPP associated with diffuse toxic goitre was made based on clinical and laboratory findings. Treatment with propranolol (40 mg/day) and methimazole (20 mg/day) was initiated on the 2nd day of admission. Oral potassium replacement at dose of 80 mEq/L was continued for another 4 days (total 5 days). Serial potassium values on day 2-5, were 3.9 mEq/L, 4.0 mEq/L, 4.2 mEq/L, and 4.0 mEq/L. Potassium replacement was stopped after 5 days, and she was followed up for next 3 days with daily potassium level checks which were in normal range (4.0 mEq/L, 4.0 mEq/L, 3.8 mEq/L). She was counseled for thyroidectomy (to be performed after adequate control of the hyperthyroid state). Alongside, she was advised a low carbohydrate diet and a caution to avoid heavy or strenuous exercise, to be followed life-long. She was discharged in a stable condition on the 9th day of admission.
A 62-year-old white female with a history of hypertension, which is well controlled, was found to have a new irregular density with microcalcifications on screening mammogram. Biopsy showed invasive mammary carcinoma of the ductal type. Tumor was grade 3, ER negative, PR negative, and HER2-neu negative by immunohistochemistry staining. She was diagnosed with stage IIA (T2, N0, M0) breast cancer. She has never smoked and has no history of drinking.\nShe underwent lumpectomy with sentinel lymph node biopsy. Her tumor measured 3.2 cm with negative margins. Lymph node biopsy was negative. She met the criteria for adjuvant chemotherapy treatment. She was enrolled in clinical trial BR003. The trial investigates the benefits of adding carboplatin to the standard chemotherapy in patients with triple-negative breast cancer in the adjuvant setting. She was planned to receive dose-dense adriamycin/cyclophosphamide for 4 cycles followed by weekly Taxol for 12 weeks plus carboplatin every 3 weeks for 4 cycles. She received 4 cycles of adriamycin 60 mg/m2 and cyclophosphamide 600 mg/m2 every 2 weeks for 4 cycles with pegfilgrastim support. She was then started on paclitaxel 80 mg/m2 with carboplatin adjusted for an area under the curve of 6 mg/mL/min.\nShe tolerated 6 cycles of weekly Taxol as well as 2 doses of carboplatin with the exception of mild neuropathy and mild cytopenia. Three days after her cycle 6 of Taxol, the patient presented to the emergency room with abdominal cramping and diarrhea for 1 day prior to admission. She also reported multiple episodes of large amounts of bright red blood with bowel movements. Her symptoms were associated with generalized weakness and fatigue. She denied any fever, chills, nausea, or vomiting. Evaluation upon hospitalization revealed stable vital signs with no fever. Abdominal examination revealed mild diffuse tenderness with no guarding or rebound tenderness.\nLaboratory examination revealed normal white blood cells with absolute neutrophilic count of 6.9 ×109/L, hemoglobin of 9.4 g/dL, and platelet count of 83 × 109/L. Chemistry profile was remarkable for potassium of 3.3 mEq/L. Stool for occult blood was positive. Stool PCR testing was negative for multiple organisms including Campylobacter, Clostridium difficile (toxin A/B), Salmonella, Yersinia enterocolitica, enteroaggregative E. coli, enteropathogenic E. coli, enterotoxigenic E. coli, Cyclospora cayetanensis, Entamoeba histolytica, Giardia lamblia, adenovirus, rotavirus A, and Cryptosporidium. Abdominal X-ray showed no evidence of bowel obstruction or ileus. The patient underwent colonoscopic evaluation, which revealed moderately severe ischemic colitis in the splenic flexure, descending colon, and sigmoid colon (Fig. ). The cecum, ascending colon, transverse colon, and rectum appeared normal. These findings, along with the lack of significant cardiovascular risk factors and previous events, suggested that her condition is likely related to chemotherapy. Pathology showed acute colitis, favoring ischemic colitis (Fig. , Fig. ).\nThe patient was treated with intravenous fluid hydration and bowel rest. Her diarrhea as well as her abdominal cramps resolved within 3 days. She was discharged home and her chemotherapy was held for 2 weeks. After carefully reviewing the literature, the patient was offered to continue on single-agent paclitaxel, with close monitoring after explaining the possibility of relapse. Single-agent weekly paclitaxel was resumed and carboplatin was discontinued. She was able to tolerate the remaining 6 cycles of weekly paclitaxel well.
A 15-year-old boy was diagnosed to have mitral regurgitation with a floppy anterior mitral leaflet. He was also found to have retinitis pigmentosa and Marfan's syndrome. His exercise tolerance was adequate, and he did not have any symptoms suggestive of pulmonary hypertension or heart failure. No symptoms suggesting unstable atlanto-occipital joint were present. He was scheduled for mitral valve replacement. The decision to replace the valve as opposed to a repair was taken because extensive annular calcification was noted in the preoperative transthoracic echocardiography.\nAfter induction of anesthesia, right IJV cannulation was attempted in the standard position with the insertion point at the apex of the triangle formed by the sternal and clavicular heads of sternocleidomastoid using triple lumen catheter set (Arrow, 7F) using Seldinger's technique.\nIn the first attempt, blood was freely aspirated at around 4 cm depth with the finder needle and the introducer needle. During insertion of the guide-wire mild resistance was felt at about the depth the guide-wire was expected to enter the vein. However, the senior resident (who had nearly 3 years of experience after postgraduation) doing the cannulation, managed to thread the guide-wire in, with minimal manipulation. Following dilation, the catheter was inserted over the guide-wire without any difficulty. Since a total of five operating rooms share a single ultrasound machine, it was not available for immediate use at that point of time. It was decided to fix the catheter at 10 cm, but blood could be aspirated from only one side port of the triple lumen. Withdrawing the catheter did not help, and the guide-wire was inserted and the catheter once again advanced. Free flow of blood was not obtained even with this, and the catheter was removed and pressure applied.\nThe landmark was re-identified, and the finder needle inserted. The initial attempt was unsuccessful, and the angle of the needle was reduced. Blood was aspirated at the same depth as in the previous attempt, and free flow was observed. After passing the guide-wire freely, dilation of the vein was done with the dilator. The catheter was passed again to 10 cm and blood could be aspirated from only one lumen, this time from the distal one. A small amount of saline was pushed through the other lumens, and there was no resistance. Again misplacement of the central venous catheter was suspected, and the subsequently catheter was removed and the pressure was applied at the insertion site. A more medial point of entry was chosen (medial to the sternal head of sternocleidomastoid).[] The cannulation was done this time without difficulty. All the three lumens were patented this time as evident by free aspiration of blood. No swelling was found above the clavicle. The patient was hemodynamically stable, and the surgery proceeded. Before going on bypass after heparinization, the only thing noted was a slightly lower blood pressure (BP) of 90/50 mm Hg and a relatively low central venous pressure (CVP) of 3–4 cm of H2O.\nRelative hypotension was ensured at the time of aortic cannulation to prevent dissection of the aorta which is possible in Marfan's syndrome. Operating surgeon was able to trace the tip of the catheter inside superior vena cava (SVC) during CPB. On weaning from bypass, after removing the SVC cannula, it was noticed that the medial portion of the right side pleura was bulging into the operating field. Initially, seepage of blood into the pleura from the operating field was suspected, and pleura was opened. About 1.5 L of clots and blood was removed. At this point, the BP fell suddenly from 90 to 50 systolic. A single, 2 mm tear in the right subclavian vein at the portion where it crosses the apex of the lung was noticed.\nThe tear was sutured in about 10 min and the BP improved. Adequate replacement of packed red cells was done, and the patient was separated from bypass uneventfully. The postoperative course was uneventful.
A 19 years old male presented with a rapidly progressing painless neck swelling of 3 months duration. There were no complaints of fever or weight loss or symptoms suggestive of compression of adjacent structures. The patient was afebrile and had a cystic, non-tender, non-translucent and smooth swelling occupying the whole of the neck anteriorly, extending from the hyoid bone to the suprasternal notch. The lower limit of the swelling could not be reached. There were no neck nodes or dilated tortuous neck or chest wall veins.\nChest X-ray revealed widening of the mediastinum and a soft tissue neck swelling, continuous with the mediastinal shadow (Fig ). On neck ultrasonography, a predominantly cystic, multiseptate mass lying superficial to the thyroid lobes was evident. Fine needle aspirate cytology from the swelling showed largely necrotic material with few macrophages and mixed inflammatory cells on a background of proteinacious material, suggesting a diagnosis of a dermoid cyst. There were no acid-fast bacilli, bacterial and fungal elements on microscopy and culture. 99mTc-thyroid scan ruled out a thyroid lesion. Contrast enhanced CT of neck and mediastinum (Fig and ) showed a multi-septate, predominantly cystic neck mass, superficial to thyroid and strap muscles. The mass was continuous with a more solid intrathoracic mass with areas of calcification and cystic necrosis, extending up to the level of right atrium. The trachea was shifted to the right but there was no compression or infiltration of great vessels or mediastinal structures. There were no mediastinal lymph nodes and pulmonary lesions. A diagnosis of anterior mediastinal teratoma with cervical extension was made.\nThe patient was operated upon through a neck crease and median sternotomy incision under general anesthesia with endotracheal intubation. The posterior wall of the mass in the neck was adherent to the strap muscles. A solid mediastinal tumour with areas of necrosis, which seemed to be arising from the thymus gland, was found on sternotomy. The tumor derived its blood supply from the thoracic vascular channels as direct branches from aortic arch and the subclavian artery. There were no vessels feeding or draining the tumor in the neck. The mass was adherent to but did not infiltrate, the innominate vein. The neck and thoracic mass, along with a densely adherent 4 × 3 cm area of left mediastinal pleura, were removed in continuity, preserving nearby vital structures.\nThe resected surgical specimen was subjected to a detailed histopathological evaluation. On naked eye examination, the globular brownish mass measured 16 × 7 × 2 cms. The cut surface of the mass was cystic, filled with yellow pultaceous material and a mass of hair. There was a solid area projecting into the lumen of the cystic area, which had multiple cysts filled with gelatinous material. On microscopy, the cyst wall showed predominantly degenerate necrotic area, associated with inflammatory cells. Sections from the solid areas revealed cartilage, osseous tissue and nerve bundles with ganglionic cells, respiratory epithelium and sero-mucinous glands embedded in dense fibro-collagenous and fibro-muscular tissue. The lesion was thus labeled as a mature cystic teratoma on basis of the histopathological features.\nThe patient made an uneventful postoperative recovery. After five years in the follow-up, the patient has remained asymptomatic, and follow-up imaging studies in the form of chest x-ray examination undertaken 3, 14 and 36 months after operation, as well as a contrast enhanced CT scan of the neck and mediastinum performed 14 months after operation, have not shown any residual or recurrent mass.
The patient is a 61-year-old male with a history significant for NF-1, hypertension, esophagitis and intermittent gastrointestinal bleeding, who initially presented to an outside institution for acute onset of bleeding per rectum. The patient noted bloody bowel movements with diarrhea for several days, which had increased in frequency over the past 24 hours. The patient reported mild abdominal pain and denied nausea, emesis, chest pain, shortness of breath, syncope or other symptoms at the time. He was not on anticoagulation and denied excessive alcohol or nonsteroidal anti-inflammatory drug (NSAID) use. His family history was significant for NF-1 diagnosed in his mother and brother. He had no significant surgical history other than a total hip replacement.\nOn admission at the outside hospital, the patient’s hemoglobin was 6.6 g/dl, with normal platelets, partial thromboplastin time and prothrombin time. Diagnostic workup at the outside institution included a nuclear medicine gastrointestinal scan (mTc-labeled RBCs), which was negative for abnormal bleeding. On hospital Day 2, his hemoglobin failed to respond appropriately to transfusions and a computed tomography angiogram (CTA) was completed, which showed a 6.9 × 5.8 × 6.8 cm hyper-vascular mass in the left pelvis; abutting the left border of the bladder medially, iliac arteries and veins posteriorly, rectus sheath anteriorly and the small and large bowel (). Vascular supply of the mass was identified to originate from branches of the superior mesenteric artery (SMA) and appeared to be contiguous with the adjacent jejunum. The mass was noted to also abut, but not involve, the sigmoid colon. The CT scan further noted a 9 mm enhancing tumor in the second portion of the duodenum anteriorly (). After administration of five total units of packed red blood cells with limited improvement in hemoglobin, the patient was transferred to our institutions for further management.\nThe patient arrived hemodynamically stable and underwent esophagogastroduodenoscopy (EGD). The EGD was unremarkable with no visualization of the previously mentioned duodenal mass. Colonoscopy was performed, which was notable for bright red blood present throughout the entire colon as well as blood 5 cm proximal to the ileocecal valve (). As the patient continued to have bloody output per rectum, with insufficient response to transfusion, interventional radiology was consulted and proceeded with mesenteric angiography with intervention (). The hyper-vascular mass was found to be supplied by ileal branches of the SMA, which were successfully embolized (). After conversations with the interventional radiology team and the patient, the decision was made to proceed with an exploratory laparotomy and resection of the identified mass.\nExploratory laparotomy was notable for a 7 cm mass originating from the distal jejunum (). This mass was mostly exophytic and a single firing of a GIA load was used to excise the mass with preserved adjacent normal wall of the jejunum. Kocherization of the duodenum revealed a single sub-centimeter duodenal mass at D2. The mass was excised with subsequent primary closure of the defect. Taking down the Ligament of Treitz allowed us to identify two additional proximal jejunal lesions that were resected and resulting defects were primarily closed. The remainder of the jejunum was evaluated and a stretch of proximal jejunum, about 10 cm from Treitz, containing 10 small (0.5 to 2 cm) lesions was identified (). The decision was made to resect a 30 cm segment of jejunum with creation of a side-to-side functional end-to-end anastomosis using a linear stapler. This allowed complete resection of macroscopic disease. The mesenteric defect was closed using multiple interrupted silk sutures. The remainder of the bowel was examined and found to be normal. The patient returned to the intensive care unit and recovered over the course of the coming days without immediate complications and without requiring additional transfusions.\nFive surgical specimens were sent to pathology, including the large intra-abdominal mass, a segment of proximal jejunum (30 cm), the duodenal lesion and two proximal jejunal lesions. Microscopic examination revealed a total of 13 foci of tumor. All tumor margins were negative and 12 regional lymph nodes were examined and revealed no evidence of nodal metastases. All tumors underwent H&E staining () and immunohistochemical staining for DOG-1 (), which was strongly positive, confirming a diagnosis of GIST for all tumors.\nGenetic analysis of the tumors samples was performed on paraffin-embedded tissue using the Tempus XT next generation sequencing (NGS) platform, which includes 648 cancer-related genes. No KIT or PDGFRA mutations were detected (both were wild type). Instead, NF-1 was found to harbor a loss-of-function single nucleotide alteration (c.654 + 1G > T splice region variant).\nThe patient recovered appropriately from his surgery and was discharged one week after the operation. He continues to do well and has returned to full-time work.
A 69-year-old woman with a history of hypertension was identified to have an incidental renal tumor on computed tomography (CT). She denied hematuria, lower urinary tract symptoms, pain, fever, fatigue, or weight loss. Her medical history was significant for hypertension and obstructive sleep apnea. Family history and social history were noncontributory. Physical exam at the time of presentation was normal.\nOn CT, the tumor was an exophytic, enhancing mass (3.0 × 2.0 × 3.5 cm), arising from the lower lateral pole of the left kidney with areas of low attenuation at its inferior aspect. The remainder of the urinary system was normal. No adenopathy or sign of metastasis was detected. An imaging obtained later the same year demonstrated no interval change in the size of the lesion. Biopsy was positive for an oncocytic neoplasm, which at the time was classified as an onocytoma. The patient was managed conservatively and presented 2 years later for repeat imaging.\nA repeat CT was significant for an interval increase in the size of the mass from 3.5 to 5.6 cm in the greatest dimension. Tumor compressed the lower pole calyces without ureteral obstruction. There was no radiologic evidence of tumor calcification, fat, or infiltration into the adjacent tissues. Fine needle aspiration and the biopsies of the mass were again consistent with an oncocytic neoplasm.\nComparative radiologic images are provided (); the top images are radiographs with a smaller tumor from 2 years ago, while the bottom radiographs are from the patient's recent CT with a larger tumor. Given the unusual clinical features and behavior of the tumor, the patient was referred for a radical nephrectomy.\nThe specimen received at the pathology lab was composed of an intact kidney and perinephric adipose tissue (205g, 8.5 × 8.0 × 4.2 cm). At the midlower pole of the kidney, there was a circumscribed, cystic, and focally solid mass (6.0 × 4.7 × 4.5 cm). The mass had a tan-brown multiloculated cut surface (). There was no gross invasion of the renal vessels, ureter, or perinephric fat.\nThe majority of tumor was composed of monotonous cells with distinct borders, abundant eosinophilic cytoplasm, raisinoid nuclei and perinuclear halos, raising a possibility of an eosinophilic chromophobe carcinoma. As anticipated, this cellular component had cytoplasmic staining with Hale colloidal iron and membranous staining with c-kit (CD 117) and Ec-adherin. It was negative with vimentin.\nA smaller subset of tumor cells had increased atypia, higher grade, hobnail morphology, and a tubulocystic architecture set within a desmoplastic stroma. This component was negative with Hale-Colloidal Iron and Racemase and had foci of intraglandular staining with mucin. CK7 and PAX-2 were positive but PAX-5 was negative in both components. Vimentin was only positive in the higher-grade tumor component, morphologically and by immunoprofile consistent with collecting duct carcinoma (see Figures and for the H&E and staining images).\nProliferative index, assessed by Ki-67 labeling, was low in the chromophobe (0–5% nuclear staining) and high in the collecting duct carcinoma component (60% of nuclei).\nOn EM analysis, although the morphologic preservation was somewhat compromised by formalin fixation and paraffin embedding, ultrastructural details of the two types of tumor cells were readily visible and distinctive. The tumor section represented by monotonous cells contained rounded cells with centrally located nucleus (). At higher magnification, their cytoplasm was found to be packed with mitochondria and prevalent electron dense microvesicles (). The central tubulocystic-appearing regions contained elongated epithelioid cells with large, irregularly shaped nuclei (). At higher magnification, the plasma membrane of these cells possessed abundant microvillar projections with junctional complexes joining adjacent cells (). The cytoplasm was rich with organelles including mitochondria and rough endoplasmic reticulum.
A 32-year-old white man presented to a local emergency department with a noticeable puncture wound, progressive swelling, and erythema to the right leg. The injury was sustained when he fell against the metal pedal of his bicycle. After 3 days of hospitalization and multiple courses of antibiotic, a surgical team was consulted for operative debridement of the wound. Diagnosis and confirmation of necrotizing fasciitis by polymicrobial group A streptococcal organisms was made. The resultant surgical debridement of the right posterior leg over the span of 1 week resulted in an open wound extending from the right popliteal fossa to about 8 cm from his right ankle (). After a period of negative pressure wound therapy, the patient was referred to University of California Davis Medical Center for definitive reconstruction of his posterior right leg wound with exposed Achilles tendon. The patient had a history of Hodgkin's lymphoma, currently in remission, and ureteral stone causing hydronephrosis. He had no history of diabetes, alcoholism, or other general medical condition. The patient was a habitual smoker with history of drug abuse. Upon transfer to University of California Davis medical center, he was immediately prepared for free-tissue transfer.\nA line was drawn from anterior superior iliac spine to the lateral border of the patella (). This line roughly corresponds to the intermuscular septum between the rectus femoris and the vastus lateralis muscles. Skin vessels supplying the ALT flap are centered along this line or slightly lateral of it. The midpoint of this line, an area where skin perforators are generally located, was marked. Additional perforators were located within 10 cm proximal and distal to the midpoint perforator. At each location, this conventional naming system of skin perforator clusters provides a guideline for vascular localization. A handheld Doppler was used to localize the skin perforators in the anterolateral aspect of the thigh. The required size of the ALT flap was then measured and marked incorporating these perforators.\nExamination of the foot revealed palpable dorsalis pedis and posterior tibial vessels and a normal modified lower-extremity Allen's test. After debridement of the open wound, the right posterior tibial vessels were exposed for use as recipient vessels. A large free ALT flap with a 15 × 20 cm2 skin paddle based on 2 perforators was harvested from the right thigh for coverage of the right Achilles tendon. No thinning of the flap was performed. Of note, the flap pedicle was medial and pierced through the medial aspect of the rectus muscle, slightly increasing dissection time. Once the flap was raised, the pedicle was divided at the bifurcation from the profunda femoral artery and was anastomosed to the posterior tibial vessels using a surgical microscope without complication. Vein couplers were used for venous anastomosis. Arterial anastomosis was performed with interrupted 9.0 Nylon suture in an end-to-end fashion. The flap was inset to completely cover the Achilles tendon. The remaining exposed gastrocnemius muscle was covered with STSG from the right thigh and vacuum-assisted closure therapy (KCI, San Antonio, Texas) was initiated (). The foot perfusion was examined by normal capillary refill in all toes and palpable dorsalis pedis artery.\nThe patient was placed in an intensive care unit for Cook Doppler monitoring for 4 days postoperatively and on a splint to keep his foot at 90 degrees. The Cook Dopplers and vacuum-assisted closure device were removed on postoperative day (POD) 5, and the patient was discharged home on POD 7 (). Although the patient was scheduled for immediate physical therapy to improve foot function, he did not begin therapy until 4 to 5 weeks after discharge due to financial difficulties. Despite the late start, the patient was able to gain independent ambulation by 8 weeks postoperatively ().
A 52-year-old female presented with a 6-month history of ulceration to the dorsal aspect of the left foot. She related the wound first occurred due to an injury involving a fall from a doorstep 1 year prior and admitted to intermittent swelling and difficulty ambulating ever since. The patient underwent surgical debridement twice for repeated infections at the wound site. Her primary care physician had most recently initiated local wound care by a home health provider on a daily basis consisting of moist gauze dressings since she lived alone and had no other caretakers. She denied being on current antibiotics but stated she was given antibiotics prior to each of her surgeries for the foot. She reported using a wheelchair for the majority of her activities due to her unstable gait. Her past medical history was significant for poorly controlled diabetes mellitus, hyperlipidemia, hypertension, peripheral neuropathy, and glaucoma. She denied drug allergies or use of tobacco or alcohol.\nPhysical examination revealed a well-nourished individual in no distress and stable vital signs. The left lower extremity demonstrated loss of protective sensation, palpable dorsalis pedis and posterior tibial pulses, and pitting edema circumferentially about the foot and ankle. A full-thickness ulceration with fibrogranular base was located at the dorsal aspect of the foot measuring 4.5 cm×2.1 cm with probing to bone, expressible purulence, and periwound erythema. Plain film radiographs and computed tomography of the foot and ankle revealed lateral subluxation of the second through fifth tarsometatarsal joints with dorsal subluxation of the metatarsal bases with osseous fragmentation, cystic osteolysis, and remodeling, in addition to partial collapse about the first tarsometatarsal joint. Magnetic resonance imaging showed extensive marrow edema and enhancement involving the first metatarsal suspicious for osteomyelitis. This constellation of clinical and diagnostic imaging findings were most consistent for Charcot midfoot neuroarthropathy superimposed with osteomyelitis (). Preoperative laboratory analysis, chest radiographs, and electrocardiogram were unremarkable. Non-invasive vascular testing consisting of ankle-brachial index, toe-brachial index, pulse-volume recordings, and segmental pressures showed no evidence of occlusive arterial disease; in addition, formal vascular surgery consultation deemed the patient appropriate for limb salvage without further vascular intervention.\nThe patient was taken to the operating room for ulcer excision, first metatarsal ostectomy with bone biopsy, as well as bone and soft tissue cultures. Bone cultures showed growth of Enterobacter cloacae, while histopathological inspection confirmed chronic osteomyelitis of the first metatarsal base. Two days later, a revisional surgical debridement was performed with partial resection of the first metatarsal base and placement of tobramycin-impregnated antibiotic cemented beads at the resultant defect. Infectious disease consultation recommended intravenous Cefepime based on susceptibility results for a total of 6 weeks duration. The patient maintained non-weight-bearing status during this period with immobilization in a posterior splint and monitoring of the wound in the outpatient setting at 2-week intervals. Upon completion of systemic antibiotic therapy and with no clinical evidence of acute infection, the patient underwent revisional ulcer excision, bone culture, removal of the antibiotic cemented beads, and irrigation. Further debridement at the proximal first metatarsal and dorsal exostectomy of the first tarso-metatarsal was performed to address the sequestrum identified. Due to the extent of the soft tissue defect with exposed bone and joint, the abductor hallucis muscle was harvested for coverage. The tendon was identified at its insertion distally and transected. The muscle was skeletonized from the tendon in a distal to proximal direction, taking care to protect the dominant proximal arterial supply, while all distal minor pedicles were isolated and tied off. The distal remnant tendon was sutured to the first metatarsophalangeal joint capsule, and the muscle was then rotated proximally and superiorly over the medial column defect. Primary closure of the skin was obtained distally while the remaining muscle flap was covered with a split-thickness skin graft harvested from the lateral aspect of the ipsilateral leg. To reduce seroma formation and motion at the graft site, a bolster dressing was secured by skin staples. An off-loading circular external fixator was then applied to the foot and ankle for strict non-weight-bearing and stabilization of the foot and ankle. Six weeks later, the circular external fixator was removed and the limb immobilized in a below-knee cast with subsequent gradual transition to a walking boot and finally custom-molded extra depth shoes. At 11 months post-operatively, the patient continued to ambulate well without further infection, collapse, or skin breakdown ().
A 69-year-old man with pain on urination visited a physician. The patient had no contributory illnesses except hypertension. Urethritis was diagnosed and treated with an antibiotic agent, but it recurred and swelling of the scrotum over the perineum developed. The patient was referred to our department and admitted for further examination and treatment. His general condition was fair, and no high fever developed. Swelling of the scrotum over the perineal region was noted; the perineal skin was disintegrated and there was a purulent discharge. The scrotal skin was partially necrotized, but no tumorous changes were seen. The prostatic findings were normal.\nBlood and chemistry test results on admission were within normal ranges, except for a mild elevation in C-reactive protein. A urinary sediment examination showed a mild degree of pyuria, but no bacteria were observed. Enhanced computed tomography found ulceration accompanied by gas in the scrotum over the perineal region. The cavernous portion was lightly stained in the early phase, and a region with a lower concentration than the surrounding area was noted in the late phase (Fig. a). The patient was diagnosed with an epididymitis-induced scrotal and perineal abscess. A skin incision was made in the abscess region; and discharge of pus, wound irrigation, and Cx with ampicillin sodium were performed. The local findings improved and the perineal wound was sutured. After 3 weeks, the patient re-visited due to urinary incontinence from the perineal suture wound. Endoscopic examination showed rude tissues protruded into the urethral lumen, and causing urethral stricture. Posterior urethral stricture and urethrocutaneous fistula were diagnosed and percutaneous cystostomy was performed. Urine cytology was negative. One week later, a purulent discharge from the suture wound and external urethral meatus was observed. Re-infection was diagnosed and wound opening, pus drainage, and Cx with levofloxacin were performed. On enhanced computed tomography 2 months after the first examination (Fig. b), discharge of pus from a deep region was insufficient and resection of morbid granulation was considered necessary (Fig. a). The infected tissue in the perineal region was resected under general anesthesia. Morbid granulation and scarring reached from the cavernous portion to the urethral mucosal surface. It was not possible to entirely resect the infected tissue. On pathological examination, proliferation of cornified atypical cells was observed and he was diagnosed as squamous cell carcinoma. No finding of metastasis was noted on careful examination, including enhanced computed tomography. The tumor in the perineal region rapidly grew thereafter (Figs c,b). Urethral tumor resection and pelvic lymph node dissection were performed based on the diagnosis of primary urethral cancer. Being continuous to the mass in the perineal region, the penis was entirely hardened excluding the glans. The tumor was en bloc excised including the entire urethra. The pubis was strongly adhered, suggesting invasion. The bilateral external iliac lymph nodes and obturator lymph node were dissected. Tumor size in the cross-section of the excised specimen was 11 × 5.5 cm. On microscopy, atypical squamous cells with a cornification tendency were present, and the tumor was diagnosed as squamous cell carcinoma (Fig. c). The stump was positive, and all lymph nodes were negative. Since the resected stump was positive, 54 Gy irradiation was applied to the pelvic and perineal regions. However, lung metastasis and local recurrence occurred. Cx (3 weeks schedule; paclitaxel 175 mg/m2 Day 1, ifosfamide 1200 mg/m2 Days 1–3, cisplatin 25 mg/m2 Days 1–3) was administered, but his general condition gradually worsened, and he died 17 months after radical surgery.
A 71-year-old woman initially presented to an outside hospital in December 2015 with vague epigastric discomfort. A chest computed tomography (CT) was obtained to evaluate the possibility of a pulmonary embolism, and a calcified cyst was identified in the tail of the pancreas. Of note, laboratory tests were notable for a serum amylase level of 402 U/L and a lipase level of 553 U/L. The patient underwent additional imaging before surgical consultation to further characterize the pancreatic lesion, including an abdominal ultrasound, CT, and magnetic resonance imaging (MRI). The patient was then referred for a surgical evaluation.\nAt the time of her visit, she was asymptomatic, without abdominal pain, back pain, steatorrhea, jaundice, weight loss, or nausea. Her physical examination did not reveal any abnormalities. Pertinent laboratory data included a serum CA 19-9 level of 35 U/mL, HbA1c level of 6.1%, repeat amylase level of 378 U/L, and repeat lipase level of 439 U/L.\nA review of her abdominal imaging revealed a 3 cm complex cystic mass in the pancreatic tail, with thickened septa, and an associated solid nodule that appeared calcified, and was associated with central scarring (). These findings were suggestive of a benign serous cystadenoma. Peripheral enhancement was observed on an MRI (), raising the possibility of a mucinous cystic neoplasm as well. Peripancreatic edema on CT () was interpreted as evidence of acute pancreatitis, further confounding the clinical picture. Endoscopic ultrasound and aspiration of the cyst were not performed because of anatomic inaccessibility related to the cyst's location near the splenic hilum, and away from the posterior wall of the stomach. The patient was offered resectional therapy based on the fact that her symptoms and serum tests reflected pancreatitis, attributable to the pancreatic cyst. The possibility of a mucinous neoplasm and a serum CA 19-9 level at the upper range of normal also factored into the decision.\nA laparoscopic distal pancreatectomy with en bloc splenectomy was performed without incident, although the dissection was challenged by the peripancreatic inflammation observed on imaging, which obscured the natural plane between the splenic vessels and the pancreas. On gross inspection of the resected specimen, the lesion had the appearance of a solid mass with infiltrating tentacles radiating toward the distal resection margin. A cystic component was not immediately apparent. Microscopic examination revealed desmoplastic stroma, which distorted the glands, and atypical epithelium () infiltrating toward the edge of the resection margin. These findings were interpreted to be consistent with invasive ductal adenocarcinoma, and background chronic pancreatitis. The proximal pancreatic neck margin was believed to be microscopically negative for invasive cancer. However, on gross inspection, abnormal tissue extended up to the transected parenchyma, leaving a possibility for a revised diagnosis of a positive resection margin on final pathological review.\nIn light of these unexpected results, the surgical team contemplated converting to an open operation to resect additional parenchyma, and ensure a safe and complete resection in the context of pancreatitis, and a difficult laparoscopic dissection. However, after discussing with the family that the frozen section review was discordant with preoperative imaging, the decision was made to terminate the procedure, close the laparoscopic port site incisions, and defer any further management decisions regarding a more extensive resection until the final pathological review was finalized. Parenthetically, the intraoperative pathological review and family discussion added roughly 30 min to the operation. The postoperative course was uneventful, and the patient was discharged on the third postoperative day. At 6 months follow-up, the patient is well.\nIn the final analysis, the lesion was determined to be a calcified microcystic serous cystadenoma with background chronic fibrosing pancreatitis. There was no evidence of invasive adenocarcinoma ().
A 60-year-old right hand dominant male suffered a blast injury from a stick of dynamite. He was complaining of left hand, forearm, and elbow pain. Patient also endorsed significant numbness and tingling in the left hand. On physical exam, there was significant degloving of the palm and partial amputations of the second and third distal phalanges. Radial pulses were intact, with no evidence of an arterial bleed. A photograph of the hand on presentation can be seen in . Figures and are the initial radiographs of the hand and elbow, respectively, showing the extent of the injury.\nThe patient went for emergent washout and exploration by hand surgery. He was found to have complete obliteration of the superficial and deep palmar arches. Approximately half of the flexor tendons were intact. The thumb was attached via a single flexor tendon and remnant skin. The median nerve was completely severed at the level of the wrist. Open reduction and internal fixation (ORIF) of the distal radius and the distal ulna was not performed because of a lack of viable soft tissue coverage secondary to the traumatic injury from the blast effect as determined by the hand surgeon intraoperatively. The amputation level was partially based on the level at which viable soft tissue coverage was available for coverage of bone. The hand surgeon proceeded with a transradial amputation.\nClosed reduction of the ulnohumeral joint was performed by the orthopaedic team once hand surgery was done with their part of the procedure. The patient required 90 degrees of flexion at the elbow to maintain reduction due to gross instability. 3D reconstructions from the postreduction computerized tomography (CT) scan are seen in Figures and showing the terrible triad injury of the elbow.\nTwelve days after the initial injury, the patient returned to the operating room for definitive fixation. A Kaplan approach was used, which demonstrated rupture of the lateral collateral ligament (LCL) as well as a comminuted radial head fracture. An ulnar nerve decompression was performed because of preoperative ulnar nerve symptoms. A Hotchkiss “over the top” approach was used to expose the coronoid and medial collateral ligament (MCL), which demonstrated a midsubstance disruption. MCL was reconstructed and reattached to the medial epicondyle. The small coronoid tip fragment was excised. A cemented radial head arthroplasty was performed. LCL was then repaired. The remnant radial shaft and ulnar shaft were percutaneously pinned in neutral pronosupination due to instability noted intraoperatively.\nThe patient was seen in the clinic two weeks postoperatively. Radiograph () revealed maintained reduction of the ulnohumeral joint and satisfactory alignment of the radial head replacement. The patient was noted to have a stable arc of motion between 20 and 90 degrees. Five weeks after reconstruction, the distal forearm pin was removed. The patient had a flexion arc of 5-90 degrees, but limited pronosupination. Two months postoperatively, his arc of motion was 5-115 degrees, as seen in Figures and . He was able to attain 50 degrees of pronation and 50 degrees of supination. Radiographs at that time once again show intact hardware, seen in .\nThe patient was seen again at 12 months postop for prosthetic consult. The patient was fitted for prosthetic devices including the body-controlled hook prosthesis and the myoelectric hand prosthesis. The patient chose the myoelectric device due to the cosmetic appearance and fine motor capabilities. shows the myoelectric device prior to fitting. Figures and show the patient during his prosthetic fitting. We will continue to watch his progress and long-term outcome.
A 22-year-old female, weighing 53 kg, with a height of 153 cm, data entry operator by profession, presented to the outpatient skin department in January. The patient reported with gangrene and black spots of multiple fingers and toes with severe pain since last one month. She was diagnosed with SLE and was started on prednisolone and hydroxychloroquine. A Doppler examination of limbs was performed with contrast injected intravenously through the left internal jugular vein to prevent venous contamination in limbs since all limbs were affected and were to be evaluated. CT angiography of upper limbs revealed attenuation of bilateral radial and ulnar arteries with poor distal run off seen in left radial artery and in left ulnar artery run off till hand was seen. No thrombus was seen. In the lower limbs, bilateral arteries below the knees were attenuated. Right anterior tibial artery and right peroneal artery were attenuated and left posterior tibial artery was totally obliterated []. No thrombus was seen.\nFor the management of pain and gangrene of her fingers and toes, she was referred to the pain clinic of the anaesthesia department. On examination, she had gangrene in the right index and middle finger, left thumb and index finger with multiple black spots in rest of the fingers and toes []. She had rest pain of numerical rating score (NRS) 8 in upper limbs and NRS 6 in lower limbs. She was very anxious and being a data entry operator required her to primarily use her fingers while working on the computer. After taking her consent, she was admitted for sympathectomy blocks. All blocks were performed in the pain clinic block room after securing an intravenous cannula on the wrist and attaching pulse rate and non-invasive blood pressure monitors and pulse oximeter. The monitors were attached on ear lobes as none of her fingers and toes showed any waveform or value on pulse oximetry. She was given ultrasound-guided stellate ganglion nerve block (USGNB) with a linear probe of 13–6 MHz (Fujifilm SonoSite Edge) with 5 ml of 0.25% ropivacaine and clonidine 15 μg on the more-affected right side. Clonidine was added as an adjuvant to prolong the effect of ropivacaine and for its vasodilatory effects as demonstrated previously.[] The block was performed in long axis with 26 gauge 1.5 inches hypodermic needle attached to a 10-cm extension line without giving prior local anaesthetic because of the small-gauge needle used to perform the block []. The needle was inserted from lateral to medial side of the neck, placing the needle tip between longus colli muscle and carotid sheath at level C7 vertebra—the anatomical location of stellate ganglion. Before injecting the drug, saline was injected to ensure the needle tip is not placed either in longus colli muscle or within the carotid sheath []. After monitoring for any untoward side effects for an hour, a left-sided USGNB with the same drug volume was injected, and the patient was observed for another 1 hour. Her NRS decreased to 3 but, after 5 hours, she again complained of pain of similar intensity. Therefore, a bilateral USGNB was repeated in the evening with similar drug injectate and precautions. The next morning, she reported NRS >5, and thus a continuous stellate ganglion block on the more-affected right side with plain 0.25% ropivacaine 2 ml/h was planned with left side USGNB planned twice a day. For continuous infusion under ultrasound guidance, an epidural needle was used to perform the block and epidural catheter was threaded to place the catheter tip between longus colli muscle and carotid sheath at level C7 vertebra. The catheter was also tunnelled at the skin entry point. Left-sided USGNB was performed twice a day, both times, after stopping the infusion of the right side for an hour before and after the block. Catheter was inserted thrice in the course of treatment of 35 days. Catheter tip was checked for correct position twice a day, and infusion was disconnected at night between 12 and 4 am for the patient to sleep comfortably. The average time of correct position of the catheter tip was 3–5 days. At every block, the spread of local anaesthetic was looked for to prevent deposition of drug either in the adjoining vessels or inside the carotid sheath to avoid phrenic nerve palsy. In addition, precaution was taken to avoid deposition of drug in longus colli muscle, which would result in an ineffective block. In about a week, the gangrene of the patient's fingers started improving. She was admitted for 35 days during which a total of 64 USGNB injections were given. For lower limbs, a single epidural injection block was given twice with 8 ml of 0.25% ropivacaine and a continuous epidural infusion was given once with 3 ml/h of 0.125% ropivacaine for 3 days. None of this resulted in any motor weakness. With this treatment, the blackness of toes of lower limbs and pain completely regressed. Upper and lower limb infusions were never given simultaneously, and the total dose of ropivacaine was calculated at all times and kept within safe limits with intense monitoring during the peri-block period. 20% lipid and resuscitative equipment were kept in stand-by at all times. Supportive treatment to keep all limbs warm with gloves/socks was ensured and enforced at all times. Medical management was continued.\nAt every block, the pulse oximeter probe was attached to all fingers and toes, which showed improvement in the quality of waveform and/or pulse oximeter value after every block. Thirteen days after the commencement of blocks (around halfway through the 35-day treatment), repeat computed tomography (CT) angiography revealed bilateral ulnar arteries to be unremarkable in contrast to previous report. Right radial artery was normal and there was increase in calibre of left radial artery, both showing improvement from previous reports. Similarly there was marked improvement seen in lower limbs with normal bilateral anterior tibial arteries, bilateral peroneal arteries and right posterior tibial artery. Only posterior tibial artery remained attenuated [].\nBy the end of 35 days, she had no rest pain in any of the fingers and toes. All her fingers with wet gangrene had dried. No repeat CT angiography was done due to financial constraints of the patient. Pulse oximetry waveform pattern improved in all fingers and toes with improvement in waveform and a value of >95% in all fingers.\nAt the 7-month follow-up, there was no pain or blackening of her fingers and toes, however, she had lost the distal part of the terminal phalanx of the right finger which was worst affected when she had first reported to us []. Nevertheless, this did not affect her profession and she was happy to return to her job successfully. She is under follow-up with us since the last 2 years with no similar complaints.
A 24-year-old previously asymptomatic male presented to his primary care physician with a complaint of focal penile irritation related to sexual intercourse. The irritation originates from a lesion along the midline on the dorsum of his penile glans. He was referred to a urologist for further evaluation.\nThe patient reported noticing a small dimple along the midline on the dorsum of his glans for as long as he could remember. The lesion had not previously caused him any discomfort, nor did he report a history of discharge, including urine, semen, blood or pus from the orifice. In recent months, the patient has become more sexually active and he has become aware that during and after intercourse the site is painful and inflamed for a short period of time. The patient wants to make sure there is not something wrong with his anatomy and seeks a solution.\nThe patient had no significant past medical history. There is no family medical history of relevance, specifically no one has reported any genital malformation. Physical examination by a urologist demonstrated a well-developed adult male. A small midline opening was present on the dorsum of the penile glans. There was no focal erythema or discharge present at the time of examination. Manipulation of the opening demonstrated a thin lumen that appeared to continue proximally along the dorsum of the penile shaft. The most likely aetiology was determined to be urethral duplication. Imaging was necessary for confirmation and to delineate the particular anatomic presentation in order to plan treatment. Demonstration of communication with the urethra or bladder would require more extensive surgical intervention to eliminate the sequelae of discharge accumulation in the lumen causing infection, cyst formation or recanalisation of the accessory orifice. The patient was referred to radiology for urethrography.\nSince no urine, semen or other discharge had ever been noted to exude from the accessory urethra, a retrograde urethrogram (RUG) was performed (). A 5F paediatric catheter was advanced 3 cm through the dorsal accessory meatus. Simultaneously, a 6F Foley catheter was inserted into the orthotopic urethral meatus and the retention balloon inflated in the fossa navicularis. Cystografin contrast was manually instilled into both catheters. Opacification of the accessory meatus demonstrated a hypoplastic urethra traversing the dorsum of the penis and terminating blindly at the level of the levator musculature. No contrast was visualized refluxing into either the orthotopic urethra or the bladder. Contrast injected into the orthotopic urethra demonstrated a normal appearing urethra terminating at the sphincteric musculature. There was 2 mm of distance separating the terminal blind end of the accessory urethra and the orthotopic urethra. Based on the radiographic evidence a Type 1-A urethral duplication was diagnosed.\nAfter confirming a Type 1-A urethral duplication the patient was offered and consented to operative reconstruction. A short rigid ureteroscope was used to inspect the main urethra and bladder demonstrating the appearance of normal verumontanum and sphincteric mechanisms confirming the ventral urethra as the functional urethra. The ureteroscope was then used to evaluate the accessory urethra and passed through to the blind-end. The accessory urethra was cauterized as the ureteroscope was withdrawn.\nThe patient tolerated the procedure well without any reported postoperative complications. At follow-up the patient did not report recurrent irritation during sexual intercourse and was pleased with the cosmetic result.
A 24-year-old Caucasian man presented with a several month history of muscle pain, fatigue and insidious onset of pitting edema to his lower extremities. His symptoms progressed to include bilateral arm swelling, muscle pain to the thenar eminence of both hands, and paresthesias to his hands. He did not have a rash, joint pain, Raynaud phenomenon, oral ulcers, fever, hardening of the skin or weight loss, and he denied any cardiac, respiratory, genitourinary, or gastrointestinal symptoms. Prior to symptom onset, he had traveled to South America and reported possible ingestion of undercooked meat as well as swimming in a river and lake. He had frequent visits to the Northeastern United States and had recently spent an extended period of time outdoors in Rhode Island. Medical, surgical, and family histories were unremarkable, and he was not taking any medications. He had a history of mild alcohol intake, no history of smoking, and some marijuana use. On examination, his vital signs revealed a blood pressure of 104/57 mm Hg, pulse of 56 bpm, and normal temperature. He had no significant findings on head, neck, cardiovascular, respiratory, or abdominal exam. He had no cervical, axillary, or inguinal lymphadenopathy. He had significant pitting edema on his feet and legs extending up to his knees as well as non-pitting edema on the dorsum of both hands. Although there was edema, the skin was soft without any significant hardening and was without any overlying erythema. There were no signs of skin dimpling or grooves. His neurological examination revealed normal strength.\nHis initial laboratory work was significant for a mild eosinophilia of 700 with a normal white blood cell count, hemoglobin, and platelets. He had normal calcium, creatinine, and electrolyte levels. His alanine aminotransferase was slightly elevated and total protein slightly low, but he had normal albumin and bilirubin. His thyroid-stimulating hormone was slightly increased, but his free T4 and total T3 were normal. His urinalysis was normal. He had a normal level of creatine phosphokinase, sedimentation rate, and C-reactive protein. Further workup revealed a positive anti-nuclear antibody with a titer of 1:160 with a speckled pattern. His extractable nuclear antigen panel was negative, including Scl-70. His ANCA, myeloperoxidase and proteinase-3 serum studies were also negative. His ACE level and complement levels were normal. Infectious workup revealed negative stool studies for culture, ova, and parasites. Antibodies for HIV, CMV, and Trichinella were negative. Serum for histoplasmosis, cryptosporidium, coccidiomycosis, and interferon gamma release assay were negative. A blood smear for parasites was negative. An ELISA IgG/IgM test for Lyme disease was positive with subsequent testing with Western blot strongly positive for IgG (eight out of ten bands positive) and also positive for IgM (two out of three bands positive).\nThe patient had extensive imaging done with a normal CT scan of his neck, chest, abdomen, and pelvis. An echocardiogram was also normal. Due to a previous negative workup along with persistent pain and swelling, an MRI of his right lower extremity was performed (see Figure ). Imaging demonstrated extensive circumferential edema with enhancement of the superficial soft tissues, superficial fascia, and, to a lesser extent, deep fascia of the lower leg. Taking into account the mild peripheral eosinophilia and the imaging findings, a diagnosis of eosinophilic fasciitis was considered. To complete the workup, a biopsy of the fascia, muscle, and adipose tissue of the left calf was taken (see Figure ). The biopsy did not include the dermis. Surprisingly, there was no evidence of eosinophilic fasciitis. Instead, the specimen illustrated a striking granulomatous fasciitis and vasculitis. The fascia showed exuberant granulomatous inflammation (Figure A) with an inflammatory infiltrate that was made up predominately of histiocytes and CD3-positive T cells with very rare eosinophils (Figure B). The granulomatous inflammation centered primarily on small- to medium-sized blood vessels and was non-necrotizing. While the vessels did not display overt fibrinoid necrosis, they did appear damaged with loss of endothelial cells confirmed with CD31 immunostaining. The inflammatory infiltrate was seen extending into adipose tissue and particularly around blood vessels within the fat. The adjacent skeletal muscle also showed perivascular inflammation and vasculitis in both the perimysial and endomysial compartments. There was no endomysial fibrosis, fatty infiltration, or inflammation surrounding muscle fibers. AFB (acid-fast bacteria) and Wade-Fite stain were negative for mycobacterial organisms. GMS (Grocott-Gomori's methenamine silver) stain was negative for fungal organisms. Due to the positive Western blot for Lyme, a Warthin-Starry silver nitrate stain was performed to evaluate for spirochetes; however, no definitive organisms were seen. A Borrelia PCR analysis of the tissue was performed as well, but no DNA was detected.\nThe patient was given a diagnosis of granulomatous fasciitis along with a diagnosis of Lyme disease. He was first treated with doxycycline for 42 days straight due to initial Lyme serology being positive. The calf biopsy revealing fasciitis was not performed until the patient was 3 weeks into the doxycycline course. Once fasciitis was diagnosed, he was started on a prednisone taper starting at 1 mg/kg/day for a week with taper by 10 mg every 2 weeks. After 2 months of treatment with prednisone, the patient had near resolution of symptoms. A repeat MRI was performed 82 days after the initial MRI with the previously seen changes consistent with fasciitis nearly completely resolved with only a thin sliver of edema over the superficial fascia. On re-evaluation of the patient, he reported skin changes to his left upper arm at 20 mg of prednisone per day and skin changes to his left forearm at 7.5 mg per day. Examination of the upper arm revealed an atrophic patch with some overlying erythema and examination of the forearm showed indurated, bound-down, tense skin with a slight groove and minimal overlying hyperpigmentation. The rest of the dermatological examination was within normal limits. Skin biopsy revealed marked septal thickening with sclerosis, sparse lymphoplasmacytic infiltrate along the dermal subcutaneous junction, and swollen, homogenized collagen fibers with diminished spaces between the fibers (see Figure ). The clinical examination along with pathology revealing dermal and subcutaneous sclerosis was consistent with a diagnosis morphea profunda. Lyme serology was repeated, but Western blot for IgG was negative. A scleroderma antibody panel was negative as well. He was started on methotrexate and a higher dose of prednisone.
A 37 year old male and current smoker (1 pack per day) with a history of prostate rhabdomyosarcoma at age 2 treated with partial resection and high dose external beam radiation presented to the emergency department (ED) with fever, groin pain and abdominal distension. His history was notable for numerous complications including bilateral osteonecrosis of the hip, lifelong complete urinary incontinence, a dense rectal stricture causing chronic colonic dilation and critical lower extremity ischemia due to bilateral iliofemoral disease. He had undergone 45 procedures to address these complications. He was initially managed conservatively for intestinal obstruction secondary to a rectal stricture. Rectal dilation was performed. Subsequently, he developed MSSA (methicillin sensitive Staphylococcus aureus) bacteremia and an abscess was noted in his left thigh (adductor region). The abscess was drained under ultrasound guidance by the interventional radiology team, and the drain was removed after a week. A month later, he presented to the ED with fluid draining from the former site of the IR drain. The fluid was found to be urine, with creatinine of 30.9 mg/dL. A Foley catheter was placed, and retrograde urethrogram (RUG) showed a urethrocutaneous fistula from the bulbar urethra to the left thigh (). Cystoscopy and subsequent biopsy of the fistula revealed no malignancy. Given the need of serial rectal dilations for his chronically dilated large bowel, the patient was formally recommended a permanent colostomy, but he declined. He was discharged with catheter in place and the fistula site dry.\nAs definitive treatment for the fistula, an ileal conduit urinary diversion with partial cystectomy was done. The patient was discharged postoperatively on day 12, with fistula dry and scant discharge per urethra. Two months after this surgery, the patient developed a cold lower limb for which he underwent a successful axillary-femoral artery graft thrombectomy. The next month, he also underwent a major hip joint reconstruction. 8 weeks later, he developed fever and chills followed by passage of feces per urethra. The next week, he developed fecal drainage from the left thigh as well. A RUG was performed and revealed a rectourethral fistula (). To treat this rectourethral fistula an end colostomy with distal mucus fistula was performed. Drainage from the urethra and thigh fistula persisted despite the surgery. Proctoscopy showed a tight rectal stricture at 8 cm. Colonic irrigation through a red rubber tube, passed through the distal mucus limb of his colostomy was done with the aim of clearing out the stool in his distal colon from his thigh fistula.\nThe cutaneous fistula remained dry for several weeks. Leakage per rectum remained minimal. He then reported passage of sutures per urethra and discharge of straw-colored peritoneal fluid from both the urethra and thigh fistulae. As a temporary measure, he underwent intraoperative cystoscopic identification of the fistula site and urethral bulking therapy using a dextranomer and hyaluronic acid (Deflux®, Salix Pharmaceuticals, Raleigh) applied to the fistula site. Debridement of the left groin fistula tract, and negative pressure wound therapy placement to control drainage from the peritoneo-urethral fistula was also done. Postoperatively, the drainage from the thigh and urethra persisted, so he underwent takedown of the previous descending colostomy and mucus fistula, descending colectomy and proctectomy, creation of a new permanent colostomy and simple cystectomy. As drainage still persisted after this, his urethra was closed perineally proximal to the fistula, and the defect was reinforced with a pedicled rectus femoris muscular flap. His incisions have healed well, and he no longer has drainage 5 months after surgery.
A 17-year-old female patient was referred to the Infectious Diseases Ward from a district hospital because of prolonged fever lasting for 14 days. In the patient history, in the evening of the first day of the onset of symptoms the patient reported a temperature of 40°C, pain in the lower limbs and muscular pain. The next day, the patient was without fever but developed a sore throat and had enlarged submandibular lymph nodes. The patient was consulted by her family doctor, who diagnosed a throat infection and prescribed second-generation cephalosporin (cefuroxime axetil) and ibuprofen. After a few days, the sore throat was relieved, although the fever remained. Five days later, the patient went to a gynecologist with the symptoms of intense lower abdominal pain during her menses; a gynecological examination revealed no abnormalities. On the basis of her fever for the previous 8 days and not responding to antibiotic treatment, the patient was admitted to hospital for further evaluation.\nOn being admitted, the patient was in a generally good state, with good contact and orientation, no pathological changes on the skin, a body mass of 60 kg, height of 170 cm, body mass index (BMI) of 19.33, blood pressure of 110/70 and without any abnormalities determined during the physical examination. Past medical history of this patient was as follows: at the age of 5, she was hospitalized because of an infection of the oral cavity, urticaria and edema of the joints. At the age of 13, the patient was admitted once again because of tonsillitis accompanied by another episode of edema of the joints. At the age of 14, the patient underwent tonsillectomy. The girl was then consulted by a rheumatologist – but the diagnosis of a connective tissue disease was not established. The consulting hematologist did not recommend bone marrow examination. The current process of diagnostic laboratory tests revealed elevated inflammatory markers: ESR, CRP, PCT. Serum ferritin concentration was slightly elevated, and serological markers indicated previous infection with Epstein-Barr virus (EBV), cytomegalovirus (CMV) and Mycoplasma pneumoniae. Immunoelectrophoresis showed increased concentrations of α-globulins. Both antinuclear antibodies (ANA) and anti-neutrophil cytoplasmic antibodies (ANCA) were negative. On three separate occasions, blood culture did not cultivate any bacteria. Also urine culture was negative. The results are presented in .\nChest X-ray, abdominal ultrasonography, and echocardiography did not reveal significant abnormalities. During hospitalization, episodes of fever with skin rash and musculoskeletal pain of the lower limbs, which responded well to 1 g paracetamol administered intravenously, were observed. Procalcitonin concentrations continued to increase, despite antibiotic therapy, a lack of a bacterial source of infection and the patient’s generally good status between episodes of fever ().\nC-reactive protein concentrations decreased during therapy, starting from 191 mg/l to 18 mg/l (normal values 0–5 mg/l) on antibiotics, and further to the normal range on steroid treatment. Procalcitonin analysis was performed by the VIDAS B.R.A.H.M.S PCT immunoassay, BioMérieux, Paris, France). On the 15th day of illness, the patient complained of vision loss. However, subsequent ophthalmologist examination and computed tomography of the head did not reveal any pathologies. On the 10th day of hospitalization (23rd day of the disease), edema of the feet, ankles, and knees appeared, with edema of the feet persisting for the next few days. On the basis of the clinical picture and after excluding any other possible causes of fever, especially infections, the patient was diagnosed with adult onset Still’s disease (AOSD); steroid therapy was initiated, and antibiotics were discontinued. The procalcitonin concentration of 13 ng/ml (normal values < 0.5 ng/ml) was normalized after 5 days of steroid therapy. The patient was discharged under ambulatory rheumatologic supervision.
A 41-year-old male with a past medical history of intravenous drug abuse (IVDA) presented to our emergency department as a transfer following two days of medical management of rhabdomyolysis at an outside community hospital. He initially presented with weakness and numbness of the lower extremities. He had been using intravenous heroin and was lying supine on a floor for approximately 24 hours.\nUpon presentation to our emergency department, the patient had pain in his bilateral lower extremities and no appreciable motor function below the level of the knee. He was in mild distress with a temperature of 37°C, pulse of 104 beats per minute, blood pressure of 146/56 mmHg, respiratory rate of 18 and oxygen saturation of 97% on room air. Examination of the lower extremities revealed erythema and tension in the bilateral posterior thigh compartments. In contrast, the medial thigh compartments bilaterally along with all four leg compartments were soft. Gluteal and buttock compartments were soft and compressible bilaterally. Motor strength testing revealed 1/5 strength bilaterally with manual testing of ankle dorsiflexion and plantarflexion, and knee flexion and extension. The patient was found to have bilateral sciatic nerve palsies, with no sensation bilaterally in the tibial nerve, deep and superficial peroneal nerve distributions. Both legs were warm and pink with brisk capillary refill along with 2+ dorsalis pedis pulses bilaterally. Provocative testing demonstrated pain with passive range of motion of the knees bilaterally and no pain with passive ankle dorsiflexion and plantarflexion. Lab work was significant for a creatinine phosphokinase (CPK) of 231,360 U/L.\nGiven the high suspicion for compartment syndrome, the patient underwent compartment pressure testing via Stryker pressure monitor system. Diastolic blood pressure recording measured 75 mmHg. The right posterior thigh compartment measured 75 mmHg and left posterior thigh compartment measured 30 mmHg. Based on the history and physical examination findings, the patient was diagnosed with bilateral thigh compartment syndrome likely secondary to his recent IVDA and subsequent immobilization and was taken to the operating room for urgent bilateral posterior thigh fasciotomies.\nIn the operating room, the right posterior compartment was approached first. The intermuscular septum was released with the fascia along the posterior compartment for full release of both the anterior and posterior compartments of the right thigh (Figure ).\nFollowing fasciotomy, cautery was used to confirm the viability of the exposed muscles in the anterior and posterior compartments. The skin surrounding the incision for the compartment release was too tense for safe closure, and so it was decided to place a wound vac. A 22 x 8-cm negative pressure vacuum-assisted closure (VAC) dressing was then placed over the wound (Figure ).\nAttention was then paid to the left thigh. Compartment pressures were rechecked. The left posterior thigh compartment measured 30 mmHg. Given these findings, the decision was made to forego the compartment release due to the morbidity associated with fasciotomies.\nSerial wound vac changes were then carried out on postoperative day (POD) two and four. On POD six, we removed the wound vac and placed a DermaClose device for assistance with skin closure. On POD 10, his skin edges were closable and so he underwent complex wound closure approximately 20 cm in length.\nThroughout operative treatment and recovery, the patient was given antibiotics and developed no further complications. His CPK levels returned to normal. He was discharged on antibiotics and was given counseling on the potential adverse effects of IV-drug abuse. He had a favorable recovery at two-week follow-up.
A 29-year-old male was brought to the emergency department following a car accident. It was reported that the wheel of a 5-ton water tanker rolled over his lower body as he was stepping into a car. Workup revealed a Glasgow Coma Scale (GCS) score of 15 with a pulse rate of 80 beats per minute and blood pressure of 90/60 mmHg. There was profuse bleeding due to a perineum injury. No fractures of the skull, cervical spine, and pelvis were detected in the X-rays. Urinary catheterization was performed without difficulty and there was no hematuria. No internal bleeding was seen during the abdominal ultrasound. The patient was immediately taken to the operating theatre for injury assessment after the replacement of fluid and blood.\nOperative Findings and Procedure\nWhile the patient was placed in the lithotomy position, the anterior displacement of the anus could be seen with a circular skin defect surrounding the region. The anus looked normal. There was a remaining 1 cm of normal perianal skin with no actual skin loss. Digital and proctoscopy examination showed an intact anorectum and its surrounding sphincters. Whereas exploring the wound revealed complete disruption of the posterior pelvic floor with lateral extensions into both gluteal regions and the right thigh. In addition, a hand could be passed behind the rectum and into the sacral promontory.\nThe case was associated with extensive venous bleeding with the absence of major arterial tears. It was managed by the insertion of multiple packs along with partial closure of the skin defect. A small incision was made to perform a defunctioning sigmoid colostomy. No intra-abdominal bleeding was reported. The packs were removed two days later without any bleeding complications. A total of 22 units of blood were required during the first 48 hours of admission. Figures , show the site of injury before and after treatment, respectively.\nProgress\nContinuous follow-up examinations were done during the following months of the accident. Seven examinations under anesthesia were performed. The skin was not closed completely at the site of the procedure. Consequently, it was decided not to reallocate the anorectum to a further posterior direction and the wound was left open. Initially, infection of deep injury recess was found and debridement and daily cleaning with betadine was performed. In later stages, as the wound became clean, saline dressings were substituted and the wound healed by granulation.\nThe defect was reduced to an area of 4 x 2 cm after four months of the procedure and was contracted towards the coccyx. Anterior to this, the anus felt normal on digital examination with a good sphincter tone and squeeze.\nPhysiological tests were done to test the sphincter function and sensation. Manometry showed the resting sphincter pressure of around 30 cmH2O. This increase in squeeze pressure was due to a combination of contraction of the puborectalis and gluteal muscles. The presence of rectal sensation was noted but not quantified. Defecography was assessed using a defecation proctogram. It revealed a normal anorectum that was displaced towards the pubic bone. Furthermore, although he was able to evacuate barium paste from the rectum, the anorectal angle did not widen during straining at the angle of 90°. Anyhow, there was no abnormal descent of the rectum on straining.\nFive months after the surgical procedure, the perineal wound healed, and the colostomy was closed. The patient was able to pursue normal defecation without any episodes of major or minor incontinence. In the following follow-up visit, the patient expressed satisfactory defecation and micturition without incontinence.
A 14-year-old boy referred to our department for a slowly growing, nonpainful swelling in the medial upper right arm that he had noticed for 8 months. He had undergone partial resection of an osteochondroma in the posterior aspect of the proximal humerus 3 years earlier. Follow-up was unremarkable. He recalled a blunt trauma in his right upper arm while riding a horse; however, swelling presented some weeks later and was characterized by a gradual enlargement. An X-ray was performed and showed a large sessile osteochondroma in the median side of the proximal humerus. An MRI was performed to study the cartilaginous cap of the osteochondroma for malignant transformation and the soft tissues for a soft tissue tumor. MRI was considered suggestive of a soft tissue tumor, and the patient was referred to our department. Physical examination demonstrated a firm, nonpulsatile, 8-cm swelling in the medial upper arm that was painless during palpation (Fig. ). There were no signs of vascular or neurologic failure. No enlarged lymph nodes were palpable in the axilla. Bone scan revealed increased uptake at the site of the osteochondroma. MRI performed in our Institute revealed a large, complex mass close to the osteochondroma and the humeral artery. The nonhomogeneous lamellar structure of the mass on MRI, the hyperintensity on T1-weighted sequences, and the regularly capsulated aspect of the contours were suggestive of hematoma–thrombosis (Figs. a–c, a). Due to these characteristics, the hypothesis of malignant transformation was difficult to asses. The MR angiography facilitated the diagnosis, as it showed a pseudoaneurysm arising from the compressed brachial artery with extravasation of contrast medium into the mass (Fig b). Angiography confirmed the diagnosis of pseudoaneurysm measuring 35 mm of patent lumen and provided a useful map for surgical planning (Fig. c). On T2-weighted MRI, an aspect of concentric rings was observed due to the presence of thrombus into the pseudoaneurysm that did not diffusely enhance with contrast material. In this case, the difficulty of recognizing the cartilage cap on T2 sequences because of the overlying pseudoaneurysm, hyperintensity on fat-suppressed proton density (PD)-weighted sequences, and enhancement of the medulla after contrast media could not exclude malignant transformation (Fig. a– d). Therefore, surgical exploration was mandatory. At operation, a longitudinal incision was made on the right medial upper arm. The nerve was identified and preserved. The brachial artery was controlled above and below the pseudoaneurysm with nylon tape (Fig. a). The pseudoaneurysm sac was opened and the thrombus removed (Fig. b). After retrograde flow was restored, a 7-cm arterial segment that included the pseudoaneurysmal region was resected, and marginal resection of the osteochondroma was performed (Fig. c, d). Reversed saphenous vein interposition graft was then performed (Fig. d). The wound was closed and a suction drain was left in situ. At the end of the procedure, there were good radial and ulnar pulses palpable. Specimens of the sac wall and thrombus were negative following histopathological and microbiological examination. Histopathological diagnosis was osteochondroma. The patient was discharged and followed up in the outpatient clinic. Patient gave consent to the publication of this report.
A 33-year-old female presented to the clinic complaining of a polyp on top of a red plaque in the left side mons pubis for 1 year. It was a kind of round flaky red bulge lesion in the skin of mons pubis. On top of this, it is shown sarcomatoid hyperplasia covering with the yellow-green crust, and the surrounding skin had no obvious abnormality and elcosis. The plaque was slightly bulgy without pressing pain, covered with a thick yellow-white crust (Fig. ). The plaque was 2.2 × 1.8 × 0.5 cm, and the polyp was 2.5 × 2 × 1.5 cm. The width of the pedicle was 1.4 cm. There were no other systemic abnormalities or any palpable lymphadenopathy, ultrasound B was applied to evaluate the superficial inguinal lymph nodes. She had no significant history of medicine, surgery, irritation, and trauma. Before the lesion appearance, the patient had no discomfort, thus she did not pay attention to the skin lesion, and had not used other external medicines or ask for help from professionals. Until nearly a month, she found that the lesion was prone to bleed after friction, thus she came to our hospital for treatment. The lesion was removed surgically and the histopathologic examination was performed. The possibility of skin tumor was considered through dermoscopy, then the histopathological examination was performed to make the confirmation. Skin biopsy was made on December 31, 2019, and further immunohistochemical reports have been done on January 17, 2020. Detailed information was shown below.\nThe dermoscopic images showed the dark red background, covering a thick yellow-and-white crust, with spot-shaped and polymorphic vascular structures which focally distributed. In some areas, white homogeneous structures could be seen, as well as dark red clumps. No typical pigment structure was seen (Fig. a, b). The skin lesions were considered as the diagnosis of skin tumors using dermoscopy.\nThe excisional biopsy was carried out, and the specimen tissue was fixed in formalin, and embedded in paraffin. The histological examination showed: the skin lesion at the left side of mons pubis was spindle-shaped, the lesion size was 2.2 × 1.8 × 0.5 cm. There were gray-brown and mushroom-shaped protrusions on the epidermis, and the size of the protrusions was 2.5 × 2 × 1.5 cm, the pedicle width was 1.4 cm, and the transaction of the protrusions was grayish-white and grayish-red. Besides, Breslow thickness was about 9.5mm, and Clark level was IV. No tumor embolus was detected in the vessels. The tumor involvement had been found in the incisal edge of long-axis two sides and base of the tumor sample.\nMicroscopically, the polyps were lined by melanocytes, with pale cytoplasm (Fig. a–d). It was represented as atypical cells and heteromorphic nuclei, with different cell sizes and abnormal mitosis of 5–7 counts /10HPF. Each slide was reviewed by 3 different pathologists, and the diagnosis was made as the melanocyte tumor.\nThe immunohistochemistry (IHC) studies revealed that the expressions of S-100, HMB-45, Melan A and Cyclin D1 were stained positive, while CD-117 was focally immunoreactive and CD31, P16, PCK and LCA were stained negative. The final histopathological diagnosis was made: melanocyte nevus malignancy, nodular malignant melanoma. This patient underwent a complete local excision and she recovered well recently.\nThe patient was required to re-examined regularly after surgery, and recent follow-ups showed that she recovered well and there was no sign of recurrence till now.
A 56-year-old female was referred to our department from another facility in the patient’s area for a rapidly progressing tumor in the gallbladder and liver area. The patient reported several-month right upper quadrant pain and 4-kg weight loss over the past year. There was no laboratory sign of obstructive jaundice at the day of admission. Preoperative CT and MR scan (Figs. and ) of the liver was performed, and the patient was diagnosed with a tumor in the gallbladder area with a relatively massive infiltration of the S5 and S6 liver segments and extensive regions of necrosis. Given the potentially resectable lesion according to preoperative imaging, exploratory laparotomy was indicated to attempt radical resection. During the exploration, a voluminous tumor was found attached to the peritoneum. Intraoperative ultrasound was performed and revealed a tumor originating from the gallbladder bed area and reaching up to the area of the hepatic hilum and extensive involvement of the hepatoduodenal ligament by the tumor through the lymph nodes. The tumor was classified as inoperable due to this finding. But during the exploration, however, a rupture of the fragile tumor occurred with massive eruption of the necrotic mass and the gallbladder content into the abdominal cavity, accompanied by bleeding of the liver parenchyma. We decided that the condition could only be managed by attempting modified resection. We performed cholecystectomy and non-anatomical resection of hepatic segments S5 and S6 and partial resection of S4 without lymphadenectomy as a debulking operation (Fig. ). The course of hospitalization was uncomplicated, and the patient was discharged to home care on postoperative day 9. Histologically, the tumor was confirmed as MINEN of gallbladder (Figs. , , and ), and its non-neuroendocrine component had the character of moderately differentiated tubular gall bladder adenocarcinoma, while the neuroendocrine component had the appearance of small cell carcinoma and was dominant, accounting for more than 65% of the viable tumor. The neuroendocrine component contained extensive necrosis, with mitotic index 64/10 HPF and a proliferation index of 70% (Fig. ). It was therefore obvious that the prognosis and the subsequent biological behavior would be influenced in particular by the neuroendocrine carcinoma component. Six weeks after the discharge, the patient underwent a follow-up CT scan prior to the initiation of systemic therapy, which revealed a large recurrence of the disease at the resection surface of the liver accompanied by hilar lymphadenopathy. The patient was started on systemic therapy with etoposide and carboplatin in combination with somatostatin analogues with very good radiological effect. We use this regimen as a standard in patients with MINEN of gastrointestinal tract with dominant neuroendocrine component, even with no somatostatin receptors staining available. Now the patient is almost a year after being diagnosed with a tumor, after completion of 6 cycles of adjuvant chemotherapy (carboplatin + etoposide) in combination with biological therapy, the long-acting somatostatin analogues. The patient is in good clinical condition, and while a recently performed PET/MRI scan revealed a hepatic lesion and hilar lymphadenopathy in full regression, there was a spread of small peritoneal and pleural metastases, with a solitary metastasis in Th9. The condition was evaluated as disease progression stage according to RECIST criteria, the patient remains in the follow-up care, and it is now 13 months after surgery (Figs. , , and ).
A 24-year-old Caucasian man presented with a several month history of muscle pain, fatigue and insidious onset of pitting edema to his lower extremities. His symptoms progressed to include bilateral arm swelling, muscle pain to the thenar eminence of both hands, and paresthesias to his hands. He did not have a rash, joint pain, Raynaud phenomenon, oral ulcers, fever, hardening of the skin or weight loss, and he denied any cardiac, respiratory, genitourinary, or gastrointestinal symptoms. Prior to symptom onset, he had traveled to South America and reported possible ingestion of undercooked meat as well as swimming in a river and lake. He had frequent visits to the Northeastern United States and had recently spent an extended period of time outdoors in Rhode Island. Medical, surgical, and family histories were unremarkable, and he was not taking any medications. He had a history of mild alcohol intake, no history of smoking, and some marijuana use. On examination, his vital signs revealed a blood pressure of 104/57 mm Hg, pulse of 56 bpm, and normal temperature. He had no significant findings on head, neck, cardiovascular, respiratory, or abdominal exam. He had no cervical, axillary, or inguinal lymphadenopathy. He had significant pitting edema on his feet and legs extending up to his knees as well as non-pitting edema on the dorsum of both hands. Although there was edema, the skin was soft without any significant hardening and was without any overlying erythema. There were no signs of skin dimpling or grooves. His neurological examination revealed normal strength.\nHis initial laboratory work was significant for a mild eosinophilia of 700 with a normal white blood cell count, hemoglobin, and platelets. He had normal calcium, creatinine, and electrolyte levels. His alanine aminotransferase was slightly elevated and total protein slightly low, but he had normal albumin and bilirubin. His thyroid-stimulating hormone was slightly increased, but his free T4 and total T3 were normal. His urinalysis was normal. He had a normal level of creatine phosphokinase, sedimentation rate, and C-reactive protein. Further workup revealed a positive anti-nuclear antibody with a titer of 1:160 with a speckled pattern. His extractable nuclear antigen panel was negative, including Scl-70. His ANCA, myeloperoxidase and proteinase-3 serum studies were also negative. His ACE level and complement levels were normal. Infectious workup revealed negative stool studies for culture, ova, and parasites. Antibodies for HIV, CMV, and Trichinella were negative. Serum for histoplasmosis, cryptosporidium, coccidiomycosis, and interferon gamma release assay were negative. A blood smear for parasites was negative. An ELISA IgG/IgM test for Lyme disease was positive with subsequent testing with Western blot strongly positive for IgG (eight out of ten bands positive) and also positive for IgM (two out of three bands positive).\nThe patient had extensive imaging done with a normal CT scan of his neck, chest, abdomen, and pelvis. An echocardiogram was also normal. Due to a previous negative workup along with persistent pain and swelling, an MRI of his right lower extremity was performed (see Figure ). Imaging demonstrated extensive circumferential edema with enhancement of the superficial soft tissues, superficial fascia, and, to a lesser extent, deep fascia of the lower leg. Taking into account the mild peripheral eosinophilia and the imaging findings, a diagnosis of eosinophilic fasciitis was considered. To complete the workup, a biopsy of the fascia, muscle, and adipose tissue of the left calf was taken (see Figure ). The biopsy did not include the dermis. Surprisingly, there was no evidence of eosinophilic fasciitis. Instead, the specimen illustrated a striking granulomatous fasciitis and vasculitis. The fascia showed exuberant granulomatous inflammation (Figure A) with an inflammatory infiltrate that was made up predominately of histiocytes and CD3-positive T cells with very rare eosinophils (Figure B). The granulomatous inflammation centered primarily on small- to medium-sized blood vessels and was non-necrotizing. While the vessels did not display overt fibrinoid necrosis, they did appear damaged with loss of endothelial cells confirmed with CD31 immunostaining. The inflammatory infiltrate was seen extending into adipose tissue and particularly around blood vessels within the fat. The adjacent skeletal muscle also showed perivascular inflammation and vasculitis in both the perimysial and endomysial compartments. There was no endomysial fibrosis, fatty infiltration, or inflammation surrounding muscle fibers. AFB (acid-fast bacteria) and Wade-Fite stain were negative for mycobacterial organisms. GMS (Grocott-Gomori's methenamine silver) stain was negative for fungal organisms. Due to the positive Western blot for Lyme, a Warthin-Starry silver nitrate stain was performed to evaluate for spirochetes; however, no definitive organisms were seen. A Borrelia PCR analysis of the tissue was performed as well, but no DNA was detected.\nThe patient was given a diagnosis of granulomatous fasciitis along with a diagnosis of Lyme disease. He was first treated with doxycycline for 42 days straight due to initial Lyme serology being positive. The calf biopsy revealing fasciitis was not performed until the patient was 3 weeks into the doxycycline course. Once fasciitis was diagnosed, he was started on a prednisone taper starting at 1 mg/kg/day for a week with taper by 10 mg every 2 weeks. After 2 months of treatment with prednisone, the patient had near resolution of symptoms. A repeat MRI was performed 82 days after the initial MRI with the previously seen changes consistent with fasciitis nearly completely resolved with only a thin sliver of edema over the superficial fascia. On re-evaluation of the patient, he reported skin changes to his left upper arm at 20 mg of prednisone per day and skin changes to his left forearm at 7.5 mg per day. Examination of the upper arm revealed an atrophic patch with some overlying erythema and examination of the forearm showed indurated, bound-down, tense skin with a slight groove and minimal overlying hyperpigmentation. The rest of the dermatological examination was within normal limits. Skin biopsy revealed marked septal thickening with sclerosis, sparse lymphoplasmacytic infiltrate along the dermal subcutaneous junction, and swollen, homogenized collagen fibers with diminished spaces between the fibers (see Figure ). The clinical examination along with pathology revealing dermal and subcutaneous sclerosis was consistent with a diagnosis morphea profunda. Lyme serology was repeated, but Western blot for IgG was negative. A scleroderma antibody panel was negative as well. He was started on methotrexate and a higher dose of prednisone.
A 52-year-old Australian Caucasian male with cystic fibrosis was admitted to our hospital with an exacerbation of pulmonary sepsis accompanied by a vague abdominal pain. Abdominal X-ray revealed faecal loading in his caecum and ascending colon with proximal small bowel dilatation consistent with meconium ileus equivalent. His relevant medical history consisted of pancreatic insufficiency and bronchiectasis with moderately severe lung function impairment (FEV1 2.18 L/s; 53% predicted). He had multiple hospital admissions over the preceding two years with exacerbations of chronic airway sepsis.\nThe diagnosis of cystic fibrosis had been made during his early childhood when he presented with failure to thrive, and this had been confirmed with an elevated sweat test and genotyping that revealed him to be a heterozygote for G542X, with the other allele unidentified. G542X is a Class I mutation that results in the complete failure to synthesize functional cystic fibrosis transmembrane conductance regulator (CFTR) and is usually associated with pancreatic insufficiency. On this particular admission, his chest and abdominal symptoms resolved after a course of intravenous antibiotics, fluid replacement, and oral administration of N-acetyl cysteine. His 24-hour fecal fat levels were elevated at 41 grams and his pancreatic enzymes were thus increased.\nHe presented again after six weeks due to a recurrence of severe abdominal pain, anorexia and weight loss, but without any alteration to his bowel habit. Examination revealed epigastric tenderness and active bowel sounds, but no guarding. Results of respiratory examination were unchanged. On this occasion, abdominal X-ray was normal, as were his full blood count, urea and electrolytes, serum amylase (46 IU/L; NR < 100 IU/L), and liver function tests. However, he continued to complain of severe abdominal pain radiating through his back and lower chest. An abdominal ultrasound demonstrated an increased echogenicity consistent with inspissated secretions in the pancreatic duct and an 8 mm common bile duct with no other abnormalities.\nTwo days after admission, our patient became jaundiced. Repeat blood tests demonstrated a cholestatic picture: total protein 66 g/L, albumin 36 g/L, alkaline phosphates (ALP) 809IU/L, alanine transaminase (ALT) 543IU/L, glutamyl transaminase (GGT) 334IU/L, and bilirubin 23 mmol/L. His serum amylase (42IU/L) and lipase (4IU/L; NR: < 10IU/L), as well as urinary lipase (96IU/L, NR: < 500IU/L) levels remained normal. An abdominal computed tomography (CT) scan demonstrated that he had a heterogeneous mass measuring 5×5×5 cm and located at the head of the pancreas with biliary and pancreatic duct dilation (Figure ). Magnetic resonance cholangiopancreatography confirmed the enlargement of the head of his pancreas with dilated intrahepatic and extrahepatic biliary ducts. These findings were thought to be consistent with either acute pancreatitis or a pancreatic malignancy.\nResults of his liver function tests remained abnormal (ALP 1085IU/L, ALT 249IU/L, GGT 383IU/L, and bilirubin 37 μmol/L) and the patient proceeded to endoscopic retrograde cholangiopancreatography, where a narrowing of the common bile duct at the head of the pancreas was identified with more distal anatomical distortion of the entire pancreatic ductal system. A biliary stent was consequently inserted. CT guided biopsy of the pancreatic mass demonstrated reactive pancreatic ductal epithelium with an infiltrate of macrophages and lymphocytes, but no evidence of malignancy was found.\nThe patient continued to experience abdominal pain and ursodeoxycholic acid was introduced to treat any potential contribution of biliary sludging to cholestasis and also to minimize the risk of stent occlusion. Following stent insertion and commencement of ursodeoxycholic acid, his symptoms and liver function tests slowly improved, and then returned to normal over the next 6 weeks. A repeat CT scan showed a resolution of biliary dilation, but no change in the pancreatic mass was noted. After 18 months he remains well with normal liver function tests and no abdominal pain. A repeat CT scan at this time demonstrated a complete resolution of the pancreatic mass (Figure ).
An 18-year-old man referred for ASD repair to our hospital. He was moderately cyanotic but reported no chest discomfort, dyspnea, or hemoptysis. He was in New York Heart Association functional class I. On physical examination, the patient had no dysmorphic features but had moderate central and peripheral cyanosis, stage II clubbing with drumstick appearance of the fingers and toes, pulse rate of 90 beats per minute, and blood pressure of 130/70 mmHg. Blood gas analysis demonstrated oxygen saturation of 85% in room air. Cardiac examination showed a normal apical impulse, no right ventricular heaves or thrills, and normal first and second heart sounds. Chest examination was unremarkable apart from lower-limb cyanosis. Laboratory examination revealed serum hemoglobin of 18 g/l, hematocrit of 55%, and normal serum electrolyte levels and renal function. The electrocardiogram and chest X-ray were normal. Transthoracic echocardiography showed normal left and right ventricular functions and dimensions. Also, no tricuspid insufficiency jet was identified from which a systolic pulmonary arterial pressure could be estimated. However, the estimations of the mean pulmonary arterial pressures using acceleration time and pulmonary regurgitation were normal. No persistent left SVC was seen, and nor was there a report of an anomalous drainage of the IVC into the left atrium. Cardiac angiography was not performed to visualize the anatomy of the ASD and IVC.\nThe patient underwent ASD repair with bicaval and aortic cannulation. Gross examination revealed that the left SVC drained into the left atrium at the entrance of the left superior pulmonary vein into the left atrium. After an antegrade aortic injection of cardioplegia and the subsequent cardiac arrest and local hypothermia, the right atrium was opened and there was an unroofed coronary sinus to the left atrium, which was treated via extracardiac ligation of the left SVC. Moreover, there was a large low-lying secundum type ASD in the vicinity of an undiagnosed anomalously displaced IVC orifice in the left atrium. The defect was repaired with a pericardial patch, with continuous running suture. The patch was wrongly placed over the upper margin of the Eustachian valve and sutured to the lateral and inferior margin of the defect; this completely diverted the IVC into the left atrium. After repair, the right atrial incision was closed and the aortic cross-clamp was opened. Weaning from cardiac pulmonary bypass was complicated by a low cardiac output and central cyanosis. The volume of ringer lactate and normal saline was increased, but the patient's central venous pressure was not elevated and remained below 5 cm H2O.\nWith a low cardiac output, low arterial saturation, and inotropic drug support, the patient was transferred to the Intensive Care Unit, where he was connected to the ventilator with 100% fraction of inhalation oxygen (FIO2). Despite this high fraction of inhalation oxygen, however, blood gas analysis revealed a pressure of arterial oxygenation (PaO2) of 56 mmHg and saturation of 70%. Lactic acidosis was treated using a repeated dose of bicarbonate.\nThe following day, when the anesthesiologist tried to wean the patient from the ventilator, the patient's hemodynamic and blood gas analysis was compromised and he complained of severe epigastric pain. He was, therefore, sedated and reconnected to the ventilator. Transthoracic echocardiography illustrated the diversion of the IVC into the left atrium ( and ). The patient underwent reoperation, during which the pericardial patch was removed, the upper margin of the Eustachian valve was excised, and the lower margin of the patch was sutured to the wall of the left atrium below the IVC orifice. After diverting the IVC into the right atrium and opening the aortic cross-clamp, the patient was weaned from cardiopulmonary bypass uneventfully.\nOn the following day, the patient was fully conscious and was weaned from the ventilator. Nevertheless, he complained of severe epigastric pain. Physical examination revealed a tense and tender abdomen. In the semi-setting position, abdominal X-ray showed gas-fluid level below the diaphragm. The patient was, consequently, subjected to laparotomy, which revealed a perforated duodenum. The duodenum was repaired and the abdomen was closed.\nThe recovery of the patient was uneventful and he was discharged 2 weeks later from the hospital. At one-year follow-up, there was no recurrence of cyanosis or presence of a residual ASD.
A 47-year-old male was admitted to our institution with a history of intellectual disability for more than 30 years and behavioral abnormalities for the past 3 mo. He had a poor academic performance, having dropped out after completing elementary school. The patient could talk with others in daily life, but he was unable to do housework.\nThree months ago, he underwent an operation for renal calculus, after which he showed progressive delusion (he believed unreasonably that he had a serious disease and was going to die), combined with slow response and speech reduction. At 1 wk before admission, he was unable to answer questions and developed an eating difficulty, incontinence, fever (T ≤ 38.2 °C) and severe weight loss. Chronic diarrhea was absent.\nThe proband is the 4th child of 5 in a non-consanguineous Chinese family. His family history was negative for symptoms related to neurological disorders. He was divorced twice and had no children, and did not have a history of smoking or drinking. The proband’s parents had died and his mother had a history of uremia. All of his four sisters are healthy (Figure ).\nThe patient had dark skin and a poor mental state (Figure ). Neurological examination indicated cervical rigidity and Kernig sign. Deep tendon reflexes and limb muscle strength were normal. Babinski sign was negative. Enlarged Achilles tendons and nodules on the bilateral tibial tubercles were observed (Figure and ). There was no evidence of cataract or xanthomas at other sites such as the eyelids.\nThe laboratory results (Table ) were as follows: Increased leukocyte count, neutrophil ratio and high erythrocyte sedimentation rate. There was also a significant increase in concentration of free fatty acid compared to normal range. In contrast, levels of high-density lipoprotein cholesterol were low. Serum cholesterol, glucose, electrolytes, and adrenocorticotropic hormone (ACTH) levels were all normal, as were the liver function tests. Doppler ultrasound of the urinary system showed multiple left kidney stones, a right kidney cyst, and a hypoechoic area in the bladder which could move with body position (Figure ). Cerebrospinal fluid protein was mildly elevated: 680.4 mg/L (normal range: 150-400 mg/L).\nX-ray of the lower limbs showed soft tissue swelling above the tibial tuberosities bilaterally (Figure ). Sagittal and axial magnetic resonance imaging (MRI) of the right ankle joint showed apparent enlargement of the right Achilles tendon and upper medial malleolus flexor tendon (consisting of low signal intensity on both T1- and T2-weighted images), abnormal thickening of the plantar fat, and a small amount of exudation around the fascia in front of the Achilles tendon (Figure ). The electroencephalogram (EEG) showed increased slow activities than normal and electrophysiological examination found mixed sensorimotor neuropathy of the upper and lower limbs. Cerebral MRI suggested white matter (WM) demyelination and slight cerebral atrophy (Figure and ).\nGenomic DNA was isolated from blood samples of the patient and his four healthy sisters. Mutation screening of all exons and flanking regions was performed on the patient’s sample by targeted sequencing as previously reported[]. Targeted sequencing revealed that the proband had compound heterozygous mutations in the CYP27A1 gene and that his four sisters were mutation carriers (Figure -, and Table ). Both of the variants found are known pathogenic mutations of CTX. The variant in exon 2 (c.435G>T, p.Gly145Gly), a functionally silent nucleotide substitution, has been reported to activate a 5’ splice site, leading to alternative pre-mRNA splicing[]. The other variant (c.1263+1G>A) is a splice site mutation that disrupts normal mRNA splicing and results in exon 7 being skipped in the transcript[]. In Italian and Japanese patients, the variant has been found to cause loss of a heme binding domain, a vital part of hydroxylase, and to damage bile acid synthesis[,].
The patient is a 60-year-old male with a history of metastatic lung cancer to the lung, liver, and brain. The patient presented to an outside hospital's ER due to rapidly progressive right foot pain, swelling, and a black area on right lower extremity. About a week earlier, he had scratched the anterolateral part of his ankle while mowing his lawn. He subsequently worked on his pool which was known to be dirty with black mold. The patient was found to have a quarter-sized lesion on right lower extremity. Then he began feeling more sick and went to a local hospital. That same night, the patient was transferred to Moffitt Cancer Center from over 100 miles away, despite his blood pressure being in the 70s. On admission, the patient appeared to be in sepsis and was immediately transferred to ICU to start hemodynamic support. The patient's past medical history includes a progressive cancer despite frontline chemotherapy that he last received 2 months earlier. He was to be enrolled in a clinical trial when screening evaluation found a new brain metastasis and had since received whole-brain radiation therapy. Medications included dexamethasone 4 mg twice a day for the past 3 weeks and Xarelto for history of pulmonary embolus.\nThe patient was afebrile with a temperature of 97.8 F. Pulse was 89 and respiratory rate was 23. Of note, the patient was hypotensive with a blood pressure of 72/50. He was alert and oriented and in considerable distress. On physical exam, the patient was found to have warm extremities with bilateral pitting edema. His right foot was erythematous and tender on palpation. His wound had gotten worse as there was purplish discoloration in a 10 cm area with possible necrosis of skin. No crepitus was felt. Also, the patient had thrush and no lymphadenopathy with no other skin lesions noted. Lab results showed the following: negative urine nitrite and leukocyte esterase, WBC of 18.23 k/ul, neutro auto of 15.24 k/ul, prothrombin time of 17.9 s, APTT of 35.3 s, INR of 1.9, glucose of 47 mg/dl, BUN of 32 mg/dl, creatinine of 1.7 mg/dl, estimated GFR of 41 ml/min/1.73 m2, albumin of 2.5, total bilirubin of 4.9 mg/dl, alkaline phosphatase of 182 U/L, AST of 173 U/L, ALT of 130 U/L, and lactic acid of 4.8 mmol/L. His initial ABG after intubation showed pH of 7.08, pCO2 of 54, and pO2 of 62 on 100% O2. His chest X-ray showed what appeared to be acute respiratory distress syndrome.\nDuring initial resuscitation, the patient was treated with maximum levophed dose and systolic blood pressure in the low 100s was obtained. He then developed atrial flutter with heart rate in the 200s. After giving 5 mg of metoprolol and holding levophed, the patient converted to normal sinus rhythm. Systolic blood pressure again dropped into the 50s and the patient was again given levophed along with phenylephrine and vasopressin and blood pressure rose to the 70s. He needed to be intubated due to progressive hypoxia. The patient had an episode of aspiration with a 10-second period of O2 dropping to 30% during procedure. He eventually had successful intubation.\nFor empiric coverage, the patient received vancomycin, meropenem, and doxycycline. A diagnosis of septic shock with multiple organ failure secondary to necrotizing fasciitis was made and urgent surgery consult was placed. The patient was also found to be coagulopathic, in acute renal failure, acidotic, and in acute respiratory failure. Surgery agreed with the diagnosis and the patient was emergently sent to OR for irrigation and debridement, about 2 to 3 hours after transfer to our institution. In the OR, purulent material was found coming out from the fascia. The material was cultured. Full thickness skin necrosis was found throughout most of the anterolateral aspect of the leg. The entire skin was removed in excess of a 15 by 20 cm area with 1 cm of subcutaneous tissue. Thorough irrigation was done with over 6 liters of normal saline with bacitracin in two different compartments of the leg. Despite the extensive infection, the muscles appeared to be healthy. At the end of the procedure, the patient was stable and ultimately required less pressor drugs.\nDue to extensive coagulopathy, it was not deemed safe for the patient to go back to the OR, so surgery was unable to reevaluate wound the next day as planned. After correcting his coagulopathy, he was taken back to the OR on hospital day 4 for elevated lactic acid and possible ischemic bowel. During the procedure, the bowel appeared to be healthy; however, the liver was found to be replaced by tumor and physiologically the patient appeared cirrhotic. Wound cultures taken during initial debridement were found to grow nonlactose fermenting, oxidase-positive, Gram-negative rods. Cultures were later confirmed to grow Aeromonas hydrophila and Aeromonas caviae. The cultures showed sensitivity to ceftriaxone, ciprofloxacin, gentamicin, tobramycin, and piperacillin/tazobactam.\nDespite treatments, on hospital day 8, the patient developed severe subcutaneous emphysema with unclear cause. After discussion with the patient's family, the decision was made to perform terminal extubation, given the patient's underlying stage IV lung cancer and worsening clinical status.
A thirteen-year-old female patient who presented with respiratory distress and cyanosis was admitted to the emergency department of a different medical center one week ago. The patient’s condition was reported to deteriorate with development of pneumonia and respiratory failure and she was referred to our hospital because of increasing respiratory distress. At admission to our intensive care unit (ICU), the patient was in a drowsy state. The breathing was shallow and she was cyanotic. Respiratory acidosis was determined in the blood gas analysis. She was intubated with assisted ventilation.\nThe medical history of the patient revealed that her parents were unrelated and healthy, that she was born at term and weighed 3500 grams at birth and that she had two healthy siblings. We were informed that she had started overeating at age 3 years, had gained weight rapidly after that age and had been referred to different medical centers with these complaints. She was reported to have her first menstruation at age 12 years. According to her record at another hospital where she was seen at age 10 years, her body measurements were as follows: body weight: 51 kg, relative body mass index (RBMI) 166%, BMI: 31.62 kg/m2, height: 127 cm and height standard deviation score (SDS): -3.04. She was reported to be obese in appearance and her puberty rating was at Tanner Stage 2. Acanthosis nigricans was identified in the axilla and neck and coldness in hands and feet suggestive of Raynaud phenomenon was noted. The other system findings were found to be normal. These previous records included presence of hypernatremia in the laboratory tests and a diagnosis of diabetes insipidus (DI) despite absence of polyuria and polydipsia. No medication for DI was given, but levothyroxine treatment was started due to primary hypothyroidism. Although cranial magnetic resonance imaging (MRI) findings were reported as normal, bromocriptine treatment was started (dose not recorded) to control hyperprolactinemia. Metformin was started to treat the euglycemic hyperinsulinism noted in the oral glucose tolerance test. The patient was also reported to have cold hands and feet and discoloration, especially increasing in the cold. Presence of Raynaud phenomenon was mentioned also in the follow-up records of different centers. The obese state of the patient could not be brought under control during the follow-up.\nUntil two years before the patient was admitted to our clinic, her school performance had been satisfactory. Subsequently, a decrease in concentration and decline in school performance were noted. In the past 10 days, these complaints became more evident and drowsiness started.\nThe patient was admitted to our ICU and was intubated. Her body temperature was 39.2 ˚C, heart rate was 117/min, blood pressure 105/60 mmHg. Her body weight was 69 kg. Height was 145 cm (height SDS -2.28). BMI was calculated as 32.82 kg/m2 and RBMI as 159%. The patient had a round plethoric face, buffalo neck, umbilical hernia. Mild acanthosis nigricans in the neck and armpits was present. By Tanner staging, pubertal stage was at stage 4 and other system examinations were normal.\nDuring the follow-up, the patient’s general condition gradually improved and on the 10th day of hospitalization, she was extubed. After extubation, the patient did not have acidosis, but her PCO2 level continued to remain high. Acute phase reactants were negative, but the feverish state continued. The cause of the fever origin could not be found. Blood and tracheal aspirate cultures were negative. The patient continued to be feverish during her stay in the ICU and after. This fever of unknown cause was thought to be of central origin. The patient’s complete blood count values, renal and hepatic function tests were normal, but hypernatremia was detected (Na: 151 mmol/L). Urine density varied between 1015 and 1017, serum osmolality was normal and no polyuria was observed. During her stay in the ICU, megaloblastic changes were found in her peripheral blood smear and vitamin B12 deficiency was detected.\nThe patient was referred to our Pediatric Endocrinology Department for reevaluation. Some of the laboratory results are given in Table 1. Serum ACTH (21.01 pg/mL) and cortisol (14.07 µg/dL) levels were normal in the patient, findings which excluded Cushing’s syndrome. Prolactin levels were found to be moderately high. Serum insulin-like growth factor-1 (IGF-1) level was 32.4 ng/mL (-7.92 SD) and IGF binding protein-3 (IGFBP-3) level was 1500 ng/mL (-6.54 SD). These findings and an inadequate response to GH in the GH stimulation test (L-DOPA-induced peak GH response: 0.08 ng/mL) were consistent with GH deficiency. The epiphysis was closed in the left hand-wrist X-ray and the bone age was evaluated as 15 years.\nMetformin therapy was discontinued due to normal blood glucose and insulin levels. The patient, who had menarche a year before the application, had secondary amenorrhea. Hypergonadotropic hypogonadism was diagnosed in the laboratory and imaging tests and sex hormone replacement therapy was started. On cranial MRI, cerebral atrophy secondary to the dilatation in second, third and lateral ventricles was detected. The pituitary gland was of normal appearance. Genetic analysis was performed and fluorescence in situ hybridization (FISH) test was negative for Prader-Willi syndrome (PWS).\nAll these findings indicated the presence of ROHHAD syndrome in our patient. No pathology was found in the abdomen and thorax MRI performed due to the possibility of a NET.
A 10-month-old female presented with an oedema in the left zygomatic and retroauricular region without other inflammation sites. She was afebrile and in good clinical condition with otoscopic findings, characteristic of acute otitis media and concomitant oedema in the external auditory meatus of the left ear. Due to otorrhoea on the left side 4 days ago, the child started receiving antibiotic treatment per os with amoxicillin and clavulanic acid 457 mg/5 ml (90 mg/kg) every 12 h. Family history showed that the mother died 7 months ago at the age of 34 due to melanoma recurrence during pregnancy. She was diagnosed with melanoma at the age of 25, for which she was treated with chemotherapy with complete regression of the disease. During her pregnancy, she presented with a recurrence of melanoma with metastases in the liver, bones, lungs, and brain. She died 3 months after delivery. The child was initially treated as an acute mastoiditis on the left side according to our clinic's protocol, and a double intravenous antibiotic scheme of cefotaxime + clindamycin and dexamethasone was administered. Subsequently, a myringotomy was performed on both sides under general anaesthesia, and ventilation tubes were placed. A purulent fluid was drained from the left side, which was sent for culture. The child showed an immediate improvement in her clinical picture, showing reduced otorrhoea on the left and reduced oedema in the left zygomatic and retroauricular region after the following 24 hours. After the antibiogram results (Pseudomonas aeruginosa), the treatment was changed to ceftazidime and amikacin. Due to recurrence of the retroauricular oedema on the left after 7 days, a CT of the temporal bone with contrast was performed. An invasive lesion of the mastoid cavity on the left with widespread corrosion of the trabeculae of the bone was found, expanding intracranially (towards the cranial bones and the underlying meninx) (). A drilling of the mastoid on the left followed. During the retroauricular incision, an infiltration was observed, with multiple friable fragments of dark-coloured subcutaneous tissue of the underlying corroded bone cortex and of the whole mastoid cavity, which had been submitted to “automated trephination.” Characteristically, the mastoid cavity was infused with a material similar to cuttlefish ink in colour (). Moreover, corrosion was observed on the posterior wall of the external auditory meatus, on the apex of the mastoid, and on the bony wall of the meninx, which was uncovered especially in the area of the meninx-sigmoid corner. Furthermore, the wall of the sigmoid sinus was corroded. No thrombosis was observed of the sigmoid sinus. Neuromonitoring of the facial nerve was performed, and an urgent neurosurgical assessment was requested. Debridement and removal of the corroded bone fragments was performed.\nMultiple fragments of dark-coloured tissue were sent for an immediate histological examination. The history (individual and family), the clinical picture, the radiological and surgical findings, and the immunophenotype showed an intermediate level malignity of a melanocytic tumour in the mastoid, with areas of a high level of malignity (). Oncologists were consulted, and we came into communication with the international “rare tumours” protocol in order to choose the right therapy. Using the real-time PCR-HRM analysis technique, a mutation was detected in exon 15 of the ΒRAF (p.V600E) gene. A full radiological examination was followed by an MRI of the brain, an MRI of the visceral cranium, and an MRI of the vertebral column; a thorax-CT; a cervical/parotid/axillary/groin U/S; and an upper-lower abdomen U/S.\nThe visceral cranium MRI showed an invasive lesion of a pathological magnetic signal with mild enhancement by contrast administration and areas of necrosis, occupying all cavities of the left temporal bone (). Whether this lesion corresponds to a residual disease or postoperative lesions remains a question.\nThe rest of the radiological examination was normal. The child remained in good clinical condition without treatment.\nOne month later, due to the appearance of asymmetry on the cheek and the right preauricular region, second visceral cranium MRI was performed, which was negative for activation of the disease. Compared to the previous ΜRI, we distinguished a clear reduction in the area of the pathological signal and of the intake of the paramagnetic substance in and around the left temporal bone (). Complete regression of the metastatic bone lesion has been confirmed by follow-up; now, the child is 4 years old, alive, and without evidence of disease.
A 73-year-old Asian woman with an underlying anxiety disorder, functional headache, and hypertension was prescribed escitalopram and lorazepam when she presented with progressively worsening headaches to her primary care doctor. Her symptoms did not improve with the medications, and she was unable to eat well and required bed rest. She was transported to our hospital 4 days later after developing chest and back pain with altered consciousness. She was a housekeeper, had no allergies, and had no alcohol or tobacco smoking history. On arrival, her Glasgow Coma Scale score was 3/15 (E1V1M1); both pupils were approximately 4 mm in diameter and reactive. Her blood pressure was too low to be measured, her carotid artery pulse was palpable, her heart rate was 112 beats/minute, and her respiratory rate was 30 breaths/minute. Her conjunctiva was pale. An auscultation of breath sounds did not reveal upper and lower airway obstructions and was within normal limits. Her abdomen was soft and flat without tenderness. She had no skin abnormalities (such as rash). Both legs had no edema. Echocardiography on arrival was performed as point of care ultrasound and revealed a hypercontractile left ventricle with an eliminated left ventricular cavity and a collapsed inferior vena cava without right ventricular dilation. There was no pericardial effusion or obvious large regurgitant jet observed on color Doppler. In response, we immediately inserted a peripheral venous catheter and began introducing fluid resuscitation; however, she developed PEA. Conventional CPR according to the adult advanced cardiovascular life support guidelines (including adrenaline) was initiated and a return of spontaneous circulation (ROSC) occurred. However, her blood pressure was unstable and PEA returned, prompting repeated CPR with immediate administration of fluids and three adrenaline injections. Venoarterial extracorporeal membrane oxygenation (VA-ECMO) was initiated for refractory PEA. Whole-body contrast-enhanced computed tomography was unremarkable, and the admission laboratory results were also unremarkable, except for anemia (Table ). Her hemoglobin level decreased from 7.1 g/dL to 3.5 g/dL 1 hour later without obvious signs of gastrointestinal hemorrhage. Therefore, 8 units of packed red blood cells were transfused for 1 day, after which her hemodynamic status stabilized. She was in a coma without sedatives; thus, targeted temperature management at 34 °C was initiated on admission to an intensive care unit. Echocardiography in the intensive care unit showed a thickened interventricular septum (which was 12.8 mm), prolonged anterior mitral valve, and contact between the bodies of the anterior and posterior mitral valves, suggesting that the left ventricular obstruction could have potentially occurred through this redundant anterior mitral valve. VA-ECMO was terminated on day 3, and after stabilizing her hemodynamics, transthoracic echocardiography showed a sigmoid septum with normal left ventricular function (ejection fraction, 75%) (Fig. ). On day 26, dobutamine-infused (30 μg/kg per minute) Doppler echocardiography revealed a significant outflow gradient (236 mmHg) accompanied with chest pain (Fig. ) and intermittent systolic anterior motion (SAM) of the mitral valve; continuous monitoring during Doppler echocardiography showed a Brockenbrough–Braunwald sign (Fig. ), which is a fall of arterial blood pressure after premature ventricular contraction; these findings confirmed a diagnosis of latent LVOTO due to a sigmoid septum. The significant LVOTO was not dependent on SAM but might have occurred due to the greatly thickened interventricular septum. As a result, carvedilol was initiated with gradual increment up to 10 mg/day on day 35. In addition, verapamil (120 mg/day) was administered on day 29. A follow-up dobutamine-infused Doppler echocardiography on day 40 showed a reduction of the outflow gradient to 14 mmHg, indicating a successful medical therapy.\nThe worsening anemia that was identified at admission was suspected to be hemolytic anemia (HA) based on results of the blood test. The results of the laboratory examination, including total bilirubin, direct bilirubin, lactate dehydrogenase, reticulocyte count, and haptoglobin, and a direct Coombs test on day 1 are presented in Table . Her drug lymphocyte stimulation test was positive, and agglutination occurred when her serum reacted with lorazepam. Therefore, lorazepam-induced immunological HA was diagnosed. Her anemia improved following discontinuation of lorazepam. Her hemoglobin level was 11.9 g/dL on day 64, and she was eventually discharged on day 68 without any sequelae.
A 25-year-old unmarried male educated up to higher secondary with no premorbid mal-adaptive traits was brought to Psychiatry emergency with a history of unmanageable aggression toward family members. Review of history revealed that he had unreasonable suspiciousness toward his mother that she used to poison his food, and would also report hearing of voices of family members conspiring to kill him, along with disturbed sleep for last 20 days. He had a history of recurrent generalized tonic-clonic seizures for last 15 years. He was taking 200 mg per day of phenytoin sodium orally for long time earlier and the dose was increased to 300 mg per day after last seizure episode around 2 months back (i.e., 40 days before onset of psychosis). There was no seizure in last 2 months before presentation. There was no history of fever, head injury, disturbance in the level of consciousness or any substance use.\nHis physical examination including detailed central nervous system examination showed mild tremors of outstretched hands and titubation (family members denied having noticed it earlier) without any other abnormality. Mental status examination revealed delusions of persecution and reference along with auditory hallucinations (second person with threatening content), with impaired judgment and absent insight. Investigations including complete blood count, liver function tests, renal function tests, fasting blood sugar, serum electrolytes, serum Vitamin B12 and folic acid, X-ray chest (posterior-anterior view), electroencephalograph, and computed tomography Scan head did not reveal any abnormality. Oral lorazepam up to 6 mg in divided doses was given for initial few days in order to control marked aggression and was gradually tapered off after 7–10 days. Oral olanzapine 10 mg was started in view of psychotic features and was gradually increased to 30 mg/day over 21 days, but improvement remained unsatisfactory.\nIn view of poor improvement in psychotic symptoms and worsening of tremors and titubation (suggesting cerebellar signs of phenytoin toxicity) along with slight decrease in level of consciousness, serum phenytoin levels were obtained and were found to be markedly raised (24.9 mcg/ml against reference range of 10–20 mcg/ml). Phenytoin was stopped, and he was started on a combination of sodium valproate and clobazam as antiepileptic. It was respitefully surprising to note that besides improvement in level of consciousness, tremors and titubation; the delusions and hallucinations and aggression secondary to them, which were not responding to olanzapine 30 mg/day even after 5 weeks, started waning off within 2–3 days of stopping phenytoin. Repeat serum phenytoin levels were obtained after 10 days which came down to 19.3 mcg/ml, and again after 2 weeks when it was 12.4 mcg/ml with complete improvement in his psychotic features. Olanzapine was subsequently tapered off after being given for 5 weeks.\nAfter maintaining well for 2 months, the patient again presented in psychiatry OPD with reemergence of psychotic symptoms and tremors and titubation. On review, it was found that the patient had poor control of seizures after stopping sodium valproate and clobazam due to poor affordability. Subsequently, he had been restarted on phenytoin by a Neurologist. The serum phenytoin level was again very high (29.7 mcg/ml). This time he was managed without antipsychotics by just withholding the phenytoin, and all the symptoms disappeared in 7–10 days. Subsequently, he was again prescribed sodium valproate in consultation with treating Neurologist and logistics of follow-up visits, and free dispensing of medication were worked out. He had been symptom-free for at least 6 months thereafter.
A 37-year-old man reported exercise/activity-related muscle pain and fatigue from early childhood. His symptoms were labelled as “growing pains” by different medical professionals, and he was often called “a lazy child”. He had difficulties to keep up with his friends and family when walking. He reported physical education classes and school games as bad experiences. Throughout his life he continued to avoid activities that provoked muscle symptoms. Despite not being aware of the second wind phenomenon, he used strategies such as slowing down or stopping and restarting when symptoms eased off. He reported pain in his muscles within a few minutes or sometimes seconds of initiating physical activity, particularly noticeable when walking upstairs, walking up hills, and carrying shopping bags. He had a previous medical history of four episodes of myoglobinuria triggered by playing football or lifting heavy items. He was diagnosed with McArdle disease at the age of 20 years based on an abnormal muscle biopsy. He was later confirmed to have a homozygous mutation (p.Gln567Pro) in PYGM.\nPhysical examination at the age of 29 revealed rounded shoulders with hypertrophy of deltoid, biceps, and calf muscles. He had significantly wasted pectoralis muscles and bilateral scapular winging, but muscle strength was normal. When diagnosed he had been advised to complete at least three sessions of walking 30 minutes per week. However, he did not change his physical activity levels and did not report changes in his quality of life.\nAfter graduation he started his first office job. He became more sedentary, his weight increased, and symptoms worsened. He reported difficulties in walking short distances. Everyday tasks such as vacuuming and cutting grass became more difficult.\nHe joined a local gym, where he has been a member for approximately 9 years. Initially exercises included walking on a treadmill and cycling on a stationary bike. He tried resistance machines but was not confident in using them. Four years ago, he approached a personal trainer, who took the time to learn about his metabolic condition []. He suggested that weight lifting could be safe and effective if using principles of strength training after considering the pathophysiology of McArdle disease.\nInitial phase of training consisted of gentle 15-20 minutes aerobic exercise to warm up and get into second wind (walking on a treadmill, cycling on a stationary bike) followed by learning strengthening exercise techniques using body weight and very light weights. Training intensity gradually progressed towards mobility movements (e.g., Turkish get ups, walking lunges), increasing resistance as well as adding high intensity interval training (HIIT) protocol on the rowing ergometer at the end of the session. Strength exercises were mainly performed using compound movements with free weights rather than resistance machines. Currently, he performs a 15-20 minute aerobic warm up. He performs 1-5 repetitions with 2-5 minutes rest in between sets depending on the % of one repetition max (1RM). He also tried a different protocol involving four repetitions with 30 seconds rest followed by another four repetitions of the same weight. He has been doing two sessions with the personal trainer and two sessions on his own each week. When without the trainer, he only performs exercises he is familiar with.\nOver the past four years of strength training his weight increased from 65kg to 70kg; body composition dramatically changed by significantly increasing muscle bulk, in particular of his quadriceps, gluteus, pectoralis, deltoids, and trapezius muscles. His waist remained the same; collar size increased from size 14.5 to 15.5/16.0. He had to purchase new clothing due to dramatic change in body composition. Importantly, his muscle strength increased significantly as described in .\nHe also performed other exercises, including lateral pull downs, TRX rows, TRX pull-ups, body weight pull-ups from jumps, Olympic lifting movements, box jumps, medium height approx. 45cm, and pistol squats.\nHe has never experienced any McArdle symptoms during or after strength training and has not had myoglobinuria following his gym sessions. His serum CK level varied as expected in McArdle disease, with a decreasing trend (average CK in 2011-2014: 3,006 IU/L, average in 2015-2017: 1,029 IU/L; last measured in July 2017: 941 IU/L; reference range: up to 240 IU/L). Improvement in McArdle symptoms was described as a delayed onset of skeletal muscle symptoms, which now occurs at much higher physical activity intensity. Reaching the second wind is more efficient. In general, his quality of life improved significantly. He has been eating high protein diet with a bigger portion of carbohydrates on training days. He autonomously chose not to take any supplements containing glucose pre- or intra-training sessions.
The patient was a female aged 48 years old, who had a lumbar mass on her right lower back for 4 years, and was admitted to hospital more than a year after noticing the enlargement of the mass. The mass on the right lower back was unintentionally discovered 4 years earlier and was approximately 2 × 2 cm in size. The patient did not experience any discomfort such as chills, fever, or local pain. The mass began to enlarge 1 year earlier without discomfort. The past surgical history included total hysterectomy in 2013. On examination, a cystic mass of about 5 × 5 cm was observed in the right lower back, with clear borders, smooth surface, hard on palpation, no pressure pain, and no mobility. Laboratory examinations showed decreased hemoglobin levels of 102 g/L (normal value: 130–175 g/L). Liver function, renal function, AFP, CEA, and CA199 were normal. Color Doppler ultrasonography showed mixed echoes on the right lower back. Plain CT scans showed irregular low-density cystic masses on the right retroperitoneum and on the soft muscles of the back. The size was about 10.1 × 8.5 cm. The borders were unclear and the density was irregular. The solid region of enhanced scans showed uneven strengthening, with the mural wall showing nodular strengthening (Figs. and ). Plain MRI scans showed mixed-signal cystic solid masses in the right retroperitoneum and lower back, with necrotic bleeding, and cystic changes in the masses. T1WI showed equal or slightly lower signals, with T2WI showing high signals. The cyst wall, partition, and mural nodules were significantly strengthened, and the right kidney and liver moved forward under pressure. The boundaries with subcutaneous and surrounding muscles were unclear (Figs. –).\nBiopsy pathology prompted the diagnosis of a solid-pseudopapillary tumor, and surgical treatment was provided. Intraoperatively, a giant cystic solid tumor was observed behind the right retroperitoneum, located extremely behind the right kidney below the liver. The tumor pushed the right kidney forward and medially, and the medial side was adjacent to the inferior vena cava, the right adrenal gland, and the right diaphragm. The dorsal base of the tumor invaded the lower back muscles. The tumor, right adrenal gland, part of the diaphragm and lower back muscles were removed. The tumor had a positive resected margin, and the tumor invaded the fascia. The size of the specimen was about 10 × 8 × 5 cm. Histopathology showed tumor cells arranged in a papillary shape under a light microscopy. The cells were round or oval, the nuclei were round, and the chromatin was coarse-grained. The nucleoli were obvious and mitotic cells were abundant (Fig. ). Immunohistochemistry findings: Vimentin(+), S-100(+), CD68(+), CD163(+), CD1a(−), CD21(−), β-catenin(cytoplasm+), ER(−), PR(weak+), Fli(−), CD99(−), Catenin-b(−), CD10(−), CK(AE1/AE3)( −), cyclin D1(−), Galectin-3(−), EMA (weak +), Ki-67 (+, about 10%), the cell atypia was obvious. Electron microscopy was not performed due to limited conditions. IDCS was diagnosed based on cell morphology and immunohistochemical examination (Figs. –). There was no tumor involvement in the right adrenal gland. The patient received adjuvant radiotherapy for 2 months after the surgery. The radiotherapy dose was DT 50GY/25F. After radiotherapy, the patient's white blood cells were reduced to 2.13 × 109/L. No obvious tumor recurrence or metastatic signs were observed in the abdomen during 4 months of follow-up. Chest CT showed multiple metastases in both lungs 12 months after radiotherapy. He was given doxorubicin + ifosfamide combined chemotherapy and is still under follow-up.
A 29-year-old male patient was admitted to the emergency department with a bleeding pulsatile mass of the right groin and pain in the right lower abdominal quadrant and hypogastrium. Upon admission, the patient was confused, disorientated, and febrile. Past history included hepatitis C and heroin abuse over the last 10 years. Vital signs included a blood pressure of 130/70 mmHg, a heart rate of 110 pulses per minute and a body temperature of 38.7 Celsius degrees. Clinical examination revealed a painful, pulsatile mass extending above the right inguinal ligament to the midline. There were extensive skin and soft tissue necrosis and a fistulous track draining blood and pus. Laboratory investigation showed anemia (Ht = 34%), marked leukocytosis (24.65 K/μL), and an elevated CRP (186 mg/dL). After insertion of a central venous line catheter for fluid resuscitation, a diagnostic duplex ultrasound was performed, which revealed a large pseudoaneurysm of the right common femoral artery (CFA), extending above the inguinal ligament and surrounded by a large extraperitoneal abscess. Abdominal and thigh computed tomography scan demonstrated a 20-millimeter pseudoaneurysm of the right external iliac and common femoral artery, with marked inflammatory fluid collection.\nThe patient was transferred to the surgical ward where intravenous administration of antibiotics was initiated. Digital subtraction angiography (DSA) of the abdominal aorta, iliac, and peripheral arteries was performed via a left brachial approach, in an attempt to primarily exclude the pseudoaneurysm with a stent graft before surgical debridement and drainage of the abscess. Due to profound kinking and compression of the external iliac artery by the surrounding abscess, an attempt to cross the lesion antegrade proved fruitless. A second attempt to exclude the pseudoaneurysm retrograde via femoral cutdown also failed, despite successful crossing of the lesion with a 0.035′′ J-wire because the stent graft could not be advanced beyond the external iliac artery.\nWe next opted for an open approach. A midline abdominal incision was carried out and the aortic bifurcation and the right external and internal iliac artery were dissected and controlled with elastic tapes. The CFA was exposed via a longitudinal incision in the groin. After heparin administration and cross-clamping of the external iliac and the CFA, the right extraperitoneal cavity was explored and a large amount of pus was evacuated. Careful dissection of the distal external iliac artery towards the CFA revealed a 3 cm long defect in the anterior wall of the artery (). Due to the unavailability of any autologous veins, the right internal iliac artery was harvested from its origin to its first pelvic branch and used as an interposition graft from the external iliac to the CFA in an end-to-end fashion. Based upon our previous experience with the use of the internal iliac artery [], we considered this to be the best option for this patient (). Cultures obtained from the abscess were positive for Streptococcus and Klebsiella. Due to extensive necrosis of the overlying skin and soft tissues, the femoral wound was partially closed.\nOn the 10th postoperative day, the patient suffered bleeding from a leak in the graft anastomosis and was emergently taken to the operating room, where a PTFE patch was wrapped over the arterial graft to secure the anastomotic site (). Unfortunately, ten days later, the patient suffered a second, massive bleeding from the right femoral artery, due to patch rupture, and was reoperated urgently due to imminent hemorrhagic shock. Immediate clamping of the femoral artery was performed to stop the bleeding, and, after resuscitation, the right femoral artery was ligated. An extra-anatomical right subclavian-popliteal bypass was then carried out using an 8 mm PTFE graft. Postoperatively, the patient maintained a good peripheral arterial flow and, after daily wound care and surgical debridement, reconstructive surgery was planned to cover the tissue defect of the right groin.\nA contralateral, distally based rectus abdominis musculocutaneous flap was harvested in order to cover the affected right groin area. Due to previous manipulations of the iliac and femoral vessels we opted for the rectus abdominis muscle instead of the tensor fascia lata (TFL) flap, routinely used otherwise. The distal third of the flap was harvested as a myocutaneous flap in order to reconstruct the right groin area, whereas the proximal two thirds consisted solely of the rectus abdominis muscle separated from its fascia. After ligating the superior epigastric vessels and dividing the proximal insertion of the muscle, the flap was meticulously raised from the posterior fascia and passed through a suprapubic tunnel in order to cover the right groin defect. Subsequently, the myocutaneous portion of the flap was fixed in place. A mesh was used to cover and strengthen the lower part of the abdomen in order to minimize herniation (). The patient was mobilized on the 5th postoperative day, while the rest of his postoperative course was uneventful. He was discharged after 64 days of hospitalization on double antiplatelet therapy (aspirin 100 mg plus clopidogrel 75 mg daily) and satisfactory wound healing. The extra-anatomic graft remains patent one year postoperatively.
This 29-year-old woman was previously healthy until she awoke with a severe left frontal headache associated with nausea and vomiting. A few days later, she had a similar episode, prompting medical attention. A head MRI scan demonstrated a large, partially enhancing, left frontal lesion with some mass effect including mild left-to-right shift and compression of the ipsilateral ventricle. There was some high attenuation on pre-gadolinium images. It also had some hypodense and cystic areas. It did not appear to cross the corpus callosum. A left frontal craniotomy with intraoperative motor and speech mapping was performed and the entire enhancing component was resected. A decision was made not to treat the neoplasm with radiation or chemotherapy, but to follow with frequent MRI scans.\nOver the next 2 years, the patient remained asymptomatic and MRI scans were stable. Eventually however, they revealed gradually increasing areas of FLAIR abnormality and a small area of new enhancement situated near the anterior pole of the surgical cavity. The corpus callosum was thickened and the neoplasm had now extended into the right frontal lobe. Therefore, a second resection was performed roughly 2.2 years after her initial presentation. The patient was treated post-operatively with 12 cycles of temozolomide chemotherapy. At her last follow-up visit 3.5 years from the first surgery, she was doing well with stable disease on imaging studies.\nThe first pathology specimen revealed a neoplasm that was mostly consistent with oligodendroglioma, WHO grade II, but focally showed small foci of enlarged epithelioid cells with increased cytoplasm, nucleolar prominence, and increased mitotic activity of up to 6 mitoses per 10 high powered fields, warranting a designation of focal anaplasia, WHO grade III. Small clusters of minigemistocytes were seen in a few areas. In addition there were multiple small GGLF that were mostly intermingled with the rest of the tumor. These foci included large, dysmorphic, occasionally binucleate ganglion cells embedded within collections of loose to microcystic, delicate fibrillary matrix, consistent with tumor-associated neuropil. A small subset of these dysmorphic cells contained discernable Nissl substance. No EGBs or bizarre astrocytes were seen in either component. The recurrent tumor showed similar features, but had only rare GGLF. Additionally, there was focal microvascular proliferation as well as focal pseudopalisading necrosis, further evidence of its anaplastic nature. Immunohistochemical studies revealed cytoplasmic and Golgi-like synaptophysin positivity in both dysmorphic ganglion cells and a subset of the oligodendroglioma cells. The dysmorphic ganglion cells were also variably immunoreactive for neurofilament protein and Neu-N, while the oligodendroglioma cells were negative. Subsets of tumor cells were strongly GFAP positive, mostly showing morphologic features of minigemistocytes and gliofibrillary oligodendrocytes. Endothelial cells stained appropriately for CD34, although tumor cells were negative. The Ki-67 labeling index was mostly low, but focally reached up to 12% in the oligodendroglial component. Dysmorphic ganglion cells were negative. FISH studies were performed on the recurrent tumor and showed 1p and 19q codeletion. However, there were too few dysmorphic ganglion cells to reliably analyze the GGLF portion.
An 8-year-old male patient who complained of deformity, pain, and limited range of motion in his right elbow for the past 2 years was hospitalized in our department in January 2018. The patient had a normal full-term delivery and did not report a traumatic or family history of malformation. Upon physical examination, the right elbow joint presented with a valgus deformity (carrying angle: 25°). No swelling was observed and no percussion pain was reported by the patient. The posterior cubital triangle of the right elbow was present. The range of elbow flexion and extension was 0° to 120°. Rotation of the right forearm was limited; the range of supination was 60° to 80° (Fig. ). The circumference of the right mid-arm muscle was not different from that of the left arm. Myodynamia of the right arm also was normal. No other motion dysfunction was noted in the bilateral hand or wrist joints. Bilateral digital radiography (DR) of the elbows showed synostosis of the right proximal radioulnar joint as well as valgus deformity in the right elbow; no obvious abnormality was observed in the left elbow (Fig. ). A 3-dimensional computed tomography (3D CT) scan showed dysplasia in the proximal part of the right ulna and radius as well as anterior dislocation of the radius head (Fig. ). Based on these findings, the patient was diagnosed with congenital proximal radioulnar synostosis of the right elbow and right radial head dislocation.\nThe following surgical procedures were performed: arthrolysis of the right proximal radioulnar joint, proximal radius osteotomy, internal fixation with Kirschner wires, and reconstruction of the annular ligament of the radius. The posterolateral elbow approach was used. During surgery, dislocation of the radial head, synostosis of the radius and ulna, and absence of the annular ligament were confirmed. Rotation of the forearm was severely limited. The proximal fusion of the ulna and radius were separated by osteotomy after cleaning hypertrophic scar tissue under the capitulum humerus. Bone wax was applied to the surfaces of the osteotomy sites for hemostasis. Reduction of the radial head was performed via a Wedge osteotomy approximately 1.5 cm below the radial head. The radial head was fixed to the radius trunk using 2 Kirschner wires from the capitulum humerus to the radius trunk with the elbow flexed at 90° and the forearm in the supination position. A vascularized fascial patch was placed proximally between the ulna and radius to reconstruct the annular ligament (Fig. ). The incision was closed after hemostasis and douching. The right elbow was immobilized in the flexion and supination position via a plaster cast for 2 weeks. Nonsteroidal anti-inflammatory drugs were administered to prevent heterotopic ossification.\nDR 2 weeks postoperation showed that the radial head was not dislocated and the proximal radioulnar joint had not re-fused (Fig. ). At 4 weeks postoperation, the Kirschner wires were removed, and flexion, extension, and rotation exercises were started. DR 4 weeks postoperation showed partial union of the radial head and no obvious fusion of the proximal radioulnar joint (Fig. ). At 2 months postoperation, the range of flexion and extension was 10° to 100°, the range of pronation was 0° to 10°, the range of supination was 0° to 60°, and the carrying angle was 15°. The 2-month postoperation DR also showed total union of the radial head with the corpus radii and no obvious fusion of the proximal radioulnar joint (Fig. ). At 4 months postoperation, the range of flexion and extension was 0° to 130°, the range of pronation was 0° to 15°, the range of supination was 0° to 90°, and the carrying angle was 15°. Myodynamia was normal. The 4-month postoperation DR showed that the proximal radioulnar joint was in the correct position with significant osteoproliferation around the joint (Fig. ). At 6 months postoperation, there was no significant change in function from the 4-month follow-up (Fig. ), but the patient reported slight discomfort when the right forearm was pronated for long periods of time. The 6-month postoperation DR showed that fusion between the proximal radius and ulna had recurred (Fig. ). The case report was waived from the Jilin Province FAW General Hospital Ethical Board, based upon their policy to review all intervention and observational study except for a case report. The patient provided informed consent for the publication of his clinical data. The presented data are anonymized and risk of identification is minimal.

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.