text
stringlengths
9
4.92M
input_ids
listlengths
4
1.02k
attention_mask
listlengths
4
1.02k
Hope. Joy.. Feelings cloaked as words. Tag challenge deep down where you are truly are the most rudimental form of you. it is a will, a compassion, a purpose, a meaning, a purpose to bring meaning to this world that slowly loses its meaning. on the surface we... Continue Reading → We live in a society where opportunities are more open to everyone, information is more accessible to everyone, the ways of thinking are more widely acceptable by everyone, choices are more freely to be made by people. Or is it?... Continue Reading → 3:30 a.m. woke up by the alarm and some discipline, the wee hours felt groggy but I must get ready for the run 2 hours away. Dragged myself out of bed, washed up with a half-awoken mind, saturated myself with... Continue Reading → Wow... This is beyond my imaginations and the fact that I have made it this far not giving up on anything yet, indeed this is remarkable. Thanks! A big shout-out to people who read my posts although I had hiatuses... Continue Reading → What is life? A simple rhetorical question that we ask ourselves every time that we need to. Most of us wander around in this realm of life without any definite purpose; most of us live simply just to find the... Continue Reading → Falling down in life is inevitable and the chances of people getting up are never on the bright side. Life is never a bed of roses and we should never underestimate the repercussions of losing momentum completely. If we were... Continue Reading → The sun overhung above me, shining mercilessly on me, scorching the air that I breathed. I was heaving heavily as I reached my 3rd km mark, my body was shouting out for me to quit, to take a rest, and... Continue Reading → do the right thing, at the right time, at the right place, for the right reason. - Mr. Leong Youth is never waiting, so as time. I am not any younger than I was yesterday, I am letting time slip... Continue Reading → Scratching my head after I had awakened from a sudden blackout while pondering about my choices about giving consciousness to an Artificial Intelligence (A.I.)- my computer, Alexa. I did all my equations over stacks of papers, scribbled messily. The idea... Continue Reading →
[ 34456, 13, 14087, 492, 18571, 654, 45853, 355, 2456, 13, 198, 198, 24835, 198, 198, 36747, 3540, 198, 198, 22089, 866, 810, 345, 389, 4988, 389, 262, 749, 28906, 9134, 1296, 286, 345, 13, 340, 318, 257, 481, 11, 257, 15213, 11, 257, 4007, 11, 257, 3616, 11, 257, 4007, 284, 2222, 3616, 284, 428, 995, 326, 6364, 14754, 663, 3616, 13, 319, 262, 4417, 356, 986, 10054, 11725, 15168, 198, 198, 1135, 2107, 287, 257, 3592, 810, 6443, 389, 517, 1280, 284, 2506, 11, 1321, 318, 517, 9857, 284, 2506, 11, 262, 2842, 286, 3612, 389, 517, 6768, 10909, 416, 2506, 11, 7747, 389, 517, 12748, 284, 307, 925, 416, 661, 13, 1471, 318, 340, 30, 986, 10054, 11725, 15168, 198, 198, 18, 25, 1270, 257, 13, 76, 13, 19092, 510, 416, 262, 10436, 290, 617, 12883, 11, 262, 43671, 2250, 2936, 7128, 19970, 475, 314, 1276, 651, 3492, 329, 262, 1057, 362, 2250, 1497, 13, 12697, 2004, 3589, 503, 286, 3996, 11, 18989, 510, 351, 257, 2063, 12, 707, 4233, 2000, 11, 24725, 3589, 351, 986, 10054, 11725, 15168, 198, 198, 22017, 986, 770, 318, 3675, 616, 3590, 7352, 290, 262, 1109, 326, 314, 423, 925, 340, 428, 1290, 407, 3501, 510, 319, 1997, 1865, 11, 5600, 428, 318, 11004, 13, 6930, 0, 317, 1263, 9191, 12, 448, 284, 661, 508, 1100, 616, 6851, 3584, 314, 550, 289, 5375, 2664, 986, 10054, 11725, 15168, 198, 198, 2061, 318, 1204, 30, 317, 2829, 38505, 1808, 326, 356, 1265, 6731, 790, 640, 326, 356, 761, 284, 13, 4042, 286, 514, 27776, 1088, 287, 428, 13360, 286, 1204, 1231, 597, 21892, 4007, 26, 749, 286, 514, 2107, 2391, 655, 284, 1064, 262, 986, 10054, 11725, 15168, 198, 198, 37, 9221, 866, 287, 1204, 318, 13203, 290, 262, 8395, 286, 661, 1972, 510, 389, 1239, 319, 262, 6016, 1735, 13, 5155, 318, 1239, 257, 3996, 286, 42152, 290, 356, 815, 1239, 34994, 262, 34056, 286, 6078, 12858, 3190, 13, 1002, 356, 547, 986, 10054, 11725, 15168, 198, 198, 464, 4252, 625, 43274, 2029, 502, 11, 22751, 40618, 306, 319, 502, 11, 34203, 10813, 262, 1633, 326, 314, 39545, 13, 314, 373, 339, 2703, 7272, 355, 314, 4251, 616, 513, 4372, 10571, 1317, 11, 616, 1767, 373, 19642, 503, 329, 502, 284, 11238, 11, 284, 1011, 257, 1334, 11, 290, 986, 10054, 11725, 15168, 198, 198, 4598, 262, 826, 1517, 11, 379, 262, 826, 640, 11, 379, 262, 826, 1295, 11, 329, 262, 826, 1738, 13, 532, 1770, 13, 1004, 506, 17582, 318, 1239, 4953, 11, 523, 355, 640, 13, 314, 716, 407, 597, 7099, 621, 314, 373, 7415, 11, 314, 716, 9616, 640, 13819, 986, 10054, 11725, 15168, 198, 198, 3351, 81, 19775, 616, 1182, 706, 314, 550, 39217, 422, 257, 4802, 45939, 981, 16723, 1586, 546, 616, 7747, 546, 3501, 10510, 284, 281, 35941, 9345, 357, 32, 13, 40, 2014, 12, 616, 3644, 11, 34630, 13, 314, 750, 477, 616, 27490, 625, 24285, 286, 9473, 11, 44661, 9342, 2085, 813, 13, 383, 2126, 986, 10054, 11725, 15168 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Inhibition by ammonium ion of germination of unactivated spores of Bacillus cereus T induced by l-alanine and inosine. Studies were carried out on the inhibitory effect of NH4+ on germination of spores of Bacillus cereus T induced by L-alanine and inosine. Kinetic analysis showed that NH4+ inhibited the germination competitively. Its inhibitory effect was greater when the unactivated spores had been preincubated with L-alanine. NH4+ did not inhibit the response of unactivated spores to L-alanine during preincubation. These results suggest that L-alanine sensitizes the spores to the inhibitory effect of NH4+.
[ 818, 24108, 416, 34946, 1505, 22088, 286, 27602, 17928, 286, 555, 33106, 47306, 286, 35583, 44342, 6736, 385, 309, 18268, 416, 300, 12, 25786, 500, 290, 287, 418, 500, 13, 198, 45833, 547, 5281, 503, 319, 262, 26776, 652, 1245, 286, 24451, 19, 10, 319, 27602, 17928, 286, 47306, 286, 35583, 44342, 6736, 385, 309, 18268, 416, 406, 12, 25786, 500, 290, 287, 418, 500, 13, 16645, 5139, 3781, 3751, 326, 24451, 19, 10, 48582, 262, 27602, 17928, 7606, 306, 13, 6363, 26776, 652, 1245, 373, 3744, 618, 262, 555, 33106, 47306, 550, 587, 662, 1939, 549, 515, 351, 406, 12, 25786, 500, 13, 24451, 19, 10, 750, 407, 26776, 262, 2882, 286, 555, 33106, 47306, 284, 406, 12, 25786, 500, 1141, 662, 1939, 549, 341, 13, 2312, 2482, 1950, 326, 406, 12, 25786, 500, 3054, 3029, 274, 262, 47306, 284, 262, 26776, 652, 1245, 286, 24451, 19, 27613 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Cuc Phuong is very diverse in flora species composition structure. With such an area equaling to 0.07 % out of the total area nationwide, it accounts for 57.93 % of flora families, 36.09 % of genetic diversity and 17.27 % of the species as compared with total figures for the country. Cuc Phuong NP has 20,473 ha of forest out of the total land area of 22,200 ha (accounting for 92.2 %). The vegetation cover here is the type of evergreen tropical rainforest. According to Thai Van Trung (1976), Cuc Phuong belongs to the type of closed humid evergreen tropical rainforest. Cuc Phuong has a considerable area of primary forest, mainly focused on the limestone mountain area and at valleys in the centre of the NP. It is the special location that leads to the rich species composition structure of the park. Cuc Phuong contains many non-indigenous plant species established with many indigenous ones. Representation of the indigenous species is those of Lauraceae, Magnoliaceae and Meliaceae families while those species of Dipterocarpaceae family is representative of non-indigenous species from the warmer southern region. Representative of those coming from the north are those of Fagaceae species. Cuc Phuongisan area of​​significantprimary forest, mainlyonlimestonemountainsandvalleysinthecenter ofthe park.As aspecial placetoholdthe rich plant species inCuc Phuong. Survey results of recent years (2008) recorded 2,234 species of 917 genera, 231 families. Many of them are of high value: 430 medicinal plant species, 229 edible plant species, 240 species can be used as medicine, dye, 137 species can provide tannin, etc; 13 species are listed in Vietnam Red Data Book 2000 and IUCN Red List 2004. Some outstanding species are Dalbergia tonkinensis; Parashorea chinensis, Erythrophloeum fordii; and Nageia fleyri. There are 11 endemic plant species, including Camellia cucphuongensis; Begonia cucphuongensis; Pistacia cucphuongensis; Amorphophallus dzui; Vietorchis aurea; Carex trongii, etc. The vertebrate animal species in Cuc Phuong is rich and diverse, there are 133 species, accounting for 51.35 % of the total nationwide (259 species). For birds, Cuc Phuong NP is assessed by Birdlife International as an Important Bird Area of Vietnam. It has recorded here now 336 species, accounting for 39.25 % of the total bird species nationwide (856 species). For reptiles, Cuc Phuong NP has 76 species, accounting for 26.67 % of the nation’s total figure (296 species). For amphibians, Cuc Phuong NP has 46 species, accounting for 28.39% of the nation’s total figure (162 species). For fish, Cuc Phuong NP has 66 species, accounting for 10.81 % of the nation’s total figure of fresh water fish species (610 species).In total 659 vertebrate species that 85 species have recorded in Vietnam Red Book, some Cuc Phuong endemic species such as Trachipythecus francoisi delacouri, Callosciurus erythraeus cucphuongensis, Tropidophorus cucphuongensis, Rana maosonensis, Pterocryptis cucphuongensis etc. - Invertebratefauna: The invertebrate fauna in Cuc Phuong is even more abundant and diverse. In the period from 2000-2008, about 7,400 invertebrate animal samples have been collected, including 1,670 species and species types of insect, 14 crustacean species, 18 species and types of species of myriapod, 16 spider-shaped species, 52 species and species types of annelid, 129 species and species types of mollusc, and many other species of lower animal. However, it is due to the fact that the lower animal species did not get much attention and research on these species have been rarely done; the figures mentioned are the preliminary ones only. In reality, the invertebrates in Cuc Phuong are extremely rich and diverse, it is estimated the real figures are much higher. - Palaeontology: In addition to the relics and fossils of prehistoric animals have been discovered and excavated and published before. Recently, in 2000, a marine animal fossil has been found in CucPhuongNational Park. Fossils exposed on the suface of limestone rock, it appeared in Dong Giao fomation to Middle Triassic (T2), it is about 200 to 230 million years, including at least 12 intact vertebra, 10 ribs and some others. The fossil has been preliminarily determined Placodontia species (reptiles tooth blade). According to scientists, this is first discovery in Southeast Asiaon Placodontia. Socio-economicsituation - Ethnic: CucPhuongNational Park is located in the region of 14 communes that include two mainly ethnic groups. Muong ethnic accounted for 76.6% of the total population in the region and Kinh ethnic is accounted for 23.4%. Two ethnic groups have been the oldest community living both in terms of economic and cultural. In recent years, in the process of innovation, market economy has penetrated into the Muong villages that are gradually losing the cultural characteristics. However, there are some villages in remote areas still retaining the customs, festival of Gongs ... that bring imbued Muong’s culture. The values of intangible culture are human resources that are likely to serve to promote eco-tourism development, culture and the humanity in the future.
[ 34, 1229, 1380, 84, 506, 318, 845, 10084, 287, 48037, 4693, 11742, 4645, 13, 2080, 884, 281, 1989, 1602, 4272, 284, 657, 13, 2998, 4064, 503, 286, 262, 2472, 1989, 13673, 11, 340, 5504, 329, 7632, 13, 6052, 4064, 286, 48037, 4172, 11, 4570, 13, 2931, 4064, 286, 8513, 9573, 290, 1596, 13, 1983, 4064, 286, 262, 4693, 355, 3688, 351, 2472, 5538, 329, 262, 1499, 13, 327, 1229, 1380, 84, 506, 28498, 468, 1160, 11, 37804, 387, 286, 8222, 503, 286, 262, 2472, 1956, 1989, 286, 2534, 11, 2167, 387, 357, 23317, 278, 329, 10190, 13, 17, 4064, 737, 383, 28459, 3002, 994, 318, 262, 2099, 286, 1683, 14809, 19690, 6290, 29623, 13, 4784, 284, 18933, 6656, 833, 2150, 357, 38108, 828, 327, 1229, 1380, 84, 506, 14448, 284, 262, 2099, 286, 4838, 35441, 1683, 14809, 19690, 6290, 29623, 13, 327, 1229, 1380, 84, 506, 468, 257, 11091, 1989, 286, 4165, 8222, 11, 8384, 5670, 319, 262, 48520, 8598, 1989, 290, 379, 43088, 287, 262, 7372, 286, 262, 28498, 13, 632, 318, 262, 2041, 4067, 326, 5983, 284, 262, 5527, 4693, 11742, 4645, 286, 262, 3952, 13, 327, 1229, 1380, 84, 506, 4909, 867, 1729, 12, 521, 12357, 4618, 4693, 4920, 351, 867, 17673, 3392, 13, 10858, 341, 286, 262, 17673, 4693, 318, 883, 286, 13240, 48319, 11, 14872, 11106, 48319, 290, 5616, 72, 48319, 4172, 981, 883, 4693, 286, 43945, 353, 420, 5117, 48319, 1641, 318, 8852, 286, 1729, 12, 521, 12357, 4693, 422, 262, 23254, 8372, 3814, 13, 19920, 286, 883, 2406, 422, 262, 5093, 389, 883, 286, 376, 363, 48319, 4693, 13, 327, 1229, 1380, 84, 506, 9057, 1989, 286, 39009, 36591, 39754, 8222, 11, 8384, 261, 2475, 19115, 368, 608, 1299, 392, 2100, 21325, 600, 258, 16159, 286, 1169, 3952, 13, 1722, 355, 431, 2413, 21957, 316, 1219, 727, 1169, 5527, 4618, 4693, 287, 34, 1229, 1380, 84, 506, 13, 198, 198, 14214, 3304, 2482, 286, 2274, 812, 357, 11528, 8, 6264, 362, 11, 24409, 4693, 286, 860, 1558, 1152, 64, 11, 34598, 4172, 13, 4650, 286, 606, 389, 286, 1029, 1988, 25, 35090, 30381, 4618, 4693, 11, 31064, 35988, 4618, 4693, 11, 14956, 4693, 460, 307, 973, 355, 9007, 11, 30121, 11, 21643, 4693, 460, 2148, 256, 1236, 259, 11, 3503, 26, 1511, 4693, 389, 5610, 287, 10836, 2297, 6060, 4897, 4751, 290, 314, 9598, 45, 2297, 7343, 5472, 13, 2773, 11660, 4693, 389, 12348, 3900, 544, 5680, 5116, 37834, 26, 2547, 1077, 46215, 22531, 37834, 11, 412, 563, 400, 10051, 24617, 388, 329, 67, 4178, 26, 290, 399, 496, 544, 277, 1636, 380, 13, 1318, 389, 1367, 42560, 4618, 4693, 11, 1390, 32653, 297, 544, 38421, 746, 84, 506, 37834, 26, 47479, 11339, 38421, 746, 84, 506, 37834, 26, 18667, 47431, 38421, 746, 84, 506, 37834, 26, 1703, 13425, 2522, 439, 385, 288, 89, 9019, 26, 8730, 273, 354, 271, 257, 495, 64, 26, 7276, 87, 491, 506, 4178, 11, 3503, 13, 198, 198, 464, 30362, 40804, 5044, 4693, 287, 327, 1229, 1380, 84, 506, 318, 5527, 290, 10084, 11, 612, 389, 22169, 4693, 11, 14317, 329, 6885, 13, 2327, 4064, 286, 262, 2472, 13673, 357, 25191, 4693, 737, 1114, 10087, 11, 327, 1229, 1380, 84, 506, 28498, 318, 15276, 416, 14506, 6042, 4037, 355, 281, 28511, 14506, 9498, 286, 10836, 13, 632, 468, 6264, 994, 783, 38867, 4693, 11, 14317, 329, 5014, 13, 1495, 4064, 286, 262, 2472, 6512, 4693, 13673, 357, 23, 3980, 4693, 737, 1114, 46617, 11, 327, 1229, 1380, 84, 506, 28498, 468, 8684, 4693, 11, 14317, 329, 2608, 13, 3134, 4064, 286, 262, 3277, 447, 247, 82, 2472, 3785, 357, 27137, 4693, 737, 1114, 38255, 1547, 11, 327, 1229, 1380, 84, 506, 28498, 468, 6337, 4693, 11, 14317, 329, 2579, 13, 2670, 4, 286, 262, 3277, 447, 247, 82, 2472, 3785, 357, 25061, 4693, 737, 1114, 5916, 11, 327, 1229, 1380, 84, 506, 28498, 468, 7930, 4693, 11, 14317, 329, 838, 13, 6659, 4064, 286, 262, 3277, 447, 247, 82, 2472, 3785, 286, 4713, 1660, 5916, 4693, 357, 39132, 4693, 737, 818, 2472, 718, 3270, 30362, 40804, 4693, 326, 7600, 4693, 423, 6264, 287, 10836, 2297, 4897, 11, 617, 327, 1229, 1380, 84, 506, 42560, 4693, 884, 355, 833, 620, 541, 88, 1169, 9042, 1216, 47699, 23267, 1619, 330, 10300, 11, 4889, 418, 979, 31891, 220, 1924, 400, 430, 27650, 38421, 746, 84, 506, 37834, 11, 25491, 312, 2522, 15125, 38421, 746, 84, 506, 37834, 11, 371, 2271, 285, 7495, 261, 37834, 11, 350, 353, 420, 6012, 271, 38421, 746, 84, 506, 37834, 3503, 13, 198, 198, 12, 554, 332, 660, 40804, 69, 32837, 25, 383, 40631, 660, 40804, 277, 32837, 287, 327, 1229, 1380, 84, 506, 318, 772, 517, 23263, 290, 10084, 13, 554, 262, 2278, 422, 4751, 12, 11528, 11, 546, 767, 11, 7029, 40631, 660, 40804, 5044, 8405, 423, 587, 7723, 11, 1390, 352, 11, 43798, 4693, 290, 4693, 3858, 286, 12833, 11, 1478, 20048, 558, 272, 4693, 11, 1248, 4693, 290, 3858, 286, 4693, 286, 616, 380, 499, 375, 11, 1467, 19230, 12, 16760, 4693, 11, 6740, 4693, 290, 4693, 3858, 286, 1529, 417, 312, 11, 20248, 4693, 290, 4693, 3858, 286, 285, 692, 16241, 11, 290, 867, 584, 4693, 286, 2793, 5044, 13, 2102, 11, 340, 318, 2233, 284, 262, 1109, 326, 262, 2793, 5044, 4693, 750, 407, 651, 881, 3241, 290, 2267, 319, 777, 4693, 423, 587, 8365, 1760, 26, 262, 5538, 4750, 389, 262, 15223, 3392, 691, 13, 554, 3950, 11, 262, 40631, 660, 44835, 287, 327, 1229, 1380, 84, 506, 389, 4457, 5527, 290, 10084, 11, 340, 318, 6108, 262, 1103, 5538, 389, 881, 2440, 13, 198, 198, 12, 3175, 3609, 756, 1435, 25, 554, 3090, 284, 262, 40970, 290, 34066, 286, 44741, 4695, 423, 587, 5071, 290, 22659, 515, 290, 3199, 878, 13, 23413, 11, 287, 4751, 11, 257, 16050, 5044, 12584, 468, 587, 1043, 287, 327, 1229, 2725, 84, 506, 16186, 3250, 13, 40515, 4487, 7362, 319, 262, 424, 2550, 286, 48520, 3881, 11, 340, 4120, 287, 28831, 402, 13481, 277, 296, 341, 284, 6046, 7563, 31635, 357, 51, 17, 828, 340, 318, 546, 939, 284, 18395, 1510, 812, 11, 1390, 379 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Experience the legendary battle between the Autobots and Decepticons before their exodus to Earth in the untold story of the civil war for their home planet, Cybertron. Two distinct and intertwined campaigns chronicle the Autobots heroism in the face of total annihilation and the Decepticons unquenchable thirst for power. Play both campaigns and battle as your favorite Transformer characters in the war that spawned one of the most brutal conflicts of all time.
[ 44901, 262, 13273, 3344, 1022, 262, 41735, 1747, 290, 1024, 984, 34280, 878, 511, 39524, 284, 3668, 287, 262, 47872, 1621, 286, 262, 3026, 1175, 329, 511, 1363, 5440, 11, 5934, 4835, 1313, 13, 4930, 7310, 290, 45905, 9964, 16199, 1548, 262, 41735, 1747, 48661, 287, 262, 1986, 286, 2472, 49972, 290, 262, 1024, 984, 34280, 555, 421, 24421, 540, 24613, 329, 1176, 13, 3811, 1111, 9964, 290, 3344, 355, 534, 4004, 3602, 16354, 3435, 287, 262, 1175, 326, 29013, 530, 286, 262, 749, 12399, 12333, 286, 477, 640, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Native Village of Pedro Bay Pedro Bay is located at the head of Pedro Bay in Lake Iliamna, 30 miles northeast of Iliamna and 180 miles southwest of Anchorage. Located in a heavily wooded area, with birch, cottonwood, alders, willow and white spruce trees, Pedro Bay has one of the most attractive settings in southwest Alaska. Pedro Bay is accessible by air and water. There is a State-owned 3,000' long by 60' wide gravel airstrip. Scheduled and charter air services are available from Iliamna and Anchorage. Barge service is available from Naknek via the Kvichak River. Goods are also sent by barge from Homer to Iliamna Bay on the Cook Inlet side and portaged over a 14-mile road to Pile Bay, 10 miles to the east. The Dena'ina Indians have inhabited this area for hundreds of years, and still live in the area. The community was named for a man known as "Old Pedro," who lived in this area in the early 1900s. A post office was established in the village in 1936. St. Nicholas Russian Orthodox Chapel, built in 1890, is on the National Register of Historic Places.
[ 31272, 14812, 286, 28855, 4696, 198, 198, 43468, 305, 4696, 318, 5140, 379, 262, 1182, 286, 28855, 4696, 287, 6233, 314, 5058, 2616, 11, 1542, 4608, 24287, 286, 314, 5058, 2616, 290, 11546, 4608, 26283, 286, 50066, 13, 40764, 287, 257, 7272, 4898, 276, 1989, 11, 351, 35122, 354, 11, 15985, 3822, 11, 257, 335, 364, 11, 481, 322, 290, 2330, 599, 26524, 7150, 11, 28855, 4696, 468, 530, 286, 262, 749, 10966, 6460, 287, 26283, 12926, 13, 28855, 4696, 318, 9857, 416, 1633, 290, 1660, 13, 1318, 318, 257, 1812, 12, 11990, 513, 11, 830, 6, 890, 416, 3126, 6, 3094, 34375, 20253, 5528, 13, 27774, 6309, 290, 17422, 1633, 2594, 389, 1695, 422, 314, 5058, 2616, 290, 50066, 13, 347, 1376, 2139, 318, 1695, 422, 22255, 710, 74, 2884, 262, 509, 49547, 461, 5866, 13, 38360, 389, 635, 1908, 416, 275, 1376, 422, 28440, 284, 314, 5058, 2616, 4696, 319, 262, 8261, 554, 1616, 1735, 290, 2493, 1886, 625, 257, 1478, 12, 18085, 2975, 284, 350, 576, 4696, 11, 838, 4608, 284, 262, 7627, 13, 198, 198, 464, 5601, 64, 6, 1437, 12746, 423, 30671, 428, 1989, 329, 5179, 286, 812, 11, 290, 991, 2107, 287, 262, 1989, 13, 383, 2055, 373, 3706, 329, 257, 582, 1900, 355, 366, 19620, 28855, 553, 508, 5615, 287, 428, 1989, 287, 262, 1903, 21489, 82, 13, 317, 1281, 2607, 373, 4920, 287, 262, 7404, 287, 27653, 13, 520, 13, 20320, 3394, 17650, 32939, 11, 3170, 287, 31982, 11, 318, 319, 262, 2351, 17296, 286, 30426, 37291, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Nudists stripped down and shouted anti-corporate slogans when a second approval for the nude ban passed in City Hall. You've got to admire their tenacity. In January, a judge dismissed a lawsuit filed by San Francisco nudists that claimed their First Amendment right to free speech was violated by Supervisor Scott Wiener’s nudity ban. But the decision didn’t deter nudists from their fight to strip down in The City – they’ve filed an amended suit and are staging a protest and ‘body freedom parade’ this Saturday. The protest is scheduled at noon on July 20, in front of City Hall. The parade will follow, but there’s no word on what route it will take. Under the ban, nudists face a $100 fine for their first offense, with increases for additional infractions. The amended lawsuit includes five plaintiffs: Russell “Trey” Allen, Mitch Hightower, George Davis, Russell Mills, and Oxane “Gypsy” Taub. Although they initially sued The City for alleged free speech violations, they’ve now taken a different approach. The new suit alleges that the nudity ban has been enforced against them in a discriminatory fashion. The lawsuit states that several plaintiffs were arrested for baring it all at a rally on February 1, and the others were arrested during a nude dance on February 27. However, plaintiffs were not arrested when they participated in nude activities led by other organizations, leading them to believe that they are being targeted by The City.
[ 45, 463, 1023, 18818, 866, 290, 17293, 3098, 12, 10215, 38133, 31139, 618, 257, 1218, 7546, 329, 262, 26349, 3958, 3804, 287, 2254, 4789, 13, 198, 198, 1639, 1053, 1392, 284, 21099, 511, 3478, 4355, 13, 198, 198, 818, 3269, 11, 257, 5052, 11126, 257, 8087, 5717, 416, 2986, 6033, 26731, 1023, 326, 4752, 511, 3274, 8441, 826, 284, 1479, 4046, 373, 13998, 416, 45673, 4746, 11759, 877, 447, 247, 82, 42156, 3958, 13, 887, 262, 2551, 1422, 447, 247, 83, 2206, 26731, 1023, 422, 511, 1907, 284, 10283, 866, 287, 383, 2254, 784, 484, 447, 247, 303, 5717, 281, 11412, 6050, 290, 389, 29475, 257, 5402, 290, 564, 246, 2618, 4925, 16134, 447, 247, 428, 3909, 13, 198, 198, 464, 5402, 318, 7530, 379, 19613, 319, 2901, 1160, 11, 287, 2166, 286, 2254, 4789, 13, 383, 16134, 481, 1061, 11, 475, 612, 447, 247, 82, 645, 1573, 319, 644, 6339, 340, 481, 1011, 13, 4698, 262, 3958, 11, 26731, 1023, 1986, 257, 720, 3064, 3734, 329, 511, 717, 6907, 11, 351, 5732, 329, 3224, 1167, 37810, 13, 198, 198, 464, 11412, 8087, 3407, 1936, 21880, 25, 11563, 564, 250, 51, 4364, 447, 251, 9659, 11, 20472, 367, 432, 789, 11, 4502, 7802, 11, 11563, 19790, 11, 290, 10736, 1531, 564, 250, 44802, 13764, 447, 251, 11940, 549, 13, 4900, 484, 7317, 16334, 383, 2254, 329, 4260, 1479, 4046, 11734, 11, 484, 447, 247, 303, 783, 2077, 257, 1180, 3164, 13, 383, 649, 6050, 24763, 326, 262, 42156, 3958, 468, 587, 20326, 1028, 606, 287, 257, 27200, 6977, 13, 198, 198, 464, 8087, 2585, 326, 1811, 21880, 547, 5169, 329, 275, 1723, 340, 477, 379, 257, 7903, 319, 3945, 352, 11, 290, 262, 1854, 547, 5169, 1141, 257, 26349, 9280, 319, 3945, 2681, 13, 2102, 11, 21880, 547, 407, 5169, 618, 484, 14888, 287, 26349, 4568, 2957, 416, 584, 5745, 11, 3756, 606, 284, 1975, 326, 484, 389, 852, 7977, 416, 383, 2254, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Menu What’s your WHY? What’s your WHY?! Did you know one of the things I hate the most is pictures and videos of myself. Yes, you got that right, I’ve made a living off of posting pictures and videos of myself to social media. Something I highly DISLIKE. . So WHY?! On the days when I really don’t feel like taking another picture, making another post, coming up with the perfect thing to say, I remind myself why the heck I started this in the first place. . Sharing my story. Sharing my struggles. Helping other women not feel ALONE. Helping other women reach their true potential. This is what I get to do on a daily basis. . To me there is nothing more REWARDING than helping another woman not feel the feelings I felt for so many years. And yes I have my days where I just don’t feel like it too, but then I remember WHY I started this whole thing in the first place. I realize all that I’ve accomplished. And I remember that I’m doing EXACTLY what I set out to do. 💕 . What’s your WHY? Drop it in the comments
[ 23381, 198, 198, 2061, 447, 247, 82, 534, 44463, 30, 198, 198, 2061, 447, 247, 82, 534, 44463, 12248, 7731, 345, 760, 530, 286, 262, 1243, 314, 5465, 262, 749, 318, 5986, 290, 5861, 286, 3589, 13, 3363, 11, 345, 1392, 326, 826, 11, 314, 447, 247, 303, 925, 257, 2877, 572, 286, 10754, 5986, 290, 5861, 286, 3589, 284, 1919, 2056, 13, 13742, 314, 4047, 13954, 31271, 7336, 13, 198, 13, 198, 2396, 44463, 12248, 1550, 262, 1528, 618, 314, 1107, 836, 447, 247, 83, 1254, 588, 2263, 1194, 4286, 11, 1642, 1194, 1281, 11, 2406, 510, 351, 262, 2818, 1517, 284, 910, 11, 314, 7101, 3589, 1521, 262, 22574, 314, 2067, 428, 287, 262, 717, 1295, 13, 198, 13, 198, 2484, 1723, 616, 1621, 13, 198, 2484, 1723, 616, 12766, 13, 198, 12621, 13886, 584, 1466, 407, 1254, 8355, 11651, 13, 198, 12621, 13886, 584, 1466, 3151, 511, 2081, 2785, 13, 198, 198, 1212, 318, 644, 314, 651, 284, 466, 319, 257, 4445, 4308, 13, 198, 13, 198, 2514, 502, 612, 318, 2147, 517, 4526, 39743, 2751, 621, 5742, 1194, 2415, 407, 1254, 262, 7666, 314, 2936, 329, 523, 867, 812, 13, 843, 3763, 314, 423, 616, 1528, 810, 314, 655, 836, 447, 247, 83, 1254, 588, 340, 1165, 11, 475, 788, 314, 3505, 44463, 314, 2067, 428, 2187, 1517, 287, 262, 717, 1295, 13, 314, 6537, 477, 326, 314, 447, 247, 303, 13013, 13, 843, 314, 3505, 326, 314, 447, 247, 76, 1804, 7788, 10659, 11319, 644, 314, 900, 503, 284, 466, 13, 12520, 240, 243, 198, 13, 198, 2061, 447, 247, 82, 534, 44463, 30, 14258, 340, 287, 262, 3651 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
[Cite as State v. McDougald, 2016-Ohio-5080.] IN THE COURT OF APPEALS OF OHIO FOURTH APPELLATE DISTRICT SCIOTO COUNTY STATE OF OHIO, : Case No. 16CA3736 Plaintiff-Appellee, : v. : DECISION AND JUDGMENT ENTRY JERONE MCDOUGALD, : RELEASED: 7/15/2016 Defendant-Appellant. : APPEARANCES: Jerone McDougald, Lucasville, OH, pro se appellant. Mark E. Kuhn, Scioto County Prosecuting Attorney, and Jay S. Willis, Scioto County Assistant Prosecuting Attorney, Portsmouth, OH, for appellee. Harsha, J. {¶1} Jerone McDougald appeals the judgment denying his fifth petition for postconviction relief and his motion for leave to file a motion for new trial. McDougald contends that the court erred in denying his petition, which raised claims of ineffective assistance of his trial counsel. He additionally argues that the court erred in denying his motion for leave to file a motion for new trial, but did not assign any errors regarding this decision. {¶2} We reject McDougald’s claims. He failed to demonstrate the requirements necessary for the trial court to address the merits of his untimely claims in his fifth petition for postconviction relief. Moreover, res judicata barred this successive petition because he could have raised these claims on direct appeal or in one of his earlier postconviction petitions. Finally, because he failed to assign any error regarding the trial court’s denial of his motion for leave to file a motion for new trial, we need not address his arguments regarding that decision. Scioto App. No. 16CA3736 2 {¶3} Therefore, we affirm the judgment of the trial court denying his petition and motion. I. FACTS1 {¶4} Authorities searched a premises in Portsmouth and found crack cocaine, money, digital scales, and a pistol. They arrested the two occupants of the residence, McDougald and Kendra White, at the scene. Subsequently, the Scioto County Grand Jury returned an indictment charging McDougald with drug possession, drug trafficking, possession of criminal tools, and the possession of a firearm while under disability. McDougald pleaded not guilty to all charges. {¶5} At the jury trial Kendra White testified that McDougald used her home to sell crack cocaine and that she sold drugs on his behalf as well. She also testified that the digital scales belonged to McDougald and, although the pistol belonged to her ex- boyfriend, Benny Simpson (who was then incarcerated), McDougald asked her to bring it inside the home so that he would feel more secure. White explained that Simpson previously used the pistol to shoot at her, but threw it somewhere in the backyard when he left. Simpson then allegedly called White from jail and instructed her to retrieve the pistol. White complied and then hid it “under the tool shed” until McDougald instructed her to retrieve it and bring it inside the house. White confirmed that she saw McDougald at the premises with the gun on his person. {¶6} Jesse Dixon and Melinda Elrod both testified that they purchased crack cocaine from McDougald at the residence. Shawna Lattimore testified that she served 1Except where otherwise noted, these facts are taken from our opinion in State v. McDougald, 4th Dist. Scioto Nos. 14CA3649 and 15CA3679, 2015-Ohio-5590, appeal not accepted for review, State v. McDougald, 144 Ohio St.3d 147, 2016-Ohio-467, 845 N.E.3d 245. Scioto App. No. 16CA3736 3 as a “middleman” for McDougald's drug operation and also helped him transport drugs from Dayton. She testified that she also saw McDougald carry the pistol. {¶7} The jury returned guilty verdicts on all counts. The trial court sentenced McDougald to serve five years on the possession count, nine years for trafficking, one year for the possession of criminal tools, and five years for the possession of a firearm while under disability. The court ordered the sentences to be served consecutively for a total of twenty years imprisonment. The sentences were included in a judgment entry filed April 30, 2007, as well as a nunc pro tunc judgment entry filed May 16, 2007. {¶8} In McDougald's direct appeal, where he was represented by different counsel than his trial attorney, we affirmed his convictions and sentence. State v. McDougald, 4th Dist. Scioto No. 07CA3157, 2008-Ohio-1398. We rejected McDougald's contention that because the only evidence to link him to the crimes was “the testimony of admitted drug addicts and felons,” the verdicts were against the manifest weight of the evidence: * * * appellant's trial counsel skillfully cross-examined the prosecution's witnesses as to their statuses as drug addicts and convicted felons. Counsel also drew attention to the fact that some of the witnesses may actually benefit from the testimony that they gave. That evidence notwithstanding, the jury obviously chose to believe the prosecution's version of the events. Because the jury was in a better position to view those witnesses and determine witness credibility, we will not second- guess them on these issues. Id. at ¶ 8, 10. {¶9} In January 2009, McDougald filed his first petition for postconviction relief. He claimed that he was denied his Sixth Amendment right to confrontation when the trial court admitted a drug laboratory analysis report into evidence over his objection. Scioto App. No. 16CA3736 4 The trial court denied the petition, and we affirmed the trial court's judgment. State v. McDougald, 4th Dist. Scioto No. 09CA3278, 2009-Ohio-4417. {¶10} In October 2009, McDougald filed his second petition for postconviction relief. He again claimed that he was denied his Sixth Amendment right of confrontation when the trial court admitted the drug laboratory analysis report. The trial court denied the petition, and McDougald did not appeal the judgment. {¶11} In July 2014, McDougald filed his third petition for postconviction relief. He claimed that: (1) the trial court lacked jurisdiction to convict and sentence him because the original complaint filed in the Portsmouth Municipal Court was based on false statements sworn to by the officers; (2) the prosecuting attorney knowingly used and relied on false and perjured testimony in procuring the convictions against him; and (3) the state denied him his right to due process by withholding exculpatory evidence, i.e., a drug task force report. McDougald attached the report, the municipal court complaints, a portion of the trial transcript testimony of Kendra White, his request for discovery, and the state's answer to his request for discovery to his petition. The trial court denied the petition because it was untimely and did not fall within an exception justifying its late filing. McDougald appealed from the trial court's judgment denying his third petition for postconviction relief. {¶12} In December 2014, McDougald filed his fourth petition for postconviction relief. He claimed that his sentence is void because the trial court never properly entered a final order in his criminal case. The trial court denied the petition. McDougald appealed from the trial court's judgment denying his fourth petition for postconviction relief. Scioto App. No. 16CA3736 5 {¶13} We consolidated the appeals and affirmed the judgments of the trial court denying his third and fourth petitions for postconviction relief. McDougald, 2015-Ohio- 5590. We held that McDougald failed to establish the requirements necessary for the trial court to address the merits of his untimely claims and that res judicata barred the claims because he either raised them on direct appeal or could have raised them on direct appeal or in one of his previous petitions for postconviction relief. Id. {¶14} In November 2015, over eight and one-half years after he was sentenced, McDougald filed his fifth petition for postconviction relief. He argued that his trial counsel had provided ineffective assistance by failing to conduct an independent investigation of various matters, failing to use preliminary hearing testimony of the arresting officer to impeach the state’s case, failing to emphasize Kendra White’s prior statements to the police to impeach her testimony, failing to object to the arresting officer’s testimony that the firearm found at the scene was operable and had a clip and bullets, and failing to counter the state’s response to his objection concerning testimony about an Ohio Bureau of Criminal Investigation (“BCI”) report with evidence that the BCI employee had been timely subpoenaed. {¶15} In December 2015, McDougald filed a motion for leave to file a motion for new trial. He claimed that the state withheld a drug task force report that contained strong exculpatory evidence and that the report proved that the state presented false and perjured testimony at trial. {¶16} After the state responded, the trial court denied the petition and the motion, and this appeal ensued. II. ASSIGNMENTS OF ERROR Scioto App. No. 16CA3736 6 {¶17} McDougald assigns the following errors for our review: 1. Defendant was prejudiced by trial counsel’s failure to conduct independent investigation to rebut state’s theory of prior acts of the defendant or ask for a mistrial prejudicing defendant’s trial. 2. Defendant was prejudiced by trial counsel’s failure to conduct independ[e]nt investigation and failed to present that the prosecutor knowingly used false and fabricated testimony concerning the gun in violation of defendant[’]s due process prejudicing defendant[’]s trial. 3. Defendant was prejudiced by trial counsel[’]s failure to conduct independent investigation and failed to present that the state knowingly used false and fabricated evidence in violation of defendant’s due process rights and prejudicing defendant’s trial. 4. Defendant was prejudiced by trial counsel’s failure to conduct independent investigation and failed to present that the arresting officer[’]s conduct in admitting and establishing the op[]erability of the f[i]rearm violat[ed] defendant’s due process rights and also evidence [rule] 702-703. 5. Defendant was prejudiced by trial counsel’s failure to raise that BCI tech was subpoenaed within the 7 day requirement pursuant to R.C. 2925.51(C) prejudicing defendant’s 6th amendment rights to confrontation. Trial attorney was ineffective in this regard. III. STANDARD OF REVIEW {¶18} McDougald’s assignments of error contest the trial court’s denial of his fifth petition for postconviction relief. {¶19} The postconviction relief process is a collateral civil attack on a criminal judgment rather than an appeal of the judgment. State v. Calhoun, 86 Ohio St.3d 279, 281, 714 N.E.2d 905 (1999). Postconviction relief is not a constitutional right; instead, it is a narrow remedy that gives the petitioner no more rights than those granted by statute. Id. It is a means to resolve constitutional claims that cannot be addressed on direct appeal because the evidence supporting the claims is not contained in the record. State v. Knauff, 4th Dist. Adams No. 13CA976, 2014-Ohio-308, ¶ 18. Scioto App. No. 16CA3736 7 {¶20} “[A] trial court's decision granting or denying a postconviction relief petition filed pursuant to R.C. 2953.21 should be upheld absent an abuse of discretion; a reviewing court should not overrule the trial court's finding on a petition for postconviction relief that is supported by competent and credible evidence.” State v. Gondor, 112 Ohio St.3d 377, 2006-Ohio-6679, 860 N.E.2d 77, ¶ 58. A trial court abuses its discretion when its decision is unreasonable, arbitrary, or unconscionable. In re H. V., 138 Ohio St.3d 408, 2014-Ohio-812, 7 N.E.3d 1173, ¶ 8. IV. LAW AND ANALYSIS A. Fifth Petition for Postconviction Relief {¶21} In his five assignments of error McDougald asserts that his trial counsel was ineffective for failing to investigate his case and failing to take certain actions during his jury trial. {¶22} R.C. 2953.21(A)(2) provides that a petition for postconviction relief must be filed “no later than three hundred sixty-five days after the expiration of the time for filing the appeal.” McDougald’s fifth petition for postconviction relief was filed over eight years after the expiration of time for filing an appeal from his convictions and sentence so it was untimely. See, e.g., State v. Heid, 4th Dist. Scioto No. 15CA3710, 2016-Ohio- 2756, ¶ 15. {¶23} R.C. 2953.23(A)(1) authorizes a trial court to address the merits of an untimely filed petition for postconviction relief only if: (1) the petitioner shows either that he was unavoidably prevented from discovery of the facts upon which he must rely to present the claim for relief or that the United States Supreme Court recognized a new federal or state right that applies retroactively to him; and (2) the petitioner shows by Scioto App. No. 16CA3736 8 clear and convincing evidence that no reasonable factfinder would have found him guilty but for constitutional error at trial. {¶24} McDougald does not contend that the United States Supreme Court recognized a new right that applied retroactively to him, so he had to prove that he was unavoidably prevented from the discovery of the facts upon which he relied to present his ineffective-assistance-of-counsel claim. “A defendant is ‘unavoidably prevented’ from the discovery of facts if he had no knowledge of the existence of those facts and could not have, in the exercise of reasonable diligence, learned of their existence within the time specified for filing his petition for postconviction relief.” State v. Cunningham, 3d Dist. Allen No. 1-15-61, 2016-Ohio-3106, ¶ 19, citing State v. Holnapy, 11th Dist. Lake No. 2013-L-002, 2013-Ohio-4307, ¶ 32, and State v. Roark, 10th Dist. Franklin No. 15AP-142, 2015-Ohio-3206, ¶ 11. {¶25} The only “new” evidence cited by McDougald in his petition for postconviction relief consisted of an excerpt from the arresting officer’s preliminary hearing testimony, a subpoena issued to a BCI employee, and a CD of Kendra White’s police interview following her arrest. He does not explain how either he or his appellate counsel were unavoidably prevented from having access to this evidence at the time he filed his direct appeal. Nor does he indicate how he was unavoidably prevented from discovering them before he filed any of his previous four petitions for postconviction relief. “Moreover, ‘[t]he fact that appellant raises claims of ineffective assistance of counsel suggests that the bases for his claims could have been uncovered if “reasonable diligence” had been exercised.’ ” Cunningham, 2016-Ohio-3106, at ¶ 22, quoting State v. Creech, 4th Dist. Scioto No. 12CA3500, 2013-Ohio-3791, ¶ 18. Scioto App. No. 16CA3736 9 Therefore, McDougald did not establish that the trial court possessed the authority to address the merits of his untimely fifth petition for postconviction relief. {¶26} Furthermore, res judicata barred his successive petition because he could have raised his claims of ineffective assistance of trial counsel on direct appeal, when he was represented by different counsel, or in one of his earlier petitions for postconviction relief. See State v. Griffin, 9th Dist. Lorain No. 14CA010680, 2016-Ohio- 2988, ¶ 12, citing State v. Cole, 2 Ohio St.3d 112 (1982), syllabus (“When the issue of competent trial counsel could have been determined on direct appeal without resort to evidence outside the record, res judicata is a proper basis to dismiss a petition for postconviction relief”); Heid, 2016-Ohio-2756, at ¶ 18 (res judicata barred petitioner from raising ineffective-assistance claim that he raised or could have raised in prior petitions for postconviction relief); State v. Edwards, 4th Dist. Ross No. 14CA3474, 2015-Ohio-3039, ¶ 10 (“claims of ineffective assistance of trial counsel are barred from being raised on postconviction relief by the doctrine of res judicata”). This is not a case where the exception to the general rule of res judicata applies, i.e., this is not a case where the defendant was represented by the same counsel at both the trial and on direct appeal. See State v. Ulmer, 4th Dist. Scioto No. 15CA3708, 2016-Ohio-2873, ¶ 15. {¶27} Therefore, the trial court did not act in an unreasonable, arbitrary, or unconscionable manner by denying McDougald’s fifth petition for postconviction relief. We overrule his assignments of error. B. Motion for Leave to File Motion for New Trial Scioto App. No. 16CA3736 10 {¶28} McDougald also argues that the trial court erred by denying his motion for leave to file a motion for new trial. But he failed to assign any error regarding the court’s decision, and we thus need not address his arguments. See State v. Owens, 2016- Ohio-176, __ N.E.3d __, ¶ 59 (4th Dist.), quoting State v. Nguyen, 4th Dist. Athens No. 14CA42, 2015–Ohio–4414, ¶ 41 (“ ‘we need not address this contention because we review assignments of error and not mere arguments’ ”). {¶29} In addition, even if we exercised our discretion and treated McDougald’s “issues presented for review” as assignments of error, they would lack merit. The trial court did not abuse its considerable discretion by denying McDougald’s motion, which was based on his claim that the state withheld a drug task force report. McDougald did not establish by clear and convincing evidence that he was unavoidably prevented from discovering the report long before he filed his motion for leave over eight years after the verdict in his jury trial. See State v. N.D.C., 10th Dist. Franklin No. 15AP-63, 2015- Ohio-3643, ¶ 13. Moreover, we held in McDougald’s appeal from the denial of his fourth and fifth petitions for postconviction relief that the drug task force report did not establish that the state’s case was false because “[t]he report would merely have been cumulative to the other evidence admitted at trial” and it “did not constitute material, exculpatory evidence that the state improperly withheld from McDougald.” McDougald, 2015-Ohio-5590, at ¶ 24. V. CONCLUSION {¶30} Having overruled McDougald’s assignments of error, we affirm the judgment of the trial court. JUDGMENT AFFIRMED. Scioto App. No. 16CA3736 11 JUDGMENT ENTRY It is ordered that the JUDGMENT IS AFFIRMED and that Appellant shall pay the costs. The Court finds there were reasonable grounds for this appeal. It is ordered that a special mandate issue out of this Court directing the Scioto County Court of Common Pleas to carry this judgment into execution. Any stay previously granted by this Court is hereby terminated as of the date of this entry. A certified copy of this entry shall constitute the mandate pursuant to Rule 27 of the Rules of Appellate Procedure. McFarland, J. & Hoover, J.: Concur in Judgment and Opinion. For the Court BY: ________________________________ William H. Harsha, Judge NOTICE TO COUNSEL Pursuant to Local Rule No. 14, this document constitutes a final judgment entry and the time period for further appeal commences from the date of filing with the clerk.
[ 58, 34, 578, 355, 1812, 410, 13, 23394, 20805, 1940, 11, 1584, 12, 31274, 12, 1120, 1795, 8183, 628, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3268, 3336, 46627, 3963, 3486, 11401, 23333, 3963, 18723, 9399, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 376, 11698, 4221, 3486, 11401, 3069, 6158, 45057, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6374, 40, 26631, 41012, 198, 198, 44724, 3963, 18723, 9399, 11, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 220, 220, 8913, 1400, 13, 1467, 8141, 2718, 2623, 628, 220, 220, 220, 220, 220, 220, 220, 41990, 12, 4677, 417, 7197, 11, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 198, 198, 85, 13, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 220, 220, 27196, 42446, 5357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 449, 8322, 38, 10979, 12964, 40405, 198, 41, 1137, 11651, 337, 8610, 2606, 38, 44071, 11, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 49968, 42827, 25, 767, 14, 1314, 14, 5304, 198, 220, 220, 220, 220, 220, 220, 220, 43402, 12, 4677, 695, 415, 13, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3486, 11401, 1503, 20940, 1546, 25, 198, 198, 36134, 505, 23394, 20805, 1940, 11, 15257, 4244, 11, 18723, 11, 386, 384, 44975, 13, 198, 198, 9704, 412, 13, 46035, 77, 11, 10286, 2069, 3418, 26233, 278, 8123, 11, 290, 9180, 311, 13, 32748, 11, 10286, 2069, 3418, 198, 48902, 26233, 278, 8123, 11, 48823, 11, 18723, 11, 329, 598, 417, 7197, 13, 198, 39, 945, 3099, 11, 449, 13, 198, 220, 220, 220, 220, 220, 220, 220, 1391, 26604, 16, 92, 220, 220, 220, 4230, 505, 23394, 20805, 1940, 15192, 262, 8492, 17086, 465, 8150, 8853, 329, 198, 198, 7353, 42946, 2867, 8259, 290, 465, 6268, 329, 2666, 284, 2393, 257, 6268, 329, 649, 4473, 13, 23394, 20805, 1940, 198, 198, 3642, 2412, 326, 262, 2184, 1931, 445, 287, 17086, 465, 8853, 11, 543, 4376, 3667, 286, 23693, 198, 198, 562, 9311, 286, 465, 4473, 7739, 13, 679, 36527, 11673, 326, 262, 2184, 1931, 445, 287, 17086, 465, 198, 198, 38714, 329, 2666, 284, 2393, 257, 6268, 329, 649, 4473, 11, 475, 750, 407, 8333, 597, 8563, 5115, 428, 198, 198, 12501, 1166, 13, 628, 220, 220, 220, 220, 220, 220, 220, 1391, 26604, 17, 92, 220, 220, 220, 775, 4968, 23394, 20805, 1940, 447, 247, 82, 3667, 13, 679, 4054, 284, 10176, 262, 5359, 198, 198, 49986, 329, 262, 4473, 2184, 284, 2209, 262, 21692, 286, 465, 1418, 524, 306, 3667, 287, 465, 8150, 198, 198, 6449, 653, 329, 1281, 42946, 2867, 8259, 13, 10968, 11, 581, 2553, 291, 1045, 23902, 428, 25175, 8853, 198, 198, 13893, 339, 714, 423, 4376, 777, 3667, 319, 1277, 5198, 393, 287, 530, 286, 465, 2961, 198, 198, 7353, 42946, 2867, 32890, 13, 9461, 11, 780, 339, 4054, 284, 8333, 597, 4049, 5115, 262, 198, 198, 45994, 2184, 447, 247, 82, 14425, 286, 465, 6268, 329, 2666, 284, 2393, 257, 6268, 329, 649, 4473, 11, 356, 761, 407, 198, 198, 21975, 465, 7159, 5115, 326, 2551, 13, 198, 200, 50, 979, 2069, 2034, 13, 1400, 13, 1467, 8141, 2718, 2623, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 362, 628, 198, 220, 220, 220, 220, 220, 220, 220, 1391, 26604, 18, 92, 220, 220, 220, 8447, 11, 356, 16266, 262, 8492, 286, 262, 4473, 2184, 17086, 465, 8853, 290, 198, 198, 38714, 13, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 314, 13, 44216, 4694, 16, 628, 220, 220, 220, 220, 220, 220, 220, 1391, 26604, 19, 92, 220, 220, 220, 30756, 16499, 257, 17095 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
using System; using ModuleManager.Progress; namespace ModuleManager.Patches.PassSpecifiers { public class LegacyPassSpecifier : IPassSpecifier { public bool CheckNeeds(INeedsChecker needsChecker, IPatchProgress progress) { if (needsChecker == null) throw new ArgumentNullException(nameof(needsChecker)); if (progress == null) throw new ArgumentNullException(nameof(progress)); return true; } public string Descriptor => ":LEGACY (default)"; } }
[ 171, 119, 123, 3500, 4482, 26, 198, 3500, 19937, 13511, 13, 32577, 26, 198, 198, 14933, 10223, 19937, 13511, 13, 12130, 2052, 13, 14478, 22882, 13350, 198, 90, 198, 220, 220, 220, 1171, 1398, 14843, 14478, 22882, 7483, 1058, 6101, 562, 22882, 7483, 198, 220, 220, 220, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 1171, 20512, 6822, 23037, 82, 7, 1268, 39642, 9787, 263, 2476, 9787, 263, 11, 6101, 963, 32577, 4371, 8, 198, 220, 220, 220, 220, 220, 220, 220, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 357, 50032, 9787, 263, 6624, 9242, 8, 3714, 649, 45751, 35067, 16922, 7, 3672, 1659, 7, 50032, 9787, 263, 18125, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 357, 33723, 6624, 9242, 8, 3714, 649, 45751, 35067, 16922, 7, 3672, 1659, 7, 33723, 18125, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 2081, 26, 198, 220, 220, 220, 220, 220, 220, 220, 1782, 628, 220, 220, 220, 220, 220, 220, 220, 1171, 4731, 2935, 6519, 273, 5218, 366, 25, 2538, 38, 43300, 357, 12286, 8, 8172, 198, 220, 220, 220, 1782, 198, 92, 198 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
When doing queries to a database it’s very common to have a unified way to obtain data from it. In quepy we called it keyword. To use the Keywords in a quepy project you must first configurate what’s the relationship that you’re using. You do this by defining the class attribute of the quepy.dsl.HasKeyword. For example, if you want to use rdfs:label as Keyword relationship you do: fromquepy.dslimportHasKeywordHasKeyword.relation="rdfs:label" If your Keyword uses language specification you can configure this by doing: HasKeyword.language="en" Quepy provides some utils to work with Keywords, like quepy.dsl.handle_keywords(). This function will take some text and extract IRkeys from it. If you need to define some sanitize function to be applied to the extracted Keywords, you have define the staticmethod sanitize. It’s very common to find patterns that are repeated on several regex so quepy provides a mechanism to do this easily. For example, in the DBpedia example, a country it’s used several times as regex and it has always the same interpretation. In order to do this in a clean way, one can define a Particle by doing:
[ 2215, 1804, 20743, 284, 257, 6831, 340, 447, 247, 82, 845, 2219, 284, 423, 257, 22706, 835, 284, 7330, 198, 7890, 422, 340, 13, 554, 627, 538, 88, 356, 1444, 340, 21179, 13, 198, 2514, 779, 262, 7383, 10879, 287, 257, 627, 538, 88, 1628, 345, 1276, 717, 4566, 15537, 644, 447, 247, 82, 262, 198, 39468, 1056, 326, 345, 447, 247, 260, 1262, 13, 921, 466, 428, 416, 16215, 262, 1398, 11688, 198, 1659, 262, 627, 538, 88, 13, 67, 6649, 13, 19242, 9218, 4775, 13, 198, 198, 1890, 1672, 11, 611, 345, 765, 284, 779, 374, 7568, 82, 25, 18242, 355, 7383, 4775, 2776, 345, 466, 25, 198, 198, 6738, 421, 538, 88, 13, 9310, 2475, 634, 19242, 9218, 4775, 19242, 9218, 4775, 13, 49501, 2625, 4372, 9501, 25, 18242, 1, 198, 198, 1532, 534, 7383, 4775, 3544, 3303, 20855, 345, 460, 17425, 428, 416, 1804, 25, 198, 198, 19242, 9218, 4775, 13, 16129, 2625, 268, 1, 198, 198, 15681, 9078, 3769, 617, 3384, 4487, 284, 670, 351, 7383, 10879, 11, 588, 198, 421, 538, 88, 13, 67, 6649, 13, 28144, 62, 2539, 10879, 22446, 770, 2163, 481, 1011, 617, 198, 5239, 290, 7925, 14826, 13083, 422, 340, 13, 1002, 345, 761, 284, 8160, 617, 5336, 270, 1096, 198, 8818, 284, 307, 5625, 284, 262, 21242, 7383, 10879, 11, 345, 423, 8160, 262, 198, 12708, 24396, 5336, 270, 1096, 13, 198, 198, 1026, 447, 247, 82, 845, 2219, 284, 1064, 7572, 326, 389, 5100, 319, 1811, 40364, 523, 627, 538, 88, 198, 15234, 1460, 257, 9030, 284, 466, 428, 3538, 13, 1114, 1672, 11, 287, 262, 20137, 50235, 1672, 11, 198, 64, 1499, 340, 447, 247, 82, 973, 1811, 1661, 355, 40364, 290, 340, 468, 1464, 262, 976, 10794, 13, 198, 818, 1502, 284, 466, 428, 287, 257, 3424, 835, 11, 530, 460, 8160, 257, 2142, 1548, 416, 1804, 25 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
<!DOCTYPE html> <html lang="en" data-navbar="/account/navbar-profile.html"> <head> <meta charset="utf-8" /> <title translate="yes">Establecer o perfil predeterminado</title> <link href="/public/pure-min.css" rel="stylesheet"> <link href="/public/content.css" rel="stylesheet"> <link href="/public/content-additional.css" rel="stylesheet"> <base target="_top" href="/"> </head> <body> <h1 translate="yes">Establecer o perfil predeterminado</h1> <p translate="yes">O teu perfil predeterminado serve como principal punto de contacto da túa conta.</p> <div id="message-container"></div> <form id="submit-form" method="post" class="pure-form" action="/account/set-default-profile" name="submit-form"> <fieldset> <div class="pure-control-group"> <select id="profileid" name="profileid"> <option value="" translate="yes"> Selecciona perfil </option> </select> </div> <button id="submit-button" type="submit" class="pure-button pure-button-primary" translate="yes">Establecer o perfil predeterminado</button> </fieldset> </form> <template id="success"> <div class="success message" translate="yes"> Éxito! O perfil é o teu estándar </div> </template> <template id="unknown-error"> <div class="error message" translate="yes"> Erro! Produciuse un erro descoñecido </div> </template> <template id="default-profile"> <div class="error message" translate="yes"> Erro! Este é xa o teu perfil predeterminado </div> </template> <template id="profile-option"> <option value="${profile.profileid}"> ${profile.contactEmail}, ${profile.firstName} ${profile.lastName} </option> </template> </body> </html>
[ 27, 0, 18227, 4177, 56, 11401, 27711, 29, 198, 27, 6494, 42392, 2625, 268, 1, 1366, 12, 28341, 5657, 35922, 23317, 14, 28341, 5657, 12, 13317, 13, 6494, 5320, 198, 27, 2256, 29, 198, 220, 1279, 28961, 34534, 316, 2625, 40477, 12, 23, 1, 11037, 220, 198, 220, 1279, 7839, 15772, 2625, 8505, 5320, 22362, 540, 2189, 267, 583, 10379, 2747, 13221, 4533, 3556, 7839, 29, 198, 220, 1279, 8726, 13291, 35922, 11377, 14, 37424, 12, 1084, 13, 25471, 1, 823, 2625, 47720, 25473, 5320, 198, 220, 1279, 8726, 13291, 35922, 11377, 14, 11299, 13, 25471, 1, 823, 2625, 47720, 25473, 5320, 198, 220, 1279, 8726, 13291, 35922, 11377, 14, 11299, 12, 2860, 1859, 13, 25471, 1, 823, 2625, 47720, 25473, 5320, 198, 220, 1279, 8692, 2496, 2625, 62, 4852, 1, 13291, 35922, 5320, 198, 3556, 2256, 29, 198, 27, 2618, 29, 198, 220, 1279, 71, 16, 15772, 2625, 8505, 5320, 22362, 540, 2189, 267, 583, 10379, 2747, 13221, 4533, 3556, 71, 16, 29, 198, 220, 1279, 79, 15772, 2625, 8505, 5320, 46, 573, 84, 583, 10379, 2747, 13221, 4533, 4691, 401, 78, 10033, 4000, 1462, 390, 2800, 78, 12379, 256, 21356, 64, 542, 64, 25970, 79, 29, 198, 220, 1279, 7146, 4686, 2625, 20500, 12, 34924, 23984, 7146, 29, 198, 220, 1279, 687, 4686, 2625, 46002, 12, 687, 1, 2446, 2625, 7353, 1, 1398, 2625, 37424, 12, 687, 1, 2223, 35922, 23317, 14, 2617, 12, 12286, 12, 13317, 1, 1438, 2625, 46002, 12, 687, 5320, 198, 220, 220, 220, 1279, 3245, 2617, 29, 198, 220, 220, 220, 220, 220, 1279, 7146, 1398, 2625, 37424, 12, 13716, 12, 8094, 5320, 198, 220, 220, 220, 220, 220, 220, 220, 1279, 19738, 4686, 2625, 13317, 312, 1, 1438, 2625, 13317, 312, 5320, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1279, 18076, 1988, 33151, 15772, 2625, 8505, 5320, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1001, 293, 535, 32792, 583, 10379, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7359, 18076, 29, 198, 220, 220, 220, 220, 220, 220, 220, 7359, 19738, 29, 198, 220, 220, 220, 220, 220, 7359, 7146, 29, 198, 220, 220, 220, 220, 220, 1279, 16539, 4686, 2625, 46002, 12, 16539, 1, 2099, 2625, 46002, 1, 1398, 2625, 37424, 12, 16539, 5899, 12, 16539, 12, 39754, 1, 15772, 2625, 8505, 5320, 22362, 540, 2189, 267, 583, 10379, 2747, 13221, 4533, 3556, 16539, 29, 198, 220, 220, 220, 7359, 3245, 2617, 29, 198, 220, 7359, 687, 29, 198, 220, 1279, 28243, 4686, 2625, 13138, 5320, 198, 220, 220, 220, 1279, 7146, 1398, 2625, 13138, 3275, 1, 15772, 2625, 8505, 5320, 198, 220, 220, 220, 220, 220, 43052, 87, 10094, 0, 440, 583, 10379, 38251, 267, 573, 84, 1556, 6557, 358, 283, 198, 220, 220, 220, 7359, 7146, 29, 198, 220, 7359, 28243, 29, 198, 220, 1279, 28243, 4686, 2625, 34680, 12, 18224, 5320, 198, 220, 220, 220, 1279, 7146, 1398, 2625, 18224, 3275, 1, 15772, 2625, 8505, 5320, 198, 220, 220, 220, 220, 220, 5256, 305, 0, 21522, 979, 1904, 555, 1931, 305, 748, 1073, 12654, 721, 17305, 198, 220, 220, 220, 7359, 7146, 29, 198, 220, 7359, 28243, 29, 198, 220, 1279, 28243, 4686, 2625, 12286, 12, 13317, 5320, 198, 220, 220, 220, 1279, 7146, 1398, 2625, 18224, 3275, 1, 15772, 2625, 8505, 5320, 198, 220, 220, 220, 220, 220, 5256, 305, 0, 412, 4169, 38251, 2124, 64, 267, 573, 84, 583, 10379, 2747, 13221, 4533, 198, 220, 220, 220, 7359, 7146, 29, 198, 220, 7359, 28243, 29, 198, 220, 1279, 28243, 4686, 2625, 13317, 12, 18076, 5320, 198, 220, 220, 220, 1279, 18076, 1988, 2625, 38892, 13317, 13, 13317, 312, 92, 5320, 198, 220, 220, 220, 220, 220, 25597, 13317, 13, 32057, 15333, 5512, 25597, 13317, 13, 11085, 5376, 92, 25597, 13317, 13, 12957, 5376, 92, 198, 220, 220, 220, 7359, 18076, 29, 198, 220, 7359, 28243, 29, 198, 3556, 2618, 29, 198, 3556, 6494, 29, 198 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Building upon the pioneering work of Vicsek *et al.*[@b1], physicists, mathematicians and biologists have contemplated the self-organization of living-organism groups into flocks as an emergent process stemming from simple interaction rules at the individual level[@b2][@b3][@b4]. This idea has been supported by quantitative trajectory analysis in animal groups[@b5][@b6][@b7], together with a vast number of numerical and theoretical models[@b3][@b4], and more recently by the observations of flocking behaviour in ensembles of non-living motile particles such as shaken grains, active colloids, and mixtures of biofilaments and molecular motors[@b8][@b9][@b10][@b11][@b12]. From a physicist\'s perspective, these various systems are considered as different instances of polar active matter, which encompasses any ensemble of motile bodies endowed with local velocity--alignment interactions. The current paradigm for flocking physics is the following. Active particles are persistent random walkers, which when dilute form a homogeneous isotropic gas. Upon increasing density, collective motion emerges in the form of spatially localized swarms that may cruise in a sea of randomly moving particles; further increasing density, a homogeneous polar liquid forms and spontaneously flows along a well-defined direction[@b1][@b13][@b14]. This picture is the outcome of experiments, simulations and theories mostly performed in unbounded or periodic domains. Beyond this picture, significant attention has been devoted over the last five years to confined active matter[@b3][@b12][@b15][@b16][@b17][@b18][@b19][@b20][@b21][@b22][@b23][@b24][@b25][@b26]. Confined active particles have consistently, yet not systematically, been reported to self-organize into vortex-like structures. However, unlike for our understanding of flocking, we are still lacking a unified picture to account for the emergence and structure of such vortex patterns. This situation is mostly due to the extreme diversity in the nature and symmetries of the interactions between the active particles that have been hitherto considered. Do active vortices exist only in finite-size systems as in the case of bacterial suspensions[@b17], which lose this beautiful order and display intermittent turbulent dynamics[@b27] when unconfined? What are the necessary interactions required to observe and/or engineer bona fide stationary swirling states of active matter? In this paper, we answer these questions by considering the impact of geometrical boundaries on the collective behaviour of motile particles endowed with velocity--alignment interactions. Combining quantitative experiments on motile colloids, numerical simulations and analytical theory, we elucidate the phase behaviour of *polar* active matter restrained by geometrical boundaries. We use colloidal rollers, which, unlike most of the available biological self-propelled bodies, interact via well-established dynamical interactions[@b11]. We first exploit this unique model system to show that above a critical concentration populations of motile colloids undergo a non-equilibrium phase transition from an isotropic gaseous state to a novel ordered state where the entire population self-organizes into a single heterogeneous steadily rotating vortex. This self-organization is *not* the consequence of the finite system size. Rather, this emergent vortex is a genuine state of polar active matter lying on the verge of a macroscopic phase separation. This novel state is the only ordered phase found when unidirectional directed motion is hindered by convex isotropic boundaries. We then demonstrate theoretically that a competition between alignment, repulsive interactions and confinement is necessary to yield large-scale vortical motion in ensembles of motile particles interacting via alignment interactions, thereby extending the relevance of our findings to a broad class of active materials. Results ======= Experiments ----------- The experimental setup is fully described in the *Methods* section and in [Fig. 1a,b](#f1){ref-type="fig"}. Briefly, we use colloidal rollers powered by the Quincke electrorotation mechanism as thoroughly explained in ref. [@b11]. An electric field **E**~**0**~ is applied to insulating colloidal beads immersed in a conducting fluid. Above a critical field amplitude *E*~Q~, the symmetry of the electric charge distribution at the bead surface is spontaneously broken. As a result, a net electric torque acts on the beads causing them to rotate at a constant rate around a random axis transverse to the electric field[@b28][@b29][@b30]. When the colloids sediment, or are electrophoretically driven, onto one of the two electrodes, rotation is converted into a net rolling motion along a random direction. Here, we use poly(methyl methacrylate) (PMMA) spheres of radius *a*=2.4 μm immersed in a hexadecane solution. As sketched in [Fig. 1a](#f1){ref-type="fig"}, the colloids are handled and observed in a microfluidic device made of double-sided scotch tape and of two glass slides coated with an indium-tin-oxide layer. The ITO layers are used to apply a uniform DC field in the *z*-direction, with *E*~0~=1.6 V μm^−1^ (*E*~0~=1.1*E*~Q~). Importantly, the electric current is nonzero solely in a disc-shaped chamber at the centre of the main channel. As exemplified by the trajectories shown in [Fig. 1b](#f1){ref-type="fig"} and in [Supplementary Movie 1](#S1){ref-type="supplementary-material"}, Quincke rotation is hence restrained to this circular region in which the rollers are trapped. We henceforth characterize the collective dynamics of the roller population for increasing values of the colloid packing fraction *φ*~0~. Individual self-propulsion -------------------------- For area fractions smaller than , the ensemble of rollers uniformly explores the circular confinement as illustrated by the flat profile of the local packing fraction averaged along the azimuthal direction *φ*(*r*) in [Fig. 2a](#f2){ref-type="fig"}. The rollers undergo uncorrelated persistent random walks as demonstrated in [Fig. 2b,c](#f2){ref-type="fig"}. The probability distribution of the roller velocities is isotropic and sharply peaked on the typical speed *v*~0~=493±17 μm s^−1^. In addition, the velocity autocorrelation function decays exponentially at short time as expected from a simple model of self-propelled particles having a constant speed *v*~0~ and undergoing rotational diffusion with a rotational diffusivity *D*^−1^=0.31±0.02 s that hardly depends on the area fraction (see [Supplementary Note 1](#S1){ref-type="supplementary-material"}). These quantities correspond to a persistence length of that is about a decade smaller than the confinement radius *R*~c~ used in our experiments: 0.9 mm\<*R*~c~\<1.8 mm. At long time, because of the collisions on the disc boundary, the velocity autocorrelation function sharply drops to 0 as seen in [Fig. 2c](#f2){ref-type="fig"}. Unlike swimming cells[@b26][@b31], self-propelled grains[@b8][@b22][@b23] or autophoretic colloids[@b32], dilute ensembles of rollers do not accumulate at the boundary. Instead, they bounce off the walls of this virtual box as shown in a close-up of a typical roller trajectory in [Fig. 2d](#f2){ref-type="fig"}, and in the [Supplementary Movie 1](#S1){ref-type="supplementary-material"}. As a result, the outer region of the circular chamber is depleted, and the local packing fraction vanishes as *r* goes to *R*~c~, [Fig. 2a](#f2){ref-type="fig"}. The repulsion from the edges of the circular hole in the microchannel stems from another electrohydrodynamic phenomenon[@b33]. When an electric field is applied, a toroidal flow sketched in [Fig. 1a](#f1){ref-type="fig"} is osmotically induced by the transport of the electric charges at the surface of the insulating adhesive films. Consequently, a net inward flow sets in at the vicinity of the bottom electrode. As the colloidal rollers are prone to reorient in the direction of the local fluid velocity[@b11], this vortical flow repels the rollers at a distance typically set by the channel height *H* while leaving unchanged the colloid trajectories in the centre of the disc. This electrokinetic flow will be thoroughly characterized elsewhere. Collective motion in confinement -------------------------------- As the area fraction is increased above , collective motion emerges spontaneously at the entire population level. When the electric field is applied, large groups of rollers akin to the band-shaped swarms reported in[@b11] form and collide. However, unlike what was observed in periodic geometries, the colloidal swarms are merely transient and ultimately self-organize into a single vortex pattern spanning the entire confining disc as shown in [Fig. 3a](#f3){ref-type="fig"} and [Supplementary Movie 2](#S1){ref-type="supplementary-material"}. Once formed, the vortex is very robust, rotates steadily and retains an axisymmetric shape. To go beyond this qualitative picture, we measured the local colloid velocity field **v**(**r**, *t*) and use it to define the polarization field **Π**(**r**, *t*)≡**v**/*v*~0~, which quantifies local orientational ordering. The spatial average of **Π** vanishes when a coherent vortex forms, therefore we use its projection along the azimuthal direction as a macroscopic order parameter to probe the transition from an isotropic gas to a polar-vortex state. As illustrated in [Fig. 3b](#f3){ref-type="fig"}, displays a sharp bifurcation from an isotropic state with to a globally ordered state with equal probability for left- and right-handed vortices above . Furthermore, [Fig. 3b](#f3){ref-type="fig"} demonstrates that this bifurcation curve does not depend on the confinement radius *R*~c~. The vortex pattern is spatially heterogeneous. The order parameter and density fields averaged over time are displayed in [Fig. 3c,d](#f3){ref-type="fig"}, respectively. At first glance, the system looks phase-separated: a dense and ordered polar-liquid ring where all the colloids cruise along the azimuthal direction encloses a dilute and weakly ordered core at the centre of the disc. We shall also stress that regardless of the average packing fraction, the packing fraction in the vortex core is measured to be very close to , the average concentration below which the population is in a gaseous state, see [Fig. 3e](#f3){ref-type="fig"}. This phase-separation picture is consistent with the variations of the area occupied by the ordered outer ring, *A*~ring~, for different confinement radii *R*~c~, as shown in [Fig. 3e](#f3){ref-type="fig"}. We define *A*~ring~ as the area of the region where the order parameter exceeds 0.5, and none of the results reported below depend on this arbitrary choice for the definition of the outer-ring region. *A*~ring~ also bifurcates as *φ*~0~ exceeds , and increases with *R*~c~. Remarkably, all the bifurcation curves collapse on a single master curve when *A*~ring~ is rescaled by the overall confinement area , [Fig. 3f](#f3){ref-type="fig"}. In other words, the strongly polarized outer ring always occupies the same area fraction irrespective of the system size, as would a molecular liquid coexisting with a vapour phase at equilibrium. However, if the system were genuinely phase-separated, one should be able to define an interface between the dense outer ring and the dilute inner core, and this interface should have a constant width. This requirement is not borne out by our measurements. The shape of the radial density profiles of the rollers in [Fig. 3g](#f3){ref-type="fig"} indeed makes it difficult to unambiguously define two homogeneous phases separated by a clear interface. Repeating the same experiments in discs of increasing radii, we found that the density profiles are self-similar, [Fig. 3h](#f3){ref-type="fig"}. The width of the region separating the strongly polarized outer ring from the inner core scales with the system size, which is the only characteristic scale of the vortex patterns. The colloidal vortices therefore correspond to a monophasic yet spatially heterogeneous liquid state. To elucidate the physical mechanisms responsible for this intriguing structure, we now introduce a theoretical model that we solve both numerically and analytically. Numerical simulations --------------------- The Quincke rollers are electrically powered and move in a viscous fluid, and hence interact at a distance both hydrodynamically and electrostatically. In ref. [@b11], starting from the Stokes and Maxwell equations, we established the equations of motion of a dilute ensemble of Quincke rollers within a pairwise additive approximation. When isolated, the *i*th roller located at **r**~*i*~ moves at a speed *v*~0~ along the direction opposite to the in-plane component of the electrostatic dipole responsible for Quincke rotation[@b11]. When interacting via contact and electrostatic repulsive forces, the roller velocity and orientation are related by: Inertia is obviously ignored, and for the sake of simplicity we model all the central forces acting on the colloids as an effective hard-disc exclusion of range *b*. In addition, *θ*~*i*~ follows an overdamped dynamics in an effective angular potential capturing both the electrostatic and hydrodynamic torques acting on the colloids[@b11]: The *ξ*~*i*~\'s account for rotational diffusion of the rollers. They are uncorrelated white noise variables with zero mean and variance 〈*ξ*~*i*~(*t*)*ξ*~*j*~(*t*′)〉=2*Dδ*(*t*−*t*′)*δ*~*ij*~. The effective potential in [equation 2](#eq15){ref-type="disp-formula"} is composed of three terms with clear physical interpretations: where and **I** is the identity matrix. The symmetry of these interactions is not specific to colloidal rollers and could have been anticipated phenomenologically exploiting both the translational invariance and the polar symmetry of the surface-charge distribution of the colloids[@b34]. The first term promotes alignment and is such that the effective potential is minimized when interacting rollers propel along the same direction. *A*(*r*) is positive, decays exponentially with *r*/*H*, and results both from hydrodynamic and electrostatic interactions. The second term gives rise to repulsive *torques*, and is minimized when the roller orientation points away from its interacting neighbour. *B*(*r*) also decays exponentially with *r*/*H* but solely stems from electrostatics. The third term has a less intuitive meaning, and promotes the alignment of along a dipolar field oriented along . This term is a combination of hydrodynamic and electrostatic interactions, and includes a long-ranged contribution. The functions *A*(*r*), *B*(*r*) and *C*(*r*) are provided in the [Supplementary Note 2](#S1){ref-type="supplementary-material"}. As it turns out, all the physical parameters (roller velocity, field amplitude, fluid viscosity, etc.) that are needed to compute their exact expressions have been measured, or estimated up to logarithmic corrections, see [Supplementary Note 2](#S1){ref-type="supplementary-material"}. We are then left with a model having a single free parameter that is the range, *b*, of the repulsive *forces* between colloids. We numerically solved this model in circular simulation boxes of radius *R*~c~ with reflecting boundary conditions using an explicit Euler scheme with adaptive time-stepping. All the numerical results are discussed using the same units as in the experiments to facilitate quantitative comparisons. The simulations revealed a richer phenomenology than the experiments, as captured by the phase diagram in [Fig. 4a](#f4){ref-type="fig"} corresponding to *R*~c~=0.5 mm. By systematically varying the range of the repulsive forces and the particle concentration, we found that the (*φ*~0~, *b*) plane is typically divided into three regions. At small packing fractions, the particles hardly interact and form an isotropic gaseous phase. At high fractions, after a transient dynamics strikingly similar to that observed in the experiments, the rollers self-organize into a macroscopic vortex pattern, [Fig. 4b](#f4){ref-type="fig"} and [Supplementary Movie 3](#S1){ref-type="supplementary-material"}. However, at intermediate densities, we found that collective motion emerges in the form of a macroscopic swarm cruising around the circular box through an ensemble of randomly moving particles, [Fig. 4c](#f4){ref-type="fig"} and [Supplementary Movie 4](#S1){ref-type="supplementary-material"}. These swarms are akin to the band patterns consistently reported for polar active particles at the onset of collective motion in periodic domains[@b11][@b14]. This seeming conflict between our experimental and numerical findings is solved by looking at the variations of the swarm length *ξ*~s~ with the confinement radius *R*~c~ in [Fig. 4d](#f4){ref-type="fig"}. We define *ξ*~s~ as the correlation length of the density fluctuations in the azimuthal direction. The angular extension of the swarms *ξ*~s~/*R*~c~ increases linearly with the box radius. Therefore, for a given value of the interaction parameters, there exists a critical box size above which the population undergoes a direct transition from a gaseous to an axisymmetric vortex state. For *b*=3*a*, which was measured to be the typical interparticle distance in the polar liquid state[@b11], this critical confinement is *R*~c~=1 mm. This value is close to the smallest radius accessible in our experiments where localized swarms were never observed, thereby solving the apparent discrepancy with the experimental phenomenology. More quantitatively, we systematically compare our numerical and experimental measurements in [Fig. 3b,c](#f3){ref-type="fig"} for *R*~c~=1 mm. Even though a number of simplifications were needed to establish [equations 1](#eq13){ref-type="disp-formula"}, [2](#eq15){ref-type="disp-formula"} and [3](#eq16){ref-type="disp-formula"} (ref. [@b11]), the simulations account very well for the sharp bifurcation yielding the vortex patterns as well as their self-similar structure. This last point is proven quantitatively in [Fig. 3h](#f3){ref-type="fig"}, which demonstrates that the concentration increases away from the vortex core, where , over a scale that is solely set by the confinement radius. We shall note however that the numerical simulations underestimate the critical packing fraction at which collective motion occurs, which is not really surprising given the number of approximations required to establish the interaction parameters in the equations of motion [equation 3](#eq16){ref-type="disp-formula"}. We unambiguously conclude from this set of results that [equations 1](#eq13){ref-type="disp-formula"}, [2](#eq15){ref-type="disp-formula"} and [3](#eq16){ref-type="disp-formula"} include all the physical ingredients that chiefly dictate the collective dynamics of the colloidal rollers. We now exploit the opportunity offered by the numerics to turn on and off the four roller-roller interactions one at a time, namely the alignment torque, *A*, the repulsion torque *B* and force *b*, and the dipolar coupling *C*. Snapshots of the resulting particle distributions are reported in [Fig. 4e](#f4){ref-type="fig"}. None of these four interactions alone yields a coherent macroscopic vortex. We stress that when the particles solely interact via pairwise-additive alignment torques, *B*=*C*=*b*=0, the population condenses into a single compact polarized swarm. Potential velocity-alignment interactions are *not* sufficient to yield macroscopic vortical motion. We evidence in [Fig. 4e](#f4){ref-type="fig"} (top-right and bottom-left panels) that the combination of alignment (*A*≠0) and of repulsive interactions (*B*≠0 and/or *b*≠0) is necessary and sufficient to observe spontaneously flowing vortices. Analytical theory ----------------- Having identified the very ingredients necessary to account for our observations, we can now gain more detailed physical insight into the spatial structure of the vortices by constructing a minimal hydrodynamic theory. We start from [equations 1](#eq13){ref-type="disp-formula"}, [2](#eq15){ref-type="disp-formula"} and [3](#eq16){ref-type="disp-formula"}, ignoring the *C* term in [equation 3](#eq16){ref-type="disp-formula"}. The model can be further simplified by inspecting the experimental variations of the individual roller velocity with the local packing fraction, see [Supplementary Fig. 1](#S1){ref-type="supplementary-material"}. The roller speed only displays variations of 10% as *φ*(**r**) increases from 10^−2^ to 4 × 10^−2^. These minute variations suggest ignoring the contributions of the repulsive forces in [equation 1](#eq13){ref-type="disp-formula"}, and solely considering the interplay between the alignment and repulsion torques on the orientational dynamics of [equation 2](#eq15){ref-type="disp-formula"}. These simplified equations of motion are coarse-grained following a conventional kinetic-theory framework reviewed in[@b4] to establish the equivalent to the Navier-Stokes equations for this two-dimensional active fluid. In a nutshell, the two observables we need to describe are the local area fraction φ and the local momentum field *φ***Π**. They are related to the first two angular moments of the one-particle distribution function , which evolves according to a Fokker-Plank equation derived from the conservation of and [equations 1](#eq13){ref-type="disp-formula"} and [2](#eq15){ref-type="disp-formula"}. This equation is then recast into an infinite hierarchy of equations for the angular moments of . The two first equations of this hierarchy, corresponding to the mass conservation equation and to the momentum dynamics, are akin to the continuous theory first introduced phenomenologically by Toner and Tu[@b2][@b4]: where **Q** is the usual nematic order parameter. The meaning of the first equation is straightforward, while the second calls for some clarifications. The divergence term on the left-hand side of [equation 5](#eq26){ref-type="disp-formula"} is a convective kinematic term associated with the self-propulsion of the particles. The force field **F** on the right-hand side would vanish for non-interacting particles. Here, at first order in a gradient expansion, **F** is given by: This force field has a clear physical interpretation. The first term reflects the damping of the polarization by the rotational diffusion of the rollers. The second term, defined by the time rate *α*=(∫~*r*\>2*a*~*rA*(*r*)d*r*)/*a*^2^, echoes the alignment rule at the microscopic level and promotes a nonzero local polarization. The third term, involving *β*=(∫~*r*\>2*a*~*r*^2^*B*(*r*)d*r*)/(2*a*^2^), is an anisotropic pressure reflecting the repulsive interactions between rollers at the microscopic level. [equations 4](#eq25){ref-type="disp-formula"} and [5](#eq26){ref-type="disp-formula"} are usually complemented by a dynamical equation for **Q** and a closure relation. This additional approximation, however, is not needed to demonstrate the existence of vortex patterns and to rationalize their spatial structure. Looking for axisymmetric steady states, it readily follows from mass conservation, [equation 4](#eq25){ref-type="disp-formula"}, that the local fields must take the simple forms: *φ*=*φ*(*r*), and where *Q*(*r*)\>0. We also infer the relation from the projection of the momentum equation, [equation 5](#eq26){ref-type="disp-formula"}, on the azimuthal direction. This relation tells us that the competition between rotational diffusion and local alignment results in a mean-field transition from an isotropic state with to a polarized vortex state with and *Q*=(1)/(2)(1−*D*/(*αφ*)). This transition occurs when φ exceeds , the ratio of the rotational diffusivity to the alignment strength at the hydrodynamic level. In addition, the projection of [equation 5](#eq26){ref-type="disp-formula"} on the radial direction sets the spatial structure of the ordered phase: with again in the ordered polar phase. This equation has a clear physical meaning and expresses the balance between the centrifugal force arising from the advection of momentum along a circular trajectory and the anisotropic pressure induced by the repulsive interactions between rollers. It has an implicit solution given by *φ*(*r*) is therefore parametrized by the dimensionless number reflecting the interplay between self-propulsion and repulsive interactions. Given the experimental values of the microscopic parameters, Λ is much smaller that unity . An asymptotic analysis reveals that is the typical core radius of the vortex. For , the density increases slowly as for all *φ*~0~ and *R*~c~. As *r* reaches , it increases significantly and then grows logarithmically as away from the vortex core. However, is an integration constant, which is solely defined via the mass conservation relation: and therefore only depends on *φ*~0~ and *R*~c~. does not provide any intrinsic structural scale, and the vortex patterns formed in different confinements are predicted to be self-similar in agreement with our experiments and simulations despite the simplification made in the model, [Fig. 3e](#f3){ref-type="fig"}. In addition, [equation 8](#eq36){ref-type="disp-formula"} implies that the rollers self-organize by reducing their density at the centre of the vortex down to , the mean area fraction at the onset of collective motion, again in excellent agreement with our measurements in [Fig. 3e](#f3){ref-type="fig"}. To characterize the orientational structure of the vortices, an additional closure relation is now required. The simplest possible choice consists in neglecting correlations of the orientational fluctuations, and therefore assuming . This choice implies that [Equations 8](#eq36){ref-type="disp-formula"} and [9](#eq49){ref-type="disp-formula"} provide a very nice fit of the experimental polarization curve as shown in [Fig. 3b](#f3){ref-type="fig"}, and therefore capture both the pitchfork bifurcation scenario at the onset of collective motion and the saturation of the polarization at high packing fractions. The best fit is obtained for values of and *β*, respectively, five and two times larger than those deduced from the microscopic parameters. Given the number of simplifications needed to establish both the microscopic and hydrodynamic models, the agreement is very convincing. We are then left with a hydrodynamic theory with no free fitting parameter, which we use to compute the area fraction of the outer polarized ring where . The comparison with the experimental data in [Fig. 3f](#f3){ref-type="fig"} is excellent. Furthermore, [equations 8](#eq36){ref-type="disp-formula"} and [9](#eq49){ref-type="disp-formula"} predict that the rollers are on the verge of a phase separation. If the roller fraction in the vortex core were smaller , orientational order could not be supported and an isotropic bubble would nucleate in a polar liquid. This phase separation is avoided by the self-regulation of *φ*(*r*=0) at . Discussion ========== Altogether our theoretical results confirm that the vortex patterns stem from the interplay between self-propulsion, alignment, repulsion and confinement. Self-propulsion and alignment interactions promote a global azimuthal flow. The repulsive interactions prevent condensation of the population on the geometrical boundary and allow for extended vortex patterns. If the rollers were not confined, the population would evaporate as self-propulsion induces a centrifugal force despite the absence of inertia. We close this discussion by stressing on the generality of this scenario. First, the vortex patterns do not rely on the perfect rotational symmetry of the boundaries. As illustrated in [Supplementary Fig. 2,](#S1){ref-type="supplementary-material"} the same spatial organization is observed for a variety of convex polygonal geometries. However, strongly anisotropic, and/or strongly non-convex confinements can yield other self-organized states such as vortex arrays, which we will characterize elsewhere. Second, neither the nature of the repulsive couplings nor the symmetry of the interactions yielding collective motion are crucial, thereby making the above results relevant to a much broader class of experimental systems. For instance, self-propelled particles endowed with nematic alignment rules are expected to display the same large-scale phenomenology. The existence of a centrifugal force does not rely on the direction of the individual trajectories. Shaken rods, concentrated suspensions of bacteria or motile biofilaments, among other possible realizations, are expected to have a similar phase behaviour. Quantitative local analysis of their spatial patterns[@b10][@b12][@b15][@b16][@b17] would make it possible to further test and elaborate our understanding of the structure of confined active matter. For instance, the polar order found in confined bacteria is destroyed upon increasing the size of the confinement. The analysis of the spacial distribution of the bacteria could be used to gain insight on the symmetries and the magnitude of the additional interactions mediated by the host fluid, which are responsible for the emergence of bacterial turbulence[@b17]. In conclusion, we take advantage of a model experimental system where ensembles of self-propelled colloids with well-established interactions self-organize into macrosopic vortices when confined by circular geometric boundaries. We identify the physical mechanism that chiefly dictates this emergent behaviour. Thanks to a combination of numerical simulations and analytical theory, we demonstrate that orientational couplings alone cannot account for collective circular motion. Repulsion between the motile individuals is necessary to balance the centrifugal flow intrinsic to any ordered active fluid and to stabilize heterogeneous yet monophasic states in a broad class of active fluids. A natural challenge is to extend this description to the compact vortices observed in the wild, for example, in shoals of fish. In the absence of confining boundaries, the centrifugal force has to be balanced by additional density-regulation mechanisms[@b35][@b36]. A structural investigation akin to the one introduced here for roller vortices could be a powerful tool to shed light on density regulation in natural flocks, which remains to be elucidated. Methods ======= Experiments ----------- We use fluorescent PMMA colloids (Thermo scientific G0500, 2.4 μm radius), dispersed in a 0.15 mol l^−1^ AOT/hexadecane solution. The suspension is injected in a wide microfluidic chamber made of double-sided scotch tapes. The tape is sandwiched between two ITO-coated glass slides (Solems, ITOSOL30, 80 nm thick). An additional layer of scotch tape including a hole having the desired confinement geometry is added to the upper ITO-coated slide. The holes are made with a precision plotting cutter (Graphtec robo CE 6,000). The gap between the two ITO electrodes is constant over the entire chamber *H*=220 μm. The electric field is applied by means of a voltage amplifier (Stanford Research Systems, PS350/5000 V-25 W). All the measurements were performed 5 min after the beginning of the rolling motion, when a steady state was reached for all the observables. The colloids are observed with a × 4 microscope objective for particle tracking, particle imaging velocimetry (PIV) and number-density measurements. High-speed movies are recorded with a CMOS camera (Basler ACE) at a frame rate of 190 fps. All images are 2,000 × 2,000 8-bit pictures. The particles are detected to sub-pixel accuracy and the particle trajectories are reconstructed using a MATLAB version of a conventional tracking code[@b37]. The PIV analysis was performed with the mpiv MATLAB code. A block size of 44 μm was used. Numerical simulations --------------------- The simulations are performed by numerically integrating the equations of motion ([equations 1](#eq13){ref-type="disp-formula"} and [2)](#eq15){ref-type="disp-formula"}. Particle positions and rolling directions are initialized randomly inside a circular domain. Integration is done using an Euler scheme with an adaptive time step *δt*, and the diffusive term in the equation for the rotational dynamics is modelled as a Gaussian variable with zero mean and with variance 2*D*/*δt*. Steric exclusion between particles is captured by correcting particle positions after each time step so as to prevent overlaps. Bouncing off of particles at the confining boundary is captured using a phenomenological torque that reorients the particles towards the centre of the disc; the form of the torque was chosen so at the reproduce the bouncing trajectories observed in the experiments. Additional information ====================== **How to cite this article:** Bricard, A. *et al.* Emergent vortices in populations of colloidal rollers. *Nat. Commun.* 6:7470 doi: 10.1038/ncomms8470 (2015). Supplementary Material {#S1} ====================== ###### Supplementary Information Supplementary Figures 1-3, Supplementary Notes 1-2 and Supplementary References ###### Supplementary Movie 1 Epifluorescence movie of a dilute ensemble of colloidal rollers exploring a circular chamber. Rc=1 mm. Packing Fraction: 0.3%. Movie recorded at 100 fps, played at 25 fps. ###### Supplementary Movie 2 Emergence of a macroscopic vortex pattern. Packing fraction: 3.6%. Rc=1 mm. Epifluorescence movie recorded at 100 fps, played at 11 fps. At t=3 s, the electric field is turned on and the rollers start propelling. ###### Supplementary Movie 3 Numerical simulation of a population of rollers showing the formation of an axisymmetric vortex. Packing fraction: 10%, range of repulsive forces: b=5a. ###### Supplementary Movie 4 Numerical simulation of a population of rollers showing the formation of a finitesized swarm. Packing fraction: 4.5%, range of repulsive forces: b=2a. We benefited from valuable discussions with Hugues Chaté, Nicolas Desreumaux, Olivier Dauchot, Cristina Marchetti, Julien Tailleur and John Toner. This work was partly funded by the ANR program MiTra, and Institut Universitaire de France. D.S. acknowledges partial support from the Donors of the American Chemical Society Petroleum Research Fund and from NSF CAREER Grant No. CBET-1151590. K.S. was supported by the JSPS Core-to-Core Program 'Non-equilibrium dynamics of soft matter and information\'. **Author contributions** A.B. and V.C. carried out the experiments and processed the data. D.D., C.S., O.C., F.P. and D.S. carried out the the numerical simulations. J.-B.C., K.S. and D.B. established the analytical model. All the authors discussed and interpreted results. D.B., J.-B.C. and D.S. wrote the manuscript. D.B. conceived the project. A.B. and J.-B.C. have equally contributed to this work. ![Experimental setup.\ (**a**) Sketch of the setup. Five5-micrometre PMMA colloids roll in a microchannel made of two ITO-coated glass slides assembled with double-sided scotch tape. An electrokinetic flow confines the rollers at the centre of the device in a circular chamber of radius *R*~c~. (**b**) Superimposed fluorescence pictures of a dilute ensemble of rollers (*E*~0~/*E*~*Q*~=1.1, *φ*~0~=6 × 10^−3^). The colloids propel only inside a circular disc of radius *R*~c~=1 mm and follow persistent random walks.](ncomms8470-f1){#f1} ![Dynamics of an isolated colloidal roller.\ (**a**) Local packing fraction *φ*(*r*), averaged over the azimuthal angle *φ*, plotted as a function of the radial distance. The dashed line indicates the radius of the circular chamber. (**b**) Probability distribution function of the roller velocities measured from the individual tracking of the trajectories. (**c**) Autocorrelation of the roller velocity 〈**v**~*i*~(*t*)·**v**~*i*~(*t*+*T*)〉 plotted as a function of *v*~0~*T* for packing fractions ranging from *φ*~0~=6 × 10^−3^ to *φ*~0~=10^−2^. Full line: best exponential fit. (**d**) Superimposed trajectories of colloidal rollers bouncing off the edge of the confining circle. Time interval: 5.3 ms (*E*~0~/*E*~*Q*~=1.1, *φ*~0~=6 × 10^−3^). Same parameters for the four panels: *R*~c~=1.4 mm, *E*~0~/*E*~*Q*~=1.1, *φ*~0~=6 × 10^−3^.](ncomms8470-f2){#f2} ![Collective-dynamics experiments.\ (**a**) Snapshot of a vortex of rollers. The dark dots show the position of one half of the ensemble of rollers. The blue vectors represent their instantaneous speed (*R*~c~=1.35 mm, *φ*~0~=5 × 10^−2^). (**b**) Average polarization plotted versus the average packing fraction for different confinement radii. Open symbols: experiments. Full line: best fit from the theory. Filled circles: numerical simulations (*b*=3*a*, *R*~c~=1 mm). (**c**) Time-averaged polarization field (*R*~c~=1.35 mm, *φ*~0~=5 × 10^−2^). (**d**) Time average of the local packing fraction (*R*~c~=1.35 mm, *φ*~0~=5 × 10^−2^). (**e**) Time-averaged packing fraction at the centre of the disc, normalized by and plotted versus the average packing fraction. Error bars: one standard deviation. (**f**) Fraction of the disc where versus the average packing fraction. Open symbols: experiments. Full line: theoretical prediction with no free fitting parameter. Filled circles: numerical simulations (*b*=3*a*, *R*~c~=1 mm). (**g**) Radial density profiles plotted as a function of the distance to the disc centre *r*. All the experiments correspond to *φ*~0~=0.032±0.002, error bars: 1*σ*. (**h**) Open symbols: same data as in **g**. The radial density profiles are rescaled by and plotted versus the rescaled distance to the centre *r*/*R*~c~. All the profiles are seen to collapse on a single master curve. Filled symbols: Numerical simulations. Solid line: theoretical prediction. All the data correspond to *E*~0~/*E*~*Q*~=1.1.](ncomms8470-f3){#f3} ![Collective-dynamics simulations.\ (**a**) The numerical phase diagram of the confined population is composed of three regions: isotropic gas (low *φ*~0~, small *b*), swarm coexisting with a gaseous phase (intermediate *φ*~0~ and *b*) and vortex state (high *φ*~0~ and *b*). *R*~c~=0.5 mm. (**b**) Snapshot of a vortex state. Numerical simulation for *φ*~0~=0.1 and *b*=5*a*. (**c**) Snapshot of a swarm. Numerical simulation for *φ*~0~=4.5 × 10^−2^ and *b*=2*a*. (**d**) Variation of the density correlation length as a function of *R*~c~. Above *R*~c~=1 mm, ξ plateaus and a vortex is reached (*φ*~0~=3 × 10^−2^, *b*=3*a*). (**e**) Four numerical snapshots of rollers interacting via: alignment interactions only (*A*), alignment interactions and repulsive torques (*A*+*B*, where the magnitude of *B* is five times the experimental value), alignment and excluded volume interactions (*A*+*b*, where the repulsion distance is *b*=5*a*), alignment and the *C*-term in [equation 3](#eq16){ref-type="disp-formula"} (*A*+*C*). Polarized vortices emerge solely when repulsive couplings exist (*A*+*B* and *A*+*b*).](ncomms8470-f4){#f4} [^1]: These authors equally contributed to this work
[ 25954, 2402, 262, 36304, 670, 286, 24017, 325, 74, 1635, 316, 435, 15885, 58, 31, 65, 16, 4357, 37898, 11, 33161, 1547, 290, 43149, 423, 39496, 262, 2116, 12, 9971, 1634, 286, 2877, 12, 9971, 1042, 2628, 656, 781, 3320, 355, 281, 3165, 6783, 1429, 34807, 422, 2829, 10375, 3173, 379, 262, 1981, 1241, 58, 31, 65, 17, 7131, 31, 65, 18, 7131, 31, 65, 19, 4083, 770, 2126, 468, 587, 4855, 416, 26610, 22942, 3781, 287, 5044, 2628, 58, 31, 65, 20, 7131, 31, 65, 21, 7131, 31, 65, 22, 4357, 1978, 351, 257, 5909, 1271, 286, 29052, 290, 16200, 4981, 58, 31, 65, 18, 7131, 31, 65, 19, 4357, 290, 517, 2904, 416, 262, 13050, 286, 781, 8629, 9172, 287, 551, 4428, 829, 286, 1729, 12, 19950, 2369, 576, 13166, 884, 355, 27821, 21824, 11, 4075, 2927, 10994, 11, 290, 285, 25506, 286, 13401, 10379, 12604, 290, 18955, 24699, 58, 31, 65, 23, 7131, 31, 65, 24, 7131, 31, 65, 940, 7131, 31, 65, 1157, 7131, 31, 65, 1065, 4083, 3574, 257, 33013, 43054, 82, 6650, 11, 777, 2972, 3341, 389, 3177, 355, 1180, 10245, 286, 13559, 4075, 2300, 11, 543, 38932, 597, 34549, 286, 2369, 576, 5920, 44134, 351, 1957, 15432, 438, 282, 16747, 12213, 13, 383, 1459, 23457, 329, 781, 8629, 11887, 318, 262, 1708, 13, 14199, 13166, 389, 16218, 4738, 2513, 364, 11, 543, 618, 11844, 1133, 1296, 257, 3488, 32269, 31624, 1773, 291, 3623, 13, 14438, 3649, 12109, 11, 10098, 6268, 25457, 287, 262, 1296, 286, 15246, 1927, 36618, 1509, 8357, 326, 743, 20382, 287, 257, 5417, 286, 15456, 3867, 13166, 26, 2252, 3649, 12109, 11, 257, 3488, 32269, 13559, 8122, 5107, 290, 37512, 15623, 1863, 257, 880, 12, 23211, 4571, 58, 31, 65, 16, 7131, 31, 65, 1485, 7131, 31, 65, 1415, 4083, 770, 4286, 318, 262, 8055, 286, 10256, 11, 27785, 290, 10946, 4632, 6157, 287, 22619, 6302, 393, 27458, 18209, 13, 198, 198, 24102, 428, 4286, 11, 2383, 3241, 468, 587, 13378, 625, 262, 938, 1936, 812, 284, 19733, 4075, 2300, 58, 31, 65, 18, 7131, 31, 65, 1065, 7131, 31, 65, 1314, 7131, 31, 65, 1433, 7131, 31, 65, 1558, 7131, 31, 65, 1507, 7131, 31, 65, 1129, 7131, 31, 65, 1238, 7131, 31, 65, 2481, 7131, 31, 65, 1828, 7131, 31, 65, 1954, 7131, 31, 65, 1731, 7131, 31, 65, 1495, 7131, 31, 65, 2075, 4083, 7326, 1389, 4075, 13166, 423, 9835, 11, 1865, 407, 25735, 11, 587, 2098, 284, 2116, 12, 9971, 1096, 656, 42726, 12, 2339, 8573, 13, 2102, 11, 5023, 329, 674, 4547, 286, 781, 8629, 11, 356, 389, 991, 14394, 257, 22706, 4286, 284, 1848, 329, 262, 22106, 290, 4645, 286, 884, 42726, 7572, 13, 770, 3074, 318, 4632, 2233, 284, 262, 3257, 9573, 287, 262, 3450, 290, 23606, 316, 1678, 286, 262, 12213, 1022, 262, 4075, 13166, 326, 423, 587, 45053, 3177, 13, 2141, 4075, 410, 419, 1063, 2152, 691, 287, 27454, 12, 7857, 3341, 355, 287, 262, 1339, 286, 23462, 47228, 58, 31, 65, 1558, 4357, 543, 4425, 428, 4950, 1502, 290, 3359, 38361, 42291, 17262, 58, 31, 65, 1983, 60, 618, 555, 10414, 1389, 30, 1867, 389, 262, 3306, 12213, 2672, 284, 12414, 290, 14, 273, 11949, 41602, 43340, 31607, 40431, 2585, 286, 4075, 2300, 30, 198, 198, 818, 428, 3348, 11, 356, 3280, 777, 2683, 416, 6402, 262, 2928, 286, 4903, 908, 8143, 13215, 319, 262, 10098, 9172, 286, 2369, 576, 13166, 44134, 351, 15432, 438, 282, 16747, 12213, 13, 14336, 3191, 26610, 10256, 319, 2369, 576, 2927, 10994, 11, 29052, 27785, 290, 30063, 4583, 11, 356, 49031, 20540, 262, 7108, 9172, 286, 1635, 79, 6192, 9, 4075, 2300, 31531, 416, 4903, 908, 8143, 13215, 13, 775, 779, 2927, 47502, 4836, 364, 11, 543, 11, 5023, 749, 286, 262, 1695, 10685, 2116, 12, 1676, 15803, 5920, 11, 9427, 2884, 880, 12, 27718, 6382, 605, 12213, 58, 31, 65, 1157, 4083, 775, 717, 14561, 428, 3748, 2746, 1080, 284, 905, 326, 2029, 257, 4688, 10368, 9684, 286, 2369, 576, 2927, 10994, 17777, 257, 1729, 12, 4853, 24741, 7108, 6801, 422, 281, 31624, 1773, 291, 308, 589, 516, 1181, 284, 257, 5337, 6149, 1181, 810, 262, 2104, 3265, 2116, 12, 9971, 4340, 656, 257, 2060, 14445, 32269, 18434, 24012, 42726, 13, 770, 2116, 12, 9971, 1634, 318, 1635, 1662, 9, 262, 12921, 286, 262, 27454, 1080, 2546, 13, 11317, 11, 428, 3165, 6783, 42726, 318, 257, 8768, 1181, 286, 13559, 4075, 2300, 9105, 319, 262, 27373, 286, 257, 15021, 1416, 16603, 7108, 14139, 13, 770, 5337, 1181, 318, 262, 691, 6149, 7108, 1043, 618, 555, 312, 4154, 282, 7924, 6268, 318, 49186, 416, 24748, 87, 31624, 1773, 291, 13215, 13, 775, 788, 10176, 26787, 326, 257, 5449, 1022, 19114, 11, 1128, 22220, 12213, 290, 28739, 318, 3306, 284, 7800, 1588, 12, 9888, 410, 419, 605, 6268, 287, 551, 4428, 829, 286, 2369, 576, 13166, 24986, 2884, 19114, 12213, 11, 12839, 16610, 262, 23082, 286, 674, 6373, 284, 257, 3154, 1398, 286, 4075, 5696, 13, 198, 198, 25468, 198, 1421, 18604, 198, 198, 20468, 6800, 198, 32284, 198, 198, 464, 11992, 9058, 318, 3938, 3417, 287, 262, 1635, 46202, 9, 2665, 290, 287, 685, 14989, 13, 352, 64, 11, 65, 16151, 2, 69, 16, 19953, 5420, 12, 4906, 2625, 5647, 20662, 13, 22821, 306, 11, 356, 779, 2927, 47502, 4836, 364, 13232, 416, 262, 2264, 1939, 365, 1742, 1472, 14221, 9030, 355, 13770, 4893, 287, 1006, 13, 685, 31, 65, 1157, 4083, 1052, 5186, 2214, 12429, 36, 1174, 93, 1174, 15, 1174, 93, 318, 5625, 284, 1035, 8306, 2927, 47502, 36116, 37970, 287, 257, 14523, 11711, 13, 23302, 257, 4688, 2214, 37188, 1635, 36, 9, 93, 48, 93, 11, 262, 40686, 286, 262, 5186, 3877, 6082, 379, 262, 49773, 4417, 318, 37512, 5445, 13, 1081, 257, 1255, 11, 257, 2010, 5186, 26415, 6529, 319, 262, 36116, 6666, 606, 284, 23064, 379, 257, 6937, 2494, 1088, 257, 4738, 16488, 1007, 4399, 284, 262, 5186, 2214, 58, 31, 65, 2078, 7131, 31, 65, 1959, 7131, 31, 65, 1270, 4083, 1649, 262, 2927, 10994, 33408, 11, 393, 389, 1742, 10051, 9997, 1146, 7986, 11, 4291, 530, 286, 262, 734, 39780, 11 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
TODO: Implement depth-major-sources packing paths for NEON Platforms: ARM NEON Coding time: M Experimentation time: M Skill required: M Prerequisite reading: doc/kernels.txt doc/packing.txt Model to follow/adapt: internal/pack_neon.h At the moment we have NEON optimized packing paths for WidthMajor sources. We also need paths for DepthMajor sources. This is harder because for DepthMajor sources, the size of each slice that we have to load is the kernel's width, which is typically 12 (for the LHS) or 4 (for the RHS). That's not very friendly to NEON vector-load instructions which would allow us to load 8 or 16 entries, but not 4 or 12. So you will have to load 4 entries at a time only. For that, the vld1q_lane_u32 seems to be as good as you'll get. The other possible approach would be to load (with plain scalar C++) four uint32's into a temporary local buffer, and use vld1q_u8 on that. Some experimentation will be useful here. For that, you can generate assembly with -save-temps and make assembly easier to inspect by inserting inline assembly comments such as asm volatile("#hello");
[ 51, 3727, 46, 25, 48282, 6795, 12, 22478, 12, 82, 2203, 24157, 13532, 329, 10635, 1340, 198, 198, 37148, 82, 25, 20359, 10635, 1340, 198, 198, 34, 7656, 640, 25, 337, 198, 20468, 3681, 341, 640, 25, 337, 198, 35040, 2672, 25, 337, 198, 198, 6719, 27614, 3555, 25, 198, 220, 2205, 14, 74, 44930, 13, 14116, 198, 220, 2205, 14, 41291, 13, 14116, 198, 198, 17633, 284, 1061, 14, 42552, 25, 198, 220, 5387, 14, 8002, 62, 710, 261, 13, 71, 198, 198, 2953, 262, 2589, 356, 423, 10635, 1340, 23392, 24157, 13532, 329, 38807, 24206, 4237, 13, 198, 1135, 635, 761, 13532, 329, 36350, 24206, 4237, 13, 198, 198, 1212, 318, 7069, 780, 329, 36350, 24206, 4237, 11, 262, 2546, 286, 1123, 16416, 326, 198, 732, 423, 284, 3440, 318, 262, 9720, 338, 9647, 11, 543, 318, 6032, 1105, 357, 1640, 262, 406, 7998, 8, 198, 273, 604, 357, 1640, 262, 371, 7998, 737, 1320, 338, 407, 845, 8030, 284, 10635, 1340, 15879, 12, 2220, 7729, 198, 4758, 561, 1249, 514, 284, 3440, 807, 393, 1467, 12784, 11, 475, 407, 604, 393, 1105, 13, 198, 198, 2396, 345, 481, 423, 284, 3440, 604, 12784, 379, 257, 640, 691, 13, 1114, 326, 11, 262, 198, 85, 335, 16, 80, 62, 33533, 62, 84, 2624, 2331, 284, 307, 355, 922, 355, 345, 1183, 651, 13, 383, 584, 1744, 198, 21064, 620, 561, 307, 284, 3440, 357, 4480, 8631, 16578, 283, 327, 29577, 1440, 20398, 2624, 338, 656, 257, 198, 11498, 5551, 1957, 11876, 11, 290, 779, 410, 335, 16, 80, 62, 84, 23, 319, 326, 13, 2773, 29315, 198, 10594, 307, 4465, 994, 13, 1114, 326, 11, 345, 460, 7716, 10474, 351, 532, 21928, 12, 11498, 862, 198, 392, 787, 10474, 4577, 284, 10104, 416, 19319, 26098, 10474, 3651, 198, 10508, 355, 198, 220, 355, 76, 22750, 7203, 2, 31373, 15341, 198 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
package de.peeeq.wurstscript.utils; import de.peeeq.wurstscript.WLogger; public class ExecutiontimeMeasure implements AutoCloseable { private String message; private long startTime; public ExecutiontimeMeasure(String message) { this.message = message; this.startTime = System.currentTimeMillis(); } @Override public void close() { long time = System.currentTimeMillis() - startTime; WLogger.info("Executed " + message + " in " + time + "ms."); } }
[ 26495, 390, 13, 431, 1453, 80, 13, 86, 24962, 12048, 13, 26791, 26, 198, 198, 11748, 390, 13, 431, 1453, 80, 13, 86, 24962, 12048, 13, 54, 11187, 1362, 26, 198, 198, 11377, 1398, 37497, 2435, 47384, 23986, 11160, 26125, 540, 1391, 628, 220, 220, 220, 2839, 10903, 3275, 26, 198, 220, 220, 220, 2839, 890, 923, 7575, 26, 628, 220, 220, 220, 1171, 37497, 2435, 47384, 7, 10100, 3275, 8, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 428, 13, 20500, 796, 3275, 26, 198, 220, 220, 220, 220, 220, 220, 220, 428, 13, 9688, 7575, 796, 4482, 13, 14421, 7575, 22603, 271, 9783, 198, 220, 220, 220, 1782, 628, 220, 220, 220, 2488, 37961, 198, 220, 220, 220, 1171, 7951, 1969, 3419, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 890, 640, 796, 4482, 13, 14421, 7575, 22603, 271, 3419, 532, 923, 7575, 26, 198, 220, 220, 220, 220, 220, 220, 220, 370, 11187, 1362, 13, 10951, 7203, 23002, 7241, 366, 1343, 3275, 1343, 366, 287, 366, 1343, 640, 1343, 366, 907, 526, 1776, 198, 220, 220, 220, 1782, 198, 198, 92, 198 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Pages Monday, February 27, 2017 With just a fortnight left till CNY, the OUG morning market was in a frenzy. You know things are getting serious when RELA is deployed to control traffic. Roads once accessible to traffic were closed and the extra space occupied by vendors selling fireworks, waxed meat, biscuits, sea cucumber, dried mushrooms (a lot of 'em!), etc. While I was walking past Restoran New Sun Ho, saw another example of the globalized Malaysian breakfast-- roti canai with salmon sashimi. One day I might start seeing roti sashimi on the menu. Lunch was a simple meal of chicken porridge with a can of fried dace. Very traditional fare. CNY was around the corner, so we spruced up the house a bit. Bought a can of white paint and repainted the metal grills at the living room. Was a little woozy after inhaling the paint fumes. Felt better after we had dinner at Dao Dao. A plate of tofu with mixed vegetables and Marmite chicken really hit the spot. Wednesday, February 22, 2017 Lego was very much a part of my childhood. Back then, I saved my pocket money, angpao money, and Cantonese Association award money to buy Lego. Back then, the cheapest set cost MYR5+. I think the most expensive model I bought was around MYR80+. Just the normal Lego, for age 5-12. Back then, the only other ranges were Duplo and Technic. So many varieties have popped up after the Lego resurgence. Today we have: Star Wars Creator Minifigures City Friends Nexo Knights Ninjago DC Comics Superheroes The Batman Movie Marvel Superheroes Elves Disney Juniors Architecture Mindstorms Scooby Doo Minecraft Speed Angry Birds Ideas Superhero Girls Pening kan? However, all those varieties don't interest me. Technic seems way cooler to me with all those gears, shafts, and moving parts. A sort of kiddy mechanical engineering. More worth it to pay for design and complex parts, rather than paying for copyright costs. Back then, they had pneumatic models, these days, electric motors. Goes without saying that I didn't buy any Technic models back then due to the cost factor. Twenty four years later, I got to assemble my first Technic model-- a Christmas gift from KH. Muacks. He bought me a Lego Technic Drag Racer (42050) which is kind of cool because it has a huge motor block with moving pistons, front wheel steering, big wheely bar, car body that can be raised, and a hidden jack that can be used to pose the drag racer in wheely position. Tuesday, February 21, 2017 Closer and closer to CNY, the market was getting redder and redder. The pace was catching up. Definitely more people than usual judging from the crowds and the lack of parking. Mum stopped at a fishmonger's truck and I was shocked by a large grouper that was on the weighing scale. It was not the size of it that caught my eye, but the fact that it looked like it was dripping in cum! Guess bukkake is not uncommon among fish. Haha. On a serious note, the slime is a layer of mucus that helps fish with gas transport, provide protection, and reduce turbulence in the water. Ventured to Taman Bukit Desa for Sarawak Laksa at Charlie's Cafe because we were bored of the food options at OUG. Taman Bukit Desa was very peaceful compared to the chaos at the market. Always quiet at that neck of the woods. On the way home, we turned into Pearl Shopping Gallery, an interesting new addition to Pearl Point. Located across the road from Jalan Sepadu, it's connected to the old wing via a bridge. Yes, it's always about bridges with shopping malls these days. Inside, there's a small Village Grocer and multiple food establishments (for some reason they have three Korean restaurants). Notable outlets are Paradise Dynasty, Kyochon, Go Noodle House, Kin Kin Pan Mee, and Powerplant. There's also Cremeo that serves premium soft serve ice cream. Will give an update as I try the food outlets there! Friday, February 17, 2017 After a whole month of babysitting, mum and I finally had the chance to go to the market. The first visit of 2017. With all the year end holidays out of the way, it finally dawned on people that the Lunar Chinese New Year was less than a month away! Start the panic buying! The earliest merchants to start the ball rolling were the those who sold religious paraphernalia. They had already started stocking all sorts of special paper offerings, fancy joss sticks, and even the stuff needed to Pai Ti Kong were already on sale. Breakfast was our favourite curry noodles in the alley. In the afternoon, KH came over to my place to chill (kind of like a chaperoned type of paktor). We would just laze on the sofa and chat. Sometimes, we would play our current addiction-- LINE Rangers. So cute, so pointless, and yet... Haha. Received a call from SK and we were out to The Coffee Sessions. More updates from SK regarding her family issues over a cup of mocha and a side of fries. People never fail to surprise. When you thought that they've hit rock bottom, there seems to be more to go! SK stayed on for dinner while KH returned home. Just a simple meal at nearby Restoran 83. A very satisfying dinner of pork noodles, grilled stingray, fried rice, and chicken soup. Remember when it was such a craze to have Portugese style grilled stingray at the Midvalley Megamall Food Court? Ages ago... Wednesday, February 15, 2017 For mum and I, church is the best place to usher in the new year. Bilingual mass started at 10:30 PM and ended fifteen minutes shy of midnight, giving parishioners enough time to find a good location to watch the fireworks display outside (some places actually started the fireworks five minutes before midnight). And a snack box was provided too. By the time we got home, it was past 1:00 AM and we had mass to attend on the 1st of January too! Not that it was mandatory, just that I had traffic warden duties to perform. A thankless job that nobody wants to do. You have to come to church before the crowd, and leave only after everyone does. And its not pleasant when the weather is hot. And drivers are a cranky bunch. Basically, traffic wardens are disconnected from what happens in the church. Been a while since we ate at Nihon-Kai, so we gave it a try for lunch on New Year's day. Got there at 1:30 PM and it was still crowded. Had to sit at the bar counter. Interesting to experience the Japanese way of celebrating the new year. Right at the cashier counter, they had a plastic kagami mochi, which translates to mirror rice cake. Basically a snowman made of rice cake with a bitter orange on top. Not too sure about the traditional symbolism though. Since they had a special set for the day, we ordered it. Perfect for sharing with a little bit of everything-- tempura moriawase, grilled Saba, tamago, maki, inari, arrowroot chips (a Chinese touch), and ozoni which is a special mochi soup that is prepared during the new year. Also added on some nigiri sushi to complete the meal. In the afternoon, I played Mr. Plumber. Tried to fix mum's leaky toilet. That attempt really taught me a thing or two about the 'anatomy' of a toilet. LOL. Managed to fix the leak, but I had to run out to the hardware store to get the right spare parts. Unfortunately, I discovered a more sinister problem with the plumbing. Something was definitely screwing up the pressure in my mum's bathroom. Probably some pesky leak. That's a job best left to the professionals. At night, we had a BEC gathering at KM1 West. Everyone had a fun time trying to get to the multi-purpose hall due to the security measures. Visitors with no access cards could not access the lift lobbies and it was raining heavily outside. The problem with all these 6-tier security condominiums. A hell when you have a lot of guests coming over. At the venue, we were experiencing blackouts because the power was overloaded. Goodness. When we got all of that ironed out, we started the festivities. Stress levels were a little high because both parish priests came for the party. Luckily for us, they didn't stay long. Plenty of food and games. The hostess looked very happy because her husband joined in for the first time ever. Perhaps he wanted to cheer his wife up, who was diagnosed with breast cancer earlier this year. A simple gesture but brings deep joy. Monday, February 13, 2017 On the last day of the Christmas long weekend, I finally managed to spend some time with KH. Normally, Gratitude would cook Christmas dinner, but fears of water disruption, and a lack of a maid to do the clean up made him change his mind. Instead, he invited us for a dim sum brunch at Mayflower Restaurant, Le Garden Hotel (not to be confused with KK Mayflower nearby). It was a nice reunion with KH, Gratitude's mum, my mum, Apollo and QueerRanter-D. The dim sum was pretty good, with a larger portion. They had all the standard varieties, but KH was disappointed that they didn't have custard buns. I liked their siew mai and egg tarts. For coffee, we moved to Brew and Bread. Now, they operate upstairs with the kitchen located in a nearby lot. Compared to last time, this arrangement gives them a whole lot more space to play with. With windows along the whole length of the back, the whole place is spilling with natural light. However, their furniture arrangement is a bit unconventional. A big round tables are quite out of place in a cafe. Why would people want to sit around it especially when there's a huge centerpiece in the middle. Then there's the super long table at the back. Reminded me of the school canteen. In terms of coffee, they now have two blends to choose from-- Driver and Sugar Daddy. Can't imagine why they chose those names. If you're into cold brew, they have something called a Bombshell that actually tastes like its spiked with alcohol. Their croissant is pretty good too, buttery and flaky. Before leaving Kota Kemuning, we stopped a while at AEON Big but that turned out to be a big disappointment. Not well-stocked at all. Walked into a Nagoya as well, a place which brought back memories of my childhood. When I was a kid, mum regularly brought me to fabric shops. As a seamstress, she sometimes had to source for fabrics. While she was choosing, I would be exploring the 'forest' of cloth rolls, running my hands over the cold, silky material. Sometimes, I would scrutinize the price tags attached to the cloth rolls with safety pins. They were usually stamped in blue ink with a small sample of the cloth taped to the tag. Later in the evening, KH and I had a dinner date with QueerRanter (the real deal!), Jin, Apollo, and QueerRanter-D. KH had no luck choosing the dinner venue in Publika. Plan A - Episode. Not open. Plan B - Silver Spoon. Not open. Plan C - Two Sons Bistro. A random choice based on what was open. Halal. Two Sons is a place famous for its mussels and clams. Sixteen varieties to choose from. We ordered a full size (900 grams) of lemon garlic butter mussels to share. Delicious with two portions of garlic bread to lap up the gravy. KH and I shared a Supreme Stuffed Chicken. Stuffed with what you may ask? Jalapeno peppers, sun-dried tomatoes, and cream cheese. Spicy and creamy at the same time. Not a very good feeling. Dessert and coffee was really at Plan B. We reminisced about the days of drama in the heyday of the BFF. So much nonsense from nonsense people. "My birthday party is better than your's" nonsense. "I'm manipulating your feelings" nonsense. "It's all about me" nonsense. "I'm a hypocrite who talks shit" nonsense. The list goes on. But without them, it would have been a bland existence with nothing to reminisce about. Haha. Friday, February 10, 2017 I did not wake up bright and early on Christmas morning. Just as I hit the send button on What's App asking my sister whether the kids had woken up, I heard a commotion downstairs. No mistaking it-- it was The Tribe. My sister had moved all the presents to my place. And it was a lot of presents. Combined with presents from SK and I, it was truly a formidable heap! The excitement and anticipation from the kids was palpable. However, they had to wait a little while longer. All of us donned our customized Christmas T-shirts and took a group photo first. Before we began, I brought out a laundry basket to contain all the discarded gift wrapping. The kids went through their presents like locusts. They got toys, shoes, clothes, bags, and water tumblers. Guess they were on Santa's Good list else they would have received white envelopes filled with cash from Sump'n Claus. Never actually played with Lego Technic before, so it was nice of KH to get me a set. Once we cleared all the debris, it was time to go out for breakfast. BIL wanted to go to a cafe that was Christmas-y. Unfortunately, most of the cafes in Sri Petaling only opened at 11:00 AM. In the end, our stomachs decided that we eat at Poppo Kanteen, a cafe famed for its nasi lemak. If you're not into that, they have noodles and bread too. Plenty of variety and value for money. A suprising MYR8.90 for a big plate with a whole fried chicken leg. Their sambal is pretty good, but the rice didn't quite make the cut. Right on their doorstep is another nasi lemak stall. That stall has been around for years and the rice is really good. Very savoury and creamy. Much better than Poppo Kanteen, but their sambal falls short. What we did was combine the best of both worlds. Haha. The staff didn't mind. Another thing I liked about Poppo Kanteen was the cham. Great taste and hot! Don't ever give me that lukewarm shit. A drink that makes you go "Ahhhhhh...." after every sip. Big Monster had a very good appetite. He walloped a plate of nasi lemak, roti Planta, and potato wedges! In the afternoon, we made a visit to Sunway Velocity Mall, one of KL's newest retail spots. Boy, what a mistake that was. The roads were choked and the mall was overflowing with people. Been a long time since I saw such good business at a mall. The escalators were packed and groups of people were seen just standing around. Crazy. Every ten minutes, there would be a public paging for lost kids and disoriented adults. But this took the cake: "Dear shoppers, please be advised that there is a traffic jam on Jalan Cheras and Jalan Peel. We advise you to continue shopping. Thank you." The Tribe watched "Moana" there at 4:00 PM, but mum and I had some time to kill before our movie. We did some shopping and had a late lunch / early dinner at Canton Kitchen. Not recommended at all. Lethargic service and lousy portions. They charge prices similar to Foong Lye for their set meals but what you get is a far cry. Lukewarm food with just a whole lot of Chinese cabbage in different forms. The only thing I liked was the Pumpkin Springroll. With an hour to go before our movie at Leisure Mall, I fired up the Uber app. Got a ride on a brand new HRV. The driver remarked that traffic was fine before the opening of the mall. Oh well. The ride to Leisure Mall took less than fifteen minutes. Believe it or not, it was my first time at this iconic Cheras mall. Looks pretty good for a neighbourhood mall. Pretty impressive Christmas decorations. Gave me some Singapore heartland mall vibes. We watched "Show Me Your Love", a local production with a cast fortified by Hong Kong actors. I expected more tears from the movie, but it fell a bit short. Overall a nice movie with funny and touching moments. The cinema hall was also surprisingly comfortable. Perhaps they had changed the seats in recent years. Got out of the cinema just in time for The Tribe to pick us up. Truly a fun Christmas spent with loved ones. Thursday, February 09, 2017 Unexpectedly, my sister turned up at our doorstep on the morning of Christmas eve. Naturally, the kids were thrilled to see her. We had a day out in Bukit Bintang ahead of us. First stop was Pavilion Kuala Lumpur to look at the Christmas decorations. Like past years, there was a huge tree out front. The only difference was that they had a train that traveled around the tree. In my opinion, its quite a nuisance to have that when so many people mill at the entrance. Swarovski returned as the main sponsors for the center atrium's Christmas decorations, but I wasn't very impressed by it. This time round, the center atrium is dominated by a castle and a crystal carousel. In the overall theme, it's not very attention-grabbing. Mum shopped while I kept the kids in check. The typical running around, and crawling in and out of clothes racks. Difficult to shop in peace with kids around. All that running around helped the kids build up an appetite. By noon, they were asking for food. At first, we thought of eating at D'Empire, but after looking at how limited the menu was, we walked out. Instead, we ate at Pigs and Wolf located on the Dining Loft. Much better options there. The Christmas set looked like a steal, so we ordered that. MYR60 bought us a soup, main, dessert, and ice lemon tea. They served a cream of potato soup that came with a side of bacon. Both kids gave a squeal of joy when they saw the bacon. For the main, we chose the Prawn and Salmon Pesto that came with generous portion of smoked salmon, and juicy prawns. Dessert was a slice of moist chocolate roll. In addition to that, we got a plate of Carbonara with pork sausages for Little Monster. Big Monster practically polished off a Mighty Piggy Burger all by himself. He loved the thick, juicy patty made from US pork. Since he ordered a burger, his uncle could get a pint of Asahi for MYR10. Their neighbours, Starz Kitchen and Rocku Yakiniku both had Santa Claus out front to attract customers and spread some Christmas cheer. But not all Santa Claus are created equal. Starz Kitchen obviously had the bigger budget. They actually got a fat gweilo to play the part. The wig, beard, and costume was also much better. The guy from Rocku Yakiniku was Cina-fied version in an ill-fitting SuperSave costume. Last stop for the day was Isetan the Japan Store. Had to be very careful in there. Porcelain art with a price tag of MYR14,000 located at child level? OK, shoooh, we are going to the other floors. Didn't stay long really. The kids were tired and Big Monster even started sneezing from all the air-conditioning. Mum and I attended Christmas Eve mass at church that night. There was the usual caroling before mass. During the procession, Baby Jesus was held aloft by the priest and subsequently placed into the manger, and incensed. Everyone was all dressed up and parishioners exchanged greetings to mark the happy occasion of Jesus' birth. Monday, February 06, 2017 In order to make it to English mass at SIC, we had to get up at 7:00 AM. After getting ready, one still needs to fuss over the sleepy kids. At church, we bundled them into the soundproof family room and hoped that they would not be too rowdy. Big Monster asked me a legit question:Big Monster: Is Jesus dead?Moi: Yes, but he resurrected after three days.Big Monster: Oh, someone threw him a Potion of Regeneration. In case you were wondering, he was talking about something from Minecraft! Obsessed with that game, they are. We ate breakfast at Mian then headed home. Mum needed to prepare for her event in the afternoon. She boiled the tang yuan and packed loads of pots and ladles. There was even a portable stove in the heap of stuff. Sent her out to Happy Garden where she would carpool to Brickfields with her friends. It's daunting to handle the two monsters alone so I employed the help of KH. Picked him up and went for a late lunch at Secret Loc Cafe, Kuchai Lama. Although it was already 3:00 PM, all of use weren't starving. Chose kid-friendly items from the menu-- American breakfast, French toast, and pizza. The little one was shouting his head off in the cafe. Buat macam rumah sendiri. When the little ones saw me feeding KH, they exclaimed: "Uncle KH is not a kid!" Went home soon after. Switched on the Google Chromecast for the kids then we stole off to my room for some snogging. In the heat of the moment, there would suddenly be a knock on the door: "Kau fu! I wanna watch a different YouTube clip!" Talk about coitus interruptus. In the end we just gave up and went downstairs to watch "Assassination Classroom: The Graduation" with the kids. The weird story line and even weirder main character, Korosensei resonated with my nephews. SK joined us for dinner at Restoran Mirasa, a mamak joint near my place. Big Monster finished a Maggi goreng all by himself while the little one only concentrated on the cup of Milo. The idea of waffles was tantalizing to the kids, so we had dessert at The New Chapter. Loitered there as long as we could, but the night was still young, and mum's event was far from over. Decided to send KH home first. On our way back home, received a call from mum. Aha! Duty would be over soon. :P. who i am ? I've been told that I look like Suneo Honekawa (how I wish it was Takuya Kimura). I'm fickle (so typical of Librans and other member's of the Alternate society). I laugh and grin a lot (must be some Cheshire Cat genes in there some where too). I have a loving family. Plenty of friends (SK's the best!). And a single person who completes me-- my dear KH. Life has been all ups and downs. But I'm a Thurday's child, so I guess there 's still far to go. Drop me a mail at tanduk7 [at] hotmail.com.
[ 47798, 198, 198, 23810, 11, 3945, 2681, 11, 2177, 198, 198, 3152, 655, 257, 46327, 1364, 10597, 327, 12805, 11, 262, 440, 7340, 3329, 1910, 373, 287, 257, 31934, 13, 921, 760, 1243, 389, 1972, 2726, 618, 29749, 32, 318, 12380, 284, 1630, 4979, 13, 40065, 1752, 9857, 284, 4979, 547, 4838, 290, 262, 3131, 2272, 12030, 416, 17192, 6301, 26056, 11, 20302, 276, 6174, 11, 50128, 11, 5417, 38421, 4494, 11, 16577, 23452, 357, 64, 1256, 286, 705, 368, 26290, 3503, 13, 198, 198, 3633, 314, 373, 6155, 1613, 8324, 31884, 968, 3825, 9544, 11, 2497, 1194, 1672, 286, 262, 3298, 1143, 30031, 12607, 438, 5724, 72, 460, 1872, 351, 24535, 264, 1077, 25236, 13, 1881, 1110, 314, 1244, 923, 4379, 5724, 72, 264, 1077, 25236, 319, 262, 6859, 13, 198, 198, 43, 3316, 373, 257, 2829, 9799, 286, 9015, 16964, 12818, 351, 257, 460, 286, 23018, 288, 558, 13, 9576, 4569, 14505, 13, 198, 198, 34, 12805, 373, 1088, 262, 5228, 11, 523, 356, 599, 622, 771, 510, 262, 2156, 257, 1643, 13, 29888, 257, 460, 286, 2330, 7521, 290, 1128, 14215, 262, 6147, 1036, 2171, 379, 262, 2877, 2119, 13, 8920, 257, 1310, 36440, 7357, 706, 25783, 4272, 262, 7521, 47301, 13, 376, 2120, 1365, 706, 356, 550, 8073, 379, 360, 5488, 360, 5488, 13, 317, 7480, 286, 40108, 351, 7668, 13701, 290, 1526, 32937, 9015, 1107, 2277, 262, 4136, 13, 198, 198, 27150, 11, 3945, 2534, 11, 2177, 198, 198, 11484, 78, 373, 845, 881, 257, 636, 286, 616, 9963, 13, 5157, 788, 11, 314, 7448, 616, 10000, 1637, 11, 3550, 79, 5488, 1637, 11, 290, 16821, 1952, 68, 5396, 5764, 1637, 284, 2822, 33198, 13, 5157, 788, 11, 262, 28918, 900, 1575, 17615, 49, 20, 27613, 314, 892, 262, 749, 5789, 2746, 314, 5839, 373, 1088, 17615, 49, 1795, 27613, 2329, 262, 3487, 33198, 11, 329, 2479, 642, 12, 1065, 13, 5157, 788, 11, 262, 691, 584, 16069, 547, 49821, 78, 290, 5429, 291, 13, 1406, 867, 20328, 423, 22928, 510, 706, 262, 33198, 39330, 13, 6288, 356, 423, 25, 198, 198, 8248, 6176, 198, 198, 16719, 273, 198, 198, 9452, 361, 328, 942, 198, 198, 14941, 198, 198, 36705, 198, 198, 45, 1069, 78, 15188, 198, 198, 36091, 73, 3839, 198, 198, 9697, 15650, 3115, 11718, 274, 198, 198, 464, 9827, 15875, 198, 198, 38864, 3115, 11718, 274, 198, 198, 9527, 1158, 198, 198, 37338, 198, 198, 22396, 12706, 198, 198, 19895, 5712, 495, 198, 198, 28478, 38563, 198, 198, 50, 1073, 26730, 2141, 78, 198, 198, 39194, 198, 198, 22785, 198, 198, 13450, 563, 27124, 198, 198, 41452, 292, 198, 198, 12442, 11718, 12002, 198, 198, 47, 3101, 43998, 30, 2102, 11, 477, 883, 20328, 836, 470, 1393, 502, 13, 5429, 291, 2331, 835, 19346, 284, 502, 351, 477, 883, 28713, 11, 18619, 82, 11, 290, 3867, 3354, 13, 317, 3297, 286, 479, 34208, 12370, 8705, 13, 3125, 2861, 340, 284, 1414, 329, 1486, 290, 3716, 3354, 11, 2138, 621, 5989, 329, 6634, 3484, 13, 5157, 788, 11, 484, 550, 279, 710, 16735, 4981, 11, 777, 1528, 11, 5186, 24699, 13, 31914, 1231, 2282, 326, 314, 1422, 470, 2822, 597, 5429, 291, 4981, 736, 788, 2233, 284, 262, 1575, 5766, 13, 22381, 1440, 812, 1568, 11, 314, 1392, 284, 25432, 616, 717, 5429, 291, 2746, 438, 257, 6786, 6979, 422, 40249, 13, 8252, 4595, 13, 679, 5839, 502, 257, 33198, 5429, 291, 12697, 39359, 357, 27211, 1120, 8, 543, 318, 1611, 286, 3608, 780, 340, 468, 257, 3236, 5584, 2512, 351, 3867, 11714, 684, 11, 2166, 7825, 19702, 11, 1263, 483, 68, 306, 2318, 11, 1097, 1767, 326, 460, 307, 4376, 11, 290, 257, 7104, 14509, 326, 460, 307, 973, 284, 12705, 262, 6715, 48233, 287, 483, 68, 306, 2292, 13, 198, 198, 26133, 11, 3945, 2310, 11, 2177, 198, 198, 2601, 13416, 290, 5699, 284, 327, 12805, 11, 262, 1910, 373, 1972, 2266, 1082, 290, 2266, 1082, 13, 383, 8761, 373, 16508, 510, 13, 33562, 517, 661, 621, 6678, 22989, 422, 262, 15779, 290, 262, 3092, 286, 7647, 13, 38367, 5025, 379, 257, 5916, 31059, 263, 338, 7779, 290, 314, 373, 11472, 416, 257, 1588, 1132, 525, 326, 373, 319, 262, 21990, 5046, 13, 632, 373, 407, 262, 2546, 286, 340, 326, 4978, 616, 4151, 11, 475, 262, 1109, 326, 340, 3114, 588, 340, 373, 37472, 287, 10973, 0, 37571, 809, 28747, 539, 318, 407, 19185, 1871, 5916, 13, 367, 12236, 13, 1550, 257, 2726, 3465, 11, 262, 34570, 318, 257, 7679, 286, 30322, 385, 326, 5419, 5916, 351, 3623, 4839, 11, 2148, 4800, 11, 290, 4646, 47741, 287, 262, 1660, 13, 198, 198, 53, 298, 1522, 284, 309, 10546, 36810, 270, 2935, 64, 329, 6866, 707, 461, 406, 4730, 64, 379, 11526, 338, 26965, 780, 356, 547, 17533, 286, 262, 2057, 3689, 379, 440, 7340, 13, 309, 10546, 36810, 270, 2935, 64, 373, 845, 12309, 3688, 284, 262, 11918, 379, 262, 1910, 13, 16622, 5897, 379, 326, 7393, 286, 262, 16479, 13, 198, 198, 2202, 262, 835, 1363, 11, 356, 2900, 656, 18482, 39109, 12917, 11, 281, 3499, 649, 3090, 284, 18482, 6252, 13, 40764, 1973, 262, 2975, 422, 449, 25786, 8621, 324, 84, 11, 340, 338, 5884, 284, 262, 1468, 8539, 2884, 257, 7696, 13, 3363, 11, 340, 338, 1464, 546, 19432, 351, 9735, 43890, 777, 1528, 13, 14384, 11, 612, 338, 257, 1402, 14812, 10299, 2189, 290, 3294, 2057, 33228, 357, 1640, 617, 1738, 484, 423, 1115, 6983, 10808, 737, 1892, 540, 12527, 389, 20494, 30908, 11, 11118, 5374, 261, 11, 1514, 399, 27106, 2097, 11, 16645, 16645, 5961, 337, 1453, 11, 290, 4333, 15060, 13, 1318, 338, 635, 327, 2182, 78, 326, 9179, 8683, 2705, 4691, 4771, 8566, 13, 2561, 1577, 281, 4296, 355, 314, 1949, 262, 2057, 12527, 612, 0, 198, 198, 20610, 11, 3945, 1596, 11, 2177, 198, 198, 3260, 257, 2187, 1227, 286, 46711, 2535, 11, 25682, 290, 314, 3443, 550, 262, 2863, 284, 467, 284, 262, 1910, 13, 383, 717, 3187, 286, 2177, 13, 2080, 477, 262, 614, 886, 17122, 503, 286, 262, 835, 11, 340, 3443, 17577, 276, 319, 661, 326, 262, 31947, 3999, 968, 6280, 373 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
//------------------------------------------------------------------------------ // <auto-generated> // This code was generated by AsyncGenerator. // // Changes to this file may cause incorrect behavior and will be lost if // the code is regenerated. // </auto-generated> //------------------------------------------------------------------------------ using System.Collections.Generic; using NUnit.Framework; using NHibernate.Criterion; namespace NHibernate.Test.NHSpecificTest.NH2546 { using System.Threading.Tasks; [TestFixture] public class SetCommandParameterSizesFalseFixtureAsync : BugTestCase { protected override bool AppliesTo(Dialect.Dialect dialect) { return dialect is Dialect.MsSql2008Dialect; } protected override void OnSetUp() { using (ISession session = Sfi.OpenSession()) { session.Persist(new Student() { StringTypeWithLengthDefined = "Julian Maughan" }); session.Persist(new Student() { StringTypeWithLengthDefined = "Bill Clinton" }); session.Flush(); } } protected override void OnTearDown() { using (ISession session = Sfi.OpenSession()) { session.CreateQuery("delete from Student").ExecuteUpdate(); session.Flush(); } base.OnTearDown(); } [Test] public async Task LikeExpressionWithinDefinedTypeSizeAsync() { using (ISession session = Sfi.OpenSession()) { ICriteria criteria = session .CreateCriteria<Student>() .Add(Restrictions.Like("StringTypeWithLengthDefined", "Julian%")); IList<Student> list = await (criteria.ListAsync<Student>()); Assert.That(list.Count, Is.EqualTo(1)); } } [Test] public async Task LikeExpressionExceedsDefinedTypeSizeAsync() { // In this case we are forcing the usage of LikeExpression class where the length of the associated property is ignored using (ISession session = Sfi.OpenSession()) { ICriteria criteria = session .CreateCriteria<Student>() .Add(Restrictions.Like("StringTypeWithLengthDefined", "[a-z][a-z][a-z]ian%", MatchMode.Exact, null)); IList<Student> list = await (criteria.ListAsync<Student>()); Assert.That(list.Count, Is.EqualTo(1)); } } } }
[ 171, 119, 123, 1003, 10097, 26171, 198, 1003, 1279, 23736, 12, 27568, 29, 198, 1003, 220, 220, 220, 220, 770, 2438, 373, 7560, 416, 1081, 13361, 8645, 1352, 13, 198, 1003, 198, 1003, 220, 220, 220, 220, 19179, 284, 428, 2393, 743, 2728, 11491, 4069, 290, 481, 307, 2626, 611, 198, 1003, 220, 220, 220, 220, 262, 2438, 318, 16935, 515, 13, 198, 1003, 7359, 23736, 12, 27568, 29, 198, 1003, 10097, 26171, 628, 198, 3500, 4482, 13, 5216, 26448, 13, 46189, 26, 198, 3500, 399, 26453, 13, 21055, 6433, 26, 198, 3500, 24451, 1856, 77, 378, 13, 18559, 28019, 26, 198, 198, 14933, 10223, 24451, 1856, 77, 378, 13, 14402, 13, 33863, 32419, 14402, 13, 33863, 1495, 3510, 198, 90, 198, 197, 3500, 4482, 13, 16818, 278, 13, 51, 6791, 26, 198, 197, 58, 14402, 37, 9602, 60, 198, 197, 11377, 1398, 5345, 21575, 36301, 50, 4340, 25101, 37, 9602, 42367, 1058, 15217, 14402, 20448, 198, 197, 90, 198, 197, 197, 24326, 20957, 20512, 2034, 13508, 2514, 7, 24400, 478, 13, 24400, 478, 23637, 8, 198, 197, 197, 90, 198, 197, 197, 197, 7783, 23637, 318, 21269, 478, 13, 10128, 50, 13976, 11528, 24400, 478, 26, 198, 197, 197, 92, 628, 197, 197, 24326, 20957, 7951, 1550, 7248, 4933, 3419, 198, 197, 197, 90, 198, 197, 197, 197, 3500, 357, 1797, 2521, 6246, 796, 311, 12463, 13, 11505, 36044, 28955, 198, 197, 197, 197, 90, 198, 197, 197, 197, 197, 29891, 13, 30946, 396, 7, 3605, 13613, 3419, 1391, 10903, 6030, 3152, 24539, 7469, 1389, 796, 366, 16980, 666, 337, 1567, 272, 1, 14980, 198, 197, 197, 197, 197, 29891, 13, 30946, 396, 7, 3605, 13613, 3419, 1391, 10903, 6030, 3152, 24539, 7469, 1389, 796, 366, 17798, 2605, 1, 14980, 198, 197, 197, 197, 197, 29891, 13, 7414, 1530, 9783, 198, 197, 197, 197, 92, 198, 197, 197, 92, 198, 197, 197, 198, 197, 197, 24326, 20957, 7951, 1550, 51, 451, 8048, 3419, 198, 197, 197, 90, 198, 197, 197, 197, 3500, 357, 1797, 2521, 6246, 796, 311, 12463, 13, 11505, 36044, 28955, 198, 197, 197, 197, 90, 198, 197, 197, 197, 197, 29891, 13, 16447, 20746, 7203, 33678, 422, 13613, 11074, 23002, 1133, 10260, 9783, 198, 197, 197, 197, 197, 29891, 13, 7414, 1530, 9783, 198, 197, 197, 197, 92, 198, 197, 197, 197, 8692, 13, 2202, 51, 451, 8048, 9783, 198, 197, 197, 92, 628, 197, 197, 58, 14402, 60, 198, 197, 197, 11377, 30351, 15941, 4525, 16870, 2234, 22005, 7469, 1389, 6030, 10699, 42367, 3419, 198, 197, 197, 90, 198, 197, 197, 197, 3500, 357, 1797, 2521, 6246, 796, 311, 12463, 13, 11505, 36044, 28955, 198, 197, 197, 197, 90, 198, 197, 197, 197, 197, 2149, 799, 5142, 9987, 796, 6246, 198, 197, 197, 197, 197, 197, 13, 16447, 18559, 5142, 27, 38778, 29, 3419, 198, 197, 197, 197, 197, 197, 13, 4550, 7, 19452, 2012, 507, 13, 7594, 7203, 10100, 6030, 3152, 24539, 7469, 1389, 1600, 366, 16980, 666, 4, 4943, 1776, 198, 197, 197, 197, 197, 198, 197, 197, 197, 197, 4146, 396, 27, 38778, 29, 1351, 796, 25507, 357, 22213, 5142, 13, 8053, 42367, 27, 38778, 29, 35430, 198, 197, 197, 197, 197, 198, 197, 197, 197, 197, 8021, 861, 13, 2504, 7, 4868, 13, 12332, 11, 1148, 13, 36, 13255, 2514, 7, 16, 18125, 198, 197, 197, 197, 92, 198, 197, 197, 92, 198, 197, 197, 198, 197, 197, 58, 14402, 60, 198, 197, 197, 11377, 30351, 15941, 4525, 16870, 2234, 3109, 2707, 82, 7469, 1389, 6030, 10699, 42367, 3419, 198, 197, 197, 90, 198, 197, 197, 197, 1003, 554, 428, 1339, 356, 389, 10833, 262, 8748, 286, 4525, 16870, 2234, 1398, 810, 262, 4129, 286, 262, 3917, 3119, 318, 9514, 198, 197, 197, 197, 3500, 357, 1797, 2521, 6246, 796, 311, 12463, 13, 11505, 36044, 28955, 198, 197, 197, 197, 90, 198, 197, 197, 197, 197, 2149, 799, 5142, 9987, 796, 6246, 198, 197, 197, 197, 197, 197, 13, 16447, 18559, 5142, 27, 38778, 29, 3419, 198, 197, 197, 197, 197, 197, 13, 4550, 7, 19452, 2012, 507, 13, 7594, 7203, 10100, 6030, 3152, 24539, 7469, 1389, 1600, 12878, 64, 12, 89, 7131, 64, 12, 89, 7131, 64, 12, 89, 60, 666, 4, 1600, 13225, 19076, 13, 3109, 529, 11, 9242, 18125, 198, 197, 197, 197, 197, 198, 197, 197, 197, 197, 4146, 396, 27, 38778, 29, 1351, 796, 25507, 357, 22213, 5142, 13, 8053, 42367, 27, 38778, 29, 35430, 198, 197, 197, 197, 197, 198, 197, 197, 197, 197, 8021, 861, 13, 2504, 7, 4868, 13, 12332, 11, 1148, 13, 36, 13255, 2514, 7, 16, 18125, 198, 197, 197, 197, 92, 198, 197, 197, 92, 198, 197, 92, 198, 92, 198 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
723 P.2d 394 (1986) L. Lynn ALLEN and Merle Allen, Plaintiffs and Respondents, v. Thomas M. KINGDON and Joan O. Kingdon, Defendants and Appellants. No. 18290. Supreme Court of Utah. July 29, 1986. H. James Clegg, Scott Daniels, Salt Lake City, for defendants and appellants. Boyd M. Fullmer, Salt Lake City, for plaintiffs and respondents. HOWE, Justice: The plaintiffs Allen (buyers) brought this action for the return of all money they had paid on an earnest money agreement to purchase residential real estate. The defendants Kingdon (sellers) appeal the trial court's judgment that the agreement had been rescinded by the parties and that the buyers were entitled to a full refund. *395 On February 12, 1978, the buyers entered into an earnest money agreement to purchase the sellers' home for $87,500. The agreement provided for an immediate deposit of $1,000, which the buyers paid, to be followed by an additional down payment of $10,000 by March 15, 1978. The buyers were to pay the remainder of the purchase price at the closing which was set on or before April 15, 1978. The agreement provided for the forfeiture of all amounts paid by the buyers as liquidated and agreed damages in the event they failed to complete the purchase. The buyers did not pay the additional $10,000, but paid $9,800 because the parties later agreed on a $200 deduction for a light fixture the sellers were allowed to take from the home. An inscription on the $9,800 check stated all monies paid were "subject to closing." There were several additional exchanges between the parties after the earnest money agreement was signed. The buyers requested that the sellers fix the patio, which the sellers refused to do. The buyers asked that the sellers paint the front of the home, which Mr. Kingdon agreed to do, but did not accomplish. The parties eventually met to close the sale. The buyers insisted on a $500 deduction from the purchase price because of the sellers' failure to paint. The sellers refused to convey title unless the buyers paid the full purchase price. Because of this impasse, the parties did not close the transaction. Mrs. Allen and Mrs. Kingdon left the meeting, after which Mr. Kingdon orally agreed to refund the $10,800, paid by the buyers. However, three days later, the sellers' attorney sent a letter to the buyers advising them that the sellers would retain enough of the earnest money to cover any damages they would incur in reselling the home. The letter also stated that the buyers could avoid these damages by closing within ten days. The buyers did not offer to close the sale. The home was eventually sold for $89,100, less a commission of $5,346. Claiming damages in excess of $15,000, the sellers retained the entire $10,800 and refused to make any refund to the buyers. The trial court found that the parties had orally rescinded their agreement and ordered the sellers to return the buyers' payments, less $1,000 on a counterclaim of the sellers, which award is not challenged on this appeal. The sellers first contend that the trial court erred in holding that our statute of frauds permits oral rescission of a written executory contract for the sale of real property. U.C.A., 1953, § 25-5-1 provides: No estate or interest in real property, other than leases for a term not exceeding one year, nor any trust or power over or concerning real property or in any manner relating thereto, shall be created, granted, assigned, surrendered or declared otherwise than by operation of law, or by deed or conveyance in writing subscribed by the party creating, granting, assigning, surrendering or declaring the same, or by his lawful agent thereunto authorized by writing. (Emphasis added.) In Cutwright v. Union Savings & Investment Co., 33 Utah 486, 491-92, 94 P. 984, 985 (1908), this Court interpreted section 25-5-1 as follows: No doubt the transfer of any interest in real property, whether equitable or legal, is within the statute of frauds; and no such interest can either be created, transferred, or surrendered by parol merely.... No doubt, if a parol agreement to surrender or rescind a contract for the sale of lands is wholly executory, and nothing has been done under it, it is within the statute of frauds, and cannot be enforced any more than any other agreement concerning an interest in real property may be. (Emphasis added.) In that case, the buyer purchased a home under an installment contract providing for the forfeiture of all amounts paid in the event the buyer defaulted. The buyer moved into the home but soon discontinued payments. He informed the seller that he would make no more payments on the contract, surrendered the key to the house, and vacated the premises. Soon thereafter, an assignee of the buyer's interest informed the seller that he intended to make the payments *396 under the contract and demanded possession. The seller refused to accept the payments, claiming that the contract had been mutually rescinded on the buyer's surrender of possession. We held that the statute of frauds generally requires the surrender of legal and equitable interests in land to be in writing. Where, however, an oral rescission has been executed, the statute of frauds may not apply. In Cutwright, surrender of possession by the buyer constituted sufficient part performance of the rescission agreement to remove it from the statute of frauds. This exception is one of several recognized by our cases. We have also upheld oral rescission of a contract for the sale of land when the seller, in reliance on the rescission, enters into a new contract to resell the land. Budge v. Barron, 51 Utah 234, 244-45, 169 P. 745, 748 (1917). In addition, an oral rescission by the buyer may be enforceable where the seller has breached the written contract. Thackeray v. Knight, 57 Utah 21, 27-28, 192 P. 263, 266 (1920). In the present case, the oral rescission involved the surrender of the buyers' equitable interest in the home under the earnest money agreement. Further, the rescission was wholly executory. There is no evidence of any part performance of the rescission or that the buyers substantially changed their position in reliance on the promise to discharge the contract. On the contrary, three days after the attempted closing, the sellers informed the buyers that they intended to hold them to the contract. It was only after the buyers continued in their refusal to close that the sellers placed the home on the market. The buyers argue that the weight of authority in the United States is to the effect that an executory contract for the sale of land within the statute of frauds may be orally rescinded. This may indeed be the case when there are acts of performance of the oral agreement sufficient to take it out of the statute of frauds. See Annot., 42 A.L.R.3d 242, 251 (1972). In support of their contention that an oral rescission of an earnest money agreement for the purchase of land is valid absent any acts of performance, the buyers rely on Niernberg v. Feld, 131 Colo. 508, 283 P.2d 640 (1955). In that case, the Colorado Supreme Court upheld the oral rescission of an executory contract for the sale of land under a statute of frauds which, like Utah's, applies specifically to the surrender of interests in land. The Colorado court concluded that the statute of frauds concerns the making of contracts only and does not apply to their revocation. However, the court did not attempt to reconcile its holding with the contradictory language of the controlling statute. For a contrary result under a similar statute and fact situation, see Waller v. Lieberman, 214 Mich. 428, 183 N.W. 235 (1921). In light of the specific language of Utah's statute of frauds and our decision in Cutwright v. Union Savings & Investment Co., supra, we decline to follow the Colorado case. We note that the annotator at 42 A.L.R.3d 257 points out that in Niernberg the rescission was acted upon in various ways. We hold in the instant case that the wholly executory oral rescission of the earnest money agreement was unenforceable under our statute of frauds. Nor were the buyers entitled to rescind the earnest money agreement because of the sellers' failure to paint the front of the home as promised. Cf. Thackeray v. Knight, 57 Utah at 27-28, 192 P. at 266 (buyer's oral rescission of contract for sale of land was valid when seller breached contract). The rule is well settled in Utah that if the original agreement is within the statute of frauds, a subsequent agreement that modifies any of the material parts of the original must also satisfy the statute. Golden Key Realty, Inc. v. Mantas, 699 P.2d 730, 732 (Utah 1985). An exception to this general rule has been recognized where a party has changed position by performing an oral modification so that it would be inequitable to permit the other party to found a claim or defense on the original agreement as unmodified. White v. Fox, 665 P.2d 1297, 1301 (Utah 1983) *397 (citing Bamberger Co. v. Certified Productions, Inc., 88 Utah 194, 201, 48 P.2d 489, 492 (1935), aff'd on rehearing, 88 Utah 213, 53 P.2d 1153 (1936)). There is no indication that the buyers changed their position in reliance on the sellers' promise to paint the front of the house. Thus, equitable considerations would not preclude the sellers from raising the unmodified contract as a defense to the claim of breach. The fact that the parties executed several other oral modifications of the written contract does not permit the buyers to rescind the contract for breach of an oral promise on which they did not rely to their detriment. We therefore hold that the buyers were not entitled to rescind the earnest money agreement because of the sellers' failure to perform an oral modification required to be in writing under the statute of frauds. The buyers also contend that they are entitled to the return of the $10,800 because the inscription on the $9,800 check stated that all monies were paid "subject to closing." The buyers argue that by conditioning the check in this manner they may, in effect, rewrite the earnest money agreement and relieve themselves of any liability for their own failure to close the sale. We cannot accept this argument. The buyers were under an obligation to pay the monies unconditionally. The sellers' acceptance of the inscribed check cannot be construed as a waiver of their right to retain the $10,800 when the buyers failed to perform the agreement. Having concluded that the buyers breached their obligation under the earnest money agreement, we must next consider whether the liquidated damages provision of the agreement is enforceable. That provision provided that the sellers could retain all amounts paid by the buyers as liquidated and agreed damages in the event the buyers failed to complete the purchase. The general rules in Utah regarding enforcement of liquidated damages for breach of contract have been summarized as follows: Under the basic principles of freedom of contract, a stipulation to liquidated damages for breach of contract is generally enforceable. Where, however, the amount of liquidated damages bears no reasonable relationship to the actual damage or is so grossly excessive as to be entirely disproportionate to any possible loss that might have been contemplated that it shocks the conscience, the stipulation will not be enforced. Warner v. Rasmussen, 704 P.2d 559, 561 (Utah 1985) (citations omitted). In support of their contention that the liquidated damages are not excessive compared to actual damages, the sellers assert that they offered evidence of actual damages in excess of $15,000. However, the trial court disagreed and found the amount of liquidated damages excessive. The record indicates that the only recoverable damages sustained by the sellers resulted from the resale of the home at a lower net price amounting to $3,746 (the difference between the contract price of $87,500 and the eventual selling price, less commission, of $83,754). We agree that $10,800 is excessive and disproportionate when compared to the $3,746 loss of bargain suffered by the sellers. Since the buyers did not ever have possession of the property, the other items of damage claimed by the sellers (interest on mortgage, taxes, and utilities) are not recoverable by them. Perkins v. Spencer, 121 Utah 468, 243 P.2d 446 (1952). Therefore, the sellers are not entitled to retain the full amount paid, but may offset their actual damages of $3,746 against the buyers' total payments. See Soffe v. Ridd, 659 P.2d 1082 (Utah 1983) (seller was entitled to actual damages where liquidated damages provision was held unenforceable). We reverse the trial court's judgment that the earnest money agreement was rescinded and conclude that the buyers breached their obligation to close the transaction. However, we affirm the judgment below that the liquidated damages provided for were excessive and therefore not recoverable. *398 The case is remanded to the trial court to amend the judgment to award the buyers $7,054, less $1,000 awarded by the trial court to the sellers on their counterclaim which is not challenged on this appeal. No interest or attorney fees are awarded to either party inasmuch as the trial court awarded none and neither party has raised the issue on appeal. HALL, C.J., and STEWART and DURHAM, JJ., concur. ZIMMERMAN, Justice (concurring): I join the majority in its disposition of the various issues. However, the majority quotes from Warner v. Rasmussen, 704 P.2d 559 (Utah 1985), to the effect that contractual provisions for liquidated damages will be enforced unless "the amount of liquidated damages bears no reasonable relationship to the actual damage or is so grossly excessive as to be entirely disproportionate to any loss that might have been contemplated that it shocks the conscience." The Court then finds that the amount of the liquidated damages provided for in the agreement is "excessive and disproportionate" when compared to the actual loss suffered by the sellers, thus implying that in the absence of a disparity as great as that which exists here (actual loss is approximately one-third of the penalty), the standard of Warner v. Rasmussen will not be satisfied. I think an examination of our cases should suggest to any thoughtful reader that, in application, the test stated in Warner is not nearly as accepting of liquidated damage provisions as the quoted language would suggest. In fact, I believe this Court routinely applies the alternative test of Warner—that the liquidated damages must bear some reasonable relationship to the actual damages—and that we carefully scrutinize liquidated damage awards. I think it necessary to say this lest the bar be misled by the rather loose language of Warner and its predecessors.
[ 198, 22, 1954, 350, 13, 17, 67, 5014, 19, 357, 28054, 8, 198, 43, 13, 24868, 11096, 1677, 290, 4638, 293, 9659, 11, 31313, 10203, 290, 33556, 658, 11, 198, 85, 13, 198, 22405, 337, 13, 32957, 41173, 290, 26640, 440, 13, 2677, 9099, 11, 44162, 290, 2034, 695, 1187, 13, 198, 2949, 13, 1248, 24369, 13, 198, 40784, 2182, 3078, 286, 10202, 13, 198, 16157, 2808, 11, 12113, 13, 198, 39, 13, 3700, 3779, 1130, 11, 4746, 28162, 11, 13754, 6233, 2254, 11, 329, 16757, 290, 24781, 1187, 13, 198, 33, 12192, 337, 13, 6462, 647, 11, 13754, 6233, 2254, 11, 329, 21880, 290, 14502, 13, 198, 37181, 36, 11, 4796, 25, 198, 464, 21880, 9659, 357, 17846, 364, 8, 3181, 428, 2223, 329, 262, 1441, 286, 477, 1637, 484, 550, 3432, 319, 281, 23176, 1637, 4381, 284, 5001, 12420, 1103, 7964, 13, 383, 16757, 2677, 9099, 357, 7255, 364, 8, 5198, 262, 4473, 2184, 338, 8492, 326, 262, 4381, 550, 587, 39091, 276, 416, 262, 4671, 290, 326, 262, 14456, 547, 9080, 284, 257, 1336, 12929, 13, 198, 9, 31010, 1550, 3945, 1105, 11, 15524, 11, 262, 14456, 5982, 656, 281, 23176, 1637, 4381, 284, 5001, 262, 23531, 6, 1363, 329, 720, 5774, 11, 4059, 13, 383, 4381, 2810, 329, 281, 7103, 14667, 286, 720, 16, 11, 830, 11, 543, 262, 14456, 3432, 11, 284, 307, 3940, 416, 281, 3224, 866, 6074, 286, 720, 940, 11, 830, 416, 2805, 1315, 11, 15524, 13, 383, 14456, 547, 284, 1414, 262, 17675, 286, 262, 5001, 2756, 379, 262, 9605, 543, 373, 900, 319, 393, 878, 3035, 1315, 11, 15524, 13, 383, 4381, 2810, 329, 262, 32075, 286, 477, 6867, 3432, 416, 262, 14456, 355, 8122, 515, 290, 4987, 12616, 287, 262, 1785, 484, 4054, 284, 1844, 262, 5001, 13, 383, 14456, 750, 407, 1414, 262, 3224, 720, 940, 11, 830, 11, 475, 3432, 720, 24, 11, 7410, 780, 262, 4671, 1568, 4987, 319, 257, 720, 2167, 24374, 329, 257, 1657, 29220, 262, 23531, 547, 3142, 284, 1011, 422, 262, 1363, 13, 1052, 40189, 319, 262, 720, 24, 11, 7410, 2198, 5081, 477, 937, 444, 3432, 547, 366, 32796, 284, 9605, 526, 198, 1858, 547, 1811, 3224, 14525, 1022, 262, 4671, 706, 262, 23176, 1637, 4381, 373, 4488, 13, 383, 14456, 9167, 326, 262, 23531, 4259, 262, 39660, 11, 543, 262, 23531, 6520, 284, 466, 13, 383, 14456, 1965, 326, 262, 23531, 7521, 262, 2166, 286, 262, 1363, 11, 543, 1770, 13, 2677, 9099, 4987, 284, 466, 11, 475, 750, 407, 9989, 13, 383, 4671, 4191, 1138, 284, 1969, 262, 5466, 13, 383, 14456, 11189, 319, 257, 720, 4059, 24374, 422, 262, 5001, 2756, 780, 286, 262, 23531, 6, 5287, 284, 7521, 13, 383, 23531, 6520, 284, 13878, 3670, 4556, 262, 14456, 3432, 262, 1336, 5001, 2756, 13, 4362, 286, 428, 848, 21612, 11, 262, 4671, 750, 407, 1969, 262, 8611, 13, 9074, 13, 9659, 290, 9074, 13, 2677, 9099, 1364, 262, 3249, 11, 706, 543, 1770, 13, 2677, 9099, 47311, 4987, 284, 12929, 262, 720, 940, 11, 7410, 11, 3432, 416, 262, 14456, 13, 2102, 11, 1115, 1528, 1568, 11, 262, 23531, 6, 6136, 1908, 257, 3850, 284, 262, 14456, 30341, 606, 326, 262, 23531, 561, 12377, 1576, 286, 262, 23176, 1637, 284, 3002, 597, 12616, 484, 561, 35870, 287, 1599, 2680, 262, 1363, 13, 383, 3850, 635, 5081, 326, 262, 14456, 714, 3368, 777, 12616, 416, 9605, 1626, 3478, 1528, 13, 383, 14456, 750, 407, 2897, 284, 1969, 262, 5466, 13, 383, 1363, 373, 4191, 2702, 329, 720, 4531, 11, 3064, 11, 1342, 257, 5810, 286, 720, 20, 11, 30557, 13, 22070, 278, 12616, 287, 6992, 286, 720, 1314, 11, 830, 11, 262, 23531, 17383, 262, 2104, 720, 940, 11, 7410, 290, 6520, 284, 787, 597, 12929, 284, 262, 14456, 13, 383, 4473, 2184, 1043, 326, 262, 4671, 550, 47311, 39091, 276, 511, 4381, 290, 6149, 262, 23531, 284, 1441, 262, 14456, 6, 7524, 11, 1342, 720, 16, 11, 830, 319, 257, 3753, 6604, 286, 262, 23531, 11, 543, 5764, 318, 407, 12827, 319, 428, 5198, 13, 198, 464, 23531, 717, 24351, 326, 262, 4473, 2184, 1931, 445, 287, 4769, 326, 674, 14195, 286, 7394, 82, 13892, 12886, 6811, 1480, 286, 257, 3194, 3121, 652, 2775, 329, 262, 5466, 286, 1103, 3119, 13, 471, 13, 34, 13, 32, 1539, 24217, 11, 8460, 1679, 12, 20, 12, 16, 3769, 25, 198, 2949, 7964, 393, 1393, 287, 1103, 3119, 11, 584, 621, 38522, 329, 257, 3381, 407, 23353, 530, 614, 11, 4249, 597, 3774, 393, 1176, 625, 393, 9305, 1103, 3119, 393, 287, 597, 5642, 11270, 44597, 11, 2236, 307, 2727, 11, 7520, 11, 8686, 11, 29209, 393, 6875, 4306, 621, 416, 4905, 286, 1099, 11, 393, 416, 28637, 393, 13878, 590, 287, 3597, 45794, 416, 262, 2151, 4441, 11, 21787, 11, 38875, 11, 16908, 278, 393, 18684, 262, 976, 11, 393, 416, 465, 20785, 5797, 612, 403, 1462, 10435, 416, 3597, 13, 198, 7, 10161, 28432, 2087, 2014, 554, 9712, 29995, 410, 13, 4479, 40947, 1222, 20877, 1766, 1539, 4747, 10202, 604, 4521, 11, 5125, 16, 12, 5892, 11, 10048, 350, 13, 860, 5705, 11, 860, 5332, 357, 1129, 2919, 828, 428, 3078, 16173, 2665, 1679, 12, 20, 12, 16, 355, 5679, 25, 198, 2949, 4719, 262, 4351, 286, 597, 1393, 287, 1103, 3119, 11, 1771, 37164, 393, 2742, 11, 318, 1626, 262, 14195, 286, 7394, 82, 26, 290, 645, 884, 1393, 460, 2035, 307, 2727, 11, 11172, 11, 393, 29209, 416, 1582, 349, 6974, 1106, 1400, 4719, 11, 611, 257, 1582, 349, 4381, 284, 16908, 393, 39091, 257, 2775, 329, 262, 5466, 286, 8604, 318, 18174, 3121, 652, 11, 290, 2147, 468, 587, 1760, 739, 340, 11, 340, 318, 1626, 262, 14195, 286, 7394, 82, 11, 290, 2314, 307, 20326, 597, 517, 621, 597, 584, 4381, 9305, 281, 1393, 287, 1103, 3119, 743, 307, 13, 198, 7, 10161, 28432, 2087, 2014, 554, 326, 1339, 11, 262, 17872, 8155, 257, 1363, 739, 281, 25168, 2775, 4955, 329, 262, 32075, 286, 477, 6867, 3432, 287, 262, 1785, 262, 17872, 4277, 276, 13, 383, 17872, 3888, 656, 262, 1363, 475, 2582, 31349, 7524, 13, 679, 7981 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
AxisControlBus ControlBus PathPlanning1 PathPlanning6 PathToAxisControlBus GearType1 GearType2 Motor Controller AxisType1 AxisType2 MechanicalStructure
[ 31554, 271, 15988, 16286, 198, 15988, 16286, 198, 15235, 20854, 768, 16, 198, 15235, 20854, 768, 21, 198, 15235, 2514, 31554, 271, 15988, 16286, 198, 38141, 6030, 16, 198, 38141, 6030, 17, 198, 34919, 198, 22130, 198, 31554, 271, 6030, 16, 198, 31554, 271, 6030, 17, 198, 28452, 36684, 1273, 5620, 198 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Fighting for a climate change treaty A NASA study finds the amount of ozone destroyed in the Arctic in 2011, shown in this image, was comparable to the ozone 'hole' that formed each spring since the mid-1980s [EPA] In 1974, chemists Mario Molina and Frank Sherwood Rowland published a landmark article that demonstrated the ability of chlorofluorocarbons (CFCs) to break down the ozone layer, the atmospheric region that plays a vital role in shielding humans and other life from harmful ultraviolet (UV) radiation. It marked the opening salvo of a decade-long fight to phase out and ban the use of these widespread industrial compounds. The period between Molina and Rowland's article and the establishment of an international agreement to regulate CFCs was remarkably similar to current climate change politics. It included calls for scientific consensus before moving on the issue, industry push back, fears over economic chaos, claims of inadequate chemical substitutes, difficulty in getting industrialised nations to the table, and debates and diplomacy over how to get developing nations to agree to regulate a problem predominantly caused by the industrialised world. Together, these issues created a political climate that was anything but conducive to an agreement for avoiding environmental catastrophe. And yet an agreement was reached. CFC production was greatly curtailed and disaster was averted. The Montreal Protocol - initially signed by 24 nations in 1987 and now ratified by 196 countries - bound nations to a set of policies that would rapidly reduce the use of CFCs. It became the first global environmental treaty to implement the precautionary approach, mandating strong actions now to avert future damage. The protocol has since become, in the words of former UN secretary-general Kofi Annan, "perhaps the single most successful international environmental agreement." It can also be called the first climate change treaty, since ozone-depleting substances are potent greenhouse gases. Lessons from the fight and eventual ban of CFCs can illuminate our current struggles to regulate greenhouse gases and provide guidance toward creating a strong treaty necessary to stave off another environmental disaster. An $8bn industry For more than 40 years, the generally non-toxic and non-flammable compounds known as CFCs were widely produced and used in refrigerants, propellants, and solvents. They were first manufactured as a safe alternative to ammonia and sulphur dioxide in refrigeration in the early 1930s. Their widespread success, due to their unique and seemingly miraculous chemical properties, propelled an $8bn industry that employed 600,000 people directly and was reaching new heights of manufacturing at the time of Molina and Rowland's discovery. As CFC production swelled to meet the global demand for aerosol and refrigeration, so too did the release of these ozone-depleting compounds into the atmosphere. Unlike carbon dioxide, CFCs are a foreign element in the atmosphere. When released, CFC molecules rise and reach the ozone layer where they encounter UV radiation. The strong radiation breaks down these molecules into their simpler parts, most notably chlorine atoms. Molina and Rowland realised these now free chlorine atoms could react and deplete the ozone layer. The US Environmental Protection Agency estimates that one chlorine atom can destroy 100,000 ozone molecules. Continuing to produce CFCs at such high levels would inevitably have depleted more of the ozone layer and would have led to greater harm to humans from UV rays. Further studies concurred with Molina and Rowland's findings and predicted losses of ozone that would have greatly increased cases of skin cancer and eye damage. Other detrimental impacts included reduced productivity in plants and crops and harm to marine life and air quality. The findings provoked wide-ranging reactions. Emboldened by the passage of the Clean Air and Clean Water Acts in the United States, the science and environmental communities wanted the US government to ban production and use of CFCs. They saw the depletion of the ozone layer as a grave, imminent threat that needed to be met with decisive action. The CFC industry, led by DuPont, which accounted for nearly 50 per cent of the market, attacked the theory as unfounded, arguing that no stratospheric ozone loss had been observed. DuPont and other CFC manufacturers lobbied extensively to prevent states from passing bills banning CFC use. The 'ban-now-find-out-later' approach DuPont also embarked on an advertising campaign to undermine the idea that CFCs damaged the ozone layer, while simultaneously arguing that any hasty restrictions would have a disastrous impact on businesses, jobs and the economy. DuPont's chairman, Irving Shapiro, announced to several major newspapers that "the 'ban-now-find-out-later' approach thrust upon an $8bn segment of industry, both in the headlines and in many legislative proposals, is a disturbing trend. Businesses can be destroyed before scientific facts are assembled and evaluated … The nation cannot afford to act on this and other issues before the full facts are known." Public health concerns, however, trumped industry arguments and consumers began boycotting aerosol sprays. Pressure from environmentalists and consumer groups resulted in a ban on aerosol sprays in 1978. In the end, though, the ban turned out to be only a partial victory for both sides. Nearly all sprays were banned, but numerous putatively "essential" uses of CFCs in air conditioners and refrigerators remained unregulated. The United States was the only major CFC-producing nation to voluntarily eliminate CFCs in aerosols, although relatively minor producers such as Canada, Denmark and Sweden soon followed suit. And while European nations today are at the forefront of promoting climate change legislation, in the 1970s and 1980s, CFC-producing giants like England and France were reluctant to impose restrictions. After these initial efforts by individual nations, progress toward an international CFCs agreement ground to a halt in the early 1980s. This was largely because protecting the ozone layer produced an unprecedented problem for human society. The public and governments were being told that the impacts of a thinning ozone layer would not be seen for decades. Yet in order to prevent much higher risks of skin cancer and cataracts, it was essential to act now and begin phasing out CFCs. Manufacturers continued to resist, arguing that in the absence of suitable substitutes, curtailing CFC production would result in significant job losses and a large reduction in the supply of air conditioners and refrigerators. They argued that action on CFCs would harm both the developed and developing world. On top of this, almost all nations would have to agree on a coordinated phase out and eventual ban of the industrial compounds since the release of CFCs by any one nation would have a global impact. Delayed implementations Producers of CFCs continued to wage a public battle against further regulation. Sceptics stepped up their public relations campaigns disputing the evidence, finding scientists to argue persuasively against the threat, and predicting dire economic consequences. The doubt did nothing to change the scientific consensus around CFCs and ozone depletion, but it helped to delay implementation of limits on CFCs for many years. While special interests were fighting it out in the public square, diplomacy was taking place behind the scenes. Domestic and international workshops were assessing the CFC-ozone connection while proposing various regulations, compromises, and deals to get major CFC-producing nations and developing nations to the table to begin talks toward an international agreement. The United States and the UN Environment Programme played leading roles. The fruit of this diplomatic labour was the Vienna Convention of March 1985, which produced a framework agreement in which states agreed to cooperate in research and assessments of the ozone problem, to exchange information and to adopt measures to prevent harm to the ozone layer. But the accord fell far short of mandating actions to limit CFC production or of establishing a timetable to phase it out. Much like the current climate change debate, it looked as if action on the issue was about to be stymied by a lengthy political struggle. Two months later, scientists discovered the Antarctic ozone hole. From a climate change perspective, this would be comparable to a large ice sheet breaking off from an ice shelf, melting overnight and causing a small rise in sea level, thereby warning the world of the potential consequences of unchecked climate change. Scientists discovered that ozone levels over the Antarctic had dropped by 10 per cent during the winter and an ozone hole had begun to form. The ozone hole is an area with extremely low amounts of ozone, not an actual hole. But the discovery, the first startling proof of the thinning ozone layer, was an alarming wake-up call that human activities can have dire consequences for the atmosphere and in turn major health implications. Intense media attention galvanised public opinion and sparked fears that ozone holes might form over populated cities around the world. The EPA estimated that if CFC production continued to grow at 2.5 per cent a year until 2050, 150 million Americans would develop skin cancer, leading to some 3 million deaths by 2075. After the momentous discovery of ozone depletion, the balance shifted toward regulation. Industry at first still lobbied in private, but eventually began to change its position as scientific evidence of ozone depletion continued to mount. In the summer of 1987, as preparations were under way for the Montreal Conference on Substances that Deplete the Ozone Layer, the Reagan administration publicly came out in support of international limits on CFC production. This effectively put a stop to industry opposition and propelled an agreement among industrialised nations to reduce CFC production by 50 per cent by 2000. The resulting Montreal Protocol included a 10-year grace period and a fund for developing nations in order to get them to agree to regulate a problem largely generated by the industrialised world. The Multilateral Fund has since provided $2.7bn to developing nations for transitioning to better technology and CFC substitutes and for meeting phase-out obligations. The fund was the first financial instrument of its kind and is the model for the UN-REDD (Reducing Emissions from Deforestation and Forest Degradation) programme, in which industrial nations use carbon offsets to provide developing nations with an incentive for conserving their forests. The Montreal Protocol Since 1987, the Montreal Protocol has been strengthened with the addition of more ozone-damaging substances to the list and the compliance of nearly 200 countries. Ozone-depleting substances in the atmosphere hit their peak in 1997–98 and have been falling ever since. Action on account of the ozone layer has greatly improved air quality while reducing the future risk of skin cancer, cataracts, and blindness. Furthermore, the treaty has done more than any other to reduce climate change by stopping 135bn metric tonnes of CO2-equivalent emissions from escaping to the atmosphere in the last two decades. Due to the nature of CFCs, however, the ozone is still thinning in certain places. This may well continue until the middle of the 21st century, at which point the ozone layer should begin to recover. The true significance of the international agreement is best illustrated by a NASA simulation of what would have occurred had CFC production continued at its pre-Montreal rate. By 2020, 17 per cent of global ozone would be destroyed. By 2040, the ozone thinning would affect the entire planet. And by 2065, atmospheric ozone drops to 70 per cent below 1970s levels. As a result, there would have been a threefold increase in the amount of harmful UV radiation reaching the planet's surface, resulting in tens of millions of skin cancer and cataract cases and trillions in health care costs. Luckily, it is a fate we managed to avoid. The first and foremost lesson to take from the fight to ban CFCs is that it was successful. The discovery that human activity was harming the atmosphere influenced public opinion and consumer buying power enough to change national policy and provide momentum toward an international agreement that enacted regulations to prevent a future catastrophe. Nations agreed to take precautions that would cause some short-term difficulties in order to head off a long-term disaster. Secondly, health concerns were the driving motivator behind public and government action. Peter Morrisette argues that the passage of a meaningful ozone treaty relied on four key factors: Ozone depletion was viewed as a global problem; there was strong scientific understanding of the causes and effects of ozone depletion; there were public-health concerns about skin cancer, which were amplified by the ozone hole discovery; and substitutes for CFCs were available. Climate change is also viewed as a global problem and there is a nearly universal consensus among climate scientists over the causes. Some argue that the major difference between obtaining a treaty back then and what hinders today's agreement is a lack of readily available substitutes in the form of alternative energy - wind, solar, electric - to take the place of fossil fuels. International agreement Yet the claim that no cost-effective, efficient substitutes were available was also made during the CFC debates. It was not until after the ozone hole discovery, at which point an international agreement seemed likely, that industry announced that substitutes could be made available under the right market conditions and policy incentives. CFC producers used the ensuing protocol as a mechanism to develop and market substitutes. Might not a similar situation unfold today if governments enforced greenhouse gas reductions, and policy and market conditions fostered alternative energies? It seems the major difference between a successful ozone treaty and an out-of-reach climate agreement is the weak connection made between climate change and human health. Where ozone depletion was primarily thought of as a human health issue, climate change is an environmental issue. Until that narrative is altered, an agreement on climate change could be elusive. Encouraging signs toward that end are emerging, none more so than the US EPA declaration that greenhouse gases jeopardise public health. The declaration paves way for the EPA to regulate greenhouse gas emissions from coal plants and other facilities. The regulatory route seems the most feasible way to reduce greenhouse emissions in the United States, as any climate change legislation has been killed in Congress. The Supreme Court ruling in favour of the EPA gave the agency judicial approval to use its authority to regulate such gases under the Clean Air Act. Just as measures to protect the ozone layer have benefited the climate, so too will EPA action on regulating greenhouse gases provide important health benefits by cleaning up the air. Added benefits of climate mitigation It is important to communicate that climate change mitigation will have the added benefit of reducing air pollution and improving respiratory health. It will also reduce the use of fossil fuels like oil and coal whose extraction processes - from mountaintop removal, which clogs streams and pollutes water supplies, to offshore drilling spills, which can contaminate seafood - have direct human health implications. While regulation at the national level is a good start, an international agreement - perhaps a stronger version of the Kyoto Protocol - will be necessary to achieve global cooperation on climate change. For this to happen, the public will need to voice greater concern and take more action, as it did during the CFC threat. Ozone depletion was framed as an international human health issue, which amplified the public's demand for accelerated government action. A similar approach may work for climate change. The question that remains is whether a catastrophic discovery similar to the ozone hole will be necessary to spur global concerns over climate change and push governments to act. If so, the consequences may prove to be far more disruptive - economically and ecologically - than the ozone problem of the previous century. Matthew Cimitile is a writer for the US Geological Survey Coastal and Marine Science Center in St. Petersburg, Florida.
[ 46375, 329, 257, 4258, 1487, 15775, 198, 198, 32, 8884, 2050, 7228, 262, 2033, 286, 37170, 6572, 287, 262, 15723, 287, 2813, 11, 3402, 287, 428, 2939, 11, 373, 13975, 284, 262, 37170, 705, 13207, 6, 326, 7042, 1123, 6076, 1201, 262, 3095, 12, 23664, 82, 685, 40906, 60, 198, 198, 818, 16489, 11, 4607, 1023, 10682, 17958, 1437, 290, 5278, 6528, 3822, 11314, 1044, 3199, 257, 20533, 2708, 326, 9555, 262, 2694, 286, 20207, 1659, 2290, 273, 420, 283, 23461, 357, 34, 4851, 82, 8, 284, 2270, 866, 262, 37170, 7679, 11, 262, 20938, 3814, 326, 5341, 257, 9204, 2597, 287, 43539, 5384, 290, 584, 1204, 422, 13568, 49961, 357, 31667, 8, 11881, 13, 632, 7498, 262, 4756, 3664, 13038, 286, 257, 5707, 12, 6511, 1907, 284, 7108, 503, 290, 3958, 262, 779, 286, 777, 10095, 7593, 16439, 13, 383, 2278, 1022, 17958, 1437, 290, 11314, 1044, 338, 2708, 290, 262, 9323, 286, 281, 3230, 4381, 284, 16697, 327, 4851, 82, 373, 21196, 2092, 284, 1459, 4258, 1487, 4819, 13, 632, 3017, 3848, 329, 5654, 11529, 878, 3867, 319, 262, 2071, 11, 2831, 4574, 736, 11, 10251, 625, 3034, 11918, 11, 3667, 286, 20577, 5931, 44234, 11, 8722, 287, 1972, 7593, 1417, 7027, 284, 262, 3084, 11, 290, 15389, 290, 25482, 625, 703, 284, 651, 5922, 7027, 284, 4236, 284, 16697, 257, 1917, 20736, 4073, 416, 262, 7593, 1417, 995, 13, 17083, 11, 777, 2428, 2727, 257, 1964, 4258, 326, 373, 1997, 475, 45645, 284, 281, 4381, 329, 14928, 6142, 27767, 13, 198, 198, 1870, 1865, 281, 4381, 373, 4251, 13, 327, 4851, 3227, 373, 9257, 1090, 34966, 290, 9336, 373, 9076, 1513, 13, 383, 12871, 20497, 532, 7317, 4488, 416, 1987, 7027, 287, 12923, 290, 783, 39067, 416, 28817, 2678, 532, 5421, 7027, 284, 257, 900, 286, 4788, 326, 561, 8902, 4646, 262, 779, 286, 327, 4851, 82, 13, 632, 2627, 262, 717, 3298, 6142, 15775, 284, 3494, 262, 32992, 560, 3164, 11, 6855, 803, 1913, 4028, 783, 284, 45347, 2003, 2465, 13, 383, 8435, 468, 1201, 1716, 11, 287, 262, 2456, 286, 1966, 4725, 7705, 12, 24622, 509, 39542, 5506, 272, 11, 366, 28998, 262, 2060, 749, 4388, 3230, 6142, 4381, 526, 632, 460, 635, 307, 1444, 262, 717, 4258, 1487, 15775, 11, 1201, 37170, 12, 10378, 293, 889, 15938, 389, 16739, 16325, 21678, 13, 46885, 422, 262, 1907, 290, 19657, 3958, 286, 327, 4851, 82, 460, 38407, 674, 1459, 12766, 284, 16697, 16325, 21678, 290, 2148, 11154, 3812, 4441, 257, 1913, 15775, 3306, 284, 336, 1015, 572, 1194, 6142, 9336, 13, 198, 198, 2025, 720, 23, 9374, 2831, 198, 198, 1890, 517, 621, 2319, 812, 11, 262, 4143, 1729, 12, 83, 18047, 290, 1729, 12, 69, 11199, 540, 16439, 1900, 355, 327, 4851, 82, 547, 6768, 4635, 290, 973, 287, 19866, 1187, 11, 46059, 1187, 11, 290, 1540, 85, 658, 13, 1119, 547, 717, 15943, 355, 257, 3338, 5559, 284, 44957, 290, 45558, 333, 17556, 287, 19866, 341, 287, 262, 1903, 15533, 82, 13, 5334, 10095, 1943, 11, 2233, 284, 511, 3748, 290, 9775, 40336, 5931, 6608, 11, 40390, 281, 720, 23, 9374, 2831, 326, 9322, 10053, 11, 830, 661, 3264, 290, 373, 8978, 649, 23245, 286, 9138, 379, 262, 640, 286, 17958, 1437, 290, 11314, 1044, 338, 9412, 13, 1081, 327, 4851, 3227, 1509, 11978, 284, 1826, 262, 3298, 3512, 329, 41376, 349, 290, 19866, 341, 11, 523, 1165, 750, 262, 2650, 286, 777, 37170, 12, 10378, 293, 889, 16439, 656, 262, 8137, 13, 198, 198, 18521, 6588, 17556, 11, 327, 4851, 82, 389, 257, 3215, 5002, 287, 262, 8137, 13, 1649, 2716, 11, 327, 4851, 17745, 4485, 290, 3151, 262, 37170, 7679, 810, 484, 8791, 22033, 11881, 13, 383, 1913, 11881, 9457, 866, 777, 17745, 656, 511, 18599, 3354, 11, 749, 14660, 43107, 23235, 13, 17958, 1437, 290, 11314, 1044, 19169, 777, 783, 1479, 43107, 23235, 714, 6324, 290, 390, 6677, 262, 37170, 7679, 13, 383, 1294, 13272, 9985, 7732, 7746, 326, 530, 43107, 22037, 460, 4117, 1802, 11, 830, 37170, 17745, 13, 48516, 284, 4439, 327, 4851, 82, 379, 884, 1029, 2974, 561, 16857, 423, 34069, 517, 286, 262, 37170, 7679, 290, 561, 423, 2957, 284, 3744, 4419, 284, 5384, 422, 22033, 24823, 13, 7735, 3640, 1673, 12808, 351, 17958, 1437, 290, 11314, 1044, 338, 6373, 290, 11001, 9089, 286, 37170, 326, 561, 423, 9257, 3220, 2663, 286, 4168, 4890, 290, 4151, 2465, 13, 3819, 29417, 12751, 3017, 5322, 13714, 287, 6134, 290, 14450, 290, 4419, 284, 16050, 1204, 290, 1633, 3081, 13, 198, 198, 464, 6373, 29579, 3094, 12, 32319, 12737, 13, 13302, 727, 2945, 416, 262, 10066, 286, 262, 5985, 3701, 290, 5985, 5638, 25528, 287, 262, 1578, 1829, 11, 262, 3783, 290, 6142, 5348, 2227, 262, 1294, 1230, 284, 3958, 3227, 290, 779, 286, 327, 4851, 82, 13, 1119, 2497, 262, 42435, 286, 262, 37170, 7679, 355, 257, 12296, 11, 21161, 2372, 326, 2622, 284, 307, 1138, 351, 21112, 2223, 13, 383, 327, 4851, 2831, 11, 2957, 416, 10343, 48039, 11, 543, 17830, 329, 3016, 2026, 583, 1247, 286, 262, 1910, 11, 7384, 262, 4583, 355, 40530, 11, 11810, 326, 645, 25369, 2117, 15011, 37170, 2994, 550, 587, 6515, 13, 10343, 48039, 290, 584, 327, 4851, 11372, 40835, 20823, 284, 2948, 2585, 422, 6427, 9024, 19479, 327, 4851, 779, 13, 198, 198, 464, 705, 3820, 12, 2197, 12, 19796, 12, 448, 12, 36760, 6, 3164, 198, 198, 35660, 48039, 635, 36385, 319, 281, 8560, 1923, 284, 16637, 262, 2126, 326, 327, 4851, 82, 9694, 262, 37170, 7679, 11, 981, 11640, 11810, 326, 597, 289, 7833, 8733, 561, 423, 257, 20756, 2928, 319, 5692, 11, 3946, 290, 262, 3773, 13, 10343, 48039, 338, 8900, 11, 26101, 34034, 11, 3414, 284, 1811, 1688, 14741, 326, 366, 1169, 705, 3820, 12, 2197, 12, 19796, 12, 448, 12, 36760, 6, 3164, 14613, 2402, 281, 720, 23, 9374, 10618, 286, 2831, 11, 1111, 287, 262, 14408, 290, 287, 867, 10828, 11628, 11, 318, 257, 14851, 5182, 13, 7320, 274, 460, 307, 6572, 878, 5654, 6419, 389, 16030, 290, 16726, 3926, 383, 3277, 2314, 5368, 284, 719, 319, 428, 290, 584, 2428, 878, 262, 1336, 6419, 389, 1900, 526, 198 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Despite a warning from Governor Eric Holcomb not to have gatherings of more than 250 people, and despite all the warnings about the need to self-quarantine in order to protect the elderly, the New Life Christian Center in Indiana held a service Friday night to stick it to all those people who accept science. They urged people — especially sick people — to ignore the “raw, unmitigated stupidity” coming out of the CDC and visit the church. The plan was to “lay hands on the sick, and the sick shall recover.” In direct eye-rolling at our Indiana Governor’s requests, we have a GOAL to have AT LEAST 250 people here at church tomorrow night ! Good lord, ignorant Christians are going to exacerbate a pandemic because they’re too stubborn to listen to anyone who actually understands science… For what it’s worth, there’s video of Friday night’s service on Facebook and the place looks mostly empty: That’s a relief. Kind of. But the church leaders haven’t apologized, and no one should expect them to do so anytime soon, which means they may continue holding services for the foreseeable future. Capitulating to experts would be blasphemous for them. Some churches care for the sick. This one wants to create the sick. It’s dangerous, and they don’t care.
[ 8332, 257, 6509, 422, 10807, 7651, 6479, 24011, 407, 284, 423, 37134, 286, 517, 621, 8646, 661, 11, 290, 3805, 477, 262, 14601, 546, 262, 761, 284, 2116, 12, 421, 37996, 287, 1502, 284, 1805, 262, 13830, 11, 262, 968, 5155, 4302, 3337, 287, 10278, 2714, 257, 2139, 3217, 1755, 284, 4859, 340, 284, 477, 883, 661, 508, 2453, 3783, 13, 198, 198, 2990, 11643, 661, 851, 2592, 6639, 661, 851, 284, 8856, 262, 564, 250, 1831, 11, 555, 2781, 26963, 37775, 447, 251, 2406, 503, 286, 262, 20434, 290, 3187, 262, 4928, 13, 383, 1410, 373, 284, 564, 250, 10724, 2832, 319, 262, 6639, 11, 290, 262, 6639, 2236, 8551, 13, 447, 251, 198, 198, 818, 1277, 4151, 12, 18886, 379, 674, 10278, 10807, 447, 247, 82, 7007, 11, 356, 423, 257, 10351, 1847, 284, 423, 5161, 12509, 11262, 8646, 661, 994, 379, 4928, 9439, 1755, 5145, 198, 198, 10248, 15876, 11, 20109, 9316, 389, 1016, 284, 49522, 257, 19798, 5314, 780, 484, 447, 247, 260, 1165, 24444, 284, 6004, 284, 2687, 508, 1682, 14759, 3783, 1399, 198, 198, 1890, 644, 340, 447, 247, 82, 2861, 11, 612, 447, 247, 82, 2008, 286, 3217, 1755, 447, 247, 82, 2139, 319, 3203, 290, 262, 1295, 3073, 4632, 6565, 25, 198, 198, 2504, 447, 247, 82, 257, 8259, 13, 14927, 286, 13, 887, 262, 4928, 2766, 4398, 447, 247, 83, 22893, 11, 290, 645, 530, 815, 1607, 606, 284, 466, 523, 17949, 2582, 11, 543, 1724, 484, 743, 2555, 4769, 2594, 329, 262, 34922, 2003, 13, 4476, 270, 8306, 284, 6154, 561, 307, 30459, 4411, 516, 329, 606, 13, 198, 198, 4366, 14422, 1337, 329, 262, 6639, 13, 770, 530, 3382, 284, 2251, 262, 6639, 13, 632, 447, 247, 82, 4923, 11, 290, 484, 836, 447, 247, 83, 1337, 13, 628 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
I want to make roasted artichokes for a party tomorrow. Can I hold prepped artichokes (lemon water and oil) in the baking dish overnight? 2 Comments Well, I thought the better of that strategy and roasted them today. Half of them are vacuum sealed for future use and the other half will be served either at room temp or gently warmed! I was concerned about excessive oxidation.
[ 40, 765, 284, 787, 30490, 1242, 488, 3369, 329, 257, 2151, 9439, 13, 1680, 314, 1745, 662, 1496, 1242, 488, 3369, 357, 293, 2144, 1660, 290, 3056, 8, 287, 262, 16871, 9433, 13417, 30, 198, 198, 17, 19502, 198, 198, 5779, 11, 314, 1807, 262, 1365, 286, 326, 4811, 290, 30490, 606, 1909, 13, 13139, 286, 606, 389, 17076, 15283, 329, 2003, 779, 290, 262, 584, 2063, 481, 307, 4983, 2035, 379, 2119, 20218, 393, 15165, 38794, 0, 314, 373, 5213, 546, 13181, 37767, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
There is no denying the fact that night shift workers are fast losing on their health. Long and hectic work schedules lead to irregular appetites, rapid changes in weight and a high risk of gastro-intestinal […] After 60 years, authorities in the United States have approved a pill that will treat malaria. According to a report in BBC, the drug, tafenoquine is being described as a “phenomenal achievement” and will treat the recurring […] Compounds in green tea and in red wine may help block the formation of toxic molecules that cause severe developmental and mental disorders, and may help treat certain inborn congenital metabolic diseases, a study has […] Carbohydrates have become the ‘culprits’ for many healthy eaters recently. Despite their less stellar stature in the nutrition department, carbs aren’t actually the enemies for your body. They are responsible for providing you with energy, […] Does the surgical removal of tonsils and adenoids in young children have long-term health implications? Researchers in a new study say the removal may increase the risk of certain ailments, but other experts aren’t so […]
[ 1858, 318, 645, 17086, 262, 1109, 326, 1755, 6482, 3259, 389, 3049, 6078, 319, 511, 1535, 13, 5882, 290, 339, 11048, 670, 24025, 1085, 284, 21388, 16422, 2737, 11, 5801, 2458, 287, 3463, 290, 257, 1029, 2526, 286, 33131, 12, 36387, 23834, 198, 198, 3260, 3126, 812, 11, 4773, 287, 262, 1578, 1829, 423, 6325, 257, 9582, 326, 481, 2190, 33917, 13, 4784, 284, 257, 989, 287, 7823, 11, 262, 2563, 11, 256, 1878, 268, 22696, 500, 318, 852, 3417, 355, 257, 564, 250, 31024, 3674, 282, 13293, 447, 251, 290, 481, 2190, 262, 24824, 23834, 198, 198, 7293, 3733, 287, 4077, 8887, 290, 287, 2266, 8237, 743, 1037, 2512, 262, 9978, 286, 11422, 17745, 326, 2728, 6049, 23456, 290, 5110, 11916, 11, 290, 743, 1037, 2190, 1728, 287, 6286, 41174, 1287, 19737, 10040, 11, 257, 2050, 468, 23834, 198, 198, 9914, 65, 15782, 9700, 423, 1716, 262, 564, 246, 3129, 79, 799, 82, 447, 247, 329, 867, 5448, 4483, 364, 2904, 13, 7945, 511, 1342, 25041, 32600, 287, 262, 16633, 5011, 11, 33037, 3588, 447, 247, 83, 1682, 262, 5775, 329, 534, 1767, 13, 1119, 389, 4497, 329, 4955, 345, 351, 2568, 11, 23834, 198, 198, 13921, 262, 21998, 9934, 286, 10860, 4487, 290, 512, 268, 10994, 287, 1862, 1751, 423, 890, 12, 4354, 1535, 10939, 30, 26685, 287, 257, 649, 2050, 910, 262, 9934, 743, 2620, 262, 2526, 286, 1728, 42549, 11, 475, 584, 6154, 3588, 447, 247, 83, 523, 23834 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
New Garden Website Design Woodside Garden is a walled garden near Jedburgh in the Scottish Borders. It has a plant centre, an award winning coffee shop and runs a series of events throughout the year. We were delighted when we secured the Woodside Garden website design contract. Stephen and Emma Emmerson inherited their website when they bought the business back in 2010. Over the years they had “made do” with it, but it no longer met their needs: it was not mobile-friendly and it was difficult to add events and highlight blogs on the front page. There has also been a recent re-brand and the existing site could not be updated easily to incorporate the new logo and colour scheme. Emma was confident that Red Kite Services could deliver a website that she wanted as we have a good knowledge of plants and wildlife. We have also worked on updating the website for Stillingfleet Lodge Gardens for many years, showing further experience in the sector. Website Review We started the re-build process by reviewing the existing site and agreeing the content and images that would be retained. We streamlined the number of pages and reviewed the categories on the site. We set up a development site where we could design the outline using our favourite template. We used the new colours from the logo throughout the site and used categories to place appropriate blogs onto the static pages. Emma did not want us to use sliders, but did send us some stunning images to use. She wanted a nice clean site but with a flowery touch, which we achieved by adding curved frames to the images. Events She also wanted to easily add events, so we used a simple plug in. This makes it easy to add events and the next few events are highlighted in the sidebar. We have also categorised events so that if you look on the Wee Woodsiders page you can see a full list of child-friendly events. We are still in the free “snagging” stage which we offer on all our website builds, so we are still working with Emma to develop the site now it has gone live. Contact Us About Red Kite Services Red Kite Services is a family run business owned by Peter and Samantha Lyth. We believe in supporting independent, local companies and our aim with RKS is to provide cost-effective support to help local small businesses to thrive. Sam set up the business in 2010 after seeing that many small business owners know what they need to do in terms of administration and marketing, but don't have enough time to do it. Peter joined the business in 2015, which has allowed us to offer a broader range of services. Between us we have experience in Financial Services, health and science sector and retail. Testimonials I contacted Red Kite because I have been unable to update my website for a few years now. The site was built for me over five years ago and I just wanted to be able to update the price list regularly and alter treatments. I had already been in touch with other companies about updating Continue Reading
[ 3791, 11652, 15887, 8495, 198, 198, 22911, 1589, 11652, 318, 257, 3355, 276, 11376, 1474, 39952, 9228, 287, 262, 11905, 40934, 13, 632, 468, 257, 4618, 7372, 11, 281, 5764, 5442, 6891, 6128, 290, 4539, 257, 2168, 286, 2995, 3690, 262, 614, 13, 775, 547, 20707, 618, 356, 13659, 262, 5326, 1589, 11652, 3052, 1486, 2775, 13, 198, 198, 24920, 290, 18966, 2295, 76, 882, 19552, 511, 3052, 618, 484, 5839, 262, 1597, 736, 287, 3050, 13, 3827, 262, 812, 484, 550, 564, 250, 9727, 466, 447, 251, 351, 340, 11, 475, 340, 645, 2392, 1138, 511, 2476, 25, 340, 373, 407, 5175, 12, 13120, 290, 340, 373, 2408, 284, 751, 2995, 290, 7238, 19118, 319, 262, 2166, 2443, 13, 1318, 468, 635, 587, 257, 2274, 302, 12, 17938, 290, 262, 4683, 2524, 714, 407, 307, 6153, 3538, 284, 19330, 262, 649, 11112, 290, 9568, 7791, 13, 198, 198, 10161, 2611, 373, 6563, 326, 2297, 509, 578, 6168, 714, 5203, 257, 3052, 326, 673, 2227, 355, 356, 423, 257, 922, 3725, 286, 6134, 290, 15599, 13, 775, 423, 635, 3111, 319, 19698, 262, 3052, 329, 520, 4509, 33559, 27046, 29330, 329, 867, 812, 11, 4478, 2252, 1998, 287, 262, 6567, 13, 198, 198, 33420, 6602, 198, 198, 1135, 2067, 262, 302, 12, 11249, 1429, 416, 17217, 262, 4683, 2524, 290, 24093, 262, 2695, 290, 4263, 326, 561, 307, 17383, 13, 775, 39673, 262, 1271, 286, 5468, 290, 11765, 262, 9376, 319, 262, 2524, 13, 198, 198, 1135, 900, 510, 257, 2478, 2524, 810, 356, 714, 1486, 262, 19001, 1262, 674, 12507, 11055, 13, 775, 973, 262, 649, 18915, 422, 262, 11112, 3690, 262, 2524, 290, 973, 9376, 284, 1295, 5035, 19118, 4291, 262, 9037, 5468, 13, 18966, 750, 407, 765, 514, 284, 779, 1017, 4157, 11, 475, 750, 3758, 514, 617, 13393, 4263, 284, 779, 13, 1375, 2227, 257, 3621, 3424, 2524, 475, 351, 257, 15061, 88, 3638, 11, 543, 356, 8793, 416, 4375, 26929, 13431, 284, 262, 4263, 13, 198, 198, 37103, 198, 198, 3347, 635, 2227, 284, 3538, 751, 2995, 11, 523, 356, 973, 257, 2829, 6107, 287, 13, 770, 1838, 340, 2562, 284, 751, 2995, 290, 262, 1306, 1178, 2995, 389, 14537, 287, 262, 40217, 13, 775, 423, 635, 17851, 1417, 2995, 523, 326, 611, 345, 804, 319, 262, 48643, 16483, 4157, 2443, 345, 460, 766, 257, 1336, 1351, 286, 1200, 12, 13120, 2995, 13, 198, 198, 1135, 389, 991, 287, 262, 1479, 564, 250, 16184, 16406, 447, 251, 3800, 543, 356, 2897, 319, 477, 674, 3052, 12188, 11, 523, 356, 389, 991, 1762, 351, 18966, 284, 1205, 262, 2524, 783, 340, 468, 3750, 2107, 13, 198, 198, 17829, 4021, 198, 198, 8585, 2297, 509, 578, 6168, 198, 198, 7738, 509, 578, 6168, 318, 257, 1641, 1057, 1597, 6898, 416, 5613, 290, 34778, 406, 5272, 13, 775, 1975, 287, 6493, 4795, 11, 1957, 2706, 290, 674, 4031, 351, 371, 27015, 318, 284, 2148, 1575, 12, 16803, 1104, 284, 1037, 1957, 1402, 5692, 284, 22191, 13, 198, 198, 16305, 900, 510, 262, 1597, 287, 3050, 706, 4379, 326, 867, 1402, 1597, 4393, 760, 644, 484, 761, 284, 466, 287, 2846, 286, 3662, 290, 7124, 11, 475, 836, 470, 423, 1576, 640, 284, 466, 340, 13, 5613, 5399, 262, 1597, 287, 1853, 11, 543, 468, 3142, 514, 284, 2897, 257, 11622, 2837, 286, 2594, 13, 198, 198, 25262, 514, 356, 423, 1998, 287, 11302, 6168, 11, 1535, 290, 3783, 6567, 290, 6308, 13, 198, 198, 14402, 20473, 8231, 198, 198, 40, 11237, 2297, 509, 578, 780, 314, 423, 587, 5906, 284, 4296, 616, 3052, 329, 257, 1178, 812, 783, 13, 383, 2524, 373, 3170, 329, 502, 625, 1936, 812, 2084, 290, 314, 655, 2227, 284, 307, 1498, 284, 4296, 262, 2756, 1351, 7987, 290, 8343, 13820, 13, 314, 550, 1541, 587, 287, 3638, 351, 584, 2706, 546, 19698, 10054, 11725 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
DataverseUse test Set import-private-functions=true Query: Let Variable [ Name=$txt ] := LiteralExpr [STRING] [Hello World, I would like to inform you of the importance of Foo Bar. Yes, Foo Bar. Jürgen.] Let Variable [ Name=$tokens ] := FunctionCall asterix.hashed-word-tokens@1[ Variable [ Name=$txt ] ] SELECT ELEMENT [ Variable [ Name=$token ] ] FROM [ Variable [ Name=$tokens ] AS Variable [ Name=$token ] ]
[ 6601, 4399, 11041, 1332, 198, 7248, 1330, 12, 19734, 12, 12543, 2733, 28, 7942, 198, 20746, 25, 198, 5756, 35748, 685, 6530, 43641, 14116, 2361, 198, 220, 19039, 198, 220, 25659, 1691, 3109, 1050, 685, 18601, 2751, 60, 685, 15496, 2159, 11, 314, 561, 588, 284, 4175, 345, 286, 262, 6817, 286, 36080, 2409, 13, 3363, 11, 36080, 2409, 13, 449, 25151, 5235, 8183, 198, 5756, 35748, 685, 6530, 43641, 83, 482, 641, 2361, 198, 220, 19039, 198, 220, 15553, 14134, 18503, 844, 13, 71, 5263, 12, 4775, 12, 83, 482, 641, 31, 16, 58, 198, 220, 220, 220, 35748, 685, 6530, 43641, 14116, 2361, 198, 220, 2361, 198, 46506, 40342, 10979, 685, 198, 43015, 685, 6530, 43641, 30001, 2361, 198, 60, 198, 10913, 2662, 685, 220, 35748, 685, 6530, 43641, 83, 482, 641, 2361, 198, 220, 7054, 35748, 685, 6530, 43641, 30001, 2361, 198, 60, 198 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
“I can’t express how extremely pleased we are with Jenny and her work! We had tons of questions which she quickly, thoroughly and happily answered. She walked us through the process and asked our opinion while also providing her own input along the way. She sent pictures once printed and even sent us the original water color of the map that she created for us. I would — and certainly will — recommend her to all friends and family moving forward!” “I don’t think I have one bad thing to say about this purchase. The seller was extremely accommodating, wonderful to work with, and made this experience such a joy. Our invitations, RSVP postcards and reception cards are perfect. The coloring, font, and design look beautiful in person. We also chose colored envelopes and return address printing, which I think turned out amazing. Jenny had incredible suggestions and made the entire process so smooth. If you’re on the fence about who to work with or where to go for invitations, stop looking! You’ve found it!”
[ 126, 241, 40, 460, 447, 247, 83, 4911, 703, 4457, 10607, 356, 389, 351, 28437, 290, 607, 670, 0, 775, 550, 10860, 286, 2683, 543, 673, 2952, 11, 13770, 290, 18177, 9373, 13, 1375, 6807, 514, 832, 262, 1429, 290, 1965, 674, 4459, 981, 635, 4955, 607, 898, 5128, 1863, 262, 835, 13, 1375, 1908, 5986, 1752, 10398, 290, 772, 1908, 514, 262, 2656, 1660, 3124, 286, 262, 3975, 326, 673, 2727, 329, 514, 13, 314, 561, 851, 290, 3729, 481, 851, 4313, 607, 284, 477, 2460, 290, 1641, 3867, 2651, 0, 126, 242, 198, 198, 126, 241, 40, 836, 447, 247, 83, 892, 314, 423, 530, 2089, 1517, 284, 910, 546, 428, 5001, 13, 383, 18583, 373, 4457, 49389, 11, 7932, 284, 670, 351, 11, 290, 925, 428, 1998, 884, 257, 8716, 13, 3954, 42851, 11, 19340, 8859, 1281, 27761, 290, 16307, 4116, 389, 2818, 13, 383, 33988, 11, 10369, 11, 290, 1486, 804, 4950, 287, 1048, 13, 775, 635, 7690, 16396, 16441, 274, 290, 1441, 2209, 13570, 11, 543, 314, 892, 2900, 503, 4998, 13, 28437, 550, 8082, 11776, 290, 925, 262, 2104, 1429, 523, 7209, 13, 1002, 345, 447, 247, 260, 319, 262, 13990, 546, 508, 284, 670, 351, 393, 810, 284, 467, 329, 42851, 11, 2245, 2045, 0, 921, 447, 247, 303, 1043, 340, 0, 126, 242 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Press New Wellesley Business Wants To Teach The World To Sew! Lauren Johnston is doing her part to ensure sewing doesn’t become a lost art. Sew Easy, a business she started 15 years ago in Needham to teach kids and teens how to sew, expanded this summer into a second floor space in Wellesley at 159 Linden St. 3C. Sew easy, which begins its next 8-week session in Wellesley on Sept. 17, has taught more than 9,000 girls and boys to sew over the years. Students range in age from 5.5 to about 16, and classes are held after school and on Saturdays. Sew Easy charges about $325 per session, which includes materials. The Wellesley location has 12 sewing machines. “I want to teach the world to sew,” says Johnston, whose programs mainly involve using sewing machines, though also include hand sewing. She says that she thinks sewing is coming back, even though most kids’ parents don’t sew and even though sewing classes are rare in school these days. “They’ve seen grandparents sewing,” she says. At Sew Easy, kids learn how to sew buttonholes, zippers, pockets and hems as well as how to thread the sewing machines. They get to use a variety of fabrics, including cotton and fleece. Students complete between 5 and 10 projects per session, creating clothes, bags and even American Doll outfits. While Sew Easy’s two locations are just a few miles far apart, Johnston says she appreciates that the closer the better for parents shuttling their children from activity to activity after school. She said parents of kids who have taken classes at the Needham spot have been begging her to open a place in Wellesley. It would be a stretch to call Wellesley the sewing capital of the world, but there is maybe more needle-and-thread action around here than you might think. For example, there’s the Button Box shop on Rte. 9 that caters to quilters, the Wellesley Needlepoint Collection on Grove Street, and local artist Abby Glassenberg has made a name for herself via the soft sculptures she sews. Classes start at 3:15 p.m., but children’s noses press up against the glass of the Needham storefront long before the door is unlocked. Here, six days a week, the nearly lost art of sewing is revered and creativity is unleashed. By Bob Brown | THE SWELLESLEY REPORT Enriching Fabric of Their Lives Lauren Johnston says she has taught over 8,000 students since launching Sew Easy 13 years ago. Last week she opened a second branch in West Roxbury, where she hopes to further disseminate an old-fashioned skill that is still indispensable in this high-tech age. “In an instant, children feel empowered,” said Johnston, whose students, male and female, range in age from elementary through high school. “They choose the project that they want to work on and the fabrics that they want to use, and are excited and proud about expressing their creativity.” Johnston has over 300 projects for her students to choose from – book bags, fleece vests, ponchos, mittens, quilts, American Girl Doll accessories, pajama pants. Some use their time to alter clothing, and during the holiday season they tend to make gifts. Each time someone finishes a project, they ring a large bell and the class goes silent in order to see what has been completed and give the student a round of applause. Johnston then encourages them to place their project in the storefront window “to show the world what they’ve made.” Some projects are basic, like small decorative pillows, and others are more elaborate. One girl, she said, walked in with a sketch of a lobster costume and made it for Halloween. An eight-week session of one class a week costs $299, which includes all materials. On average, classes are capped at 18 students. With 15 sewing machines, no one has to wait to use one, since not every student needs a machine all the time. “They help each other out and really feel like they’re a part of this place,” she said. Johnston said parents often tell her that their child is creating things using tape and staples to hold the fabric together. Those kids, she said, are really ready to learn. But it’s not just the creative and technical aspects of teaching that bring Johnston satisfaction, it’s also observing the emotional growth of her students. “There is no gossip allowed in here,” said Johnston. “I tell the kids ‘I’d rather hear about you.’ ” Sometimes during a snack break, she will throw out questions for discussion, such as “What is something positive that we would never guess about you?” or “What are some experiences that you would like to have but aren’t yet old enough?” And on occasion she will read aloud an inspirational thought for the day. “They laugh, but then they quiet down and listen,” said Johnston, who hopes that insightful, introspective words will encourage self-awareness and confidence. By Susan Chaityn Lebovits | THE BOSTON GLOBE Sew Easy opens new location in Wellesley Lauren Johnston, owner and founder of Sew Easy, has been teaching children how to sew since 1995. She said she’s taught the “dying art” to more than 9,000 kids and teens in the past 15 years. Johnston recently expanded her operation to Wellesley. The Townsman caught up with Johnston at the new location, 159 Linden St., to ask her about her business and why so many children still want to learn to sew. “I always loved sewing,” Johnston said. “So my children always wanted to get at the machine. I saw that it was easy to teach them and then their friends started joining and the masses came.” What prompted your expansion to Wellesley? “Wellesley wanted us to come and so I said, ‘Why not?’” Johnston said. “Wellesley asked us over and over to come here.” Why do you think kids and teens want to sew when they could just buy everything they needed? “It’s not about being able to buy it,” Johnston said. “When you create something you feel empowered. Most of the last generation doesn’t know how to sew so kids feel empowered because their parents don’t know how to sew.” What kind of items do the students sew? “We have over 300 projects,” Johnston said. She said that students make everything from clothing to American Girl Doll accessories and even, sometimes, dog clothing. Do any boys come to these classes? “I usually have one or two in a class,” she said. Classes range in size from 12 to 20. Where did you learn to sew? “[I learned from] my grandma and Home Ec in junior high.” Is that where the passion began? “Yes, it felt so good to complete a project from scratch and I couldn’t believe I made it myself. The stuff I made when I was young was so elaborate,” Johnston said. “I really loved it.” What would you say to a kid who said sewing is boring? “I’ve never heard that once from the 9,000 kids I’ve taught,” Johnston said. “So I don’t think I have to answer that.” “It’s word of mouth,” she added. “It’s the kids that do all the advertising. I’m always full despite the bad economy.” How do you stay current? “We know what kids like,” Johnston said. “After 15 years and 9,000 kids, we know. I have to buy fabric with peace signs, turtles, polka dots and monkeys.” What do you love about teaching? ‘I love to teach,” Johnston said, “and the some of the kids come in nervous, but within an hour and a half they don’t want to leave. “I love to see the shift in kids to when they start feeling empowered. I get to witness the shift from knowing nothing to feeling like they know a lot in a short amount of time – it’s instant. “I ask them, ‘do you feel like a good sewer?’ and they say ‘yes.’” “Our mission is to instill confidence and creativity. And we feel every child needs to feel success. We want them to walk away with that feeling and completing a project makes them feel that way.” Johnston said it’s her particular system that helps her students find this success. “The system is the reason why we are successful,” Johnston said. “It allows kids to create quicker. The way we design our things more streamlined. The detail is not like yesteryears.” “The kids that come in with learning disabilities,” Johnston said, “in 99 percent of them I don’t find what they’ve been diagnosed with here. And I’m looking for it, but I never find it. They just take it in and grasp it.”
[ 13800, 198, 198, 3791, 3894, 49048, 7320, 370, 1187, 1675, 42015, 383, 2159, 1675, 27347, 0, 198, 198, 14772, 23532, 28972, 318, 1804, 607, 636, 284, 4155, 35356, 1595, 447, 247, 83, 1716, 257, 2626, 1242, 13, 198, 198, 50, 413, 16789, 11, 257, 1597, 673, 2067, 1315, 812, 2084, 287, 10664, 2763, 284, 4545, 3988, 290, 15508, 703, 284, 34249, 11, 9902, 428, 3931, 656, 257, 1218, 4314, 2272, 287, 3894, 49048, 379, 26422, 9329, 268, 520, 13, 513, 34, 13, 198, 198, 50, 413, 2562, 11, 543, 6140, 663, 1306, 807, 12, 10464, 6246, 287, 3894, 49048, 319, 2362, 13, 1596, 11, 468, 7817, 517, 621, 860, 11, 830, 4813, 290, 6510, 284, 34249, 625, 262, 812, 13, 14882, 2837, 287, 2479, 422, 642, 13, 20, 284, 546, 1467, 11, 290, 6097, 389, 2714, 706, 1524, 290, 319, 41703, 13, 27347, 16789, 4530, 546, 720, 26582, 583, 6246, 11, 543, 3407, 5696, 13, 383, 3894, 49048, 4067, 468, 1105, 35356, 8217, 13, 198, 198, 447, 250, 40, 765, 284, 4545, 262, 995, 284, 34249, 11, 447, 251, 1139, 28972, 11, 3025, 4056, 8384, 6211, 1262, 35356, 8217, 11, 996, 635, 2291, 1021, 35356, 13, 1375, 1139, 326, 673, 6834, 35356, 318, 2406, 736, 11, 772, 996, 749, 3988, 447, 247, 3397, 836, 447, 247, 83, 34249, 290, 772, 996, 35356, 6097, 389, 4071, 287, 1524, 777, 1528, 13, 564, 250, 2990, 447, 247, 303, 1775, 28571, 35356, 11, 447, 251, 673, 1139, 13, 198, 198, 2953, 27347, 16789, 11, 3988, 2193, 703, 284, 34249, 4936, 28439, 11, 1976, 16415, 11, 16511, 290, 339, 907, 355, 880, 355, 703, 284, 4704, 262, 35356, 8217, 13, 1119, 651, 284, 779, 257, 4996, 286, 39533, 11, 1390, 15985, 290, 11562, 344, 13, 14882, 1844, 1022, 642, 290, 838, 4493, 583, 6246, 11, 4441, 8242, 11, 11668, 290, 772, 1605, 22209, 27655, 13, 198, 198, 3633, 27347, 16789, 447, 247, 82, 734, 7064, 389, 655, 257, 1178, 4608, 1290, 5475, 11, 28972, 1139, 673, 5763, 689, 326, 262, 5699, 262, 1365, 329, 3397, 4423, 83, 1359, 511, 1751, 422, 3842, 284, 3842, 706, 1524, 13, 1375, 531, 3397, 286, 3988, 508, 423, 2077, 6097, 379, 262, 10664, 2763, 4136, 423, 587, 26732, 607, 284, 1280, 257, 1295, 287, 3894, 49048, 13, 198, 198, 1026, 561, 307, 257, 7539, 284, 869, 3894, 49048, 262, 35356, 3139, 286, 262, 995, 11, 475, 612, 318, 3863, 517, 17598, 12, 392, 12, 16663, 2223, 1088, 994, 621, 345, 1244, 892, 13, 1114, 1672, 11, 612, 447, 247, 82, 262, 20969, 8315, 6128, 319, 371, 660, 13, 860, 326, 3797, 364, 284, 627, 346, 1010, 11, 262, 3894, 49048, 10664, 293, 4122, 12251, 319, 24144, 3530, 11, 290, 1957, 6802, 49220, 12158, 23140, 468, 925, 257, 1438, 329, 5223, 2884, 262, 2705, 42645, 673, 384, 18504, 13, 198, 198, 9487, 274, 923, 379, 513, 25, 1314, 279, 13, 76, 1539, 475, 1751, 447, 247, 82, 41760, 1803, 510, 1028, 262, 5405, 286, 262, 10664, 2763, 45527, 890, 878, 262, 3420, 318, 14838, 13, 3423, 11, 2237, 1528, 257, 1285, 11, 262, 3016, 2626, 1242, 286, 35356, 318, 37184, 290, 16389, 318, 28136, 13, 198, 198, 3886, 5811, 4373, 930, 3336, 311, 8845, 3069, 1546, 25173, 39099, 198, 198, 4834, 7527, 278, 37759, 286, 5334, 18965, 198, 198, 14772, 23532, 28972, 1139, 673, 468, 7817, 625, 807, 11, 830, 2444, 1201, 13925, 27347, 16789, 1511, 812, 2084, 13, 4586, 1285, 673, 4721, 257, 1218, 8478, 287, 2688, 34821, 10711, 11, 810, 673, 7176, 284, 2252, 30548, 378, 281, 1468, 12, 28776, 5032, 326, 318, 991, 35669, 287, 428, 1029, 12, 13670, 2479, 13, 198, 198, 447, 250, 818, 281, 9113, 11, 1751, 1254, 29669, 11, 447, 251, 531, 28972, 11, 3025, 2444, 11, 4257, 290, 4048, 11, 2837, 287, 2479, 422, 19823, 832, 1029, 1524, 13, 564, 250, 2990, 3853, 262, 1628, 326, 484, 765, 284, 670, 319, 290, 262, 39533, 326, 484, 765, 284, 779, 11, 290, 389, 6568, 290, 6613, 546, 16621, 511, 16389, 13, 447, 251, 198, 198, 7554, 3743, 468, 625, 5867, 4493, 329, 607, 2444, 284, 3853, 422, 784, 1492, 11668, 11, 11562, 344, 410, 3558, 11, 279, 261, 354, 418, 11, 285, 34978, 11, 627, 50076, 11, 1605, 7430, 22209, 18199, 11, 279, 1228, 1689, 12581, 13, 2773, 779, 511, 640, 284, 8343, 9528, 11, 290, 1141, 262, 9912, 1622, 484, 4327, 284, 787, 13201, 13, 198, 198, 10871, 640, 2130, 20271, 257, 1628, 11, 484, 5858, 257, 1588, 8966, 290, 262, 1398, 2925, 10574, 287, 1502, 284, 766, 644, 468, 587, 5668, 290, 1577, 262, 3710, 257, 2835, 286, 28445, 13, 28972, 788, 18656, 606, 284, 1295, 511, 1628, 287, 262, 45527, 4324, 564, 250, 1462, 905, 262, 995, 644, 484, 447, 247, 303, 925, 13, 447, 251, 198, 198, 4366, 4493, 389, 4096, 11, 588, 1402, 39798, 9582, 1666, 11, 290, 1854, 389, 517, 15962, 13, 1881, 2576, 11, 673, 531, 11, 6807, 287, 351, 257, 17548, 286, 257, 43657, 16569, 290, 925, 340, 329, 16032, 13, 198, 198, 2025, 3624, 12, 10464, 6246, 286, 530, 1398, 257, 1285, 3484, 720, 22579, 11, 543, 3407, 477, 5696, 13, 1550, 2811, 11, 6097, 389, 28490, 379, 1248, 2444, 13, 2080, 1315, 35356, 8217, 11, 645, 530, 468, 284, 4043, 284, 779, 530, 11, 1201, 407, 790, 3710, 2476, 257, 4572, 477, 262, 640, 13, 564, 250, 2990, 1037, 1123, 584, 503, 290, 1107, 1254, 588, 484, 447, 247, 260, 257, 636, 286, 428, 1295, 11, 447, 251, 673, 531, 13, 198, 198, 7554, 3743, 531, 3397, 1690, 1560, 607, 326, 511, 1200, 318, 4441, 1243, 1262, 9154, 290, 46413, 284, 1745, 262, 9664, 1978, 13, 5845, 3988, 11, 673, 531, 11, 389, 1107, 3492, 284, 2193, 13, 887, 340, 447, 247, 82, 407, 655, 262, 7325, 290, 6276, 7612, 286, 7743, 326, 2222, 28972, 14676, 11, 340, 447, 247, 82, 635, 21769, 262, 7016, 3349, 286, 607, 2444, 13, 198, 198, 447, 250, 1858, 318, 645, 30914, 3142, 287, 994, 11, 447, 251, 531, 28972, 13, 564, 250, 40, 1560, 262, 3988, 564, 246, 40, 447, 247, 67, 2138, 3285, 546, 345, 13, 447, 247 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
<?xml version="1.0" ?> <component id="root" name="root"> <component id="system" name="system"> <!--McPAT will skip the components if number is set to 0 --> <param name="number_of_cores" value="64"/> <param name="number_of_L1Directories" value="0"/> <param name="number_of_L2Directories" value="0"/> <param name="number_of_L2s" value="64"/> <!-- This number means how many L2 clusters in each cluster there can be multiple banks/ports --> <param name="number_of_L3s" value="0"/> <!-- This number means how many L3 clusters --> <param name="number_of_NoCs" value="1"/> <param name="homogeneous_cores" value="1"/><!--1 means homo --> <param name="homogeneous_L2s" value="1"/> <param name="homogeneous_L1Directorys" value="1"/> <param name="homogeneous_L2Directorys" value="1"/> <param name="homogeneous_L3s" value="1"/> <param name="homogeneous_ccs" value="1"/><!--cache coherece hardware --> <param name="homogeneous_NoCs" value="1"/> <param name="core_tech_node" value="22"/><!-- nm --> <param name="target_core_clockrate" value="3500"/><!--MHz --> <param name="temperature" value="360"/> <!-- Kelvin --> <param name="number_cache_levels" value="2"/> <param name="interconnect_projection_type" value="0"/><!--0: agressive wire technology; 1: conservative wire technology --> <param name="device_type" value="0"/><!--0: HP(High Performance Type); 1: LSTP(Low standby power) 2: LOP (Low Operating Power) --> <param name="longer_channel_device" value="1"/><!-- 0 no use; 1 use when possible --> <param name="machine_bits" value="64"/> <param name="virtual_address_width" value="64"/> <param name="physical_address_width" value="52"/> <param name="virtual_memory_page_size" value="4096"/> <stat name="total_cycles" value="100000"/> <stat name="idle_cycles" value="0"/> <stat name="busy_cycles" value="100000"/> <!--This page size(B) is complete different from the page size in Main memo secction. this page size is the size of virtual memory from OS/Archi perspective; the page size in Main memo secction is the actuall physical line in a DRAM bank --> <!-- *********************** cores ******************* --> <component id="system.core0" name="core0"> <!-- Core property --> <param name="clock_rate" value="3500"/> <param name="instruction_length" value="32"/> <param name="opcode_width" value="9"/> <!-- address width determins the tag_width in Cache, LSQ and buffers in cache controller default value is machine_bits, if not set --> <param name="machine_type" value="1"/><!-- 1 inorder; 0 OOO--> <!-- inorder/OoO --> <param name="number_hardware_threads" value="4"/> <!-- number_instruction_fetch_ports(icache ports) is always 1 in single-thread processor, it only may be more than one in SMT processors. BTB ports always equals to fetch ports since branch information in consective branch instructions in the same fetch group can be read out from BTB once.--> <param name="fetch_width" value="1"/> <!-- fetch_width determins the size of cachelines of L1 cache block --> <param name="number_instruction_fetch_ports" value="1"/> <param name="decode_width" value="1"/> <!-- decode_width determins the number of ports of the renaming table (both RAM and CAM) scheme --> <param name="issue_width" value="1"/> <!-- issue_width determins the number of ports of Issue window and other logic as in the complexity effective proccessors paper; issue_width==dispatch_width --> <param name="commit_width" value="1"/> <!-- commit_width determins the number of ports of register files --> <param name="fp_issue_width" value="1"/> <param name="prediction_width" value="0"/> <!-- number of branch instructions can be predicted simultannouesl--> <!-- Current version of McPAT does not distinguish int and floating point pipelines Theses parameters are reserved for future use.--> <param name="pipelines_per_core" value="1,1"/> <!--integer_pipeline and floating_pipelines, if the floating_pipelines is 0, then the pipeline is shared--> <param name="pipeline_depth" value="6,6"/> <!-- pipeline depth of int and fp, if pipeline is shared, the second number is the average cycles of fp ops --> <!-- issue and exe unit--> <param name="ALU_per_core" value="1"/> <!-- contains an adder, a shifter, and a logical unit --> <param name="MUL_per_core" value="1"/> <!-- For MUL and Div --> <param name="FPU_per_core" value="0.125"/> <!-- buffer between IF and ID stage --> <param name="instruction_buffer_size" value="16"/> <!-- buffer between ID and sche/exe stage --> <param name="decoded_stream_buffer_size" value="16"/> <param name="instruction_window_scheme" value="0"/><!-- 0 PHYREG based, 1 RSBASED--> <!-- McPAT support 2 types of OoO cores, RS based and physical reg based--> <param name="instruction_window_size" value="16"/> <param name="fp_instruction_window_size" value="16"/> <!-- the instruction issue Q as in Alpha 21264; The RS as in Intel P6 --> <param name="ROB_size" value="80"/> <!-- each in-flight instruction has an entry in ROB --> <!-- registers --> <param name="archi_Regs_IRF_size" value="32"/> <param name="archi_Regs_FRF_size" value="32"/> <!-- if OoO processor, phy_reg number is needed for renaming logic, renaming logic is for both integer and floating point insts. --> <param name="phy_Regs_IRF_size" value="80"/> <param name="phy_Regs_FRF_size" value="80"/> <!-- rename logic --> <param name="rename_scheme" value="0"/> <!-- can be RAM based(0) or CAM based(1) rename scheme RAM-based scheme will have free list, status table; CAM-based scheme have the valid bit in the data field of the CAM both RAM and CAM need RAM-based checkpoint table, checkpoint_depth=# of in_flight instructions; Detailed RAT Implementation see TR --> <param name="register_windows_size" value="8"/> <!-- how many windows in the windowed register file, sun processors; no register windowing is used when this number is 0 --> <!-- In OoO cores, loads and stores can be issued whether inorder(Pentium Pro) or (OoO)out-of-order(Alpha), They will always try to exeute out-of-order though. --> <param name="LSU_order" value="inorder"/> <param name="store_buffer_size" value="32"/> <!-- By default, in-order cores do not have load buffers --> <param name="load_buffer_size" value="32"/> <!-- number of ports refer to sustainable concurrent memory accesses --> <param name="memory_ports" value="1"/> <!-- max_allowed_in_flight_memo_instructions determins the # of ports of load and store buffer as well as the ports of Dcache which is connected to LSU --> <!-- dual-pumped Dcache can be used to save the extra read/write ports --> <param name="RAS_size" value="32"/> <!-- general stats, defines simulation periods;require total, idle, and busy cycles for senity check --> <!-- please note: if target architecture is X86, then all the instrucions refer to (fused) micro-ops --> <stat name="total_instructions" value="800000"/> <stat name="int_instructions" value="600000"/> <stat name="fp_instructions" value="20000"/> <stat name="branch_instructions" value="0"/> <stat name="branch_mispredictions" value="0"/> <stat name="load_instructions" value="100000"/> <stat name="store_instructions" value="100000"/> <stat name="committed_instructions" value="800000"/> <stat name="committed_int_instructions" value="600000"/> <stat name="committed_fp_instructions" value="20000"/> <stat name="pipeline_duty_cycle" value="0.6"/><!--<=1, runtime_ipc/peak_ipc; averaged for all cores if homogenous --> <!-- the following cycle stats are used for heterogeneouse cores only, please ignore them if homogeneouse cores --> <stat name="total_cycles" value="100000"/> <stat name="idle_cycles" value="0"/> <stat name="busy_cycles" value="100000"/> <!-- instruction buffer stats --> <!-- ROB stats, both RS and Phy based OoOs have ROB performance simulator should capture the difference on accesses, otherwise, McPAT has to guess based on number of commited instructions. --> <stat name="ROB_reads" value="263886"/> <stat name="ROB_writes" value="263886"/> <!-- RAT accesses --> <stat name="rename_accesses" value="263886"/> <stat name="fp_rename_accesses" value="263886"/> <!-- decode and rename stage use this, should be total ic - nop --> <!-- Inst window stats --> <stat name="inst_window_reads" value="263886"/> <stat name="inst_window_writes" value="263886"/> <stat name="inst_window_wakeup_accesses" value="263886"/> <stat name="fp_inst_window_reads" value="263886"/> <stat name="fp_inst_window_writes" value="263886"/> <stat name="fp_inst_window_wakeup_accesses" value="263886"/> <!-- RF accesses --> <stat name="int_regfile_reads" value="1600000"/> <stat name="float_regfile_reads" value="40000"/> <stat name="int_regfile_writes" value="800000"/> <stat name="float_regfile_writes" value="20000"/> <!-- accesses to the working reg --> <stat name="function_calls" value="5"/> <stat name="context_switches" value="260343"/> <!-- Number of Windowes switches (number of function calls and returns)--> <!-- Alu stats by default, the processor has one FPU that includes the divider and multiplier. The fpu accesses should include accesses to multiplier and divider --> <stat name="ialu_accesses" value="800000"/> <stat name="fpu_accesses" value="10000"/> <stat name="mul_accesses" value="100000"/> <stat name="cdb_alu_accesses" value="1000000"/> <stat name="cdb_mul_accesses" value="0"/> <stat name="cdb_fpu_accesses" value="0"/> <!-- multiple cycle accesses should be counted multiple times, otherwise, McPAT can use internal counter for different floating point instructions to get final accesses. But that needs detailed info for floating point inst mix --> <!-- currently the performance simulator should make sure all the numbers are final numbers, including the explicit read/write accesses, and the implicite accesses such as replacements and etc. Future versions of McPAT may be able to reason the implicite access based on param and stats of last level cache The same rule applies to all cache access stats too! --> <!-- following is AF for max power computation. Do not change them, unless you understand them--> <stat name="IFU_duty_cycle" value="0.25"/> <stat name="LSU_duty_cycle" value="0.25"/> <stat name="MemManU_I_duty_cycle" value="1"/> <stat name="MemManU_D_duty_cycle" value="0.25"/> <stat name="ALU_duty_cycle" value="0.9"/> <stat name="MUL_duty_cycle" value="0.5"/> <stat name="FPU_duty_cycle" value="0.4"/> <stat name="ALU_cdb_duty_cycle" value="0.9"/> <stat name="MUL_cdb_duty_cycle" value="0.5"/> <stat name="FPU_cdb_duty_cycle" value="0.4"/> <component id="system.core0.predictor" name="PBT"> <!-- branch predictor; tournament predictor see Alpha implementation --> <param name="local_predictor_size" value="10,3"/> <param name="local_predictor_entries" value="1024"/> <param name="global_predictor_entries" value="4096"/> <param name="global_predictor_bits" value="2"/> <param name="chooser_predictor_entries" value="4096"/> <param name="chooser_predictor_bits" value="2"/> <!-- These parameters can be combined like below in next version <param name="load_predictor" value="10,3,1024"/> <param name="global_predictor" value="4096,2"/> <param name="predictor_chooser" value="4096,2"/> --> </component> <component id="system.core0.itlb" name="itlb"> <param name="number_entries" value="64"/> <stat name="total_accesses" value="800000"/> <stat name="total_misses" value="4"/> <stat name="conflicts" value="0"/> <!-- there is no write requests to itlb although writes happen to itlb after miss, which is actually a replacement --> </component> <component id="system.core0.icache" name="icache"> <!-- there is no write requests to itlb although writes happen to it after miss, which is actually a replacement --> <param name="icache_config" value="16384,32,4,1,1,3,8,0"/> <!-- the parameters are capacity,block_width, associativity, bank, throughput w.r.t. core clock, latency w.r.t. core clock,output_width, cache policy --> <!-- cache_policy;//0 no write or write-though with non-write allocate;1 write-back with write-allocate --> <param name="buffer_sizes" value="16, 16, 16,0"/> <!-- cache controller buffer sizes: miss_buffer_size(MSHR),fill_buffer_size,prefetch_buffer_size,wb_buffer_size--> <stat name="read_accesses" value="200000"/> <stat name="read_misses" value="0"/> <stat name="conflicts" value="0"/> </component> <component id="system.core0.dtlb" name="dtlb"> <param name="number_entries" value="64"/> <stat name="total_accesses" value="200000"/> <stat name="total_misses" value="4"/> <stat name="conflicts" value="0"/> </component> <component id="system.core0.dcache" name="dcache"> <!-- all the buffer related are optional --> <param name="dcache_config" value="8192,16,4,1,1,3,16,0"/> <param name="buffer_sizes" value="16, 16, 16, 16"/> <!-- cache controller buffer sizes: miss_buffer_size(MSHR),fill_buffer_size,prefetch_buffer_size,wb_buffer_size--> <stat name="read_accesses" value="200000"/> <stat name="write_accesses" value="27276"/> <stat name="read_misses" value="1632"/> <stat name="write_misses" value="183"/> <stat name="conflicts" value="0"/> </component> <component id="system.core0.BTB" name="BTB"> <!-- all the buffer related are optional --> <param name="BTB_config" value="8192,4,2,1, 1,3"/> <!-- the parameters are capacity,block_width,associativity,bank, throughput w.r.t. core clock, latency w.r.t. core clock,--> </component> </component> <component id="system.L1Directory0" name="L1Directory0"> <param name="Directory_type" value="0"/> <!--0 cam based shadowed tag. 1 directory cache --> <param name="Dir_config" value="2048,1,0,1, 4, 4,8"/> <!-- the parameters are capacity,block_width, associativity,bank, throughput w.r.t. core clock, latency w.r.t. core clock,--> <param name="buffer_sizes" value="8, 8, 8, 8"/> <!-- all the buffer related are optional --> <param name="clockrate" value="3500"/> <param name="ports" value="1,1,1"/> <!-- number of r, w, and rw search ports --> <param name="device_type" value="0"/> <!-- altough there are multiple access types, Performance simulator needs to cast them into reads or writes e.g. the invalidates can be considered as writes --> <stat name="read_accesses" value="800000"/> <stat name="write_accesses" value="27276"/> <stat name="read_misses" value="1632"/> <stat name="write_misses" value="183"/> <stat name="conflicts" value="20"/> <stat name="duty_cycle" value="0.45"/> </component> <component id="system.L2Directory0" name="L2Directory0"> <param name="Directory_type" value="1"/> <!--0 cam based shadowed tag. 1 directory cache --> <param name="Dir_config" value="1048576,16,16,1,2, 100"/> <!-- the parameters are capacity,block_width, associativity,bank, throughput w.r.t. core clock, latency w.r.t. core clock,--> <param name="buffer_sizes" value="8, 8, 8, 8"/> <!-- all the buffer related are optional --> <param name="clockrate" value="3500"/> <param name="ports" value="1,1,1"/> <!-- number of r, w, and rw search ports --> <param name="device_type" value="0"/> <!-- altough there are multiple access types, Performance simulator needs to cast them into reads or writes e.g. the invalidates can be considered as writes --> <stat name="read_accesses" value="58824"/> <stat name="write_accesses" value="27276"/> <stat name="read_misses" value="1632"/> <stat name="write_misses" value="183"/> <stat name="conflicts" value="100"/> <stat name="duty_cycle" value="0.45"/> </component> <component id="system.L20" name="L20"> <!-- all the buffer related are optional --> <param name="L2_config" value="1048576,64,16,1, 4,23, 64, 1"/> <!-- consider 4-way bank interleaving for Niagara 1 --> <!-- the parameters are capacity,block_width, associativity, bank, throughput w.r.t. core clock, latency w.r.t. core clock,output_width, cache policy --> <param name="buffer_sizes" value="16, 16, 16, 16"/> <!-- cache controller buffer sizes: miss_buffer_size(MSHR),fill_buffer_size,prefetch_buffer_size,wb_buffer_size--> <param name="clockrate" value="3500"/> <param name="ports" value="1,1,1"/> <!-- number of r, w, and rw ports --> <param name="device_type" value="0"/> <stat name="read_accesses" value="200000"/> <stat name="write_accesses" value="0"/> <stat name="read_misses" value="0"/> <stat name="write_misses" value="0"/> <stat name="conflicts" value="0"/> <stat name="duty_cycle" value="0.5"/> </component> <!--**********************************************************************--> <component id="system.L30" name="L30"> <param name="L3_config" value="1048576,64,16,1, 2,100, 64,1"/> <!-- the parameters are capacity,block_width, associativity, bank, throughput w.r.t. core clock, latency w.r.t. core clock,output_width, cache policy --> <param name="clockrate" value="3500"/> <param name="ports" value="1,1,1"/> <!-- number of r, w, and rw ports --> <param name="device_type" value="0"/> <param name="buffer_sizes" value="16, 16, 16, 16"/> <!-- cache controller buffer sizes: miss_buffer_size(MSHR),fill_buffer_size,prefetch_buffer_size,wb_buffer_size--> <stat name="read_accesses" value="58824"/> <stat name="write_accesses" value="27276"/> <stat name="read_misses" value="1632"/> <stat name="write_misses" value="183"/> <stat name="conflicts" value="0"/> <stat name="duty_cycle" value="0.35"/> </component> <!--**********************************************************************--> <component id="system.NoC0" name="noc0"> <param name="clockrate" value="3500"/> <param name="type" value="1"/> <!-- 1 NoC, O bus --> <param name="horizontal_nodes" value="8"/> <param name="vertical_nodes" value="8"/> <param name="has_global_link" value="1"/> <!-- 1 has global link, 0 does not have global link --> <param name="link_throughput" value="1"/><!--w.r.t clock --> <param name="link_latency" value="1"/><!--w.r.t clock --> <!-- througput >= latency --> <!-- Router architecture --> <param name="input_ports" value="5"/> <param name="output_ports" value="5"/> <param name="virtual_channel_per_port" value="1"/> <!-- input buffer; in classic routers only input ports need buffers --> <param name="flit_bits" value="256"/> <param name="input_buffer_entries_per_vc" value="4"/><!--VCs within the same ports share input buffers whose size is propotional to the number of VCs--> <param name="chip_coverage" value="1"/> <!-- When multiple NOC present, one NOC will cover part of the whole chip. chip_coverage <=1 --> <stat name="total_accesses" value="360000"/> <!-- This is the number of total accesses within the whole network not for each router --> <stat name="duty_cycle" value="0.1"/> </component> <!--**********************************************************************--> <component id="system.mem" name="mem"> <!-- Main memory property --> <param name="mem_tech_node" value="32"/> <param name="device_clock" value="200"/><!--MHz, this is clock rate of the actual memory device, not the FSB --> <param name="peak_transfer_rate" value="3200"/><!--MB/S--> <param name="internal_prefetch_of_DRAM_chip" value="4"/> <!-- 2 for DDR, 4 for DDR2, 8 for DDR3...--> <!-- the device clock, peak_transfer_rate, and the internal prefetch decide the DIMM property --> <!-- above numbers can be easily found from Wikipedia --> <param name="capacity_per_channel" value="4096"/> <!-- MB --> <!-- capacity_per_Dram_chip=capacity_per_channel/number_of_dimms/number_ranks/Dram_chips_per_rank Current McPAT assumes single DIMMs are used.--> <param name="number_ranks" value="2"/> <param name="num_banks_of_DRAM_chip" value="8"/> <param name="Block_width_of_DRAM_chip" value="64"/> <!-- B --> <param name="output_width_of_DRAM_chip" value="8"/> <!--number of Dram_chips_per_rank=" 72/output_width_of_DRAM_chip--> <!--number of Dram_chips_per_rank=" 72/output_width_of_DRAM_chip--> <param name="page_size_of_DRAM_chip" value="8"/> <!-- 8 or 16 --> <param name="burstlength_of_DRAM_chip" value="8"/> <stat name="memory_accesses" value="1052"/> <stat name="memory_reads" value="1052"/> <stat name="memory_writes" value="1052"/> </component> <component id="system.mc" name="mc"> <!-- Memeory controllers are for DDR(2,3...) DIMMs --> <!-- current version of McPAT uses published values for base parameters of memory controller improvments on MC will be added in later versions. --> <param name="mc_clock" value="200"/><!--DIMM IO bus clock rate MHz DDR2-400 for Niagara 1--> <param name="peak_transfer_rate" value="3200"/><!--MB/S--> <param name="llc_line_length" value="64"/><!--B--> <param name="number_mcs" value="4"/> <!-- current McPAT only supports homogeneous memory controllers --> <param name="memory_channels_per_mc" value="1"/> <param name="number_ranks" value="2"/> <!-- # of ranks of each channel--> <param name="req_window_size_per_channel" value="32"/> <param name="IO_buffer_size_per_channel" value="32"/> <param name="databus_width" value="128"/> <param name="addressbus_width" value="51"/> <!-- McPAT will add the control bus width to the addressbus width automatically --> <stat name="memory_accesses" value="33333"/> <stat name="memory_reads" value="16667"/> <stat name="memory_writes" value="16667"/> <!-- McPAT does not track individual mc, instead, it takes the total accesses and calculate the average power per MC or per channel. This is sufficent for most application. Further trackdown can be easily added in later versions. --> </component> <!--**********************************************************************--> </component> </component>
[ 47934, 19875, 2196, 2625, 16, 13, 15, 1, 5633, 29, 198, 27, 42895, 4686, 2625, 15763, 1, 1438, 2625, 15763, 5320, 198, 197, 27, 42895, 4686, 2625, 10057, 1, 1438, 2625, 10057, 5320, 198, 197, 197, 27, 28112, 9742, 47, 1404, 481, 14267, 262, 6805, 611, 1271, 318, 900, 284, 657, 14610, 198, 197, 197, 27, 17143, 1438, 2625, 17618, 62, 1659, 62, 66, 2850, 1, 1988, 2625, 2414, 26700, 198, 197, 197, 27, 17143, 1438, 2625, 17618, 62, 1659, 62, 43, 16, 13470, 1749, 1, 1988, 2625, 15, 26700, 198, 197, 197, 27, 17143, 1438, 2625, 17618, 62, 1659, 62, 43, 17, 13470, 1749, 1, 1988, 2625, 15, 26700, 198, 197, 197, 27, 17143, 1438, 2625, 17618, 62, 1659, 62, 43, 17, 82, 1, 1988, 2625, 2414, 26700, 37922, 770, 1271, 1724, 703, 867, 406, 17, 23163, 287, 1123, 13946, 612, 460, 307, 3294, 6341, 14, 3742, 14610, 198, 197, 197, 27, 17143, 1438, 2625, 17618, 62, 1659, 62, 43, 18, 82, 1, 1988, 2625, 15, 26700, 37922, 770, 1271, 1724, 703, 867, 406, 18, 23163, 14610, 198, 197, 197, 27, 17143, 1438, 2625, 17618, 62, 1659, 62, 2949, 32274, 1, 1988, 2625, 16, 26700, 198, 197, 197, 27, 17143, 1438, 2625, 26452, 32269, 62, 66, 2850, 1, 1988, 2625, 16, 1, 14, 6927, 28112, 16, 1724, 3488, 78, 14610, 198, 197, 197, 27, 17143, 1438, 2625, 26452, 32269, 62, 43, 17, 82, 1, 1988, 2625, 16, 26700, 198, 197, 197, 27, 17143, 1438, 2625, 26452, 32269, 62, 43, 16, 43055, 82, 1, 1988, 2625, 16, 26700, 198, 197, 197, 27, 17143, 1438, 2625, 26452, 32269, 62, 43, 17, 43055, 82, 1, 1988, 2625, 16, 26700, 198, 197, 197, 27, 17143, 1438, 2625, 26452, 32269, 62, 43, 18, 82, 1, 1988, 2625, 16, 26700, 198, 197, 197, 27, 17143, 1438, 2625, 26452, 32269, 62, 535, 82, 1, 1988, 2625, 16, 1, 14, 6927, 28112, 23870, 763, 1456, 344, 6890, 14610, 198, 197, 197, 27, 17143, 1438, 2625, 26452, 32269, 62, 2949, 32274, 1, 1988, 2625, 16, 26700, 198, 197, 197, 27, 17143, 1438, 2625, 7295, 62, 13670, 62, 17440, 1, 1988, 2625, 1828, 1, 14, 6927, 28112, 28642, 14610, 198, 197, 197, 27, 17143, 1438, 2625, 16793, 62, 7295, 62, 15750, 4873, 1, 1988, 2625, 2327, 405, 1, 14, 6927, 28112, 25983, 14610, 198, 197, 197, 27, 17143, 1438, 2625, 11498, 21069, 1, 1988, 2625, 15277, 26700, 37922, 46577, 14610, 198, 197, 197, 27, 17143, 1438, 2625, 17618, 62, 23870, 62, 46170, 1, 1988, 2625, 17, 26700, 198, 197, 197, 27, 17143, 1438, 2625, 3849, 8443, 62, 16302, 295, 62, 4906, 1, 1988, 2625, 15, 1, 14, 6927, 28112, 15, 25, 556, 3314, 6503, 3037, 26, 352, 25, 5940, 6503, 3037, 14610, 198, 197, 197, 27, 17143, 1438, 2625, 25202, 62, 4906, 1, 1988, 2625, 15, 1, 14, 6927, 28112, 15, 25, 6574, 7, 11922, 15193, 5994, 1776, 352, 25, 406, 2257, 47, 7, 20535, 42020, 1176, 8, 362, 25, 406, 3185, 357, 20535, 24850, 4333, 8, 220, 14610, 198, 197, 197, 27, 17143, 1438, 2625, 6511, 263, 62, 17620, 62, 25202, 1, 1988, 2625, 16, 1, 14, 6927, 28112, 657, 645, 779, 26, 352, 779, 618, 1744, 14610, 198, 197, 197, 27, 17143, 1438, 2625, 30243, 62, 9895, 1, 1988, 2625, 2414, 26700, 198, 197, 197, 27, 17143, 1438, 2625, 32844, 62, 21975, 62, 10394, 1, 1988, 2625, 2414, 26700, 198, 197, 197, 27, 17143, 1438, 2625, 42854, 62, 21975, 62, 10394, 1, 1988, 2625, 4309, 26700, 198, 197, 197, 27, 17143, 1438, 2625, 32844, 62, 31673, 62, 7700, 62, 7857, 1, 1988, 2625, 1821, 4846, 26700, 198, 197, 197, 27, 14269, 1438, 2625, 23350, 62, 32503, 1, 1988, 2625, 3064, 830, 26700, 198, 197, 197, 27, 14269, 1438, 2625, 312, 293, 62, 32503, 1, 1988, 2625, 15, 26700, 198, 197, 197, 27, 14269, 1438, 2625, 10885, 88, 62, 32503, 1, 220, 1988, 2625, 3064, 830, 26700, 198, 197, 197, 197, 27, 28112, 1212, 2443, 2546, 7, 33, 8, 318, 1844, 1180, 422, 262, 2443, 2546, 287, 8774, 16155, 792, 596, 13, 428, 2443, 2546, 318, 262, 2546, 286, 220, 198, 197, 197, 197, 32844, 4088, 422, 7294, 14, 3163, 11072, 6650, 26, 262, 2443, 2546, 287, 8774, 16155, 792, 596, 318, 262, 43840, 439, 3518, 1627, 287, 257, 10560, 2390, 3331, 220, 14610, 198, 197, 197, 27, 28112, 220, 8412, 2466, 8162, 21758, 220, 8412, 8162, 14610, 198, 197, 197, 27, 42895, 4686, 2625, 10057, 13, 7295, 15, 1, 1438, 2625, 7295, 15, 5320, 198, 197, 197, 197, 27, 28112, 7231, 3119, 14610, 198, 197, 197, 197, 27, 17143, 1438, 2625, 15750, 62, 4873, 1, 1988, 2625, 2327, 405, 26700, 198, 197, 197, 197, 27, 17143, 1438, 2625, 8625, 2762, 62, 13664, 1, 1988, 2625, 2624, 26700, 198, 197, 197, 197, 27, 17143, 1438, 2625, 404, 8189, 62, 10394, 1, 1988, 2625, 24, 26700, 198, 197, 197, 197, 27, 28112, 2209, 9647, 2206, 42951, 262, 7621, 62, 10394, 287, 34088, 11, 30948, 48, 290, 39334, 287, 12940, 10444, 220, 198, 197, 197, 197, 12286, 1988, 318, 4572, 62, 9895, 11, 611, 407, 900, 14610, 220, 198, 197, 197, 197, 27, 17143, 1438, 2625, 30243, 62, 4906, 1, 1988, 2625, 16, 1, 14, 6927, 28112, 352, 287, 2875, 26, 657, 440, 6684, 46904, 198, 197, 197, 197, 27, 28112, 287, 2875, 14, 46, 78, 46, 14610, 198, 197, 197, 197, 27, 17143, 1438, 2625, 17618, 62, 10424, 1574, 62, 16663, 82, 1, 1988, 2625, 19, 26700, 198, 197, 197, 197, 27, 28112, 1271, 62, 8625, 2762, 62, 69, 7569, 62, 3742, 7, 291, 4891, 14090, 8, 318, 1464, 352, 287, 2060, 12, 16663, 12649, 11, 198, 197, 197, 197, 270, 691, 743, 307, 517, 621, 530, 287, 9447, 51, 20399, 13, 22205, 33, 14090, 1464, 21767, 284, 21207, 14090, 1201, 220, 198, 197, 197, 197, 1671, 3702, 1321, 287, 369, 8831, 425, 8478, 7729, 287, 262, 976, 21207, 1448, 460, 307, 1100, 503, 422, 22205, 33, 1752, 9816, 29, 220, 198, 197, 197, 197, 27, 17143, 1438, 2625, 69, 7569, 62, 10394, 1, 1988, 2625, 16, 26700, 198, 197, 197, 197, 27, 28112, 21207, 62, 10394, 2206, 42951, 262, 2546, 286, 269 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
About This Video Episode 8 699 votes “Trick Play” Targeted by a “hacker hunter,” Enokida is forced to run from place to place in Hakata. Assassins after the bounty on his head are steadily closing in, and Enokida has been cut off from using computers, his only weapon. He’s fallen into a desperate situation. Meanwhile, Banba receives a message from Enokida. It’s a desperate counter to the cyberterrorist cell which came to Banba and Lin. ...more
[ 8585, 770, 7623, 198, 198, 23758, 807, 198, 198, 47325, 5690, 198, 198, 447, 250, 2898, 624, 3811, 447, 251, 198, 198, 21745, 276, 416, 257, 564, 250, 71, 10735, 19177, 11, 447, 251, 2039, 482, 3755, 318, 4137, 284, 1057, 422, 1295, 284, 1295, 287, 24734, 1045, 13, 48975, 706, 262, 24180, 319, 465, 198, 2256, 389, 18434, 9605, 287, 11, 290, 2039, 482, 3755, 468, 587, 2005, 572, 422, 1262, 9061, 11, 465, 691, 4282, 13, 679, 447, 247, 82, 9292, 656, 257, 12111, 3074, 13, 11214, 11, 10274, 7012, 11583, 257, 3275, 422, 2039, 482, 3755, 13, 632, 447, 247, 82, 257, 12111, 3753, 284, 262, 10075, 42002, 2685, 543, 1625, 284, 10274, 7012, 290, 5164, 13, 2644, 3549 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
log.level=${log.level} log.path=${log.path} dubbo.registry.address=${dubbo.registry.address} dubbo.protocal.port=${dubbo.protocal.port} dubbo.service.version=${dubbo.service.version} ws.connect.path=${ws.connect.path} ws.connect.port=${ws.connect.port} ws.connect.bus.port=${ws.connect.bus.port} service.name=ws_server service.version=1.0 service.bus.name=bus_ws_server service.bus.version=1.0 consul.host=${consul.host} consul.port=${consul.port}
[ 6404, 13, 5715, 28, 38892, 6404, 13, 5715, 92, 198, 6404, 13, 6978, 28, 38892, 6404, 13, 6978, 92, 198, 198, 67, 549, 2127, 13, 2301, 4592, 13, 21975, 28, 38892, 67, 549, 2127, 13, 2301, 4592, 13, 21975, 92, 198, 67, 549, 2127, 13, 11235, 4374, 13, 634, 28, 38892, 67, 549, 2127, 13, 11235, 4374, 13, 634, 92, 198, 67, 549, 2127, 13, 15271, 13, 9641, 28, 38892, 67, 549, 2127, 13, 15271, 13, 9641, 92, 198, 198, 18504, 13, 8443, 13, 6978, 28, 38892, 18504, 13, 8443, 13, 6978, 92, 198, 18504, 13, 8443, 13, 634, 28, 38892, 18504, 13, 8443, 13, 634, 92, 198, 198, 18504, 13, 8443, 13, 10885, 13, 634, 28, 38892, 18504, 13, 8443, 13, 10885, 13, 634, 92, 198, 198, 15271, 13, 3672, 28, 18504, 62, 15388, 198, 15271, 13, 9641, 28, 16, 13, 15, 198, 198, 15271, 13, 10885, 13, 3672, 28, 10885, 62, 18504, 62, 15388, 198, 15271, 13, 10885, 13, 9641, 28, 16, 13, 15, 198, 198, 5936, 377, 13, 4774, 28, 38892, 5936, 377, 13, 4774, 92, 198, 5936, 377, 13, 634, 28, 38892, 5936, 377, 13, 634, 92 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
/* * Copyright (c) 2017, 2019, Oracle and/or its affiliates. All rights reserved. * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER. * * This code is free software; you can redistribute it and/or modify it * under the terms of the GNU General Public License version 2 only, as * published by the Free Software Foundation. * * This code is distributed in the hope that it will be useful, but WITHOUT * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License * version 2 for more details (a copy is included in the LICENSE file that * accompanied this code). * * You should have received a copy of the GNU General Public License version * 2 along with this work; if not, write to the Free Software Foundation, * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA. * * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA * or visit www.oracle.com if you need additional information or have any * questions. * */ #include "precompiled.hpp" #include "jfr/recorder/checkpoint/types/jfrTypeSetUtils.hpp" #include "oops/instanceKlass.hpp" #include "oops/oop.inline.hpp" #include "oops/symbol.hpp" static JfrSymbolId::CStringEntry* bootstrap = NULL; JfrSymbolId::JfrSymbolId() : _sym_table(new SymbolTable(this)), _cstring_table(new CStringTable(this)), _sym_list(NULL), _cstring_list(NULL), _sym_query(NULL), _cstring_query(NULL), _symbol_id_counter(1), _class_unload(false) { assert(_sym_table != NULL, "invariant"); assert(_cstring_table != NULL, "invariant"); bootstrap = new CStringEntry(0, (const char*)&BOOTSTRAP_LOADER_NAME); assert(bootstrap != NULL, "invariant"); bootstrap->set_id(1); _cstring_list = bootstrap; } JfrSymbolId::~JfrSymbolId() { clear(); delete _sym_table; delete _cstring_table; delete bootstrap; } void JfrSymbolId::clear() { assert(_sym_table != NULL, "invariant"); if (_sym_table->has_entries()) { _sym_table->clear_entries(); } assert(!_sym_table->has_entries(), "invariant"); assert(_cstring_table != NULL, "invariant"); if (_cstring_table->has_entries()) { _cstring_table->clear_entries(); } assert(!_cstring_table->has_entries(), "invariant"); _sym_list = NULL; _symbol_id_counter = 1; _sym_query = NULL; _cstring_query = NULL; assert(bootstrap != NULL, "invariant"); bootstrap->reset(); _cstring_list = bootstrap; } void JfrSymbolId::set_class_unload(bool class_unload) { _class_unload = class_unload; } void JfrSymbolId::on_link(const SymbolEntry* entry) { assert(entry != NULL, "invariant"); const_cast<Symbol*>(entry->literal())->increment_refcount(); assert(entry->id() == 0, "invariant"); entry->set_id(++_symbol_id_counter); entry->set_list_next(_sym_list); _sym_list = entry; } bool JfrSymbolId::on_equals(uintptr_t hash, const SymbolEntry* entry) { assert(entry != NULL, "invariant"); assert(entry->hash() == hash, "invariant"); assert(_sym_query != NULL, "invariant"); return _sym_query == entry->literal(); } void JfrSymbolId::on_unlink(const SymbolEntry* entry) { assert(entry != NULL, "invariant"); const_cast<Symbol*>(entry->literal())->decrement_refcount(); } static const char* resource_to_cstring(const char* resource_str) { assert(resource_str != NULL, "invariant"); const size_t length = strlen(resource_str); char* const c_string = JfrCHeapObj::new_array<char>(length + 1); assert(c_string != NULL, "invariant"); strncpy(c_string, resource_str, length + 1); return c_string; } void JfrSymbolId::on_link(const CStringEntry* entry) { assert(entry != NULL, "invariant"); assert(entry->id() == 0, "invariant"); entry->set_id(++_symbol_id_counter); const_cast<CStringEntry*>(entry)->set_literal(resource_to_cstring(entry->literal())); entry->set_list_next(_cstring_list); _cstring_list = entry; } static bool string_compare(const char* query, const char* candidate) { assert(query != NULL, "invariant"); assert(candidate != NULL, "invariant"); const size_t length = strlen(query); return strncmp(query, candidate, length) == 0; } bool JfrSymbolId::on_equals(uintptr_t hash, const CStringEntry* entry) { assert(entry != NULL, "invariant"); assert(entry->hash() == hash, "invariant"); assert(_cstring_query != NULL, "invariant"); return string_compare(_cstring_query, entry->literal()); } void JfrSymbolId::on_unlink(const CStringEntry* entry) { assert(entry != NULL, "invariant"); JfrCHeapObj::free(const_cast<char*>(entry->literal()), strlen(entry->literal() + 1)); } traceid JfrSymbolId::bootstrap_name(bool leakp) { assert(bootstrap != NULL, "invariant"); if (leakp) { bootstrap->set_leakp(); } return 1; } traceid JfrSymbolId::mark(const Symbol* symbol, bool leakp) { assert(symbol != NULL, "invariant"); return mark((uintptr_t)symbol->identity_hash(), symbol, leakp); } traceid JfrSymbolId::mark(uintptr_t hash, const Symbol* data, bool leakp) { assert(data != NULL, "invariant"); assert(_sym_table != NULL, "invariant"); _sym_query = data; const SymbolEntry& entry = _sym_table->lookup_put(hash, data); if (_class_unload) { entry.set_unloading(); } if (leakp) { entry.set_leakp(); } return entry.id(); } traceid JfrSymbolId::mark(uintptr_t hash, const char* str, bool leakp) { assert(str != NULL, "invariant"); assert(_cstring_table != NULL, "invariant"); _cstring_query = str; const CStringEntry& entry = _cstring_table->lookup_put(hash, str); if (_class_unload) { entry.set_unloading(); } if (leakp) { entry.set_leakp(); } return entry.id(); } /* * jsr292 anonymous classes symbol is the external name + * the identity_hashcode slash appended: * java.lang.invoke.LambdaForm$BMH/22626602 * * caller needs ResourceMark */ uintptr_t JfrSymbolId::unsafe_anonymous_klass_name_hash(const InstanceKlass* ik) { assert(ik != NULL, "invariant"); assert(ik->is_anonymous(), "invariant"); const oop mirror = ik->java_mirror_no_keepalive(); assert(mirror != NULL, "invariant"); return (uintptr_t)mirror->identity_hash(); } static const char* create_unsafe_anonymous_klass_symbol(const InstanceKlass* ik, uintptr_t hash) { assert(ik != NULL, "invariant"); assert(ik->is_anonymous(), "invariant"); assert(hash != 0, "invariant"); char* anonymous_symbol = NULL; const oop mirror = ik->java_mirror_no_keepalive(); assert(mirror != NULL, "invariant"); char hash_buf[40]; sprintf(hash_buf, "/" UINTX_FORMAT, hash); const size_t hash_len = strlen(hash_buf); const size_t result_len = ik->name()->utf8_length(); anonymous_symbol = NEW_RESOURCE_ARRAY(char, result_len + hash_len + 1); ik->name()->as_klass_external_name(anonymous_symbol, (int)result_len + 1); assert(strlen(anonymous_symbol) == result_len, "invariant"); strcpy(anonymous_symbol + result_len, hash_buf); assert(strlen(anonymous_symbol) == result_len + hash_len, "invariant"); return anonymous_symbol; } bool JfrSymbolId::is_unsafe_anonymous_klass(const Klass* k) { assert(k != NULL, "invariant"); return k->is_instance_klass() && ((const InstanceKlass*)k)->is_anonymous(); } traceid JfrSymbolId::mark_unsafe_anonymous_klass_name(const InstanceKlass* ik, bool leakp) { assert(ik != NULL, "invariant"); assert(ik->is_anonymous(), "invariant"); const uintptr_t hash = unsafe_anonymous_klass_name_hash(ik); const char* const anonymous_klass_symbol = create_unsafe_anonymous_klass_symbol(ik, hash); return mark(hash, anonymous_klass_symbol, leakp); } traceid JfrSymbolId::mark(const Klass* k, bool leakp) { assert(k != NULL, "invariant"); traceid symbol_id = 0; if (is_unsafe_anonymous_klass(k)) { assert(k->is_instance_klass(), "invariant"); symbol_id = mark_unsafe_anonymous_klass_name((const InstanceKlass*)k, leakp); } if (0 == symbol_id) { Symbol* const sym = k->name(); if (sym != NULL) { symbol_id = mark(sym, leakp); } } assert(symbol_id > 0, "a symbol handler must mark the symbol for writing"); return symbol_id; } JfrArtifactSet::JfrArtifactSet(bool class_unload) : _symbol_id(new JfrSymbolId()), _klass_list(NULL), _total_count(0) { initialize(class_unload); assert(_klass_list != NULL, "invariant"); } static const size_t initial_class_list_size = 200; void JfrArtifactSet::initialize(bool class_unload, bool clear /* false */) { assert(_symbol_id != NULL, "invariant"); if (clear) { _symbol_id->clear(); } _symbol_id->set_class_unload(class_unload); _total_count = 0; // resource allocation _klass_list = new GrowableArray<const Klass*>(initial_class_list_size, false, mtTracing); } JfrArtifactSet::~JfrArtifactSet() { _symbol_id->clear(); delete _symbol_id; // _klass_list will be cleared by a ResourceMark } traceid JfrArtifactSet::bootstrap_name(bool leakp) { return _symbol_id->bootstrap_name(leakp); } traceid JfrArtifactSet::mark_unsafe_anonymous_klass_name(const Klass* klass, bool leakp) { assert(klass->is_instance_klass(), "invariant"); return _symbol_id->mark_unsafe_anonymous_klass_name((const InstanceKlass*)klass, leakp); } traceid JfrArtifactSet::mark(uintptr_t hash, const Symbol* sym, bool leakp) { return _symbol_id->mark(hash, sym, leakp); } traceid JfrArtifactSet::mark(const Klass* klass, bool leakp) { return _symbol_id->mark(klass, leakp); } traceid JfrArtifactSet::mark(const Symbol* symbol, bool leakp) { return _symbol_id->mark(symbol, leakp); } traceid JfrArtifactSet::mark(uintptr_t hash, const char* const str, bool leakp) { return _symbol_id->mark(hash, str, leakp); } bool JfrArtifactSet::has_klass_entries() const { return _klass_list->is_nonempty(); } int JfrArtifactSet::entries() const { return _klass_list->length(); } void JfrArtifactSet::register_klass(const Klass* k) { assert(k != NULL, "invariant"); assert(_klass_list != NULL, "invariant"); assert(_klass_list->find(k) == -1, "invariant"); _klass_list->append(k); } size_t JfrArtifactSet::total_count() const { return _total_count; }
[ 15211, 198, 1635, 15069, 357, 66, 8, 2177, 11, 13130, 11, 18650, 290, 14, 273, 663, 29116, 13, 1439, 2489, 10395, 13, 198, 1635, 8410, 5626, 8355, 5781, 6375, 22657, 46, 6089, 27975, 38162, 9947, 5626, 34444, 6375, 12680, 45811, 39837, 1137, 13, 198, 1635, 198, 1635, 770, 2438, 318, 1479, 3788, 26, 345, 460, 17678, 4163, 340, 290, 14, 273, 13096, 340, 198, 1635, 739, 262, 2846, 286, 262, 22961, 3611, 5094, 13789, 2196, 362, 691, 11, 355, 198, 1635, 3199, 416, 262, 3232, 10442, 5693, 13, 198, 1635, 198, 1635, 770, 2438, 318, 9387, 287, 262, 2911, 326, 340, 481, 307, 4465, 11, 475, 42881, 198, 1635, 15529, 34764, 56, 26, 1231, 772, 262, 17142, 18215, 286, 34482, 3398, 1565, 5603, 25382, 393, 198, 1635, 376, 46144, 7473, 317, 16652, 2149, 37232, 33079, 48933, 13, 220, 4091, 262, 22961, 3611, 5094, 13789, 198, 1635, 2196, 362, 329, 517, 3307, 357, 64, 4866, 318, 3017, 287, 262, 38559, 24290, 2393, 326, 198, 1635, 11791, 428, 2438, 737, 198, 1635, 198, 1635, 921, 815, 423, 2722, 257, 4866, 286, 262, 22961, 3611, 5094, 13789, 2196, 198, 1635, 362, 1863, 351, 428, 670, 26, 611, 407, 11, 3551, 284, 262, 3232, 10442, 5693, 11, 198, 1635, 3457, 1539, 6885, 14021, 520, 11, 19383, 22343, 11, 6182, 11, 8779, 657, 2481, 940, 12, 1485, 486, 4916, 13, 198, 1635, 198, 1635, 4222, 2800, 18650, 11, 5323, 18650, 38613, 11, 2297, 3822, 911, 2850, 11, 7257, 860, 1821, 2996, 4916, 198, 1635, 393, 3187, 7324, 13, 273, 6008, 13, 785, 611, 345, 761, 3224, 1321, 393, 423, 597, 198, 1635, 2683, 13, 198, 1635, 198, 9466, 198, 198, 2, 17256, 366, 3866, 5589, 3902, 13, 71, 381, 1, 198, 2, 17256, 366, 73, 8310, 14, 8344, 2875, 14, 9122, 4122, 14, 19199, 14, 73, 8310, 6030, 7248, 18274, 4487, 13, 71, 381, 1, 198, 2, 17256, 366, 44860, 14, 39098, 42, 31172, 13, 71, 381, 1, 198, 2, 17256, 366, 44860, 14, 11224, 13, 45145, 13, 71, 381, 1, 198, 2, 17256, 366, 44860, 14, 1837, 23650, 13, 71, 381, 1, 198, 198, 12708, 449, 8310, 13940, 23650, 7390, 3712, 34, 10100, 30150, 9, 6297, 26418, 796, 15697, 26, 198, 198, 41, 8310, 13940, 23650, 7390, 3712, 41, 8310, 13940, 23650, 7390, 3419, 1058, 198, 220, 4808, 37047, 62, 11487, 7, 3605, 38357, 10962, 7, 5661, 36911, 198, 220, 4808, 66, 8841, 62, 11487, 7, 3605, 327, 10100, 10962, 7, 5661, 36911, 198, 220, 4808, 37047, 62, 4868, 7, 33991, 828, 198, 220, 4808, 66, 8841, 62, 4868, 7, 33991, 828, 198, 220, 4808, 37047, 62, 22766, 7, 33991, 828, 198, 220, 4808, 66, 8841, 62, 22766, 7, 33991, 828, 198, 220, 4808, 1837, 23650, 62, 312, 62, 24588, 7, 16, 828, 198, 220, 4808, 4871, 62, 403, 2220, 7, 9562, 8, 1391, 198, 220, 6818, 28264, 37047, 62, 11487, 14512, 15697, 11, 366, 16340, 2743, 415, 15341, 198, 220, 6818, 28264, 66, 8841, 62, 11487, 14512, 15697, 11, 366, 16340, 2743, 415, 15341, 198, 220, 6297, 26418, 796, 649, 327, 10100, 30150, 7, 15, 11, 357, 9979, 1149, 28104, 5, 8202, 2394, 18601, 2969, 62, 35613, 1137, 62, 20608, 1776, 198, 220, 6818, 7, 18769, 26418, 14512, 15697, 11, 366, 16340, 2743, 415, 15341, 198, 220, 6297, 26418, 3784, 2617, 62, 312, 7, 16, 1776, 198, 220, 4808, 66, 8841, 62, 4868, 796, 6297, 26418, 26, 198, 92, 198, 198, 41, 8310, 13940, 23650, 7390, 3712, 93, 41, 8310, 13940, 23650, 7390, 3419, 1391, 198, 220, 1598, 9783, 198, 220, 12233, 4808, 37047, 62, 11487, 26, 198, 220, 12233, 4808, 66, 8841, 62, 11487, 26, 198, 220, 12233, 6297, 26418, 26, 198, 92, 198, 198, 19382, 449, 8310, 13940, 23650, 7390, 3712, 20063, 3419, 1391, 198, 220, 6818, 28264, 37047, 62, 11487, 14512, 15697, 11, 366, 16340, 2743, 415, 15341, 198, 220, 611, 44104, 37047, 62, 11487, 3784, 10134, 62, 298, 1678, 28955, 1391, 198, 220, 220, 220, 4808, 37047, 62, 11487, 3784, 20063, 62, 298, 1678, 9783, 198, 220, 1782, 198, 220, 6818, 7, 0, 62, 37047, 62, 11487, 3784, 10134, 62, 298, 1678, 22784, 366, 16340, 2743, 415, 15341, 628, 220, 6818, 28264, 66, 8841, 62, 11487, 14512, 15697, 11, 366, 16340, 2743, 415, 15341, 198, 220, 611, 44104, 66, 8841, 62, 11487, 3784, 10134, 62, 298, 1678, 28955, 1391, 198, 220, 220, 220, 4808, 66, 8841, 62, 11487, 3784, 20063, 62, 298, 1678, 9783, 198, 220, 1782, 198, 220, 6818, 7, 0, 62, 66, 8841, 62, 11487, 3784, 10134, 62, 298, 1678, 22784, 366, 16340, 2743, 415, 15341, 628, 220, 4808, 37047, 62, 4868, 796, 15697, 26, 198, 220, 4808, 1837, 23650, 62, 312, 62, 24588, 796, 352, 26, 628, 220, 4808, 37047, 62, 22766, 796, 15697, 26, 198, 220, 4808, 66, 8841, 62, 22766, 796, 15697, 26, 628, 220, 6818, 7, 18769, 26418, 14512, 15697, 11, 366, 16340, 2743, 415, 15341, 198, 220, 6297, 26418, 3784, 42503, 9783, 198, 220, 4808, 66, 8841, 62, 4868, 796, 6297, 26418, 26, 198, 92, 198, 198, 19382, 449, 8310, 13940, 23650, 7390, 3712, 2617, 62, 4871, 62, 403, 2220, 7, 30388, 1398, 62, 403, 2220, 8, 1391, 198, 220, 4808, 4871, 62, 403, 2220, 796, 1398, 62, 403, 2220, 26, 198, 92, 198, 198, 19382, 449, 8310, 13940, 23650, 7390, 3712, 261, 62, 8726, 7, 9979, 38357, 30150, 9, 5726, 8, 1391, 198, 220, 6818, 7, 13000, 14512, 15697, 11, 366, 16340, 2743, 415, 15341, 198, 220, 1500, 62, 2701, 27, 13940, 23650, 9, 33994, 13000, 3784, 18250, 1691, 28955, 3784, 24988, 434, 62, 5420, 9127, 9783, 198, 220, 6818, 7, 13000, 3784, 312, 3419, 6624, 657, 11, 366, 16340, 2743, 415, 15341, 198, 220, 5726, 3784, 2617, 62, 312, 7, 4880, 62, 1837, 23650, 62, 312, 62, 24588, 1776, 198, 220, 5726, 3784, 2617, 62, 4868, 62, 19545, 28264, 37047, 62, 4868, 1776, 198, 220, 4808, 37047, 62, 4868, 796, 5726, 26, 198, 92, 198, 198, 30388, 449, 8310, 13940, 23650, 7390, 3712, 261, 62, 4853, 874, 7, 28611, 20692, 62, 83, 12234, 11, 1500, 38357, 30150, 9, 5726, 8, 1391, 198, 220, 6818, 7, 13000, 14512, 15697, 11, 366, 16340, 2743, 415, 15341 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
goog.module('nested.exported.enums'); /** @const */ exports = { /** @const @enum {string} */ A: { A1: 'a1', }, // The structure of the AST changes if this extra property is present. B: 0, };
[ 2188, 519, 13, 21412, 10786, 77, 7287, 13, 1069, 9213, 13, 268, 5700, 24036, 198, 198, 35343, 2488, 9979, 9466, 198, 1069, 3742, 796, 1391, 198, 220, 42638, 2488, 9979, 2488, 44709, 1391, 8841, 92, 9466, 198, 220, 317, 25, 1391, 198, 220, 220, 220, 317, 16, 25, 705, 64, 16, 3256, 198, 220, 8964, 198, 220, 3373, 383, 4645, 286, 262, 29273, 2458, 611, 428, 3131, 3119, 318, 1944, 13, 198, 220, 347, 25, 657, 11, 198, 19629 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
BP12-S18-U24 B-Line has long been a leading manufacturer of support systems and electrical enclosures for the mechanical, electrical and telecommunications industries. our spring steel fastener line includes a wide range of quality fastening systems for electrical, mechanical and telecommunication applications. our spring steel fasteners include products for attachment to metal studs, steel beams, acoustical tee, drywall purlins, and channel.
[ 20866, 1065, 12, 50, 1507, 12, 52, 1731, 198, 198, 33, 12, 13949, 468, 890, 587, 257, 3756, 11554, 286, 1104, 3341, 290, 12278, 13507, 16091, 329, 262, 12370, 11, 12278, 290, 27473, 11798, 13, 674, 6076, 7771, 3049, 877, 1627, 3407, 257, 3094, 2837, 286, 3081, 3049, 3101, 3341, 329, 12278, 11, 12370, 290, 5735, 32560, 5479, 13, 674, 6076, 7771, 3049, 36014, 2291, 3186, 329, 18231, 284, 6147, 941, 82, 11, 7771, 26741, 11, 936, 23968, 605, 30479, 11, 5894, 11930, 1308, 21602, 11, 290, 6518, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Too many people are oblivious to the daily injustices that our systems enforce against our own fellow citizens within the city of San Diego and otherwise. Today, you shed light on the criminal justice system’s flaws and our cultural shortcomings. These systems are perpetuated by, as most things unjust, money changing hands. To get at the root of institutionalized injustice, which already impairs marginalized communities disproportionately, consider investigating the impact of the two, publicly-traded private prison companies who hold contracts with the State of California. The State’s contracts directly impact justice and the lack thereof in San Diego. Specifically, question the lobbying they do with respect to rules around detainment, arrests, convictions and lengths of prison sentences. These two companies and the handful of financial institutions with large holdings in them have assets in multibillions that depend on consistent - or ideally rapid - growth in the number of people in jail. how many people attended the rallies? Particularly the one on Saturday. Where was it? apparently the NAACP paid for it. Who was the keynote speaker? Where was it on the news on Saturday night or Sunday morning or even Sunday night? How does the Hispanic community feel about the vilification of Zimmerman? Since the courts found him innocent and the NAACP convicted him yet never referred to him as a Hispanic does this show bias on their part? He would have been better to say, "Due to the Stand Your Ground law in Florida, what happened to Martin could have happened to any one of us." I didn't vote for Obama because he's black. I voted for him because I thought he'd do a better job than McCain and Romney. I still do. But for the first time I feel like he's telling us he's not the American president, but a black man. Still, I understand where he's coming from. I'm a minority, too. But oddly the racist comments I've received in my life have been directed at me by black people, not white. Although some whites have, they were mostly black. And the prejudiced comments directed toward me have been from Mexicans who don't believe I'm Mexican enough. They accuse me of being ashamed of being a Mexican because I'm different than the stereotype. I think the president would have been better to keep out of this. The law is the law and will remain so until changed. Obama aside, I don't think the Martin/Zimmerman verdict will have a lasting impact on race relations in San Diego. Mexican-Americans and Asians are always excluded from "conversations about race." From this corner of the country, "race relations" on the national level comes down to Black or White. That's what the media peddles and the public buys. I agree wholeheartedly with the speakers about the need for greater understanding, so that people of color can experience life without constantly being disrespected. A Black man should be able to ride an elevator with a White woman without being perceived as a threat! This harkens back to the racism that eventually took the life of Emmet Till. The point about power and the desire to maintain it is so true. Power in this society is still held by a wealthy White majority, and until White privilege stops driving violence like it did that night in Florida -- even though Zimmerman is not ethnically White, he displays as White, and was subjected all his life to the lure of Euro-centrism -- and like it did when the jury decided to acquit him, we will rally, march, and yes PROTEST. Barbarism and bigotry begin in the home. Younger generations inherited their bigotry from their parents and grandparents. They'll pass those values on to their children. Enlightenment breaks the chain. Weil asks good questions. Where were they held. Why were they not more widely announced? This is the problem with many of the pro-immigrant rallies. By the time I hear about them, it's too late! Or, they have it in from of the County building at 4pm on a Friday!!! It's impacted the country badly with very different narratives about the event being a function of race. I have seen little that would seem to lead toward harmonizing those disparate viewpoints. I don't know why it would be different in San Diego. Barack Obama speaks on behalf of many special interests each and every day. He made the statement as a result of being under intense pressure from 13% of the population. No one has a problem with the innumberable statements he's made on behalf of other special interest groups, domestic or foreign. "It's impacted the country badly with very different narratives about the event being a function of race. I have seen little that would seem to lead toward harmonizing those disparate viewpoints. I don't know why it would be different in San Diego." San Diego's African-American population is 6% (in the City with a lower percentage in the County). Looking at the disparities on this comment board, those numbers hold up. Getting a balanced reaction to the verdict in San Diego is statistically impossible. That's why this conversation has to be opened-up to Americans of all ethnic descents. That won't be possible until "racism" is no longer framed solely as Black or White. "he displays as White". Is this new liberal speak? I have never heard this term before and wonder what kind of mind came up with this. Sad commentary on "civil" society. Racial and ethnic division and separation seems to be the focus instead of racial and ethnic harmony. DLR is correct, we know how the Korean immigrants viewed African Americans in L.A. Any race or ethnicity can be a bigot or discriminatory toward another. We also know how a lot of people today view Arab-Americans. I remember one time, I was at a gas station downtown. A black man was saying something outloud. I wasn't paying attention. He then drew closer to me and repeated his question. I replied, "Sorry, I didn't realize you were speaking to me." He had an accent which in my educated guess, I would say he was Somali. Anyway, he then said "Oh, I thought you were being racist" or words to that effect. It was obvious to me that he had had some unpleasant encounter. As for Zimmerman, he is Latino on his mother's side (it usually on the mother's side), but even as a Latino, he can still be classified for statistical purposes as the governemnt puts it, as "white." Duckster, then "stand your ground laws" are a legal/judicial issue--not a racial one--and should be reconsidered. Take those laws to court. This whole incident has shown that America seems to prefer segregation (by all sides) rather than inclusion. Perhaps the past is our future, too. Mission, Why would the government classify Zimmerman as white? I would assume it would be Hispanic. Just like Obama is black and would never be considered white. Unless he committed a crime against a minority. Funny how that works. IT IS A SICK SOCIETY which pretends that Trayvon Martin hasn't already received the justice that he deserved, a sick society which calls for George Zimmerman's head --- but then it is a sick, sick society which elects --- and then re-elects --- and re-elects --- scum like Barak Hushpuppy OhBummer, Biden The Magnificent, Nazi Pelosi, Filthy Harry Reid, and NYC Mayor Doomberg. In the best of all possible worlds, they'll all be on a plane which crashes into the NY Times Editorial offices at midmorning, any work day, next week. The real assassins in the Martin-Zimmerman confrontation are 1] Martin, 2] Barak Hushpuppy OhBummer, who is trying to promote race riots and the assassination of George Zimmerman, 3] Attorney General Eric "Fast and Furious" Holder, who will make sure that Zimmerman is unarmed when OhBummer’s and Holder's proxy assassins come for him, and 4] the fascist Democrat-captured media who are character assassins operating on behalf of the Democrat party and the OhBummer dictatorship. As well, these media propagandists are actionable as accessories before the fact if they succeed in promoting the injury or assassination of George Zimmerman. Every one of the media who have tried or who will try to cause injury to Zimmerman is a legitimate legal target of people who believe in justice --- the justice which Trayvon Martin earned when he jumped George Zimmerman and attempted to murder him. Two lying fascist sacks of shxt --- OhBummer and Holder --- and of course the usual race hustlers like Sharpton, Farrakhan, and Jackson --- can be counted on to promote racial hysteria and a false narrative on this subject, year-on-year, and decade-on-decade, ad nauseam, ad infinitum. As for "racism in America," there are millions more black racists than white racists in America today --- and the hundreds of millions of non-racists in America have "nothing" to apologize for --- no "guilt" to feel or adopt --- no "white privilege" to apologize for --- no “reparations” to pay --- no obligation to kowtow to all of the black racists --- or to Unkle Skum --- by which expression I mean “government at any and every level of American society.” In his call to the police before the incident, Zimmerman was advised by the cops to stay in his vehicle. Critics say that Zimmerman had “a duty” to "follow orders" but the caution issued by the cops was not a lawful command, else he would have been cited by the cops, and he wasn't. Even corrupt Florida State Attorney Angela Corey --- who hid evidence from the defense and fired the whistleblower who outed her --- did not argue that Zimmerman had a legal obligation to remain in his vehicle --- and he exited his vehicle when Martin disappeared from sight. Zimmerman called the police before Martin jumped him --- and MSNBC deleted parts of the recorded discussion and broadcast it to make it look like Zimmerman was targeting Martin because Martin was black --- rather than tailing Martin because he was wandering around in the dark in a neighborhood which had recently suffered some break-ins and thwarted other break-ins. This was MSNBC's attempt to lynch a straw horse, a so-called "white" Hispanic. MSNBC needed a black-white confrontation to promote their own racist, anti-white narrative that America is a "racist" society --- a society wherein whites should be disarmed --- and pay reparations to non-whites for the "privilege" [crime] of being white. There is no evidence whatever that race played a part in Zimmerman's execution of his duties as the on-duty Neighborhood Watch Volunteer. It is said with great derision that Zimmerman is or was "a wannabe cop." These critics appear to live in safe neighborhoods, no? There's nothing wrong with the aspiration to be a cop unless one intends to indict all cops for wanting to be cops --- and letting a puddy like Chris Matthews be the nighttime Neighborhood Watch volunteer strikes me as ineffective, to say the least --- although a pretty good way to get rid of Chris Matthews, come to think of it. Immediately upon the breaking of this story in the media, there was the assumption that the confrontation between Martin and Zimmerman had something to do with Florida's "stand your ground" law. But because Martin jumped Zimmerman and knocked him to the ground and proceeded to beat him in "mixed martial arts" pound-and-ground style, Zimmerman clearly was not "standing his ground" --- in the moment of confrontation, he was on his back with Martin on top of him smashing his nose out of shape and smashing Zimmerman's head on the cement. The attacks on “stand your ground” laws are being made by opportunists whose real objective is to leave the American citizen defenseless and let the freelance-Democrat scum rule the streets of America. I say that the American people should be well-armed and well-ammoed and stand their ground against the OhBummer dictatorship and against Unkle Skum --- against American government at every level. We have no obligation whatever to surrender to fascist statism --- or to any other brand of statism, as a matter of fact. That government is best which governs least. It is said that American government rests upon the consent of the governed. Now is the time for all good men and women to withdraw and cancel that consent. Trayvon Martin has been portrayed in the media as a sweetie-pie. The first published pictures of him that I saw were of Martin at the age of 12, or so, looking relatively mild and not especially bright. The pictures which Martin published of himself at age 17, online, and before he attacked Zimmerman --- and pictures which others had of him at that age --- showed him at 160 lbs and six feet in height --- a football player who had had some "mixed martial arts" training, in his own website flipping-off the viewer, smoking marijuana, and holding a semiautomatic handgun --- I guess OhBummer would have to call that “an assault weapon,” ay? He'd twice been suspended from school, had been found in possession of stolen property, started fights with other people, was a dopehead, and gave the impression that he was also a dope dealer. Trayvon Martin was a cheap thug, and it makes perfect sense for Barak Hushpuppy OhBummer to say that if he'd had a son, that his son would look like and be like Trayvon Martin, although, arguably, that son would look more like Trayvon Martin's ally, Rachel Jeantel, who has good reason to wear a hoodie, and probably also a very large trashbag, all things considered. So let Barak Hushpuppy OhBummer and Eric "Fast and Furious" Holder don their hoodies --- their version of the racist KKK pointy-headed white sheets --- and let them pursue their black racist witch hunt and their campaign of character assassination against George Zimmerman. I say that the majority of the American people see OhBummer and Holder --- and the Democrat-captured media --- and the whole OhBummer Wrecking Crew --- for what they truly are --- a dictatorship which deserves to be smashed. "This whole incident has shown that America seems to prefer segregation (by all sides) rather than inclusion." No it hasn't. When considered relative to other white-on-black justifiable shootings, this case shows that racism is alive and well in the american judicial system. "Are there are racial disparities in justifiable homicide rulings? Out of 53,000 homicides in the database, 23,000 have a white shooter and a white victim. The shooting is ruled to have been justified in a little more than 2 percent of cases. In states with a SYG law (after enactment), the shooting is ruled to be justified in 3.5 percent of cases, compared to less than 2 percent in non-SYG states. In cases where both the victim and shooter are black, the numbers are almost identical, if slightly lower. When the shooter and victim are of different races, there are substantial differences in the likelihood a shooting is ruled to be justified. When the shooter is black and the victim is white, the shooting is ruled justified in about 1 percent of cases, and is actually slightly lower in non-SYG states. Between 2005 and 2010, there were 1,210 homicides with a black shooter and a white victim—the shooting was ruled to be justified in just 17 of them (about 1 percent)." The story is completely different when there is a white shooter and a black victim. In the same time period, there were 2,069 shootings where the shooter was white and the victim black. The homicide was ruled to be justified in 236 cases (11 percent). In SYG states, almost 17 percent of white-on-black shootings were ruled to be justified. Those statistics as well as data from prisons tell an inconvenient truth. I think "Equal Justice" is the next "Marriage Equality" if done correctly. As with LGBT marriage, the country hasn't yet realized the extent of our institutionalized discrimination. FLORI-DUH Defender, okay, if it makes you feel better, Zimmerman is Latino even though he's father is NOT. Maybe you should check some of the job applications around town where LATINOS are asked to mark "white" for statistical purposes.
[ 23307, 867, 661, 389, 38603, 284, 262, 4445, 19019, 1063, 326, 674, 3341, 4605, 1028, 674, 898, 5891, 4290, 1626, 262, 1748, 286, 2986, 9500, 290, 4306, 13, 6288, 11, 345, 14999, 1657, 319, 262, 4301, 5316, 1080, 447, 247, 82, 17978, 290, 674, 6467, 31731, 13, 2312, 3341, 389, 8939, 6605, 416, 11, 355, 749, 1243, 21218, 11, 1637, 5609, 2832, 13, 1675, 651, 379, 262, 6808, 286, 15855, 1143, 21942, 11, 543, 1541, 848, 3468, 31670, 5348, 28719, 11, 2074, 10240, 262, 2928, 286, 262, 734, 11, 7271, 12, 2213, 5286, 2839, 3770, 2706, 508, 1745, 8592, 351, 262, 1812, 286, 3442, 13, 383, 1812, 447, 247, 82, 8592, 3264, 2928, 5316, 290, 262, 3092, 15370, 287, 2986, 9500, 13, 22426, 11, 1808, 262, 17502, 484, 466, 351, 2461, 284, 3173, 1088, 17017, 434, 11, 14794, 11, 19131, 290, 20428, 286, 3770, 13439, 13, 2312, 734, 2706, 290, 262, 10089, 286, 3176, 6712, 351, 1588, 27572, 287, 606, 423, 6798, 287, 1963, 571, 40083, 326, 4745, 319, 6414, 532, 393, 30274, 5801, 532, 3349, 287, 262, 1271, 286, 661, 287, 7356, 13, 198, 198, 4919, 867, 661, 9141, 262, 22558, 30, 47674, 262, 530, 319, 3909, 13, 6350, 373, 340, 30, 5729, 262, 39829, 3432, 329, 340, 13, 5338, 373, 262, 37332, 10834, 30, 6350, 373, 340, 319, 262, 1705, 319, 3909, 1755, 393, 3502, 3329, 393, 772, 3502, 1755, 30, 198, 198, 2437, 857, 262, 16949, 2055, 1254, 546, 262, 39796, 2649, 286, 24332, 30, 4619, 262, 8028, 1043, 683, 10218, 290, 262, 39829, 9118, 683, 1865, 1239, 6412, 284, 683, 355, 257, 16949, 857, 428, 905, 10690, 319, 511, 636, 30, 198, 198, 1544, 561, 423, 587, 1365, 284, 910, 11, 366, 22229, 284, 262, 5751, 3406, 13706, 1099, 287, 4744, 11, 644, 3022, 284, 5780, 714, 423, 3022, 284, 597, 530, 286, 514, 526, 198, 198, 40, 1422, 470, 3015, 329, 2486, 780, 339, 338, 2042, 13, 314, 7052, 329, 683, 780, 314, 1807, 339, 1549, 466, 257, 1365, 1693, 621, 14264, 290, 8431, 13, 314, 991, 466, 13, 887, 329, 262, 717, 640, 314, 1254, 588, 339, 338, 5149, 514, 339, 338, 407, 262, 1605, 1893, 11, 475, 257, 2042, 582, 13, 198, 198, 9590, 11, 314, 1833, 810, 339, 338, 2406, 422, 13, 314, 1101, 257, 9137, 11, 1165, 13, 887, 31414, 262, 9811, 3651, 314, 1053, 2722, 287, 616, 1204, 423, 587, 7924, 379, 502, 416, 2042, 661, 11, 407, 2330, 13, 4900, 617, 13216, 423, 11, 484, 547, 4632, 2042, 13, 843, 262, 14696, 3711, 3651, 7924, 3812, 502, 423, 587, 422, 36783, 508, 836, 470, 1975, 314, 1101, 10816, 1576, 13, 1119, 24456, 502, 286, 852, 22461, 286, 852, 257, 10816, 780, 314, 1101, 1180, 621, 262, 31240, 13, 198, 198, 40, 892, 262, 1893, 561, 423, 587, 1365, 284, 1394, 503, 286, 428, 13, 383, 1099, 318, 262, 1099, 290, 481, 3520, 523, 1566, 3421, 13, 198, 198, 15948, 7263, 11, 314, 836, 470, 892, 262, 5780, 14, 57, 10957, 805, 15593, 481, 423, 257, 15727, 2928, 319, 3234, 2316, 287, 2986, 9500, 13, 10816, 12, 17636, 290, 30852, 389, 1464, 15009, 422, 366, 1102, 690, 602, 546, 3234, 526, 3574, 428, 5228, 286, 262, 1499, 11, 366, 16740, 2316, 1, 319, 262, 2260, 1241, 2058, 866, 284, 2619, 393, 2635, 13, 1320, 338, 644, 262, 2056, 36145, 829, 290, 262, 1171, 24779, 13, 198, 198, 40, 4236, 2187, 44407, 351, 262, 11636, 546, 262, 761, 329, 3744, 4547, 11, 523, 326, 661, 286, 3124, 460, 1998, 1204, 1231, 7558, 852, 595, 48268, 13, 317, 2619, 582, 815, 307, 1498, 284, 6594, 281, 20932, 351, 257, 2635, 2415, 1231, 852, 11067, 355, 257, 2372, 0, 770, 289, 668, 641, 736, 284, 262, 10713, 326, 4191, 1718, 262, 1204, 286, 2295, 4164, 17888, 13, 198, 198, 464, 966, 546, 1176, 290, 262, 6227, 284, 5529, 340, 318, 523, 2081, 13, 4333, 287, 428, 3592, 318, 991, 2714, 416, 257, 11574, 2635, 3741, 11, 290, 1566, 2635, 11941, 9911, 5059, 3685, 588, 340, 750, 326, 1755, 287, 4744, 1377, 772, 996, 24332, 318, 407, 33961, 1146, 2635, 11, 339, 11298, 355, 2635, 11, 290, 373, 16164, 477, 465, 1204, 284, 262, 26166, 286, 1898, 12, 1087, 81, 1042, 1377, 290, 588, 340, 750, 618, 262, 9002, 3066, 284, 4078, 270, 683, 11, 356, 481, 7903, 11, 9960, 11, 290, 3763, 48006, 6465, 13, 198, 198, 10374, 5657, 1042, 290, 28849, 2221, 287, 262, 1363, 13, 45174, 10439, 19552, 511, 28849, 422, 511, 3397, 290, 28571, 13, 1119, 1183, 1208, 883, 3815, 319, 284, 511, 1751, 13, 39057, 9457, 262, 6333, 13, 198, 198, 1135, 346, 7893, 922, 2683, 13, 6350, 547, 484, 2714, 13, 4162, 547, 484, 407, 517, 6768, 3414, 30, 770, 318, 262, 1917, 351, 867, 286, 262, 386, 12, 39835, 22558, 13, 2750, 262, 640, 314, 3285, 546, 606, 11, 340, 338, 1165, 2739, 0, 1471, 11, 484, 423, 340, 287, 422, 286, 262, 3418, 2615, 379, 604, 4426, 319, 257, 3217, 10185, 198, 198, 1026, 338, 20755, 262, 1499, 11234, 351, 845, 1180, 26274, 546, 262, 1785, 852, 257, 2163, 286, 3234, 13, 314, 423, 1775, 1310, 326, 561, 1283, 284, 1085, 3812, 25625, 2890, 883, 37433, 42806, 13, 314, 836, 470, 760, 1521, 340, 561, 307, 1180, 287, 2986, 9500, 13, 198, 198, 10374, 441, 2486, 9209, 319, 8378, 286, 867, 2041, 5353, 1123, 290, 790, 1110, 13, 679, 925, 262, 2643, 355, 257, 1255, 286, 852, 739, 8157, 3833, 422, 1511, 4, 286, 262, 3265, 13, 1400, 530, 468, 257, 1917, 351, 262, 3527, 4494, 540, 6299, 339, 338, 925, 319, 8378, 286, 584, 2041, 1393, 2628, 11, 5928, 393, 3215, 13, 198, 198, 1, 1026, 338, 20755, 262, 1499, 11234, 351, 845, 1180, 26274, 546, 262, 1785, 852, 257, 2163, 286, 3234, 13, 314, 423, 1775, 1310, 326, 561, 1283, 284, 1085, 3812, 25625, 2890, 883, 37433, 42806, 13, 314, 836, 470, 760, 1521, 340, 561, 307, 1180, 287, 2986, 9500, 526, 198, 198, 15017, 9500, 338, 5510, 12, 7437, 3265, 318, 718, 4, 357, 259, 262, 2254, 351, 257, 2793, 5873, 287, 262, 3418, 737, 15616, 379 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
The Jasenovac camp complex consisted of five detention facilities established between August 1941 and February 1942 by the authorities of the so-called Independent State of Croatia. As Germany and its Axis allies invaded and dismembered Yugoslavia in April 1941, the Germans and the Italians endorsed the proclamation of the so-called Independent State of Croatia by the fanatically nationalist, fascist, separatist, and terrorist Ustaša organization on April 10, 1941. After seizing power, the Ustaša authorities erected numerous concentration camps in Croatia between 1941 and 1945. These camps were used to isolate and murder Jews, Serbs, Roma (also known as Gypsies), and other non-Catholic minorities, as well as Croatian political and religious opponents of the regime. The largest of these centers was the Jasenovac complex, a string of five camps on the bank of the Sava River, about 60 miles south of Zagreb. It is presently estimated that the Ustaša regime murdered between 77,000 and 99,000 people in Jasenovac between 1941 and 1945. In late August 1941, the Croat authorities established the first two camps of the Jasenovac complex—Krapje and Brocica. These two camps were closed four months later. The other three camps in the complex were: Ciglana, established in November 1941 and dismantled in April 1945; Kozara, established in February 1942 and dismantled in April 1945; and Stara Gradiška, which had been an independent holding center for political prisoners since the summer of 1941 and was converted into a concentration camp for women in the winter of 1942. The camps were guarded by Croatian political police and personnel of the Ustasa militia, which was the paramilitary organization of the Ustaša movement. Conditions in the Jasenovac camps were horrendous. Prisoners received minimal food. Shelter and sanitary facilities were totally inadequate. Worse still, the guards cruelly tortured, terrorized, and murdered prisoners at will. Between its establishment in 1941 and its evacuation in April 1945, Croat authorities murdered thousands of people at Jasenovac. Among the victims were: between 45,000 and 52,000 Serb residents of the so-called Independent State of Croatia; between 12,000 and 20,000 Jews; between 15,000 and 20,000 Roma (Gypsies); and between 5,000 and 12,000 ethnic Croats and Muslims, who were political and religious opponents of the regime. The Croat authorities murdered between 320,000 and 340,000 ethnic Serb residents of Croatia and Bosnia during the period of Ustaša rule; more than 30,000 Croatian Jews were killed either in Croatia or at Auschwitz-Birkenau. Between 1941 and 1943, Croat authorities deported Jews from throughout the so-called Independent State to Jasenovac and shot many of them at the nearby killing sites of Granik and Gradina. The camp complex management spared those Jews who possessed special skills or training, such as physicians, electricians, carpenters, and tailors. In two deportation operations, in August 1942 and in May 1943, Croat authorities permitted the Germans to transfer most of Croatia's surviving Jews (about 7,000 in total), including most of those still alive in Jasenovac, to Auschwitz-Birkenau in German-occupied Poland. As the Partisan Resistance Movement under the command of Communist leader Josip Tito approached Jasenovac in late April 1945, several hundred prisoners rose against the camp guards. Many of the prisoners were killed; a few managed to escape. The guards murdered most of the surviving prisoners before dismantling the last three Jasenovac camps in late April. The Partisans overran Jasenovac in early May 1945. Determining the number of victims for Yugoslavia, for Croatia, and for Jasenovac is highly problematic, due to the destruction of many relevant documents, the long-term inaccessibility to independent scholars of those documents that survived, and the ideological agendas of postwar partisan scholarship and journalism, which has been and remains influenced by ethnic tension, religious prejudice, and ideological conflict. The estimates offered here are based on the work of several historians who have used census records as well as whatever documentation was available in German, Croat, and other archives in the former Yugoslavia and elsewhere. As more documents become accessible and more research is conducted into the records of the Ustaša regime, historians and demographers may be able to determine more precise figures than are now available.
[ 464, 21961, 268, 709, 330, 1413, 3716, 19954, 286, 1936, 13280, 7291, 4920, 1022, 2932, 23234, 290, 3945, 22458, 416, 262, 4773, 286, 262, 523, 12, 7174, 13362, 1812, 286, 28975, 13, 1081, 4486, 290, 663, 38349, 7681, 26466, 290, 595, 11883, 9451, 37777, 287, 3035, 23234, 11, 262, 16064, 290, 262, 41720, 17441, 262, 39862, 286, 262, 523, 12, 7174, 13362, 1812, 286, 28975, 416, 262, 4336, 4142, 19848, 11, 28342, 11, 40680, 11, 290, 7417, 471, 38031, 32790, 64, 4009, 319, 3035, 838, 11, 23234, 13, 198, 198, 3260, 37054, 1176, 11, 262, 471, 38031, 32790, 64, 4773, 28415, 6409, 10368, 11665, 287, 28975, 1022, 23234, 290, 15761, 13, 2312, 11665, 547, 973, 284, 28091, 290, 5123, 6771, 11, 2930, 1443, 11, 29600, 357, 14508, 1900, 355, 18488, 862, 444, 828, 290, 584, 1729, 12, 48919, 15557, 11, 355, 880, 355, 48853, 1964, 290, 4158, 7691, 286, 262, 7142, 13, 383, 4387, 286, 777, 10399, 373, 262, 21961, 268, 709, 330, 3716, 11, 257, 4731, 286, 1936, 11665, 319, 262, 3331, 286, 262, 311, 4170, 5866, 11, 546, 3126, 4608, 5366, 286, 1168, 363, 34806, 13, 632, 318, 27606, 6108, 326, 262, 471, 38031, 32790, 64, 7142, 12864, 1022, 8541, 11, 830, 290, 7388, 11, 830, 661, 287, 21961, 268, 709, 330, 1022, 23234, 290, 15761, 13, 198, 198, 818, 2739, 2932, 23234, 11, 262, 22422, 4773, 4920, 262, 717, 734, 11665, 286, 262, 21961, 268, 709, 330, 3716, 960, 42, 2416, 18015, 290, 2806, 66, 3970, 13, 2312, 734, 11665, 547, 4838, 1440, 1933, 1568, 13, 383, 584, 1115, 11665, 287, 262, 3716, 547, 25, 32616, 75, 2271, 11, 4920, 287, 3389, 23234, 290, 44001, 287, 3035, 15761, 26, 40772, 3301, 11, 4920, 287, 3945, 22458, 290, 44001, 287, 3035, 15761, 26, 290, 2907, 64, 1902, 9189, 32790, 4914, 11, 543, 550, 587, 281, 4795, 4769, 3641, 329, 1964, 10577, 1201, 262, 3931, 286, 23234, 290, 373, 11513, 656, 257, 10368, 1413, 329, 1466, 287, 262, 7374, 286, 22458, 13, 198, 198, 464, 11665, 547, 28178, 416, 48853, 1964, 1644, 290, 8213, 286, 262, 471, 301, 15462, 21085, 11, 543, 373, 262, 43542, 4009, 286, 262, 471, 38031, 32790, 64, 3356, 13, 198, 198, 25559, 1756, 287, 262, 21961, 268, 709, 330, 11665, 547, 42613, 13, 16999, 364, 2722, 10926, 2057, 13, 36507, 290, 5336, 9331, 7291, 547, 6635, 20577, 13, 36855, 991, 11, 262, 10942, 1067, 518, 12810, 22485, 11, 3246, 1143, 11, 290, 12864, 10577, 379, 481, 13, 198, 198, 25262, 663, 9323, 287, 23234, 290, 663, 24663, 287, 3035, 15761, 11, 22422, 4773, 12864, 4138, 286, 661, 379, 21961, 268, 709, 330, 13, 9754, 262, 4970, 547, 25, 1022, 4153, 11, 830, 290, 6740, 11, 830, 2930, 65, 5085, 286, 262, 523, 12, 7174, 13362, 1812, 286, 28975, 26, 1022, 1105, 11, 830, 290, 1160, 11, 830, 6771, 26, 1022, 1315, 11, 830, 290, 1160, 11, 830, 29600, 357, 44802, 862, 444, 1776, 290, 1022, 642, 11, 830, 290, 1105, 11, 830, 9450, 9325, 1381, 290, 7045, 11, 508, 547, 1964, 290, 4158, 7691, 286, 262, 7142, 13, 198, 198, 464, 22422, 4773, 12864, 1022, 20959, 11, 830, 290, 28560, 11, 830, 9450, 2930, 65, 5085, 286, 28975, 290, 34292, 1141, 262, 2278, 286, 471, 38031, 32790, 64, 3896, 26, 517, 621, 1542, 11, 830, 48853, 6771, 547, 2923, 2035, 287, 28975, 393, 379, 37992, 12, 50091, 3464, 559, 13, 198, 198, 25262, 23234, 290, 21577, 11, 22422, 4773, 27434, 6771, 422, 3690, 262, 523, 12, 7174, 13362, 1812, 284, 21961, 268, 709, 330, 290, 2823, 867, 286, 606, 379, 262, 6716, 5170, 5043, 286, 17113, 1134, 290, 17701, 1437, 13, 383, 1413, 3716, 4542, 31348, 883, 6771, 508, 17273, 2041, 4678, 393, 3047, 11, 884, 355, 17206, 11, 5186, 1547, 11, 1097, 16923, 364, 11, 290, 7894, 669, 13, 554, 734, 24031, 4560, 11, 287, 2932, 22458, 290, 287, 1737, 21577, 11, 22422, 4773, 10431, 262, 16064, 284, 4351, 749, 286, 28975, 338, 16997, 6771, 357, 10755, 767, 11, 830, 287, 2472, 828, 1390, 749, 286, 883, 991, 6776, 287, 21961, 268, 709, 330, 11, 284, 37992, 12, 50091, 3464, 559, 287, 2679, 12, 28756, 12873, 13, 198, 198, 1722, 262, 2142, 9057, 17363, 15477, 739, 262, 3141, 286, 14884, 3554, 22568, 541, 7659, 78, 10448, 21961, 268, 709, 330, 287, 2739, 3035, 15761, 11, 1811, 3470, 10577, 8278, 1028, 262, 1413, 10942, 13, 4650, 286, 262, 10577, 547, 2923, 26, 257, 1178, 5257, 284, 6654, 13, 383, 10942, 12864, 749, 286, 262, 16997, 10577, 878, 41928, 262, 938, 1115, 21961, 268, 709, 330, 11665, 287, 2739, 3035, 13, 383, 2142, 26100, 625, 2596, 21961, 268, 709, 330, 287, 1903, 1737, 15761, 13, 198, 198, 35, 13221, 278, 262, 1271, 286, 4970, 329, 37777, 11, 329, 28975, 11, 290, 329, 21961, 268, 709, 330, 318, 4047, 15833, 11, 2233, 284, 262, 8166, 286, 867, 5981, 4963, 11, 262, 890, 12, 4354, 287, 15526, 2247, 284, 4795, 9123, 286, 883, 4963, 326, 11803, 11, 290, 262, 15735, 37611, 286, 44060, 19666, 18652, 290, 14033, 11, 543, 468, 587, 290, 3793, 12824, 416, 9450, 12097, 11, 4158, 20226, 11, 290, 15735, 5358, 13, 383, 7746, 4438, 994, 389, 1912, 319, 262, 670, 286, 1811, 21262, 508, 423, 973, 21649, 4406, 355, 880, 355, 4232, 10314, 373, 1695, 287, 2679, 11, 22422, 11, 290, 584, 22415, 287, 262, 1966, 37777, 290, 8057, 13, 198, 198, 1722, 517, 4963, 1716, 9857, 290, 517, 2267, 318, 5952, 656, 262, 4406, 286, 262, 471, 38031, 32790, 64, 7142, 11, 21262, 290, 1357, 34063, 743, 307, 1498, 284, 5004, 517, 7141, 5538, 621, 389, 783, 1695, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Based out of Los Angeles, we specialize in service and repair of all major home and commercial appliances, A/C and Heating units, including most brands and models. Serving the Greater Los Angeles and San Fernando Valley, see our Service Areas,Our technicians are well experienced and have many years of field work behind them. We offer same day service on most orders. There is no extra charge for evenings, weekends or holidays. We are always in your area, so there is no travel charge! Lastly, we only install brand new, factory recommended parts.
[ 15001, 503, 286, 5401, 5652, 11, 356, 39868, 287, 2139, 290, 9185, 286, 477, 1688, 1363, 290, 5068, 29834, 11, 317, 14, 34, 290, 679, 803, 4991, 11, 1390, 749, 11394, 290, 4981, 13, 49208, 262, 18169, 5401, 5652, 290, 2986, 31063, 6916, 11, 766, 674, 4809, 38662, 11, 5122, 33519, 389, 880, 5924, 290, 423, 867, 812, 286, 2214, 670, 2157, 606, 13, 775, 2897, 976, 1110, 2139, 319, 749, 6266, 13, 1318, 318, 645, 3131, 3877, 329, 37119, 11, 21511, 393, 17122, 13, 775, 389, 1464, 287, 534, 1989, 11, 523, 612, 318, 645, 3067, 3877, 0, 36778, 11, 356, 691, 2721, 4508, 649, 11, 8860, 7151, 3354, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Subscribe Translate Monday, October 13, 2014 Fordham’s First Win over Penn is a Record Breaker Fordham’s First Win over Penn is a Record Breaker (Photos by Gary Quintal) By Howard Goldin BRONX, NEW YORK, OCTOBER 13- The sixth meeting between the Fordham Rams (6-1, 2-0) and the University of Pennsylvania Quakers (0-4, 0-1) took place at Jack Coffey Field in the Bronx on October 11. The game on Saturday was the first victory of Fordham, 60-22, over the Quakers. The two teams seem to be heading in different directions. The win for Fordham was its fifth straight and 11th consecutive home win, and the loss for Penn was its eighth straight. The 60 points scored by the Rams was the most their Ivy League opponent had surrendered in a single game since its 61-0 defeat by #1 ranked Army on November 17, 1945. The visitors reached the scoreboard first as Penn quarterback Alek Torgerson threw a 33-yard touchdown pass to Ryan O’Malley at 10:01. To the credit of the Fordham defense, that intercepted two passes and forced two fumbles, the first Penn touchdown was also its last. The last 16 points scored by the Quakers were off the foot of Jimmy Gammil. The junior kicked the point after touchdown and five field goals. Fordham scored twice on the ground in the first quarter. Harrisburg, Pennsylvania native Chase Edmunds carried the ball three yards for Fordham’s first points. His 11th touchdown of the season, in only six games, has been topped only five times in Fordham history in a single (full). He rushed for 101 yards, the sixth game in which has rushed for triple figures of yards. He is the first Fordham freshman to have a season rushing yardage total above 1,000 (1,011). Fordham head coach Joe Moorhead, in his third successful season in the Bronx, spoke very highly of the sensational freshman’s work ethic, preparation, and effort, “He’s an old soul. Everything he’s gotten, he’s earned. It’s not a surprise the success he’s had.” Quarterback Mike Nebrich, a senior, has also been impressed by the freshman running back, “He’s been huge. It [his rushing] opens up the defense. You can lead as a freshman.” The second Fordham first quarter touchdown came on a recovered fumble and eight-yard run by senior defenseman DeAndre Slate. Fordham’s defensive onslaught during the remainder of the game was achieved through the air under the leadership and outstanding ability of quarterback Nebrich. The senior from Virginia spoke of how he sees his responsibility during each contest, “My job is to get us going anytime we start sputtering.” On Saturday, he completed 36 of 47 passes for a Fordham record of 566 yards, which broke the mark of 524 yards he set in 2013. Six of the 36 completions were for touchdowns, tying a Fordham game mark. Five different receivers caught touchdown tosses from Nebrich. Tubucky Jones Jr., like Nebrich, a University of Connecticut transfer, caught two, one of 37 yards and one of 47 yards. Jones caught 10 for 203 yards, the eighth highest total in Fordham history. Sam Ajala received eight passes for 199 yards, the ninth highest total. The 730 yards gained by the Fordham offense was a single game school record and the highest total by an NCAA FCS team this season. According to Moorhead, this success stems from good practice habits and game preparation. The coach also praised his players as being good students and fine human beings as well as good athletes. His own college experience at Fordham has obviously imbued in him the knowledge of what a student-athlete should be. After Fordham’s bye-week the team will travel to Lehigh for its next contest on October 25. The Rams will return to Jack Coffey Field on November 1 to host Colgate.
[ 27125, 198, 198, 8291, 17660, 198, 198, 23810, 11, 3267, 1511, 11, 1946, 198, 198, 37308, 2763, 447, 247, 82, 3274, 7178, 625, 6595, 318, 257, 13266, 44478, 198, 198, 37308, 2763, 447, 247, 82, 3274, 7178, 625, 6595, 318, 257, 13266, 44478, 198, 198, 7, 21197, 416, 10936, 33405, 282, 8, 198, 198, 3886, 8442, 3561, 259, 198, 198, 11473, 1340, 55, 11, 12682, 28154, 11, 42256, 9864, 1137, 1511, 12, 383, 11695, 3249, 1022, 262, 8092, 2763, 16077, 357, 21, 12, 16, 11, 362, 12, 15, 8, 290, 262, 2059, 286, 9589, 2264, 3979, 357, 15, 12, 19, 11, 657, 12, 16, 8, 1718, 1295, 379, 3619, 28584, 2959, 7663, 287, 262, 32486, 319, 3267, 1367, 13, 383, 983, 319, 3909, 373, 262, 717, 5373, 286, 8092, 2763, 11, 3126, 12, 1828, 11, 625, 262, 2264, 3979, 13, 383, 734, 3466, 1283, 284, 307, 9087, 287, 1180, 11678, 13, 383, 1592, 329, 8092, 2763, 373, 663, 8150, 3892, 290, 1367, 400, 12785, 1363, 1592, 11, 290, 262, 2994, 329, 6595, 373, 663, 16974, 3892, 13, 383, 3126, 2173, 7781, 416, 262, 16077, 373, 262, 749, 511, 27386, 4041, 6125, 550, 29209, 287, 257, 2060, 983, 1201, 663, 8454, 12, 15, 7433, 416, 1303, 16, 10307, 5407, 319, 3389, 1596, 11, 15761, 13, 198, 198, 464, 9692, 4251, 262, 50198, 717, 355, 6595, 7880, 9300, 74, 309, 2398, 882, 9617, 257, 4747, 12, 9413, 10242, 1208, 284, 6047, 440, 447, 247, 33776, 379, 838, 25, 486, 13, 1675, 262, 3884, 286, 262, 8092, 2763, 3761, 11, 326, 29842, 734, 8318, 290, 4137, 734, 277, 25329, 11, 262, 717, 6595, 10242, 373, 635, 663, 938, 13, 383, 938, 1467, 2173, 7781, 416, 262, 2264, 3979, 547, 572, 262, 2366, 286, 12963, 402, 6475, 346, 13, 383, 13430, 12165, 262, 966, 706, 10242, 290, 1936, 2214, 4661, 13, 198, 198, 37308, 2763, 7781, 5403, 319, 262, 2323, 287, 262, 717, 3860, 13, 10026, 7423, 11, 9589, 6868, 16346, 35646, 82, 5281, 262, 2613, 1115, 5695, 329, 8092, 2763, 447, 247, 82, 717, 2173, 13, 2399, 1367, 400, 10242, 286, 262, 1622, 11, 287, 691, 2237, 1830, 11, 468, 587, 20633, 691, 1936, 1661, 287, 8092, 2763, 2106, 287, 257, 2060, 357, 12853, 737, 679, 13999, 329, 8949, 5695, 11, 262, 11695, 983, 287, 543, 468, 13999, 329, 15055, 5538, 286, 5695, 13, 679, 318, 262, 717, 8092, 2763, 18621, 284, 423, 257, 1622, 15795, 12699, 496, 2472, 2029, 352, 11, 830, 357, 16, 11, 28555, 737, 198, 198, 37308, 2763, 1182, 3985, 5689, 31451, 2256, 11, 287, 465, 2368, 4388, 1622, 287, 262, 32486, 11, 5158, 845, 4047, 286, 262, 31826, 18621, 447, 247, 82, 670, 29520, 11, 11824, 11, 290, 3626, 11, 564, 250, 1544, 447, 247, 82, 281, 1468, 5848, 13, 11391, 339, 447, 247, 82, 7891, 11, 339, 447, 247, 82, 7366, 13, 632, 447, 247, 82, 407, 257, 5975, 262, 1943, 339, 447, 247, 82, 550, 13, 447, 251, 198, 198, 4507, 2571, 1891, 4995, 3169, 1671, 488, 11, 257, 4664, 11, 468, 635, 587, 12617, 416, 262, 18621, 2491, 736, 11, 564, 250, 1544, 447, 247, 82, 587, 3236, 13, 632, 685, 14363, 15795, 60, 9808, 510, 262, 3761, 13, 921, 460, 1085, 355, 257, 18621, 13, 447, 251, 198, 198, 464, 1218, 8092, 2763, 717, 3860, 10242, 1625, 319, 257, 11911, 41405, 290, 3624, 12, 9413, 1057, 416, 4664, 32246, 1024, 31258, 30621, 13, 198, 198, 37308, 2763, 447, 247, 82, 6110, 36847, 1141, 262, 17675, 286, 262, 983, 373, 8793, 832, 262, 1633, 739, 262, 5531, 290, 11660, 2694, 286, 7880, 3169, 1671, 488, 13, 383, 4664, 422, 6025, 5158, 286, 703, 339, 7224, 465, 5798, 1141, 1123, 8414, 11, 564, 250, 3666, 1693, 318, 284, 651, 514, 1016, 17949, 356, 923, 599, 33598, 13, 447, 251, 198, 198, 2202, 3909, 11, 339, 5668, 4570, 286, 6298, 8318, 329, 257, 8092, 2763, 1700, 286, 642, 2791, 5695, 11, 543, 6265, 262, 1317, 286, 642, 1731, 5695, 339, 900, 287, 2211, 13, 9699, 286, 262, 4570, 1224, 45240, 547, 329, 17692, 11, 28379, 257, 8092, 2763, 983, 1317, 13, 198, 198, 20029, 1180, 19137, 4978, 10242, 12153, 274, 422, 3169, 1671, 488, 13, 42850, 5309, 5437, 7504, 1539, 588, 3169, 1671, 488, 11, 257, 2059, 286, 14493, 4351, 11, 4978, 734, 11, 530, 286, 5214, 5695, 290, 530, 286, 6298, 5695, 13, 5437, 4978, 838, 329, 27408, 5695, 11, 262, 16974, 4511, 2472, 287, 8092, 2763, 2106, 13, 3409, 22028, 6081, 2722, 3624, 8318, 329, 1594, 5695, 11, 262, 19646, 4511, 2472, 13, 198, 198, 464, 767, 1270, 5695, 8618, 416, 262, 8092, 2763, 6907, 373, 257, 2060, 983, 1524, 1700, 290, 262, 4511, 2472, 416, 281, 15244, 376, 7902, 1074, 428, 1622, 13, 4784, 284, 31451, 2256, 11, 428, 1943, 21552, 422, 922, 3357, 13870, 290, 983, 11824, 13, 383, 3985, 635, 15342, 465, 1938, 355, 852, 922, 2444, 290, 3734, 1692, 9791, 355, 880, 355, 922, 10856, 13, 2399, 898, 4152, 1998, 379, 8092, 2763, 468, 6189, 33966, 1739, 287, 683, 262, 3725, 286, 644, 257, 3710, 12, 776, 5807, 815, 307, 13, 198, 198, 3260, 8092, 2763, 447, 247, 82, 33847, 12, 10464, 262, 1074, 481, 3067, 284, 1004, 8929, 329, 663, 1306, 8414, 319, 3267, 1679, 13, 383, 16077, 481, 1441, 284, 3619, 28584, 2959, 7663, 319, 3389, 352, 284, 2583, 1623, 10494, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
If you have very poor credit, the cheapest car insurance company is Nationwide. Here, your premium will be more than $435 less than the group average. Compared to the highest credit level, drivers with bad credit pay nearly $1,450 more per year for auto insurance. If you pay off a loan or otherwise improve your credit score, you should shop around for car insurance as your premium should change. Just another reason to keep your score up! You’ll notice that none of that liability coverage pays for your car or injuries, nor for any injuries your passengers sustain if you cause a wreck. This is why many people — particularly those whose car isn’t yet paid off — want “full coverage” car insurance. This isn’t actually a type of coverage, but instead typically refers to policies that include liability coverage, plus comprehensive and collision coverages. Auto Insurance is required by law for drivers in most states. Drivers who own a car and drive it often should definitely have auto insurance to cover the risk of damages to their car and personal injury and the liability of harm to other people and property. Otherwise, repairs and medical costs, particularly when you’re liable for an accident, can be very expensive. Liability auto insurance protects you from that worst case scenario by providing a cushion between your assets and the amount you’re on the hook for. For this reason, choosing the right auto liability limits is the most important part of your car insurance quote comparison. NerdWallet typically recommends having at least as much liability coverage as your net worth. The best car insurance companies have a few things in common: They have straightforward shopping experiences, take good care of policyholders after a crash and treat their customers with respect and courtesy. That means only insurers with high customer satisfaction scores and relatively few complaints to insurance commissioners make it to the top of our list of the best auto insurance companies. The key difference in collision vs. comprehensive coverage is that, to a certain extent, the element of the car driver's control. As we have stated before, collision insurance will typically cover events within a motorist's control, or when another vehicle collides with your car. Comprehensive coverage generally falls under "acts of God or nature," that are typically out of your control when driving. These can include such events as a spooked deer, a heavy hailstorm, or a carjacking. The life insurance market has shrunk by around 4% over the last ten years. Interestingly, the market shrunk after the recession then grew about 51% between 2010 and 2015, though it has since begun to drop in size again. In 2017, life insurance premiums exceeded the amount spent in four of the past five years, but still came short of levels seen in 2008 and 2015. Check out our graph below to see how the market has fluctuated in the last decade. All numbers in billions. Know when to cut coverage. Don’t strip away coverage just for the sake of cheaper insurance. You’ll need full coverage car insurance to satisfy the terms of an auto loan, and you’ll want it as long as your car would be a financial burden to replace. But for older cars, you can drop comprehensive and collision coverage, which only pay out up to your car’s current value, minus the deductible. The best companies will also have several supplemental coverage options, or endorsements, that you can add to your homeowners policy. Endorsements can vary, as some provide higher coverage limits for certain types of personal property like jewelry or fine furs; or they can provide supplemental coverage for risks — like water backups, floods, or earthquakes — not covered by home insurance. If you live in an area with unusual state regulations or heightened risk of weather-related claims, shopping car insurance options will be vital. Not every car insurance company offers policies in every state, which can make pricing less competitive. If you live in storm-prone states like Louisiana or Florida, you might find it harder to get a competitive rate. If you have very poor credit, the cheapest car insurance company is Nationwide. Here, your premium will be more than $435 less than the group average. Compared to the highest credit level, drivers with bad credit pay nearly $1,450 more per year for auto insurance. If you pay off a loan or otherwise improve your credit score, you should shop around for car insurance as your premium should change. Just another reason to keep your score up! To calculate the added cost in purchasing comprehensive and/or collision coverage we looked at annual insurance quotes for a 30 year old male from New York across four different insurance companies, and the ten best-selling vehicles in the US. We look at the range of rates you could pay from basic liability to policy plans with comprehensive and collision coverage. Collision typically costs more than comprehensive, although some companies require you to carry both rather than just one. Comparing quotes across at least three companies can get you lower car insurance rates.
[ 1532, 345, 423, 845, 3595, 3884, 11, 262, 28918, 1097, 5096, 1664, 318, 49232, 13, 3423, 11, 534, 8683, 481, 307, 517, 621, 720, 40064, 1342, 621, 262, 1448, 2811, 13, 27492, 284, 262, 4511, 3884, 1241, 11, 6643, 351, 2089, 3884, 1414, 3016, 720, 16, 11, 17885, 517, 583, 614, 329, 8295, 5096, 13, 1002, 345, 1414, 572, 257, 8063, 393, 4306, 2987, 534, 3884, 4776, 11, 345, 815, 6128, 1088, 329, 1097, 5096, 355, 534, 8683, 815, 1487, 13, 2329, 1194, 1738, 284, 1394, 534, 4776, 510, 0, 198, 1639, 447, 247, 297, 4003, 326, 4844, 286, 326, 12247, 5197, 13831, 329, 534, 1097, 393, 6821, 11, 4249, 329, 597, 6821, 534, 10405, 8080, 611, 345, 2728, 257, 15228, 13, 770, 318, 1521, 867, 661, 851, 3573, 883, 3025, 1097, 2125, 447, 247, 83, 1865, 3432, 572, 851, 765, 564, 250, 12853, 5197, 447, 251, 1097, 5096, 13, 770, 2125, 447, 247, 83, 1682, 257, 2099, 286, 5197, 11, 475, 2427, 6032, 10229, 284, 4788, 326, 2291, 12247, 5197, 11, 5556, 9815, 290, 17661, 3002, 1095, 13, 198, 198, 27722, 17541, 318, 2672, 416, 1099, 329, 6643, 287, 749, 2585, 13, 36577, 508, 898, 257, 1097, 290, 3708, 340, 1690, 815, 4753, 423, 8295, 5096, 284, 3002, 262, 2526, 286, 12616, 284, 511, 1097, 290, 2614, 5095, 290, 262, 12247, 286, 4419, 284, 584, 661, 290, 3119, 13, 15323, 11, 20097, 290, 3315, 3484, 11, 3573, 618, 345, 447, 247, 260, 17583, 329, 281, 5778, 11, 460, 307, 845, 5789, 13, 198, 198, 43, 12455, 8295, 5096, 17289, 345, 422, 326, 5290, 1339, 8883, 416, 4955, 257, 33579, 1022, 534, 6798, 290, 262, 2033, 345, 447, 247, 260, 319, 262, 8011, 329, 13, 1114, 428, 1738, 11, 11236, 262, 826, 8295, 12247, 7095, 318, 262, 749, 1593, 636, 286, 534, 1097, 5096, 9577, 7208, 13, 44031, 47152, 6032, 20829, 1719, 379, 1551, 355, 881, 12247, 5197, 355, 534, 2010, 2861, 13, 198, 464, 1266, 1097, 5096, 2706, 423, 257, 1178, 1243, 287, 2219, 25, 1119, 423, 15836, 9735, 6461, 11, 1011, 922, 1337, 286, 2450, 10476, 706, 257, 7014, 290, 2190, 511, 4297, 351, 2461, 290, 12537, 13, 1320, 1724, 691, 24668, 351, 1029, 6491, 14676, 8198, 290, 5365, 1178, 9687, 284, 5096, 33020, 787, 340, 284, 262, 1353, 286, 674, 1351, 286, 262, 1266, 8295, 5096, 2706, 13, 198, 464, 1994, 3580, 287, 17661, 3691, 13, 9815, 5197, 318, 326, 11, 284, 257, 1728, 6287, 11, 262, 5002, 286, 262, 1097, 4639, 338, 1630, 13, 1081, 356, 423, 5081, 878, 11, 17661, 5096, 481, 6032, 3002, 2995, 1626, 257, 5584, 396, 338, 1630, 11, 393, 618, 1194, 4038, 2927, 1460, 351, 534, 1097, 13, 40917, 5197, 4143, 8953, 739, 366, 8656, 286, 1793, 393, 3450, 553, 326, 389, 6032, 503, 286, 534, 1630, 618, 5059, 13, 2312, 460, 2291, 884, 2995, 355, 257, 599, 46288, 20096, 11, 257, 4334, 387, 11750, 579, 11, 393, 257, 1097, 73, 5430, 13, 198, 464, 1204, 5096, 1910, 468, 38900, 416, 1088, 604, 4, 625, 262, 938, 3478, 812, 13, 25044, 11, 262, 1910, 38900, 706, 262, 16457, 788, 6348, 546, 6885, 4, 1022, 3050, 290, 1853, 11, 996, 340, 468, 1201, 9258, 284, 4268, 287, 2546, 757, 13, 554, 2177, 11, 1204, 5096, 21884, 20672, 262, 2033, 3377, 287, 1440, 286, 262, 1613, 1936, 812, 11, 475, 991, 1625, 1790, 286, 2974, 1775, 287, 3648, 290, 1853, 13, 6822, 503, 674, 4823, 2174, 284, 766, 703, 262, 1910, 468, 19180, 6605, 287, 262, 938, 5707, 13, 1439, 3146, 287, 13188, 13, 198, 23812, 618, 284, 2005, 5197, 13, 2094, 447, 247, 83, 10283, 1497, 5197, 655, 329, 262, 11060, 286, 11721, 5096, 13, 921, 447, 247, 297, 761, 1336, 5197, 1097, 5096, 284, 15959, 262, 2846, 286, 281, 8295, 8063, 11, 290, 345, 447, 247, 297, 765, 340, 355, 890, 355, 534, 1097, 561, 307, 257, 3176, 10538, 284, 6330, 13, 887, 329, 4697, 5006, 11, 345, 460, 4268, 9815, 290, 17661, 5197, 11, 543, 691, 1414, 503, 510, 284, 534, 1097, 447, 247, 82, 1459, 1988, 11, 20208, 262, 42161, 13, 198, 464, 1266, 2706, 481, 635, 423, 1811, 34885, 5197, 3689, 11, 393, 40614, 11, 326, 345, 460, 751, 284, 534, 24692, 2450, 13, 5268, 7615, 902, 460, 7565, 11, 355, 617, 2148, 2440, 5197, 7095, 329, 1728, 3858, 286, 2614, 3119, 588, 22634, 393, 3734, 277, 1834, 26, 393, 484, 460, 2148, 34885, 5197, 329, 7476, 851, 588, 1660, 35872, 11, 27283, 11, 393, 29781, 851, 407, 5017, 416, 1363, 5096, 13, 198, 1532, 345, 2107, 287, 281, 1989, 351, 8468, 1181, 6647, 393, 25556, 2526, 286, 6193, 12, 5363, 3667, 11, 9735, 1097, 5096, 3689, 481, 307, 9204, 13, 1892, 790, 1097, 5096, 1664, 4394, 4788, 287, 790, 1181, 11, 543, 460, 787, 13045, 1342, 7606, 13, 1002, 345, 2107, 287, 6388, 12, 46330, 2585, 588, 13340, 393, 4744, 11, 345, 1244, 1064, 340, 7069, 284, 651, 257, 7606, 2494, 13, 198, 198, 1532, 345, 423, 845, 3595, 3884, 11, 262, 28918, 1097, 5096, 1664, 318, 49232, 13, 3423, 11, 534, 8683, 481, 307, 517, 621, 720, 40064, 1342, 621, 262, 1448, 2811, 13, 27492, 284, 262, 4511, 3884, 1241, 11, 6643, 351, 2089, 3884, 1414, 3016, 720, 16, 11, 17885, 517, 583, 614, 329, 8295, 5096, 13, 1002, 345, 1414, 572, 257, 8063, 393, 4306, 2987, 534, 3884, 4776, 11, 345, 815, 6128, 1088, 329, 1097, 5096, 355, 534, 8683, 815, 1487, 13, 2329, 1194, 1738, 284, 1394, 534, 4776, 510, 0, 198, 198, 2514, 15284, 262, 2087, 1575, 287, 14080, 9815, 290, 14, 273, 17661, 5197, 356, 3114, 379, 5079, 5096, 13386, 329, 257, 1542, 614, 1468, 4257, 422, 968, 1971, 1973, 1440, 1180, 5096, 2706, 11, 290, 262, 3478, 1266, 12, 16473, 5672, 287, 262, 1294, 13, 775, 804, 379, 262, 2837, 286, 3965, 345, 714, 1414, 422, 4096, 12247, 284, 2450, 3352, 351, 9815, 290, 17661, 5197, 13, 7778, 1166, 6032, 3484, 517, 621, 9815, 11, 3584, 617, 2706, 2421, 345, 284, 3283, 1111, 2138, 621, 655, 530, 13, 3082, 1723, 13386, 1973, 379, 1551, 1115, 2706, 460, 651, 345, 2793, 1097, 5096, 3965, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
The authors confirm that all data underlying the findings are fully available without restriction. All relevant data are within the paper. Introduction {#s1} ============ Mechanical ventilation (MV) has been used in critical care patients for decades. In spite of its life-saving potential, it has several shortcomings. A number of experimental studies have shown that mechanical ventilation may result in the appearance of inflammatory mediators in the lung [@pone.0114247-Uhlig1] and subsequently in oedema. [@pone.0114247-Dreyfuss1] Ventilator-Induced Lung Injury (VILI) causes macro and microscopic unspecific changes[@pone.0114247-Katzenstein1] similar to those found in patients with Acute Respiratory Distress Syndrome (ARDS). As it happens with ARDS, VILI is basically the result of important changes in the permeability of the alveolar-capillary membrane. [@pone.0114247-Dreyfuss2] The potential of mechanical ventilation for triggering or worsening pulmonary damages has been shown in animal models where the application of non-physiological ventilatory parameters (mostly very high tidal volumes) aggravated the condition of animals with a previously injured lung [@pone.0114247-Corbridge1], and even caused an injury in those without a previous pulmonary pathology. [@pone.0114247-Dreyfuss1] The use of low tidal volumes has proved to be a better approach in ARDS patients, survival being improved in strategies based on its usage. [@pone.0114247-Amato1]--[@pone.0114247-Villar1] Interestingly, recent experimental and clinical work has demonstrated that MV with low tidal volume can induce similar pulmonary changes to those noticed for VILI [@pone.0114247-Cobelens1]--[@pone.0114247-Wolthuis1] and that its appearance may be related to MV exposure time. [@pone.0114247-Hegeman1] Aquaporins are a family of small transmembrane proteins that help water to move fast, selectively and bi-directionally through lipid bi-layers. [@pone.0114247-Kozono1], [@pone.0114247-Ma1] 13 different types have been identified in mammals, [@pone.0114247-Verkman1] from which the lung is known to express four: AQP-1, in the pulmonary capillary endothelium (especially alveolar), and the visceral pleura; AQP-3, in the tracheal epithelium; AQP-4, in the tracheal and bronchial epithelium; and AQP-5, on type I pneumocyte cells of the alveoli, on the membrane adjoining to the alveolar lumen. [@pone.0114247-King1] Their role in the development and resolution of pulmonary oedema gives rise to controversy, although it does seem to play a part in VILI. [@pone.0114247-Hales1] This research aimed to verify if MV with low or moderately high tidal volumes (10 ml/Kg) sustained over time results in lung injury, subsequently altering pulmonary water content and microvascular permeability, as observed in VILI, and to objectivize what happens with AQP 1 and 5 expression, both types mainly involved in the formation of lung oedema, under the same ventilation conditions. Material and Methods {#s2} ==================== 1. Ethics statement {#s2a} ------------------- The project was carried out after approval from the Ethics Committee for Animal Experimentation and Wellbeing of the Research Foundation of Valencia\'s Hospital Clínico Universitario. 2. Animal model and monitoring {#s2b} ------------------------------ A total of 30 rats were anaesthetised by intraperitoneal injection of ketamine 80 mg/kg and xylazine 5 mg/kg. 5 rats (group C or controls) were sacrificed by intravenous injection of 100 mg/Kg thiopental. The rest of the animals (n = 25) were performed a surgical tracheostomy, using a teflon cannula (Surflo, 16G). Rats were randomly allocated into two groups. 12 rats were ventilated for 2 hours (group 2H) with a Harvard Rodent Ventilator, model 683 (Harvard Apparatus) with a tidal volume of 10 ml/kg and a respiratory rate of 90 breaths/minute. 13 rats were ventilated with exactly the same parameters for 4 hours (group 4H). The cervical vascular bundle was dissected, and the right internal jugular vein and the right carotid artery were catheterized to continuously monitor heart rate (HR) and mean arterial pressure (MAP). Peak inspiratory pressure and respiratory system compliance were continuously recorded. Anaesthesia was maintained by continuous intravenous infusion of ketamine and cisatracurium using dosis of 100 mcg/Kg/min and 2--3 mcg/Kg/min, respectively (20 ml of ketamine 5%, 10 ml of cisatracurium 0,2% and 20 ml of saline solution 0,9% at a rate of approximately 0,1 ml/h in the internal jugular vein). Anesthesia was supplemented, in cases in which it was necessary, by administration of an intravenous bolus of 0.1 ml of the mixture. Gasometric samples were taken in all animals in groups 2H and 4H at the beginning of MV and 30 minutes before the end of MV. Rats were sacrificed by intravenous injection of sodium thiopental. The left lung was used for the determination of lung water content. The right lung of 6 rats from groups 2H and 4H was used for determining AQP 1 and AQP 5 expression. Lungs were either frozen in liquid nitrogen or paraffin-embedded for immunohistochemical sectioning and marking. 2 rats in group C and 4 rats from groups 2H and 4H were used to establish pulmonary macrovascular permeability. 3. Measuring lung oedema {#s2c} ------------------------ Lungs were dried with filter paper and placed on a Petri dish with known weight to obtain lung wet weight (LWW). They were then placed in a drying chamber at 80°C for 96 hours and their dry weight (LDW) was determined. Two indicators of the amount of oedema were obtained: Lung WW/DW ratio and the proportion of pulmonary water, expressed in percentages (%~water~). The latter parameter was estimated using this formula: % ~water~  =  (LWW - LDW)/LWW \* 100 4. Measuring microvascular permeability {#s2d} --------------------------------------- Microvascular permeability was quantified using Evans Blue Dye. 0.5 ml Evans Blue was injected intravenously (30 mg/Kg) 30 minutes before sacrificing the animal. Rats were sacrificed by exsanguination from the carotid artery, but saline was simultaneously infused via the jugular vein in the same amount as that of the blood extracted. After death, the right lung was separated and immersed in formamide (5 ml) and homogenised for 2 min. The resulting suspension was incubated at 37°C/18 h and then centrifuged at 5000xg/30 minutes, and the supernatant was measured. Concentration of Evans Blue in the supernatant was spectrophotometrically determined. 5. Study of aquaporin expression {#s2e} -------------------------------- ### 5.1 Western blot {#s2e1} Proteins were extracted from previously frozen lungs. A Compartmental Protein Extraction Kit (Chemicon International, Temecula CA) was used. 200--400 mg tissue was homogenised in cold buffer C (1 ml/g tissue) and Ultra Turrax (KA, Staufen, Germany). Two protein fractions were obtained for each sample: cytoplasm and membrane, and they were quantified. Proteins in each fraction (100 mg) were separately run on a Tris-HCl/SDS gel, 8% acrylamide, and they were transferred onto a nitrocellulose membrane (Hybond-ECL, Amersham). After washing the membrane with distilled water, it was blocked with a PBS/Tween solution, 0.2%, with 5% skimmed milk. It was then incubated with the primary antibody during 2 hours at room temperature. The antibodies used were Anti-Rat AQP1 (Alpha Diagnostic, San Antonio, TX) and Anti-Rat AQP5 (Alpha Diagnostic, San Antonio, TX), both with a 2 mg/ml concentration. After several washes with PBS/Tween 0.2%, it was incubated with the secondary antibody Anti-Rabbit IgG (DAKO, Glostrup, Denmark) in 1∶2000 dilution. β-actin expression was detected as an internal control, and relative protein content was analysed using the enhanced chemoluminiscence method. ### 5.2 Real-time polymerase chain reaction with reverse transcriptase {#s2e2} Lungs were cut with a microtome, three sections being obtained for each sample for total RNA extraction with TRIZOL (Reagent InvitrogenTM Life Technologies) as in the phenol extraction method described by Chomczynsky. [@pone.0114247-Chomczynski1] Microsections were added 1 ml TRIZOL and homogenized (Polytron PT 1200, Kinematica AG) and centrifuged at 10.000 rpm/10 min at 4°C. The supernatant was removed and RNA was precipitated by adding 0.1 volumes of sodium acetate 3 M, 2.5 volumes cold ethanol and 0.5 µl glycogen (20 mg/ml). RNA was centrifuged again, air-dried and resuspended in 20 µl Tris/EDTA buffer. RNA was reversely transcribed to cDNA with Superscript II (Invitrogen), by incubation with reverse transcriptase at 50°C for 30 min, followed by amplification with custom primers (Invitrogen), summarised in [Table 1](#pone-0114247-t001){ref-type="table"}. 35 amplification cycles were completed, with denaturalization at 95°C (30 sec), hybridization (30 sec) (temperatures on [Table 1](#pone-0114247-t001){ref-type="table"}) and extension at 72°C (1 min). Following amplification, RT-PCR products were separated in agarose gels at 1% and bands were viewed by ethidium bromide staining, and quantified by band density scanning using Scion Image (Beta 4.02, Scion Corporation). Results were expressed in relation to the level of β-actin mRNA in the same RNA samples. 10.1371/journal.pone.0114247.t001 ###### RT-PCR primer sequences and temperature conditions. ![](pone.0114247.t001){#pone-0114247-t001-1} Gene Primer (5′-3′) Primer, counterclockwise (5′--3) T (°C) --------- ---------------------------- ---------------------------------- -------- AQP1 TCTGGAGGCTGTGGTGGCT AAGTGAGTTCTCGAGCAGGGA 60 AQP5 TGGGTCTTCTGGGTAGGGCCTATTGT GCCGGCTTTGGCACTTGAGATACT 50 β-Actin ATCATGTTTGAGACCTTCAACA CATCTCTTGCTCGAAGTCCA 56 ### 5.3 Immunohistochemical study {#s2e3} Sections (4 µm thickness) from the paraffin-embedded lungs were obtained with the microtome. After the sections were dewaxed and hydrated, autoclave pretreatment (10 min, 121°C) for AQP1 and AQP5 antigen retrieval was performed and the sections were incubated in 1% H2O2 for 30 min at room temperature to block endogenous peroxidase activity. After being washed in PBS, the sections were then preincubated with goat serum albumin for 30 min at 37°C, and subsequently incubated with the primary antibodies against AQP1 (1∶500) and AQP5 (1∶300) for 18 h at 4°C. Then, the sections were washed with PBS and stained with Biotin-labelled goat anti-rabbit IgG for 30 min at 37°C. Intervening washes in PBS again were followed by incubation with Horseradish enzyme labelled streptavidin working solution for 30 min at 37°C. The sections were washed in PBS before application of diaminobenzidine (DAB), then were mounted under coverslip and analyzed under light microscope. 6. Statistical analysis {#s2f} ----------------------- Results were expressed as mean ± standard deviation (SD). To compare results between groups, the non-parametric Kruskall-Wallis and Mann-Whitney tests were used. For the analysis of data within each individual group, the Wilconxon test was applied. Regression analyses for the amount of aquaporins and mRNA and determination coefficients (R^2^) were performed. Values of p\<0.05 were assumed to be statistically significant in all cases. Results {#s3} ======= 1. Pulmonary oedema {#s3a} ------------------- No significant differences were found between the three groups for the wet weight-dry weight ratio (group C: 4.72±0.04 vs. group 2H: 4.90±0.33 vs. group 4H: 5.23±0.79) or the percentage of pulmonary water (group C: 78.82±0.16 vs. group 2H: 79.52±1.31 vs. group 4H: 80.55±2.50), though an increasing trend was noticed for both parameters ([Fig. 1](#pone-0114247-g001){ref-type="fig"}). ![Pulmonary water content charts.\ **A.** The bar chart shows the results of lung wet weight/dry weight ratio (WW/DW). **B.** Graphic representation of pulmonary water content (%~water~). Error bars represent standard deviation. Group C  =  Control rats; Group 2H  =  Rats ventilated with 10 ml/Kg tidal volume for 2 hours; Group 4H  =  Rats ventilated with 10 ml/Kg tidal volume for 4 hours.](pone.0114247.g001){#pone-0114247-g001} 2. Ventilatory mechanics and hemodynamic parameters {#s3b} --------------------------------------------------- Peak inspiratory pressure (PIP) progressively rose in both groups (group 2H and group 4H), higher values being found 90 minutes after the start of the experiment in group 2H and at minute 60 in group 4H ([Fig. 2](#pone-0114247-g002){ref-type="fig"}). No differences were found in the cut-off points of the two groups. ![Peak inspiratory pressure.\ The figure shows the results of animals in Groups 2H (ventilated for 2 hours) and 4H (ventilated for 4 hours). **A.** Evolution of peak inspiratory pressure in relation to time. **B.** Graphic representation of mean peak inspiratory pressure in Groups 2H and 4H. Error bars represent standard deviation. Group 2H  =  Rats ventilated with 10 ml/Kg tidal volume for 2 hours; Group 4H  =  Rats ventilated with 10 ml/Kg tidal volume for 4 hours. ^\*^ p\<0.05 in relation to baseline of Group 2H. \* p\<0.05 in relation to baseline of Group 4H. \# p\<0.05 in relation to Group 2H.](pone.0114247.g002){#pone-0114247-g002} Pulmonary compliance was reduced gradually in both groups, with significance in respect of the initial value as from minute 30 for group 2H and minute 60 in group 4H ([Fig. 3A](#pone-0114247-g003){ref-type="fig"}). No differences were found between the groups in none of the cut-off points. This decrease in compliance correlated with the peak pressure rise, with an R^2^ value of 0.98, p\<0.01 ([Fig. 3B](#pone-0114247-g003){ref-type="fig"}). ![Pulmonary compliance.\ **A.** Evolution of animals in Groups 2H (ventilated for 2 hours) and 4H (ventilated for 4 hours) in relation to time. Error bars represent standard deviation. **B.** Dispersion chart and trend line for variation in pulmonary compliance in relation to peak inspiratory pressure in Group 4H animals (ventilated during 4 hours). \*p\<0.05 in relation to baseline of Group 2H. \# p\<0.05 in relation to baseline of Group 4H.](pone.0114247.g003){#pone-0114247-g003} Rats in both groups were hemodynamically stable. No differences were found in mean arterial pressure (group 2H: 97.95 mmHg ±27.75 vs. group 4H: 104.53 mmHg ±27.54), and the same applies to average heart rate values (group 2H: 341.29 bpm ±66.73 vs. group 4H: 306.52 bpm ±78.11). Mean arterial pressure (MAP) dropped in group 2H progressively compared to the baseline as from minute 60, but this also happened in group 4H as from minute 45. Heart rate also decreased after 120 minutes ([Fig. 4](#pone-0114247-g004){ref-type="fig"}). ![Evolution of hemodynamic parameters.\ **A.** Mean arterial pressure (MAP) and **B**. heart rate (HR) in Groups 2H (ventilated for 2 hours) and 4H (ventilated for 4 hours). Error bars represent standard deviation. \*p\<0.05 in relation to baseline of Group 2H. \* p\<0.05 in relation to baseline of Group 4H.](pone.0114247.g004){#pone-0114247-g004} 3. Gasometric parameters {#s3c} ------------------------ Gasometric results for groups 2H and 4H are summarised in [Table 2](#pone-0114247-t002){ref-type="table"}. No differences were found for pH, pCO~2~, ABE and lactate values within the study groups, and differences between the two groups were not found either. But a tendency towards mixed acidosis in relation to duration of MV was observed. Oxygenation presented a tendency to pO~2~ and pO~2~/FiO~2~ ratio reduction two hours after MV in group 2H, which was slightly more marked in group 4H after 4 hours. 10.1371/journal.pone.0114247.t002 ###### Results of arterial blood gas tests in Group 2H (ventilated for 2 hours, 10 ml/Kg) and Group 4H (ventilated for 4 hours, 10 ml/Kg). ![](pone.0114247.t002){#pone-0114247-t002-2} Group 2H (2 hours) Group 4H (4 hours) -------------- -------------------- --------------------------------------------- -------------- --------------- **pH** 7,29±0,05 7,21±0,07 7,30±0,05 7,23±0,07 **pCO2** 47,96±3,56 56,87±18,04 47,33±8,51 52,84±7,73 **ABE** −3,96±2,02 −6,70±1,61[\*](#nt102){ref-type="table-fn"} −3,70±2,72 −6,26±4,20 **Lac** 2,08±0,62 1,99±0,66 1,79±0,74 1,91±1,24 **pO2** 93,30±17,72 91,56±16,56 97,28±15,76 83,03±24,27 **pO2/FiO2** 444,38±84,62 436,86±79,17 462,78±74,61 395,22±115,30 Values expressed as mean ± standard deviation. \* p \<0.05 in relation to baseline. 4. Microvascular permeability {#s3d} ----------------------------- A significant increase in microvascular permeability was not found. Evans Blue absorbance on lung tissue was as follows: 16.08 ng/mg ±2.45 in group C; 25.96 ng/mg ±9.90 in group 2H and 20.39 ng/mg ±2.20 in group 4H. 5. Expression of aquaporins 1 and 5 {#s3e} ----------------------------------- AQP 1 steady state levels measured by Western blot in membrane and cytoplasm did not show statistically significant differences in relation to duration of MV ([Figs. 5](#pone-0114247-g005){ref-type="fig"} and [6](#pone-0114247-g006){ref-type="fig"}). ![Western Blot densitometry values.\ Mean values. Error bars represent standard deviation. AQP 1 cyt.  =  Aquaporin 1, cytosolic; AQP 1 mb.  =  Aquaporin 1, membrane; AQP 5 cyt.  =  Aquaporin 5, cytosolic; AQP 5 mb.  =  Aquaporin 5, membrane. \* p \<0.05 in relation to value of Group C. \# p \<0.05 in relation to value of Group 2H.](pone.0114247.g005){#pone-0114247-g005} ![Western blot, AQP 1, cytosolic and membrane.](pone.0114247.g006){#pone-0114247-g006} AQP-5 steady state levels in cytoplasm and membranes was significantly greater in both groups (2H and 4H) vs. the controls. Besides, AQP-5 expression on cytoplasm and membranes was greater in group 4H than in group 2H (p = 0.027 and p = 0.039, respectively) ([Figs. 5](#pone-0114247-g005){ref-type="fig"} and [7](#pone-0114247-g007){ref-type="fig"}). To better characterize these differences in the expression of AQP 5, a regression analysis of both variables was conducted, which provided a coefficient of determination R^2^ = 0.80 (p = 0.008) and R^2^ = 0.90 (p = 0.001) ([Fig. 8](#pone-0114247-g008){ref-type="fig"}). ![Western blot, AQP 5, cytosolic and membrane.](pone.0114247.g007){#pone-0114247-g007} ![Dispersion chart and regression lines for Western Blot densitometries, AQP 5, cytosolic and membrane, in relation to time.\ Values correspond to dispersion coefficients R^2^. AQP 5 cyt.  =  Aquaporin 5, cytosolic; AQP 5 mb.  =  Aquaporin 5, membrane.](pone.0114247.g008){#pone-0114247-g008} RT-PCR results show a significant increase in the amount of mRNA for AQP-1 in groups 2H and 4H compared to group C. For AQP 5, an increase was found in the amount of mRNA in group 4H compared to group C ([Fig. 9](#pone-0114247-g009){ref-type="fig"}). The regression analysis of the amount of mRNA showed very significant determination coefficients for alveolar AQP 5 and AQP 1 in relation to duration of MV (R^2^ AQP-5 = 0.71 (p\<0.001) and R^2^ AQP-1 = 0.69 (p\<0.001). ![Representation of mRNA measured by RT-PCR.\ Error bars represent standard deviation. \*p\<0.05 in relation to value of Group C. \# p\<0.05 in relation to value of Group 2H.](pone.0114247.g009){#pone-0114247-g009} Immunohistochemical lung preparations of AQP-5 show the membranes of type 1 pneumocytes delimiting the alveolar network. The intensity of the staining increases with duration of MV ([Fig. 10](#pone-0114247-g010){ref-type="fig"}). AQP 1 samples show the network of the alveolar capillaries, as AQP-1 is found in endothelial cells and red blood cells but not in the pneumocytes covering the alveolus. In this case, image analysis does not show an increase in dye intensity in relation to MV time ([Fig. 11](#pone-0114247-g011){ref-type="fig"}). ![Inmunohistochemistry of AQP 5.\ The dye stakes the alveolar network and the surface of type 1 pneumocytes perfectly. Staining is more intense with longer MV exposure times (Groups 2H and 4H).](pone.0114247.g010){#pone-0114247-g010} ![Immunohistochemistry of AQP 1.\ The dye demarks the microvascular network of capillaries around the alveoli, on the endothelium, of which AQPs-1 are preferentially expressed, as well as on the erythrocytes. No staining can be seen on type 1 pneumocytes.](pone.0114247.g011){#pone-0114247-g011} Discussion {#s4} ========== MV with high tidal volumes or without positive end-expiratory pressure (PEEP) may lead to the appearance of inflammatory mediators in the lung via mechanotransduction. [@pone.0114247-Uhlig1], [@pone.0114247-Tremblay1], [@pone.0114247-Bueno1] MV with tidal volumes over 12 ml/kg is associated with a bad prognosis, while \"lung-protective ventilation\" with low tidal volumes (under 10 ml/kg) and PEEP optimization reduces ventilation-induced injuries. [@pone.0114247-Noauthors1] However, ventilation with low tidal volumes may result in the appearance of an inflammatory response pattern in the lung. In rats ventilated with low pressures (12 cmH~2~O) and 4 cmH~2~O PEEP during 4 hours, increased activity of myeloperoxidase and macrophage inflammatory protein-2 and interleukin-6 has been reported. [@pone.0114247-Cobelens1] Similarly, mild pro-inflammatory changes have been found in tracheal aspirates and blood of children with healthy lungs ventilated for 2 hours for heart surgery. [@pone.0114247-Plotz1] Likewise, 6 ml/Kg tidal volume MV in Wistar rats has been reported to induce a proinflammatory and profibrogenic response in the lung. [@pone.0114247-Caruso1] And in mechanically ventilated mice at 7.5 ml/Kg for 5 hours, rising levels of IL-6, TNF-α and lung water were found. [@pone.0114247-Wolthuis1] Conversely, some trials have demonstrated MV with tidal volumes of 10 ml/kg during 6 hours not to cause an increase in cytokine expression. [@pone.0114247-Altemeier1] Similarly, no increases in cytokines or mediators were found in previously healthy patients undergoing MV after one hour of exposure, even with tidal volumes of 15 ml/Kg. [@pone.0114247-Wrigge1] Based on our results, we fail to confirm that MV with scarcely injurious parameters during 4 hours causes acute lung damage or changes in pulmonary permeability with an increase in lung water. A mild trend was observed in our experiments, however. Although levels were not measured for any inflammatory mediator, based on previous studies, inflammatory mediators are likely to be increased by MV even with low tidal volumes. General anaesthesia and the supine position are known to cause pulmonary atelectasis with predominance in the dependent region. [@pone.0114247-Hedenstierna1] These give the lung a heterogeneous appearance in which atelectasis areas co-exist with aired and even overdistended areas and their corresponding transition zones. [@pone.0114247-Dreyfuss2] Besides, the use of low tidal volumes without PEEP can result in the appearance and maintenance of atelectasis in patients under general anaesthesia and muscular relaxation. [@pone.0114247-Wolthuis1] Regular recruitment with frequent deep insufflations during low tidal volume MV has been reported to improve oxygenation without signs of lung injury in mice mechanically ventilated for hours. [@pone.0114247-Allen1] Therefore, this would explain the worsening observed in the oxygenation of our animals as exposure to MV with low tidal volumes and without PEEP increased. Our animals may have developed atelectasis in dependent areas, causing different degrees of atelectrauma that would explain the degradation in oxygenation seen in the experiment (*see* [Table 2](#pone-0114247-t002){ref-type="table"}), although it was not statistically significant, as well as the fall in pulmonary compliance and the rise in peak inspiratory pressure (*see* [Figs. 2](#pone-0114247-g002){ref-type="fig"} and [3A](#pone-0114247-g003){ref-type="fig"}). The latter parameters correlated linearly with a coefficient of determination R^2^ of 0.98 in group 4H (animals ventilated for 4 hours) ([Fig. 3B](#pone-0114247-g003){ref-type="fig"}). Although acid-base parameters are well-known reliable indicators of animal wellbeing, they have only been partially evaluated in murine mechanical ventilation models. [@pone.0114247-Cobelens1], [@pone.0114247-Belperio1], [@pone.0114247-Altemeier1], [@pone.0114247-Tremblay1] In our model, ventilated animals in groups 2H and 4H showed a trend towards mixed acidosis but without significance. As a result of the formation of atelectasis and higher pressures, ventilation might have been less effective, which could account for the rise in pCO~2~ levels, although not significantly. The metabolic component of acidosis can have several causes. Metabolic acidosis in mice can be induced by saline administration, [@pone.0114247-Zuurbier1], [@pone.0114247-Wolthuis1] which in our animals was used for maintenance at very low levels. Yet, metabolic acidosis caused by some hemodynamic failure cannot be totally excluded. This is possibly related to poor compensation for losses rather than potential deficits in venous return and secondary low cardiac output, as a result of the thoracic pressure reversal observed in positive pressure MV. [@pone.0114247-Schwarte1] Similarly, heart rate data showed a significant reduction over time from minute 120 of the experiment, although always within the physiological range of rats. [@pone.0114247-Papadimitriou1] To date, no research group has explored the expression of AQP 1 and AQP 5 jointly in mechanically ventilated rats with low tidal volumes. However, a study conducted in rats ventilated with very high tidal volumes (40 ml/Kg during 4 hours) showed a reduction in AQP 1 expression. The researchers suggested an inflammatory mediator secondary mechanism, as they managed to mitigate the reduction in AQP 1 by administering a cyclooxygenase 2 inhibitor. [@pone.0114247-Jin1] In another trial, based on an animal model of ARDS induced by smoke inhalation, animals were subjected to MV, finding an increase in mRNA for AQP 1. [@pone.0114247-Schmalstieg1] The shortcoming in these studies is the absence of a control group with non-ventilated animals to study AQP expression. Our experiments show an increase in AQP 5 expression that became more significant as MV exposure was prolonged and, similarly, an increase in mRNA of AQP 5 which was also greater in group 4H compared to non-ventilated animals. These increases were not accompanied by significant variations in lung water content or microvascular permeability. Although an increase in AQP 1 in the lungs was not found, after 4 h of MV, our study did find a significant increase in mRNA. This is likely to be the previous step to AQP 1 synthesis. It is possibly due to the fact that a longer MV period is needed for an increase in AQP 1 on cytoplasm and membranes to be seen with the Western blot. Different factors have been shown to modulate the amount of AQPs, reducing them under a number of pathological conditions and leading to an increase in pulmonary water and oedema. [@pone.0114247-Wang1]--[@pone.0114247-Jiao1] In addition, the fact that lung injury parameters improve when their expression is induced, assigns AQPs a protective mechanism in the occurrence and development of pulmonary oedema. [@pone.0114247-Cao1]--[@pone.0114247-Dong1] Although some studies with genetically modified animals debate the possible relevant role of AQPs in the reabsorption of alveolar water, they prove the importance of these channels in pulmonary permeability. [@pone.0114247-Bai1], [@pone.0114247-Ma1], [@pone.0114247-Song1] Significant changes in lung water or microvascular permeability were not objectivized in our animals. The explanation for this could be that AQPs, according to some authors, only work in situations of stress. [@pone.0114247-Hales1] Further studies are needed to determine the true role of AQP1 and AQP 5 in MV. To conclude, in our model prolonged MV and tidal volumes of 10 ml/Kg for 4 hours did not result in increased pulmonary water or changes in microvascular permeability, these being mechanisms involved in ventilation-induced lung injury. Our study found an increase in the protein expression of AQP 5 and its mRNA, correlated with exposure time and mechanical ventilation. Likewise, the amount of mRNA for AQP 1 also increased in correlation with MV time. Apparently, AQP 5 and AQP 1 can have a protective effect against MV-induced pulmonary oedema, but more studies are needed to clarify whether these proteins really play a relevant role in mechanically ventilated lungs under different conditions. The experiment was carried out in the facilities of the Medical School (University of Valencia). [^1]: **Competing Interests:**The authors have declared that no competing interests exist. [^2]: Conceived and designed the experiments: GF JGDLA. Performed the experiments: GF MM EP. Analyzed the data: GF JGDLA BS JC JDA FJB. Contributed reagents/materials/analysis tools: JC BS. Wrote the paper: GF JGDLA BS EP.
[ 464, 7035, 6216, 326, 477, 1366, 10238, 262, 6373, 389, 3938, 1695, 1231, 17504, 13, 1439, 5981, 1366, 389, 1626, 262, 3348, 13, 198, 198, 21906, 1391, 2, 82, 16, 92, 198, 25609, 198, 198, 28452, 36684, 34834, 357, 44, 53, 8, 468, 587, 973, 287, 4688, 1337, 3871, 329, 4647, 13, 554, 15275, 286, 663, 1204, 12, 29336, 2785, 11, 340, 468, 1811, 31731, 13, 317, 1271, 286, 11992, 3640, 423, 3402, 326, 12370, 34834, 743, 1255, 287, 262, 5585, 286, 23760, 16957, 2024, 287, 262, 12317, 685, 31, 79, 505, 13, 486, 1415, 23753, 12, 34653, 4604, 16, 60, 290, 12412, 287, 267, 276, 19687, 13, 685, 31, 79, 505, 13, 486, 1415, 23753, 12, 35, 4364, 69, 1046, 16, 60, 15716, 346, 1352, 12, 5497, 19513, 39337, 40883, 357, 53, 4146, 40, 8, 5640, 15021, 290, 41858, 555, 11423, 2458, 58, 31, 79, 505, 13, 486, 1415, 23753, 12, 25881, 4801, 5714, 16, 60, 2092, 284, 883, 1043, 287, 3871, 351, 4013, 1133, 1874, 4063, 2870, 4307, 601, 27109, 357, 48294, 737, 1081, 340, 4325, 351, 5923, 5258, 11, 569, 4146, 40, 318, 6209, 262, 1255, 286, 1593, 2458, 287, 262, 29298, 1799, 286, 262, 435, 303, 6192, 12, 11128, 15856, 25019, 13, 685, 31, 79, 505, 13, 486, 1415, 23753, 12, 35, 4364, 69, 1046, 17, 60, 383, 2785, 286, 12370, 34834, 329, 26555, 393, 42373, 45105, 12616, 468, 587, 3402, 287, 5044, 4981, 810, 262, 3586, 286, 1729, 12, 34411, 15071, 7435, 346, 2870, 10007, 357, 29471, 845, 1029, 40738, 15343, 8, 25890, 262, 4006, 286, 4695, 351, 257, 4271, 6686, 12317, 685, 31, 79, 505, 13, 486, 1415, 23753, 12, 10606, 9458, 16, 4357, 290, 772, 4073, 281, 5095, 287, 883, 1231, 257, 2180, 45105, 40572, 13, 685, 31, 79, 505, 13, 486, 1415, 23753, 12, 35, 4364, 69, 1046, 16, 60, 383, 779, 286, 1877, 40738, 15343, 468, 8302, 284, 307, 257, 1365, 3164, 287, 5923, 5258, 3871, 11, 9441, 852, 6596, 287, 10064, 1912, 319, 663, 8748, 13, 685, 31, 79, 505, 13, 486, 1415, 23753, 12, 5840, 5549, 16, 60, 438, 58, 31, 79, 505, 13, 486, 1415, 23753, 12, 42074, 283, 16, 60, 25044, 11, 2274, 11992, 290, 8668, 670, 468, 9555, 326, 32947, 351, 1877, 40738, 6115, 460, 21155, 2092, 45105, 2458, 284, 883, 6810, 329, 569, 4146, 40, 685, 31, 79, 505, 13, 486, 1415, 23753, 12, 34, 672, 417, 641, 16, 60, 438, 58, 31, 79, 505, 13, 486, 1415, 23753, 12, 54, 349, 400, 84, 271, 16, 60, 290, 326, 663, 5585, 743, 307, 3519, 284, 32947, 7111, 640, 13, 685, 31, 79, 505, 13, 486, 1415, 23753, 12, 39, 1533, 8463, 16, 60, 198, 198, 32, 421, 12687, 1040, 389, 257, 1641, 286, 1402, 1007, 11883, 1671, 1531, 15568, 326, 1037, 1660, 284, 1445, 3049, 11, 39119, 290, 3182, 12, 37295, 453, 832, 34073, 3182, 12, 75, 6962, 13, 685, 31, 79, 505, 13, 486, 1415, 23753, 12, 42, 8590, 29941, 16, 4357, 685, 31, 79, 505, 13, 486, 1415, 23753, 12, 21467, 16, 60, 1511, 1180, 3858, 423, 587, 5174, 287, 23426, 11, 685, 31, 79, 505, 13, 486, 1415, 23753, 12, 53, 9587, 805, 16, 60, 422, 543, 262, 12317, 318, 1900, 284, 4911, 1440, 25, 39514, 47, 12, 16, 11, 287, 262, 45105, 1451, 15856, 46710, 2978, 1505, 357, 16480, 435, 303, 6192, 828, 290, 262, 38259, 3339, 5330, 26, 39514, 47, 12, 18, 11, 287, 262, 491, 4891, 282, 21240, 2978, 1505, 26, 39514, 47, 12, 19, 11, 287, 262, 491, 4891, 282, 290, 18443, 354, 498, 21240, 2978, 1505, 26, 290, 39514, 47, 12, 20, 11, 319, 2099, 314, 29631, 43320, 4778, 286, 262, 435, 303, 11106, 11, 319, 262, 25019, 48106, 284, 262, 435, 303, 6192, 300, 20080, 13, 685, 31, 79, 505, 13, 486, 1415, 23753, 12, 15708, 16, 60, 5334, 2597, 287, 262, 2478, 290, 6323, 286, 45105, 267, 276, 19687, 3607, 4485, 284, 10386, 11, 3584, 340, 857, 1283, 284, 711, 257, 636, 287, 569, 4146, 40, 13, 685, 31, 79, 505, 13, 486, 1415, 23753, 12, 39, 2040, 16, 60, 198, 198, 1212, 2267, 8998, 284, 11767, 611, 32947, 351, 1877, 393, 32611, 1029, 40738, 15343, 357, 940, 25962, 14, 42, 70, 8, 12605, 625, 640, 2482, 287, 12317, 5095, 11, 12412, 29057, 45105, 1660, 2695, 290, 4580, 85, 14767, 29298, 1799, 11, 355, 6515, 287, 569, 4146, 40, 11, 290, 284, 2134, 452, 1096, 644, 4325, 351, 39514, 47, 352, 290, 642, 5408, 11, 1111, 3858, 8384, 2950, 287, 262, 9978, 286, 12317, 267, 276, 19687, 11, 739, 262, 976, 34834, 3403, 13, 198, 198, 17518, 290, 25458, 1391, 2, 82, 17, 92, 198, 4770, 1421, 198, 198, 16, 13, 25092, 2643, 1391, 2, 82, 17, 64, 92, 198, 1783, 6329, 198, 198, 464, 1628, 373, 5281, 503, 706, 7546, 422, 262, 25092, 4606, 329, 13792, 29544, 341, 290, 3894, 11873, 286, 262, 4992, 5693, 286, 35773, 43054, 82, 9256, 1012, 39588, 3713, 26986, 270, 4982, 13, 198, 198, 17, 13, 13792, 2746, 290, 9904, 1391, 2, 82, 17, 65, 92, 198, 1783, 26171, 198, 198, 32, 2472, 286, 1542, 13623, 547, 44763, 395, 3202, 1417, 416, 23422, 525, 49644, 282, 16954, 286, 22354, 9862, 4019, 10527, 14, 10025, 290, 2124, 2645, 4994, 642, 10527, 14, 10025, 13, 642, 13623, 357, 8094, 327, 393, 6973, 8, 547, 27445, 416, 45840, 516, 16954, 286, 1802, 10527, 14, 42, 70, 294, 14922, 2470, 13, 383, 1334, 286, 262, 4695, 357, 77, 447, 232, 28, 447, 232, 1495, 8, 547, 6157, 257, 21998, 491, 4891, 455, 9145, 11, 1262, 257, 573, 2704, 261, 6463, 4712, 357, 14214, 48679, 11, 1467, 38, 737, 44164, 547, 15456, 19171, 656, 734, 2628, 13, 1105, 13623, 547, 7435, 40080, 329, 362, 2250, 357, 8094, 362, 39, 8, 351, 257, 11131, 6882, 298, 15716, 346, 1352, 11, 2746, 718, 5999, 357, 13587, 10187, 2034, 283, 7240, 8, 351, 257, 40738, 6115, 286, 838, 25962, 14, 10025, 290, 257, 22949, 2494, 286, 4101, 45576, 14, 11374, 13, 1511, 13623, 547, 7435, 40080, 351, 3446, 262, 976, 10007, 329, 604, 2250, 357, 8094, 604, 39, 737, 383, 36012 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Q: How dangerous is it to translate IPs directly via hosts in Windows Sorry for the inconvenience, as English is not my native. I use hosts to access some websites as DNS is polluted. My question is, take www.google.com as an example. If I am successfully social engineered by an attacker, and changes the translation in hosts into a phishing website. If I use http, then I am completely screwed, right? If I use https, then the browser will give a warning, if my PC is not compromised. For the https case, is it possible that the phishing website just pass a certificate from www.google.com to me to prove it is genuine? A: Consider the following statements: All certificate authorities trusted by your web browser refuse to issue a certificate for examplebank.com to the attacker without proof of domain ownership. The signing keys of all authorities are securely stored and an unauthorized person cannot issue a certificate to themselves. (See recent Comodo break-in.) Your web browser correctly checks if the server's SSL certificate is issued by a valid CA, not revoked, valid for use by servers, and issued for the examplebank.com domain. There is no active malware or a browser bug that causes such checks to be bypassed. You always open https://examplebank.com, requesting SSL explicitly instead of relying for the website to redirect you. You actually read the SSL error messages instead of blindly clicking Ignore when you open the website. If all of the above are true, HTTPS will warn you that you tried to connect to a fake website. However, HTTPS cannot bypass lower-level redirections (such as spoofing examplebank.com by DNS or /etc/hosts), so if you ignore the warnings, your data will be going to the attacker, not to the real bank. To conclude, yes, it's dangerous. In response to the edited question: If you use plain HTTP, you're screwed. If you use HTTPS, you will receive a big red warning (see first part of the answer). Every "certificate" has a RSA (sometimes DSA, ECDSA) key pair. The public key of the pair is part of the certificate, while the private key is locked away in the webserver and never sent over the network. Both keys are needed to successfully complete the TLS/SSL handshake. If the attacker presents a certificate, but does not have the associated private key, they will not be able to decrypt any traffic that goes over TLS. Wikipedia has a description of the TLS handshake. A: SSL (HTTPS) will only protect you as long as your client is not compromised. If someone manages to modify /etc/hosts, he can also manage to modify your browser to not perform the SSL validation of the server you're connecting to, or he can add his fraud server's fake certificate into your system's database of trusted certificates. If however your client is not compromised and someone manages to redirect your browser to a different IP address (e.g. some kind of DNS-related hack, or cheating you to modify /etc/hosts without anything else), the browser will warn you that something's wrong with the server's certificate, and, provided you don't ignore the warning and proceed, you are safe. On your second question: For the https case, is it possible that the phishing website just pass a certificate from www.google.com to me to prove it is genuine? No, that is not possible, unless the attacker managed to obtain the server's private key (e.g. by hacking the server itself). Even if a fraud server "passed on" the server's certificate, he will not be able to prove its identity to the client if it does not possess that private key. If he attempted to do that, he will fail and the browser will show a warning.
[ 48, 25, 198, 198, 2437, 4923, 318, 340, 284, 15772, 6101, 82, 3264, 2884, 11453, 287, 3964, 198, 198, 14385, 329, 262, 31818, 11, 355, 3594, 318, 407, 616, 6868, 13, 198, 40, 779, 11453, 284, 1895, 617, 9293, 355, 18538, 318, 42340, 13, 198, 3666, 1808, 318, 11, 1011, 7324, 13, 13297, 13, 785, 355, 281, 1672, 13, 198, 1532, 314, 716, 7675, 1919, 23371, 416, 281, 15250, 11, 290, 2458, 262, 11059, 287, 11453, 656, 257, 872, 3929, 3052, 13, 198, 1532, 314, 779, 2638, 11, 788, 314, 716, 3190, 27527, 11, 826, 30, 198, 1532, 314, 779, 3740, 11, 788, 262, 6444, 481, 1577, 257, 6509, 11, 611, 616, 4217, 318, 407, 19066, 13, 198, 1890, 262, 3740, 1339, 11, 318, 340, 1744, 326, 262, 872, 3929, 3052, 655, 1208, 257, 10703, 422, 7324, 13, 13297, 13, 785, 284, 502, 284, 5879, 340, 318, 8768, 30, 198, 198, 32, 25, 198, 198, 19626, 262, 1708, 6299, 25, 198, 198, 3237, 10703, 4773, 13467, 416, 534, 3992, 6444, 11148, 284, 2071, 257, 10703, 329, 1672, 17796, 13, 785, 284, 262, 15250, 1231, 6617, 286, 7386, 9238, 13, 198, 464, 8415, 8251, 286, 477, 4773, 389, 30835, 8574, 290, 281, 22959, 1048, 2314, 2071, 257, 10703, 284, 2405, 13, 357, 6214, 2274, 955, 24313, 2270, 12, 259, 2014, 198, 7120, 3992, 6444, 9380, 8794, 611, 262, 4382, 338, 25952, 10703, 318, 4884, 416, 257, 4938, 7257, 11, 407, 30809, 11, 4938, 329, 779, 416, 9597, 11, 290, 4884, 329, 262, 1672, 17796, 13, 785, 7386, 13, 198, 1858, 318, 645, 4075, 18953, 393, 257, 6444, 5434, 326, 5640, 884, 8794, 284, 307, 17286, 276, 13, 198, 1639, 1464, 1280, 3740, 1378, 20688, 17796, 13, 785, 11, 20623, 25952, 11777, 2427, 286, 17965, 329, 262, 3052, 284, 18941, 345, 13, 198, 1639, 1682, 1100, 262, 25952, 4049, 6218, 2427, 286, 39615, 12264, 41032, 618, 345, 1280, 262, 3052, 13, 198, 198, 1532, 477, 286, 262, 2029, 389, 2081, 11, 38288, 481, 9828, 345, 326, 345, 3088, 284, 2018, 284, 257, 8390, 3052, 13, 2102, 11, 38288, 2314, 17286, 2793, 12, 5715, 18941, 507, 357, 10508, 355, 42078, 278, 1672, 17796, 13, 785, 416, 18538, 393, 1220, 14784, 14, 4774, 82, 828, 523, 611, 345, 8856, 262, 14601, 11, 534, 1366, 481, 307, 1016, 284, 262, 15250, 11, 407, 284, 262, 1103, 3331, 13, 198, 2514, 13796, 11, 3763, 11, 340, 338, 4923, 13, 198, 198, 818, 2882, 284, 262, 13012, 1808, 25, 198, 198, 1532, 345, 779, 8631, 14626, 11, 345, 821, 27527, 13, 198, 1532, 345, 779, 38288, 11, 345, 481, 3328, 257, 1263, 2266, 6509, 357, 3826, 717, 636, 286, 262, 3280, 737, 198, 6109, 366, 22583, 22460, 1, 468, 257, 42319, 357, 29810, 360, 4090, 11, 412, 8610, 4090, 8, 1994, 5166, 13, 383, 1171, 1994, 286, 262, 5166, 318, 636, 286, 262, 10703, 11, 981, 262, 2839, 1994, 318, 8970, 1497, 287, 262, 2639, 18497, 290, 1239, 1908, 625, 262, 3127, 13, 5747, 8251, 389, 2622, 284, 7675, 1844, 262, 33855, 14, 31127, 42231, 13, 198, 1532, 262, 15250, 10969, 257, 10703, 11, 475, 857, 407, 423, 262, 3917, 2839, 1994, 11, 484, 481, 407, 307, 1498, 284, 42797, 597, 4979, 326, 2925, 625, 33855, 13, 15312, 468, 257, 6764, 286, 262, 33855, 42231, 13, 198, 198, 32, 25, 198, 198, 31127, 357, 6535, 28820, 8, 481, 691, 1805, 345, 355, 890, 355, 534, 5456, 318, 407, 19066, 13, 198, 1532, 2130, 15314, 284, 13096, 1220, 14784, 14, 4774, 82, 11, 339, 460, 635, 6687, 284, 13096, 534, 6444, 284, 407, 1620, 262, 25952, 21201, 286, 262, 4382, 345, 821, 14320, 284, 11, 393, 339, 460, 751, 465, 7394, 4382, 338, 8390, 10703, 656, 534, 1080, 338, 6831, 286, 13467, 20835, 13, 198, 1532, 2158, 534, 5456, 318, 407, 19066, 290, 2130, 15314, 284, 18941, 534, 6444, 284, 257, 1180, 6101, 2209, 357, 68, 13, 70, 13, 617, 1611, 286, 18538, 12, 5363, 8156, 11, 393, 21608, 345, 284, 13096, 1220, 14784, 14, 4774, 82, 1231, 1997, 2073, 828, 262, 6444, 481, 9828, 345, 326, 1223, 338, 2642, 351, 262, 4382, 338, 10703, 11, 290, 11, 2810, 345, 836, 470, 8856, 262, 6509, 290, 5120, 11, 345, 389, 3338, 13, 198, 2202, 534, 1218, 1808, 25, 198, 198, 1890, 262, 3740, 1339, 11, 318, 340, 1744, 326, 262, 872, 3929, 3052, 655, 1208, 198, 220, 257, 10703, 422, 7324, 13, 13297, 13, 785, 284, 502, 284, 5879, 340, 318, 8768, 30, 198, 198, 2949, 11, 326, 318, 407, 1744, 11, 4556, 262, 15250, 5257, 284, 7330, 262, 4382, 338, 2839, 1994, 357, 68, 13, 70, 13, 416, 15656, 262, 4382, 2346, 737, 3412, 611, 257, 7394, 4382, 366, 6603, 276, 319, 1, 262, 4382, 338, 10703, 11, 339, 481, 407, 307, 1498, 284, 5879, 663, 5369, 284, 262, 5456, 611, 340, 857, 407, 8588, 326, 2839, 1994, 13, 1002, 339, 7482, 284, 466, 326, 11, 339, 481, 2038, 290, 262, 6444, 481, 905, 257, 6509, 13, 628 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
/* Copyright 2019 Google Inc. All Rights Reserved. Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. ==============================================================================*/ import {Polygon} from '/lib/math/polygon2d.js'; import * as moduleInterface from '/lib/module_interface.js'; import * as moduleTicker from '/client/modules/module_ticker.js'; import * as network from '/client/network/network.js'; import * as peerNetwork from '/client/network/peer.js'; import {easyLog} from '/lib/log.js'; import assert from '/lib/assert.js'; import asset from '/client/asset/asset.js'; import conform from '/lib/conform.js'; import inject from '/lib/inject.js'; import * as stateManager from '/client/state/state_manager.js'; import {TitleCard} from '/client/title_card.js'; import * as time from '/client/util/time.js'; import {delay} from '/lib/promise.js'; function createNewContainer(name) { var newContainer = document.createElement('div'); newContainer.className = 'container'; newContainer.id = 't-' + time.now(); newContainer.setAttribute('moduleName', name); return newContainer; } export const FadeTransition = { start(container) { if (container) { container.style.opacity = 0.001; document.querySelector('#containers').appendChild(container); } }, async perform(oldModule, newModule, deadline) { if (newModule.name == '_empty') { // Fading out.. so fade *out* the *old* container. oldModule.container.style.transition = 'opacity ' + time.until(deadline).toFixed(0) + 'ms'; oldModule.container.style.opacity = 0.0; } else { newModule.container.style.transition = 'opacity ' + time.until(deadline).toFixed(0) + 'ms'; newModule.container.style.opacity = 1.0; } // TODO(applmak): Maybe wait until css says that the transition is done? await delay(time.until(deadline)); } } export class ClientModule { constructor(name, path, config, titleCard, deadline, geo, transition) { // The module name. this.name = name; // The path to the main file of this module. this.path = path; // The module config. this.config = config; // The title card instance for this module. this.titleCard = titleCard; // Absolute time when this module is supposed to be visible. Module will // actually be faded in by deadline + 5000ms. this.deadline = deadline; // The wall geometry. this.geo = geo; // The transition to use to transition to this module. this.transition = transition; // The dom container for the module's content. this.container = null; // Module class instance. this.instance = null; // Network instance for this module. this.network = null; } // Deserializes from the json serialized form of ModuleDef in the server. static deserialize(bits) { if (bits.module.name == '_empty') { return ClientModule.newEmptyModule(bits.time); } return new ClientModule( bits.module.name, bits.module.path, bits.module.config, new TitleCard(bits.module.credit), bits.time, new Polygon(bits.geo), FadeTransition, ); } static newEmptyModule(deadline = 0, transition = FadeTransition) { return new ClientModule( '_empty', '', {}, new TitleCard({}), deadline, new Polygon([{x: 0, y:0}]), transition ); } // Extracted out for testing purposes. static async loadPath(path) { return await import(path); } async instantiate() { this.container = createNewContainer(this.name); if (!this.path) { return; } const INSTANTIATION_ID = `${this.geo.extents.serialize()}-${this.deadline}`; this.network = network.forModule(INSTANTIATION_ID); let openNetwork = this.network.open(); this.stateManager = stateManager.forModule(network, INSTANTIATION_ID); const fakeEnv = { asset, debug: easyLog('wall:module:' + this.name), game: undefined, network: openNetwork, titleCard: this.titleCard.getModuleAPI(), state: this.stateManager.open(), wallGeometry: this.geo, peerNetwork, assert, }; try { const {load} = await ClientModule.loadPath(this.path); if (!load) { throw new Error(`${this.name} did not export a 'load' function!`); } const {client} = inject(load, fakeEnv); conform(client, moduleInterface.Client); this.instance = new client(this.config); } catch (e) { // something went very wrong. Wind everything down.! this.network.close(); this.network = null; throw e; } } // Returns true if module is still OK. async willBeShownSoon() { if (!this.path) { return; } // Prep the container for transition. // TODO(applmak): Move the transition smarts out of ClientModule. this.transition.start(this.container); try { await this.instance.willBeShownSoon(this.container, this.deadline); } catch(e) { this.dispose(); throw e; } } // Returns true if module is still OK. beginTransitionIn(deadline) { if (!this.path) { return; } moduleTicker.add(this.name, this.instance); try { this.instance.beginFadeIn(deadline); } catch (e) { this.dispose(); throw e; } } finishTransitionIn() { if (!this.path) { return; } this.titleCard.enter(); this.instance.finishFadeIn(); } beginTransitionOut(deadline) { if (!this.path) { return; } this.titleCard.exit(); this.instance.beginFadeOut(deadline); } finishTransitionOut() { if (!this.path) { return; } this.instance.finishFadeOut(); } async performTransition(otherModule, transitionFinishDeadline) { await this.transition.perform(otherModule, this, transitionFinishDeadline); } dispose() { if (this.container) { this.container.remove(); this.container = null; } if (!this.path) { return; } this.titleCard.exit(); // Just in case. moduleTicker.remove(this.instance); if (this.network) { this.stateManager.close(); this.stateManager = null; this.network.close(); this.network = null; } } }
[ 15211, 15069, 13130, 3012, 3457, 13, 1439, 6923, 33876, 13, 198, 198, 26656, 15385, 739, 262, 24843, 13789, 11, 10628, 362, 13, 15, 357, 1169, 366, 34156, 15341, 198, 5832, 743, 407, 779, 428, 2393, 2845, 287, 11846, 351, 262, 13789, 13, 198, 1639, 743, 7330, 257, 4866, 286, 262, 13789, 379, 628, 220, 220, 220, 2638, 1378, 2503, 13, 43073, 13, 2398, 14, 677, 4541, 14, 43, 2149, 24290, 12, 17, 13, 15, 198, 198, 28042, 2672, 416, 9723, 1099, 393, 4987, 284, 287, 3597, 11, 3788, 198, 17080, 6169, 739, 262, 13789, 318, 9387, 319, 281, 366, 1921, 3180, 1, 29809, 1797, 11, 198, 54, 10554, 12425, 34764, 11015, 6375, 7102, 49828, 11053, 3963, 15529, 509, 12115, 11, 2035, 4911, 393, 17142, 13, 198, 6214, 262, 13789, 329, 262, 2176, 3303, 15030, 21627, 290, 198, 2475, 20597, 739, 262, 13789, 13, 198, 23926, 25609, 855, 16208, 198, 198, 11748, 1391, 34220, 14520, 92, 422, 31051, 8019, 14, 11018, 14, 35428, 14520, 17, 67, 13, 8457, 17020, 198, 11748, 1635, 355, 8265, 39317, 422, 31051, 8019, 14, 21412, 62, 39994, 13, 8457, 17020, 198, 11748, 1635, 355, 8265, 51, 15799, 422, 31051, 16366, 14, 18170, 14, 21412, 62, 83, 15799, 13, 8457, 17020, 198, 11748, 1635, 355, 3127, 422, 31051, 16366, 14, 27349, 14, 27349, 13, 8457, 17020, 198, 11748, 1635, 355, 12720, 26245, 422, 31051, 16366, 14, 27349, 14, 33350, 13, 8457, 17020, 198, 11748, 1391, 38171, 11187, 92, 422, 31051, 8019, 14, 6404, 13, 8457, 17020, 198, 11748, 6818, 422, 31051, 8019, 14, 30493, 13, 8457, 17020, 198, 11748, 11171, 422, 31051, 16366, 14, 562, 316, 14, 562, 316, 13, 8457, 17020, 198, 11748, 17216, 422, 31051, 8019, 14, 1102, 687, 13, 8457, 17020, 198, 11748, 8677, 422, 31051, 8019, 14, 259, 752, 13, 8457, 17020, 198, 11748, 1635, 355, 1181, 13511, 422, 31051, 16366, 14, 5219, 14, 5219, 62, 37153, 13, 8457, 17020, 198, 11748, 1391, 19160, 16962, 92, 422, 31051, 16366, 14, 7839, 62, 9517, 13, 8457, 17020, 198, 11748, 1635, 355, 640, 422, 31051, 16366, 14, 22602, 14, 2435, 13, 8457, 17020, 198, 11748, 1391, 40850, 92, 422, 31051, 8019, 14, 16963, 786, 13, 8457, 17020, 198, 198, 8818, 2251, 3791, 29869, 7, 3672, 8, 1391, 198, 220, 1401, 649, 29869, 796, 3188, 13, 17953, 20180, 10786, 7146, 24036, 198, 220, 649, 29869, 13, 4871, 5376, 796, 705, 34924, 17020, 198, 220, 649, 29869, 13, 312, 796, 705, 83, 19355, 1343, 640, 13, 2197, 9783, 198, 220, 649, 29869, 13, 2617, 33682, 10786, 21412, 5376, 3256, 1438, 1776, 198, 220, 1441, 649, 29869, 26, 198, 92, 198, 198, 39344, 1500, 376, 671, 8291, 653, 796, 1391, 198, 220, 923, 7, 34924, 8, 1391, 198, 220, 220, 220, 611, 357, 34924, 8, 1391, 198, 220, 220, 220, 220, 220, 9290, 13, 7635, 13, 404, 4355, 796, 657, 13, 8298, 26, 198, 220, 220, 220, 220, 220, 3188, 13, 22766, 17563, 273, 10786, 2, 3642, 50221, 27691, 33295, 16424, 7, 34924, 1776, 198, 220, 220, 220, 1782, 198, 220, 8964, 198, 220, 30351, 1620, 7, 727, 26796, 11, 649, 26796, 11, 12508, 8, 1391, 198, 220, 220, 220, 611, 357, 3605, 26796, 13, 3672, 6624, 705, 62, 28920, 11537, 1391, 198, 220, 220, 220, 220, 220, 3373, 376, 4980, 503, 492, 523, 22100, 1635, 448, 9, 262, 1635, 727, 9, 9290, 13, 198, 220, 220, 220, 220, 220, 1468, 26796, 13, 34924, 13, 7635, 13, 7645, 653, 796, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 404, 4355, 705, 1343, 640, 13, 28446, 7, 25124, 1370, 737, 1462, 13715, 7, 15, 8, 1343, 705, 907, 17020, 198, 220, 220, 220, 220, 220, 1468, 26796, 13, 34924, 13, 7635, 13, 404, 4355, 796, 657, 13, 15, 26, 198, 220, 220, 220, 1782, 2073, 1391, 198, 220, 220, 220, 220, 220, 649, 26796, 13, 34924, 13, 7635, 13, 7645, 653, 796, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 404, 4355, 705, 1343, 640, 13, 28446, 7, 25124, 1370, 737, 1462, 13715, 7, 15, 8, 1343, 705, 907, 17020, 198, 220, 220, 220, 220, 220, 649, 26796, 13, 34924, 13, 7635, 13, 404, 4355, 796, 352, 13, 15, 26, 198, 220, 220, 220, 1782, 198, 220, 220, 220, 3373, 16926, 46, 7, 1324, 75, 76, 461, 2599, 6674, 4043, 1566, 269, 824, 1139, 326, 262, 6801, 318, 1760, 30, 198, 220, 220, 220, 25507, 5711, 7, 2435, 13, 28446, 7, 25124, 1370, 18125, 198, 220, 1782, 198, 92, 628, 198, 39344, 1398, 20985, 26796, 1391, 198, 220, 23772, 7, 3672, 11, 3108, 11, 4566, 11, 3670, 16962, 11, 12508, 11, 40087, 11, 6801, 8, 1391, 198, 220, 220, 220, 3373, 383, 8265, 1438, 13, 198, 220, 220, 220, 428, 13, 3672, 796, 1438, 26, 628, 220, 220, 220, 3373, 383, 3108, 284, 262, 1388, 2393, 286, 428, 8265, 13, 198, 220, 220, 220, 428, 13, 6978, 796, 3108, 26, 628, 220, 220, 220, 3373, 383, 8265, 4566, 13, 198, 220, 220, 220, 428, 13, 11250, 796, 4566, 26, 628, 220, 220, 220, 3373, 383, 3670, 2657, 4554, 329, 428, 8265, 13, 198, 220, 220, 220, 428, 13, 7839, 16962, 796, 3670, 16962, 26, 628, 220, 220, 220, 3373, 36532, 640, 618, 428, 8265, 318, 4385, 284, 307, 7424, 13, 19937, 481, 198, 220, 220, 220, 3373, 1682, 307, 24887, 287, 416, 12508, 1343, 23336, 907, 13, 198, 220, 220, 220, 428, 13, 25124, 1370, 796, 12508, 26, 628, 220, 220, 220, 3373, 383, 3355, 22939, 13, 198, 220, 220, 220, 428, 13, 469, 78, 796, 40087, 26, 628, 220, 220, 220, 3373, 383, 6801, 284, 779, 284, 6801, 284, 428, 8265, 13, 198, 220, 220, 220, 428, 13, 7645, 653, 796, 6801, 26, 628, 220, 220, 220, 3373, 383, 2401, 9290, 329, 262, 8265, 338, 2695, 13, 198, 220, 220, 220, 428, 13, 34924, 796, 9242, 26, 628, 220, 220, 220, 3373, 19937, 1398, 4554, 13, 198, 220, 220, 220, 428, 13, 39098, 796, 9242, 26, 628, 220, 220, 220, 3373, 7311, 4554, 329, 428, 8265, 13, 198, 220, 220, 220, 428, 13, 27349, 796, 9242, 26, 198, 220, 1782, 628, 220, 3373, 2935, 48499, 4340 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Incredibly big tune by Watermat & TAI, building upon an effective piano groove, turning this from catchy house music to a bigger than life future anthem. It’s got main stage written all over it, without falling for the known big room sounds. This is new and highly creative dance music, Frequency setting the standard for house music to come. HUGE! Expertly layering rich melodic synths with driving yet enchanting vocals, Warriors climaxes in a euphoric drop that creates an uplifting, progressive anthem suitable for any festival main stage. Alongside Nicky, Volt & State have created an anthem portraying a mantra of never giving up and always fighting for what you believe in which can be related to on a universal level.
[ 25517, 45779, 1263, 14009, 416, 5638, 6759, 1222, 309, 20185, 11, 2615, 2402, 281, 4050, 19132, 35096, 11, 6225, 428, 422, 46124, 2156, 2647, 284, 257, 5749, 621, 1204, 2003, 24577, 13, 632, 447, 247, 82, 1392, 1388, 3800, 3194, 477, 625, 340, 11, 1231, 7463, 329, 262, 1900, 1263, 2119, 5238, 13, 770, 318, 649, 290, 4047, 7325, 9280, 2647, 11, 31902, 4634, 262, 3210, 329, 2156, 2647, 284, 1282, 13, 48068, 0, 198, 198, 3109, 11766, 306, 3830, 1586, 5527, 7758, 29512, 6171, 9998, 351, 5059, 1865, 23260, 278, 25355, 11, 12090, 30032, 274, 287, 257, 40381, 8146, 4268, 326, 8075, 281, 28996, 13309, 11, 10393, 24577, 11080, 329, 597, 10876, 1388, 3800, 13, 17159, 1589, 8047, 88, 11, 22702, 1222, 1812, 423, 2727, 281, 24577, 42458, 257, 32628, 286, 1239, 3501, 510, 290, 1464, 4330, 329, 644, 345, 1975, 287, 543, 460, 307, 3519, 284, 319, 257, 10112, 1241, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Road study gets Sampson’s attention Chris Berendt/Sampson IndependentEconomic developer John Swope talks business during Monday night's meeting of the Sampson Board of Commissioners. Photo Chris Berendt/Sampson IndependentEconomic developer John Swope talks business during Monday night's meeting of the Sampson Board of Commissioners. Chris Berendt/Sampson IndependentCounty board chairman Jefferson Strickland, standing, flanked by Commissioners Jarvis McLamb, left, and Albert Kirby, talks about an invitation to a reads impact study announcement in Wayne County and what it could mean to Sampson. Photo Chris Berendt/Sampson IndependentCounty board chairman Jefferson Strickland, standing, flanked by Commissioners Jarvis McLamb, left, and Albert Kirby, talks about an invitation to a reads impact study announcement in Wayne County and what it could mean to Sampson. A road economic impact study in Wayne County has drawn the attention of those in Sampson for its future implications — notably the money and jobs it could bring with it. The U.S. 117/I-795 economic impact assessment study will be unveiled later this month and the Wayne County Transportation Committee sent invitations out to those in surrounding counties interested in learning about the effect of the growth on “citizens, economy, development patterns and lifestyle.” Sampson County officials were among those invited. “Many of you are familiar with the new road from Wilson to Goldsboro with a number designation of 795,” Sampson Board of Commissioners chairman Jefferson Strickland told his fellow board members. “The plan is for that road to continue onto Faison and be in Sampson County at the (Interstate) 40/(N.C.) 403 intersection. One of the first meetings to present some of the faces and facts is going to be held in August, and they’ve asked several members of our community to attend.” Strickland proposed that Jerol Kivett, chairman of the Sampson County Transportation Advocacy Group (TAG), Commissioners Albert Kirby and Billy Lockamy, as well as John Swope, executive director of the Sampson Economic Development Commission, be in attendance at the Aug. 21 meeting at Lane Tree Conference Center in Goldsboro. The board agreed unanimously. Interstate 795 is an interstate spur that follows the U.S. 117 corridor from I-95 near Wilson to U.S. 70 in Goldsboro, a length of about 25 miles. There are no other interstates in the eastern portion of North Carolina, east of I-95 and I-40. Its connectivity with a portion of I-40 in northern Sampson could prove vastly beneficial, local officials attested. The extension of I-795 southward along the U.S. 117 corridor would connect cities and industrial centers important to national defense, economic growth and job creation, Joe Daughtery, chairman of the Wayne County Transportation Committee, stated in his correspondence to Sampson County and others. Daughtery cited the potential of $74 million in business and resident cost savings, $520 million in GRP (gross regional product) and nearly $490 million in additional personal income by 2040. “Employment is projected to grow faster as well, adding about 220 more jobs on average per year along the corridor when compared to not completing the corridor,” he said. A recently-concluded U.S. 70 Corridor Commission study evaluated the economic development impacts of completing the four-lane freeway bypass system of highways for U.S. 70 from I-40 in Raleigh to the Morehead City State Ports facility; and the conversion of U.S. 117 to I-795 from Goldsboro to I-40. A U.S. 117 conversion would mean expansion for that road and an impact for I-40 in Sampson, Swope said at the time the study was initiated. The study team of Cambridge Systematics and the Sanford Holshouser Economic Development Consulting LLC conducted that analysis and are the same team set to conduct the U.S. 117/I-795 economic impact assessment study. With the Department of Transportation also in the fold, Swope has alluded to exciting possibilities. “I-795 would be proposed to connect to I-40 near Faison,” Swope said previously. “That would give us a direct route north to I-95, direct access instead of going (west) on I-40 and then catching I-95 North. They would connect to a new I-795, giving people traveling north and south better access than traveling I-40 to I-95.” State officials said the completion of the highway improvements, has extensive long-term implications for the economic future of eastern North Carolina and the counties along the corridor. The U.S. 70 Corridor Commission study found that as many as 1,900 jobs could be created each year for communities that rely on the corridor such as Smithfield, Goldsboro, Kinston, New Bern, Havelock and Morehead City. Among other statistics, $1.2 billion could be added to the GRP, including $900 million in additional personal income, and as much as $56 million saved for existing businesses. Local officials are hoping those positive effects ultimately extend to Sampson. For years, Swope has sought — and local officials have extended incentives — to attract industries to locate permanently to Exits 348 and 355 off of I-40 in northern Sampson County with mixed success. Another large interstate would only aid in that pursuit. “The highest investment value is an interstate,” Swope said last year. “That is what potential investors look for when developing properties. To bring U.S. 117 on as I-795 would be one more strong asset toward improving and strengthening Sampson County’s economy.” Lockamy said the new road is already getting plenty of use, which bodes well for the counties through which motorists are navigating. “I traveled that road Saturday evening going into Goldsboro and the traffic was bumper to bumper coming down it,” Lockamy noted. “The traffic is used to it now.” Chris Berendt can be reached at 910-249-4616. Follow us on twitter @SampsonInd. Contribute Comments All user comments are subject to our Terms of Service. Users may flag inappropriate comments.
[ 29197, 2050, 3011, 42168, 1559, 447, 247, 82, 3241, 198, 198, 15645, 37951, 358, 83, 14, 50, 696, 1559, 13362, 48307, 8517, 1757, 2451, 3008, 6130, 1597, 1141, 3321, 1755, 338, 3249, 286, 262, 42168, 1559, 5926, 286, 48053, 13, 198, 198, 6191, 198, 198, 15645, 37951, 358, 83, 14, 50, 696, 1559, 13362, 48307, 8517, 1757, 2451, 3008, 6130, 1597, 1141, 3321, 1755, 338, 3249, 286, 262, 42168, 1559, 5926, 286, 48053, 13, 198, 198, 15645, 37951, 358, 83, 14, 50, 696, 1559, 13362, 12332, 88, 3096, 8900, 15375, 4285, 624, 1044, 11, 5055, 11, 49059, 416, 48053, 46595, 18365, 4131, 11, 1364, 11, 290, 9966, 23965, 11, 6130, 546, 281, 17023, 284, 257, 9743, 2928, 2050, 8009, 287, 13329, 3418, 290, 644, 340, 714, 1612, 284, 42168, 1559, 13, 198, 198, 6191, 198, 198, 15645, 37951, 358, 83, 14, 50, 696, 1559, 13362, 12332, 88, 3096, 8900, 15375, 4285, 624, 1044, 11, 5055, 11, 49059, 416, 48053, 46595, 18365, 4131, 11, 1364, 11, 290, 9966, 23965, 11, 6130, 546, 281, 17023, 284, 257, 9743, 2928, 2050, 8009, 287, 13329, 3418, 290, 644, 340, 714, 1612, 284, 42168, 1559, 13, 198, 198, 32, 2975, 3034, 2928, 2050, 287, 13329, 3418, 468, 7428, 262, 3241, 286, 883, 287, 42168, 1559, 329, 663, 2003, 10939, 851, 14660, 262, 1637, 290, 3946, 340, 714, 2222, 351, 340, 13, 198, 198, 464, 471, 13, 50, 13, 19048, 14, 40, 12, 41544, 3034, 2928, 8922, 2050, 481, 307, 18475, 1568, 428, 1227, 290, 262, 13329, 3418, 15198, 4606, 1908, 42851, 503, 284, 883, 287, 7346, 14683, 4609, 287, 4673, 546, 262, 1245, 286, 262, 3349, 319, 564, 250, 46801, 11, 3773, 11, 2478, 7572, 290, 12263, 13, 447, 251, 198, 198, 50, 696, 1559, 3418, 2828, 547, 1871, 883, 9392, 13, 198, 198, 447, 250, 7085, 286, 345, 389, 5385, 351, 262, 649, 2975, 422, 8127, 284, 3561, 82, 21513, 351, 257, 1271, 22566, 286, 767, 3865, 11, 447, 251, 42168, 1559, 5926, 286, 48053, 8900, 15375, 4285, 624, 1044, 1297, 465, 5891, 3096, 1866, 13, 564, 250, 464, 1410, 318, 329, 326, 2975, 284, 2555, 4291, 18350, 1653, 290, 307, 287, 42168, 1559, 3418, 379, 262, 357, 9492, 5219, 8, 2319, 29006, 45, 13, 34, 2014, 38210, 16246, 13, 1881, 286, 262, 717, 8292, 284, 1944, 617, 286, 262, 6698, 290, 6419, 318, 1016, 284, 307, 2714, 287, 2932, 11, 290, 484, 447, 247, 303, 1965, 1811, 1866, 286, 674, 2055, 284, 5262, 13, 447, 251, 198, 198, 1273, 5557, 1044, 5150, 326, 4230, 349, 509, 425, 926, 11, 8900, 286, 262, 42168, 1559, 3418, 15198, 37866, 1590, 4912, 357, 42197, 828, 48053, 9966, 23965, 290, 15890, 13656, 14814, 11, 355, 880, 355, 1757, 2451, 3008, 11, 4640, 3437, 286, 262, 42168, 1559, 11279, 7712, 4513, 11, 307, 287, 14858, 379, 262, 2447, 13, 2310, 3249, 379, 15016, 12200, 8785, 3337, 287, 3561, 82, 21513, 13, 198, 198, 464, 3096, 4987, 28355, 13, 198, 198, 9492, 5219, 767, 3865, 318, 281, 33078, 26724, 326, 5679, 262, 471, 13, 50, 13, 19048, 20749, 422, 314, 12, 3865, 1474, 8127, 284, 471, 13, 50, 13, 4317, 287, 3561, 82, 21513, 11, 257, 4129, 286, 546, 1679, 4608, 13, 1318, 389, 645, 584, 987, 27219, 287, 262, 10183, 6903, 286, 2258, 5913, 11, 7627, 286, 314, 12, 3865, 290, 314, 12, 1821, 13, 198, 198, 20459, 19843, 351, 257, 6903, 286, 314, 12, 1821, 287, 7840, 42168, 1559, 714, 5879, 22056, 13205, 11, 1957, 2828, 708, 7287, 13, 198, 198, 464, 7552, 286, 314, 12, 41544, 5366, 904, 1863, 262, 471, 13, 50, 13, 19048, 20749, 561, 2018, 4736, 290, 7593, 10399, 1593, 284, 2260, 3761, 11, 3034, 3349, 290, 1693, 6282, 11, 5689, 30332, 88, 11, 8900, 286, 262, 13329, 3418, 15198, 4606, 11, 5081, 287, 465, 22440, 284, 42168, 1559, 3418, 290, 1854, 13, 198, 198, 35, 3637, 88, 9181, 262, 2785, 286, 720, 4524, 1510, 287, 1597, 290, 6623, 1575, 10653, 11, 720, 31211, 1510, 287, 10863, 47, 357, 47181, 7915, 1720, 8, 290, 3016, 720, 31503, 1510, 287, 3224, 2614, 3739, 416, 1160, 1821, 13, 198, 198, 447, 250, 29733, 434, 318, 13301, 284, 1663, 5443, 355, 880, 11, 4375, 546, 15629, 517, 3946, 319, 2811, 583, 614, 1863, 262, 20749, 618, 3688, 284, 407, 14339, 262, 20749, 11, 447, 251, 339, 531, 13, 198, 198, 32, 2904, 12, 1102, 10341, 471, 13, 50, 13, 4317, 48994, 4513, 2050, 16726, 262, 3034, 2478, 12751, 286, 14339, 262, 1440, 12, 33533, 39042, 17286, 1080, 286, 27239, 329, 471, 13, 50, 13, 4317, 422, 314, 12, 1821, 287, 34520, 284, 262, 3125, 2256, 2254, 1812, 30824, 6841, 26, 290, 262, 11315, 286, 471, 13, 50, 13, 19048, 284, 314, 12, 41544, 422, 3561, 82, 21513, 284, 314, 12, 1821, 13, 198, 198, 32, 471, 13, 50, 13, 19048, 11315, 561, 1612, 7118, 329, 326, 2975, 290, 281, 2928, 329, 314, 12, 1821, 287, 42168, 1559, 11, 2451, 3008, 531, 379, 262, 640, 262, 2050, 373, 16862, 13, 198, 198, 464, 2050, 1074, 286, 14457, 4482, 23372, 290, 262, 42862, 6479, 1477, 516, 263, 11279, 7712, 41005, 11419, 5952, 326, 3781, 290, 389, 262, 976, 1074, 900, 284, 3189, 262, 471, 13, 50, 13, 19048, 14, 40, 12, 41544, 3034, 2928, 8922, 2050, 13, 198, 198, 3152, 262, 2732, 286, 15198, 635, 287, 262, 5591, 11, 2451, 3008, 468, 45652, 284, 7895, 12779, 13, 198, 198, 447, 250, 40, 12, 41544, 561, 307, 5150, 284, 2018, 284, 314, 12, 1821, 1474, 18350, 1653, 11, 447, 251, 2451, 3008, 531, 4271, 13, 564, 250, 2504, 561, 1577, 514, 257, 1277, 6339, 5093, 284, 314, 12, 3865, 11, 1277, 1895, 2427, 286, 1016, 357, 7038, 8, 319, 314, 12, 1821, 290, 788, 16508, 314, 12, 3865, 2258, 13, 1119, 561, 2018, 284, 257, 649, 314, 12, 41544, 11, 3501, 661, 11300, 5093, 290, 5366, 1365, 1895, 621, 11300, 314, 12, 1821, 284, 314, 12, 3865, 13, 447, 251, 198, 198, 9012, 2828, 531, 262, 11939, 286, 262, 12763, 8561, 11, 468, 7667, 890, 12, 4354, 10939, 329, 262, 3034, 2003, 286, 10183, 2258, 5913, 290, 262, 14683, 1863, 262, 20749, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Reminder: Things can go bad even when racing slowly. Those who enter rallies do so knowing full well there's a solid chance their car might not make it out in one piece. Crashing is just part of the rally game. This YouTube video shows how a handful of rally cars met their doom as they entered one very slick, low-speed corner. A video shared on YouTube Sunday shows action from last weekend's Śląska Rally in Poland—or more specifically, a handful of rally cars at the rally crashing into a ditch. From the looks of the video, the cars came in hot, but not too hot, from a faster stretch of the rally stage, and were forced to slow down to handle the upcoming corner without going off the course. But because of the stretch of road near the corner is wet and muddy, some of the cars—mostly small European hatchbacks—have trouble making the corner. This, in turn, led to them driving into the ditch next to the course. Going off a stage in rally happens. The important thing is whether you and the helpful spectators around you manage to push the car right-side-up so you can keep hustling down the course.
[ 8413, 5540, 25, 11597, 460, 467, 2089, 772, 618, 11717, 6364, 13, 198, 198, 9627, 508, 3802, 22558, 466, 523, 6970, 1336, 880, 612, 338, 257, 4735, 2863, 511, 1097, 1244, 407, 787, 340, 503, 287, 530, 3704, 13, 3864, 2140, 318, 655, 636, 286, 262, 7903, 983, 13, 770, 7444, 2008, 2523, 703, 257, 10089, 286, 7903, 5006, 1138, 511, 27666, 355, 484, 5982, 530, 845, 29395, 11, 1877, 12, 12287, 5228, 13, 198, 198, 32, 2008, 4888, 319, 7444, 3502, 2523, 2223, 422, 938, 5041, 338, 25370, 248, 75, 128, 227, 82, 4914, 27752, 287, 12873, 960, 273, 517, 5734, 11, 257, 10089, 286, 7903, 5006, 379, 262, 7903, 21899, 656, 257, 30115, 13, 3574, 262, 3073, 286, 262, 2008, 11, 262, 5006, 1625, 287, 3024, 11, 475, 407, 1165, 3024, 11, 422, 257, 5443, 7539, 286, 262, 7903, 3800, 11, 290, 547, 4137, 284, 3105, 866, 284, 5412, 262, 7865, 5228, 1231, 1016, 572, 262, 1781, 13, 887, 780, 286, 262, 7539, 286, 2975, 1474, 262, 5228, 318, 9583, 290, 39085, 11, 617, 286, 262, 5006, 960, 29471, 1402, 3427, 25834, 10146, 960, 14150, 5876, 1642, 262, 5228, 13, 770, 11, 287, 1210, 11, 2957, 284, 606, 5059, 656, 262, 30115, 1306, 284, 262, 1781, 13, 198, 198, 27404, 572, 257, 3800, 287, 7903, 4325, 13, 383, 1593, 1517, 318, 1771, 345, 290, 262, 7613, 31704, 1088, 345, 6687, 284, 4574, 262, 1097, 826, 12, 1589, 12, 929, 523, 345, 460, 1394, 33376, 1359, 866, 262, 1781, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
August 30, 2011 First amendment gives the Press the right to publish news, information and opinions without government interference. Sixth amendment guarantees that the defendant is tried in a court open to the public before an impartial jury. The full accommodation of these seemingly over-lapping fundamental rights is rather challenging. The responsibility to establish a balance between the defendant’s right to a fair trial, the media's right to free speech and the public's right to an open court lies squarely on the shoulders of the presiding judge: Michael Pastor, in our case. There are several measurements that a judge could employ to establish the aforementioned balance in his court. Jury sequestration is one of them. JURY SEQUESTRATION Sequestration is the practice of physically keeping the jury together and totally isolated from outside influences during the trial or deliberation stage, or both. This measure is usually taken only for high profile cases, where the massive media coverage may prejudice the jury's verdict, thus, violating the defendant’s six amendment rights. In its most extreme form, when not in the courtroom hearing the case, jurors are kept under the constant supervision of a guard at an undisclosed location. Their contact with the outsiders including family is eliminated or curtailed. Any outgoing communication, if any allowed, is monitored to ascertain that their communication doesn’t involve the Trial. It cost the state of California $3 million to sequester OJ Simpson jury for almost 9 months. Scott Peterson jury was sequestered only during deliberation period for a week. Mark Geragos, Scott Peterson attorney requested full sequestration during the entire trial. Mr. Geragos stated “This gentleman beside me is fighting with one hand tied behind his back. I'm just trying to level the playing field.”Judge Alfred Delucchi denied the total sequestration request, reasoning that “if I was to tell people you can't see your loved ones for five months, you can't watch television, you can't listen to the radio, you're going to be locked away in a hotel somewhere ... it could have a negative effect on people who could get resentful that they've been locked up."JudgeDelucchi remarked that the jurors will be exposed to outside influences regardless and that "the only place this wouldn't happen is if we parked the jury on Mars. We can't do that." Michael Jackson 2005 Trial was heard by a non-sequestered jury and despite of the intense worldwide coverage of the trial in detriment of Mr. Jackson, jury rendered a verdict contrary to the media verdict, acquitting him of all 14 counts of charges. in the court, stating “we would really like the decision to be made based upon the evidence that is given in this courtroom and the arguments made inside this courtroom as opposed to what happens on the Nancy Grace Show”  -Michael Flanagan  Judge Pastor asked the prosecution’s stance on the jury sequestration. Deputy Prosecutor David Walgren responded “the court had addressed the issue previously and advised all parties that the court was not inclined to do a sequestering of the jury 24/7. The People were comfortable with the court’s decision. That’s still our position.” Judge Pastor then declared “at this juncture, I do not feel in any way, shape or form total sequestration of jury is necessary in this case. To have jurors undergo that kind of extraordinary deprivation, quiet frankly, unhealthy to the administration of justice. I remain confident that jurors follow the law. They follow orders. I feel confident that the jurors understand their responsibility is to follow the evidence and to decide the case on the evidence and not to be influenced by the extraneous materials”. He then advised the defense team to file a motion for his consideration. On August 18, 2011, Conrad Murray defense team filed a motion requesting jury sequestration. “This is an unusual Trial. There is a reasonable expectation that Dr. Murray’s Trial will be the most publicized in history” stated the motion which then went on to compare Conrad Murray case to Casey Anthony trial. “Television pundits such as Nancy Grace use air time to campaign for the conviction of Ms. Anthony. By feeding on the public anger, Grace’s viewership rose to one and half million per night in June Grace engaged in continuous character assassination with regard to Ms Anthony, the woman she condescendingly referred to as tot mom.” And then came, in my opinion, highly incendiary and offensive remarks: “Even if the jurors are instructed not to watch any news coverage, it is unrealistic to expect an unsequestered jury to avoid hearing about the case. Therefore, complete sequestration is necessary to eliminate the high risk of jury contamination. Dr. Murray respectfully asks this court for an order sequestering the jury during the entire trial, including jury deliberations” concluded the defense motion. On August 25, 2011, Judge Michael Pastor denied the motion to sequester the jury.    Deputy District Attorney David Walgren stated that the prosecution didn’t feel the sequestration was necessary. “There has to be a level of trust granted to the jurors” ~David Walgren “Sequestered juries have indicated they have felt like inmates and they feel they were being imprisoned. They are monitored 24/7, they have minimal freedom of movement and they can’t even speak to loved ones without being monitored. Many sequestered jury indicated that they found the sequestration so frustrating, so intimidating and so cruel that it actually interfered with their assessment of the evidence and the law. While I raise the issue of cost, that is not the over-riding consideration. Justice trumps everything" stated judge Michael Pastor. Ed Chernoff then stated that in Casey Anthony case media pundits offered their interpretation of the evidence and testimonies, acting as a quasi juror. He then requested that the judge ban the Trial from being televised. “I am suggesting that you consider in-court cameras, maybe amend it to prevent that particular problem” Chernoff said. Judge Pastor responded “by problem, do you mean the exercise of first amendment? The first amendment is one of those cherished fundamental constitutional rights in the United States. That includes the right to comment. Judge Michael Pastor then denied the motion for jury sequestration: “I expect that the jurors will follow the high road and that means that they will not be in the receipt of or in contact with information regarding this case. I have tremendous faith in the jury system and in the individual promises of jurors. The defense motion is denied." In summary, Conrad Murray jury won't be sequestered and the Trial will be televised. PROS OF SEQUESTRING JURY Preventing exposure of the jurors to prejudicial publicity Minimizing pressure from public for a particular verdict Ensuring juror safety from harassment during trial Promoting a perception of fairness due to no outside influences CONS OF SEQUESTRING JURY It is financially costly to the government If an impartial jury isn’t acquired in the first place then it can’t be maintained by means of sequestering It doesn't undo prejudice based on pretrial media coverage It imposes jurors emotional harm if the sequestration period is long It may be counter to truth-seeking because it: vCan lead to a non-representative jury because only limited categories of people are available for a jury that will be sequestered. vCan cause jurors to rush to judgment to escape sequestration. vCan cause the jurors to identify with the government (as caretaker) or against the government (as the jury’s jailer). Marcia Clark on jury sequestration "When jurors are forced to spend day and night with each other, apart from their families and friends, they become a tribe unto themselves. Because they only have each other for company, and because most people prefer harmony to discord, there’s a natural desire to cooperate, to compromise in order to reach agreement. And they have no safe retreat. If they disagree with their fellow jurors, they can’t go home to a husband, a wife, a friend, where they can regroup and marshal their energies. Make no mistake about it, sequestration is no picnic and I have sympathy and respect for the jurors who put up with that incredible hardship. We can’t ignore the mental and emotional impact it has on the jurors—an impact that thwarts the whole point of drafting twelve individuals to decide a defendant’s fate"~Marcia Clark, OJ Simpson prosecutor August 26, 2011 Despite of ardent fan protests and a letter from Michael Jackson Estate Executers, Global Live Events announced that they are “%100 going ahead”. Yesterday, they announced Ne-Yo as part of their line-up. But would Ne-Yo have agreed to be participate IF he knew that Leonard Rowe is involved in 'Michael Forever Tribute'? In 2007, LiveNations cancelled Janet Jackson’s Tour. Her dancers had counted on income from the Tour so she reached out to Leonard Rowe asking if he could promote a 20 concert Tour. “I did not believe that she had the drawing power to tour” Leonard Rowe wrote in his book. He tried his best to convince Michael Jackson to tour as Janet being the opening act but there was no convincing Michael. So Mr. Rowe asked R Kelly to tour with Janet Jackson. R Kelley agreed. Later, Janet thought that R Kelley would steal the spotlight so she changed her mind about touring with R Kelly. Leonard Rowe proceeding planning just an R Kelley Tour. He booked Ne Yo as an opening act for R Kelley. Ultimately, both R Kelley and Ne Yo litigated Leonard Rowe. Ne-Yo sued Leonard Rowe for breach of contract. Leonard Rowe had dropped Ne-Yo from the Tour without merit. On September 4, 2008, Ne-Yo was awarded $700,320 Fast forward to the present day…. “Latoya was the lead one” said Chris Hunt, President of Global Live Events regarding Jackson Family members backing for ‘Michael Forever Tribute’. Latoya and her company is very much involved & vested in the tribute. Paul Ring, vice president of Ja Tail business development, is also "Head of US Operations, Global Live Events" Global Live Events CEO, Eric Bute directed Latoya's "Home' song Ja Tail made a minor change in their website recently. The nature of the change is blaringly evident: to conceal Leonard Rowe involment in 'Michael Forever Tribute'. With his unpleasant history with Rowe, Ne-Yo might have had reservations in performing in the tribute had he known the Rowe connection. So they surreptitiously deleted evidence. August 24, 2011 "We are %100 going ahead. We will continue to announce names for the line-up. We are moving forward and now we will try to address issues that have been raised by fans" Global Live Events stated, inviting verified Michael Jackson fanclubs to take part in a conference call on August 30, in which our concerns will be allayed. We have been Michael Jackson fans and members of fanclubs for our entire lives yet we are not aware of the "verified fanclub” concept. Do you doubt our fanship? When Mr. Jackson was alive, never once did he limit his communications only to “verified Michael Jackson fanclubs”. We don't hear this utter nonsense from his Estate Executers either. We are ALL verified in the sense that we would walk through fire to make sure that an audacious company doesn’t cheapen Michael Jackson legacy and brand. We do not want our concerns allayed, we would like them resolved and how can resolution be possible if your very first step towards us is “we are %100 going ahead”?The so-called tribute is taking place during Conrad Murray Trial. Our most pressing concern is the timing. It is futile to elaborate on why the timing is utterly inappropriate for any decent human-being should be able to connect the dots. Your invitation to fans is simply a PR stunt in light of adverse media coverage of your event. Your assertion of “we have been listening to the fans” is a bold-faced lie. We started our campaign BECAUSE you refuse to listen to us and consistently delete our comments from your facebook! We learnt from experience and started screen-capping our comments before you delete them. Here is a comment you deleted yesterday: In a letter dated August 15, 2011, Michael Jackson Estate declared to Global Live Events "Estate is the only entity that can grant the right to use Michael Jackson’s name, likeness or any of his intellectual property, whether such use is commercial or other purposes. We assume that you do not intend to use any intellectual property controlled by the Estate" How does your company leap from receiving this communiqué from the Estate Executers of Michael Jackson to selling tickets to commercialize a brand that is not your property? Michael Jackson Estate is the single entity who owns and is responsible to protect the integrity of Michael Jackson brand which we believe you are tainting by an exceedingly questionable event marred with negative publicity. Adding insult to injury, you dub this lackluster event as a Michael Jackson “tribute”.Estate Executors communicated with you that “in light of confusion surrounding this ‘event’ we are extremely concerned about Michael’s legacy. We believe Global Live should address our concerns….” Global Live Events owe Michael Jackson Estate Executers through and through explanation before they proceed. Your failure to seek Estate's approval demonstrates your lack of respect to the very man you are allegedly honoring.Let me remind you that it is your legal and moral obligation to the Estate Executors to resolve every single issue surrounding the event and have their approval before “%100 going ahead” We realize that your financial interest indeed outweighs integrity. There is nothing decent about exploiting Mr. Jackson’s death for financial gain, doing so during Conrad Murray Trial and exploiting his young children as an advertising tool. We find the exploitation of Michael's children in your terms and conditions document totally abhorrent. Michael Jackson wrote a song about your ilk titled “money”, will that song be in the tribute line up? Which brings us to another legal issue to be contended with.   Mr. Jackson worked very hard to build one of the most profitable brands of all time. His brand stands for unsurpassed quality and “magic”.There is nothing quality or magical about Michael Forever Tribute which is simply a circus show of has-beens or rookies. You stated that you have the backing of “overwhelming majority” of the Jackson Family. So what? Jackson Family doesn’t own Michael Jackson brand, his Estate does…solely. Jackson family has no authority to broker Michael image, likeness and songs all of which you declared you will exploit. The Executers clearly communicated to you that you do NOT have their permission to use their intellectual property. Either you intend to violate copyright laws or you are defrauding public by false advertising. Unless you show willingness to modify terms surrounding Michael Forever Tribute, including but not limited to the timing & unless a representative of Michael Jackson Estate is present, our answer to your conference call is a resounding NO! We propose that you proceed with the concert but cease and desist the use of Michael Jackson name, likeness & songs. This is a reasonable compromise. Most of your attendees are fans of the participating artists. Since you are determined to “go ahead” and we are determined not to let that happen with the current terms, why don't we reach an agreement where everyone wins? Our proposal satisfies all parties: August 22, 2011 Gentlemen, we are writing you once again in regards to the Michael Forever Tribute. As you know, Michael Jackson worldwide fan community ardently objects and protests the October 2011 tribute. The fans who cherished a very closed-knit relationship with Mr. Jackson would want nothing more than a befitting tribute in his honor…but in due time & organized with utmost care and professionalism. Under the current circumstances, Michael Forever tribute produces an outcome opposite of what is being marketed. The tribute is simply tasteless, improper, impractical, insensitive and disrespectful. There is no way to resolve the issues we have with this tribute. Since the announcement of this tribute, the fan community has been upset and unable to focus on the upcoming trial. Every day, we wake up hoping for a cancellation and to our dismay, we encounter deafening silence. We've learnt that Michael Forever Tribute facebook is maintained by a ticketing company who doesn't have answers. Estate Executers had asked you to “address our concerns and those of Michael's loyal fans”. To date, you haven’t communicated with neither the fans nor the Executors of Michael Jackson -you know, the gentelman you are purportedly paying tribute to. If you don’t respect his Estate or his fans then where do you get off monetizing Michael Jackson’s name? You don’t even bother answering simple customer service questions about the event, let alone addressing grave concerns which were made known to you. Yet you proceed to selling tickets nonchalantly. Global Live Events could really benefit from a crash course on business ethics, integrity, professionalism and customer service. You are prolonging an unpleasant situation to gauge if you could garner enough ticket buyers who are fans of the attending artists. Do you think that the negative media coverage is beneficial for your company reputation or ticket sales? Since you don't have enough regard for Michael Jackson to cancel out of respect for him, since your corporate aspirations weigh heavier than doing what’s morally right, we propose this compromise: Drop Michael's name and proceed with the concert with the artists you already booked, including the Jacksons. We only request that you don’t use or refer to Mr. Jackson’s name in any shape or form and that the participating artists including the Jacksons don't butcher…I mean attempt to sing Mr. Jackson’s songs.We find this to be a reasonable compromise for all. We present our offer for your consideration and expect preferably an immediate cancellation or a modification. Look forward to your response as practicable as possible. August 19, 2011 Thank you for your prompt reaction in regards to the Michael Forever Tribute. We realize that unlike fans who react with raw emotion, the Estate executors approach matters with composed diplomacy and that there is a legal chain of actions to be followed. The Fan Community is in total agreement with every concern outlined in the letter from the Estate to the Michael Forever Tribute organizers. And whilst we are confident that the Estate will follow through and take the necessary legal actions in the event that the organizers aren’t compliant, we would like to communicate with you our sentiments in regard to some disconcertingissues relevant to the Michael Forever tribute. Timing: The Fan Community feels that the timing of this event aims to exploit the Conrad Murray trial. It is exceedingly insensitive, tasteless and improper. Caliber of artists: We feel that Michael Forever Tribute isn’t a tribute to honor Michael Jackson. It is merely a concert of various artists but the organizers exploit Michael Jackson’s name to garner interest in the event. The participating artists aren’t selected carefully based on the special connection they may have to Mr. Jackson. Rather, Global Live Events extends invitations to any artist who may agree to participate. They are scraping the bottom of the barrel. We feel that the haphazard and sloppy organization so far will not produce a fitting tribute. We would like the official Tribute to come in due time, preferably organized by Michael’s children and sanctioned by his Estate. Questionable intent: We feel that the intention of the tribute isn’t to pay homage to Michael Jackson but to capitalize on his good name. We don’t feel that a mere concert with mosaic of artists thrown together on the 11th hour is a suitable tribute Aptitude of Global Live Events: The Company was formed on March 29, 2011. As evidenced by their incompetency so far, we feel that the inexperienced organizers will fall short in organizing a deserving tribute to Michael Jackson. Paul Ring who is dubbed as "Global Live Events Executive" is also Latoya's employee. This screams conflict of interest. Latoya appears to be the force behind this exploitation of Michael & his children under the guise of a "tribute".  Latoya Jackson 'Starting Over' book, page 340  Global Live Events CEO Eric Bute & Latoya Jackson Questionable ticketing: We don't get a sense that this tribute is for L.O.V.E. It is all about money. Fans are required to pledge to charities in addition to the ticket price. Surreptitiously, the organizers use fans’ donations to assert that the tribute is for a charitable cause. Then why aren’t they donating part of their profits to charities? We don’t even know where the proceedings are going. Ticketing policy: The organizer declared “If %50 or more of the contracted artists ATTEND OR PERFORM, the concert will take place and NO refunds will be offered”. We believe that the %50 is covered by the Jacksons' appearances and that the announced artists may attend but not necessarily perform. Attending public should receive exactly what the organizers advertised, they shouldn't be short-changed or duped. The promoter aims to cheat the public with fine print. Doing so in Michael's name dishonors Michael's good name & memory. Gene Simmons:Global Live Events invited someone who not only made public disparaging remarks about Michael but also his children. We feel that the organizer should have been more diligent in carefully selecting artists. We can forgive Mrs. Jackson; due to her age, perhaps she didn’t know who Kiss is or about Gene Simmons remarks but it's hard to believe that Jackson siblings didn’t know about it. We feel that they proceeded despite of the knowledge. When we TRIED communicating our concerns about Kiss, our voices fell on deaf ears. Promoter deleted our comments from its facebook and tweeted a promotional video nonchalantly. It took a letter from the Estate for them to address this issue. They shut out the very people they are trying to sell tickets to. After dropping Kiss today from their line-up, the organizer released this statement: “We have listened to Michael's fans and are grateful to have been alerted to these unfortunate statements by Gene Simmons. Under the circumstances, we fully agree that even though Kiss is a band Michael admired, we have no choice but to rescind our invitation to them to appear in our tribute” Whom Global Live Events heard was NOT “Michael’s fans” but a potential lawsuit and the possibility of the Estate Executers throwing a monkey wrench into their event. We are also displeased by their absurd remark that Michael admired Kiss. That is a completely inaccurate nonsense. We do NOT feel right about Global Live Events, we do not trust them, we do not wish to do business with them. Recent headlines dragged Mr. Jackson’s name in mud so close to the jury selection to the Conrad Murray trial. We feel this may have tainted the potential jury pool. We do not feel that dropping Kiss suffices. The damage is already done. We didn't sense any genuine regret from the statement by Global Live Events. WE DO NOT ACCEPT THEIR APOLOGY! Most of the attendees are fans of participating artists. Michael Jackson fans are troubled that his name is used to sell this concert. If they desire to proceed, then they should just market it as a concert event without involving MJ's name into it. With the upcoming criminal trial, fans would like to focus only on the trial. We find it near impossible to do so because of constant debacles related to this tribute. It’s Michael Forever Tribute. His mother, siblings and children are involved. The use of Michael Jackson image and likeness is bound to happen.We cordially request that the Estate commence the necessary steps to acertain that this Tribute either doesn’t happen or it doesn’t happen as a Michael Jackson tribute. We hope that you will attend this matter in a timely manner so that the storm in our community may pass & we may focus on the upcoming Conrad Murray trial. We, as Michael Jackson's staunch supporters, refuse to support the Michael Forever Tribute, planned by Global Live Events in October, 2011. Even after the removal of Kiss, we feel that the damage is already done. This colossal mistake could have been avoided, had you exerted the diligence required to organize a befitting tribute. You have proven that you will book just any artist who affirms your invitation. This monumental mistake cannot be forgiven, given the magnitude of the damage it caused so close to the criminal trial. Your apology is too little too late and it does not solve the problems we have with this tribute in general. Since the initial announcement of the event, fans tried communicating with you in regards to our very valid concerns, have we not? Instead of acknowledging, hearing and working together with us, you have deleted “selected” comments from your facebook page, forcing us to form our own facebook Group: Fans Against Michael Forever Tribute.It shouldn't have come to this. Any company who conducts business in Michael Jackson's name should better know that Michael and his fans have cherished a close-knit relationship where we were always heard and communicated with. We refuse to be treated this way by you! You only addressed the Gene Simmons issue after the Estate's letter. Therefore, the contention that you "listened to Michael's fans" is empty words uttered to save face in the media. Global Live Events rescinded their offer to Kiss only to qualm the media and the Estate. Simply put, the Kiss cancellation is merely a product of the negative media coverage which stood to affect ticket sales and your profit. It was not done out of respect to Michael Jackson. You've no respect for Michael. The timing of this tribute in the middle of Conrad Murray's trial, ticketing arrangements, faraway location, obscurity over what charities will be receiving the donations, obscurity over who is pocketing the profits, no-guarantee policy of performers.....the issues with this tribute keep piling up, thus, breaking our focus away from the criminal trial. We find this very upsetting. The addition of Gene Simmons, thus, tarnishing Michael Jackson's name was simply the last straw for us. With the damage you caused, it will be us fans having to fix your mistake. Michael Forever Tribute is not proper at this time for myriad of reasons. We hope we can resolve this matter amicably so that perhaps in the future when a Tribute is planned, you could be part of the production, with more care and diligence. Understand that we will not rest until this tribute is cancelled. We do NOT care who from the Jackson family is supporting it. We condemn the exploitation of Michael's children & his mother to legitimatize your tribute!!! We cordially invite you to announce the cancellation of Michael Forever Tribute.
[ 17908, 1542, 11, 2813, 198, 198, 5962, 11326, 3607, 262, 4332, 262, 826, 284, 7715, 1705, 11, 1321, 290, 9317, 1231, 1230, 14517, 13, 198, 198, 21447, 400, 11326, 19026, 326, 262, 11304, 318, 3088, 287, 257, 2184, 1280, 284, 262, 1171, 878, 281, 32521, 9002, 13, 198, 198, 464, 1336, 19711, 286, 777, 9775, 625, 12, 75, 5912, 7531, 2489, 318, 2138, 9389, 13, 383, 5798, 284, 4474, 257, 5236, 1022, 262, 11304, 447, 247, 82, 826, 284, 257, 3148, 4473, 11, 262, 2056, 338, 826, 284, 1479, 4046, 290, 262, 1171, 338, 826, 284, 281, 1280, 2184, 7363, 38590, 319, 262, 12450, 286, 262, 44851, 5052, 25, 3899, 38256, 11, 287, 674, 1339, 13, 198, 198, 1858, 389, 1811, 13871, 326, 257, 5052, 714, 1873, 284, 4474, 262, 20794, 5236, 287, 465, 2184, 13, 48705, 46314, 1358, 318, 530, 286, 606, 13, 198, 198, 41, 4261, 56, 7946, 10917, 1546, 5446, 6234, 198, 198, 4653, 6138, 1358, 318, 262, 3357, 286, 10170, 5291, 262, 9002, 1978, 290, 6635, 11557, 422, 2354, 16717, 1141, 262, 4473, 393, 8958, 341, 3800, 11, 393, 1111, 13, 770, 3953, 318, 3221, 2077, 691, 329, 1029, 7034, 2663, 11, 810, 262, 4858, 2056, 5197, 743, 20226, 262, 9002, 338, 15593, 11, 4145, 11, 18134, 262, 11304, 447, 247, 82, 2237, 11326, 2489, 13, 198, 198, 818, 663, 749, 3257, 1296, 11, 618, 407, 287, 262, 24832, 4854, 262, 1339, 11, 28792, 389, 4030, 739, 262, 6937, 20865, 286, 257, 4860, 379, 281, 33457, 4067, 13, 5334, 2800, 351, 262, 29028, 1390, 1641, 318, 15254, 393, 1090, 34966, 13, 4377, 28181, 6946, 11, 611, 597, 3142, 11, 318, 20738, 284, 35520, 326, 511, 6946, 1595, 447, 247, 83, 6211, 262, 21960, 13, 198, 198, 1026, 1575, 262, 1181, 286, 3442, 720, 18, 1510, 284, 4726, 7834, 440, 41, 20531, 9002, 329, 2048, 860, 1933, 13, 198, 198, 19040, 18914, 9002, 373, 46314, 1068, 691, 1141, 8958, 341, 2278, 329, 257, 1285, 13, 2940, 13573, 48215, 11, 4746, 18914, 6136, 9167, 1336, 46314, 1358, 1141, 262, 2104, 4473, 13, 1770, 13, 13573, 48215, 5081, 564, 250, 1212, 22427, 13970, 502, 318, 4330, 351, 530, 1021, 8165, 2157, 465, 736, 13, 314, 1101, 655, 2111, 284, 1241, 262, 2712, 2214, 13, 447, 251, 29511, 22044, 4216, 1229, 11072, 6699, 262, 2472, 46314, 1358, 2581, 11, 14607, 326, 564, 250, 361, 314, 373, 284, 1560, 661, 345, 460, 470, 766, 534, 6151, 3392, 329, 1936, 1933, 11, 345, 460, 470, 2342, 5581, 11, 345, 460, 470, 6004, 284, 262, 5243, 11, 345, 821, 1016, 284, 307, 8970, 1497, 287, 257, 7541, 7382, 2644, 340, 714, 423, 257, 4633, 1245, 319, 661, 508, 714, 651, 20315, 913, 326, 484, 1053, 587, 8970, 510, 526, 29511, 13856, 1229, 11072, 24998, 326, 262, 28792, 481, 307, 7362, 284, 2354, 16717, 7692, 290, 326, 366, 1169, 691, 1295, 428, 3636, 470, 1645, 318, 611, 356, 19584, 262, 9002, 319, 8706, 13, 775, 460, 470, 466, 326, 526, 198, 198, 13256, 6612, 5075, 21960, 373, 2982, 416, 257, 1729, 12, 3107, 395, 1068, 9002, 290, 3805, 286, 262, 8157, 8688, 5197, 286, 262, 4473, 287, 42959, 286, 1770, 13, 6612, 11, 9002, 15111, 198, 198, 64, 15593, 10388, 284, 262, 2056, 15593, 11, 4078, 2535, 683, 286, 477, 1478, 9853, 286, 4530, 13, 198, 198, 259, 262, 2184, 11, 12316, 564, 250, 732, 561, 1107, 588, 262, 2551, 284, 307, 925, 1912, 2402, 198, 198, 1169, 2370, 326, 318, 1813, 287, 428, 24832, 290, 262, 7159, 925, 2641, 198, 198, 5661, 24832, 355, 6886, 284, 644, 4325, 319, 262, 18496, 16156, 5438, 447, 251, 198, 198, 171, 119, 123, 198, 198, 12, 13256, 39016, 7329, 198, 198, 171, 119, 123, 198, 198, 29511, 38256, 1965, 262, 12580, 447, 247, 82, 12046, 319, 262, 9002, 46314, 1358, 13, 15110, 37478, 3271, 6445, 32762, 7082, 564, 250, 1169, 2184, 550, 9469, 262, 2071, 4271, 290, 13030, 477, 4671, 326, 262, 2184, 373, 407, 19514, 284, 466, 257, 4726, 7834, 278, 286, 262, 9002, 1987, 14, 22, 13, 383, 4380, 547, 6792, 351, 262, 2184, 447, 247, 82, 2551, 13, 1320, 447, 247, 82, 991, 674, 2292, 13, 447, 251, 198, 198, 29511, 38256, 788, 6875, 564, 250, 265, 428, 10891, 48715, 11, 314, 466, 407, 1254, 287, 597, 835, 11, 5485, 393, 1296, 2472, 46314, 1358, 286, 9002, 318, 3306, 287, 428, 1339, 13, 1675, 423, 28792, 17777, 326, 1611, 286, 11359, 28922, 11, 5897, 17813, 11, 27942, 284, 262, 3662, 198, 198, 1659, 5316, 13, 314, 3520, 6563, 326, 28792, 1061, 262, 1099, 13, 1119, 1061, 6266, 13, 314, 1254, 6563, 326, 262, 28792, 1833, 511, 5798, 318, 284, 1061, 262, 2370, 290, 284, 5409, 262, 1339, 319, 262, 2370, 290, 407, 284, 307, 12824, 416, 262, 22820, 11655, 5696, 447, 251, 13, 679, 788, 13030, 262, 3761, 1074, 284, 2393, 257, 6268, 329, 465, 9110, 13, 198, 198, 2202, 2932, 1248, 11, 2813, 11, 39708, 12164, 3761, 1074, 5717, 257, 6268, 20623, 9002, 46314, 1358, 13, 564, 250, 1212, 318, 281, 8468, 21960, 13, 1318, 318, 257, 6397, 17507, 326, 1583, 13, 12164, 447, 247, 82, 21960, 481, 307, 262, 749, 42732, 287, 2106, 447, 251, 5081, 262, 6268, 543, 788, 1816, 319, 284, 8996, 39708, 12164, 1339, 284, 21097, 9953, 4473, 13, 564, 250, 6767, 5024, 30855, 884, 355, 18496, 16156, 779, 1633, 640, 284, 1923, 329, 262, 11375, 286, 6997, 13, 9953, 13, 2750, 13017, 319, 262, 1171, 8993, 11, 16156, 447, 247, 82, 48347, 8278, 284, 530, 290, 2063, 1510, 583, 1755, 287, 2795, 16156, 7953, 287, 12948, 2095, 18898, 351, 2754, 284, 6997, 9953, 11, 262, 2415, 673, 41466, 1571, 306, 6412, 284, 355, 2006, 1995, 13, 447, 251, 198, 198, 1870, 788, 1625, 11, 287, 616, 4459, 11, 4047, 47716, 290, 5859, 10252, 25, 198, 198, 447, 250, 6104, 611, 262, 28792, 389, 17767, 407, 284, 2342, 597, 1705, 5197, 11, 340, 318, 31363, 284, 1607, 281, 555, 3107, 395, 1068, 9002, 284, 3368, 4854, 546, 262, 1339, 13, 8447, 11, 1844, 46314, 1358, 318, 3306, 284, 11005, 262, 1029, 2526, 286, 9002, 22733, 13, 1583, 13, 12164, 41177, 7893, 428 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Quiksilver Technical Figueira da Foz (Portugal), will participate on this year's Kayaksurf & Waveski circuit with two athletes: José Morais (owner of the store) and Gonçalo Duarte (surfkayaker). Meet the team and check the photos. The swell was not so good but was only to present the Team. Both riders belong to the Figueira Kayak Clube.
[ 4507, 72, 591, 46978, 20671, 12138, 518, 8704, 12379, 376, 8590, 357, 13924, 43778, 828, 481, 8277, 319, 428, 614, 338, 17356, 4730, 333, 69, 1222, 42733, 4106, 10349, 351, 734, 10856, 25, 36997, 3461, 15152, 357, 18403, 286, 262, 3650, 8, 290, 35371, 16175, 7335, 10343, 32074, 357, 11793, 69, 5568, 3110, 737, 21167, 262, 1074, 290, 2198, 262, 5205, 13, 383, 36214, 373, 407, 523, 922, 475, 373, 691, 284, 1944, 262, 4816, 13, 5747, 13750, 5594, 284, 262, 12138, 518, 8704, 17356, 461, 1012, 3266, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Is racial bias built into U.S. immigration law? “The first instance of any kind of visa as we know it for a legal way to come into the system started with the Chinese Exclusion Act of 1884,” according to Jenny Yang, Director of Advocacy and Policy for World Relief’s Refugee and Immigration Program. Scientific data was circulated as evidence that Chinese people were inferior and ought to be kept out. However, immigration law based on race was abolished in 1965. “Still, a lot of reforms are needed.”
[ 3792, 8425, 10690, 3170, 656, 471, 13, 50, 13, 6272, 1099, 30, 564, 250, 464, 717, 4554, 286, 597, 1611, 286, 14552, 355, 356, 760, 340, 329, 257, 2742, 835, 284, 1282, 656, 262, 1080, 2067, 351, 262, 3999, 1475, 4717, 2191, 286, 1248, 5705, 11, 447, 251, 1864, 284, 28437, 10998, 11, 5890, 286, 37866, 1590, 290, 7820, 329, 2159, 30323, 447, 247, 82, 42791, 290, 18204, 6118, 13, 22060, 1366, 373, 26772, 355, 2370, 326, 3999, 661, 547, 18536, 290, 10783, 284, 307, 4030, 503, 13, 2102, 11, 6272, 1099, 1912, 319, 3234, 373, 32424, 287, 17672, 13, 564, 250, 9590, 11, 257, 1256, 286, 12506, 389, 2622, 13, 447, 251 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
// Copyright (c) Microsoft Open Technologies, Inc. All rights reserved. See License.txt in the project root for license information. namespace System.Data.Entity.TestModels.ProviderAgnosticModel { using System; public enum AllTypesEnum { EnumValue0 = 0, EnumValue1 = 1, EnumValue2 = 2, EnumValue3 = 3, }; public class AllTypes { public int Id { get; set; } public bool BooleanProperty { get; set; } public byte ByteProperty { get; set; } public DateTime DateTimeProperty { get; set; } public decimal DecimalProperty { get; set; } public double DoubleProperty { get; set; } public byte[] FixedLengthBinaryProperty { get; set; } public string FixedLengthStringProperty { get; set; } public string FixedLengthUnicodeStringProperty { get; set; } public float FloatProperty { get; set; } public Guid GuidProperty { get; set; } public short Int16Property { get; set; } public int Int32Property { get; set; } public long Int64Property { get; set; } public byte[] MaxLengthBinaryProperty { get; set; } public string MaxLengthStringProperty { get; set; } public string MaxLengthUnicodeStringProperty { get; set; } public TimeSpan TimeSpanProperty { get; set; } public string VariableLengthStringProperty { get; set; } public byte[] VariableLengthBinaryProperty { get; set; } public string VariableLengthUnicodeStringProperty { get; set; } public AllTypesEnum EnumProperty { get; set; } } }
[ 171, 119, 123, 1003, 15069, 357, 66, 8, 5413, 4946, 21852, 11, 3457, 13, 1439, 2489, 10395, 13, 4091, 13789, 13, 14116, 287, 262, 1628, 6808, 329, 5964, 1321, 13, 198, 198, 14933, 10223, 4482, 13, 6601, 13, 32398, 13, 14402, 5841, 1424, 13, 29495, 32, 4593, 15132, 17633, 198, 90, 198, 220, 220, 220, 1262, 4482, 26, 628, 220, 220, 220, 1171, 33829, 1439, 31431, 4834, 388, 198, 220, 220, 220, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 2039, 388, 11395, 15, 796, 657, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2039, 388, 11395, 16, 796, 352, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2039, 388, 11395, 17, 796, 362, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2039, 388, 11395, 18, 796, 513, 11, 198, 220, 220, 220, 18083, 628, 220, 220, 220, 1171, 1398, 1439, 31431, 198, 220, 220, 220, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 1171, 493, 5121, 1391, 651, 26, 900, 26, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 1171, 20512, 41146, 21746, 1391, 651, 26, 900, 26, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 1171, 18022, 30589, 21746, 1391, 651, 26, 900, 26, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 1171, 7536, 7575, 7536, 7575, 21746, 1391, 651, 26, 900, 26, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 1171, 32465, 4280, 4402, 21746, 1391, 651, 26, 900, 26, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 1171, 4274, 11198, 21746, 1391, 651, 26, 900, 26, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 1171, 18022, 21737, 10832, 24539, 33, 3219, 21746, 1391, 651, 26, 900, 26, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 1171, 4731, 10832, 24539, 10100, 21746, 1391, 651, 26, 900, 26, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 1171, 4731, 10832, 24539, 3118, 291, 1098, 10100, 21746, 1391, 651, 26, 900, 26, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 1171, 12178, 48436, 21746, 1391, 651, 26, 900, 26, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 1171, 37026, 37026, 21746, 1391, 651, 26, 900, 26, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 1171, 1790, 2558, 1433, 21746, 1391, 651, 26, 900, 26, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 1171, 493, 2558, 2624, 21746, 1391, 651, 26, 900, 26, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 1171, 890, 2558, 2414, 21746, 1391, 651, 26, 900, 26, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 1171, 18022, 21737, 5436, 24539, 33, 3219, 21746, 1391, 651, 26, 900, 26, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 1171, 4731, 5436, 24539, 10100, 21746, 1391, 651, 26, 900, 26, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 1171, 4731, 5436, 24539, 3118, 291, 1098, 10100, 21746, 1391, 651, 26, 900, 26, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 1171, 3862, 4561, 272, 3862, 4561, 272, 21746, 1391, 651, 26, 900, 26, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 1171, 4731, 35748, 24539, 10100, 21746, 1391, 651, 26, 900, 26, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 1171, 18022, 21737, 35748, 24539, 33, 3219, 21746, 1391, 651, 26, 900, 26, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 1171, 4731, 35748, 24539, 3118, 291, 1098, 10100, 21746, 1391, 651, 26, 900, 26, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 1171, 1439, 31431, 4834, 388, 2039, 388, 21746, 1391, 651, 26, 900, 26, 1782, 198, 220, 220, 220, 1782, 198, 92, 198 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
YA/Teen Book Club The YA/Teen Book Club is now reading In Other Lands by Sarah Rees Brennan. “Four years in the life of an unloved English schoolboy who’s invited to a secret magical school and learns that even in fantasyland, real life is messier than books. . . . But over the course of four years training among child soldiers, Elliot, unsurprisingly, grows up. His slow development into a genuinely kind person is entirely satisfying, as is his awakening to his own bisexuality and to the colonialism, sexism, and racism of Borderlands society. . . . A stellar . . . wholly rewarding journey.” ―Kirkus Reviews (starred review) Pick up a copy of In Other Lands today at Griffin Free and then join us on Wednesday, May 30 at 5:30 PM for a lively discussion.
[ 44947, 14, 45639, 4897, 6289, 198, 198, 464, 575, 32, 14, 45639, 4897, 6289, 318, 783, 3555, 554, 3819, 24182, 416, 10490, 797, 274, 26577, 13, 198, 198, 447, 250, 15137, 812, 287, 262, 1204, 286, 281, 9642, 2668, 3594, 1524, 7081, 508, 447, 247, 82, 9392, 284, 257, 3200, 10883, 1524, 290, 22974, 326, 772, 287, 8842, 1044, 11, 1103, 1204, 318, 2085, 959, 621, 3835, 13, 764, 764, 764, 887, 625, 262, 1781, 286, 1440, 812, 3047, 1871, 1200, 5795, 11, 30451, 11, 49619, 11, 13676, 510, 13, 2399, 3105, 2478, 656, 257, 17170, 1611, 1048, 318, 5000, 19201, 11, 355, 318, 465, 33971, 284, 465, 898, 24249, 414, 290, 284, 262, 48359, 11, 24953, 11, 290, 10713, 286, 47071, 3592, 13, 764, 764, 764, 317, 25041, 764, 764, 764, 18174, 23404, 7002, 13, 447, 251, 198, 31857, 42, 14232, 385, 20871, 357, 7364, 445, 2423, 8, 198, 198, 31686, 510, 257, 4866, 286, 554, 3819, 24182, 1909, 379, 16525, 3232, 290, 788, 4654, 514, 319, 3583, 11, 1737, 1542, 379, 642, 25, 1270, 3122, 329, 257, 29696, 5114, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
In aged humans, stroke is a major cause of disability for which no neuroprotective measures are available. In animal studies of focal ischemia, short-term hypothermia often reduces infarct size. Nevertheless, efficient neuroprotection requires long-term, regulated lowering of whole-body temperature. Previously, it is reported that post-stroke exposure to hydrogen sulfide (H2S) effectively lowers whole-body temperature and confers neuroprotection in aged animals. Here we report for the first time that the animals exposed to H2S the normal sleep–wake oscillations are replaced by a low-amplitude EEG dominated by a 4-Hz rhythmicactivity, reminiscent of EEG recordings in hibernating animals. In the present study using magnetic resonance imaging, reverse transcriptase polymerase chain reaction, western blotting and immunofluorescence, we characterized the central nervous system response to H2S -induced hypothermia and report, that annexin A1, a major constituent of peripheral leukocytes that is upregulated after stroke, was consistently downregulated in polymorphonuclear cells in the peri-lesional cortex of post-ischemic, aged rat brain after 48 hours of hypothermia induced by exposure to H2S. This might be due to the reduced kinetics of recruitment, adherence and infiltration of PMN cells by H2S -induced hypothermia. Our findings further suggest that, in contrast to monotherapies that have thus far uniformly failed in clinical practice, prolonged hypothermia has pleiotropic effects on brain physiology that may be necessary for effective protection of the brain after stroke.
[ 818, 9722, 5384, 11, 14000, 318, 257, 1688, 2728, 286, 14013, 329, 543, 645, 7669, 11235, 13967, 5260, 389, 1695, 13, 554, 5044, 3640, 286, 25397, 318, 15245, 544, 11, 1790, 12, 4354, 5328, 847, 20730, 1690, 12850, 1167, 283, 310, 2546, 13, 15933, 11, 6942, 7669, 42846, 4433, 890, 12, 4354, 11, 17153, 21683, 286, 2187, 12, 2618, 5951, 13, 29875, 11, 340, 318, 2098, 326, 1281, 12, 30757, 7111, 284, 17669, 22443, 485, 357, 39, 17, 50, 8, 6840, 34157, 2187, 12, 2618, 5951, 290, 1013, 364, 7669, 42846, 287, 9722, 4695, 13, 3423, 356, 989, 329, 262, 717, 640, 326, 262, 4695, 7362, 284, 367, 17, 50, 262, 3487, 3993, 22940, 26391, 447, 250, 48530, 24969, 602, 389, 6928, 416, 257, 1877, 12, 321, 489, 3984, 48749, 13354, 416, 257, 604, 12, 7399, 14405, 9383, 21797, 11, 24960, 286, 48749, 18813, 287, 46681, 77, 803, 4695, 13, 554, 262, 1944, 2050, 1262, 14091, 29371, 19560, 11, 9575, 14687, 589, 30528, 589, 6333, 6317, 11, 8830, 43182, 889, 290, 16217, 1659, 2290, 48699, 11, 356, 16264, 262, 4318, 10927, 1080, 2882, 284, 367, 17, 50, 532, 17223, 5328, 847, 20730, 290, 989, 11, 326, 22768, 259, 317, 16, 11, 257, 1688, 39384, 286, 25514, 443, 2724, 30309, 326, 318, 510, 27739, 706, 14000, 11, 373, 9835, 866, 27739, 287, 34196, 261, 4016, 4778, 287, 262, 583, 72, 12, 829, 1538, 20223, 286, 1281, 12, 2304, 4411, 291, 11, 9722, 4227, 3632, 706, 4764, 2250, 286, 5328, 847, 20730, 18268, 416, 7111, 284, 367, 17, 50, 13, 770, 1244, 307, 2233, 284, 262, 5322, 18967, 14596, 286, 19624, 11, 34721, 290, 45106, 286, 3122, 45, 4778, 416, 367, 17, 50, 532, 17223, 5328, 847, 20730, 13, 3954, 6373, 2252, 1950, 326, 11, 287, 6273, 284, 937, 847, 499, 444, 326, 423, 4145, 1290, 42096, 4054, 287, 8668, 3357, 11, 20573, 5328, 847, 20730, 468, 3339, 5151, 1773, 291, 3048, 319, 3632, 38033, 326, 743, 307, 3306, 329, 4050, 4800, 286, 262, 3632, 706, 14000, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Q: How to install Visual Studio on Ubuntu 20.04? Can anyone tell how to install Visual Studio and .NET Framework on Ubuntu 20.04? Is there any way to Install .NET and Visual Studio in Ubuntu 20.04? A: Unfortunately Visual Studio does not available for Linux. But you really want' exactly VS - you should try Wine or any Windows VM. But I recommend for you one of the following options: Rider (Cross platform IDE from JetBrains) Visual Studio Code (Very popular solution for developer on any technology) Mono Develop Eclipse
[ 48, 25, 198, 198, 2437, 284, 2721, 15612, 11733, 319, 14949, 1160, 13, 3023, 30, 198, 198, 6090, 2687, 1560, 703, 284, 2721, 15612, 11733, 290, 764, 12884, 25161, 319, 14949, 1160, 13, 3023, 30, 198, 3792, 612, 597, 835, 284, 15545, 764, 12884, 290, 15612, 11733, 287, 14949, 1160, 13, 3023, 30, 198, 198, 32, 25, 198, 198, 13898, 15612, 11733, 857, 407, 1695, 329, 7020, 13, 887, 345, 1107, 765, 6, 3446, 22269, 532, 345, 815, 1949, 20447, 393, 597, 3964, 16990, 13, 198, 1537, 314, 4313, 329, 345, 530, 286, 262, 1708, 3689, 25, 198, 198, 49, 1304, 357, 21544, 3859, 33497, 422, 19013, 9414, 1299, 8, 198, 36259, 11733, 6127, 357, 16371, 2968, 4610, 329, 8517, 319, 597, 3037, 8, 198, 9069, 78, 6013, 198, 36, 17043, 628 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
IN THE COURT OF CRIMINAL APPEALS OF TEXAS NO. PD-1240-10 DAVID CEPEDA JONES, Appellant v. THE STATE OF TEXAS ON APPELLANT’S PETITION FOR DISCRETIONARY REVIEW FROM THE FOURTH COURT OF APPEALS BEXAR COUNTY                         Per curiam. Keasler, and Hervey, JJ., dissent. O R D E R            The petition for discretionary review violates Rule of Appellate Procedure 9.3(b) and 68.4(i) because the original petition is not accompanied by 11 copies and the petition does not contain a complete copy of the opinion of the court of appeals.            The petition is struck. See Rule of Appellate Procedure 68.6.            The petitioner may redraw the petition. The redrawn petition and copies must be filed in the Court of Criminal Appeals within thirty days after the date of this Order.  Filed: October 6, 2010 Do Not Publish
[ 628, 628, 628, 628, 628, 198, 198, 1268, 3336, 46627, 3963, 8740, 3955, 17961, 3486, 11401, 23333, 198, 19238, 309, 6369, 1921, 628, 198, 198, 15285, 13, 14340, 12, 1065, 1821, 12, 940, 628, 628, 198, 5631, 11008, 327, 8905, 1961, 32, 449, 39677, 11, 2034, 695, 415, 198, 198, 85, 13, 198, 198, 10970, 35454, 3963, 309, 6369, 1921, 628, 198, 198, 1340, 3486, 11401, 3069, 8643, 447, 247, 50, 220, 32043, 17941, 7473, 13954, 43387, 24131, 13153, 4526, 28206, 198, 10913, 2662, 3336, 376, 11698, 4221, 46627, 3963, 3486, 11401, 23333, 198, 33, 6369, 1503, 41012, 628, 628, 39172, 8828, 33477, 1849, 5990, 1090, 1789, 13, 220, 3873, 292, 1754, 11, 290, 2332, 3304, 11, 38775, 1539, 17873, 13, 198, 198, 46, 371, 360, 412, 371, 220, 628, 17811, 4603, 1849, 464, 8853, 329, 41314, 2423, 21806, 14330, 286, 2034, 695, 378, 34997, 860, 13, 18, 7, 65, 8, 290, 201, 198, 3104, 13, 19, 7, 72, 8, 780, 262, 2656, 8853, 318, 407, 11791, 416, 1367, 9088, 290, 262, 8853, 857, 201, 198, 1662, 3994, 257, 1844, 4866, 286, 262, 4459, 286, 262, 2184, 286, 15192, 13, 198, 17811, 4603, 1849, 464, 8853, 318, 7425, 13, 220, 4091, 14330, 286, 2034, 695, 378, 34997, 8257, 13, 21, 13, 198, 17811, 4603, 1849, 464, 39741, 743, 2266, 1831, 262, 8853, 13, 220, 383, 2266, 5791, 8853, 290, 9088, 1276, 307, 5717, 201, 198, 259, 262, 3078, 286, 15531, 20172, 1626, 12277, 1528, 706, 262, 3128, 286, 428, 8284, 13, 1849, 198, 37, 3902, 25, 3267, 718, 11, 3050, 198, 5211, 1892, 8525, 1836, 198 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Get affordable prints and increased versatility. Set up, connect, and print right from your mobile device, and produce high-quality photos and everyday documents. Print, scan, and copy with ease. HP Photo and Document All-in-One Printers are designed for families and other home users who want a device capable of printing everything from documents, email and web pages to rich, bright lab-quality photos - with copy and scan tools too. Dynamic security enabled printer. Intended to be used with cartridges using only HP original electronic circuitry. Cartridges with modified or non-HP electronic circuitry may not work, and those that work today may not work in the future. Get affordable prints and increased versatility. Set up, connect, and print right from your mobile device, and produce high-quality photos and everyday documents. Print, scan, and copy with ease. HP Photo and Document All-in-One Printers are designed for families and other home users who want a device capable of printing everything from documents, email and web pages to rich, bright lab-quality photos - with copy and scan tools too. Dynamic security enabled printer. Intended to be used with cartridges using only HP original electronic circuitry. Cartridges with modified or non-HP electronic circuitry may not work, and those that work today may not work in the future.
[ 3855, 10935, 20842, 290, 3220, 31689, 13, 5345, 510, 11, 2018, 11, 290, 3601, 826, 422, 534, 5175, 3335, 11, 290, 4439, 1029, 12, 13237, 5205, 290, 10908, 4963, 13, 12578, 11, 9367, 11, 290, 4866, 351, 10152, 13, 6574, 5555, 290, 16854, 1439, 12, 259, 12, 3198, 7489, 1010, 389, 3562, 329, 4172, 290, 584, 1363, 2985, 508, 765, 257, 3335, 6007, 286, 13570, 2279, 422, 4963, 11, 3053, 290, 3992, 5468, 284, 5527, 11, 6016, 2248, 12, 13237, 5205, 532, 351, 4866, 290, 9367, 4899, 1165, 13, 26977, 2324, 9343, 20632, 13, 2558, 1631, 284, 307, 973, 351, 37852, 1262, 691, 6574, 2656, 7914, 42344, 13, 13690, 32124, 351, 9518, 393, 1729, 12, 14082, 7914, 42344, 743, 407, 670, 11, 290, 883, 326, 670, 1909, 743, 407, 670, 287, 262, 2003, 13, 198, 198, 3855, 10935, 20842, 290, 3220, 31689, 13, 5345, 510, 11, 2018, 11, 290, 3601, 826, 422, 534, 5175, 3335, 11, 290, 4439, 1029, 12, 13237, 5205, 290, 10908, 4963, 13, 12578, 11, 9367, 11, 290, 4866, 351, 10152, 13, 198, 198, 14082, 5555, 290, 16854, 1439, 12, 259, 12, 3198, 7489, 1010, 389, 3562, 329, 4172, 290, 584, 1363, 2985, 508, 765, 257, 3335, 6007, 286, 13570, 2279, 422, 4963, 11, 3053, 290, 3992, 5468, 284, 5527, 11, 6016, 2248, 12, 13237, 5205, 532, 351, 4866, 290, 9367, 4899, 1165, 13, 198, 198, 44090, 2324, 9343, 20632, 13, 2558, 1631, 284, 307, 973, 351, 37852, 1262, 691, 6574, 2656, 7914, 42344, 13, 13690, 32124, 351, 9518, 393, 1729, 12, 14082, 7914, 42344, 743, 407, 670, 11, 290, 883, 326, 670, 1909, 743, 407, 670, 287, 262, 2003, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
--- layout: example title: Wheat Plot Example permalink: /examples/wheat-plot/index.html spec: wheat-plot image: /examples/img/wheat-plot.png --- A [wheat plot](http://www.perceptualedge.com/articles/visual_business_intelligence/the_datavis_jitterbug.pdf) is an alternative to standard dot plots and histograms that incorporates aspects of both. The x-coordinate of a point is based on its exact value. The y-coordinate is determined by grouping points into histogram bins, then stacking them based on their rank order within each bin. While not scalable to large numbers of data points, wheat plots allow inspection of (and interaction with) individual points without overplotting. For a related approach, see [beeswarm plots](../beeswarm-plot/). {% include example spec=page.spec %}
[ 6329, 198, 39786, 25, 1672, 198, 7839, 25, 34744, 28114, 17934, 198, 525, 31000, 25, 1220, 1069, 12629, 14, 12491, 265, 12, 29487, 14, 9630, 13, 6494, 198, 16684, 25, 17135, 12, 29487, 198, 9060, 25, 1220, 1069, 12629, 14, 9600, 14, 12491, 265, 12, 29487, 13, 11134, 198, 6329, 198, 198, 32, 685, 12491, 265, 7110, 16151, 4023, 1378, 2503, 13, 525, 984, 723, 14907, 13, 785, 14, 26845, 14, 41464, 62, 22680, 62, 32683, 14, 1169, 62, 19608, 23401, 62, 73, 1967, 25456, 13, 12315, 8, 318, 281, 5559, 284, 3210, 16605, 21528, 290, 1554, 26836, 326, 33181, 7612, 286, 1111, 13, 383, 2124, 12, 37652, 4559, 286, 257, 966, 318, 1912, 319, 663, 2748, 1988, 13, 383, 331, 12, 37652, 4559, 318, 5295, 416, 36115, 2173, 656, 1554, 21857, 41701, 11, 788, 41228, 606, 1912, 319, 511, 4279, 1502, 1626, 1123, 9874, 13, 2893, 407, 43865, 284, 1588, 3146, 286, 1366, 2173, 11, 17135, 21528, 1249, 15210, 286, 357, 392, 10375, 351, 8, 1981, 2173, 1231, 625, 29487, 889, 13, 1114, 257, 3519, 3164, 11, 766, 685, 41712, 31975, 21528, 16151, 40720, 41712, 31975, 12, 29487, 14, 737, 198, 198, 90, 4, 2291, 1672, 1020, 28, 7700, 13, 16684, 4064, 92, 198 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Michael Bloomberg’s policies as New York City mayor are analyzed by legal and constitutional experts who explain that in their view the 2020 presidential candidate pursued policies detrimental to people of color. Joy Reid and her panel discuss.
[ 13256, 15689, 447, 247, 82, 4788, 355, 968, 1971, 2254, 9591, 389, 15475, 416, 2742, 290, 9758, 6154, 508, 4727, 326, 287, 511, 1570, 262, 12131, 4787, 4540, 19189, 4788, 29417, 284, 661, 286, 3124, 13, 14087, 16095, 290, 607, 6103, 2112, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
The Miami Art Museum and Miami Art Central announced last week that they are forming a partnership in presenting exhibitions of original art works to the public. The move comes as plans by the Miami Art Museum move ahead for creation of an expanded museum. In six months, the two organizations plan to evaluate a possible merger. Whatever the outcome, the development means added impetus to the campaign to build a new museum in downtown Miami and heralds expanded relationships between public and private art institutions here. Playing a key role in the partnership is Ella Fontanals-Cisneros, who founded Miami Art Central with the objective, she says, of stimulating an active dialogue with the community through exhibitions and education programs reflecting the interests of the local community. The facility of Cuba-born Mrs. Cisneros is in a 1940s building in South Miami formerly occupied by Southern Bell Co., renovated under the direction of Italian architect Alessandro Fiorentino. It features 20,000 square feet of exhibition space on two floors where five major exhibitions per year and special events are staged. Mrs. Cisneros was interviewed by Miami Today international editor Michael Hayes before the partnership announcement as she prepared special events at Miami Art Central in conjunction with the Art Basel Miami Beach art fair earlier this month. This is an excerpt from the weekly profile article published in Miami Today. To read the entire article in full, order this issue or subscribe to the print edition of Miami Today.
[ 464, 8437, 3683, 9594, 290, 8437, 3683, 5694, 3414, 938, 1285, 326, 484, 389, 14583, 257, 10413, 287, 17728, 48130, 286, 2656, 1242, 2499, 284, 262, 1171, 13, 383, 1445, 2058, 355, 3352, 416, 262, 8437, 3683, 9594, 1445, 4058, 329, 6282, 286, 281, 9902, 13257, 13, 554, 2237, 1933, 11, 262, 734, 5745, 1410, 284, 13446, 257, 1744, 24589, 13, 15935, 262, 8055, 11, 262, 2478, 1724, 2087, 43007, 284, 262, 1923, 284, 1382, 257, 649, 13257, 287, 9436, 8437, 290, 28783, 82, 9902, 6958, 1022, 1171, 290, 2839, 1242, 6712, 994, 13, 198, 198, 36530, 257, 1994, 2597, 287, 262, 10413, 318, 7122, 64, 24060, 272, 874, 12, 34, 49861, 418, 11, 508, 9393, 8437, 3683, 5694, 351, 262, 9432, 11, 673, 1139, 11, 286, 35640, 281, 4075, 10721, 351, 262, 2055, 832, 48130, 290, 3707, 4056, 20252, 262, 5353, 286, 262, 1957, 2055, 13, 198, 198, 464, 6841, 286, 14159, 12, 6286, 9074, 13, 327, 49861, 418, 318, 287, 257, 16236, 82, 2615, 287, 2520, 8437, 15734, 12030, 416, 8050, 7459, 1766, 1539, 46353, 739, 262, 4571, 286, 8200, 7068, 47319, 28092, 23238, 382, 429, 2879, 13, 632, 3033, 1160, 11, 830, 6616, 3625, 286, 17127, 2272, 319, 734, 18570, 810, 1936, 1688, 48130, 583, 614, 290, 2041, 2995, 389, 23393, 13, 198, 198, 27034, 13, 327, 49861, 418, 373, 12299, 416, 8437, 6288, 3230, 5464, 3899, 25109, 878, 262, 10413, 8009, 355, 673, 5597, 2041, 2995, 379, 8437, 3683, 5694, 287, 17856, 351, 262, 3683, 6455, 417, 8437, 8511, 1242, 3148, 2961, 428, 1227, 13, 770, 318, 281, 20911, 422, 262, 10273, 7034, 2708, 3199, 287, 8437, 6288, 13, 1675, 1100, 262, 2104, 2708, 287, 1336, 11, 1502, 428, 2071, 393, 12383, 284, 262, 3601, 8313, 286, 8437, 6288, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Prep for Changing Brake Pad Material Should I fully sand my rotors if Im changing pad material? I understand the basics of disc brakes in that a little bit of the pad material imbeds itsself in the rotors as part of the normal process of braking. This would lead me to believe sanding is necessary. The problem is of course that Im a little lazy. If it matters, I would be coming off EBC Red pads, which they say are a type of organic material, and moving back to the stock Shimano sintered pads. I originally left the Shimano pads as they were howlingly loud and had ok success with the EBC's. They are starting to wear fast however, and I now have at least 4 brand new sets of the Shimano's laying around, so I figure I'll try them again rather than spending more money. Frankly I don't think that's necessary. I would suggest simply changing them out for new pads of whatever compound and then breaking them in. Whenever you change brake pads, independent of compound, you must break them in again. For God's Sake! Do NOT sand your rotors. Clean them with isopropyl alcohol, wipe dry with a nice clean rag and keep your greasy, KFC-eatin' fingers offa them. Change out the pads, making sure to center them correctly and then go ride your bike. Well, I know I would need to break in the new pads, but doing that on top of the older material and mixing the 2 is what I was questioning. The actuall process of breaking in pads is where through application of the brakes the pad material imbeds in the rotor surface gradually getting you up to full braking performance. What I dont know is: will the new pad material just push out the old with no problem? Or will they mix and decrease braking performance? It would be highly unusual for the use of one pad material to interfere with the efficacy of another material on a standard metal rotor in such a way as to noticeably affect braking performance, particularly if the rotor were thoroughly cleaned beforehand. That's my opinion. There may be some kind of materials scientist out there who may know about something going on in the meso-scale that I don't who may disagree with what I just said, but I don't think so. As far as I'm concerned there's no need to do anything to the rotor when switching between different types of pads. I have a set of older Shimano XTs where I switch to the stock metallic pads when riding up at my friends cottage and use organic ones when riding in the city. I just drop the pads in and they work just fine, no need to clean the rotors or pads. I've switched back & forth many times over the years and I've never had any problems. It would be highly unusual for the use of one pad material to interfere with the efficacy of another material on a standard metal rotor in such a way as to noticeably affect braking performance, particularly if the rotor were thoroughly cleaned beforehand. That's my opinion. There may be some kind of materials scientist out there who may know about something going on in the meso-scale that I don't who may disagree with what I just said, but I don't think so. All cleaning them with alcohol will do is remove oils, dirt, etc. IF the previous pad material should in fact be removed to optimize performance, alcohol isn't going to do it. IF the previous pad material should in fact be removed to optimize performance, alcohol isn't going to do it. The rotor has micropores in it that may have captured some pad material, maybe several micrograms at most. If you are being told by a manufacturer or dealer someplace that such an infinitesimally small amount of previous material will somehow interfere with the performance of your new brake pads (which it won't), then you probably need to find a new brand of rotor, brake and pad. The bottom line is this: there is no credible reason to believe that removal of previous pad material is necessary unless you have done something highly unusual with your brakes or are using them for some highly unusual application or there is some highly unusual condition that you are not mentioning in this forum.
[ 37534, 329, 33680, 9718, 365, 15744, 14633, 198, 198, 19926, 314, 3938, 6450, 616, 5724, 669, 611, 1846, 5609, 14841, 2587, 30, 198, 198, 40, 1833, 262, 19165, 286, 1221, 23746, 287, 326, 257, 1310, 1643, 286, 262, 14841, 2587, 545, 3077, 82, 663, 944, 287, 262, 5724, 669, 355, 636, 286, 262, 3487, 1429, 286, 36682, 13, 770, 561, 1085, 502, 284, 1975, 6450, 278, 318, 3306, 13, 383, 1917, 318, 286, 1781, 326, 1846, 257, 1310, 16931, 13, 198, 198, 1532, 340, 6067, 11, 314, 561, 307, 2406, 572, 412, 2749, 2297, 21226, 11, 543, 484, 910, 389, 257, 2099, 286, 10469, 2587, 11, 290, 3867, 736, 284, 262, 4283, 31698, 5733, 264, 600, 1068, 21226, 13, 198, 198, 40, 6198, 1364, 262, 31698, 5733, 21226, 355, 484, 547, 703, 1359, 306, 7812, 290, 550, 12876, 1943, 351, 262, 412, 2749, 338, 13, 1119, 389, 3599, 284, 5806, 3049, 2158, 11, 290, 314, 783, 423, 379, 1551, 604, 4508, 649, 5621, 286, 262, 31698, 5733, 338, 16299, 1088, 11, 523, 314, 3785, 314, 1183, 1949, 606, 757, 2138, 621, 4581, 517, 1637, 13, 198, 198, 17439, 306, 314, 836, 470, 892, 326, 338, 3306, 13, 314, 561, 1950, 2391, 5609, 606, 503, 329, 649, 21226, 286, 4232, 13061, 290, 788, 7163, 606, 287, 13, 21326, 345, 1487, 20439, 21226, 11, 4795, 286, 13061, 11, 345, 1276, 2270, 606, 287, 757, 13, 198, 198, 1890, 1793, 338, 311, 539, 0, 198, 198, 5211, 5626, 6450, 534, 5724, 669, 13, 5985, 606, 351, 318, 404, 1773, 2645, 5548, 11, 19916, 5894, 351, 257, 3621, 3424, 34232, 290, 1394, 534, 10536, 4107, 11, 509, 4851, 12, 4098, 259, 6, 9353, 572, 64, 606, 13, 9794, 503, 262, 21226, 11, 1642, 1654, 284, 3641, 606, 9380, 290, 788, 467, 6594, 534, 7161, 13, 198, 198, 5779, 11, 314, 760, 314, 561, 761, 284, 2270, 287, 262, 649, 21226, 11, 475, 1804, 326, 319, 1353, 286, 262, 4697, 2587, 290, 17090, 262, 362, 318, 644, 314, 373, 14085, 13, 198, 198, 464, 43840, 439, 1429, 286, 7163, 287, 21226, 318, 810, 832, 3586, 286, 262, 23746, 262, 14841, 2587, 545, 3077, 82, 287, 262, 44883, 4417, 11835, 1972, 345, 510, 284, 1336, 36682, 2854, 13, 198, 198, 2061, 314, 17666, 760, 318, 25, 481, 262, 649, 14841, 2587, 655, 4574, 503, 262, 1468, 351, 645, 1917, 30, 1471, 481, 484, 5022, 290, 10070, 36682, 2854, 30, 198, 198, 1026, 561, 307, 4047, 8468, 329, 262, 779, 286, 530, 14841, 2587, 284, 18135, 351, 262, 20179, 286, 1194, 2587, 319, 257, 3210, 6147, 44883, 287, 884, 257, 835, 355, 284, 33752, 2689, 36682, 2854, 11, 3573, 611, 262, 44883, 547, 13770, 20750, 27091, 13, 1320, 338, 616, 4459, 13, 1318, 743, 307, 617, 1611, 286, 5696, 11444, 503, 612, 508, 743, 760, 546, 1223, 1016, 319, 287, 262, 18842, 78, 12, 9888, 326, 314, 836, 470, 508, 743, 12546, 351, 644, 314, 655, 531, 11, 475, 314, 836, 470, 892, 523, 13, 198, 198, 1722, 1290, 355, 314, 1101, 5213, 612, 338, 645, 761, 284, 466, 1997, 284, 262, 44883, 618, 15430, 1022, 1180, 3858, 286, 21226, 13, 314, 423, 257, 900, 286, 4697, 31698, 5733, 1395, 33758, 810, 314, 5078, 284, 262, 4283, 27306, 21226, 618, 10311, 510, 379, 616, 2460, 36856, 290, 779, 10469, 3392, 618, 10311, 287, 262, 1748, 13, 314, 655, 4268, 262, 21226, 287, 290, 484, 670, 655, 3734, 11, 645, 761, 284, 3424, 262, 5724, 669, 393, 21226, 13, 314, 1053, 15293, 736, 1222, 6071, 867, 1661, 625, 262, 812, 290, 314, 1053, 1239, 550, 597, 2761, 13, 198, 198, 1026, 561, 307, 4047, 8468, 329, 262, 779, 286, 530, 14841, 2587, 284, 18135, 351, 262, 20179, 286, 1194, 2587, 319, 257, 3210, 6147, 44883, 287, 884, 257, 835, 355, 284, 33752, 2689, 36682, 2854, 11, 3573, 611, 262, 44883, 547, 13770, 20750, 27091, 13, 1320, 338, 616, 4459, 13, 1318, 743, 307, 617, 1611, 286, 5696, 11444, 503, 612, 508, 743, 760, 546, 1223, 1016, 319, 287, 262, 18842, 78, 12, 9888, 326, 314, 836, 470, 508, 743, 12546, 351, 644, 314, 655, 531, 11, 475, 314, 836, 470, 892, 523, 13, 198, 198, 3237, 12724, 606, 351, 5548, 481, 466, 318, 4781, 20629, 11, 13647, 11, 3503, 13, 198, 198, 5064, 262, 2180, 14841, 2587, 815, 287, 1109, 307, 4615, 284, 27183, 2854, 11, 5548, 2125, 470, 1016, 284, 466, 340, 13, 198, 198, 5064, 262, 2180, 14841, 2587, 815, 287, 1109, 307, 4615, 284, 27183, 2854, 11, 5548, 2125, 470, 1016, 284, 466, 340, 13, 198, 198, 464, 44883, 468, 12314, 1773, 2850, 287, 340, 326, 743, 423, 7907, 617, 14841, 2587, 11, 3863, 1811, 4580, 4546, 82, 379, 749, 13, 1002, 345, 389, 852, 1297, 416, 257, 11554, 393, 16456, 617, 5372, 326, 884, 281, 1167, 259, 2737, 320, 453, 1402, 2033, 286, 2180, 2587, 481, 7599, 18135, 351, 262, 2854, 286, 534, 649, 20439, 21226, 357, 4758, 340, 1839, 470, 828, 788, 345, 2192, 761, 284, 1064, 257, 649, 4508, 286, 44883, 11, 20439, 290, 14841, 13, 383, 4220, 1627, 318, 428, 25, 612, 318, 645, 18409, 1738, 284, 1975, 326, 9934, 286, 2180, 14841, 2587, 318, 3306, 4556, 345, 423, 1760, 1223, 4047, 8468, 351, 534, 23746, 393, 389, 1262, 606, 329, 617, 4047, 8468, 3586, 393, 612, 318, 617, 4047, 8468, 4006, 326, 345, 389, 407, 20862, 287, 428, 10041, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
7 P.3d 49 (2000) Donald L. SEGNITZ, Appellant (Defendant), v. The STATE of Wyoming, Appellee (Plaintiff). Donald L. Segnitz, Appellant (Defendant), v. The State of Wyoming, Appellee (Plaintiff). Nos. 99-223, 99-254. Supreme Court of Wyoming. June 2, 2000. *50 Representing Appellant: Donald L. Segnitz, Pro Se. Representing Appellee: Gay Woodhouse, Attorney General; Paul S. Rehurek, Deputy Attorney General; and D. Michael Pauling, Senior Assistant Attorney General. Before LEHMAN, C.J., and THOMAS, MACY, GOLDEN, and HILL, JJ. MACY, Justice. Appellant Donald L. Segnitz appeals from the denials of two motions he filed in two separate courts to correct his illegal sentences. The cases were consolidated for purposes of appeal. We affirm in part and reverse in part. ISSUES In Case No. 99-223, Segnitz presents the following issues for our review: 1. Did the District Court [err] by denying Appellant's Motion to Correct an Illegal Sentence, which was filed because while orally sentenced to concurrent sentences, the Written Judgement and Sentence, and Mitimus failed to stipulate that sentence was concurrent[?] 2. Did the District Court [err] by denying Appellant's Motion to Correct ... an ILLEGAL Sentence, which was filed because the Court did not award credit for time served in it[]s Judgement and Sentence, nor Mitimus[?] Nor had it been *51 addressed orally by the Court at sentencing. In Case No. 99-254, Segnitz presents the following issues for our review: A. Did the District Court sentence the Appellant to an illegal term by not abiding by W.R.Cr.P. 32(c)2(C), (E), and (F)? B. Did the District Court by denying the Motion to Correct an Illegal Sentence and then changing the original sentence abuse it[]s d[i]scretion? C. If the change in sentence was proper then should the Appellant [be] afforded due process by the District Court? FACTS In November of 1997, Segnitz was sentenced in Sweetwater County to serve a term in the Wyoming State Penitentiary of not less than one year nor more than three years, with credit for the time he served in presentence confinement, for the offense of felony larceny. He was released on parole to Community Alternatives of Casper on June 25, 1998. On July 30, 1998, Segnitz departed from Community Alternatives of Casper without authorization, stealing a car to facilitate his exit. He drove to Wheatland where he abandoned this car and stole another, which he drove to Indiana. Both the Platte County and Natrona County authorities issued arrest warrants for the crimes committed in their respective counties. The Board of Parole issued an order of arrest because Segnitz had violated the terms of his parole for the Sweetwater County felony larceny conviction. Segnitz was arrested in Indiana on August 1, 1998, and later charged with felony larceny in both Platte County and Natrona County. He pleaded guilty to the charges. Segnitz was sentenced on September 10, 1998, in Platte County to a term of not less than two years nor more than four years in the Wyoming State Penitentiary. The order was silent with regard to whether the sentence was to be served concurrently with or consecutively to any other sentences. On March 5, 1999, Segnitz was orally sentenced in Natrona County to the stipulated prison term of three to four years. The stipulation provided for the sentence to be served concurrently with the sentences imposed in Sweetwater County and Platte County. The written Judgment and Sentence failed to mention that the sentence was to be served concurrently with the other sentences, but, three months later, the district court entered an order nunc pro tunc to that effect. Segnitz arrived at the Wyoming State Penitentiary on or shortly after March 5, 1999, the date he was sentenced in Natrona County. On April 12, 1999, the Board of Parole revoked his parole for the Sweetwater County offense, crediting him "with all of the time during which he was released." Segnitz filed motions in the district courts of Platte County and Natrona County to correct illegal sentences. In his Platte County motion, Segnitz asserted that the Judgment and Sentence failed to specify how the sentence was to be served with regard to his other sentences. He also complained that the Judgment and Sentence failed to state the number of days awarded as presentence incarceration credit. In response, the district court issued an order wherein it announced that it intended for the sentence to be served consecutively to the others and that Segnitz was not entitled to presentence incarceration credit. In his Natrona County motion, Segnitz claimed that the Judgment and Sentence failed to reflect the district court's oral pronouncement that made the sentence run concurrently with the others and failed to award any presentence incarceration credit. Although the district court initially denied Segnitz's motion, it later entered the order nunc pro tunc referenced above which ordered the sentence for the Natrona County crime to be served concurrently with the other sentences. Segnitz appeals to the Wyoming Supreme Court. DISCUSSION A. Presentence Incarceration Credit Segnitz contends that both district courts erred when they refused to award credit for the time he spent confined before he was sentenced. The state counters that Segnitz was on parole and in the legal custody *52 of the Board of Parole during the entire time he was confined on these two charges and that the Board of Parole awarded him credit against his Sweetwater County sentence for all the time he spent on parole when his parole was eventually revoked. The decision to grant or deny a motion to correct an illegal sentence is usually left to the sound discretion of the district court. Hamill v. State, 948 P.2d 1356, 1358 (Wyo.1997). The district court's decision is given considerable deference unless a rational basis does not exist for it. Id. A criminal defendant is entitled to receive credit against his sentence for the time he was incarcerated prior to sentencing, provided that such confinement was because of his inability and failure to post bond on the offense for which he was awaiting disposition. Smith v. State, 988 P.2d 39, 40 (Wyo.1999). A sentence which does not include credit for presentence incarceration is illegal and constitutes an abuse of discretion. Id. A defendant is not, however, entitled to credit for the time he spent in custody when that confinement would have continued despite his ability to post bond. Id. The Board of Parole revoked Segnitz's parole for the Sweetwater County conviction after he had been sentenced in the Platte County and Natrona County cases. Had the Board of Parole revoked Segnitz's parole before he was sentenced in the Platte County and Natrona County cases, there would be no argument about the fact that those district courts refused to award presentence incarceration credit. We, however, are not concerned with this order of events and agree with the state's observation that Segnitz should not be allowed to apply the credit to the new sentences "simply because his parole was fortuitously revoked" after, and not before, his convictions for the new crimes. When the Board of Parole awarded Segnitz full credit against his Sweetwater County sentence for the time he spent on parole, it cured any problems that existed as a result of the failures by the district courts in Platte County and Natrona County to do so. B. Concurrent Sentences Segnitz contends that the district court erred when it ordered his Platte County sentence to run consecutively to the other sentences. The state concedes that Segnitz is correct in this assertion. The original order was silent with regard to how the Platte County sentence was intended to run with the other sentences. Eleven months later, the district court clarified the Judgment and Sentence by ordering the sentence to run consecutively to the others. In the meantime, the district court of Natrona County ordered its sentence to run concurrently with the other sentences. When the district court of Platte County entered its order, Segnitz had not yet been prosecuted in Natrona County nor had his parole been revoked. If a defendant is subject to prosecution in more than one court, the decision regarding how the sentences will run with respect to one another should be made by the last judge to impose a sentence. 24 C.J.S. Criminal Law § 1524 (1989). The underlying rationale for this theory is that a judge cannot require a sentence to be served consecutively to a sentence that has not yet been imposed. Id. We agree with the state that this is the best practice and conclude that the district court of Platte County abused its discretion when it ordered its sentence to run consecutively to the others. The district court of Natrona County was the last court to impose a sentence, and it ordered its sentence to run concurrently with the others. That portion of the order for the Platte County offense which directed the sentence to run consecutively to the others is illegal and is hereby stricken. Affirmed in part and reversed in part.
[ 198, 22, 350, 13, 18, 67, 5125, 357, 11024, 8, 198, 7371, 406, 13, 311, 7156, 45, 2043, 57, 11, 2034, 695, 415, 357, 7469, 23048, 828, 198, 85, 13, 198, 464, 35454, 286, 24533, 11, 2034, 417, 7197, 357, 3646, 2913, 733, 737, 198, 7371, 406, 13, 1001, 4593, 4224, 11, 2034, 695, 415, 357, 7469, 23048, 828, 198, 85, 13, 198, 464, 1812, 286, 24533, 11, 2034, 417, 7197, 357, 3646, 2913, 733, 737, 198, 45, 418, 13, 7388, 12, 22047, 11, 7388, 12, 24970, 13, 198, 40784, 2182, 3078, 286, 24533, 13, 198, 15749, 362, 11, 4751, 13, 198, 9, 1120, 10858, 278, 2034, 695, 415, 25, 3759, 406, 13, 1001, 4593, 4224, 11, 1041, 1001, 13, 198, 40171, 278, 2034, 417, 7197, 25, 16013, 5326, 4803, 11, 8123, 3611, 26, 3362, 311, 13, 797, 71, 495, 74, 11, 15110, 8123, 3611, 26, 290, 360, 13, 3899, 3362, 278, 11, 14017, 15286, 8123, 3611, 13, 198, 8421, 12509, 39, 10725, 11, 327, 13, 41, 1539, 290, 2320, 2662, 1921, 11, 20582, 56, 11, 44428, 1677, 11, 290, 367, 8267, 11, 38775, 13, 198, 44, 43300, 11, 4796, 13, 198, 4677, 695, 415, 3759, 406, 13, 1001, 4593, 4224, 15192, 422, 262, 2853, 8231, 286, 734, 25530, 339, 5717, 287, 734, 4553, 8028, 284, 3376, 465, 5293, 13439, 13, 383, 2663, 547, 27890, 329, 4959, 286, 5198, 13, 198, 1135, 16266, 287, 636, 290, 9575, 287, 636, 13, 198, 198, 1797, 12564, 1546, 198, 818, 8913, 1400, 13, 7388, 12, 22047, 11, 1001, 4593, 4224, 10969, 262, 1708, 2428, 329, 674, 2423, 25, 198, 16, 13, 7731, 262, 5665, 3078, 685, 8056, 60, 416, 17086, 2034, 695, 415, 338, 20843, 284, 22941, 281, 42272, 11352, 594, 11, 543, 373, 5717, 780, 981, 47311, 11897, 284, 24580, 13439, 11, 262, 22503, 4794, 16025, 290, 11352, 594, 11, 290, 11707, 20704, 4054, 284, 22111, 5039, 326, 6827, 373, 24580, 58, 26398, 198, 17, 13, 7731, 262, 5665, 3078, 685, 8056, 60, 416, 17086, 2034, 695, 415, 338, 20843, 284, 22941, 2644, 281, 14639, 2538, 38, 1847, 11352, 594, 11, 543, 373, 5717, 780, 262, 3078, 750, 407, 5764, 3884, 329, 640, 4983, 287, 340, 21737, 82, 4794, 16025, 290, 11352, 594, 11, 4249, 11707, 20704, 58, 26398, 5414, 550, 340, 587, 1635, 4349, 9469, 47311, 416, 262, 3078, 379, 20565, 13, 198, 818, 8913, 1400, 13, 7388, 12, 24970, 11, 1001, 4593, 4224, 10969, 262, 1708, 2428, 329, 674, 2423, 25, 198, 32, 13, 7731, 262, 5665, 3078, 6827, 262, 2034, 695, 415, 284, 281, 5293, 3381, 416, 407, 48637, 416, 370, 13, 49, 13, 13916, 13, 47, 13, 3933, 7, 66, 8, 17, 7, 34, 828, 357, 36, 828, 290, 357, 37, 19427, 198, 33, 13, 7731, 262, 5665, 3078, 416, 17086, 262, 20843, 284, 22941, 281, 42272, 11352, 594, 290, 788, 5609, 262, 2656, 6827, 5076, 340, 21737, 82, 288, 58, 72, 60, 1416, 12307, 30, 198, 34, 13, 1002, 262, 1487, 287, 6827, 373, 1774, 788, 815, 262, 2034, 695, 415, 685, 1350, 60, 28109, 2233, 1429, 416, 262, 5665, 3078, 30, 198, 198, 37, 2246, 4694, 198, 818, 3389, 286, 8309, 11, 1001, 4593, 4224, 373, 11897, 287, 15335, 7050, 3418, 284, 4691, 257, 3381, 287, 262, 24533, 1812, 7507, 48324, 8042, 286, 407, 1342, 621, 530, 614, 4249, 517, 621, 1115, 812, 11, 351, 3884, 329, 262, 640, 339, 4983, 287, 1944, 594, 28739, 11, 329, 262, 6907, 286, 14544, 300, 5605, 28558, 13, 679, 373, 2716, 319, 25450, 284, 8108, 13243, 2929, 286, 11294, 525, 319, 2795, 1679, 11, 7795, 13, 1550, 2901, 1542, 11, 7795, 11, 1001, 4593, 4224, 24057, 422, 8108, 13243, 2929, 286, 11294, 525, 1231, 19601, 11, 16568, 257, 1097, 284, 15570, 465, 8420, 13, 679, 10357, 284, 34744, 1044, 810, 339, 9958, 428, 1097, 290, 18240, 1194, 11, 543, 339, 10357, 284, 10278, 13, 198, 10265, 262, 32715, 660, 3418, 290, 14393, 1313, 64, 3418, 4773, 4884, 3251, 23070, 329, 262, 6741, 5364, 287, 511, 11756, 14683, 13, 383, 5926, 286, 2547, 2305, 4884, 281, 1502, 286, 3251, 780, 1001, 4593, 4224, 550, 13998, 262, 2846, 286, 465, 25450, 329, 262, 15335, 7050, 3418, 14544, 300, 5605, 28558, 11375, 13, 1001, 4593, 4224, 373, 5169, 287, 10278, 319, 2932, 352, 11, 7795, 11, 290, 1568, 5047, 351, 14544, 300, 5605, 28558, 287, 1111, 32715, 660, 3418, 290, 14393, 1313, 64, 3418, 13, 679, 16407, 6717, 284, 262, 4530, 13, 1001, 4593, 4224, 373, 11897, 319, 2693, 838, 11, 7795, 11, 287, 32715, 660, 3418, 284, 257, 3381, 286, 407, 1342, 621, 734, 812, 4249, 517, 621, 1440, 812, 287, 262, 24533, 1812, 7507, 48324, 8042, 13, 383, 1502, 373, 10574, 351, 2754, 284, 1771, 262, 6827, 373, 284, 307, 4983, 47480, 351, 393, 12358, 2280, 284, 597, 584, 13439, 13, 1550, 2805, 642, 11, 7358, 11, 1001, 4593, 4224, 373, 47311, 11897, 287, 14393, 1313, 64, 3418, 284, 262, 22111, 4817, 3770, 3381, 286, 1115, 284, 1440, 812, 13, 383, 22111, 1741, 2810, 329, 262, 6827, 284, 307, 4983, 47480, 351, 262, 13439, 10893, 287, 15335, 7050, 3418, 290, 32715, 660, 3418, 13, 383, 3194, 36969, 290, 11352, 594, 4054, 284, 3068, 326, 262, 6827, 373, 284, 307, 4983, 47480, 351, 262, 584, 13439, 11, 475, 11, 1115, 1933, 1568, 11, 262, 4783, 2184, 5982, 281, 1502, 299, 19524, 386, 6278, 66, 284, 326, 1245, 13, 198, 41030, 77, 4224, 5284, 379, 262, 24533, 1812, 7507, 48324, 8042, 319, 393, 8972, 706, 2805, 642, 11, 7358, 11, 262, 3128, 339, 373, 11897, 287, 14393, 1313, 64, 3418, 13, 1550, 3035, 1105, 11, 7358, 11, 262, 5926, 286, 2547, 2305, 30809, 465, 25450, 329, 262, 15335, 7050, 3418, 6907, 11, 2600, 1780, 683, 366, 4480, 477, 286, 262, 640, 1141, 543, 339, 373, 2716, 526, 198, 41030, 77, 4224, 5717, 25530, 287, 262, 4783, 8028, 286, 32715, 660, 3418, 290, 14393, 1313, 64, 3418, 284, 3376, 5293, 13439, 13, 554, 465, 32715, 660, 3418, 6268, 11, 1001, 4593, 4224, 21635, 326, 262, 36969, 290, 11352, 594, 4054, 284, 11986, 703, 262, 6827, 373, 284, 307, 4983, 351, 2754, 284, 465, 584, 13439, 13, 679 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Fish poisoning may be why Polynesians left paradise Washington, May 19 (ANI): Scientists have come up with a theory that attributes the historic migrations of the Polynesians from the Cook islands to New Zealand, Easter Island and Hawaii in the 11th to 15th centuries, to fish poisoning. The theory has been proposed by Teina Rongo, a Cook Island Maori from Rarotonga and a Ph.D. student at the Florida Institute of Technology, and his faculty advisers Professors Robert van Woesik and Mark Bush. Based on archeological evidence, paleoclimatic data and modern reports of ciguatera poisoning, they theorize that ciguatera outbreaks were linked to climate and that the consequent outbreaks prompted historical migrations of Polynesians. Ciguatera poisoning is a food-borne disease that can come from eating large, carnivorous reef fish, and causes vomiting, headaches, and a burning sensation upon contact with cold surfaces. It is known that the historic populations of Cook Islanders was heavily reliant on fish as a source of protein, and the scientists suggest that once their fish resources became inedible, voyaging became a necessity. Modern Cook Islanders, though surrounded by an ocean teeming with fish, don’t eat fish as a regular part of their diet but instead eat processed, imported foods. In the late 1990s, lower-income families who could not afford processed foods emigrated to New Zealand and Australia. The researchers suggest that past migrations had similar roots. The heightened voyaging from A.D. 1000 to 1450 in eastern Polynesia was likely prompted by ciguatera fish poisoning. There were few options but to leave once the staple diet of an island nation became poisonous. According to van Woesik, “Our approach brings us a step closer to solving the mysteries of ciguatera and the storied Polynesian native migrations. We hope it will lead to better forecasting and planning for ciguatera outbreaks.” (ANI)
[ 39428, 22475, 743, 307, 1521, 12280, 2516, 1547, 1364, 31354, 198, 198, 17402, 11, 1737, 678, 357, 43664, 2599, 23782, 423, 1282, 510, 351, 257, 4583, 326, 12608, 262, 9566, 15720, 602, 286, 262, 12280, 2516, 1547, 422, 262, 8261, 14807, 284, 968, 8936, 11, 20111, 5451, 290, 13708, 287, 262, 1367, 400, 284, 1315, 400, 10675, 11, 284, 5916, 22475, 13, 198, 198, 464, 4583, 468, 587, 5150, 416, 1665, 1437, 371, 25162, 11, 257, 8261, 5451, 6669, 10145, 422, 371, 283, 313, 44294, 290, 257, 1380, 13, 35, 13, 3710, 379, 262, 4744, 5136, 286, 8987, 11, 290, 465, 12829, 20409, 4415, 23295, 5199, 5719, 370, 3028, 1134, 290, 2940, 5511, 13, 198, 198, 15001, 319, 20944, 2770, 2370, 11, 14005, 420, 2475, 1512, 1366, 290, 3660, 3136, 286, 8594, 84, 729, 64, 22475, 11, 484, 18765, 1096, 326, 8594, 84, 729, 64, 35198, 547, 6692, 284, 4258, 290, 326, 262, 4937, 298, 35198, 12053, 6754, 15720, 602, 286, 12280, 2516, 1547, 13, 198, 198, 34, 328, 84, 729, 64, 22475, 318, 257, 2057, 12, 13555, 4369, 326, 460, 1282, 422, 6600, 1588, 11, 41919, 9610, 25088, 5916, 11, 290, 5640, 30874, 11, 29432, 11, 290, 257, 9482, 18098, 2402, 2800, 351, 4692, 16649, 13, 198, 198, 1026, 318, 1900, 326, 262, 9566, 9684, 286, 8261, 32868, 373, 7272, 39150, 319, 5916, 355, 257, 2723, 286, 7532, 11, 290, 262, 5519, 1950, 326, 1752, 511, 5916, 4133, 2627, 287, 276, 856, 11, 23291, 3039, 2627, 257, 14564, 13, 198, 198, 31439, 8261, 32868, 11, 996, 11191, 416, 281, 9151, 573, 46564, 351, 5916, 11, 836, 447, 247, 83, 4483, 5916, 355, 257, 3218, 636, 286, 511, 5496, 475, 2427, 4483, 13686, 11, 17392, 9013, 13, 198, 198, 818, 262, 2739, 6303, 82, 11, 2793, 12, 12519, 4172, 508, 714, 407, 5368, 13686, 9013, 795, 38769, 284, 968, 8936, 290, 4505, 13, 198, 198, 464, 4837, 1950, 326, 1613, 15720, 602, 550, 2092, 11135, 13, 198, 198, 464, 25556, 23291, 3039, 422, 317, 13, 35, 13, 8576, 284, 1478, 1120, 287, 10183, 12280, 31401, 373, 1884, 12053, 416, 8594, 84, 729, 64, 5916, 22475, 13, 198, 198, 1858, 547, 1178, 3689, 475, 284, 2666, 1752, 262, 25629, 5496, 286, 281, 7022, 3277, 2627, 32199, 13, 198, 198, 4821, 284, 5719, 370, 3028, 1134, 11, 564, 250, 5122, 3164, 6774, 514, 257, 2239, 5699, 284, 18120, 262, 26045, 286, 8594, 84, 729, 64, 290, 262, 336, 42058, 12280, 2516, 666, 6868, 15720, 602, 13, 775, 2911, 340, 481, 1085, 284, 1365, 41164, 290, 5410, 329, 8594, 84, 729, 64, 35198, 13, 447, 251, 357, 43664, 8 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Size: - 0.1 - 0.1 - 0.1 Color: - 0.66 - 0.70220774 - 0.94 - 1 Body: Animated Pose: - - -0.41426134 - 0.9058533 - -8.841649e-2 - 1.6415431 - - 0.6057532 - 0.34691048 - 0.71604204 - 4.429285 - - 0.6793016 - 0.24306992 - -0.69243515 - 8.778018 - - 0.0 - 0.0 - 0.0 - 1 Shape: Cube
[ 10699, 25, 201, 198, 12, 657, 13, 16, 201, 198, 12, 657, 13, 16, 201, 198, 12, 657, 13, 16, 201, 198, 10258, 25, 201, 198, 12, 657, 13, 2791, 201, 198, 12, 657, 13, 2154, 17572, 47582, 201, 198, 12, 657, 13, 5824, 201, 198, 12, 352, 201, 198, 25842, 25, 36492, 201, 198, 47, 577, 25, 201, 198, 12, 532, 532, 15, 13, 37309, 2075, 19880, 201, 198, 220, 532, 657, 13, 44928, 5332, 2091, 201, 198, 220, 532, 532, 23, 13, 5705, 1433, 2920, 68, 12, 17, 201, 198, 220, 532, 352, 13, 2414, 21526, 3132, 201, 198, 12, 532, 657, 13, 32417, 2425, 2624, 201, 198, 220, 532, 657, 13, 2682, 3388, 940, 2780, 201, 198, 220, 532, 657, 13, 22, 1433, 3023, 18638, 201, 198, 220, 532, 604, 13, 11785, 26279, 201, 198, 12, 532, 657, 13, 3134, 6052, 27037, 201, 198, 220, 532, 657, 13, 1731, 20548, 41561, 201, 198, 220, 532, 532, 15, 13, 3388, 1731, 2327, 1314, 201, 198, 220, 532, 807, 13, 39761, 29159, 201, 198, 12, 532, 657, 13, 15, 201, 198, 220, 532, 657, 13, 15, 201, 198, 220, 532, 657, 13, 15, 201, 198, 220, 532, 352, 201, 198, 33383, 25, 23315, 201, 198 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
P21S Carnauba Paste Wax is a non-chalky wax, leaving no powder residue or ugly white stains on rubber or plastic. This unique carnauba-beeswax blend goes on and comes off with incredible ease and delivers a great long lasting shine. You will enhance ... Product Description LG 5231EL1003B Dryer Lint Filter Assembly with Felt Rim Seal. This part number replaces part number 5231EL1003E. For use with the following LG Electronics models: 5231EL1003B, DLE2512W, DLE2514W, DLE2515S, DLE2516W, DLE3733S, DLE3... Permatex Dielectric Tune-Up Grease protects electrical connections and wiring from salt, dirt and corrosion. Required for modern high energy ignition systems, dialectric grease extends the life of bulb sockets and prevents voltage leaks around any el... Both Male and Female buckles are Dual Adjust.Made for thin 1" (25mm) backpack style webbing. SIZING TIP: The size of buckles is measured by the webbing that goes in them, not the O.D. of the buckle. WARNING: This is NOT one size/style fits all. This ... Both Male and Female buckles are Dual Adjust.Made for thin 1" (25mm) backpack style webbing. SIZING TIP: The size of buckles is measured by the webbing that goes in them, not the O.D. of the buckle. WARNING: This is NOT one size/style fits all. This ... Both Male and Female buckles are Dual Adjust.Made for thin 1" (25mm) backpack style webbing. SIZING TIP: The size of buckles is measured by the webbing that goes in them, not the O.D. of the buckle. WARNING: This is NOT one size/style fits all. This ... Both Male and Female buckles are Dual Adjust.Made for thin 1" (25mm) backpack style webbing. SIZING TIP: The size of buckles is measured by the webbing that goes in them, not the O.D. of the buckle. WARNING: This is NOT one size/style fits all. This ... Both Male and Female buckles are Dual Adjust.Made for thin 1" (25mm) backpack style webbing. SIZING TIP: The size of buckles is measured by the webbing that goes in them, not the O.D. of the buckle. WARNING: This is NOT one size/style fits all. This ...
[ 47, 2481, 50, 19659, 64, 22013, 23517, 42656, 318, 257, 1729, 12, 354, 18354, 20302, 11, 4305, 645, 11913, 35186, 393, 13400, 2330, 43329, 319, 14239, 393, 7309, 13, 770, 3748, 1097, 2616, 22013, 12, 41712, 86, 897, 13516, 2925, 319, 290, 2058, 572, 351, 8082, 10152, 290, 16316, 257, 1049, 890, 15727, 18340, 13, 921, 481, 9494, 2644, 198, 198, 15667, 12489, 17370, 642, 25667, 3698, 3064, 18, 33, 22408, 263, 406, 600, 25853, 10006, 351, 376, 2120, 29542, 26975, 13, 770, 636, 1271, 24020, 636, 1271, 642, 25667, 3698, 3064, 18, 36, 13, 1114, 779, 351, 262, 1708, 17370, 27828, 4981, 25, 642, 25667, 3698, 3064, 18, 33, 11, 360, 2538, 1495, 1065, 54, 11, 360, 2538, 1495, 1415, 54, 11, 360, 2538, 1495, 1314, 50, 11, 360, 2538, 1495, 1433, 54, 11, 360, 2538, 2718, 2091, 50, 11, 360, 2538, 18, 986, 198, 198, 5990, 9830, 87, 6733, 801, 1173, 42587, 12, 4933, 11955, 589, 17289, 12278, 8787, 290, 29477, 422, 8268, 11, 13647, 290, 41677, 13, 20906, 329, 3660, 1029, 2568, 37594, 3341, 11, 23637, 1173, 35537, 14582, 262, 1204, 286, 28287, 37037, 290, 15174, 15004, 17316, 1088, 597, 1288, 986, 198, 198, 10265, 12674, 290, 15396, 10230, 829, 389, 20446, 20292, 13, 24616, 329, 7888, 352, 1, 357, 1495, 3020, 8, 22526, 3918, 3992, 4623, 13, 311, 14887, 2751, 309, 4061, 25, 383, 2546, 286, 10230, 829, 318, 8630, 416, 262, 3992, 4623, 326, 2925, 287, 606, 11, 407, 262, 440, 13, 35, 13, 286, 262, 44983, 13, 39410, 25, 770, 318, 5626, 530, 2546, 14, 7635, 11414, 477, 13, 770, 2644, 198, 198, 10265, 12674, 290, 15396, 10230, 829, 389, 20446, 20292, 13, 24616, 329, 7888, 352, 1, 357, 1495, 3020, 8, 22526, 3918, 3992, 4623, 13, 311, 14887, 2751, 309, 4061, 25, 383, 2546, 286, 10230, 829, 318, 8630, 416, 262, 3992, 4623, 326, 2925, 287, 606, 11, 407, 262, 440, 13, 35, 13, 286, 262, 44983, 13, 39410, 25, 770, 318, 5626, 530, 2546, 14, 7635, 11414, 477, 13, 770, 2644, 198, 198, 10265, 12674, 290, 15396, 10230, 829, 389, 20446, 20292, 13, 24616, 329, 7888, 352, 1, 357, 1495, 3020, 8, 22526, 3918, 3992, 4623, 13, 311, 14887, 2751, 309, 4061, 25, 383, 2546, 286, 10230, 829, 318, 8630, 416, 262, 3992, 4623, 326, 2925, 287, 606, 11, 407, 262, 440, 13, 35, 13, 286, 262, 44983, 13, 39410, 25, 770, 318, 5626, 530, 2546, 14, 7635, 11414, 477, 13, 770, 2644, 198, 198, 10265, 12674, 290, 15396, 10230, 829, 389, 20446, 20292, 13, 24616, 329, 7888, 352, 1, 357, 1495, 3020, 8, 22526, 3918, 3992, 4623, 13, 311, 14887, 2751, 309, 4061, 25, 383, 2546, 286, 10230, 829, 318, 8630, 416, 262, 3992, 4623, 326, 2925, 287, 606, 11, 407, 262, 440, 13, 35, 13, 286, 262, 44983, 13, 39410, 25, 770, 318, 5626, 530, 2546, 14, 7635, 11414, 477, 13, 770, 2644, 198, 198, 10265, 12674, 290, 15396, 10230, 829, 389, 20446, 20292, 13, 24616, 329, 7888, 352, 1, 357, 1495, 3020, 8, 22526, 3918, 3992, 4623, 13, 311, 14887, 2751, 309, 4061, 25, 383, 2546, 286, 10230, 829, 318, 8630, 416, 262, 3992, 4623, 326, 2925, 287, 606, 11, 407, 262, 440, 13, 35, 13, 286, 262, 44983, 13, 39410, 25, 770, 318, 5626, 530, 2546, 14, 7635, 11414, 477, 13, 770, 2644 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
The United States and Japan will step up their defence cooperation to deal with the threat from nuclear-armed North Korea as tensions in East Asia remain high, officials from the two allies said on Thursday. Mr Wright started a relationship with Elizabeth after divorcing three earlier wives. Olivia is the youngest of Mr Wright's four children but she had a difficult relationship with her father, who was frequently absent and gave little support for her single mother before his death in 2012. She had not met older siblings Leonie Baldock, Alexandra Burt and Myles Wright prior to his death. Olivia challenged her father's will because her $3 million trust fund had onerous conditions and could not be accessed until she was the age of 30. Related Articles She sought an immediate $12 million share of her father's estate, estimated at more than $1 billion, but in February the WA Supreme Court instead awarded her $25 million, the largest such payout in Australian legal history. Olivia told the Seven Network's Sunday Night program there had been many personal hurdles during her long legal battle. While she is ready to contest the appeal, she said she's unsure if she would go through the initial legal battle again.
[ 464, 1578, 1829, 290, 2869, 481, 2239, 510, 511, 9366, 11113, 284, 1730, 351, 262, 2372, 422, 4523, 12, 12026, 2258, 4969, 355, 15733, 287, 3687, 7229, 3520, 1029, 11, 2828, 422, 262, 734, 7681, 531, 319, 3635, 13, 198, 198, 5246, 12206, 2067, 257, 2776, 351, 10674, 706, 21781, 2259, 1115, 2961, 17743, 13, 198, 198, 46, 16017, 544, 318, 262, 18887, 286, 1770, 12206, 338, 1440, 1751, 475, 673, 550, 257, 2408, 2776, 351, 607, 2988, 11, 508, 373, 6777, 13717, 290, 2921, 1310, 1104, 329, 607, 2060, 2802, 878, 465, 1918, 287, 2321, 13, 198, 198, 3347, 550, 407, 1138, 4697, 20569, 10592, 494, 17048, 735, 11, 44075, 347, 3325, 290, 2011, 829, 12206, 3161, 284, 465, 1918, 13, 198, 198, 46, 16017, 544, 12827, 607, 2988, 338, 481, 780, 607, 720, 18, 1510, 3774, 1814, 550, 319, 48411, 3403, 290, 714, 407, 307, 17535, 1566, 673, 373, 262, 2479, 286, 1542, 13, 198, 198, 9819, 22698, 198, 198, 3347, 7194, 281, 7103, 720, 1065, 1510, 2648, 286, 607, 2988, 338, 7964, 11, 6108, 379, 517, 621, 720, 16, 2997, 11, 475, 287, 3945, 262, 16400, 5617, 3078, 2427, 11343, 607, 720, 1495, 1510, 11, 262, 4387, 884, 40055, 287, 6638, 2742, 2106, 13, 198, 198, 46, 16017, 544, 1297, 262, 13723, 7311, 338, 3502, 5265, 1430, 612, 550, 587, 867, 2614, 34283, 1141, 607, 890, 2742, 3344, 13, 198, 198, 3633, 673, 318, 3492, 284, 8414, 262, 5198, 11, 673, 531, 673, 338, 22147, 611, 673, 561, 467, 832, 262, 4238, 2742, 3344, 757, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
RALEIGH Complete with everything from excellent school systems and a thriving local economy to miles of parkland and bountiful culinary & cultural attractions, the greater Raleigh metropolitan area truly has it all. See for yourself why so many families and businesses chose to move here, grow here, and stay here.
[ 49, 21358, 18060, 198, 198, 20988, 351, 2279, 422, 6275, 1524, 3341, 290, 257, 27723, 1957, 3773, 284, 4608, 286, 3952, 1044, 290, 49937, 4135, 35956, 1222, 6467, 29156, 11, 262, 3744, 34520, 27953, 1989, 4988, 468, 340, 477, 13, 4091, 329, 3511, 1521, 523, 867, 4172, 290, 5692, 7690, 284, 1445, 994, 11, 1663, 994, 11, 290, 2652, 994, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
A Delicious Way to Support the Princeton Schools This Weekend at Eno Terra Noriko and Erik Svenson and their children with Eno Terra server Giovanni Maselli last weekend.. Eno Terra is donating four days of lunch proceeds to the PowerUp! PRS Technology Campaign to benefit the Princeton Regional Schools. This Saturday and Sunday if you eat lunch at Eno Terra, you will be supporting fundraising efforts to improve technology in the public schools. The Terra Momo Restaurant Group, owner of Eno Terra, is donating the net proceeds from lunch sale both last weekend and this weekend to the Princeton Education Foundation. Since 1995, the Princeton Education Foundation has encouraged private philanthropy to enhance public education. Since its inception, PEF has contributed over $1 million to the Princeton Public Schools for capital improvements, educational programs and teacher support. “The donated funds from Eno Terra will go directly to PowerUp! PRS, our campaign to provide much needed technology upgrades to every school in the district,” said PEF Executive Director Adrienne Rubin. “We are very grateful to Eno Terra for this promotion as well as for their ongoing support of our schools.” Eno Terra, located on Route 27 in Kingston, recently opened for lunch on the weekends. You can make a reservation for lunch for this Saturday, March 24, or this Sunday, March 25 by calling (609) 497-1777. Raoul Momo, co-owner Terra Momo Restaurant Group, said that it is crucial that schools find new ways of raising money to ensure a high standard of education for all students in Princeton. “With all the challenges at the state level with school finances, it is important to look to develop local partnerships with businesses like Eno Terra,” he said. “In the end, our children are our most important investment.”
[ 32, 39528, 6378, 284, 7929, 262, 23173, 20357, 770, 30537, 379, 2039, 78, 24118, 198, 198, 21991, 12125, 290, 22722, 44611, 1559, 290, 511, 1751, 351, 2039, 78, 24118, 4382, 50191, 337, 589, 15516, 938, 5041, 492, 198, 198, 36, 3919, 24118, 318, 29798, 1440, 1528, 286, 9965, 15740, 284, 262, 4333, 4933, 0, 4810, 50, 8987, 13718, 284, 4414, 262, 23173, 15994, 20357, 13, 198, 198, 1212, 3909, 290, 3502, 611, 345, 4483, 9965, 379, 2039, 78, 24118, 11, 345, 481, 307, 6493, 18066, 4040, 284, 2987, 3037, 287, 262, 1171, 4266, 13, 198, 198, 464, 24118, 11254, 78, 26078, 4912, 11, 4870, 286, 2039, 78, 24118, 11, 318, 29798, 262, 2010, 15740, 422, 9965, 5466, 1111, 938, 5041, 290, 428, 5041, 284, 262, 23173, 7868, 5693, 13, 198, 198, 6385, 8735, 11, 262, 23173, 7868, 5693, 468, 10085, 2839, 28150, 88, 284, 9494, 1171, 3707, 13, 4619, 663, 30839, 11, 18468, 37, 468, 8639, 625, 720, 16, 1510, 284, 262, 23173, 5094, 20357, 329, 3139, 8561, 11, 9856, 4056, 290, 4701, 1104, 13, 198, 198, 447, 250, 464, 15863, 5153, 422, 2039, 78, 24118, 481, 467, 3264, 284, 4333, 4933, 0, 4810, 50, 11, 674, 1923, 284, 2148, 881, 2622, 3037, 16608, 284, 790, 1524, 287, 262, 4783, 11, 447, 251, 531, 18468, 37, 10390, 5890, 1215, 15355, 710, 34599, 13, 564, 250, 1135, 389, 845, 14066, 284, 2039, 78, 24118, 329, 428, 12148, 355, 880, 355, 329, 511, 7044, 1104, 286, 674, 4266, 13, 447, 251, 198, 198, 36, 3919, 24118, 11, 5140, 319, 18956, 2681, 287, 34612, 11, 2904, 4721, 329, 9965, 319, 262, 21511, 13, 921, 460, 787, 257, 24048, 329, 9965, 329, 428, 3909, 11, 2805, 1987, 11, 393, 428, 3502, 11, 2805, 1679, 416, 4585, 357, 31751, 8, 5125, 22, 12, 1558, 3324, 13, 198, 198, 21762, 2852, 11254, 78, 11, 763, 12, 18403, 24118, 11254, 78, 26078, 4912, 11, 531, 326, 340, 318, 8780, 326, 4266, 1064, 649, 2842, 286, 8620, 1637, 284, 4155, 257, 1029, 3210, 286, 3707, 329, 477, 2444, 287, 23173, 13, 198, 198, 447, 250, 3152, 477, 262, 6459, 379, 262, 1181, 1241, 351, 1524, 20903, 11, 340, 318, 1593, 284, 804, 284, 1205, 1957, 22867, 351, 5692, 588, 2039, 78, 24118, 11, 447, 251, 339, 531, 13, 564, 250, 818, 262, 886, 11, 674, 1751, 389, 674, 749, 1593, 4896, 13, 447, 251 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Formula 1 2012 Free Download Full Version PC Game setup in single direct link for Windows It is an awesome Racing game Formula 1 2007? F1 2016 includes the expansion of the Safety Car and also the Virtual Safety Car for very first time, yet in addition, extraordinarily offers the drama and vehicle improvement that goes ahead off camera. Download 2go version 3 for java phone 7 0 2 F1 2019. Grand Prix Circuits Formula 1 Grand Prix racing game The simulation of Grand Prix F1 races Formula 1 games are still a powerhouse in modern gaming they. List of top downloads. This offers gamers the threat to dive into the sport and play alongside the free F1 2019 Championship Above all F1 2018 changed into a massive breakthrough for Codemasters receiving glowing reviews from across the industry Similarly Codemasters have delivered the F2. Discussions Rules and Guidelines. Ops: The Mindgate Conspiracy. F1 2017 Free Download (v1 7) IGGGAMES. You can also Download: F1 2017F1 2016 DownloadF1 2016 features the full official season of Formal one 2016 season. Ferrari Formula 1 is an old DOS racing simulation game developed by Electronic Arts in 1989 from an original idea by Rick Koenig? F1 2016 v1 0 1 Apk Data Android Formula One Games Apkfine. Download Official F1 Manager Game For iPhone iPad And Android! Well here is your chance We need enthusiastics for the upcoming F1 2011 Race Track release The feeling of the game will be alike the Beta (demo download). F1 2018 Download Game PC Iso New Free. GB at my PC. Does it include DLC? It was the creme of the crop then. Full Version PC Games Free Download F1 2002 Download Free PC Game. F1 2019 General Discussions. Make sure you read the above link before downloading! F1 2018 Download GamesofPC com. They however created many successful titles and series mainly from racing category like Test Drive or Grand Prix series. You'll notice that instead of a single year the game sports a series of four years after the name. Grand Prix Racing Free Download. Download free Android game F1 mobile racing apk Find the best games for any Android tablet and phone F1 mobile racing and many others games at MOB org. Download the Game from any of the link provided below. Download vqs 2 0 free F1 2018 Mac Download Free Game For Mac tappdf? F1 2018 free and safe download F1 2018 latest version A Racing Game that Builds Up on Its Highly Acclaimed Past F1 2018 is a racing game that would. Our web site is using cookies. Formula 1 is no exception Get ready to jump behind the wheel of a high speed Formula 1 racer Psygnosis packs in all of the excitement of real Formula 1 racing A game by Psygnosis. Im playing Grand Prix 2012 these days but this one still has touches of class. F1 2018 FREE Download PC Game Download F1 2018 For Free on PC Simple and Easy F1 2018 is the latest installment in the F1 series. Formula 1 ROM Download for Sega Game Gear CoolROM com? F1 Challenge 99 02 PC Review and Full Download Old PC Gaming? Formula 1 Old DOS Games Download for Free or play on Windows. Click the download torrent button below to start your F1 2018 Free Download It is the full version of the game Don't forget to run the game as administrator. Grand Prix Circuits Old DOS Games Download for Free or play on! Download for Free or play on Windows online. F1 2016 free and safe download this is a high point in Formula 1 racing games accessible for new players but with plenty of depth Downloadfor Windows. F1 Manager Apps on Google Play! Download Will Start Automatically. If the files are compressed when downloaded, when are they decompressed? F1 Race Stars free and safe download F1 Race Stars latest version Can F1 work as a karting game! Some geospatial data on this website is provided by geonames. More than 14600 old games to download for free! Can I run F1 2018 Minimum System Requirements Download Size. Formula 1 racing game online free F1 for PC to play no download. There are a variety of tracks to choose from named after different places which include Brazil, Britain, Germany, Italy, Japan, Monaco, and Detroit. Download F1 2016 Game Free for PC DLC Multiplayer Rihno. F1 2018 PC Game Download Complete Setup The Games Tec. Want to install F1 2019 on your PC Click here to learn all about the game download F1 2019 100 Free Full game from official certified. HP Probook Elitebook BIOS Password Reset Util Take your place in the world's biggest motorsport with F1 Mobile Racing an official mobile game of the FIA FORMULA ONE WORLD CHAMPIONSHIP Videos8 09How To CRACK F1 2018 FULL GAME CODEX PC Download Install MolniiYouTube Apr 20 201911 43F1 2015 Download and Install Pc (Free Game Sessions GIVEAWAY)Games SolutionsYouTube Nov 30 2018. FORMULA WORLD GRAND PRIXFORMULAWORLDGRANDPRIX. Formula One: Born To Win is a career racing game. What is the Download Size of this Game? F1 2017 PC game Free Download Torrent SaltyTelevision. Download F1 2018 CODEX free download game new game. Free Download F1 2017 Free Download F1 2017 Update V1. Multiplayer racing, as well as several new game features which will be revealed in the coming months. Download x64a.rpf gta v bundle version Awesome game, I started playing it when I was about 9 years old, I did a Monaco lap in 58 seconds once. Developed and published by Codemasters. Download F1 Mobile Racing APK v1 10 4 (Update Latest Verison)! Where can I download the full version of the Formula 1 game for. Download F1 2018 full version from google drive for pc free DLCs included F1 2018 game download full is the latest formula one racing game with crack. F1 2019 Download free full game for pc Install Game. Group for every Game. As an officially licensed and endorsed product, you get the full spectrum of courses, teams, and drivers you'd expect from watching Formula One on TV or following it in the trade press.
[ 8479, 4712, 352, 2321, 3232, 10472, 6462, 10628, 4217, 3776, 9058, 287, 2060, 1277, 2792, 329, 3964, 632, 318, 281, 7427, 14954, 983, 19639, 352, 4343, 30, 198, 198, 37, 16, 1584, 3407, 262, 7118, 286, 262, 11233, 1879, 290, 635, 262, 15595, 11233, 1879, 329, 845, 717, 640, 11, 1865, 287, 3090, 11, 31999, 4394, 262, 10512, 290, 4038, 9025, 326, 2925, 4058, 572, 4676, 13, 198, 198, 10002, 362, 2188, 2196, 513, 329, 20129, 3072, 767, 657, 362, 198, 198, 37, 16, 13130, 13, 198, 198, 23581, 23832, 7672, 15379, 19639, 352, 5675, 23832, 11717, 983, 383, 18640, 286, 5675, 23832, 376, 16, 9558, 19639, 352, 1830, 389, 991, 257, 34886, 287, 3660, 7776, 484, 13, 198, 198, 8053, 286, 1353, 21333, 13, 198, 198, 1212, 4394, 15072, 262, 2372, 284, 15647, 656, 262, 6332, 290, 711, 7848, 262, 1479, 376, 16, 13130, 10749, 23302, 477, 376, 16, 2864, 3421, 656, 257, 4858, 19304, 329, 18720, 368, 7060, 6464, 21377, 8088, 422, 1973, 262, 2831, 15298, 18720, 368, 7060, 423, 6793, 262, 376, 17, 13, 198, 198, 15642, 21585, 14252, 290, 31072, 13, 198, 198, 41472, 25, 383, 10175, 10494, 38786, 13, 198, 198, 37, 16, 2177, 3232, 10472, 357, 85, 16, 767, 8, 314, 11190, 38, 29559, 13, 198, 198, 1639, 460, 635, 10472, 25, 376, 16, 2177, 37, 16, 1584, 10472, 37, 16, 1584, 3033, 262, 1336, 1743, 1622, 286, 5178, 282, 530, 1584, 1622, 13, 198, 198, 37, 8056, 2743, 19639, 352, 318, 281, 1468, 43036, 11717, 18640, 983, 4166, 416, 19508, 11536, 287, 11104, 422, 281, 2656, 2126, 416, 8759, 49178, 328, 30, 198, 198, 37, 16, 1584, 410, 16, 657, 352, 5949, 74, 6060, 5565, 19639, 1881, 5776, 5949, 74, 38125, 13, 198, 198, 10002, 15934, 376, 16, 9142, 3776, 1114, 7133, 13133, 843, 5565, 0, 198, 198, 5779, 994, 318, 534, 2863, 775, 761, 11273, 24232, 329, 262, 7865, 376, 16, 2813, 12588, 17762, 2650, 383, 4203, 286, 262, 983, 481, 307, 12936, 262, 17993, 357, 9536, 78, 4321, 737, 198, 198, 37, 16, 2864, 10472, 3776, 4217, 314, 568, 968, 3232, 13, 198, 198, 4579, 379, 616, 4217, 13, 198, 198, 13921, 340, 2291, 18068, 30, 198, 198, 1026, 373, 262, 1126, 1326, 286, 262, 13833, 788, 13, 198, 198, 13295, 10628, 4217, 5776, 3232, 10472, 376, 16, 6244, 10472, 3232, 4217, 3776, 13, 198, 198, 37, 16, 13130, 3611, 8444, 21585, 13, 198, 198, 12050, 1654, 345, 1100, 262, 2029, 2792, 878, 22023, 0, 198, 198, 37, 16, 2864, 10472, 5776, 1659, 5662, 401, 13, 198, 198, 2990, 2158, 2727, 867, 4388, 8714, 290, 2168, 8384, 422, 11717, 6536, 588, 6208, 9974, 393, 5675, 23832, 2168, 13, 198, 198, 1639, 1183, 4003, 326, 2427, 286, 257, 2060, 614, 262, 983, 5701, 257, 2168, 286, 1440, 812, 706, 262, 1438, 13, 198, 198, 23581, 23832, 14954, 3232, 10472, 13, 198, 198, 10002, 1479, 5565, 983, 376, 16, 5175, 11717, 2471, 74, 9938, 262, 1266, 1830, 329, 597, 5565, 14147, 290, 3072, 376, 16, 5175, 11717, 290, 867, 1854, 1830, 379, 337, 9864, 8745, 13, 198, 198, 10002, 262, 3776, 422, 597, 286, 262, 2792, 2810, 2174, 13, 198, 198, 10002, 410, 48382, 362, 657, 1479, 198, 198, 37, 16, 2864, 4100, 10472, 3232, 3776, 1114, 4100, 256, 1324, 7568, 30, 198, 198, 37, 16, 2864, 1479, 290, 3338, 4321, 376, 16, 2864, 3452, 2196, 317, 14954, 3776, 326, 10934, 82, 3205, 319, 6363, 38254, 6366, 20438, 276, 11303, 376, 16, 2864, 318, 257, 11717, 983, 326, 561, 13, 198, 198, 5122, 3992, 2524, 318, 1262, 14746, 13, 198, 198, 8479, 4712, 352, 318, 645, 6631, 3497, 3492, 284, 4391, 2157, 262, 7825, 286, 257, 1029, 2866, 19639, 352, 48233, 18773, 4593, 5958, 15186, 287, 477, 286, 262, 14067, 286, 1103, 19639, 352, 11717, 317, 983, 416, 18773, 4593, 5958, 13, 198, 198, 3546, 2712, 5675, 23832, 2321, 777, 1528, 475, 428, 530, 991, 468, 18105, 286, 1398, 13, 198, 198, 37, 16, 2864, 17189, 10472, 4217, 3776, 10472, 376, 16, 2864, 1114, 3232, 319, 4217, 17427, 290, 16789, 376, 16, 2864, 318, 262, 3452, 25168, 287, 262, 376, 16, 2168, 13, 198, 198, 8479, 4712, 352, 21224, 10472, 329, 29490, 3776, 10740, 15226, 33676, 401, 30, 198, 198, 37, 16, 13879, 7388, 7816, 4217, 6602, 290, 6462, 10472, 5706, 4217, 14426, 30, 198, 198, 8479, 4712, 352, 5706, 43036, 5776, 10472, 329, 3232, 393, 711, 319, 3964, 13, 198, 198, 8164, 262, 4321, 24458, 4936, 2174, 284, 923, 534, 376, 16, 2864, 3232, 10472, 632, 318, 262, 1336, 2196, 286, 262, 983, 2094, 470, 6044, 284, 1057, 262, 983, 355, 18382, 13, 198, 198, 23581, 23832, 7672, 15379, 5706, 43036, 5776, 10472, 329, 3232, 393, 711, 319, 0, 198, 198, 10002, 329, 3232, 393, 711, 319, 3964, 2691, 13, 198, 198, 37, 16, 1584, 1479, 290, 3338, 4321, 428, 318, 257, 1029, 966, 287, 19639, 352, 11717, 1830, 9857, 329, 649, 1938, 475, 351, 6088, 286, 6795, 10472, 1640, 3964, 13, 198, 198, 37, 16, 9142, 27710, 319, 3012, 3811, 0, 198, 198, 10002, 2561, 7253, 17406, 4142, 13, 198, 198, 1532, 262, 3696, 389, 25388, 618, 15680, 11, 618, 389, 484, 38237, 2790, 30, 198, 198, 37, 16, 12588, 10271, 1479, 290, 3338, 4321, 376, 16, 12588, 10271, 3452, 2196, 1680, 376, 16, 670, 355, 257, 479, 433, 278, 983, 0, 198, 198, 4366, 4903, 2117, 34961, 1366, 319, 428, 3052, 318, 2810, 416, 4903, 261, 1047, 13, 198, 198, 5167, 621, 1478, 8054, 1468, 1830, 284, 4321, 329, 1479, 0, 198, 198, 6090, 314, 1057, 376, 16, 2864, 26265, 4482, 24422, 10472, 12849, 13, 198, 198, 8479, 4712, 352, 11717, 983, 2691, 1479, 376, 16, 329, 4217, 284, 711, 645, 4321, 13, 198, 198, 1858, 389, 257, 4996, 286, 8339, 284, 3853, 422, 3706, 706, 1180, 4113, 543, 2291, 7595, 11, 5491, 11, 4486, 11, 8031, 11, 2869, 11, 31630, 11, 290, 8488, 13, 198, 198, 10002, 376, 16, 1584, 3776, 3232, 329, 4217, 18068, 39759, 44502, 3919, 13, 198, 198, 37, 16, 2864, 4217, 3776, 10472, 13248, 31122, 383, 5776, 48257, 13, 198, 198, 19633, 284, 2721, 376, 16, 13130, 319, 534 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
As your personal Realtor, I will focus on your complete satisfaction. I am fully committed to meeting your real estate needs. Whether it''s finding the right home, or helping you get the most out of selling your home, I am happy to help. I will listen to your needs and will work hard to meet them. I believe communication is key in meeting your goals and building our relationship. Please use my Website, www.StacySchwenk.com to find a wide range of information, including Local Services, finding a lender, finding a home, or learning how to prepare your home for sale. If I can be of service, please feel free to contact me at [email protected], or call 269-503-0204. Visit me on Facebook https://www.facebook.com/StacySchwenkREMAX/ and Like my Page!Giving Back:In addition to many local donations, I donate to Children's Miracle Network each time I sell a home. This money stays in Michigan to help local children's hospitals. My Success Depends on the Satisfaction of My Clients and Customers. My satisfied clients are my best resource for new business. In this very competitive business of real estate, service makes the difference. If you are considering a real estate professional, please give me the opportunity to earn your business as well. I am confident you will be very happy! I am a college graduate, and have my Bachelor''s Degree in Business Administration. I grew up in the Leonidas/Colon area.Professional Designations:
[ 1722, 534, 2614, 797, 2501, 273, 11, 314, 481, 2962, 319, 534, 1844, 14676, 13, 314, 716, 3938, 5364, 284, 3249, 534, 1103, 7964, 2476, 13, 10127, 340, 7061, 82, 4917, 262, 826, 1363, 11, 393, 5742, 345, 651, 262, 749, 503, 286, 6301, 534, 1363, 11, 314, 716, 3772, 284, 1037, 13, 314, 481, 6004, 284, 534, 2476, 290, 481, 670, 1327, 284, 1826, 606, 13, 314, 1975, 6946, 318, 1994, 287, 3249, 534, 4661, 290, 2615, 674, 2776, 13, 198, 198, 5492, 779, 616, 15887, 11, 7324, 13, 1273, 1590, 14874, 21006, 74, 13, 785, 284, 1064, 257, 3094, 2837, 286, 1321, 11, 1390, 10714, 6168, 11, 4917, 257, 35747, 11, 4917, 257, 1363, 11, 393, 4673, 703, 284, 8335, 534, 1363, 329, 5466, 13, 1002, 314, 460, 307, 286, 2139, 11, 3387, 1254, 1479, 284, 2800, 502, 379, 49523, 14874, 21006, 74, 31, 2787, 897, 13, 3262, 11, 393, 869, 38249, 12, 31938, 12, 15, 18638, 13, 16440, 502, 319, 3203, 3740, 1378, 2503, 13, 19024, 13, 785, 14, 1273, 1590, 14874, 21006, 74, 2200, 22921, 14, 290, 4525, 616, 7873, 0, 49701, 5157, 25, 818, 3090, 284, 867, 1957, 10976, 11, 314, 16565, 284, 8990, 338, 33292, 7311, 1123, 640, 314, 3677, 257, 1363, 13, 770, 1637, 14768, 287, 7055, 284, 1037, 1957, 1751, 338, 11301, 13, 198, 198, 3666, 16282, 2129, 2412, 319, 262, 48168, 2673, 286, 2011, 1012, 2334, 290, 36707, 13, 2011, 11378, 7534, 389, 616, 1266, 8271, 329, 649, 1597, 13, 554, 428, 845, 7606, 1597, 286, 1103, 7964, 11, 2139, 1838, 262, 3580, 13, 1002, 345, 389, 6402, 257, 1103, 7964, 4708, 11, 3387, 1577, 502, 262, 3663, 284, 5160, 534, 1597, 355, 880, 13, 314, 716, 6563, 345, 481, 307, 845, 3772, 0, 314, 716, 257, 4152, 10428, 11, 290, 423, 616, 33399, 7061, 82, 34486, 287, 7320, 8694, 13, 314, 6348, 510, 287, 262, 10592, 24496, 14, 5216, 261, 1989, 13, 49138, 8495, 602, 25 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Description du produit Comes with a download code. Epic 2016 album from the French metal juggernauts ... their first in 4 years, and first since relocating to New York! Includes "Stranded". Critique Sixième brûlot du groupe de death metal progressif français le plus épique, Magma marque d’entrée son universalité en s’éloignant des clichés collés à la peau d’un genre souvent réduit à un déluge de décibels manquant de créativité. « The Shooting Star », à la rythmique plombée parfaitement assumée par le batteur virtuose Mario Duplantier, ouvre ainsi avec fracas les hostilités, dévoilant du même coup le chant posé et hautement hypnotique de son frère Joe. Plus ouvert que ses prédécesseurs, Magma pourrait bien être, à l’instar du Black Album de Metallica, le disque qui permettra à Gojira d’accroître une base de fans déjà impressionnante et de dépasser son genre de prédilection. Une remise en question appelée par la peine vécue par les deux frères Duplantier, qui ont connu la douleur de perdre leur mère au moment même où démarrait l’enregistrement de ce nouvel opus. L’humeur de ce dernier s’en trouverait radicalement changée, servant littéralement de catharsis. Le simple « Silveria », toujours animé par la fibre écologiste chère au groupe, réserve des parties de guitare incroyables tandis que le chant possédé et la batterie martiale de « The Cell » seront loin de déplaire aux amateurs de la première heure. Car s’il marque une rupture avec l’œuvre pré-existante de Gojira, Magma sait aussi assurer les fondamentaux, promettant de nouveaux glorieux moments de headbanging, comme sur « Pray » ou encore le furieux et libérateur « Only Pain ». L’ouverture se matérialise surtout sur des morceaux tels que « Stranded » ou même « Magma », qu’il ne serait pas impossible de diffuser en radio. Avec Magma, Gojira fait assurément un immense pas en avant, prenant et assumant les risques, comme celui de faire reculer d’un cran le chant guttural de Joe Duplantier au profit de l’aspect mélodique d’un chant plus clair. Un pari réussi haut la main et qui place le groupe à un endroit stratégique de l’échiquier metal. Olivier Roubin - Copyright 2017 Music Story
[ 11828, 7043, 990, 270, 198, 198, 34, 2586, 351, 257, 4321, 2438, 13, 16781, 1584, 5062, 422, 262, 4141, 6147, 24873, 1142, 17712, 2644, 511, 717, 287, 604, 812, 11, 290, 717, 1201, 823, 27123, 284, 968, 1971, 0, 29581, 366, 13290, 12249, 1911, 198, 198, 18559, 2350, 198, 198, 21447, 72, 14064, 1326, 865, 42324, 26487, 7043, 1132, 431, 390, 1918, 6147, 4371, 361, 1216, 272, 16175, 15152, 443, 5556, 38251, 79, 2350, 11, 2944, 2611, 1667, 4188, 288, 447, 247, 298, 81, 22161, 3367, 10112, 43816, 551, 264, 447, 247, 2634, 5439, 25114, 748, 35478, 20954, 2927, 20954, 28141, 8591, 613, 559, 288, 447, 247, 403, 12121, 24049, 1151, 40560, 646, 270, 28141, 555, 39073, 75, 2217, 390, 39073, 66, 571, 1424, 582, 40972, 390, 1067, 2634, 265, 452, 43816, 13, 21110, 383, 25360, 2907, 13355, 11, 28141, 8591, 374, 34853, 2350, 458, 2381, 22161, 1582, 69, 4548, 972, 4368, 22161, 1582, 443, 7365, 660, 333, 4118, 84, 577, 10682, 10343, 15060, 959, 11, 267, 14795, 260, 257, 1040, 72, 257, 35138, 1216, 40263, 10287, 2583, 6392, 20954, 11, 39073, 85, 9437, 415, 7043, 285, 25792, 1326, 12092, 443, 33541, 1426, 2634, 2123, 387, 315, 972, 36580, 2350, 390, 3367, 1216, 35979, 5689, 13, 628, 198, 198, 17860, 267, 84, 1851, 8358, 264, 274, 778, 2634, 67, 2634, 728, 325, 1834, 11, 2944, 2611, 12797, 12907, 275, 2013, 6184, 103, 33945, 11, 28141, 300, 447, 247, 259, 7364, 7043, 2619, 23999, 390, 35616, 3970, 11, 443, 595, 4188, 45567, 9943, 3087, 430, 28141, 1514, 73, 8704, 288, 447, 247, 4134, 305, 34803, 33945, 17809, 2779, 390, 3296, 39073, 73, 24247, 10647, 77, 12427, 2123, 390, 39073, 6603, 263, 3367, 12121, 390, 778, 2634, 67, 576, 596, 13, 471, 710, 816, 786, 551, 1808, 598, 417, 22161, 1582, 8591, 613, 500, 410, 2634, 15509, 1582, 10287, 390, 2821, 1216, 14064, 411, 10343, 15060, 959, 11, 45567, 39585, 369, 28803, 8591, 2255, 293, 333, 390, 583, 67, 260, 443, 333, 285, 35979, 35851, 2589, 285, 25792, 1326, 267, 127, 117, 39073, 3876, 12907, 300, 447, 247, 268, 2301, 396, 260, 434, 390, 2906, 299, 280, 626, 1034, 385, 13, 628, 198, 198, 43, 447, 247, 71, 2454, 333, 390, 2906, 288, 1142, 959, 264, 447, 247, 268, 4057, 332, 4548, 7702, 972, 1488, 22161, 11, 18807, 300, 715, 2634, 1373, 972, 390, 32171, 945, 271, 13, 1004, 2829, 21110, 7698, 544, 13355, 11, 2819, 73, 4662, 2355, 2634, 1582, 8591, 33073, 38251, 66, 7451, 68, 442, 35979, 35851, 1132, 431, 11, 40560, 2655, 303, 748, 4671, 390, 915, 270, 533, 753, 3287, 2977, 256, 392, 271, 8358, 443, 33541, 1184, 2634, 67, 2634, 2123, 8591, 4984, 494, 15618, 68, 390, 21110, 383, 12440, 13355, 1055, 756, 2376, 259, 390, 39073, 489, 7626, 27506, 716, 45211, 390, 8591, 4199, 72, 35979, 339, 495, 13, 1879, 264, 447, 247, 346, 1667, 4188, 17809, 46836, 257, 35138, 300, 447, 247, 129, 241, 14795, 260, 778, 2634, 12, 1069, 10167, 68, 390, 1514, 73, 8704, 11, 2944, 2611, 473, 270, 257, 1046, 72, 840, 15051, 10287, 16245, 3263, 14644, 11, 1552, 3087, 415, 390, 299, 280, 303, 14644, 1278, 19257, 2821, 7188, 390, 1182, 65, 4924, 11, 725, 68, 969, 21110, 1736, 323, 13355, 267, 84, 2207, 382, 443, 9230, 494, 2821, 2123, 9195, 2634, 4873, 333, 21110, 5514, 15627, 13355, 13, 628, 198, 198, 43, 447, 247, 280, 1851, 495, 384, 2603, 2634, 4454, 786, 969, 83, 448, 969, 748, 2146, 344, 14644, 256, 1424, 8358, 21110, 4285, 12249, 13355, 267, 84, 285, 25792, 1326, 21110, 2944, 2611, 13355, 11, 627, 447, 247, 346, 497, 1055, 4548, 38836, 5340, 390, 814, 7220, 551, 5243, 13, 12761, 66, 2944, 2611, 11, 1514, 73, 8704, 277, 4548, 840, 333, 2634, 434, 555, 13964, 38836, 551, 1196, 415, 11, 662, 22057, 2123, 4368, 415, 10287, 6106, 13281, 11, 725, 68, 18725, 9019, 390, 37063, 664, 18173, 288, 447, 247, 403, 41286, 443, 33541, 12500, 83, 1523, 390, 5689, 10343, 15060, 959, 35851, 7630, 390, 300, 447, 247, 292, 806, 285, 2634, 75, 375, 2350, 288, 447, 247, 403, 33541, 5556, 537, 958, 13, 791, 1582, 72, 40560, 1046, 72, 387, 315, 8591, 1388, 2123, 45567, 1295, 443, 1132, 431, 28141, 555, 886, 7775, 25369, 2634, 70, 2350, 390, 300, 447, 247, 2634, 354, 1557, 959, 6147, 13, 628, 198, 198, 46, 16017, 959, 13876, 8800, 532, 15069, 2177, 7849, 8362 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
You are here: Yes I'm a newb to the Turnkey Linux thing, as well as EC2. All I'm trying to do is open up a different port to run a virtual host. I've added port 85 to the EC2 security group, and added an accept rule to the Linux Firewall for port 85 coming from any address. I've also created a virtual host that responds to any inbound address on port 85. However, the connection is getting refused. Since multiple things could be going wrong, it's best to try and diagnose the issue by progressing incrementally. By default the firewall is disabled so unless you enabled it, that shouldn't be an issue which leaves the web server and the EC2 security groups. Test the EC2 security groups first. Use netcat to listen on port 85 and then make sure you can connect to it remotely. If that doesn't work (and you don't have a firewall up) you know it's the EC2 group.
[ 1639, 389, 994, 25, 198, 198, 5297, 314, 1101, 257, 649, 65, 284, 262, 6756, 2539, 7020, 1517, 11, 355, 880, 355, 13182, 17, 13, 1439, 314, 1101, 2111, 284, 466, 318, 1280, 510, 257, 1180, 2493, 284, 1057, 257, 7166, 2583, 13, 314, 1053, 2087, 2493, 7600, 284, 262, 13182, 17, 2324, 1448, 11, 290, 2087, 281, 2453, 3896, 284, 262, 7020, 3764, 11930, 329, 2493, 7600, 2406, 422, 597, 2209, 13, 314, 1053, 635, 2727, 257, 7166, 2583, 326, 20067, 284, 597, 287, 7784, 2209, 319, 2493, 7600, 13, 2102, 11, 262, 4637, 318, 1972, 6520, 13, 198, 198, 6385, 3294, 1243, 714, 307, 1016, 2642, 11, 340, 338, 1266, 284, 1949, 290, 37489, 262, 2071, 416, 37335, 18703, 453, 13, 2750, 4277, 262, 32928, 318, 10058, 523, 4556, 345, 9343, 340, 11, 326, 6584, 470, 307, 281, 2071, 543, 5667, 262, 3992, 4382, 290, 262, 13182, 17, 2324, 2628, 13, 198, 198, 14402, 262, 13182, 17, 2324, 2628, 717, 13, 5765, 2010, 9246, 284, 6004, 319, 2493, 7600, 290, 788, 787, 1654, 345, 460, 2018, 284, 340, 19863, 13, 1002, 326, 1595, 470, 670, 357, 392, 345, 836, 470, 423, 257, 32928, 510, 8, 345, 760, 340, 338, 262, 13182, 17, 1448, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Marginal improvement in Assam situation Last updated on: November 21, 2003 13:13 IST An uneasy calm prevails in Assam with no major incident of violence reported overnight while curfew in worst-hit Tinsukia town was relaxed for two hours from 11.30 a.m. to enable people to buy essential commodities. Official sources in Guwahati said the fear of reprisal continues to stalk some residents of Tinsukia, Dibrugarh, Dhubri, Bongaigaon and Nalbari towns. In Nalbari, curfew was suspended for 10 hours from 6 am. The curfew in Tinsukia and Dibrugarh districts has hit train services. The districts have a sizeable Bihari population but many opted to leave the state and made a beeline for railway stations. Dibrugarh district Deputy Commissioner N Verma told PTI that the dusk-to-dawn curfew was clamped from 5 pm to 5 am in the oil town of Duliajan, the fertiliser town of Namrup, Tengakhat, Tingkhong and Moran to prevent any fresh outbreak of violence. Prohibitory orders under Section 144 of the Criminal Procedure Code continued to remain in force in Bihari-dominated areas in Dibrugarh district.
[ 36003, 9025, 287, 2195, 321, 3074, 198, 198, 5956, 6153, 319, 25, 3389, 2310, 11, 5816, 1511, 25, 1485, 45790, 198, 198, 2025, 34644, 9480, 8654, 1768, 287, 2195, 321, 351, 645, 1688, 4519, 286, 3685, 2098, 13417, 981, 49565, 287, 5290, 12, 17945, 309, 1040, 2724, 544, 3240, 373, 18397, 329, 734, 2250, 422, 1367, 13, 1270, 257, 13, 76, 13, 284, 7139, 661, 284, 2822, 6393, 24392, 13, 198, 198, 28529, 4237, 287, 1962, 86, 993, 7246, 531, 262, 3252, 286, 41575, 28456, 4477, 284, 31297, 617, 5085, 286, 309, 1040, 2724, 544, 11, 360, 571, 2143, 283, 71, 11, 20529, 549, 380, 11, 347, 44294, 13827, 261, 290, 399, 282, 65, 2743, 11684, 13, 554, 399, 282, 65, 2743, 11, 49565, 373, 9951, 329, 838, 2250, 422, 718, 716, 13, 198, 198, 464, 49565, 287, 309, 1040, 2724, 544, 290, 360, 571, 2143, 283, 71, 12815, 468, 2277, 4512, 2594, 13, 383, 12815, 423, 257, 47225, 347, 4449, 2743, 3265, 475, 867, 18524, 284, 2666, 262, 1181, 290, 925, 257, 307, 4470, 329, 20515, 8985, 13, 198, 198, 35, 571, 2143, 283, 71, 4783, 15110, 13270, 399, 4643, 2611, 1297, 19310, 40, 326, 262, 46166, 12, 1462, 12, 67, 3832, 49565, 373, 537, 13322, 422, 642, 9114, 284, 642, 716, 287, 262, 3056, 3240, 286, 42148, 544, 13881, 11, 262, 19078, 5847, 3240, 286, 17871, 12618, 11, 309, 1516, 461, 5183, 11, 309, 278, 14636, 506, 290, 42705, 284, 2948, 597, 4713, 17645, 286, 3685, 13, 198, 198, 2964, 26964, 652, 6266, 739, 7275, 20224, 286, 262, 15531, 34997, 6127, 3767, 284, 3520, 287, 2700, 287, 347, 4449, 2743, 12, 34475, 3006, 287, 360, 571, 2143, 283, 71, 4783, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Menu The Freedom of Choice In every moment we have a choice. The freedom to choose our actions that create our day, month and year all adding up to the life we are creating for ourself. Even if you think are not choosing, you are. No decision is a decision. The choices we make either support our goals and the life we truly want to live or they are taking us further away. Our choices cause us to feel great pleasure in our life or they are creating pain and suffering. Without focusing on the past too much, reflect back on the last couple of days, the last week or even the last month. What choices have you made that led you to where you are or allowed you to stay stagnant with no growth at all? What do you want to accomplish? How do you want to feel? If you’re not sure what choices you have made, then just look at your actions. If you want to lose weight and you choose to not work out or eat fast food, than the choices you are making do not support your goal. Every time you look in the mirror and see no progress you create pain and suffering for yourself. If you want a new job, but you don’t update your résumé, network or apply for jobs, than your choices are not supporting your goal and everyday when you go to work at a job you don’t want to be at, you create pain and suffering for yourself. If you are unhappily in a relationship and you choose to complain to everyone around you, rather than communicating to your partner to see how they feel, make an effort to improve your relationship by working on you or decide to end the relationship, than you create pain and suffering for yourself and your partner. How about anytime you need to drive somewhere you have never been and are unfamiliar with. If your goal is to arrive at your destination, you can choose to put the address into the navigation on your phone, print out directions, use a map, or you could just get in the car and drive, hoping that you get there. Which choice will allow you to arrive at your destination? Which choice do you think will give you more pleasure than pain? You can take this formula and apply it to any part of your life. The formula to feeling pleasure is not complicated, but it’s also very easy to feel pain and suffering. So you have a choice, what do you want to feel, pleasure or pain? Choice is a decision to take action or not.Tony Robbins said, “A real decision is measured by the fact that you’ve taken a new action. If there is no action, you haven’t truly decided.” So whatever your goals are, whatever life you want to create for yourself, the first thing you have to do is choose to take actions that will support your goal so you can ultimately feel more pleasure and less pain.
[ 23381, 198, 198, 464, 10204, 286, 18502, 198, 198, 818, 790, 2589, 356, 423, 257, 3572, 13, 383, 4925, 284, 3853, 674, 4028, 326, 2251, 674, 1110, 11, 1227, 290, 614, 477, 4375, 510, 284, 262, 1204, 356, 389, 4441, 329, 674, 944, 13, 3412, 611, 345, 892, 389, 407, 11236, 11, 345, 389, 13, 1400, 2551, 318, 257, 2551, 13, 383, 7747, 356, 787, 2035, 1104, 674, 4661, 290, 262, 1204, 356, 4988, 765, 284, 2107, 393, 484, 389, 2263, 514, 2252, 1497, 13, 3954, 7747, 2728, 514, 284, 1254, 1049, 9476, 287, 674, 1204, 393, 484, 389, 4441, 2356, 290, 7195, 13, 9170, 10759, 319, 262, 1613, 1165, 881, 11, 4079, 736, 319, 262, 938, 3155, 286, 1528, 11, 262, 938, 1285, 393, 772, 262, 938, 1227, 13, 1867, 7747, 423, 345, 925, 326, 2957, 345, 284, 810, 345, 389, 393, 3142, 345, 284, 2652, 41391, 351, 645, 3349, 379, 477, 30, 1867, 466, 345, 765, 284, 9989, 30, 1374, 466, 345, 765, 284, 1254, 30, 1002, 345, 447, 247, 260, 407, 1654, 644, 7747, 345, 423, 925, 11, 788, 655, 804, 379, 534, 4028, 13, 198, 198, 1532, 345, 765, 284, 4425, 3463, 290, 345, 3853, 284, 407, 670, 503, 393, 4483, 3049, 2057, 11, 621, 262, 7747, 345, 389, 1642, 466, 407, 1104, 534, 3061, 13, 3887, 640, 345, 804, 287, 262, 10162, 290, 766, 645, 4371, 345, 2251, 2356, 290, 7195, 329, 3511, 13, 1002, 345, 765, 257, 649, 1693, 11, 475, 345, 836, 447, 247, 83, 4296, 534, 40560, 16345, 2634, 11, 3127, 393, 4174, 329, 3946, 11, 621, 534, 7747, 389, 407, 6493, 534, 3061, 290, 10908, 618, 345, 467, 284, 670, 379, 257, 1693, 345, 836, 447, 247, 83, 765, 284, 307, 379, 11, 345, 2251, 2356, 290, 7195, 329, 3511, 13, 1002, 345, 389, 14274, 1324, 813, 287, 257, 2776, 290, 345, 3853, 284, 13121, 284, 2506, 1088, 345, 11, 2138, 621, 22889, 284, 534, 5212, 284, 766, 703, 484, 1254, 11, 787, 281, 3626, 284, 2987, 534, 2776, 416, 1762, 319, 345, 393, 5409, 284, 886, 262, 2776, 11, 621, 345, 2251, 2356, 290, 7195, 329, 3511, 290, 534, 5212, 13, 1374, 546, 17949, 345, 761, 284, 3708, 7382, 345, 423, 1239, 587, 290, 389, 22594, 351, 13, 1002, 534, 3061, 318, 284, 9240, 379, 534, 10965, 11, 345, 460, 3853, 284, 1234, 262, 2209, 656, 262, 16408, 319, 534, 3072, 11, 3601, 503, 11678, 11, 779, 257, 3975, 11, 393, 345, 714, 655, 651, 287, 262, 1097, 290, 3708, 11, 7725, 326, 345, 651, 612, 13, 9022, 3572, 481, 1249, 345, 284, 9240, 379, 534, 10965, 30, 9022, 3572, 466, 345, 892, 481, 1577, 345, 517, 9476, 621, 2356, 30, 198, 198, 1639, 460, 1011, 428, 10451, 290, 4174, 340, 284, 597, 636, 286, 534, 1204, 13, 383, 10451, 284, 4203, 9476, 318, 407, 8253, 11, 475, 340, 447, 247, 82, 635, 845, 2562, 284, 1254, 2356, 290, 7195, 13, 1406, 345, 423, 257, 3572, 11, 644, 466, 345, 765, 284, 1254, 11, 9476, 393, 2356, 30, 18502, 318, 257, 2551, 284, 1011, 2223, 393, 407, 13, 29387, 44117, 531, 11, 564, 250, 32, 1103, 2551, 318, 8630, 416, 262, 1109, 326, 345, 447, 247, 303, 2077, 257, 649, 2223, 13, 1002, 612, 318, 645, 2223, 11, 345, 4398, 447, 247, 83, 4988, 3066, 13, 447, 251, 1406, 4232, 534, 4661, 389, 11, 4232, 1204, 345, 765, 284, 2251, 329, 3511, 11, 262, 717, 1517, 345, 423, 284, 466, 318, 3853, 284, 1011, 4028, 326, 481, 1104, 534, 3061, 523, 345, 460, 6165, 1254, 517, 9476, 290, 1342, 2356, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Oxford Instruments - Trading Update Oxford Instruments plc, a leading provider of high technology products and services to industrial companies and scientific research communities, is today issuing a trading update. Given the current uncertainty from Covid-19 and the impact on trading, Oxford Instruments plc is issuing its pre-close for the financial year 2019/20 earlier than usual. The severe disruption as a result of Covid-19 has impacted our customers, with a number of product shipments and installations in the final quarter of the financial year being delayed, in addition to an enforced site closure in California. While we are seeing some re-opening of customer sites in China, the situation in Europe and North America is deteriorating. As a result, the Group currently expects adjusted operating profit for the full year of between £47m to £50m. Looking ahead, we expect current events to adversely impact trading during the first half of the financial year 2020/21, but at this stage there remains considerable uncertainty. The Group has a strong balance sheet and substantial liquidity, with net cash of over £50m. We operate in robust markets with a well-positioned portfolio of products and solutions for attractive end markets. We remain committed to our strategy and would expect trading to recover in line with a reduction in disruption from Covid-19. Oxford Instruments' results for the year ended 31 March 2020 will be released on 9 June 2020. Note: Oxford Instruments compiled consensus analyst forecast for adjusted operating profit (year to 31 March 2020) is £53.3m. This excludes analysts that have not updated forecasts following the disposals of OI Healthcare and our share in Scienta Omicron. Enquiries: Oxford Instrumentsplc Tel: 01865 393200 Ian Barkshire, Chief Executive Gavin Hill, Group Finance Director MHP CommunicationsTel: 020 3128 8100 Rachel Hirst/Alice McLaren - Ends - Issued for and on behalf of Oxford Instruments plc Notes to Editors About Oxford Instruments plc Oxford Instruments designs, supplies and supports high-technology tools and systems with a focus on research and industrial applications. Innovation has been the driving force behind Oxford Instruments' growth and success for 60 years, supporting its core purpose to address some of the world's most pressing challenges. The first technology business to be spun out from Oxford University, Oxford Instruments is now a global company and is listed on the FTSE250 index of the London Stock Exchange (OXIG). Its strategy focuses on being a customer-centric, market-focused Group, understanding the technical and commercial challenges faced by its customers. Key market segments include Semiconductor & Communications, Advanced Materials, Healthcare & Life Science, and Quantum Technology. Their portfolio includes a range of core technologies in areas such as low temperature and high magnetic field environments; Nuclear Magnetic Resonance; X-ray, electron, laser and optical based metrology; atomic force microscopy; optical imaging; and advanced growth, deposition and etching. Oxford Instruments is helping enable a greener economy, increased connectivity, improved health and leaps in scientific understanding. Their advanced products and services allow the world's leading industrial companies and scientific research communities to image, analyse and manipulate materials down to the atomic and molecular level, helping to accelerate R&D, increase manufacturing productivity and make ground-breaking discoveries. This information is provided by RNS, the news service of the London Stock Exchange. RNS is approved by the Financial Conduct Authority to act as a Primary Information Provider in the United Kingdom. Terms and conditions relating to the use and distribution of this information may apply. For further information, please contact [email protected] or visit www.rns.com. END TSTKKOBKKBKBFND Quick facts: Oxford Instruments PLC Price: 1334 Market: AIM Market Cap: £766.23 m Follow NO INVESTMENT ADVICE The Company is a publisher. You understand and agree that no content published on the Site constitutes a recommendation that any particular security, portfolio of securities, transaction, or investment strategy is...
[ 38208, 3841, 43953, 532, 25469, 10133, 198, 198, 38208, 3841, 43953, 458, 66, 11, 257, 3756, 10131, 286, 1029, 3037, 3186, 290, 2594, 284, 7593, 2706, 290, 5654, 2267, 5348, 11, 318, 1909, 19089, 257, 7313, 4296, 13, 198, 198, 15056, 262, 1459, 13479, 422, 39751, 312, 12, 1129, 290, 262, 2928, 319, 7313, 11, 13643, 43953, 458, 66, 318, 19089, 663, 662, 12, 19836, 329, 262, 3176, 614, 13130, 14, 1238, 2961, 621, 6678, 13, 198, 198, 464, 6049, 19911, 355, 257, 1255, 286, 39751, 312, 12, 1129, 468, 20755, 674, 4297, 11, 351, 257, 1271, 286, 1720, 29311, 290, 26162, 287, 262, 2457, 3860, 286, 262, 3176, 614, 852, 11038, 11, 287, 3090, 284, 281, 20326, 2524, 16512, 287, 3442, 13, 2893, 356, 389, 4379, 617, 302, 12, 29443, 286, 6491, 5043, 287, 2807, 11, 262, 3074, 287, 2031, 290, 2258, 2253, 318, 43229, 13, 1081, 257, 1255, 11, 262, 4912, 3058, 13423, 12328, 5361, 7630, 329, 262, 1336, 614, 286, 1022, 4248, 2857, 76, 284, 4248, 1120, 76, 13, 198, 198, 15784, 4058, 11, 356, 1607, 1459, 2995, 284, 34079, 2928, 7313, 1141, 262, 717, 2063, 286, 262, 3176, 614, 12131, 14, 2481, 11, 475, 379, 428, 3800, 612, 3793, 11091, 13479, 13, 383, 4912, 468, 257, 1913, 5236, 9629, 290, 8904, 31061, 11, 351, 2010, 5003, 286, 625, 4248, 1120, 76, 13, 775, 8076, 287, 12373, 5939, 351, 257, 880, 12, 9150, 276, 15320, 286, 3186, 290, 8136, 329, 10966, 886, 5939, 13, 775, 3520, 5364, 284, 674, 4811, 290, 561, 1607, 7313, 284, 8551, 287, 1627, 351, 257, 7741, 287, 19911, 422, 39751, 312, 12, 1129, 13, 198, 198, 38208, 3841, 43953, 6, 2482, 329, 262, 614, 4444, 3261, 2805, 12131, 481, 307, 2716, 319, 860, 2795, 12131, 13, 198, 198, 6425, 25, 13643, 43953, 14102, 11529, 12499, 11092, 329, 12328, 5361, 7630, 357, 1941, 284, 3261, 2805, 12131, 8, 318, 4248, 4310, 13, 18, 76, 13, 770, 36833, 13440, 326, 423, 407, 6153, 26119, 1708, 262, 12483, 874, 286, 440, 40, 30289, 290, 674, 2648, 287, 9898, 64, 440, 9383, 1313, 13, 198, 198, 4834, 421, 18561, 25, 198, 198, 38208, 3841, 43953, 489, 66, 12088, 25, 5534, 23, 2996, 5014, 18, 2167, 198, 198, 37776, 2409, 591, 10695, 11, 5953, 10390, 198, 198, 38, 20637, 3327, 11, 4912, 15007, 5890, 198, 198, 44, 14082, 14620, 33317, 25, 657, 1238, 513, 12762, 807, 3064, 198, 198, 44045, 367, 667, 14, 44484, 33017, 198, 198, 12, 46756, 532, 198, 198, 27738, 1739, 329, 290, 319, 8378, 286, 13643, 43953, 458, 66, 198, 198, 16130, 284, 48073, 198, 198, 8585, 13643, 43953, 458, 66, 198, 198, 38208, 3841, 43953, 9824, 11, 9416, 290, 6971, 1029, 12, 45503, 4899, 290, 3341, 351, 257, 2962, 319, 2267, 290, 7593, 5479, 13, 27724, 468, 587, 262, 5059, 2700, 2157, 13643, 43953, 6, 3349, 290, 1943, 329, 3126, 812, 11, 6493, 663, 4755, 4007, 284, 2209, 617, 286, 262, 995, 338, 749, 12273, 6459, 13, 198, 198, 464, 717, 3037, 1597, 284, 307, 26843, 503, 422, 13643, 2059, 11, 13643, 43953, 318, 783, 257, 3298, 1664, 290, 318, 5610, 319, 262, 376, 4694, 36, 9031, 6376, 286, 262, 3576, 10500, 12516, 357, 48632, 3528, 737, 6363, 4811, 13692, 319, 852, 257, 6491, 12, 28577, 11, 1910, 12, 18143, 4912, 11, 4547, 262, 6276, 290, 5068, 6459, 7452, 416, 663, 4297, 13, 7383, 1910, 17894, 2291, 311, 5314, 40990, 1222, 14620, 11, 13435, 24310, 11, 30289, 1222, 5155, 5800, 11, 290, 29082, 8987, 13, 198, 198, 14574, 15320, 3407, 257, 2837, 286, 4755, 8514, 287, 3006, 884, 355, 1877, 5951, 290, 1029, 14091, 2214, 12493, 26, 19229, 44629, 44783, 590, 26, 1395, 12, 2433, 11, 11538, 11, 12855, 290, 18480, 1912, 1138, 31142, 26, 17226, 2700, 21145, 11081, 26, 18480, 19560, 26, 290, 6190, 3349, 11, 32553, 290, 2123, 10813, 13, 198, 198, 38208, 3841, 43953, 318, 5742, 7139, 257, 10536, 877, 3773, 11, 3220, 19843, 11, 6596, 1535, 290, 37312, 287, 5654, 4547, 13, 5334, 6190, 3186, 290, 2594, 1249, 262, 995, 338, 3756, 7593, 2706, 290, 5654, 2267, 5348, 284, 2939, 11, 39552, 290, 18510, 5696, 866, 284, 262, 17226, 290, 18955, 1241, 11, 5742, 284, 22636, 371, 5, 35, 11, 2620, 9138, 13714, 290, 787, 2323, 12, 13395, 24362, 13, 198, 198, 1212, 1321, 318, 2810, 416, 371, 8035, 11, 262, 1705, 2139, 286, 262, 3576, 10500, 12516, 13, 371, 8035, 318, 6325, 416, 262, 11302, 28579, 11416, 284, 719, 355, 257, 21087, 6188, 32549, 287, 262, 1578, 7526, 13, 17637, 290, 3403, 11270, 284, 262, 779, 290, 6082, 286, 428, 1321, 743, 4174, 13, 1114, 2252, 1321, 11, 3387, 2800, 685, 12888, 6861, 60, 393, 3187, 7324, 13, 81, 5907, 13, 785, 13, 198, 198, 10619, 198, 198, 51, 2257, 16601, 9864, 16601, 33, 22764, 37, 8575, 198, 198, 21063, 6419, 25, 13643, 43953, 350, 5639, 198, 198, 18124, 25, 198, 1485, 2682, 198, 198, 27470, 25, 317, 3955, 198, 198, 27470, 4476, 25, 4248, 22, 2791, 13, 1954, 285, 198, 198, 7155, 198, 198, 15285, 34899, 6465, 10979, 5984, 27389, 198, 198, 464, 5834, 318, 257, 9991, 13, 921, 1833, 290, 4236, 326, 645, 2695, 3199, 319, 262, 14413, 19300, 257, 15602, 326, 597, 1948, 2324, 11, 15320, 286, 16145, 11, 8611, 11, 393, 4896, 4811, 318, 986 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
NEXBOX has recently unveiled its new TV Box model, NEXBOX N9. This model comes with a Rockchip RK3229 Quad-core Cortex A7 1.5GHz 64bit chipset. The model also includes a penta-core HD graphics. Coupled with 1 GB of RAM, the chipset delivers stellar performance for using the device along with the HDTV as a mini PC. NEXBOX N9 runs with Android 4.4 OS which is very stable and allows the user to freely install desired apps like YouTube and Facebook. If users like Google apps, they can install the required apps through third-party app stores. The device supports XBMC, and can deliver amazing entertainment through movies, TV shows and music. “Rockchip RK3229 is 2016’s new chipset, and we use it to make our N9 TV Box. We’re more than delighted to share the new products and happiness with our customers. N9 TV Box can change your traditional TV & LCD Monitor into a intelligent platform via WiFi & LAN. This device also allows you to watch lots of free videos, movies and play popular games without monthly bills and restrictions. It will bring you much fun and convenience,” the spokesman of the business said. Now, NEXBOX N9 has been available with a promotional price about $30. Power plugs are provided for different markets like the U.S., the U.K., Australia and Europe. Customers across the world can purchase NEXBOX N9 Android TV box through online retailers and enjoy free shipping service. Moreover, NEXBOX has also introduced its new TV Box model, Amlogic S905X Processor TV Box featuring 64bit VP9 decoding. This new models is equipped with the latest Amlogic S905X, which is a Quad-core CPU with a frequency of clock of 2.0 GHz. NEXBOX specializes in manufacturing and developing popular consumer electronics for global users. The business’ brand is NEXBOX which is well-known for stable premium quality at affordable prices. From hot styles of TV Boxes and Mini PCs, customers are sure to find their own must-have models at iNEXBOX.com
[ 45, 6369, 39758, 468, 2904, 18475, 663, 649, 3195, 8315, 2746, 11, 399, 6369, 39758, 399, 24, 13, 770, 2746, 2058, 351, 257, 4631, 35902, 371, 42, 18, 23539, 20648, 12, 7295, 44420, 317, 22, 352, 13, 20, 23741, 5598, 2545, 49013, 13, 383, 2746, 635, 3407, 257, 28145, 64, 12, 7295, 5572, 9382, 13, 15062, 10137, 351, 352, 13124, 286, 13931, 11, 262, 49013, 16316, 25041, 2854, 329, 1262, 262, 3335, 1863, 351, 262, 5572, 6849, 355, 257, 9927, 4217, 13, 198, 198, 45, 6369, 39758, 399, 24, 4539, 351, 5565, 604, 13, 19, 7294, 543, 318, 845, 8245, 290, 3578, 262, 2836, 284, 12748, 2721, 10348, 6725, 588, 7444, 290, 3203, 13, 1002, 2985, 588, 3012, 6725, 11, 484, 460, 2721, 262, 2672, 6725, 832, 2368, 12, 10608, 598, 7000, 13, 383, 3335, 6971, 1395, 33, 9655, 11, 290, 460, 5203, 4998, 9739, 832, 6918, 11, 3195, 2523, 290, 2647, 13, 198, 198, 447, 250, 19665, 35902, 371, 42, 18, 23539, 318, 1584, 447, 247, 82, 649, 49013, 11, 290, 356, 779, 340, 284, 787, 674, 399, 24, 3195, 8315, 13, 775, 447, 247, 260, 517, 621, 20707, 284, 2648, 262, 649, 3186, 290, 12157, 351, 674, 4297, 13, 399, 24, 3195, 8315, 460, 1487, 534, 4569, 3195, 1222, 23598, 18289, 656, 257, 12661, 3859, 2884, 24904, 1222, 24192, 13, 770, 3335, 635, 3578, 345, 284, 2342, 6041, 286, 1479, 5861, 11, 6918, 290, 711, 2968, 1830, 1231, 9651, 9024, 290, 8733, 13, 632, 481, 2222, 345, 881, 1257, 290, 15607, 11, 447, 251, 262, 6523, 286, 262, 1597, 531, 13, 198, 198, 3844, 11, 399, 6369, 39758, 399, 24, 468, 587, 1695, 351, 257, 18767, 2756, 546, 720, 1270, 13, 4333, 37008, 389, 2810, 329, 1180, 5939, 588, 262, 471, 13, 50, 1539, 262, 471, 13, 42, 1539, 4505, 290, 2031, 13, 36707, 1973, 262, 995, 460, 5001, 399, 6369, 39758, 399, 24, 5565, 3195, 3091, 832, 2691, 16167, 290, 2883, 1479, 8440, 2139, 13, 198, 198, 24606, 11, 399, 6369, 39758, 468, 635, 5495, 663, 649, 3195, 8315, 2746, 11, 1703, 6404, 291, 311, 44928, 55, 32893, 3195, 8315, 9593, 5598, 2545, 23342, 24, 39938, 13, 770, 649, 4981, 318, 10911, 351, 262, 3452, 1703, 6404, 291, 311, 44928, 55, 11, 543, 318, 257, 20648, 12, 7295, 9135, 351, 257, 8373, 286, 8801, 286, 362, 13, 15, 26499, 13, 198, 198, 45, 6369, 39758, 29786, 287, 9138, 290, 5922, 2968, 7172, 17075, 329, 3298, 2985, 13, 383, 1597, 447, 247, 4508, 318, 399, 6369, 39758, 543, 318, 880, 12, 4002, 329, 8245, 8683, 3081, 379, 10935, 4536, 13, 3574, 3024, 12186, 286, 3195, 8315, 274, 290, 12558, 21869, 171, 120, 234, 4297, 389, 1654, 284, 1064, 511, 898, 1276, 12, 14150, 4981, 379, 1312, 45, 6369, 39758, 13, 785 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
MotoGP French Grand Prix Just days after announcing that he will retire at the end of the 2012 season, Aussie ace Casey Stoner will be out to show that he is still the best rider in the world when he contests the French Grand Prix on Sunday night (AEST). Stoner holds a one point championship lead over Spanish ace Jorge Lorenzo three races into the season and will be confident of extending his lead by adding to his victory around the Le Mans circuit last year. Dani Pedrosa has finished on the podium alongside Lorenzo and Stoner in each of the three races this season and will be bidding for his first victory of 2012, while Andrea Dovizioso will be bidding to go one better than last year, when he finished second to Stoner.
[ 44, 2069, 16960, 4141, 5675, 23832, 198, 198, 5703, 1528, 706, 16428, 326, 339, 481, 8058, 379, 262, 886, 286, 262, 2321, 1622, 11, 317, 43480, 31506, 21097, 520, 14491, 481, 307, 503, 284, 905, 326, 339, 318, 991, 262, 1266, 17876, 287, 262, 995, 618, 339, 22830, 262, 4141, 5675, 23832, 319, 3502, 1755, 357, 32, 6465, 737, 520, 14491, 6622, 257, 530, 966, 12184, 1085, 625, 7897, 31506, 34687, 41721, 1115, 9558, 656, 262, 1622, 290, 481, 307, 6563, 286, 16610, 465, 1085, 416, 4375, 284, 465, 5373, 1088, 262, 1004, 18580, 10349, 938, 614, 13, 198, 198, 35, 3216, 13457, 4951, 64, 468, 5201, 319, 262, 27941, 7848, 41721, 290, 520, 14491, 287, 1123, 286, 262, 1115, 9558, 428, 1622, 290, 481, 307, 23829, 329, 465, 717, 5373, 286, 2321, 11, 981, 23174, 360, 709, 528, 4267, 78, 481, 307, 23829, 284, 467, 530, 1365, 621, 938, 614, 11, 618, 339, 5201, 1218, 284, 520, 14491, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
How Much Does it Cost For those not qualifying for the $10 surgery, we have other low income options available. Check the chart to see whether or not you qualify for our low income program which offers the surgery at $20 for males and $25 for females. If you are feeding or caring for a feral or stray cat, please contact the Feral Cat Coalition of Oregon at (503) 797-2606 to make an appointment. You can also click here to visit their website for more information. Feral cat caregivers do not need to qualify under the Spay & Save guidelines. There are no limits to the numbers of cats and kittens that can be brought in per household.
[ 2437, 13111, 8314, 340, 6446, 198, 198, 1890, 883, 407, 18677, 329, 262, 720, 940, 8185, 11, 356, 423, 584, 1877, 3739, 3689, 1695, 13, 6822, 262, 8262, 284, 766, 1771, 393, 407, 345, 12780, 329, 674, 1877, 3739, 1430, 543, 4394, 262, 8185, 379, 720, 1238, 329, 10835, 290, 720, 1495, 329, 12366, 13, 198, 198, 1532, 345, 389, 13017, 393, 18088, 329, 257, 43057, 393, 28583, 3797, 11, 3387, 2800, 262, 376, 1691, 5181, 15135, 286, 8819, 379, 357, 31938, 8, 767, 5607, 12, 21719, 21, 284, 787, 281, 12557, 13, 921, 460, 635, 3904, 994, 284, 3187, 511, 3052, 329, 517, 1321, 13, 376, 1691, 3797, 45044, 466, 407, 761, 284, 12780, 739, 262, 1338, 323, 1222, 12793, 9949, 13, 198, 198, 1858, 389, 645, 7095, 284, 262, 3146, 286, 11875, 290, 45584, 326, 460, 307, 3181, 287, 583, 6641, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
The mainstream language of leadership is geared toward deciding and affirming rather than questioning. Yet my recent research finds that – contrary to popular belief – leaders who routinely ask questions become more credible in their roles. Most leaders believe the opposite. They think their questions betray a lack of knowledge that could raise doubts about their competence. While not always untrue, that is only part of a more complex picture, as my co-author Irina Cojuhrenco of the University of Surrey and I explain in a forthcoming paper in Organizational Behavior and Human Decision Processes. Why leaders don’t ask questions Our first study, a survey completed by 281 managers, found that only 29 percent of participants asked questions as often as they could. Curiously, the managers also reported that asking questions was a great way to elicit trust, input and help – as well as to display humility. However, they were much less optimistic about how being inquisitive may affect how competent a leader is perceived to be. There’s the rub. The appearance of competence may appear so important that it overshadows other critical factors of a leader’s success such as trust, cooperation from employees, etc. It is not surprising, then, that leaders are wary of asking questions. We proceeded to investigate whether this negative correlation between question-asking and perceived competence actually existed. In four subsequent studies, participants recruited through Amazon’s Mechanical Turk platform read different versions of scenarios depicting bosses either asking questions, delivering conclusions or admitting that they didn’t know something. They then rated the boss’s perceived competence, humility and trustworthiness as well as their own inclination to help the boss, based on the information in the scenario. We found that for the hypothetical bosses who were described as new in their role and with relatively low qualifications (i.e. whose competence was initially in doubt), asking questions indeed incurred a modest competence penalty. Interestingly, the penalty for asking questions was much lower than that for openly admitting ignorance (“I don’t know…”). Most importantly, however, any penalty for asking questions was largely counterbalanced by a boost in perceived humility. As a result, leaders who asked questions were rated as more trustworthy and participants were more willing to help – compared to those who sought the same information without using questions (like an invitation for input with tentative conclusions). Bosses whose excellent credentials largely eliminated ex-ante doubts about their competence received the same rewards for asking questions – but with no competence penalty attached. Relational humility Question-asking could be construed as just another way of admitting ignorance. So why do people respond far more positively to “Do you know…?” than “I don’t know”? We think that reframing knowledge gaps as curiosity signals what theorists call relational humility, i.e. a humble style that elevates others as opposed to lowering oneself. Relational humility means willingness to view oneself accurately – including observing gaps in personal knowledge, displaying appreciation of others’ strengths and contributions and being eager to learn from others. For leaders, greater relational humility is associated with increased leader effectiveness and translates into increased employee engagement and performance. Inquisitive leaders, then, reap interpersonal benefits over and above the information or solutions their questions are designed to elicit. Caveats to keep in mind These findings contradict the common assumption that the relationship-building benefits of asking questions will always be nullified by a decline in perceived competence. Rather, leaders who frequently ask questions before making decisions can strengthen their interpersonal relationships, while simultaneously improving problem-solving as well as leadership performance. However, they should also be aware of possible competence penalties arising from asking questions. In particular, women – and others whose atypical leadership profile may throw their competence into doubt – should ensure to establish their readiness for the role and ability to deliver before adopting a question-heavy leadership style. They should also communicate very clearly that they are the final decision-maker so that asking questions is not mistaken for a deflection of responsibility. Remember, however, that not all questions are worth asking. The “humble” questions included in our studies sincerely invoke the addressee’s unique expertise and insights. More self-serving types of questions – e.g. manipulative ones designed to extract a predetermined answer or lazy ones posed in lieu of doing one’s own homework – are unlikely to register as humble, and therefore may damage rather than boost your reputation as a leader. Making better decisions and building better relationships With these caveats in mind, leaders should not let concerns about seeming less competent prevent them from asking questions. Those who are well-established in their roles or who come with stellar credentials have the least to lose, according to our studies – putting questions to employees won’t damage their standing in the slightest. But the “When in doubt, ask questions” rule of thumb holds true for less secure leaders too. Any moderate competence penalties they may suffer are likely to be balanced out by an increase in the quality of their working relationships. Consider question-asking a solid interpersonal investment that also allows you to make better decisions. Natalia Karelaia is an Associate Professor of Decision Sciences at INSEAD. Don’t miss our latest content. Download the free INSEAD Knowledge app today. Follow INSEAD Knowledge on Twitter and Facebook.
[ 464, 8661, 3303, 286, 5531, 318, 31394, 3812, 14615, 290, 1527, 29808, 2138, 621, 14085, 13, 6430, 616, 2274, 2267, 7228, 326, 784, 10388, 284, 2968, 4901, 784, 2766, 508, 16231, 1265, 2683, 1716, 517, 18409, 287, 511, 9176, 13, 198, 198, 6943, 2766, 1975, 262, 6697, 13, 1119, 892, 511, 2683, 13935, 257, 3092, 286, 3725, 326, 714, 5298, 17188, 546, 511, 31450, 13, 2893, 407, 1464, 35212, 11, 326, 318, 691, 636, 286, 257, 517, 3716, 4286, 11, 355, 616, 763, 12, 9800, 5686, 1437, 1766, 73, 7456, 918, 1073, 286, 262, 2059, 286, 38805, 290, 314, 4727, 287, 257, 21220, 3348, 287, 7221, 22684, 20181, 290, 5524, 26423, 10854, 274, 13, 198, 198, 5195, 2766, 836, 447, 247, 83, 1265, 2683, 198, 198, 5122, 717, 2050, 11, 257, 5526, 5668, 416, 39882, 11663, 11, 1043, 326, 691, 2808, 1411, 286, 6809, 1965, 2683, 355, 1690, 355, 484, 714, 13, 4424, 6819, 11, 262, 11663, 635, 2098, 326, 4737, 2683, 373, 257, 1049, 835, 284, 44055, 3774, 11, 5128, 290, 1037, 784, 355, 880, 355, 284, 3359, 34935, 13, 2102, 11, 484, 547, 881, 1342, 16915, 546, 703, 852, 7949, 271, 1800, 743, 2689, 703, 19701, 257, 3554, 318, 11067, 284, 307, 13, 198, 198, 1858, 447, 247, 82, 262, 6437, 13, 383, 5585, 286, 31450, 743, 1656, 523, 1593, 326, 340, 625, 1477, 9797, 584, 4688, 5087, 286, 257, 3554, 447, 247, 82, 1943, 884, 355, 3774, 11, 11113, 422, 4409, 11, 3503, 13, 632, 318, 407, 6452, 11, 788, 11, 326, 2766, 389, 23300, 286, 4737, 2683, 13, 198, 198, 1135, 18814, 284, 9161, 1771, 428, 4633, 16096, 1022, 1808, 12, 30463, 290, 11067, 31450, 1682, 11196, 13, 554, 1440, 8840, 3640, 11, 6809, 18774, 832, 6186, 447, 247, 82, 19663, 8484, 3859, 1100, 1180, 6300, 286, 13858, 27561, 17317, 2035, 4737, 2683, 11, 13630, 13242, 393, 22688, 326, 484, 1422, 447, 247, 83, 760, 1223, 13, 1119, 788, 13178, 262, 6478, 447, 247, 82, 11067, 31450, 11, 34935, 290, 3774, 48756, 355, 880, 355, 511, 898, 36793, 284, 1037, 262, 6478, 11, 1912, 319, 262, 1321, 287, 262, 8883, 13, 198, 198, 1135, 1043, 326, 329, 262, 25345, 17317, 508, 547, 3417, 355, 649, 287, 511, 2597, 290, 351, 5365, 1877, 24751, 357, 72, 13, 68, 13, 3025, 31450, 373, 7317, 287, 4719, 828, 4737, 2683, 5600, 23436, 257, 12949, 31450, 7389, 13, 25044, 11, 262, 7389, 329, 4737, 2683, 373, 881, 2793, 621, 326, 329, 11764, 22688, 17010, 357, 447, 250, 40, 836, 447, 247, 83, 760, 1399, 447, 251, 737, 4042, 11003, 11, 2158, 11, 597, 7389, 329, 4737, 2683, 373, 5688, 3753, 27753, 416, 257, 5750, 287, 11067, 34935, 13, 1081, 257, 1255, 11, 2766, 508, 1965, 2683, 547, 13178, 355, 517, 34412, 290, 6809, 547, 517, 4684, 284, 1037, 784, 3688, 284, 883, 508, 7194, 262, 976, 1321, 1231, 1262, 2683, 357, 2339, 281, 17023, 329, 5128, 351, 38358, 13242, 737, 198, 198, 37310, 274, 3025, 6275, 18031, 5688, 15254, 409, 12, 12427, 17188, 546, 511, 31450, 2722, 262, 976, 11530, 329, 4737, 2683, 784, 475, 351, 645, 31450, 7389, 7223, 13, 198, 198, 6892, 864, 34935, 198, 198, 24361, 12, 30463, 714, 307, 30816, 355, 655, 1194, 835, 286, 22688, 17010, 13, 1406, 1521, 466, 661, 3031, 1290, 517, 19888, 284, 564, 250, 5211, 345, 760, 1399, 30, 447, 251, 621, 564, 250, 40, 836, 447, 247, 83, 760, 447, 251, 30, 775, 892, 326, 1006, 859, 278, 3725, 17332, 355, 20136, 10425, 644, 33142, 869, 50126, 34935, 11, 1312, 13, 68, 13, 257, 19695, 3918, 326, 7662, 689, 1854, 355, 6886, 284, 21683, 27186, 13, 4718, 864, 34935, 1724, 16826, 284, 1570, 27186, 14351, 784, 1390, 21769, 17332, 287, 2614, 3725, 11, 19407, 19163, 286, 1854, 447, 247, 18929, 290, 9284, 290, 852, 11069, 284, 2193, 422, 1854, 13, 1114, 2766, 11, 3744, 50126, 34935, 318, 3917, 351, 3220, 3554, 13530, 290, 23677, 656, 3220, 6538, 12352, 290, 2854, 13, 198, 198, 818, 421, 271, 1800, 2766, 11, 788, 11, 35860, 43146, 4034, 625, 290, 2029, 262, 1321, 393, 8136, 511, 2683, 389, 3562, 284, 44055, 13, 198, 198, 34, 1015, 1381, 284, 1394, 287, 2000, 198, 198, 4711, 6373, 18372, 262, 2219, 13196, 326, 262, 2776, 12, 16894, 4034, 286, 4737, 2683, 481, 1464, 307, 9242, 1431, 416, 257, 7794, 287, 11067, 31450, 13, 11317, 11, 2766, 508, 6777, 1265, 2683, 878, 1642, 5370, 460, 12160, 511, 43146, 6958, 11, 981, 11640, 10068, 1917, 12, 82, 10890, 355, 880, 355, 5531, 2854, 13, 198, 198, 4864, 11, 484, 815, 635, 307, 3910, 286, 1744, 31450, 12970, 21539, 422, 4737, 2683, 13, 554, 1948, 11, 1466, 784, 290, 1854, 3025, 379, 4464, 605, 5531, 7034, 743, 3714, 511, 31450, 656, 4719, 784, 815, 4155, 284, 4474, 511, 30618, 329, 262, 2597, 290, 2694, 284, 5203, 878, 22868, 257, 1808, 12, 23701, 5531, 3918, 13, 1119, 815, 635, 10996, 845, 4084, 326, 484, 389, 262, 2457, 2551, 12, 10297, 523, 326, 4737, 2683, 318, 407, 16011, 329, 257, 825, 1564, 286, 5798, 13, 198, 198, 16676, 11, 2158, 11, 326, 407, 477, 2683, 389, 2861, 4737, 13, 383, 564, 250, 71, 10344, 447, 251, 2683, 3017, 287, 674, 3640, 29093, 26342, 262, 751, 411, 3826, 447, 247, 82, 3748, 13572, 290, 17218, 13, 3125, 2116, 12, 31293, 3858, 286, 2683, 784, 304, 13, 70, 13, 47859, 3392, 3562, 284, 7925, 257, 45574, 3280, 393, 16931, 3392, 15459, 287, 32267, 286, 1804, 530, 447, 247, 82, 898, 26131, 784, 389, 7485, 284, 7881, 355, 19695, 11, 290, 4361, 743, 2465, 2138, 621, 5750, 534, 8507, 355, 257, 3554, 13, 198, 198, 23874, 1365, 5370, 290, 2615, 1365, 6958, 198, 198, 3152, 777, 47155, 287, 2000, 11, 2766, 815, 407, 1309, 4786, 546, 31792, 1342, 19701, 2948, 606, 422, 4737, 2683, 13, 5845, 508, 389, 880, 12, 27718, 287, 511, 9176, 393, 508, 1282, 351, 25041, 18031, 423, 262, 1551, 284, 4425, 11, 1864, 284, 674, 3640, 784, 5137, 2683, 284, 4409, 1839, 447, 247, 83, 2465, 511, 5055, 287, 262, 24917, 13, 887, 262, 564, 250, 2215, 287, 4719, 11, 1265, 2683, 447, 251, 3896 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
This pattern is what we call the progress principle: of all the positive events that influence inner work life, the single most powerful is progress in meaningful work; of all the negative events, the single most powerful is the opposite of progress—setbacks in the work. We consider this to be a fundamental management principle: facilitating progress is the most effective way for managers to influence inner work life. Even when progress happens in small steps, a person’s sense of steady forward movement toward an important goal can make all the difference between a great day and a terrible one. This pattern became increasingly obvious as the diaries came in from all the teams in our study. People’s inner work lives seemed to lift or drag depending on whether or not their projects moved forward, even by small increments. Small wins often had a surprisingly strong positive effect, and small losses a surprisingly strong negative one. We tested our impressions more rigorously in two ways. Each confirmed the power of progress to dominate inner work life. And this can spur innovation: On days when people have made real progress in work that matters to them, they end the day feeling more intrinsically motivated—turned by their interest in and enjoyment of the work. There’s plenty of research showing that, when people are more intrinsically motivated, they are more likely to be creative. This means that when your subordinates have pulled off a real accomplishment, they may be more open to new, challenging work that calls for creativity. In other words, they should be particularly eager to take on vexing problems and find creative solutions following days of notable progress.
[ 1212, 3912, 318, 644, 356, 869, 262, 4371, 7989, 25, 286, 477, 262, 3967, 2995, 326, 4588, 8434, 670, 1204, 11, 262, 2060, 749, 3665, 318, 4371, 287, 11570, 670, 26, 286, 477, 262, 4633, 2995, 11, 262, 2060, 749, 3665, 318, 262, 6697, 286, 4371, 960, 2617, 10146, 287, 262, 670, 13, 775, 2074, 428, 284, 307, 257, 7531, 4542, 7989, 25, 36045, 4371, 318, 262, 749, 4050, 835, 329, 11663, 284, 4588, 8434, 670, 1204, 13, 3412, 618, 4371, 4325, 287, 1402, 4831, 11, 257, 1048, 447, 247, 82, 2565, 286, 11831, 2651, 3356, 3812, 281, 1593, 3061, 460, 787, 477, 262, 3580, 1022, 257, 1049, 1110, 290, 257, 7818, 530, 13, 770, 3912, 2627, 6481, 3489, 355, 262, 2566, 3166, 1625, 287, 422, 477, 262, 3466, 287, 674, 2050, 13, 4380, 447, 247, 82, 8434, 670, 3160, 3947, 284, 10303, 393, 6715, 6906, 319, 1771, 393, 407, 511, 4493, 3888, 2651, 11, 772, 416, 1402, 41867, 13, 10452, 7864, 1690, 550, 257, 12362, 1913, 3967, 1245, 11, 290, 1402, 9089, 257, 12362, 1913, 4633, 530, 13, 775, 6789, 674, 25885, 517, 7805, 24882, 287, 734, 2842, 13, 5501, 4999, 262, 1176, 286, 4371, 284, 17863, 8434, 670, 1204, 13, 198, 198, 1870, 428, 460, 26724, 11044, 25, 198, 198, 2202, 1528, 618, 661, 423, 925, 1103, 4371, 287, 670, 326, 6067, 284, 606, 11, 484, 886, 262, 1110, 4203, 517, 48676, 13338, 960, 33886, 416, 511, 1393, 287, 290, 23334, 286, 262, 670, 13, 1318, 447, 247, 82, 6088, 286, 2267, 4478, 326, 11, 618, 661, 389, 517, 48676, 13338, 11, 484, 389, 517, 1884, 284, 307, 7325, 13, 770, 1724, 326, 618, 534, 45506, 423, 5954, 572, 257, 1103, 29340, 11, 484, 743, 307, 517, 1280, 284, 649, 11, 9389, 670, 326, 3848, 329, 16389, 13, 554, 584, 2456, 11, 484, 815, 307, 3573, 11069, 284, 1011, 319, 41548, 278, 2761, 290, 1064, 7325, 8136, 1708, 1528, 286, 12411, 4371, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
#!/bin/bash # WINDOWS PACKAGING SCRIPT FOR NAEV # Requires NSIS, and python3-pip to be installed # # This script should be run after compiling Naev # It detects the current environment, and builds the appropriate NSIS installer # into the root naev directory. # # Checks if argument(s) are valid if [[ $1 == "--nightly" ]]; then echo "Building for nightly release" NIGHTLY=true # Get Formatted Date BUILD_DATE="$(date +%m_%d_%Y)" elif [[ $1 == "" ]]; then echo "No arguments passed, assuming normal release" NIGHTLY=false elif [[ $1 != "--nightly" ]]; then echo "Please use argument --nightly if you are building this as a nightly build" exit -1 else echo "Something went wrong." exit -1 fi # Check if we are running in the right place if [[ ! -f "naev.6" ]]; then echo "Please run from Naev root directory." exit -1 fi # Rudementary way of detecting which environment we are packaging.. # It works, and it should remain working until msys changes their naming scheme if [[ $PATH == *"mingw32"* ]]; then echo "Detected MinGW32 environment" ARCH="32" elif [[ $PATH == *"mingw64"* ]]; then echo "Detected MinGW64 environment" ARCH="64" else echo "Welp, I don't know what environment this is... Make sure you are running this in an MSYS2 MinGW environment" exit -1 fi VERSION="$(cat $(pwd)/VERSION)" BETA=false # Get version, negative minors mean betas if [[ -n $(echo "$VERSION" | grep "-") ]]; then BASEVER=$(echo "$VERSION" | sed 's/\.-.*//') BETAVER=$(echo "$VERSION" | sed 's/.*-//') VERSION="$BASEVER.0-beta.$BETAVER" BETA=true else echo "could not find VERSION file" exit -1 fi # Download and Install mingw-ldd echo "Update pip" pip3 install --upgrade pip echo "Install mingw-ldd script" pip3 install mingw-ldd # Move compiled binary to staging folder. echo "creating staging area" mkdir -p extras/windows/installer/bin # Move data to staging folder echo "moving data to staging area" cp -r dat/ extras/windows/installer/bin cp AUTHORS extras/windows/installer/bin cp VERSION extras/windows/installer/bin # Collect DLLs if [[ $ARCH == "32" ]]; then for fn in `mingw-ldd naev.exe --dll-lookup-dirs /mingw32/bin | grep -i "mingw32" | cut -f1 -d"/" --complement`; do fp="/"$fn echo "copying $fp to staging area" cp $fp extras/windows/installer/bin done elif [[ $ARCH == "64" ]]; then for fn in `mingw-ldd naev.exe --dll-lookup-dirs /mingw64/bin | grep -i "mingw64" | cut -f1 -d"/" --complement`; do fp="/"$fn echo "copying $fp to staging area" cp $fp extras/windows/installer/bin done else echo "Aw, man, I shot Marvin in the face..." echo "Something went wrong while looking for DLLs to stage." exit -1 fi echo "copying naev binary to staging area" if [[ $NIGHTLY == true ]]; then cp src/naev.exe extras/windows/installer/bin/naev-$VERSION-$BUILD_DATE-win$ARCH.exe elif [[ $NIGHTLY == false ]]; then cp src/naev.exe extras/windows/installer/bin/naev-$VERSION-win$ARCH.exe else echo "Cannot think of another movie quote." echo "Something went wrong while copying binary to staging area." exit -1 fi # Create distribution folder echo "creating distribution folder" mkdir -p dist/release # Build installer if [[ $NIGHTLY == true ]]; then if [[ $BETA == true ]]; then makensis -DVERSION=$BASEVER.0 -DVERSION_SUFFIX=-beta.$BETAVER-$BUILD_DATE -DARCH=$ARCH extras/windows/installer/naev.nsi elif [[ $BETA == false ]]; then makensis -DVERSION=$VERSION -DVERSION_SUFFIX=-$BUILD_DATE -DARCH=$ARCH extras/windows/installer/naev.nsi else echo "Something went wrong determining if this is a beta or not." fi # Move installer to distribution directory mv extras/windows/installer/naev-$VERSION-$BUILD_DATE-win$ARCH.exe dist/release/naev-win$ARCH.exe elif [[ $NIGHTLY == false ]]; then if [[ $BETA == true ]]; then makensis -DVERSION=$BASEVER.0 -DVERSION_SUFFIX=-beta.$BETAVER -DARCH=$ARCH extras/windows/installer/naev.nsi elif [[ $BETA == false ]]; then makensis -DVERSION=$VERSION -DVERSION_SUFFIX= -DARCH=$ARCH extras/windows/installer/naev.nsi else echo "Something went wrong determining if this is a beta or not." fi # Move installer to distribution directory mv extras/windows/installer/naev-$VERSION-win$ARCH.exe dist/release/naev-win$ARCH.exe else echo "Cannot think of another movie quote.. again." echo "Something went wrong.." exit -1 fi echo "Successfully built Windows Installer for win$ARCH" # Package zip cd extras/windows/installer/bin zip ../../../../dist/release/naev-win$ARCH.zip *.dll *.exe cd ../../../../ echo "Successfully packaged zipped folder for win$ARCH" echo "Cleaning up staging area" rm -rf extras/windows/installer/bin
[ 2, 48443, 8800, 14, 41757, 198, 2, 370, 12115, 22845, 47035, 4760, 2751, 6374, 46023, 7473, 11746, 20114, 198, 2, 26848, 10896, 1797, 11, 290, 21015, 18, 12, 79, 541, 284, 307, 6589, 198, 2, 198, 2, 770, 4226, 815, 307, 1057, 706, 33393, 11013, 1990, 198, 2, 632, 39382, 262, 1459, 2858, 11, 290, 12188, 262, 5035, 10896, 1797, 29124, 198, 2, 656, 262, 6808, 12385, 1990, 8619, 13, 198, 2, 198, 198, 2, 47719, 611, 4578, 7, 82, 8, 389, 4938, 198, 198, 361, 16410, 720, 16, 6624, 366, 438, 3847, 306, 1, 2361, 11208, 788, 198, 220, 220, 220, 9809, 366, 25954, 329, 37862, 2650, 1, 198, 220, 220, 220, 37707, 11319, 28, 7942, 198, 220, 220, 220, 1303, 3497, 5178, 16898, 7536, 198, 220, 220, 220, 20571, 26761, 62, 35, 6158, 2625, 3, 7, 4475, 1343, 4, 76, 62, 4, 67, 62, 4, 56, 16725, 198, 417, 361, 16410, 720, 16, 6624, 13538, 2361, 11208, 788, 198, 220, 220, 220, 9809, 366, 2949, 7159, 3804, 11, 13148, 3487, 2650, 1, 198, 220, 220, 220, 37707, 11319, 28, 9562, 198, 417, 361, 16410, 720, 16, 14512, 366, 438, 3847, 306, 1, 2361, 11208, 788, 198, 220, 220, 220, 9809, 366, 5492, 779, 4578, 1377, 3847, 306, 611, 345, 389, 2615, 428, 355, 257, 37862, 1382, 1, 198, 220, 220, 220, 8420, 532, 16, 198, 17772, 198, 220, 220, 220, 9809, 366, 22210, 1816, 2642, 526, 198, 220, 220, 220, 8420, 532, 16, 198, 12463, 198, 198, 2, 6822, 611, 356, 389, 2491, 287, 262, 826, 1295, 198, 198, 361, 16410, 5145, 532, 69, 366, 2616, 1990, 13, 21, 1, 2361, 11208, 788, 198, 220, 220, 220, 9809, 366, 5492, 1057, 422, 11013, 1990, 6808, 8619, 526, 198, 220, 220, 220, 8420, 532, 16, 198, 12463, 198, 198, 2, 17421, 972, 560, 835, 286, 31521, 543, 2858, 356, 389, 16846, 492, 220, 198, 2, 632, 2499, 11, 290, 340, 815, 3520, 1762, 1566, 13845, 893, 2458, 511, 19264, 7791, 198, 198, 361, 16410, 720, 34219, 6624, 1635, 1, 2229, 86, 2624, 1, 9, 2361, 11208, 788, 198, 220, 220, 220, 9809, 366, 11242, 11197, 1855, 33191, 2624, 2858, 1, 198, 220, 220, 220, 5923, 3398, 2625, 2624, 1, 198, 417, 361, 16410, 720, 34219, 6624, 1635, 1, 2229, 86, 2414, 1, 9, 2361, 11208, 788, 198, 220, 220, 220, 9809, 366, 11242, 11197, 1855, 33191, 2414, 2858, 1, 198, 220, 220, 220, 5923, 3398, 2625, 2414, 1, 198, 17772, 198, 220, 220, 220, 9809, 366, 54, 417, 79, 11, 314, 836, 470, 760, 644, 2858, 428, 318, 986, 6889, 1654, 345, 389, 2491, 428, 287, 281, 6579, 16309, 17, 1855, 33191, 2858, 1, 198, 220, 220, 220, 8420, 532, 16, 198, 12463, 198, 198, 43717, 2625, 3, 7, 9246, 29568, 79, 16993, 20679, 43717, 16725, 198, 33, 20892, 28, 9562, 198, 2, 3497, 2196, 11, 4633, 21423, 1612, 731, 292, 198, 361, 16410, 532, 77, 29568, 30328, 17971, 43717, 1, 930, 42717, 27444, 4943, 2361, 11208, 788, 198, 220, 220, 220, 49688, 5959, 43641, 7, 30328, 17971, 43717, 1, 930, 10081, 705, 82, 14, 59, 7874, 15885, 1003, 11537, 198, 220, 220, 220, 347, 20892, 5959, 43641, 7, 30328, 17971, 43717, 1, 930, 10081, 705, 82, 11757, 9, 12, 1003, 11537, 198, 220, 220, 220, 44156, 2849, 2625, 3, 33, 11159, 5959, 13, 15, 12, 31361, 48082, 33, 20892, 5959, 1, 198, 220, 220, 220, 347, 20892, 28, 7942, 198, 17772, 198, 220, 220, 220, 9809, 366, 24089, 407, 1064, 44156, 2849, 2393, 1, 198, 220, 220, 220, 8420, 532, 16, 198, 12463, 198, 198, 2, 10472, 290, 15545, 42434, 86, 12, 335, 67, 198, 198, 30328, 366, 10260, 7347, 1, 198, 79, 541, 18, 2721, 1377, 929, 9526, 7347, 198, 198, 30328, 366, 15798, 42434, 86, 12, 335, 67, 4226, 1, 198, 79, 541, 18, 2721, 42434, 86, 12, 335, 67, 198, 198, 2, 10028, 14102, 13934, 284, 29475, 9483, 13, 198, 198, 30328, 366, 20123, 278, 29475, 1989, 1, 198, 28015, 15908, 532, 79, 33849, 14, 28457, 14, 17350, 263, 14, 8800, 198, 198, 2, 10028, 1366, 284, 29475, 9483, 198, 30328, 366, 31462, 1366, 284, 29475, 1989, 1, 198, 13155, 532, 81, 4818, 14, 33849, 14, 28457, 14, 17350, 263, 14, 8800, 198, 13155, 37195, 20673, 33849, 14, 28457, 14, 17350, 263, 14, 8800, 198, 13155, 44156, 2849, 33849, 14, 28457, 14, 17350, 263, 14, 8800, 198, 198, 2, 9745, 360, 3069, 82, 198, 220, 198, 361, 16410, 720, 31315, 6624, 366, 2624, 1, 2361, 11208, 788, 198, 1640, 24714, 287, 4600, 2229, 86, 12, 335, 67, 12385, 1990, 13, 13499, 1377, 12736, 12, 5460, 929, 12, 15908, 82, 1220, 2229, 86, 2624, 14, 8800, 930, 42717, 532, 72, 366, 2229, 86, 2624, 1, 930, 2005, 532, 69, 16, 532, 67, 1, 30487, 1377, 785, 26908, 63, 26, 466, 198, 220, 220, 220, 277, 79, 2625, 30487, 3, 22184, 198, 220, 220, 220, 9809, 366, 22163, 1112, 720, 46428, 284, 29475, 1989, 1, 198, 220, 220, 220, 31396, 720, 46428, 33849, 14, 28457, 14, 17350, 263, 14, 8800, 198, 28060, 198, 417, 361, 16410, 720, 31315, 6624, 366, 2414, 1, 2361, 11208, 788, 198, 1640, 24714, 287, 4600, 2229, 86, 12, 335, 67, 12385, 1990, 13, 13499, 1377, 12736, 12, 5460, 929, 12, 15908, 82, 1220, 2229, 86, 2414, 14, 8800, 930, 42717, 532, 72, 366, 2229, 86, 2414, 1, 930, 2005, 532, 69, 16, 532, 67, 1, 30487, 1377, 785, 26908, 63, 26, 466, 198, 220, 220, 220, 277, 79, 2625, 30487, 3, 22184, 198, 220, 220, 220, 9809, 366, 22163, 1112, 720, 46428, 284, 29475, 1989, 1, 198, 220, 220, 220, 31396, 720, 46428, 33849, 14, 28457, 14, 17350, 263, 14, 8800, 198, 28060, 198, 17772, 198, 220, 220, 220, 9809, 366, 23155, 11, 582, 11, 314, 2823, 35105, 287, 262, 1986, 9313, 198, 220, 220, 220, 9809, 366, 22210, 1816, 2642, 981, 2045, 329, 360, 3069, 82, 284, 3800, 526, 198, 220, 220, 220, 8420, 532, 16, 198, 12463, 198, 198, 30328, 366, 22163, 1112, 12385, 1990, 13934, 284, 29475, 1989, 1, 198, 361, 16410, 720, 45, 9947, 11319, 6624, 2081, 2361, 11208, 788, 198, 13155 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Demographics near Evesham Twp, NJ Evesham Twp is located in New Jersey. Evesham Twp, New Jersey has a population of22,990. The median household income in Evesham Twp, New Jersey is $78,523. The median household income for the surrounding county is $68,620 compared to the national median of $49,877. The median age of people living in Evesham Twp is 42.1 years. Evesham Twp Weather The average high temperature in July is 87.8 degrees, with an average low temperature in January of 23.2 degrees. The annual precipitation is 48.25.
[ 11522, 24188, 1474, 412, 1158, 2763, 1815, 79, 11, 18732, 198, 198, 36, 1158, 2763, 1815, 79, 318, 5140, 287, 968, 8221, 13, 198, 36, 1158, 2763, 1815, 79, 11, 968, 8221, 468, 257, 3265, 286, 1828, 11, 34155, 13, 198, 198, 464, 14288, 6641, 3739, 287, 412, 1158, 2763, 1815, 79, 11, 968, 8221, 318, 198, 3, 3695, 11, 49803, 13, 198, 464, 14288, 6641, 3739, 329, 262, 7346, 7968, 318, 720, 3104, 11, 38850, 198, 5589, 1144, 284, 262, 2260, 14288, 286, 720, 2920, 11, 42802, 13, 198, 464, 14288, 2479, 286, 661, 2877, 287, 412, 1158, 2763, 1815, 79, 318, 198, 3682, 13, 16, 812, 13, 198, 198, 36, 1158, 2763, 1815, 79, 15615, 198, 198, 464, 2811, 1029, 5951, 287, 2901, 318, 10083, 13, 23, 198, 13500, 6037, 11, 351, 281, 2811, 1877, 5951, 287, 3269, 286, 2242, 13, 17, 7370, 13, 198, 464, 5079, 32025, 318, 198, 2780, 13, 1495, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
23:30, 15 December 2009 206.169.172.212@enwiki (talk | contribs | logs) edited Orly Taitz(Removed reference to media outlets calling her "cross between Joan of Arc and Paul Revere" since the article referenced clearly states that "Some within the birther movement consider her to be ...")
[ 1954, 25, 1270, 11, 1315, 3426, 3717, 27253, 13, 22172, 13, 23628, 13, 21777, 31, 268, 15466, 357, 16620, 930, 542, 822, 82, 930, 17259, 8, 13012, 1471, 306, 11940, 4224, 7, 45975, 4941, 284, 2056, 12527, 4585, 607, 366, 19692, 1022, 26640, 286, 10173, 290, 3362, 797, 4119, 1, 1201, 262, 2708, 20717, 4084, 2585, 326, 366, 4366, 1626, 262, 35122, 490, 3356, 2074, 607, 284, 307, 35713, 8 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Subscribe to the Little, Brown newsletter First name: Email address: The books featured on this site are aimed primarily at readers aged 13 or above and therefore you must be 13 years or over to sign up to our newsletter. Please tick this box to indicate that you’re 13 or over. Sign up to the Little, Brown newsletter for news of upcoming publications, competitions and updates from our authors. From time to time we may contact you with surveys so that we can get to know you better. The Essential Air Fryer Cookbook by Bruce Weinstein With more than 7 million sold in America, air fryers are the next Instant Pot: the new hot kitchen appliance home cooks have to have–and Bruce Weinstein and Mark Scarbrough are here to help you make the most of it. Initially conceived as a way of producing crispy “fried” foods with half the calories and fat, the air fryer is more than just a diet trick. It’s also the best, easiest way to cook with the power of a commercial convection oven at home, producing the crispiest roasted vegetables, perfectly-cooked chicken with crunchy skin, and, yes, the most delicious french fries you’ll ever make without digging out a deep fryer. With more than 300 delicious, unpretentious, and totally customisable recipes for everything from entire meals cooked inside the air fryer to party snacks, healthy sides, and delicious desserts, this book will be the go-to resource for this year’s hottest home cooking appliance.
[ 27125, 284, 262, 7703, 11, 4373, 13129, 198, 198, 5962, 1438, 25, 198, 198, 15333, 2209, 25, 198, 198, 464, 3835, 8096, 319, 428, 2524, 389, 8998, 7525, 379, 7183, 9722, 1511, 393, 2029, 290, 4361, 345, 1276, 307, 1511, 812, 393, 625, 284, 1051, 510, 284, 674, 13129, 13, 4222, 4378, 428, 3091, 284, 7603, 326, 345, 447, 247, 260, 1511, 393, 625, 13, 198, 198, 11712, 510, 284, 262, 7703, 11, 4373, 13129, 329, 1705, 286, 7865, 16125, 11, 24174, 290, 5992, 422, 674, 7035, 13, 3574, 640, 284, 640, 356, 743, 2800, 345, 351, 16255, 523, 326, 356, 460, 651, 284, 760, 345, 1365, 13, 198, 198, 464, 36294, 3701, 25305, 263, 8261, 2070, 198, 198, 1525, 11088, 22473, 198, 198, 3152, 517, 621, 767, 1510, 2702, 287, 2253, 11, 1633, 32959, 364, 389, 262, 1306, 24470, 6902, 25, 262, 649, 3024, 9592, 45248, 1363, 38383, 423, 284, 423, 1906, 392, 11088, 22473, 290, 2940, 12089, 65, 740, 389, 994, 284, 1037, 345, 787, 262, 749, 286, 340, 13, 198, 198, 40443, 21581, 355, 257, 835, 286, 9194, 42807, 564, 250, 25520, 447, 251, 9013, 351, 2063, 262, 14653, 290, 3735, 11, 262, 1633, 32959, 263, 318, 517, 621, 655, 257, 5496, 6908, 13, 632, 447, 247, 82, 635, 262, 1266, 11, 16638, 835, 284, 4255, 351, 262, 1176, 286, 257, 5068, 24748, 596, 14361, 379, 1363, 11, 9194, 262, 23453, 6386, 30490, 13701, 11, 7138, 12, 46591, 9015, 351, 23527, 88, 4168, 11, 290, 11, 3763, 11, 262, 749, 12625, 48718, 31757, 345, 447, 247, 297, 1683, 787, 1231, 18894, 503, 257, 2769, 32959, 263, 13, 198, 198, 3152, 517, 621, 5867, 12625, 11, 555, 5310, 43787, 11, 290, 6635, 2183, 43942, 14296, 329, 2279, 422, 2104, 13840, 15847, 2641, 262, 1633, 32959, 263, 284, 2151, 28487, 11, 5448, 5389, 11, 290, 12625, 47950, 11, 428, 1492, 481, 307, 262, 467, 12, 1462, 8271, 329, 428, 614, 447, 247, 82, 26896, 1363, 10801, 45248, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Home > US 10-year Treasury yields are flat to down slightly; NZD has ended up one of the better performers as short-positions were likely pared; the weaker USD since this time yesterday likely reflects a reduction in long positioning US 10-year Treasury yields are flat to down slightly; NZD has ended up one of the better performers as short-positions were likely pared; the weaker USD since this time yesterday likely reflects a reduction in long positioning Following yesterday’s rout in global equities a risk-off tone remains evident, with the S&P500 making further losses overnight, while US 10-year Treasury yields are flat to down slightly. Despite the fall in risk appetite, the NZD has ended up one of the better performers as short-positions were likely pared. After we went to print yesterday, US equities lunged further into negative territory and this spilled over into global markets, with NZ’s high-flying equity market ending down a chunky 3.6%. No single trigger can adequately explain the sudden plunge in equity markets but a number of factors can be pointed at, including US rates having reached a tipping point late into the cycle, worries about the impact of higher oil prices, escalating US-China tensions (not just on trade but at a military level as well), an over-valued tech sector and allegations of Chinese chip-makers including devices in products to spy on their overseas customers, to name a few. Overnight, President Trump blamed the Fed for the market rout saying “The Fed is out of control…I think what they’re doing is wrong”, but adding that he wasn’t going to fire Fed Chair Powell. This followed his comments yesterday that the Fed has gone crazy and was making a mistake. The S&P500 has spent most of the session so far in negative territory, down as much as 1½% recently and currently down about 1%, to sit just below its 200-day moving average. Earlier in the year the index broke down through that technical indicator a number of times but not for very long and recovered each time. Another lurch lower could well feed on itself, while a bounce would get the buy-the-dip brigade back into action, so we’re currently at an interesting juncture. Of some relief, US CPI inflation was lower than expected for the second month in a row, with the annual core measure staying steady at 2.2% y/y. The market still thinks another rate hike is likely in December as the tighter labour market forewarns future inflationary pressure, but the softer inflation data supports the Fed’s gradual approach to raising rates. In other news, Dow Jones reported that President Trump is going to meet with his Chinese counterpart Xi at the G20 meeting next month. Later, Larry Kudlow told reporters he "can't officially" confirm Trump and Xi are planning to meet, saying only it's under discussion. US Treasury yields have settled in a 3.14-3.19% range since the open of the Asian trading session, following the 8bps decline in late NY trading yesterday. Despite the softer inflation data, the 2-year rate shows some upward drift and is up 2bps from the NZ close compared to the flat 10-year rate. The market is taking the view that equity markets would have to show a much larger downward correction to sway the Fed from its gradual tightening path. In currency markets, the NZD has outperformed despite the weaker risk appetite environment and has blasted up over 1% through the 0.65 mark and is higher on all the crosses. While this is unusual, in a big risk-off event the natural behaviour of traders is to shut down or reduce positions. Positioning in the NZD has been significantly short – the greatest on record according to CFTC data for non-commercial positions in the futures market – so NZD strength at a time like this suggests some short covering. Indeed, currency movements over the past 24 hours or so tells us a lot about positioning. The AUD has also outperformed but not to the extent of the NZD. The AUD has blasted up through 0.71, while NZD/AUD is up to 0.9160. With positioning a key factor behind the moves we wouldn’t read too much into them or want to extrapolate the move too far into the future. The weaker USD since this time yesterday likely reflects a reduction in long positioning, although Trump’s outburst against the Fed and the softer CPI data haven’t helped either. USD indices are down around 0.4-0.5% for the day. EUR is up 0.6% to 1.1590 while GBP is flat around the 1.32 mark. Brexit headlines remain confusing and conflicting. Italy remains a focus for the market and rates are modestly higher there ahead of Italy submitting its Budget. EU economy chief Moscovici said he’ll try to bring Italy “closer” to EU spending rules in negotiations over the country’s 2019 budget. Finally, oil prices have retreated again. Alongside data showing some inventory build, OPEC cut its estimate for global demand for its crude next year by 900k barrels per day due to weakening economic growth and higher output from rivals, notably US shale drillers. Brent crude is down 3% to $80.60 and well down from the $86.70 peak of mid-last week.
[ 16060, 1875, 1294, 838, 12, 1941, 13419, 19299, 389, 6228, 284, 866, 4622, 26, 26905, 35, 468, 4444, 510, 530, 286, 262, 1365, 23827, 355, 1790, 12, 1930, 1756, 547, 1884, 279, 1144, 26, 262, 17642, 11403, 1201, 428, 640, 7415, 1884, 12497, 257, 7741, 287, 890, 22097, 198, 198, 2937, 838, 12, 1941, 13419, 19299, 389, 6228, 284, 866, 4622, 26, 26905, 35, 468, 4444, 510, 530, 286, 262, 1365, 23827, 355, 1790, 12, 1930, 1756, 547, 1884, 279, 1144, 26, 262, 17642, 11403, 1201, 428, 640, 7415, 1884, 12497, 257, 7741, 287, 890, 22097, 198, 198, 14291, 7415, 447, 247, 82, 3441, 287, 3298, 1602, 871, 257, 2526, 12, 2364, 8216, 3793, 10678, 11, 351, 262, 311, 5, 47, 4059, 1642, 2252, 9089, 13417, 11, 981, 1294, 838, 12, 1941, 13419, 19299, 389, 6228, 284, 866, 4622, 13, 7945, 262, 2121, 287, 2526, 20788, 11, 262, 26905, 35, 468, 4444, 510, 530, 286, 262, 1365, 23827, 355, 1790, 12, 1930, 1756, 547, 1884, 279, 1144, 13, 198, 198, 3260, 356, 1816, 284, 3601, 7415, 11, 1294, 1602, 871, 14678, 2004, 2252, 656, 4633, 7674, 290, 428, 31896, 625, 656, 3298, 5939, 11, 351, 26905, 447, 247, 82, 1029, 12, 45928, 13598, 1910, 7464, 866, 257, 442, 28898, 513, 13, 21, 7225, 1400, 2060, 7616, 460, 22668, 4727, 262, 4802, 32669, 287, 13598, 5939, 475, 257, 1271, 286, 5087, 460, 307, 6235, 379, 11, 1390, 1294, 3965, 1719, 4251, 257, 31639, 966, 2739, 656, 262, 6772, 11, 18572, 546, 262, 2928, 286, 2440, 3056, 4536, 11, 32206, 1294, 12, 14581, 15733, 357, 1662, 655, 319, 3292, 475, 379, 257, 2422, 1241, 355, 880, 828, 281, 625, 12, 39728, 7261, 6567, 290, 7636, 286, 3999, 11594, 12, 6620, 1390, 4410, 287, 3186, 284, 13997, 319, 511, 11292, 4297, 11, 284, 1438, 257, 1178, 13, 198, 198, 46, 47443, 11, 1992, 1301, 13772, 262, 10169, 329, 262, 1910, 3441, 2282, 564, 250, 464, 10169, 318, 503, 286, 1630, 1399, 40, 892, 644, 484, 447, 247, 260, 1804, 318, 2642, 447, 251, 11, 475, 4375, 326, 339, 2492, 447, 247, 83, 1016, 284, 2046, 10169, 9369, 19675, 13, 770, 3940, 465, 3651, 7415, 326, 262, 10169, 468, 3750, 7165, 290, 373, 1642, 257, 7457, 13, 198, 198, 464, 311, 5, 47, 4059, 468, 3377, 749, 286, 262, 6246, 523, 1290, 287, 4633, 7674, 11, 866, 355, 881, 355, 352, 23141, 4, 2904, 290, 3058, 866, 546, 352, 7441, 284, 1650, 655, 2174, 663, 939, 12, 820, 3867, 2811, 13, 20635, 287, 262, 614, 262, 6376, 6265, 866, 832, 326, 6276, 16916, 257, 1271, 286, 1661, 475, 407, 329, 845, 890, 290, 11911, 1123, 640, 13, 6023, 300, 2575, 2793, 714, 880, 3745, 319, 2346, 11, 981, 257, 20110, 561, 651, 262, 2822, 12, 1169, 12, 67, 541, 35889, 736, 656, 2223, 11, 523, 356, 447, 247, 260, 3058, 379, 281, 3499, 10891, 48715, 13, 198, 198, 5189, 617, 8259, 11, 1294, 42103, 10610, 373, 2793, 621, 2938, 329, 262, 1218, 1227, 287, 257, 5752, 11, 351, 262, 5079, 4755, 3953, 10589, 11831, 379, 362, 13, 17, 4, 331, 14, 88, 13, 383, 1910, 991, 6834, 1194, 2494, 18390, 318, 1884, 287, 3426, 355, 262, 28619, 10515, 1910, 1674, 40539, 82, 2003, 10610, 560, 3833, 11, 475, 262, 32359, 10610, 1366, 6971, 262, 10169, 447, 247, 82, 24972, 3164, 284, 8620, 3965, 13, 198, 198, 818, 584, 1705, 11, 21842, 5437, 2098, 326, 1992, 1301, 318, 1016, 284, 1826, 351, 465, 3999, 11283, 21313, 379, 262, 402, 1238, 3249, 1306, 1227, 13, 11450, 11, 13633, 509, 463, 9319, 1297, 7638, 339, 366, 5171, 470, 8720, 1, 6216, 1301, 290, 21313, 389, 5410, 284, 1826, 11, 2282, 691, 340, 338, 739, 5114, 13, 198, 198, 2937, 13419, 19299, 423, 10282, 287, 257, 513, 13, 1415, 12, 18, 13, 1129, 4, 2837, 1201, 262, 1280, 286, 262, 7740, 7313, 6246, 11, 1708, 262, 807, 18799, 7794, 287, 2739, 6645, 7313, 7415, 13, 7945, 262, 32359, 10610, 1366, 11, 262, 362, 12, 1941, 2494, 2523, 617, 18644, 24260, 290, 318, 510, 362, 18799, 422, 262, 26905, 1969, 3688, 284, 262, 6228, 838, 12, 1941, 2494, 13, 383, 1910, 318, 2263, 262, 1570, 326, 13598, 5939, 561, 423, 284, 905, 257, 881, 4025, 20841, 17137, 284, 20009, 262, 10169, 422, 663, 24972, 36040, 3108, 13, 198, 198, 818, 7395, 5939, 11, 262, 26905, 35, 468, 33597, 12214, 3805, 262, 17642, 2526, 20788, 2858, 290, 468, 26044, 510, 625, 352, 4, 832, 262, 657, 13, 2996, 1317, 290, 318, 2440, 319, 477, 262, 24234, 13, 2893, 428, 318, 8468, 11, 287, 257, 1263, 2526, 12, 2364, 1785, 262, 3288, 9172, 286, 21703, 318, 284, 4423, 866, 393, 4646, 6116, 13, 23158, 278, 287, 262, 26905, 35, 468, 587, 5566, 1790, 784, 262, 6000, 319, 1700, 1864, 284, 18551, 4825, 1366, 329, 1729, 12, 36313, 6116, 287, 262, 25650, 1910, 784, 523, 26905, 35, 4202, 379, 257, 640, 588, 428, 5644, 617, 1790, 9505, 13, 9676, 11, 7395, 8650, 625, 262, 1613, 1987, 2250, 393, 523, 4952, 514, 257, 1256, 546, 22097, 13, 383, 41260, 468, 635, 33597, 12214, 475, 407, 284, 262, 6287, 286, 262, 26905, 35, 13, 383, 41260, 468, 26044, 510, 832, 657, 13, 4869, 11, 981, 26905, 35, 14, 48877, 318, 510, 284, 657, 13, 24, 14198, 13, 2080, 22097, 257, 1994, 5766, 2157, 262, 6100, 356, 3636, 447, 247, 83, 1100, 1165, 881, 656, 606, 393, 765, 284, 36804, 27976, 262, 1445, 1165, 1290, 656, 262, 2003, 13, 198, 198, 464, 17642, 11403, 1201, 428, 640, 7415, 1884, 12497, 257, 7741, 287, 890, 22097, 11, 3584, 1301, 447, 247, 82, 49088, 1028, 262, 10169, 290, 262, 32359, 42103, 1366, 4398, 447, 247, 83, 4193, 2035, 13, 11403, 36525, 389, 866, 1088, 657, 13, 19, 12, 15, 13, 20, 4, 329, 262, 1110, 13, 27526, 318, 510, 657, 13, 21, 4, 284, 352, 13, 1314, 3829, 981, 13124, 47, 318, 6228, 1088, 262, 352, 13, 2624, 1317, 13, 11435, 14408, 3520, 15337, 290, 24916, 13, 8031, 3793, 257, 2962, 329, 262, 1910, 290, 3965, 389, 12949, 306, 2440, 612, 4058, 286, 8031, 24353, 663, 15401, 13, 4576, 3773, 4039 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Settler Theology & Israel's Future Over the years, the West Bank olive harvest has become an annual low-level battle, with settlers stealing from and ravaging Palestinian groves and with outpost settlers as prime suspects. But finding these ideas printed in a glossy manifesto, starkly presented as religious principles, was more than I'd expected.
[ 50, 3087, 1754, 383, 1435, 1222, 2692, 338, 10898, 198, 198, 5886, 262, 812, 11, 262, 2688, 5018, 19450, 13222, 468, 1716, 281, 5079, 1877, 12, 5715, 3344, 11, 351, 25371, 16568, 422, 290, 24343, 3039, 8501, 7128, 1158, 290, 351, 38327, 25371, 355, 6994, 11826, 13, 887, 4917, 777, 4213, 10398, 287, 257, 40551, 29960, 11, 19278, 306, 5545, 355, 4158, 7811, 11, 373, 517, 621, 314, 1549, 2938, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Please enable Javascript to play this video properly. If you're using NoScript, please whitelist these domains: vid.me, viddme.blob.core.windows.net, d3d22t4ev2lc8b.cloudfront.net, and d1kjvq24a07es4.cloudfront.net If you're viewing this inside an app with Javascript disabled, follow this link to watch the video: https://vid.me/tiy4 World of final fantasy - The five Cogna lords Port Besaid & Nibelheim Ep80 In the main story we need to face the five Cogna lords that are currently running rampant across the world of Grymoire. Firstly we tackle the Cogna residing in Port Besaid which is a very easy airborne enemy but the one afterwards in Nibelheim was not so easy! He did look awesome though :D World of Final Fantasy is a role-playing video game which utilizes a turn-based battle system. It is is primarily set in the world of Grymoire, a land populated by classic Final Fantasy characters and monsters from across the series, while being unconnected to any other series entry. Lann and Reynn suffer from amnesia and hold the power in one of their arms to capture and wield Mirages, the monsters of Grymoire. They travel to Grymoire to recover their memories. Donate on Patreon to improve the content of my channel: https://www.patreon.com/user?u=4377549 Hungry for more final fantasy content? Check out my playlist for Final Fantasy XIV: https://www.youtube.com/playlist?list=PLCiuXKb2dSVrQo5HnSEFESvJYeedValQb Follow me on Twitter! (^ _ ^) Twitter: https://twitter.com/MissMulti?lang=en-gb ----------------------------------------­------------------------------------------------- A big thank you to my Patreons of May 2017!! - Bastion - Just2Game - https://www.youtube.com/channel/UCLTUNzgYHoK1nnGPp-_1vpg - Vult Avos - https://www.youtube.com/channel/UCyGf12y2EDAvtr-bc-s5nhA - Skwalker - https://www.youtube.com/channel/UCk4T-qN3lLFqGh8ck8AX9cQ ----------------------------------------­------------------------------------------------- Copyright free music included in this video: Songname: Aero Chord feat. DDARK - Shootin Stars https://www.youtube.com/watch?v=PTF5xgT-pm8 Thanks, Miss Multi-Console. (MMC)
[ 5492, 7139, 24711, 284, 711, 428, 2008, 6105, 13, 1002, 345, 821, 1262, 198, 2949, 7391, 11, 3387, 20542, 46331, 777, 18209, 25, 198, 16921, 13, 1326, 11, 198, 85, 1638, 1326, 13, 2436, 672, 13, 7295, 13, 28457, 13, 3262, 11, 198, 67, 18, 67, 1828, 83, 19, 1990, 17, 44601, 23, 65, 13, 17721, 8534, 13, 3262, 11, 290, 198, 67, 16, 42421, 85, 80, 1731, 64, 2998, 274, 19, 13, 17721, 8534, 13, 3262, 198, 198, 1532, 345, 821, 11681, 428, 2641, 281, 598, 351, 24711, 10058, 11, 1061, 198, 5661, 2792, 284, 2342, 262, 2008, 25, 198, 5450, 1378, 16921, 13, 1326, 14, 83, 7745, 19, 198, 198, 10603, 286, 2457, 8842, 532, 383, 1936, 26543, 64, 33200, 4347, 30837, 1698, 1222, 399, 43837, 9096, 4551, 1795, 198, 198, 818, 262, 1388, 1621, 356, 761, 284, 1986, 262, 1936, 26543, 64, 33200, 326, 389, 3058, 2491, 26262, 1973, 262, 995, 286, 33958, 5908, 557, 13, 41039, 356, 9761, 262, 26543, 64, 35173, 287, 4347, 30837, 1698, 543, 318, 257, 845, 2562, 32726, 4472, 475, 262, 530, 12979, 287, 399, 43837, 9096, 373, 407, 523, 2562, 0, 679, 750, 804, 7427, 996, 1058, 35, 198, 10603, 286, 8125, 10982, 318, 257, 2597, 12, 17916, 2008, 983, 543, 34547, 257, 1210, 12, 3106, 3344, 1080, 13, 632, 318, 318, 7525, 900, 287, 262, 995, 286, 33958, 5908, 557, 11, 257, 1956, 22331, 416, 6833, 8125, 10982, 3435, 290, 10963, 422, 1973, 262, 2168, 11, 981, 852, 555, 15236, 284, 597, 584, 2168, 5726, 13, 39004, 290, 18567, 77, 8659, 422, 716, 31401, 290, 1745, 262, 1176, 287, 530, 286, 511, 5101, 284, 8006, 290, 15445, 7381, 1095, 11, 262, 10963, 286, 33958, 5908, 557, 13, 1119, 3067, 284, 33958, 5908, 557, 284, 8551, 511, 9846, 13, 198, 3987, 378, 319, 29859, 284, 2987, 262, 2695, 286, 616, 6518, 25, 198, 5450, 1378, 2503, 13, 8071, 21833, 13, 785, 14, 7220, 30, 84, 28, 43284, 2425, 2920, 198, 39505, 563, 329, 517, 2457, 8842, 2695, 30, 6822, 503, 616, 33178, 329, 8125, 10982, 42667, 25, 198, 5450, 1378, 2503, 13, 11604, 13, 785, 14, 1759, 4868, 30, 4868, 28, 47, 5639, 16115, 55, 42, 65, 17, 67, 50, 53, 81, 48, 78, 20, 39, 77, 5188, 37, 1546, 85, 41, 56, 2308, 7762, 48, 65, 198, 7155, 502, 319, 3009, 0, 357, 61, 4808, 10563, 8, 198, 14254, 25, 198, 5450, 1378, 6956, 13, 785, 14, 17140, 29800, 30, 17204, 28, 268, 12, 22296, 198, 3880, 982, 3907, 47232, 12, 198, 32, 1263, 5875, 345, 284, 616, 3208, 260, 684, 286, 1737, 2177, 3228, 198, 12, 17520, 295, 198, 12, 2329, 17, 8777, 532, 3740, 1378, 2503, 13, 11604, 13, 785, 14, 17620, 14, 52, 5097, 51, 4944, 89, 70, 56, 28900, 42, 16, 20471, 16960, 79, 12, 62, 16, 85, 6024, 198, 12, 569, 586, 5184, 418, 532, 3740, 1378, 2503, 13, 11604, 13, 785, 14, 17620, 14, 9598, 88, 38, 69, 1065, 88, 17, 1961, 7355, 2213, 12, 15630, 12, 82, 20, 77, 71, 32, 198, 12, 3661, 20783, 532, 3740, 1378, 2503, 13, 11604, 13, 785, 14, 17620, 14, 9598, 74, 19, 51, 12, 80, 45, 18, 75, 43, 37, 80, 41126, 23, 694, 23, 25922, 24, 66, 48, 198, 3880, 982, 3907, 47232, 12, 198, 15269, 1479, 2647, 3017, 287, 428, 2008, 25, 198, 44241, 3672, 25, 44720, 609, 585, 2218, 13, 20084, 14175, 532, 17011, 259, 10271, 198, 5450, 1378, 2503, 13, 11604, 13, 785, 14, 8340, 30, 85, 28, 47, 10234, 20, 87, 70, 51, 12, 4426, 23, 198, 9690, 11, 198, 17140, 15237, 12, 47581, 13, 357, 44, 9655, 8 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
I think your team is lacking power. Outside of Ortiz you dont have much power. OF is suspect. Delmon will give you decent numbers across the board. Rowand isn't going to put up last years numbers, so I would lower your expectations if you haven't done so already. Hamilton should put up some power numbers, but not completely sold on him. Pitching looks good. I would keep an eye on Pena just in case Lyon slips up.
[ 40, 892, 534, 1074, 318, 14394, 1176, 13, 22151, 286, 39039, 345, 17666, 423, 881, 1176, 13, 3963, 318, 4099, 13, 4216, 2144, 481, 1577, 345, 7709, 3146, 1973, 262, 3096, 13, 11314, 392, 2125, 470, 1016, 284, 1234, 510, 938, 812, 3146, 11, 523, 314, 561, 2793, 534, 9027, 611, 345, 4398, 470, 1760, 523, 1541, 13, 11582, 815, 1234, 510, 617, 1176, 3146, 11, 475, 407, 3190, 2702, 319, 683, 13, 350, 19811, 3073, 922, 13, 314, 561, 1394, 281, 4151, 319, 7507, 64, 655, 287, 1339, 35193, 33841, 510, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
United Kingdom The look on Mim’s face said it all; “That is one of the best things I’ve ever tasted”, she said gleefully, pushing the gloriously large yet somewhat daunting mac and cheese toasty across the table for Mark to taste. Were we in Manchester, or had we magically teleported back to our hometown of Melbourne for some top quality grub? Being from Melbourne, we’re kinda food snobs. When you’ve got access to so many incredible restaurants, it’s hard not to be.…
[ 17013, 7526, 198, 198, 464, 804, 319, 39312, 447, 247, 82, 1986, 531, 340, 477, 26, 564, 250, 2504, 318, 530, 286, 262, 1266, 1243, 314, 447, 247, 303, 1683, 29187, 447, 251, 11, 673, 531, 26852, 7549, 11, 7796, 262, 26996, 6819, 1588, 1865, 6454, 30496, 8352, 290, 9891, 284, 7833, 1973, 262, 3084, 329, 2940, 284, 6938, 13, 15176, 356, 287, 9502, 11, 393, 550, 356, 34850, 5735, 9213, 736, 284, 674, 20994, 286, 14819, 329, 617, 1353, 3081, 1036, 549, 30, 11204, 422, 14819, 11, 356, 447, 247, 260, 17855, 2057, 3013, 8158, 13, 1649, 345, 447, 247, 303, 1392, 1895, 284, 523, 867, 8082, 10808, 11, 340, 447, 247, 82, 1327, 407, 284, 307, 13, 1399 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Book Review: Crochet Saved My Life Sunday, March 10, 2013 If you’ve ever turned to your hooks and yarn when times were hard, you will probably see yourself in Crochet Saved My Life: The Mental and Physical Health Benefits of Crochet. Kathryn Vercillo, the blogger behind Crochet Concupiscence, has written and self-published this compelling non-fiction book which tells the stories of 24 crocheters (including herself) who attest to the healing power of crochet. Kathryn’s personal experience using crochet as part of a comprehensive plan to manage her depression sparked her interest in researching the mental, physical, and social benefits of crochet. The book takes a journalistic approach to exploring research into the potential for using crochet as part of a treatment plan for several physical and mental health conditions (depression, anxiety, obsessive compulsive disorder, addiction, post traumatic stress disorder, schizophrenia, bipopular disorder, Alzheimer’s and other age related memory conditions, and stress). Kathryn also explores the use of crochet as part of pain management and occupational therapy regimens. Each chapter includes a clearly written overview of research as well as existing programs using crochet (or other needlecrafts) to treat these conditions. Kathryn’s writing style is accessible and casual, but she has clearly done her homework and documents her sources. She also peppers the anecdotal experiences of the many crocheters she interviewed for the book throughout the relevant chapters, so you can learn about how crochet helped them manage their health. The book includes appendices with mindfulness activities, hand stretches, and other exercises for crocheters. Kathryn also shares the complete story of each crafter she interviewed in “Meet the Crafters” profiles. Crocheters who are active online will recognize many of Kathryn’s interview subjects, who include bloggers, Etsy sellers, and designers. The profiles provide a personal touch and a window into the many ways that crocheting, creativity, and a community of crafters can support healing during difficult times. Although the book is self-published, it is well written and thoroughly edited. Other than the unconventional font (which is highly readable), there is little to distinguish it from a book produced by a major publishing house. Before picking up the book, I feared it would be depressing, but it is actually quite uplifting and inspiring. Through the profiles of these creative women, the reader gets to experience the healing powers of crochet. Fans of Kathryn’s blog will recognize her conversational tone and enjoy the opportunity to learn more about other active members of the online crochet community. This book would also make a delightful gift for anyone in a helping profession or caregivers, since there are some great suggestions for using crochet specifically and needlecrafts in general to support healing. Retail price: $17.95 (paperback), $9.99 (Kindle edition). This book is also available to borrow via the Kindle Lending Library for Amazon Prime Members. 1 comment: CGOA welcomes your comments! To help us avoid comment-spam, all comments are moderated. Damaging, hateful, profane, advertising, or solicitation comments will not be approved. If your comment is not approved, please feel free to reword it and post it again. For guild-related questions, please send an email to: cgoanow @ crochet.org (to help us avoid spam, cut and paste address into your email program and remove spaces from "@"). CGOA Member Pics from Chain Link Important Blog Information About This Blog CGOA Now! is the place to find book reviews, the latest news and information about CGOA, and general items of interest from the crochet community. The content of the blog is overseen by the Board of Directors and Chain Link editor Kim Guzman.
[ 10482, 6602, 25, 9325, 20043, 8858, 276, 2011, 5155, 198, 198, 21934, 11, 2805, 838, 11, 2211, 198, 198, 1532, 345, 447, 247, 303, 1683, 2900, 284, 534, 26569, 198, 392, 21181, 618, 1661, 547, 1327, 11, 345, 481, 2192, 766, 3511, 287, 9325, 20043, 8858, 276, 2011, 5155, 25, 383, 21235, 290, 16331, 3893, 30582, 286, 9325, 20043, 13, 48674, 569, 2798, 16111, 11, 262, 23530, 2157, 9325, 20043, 13223, 929, 2304, 594, 11, 468, 3194, 290, 2116, 12, 30271, 428, 13206, 198, 13159, 12, 24046, 1492, 543, 4952, 262, 3923, 286, 1987, 6763, 2395, 1010, 357, 8201, 198, 372, 944, 8, 508, 44477, 284, 262, 11516, 1176, 286, 46149, 13, 198, 198, 42, 776, 29441, 447, 247, 82, 2614, 1998, 1262, 198, 19915, 20043, 355, 636, 286, 257, 9815, 1410, 284, 6687, 607, 8862, 198, 2777, 668, 276, 607, 1393, 287, 24114, 262, 5110, 11, 3518, 11, 290, 1919, 198, 36934, 896, 286, 46149, 13, 383, 1492, 2753, 257, 35227, 3164, 284, 198, 20676, 3255, 2267, 656, 262, 2785, 329, 1262, 46149, 355, 636, 286, 257, 198, 42487, 1410, 329, 1811, 3518, 290, 5110, 1535, 3403, 198, 7, 10378, 2234, 11, 9751, 11, 36681, 552, 22220, 8967, 11, 13230, 11, 1281, 198, 41521, 5503, 8967, 11, 22794, 11, 14141, 404, 934, 8967, 11, 198, 2348, 89, 16288, 447, 247, 82, 290, 584, 2479, 3519, 4088, 3403, 11, 290, 5503, 737, 198, 42, 776, 29441, 635, 25409, 262, 779, 286, 46149, 355, 636, 286, 2356, 4542, 198, 392, 34266, 9102, 842, 12117, 13, 198, 198, 10871, 6843, 3407, 257, 4084, 3194, 198, 2502, 1177, 286, 2267, 355, 880, 355, 4683, 4056, 1262, 46149, 357, 273, 198, 847, 17598, 3323, 82, 8, 284, 2190, 777, 3403, 13, 48674, 447, 247, 82, 3597, 198, 7635, 318, 9857, 290, 9341, 11, 475, 673, 468, 4084, 1760, 607, 26131, 198, 392, 4963, 607, 4237, 13, 1375, 635, 31804, 262, 41666, 198, 23100, 10035, 286, 262, 867, 6763, 2395, 1010, 673, 12299, 329, 262, 1492, 198, 9579, 448, 262, 5981, 15754, 11, 523, 345, 460, 2193, 546, 703, 46149, 198, 2978, 9124, 606, 6687, 511, 1535, 13, 198, 198, 464, 1492, 3407, 24443, 1063, 351, 198, 10155, 15538, 4568, 11, 1021, 23687, 11, 290, 584, 13565, 329, 198, 19915, 2395, 1010, 13, 48674, 635, 7303, 262, 1844, 1621, 286, 1123, 15671, 637, 198, 7091, 12299, 287, 564, 250, 29318, 262, 11176, 47131, 447, 251, 16545, 13, 9325, 2395, 1010, 508, 198, 533, 4075, 2691, 481, 7564, 867, 286, 48674, 447, 247, 82, 2720, 198, 32796, 82, 11, 508, 2291, 30357, 11, 38909, 23531, 11, 290, 15441, 13, 383, 198, 5577, 2915, 2148, 257, 2614, 3638, 290, 257, 4324, 656, 262, 867, 2842, 198, 5562, 6763, 2395, 889, 11, 16389, 11, 290, 257, 2055, 286, 15671, 47131, 460, 1104, 198, 258, 4272, 1141, 2408, 1661, 13, 198, 198, 7003, 262, 1492, 318, 2116, 12, 30271, 11, 340, 198, 271, 880, 3194, 290, 13770, 13012, 13, 3819, 621, 262, 34014, 198, 10331, 357, 4758, 318, 4047, 31744, 828, 612, 318, 1310, 284, 15714, 340, 198, 6738, 257, 1492, 4635, 416, 257, 1688, 12407, 2156, 13, 7413, 10868, 510, 198, 1169, 1492, 11, 314, 15240, 340, 561, 307, 31193, 11, 475, 340, 318, 1682, 2407, 198, 84, 489, 13309, 290, 20886, 13, 9561, 262, 16545, 286, 777, 7325, 198, 25878, 11, 262, 9173, 3011, 284, 1998, 262, 11516, 5635, 286, 46149, 13, 198, 198, 36570, 286, 48674, 447, 247, 82, 4130, 481, 7564, 607, 3453, 864, 8216, 290, 198, 268, 2633, 262, 3663, 284, 2193, 517, 546, 584, 4075, 1866, 286, 262, 198, 25119, 46149, 2055, 13, 770, 1492, 561, 635, 787, 257, 32327, 198, 70, 2135, 329, 2687, 287, 257, 5742, 7573, 393, 45044, 11, 1201, 612, 198, 533, 617, 1049, 11776, 329, 1262, 46149, 5734, 290, 198, 31227, 293, 3323, 82, 287, 2276, 284, 1104, 11516, 13, 198, 198, 9781, 603, 2756, 25, 198, 3, 1558, 13, 3865, 357, 20189, 1891, 828, 720, 24, 13, 2079, 357, 35854, 293, 8313, 737, 770, 1492, 318, 635, 198, 15182, 284, 8804, 2884, 262, 27114, 406, 1571, 10074, 329, 6186, 5537, 198, 25341, 13, 198, 198, 16, 2912, 25, 198, 198, 34, 11230, 32, 35481, 534, 3651, 0, 1675, 1037, 514, 3368, 2912, 12, 2777, 321, 11, 477, 3651, 389, 7019, 515, 13, 5245, 3039, 11, 30367, 11, 1534, 1531, 11, 8560, 11, 393, 47770, 3651, 481, 407, 307, 6325, 13, 1002, 534, 2912, 318, 407, 6325, 11, 3387, 1254, 1479, 284, 302, 4775, 340, 290, 1281, 340, 757, 13, 1114, 19806, 12, 5363, 2683, 11, 3387, 3758, 281, 3053, 284, 25, 269, 2188, 272, 322, 2488, 46149, 13, 2398, 357, 1462, 1037, 514, 3368, 18084, 11, 2005, 290, 17008, 2209, 656, 534, 3053, 1430, 290, 4781, 9029, 422, 44212, 11074, 198, 198, 34, 11230, 32, 10239, 350, 873, 422, 21853, 7502, 198, 198, 33796, 14001, 6188, 198, 198, 8585, 770, 14001, 198, 198, 34, 11230, 32, 2735, 0, 318, 262, 1295, 284, 1064, 1492, 8088, 11, 262, 3452, 1705, 290, 1321, 546, 327, 11230, 32, 11, 290, 2276, 3709, 286, 1393, 422, 262, 46149, 2055, 13, 383, 2695, 286, 262, 4130, 318, 43097, 416, 262, 5926, 286, 29200, 290, 21853, 7502, 5464, 6502, 1962, 32054, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Power Cables For large utility applications, providing power to large building developments means ensuring continuity of supply using the most robust of cables. These include the installation of XLPE insulated (cross-linked polyethylene), PVC sheathed armoured cable usually underground. These cables are maintenance-free, have low electrical losses, are environmentally friendly and unaffected by weather condition and are a solution particularly where power cables serve large densely populated ares.
[ 13434, 327, 2977, 198, 198, 1890, 1588, 10361, 5479, 11, 4955, 1176, 284, 1588, 2615, 13312, 1724, 13359, 24216, 286, 5127, 1262, 262, 749, 12373, 286, 18018, 13, 198, 198, 4711, 2291, 262, 9988, 286, 16276, 11401, 47869, 357, 19692, 12, 25614, 7514, 21610, 1734, 828, 46377, 673, 35932, 44138, 7862, 3221, 11447, 13, 198, 198, 4711, 18018, 389, 9262, 12, 5787, 11, 423, 1877, 12278, 9089, 11, 389, 34132, 8030, 290, 35290, 416, 6193, 4006, 290, 389, 257, 4610, 3573, 810, 1176, 18018, 4691, 1588, 42255, 22331, 389, 82, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Inker RECENT ACTIVITY The passions of one of history's greatest artists are captured in this volume collecting the dark and provacative 10-issue Vertigo maxiseries. Framed around the story of Salai, a young man whose beauty entrances the great maestro, CHIAROSCURO follows the struggles and triumphs of da Vinci's illustrious career, from his early work in Florence and Milan to the painting of the Mona Lisa and his epochal rivalry with Michaelangelo.
[ 818, 6122, 198, 198, 38827, 3525, 11741, 3824, 9050, 198, 198, 464, 30477, 286, 530, 286, 2106, 338, 6000, 7912, 389, 7907, 287, 428, 6115, 13157, 262, 3223, 290, 899, 330, 876, 838, 12, 21949, 24417, 14031, 3509, 5847, 444, 13, 15183, 276, 1088, 262, 1621, 286, 4849, 1872, 11, 257, 1862, 582, 3025, 8737, 43818, 262, 1049, 17266, 47692, 11, 5870, 40, 1503, 2640, 34, 4261, 46, 5679, 262, 12766, 290, 15499, 82, 286, 12379, 11820, 979, 338, 47887, 3451, 11, 422, 465, 1903, 670, 287, 28537, 290, 21574, 284, 262, 12036, 286, 262, 2892, 64, 15378, 290, 465, 36835, 282, 26390, 351, 3899, 46525, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
--- contrib/virt.te 2012-11-25 21:35:09.181247450 +0100 +++ contrib/virt.te 2012-11-25 21:34:09.223216815 +0100 @@ -281,7 +281,11 @@ userdom_search_user_home_dirs(virt_domain) userdom_read_all_users_state(virt_domain) -qemu_exec(virt_domain) +ifdef(`distro_gentoo',` + optional_policy(` + qemu_exec(virt_domain) + ') +') tunable_policy(`virt_use_execmem',` allow virt_domain self:process { execmem execstack };
[ 6329, 542, 822, 14, 48940, 13, 660, 197, 6999, 12, 1157, 12, 1495, 2310, 25, 2327, 25, 2931, 13, 1507, 1065, 2857, 17885, 1343, 39103, 198, 45340, 542, 822, 14, 48940, 13, 660, 197, 6999, 12, 1157, 12, 1495, 2310, 25, 2682, 25, 2931, 13, 1828, 2624, 14656, 1314, 1343, 39103, 198, 12404, 532, 30368, 11, 22, 1343, 30368, 11, 1157, 25248, 198, 2836, 3438, 62, 12947, 62, 7220, 62, 11195, 62, 15908, 82, 7, 48940, 62, 27830, 8, 198, 2836, 3438, 62, 961, 62, 439, 62, 18417, 62, 5219, 7, 48940, 62, 27830, 8, 198, 220, 198, 12, 80, 368, 84, 62, 18558, 7, 48940, 62, 27830, 8, 198, 10, 361, 4299, 7, 63, 17080, 305, 62, 6783, 2238, 3256, 63, 198, 10, 197, 25968, 62, 30586, 7, 63, 198, 10, 197, 197, 80, 368, 84, 62, 18558, 7, 48940, 62, 27830, 8, 198, 10, 197, 11537, 198, 10, 11537, 198, 220, 198, 6278, 540, 62, 30586, 7, 63, 48940, 62, 1904, 62, 18558, 11883, 3256, 63, 198, 220, 197, 12154, 4118, 62, 27830, 2116, 25, 14681, 1391, 2452, 11883, 2452, 25558, 18083, 198 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Satin Printed Fit and Flare Homecoming Dress from JVN by Jovani Options Return Policy Details Be fun and flirty in the Satin Printed Fit and Flare Homecoming Dress from JVN by Jovani. This sassy style has a sweetheart neckline, a fitted bodice, and a tiered A-line skirt. Complete this adorable look with gemstone chandelier earrings and an embellished handbag.
[ 50, 10680, 38482, 25048, 290, 39833, 5995, 4976, 33611, 422, 449, 53, 45, 416, 449, 709, 3216, 198, 198, 29046, 198, 198, 13615, 7820, 198, 198, 24259, 198, 198, 3856, 1257, 290, 781, 5893, 287, 262, 7031, 259, 38482, 25048, 290, 39833, 5995, 4976, 33611, 422, 449, 53, 45, 416, 449, 709, 3216, 13, 770, 264, 11720, 3918, 468, 257, 6029, 11499, 7393, 1370, 11, 257, 18235, 16429, 501, 11, 290, 257, 9839, 445, 317, 12, 1370, 23967, 13, 13248, 428, 29012, 804, 351, 16840, 6440, 442, 33134, 959, 1027, 33173, 290, 281, 47399, 1348, 1021, 21454, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
This issue was published in two versions, One by Marvel Comics, the other by Whitman Publishing.The Whitman version has the "W" logo replacing the Comics code logo, but the rest of the comic is the same.
[ 1212, 2071, 373, 3199, 287, 734, 6300, 11, 1881, 416, 9923, 15650, 11, 262, 584, 416, 47958, 23499, 13, 464, 47958, 2196, 468, 262, 366, 54, 1, 11112, 13586, 262, 15650, 2438, 11112, 11, 475, 262, 1334, 286, 262, 9048, 318, 262, 976, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Jacob et Wilhelm Grimm Contes J'ai lu Librio Flammarion Dépôt légal : juin 2015 © E.J.L., 2015 pour le supplément pédagogique ISBN numérique : 9782290117965 ISBN du pdf web : 9782290117972 Le livre a été imprimé sous les références : ISBN : 9782290112465 Ce document numérique a été réalisé par PCA **Présentation de l'éditeur : **Il était une fois un meunier, un gentil garçon, une fille paresseuse ; il était une fois un soldat, un maître sorcier, une adorable fillette que tout le monde aimait ; un bûcheron pauvre et ses deux enfants ; un roi, une reine et leur fille unique ; une jeune fille aux souliers rouges : il était une fois de merveilleux contes issus des récits poétiques de la culture allemande. Ce recueil rassemble les plus célèbres contes des frères Grimm, parmi lesquels La Belle au Bois Dormant, Jeannot et Margot, Cendrillon, Le Petit Chaperon rouge, Le Voyage du Petit-Poucet, Le Fiancé brigand, Le Conte du crapaud. Couverture : Le Petit Chaperon rouge s'arrête pour cueillir des fleurs. Illustration par John HASSAL (1868-1948 ) © Collection Grob/Kharbine Tapabor **Biographie de l'auteur : **Jacob (1785 - 1863) et Wilhelm Grimm (1786 - 1859) Écrivains et philologues allemands, les deux frères rassemblèrent et publièrent les contes et légendes germaniques, transformant ainsi une tradition orale en oeuvre immortelle. DANS LA MÊME COLLECTION _Les Éparges_ , Librio no 1130 _La Peine de mort_ , Librio no 1129 _Un humaniste, et autres nouvelles à chute_ , Librio no 1128 _La Parure_ , Librio no 1104 _Alcools,_ Librio no 1094 _Le Tour du monde en 80 jours_ , no 1059 _Le Silence blanc_ , Librio no 856 _Médée_ , Librio no 527 _Phèdre_ , Librio no 301 _L'Odyssée_ , Librio no 300 _Le Chat noir_ , Librio no 213 _L'Ingénu_ , Librio no 180 _Pierre et Jean_ , Librio no 151 _L'Étrange Cas du Dr Jekyll et Mr. Hyde_ , Librio no 113 _Orphée_ , Librio no 75 _Le Dernier Jour d'un condamné_ , Librio no 70 _La Princesse de Clèves_ , Librio no 57 _Candide_ , no 31 _Boule de Suif_ , Librio no 27 _Le Cid_ , Librio no 21 _Le Bateau ivre_ , Librio no 18 _Roméo et Juliette_ , Librio no 9 # Blanche-Neige Il était une fois, en plein hiver, quand les flocons descendaient du ciel comme des plumes et du duvet, une reine qui était assise et cousait devant une fenêtre qui avait un encadrement de bois d'ébène, noir et profond. Et tandis qu'elle cousait négligemment tout en regardant la belle neige au-dehors, la reine se piqua le doigt avec son aiguille et trois petites gouttes de sang tombèrent sur la neige. C'était si beau, ce rouge sur la neige, qu'en le voyant la reine songea : « Oh ! si je pouvais avoir un enfant aussi blanc que la neige, aussi vermeil que le sang et aussi noir de cheveux que l'ébène de cette fenêtre ! » Bientôt après, elle eut une petite fille qui était blanche comme la neige, vermeille comme le sang et noire de cheveux comme le bois d'ébène, et Blanche-Neige fut son nom à cause de cela. Mais la reine mourut en la mettant au monde. Au bout d'un an, le roi prit une autre femme qui était très belle, mais si fière et si orgueilleuse de sa beauté qu'elle ne pouvait supporter qu'une autre la surpassât. Elle possédait un miroir magique avec lequel elle parlait quand elle allait s'y contempler : _Miroir, gentil miroir, dis-moi, dans le royaume_ _Qui est la femme la plus belle ?_ Et le miroir lui répondait : _Vous êtes la plus belle du pays, Madame_. Alors la reine était contente, car elle savait que le miroir disait la vérité. Blanche-Neige cependant grandissait peu à peu et devenait toujours plus belle ; et quand elle eut sept ans, elle était belle comme le jour et bien plus belle que la reine elle-même. Et quand la reine, un jour, questionna son miroir : _Miroir, gentil miroir, dis-moi, dans le royaume Quelle est de toutes la plus belle ?_ Le miroir répondit : _Dame la reine, ici vous êtes la plus belle,_ _Mais Blanche-Neige l'est mille fois plus que vous_. La reine sursauta et devint jaune, puis verte de jalousie ; à partir de cette heure-là, elle ne pouvait plus voir Blanche-Neige sans que le cœur lui chavirât dans la poitrine tant elle la haïssait. L'orgueil poussa dans son cœur, avec la jalousie, comme pousse la mauvaise herbe, ne lui laissant aucun repos ni de jour, ni de nuit. Elle appela un chasseur et lui dit : « Tu vas prendre l'enfant et l'emmener au loin dans la forêt : je ne veux plus la voir devant mes yeux. Tu la tueras et tu me rapporteras son foie et ses poumons en témoignage. » Le chasseur obéit et emmena l'enfant ; mais quand il tira son couteau de chasse pour le plonger dans le cœur innocent de Blanche-Neige, elle se mit à pleurer et lui dit : — Oh ! laisse-moi la vie sauve, mon bon chasseur : je m'enfuirai à travers bois et ne reparaîtrai jamais ! Elle était si belle que le chasseur s'apitoya et lui dit : « Sauve-toi, ma pauvre petite ! » Il était certain, au-dedans de lui-même, que les bêtes sauvages auraient tôt fait de la dévorer ; mais il n'en avait pas moins le cœur soulagé d'un gros poids en évitant ainsi de la tuer de sa main ; et comme un marcassin passait par là, il l'abattit et le dépouilla, rapportant son foie et ses poumons à la reine, en guise de preuve. Il fallut que le cuisinier les mît au sel et les fît cuire, après quoi la mauvaise femme les mangea, croyant se repaître du foie et des poumons de Blanche-Neige. Dans la vaste forêt, la malheureuse fillette était désespérément seule et tellement apeurée qu'elle regardait, pour ainsi dire, derrière chaque feuille sur les arbres, ne sachant que faire ni que devenir. Elle commença à courir, s'écorchant aux épines et sur les pierres pointues, voyant sauter devant elle les bêtes sauvages qui venaient la frôler, mais qui ne lui faisaient pas de mal. Tant que ses petits pieds voulurent bien la porter, elle courut ainsi droit devant elle, et quand tomba la nuit, n'en pouvant plus, elle eut la chance de voir une toute petite maison où elle entra pour se reposer. Tout était petit dans cette maison en miniature, mais si propre et si charmant que c'est impossible de le dire. Il y avait une petite table qui était déjà mise, avec sa nappe blanche et sept petites assiettes ayant chacune son couvert : le petit couteau, la petite cuillère, la petite fourchette et le petit gobelet. Sept petits lits s'alignaient côte à côte le long du mur, bien faits, et tous avec de beaux draps blancs et frais. Blanche-Neige avait si grand-faim et si terriblement soif qu'elle prit et mangea un petit peu dans chaque petite assiette, puis but une gorgée de vin dans chaque petit gobelet ; à chaque place aussi, elle avait pris une bouchée de pain. Après, comme elle était si fatiguée, elle voulut se coucher, mais aucun des petits lits n'était à sa taille : celui-ci était trop long, celui-là trop court, un autre trop étroit ; bref, elle les essaya tous, et le septième enfin lui alla parfaitement. Elle y resta couchée, fit sa prière et s'endormit. Les maîtres du petit logis ne rentrèrent chez eux que lorsqu'il faisait déjà nuit noire, et c'étaient les sept nains qui piochent et creusent les montagnes pour trouver les filons de minerai. Ils allumèrent leurs petites bougies et s'aperçurent, avec la lumière, que quelqu'un était entré chez eux, parce que tout n'était pas parfaitement en ordre ni exactement comme ils l'avaient laissé en partant. — Qui s'est assis sur ma petite chaise ? demanda le premier. — Qui a mangé dans ma petite assiette ? fit le second. — Qui a pris un morceau de mon petit pain ? dit le troisième. — Qui m'a pris un peu de ma petite potée ? s'étonna le quatrième. — Qui a sali ma petite fourchette ? questionna le cinquième. — Qui s'est servi de mon petit couteau ? interrogea le sixième. — Qui a bu dans mon petit gobelet ? s'inquiéta le septième enfin. Le premier, en regardant un peu partout autour de lui, vit alors qu'il y avait un creux dans son lit et il s'exclama : « Qui s'est allongé sur mon petit lit ? » Les six autres accoururent et s'écrièrent tous, les uns après les autres : « Dans mon lit aussi quelqu'un s'est couché ! » Tous, sauf le septième, toutefois, qui arriva devant son lit et vit Blanche-Neige qui y était couchée et qui dormait. Il appela les autres qui galopèrent jusque-là et poussèrent des cris de surprise et d'admiration en levant haut leurs petits bougeoirs pour éclairer Blanche-Neige. — Ô mon Dieu ! Ô mon Dieu ! s'exclamaient-ils tous, la belle enfant ! Comme elle est mignonne ! Comme elle est jolie ! Leur joie était si grande qu'ils ne voulurent pas la réveiller et la laissèrent dormir dans le lit où elle était. Le septième nain s'en alla dormir avec ses compagnons, une heure avec chacun et la nuit fut passée. Au jour, quand Blanche-Neige se réveilla, elle eut grand-peur en voyant les sept nains ; mais ils se montrèrent très amicaux avec elle et lui demandèrent : — Comment t'appelles-tu ? — Je m'appelle Blanche-Neige, leur répondit-elle. — Comment es-tu venue dans notre maison ? Elle leur raconta que sa marâtre avait voulu la faire mourir, mais que le chasseur lui avait laissé la vie sauve et qu'elle avait couru toute la journée sans s'arrêter, jusqu'au moment qu'elle avait trouvé leur maisonnette. — Veux-tu prendre soin de notre ménage ? lui demandèrent les nains. Tu ferais la cuisine, les lits, la lessive, la couture, le tricot, et si tu tiens tout bien propre et bien en ordre, nous pourrions te garder avec nous et tu ne manquerais de rien. — Oh ! oui, de tout mon cœur ! dit Blanche-Neige. (Et elle resta avec eux.) Elle leur faisait le ménage et leur tenait la petite maison bien propre et bien en ordre, et les nains s'en allaient le matin chercher dans la montagne les minéraux et l'or ; ils ne revenaient qu'à la nuit, et il fallait alors que leur repas fût prêt. Toute la longue journée Blanche-Neige restait seule, et les gentils petits nains l'avertirent prudemment et lui dirent : « Tiens-toi bien sur tes gardes à cause de ta belle-mère : elle ne tardera pas à savoir que tu es ici. Ne laisse donc entrer personne ! » La reine, en effet, quand elle crut avoir mangé le foie et les poumons de Blanche-Neige, ne douta plus dans sa pensée d'être de nouveau la première et la plus belle du royaume. Elle s'en alla devant son miroir et lui parla : _Miroir, gentil miroir, dis-moi, dans le royaume_ _Quelle est de toutes la plus belle ?_ Alors le miroir répondit : _Dame la reine, ici vous êtes la plus belle_ , _Mais Blanche-Neige sur les monts_ _Là-bas, chez les sept nains_ , _Est belle plus que vous, et mille fois au moins !_ Elle frémit, car elle savait que le miroir ne pouvait pas dire un mensonge, et elle sut ainsi que le chasseur l'avait trompée et que Blanche-Neige vivait toujours. Alors elle se mit à réfléchir et à réfléchir encore au moyen de la supprimer, car si la reine n'était pas la plus belle de tout le pays, la jalousie la dévorait et ne la laissait pas en repos. Et pour finir, quand elle eut forgé quelque chose, elle se barbouilla le visage et se rendit méconnaissable en s'habillant comme une vieille colporteuse. Accoutrée et grimée de la sorte, elle passa les sept montagnes jusque chez les sept nains et frappa à la porte en lançant le cri de la colporteuse : « De beaux articles à vendre ! Rien que du beau, je vends ! » Blanche-Neige vint regarder à la fenêtre et cria : — Bonjour, ma bonne dame, qu'est-ce que vous vendez ? — Du bel article, du bon article, répondit-elle, du lacet de toutes les couleurs ! En même temps elle en tirait un pour le montrer : un beau lacet tressé de soies multicolores. « Cette brave femme, pensa Blanche-Neige, je peux la laisser entrer ! » Elle déverrouilla et la fit entrer pour lui acheter le beau lacet multicolore qu'elle voulait mettre à son corset. — Mais mon enfant, de quoi as-tu l'air ? s'exclama la vieille. Viens ici, que je lace un peu proprement ! Blanche-Neige, sans méfiance, vint se planter devant la vieille et la laissa lui mettre le nouveau lacet ; mais la vieille passa si vite le lacet et le serra si fort que Blanche-Neige ne put plus respirer, suffoqua et tomba comme morte. — Et voilà pour la plus belle ! ricana la vieille qui sortit précipitamment. Le soir venu (mais ce n'était pas bien longtemps après) les sept nains rentrèrent à la maison : quel ne fut pas leur effroi en voyant leur chère Blanche-Neige qui gisait sur le sol, inerte et immobile comme si elle était morte ! Ils la redressèrent tout d'abord, et voyant comme elle était sanglée dans son corset, ils se hâtèrent d'en couper le lacet ; le souffle lui revint petit à petit et elle se ranima peu à peu. Lorsque les nains apprirent ce qu'il lui était arrivé, ils lui dirent : « Cette vieille colporteuse n'était nulle autre que la maudite reine. À l'avenir, garde-toi bien et ne laisse entrer nul être vivant quand nous n'y sommes pas ! » La méchante femme, de son côté, aussitôt rentrée chez elle s'en alla devant son miroir et le questionna : _Miroir, gentil miroir, dis-moi, dans le royaume_ _Quelle est de toutes la plus belle ?_ Et le miroir répondit comme devant : _Dame la reine, ici vous êtes la plus belle_ , _Mais Blanche-Neige sur les monts_ _Là-bas, chez les sept nains_ , _Est plus belle que vous, et mille fois au moins !_ Son sang s'arrêta quand elle entendit ces paroles qui lui révélaient que Blanche-Neige, une fois encore, avait pu échapper à la mort. « À présent, pensa-t-elle, je vais composer quelque chose à quoi tu n'échapperas pas ! » Recourant alors aux artifices des sorcières qu'elle connaissait bien, elle fabriqua un peigne empoisonné. Ensuite elle se grima et s'habilla en vieille femme, mais avec un autre air que la fois précédente. Ainsi travestie, elle passa les sept montagnes pour aller jusque chez les sept nains, frappa à la porte et cria : — Beaux articles à vendre ! Beaux articles ! Blanche-Neige regarda dehors et cria : — Allez-vous-en plus loin ! Je ne dois laisser entrer personne dans la maison ! — Il n'est pas défendu de regarder ! répondit la fausse vieille en tirant le peigne empoisonné pour le lui faire voir à travers la fenêtre. La petite le trouva si beau qu'elle ne put pas résister et qu'elle ouvrit la porte pour acheter le peigne à cette vieille femme. — Et à présent laisse-moi faire, lui dit la vieille, je vais te peigner un peu comme il faut ! La pauvre Blanche-Neige, sans réfléchir, laissa faire la vieille, qui lui passa le peigne dans les cheveux ; mais à peine avait-elle commencé que le poison foudroya Blanche-Neige, qui tomba de tout son long et resta là, sans connaissance. — Et voilà pour toi, merveille de beauté ! ricana la vieille qui s'éloigna bien vite. Par bonheur, la nuit ne tarda pas à venir et les sept nains à rentrer. En voyant Blanche-Neige étendue sur le sol, ils pensèrent tout de suite à l'affreuse marâtre, cherchèrent ce qu'elle avait bien pu faire et trouvèrent le peigne empoisonné ; dès qu'ils l'eurent ôté de ses cheveux, Blanche-Neige revint à elle et leur raconta ce qu'il lui était arrivé. De nouveau, ils la mirent en garde et lui recommandèrent de ne jamais plus ouvrir la porte à qui que ce soit. Quant à la reine, aussitôt son retour, elle alla s'asseoir devant son miroir et demanda : _Miroir, gentil miroir, dis-moi, dans le royaume_ _Quelle est de toutes la plus belle ?_ Et le miroir répondit encore comme auparavant : _Dame la reine, ici vous êtes la plus belle_ , _Mais Blanche-Neige sur les monts_ _Là-bas, chez les sept nains_ , _Est plus belle que vous, et mille fois au moins !_ Quand le miroir eut ainsi parlé, la reine trembla de rage et de fureur et s'écria : — Il faut que Blanche-Neige meure, même si je dois y laisser ma vie ! Alors elle alla s'enfermer dans une chambre secrète où personne n'entrait jamais, et là, elle confectionna un terrible poison avec lequel elle fit une pomme empoisonnée, mais alors empoisonnée ! Extérieurement, elle était très belle, bien blanche avec des joues rouges, et si appétissante que nul ne pouvait la voir sans en avoir envie ; mais une seule bouchée, et c'était la mort. Lorsque ses préparatifs furent achevés avec la pomme, la reine se brunit la figure et se costuma en paysanne, puis se rendit chez les sept nains en passant les sept montagnes. Quand elle eut frappé à la porte, Blanche-Neige passa la tête par la fenêtre et lui dit : — Je ne peux laisser entrer personne au monde : les sept nains me l'ont défendu. — Cela m'est égal, dit la paysanne, je saurai bien me débarrasser quand même de mes pommes. Tiens, je vais t'en donner une ! — Non, merci, dit Blanche-Neige. Je ne dois rien accepter non plus. — Aurais-tu peur du poison ? dit la paysanne. Regarde : je coupe la pomme en deux ; la moitié rouge, c'est pour toi, et la blanche, je la mange, moi. Parce que la pomme avait été faite si astucieusement que la moitié rouge était seule empoisonnée. Blanche-Neige avait grande envie de cette belle pomme, et quand elle vit la paysanne croquer à belles dents dans sa moitié de pomme, elle ne put pas résister et tendit le bras pour prendre l'autre moitié. Mais à peine la première bouchée fut-elle dans sa bouche qu'elle tomba morte sur le plancher. La reine l'examina avec des regards cruels et partit d'un grand éclat de rire, en s'écriant cette fois avec satisfaction : — Blanche comme neige, rouge comme sang, noire comme le bois d'ébène, ce coup-ci les nains ne pourront plus te ranimer ! Et dès qu'elle fut devant son miroir, elle le questionna : _Miroir, gentil miroir, dis-moi, dans le royaume_ _Quelle est de toutes la plus belle ?_ Alors et enfin, le miroir répondit : _Vous êtes la plus belle du pays, Madame !_ Et là, son cœur envieux fut apaisé, autant que peut être apaisé un cœur envieux. Les nains, quand ils revinrent le soir à la maison, trouvèrent Blanche-Neige étendue sur le plancher ; mais cette fois elle n'avait plus de souffle et elle était vraiment morte. Ils la relevèrent ; ils cherchèrent bien partout s'ils ne trouvaient pas quelque chose d'empoisonné ; ils lui défirent son corset ; ils peignèrent ses cheveux ; ils la lavèrent avec de l'eau, puis avec du vin : mais rien de tout cela n'y fit ; morte elle était, la chère petite, et morte elle resta. Ils la couchèrent sur une civière, et tous les sept, ils restèrent à côté et la pleurèrent pendant trois jours. Puis ils pensèrent à l'enterrer ; mais elle était encore aussi fraîche que si elle eût été vivante et elle avait encore toutes ses couleurs et ses belles joues rouges. — Nous ne pouvons pas l'enfouir comme cela dans la terre noire ! dirent-ils. Alors ils lui firent faire un cercueil de verre afin qu'on pût la voir de tous les côtés, puis ils l'y couchèrent et écrivirent dessus son nom en lettres d'or, en grandes, belles lettres capitales, sous lesquelles ils écrivirent encore qu'elle était une princesse, fille de roi. Ensuite ils portèrent le cercueil au haut de la montagne ; et depuis ce moment-là il y eut toujours l'un des sept qui y resta pour la garder. Et les bêtes y venaient aussi et pleuraient Blanche-Neige : d'abord ce fut une chouette, puis un corbeau, et une colombe en dernier. Longtemps, longtemps Blanche-Neige resta là, dans son cercueil de verre, sans changer du tout ; le temps passa et passa, mais elle était toujours aussi fraîche, aussi blanche que neige, aussi vermeille que le sang, aussi noire de cheveux que l'ébène poli, et elle avait l'air de dormir. Et puis un jour, il arriva qu'un prince, qui s'était égaré dans la forêt, passa la nuit dans la maison des nains. Il vit sur la montagne le cercueil dans lequel était exposée Blanche-Neige, qu'il admira beaucoup, et il lut aussi ce qui était écrit dessus en grandes lettres d'or. Alors il dit aux nains : — Laissez-moi emporter le cercueil : je vous donnerai en échange ce que vous voudrez. — Pour tout l'or du monde, tu ne pourras nous l'acheter ! répondirent-ils. — Alors donnez-le-moi, reprit le prince, parce que je ne puis pas vivre sans admirer Blanche-Neige, et je la traiterai et la vénérerai comme ma bien-aimée, comme ce que j'ai de plus cher au monde ! Les bons nains, en entendant ses paroles, s'émurent de compassion pour lui et lui donnèrent le cercueil. Le prince le fit prendre par ses serviteurs, qui le chargèrent sur leurs épaules et l'emportèrent. Mais voilà qu'ils trébuchèrent contre une racine en le portant, et la secousse fit rendre à Blanche-Neige le morceau de pomme qui lui était resté dans le gosier. Ainsi libérée, elle ouvrit les yeux, souleva le couvercle de verre et se redressa, ayant retrouvé la vie. — Ô mon Dieu, mais où suis-je ? s'exclama-t-elle. — Tu es près de moi ! lui répondit le prince tout heureux, avant de lui raconter ce qui s'était passé. Puis il dit : — Je t'aime et tu m'es plus chère que tout au monde. Viens, accompagne-moi au château de mon père : tu seras mon épouse. Alors Blanche-Neige s'éprit de lui et elle l'accompagna, et leurs noces furent célébrées dans la magnificence et la somptuosité. Mais à ce grand mariage princier, la reine terrible et maudite marâtre de Blanche-Neige fut invitée aussi ; et quand elle se fut richement habillée et parée, elle alla devant son miroir pour lui poser sa question : _Miroir, gentil miroir, dis-moi, dans le royaume_ _Qui est la femme la plus belle ?_ Et le miroir lui répondit : _Dame la reine, ici vous êtes la plus belle,_ _Mais la nouvelle reine est mille fois plus belle_. Un juron échappa à l'horrible femme qui fut prise d'effroi, d'un tel effroi qu'elle ne savait plus que devenir. Pour commencer, son idée fut de ne pas aller du tout aux fêtes du mariage ; mais elle ne put y tenir et il fallut qu'elle y allât, dévorée par la jalousie, pour voir cette jeune reine. Lorsqu'elle fit son entrée, elle reconnut immédiatement Blanche-Neige, et la peur qu'elle en eut la cloua sur place, sa terreur l'empêcha de bouger. Mais on lui avait déjà préparé des souliers de fer qui étaient sur le feu, à rougir : on les lui apporta avec des tenailles et on les mit devant elle, l'obligeant à s'en chausser et à danser, à danser dans ces escarpins de fer rouge jusqu'à sa mort, qui suivit bientôt. # Les Trois Fileuses Il était une fois une fille paresseuse et qui ne voulait pas filer ; sa mère avait beau dire et faire ce qu'elle voulait, elle ne parvenait à rien avec elle. À la fin, la mère perdit patience et s'emporta d'une si grande colère qu'elle battit sa fille ; et la fille poussa des cris et pleura sans retenue. La reine, qui passait justement par là, entendit ces pleurs et ces gémissements ; elle fit arrêter son carrosse, entra dans la maison et demanda à la mère pourquoi sa fille pleurait à en ameuter tout le voisinage. Honteuse d'avoir à révéler la paresse de sa fille, la femme déclara : « C'est que je n'arrive pas à lui faire lâcher son fuseau ! Elle est là qui file et qui file sans arrêt, et moi je suis pauvre et je ne puis pas lui fournir le lin. — Je n'aime rien tant que le bruit de rouet qui tourne, dit la reine, et je me plais à entendre filer. Laissez votre fille venir avec moi au château : j'ai du lin en quantité et elle pourra filer autant qu'il lui plaira. » La mère en fut bien aise dans son cœur, et la reine emmena la jeune fille. Quand elles furent au château, la reine conduisit la jeune fille à trois chambres qui, du plancher au plafond, étaient pleines du plus beau lin. « Tout le lin que tu vois là, dit la reine, tu vas me le filer à présent ; et quand tu auras fini, tu auras mon fils aîné comme mari ; si pauvre que tu sois, je n'y prendrai pas garde : ton zèle persévérant te suffira comme dot. » La jeune fille en eut froid dans le dos, car tout le lin qu'il y avait là, jamais elle ne pourrait arriver à le filer, même si elle vivait pendant trois cents ans et travaillait sans s'arrêter du matin au soir sans sauter un seul jour ! Elle n'en laissa rien voir ; mais dès qu'elle fut seule, elle se mit à pleurer et resta trois longs jours dans ses larmes, sans seulement bouger le petit doigt. Le troisième jour, la reine reparut et fut très étonnée en voyant que la jeune fille n'avait rien fait du tout ; mais la jeune fille s'excusa en prétendant que son chagrin d'être loin de chez elle et de sa mère l'avait troublée et empêchée de s'y mettre. La reine s'en contenta, mais au moment de s'en aller lui dit : « Demain, il faut que tu commences à travailler. » Dès qu'elle fut seule à nouveau, la jeune fille se demanda désespérément comment elle allait se tirer d'affaire et quel moyen elle pourrait utiliser, mais elle ne trouvait rien et, dans son angoisse, elle alla se planter à la fenêtre. Elle vit alors trois vieilles femmes qui approchaient : la première avec un pied plat, la seconde avec une lèvre qui lui tombait sur le menton, et la troisième avec un pouce comme une palette. Elles s'arrêtèrent sous la fenêtre, regardèrent vers la jeune fille et lui demandèrent ce qu'il lui manquait. Elle se plaignit de son affaire, et les femmes lui proposèrent de venir à son aide en lui disant : « Pourvu que tu nous invites à ton mariage, que tu n'aies pas honte de nous et que tu nous appelles tes cousines, et aussi que tu nous fasses asseoir à ta table, nous allons te filer ton lin et ce sera vite fait. — Volontiers et de tout cœur, répondit-elle. Venez et commencez le travail tout de suite. » Elle fit donc entrer les trois étranges femmes et leur aménagea une place libre dans la première pièce, où elles s'installèrent et se mirent aussitôt à filer. La première tirait l'étoupe et faisait tourner le rouet, la seconde mouillait le fil, et la troisième le retordait et l'égalisait avec le pouce sur la table : à chaque coup, c'était un écheveau entier qui tombait sur le sol, et du lin le plus fin filé ! Elle veilla à cacher les trois fileuses à la reine, tout en lui montrant, chaque fois qu'elle venait, la quantité de lin filé ; et la reine ne pouvait pas mettre fin à ses louanges. La première chambre vidée, ce fut le tour de la seconde, puis de la troisième, qui fut terminée en un rien de temps ; après quoi les trois femmes prirent congé de la jeune fille et lui rappelèrent en s'en allant : « N'oublie pas ce que tu nous as promis : ce sera ton bonheur. » Quand la jeune fille eut fait voir à la reine les chambres vides et les tas de lin filé, le jour des noces fut arrêté et le fiancé fut enchanté d'avoir une femme aussi active et d'une telle habileté, et il l'en félicita grandement. — J'ai trois cousines, lui dit la jeune fiancée, et comme je leur dois beaucoup, je ne voudrais pas les oublier dans mon bonheur : puis-je les inviter au mariage, et aurai-je la permission de les faire asseoir à ma table ? — Pourquoi ne le permettrions-nous pas ? répondirent la reine et son fils aîné. Lors donc que commença la fête nuptiale, les trois vieilles filles arrivèrent dans le plus bizarre accoutrement et l'épousée les accueillit en disant : « Soyez les bienvenues, mes chères cousines ! — Oh ! dit le prince à sa jeune femme, comment peux-tu avoir une aussi laide parenté ? » Puis, se tournant vers celle qui avait le pied plat, il lui demanda : — D'où vous vient un pied aussi large ? — Le rouet, lui répondit-elle, c'est le rouet. Il se tourna vers la seconde et demanda : — D'où vous vient cette lèvre qui pend ? — Le fil, répondit-elle, c'est de mouiller le fil. Il demanda à la troisième : — D'où vous vient ce pouce énorme ? — De retordre, répondit-elle, c'est de retordre le fil en l'étirant. Alors le fils aîné du roi en fut tout effrayé et déclara : — Jamais, au grand jamais, à partir d'aujourd'hui, ma belle épouse ne touchera à un rouet ! Grâce à quoi elle en fut quitte avec l'odieux filage du lin. # Chat et souris associés Un chat avait lié connaissance avec une souris et lui en avait tant dit et raconté sur l'amour immense et la grande amitié qu'il lui portait, que pour finir elle avait consenti à ce qu'ils vivent ensemble dans la même maison, où ils partageraient tous les soins et soucis du ménage. « Mais pour l'hiver, il nous faut faire provision, sinon on va souffrir la faim, affirma le chat ; toi, petite souris, tu ne peux pas te risquer à courir sans cesse de tous côtés, ou tu vas finir par tomber dans un piège ! » Le conseil étant sage, on le suivit sur l'heure en achetant, pour provision, un petit pot empli de graisse. Mais ils ne savaient pas où le ranger. Enfin, et après mûre réflexion, le chat parla : « Je ne vois pas de meilleur endroit que l'église pour le bien garder : personne n'aurait l'audace d'en enlever quelque chose ; nous irons donc le cacher là-bas, sous l'autel, et nous n'y toucherons plus tant qu'il ne nous sera pas devenu nécessaire. » Et ainsi le petit pot de graisse fut mis en sécurité. Il ne devait pourtant pas se passer beaucoup de jours avant que le chat s'y sentît poussé par l'envie, et il parla ainsi à la souris : « À propos, je voulais te dire, petite souris, ma cousine me demande comme parrain : elle a mis au monde un fiston tout blanc avec des taches rousses, et c'est moi qui dois le tenir sur les fonts baptismaux. Tu veux bien, n'est-ce pas, t'occuper seule de la maison et me laisser sortir aujourd'hui ? – Mais bien sûr, répondit la souris, vas-y, et si tu manges quelque chose de bon, pense à moi, et n'oublie pas non plus que quelques gouttes du bon vin doux des relevailles ne seraient pas pour me déplaire ! » Mais il n'y avait rien de vrai dans tout cela : le chat n'avait pas plus de cousine qu'il n'était invité comme parrain. Il s'en alla tout droit à l'église, se glissa jusqu'au pot de graisse qu'il commença à lécher, et lécha tant et si bien qu'il en ôta toute la fine graisse du dessus. Cela fait, il s'en alla se promener sur les toits de la ville, inspectant tout, puis se coucha et paressa au soleil en se pourléchant chaque fois qu'il songeait au petit pot de graisse. Ce ne fut pas avant le soir qu'il s'en revint à la maison. « Ah, te voilà ! dit la souris, tu as sûrement passé une bonne journée... » Et le chat répondit que tout avait été pour le mieux. « Et quel nom a-t-on donné à l'enfant ? demanda la souris. – "Dessus-Parti", laissa tomber le chat d'un ton sec. – "Dessus-Parti !" s'écria la souris, quel drôle de nom c'est là, vraiment étrange ! Est-ce qu'il est usuel dans votre famille ? – Et alors ? répondit le chat, il n'est pas plus mal que Chipe-miettes, comme s'appellent ceux qui t'ont baptisée. » Peu de temps après, le chat fut repris par son envie. « Il faut que tu me rendes service et que tu t'occupes seule encore de la maison, dit-il à la souris ; je suis une deuxième fois invité à être parrain, et comme l'enfant est né avec un collier blanc, je ne peux pas refuser. » La brave petite souris consentit de bonne grâce, mais le chat rampa derrière le mur d'enceinte jusqu'à l'église, et engloutit la moitié du pot. « Rien n'a plus de saveur que ce qu'on mange seul », se dit-il ; et il était bien content et satisfait de son ouvrage. Quand il rentra, la souris questionna : « Et de quel nom a-t-on baptisé cet enfant-là ? – Mivide, répondit le chat. – Mivide ! reprit la souris, mais que me dis-tu là ? De ma vie, je n'ai entendu ce nom et je parierais qu'il ne se trouve pas dans le calendrier. » Le chat ne tarda pas à se sentir de nouveau l'eau à la bouche en rêvant de la gourmandise. « Les bonnes choses vont par trois, dit-il à la souris, je dois encore être parrain ; l'enfant est complètement noir, avec seulement le bout des pattes blanches et pas un seul poil blanc sur tout le corps, ce qui n'arrive guère qu'une fois tous les deux ans. Tu me laisses sortir, n'est-ce pas ? — Dessus-Parti, Mivide, répondit la souris, quels curieux noms, en vérité, et qui me laissent toute pensive... — À toujours rester à la maison dans ta robe gris foncé à longue queue, tu te fais des idées, déclara le chat ; voilà ce qui arrive quand on reste des jours et des jours sans sortir. » La souris s'activa pendant que le chat n'était pas là, fit le ménage et mit tout en ordre dans la maison ; et le gros chat gourmand nettoya tout le pot de graisse et le laissa bien net. « Quand il ne reste rien, alors on est tranquille ! » se dit-il à lui-même, et gros et gras, et satisfait, il ne rentra à la maison qu'avec la nuit. La première question de la souris fut pour lui demander quel nom on avait donné à l'enfant. « C'est un nom qui ne te plaira guère, dit le chat : on l'a appelé Toutnet. — Toutnet ! s'écria la souris. Celui-là, c'est bien le plus problématique de tous les noms et je ne l'ai jamais vu imprimé nulle part. Toutnet, qu'est-ce que cela peut bien vouloir dire ? » Et elle hocha gravement la tête avant de se mettre en rond pour dormir. À partir de ce moment-là plus personne ne demanda au chat d'être parrain ; mais quand l'hiver fut venu et qu'on ne trouva plus rien dehors, la souris pensa à leurs provisions et dit : « Tu viens, chat ? Nous allons chercher le pot de graisse que nous avons mis en réserve et on va bien se régaler. — Oh, pour ça oui ! dit le chat, tu vas t'en régaler, et ce sera pour ta fine langue comme si tu la mettais à la fenêtre. » Ils se mirent donc en route et quand ils arrivèrent, le pot de graisse se trouvait bien à sa place, mais il était vide. « Ah ! s'exclama la souris, maintenant je comprends ce qui s'est passé et tout est clair à présent : toi, au moins, tu es un véritable ami ! Tu as tout dévoré quand tu étais le soi-disant parrain : d'abord Dessus-Parti, et ensuite Mivide, et ensuite... — Veux-tu te taire ! coupa le chat. Encore un mot et c'est toi que je croque ! » Mais la malheureuse souris avait déjà lâché le « Toutnet » qu'elle avait sur la langue et le chat, aussitôt, avait bondi sur elle, l'avait prise et avalée d'un coup. Ainsi va le monde, vois-tu. # La Belle au Bois Dormant # (ou la Princesse Fleur-d'Épine) Il y avait dans le temps un roi et une reine qui se répétaient chaque jour : « Ah ! si seulement nous avions un enfant ! » Mais ils n'en avaient toujours pas. Un jour que la reine était au bain, il advint qu'une grenouille sauta de l'eau pour s'avancer vers elle et lui parler : — Ton vœu sera exaucé, lui annonça-t-elle ; avant un an, tu mettras une fille au monde. Ce que la grenouille avait dit se produisit, et la reine donna naissance à une fille ; et l'enfant était tellement jolie que le roi ne se tenait plus de joie et fit donner une grande fête. Il ne se contenta pas d'y inviter ses parents, amis et connaissances, mais il voulut aussi que les fées y eussent part afin qu'elles fussent favorables et bienveillantes à l'enfant. On en comptait treize dans le royaume, mais comme il n'y avait que douze assiettes d'or au palais, pour leur servir le festin, il fallut en laisser une chez elle. La fête eut lieu et le festin se déroula au milieu des splendeurs, puis, quand tout finissait, les fées revêtirent l'enfant de leurs dons merveilleux : de l'une, la vertu ; de l'autre, la beauté ; de la troisième, la richesse ; et ainsi de suite pour tout ce qu'on peut souhaiter et avoir au monde. La onzième venait juste de prononcer son incantation, quand brusquement entra la treizième : celle qui n'avait pas été invitée et qui voulait se venger. Sans un salut ni seulement un regard pour personne, elle lança à voix haute sur le berceau cette parole : « La princesse, quand elle aura quinze ans, se piquera avec un fuseau et tombera morte. » Sans un mot de plus, elle fit demi-tour et quitta la chambre. Dans l'effroi général, la douzième fée, qui avait encore à prononcer son vœu, s'avança vers le berceau ; elle ne pouvait pas annuler la malédiction, mais elle pouvait en atténuer les effets, aussi prononça-t-elle : — Ce n'est pas dans la mort que sera plongée la princesse, mais dans un sommeil profond de cent années. Le roi, qui eût bien voulu préserver son enfant chérie du mauvais sort, fit ordonner que tous les fuseaux soient brûlés dans le royaume tout entier. Les dons des fées se réalisèrent pleinement chez l'enfant qui devint si belle, si vertueuse, si gracieuse et si intelligente que tous ceux qui seulement la voyaient se sentaient obligés de l'aimer. Le jour de ses quinze ans, il se trouva que le roi et la reine furent absents et que la jeune princesse resta toute seule au château, où elle se mit à errer çà et là, visitant les chambres et les galeries, les salons et les resserres selon sa fantaisie et son humeur. Sa promenade la conduisit finalement dans un très vieux donjon, dont elle gravit marche à marche l'étroit escalier tournant pour arriver devant une petite porte, tout en haut. Il y avait une vieille clé rouillée dans la serrure, et quand elle la fit tourner, la porte s'ouvrit d'un coup, lui découvrant une chambrette où se tenait une vieille femme assise, le fuseau à la main, occupée à filer son lin avec beaucoup d'ardeur. — Bonjour, petite grand-mère, lui dit la princesse, que fais-tu là ? — Je file, dit la vieille avec un bref mouvement de tête. — Et cette chose-là, qui danse si joyeusement, qu'est-ce que c'est ? fit la demoiselle en s'emparant du fuseau pour essayer de filer elle aussi. Mais elle l'avait à peine touché que l'incantation prenait son plein effet et qu'elle se piquait le doigt. Ce fut à peine si elle sentit la piqûre, car déjà elle tombait sur le lit, derrière elle, et s'y trouvait plongée dans le plus profond sommeil. Ce sommeil profond se répandit sur le château entier, à commencer par le roi et la reine qui venaient de rentrer et se trouvaient encore dans la grand-salle, où ils se mirent à dormir, et avec eux toute la cour. Alors les chevaux s'endormirent dans les écuries, et les chiens dans la cour d'entrée, et les pigeons sur le toit, et les mouches même sur le mur, et le feu lui aussi, qui cessa de flamber dans la cheminée, et qui se fit silencieux et s'endormit ; le rôti sur la broche cessa de grillotter, et le cuisinier qui allait tirer l'oreille du marmiton pour quelque bêtise, le laissa et dormit. Même le vent se coucha, et plus la moindre feuille ne bougea sur les arbres tout autour du château. Mais autour du château la broussaille épineuse se mit à croître et à grandir, à s'épaissir et à monter année après année, si bien que le château en fut d'abord tout entouré, puis complètement recouvert ; c'était à tel point qu'on ne le voyait plus du tout, non, pas même la bannière sur la plus haute tour. Et peu à peu, dans le pays, circula la légende de la belle Fleur-d'Épine endormie sous les ronces, car tel était le nom qu'on avait donné à la princesse ; et des princes y venaient de temps à autre, qui voulaient se forcer un passage à travers les buissons pour pénétrer dans le château. Mais c'était impossible parce que les buissons d'épines, comme avec des mains, se tenaient fermement ensemble, et les jeunes gens y restaient accrochés ; ils ne pouvaient plus s'en défaire et finissaient par mourir là de la plus misérable des morts. Après bien des années et encore bien des années, il arriva qu'un fils de roi passa dans le pays et entendit ce que racontait un vieillard sur ce massif d'épines, et comment il devait y avoir un château par-dessous, dans lequel une princesse d'une beauté merveilleuse, appelée Fleur-d'Épine, dormait depuis cent ans déjà ; et avec elle dormaient aussi le roi, la reine et la cour tout entière. Ce prince avait également entendu raconter par son grand-père que de nombreux fils de rois étaient déjà venus et avaient essayé de passer à travers la broussaille, mais qu'ils en étaient tous restés prisonniers, mourant là d'une affreuse mort. Le jeune prince n'en déclara pas moins : « Je n'ai pas peur : je veux y aller et voir la belle princesse Fleur-d'Épine ! » Le bon vieillard put bien le lui déconseiller tant qu'il voulut, il n'écouta rien et n'entendit rien de ce qu'on lui disait. Mais en vérité, les cent années se trouvaient justement révolues et le jour était arrivé, que la princesse devait se réveiller. Quand le prince avança vers la haute roncière, il ne trouva plus rien devant lui que de belles et grandes fleurs épanouies, qui s'écartaient d'elles-mêmes pour lui ouvrir le passage, et qui se resserraient derrière lui en refermant leur masse épaisse. Dans la cour du château, il vit les chevaux couchés dans leurs stalles comme au-dehors, les grands chiens de chasse blancs et roux, qui dormaient ; sur le toit il vit des pigeons qui avaient tous la tête sous l'aile. À l'intérieur du château, quand il entra, les mouches dormaient sur le mur ; le cuisinier, dans sa cuisine, avait toujours le bras tendu, comme s'il voulait attraper le petit marmiton, et la servante était assise avec la poule noire qu'elle allait plumer ; il pénétra dans la grand-salle du trône, où il vit toute la cour royale endormie et couchée çà et là ; et plus haut, près du trône, le roi lui-même et la reine étaient allongés. Il s'avança encore et s'en alla plus loin ; tout était si calme et si parfaitement silencieux qu'on s'entendait respirer ; et pour finir, le prince monta dans le vieux donjon, ouvrit la porte de la chambrette haute où la belle princesse Fleur-d'Épine dormait. Couchée là, elle était si merveilleusement belle qu'il ne pouvait pas en détourner ses yeux ; il se pencha sur elle et lui donna un baiser. À la caresse de ce baiser, Fleur-d'Épine ouvrit les yeux, et la belle se réveilla tout à fait, regarda le prince d'un regard tendre et amoureux. Alors ils redescendirent ensemble et quand ils furent en bas, le roi se réveilla, puis la reine et toute la cour sortirent de leur sommeil, et tous s'entre-regardaient avec des yeux ronds. Les chevaux dans la cour se relevèrent et s'ébrouèrent ; les chiens de chasse bondirent en frétillant de la queue ; les pigeons sur le toit tirèrent leur tête de sous l'aile, inspectèrent les environs et prirent leur vol ; les mouches recommencèrent à grimper le long des murs, cependant que le feu reprenait dans la cuisine et, flambant clair, remettait la cuisson en train ; le rôti à la broche grésilla de nouveau, et le cuisinier expédia une bonne taloche au marmiton, le faisant criailler, tandis que la servante se remettait à plumer sa volaille. Alors furent célébrées avec splendeur les noces du prince avec la belle princesse, que la légende et les gens avaient nommée Fleur-d'Épine, et ce fut le bonheur pour eux jusqu'à la fin de leurs jours. # Le Fiancé brigand Il était une fois un meunier qui avait une fille bien jolie, et lorsqu'elle fut grande, il souhaita qu'elle n'eût plus de soucis et fût bien mariée. « Si quelque prétendant convenable vient me la demander, pensait-il, je la lui donnerai. » Et peu de temps après se présenta un prétendant qui paraissait fort riche et auquel le meunier, ne voyant rien à objecter, promit sa fille. La jeune fille, par contre, ne sentait pas pour lui le vrai penchant qu'une fiancée doit avoir pour son fiancé, et elle n'avait aucune confiance en lui : elle éprouvait comme une horreur dans le fond de son cœur à chaque fois qu'elle le voyait ou seulement pensait à lui. — Tu es ma fiancée et tu ne viens même pas me faire une visite chez moi ? lui dit-il une fois. — Je ne sais pas où est votre maison, lui répondit-elle. — Au plus épais de la forêt se trouve une maison, dit le fiancé. Cherchant d'autres prétextes, elle prétendit ne pas être capable d'en trouver le chemin. Mais le fiancé coupa court et lui dit : — Il faut que tu viennes dimanche prochain, j'ai déjà fait mes invitations ; et pour que tu t'y retrouves dans la forêt, je te tracerai le chemin en y mettant des cendres. Le dimanche venu, il fallut bien qu'elle se mît en route, mais l'angoisse lui serrait la gorge sans qu'elle sût au juste pourquoi ; et comme elle voulait être sûre de pouvoir retrouver sa route, elle emporta ses pleines poches de lentilles et de petits pois. Dès qu'elle entra dans la forêt, elle suivit le chemin que marquait la cendre, mais tout en avançant, elle jetait de temps à autre, à droite et à gauche, quelques graines par terre. Elle marcha presque toute la journée pour arriver au cœur sombre de la forêt, au plus épais des bois, où se dressait une maison solitaire, qui ne lui plut pas du tout à cause de son air ténébreux et sinistre. Elle y entra, mais ne trouva personne à l'intérieur et resta là, écoutant régner le grand silence, quand soudain une voix cria : _Chez les brigands tu es entrée !_ _Va-t'en, va-t'en, la fiancée_. La jeune fille leva les yeux et vit que la voix venait d'un oiseau dans une cage suspendue au mur. Et l'oiseau de nouveau cria : _Va-t'en, va-t'en, la fiancée_ _Chez les brigands tu es entrée !_ Passant alors d'une pièce à l'autre, la jolie fiancée visita toute la maison qu'elle trouva entièrement vide et sans âme qui vive. Elle descendit même à la cave pour finir, et là, il y avait une vieille, vieille femme qui était assise et qui branlait la tête. — Pouvez-vous me dire si mon fiancé habite bien ici ? demanda la jeune fille. — Hélas, ma pauvre enfant ! dit la vieille, où t'es-tu donc fourrée ? Tu es ici dans un repaire de bandits, un coupe-gorge, une maison d'assassins. Tu croyais être une fiancée qui va bientôt fêter ses noces, mais c'est avec la mort que tu vas les fêter ! Tu vois ce grand chaudron ? Je devais le remplir et le mettre au feu quand tu serais tombée entre leurs mains, et ils t'auraient coupée en morceaux pour t'y faire cuire et te manger, parce que ce sont des ogres. Mais j'ai pitié de toi et je te sauverai ! Autrement tu étais perdue. La vieille la conduisit alors et la fit se cacher derrière un grand tonneau où l'on ne pouvait pas la voir. — Ne fais pas plus de bruit qu'une souris, lui recommanda-t-elle, ne bouge pas de là, ne fais pas le moindre mouvement, sans quoi c'en est fini de toi. Cette nuit, quand les bandits seront endormis, nous nous enfuirons toutes les deux : c'est l'occasion que j'attendais depuis longtemps. À peine était-ce dit, que déjà les bandits rentraient chez eux : toute la bande de ces scélérats qui traînaient avec eux une autre jeune fille ; ils étaient ivres et n'écoutaient ni ses cris, ni ses plaintes, ni ses gémissements. Ils lui donnèrent du vin à boire : trois verres, qu'ils la forcèrent d'absorber, un verre de rouge, un verre de blanc et un verre de jaune, qui lui fit éclater le cœur. Ils lui arrachèrent alors ses riches vêtements, la couchèrent sur une table et coupèrent son beau corps en morceaux, à coups de hache, puis salèrent les morceaux en les couvrant de gros sel. La pauvre fiancée, derrière le gros tonneau, tremblait de tous ses membres en voyant quel sort les bandits lui auraient réservé. L'un d'eux, qui venait de voir une bague d'or au doigt de la morte, voulut la prendre, mais ne réussit pas tout de suite à la faire glisser du doigt ; alors il empoigna la hache et lui trancha ce doigt d'un coup furieux qui l'envoya voler en l'air et retomber, finalement, sur les genoux de la malheureuse qui tremblait derrière le gros tonneau. Le bandit attrapa une chandelle et se mit à chercher après, mais sans rien trouver. — As-tu regardé derrière le tonneau ? lui suggéra l'un des autres bandits. Sur quoi la vieille femme leur cria à tous : — À table maintenant, venez manger ! Vous pouvez bien attendre à demain matin pour chercher : le doigt ne va pas s'envoler tout seul ! — Elle a raison ! dirent les bandits, abandonnant la recherche pour aller manger et boire. La vieille femme avait mis un somnifère dans leur vin et ils ne tardèrent pas à se coucher tous dans la cave, dormant et ronflant comme les brutes qu'ils étaient. La jeune fiancée, en entendant ces ronflements, sortit de derrière son tonneau et dut enjamber les corps serrés des dormeurs qui encombraient la cave ; elle avait terriblement peur d'en réveiller un au passage, mais grâce à Dieu, elle traversa sans dommage, et la vieille l'entraîna vivement en haut, ouvrit la porte, et elles s'enfuirent aussi vite qu'elles le pouvaient, courant presque pour s'éloigner de la maison des assassins. Le vent avait dispersé les cendres qui marquaient le chemin, mais les lentilles et les pois avaient germé et poussé, si bien qu'avec le clair de lune, elles purent le suivre sans difficulté ; et elles marchèrent toute la nuit durant pour arriver enfin au moulin avec le petit matin. La jeune fille raconta tout ce qu'il lui était advenu à son père, muet d'étonnement. Vint le jour que devaient se célébrer les noces, et le fiancé arriva. Mais le meunier n'avait pas manqué d'inviter tous ses parents et amis en grand nombre. Quand tout le monde fut à table, chacun dut raconter une histoire et tous le firent, l'un après l'autre. Mais la mariée restait assise et ne disait rien. — Eh bien, mon cœur, tu ne sais donc rien dire ? Raconte-nous aussi quelque chose ! lui dit le fiancé. — Alors je vais vous raconter un rêve, dit-elle. Je marchais seule dans une grande forêt et j'ai fini par arriver à une étrange maison où il n'y avait personne, pas une âme de bas en haut ; mais au mur, dans une cage, il y avait un oiseau qui criait : _Chez les brigands tu es entrée !_ _Va-t'en, va-t'en, la fiancée_. « Une fois je l'entendis, et encore une autre fois, mais je ne faisais que rêver, mon chéri. Alors je suis entrée dans toutes les chambres, et toutes les chambres étaient complètement vides ; il y avait quelque chose d'affreusement sinistre dans cette maison déserte. Alors je suis descendue à la cave pour finir, et là il y avait une vieille, vieille femme à la tête branlante. Je lui ai demandé : "Est-ce que mon fiancé habite ici, dans cette maison ?" Elle m'a répondu : "Hélas ! ma pauvre enfant, tu es tombée dans un repaire de bandits. Ton fiancé habite ici, en effet, mais il va te tuer et te couper en morceaux ; et moi je devrai te faire cuire et il te mangera." C'était dans mon rêve, mon chéri, rien qu'un rêve que je faisais, tu comprends ? Alors la vieille femme m'a cachée derrière un grand tonneau pour que personne ne me voie, et j'étais à peine là, que déjà les bandits rentraient chez eux avec une malheureuse jeune fille qu'ils traînaient à leur suite. Ils lui donnèrent à boire trois sortes de vins : du rouge, du blanc et du jaune, qui lui fit éclater le cœur. C'est ce que j'ai rêvé, mon chéri, rien d'autre que mon rêve. Alors ils lui ont enlevé ses riches vêtements et ils ont coupé son beau corps en morceaux sur une table, et ils ont répandu du sel dessus. Mon chéri, c'est seulement ce que j'ai rêvé. Il y avait à son doigt une bague d'or, que l'un de ces bandits a vue et a voulu prendre, mais comme la bague ne venait pas assez vite, il lui a coupé le doigt d'un coup de hache. Mais le doigt a sauté et volé en l'air par-dessus le grand tonneau pour venir me tomber sur les genoux. « Et ce doigt avec la bague, le voici ! » conclut-elle brusquement en prenant le doigt dans sa poche pour le montrer à toute l'assistance. Le bandit, qui était devenu blanc de craie tout au long de son histoire, se leva brusquement et voulut se sauver, mais l'assistance était nombreuse et le tint bien. Ils l'immobilisèrent et le livrèrent à la justice. Et ce fut ainsi qu'il finit avec toute sa bande, jugé et condamné pour tous les crimes commis. # Jeannot et Margot Tout près d'une grande forêt vivaient un pauvre bûcheron, sa femme et leurs deux enfants : un garçon qui s'appelait Jeannot, et une fillette qui se nommait Margot. Le bûcheron gagnait si peu qu'il n'avait presque rien à leur donner à manger d'ordinaire, mais lorsqu'il y eut la famine dans la contrée, ce fut même le pain quotidien qui manqua. Un soir qu'il ne pouvait dormir à cause de ses soucis et qu'il se retournait dans son lit en soupirant à cause de ses tristes pensées, il dit à sa femme : « Qu'allons-nous devenir ? Et comment pourrions-nous faire manger nos enfants quand nous n'avons rien à manger nous-mêmes ? — Sais-tu quoi, mon homme ? Demain matin, de très bonne heure, nous emmènerons les enfants dans la forêt, là où elle est le plus épaisse. Nous leur préparerons un feu là-bas, et nous leur donnerons encore à chacun un dernier petit bout de pain, puis nous irons à notre travail et nous les laisserons seuls. Ils ne retrouveront plus le chemin de la maison et nous en serons débarrassés. — Non, femme, je ne peux pas faire cela ! dit-il. Comment prendrais-je sur mon cœur de laisser mes enfants tout seuls dans la forêt, avec les bêtes sauvages qui ne tarderaient pas à venir les dévorer ? — Idiot que tu es ! dit la femme. Nous allons donc mourir de faim tous les quatre, et il ne te reste plus qu'à raboter les planches pour nos cercueils ! » Sans lui laisser ni trêve ni repos, elle continua et insista jusqu'à ce qu'il eût consenti. — Mais quand même, dit l'homme, ces pauvres enfants me font regret. Les deux enfants, qui ne pouvaient pas dormir à cause de la faim, avaient tout entendu de ce que la marâtre avait dit à leur père. Margot, en pleurant des larmes amères, dit à Jeannot : « À présent, c'en est fini de nous ! — Console-toi, Margot, ne te mets pas en peine, dit Jeannot : j'aurai tôt fait de nous tirer de là. » Et quand les parents furent endormis, il se glissa à bas du lit, enfila sa petite veste, courut jusqu'à la porte-coupée, dont il ouvrit le bas, et passa dehors. C'était en plein clair de lune et le gravier, devant la maison, faisait luire ses petits cailloux comme autant de sous neufs. Jeannot se baissa et en ramassa tant qu'il put en mettre dans ses petites poches ; puis il rentra et dit à Margot : « Tranquillise-toi, ma chère petite sœur, tu peux dormir en paix et avoir confiance : Dieu ne nous abandonnera pas. » Puis il se remit au lit. À la pointe du jour, bien avant le lever du soleil, la femme s'en venait réveiller les deux enfants : « Debout ! Debout, paresseux, leur dit-elle, nous allons dans la forêt pour y faire du bois. » Ensuite elle leur donna à chacun un petit bout de pain en leur disant : « Comme cela, vous aurez un petit quelque chose pour midi ; mais ne le mangez pas avant, parce qu'il n'y aura rien d'autre. » Margot serra le pain sous son tablier puisque Jeannot avait les cailloux dans ses poches ; et en route pour la forêt. Après un petit bout de chemin, Jeannot s'arrêta et se retourna pour jeter un coup d'œil du côté de la maison, puis encore un peu plus loin, et encore, et encore il recommençait la même chose. — Qu'est-ce que tu as à toujours regarder et traîner en arrière ? lui dit son père. Tâche de faire attention et n'oublie pas de faire marcher tes jambes ! — Oh ! père, c'est mon petit chat blanc que je regardais : il est monté sur le toit et veut me dire adieu. — Idiot, dit la femme, ce n'est pas ton chat : c'est le soleil levant qui luit sur la cheminée ! Mais Jeannot n'avait ni regardé, ni vu son petit chat ; il avait seulement tiré chaque fois un petit caillou blanc de sa poche pour le jeter sur le chemin. Lorsqu'ils furent arrivés au beau milieu de la forêt, le père dit : « À présent, les enfants, vous allez me ramasser du bois : je vais vous faire un feu pour que vous n'ayez pas froid. » Jeannot et Margot rapportèrent du bois mort et en firent tous les deux une petite montagne. Le feu fut allumé, et quand la flamme fut bien haute, la femme dit : « Vous, les enfants, couchez-vous près du feu et reposez-vous pendant que nous allons plus loin faire du bois. Nous viendrons vous chercher quand nous aurons fini. » Jeannot et Margot se tinrent sagement près du feu, et quand ce fut midi, chacun mangea son petit bout de pain. Ils croyaient que leur père n'était pas loin, parce qu'ils entendaient les coups de la cognée ; mais ce n'était pas sa hache qu'ils entendaient frapper : c'était une grosse branche qu'il avait attachée de telle sorte que le vent la fît battre çà et là. Et comme ils étaient restés là longtemps, ils eurent les yeux lourds de fatigue et ils finirent par s'endormir. Quand ils se réveillèrent, c'était déjà nuit noire. Margot commença à pleurer en disant : « Comment allons-nous faire à présent pour sortir de la forêt ? » Mais Jeannot la réconforta et lui dit : « Attends seulement que la lune se lève, ce ne sera pas long, et nous trouverons bien le chemin. » Et quand la pleine lune fut levée, Jeannot prit Margot par la main et emmena sa petite sœur en suivant le chemin tracé par les cailloux blancs, qui luisaient comme des sous neufs. Ils marchèrent toute la nuit et n'arrivèrent qu'à la pointe du jour devant la maison de leur père. Ils frappèrent à la porte et la femme vint ouvrir ; et quand elle vit que c'étaient Jeannot et Margot, elle s'écria : « Méchants enfants ! Dormir si longtemps dans la forêt, en voilà des façons ! Nous avons cru que vous vouliez ne plus jamais revenir. » Le père, par contre, se réjouit de les revoir, car son cœur lui pesait de les avoir laissés comme cela, tout seuls. Mais au bout de très peu de temps ce fut de nouveau la misère chez eux, et le besoin était dans tous les coins ; et de nouveau les enfants entendirent leur mère qui parlait avec leur père et qui lui disait : « Voilà que tout est encore mangé : une demi-miche de pain, c'est tout ce qu'il nous reste, et après c'est fini la musique. Il faut expédier les enfants, mais cette fois nous les mènerons bien plus profond dans la forêt pour qu'ils n'arrivent pas à retrouver le chemin ; autrement, pas de salut pour nous. » L'homme se sentit un gros poids sur le cœur et pensa : « Mieux vaudrait partager avec les enfants ta dernière bouchée ! » Sa femme ne voulut rien entendre de ce qu'il pouvait dire ; elle le rabroua, au contraire, le houspilla et l'accabla de reproches. Qui a dit A doit aussi dire B, et puisqu'il avait consenti la première fois, il fallut bien qu'il cédât la seconde aussi. Mais les enfants ne dormaient pas non plus, et ils avaient surpris tout le dialogue. Aussi Jeannot se leva-t-il quand les vieux se furent endormis, comme la fois d'avant, voulant se glisser dehors. Mais cette fois la mère avait fermé les deux parties de la porte et il ne put sortir. Néanmoins, il réconforta sa petite sœur et lui dit : « Ne t'inquiète pas, Margot, tu n'as pas besoin de pleurer et tu peux dormir tranquille : Dieu nous assistera encore. » Au petit matin, la femme vint tirer les enfants du lit, mais le petit bout de pain qu'ils reçurent était encore un plus petit bout que l'autre fois. En route vers la forêt, Jeannot l'émietta dans sa poche et s'arrêta de temps à autre pour en jeter une miette sur le chemin. — Jeannot, qu'est-ce que tu restes en arrière à regarder n'importe quoi ? gronda le père. Allons, avance ! — C'est mon petit pigeon blanc que je regardais, dit Jeannot : il est perché sur le toit et veut me dire adieu. — Idiot, ce n'est pas ton petit pigeon, dit la femme : c'est le soleil levant qui luit sur la cheminée ! Ce qui n'empêcha pas le garçon de jeter de place en place toutes les miettes de son pain sur le chemin. La femme emmena les enfants bien plus au cœur de la forêt, dans un endroit qu'ils n'avaient jamais vu de leur vie. Un grand feu fut préparé de nouveau et la mère leur dit : « Restez là, les enfants, et quand vous serez fatigués, vous n'aurez qu'à dormir un peu : nous allons faire du bois un peu plus loin et ce soir, quand nous aurons fini, nous viendrons vous chercher. » Lorsque ce fut midi, Margot partagea son peu de pain avec Jeannot, puisqu'il avait semé son morceau miette par miette tout le long du chemin. Après, les enfants s'endormirent et le temps passa ; l'après-midi s'écoula, puis le soir, mais personne ne revint près des pauvres petits. Quand ils se réveillèrent enfin, c'était déjà nuit noire, et Jeannot consola sa petite sœur en lui disant : « Attends seulement que la lune se lève, Margot, alors nous pourrons voir les miettes que j'ai répandues et qui nous montreront le chemin jusqu'à la maison. » La lune monta et ils se levèrent, mais ils ne trouvèrent plus une seule miette de pain nulle part, car les milliers de becs des milliers d'oiseaux qui volent tout partout, dans la forêt ou la campagne, les avaient avalées. « Nous trouverons bien notre chemin quand même, va ! » dit Jeannot à Margot. Mais ils ne le trouvèrent pas. Ils marchèrent toute la nuit et encore toute la journée du matin jusqu'au soir, mais ils n'étaient toujours pas sortis de la grande forêt ; et comme ils n'avaient rien mangé que quelques rares petits fruits qu'ils avaient pu trouver par terre, quelle faim ils avaient ! Ils étaient tellement fatigués que leurs jambes ne voulaient plus les porter. Alors ils se laissèrent tomber au pied d'un arbre et s'y endormirent. Le matin fut vite là, et c'était déjà leur troisième journée loin de la maison paternelle. Ils se remirent en marche, mais ce fut pour s'enfoncer toujours plus profondément dans la forêt ; s'il ne leur venait pas un prompt secours, ils allaient infailliblement mourir d'épuisement. Or, vers midi, ils aperçurent sur une branche un bel oiseau blanc comme neige, et il chantait si joliment qu'ils s'arrêtèrent pour l'écouter. Son chant fini, l'oiseau ouvrit ses ailes et voleta devant eux, et ils le suivirent jusqu'auprès d'une maisonnette, sur le toit de laquelle il alla se poser. En approchant encore, ils virent que la maisonnette avait des murs de pain d'épice et un toit de biscuit ; quant aux fenêtres, elles étaient de sucre filé. — Nous allons croquer dedans, que c'en est une bénédiction ! Moi je mange un bout de toit, dit Jeannot, et toi, Margot, tu peux manger de la fenêtre, c'est tout sucré. Il se mit sur la pointe des pieds pour atteindre le toit, et s'en cassa d'abord un petit bout pour voir si c'était bon, tandis que Margot s'agrippait à la fenêtre et se mettait à en grignoter. Alors une douce voix sortit de l'intérieur : _Et j'te grignote et grignotons,_ _Qui me grignote ma maison ?_ Tranquillement, les enfants répondirent : _C'est le vent, c'est le vent,_ _C'est le céleste enfant._ Et ils continuèrent à manger sans se laisser troubler ni déranger. Jeannot, qui avait trouvé le toit fort à son goût, s'en cassa du coup un bon morceau, et Margot, de son côté, avait ôté de la fenêtre toute une belle vitre ronde, s'était assise par terre et s'en régalait tout son soûl. Mais voilà que la porte s'ouvre d'un coup, et qu'une vieille encore plus vieille que les pierres s'avance à petits pas dehors, en béquillant sur sa béquille. Jeannot et Margot en furent si violemment épouvantés qu'ils en laissèrent tomber ce qu'ils avaient dans les mains. Mais la vieille branla tête et dit : « Hé, hé ! mes chers enfants, qui vous a amenés ici ? Mais entrez donc, voyons ! et restez chez moi, il ne vous arrivera rien de mal. » Elle les prit par la main tous les deux et les conduisit dans sa maisonnette. Là, ils eurent devant eux de bonnes choses à manger, du lait et des crêpes au sucre, des pommes et des noix ; puis ils eurent deux beaux petits lits blancs pour se coucher, et ils se crurent au ciel. Mais si la vieille avait été si aimable, c'était seulement pour faire semblant : en réalité c'était une méchante sorcière qui guettait les enfants, et c'était justement pour les attirer qu'elle avait construit sa maisonnette de pain d'épices. Une fois qu'ils étaient en son pouvoir, elle les tuait, les faisait cuire et les mangeait, ce qui était pour elle un jour de fête. Les sorcières ont les yeux rouges et la vue si basse qu'elles n'y voient que de tout près ; mais elles ont une espèce de flair, comme les animaux, et elles savent très bien quand on approche d'elles. Ainsi quand Jeannot et Margot arrivèrent dans les environs, elle avait ricané méchamment et dit en se réjouissant d'avance : « Je les tiens, ceux-là, ils ne m'échapperont plus ! » Le lendemain matin, très tôt, elle se leva avant le réveil des enfants, et quand elle les vit dormir si gentiment, avec leurs bonnes joues rouges, elle se chuchota à elle-même : « Un fameux morceau que je vais avoir là ! » Alors elle empoigna Jeannot de ses mains sèches et le porta dans une petite remise où elle l'enferma derrière une porte grillée : il pouvait bien crier tant qu'il voulait, cela ne servait à rien. Ensuite elle revint secouer Margot pour la réveiller, et elle lui cria : « Debout, paresseuse, puise de l'eau et fais cuire quelque chose de bon pour ton frère qui est là-bas, dans la remise, où il faut qu'il engraisse. Parce que dès qu'il sera assez dodu, je le mangerai. » Et Margot eut beau pleurer très amèrement, cela ne servit à rien et rien n'y fit : elle dut faire ce que la méchante sorcière voulait. Dès lors, pour le malheureux Jeannot, fut préparée la meilleure cuisine ; Margot, par contre, n'avait rien que les os à sucer, ou la carapace des écrevisses. Chaque matin, la vieille se traînait jusqu'à la petite remise et criait : « Jeannot, passe-moi tes doigts dehors, que je tâte pour savoir si tu seras bientôt assez gras. » Mais Jeannot lui tendait un petit os, et la vieille, avec sa vue trouble, ne voyait rien et croyait que c'était son doigt, s'étonnant qu'il ne voulût toujours pas engraisser. Au bout de quatre semaines, comme il était toujours aussi maigre, la vieille s'impatienta et ne voulut pas attendre plus longtemps. — Holà, Margot ! cria-t-elle à la fillette, tâche de ne pas traîner et apporte de l'eau ! Maigre ou gras, le Jeannot, je le tue demain pour le faire cuire. Ah ! comme elle se désola, la pauvre petite sœur, quand elle dut porter de l'eau ! Et comme elles ruisselaient, les larmes, tout le long de ses joues ! « Mon Dieu, mon Dieu, gémissait-elle, viens donc à notre secours ! Si seulement les bêtes sauvages dans la forêt nous avaient dévorés, au moins nous serions morts ensemble ! — Épargne-moi tes piailleries, dit la vieille, cela ne sert à rien du tout. » Le lendemain, de très bonne heure, Margot fut dehors et dut suspendre le chaudron rempli d'eau et allumer le feu dessous. « Avant tout, dit la vieille, nous allons faire cuire le pain : j'ai déjà fait chauffer le four et la pâte est pétrie. » Et elle poussa la malheureuse Margot devant l'entrée du four, où l'on voyait déjà sortir les flammes du grand feu qui brûlait. « Faufile-toi dedans, dit la sorcière, et vois un peu si c'est assez chaud pour qu'on enfourne le pain. » Oui, et quand Margot serait dedans, elle fermerait la porte sur elle et pousserait encore le feu pour qu'elle y rôtisse, et alors elle la mangerait aussi. Mais Margot avait compris ce qu'elle avait dans l'idée, et elle dit : « Je ne sais pas comment m'y prendre pour entrer là-dedans. Que faut-il faire ? — Stupide dinde ! s'exclama la vieille, l'ouverture est bien assez grande ! Regarde : je pourrais moi-même y passer ! » Et en même temps, elle s'accroupissait devant le four et s'y poussait à petits coups pour y engager la tête. Alors Margot la poussa un grand coup pour la faire basculer dedans, ferma la porte de fer et bloqua le gros verrou. Houla ! quels hurlements affreux elle se mit à pousser là-dedans ! Mais Margot s'éloigna de toute la vitesse de ses petites jambes et il fallut bien que la maudite sorcière brûlât et pérît misérablement. Margot s'était précipitée directement vers Jeannot, ouvrant bien vite la petite remise en lui criant : « Jeannot, nous sommes libres ! La vieille sorcière est morte ! » Tel un oiseau hors de sa cage, il était sorti dès que la porte s'était ouverte ; et quelle joie pour eux ! et comme ils tombèrent dans les bras l'un de l'autre, s'embrassèrent et gambadèrent comme des fous ! Maintenant qu'ils n'avaient plus rien à craindre, ils entrèrent dans la maison de la sorcière, où il y avait dans tous les coins des coffres pleins de perles et de pierres précieuses. — C'est encore mieux que les petits cailloux blancs ! remarqua Jeannot, tout en en remplissant ses poches à craquer. — Moi aussi, je veux rapporter quelque chose à la maison, dit Margot, qui en prit plein son tablier. — Mais à présent allons-nous-en, dit Jeannot, parce qu'il faut d'abord sortir de cette forêt de sorcières. Ils s'en allèrent et marchèrent pendant quelques heures, mais là, ils furent arrêtés par une large rivière. — Nous ne pouvons pas traverser, dit Jeannot : je ne vois ni pont, ni gué. — Et pas le plus petit bateau non plus, ajouta Margot. Mais je vois là un canard blanc, et si je lui demande, il va bien nous aider. _Canard blanc, canard blanc,_ _Ici Margot et Petit-Jean._ _Aucun sentier et pas de pont,_ _Porte-nous sur ton beau dos rond_. Ainsi avait-elle appelé, et le canard s'était aussi approché. Jeannot s'installa sur son dos, se tournant aussitôt pour dire à sa petite sœur de venir s'y asseoir aussi. « Non, non, dit-elle, ce serait trop lourd pour le petit canard : il faut qu'il nous porte l'un après l'autre pour traverser. » Et c'est ce que fit le brave petit canard ; et quand ils furent de l'autre côté, ils marchèrent encore un petit moment, et voilà qu'autour d'eux la forêt était de moins en moins étrangère, plus connue et toujours plus connue à mesure qu'ils avançaient, jusqu'au moment où ils aperçurent de loin la maison de leur père. Ils y coururent, entrèrent en trombe dans la chambre et se jetèrent au cou de leur père. Le pauvre homme n'avait pas eu une heure de bon temps depuis qu'il avait laissé ses enfants dans la forêt ; mais la femme était morte. En secouant son tablier, Margot fit cascader les perles et les pierres précieuses qui roulèrent de tous côtés, cependant que Jeannot les tirait par poignées de ses poches et les faisait rouler aussi. De leurs soucis, dès lors, ils ne surent plus rien ; et ils vécurent ensemble en perpétuelle joie. Mon conte est fini, trotte la souris, celui qui la prendra pourra se faire un grand bonnet, un grand bonnet de sa fourrure, et puis voilà ! # Le Conte du crapaud Il était une fois un petit garçon qui avait tous les jours, pour son goûter, une brioche et un petit bol de lait que lui donnait sa mère ; il emportait son bol et sa brioche et s'en allait manger dehors. Dès qu'il commençait à manger, le crapaud familier de la maison se glissait hors d'une fente du mur et arrivait, penchait sa petite tête dans le lait et partageait son goûter. C'était une joie pour le petit garçon ; et quand il était là avec son bol, si d'aventure le crapaud ne venait pas tout de suite, il l'appelait : _Crapaud, crapaud, petit crapaud,_ _Viens manger ton gâteau !_ _Arrive vite, s'il te plaît_ _Te régaler avec mon lait !_ Alors le crapaud trottait vite vers l'enfant et s'en donnait à cœur joie. Mais il lui montrait aussi sa gratitude en lui apportant toutes sortes de choses tirées de son trésor secret : des pierres étincelantes, des perles ou de petits jouets d'or. Seulement le crapaud ne touchait pas aux miettes de brioche et se contentait de laper le lait, alors l'enfant s'arma de sa petite cuillère et lui frappa légèrement la tête en lui disant : « Mange les miettes ! Tu dois manger les miettes aussi ! » La mère, dans sa cuisine, entendit parler son enfant et vint voir avec qui il était en conversation ; mais quand elle le vit occupé à frapper sur la tête d'un crapaud avec sa petite cuillère, elle attrapa une grosse bûche avec laquelle elle écrasa la brave petite bête. À partir de ce moment tout changea pour l'enfant : tant que le crapaud était venu manger avec lui, il grandissait en force et en généreuse santé, alors que maintenant il perdait ses belles couleurs et maigrissait de jour en jour. Il ne fallut pas longtemps pour entendre crier l'oiseau de la mort et pour voir le rouge-gorge ramasser les brindilles et les feuilles d'une couronne mortuaire ; quelques jours plus tard, l'enfant était couché dans son cercueil. C'était fini. ## Un autre conte du crapaud Une orpheline qui filait sa quenouille, assise au pied du mur d'enceinte de la ville, vit un crapaud sortir de son trou dans le mur ; vite, elle étala devant lui son foulard de soie bleue, que les crapauds aiment énormément et sur quoi ils marchent de préférence. Dès qu'il l'eut aperçu, le crapaud fit demi-tour, puis revint peu après, apportant une petite couronne d'or qu'il posa sur le foulard de soie avant de regagner son trou de nouveau. La fillette prit la couronne, qui était faite d'un délicat filigrane d'or et qui brillait merveilleusement. Le crapaud s'en revint peu de temps après, et quand il s'aperçut que la couronne n'y était plus, son désespoir fut tel qu'il alla se frapper la tête contre le mur, recommençant et recommençant jusqu'à ce qu'il eût épuisé ses forces et tombât mort. Si la fillette n'avait pas enlevé la couronne, le crapaud n'eût certainement pas manqué d'apporter bien d'autres trésors de son trou. # Cendrillon Il y avait un homme riche dont la femme était tombée malade ; et quand elle se sentit approcher de sa fin, elle appela à son chevet son unique fillette et lui dit : « Mon enfant chérie, reste toujours pieuse et bonne, et tu pourras compter sur l'aide du Bon Dieu ; et moi, du haut du ciel, je te regarderai et te protégerai. » Après ces paroles, elle ferma les yeux et mourut. Chaque jour, désormais, la fillette se rendit sur la tombe de sa mère, et chaque jour elle pleurait, s'appliquant à rester pieuse et bonne. Quand l'hiver vint, il mit un blanc manteau de neige sur la tombe ; et quand le soleil du printemps l'eut enlevé, le père prit une seconde femme. Cette femme avait amené dans la maison ses deux filles, qui étaient jolies et blanches de visage, mais vilaines et noires de cœur. Et pour la pauvre enfant du premier lit, ce fut une période affreuse qui commença. — Cette dinde idiote, est-ce qu'elle va rester avec nous ? dirent-elles. Elle n'a pas sa place au salon ! Il faut gagner son pain quand on veut le manger. Allez ouste ! Hors d'ici, la fille de cuisine ! Elles lui ôtèrent ses beaux vêtements, lui mirent un vieux tablier gris et la chaussèrent de sabots de bois, puis se moquèrent d'elle en la poussant dans la cuisine. « Oh ! la fière princesse, qu'elle est bien attifée, voyez-moi ça ! » Alors elle dut travailler dur du matin jusqu'au soir, se lever tôt, tirer de l'eau, allumer le feu, faire la cuisine et la vaisselle, la lessive et tous les gros travaux. Les deux sœurs, au surplus, n'arrêtaient pas de lui faire toutes les misères possibles et imaginables, riaient d'elle à tout propos, lui jetaient les pois ou les lentilles dans la cendre pour qu'elle eût à rester là encore à les trier une fois de plus. Le soir, quand elle était exténuée de sa journée, elle n'avait pas de lit pour se coucher, mais devait s'étendre par terre, sur la pierre du foyer, dans les cendres ; et comme elle en était toujours souillée et salie, les sœurs l'appelaient Cendrillon. Un jour que le père devait se rendre à la foire, il demanda à ses deux belles-filles ce qu'elles voulaient qu'il leur en rapportât. « De belles robes ! » dit l'une. « Des perles et des joyaux ! » dit l'autre. — Et toi, Cendrillon, qu'aimerais-tu ? demanda-t-il à sa fille. — La première branche qui cinglera votre chapeau en cours de route, père, coupez-la pour moi, répondit-elle. Il acheta donc pour ses deux belles-filles de jolies toilettes, des perles et des pierres précieuses ; et il s'en revenait, quand en passant à cheval dans un bosquet, une branche de noisetier lui cingla le chapeau et le lui fit tomber à terre. Il coupa le rameau et l'emporta. Arrivé à la maison, il donna aux deux sœurs ce qu'elles avaient voulu, et à Cendrillon le rameau de noisetier. Cendrillon l'en remercia et s'en alla planter la petite branche sur la tombe de sa mère ; elle pleurait si fort que ses larmes mouillèrent et arrosèrent le rameau, qui prit racine, poussa et devint un fort bel arbre. Cendrillon s'y rendait chaque jour trois fois, pleurant et priant sous le bel arbre, et toujours un petit oiseau blanc venait s'y poser ; et si elle formulait un souhait, le petit oiseau de l'arbre lui jetait aussitôt ce qu'elle avait souhaité. Il advint, une fois, que le roi donna une grande fête de trois jours, à laquelle étaient invitées toutes les jolies filles du pays, afin que son fils pût se choisir une fiancée. Quand les deux sœurs apprirent qu'elles étaient invitées aussi, elles furent tout excitées et appelèrent Cendrillon aussitôt : « Coiffe-nous, lui dirent-elles, fais briller nos chaussures et serre-nous bien dans nos ceintures : nous allons pour le mariage au palais du roi. » Cendrillon obéit, mais en pleurant, tant elle eût aimé les accompagner au bal ; aussi alla-t-elle en demander la permission à sa belle-mère. — Toi, Cendrillon ? fit la belle-mère. Sale et dégoûtante comme tu l'es, tu voudrais être de la noce ? Tu n'as ni robe ni souliers, et tu voudrais aller danser ? Mais comme elle ne se laissait pas décourager et continuait de la supplier, la belle-mère finit par lui dire, pour avoir la paix : « Bon, tu pourras venir si, en deux heures de temps, tu réussis à ramasser et à trier le pot de lentilles que je vais renverser dans les cendres. » Le pot versé, Cendrillon gagna le jardin par la porte de derrière et appela : — Gentils pigeons, mignonnes tourterelles, et vous tous les petits oiseaux de sous le ciel, venez vite à mon aide et trions comme il faut : _Les bonnes dans le petit pot,_ _Les autres dans votre jabot_. Deux blancs pigeons entrèrent d'abord par la fenêtre de la cuisine, puis vinrent les tourterelles et enfin tous les petits oiseaux du ciel, en rangs pressés, battant des ailes, pour se poser tout partout sur les cendres. Les pigeons penchèrent un peu la tête et commencèrent à pic, pic, pic, piqueter les lentilles, et les autres se mirent aussi à pic, pic, pic, piqueter les lentilles pour les tirer de la cendre et les rassembler dans le pot. Il ne s'était pas passé une heure que déjà tout était fini et que tous les oiseaux s'étaient envolés de nouveau. Tout heureuse, Cendrillon s'empressa d'aller montrer le pot à sa marâtre, croyant qu'elle allait, elle aussi, se rendre avec les autres à la fête du roi. — Non, Cendrillon, dit celle-ci : tu n'as pas de robe à te mettre et tu ne sais pas danser. Tout le monde se moquerait de toi. Mais pour qu'elle cessât de pleurer, la marâtre lui promit : — Si tu me tries deux pleins pots de lentilles dans la cendre en une heure de temps, alors tu pourras venir. Car en elle-même, elle se disait : « Cela, jamais elle n'arrivera à le faire ! » Dès qu'elle eut éparpillé les deux pots de lentilles dans les cendres, Cendrillon courut au jardin par la porte de derrière et appela : — Gentils pigeons, mignonnes tourterelles, et vous tous les petits oiseaux de sous le ciel, venez vite à mon aide et trions comme il faut : _Les bonnes dans le petit pot,_ _Les autres dans votre jabot_. Deux blancs pigeons entrèrent d'abord par la fenêtre de la cuisine, puis vinrent les tourterelles et enfin tous les petits oiseaux du ciel, en rangs serrés, battant des ailes, pour se poser tout partout sur les cendres. Les pigeons penchèrent un peu la tête et commencèrent à pic, pic, pic, piqueter les lentilles, et les autres se mirent aussi à pic, pic, pic, piqueter les lentilles pour les tirer de la cendre et les ramasser dans les pots. Il ne s'était pas passé une demi-heure que tout était fini et que tous les oiseaux s'envolèrent de nouveau. Joyeuse, Cendrillon s'empressa d'aller montrer les pots à sa marâtre, croyant aller avec les autres à la fête du roi. — Tout cela ne sert à rien, dit celle-ci : tu n'as pas de robe à te mettre et tu ne sais pas danser ; tu ne peux donc pas venir avec nous. Tu nous ferais honte. Elle lui tourna le dos et gagna la porte avec ses deux filles orgueilleuses et altières. Lorsqu'il n'y eut plus personne à la maison, Cendrillon alla sur la tombe de sa mère, se mit sous le noisetier et dit : _Arbre gentil, agite-toi bien fort_ _Pour me couvrir d'argent et d'or_. Alors l'oiseau lui fit descendre une robe d'argent et d'or ainsi que des pantoufles brodées de soie et d'argent. Elle se hâta de revêtir la robe et alla à la fête des noces. Ni sa belle-mère, ni ses demi-sœurs ne la reconnurent, pensant plutôt que ce devait être là quelque fille de roi étrangère au pays, tant elle était belle dans sa robe d'or. Elles ne songeaient pas le moins du monde à Cendrillon, qu'elles croyaient toujours à la maison, en train de fouiller dans les cendres pour en trier les lentilles. Le fils du roi vint à sa rencontre, la prit par la main et dansa avec elle. Il ne voulut même danser avec nulle autre, et c'est pourquoi il ne lui lâchait pas la main ; et si quelque autre cavalier venait pour l'inviter à son tour, le prince lui disait : « C'est ma cavalière. » Jusqu'au soir elle dansa, puis elle voulut rentrer chez elle, mais le prince lui dit qu'il irait avec elle et l'accompagnerait, tant il était curieux de voir de quelle famille venait cette jolie jeune fille. Il l'accompagna, en effet, mais au dernier moment elle lui échappa et sauta dans le pigeonnier. Le prince attendit que revînt le père et lui dit que la jeune inconnue avait sauté dans le pigeonnier. « Serait-ce Cendrillon ? » se demanda le père, qui réclama une hache et une pioche pour ouvrir en deux le pigeonnier. Mais il n'y avait personne à l'intérieur ; et quand ils entrèrent dans la maison, Cendrillon, dans son costume misérable et souillé, était couchée sur la cendre, avec une méchante veilleuse à huile qui clignotait dans la cheminée. Elle avait, en effet, bien vite sauté du pigeonnier par-derrière et couru jusqu'au noisetier, où elle avait quitté sa robe magnifique pour la déposer sur la tombe, et le petit oiseau l'avait remportée tandis qu'elle retrouvait la cuisine et son vieux tablier gris pour se coucher sur la cendre, dans l'âtre. Le lendemain, comme recommençait la fête, dès que ses parents et les deux sœurs altières eurent quitté la maison, Cendrillon courut au noisetier et dit : _Arbre gentil, agite-toi bien fort_ _Pour me couvrir d'argent et d'or_. Alors l'oiseau lui fit descendre une robe encore beaucoup plus splendide et magnifique que celle de la veille. Et quand elle apparut à la fête ainsi parée, tout le monde s'étonna et s'émerveilla de sa beauté. Le fils du roi, qui avait attendu sa venue, la prit aussitôt par la main et ne dansa qu'avec elle. Et si quelque autre cavalier venait pour l'inviter, il lui disait : « C'est ma danseuse. » Quand elle voulut rentrer, le soir venu, le prince l'accompagna, car il voulait voir dans quelle maison elle entrait. Mais elle lui échappa et sauta dans le jardin derrière la maison. Il y avait là un grand bel arbre tout chargé de magnifiques poires, et elle grimpa si prestement entre ses branches, vive comme un écureuil, que le prince ne sut pas où elle avait bien pu passer. Mais il attendit que revînt le père et lui dit que la jolie inconnue avait disparu, mais qu'il croyait qu'elle s'était cachée dans le grand poirier. Le père se dit en lui-même : « Serait-ce Cendrillon ? » et se fit apporter une hache, entama l'arbre tout autour et l'abattit ; mais il n'y avait personne dedans. Et quand ils entrèrent dans la cuisine, Cendrillon était là, couchée dans la cendre comme toujours. Elle avait sauté de l'arbre par-derrière, en effet, et rapporté vite, vite, sa robe magnifique au petit oiseau du noisetier pour reprendre son vieux tablier gris. Le troisième jour, quand ses parents et les sœurs furent partis, Cendrillon retourna sur la tombe de sa mère et dit au noisetier : _Arbre gentil, agite-toi bien fort_ _Pour me couvrir d'argent et d'or_. Et la robe que l'oiseau lui fit descendre, cette fois, était si merveilleuse et d'une telle magnificence que jamais elle n'avait rien eu qui lui ressemblât ; et les escarpins n'étaient faits que d'or. Parée de la sorte, elle fit son entrée à la fête et tout le monde béa d'admiration, ne sachant plus que dire. Le fils du roi ne dansa qu'avec elle, et si quelqu'un d'autre venait pour l'inviter, il disait : « C'est ma cavalière. » Le soir venu, Cendrillon voulut s'en aller et le prince voulut l'accompagner, mais elle s'esquiva si lestement qu'il ne put la suivre. Seulement le prince avait recouru à la ruse et fait enduire de poix toutes les marches du perron, et tandis qu'elle dégringolait l'escalier en volant presque, sa pantoufle gauche y resta collée. Le fils du roi prit cet escarpin, qui était minuscule, délicat, et entièrement fait d'or. Le lendemain matin, le prince alla trouver le père et lui dit : « Je ne veux point d'autre épouse que celle à qui cette chaussure d'or ira. » Ce fut une grande joie pour les deux sœurs, car elles avaient un joli pied. L'aînée alla dans sa chambre avec l'escarpin, qu'elle voulait chausser. Sa mère était présente. Mais le soulier était trop petit et le pouce n'y pouvait entrer. La mère s'empressa de lui tendre un couteau : « Coupe-le, lui dit-elle ; quand tu seras reine, tu n'auras plus besoin de marcher. » La jeune fille se coupa l'orteil et enfila son pied dans la chaussure, quelque vive que fût la douleur, puis sortit retrouver le prince. Il la prit sur son cheval et partit avec elle comme sa fiancée ; mais ils devaient passer non loin de la tombe où deux colombes, perchées sur le noisetier, se mirent à glousser bien fort : _Roucou-oucou, roucou-oucou_ _Dans la pantoufle le sang coule :_ _L'escarpin était trop petit,_ _La fiancée est au logis_. Jetant un coup d'œil au pied chaussé, le prince vit que le sang en ruisselait. Il fit faire demi-tour à son cheval et ramena la fausse fiancée à sa maison, disant que ce n'était pas elle qu'il devait épouser, et que l'autre sœur devait essayer l'escarpin. La seconde sœur alla dans sa chambre avec l'escarpin et réussit très bien à y enfiler ses orteils, mais ce fut le talon qui refusa d'entrer. Oui, le talon était trop gros. Alors la mère lui tendit le couteau et lui dit : « Coupe un bout du talon : quand tu seras reine, tu n'auras plus besoin de marcher. » La jeune fille s'enleva un morceau du talon et força son pied dans la chaussure, quelque vive que fût la douleur, puis sortit retrouver le prince. Il la prit sur son cheval et partit avec elle comme sa fiancée. Mais quand ils furent non loin du noisetier, les deux colombes roucoulèrent de plus belle : _Roucou-oucou, roucou-oucou_ _Dans la pantoufle le sang coule :_ _L'escarpin était trop petit,_ _La fiancée est au logis_. De nouveau, le prince jeta un coup d'œil sur le pied chaussé, vit que le sang coulait, coulait si fort que le bas blanc en était tout rougi. Alors il tourna bride et ramena la fausse fiancée à la maison. — Ce n'est pas celle-là non plus que je dois épouser, dit-il. N'avez-vous pas d'autre fille ? — Non, dit le père, il n'y a plus ici que ce pauvre souillon de Cendrillon, la fille de ma première femme, qui est là-bas, dans la cuisine ; mais celle-là ne saurait être la fiancée, c'est impossible ! Le fils du roi déclara néanmoins qu'il fallait l'envoyer chercher, mais la mère s'interposa : « Non, non, elle n'est pas présentable : elle est beaucoup trop sale pour se laisser voir ! » Le prince insista : il y tenait absolument, et il fallut qu'on allât la chercher. Cendrillon voulut d'abord se laver les mains et le visage, puis elle vint s'incliner devant le fils du roi, qui lui tendit l'escarpin d'or. Ensuite elle s'assit sur un escabeau, sortit son pied du pesant sabot de bois et le chaussa de la pantoufle qui le moulait parfaitement. Quand elle se releva, en voyant son visage, le prince la reconnut et s'exclama : « C'est elle, la véritable fiancée ! » La belle-mère et les deux demi-sœurs en pâlirent de rage, mais le prince prit Cendrillon sur son cheval et partit avec elle. Et quand ils passèrent non loin du noisetier, les deux colombes blanches roucoulèrent doucement, quoique assez haut pour se faire entendre : _Roucou-oucou, roucou-oucou_ _La pantoufle n'a rien du tout :_ _Sa fiancée est avec lui,_ _L'escarpin n'est pas trop petit_. Puis les colombes quittèrent l'arbre et vinrent se poser gracieusement sur les épaules de Cendrillon, une à droite et l'autre à gauche, et elles restèrent là. Le jour des noces de Cendrillon avec le fils du roi, à l'heure de la cérémonie, arrivèrent les deux sœurs pour l'accabler de flatteries et de doux compliments, car elles voulaient s'insinuer dans ses bonnes grâces et avoir part à son bonheur. Le cortège gagnait l'église derrière les fiancés, et la sœur aînée marchait à droite de Cendrillon, la cadette à sa gauche ; alors la colombe de droite et la colombe de gauche leur piquèrent à chacune un œil. À la sortie de l'église, par contre, l'aînée marchait à gauche de Cendrillon et la cadette à droite ; alors les deux colombes leur piquèrent à chacune l'autre œil. Et c'est ainsi que, par la cécité jusqu'à leur dernier jour, elles ont été punies de leur méchanceté et de leur fausseté. # L'Oiseau d'Ourdi # (ou Barbe-Bleue dans la poésie populaire allemande) Il était une fois un maître sorcier qui se donnait l'apparence d'un pauvre et s'en allait mendier de maison en maison pour s'emparer des jolies filles. Nul au monde ne savait où il les emportait, et jamais plus elles ne revenaient de là-bas. Un jour, il se présenta à la porte de quelqu'un qui avait trois filles, jolies toutes les trois ; et il avait l'air d'un misérable mendiant tout loqueteux et presque à bout de forces, avec une vieille besace sur le dos qui semblait faite pour emporter les dons de la charité. Il mendia humblement un petit quelque chose à manger, et quand la fille aînée vint pour lui apporter un morceau de pain, il la toucha seulement du bout du doigt, ce qui l'obligea à sauter elle-même dans la besace. Aussitôt l'homme s'éloigna à grandes et solides enjambées, gagnant rapidement une sombre forêt au milieu de laquelle il avait sa maison. Là, dans cette maison, tout était merveilleux, et la jeune fille avait tout ce qu'elle pouvait désirer ou même souhaiter, car il lui donnait tout. « Mon trésor, lui dit-il, ton cœur ici n'aura plus rien à désirer : tu verras comme tu seras bien chez moi. » Quelques jours passèrent, puis il lui dit : — Je dois m'absenter et te laisser seule, mais ce ne sera pas long. Voici toutes les clefs de la maison : tu peux aller partout, à la seule exception d'une chambre, à laquelle correspond cette petite clef-ci. Dans celle-là, je t'interdis d'entrer sous peine de mort. Il lui confia également un œuf en lui disant : — Cet œuf, garde-le-moi précieusement et porte-le de préférence toujours sur toi, car s'il venait à se perdre, cela provoquerait un énorme malheur. Elle prit les clefs ainsi que l'œuf, promettant d'exécuter tout à la lettre. Une fois le maître parti, elle alla ici et là visiter la maison du haut en bas, admirant tout ce qu'il y avait à admirer, les chambres qui étincelaient d'or et d'argent, des merveilles telles qu'il lui semblait n'avoir jamais rien vu d'aussi beau, ni seulement rêvé de pareilles splendeurs. Elle arriva aussi, pour finir, devant la porte interdite et voulut passer outre ; mais la curiosité la retint, la tracassa, ne la laissa pas en repos. Elle considéra la petite clef, qui ressemblait aux autres, l'introduisit dans la serrure et la tourna un tout petit peu, mais la porte s'ouvrit d'un coup. Et que vit-elle, lorsqu'elle entra ? Au milieu de la chambre, un grand bac plein de sang où nageaient des membres humains, et à côté un gros billot avec une hache étincelante. Elle eut un tel sursaut d'effroi que l'œuf, qu'elle tenait à la main, lui échappa et tomba dans le bac sanglant. Elle le reprit bien vite et voulut le nettoyer du sang qui le tachait, mais elle eut beau laver, frotter, essuyer : il n'y avait rien à faire, le sang réapparaissait toujours. Peu de temps après, l'homme rentra de son voyage et sa première demande fut pour les clefs et pour l'œuf. Elle les lui tendit en tremblant, et il s'aperçut tout de suite, en voyant les taches sur l'œuf, qu'elle était entrée dans la chambre sanglante. — Puisque tu es entrée contre ma volonté dans la chambre, lui dit-il, tu vas maintenant y retourner contre ta volonté ! Tu as fini de vivre. Il la jeta à terre, la traîna par les cheveux dans la terrible pièce, lui trancha la tête sur le billot puis lui coupa les membres en inondant le plancher de son sang, et les jeta avec les autres dans le grand bac. — Maintenant je vais aller chercher la seconde ! dit à haute voix le maître sorcier, qui reprit aussitôt son apparence de pauvre mendiant et revint, comme tel, devant la porte de la maison où il avait pris la première demoiselle. La seconde lui apporta un morceau de pain, il la toucha du doigt et l'emporta comme l'autre. Elle ne connut pas un meilleur sort que sa sœur, car elle aussi se laissa pousser par la curiosité, ouvrit la porte et vit la chambre sanglante avant de le payer de sa vie. Alors le sorcier s'en alla chercher la troisième sœur, qui était plus intelligente et plus rusée. Après qu'il lui eut remis les clefs et l'œuf et se fut en allé, elle prit soin tout d'abord de mettre l'œuf en sûreté, puis elle visita toute la maison pour entrer finalement, elle aussi, dans la chambre interdite. Hélas ! que n'y vit-elle pas ? Ses deux sœurs bien-aimées gisaient là, horriblement assassinées et coupées en morceaux, dans le bac sanglant avec d'autres corps ! Courageusement elle s'avança et chercha leurs membres épars, les rassembla et les remit comme il convenait : la tête, le tronc, les bras et les jambes ; et dès que les corps furent complets, quand ils eurent tous leurs membres sans que rien ne manquât, la vie revint et les parties se ressoudèrent, si bien que les deux sœurs ouvrirent leurs yeux et se retrouvèrent bien vivantes. Quelle joie ! quelles embrassades ! quel bonheur pour toutes trois ! À son retour de voyage, l'homme réclama les clefs et l'œuf, sur lequel il ne décela pas la moindre tache de sang. Alors il dit : — Tu as subi l'épreuve : tu seras donc mon épouse. Il n'avait plus aucun pouvoir sur elle et devait, au contraire, faire absolument tout ce qu'elle désirait. — Très bien, dit-elle, mais tu devras d'abord porter une pleine besace d'or à mon père et à ma mère ; et cette besace, c'est sur ton dos que tu devras la porter, afin que ce présent ait un sens et une réelle valeur. Pendant ce temps, moi, je ferai les préparatifs de la noce. Elle courut alors retrouver ses sœurs, qu'elle avait cachées dans un cabinet, et leur dit : — L'heure et l'instant sont venus, et je peux vous sauver ! Le maudit va lui-même vous ramener, à son insu, à la maison en vous portant sur son dos. Mais dès que vous serez à la maison, envoyez-moi vite du secours ! Elle les mit toutes deux au fond d'une besace, puis elle les couvrit d'or, de façon qu'on ne puisse pas les voir, puis elle appela le maître sorcier et lui dit : — Voilà la besace que tu vas porter, mais ne t'arrête pas en chemin et ne cherche pas à te reposer : je te verrai de ma petite fenêtre d'en haut et je te surveillerai ! Le sorcier chargea la lourde besace sur son dos et se mit en route aussitôt, mais elle pesait si lourd que la sueur lui en coulait du front et lui inondait le visage. Il s'arrêta et s'assit pour se reposer un moment, mais une voix lui cria de l'intérieur de la besace : « Je te vois de ma petite fenêtre ! Tu te reposes ! Allons, marche ! » Il se releva et se remit en route, croyant que c'était sa fiancée qui lui avait crié cela depuis la lucarne, là-bas. Une nouvelle fois, il essaya de se reposer, mais cette fois encore la voix cria : « Je te vois de ma petite fenêtre ! Tu te reposes ! Veux-tu bien te remettre en marche ! » Puis chaque fois qu'il faisait mine de s'arrêter, succombant sous la charge, la voix le rappelait à l'ordre et il lui fallait marcher, de telle sorte qu'il finit par arriver à bout de souffle et en gémissant à la maison des parents, où il déposa son or et, avec l'or, les deux sœurs saines et sauves. Dans la maison du sorcier, pendant ce temps, la fiancée préparait la noce et invitait tous les amis de la maison à y prendre part. Puis elle prit une tête de mort qui grimaçait de toutes ses dents, la para de bijoux et lui mit une couronne de fleurs avant d'aller la poser devant la fenêtre du grenier comme si elle regardait dehors. Quand tout fut prêt, elle se plongea elle-même dans un tonneau de miel, puis alla se rouler dans l'édredon qu'elle avait éventré, de sorte qu'elle eut l'air d'un oiseau étrange, mais plus du tout d'un être humain ; et alors elle quitta la maison pour rentrer chez elle. En chemin, elle rencontra un premier groupe d'invités de la noce, qui lui demanda : _Ô toi, l'oiseau d'Ourdi, d'où viens-tu par ici ?_ — _Tout droit de la maison de l'Ourdisseur Ourdi_. — _Que fait là-bas la jeune fiancée ?_ — _De haut en bas, la maison préparée_ , _À la lucarne elle est allée_ _Pour voir venir les invités_. Plus loin, elle rencontra le fiancé lui-même qui s'en revenait d'un pas lourd et lent, tellement il était fatigué. Comme les autres, il l'interrogea : _Ô toi, l'oiseau d'Ourdi, d'où viens-tu par ici ?_ — _Tout droit de la maison de l'Ourdisseur Ourdi_. — _Que fait là-bas ma jeune fiancée ?_ — _De haut en bas, la maison préparée_ , _À la lucarne elle est allée_ _Pour voir venir son fiancé_. Regardant tout là-bas, au grenier, le fiancé y vit dans la lucarne la tête de mort couronnée de fleurs et ornée de bijoux ; mais comme c'était si loin encore, il crut que c'était, en effet, sa fiancée qui le regardait venir, et il la salua en lui faisant signe joyeusement. Mais dès qu'il se trouva avec les invités à l'intérieur de la maison, les frères et les parents des trois sœurs arrivèrent justement, accourant au secours de la fiancée. La sachant maintenant sauvée, ils fermèrent toutes les portes et les issues de la maison de façon que personne ne pût en sortir, puis ils y mirent le feu. Et le maître sorcier avec toute sa bande y périt dans les flammes. # Le Petit Chaperon Rouge # (version bavaroise) Il était une fois une adorable petite fillette que tout le monde aimait rien qu'à la voir, et plus que tous, sa grand-mère, qui ne savait que faire ni que donner comme cadeaux à l'enfant. Une fois, elle lui donna un petit chaperon de velours rouge et la fillette le trouva si joli, il lui allait tellement bien, qu'elle ne voulut plus porter autre chose et qu'on ne l'appela plus que le Petit Chaperon Rouge. Un jour, sa mère lui dit : — Tiens, Petit Chaperon Rouge, voici un morceau de galette et une bouteille de vin : tu iras les porter à ta grand-mère ; elle est malade et affaiblie, et elle va bien se régaler. Vas-y tout de suite, avant qu'il ne fasse trop chaud ; et sois bien sage en chemin et ne saute pas à droite ou à gauche pour aller tomber et me casser la bouteille de grand-mère, qui n'aurait plus rien. Et puis, dis bien bonjour en entrant et ne regarde pas d'abord dans tous les coins ! — Je serai sage et je ferai tout pour le mieux, promit le Petit Chaperon Rouge à sa mère, avant de lui dire au revoir et de partir. Mais la grand-mère habitait à une bonne demi-heure du village, tout là-bas, dans la forêt ; et lorsque le Petit Chaperon Rouge entra dans la forêt, ce fut pour rencontrer le loup. Mais elle ne savait pas que c'était une si méchante bête et elle n'avait pas peur. — Bonjour, Petit Chaperon Rouge, dit le loup. — Merci à toi et bonjour aussi, loup. — Où vas-tu de si bonne heure, Petit Chaperon Rouge ? — Chez grand-mère. — Que portes-tu sous ton tablier, dis-moi ? — De la galette et du vin, dit le Petit Chaperon Rouge ; nous l'avons cuite hier et je vais en porter à grand-mère, parce qu'elle est malade et que cela lui fera du bien. — Où habite-t-elle, ta grand-mère, Petit Chaperon Rouge ? demanda le loup. — Plus loin dans la forêt, à un quart d'heure d'ici ; c'est sous les trois grands chênes, et juste en dessous, il y a des noisetiers, tu reconnaîtras forcément, dit le Chaperon Rouge. Fort de ce renseignement, le loup pensa : « Un fameux régal, cette mignonne et tendre jeunesse ! Grasse chère, que j'en ferai : meilleure encore que la grand-mère, que je vais engloutir aussi. Mais attention, il faut être malin si tu veux les déguster l'une et l'autre. » Telles étaient les pensées du loup tandis qu'il faisait un bout de conduite au Petit Chaperon Rouge. Puis il dit, tout en marchant : — Toutes ces jolies fleurs dans le sous-bois, comment se fait-il que tu ne les regardes même pas, Petit Chaperon Rouge ? Et les oiseaux, on dirait que tu ne les entends pas chanter ! Tu marches droit devant toi comme si tu allais à l'école, mais c'est pourtant rudement joli, la forêt ! Le Petit Chaperon Rouge donna un coup d'œil alentour et vit danser les rayons du soleil entre les arbres, et puis partout, partout des fleurs qui brillaient. « Si j'en faisais un bouquet pour grand-mère, se dit-elle, cela lui ferait plaisir aussi ; il est tôt et j'ai bien le temps d'en cueillir. » Sans attendre, elle quitta le chemin pour entrer dans le sous-bois et cueillir des fleurs : une ici, l'autre là, mais la plus belle était toujours un peu plus loin, et encore plus loin dans l'intérieur de la forêt. Le loup, pendant ce temps, courait tout droit à la maison de la grand-mère et frappait à sa porte. — Qui est là ? cria la grand-mère. — C'est moi, le Petit Chaperon Rouge, dit le loup ; je t'apporte de la galette et du vin, ouvre-moi ! — Tu n'as qu'à tirer le loquet, cria la grand-mère. Je suis trop faible pour aller t'ouvrir. Le loup tira le loquet, poussa la porte et entra pour s'avancer tout droit, sans dire un mot, jusqu'au lit de la grand-mère, qu'il avala. Il mit ensuite sa chemise, s'enfouit la tête sous son bonnet de dentelle et se coucha dans son lit, puis tira les rideaux de l'alcôve. Le Petit Chaperon Rouge avait couru de fleur en fleur, mais à présent son bouquet était si gros que c'était tout juste si elle pouvait le porter. Alors elle pensa à sa grand-mère et se remit bien vite en chemin pour arriver chez elle. La porte était ouverte et cela l'étonna ; mais quand elle fut dans la chambre, tout lui parut de plus en plus bizarre et elle se dit : « Mon Dieu, comme tout est étrange aujourd'hui ! D'habitude, je suis si heureuse quand je suis chez grand-mère ! » Elle salua pourtant : — Bonjour, grand-mère ! Mais comme personne ne répondait, elle s'avança jusqu'à son lit et écarta les rideaux. La grand-mère était là, couchée, avec son bonnet qui lui cachait presque toute la figure, et elle avait l'air si étrange. — Comme tu as de grandes oreilles, grand-mère ! — C'est pour mieux t'entendre, répondit-elle. — Comme tu as de gros yeux, grand-mère ! — C'est pour mieux te voir, répondit-elle. — Comme tu as de grandes mains ! — C'est pour mieux te prendre, répondit-elle. — Oh ! grand-mère, quelle grande bouche et quelles terribles dents tu as ! — C'est pour mieux te manger, dit le loup, qui fit un bond hors du lit et avala le pauvre Petit Chaperon Rouge d'un seul coup. Sa voracité satisfaite, le loup retourna se coucher dans le lit et s'endormit bientôt, ronflant plus fort que fort. Le chasseur, qui passait devant la maison, l'entendit et pensa : « Qu'a donc la vieille femme à ronfler si fort ? Il faut que tu entres et que tu voies si elle a quelque chose qui ne va pas. » Il entra donc et, s'approchant du lit, vit le loup qui dormait là. — C'est ici que je te trouve, vieille canaille ! dit le chasseur. Il y a un moment que je te cherche !... Et il allait épauler son fusil, quand, tout à coup, l'idée lui vint que le loup avait peut-être mangé la grand-mère et qu'il pouvait être encore temps de la sauver. Il reposa son fusil, prit des ciseaux et se mit à tailler le ventre du loup endormi. Au deuxième ou au troisième coup de ciseaux, il vit le rouge chaperon qui luisait ; deux ou trois coups de ciseaux encore, et la fillette sautait dehors en s'écriant : « Oh, la, la, quelle peur j'ai eue ! Comme il faisait noir dans le ventre du loup ! » Et bientôt après, sortait aussi la vieille grand-mère, mais c'était à peine si elle pouvait encore respirer. Le Petit Chaperon Rouge courut chercher de grosses pierres qu'ils fourrèrent dans le ventre du loup ; et quand il se réveilla et voulut bondir, les pierres pesaient si lourd qu'il s'affala et resta mort sur le coup. Tous les trois étaient bien contents : le chasseur prit la peau du loup et rentra chez lui ; la grand-mère mangea la galette et but le vin que le Petit Chaperon Rouge lui avait apportés, se retrouvant bientôt à son aise. Mais pour ce qui est du Petit Chaperon Rouge, elle se jura : « Jamais plus de ta vie tu ne quitteras le chemin pour courir dans les bois, quand ta mère te l'a défendu. » On raconte encore qu'une autre fois, quand le Petit Chaperon Rouge apportait de nouveau de la galette à sa vieille grand-mère, un autre loup essaya de la distraire et de la faire sortir du chemin. Mais elle s'en garda bien et continua à marcher tout droit. Arrivée chez sa grand-mère, elle lui raconta bien vite que le loup était venu à sa rencontre et qu'il lui avait souhaité le bonjour, mais qu'il l'avait regardée avec des yeux si méchants : « Si je n'avais pas été sur la grand-route, il m'aurait dévorée ! » ajouta-t-elle. — Viens, lui dit sa grand-mère, nous allons fermer la porte et la bien cadenasser pour qu'il ne puisse pas entrer ici. Peu après, le loup frappait à la porte et criait : « Ouvre-moi, grand-mère ! C'est moi, le Petit Chaperon Rouge, qui t'apporte des gâteaux ! » Mais les deux gardèrent le silence et n'ouvrirent point la porte. Tête-Grise fit alors plusieurs fois le tour de la maison à pas feutrés, et, pour finir, il sauta sur le toit, décidé à attendre jusqu'au soir, quand le Petit Chaperon Rouge sortirait, pour profiter de l'obscurité et l'engloutir. Mais la grand-mère se douta bien de ses intentions. — Prends le seau, mon enfant, dit-elle au Petit Chaperon Rouge ; j'ai fait cuire des saucisses hier, et tu vas porter l'eau de cuisson dans la grande auge de pierre qui est devant l'entrée de la maison. Le Petit Chaperon Rouge en porta tant et tant de seaux que, pour finir, l'auge était pleine. Alors la bonne odeur de la saucisse vint caresser les narines du loup jusque sur le toit. Il se pencha pour voir et renifler, se pencha et renifla, renifla et se pencha si bien en tendant le cou, qu'à la fin il glissa et ne put plus se retenir. Il glissa du toit et tomba droit dans l'auge de pierre où il se noya. Allégrement, le Petit Chaperon Rouge regagna sa maison, et personne ne lui fit le moindre mal. # Le Vieux Sultan Un paysan avait un chien fidèle qui s'appelait Sultan, mais il était vieux et avait perdu toutes ses dents, si bien qu'il ne pouvait plus rien mordre. Et un jour, devant sa porte, le paysan dit à sa femme : « Demain matin, je prends le fusil et je vais tuer le vieux Sultan qui n'est plus bon à rien. » La femme s'émut de compassion pour la bonne vieille bête fidèle et dit : — Lui qui nous a si bien et si fidèlement servis pendant de si longues années, nous pourrions bien lui accorder le pain de la grâce ! — Eh quoi ? dit l'homme, tu n'y penses pas ! Il n'a plus une dent dans la gueule et aucun voleur n'a peur de lui ; c'est bien son heure de partir à présent. Il nous a servis, mais aussi cela lui a valu la bonne pâtée dont il s'est nourri ! Le pauvre vieux chien, couché au soleil non loin de là, entendit tout et fut bien triste d'apprendre qu'il devait mourir le lendemain matin. Il avait un bon ami en la personne du loup, et, le soir, il se faufila jusqu'à la forêt pour aller lui confier sa peine et le triste destin qui l'attendait. — Écoute, camarade, reprends courage ! Je vais t'aider dans ta détresse et j'ai une bonne idée : le matin, de très bonne heure, ton maître s'en va faire les foins avec sa femme, et ils emmènent leur enfant avec eux, puisqu'il n'y a personne à la maison pour le garder ; ils le couchent à l'ombre d'une haie pendant qu'ils travaillent. Tu n'auras qu'à te coucher du côté du petit comme si tu voulais le garder, et moi je sortirai de la forêt pour venir enlever l'enfant ; alors tu te précipiteras derrière moi et tu me poursuivras comme pour me le reprendre ; je le laisserai tomber et tu le rapporteras à tes maîtres, qui croiront que tu l'as sauvé et qui te seront bien trop reconnaissants pour vouloir te faire ensuite le moindre mal : tout au contraire, tu rentreras en complète grâce et ils ne te laisseront plus jamais manquer de rien. Cette idée plut beaucoup au chien et tout se passa comme prévu. Le père poussa des cris pendant que le loup fuyait à travers champs avec l'enfant dans sa gueule ; mais quand le vieux Sultan le rapporta, il ne se tenait plus de joie et il caressa le bon chien en lui disant : « Aussi longtemps que tu vivras, tu seras bien nourri et bien traité ; jamais on ne touchera même à un poil de ta fourrure ! » Et, se tournant vers sa femme, il lui dit : « Va vite à la maison et prépare-lui une bonne soupe au lait bien trempée, qu'il n'ait pas de mal à se donner pour la mâcher, et donne-lui mon oreiller : je lui en fais cadeau pour qu'il soit bien couché. » À partir de ce moment, le vieux Sultan eut la vie si belle qu'il n'avait plus rien à désirer. Le loup vint un peu plus tard lui faire visite et se félicita de la bonne tournure des choses. — Mais je compte bien, mon vieux, que tu fermeras l'œil si d'aventure je viens prendre au troupeau de ton maître un joli mouton bien dodu, ajouta-t-il. La vie devient de plus en plus dure de nos jours ! — Cela non, n'y compte pas ! répondit le chien. Je reste fidèle à mon maître et je ne peux pas consentir à cela ! Le loup pensa qu'il ne parlait pas sérieusement et, la nuit même, se glissa dans la bergerie pour emporter son mouton. Mais le fidèle Sultan avait averti son maître des mauvaises intentions du loup, et le maître était là qui l'attendait, armé d'un fléau avec lequel il lui caressa douloureusement l'échine. Le loup ne put que s'enfuir, mais il cria au chien : « Attends seulement un peu : tu vas me payer cela, faux frère ! » Le lendemain matin, déjà, le sanglier, envoyé par le loup, vint provoquer le chien en duel dans la forêt pour régler cette affaire d'honneur. Le vieux Sultan ne put trouver d'autre témoin que le vieux chat, un très vieux chat qui n'avait que trois pattes. Quand ils s'en allèrent tous les deux vers la forêt pour le duel, le pauvre vieux chat marchait péniblement sur ses trois pattes, et la douleur lui faisait tenir sa queue toute droite. Le loup et son témoin le sanglier se trouvaient déjà sur le terrain, et quand ils virent de loin approcher leur adversaire, ils crurent qu'il s'était armé d'une épée en prenant la queue droite du chat pour une arme. Et quand ils virent d'un peu plus près le chat boiteux qui s'avançait en plongeant de la tête à chaque pas, ils crurent que celui-là ramassait des pierres pour les jeter sur eux. Pris de peur tous les deux, ils se défilèrent : le sanglier fonça dans un épais fourré pour s'y cacher, et le loup monta dans un arbre pour se tenir à l'abri. En arrivant sur le terrain du duel, le chien et le chat furent très étonnés de n'y trouver personne. Ils cherchèrent des yeux alentour. Or, le sanglier était si gros qu'il n'avait pas réussi à se dissimuler entièrement dans le fourré, et ses oreilles dépassaient. Le chat, si vieux qu'il fût, en les voyant bouger, crut que c'était une souris qui bougeait là et lui sauta dessus, mordant à belles dents dans cette proie inespérée. Avec un hurlement de douleur, le sanglier s'enfuit en quittant sa cachette au triple galop, mais non sans leur crier : « Dans l'arbre, le fautif est là-haut, dans l'arbre ! » Levant les yeux, le vieux chien et le vieux chat aperçurent le loup, en effet, qui se sentit si honteux de sa couardise, si humilié de s'être montré si lâche, qu'il accepta la paix que le chien lui offrait. # Margot-la-Malice Il y avait une cuisinière appelée Margot qui portait des chaussures à talons rouges, et quand elle les mettait pour sortir, elle se dandinait et se tournait de droite et de gauche en se disant, toute joyeuse, qu'elle était vraiment jolie fille. Quand elle rentrait à la maison, par bonne humeur, elle buvait un bon petit coup ; et comme le vin met en appétit, elle choisissait le meilleur de ce qu'elle avait cuisiné pour le goûter ; mais elle goûtait toujours, jusqu'à ce qu'elle n'eût plus faim du tout. « C'est un devoir pour la cuisinière, disait-elle, de savoir quel goût a ce qu'elle fait. » Et comme cela, elle avait toujours le meilleur de tout. Un jour, son maître lui annonça : — Margot, ce soir j'ai un invité ; tu nous feras rôtir deux chapons bien tendres et savoureux. — Je m'y mets tout de suite, monsieur ! répondit Margot, qui s'en alla choisir deux jolis chapons qu'elle tua, ébouillanta, pluma, vida, prépara et enfila sur la broche, attendant le soir pour les mettre au feu. Les chapons commencèrent à bien dorer et bientôt furent à point, mais l'invité n'était toujours pas là. Alors Margot cria à son maître : — Si l'invité n'arrive pas, il va falloir que je retire les chapons du feu ; mais c'est un crime et une désolation de ne pas les manger quand ils sont cuits à point, juteux et parfaits ! — Bon, dit le maître, je fais un saut dehors pour ramener l'invité. Dès que le maître eut le dos tourné, Margot retira la broche de devant le feu et mit les chapons de côté, puis elle se dit : « À rester comme cela devant le feu de braise, on se donne soif à force de transpirer. Et qui sait maintenant quand ils vont venir ? En attendant, je vais faire un saut à la cave et boire un petit coup. » Elle y courut, attrapa une cruche pour la remplir, se souhaita bonne santé et que Dieu la bénisse, sur quoi elle but un long trait. Mais comme la cruche n'était pas vide, elle se dit à haute voix : « Le vin se tient bien : et il n'est pas bon de le couper ! » Alors elle but tout le reste à longs traits. « Ça, c'était vraiment un bon coup, bien sérieux ! » Elle remonta ensuite, remit les chapons à rôtir, après les avoir bien beurrés et arrosés, et tout gaiement, elle fit tourner la broche. La peau, joliment croustillante et dorée, chantait que les chapons étaient cuits à point. — Mais on ne sait jamais, dit Margot, il pourrait y manquer un petit quelque chose et ce serait trop dommage ! Alors elle goûta en y mettant le doigt, qu'elle lécha. — Mon Dieu que ces chapons sont bons ! s'exclama-t-elle. C'est un vrai péché de ne point les manger immédiatement ! Ils sont parfaits. Parfaits ! Elle courut à la fenêtre pour voir si le maître n'arrivait pas. Mais non ! Il n'y avait personne en vue. Elle revint aux chapons et tourna la broche. — Là ! en voilà un qui a l'aile qui commence à brûler ! Le mieux, c'est encore que je la mange tout de suite ! Elle la coupe et la mange, la trouve si savoureuse qu'elle se dit : « L'autre, il faut que je la coupe aussi, autrement le maître va trouver cela bizarre. » Et quand elle eut englouti les deux ailes, elle courut encore à la fenêtre ; mais personne ne venait. — Si cela se trouve, pensa-t-elle, ils sont peut-être entrés quelque part et ne viendront pas dîner ici ! Mais ne t'en fais pas, Margot : il y en a un qui est de toute façon entamé ; alors tu vas boire un bon petit coup et là-dessus, finir de le manger ! Tu seras plus tranquille quand il sera tout mangé, et puis c'est péché que de laisser se perdre et dessécher un aussi succulent chapon qui est un véritable don de Dieu ! Elle fit un second saut, jusqu'à la cave, où elle se rafraîchit fort noblement le gosier, puis s'en revint, gaillarde et joyeuse, manger le chapon en entier. — Où est le premier, l'autre doit suivre, se dit-elle alors : ils vont ensemble, il n'y a pas de doute, et ce qui est bon pour l'un va pour l'autre également. Je crois qu'un autre petit coup ne me ferait pas de mal, ma petite Margot. Aussitôt elle descendit s'humecter le palais bien vigoureusement, puis elle fit prendre au second chapon le chemin qu'avait suivi le premier. Elle venait juste de finir son petit festin personnel quand son maître rentra. — Pressons-nous, Margot ! lui cria-t-il, notre invité arrive à l'instant ! — Bien monsieur, je vais servir ! dit Margot. Le maître, pendant ce temps, vérifia s'il y avait tout ce qu'il fallait sur la table et s'empara du grand couteau à découper qu'il alla aiguiser dans le couloir. L'invité arriva, frappant civilement à la porte extérieure, et Margot y courut. Voyant que c'était l'invité, elle mit un doigt sur sa bouche et lui chuchota : « Ne faites pas de bruit et filez vite avant que mon maître ne vous voie, sinon cela va mal aller pour vous ! Il vous a invité à dîner, c'est vrai, mais c'est uniquement dans l'idée de vous couper les deux oreilles. Écoutez-le : il est en train d'aiguiser son couteau ! » Dès qu'il eut entendu le bruit du couteau qu'on aiguisait dans le couloir, l'invité fit demi-tour et prit ses jambes à son cou pour dévaler l'escalier et filer dans la rue. Margot ne perdit pas le nord et se précipita vers son maître en criant : — Eh bien, ils sont jolis, les gens que vous invitez ! — Pourquoi dis-tu cela, Margot ? Qu'est-ce qu'il y a ? — Oui, oui, du joli monde ! reprit Margot. Celui-là m'a arraché les deux chapons que je venais servir, et le voilà parti avec ! — En voilà des façons ! grogna le maître tout dépité à la pensée de ses deux succulents chapons rôtis. Si seulement il m'en avait laissé un, que j'aie quelque chose à manger ! Vite, il cria à l'autre de s'arrêter, et l'autre n'en fit rien, mais courut de plus belle. Alors le maître se lança à sa poursuite, tenant toujours le couteau dans sa main, et tout en courant il lui criait : « Pas les deux ! Pas les deux ! » voulant dire par là qu'il ne réclamait qu'un seul des deux chapons. Mais après ce que lui avait dit la Margot, le fuyard comprit que son hôte n'en voulait qu'à une de ses oreilles et ne lui couperait pas les deux. Sur quoi il se mit à courir comme s'il avait le feu aux trousses, car il tenait, lui, à les ramener toutes les deux chez lui, ses oreilles. # Le Voyage du Petit-Poucet Un tailleur avait un fils qui était né minuscule et n'avait jamais dépassé la taille du pouce d'un homme ; c'était pourquoi on l'avait appelé le Petit-Poucet. Mais si petit qu'il fût, il avait du cœur au ventre et plus de courage que bien des grands. — Père, dit-il un jour, je veux et je dois m'en aller pour voir du pays et connaître le monde. — Tu as raison, fiston ! répondit le père qui prit une longue aiguille à tricoter, y souda une garde de cire à cacheter qu'il fondit sur la chandelle, et la lui tendit. Tiens ! voilà au moins une épée pour te défendre sur ta route ! lui dit-il. Le minuscule tailleur, qui voulait partager le dernier repas avec ses parents, sauta jusqu'à la cuisine pour voir un peu ce que Madame sa mère avait cuisiné comme festin d'adieu. — Madame ma mère, que nous donnes-tu aujourd'hui à manger ? demanda-t-il. — Regarde toi-même ! dit la mère. Alors le Petit-Poucet sauta dans la cheminée et regarda dans le chaudron ; mais comme il avait trop tendu le cou en se penchant sur la marmite, la vapeur qui montait du bouillon l'enleva et l'emporta par la cheminée. Un moment, il chevaucha les airs sur cette vapeur puis il redescendit par terre ; et le petit tailleur, qui se trouvait du coup au milieu du monde extérieur, commença son voyage et s'en alla d'abord s'engager chez un maître tailleur ; mais dans cette maison, la nourriture ne lui plaisait pas. — Madame la maîtresse, si vous ne nous donnez pas une meilleure nourriture, dit le Petit-Poucet, je m'en irai d'ici et demain de bonne heure, j'écrirai à la craie sur votre porte : « Trop de pommes de terre et pas assez de viande ; adieu, roi des patates ! » — Qu'est-ce que tu veux encore, petite sauterelle ? cria la maîtresse de maison en colère, empoignant un torchon pour en frapper notre Poucet. Mais le petit tailleur sauta se mettre à l'abri sous le dé, glissa un œil au-dehors et tira la langue à la maîtresse. — Je vais t'apprendre ! cria-t-elle en prenant le dé entre ses doigts pour s'emparer de l'insolent. Mais le dé était vide, car déjà le Petit-Poucet avait sauté se cacher dans le torchon ; et quand elle secoua le torchon pour le trouver, il s'était glissé dans une fente de la table. — Hé, hé ! Madame la maîtresse ! l'appela-t-il en sortant sa petite tête. Elle voulut le frapper d'un coup de torchon, mais il était déjà dans le tiroir, où elle finit quand même par le trouver, le prendre et le jeter dehors. Le petit tailleur s'en alla sans souci, marchant droit devant lui, et arriva ainsi dans une grande forêt, où il fit la rencontre de bandits qui s'apprêtaient à dévaliser le trésor du roi. En voyant le petit bout d'homme, ils se dirent : « Voilà un marmouset qui pourrait bien passer par un trou de serrure et qui nous servirait fort bien de passe-partout ! » — Holà ! toi, le géant Goliath, cria l'un d'eux, cela te dirait-il de venir avec nous à la salle du trésor ? Tu te glisserais à l'intérieur et tu nous passerais l'argent. Le Petit-Poucet réfléchit un moment, finit par accepter et s'en fut avec eux à la salle du trésor, dont il examina la porte du haut en bas pour voir si elle n'avait pas une bonne petite fente quelque part. Il ne lui fallut pas longtemps pour découvrir ce qu'il cherchait : une fente assez large pour qu'il pût s'y glisser. Il allait s'y engager, quand l'une des deux sentinelles en faction devant la porte l'aperçut et dit à son compagnon de garde : — Dis donc, qu'est-ce que c'est que cette vilaine araignée qui court par là ? Je vais l'écraser sous ma botte ! — Laisse donc aller cette pauvre bête qui ne t'a rien fait ! répondit l'autre soldat. Pendant ce temps, le Petit-Poucet avait heureusement passé à travers la fente et se trouvait à l'intérieur de la chambre du trésor. Il alla ouvrir la fenêtre, sous laquelle attendaient les voleurs, et il commença à leur jeter les écus d'or un à un. Il était en plein travail quand il entendit le roi qui venait admirer ses richesses, et vite, vite, il se cacha. Le roi remarqua bien que nombre de beaux écus d'or manquaient, mais il n'arrivait pas à comprendre qui avait bien pu les voler, puisque rien n'était fracturé et que toutes les serrures et tous les verrous étaient intacts et parfaitement fermés. Au bout d'un moment, le roi s'en alla et dit aux sentinelles devant la porte : « Ayez l'œil, vous autres, il y a quelqu'un qui en veut à mon or. » La porte refermée, Petit-Poucet s'était remis au travail, mais les sentinelles, de l'extérieur, entendirent les écus qui dansaient à l'intérieur et qui sonnaient cling ! cling ! cling ! Ils se précipitèrent à l'intérieur pour s'emparer du voleur. Ouiche donc ! Le Petit-Poucet les avait entendus dans leur lourde hâte, et il s'était montré beaucoup plus rapide, sautant dans un coin pour se cacher derrière un bel écu brillant. Il s'était glissé dessous et personne ne pouvait le voir ; alors il s'offrit le luxe d'appeler les gardes pour se moquer d'eux : « Hé ! hé ! Je suis ici ! » Les sentinelles accoururent, mais le temps qu'elles arrivent, il était déjà sous un autre écu, dans un autre coin, et leur criait : « Ho ! ho ! Je suis là ! » Les soldats y bondirent, mais le Petit-Poucet ne les avait pas attendus et criait d'un troisième endroit : « Ohé ! Je suis ici ! » Puis ailleurs, et encore ailleurs, et ainsi de suite jusqu'à ce que les soldats, exaspérés et las d'être moqués, s'en allèrent et reprirent leur garde devant la porte du trésor. Aussitôt les pièces d'or reprirent le chemin de la fenêtre et tous les écus y passèrent prestement, jusqu'à ce que le trésor fût parfaitement vide. La dernière pièce, Petit-Poucet l'expédia de toutes ses forces, sauta dessus et s'en alla avec elle par la fenêtre pour venir tomber au milieu des autres. Les bandits ne tarissaient pas d'éloges et multipliaient leurs félicitations : « Tu es un grand héros, finirent-ils par lui dire, veux-tu être notre chef ? » Le Petit-Poucet les remercia mais s'excusa, car, leur dit-il, il voulait d'abord voir le monde. Quand ils firent le partage du butin, notre minuscule tailleur ne put rien prendre qu'un petit sou, n'ayant pas la force de porter autre chose avec lui. Il boucla alors le ceinturon de son épée, souhaita le bonjour à la bande et prit la route entre ses jambes. Ici ou là, il entra travailler chez certains maîtres tailleurs, mais ce genre de travail ne lui plaisait guère et, pour finir, il loua ses services comme valet dans une auberge. Mais là, ce furent les servantes qui le prirent en grippe parce qu'elles n'arrivaient jamais à l'apercevoir, alors qu'il voyait tout ce qu'elles faisaient en cachette, se trouvant toujours là pour les surprendre et aller raconter aux patrons combien d'assiettées elles avaient mangées à table ou ce qu'elles avaient chipé dans le garde-manger pour leur compte personnel. « Tu n'y perdras rien pour attendre, pensèrent-elles, et nous te le ferons payer ! » Elles complotèrent, en cherchant quelque vilain tour à lui jouer. Un jour que l'une d'elles était en train de faucher dans le jardin, voyant le Petit-Poucet batifoler et gambader parmi les hautes herbes de la pelouse, elle s'empressa de faucher l'endroit et de le ramasser avec l'herbe, qu'elle alla bien vite porter aux vaches, en cachette. Parmi les vaches, il y en avait une grosse et noire, qui l'avala avec son herbe, mais sans lui faire de mal. Dans le ventre de la bête, il ne se plaisait pas, mais pas du tout, parce que c'était tout sombre et qu'il n'y avait pas la moindre lumière dans ces noires ténèbres. Quand on vint traire la vache, il se mit à crier : _Traich, trich, train_ _Le seau n'est-il pas bientôt plein ?_ Mais nul ne l'entendit à cause du bruit que faisait le lait en fusant dans le seau, et cela ne servit de rien. Un peu plus tard arriva l'aubergiste dans son étable : « Demain, dit-il devant la grosse vache noire, on va tuer et bouchoyer cette bête. » Petit-Poucet, dans le ventre de la vache, fut pris d'une telle peur qu'il se mit à crier de toute sa petite voix claire : — Laissez-moi d'abord sortir ! Je suis dedans ! — Mais où es-tu ? demanda le maître, qui avait fort bien entendu cette voix, mais ne savait pas d'où elle pouvait venir. — Dans la noire ! Dans la noire ! cria le Poucet. Mais le maître ne le comprit pas et s'en alla tout bonnement. Le lendemain matin la vache fut abattue, saignée et découpée. Par bonheur le Petit-Poucet passa entre les coups de hache et les coups de couteau sans y laisser sa vie, mais il resta prisonnier de la chair à saucisses ; et lorsque le boucher s'approcha et se mit à hacher, le marmouset hurla de toute la force de ses petits poumons : « Pas trop menu ! pas trop menu ! Je suis au milieu de la viande ! » Mais à quoi bon ? Avec le bruit que faisait le hachoir, personne ne pouvait rien entendre. Petit-Poucet se trouvait à présent jeté dans son plus grand péril, mais le péril donne du nerf et fait marcher les jambes : à force de sauter et de bondir de-ci de-là pour éviter le pire, il réussit à passer entre les couteaux du hachoir sans dommage pour ses membres, et il sauva sa peau. Sa peau et rien de plus, car sortir de là, il ne le pouvait pas, quoi qu'il fit : la vie qu'il venait de sauver n'avait au bout du compte pas d'avenir ailleurs qu'à l'intérieur d'une saucisse. Ce domicile était plutôt exigu, à vrai dire, et il lui fallut, de plus, se trouver suspendu dans la cheminée pour y être fumé, ce qui fit que le temps de cet interminable séjour lui parut plutôt long ! Mais enfin, en plein hiver, arriva le jour qu'il fut dépendu, car la saucisse était destinée à l'assiette d'un client. Aussi, quand l'aubergiste, dans sa cuisine, se mit à couper la saucisse en tranches, le Petit-Poucet fit-il bien attention de ne pas avancer sa tête au-dehors pour ne pas risquer de se faire couper le cou. Libéré, enfin, il respira le bon air du dehors et bondit pour se sauver. Car dans cette maison où il en avait tant vu, il n'avait pas l'intention de rester une seconde de plus : sa seule hâte et son unique pensée étant de reprendre la route pour aller voir du pays. Pourtant sa liberté ne fut pas de longue durée. En pleine campagne, il se trouva nez à nez avec un renard qui l'avala sans même y prendre garde, tout en rêvant à autre chose. — Eh ! monsieur le renard ! hurla le petit homme, je suis déjà au beau milieu de votre gosier, laissez-moi reprendre ma liberté ! — Tu as raison, répondit le renard, te manger toi, c'est tout autant que rien. Mais il faut que tu me promettes toutes les poules du poulailler de ton père, si tu veux que je te laisse aller. — De tout mon cœur ! répondit le Petit-Poucet. Les poules, tu les auras toutes jusqu'à la dernière, je te le promets ! Alors le renard lui rendit sa liberté et le porta lui-même jusque chez lui, dans la maison paternelle. Et quand le père retrouva son cher petit bout de fils, il fut si heureux qu'il donna bien volontiers ses poules au renard. — Et en plus, annonça triomphalement le Petit-Poucet à son père, je te rapporte une bonne petite somme d'argent ! Et il lui tendit la pièce d'un sou qu'il avait gagnée au cours de son périple. — Mais pourquoi le renard s'était-il vu donner toutes les malheureuses poules sans qu'elles eussent rien à dire ? — Eh bien, petit idiot, ton père aussi aime mieux son enfant que les poules de son poulailler ! # La Lumière bleue Il était une fois un soldat qui avait, pendant de longues années, fidèlement servi le roi ; mais il fut licencié quand la guerre fut terminée, en dépit des nombreuses blessures qui avaient fait de lui un invalide. Le roi s'adressa à lui en personne et lui dit : « Tu peux rentrer chez toi, je n'ai plus besoin de tes services ; mais tu n'as plus d'argent à attendre à présent, les soldes n'étant versées qu'à ceux qui sont à mon service. » Accablé de soucis et ne sachant comment gagner sa vie, le soldat s'éloigna et marcha tout le jour. Le soir, il se trouva dans une forêt où il vit, dans l'obscurité, briller une lumière ; il s'en approcha et arriva ainsi à une maison qu'habitait une sorcière. — Donne-moi asile pour la nuit, lui demanda-t-il, et si peu que ce soit à boire et à manger, sinon je vais tomber d'inanition ! — Holà ! s'écria la sorcière, qui est-ce qui donne quelque chose à un soldat vagabond ? Pourtant je vais me montrer charitable et t'accepter, à condition que tu fasses ce que je te demande. — Que veux-tu ? demanda le soldat. — Que tu me bêches mon jardin demain, dit la sorcière. Il accepta et travailla, le lendemain, autant qu'il le put et de toutes ses forces, mais le soir survint avant qu'il eût terminé son ouvrage. — Bon ! lui dit la sorcière, je vois bien que tu ne pourrais pas en faire plus aujourd'hui et je vais te garder une nuit de plus, à condition que demain, tu me fendes mon bois. Le soldat fendit du bois toute la journée et le soir, la sorcière lui offrit de le coucher une nuit encore. — Tu n'auras qu'à me faire un tout petit travail demain, lui dit-elle : j'ai un vieux puits à sec derrière la maison, au fond duquel j'ai laissé tomber ma lumière ; c'est une chandelle qui brûle avec une flamme bleue et qui ne s'éteint pas. Il te suffira de me la remonter. Le lendemain, la vieille femme le mena à son vieux puits et l'y fit descendre dans un panier attaché à la corde. Il trouva tout de suite la lumière bleue et fit un signe pour se faire remonter. La vieille femme le hissa en tirant la corde, mais quand il fut à la hauteur de la margelle, elle tendit la main pour prendre la lumière. — Non, déclara le soldat qui se méfiait de ses mauvaises intentions, tu n'auras ta chandelle que lorsque j'aurai, moi, les deux pieds sur la terre ferme ! Furieuse, la sorcière lâcha la corde et s'en alla, le laissant tomber au fond du puits où il se retrouva, le malheureux, sans pourtant s'être rien cassé ni fait de mal ; la lumière bleue éclairait toujours, mais à quoi cela lui servait-il ? Là où il était, il n'avait plus qu'à attendre la mort. Tout à ses tristes pensées, il fourra machinalement la main dans sa poche et y trouva sa pipe à demi bourrée. « Ce sera ma dernière consolation ! » se dit-il, et il l'alluma à la flamme bleue pour en tirer quelques bonnes bouffées. Quand la fumée eut envahi le fond du puits, un petit homme surgit tout soudain devant lui et demanda : — Maître, que désires-tu ? Quels sont tes ordres ? — Moi, s'étonna le soldat, quels ordres aurais-je à donner ? — Je dois faire tout ce que tu désires, répondit le petit homme. — Très bien, dans ce cas, tire-moi d'abord de ce puits ! Le nain le prit par la main et le conduisit par un chemin souterrain, mais sans oublier d'emporter avec lui la lumière bleue ; en cours de route, il lui montra les trésors accumulés et cachés là par la sorcière, et le soldat se bourra les poches d'or et en emporta autant qu'il pouvait en porter. Une fois dehors, il dit au petit homme : — Entre à présent chez la vieille sorcière, attache-la et livre-la à la justice ! Quelques instants plus tard, il la vit passer en coup de vent, à cheval sur un chat sauvage et poussant des hurlements affreux, puis le petit homme reparaissait presque aussitôt pour lui annoncer : — Tout est terminé et la sorcière est déjà pendue au gibet. Quels sont tes ordres à présent, maître ? — Rien pour l'instant, répondit le soldat ; tu peux rentrer chez toi. Mais trouve-toi à ma disposition immédiate aussitôt que je t'appellerai ! — Il te suffira d'allumer ta pipe à la lumière bleue, et je serai là, lui répondit le petit homme qui disparut aussitôt. Le soldat s'en revint à la ville d'où il était parti, choisit la meilleure auberge, se fit faire un bel habit, après quoi il se fit donner par l'aubergiste la chambre la plus confortable et la plus luxueuse qu'on pouvait lui préparer. Une fois que tout fut prêt, quand il fut lui-même bien installé, le soldat appela le petit homme et lui dit : — Le roi, que j'avais servi avec fidélité, m'a licencié en me laissant crever de faim : c'est pourquoi je voudrais à présent me venger ! — Que dois-je faire ? questionna le petit homme. — Ce soir, tard, quand la princesse sera couchée et endormie, tu me l'amèneras jusqu'ici, dans son sommeil, pour qu'elle me fasse office de servante. — Pour moi, répondit le petit homme, la chose n'est que facile ; mais pour toi, elle est pleine de danger dans ses conséquences, car si jamais cela se sait, tu ne t'en tireras pas à bon compte. Le douzième coup de minuit sonnait encore quand la porte s'ouvrit brusquement : le petit homme arriva dans la chambre du soldat, portant la princesse. — Ah ! te voilà ! s'exclama le soldat. Alors mets-toi au travail, et en vitesse ! Attrape le balai et fais-moi le ménage de ma chambre ! Dès qu'elle eut fini de balayer, il lui commanda de venir jusqu'à son fauteuil, allongea les jambes et dit : « Tire-moi mes bottes ! » Il les lui lança ensuite à travers la figure et elle dut les ramasser, les lui décrotter, les lui faire briller et reluire impeccablement. Les yeux mi-clos, sans une protestation ni un soupir, elle fit tout ce qu'il lui ordonna jusqu'au premier chant du coq ; alors le petit homme la remporta au palais royal et la recoucha dans son lit. Le matin, après son réveil, la princesse s'en fut trouver son père et lui raconta qu'elle avait eu un rêve étrange. — J'ai été emportée comme par un éclair dans les rues, lui dit-elle, et amenée dans la chambre d'un soldat auquel j'ai dû servir de domestique, obéissant à tous ses ordres et lui faisant les travaux les plus rebutants : il m'a fallu lui balayer sa chambre et lui cirer ses bottes. Ce n'était qu'un rêve, ajouta-t-elle, et pourtant je suis aussi exténuée que si je l'avais réellement vécu. — Le rêve aussi pourrait avoir été réel, dit le roi, et je te donnerai un conseil : bourre ta poche de petits pois et perce-la d'un petit trou qui les laisse passer ; comme cela, si l'on vient te chercher de nouveau, ils marqueront la trace de ton passage dans les rues. Mais tandis que le roi parlait ainsi, le petit homme était là, invisible, et il entendit tout. Dans la nuit, quand il emporta la princesse endormie par les rues, il y eut bien quelques petits pois qui tombèrent, par-ci par-là, de sa poche ; mais l'indication qu'ils pouvaient donner était nulle, car le malin petit homme en avait parsemé toutes les rues. Et jusqu'au chant du coq, de nouveau, la princesse dut travailler et obéir comme la plus humble des servantes. Le lendemain matin, le roi envoya ses gens pour relever sa trace, mais à quoi pouvaient-ils aboutir, quand, dans toutes les rues, ils trouvèrent les enfants des pauvres en train de ramasser des petits pois et déclarant, émerveillés : — Il en a plu cette nuit ! — Il faut que nous trouvions autre chose, décida le roi. Ce soir, en allant te coucher, tu resteras chaussée ; et avant de revenir de là-bas, tu cacheras l'une de tes chaussures : je saurai bien faire en sorte qu'elle soit retrouvée. Le petit homme noir, cette fois encore, avait surpris la conversation ; le soir, quand le soldat désira qu'il allât encore chercher la princesse, il voulut le détourner de son projet en lui disant qu'il ne voyait pas le moyen de déjouer cette ruse, et que si la chaussure était découverte chez lui, cela ne pourrait que tourner très mal. « Fais ce que je te dis ! » répondit le soldat ; et la princesse, pour la troisième nuit consécutive, dut accomplir sa besogne de servante. Mais avant d'être retransportée au palais, elle avait caché sa chaussure sous le lit. Le lendemain matin, le roi fit rechercher par toute la ville la chaussure de sa fille, qui fut trouvée chez le soldat ; mais il avait lui-même, sur les instances du petit homme, quitté la ville quelques instants auparavant. Il n'en fut pas moins rejoint, arrêté et jeté en prison, alors que, dans la précipitation de sa fuite, il avait oublié et laissé derrière lui ce qu'il avait de plus précieux : son or et la lumière bleue ; il n'avait plus en poche qu'un unique ducat. Dans ses chaînes, debout à la fenêtre de son cachot, il vit passer l'un de ses anciens camarades dans la rue et frappa au carreau pour attirer son attention. Lorsque le camarade se fut approché assez près pour l'entendre, il lui cria : « Sois bon, et va me chercher le petit baluchon que j'ai laissé à l'auberge : je te donnerai un ducat. » Le camarade courut à l'auberge et lui rapporta peu après son bien tant désiré. Dès qu'il se retrouva seul, le soldat tira sa pipe et l'alluma à la lumière bleue pour faire venir le petit homme noir. « Sois sans crainte, dit le petit homme à son maître ; laisse-les faire et t'emmener où ils voudront, pourvu que tu aies avec toi la lumière bleue. » Le soldat comparut le lendemain devant le tribunal, et le juge prononça contre lui la sentence de mort, bien qu'il ne fût coupable de rien. Comme on allait l'emmener sur les lieux du supplice, il demanda au roi une ultime grâce. — Laquelle ? s'enquit le roi. — Qu'il me soit permis de fumer une dernière pipe en cours de route. — Tu peux en fumer trois, déclara le roi, mais ne va pas t'imaginer que je te ferai grâce de la vie ! Alors le soldat sortit sa pipe et l'alluma à la lumière bleue pour en tirer deux ou trois bouffées, et déjà le petit homme se trouvait là, devant lui, serrant un petit gourdin dans sa petite main. — Que commande mon maître ? demanda-t-il. — Bâtonne-moi ces mauvais juges et leurs sbires à les laisser sur le carreau, dit-il, et n'épargne pas le roi qui m'a si indignement traité ! Le petit homme tomba sur eux comme la foudre, frappant ici et là, en zigzag, et à peine son gourdin en avait-il touché un qu'il restait cloué au sol, n'osant plus bouger. Le roi, dans son épouvante, en fut réduit aux supplications et aux prières, allant jusqu'à faire don au soldat, pour seulement avoir la vie sauve, de son royaume et de sa fille comme épouse. # SUPPLÉMENT PÉDAGOGIQUE ## Fiche élève 1 : souvenez-vous des contes de votre enfance ! ### 1. Langue a. Trouvez deux homophones du mot « conte ». b. Employez chacun de ces trois termes dans trois phrases de votre invention permettant d'en saisir le sens. ### 2. Vous avez déjà lu des contes à l'école primaire. Vous souvenez-vous des titres ? ### 3. Voici des noms de conteurs célèbres. Faites une recherche dans un dictionnaire des noms propres, au C.D.I. ou sur un moteur de recherche pour compléter le tableau suivant : **Nom** | **Siècle** | **Langue d'écriture** | **Un titre au choix** ---|---|---|--- Charles Perrault | | | Amadou Hampâté Bâ | | | Lewis Carroll | | | Jacob et Wilhelm Grimm | | | Roald Dahl | | | Hans Christian Andersen | | | Anonyme | | | « Ali Baba et les quarante voleurs » N'hésitez pas à lire ces contes. ## Fiche élève 2 : observez ! ### 1. Décrivez la première de couverture. ### 2. Grâce à cette couverture, qu'imaginez-vous trouver dans ce recueil ? **Le saviez-vous ?** Un recueil est un livre qui recueille, qui réunit plusieurs écrits. On peut trouver par exemple des recueils de poésies, de récits portant sur un thème choisi, ou encore des recueils de lois. Les mots « anthologie », « florilège », « annales » ou « compilation » sont des synonymes du terme « recueil ». ## Fiche élève 3 : entrez dans l'histoire ! ### 1. Recopiez et remplissez le tableau ci-dessous pour comprendre comment sont ancrées les histoires. **Conte** | **Premiers mots du récit** | **Lieu du récit (s'il est exprimé)** | **Époque du récit (si elle est exprimée)** | **Les deux principaux temps verbaux utilisés** ---|---|---|---|--- « Blanche-Neige » | | | | « Les Trois Fileuses » | | | | « Le Fiancé brigand » | | | | « La Lumière bleue » | | | | ### 2. Que ressentez-vous lorsque vous entendez la formule d'entrée « il était une fois » ? **Bilan** Le cadre spatio-temporel d'un conte est indéterminé. En effet, l'histoire se déroule dans un passé lointain et un lieu géographique imprécis. La formule d'entrée, souvent utilisée, permet de s'immerger dans un monde imaginaire. **Le saviez-vous ?** On doit la formule d'entrée « il était une fois » à Charles Perrault. Elle est réutilisée dans de nombreuses langues, notamment en anglais ( _once upon a time_ ), en allemand ( _es war einmal_ ) ou encore en italien ( _c'era una volta_ ). On retrouve souvent la même structure de phrase « il était une fois, quelqu'un qui... », ou encore « il était une fois, quelque part... ». ## Fiche élève 4 : avez-vous bien lu ? ### 1. « Blanche-Neige » a. Pourquoi Blanche-Neige s'appelle-t-elle ainsi ? b. Pour quelle raison le chasseur ne la tue-t-il pas ? c. Quel stratagème le chasseur met-il en place afin de faire croire à la reine qu'il lui a obéi ? d. Quel est le métier des sept nains ? Citez le texte pour justifier votre réponse. e. Quels sont les trois différents pièges que la reine tend à Blanche-Neige pour la tuer ? ### 2. « Les Trois Fileuses » a. Quel est le principal défaut de l'héroïne ? b. Chacune des fileuses a un défaut physique. Quels sont-ils ? c. À quelle condition les trois fileuses viennent-elles au secours de l'héroïne ? ### 3. « La Lumière bleue » a. Quelle est l'injustice que subit le soldat au début du conte ? b. Que se passe-t-il lorsque le soldat allume sa pipe à l'aide de la lumière bleue ? c. Quel est le souhait, très risqué, du soldat ? d. Par quel stratagème le roi parvient-il à retrouver ce soldat ? e. Quel est le dénouement pour le soldat ? ## Fiche élève 5 : observez les personnages ### 1. Recopiez et remplissez le tableau ci-dessous pour comprendre comment sont élaborés les personnages des contes. Conte | Nom du personnage | Caractéristiques physiques (expressions à relever dans le texte) | Caractéristiques morales (expressions à relever dans le texte) ---|---|---|--- « Jeannot et Margot » | La vieille | | « Cendrillon » | Cendrillon | | « Margot-la-Malice » | Margot-la-Malice | | ### 2. Trouvez un synonyme et un antonyme de chaque caractéristique relevée. ### Bilan Les personnages des contes sont souvent stéréotypés : leur aspect physique correspond à leur caractère. Le nom du personnage peut révéler une caractéristique physique (Le Petit Chaperon rouge, Blanche-Neige, Cendrillon, etc.), un trait de caractère (la méchante sorcière, Margot-la-Malice), ou encore une fonction (le Roi, la Reine, le Père, etc.). La mémorisation des noms est ainsi facilitée lors de la transmission orale des contes. ## Fiche élève 6 : décrivez ### 1. Revoyez les différentes valeurs de l'imparfait. ### 2. Préparation de rédaction En binôme ou en petits groupes, listez différentes expressions qui peuvent être utilisées dans une description pour remplacer les verbes « être » et « avoir ». Cette liste vous permettra d'enrichir votre rédaction. ### 3. Rédaction Décrivez à l'imparfait une sorcière ou une princesse de votre invention. Votre production sera composée de deux paragraphes : l'un mettant en valeur ses caractéristiques physiques, l'autre ses caractéristiques morales. N'oubliez pas de donner un nom à votre personnage. Vous pouvez pour cela vous aider d'une image (trouvée dans un livre de contes, ou sur Internet). ## Fiche élève 7 : étudiez le merveilleux Le mot « merveilleux » vient du latin _mirabilia_ qui signifie « les choses qui étonnent ». ### 1. « L'Oiseau d'Ourdi » Quel objet est magique ? Pourquoi est-il magique ? ### 2. « Blanche-Neige » Pourquoi peut-on dire que le miroir de la reine est merveilleux ? ### 3. « Jeannot et Margot » et « La Lumière bleue » Quel est le type de personnage merveilleux que l'on retrouve dans ces deux contes ? ### 4. « La Lumière bleue » Quel est le personnage surnaturel ? ### 5. « Contes du crapaud » Que fait d'extraordinaire le crapaud de chacun de ces deux contes ? ### 6. « Cendrillon » Pourquoi peut-on dire que la métamorphose de Cendrillon est magique ? ### Bilan En littérature, on appelle merveilleux l'irruption du surnaturel dans un récit. Les éléments merveilleux peuvent être des objets (un tapis volant, une baguette magique, des bottes de sept lieues, etc.), des personnages (un ogre, une fée, une sorcière, etc.) ou des événements (comme une métamorphose ou un ensorcellement). ## Fiche élève 8 : retenez l'orthographe Votre professeur vous dictera un passage du conte « Chat et souris associés » situé entre le début du texte et « le petit pot de graisse fut mis en sécurité ». ### Comment préparer une dictée ? 1. Lisez plusieurs fois le passage et comprenez-le bien (si nécessaire, cherchez la définition des mots inconnus, comme celle du verbe « consentir »). 2. Observez les difficultés orthographiques (comme dans le mot « audace ») et soulignez-les. 3. Faites une première dictée sur une partie du texte avec vos parents ou un camarade. 4. Listez les erreurs commises, cherchez-en l'explication (revoyez par exemple la différence entre « ou » et « où ») et mémorisez-en la graphie correcte (si besoin, recopiez les mots difficiles pour vous plusieurs fois). 5. Faites-vous dicter ce passage à nouveau, jusqu'à ne plus faire d'erreur. 6. Recommencez les étapes 3 à 5 avec une autre partie de l'extrait. Après votre préparation, vous devez pouvoir écrire entièrement cet extrait et connaître les « pièges » à éviter pour ne plus faire d'erreur. ## Fiche élève 9 : étudiez la structure – « La Belle au bois dormant » ### 1. La situation initiale Que s'apprête à célébrer le royaume ? ### 2. L'élément perturbateur Quel événement perturbe la fête ? ### 3. Les péripéties a. Effectuez une recherche afin de comprendre ce qu'est un fuseau. b. Qu'arrive-t-il à la princesse ? c. Quelles sont les conséquences de cet événement pour le royaume ? d. Pourquoi peut-on dire que le prince fait preuve de courage lorsqu'il décide d'aller retrouver la princesse Fleur-d'Épine ? ### 4. L'élément de résolution Quel exploit accomplit le prince ? ### 5. La situation finale Pourquoi peut-on dire que le conte se termine bien ? ### Bilan Les contes sont souvent construits à partir d'un même schéma. Ces cinq différentes étapes sont modulables. Les connaître permet de mieux comprendre le déroulement de l'action, et de les utiliser comme support de brouillon lorsque l'on veut soi-même écrire un conte. ## Fiche élève 10 : étudiez la morale ### 1. « L'Oiseau d'Ourdi » a. Quelle leçon doit-on tirer du conte ? b. Cette leçon, la morale de l'histoire, est-elle exprimée clairement ou le lecteur doit-il la déduire lui-même ? ### 2. « Cendrillon » a. Quelle leçon doit-on tirer de « Cendrillon » ? b. Est-elle exprimée clairement ou le lecteur doit-il la déduire lui-même ? ### 3. À chaque conte, sa (ou ses) morale(s) Saurez-vous relier les contes aux morales qui leur correspondent ? Attention, il peut y avoir plusieurs morales pour un même conte. **Conte** | **Morale** ---|--- « Jeannot et Margot » | Il ne faut pas s'attacher à ce qui est éphémère, comme la beauté. « Chat et souris associés » | Il ne faut pas rejeter les personnes dont l'apparence physique est hors du commun. « Cendrillon » | L'ingratitude est toujours punie. « Les Trois Fileuses » | Quels que soient les accords passés, c'est toujours le plus fort qui vainc. « La Lumière bleue » | Il faut se soutenir au sein d'une même famille. « Blanche-Neige » | Il ne faut pas accepter de cadeaux d'inconnus. | La méchanceté et l'hypocrisie sont punies, la bonté, elle, est récompensée. ### Bilan Outre le divertissement du lecteur à travers une histoire imaginaire, les contes ont pour objectif de lui transmettre une leçon. Si cette leçon est exprimée clairement, il s'agit d'une morale explicite ; si c'est au lecteur de la déduire, il s'agit d'une morale implicite. ### Pour aller plus loin Visionnez le spot publicitaire pour la marque Badoit, qui reprend et transforme le conte de « Cendrillon ». 1. Quelle nouvelle morale cette publicité propose-t-elle au conte ? 2. Quelles caractéristiques de la boisson cette publicité présente-t-elle ? ## Fiche élève 11 : interrogez-vous sur la fonction des contes 1. Pour qui sont écrits les contes des frères Grimm ? 2. À quoi ces contes vous permettent-ils de réfléchir de façon générale ? 3. Dans quels autres courts écrits littéraires retrouve-t-on une morale ? 4. Pourquoi utilise-t-on des histoires imaginaires pour faire réfléchir petits et grands ? ## Fiche élève 12 : exprimez-vous ### Exposé En binôme, étudiez la reprise d'un conte dans une autre œuvre (littéraire, picturale, théâtrale, cinématographique, musicale, etc.). Pour cela, vous pouvez par exemple effectuer une recherche sur un conte que vous avez choisi dans le recueil ou parmi les lectures cursives. 1. Notez les références précises des deux œuvres (date, nom de l'artiste, pays de l'artiste). 2. Quelles sont les différences de forme entre les deux versions ? 3. Y a-t-il des différences entre l'histoire des deux versions ? Si oui, quelles sont les principales modifications ? 4. Quelle version préférez-vous ? Pourquoi ? ### Pour aller plus loin – Livres _Les Mille et Une Nuits_ , abrégés par V. Charpentier, éd. École des loisirs, 2005. Amadou Hampâté Bâ, _Petit Bodiel et autres contes de la savane_ , éd. Stock, 2006. Antoine de Saint Exupéry, _Le Petit Prince_ , éd. Gallimard, 1946. J.M.G. Le Clézio, _Mondo et autres histoires_ , éd. Gallimard, 1982. Erik Orsenna, _La grammaire est une chanson douce_ , éd. Stock, 2001. L. Frank Baum, _Le Magicien d'Oz_ , éd. Gallimard, 1998. – Téléfilms Jacques Demy, _Peau d'âne_ , 1970. Jean Cocteau, _La Belle et la Bête_ , 1946 (en noir et blanc). Paul Grimault, _Le Roi et l'Oiseau_ , 1980 (dessin animé avec des textes de Jacques Prévert, d'après _La Bergère et le Ramoneur_ d'Andersen). Les adaptations par Disney de nombreux contes ( _Alice au pays des merveilles_ , _Cendrillon_ , _Blanche Neige_ , etc.). TABLE Blanche-Neige Les Trois Fileuses Chat et souris associés La Belle au Bois Dormant ou la Princesse Fleur-d'Épine Le Fiancé brigand Jeannot et Margot Le Conte du crapaud Cendrillon L'Oiseau d'Ourdi (ou Barbe-Bleue dans la poésie populaire allemande) Le Petit Chaperon Rouge (version bavaroise) Le Vieux Sultan Margot-la-Malice Le Voyage du Petit-Poucet La Lumière bleue Supplément pédagogique Dans la même collection Notes . On ne sait généralement plus aujourd'hui que c'était le nom d'un chaudron qui restait dans l'âtre. . Annonceur : Danone. Produit : Badoit. Période : octobre 2002. Agence : Louis XIV DDB. Description : Cendrillon, revu et corrigé. On pourra trouver cette publicité notamment sur le lien suivant : http://www.ina.fr/video/PUB2393649115
[ 198, 198, 46751, 2123, 50031, 27145, 198, 198, 4264, 274, 198, 198, 41, 6, 1872, 300, 84, 198, 198, 25835, 27250, 198, 198, 37, 2543, 3876, 295, 198, 198, 35, 2634, 79, 27083, 83, 300, 2634, 13528, 1058, 7544, 259, 1853, 198, 198, 16224, 412, 13, 41, 13, 43, 1539, 1853, 12797, 443, 6019, 2634, 434, 279, 2634, 67, 37300, 2350, 198, 198, 1797, 15766, 997, 2634, 33865, 1058, 41417, 23539, 486, 21738, 2996, 198, 198, 1797, 15766, 7043, 37124, 3992, 1058, 41417, 23539, 486, 21738, 4761, 198, 198, 3123, 17717, 260, 257, 220, 25125, 2634, 848, 3036, 2634, 264, 516, 10287, 40560, 69, 2634, 34303, 1058, 198, 198, 1797, 15766, 1058, 41417, 23539, 486, 17464, 2996, 198, 198, 34, 68, 3188, 997, 2634, 33865, 257, 220, 25125, 2634, 40560, 27315, 2634, 1582, 4217, 32, 198, 198, 1174, 6836, 20954, 298, 341, 390, 300, 6, 2634, 67, 578, 333, 1058, 220, 220, 198, 1174, 33666, 220, 25125, 4548, 17809, 277, 10924, 555, 502, 403, 959, 11, 555, 25049, 346, 5482, 16175, 261, 11, 17809, 1226, 293, 279, 3565, 325, 1904, 2162, 4229, 220, 25125, 4548, 17809, 277, 10924, 555, 2702, 265, 11, 555, 17266, 34803, 33945, 264, 24449, 959, 11, 17809, 29012, 1226, 21348, 8358, 256, 448, 443, 285, 14378, 4031, 4548, 2162, 555, 275, 42324, 2044, 261, 279, 559, 43933, 2123, 264, 274, 390, 2821, 551, 69, 1187, 2162, 555, 686, 72, 11, 17809, 302, 500, 2123, 443, 333, 1226, 293, 3748, 2162, 17809, 11223, 1726, 1226, 293, 27506, 5848, 3183, 13805, 3212, 1058, 4229, 220, 25125, 4548, 17809, 277, 10924, 390, 285, 3760, 8270, 2821, 542, 274, 1189, 385, 748, 40560, 66, 896, 745, 25125, 6368, 390, 8591, 3968, 435, 10671, 40004, 13, 220, 220, 198, 34, 68, 664, 518, 346, 374, 292, 15140, 10287, 5556, 269, 2634, 75, 14064, 65, 411, 542, 274, 748, 1216, 14064, 411, 27145, 11, 1582, 11632, 10287, 421, 1424, 4689, 31974, 35851, 3248, 271, 360, 579, 415, 11, 3852, 34574, 2123, 11899, 313, 11, 327, 437, 20190, 261, 11, 1004, 4767, 270, 609, 2136, 261, 13805, 469, 11, 1004, 23020, 496, 7043, 4767, 270, 12, 47, 280, 66, 316, 11, 1004, 376, 666, 32682, 24393, 392, 11, 1004, 1482, 660, 7043, 18824, 3885, 13, 198, 198, 34, 280, 1851, 495, 1058, 1004, 4767, 270, 609, 2136, 261, 13805, 469, 264, 6, 3258, 25792, 660, 12797, 28381, 359, 343, 748, 5104, 1834, 13, 23279, 1358, 1582, 1757, 367, 10705, 1847, 357, 1507, 3104, 12, 1129, 2780, 1267, 10673, 12251, 10299, 65, 14, 42, 9869, 65, 500, 16880, 4820, 198, 198, 1174, 23286, 2384, 494, 390, 300, 6, 64, 1133, 333, 1058, 220, 220, 198, 1174, 46751, 357, 1558, 5332, 532, 47072, 8, 2123, 50031, 27145, 357, 1558, 4521, 532, 1248, 3270, 8, 43052, 66, 15104, 1299, 2123, 5206, 928, 947, 435, 10671, 1746, 11, 10287, 390, 2821, 1216, 14064, 411, 374, 34455, 75, 14064, 1156, 2123, 2240, 4528, 14064, 1156, 10287, 542, 274, 2123, 300, 2634, 70, 437, 274, 308, 2224, 6368, 11, 6121, 415, 257, 1040, 72, 17809, 6761, 393, 1000, 551, 267, 12496, 43933, 2296, 419, 13485, 13, 220, 198, 35, 15037, 9131, 337, 127, 232, 11682, 20444, 16779, 2849, 628, 4808, 35882, 43052, 79, 853, 274, 62, 837, 7980, 27250, 645, 1367, 1270, 628, 4808, 14772, 2631, 500, 390, 5596, 62, 837, 7980, 27250, 645, 13539, 24, 628, 4808, 3118, 1692, 40833, 11, 2123, 1960, 411, 299, 280, 29333, 274, 28141, 442, 1133, 62, 837, 7980, 27250, 645, 352, 12762, 628, 4808, 14772, 2547, 495, 62, 837, 7980, 27250, 645, 9796, 19, 628, 4808, 2348, 66, 10141, 11, 62, 7980, 27250, 645, 838, 5824, 628, 4808, 3123, 9852, 7043, 285, 14378, 551, 4019, 474, 4662, 62, 837, 645, 838, 3270, 628, 4808, 3123, 26354, 698, 1192, 62, 837, 7980, 27250, 645, 807, 3980, 628, 4808, 44, 2634, 67, 22161, 62, 837, 7980, 27250, 645, 642, 1983, 628, 4808, 2725, 14064, 67, 260, 62, 837, 7980, 27250, 645, 25643, 628, 4808, 43, 6, 46, 9892, 824, 22161, 62, 837, 7980, 27250, 645, 5867, 628, 4808, 3123, 24101, 645, 343, 62, 837, 7980, 27250, 645, 28658, 628, 4808, 43, 6, 27682, 2634, 28803, 62, 837, 7980, 27250, 645, 11546, 628, 4808, 36910, 2123, 11320, 62, 837, 7980, 27250, 645, 25326, 628, 4808, 43, 6, 38351, 2213, 858, 11294, 7043, 1583, 449, 988, 25727, 2123, 1770, 13, 30785, 62, 837, 7980, 27250, 645, 17318, 628, 4808, 5574, 746, 22161, 62, 837, 7980, 27250, 645, 5441, 628, 4808, 3123, 360, 1142, 959, 449, 454, 288, 6, 403, 1779, 34684, 2634, 62, 837, 7980, 27250, 645, 4317, 628, 4808, 14772, 7489, 728, 325, 390, 1012, 14064, 1158, 62, 837, 7980, 27250, 645, 7632, 628, 4808, 41572, 485, 62, 837, 645, 3261, 628, 4808, 33, 280, 293, 390, 1778, 361, 62, 837, 7980, 27250, 645, 2681, 628, 4808, 3123, 327, 312, 62, 837, 7980, 27250, 645, 2310, 628, 4808, 3123, 347, 378, 559, 21628, 260, 62, 837, 7980, 27250, 645, 1248, 628, 4808, 22834, 2634, 78, 2123, 38201, 660, 62, 837, 7980, 27250, 645, 860, 198, 198, 2, 1086, 6362, 12, 8199, 10045, 198, 198, 33666, 220, 25125, 4548, 17809, 277, 10924, 11, 551, 3339, 259, 289, 1428, 11, 627, 392, 10287, 781, 420, 684, 1715, 7438, 1153, 7043, 269, 8207, 725, 68, 748, 458, 8139, 2123, 7043, 7043, 16809, 11, 17809, 302, 500, 45567, 220, 25125, 4548, 840, 786, 2123, 13233, 4548, 1614, 415, 17809, 277, 268, 25792, 33945, 45567, 1196, 4548, 555, 2207, 324, 260, 434, 390, 1489, 271, 288, 6, 2634, 65, 14064, 710, 11, 645, 343, 2123, 1534, 623, 13, 17906, 256, 392, 271, 627, 6, 13485, 13233, 4548, 299, 2634, 70, 4604, 368, 434, 256, 448, 551, 2754, 415, 8591, 894, 293, 497, 10045, 35851, 12, 2934, 71, 669, 11, 8591, 302, 500, 384, 279, 1557, 64, 443, 466, 328, 83, 257, 35138, 3367, 257, 328, 84, 8270, 2123, 4161, 271, 4273, 2737, 308, 448, 4879, 390, 25889, 22234, 14064, 1156, 969, 8591, 497, 10045, 13, 327, 6, 25125, 4548, 33721, 307, 559, 11, 2906, 13805, 469, 969, 8591, 497, 10045, 11, 627, 6, 268, 443, 23291, 415, 8591, 302, 500, 3367, 469, 64, 1058 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Why knowing your purpose saves you so much time in life I used to be a person who always wanted to please everyone in my life. The truth of it is that there is nothing wrong in wanting to make those around you proud however it becomes a barrier for your life when you do things just to please everyone around you. I would say that discovering your purpose early in life is one of the best things that you can do for yourself. It prevents you from so many unwanted obstacles that you could possible face. When I was younger, I honestly thought that I knew what I wanted to do with my life. In fact, I was sure that was the correct profession for me because I loved it so much. No one forced me to think in that direction nor did I feel any pressure from society to want to pursue said career. To even prove my honest desire for this profession, I went to university to study a course that would eventually put me on the right track of this desire that I so long for since my youth. However to my surprise, I was wrong, very wrong about it all and what I never thought of doing in my life, not even for a second is exactly where I was thrown- by God. My purpose is to educate! I am a teacher! I never wanted to be a teacher, I wanted to become a world class physician. I thought it was my purpose, the reason for my creation. I ate, slept, and breathe anything that would move me in the direction of becoming an awesome physician not knowing that I was journeying on a path that wasn’t my own. So I was thrown into teaching and I fought it for years. My first year was miserable only because I didn’t have an open mind nor did I think that I was called to be an educator. It wasn’t until my 4th year of teaching that I discovered that this was something that I didn’t mind doing actually and that I did very much enjoy it and not until my 7th year did I fully know that this was my purpose. Discovering your purpose in life is crucial if you desire to live a happy, healthy and fulfilled life. I want to share 5 reasons why knowing/discovering your purpose saves you so much time (and money) in life. WHEN YOU KNOW YOUR PURPOSE YOU THINK MORE CLEARLY When you are unsure of the path to take in life everything will look fuzzy and hazy to you. You will think that you are doing the correct thing meanwhile you are not. This was me for years- I thought becoming a physician was what I was made for. It wasn’t until I was thrown into the field of teaching that I not only discovered that I wasn’t seeing clearly about my life but that indeed this was my purpose. When I eventually made that discovery, I was able to think so much more clearly, way more than the 7- 8 years that I was constantly thinking of many ways to become a physician. I didn’t have “foggy mind” syndrome any more because it was all so clear to me. I could see the potential of my growth while I was teaching because I no longer focused on what was not mine in the first place.Desire to think and see your purpose more clearly. YOU BECOME MUCH MORE HAPPIER I have to admit, when I didn’t know my purpose I was so unhappy. It was some of the darkest times of my life because I was pursuing something that wasn’t for me at all. I was confused as to why it was so hard for me. I was putting an insane amount of pressure on myself. I was sad that I felt like I was being left behind. I felt like a complete and total failure and disappointment. I was just bad and sad for me. However, the moment in which I slowing began to see that my calling and purpose was indeed to become a teacher so that I could later in life fulfill what God was calling me to do I found a new sense of peace and happiness. Ever since my discovery, I’ve been so happy about my calling, my purpose, my destiny. I wake up every morning with a smile knowing that I am able to teach my students something new that day. I love standing in front of students who are eager to learn and teach them all I know and I derive such great happiness and joy in knowing that I am able to shape the minds of the next generation.Do something that will make you happy! YOU SAVE TONS OF MONEY When you are unsure of what you are meant to do in life, it can be quite costly. I mean it is EXPENSIVE. I can tell you that I’ve spent hundreds of thousands of dollars pursuing a field that was not for me. It’s not fun to spend money where you don’t need to spend money. Everyone loves to save when and where they can. Knowing your purpose saves you tons of money.Don’t waste money on something you are not sure is for you. IT TAKES YOU INTO YOUR DESTINY, EARLY! For years, I thought I was going in the right direction to my destiny but I am so grateful that God re-routed me in the correct direction. Imagine driving on the highway without a GPS or navigation system to a location you’ve never been to in your life. Let’s say you were to exit on exit 5 but you kept driving to exit 50 only to discover that your exit was exit 5. How you would you feel? Bothered and annoyed I’m sure! That’s exactly what happens when we don’t know our purpose in life. We keep walking and pursuing other things aimlessly. Sometimes we have jobs that are giving us a temporary financial benefit and we stay the course for years only to be honest with ourselves after serving that company for 30 years of our life unfulfilled. When you know your purpose it takes you to your destiny, your exit quicker. You begin to operate in your destiny way quicker than if you had to wait for 30 years.Desire to get there without any delays. YOU FEEL ACCOMPLISHED When you know your purpose you will feel accomplished. Although your purpose will evolve as you grow and mature in life, you will have a sense of accomplishment when you are truly walking in your purpose. It can be super dreadful to be walking a path that is not meant for you. I constantly tell people especially my students that the one thing that you don’t want to do in life is to be walking on the wrong path and discover it when it’s too late. The only way that you will be accomplished is if you open yourself up to actively pursuing your purpose in life.Desire to discover your purpose today if you want to feel accomplished in life. Do you know the purpose for your life? Share your thoughts with me down below.
[ 5195, 6970, 534, 4007, 16031, 345, 523, 881, 640, 287, 1204, 198, 198, 40, 973, 284, 307, 257, 1048, 508, 1464, 2227, 284, 3387, 2506, 287, 616, 1204, 13, 383, 3872, 286, 340, 318, 326, 612, 318, 2147, 2642, 287, 10291, 284, 787, 883, 1088, 345, 6613, 2158, 340, 4329, 257, 13054, 329, 534, 1204, 618, 345, 466, 1243, 655, 284, 3387, 2506, 1088, 345, 13, 314, 561, 910, 326, 21611, 534, 4007, 1903, 287, 1204, 318, 530, 286, 262, 1266, 1243, 326, 345, 460, 466, 329, 3511, 13, 632, 15174, 345, 422, 523, 867, 19125, 17648, 326, 345, 714, 1744, 1986, 13, 198, 198, 2215, 314, 373, 7099, 11, 314, 12698, 1807, 326, 314, 2993, 644, 314, 2227, 284, 466, 351, 616, 1204, 13, 554, 1109, 11, 314, 373, 1654, 326, 373, 262, 3376, 7573, 329, 502, 780, 314, 6151, 340, 523, 881, 13, 1400, 530, 4137, 502, 284, 892, 287, 326, 4571, 4249, 750, 314, 1254, 597, 3833, 422, 3592, 284, 765, 284, 10660, 531, 3451, 13, 1675, 772, 5879, 616, 5508, 6227, 329, 428, 7573, 11, 314, 1816, 284, 6403, 284, 2050, 257, 1781, 326, 561, 4191, 1234, 502, 319, 262, 826, 2610, 286, 428, 6227, 326, 314, 523, 890, 329, 1201, 616, 6205, 13, 2102, 284, 616, 5975, 11, 314, 373, 2642, 11, 845, 2642, 546, 340, 477, 290, 644, 314, 1239, 1807, 286, 1804, 287, 616, 1204, 11, 407, 772, 329, 257, 1218, 318, 3446, 810, 314, 373, 8754, 12, 416, 1793, 13, 198, 198, 3666, 4007, 318, 284, 20771, 0, 314, 716, 257, 4701, 0, 314, 1239, 2227, 284, 307, 257, 4701, 11, 314, 2227, 284, 1716, 257, 995, 1398, 14325, 13, 314, 1807, 340, 373, 616, 4007, 11, 262, 1738, 329, 616, 6282, 13, 314, 15063, 11, 21256, 11, 290, 18044, 1997, 326, 561, 1445, 502, 287, 262, 4571, 286, 5033, 281, 7427, 14325, 407, 6970, 326, 314, 373, 30068, 710, 1112, 319, 257, 3108, 326, 2492, 447, 247, 83, 616, 898, 13, 1406, 314, 373, 8754, 656, 7743, 290, 314, 8350, 340, 329, 812, 13, 2011, 717, 614, 373, 22444, 691, 780, 314, 1422, 447, 247, 83, 423, 281, 1280, 2000, 4249, 750, 314, 892, 326, 314, 373, 1444, 284, 307, 281, 45562, 13, 632, 2492, 447, 247, 83, 1566, 616, 604, 400, 614, 286, 7743, 326, 314, 5071, 326, 428, 373, 1223, 326, 314, 1422, 447, 247, 83, 2000, 1804, 1682, 290, 326, 314, 750, 845, 881, 2883, 340, 290, 407, 1566, 616, 767, 400, 614, 750, 314, 3938, 760, 326, 428, 373, 616, 4007, 13, 198, 198, 44596, 278, 534, 4007, 287, 1204, 318, 8780, 611, 345, 6227, 284, 2107, 257, 3772, 11, 5448, 290, 23085, 1204, 13, 314, 765, 284, 2648, 642, 3840, 1521, 6970, 14, 67, 29392, 278, 534, 4007, 16031, 345, 523, 881, 640, 357, 392, 1637, 8, 287, 1204, 13, 198, 198, 12418, 1677, 7013, 35876, 16592, 33079, 48933, 7013, 2320, 17248, 12011, 30301, 1503, 11319, 198, 198, 2215, 345, 389, 22147, 286, 262, 3108, 284, 1011, 287, 1204, 2279, 481, 804, 34669, 290, 387, 7357, 284, 345, 13, 921, 481, 892, 326, 345, 389, 1804, 262, 3376, 1517, 15066, 345, 389, 407, 13, 770, 373, 502, 329, 812, 12, 314, 1807, 5033, 257, 14325, 373, 644, 314, 373, 925, 329, 13, 632, 2492, 447, 247, 83, 1566, 314, 373, 8754, 656, 262, 2214, 286, 7743, 326, 314, 407, 691, 5071, 326, 314, 2492, 447, 247, 83, 4379, 4084, 546, 616, 1204, 475, 326, 5600, 428, 373, 616, 4007, 13, 1649, 314, 4191, 925, 326, 9412, 11, 314, 373, 1498, 284, 892, 523, 881, 517, 4084, 11, 835, 517, 621, 262, 767, 12, 807, 812, 326, 314, 373, 7558, 3612, 286, 867, 2842, 284, 1716, 257, 14325, 13, 314, 1422, 447, 247, 83, 423, 564, 250, 69, 519, 1360, 2000, 447, 251, 14027, 597, 517, 780, 340, 373, 477, 523, 1598, 284, 502, 13, 314, 714, 766, 262, 2785, 286, 616, 3349, 981, 314, 373, 7743, 780, 314, 645, 2392, 5670, 319, 644, 373, 407, 6164, 287, 262, 717, 1295, 13, 5960, 557, 284, 892, 290, 766, 534, 4007, 517, 4084, 13, 198, 198, 36981, 347, 2943, 13649, 45859, 12011, 367, 2969, 11901, 1137, 198, 198, 40, 423, 284, 9159, 11, 618, 314, 1422, 447, 247, 83, 760, 616, 4007, 314, 373, 523, 19283, 13, 632, 373, 617, 286, 262, 35995, 1661, 286, 616, 1204, 780, 314, 373, 15461, 1223, 326, 2492, 447, 247, 83, 329, 502, 379, 477, 13, 314, 373, 10416, 355, 284, 1521, 340, 373, 523, 1327, 329, 502, 13, 314, 373, 5137, 281, 13251, 2033, 286, 3833, 319, 3589, 13, 314, 373, 6507, 326, 314, 2936, 588, 314, 373, 852, 1364, 2157, 13, 314, 2936, 588, 257, 1844, 290, 2472, 5287, 290, 18641, 13, 314, 373, 655, 2089, 290, 6507, 329, 502, 13, 2102, 11, 262, 2589, 287, 543, 314, 21605, 2540, 284, 766, 326, 616, 4585, 290, 4007, 373, 5600, 284, 1716, 257, 4701, 523, 326, 314, 714, 1568, 287, 1204, 14658, 644, 1793, 373, 4585, 502, 284, 466, 314, 1043, 257, 649, 2565, 286, 4167, 290, 12157, 13, 10776, 1201, 616, 9412, 11, 314, 447, 247, 303, 587, 523, 3772, 546, 616, 4585, 11, 616, 4007, 11, 616, 22701, 13, 314, 7765, 510, 790, 3329, 351, 257, 8212, 6970, 326, 314, 716, 1498, 284, 4545, 616, 2444, 1223, 649, 326, 1110, 13, 314, 1842, 5055, 287, 2166, 286, 2444, 508, 389, 11069, 284, 2193, 290, 4545, 606, 477, 314, 760, 290, 314, 27099, 884, 1049, 12157, 290, 8716, 287, 6970, 326, 314, 716, 1498, 284, 5485, 262, 9017, 286, 262, 1306, 5270, 13, 5211, 1223, 326, 481, 787, 345, 3772, 0, 198, 198, 36981, 14719, 6089, 309, 19213, 3963, 337, 48399, 198, 198, 2215, 345, 389, 22147, 286, 644, 345, 389, 4001, 284, 466, 287, 1204, 11, 340, 460, 307, 2407, 16378, 13, 314, 1612, 340, 318, 25703, 16938, 9306, 13, 314, 460, 1560, 345, 326, 314, 447, 247, 303, 3377, 5179, 286, 4138, 286, 5054, 15461, 257, 2214, 326, 373, 407, 329, 502, 13, 632, 447, 247, 82, 407, 1257, 284, 4341, 1637, 810, 345, 836, 447, 247, 83, 761, 284, 4341, 1637 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
SYNOPSIS: The movie consists of a conversation between Andre Gregory and Wallace Shawn, both of whom were active in New York theater at the time of the movie. Two themes tie the entire dialog together: (1) should we live spontaneously in the moment, disconnecting ourselves from the purposes of our actions (a la Hindu Karma Yoga), and (2) what is the purpose of the theater. Andre answers yes to the first question and argues that experimental theater can help facilitate this. Wally answers no to the first question and argues that theater has the more modest task of awakening us to new views and issues. In spite of the movie’s dialogically-driven format, it nevertheless follows the standard three-act formula of movie making (i.e., beginning, middle, and end). In Act 1, Wally displays reluctance to meet with Andre, thus creating the tension that is carried throughout the film. For about a half hour, Andre, with brilliant story-telling ability, describes his quests around the world in an attempt to find meaning. In Act 2, Andre defends his philosophy of life (point 1 above), while Wally uncomfortably listens and politely even concedes some points. In Act 3, Wally reveals his true opinion of Andre’s views and, defending common sense, hammers away at Andre’s notions of purposeless action, outposts of enlightenment, and the supernatural. Andre listens graciously to the attack. Both leave the dinner unconvinced of the others’ views, but rewarded by the debate. Like philosophy itself, this movie is for selective audiences, which the filmmakers themselves clearly understood. The format of “My Dinner with Andre” has influenced two other philosophical movies. In “The Quarrel” (1991), a conservative and a liberal Jew discuss the moral implications of the Nazi Holocaust. In “Mind Walk” (1991), a poet, politician and physicist discuss the relation between quantum physics and environmentalism. The specific stories and issues discussed in the film are as follows: Polish theatre director Gratovsky who organizes 40 people in a forest retreat and 100 people in the “bee hive”; the Little Prince; Japanese Buddhist monk Kozan who goes with Andre to the Sahara desert and later lives with Andre and family; the flag; the Scottish agricultural community; Halloween on Long Island; awareness that he is an intellectual creep; people not saying what they’re really feeling but simply play roles; breaking life’s habits and experiencing each moment anew; needing extraordinary experiences to get in touch with reality; contemporary culture turning us into robots and the need to create new centers to preserve life; science vs. the supernatural; perceiving death. DISCUSSION QUESTIONS: 1. Andre describes hallucinations that he had, which, from the perspective of an impartial observer, suggest that he was schizophrenic. Does his intellectualism and association with the theatre legitimize his hallucinatory experiences – more so than if, for example, an accountant had similar hallucinations? 2. Although we might explain away Andre’s experiences as the product of schizophrenia, what are we to make of all the people who went through the same experiences with him – e.g., the Polish theatre group, Gratovsky, Kozan? 3. Now rejecting his extreme adventures, Andre compares himself to Nazi architect Albert Speer, a cultured man who didn’t think that ordinary rules of life applied to him. Is anything about this comparison appropriate? 4. According to Andre, Gratovsky gave up the theatre since he felt that people were performing so well in their lives that the theatre was superfluous. Do we really perform in our daily lives in the way that actors perform on the stage? If so, then why do most people seem so unnatural when they attempt to perform on stage? 5. Andre describes a Scottish mathematician who would attempt to “break the habits of living” through a series of exercises, such as doing things with his left hand rather than his right. This would force him to learn things. What are the benefits and disbenefits of breaking such habits of living? 6. The electric blanket: Wally finds it to be an important creature comfort, but Andre believes that it separates us from reality; that is, like a lobotomy, comfort can lull us into a dangerous tranquility. Who’s right? 7. Andre discusses Martin Buber’s book “On Hadism” which describes the Hasidic view that there are spirits chained in everything, and prayer is the act of liberating them. Each moment of our lives, then, should be a kind of prayerful sacrament. Wally, by contrast, states that he has to block out large sections of the real world – such as people starving in Africa – in order to be happy. Who’s right? 8. Wally believes that serious plays about human alienation may make people aware of reality. Andre believes that such serious plays do more harm than good by only reinforcing the views of alienation that people already have. Theatre, he believes, should be eye-opening, like some of his experiences with the Theatre group in Poland. What’s the purpose of theatre? 10. Wally asks whether we need an extraordinary experience such as a trip to Mount Everest in order to perceive reality. Is there any kind of literature or theatre that can do this without taking a dramatic trip? 11. Wally states near the end of the film that in the normal world of jobs, bills, and other responsibilities, there’s no need for the awareness-outposts that Andre describes. Happiness can be achieved within our routine. Is Wally correct, or is he just a content robot? 12. Wally attempts to debunk Andre’s various supernatural experiences in favor of scientific explanations. Andre asks what’s the difference if all facts are meaningless. Wally responds, “The meaningless fact of the fortune cookie or the turtles egg can’t possibly have any relevance to the subject you’re analyzing. Whereas a group of meaningless facts that are collected and interpreted in a scientific way might quite possibly be relevant, because the wonderful thing about scientific theories of things is that they are based on experiments that can be repeated.” Is Wally correct in his rejection of the supernatural? 13. Andre states that science has been held up as a magical force that will solve everything, when in fact it has destroyed everything, thus making it necessary to create awareness outposts. To what extent might science be responsible for the modern alienation that Andre describes? 14. Wally states his fundamental objection to Andre’s strange adventures: Andre and those he was with attempted to strip purpose away from all activity in an attempt to experience pure being. But, according to Wally, it is our nature to do things with purpose. Andre responds that we can do all sorts of things but still be completely dead inside. Can these two views be reconciled? REVIEWS My Dinner with Andre strikes me as a film which many wish to have seen, but few wish to see. Though I understand full well that, like philosophy itself, the film is meant for "selective audiences," and though I love philosophy, I simply could not bring myself to become engaged in the film. It is, to be blunt, about 30 minutes of interesting dialogue packed into a 110-minute film. Most of the film consists of Andre's blabbering forth syrupy pop-spirituality, which is meant to be legitimized somehow by his connection to the theatre community. Though Andre occasionally makes a good point, he consistently does so in the same annoying, patronizing manner, in which he treats Wally – who for most of the film plays the part of the audience – as though he were some poor simpleton who has never had the privilege of Andre's hippie-dippy enlightenment camps. By the third act, Wally finally begins to speak up and offers some criticisms of Andre's views; though I understand the purpose of the mounting tension released at this point, Wally simply did not offer enough bite in his replies to be satisfactory. In particular, I was most bothered by Andre's repeated (usually implied) insistence that his whacky adventures are necessary to get in touch with reality. As the film uses Wally as the audience's on-screen counterpart, I was thoroughly disappointed when he did not slap Andre in the face and inform him that all he has accomplished is getting in touch with whacky adventures, and thus has set himself up for precisely the same sort of alienation which he so thoroughly laments. -- Frezno Smooth I would not recommend this movie, unless the philosophical issues of finding a persons purpose in life was worth watching a hour and half two guy chatting. The movie made some nice and interesting points. However, the movie was too long, a little boring, and the meaning of the movie was hard to pinpoint. Watching one person chat for 45 minutes in a motion picture is not my impression of entertaining. The philosophical issues of knowing ones purpose in life was interesting; however, the movie could have been shortened to half an hour, no more. The meaning of life and the pursuit of what it means to you is a worthy philosophical issue for a movie, and the way that Andre wanted to find his true self in the world was a rightful challenge. However, Andre picked an expensive restaurant, and the way he acted towards the waiter shows the true nature of a rich person not an individual. -- Ubermensch This went on a little long. A lot of interesting concepts were touched on, and largely the movie served as a comparison between two lifestyles. Andre is an eccentric and a traveler, and Wallace is more of a settled type. Andre believes and argues that life should be lived in a spontaneous fashion, and that comforts that make one too sedentary should be discarded. Wallace seems to mostly be a background character throughout the film, asking questions to prompt Andre, and responding to his largely rhetorical questions. Now, don’t get me wrong, I’m not going to say the dialogue was boring. It wasn’t. There were numerous wonderful little tidbits of thought and ideas ripe for exploration. Andre Gregory seems like a terribly interesting guy. The problem here is one of choosing an appropriate medium. Visual mediums like painting, theater, and cinema, are best used when something is worth looking at. This production could have benefited enormously if, before anyone started wasting film or location scouting budgets, Andre Gregory would have said to himself, “Ya know what? Screw a movie, I’m just gonna write this stuff down. Maybe an essay or a short story.” As a text, I wouldn’t have been able to put this down. As a film, I had to continuously rock myself back and fourth in the little booth in the media center to keep my attention on the screen. I do not have ADD, but this film made me feel like it. The fact that they even credited someone as directing it stuck me as pretty bizarre. -- Reviewer from Hell
[ 23060, 45, 30737, 1797, 25, 383, 3807, 10874, 286, 257, 5273, 1022, 10948, 20653, 290, 17161, 25225, 11, 1111, 286, 4150, 547, 4075, 287, 968, 1971, 13766, 379, 262, 640, 286, 262, 3807, 13, 4930, 13460, 9839, 262, 2104, 17310, 1978, 25, 357, 16, 8, 815, 356, 2107, 37512, 287, 262, 2589, 11, 22837, 278, 6731, 422, 262, 4959, 286, 674, 4028, 357, 64, 8591, 16397, 32648, 32856, 828, 290, 357, 17, 8, 644, 318, 262, 4007, 286, 262, 13766, 13, 10948, 7429, 3763, 284, 262, 717, 1808, 290, 11673, 326, 11992, 13766, 460, 1037, 15570, 428, 13, 50117, 7429, 645, 284, 262, 717, 1808, 290, 11673, 326, 13766, 468, 262, 517, 12949, 4876, 286, 33971, 514, 284, 649, 5009, 290, 2428, 13, 554, 15275, 286, 262, 3807, 447, 247, 82, 17310, 1146, 12, 15808, 5794, 11, 340, 19032, 5679, 262, 3210, 1115, 12, 529, 10451, 286, 3807, 1642, 357, 72, 13, 68, 1539, 3726, 11, 3504, 11, 290, 886, 737, 554, 2191, 352, 11, 50117, 11298, 33506, 284, 1826, 351, 10948, 11, 4145, 4441, 262, 12097, 326, 318, 5281, 3690, 262, 2646, 13, 1114, 546, 257, 2063, 1711, 11, 10948, 11, 351, 10457, 1621, 12, 18072, 2694, 11, 8477, 465, 21359, 1088, 262, 995, 287, 281, 2230, 284, 1064, 3616, 13, 554, 2191, 362, 11, 10948, 33446, 465, 8876, 286, 1204, 357, 4122, 352, 2029, 828, 981, 50117, 8820, 3319, 1346, 35019, 290, 34313, 772, 49867, 617, 2173, 13, 554, 2191, 513, 11, 50117, 10069, 465, 2081, 4459, 286, 10948, 447, 247, 82, 5009, 290, 11, 11749, 2219, 2565, 11, 25755, 364, 1497, 379, 10948, 447, 247, 82, 26226, 286, 4007, 1203, 2223, 11, 503, 24875, 286, 35957, 11, 290, 262, 22239, 13, 10948, 35019, 1036, 45289, 284, 262, 1368, 13, 5747, 2666, 262, 8073, 21254, 7114, 771, 286, 262, 1854, 447, 247, 5009, 11, 475, 20945, 416, 262, 4384, 13, 4525, 8876, 2346, 11, 428, 3807, 318, 329, 21792, 15579, 11, 543, 262, 28303, 2405, 4084, 7247, 13, 383, 5794, 286, 564, 250, 3666, 34584, 351, 10948, 447, 251, 468, 12824, 734, 584, 17580, 6918, 13, 554, 564, 250, 464, 2264, 283, 2411, 447, 251, 357, 24529, 828, 257, 5940, 290, 257, 7270, 3370, 2112, 262, 6573, 10939, 286, 262, 12267, 18661, 13, 554, 564, 250, 28478, 6857, 447, 251, 357, 24529, 828, 257, 21810, 11, 14971, 290, 33013, 2112, 262, 8695, 1022, 14821, 11887, 290, 6142, 1042, 13, 198, 198, 464, 2176, 3923, 290, 2428, 6693, 287, 262, 2646, 389, 355, 5679, 25, 15945, 21421, 3437, 1902, 265, 29716, 508, 1618, 4340, 2319, 661, 287, 257, 8222, 13703, 290, 1802, 661, 287, 262, 564, 250, 20963, 35881, 447, 251, 26, 262, 7703, 9005, 26, 4960, 20838, 27266, 40772, 272, 508, 2925, 351, 10948, 284, 262, 46882, 10326, 290, 1568, 3160, 351, 10948, 290, 1641, 26, 262, 6056, 26, 262, 11905, 14240, 2055, 26, 16032, 319, 5882, 5451, 26, 9359, 326, 339, 318, 281, 9028, 13972, 26, 661, 407, 2282, 644, 484, 447, 247, 260, 1107, 4203, 475, 2391, 711, 9176, 26, 7163, 1204, 447, 247, 82, 13870, 290, 13456, 1123, 2589, 44951, 26, 18139, 11359, 6461, 284, 651, 287, 3638, 351, 3950, 26, 11811, 3968, 6225, 514, 656, 14193, 290, 262, 761, 284, 2251, 649, 10399, 284, 12201, 1204, 26, 3783, 3691, 13, 262, 22239, 26, 36974, 1412, 1918, 13, 198, 198, 26288, 34, 32835, 2849, 43658, 11053, 25, 198, 198, 16, 13, 10948, 8477, 40371, 326, 339, 550, 11, 543, 11, 422, 262, 6650, 286, 281, 32521, 22890, 11, 1950, 326, 339, 373, 19991, 291, 13, 8314, 465, 9028, 1042, 290, 8112, 351, 262, 21421, 18262, 1096, 465, 23251, 23132, 6461, 784, 517, 523, 621, 611, 11, 329, 1672, 11, 281, 42627, 550, 2092, 40371, 30, 198, 198, 17, 13, 4900, 356, 1244, 4727, 1497, 10948, 447, 247, 82, 6461, 355, 262, 1720, 286, 22794, 11, 644, 389, 356, 284, 787, 286, 477, 262, 661, 508, 1816, 832, 262, 976, 6461, 351, 683, 784, 304, 13, 70, 1539, 262, 15945, 21421, 1448, 11, 1902, 265, 29716, 11, 40772, 272, 30, 198, 198, 18, 13, 2735, 26734, 465, 3257, 17545, 11, 10948, 23008, 2241, 284, 12267, 7068, 9966, 2531, 263, 11, 257, 45847, 582, 508, 1422, 447, 247, 83, 892, 326, 8850, 3173, 286, 1204, 5625, 284, 683, 13, 1148, 1997, 546, 428, 7208, 5035, 30, 198, 198, 19, 13, 4784, 284, 10948, 11, 1902, 265, 29716, 2921, 510, 262, 21421, 1201, 339, 2936, 326, 661, 547, 9489, 523, 880, 287, 511, 3160, 326, 262, 21421, 373, 48713, 516, 13, 2141, 356, 1107, 1620, 287, 674, 4445, 3160, 287, 262, 835, 326, 10544, 1620, 319, 262, 3800, 30, 1002, 523, 11, 788, 1521, 466, 749, 661, 1283, 523, 33975, 618, 484, 2230, 284, 1620, 319, 3800, 30, 198, 198, 20, 13, 10948, 8477, 257, 11905, 48251, 508, 561, 2230, 284, 564, 250, 9032, 262, 13870, 286, 2877, 447, 251, 832, 257, 2168, 286, 13565, 11, 884, 355, 1804, 1243, 351, 465, 1364, 1021, 2138, 621, 465, 826, 13, 770, 561, 2700, 683, 284, 2193, 1243, 13, 1867, 389, 262, 4034, 290, 595, 36934, 896, 286, 7163, 884, 13870, 286, 2877, 30, 198, 198, 21, 13, 383, 5186, 18447, 25, 50117, 7228, 340, 284, 307, 281, 1593, 7185, 4467, 11, 475, 10948, 5804, 326, 340, 31555, 514, 422, 3950, 26, 326, 318, 11, 588, 257, 6804, 38385, 11, 4467, 460, 42858, 514, 656, 257, 4923, 31882, 879, 13, 5338, 447, 247, 82, 826, 30, 198, 198, 22, 13, 10948, 19451, 5780, 9842, 527, 447, 247, 82, 1492, 564, 250, 2202, 11161, 1042, 447, 251, 543, 8477, 262, 7875, 312, 291, 1570, 326, 612, 389, 13747, 40682, 287, 2279, 11, 290, 11443, 318, 262, 719, 286, 48291, 606, 13, 5501, 2589, 286, 674, 3160, 11, 788, 11, 815, 307, 257, 1611, 286, 11443, 913, 49081, 13, 50117, 11, 416, 6273, 11, 2585, 326, 339, 468, 284, 2512, 503, 1588, 9004, 286, 262, 1103, 995, 784, 884, 355, 661, 34253, 287, 5478, 784, 287, 1502, 284, 307, 3772, 13, 5338, 447, 247, 82, 826, 30, 198, 198, 23, 13, 50117, 5804, 326, 2726, 5341, 546, 1692, 44984, 743, 787, 661, 3910, 286, 3950, 13 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
The Samsung GALAXY Tab 7.0 Plus has been officially announced, which brings yet another Honeycomb-flavored tablet to the scene. What we are dealing with is a device meant to be a successor to the original 7-inch GALAXY Tab, which debuted about a year ago, and standing a tad below the recently unveiled Samsung GALAXY Tab 7.7 in terms of specs. Just like the very first GALAXY Tab, the 7.0 Plus sports a 7-inch touchscreen display with 1024 by 600 pixels of resolution. This time, however, the display is of the PLS type, which should translate into superior viewing angles and a 10% boost in brightness when compared to IPS LCDs. The Samsung GALAXY Tab 7.0 Plus is also lighter and slimmer than its predecessor tipping the scales at 12.16 ounces (345 grams) and boasting a waistline of 0.39 inches (9.96 millimeters). What provides the GALAXY Tab 7.0 Plus with processing power is a 1.2GHz dual-core chip accompanied by a gig of RAM. That should be enough processing punch to allow for 1080p HD video to play back smoothly. The tablet is also equipped with a 2-megapixel front-facing camera for video chats and a 3-megapixel main one capable of recording 720p footage. In terms of software, the Samsung GALAXY Tab 7.0 Plus will come with Android 3.2 Honeycomb out of the box. Of course, Samsung's very own TouchWiz interface will be installed on top of it along with a bunch of handy apps provided by the company, namely Social Hub, Readers Hub, and Music Hub. Last but not least, the tablet will be equipped with a 21Mbps HSPA+ radio meaning that you will be able to stay connected to the web even when on the move. Although folks in Indonesia and Austria will be the first ones to get a taste of the Samsung GALAXY Tab 7.0 Plus, which will happen by the end of October, the tablet is expected to become available in the US eventually. It will also be sold across Europe, Latin America, Southeast and Southwest Asia, CIS, Latin America, Africa, the Middle East, Japan and China. source: Samsung UPDATE: Our eagle-eyed readers have pointed out that the Samsung GALAXY Tab 7.0 Plus has a dialer icon on its home screen, which is a clear indication that it will be able to make phone calls like the old-school GALAXY Tab could. There also appears to be an earpiece above its display. “Samsung pioneered the seven-inch tablet market with the launch of the GALAXY Tab, marking an innovation milestone in the mobile industry. Building on the success of the GALAXY Tab, we’re now delighted to introduce the GALAXY Tab 7.0 Plus reloaded with enhanced portability, productivity and a richer multimedia experience” said JK Shin, President and Head of Samsung’s Mobile Communications Business. He added “GALAXY Tab 7.0 Plus is for those who want to stay productive and in touch with work, friends and content anytime, anywhere.” Enhanced Portability With 7-inch display, GALAXY Tab 7.0 Plus provides enhanced portability, weighing just 345g and measuring at just 9.96mm thin. Enhanced portability ensures that it fits easily into an inside-jacket pocket or a handbag, making it an ideal device for those who need to stay productive and entertained while on-the-move. Advanced Productivity GALAXY Tab 7.0 Plus delivers a smooth and intuitive user experience with powerful performance powered by 1.2GHz dual core processor. Mini Apps allows seamless multitasking by consolidating 7 applications easily accessed from a bottom-side tray on main screen. Users can launch favorite features such as music player or calendar as pop-ups over full screen applications. Not only that, users can design an individualized up-to-the-minute interface through Live Panel. Web browsing is also enhanced by Adobe Flash and super-fast HSPA+ connectivity, providing download speeds up to three times faster than a conventional HSPA connection. On top of that Wi-Fi Channel Bonding bonds two channels into one for improved network connection and data transfer at up to twice the speed. Furthermore, the GALAXY Tab 7.0 Plus offers voice and video call support, with no need for a headset. Users can see friends and family from anywhere in the world in high quality thanks to the device’s larger screen. Rich Multimedia on-the-move Full HD videos can be enjoyed on the 7-inch WSVGA PLS display, with DivX & multi codec support ensuring the device is capable of supporting a variety of different formats. An improved virtual clipboard, which stores text and images enabling easy copy and paste, further adds to these capabilities. Additionally, the GALAXY Tab 7.0 Plus features Social Hub, Readers Hub and Music Hub services. Social Hub aggregates the user’s contacts, calendar and email along with instant messaging and social networking connections all within one easy-to-use interface. Readers Hub provides e-reading content such as e-books, newspapers and magazines. Music Hub enables access to over 13 million songs even when out and about. GALAXY Tab 7.0 Plus will be available starting in Indonesia and Austria from end-October and gradually rolled out globally including Southeast and Southwest Asia, US, Europe, CIS, Latin America, Middle East, Africa, Japan and China. 5.liat2ajah (unregistered) Wow, so Samsung will sell one of their first batch production of Galaxy Plus 7" in Indonesia? Hopefully trouble free hardware and software wise. If the release date is true as posted by PhoneArena, then we have two tablet launch in Indonesia. Samsung Indonesia already put an advertisement for launching aka first sale for Galaxy 8.9" in Jakarta, Indonesia tomorrow (Oct 1st) All content (phone reviews, news, specs, info), design and layouts are Copyright 2001-2015 phoneArena.com. All rights reserved. Reproduction in whole or in part or in any form or medium without written permission is prohibited! Privacy . Terms of use . Cookies . Team
[ 464, 10397, 402, 1847, 25922, 56, 16904, 767, 13, 15, 8227, 468, 587, 8720, 3414, 11, 543, 6774, 1865, 1194, 21788, 24011, 12, 2704, 48275, 14147, 284, 262, 3715, 13, 1867, 356, 389, 7219, 351, 318, 257, 3335, 4001, 284, 307, 257, 17270, 284, 262, 2656, 767, 12, 8589, 402, 1847, 25922, 56, 16904, 11, 543, 26376, 546, 257, 614, 2084, 11, 290, 5055, 257, 36264, 2174, 262, 2904, 18475, 10397, 402, 1847, 25922, 56, 16904, 767, 13, 22, 287, 2846, 286, 25274, 13, 198, 198, 5703, 588, 262, 845, 717, 402, 1847, 25922, 56, 16904, 11, 262, 767, 13, 15, 8227, 5701, 257, 767, 12, 8589, 39965, 3359, 351, 28119, 416, 10053, 17848, 286, 6323, 13, 770, 640, 11, 2158, 11, 262, 3359, 318, 286, 262, 350, 6561, 2099, 11, 543, 815, 15772, 656, 9098, 11681, 18333, 290, 257, 838, 4, 5750, 287, 22204, 618, 3688, 284, 37632, 23598, 82, 13, 383, 10397, 402, 1847, 25922, 56, 16904, 767, 13, 15, 8227, 318, 635, 14871, 290, 1017, 10957, 621, 663, 18476, 31639, 262, 16252, 379, 1105, 13, 1433, 24405, 357, 27712, 16379, 8, 290, 40776, 257, 16139, 1370, 286, 657, 13, 2670, 8331, 357, 24, 13, 4846, 3939, 31551, 737, 198, 198, 2061, 3769, 262, 402, 1847, 25922, 56, 16904, 767, 13, 15, 8227, 351, 7587, 1176, 318, 257, 352, 13, 17, 23741, 10668, 12, 7295, 11594, 11791, 416, 257, 12526, 286, 13931, 13, 1320, 815, 307, 1576, 7587, 10862, 284, 1249, 329, 17729, 79, 5572, 2008, 284, 711, 736, 21461, 13, 383, 14147, 318, 635, 10911, 351, 257, 362, 12, 28917, 48633, 2166, 12, 29532, 4676, 329, 2008, 40815, 290, 257, 513, 12, 28917, 48633, 1388, 530, 6007, 286, 8296, 26250, 79, 9640, 13, 198, 198, 818, 2846, 286, 3788, 11, 262, 10397, 402, 1847, 25922, 56, 16904, 767, 13, 15, 8227, 481, 1282, 351, 5565, 513, 13, 17, 21788, 24011, 503, 286, 262, 3091, 13, 3226, 1781, 11, 10397, 338, 845, 898, 15957, 54, 528, 7071, 481, 307, 6589, 319, 1353, 286, 340, 1863, 351, 257, 7684, 286, 15728, 6725, 2810, 416, 262, 1664, 11, 14811, 5483, 14699, 11, 41969, 14699, 11, 290, 7849, 14699, 13, 4586, 475, 407, 1551, 11, 262, 14147, 481, 307, 10911, 351, 257, 2310, 47842, 367, 50087, 10, 5243, 3616, 326, 345, 481, 307, 1498, 284, 2652, 5884, 284, 262, 3992, 772, 618, 319, 262, 1445, 13, 198, 198, 7003, 7974, 287, 16256, 290, 17322, 481, 307, 262, 717, 3392, 284, 651, 257, 6938, 286, 262, 10397, 402, 1847, 25922, 56, 16904, 767, 13, 15, 8227, 11, 543, 481, 1645, 416, 262, 886, 286, 3267, 11, 262, 14147, 318, 2938, 284, 1716, 1695, 287, 262, 1294, 4191, 13, 632, 481, 635, 307, 2702, 1973, 2031, 11, 9133, 2253, 11, 21199, 290, 24320, 7229, 11, 36159, 11, 9133, 2253, 11, 5478, 11, 262, 6046, 3687, 11, 2869, 290, 2807, 13, 198, 198, 10459, 25, 10397, 198, 198, 16977, 25, 3954, 31176, 12, 18834, 7183, 423, 6235, 503, 326, 262, 10397, 402, 1847, 25922, 56, 16904, 767, 13, 15, 8227, 468, 257, 5980, 263, 7196, 319, 663, 1363, 3159, 11, 543, 318, 257, 1598, 12955, 326, 340, 481, 307, 1498, 284, 787, 3072, 3848, 588, 262, 1468, 12, 14347, 402, 1847, 25922, 56, 16904, 714, 13, 1318, 635, 3568, 284, 307, 281, 1027, 12239, 2029, 663, 3359, 13, 198, 198, 447, 250, 32334, 43185, 262, 3598, 12, 8589, 14147, 1910, 351, 262, 4219, 286, 262, 402, 1847, 25922, 56, 16904, 11, 18730, 281, 11044, 23554, 287, 262, 5175, 2831, 13, 11819, 319, 262, 1943, 286, 262, 402, 1847, 25922, 56, 16904, 11, 356, 447, 247, 260, 783, 20707, 284, 10400, 262, 402, 1847, 25922, 56, 16904, 767, 13, 15, 8227, 18126, 276, 351, 13105, 2493, 1799, 11, 13714, 290, 257, 26192, 40162, 1998, 447, 251, 531, 449, 42, 11466, 11, 1992, 290, 7123, 286, 10397, 447, 247, 82, 12173, 14620, 7320, 13, 679, 2087, 564, 250, 38, 1847, 25922, 56, 16904, 767, 13, 15, 8227, 318, 329, 883, 508, 765, 284, 2652, 12973, 290, 287, 3638, 351, 670, 11, 2460, 290, 2695, 17949, 11, 6609, 13, 447, 251, 198, 198, 49026, 4347, 1799, 198, 198, 3152, 767, 12, 8589, 3359, 11, 402, 1847, 25922, 56, 16904, 767, 13, 15, 8227, 3769, 13105, 2493, 1799, 11, 21990, 655, 39937, 70, 290, 15964, 379, 655, 860, 13, 4846, 3020, 7888, 13, 22104, 2493, 1799, 19047, 326, 340, 11414, 3538, 656, 281, 2641, 12, 73, 8317, 10000, 393, 257, 1021, 21454, 11, 1642, 340, 281, 7306, 3335, 329, 883, 508, 761, 284, 2652, 12973, 290, 34988, 981, 319, 12, 1169, 12, 21084, 13, 198, 198, 28809, 8721, 3458, 198, 198, 38, 1847, 25922, 56, 16904, 767, 13, 15, 8227, 16316, 257, 7209, 290, 19933, 2836, 1998, 351, 3665, 2854, 13232, 416, 352, 13, 17, 23741, 10668, 4755, 12649, 13, 12558, 27710, 3578, 32354, 41785, 30463, 416, 14652, 803, 767, 5479, 3538, 17535, 422, 257, 4220, 12, 1589, 26473, 319, 1388, 3159, 13, 18987, 460, 4219, 4004, 3033, 884, 355, 2647, 2137, 393, 11845, 355, 1461, 12, 4739, 625, 1336, 3159, 5479, 13, 1892, 691, 326, 11, 2985, 460, 1486, 281, 1981, 1143, 510, 12, 1462, 12, 1169, 12, 11374, 7071, 832, 7547, 18810, 13, 198, 198, 13908, 23182, 318, 635, 13105, 416, 21771, 9973, 290, 2208, 12, 7217, 367, 50087, 10, 19843, 11, 4955, 4321, 12055, 510, 284, 1115, 1661, 5443, 621, 257, 10224, 367, 50087, 4637, 13, 1550, 1353, 286, 326, 11759, 12, 10547, 11102, 12812, 278, 13100, 734, 9619, 656, 530, 329, 6596, 3127, 4637, 290, 1366, 4351, 379, 510, 284, 5403, 262, 2866, 13, 198, 198, 24951, 11, 262, 402, 1847, 25922, 56, 16904, 767, 13, 15, 8227, 4394, 3809, 290, 2008, 869, 1104, 11, 351, 645, 761, 329, 257, 23492, 13, 198, 198, 14490, 460, 766, 2460, 290, 1641, 422, 6609, 287, 262, 995, 287, 1029, 3081, 5176, 284, 262, 3335, 447, 247, 82, 4025, 3159, 13, 198, 198, 14868, 7854, 20626, 319, 12, 1169, 12, 21084, 198, 198, 13295, 5572, 5861, 460, 307, 8359, 319, 262, 767, 12, 8589, 25290, 53, 9273, 350, 6561, 3359, 11, 351, 4777, 55, 1222, 5021, 40481, 1104, 13359, 262, 3335 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Relax With Confidence (4) Take a deep breath and breathe easy knowing that we are doing everything in our power to free your friend or relative from jail. We will inform you as soon as the arrangement has been completed. If you have any further questions during this time, contact us or feel free to call us at (706) 549-7777
[ 6892, 897, 2080, 7326, 1704, 198, 198, 7, 19, 8, 7214, 257, 2769, 8033, 290, 18044, 2562, 6970, 326, 356, 389, 1804, 2279, 287, 674, 1176, 284, 1479, 534, 1545, 393, 3585, 422, 7356, 13, 775, 481, 4175, 345, 355, 2582, 355, 262, 13888, 468, 587, 5668, 13, 1002, 345, 423, 597, 2252, 2683, 1141, 428, 640, 11, 2800, 514, 393, 1254, 1479, 284, 869, 514, 379, 357, 35402, 8, 642, 2920, 12, 3324, 3324 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Celebrities are known for star power but they’re often admired for their generosity to charity’s and non profits. This infographic takes a look at the celebrities that donated money for education and exactly what and how much they donated. Source
[ 42741, 65, 19491, 389, 1900, 329, 3491, 1176, 475, 484, 447, 247, 260, 1690, 29382, 329, 511, 31569, 284, 11016, 447, 247, 82, 290, 1729, 10177, 13, 770, 48033, 2753, 257, 804, 379, 262, 21305, 326, 15863, 1637, 329, 3707, 290, 3446, 644, 290, 703, 881, 484, 15863, 13, 8090 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Honduras's Azcona: proud, conservative, and maybe surprising Tegucigalpa, Honduras — The man who almost certainly will be the next president of Honduras looks like the portrait of a 19th-century Central American statesman come to life. Tall, haughty, with a full head of straight, white hair brushed back from a wide expanse of forehead, Jos'e Azcona Hoyo, seems nothing if not presidential. A reputation for scrupulous financial integrity and a traditionally conservative ideology combined with an equally traditional concern for the poor, complete the idealized picture of a Latin founding father. And yet, surprisingly, this man aroused some apprehension before the elections among right-wing groups in the oligarchy, Army, and United States government. Mr. Azcona was distrusted in part because of his well-known pride, which his enemies call arrogance, and inflexibility, which many analysts here believe could make him a less reliable executor of US policies than the outgoing Honduran administration. Azcona will be weakened in carrying out his programs, because he received only 30 percent of the popular vote and a minority of seats in the National Assembly. His main opponent, Liberal Party candidate Rafael Leonardo Callejas, won 40 percent of the vote. The electoral system provides that the leading candidate of the party with the most votes wins. Azcona's victory will probably be challenged in court by opposition leaders. Outgoing President Roberto Suazo C'ordova has been widely perceived here as complying completely with US wishes to turn Honduras into a base from which US-backed Nicaraguan rebels, known as ``contras,'' launch attacks on neighboring Nicaragua's leftist Sandinista government. There is a strong US military presence in Honduras. The US has held military maneuvers here and has a large number of US troops in Palmerola. Ultraconservatives distrust the group of advisers around Azcona, a group that covers a surprisingly broad gamut, ranging from traditional Liberal Party politicians to bankers who consider themselves socially progressive, to former Marxists rapidly moving to the right. Extensive interviews with several of Azcona's top advisers make it clear that many important groups around the Honduran leader favor policies that the US opposes. But, given Honduras's extreme economic and military dependence on the US and the mixed nature of the group around Azcona, the big question is: To what extent will these controversial policies prevail? The policies are based on: The withdrawal of the contras from Honduras. The strong opposition to the fiscal policy of devaluing the Honduran currency, the lempira. The policy is advocated by the US and the International Monetary Fund (IMF) for third world countries struggling to pay back large foreign debts. Several sources close to Azcona say neither the future president, who assumes office in January, nor most of his advisers are happy with the presence of the contras in Honduras. They feel uncomfortable with a foreign military presence that may grow to be as large as the Honduran armed services, which has roughly 22,000 troops. They also fear that the US might eventually back away from an unsuccessful contra policy, leaving Honduras stuck with the armed Nicaraguan exiles in its territory. The problem, says a key Azcona adviser, is: ``How do we get rid of the contras without getting rid of US aid?'' Although the US shows no signs of budging from its insistence that Honduras serve as a contra base, some Liberal Party sources speculate that in a year or so, after finding that the contras are no closer to overthrowing the Sandinistas than they are now, the US might be willing to strike a deal. Such a deal, say these sources, might be the possible establishment of an official US naval base in the Honduran port town of Puerto Castilla, in exchange for the withdrawal of the contras. Other Liberal Party M DBRleaders believe that it is unrealistic to expect such a deal. The chances that Azcona's economic policy will be somewhat independent of US dictates are greater than those of the outgoing administration. Washington and the IMF argue that devaluation makes a country's goods cheaper and thus easier to sell abroad. But in a country that has little to export except bananas, devaluation is no panacea, say Honduran opponents of devaluation. Instead, devaluation leads to an endless round of inflation and further devaluation, says Azcona adviser Jaime Rosenthal. Mr. Rosenthal is a leader of the Alipo faction. He says devaluation is inflationary, because much of the basic foodstuffs and mass industrial goods consumed in Honduras are imported. When their prices go up, wages must rise. Fears of further devaluation cause investors to keep their money in dollars and send it out of the country. The more liberal Alipo faction is expected to have a strong voice in Azcona's economic policies, as Alipo leader Jorge Bue-sos Arias will be Treasury Minister. Those around Azcona want Hon-duras's foreign debt to be renegotiated with better terms of repayment and lower interest rates. The problem can be solved eventually, within the context of Latin American solidarity, they say. Two other key politicians outside Alipo are close to Azcona. Jorge Madariaga, a young lawyer whose policies are slightly to the left of Alipo, and Carlos Montoya, a former Marxist who has become considerably more conservative. Political observers here see a potential power struggle developing between the two men. Most analysts here say that, apart from some leftovers from the Liberal Party old guard, Azcona and his advisers will be more honest and efficient than the outgoing administration. Azcona's group wants mass employment policies and to bring the stalled land-reform program back to life. Many analysts here doubt that the group will be able to carry out the kind of massive social change necessary to lift most Hondurans out of poverty. ``I don't think Azcona can make a big difference, because I don't think he can make deep structural changes here. Unfortunately, I believe that the groups behind the status quo, around him, in the Liberal Party, in the Army, and in the oligarchy will prevail,'' a foreigner working here in development projects says. In an article on Honduras in Monday's Monitor, Rafael Leonardo Callejas was incorrectly identified as the presidential candidate of the Liberal Party. He was the National Party candidate.
[ 39, 623, 17786, 338, 7578, 1102, 64, 25, 6613, 11, 5940, 11, 290, 3863, 6452, 198, 198, 51, 1533, 1229, 328, 282, 8957, 11, 32982, 198, 960, 383, 582, 508, 2048, 3729, 481, 307, 262, 1306, 1893, 286, 32982, 3073, 588, 262, 18560, 286, 257, 678, 400, 12, 14792, 5694, 1605, 2585, 805, 1282, 284, 1204, 13, 22676, 11, 387, 6724, 774, 11, 351, 257, 1336, 1182, 286, 3892, 11, 2330, 4190, 31782, 736, 422, 257, 3094, 1033, 40054, 286, 22645, 11, 22568, 6, 68, 7578, 1102, 64, 49873, 78, 11, 2331, 2147, 611, 407, 4787, 13, 317, 8507, 329, 629, 46272, 3176, 11540, 290, 257, 16083, 5940, 12959, 5929, 351, 281, 8603, 4569, 2328, 329, 262, 3595, 11, 1844, 262, 7306, 1143, 4286, 286, 257, 9133, 16636, 2988, 13, 198, 198, 1870, 1865, 11, 12362, 11, 428, 582, 38832, 617, 46473, 878, 262, 7024, 1871, 826, 12, 5469, 2628, 287, 262, 24869, 9282, 11, 5407, 11, 290, 1578, 1829, 1230, 13, 198, 198, 5246, 13, 7578, 1102, 64, 373, 1233, 81, 8459, 287, 636, 780, 286, 465, 880, 12, 4002, 11293, 11, 543, 465, 5775, 869, 35033, 11, 290, 1167, 2588, 2247, 11, 543, 867, 13440, 994, 1975, 714, 787, 683, 257, 1342, 9314, 3121, 273, 286, 1294, 4788, 621, 262, 28181, 27040, 42211, 3662, 13, 198, 198, 26903, 1102, 64, 481, 307, 24135, 287, 6872, 503, 465, 4056, 11, 780, 339, 2722, 691, 1542, 1411, 286, 262, 2968, 3015, 290, 257, 9137, 286, 8632, 287, 262, 2351, 10006, 13, 2399, 1388, 6125, 11, 12266, 3615, 4540, 31918, 38083, 2199, 293, 28121, 11, 1839, 2319, 1411, 286, 262, 3015, 13, 383, 13901, 1080, 3769, 326, 262, 3756, 4540, 286, 262, 2151, 351, 262, 749, 5690, 7864, 13, 7578, 1102, 64, 338, 5373, 481, 2192, 307, 12827, 287, 2184, 416, 5471, 2766, 13, 198, 198, 7975, 5146, 1992, 32076, 1778, 44299, 327, 6, 585, 10071, 468, 587, 6768, 11067, 994, 355, 39076, 3190, 351, 1294, 12802, 284, 1210, 32982, 656, 257, 2779, 422, 543, 1294, 12, 17078, 33288, 7258, 12669, 11, 1900, 355, 7559, 3642, 8847, 14004, 4219, 3434, 319, 19651, 38252, 338, 28318, 3837, 259, 12523, 1230, 13, 1318, 318, 257, 1913, 1294, 2422, 4931, 287, 32982, 13, 383, 1294, 468, 2714, 2422, 38974, 994, 290, 468, 257, 1588, 1271, 286, 1294, 6553, 287, 18918, 5708, 13, 198, 198, 47920, 2213, 37256, 35291, 30086, 262, 1448, 286, 20409, 1088, 7578, 1102, 64, 11, 257, 1448, 326, 8698, 257, 12362, 3154, 9106, 315, 11, 12897, 422, 4569, 12266, 3615, 7602, 284, 25091, 508, 2074, 2405, 18118, 10393, 11, 284, 1966, 10487, 1023, 8902, 3867, 284, 262, 826, 13, 198, 198, 11627, 2021, 9299, 351, 1811, 286, 7578, 1102, 64, 338, 1353, 20409, 787, 340, 1598, 326, 867, 1593, 2628, 1088, 262, 27040, 42211, 3554, 2661, 4788, 326, 262, 1294, 28928, 13, 887, 11, 1813, 32982, 338, 3257, 3034, 290, 2422, 21403, 319, 262, 1294, 290, 262, 7668, 3450, 286, 262, 1448, 1088, 7578, 1102, 64, 11, 262, 1263, 1808, 318, 25, 1675, 644, 6287, 481, 777, 8381, 4788, 28615, 30, 198, 198, 464, 4788, 389, 1912, 319, 25, 198, 198, 464, 15220, 286, 262, 3445, 292, 422, 32982, 13, 198, 198, 464, 1913, 5471, 284, 262, 9068, 2450, 286, 35966, 4250, 262, 27040, 42211, 7395, 11, 262, 443, 3149, 8704, 13, 383, 2450, 318, 25828, 416, 262, 1294, 290, 262, 4037, 34112, 7557, 357, 3955, 37, 8, 329, 2368, 995, 2678, 9648, 284, 1414, 736, 1588, 3215, 20250, 13, 198, 198, 14945, 4237, 1969, 284, 7578, 1102, 64, 910, 6159, 262, 2003, 1893, 11, 508, 18533, 2607, 287, 3269, 11, 4249, 749, 286, 465, 20409, 389, 3772, 351, 262, 4931, 286, 262, 3445, 292, 287, 32982, 13, 1119, 1254, 12916, 351, 257, 3215, 2422, 4931, 326, 743, 1663, 284, 307, 355, 1588, 355, 262, 27040, 42211, 6936, 2594, 11, 543, 468, 7323, 2534, 11, 830, 6553, 13, 1119, 635, 3252, 326, 262, 1294, 1244, 4191, 736, 1497, 422, 281, 23993, 25736, 2450, 11, 4305, 32982, 7819, 351, 262, 6936, 33288, 7258, 409, 2915, 287, 663, 7674, 13, 198, 198, 464, 1917, 11, 1139, 257, 1994, 7578, 1102, 64, 12534, 11, 318, 25, 7559, 2437, 466, 356, 651, 5755, 286, 262, 3445, 292, 1231, 1972, 5755, 286, 1294, 6133, 30, 7061, 198, 198, 7003, 262, 1294, 2523, 645, 5895, 286, 3600, 2667, 422, 663, 30696, 326, 32982, 4691, 355, 257, 25736, 2779, 11, 617, 12266, 3615, 4237, 26256, 326, 287, 257, 614, 393, 523, 11, 706, 4917, 326, 262, 3445, 292, 389, 645, 5699, 284, 34514, 11577, 262, 3837, 259, 37503, 621, 484, 389, 783, 11, 262, 1294, 1244, 307, 4684, 284, 5587, 257, 1730, 13, 8013, 257, 1730, 11, 910, 777, 4237, 11, 1244, 307, 262, 1744, 9323, 286, 281, 1743, 1294, 19014, 2779, 287, 262, 27040, 42211, 2493, 3240, 286, 15295, 5833, 5049, 11, 287, 5163, 329, 262, 15220, 286, 262, 3445, 292, 13, 3819, 12266, 3615, 337, 360, 11473, 37553, 1975, 326, 340, 318, 31363, 284, 1607, 884, 257, 1730, 13, 198, 198, 464, 8395, 326, 7578, 1102, 64, 338, 3034, 2450, 481, 307, 6454, 4795, 286, 1294, 35054, 389, 3744, 621, 883, 286, 262, 28181, 3662, 13, 2669, 290, 262, 25375, 7267, 326, 35966, 2288, 1838, 257, 1499, 338, 7017, 11721, 290, 4145, 4577, 284, 3677, 10522, 13, 198, 198, 1537, 287, 257, 1499, 326, 468, 1310, 284, 10784, 2845, 35484, 11, 35966, 2288, 318, 645, 3425, 44977, 11, 910, 27040, 42211, 7691, 286, 35966, 2288, 13, 5455, 11, 35966, 2288, 5983, 284, 281, 13079, 2835, 286, 10610, 290, 2252, 35966, 2288, 11, 1139, 7578, 1102, 64, 12534, 38028, 49859, 13, 198, 198, 5246, 13, 49859, 318, 257, 3554, 286, 262, 978, 541, 78, 17710, 13, 679, 1139, 35966, 2288, 318, 10610, 560, 11, 780, 881, 286, 262, 4096, 2057, 301, 18058, 290, 2347, 7593, 7017, 13529, 287, 32982, 389, 17392, 13, 1649, 511, 4536, 467, 510, 11, 9400, 1276, 4485, 13, 376, 4127, 286, 2252, 35966, 2288, 2728, 7713, 284, 1394, 511, 1637, 287, 5054, 290, 3758, 340, 503, 286, 262, 1499, 13, 383, 517, 7270, 978, 541, 78, 17710, 318, 2938, 284, 423, 257, 1913, 3809, 287, 7578, 1102 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
// This source file is part of the Swift.org open source project // Copyright (c) 2014 - 2017 Apple Inc. and the Swift project authors // Licensed under Apache License v2.0 with Runtime Library Exception // // See https://swift.org/LICENSE.txt for license information // See https://swift.org/CONTRIBUTORS.txt for the list of Swift project authors // RUN: not %target-swift-frontend %s -emit-ir protocol 0{class TextOutputStream
[ 1003, 770, 2723, 2393, 318, 636, 286, 262, 15608, 13, 2398, 1280, 2723, 1628, 198, 1003, 15069, 357, 66, 8, 1946, 532, 2177, 4196, 3457, 13, 290, 262, 15608, 1628, 7035, 198, 1003, 49962, 739, 24843, 13789, 410, 17, 13, 15, 351, 43160, 10074, 35528, 198, 1003, 198, 1003, 4091, 3740, 1378, 2032, 2135, 13, 2398, 14, 43, 2149, 24290, 13, 14116, 329, 5964, 1321, 198, 1003, 4091, 3740, 1378, 2032, 2135, 13, 2398, 14, 10943, 5446, 9865, 3843, 20673, 13, 14116, 329, 262, 1351, 286, 15608, 1628, 7035, 628, 198, 1003, 32494, 25, 407, 4064, 16793, 12, 2032, 2135, 12, 8534, 437, 4064, 82, 532, 368, 270, 12, 343, 198, 11235, 4668, 657, 90, 4871, 8255, 26410, 12124, 198 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Do We Remember: ‘We Have Had Our Fall’ My first meaningful encounters with Mencken’s work came while we were in Dayton. Mencken approached his coverage of the Scopes Trial — and Dayton and its people — with the same quick-witted ferocity he was famous for. In reading over his attacks of the South in Ralph C. Wood’s Flannery O’Connor and the Christ-Haunted South, though, I realized something: many of the arguments he made against the South, its critics still make today. As Wood quotes him: Down there a poet is now almost as rare as an oboe player, a dry-point etcher of a metaphysician. It is, indeed, amazing to contemplate so vast a vacuity. . . . Nearly the whole of Europe could be lost in that stupendous region of fat farms, shoddy cities and paralyzed cerebrums. . . . And yet, for all its size and and all its wealth and all the ‘progress’ it babbles of, it is almost as sterile, artistically, intellectually, culturally, as the Sahara Desert. And with Mencken’s attacks came the rise of the Agrarians — that class of Southern writers who resisted Mencken’s arguments and defended the South, warts and all, as a distinct and true region. Wood points out that Flannery O’Connor took Mencken seriously at one particular point that the Agrarians may not have: Mencken’s recognition of fundamentalist Christianity as the lynchpin that held so much of the South together. Hence the double-edged nature of O’Connor’s fiction. Wood gets into all those issues and weaves together, really, a masterful account, nuanced as the issues are in reality. If you’re interested, I encourage you to pick his book up. But here’s the thing that nags me now: Mencken and others backed up their claims with sociological data that was hard to refute on its face. The Southern defenders’ best argument was that the “fixes” Northerners would have Southerners undertake burn away the South’s identity and render it like every other part of the country: indistinct. Faced with many of the same sociological problems today (see, for example, lots of the data at www.datacenter.kidscount.org), does the South still possess its distinctiveness? Do we Southerners know today what makes us Southern? Courtesy Kids Count Data Center The cynic here would offer a caricature of Kim Davis and say that the South is as backwards as it ever has been, and as backwards as Mencken described it, save for the addition of “gay-hating” and “gun-toting” to the long list of adjectives. The Agrarian defenders, in countering Mencken and others, pointed out the South’s penchant for politeness and manners, its honor code that rewarded moral behavior, its work ethic that in many cases was actually color blind. Many of them acknowledged the fact that the South’s loss in the Civil War instilled in its people a loss of innocence and understanding of reality. Wood says: With its humiliating defeat in defense of an indefensible cause, the South acquired an ineradicable sense of the tragic: the awareness that even the best of cultures can go profoundly wrong, that seeming good can be built on massive evil, that many things broken cannot be mended, and that much evil must patiently be endured. In O’Connor’s words, “We have had our fall.” Arguably until the Vietnam War or 9/11, no other pocket of the country knew of such. My question: outside of a deceptive sentimentalism, do we today in the South still have this identity? Perhaps this has always been true, but my sense of this is that very few have any clue of this identity, and few care to. In the rural areas, such as where I live, a remnant sense of identity — based as much in local communities as in the South itself — still clings to the hills and fields. My county, Greene County, was once one of the biggest producers of Burley tobacco in the South. Until his dying days right after I joined the staff, my newspaper’s much-loved columnist, Bob Hurley, still wrote of the smells that filled downtown Greeneville in December, when tobacco was put to market in the huge warehouses that peppered town. But it wasn’t just the tobacco and its smell: it was the community’s recognition that it was very much a lifeblood of the local economy, and the work it took to harvest it kept families working together in the fields. East Tennessee, thanks to its mountainous terrain and lack of plantations, was home to Union sympathizers. Our side of the state voted against secession. Greeneville was the home of Andrew Johnson, perhaps the most misunderstood and most scorned scorned son of the South. A few weeks ago I helped interview two locals who attended Greeneville’s black high school before school integration in 1965. Here in Greeneville, there were virtually no issues when blacks began sitting in classrooms with whites. No protests, no fights, no scenes of police officers wielding fire hoses, or anything of the sort. When I asked these two people why that was — what made Greene County so different — they answered almost immediately that everyone was so poor — especially out in the county — and used to working, living, and playing with each other, no one harbored any ill will. Memories like this are becoming scant, I fear. But these memories exist here (and I’m proud that stories like this are how I can help keep these memories alive). Growing up in suburbia outside Chattanooga, I never heard much of who we Southerners were, outside of my father’s love of history. As Chattanooga has grown and finds itself as an up-and-coming locale for hipsters, Millennials, and anyone wanting a taste of the New South, I wonder if the values the Agrarians offered as rebuttals to Mencken resonate with folks there. Do we still possess the virtues of the Old South? The Southern writers of the early and mid-20th century had sturdy ground on which to stand when defending Southern virtues. Do we today? Elsewhere in his book, Wood points out that O’Connor, in her devout Catholicism, saw the importance of the sacraments in her theology. And her fiction. Those sacraments illustrate the length to which God sought His people — using the crude stuff He Himself fashioned in brining forgiveness and redemption, and they stand in stark opposition to the sort of gnosticism that hyper-spiritualized, fundamentalist Protestantism brought. The idea that one could be “so heavenly minded that he is no earthly good” is in part an indictment of the kind of fundamentalism that shuns enjoyment of the physical — intended for enjoyment, when regarded and used correctly —and supplants it with a pharisaical bent toward the judgmental. I wonder if this fundamentalist gnosticism leads to the directionless poverty typified by the family Dylan Roof stayed with before killing nine black people in a church in Charleston. This fundamentalism no doubt has some Southern roots, but its effect is to divorce us from the tradition of hard work and genuine care for the well-being of others. And it grows like kudzu, creating a Southern void. I’m aware some people reading this may not buy anything I have said that puts the South or Southerners in any kind of redeemable light. But I wholeheartedly believe that is a product of cynicism, formed by an almost nihilistic incivility. And I hope if any discussion starts here, we will steer clear of it. Post navigation One thought on “Do We Remember: ‘We Have Had Our Fall’” Wonderful essay, Michael. I’m glad you agonize over these things; for some of us, they are important. The South is Flannery O’Connor’s Catholicism and Tennessee Williams’s whiskey-soaked Big Daddy (not to omit Brick, his closeted gay son). As the old folks depart this life, things do change. And, I must even admit that some of our elders have amended their ways without the Grim Reaper at their door. With their passing, holdovers of prejudice and bigotry leave, but so does some of the grace and gentility — as if to affirm that this region has always been a schizophrenic’s paradise. “Too heavenly minded to be any earthly good” only scratches the surface of our profound and cherished contradictions. To whit, that “gay-hating” thing is really too bad, but quite logical, as I have long speculated that the majority of gay men in the south are married to women. Mencken may have “hated the south,” but I think he must also have been grateful for its alien ways which presented him (on a rusty Ford hubcap) the imperative to exercise his formidable acerbity. I will definitely read Ralph Woods’s book.
[ 5211, 775, 11436, 25, 564, 246, 1135, 8192, 11161, 3954, 7218, 447, 247, 198, 198, 3666, 717, 11570, 16925, 351, 6065, 694, 268, 447, 247, 82, 670, 1625, 981, 356, 547, 287, 24450, 13, 6065, 694, 268, 10448, 465, 5197, 286, 262, 1446, 13920, 21960, 851, 290, 24450, 290, 663, 661, 851, 351, 262, 976, 2068, 12, 86, 2175, 11354, 11683, 339, 373, 5863, 329, 13, 198, 198, 818, 3555, 625, 465, 3434, 286, 262, 2520, 287, 20993, 327, 13, 5326, 447, 247, 82, 39016, 35865, 440, 447, 247, 27136, 290, 262, 1951, 12, 46979, 2520, 11, 996, 11, 314, 6939, 1223, 25, 867, 286, 262, 7159, 339, 925, 1028, 262, 2520, 11, 663, 9188, 991, 787, 1909, 13, 1081, 5326, 13386, 683, 25, 198, 198, 8048, 612, 257, 21810, 318, 783, 2048, 355, 4071, 355, 281, 909, 2577, 2137, 11, 257, 5894, 12, 4122, 2123, 2044, 286, 257, 13738, 893, 6749, 13, 632, 318, 11, 5600, 11, 4998, 284, 39248, 523, 5909, 257, 6658, 14834, 13, 764, 764, 764, 21233, 262, 2187, 286, 2031, 714, 307, 2626, 287, 326, 336, 929, 437, 516, 3814, 286, 3735, 15893, 11, 427, 38553, 4736, 290, 36175, 6736, 1671, 5700, 13, 764, 764, 764, 843, 1865, 11, 329, 477, 663, 2546, 290, 290, 477, 663, 5129, 290, 477, 262, 564, 246, 33723, 447, 247, 340, 275, 6485, 829, 286, 11, 340, 318, 2048, 355, 38697, 11, 6802, 1146, 11, 39186, 11, 30573, 11, 355, 262, 46882, 18692, 13, 198, 198, 1870, 351, 6065, 694, 268, 447, 247, 82, 3434, 1625, 262, 4485, 286, 262, 317, 2164, 13517, 851, 326, 1398, 286, 8050, 8786, 508, 26643, 6065, 694, 268, 447, 247, 82, 7159, 290, 13768, 262, 2520, 11, 266, 5889, 290, 477, 11, 355, 257, 7310, 290, 2081, 3814, 13, 198, 198, 22911, 2173, 503, 326, 39016, 35865, 440, 447, 247, 27136, 1718, 6065, 694, 268, 6411, 379, 530, 1948, 966, 326, 262, 317, 2164, 13517, 743, 407, 423, 25, 6065, 694, 268, 447, 247, 82, 9465, 286, 42277, 13624, 355, 262, 31432, 354, 11635, 326, 2714, 523, 881, 286, 262, 2520, 1978, 13, 16227, 262, 4274, 12, 48916, 3450, 286, 440, 447, 247, 27136, 447, 247, 82, 10165, 13, 198, 198, 22911, 3011, 656, 477, 883, 2428, 290, 356, 3080, 1978, 11, 1107, 11, 257, 4958, 913, 1848, 11, 34150, 355, 262, 2428, 389, 287, 3950, 13, 1002, 345, 447, 247, 260, 4609, 11, 314, 7898, 345, 284, 2298, 465, 1492, 510, 13, 198, 198, 1537, 994, 447, 247, 82, 262, 1517, 326, 299, 3775, 502, 783, 25, 6065, 694, 268, 290, 1854, 9763, 510, 511, 3667, 351, 1307, 15071, 1366, 326, 373, 1327, 284, 45071, 319, 663, 1986, 13, 383, 8050, 16355, 447, 247, 1266, 4578, 373, 326, 262, 564, 250, 42624, 447, 251, 15209, 372, 2741, 561, 423, 311, 44262, 2741, 25340, 4245, 1497, 262, 2520, 447, 247, 82, 5369, 290, 8543, 340, 588, 790, 584, 636, 286, 262, 1499, 25, 37665, 4612, 13, 198, 198, 37, 2286, 351, 867, 286, 262, 976, 1307, 15071, 2761, 1909, 357, 3826, 11, 329, 1672, 11, 6041, 286, 262, 1366, 379, 7324, 13, 19608, 330, 9255, 13, 38439, 1416, 608, 13, 2398, 828, 857, 262, 2520, 991, 8588, 663, 7310, 6517, 30, 2141, 356, 311, 44262, 2741, 760, 1909, 644, 1838, 514, 8050, 30, 198, 198, 31825, 17476, 2764, 6060, 3337, 198, 198, 464, 19768, 291, 994, 561, 2897, 257, 47346, 286, 6502, 7802, 290, 910, 326, 262, 2520, 318, 355, 16196, 355, 340, 1683, 468, 587, 11, 290, 355, 16196, 355, 6065, 694, 268, 3417, 340, 11, 3613, 329, 262, 3090, 286, 564, 250, 22744, 12, 71, 803, 447, 251, 290, 564, 250, 7145, 12, 83, 10720, 447, 251, 284, 262, 890, 1351, 286, 31129, 1083, 13, 198, 198, 464, 317, 2164, 3699, 16355, 11, 287, 50043, 6065, 694, 268, 290, 1854, 11, 6235, 503, 262, 2520, 447, 247, 82, 41773, 329, 1408, 9449, 290, 33558, 11, 663, 7522, 2438, 326, 20945, 6573, 4069, 11, 663, 670, 29520, 326, 287, 867, 2663, 373, 1682, 3124, 7770, 13, 4650, 286, 606, 10810, 262, 1109, 326, 262, 2520, 447, 247, 82, 2994, 287, 262, 7511, 1810, 916, 2967, 287, 663, 661, 257, 2994, 286, 24211, 290, 4547, 286, 3950, 13, 5326, 1139, 25, 198, 198, 3152, 663, 37743, 7433, 287, 3761, 286, 281, 16536, 27339, 2728, 11, 262, 2520, 9477, 281, 287, 263, 324, 18424, 2565, 286, 262, 15444, 25, 262, 9359, 326, 772, 262, 1266, 286, 13817, 460, 467, 27377, 2642, 11, 326, 31792, 922, 460, 307, 3170, 319, 4858, 6181, 11, 326, 867, 1243, 5445, 2314, 307, 285, 1631, 11, 290, 326, 881, 6181, 1276, 37220, 307, 24067, 13, 198, 198, 818, 440, 447, 247, 27136, 447, 247, 82, 2456, 11, 564, 250, 1135, 423, 550, 674, 2121, 13, 447, 251, 943, 5162, 1346, 1566, 262, 10836, 1810, 393, 860, 14, 1157, 11, 645, 584, 10000, 286, 262, 1499, 2993, 286, 884, 13, 198, 198, 3666, 1808, 25, 2354, 286, 257, 34036, 46908, 1042, 11, 466, 356, 1909, 287, 262, 2520, 991, 423, 428, 5369, 30, 198, 198, 13710, 428, 468, 1464, 587, 2081, 11, 475, 616, 2565, 286, 428, 318, 326, 845, 1178, 423, 597, 18437, 286, 428, 5369, 11, 290, 1178, 1337, 284, 13, 554, 262, 10016, 3006, 11, 884, 355, 810, 314, 2107, 11, 257, 49332, 2565, 286, 5369, 851, 1912, 355, 881, 287, 1957, 5348, 355, 287, 262, 2520, 2346, 851, 991, 537, 654, 284, 262, 18639, 290, 7032, 13, 2011, 7968, 11, 28132, 3418, 11, 373, 1752, 530, 286, 262, 4094, 11408, 286, 5481, 1636, 11219, 287, 262, 2520, 13, 14303, 465, 9950, 1528, 826, 706, 314, 5399, 262, 3085, 11, 616, 7533, 447, 247, 82, 881, 12, 75, 2668, 22309, 11, 5811, 10077, 1636, 11, 991, 2630, 286, 262, 25760, 326, 5901, 9436, 3469, 1990, 8270, 287, 3426, 11, 618, 11219, 373, 1234, 284, 1910, 287, 262, 3236, 43675, 326, 49038, 1068, 3240, 13, 198, 198, 1537, 340, 2492, 447, 247, 83, 655, 262, 11219, 290, 663, 8508, 25, 340, 373, 262, 2055, 447, 247, 82, 9465, 326, 340, 373, 845, 881, 257, 1204, 18041, 286, 262, 1957, 3773, 11, 290 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]
Marc has spent 25 years in the live entertainment industry. He became interested in comics in 6th grade, but he couldn't draw. With the advent of computer graphic programs, he's giving it a go after 5 years of trial & error (mostly error). ... full profile
[ 22697, 468, 3377, 1679, 812, 287, 262, 2107, 9739, 2831, 13, 679, 2627, 4609, 287, 12770, 287, 718, 400, 9559, 11, 475, 339, 3521, 470, 3197, 13, 2080, 262, 19980, 286, 3644, 13028, 4056, 11, 339, 338, 3501, 340, 257, 467, 706, 642, 812, 286, 4473, 1222, 4049, 357, 29471, 4049, 737, 198, 986, 1336, 7034 ]
[ 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1, 1 ]