text
stringlengths 1.9k
1.3M
| url
stringlengths 24
511
|
|---|---|
The New Humanitarian | IRIN special report on proposed Niger Delta bill
IRIN special report on proposed Niger Delta bill - The New Humanitarian puts quality, independent journalism at the service of the millions of people affected by humanitarian crises around the world
LAGOS
[This IRIN report does not necessarily reflect the views of the United Nations]
A bill proposed by President Olusegun Obasanjo for the development of the Nigeria's strife-torn Niger Delta has had a
difficult time gaining unanimous acceptance.
In fact, none of the groups in the region, often in conflict with one another in recent years, have found the draft Niger Delta Development Commission (NDDC) bill acceptable.
On 1 September, traditional rulers from the Delta, grouped in the
Traditional Rulers Oil Mineral Producing Communities of Nigeria (TROPCON), urged the National Assembly to throw out the bill, saying it was not meant to serve the interests of the people in the oil region.
Both the government and militant activists in the Niger Delta agree that the region, which produces most of the country's wealth, has suffered untold neglect in the 40 years since oil production began there.
But there are strong differences on how best to redress the grievances of the area's inhabitants.
Obasanjo's bill proposes a development plan for the impoverished Delta to be funded with 0.5 percent of the annual budgets of the oil transnationals operating in the country and half of the 13 percent of oil revenue which, according to the constitution, should go to each producing region.
But Chief Edwin Clark, a leader of the estimated four million Ijaws - the biggest ethnic group in the area - says not only did the government not consult the people in drafting the bill, but also the provisions are insufficient.
"All we are saying is that the beneficiaries of the bill are not
consulted," he said in a protest sent to the national assembly. "We will like to have a say. The bill is defective in certain aspects. We are saying if the bill is passed in this form it is not our bill."
The communities in the three core delta states of Rivers, Delta and Bayelsa contest the government's definition of the Niger Delta, which includes the neighbouring oil-producing states of Cross River, Abia, Imo, Akwa Ibom and Edo, on the grounds that people in their areas have suffered years of abject neglect.
In addition, Clark says, the 13 percent of oil revenue reserved for the oil states should be left intact, while more funds should be provided from oil taxes, rents and royalties accruing to the federal government.
Another point of disagreement is membership and chairmanship of the board of the NDDC.
While only indigenes of the real oil-producing communities were eligible to be members of an Oil Minerals Producing Areas Development Commission (OMPADEC) that operated under the country's former military rulers, the NNDC bill does not make any such provision.
Community leaders also complain that unlike the decree that established OMPADEC in 1991, the NDDC bill does not provide for prior consultation with the oil-producing communities on proposed developmental projects.
They maintain that OMPADEC failed in the past because it was politicised and severely underfunded, pointing out that up until this year, the federal government had withheld 41 billion naira belonging to the commission.
(The exchange rate of the naira is now 100 to the US dollar. For most of the existence of OMPADEC, a rate of 22:1 for governmental transactions coexisted with a parallel rate under a two-tiered system that was scrapped at the end of 1998.)
OMPADEC, the community leaders say, received only 20 billion naira in the six years that it really functioned - by 1997, it had all but collapsed and was placed under a sole administrator.
More radical elements in the Delta are worried that the bill does not address their demands for a decentralisation of state power so as to give the area more political autonomy and control over the oil resources that form the backbone of Nigeria's economy.
"What we are against is a unitarist state that takes control over the resources of our people and gives us handouts," Nengi Ebitimi of the militant Movement for the Survival of Ethnic Ijaws of the Niger Delta told IRIN.
Government officials have met various interest groups in the Delta, including a forum of the area's elected representatives, to work out mutually acceptable amendments to the draft bill.
In the meantime, "let us appeal to our Niger Delta brethren to continue to exercise restraint", ethnic Ijaw lawyer A.J. Owonikoko urged in a recent article in 'Thisday' newspaper.
"They must realise that were it not for democracy, the first version of that bill would have become law undebated and nobody would have been happier for it."
This article was produced by IRIN News while it was part of the United Nations Office for the Coordination of Humanitarian Affairs. Please send queries on copyright or liability to the UN. For more information:https://shop.un.org/rights-permissions
| https://www.thenewhumanitarian.org/feature/1999/09/06/irin-special-report-proposed-niger-delta-bill |
Sustainability | Free Full-Text | Energy Efficiency for Supplier and Sustainability for Demand: A Case of Heating Systems in South Korea
This paper addresses an analysis of a recent debate in South Korea on energy efficiencies between a combined heat and power system with district heating (CHP-DH) and separate heat and power system (SHP) by applying a scenario analysis technique. In accordance with the Low Carbon Green Growth strategy where the rise of social awareness for energy savings is imminent, various scenarios were considered including CHP-DH (excluding waste heat recovery) versus SHP and CHP-DH (including waste heat recovery) versus SHP. To analyze the satisfaction on energy efficiency of each heating system, nationwide average field data were acquired via a survey with the help of the Korea District Heating Corporation (KDHC), and a comprehensive model for measuring sustainable value related to energy consumption, including economic (ECON), non-economic (NECON), and environmental (ENV) values were presented based on customer satisfaction (SAT). As a result of the structural equation model (SEM) and ordinary least squares (OLS) regression, variations of energy efficiencies of each heat and power delivery system are rather distinctive among different scenarios due to the performance characteristics of each system in the field. The energy savings of CHP-DH systems owned by KDHC, based on nationwide average performance, was found to be higher than the SHP system by 3.25% to 18.1%. While the effect of NECON and ENV on SAT was not significant in SHP, it was significant in CHP-DH. Based on these results, rational decisions can be made to lead the government and energy consumers to maximize energy efficiency, especially in South Korea, where the energy market heavily relies on foreign countries.
Energy Efficiency for Supplier and Sustainability for Demand: A Case of Heating Systems in South Korea
by Chulseung Lee 1 , Jaechan Park 2 , Kangmun Lee 3 , Ji Yeon Yang 4 and Taewoo Roh 5,*
Seoul School of Integrated Sciences & Technologies, Ewhayeodae 2-gil, Seodaemun-gu, Seoul 03767, Korea
Department of Business Administration, Yeungnam University, Daehak-ro 280, Gyeongsan, Gyeongbuk-do 38541, Korea
5
Department of International Trade and Commerce, Soonchunhyang University, Unitopia 901, Soonchunhyang-ro 22, Sinchang-myeon, Asan-si, Chungchungnam-do 31538, Korea
*
Author to whom correspondence should be addressed.
Sustainability 2019 , 11 (15), 4216; https://doi.org/10.3390/su11154216
Received: 10 July 2019 / Revised: 30 July 2019 / Accepted: 2 August 2019 / Published: 4 August 2019
Abstract
:
This paper addresses an analysis of a recent debate in South Korea on energy efficiencies between a combined heat and power system with district heating (CHP-DH) and separate heat and power system (SHP) by applying a scenario analysis technique. In accordance with the Low Carbon Green Growth strategy where the rise of social awareness for energy savings is imminent, various scenarios were considered including CHP-DH (excluding waste heat recovery) versus SHP and CHP-DH (including waste heat recovery) versus SHP. To analyze the satisfaction on energy efficiency of each heating system, nationwide average field data were acquired via a survey with the help of the Korea District Heating Corporation (KDHC), and a comprehensive model for measuring sustainable value related to energy consumption, including economic (ECON), non-economic (NECON), and environmental (ENV) values were presented based on customer satisfaction (SAT). As a result of the structural equation model (SEM) and ordinary least squares (OLS) regression, variations of energy efficiencies of each heat and power delivery system are rather distinctive among different scenarios due to the performance characteristics of each system in the field. The energy savings of CHP-DH systems owned by KDHC, based on nationwide average performance, was found to be higher than the SHP system by 3.25% to 18.1%. While the effect of NECON and ENV on SAT was not significant in SHP, it was significant in CHP-DH. Based on these results, rational decisions can be made to lead the government and energy consumers to maximize energy efficiency, especially in South Korea, where the energy market heavily relies on foreign countries.
Keywords:
combined heat and power
;
consumer sustainability
;
district heating
;
energy efficiency
;
separate heat and power
1. Introduction
The United Nations Framework Convention on Climate Change (UNFCCC) is an international environmental treaty negotiated at the United Nations Conference on Environment and Development (UNCED), held in Rio de Janeiro from 3–14 June 1992. The objective of the treaty was to “stabilize greenhouse gas concentrations in the atmosphere at a level that would prevent dangerous anthropogenic interference with the climate system” in line with “States (both developed and developing countries) [that] have common but differentiated responsibilities.” [
1
]. In 1997, after the signing of the UNFCCC treaty in Kyoto, parties to the UNFCCC met at conferences to discuss how to achieve the treaty’s aims. At the 3rd Conference of the Parties (COP-3), the parties paved the way to reduce greenhouse gas emission effectively and support sustainable development of developing countries by defining three “flexibility mechanisms” which are International Emissions Trading (IET), the Clean Development Mechanism (CDM), and Joint Implementation (JI); the Kyoto Protocol [
2
].
Although South Korea is not bound by the U.N.’s Kyoto Protocol as a first developing (non-Annex I) country, the Korean government voluntarily set a 2020 emissions reduction target to head off an estimated 30 percent rise in emissions compared to the 2020 Business-as-Usual (BAU) emission projection, considering increased national competitiveness and expectations from international society [ 3 ]. This goal reaches the highest level of recommendations from the IPCC, showing the strong commitment of the Korean government to join the global movement for coping with climate change. However, the heavy-duty climate change policy of Korean government re-ignited the debate over the effectiveness between combined heat and power systems with district heating (CHP-DH) and separate heat and power systems (SHP), which is a deep-rooted debate in the domestic heating energy industry. Keeping pace with the promotion of the policy for expanding district heating in energy advanced countries such as National Green Growth Strategy [ 4 ] and the European Union [ 5 , 6 , 7 , 8 , 9 , 10 , 11 ], the South Korean government released an expansion plan on the CHP-DH system in both residential and commercial sectors. Moreover, in some countries, the tendency is to reduce temperatures and use renewable or waste energy recovery, and legislative enforcement of the policy to utilize at least 50% renewable and recovery is found in district heating (DH). It means that any buildings in such countries are required to increase energy efficiency when using heat pumps and thermal storage. In this regard, 4th generation DH integrating smart thermal grids [ 12 ], thermal energy storage strategies for solar heating systems, and data-driven models for building scale applications are suggested [ 13 ].
This has made the conflict even more profound on the comparative advantages of energy efficiency between business operators of the CHP-DH system and the SHP system [ 14 , 15 , 16 ]. Accordingly, several comparative studies have been published claiming comparative advantage of energy efficiency between the CHP-DH and SHP systems [ 17 , 18 ]. The differences between each study for estimating or using specific parameters are listed in Table 1 . However, two points should be considered in terms of understanding these previous studies. First, previous researches analyzing the fuel consumption reduction effects of most heating methods are based on different research methodologies, but, in the end, these research methodologies are merely a difference in methodology and there is no difference in primary research value. Secondly, each research agency (business operators who own either the CHP-DH system or SHP system) sets their analysis conditions more favorably based on their own interests compared to their opponents’, which can result in different aspects favoring their system. For instance, in terms of the calculation method of the heat production used in energy efficiency comparison between different heating delivery systems, Yoon and Kang [ 19 ] included the amount of waste heat recovery from an incineration plant while the Korea Energy Agency (KEA) [ 20 ] calculated the amount of heat production based on the volume of the sales records. Additionally, in terms of the electricity production, the report provide compensation amounts based on the contract while reports from the Korea Institute of Energy Research (KIER) did not differentiate since it already included the amount of electricity production from the Korea Electric Power Corporation (KEPCO) or did not include any comparison [ 18 ]. These results from different approaches based on different interests become a problem confusing the government and energy consumers.
On the other hand, in previous research, the efficiency debate by the heating system was centered on the producer. In other words, the perceived value by consumers using the heating was not reflected. It is a crucial consideration, because first of all, economic efficiency alone can deepen the current environmental problems and make it challenging to use sustainable energy [ 21 ]. The efficiency debate between CHP-DP and SHP may be exhaustive when considering the preference of customers who tend to choose one or the other system as final energy demand. Thus, incorporating the value of demand in energy consumption may help to increase the understanding for which heating system is sustainable for our society. Besides, if customer preferences are a way to deepen environmental concerns, a national strategy is needed to improve the use of eco-friendly energy through policy-based support and promotion [ 22 , 23 ]. In this study, we try to identify the value of the actual customers in the selection and use of a heating system beyond the current producer-centered efficiency controversy and to clarify the relationship between the satisfaction with and loyalty to the selected heating system. Through previous studies, we found that customer value for each heating mode can be divided into economic value and non-economic value, and non-economic value is again divided into convenience and sociality. While previous studies on energy use have primarily focused on economic value, some recent studies suggest that customers are increasingly interested in sustainable energy development and use [ 24 , 25 ].
Based on the current situation in the heating energy market in South Korea, this study emphasizes the importance of the consumer’s social responsibility by analyzing efficient energy usage according to the Low Carbon and Green Growth Strategy, and by inducing the government and energy consumers to make a reasonable selection of a heat and power delivery system [ 26 , 27 ]. This study is realized by comparing the energy efficiencies of the CHP-DH and SHP systems under various scenarios that can happen in the market to overcome the limitations of previous studies in South Korea.
2. Efficiency Comparison in CHP-DH and SHP
A typical residence for South Koreans is an apartment. According to the results of the 2010 Housing and Housing Census conducted by the Population and Housing Census, the number of households living in apartments was 816.9 million, accounting for 47.1% of the total, and the proportion of apartments in all houses was 59% [
29
]. There are three types of heating methods used in apartments representing apartment houses: District heating, individual heating, and central heating. Of these, central heating has been replaced with other heating methods recently, so it can be said that district heating and individual heating are the mainstream. Until now, the discussion about the heating method has been centered mainly on suppliers. Most of these discussions have been done in a way that deduces mechanical efficiency from the heat producer’s point of view or the heater manufacturer’s point of view. Also, it is indeed impossible to calculate accurate efficiency because the characteristics of buildings and facility operating conditions are different.
2.1. Definitions of Efficiencies Applied for Evaluating the CHP System
2.1.1. Heat Efficiency
Heat efficiency (or total efficiency) of a system is defined as a ratio of the output energy against the input that is required in terms of thermal unit. In the case of a CHP system, it is defined as shown below Equation (1) [ 30 ]. In Equation (1), refers to efficiency which is dimensionless while E refers to energy.
n
g
,
o
u
)
/
E
u
e
l
n
(1)
Since the relative usefulness of the electric energy against heat energy is neglected in this efficiency equation, the overall efficiency of the CHP system can be underestimated compared to the SHP system. Application of the heat efficiency is mostly appropriate when types of outputs and heat to power ratios between systems are the same. Thus, it is not suitable to use heat efficiency when types of outputs or heat to power ratios between systems are different.
2.1.2. Exergy Efficiency
Although there are various definitions for exergy efficiency, exergy is technically formulated as a combination of absolute temperatures reflecting the usefulness of each type of energy. The exergy can also be described as one of the thermodynamic properties that can produce useful work. Thus, it can also be defined as a ratio of this useful work against the exergy input. Exergy efficiency is suitable for the performance analysis of energy systems since it precisely provides the limit of possible improvements on the system’s efficiency [
31
]. However, the exergy efficiency is usually low in residential and commercial buildings for heating and cooling with hot water supply where the lower temperature grade source is being used. It indicates that it is more appropriate to use renewable energy sources such as groundwater and waste heat rather than using fuel or an expensive form of energy in places where low-temperature grade sources are being used. Exergy is also known as an available work (availability) based on the second law of thermodynamics and a tool to analyze the amount of lost and useful work for various system types. In other words, the exergy is a method of evaluating the quality and the quantity of a form of energy within a thermodynamic process which can help to improve the process by verifying errors in the design stage and analyzing the input and output of the entire process.
2.1.3. PURPA Efficiency
PURPA efficiency is defined as follows according to the “Public Utility Regulatory Policy Act (U.S. Congress 1978),” [ 32 ] which assumes the usefulness of the heat energy is half of the electric energy for the CHP system. In the case of a CHP system, it is defined as shown below the Equation (2).
η
PURPA
=
(
E
e
l
e
c
t
r
i
c
i
y
u
t
(2)
2.2. Methods of Evaluating Energy Savings of CHP System
Although there are various approaches for evaluating energy savings between CHP and SHP systems [ 25 ], these approaches can be classified into three different approaches. First is a relative comparison of energy inputs between two systems for producing the same amount of electric and heat energy based on the CHP system’s output. The second approach is a relative comparison of two systems, where the CHP system’s operation is led by heat energy demand. The latter approach is a relative comparison of two systems, where the CHP system’s operation is led by electric energy demand.
2.2.1. CHP System Electric and Heat Energy Output
This approach compares the number of energy inputs between systems where the SHP system produces the same amount of electric and heat energy that is produced from the CHP system. For example, as shown in Figure 1 , if the thermal efficiency and electrical efficiency of a CHP system are 36% and 40%, and those of an SHP system is 45% and 85%, respectively; the SHP system requires 131.24 of input energy to produce the same amount of electric and heat energy when 100 of input energy is used for the CHP system. Thus, the amount of energy saved for using CHP system is 31.24%, and the energy-saving is 23.8%. Examples are as follows:
Amount of energy-saving (88.89 + 42.35) − 100 = 31.24%
Percentage of energy-saving (131.24 − 100) / 131.24 = 23.8%
2.2.2. CHP System Operation Led by Heat Energy Demand
As shown in Figure 2 , if the demand of electric and heat energy is 45 and 36, respectively, the SHP system requires 42.35 of input energy to meet the heat energy demand and 100 of input energy to meet the electric energy demand. To meet the same demand with CHP system where the heat energy demand leads the system operation, 100 of the input energy is required to produce 36 of heat energy and the corresponding electric energy production becomes 40. An additional 11.11 of the input energy is required to meet the remaining electric energy demand. Thus, the SHP system requires a total of 142.35 of input energy to meet the demand where the same demand can be met with 111.11 of input energy by the CHP system. The amount of energy-saving is 31.24% in this case, and the percentage of energy-saving becomes 21.9%.
2.2.3. CHP System Operation Led by Electric Energy Demand
As shown in Figure 3 , if the CHP system’s operation is led by electric energy demand and where the heat energy produced from the CHP system is considered as the heat demand for the SHP system, 112.5 of input energy is required for the CHP system to meet 45 of electric energy demand which results in 40.5 of the heat energy production. The SHP system requires 47.65 of input energy to meet the heat energy demand of 40.5. Thus, the SHP system requires total 147.65 of input energy. The amount of energy-saving is 35.15% in this case, and the percentage of energy-saving becomes 23.8%. Examples are as follows:
Amount of energy-saving (100 + 47.65) – 112.5 = 35.15%
Percentage of energy-saving (147.65 – 112.5) / 147.65 = 23.8%
2.3. Scenario Analysis
Our scenario approach illustrated in Section 2.2.1 is selected in this study to relatively compare the energy efficiencies between the CHP-DH and SHP systems [ 33 , 34 , 35 ]. Since there is a significant difference between scenarios where the waste heat recovery is included or not included, two different cases with and without waste heat recovery were separately compared to eliminate the case when certain heat and power delivery systems are favored in certain scenarios (see Table 2 ).
Various scenarios are considered in this study using the scenario analysis technique which acts as a strategic planning tool [
36
,
37
] to aid rational decision making of policymakers and energy consumers by verifying parameters that affect results for different and possible scenarios to provide reliable results. In other words, an appropriate strategy can be established and put into practice [
38
] by analyzing possible scenarios that will occur under the situation with uncertainties. However, rational decisions will be more challenging to make if the number of scenarios is too many. Thus, the total number of scenarios is typically limited to a particular maximum [
39
].
Scenario analysis includes estimates of energy that meet a variety of policies. Generally, energy policymakers make forecasts based on the extent of the results, but the uncertainty range of the forecasts is conditional. While existing literature often embraces uncertainty, results from a wide range of empirical studies do not provide more in-depth information than we think.
Scenarios forecasts and typical forecasts can be used interchangeably, but there are some differences in their meaning. In order to distinguish their meanings, a prediction is something in the future that can be accessed with probability [
40
]. That is, scenarios are predictions that something can happen under certain conditions, and scenario-based forecasting means analyzing the various alternatives that arise from what can happen. The scenario analysis covered in this paper started with the assumption that the forecasting can have the same energy efficiency to solve CHP-DH and SHP conflicts. As a result, we compared each heating system with energy input that could be different for each scenario. In this context, the scenario analysis technique is a simplified modeling technique based on a specific perspective and is a thought experiment predicting multiple futures, practically, under a pre-selected important and meaningful point of view [
41
]. Eight possible scenarios are considered in this study to limit the number of scenarios and to induce rational decision making for energy consumers. Our three-digit components of scenarios were comprised of eight scenarios. The first digit ranges from 40 to 50 percent of electrical efficiency. The second one ranges from 15 to 20 percent of heat loss. The third one ranges from 85 to 90 percent of thermal efficiency.
2.4. Results
2.4.1. Case 1: Energy Efficiencies between Heat and Power Systems without Waste Heat Recovery
The selected six cities were the branches of KDHC (Korea District Heating Corporation) which was transformed into a public corporation under the Collective Energy Business Act in May 1990. Although KDHC operates 18 branches, there were only eight operating CHP-DHs among them. In addition, there were 6 cites (Daegu, Suwon, Cheongju, Hwaseong, Bundang, and Goyang) that allowed us to use actual data on energies for the scenarios to be confirmed. The energy savings of the CHP-DH system compared to the SHP system are calculated for six different KDHC’s branch plants in six cities by classifying eight scenarios with combinations of the most significant parameters (electrical efficiency, heat loss percentage, and boiler efficiency) that affect the energy efficiency of the system. The difference between including and excluding the energy from the waste heat recovery system is depicted in
Figure 4
.
Table 3
shows an example of energy savings calculation for scenario 1. Electrical efficiency, heat loss percentage, and boiler efficiency are assumed as 40%, 15%, and 85%, respectively, under the condition where the waste heat recovery is not considered. Based on field measurements of KDHC’s branch plants, heat to power ratio (HPR) of the CHP-DH system in Daegu is measured as 5.23:1 without the effect of waste heat recovery. The amount of energy input to produce the electric and heat demand on this site is assumed as 100. In this scenario, the SHP system requires 68.08 of energy input to meet the heat demand and 32.51 of energy input to meet the electric demand. Thus, the total energy input for the SHP system is 100.59, and the amount of energy saving of the CHP-DH system becomes 0.59 kcal (percentage of energy-saving is 0.59%). The HPR in Suwon is measured as 4.23:1 and 100 energy input is assumed on this site as well for the CHP-DH system. In this scenario, the SHP system requires 69.04 of energy input to meet the heat demand and 40.78 of energy input to meet the electric demand. The total energy input of the SHP system becomes 109.82, and the amount of energy saving of the CHP-DH system is 9.82 (percentage of energy-saving is 8.94%). The HPR in Cheongju is measured as 2.62:1 and 100 energy input is assumed on this site as well for the CHP-DH system. In this scenario, the SHP system requires 64.15 of energy input to meet the heat demand and 61.10 of energy input to meet the electric demand. The total energy input of the SHP system becomes 125.25, and the amount of energy saving of the CHP-DH system is 25.25 (percentage of energy-saving is 20.16%). The HPR in Hwaseong is measured as 0.63:1 and 100 energy input is assumed on this site as well for the CHP-DH system. In this scenario, the SHP system requires 27.32 of energy input to meet the heat demand and 108.17 of energy input to meet the electric demand. The total energy input of the SHP system becomes 135.49, and the amount of energy saving of the CHP-DH system is 35.49 (percentage of energy-saving is 26.19%). The HPR in Bundang is measured as 0.83:1 and 100 energy input is assumed on this site as well for the CHP-DH system. In this scenario, the SHP system requires 28.32 of energy input to meet the heat demand and 84.67 of energy input to meet the electric demand. The total energy input of the SHP system becomes 113.01, and the amount of energy saving of the CHP-DH system is 13.01 (percentage of energy-saving is 11.51%). The HPR in Goyang is measured as 0.76:1 and 100 energy input is assumed on this site as well for the CHP-DH system. In this scenario, the SHP system requires 27.16 of energy input to meet the heat demand and 89.10 of energy input to meet the electric demand. The total energy input of the SHP system becomes 116.26, and the amount of energy saving of the CHP-DH system is 16.26 kcal (percentage of energy-saving is 13.99%).
The same calculations are used for the remaining seven scenarios (scenarios from 1 to 8). As shown in Table 4 , the CHP-DH system in scenarios 2 (40%, 15%, 90%), 3 (40%, 20%, 85%) and 4 (40%, 20%, 90%) mostly provides energy-saving against the SHP system, besides in Daegu. However, the CHP-DH system is favorable compared to the SHP system in Cheongju and Hwaseong while the SHP system is more favorable in Daegu, Bundang, and Goyang in scenarios 5 (50%, 15%, 85%), 6 (50%, 15%, 90%), 7 (50%, 20%, 85%), and 8 (50%, 20%, 90%).
2.4.2. Case 2: Energy Efficiencies between Heat and Power Systems with Waste Heat Recovery
Under the same condition, as shown in the previous section, the waste heat recovery is considered in this set of scenarios when calculating heat energy output. As shown in Table 5 , the first scenario assumes electric efficiency, the heat lost percentage, and boiler efficiency is 40%, 15%, and 85%, respectively. However, Cheongju and Hwaseong branch plants are excluded since those two branch plants do not have a waste heat recovery system.
The HPR in Daegu is measured as 6.40:1 by including the effect of waste heat recovery and 100 energy input is assumed on this site for the CHP-DH system. In this scenario, the SHP system requires 79.07 of energy input to meet the heat demand and 30.88 of energy input to meet the electric demand. The total energy input of the SHP system becomes 109.95, and the amount of energy saving of the CHP-DH system is 9.95 (percentage of energy-saving is 9.05%). The HPR in Suwon is measured as 6.33:1 and 100 energy input is assumed on this site as well for the CHP-DH system. In this scenario, the SHP system requires 93.37 of energy input to meet the heat demand and 36.86 of energy input to meet the electric demand. The total energy input of the SHP system becomes 130.24, and the amount of energy saving of the CHP-DH system is 30.24 (percentage of energy-saving is 23.22%). The HPR in Bundang is measured as 0.92:1 and 100 energy input is assumed on this site as well for the CHP-DH system. In this scenario, the SHP system requires 30.99 of energy input to meet the heat demand and 84.09 of energy input to meet the electric demand. The total energy input of the SHP system becomes 115.08, and the amount of energy saving of the CHP-DH system is 15.08 (percentage of energy-saving is 13.10%). The HPR in Goyang is measured as 0.8:1 and 100 energy input is assumed on this site as well for the CHP-DH system. In this scenario, the SHP system requires 28.6 of energy input to meet the heat demand and 88.74 of energy input to meet the electric demand. The total energy input of the SHP system becomes 117.34, and the amount of energy saving of the CHP-DH system is 17.34 (percentage of energy-saving is 14.78%).
Based on the results above, the CHP-DH system in Daegu (9.05%), Suwon (23.22%), Bundang (13.10%), and Goyang (14.78%) where electrical efficiency, heat loss percentage, and boiler efficiency are 40%, 15%, and 85%, respectively, showed favorable energy savings compared to the SHP system. The same calculations are used for the remaining seven scenarios (scenarios 2 to 8).
As shown in Table 6 , the CHP-DH system in scenarios 2 (40%, 15%, 90%), 3 (40%, 20%, 85%), and 4 (40%, 20%, 90%) provide energy savings in Daegu, Suwon, Bundang, and Goyang compared to the SHP system. The SHP system is more favorable compared to the CHP-DH system in Bundang and Goyang in scenarios 5 (50%, 15%, 85%), 6 (50%, 15%, 90%), 7 (50%, 20%, 85%) and 8 (50%, 20%, 90%). However, since Bundang and Goyang branch plants do have a system for recovering waste heat while electricity is being generated, it cannot be considered as a fair comparison.
2.4.3. Case 3: Comparison of Energy Efficiencies between Heat and Power Systems Based on Nationwide Average Performance
The last set of scenarios uses the nationwide average of total energy input, total electricity production and total heat production from the entire KDHC’s branch plants to calculate the energy savings of the CHP-DH system compared to the SHP system. As a result, the CHP-DH system showed affirmative energy savings against the SHP system in all eight scenarios by 3.25% to 18.1%, as shown in Table 7 .
3. Satisfaction Analysis for Demand Side
3.1. Consumer Values on the Heating System
The value inherent in a product or service produced by a company can be divided into two parts: Economic and non-economic. The economic value is the part where the consumer pays for the cost of providing the product or service, mainly the concept related to monetary value. The non-economic value is the part that the consumer can get through the consumption of the product or service [
42
]. In this study, we try to analyze the value produced by the heat supplier in economic and non-economic value. First, we would like to evaluate the economic feasibility by the heating system. Lee and Overby [
43
] compared the economic efficiency of central heating, individual heating, and district heating by actual heating ratio and a heating mode consciousness survey. The study analyzed apartment complexes in Seoul. As a result of the analysis, it was found that the heating cost of the district heating system was the lowest when using the same amount of heat. However, the heating cost of the apartment complex was found to be the lowest in the actual heating system.
Previous studies related to the non-economic value of apartment house heating systems are scarce. First, Yoon [
44
] classified apartment heating system into central heating, district heating system, and individual heating system according to the heat source production method. The results of the questionnaire survey and the comparison of the heating rate, heating temperature, and the number of heating complaints of rental houses show that the residents were satisfied because the district heating system is more environmentally friendly. Yoon et al. [
25
] evaluated the non-economic value of consumers for collective energy (district heating) through questionnaires. One of the results of the survey showed that the heating method was an essential factor in apartment selection. Consumers were having a significant influence on the selection of apartments. Comparing heating methods, satisfaction with the district heating method was higher than other heating methods. On the safety level, the local heating systems, individual heating systems, and central heating systems are listed in order of safety. Satisfaction with the indoor temperature had little difference between individual heating systems and the district heating systems, but the satisfaction with central heating systems is relatively low. Regarding the use of hot water, satisfaction was high in the order of district heating, individual heating, and central heating.
Sheth et al. [
45
] classified several values that occur concurrently in inducing the selection of a particular product, which is again referred to as a personal value and an inter-personal value. The value of personal value is that the factor that affects the behavior of consuming the product itself is derived from the value already possessed by the individual. Conversely, the relational value is the additional value that appears through purchasing. Thus, the personal value includes functional, conditional, emotional, and cognitive values, and relational value include social values. In this study, we attempted to approach these two categories of value from three perspectives. The value of personal value is divided into ECON and NECON, and the value of relational value generated through others is classified as ENV. In particular, ENV is personal values, and they are of considerable value to sustainability, including organizational and social values as well as global public interest and macro values.
3.2. Customer’s Satisfaction with the Heating System
Based on the existing research, the following research model was constructed in this study. The three factors of ECON, NECON, and ENV are derived from the values that consumers consider when choosing and using the heating method. It is the structure that affects loyalty with the heating method through customer satisfaction. ECON is the primary motivation for customer purchase behavior, and customer satisfaction is determined by the evaluation of customer economic value [
25
,
43
,
45
]. It is also the case with the choice of heating mode, where consumers are more likely to consider the economic aspect of heating considerably.
Consumer buying behavior is influenced by convenience NECON that are difficult to quantify, such as customer emotion and attitudes toward convenience, affecting customer satisfaction at the same time [
25
,
46
]. In recent years, consumers tend to use NECON as essential criteria for purchasing. In addition to the attributes, economics, and convenience of the product itself, the customer considers the social value of the product in terms of public interest and relationship, which is a focal indicator of customer satisfaction [
47
]. Recently, consumers are pursuing green consumption due to the impact of sustainable management and green management. In other words, consumer buying behavior can be interpreted as merely considering the social relations and influences as well as the attributes of the product itself, as well as its economic and non-economic aspects.
In general, customers who are highly satisfied with a particular product or service are likely to repeatedly purchase the product or service or give a positive word of mouth to others [ 46 ]. Also, satisfaction with customer value explains the positive relationship between customer buying behavior and loyalty [ 48 , 49 , 50 ]. This characteristic of the customer buying behavior can be applied to the selection of a heating system. Customers who are highly satisfied with a particular heating method are more likely to repurchase or recommend the same heating method to others. Based on these discussions, the research model can be derived in Figure 5 .
3.3. Methodology
SEM is an excellent tool for analyzing the degree to which consumers are aware of specific issues structurally through a questionnaire. SEM helps the study interpret the conceptual approach to qualitative analysis more quantitatively. In order for SEM to be justified, exploratory factor analysis (EFA) and confirmatory factor analysis (CFA) must first be identified, and then reliability and validity should be verified. Then, the conceptual relationship can be grasped through the path analysis model. In general, this study adopts this method as it can increase the robustness of the study by checking again with ordinary least squares (OLS) regression.
The order of estimation is summarized as follows. First, the value of the customer, which is considered necessary when choosing the heating method, is divided into efficiency as ECON, convenience as NECON, and sustainability as ENV. Second, economic, non-economic, and environmental values affect SAT. Third, satisfaction has a positive relationship with continuous to use (CU). Fourth, as a tool of estimation, we adopted both the structural equation method (SEM) and ordinary least square (OLS) regression. Lastly, by comparing with results of each estimation, we confirm which value has more influence on satisfaction and, thus, on continuous to use as accordance with the heating system.
3.4. Samples
In this study, 226 households using CHP-DH (146 households in the metropolitan area, 80 households in the metropolitan area) and 104 households using SHP (76 households in the metropolitan area and 28 households in the metropolitan area) were surveyed to measure the customer value of each heating system. Statistical random sampling was maintained, but sample sizes for heating methods were extracted as carefully as possible for objective analysis. Also, data were collected and analyzed by controlling the age, area, sunshine hours, living room direction, number of residences, and resident characteristics (e.g., number of living together, living with infants and the elderly, winter heating cost).
3.5. SEM Estimation
In order to verify latent variables for SEM, both exploratory factor analysis (EFA) and confirmatory factor analysis (CFA) were examined. As shown in
Table 8
, all indexes passed the threshold of each fit criteria concerning full samples comprised of two heat systems. Compared to the four indicators of EFA, CFA has been improved by eliminating each one of the variables observed in ECON and NECON. Factor loading (>0.7), average variance extracted (AVE) (>0.5), construct reliability (CR) (>0.7), and Cronbach’s alpha (>0.7) were all identified by dividing each heating system, and all conditions were satisfactory for convergent validity (see
Table A1
). For the discriminant validity, we verified the discrepancy in the degree of difference by comparing the coefficient found in the intra-class correlations (ICCs) of each latent to its square-rooted AVEs: No problem was found [
51
].
Results for SEM were shown in
Table 9
, and the dissimilarity of consumers’ perception of each heating system was verified. Panel A shows consumer perception on CHP-DH, and the effect of NECON and ENV on SAT was significant at 0.05 level (
β =
0.283,
β =
0.256, respectively). The effect of ECON on SAT was not significant. The effect of SAT on CU was significant at the 0.001 level (
β
= 0.652). In CHP-DH, ENV was the most influential factor in consumer satisfaction, followed by NECON, but the effect was not significant. Panel B shows consumers’ perception of SHP, and only ECON was found to affect SAT (
β =
0.437,
p
< 0.05). The effect of both NECON and ENV on SAT was insignificant. The effect of SAT on CU was significant at the 0.001 level (
β
= 0.606). Also, comparing Panel A with Panel B, fitness statistics for Panel A were slightly better.
3.6. OLS Regression
As shown in Table 10 , the results of OLS regression are not considerably different from those of SEM. Model 1 is the cognitive value of consumers on SAT. NECON and ENV showed a significant effect on SAT at 0.01 level ( β = 0.23, β = 0.26, respectively) and ECON did not. Model 2 is about the effect of CHP-DH on the CU of SAT, and the effect is significant at the 0.01 level ( β = 0.6). Model 3 examines the effect of SHP on consumers’ energy values on the SAT. As a result, only ECON was found to affect the SAT ( β = 0.27, p < 0.05). Model 4 shows that the effect of consumer satisfaction using SHP on CU is significant ( β = 0.57, p < 0.01). In summary, the results of OLS regression show that the effect of each factor is slightly different, but the overall meaningful relationship is the same as SEM.
4. Discussion
The energy efficiencies between the CHP-DH and SHP systems are compared in the previous sections. As shown in the previous sections, the energy savings between the two systems can be different based on how the set of parameters (electrical efficiency, heat loss percentage, and boiler efficiency) are specified. The CHP-DH system was saving energy, besides in Daegu, compared to the SHP system regardless of the waste heat recovery system in scenario group 1 (1, 2, 3 and 4) where the electrical efficiency is assumed as 40%. However, in scenario group 2 (5, 6, 7 and 8) where the electrical efficiency was increased to 50%, the energy savings of using the CHP-DH system became relatively less, or even not, favorable compared to the SHP system. Branches, where the CHP-DH system was not favorable compared to the SHP system, utilized more waste heat and produced relatively more heat energy than the electrical energy production. The main purpose of Bundang and Goyang branches is to meet the electric demand of the area rather than provide heat energy, and since these branches are supplied with additional heat energy from the waste heat recovery system of the Korea Electric Power Corporation (KEPCO), the energy savings drop relative to other branch plants. The case where the nationwide average performance (total energy input and total energy output) of the entire (also including branch plants without the CHP system available) KDHC’s branch plants are considered showed that the CHP-DH system saved more energy compare to the SHP system and produced more heat energy in both scenario groups.
5. Conclusions
This study analyzed the energy savings of the CHP-DH system by comparing the energy efficiencies between the CHP-DH and the SHP systems. The analysis is first classified into three different cases. The first case is where the CHP-DH system’s energy savings is calculated in comparison to the SHP system in terms of how much energy input is required in both systems based on the actual efficiencies of each plant and without including waste heat recovery. The second case is the same as the first case accept that the waste heat recovery effect is included in the calculation. The last case is where nationwide average efficiencies acquired from KDHC are used for the energy-saving calculation. Actual average efficiencies (15–20% heat loss) were applied based on field measurements in each plant (Daegu, Suwon, Cheongju, Hwaseong, Bundang, and Goyang) and the SHP system’s boiler efficiency (85–90%) and electrical efficiency (40–50%) were applied based on references.
The energy savings of the CHP-DH system compared to the SHP system mostly showed favorable results in scenarios 1 to 8, besides in Daegu, as shown in Table 4 . If waste heat recovery is included in the energy savings calculation for those branch plants which have the recovery system, the CHP-DH system is favorable compared to the SHP system for every plant in the scenarios, as shown in Table 6 . Based on the result of the nationwide average performance of the entire branch plants of KDHC, the CHP-DH system is favorable against the SHP system in every case where the energy savings vary from 3.25% to 18.1%. Thus, the policymaker and energy consumers should make rational decisions since the relative performance between two systems can vary according to the different characteristics (HPR, availability of waste heat recovery) of each plant. It should also be noted that there is no specific type of system favored in any conditions. It answers the latest issue that has been raised in the residential heating market in South Korea. However, these decisions must be made not by comparing energy efficiencies but based on the method which minimizes the social cost by maximizing the use of waste and renewable resources. Because the latest trend of energy-consuming patterns and technology development have been more focused not only on the energy efficiency but also on safety, minimizing energy loss, reducing greenhouse gases, complex systems, the stability of heat sources, the cost-effectiveness of heat sources, and renewable sources [ 52 , 53 , 54 , 55 ].
5.1. Theoretical Implications
This study has the following two theoretical contributions.
First, we simulated the assumption of energy waste in a multidimensional approach with several scenarios where energy is delivered to consumers by the supplier. This approach goes a step further from the previous study on energy supply and contributes to the flow of energy sustainability research by simultaneously dealing with both energy supply efficiency and customer satisfaction with the demands of heating systems. Energy sustainability is studied by Kelly and Pollitt [ 35 ], Chen et al. [ 16 ], and van der Veen and Kasmire [ 21 ]. Kelly and Pollitt [ 35 ] and Chen et al. [ 16 ] verified energy from a supplier perspective. Kelly and Pollitt [ 35 ] analyzed the future value of CHP-DH across the UK, and Chen et al. [ 16 ] derived positive results for geothermal use of the CHP system. On the other hand, van der Veen and Kasmire [ 21 ] attempted to narrow the gap between consumers and suppliers by suggesting a theoretical model that reduces the greenhouse gas in Germany, but only to understand consumer perception of the structure of energy. In particular, South Korea is a country that is highly dependent on SHP and is a representative country that needs long-term planning for sustainable energy consumption. We compared the views of DH and SHP energy on a nationwide sample of energy consumers in South Korea. In other words, this study aims to contribute to energy sustainability by developing a solution to how the discrepancy between the different points that suppliers and consumers can have can be solved.
Second, this study integrates subjective satisfaction based on user cognition based on objective simulation results related to energy efficiency by heating systems. Most of the previous researches relating customer value to heating systems showed mostly descriptive statistics focusing only on economics by consumer survey. The results of this study contributed to the flow of customer value measurement by heating systems. Energy policy should be established and implemented from a long-term and sustainable perspective, and the results of this study will help determine which heating methods are more sustainable over time, depending on the energy usage patterns of each country. In this study, a comprehensive model for measuring sustainable value related to energy consumption, including ECON, NECON, and ENV, was presented based on customer satisfaction [
45
,
48
]. After establishing hypotheses based on these models, we gathered data through a systematic questionnaire and then conducted a regression analysis to verify the hypotheses to further investigate customer satisfaction by the heating method.
5.2. Managerial Implications
This study suggests the following three practical implications.
First, we presented an option for an energy policy that the state could choose. This study is meaningful in that it confirms that the CHP-DH system is superior to the SHP system in energy savings. There are not many countries that can supply energy self-procurement, including South Korea. According to the OECD self-sufficiency rate by energy source [
56
], 15 out of 35 countries are not able to exceed 50% self-sufficiency rate. South Korea has the lowest energy self-sufficiency rate of 3.3%, the lowest among 35 countries. Therefore, this study suggests that the utilization of the district heating system for the efficient utilization of energy is an optional factor to be positively discussed at the national level.
Second, we suggested the possibility of using CHP-DH in the development of new high-density cities. CHP-DH is substantially related to the characteristics of urban development in South Korea. The urban development of South Korea, which is dominated by the expansion of high-density residential and business facilities using high-rise buildings, can be seen as promoting the active use of CHP-DH. Since the 1990s, the CHP-DH system has been actively utilized in heating and power supply systems in South Korea’s new urban development projects. In the process of such expansion, problems of thermal efficiency and measurement of consumption, which were raised as a problem of CHP-DH, have been continuously improved. CHP-DH has maintained its competitiveness through continuous improvement of problems and proved its value by applying the district heating system to recent new city development (e.g., second Dongtan). As a result, in the context of South Korea’s unique urban development approach, CHP-DH focused on convergence and integration of heating and power supply can achieve economies of scale on energy capacity. In other words, the results of the verification of the energy efficiency advantage of CHP-DH presented in this study will provide an additional basis for the necessity of CHP-DH selection in certain types of urban development. Mainly, CHP-DH is likely to be applied in areas with similar residential and climatic factors as Korea.
Third, we propose sustainable development such as energy welfare in addition to the importance of grasping customer needs for effective implementation of established government policy. Recent studies have shown that customers tend to consume social consumption that contributes to the public good, in addition to product attributes, economics, and convenience [
47
], and that consumer perception on CHP-DH and the effect of NECON and ENV on satisfaction (SAT) was significant. It implies that policymakers can effectively implement energy policy since customers have a positive perception of CHP-DH if they are aware of “good consumption.” On the other hand, in this study, we found that CHP-DH can increase the sustainability of energy use from a technical point of view. This result can be applied to the issue of stable and continuous heating and power supply to vulnerable groups in the context of social sustainability. In South Korea, CHP-DH is operated by the KDHC. The goal of public corporations is to pursue profit and to carry out public service activities. In recent years, South Korea has tried to implement policies such as public rental housing to deal with housing stabilization issues for vulnerable people in the new city development plan.. KDHC’s CHP-DH could be presented as an alternative to stable heating, cooling, and power supply to the disadvantaged. In other words, CHP-DH system operated by the public enterprise can achieve the social goal by differentiating the air-conditioning and power supply system according to the situation of the beneficiary using the energy in order to secure the sustainability of society at the welfare level.
5.3. Limitations
The limitations of this study can be described in four different aspects. The first limitation is that types of different heat and power systems are only classified into two different systems (CHP-DH and SHP) in this study. It leaves future work of estimating the energy savings for various types of systems other than the CHP-DH and SHP systems. The second limitation is based on the number of field measurements that were acquired in this study. Although this study includes field measurements in six different branch plants in South Korea, there is a chance for future work to increase the reliability of the comparison analysis by including additional field measurements. Moreover, if additional cases of various SHP systems can be assumed and the difference of energy efficiencies between cases be analyzed thoroughly, more precise results can be drawn. The third limitation of this study is the number of scenarios that are considered where the results might not be extended to other general cases. The fourth limitation of this study is related to the specific condition in South Korea. The estimation of energy savings of the CHP-DH system was relatively lower because there are four branch plants (Daegu, Suwon, Bundang, and Goyang) which have the capability of using the waste heat recovery system. Although the government is striving toward expanding infrastructures related to the use of CHP-DH and waste heat recovery systems to sustain the national economy and industry, the underestimated result shows the current situation of South Korea is vulnerable to the outside world, such as the crisis in the Middle East, since the energy market heavily relies on foreign countries.
Author Contributions
Conceptualization, C.L. and T.R.; methodology, C.L. and T.R.; formal analysis, T.R.; data curation, C.L., J.P. and T.R.; writing—original draft preparation, C.L., J.P., J.Y.Y., K.L., and T.R.; writing—review and editing, J.P., J.Y.Y., K.L., and T.R.; supervision, T.R.
Acknowledgments
This work was supported by the Soonchunhyang University Research Fund.
Conflicts of Interest
The authors declare no conflict of interest.
Appendix A
Table A1. Questionnaire items and statistics.
Table A1. Questionnaire items and statistics.
Construct Mean SD Economic value (Cronbach’s α = 0.77, AVE = 0.57, CR = 0.78) (strongly disagree = 1, strongly agree = 5) Heating charge (heating cost) 4.64 0.61 Unit rate (heating unit price) 4.45 0.79 Initial investment or conversion cost 3.88 0.95 Maintenance and operation maintenance cost 4.29 0.76 Non-economic value (Cronbach’s α = 0.79, AVE = 0.57, CR = 0.80) (strongly disagree = 1, strongly agree = 5) Convenience of heating use 4.54 0.61 Continuity of heating 4.31 0.75 Continuous hot water supply 4.53 0.70 Environmental value (Cronbach’s α = 0.87, AVE = 0.60, CR = 0.88) (strongly disagree = 1, strongly agree = 5) Safety in use 4.72 0.59 Accident risk 4.70 0.64 Eco-friendly 4.24 0.92 Energy efficiency 4.46 0.78 Saving energy 4.49 0.75 Satisfaction (Cronbach’s α = 0.90, AVE = 0.69, CR = 0.86) (strongly disagree = 1, strongly agree = 5) Heating cost, initial investment, and operating cost 3.82 0.93 Convenience, safety, continuity, and space utilization 4.06 0.93 Heating service management and services 3.75 1.03 Energy efficiency and eco-friendliness 3.93 0.96 Continuous to use (Cronbach’s α = 0.96, AVE = 0.88, CR = 0.96) (strongly disagree = 1, strongly agree = 5) Willingness to continue choosing the current heating system even after moving 3.93 1.10 Willingness to recommend the current heating system to relatives 3.84 1.11 Willingness to recommend the current heating system you are using to others 3.81 1.07
References
UNFCCC. What Is the United Nations Framework Convention on Climate Change? United Nations: Geneva, Switzerland, 1992. [ Google Scholar ]
UNFCCC. Mechanisms under the Kyoto Protocol ; UNFCCC: Geneva, Switzerland, 2006. [ Google Scholar ]
Kim, S. Korea to reduce greenhouse gas emissions 37% by 2030. The Korea Times , 30 June 2015. [ Google Scholar ]
OECD. National Green Growth Strategy ; OECD: Paris, France, 2013. [ Google Scholar ]
Meyer, N.I. European schemes for promoting renewables in liberalised markets. Energy Policy 2003 , 31 , 665–676. [ Google Scholar ] [ CrossRef ]
Knutsson, D.; Werner, S.; Ahlgren, E.O. Combined heat and power in the Swedish district heating sector-impact of green certificates and CO 2 trading on new investments. Energy Policy 2006 , 34 , 3942–3952. [ Google Scholar ] [ CrossRef ]
Andersen, A.N.; Lund, H. New CHP partnerships offering balancing of fluctuating renewable electricity productions. J. Clean. Prod. 2007 , 15 , 288–293. [ Google Scholar ] [ CrossRef ]
Al-Mansour, F.; Kožuh, M. Risk analysis for CHP decision making within the conditions of an open electricity market. Energy 2007 , 32 , 1905–1916. [ Google Scholar ] [ CrossRef ]
Danestig, M.; Gebremehdin, A.; Karlsson, B. Stockholm CHP potential-An opportunity for CO 2 reductions? Energy Policy 2007 , 35 , 4650–4660. [ Google Scholar ] [ CrossRef ]
Hinnells, M. Combined heat and power in industry and buildings. Energy Policy 2008 , 36 , 4522–4526. [ Google Scholar ] [ CrossRef ]
Difs, K. National energy policies: Obstructing the reduction of global CO 2 emissions? An analysis of Swedish energy policies for the district heating sector. Energy Policy 2010 , 38 , 7775–7782. [ Google Scholar ] [ CrossRef ]
Lund, H.; Werner, S.; Wiltshire, R.; Svendsen, S.; Thorsen, J.E.; Hvelplund, F.; Mathiesen, B.V. 4th Generation District Heating (4GDH). Integrating smart thermal grids into future sustainable energy systems. Energy 2014 , 68 , 1–11. [ Google Scholar ] [ CrossRef ]
Bourdeau, M.; Zhai, X.Q.; Nefzaoui, E.; Guo, X.; Chatellier, P. Modeling and forecasting building energy consumption: A review of data-driven techniques. Sustain. Cities Soc. 2019 , 48 , 101533. [ Google Scholar ] [ CrossRef ]
Lee, K.H.; Ryu, S.H.; Yang, J.H. A study on the estimation model of the amount of the energy consumption and CO2 emission according to the apartment heating type. Archit. Inst. Korea 2010 , 26 , 355–359. [ Google Scholar ]
Gustavsson, L.; Dodoo, A.; Truong, N.L.; Danielski, I. Primary energy implications of end-use energy efficiency measures in district heated buildings. Energy Build. 2011 , 43 , 38–48. [ Google Scholar ] [ CrossRef ]
Chen, M.; Lund, H.; Rosendahl, L.A.; Condra, T.J. Energy efficiency analysis and impact evaluation of the application of thermoelectric power cycle to today’s CHP systems. Appl. Energy 2010 , 87 , 1231–1238. [ Google Scholar ] [ CrossRef ]
Park, H.C.; Kim, H. Heat supply system using natural gas in the residential sector: The case of the agglomeration Seoul. Energy Policy 2008 , 36 , 3843–3853. [ Google Scholar ] [ CrossRef ]
Kim, D.W.; Lee, D.H.; Joo, D.H.; Seo, G.W. Comparative study on energy efficiency and environmental pollution by heating method. J. KARSE 2007 , 20 , 125–133. [ Google Scholar ]
Yoon, T.; Kang, J. Analysis of the effects of heating systems on household heating costs: Gas-boiler heating systems vs. district heating systems. Korean Energy Econ. Rev. 2015 , 14 , 243–272. [ Google Scholar ]
Korea Energy Agency (KEA). Comparison of Energy Usage and Cost by Type of Heating and Fuel Type ; KEA: Seoul, Korea, 2015. [ Google Scholar ]
Van der Veen, R.A.C.; Kasmire, J. Combined heat and power in Dutch greenhouses: A case study of technology diffusion. Energy Policy 2015 , 87 , 8–16. [ Google Scholar ] [ CrossRef ]
Jang, E.K.; Park, M.S.; Roh, T.; Han, K.J. Policy instruments for eco-innovation in Asian countries. Sustainability 2015 , 7 , 12586–12614. [ Google Scholar ] [ CrossRef ]
Jo, J.-H.; Roh, T.; Kim, S.; Youn, Y.-C.; Park, M.S.; Han, K.J.; Jang, E.K. Eco-innovation for sustainability: Evidence from 49 countries in Asia and Europe. Sustainability 2015 , 7 , 16820–16835. [ Google Scholar ] [ CrossRef ]
Park, S.-Y.; Lee, K.-S.; Yoo, S.-H. Economies of scale in the Korean district heating system: A variable cost function approach. Energy Policy 2016 , 88 , 197–203. [ Google Scholar ] [ CrossRef ]
Yoon, T.; Ma, Y.; Rhodes, C. Individual heating systems vs. district heating systems: What will consumers pay for convenience? Energy Policy 2015 , 86 , 73–81. [ Google Scholar ] [ CrossRef ]
Shim, Y. A study on consumer’s social responsibility. J. Consum. Stud. 2009 , 20 , 81–119. [ Google Scholar ]
Lah, T.J.; Pai, I.M.; Choi, S.Y.; Kim, A.S.; Kim, T.R. A study on the efficiency improvement of mass energy business in Seoul. Seoul Urban Res. 2003 , 4 , 105–124. [ Google Scholar ]
Ren, H.; Gao, W. Economic and environmental evaluation of micro CHP systems with different operating modes for residential buildings in Japan. Energy Build. 2010 , 42 , 853–861. [ Google Scholar ] [ CrossRef ]
Korea Energy Economics Institute (KEEI). Survey on Household Energy Consumption ; KEEI: Ulsan, Korea, 2018. [ Google Scholar ]
Dietsch, N. Model Energy Efficiency Program Impact Evaluation Guide ; United States Environmental Protection Agency (US EPA): Washington, DC, USA, 2007.
Ertesvåg, I.S. Exergetic comparison of efficiency indicators for combined heat and power (CHP). Energy 2007 , 32 , 2038–2050. [ Google Scholar ] [ CrossRef ]
US Congress. Public Utility Regulatory Policies ACT of 1978 ; US Congress: Washington, DC, USA, 1978.
Kaarsberg, T.M.; Roop, J.M. Combined heat and power: How much carbon and energy can manufacturers save? IEEE Aerosp. Electron. Syst. Mag. 1999 , 14 , 7–11. [ Google Scholar ] [ CrossRef ]
Nesheim, S.J.; Ertesvåg, I.S. Efficiencies and indicators defined to promote combined heat and power. Energy Convers. Manag. 2007 , 48 , 1004–1015. [ Google Scholar ] [ CrossRef ]
Kelly, S.; Pollitt, M. An assessment of the present and future opportunities for combined heat and power with district heating (CHP-DH) in the United Kingdom. Energy Policy 2010 , 38 , 6936–6945. [ Google Scholar ] [ CrossRef ]
Wack, P. Scenarios: Shooting the rapids. Harv. Bus. Rev. 1985 , 63 , 139–150. [ Google Scholar ]
Lee, S.H.; Lee, J.W. Korea mobile telecommunication market scenario analysis. East West Stud. 2005 , 17 , 143–164. [ Google Scholar ]
Shoemaker, P.J.H. Profiting from Uncertainty: Strategies for Succeeding No Matter What the Future Brings ; The Free Press: New Work, NY, USA, 2002. [ Google Scholar ]
Courtney, H.; Kirkland, J.; Viguerie, P. Strategy under uncertainty. Harv. Bus. Rev. 1997 , 75 , 66–79. [ Google Scholar ]
Peterson, G.D.; Cumming, G.S.; Carpenter, S.R. Scenario Planning: A Tool for Conservation in an Uncertain World Planificación de un Escenario: Una Herramienta para la Conservación en un Mundo Incierto. Conserv. Biol. 2003 , 17 , 358–366. [ Google Scholar ] [ CrossRef ]
Aligica, P.D. Scenarios and the growth of knowledge: Notes on the epistemic element in scenario building. Technol. Forecast. Soc. Chang. 2005 , 72 , 815–824. [ Google Scholar ] [ CrossRef ]
Kotler, P.; Keller, K. Marketing Management , 12th ed.; Prentice Hall: Upper Saddle River, NJ, USA, 2006. [ Google Scholar ]
Lee, E.J.; Overby, J.W. Creating Value for Online Shopping: Implications for Satisfaction and Loyalty. J. Cust. Satisf. 2004 , 17 , 54–67. [ Google Scholar ]
Yoon, T. A Study on Social and Economic Valuation of Collective Energy: Focused on Consumer Value ; Korea Energy Economics Institue (KEEI): Seoul, Korea, 2008. [ Google Scholar ]
Sheth, J.N.; Newman, B.I.; Gross, B.L. Why we buy what we buy: A theory of consumption values. J. Bus. Res. 1991 , 22 , 159–170. [ Google Scholar ] [ CrossRef ]
Westbrook, R.A.; Oliver, R.L. The Dimensionality of Consumption Emotion Patterns and Consumer Satisfaction. J. Consum. Res. 1991 , 18 , 84–91. [ Google Scholar ] [ CrossRef ]
Bobby, J.C.; Burnkrant, R.E. Interpersonal Influence on Consumer Behavior: An Attribution Theory Approach. J. Consum. Res. 1977 , 4 , 29–38. [ Google Scholar ]
Zeithaml, V.A. Consumer perceptions of price, quality, and value: A means-end model and synthesis of evidence. J. Mark. 1988 , 52 , 2–22. [ Google Scholar ] [ CrossRef ]
Rao, T.R. Consumer’s purchase decision process: Stochastic models. J. Mark. Res. 1969 , 6 , 321–329. [ Google Scholar ] [ CrossRef ]
Wathieu, L. Consumer habituation. Manag. Sci. 2004 , 50 , 587–596. [ Google Scholar ] [ CrossRef ]
Hu, L.; Bentler, P.M. Fit indices in covariance structure modeling: Sensitivity to underparameterized model misspecification. Psychol. Methods 1998 , 3 , 424–453. [ Google Scholar ] [ CrossRef ]
Yoo, B.-W. A mathematical model of a central district heating system for an urban residential community. J. Korean Inst. Ind. Eng. 1978 , 4 , 97–105. [ Google Scholar ]
Wu, D.W.; Wang, R.Z. Combined cooling, heating and power: A review. Prog. Energy Combust. Sci. 2006 , 32 , 459–495. [ Google Scholar ] [ CrossRef ]
Choi, Y.J. Water Management Policy of the City of Seoul ; Waterworks Research Institute (WRI): Seoul, Korea, 2015. [ Google Scholar ]
Jung, Y.M. Analysis on policy measurements and constitution for promotion of Combined Heat & Power (CHP) in context of climate change mitigation. Korea Environ. Policy Adm. Soc. 2010 , 18 , 1–28. [ Google Scholar ]
IEA (International Energy Agency). World Energy Outlook 2018 ; IEA: Paris, France, 2017. [ Google Scholar ]
Figure 1. Based on the CHP system’s electric and heat energy output.
Figure 1. Based on the CHP system’s electric and heat energy output.
Figure 2. Based on the CHP system operation led by heat energy demand.
Figure 2. Based on the CHP system operation led by heat energy demand.
Figure 3. Based on the CHP system operation led by electric energy demand.
Figure 3. Based on the CHP system operation led by electric energy demand.
Figure 4. Consideration of waste heat recovery.
Figure 4. Consideration of waste heat recovery.
Figure 5. Research model on the heating system.
Figure 5. Research model on the heating system.
Table 1. Review on energy efficiency analysis.
Table 1. Review on energy efficiency analysis.
Component Contents [Source] [ 19 , 24 ] [ 28 ] [ 20 ] [ 18 ] Heat Demand production record including waste heat recovery 25% of supply record sales record including waste heat recovery production record minus pipe loss (14%) including waste heat recovery CHP Fuel Consumption KDHC field measurement 85% thermal efficiency based on heat production KDHC field measurement KDHC field measurement Additional Fuel Consumption for SHP amount of compensation based on contract amount of compensation (fuel consumption difference between the thermal power plant and CHP plant) no criterion not required (includes electricity generation from KEPCO) SHP Electricity Production excluded excluded excluded included CHP Electricity Production used to calculate heat production (met by SHP’s boiler) based on CHP’s HPR used to calculate electricity deficit which is met by the typical thermal power plant fuel consumption based on electricity production which is met by the thermal power plant fuel consumption based on electricity production which is met by the thermal power plant Fuel Type of SHP Electricity Generation boiler (LNG) LNG bunker fuel, LNG thermal power plant field measurement SHP electrical Efficiency not required 38% (CHP electrical efficiency 27%) 38% each generation plant including transmission loss 4.5% Type of Heating for Comparison CHP-DH and SHP SHP CHP-DH SHP
Table 2. Combination of scenarios.
Table 2. Combination of scenarios.
Components (%) 1 2 3 4 5 6 7 8 Electrical Efficiency 40 40 40 40 50 50 50 50 Heat Loss 15 15 20 20 15 15 20 20 Thermal Efficiency 85 90 85 90 85 90 85 90
Notes: All combination will be the same for the condition (1) without waste heat recovery, (2) with waste heat recovery, and (3) nationwide average performance.
Table 3. Energy savings for scenario 1 without waste heat recovery.
Table 3. Energy savings for scenario 1 without waste heat recovery.
Branch Daegu Suwon Cheongju Hwaseong Bundang Goyang HPR 5.23:1 4.23:1 2.62:1 0.63:1 0.83:1 0.76:1 CHP-DH E fuel,CHP (a) 100 100 100 100 100 100 SHP E fuel,SHP,heat (b) 68.08 69.04 64.15 27.32 28.32 27.16 E fuel,SHP,electrical (c) 32.51 40.78 61.1 108.17 84.67 89.1 E fuel,SHP,total (d = b + c) 100.59 109.82 125.25 135.49 113.01 116.26 E saving (e = d − a) 0.59 9.82 25.25 35.49 13.01 16.26 E saving (f = e/d) (%) 0.59 8.94 20.16 26.19 11.51 13.99
Table 4. Energy savings for scenarios without waste heat recovery.
Table 4. Energy savings for scenarios without waste heat recovery.
Scenario CHP-DH SHP E sav E sav (%) Branch E fue,CHP E fue,SHP,htg E fue,SHP,ele E fue,SHP,tot 1 Daegu 100 68.08 32.51 100.59 0.59 0.59% Suwon 100 69.04 40.78 109.82 9.82 8.94% Cheongju 100 64.15 61.1 125.25 25.25 20.16% Hwaseong 100 27.32 108.17 135.49 35.49 26.19% Bundang 100 28.32 84.67 113.01 13.01 11.51% Goyang 100 27.16 89.1 116.26 16.26 13.99% 2 Daegu 100 64.3 32.51 96.81 −3.91 −3.3% Suwon 100 65.2 40.78 105.98 5.98 5.64% Cheongju 100 60.59 61.1 121.69 21.69 17.82% Hwaseong 100 25.81 108.17 133.97 33.97 25.36% Bundang 100 26.76 84.68 111.43 11.43 10.26% Goyang 100 25.65 89.10 114.75 14.75 12.85% 3 Daegu 100 64.07 32.51 96.58 −3.42 −3.54% Suwon 100 64.98 40.78 105.76 5.76 5.44% Cheongju 100 60.38 61.1 121.48 21.48 17.68% Hwaseong 100 25.72 108.17 133.88 33.88 25.31% Bundang 100 26.66 84.68 111.34 11.34 10.18% Goyang 100 25.56 89.1 114.66 14.66 12.79% 4 Daegu 100 60.51 32.51 93.03 −6.97 −7.5% Suwon 100 61.37 40.78 102.15 2.15 2.1% Cheongju 100 57.02 61.1 118.12 18.12 15.34% Hwaseong 100 24.29 108.17 132.45 32.45 24.5% Bundang 100 25.18 84.68 109.86 9.86 8.97% Goyang 100 24.14 89.1 113.24 13.24 11.69% 5 Daegu 100 68.08 26.01 94.09 −5.91 −6.28% Suwon 100 69.04 32.62 101.66 1.66 1.63% Cheongju 100 64.15 48.88 113.03 13.03 11.53% Hwaseong 100 27.32 86.53 113.86 13.86 12.17% Bundang 100 28.33 67.74 96.07 −3.93 −4.09% Goyang 100 27.16 71.28 98.44 −1.56 −1.59% 6 Daegu 100 64.3 26.01 90.3 −9.7 −10.74% Suwon 100 65.2 32.62 97.83 −2.17 −2.22% Cheongju 100 60.59 48.88 109.47 9.47 8.65% Hwaseong 100 25.81 86.53 112.34 12.34 10.98% Bundang 100 26.76 67.74 94.5 −5.5 −5.82% Goyang 100 25.65 71.28 96.93 −3.07 −3.17% 7 Daegu 100 64.07 26.01 90.08 −9.92 −11.01% Suwon 100 64.98 32.62 97.60 −2.40 −2.46% Cheongju 100 60.38 48.88 109.26 9.26 8.47% Hwaseong 100 25.72 86.53 112.25 12.25 10.91% Bundang 100 26.66 67.74 94.4 −5.6 −5.93% Goyang 100 25.56 71.28 96.84 −3.16 −3.26% 8 Daegu 100 60.51 26.01 86.52 −13.48 −15.58% Suwon 100 61.37 32.62 93.99 −6.01 −6.39% Cheongju 100 57.02 48.88 105.9 5.9 5.57% Hwaseong 100 24.29 86.53 110.82 10.82 9.76% Bundang 100 25.18 67.74 92.92 −7.08 −7.62% Goyang 100 24.14 71.28 95.42 −4.58 −4.8%
Table 5. Energy savings for scenario 1 with waste heat recovery.
Table 5. Energy savings for scenario 1 with waste heat recovery.
Branch Daegu Suwon Bundang Goyang HPR 6.4:1 6.33:1 0.92:1 0.8:1 CHP-DH E fuel,CHP (a) 100 100 100 100 SHP E fuel,SHP,heat (b) 79.07 93.37 30.99 28.6 E fuel,SHP,electrical (c) 30.88 36.86 84.09 88.74 E fuel,SHP,total (d = b + c) 109.95 130.24 115.08 117.34 E saving (e = d − a) 30.24 15.08 17.34 E saving (f = e/d) (%) 23.22 13.1 14.78
Table 6. Energy savings for scenarios with waste heat recovery.
Table 6. Energy savings for scenarios with waste heat recovery.
Scenario CHP-DH SHP E sav E sav ( % ) Branch E fue , CHP E fue , SHP , htg E fue , SHP , ele E fue , SHP , tot 1 Daegu 100 79.07 30.88 109.95 9.95 9.05% Suwon 100 93.37 36.86 130.24 30.24 23.22% Bundang 100 30.99 84.09 115.08 15.08 13.1% Goyang 100 28.60 88.74 117.34 17.34 14.78% 2 Daegu 100 74.67 30.88 105.55 5.55 5.26% Suwon 100 88.19 36.86 125.05 25.05 20.03% Bundang 100 29.27 84.09 113.36 13.36 11.78% Goyang 100 27.01 88.74 115.75 15.75 13.61% 3 Daegu 100 74.42 30.88 105.29 5.29 5.03% Suwon 100 87.88 36.86 124.74 24.74 19.84% Bundang 100 29.17 84.09 113.26 13.26 11.71% Goyang 100 26.92 88.74 115.66 15.66 13.54% 4 Daegu 100 70.28 30.88 101.16 1.16 1.15% Suwon 100 83 36.86 119.86 19.86 16.57% Bundang 100 27.55 84.09 111.64 11.64 10.42% Goyang 100 25.42 88.74 114.16 14.16 12.4% 5 Daegu 100 79.07 24.7 103.77 3.77 3.63% Suwon 100 93.37 29.49 122.86 22.86 18.61% Bundang 100 30.99 67.27 98.26 −1.74 −1.77% Goyang 100 28 70.99 99.59 −0.41 −0.41% 6 Daegu 100 74.67 24.7 99.38 −0.62 −0.63% Suwon 100 88.19 29.49 117.68 17.68 15.02% Bundang 100 29.27 67.27 96.54 −3.46 −3.58% Goyang 100 27.01 70.99 98.00 −2.00 −2.04% 7 Daegu 100 74.42 24.7 99.12 −0.88 −0.89% Suwon 100 87.88 29.49 117.37 17.37 14.8% Bundang 100 29.17 67.27 96.44 −3.56 −3.69% Goyang 100 26.92 70.99 97.91 −2.09 −2.14% 8 Daegu 100 70.28 24.7 94.98 −5.02 −5.28% Suwon 100 83 29.49 112.49 12.49 11.1% Bundang 100 27.55 67.27 94.82 −5.18 −5.46% Goyang 100 25.42 70.99 96.41 −3.59 −3.72%
Table 7. Energy savings for scenario 1 with waste heat recovery.
Table 7. Energy savings for scenario 1 with waste heat recovery.
Table 8. Comparison of fit indexes between exploratory factor analysis (EFA) and confirmatory factor analysis (CFA).
Table 8. Comparison of fit indexes between exploratory factor analysis (EFA) and confirmatory factor analysis (CFA).
Fit index Measurement Model Accept EFA CFA Difference Comparative fit index (CFI) 0.921 0.932 0.011 Good Tucker–Lewis index (TLI) 0.906 0.918 0.012 Good Standardized root mean squared residual (SRMR) 0.054 0.048 −0.006 Good Root mean squared error of approximation (RMSEA) 0.081 0.079 −0.002 Good
Table 9. Results of structural equation model (SEM).
Table 9. Results of structural equation model (SEM).
Panel A: CHP-DH Hypothesized Paths Coefficients t -value Testing Goodness-of-Fit Statistics ECON → SAT 0.111 1.09 Supported χ 2 = 2345.16 df = 171 χ 2 /df = 13.714 RMSEA = 0.077 CFI = 0.92 TLI = 0.905 SRMR = 0.060 NECON → SAT 0.283 2.56* Supported ENV → SAT 0.259 2.48* Supported SAT → CU 0.652 14.17*** Supported Total Effect on SAT λ E C O N = 0.207 λ N E C O N = 0.508 * λ E N V = 0.492 * Total Effect on CU λ E C O N = 0.154 λ N E C O N = 0.381 * λ E N V = 0.369 * λ S A T = 0.75 *** Indirect Effect on CU λ E C O N = 0.154 λ N E C O N = 0.381 * λ E N V = 0.369 * R 2 of Bentler-Raykov R S A T 2 = 0.323 R C U 2 = 0.425 R O v e r a l l 2 = 0.990 Panel B: SHP Hypothesized Paths Coefficients t -value Testing Goodness-of-Fit Statistics ECON → SAT 0.437 2.15* Supported χ 2 = 1534.34 df = 171 χ 2 /df = 8.972 RMSEA = 0.106 CFI = 0.876 TLI = 0.854 SRMR = 0.068 NECON → SAT 0.138 0.94 Rejected ENV → SAT −0.113 −0.54 Rejected SAT → CU 0.606 8.61*** Supported Total Effect on SAT λ E C O N = 0.745 * λ N E C O N = 0.218 λ E N V = −.152 Total Effect on CU λ E C O N = 0. 556 * λ N E C O N = 0.162 λ E N V = −0.113 λ S A T = 0. 747 *** Indirect Effect on CU λ E C O N = 0.556 * λ N E C O N = 0.162 λ E N V = ‒0.113 R 2 of Bentler-Raykov R S A T 2 = 0.197 R C U 2 = 0.367 R O v e r a l l 2 = 0.994
Notes: (1) Standardized beta coefficients, (2) * p < 0.05, ** p < 0.01, *** p < 0.001.
Table 10. Results of ordinary least square (OLS) regression.
Table 10. Results of ordinary least square (OLS) regression.
Variable CHP-DH SHP Model 1 (SAT) Model 2 (CU) Model 3 (SAT) Model 4 (CU) ECON 0.13 0.27 * (1.97) (2.18) NECON 0.23 ** 0.14 (3.33) (1.19) ENV 0.26 ** 0.04 (3.61) (0.33) SAT 0.60 ** 0.57 ** (11.11) (7.05) N 223 223 104 104 R 2 0.268 0.359 0.151 0.328 adj. R 2 0.258 0.356 0.125 0.321 Log-likelihood −190.1 −15.8 −125.8 −122.6 F 26.70 123.5 5.914 49.74
Notes: (1) Standardized beta coefficients; t statistics in parentheses, (2) * p < 0.05, ** p < 0.01.
MDPI and ACS Style
Lee, C.; Park, J.; Lee, K.; Yang, J.Y.; Roh, T. Energy Efficiency for Supplier and Sustainability for Demand: A Case of Heating Systems in South Korea. Sustainability 2019, 11, 4216.
https://doi.org/10.3390/su11154216
AMA Style
Lee C, Park J, Lee K, Yang JY, Roh T. Energy Efficiency for Supplier and Sustainability for Demand: A Case of Heating Systems in South Korea. Sustainability. 2019; 11(15):4216.
https://doi.org/10.3390/su11154216
Chicago/Turabian Style
Lee, Chulseung, Jaechan Park, Kangmun Lee, Ji Yeon Yang, and Taewoo Roh. 2019. "Energy Efficiency for Supplier and Sustainability for Demand: A Case of Heating Systems in South Korea" Sustainability11, no. 15: 4216.
https://doi.org/10.3390/su11154216
Article Metrics
Export citation file: BibTeX | EndNote | RIS
MDPI and ACS Style
Lee, C.; Park, J.; Lee, K.; Yang, J.Y.; Roh, T. Energy Efficiency for Supplier and Sustainability for Demand: A Case of Heating Systems in South Korea. Sustainability 2019, 11, 4216.
https://doi.org/10.3390/su11154216
AMA Style
Lee C, Park J, Lee K, Yang JY, Roh T. Energy Efficiency for Supplier and Sustainability for Demand: A Case of Heating Systems in South Korea. Sustainability. 2019; 11(15):4216.
https://doi.org/10.3390/su11154216
Chicago/Turabian Style
Lee, Chulseung, Jaechan Park, Kangmun Lee, Ji Yeon Yang, and Taewoo Roh. 2019. "Energy Efficiency for Supplier and Sustainability for Demand: A Case of Heating Systems in South Korea" Sustainability11, no. 15: 4216.
https://doi.org/10.3390/su11154216
| https://www.mdpi.com/2071-1050/11/15/4216/html |
Condensed Matter | Free Full-Text | Mixtures of Dipolar Gases in Two Dimensions: A Quantum Monte Carlo Study
We studied the miscibility of two dipolar quantum gases in the limit of zero temperature. The system under study is composed of a mixture of two Bose gases with dominant dipolar interaction in a two-dimensional harmonic confinement. The dipolar moments are all considered to be perpendicular to the plane, turning the dipolar potential in a purely repulsive and isotropic model. Our analysis is carried out by using the diffusion Monte Carlo method, which allows for an exact solution to the many-body problem within some statistical noise. Our results show that the miscibility between the two species is rather constrained as a function of the relative dipolar moments and masses of the two components. A narrow regime is predicted where both species mix and we introduce an adimensional parameter whose value quite accurately predicts the miscibility of the two dipolar gases.
Mixtures of Dipolar Gases in Two Dimensions: A Quantum Monte Carlo Study
by Sergi Pradas † and Jordi Boronat *,†
Departament de Física, Campus Nord B4-B5, Universitat Politècnica de Catalunya, 08034 Barcelona, Spain
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Condens. Matter 2022 , 7 (2), 32; https://doi.org/10.3390/condmat7020032
Received: 11 February 2022 / Revised: 23 March 2022 / Accepted: 24 March 2022 / Published: 1 April 2022
Abstract
:
We studied the miscibility of two dipolar quantum gases in the limit of zero temperature. The system under study is composed of a mixture of two Bose gases with dominant dipolar interaction in a two-dimensional harmonic confinement. The dipolar moments are all considered to be perpendicular to the plane, turning the dipolar potential in a purely repulsive and isotropic model. Our analysis is carried out by using the diffusion Monte Carlo method, which allows for an exact solution to the many-body problem within some statistical noise. Our results show that the miscibility between the two species is rather constrained as a function of the relative dipolar moments and masses of the two components. A narrow regime is predicted where both species mix and we introduce an adimensional parameter whose value quite accurately predicts the miscibility of the two dipolar gases.
Keywords:
quantum dipolar gases
;
quantum bose mixtures
;
quantum monte carlo
1. Introduction
Ultracold Bose and Fermi gases have proved to be the best platform for the study of quantum many-body systems [
1
]. Their versatility and fine tuning of the interatomic interactions allow for the study of many phenomena, which are difficult to attain in real systems. They offer the opportunity of using a laboratory as a quantum simulator of Hamiltonians proposed from theory, which could be difficult to manage using classical computers and algorithms [
2
,
3
]. Many of the atoms used to achieve the Bose-Einstein condensate (BEC) state interact among themselves with a contact short-range potential, which depends only on the
s
-wave scattering length, due to the extreme low density of these gases. However, it has also been possible to cool down to degeneracy gases composed by atoms with a permanent magnetic moment [
4
5
]. The dipolar potential decays as
r
−
3
and thus the interaction effects become fundamental in the properties of the gas.
First experiments showing dipolar effects were carried out with Cr, with a magnetic moment
μ
=
6
μ
B
[
5
]. In the last years, two more candidates have joined this class of materials, Dy [
6
] with
μ
=
10
μ
B
and Er [
7
] with
μ
=
7
μ
B
, significantly widening the possibilities for observing the two main features of these systems: anisotropy and slow-decaying two-body interactions [
8
]. The different interaction between side-by-side moments (repulsive) and head-to-tail ones (attractive) leads to the formation of self-bound liquid drops if the number of atoms is above a threshold known as critical atom number [
9
]. By changing the total scattering length of the system, one can see how the critical atom number increases when the scattering length also increases [
10
]. Under proper harmonic confinement, and when the number of atoms is large enough, one observes that the system arranges in drops forming a linear array, if the trapping is cigar-shaped, and a triangular one is in a plane, it has a pancake form. Interestingly, these patterns emulate a crystal, but where every site is not monoatomic but occupied by a multiparticle drop. Recent experimental work claims that these solid-like patterns show coherence and thus are examples of the pursued supersolid state of matter [
11
,
12
,
13
].
The field of ultracold dipolar gases has entered an even more rich landscape with the realization of Er-Dy mixtures [ 14 , 15 , 16 ]. The interplay between the two dipolar species opens new scenarios like the formation of mixed dipolar drops and the possible stability of mixed supersolids, with arrays composed by single-species drops or mixed drops. A key ingredient in this discussion is the miscibility of the two species since inmiscibility would hinder the observation of these new intriguing phases. Recent measures on this system show that both components tend to be phase separated, both due to the gravitational sag originated by the different masses of Er and Dy and by an overall repulsive interaction between both condensates [ 16 ]. Dipolar mixtures in three dimensions have also been theoretically studied, focusing on the miscibility of both species [ 17 , 18 , 19 ], the structure of emerging vortices under rotation [ 20 , 21 ], and the formation of mixed dipolar drops [ 22 , 23 ].
Dipolar mixtures add long-range and anisotropy in the field of quantum mixtures. The case of short-range or contact repulsive interactions in the mixtures is well understood, both from theory and experiment [ 24 , 25 , 26 , 27 , 28 , 29 , 30 , 31 , 32 ]. The miscibility criterion when the mixture is harmonically confined was analyzed in Refs. [ 33 , 34 ], concluding that in dilute mixtures the criterium for the bulk also works quite well in the confined case.
In the present work, we use the ab initio diffusion Monte Carlo (DMC) method to study a mixture of two dipolar Bose gases harmonically confined in two dimensions (2D). In our analysis, we assume that all the dipoles are oriented perpendicularly to the plane and thus interact with a fully repulsive
1
/
r
3
potential. A single dipolar gas in the same conditions was studied some time ago with DMC but in an extended configuration, free from confinement. It was shown that the gas becomes a triangular crystal when the density increases [
35
]. If the dipoles are not perpendicular to the plane but tilted at a certain angle, the interaction becomes anisotropic and, beyond a certain critical angle, it collapses. That anisotropy produces a rich diagram, with a stable stripe phase [
36
], which is indeed a supersolid or superstripe that suffers a Berezinskii–Kostrelitz–Thouless phase transition at finite temperature [
37
].
As a function of the ratio between both the dipolar moments and the masses of the two species in the mixture, we analyze the miscibility of the two gases. Our results show that both species are miscible only in a restricted area in the dipolar moment, a mass ratio plane where both ratios are close to one. In the majority of situations that we analyzed, we observe that the two confined gases do not mix: one species remains in the center and the second goes to the surface. If the trap is deformed, we observe that in some cases the external component appears in two separated blobs, separated by the inner species. Finally, we particularize our study to the Er-Dy mixture and predict that both species do not mix, in agreement with available experimental data.
The rest of the paper is organized as follows. In Section 2 , we discuss the quantum Monte Carlo methods used in our study and the miscibility criterion that accounts well for the phase diagram. In Section 3 , we present the results obtained for both isotropic and anisotropic traps and analyze the particular case of an Er-Dy mixture, which is the one observed recently in experiments. Finally, Section 4 comprises the summary of the main results and the conclusions of our work.
2. Quantum Monte Carlo Methods
2.1. Hamiltonian
The object of study of this work are two-component dipolar bosonic mixtures at zero temperature, in a purely two dimensional geometry. We consider that all the magnetic moments are perpendicular to the plane and the gas is confined by either an isotropic harmonic trap or an anisotropic one. The dipole–dipole interaction (DDI) potential between two identical particles is given by
V
d
d
(
r
)
=
C
d
d
4
π
p
^
1
·
p
^
2
−
3
(
p
^
1
·
r
^
)
(
p
^
2
·
r
^
)
r
3
,
(1)
with
C
d
d
=
μ
0
μ
2
,
μ
0
being the magnetic permeability of free space and
μ
the particle’s magnetic moment.
p
^
1
and
p
^
2
are the vectors pointing in the direction of the dipole’s moment of particles 1 and 2, respectively, and
r
^
=
r
/
r
is the unit position vector. In our case, with the particles confined to the
x
y
plane and polarized parallel to the
z
axis, the interaction is always isotropic and repulsive,
V
d
d
(
r
)
=
V
d
d
(
r
)
=
C
d
d
4
π
1
r
3
.
(2)
This is the dipolar potential of a purely 2D system and it corresponds to a pancake geometry where the transverse confinement has an energy
ℏ
ω
≫
E
/
N
, with
E
/
N
being the interaction energy per particle. In other words, the oscillator length of the transverse confinement is assumed to be much smaller than the mean interparticle distance. If this is not the case, one needs to include a short range repulsive (contact) interaction that stabilizes the system [
10
,
38
]. The mixture is confined by a 2D harmonic oscillator (ho) potential, which in the isotropic case is given by
V
h
o
(
r
i
)
=
1
2
m
ω
2
r
i
2
,
(3)
where
m
is the mass of the particle,
ω
is the ho’s trapping frequency, and
r
i
is the particle’s distance to the origin, which matches the center of the trap. The full Hamiltonian of the system is then given by
H
)
=
−
ℏ
2
2
m
1
∇
R
1
2
−
ℏ
2
2
m
2
∇
R
2
1
2
m
1
ω
1
2
∑
i
=
1
N
1
r
i
2
+
1
2
m
2
2
∑
k
=
N
1
+
1
N
r
k
2
+
μ
0
μ
1
2
4
π
∑
1
N
1
−
1
∑
j
=
i
+
1
N
1
1
r
i
j
3
+
μ
0
2
4
π
∑
i
=
N
1
+
1
N
−
1
∑
j
=
i
+
1
N
1
j
3
+
μ
0
μ
1
μ
2
4
π
∑
i
=
1
N
1
∑
j
=
N
1
N
1
r
i
j
3
,
(4)
with
N
=
N
1
+
N
2
,
N
1
and
being the number of particles of each type in our mixture, and
m
1
and
m
2
the corresponding mass of the particles. In order to simplify Equation (
4
), we have used
R
=
{
r
1
,
r
2
,
⋯
,
r
as the whole coordinate set such that
∑
i
∇
i
2
=
∇
R
2
. Finally,
ω
1
and
ω
2
are the trapping frequencies and
μ
1
and
μ
2
are the magnetic dipole moments of type 1 and 2 particles, respectively, with
r
i
j
=
r
i
−
r
j
.
As in previous studies [
35
], we use dipolar units (for species 1),
r
0
=
m
1
C
d
d
)
4
π
ℏ
2
=
m
1
μ
0
μ
1
2
4
π
ℏ
2
&
E
0
=
m
1
r
0
2
,
(5)
with
r
0
and
E
0
being the units of distance and energy, respectively. Then, in these units, the Hamiltonian is written as
H
(
R
*
)
=
−
i
=
1
N
1
r
i
*
,
2
+
1
2
A
2
∑
k
=
N
1
+
r
k
*
,
2
+
∑
i
=
1
N
1
∑
j
=
i
+
1
N
1
−
r
i
j
*
,
3
+
μ
2
μ
1
2
∑
i
=
N
1
+
1
N
−
j
=
i
+
1
N
1
r
i
j
*
,
3
+
μ
2
μ
1
∑
i
=
N
1
∑
j
=
N
1
+
1
N
1
r
i
j
*
,
3
,
(6)
where the superscript ’
*
‘ denotes the use of normalized units
=
r
/
r
0
. The strength of the harmonic confinement in both species is
A
1
=
m
1
2
ω
1
2
r
0
4
ℏ
2
=
l
1
4
&
A
2
=
m
1
m
2
ω
2
2
r
0
4
ℏ
2
=
m
2
r
0
l
2
4
=
m
2
ω
2
2
m
1
ω
1
2
A
1
,
1
=
ℏ
/
m
1
ω
1
and
l
2
=
ℏ
/
m
2
ω
2
being the harmonic oscillator lengths.
We have also explored the effects induced by an anisotropic confinement. The Hamiltonian in this case is
H
*
)
=
−
1
2
∇
R
1
*
2
−
1
2
m
1
m
2
∇
R
2
with
,
2
=
m
1
m
2
ω
x
,
2
2
r
0
4
ℏ
2
=
m
1
m
0
l
x
,
2
4
=
m
2
ω
x
,
2
2
m
1
ω
x
,
1
2
,
1
A
y
,
1
=
m
1
2
ω
y
,
1
2
r
0
4
ℏ
2
=
l
y
,
1
4
,
A
y
,
2
=
m
1
m
2
ω
y
,
2
2
r
ℏ
2
=
m
1
m
2
r
0
l
y
,
2
4
=
m
2
ω
y
,
2
1
ω
y
,
1
2
A
y
,
1
.
The oscillator lengths are now:
l
x
,
1
=
ℏ
/
m
x
,
1
,
l
x
,
2
=
ℏ
/
m
2
ω
x
,
2
,
l
y
,
ℏ
/
m
1
ω
y
,
1
, and
l
y
,
2
=
ℏ
/
m
2
ω
y
,
To reduce the number of variables of our numerical simulations, we assume that both types of particles are under the presence of the same harmonic potential, with strengths
A
x
in the
x
-direction and
A
y
in the
y
-direction. Therefore,
m
1
ω
x
,
1
2
=
m
2
ω
x
,
2
2
and
m
1
ω
y
,
1
2
=
m
2
ω
y
,
2
2
,
ω
x
,
α
and
ω
y
,
α
are the confinement frequencies for type
α
particles along the
x
and
y
axes, respectively. This also applies to the isotropic case, where we consider
A
1
=
A
2
via the use of different confinement frequencies verifying
m
1
ω
1
2
=
m
2
ω
2
2
.
2.2. Diffusion Monte Carlo
The main theoretical tool used in this work is the diffusion Monte Carlo (DMC) method, which finds the ground-state energy of a many-particle system by propagating the imaginary-time Schrödinger equation exploiting the similarities with a diffusion process.
The time-dependent Schrödinger equation associated to a system of
N
particles, written in imaginary time
τ
=
i
t
/
ℏ
, is
−
|
R
being the Green function and
)
its initial condition. The above integral (
11
) is in principle intractable due to the non-commutativity of the kinetic and potential operators that appear in the Green function. As we will shortly discuss, we may avoid this by computing short-time approximations for
and using the convolution property of Equation (
11
).
As in many Monte Carlo simulations, it is convenient to introduce importance sampling to reduce the variance to a manageable level. In DMC, this is carried out by solving the Schrödinger equation for the wave function
39
], and whose specific form for the present problem will be discussed in
Section 2.3
.
acts as a guiding wave function, which drives the system away from regions of the phase space where the interatomic potential is strongly repulsive, or even divergent, and increases the sampling of regions where the wave function is expected to be large. With that, the Schrödinger equation may be rewritten as
is the local energy. The kinetic term, which gives DMC its name, is the same as a classical diffusion operator,
, is straightforwardly obtained by using the completeness relation of the momentum basis and gaussian integration, leading to
(21)
which gives name to the method known as quadratic diffusion Monte Carlo [
41
,
42
], which is used throughout this work.
Having discussed the formal concepts associated with the DMC method, let us then comment how it is applied in practice. In order to evolve the system, one represents it using sets of coordinates
}
known as
walkers
, each one being a configuration of the
N
-particle system, which is to be propagated separately. One then makes use of the approximation (Equation (
21
)), with each operator in this expression applied in the same order each time-step.
The diffusion operator is straightforwardly applied, as one can use the Box–Muller algorithm to sample from the desired Gaussian distribution. The drift operator
is deterministic, and requires solving Equation (
18
. We do this by using the second-order Runge–Kutta method. Finally, the branching operator kills or reproduces walkers based on the difference between their local energy
E
L
and the reference energy
. This way, we promote the configurations with the lowest energy and remove the ones with a higher energy. To implement the branching term, the number of copies of a given walker is calculated as
N
sons
=
exp
(
where
is sampled from the uniform probability distribution
denotes the integer part, and
,
are walkers at two successive times.
In a DMC simulation, one fixes the time-step
, the desired number of walkers
, and chooses a guiding wave function whose parameters are previously optimized using the VMC method. Then, after each time-step, a new set of walkers is obtained and after every block
is updated to be the average local energy of the previous set. Approaching the limit
, we get the ground-state energy
as a mean of the local energies of the walkers set. It is important to remark, however, that this estimate is only exact in the limits
and
. This way, different simulations approaching these two limits have to be made in order to obtain the result as an extrapolation to such limits. This is the method used throughout this work, and any result shown in
Section 3
has been obtained by an initial optimization of the trial wave function via VMC, followed by its use as a guiding function in DMC, and the check for the optimum
and
Finally, to conclude this discussion on the DMC method we briefly describe the estimation of observables. In a DMC simulation we sample the mixed wave function
as
, where
is the exact ground state wave function, in a process known as mixed estimation. In case the operator being estimated is the Hamiltonian or commutes with it, this leads to an exact estimation within some statistical errors. However, for other operators, such as the potential energy or the density profile, the estimation is biased in a way that makes it difficult to assess a priori. The simplest way to approximately correct this bias is to use an extrapolated estimator, which makes use of both mixed (DMC) and variational (VMC) results. This result, however, is still biased in an unknown way as it still depends on the trial wave function. The solution to definitely eliminate that bias is by means of the pure estimation, a technique based on forward walking, which we use throughout this work as implemented in Ref. [
].
2.3. The Trial Wave Functions
As we have discussed in the previous section, a reasonable choice for the ground-state wave function is necessary to guide the diffusion process in DMC. The usual approach, and the one taken in this work, is to use the VMC method to optimize the trial wave function before using it in the DMC method.
Our system is a bosonic one, so the wave function must be symmetric with respect to exchange of particles. We include one- and two-body correlation factors in the usual Bijl–Jastrow form [
) are too repulsive for intermediate and large inter-particle distances. Therefore, we match Equation (
, and
cut
constants for each type of
interaction, such that the wave function and its first derivative are continuous at
. This is then introduced in the VMC code with
in the isotropic case, with
being the only free variational parameters with respect to which the trial wave function is optimized. In the presence of an anisotropic harmonic potential, this is adapted considering
as a more convenient choice for the matching distance.
2.4. The Miscibility Criterion
The miscibility in Bose–Bose mixtures is determined by the parameter
]. Equation (
) classifies the behavior of the mixtures:
signals miscibility,
phase separation, and
the critical value separating both regimes.
In three dimensions, the interaction strengths in Equation (
being the reduced mass and
being the
-wave scattering length. In a purely two-dimensional system,
with
and
being the densities of the
and
species, respectively, with
normally defined as the geometrical mean
with
being the Euler’s constant.
It is worth noticing that, in contrast to Bose–Bose mixtures with contact interactions [
34
] where the scattering lengths
,
can all be changed independently, in our dipolar system setting
and
does not only fix
and
, but the crossed scattering length
31
)). This dependence constrains the accessible regions of the phase-space given by
and
, which means that certain regions that would normally be mapped in order to find characteristic spatial configurations, given by specific relations between the scattering lengths, are unreachable.
The miscibility criterion in 2D is more complex than that in 3D (
) because of the explicit dependence of
). However, these densities are not clearly defined in a finite system and, in addition, cannot be predicted exclusively from the knowledge of the external parameters. One could think of different ways of approximating them, such as considering
and
to be the central values of the density profiles
and
, respectively, or their peak values, among other options. In the present work, we tried these approaches regarding the densities, and also other
]. In all these trials, we were not able to match the DMC results with the miscibility criterion (
28
). We conclude that the complex 2D
expressions and the uncertainties regarding the proper definitions of
,
, and
in finite, confined systems make an exploration of the phase-space according to Equation (
28
) unfeasible.
Parameter
is a quotient between the dominant effect when the mass of one of the components is changed (
) and the corresponding effect when the dipolar moment is changed (
). Both factors are directly related to the kinetic and potential energies, respectively (
6
). According to this empirical parameter, we concluded that
signals miscibility, with both
and
indicating phase separation. The application of this parameter is discussed in the next section.
3. Results
We focus exclusively on systems with
and a harmonic confinement of strength
in reduced units. We do this to limit the number of free parameters and to focus on a system size for which a balance is found between the importance of interactions and the computational cost. Under these conditions, the central densities are of order one, always in reduced units.
We start with the following paradigmatic mixtures:
. These will allow to understand the effects of the mass and magnetic dipole moment relations between species before an exhaustive analysis of the phase diagram is performed. The pure estimators for the radial density functions
are shown in
Figure 1
. We observe that if the mass of the two species is the same, the particles with the larger magnetic dipole moment move out of the center and completely surround the other species. This is due to the type 2 particles repelling each other more strongly than type 1 particles do, leading the system to a configuration where type 2 particles are as separated as possible from one another and from the other species. The DMC simulation tells us that the most energetically favorable way to do this is by the second species forming a ring around the first one. Regarding the right panel in
Figure 1
, we see that if the magnetic dipole moment of the two species is the same, it is the lighter particles that now envelop the heavier ones. This is a direct consequence of both species being under the presence of the same confinement, as the lighter one presents a larger harmonic length.
The phase diagram of the mixture is obtained by carrying out multiple simulations for different
values. From the density profiles of both species, we determine if they are miscible or not and these results are compared with the empirical criterion of Equation (
32
). The results are shown in
Figure 2
.
As it can be seen in
Figure 2
, the criterion (
32
) matches almost perfectly with the DMC results, with a very narrow region of miscibility at
, indicating the system’s clear tendency to phase-separate as soon as it is possible due to the repulsiveness of the DDIs. In addition, every system that phase separates does so via one species leaving the center and surrounding the other one. The farther
is from
and
, with complete separation already happening for values closer to
for specific
and
is changed, the phase-separation is clearer, with one species abandoning the center entirely for values closer to
. Moreover, let us remark how
can also be used to predict which particles leave the core, as for
species 1 does it, while for
it is species 2 that occupies the external shell.
There is one exception in
Figure 2
and
(green point). In this case, the system does not entirely mix, but neither does it phase-separate in the usual form. As reported in Ref. [
34
] for 3D harmonically trapped Bose–Bose mixtures with contact interactions, in certain cases the system clearly phase-separates forming a “two-blobs” configuration, where each species occupies a semi-circumference. As the trap is isotropic, the “two-blobs” structure is degenerate and the axis, transverse to the line (2D) or surface (3D) separating the two phases, can appear in any direction. Only when one plots the structure along this transverse axis the structure can be observed. This effect produces in the density profile a maximum value which is slightly displaced with respect to the center of the trap. In our case, under an isotropic confinement the system does not phase-separate completely, and seems to only hint at such a configuration. This seems to be an exception, as we were unable to find any other case where this happened, and so we leave the analysis of this particular system to the next subsection, where we will discuss how for a given deformation of the trap, the “two-blobs” configuration can be observed before it disappears for stronger compressions.
3.2. Anisotropically Trapped Mixtures
In this section, we focus on systems with
particles and analyze progressively stronger sets of anisotropic harmonic confinements with
fixed and
changing from
to
. We do not want
to be too large as we do not wish to enter the one-dimensional regime; we are interested in the effects of deforming the system, not changing its behavior completely. We study three mixtures given by
, which hereinafter we label as
A
,
B
, and
C
, respectively. Mixture
A
will allow us to isolate the effects of changing the magnetic dipole moment of one species and mixture
B
will do the same with the mass relation. Finally, mixture
C
, as explained in
Section 3.1
, seemed to hint at a two-blobs configuration under an isotropic confinement, and so we will study how it evolves as it is compressed.
The density profiles of mixture A , obtained with pure estimators, are shown in Figure 3 . In this case, the type 2 particles intra-species interactions, and the cross interactions with particles 1, are so repulsive that no matter how much we compress the system in the y -direction, particles 2 always leave the center, forming a ring surrounding the species with the smaller magnetic dipole moment. Therefore, if the DDIs are strong enough for one species compared to the other, the ring configuration is maintained throughout the compression.
The density profiles for mixture
Figure 4
. We can see that in this case the configuration is not maintained throughout the deformation. If the compression is small (see
) the ring is still present, as it is still energetically favorable for the lighter species to leave the center, surrounding the others. However, as the compression progresses, the equilibrium between the DDIs and the harmonic confinement for particles 1 cannot be reached with the ring configuration. Particles 2 now occupy the center in such a way that the second species cannot keep enough distance between themselves and the other species at small and intermediate
x
values for it to be energetically favorable. As a result, particles 1 form “wings” surrounding particles 2.
Finally, mixture
C
’s density profiles are shown in
Figure 5
. In this case, we start with the system hinting at a two-blobs configuration, which gets completely clear and defined for
. Different simulations produce two mirroring degenerate structures, with a particular species on the right or on the left (along the
x
-axis). In our plots, we break this degeneracy by a proper rotation. The two-blobs configuration disappears for stronger deformations, and gives way to the wing configuration described for mixture
B
relations for which 1-2 interactions are the most repulsive and 1-1 and 2-2 interactions are of similar strength. In this situation, the mixture could form symmetric distributions for each species, allowing for large interparticle distances.
Any other mixed isotropic configuration that we have analyzed turns into a phase-separated system as it is compressed. As we saw in Figure 2 , it required very specific mass and magnetic dipole relations between the two species for the system to be in a mixed state. Therefore, those very specific conditions move and maybe even disappear as the system is compressed and the DDIs become more repulsive. It may be possible, though, that different regions of existence for the miscible state exist for these anisotropic confinements. It is, however, beyond the scope of this work to probe the full phase-space, as it was done for the isotropic case, Figure 2 .
3.3. Erbium-Dysprosium Mixture
Throughout this work we have studied a generic set of systems, given by changes in the mass and magnetic dipole moment relations between species and the deformation of the harmonic confinement applied to it. In this section, we perform a study of these effects for an Erbium-Dysprosium (Er-Dy henceforth) system, as it is the first Bose–Bose dipolar mixture that has been realized experimentally [
14
,
15
,
16
] and offers us a perfect opportunity to predict potentially observable configurations. Both Er and Dy are part of the magnetic rare-earth species group, and we are going to focus on the case of a
Dy mixture, with
Er having an atomic mass of
uma and a magnetic dipole moment of
, and
Dy having a mass of
and a magnetic dipole moment of
. For convenience, we define the Er atoms as the type 1 species and the Dy ones as type 2, so that the mass and magnetic dipole moment relations characterizing the system are
and
, respectively. As commented previously, we remain in a strictly 2D geometry and the interaction is the dipolar potential (
2
) without any short-range (contact) repulsive interaction. In this 2D limit, and all the dipoles oriented perpendicularly to the plane, the dipolar interaction is fully repulsive and the contact interaction would not change the present results in a significant way. Instead, in 3D the contact interaction is crucial to avoid the collapse that the dipolar potential produces [
10
].
We start with a balanced mixture of Er-Dy atoms, with
particles each, under the presence of an isotropic harmonic confinement of strength
. The pure density profiles for this case are shown in
Figure 6
. As it can be clearly seen, under these conditions the system phase-separates, with the Dy atoms leaving the center and surrounding the Er particles. In this case
, meaning the mass difference between species, is not a key factor, and the inmiscibility is due to the Dy atoms having a significantly larger magnetic dipole moment, which forces them out of the center due to the stronger repulsive DDI interactions between themselves and the Er atoms.
In
Figure 6
, the confinement produces a central density of 1 in dipolar units. This density is larger than the typical densities in experiments with dipolar gases. To analyze the influence of the density and approach the experimental conditions better, we have simulated the mixture with a smaller confinement. By choosing
we observe central densities of
that are in the range of confined dipolar gases in experiments [
48
]. The results obtained are shown in
Figure 7
. As one can see, the reduction of the density does not affect the prediction regarding the phase separated configuration of the 2D Er-Dy mixtures.
We expose the mixture to progressively stronger potentials in the
y
-direction, in the same way as in
Section 3.1
. The pure density profiles are shown in
Figure 8
. In this case, due to the mass relation between species essentially not playing any role, it is the DDIs that are integral to the obtained spatial configurations. These are so repulsive that, again, the ring configuration is the most favorable one, regardless of the applied deformation in the
y
-direction. However, as we can see from the
4. Discussion
In this study, we have presented a thorough analysis of dipolar binary Bose–Bose mixtures at zero temperature in two dimensions, confined harmonically in the
plane. The results have been obtained by a combination of two quantum Monte Carlo methods: variational Monte Carlo, for the optimization of the trial wave function, and diffusion Monte Carlo, to get a statistically exact solution by means of solving the Schrödinger equation in imaginary time. With this, we have been able to map the miscibility of balanced mixtures under an isotropic harmonic confinement, studied anisotropic confinements by progressively applying a stronger trapping in the
y
direction, and performed a study of the Erbium-Dysprosium mixture, the first dipolar Bose–Bose mixture realized experimentally.
In
Section 3.1
, we performed a complete analysis of mixtures with a total number of particles of
under an isotropic harmonic confinement of strength
. We saw how the masses were equal, as the species with the larger magnetic dipole moment left the center and surrounded the other ones in a ring configuration, while
led to the lighter particles leaving the core as a consequence of having a larger harmonic characteristic length. We studied the miscibility of the system as a function of
and
with the help of a dimensionless parameter
(see Equation (
32
) and
Figure 2
), and concluded that the miscibility region of the system is very narrow, as it only occurs around
, otherwise the system phase-separates in two different ways: for
species 1 leaves the center, while for
it is species 2 that abandons the core. Every system studied that phase-separated did so by means of this ’ring’ configuration in which one species occupies the core, and the other encircles it, as due to the repulsive DDIs this allows for the maximum distance between particles of both the same and different species.
In
Section 3.2
, we focused on analyzing three mixtures (
A
,
B
, and
C
) given under progressively stronger confinements in the
y
direction, keeping the
x
component constant. We concluded that by changing the dipole moments, the ring configuration remained the stable one in the deformation regime studied. When the mass ratio is changed, under strong enough compression, the ring configuration turns to a wing structure, in which the lighter species is pushed to the edges of the system in the
x
axis. In addition, we studied a very particular case, an exception from
Section 3.1
, the
mixture, which under an isotropic confinement hinted at a ’two-blobs’ configuration, in which two symmetrical semi-circumferences are formed by each species separately [
] for a simpler contact interaction in a three-dimensional case. This system, under a moderately strong deformation, turns to a two-blobs configuration along the squeezed axis, which transformed into the wing one under stronger compressions. We tried to find other systems with this behavior, but we were ultimately unable to discover them.
To conclude, we studied the Er-Dy mixture, the first experimentally realized one [
14
,
15
,
16
], in order to make predictions on its miscibility. We observe how under an isotropic confinement the mixture phase-separated, with the Dy atoms leaving the center due to their greater magnetic dipole moments. We then analyzed the same mixture under progressively stronger confinements in the
y
direction and observed how the ring configuration held for every single strength that we applied. The total number of particles in the DMC simulations is clearly smaller than the corresponding one in experiments because of computer limitations. Nevertheless, we are confident that the parameter
defined in our work would also be applicable in mixtures with a realistic number of particles since adimensional
contains the relevant factors entering into the problem. Recent experiments on Er-Dy mixtures in three dimensions show that the system prefers to be phase separated due to an overall repulsion between the two species. Moreover, the gravitational sag between both species, due to their different masses, makes it difficult to get a full overlap between both species [
16
]. It would be interesting to deform the trapping potential and approach the 2D limit, with the magnetic moments perpendicular to the plane, because then the gravitational effect would be reduced and thus the possible miscibility between both components could be better resolved. We also hope that our work can stimulate the analysis of the dipolar mixture in two dimensions within mean-field theory, which can be compared with our DMC results. A similar study, using the Gross–Pitaevskii equation, was recently carried out for three-dimensional dipolar mixtures [
49
].
Author Contributions
Conceptualization, J.B.; Data curation, S.P.; Formal analysis, S.P. and J.B.; Supervision, J.B.; Writing—original draft, S.P.; Writing—review and editing, J.B. All authors have read and agreed to the published version of the manuscript.
Funding
This work funded by Direcció General de Recerca, Generalitat de Catalunya: 001-P-001644.
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
Data is contained within the article.
Acknowledgments
This work has been supported by AEI (Spain) under grant No. PID2020-113565GB-C21. We also acknowledge financial support from Secretaria d’Universitats i Recerca del Departament d’Empresa i Coneixement de la Generalitat de Catalunya, co-funded by the European Union Regional Development Fund within the ERDF Operational Program of Catalunya (project QuantumCat, ref. 001-P-001644).
Conflicts of Interest
The authors declare no conflict of interest.
References
Pethick, C.J.; Smith, H. Bose–Einstein Condensation in Dilute Gases , 2nd ed.; Cambridge University Press: Cambridge, UK, 2008. [ Google Scholar ]
Georgescu, I.M.; Ashhab, S.; Nori, F. Quantum simulation. Rev. Mod. Phys. 2014 , 86 , 153–185. [ Google Scholar ] [ CrossRef ][ Green Version ]
Altman, E.; Brown, K.R.; Carleo, G.; Carr, L.D.; Demler, E.; Chin, C.; DeMarco, B.; Economou, S.E.; Eriksson, M.A.; Fu, K.M.C.; et al. Quantum Simulators: Architectures and Opportunities. PRX Quantum 2021 , 2 , 017003. [ Google Scholar ] [ CrossRef ]
Lahaye, T.; Menotti, C.; Santos, L.; Lewenstein, M.; Pfau, T. The physics of dipolar bosonic quantum gases. Rep. Prog. Phys. 2009 , 72 , 126401. [ Google Scholar ] [ CrossRef ]
Koch, T.; Lahaye, T.; Metz, J.; Fröhlich, B.; Griesmaier, A.; Pfau, T. Stabilization of a purely dipolar quantum gas against collapse. Nat. Phys. 2008 , 4 , 218–222. [ Google Scholar ] [ CrossRef ][ Green Version ]
Lu, M.; Burdick, N.Q.; Youn, S.H.; Lev, B.L. Strongly Dipolar Bose-Einstein Condensate of Dysprosium. Phys. Rev. Lett. 2011 , 107 , 190401. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Aikawa, K.; Frisch, A.; Mark, M.; Baier, S.; Rietzler, A.; Grimm, R.; Ferlaino, F. Bose-Einstein condensation of erbium. Phys. Rev. Lett. 2012 , 108 , 210401. [ Google Scholar ] [ CrossRef ][ Green Version ]
Norcia, M.A.; Ferlaino, F. New opportunites for interactions and control with ultracold lanthanides. arXiv 2021 , arXiv:2108.04491. [ Google Scholar ]
Ferrier-Barbut, I.; Kadau, H.; Schmitt, M.; Wenzel, M.; Pfau, T. Observation of Quantum Droplets in a Strongly Dipolar Bose Gas. Phys. Rev. Lett. 2016 , 116 , 215301. [ Google Scholar ] [ CrossRef ]
Böttcher, F.; Wenzel, M.; Schmidt, J.N.; Guo, M.; Langen, T.; Ferrier-Barbut, I.; Pfau, T.; Bombín, R.; Sánchez-Baena, J.; Boronat, J.; et al. Dilute dipolar quantum droplets beyond the extended Gross-Pitaevskii equation. Phys. Rev. Res. 2019 , 1 , 033088. [ Google Scholar ] [ CrossRef ][ Green Version ]
Tanzi, L.; Lucioni, E.; Famà, F.; Catani, J.; Fioretti, A.; Gabbanini, C.; Bisset, R.N.; Santos, L.; Modugno, G. Observation of a Dipolar Quantum Gas with Metastable Supersolid Properties. Phys. Rev. Lett. 2019 , 122 , 130405. [ Google Scholar ] [ CrossRef ][ Green Version ]
Böttcher, F.; Schmidt, J.N.; Wenzel, M.; Hertkorn, J.; Guo, M.; Langen, T.; Pfau, T. Transient Supersolid Properties in an Array of Dipolar Quantum Droplets. Phys. Rev. X 2019 , 9 , 011051. [ Google Scholar ] [ CrossRef ][ Green Version ]
Chomaz, L.; Petter, D.; Ilzhöfer, P.; Natale, G.; Trautmann, A.; Politi, C.; Durastante, G.; van Bijnen, R.M.W.; Patscheider, A.; Sohmen, M.; et al. Long-Lived and Transient Supersolid Behaviors in Dipolar Quantum Gases. Phys. Rev. X 2019 , 9 , 021012. [ Google Scholar ] [ CrossRef ][ Green Version ]
Ravensbergen, C.; Corre, V.; Soave, E.; Kreyer, M.; Kirilov, E.; Grimm, R. Production of a degenerate Fermi-Fermi mixture of dysprosium and potassium atoms. Phys. Rev. A 2018 , 98 , 063624. [ Google Scholar ] [ CrossRef ][ Green Version ]
Trautmann, A.; Ilzhöfer, P.; Durastante, G.; Politi, C.; Sohmen, M.; Mark, M.J.; Ferlaino, F. Dipolar Quantum Mixtures of Erbium and Dysprosium Atoms. Phys. Rev. Lett. 2018 , 121 , 213601. [ Google Scholar ] [ CrossRef ] [ PubMed ][ Green Version ]
Politi, C.; Trautmann, A.; Ilzhöfer, P.; Durastante, G.; Mark, M.J.; Modugno, M.; Ferlaino, F. Study of the inter-species interactions in an ultracold dipolar mixture. arXiv 2021 , arXiv:2110.09980. [ Google Scholar ]
Wilson, R.M.; Ticknor, C.; Bohn, J.L.; Timmermans, E. Roton immiscibility in a two-component dipolar Bose gas. Phys. Rev. A 2012 , 86 , 033606. [ Google Scholar ] [ CrossRef ][ Green Version ]
Kumar, R.K.; Muruganandam, P.; Tomio, L.; Gammal, A. Miscibility in coupled dipolar and non-dipolar Bose–Einstein condensates. J. Phys. Commun. 2017 , 1 , 035012. [ Google Scholar ] [ CrossRef ]
Xi, K.T.; Byrnes, T.; Saito, H. Fingering instabilities and pattern formation in a two-component dipolar Bose-Einstein condensate. Phys. Rev. A 2018 , 97 , 023625. [ Google Scholar ] [ CrossRef ][ Green Version ]
Kumar, R.K.; Tomio, L.; Gammal, A. Spatial separation of rotating binary Bose-Einstein condensates by tuning the dipolar interactions. Phys. Rev. A 2019 , 99 , 043606. [ Google Scholar ] [ CrossRef ][ Green Version ]
Kumar, R.K.; Tomio, L.; Malomed, B.A.; Gammal, A. Vortex lattices in binary Bose-Einstein condensates with dipole-dipole interactions. Phys. Rev. A 2017 , 96 , 063624. [ Google Scholar ] [ CrossRef ][ Green Version ]
Bisset, R.N.; Ardila, L.A.P.n.; Santos, L. Quantum Droplets of Dipolar Mixtures. Phys. Rev. Lett. 2021 , 126 , 025301. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Smith, J.C.; Baillie, D.; Blakie, P.B. Quantum Droplet States of a Binary Magnetic Gas. Phys. Rev. Lett. 2021 , 126 , 025302. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Myatt, C.J.; Burt, E.A.; Ghrist, R.W.; Cornell, E.A.; Wieman, C.E. Production of Two Overlapping Bose-Einstein Condensates by Sympathetic Cooling. Phys. Rev. Lett. 1997 , 78 , 586–589. [ Google Scholar ] [ CrossRef ]
Hall, D.S.; Matthews, M.R.; Ensher, J.R.; Wieman, C.E.; Cornell, E.A. Dynamics of Component Separation in a Binary Mixture of Bose-Einstein Condensates. Phys. Rev. Lett. 1998 , 81 , 1539–1542. [ Google Scholar ] [ CrossRef ][ Green Version ]
Maddaloni, P.; Modugno, M.; Fort, C.; Minardi, F.; Inguscio, M. Collective Oscillations of Two Colliding Bose-Einstein Condensates. Phys. Rev. Lett. 2000 , 85 , 2413–2417. [ Google Scholar ] [ CrossRef ][ Green Version ]
Papp, S.B.; Pino, J.M.; Wieman, C.E. Tunable Miscibility in a Dual-Species Bose-Einstein Condensate. Phys. Rev. Lett. 2008 , 101 , 040402. [ Google Scholar ] [ CrossRef ][ Green Version ]
Modugno, G.; Modugno, M.; Riboli, F.; Roati, G.; Inguscio, M. Two Atomic Species Superfluid. Phys. Rev. Lett. 2002 , 89 , 190404. [ Google Scholar ] [ CrossRef ][ Green Version ]
McCarron, D.J.; Cho, H.W.; Jenkin, D.L.; Köppinger, M.P.; Cornish, S.L. Dual-species Bose-Einstein condensate of 87 Rb and 133 Cs. Phys. Rev. A 2011 , 84 , 011603. [ Google Scholar ] [ CrossRef ][ Green Version ]
Pasquiou, B.; Bayerle, A.; Tzanova, S.M.; Stellmer, S.; Szczepkowski, J.; Parigger, M.; Grimm, R.; Schreck, F. Quantum degenerate mixtures of strontium and rubidium atoms. Phys. Rev. A 2013 , 88 , 023601. [ Google Scholar ] [ CrossRef ][ Green Version ]
Wacker, L.; Jørgensen, N.B.; Birkmose, D.; Horchani, R.; Ertmer, W.; Klempt, C.; Winter, N.; Sherson, J.; Arlt, J.J. Tunable dual-species Bose-Einstein condensates of 39 K and 87 Rb. Phys. Rev. A 2015 , 92 , 053602. [ Google Scholar ] [ CrossRef ][ Green Version ]
Chen, L.; Zhu, C.; Zhang, Y.; Pu, H. Spin-exchange-induced spin-orbit coupling in a superfluid mixture. Phys. Rev. A 2018 , 97 , 031601. [ Google Scholar ] [ CrossRef ][ Green Version ]
Lee, K.L.; Jørgensen, N.B.; Liu, I.K.; Wacker, L.; Arlt, J.J.; Proukakis, N.P. Phase separation and dynamics of two-component Bose-Einstein condensates. Phys. Rev. A 2016 , 94 , 013602. [ Google Scholar ] [ CrossRef ][ Green Version ]
Cikojević, V.; Markić, L.V.; Boronat, J. Harmonically trapped Bose–Bose mixtures: A quantum Monte Carlo study. New J. Phys. 2018 , 20 , 085002. [ Google Scholar ] [ CrossRef ]
Astrakharchik, G.E.; Boronat, J.; Kurbakov, I.L.; Lozovik, Y.E. Quantum Phase Transition in a Two-Dimensional System of Dipoles. Phys. Rev. Lett. 2007 , 98 , 060405. [ Google Scholar ] [ CrossRef ] [ PubMed ][ Green Version ]
Bombin, R.; Boronat, J.; Mazzanti, F. Dipolar Bose Supersolid Stripes. Phys. Rev. Lett. 2017 , 119 , 250402. [ Google Scholar ] [ CrossRef ][ Green Version ]
Bombín, R.; Mazzanti, F.; Boronat, J. Berezinskii-Kosterlitz-Thouless transition in two-dimensional dipolar stripes. Phys. Rev. A 2019 , 100 , 063614. [ Google Scholar ] [ CrossRef ][ Green Version ]
Pawłowski, K.; Bienias, P.; Pfau, T.; Rzążewski, K. Correlations of a quasi-two-dimensional dipolar ultracold gas at finite temperatures. Phys. Rev. A 2013 , 87 , 043620. [ Google Scholar ] [ CrossRef ][ Green Version ]
Guardiola, R. Monte carlo methods in quantum many-body theories. In Microscopic Quantum Many-Body Theories and Their Applications ; Springer: Berlin/Heidelberg, Germany, 2007; pp. 269–336. [ Google Scholar ] [ CrossRef ]
Vrbik, J.; Rothstein, S.M. Quadratic accuracy diffusion Monte Carlo. J. Comput. Phys. 1986 , 63 , 130–139. [ Google Scholar ] [ CrossRef ]
Boronat, J.; Casulleras, J. Monte Carlo analysis of an interatomic potential for He. Phys. Rev. B 1994 , 49 , 8920–8930. [ Google Scholar ] [ CrossRef ][ Green Version ]
Boronat, J. Monte Carlo simulations at zero temperature: Helium in one, two and three dimensions. In Microscopic Approaches to Quantum Liquids in Confined Geometries ; Krotscheck, E., Navarro, J., Eds.; World Scientific: Singapore, 2002; p. 21. [ Google Scholar ]
Casulleras, J.; Boronat, J. Unbiased estimators in quantum Monte Carlo methods: Application to liquid 4 He. Phys. Rev. B 1995 , 52 , 3654. [ Google Scholar ] [ CrossRef ][ Green Version ]
Jastrow, R. Many-Body Problem with Strong Forces. Phys. Rev. 1955 , 98 , 1479–1484. [ Google Scholar ] [ CrossRef ]
Macia, A. Microscopic Description of Two Dimensional Dipolar Quantum Gases. Ph.D. Thesis, Universitat Politecnica de Catalunya, Barcelona, Spain, 2015. [ Google Scholar ] [ CrossRef ]
Kim, S.H.; Won, C.; Oh, S.D.; Jhe, W. Two-dimensional Gross-Pitaevskii Equation: Theory of Bose-Einstein Condensation and the Vortex State. arXiv 1999 , arXiv:cond-mat/9904087. [ Google Scholar ]
Karle, V.; Defenu, N.; Enss, T. Coupled superfluidity of binary Bose mixtures in two dimensions. Phys. Rev. A 2019 , 99 , 063627. [ Google Scholar ] [ CrossRef ][ Green Version ]
Hertkorn, J.; Schmidt, J.N.; Böttcher, F.; Guo, M.; Schmidt, M.; Ng, K.S.H.; Graham, S.D.; Büchler, H.P.; Langen, T.; Zwierlein, M.; et al. Density Fluctuations across the Superfluid-Supersolid Phase Transition in a Dipolar Quantum Gas. Phys. Rev. X 2021 , 11 , 011037. [ Google Scholar ] [ CrossRef ]
Lee, A.C.; Baillie, D.; Blakie, P.B.; Bisset, R.N. Miscibility and stability of dipolar bosonic mixtures. Phys. Rev. A 2021 , 103 , 063301. [ Google Scholar ] [ CrossRef ]
Figure 1.
Left
column: pure estimators of the density for
and
. The points indicate the performed simulations.
Figure 3.
Mixture
A
. First and second rows, from left to right: pure density profiles for
,
and
, respectively. Third and fourth rows, from left to right: density profiles for
,
and
, respectively. In all cases
Figure 4.
Mixture
B
,
and
, respectively. Third and fourth rows, from left to right: density profiles for
,
| https://www.mdpi.com/2410-3896/7/2/32 |
Glorification of Saint Innocent, Metropolitan of Moscow, Enlightener of the Aleuts, Apostle to the Americas - Orthodox Church in America
Saint Innocent, Metropolitan of Moscow, Enlightener of the Aleuts and Apostle to America (in the world John Popov-Veniaminov), was born on August 26, 1797 in the village of Anginsk in the Irkutsk diocese, into the family of a sacristan. The boy mastered his studies at an early age and by age seven,…
Glorification of Saint Innocent, Metropolitan of Moscow, Enlightener of the Aleuts, Apostle to the Americas
Troparion & Kontakion
Saint Innocent, Metropolitan of Moscow, Enlightener of the Aleuts and Apostle to America (in the world John Popov-Veniaminov), was born on August 26, 1797 in the village of Anginsk in the Irkutsk diocese, into the family of a sacristan. The boy mastered his studies at an early age and by age seven, he was reading the Epistle in church. In 1806 they sent him to the Irkutsk seminary. In 1814, the new rector thought it proper to change the surnames of some of the students. John Popov received the surname Veniaminov in honor of the deceased Archbishop Benjamin of Irkutsk (+ July 8, 1814). On May 13, 1817 he was ordained deacon for the Irkutsk Annunciation church, and on May 18, 1821, he was ordained priest.
Father John was a remarkable preacher. During the celebration of the Liturgy, memorial services and the all-night Vigil, he incessantly guided his flock. During his time of endless travels, Father John studied the languages, customs and habits of the peoples, among whom he preached. His work in geography, ethnography and linguistics received worldwide acclaim. He composed an alphabet and grammar for the Aleut language and translated the Catechism, the Gospel and many prayers into that language. One of the finest of his works was the Indication of the Way into the Kingdom of Heaven (1833), translated into the various languages of the peoples of Siberia and appearing in more than 40 editions. Thanks to the toil of Father John, the Yakut people in 1859 first heard the Word of God and divine services in their own native language.
On November 29, 1840, after the death of his wife, Father John was tonsured a monk with the name Innocent by Saint Philaret, the Metropolitan of Moscow, in honor of Saint Innocent of Irkutsk. On December 15, Archimandrite Innocent was consecrated Bishop of Kamchatka, the Kurile and Aleutian Islands. On April 21, 1850 Bishop Innocent was elevated to the rank of archbishop.
By the Providence of God on January 5, 1868, Saint Innocent succeeded Metropolitan Philaret on the Moscow cathedra. Through the Holy Synod, Metropolitan Innocent consolidated the secular missionary efforts of the Russian Church (already in 1839 he had proposed a project for improving the organization of missionary service).
Under the care of Metropolitan Innocent a Missionary Society was created, and the Protection monastery was reorganized for missionary work. In 1870 the Japanese Orthodox Spiritual Mission headed by Archimandrite Nicholas Kasatkin [afterwards Saint Nicholas of Japan, (February 3)] was set up, with whom Saint Innocent had shared much of his own spiritual experience. The guidance by Saint Innocent of the Moscow diocese was also fruitful, by his efforts, the church of the Protection of the Most Holy Theotokos was built up into the Moscow Spiritual Academy.
Saint Innocent fell asleep in the Lord on March 31, 1879, on Holy Saturday, and was buried at the Holy Spirit Church of the Trinity-Saint Sergius Lavra. On October 6, 1977, Saint Innocent was glorified by the Russian Orthodox Church. His memory is celebrated three times during the year: on March 31, the day of his blessed repose, on October 5 (Synaxis of the Moscow Hierarchs), and on October 6, the day of his glorification.
| https://www.oca.org/saints/lives/0577/10/06/102884-glorification-of-saint-innocent-metropolitan-of-moscow-enlighten |
Refworld | Ukraine: Treatment of members of the Social Democratic Party of Ukraine (United) [SDPU(U)]; treatment of supporters of Yanukovych; whether there are regions of the country where pro-Yanukovych supporters are in the majority or in control (January 2005 - April 2006)
Refworld is the leading source of information necessary for taking quality decisions on refugee status. Refworld contains a vast collection of reports relating to situations in countries of origin, policy documents and positions, and documents relating to international and national legal frameworks. The information has been carefully selected and compiled from UNHCR's global network of field offices, Governments, international, regional and non-governmental organizations, academic institutions and judicial bodies.
Ukraine: Treatment of members of the Social Democratic Party of Ukraine (United) [SDPU(U)]; treatment of supporters of Yanukovych; whether there are regions of the country where pro-Yanukovych supporters are in the majority or in control (January 2005 - April 2006)
Publisher Canada: Immigration and Refugee Board of Canada
Author Research Directorate, Immigration and Refugee Board of Canada, Ottawa
Publication Date 12 April 2006
Citation / Document Symbol UKR101137.E
Reference 2
Cite as
Canada: Immigration and Refugee Board of Canada,
Ukraine: Treatment of members of the Social Democratic Party of Ukraine (United) [SDPU(U)]; treatment of supporters of Yanukovych; whether there are regions of the country where pro-Yanukovych supporters are in the majority or in control (January 2005 - April 2006)
, 12 April 2006, UKR101137.E
, available at: https://www.refworld.org/docid/45f147b72f.html [accessed 23 June 2023]
Disclaimer This is not a UNHCR publication. UNHCR is not responsible for, nor does it necessarily endorse, its content. Any views expressed are solely those of the author or publisher and do not necessarily reflect those of UNHCR, the United Nations or its Member States.
Sources such as Country Reports on Human Rights Practices for 2005and Ukrainian News differed in their reports on the treatment of members of the Social Democratic Party of Ukraine (United), SDPU(U) (Ukrainian News 27 May 2005; Country Reports 20058 Mar. 2006, Sec. 2.b), an opposition party which was led by Viktor Medvedchuk (Ukrainian News 6 Feb. 2005).
According to Country Reports 2005, the SDPU(U) claimed that "thousands" of its supporters, including many doctors and teachers, were fired in 2005 for their opposition to the ruling party of Viktor Yushchenko (8 Mar. 2006, Sec. 2.b). Media reports indicated that 1,243 people made complaints to the Human Rights Ombudsman after being "pressured or dismissed because of their political beliefs" ( Country Reports 20058 Mar. 2006, Sec. 2.b). In addition, the SDPU(U) claimed its members were being "politically repressed" (Interfax 12 Feb. 2005). Ukrainian News quoted figures from the SDPU(U) claiming that 4,000 of its 12,000 members in Lviv had left the party "because of the pressure exerted on them by political opponents" (27 May 2005).
Citing information obtained from unspecified human rights organizations, however, Country Reports 2005stated that "only approximately 5 per cent of the country's 450,000 civil servants had been dismissed and replaced by supporters of the Yushchenko administration," many of whom had reportedly been political appointees under the previous government (8 Mar. 2006, Sec. 2.b).
In its 2005 annual report, the International Helsinki Federation for Human Rights (IHF) noted that, in Ukraine, many public meetings involving political campaigners prior to the December 2004 elections were banned. Although most of the bans involved Yushchenko supporters, Lviv courts also prohibited some gatherings of Yanukovych-supporting members of the SDPU(U) (IHF 2005).
A report by the Eurasia Daily Monitornoted that in February 2005, President Yushchenko replaced Anatoly Blyznyuk, the governor of the province of Donetsk and former ally of Yanukovych, with the "more or less independent" former ambassador to Turkmenistan Vadym Chuprun (11 Apr. 2005). While Yushchenko's opponents denounced this move as an indication of "political persecution," Yushchenko responded that his government was against such practices ( Eurasia Daily Monitor11 Apr. 2005). Ukrainian News, however, quoted him as stating that he did not want supporters of Viktor Yanukovych in his team (13 May 2005).
In April 2005, the Eurasia Daily Monitorfurther reported that the chairman of the Donetsk Region Council Borys Kolesnykov, "a top representative of the old Kuchma regime" and a supporter of Viktor Yanukovych, was arrested and imprisoned for extortion (11 Apr. 2005). Considered a "serious blow to the 'Donetsk clan' and the [Party of] Regions of Ukraine," Kolesnykov's arrest was seen as politically motivated by many and his supporters called for his immediate release ( Eurasia Daily Monitor11 Apr. 2005). According to Interfax-Ukraine News Agency, Kolesnykov was imprisoned until August 2005 when he offered a written pledge not to flee the country (Interfax 24 Mar. 2006). As of March 2006, however, the criminal case against Kolesnykov was still open and four courts had agreed that the "criminal case was well justified" (ibid.).
The opposition Party of Regions stated that on 7 March 2006, one of its offices in Lviv was set on fire three days after one of the party's activists was physically assaulted in Lviv (UNIAN 7 Mar. 2006). While the Ukrainian Independent Information Agency (UNIAN) had no information on the perpetrators of the attacks, it stated that the police were investigating both cases (ibid.). In February 2006, UNIAN reported that a case concerning the abuse of office against a member of the Party of Regions was closed "'as there [were] no signs of crime'" (ibid. 28 Feb. 2006).
On 27 May 2005, Ukrainian News cited claims by SDPU(U) deputy chairperson Ihor Shurma that members of his party were being "politically repressed" in the region of Zakarpattia. Shurma claimed that teachers, doctors, and government officials who were members of the SDPU(U) were frequently being dismissed for their political allegiance and he speculated that many of the criminal charges against party members would be dropped after the April 2006 parliamentary elections (Ukrainian News 27 May 2005). In protest of politically-motivated dismissals, the SDPU(U) asked the president of the European Court of Human Rights to take action (Ukrainian News 10 May 2005) and announced it would block the parliament's activities until the dismissals were reviewed (Ukrainian News 13 May 2005). Further or corroborating information regarding these allegations could not be found among the sources consulted by the Research Directorate.
On 23 May 2005, Radio Free Europe/Radio Liberty (RFE/RL) reported that Nina Karpachova, the Ukrainian Human Rights Ombudspersonan, had denounced the beating of several SDPU(U) lawmakers by riot police in Uzhhorod on 20 May 2005.
On 14 July 2005, Ukrainian News reported that a Kiev district court issued an arrest warrant for Mykola Dmytrenko, the former first deputy chairman of the Vinnytsia regional state administration and member of the SDPU(U). Reportedly, other members of the SDPU(U) felt that Dmytrenko, who was officially arrested for abuse of office and misuse of government funds, was instead arrested on political grounds (Ukrainian News 14 July 2005). Yurii Lutsenko, Ukraine's Minister of the Interior, however, denied these allegations, stating, "'The Dmytrenko case is strictly an economic crime, and statements by his fellow members of the SDPU(U) in defense of a 'victim of political repression' are speculative and provocative in relation to the investigation'" (Ukrainian News 14 July 2005).
The Website of Global Security.org contains a colour-coded map of the regions that supported Viktor Yanukovych (Eastern and Southern Ukraine) in the 2004 legislative elections and those that supported Viktor Yushchenko (Central and Western Ukraine) (2004). More recently, a graph showing regional voter support for Yanukovych's Party of Regions (CNN 26 March 2006) in Ukraine's 26 March 2006 parliamentary elections can be found on the Website of the Central Election Commission of Ukraine (Ukraine 26 Mar. 2006).
This Response was prepared after researching publicly accessible information currently available to the Research Directorate within time constraints. This Response is not, and does not purport to be, conclusive as to the merit of any particular claim for refugee protection. Please find below the list of additional sources consulted in researching this Information Request.
References
Cable News Network (CNN). 26 March 2006. "Ukraine."
World/Election Watch
.
[Accessed 12 Apr. 2006]
Country Reports on Human Rights Practices for 2005
. 8 March 2006. "Ukraine." United States Department of State.
[Accessed 9 Apr. 2006]
Eurasia Daily Monitor
[Washington, DC]. 11 April 2005. Vol. 2, Issue 70. Oleg Varfolomeyev. "Yushchenko Opponent Imprisoned, Suspected of Extortion."
[Accessed 10 Apr. 2006]
Global Security.org. 2004. "2004 Presidential Election."
[Accessed 9 Apr. 2006]
Interfax-Ukraine News Agency [Kiev, in Russian]. 24 March 2006. "Charges Against Ukrainian Regional Ex-Official Still Stand – Prosecutor." (Factiva/BBC Monitoring)
_____. 12 February 2005. "SDPU(U) Protesting against Political Repressions in Ukraine." (Factiva)
International Helsinki Federation for Human Rights (IHF). 27 June 2005. "Ukraine."
Human Rights in the OSCE Region: Europe, Central Asia and North America, Report 2005 (Events of 2004)
.
[Accessed 10 Apr. 2006]
Radio Free Europe/Radio Liberty (RFE/RL). 23 May 2005. "Ukrainian Ombudsman Condemns Reported Beating of Opposition Lawmakers."
[Accessed 7 Mar. 2006]
Ukraine. 26 March 2006. Central Election Commission of Ukraine. "Results of Voting in Oblasts of Ukraine, Party of Regions."
[Accessed 12 Apr. 2006]
Ukrainian News Agency [Kiev]. 14 July 2005. "Update: Court Arrests Vinnytsia Ex-First Deputy Governor Dmytrenko." (Factiva)
_____. 27 May 2005. "SDPU(U) Says Its Members Are Persecuted in Zakarpattia Region." (Factiva)
_____. 13 May 2005. "SDPU(U) To Block Parliament's Activity Until Dismissals of People Who Supported Yanykovych in 2004 Presidential Elections Are Reviewed." (Factiva)
_____. 10 May 2005. "SDPU(U) Urges European Rights Advocates to Stop Political Persecution in Ukraine." (Factiva)
_____. 6 February 2005. "Medvedchuk Anxious About No Representation of Southeast Ukraine in Cabinet." (Factiva)
Ukrainian Independent Information Agency (UNIAN) [Kiev, in Ukrainian]. 7 March 2006. "Opposition Mayoral Candidate's Office Reportedly Burnt in West Ukraine." (Factiva/BBC Monitoring)
_____. 28 February 2006. "Ukrainian Prosecutors Said to Drop Case against Opposition Figure." (Factiva/BBC Monitoring)
Additional Sources Consulted
Internet Sites, including:Amnesty International (AI), British Broadcasting Corporation (BBC), CNN Election Watch, The Economist[London], Electionworld.org, European Country of Origin Information Network (ECOI), Freedom House, Human Rights Watch (HRW), Organization for Security and Co-operation in Europe (OSCE), Social Democratic Party of Ukraine (United) (inaccessible), United States Department of State.
Publications: Political Handbook of the World 2005-2006.
| https://www.refworld.org/cgi-bin/texis/vtx/rwmain?docid=45f147b72f&page=printdoc |
Scientology 'Detox' Furor
Scientology, Scientologists, programs
Scientology 'Detox' Furor
The managers of a Scientology-based detox program that's been free for those officially involved in the 9/11 rescue effort now want to offer the service to thousands of other Ground Zero victims - for $5,000 each. Critics, however, are skeptical about whether the program works at all.
The clinic's advisory board, which includes Scientologists, doctors and rescue workers, is also pushing for a $1 million government grant to determine whether the program actually works.
The New York Rescue Workers Detoxification Project - partially funded by practicing Scientologist Tom Cruise - plans to open its third and fourth clinics next year in Staten Island and upstate in Orange County.
In addition, a new training facility at the group's Fulton Street clinic in downtown Manhattan would teach medics the project's controversial methods of removing toxins from the body.
Project spokesman Keith Miller said trained medics could supervise programs at their own practices - reaching office workers and residents sick from inhaling pollutants they were exposed to after the attacks on the World Trade Center.
The program has been offered free to city firefighters, police officers and other rescue workers. In addition, several Wall Street workers have already paid about $5,000 to participate.
The daily regimen involves drinking niacin, which reacts to chemicals in fat, running on a treadmill and then hitting the steam room for up to four hours. These activities release toxins stored in fat cells for years, says Dr. David Root, who has administered the program for more than 20 years.
Last week, however, toxicology experts said there was no scientific evidence that toxins can be dislodged from your body by any means.
"It sounds great and they mean well, but it just doesn't work," claimed University of Georgia professor Cham Dallas, who has studied toxins in humans for more than 20 years and is a leading expert in bioterrorism.
"This is just hocus-pocus," said Dr. Bob Hoffman of the New York City Poison Control Center. "For some people, sitting in a hot environment can be very dangerous."
But Root said temperatures are carefully regulated to ensure they are safe.
The Post toured the detoxification project's clinic in Williston Park, L.I. - opened last month by Cruise - and spoke to more than 30 of the 286 firefighters, EMT volunteers and downtown residents who have completed the program. They all said that their physical and mental health had improved.
"I have to say it saved me - it saved my marriage and my family," said Eric Brodin, 34, from Engine 50/Ladder 19 in the South Bronx. "I was angry all the time, and I couldn't sleep. I felt so sick. It only took me 16 days, and the transformation was amazing - I felt like a kid again."
Retired firefighter Andy Isolano, 32, echoed Brodin's comments. "I was wheezing and had chronic asthma," he said. "When I signed up, I was skeptical, but . . . I cannot believe I don't have to take all that medicine any more."
FDNY deputy chief medical examiner Dr. David Prezant says his main concern is that many rescue workers are going off their medication without consulting their doctors before they start the program.
One retired firefighter, eager to start the program, passed out in a Queens Barnes & Noble after suffering an asthma attack. "They wanted me off my meds for 30 days before I started," said Robert McGuire, 37. "Two weeks into it I was by myself [in a store], my inhaler was in the car and I thought I was going to die.
"I was taken to the emergency room - it was really scary," he added. "I don't like being on so much medication, but I really can't live without it."
(The program's doctors deny they advised McGuire to go off his medication.)
Clinic spokesman Miller said his organization has twice asked the FDNY to help fund its research effort to test sweat and other excretions from patients for toxins - and have twice been refused.
| https://culteducation.com/group/1284-scientology/25612-scientology-detox-furor.html?print=1&tmpl=component |
The Project Gutenberg eBook of Prison Journals During the French Revolution, by Louise Henriette Charlotte Philippine (de Noailles) de Durfort, duchesse de Duras
The Project Gutenberg eBook, Prison Journals During the French Revolution,
by Louise Henriette Charlotte Philippine (de Noailles) de Durfort,
duchesse de Duras, Translated by Martha Ward Carey
This eBook is for the use of anyone anywhere in the United States
and most other parts of the world at no cost and with almost no
restrictions whatsoever. You may copy it, give it away or re-use it
under the terms of the Project Gutenberg License included with this
eBook or online at
www.gutenberg.org
. If you are not
located in the United States, you'll have to check the laws of the
country where you are located before using this ebook.
Title: Prison Journals During the French Revolution
Author: Louise Henriette Charlotte Philippine (de Noailles) de Durfort, duchesse de Duras
Release Date: September 1, 2014 [eBook #46750]
Language: English
Character set encoding: ISO-8859-1
***START OF THE PROJECT GUTENBERG EBOOK PRISON JOURNALS DURING THE FRENCH REVOLUTION***
E-text prepared by Dianna Adair, readbueno,
and the Online Distributed Proofreading Team
(
http://www.pgdp.net
)
from page images generously made available by
Internet Archive
Frontispiece
PRISON JOURNALS DURING THE FRENCH REVOLUTION.
BY
THE DUCHESSE DE DURAS
NÉE NOAILLES
Translated by Mrs. M. Carey
NEW YORK
DODD, MEAD AND COMPANY
1892
Copyright, 1891,
By Dodd, Mead and Company .
All rights reserved.
University Press:
John Wilson and Son, Cambridge.
CONTENTS.
Page. Prison Life during the French Revolution 7 Addenda 139 Madame Latour's Memoir 159 Events of the 21st of July, 1794 199 Narrative of an Eye-witness of the Affair of July 22, 1794 209 Letter from Madame la Duchesse de Duras, née Noailles, to Monsieur Grelet 227 Extract from the 'Mémorial Européen,' April 24, 1809 229
PRISON LIFE DURING THE
FRENCH REVOLUTION.
I was put under arrest, together with my
father and mother, on August 23, 1793,
at our château of Mouchy-le-Châtel, in the
Department of the Oise. I was taken to the
prison at Saint-François à Beauvais, in the
old convent, on the 6th of October of the same
year and to that at Chantilly on the 20th of
the same month. There I remained until the
5th of April, 1794, when I was transferred to
Paris, to the Collège du Plessis, from which
I was liberated on the 19th of the following
October.
PRISON LIFE DURING THE FRENCH REVOLUTION. WRITTEN IN 1801, THE YEAR IX. OF THE REPUBLIC.
The period of my confinement in different
prisons during the Reign of Terror was so
harassing that the idea of writing out its details
did not then occur to me; but when I had the
consolation of seeing my son once more, he
was desirous of learning all about it. I feared
that I should be overcome by my feelings if I
tried to relate the details to him, and
consequently determined to write the following
memoirs.
My parents retired to their estate of Mouchy-le-Châtel,
in the Department of the Oise, in the
month of September, 1792. I accompanied
them thither, and was their sole companion.
They resolved, from prudential motives, to receive
visits from no one. This privation cost
my father nothing, for he was naturally shy,
though the positions he had occupied had forced
him to live constantly in the great world. My
mother, who loved him dearly, accustomed herself
to retirement with submission to the will
of Providence, with the naturally happy disposition
maintained through all the events of
her life.
She loved system in all things, and she introduced
it so successfully into our daily life that
it passed rapidly. Reading, work, play, and
walking filled up every moment. My parents
took pleasure in furnishing refreshment to the
harvesters during their weary labour, in sympathizing
with their troubles, and in helping them
by kindnesses. In spite of the position in
which the Revolution placed my father, and the
natural repugnance which he declared he felt
for those who were engaged in it, he gave
volunteers the means of paying their way. My
father had, if I may so express myself, a passion
for charity. His hands were always ready to
bestow, and whenever he received a sum of
money he would in a few hours declare, with
satisfaction, that he had none of it left.
He could keep nothing when he knew that
others were suffering; hospital visiting, aid
rendered in private, all sorts of kind deeds and
comforting words,—in fact all good works
were familiar to him; in these alone he found
happiness.
I have seen him refuse things which he might
have considered necessary for himself in order
to add to the number of his charities. Yet my
father was born with a very unhappy disposition;
the fortune, the honours, and all the
pleasures that his position secured him were
spoiled by the most miserable discontent. I
frequently endeavoured, firmly and respectfully,
to show him that Heaven had bestowed every
gift upon him, and that nothing was wanting to
his position. He listened patiently to what I
had to say; but I did not succeed in convincing
him. I worried myself and gained nothing.
My mother, on the contrary, often said to me
that if she should return to society she would
not desire to change her manner of living in the
least. She had a charmingly happy disposition,
and was never out of humour for a moment.
Several times during the Revolution it was
proposed that I should emigrate. One of my
relatives sent for me at different periods, and
urged me to consent to do so. I always refused,
having a great repugnance to leaving my
country, and desiring to watch over the old age
of my parents, who were already separated from
some of their children.
How great would have been my regret had I
not remained with them up to the moment when
I was deprived of my liberty. I shall retain
to my latest breath the memory of their kindness,
and the tenderest gratitude for the good
example and daily lessons in virtue which I
received from them.
But to return to the details of our family life
at Mouchy.
Every day I was filled with wonder to see my
father, who from his youth had been accustomed
to command (he had at the age of seven been
given the reversion of the governorship of
Versailles, after his father's death), obey without
complaint the Revolutionary laws and all those
who executed them. Everything worried him
under the old régime, yet during the Reign of
Terror he was calm because he was entirely
resigned to the will of God. Religion had
regulated all the actions of his life. It was
really, for him, eternal happiness.
We suffered great anxiety during our sojourn
at Mouchy. We were utterly ignorant of the
fate of my elder brother. [1]A price had been
put on his head and the notice of it posted at the
corners of the streets of Paris, and the newspapers
had stated that he had been guillotined.
One afternoon, in the month of October (the
10th), we saw approaching us quite a large body
of troops composed of Hussars and National
Guards from different villages of the estate of
Mouchy. It was preceded by a commissioner of
the Committee of General Security, named Landry,
who came to arrest my brother, believing that
he was concealed in the castle. We were surprised,
but not frightened. It was absurd to
suppose that he would have chosen his own father's
house for his hiding-place. They searched
everywhere under pretext of taking him and
of seizing arms, but they found nothing.
The official report made by the commissioner
and the municipality proves this.
The drawing up of the report and the search
lasted from five o'clock in the evening to eleven.
Landry, called upon my father to denounce his
son, though he could not even know whether he
was alive or not. He answered with much dignity
that such a demand was as harsh as it was
unusual, and that he would not accede to it; yet
he asked Landry, to take something to eat, and
lent him one of his saddle horses to take him back
to his carriage. My father, who was naturally
very fiery, knew how to control himself when
the importance of the occasion required it.
The officer of the Hussars who commanded
the detachment was a very excellent man. He
told us that he was marching with his troop
along the highway from Beauvais, to Paris; that
being required by the commissioner of the Committee
of General Security to accompany him to
Mouchy, he had been obliged to obey him,
though with great repugnance, and that he came
with the kindest intentions possible. He gave
me an immediate proof of this; for he whispered
in my ear that if my brother was in the house
he would advise me to hasten his escape, and
that he would be very glad of it. I have retained
a feeling of real gratitude for this officer,
whose name I do not know; he was from the
region of Rouen.
The intense animosity which was shown in
the attempt to capture my brother increased our
anxiety concerning our own fate. A report,
circulated by the newspapers, that he was in
England somewhat allayed our anxiety; and
Monsieur Noël (my father's man of business,
who has given proof of the strongest attachment
to our family) afterward assured us of its truth.
When he entered the drawing-room we were
much agitated, not knowing what news he was
about to announce to us.
Various accounts have been given of the
manner in which my brother escaped the scaffold.
Some have said that he escaped from
prison by the payment of a hundred thousand
crowns to Manuel, then Procureur, of the Commune;
others, that he left Paris disguised as a
wagoner, and had been seen passing along
several roads.
The truth is that he was never arrested, and
that he found good and brave men who were
kind enough to hide him in their houses; that
he remained for several hours in the very top of
the Louvre, stretched upon a beam, at the very
moment when the famous search of September,
1792, was made; and that afterward he escaped
by means of a passport to Granville, where Monsieur
Mauduit, his son's old tutor, a naval commissioner,
assisted him to embark for Dover.
Monsieur Mauduit, was guillotined, but he
made no mention of my brother's affairs at his
trial. My poor brother, having sailed from
port, thought he had escaped death. A storm
compelled his vessel to return to the port. He
was obliged to hide himself in a place so close
that his suffering for want of air came near
causing him to betray himself. The search
ended just in time to save his life, and he again
set sail. It is also false that he used large sums
of money to get out of his danger. He was not
forced to spend more than two thousand crowns.
The knowledge that he was out of danger
diminished our daily increasing anxiety.
We had peaceful consciences, but the condition
of affairs was becoming very threatening,
and the future very disturbing. We often talked
it over. I had the comfort of alleviating the
situation of my dear parents, and they showed
great pleasure in receiving my attentions. I
concealed from them the terrible thoughts which
constantly came to my mind, and occupied myself
in distracting them from those by which
they were sometimes agitated. We had not
even the consolation of religious worship, the
curate of the parish having taken the oath to
the civil constitution exacted from the clergy;
but we had had until our arrest opportunity to
hear Mass from a Catholic priest. I prayed to
God with all my heart for grace sufficient to endure
all the terrible things that I foresaw in our
future experience. About the 15th of August,
1793, Collot d'Herbois, and Isoré were sent en missioninto the Departments of the Aisne
and the Oise. They immediately put into execution
there the decree regarding suspects, though this was
not done in Paris until the 18th of the following
September. Consequently all the priests
and nobles were arrested. On the 23d of
August the municipality of Mouchy, notified us
of the order to remain under arrest in our residences
until the houses of confinement were
ready to receive us. The mayor, who was a
zealous patriot, disposed to enforce an extreme
rather than a moderate execution of the severe
laws, told us that this was a measure for the
public safety,—a phrase much in use during
the Reign of Terror,—and that we need not be
alarmed. We were allowed a space of a hundred
paces in the park to walk in, and the free
use of the courtyard, provided the grating was
closed. We went there sometimes to talk with
the people. This way of living was only an
apprenticeship to the slavery that was impending.
One quite singular fact was that, the population
of Mouchy, being small, our own dependents
acted National Guardsmen, and stood sentinel at
our gates. I suppose there were those among
them who took pleasure in doing this; for
charity's sake I pass over their conduct in
silence.
A very few of them, however, gave my parents
strong proof of their attachment. I will
give a list of their names at the end of these
memoirs.
The municipality of Mouchy, sent a petition
to the Department of the Oise, asking to be
allowed to keep us within its limits and on its
own responsibility. It referred in kindly terms
to our wise and prudent conduct, and to our
submission to the laws. The Department of
the Oise, acceded to the petition relative to my
parents; but they did not consider me old
enough, and it had been said at Beauvais, that
they wished to have a titled woman at Chantilly.
Consequently a sergeant of the national
gendarmes came with four horsemen to take me
to Beauvais. I was at that moment sick in bed.
The village surgeon, named Marais, and my
father's physician considered that I was in no
condition to be moved; but their attestations
were not sufficient, and the sergeant sent for the
physician of the Department, who decided that
it was necessary for me to remain at Mouchy,
and drew up an official paper in regard to my
condition. I remained about five weeks to recuperate,
during which time several petitions
were sent to the Department in my favour.
Monsieur Legendre went to see Collot d'Herbois,
and Isoré. But all these efforts were
fruitless.
I was so fully persuaded that I was going to be
incarcerated that I packed up all my belongings,
and hoped that my punishment would suffice
for all. It cost me great suffering to leave
my honoured parents to whom I had the comfort
of being useful.
I was a little better, and had been for a few
days going down into the courtyard to take the
air, when I saw a man arrive dressed in the uniform
of the National Guard,—he was the commander
of the Guard at Beauvais, and his name
was Poulain. I immediately suspected with
what mission he was charged, and arranged with
him that my parents should not know of the
time of my departure. We agreed that at a
signal which he would give me I should under
some pretext leave the drawing-room and not
return to it. It was important that my parents
should not undergo too much emotion. I went
up to them quietly and told them of my arrest.
At first they bore the announcement bravely. I
avoided saying anything to them which could
agitate them, and conversed with the officer
upon ordinary subjects. He searched neither
my packages nor my papers. At last the moment
came when I was obliged to leave them.
I seemed to foresee that I should never again
behold my parents.
I went away, saying nothing, but feeling
broken-hearted. I felt as though my limbs were
giving way under me. And that scene of grief,
which I am describing on the very spot where
it took place, still causes me deep emotion as I
recall it; but there are feelings which it is
impossible to express. I have been told since,
and Madame Latour also relates it in her journal,
that my father and mother remained in a
frightful state of dejection; they would take
no nourishment, and passed the nights weeping
and constantly reiterating that they had been
deprived of half their existence when their dear
daughter was taken away.
It was on the 6th of October, 1793, that I left
Mouchy, at five o'clock in the evening, in one
of my father's carriages, with Monsieur Poulain
and my maid. We reached Beauvais, after a
drive of two hours. The carriage tilted as we
drove along; the officer endeavoured to assure
me there was no danger. I somewhat insolently
replied, 'I fear God, dear Abner, and have no
other fear.' [2]
I was, however, suffering intensely inwardly.
Fortunately the darkness concealed the tears
that fell from my eyes. I prayed Heaven
earnestly to sustain my courage.
The officer had orders to have me alight at the
prison. He went to the Revolutionary committee
to ask permission for me to spend the
night at his house; it was granted him.
I learned afterward that this kind act, done
without my knowledge, and the irreproachable
manner in which he had treated me had brought
persecution upon him, and that he had been
obliged to flee from Beauvais. His wife received
me very politely. She tried to make me
take some supper; I accepted a very little, but
it may easily be imagined that my appetite was
not of the best. I passed a wretched night.
The desolate situation of my parents weighed
constantly upon my mind and heart,—their age,
their loneliness (they who so short a time before
had been surrounded by so many relatives and
friends), and the uncertainty of their future,
which left so much to be feared.
I did not have the grief of awakening, so
terrible to the unhappy. I received all sorts of
care from my kind hostess, who had me breakfast
with her husband and herself. After that I
set out for a convent of nuns of the third order
of Saint Francis, which was occupied by some
sick soldiers, and by prisoners who were placed
here temporarily until a sufficient number were
collected to form a convoy and be sent to
Chantilly. I entered a drawing-room where the
company was assembled; it was composed of
ecclesiastics, a few nobles, and some women.
The most important ones were, among others,
a man named Poter, head of the manufactory of
Chantilly, a nun, a sutler, etc. They scrutinized
my countenance. I took pains to please
my new companions, and then asked to be conducted
to my lodging-room, which was a former
linen closet, far away from every one, so that
if I had wanted anything it would have been
impossible for me to make myself heard.
Monsieur Allou, our neighbour from Mouchy,
who frequently came to see my parents, rendered
me all the service in his power, and persuaded
me to have a young girl, a prisoner,
sleep in my apartment. I agreed, though with
extreme reluctance, for I greatly preferred being
alone. Sad thoughts prevented my sleeping,
besides my being so unaccustomed to lying upon
sacking for a bed. I at once had to give up
the habit of having a light, upon which I was
very dependent; but being destined to undergo
great privations, I from that moment renounced
the conveniences of life and set myself to learn
how to attend to my own wants. As a beginning,
I made some chocolate, which was horrible.
Seeing my incapacity, I took some lessons,
and after a day or two I ventured to invite
one of my neighbours to breakfast; and she
felt herself obliged, for politeness' sake, to
praise my new talent. I arranged my employments
so that the days might not seem so long.
I read, I wrote, and I fixed a certain time to
walk in the cloisters. They were always filled
with the odour of sulphur, which was much used
in the house for treating the soldiers afflicted
with the itch. The air was not good on account
of the gutters of stagnant water which crossed
the yard. We were not allowed to go into the
garden; it was appropriated to the use of
the convalescents. The old chapel of the nuns
was still in existence, and most of the prisoners
went there to say their prayers. I sometimes
thought how great in the eyes of Heaven must
be the difference between us and the pure spirits
who had gone there before us. They had
voluntarily given up their liberty to consecrate
it to God, while I felt that the loss of mine was
a great sacrifice. Formerly the walls of this
sacred place echoed only the praises of God,
and now within them the soldiers blasphemed
undisturbed. One day while I was at confession
I was deafened by the songs of the Terror,
the guardhouse of the Revolutionary army being
just back of my room.
Among the prisoners there were some venerable
priests, who set us an example of perfect
submission to the will of Providence. I tried
hard to imitate them. Shortly after my arrival
at St. François the steward of Mouchy,
named Legendre (whom I shall set down at the
end of these memoirs among those persons who
have been most devoted to us), was arrested and
thrown into our prison on account of his attachment
to my parents. I was particularly distressed
at this, because if I had sent warning to
him at Beauvais, when Monsieur Poulain came
to arrest me at Mouchy, he would have had
time to escape. I told him all I felt on this
point. I shall have occasion to speak of him
again more than once.
Upon a petition from Monsieur Poulain to
the Revolutionary committee of Beauvais, my
waiting-woman (Mademoiselle Dubois) was
granted permission to come for an hour each
day to St. François, to assist me in making
my toilet. To that I have never attached the
slightest importance; but it was a real satisfaction
to me to receive through her some tidings
from my parents, and to send them information
concerning myself, and which they too
received with kindest interest. Imagine how
terrible a shock it was to me when I heard
through Monsieur Allou, our neighbour from
Mouchy, that they had been carried off on the
16th of October, by order of the Committee of
General Security and taken to Paris to the great
prison of La Force. I knew none of the details
(they are recounted in Madame Latour's
memoirs), and was completely overwhelmed.
This poor man was moved also, and we wept
together. I had hoped that the advanced age
of my parents, their virtues, and the voice of
the poor would appease the anger of the established
authorities; but Robespierre, having learned
that the great proprietors who had estates in the
environs, had retired to them, and were living
quietly upon them, resolved to drive them away
and have them put in prison.
My parents passed only twenty-four hours in
La Force. They were transferred to the Luxembourg,
which they left only to pass into eternity.
Every day I heard sad news through prisoners
who read the public papers, and who desired to
communicate it to me. I refused to listen,
thinking that to do so was only to incur additional
pain. One day, when I was wondering
what my parents were undergoing, I saw enter
the cloister Monsieur d'Aryon, a captain of the
National Guard (a very honest man, to whom I
was afterward under many obligations), who
seemed anxious not to meet me, so entirely was
he dismayed by his mission. He sent a prisoner
to deliver to me my order of imprisonment, of
which the following is a copy:—
Beauvais , this 19th of October,
28th day of the 2d month of
the year II. of the Republic.
You are informed that you are to start for
Chantilly on the night of this day, Saturday
to Sunday. You would do well to make all your
preparations to take with you everything
absolutely necessary to you.
If you have occasion to procure a carriage,
let me know.
(Signed)
E. Portier . Michel ,
Taquet , Dufour ,
Procureur, of the Commune .
To Madame Duras [la dame Duras], whose
carriage is at the Golden Lion. She can use it
if she wishes to do so.
It was addressed to 'Madame Duras, St. François.'
As soon as we had been informed of the order
to leave, we became anxious to know whether all
the prisoners at St. François were to be of
the party. Only a portion of them were destined
at that time for Chantilly. We passed the
whole day in packing our belongings. Mine
were taken there from Mouchy, which spared
me for that time the worry of moving them, to
which I was afterward compelled to accustom
myself. I forgot to say that the keeper of
St. François was the most humane of all under
whom I was placed. I could not determine
whether I was sorry or glad to change my
prison. Those to which I was going were
infinitely more wretched; but I did not then
know their terrible methods.
About eleven o'clock at night we were told
to get into the carriage, but the train did not
start till midnight. It was composed of wagons
and carriages of different sorts. I took in mine
Monsieur de Reignac, an officer of the King's
Constitutional Guard, who was afterward guillotined,
a nun from the Hôtel-Dieu at Beauvais,
and my waiting-woman. My coachman, to whom
this journey was exceedingly distressing,
wept the whole way. We were escorted
by the Beauvais, National Guard, part on foot
and part on horseback. As it was moonlight
the people came out in front of their doors to
hoot at us and throw stones at us. The train
which had preceded us had been insulted infinitely
worse. Monsieur Descourtils, an old and very
estimable soldier, who had on all occasions
rendered services to the town of Beauvais,
and also Monsieur Wallon, the kind patron of
the poor, were treated in the most outrageous
manner.
Our procession moved so slowly, and we
stopped so often, that we did not reach Clermont
until eleven o'clock in the morning, after
having come six leagues. My nun, who was
not accustomed to travelling in a carriage, was
almost nauseated all the way. I read throughout
almost the whole journey.
We dined at an inn in Clermont. The people
watched us dismount with an expression of pity.
This feeling, which it is generally so undesirable
to inspire, gave us pleasure on account of its rarity
during the Reign of Terror. Nothing worthy
of remark took place during our short stay at
Clermont, unless it was the manner in which
we were guarded. Our escort, being obliged
to rest and get something to eat, confided us to
the care of the National Guard of the city,
among whom there were some prisoners who
had been placed there to increase the size of
the troop. The vicinity of Fitz-James made
me sadly recall memories of the past. I had
been so happy there from my earliest childhood;
now nothing was left me but to regret it; all
those with whom I had spent my life there were
either dead or gone away. But while I was
giving way to these sad thoughts, we were told
it was time to leave. The train started, and we
reached Chantilly at three o'clock.
It would be difficult to describe the confusion
caused by the unpacking of the many vehicles
loaded with mattresses and other things belonging
to the prisoners, all thrown haphazard in
the court, without other order than to unload
them, and that the bundles should not be taken
upstairs till the next day, when there would be
time to examine them.
Consequently it was the custom to go to bed
on a chair the first night, after a very scanty
supper, or to accept the mattress of some
prisoner willing to deprive himself of it. As
we passed the iron grating at the entrance of
the place, I recalled the 2d of September, and
said to Monsieur de Reignac that it was quite
probable that we were being gathered together
to be made to submit to the same fate; he
seemed to think so too. Several attempts had
been made to invent conspiracies, which had in
fact no real existence at Chantilly any more
than in other prisons. In order to render the
name prison less terrible, they were called
houses of arrest, of justice, of detention, etc.;
but as during the Reign of Terror these words
were synonyms, I shall make use of them without
distinction. The whole party was taken
into a beautifully gilded chapel, where I had
heard Mass in the time of the Prince de Condé.
It was quite filled with bags of flour; I found
one which was placed in a comfortable position,
and seated myself on it. Then the steward of the
house, by name Notté, member for the Department
of the Oise, mounted on the altar steps to
call the roll, holding in his hand the list
of those who composed the party; he had on
his right a man named Marchand (who was the
son of a very respectable waiting-woman of my
aunt, Madame la Maréchale de Noailles), an
agent of the Revolutionary army, who was in
the confidence of the Committee of Public
Safety. He seemed to take pleasure, as the
names of the priests and nobles were called, in
saying the harshest and most cutting things to
them. A village vicar from the environs of
Beauvais, and I had the worst of it all. This
poor priest was quite in a tremor; but as for
me, I did not mind it at all. This man Marchand
asked Notté if he had taken care to see
that I was very poorly lodged, and he replied
that he had selected for me the smallest room to
be had. When the roll-call was over, Mademoiselle
Dubois, my waiting-woman, asked permission to
remain in prison with me. The commissioners
refused her request, and declared
their determination of sending away all
those not prisoners who up to that time had
remained in the place. She was much grieved
at parting from me. I was not sorry to give
her up, for I had been extremely worried to see
her suffering and deprived of liberty on account
of her attachment to me. I remember with
gratitude the feeling she showed for me at that
time, and I am very glad to record it in this
memoir. After a very long and wearisome discussion
we left the chapel, quite curious to see
our new quarters. I was agreeably surprised
when they conducted me to a small room, neat
and prettily gilded, where I was to be alone.
Notté had had the good manners to keep it for
me. I valued it the more when I saw the
lodgings of my travelling companions. Several
prisoners came to see me. I was not acquainted
with one of them. I seemed to have
been shipwrecked on an island inhabited by
good people. They welcomed me heartily, and
I was permitted to have my belongings, which
had come from Mouchy, sent up to me at once.
Consequently I had the pleasure of sleeping on
a bed,—a rare thing on the day of one's arrival.
Several of my neighbours were kind enough to
help me make it up. I was quite overcome,
and terribly fatigued. I received all these
kindnesses as graciously as possible, but was
impatient to be left to repose. Mademoiselle
de Pons, now Madame de Tourzel, came with a
message from her mother, asking me to supper;
and Madame de Chevigné invited me to breakfast
next morning. I accepted the second
invitation with pleasure. I had never known
these ladies intimately. They were the only
ones belonging to the court who were in the
house. I had only met them at the houses of
my acquaintances.
The fatigue I had undergone the day before
made me sleep. I had scarcely risen when
Mademoiselle Lèfvre, the sister-in-law of the
steward of Mouchy, came to my room to give
me information concerning the inhabitants of our
prison, and advice about my own arrangements,—all
of which was very useful to me.
It is a very sad thing to find oneself utterly
alone in the midst of a crowd. Monsieur
Notté paid me a visit; I did not find his face
so severe as it had seemed on the arrival of our
party, when he stood beside the commissioner
of the Revolutionary army. He spoke pleasantly
to me, and told me that, as the prisoners
were very much crowded in their lodgings, he
thought it best to put some one with me in a
little cabinet which was under my control. In
order to enter it one had to pass through my
room. He allowed me to select the person,
and I chose the hospital sister who had come
from Beauvais, with me. She was a good woman,
the daughter of a village farrier, without
education, but a great help to me in the daily
needs of life. I had an opportunity to show her
my gratitude for it all during a severe illness
of hers, when I acted not only as her nurse, but
also as her physician, as she was not willing to
see a doctor. She frequently gave me proof of
the fact that when one has not received certain
ideas in youth it is impossible to comprehend
some of the simplest things. I would alter my
phrases in every possible way in order to enable
her to understand what I meant,—among other
things respect for opinion, etc. She remained
with me until I was removed to Paris, and
was never annoying to me. This was a great
blessing, since our companionship was enforced.
I soon began to pay visits among our colony,
which was composed of very incongruous material.
There were priests, nobles, nuns,
magistrates, soldiers, merchants, and a large
number of what were called 'sans-culottes,'
from all parts of the country, and who were
excellent people. I had near me a mail-carrier,
a barmaid, and other domestics, whom I highly
esteemed. They had become greatly attached
to a venerable curate from Beauvais who lodged
with them. They called him their father, rendered
him many services, and took perfect care
of him during a serious illness which he had
while in prison. I first learned something of
the character and habits of our companions, and
which of them seemed most honest. They told
me that we had among us samples of all sorts
of persons and opinions. There were priests,
real confessors of Jesus Christ, to be revered
on account of their patience and their charity,
others who had renounced their profession, and
declared from the pulpit that they had formerly
only uttered fables. One of these unprincipled
priests, a man still very young, who had served
in a regiment, often said that he did not know
why he was kept in prison, for on every occasion
since the Revolution he had done whatever
he had been desired to do. When civic festivals
were given in the village of Chantilly he
had been the composer of couplets. He wore
habitually the national uniform. We had two
abbesses,—the abbess of the Parc-aux-Dames and
the abbess of Royal-Lieu, Madame de Soulanges,
who was nearly eighty years old, and had
been under-governess to Madame Louise at
Fontevrault, and was tenderly beloved by her.
During her sojourns in Compèigne the princess
used to go to see her every day. (Madame
Louise, daughter of Louis XV., a Carmelite at
St. Denis, had been brought up at the abbey
of Fontevrault, together with Madame Victoire
and Madame Sophie.)
I discovered, soon after my arrival at Chantilly
that loss of liberty unites neither minds nor
hearts, and that people are the same in prison
as in the world at large,—jealous, intriguing,
false; for there were among us many spies,—an
epithet, however, which was often lightly bestowed.
I endeavoured to be polite to every
one, and intimate only with a very small circle.
I made some visits every day, and received
visitors after dinner, during which time I also
worked. Sometimes some patriots whom I
recognized quite well, pretended to be aristocrats,
so as to make me talk; it was without
doubt the most disagreeable part of the day.
The time passed without great weariness, for I
filled it up with prayer and reading, and a little
walking in a courtyard, walled on four sides, and
very dreary looking. At first we were able to
go to the grating and talk with persons outside;
but it was not desired that we should do this,
and to prevent it planks were placed over the
grating. These concealed the outer view and
made communication impossible. On the third
story there were terraces on the leads, upon
which all our windows opened; and these windows,
in several instances, also served as doors;
only one person could pass through them at a
time. It was really a comical sight, this file of
prisoners, dressed in all sorts of costumes, and
going around and around like a panorama. We
were frequently obliged to stop on account of
the great number of promenaders. Mademoiselle
de Pons, who played on the piano, accompanied
on the violin by Monsieur de Corberon
(an officer of the French Guards, who was
afterwards guillotined), entertained us most
agreeably; she occupied one of the apartments
of which I have just spoken. The view from it
was very pleasant,—the most beautiful rippling
waters, numerous villages, a superb forest,
fine buildings belonging to the château, and a
green lawn most charming to look upon. I
thoroughly examined every portion of our
prison. Several of the large rooms had been
divided by plank partitions which were only six
or seven feet high. Those who occupied these
compartments during the winter suffered excessively
from cold. In the rooms which were not so
divided there were put as many as twenty-five
persons. I noticed the arrangement of one
of these communities, in which the curtain-less
beds were placed so close together that during
the day the prisoners, in order to move around,
were obliged to pile them up on top of one another.
Here is a list of the individuals occupying
this room: A republican general and his
wife, a curate from Noyon, twenty-seven years
old, several young men, two estimable mothers of
families, with five or six daughters from fourteen
to twenty years. In another there were a
soldier with two or three nuns. The one next
to mine contained a general, called Monsieur
de Coincy, eighty-three years old, who still
retained his strength, his wife, his son, his
daughter, a nun of the Visitation, and Mesdemoiselles
de Grammont-Caderousse, the eldest
of whom was about fourteen. A special annoyance
in our prison was the mingling of the sexes
in the same lodging. I was the more thankful
for my little cell. Marchand, the commissioner
of the Revolutionary army, came to make
me a visit; he found nothing to complain of in
the furnishing of my apartment, which was composed
of a servant's bed, two chairs, and a table.
The beds and the trunks served as seats when
the company was too numerous. Generally
luxury was an offence to him. I told him he
could find no fault with mine. I was mistaken;
he answered that I as well as my parents had
once had too much of it. He went from one
end to the other of the place, and took it into
his head, in order to annoy those ladies who
seemed somewhat careful of their toilets, to
order them to have their hair cut off; and he also
sent sans-culottesto sleep in their rooms.
These poor fellows were as much worried at this
as those who were compelled to submit to it.
They used to come as late as they possibly could
and go away very early in the morning. They
were very well behaved, with the exception of
a cobbler from Compiègne, of whom his hosts
complained bitterly; he was ill-tempered and
annoying. One of his comrades, probably
better reared, came near dying of colic through
his politeness in not wishing to awaken those
with whom he was forced to lodge.
Care had been taken, in order to avoid too
active a correspondence between the prisoners and
outsiders, to send those who were inhabitants
of the district of Senlis to the abbey of
St. Paul at Beauvais, and those of Beauvais,
to Chantilly. We could not write even to our
parents, nor could we receive news from them
without a great deal of trouble. Of all the
privations we were forced to undergo, this was
the hardest to bear. While Notté was at the
head of the house, the prisoners continually
complained of him, though our situation was
endurable. The wretched are naturally fault-finding.
I assured them that if he went away it would
be worse for us; and so it actually happened.
This man was passionate but not wicked. I
had found out that one should never ask him
anything in the presence of other persons, because
he feared lest they might be indiscreet;
but in private he was quite accommodating. I
never had any reason to complain of him. By
one of the strange chances of the Revolution, he
is now in want, and at the very time when I
am writing this memoir, is soliciting my protection,
which I would willingly grant him if it
were better worth having.
I was generally strictly obedient to the rules
of the household, and consequently had to endure
fewer annoyances than those who strove
to evade them. It is true that they changed so
frequently that it was difficult to keep the run
of them.
We were guarded at first by the gendarmerie,
afterward by the National Guard of Chantilly.
I was informed of this by a carpenter who, while
doing some work in my room, told me he was
now our military commander. I found it necessary
to ask his permission to do something the
next day, and I did so in such a serious manner
that Madame Séguier, who was present, could
not help laughing.
The Revolutionary army succeeded the National
Guard, and made its entrance into the
house in a manner suitable to the functions with
which it was charged. At ten o'clock in the evening
we learned that there were cannon pointed
toward the château, and at the same moment
we heard the grating open amid songs which
sounded more like rage than joy. The van-guard
was preceded by cannon, drums, and torches.
Women mingled with the procession. The refrain
of 'Ça ira, les aristocrates à la lanterne!'
was repeated with stubborn animosity. My
neighbours were seized with terror, and rushed
trembling into my apartment. I reassured them
as well as I could without knowing why, except
that the feeling of fear is one to which I do not
readily yield.
When the troop had finished its dances and
songs in the courtyard, and gone through a sort
of march, it placed its sentinels and retired.
I had the full benefit of the performance, as my
windows opened on the courtyard.
I cannot now remember the exact time, but a
few days after the scene I have just described
took place, several prisoners were sent to
the prisons at Paris, among them Monsieur de
Vernon, Master of Horse to the king, who
had gout in his hands, but on whom they put
handcuffs. A curate named Daniel was sent off
with him. They were taken to the prison of
the Carmelites on the Rue de Vaugirard. A
party of thirty persons followed them immediately.
Madame de Pontevès seeing them carrying
off her husband, asked a commissioner named
Martin for permission to go with him. He
answered her roughly, granted her request, and
then separated them when they reached Paris.
One of them was put in the Madelonnettes,
and the other in Ste. Pélagie. In order
to fill the prisons of Paris it was sometimes
necessary to draw recruits from the
neighbouring prisons; for this purpose different
pretexts were made. Evil designs were imputed
to the prisoners,—such as anti-revolutionary
projects; for instance, one was called an
agitator if he spoke to the keeper or to the
commissioner in order to make known his wants.
When any one came to inspect us I kept in the
background. I was obliged, however, to appear
before Martin, the commissioner extraordinary,
who was accompanied by a man with a red cap,
and had a roll-call of all the
prisoners. He only asked me my name. A
sort of officer who was with them said that he
had dined once at the house of Monsieur de
Duras, at Bordeaux, and had been very well
entertained. I did not continue the conversation.
Some of the prisoners pleaded their
causes, and petitioned to be allowed to go free.
I withdrew as soon as I possibly could.
Monsieur de Saint-Souplet, the king's esquire,
who was constantly worrying about getting
the news, was taken away, arraigned before
the Revolutionary tribunal, and perished on the
scaffold with his father, who was eighty years
old, and one of his brothers. He was denounced
by one of his servants; but the latter
was guillotined with him for not having betrayed
his master sooner. We now began to hear of
a great many executions; that of Madame de
Larochefoucauld-Durtal caused me intense sorrow,
and also made me extremely anxious for
the future. She was a widow of thirty years,
lived a most retired life, caring for her parents,
and occupied solely with their happiness and
with works of charity. She was carried off from
the Anglaises, where she had been imprisoned
with her mother, who was very old
and extremely infirm. She was taken before
the Revolutionary tribunal as a witness for her
uncle, Monsieur de l'Aigle, whose mind was
affected. He compromised her in consequence
of his weakness of mind, and the address of a
letter which did not belong to her was made
a pretext to remove her from the position of
witness to that of criminal. Sentence was
passed at once upon her. As something was
the matter with the guillotine that day, she
spent twenty-four hours in the record-office
awaiting her execution; during this time she
lovingly and zealously exhorted her uncle to
meet death bravely. She assured him many
times that she forgave him for being the cause
of her own death; and after having somewhat
aroused his senses, she showed him how to
die resignedly.
I could not understand how it was that the
prisoners who were every day hearing sad news
should feel the need of being amused. They
assembled to play with high stakes, have music,
dance, etc. A Monsieur Leloir, an architect
from Paris, and quite facetious, was the leader
of all the amusements. I was constantly invited
to join them, but always refused.
Notté was sent away from the place, and a
grocer from Chantilly, named Vion, became
our keeper. This was the golden age of our
house. Leloir had influence over him, and as
he was one of the prisoners, we reaped the
benefit of it; but the commissioners of the
Revolutionary committees of the neighbouring
villages, the greater part of whom were employed
about us, were able to persecute us.
In fact, any one could do so who chose to take
the trouble. I will give an example of this
which is ludicrous enough: A man named Bizoti,
employed as a wagoner, had the curiosity
to pay us a visit, and took real pleasure
in abusing all the priests. There was an old maid
from Vandeuil, once fond of the chase, who
was in the habit of wearing a costume somewhat
masculine, composed of a man's hat and
a dressing-gown. The wagoner-citizen said to
her: 'I know you; you are a curate;' and then
he addressed to her the same abusive language
he had used to the priests. Loud bursts of
laughter followed this. I sometimes went to
see this spinster, who was very original.
I was very fond of the family of Monsieur de
Boury, a captain of the French Guards, who
had a wife and ten children. They are examples
of every virtue; the father is truly religious,
honourable, and well instructed; the wife is
sweet and good. The harmony that pervades
their life recalls that of the old Patriarchs.
They were entirely resigned to the decrees of
Providence, and preached to us by their example.
A number of pious prisoners used to gather in
their apartment for prayer and edifying reading.
In all the house it was the spot I enjoyed most.
It seemed to me that there one breathed purer
air than anywhere else.
My chief amusement was to watch from
my window the young people of fourteen or
fifteen, who played foot-ball in the courtyard,
forgetful of their captivity, and never
dreaming that execution could await them.
Alas! The Terror laid hold on one of them.
Young Goussainville, only fifteen years old,
was beheaded with his father. Several of the
prisoners had brought their children with them,
even nursing babies. (Madame de Maupeou
was nursing one.) These children were of all
ages; I could never understand how any one
dared bring them into houses so full of dangers,
to say nothing of the bad air. The laws now
forbid persons to be received among the prisoners
who desire to be there for the purpose of
caring for those they love, which is very wise.
We had at Chantilly several examples of that
sort of devotion. The spirit of everything
there was, in general, better than in the prison
where I have since been.
Our keepers took a notion to put us at a
common table, and this custom was afterward
elegantly called 'eating in mess.' At first,
during our sojourn at Chantilly, we were fed
by eating-house keepers, established at the
château. The keeper Désignon was one of
the number. He served, beyond comparison,
the worst fare to his customers; but I took it
from motives of policy, knowing that he had
more consideration for those whose food he
furnished. He never failed in respect to me.
Although he was only the subaltern of the
commissioner, he arrogated the right to abuse
those of the prisoners who asked to change
their lodgings or to be less crowded together in
the rooms they were occupying. The new arrangement
was a calamity for him, since he had
contracted with the government to supply all
those who could not pay for their own food,
and of these there was a large number.
A table was set in the gilded gallery of the
Petit Château, [3]without a cloth, and with two
hundred covers. The tables were reset three
times, for there were many more than six hundred
prisoners in the house; but the old and
infirm were allowed to remain in their apartments.
One of the tables was occupied by
priests and unmarried men, the second by
married people and children, the third by those
who were alone; and this was my situation.
The places were all numbered, and each of us
had a duplicate number. When the bell rang,
we came like children going to school, with
baskets, in which were our plates, goblets, etc.
Often the previous dinner was not over, and
we had to stand a long time in groups in the
drawing-room, which was next the gallery.
We ate soup, which was only water with a
few lentils such as are fed to horses, grass for
spinach, sprouted potatoes, and a perfectly
disgusting stew called ratatouille. I suppose
that this word is not in the dictionary of the
Academy, and that the Institute is not likely to
put it there. We rose from the table hungry.
There was a very hearty young man to whom
we used to send all that was left at our
table, in order to appease his hunger in some
degree.
The members of the Revolutionary committee,
with the officers of our guard, marched around
our table with their red caps on their heads.
There was one of them—the peruke-maker for
the whole company—who watched us closely,
to see if any one abstained from meat. Under
such circumstances it was not easy to keep
Lent. Many persons, however, did keep it
strictly, although the grand vicars of the diocese
had exempted three days.
Our tables were surrounded by sentinels of
the Revolutionary army. I sometimes conversed
with them. I found one among them
to whom his service was extremely disagreeable.
He was a servant whom want had
compelled to take such a wretched position.
He pitied us, and would willingly have afforded
some alleviation of our terrible condition. One
of the guards' duties was to accompany, with
drawn sabres, the washerwomen when they
came to bring and carry away our linen. This
performance was truly humiliating, and I made
some effort to avoid its most embarrassing
details.
One day a commissioner delivered a most
atrocious reproof to the keeper. He told
him that there did not enough prisoners die
in the house. In fact, through lack of care,
the bad food, and the incapacity of the health
officers, a great many would have died; but
Providence protected them, and their constitutions
held out much better than could have
been expected.
One day as we were dining in the gallery of
the Petit Château, I recalled the beautiful
pictures which formerly adorned it, the armour
of the great Condé, pierced with bullets, his
victories represented by the great painters, all
the festivals I had attended in that place; but
happily these ideas came to me rarely. I generally
had there very commonplace thoughts;
those which concerned my bill of fare,—such
as the endeavour to introduce into it, by means of
bribery, a pound of butter or a few eggs,—absorbed
me. In this connection I had a very amusing
encounter with our new commissioner, named Perdrix.
This man had a grotesque figure, and wore a costume
not less so. His former profession had been to paint
the dogs of Monsieur the Prince of Condé.
He probably imagined it would add to his
dignity to be more severe than his predecessors.
We were allowed to speak to him only through
an opening made in the wall. I one day presented
myself at this strange parlour to ask him
to allow me to have six pounds of chocolate
which he had held back; he replied with dignity
that he would allow me exactly as much of it
as was good for my stomach. I assured him that
in order to have the dose exact the only way
was to have me breakfast every morning with the
surgeon, and said moreover, that I wanted to
give it to a sick man. He did not grant my
request, and I went away somewhat angry at
not being able to obtain the nourishment
which kept up my strength. My charwoman,
who fortunately was also his, brought
back to me the full supply the next day.
The parties sent off increased in number to
an alarming degree. Each day when one went
off we were filled with consternation. Husbands
were separated from their wives, mothers from
their children; and those who had no interests
so dear had to regret some one of their
companions. We did not know where they
were taken, nor what took place in the prisons
at Paris. For my part, I imagined them to be
still worse than ours; and I was quite right, in
spite of the continual vexations, hunger, and
daily anxieties which we experienced.
One evening as I was taking a walk on the
terraces in the delightful moonlight, which
gleamed over the forest and made the waters
sparkle, my ears delighted by the rippling
sound, my eyes taking in all the beauty which
surrounded me, I congratulated myself upon
being, after all, less unfortunate than a great
many persons whom I loved and respected.
The wretched situation of my parents came
over me at that moment so terribly that I shed
tears. I scarcely ever received news from
them, or from any of the friends who were dear
to me.
Eatables were forbidden to be brought to us,
lest letters should be concealed in them; and
this reduced us sometimes to the necessity of
eating soup made of salt and water only.
The Revolutionary guard took it into their
heads to go on patrol from ten to eleven o'clock
in the evening. They put out the lights, and
made the prisoners go to bed. One day the
soldiers came with drawn sabres into the apartment
of Madame de Boursonne (former lady-in-waiting
to Mesdames), who was very ill from
hemorrhage, and had a constant fever. They
went up to her bed, examined her closely,
and said aloud 'that they would not have the
trouble of visiting her long.' She came near
dying after they went out. These kind fellow-citizens
frequently had the goodness to forget to
come to see me, because they knew that my
cell was somewhat apart from the others.
Suddenly a party of forty prisoners were set
at liberty in accordance with a command from
their communes, under a law which granted the
communes this right. There was general rejoicing
among those who departed, and sweet
hope for those who remained; but it was seen
that by this means the prisons would be emptied,
and the law was repealed. I was glad to take
leave of two good Sisters of Charity from
Noyon, thinking of all they would do for the
poor whom they cared for so tenderly; but
scarcely had a few prisoners been set at liberty
when a larger number came to replace them.
The districts of Beauvais, Noyon, Senlis, and
Compiègne were most zealous in gathering recruits.
We never had any vacancies. One day
I met an old nun whom I did not know, bent with
age and infirmities, who seemed to be suffering
terrible pain in the side of her face. One of
her companions told me that as she was getting
into the wagon which brought her to Chantilly
she made the sign of the cross; and one of the
soldiers of the escort was so indignant that he
gave her a frightful blow on her cheek which
broke several of her teeth. How horrible! I
took great pleasure in visiting these holy virgins,
who were inconsolable at being compelled to
leave their retreats where peace and innocence
reigned. In order to console them for this,
they were lodged so close to the coarsest men
in the house that they constantly heard things
said which made them very unhappy. They
endured their strange and terrible situation with
perfect resignation, and never failed to read
their office as though they were in their
convent.
My companions in misfortune differed very
much; there were some who, in the hope of
obtaining their liberty, undertook the rôle
of informer. Several of them tried to sound me;
they were not rewarded for their trouble.
When they told me tales I would not listen, but
immediately changed the conversation.
One thing which astonishes me as I look back is
how little I suffered from ennuiduring
my captivity. My thoughts were confined
within a very narrow sphere. They dwelt upon
my regret at being separated from those I
loved and upon the needs of my daily life. The
want of exercise, which is absolutely necessary
to me from habits contracted in my childhood,
gave me too great fulness of blood. I
had violent rushes of blood to the head, and
also rheumatism. Once on awakening I felt so
stunned that I called the hospital nurse, who
lodged near me. She thought I was dying, and
went for help. This condition, which was
really dangerous, was relieved by vomiting. I
fell asleep; and when I woke I found myself
surrounded by kind people, to whom I acknowledged
my gratitude, and then burst into tears.
They did not know what to make of it. I
excused myself, and explained to them that
once several years before I had had a similar
attack, when I was surrounded by friends and
relatives, and now I was terribly alone. I regained
my composure, and then went out into
the air.
The weak condition to which I was reduced
made me unable to restrain the feelings and
emotions which these sad memories aroused,
though generally I have an aversion to speaking
of what grieves me. The health officer of the
prison was sent for; he was a violent revolutionist,
small, very dark, uneducated, and
dressed in a carmagnole, the uniform of the sans-culottes. Being difficult to bleed, I
dared not have him bleed me, although I was in
great need of it. He put leeches on my neck,
which eased the pains in my head.
Very disturbing news reached us from Paris,
and those were the only tidings which could
come to us. It was reported that we were to
be interrogated by means of blanks, which must
be filled up. I had a great dread of this kind
of torture on account of my love of truth, which
might compromise both myself and others.
Heaven did not allow them to realize this base
project.
One of the prisoners died from the mistaken
treatment of that imbecile surgeon, who, without
asking him if he had hernia, gave him an emetic,
which caused his death in twenty-four hours.
The treatment of the sick was terrible; no
medicine was given them, no one was appointed
to nurse them, and even the prisoners
were forbidden to show them any attention. I
once saw five cases of putrid fever in one room.
A respectable girl from Crépy, who stayed in
the apartment, was obliged to spend every night
waiting on the patients. A good schoolmaster,
who also was in the room, helped her as well as
he could. I have seen him since, with great
pleasure, and I entertain a real esteem for him.
Madame de Boursonne, who had recovered from her
illness, and from the visit of the revolutionists,
heard that Monsieur d'Ecquevilly, her
father, was dying at Amiens. One may imagine
her great desire to go to him and hear his
last words; but an insurmountable barrier was
placed between us and those dear to us. She
could only hope to hear frequently from him,
being very near him; but our keeper, Perdrix,
refused even this, and kept all letters addressed
to her. After a fortnight of terrible suspense
had passed, he sent for her to come to him;
this was for the purpose of reading to her, in the
presence of every one, the letter announcing the
death of her father, without even allowing her
to have it, which at least would have given her
the consolation of learning the details. Poor
Madame de Boursonne was in a terrible state.
I did everything in my power for her, and took
her back to her own room.
One day as I was sitting alone in my chamber
some officers of our guard came in with Monsieur
Lambert, the Commissioner of War. The dread
of something frightful was the first thing that
flashed across my mind; but I was mistaken
in my fear. This Monsieur Lambert, to whom I
had rendered services under the old régime, had
expressed a desire to see the place and my little
cell. I made no sign of recognition because of
the fear I had always had since the Revolution
of compromising those who wished me well.
When the officers were going out he let them
pass before him, and said to me that if I had
need of his services and wished to send off any
letters he would take charge of them, and would
be delighted to do me any kindness. I cannot
tell how touched I was by this proposition, which,
however, I was unwilling to accept. During
the Reign of Terror the slightest kindness offered
to persons of our rank was so dangerous that I
still feel grateful to him for his good will.
Perdrix did not spoil us. Several of us asked
him for a copy of our entry in the jail-book; this
seemed a small favour, but we could not obtain it.
The clerk of the commune of Chantilly came
quite frequently to the château, in order to
give certificates of residence. He showed a
sort of interest in the prisoners. Whenever
they were not harshly treated it was on account
of the natural amiability of individuals. Monsieur
Wallon, of Beauvais, having confidence in
the clerk, commissioned him to procure some
money for him; he accepted the commission
graciously, and disappeared. I never should have
imagined it necessary to have one's residence
in a prison certified. It seemed to me
that to make a list of those who were there
would have been sufficient; but it turned out
very well for me that I took the precaution I
thought superfluous, as I was inscribed upon the
list of émigrésduring my imprisonment.
I was not pleased at the reception given a fat
curate from Noyon who had apostatized, and
had denounced and caused to be imprisoned a
good many of our fellow-prisoners. He was
hooted at from the head of any stairway he attempted
to ascend; and the crowd pushed him
back, and used syringes upon him. I was very
sorry to see a man so lost to principle among
us; but I should have preferred not to see any
unfortunate being insulted. Any one is unfortunate
who has lost his liberty; and those who are
wicked are the most to be pitied under such
circumstances. I was sorry also for those who,
instead of thinking of more serious things, fed
themselves with vain hopes concerning the future,
and the possibility of shaking off their fetters.
I grew accustomed to living at Chantilly, and my
companions in misfortune treated me with great
kindness. Madame de Séguier and Mademoiselle
le Caron de Troupure, now Madame Flomond,
both amiable and excellent women, were a great
comfort to me. I tried to help those who needed
courage. The Coincy family, who lodged near me,
were good company. I had great consolation from
a religious point of view. A venerable priest
undertook to confess me, and even to give me the
communion. He had had the courage to bring a large
supply of consecrated wafers, and had kept them
in spite of the danger he ran should the fact
have been discovered.
I was quite content with my fate, since I was
compelled to endure a hard one. I could not
have asked to be in a better prison; Providence
had placed me there, and six months sojourn
had accustomed me to it.
Toward the end of March, 1794, I received
a letter from my mother, full of kindness, but
which grieved me very much. She told me that
she had thought it astonishing that I made no
application to the government commissioners
who came to Chantilly, to be allowed to join
her. This intimation seemed to be an order
and a command of Providence which altered my
destiny. I immediately inquired when Citizen
Martin, who inspected our house, was to come.
I presented him a petition, asking to be sent
to the Luxembourg by the first train destined
for Paris. He assented, and then occupied
himself in getting ready a most atrocious party,
composed of young girls who were torn from
the arms of their mothers without knowing for
what they were destined.
Many persons believed, and it was really
talked of, that the intentions of the Terrorists
was to marry them to sans-culottes. To this
party were added some priests, women, laymen,
etc. The unhappy mothers were in despair. I
was a witness of the scene with Madame de
Pons (formerly Vicomtesse) at Perdrix's apartments.
She fell on her knees before him and
before Martin; she said everything to them
that the desperation of such a moment could
suggest, using the most touching expressions;
they would listen to nothing. She fell fainting at
their feet. After she recovered her consciousness,
she implored to be permitted at least to follow
her daughter; they refused her.
I forgot to say that a moment before Madame
de Pons came to see Perdrix the latter had sent
for her daughter, and in the presence of Martin
and two gendarmes said to her,
'What is your name?'
'Pons.'
'You should speak to my mother; I will go
for her.'
'No, no; I ask you for your names.'
'There they are. May I know what use you
have for them?'
'You will leave here with other prisoners
to-morrow, to go to another prison.'
'Without mamma! O God! What will be
my fate?'
'Go, or I will have you carried out.'
Madame de Pons wrote several letters to
Martin, asking only for a delay; she offered
all her property to the Republic; and the
only answer she received was, 'Your daughter
must go!'
I busied myself in arranging my trunks and
packing them for the Luxembourg, so as to have
with me only what was strictly necessary. On
the 3d of April, 1794, we were told to hold
ourselves in readiness to leave the next day or
the day following, as the carriages were expected.
My travelling companions were in despair at
leaving their parents, but I delighted at going
to see mine once more; every one said pleasant
things to me. I received many testimonials
of interest and regret from the prisoners.
There were some from whom I was grieved to part,
and a secret presentiment (though generally
I do not believe in them) seemed to warn
me that the reunion with my parents would
never be effected. The days of the 3d and
4th were passed in leave-taking. I did not
know that the train was to start early on the
5th, the anniversary of the birth of my son. I
was summoned at ten o'clock in the morning.
I found the wagons almost full; consequently I
had a wretched seat next a vile woman who
boasted of being a friend of Robespierre, and
told us that she would receive on the way some
marks of public interest. She sat almost half
on top of me; and to add to our suffering, the
straw which is usually put in the bottom of the
carts for calves, was left out. When we left,
the courtyard was filled with our companions
in misery, who were mourning and sighing over
our fate. They concealed their tears, fearing
to let them be seen.
Our procession stopped as it passed out of
the gate, in order to have the roll-call, lest
some prisoner should have escaped; we were
as accustomed to it as the soldiers were. We
were surrounded by the National Guard, and
remained an hour under the windows of the
château, in sight of mothers disconsolate at the
removal of their daughters, and who, with their
hands raised to heaven, were giving them their
blessings. That sad sight is still distinctly
before me. How many of those who gave those
blessings and of those who looked on were
sacrificed on the scaffold! I should like to be
able to depict and describe fully all that
terrible and touching scene, but I cannot. As
for me I was terribly overcome, but I struggled
to hide it.
The train was put in command of a printer's
apprentice from Beauvais, who went ahead of
us. The first cart was filled with young
girls, the second with women, and three others
with men. The vehicles were surrounded by
musketeers. We started at eleven o'clock in
the morning, in very bad weather. A terribly
cold wind was blowing, and there were no
covers to our wagons.
At the entrances of towns and villages our
escort was gathered together, and we entered
with dignity, drums beating.
In some places, particularly at Creil-sur-Oise,
gestures indicating the cutting off of the head
were made to us. In a village called La Mortaye
a dozen persons suddenly appeared, who came to
see my heavy neighbour, and whispered to her
that she would not be much longer in prison.
When we reached Mesnil-Aubry we were made to
get out at an inn,—that is, the women and
young girls at one, and the men at another. It
was Saturday. I obtained the favour of an
omelette. Immediately after dinner it was
demanded of us that we should pay on the spot
the expenses of our removal; I refused to do this,
saying truly that I had no money. Mademoiselle
de Pons obeyed, and gave a hundred and
ninety-two francs. The women whose husbands
were in the train asked permission to go to
see them while the horses were resting, but
could not obtain it. The notorious Martin, of
whom I have already had occasion to speak several
times, came to inspect us, and placed himself at
the head of our train when it started off. He
was in a gilded berline, drawn by post horses,
and seated in front was a small clerk, about
twelve years old. I said to myself, 'Unfortunate
child, what an education this Terrorism
is!' Along the way he reviewed us as though
he were a superior officer, going from end to
end of our melancholy column, to see if it was
coming up in order. Sometimes our horses
began to trot, and we were terribly jolted.
As we were approaching Paris, my side, which
was pressed against the wagon, with nothing
between, began to hurt me very much. My
love of books, and the fear of being without
them, had caused me to fill two pairs of pockets
with them, and they thumped against me. If
we had been obliged to go any farther I should
have been compelled to change my position, but
I could not make up my mind to ask any favour
of the friend of Robespierre.
The train stopped about eight o'clock in the
evening at St. Denis. Martin left us. The
officer of the guard separated the men from the
women, in order to take the former to the
Luxembourg. It began to rain, and continued
until we reached Paris. Our conductors did not
know the streets. We implored them to tell us
where we were going; their reply was that they
knew nothing about it. After driving us around
until eleven o'clock in the darkness, they came
to the gates of the Madelonnettes. We had
great difficulty in making the porter hear, and he
said that no women were received in that house,
that Ste. Pélagie, which was set apart for them,
was quite full, but that we would find room in
the Plessis, an old college of the University,
Rue St. Jacques, next to that of Louis-le-Grand.
Our guards, who were but human,
were overcome with fatigue, and impatient to
put us down in some prison or other. I saw that
we were taking the way to the Conciergerie;
then frightful thoughts rushed over me, and also
a suspicion that our end was near at hand if we
were to be confined there. But we passed by
without stopping, and I felt more tranquil the
remainder of the way.
The gate of the Collège du Plessis was the
end of our journey. Our conductor knocked
there a long time without attracting any notice;
perhaps no one heard, or perhaps the porter did
not wish to be aroused. It was one o'clock. At
last in the darkness the gates were opened;
we did not know where we were. I feared lest
the cart in which the young girls were had been
separated from the train. I perceived it as we were
entering the courtyard, and had a sad satisfaction
in seeing them again even in so wretched
a place. We passed under an archway and stopped.
Our guards were kind enough to assist
us to descend from our rude vehicles; we should
scarcely have had strength to do so without their
help, weary and bruised as we were from our
fourteen hours' journey.
The first object to attract my attention was a
man dressed in a sort of dressing-gown, who
said he was the porter. He had an enormous
bunch of keys hanging from his belt, and carried
a lantern, by the light of which I saw gratings,
enormous bars of iron, heaps of stone and other
materials,—in short, the general appearance
of a prison which was being enlarged.
We were taken through several gratings, and were
immediately surrounded by drunken jailers,—great
heavily built men, half naked, with their
sleeves rolled up, and red caps on their heads,
and whose speech was suited to their
costumes. I trembled at the sight of these
creatures, who seemed to wish to be familiar
with our young girls. I immediately proposed
to the ladies who came with me that we should
each take one of them under our care, so as to
protect them against this vulgar herd. They
agreed to my proposition. Mademoiselle de
Pons, who has since married Monsieur de Tourzel,
fell to my charge. I warned her not to get
behind me, but to hold on to my dress, and not
leave me for a moment. One of the jailers, who
was a regular Goliath, began to read the list of
those who composed our train, and could scarcely
decipher it. Detention in the gate-house being
impossible, he conducted us to a large hall
where there was not a single pane of glass in
the windows, and only wooden benches to sit
on. We were suffering terribly from thirst; the
worst of the jailers, named Baptiste, brought
us a bucket of water, which we hailed with
intense delight. A moment after he brought
another for other purposes. The visit of this
man, Baptiste, was accompanied by speeches
such as we had never before heard, and which
filled me with horror, particularly on account of
our young friends. About two o'clock in the
morning our keeper appeared; he had been absent
when we arrived. His name was Haly;
his face was pale and livid. He smiled as he
saw the young girls, and said to them, 'My children,
you have not yet been entered in the jail-book.
I keep you here only for humanity's sake. This
house is at the disposal of the public accuser,
Fouquier-Tinville, and is only destined
for the anti-revolutionists; you do not seem to
be such. To-morrow your report will be made
out, and I will inform you of your destination.'
Every one tried to speak to him. I had my
turn, and told him that as I had never been
denounced I was only to be classed among the
suspected; that I ought not to be kept in his
prison; and that I had left Chantilly in order to
be transferred to the Luxembourg. I implored
him to have me sent there. Several persons
told him he had no right to keep us; he paid
no attention to what they said, and had the
mattresses, which had been brought in the wagons,
brought in. I had not taken the precaution to
bring one, and consequently passed the night
seated on a small wooden bench, occupied in
trying to conceal the small amount of paper
money I had with me. I did not sleep a moment;
neither did my companions. As the day dawned
I saw with delight that our young girls were
sleeping sweetly and peacefully. I said to myself,
'At their age one has had neither the experience
of misfortune nor the anxiety born of
foresight.' The thought of seeing my parents
during the day cheered my sad heart. It was
extremely cold. Baptiste came in, accompanied
by several of his comrades, who regarded
us with a ferocious sort of pleasure, judging
that we were good recruits for their house, and
that they would have a good share of our purses.
One of them, a former lackey of Madame de
Narbonne, recognized me, and behaved very
properly toward me. A gendarme, whose name
I never learned, came up to me and whispered
in my ear, 'Hide your money and your jewels.
They will leave you only fifty francs in paper
money, and will take away your knives and
your scissors.' I thanked him, and he retired.
Although the great mental agony we endured
caused us to pay but little heed to our physical
needs, we nevertheless became extremely hungry.
We had taken nothing to eat since the
day before, and had endured excessive physical
and mental fatigue. We petitioned our jailers
for food, and after keeping us waiting two hours
they brought us some coffee and chocolate. I
breakfasted with the pleasant feeling of alleviating
suffering for a moment at least. Martin
came in afterward to get a cloak which had
been lent to Madame de Vassy; he looked at us
sternly. Several went up to him to ask something
of him, among them the young girls, who
were extremely anxious to let their mothers
know what had become of them. They gave
him some notes for this purpose, but these
never reached their destination.
I implored the said Martin (I may speak of
him in this way under the circumstances) to send
me to the Luxembourg; he gave me some hope,
but I regarded it as slender. His visit was soon
over. Up to this time the National Guard of
Chantilly had remained with us; it was now
replaced by jailers who never left us. A new
face appeared; it was an inspector named
Grandpré, who had quite a pleasing countenance.
Being astonished at seeing us in this prison,
and a little touched by our forlorn situation,
he promised to endeavour to have us transferred
to a house for suspected persons, and me in
particular to the Luxembourg. Haly, our keeper,
now came in, and said that our fate had been
decided,—that we were entered on the
jail-book as agitators and as refractory to
discipline at the house at Chantilly. A cry of
surprise and grief arose, but our keeper was
deaf to all complaints. My companions deserved
such terms as little as I did; and I declare
that after my conduct there, submitting as I
did to all the wishes of the commissioners,
meddling with nothing, complaining of nothing,
being taken to Paris at my own request, I was
more completely astonished than I can express.
The false accusations were certainly the least
of my woes,—innocence easily consoles itself;
but to see myself deprived of the delight of
rejoining my parents made my heart ache, and
all the more because I was very sure that they
would fully share my sorrow.
We were obliged to resign ourselves to remaining
under the immediate rule of Fouquier-Tinville,
shut up with those directly accused, and
consequently treated more severely than the
suspected. We remained fifteen hours in that
hall, into which we had been thrown rather than
conducted. If we went out for necessary purposes
we were escorted by two musketeers; most of
us preferred to suffer rather than take
such a promenade. The day wore away; we saw
a movement among our jailers. Following the
example of one of my pious companions, I had
got into a corner of the hall to recite my mass
and office. It was Passion Sunday; following
the example of our divine Master we forgave
insult, and tried to imitate his patience.
We were given to understand that we could
write and receive letters, a pleasure of which
we had been deprived at Chantilly. Mademoiselle
de Pons received one letter, which gave us
some little hope. Toward evening a rumour
spread that we were to be searched and put in
lodgings. We sought new means of concealing
our watches and our paper money. The keeper
ordered us to appear before him two by two to
be registered; he then informed us that it was
the custom of the house to turn over to him all
scissors, knives, forks, and watches, because
such things could be used to file away the bars.
Afterward he demanded all our jewels and money
with the exception of fifty francs in assignats.
He had the politeness not to search us,
saying that he would dispense with that out of
respect for us. I gave up to him all he required,
except a few assignatsand a small and
very ugly brass clock, which was precious to me
because it had sounded in my hearing the last
hours of the lives of my dear friends Mesdames
de Chaulnes and de Mailly. The keeper would
not leave it with me, in spite of the sorrow
I assured him I felt in giving it up, alleging
the same reason that he gave when he demanded
the watches. When this agreeable operation was
over we were told to follow the jailers. They
made us mount to the very top of the building,
passing through a grating on each floor,
fastened by enormous bolts and guarded by four
men. We had to go through these two at a time.
At last we reached our own rooms. Mademoiselle
de Pons had not left my side since we
reached Plessis; we took the measure of our
habitation, and found that with some management
we had room enough for two beds, placing the
head of one at the foot of the other. This
sweet girl burst into tears when she saw our poor
little establishment, sat down on a mattress
beside me, and said, 'We shall surely die. It
is impossible to live in such a contracted place.
O God! may none of my friends ever come here!'
I did my best to arouse her courage, which had
quite vanished, and to remove her dislike at
living so intimately with an old woman by assuring
her that I had no disease. Our furniture
consisted of two chairs; our mattresses were on
the floor, and the wall served as our pillow.
Fortunately it was freshly whitened, and
consequently clean. The bolts were fastened,—a
sad moment; for the sound they made told us that
until morning, no matter what happened, it was
impossible for us to receive any assistance.
We were told that a jailer of the guard would
answer if we called; but I heard one of my
neighbours cry all night with pain, and no one
went to help her.
About eight o'clock in the morning the bolts were
drawn and the keeper, Haly, came in, followed
by an enormous dog. This strange man greeted
us as though we were in one of the old-time
châteaux where abundance, peace, and
pleasure reigned. He even seemed astonished
that we were not charmed with the pleasant
lodgings he had given us. After he was gone,
and our companions' bolts were drawn, we eagerly
gathered together, and had no trouble in
finding one another, as the corridor on which we
were lodged was only three feet wide. The
first thing to be done was to arrange about our
meals. It was only after repeated requests that
we received permission to go down six steps to
get water. The jailer who had charge of us, as
well as his comrades, assumed the title of warden,
thinking thus to render their office more
honourable. There were three classes of them,
and almost all were drunkards, selfish, rapacious,
lying, while a few were absolutely ferocious.
We specially noticed one of them, who had taken
part in the massacre of the 2d of September,
1792. This man, who at this time was our despot,
was a sculptor; and I was astonished that
he should have accepted so miserable an employment.
After he had granted us permission to go for
water, the need of having something to eat made
itself felt. The mess-table had not then been
established. I inquired how we could procure
provisions at a moderate price. An eating-house
keeper sent us our dinner; but before he could
reach the floor on which we lodged, which was
the highest in the house, the food he carried
was often taken from him as he passed along on
the other floors. Finding that I could not
possibly live in this way, I sent to learn
whether my dinner could be sent me every day
from my own house. Lucas, my father's former
clerk, was very anxious that this should be done;
but it was very difficult to find any one in the
house who was willing to bring it to me, as it
was considered a dangerous thing to do, and
not very 'civic'. At last an old postilion
named Lerot, whose name I mention with
gratitude, had the courage to undertake it. A
neighbour of the Hôtel Mouchy, said openly in
the street, when she saw him go by, that it was
not worth while taking me anything to eat because
I was going to be guillotined. Two respectable
ladies clubbed together with me, and we divided
our provisions,—they furnishing some
also; and we set about getting them cooked.
Mademoiselle de Pons did not find our fare
good enough, and joined with a woman from
Beauvais, and two young girls.
I enter into minute details which would be
very tiresome if this memoir was intended to be
read by strangers; but it is for my own relatives
that it is written, and I am too sure of the
interest they take in what I have suffered to
omit to mention the least thing.
The rules of our prison were extremely strict.
At eight o'clock in the morning the keepers
opened the doors; this was a truly agreeable
moment,—if I may use such an expression in
such a connection; then they wrote our names
on the registers, but being so little accustomed
to such matters they never made the list as it
should be, and so were obliged to have the roll-call
two or three times a day. One moment
they ordered us to remain inside our rooms, and
another we were told to stand like sentinels at
our doors. The locking up, and ascertaining
that each prisoner was in her place, seemed a
more solemn affair. The keeper, followed by
the turnkeys, gendarmes, and some large dogs,
came about ten o'clock in the evening or at
midnight. This goodly company made pleasing
jokes and a great deal of noise. I always pretended
to be asleep, and made no reply to what
they said. It seemed sad that our sleep, which
alone had the power to cause us to forget our
troubles, should be interrupted by that sound
which most quickly recalled them.
During the first days after our arrival we spent our
time mostly in sending petitions to Fouquier-Tinville,
asking to be reunited to our families.
We have since learned that not one of them
reached him. I eagerly sought for some opportunity
of sending or receiving communications
from my parents. At last I discovered that in
sending some trifling thing to the Luxembourg
I could add two or three lines, which at least
served to say we were alive. The notes were
sent open, and passed through the hands of the
registrars and jailers of Plessis and the Luxembourg.
I suffered intensely at having to inform
my parents that I should not have the consolation
of joining them; they tenderly expressed
their deep regret for this. The sight of their
handwriting, after having been so long deprived
of it, moved me profoundly; I received a few
words from them every two or three days.
The commissioner, Grandpré, fearing lest our
crowded condition should cause sickness, proposed
that we should take the air in the courtyard.
We had a great aversion to going down
a hundred steps, passing six grated iron doors,
preceded, accompanied, and followed by keepers.
We refused to do it for some time. Then
he told us that if we paid no regard to his request
we should be charged with aristocratic
opinions; consequently, we were obliged to
yield, and take the walk. The place appointed
for our promenade was very confined, enclosed
by plank fences, and surrounded by gendarmes,
who kept their eyes upon us. We found there
about twenty women who had come from the
Conciergerie, and who were lodged under us
without our knowing anything about it. After
conversing with them our fears were redoubled;
for they gave us a most fearful account of that
terrible prison, which has been called the
anti-chamber of death. They told us that every day
a large number of victims for the scaffold were
sent from there, and that our house was considered
a sort of annex to the Conciergerie. We
were entirely ignorant of what was going on
outside our cells. Madame de Vassy, a pupil
of J. J. Rousseau, and daughter of Monsieur de
Girardin, had induced a jailer named Launay, the
best of our keepers, to bring her some newspapers;
but this was found out, and was considered
an unpardonable crime. He was taken to
another prison and put in irons, and but for the
death of Robespierre would have perished.
This man, who is still living, actually wept when
he took us out on our compulsory airing, which
rather seemed like leading out a pack of dogs.
Rain or shine we were taken out for the prescribed
time. If some of us wished to go in
sooner than others, we were forbidden to do so,
and we were taken out whenever our keepers
chose. The men who lodged near the stairway
were obliged to retire when we passed in front
of their gratings; but their windows looked out
upon the space where we were allowed, or
rather ordered, to walk, and there they often
recognized their wives and children,—all those
whom they loved, and of whose very existence
they were ignorant.
Only prisoners from Chantilly were now
lodged on our corridor. Among those who
came from the Conciergerie were Mesdames
de Grimaldi and de Bussy, from whom we had a
full account of all the horrors which were being
enacted there. A few days later Madame de
Bussy was carried off, to be indicted by the
Revolutionary tribunal; but her case was not
pressed, and she returned to Plessis. We were
just congratulating her on the subject when she
was sent for again, and led to the scaffold. She
had scarcely gone when the jailers seized upon
all her effects, and tried to sell them to us,—an
incident which shocked us greatly. We repelled
their disgusting proposition with horror.
The condition of affairs grew worse every
day. Parties came to us from all the Departments;
our prison was terribly crowded; the
faces constantly changed. Those who arrived
told us of the death of persons of the highest
reputation. We questioned the keeper, but he
would give no explanation of the vague rumours
which reached us. I implored him once more
to effect my reunion with my parents, but with no
result. He replied to my earnest solicitations
compassionately, 'You do not know what you
are asking; you would certainly not be better
off at the Luxembourg.' He seemed to foresee
the horrors which were to take place there.
Alas! I was not thinking of the strictness of
the prison rule, but of the longings of my own
heart.
A garden was given us for our promenade-ground
instead of the courtyard surrounded by
the plank fence. One day as I was passing
very near the building in which we were living,
accompanied by Mesdemoiselles de Pons and
Titon, I saw them pick up a scrap of paper
which was thrown out of the vent-hole of an
underground apartment, the window of which
they had neglected to close. There were a few
lines written upon it, which were almost illegible,
but which we made out to be, 'Three unfortunate
beings, completely destitute, implore your pity.'
The paper was tied to a string, which was
withdrawn. Mademoiselle de Pons, much moved,
said to her companion, 'Is it possible that we
are surrounded by such miserable beings?' She
asked my permission to throw them some money,
and I granted it. She wrapped it in a tiny
package, and pretended to pick up a stone,
while Mademoiselle Titon let it drop quietly into
the dungeon. We heard a clapping of hands.
The eyes of the young girls filled with tears;
and the evening was passed in the satisfied
feeling that they had been able, for a moment
at least, to render the situation of those
suffering creatures less wretched.
We never learned what became of them.
A month had passed since we left Chantilly
when a party arrived, among whom was Madame
de Pons, to whom I restored the precious
charge which I had been so happy as to keep
for her; I was then left in sole possession of
my room, which I enjoyed very much. I was
informed that it was proposed to separate the
suspected persons from those indicted by the
Revolutionary tribunal, and to place us in a
building facing that we were now occupying.
This change seemed so advantageous to us that
we urged the keeper to carry it out as quickly
as possible. To do him justice, he behaved
very well on this occasion, using his influence
with the terrible Fouquier-Tinville to prevent
our being mistaken for the indicted prisoners,
and to effect our removal without delay. I regretted
for a moment the loss of the beautiful
view from my apartment; all the fine buildings
in Paris were before me,—the cathedral, St.
Sulpice, the Val-de-Grâce, etc. I remembered
that on Easter Day, as I was grieving over the
thought that the holy sacrifice was no longer
offered up in those temples made so venerable
by their antiquity, and the prayers of the faithful,
I joined in the prayers of those whose faith
was strong, and who were sharing my sad
thoughts, and found that I was really more edified
than I had often been on that holy day
when at the foot of the altar.
At last the order came for us to leave our
apartments, and carry our effects with us.
One person was sufficient to assist me in my
moving; a wretched pallet, a straw chair,
and a few dishes composed my only furniture.
The moment of our departure was very
trying to those who remained still under the
power of the public accuser. Several of them
wept when we left them. The separation was
final.
When I reached my new prison it seemed
to me a mansion, since there were only two
gratings instead of six, as before; and as the
men were entirely separated from the women,
we were allowed to go all over the building,
from top to bottom, without a keeper. I was lodged
on the fifth floor, in what was called formerly
'the philosophers' warming-place'. The
names of the scholars were, as is customary,
written in charcoal on the walls; I recognized
a few of them. There was a fireplace in this
pretty room, and I think it was the only one in
the corridor. It was immediately made use of
to warm all my neighbours' coffee-pots, which
occasioned a continual procession not at all
agreeable.
Before my detention, I had thought that a
prison would be at least a place of repose,
where I could give myself up to study; but this
was not the case at all, at least not in those
where I stayed. Every moment the keeper, the
jailers, the turnkeys, the purveyors, etc., came
in. We were made to go down to the clerk's
office to attend to our commissions. I could
not read one single hour without interruption.
One thing which I have heard spoken of, and which
I have certainly verified, is the habit prisoners
have of being destructive. It arises from
their standing in need of a thousand things. I
had no shovel, so I broke a piece of slating and
used it for one; I took a floor-tile for a lid. It
was very difficult to procure wood, so I burned
up my chairs. We could not send a keeper
down-stairs without paying him a hundred sous.
In spite of the admiration inspired by my new
dwelling-place, I was forced to sigh for the one
I had left. We slept where the plaster was
quite fresh, which gave me such a raw sensation
in my throat that I could swallow nothing but milk.
On the stairways there was a very unwholesome
smell of oil; all the windows, above and
below, had been grated, and boards adjusted,
so as to make it impossible to throw letters out.
The outer aspect of our building was frightful.
We lost by our transfer the promenade in the
garden, and had instead one no better than in
the courtyard at Plessis, so that one could not
make up one's mind to go out except when it
was absolutely necessary to go in the open air.
The men and women went there at different
hours. They were shut in on every side; and
walls had been erected so that the prisoners
could not be seen by their neighbours, and could
make no sign to them. One little alley-way,
however, which it was impossible to shut out
from our view, allowed us to see human beings
at liberty, or who at least believed themselves
to be. The windows which procured this little
view for us were very much sought after and
always occupied. Persons interested in the
prisoners came to assure themselves of our
existence. Our numbers increased each day,
and brought us some detestable recruits. I had
very near me some vulgar creatures,—young
women from the Rue de Chartres, some persons
with the itch, the hangman's mistress, and a
drunken creature, who said she was a person of
quality belonging to the family of Désarmoise,
to whom in manner at any rate she bore not the
slightest resemblance. She assumed the right
to come into our rooms every day, make a great
noise, and deliver herself of the most abusive
language, for which she afterward asked pardon.
I was, of course, very much touched by her
repentance, but her visits were still very
disagreeable to me. Another of my neighbours, a
lady of the court, was insane; and unfortunately
for me, she took a great fancy to me. She
lay down to sleep one day just in my doorway,
and could only be gotten away by force.
The sort of care that I was obliged to take of
her was as disagreeable as it was fatiguing, and
it was a real calamity. One of her fancies was
to write to Robespierre. I suppose her letters
suffered the same fate as ours,—never to reach
their destination. Only the two lines added to
the requests which we made for necessary things
ever found favour at the clerk's office.
The mess-table, the nature of which we had
experienced at Chantilly, was established. We
were placed in the rhetoric class-room, and
grouped at tables of twelve covers each. Each
of us had a wooden spoon, but no fork; and
we were given to understand that the latter was
a dangerous thing. We also had a wooden bowl
given us from which to eat our soup; and I have
kept it as a curiosity. I never used it. It
seemed as though pains had been taken to do
everything which could excite our disgust. The
tables had no cloths, and were never washed;
as a great deal of wine was spilled the smell was
insupportable. Hairs were often found in the food;
and the dirtiest of the prisoners were detailed
to wait upon us. Pigs ran about the
refectory while we were at dinner. A notice
was posted one day, saying that it was only
necessary to give us enough to keep us alive.
Supper was entirely done away with. Mesdames
de Courteilles, de Rochechouart, and de
Richelieu ate with the lowest creatures, and
Madame and Mademoiselle de Pons with
Mademoiselle Dervieux, of the Opera, a negress,
and what were called feminine sans-culottes.
The men ate in another refectory. My mess-mates
were hard to please in the matter of food,
among them the daughter of one of the Duke
of Bourbon's grooms. Such people were never
content. The keeper, angry one day because
they tried to throw their plates in his face,
pointed me out to the commissioner who examined
us, as well as others of my class, and
said, 'You can ask those ladies; they never
complain of anything.' He greatly preferred
to have charge of us than of the common people.
The keepers at Plessis were not at all like those
at Chantilly, who were kind, attentive, obliging
and attached to us. Those at Plessis persecuted
us to get money, demanded services of us, and
reproached us when we had two garments for
not giving them one of them. They were very
hard to get along with. I often served them as
secretary in writing to their relatives or making
applications. Once while doing something of
this sort a very amusing thing happened to
Madame de la Fayette. A woman asked her
to compose a petition for her, which she did
immediately, with the readiness and kindness
which characterized her. But as her handwriting
was bad, she charged the person to have it copied;
and she had the stupidity to send it to a prisoner,
who, good patriot that he was, was indignant
at the want of civism evinced in it, and sent
it back with some words effaced, and the following
remarks: 'This petition is aristocratic; one
never uses such phraseology. This is not civic;
it has the odour of a château. This person does
not know how to draw up a petition,' etc.
We laughed a great deal at the severe criticism
aroused by this kind action.
A convoy from La Force brought Madame de
la Fayette to us at Plessis. The van-guard
was composed of Madame des Réaux, who was
eighty-four years old, Madame de Machaut, and
other women who were at least seventy. These
were, as a great favour, put into a carriage;
the others, as was the custom, came in a cart.
It was a long time before they were put into
lodgings, and we were allowed to approach them.
At last I was able to see one of my cousins, who
found the rules in this prison less severe than
in the one from which she came; and all the girls
of the street from Paris collected there presented
a spectacle so indecent that one so pure as she
could scarcely endure it. Besides, she slept in a
room where there were four other persons whom
she did not know; I was able to get another
room for her, which she thought quite palatial.
She has often told me of the extreme pleasure
she felt on awaking and finding herself alone.
The room was so small that she could not put a
chair between her bed and the wall; there was
fortunately a recess, however, where with some
trouble she could sit down. Having Madame
de la Fayette so near me was very pleasant.
Her virtues and kindliness, which had suffered
no change from the life she had been compelled
to live during the first years of the Revolution,
the possibility of opening my heart to her with
regard to my family, concerning my anxiety for
whom I had never spoken to any one, did me
much good; we wept together over her own
fate. She seemed to me to be much less prepared
than I was for the general and particular
evils which threatened us. She thought, for
instance, that she could defend her cause and
that of her husband before the Revolutionary
tribunal, and that only those were in danger who
had committed some serious or trifling injury to
the Republic. It took me at least a fortnight
to set her right on this subject, and enable her
to realize her true situation; but, indeed, what
passed before our eyes was more eloquent than
anything I could say.
The number of victims carried off became
larger and larger; they generally went away
during the time we were taking our walk in
the courtyard. It seems to me now, that I
can see the unfortunate Monsieur Titon, a
counsellor in the parliament of Paris, as he
passed beneath the windows of the room of his
wife and daughter, who were not even permitted
to bid him a last farewell. He went out
at five o'clock in the evening, and the next day
at noon he was dead. Carts and Fouquier-Tinville's
carriage arrived at all hours, and were
crowded with the accused. This man's coachman
was well worthy of such a master; while
the victims were getting into the wagon he
drummed out dancing tunes, and his costume was
that of a Merry Andrew. It is almost impossible
to describe the terror excited by the
opening of the great gate, especially when it was
repeated several times a day. I can hear now
the sound of the drum beating. The bailiffs of
the Revolutionary tribunal went before the
wagons with their hands full of warrants. Then
there was a moment of deathlike silence. Every
one thought the fatal order had come for him;
faces were filled with terror, hearts and minds
overwhelmed with fright. The bailiffs went up
into the corridors to call for those who were to
go off, and only allowed them a quarter of an
hour to prepare. Each bade the other an eternal
farewell; we were in a stunned condition,
being only sure of living from ten o'clock in the
morning until seven o'clock in the evening.
Sleep was light when one suffered such anxiety,
and was frequently interrupted by the arrival of
convoys. That containing the famous prisoners
from Nantais created a great sensation. It was
the custom to receive the prisoners with lighted
torches; and the keeper, accompanied by jailers
and big dogs, dragged the poor prisoners from
the wagons in the roughest manner. They were
so much afraid of losing some of the prisoners
that they called the roll two or three times in
succession, then put them in the "mouse-trap,"—a
new name for a receiving-place. There was
no calculation as to whether there was room
enough in the house; room was made: and
there have been as many, so we have been assured,
as seventeen hundred at one time in the
colleges of Plessis and Louis-le-Grand. Twenty-five
persons were put in the same room, even in the entresols, with grated windows. The severity
of the treatment increased constantly. One
day about three o'clock in the afternoon I heard
my bolts shot to, and could not understand
the reason; it was unusual. It was on account
of a servant having thrown water out of a window
into the courtyard, after having been forbidden;
and for this great crime we were punished.
We were not allowed to have any light in our
rooms; this was a very great privation. To
room in front of a street lamp was a great piece
of good fortune. In the corridors were placed
chaffing-dishes, on which we warmed our suppers.
Those of us who had fireplaces kept the fires
bright, so as to give light. Some one would
light a candle for a moment, then extinguish it
the next, for fear of being punished. To eat
with our fingers was intolerable. To go to the
jailer every day to ask him to cut up our chocolate
was neither amusing nor satisfactory. I remember
a large penknife which belonged to Madame Vassy
which was our delight. She was a lovely woman,
bright and intelligent, and extremely obliging.
She said she liked variety. She married,
on leaving the prison, a Prussian, who took her
to Berlin.
On the 18th of June I witnessed a heart-rending
scene. I was in Madame de Pon's apartment,
playing a game of chess with her, when
some one came and called me; I went out. A
person who felt an interest in Madame de Pon's
daughter told me that her father had been transferred
from the private hospital where he had been, to
the Plessis, and that as he was getting out of the
wagon he had received his bill of indictment;
that he implored most earnestly to be
allowed to see his daughter, but was refused, in
order to avoid such a harrowing interview. The
windows of the keeper's apartment opened directly
upon the courtyard where Mademoiselle de
Pons was then walking; they were ordered to be
closed. Monsieur de Pons gave himself up to
the most frenzied despair, saying that the most
precious treasure he had in the world was taken
from him. We did not know how to get his
daughter out of the courtyard without arousing
her suspicions. Haly had caused her to suspect
that something was going on, by forbidding her
to go under the windows on account of the arrival
of some new prisoners. I made some pretext to
persuade her to go into our building with one of
my friends; and the latter led her to a place quite
away from her unfortunate father. Then I returned
to Madame de Pons's room, and from the
change in my countenance she perceived that
something had happened. I said nothing, but
began playing chess again, in order to gain time
to prepare her for it. The state of affairs between
herself and her husband rendered this less
terrible for her than for her daughter. She urged
me to tell her the cause of my emotion. As
Monsieur de Pons had been ill of consumption
for a long time, I told her that he was about to
die. She begged me not to tell her daughter of
it, and I promised. This unhappy man was not
sent for to be taken to the Conciergerie until
nine o'clock in the evening, and consequently he
was in the same building with his child for five
hours without being able to take her in his arms,
comfort her, or bid her a last farewell. He
spent all of the time in seeking by threats and
prayers to excite the compassion and interest of the
keeper, telling him of her youth, of his affection
for her, and that his last prayer was that
happier days might be in store for her. He cast
a farewell glance toward the courtyard, and then
was led away. I spent the evening in extreme
trouble and agitation; although I knew Monsieur
de Pons only very slightly, the thought
that he had not in his last agonized hours been
able to see his daughter and bless her, and the
grief I knew she would feel, all caused me to
pass a terrible night. The young girl has since
told me that she suspected that something sad
was being concealed from her, by the embarrassment
in our manner toward her. She came the
next day as usual to my apartment to comb my
thin white hair, and I could scarcely restrain my
feelings while I was dressing when I remembered
that her father was at that very moment
before the tribunal or mounting the scaffold.
She went away immediately. Madame de Pons
had asked me to tell her the whole truth, and
I had done so. She had sent for news of her
husband's trial, and learned that he and also
Messieurs de Laval, de Rohan-Soubise, de
Monterrey, and fifty others had been condemned
to death as conspirators against Robespierre,
and were to be executed at the Grève, wearing
red shirts, though these by law were required
to be worn only by murderers. It seems that
in order to make this so-called conspiracy
more noted, the most celebrated names of the
old régime, had been made use of, and that in
fact those who bore them had never thought of
conspiring.
Another calamity befell us, the small-pox broke
out. Madame des Réaux, eighty-four years old,
died of it; and an only son also died, almost in
sight of his father and mother, who were cruelly
refused permission to go into another prison to
weep over their unhappy child. They drank their
cup to the dregs. Two very old ladies by the
name of Machault were also attacked by this
horrible disease, which naturally was greatly
dreaded by all those who had not had it.
Fortunately the contagion did not spread, which
was extraordinary in a place where so many persons
were crowded together. Besides, the manner
in which the sick were treated was horrible.
No money could procure medicine for them, or
even a cup of tea. I saw a very strong woman
die, who could have been cured with very little
care. It required two days' negotiation to gain
permission to have a warming-pan brought into
the house. The prison surgeon was a Pole,
named Markoski, who had come to Paris to study
medicine, of which he was entirely ignorant. I
needed to be bled; he found that it was difficult
to do this in my arm. I let him try my foot,
and he was successful. I pardoned his want of
skill and his ignorance on account of his kindness
of heart. He was really obliging; he brought
us news of persons of our acquaintance who were
imprisoned in other houses of arrest. And he was
particularly kind to me because I gave him an
account of the sick, and because, as I knew some
medical phrases, I spared him the trouble of
making out certificates of infirmity for persons
who hoped by that means to escape close
imprisonment; it was only necessary for him
to sign what I had written. One day when I was
feeling very badly, I said to myself, 'It would
be so sweet to die in my bed.' What a terrible
condition it is when one rejoices over an
illness which may bring death!
I omitted to relate a very ridiculous incident.
The day before the Feast of the Supreme
Being [4]all the prisoners were sent down into
the courtyard, which we found filled with an
enormous quantity of branches and leaves. I
pretended to work upon them for a few minutes,
and then I withdrew into my own room; several
of our wretched companions worked away
zealously, and even offered to plant a liberty-pole
in the middle of the courtyard. The keeper,
less absurd than they, forbade it, saying that
such a decoration would not suit a prison.
They danced in the court; the jailers attended
this strange festival,—it was the day of Pentecost,
on which Robespierre permitted God to be
adored provided He should not be called by
that name. One of them praised me very much
(he was not very bad), and said that he thought
I would carry myself very well going to the
guillotine; I answered him coolly that I hoped I
should. Another boasted of the rapidity with
which the Revolutionary tribunal got through
with its trials; and he added that in order to set
things right, it would be necessary to cut off
seven thousand heads. One day as I was sitting
alone in my room two gendarmes entered;
I thought that my last moment of life had come.
They questioned me about my father and my
brothers; and as the conversation progressed, I
hoped that the mere curiosity to see a person of
my rank destined for the scaffold had attracted
them. They went away, and I was much relieved
by their departure. A little while after,
a female who had the appearance of a woman
of ill-fame came to tell me that she had been
ordered by the keeper to lodge in my room,
and that she was going immediately to bring in
her bed. For a moment I felt extremely irritated,
but I restrained myself. I told her that I
would leave the room and she could have it
all to herself. The women and young girls who
were poor had entered into a speculation which
I now found useful: they took possession of
very small cells, and for money gave them up to
other people, finding some way of crowding in
elsewhere. I thought of one occupied by the
daughter of the Prince of Condé's groom, and
she let me have it for a louis in assignats; she
boasted a great deal of her kindness to me, and
indeed it was very fortunate for me. I regretted
my fireplace very much on account of its convenience
for my neighbours; moreover, it was both
inconvenient and dangerous to light fires in
open braziers in so narrow a space, though under
the circumstances it was absolutely necessary.
My new lodging possessed one advantage
over those of Madame de la Fayette, in
that I could put a chair between my bed and
the wall. I could without rising lift the latch
of my door, and even look out into the court.
My prison life taught me that even the smallest
power is precious. The difficulty of procuring
light and fire enabled me to succeed in striking
a light with steel. I carefully concealed the
possession of this treasure, fearing that it might
be regarded as a dangerous weapon in a Revolutionary
arsenal. The keeper, learning that his name
had been used in order to turn me out of my
apartment, came to tell me that he had had
nothing to do with that enterprise, and requested
me to denounce the woman who had contrived it. I
replied that I had such a horror of denunciations
that I would not give her name. He then proposed
that I should return to my room, but I refused
to do so; the prison was getting so full that
I feared I should be compelled to receive
some one into it. Convoys were constantly
arriving from the different Departments.
One came containing eighty peasant women from
the Vivarais, who wore very singular costumes.
We questioned them concerning the cause of
their arrest; they explained to us in their
patois that it was because they went to
mass. This was considered so enormous a crime
that they were put in the building belonging
to the tribunal which was called by our wags
Fouquier's shop. Some ladies from Normandy
came to our prison. They seemed countrified,
though they did not wear their local costumes;
they spent their time from morning to night
writing memoirs and petitions,—a very dangerous
habit during the Reign of Terror, and one
which was likely to hasten the hour of death.
I received a letter from my father which made
my heart ache. I always awaited and read his
letters with deep emotion. He told me that
Madame Latour, who was their only consolation,
who lightened the burden of their old age,
had just been taken away from them; that she
had been forced to leave the prison in spite of
the efforts she had made to remain or be allowed
to return. She begged for imprisonment
as earnestly as one usually does for liberty.
All this caused me great grief. I felt more
keenly than ever how much my parents needed me,
and I again sent in applications to be allowed
to go to them; they were fruitless. Fortunately
they had with them my sister-in-law, the wife of
Louis, Vicomte de Noailles, whom they valued as
she deserved; but as she was obliged to take
care of Madame d'Ayen, her mother, and
Madame la Maréchale de Noailles, her grandmother,
who were lodging with her, she could not do very
much for my parents. Consequently they were left
entirely alone, my father then eighty
and my mother sixty. [5]Their forlorn situation
was constantly before my mind. One day as I was
intensely occupied with thoughts of them, I
heard a great noise in the courtyard; I looked
out, and saw a convoy enter containing a hundred
and fourteen persons from Neuilly-sur-Seine.
They had been compelled to pass by the camp of
Robespierre's disciples, who had shouted terrible
threats at them. As they had received no orders
to kill the prisoners, they contented themselves
with overwhelming them with threats and insults.
The convoy was composed of a great many nobles
who had established themselves in the village
of Neuilly on account of the lettres de passe.
(A decree had compelled all nobles who were
not imprisoned in Paris to go away several
leagues from the city.) A most strange thing
to happen at such a time was, that some persons
who were not of noble blood, but who wished to
be considered so, obeyed this decree, which had
no reference to them at all. The servants of
the nobles had been arrested with them; and
with them were also people of all conditions,
among them six nuns of the Visitation,—one
of whom was Madame de Croï, sister of
Madame de Tourzel. All of these unfortunate
creatures were left a whole day in the 'mouse-trap.'
I learned that Madame de Choiseul, the
mother, Madame Hippolyte de Choiseul, and
Madame de Sérent were also of the party. The
whole company were searched in the strictest
manner. At last, at seven o'clock in the evening,
they were put into lodgings. The nuns, to
their dismay, were put on the sixth floor, with
twenty-five persons; and to make them more
wretched, they were put with the lowest creatures.
All belonging to this convoy suffered
extremely from hunger. We gave them what we
could. I remember that I made for Mesdames
de Choiseul a panado which they thought delicious.
Bread and wine were usually all that was
allowed to be offered to the new-comers. This
is a minute detail, and is intended to show the
destitution which existed in our prison. I have
seen poor women, brought from the suburbs of
Paris, sleeping on the tables in the refectory.
The greatest attention we could bestow upon
people was to give up our mattresses to them
while they were waiting for theirs.
All those composing the convoy from Neuilly,
though scarcely settled in lodgings, came very
near being sent in a body to the Conciergerie
to perish the next day. About midnight I heard
the sound of carriages,—a not uncommon thing,
as I slept lightly. A melancholy curiosity,
inspired by fear, induced me to rise and see
what was going on.
I saw by the light of a number of torches a
great many gendarmes and bailiffs, and at the
same moment a frightful noise was heard in our
corridor. Loud voices cried, 'Let all who belong
to the convoy from Neuilly prepare to depart.'
I trembled all over, and went out to go and
see my neighbours, who, little accustomed to the
rules of the house, were quite undisturbed, since
they had been told that this was only a removal.
I do not remember whether I told them of the
fate which immediately threatened them, so they
might prepare for it, or whether I left them in
ignorance of their death-summons. For some
time they remained in suspense; then the jailers
came to say that there was a mistake. We
afterward learned that it was by mistake that
they had come that night to the Plessis. The
executioners did not let their wagons remain
empty, but went to another prison to fill them.
It was necessary to have a certain number of
victims every day, except from our prison, where
the number varied. I have known as many as
sixty-four to be sent from us in one day.
One thing seems almost incredible unless one
witnessed it: it is that constantly one could
hear the prisoners playing on different instruments,
and singing in chorus the Republican airs;
and again, that one could see women caring
for their dress, and even coquettish, while,
besides the guillotine, they were threatened
with death by fire and water. We heard that
we were to be shot as the Lyonnais were, against
a wall which was newly erected in our courtyard
and was destined, it was said, for that purpose.
In addition to these rumours, the fire in the
library of the abbey of St. Germain,—which we
saw very plainly,—as well as the explosion of
the magazine at Grenelle, gave us a great deal
of anxiety. As far as I myself was concerned,
I am sure these two events disturbed me but
little; but I was terribly anxious on account of
those dear to me. The walk in the open air,
which was necessary for our existence, became
almost intolerable. One day when I was out,
I saw several persons dismount who came from
Angoumois. It was about six o'clock in the evening;
the name of one of them, an old lady named
De Boursac, reminded me of two of the king's
equerries who bore the same name, and I gave
her some information concerning them which
seemed to afford her great pleasure. She told
me they were her children, and that she had
two others with her. My first conversation was
a last farewell, for she was executed with them
the next day. The pretext of conspiracies began
to be fashionable in order to cause the death
of a great many persons of different classes at
the same time. I comforted myself sometimes
with the hope that my parents' advanced age
and their virtues would save them, and that I
only would perish; for I saw clearly from all
the refusals I had received that I should be
obliged to renounce entirely the happiness of
joining them. This was for me the greatest possible
sorrow, but each day brought others. I could
never have endured my situation with fortitude
had I not resigned myself entirely to the
will of God. The charity which we were so
frequently called upon to exercise helped to distract
our minds. One day, for instance, I met a
poor woman who arrived overcome with fatigue
from her long, miserable journey, having slept
by the way only in infected prisons. The jailer,
in order to force her to go to her apartment,
which was very high up, spoke to her in most
abusive language, and even kicked her, to rouse
her from the prostration which overcame her as
she mounted the stairs. I begged this cruel
citizen not to treat her as a beast of burden,
but to put her in my charge. I had great trouble
to gain this favour from him, but succeeded
with the help of one of my companions in
getting her away from the barbarian. I think
she was Madame de Richelieu.
Madame de Rochechouart, her mother, was a
singular example of the well established fact that
prison life cured several very great invalids.
When she was arrested at Courteille she was
spitting blood so constantly that it was thought
she would never reach Paris. On reaching
Plessis her health became much better, though
she lived in a room where the plaster was still
fresh, without fire, and exposed to every wind.
I believe it was the strict diet forced upon us
by the poor food which produced this happy
effect. One ate only what was just necessary to
sustain life. The mind was so agitated that the
body felt the effects of the strain. I remember
that one night I was so hungry that I got
up to get some chocolate, wondering that a
physical need could distract me from the sad
thoughts which beset me when awake. One day I
spoke to Madame de la Fayette on this subject,
saying to her that I could not conceive how,
occupied as we were constantly with thoughts
of death, and having it continually before
us, we could provide for the next day what
was needful to preserve our lives. While we
were in the refectory we were informed that a
poor woman had thrown herself out of the only
window without a grating in the whole house,
and that she was dying in the courtyard; it was
surely despair which had urged her to this act of
folly. I ran to the spot where they had carried
her, and found her crushed, and showing no
signs of consciousness. The keeper was beside
himself, fearing lest this accident should
compromise him, and never thought of doing
anything for the unfortunate creature. I implored
him, as our surgeon had made his rounds and
lived at a great distance, to send for one of the
physicians who were imprisoned in the building
used as a court. He granted my request very
unwillingly; and the officers from the hospital
could scarcely be induced to come to see the
injured woman, as they said it was the duty of
the surgeon of the house to attend to her. They
found she had no money, and made no attempt
to do anything for her. I was extremely irritated
at this. My companions in misfortune shared my
desire to be of some assistance. I enter into
these details only to show that deeds of
kindness were the only distraction from our
own sufferings.
I always waited with impatience, mingled with
fear, the notes that came to me from the
Luxembourg. I received one on the morning of
June 26. My father wrote me (I transcribe
the note): 'Your mother is suffering from
severe indigestion, brought on by eating salad,
which is all she has for supper; at first I treated
her myself, and afterward our neighbours rendered
her all sorts of services. We have a good
physician here among the prisoners; he has given
her two grains of an emetic which have done
her much good. She will be able to take liquids
to-morrow, and is improving rapidly. You shall
hear from her to-morrow. Our tenderest love
and kisses, my dear daughter.'
On reading this my heart ached; I thought
of my mother as suffering from something like
apoplexy, of my father as heart-broken, while I
was utterly powerless to help them. I spent
the whole day and night in great agitation, and
it seemed so long before the sun rose! I went
down and sent message after message to the
clerk. Finally, when the time when we usually
received letters had passed without my getting
one, as a great many of our prisoners had husbands
at the Luxembourg I went to inquire if
they had had their letters; some said no, others
manifested a sort of embarrassment which seemed
like compassion. I was struck by it, and a suspicion
of the calamity with which I was threatened
immediately flashed across my mind. I
talked of it the whole evening to Madame de
la Fayette and other persons. Their terrified
expression confirmed my suspicions. I said
to them, with extreme emotion: 'You are
hiding from me to-day what I shall learn to-morrow.
I know what you wish to keep from me. My
cousin, you must tell me the dreadful news.'
Accordingly she came into my room early in
the morning, and I no longer doubted what my
misfortune was. I read the whole story in her
face. She did not tell me of the death of both
at once; she waited awhile before telling me
of the other. I can never express the grief I
felt,—the horror of thinking of such virtue,
perfect charity, and honour upon the scaffold!
My parents' goodness to me, their tenderness,
the immense force of their examples, the lessons
they taught me,—all came to my mind. My sobs
choked me. It was the day before the fast of
Saint Peter. I observed it strictly, swallowing
only my tears; it is impossible to describe
what one feels under such circumstances. I
could learn no details, except that they had been
beheaded as conspirators. I did not go down-stairs
for several days, and it was some time before
I went to walk in the courtyard. My neighbours
showed me every attention. From that
time the thought of death was always before
me,—everything recalled it to my mind; and
this perhaps soothed the violence of my grief.
One of the first visits I made was to a lady who
had on the same day lost her husband and her
only son, a youth of sixteen. I was told that
I might perhaps comfort her; and I tried to do
so as well as I could. I continually repeated the
prayers for the dying for others and for myself;
I repeated them so frequently that I knew them
by heart. I felt sorry to end my life without
spiritual aid. This was all the sadder since
there were two hundred priests in our house;
but they were absolutely forbidden to hold any
communication with us. Some persons were in
despair on this account. I told them that when
it was impossible to confess, one should make a
sacrifice of one's life and arouse oneself to
perfect contrition, and one would obtain pardon.
I was not greatly disturbed, because I felt
entirely resigned to the will of God.
Three peasant women from Berry, who slept just
back of my bed, received their indictments
just as they were going to bed. One of them
had spit upon a patriot's cloak; another had
stepped upon the arm of a statue of Liberty,
which had tumbled down; I do not know the
crime of the third. They were in a terrible
state all night. Their sobbing prevented my
sleeping at all. I got up and endeavoured to
encourage them, and exhort them to submit to
the decree of Providence. After a while they
grew more calm, appeared before the tribunal,
and were acquitted. This was for the purpose
of making it appear that the decisions were
rendered with some sort of equity.
These pretended conspiracies multiplied in a
frightful manner. After that of the Luxembourg,
one was invented at St. Lazare, and another at
Bicêtre. The victims collected at the last
mentioned prison, as a dépôt, were
brought to ours, and kept there twenty-four hours.
The convoy was escorted by forty gendarmes, armed
with guns. There were a good many priests. These
unfortunate beings were chained together by twos
and threes, like wild beasts; most of them held
their breviaries in their hands. All of them were
put in the dungeon to sleep, and they were taken
away in a body the next day to the Conciergerie.
It is even doubted whether they were ever
condemned before being beheaded. I cannot explain
the barbarous curiosity which incited us to go
to the windows to see these itinerant
hearses come and go. I remarked one day
to some of my companions that under the
old régime, we should have gone a long way to
avoid meeting a criminal who was going to be
hanged, and now we gazed upon every innocent
victim. I think we grew somewhat hardened
from constant contact with those who were so.
The famous Osselin, author of all the decrees
against the émigrés, was in the party
from Bicêtre; he had concealed a dagger under
his coat with which he wounded himself several
times during the night he passed at the Plessis.
These wounds were dressed as well as was possible,
and he was carried to the tribunal on a
litter. He was guillotined the next day. The
sight of this man's suffering, criminal though he
was, inspired me with horror beyond description.
He was literally cut to pieces.
On the 22d of July it was rumoured in the
prison that some of the ladies of the house of
Noailles had been condemned. I did not speak
of it to Madame de la Fayette, but tried in
vain to learn the truth of the report. A little
while after, however, I read in a newspaper
that Madame la Maréchale de Noailles and
Madame la Duchesse d'Ayen had been guillotined.
Nothing was said about my dear little
sister-in-law. [6]The difficulty of procuring news
from outside was extremely great. The servants of
the Reign of Terror even trembled for themselves.
When I questioned them, they answered vaguely.
I no longer doubted the truth of this new
calamity; but I wanted to be sure of it before
announcing it to Madame de la Fayette, whose
fears I sought in vain to arouse, and who was
always hoping for the best. At last I paid a
jailer to gain for me the confirmation of what
I feared.
It was a sorrow to me the whole time I was
hiding it from my cousin, and my spirit was
crushed. I loved the Vicomtesse de Noailles
as a daughter and friend. She possessed
every possible virtue and charm, and was the
member of my family whom I most loved and
confided in.
To find myself bereaved of five members of my
family within so short a space of time seemed
almost incredible. And how could I tell
Madame de la Fayette that she no longer had
mother or grandmother or sister! At last she
became conscious of the embarrassed manner
of those whom she questioned. She asked me
the reason; and I answered her by a flood of
tears. It was a sad service which I rendered in
return for what she had done for me, under the
same circumstances. She comprehended the
death of her parent and grandparent, but she
could not be persuaded of the death of the
angel sister whom she adored. I shared all her
sorrow, and our hearts bled for each other. Her
situation was terrible, and awakened anew my
still fresh grief. We frequently talked together
of our revered parents; and we were only roused
from our stunned condition by misfortunes more
recent than our own, which urged us to comfort
those who were suffering from them. The
indispensable duty of preparing food is a
real, though wretched, distraction when the
heart is aching.
We were now threatened with a domiciliary
visitation; the keeper, who was quite kind to
me, advised me to put my devotional books
where they would not be seen. I concealed
them carefully, as well as my assignats, a few
of which still remained, between the beams of
our cells. This visitation did not take place.
One night (I do not exactly remember the
date) I heard a great noise of horses' feet;
the great gate opened and shut every moment,
and horsemen came in and out. At
daybreak I found the courtyard filled with
gendarmes. They went away without doing
anything, and I have never learned why they
came.
I had some business to transact with Haly,
and we talked afterward of what was going on;
and he informed me that soon all persons of my
rank were to be beheaded. I realized that I
had but little time to live, and profited by the
conversation. I set a strict watch over myself,
and prayed God to sustain my courage,—a
prayer which was fully granted me.
I did not think it necessary to overwhelm my
companions with the weight of my griefs and
fears. Some of them deluded themselves as
certain sick persons do during epidemics, though
already attacked by the disease, saying, 'He
who just died had a hemorrhage; I have not.
The other complained of a pain in his back; I
have not felt anything of the sort.' Just so
with the prisoners; they said to each other,
'Those who were beheaded were in correspondence
with the émigrés, they were aristocrats,
money was found on their persons,' etc. They
tried to persuade themselves that they were not
in the category of those who were every day
being condemned. I looked at the situation in
a different light; it appeared to me impossible,
if the Reign of Terror continued, that any one
of our class should escape. I felt sure I should
suffer the same fate as my parents; I sought to
imitate their resignation, and to honour their
memory by dying in a manner worthy of them.
I thought that terrible armchair [7]had been
honoured by the many virtuous persons who had
occupied it. Every evening when I went to bed
I repeated my In manus. I arranged for the
distribution of all my small supply of furniture
among my companions. I constantly strove to
forgive injuries. My parents, who had been
very admirable in this respect, were my models.
How beautiful, how Christian, how truly worthy
of emulation it is to feel no resentment against
those who, after having overwhelmed us with
insult, conduct us to the tomb in a manner so
atrocious! It is only by following the teaching
of the Gospel in every respect that one can be
enabled to practise a charity so perfect.
One more sacrifice remained for me to make,—the
saddest of all: it was, never to see my
son again. I can never express what I felt then,
or what an effort it cost me to be resigned to
it. I believed that God would pardon me; and
I was in as peaceful a state of mind as could be
expected under such cruel circumstances. I
resolved that when I should be called before the
tribunal I would make no answer to the questions
of the iniquitous judges, but after hearing my
sentence read, I would say, 'You are condemning
an innocent person; as a Christian I forgive
you, but the God of vengeance will judge you.'
I grieved to think that I was not to die for
the faith. Ah! how delightful, when one finds
one's last hour approaching, to be able to be
sure of possessing a crown of glory and dwelling
in that country of which Saint Augustine says
that 'Truth is the King, Charity the Law, and
the Duration, Eternity.' The idea that I was to
die only because of the ineradicable stain of
aristocracy displeased me inexpressibly.
On the 8th Thermidor, July 27th, 1794, we
perceived toward evening an extreme degree of
the usual terrible watchfulness. The prisoners
were not allowed to go into the courtyard; the
gratings were closed. One would have been
anxious under any circumstances; but when one
is daily expecting one's fate, one has no other
fear. I had still, however, a great dread of
being killed by piecemeal, as was done on the
2d of September, with pikes, bayonets, and
such infernal weapons. I slept as usual; and the
next day, the 9th Thermidor, the sound of cannon
was heard. The keeper and jailer were in a
state of great excitement; their eyes looked
haggard and their faces downcast. We knew
nothing of what was passing, but we presumed
it must be something frightful. That evening
their countenances seemed more human, and
there was a rumour of the death of Robespierre.
| https://www.gutenberg.org/files/46750/46750-h/46750-h.htm |
Chemistry of Titanium Deposition Precursors for Area-Selective Deposition of Functionalized Silicon [Posters] (Conference) | OSTI.GOV
The U.S. Department of Energy's Office of Scientific and Technical Information
Title:
Chemistry of Titanium Deposition Precursors for Area-Selective Deposition of Functionalized Silicon [Posters]
Full Record Other Related Research
×
You are accessing a document from the Department of Energy's (DOE) OSTI.GOV
.
This site is a product of DOE's
Office of Scientific and Technical Information (OSTI) and is provided as a public service.
Visit OSTI
to utilize additional information resources in energy science and technology.
Abstract
Area-selective atomic layer deposition (AS-ALD) is an appealing bottom-up fabrication technique that can produce atomic-scale device features, overcoming challenges in current industrial techniques such as edge alignment errors. TiCI 4
is a common thermal ALD precursor for Ti0 2
thin films, which are appealing candidates for DRAM capacitors due to their excellent dielectric constants. Hydrogen and chlorine termination passivate the Si surface, allowing for selective deposition of TiCI 4
onto HO-terminated areas. However, selectivity loss occurs after several ALD cycles. Ti oxide nucleates onto surface defects on Cl- and H-Si resists. Previously, the use of H-Si as an ALD resist has been studied extensively, but less work has focused on chemical forces driving nucleation, especially for Cl-Si. Here, formation of defect nuclei was investigated with selectivity loss during Ti0 2
ALD with TiCI 4
and water on the (100) and (111) crystal surfaces of hydrogenated, chlorinated, and oxidized Si.
Authors:
Parker, Tyler [1] ; Silva-Quinones, Dhamelyz [2] ; Wang, George T. [2] ; Teplyakov, Andrew V. [1]
+ Show Author Affiliations
Univ. of Delaware, Newark, DE (United States) Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)
Publication Date:
2021-10-25
Research Org.:
Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)
Sponsoring Org.:
USDOE National Nuclear Security Administration (NNSA); USDOE Laboratory Directed Research and Development (LDRD) Program
OSTI Identifier:
1893287
Report Number(s):
SAND2021-13035C
701052
DOE Contract Number:
NA0003525
Resource Type:
Conference
Resource Relation:
Conference: AVS 67 Virtual Symposium, Held Virtually, 25-28 Oct 2021; Related Information: https://avs67.avs.org/
Country of Publication:
United States
Language:
English
Subject:
37 INORGANIC, ORGANIC, PHYSICAL, AND ANALYTICAL CHEMISTRY
Citation Formats MLA APA Chicago BibTeX Parker, Tyler, Silva-Quinones, Dhamelyz, Wang, George T., and Teplyakov, Andrew V.. Chemistry of Titanium Deposition Precursors for Area-Selective Deposition of Functionalized Silicon [Posters] . United States: N. p., 2021.
Web. doi:10.2172/1893287. Copy to clipboard Parker, Tyler, Silva-Quinones, Dhamelyz, Wang, George T., & Teplyakov, Andrew V.. Chemistry of Titanium Deposition Precursors for Area-Selective Deposition of Functionalized Silicon [Posters] . United States. https://doi.org/10.2172/1893287 Copy to clipboard Parker, Tyler, Silva-Quinones, Dhamelyz, Wang, George T., and Teplyakov, Andrew V.. 2021.
"Chemistry of Titanium Deposition Precursors for Area-Selective Deposition of Functionalized Silicon [Posters]". United States. https://doi.org/10.2172/1893287. https://www.osti.gov/servlets/purl/1893287. Copy to clipboard @article{osti_1893287, title = {Chemistry of Titanium Deposition Precursors for Area-Selective Deposition of Functionalized Silicon [Posters]}, author = {Parker, Tyler and Silva-Quinones, Dhamelyz and Wang, George T. and Teplyakov, Andrew V.}, abstractNote = {Area-selective atomic layer deposition (AS-ALD) is an appealing bottom-up fabrication technique that can produce atomic-scale device features, overcoming challenges in current industrial techniques such as edge alignment errors. TiCI4 is a common thermal ALD precursor for Ti02 thin films, which are appealing candidates for DRAM capacitors due to their excellent dielectric constants. Hydrogen and chlorine termination passivate the Si surface, allowing for selective deposition of TiCI4 onto HO-terminated areas. However, selectivity loss occurs after several ALD cycles. Ti oxide nucleates onto surface defects on Cl- and H-Si resists. Previously, the use of H-Si as an ALD resist has been studied extensively, but less work has focused on chemical forces driving nucleation, especially for Cl-Si. Here, formation of defect nuclei was investigated with selectivity loss during Ti02 ALD with TiCI4 and water on the (100) and (111) crystal surfaces of hydrogenated, chlorinated, and oxidized Si.}, doi = {10.2172/1893287}, url = {https://www.osti.gov/biblio/1893287},
journal = {}, number = , volume = , place = {United States}, year = {2021}, month = {10} } Copy to clipboard
Conference:
View Conference (3.17 MB)
https://doi.org/10.2172/1893287
Other availability
Please see Document Availability
for additional information on obtaining the full-text document. Library patrons may search WorldCat
to identify libraries that hold this conference proceeding.
Save / Share:
Export Metadata
Endnote RIS CSV / Excel XML JSON
Save to My Library
You must Sign In
or Create an Account
in order to save documents to your library.
Facebook Twitter Email Print More share options
LinkedIn Pinterest Tumblr
Similar records in OSTI.GOV collections: Inherent substrate-dependent growth initiation and selective-area atomic layer deposition of TiO{sub 2} using “water-free” metal-halide/metal alkoxide reactants Journal Article Atanasov, Sarah ; Kalanyan, Berç - Journal of Vacuum Science and Technology. A, Vacuum, Surfaces and Films
Titanium dioxide atomic layer deposition (ALD) is shown to proceed selectively on oxidized surfaces with minimal deposition on hydrogen-terminated silicon using titanium tetrachloride (TiCl{sub 4}) and titanium tetra-isopropoxide [Ti(OCH(CH{sub 3}){sub 2}){sub 4}, TTIP] precursors. Ex situ x-ray photoelectron spectroscopy shows a more rapid ALD nucleation rate on both Si–OH and Si–H surfaces when water is the oxygen source. Eliminating water delays the oxidation of the hydrogen-terminated silicon, thereby impeding TiO{sub 2} film growth. For deposition at 170 °C, the authors achieve ∼2 nm of TiO{sub 2} on SiO{sub 2} before substantial growth takes place on Si–H. On both Si–H and Si–OH, the more » surface reactions proceed during the first few TiCl{sub 4}/TTIP ALD exposure steps where the resulting products act to impede subsequent growth, especially on Si–H surfaces. Insight from this work helps expand understanding of “inherent” substrate selective ALD, where native differences in substrate surface reaction chemistry are used to promote desired selective-area growth. « less https://doi.org/10.1116/1.4938481 Effect of substrate composition on atomic layer deposition using self-assembled monolayers as blocking layers Journal Article Zhang, Wenyu - Journal of Vacuum Science and Technology. A, Vacuum, Surfaces and Films
The authors have examined the effect of two molecules that form self-assembled monolayers (SAMs) on the subsequent growth of TaN{sub x} by atomic layer deposition (ALD) on two substrate surfaces, SiO{sub 2} and Cu. The SAMs that the authors have investigated include two vapor phase deposited, fluorinated alkyl silanes: Cl{sub 3}Si(CH{sub 2}){sub 2}(CF{sub 2}){sub 5}CF{sub 3} (FOTS) and (C{sub 2}H{sub 5}O){sub 3}Si(CH{sub 2}){sub 2}(CF{sub 2}){sub 7}CF{sub 3} (HDFTEOS). Both the SAMs themselves and the TaN{sub x} thin films, grown using Ta[N(CH{sub 3}){sub 2}]{sub 5} and NH{sub 3}, were analyzed ex situ using contact angle, spectroscopic ellipsometry, x-ray photoelectron spectroscopy (XPS), more » and low energy ion-scattering spectroscopy (LEISS). First, the authors find that both SAMs on SiO{sub 2} are nominally stable at T{sub s} ∼ 300 °C, the substrate temperature used for ALD, while on Cu, the authors find that HDFTEOS thermally desorbs, while FOTS is retained on the surface. The latter result reflects the difference in the head groups of these two molecules. The authors find that both SAMs strongly attenuate the ALD growth of TaN{sub x} on SiO{sub 2}, by about a factor of 10, while on Cu, the SAMs have no effect on ALD growth. Results from LEISS and XPS are decisive in determining the nature of the mechanism of growth of TaN{sub x} on all surfaces. Growth on SiO{sub 2} is 2D and approximately layer-by-layer, while on the surfaces terminated by the SAMs, it nucleates at defect sites, is islanded, and is 3D. In the latter case, our results support growth of the TaN{sub x} thin film over the SAM, with a considerable delay in formation of a continuous thin film. Growth on Cu, with or without the SAMs, is also 3D and islanded, and there is also a delay in the formation of a continuous thin film as compared to growth on SiO{sub 2}. These results highlight the power of coupling measurements from both LEISS and XPS in examinations of ultrathin films formed by ALD. « less https://doi.org/10.1116/1.4931722 Highly Robust Low-PGM MEAs Based upon Composite Supports _ Final Report Technical Report Dameron, Arrelaine
This Small Business Innovation Research Phase I project investigated high performance, highly durable supports for low Platinum Group Metal (PGM) fuel cells using low-cost techniques to achieve the 2020 targets for cost ($$\$$40/kW$ at the system level, $$\$$40/kW$$ at the MEA level), start-up/shutdown durability (5,000 cycles), and less than 10% loss in power after 5,000 hours. Although carbon is currently used as a support due to its low cost, high conductivity and availability in high surface area formats, it also oxidizes or corrodes (at defect sites, C#) over time in the presence of water, via formation and oxidation of active more » (C#OH) carbon surface oxide species with H2O, and OH spill-over from Pt: 1) C # + H 2 O → C # OH + H + + e - a. C # OH + H 2 O → CO 2 + 3H + + 3e - 2) Pt + H 2 O → PtOH + H + + e - a. C # OH + PtOH → CO 2 + 2H + + 2e - + Pt * Adapted from FCPAD review, fc136_borup_2016_o.pdf The only viable approaches to obviate this issue are to either supplant the carbon with a corrosion-resistant alternative, or to isolate the carbon from direct exposure to corrosive agents through physical or chemical means. In order to reach the DOE performance and durability goals for fuel cells, the carbon corrosion issue is currently being addressed with non-carbon alternatives (e.g. Ta- or Nb-doped TiO 2 , nitrides, Indium tin oxide, etc.). However, when conductive metal oxides or corrosion-resistant nitrides are used as supports, there is typically a reduction in surface area of materials that adversely affect conventional Pt deposition processes, which can lead to accelerated ripening of Pt and loss of activity/performance. When conventional carbons have been encapsulated with materials, there had historically been a trade-off between coating cost and precision and/or coverage of the coating materials. Low-cost coating processes such as sol-gel techniques can apply rough, granular coatings that do not provide robust protection at the carbon interface; higher-cost precision processes such as Physical Vapor Deposition (PVD) are difficult to scale to meet DOE cost targets. This program will apply a recently developed low-cost Atomic Layer Deposition (ALD) technique to apply ultra-thin conductive barrier coatings onto carbon particles to prepare drop-in ready materials suitable for use in highly robust Membrane Electrode Assemblies (MEAs) and without sacrificing cost or performance, and extend system durability shortcomings shown in Figure 1. PneumatiCoat Technologies has demonstrated a high-throughput, low-cost method of applying ALD coatings to particles, allowing this precision coating technique to be implemented at very low $$/kg for fuel cells, catalysts and Li-ion batteries. This work addressed the following barriers to support commercial adoption of Fuel Cells: Durability: A demonstrated approach to applying pinhole-free, corrosion-resistant barrier coatings at the nano-scale, which has increased the lifetime of Li-ion battery cathode materials by 250% (which have severe electrochemical, morphological, structural and corrosion-derived degradation pathways). Performance and Cost: A proven low-cost encapsulation technique applied to low cost carbons used today, which can be applied before and/or after the electrocatalyst nanostructures are applied; Phase I Technical Objectives: 1) Demonstrate a successful overcoat method on low PGM Pt/C catalysts with ALD TiO 2 , specifically targeting uniform coverage of the carbon support with gas phase access to the Pt catalysts. 2) Evaluate the activity, ohmic resistance and cycling stability of overcoated catalyst materials by RDE & MEA testing. 3) Demonstrate improved cycling durability with MEA testing of optimized encapsulated catalysts without significant loss in activity. 4) Down select to a viable encapsulated Pt/C catalyst material based on electrochemical performance, process engineering and techno-economic considerations. FN is confidently stating that the Technical Feasibility has been completely demonstrated and significant improvements to high capacity and high voltage cathode materials are directly attainable using PCT’s low-cost high rate manufacturing systems for applying ALD coatings to these materials at the powder level. The general metrics for materials production can be boiled down to cost, performance and scalability, and above all, whether there is commercial interest in a finished product. This Phase I project has elucidated that PCT’s semi-continuous ALD coating systems provide highly-compelling cost, performance and scalability metrics relative to both non-ALD coating processes and batch production systems for coating particles by ALD. PCT’s approach is the only viable solution that can meet the automotive industry’s mandate to raw materials suppliers, which states that encapsulation coatings cannot add more than $1/kg to the cost of active materials. The overall objective of the Phase I project was to apply optimal encapsulation coatings to Li-ion battery cathode materials for head-to-head comparison of processes and coating techniques, to further the mission of reducing the total cost of ownership of battery systems. Screening designs were deployed to pair best coating materials for each Gen 3 cathode material, and subsequent optimization runs were to be executed to define specific down-selected coating processes for the high capacity and high voltage materials. « less Selective deposition of silicon and silicon-germanium alloys by rapid thermal chemical vapor deposition Book Grant, J ; Ang, M ; Allen, L
Selective deposition of SiGe alloys by rapid thermal deposition has been studied using a commercially available Rapid Thermal Chemical Vapor Deposition (RTCVD) cluster tool. The precursors used in this work were dichlorosilane and germane diluted in either hydrogen or argon. An initial characterization was performed to find the appropriate temperature and GeH{sub 4} flow ranges to deposit epitaxial layers with low surface roughness. For layers with higher germanium concentration lower deposition temperatures are required to minimize surface roughness. The effects of the dilutant gas on the deposition were examined. An H{sub 2} dilutant affects the deposition by consuming chlorine released more » by the SiCl{sub 2}H{sub 2} and forming HCl. When Ar is used as the dilutant, more chlorine is available for other reactions that can result in etching of the silicon surface. Finally, the effects of pre-deposition treatment were determined. When compared to a wet HF dip, a gas/vapor phase HF/methanol native oxide removal treatment appears to increase the initiation time for the epitaxial deposition reaction. This is most likely due to increased fluorine termination of the surface. When a wet HF or HF/methanol native oxide removal is followed by a UV-Cl{sub 2} process, the deposition reaction initiation time is reduced. The UV-Cl{sub 2} process was also found to etch silicon through the native oxide. « less High-reliability passivation of hydrogen-terminated diamond surface by atomic layer deposition of Al{sub 2}O{sub 3} Journal Article Daicho, Akira ; Saito, Tatsuya ; Kurihara, Shinichiro ; ... - Journal of Applied Physics
Although the two-dimensional hole gas (2DHG) of a hydrogen-terminated diamond surface provides a unique p-type conducting layer for high-performance transistors, the conductivity is highly sensitive to its environment. Therefore, the surface must be passivated to preserve the 2DHG, especially at high temperature. We passivated the surface at high temperature (450 °C) without the loss of C-H surface bonds by atomic layer deposition (ALD) and investigated the thermal reliability of the Al{sub 2}O{sub 3} film. As a result, C-H bonds were preserved, and the hole accumulation effect appeared after the Al{sub 2}O{sub 3} deposition by ALD with H{sub 2}O as an oxidant. more » The sheet resistivity and hole density were almost constant between room temperature and 500 °C by the passivation with thick Al{sub 2}O{sub 3} film thicker than 38 nm deposited by ALD at 450 °C. After the annealing at 550 °C in air The sheet resistivity and hole density were preserved. These results indicate the possibility of high-temperature application of the C-H surface diamond device in air. In the case of lower deposition temperatures, the sheet resistivity increased after air annealing, suggesting an insufficient protection capability of these films. Given the result of sheet resistivity after annealing, the increase in the sheet resistivity of these samples was not greatly significant. However, bubble like patterns were observed in the Al{sub 2}O{sub 3} films formed from 200 to 400 °C by air annealing at 550 °C for 1 h. On the other hand, the patterns were no longer observed at 450 °C deposition. Thus, this 450 °C deposition is the sole solution to enabling power device application, which requires high reliability at high temperatures. « less https://doi.org/10.1063/1.4881524 Similar Records | https://www.osti.gov/biblio/1893287 |
Difference between revisions of "Tilesets" - Dwarf Fortress Wiki
From Dwarf Fortress Wiki
Jump to navigation Jump to search Revision as of 14:56, 9 September 2014
( edit )
King Mir ( talk | contribs )
( →Row 07 (096-111) : various melon fruit )
← Older edit
Latest revision as of 14:48, 1 April 2023
( edit ) ( undo )
Lawzy93 ( talk | contribs )
m ( →Creating a custom tileset )
(150 intermediate revisions by 37 users not shown)
Line 1: Line 1:
−
{{Quality| Exceptional
}}{{av}} + {{migrated article}}
+
{{Quality| Unrated
}}{{av}}
+ :''(For an overview of graphics in DF, see [[Graphics|Graphics]])''
:''(For a chart with the default ASCII characters, see [[Main:Character table|Character table]].)''
:''(For a chart with the default ASCII characters, see [[Main:Character table|Character table]].)''
−
:''(For user-created tilesets, see [[Main:Tileset repository|Tileset repository]].)'' +
:''(For user-created creature
tilesets, see [[Main:Tileset repository|Tileset repository]].)''
−
:''(For user-created creature graphics
sets, see [[ Graphics
set repository
]] .
)''
+
:''(For information about Graphic
sets, see [[ Graphic
set |Graphic set]])''
+ :''(For information on how tilesets get colored, see [[Color
]])''
+ ----
−
--- -
+ '''Tilesets''' are images the game uses to display its graphics when "Use Classic ASCII Glyphs" is set to "Yes"; each tile is used to show text and represent things. Users create custom tilesets for a number of reasons, including increased visibility, aesthetics, or small size. Tilesets come in two flavors: "'''character sets'''" (or simply "tilesets") and "'''graphics sets'''". This article is only about tilesets.
+
+ == Overview ==
+
+
A character set (or 'tileset') is an image in BMP or PNG format that contains the 256 different tiles (numbered 0
- 255), corresponding to the [[Main:Character table|IBM Code Page 437]] (sometimes called Extended ASCII), which are used to display all graphics. The tiles are always arranged in a 16x16 grid, but its dimensions can be varied. You can have both square and non
- square tiles, with 16x16 pixels being the most common size. (If "Use Classic ASCII Glyphs" is set to "No", the tileset must be 128x192 pixels (tiles 8x12 pixels) in order to render the customs tiles properly. See [[Graphic set]])
+
+ UI scaling will only work if the tileset id 128x192px (8x12px tiles).
+
+ As the tileset is limited to only 256 tiles, some objects share the same tile. Below is a detailed list.
+
+ In previous versions of Dwarf Fortress (v0.47 and below), some of the tiles could be changed in the raws and init files, and creatures could have separate graphics (see [[DF2014:Graphic set]], this functionality has been removed in v0.50 (and above) with separate graphics being controlled by mods with "Use Classic ASCII Glyphs" set to "No".
+
+ == Installation and creation of custom tilesets ==
+ === Installation ===
+
[[Tileset repository]] is a list of user
-
made standard tilesets, and provides [[Tileset_repository#Installation|installation instructions]].
−
'''Tilesets''' are images
the game uses to display its graphics; each tile is used to show text
and represent things
.
Users create custom tilesets for a number of reasons, including increased visibility, aesthetics
, or small size. Tilesets come in two flavors: "'''character sets'''" (or simply "tilesets")
and "'''graphics sets'''"
.
+
=== Creating a custom tileset ===
+ Scaling occurs automatically based on
the
size of the tiles
and the window
.
+
The desired grid
, interface scaling
and
percentage settings only work when using 8x12 tiles
.
−
== Overview
and installation ==
+
When creating a custom tileset, it's often easiest to start with an existing one,
and edit it to your liking. Tilesets generally fall into two categories: rectangular tilesets and square tilesets. Rectangular tilesets have tiles that are taller than they are wide. The text in these tilesets is generally easier to read, but the map appears squished horizontally. Square tilesets usually provide more attractive graphics, but are slightly less readable.
−
=== Character sets ===
+ The graphics in Dwarf Fortress can be enhanced by setting "Use Classic ASCII Glyphs" to "No" and installing a [[Graphics set]] mod. (A default is provided in the premium version, but has been removed in the classic "free" version.)
−
A character set is an image in BMP or PNG format that contains the 256 different tiles, corresponding to the
[ [Main
: Character table|IBM Code Page 437
] ] (sometimes called Extended ASCII)
, which are
used to display the main graphics
. [[Main:Tileset repository
| Here is the list]] of user-made standard tilesets. To install any of these tilesets, follow these steps:
+
Mifki created a
[ http
: //mifki.com/df/fontgen/ tool
] to make a tileset from any font
, which can be
used as starting point or as is
. {{cite forum
| 140250}}
−
# Download
the tileset via right-click-save-as on
the tileset
.
The tileset
is
just an image, so there's no separate download link. (The list is [[Main:Tileset repository|here]])
+
Many tiles are used by
the game in multiple ways, and this makes customizing
the graphics difficult
. The same icon
is
used for chairs and
the north end
of one-tile-wide vertical bridges
. Ashes
and
broken arrows look
the same
, and many game entities (such as levers
,
floodgates
, bags
, and bins) share characters that are
also used in Dwarven names or other bits
of text in
the
interface
.
− # Convert it into a 24-bit BMP file<sup>V0.28.181.40d</sup> file or PNG file<sup>v0.31.06</sup>. Do NOT just change the extension to .bmp; you must use a program like MS paint to save it as a .bmp.
− # Put it in
the data/art directory
of
your Dwarf Fortress installation.
− # Open data/init/init
. txt
−
# If you want to use the tileset in fullscreen mode, locate
and modify
the
[FULLSCREENX:800], [FULLSCREENY:600]
, and
[FULLFONT:curses_800x600.bmp] configuration lines to match the specifications from the tileset list. The FULLFONT directive should match the filename of the tileset you downloaded. If you want to use the tileset in windowed mode
, search for the [WINDOWEDX:640]
, [WINDOWEDY:300]
, and
[FONT:curses_640x300.bmp] lines instead, and change them to the correct values.
−
# It is
also recommended you keep [BLACK_SPACE:YES] to prevent stretching
of the graphics.
− # Save the
. txt file, then you're ready to play!
−
=== Graphics sets ===
+ Some of these issues could be fixed by the third-party Text Will Be Text (TWBT) plugin for the [[DF2014:DFHack]] modding API. This has not been updated for compatibility with v0.50.
−
Character sets only change certain graphics, while others are left out. The confusingly-named [[graphics set]]s are used to change the appearance of [[creatures]]
in the game, such as dwarves and unicorns. They usually come with and are designed to work together with certain [[DF2012:Tilesets|tilesets]]. They can significantly change the appearance of the game and make it easier for players to tell what is happening onscreen. While Tilesets work the same as previous versions, Graphics Sets will have to be redone as the raws have changed. +
=== Generating a custom tileset from a font
in Linux ===
−
== Custom
tileset design ==
+
In Linux, it is possible to create
tileset from a .ttf font programmatically in the terminal. The following command will open a terminal window with your desired font, rendered appropriately for ''Dwarf Fortress'', and screenshots it. It requires xterm, the screenshot utility xwd, and a text file containing the code page 437 characters in the appropriate order.
−
The default (and minimum) gameplay viewport is 80 characters wide, and 25 characters tall. Therefore, a tileset
's
target resolution will be TILE_X_LENGTH * 80 by TILE_Y_LENGTH * 25
. Since the tileset is arranged into a 16x16 grid of tiles (256 tiles total
) , the tileset image size will be TILE_X_LENGTH * 16 by TILE_Y_LENGTH * 16
. Here are some common tile sizes:
+
<pre>xterm -fa "FONTFAMILY:pixelsize:SIZE:antialias=false" -bg magenta -geometry 16x16 -e "setterm -cursor off && printf
' %
s ' \"\$(<PATH/TO/CODE437
. txt
) \" && sleep 0
. 1 && xwd -id \$WINDOWID | xwdtopnm | pnmtopng > \"FONTFAMILY-SIZE.png\""</pre>
−
* A tileset with 10x12 tiles
will be 160x192 pixels large
, and the target resolution will be 800x300. +
This
will generate an image in your current directory
, so it might
be a good idea to cd into your /data/art directory beforehand
.
− * A tileset with 16x16 tiles will be 256x256 pixels large, and the target resolution will
be 1280x400
.
−
When creating a custom tileset, it
' s often easiest to start with an existing one
, and edit it to your liking. Tilesets generally fall into three categories: rectangular tilesets, square tilesets, and 16x16 square tilesets. Rectangular tilesets have tiles that are taller than they are wide. The text
in these tilesets is generally easier to read, but the map appears squished horizontally
. Square tilesets usually provide more attractive graphics, but are slightly less readable. The 16x16 square tilesets are just
a sub-set
, which are grouped together because most [[graphics set|object tilesets]] use 16x16 tiles. The graphics in Dwarf Fortress
can be somewhat diversified and enhanced through the use of graphics sets.
+
' ''This works ''much'' better for bitmap fonts
, in their native size
. ''' For
a
list of such fonts on your system and their sizes
, you
can run
−
Many tiles are used by the game in multiple ways, and this makes customizing the graphics difficult. The same icon is used for chairs and the north end of one
-
tile-wide vertical bridges. Ashes and broken arrows look the same, and many game entities (such as levers, floodgates, bags, and bins) share characters that are also used in Dwarven names or other bits of text in the interface. +
<pre>fc
- list :scalable=false:spacing=mono family pixelsize</pre>
− <!--
=== How colors other than white and magenta work === +
=== How colors other than white and magenta work ===
When the game draws a tile, it will select a foreground color, a background color, and a tile based on the item being drawn. The background color will be used in place of magenta (Hex code #FF00FF or RGB 255 0 255). All other colors in the tile will be treated as a mask against the foreground color. Pure white (#FFFFFF) will always show the foreground color, while light grey (#CCCCCC) will be a slightly darker version of the foreground color, and dark grey (#888888) will be a dark version of the foreground color. Black (#000000) will always be black. It is impossible to use different shades of the background color.
When the game draws a tile, it will select a foreground color, a background color, and a tile based on the item being drawn. The background color will be used in place of magenta (Hex code #FF00FF or RGB 255 0 255). All other colors in the tile will be treated as a mask against the foreground color. Pure white (#FFFFFF) will always show the foreground color, while light grey (#CCCCCC) will be a slightly darker version of the foreground color, and dark grey (#888888) will be a dark version of the foreground color. Black (#000000) will always be black. It is impossible to use different shades of the background color.
+
+ Alpha values are supported in png fonts (since v0.43.04), allowing for better transparency, and partial transparency, enabling anti-aliased tilesets and other interesting tricks.
In general, just remember these rules:
In general, just remember these rules:
Line 79: Line 94:
|}
|}
−
As illustrated by this example, colors in the tileset can result in colors that aren't in the foreground color or the tile graphic. In this case, a brown foreground color with a cyan pixel color in the tileset results in a final color of green. +
As illustrated by this example, colors in the tileset can result in colors that aren't in the foreground color or the tile graphic. In this case, a brown foreground color with a cyan pixel color in the tileset results in a final color of green.
−
Theoretically, the way the game handles color masks could be used to display different graphics for items that use the same tile (but whose respective colors use different color component channels). For example, if a bright red object and a bright blue object use the same tile, the tile can use bright red for all pixels that only the red object uses, bright blue for all pixels only the blue object uses, and bright magenta (but NOT #FF00FF, it would have to be #FE00FE or something similar) for all pixels both objects use. In this fashion the two objects that share a tile would look completely different. In practice however, this is probably impossible because so many objects share the same tile, the chances of the potential foreground colors sharing a red, green, or blue color component are too great. -->
+
Theoretically, the way the game handles color masks could be used to display different graphics for items that use the same tile (but whose respective colors use different color component channels). For example, if a bright red object and a bright blue object use the same tile, the tile can use bright red for all pixels that only the red object uses, bright blue for all pixels only the blue object uses, and bright magenta (but NOT #FF00FF, it would have to be #FE00FE or something similar) for all pixels both objects use. In this fashion the two objects that share a tile would look completely different. In practice however, this is probably impossible because so many objects share the same tile, the chances of the potential foreground colors sharing a red, green, or blue color component are too great.
== What tiles are used for what ==
== What tiles are used for what ==
−
* Items marked with * can have their tile changed in the [[modding|raw data]] files. +
* Items marked with * can have their tile changed in the [[modding|raw data]] files.
<small>[This list need validating for v0.50]</small>
−
* Items marked with <sup>#</sup> can have their tile replaced by a [[ graphics
set]] image, in addition to having their tile changed in the raw data. +
* Items marked with <sup>#</sup> can have their tile replaced by a [[ graphic
set]] image, in addition to having their tile changed in the raw data.
* Items marked with <sup>$</sup> can be changed in the [[d_init.txt]] file.
* Items marked with <sup>$</sup> can be changed in the [[d_init.txt]] file.
+ * Items marked with <sup>¢</sup> use dual colors.
+ * Items marked with <sup>÷</sup> use inverted tile
For a graphical table, go to the [[Main:Character Table|Character Table]].
For a graphical table, go to the [[Main:Character Table|Character Table]].
Line 110: Line 127:
|-
|-
|<small>005</small> {{TST|♣}}
|<small>005</small> {{TST|♣}}
−
| [[Quarry bush]] es
* {{verify}}
, blossoms*, [[Tilesets#Trees_on_map|various forest trees]]* +
| [[Quarry bush]] leaves
*, blossoms*, [[Tilesets#Trees_on_map|various forest trees]]*
|-
|-
|<small>006</small> {{TST|♠}}
|<small>006</small> {{TST|♠}}
−
| [[Forest|Broadleaf Forest
]], [[Tilesets#Trees_on_map|various forest trees]]*, various leaf items* +
| [[Forest|Broadleaf forest
]], [[Tilesets#Trees_on_map|various forest trees]]*, various leaf items
*, [[Plump helmet]]s
*
|-
|-
|<small>007</small> {{TST|•}}
|<small>007</small> {{TST|•}}
−
| Mined out [[stone]]*, solid [[workshop]] tile for several workshops like the [[magma smelter]], [[river]] sources in main
map, [[cave]]s in main
map, moon on travel map, flower buds*
+
| Mined -
out [[stone]]*, solid [[workshop]] tile for several workshops like the [[magma smelter]]
, filled [[nest box]] building
, [[river]] sources on world
map, [[cave]]s on world map, [[lair]]s on world
map, moon on travel map, flower buds*
|-
|-
|<small>008</small> {{TST|◘}}
|<small>008</small> {{TST|◘}}
−
| Solid workshop tile for several other workshops like the [[magma forge]], [[tanner's shop]], [[catapult]] cup
, fortress keeps on travel map
, [[nest box]] tool*, [[nest box]] building, [[ book
]]
+
| Solid workshop tile for several other workshops like the [[magma forge]], [[tanner's shop]], [[catapult]] cup, [[nest box]] tool*, empty
[[nest box]] building, [[ codex|codices]], [[die|dice
]]
|-
|-
|<small>009</small> {{TST|○}}
|<small>009</small> {{TST|○}}
−
| [[Well]], [[vermin]] colony, [[millstone]], [[quern]], vertical [[axle]], fortress walls on travel map, sun behind clouds on travel map,
fortresses
on world map, [[creeping eye]] out of view (adventure mode)*, [[staring eyeball]]*, [[bubble bulb]]* +
| [[Well]], [[vermin]] colony, [[millstone]], [[quern]], vertical [[axle]], fortress walls on travel map, sun behind clouds on travel map,
[[castle]]s on world map, [[monastery|monasteries]]
on world map, [[creeping eye]] out of view (adventure mode)*, [[staring eyeball]]*, [[bubble bulb]]*
|-
|-
|<small>010</small> {{TST|◙}}
|<small>010</small> {{TST|◙}}
−
| trunk<sup>$</sup> +
| trunk interior
<sup>$</sup> , [[fort|forts]] on world map
|-
|-
|<small>011</small> {{TST|♂}}
|<small>011</small> {{TST|♂}}
−
| [[Gender|Male]] sign, [[bag]]s, [[Tilesets#Creatures|
Various Cephalopods
]]<sup>#</sup>
+
| [[Gender|Male]] sign, [[bag]]s, [[Tilesets#Creatures|
various cephalopods
]]<sup>#</sup>
|-
|-
|<small>012</small> {{TST|♀}}
|<small>012</small> {{TST|♀}}
Line 134: Line 151:
|-
|-
|<small>013</small> {{TST|♪}}
|<small>013</small> {{TST|♪}}
−
| [[Tool|Ladle]]s* +
| [[Tool|Ladle]]s* , [[dancer]]s dancing
|-
|-
|<small>014</small> {{TST|♫}}
|<small>014</small> {{TST|♫}}
−
| [[Armor stand]]s +
| [[Armor stand ]]s, playing [[instrument
]]s
|-
|-
|<small>015</small> {{TST|☼}}
|<small>015</small> {{TST|☼}}
−
| Unmined
[[Gem]] Cluster
*, Rough [[Gem]]s and Raw [[Glass]], unmined [[bituminous coal]]*, mined [[bituminous coal]]*, [[currency
]] symbol, masterpiece [[Item quality|quality
]] symbol, spider [[web]]s, [[pond turtle]]*, sun, [[gear assembly|gear assemblies]], paralyzed [[Status icon|indicator]], fireballs, bandit camps on travel map +
| Masterpiece [[Item quality|quality]] tags, unmined
[[Gem |gem
]] cluster
*, Rough [[Gem |gem
]]s and Raw [[Glass |glass
]], unmined [[bituminous coal]]*, mined [[bituminous coal]]*, [[currency]] symbol, spider [[web]]s, [[pond turtle]]*, sun, [[gear assembly|gear assemblies]], paralyzed [[Status icon|indicator]], fireballs, bandit camps on travel map
, towns on world map, night creature senses, artifact gem [[door]]s<sup>¢</sup>
|-
|-
|}
|}
Line 157: Line 174:
|-
|-
|<small>019</small> {{TST|‼}}
|<small>019</small> {{TST|‼}}
−
| [[Cage]]s, on-[[fire]] tags, vertical [[bars]] +
| [[Cage]]s <sup>¢</sup>
, on-[[fire]] tags, vertical [[bars]]
|-
|-
|<small>020</small> {{TST|¶}}
|<small>020</small> {{TST|¶}}
−
| [[Finished_goods#Goblets|Mug]]s, largest forest retreats, cumulonimbus clouds on travel map, [[Highwood]] forests* +
| [[Finished_goods#Goblets|Mug]]s , [http://www.bay12forums.com/smf/index.php?topic=161047.msg7660465#msg7660465 drinking] in-progress
, largest forest retreats, cumulonimbus clouds on travel map, [[Highwood]] forests*
|-
|-
|<small>021</small> {{TST|§}}
|<small>021</small> {{TST|§}}
Line 175: Line 192:
|-
|-
|<small>025</small> {{TST|↓}}
|<small>025</small> {{TST|↓}}
−
| [[Status icon|Various status indicators]]
, Interface text (bridge direction) +
| Interface text (bridge direction),
[[Status icon|Various status indicators]]
|-
|-
|<small>026</small> {{TST|→}}
|<small>026</small> {{TST|→}}
Line 190: Line 207:
|-
|-
|<small>030</small> {{TST|▲}}
|<small>030</small> {{TST|▲}}
−
| Head of [[Ballista arrow]] facing north, ramp up
, track ramp up<sup>$</sup>, mountain on world map +
| Head of [[Ballista arrow]] facing north, [[
ramp ]]
, [[Minecart|
track ]]
ramp up<sup>$</sup>, mountain on world map
|-
|-
|<small>031</small> {{TST|▼}}
|<small>031</small> {{TST|▼}}
−
| Head of [[Ballista arrow]] facing south, ramp down
, track ramp
down
<sup>$</sup>
+
| Head of [[Ballista arrow]] facing south, [[
ramp ]] on level below
,
[[Minecart|
track ]]
ramp on level below
<sup>$</sup>
|-
|-
|}
|}
Line 201: Line 218:
|-
|-
|<small>032</small> {{TST| }}
|<small>032</small> {{TST| }}
−
| Unexplored underground, spaces
in text messages, black background on the title screen and interface menu +
| Spaces
in text messages , Unexplored underground
, black background on the title screen and interface menu
|-
|-
|<small>033</small> {{TST|!}}
|<small>033</small> {{TST|!}}
−
| [[Status icon|various status icons]] , text
, sound indicator in sneaking mode, tracks (footprints) in sneaking mode +
| Text,
[[Status icon|various status icons]], sound indicator in sneaking mode, tracks (footprints) in sneaking mode
|-
|-
|<small>034</small> {{TST|"}}
|<small>034</small> {{TST|"}}
−
| [[ Shrub
]]*, quotation marks, Carpenter's workshop tile, [[kobold]] out of view*, [[ goblins
]] out of view*, [[blizzard man]] out of view*
, fallen leaves{{verify}}
, tracks (bent vegetation) in sneaking mode, [[Tilesets#Stones|various stones]]*, savanna, swamp, shrubland, marsh
+
| Text,
[[ shrub
]]* , [[Status icon|various status icons]]
, quotation marks, Carpenter's workshop tile, [[kobold]] out of view*, [[ goblin
]] out of view*, [[blizzard man]] out of view*, tracks (bent vegetation) in sneaking mode, [[Tilesets#Stones|various stones]]*, savanna, swamp, shrubland, marsh
|-
|-
|<small>035</small> {{TST|#}}
|<small>035</small> {{TST|#}}
−
| [[Grate#Floor_Grate|floor grates]], [[Tilesets#Stones|various stones]]*, labyrinths on travel map, text +
| Text,
[[Grate#Floor_Grate|floor grates]], [[Tilesets#Stones|various stones]]*
, smoothed branches in elven forest retreats
, labyrinths on travel map, towns on world map
|-
|-
|<small>036</small> {{TST|$}}
|<small>036</small> {{TST|$}}
Line 222: Line 239:
|-
|-
|<small>039</small> {{TST|'}}
|<small>039</small> {{TST|'}}
−
| Rough
[[floor]]s, unexplored underground, [[Tilesets#Stones|various stones]], one eyed creatures with GLOWTILE " (kobold, goblins, and blizzard in vanilla), various [[grass|grasses]]* +
| Text, rough
[[floor]]s, unexplored underground, [[Tilesets#Stones|various stones]], one eyed creatures with GLOWTILE " (kobold, goblins, and blizzard in vanilla), various [[grass|grasses]]*
|-
|-
−
|<small>040</small> {{TST|(}} + |style="white-space:nowrap"
|<small>040</small> {{TST|(}}
−
| Foreign
object opening tag, tile in [[bowyer's workshop]], waxing
moon on travel map , text
+
| Text, foreign
object opening tag, tile in [[bowyer's workshop]], waning
moon on travel map
|-
|-
|<small>041</small> {{TST|)}}
|<small>041</small> {{TST|)}}
−
| Foreign
object closing tag, waning
moon on travel map , text
+
| Text, foreign
object closing tag,
waxing
moon on travel map
|-
|-
|<small>042</small> {{TST|*}}
|<small>042</small> {{TST|*}}
−
| Unmined [[ore]]*, [[Hell|glowing pits]]
, superior [[Item quality|quality]] tags
, key reference, working [[gear assembly]], [[gem]] [[floodgate]], [[Tilesets#Stones|various stones]]*, chestnut fruit*, other fruits and flowers*, moving armies on quick travel map +
| Interface text, superior [[Item quality|quality]] tags,
Unmined [[ore]]*, [[Hell|glowing pits]], key reference, working [[gear assembly]], [[gem]] [[floodgate]], [[Tilesets#Stones|various stones]]*, chestnut fruit*, other fruits and flowers*, moving armies on quick travel map, towns on world
map
|-
|-
|<small>043</small> {{TST|+}}
|<small>043</small> {{TST|+}}
−
| Smooth/constructed [[floor]]s
, finely-crafted [[Item quality|quality]] tags,
text
, [[block]]/[[bar]] [[bridge]] or [[road]], [[Bauxite]]*, [[wound|injury]] [[Status icon|indicator]], towns on world map +
| Text
, finely-crafted [[Item quality|quality]] tags,
Smooth/constructed [[floor]]s
, [[block]]/[[bar]] [[bridge]] or [[road]], [[Bauxite]]*, [[wound|injury]] [[Status icon|indicator]], towns on world map
, mining designation
|-
|-
|<small>044</small> {{TST|,}}
|<small>044</small> {{TST|,}}
−
| Rough
[[floor]]s, [[Claystone]]*, unexplored underground , text
, various [[grass|grasses]]* +
| Text, rough
[[floor]]s, [[Claystone]]*, unexplored underground, various [[grass|grasses]]*
|-
|-
|<small>045</small> {{TST|-}}
|<small>045</small> {{TST|-}}
−
| [[Finished_goods#Crafts|Scepters]], [[arrow]]s in flight
, well-crafted [[Item quality|quality]] tags, keyboard reference, [[Tilesets#Stones|various stones]]*, [[Status icon|overlapping creatures animation]] +
| Text
, well-crafted [[Item quality|quality]] tags
, [[Finished_goods#Crafts|Scepters]]
, keyboard reference, [[Tilesets#Stones|various stones]]*, [[Status icon|overlapping creatures animation]]
|-
|-
|<small>046</small> {{TST|.}}
|<small>046</small> {{TST|.}}
−
| Rough
[[floor]]s, [[Tilesets#Stones|various stones]]*
, text
, unexplored underground, various [[grass|grasses]]*
+
| Text, rough
[[floor]]s, [[Tilesets#Stones|various stones]]*, unexplored underground, various [[grass|grasses]]*
|-
|-
|<small>047</small> {{TST|/}}
|<small>047</small> {{TST|/}}
−
| [[ Weapon
]]s, [[bolt]]s, [[Ballista]] tile, text
, [[Status icon|overlapping creatures animation]]
+
| Text,
[[ weapon
]]s, [[bolt]]s, [[Ballista]] tile, [[Tool|Pestle]]
, [[Status icon|overlapping creatures animation]]
, [[Tool#Tools_Usable_as_Weapons|stone axe]]{{version|0.43.01}}, active [[Windmill|windmill]] blade
|-
|-
|}
|}
Line 254: Line 271:
|-
|-
|<small>048</small> {{TST|0}}
|<small>048</small> {{TST|0}}
−
| [[ Coffin
]]s, text +
| Text,
[[ coffin
]]s, tombs on world map
|-
|-
|<small>049</small> {{TST|1}}
|<small>049</small> {{TST|1}}
−
|Text, fluids if [[Technical_tricks#Tiles|SHOW_FLOW_AMOUNTS]] is YES in d_init.txt +
| Text , designation priorities, adventurer mode conversation targets
, fluids if [[Technical_tricks#Tiles|SHOW_FLOW_AMOUNTS]] is YES in d_init.txt
|-
|-
|<small>050</small> {{TST|2}}
|<small>050</small> {{TST|2}}
−
|Text, fluids if SHOW_FLOW_AMOUNTS is YES in d_init.txt
+
| Text , designation priorities, adventurer mode conversation targets
, fluids if SHOW_FLOW_AMOUNTS is YES in d_init.txt
|-
|-
|<small>051</small> {{TST|3}}
|<small>051</small> {{TST|3}}
−
|Text, fluids if SHOW_FLOW_AMOUNTS is YES in d_init.txt
+
| Text , designation priorities, adventurer mode conversation targets
, fluids if SHOW_FLOW_AMOUNTS is YES in d_init.txt
|-
|-
|<small>052</small> {{TST|4}}
|<small>052</small> {{TST|4}}
−
|Text, fluids if SHOW_FLOW_AMOUNTS is YES in d_init.txt
+
| Text , designation priorities, adventurer mode conversation targets
, fluids if SHOW_FLOW_AMOUNTS is YES in d_init.txt
|-
|-
|<small>053</small> {{TST|5}}
|<small>053</small> {{TST|5}}
−
|Text, fluids if SHOW_FLOW_AMOUNTS is YES in d_init.txt
+
| Text , designation priorities, adventurer mode conversation targets
, fluids if SHOW_FLOW_AMOUNTS is YES in d_init.txt
|-
|-
|<small>054</small> {{TST|6}}
|<small>054</small> {{TST|6}}
−
|Text, fluids if SHOW_FLOW_AMOUNTS is YES in d_init.txt
+
| Text , designation priorities, adventurer mode conversation targets
, fluids if SHOW_FLOW_AMOUNTS is YES in d_init.txt
|-
|-
|<small>055</small> {{TST|7}}
|<small>055</small> {{TST|7}}
−
|Text, fluids if SHOW_FLOW_AMOUNTS is YES in d_init.txt
+
| Text , designation priorities, adventurer mode conversation targets
, fluids if SHOW_FLOW_AMOUNTS is YES in d_init.txt
|-
|-
|<small>056</small> {{TST|8}}
|<small>056</small> {{TST|8}}
−
|Fortress gates on travel map , text +
| Text,
Fortress gates on travel map
|-
|-
|<small>057</small> {{TST|9}}
|<small>057</small> {{TST|9}}
−
|Text +
| Text
|-
|-
|<small>058</small> {{TST|:}}
|<small>058</small> {{TST|:}}
−
| [[ Wild
strawberry]]*, [[prickle berry]]*, [[fisher berry]]*, [[sun berry]]*, snowstorms, underground shrubs* , command menu text
+
| Interface text,
[[strawberry]]*, [[prickle berry]]*, [[fisher berry]]*, [[sun berry]]*, snowstorms, underground shrubs*
|-
|-
|<small>059</small> {{TST|;}}
|<small>059</small> {{TST|;}}
−
| [[Mason's workshop]], [[Kitchen]], [[Selenite]]*
, command menu text ([[CMV|Movies]] key)
, twigs<sup>$</sup>
+
| Interface text (command menu [[CMV|Movies]] key),
[[Mason's workshop]], [[Kitchen]], [[Selenite]]*, twigs<sup>$</sup>
|-
|-
|<small>060</small> {{TST|<}}
|<small>060</small> {{TST|<}}
−
| [[Stairs]] up, brackets around squad names, "Less than 1 unit weight" on Trading screen. +
| Interface text (trading screen "Less than 1 unit weight"), brackets around squad names,
[[Stairs]] up, west move indicator (adventure mode)
|-
|-
|<small>061</small> {{TST|=}}
|<small>061</small> {{TST|=}}
−
| Empty [[Stockpile]]s, hamlets on world map, [[Tilesets#Stones|various stones]]*, +
| Empty [[Stockpile]]s, hamlets on world map, [[Tilesets#Stones|various stones]]*,
middle-left tile of [[Furnace|Furnaces]], up-right tile of [[Carpenter's workshop]]
|-
|-
|<small>062</small> {{TST|>}}
|<small>062</small> {{TST|>}}
−
| [[Stairs]] down, brackets around squad names. +
| Brackets around squad names,
[[Stairs]] down,
east move indicator (adventure mode)
|-
|-
|<small>063</small> {{TST|?}}
|<small>063</small> {{TST|?}}
−
| [[Status icon|various status icons]] +
| Text,
[[Status icon|various status icons]]
|-
|-
|}
|}
Line 310: Line 327:
|-
|-
|<small>065</small> {{TST|A}}
|<small>065</small> {{TST|A}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup>, Tile in Farm Workshop , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>, Tile in Farm Workshop
|-
|-
|<small>066</small> {{TST|B}}
|<small>066</small> {{TST|B}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
|<small>067</small> {{TST|C}}
|<small>067</small> {{TST|C}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup>, text +
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>, construction designations
|-
|-
|<small>068</small> {{TST|D}}
|<small>068</small> {{TST|D}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup>, Depot Access Display , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>, Depot Access Display
|-
|-
|<small>069</small> {{TST|E}}
|<small>069</small> {{TST|E}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
|<small>070</small> {{TST|F}}
|<small>070</small> {{TST|F}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
|<small>071</small> {{TST|G}}
|<small>071</small> {{TST|G}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
|<small>072</small> {{TST|H}}
|<small>072</small> {{TST|H}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup>, text +
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>, high traffic designation
|-
|-
|<small>073</small> {{TST|I}}
|<small>073</small> {{TST|I}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup>, [[support]], [[ tower
|Necromancer's tower]] on world map , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>, [[support]], [[ Tower (necromancy)
|Necromancer's tower]] on world map
|-
|-
|<small>074</small> {{TST|J}}
|<small>074</small> {{TST|J}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
|<small>075</small> {{TST|K}}
|<small>075</small> {{TST|K}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
|<small>076</small> {{TST|L}}
|<small>076</small> {{TST|L}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup>, text +
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>, low traffic designation
|-
|-
|<small>077</small> {{TST|M}}
|<small>077</small> {{TST|M}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
|<small>078</small> {{TST|N}}
|<small>078</small> {{TST|N}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
|<small>079</small> {{TST|O}}
|<small>079</small> {{TST|O}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup>, [[trade depot]] post, glass portal, Tile in Farm Workshop, column<sup>$</sup>, wall construction, full moon on travel map and dwarf mode , text
, trunk<sup>$</sup>, [[staring eyeball]]*, [[bubble bulb]]*
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>, [[trade depot]] post, glass portal, Tile in Farm Workshop, column<sup>$</sup>, wall construction, full moon on travel map and dwarf mode, trunk<sup>$</sup>, [[staring eyeball]]*, [[bubble bulb]]*
, [[Windmill|windmill]] hub
|-
|-
|}
|}
Line 359: Line 376:
{|
{|
|-
|-
−
|<small>080</small> {{TST|P}} +
|<small>080</small>
{{TST|P}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
−
|<small>081</small> {{TST|Q}} +
|<small>081</small>
{{TST|Q}}
| Text
| Text
|-
|-
−
|<small>082</small> {{TST|R}} +
|<small>082</small>
{{TST|R}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup>, text +
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>, restricted traffic designation
|-
|-
−
|<small>083</small> {{TST|S}} +
|<small>083</small>
{{TST|S}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
−
|<small>084</small> {{TST|T}} +
|<small>084</small>
{{TST|T}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
−
|<small>085</small> {{TST|U}} +
|<small>085</small>
{{TST|U}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
−
|<small>086</small> {{TST|V}} +
|<small>086</small>
{{TST|V}}
−
| Badlands on map , Text +
| Text,
Badlands on map
|-
|-
−
|<small>087</small> {{TST|W}} +
|<small>087</small>
{{TST|W}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
, Depot Access Display +
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>, Depot Access Display
|-
|-
−
|<small>088</small> {{TST|X}} +
|<small>088</small>
{{TST|X}}
−
|[[Bin]], [[floodgate]], shop post, building footprint, Depot Access Display
, text
, up/down stairs, Tile in Ashery , keyboard cursor
, [[Archery target]], [[Status icon|various status indicators]] +
| Text, [[wear]] tags, keyboard cursor,
[[Bin]] <sup>¢</sup>
, [[floodgate]]
<sup>¢</sup>
, shop post, building footprint, Depot Access Display, up/down stairs, Tile in Ashery, [[Archery target]], [[Status icon|various status indicators]]
|-
|-
−
|<small>089</small> {{TST|Y}} +
|<small>089</small>
{{TST|Y}}
| Text, [[Yak]]<sup>#</sup>, [[Yeti]]<sup>#</sup>
| Text, [[Yak]]<sup>#</sup>, [[Yeti]]<sup>#</sup>
|-
|-
−
|<small>090</small> {{TST|Z}} +
|<small>090</small>
{{TST|Z}}
−
| Sleep [[Status icon|indicator]] , text +
| Text,
Sleep [[Status icon|indicator]]
|-
|-
−
|<small>091</small> {{TST|[}} +
|<small>091</small>
{{TST|[}}
−
| [[Clothing]], [[armor]], item stack opening tag, moon on travel map , text
, tracks (bootprints) in sneaking mode +
| Text, Floor tile in [[workshop]]s,
[[Clothing]], [[armor]], item stack opening tag, moon on travel map, tracks (bootprints) in sneaking mode
|-
|-
−
|<small>092</small> {{TST|\}} +
|<small>092</small>
{{TST|\}}
−
| [[Status icon|Overlapping creatures animation]], [[Ballista]] tile
+
| [[Status icon|Overlapping creatures animation]], [[Ballista]] tile
, [[Tool#Other_Tools|helves]]*{{version|0.43.01}}, active [[Windmill|windmill]] blade
|-
|-
−
|<small>093</small> {{TST|]}} +
|<small>093</small>
{{TST|]}}
−
| Floor tile in [[workshop]]s and [[furnace]]s, item stack closing tag
, text +
| Text,
Floor tile in [[workshop]]s and [[furnace]]s, item stack closing tag
|-
|-
−
|<small>094</small> {{TST|^}} +
|<small>094</small>
{{TST|^}}
−
| [[Trap]], [[Alabaster]]*, [[Aluminum]]*, [[Volcano]] on world map
+
| [[Trap]], [[Alabaster]]*, [[Aluminum]]*, [[Volcano]] on world map
, north move indicator (adventure mode), Mechanic Workshop center-south tile (in light cyan)
|-
|-
−
|<small>095</small> {{TST|_}} +
|<small>095</small>
{{TST|_}}
−
| [[Channel]] [[designation]] , text +
| Text,
[[Channel]] [[designation]]
|-
|-
|}
|}
Line 416: Line 433:
|-
|-
| <small>097</small> {{TST|a}}
| <small>097</small> {{TST|a}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
| <small>098</small> {{TST|b}}
| <small>098</small> {{TST|b}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
| <small>099</small> {{TST|c}}
| <small>099</small> {{TST|c}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
|<small>100</small> {{TST|d}}
|<small>100</small> {{TST|d}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
|<small>101</small> {{TST|e}}
|<small>101</small> {{TST|e}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
|<small>102</small> {{TST|f}}
|<small>102</small> {{TST|f}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
|<small>103</small> {{TST|g}}
|<small>103</small> {{TST|g}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
|<small>104</small> {{TST|h}}
|<small>104</small> {{TST|h}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
|<small>105</small> {{TST|i}}
|<small>105</small> {{TST|i}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
|<small>106</small> {{TST|j}}
|<small>106</small> {{TST|j}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
|<small>107</small> {{TST|k}}
|<small>107</small> {{TST|k}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
|<small>108</small> {{TST|l}}
|<small>108</small> {{TST|l}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
|<small>109</small> {{TST|m}}
|<small>109</small> {{TST|m}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
|<small>110</small> {{TST|n}}
|<small>110</small> {{TST|n}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
, [[Hills]] on map +
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>, [[Hills]] on map
|-
|-
|<small>111</small> {{TST|o}}
|<small>111</small> {{TST|o}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
, [[Graphite]]*, well construction, bridge construction, [[millstone]] in action, vertical axle in action, floor tile in magma [[furnace]]s, [[staring eyeball]]*, [[bubble bulb]]*, various
melon fruit
*
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>, [[Graphite]]*, well construction, bridge construction, [[millstone]] in action, vertical axle in action, floor tile in magma [[furnace]]s, [[staring eyeball]]*, [[bubble bulb]]*,
[[winter
melon ]]*, [[watermelon]]
*
|-
|-
|}
|}
Line 466: Line 483:
|-
|-
|<small>112</small> {{TST|p}}
|<small>112</small> {{TST|p}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
|<small>113</small> {{TST|q}}
|<small>113</small> {{TST|q}}
Line 472: Line 489:
|-
|-
|<small>114</small> {{TST|r}}
|<small>114</small> {{TST|r}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
|<small>115</small> {{TST|s}}
|<small>115</small> {{TST|s}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
|<small>116</small> {{TST|t}}
|<small>116</small> {{TST|t}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
|<small>117</small> {{TST|u}}
|<small>117</small> {{TST|u}}
Line 484: Line 501:
|-
|-
|<small>118</small> {{TST|v}}
|<small>118</small> {{TST|v}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
, [[Tilesets#Stones|various stones]]*, +
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>, [[Tilesets#Stones|various stones]]*,
south move indicator (adventure mode)
|-
|-
|<small>119</small> {{TST|w}}
|<small>119</small> {{TST|w}}
−
| [[Tilesets#Creatures| Various
creatures]]<sup>#</sup> , text
+
| Text,
[[Tilesets#Creatures| various
creatures]]<sup>#</sup>
|-
|-
|<small>120</small> {{TST|x}}
|<small>120</small> {{TST|x}}
−
| [[Saltpeter]]* , text +
| Text, [[wear]] tags,
[[Saltpeter]]*
|-
|-
|<small>121</small> {{TST|y}}
|<small>121</small> {{TST|y}}
Line 499: Line 516:
|-
|-
|<small>123</small> {{TST|{}}
|<small>123</small> {{TST|{}}
−
| Forbidden opening tag, tile in [[Jeweler's workshop]], vermin, [[purring maggot]]<sup>#</sup> +
| [[
Forbidden ]]
opening tag, tile in [[Jeweler's workshop]], vermin, [[purring maggot]]<sup>#</sup>
|-
|-
|<small>124</small> {{TST||}}
|<small>124</small> {{TST||}}
Line 505: Line 522:
|-
|-
|<small>125</small> {{TST|}}}
|<small>125</small> {{TST|}}}
−
| Forbidden closing tag, vermin, [[purring maggot]] alternate* +
| [[
Forbidden ]]
closing tag, vermin, [[purring maggot]] alternate*
|-
|-
|<small>126</small> {{TST|~}}
|<small>126</small> {{TST|~}}
Line 519: Line 536:
|-
|-
|<small>128</small> {{TST|Ç}}
|<small>128</small> {{TST|Ç}}
−
| [[Mechanism]]s , text +
| Text,
[[Mechanism]]s
|-
|-
|<small>129</small> {{TST|ü}}
|<small>129</small> {{TST|ü}}
Line 531: Line 548:
|-
|-
|<small>132</small> {{TST|ä}}
|<small>132</small> {{TST|ä}}
−
| Text +
| Text , [[Angel]]s
|-
|-
|<small>133</small> {{TST|à}}
|<small>133</small> {{TST|à}}
Line 540: Line 557:
|-
|-
|<small>135</small> {{TST|ç}}
|<small>135</small> {{TST|ç}}
−
| [[Finished_goods#Totems|Totem]]s +
| Text,
[[Finished_goods#Totems|Totem]]s
|-
|-
|<small>136</small> {{TST|ê}}
|<small>136</small> {{TST|ê}}
Line 552: Line 569:
|-
|-
|<small>139</small> {{TST|ï}}
|<small>139</small> {{TST|ï}}
−
| Text +
| Text , [[Pedestal]]*
|-
|-
|<small>140</small> {{TST|î}}
|<small>140</small> {{TST|î}}
−
| Elven forest retreat +
| Text,
Elven forest retreat
|-
|-
|<small>141</small> {{TST|ì}}
|<small>141</small> {{TST|ì}}
Line 561: Line 578:
|-
|-
|<small>142</small> {{TST|Ä}}
|<small>142</small> {{TST|Ä}}
−
| Deities
, [[Angel]]s +
| Text
, [[Angel]]s
|-
|-
|<small>143</small> {{TST|Å}}
|<small>143</small> {{TST|Å}}
−
| [[Figurine]]s, shrines on travel map , text +
| Text,
[[Figurine]]s, shrines on travel map
|-
|-
|}
|}
Line 572: Line 589:
|-
|-
|<small>144</small> {{TST|É}}
|<small>144</small> {{TST|É}}
−
| Text +
| Text , [[altar]]s
|-
|-
|<small>145</small> {{TST|æ}}
|<small>145</small> {{TST|æ}}
Line 581: Line 598:
|-
|-
|<small>147</small> {{TST|ô}}
|<small>147</small> {{TST|ô}}
−
| Cauldrons* + | Text, [[Tool
|Cauldrons ]]
*
|-
|-
|<small>148</small> {{TST|ö}}
|<small>148</small> {{TST|ö}}
−
| [[Jewelry|Ring]]s +
| Text,
[[Jewelry|Ring]]s
|-
|-
|<small>149</small> {{TST|ò}}
|<small>149</small> {{TST|ò}}
−
| Unactivated [[lever]]s, [[Tilesets#Creatures|Various creatures]]<sup>#</sup> , text
+
| Text,
Unactivated [[lever]]s, [[Tilesets#Creatures|Various creatures]]<sup>#</sup>
|-
|-
|<small>150</small> {{TST|û}}
|<small>150</small> {{TST|û}}
−
| [[Bucket]] , text +
| Text,
[[Bucket]] s
|-
|-
|<small>151</small> {{TST|ù}}
|<small>151</small> {{TST|ù}}
Line 596: Line 613:
|-
|-
|<small>152</small> {{TST|ÿ}}
|<small>152</small> {{TST|ÿ}}
−
| [[Valley herb]]* , text +
| Text,
[[Valley herb]]*
− |
|-
|-
|<small>153</small> {{TST|Ö}}
|<small>153</small> {{TST|Ö}}
−
| [[Jewelry|Bracelet]]s, wheelbarrows* +
| [[Jewelry|Bracelet]]s,
[[Wheelbarrow|
wheelbarrows ]]
*
|-
|-
|<small>154</small> {{TST|Ü}}
|<small>154</small> {{TST|Ü}}
Line 606: Line 622:
|-
|-
|<small>155</small> {{TST|¢}}
|<small>155</small> {{TST|¢}}
−
| [[ hatch
cover]]s +
| [[ Hatch
cover]]s <sup>¢</sup>, musical [[instrument]] pieces{{version|0.42.01}}
|-
|-
|<small>156</small> {{TST|£}}
|<small>156</small> {{TST|£}}
−
| [[Tilesets#Stones| various
stones]]*, [[Tilesets#Ores|most unmined ores]]*, +
| [[Tilesets#Stones| Various
stones]]*, [[Tilesets#Ores|most unmined ores]]*,
|-
|-
|<small>157</small> {{TST|¥}}
|<small>157</small> {{TST|¥}}
Line 615: Line 631:
|-
|-
|<small>158</small> {{TST|₧}}
|<small>158</small> {{TST|₧}}
−
| +
| [[Stepladder]]*, largest forest retreat ruins
|-
|-
|<small>159</small> {{TST|ƒ}}
|<small>159</small> {{TST|ƒ}}
Line 633: Line 649:
|-
|-
|<small>162</small> {{TST|ó}}
|<small>162</small> {{TST|ó}}
−
| Activated [[lever]]s , text +
| Text,
Activated [[lever]]s
|-
|-
|<small>163</small> {{TST|ú}}
|<small>163</small> {{TST|ú}}
Line 639: Line 655:
|-
|-
|<small>164</small> {{TST|ñ}}
|<small>164</small> {{TST|ñ}}
−
| [[Bogeyman]] +
| Text,
[[Bogeyman]]
|-
|-
|<small>165</small> {{TST|Ñ}}
|<small>165</small> {{TST|Ñ}}
Line 645: Line 661:
|-
|-
|<small>166</small> {{TST|ª}}
|<small>166</small> {{TST|ª}}
−
| [[Goblin]] settlements on world map +
| dark pit ruins
|-
|-
|<small>167</small> {{TST|º}}
|<small>167</small> {{TST|º}}
−
| [[Cloth]] +
| [[Cloth ]], [[dark pit
]]
|-
|-
|<small>168</small> {{TST|¿}}
|<small>168</small> {{TST|¿}}
−
| [[Finished_goods#Instruments| Instrument
]] +
| Musical
[[Finished_goods#Instruments| Instruments
]]
|-
|-
|<small>169</small> {{TST|⌐}}
|<small>169</small> {{TST|⌐}}
Line 666: Line 682:
|-
|-
|<small>173</small> {{TST| }}
|<small>173</small> {{TST| }}
−
| [[Flask]], [[Flask|waterskin]] +
| [[Flask]], [[Flask|waterskin ]], [[Container|Pouch
]]
|-
|-
|<small>174</small> {{TST|«}}
|<small>174</small> {{TST|«}}
−
| Tail of [[Ballista arrow]] facing west, item with [[decoration]] tag
+
| Tail of [[Ballista arrow]] facing west, item with [[decoration]] tags
|-
|-
|<small>175</small> {{TST|»}}
|<small>175</small> {{TST|»}}
−
| Tail of [[Ballista arrow]] facing east, item with [[decoration]] tag
+
| Tail of [[Ballista arrow]] facing east, item with [[decoration]] tags
|-
|-
|}
|}
Line 680: Line 696:
|-
|-
|<small>176</small> {{TST|░}}
|<small>176</small> {{TST|░}}
−
| Partially dug rock, various flows ([[miasma]], [[cave-in]] dust, [[steam]], smoke, etc.), [[Fishery]], fog on travel map, [[Semi-molten_rock|Semi-molten Rock]], [[Tilesets#Stones|various stones]]*, [[Tilesets#Soil|various soils]]*, fallen leaves +
| Partially dug rock, various flows ([[miasma]], [[cave-in]] dust, [[steam]], smoke, etc.), [[Fishery]], fog on travel map, [[Semi-molten_rock|Semi-molten Rock]], [[Tilesets#Stones|various stones]]*, [[Tilesets#Soil|various soils]]*
, Workshop wall tiles (craftdwarf's, bowyer's, mason's, mechanic's, jeweler's, clothier's, [[kitchen]], and leather works)
, fallen leaves , vermin swarm
|-
|-
|<small>177</small> {{TST|▒}}
|<small>177</small> {{TST|▒}}
−
| Partially dug rock, various flows ([[miasma]], [[cave-in]] dust, [[steam]], smoke, etc.), side tiles for catapult, [[window]], fog on travel map
, Workshops (craftdwarf's, bowyer's, mason's, mechanic's, jeweler's, clothier's, [[kitchen]], and leather works)
, [[Tilesets#Stones|various stones]]*, [[Tilesets#Soil|various kinds of soil]]*, fallen leaves, vermin swarm
+
| Partially dug rock, various flows ([[miasma]], [[cave-in]] dust, [[steam]], smoke, etc.), side tiles for catapult, [[window]], fog on travel map, [[Tilesets#Stones|various stones]]*, [[Tilesets#Soil|various kinds of soil]]*, fallen leaves, vermin swarm
|-
|-
|<small>178</small> {{TST|▓}}
|<small>178</small> {{TST|▓}}
−
| Partially dug rock, various flows ([[miasma]], [[cave-in]] dust, [[steam]], smoke, etc.), floor tile for ice, [[tanner's shop]], [[butcher's shop]], [[Wagon]] body, fog on travel map, [[Tilesets#Stones|various kinds of
soil
]]*, [[Tilesets#Soil|various kinds of soil]]*, sky<sup>$</sup>, fallen leaves
+
| Partially dug rock, various flows ([[miasma]], [[cave-in]] dust, [[steam]], smoke, etc.), floor tile for ice, [[tanner's shop]], [[butcher's shop]], [[Wagon]] body, fog on travel map, [[Tilesets#Stones|various kinds of
stones
]]*, [[Tilesets#Soil|various kinds of soil]]*, sky<sup>$</sup>, fallen leaves
|-
|-
|<small>179</small> {{TST|│}}
|<small>179</small> {{TST|│}}
−
| Overworld [[river]]s, [[well]] [[Restraint|chain/rope]], rotating horizontal [[axle]]s, branches<sup>$</sup> +
| Overworld [[river]]s, [[well]] [[Restraint|chain/rope]]
, [[bolt]]s in flight
, rotating horizontal [[axle]]s, branches<sup>$</sup>
, active EW [[Water_wheel|water wheel]], active [[Windmill|windmill]] blade, upright weapon trap
|-
|-
|<small>180</small> {{TST|┤}}
|<small>180</small> {{TST|┤}}
Line 698: Line 714:
|-
|-
|<small>182</small> {{TST|╢}}
|<small>182</small> {{TST|╢}}
−
| Branches<sup>$</sup> +
| Branches<sup>$</sup> , east [[Roller|roller]]
|-
|-
|<small>183</small> {{TST|╖}}
|<small>183</small> {{TST|╖}}
Line 710: Line 726:
|-
|-
|<small>186</small> {{TST|║}}
|<small>186</small> {{TST|║}}
−
| Smooth/constructed walls, [[bridge]]s, wooden [[door]]s, center [[catapult]] tile, center [[Ballista]] tile, [[axle]]s, tracks<sup>$</sup>, fortress walls on travel map, trunk<sup>$</sup> +
| Smooth/constructed walls, [[bridge]]s, wooden [[door]]s <sup>¢</sup>
, center [[catapult]] tile, center [[Ballista]] tile, [[axle]]s, tracks<sup>$</sup>, fortress walls on travel map, trunk<sup>$</sup>
, NS [[Water_wheel|water wheel]], [[Windmill|windmill]] blade
|-
|-
|<small>187</small> {{TST|╗}}
|<small>187</small> {{TST|╗}}
Line 725: Line 741:
|-
|-
|<small>191</small> {{TST|┐}}
|<small>191</small> {{TST|┐}}
−
| Overworld [[river]]s, branches<sup>$</sup> +
| Overworld [[river]]s, branches<sup>$</sup>
, northeast move indicator (adventure mode)
|-
|-
|}
|}
Line 733: Line 749:
|-
|-
|<small>192</small> {{TST|└}}
|<small>192</small> {{TST|└}}
−
| Overworld rivers/Roads, branches<sup>$</sup> +
| Overworld rivers/Roads, branches<sup>$</sup>
, southwest move indicator (adventure mode)
|-
|-
|<small>193</small> {{TST|┴}}
|<small>193</small> {{TST|┴}}
Line 745: Line 761:
|-
|-
|<small>196</small> {{TST|─}}
|<small>196</small> {{TST|─}}
−
| Overworld rivers/Roads, rotating [[axle]]s, branches<sup>$</sup>
+
| Overworld rivers/Roads , [[bolt]]s in flight
, rotating [[axle]]s, branches<sup>$</sup>
, active NS [[Water_wheel|water wheel]], active [[Windmill|windmill]] blade
|-
|-
|<small>197</small> {{TST|┼}}
|<small>197</small> {{TST|┼}}
−
| [[Door]]s, overworld rivers/Roads, floor [[Stone detailing|detailing]]/[[engraving]] in progress, branches<sup>$</sup> +
| [[Door]]s <sup>¢</sup>
, overworld rivers/Roads, floor [[Stone detailing|detailing]]/[[engraving]] in progress, branches<sup>$</sup>
|-
|-
|<small>198</small> {{TST|╞}}
|<small>198</small> {{TST|╞}}
Line 754: Line 770:
|-
|-
|<small>199</small> {{TST|╟}}
|<small>199</small> {{TST|╟}}
−
| branches<sup>$</sup> +
| branches<sup>$</sup> , west [[Roller|roller]]
|-
|-
|<small>200</small> {{TST|╚}}
|<small>200</small> {{TST|╚}}
Line 772: Line 788:
|-
|-
|<small>205</small> {{TST|═}}
|<small>205</small> {{TST|═}}
−
| Smooth/constructed walls, bridges, planted [[crop]]s, center [[catapult]] tile, center [[Ballista]] tile, [[axle]]s, tracks<sup>$</sup>, fortress walls on travel map, trunk<sup>$</sup> +
| Smooth/constructed walls, bridges, planted [[crop]]s, center [[catapult]] tile, center [[Ballista]] tile, [[axle]]s, tracks<sup>$</sup>, fortress walls on travel map, trunk<sup>$</sup>
, EW [[Water_wheel|water wheel]], [[Windmill|windmill]] blade
|-
|-
|<small>206</small> {{TST|╬}}
|<small>206</small> {{TST|╬}}
Line 778: Line 794:
|-
|-
|<small>207</small> {{TST|╧}}
|<small>207</small> {{TST|╧}}
−
| Tail of [[Ballista arrow]] facing north, [[screw press]] building, branches<sup>$</sup> +
| Tail of [[Ballista arrow]] facing north, [[screw press]] building, branches<sup>$</sup>
, south [[Roller|roller]]
|-
|-
|}
|}
Line 789: Line 805:
|-
|-
|<small>209</small> {{TST|╤}}
|<small>209</small> {{TST|╤}}
−
| [[Table]], tail of [[Ballista arrow]] facing south, branches<sup>$</sup> +
| [[Table]], tail of [[Ballista arrow]] facing south, branches<sup>$</sup>
, north [[Roller|roller]]
|-
|-
|<small>210</small> {{TST|╥}}
|<small>210</small> {{TST|╥}}
Line 813: Line 829:
|-
|-
|<small>217</small> {{TST|┘}}
|<small>217</small> {{TST|┘}}
−
| Overworld [[river]]s, branches<sup>$</sup> +
| Overworld [[river]]s, branches<sup>$</sup>
, southeast move indicator (adventure mode)
|-
|-
|<small>218</small> {{TST|┌}}
|<small>218</small> {{TST|┌}}
−
| Overworld rivers, branches<sup>$</sup> +
| Overworld rivers, branches<sup>$</sup> , northwest move indicator (adventure mode)
|-
|-
|<small>219</small> {{TST|█}}
|<small>219</small> {{TST|█}}
−
| Interface window border, trade depot tile, ice wall and dig-designated tiles +
| Interface window border, trade depot tile, ice wall and dig-designated tiles
, [[Mist]]
|-
|-
|<small>220</small> {{TST|▄}}
|<small>220</small> {{TST|▄}}
−
| [[ Siege engine
]] parts
, [[ Ballista
]]
tile
+
| [[ Ballista
]] tile
, [[ Siege engine
]]
parts
|-
|-
|<small>221</small> {{TST|▌}}
|<small>221</small> {{TST|▌}}
Line 848: Line 864:
|-
|-
|<small>227</small> {{TST|π}}
|<small>227</small> {{TST|π}}
−
| [[Cabinet]], [[goblin|dark fortress]]es
+
| [[Cabinet]] , [[Display case]]s<sup>÷</sup>*
, [[goblin|dark fortress]]es
|-
|-
|<small>228</small> {{TST|Σ}}
|<small>228</small> {{TST|Σ}}
Line 857: Line 873:
|-
|-
|<small>230</small> {{TST|µ}}
|<small>230</small> {{TST|µ}}
−
| [[Finished_goods#Crafts|Crown]], [[ruin]]s on world map +
| [[Finished_goods#Crafts|Crown]], [[ruin]]s on world map
, shop signs (adventure mode)
|-
|-
|<small>231</small> {{TST|τ}}
|<small>231</small> {{TST|τ}}
Line 863: Line 879:
|-
|-
|<small>232</small> {{TST|Φ}}
|<small>232</small> {{TST|Φ}}
−
| [[Sweet pod]]*, [[bloated tuber]]*, [[kobold bulb]]*, [[Health_care#Traction_Benches|traction benches]], [[pot]]s* +
| [[Sweet pod]]*, [[bloated tuber]]*, [[kobold bulb]]*, [[Health_care#Traction_Benches|traction benches]], (Large)
[[pot]]s*
|-
|-
|<small>233</small> {{TST|Θ}}
|<small>233</small> {{TST|Θ}}
Line 875: Line 891:
|-
|-
|<small>236</small> {{TST|∞}}
|<small>236</small> {{TST|∞}}
−
| [[Boulder]], dry [[brook]], middle-right [[butcher's shop]] tile, [[Tilesets#Stones|various stones]]*, sea foam, images of clouds, fortress gates on travel map, [[honeycomb]]* +
| [[Boulder]], dry [[brook]], middle-right [[butcher's shop]] tile, [[Tilesets#Stones|various stones]]*, sea foam, images of clouds, fortress gates on travel map, [[honeycomb]]*
, [[scroll|scrolls]]*{{version|0.42.01}}
|-
|-
|<small>237</small> {{TST|φ}}
|<small>237</small> {{TST|φ}}
Line 881: Line 897:
|-
|-
|<small>238</small> {{TST|ε}}
|<small>238</small> {{TST|ε}}
−
| Large Pots,
[[Bowyer's workshop]] middle-right tile +
| [[Bowyer's workshop]] middle-right tile
|-
|-
−
|<small> 240
</small> {{TST|∩}} +
|<small> 239
</small> {{TST|∩}}
| [[Hills]] on world map, [[slab]] building
| [[Hills]] on world map, [[slab]] building
|-
|-
Line 892: Line 908:
|-
|-
|<small>240</small> {{TST|≡}}
|<small>240</small> {{TST|≡}}
−
| [[Bar]]s, exceptional [[Item quality|quality]] symbol
, [[activity zone]]s, metal [[door]]s, floor [[bars]], track stops, cirrus clouds on travel map, hamlets on world map +
| [[Bar]]s, exceptional [[Item quality|quality]] tags
, [[activity zone]]s, metal [[door]]s <sup>¢</sup>
, floor [[bars]], track stops, cirrus clouds on travel map, hamlets on world map
, [[quire]]*{{version|0.42.01}}, [[bookcase]]*<sup>÷</sup>{{version|0.42.01}}
|-
|-
|<small>241</small> {{TST|±}}
|<small>241</small> {{TST|±}}
Line 907: Line 923:
|-
|-
|<small>245</small> {{TST|⌡}}
|<small>245</small> {{TST|⌡}}
−
| +
| [[sheet]]s{{version|0.42.01}}
|-
|-
|<small>246</small> {{TST|÷}}
|<small>246</small> {{TST|÷}}
−
| [[Barrel]], [[screw pump]], upper left tile of [[still]] (works well as barrel)
+
| [[Barrel]] <sup>¢</sup>
, [[screw pump]], upper left tile of [[still]]
, center tile of [[ashery]], upper left tile of [[kitchen]], [[scroll rollers]]*{{version|0.42.01}}, [[book binding]]*{{version|0.42.01}}
|-
|-
|<small>247</small> {{TST|≈}}
|<small>247</small> {{TST|≈}}
Line 916: Line 932:
|-
|-
|<small>248</small> {{TST|°}}
|<small>248</small> {{TST|°}}
−
| Sea foam, [[egg]]s, [[staring eyeball]]*, [[bubble bulb]]*
+
| Sea foam, [[egg]]s, [[staring eyeball]]*, [[bubble bulb]]*
, [[Tool|Bowl]], [[Tool|Mortar]], dark pits on world map
|-
|-
|<small>249</small> {{TST|∙}}
|<small>249</small> {{TST|∙}}
−
| [[Vermin]]*, Boulders at lower elevation . +
| [[Vermin]]*, Boulders at lower elevation
, trees at lower elevation, tundra on world map, move indicator frame 2 (adventure mode)
|-
|-
|<small>250</small> {{TST|·}}
|<small>250</small> {{TST|·}}
−
| [[Seed]]s, micro-vermin, open space, terrain at lower elevation, plants at lower elevation .
+
| [[Seed]]s, micro-vermin, open space, terrain at lower elevation, plants at lower elevation
, tundra on world map, move indicator frame 1 (adventure mode)
|-
|-
|<small>251</small> {{TST|√}}
|<small>251</small> {{TST|√}}
Line 934: Line 950:
|-
|-
|<small>254</small> {{TST|■}}
|<small>254</small> {{TST|■}}
−
| [[Block]]s , trees at lower elevation
, [[minecart]]s*, human houses/shops on travel map, progress bars +
| [[Block]]s, [[minecart]]s* <sup>÷</sup>, [[vault]]s on world map
, human houses/shops on travel map, progress bars
, move indicator frame 3 (adventure mode)
|-
|-
|<small>255</small> {{TST| }}
|<small>255</small> {{TST| }}
−
| +
|
|}
|}
== Detailed use list by type ==
== Detailed use list by type ==
+ The tile used by each entity is defined in each entity's vanilla object files. These can be overridden by using a mod. (See [[Modding]]) Changing the vanilla files is not recommended.
+
=== Creatures ===
=== Creatures ===
−
==== Main creature tiles ==== +
==== Main creature tiles ====
−
This is a list of tiles used by [[creature]]s.
Currently the lists of creatures using each tile is incomplete. In all cases the tile can be changed in the raws, and a graphic can be assigned. +
This is a list of tiles used by [[creature]]s.
−
<small>001</small> {{TST|☺}}
<small>001</small> {{TST|☺}}
(Civilian) [[dwarves]]
(Civilian) [[dwarves]]
Line 967: Line 984:
<small>065</small> {{TST|A}}
<small>065</small> {{TST|A}}
−
[[Alligator]], [[Anaconda]], [[Anaconda man]], [[Giant aardvark]], [[Giant adder]], [[Giant anaconda]], [[Giant
armadillo
]], [[Giant aye-aye
]], [[Giant
albatross
]], [[Giant axolotl
]]
+
[[Alligator ]], [[Alligator man
]], [[Anaconda]], [[Anaconda man]], [[Giant aardvark]], [[Giant adder
]], [[Giant albatross]], [[Giant alligator
]], [[Giant anaconda]], [[Giant anole
]], [[Giant
armadillo
]], [[Giant axolotl
]], [[Giant
aye-aye
]]
<small>066</small> {{TST|B}}
<small>066</small> {{TST|B}}
−
[[Beak dog]], [[Black bear]], [[Blind cave bear]], [[Giant badger]], [[Giant barn owl]], [[Giant bat]], [[Giant beaver]], [[Giant bobcat]], [[Giant bushtit]], [[Giant sloth bear]], [[Giant wild boar]], [[ Great barracuda
]], [[Grizzly bear]], [[Polar bear]], [[Sloth bear man
]], [[Sloth bear]], [[Wild boar
man
]], [[Wild boar]]
+
[[Beak dog]], [[Black bear ]], [[Black bear man
]], [[Blind cave bear]], [[Giant badger]], [[Giant barn owl]], [[Giant bat]], [[Giant beaver
]], [[Giant beetle]], [[Giant black bear]], [[Giant bluejay
]], [[Giant bobcat]], [[Giant bushtit
]], [[Giant buzzard]], [[Giant grizzly bear]], [[Giant honey badger]], [[Giant monarch butterfly]], [[Giant polar bear
]], [[Giant sloth bear]], [[Giant wild boar]], [[ Grizzly bear
]], [[Grizzly bear man]], [[Polar
bear]], [[Polar bear man
]], [[Sloth bear]], [[Sloth bear man
]], [[Wild boar]], [[Wild boar man
]]
<small>067</small> {{TST|C}}
<small>067</small> {{TST|C}}
−
[[Cave crocodile]], [[ Cougar
]], [[Cow]], [[Giant capuchin]], [[Giant capybara]], [[Giant cassowary]], [[Giant cave swallow]], [[Giant cheetah]], [[Giant chinchilla]], [[Giant coati]], [[Giant cockatiel]], [[Giant coyote]], [[Giant crab]], [[Giant crow]], [[Giant cuttlefish]], [[Giant horseshoe crab]], [[Magma crab]], [[One-humped camel]], [[Saltwater crocodile]], [[Two-humped camel]], [[Voracious cave crawler]] +
[[Bronze colossus]],
[[Cave crocodile]], [[ Centaur]], [[Chimera]], [[Coelacanth
]], [[Cow ]], [[Cyclops
]], [[Giant capuchin]], [[Giant capybara ]], [[Giant cardinal
]], [[Giant cassowary]], [[Giant cave swallow ]], [[Giant chameleon
]], [[Giant cheetah]], [[Giant chinchilla
]], [[Giant chipmunk
]], [[Giant coati]], [[Giant cockatiel ]], [[Giant cougar
]], [[Giant coyote]], [[Giant crab]], [[Giant crow]], [[Giant cuttlefish]], [[Giant horseshoe crab
]], [[Giant one-humped camel]], [[Giant saltwater crocodile]], [[Giant two-humped camel
]], [[Magma crab]], [[One-humped camel
]], [[One-humped camel man
]], [[Saltwater crocodile ]], [[Saltwater crocodile man]], [[Two-humped camel
]], [[Two-humped camel man
]], [[Voracious cave crawler]]
<small>068</small> {{TST|D}}
<small>068</small> {{TST|D}}
−
[[Cave dragon]], [[Donkey]], [[Draltha]], [[Giant damselfly
]], [[Giant dingo]] +
[[Cave dragon ]], [[Deer
]], [[Donkey ]], [[Dragon
]], [[Draltha]], [[Giant deer
]], [[Giant dingo ]], [[Giant dragonfly
]]
<small>069</small> {{TST|E}}
<small>069</small> {{TST|E}}
−
[[Elephant]], [[Elk bird]], [[Elk]], [[Emu man]], [[ Emu
]], [[Giant eagle]], [[Giant echidna]], [[Giant emu]] +
[[Elephant ]], [[Elephant man]], [[Elk
]], [[Elk bird]], [[Elk man]], [[Emu
]], [[Emu man]], [[ Ettin
]], [[Giant eagle]], [[Giant echidna
]], [[Giant elephant]], [[Giant elk
]], [[Giant emu]]
<small>070</small> {{TST|F}}
<small>070</small> {{TST|F}}
−
[[Giant green tree frog]] + [[Giant firefly]], [[Giant fly]], [[Giant fox]],
[[Giant green tree frog]]
<small>071</small> {{TST|G}}
<small>071</small> {{TST|G}}
−
[[Giant gila monster]], [[Giant grasshopper]], [[Giant grouper]], [[Giant leopard gecko]], [[Giraffe]], [[Gorilla]], [[Green devourer]]
+
[[Giant]], [[Giant gazelle]],
[[Giant gila monster
]], [[Giant giraffe]], [[Giant grackle
]], [[Giant grasshopper ]], [[Giant groundhog
]], [[Giant grouper]], [[Giant leopard gecko
]], [[Giant mountain goat
]], [[Giraffe ]], [[Giraffe man
]], [[Gorilla]], [[Green devourer
]], [[Griffon
]]
<small>072</small> {{TST|H}}
<small>072</small> {{TST|H}}
−
[[Giant hamster]], [[Giant hare]], [[Giant harp seal]], [[Giant hedgehog]], [[Giant hornbill]], [[Giant hyena]], [[Harp seal]], [[Hippo]], [[Horse]] +
[[Giant hamster]], [[Giant hare]], [[Giant harp seal]], [[Giant hedgehog
]], [[Giant hippo
]], [[Giant hornbill]], [[Giant hyena]], [[Harp seal]], [[Hippo ]], [[Hippo man
]], [[Horse ]], [[Hydra
]]
<small>073</small> {{TST|I}}
<small>073</small> {{TST|I}}
−
[[Giant ibex]], [[Giant impala]] +
[[Giant ibex ]], [[Giant iguana
]], [[Giant impala]]
<small>074</small> {{TST|J}}
<small>074</small> {{TST|J}}
−
[[Giant jackal]], [[Giant jaguar]], [[Giant jumping spider]], [[Jabberer]], [[Jaguar]] +
[[Giant jackal]], [[Giant jaguar]], [[Giant jumping spider]], [[Jabberer]], [[Jaguar ]], [[Jaguar man
]]
<small>075</small> {{TST|K}}
<small>075</small> {{TST|K}}
−
[[Giant kakapo]], [[Giant kangaroo]], [[Giant kea]], [[Giant kestrel]], [[Giant king cobra]], [[Giant kingsnake]], [[Giant kiwi]], [[Giant koala]], [[Kangaroo man
]], [[Kangaroo]]
+
[[Giant kakapo]], [[Giant kangaroo]], [[Giant kea]], [[Giant kestrel]], [[Giant king cobra]], [[Giant kingsnake]], [[Giant kiwi]], [[Giant koala]], [[Kangaroo]], [[Kangaroo man
]]
<small>076</small> {{TST|L}}
<small>076</small> {{TST|L}}
−
[[Giant gray langur]], [[Giant leech]], [[Giant leopard seal]], [[Giant
leopard
]], [[Giant lion tamarin]], [[Giant lion
]], [[Giant loon]], [[Giant lorikeet]], [[Giant louse]], [[Giant lynx]], [[Giant masked lovebird]], [[Giant peach-faced lovebird]], [[Leopard seal man
]], [[Leopard seal]], [[ Leopard
]], [[Lion]], [[Llama]]
+
[[Giant gray langur]], [[Giant leech ]], [[Giant leopard
]], [[Giant leopard seal]], [[Giant lion
]], [[Giant lion tamarin]], [[Giant lizard
]], [[Giant loon]], [[Giant lorikeet]], [[Giant louse]], [[Giant lynx]], [[Giant masked lovebird]], [[Giant peach-faced lovebird]], [[Leopard seal]], [[Leopard seal man
]], [[ Lion
]], [[Lion man
]], [[Llama]]
<small>077</small> {{TST|M}}
<small>077</small> {{TST|M}}
−
[[Amethyst man]], [[Blizzard man]], [[Blood man]], [[Fire man]], [[Gabbro man]], [[Giant magpie]], [[Giant mantis]], [[Giant mink]], [[Giant mongoose]], [[Giant monitor lizard]], [[Giant moose]], [[Giant mosquito]], [[Giant moth]], [[Giant spider monkey]], [[Iron man]], [[Magma man]], [[Merperson]], [[Molemarian]], [[Monitor lizard man
]], [[Monitor lizard]], [[Moose
man
]], [[Moose]], [[Mud man]], [[Mule]], [[Muskox]], [[Sea monster]]
+
[[Amethyst man]], [[Blizzard man]], [[Blood man]], [[Fire man]], [[Gabbro man ]], [[Giant hoary marmot
]], [[Giant magpie ]], [[Giant mandrill
]], [[Giant mantis]], [[Giant mink]], [[Giant mongoose]], [[Giant monitor lizard]], [[Giant moose]], [[Giant mosquito]], [[Giant moth
]], [[Giant muskox]], [[Giant rhesus macaque
]], [[Giant spider monkey]], [[Iron man]], [[Magma man]], [[Merperson ]], [[Minotaur
]], [[Molemarian]], [[Monitor lizard]], [[Monitor lizard man
]], [[Moose]], [[Moose man
]], [[Mud man]], [[Mule]], [[Muskox ]], [[Muskox man
]], [[Sea monster]]
<small>078</small> {{TST|N}}
<small>078</small> {{TST|N}}
−
[[Giant narwhal]], [[Giant nautilus]], [[Narwhal man
]], [[Narwhal]], [[Nightwing]] +
[[Giant narwhal]], [[Giant nautilus]], [[Narwhal]], [[Narwhal man
]], [[Nightwing]]
<small>079</small> {{TST|O}}
<small>079</small> {{TST|O}}
−
[[Blind cave ogre]], [[Giant great horned owl]], [[Giant ocelot]], [[Giant octopus]], [[Giant olm]], [[Giant opossum]], [[Giant orca]], [[Giant osprey]], [[Giant ostrich]], [[Giant otter]], [[Giant snowy owl]], [[Ogre]], [[Orangutan]], [[Orca man
]], [[Orca]], [[Ostrich man
]], [[Ostrich]]
+
[[Blind cave ogre]], [[Giant great horned owl]], [[Giant ocelot]], [[Giant octopus]], [[Giant olm]], [[Giant opossum]], [[Giant orca
]], [[Giant oriole
]], [[Giant osprey]], [[Giant ostrich]], [[Giant otter]], [[Giant snowy owl]], [[Ogre]], [[Orangutan]], [[Orca]], [[Orca man
]], [[Ostrich]], [[Ostrich
man
]]
<small>080</small> {{TST|P}}
<small>080</small> {{TST|P}}
−
[[Giant grey parrot]], [[Giant pangolin]], [[Giant parakeet]], [[Giant penguin]], [[Giant peregrine falcon]], [[Giant platypus]], [[Giant porcupine]], [[Giant puffin]], [[Giant red panda]], [[Gigantic panda]], [[Panda man
]], [[Panda]]
+
[[Giant grey parrot]], [[Giant pangolin]], [[Giant parakeet]], [[Giant penguin]], [[Giant peregrine falcon]], [[Giant platypus]], [[Giant porcupine]], [[Giant puffin]], [[Giant red panda]], [[Gigantic panda]], [[Panda]], [[Panda
man
]]
<small>082</small> {{TST|R}}
<small>082</small> {{TST|R}}
−
[[Giant rat]], [[Giant raven]], [[Reacher]], [[Reindeer]], [[Rhinoceros]], [[Rutherer]]
+
[[Giant raccoon]],
[[Giant rat]], [[Giant raven
]], [[Giant red-winged blackbird]], [[Giant rhinoceros]], [[Giant roach
]], [[Reacher]], [[Reindeer]], [[Rhinoceros
]], [[Rhinoceros man]], [[Roc
]], [[Rutherer]]
<small>083</small> {{TST|S}}
<small>083</small> {{TST|S}}
−
[[Basking shark]], [[Blacktip reef
shark]], [[Blue shark]], [[Bull shark]], [[Elephant seal man
]], [[Elephant seal]], [[Giant bark scorpion]], [[Giant black mamba]], [[Giant brown recluse spider]], [[Giant bushmaster]], [[Giant cave spider]], [[Giant copperhead snake]], [[Giant desert scorpion
]], [[Giant
elephant seal
]], [[Giant flying
squirrel]], [[Giant moon snail]], [[Giant python]], [[Giant rattlesnake]], [[Giant skunk]], [[Giant sloth]], [[Giant slug]], [[Giant snail]], [[Giant sparrow]], [[Giant sponge]], [[Giant stoat]], [[Giant swan]], [[Giant white stork]], [[Gigantic squid]], [[Great white shark]], [[Hammerhead shark]], [[Longfin mako shark]], [[Nurse shark]], [[Python
man
]], [[Python]], [[Sasquatch]], [[Sea serpent]], [[Shortfin mako shark]], [[Spotted wobbegong]], [[Tiger
shark]], [[Whitetip reef
shark]]
+
[[Basking shark]], [[Blue shark]], [[Bull shark]], [[Elephant seal]], [[Elephant seal man
]], [[Giant bark scorpion]], [[Giant black mamba]], [[Giant brown recluse spider]], [[Giant bushmaster]], [[Giant cave spider]], [[Giant copperhead snake]], [[Giant elephant seal
]], [[Giant
flying squirrel
]], [[Giant gray
squirrel]], [[Giant moon snail]], [[Giant python]], [[Giant rattlesnake
]], [[Giant red squirrel]], [[Giant skink
]], [[Giant skunk]], [[Giant sloth]], [[Giant slug]], [[Giant snail]], [[Giant sparrow]], [[Giant sponge]], [[Giant stoat]], [[Giant swan]], [[Giant white stork]], [[Gigantic squid]], [[Great white shark]], [[Hammerhead shark]], [[Longfin mako shark]], [[Nurse shark]], [[Python]], [[Python man
]], [[Sasquatch]], [[Sea serpent]], [[Shortfin mako shark]], [[Spotted wobbegong]], [[Tiger shark]]
<small>084</small> {{TST|T}}
<small>084</small> {{TST|T}}
−
[[Alligator snapping turtle]], [[Giant desert tortoise]], [[Giant pond turtle]], [[Giant snapping turtle]], [[Giant tapir]], [[Giant thrips]], [[Giant tick]], [[Giant tiger]], [[Giant toad]], [[Giant tortoise man
]], [[Giant tortoise]], [[Gigantic tortoise]], [[Tapir man
]], [[Tapir]], [[Tiger]], [[ Tigerman
]], [[Troll]]
+
[[Alligator snapping turtle ]], [[Giant cave toad
]], [[Giant desert tortoise]], [[Giant pond turtle]], [[Giant snapping turtle]], [[Giant tapir]], [[Giant thrips]], [[Giant tick]], [[Giant tiger]], [[Giant toad]], [[Giant tortoise]], [[Giant tortoise man
]], [[Gigantic tortoise]], [[Tapir]], [[Tapir
man
]], [[Tiger]], [[ Tiger man
]], [[Troll]]
<small>085</small> {{TST|U}}
<small>085</small> {{TST|U}}
[[Human]], [[Unicorn]]
[[Human]], [[Unicorn]]
+
+ <small>086</small> {{TST|V}}
+ [[Giant vulture]]
<small>087</small> {{TST|W}}
<small>087</small> {{TST|W}}
−
[[Giant earthworm]], [[Giant sperm whale]], [[Giant weasel]], [[Giant wolverine]], [[Giant wombat]], [[Giant wren]], [[Sperm whale man
]], [[Sperm whale]], [[Wagon]], [[Walrus]], [[Water buffalo]], [[Whale shark]] +
[[Giant earthworm]], [[Giant sperm whale
]], [[Giant walrus]], [[Giant warthog
]], [[Giant weasel ]], [[Giant wolf
]], [[Giant wolverine]], [[Giant wombat]], [[Giant wren]], [[Sperm whale]], [[Sperm whale man
]], [[Wagon]], [[Walrus
]], [[Walrus man]], [[Warthog]], [[Warthog man
]], [[Water buffalo]], [[Whale shark]]
<small>089</small> {{TST|Y}}
<small>089</small> {{TST|Y}}
Line 1,033: Line 1,053:
<small>097</small> {{TST|a}}
<small>097</small> {{TST|a}}
−
[[Aardvark man
]], [[Aardvark]], [[Adder
man
]], [[Adder]], [[Albatross man
]], [[Albatross]], [[Alpaca]], [[Amphibian man]], [[Antman]], [[Armadillo man
]], [[Armadillo]], [[Axolotl man]], [[Aye-aye
man
]], [[Aye-aye]]
+
[[Aardvark]], [[Aardvark man
]], [[Adder]], [[Adder man
]], [[Albatross]], [[Albatross man
]], [[Alpaca]], [[Amphibian man]], [[Anole
man]], [[Antman]], [[Armadillo]], [[Armadillo
man
]], [[Axolotl man]], [[Aye-aye]], [[Aye-aye man
]]
<small>098</small> {{TST|b}}
<small>098</small> {{TST|b}}
−
[[Badger man
]], [[Badger]], [[Barn owl
man
]], [[Barn owl]], [[Bat man]], [[Beaver man]], [[ Beaver
]], [[Bobcat
man
]], [[Bobcat]], [[Bonobo]], [[Bugbat]], [[Bushtit man]], [[Buzzard]], [[Foul blendec]], [[Honey badger]] +
[[Badger]], [[Badger man
]], [[Barn owl]], [[Barn owl man
]], [[Bat man ]], [[Beaver
]], [[Beaver man]], [[ Beetle man]], [[Bluejay man
]], [[Bobcat]], [[Bobcat man
]], [[Bonobo]], [[Bugbat]], [[Bushtit man]], [[Buzzard
]], [[Buzzard man
]], [[Foul blendec ]], [[Great barracuda
]], [[Honey badger ]], [[Honey badger man]], [[Monarch butterfly man
]]
<small>099</small> {{TST|c}}
<small>099</small> {{TST|c}}
−
[[Capuchin man]], [[ Capuchin
]], [[Capybara man]], [[ Capybara
]], [[Cassowary man
]], [[Cassowary]], [[Cat]], [[Cavy]], [[Cheetah]], [[Chicken]], [[Chimpanzee]], [[Chinchilla man]], [[ Chinchilla
]], [[Coati man
]], [[Coati]], [[Cockatiel man]], [[ Coelacanth
]], [[Coyote man
]], [[Coyote]], [[Crab man
]], [[Crab]], [[Crow man]], [[Crundle]], [[Cuttlefish man]], [[Horseshoe crab man
]], [[Horseshoe crab]]
+
[[Capuchin]],
[[Capuchin man]], [[ Capybara
]], [[Capybara man]], [[ Cardinal man
]], [[Cassowary]], [[Cassowary man
]], [[Cat]], [[Cavy ]], [[Chameleon man
]], [[Cheetah ]], [[Cheetah man
]], [[Chicken]], [[Chimpanzee ]], [[Chinchilla
]], [[Chinchilla man]], [[ Chipmunk man
]], [[Coati]], [[Coati
man
]], [[Cockatiel man]], [[ Cougar]], [[Cougar man
]], [[Coyote]], [[Coyote
man
]], [[Crab]], [[Crab man
]], [[Crow man]], [[Crundle]], [[Cuttlefish man]], [[Horseshoe crab]], [[Horseshoe crab
man
]]
<small>100</small> {{TST|d}}
<small>100</small> {{TST|d}}
−
[[Damselfly man]], [[Deer]], [[Dingo
man
]], [[Dingo]], [[Dog]], [[ Drunian
]], [[ Duck]], [[Duck
]], [[Duck]]
+
[[Damselfly man]], [[Deer man
]], [[Dingo]], [[Dingo man
]], [[Dog]], [[ Dragonfly man
]], [[ Drunian
]], [[Duck]]
<small>101</small> {{TST|e}}
<small>101</small> {{TST|e}}
−
[[ Elf
]], [[ Creeping eye
]], [[Eagle man]], [[ Eagle
]], [[Echidna man]], [[ Echidna
]] +
[[ Creeping eye
]], [[ Eagle
]], [[Eagle man]], [[ Echidna
]], [[Echidna man]], [[ Elf
]]
<small>102</small> {{TST|f}}
<small>102</small> {{TST|f}}
−
[[Cave fish man]], [[Cave floater]], [[Fox]], [[Green tree frog man]] +
[[Cave fish man]], [[Cave floater ]], [[Firefly man]], [[Fly man
]], [[Fox ]], [[Fox man
]], [[Green tree frog man]]
<small>103</small> {{TST|g}}
<small>103</small> {{TST|g}}
−
[[Goblin]],
[[Bilou]], [[Black-crested gibbon]], [[Black-handed gibbon]], [[Dark gnome]], [[Gazelle]], [[Gila monster
man
]], [[Gila monster]], [[Goat]], [[Goose]], [[Gorlak]], [[Grasshopper man]], [[Gray gibbon]], [[Gremlin]], [[Grimeling]], [[Groundhog]], [[Guineafowl]], [[Leopard gecko man]], [[Longnose gar]], [[Mountain gnome]], [[Mountain goat]], [[Pileated gibbon]], [[Silvery gibbon]], [[White-handed gibbon]] +
[[Bilou]], [[Black-crested gibbon]], [[Black-handed gibbon]], [[Dark gnome]], [[Gazelle ]], [[Gazelle man
]], [[Gila monster]], [[Gila monster man
]], [[Goat ]], [[Goblin
]], [[Goose]], [[Gorlak ]], [[Grackle man
]], [[Grasshopper man]], [[Gray gibbon]], [[Gremlin]], [[Grimeling]], [[Groundhog ]], [[Groundhog man
]], [[Guineafowl]], [[Leopard gecko man]], [[Longnose gar]], [[Mountain gnome]], [[Mountain goat ]], [[Mountain goat man
]], [[Pileated gibbon]], [[Silvery
gibbon]], [[White-browed
gibbon]], [[White-handed gibbon]]
<small>104</small> {{TST|h}}
<small>104</small> {{TST|h}}
−
[[Hamster man]], [[Hare man
]], [[Hare]], [[Harp seal man]], [[Harpy]], [[Hedgehog man]], [[Hornbill man
]], [[Hornbill]], [[Hungry head]], [[Hyena man
]], [[Hyena]]
+
[[Hamster man]], [[Hare]], [[Hare man
]], [[Harp seal man]], [[Harpy]], [[Hedgehog man]], [[Hornbill]], [[Hornbill man
]], [[Hungry head]], [[Hyena]], [[Hyena man
]]
<small>105</small> {{TST|i}}
<small>105</small> {{TST|i}}
−
[[Fire imp]], [[Ibex man]], [[ Ibex
]], [[Impala man
]], [[Impala]] +
[[Fire imp ]], [[Ibex
]], [[Ibex man]], [[ Iguana]], [[Iguana man
]], [[Impala]], [[Impala man
]]
<small>106</small> {{TST|j}}
<small>106</small> {{TST|j}}
−
[[Jackal man
]], [[Jackal]], [[Jumping spider man]] +
[[Jackal]], [[Jackal man
]], [[Jumping spider man]]
<small>107</small> {{TST|k}}
<small>107</small> {{TST|k}}
−
[[ Kobold
]], [[Kakapo man]], [[ Kakapo
]], [[Kea man]], [[ Kea
]], [[Kestrel man]], [[ Kestrel
]], [[King cobra man]], [[ King cobra
]], [[Kingsnake man]], [[ Kingsnake
]], [[Kiwi man]], [[ Kiwi
]], [[Koala man]], [[ Koala
]]
+
[[ Kakapo
]], [[Kakapo man]], [[ Kea
]], [[Kea man]], [[ Kestrel
]], [[Kestrel man]], [[ King cobra
]], [[King cobra man]], [[ Kingsnake
]], [[Kingsnake man]], [[ Kiwi
]], [[Kiwi man]], [[ Koala
]], [[Koala man]], [[ Kobold
]]
<small>108</small> {{TST|l}}
<small>108</small> {{TST|l}}
−
[[Gray langur man
]], [[Gray langur]], [[Leech man]], [[Lion tamarin man]], [[Loon man
]], [[Loon]], [[Lorikeet man]], [[Louse man]], [[Lynx man
]], [[Lynx]], [[Masked lovebird man]], [[Peach-faced lovebird man]] +
[[Gray langur]], [[Gray langur man
]], [[Leech man]], [[Leopard]], [[Leopard
man]], [[Lion tamarin man]], [[Lizard
man]], [[Loon]], [[Loon man
]], [[Lorikeet man]], [[Louse man]], [[Lynx]], [[Lynx
man
]], [[Masked lovebird man]], [[Peach-faced lovebird man]]
<small>109</small> {{TST|m}}
<small>109</small> {{TST|m}}
−
[[Giant mole]], [[Hoary marmot]], [[Magpie man]], [[Mandrill]], [[Manera]], [[Mantis man]], [[Mink man
]], [[Mink]], [[Mongoose man
]], [[Mongoose]], [[Mosquito man]], [[Moth man]], [[Plump helmet man]], [[Rhesus macaque]], [[Spider monkey man
]], [[Spider monkey]]
+
[[Giant mole]], [[Hoary marmot ]], [[Hoary marmot man
]], [[Magpie man]], [[Mandrill ]], [[Mandrill man
]], [[Manera]], [[Mantis man]], [[Mink]], [[Mink man
]], [[Mongoose]], [[Mongoose
man
]], [[Mosquito man]], [[Moth man ]], [[Mussel
]], [[Plump helmet man]], [[Rhesus macaque
]], [[Rhesus macaque man
]], [[Spider monkey]], [[Spider monkey
man
]]
<small>110</small> {{TST|n}}
<small>110</small> {{TST|n}}
Line 1,075: Line 1,095:
<small>111</small> {{TST|o}}
<small>111</small> {{TST|o}}
−
[[Cave blob]], [[Flesh ball]], [[Great horned owl man
]], [[Great horned owl]], [[Ocelot man
]], [[Ocelot]], [[Octopus
man
]], [[Octopus]], [[Olm man]], [[Opossum man]], [[ Opossum
]], [[Osprey
man
]], [[Osprey]], [[Otter man]], [[River otter]], [[Sea otter]], [[Snowy owl
man
]], [[Snowy owl]]
+
[[Cave blob]], [[Flesh ball]], [[Great horned owl]], [[Great horned owl man
]], [[Ocelot]], [[Ocelot man
]], [[Octopus]], [[Octopus man
]], [[Olm man ]], [[Opossum
]], [[Opossum man]], [[ Oriole man
]], [[Osprey]], [[Osprey man
]], [[Otter man ]], [[Oyster
]], [[River otter]], [[Sea otter]], [[Snowy owl]], [[Snowy owl man
]]
<small>112</small> {{TST|p}}
<small>112</small> {{TST|p}}
−
[[Blue peafowl]], [[Emperor penguin]], [[Grey parrot man
]], [[Grey parrot]], [[Little penguin]], [[Pangolin man
]], [[Pangolin]], [[Parakeet man]], [[Penguin
man
]], [[Penguin]], [[Peregrine falcon
man
]], [[Peregrine falcon]], [[Pig]], [[Platypus man
]], [[Platypus]], [[Pond grabber]], [[Porcupine man
]], [[Porcupine]], [[Puffin man
]], [[Puffin]], [[Red panda man
]], [[Red panda]]
+
[[Blue peafowl]], [[Emperor penguin]], [[Grey parrot]], [[Grey parrot man
]], [[Little penguin]], [[Pangolin]], [[Pangolin man
]], [[Parakeet man]], [[Penguin]], [[Penguin man
]], [[Peregrine falcon]], [[Peregrine falcon man
]], [[Pig]], [[Platypus]], [[Platypus man
]], [[Pond grabber]], [[Porcupine]], [[Porcupine man
]], [[Puffin]], [[Puffin
man
]], [[Red panda]], [[Red panda man
]]
<small>114</small> {{TST|r}}
<small>114</small> {{TST|r}}
−
[[Large rat]], [[Rabbit]], [[Raccoon]], [[Raven man]], [[ Raven
]], [[Reptile man]], [[Rodent man]] +
[[Large rat]], [[Rabbit]], [[Raccoon ]], [[Raccoon man]], [[Rat man]], [[Raven
]], [[Raven man]], [[
Red-winged blackbird man
]], [[Reptile man]], [[Roach
man]], [[Rodent man]]
<small>115</small> {{TST|s}}
<small>115</small> {{TST|s}}
−
[[Angelshark]], [[Bark scorpion man]], [[Black mamba man
]], [[Black mamba]], [[Brown recluse spider man]], [[Bushmaster man
]], [[Bushmaster]], [[Cave swallow man]], [[Copperhead snake
man
]], [[Copperhead snake]], [[Flying squirrel man]], [[Frill shark]], [[Helmet snake]], [[Moon snail man]], [[Rattlesnake man]], [[ Rattlesnake
]], [[Satyr]], [[Serpent man]], [[Sheep]], [[Siamang]], [[Skunk man
]], [[Skunk]], [[Sloth man
]], [[Sloth]], [[Slug man]], [[Snail man]], [[Sparrow man]], [[Spiny dogfish]], [[Sponge man]], [[ Sponge
]], [[Stoat man
]], [[Stoat]], [[Strangler]], [[Swan man
]], [[Swan]], [[White stork
man
]], [[White stork]]
+
[[Angelshark]], [[Bark scorpion man]], [[Black mamba]], [[Black mamba
man]], [[Blacktip reef shark
]], [[Brown recluse spider man]], [[Bushmaster]], [[Bushmaster man
]], [[Cave swallow man]], [[Copperhead snake]], [[Copperhead snake
man
]], [[Flying squirrel man]], [[Frill shark ]], [[Gray squirrel man
]], [[Helmet snake]], [[Moon snail man
]], [[Rattlesnake
]], [[Rattlesnake man]], [[ Red squirrel man
]], [[Satyr]], [[Serpent man]], [[Sheep]], [[Siamang
]], [[Skink man
]], [[Skunk]], [[Skunk man
]], [[Sloth]], [[Sloth man
]], [[Slug man]], [[Snail man]], [[Sparrow man]], [[Spiny dogfish ]], [[Sponge
]], [[Sponge man]], [[ Squid man
]], [[Stoat]], [[Stoat man
]], [[Strangler]], [[Swan]], [[Swan man
]], [[White stork]], [[White stork
man]], [[Whitetip reef shark
]]
<small>116</small> {{TST|t}}
<small>116</small> {{TST|t}}
−
[[Common snapping turtle]], [[Desert tortoise man
]], [[Desert tortoise]], [[Pond turtle man]], [[Snapping turtle man]], [[Thrips man]], [[Tick man]], [[Troglodyte]], [[Turkey]] +
[[Common snapping turtle]], [[Desert tortoise]], [[Desert tortoise man
]], [[Pond turtle man]], [[Snapping turtle man]], [[Thrips man]], [[Tick
man]], [[Toad
man]], [[Troglodyte]], [[Turkey]]
<small>118</small> {{TST|v}}
<small>118</small> {{TST|v}}
−
[[Vulture]] +
[[Vulture ]], [[Vulture man
]]
<small>119</small> {{TST|w}}
<small>119</small> {{TST|w}}
−
[[Ice wolf]], [[ Warthog
]], [[Weasel man]], [[ Weasel
]], [[Wolf]], [[Wolverine man]], [[ Wolverine
]], [[Wombat man]], [[ Wombat
]], [[Wren man]]
+
[[Ice wolf]], [[ Weasel
]], [[Weasel man]], [[ Wolf
]], [[Wolf man]], [[Wolverine
]], [[Wolverine man]], [[ Wombat
]], [[Wombat man]], [[ Worm man
]], [[Wren man]]
<small>123</small> {{TST|{}}
<small>123</small> {{TST|{}}
Line 1,099: Line 1,119:
<small>126</small> {{TST|~}}
<small>126</small> {{TST|~}}
−
[[Conger eel]], [[Sea lamprey]], [[ worm
]]
+
[[Brook lamprey]],
[[Conger eel ]], [[Hagfish]], [[Knuckle worm]], [[Leech
]], [[Sea lamprey]], [[ Slug]], [[Worm]]
+
+ <small>149</small> {{TST|ò}}
+ [[Bat ray]], [[Common skate]], [[Stingray]], [[Thornback ray
]]
<small>157</small> {{TST|¥}}
<small>157</small> {{TST|¥}}
[[Cave lobster]]
[[Cave lobster]]
−
− <small>149</small> {{TST|ò}}
− [[Stingray]], [[Common skate]]
<small>224</small> {{TST|α}}
<small>224</small> {{TST|α}}
−
[[ Yellow
bullhead]], [[Bluefin tuna]], [[Bluefish]], [[Carp]], [[Cod]], [[Halibut]], [[Marlin]], [[Milkfish]], [[Ocean sunfish]], [[Opah]], [[Pike
(fish)|Pike
]], [[Sturgeon]], [[Swordfish]], [[Tigerfish]]
+
[[ Anchovy]], [[Banded knifefish]], [[Black
bullhead]], [[Bluefin tuna]], [[Bluefish ]], [[Brown bullhead
]], [[Carp
]], [[Cave fish]], [[Char]], [[Clown loach]], [[Clownfish
]], [[Cod ]], [[Flounder]], [[Glasseye]], [[Guppy]], [[Hake
]], [[Halibut ]], [[Herring]], [[Lungfish]], [[Mackerel
]], [[Marlin]], [[Milkfish]], [[Ocean sunfish]], [[Opah ]], [[Perch
]], [[Pike ]], [[Rainbow trout]], [[Sailfin molly]], [[Salmon]], [[Seahorse]], [[Shad]], [[Sole]], [[Spotted ratfish]], [[Steelhead trout
]], [[Sturgeon]], [[Swordfish]], [[Tigerfish
]], [[White-spotted puffer]], [[Yellow bullhead
]]
<small>234</small> {{TST|Ω}}
<small>234</small> {{TST|Ω}}
−
[[ sea
nettle jellyfish]] +
[[ Sea
nettle jellyfish ]]
+
+ ==== Vermin ====
+ These creatures are classified as "vermin" and cannot have their tiles changed.
+
+ <small>249</small> {{TST|∙}}
+ [[Anole]], [[Ant]], [[Axolotl]], [[Bark scorpion]], [[Bat]], [[Blue jay]], [[Brown recluse spider]], [[Bushtit]], [[Cap hopper]], [[Cardinal]], [[Cave spider]], [[Cave swallow]], [[Chameleon]], [[Chipmunk]], [[Cockatiel]], [[Crow]], [[Damselfly]], [[Demon rat]], [[Dragonfly]], [[Fairy]], [[Fire snake]], [[Firefly]], [[Fluffy wambler]], [[Flying squirrel]], [[Fox squirrel]], [[Giant damselfly]], [[Grackle]], [[Gray squirrel]], [[Green tree frog]], [[Hamster]], [[Hedgehog]], [[Large roach]], [[Leopard gecko]], [[Lion tamarin]], [[Lizard]], [[Lorikeet]], [[Magpie]], [[Masked lovebird]], [[Moghopper]], [[Moon snail]], [[Olm]], [[Oriole]], [[Parakeet]], [[Peach-faced lovebird]], [[Phantom spider]], [[Rat]], [[Red squirrel]], [[Red-winged blackbird]], [[Skink]], [[Snail]], [[Sparrow]], [[Toad]], [[Two-legged rhino lizard]], [[Wren]]
+
+ <small>250</small> {{TST|·}}
+ [[Acorn fly]], [[Beetle]], [[Blood gnat]], [[Bumblebee]], [[Fly]], [[Grasshopper]], [[Honey bee]], [[Jumping spider]], [[Louse]], [[Mantis]], [[Mosquito]], [[Pixie]], [[Termite]], [[Thrips]], [[Tick
]]
==== Additional Tiles Used by Creatures ====
==== Additional Tiles Used by Creatures ====
−
Some creature raw
specify secondary tiles. They are listed here +
Some creature specify secondary tiles. They are listed here
{| class="wikitable"
{| class="wikitable"
|-
|-
! Tile !! Usage !! Change Properties
! Tile !! Usage !! Change Properties
|-
|-
−
|<small>002</small> {{TST|☻}} +
|<small>002</small> {{TST|☻}}
−
|Military [[dwarves]] +
|Military [[dwarves]]
|can be removed, reassigned, or overridden by graphics
|can be removed, reassigned, or overridden by graphics
|-
|-
Line 1,128: Line 1,157:
|-
|-
|<small>034</small> {{TST|"}}
|<small>034</small> {{TST|"}}
−
|[[kobold]], [[goblin]], and [[blizzard man]] glowing eyes +
|[[kobold]], [[goblin]], and [[blizzard man]] glowing eyes
|cannot be removed or reassigned without changing behavior
|cannot be removed or reassigned without changing behavior
|-
|-
|<small>039</small> {{TST|'}}
|<small>039</small> {{TST|'}}
−
|one eyed creatures with GLOWTILE " ([[kobold]], [[goblin]]s, and [[blizzard man|blizzard men]]) +
|one eyed creatures with GLOWTILE " ([[kobold]], [[goblin]]s, and [[blizzard man|blizzard men]])
|tile cannot be changed
|tile cannot be changed
|-
|-
Line 1,148: Line 1,177:
|}
|}
−
=== Trees on map === + <small> This table needs updating to v0.50 object file specifics </small>
− The tiles can all be changed in the raws. +
+ === Plants ===
+ =
=== Trees on map === =
−
<small>005</small> {{TST|♣}} +
<small>005</small>
{{TST|♣}}
[[Acacia]], [[Alder]], [[Apple]], [[Apricot]], [[Birch]], [[Cherry]], [[Feather tree]], [[Mangrove]], [[Maple]], [[Peach]], [[Pear]], [[Tea]], [[Sand pear]], [[Plum]]
[[Acacia]], [[Alder]], [[Apple]], [[Apricot]], [[Birch]], [[Cherry]], [[Feather tree]], [[Mangrove]], [[Maple]], [[Peach]], [[Pear]], [[Tea]], [[Sand pear]], [[Plum]]
−
<small>006</small> {{TST|♠}} +
<small>006</small>
{{TST|♠}}
[[Almond]], [[Hazel]], [[Oak]], [[Mahogany]], [[Chestnut]], [[Ash_(tree)|Ash]], [[Kumquat]], [[Custard-apple]], [[Orange]], [[Desert lime]], [[Finger lime]], [[Round lime]], [[Walnut]], [[Pomelo]], [[Citron]], [[Olive]] , [[Macadamia]], [[Coffee]], [[Bayberry]], [[Bitter orange]], [[Lime]], [[Lychee]], [[Pecan]], [[Persimmon]]
[[Almond]], [[Hazel]], [[Oak]], [[Mahogany]], [[Chestnut]], [[Ash_(tree)|Ash]], [[Kumquat]], [[Custard-apple]], [[Orange]], [[Desert lime]], [[Finger lime]], [[Round lime]], [[Walnut]], [[Pomelo]], [[Citron]], [[Olive]] , [[Macadamia]], [[Coffee]], [[Bayberry]], [[Bitter orange]], [[Lime]], [[Lychee]], [[Pecan]], [[Persimmon]]
−
<small>020</small> {{TST|¶}} +
<small>020</small>
{{TST|¶}}
[[Highwood]]
[[Highwood]]
−
<small>023</small> {{TST|↨}} +
<small>023</small>
{{TST|↨}}
[[Cedar]]
[[Cedar]]
−
<small>024</small> {{TST|↑}} +
<small>024</small>
{{TST|↑}}
[[Pine]], [[Ginkgo]], [[Larch]]
[[Pine]], [[Ginkgo]], [[Larch]]
−
<small>180</small> {{TST|┤}} +
<small>180</small>
{{TST|┤}}
[[Glumprong]]
[[Glumprong]]
−
<small>181</small> {{TST|╡}} +
<small>181</small>
{{TST|╡}}
[[Blood thorn]]
[[Blood thorn]]
−
<small>226</small> {{TST|Γ}} + <small>198</small> {{TST|╞}}
+ [[Saguaro]]
+
+
<small>226</small>
{{TST|Γ}}
[[abaca]], [[candlenut]], [[mango tree]], [[rubber tree]], [[cacao tree]], [[Coconut palm]], [[kapok]], [[Avocado]], [[Banana]], [[Carambola]], [[Cashew]], [[Date palm]], [[Durian]], [[Guava]], [[Papaya]], [[Paradise nut]], [[Pomegranate]], [[Rambutan]]
[[abaca]], [[candlenut]], [[mango tree]], [[rubber tree]], [[cacao tree]], [[Coconut palm]], [[kapok]], [[Avocado]], [[Banana]], [[Carambola]], [[Cashew]], [[Date palm]], [[Durian]], [[Guava]], [[Papaya]], [[Paradise nut]], [[Pomegranate]], [[Rambutan]]
−
<small>244</small> {{TST|⌠}} +
<small>244</small>
{{TST|⌠}}
[[Willow]]
[[Willow]]
−
<small>198</small> {{TST|╞}} + ==== Trees in game ====
−
[[ Saguaro
]] + {|
+ |-
+ |<small>035</small> {{TST|#}}
+ | smoothed branches in elven forest retreats
+ |-
+ |<small>037</small> {{TST|%}}
+ | various fruits, various buds
+ |-
+ |<small>042</small> {{TST|*}}
+ | chestnut fruit, catkins
+ |-
+ |<small>059</small> {{TST|;}}
+ | twigs
+ |-
+ |<small>127</small> {{TST|⌂}}
+ | trunk cap
+ |-
+ |<small>172</small> {{TST|¼}}
+ | roots, branches with leaves
+ |-
+ |<small>231</small> {{TST|τ}}
+ | [[Tree]] sapling
+ |-
+ |}
+ {|
+ |-
+ |trunk
+ |<small>010</small> {{TST|◙}}
+ |<small>079</small> {{TST|O}}
+ |<small>185</small> {{TST|╣}}
+ |<small>186</small> {{TST|║}}
+ |<small>187</small> {{TST|╗}}
+ |<small>188</small> {{TST|╝}}
+ |<small>200</small> {{TST|╚}}
+ |<small>201</small> {{TST|╔}}
+ |<small>202</small> {{TST|╩}}
+ |<small>203</small> {{TST|╦}}
+ |<small>204</small> {{TST|╠}}
+ |<small>205</small> {{TST|═}}
+ |<small>206</small> {{TST|╬}}
+ |-
+ |branches
+ |<small>179</small> {{TST|│}}
+ |<small>180</small> {{TST|┤}}
+ |<small>182</small> {{TST|╢}}
+ |<small>191</small> {{TST|┐}}
+ |<small>192</small> {{TST|└}}
+ |<small>193</small> {{TST|┴}}
+ |<small>194</small> {{TST|┬}}
+ |<small>195</small> {{TST|├}}
+ |<small>196</small> {{TST|─}}
+ |<small>197</small> {{TST|┼}}
+ |
<small>198</small>
{{TST|╞}}
+ |<small>199</small> {{TST|╟}}
+ |<small>207</small> {{TST|╧}}
+ |<small>209</small> {{TST|╤}}
+ |<small>217</small> {{TST|┘}}
+ |<small>218</small> {{TST|┌}}
+ |-
+ |}
+
+ ==== Crops ====
+ {|
+ |-
+ |<small>003</small> {{TST|♥}}
+ | [[Dimple cup]]s
+ |-
+ |<small>005</small> {{TST|♣}}
+ | [[Quarry bush]]es
+ |-
+ |<small>006</small> {{TST|♠}}
+ | [[Plump helmet]]s,
+ |-
+ |<small>058</small> {{TST|:}}
+ | [[strawberry]], [[prickle berry]], [[fisher berry]], [[sun berry]]
+ |-
+ |<small>152</small> {{TST|ÿ}}
+ | [[Valley herb]]
+ |-
+ |<small>159</small> {{TST|ƒ}}
+ | [[Rope reed]]
+ |-
+ |<small>231</small> {{TST|τ}}
+ | [[pig tail]], [[cave wheat]], [[Longland grass]], [[rat weed]], [[hide root]], [[muck root]], [[blade weed]], [[sliver barb]]
+ |-
+ |<small>232</small> {{TST|Φ}}
+ | [[Sweet pod]], [[bloated tuber]], [[kobold bulb]]
+ |-
+ |}
+
+ ==== Garden plants ====
+ {|
+ |-
+ |<small>005</small> {{TST|♣}}
+ | blossoms
+ |-
+ |<small>006</small> {{TST|♠}}
+ | leaves
+ |-
+ |<small>037</small> {{TST|%}}
+ | [[crop|all kinds of berries]]
+ |-
+ |<small>058</small> {{TST|:}}
+ | [[crop|all kinds of berries]]
+ |-
+ |<small>111</small> {{TST|o}}
+ | [[winter melon]], [[watermelon]]
+ |-
+ |}
+
+ ==== Grasses ====
+ Most grasses have 4 tiles that are alternatively used.
+
+ {|
+ |-
+ |<small>005</small> {{TST|♣}}
+ | flowers on [[baby toes succulent]], [[cloudberry]], [[cottongrass]], [[marsh thistle]], [[meadowsweet]]. [[mountain avens]], [[pebble plant]], and [[rush]].
+ |-
+ |<small>009</small> {{TST|○}}
+ |[[staring eyeball]], [[bubble bulb]]
+ |-
+ |<small>039</small> {{TST|'}}
+ | all other [[grass|grasses]]
+ |-
+ |<small>044</small> {{TST|,}}
+ | all other
[[ grass|grasses
]]
+ |-
+ |<small>046</small> {{TST|.}}
+ | all other [[grass|grasses]]
+ |-
+ |<small>079</small> {{TST|O}}
+ | [[bubble bulb]], [[staring eyeball]]
+ |-
+ | <small>096</small> {{TST|`}}
+ | all other [[grass|grasses]]
+ |-
+ |<small>111</small> {{TST|o}}
+ | [[bubble bulb]], [[staring eyeball]]
+ |-
+ |<small>159</small> {{TST|ƒ}}
+ | [[arrow bamboo]], [[golden bamboo]], [[hedge bamboo]]
+ |-
+ |<small>169</small> {{TST|⌐}}
+ |[[wormy tendril]]
+ |-
+ |<small>170</small> {{TST|¬}}
+ |[[wormy tendril]]
+ |-
+ |<small>231</small> {{TST|τ}}
+ | [[arrow bamboo]], [[golden bamboo]], [[hedge bamboo]]
+ |-
+ |<small>242</small> {{TST|≥}}
+ | [[wormy tendril]]
+ |-
+ |<small>243</small> {{TST|≤}}
+ |[[wormy tendril]]
+ |-
+ |<small>248</small> {{TST|°}}
+ |[[staring eyeball]], [[bubble bulb]]
+ |-
+ |}
−
=== Unmined stones, ores, and soil
=== +
=== Unmined inorganic material
===
− The tiles can all be changed in the raws.
==== Stones ====
==== Stones ====
{|
{|
|-
|-
|<small>015</small> {{TST|☼}}
|<small>015</small> {{TST|☼}}
−
| [[ bituminous
coal]] +
| [[ Bituminous
coal]]
|-
|-
|<small>034</small> {{TST|"}}
|<small>034</small> {{TST|"}}
Line 1,267: Line 1,460:
|-
|-
|<small>094</small> {{TST|^}}
|<small>094</small> {{TST|^}}
−
| [[ Aluminum
]] +
| [[ Native aluminum
]]
|-
|-
|<small>126</small> {{TST|~}}
|<small>126</small> {{TST|~}}
Line 1,273: Line 1,466:
|-
|-
|<small>156</small> {{TST|£}}
|<small>156</small> {{TST|£}}
−
| [[Adamantine]], [[Cassiterite ]], [[Copper
]], [[Galena]], [[ Gold
]], [[Hematite]], [[Horn silver]], [[Limonite]], [[Malachite]], [[ Platinum
]], [[ Silver
]], [[Sphalerite]], [[Tetrahedrite]]
+
| [[Adamantine]], [[Cassiterite]], [[Galena]], [[ Garnierite
]], [[Hematite]], [[Horn silver]], [[Limonite]], [[Malachite]], [[
Native copper]], [[Native gold]], [[Native platinum
]], [[ Native silver
]], [[Sphalerite]], [[Tetrahedrite]]
|-
|-
|}
|}
Line 1,294: Line 1,487:
|}
|}
−
== List of characters
used in text and interface == +
== = Characters
used in text and interface
=
==
−
Changes to these may make text look strange or be difficult to understand
, unless you are using the TrueType font feature
.
+
Changes to these may make text look strange or be difficult to understand.
−
* " ! _ + , - . 0 1 2 3 4 5 6 7 8 9 / +
* " ! _ + , - . 0 1 2 3 4 5 6 7 8 9 /
* A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
* A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
−
* a b c d e f g h i j k l m n o p q r s t u v w x y z +
* a b c d e f g h i j k l m n o p q r s t u v w x y z
−
* 32 (Space); 219█; 254■; ↑ ↓ → ← [
Bridge direction indicators ]
; ♂ ♀ ☼ Γ √;
+
* 32 (Space); 219█; 254■; ↑ ↓ → ← (
Bridge direction indicators )
; ♂ ♀ ☼ Γ √;
* [[Item quality|Quality]]: - + ≡ * ☼ « »
* [[Item quality|Quality]]: - + ≡ * ☼ « »
−
* Brackets: ( ) < > { } [ ] +
* Brackets: ( ) < > { } [ ]
−
=== Alphabets === + =
=== Alphabets =
===
Accented characters are used for names.
Accented characters are used for names.
−
Dwarvish:
íèîïéóúûôöùòêìëàáåäâabcdefghiklmnorstuvz
+
Dwarvish:
aáàâäåbcdeéèêëfghiíìîïklmnoóòôörstuúùûvz
−
Elvish:
íèéóúÿùòìçabcdefghiklmnopqrstuvwyz
+
Elvish: abcçdeéèfghiíìklmnoóòpqrstuúùvwyz
−
Human: ñáabcdefghijklmnopqrstuvwxyz +
Human: aábcdefghijklmnñopqrstuvwxyz
−
Goblin: ûôöêëäåâabdeghklmnoprstuxz +
Goblin: aâäåbdeêëghklmnoôöprstuûxz
− == No known use == + In total, the accented characters used
are : áàâäåçéèêëíìîïñóòôöúùûÿ
− These
are ideal for using to change tiles in the raw data or init.txt.
− ↕ ∟ ↔ ₧ ½ ⌡ 255 + === No known use ===
+ These are ideal for using to change tiles in a mod.
+ ↕ ∟ ↔ ½ 255
<!-- ☺ ☻ ♥ ♦ ♣ ♠ • ◘ ○ ◙ ♂ ♀ ♪ ♫ ☼ ► ◄ ↕ ‼ ¶ § ▬ ↨ ↑ ↓ → ← ∟ ↔ ▲ ▼ ! " # $ % & ' ( ) * + , - . / 0 1 2 3 4 5 6 7 8 9 : ; < = > ? @ A B C D E F G H I J K L M N O P Q R S T U V W X Y Z [ \ ] ^ _ ` a b c d e f g h i j k l m n o p q r s t u v w x y z { | } ~ ⌂ Ç ü é â ä à å ç ê ë è ï î ì Ä Å É æ Æ ô ö ò û ù ÿ Ö Ü ¢ £ ¥ ₧ ƒ á í ó ú ñ Ñ ª º ¿ ⌐ ¬ ½ ¼ « » ░ ▒ ▓ │ ┤ ╡ ╢ ╖ ╕ ╣ ║ ╗ ╝ ╜ ╛ ┐ └ ┴ ┬ ├ ─ ┼ ╞ ╟ ╚ ╔ ╩ ╦ ╠ ═ ╬ ╧ ╨ ╤ ╥ ╙ ╘ ╒ ╓ ╫ ╪ ┘ ┌ █ ▄ ▌ ▐ ▀ α ß Γ π Σ σ µ τ Φ Θ Ω δ ∞ φ ε ∩ ≡ ± ≥ ≤ ⌠ ⌡ ÷ ≈ ° ∙ · √ ⁿ ² ■ -->
<!-- ☺ ☻ ♥ ♦ ♣ ♠ • ◘ ○ ◙ ♂ ♀ ♪ ♫ ☼ ► ◄ ↕ ‼ ¶ § ▬ ↨ ↑ ↓ → ← ∟ ↔ ▲ ▼ ! " # $ % & ' ( ) * + , - . / 0 1 2 3 4 5 6 7 8 9 : ; < = > ? @ A B C D E F G H I J K L M N O P Q R S T U V W X Y Z [ \ ] ^ _ ` a b c d e f g h i j k l m n o p q r s t u v w x y z { | } ~ ⌂ Ç ü é â ä à å ç ê ë è ï î ì Ä Å É æ Æ ô ö ò û ù ÿ Ö Ü ¢ £ ¥ ₧ ƒ á í ó ú ñ Ñ ª º ¿ ⌐ ¬ ½ ¼ « » ░ ▒ ▓ │ ┤ ╡ ╢ ╖ ╕ ╣ ║ ╗ ╝ ╜ ╛ ┐ └ ┴ ┬ ├ ─ ┼ ╞ ╟ ╚ ╔ ╩ ╦ ╠ ═ ╬ ╧ ╨ ╤ ╥ ╙ ╘ ╒ ╓ ╫ ╪ ┘ ┌ █ ▄ ▌ ▐ ▀ α ß Γ π Σ σ µ τ Φ Θ Ω δ ∞ φ ε ∩ ≡ ± ≥ ≤ ⌠ ⌡ ÷ ≈ ° ∙ · √ ⁿ ² ■ -->
−
− {{Game Interface FAQ}}
{{Category|Modding}}
{{Category|Modding}}
{{Category|Interface}}
{{Category|Interface}}
+ [[ru:Tilesets]]
Latest revision as of 14:48, 1 April 2023
This article was migrated from DF2014:Tilesets and may be inaccurate for the current version of DF (v50.08). See this page for more information.
!!UNKNOWN!! · xTATTEREDx · +FINE+ · *SUPERIOR* · ≡EXCEPTIONAL≡ · ☼MASTERWORK☼
v50.08 · v0.47.05
This article is about the current version of DF.
Note that some content may still need to be updated.
More Info · V
(For an overview of graphics in DF, see Graphics )
(For a chart with the default ASCII characters, see Character table .)
(For user-created creature tilesets, see Tileset repository .)
(For information about Graphic sets, see Graphic set )
(For information on how tilesets get colored, see Color )
Tilesets
are images the game uses to display its graphics when "Use Classic ASCII Glyphs" is set to "Yes"; each tile is used to show text and represent things. Users create custom tilesets for a number of reasons, including increased visibility, aesthetics, or small size. Tilesets come in two flavors: " character sets
" (or simply "tilesets") and " graphics sets
". This article is only about tilesets.
Contents
1 Overview
2 Installation and creation of custom tilesets
2.1 Installation
2.2 Creating a custom tileset
2.3 Generating a custom tileset from a font in Linux
2.4 How colors other than white and magenta work
3 What tiles are used for what
3.1 Row 01 (000-015)
3.2 Row 02 (016-031)
3.3 Row 03 (032-047)
3.4 Row 04 (048-063)
3.5 Row 05 (064-079)
3.6 Row 06 (080-095)
3.7 Row 07 (096-111)
3.8 Row 08 (112-127)
3.9 Row 09 (128-143)
3.10 Row 10 (144-159)
3.11 Row 11 (160-175)
3.12 Row 12 (176-191)
3.13 Row 13 (192-207)
3.14 Row 14 (208-223)
3.15 Row 15 (224-239)
3.16 Row 16 (240-255)
4 Detailed use list by type
4.1 Creatures
4.1.1 Main creature tiles
4.1.2 Vermin
4.1.3 Additional Tiles Used by Creatures
4.2 Plants
4.2.1 Trees on map
4.2.2 Trees in game
4.2.3 Crops
4.2.4 Garden plants
4.2.5 Grasses
4.3 Unmined inorganic material
4.3.1 Stones
4.3.2 Ores
4.3.3 Gems
4.3.4 Soil
4.4 Characters used in text and interface
4.4.1 Alphabets
4.5 No known use
Overview [ edit ]
A character set (or 'tileset') is an image in BMP or PNG format that contains the 256 different tiles (numbered 0-255), corresponding to the IBM Code Page 437
(sometimes called Extended ASCII), which are used to display all graphics. The tiles are always arranged in a 16x16 grid, but its dimensions can be varied. You can have both square and non-square tiles, with 16x16 pixels being the most common size. (If "Use Classic ASCII Glyphs" is set to "No", the tileset must be 128x192 pixels (tiles 8x12 pixels) in order to render the customs tiles properly. See Graphic set
)
UI scaling will only work if the tileset id 128x192px (8x12px tiles).
As the tileset is limited to only 256 tiles, some objects share the same tile. Below is a detailed list.
In previous versions of Dwarf Fortress (v0.47 and below), some of the tiles could be changed in the raws and init files, and creatures could have separate graphics (see
DF2014:Graphic set
, this functionality has been removed in v0.50 (and above) with separate graphics being controlled by mods with "Use Classic ASCII Glyphs" set to "No".
Installation and creation of custom tilesets [ edit ]
Installation [ edit ]
Tileset repository
is a list of user-made standard tilesets, and provides
installation instructions
.
Creating a custom tileset [ edit ]
Scaling occurs automatically based on the size of the tiles and the window.
The desired grid, interface scaling and percentage settings only work when using 8x12 tiles.
When creating a custom tileset, it's often easiest to start with an existing one, and edit it to your liking. Tilesets generally fall into two categories: rectangular tilesets and square tilesets. Rectangular tilesets have tiles that are taller than they are wide. The text in these tilesets is generally easier to read, but the map appears squished horizontally. Square tilesets usually provide more attractive graphics, but are slightly less readable.
The graphics in Dwarf Fortress can be enhanced by setting "Use Classic ASCII Glyphs" to "No" and installing a
Graphics set
mod. (A default is provided in the premium version, but has been removed in the classic "free" version.)
Mifki created a tool
to make a tileset from any font, which can be used as starting point or as is. [1]
Many tiles are used by the game in multiple ways, and this makes customizing the graphics difficult. The same icon is used for chairs and the north end of one-tile-wide vertical bridges. Ashes and broken arrows look the same, and many game entities (such as levers, floodgates, bags, and bins) share characters that are also used in Dwarven names or other bits of text in the interface.
Some of these issues could be fixed by the third-party Text Will Be Text (TWBT) plugin for the DF2014:DFHack
modding API. This has not been updated for compatibility with v0.50.
Generating a custom tileset from a font in Linux [ edit ]
In Linux, it is possible to create tileset from a .ttf font programmatically in the terminal. The following command will open a terminal window with your desired font, rendered appropriately for Dwarf Fortress
, and screenshots it. It requires xterm, the screenshot utility xwd, and a text file containing the code page 437 characters in the appropriate order.
xterm -fa "FONTFAMILY:pixelsize:SIZE:antialias=false" -bg magenta -geometry 16x16 -e "setterm -cursor off && printf '%s' \"\$(<PATH/TO/CODE437.txt)\" && sleep 0.1 && xwd -id \$WINDOWID | xwdtopnm | pnmtopng > \"FONTFAMILY-SIZE.png\""
This will generate an image in your current directory, so it might be a good idea to cd into your /data/art directory beforehand.
This works much better for bitmap fonts, in their native size.
For a list of such fonts on your system and their sizes, you can run
fc-list :scalable=false:spacing=mono family pixelsize
How colors other than white and magenta work [ edit ]
When the game draws a tile, it will select a foreground color, a background color, and a tile based on the item being drawn. The background color will be used in place of magenta (Hex code #FF00FF or RGB 255 0 255). All other colors in the tile will be treated as a mask against the foreground color. Pure white (#FFFFFF) will always show the foreground color, while light grey (#CCCCCC) will be a slightly darker version of the foreground color, and dark grey (#888888) will be a dark version of the foreground color. Black (#000000) will always be black. It is impossible to use different shades of the background color.
Alpha values are supported in png fonts (since v0.43.04), allowing for better transparency, and partial transparency, enabling anti-aliased tilesets and other interesting tricks.
In general, just remember these rules:
Bright magenta (#FF00FF) is the background.
Bright white (#FFFFFF) is the foreground.
Darker shades of white and grey (#C0C0C0, #808080, etc) will display darker shades of the foreground color. It is possible to use any shade of grey, including ones like #333333 and #C2C2C2.
Black (#000000) will always be black.
It's probably best to avoid color in normal tilesets.
For an example, the game is drawing an exposed turquoise cluster with color bright blue
(#0000FF). While loading the tile image, it encounters the color light grey
(#CCCCCC). The color used in its place will be:
Color component Foreground color Color mask from tile Calculation in hex Calculation in decimal
Red # 00 00FF # CC CCCC
00 16 * CC 16 / 100 16 =
00 16
0 * 204 / 256 = 0
Green #00 00 FF #CC CC CC
00 16 * CC 16 / 100 16 =
00 16
0 * 204 / 256 = 0
Blue #0000 FF #CCCC CC
FF 16 * CC 16 / 100 16 =
CB 16
255 * 204 / 256 =
203
Final Color # 00 00 CB 0 0 203
Color masks with unequal amounts of R, G and B are calculated in the same fashion. The game is now drawing a speardwarf with color brown
(#C0C000). It encounters the color
cyan
while loading the tile (#008080). The color used instead of cyan will be:
Color component Foreground color Color mask from tile Calculation in hex Calculation in decimal
Red # C0 C000 # 00 8080
C0 16 * 00 16 / 100 16 =
00 16
192 * 0 / 256 = 0
Green #C0 C0 00 #00 80 80
C0 16 * 80 16 / 100 16 =
60 16
192 * 128 / 256 =
96
Blue #C0C0 00 #0080 80
00 16 * 80 16 / 100 16 =
00 16
0 * 128 / 256 = 0
Final Color # 00 60 00 0 96 0
As illustrated by this example, colors in the tileset can result in colors that aren't in the foreground color or the tile graphic. In this case, a brown foreground color with a cyan pixel color in the tileset results in a final color of green.
Theoretically, the way the game handles color masks could be used to display different graphics for items that use the same tile (but whose respective colors use different color component channels). For example, if a bright red object and a bright blue object use the same tile, the tile can use bright red for all pixels that only the red object uses, bright blue for all pixels only the blue object uses, and bright magenta (but NOT #FF00FF, it would have to be #FE00FE or something similar) for all pixels both objects use. In this fashion the two objects that share a tile would look completely different. In practice however, this is probably impossible because so many objects share the same tile, the chances of the potential foreground colors sharing a red, green, or blue color component are too great.
What tiles are used for what [ edit ]
Items marked with * can have their tile changed in the raw data files.
[This list need validating for v0.50]
Items marked with # can have their tile replaced by a graphic set image, in addition to having their tile changed in the raw data.
Items marked with $ can be changed in the d_init.txt file.
Items marked with ¢ use dual colors.
Items marked with ÷ use inverted tile
For a graphical table, go to the
Character Table
.
Row 01 (000-015) [ edit ]
000 Used for background tiles in the intro CMV and background tiles of interface screens
001 ☺ Civilian dwarves # , various status indicators
002 ☻ Military dwarves #
003 ♥ Dimple cups *
004 ♦ Cut gems , large gems
005 ♣
Quarry bush leaves*, blossoms*, various forest trees *
006 ♠
Broadleaf forest , various forest trees *, various leaf items*, Plump helmets *
007 •
Mined-out stone *, solid workshop tile for several workshops like the magma smelter , filled nest box building, river sources on world map, caves on world map, lairs on world map, moon on travel map, flower buds*
008 ◘
Solid workshop tile for several other workshops like the magma forge , tanner's shop , catapult cup, nest box tool*, empty
nest box building, codices , dice
009 ○
Well , vermin colony, millstone , quern , vertical
axle , fortress walls on travel map, sun behind clouds on travel map, castles on world map,
monasteries on world map, creeping eye out of view (adventure mode)*, staring eyeball *,
bubble bulb *
010 ◙ trunk interior $ , forts on world map
011 ♂ Male sign, bags , various cephalopods #
012 ♀ Female sign, amulet
013 ♪ Ladles *, dancers dancing
014 ♫ Armor stands , playing instruments
015 ☼
Masterpiece quality tags, unmined gem
cluster*, Rough gems and Raw glass , unmined bituminous coal *, mined bituminous coal *, currency symbol, spider webs , pond turtle *, sun, gear assemblies , paralyzed
indicator , fireballs, bandit camps on travel map, towns on world map, night creature senses, artifact gem doors ¢
Row 02 (016-031) [ edit ]
016
► Head of Ballista arrow facing east, manta ray #
017
◄ Head of Ballista arrow facing west
018
↕
019
‼ Cages ¢ , on- fire tags, vertical bars
020
¶
Mugs , drinking in-progress, largest forest retreats, cumulonimbus clouds on travel map,
Highwood forests*
021
§ Restraints , whip vine *
022
▬ Logs , hive tool*, hive building
023
↨ Cedar forest*
024
↑
Interface text ( bridge direction), conifer forests,
various forest trees *
025
↓
Interface text (bridge direction), Various status indicators
026
→ Interface text (bridge direction)
027
← Interface text (bridge direction)
028
∟
029
↔
030
▲
Head of Ballista arrow facing north, ramp , track
ramp up $ , mountain on world map
031
▼
Head of Ballista arrow facing south, ramp on level below, trackramp on level below $
Row 03 (032-047) [ edit ]
032 Spaces in text messages, Unexplored underground, black background on the title screen and interface menu
033 !
Text, various status icons , sound indicator in sneaking mode, tracks (footprints) in sneaking mode
034 "
Text, shrub *, various status icons , quotation marks, Carpenter's workshop tile, kobold out of view*, goblin out of view*, blizzard man out of view*, tracks (bent vegetation) in sneaking mode, various stones *, savanna, swamp, shrubland, marsh
035 #
Text, floor grates , various stones *, smoothed branches in elven forest retreats, labyrinths on travel map, towns on world map
036 $ Coins
037 %
Prepared meal , unexplored underground,
screw pump in action, footprints in sneaking mode, various fruits*, various buds*,
various stones *, Bismuthinite *, Floating guts #
038 & Demons #
039 '
Text, rough floors , unexplored underground,
various stones , one eyed creatures with GLOWTILE " (kobold, goblins, and blizzard in vanilla), various grasses *
040 (
Text, foreign object opening tag, tile in
bowyer's workshop , waning moon on travel map
041 ) Text, foreign object closing tag, waxing moon on travel map
042 *
Interface text, superior quality tags, Unmined
ore *, glowing pits , key reference, working
gear assembly , gem floodgate , various stones
*, chestnut fruit*, other fruits and flowers*, moving armies on quick travel map, towns on world map
043 +
Text, finely-crafted quality tags, Smooth/constructed floors , block / bar bridge or
road , Bauxite *, injury indicator , towns on world map, mining designation
044 ,
Text, rough floors , Claystone *, unexplored underground, various grasses *
045 -
Text, well-crafted quality tags, Scepters , keyboard reference, various stones *,
overlapping creatures animation
046 .
Text, rough floors , various stones *, unexplored underground, various grasses *
047 /
Text, weapons , bolts , Ballista tile, Pestle ,
overlapping creatures animation , stone axe v0.43.01 , active windmill blade
Row 04 (048-063) [ edit ]
048
0 Text, coffins , tombs on world map
049
1 Text, designation priorities, adventurer mode conversation targets, fluids if
SHOW_FLOW_AMOUNTS is YES in d_init.txt
050
2 Text, designation priorities, adventurer mode conversation targets, fluids if SHOW_FLOW_AMOUNTS is YES in d_init.txt
051
3 Text, designation priorities, adventurer mode conversation targets, fluids if SHOW_FLOW_AMOUNTS is YES in d_init.txt
052
4 Text, designation priorities, adventurer mode conversation targets, fluids if SHOW_FLOW_AMOUNTS is YES in d_init.txt
053
5 Text, designation priorities, adventurer mode conversation targets, fluids if SHOW_FLOW_AMOUNTS is YES in d_init.txt
054
6 Text, designation priorities, adventurer mode conversation targets, fluids if SHOW_FLOW_AMOUNTS is YES in d_init.txt
055
7 Text, designation priorities, adventurer mode conversation targets, fluids if SHOW_FLOW_AMOUNTS is YES in d_init.txt
056
8 Text, Fortress gates on travel map
057
9 Text
058
:
Interface text, strawberry *, prickle berry *,
fisher berry *, sun berry *, snowstorms, underground shrubs*
059
;
Interface text (command menu Movies key),
Mason's workshop , Kitchen , Selenite *, twigs $
060
< Interface text (trading screen "Less than 1 unit weight"), brackets around squad names, Stairs
up, west move indicator (adventure mode)
061
=
Empty Stockpiles , hamlets on world map,
various stones *, middle-left tile of Furnaces , up-right tile of Carpenter's workshop
062
>
Brackets around squad names, Stairs down, east move indicator (adventure mode)
063
? Text, various status icons
Row 05 (064-079) [ edit ]
064 @
berserk dwarf # , adventurer # , dwarven
merchants # , dwarven caravan guards # , dwarven diplomat # , adventurer's location on map
065 A
Text, various creatures # , Tile in Farm Workshop
066 B Text, various creatures #
067 C
Text, various creatures # , construction designations
068 D
Text, various creatures # , Depot Access Display
069 E Text, various creatures #
070 F Text, various creatures #
071 G Text, various creatures #
072 H
Text, various creatures # , high traffic designation
073 I
Text, various creatures # , support ,
Necromancer's tower on world map
074 J Text, various creatures #
075 K Text, various creatures #
076 L
Text, various creatures # , low traffic designation
077 M Text, various creatures #
078 N Text, various creatures #
079 O
Text, various creatures # , trade depot post, glass portal, Tile in Farm Workshop, column $ , wall construction, full moon on travel map and dwarf mode, trunk $ , staring eyeball *,
bubble bulb *, windmill hub
Row 06 (080-095) [ edit ]
080 P Text, various creatures #
081 Q Text
082 R
Text, various creatures # , restricted traffic designation
083 S Text, various creatures #
084 T Text, various creatures #
085 U Text, various creatures #
086 V Text, Badlands on map
087 W
Text, various creatures # , Depot Access Display
088 X
Text, wear tags, keyboard cursor, Bin ¢ ,
floodgate ¢ , shop post, building footprint, Depot Access Display, up/down stairs, Tile in Ashery, Archery target , various status indicators
089 Y Text, Yak # , Yeti #
090 Z Text, Sleep indicator
091 [
Text, Floor tile in workshops , Clothing , armor , item stack opening tag, moon on travel map, tracks (bootprints) in sneaking mode
092 \
Overlapping creatures animation , Ballista tile,
helves * v0.43.01 , active windmill blade
093 ]
Text, Floor tile in workshops and furnaces , item stack closing tag
094 ^
Trap , Alabaster *, Aluminum *, Volcano on world map, north move indicator (adventure mode), Mechanic Workshop center-south tile (in light cyan)
095 _ Text, Channel designation
Row 07 (096-111) [ edit ]
096 `
Rough floors, unexplored underground*,
various stones *, various grasses *
097 a Text, various creatures #
098 b Text, various creatures #
099 c Text, various creatures #
100 d Text, various creatures #
101 e Text, various creatures #
102 f Text, various creatures #
103 g Text, various creatures #
104 h Text, various creatures #
105 i Text, various creatures #
106 j Text, various creatures #
107 k Text, various creatures #
108 l Text, various creatures #
109 m Text, various creatures #
110 n Text, various creatures # , Hills on map
111 o
Text, various creatures # , Graphite *, well construction, bridge construction, millstone in action, vertical axle in action, floor tile in magma furnaces , staring eyeball *, bubble bulb *, winter melon *, watermelon *
Row 08 (112-127) [ edit ]
112
p Text, various creatures #
113
q Text
114
r Text, various creatures #
115
s Text, various creatures #
116
t Text, various creatures #
117
u Text
118
v
Text, various creatures # , various stones *, south move indicator (adventure mode)
119
w Text, various creatures #
120
x Text, wear tags, Saltpeter *
121
y Text
122
z Text
123
{
Forbidden opening tag, tile in Jeweler's workshop , vermin, purring maggot #
124
|
Talc *, pipe sections, overlapping creatures animation
125
}
Forbidden closing tag, vermin, purring maggot
alternate*
126
~
Unfinished rough stone road , flowing water , dirt
road , farm plot under construction, sand , furrowed soil, blood smear, guts, Various creatures # , Magnetite *
127
⌂
Animal trap , low mountains on world map, part of mechanic's workshop , trunk $
Row 09 (128-143) [ edit ]
128 Ç Text, Mechanisms
129 ü Text
130 é Text
131 â Text
132 ä Text, Angels
133 à Text
134 å Text
135 ç Text, Totems
136 ê Text
137 ë Text, military elves
138 è Text
139 ï Text, Pedestal *
140 î Text, Elven forest retreat
141 ì Text
142 Ä Text, Angels
143 Å Text, Figurines , shrines on travel map
Row 10 (144-159) [ edit ]
144
É Text, altars
145
æ Toys , hamlets on world map
146
Æ
Coffers , quivers , backpacks , hamlets on world map
147
ô Text, Cauldrons *
148
ö Text, Rings
149
ò Text, Unactivated levers , Various creatures #
150
û Text, Buckets
151
ù Text
152
ÿ Text, Valley herb *
153
Ö Bracelets , wheelbarrows *
154
Ü Military Humans
155
¢
Hatch covers ¢ , musical instrument
pieces v0.42.01
156
£ Various stones *, most unmined ores *,
157
¥ Cave lobster *
158
₧ Stepladder *, largest forest retreat ruins
159
ƒ Rope reed *, splints , arrow bamboo *, golden bamboo *, hedge bamboo *
Row 11 (160-175) [ edit ]
160
á Text
161
í Text
162
ó Text, Activated levers
163
ú Text
164
ñ Text, Bogeyman
165
Ñ Night creatures
166
ª dark pit ruins
167
º Cloth , dark pit
168
¿ Musical Instruments
169
⌐ Withered plants *, wormy tendril *
170
¬ wormy tendril *
171
½
172
¼ Roc nests, roots $ , branches $
173
Flask , waterskin , Pouch
174
«
Tail of Ballista arrow facing west, item with
decoration tags
175
»
Tail of Ballista arrow facing east, item with
decoration tags
Row 12 (176-191) [ edit ]
176 ░
Partially dug rock, various flows ( miasma ,
cave-in dust, steam , smoke, etc.), Fishery , fog on travel map, Semi-molten Rock , various stones *, various soils *, Workshop wall tiles (craftdwarf's, bowyer's, mason's, mechanic's, jeweler's, clothier's, kitchen , and leather works), fallen leaves, vermin swarm
177 ▒
Partially dug rock, various flows ( miasma ,
cave-in dust, steam , smoke, etc.), side tiles for catapult, window , fog on travel map,
various stones *, various kinds of soil *, fallen leaves, vermin swarm
178 ▓
Partially dug rock, various flows ( miasma ,
cave-in dust, steam , smoke, etc.), floor tile for ice, tanner's shop , butcher's shop , Wagon
body, fog on travel map, various kinds of stones *, various kinds of soil *, sky $ , fallen leaves
179 │
Overworld rivers , well chain/rope , bolts in flight, rotating horizontal axles , branches $ , active EW water wheel , active windmill blade, upright weapon trap
180 ┤
Overworld rivers , top-right tile for Loom , branches $ , Glumprong forests*
181 ╡
Blood thorn trees*, bridges , catapult tile, tracks $
182 ╢ Branches $ , east roller
183 ╖ Ends of smooth walls
184 ╕ Ends of smooth walls
185 ╣ Smooth/constructed walls, tracks $ , trunk $
186 ║
Smooth/constructed walls, bridges , wooden
doors ¢ , center catapult tile, center Ballista
tile, axles , tracks $ , fortress walls on travel map, trunk $ , NS water wheel , windmill blade
187 ╗
Smooth/constructed walls, bridges, tracks $ , trunk $
188 ╝
Smooth/constructed walls, bridges, tracks $ , trunk $
189 ╜ Ends of smooth walls
190 ╛ Ends of smooth walls
191 ┐
Overworld rivers , branches $ , northeast move indicator (adventure mode)
Row 13 (192-207) [ edit ]
192 └
Overworld rivers/Roads, branches $ , southwest move indicator (adventure mode)
193 ┴ Overworld rivers/Roads, branches $
194 ┬ Overworld rivers/Roads, crutches , branches $
195 ├
Overworld rivers/Roads, top-left tile for Loom , branches $
196 ─
Overworld rivers/Roads, bolts in flight, rotating axles , branches $ , active NS water wheel , active windmill blade
197 ┼
Doors ¢ , overworld rivers/Roads, floor
detailing / engraving in progress, branches $
198 ╞
Bridges, trees in winter, (un)dead trees*,
Saguaro *, catapult tile, tracks $ , branches $
199 ╟ branches $ , west roller
200 ╚
Smooth/constructed walls, bridges, tracks $ , fortress walls on travel map, trunk $
201 ╔
Smooth/constructed walls, bridges, tracks $ , fortress walls on travel map, trunk $
202 ╩ Smooth/constructed walls, tracks $ , trunk $
203 ╦
Smooth/constructed walls, tracks $ , fortress walls on travel map, trunk $
204 ╠ Smooth/constructed walls, tracks $ , trunk $
205 ═
Smooth/constructed walls, bridges, planted
crops , center catapult tile, center Ballista tile,
axles , tracks $ , fortress walls on travel map, trunk $ , EW water wheel , windmill blade
206 ╬
Smooth/constructed walls, bridges,
fortifications , (flashing) wall
detailing / engraving /fortifying in progress, tracks $ , trunk $
207 ╧
Tail of Ballista arrow facing north, screw press
building, branches $ , south roller
Row 14 (208-223) [ edit ]
208
╨ Bridges, catapult tile, tracks $
209
╤
Table , tail of Ballista arrow facing south, branches $ , north roller
210
╥
Chairs , bridges, catapult tile, farmer's workshop bottom-middle tile, tracks $
211
╙ Ends of smooth walls
212
╘ Ends of smooth walls
213
╒ Ends of smooth walls
214
╓ Ends of smooth walls
215
╫ Wooden floodgates, bone floodgates, wall grates
216
╪ Door designation
217
┘
Overworld rivers , branches $ , southeast move indicator (adventure mode)
218
┌
Overworld rivers, branches $ , northwest move indicator (adventure mode)
219
█ Interface window border, trade depot tile, ice wall and dig-designated tiles, Mist
220
▄ Ballista tile, Siege engine parts
221
▌ Ballista tile
222
▐ Ballista tile
223
▀ Ballista tile
Row 15 (224-239) [ edit ]
224 α
Various fish # , top-center fishery tile, meat , altocumulus clouds on travel map
225 ß Leather , cumulus clouds on travel map
226 Γ
Weight symbol, various forest trees , tropical forests
227 π Cabinet , Display cases ÷ *, dark fortresses
228 Σ Trap component
229 σ
Anvil , metalsmith's and magma forge bottom-middle tile, jugs *
230 µ
Crown , ruins on world map, shop signs (adventure mode)
231 τ
Tree sapling*, pig tail *, cave wheat *, Longland grass *, rat weed *, hide root *, muck root *,
blade weed *, sliver barb *, shrubland , arrow bamboo *, golden bamboo *, hedge bamboo *
232 Φ
Sweet pod *, bloated tuber *, kobold bulb *,
traction benches , (Large) pots *
233 Θ Beds , Puddingstone *
234 Ω
Statues , dwarven cities on map, sea nettle jellyfish *
235 δ Earrings , kennel tile
236 ∞
Boulder , dry brook , middle-right butcher's shop tile, various stones *, sea foam, images of clouds, fortress gates on travel map,
honeycomb *, scrolls * v0.42.01
237 φ
Thread , loom bottom left tile, farmer's workshop bottom right tile
238 ε Bowyer's workshop middle-right tile
239 ∩ Hills on world map, slab building
Row 16 (240-255) [ edit ]
240 ≡
Bars , exceptional quality tags, activity zones , metal doors ¢ , floor bars , track stops, cirrus clouds on travel map, hamlets on world map,
quire * v0.42.01 , bookcase * ÷ v0.42.01
241 ± Unfinished road
242 ≥ Debris (spent ammo, ballista bolts, and catapult stones), ashes , wormy tendril *
243 ≤ Debris (spent ammo, ballista bolts, and catapult stones), ashes , wormy tendril *
244 ⌠ swamps on world map, Willow forest/swamp*
245 ⌡ sheets v0.42.01
246 ÷
Barrel ¢ , screw pump , upper left tile of still , center tile of ashery , upper left tile of kitchen ,
scroll rollers * v0.42.01 , book binding * v0.42.01
247 ≈
Rough stone road or bridge , water , magma , snow, glob ( fat / tallow ), farm plot , furrowed soil, vomit , blood pools, sea foam, sand,
various stones *
248 °
Sea foam, eggs , staring eyeball *, bubble bulb *, Bowl , Mortar , dark pits on world map
249 ∙
Vermin *, Boulders at lower elevation, trees at lower elevation, tundra on world map, move indicator frame 2 (adventure mode)
250 ·
Seeds , micro-vermin, open space, terrain at lower elevation, plants at lower elevation, tundra on world map, move indicator frame 1 (adventure mode)
251 √
Weapon racks , badlands in main map, check mark (selecting production materials, confirmed items on manager window)
252 ⁿ Savanna , marsh , grassland , badlands
253 ² Body parts, vermin remains
254 ■
Blocks , minecarts * ÷ , vaults on world map, human houses/shops on travel map, progress bars, move indicator frame 3 (adventure mode)
255
Detailed use list by type [ edit ]
The tile used by each entity is defined in each entity's vanilla object files. These can be overridden by using a mod. (See Modding
) Changing the vanilla files is not recommended.
Creatures [ edit ]
Main creature tiles [ edit ]
This is a list of tiles used by creatures
.
001 ☺
(Civilian) dwarves
011 ♂ Cuttlefish Nautilus
, Squid
015 ☼ Pond turtle
016 ► manta ray
037 % Floating guts
042 * Creepy crawler
064 @
berserk dwarf, adventurer, dwarven merchants
, dwarven caravan
guards, dwarven diplomat
065 A Alligator
, Alligator man
, Anaconda
, Anaconda man
, Giant aardvark
, Giant adder
, Giant albatross
,
Giant alligator
, Giant anaconda
, Giant anole
, Giant armadillo
, Giant axolotl
, Giant aye-aye
066 B Beak dog
, Black bear
, Black bear man
, Blind cave bear
, Giant badger
, Giant barn owl
, Giant bat
,
Giant beaver
, Giant beetle
, Giant black bear
, Giant bluejay
, Giant bobcat
, Giant bushtit
, Giant buzzard
,
Giant grizzly bear
, Giant honey badger
, Giant monarch butterfly
, Giant polar bear
, Giant sloth bear
, Giant wild boar
, Grizzly bear
, Grizzly bear man
, Polar bear
, Polar bear man
, Sloth bear
, Sloth bear man
, Wild boar
, Wild boar man
067 C Bronze colossus
, Cave crocodile
, Centaur
, Chimera
, Coelacanth
, Cow
, Cyclops
, Giant capuchin
,
Giant capybara
, Giant cardinal
, Giant cassowary
, Giant cave swallow
, Giant chameleon
, Giant cheetah
,
Giant chinchilla
, Giant chipmunk
, Giant coati
, Giant cockatiel
, Giant cougar
, Giant coyote
, Giant crab
, Giant crow
, Giant cuttlefish
, Giant horseshoe crab
, Giant one-humped camel
, Giant saltwater crocodile
, Giant two-humped camel
, Magma crab
, One-humped camel
, One-humped camel man
, Saltwater crocodile
,
Saltwater crocodile man
, Two-humped camel
, Two-humped camel man
, Voracious cave crawler
068 D Cave dragon
, Deer
, Donkey
, Dragon
, Draltha
, Giant deer
, Giant dingo
, Giant dragonfly
069 E Elephant
, Elephant man
, Elk
, Elk bird
, Elk man
, Emu
, Emu man
, Ettin
, Giant eagle
, Giant echidna
,
Giant elephant
, Giant elk
, Giant emu
070 F Giant firefly
, Giant fly
, Giant fox
, Giant green tree frog
071 G Giant
, Giant gazelle
, Giant gila monster
, Giant giraffe
, Giant grackle
, Giant grasshopper
, Giant groundhog
, Giant grouper
, Giant leopard gecko
, Giant mountain goat
, Giraffe
, Giraffe man
, Gorilla
, Green devourer
, Griffon
072 H Giant hamster
, Giant hare
, Giant harp seal
, Giant hedgehog
, Giant hippo
, Giant hornbill
, Giant hyena
, Harp seal
, Hippo
, Hippo man
, Horse
, Hydra
073 I Giant ibex
, Giant iguana
, Giant impala
074 J Giant jackal
, Giant jaguar
, Giant jumping spider
, Jabberer
, Jaguar
, Jaguar man
075 K Giant kakapo
, Giant kangaroo
, Giant kea
, Giant kestrel
, Giant king cobra
, Giant kingsnake
, Giant kiwi
, Giant koala
, Kangaroo
, Kangaroo man
076 L Giant gray langur
, Giant leech
, Giant leopard
, Giant leopard seal
, Giant lion
, Giant lion tamarin
,
Giant lizard
, Giant loon
, Giant lorikeet
, Giant louse
, Giant lynx
, Giant masked lovebird
, Giant peach-faced lovebird
, Leopard seal
, Leopard seal man
, Lion
, Lion man
, Llama
077 M Amethyst man
, Blizzard man
, Blood man
, Fire man
, Gabbro man
, Giant hoary marmot
, Giant magpie
, Giant mandrill
, Giant mantis
, Giant mink
, Giant mongoose
, Giant monitor lizard
, Giant moose
,
Giant mosquito
, Giant moth
, Giant muskox
, Giant rhesus macaque
, Giant spider monkey
, Iron man
,
Magma man
, Merperson
, Minotaur
, Molemarian
, Monitor lizard
, Monitor lizard man
, Moose
, Moose man
,
Mud man
, Mule
, Muskox
, Muskox man
, Sea monster
078 N Giant narwhal
, Giant nautilus
, Narwhal
, Narwhal man
, Nightwing
079 O Blind cave ogre
, Giant great horned owl
, Giant ocelot
, Giant octopus
, Giant olm
, Giant opossum
,
Giant orca
, Giant oriole
, Giant osprey
, Giant ostrich
, Giant otter
, Giant snowy owl
, Ogre
, Orangutan
, Orca
,
Orca man
, Ostrich
, Ostrich man
080 P Giant grey parrot
, Giant pangolin
, Giant parakeet
, Giant penguin
, Giant peregrine falcon
, Giant platypus
, Giant porcupine
, Giant puffin
, Giant red panda
, Gigantic panda
, Panda
, Panda man
082 R Giant raccoon
, Giant rat
, Giant raven
, Giant red-winged blackbird
, Giant rhinoceros
, Giant roach
,
Reacher
, Reindeer
, Rhinoceros
, Rhinoceros man
, Roc
, Rutherer
083 S Basking shark
, Blue shark
, Bull shark
, Elephant seal
, Elephant seal man
, Giant bark scorpion
, Giant black mamba
, Giant brown recluse spider
, Giant bushmaster
, Giant cave spider
, Giant copperhead snake
,
Giant elephant seal
, Giant flying squirrel
, Giant gray squirrel
, Giant moon snail
, Giant python
, Giant rattlesnake
, Giant red squirrel
, Giant skink
, Giant skunk
, Giant sloth
, Giant slug
, Giant snail
, Giant sparrow
,
Giant sponge
, Giant stoat
, Giant swan
, Giant white stork
, Gigantic squid
, Great white shark
, Hammerhead shark
, Longfin mako shark
, Nurse shark
, Python
, Python man
, Sasquatch
, Sea serpent
, Shortfin mako shark
, Spotted wobbegong
, Tiger shark
084 T Alligator snapping turtle
, Giant cave toad
, Giant desert tortoise
, Giant pond turtle
, Giant snapping turtle
, Giant tapir
, Giant thrips
, Giant tick
, Giant tiger
, Giant toad
, Giant tortoise
, Giant tortoise man
,
Gigantic tortoise
, Tapir
, Tapir man
, Tiger
, Tiger man
, Troll
085 U Human
, Unicorn
086 V Giant vulture
087 W Giant earthworm
, Giant sperm whale
, Giant walrus
, Giant warthog
, Giant weasel
, Giant wolf
, Giant wolverine
, Giant wombat
, Giant wren
, Sperm whale
, Sperm whale man
, Wagon
, Walrus
, Walrus man
,
Warthog
, Warthog man
, Water buffalo
, Whale shark
089 Y Yak
, Yeti
097 a Aardvark
, Aardvark man
, Adder
, Adder man
, Albatross
, Albatross man
, Alpaca
, Amphibian man
,
Anole man
, Antman
, Armadillo
, Armadillo man
, Axolotl man
, Aye-aye
, Aye-aye man
098 b Badger
, Badger man
, Barn owl
, Barn owl man
, Bat man
, Beaver
, Beaver man
, Beetle man
, Bluejay man
, Bobcat
, Bobcat man
, Bonobo
, Bugbat
, Bushtit man
, Buzzard
, Buzzard man
, Foul blendec
, Great barracuda
, Honey badger
, Honey badger man
, Monarch butterfly man
099 c Capuchin
, Capuchin man
, Capybara
, Capybara man
, Cardinal man
, Cassowary
, Cassowary man
,
Cat
, Cavy
, Chameleon man
, Cheetah
, Cheetah man
, Chicken
, Chimpanzee
, Chinchilla
, Chinchilla man
,
Chipmunk man
, Coati
, Coati man
, Cockatiel man
, Cougar
, Cougar man
, Coyote
, Coyote man
, Crab
, Crab man
, Crow man
, Crundle
, Cuttlefish man
, Horseshoe crab
, Horseshoe crab man
100 d Damselfly man
, Deer man
, Dingo
, Dingo man
, Dog
, Dragonfly man
, Drunian
, Duck
101 e Creeping eye
, Eagle
, Eagle man
, Echidna
, Echidna man
, Elf
102 f Cave fish man
, Cave floater
, Firefly man
, Fly man
, Fox
, Fox man
, Green tree frog man
103 g Bilou
, Black-crested gibbon
, Black-handed gibbon
, Dark gnome
, Gazelle
, Gazelle man
, Gila monster
, Gila monster man
, Goat
, Goblin
, Goose
, Gorlak
, Grackle man
, Grasshopper man
, Gray gibbon
,
Gremlin
, Grimeling
, Groundhog
, Groundhog man
, Guineafowl
, Leopard gecko man
, Longnose gar
,
Mountain gnome
, Mountain goat
, Mountain goat man
, Pileated gibbon
, Silvery gibbon
, White-browed gibbon
, White-handed gibbon
104 h Hamster man
, Hare
, Hare man
, Harp seal man
, Harpy
, Hedgehog man
, Hornbill
, Hornbill man
,
Hungry head
, Hyena
, Hyena man
105 i Fire imp
, Ibex
, Ibex man
, Iguana
, Iguana man
, Impala
, Impala man
106 j Jackal
, Jackal man
, Jumping spider man
107 k Kakapo
, Kakapo man
, Kea
, Kea man
, Kestrel
, Kestrel man
, King cobra
, King cobra man
, Kingsnake
,
Kingsnake man
, Kiwi
, Kiwi man
, Koala
, Koala man
, Kobold
108 l Gray langur
, Gray langur man
, Leech man
, Leopard
, Leopard man
, Lion tamarin man
, Lizard man
,
Loon
, Loon man
, Lorikeet man
, Louse man
, Lynx
, Lynx man
, Masked lovebird man
, Peach-faced lovebird man
109 m Giant mole
, Hoary marmot
, Hoary marmot man
, Magpie man
, Mandrill
, Mandrill man
, Manera
,
Mantis man
, Mink
, Mink man
, Mongoose
, Mongoose man
, Mosquito man
, Moth man
, Mussel
, Plump helmet man
, Rhesus macaque
, Rhesus macaque man
, Spider monkey
, Spider monkey man
110 n Naked mole dog
, Nautilus man
111 o Cave blob
, Flesh ball
, Great horned owl
, Great horned owl man
, Ocelot
, Ocelot man
, Octopus
,
Octopus man
, Olm man
, Opossum
, Opossum man
, Oriole man
, Osprey
, Osprey man
, Otter man
, Oyster
,
River otter
, Sea otter
, Snowy owl
, Snowy owl man
112 p Blue peafowl
, Emperor penguin
, Grey parrot
, Grey parrot man
, Little penguin
, Pangolin
, Pangolin man
, Parakeet man
, Penguin
, Penguin man
, Peregrine falcon
, Peregrine falcon man
, Pig
, Platypus
, Platypus man
, Pond grabber
, Porcupine
, Porcupine man
, Puffin
, Puffin man
, Red panda
, Red panda man
114 r Large rat
, Rabbit
, Raccoon
, Raccoon man
, Rat man
, Raven
, Raven man
, Red-winged blackbird man
,
Reptile man
, Roach man
, Rodent man
115 s Angelshark
, Bark scorpion man
, Black mamba
, Black mamba man
, Blacktip reef shark
, Brown recluse spider man
, Bushmaster
, Bushmaster man
, Cave swallow man
, Copperhead snake
, Copperhead snake man
, Flying squirrel man
, Frill shark
, Gray squirrel man
, Helmet snake
, Moon snail man
,
Rattlesnake
, Rattlesnake man
, Red squirrel man
, Satyr
, Serpent man
, Sheep
, Siamang
, Skink man
, Skunk
,
Skunk man
, Sloth
, Sloth man
, Slug man
, Snail man
, Sparrow man
, Spiny dogfish
, Sponge
, Sponge man
,
Squid man
, Stoat
, Stoat man
, Strangler
, Swan
, Swan man
, White stork
, White stork man
, Whitetip reef shark
116 t Common snapping turtle
, Desert tortoise
, Desert tortoise man
, Pond turtle man
, Snapping turtle man
, Thrips man
, Tick man
, Toad man
, Troglodyte
, Turkey
118 v Vulture
, Vulture man
119 w Ice wolf
, Weasel
, Weasel man
, Wolf
, Wolf man
, Wolverine
, Wolverine man
, Wombat
, Wombat man
,
Worm man
, Wren man
123 { Purring maggot
126 ~ Brook lamprey
, Conger eel
, Hagfish
, Knuckle worm
, Leech
, Sea lamprey
, Slug
, Worm
149 ò Bat ray
, Common skate
, Stingray
, Thornback ray
157 ¥ Cave lobster
224 α Anchovy
, Banded knifefish
, Black bullhead
, Bluefin tuna
, Bluefish
, Brown bullhead
, Carp
, Cave fish
,
Char
, Clown loach
, Clownfish
, Cod
, Flounder
, Glasseye
, Guppy
, Hake
, Halibut
, Herring
, Lungfish
, Mackerel
,
Marlin
, Milkfish
, Ocean sunfish
, Opah
, Perch
, Pike
, Rainbow trout
, Sailfin molly
, Salmon
, Seahorse
, Shad
,
Sole
, Spotted ratfish
, Steelhead trout
, Sturgeon
, Swordfish
, Tigerfish
, White-spotted puffer
, Yellow bullhead
234 Ω Sea nettle jellyfish
Vermin [ edit ]
These creatures are classified as "vermin" and cannot have their tiles changed.
249 ∙ Anole
, Ant
, Axolotl
, Bark scorpion
, Bat
, Blue jay
, Brown recluse spider
, Bushtit
, Cap hopper
,
Cardinal
, Cave spider
, Cave swallow
, Chameleon
, Chipmunk
, Cockatiel
, Crow
, Damselfly
, Demon rat
,
Dragonfly
, Fairy
, Fire snake
, Firefly
, Fluffy wambler
, Flying squirrel
, Fox squirrel
, Giant damselfly
, Grackle
,
Gray squirrel
, Green tree frog
, Hamster
, Hedgehog
, Large roach
, Leopard gecko
, Lion tamarin
, Lizard
,
Lorikeet
, Magpie
, Masked lovebird
, Moghopper
, Moon snail
, Olm
, Oriole
, Parakeet
, Peach-faced lovebird
,
Phantom spider
, Rat
, Red squirrel
, Red-winged blackbird
, Skink
, Snail
, Sparrow
, Toad
, Two-legged rhino lizard
, Wren
250 · Acorn fly
, Beetle
, Blood gnat
, Bumblebee
, Fly
, Grasshopper
, Honey bee
, Jumping spider
, Louse
,
Mantis
, Mosquito
, Pixie
, Termite
, Thrips
, Tick
Additional Tiles Used by Creatures [ edit ]
Some creature specify secondary tiles. They are listed here
Tile Usage Change Properties
002
☻ Military dwarves can be removed, reassigned, or overridden by graphics
009
○ creeping eye glowing eye can be reassigned
034
"
kobold , goblin , and blizzard man
glowing eyes
cannot be removed or reassigned without changing behavior
039
' one eyed creatures with GLOWTILE " ( kobold , goblins , and blizzard men )
tile cannot be changed
125
} purring maggot alternate can be removed or reassigned
137
ë military elves can be removed, reassigned, or overridden by graphics
154
Ü Military Humans can be removed, reassigned, or overridden by graphics
This table needs updating to v0.50 object file specifics
Plants [ edit ]
Trees on map [ edit ]
005 ♣ Acacia
, Alder
, Apple
, Apricot
, Birch
, Cherry
, Feather tree
, Mangrove
, Maple
, Peach
, Pear
, Tea
, Sand pear
, Plum
006 ♠ Almond
, Hazel
, Oak
, Mahogany
, Chestnut
, Ash
, Kumquat
, Custard-apple
, Orange
, Desert lime
,
Finger lime
, Round lime
, Walnut
, Pomelo
, Citron
, Olive
, Macadamia
, Coffee
, Bayberry
, Bitter orange
, Lime
,
Lychee
, Pecan
, Persimmon
020 ¶ Highwood
023 ↨ Cedar
024 ↑ Pine
, Ginkgo
, Larch
180 ┤ Glumprong
181 ╡ Blood thorn
198 ╞ Saguaro
226 Γ abaca
, candlenut
, mango tree
, rubber tree
, cacao tree
, Coconut palm
, kapok
, Avocado
, Banana
,
Carambola
, Cashew
, Date palm
, Durian
, Guava
, Papaya
, Paradise nut
, Pomegranate
, Rambutan
244 ⌠ Willow
Trees in game [ edit ]
035 # smoothed branches in elven forest retreats
037 % various fruits, various buds
042 * chestnut fruit, catkins
059 ; twigs
127 ⌂ trunk cap
172 ¼ roots, branches with leaves
231 τ Tree sapling
trunk 010 ◙ 079 O 185 ╣ 186 ║ 187 ╗ 188 ╝ 200 ╚ 201 ╔ 202 ╩ 203 ╦ 204 ╠ 205 ═ 206 ╬
branches 179 │ 180 ┤ 182 ╢ 191 ┐ 192 └ 193 ┴ 194 ┬ 195 ├ 196 ─ 197 ┼ 198 ╞ 199 ╟ 207 ╧ 209 ╤ 217 ┘ 218 ┌
Crops [ edit ]
003 ♥ Dimple cups
005 ♣ Quarry bushes
006 ♠ Plump helmets ,
058 : strawberry , prickle berry , fisher berry , sun berry
152 ÿ Valley herb
159 ƒ Rope reed
231 τ pig tail , cave wheat , Longland grass , rat weed , hide root , muck root , blade weed , sliver barb
232 Φ Sweet pod , bloated tuber , kobold bulb
Garden plants [ edit ]
005 ♣ blossoms
006 ♠ leaves
037 % all kinds of berries
058 : all kinds of berries
111 o winter melon , watermelon
Grasses [ edit ]
Most grasses have 4 tiles that are alternatively used.
005 ♣
flowers on baby toes succulent , cloudberry ,
cottongrass , marsh thistle , meadowsweet .
mountain avens , pebble plant , and rush .
009 ○ staring eyeball , bubble bulb
039 ' all other grasses
044 , all other grasses
046 . all other grasses
079 O bubble bulb , staring eyeball
096 ` all other grasses
111 o bubble bulb , staring eyeball
159 ƒ arrow bamboo , golden bamboo , hedge bamboo
169 ⌐ wormy tendril
170 ¬ wormy tendril
231 τ arrow bamboo , golden bamboo , hedge bamboo
242 ≥ wormy tendril
243 ≤ wormy tendril
248 ° staring eyeball , bubble bulb
Unmined inorganic material [ edit ]
Stones [ edit ]
015 ☼ Bituminous coal
034 " Calcite , Hornblende
035 # Sandstone , Rock salt , Basalt , Gypsum
037 % Siltstone , Slate , Brimstone , Kimberlite , Bismuthinite , Realgar , Stibnite , Marcasite , Olivine ,
Orthoclase , Microcline , Petrified wood , Brimstone , Pyrolusite
039 ' Claystone , Rhyolite , Periclase
042 * Lignite , Pitchblende
043 + Bauxite
045 - Cryolite , Orpiment , Satinspar , Phyllite , Quartzite
046 . Dacite , Ilmenite , Shale
059 ; Selenite
061 = Chert , Gneiss , Sylvite , Chromite , Kaolinite
094 ^ Alabaster
096 ` Dolomite , Schist , Alunite , Rutile , Borax
111 o Graphite
118 v Anhydrite , Mica
120 x Saltpeter
124 | Talc
156 £ Cinnabar , Cobaltite
176 ░ Jet , Chalk , Diorite
177 ▒ Gabbro , Obsidian
178 ▓ Marble , Limestone , Granite
233 Θ Puddingstone
236 ∞ Andesite , Conglomerate
247 ≈ Mudstone , Serpentine
Ores [ edit ]
037
% Bismuthinite
094
^ Native aluminum
126
~ Magnetite
156
£
Adamantine , Cassiterite , Galena , Garnierite , Hematite , Horn silver , Limonite , Malachite , Native copper , Native gold , Native platinum , Native silver , Sphalerite , Tetrahedrite
Gems [ edit ]
015 ☼
is used by all gems
Soil [ edit ]
176 ░ Loam , Peat , Sandy clay loam , Sandy loam , Silty clay loam , Pelagic clay , Red sand , Sand (tan)
177 ▒ Loamy sand , Silt loam , Siliceous ooze , Calcareous ooze , Clay loam , Sandy clay
178 ▓ Silt , Black sand , White sand , Yellow sand , Clay , Silty clay , Fire clay
Characters used in text and interface [ edit ]
Changes to these may make text look strange or be difficult to understand.
" ! _ + , - . 0 1 2 3 4 5 6 7 8 9 /
A B C D E F G H I J K L M N O P Q R S T U V W X Y Z
a b c d e f g h i j k l m n o p q r s t u v w x y z
32 (Space); 219█; 254■; ↑ ↓ → ← (Bridge direction indicators); ♂ ♀ ☼ Γ √;
Quality : - + ≡ * ☼ « »
Brackets: ( ) < > { } [ ]
Alphabets [ edit ]
Accented characters are used for names.
Dwarvish: aáàâäåbcdeéèêëfghiíìîïklmnoóòôörstuúùûvz
Elvish: abcçdeéèfghiíìklmnoóòpqrstuúùvwyz
Human: aábcdefghijklmnñopqrstuvwxyz
Goblin: aâäåbdeêëghklmnoôöprstuûxz
In total, the accented characters used are: áàâäåçéèêëíìîïñóòôöúùûÿ
No known use [ edit ]
These are ideal for using to change tiles in a mod.
↕ ∟ ↔ ½ 255
Retrieved from " https://dwarffortresswiki.org/index.php?title=Tilesets&oldid=292741
"
Categories
: Migrated pages needing review Unknown Quality Articles Modding Interface
Hidden category: Current Cancel Hide About Rating Tilesets Change | https://dwarffortresswiki.org/index.php?diff=cur&oldid=210890&title=Tilesets |
Molecules | Free Full-Text | Metabolic Profile of Scytalidium parasiticum-Ganoderma boninense Co-Cultures Revealed the Alkaloids, Flavonoids and Fatty Acids that Contribute to Anti-Ganoderma Activity
In solving the issue of basal stem rot diseases caused by Ganoderma, an investigation of Scytalidium parasiticum as a biological control agent that suppresses Ganoderma infection has gained our interest, as it is more environmentally friendly. Recently, the fungal co-cultivation has emerged as a promising method to discover novel antimicrobial metabolites. In this study, an established technique of co-culturing Scytalidium parasiticum and Ganoderma boninense was applied to produce and induce metabolites that have antifungal activity against G. boninense. The crude extract from the co-culture media was applied to a High Performance Liquid Chromatography (HPLC) preparative column to isolate the bioactive compounds, which were tested against G. boninense. The fractions that showed inhibition against G. boninense were sent for a Liquid Chromatography-Time of Flight-Mass Spectrometry (LC-TOF-MS) analysis to further identify the compounds that were responsible for the microbicidal activity. Interestingly, we found that eudistomin I, naringenin 7-O-beta-D-glucoside and penipanoid A, which were present in different abundances in all the active fractions, except in the control, could be the antimicrobial metabolites. In addition, the abundance of fatty acids, such as oleic acid and stearamide in the active fraction, also enhanced the antimicrobial activity. This comprehensive metabolomics study could be used as the basis for isolating biocontrol compounds to be applied in oil palm fields to combat a Ganoderma infection.
Metabolic Profile of Scytalidium parasiticum - Ganoderma boninense Co-Cultures Revealed the Alkaloids, Flavonoids and Fatty Acids that Contribute to Anti-Ganoderma Activity
Nurul Fadhilah Marzuki 2 ,
Yit-Kheng Goh 2 ,
Kamalrul Azlan Azizan 1 ,
You Keng Goh 2 ,
Kah Joo Goh 2 ,
Ahmad Bazli Ramzi 1 and
Syarul Nataqain Baharum 1,*
1
Metabolomics Research Laboratory, Institute of Systems Biology (INBIOSIS), Universiti Kebangsaan Malaysia, UKM, Bangi, Selangor 43600, Malaysia
2
Advanced Agriecological Research Sdn Bhd, No. 11 Jalan Teknologi 3/6, Taman Sains Selangor 1, Kota Damansara, Petaling Jaya, Selangor Darul Ehsan 47810, Malaysia
*
Author to whom correspondence should be addressed.
Molecules 2020 , 25 (24), 5965; https://doi.org/10.3390/molecules25245965
Received: 26 October 2020 / Revised: 8 December 2020 / Accepted: 9 December 2020 / Published: 16 December 2020
Abstract
In solving the issue of basal stem rot diseases caused by Ganoderma, an investigation of
Scytalidium parasiticum
as a biological control agent that suppresses Ganoderma infection has gained our interest, as it is more environmentally friendly. Recently, the fungal co-cultivation has emerged as a promising method to discover novel antimicrobial metabolites. In this study, an established technique of co-culturing
Scytalidium parasiticum
and
Ganoderma boninense
was applied to produce and induce metabolites that have antifungal activity against
G. boninense
. The crude extract from the co-culture media was applied to a High Performance Liquid Chromatography (HPLC) preparative column to isolate the bioactive compounds, which were tested against
G. boninense
. The fractions that showed inhibition against
G. boninense
were sent for a Liquid Chromatography-Time of Flight-Mass Spectrometry (LC-TOF-MS) analysis to further identify the compounds that were responsible for the microbicidal activity. Interestingly, we found that eudistomin I, naringenin 7-O-beta-D-glucoside and penipanoid A, which were present in different abundances in all the active fractions, except in the control, could be the antimicrobial metabolites. In addition, the abundance of fatty acids, such as oleic acid and stearamide in the active fraction, also enhanced the antimicrobial activity. This comprehensive metabolomics study could be used as the basis for isolating biocontrol compounds to be applied in oil palm fields to combat a
Ganoderma
infection.
Keywords:
anti-Ganoderma
;
metabolomics
;
Scytalidium parasiticum
;
Ganoderma boninense
;
LC-TOF-MS analysis
;
biological control
1. Introduction
Malaysia has been known as one of the world’s top oil palm producers and exporters since the 1960s, and oil palm production has grown from a humble crop industry to become one of the most significant contributors to Malaysia’s gross domestic product. This industry is a booming business for Malaysia and, thus, has been enhancing Malaysia’s economic growth until now. Nevertheless, the industry faces many challenges, such as serious infections called basal stem rot (BSR) disease, which is caused by the fungus known as
Ganoderma boninense
. This disease has caused significant economic loss, and the total area affected by BSR in 2020 is estimated to be approximately 443,430 ha (65.6 million) oil palm trees [
1
]. Many measures have been implemented to control BSR diseases, such as mechanical and chemical treatments. However, the control by chemical treatment using fungicides has been shown to be less effective than the mechanical treatment and can cause harm to the environment, especially if residues remain in the soil and enter waterways [
2
,
3
]. These effects have hastened the use of biological control as a viable method to combat BSR disease in palm oil. Recently, a new fungus,
Scytalidium parasiticum
, has been isolated from the basidiomata of
G. boninense
[
4
], which causes BSR of oil palm in the southern region of Malaysia. The ascomycetes were detected to inhibit
G. boninense
under in vitro conditions. The potential antifungal metabolite produced by
S. parasiticum
responsible for the effects against Ganoderma remains unknown. The antifungal metabolites could be produced by
S. parasiticum
alone for the self-defense system against Ganoderma or could be induced by co-culturing both fungi; the co-culture technique has become a new trend in the search for a new biocontrol agent discovery.
The excitement in finding potential metabolites that could act as antifungal agents for the biocontrol of Ganoderma inspired us to start our experiment by co-culturing both fungi together at different time courses, from day 0 until day 5. The co-culturing strategy is inspired by nature, and studies have shown that the interactions of two or more different microbes may enhance the accumulation of constitutively present natural products [
5
,
6
] or may trigger the expression of silent biosynthetic pathways, finally yielding new compounds [
7
]. Furthermore, the co-cultivation approach has been widely used in the production of foods, food additives, enzymes, bulk and fine chemicals, bioremediation and the degradation of lignocelluloses. However, its application for the production of antimicrobial compounds is still in its infancy stage [
8
].
To achieve our objectives, our study is focused on the screening of antifungal metabolites produced by co-culturing
S. parasiticum
and
G. boninense
. The crude extracts from these interactions were applied to a preparative column to separate a consortium of active metabolites. The recycling preparative High Performance Liquid Chromatography (HPLC) is used in this study for the fractionation of extracts. This technology is used to increase the separation efficiency by recycling the sample into the column while keeping the peak dispersion to a minimum. This could be achieved by incorporating a recycle valve in the HPLC preparative system to recirculate the unresolved peaks into the column [
9
]. Later, the fractions were collected according to the peaks detected by a UV detector and were later tested for antimicrobial activity against
G. boninense
. The positive results of the fractions were subjected to Liquid Chromatography-Time of Flight-Mass Spectrometry (LC-TOF-MS) analysis to identify the nonvolatile secondary metabolites. As a detection technique, Ultra High Performance Liquid Chromatography-Time of Flight-Mass Spectrometry (UHPLC-TOF-MS) was preferred, since it provides enhanced sensitivity in a full-scan mode compared to triple-quadrupole MS and accurate mass measurements, which are beneficial for structure elucidation. The preprocessed data was analyzed with the appropriate statistical tools—in particular, Principal Component Analysis (PCA) [
10
]. The markers (metabolites) with the greatest variation in the LC-MS dataset were identified by comparing the accuracy of the
m
/
z
value and MS/MS spectra with an available database, as well as a comparison with pure standard compounds. The schematic diagram of the experimental design of this study is shown in
Figure 1
. The emphasis of this study is to characterize the metabolites released from the co-culture and use the metabolites that suppress
G. boninense
growth to develop a biocontrol agent against Ganoderma. The strategies devised in this project show their capability to facilitate the isolation of antifungal compounds biosynthesized by co-culturing
S. parasiticum
and
G. boninense
.
Figure 1. Schematic diagram of the study. The method consists of co-culturing both fungi, Ganoderma boninense and Scytalidium Parasiticum , in the same media with different growth ages (0, 3 and 5 days); liquid extraction; fractionation into recycling preparative High Performance Liquid Chromatography (HPLC); antifungal activity, a mass spectrometry analysis, including a data analysis and compounds identification.
2. Results
2.1. Antifungal Activity against G. boninense
S. parasiticum
released a yellowish pigment when co-cultured with
G. boninense
. Although the content of this yellowish exudate was unknown during this stage, the exudate has fungistatic effects that cause irregular hyphae, reduce growth and degrade the mycelia, as reported by Goh [
4
]. The exudates from the co-culture media were extracted, and the fractions were collected by recycling preparative HPLC for further analysis (
Figure S1
). The antifungal activity of the fractions from the
G. boninense
growth age of 0 day (G0), 3 days (G3) and 5 days (G5), co-cultures were observed against
G. boninense
(
Table 1
). The antifungal activity showed positive results in the G0 fractions, where
S. parasiticum
and
G. boninense
were co-cultured simultaneously. As shown in
Table 1
, the positive results of the G0 fractions were observed in the second, third and fifth recycles. The third recycle showed a higher inhibitory effect than hygromycin, the positive control used in this study. The positive results of the fractions that showed the highest inhibition zones that were analyzed by LC-TOF-MS to identify the metabolites that contribute to antifungal activity.
Table 1. Growth inhibition zone in mm indicates the antifungal activities of recycling preparative High Performance Liquid Chromatography (HPLC) fractions against Ganoderma boninense.
2.2. Multivariate Analysis of the G. boninense–S. parasiticum Co-culture
To evaluate differences in the acquired LC-TOF-MS base peak chromatograms, a Principal Component Analysis (PCA) was carried out on the preprocessed LC-TOF-MS data matrices. This is an initial evaluation of the developed modes and the detection of outliers that could influence their predictive ability and trends. Spectra with similar profiles were plotted closely together in the PCA (normalized Pareto scaled, log-transformed) score plot. The PCA score plot (
Figure 2
) showed that none of the samples were outside the Hotelling T2 95% confidence limit with an acceptable predictability of 10% (Q2X = 0.501), meaning that 50% of the total variation of the X-matrix could be predicted by the model. The X-matrix is the peak intensities generated from an extracted ion chromatogram (EIC). The first two principal components (PC1 and PC2) described the variation in the X-matrix (R2X = 0.627) with an acceptable predictability of 50% (Q2X = 0.501). The first component and second component accounted for 49% and 13% of the total variation, respectively, separating the control groups and the treatment groups (different fractions).
Figure 2. Principal Component Analysis (PCA) score plot of the metabolic changes of the control and co-culture of the S. parasiticum and G. boninense fractions in the first two principal components (PC1 and PC2). G0, G3 and G5 refer to the G. boninense growth age (0, 3 and 5 days), respectively. R3 and R5 represent fractions recycled number at number 3 and number 5, respectively.
2.3. PCA Loading Plot
All variables were displayed in loading plots. The loading plots exhibited the influence (weight) of the individual X-variables in the model. Each point represents a different spectral intensity. The PCA loading plot (
Figure 3
) showed the potential biomarkers for distinguishing samples of all groups. Looking at the samples with positive scores in PC1 in this model, the control masses were grouped (positive score) due to the presence of 133.048
m
/
z
at a retention time of 2.11 min and 325.106
m
/
z
at 2.05 min, which were separated from the treatment group (
Figure 3
). The treatment group (negative score) was separated along PC1 due to the presence of 236.162
m
/
z
at 2.13 min, 134.020
m
/
z
at 2.03 min and 288.284
m
/
z
at 9.52 min (
Figure 3
). The
G. boninense
growth age of 0 day that was fractioned and collected at fifth recycled with fraction number 37–40, G0 R5 37–40 and G0 R5 73–78 were separated from G0 R5 74–78 in the negative score along PC2 due to the presence of 376.256
m
/
z
at 11.43 min in both G0 R5 37–40 and G0 R5 73–78. The G0 R5 74–78 was separated along with the PC2 positive score from the other treatment group due to the presence of 126.012
m
/
z
at 1.59 min and a high level of 236.162
m
/
z
at 2.13 min.
Figure 3. PCA loading plot of control and treated samples that showed the distribution of metabolites (masses) in w*c(1) and w*c(2) planes (green dots). The most important metabolites in VIP list are highlighted in red bulleted dot.
2.4. Variable Influence on Projection (VIP) List
The variable influence on projection (VIP) list was generated from the Partial Least Square- Discriminant Analysis (PLS-DA) model. The VIP is commonly used to summarize the importance of the X-variables in multivariate models based on projections. It summarizes the contribution a variable makes to the model. The value of the VIP score, which is greater than 1, is the typical rule for selecting relevant variables. The VIP can only be generated from a PLS-DA analysis. The most important metabolites (by mass) responsible for the apparent discrimination (those with VIP > 1) are listed in
Table 2
. In the component matrix, variables with higher values indicated a higher contribution of discrimination from groups of that component. From the VIP list, the extracted ion chromatogram (EIC) for each compound across 16 samples is shown in
Figure 4
. The EIC was extracted from profile analysis software, where the signal intensity data was preprocessed (normalized) and later uploaded in SIMCA-P (log-transformed and scaled (Pareto)).
Figure 4. Representative ion intensity for the m / z value ( A ) 133.048 (Retention Time (RT) 2.11 min), ( B ) 236.162 (RT 2.13 min), ( C ) 296.065 (RT 2.01 min), ( D ) 175.130 (RT 2.00 min), ( E ) 325.106 (RT 2.05 min), ( F ) 134.020 (RT 2.03 min), ( G ) 147.034 (RT 2.39 min), ( H ) 288.284 (RT 9.52 min), ( I ) 316.317 (RT 10.08 min), ( J ) 278.061 (RT 1.95 min), ( K ) 476.143 (RT 2.04 min) and ( L ) 290.843 (RT 1.55 min) across 16 samples.
Table 2. Putatively identified metabolites with the highest score of the Variable Influence on Projection (VIP) as determined by a Partial Least Square-Discriminant Analysis (PLS-DA).
2.5. Hierarchical Clustering Analysis of Metabolites
An analysis conducted by hierarchical clustering exhibited that there were several clusters (groups) present; the larger group (the right hand) was divided into three subclusters, and the left-hand group was divided into one subcluster (Control) (
Figure 5
A). The G0 R3 37–40 group was clustered together with the G0 R5 73–78 group. The heat map of the respective metabolites corresponding to each group was also presented (
Figure 5
B). A heat map is a data visualization technique that shows the magnitude of a phenomenon as color in two dimensions. The variation in color is due to the intensity of the compound based on the EIC. Rows represent metabolites, and columns represent samples.
Figure 5. Dendrogram obtained after the hierarchical classification of metabolite profiles in the control and G. boninense–S. parasiticum co-culture fractions. ( A ) Heat map of metabolites are shown. ( B ) Bright red denotes highest intensities of metabolites, and light green denotes the lowest intensities or complete absence of metabolites.
3. Discussion
3.1. Metabolites Significantly Different in the Treatment Group and Control Group
The chemical identification of unknown metabolites remains a challenging task in metabolite profiling [ 11 ]. The identification of key metabolites (potential biomarkers) is critical for obtaining desirable discrimination results [ 12 ]. Therefore, the multivariate data analysis by using PCA and PLS-DA were employed in this study and able to provide information on the candidate biomarker from its loading plot by looking at their significant changes up and down regulation. Tryptamine or indoleamine, which was putatively identified with m / z 133.048, was found to be the most significantly different metabolite between the treatment and control groups based on the VIP value ( Table 2 ). This metabolite was found in the control group but was absent in the treatment group (co-culture media), as the fungus had fully catabolized tryptophan and tryptamine as the sources of carbon and nitrogen ( Figure 4 A). Tryptamine is an alkaloid that contains an indole group and is a derivative of tryptophan [ 13 ]. On the other hand, the presence of 236.162 m / z , which was putatively identified as eudistomin I based on the Kyoto Encyclopedia of Genes and Genomes (KEGG) and MassBank database, was found at high levels, approximately 60% higher in the treatment group compared to the control group ( Figure 4 B).
Eudistomin I is a B-carboline alkaloid, an indole alkaloid class that is isolated from the marine Caribbean ascidian Eudistoma olivaceum [ 14 ]. Biosynthesis of the B-carboline alkaloid is associated with the Pictet-Spengler reaction between indoleamines (tryptamine and serotonin) [ 15 ]. Other studies showed that the synthesis of eudistomin began with tryptamine as a starting material [ 16 ]. This finding suggested that the tryptamine that was detected in the control group was used up by the co-culture fungi and involved in the biosynthetic pathway to produce eudistomin I, which explains why tryptamine was not detected in the treatment group. In addition to eudistomin I, we found another interesting metabolite in the treatment group, 296.065 m / z , which was putatively identified as penipanoid A ( Figure 4 C). Penipanoid A is a triazole anthranilic acid alkaloid and has been isolated from marine fungi [ 17 ]. Both penipanoid A and eudistomin I are derived from the shikimate pathway through the conversion of chorismate to anthranilate by anthranilate synthase and the degradation of tryptophan via the anthranilate branch of the β-carboline pathway for eudistomin I.
Other metabolites that were present in the control group but were not in the treatment group included cis-aconitate (175.130 m / z ) ( Figure 4 D) and glucose (325.1 m / z ) ( Figure 4 E). Both cis-aconitate and glucose were consumed as a source of carbon and energy for the production of aspartic acid (134.0458 m / z ) ( Figure 4 F) and lysine (147 m / z ). Lysine was among the highest metabolites found in the treatment group but was not present in the control group ( Figure 4 G). It is known that fungi synthesizes amino acids, including lysine, via the α-aminoadipate pathway [ 18 ]. This pathway has been assumed to be involved in the production of antifungal drugs [ 19 ]. Lysine is significant in enhancing the antifungal action of amphotericin B against Candida albicans strains, although lysine itself did not exert a fungicidal effect [ 20 ]. Meanwhile, aspartic acid is a precursor for other essential amino acids, such as threonine, lysine and homoserine, in a branched and complex regulated pathway [ 21 ].
Oleic acid (288.284 m / z ) ( Figure 4 H) and stearamide (316.317 m / z ) ( Figure 4 I) were present in the co-culture media but were absent in the control group. Interestingly, this fungal co-culture produced a high amount of fatty acids (oleic acid) compared to other metabolites, such as amino acids (please refer to the heat map, Figure 5 B). Both microorganisms could be considered as oleaginous microorganisms [ 22 ]. Our findings also showed that a compound with a mass of 476.143 m / z putatively identified as naringenin 7-O-beta-D-glucoside, was produced in the treatment group and was high in the G0 R5 74–75 group compared to the other group ( Figure 4 K). This compound has antimicrobial effects against a wide spectrum of bacteria (Gram-positive and -negative) and acts as a single component [ 23 ].
3.2. Metabolites that Contribute to Antimicrobial Activity
An analysis of the heat map (
Figure 5
B) showed two main clusters: (a) and (b). The (a) group contained a list of metabolites that were highly abundant in the control group compared to the treatment group. It is suggested that these metabolites were utilized by both fungi in the co-culture directly from the media as carbon and nitrogen sources. In the (a) group, catechin was detected in the oil palm extraction media (OPEM), which is in agreement with a previous study that showed that oil palm leaf extract was rich in catechin [
24
] (
Figure 4
L). Interestingly, our studies provide the first evidence of catechin uptake from the media by the co-cultured fungi. Other metabolites that were taken up by the fungi were mainly carbon and nitrogen sources, such as glucose, tryptamine, tryptophan and aconitate.
The (b) group contained a list of metabolites that were highly abundant in the treatment group, and presumably, these metabolites were secreted by the treatment group. Tyrosine, eudistomin, naringenin and penipanoid A (metabolites in subcluster (c)) were in high abundance in the G0 R5 74–78 group compared to the other treatment group. The antifungal activity of this group was not significantly different from the other treatment groups, suggesting that these metabolites contributed less to the antifungal activity. The contribution of these metabolites to antifungal activity, however, cannot be ignored. It has been reported that the eudistomin group, which contains an oxathiazapine ring, exhibits a wide antibacterial spectrum, including activity against
Enterobacter cloacae
,
Escherichia coli
,
Klebsiella pneumoniae
,
Proteus vulgaris
,
Pseudomonas aeruginosa
,
Salmonella typhimurium
,
Serratia marcescens
,
Staphylococcus aureus
and
Staphylococcus epidermidis
in disc diffusion assays [
25
]. Nevertheless, a previous report showed that penipanoid A did not exhibit antibacterial activity against two bacteria (
Staphylococcus aureus
and
Escherichia coli
) or antifungal activity against five plant-pathogenic fungi (
Alternaria brassicae
,
Fusarium oxysporium
f. sp.
vasinfectum
,
Coniella diplodiella
,
Physalospora piricola
and
Aspergillus niger
) [
17
].
In addition, we found an interesting metabolite from the treatment group, which is putatively identified as homoserine lactone (
Figure 4
J and
Figure 5
B). This compound acts as a quorum-sensing molecule [
26
]. Generally, fungi utilize homoserine lactone to maintain or alter their population’s behavior, including changes in the morphological expression and reproduction, such as sporulation, spore dormancy and germination. Apart from their signaling ability, homoserine lactones trigger the production of other metabolites in the fermentation process. To date, it is undeniable that these molecules play an important role in triggering the production of active fungistatic metabolites, such as penipanoid A and eudistomin I, as defense mechanisms. For example, the treatment with N-butyryl-dl-homoserine lactone resulted in the production of di- and trisulfide emestrins A in
Trypanasoma brucei
and
Leishmania donovani
[
27
]. For the next biocontrol screening experiment, homoserine lactones could be added to the co-culture media to increase the production of metabolites with antimicrobial properties.
On the other hand, the inhibition and interruption of quorum-sensing molecules is also a promising strategy to combat pathogen infection [ 28 ]. This could be done to combat Ganoderma growth by the inhibition or degradation of its quorum-sensing molecules. Specifically, triggering or inhibiting the production of quorum-sensing molecules has a huge effect on both biocontrol strategies in combating a Ganoderma infection.
Metabolites that are in subcluster (d) ( Figure 5 B) enhanced the antimicrobial activity where the abundance of these metabolites was consistent with the increased antimicrobial activity between treatment groups, G0R3 37–41. Oleic acid and stearamide are both long-chain unsaturated fatty acids that are well-documented for their antimicrobial properties, especially in food additives [ 29 , 30 ]. In fact, fatty acid biosynthesis is an emerging target for the development of antimicrobial therapeutic drugs. To date, there are no studies on the antimicrobial effects of oleic acid against pathogenic Ganoderma sp. fungi. However, studies by Walters et al. [ 31 ] demonstrated that oleic acid completely inhibited the growth of plant pathogenic fungi (Rhizoctonia solani , Pythium ultimum , Pyrenophora avenae and Crinipellis perniciosa ) at 1000 µM. The groups G0 R5 74–78 and G0 R5 73–78 showed antimicrobial activities with inhibition zones of 15 mm and 17 mm, respectively, and were as effective as the positive controls and G0R3 37–41 ( Table 1 ). The G0 R5 73–78 and G0R3 37–41 groups showed higher inhibition zones compared to G0 R3 74–78 due to the high contents of oleic acid, stearamide and tricasonoyl ethanolamide.
Despite these metabolites being clustered, clusters c and d might work synergistically to exhibit antimicrobial effects. Many studies have been reporting synergy between combinations of flavonoids that showed stronger antimicrobial activity than the single compound [
32
]. Our studies involving the search for fungistatic metabolites have become known, as we are able to identify a few metabolites that exhibit antimicrobial activity. Previous studies performed by Goh et al., 2016 [
33
] hypothesized that the yellowish exudates released from
S. parasiticum
killed and inhibited the growth of
G. boninense
. Assuming that the metabolites from yellowish exudates that are involved in antimicrobial activities are not accurate and valid, as it has been clearly stated that some metabolites must work synergistically to have antimicrobial effects, for future experiments, we would like to isolate a single compound from this co-culture media—particularly, the yellowish compound—to prove this hypothesis. The detailed profiling result of group G0 R3 37–41 (the largest inhibition zone) is included in
Table 3
and with its chromatogram in
Figure 6
.
Figure 6. Base peak chromatogram (BPC) (red color) and dissect chromatograms (different colors) of the G0R3 37–41 fraction by Liquid Chromatography-Time of Flight-Mass Spectrometry (LC-MS-TOF) in a positive ionization mode. Peak labeling with different numbers represent the compounds identified that correspond to Table 3 . Bruker’s dissect algorithm in Data Analysis software 4.0 allows the user to observe overlapping peaks at very similar retention times.
Table 3. Metabolites that were detected in G0 R3 37-41.
3.3. Metabolites Involved in the Biosynthetic Pathway of the G. boninense–S. parasiticum Interaction
All the metabolites involved in the G. boninense–S. parasiticum interaction were mapped to biological pathways in the KEGG database; these metabolites and pathways involved alkaloids from the tryptophan biosynthetic pathway, phenylalanine biosynthetic pathway, flavonoid biosynthetic pathway and the fatty acid biosynthesis pathway ( Figure 7 ). The results indicated that the fungus–fungus interactions led to many metabolite alterations and the production of secondary metabolites as defense mechanism against other microorganisms.
Figure 7. Metabolites involved in the biosynthetic pathway of G. boninense–S. parasiticum interactions. Single arrows represent one-step enzymatic conversions, while dashed arrows represent multiple reactions.
4. Materials and Methods
4.1. Study Design
S. parasiticum was grown in the G. boninense broth culture at different times, measured in accordance to the G. boninense growth age (0 day, 3 days and 5 days). After 14 days, the co-cultures were extracted with 60% methanol. The extract was concentrated and fractionated with recycling preparative HPLC. The fractions were tested for antifungal activity against G. boninense . The fractions that showed the highest inhibition zones were sent to LC-TOF-MS for further analysis. The detailed workflow of the experimental design is shown in Figure 1 .
4.2. Fungal Strains
The fungal strains were obtained from Advanced Agriecological Research Sdn Bhd. G. boninense G10 (isolated from the Batu Lintang oil palm estate located in Kedah, Malaysia) [ 34 ] and S. parasiticum AAX0113 (isolated and identified from the G. boninense culture collected from the Fraser Estate, located in Johor State, Malaysia) [ 4 ] and were used in this study.
4.3. Chemicals
Methanol and acetonitrile were purchased from Merck (Darmstadt, Germany). Formic acid for UHPLC-TOF-MS analyses were purchased from Sigma-Aldrich (Steinheim, Germany). Water was purified using a Milli-Q system (Millipore, Bedford, MA, USA). All solvents used were of HPLC grade.
4.4. Extraction and Isolation
4.4.1. Preparation of Oil Palm Extract Broth (OPEB)
Healthy oil palm trunks were collected from the oil palm estate and processed without agar [ 4 ].
4.4.2. Experimental Design of Culture Conditions
G. boninense
G10 and
S. parasiticum
AAX0113 fresh cultures were prepared and maintained on malt extract agar (MEA) (Difco, Becton Dickinson, Franklin Lakes, NJ, USA) at 24 °C in dark conditions for 7 days before inoculating them onto the OPEB. Five 10-mm agar plugs of
G. boninense
were precultured in the 250–mL conical flask and incubated at 24 °C on an orbital shaker at 120 rpm. Then, five 10-mm agar plugs of
S. parasiticum
were transferred onto the same conical flask with the different time of
G. boninense
growth age, (0, 3 and 5 days) which was preinoculated in the media. The co-culture flasks were then labeled as G0, G3 and G5 according to the
G. boninense
growth age. Each flask continued to be incubated up to 14 days. Exudates produced during the
G. boninense–S. parasiticum
co-culturing assays were collected after the indicated incubation period and stored at −80 °C before extracting using 60% cold methanol. The control flasks with modified OPEM were without
S. parasiticum
inoculum or mycelial plugs. All treatments with or without
S. parasiticum
were performed in three to five replications to produce enough exudates for metabolite extraction.
4.4.3. Extraction of the Compound
S. parasiticum and G. boninense were cultivated on oil palm extraction media (OPEM) and stored at −80 °C until extraction. The extraction method was optimized from Lim [ 35 ]. Approximately 50 mL of cold 60% methanol was added to the sample at a ratio of 1:1 (i.e., 50 mL of sample in 50 mL of cold 60% methanol). After a vigorous mix (vortex ~30 s), the samples were subjected to sonication in an ice bath with a sonic dis-membrator FB120 (Fisher Scientific, Waltham, MA, USA) fitted with a Model CL-18 probe at 65% power and 30% amplitude with 15-s pulses. The sample was then centrifuged at 10,000 rpm for 10 min at 4 °C. The methanol extracts were stored at −80 °C before the next isolation steps, which were performed with an HPLC preparative system.
4.4.4. Recycling Preparative HPLC Fractionation of the Sample
The recycling preparative HPLC system consisted of an 880-PU pump (Jasco, Tokyo, Japan), a manual injector (Model 7125, Rheodyne, Cotati, CA, USA) with a 20.0-mL sample loop and an 875-UV variable wavelength detector. The detector was set at 280 nm, 254 nm and 320 nm, respectively. The preparative column was a JAIGEL C18 reversed-phase column (250 × 30 mm, particle size 10 µm; Osaka, Japan). The mobile phase was in isocratic mode, 98% methanol. The flow rate was 10 mL/min, and the injection volume was 10 mL. The fraction highlighted in Figure S1 was collected and dried in a rotary evaporator. The dried fraction was tested against a Ganoderma culture, and the inhibitory activity was measured.
4.5. Anti-Ganoderma Activity in the Laboratory
Antifungal activities of the dried fraction were first tested against Ganoderma cultures. Each fraction was diluted in distilled water [ 36 ]. S. parasiticum mycelial plugs (10-mm diameter, from a 7-day-old culture) were then excised and transferred to potato dextrose agar (PDA) plates; hygromycin was used as a positive control. The plates were then incubated at 24 °C and observed after 24 h. The inhibition zone on the agar media was defined by the diameter of the clear zone or a zone without fungal growth. The fraction that showed positive inhibition against Ganoderma was sent to the LC-TOF-MS analysis to identify the active compound(s).
4.6. LC-TOF-MS Analysis
Analyses were performed using ultra-high-performance liquid chromatography (UHPLC) with a microTOF Q III mass spectrometer (MS) (Bruker Daltonics, Bremen, Germany) equipped with an electrospray source (ESI) and connected to an Ultimate 3000 UHPLC system (Dionex, Sunnyvale, CA, USA) equipped with an Acclaim™ Polar Advantage II, 3 × 150 mm, 3-µm particle size C18, reverse-phase column. The gradient elution was performed at 0.4 mL/min at 40 °C using water with 0.1% formic acid (A) and 100% acetonitrile (B) with a 22-min total run time. The sample injection volume was 1 µl. The gradient was as follows: 5% B (0–3 min), 80% B (3–10 min), 80% B (10–15 min) and 5% B (15–22 min). MS was performed in ESI positive ionization mode with the following settings: capillary voltage, 4500 V, nebulizer pressure, 1.2 bar and drying gas, 8 L/min at 200°. The scan range was from 100–1000
m
/
z
. Data processing was performed using the software Data Analysis 4.0 and Profile Analysis (Bruker Daltonics) [
37
].
4.7. Data Processing and Data Analysis
All mass spectral data were acquired using Data Analysis software (version 4.0, Bruker Daltonics). Raw data (d) files were imported into Profile Analysis software (Bruker Daltonics). The Profile Analysis software was used for further data processing, including peak alignment and peak normalization by using a special algorithm generated from an extracted ion chromatogram (EIC) [
38
]. The parameters used were Retention Time (RT) range 0–20 min, mass range 100–1000 Da and mass tolerance 0.02 Da. Internal standard detection parameters were excluded for the peak retention time alignment. Furthermore, isotopic peaks were excluded from the analysis. The noise elimination level was set at 10.00, the maximum masses per RT was set at 6 and, finally, the RT tolerance was set at 0.01 min. Multivariate statistical evaluation of the preprocessed metabolic profiling data was performed with SIMCA-P + (version 12) (Umetrics, Umeå, Sweden). We performed the pretreatment method used in metabolomics data where the signal intensity data were log-transformed and scaled (Pareto) [
39
] and, finally, a partial least squares (PLS) model was generated, which was applied to selected statistically significant variables that were able to discriminate the compared groups. All multivariate models were built on previously prepared data with pareto scaling and logarithmic transformation [
40
].
Other data analyses, such as a Hierarchical Analysis (HCA) and heat map, were performed by using MetaboAnalyst 3.0 software [ 41 ] to visualize the metabolite profiles and reveal the relationship between metabolites and samples. The analysis was performed by using the extracted dataset by 17 metabolites filtered by ANOVA, p < 0.005.
4.8. Metabolite Identification
Compound identification of metabolites was performed by comparing of accuracy of the m / z value (<20 ppm, and MS/MS spectra with an in-house database: Human Metabolome Database (HMDB), Metabolite and Chemical Entity Database (METLIN) and KEGG. Some of the metabolites were compared with a commercially available reference standard (retention time 0.01 min and mass accuracy less than 3 ppm, MS/MS spectra).
4.9. Statistical Analysis
The differential metabolites obtained from the multivariate data analysis software were then validated using ANOVA with post-hoc Tukey’s tests. All the metabolites that contributed to group separation were significant at p < 0.005.
5. Conclusions
Our approach of co-culturing two different microorganisms to determine the biocontrol agents of Ganoderma has shed new light. Current trends for identifying new antimicrobial compounds include co-cultivating two or more microorganisms together. The interactions may trigger the formation of new secondary metabolites that may not produce in a single culture system. The results presented here showed that potential antimicrobial metabolites (alkaloids, flavonoids and fatty acids) were triggered when both
G. boninense
and
S. parasiticum
were cultured together. This finding suggested that a co-culturing technique for biocontrol determination should be introduced at the initial stage of Ganoderma manifestation in order to ensure its effectiveness as inhibitors. Although the anti-Ganoderma activity showed positive results in laboratory trials, we believed that, by identifying the metabolites released during the fungus interaction, it will lead us to the more effective control of Ganoderma in the future. This technique can be integrated into the practical management of Ganoderma control in an oil palm field by focusing on the production of the metabolites, minimum and complete inhibition through the optimal concentration of metabolite extracts and its capacity to remove Ganoderma completely. When oil palms are free from Ganoderma infection, it contributes to a higher yield and productivity in the palm oil industry that benefits Malaysia and other palm oil-importing nations.
Supplementary Materials
Figure S1: Chromatogram crude extract of G.boninense-S.parasiticum co-culture in recycling preparative HPLC. Highlighted in red is the fraction that has been collected for antifungal test.
Author Contributions
S.N.B. conceived and designed the experiments. R.A. performed the experiments. N.F.M., C.K.L., Y.K.G., Y-K.G. and K.J.G. cultured and provided the samples used in this study. C.K.L., Y-K.G., K.A.A. and A.B.R. analyzed the data. S.N.B. and R.A. wrote and edited the manuscript. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by the Universiti Kebangsaan Malaysia Industrial collaboration, grant GGPI-2016-013, and Advanced Agriecological Research Sdn Bhd. Industrial grant RB 2015-002. We also acknowledge the Centre for Research and Instrumentation Management (CRIM), UKM for the Research Instrumentation Development Grants awarded in 2010 and 2013 (PIP-CRIM).
Acknowledgments
We would like to thank our undergraduate intern, Anitha Anne and Gooi Lee Shian for their help on collecting HPLC fractionation and Tan Poi Teng from Lab Science Solution Sdn Bhd. for her guidance in operating the HPLC preparative instrument. We also would like to express our gratitude to Arief Izzairy Zamani for the technical support on the data analysis.
Conflicts of Interest
The authors declare no conflict of interest. The funders had no role in the design of the study; in the collection, analyses or interpretation of data; in the writing of the manuscript or in the decision to publish the results.
References
Abas, R.; Seman, I.A. Economic Impact of Ganoderma Incidence on Malaysian Oil Palm Plantation—A Case Study in Johor. Oil Palm Ind. Econ. J. 2012 , 12 , 24–30. [ Google Scholar ]
Kibria, G.; Haroon, A.K.Y.; Nugegoda, D.; Rose, G. Climate Change and Chemicals: Environmental and Biological Aspects ; New India Publishing Agency: New Delhi, India, 2010. [ Google Scholar ]
Komárek, M.; Čadková, E.; Chrastný, V.; Bordas, F.; Bollinger, J.-C. Contamination of vineyard soils with fungicides: A review of environmental and toxicological aspects. Environ. Int. 2010 , 36 , 138–151. [ Google Scholar ] [ CrossRef ]
Goh, Y.K.; Goh, T.K.; Marzuki, N.F.; Tung, H.J.; Goh, Y.K.; Goh, K.J. Scytalidium parasiticum sp. nov., a New Species Parasitizing on Ganoderma boninense Isolated from Oil Palm in Peninsular Malaysia. Mycobiology 2015 , 43 , 107–117. [ Google Scholar ] [ CrossRef ] [ PubMed ][ Green Version ]
Zuck, K.M.; Shipley, S.; Newman, D.J. Induced Production ofN-Formyl Alkaloids from Aspergillus fumigatusby Co-culture with Streptomyces peucetius . J. Nat. Prod. 2011 , 74 , 1653–1657. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Park, H.B.; Kim, Y.-J.; Park, J.-S.; Yang, H.O.; Lee, K.R.; Kwon, H.C. Glionitrin B, a Cancer Invasion Inhibitory Diketopiperazine Produced by Microbial Co-culture. J. Nat. Prod. 2011 , 74 , 2309–2312. [ Google Scholar ] [ CrossRef ]
Akone, S.H.; Mándi, A.; Kurtán, T.; Hartmann, R.; Lin, W.H.; Daletos, G.; Proksch, P. Inducing secondary metabolite production by the endophytic fungus Chaetomium sp. through fungal–bacterial co-culture and epigenetic modification. Tetrahedron 2016 , 72 , 6340–6347. [ Google Scholar ] [ CrossRef ][ Green Version ]
Bader, J.; Mast-Gerlach, E.; Popović, M.; Bajpai, R.; Stahl, U. Relevance of microbial co-culture fermentations in biotechnology. J. Appl. Microbiol. 2009 , 109 , 371–387. [ Google Scholar ] [ CrossRef ]
Sidana, J.; Joshi, L.K. Recycle HPLC: A Powerful Tool for the Purification of Natural Products. Chromatogr. Res. Int. 2013 , 2013 , 1–7. [ Google Scholar ] [ CrossRef ]
Azizan, K.A.; Baharum, S.N.; Noor, N.M. Metabolic Profiling of Lactococcus lactis Under Different Culture Conditions. Molecules 2012 , 17 , 8022–8036. [ Google Scholar ] [ CrossRef ]
Nakabayashi, R.; Saito, K. Metabolomics for unknown plant metabolites. Anal. Bioanal. Chem. 2013 , 405 , 5005–5011. [ Google Scholar ] [ CrossRef ]
Kim, E.J.; Kwon, J.; Park, S.H.; Park, C.; Seo, Y.-B.; Shin, H.-K.; Kim, H.K.; Lee, K.-S.; Choi, S.-Y.; Ryu, D.H.; et al. Metabolite Profiling of Angelica gigas from Different Geographical Origins Using1H NMR and UPLC-MS Analyses. J. Agric. Food Chem. 2011 , 59 , 8806–8815. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Murch, S.J.; Saxena, P.K. Role of indoleamines in regulation of morphogenesis in vitro cultures of st. John’s wort ( Hypericum perforatum L .). Acta Hortic. 2004 , 629 , 425–432. [ Google Scholar ]
Rinehart, K.L.; Kobayashi, J.; Harbour, G.C.; Hughes, R.G.; Mizsak, S.A.; Scahill, T.A. Eudistomins C, E, K, and L, potent antiviral compounds containing a novel oxathiazepine ring from the Caribbean tunicate Eudistoma olivaceum. J. Am. Chem. Soc. 1984 , 106 , 1524–1526. [ Google Scholar ] [ CrossRef ]
Beck, O.; Faull, K.F. Concentrations of the enantiomers of 5-hydroxymethtryptoline in mammalian urine: Implications for in vivo biosynthesis. Biochem. Pharmacol. 1986 , 35 , 2636–2639. [ Google Scholar ] [ CrossRef ]
Roggero, C.M.; Giulietti, J.M.; Mulcahy, S.P. Efficient synthesis of eudistomin U and evaluation of its cytotoxicity. Bioorganic Med. Chem. Lett. 2014 , 24 , 3549–3551. [ Google Scholar ] [ CrossRef ] [ PubMed ][ Green Version ]
Li, C.-S.; An, C.-Y.; Li, X.-M.; Gao, S.-S.; Cui, C.-M.; Sun, H.-F.; Wang, B.-G. Triazole and Dihydroimidazole Alkaloids from the Marine Sediment-Derived Fungus Penicillium paneum SD-44. J. Nat. Prod. 2011 , 74 , 1331–1334. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Zabriskie, T.M.; Jackson, M.D. Lysine biosynthesis and metabolism in fungi. Nat. Prod. Rep. 2000 , 17 , 85–97. [ Google Scholar ] [ CrossRef ]
Xu, H.; Andi, B.; Qian, J.; West, A.H.; Cook, P.F. The α-Aminoadipate Pathway for Lysine Biosynthesis in Fungi. Cell Biophys. 2006 , 46 , 43–64. [ Google Scholar ] [ CrossRef ]
Zhao, L.; Jiang, J.; Zhu, Z.; Liao, Z.; Yao, X.; Yang, Y.; Cao, Y.; Jiang, Y. Lysine enhances the effect of amphotericin B againstCandida albicans in vitro. Acta Biochim. Biophys. Sin. 2015 , 48 , 182–193. [ Google Scholar ] [ CrossRef ][ Green Version ]
Tanimura, A.; Takashima, M.; Sugita, T.; Endoh, R.; Kikukawa, M.; Yamaguchi, S.; Sakuradani, E.; Ogawa, J.; Shima, J. Selection of oleaginous yeasts with high lipid productivity for practical biodiesel production. Bioresour. Technol. 2014 , 153 , 230–235. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Rigano, D.; Formisano, C.; Basile, A.; Lavitola, A.; Senatore, F.; Rosselli, S.; Bruno, M. Antibacterial activity of flavonoids and phenylpropanoids from Marrubium globosum ssp. libanoticum . Phytother. Res. 2007 , 21 , 395–397. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Jaffri, J.M.; Mohamed, S.; Ahmad, I.N.; Mustapha, N.M.; Manap, Y.A.; Rohimi, N. Effects of catechin-rich oil palm leaf extract on normal and hypertensive rats’ kidney and liver. Food Chem. 2011 , 128 , 433–441. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Rinehart, K.L.; Kobayashi, J.; Harbour, G.C.; Gilmore, J.; Mascal, M.; Holt, T.G.; Shield, L.S.; LaFargue, F. Eudistomins A.-Q, beta.-carbolines from the antiviral Caribbean tunicate Eudistoma olivaceum . J. Am. Chem. Soc. 1987 , 109 , 3378–3387. [ Google Scholar ] [ CrossRef ]
Kalia, V.C. Quorum sensing inhibitors: An overview. Biotechnol. Adv. 2013 , 31 , 224–245. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Rateb, M.E.M.; Hallyburton, I.; Houssen, W.E.; Bull, A.T.; Goodfellow, M.; Santhanam, R.; Jaspars, M.; Ebel, R. Induction of diverse secondary metabolites in Aspergillus fumigatus by microbial co-culture. RSC Adv. 2013 , 3 , 14444–14450. [ Google Scholar ] [ CrossRef ][ Green Version ]
Chen, F.; Gao, Y.; Chen, X.; Yu, Z.; Li, X. Quorum Quenching Enzymes and Their Application in Degrading Signal Molecules to Block Quorum Sensing-Dependent Infection. Int. J. Mol. Sci. 2013 , 14 , 17477–17500. [ Google Scholar ] [ CrossRef ]
Freese, E.; Sheu, C.W.; Galliers, E. Function of Lipophilic Acids as Antimicrobial Food Additives. Nat. Cell Biol. 1973 , 241 , 321–325. [ Google Scholar ] [ CrossRef ]
McGaw, L.; Jäger, A.; Van Staden, J. Antibacterial effects of fatty acids and related compounds from plants. South Afr. J. Bot. 2002 , 68 , 417–423. [ Google Scholar ] [ CrossRef ][ Green Version ]
Walters, D.; Raynor, L.; Mitchell, A.; Walker, R.; Walker, K. Antifungal Activities of Four Fatty Acids against Plant Pathogenic Fungi. Mycopathologia 2004 , 157 , 87–90. [ Google Scholar ] [ CrossRef ]
Da Silva, C.R.; Neto, J.B.D.A.; Campos, R.D.S.; Figueiredo, N.S.; Sampaio, L.S.; Magalhães, H.I.F.; Cavalcanti, B.C.; Gaspar, D.M.; De Andrade, G.M.; Lima, I.S.P.; et al. Synergistic Effect of the Flavonoid Catechin, Quercetin, or Epigallocatechin Gallate with Fluconazole Induces Apoptosis in Candida tropicalis Resistant to Fluconazole. Antimicrob. Agents Chemother. 2013 , 58 , 1468–1478. [ Google Scholar ] [ CrossRef ] [ PubMed ][ Green Version ]
Goh, Y.K.; Marzuki, N.F.; Lim, C.K.; Goh, Y.K.; Goh, K.J. Cytotoxicity and Acute Oral Toxicity of Ascomycetous Mycoparasitic Scytalidium parasiticum . Trans. Sci. Technol. 2016 , 3 , 483–488. [ Google Scholar ]
Kok, S.; Goh, Y.K.; Tung, H.J.; Goh, K.J.; Wong, W.C. In vitro growth of Ganoderma boninense isolates on novel palm extract medium and virulence on oil palm (Elaeis guineensis) seedlings. Malays. J. Microbiol. 2013 , 9 , 32–42. [ Google Scholar ] [ CrossRef ]
Lim, C.K.; Ahmad, R.; Marzuki, N.F.; Goh, Y.K.; Azizan, K.A.; Goh, Y.K.; Goh, K.J. Optimization of Metabolite Extraction Protocols for Untargeted Metabolite Profiling of Mycoparasitic Scytalidium parasiticum using LC-TOF-MS. Sains Malays. 2018 , 47 , 3061–3068. [ Google Scholar ] [ CrossRef ]
Ahmad, R.; Baharum, S.N.; Bunawan, H.; Lee, M.; Noor, N.M.; Rohani, E.; Ilias, N.; Zin, N.M. Volatile Profiling of Aromatic Traditional Medicinal Plant, Polygonum minus in Different Tissues and Its Biological Activities. Molecules 2014 , 19 , 19220–19242. [ Google Scholar ] [ CrossRef ] [ PubMed ][ Green Version ]
Veeramohan, R.; Azizan, K.A.; Aizat, W.M.; Goh, H.-H.; Mansor, S.M.; Yusof, N.S.M.; Baharum, S.N.; Ng, C.L. Metabolomics data of Mitragyna speciosa leaf using LC-ESI-TOF-MS. Data Brief. 2018 , 18 , 1212–1216. [ Google Scholar ] [ CrossRef ]
Krug, D.; Zurek, G.; Schneider, B.; Garcia, R.; Müller, R. Efficient mining of myxobacterial metabolite profiles enabled by liquid chromatography–electrospray ionisation-time-of-flight mass spectrometry and compound-based principal component analysis. Anal. Chim. Acta 2008 , 624 , 97–106. [ Google Scholar ] [ CrossRef ]
Van den Berg, R.A.; Hoefsloot, H.C.J.; Westerhuis, J.A.; Smilde, A.K.; Van Der Werf, M.J. Centering, scaling, and transformations: Improving the biological information content of metabolomics data. BMC Genom. 2006 , 7 , 142. [ Google Scholar ] [ CrossRef ][ Green Version ]
Ahmad, R.; Bunawan, H.; Normah, M.N.; Baharum, S.N. Chemical composition in different tissues of Polygonum minus by using GC X GC-TOF MS and direct discrimination by multivariate analysis of fourier transform infrared spectroscopy data. Int. J. Pharmacogn. Phytochem. Res. 2016 , 8 , 1986–1992. [ Google Scholar ]
Xia, J.; Wishart, D.S. Using MetaboAnalyst 3.0 for Comprehensive Metabolomics Data Analysis. Curr. Protoc. Bioinform. 2016 , 55 , 14.10.1–14.10.91. [ Google Scholar ] [ CrossRef ]
Figure 1. Schematic diagram of the study. The method consists of co-culturing both fungi, Ganoderma boninense and Scytalidium Parasiticum , in the same media with different growth ages (0, 3 and 5 days); liquid extraction; fractionation into recycling preparative High Performance Liquid Chromatography (HPLC); antifungal activity, a mass spectrometry analysis, including a data analysis and compounds identification.
Figure 2. Principal Component Analysis (PCA) score plot of the metabolic changes of the control and co-culture of the S. parasiticum and G. boninense fractions in the first two principal components (PC1 and PC2). G0, G3 and G5 refer to the G. boninense growth age (0, 3 and 5 days), respectively. R3 and R5 represent fractions recycled number at number 3 and number 5, respectively.
Figure 4. Representative ion intensity for the m / z value ( A ) 133.048 (Retention Time (RT) 2.11 min), ( B ) 236.162 (RT 2.13 min), ( C ) 296.065 (RT 2.01 min), ( D ) 175.130 (RT 2.00 min), ( E ) 325.106 (RT 2.05 min), ( F ) 134.020 (RT 2.03 min), ( G ) 147.034 (RT 2.39 min), ( H ) 288.284 (RT 9.52 min), ( I ) 316.317 (RT 10.08 min), ( J ) 278.061 (RT 1.95 min), ( K ) 476.143 (RT 2.04 min) and ( L ) 290.843 (RT 1.55 min) across 16 samples.
Figure 5. Dendrogram obtained after the hierarchical classification of metabolite profiles in the control and G. boninense–S. parasiticum co-culture fractions. ( A ) Heat map of metabolites are shown. ( B ) Bright red denotes highest intensities of metabolites, and light green denotes the lowest intensities or complete absence of metabolites.
Figure 6. Base peak chromatogram (BPC) (red color) and dissect chromatograms (different colors) of the G0R3 37–41 fraction by Liquid Chromatography-Time of Flight-Mass Spectrometry (LC-MS-TOF) in a positive ionization mode. Peak labeling with different numbers represent the compounds identified that correspond to Table 3 . Bruker’s dissect algorithm in Data Analysis software 4.0 allows the user to observe overlapping peaks at very similar retention times.
Figure 7. Metabolites involved in the biosynthetic pathway of G. boninense–S. parasiticum interactions. Single arrows represent one-step enzymatic conversions, while dashed arrows represent multiple reactions.
Table 1. Growth inhibition zone in mm indicates the antifungal activities of recycling preparative High Performance Liquid Chromatography (HPLC) fractions against Ganoderma boninense.
Sample No. of Recycle Retention Time (min) Test Concentration (µg/mL) Diameter (mm) Hygromycin (Positive control) - - 100 17 Distilled water (negative control) - - - XP with G0 3rd 37–41 100 20 XP with G0 2nd 37–40 100 8 XP with G0 5th 73–78 100 17 XP with G0 5th 74–78 200 15 XP with G0 6th 72–85 800 - XP with G0 1st 24–28 500 - XP with G3 3rd 49–51 300 - XP with G3 4th 56–61 600 - XP with G3 5th 55–92 500 - XP with G3 7th 105–107 50 - XP with G3 8th 112–120 700 - XP with G5 3rd 50–53 400 - XP with G5 6th 87–89 200 - XP with G5 8th 111–119 500 - XP with G5 9th 124–129 700 -
XP refers to Scytalidium parasiticum; G0, G3 and G5 refer to the G. boninense growth age (0, 3 and 5 days), respectively. XP with G0 refer to S. parasiticum and G. boninense that were cultured simultaneously in the same media. XP with G3 and G5 refer to S. parasiticum was cultured in the same media after 3 and 5 days of G. boninense growth, respectively.
Table 2. Putatively identified metabolites with the highest score of the Variable Influence on Projection (VIP) as determined by a Partial Least Square-Discriminant Analysis (PLS-DA).
Var ID (Primary). M3.VIP (2) 2.44693 * M3.VIP (2) cvSE Name of Metabolite 2.11 min: 133.048 m/z 7.8737 1.5332 Tryptamine 2.13 min: 236.162 m/z 7.07568 2.49579 Eudistomin I 2.05 min: 325.106 m/z 6.40082 2.65825 Glucose 9.52 min: 288.284 m/z 6.35539 1.37838 Oleic acid 2.03 min: 134.020 m/z 5.28688 1.82764 Aspartic acid 2.00 min: 175.130 m/z 4.58414 0.974071 Cis-aconitate 2.01 min: 296.065 m/z 3.82321 0.662272 Penipanoid A 2.04 min: 476.143 m/z 3.70863 2.01345 Naringenin 7-O-beta-D-glucoside 2.26 min: 182.016 m/z 3.70402 1.55685 Tyrosine 1.55 min: 290.843 m/z 3.16889 0.535434 Catechin 1.95 min: 278.061 m/z 2.60836 0.638658 C10-Homoserine lactone 2.39 min: 147.034 m/z 2.15276 3.25775 Lysine
M3. VIP (2) 2.44693 * refers to PLS-DA model which generate VIP value that has been coefficiently combined and plotted in a w*c(1) and w*c(2); cvSE refers to Jack-knife standard error of the VIP computed from all rounds of cross validation in SIMCA-P analysis.
Table 3. Metabolites that were detected in G0 R3 37-41.
Peak No RT Mass per Charge Ratio m / z Measured Mass Assigned Identity Collision Energy Molecule Formula MS/MS Fragmentation (Intensity) Adduct 10 1.1 110.0108 Hypotaurine * 15.5eV C 2 H 7 NO 2 S 92.0250, 1143 (M + H) 15 1.3 122.9258 Benzoic acid * 16.1eV C 7 H 6 O 2 105.08760, 1290 (M + H) 16 1.3 290.8457 Catechin 24.5eV C 15 H 14 O 6 171.5677, 3678 171.5887, 4058 171.6049, 4058 179.1129, 3312 179.1367, 4082 179.1813, 4082 (M + H) 17 1.3 275.2777 5-Methyl-2-thiouridine 23.7eV C 10 H 14 N 2 O 5 S 163.1166, 3705 163.1334, 3914 163.1570, 3914 (M + H) 20 1.5 202.4605 Unknown 20.1eV 130.6173, 4463 130.6329, 4463 130.6502, 4463 202.1813, 9614 24 1.7 130.0509 1-pyrroline-3-hydroxy-5-carboxylic acid 16.5eV C 5 H 7 NO 3 (M + H) 26 1.7 120.0667 Threonine * 16.0eV C 4 H 9 NO 3 119.0912, 3282 27 1.7 147.0778 Lysine * 17.4eV C 6 H 14 N 2 O 2 130.0551, 18195 (M + H) 31 1.8 236.1492 Eudistomin I 21.8eV C 17 H 17 N 131.0746, 2460 144.1066, 1842 159.0711, 1092 162.1228, 1025 166.1661, 1081 235.9925, 1923 236.1602, 468519 (M + H) 32 1.8 134.0458 Aspartic acid * 16.7eV C 4 H 7 NO 4 130.6177, 4202 130.6332, 4202 130.6488, 4202 (M + H) 34 1.8 476.1605 Naringenin 7-O-beta-D-glucoside 33.8eV C 22 H 25 N 3 O 7 S 189.0968, 4684 189.1137, 4684 423.7170, 3421 442.7981, 3304 442.8188, 3304 442.8545, 3304 442.8990, 3304 (M + CAN + H) 35 1.8 296.065 Penipanoid A 24.8 C 16 H 13 N 3 O 3 134.0476, 7620 146.0429, 7772 176.6487, 4717 212.0545, 9702 232.0834, 7284 260.0760, 31695 278.0874, 15708 (M + H) 36 1.9 279.0883 Microdiplodiasone 23.9eV C 14 H 14 O 6 154.1383, 3673 157.9724, 4158 157.9956, 4158 158.0143, 4158 165.1407, 4022 165.1613, 4022 169.1546, 4371 (M + H) 37 1.9 278.0867 C-10 Homoserine lactone 23.9eV C 15 H 14 N 4 O 4 154.1383, 3673 157.9724, 4158 157.9956, 4158 158.0143, 4158 165.1407, 4022 165.1613, 4022 169.1546, 4371 (M + Na) 41 2.23 148.037 Glutamic acid * 17.5 C 5 H 9 NO 4 130.0593, 9726 (M + H) 42 2.26 182.016 Tyrosine * 18.8 C 9 H 11 NO 3 136.0866, 551563 123.0543, 246978 (M + H) 58 2.9 152.0994 Phenylglycine * 17.6eV C 8 H 9 NO 2 151.8762, 2975 (M + H) 59 2.9 173.7029 unknown 18.7eV 111.0084, 107 129.0178, 268 173.0086, 87 (M + H) 60 2.9 166.1228 Phenylalanine * 18.4 C 9 H 11 NO 2 120.079, 10000 121.082, 840 122.085, 1025 131.048, 1105 149.057, 350 (M + H) 132 9.5 288.2897 Oleic acid 24.4eV C 18 H 34 O 2 244.2584, 4646 270.2787, 36181 271.2816, 6490 275.6056, 8070 276.5666, 4324 288.2896, 622641 (M + H) 138 9.8 304.2834 Palmitoleoyl 25.2eV C 16 H 29 O 145.9576, 2858 145.9740, 2858 256.2629, 14828 291.7380, 2785 (M + Li) + 141 10.0 316.3202 Stearamide 25.8eV C 18 H 37 NO 298.3091, 6149 (M + CH3OH + H) 166 11.2 158.1532 Gamma-coniceine 17.9eV C 8 H 15 N 138.1894, 2298 142.0622, 2510 145.9096, 2543 145.9323, 2970 145.9569, 2970 145.9714, 2970 (M + CH3OH + H) 175 11.6 398.2401 Tricasonoyl ethanolamide 29.9eV C 22 H 37 NO 2 398.2399, 128383 (M + H) 176 11.6 376.2576 Icaceine 28.8eV C 22 H 33 NO 4 292.2000, 4970 293.1886, 5565 298.6966, 7171 298.7256, 7171 302.1885, 7183 (M + H)
* Compounds that were identified by the authentic standard.
Sample Availability: Samples of the compounds are not available from the authors. Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
MDPI and ACS Style
Ahmad, R.; Lim, C.K.; Marzuki, N.F.; Goh, Y.-K.; Azizan, K.A.; Goh, Y.K.; Goh, K.J.; Ramzi, A.B.; Baharum, S.N. Metabolic Profile of Scytalidium parasiticum- Ganoderma boninenseCo-Cultures Revealed the Alkaloids, Flavonoids and Fatty Acids that Contribute to Anti-Ganoderma Activity. Molecules 2020, 25, 5965.
https://doi.org/10.3390/molecules25245965
AMA Style
Ahmad R, Lim CK, Marzuki NF, Goh Y-K, Azizan KA, Goh YK, Goh KJ, Ramzi AB, Baharum SN. Metabolic Profile of Scytalidium parasiticum- Ganoderma boninenseCo-Cultures Revealed the Alkaloids, Flavonoids and Fatty Acids that Contribute to Anti-Ganoderma Activity. Molecules. 2020; 25(24):5965.
https://doi.org/10.3390/molecules25245965
Chicago/Turabian Style
Ahmad, Rafidah, Choon Kiat Lim, Nurul Fadhilah Marzuki, Yit-Kheng Goh, Kamalrul Azlan Azizan, You Keng Goh, Kah Joo Goh, Ahmad Bazli Ramzi, and Syarul Nataqain Baharum. 2020. "Metabolic Profile of Scytalidium parasiticum- Ganoderma boninenseCo-Cultures Revealed the Alkaloids, Flavonoids and Fatty Acids that Contribute to Anti-Ganoderma Activity" Molecules25, no. 24: 5965.
https://doi.org/10.3390/molecules25245965
| https://www.mdpi.com/1420-3049/25/24/5965/xml |
Financial Literacy and Household Investments in Structured Financial Products | Request PDF
Request PDF | Financial Literacy and Household Investments in Structured Financial Products | Classical portfolio theory suggests that investors would shun away from unfa-miliar financial products. This familiarity bias holds especially for... | Find, read and cite all the research you need on ResearchGate
Financial Literacy and Household Investments in Structured Financial Products
DOI: 10.2139/ssrn.1572339
Authors:
<here is a image 1937ee36a50dd27a-fa33d150fae83bfe>
Eric C. Chang
The University of Hong Kong
<here is a image f2f62089ad6ff61c-d19572ff1996375a>
Miao Zhang
Miao Zhang
<here is a image f2f62089ad6ff61c-d19572ff1996375a>
Avanidhar Subrahmanyam
Avanidhar Subrahmanyam
<here is a image eb0e04cc4e3e2f66-611b4135a903c6b1>
Bing Han
Beijing Jiaotong University
Abstract
Classical portfolio theory suggests that investors would shun away from unfa-miliar financial products. This familiarity bias holds especially for unsophisticated household investors. However, the rapid growth of the credit derivatives market indicates that other factors may have played important role in such investment process. Using unique household investment data from Hong Kong, we show that investors' demand of structured financial products largely depends on their finan-cial literacy. Important determinants according to mean-variance analysis, such as product premium, have little explanatory power to investor's allocation de-cisions. More financially literate investors who can form reasonable expectations about stock returns bought less. Education, intelligence, and relationship with the distributing banks are statistically significant explanatory variables. Our finding supports asset allocation model based on investor background.
... Döbeli and Vanini (2010) controlled for gender differences in SP investments.
Chang et al. (2010)
found that individual financial literacy, education, and IQ are statistically significant explanatory variables, and that investors that were more financially literate formed reasonable expectations about stocks and bought less. Yang (2013) revealed that investors' decision making is affected by their confidence and information gathering abilities, which are significantly influenced by income, age, and gender. ...
Investors' Heterogeneous Preferences for Structured Financial Products in China: The Impact of Demographic Characteristics
Purpose-Structured financial products (SPs) have become very popular with retail investors in recent years. Investors' preferences play a critical role when investing in SPs. The objective of this study is to understand SP investment behavior by investigating Chinese investors' heterogeneous preferences for choosing wealth management products (WMPs) with certain attributes. Theoretical framework-Investors with different demographic characteristics show different preferences in their SP investments. Design/methodology/approach-We employ the choice experiment (CE) method and examine preference heterogeneity using the multinomial logit (MNL) and the mixed logit (MXL) models. Findings-(i) The attributes of small bank, minimum amount, non-guaranteed floating return and guaranteed floating return significantly affect the choice when purchasing WMPs. (ii) There are significant heterogeneous preferences for minimum amount. (iii) These four characters are the sources of heterogeneous preferences for minimum amount. Practical & social implications of research-This information can contribute to understanding the heterogeneous preferences of investors, which can help in designing marketable WMPs to target different kinds of investors. Originality/value-The main contribution of the research is it examines investors' heterogeneous preferences for SPs. The study provides empirical evidence of which attributes of structured products significantly affect investor preferences. It also reveals which characteristics of investors affect their heterogeneous preferences.
The Impact of Financial Literacy Education on Subsequent Financial Behavior
This study examined the differential impact on 79 high school students of a personal financial management course completed 1 to 4 years earlier. This study used a matched sample design based on a school system's records to identify students who had and had not taken a course in personal financial management. The findings indicated that those who took the course were no more financially literate than those who had not. In addition, those who took the course did not evaluate themselves to be more savings-oriented and did not appear to have better financial behavior than those who had not taken the course. The study raises serious questions about the longer - term effectiveness of high school financial literacy courses.
Who Is in Control? The Role of Self‐Perception, Knowledge, and Income in Explaining Consumer Financial Behavior
The current research examines the relationship between consumer financial knowledge, income, and locus of control on financial behavior. Ethnicity is included as a potential moderator of the effects of these three variables on financial behavior. Findings suggest that consumers’ propensity to save, budget, and control spending depends partly on their level of perceived control over outcomes as well as knowledge and financial resources. Evidence of race and ethnicity as moderators is mixed.
What the Seller Wont Tell You: Persuasion and Disclosure in Markets
Thå paper presents the microeconomic theoretical arguments about how sellers disclose information in an attempt to encourage buyers, and the potential role for regulation in encouraging efficient disclosure of information. The author seeks to understand, when should one expect all the relevant information to be reported. If testing and reporting by the seller are costly, the question is whether too little or too much testing and reporting will be done. The article also studies the types of information withheld by the seller and the corresponding reactions of rational buyers. The problems of social welfare and the government regulations to improve the functioning of markets are also addressed. The theoretical tool proposed by the author is the theory of persuasion games games in which one or more sellers provide verifiable information to buyers to influence the actions they take.
Strategic Financial Innovation in Segmented Markets
We study an equilibrium model with restricted investor participation in which strategic arbitrageurs reap profits by exploiting mispricings across different market segments. We endogenize the asset structure as the outcome of a security design game played by the arbitrageurs. The equilibrium asset structure depends realistically upon considerations such as depth and gains from trade. It is neither complete nor socially optimal in general; the degree of inefficiency depends upon the heterogeneity of investors. The Author 2008. Published by Oxford University Press on behalf of The Society for Financial Studies. All rights reserved. For Permissions, please email: [email protected], Oxford University Press.
Risk and Time Preferences Linking Experimental and Household Data from Vietnam
We conducted experiments in Vietnamese villages to determine the predictors of risk and time preferences. In villages with higher mean income, people are less loss-averse and more patient. Household income is correlated with patience but not with risk. We expand measurements of risk and time preferences beyond expected utility and exponential discounting, replacing those models with prospect theory and a three-parameter hyperbolic discounting model. Comparable risk parameter estimates have been found for Chinese farmers, using our method.
Are Risk Aversion and Impatience Related to Cognitive Ability?
This paper investigates whether there is a link between cognitive ability, risk aversion, and impatience, using a representative sample of roughly 1,000 German adults. Subjects participate in choice experiments with monetary incentives measuring risk aversion, and impatience over an annual horizon, and conduct two different, widely used, tests of cognitive ability. We find that lower cognitive ability is associated with greater risk aversion, and more pronounced impatience. These relationships are significant, and robust to controlling for personal characteristics, education, income, and measures of credit constraints. We perform a series of additional robustness checks, which help rule out other possible confounds.
Why Does the Law of One Price Fail? An Experiment on Index Mutual Funds
We evaluate why individuals invest in high-fee index funds. In our experiments, subjects each allocate $10,000 across four
S&P 500 index funds and are rewarded for their portfolio's subsequent return. Subjects overwhelmingly fail to minimize fees.
We reject the hypothesis that subjects buy high-fee index funds because of bundled nonportfolio services. Search costs for
fees matter, but even when we eliminate these costs, fees are not minimized. Instead, subjects place high weight on annualized
returns since inception. Fees paid decrease with financial literacy. Interestingly, subjects who choose high-fee funds sense
they are making a mistake.
Does Market Experience Eliminate Market Anomalies?
This study examines individual behavior in two well-functioning marketplaces to investigate whether market experience eliminates
the endowment effect. Field evidence from both markets suggests that individual behavior converges to the neoclassical prediction
as market experience increases. In an experimental test of whether these observations are due to treatment (market experience)
or selection (e.g., static preferences), I find that market experience plays a significant role in eliminating the endowment
effect. I also find that these results are robust to institutional change and extend beyond the two marketplaces studied.
Overall, this study provides strong evidence that market experience eliminates an important market anomaly.
The Value of Waiting to Invest
This paper studies the optimal timing of investment in an irreversible project where the benefits from the project and the
investment cost follow continuous-time stochastic processes. The optimal investment rule and an explicit formula for the value
of the option to invest are derived, assuming that the option is valued by risk-averse investors who are well diversified.
The same analysis is applied to the scrapping decision. Simulations show that this option value can be significant, and that
for reasonable parameter values it is optimal to wait until benefits are twice the investment costs.
Do Retail Trades Move Markets?
We study the trading of individual investors using transaction data and identifying buyer- or seller-initiated trades. We document four results: (1) Small trade order imbalance correlates well with order imbalance based on trades from retail brokers. (2) Individual investors herd. (3) When measured annually, small trade order imbalance forecasts future returns; stocks heavily bought underperform stocks heavily sold by 4.4 percentage points the following year. (4) Over a weekly horizon, small trade order imbalance reliably predicts returns, but in the opposite direction; stocks heavily bought one week earn strong returns the subsequent week, while stocks heavily sold earn poor returns. The Author 2008. Published by Oxford University Press on behalf of The Society for Financial Studies. All rights reserved. For Permissions, please email: [email protected], Oxford University Press.
Bubble Investors: What Were They Thinking?
Real estate data are often characterized by data irregularities: missing data, censoring or truncation, measurement error, etc. Practitioners often discard missing- or censored-data cases and ignore measurement error. We argue here that an attractive remedy for these irregularity problems is simulation-based model fitting using the Gibbs sampler. The style of the paper is primarily pedagogic, employing a simple illustration to convey the essential ideas, unobscured by implementation complications. Focusing on the missing-data problem, we show dramatic improvement in inference by retaining rather than deleting cases of partially observed data. We also detail Gibbs-sampler usage for other data problems. Copyright American Real Estate and Urban Economics Association.
The Investment Behavior and Performance of Various Investor Types: A Study of Finland's Unique Data Set
Using data from Finland, this study analyzes the extent to which past returns determine the propensity to buy and sell. It also analyzes whether these differences in past-return-based behavior and differences in investor sophistication drive the performance of various investor types. We find that foreign investors tend to be momentum investors, buying past winning stocks and selling past losers. Domestic investors, particularly households, tend to be contrarians. The distinctions in behavior are consistent across a variety of past-return intervals. The portfolios of foreign investors seem to outperform the portfolios of households, even after controlling for behavior differences.
Heterogeneity and Portfolio Choice: Theory and Evidence
| https://www.researchgate.net/publication/228543299_Financial_Literacy_and_Household_Investments_in_Structured_Financial_Products |
It’s Hard to Stay Racist One-On-One, Face-to-Face - Big Think
It’s Hard to Stay Racist One-On-One, Face-to-Face
Daryl Davis has made a point of meeting Ku Klux Klan members and 200 members have quit the racist organization after getting to know him.
Image source: U.S. Embassy Jerusalem/Wikimedia
It’s often said that there’s safety in numbers, and unfortunately, the bromide applies equally to people with hateful attitudes when they operate in groups. Racism, for example, is easy to maintain when surrounded by other haters, but a different matter altogether when a racist is alone with his or her intended victim. At that moment, it’s much harder to ignore the fact that the object of hatred is just another vulnerable human being with the right to be treated respectfully and decently. Author Daryl Davis knows this, and as a black man has been disarming members of the Ku Klux Klan, one by one, since the 1980s by asking each one he meets, “How can you hate me when you don’t even know me?” he tells the Daily Mail. He says he’s gotten over 200 KKK members to quit.
Davis is about to release an updated version of his memoir, Klan-destine Relationships: A Black Man’s Odyssey in the Ku Klux Klan, which describes his experiences.
Davis cites Mark Twain in explaining how all the traveling his family did when he was young gave him a different view of racism, and an unusual patience with the ignorance underlying it: “Travel is fatal to prejudice, bigotry, and narrow-mindedness, and many of our people need it sorely on these accounts. Broad, wholesome, charitable views of men and things cannot be acquired by vegetating in one little corner of the earth all one’s lifetime.”
And Davis has certainly witnessed the damage racism causes everywhere, pointing out, “In Israel, it’s Palestinian versus Jew. In Lebanon, it’s Christian versus Muslim. In Iraq, it’s Sunni Muslim versus Shiite Muslim. In certain African countries, the conflict is tribal. In India, we see a caste system based on the shade of skin color and classicism.”
His approach isn’t without critics who consider his kindness toward racists irksome. “Not all, but most of the criticism has come from black people. I have been called a ‘sellout,’ ‘Uncle Tom,’ ‘Oreo’ and a number of other terrible names.” Davis feels, “This is because [the critics] are engaging in the exact same hateful behavior as they accuse the white racists. I can explain it like this, because I’ve seen it on both sides.”
Davis is a long-time R&B and blues musician — he’s played alongside Chuck Berry and Jerry Lee Lewis, and was friends with the legendary, late Muddy Waters — and music has often been the key to striking up a friendship with a Klan member. “Once when I was performing in a predominantly white venue, a white man approached me on my break and put his arm around me and exclaimed, ‘This is the first time I’ve ever heard a black man play piano like Jerry Lee Lewis.'” To many of us, it’s almost unbelievable that anyone wouldn’t already know the black roots of rock ‘n roll, but such are thefilter bubblesin which people live. “I quickly enlightened him as to the origin of Jerry Lee’s music and told him that Jerry Lee had learned that style from black Boogie Woogie and blues piano players. The man did not believe me, despite the fact that I further told him that Jerry Lee was a good friend of mine and he had told me himself where he learned that style.” Davis continues, “He was curious and wanted to learn more about me. Over time, he and I became good friends. He ended up leaving the KKK.”
Davis’ mano a manoapproach is not without danger, certainly. “There have been some incidents in which I was threatened and a couple of instances where I had to physically fight. Fortunately, I won in both instances.” He goes on, “At the core of it, although they won’t at first admit it, [racists] express superiority, but truly feel inferiority and in order to elevate themselves, they have to push someone else down.” For Davis, though, the risk has clearly been worth all of the minds he’s changed slowly over the years.
Big Thinkhas written before about people who discover the power in conversation between enemies to develop understanding — check outthis articlebyMaajid Nawaz.
As far as the immediate state of race relations in the U.S. goes, Davis, says, “What you are seeing is those people who were dormant racists, being given a new lease on life by the sentiments of our new President-elect. They celebrate his election. But, let me be clear here. Every racist I know, and I know a lot of them, voted for Trump. However, that does not mean that everyone who voted for Trump is a racist.” So he remains hopeful about our long-term prospects: “There has always been a great deal of racism in the U.S. before and after Obama. However, racism in the US is down, post Obama.”
Tags
In this article
bigotry confront Daryl Davis filter bubbles hate speech hatred kkk Klan-destine Relationships ku klux klan Maajid Nawaz Racism
| https://bigthink.com/culture-religion/its-hard-to-stay-racist-one-on-one-face-to-face/ |
Fathers, mothers and family violence: Which risk factors contribute to the occurrence of child maltreatment and exposure to intimate partner violence in early childhood? Findings in a German longitudinal in-depth study | Request PDF
Request PDF | Fathers, mothers and family violence: Which risk factors contribute to the occurrence of child maltreatment and exposure to intimate partner violence in early childhood? Findings in a German longitudinal in-depth study | Background Family violence, especially child maltreatment and intimate partner violence, in early childhood has a strong impact on negative... | Find, read and cite all the research you need on ResearchGate
Article
Fathers, mothers and family violence: Which risk factors contribute to the occurrence of child maltreatment and exposure to intimate partner violence in early childhood? Findings in a German longitudinal in-depth study
January 2022
Child Abuse & Neglect123(3):105373
DOI: 10.1016/j.chiabu.2021.105373
Authors:
<here is a image 962b0ec44ba9f91a-6471d549949f6bee>
Christoph Liel
German Youth Institute
<here is a image 0eb2163dde379762-1173f68cb9cb0681>
Andreas Eickhorst
Hochschule Hannover
<here is a image 1937ee36a50dd27a-fa33d150fae83bfe>
Peter Zimmermann
Bergische Universität Wuppertal
<here is a image 49c86cab9ee20373-5ea7e110a4afcc05>
Mark Stemmler
Friedrich-Alexander-University of Erlangen-Nürnberg
Abstract
Background
Family violence, especially child maltreatment and intimate partner violence, in early childhood has a strong impact on negative developmental outcomes. There is evidence of child, parental, and family risk factors. Less is known about paternal than maternal risk factors.
Objective
To identify maternal and paternal predictors of family violence and predictive constellations of risk factors.
Participants and setting
According to psychosocial adversity in a larger study, families were stratified into low-, medium- and high-risk groups. Both, mothers and fathers (n = 197/191), were investigated longitudinally across seven months using self-report questionnaires and ratings of the IFEEL Pictures.
Methods
χ²-tests, logistic regression models, and prediction configural frequency analysis (P-CFA) were employed.
Results
Univariate predictors (p < .05) were anxiety and stress in mothers, and insensitivity in recognizing negative child emotions in fathers. Within high-risk levels, paternal adverse childhood experiences (ACE) were a predictor (z = 2.92, p > .01), proven by P-CFA. Logistic regression models including family violence at baseline, sociodemographic variables, univariate predictors, and ACE of both parents revealed maternal anxiety (OR = 1.22, p < .05) and low paternal recognition of negative IFEEL Pictures (OR = 6.00, p < .05) as predictors. P-CFA identified socioemotional problems in children and low paternal recognition of negative child emotions as a predictive risk constellation (z = 2.58, p > .01).
Conclusion
Analysis of both caregivers in small population samples with oversampled at-risk families leads to a systemic perspective of family violence. The identified risk constellation is highly relevant for early childhood intervention.
... The IFEEL pictures (Infant Facial Expressions of Emotion from Looking at Pictures) ( [72] have been employed previously in parents at risk for obesity and psychosocial stress to measure their ability to recognize children's emotions [73,
74]
. Six positive, six negative and four ambiguous pictures will be included in the current study, identified by Liel et al. [74] . ...
... The IFEEL pictures (Infant Facial Expressions of Emotion from Looking at Pictures) ( [72] have been employed previously in parents at risk for obesity and psychosocial stress to measure their ability to recognize children's emotions [73,74]. Six positive, six negative and four ambiguous pictures will be included in the current study, identified by Liel et al.
[74]
. Pictures are categorized as positive (negative) if rated as positive (negative) by at least 70% of the participants [75]. ...
... Pictures are categorized as positive (negative) if rated as positive (negative) by at least 70% of the participants [75]. The internal consistency of positive/negative IFEEL Pictures was excellent for mothers and fathers
[74]
. ...
I-PREGNO – prevention of unhealthy weight gain and psychosocial stress in families during pregnancy and postpartum using an mHealth enhanced intervention: a study protocol of two cluster randomized controlled trials
Article
Full-text available
Jun 2023
<here is a image 6ded888f64c259a7-bbe3daea08aad2c1> Lea Kristina Vogel
<here is a image a520e819b1e42573-d7e7acc1732ce17c> Tanja Färber
Ingrid Hölzl
<here is a image dd96235a10d7396b-180a84f7efd828a8> Mireille van Poppel
Background
The transition to parenthood represents a critical life period with psychosocial, and behavioral changes and challenges for parents. This often increases stress and leads to unhealthy weight gain in families, especially in psychosocially burdened families. Although universal and selective prevention programs are offered to families, specific support often fails to reach psychosocially burdened families. Digital technologies are a chance to overcome this problem by enabling a low-threshold access for parents in need. However, there is currently a lack of smartphone-based interventions that are tailored to the needs of psychosocially burdened families.
Aims
The research project I-PREGNO aims to develop and evaluate a self-guided, smartphone-based intervention in combination with face-to-face counseling delivered by healthcare professionals for the prevention of unhealthy weight gain and psychosocial problems. The intervention is specifically tailored to the needs of psychosocially burdened families during the pregnancy and postpartum period.
Methods
In two cluster randomized controlled trials in Germany and Austria (N = 400) psychosocially burdened families will be recruited and randomized to i) treatment as usual (TAU), or ii) I-PREGNO intervention (self-guided I-PREGNO app with counseling sessions) and TAU. We expect higher acceptance and better outcomes on parental weight gain and psychosocial stress in the intervention group.
Discussion
The intervention offers a low cost and low-threshold intervention and considers the life situation of psychosocially burdened families who are a neglected group in traditional prevention programs. After positive evaluation, the intervention may easily be implemented in existing perinatal care structures in European countries such as Germany and Austria.
Trial registration
Both trials were registered prospectively at the German Clinical Trials Register (Germany: DRKS00029673; Austria: DRKS00029934) in July and August 2022.
... The IFEEL pictures (Infant Facial Expressions of Emotion from Looking at Pictures) ((71) have been employed previously in parents at risk for obesity and psychosocial stress to measure their ability to recognize children's emotions (72,
73)
. Six positive, six negative and four ambiguous pictures will be included in the current study, identi ed by Liel et al. (2022). ...
... The IFEEL pictures (Infant Facial Expressions of Emotion from Looking at Pictures) ((71) have been employed previously in parents at risk for obesity and psychosocial stress to measure their ability to recognize children's emotions (72,73). Six positive, six negative and four ambiguous pictures will be included in the current study, identi ed by
Liel et al. (2022)
. Pictures are categorized as positive (negative) ...
... if rated as positive (negative) by at least 70% of the participants (74). The internal consistency of positive/negative IFEEL Pictures was excellent for mothers and fathers
(73)
. ...
I-PREGNO – Prevention of unhealthy weight gain and psychosocial stress in families during pregnancy and postpartum using an mHealth enhanced intervention: A Study Protocol of two cluster randomized controlled trials
Mar 2023
<here is a image 6ded888f64c259a7-bbe3daea08aad2c1> Lea Kristina Vogel
<here is a image a520e819b1e42573-d7e7acc1732ce17c> Tanja Färber
Ingrid Hölzl
Mireille N.M. Poppel
Background
The transition to parenthood represents a critical life period with psychosocial, and behavioral changes and challenges for parents. This often increases stress and leads to unhealthy weight gain in families, especially in psychosocially burdened families. Although universal and selective prevention programs are offered to families, specific support often fails to reach psychosocially burdened families. Digital technologies are a chance to overcome this problem by enabling a low-threshold access for parents in need. However, there is currently a lack of smartphone-based interventions that are tailored to the needs of psychosocially burdened families.
Aims
The research project I-PREGNO aims to develop and evaluate a self-guided, smartphone-based intervention in combination with face-to-face counseling delivered by healthcare professionals for the prevention of unhealthy weight gain and psychosocial problems. The intervention is specifically tailored to the needs of psychosocially burdened families during the pregnancy and postpartum period.
Methods
In two cluster randomized controlled trials in Germany and Austria (N = 400) psychosocially burdened families will be recruited and randomized to i) treatment as usual (TAU), or ii) I-PREGNO intervention (self-guided I-PREGNO app with counseling sessions) and TAU. We expect higher acceptance and better outcomes on parental weight gain and psychosocial stress in the intervention group.
Discussion
The intervention offers a low cost and low-threshold intervention and considers the life situation of psychosocially burdened families who are a neglected group in traditional prevention programs. After positive evaluation, the intervention may easily be implemented in existing perinatal care structures in European countries such as Germany and Austria.
Trial registration
Both trials were registered prospectively at the German Clinical Trials Register (Germany: DRKS00029673; Austria: DRKS00029934) in July and August 2022.
... Without resorting to other strategies, based on the qualities (Crescenza et al., 2021) or the positive disposition of the individual, which could strengthen both the individual and collective sphere, and thus generate new potentialities. Despite these advantages, the assessment of child well-being still focuses on identifying gaps and risks in order to address and modify them (Yoo et al., 2022), or on identifying protective factors as mere absences of risks rather than as targets and possibilities for intervention
(Liel et al., 2022;
Soderstrom et al., 2020). ...
Development and Validation of the Adolescent and Children in Risk of Abuse and Maltreatment Protective Factors Scale (ACRAM-PFS)
Article
Full-text available
Jan 2023
Child Adolesc Soc Work J
<here is a image 7577c95ff97cb590-a8e16e9df10501f6> Adrián García Mollá
<here is a image fa83ba9fca694cce-2eb511b62a9a20b1> Ángela Carbonell
<here is a image 18b484763fb57a85-122d7badc2f6c867> Jose-Javier Navarro-Perez
<here is a image 1937ee36a50dd27a-fa33d150fae83bfe> José Manuel Tomás
Background
Child maltreatment is a significant global problem concerning over 25% of children around the world. Traditionally, the assessment of children’s welfare was characterized by the creation of instruments and models from the deficit-based theoretical framework.
Purpose
This study aims to develop an instrument to measure protective factors (the Adolescent and Children Risk of Abuse and Maltreatment Protective Factors Scale, ACRAM-PFS) and gather evidence on its psychometric properties. ACRAM-PFS is an 18-items scale for the assessment of protective factors of child maltreatment developed from the socioecological framework.
Method
Structural validity, reliability and convergent-related validity were studied for this measure in a sample of 616 children and adolescents, with age ranging from 0 to 18 years old (M = 12.14; SD = 5.22). Cases were informed by 286 child welfare workers. The sample was split in two subsamples, one to perform an Exploratory Factor Analysis (EFA) and the second to perform a Confirmatory Factor Analysis (CFA).
Results
The CFA corroborate the three-factor structure that includes the children and adolescents’ resources, the family/caregiver’s resources and the community resources (χ ² = 278.005, df = 132, p < .001, CFI = 0.955, SRMR = .084, RMSEA = .061, [90% CI: .051-.071]). Results of convergent-related validity indicated significant correlation with CTQ-SF and protective factors dimension of C-CAPS.
Discussion
The results support that ACRAM-PFS is a rigorous measure for assessing protective factors for child maltreatment. The scale can serve as a key tool for designing strengths-based intervention strategies tailored to the actual needs of children and adolescents. The present study provides the implications for the development of protective factor scales in the field of child welfare.
| https://www.researchgate.net/publication/356391320_Fathers_mothers_and_family_violence_Which_risk_factors_contribute_to_the_occurrence_of_child_maltreatment_and_exposure_to_intimate_partner_violence_in_early_childhood_Findings_in_a_German_longitudinal |
Could Spain Be Too Big to Save?
French and Greek elections have once again roiled world markets, and once again eyes are turning to Spain to see what happens next in this significant European market, writes Andy Waldock of Commodity & amp; Derivative Advisors.
Share
Facebook Twitter LinkedIn SMS
Print
GLOBAL
Could Spain Be Too Big to Save?
05/10/2012 9:45 am EST • 4 min read
Andy Waldock
Follow
Founder
Commodity & Derivative Advisors
French and Greek elections have once again roiled world markets, and once again eyes are turning to Spain to see what happens next in this significant European market, writes
Andy Waldock of Commodity & Derivative Advisors .
The Spanish debt auction proceeded in an orderly fashion even as yields crept higher. The general consensus appears to be that Spain is too big to fail. I would suggest that Spain might be too big to save.
Spain is the European Union’s fourth largest economy and 14th largest in the world. Last week, their credit rating was lowered to BBB+ by the Standard & Poor’s rating agency. This week, they announced that their GDP had contracted by 0.3%. This quarter’s decline marked the beginning of Spain’s second recession since 2009.
Finally, the composition of their debt makes any positive economic headway in the next few years nearly impossible.
The interest-rate benchmark is the ten-year bond or note. Spain saw full participation at yields of 5.82%. There are two important points to be made here. First, the participation rate is measured by the bid to cover ratio. It was quite a bit stronger than the last auction in March, coming in at 2.9 compared to 2.4 for the last auction.
The second point is the yield of 5.82%. The alarm bells sound when Spanish debt yields hit 6% on the ten-year note. That’s the magic number at which Spain can no longer afford to refinance or rollover the financing of their budget.
Spanish yields have solid resistance between 6.125% and 6.25%. They peaked at 6.625% in November 2011.
The International Monetary Fund released a report on the European Union and the global debt issues entitled, “Global Financial Stability Report.” Spain’s BBB+ credit rating is three notches above junk status. According to the IMF, the probability of default on BBB+ credit has risen from 0.734% in 2007 to 6.05% at the end of 2011.
I believe that the recent pitches by the BRICs (Brazil, Russia, India and China) to contribute to the bailout funds and push the total available reserves to $430 billion has been received by the markets as restoring confidence, rather than preparing for financial Armageddon.
Spain’s primary source of trouble is the bursting of a housing boom bubble. Sound familiar? Here in America, we struggled through the economic crisis as unemployment peaked at 10%. Meanwhile, the number of homes in foreclosure peaked at 8.12 million in January of 2010 and drove home values here down approximately 25%.
Spain’s unemployment rate is nearly 25%, and close to 50% for people under 25. The Spanish real-estate boom put 80% of the population in home ownership.
Foreclosure rates are now topping 10% at some banks and the unemployment situation is creating a death spiral. This is leading to marked to market values on repossessed homes as much as 60% below their peak. Mark-to-market values leave the repossessing bank with an overleveraged asset and reduces their capital base, further constricting their economy.
Spanish banks packaged their loans for resale on the commercial credit market as mortgage-backed securities. These securities were prime at the time of origination.
However, as their economy has declined, the nonperformance of these loans has placed more of them in the default category. Some of these mortgage pools now contain up to 14% of mortgages more than 90 days overdue. The obvious conclusion is that many Spanish banks are in trouble.
The European Central Bank and the IMF have teamed up to try and save Spain from themselves. The Troubled Asset Relief Program (TARP) committed $470 billion to US banks and the auto industry in order to keep people in their homes and on the job.
The $430 billion that has been pledged to save Spain will not be enough to cover the mortgage losses. Furthermore, the average Spaniard’s primary asset is their home, which accounts for approximately 80% of their net worth. The Spanish debt will be hard to spread around.
This leads to the IMF report on national household deleveraging within the constructs of a banking crisis, which found that the deleveraging process trims an average of 1.45% of GDP. European corporations are already hurting. The lowest levels of corporate credit have skyrocketed from 2% of total corporate credit to almost 16% of total corporate credit in the last five years.
How will the ECB decide which ones are worth saving, and how will Spain feel about relinquishing their sovereignty to the decisions of the ECB and the IMF? Government has never been very successful at manipulating markets over the long haul.
I believe the bond auction was palliative only because investors are certain the ECB will backstop their purchases, just as we have grown accustomed to the Bernanke Put here in the US. And when governments lose control of the markets they have been manipulating, the disaster is spectacular.
Read more from Commodity & Derivative Advisors here…
Related Reading:
Airline All But Cancels Big Airbus Order
Austerity Can Only Go So Far
Meet the UK’s Warren Buffett | https://www.moneyshow.com/articles/globalper-27765/could-spain-be-too-big-to-save/ |
Increased Peripheral Chemoreceptors Sensitivity and Exercise Ventilation in Heart Transplant Recipients | Circulation
Background— Heart failure is characterized by increased ventilation during exercise, which is positively related to increased peripheral and central chemoreceptor sensitivity. Heart transplantation...
Increased Peripheral Chemoreceptors Sensitivity and Exercise Ventilation in Heart Transplant Recipients
Agnieszka Ciarka
,
Nicolas Cuylits
,
Jean-Luc Vachiery
,
Michel Lamotte
,
Jean-Paul Degaute
,
Robert Naeije
and
Philippe van de Borne
Abstract
Background—Heart failure is characterized by increased ventilation during exercise, which is positively related to increased peripheral and central chemoreceptor sensitivity. Heart transplantation does not normalize the ventilatory response to exercise, and its effects on the chemoreflex control of ventilation remain unknown. We tested the hypothesis that chemoreceptor sensitivity is increased in heart transplant recipients (HTRs) and linked to exercise hyperpnea.
Methods and Results—We determined the ventilatory, muscle sympathetic nerve activity (MSNA), and circulatory responses to isocapnic hypoxia and hyperoxic hypercapnia 7±1 years after transplantation in 19 HTRs with a normal left ventricular ejection fraction of 60±2%. Results were compared with those of 11 closely matched referent subjects. Sixteen patients and 10 referent subjects also underwent cycle ergometer exercise tests. HTRs compared with referent subjects presented higher MSNA (52±4 versus 34±3 bursts/min; P<0.01) and heart rates (83±3 versus 68±3 bpm; P<0.01) during room air breathing. The ventilatory response to hypoxia was higher in HTRs than in referent subjects ( P<0.01, ANOVA). The increase in MSNA also was more marked during hypoxia in the HTRs than in the referent group ( P<0.05, ANOVA). Responses to hyperoxic hypercapnia did not differ between the HTRs and the referent group. The ventilatory response to exercise, characterized by the regression slope relating minute ventilation to CO 2output, was steeper in HTRs than in referent subjects (38±2 versus 29±1 L/mm Hg; P<0.01). Exercise ventilation in HTRs was related to the ventilatory response to isocapnic hypoxia ( r=0.57; n=16; P<0.05) and to the ventilatory response to hyperoxic hypercapnia ( r=0.50; n=16; P<0.05).
Conclusions—Peripheral chemoreceptor sensitivity is increased in HTRs and is related to exercise hyperpnea after heart transplantation.
The peripheral chemoreflex, located in the carotid bodies, is the dominant reflex control mechanism regulating the ventilatory and muscle sympathetic nerve activity (MSNA) responses to reductions in partial pressure of oxygen (Pa o 2).1Peripheral chemoreceptors also play an important modulatory role in the regulation of ventilation during exercise. 2–5This is evidenced by the observation that breathing oxygen decreases ventilation and increases arterial carbon dioxide to a greater extent during exercise than at rest. 6,7
Central chemoreceptors are located in the brain stem and respond primarily to hypercapnia.8These receptors exert important influences on the neural and circulatory responses to changes in arterial carbon dioxide content (Pa co 2).8Their activation increases minute ventilation (V̇ e), heart rate (HR), blood pressure (BP), and sympathetic activity.9In normal subjects and athletes, there is a positive relation between V̇ eand the rate of CO 2production (V̇ co 2) during exercise and central chemoreceptor sensitivity at rest. 2,5,10
Heart failure is accompanied by increased peripheral and central chemosensitivity, 11,12which correlates with an increased ventilatory response to exercise.11The ventilatory response of heart transplant recipients (HTRs) during exercise is comparable to that of patients with moderate degrees of heart failure.13Thus, although heart transplantation restores a close-to-normal cardiac function, it does not normalize the ventilatory response to exercise,14and the mechanism of hyperpnea during exercise in HTRs remains incompletely understood.
Clinical Perspective p 257
On the basis of previous evidence that chemoreceptors are important regulators of the ventilatory response to exercise,1that heart failure patients have increased peripheral and central chemoreflex sensitivity,12and that HTRs have an increased ventilatory response to exercise,14we decided to test the hypothesis that chemoreceptor sensitivity is increased in HTRs and that this mechanism is related to exercise hyperpnea after heart transplantation. For this purpose, we determined minute ventilation and MSNA in HTRs with normal left ventricular ejection fraction and in closely matched referent subjects.
Methods
Subjects
The study included 19 HTRs and 11 healthy referent subjects. Healthy referent subjects were recruited by panel advertisement in our hospital. The study protocol was approved by the ethics committee of Erasme Hospital. All patients and referent subjects agreed to participate in the study.
Measurements
Patients and referent subjects were studied in supine resting conditions in a quiet experimentation room. All were instrumented to measure HR by continuous ECG recording (Siemens). BP was determined every minute by an automatic sphygmomanometer (Physiocontrol Collin BP-880). V̇ e(pneumotacometer) and end-tidal carbon dioxide partial pressure (Pet co 2; M.E.C. capnometer) were assessed while subjects breathed through a mouthpiece with a nose clip, which guaranteed exclusive mouth breathing. Arterial blood oxygen was monitored continuously with a pulse oximeter (Nellcor). MSNA was recorded continuously with multiunit recordings of postganglionic sympathetic activity, measured from a nerve fascicle in the peroneal nerve posterior to the fibular head. 15
Baseline recordings were obtained for 5 minutes once subjects had reached stable ventilation.
Chemoreflex Activation
The protocol used to test the chemoreceptor responses to isocapnic hypoxia and hyperoxic hypercapnia was the same as in previous studies. 16,17After a 5-minute baseline period of stable ventilation, peripheral chemoreceptors were activated for 3 minutes by exposure to hypoxia (10% O 2in 90% of N 2); activation of central chemoreceptors was prevented during these 3 minutes by adding carbon dioxide to the inspired gas mixture. Central chemoreceptors were activated by hyperoxic hypercapnia (7% CO 2and 93% O 2) for 3 minutes, again after a 5-minute baseline period of stable ventilation; maintenance of hyperoxia during central chemoreceptor stimulation minimized the activation of peripheral chemoreceptors. The sequence of central and peripheral chemoreflex activation was randomized in all subjects. A 15-minute rest period was ensured between the first intervention and the next 5-minute baseline period of stable ventilation.
Changes in the cardiorespiratory variables during central chemoreceptor testing are presented as means of the 3-minute exposures to hypercapnia. During peripheral chemoreceptor testing, changes in cardiorespiratory variables are presented minute by minute during 3-minute exposure to hypoxia.
Cardiopulmonary Exercise Testing
Sixteen HTRs and 10 referent subjects underwent a maximum, symptom-limited exercise test on the cycle ergometer. They started with 1-minute unloaded pedaling; the load was subsequently increased by 10 W every minute. Expired gas was collected in the mixing chamber and sampled with an O 2and CO 2analyzer while V̇ ewas also recorded (SensorMedics Corp). Ventilation and gas concentrations were averaged over 30 seconds, and from these values, V̇ e, the rate of oxygen uptake (V̇ o), the rate of carbon dioxide production (V̇ co 2), and the respiratory exchange ratio were derived. HR was recorded by a continuously monitored ECG, and systolic and diastolic BPs were determined at the end of each workload by an automatic sphygmomanometer. Peak V̇ owas defined as the V̇ oduring the last 30 seconds of peak exercise.
The adequacy of ventilation/perfusion matching was assessed by determining the ratio of physiological dead space to tidal volume ratio (V d/V t) at the beginning of the exercise (while subjects were pedaling 20 W for 30 seconds) and at peak exercise. V d/V twas calculated from the Bohr equation.18Pet co 2was used as an estimate of Pa co 2. 19
Statistical Analysis
All the data except variables during hyperoxic hypercapnia are presented as mean±SE. Variables during central chemoreceptor sensitivity testing were not distributed normally and are presented as medians (interquartile [IC]). Baseline quantitative variables were compared by unpaired ttest. Responses to hypoxia were compared by ANOVA, with time (baseline versus intervention) and group as the factors. The group-by-time interaction was tested. Because the hypoxic ventilatory response correlates to the body surface area, 2,20,21changes in ventilation in response to hypoxia were normalized for body surface area and related to the ventilatory response to exercise (characterized by the regression slope relating ventilation to CO 2output during exercise, V̇ e/V̇ co 2slope) through linear regression analysis. 11
Responses to hypercapnia were compared by a Mann-Whitney test. Ventilatory responses to hypercapnia at rest were related to the V̇ e/V̇ co 2slope during exercise with Spearman correlation coefficients. The level of statistical significance was fixed at P<0.05.
Results
Subjects
Nineteen (14 male) HTRs (age, 54±3 years; body mass index, 26±1 kg/m 2) and 11 (9 male) referent subjects (age, 50±4 years; body mass index, 25±1 kg/m 2) matched for age, gender, and body mass index took part in our study. The mean time from heart transplantation was 7.2±1.1 years (range, 1.0 to 16.5 years). HTRs had normal left ventricular ejection fraction estimated by echocardiography (60±2%; n=13) and/or by resting radionuclide ventriculography (59±3%; n=18). HTRs were on various combinations of immunosuppressive treatment and were receiving cyclosporine (n=17), azathioprine (n=6), tacrolimus (n=1), and mofetil mycocenolate (n=3). Some HTRs also were taking calcium channel blockers (n=9), angiotensin-converting enzyme inhibitors (n=11), β-blockers (n=4), and diuretics (n=8). No patient suffered from acute allograft rejection at the time of the study. One patient was diabetic and was on oral antidiabetic treatment. For ethical reasons, medication was left unchanged in the HTRs. All referent subjects had a normal physical examination, and none was taking any medication.
Baseline Room Air Breathing
HTRs had higher MSNA (52±4 versus 34±3 bursts/min; P<0.01) and faster HRs (83±3 versus 68±3 bpm; P<0.01) than the referent subjects. Mean arterial BP of 107±3 mm Hg was higher in the HTRs than in the referent subjects (98±3 mm Hg), but the difference was not significant. Both groups had nearly identical arterial blood oxygen saturations (96.4±0.3% versus 96.2±0.4% in the HTRs and referent group, respectively; P=NS). V̇ ewas slightly larger (6.8±0.2 versus 6.5±0.2 L/min) in HTRs than in the referent subjects, but the difference was not significant ( P=NS). Pet co 2was lower (35±1 versus 39±1 mm Hg; P<0.01) in the HTRs than in the referent group.
CaptionFigure 1.Changes in V̇ e(L/min), MSNA (percent baseline amplitude), and arterial blood oxygen saturation (Sat, %) in referent group (dotted line) and HTRs (straight line) during normoxia and 3 consecutive minutes of hypoxia. Comparisons by ANOVA repeated measurements with group and time as factors.
Isocapnic Hypoxia
The increases in V̇ ein response to the 3 minutes of hypoxia were more marked in the HTRs than in the referent subjects ( P<0.01, ANOVA) despite identical reductions in arterial oxygen saturation (Figure 1andFigure 2). The enhanced ventilatory response to hypoxia was also paralleled by a larger rise in MSNA in the HTRs ( P<0.05, ANOVA) (Figure 1andFigure 2). Mean BP and Pet co 2changes were comparable in the 2 groups ( P=NS, ANOVA), whereas the increase in HR was less marked in the HTRs ( P<0.01, ANOVA).
CaptionFigure 2.Recordings show ECG, MSNA, HR, V̇ e, and arterial blood oxygen saturation (Sat) in referent subject (top) and HTR (bottom) during baseline and the third minute of hypoxia. Hypoxia increased MSNA and minute ventilation in both the referent subject and HTR. Despite a similar decrease in arterial blood oxygen saturation, hypoxia produced a greater increase in MSNA and V̇ ein the HRT than in the referent subject.
Hypercapnic Hyperoxia
Baseline values of V̇ e(HTRs, 6.9 L/min [IC, 1.3 L/min]; referent group, 6.4 L/min [IC, 0.8 L/min]; P=NS) and oxygen saturation (HTRs, 97.0% [IC, 1.1%]; referent group, 98.3% [IC, 1.0%]; P=NS) were not different between HTRs and referent subjects before central chemoreceptor testing. Mean BP was higher in HTRs than in the referent group, but the difference did not reach significance (108 mm Hg [IC, 46 mm Hg] versus 96 mm Hg [IC, 15 mm Hg]; P=NS). Pet co 2during room air breathing was lower in HTRs than in the referent subjects (36 mm Hg [IC, 4 mm Hg] versus 39 mm Hg [IC, 3 mm Hg]; P<0.001). Although the increase in Pet co 2was larger in HTRs than in the referent group during hypercapnia, the increases in mean BP, HR, ventilation, MSNA, and oxygen saturation were similar in the 2 groups (Table 1).
<table>TABLE 1. Comparison of the Increases in Mean Arterial BP, HR, V e, MSNA, Pet co 2, and Arterial Blood Oxygen Saturation Between HTRs and the Referent Group During Hyperoxic Hypercapnia<tr><th rowspan=1 colspan=1></th><th rowspan=1 colspan=1> Referent Group (n=11)</th><th rowspan=1 colspan=1> HTR (n=19)</th><th rowspan=1 colspan=1> P</th></tr><tr><td rowspan=1 colspan=4> Sat indicates saturation. Values in parentheses are IC. Despite the larger increase in Pet co 2in HTR, all other variables increase similarly in both groups.</td></tr><tbody><tr><td rowspan=1 colspan=1> ΔMean BP, mm Hg</td><td rowspan=1 colspan=1> 11.2 (6.0)</td><td rowspan=1 colspan=1> 8.1 (11.3)</td><td rowspan=1 colspan=1> 0.45</td></tr><tr><td rowspan=1 colspan=1> ΔHR, bpm</td><td rowspan=1 colspan=1> 1 (11)</td><td rowspan=1 colspan=1> 2 (5)</td><td rowspan=1 colspan=1> 0.64</td></tr><tr><td rowspan=1 colspan=1> ΔV e, L/min</td><td rowspan=1 colspan=1> 5.3 (3.5)</td><td rowspan=1 colspan=1> 6.5 (4.8)</td><td rowspan=1 colspan=1> 0.85</td></tr><tr><td rowspan=1 colspan=1> ΔMSNA, % of baseline</td><td rowspan=1 colspan=1> 33 (26)</td><td rowspan=1 colspan=1> 35 (32)</td><td rowspan=1 colspan=1> 0.11</td></tr><tr><td rowspan=1 colspan=1> ΔPet co 2, mm Hg</td><td rowspan=1 colspan=1> 9 (2)</td><td rowspan=1 colspan=1> 12 (3)</td><td rowspan=1 colspan=1> 0.02</td></tr><tr><td rowspan=1 colspan=1> ΔSat, %</td><td rowspan=1 colspan=1> 2 (1)</td><td rowspan=1 colspan=1> 2 (1)</td><td rowspan=1 colspan=1> 0.32</td></tr></tbody></table>
Cardiopulmonary Exercise Testing
HTRs and referent subjects achieved the same respiratory exchange ratio, but HTRs had lower peak V̇ o, lower peak load in Watts, lower anaerobic threshold, lower peak V̇ e, lower peak oxygen pulse, higher peak V̇ e/V̇ o, and higher peak V̇ e/V̇ co 2(Table 2). HTRs compared with referent subjects presented with a larger ventilatory response to exercise, as evidenced by a steeper V̇ e/V̇ co 2slope (38±2 versus 29±1 L/mm Hg; P<0.01). The V d/V tratio at the workload of 20 W did not differ between referent subjects and HTRs (0.33 versus 0.31; P=0.66). No difference was observed in the V d/V tratio at peak load between the 2 groups (0.22 versus 0.25; P=0.20).
<table>TABLE 2. Comparison of Exercise Test Variables in the Referent Group and HTRs<tr><th rowspan=1 colspan=1></th><th rowspan=1 colspan=1> Referent Group</th><th rowspan=1 colspan=1> HTRs</th><th rowspan=1 colspan=1> I</th></tr><tr><td rowspan=1 colspan=4> RER indicates respiratory exchange ratio; AT, anaerobic threshold.</td></tr><tbody><tr><td rowspan=1 colspan=1> RER</td><td rowspan=1 colspan=1> 1.4±0.3</td><td rowspan=1 colspan=1> 1.4±0.3</td><td rowspan=1 colspan=1> 0.91</td></tr><tr><td rowspan=1 colspan=1> Peak load, W</td><td rowspan=1 colspan=1> 195±19</td><td rowspan=1 colspan=1> 89±7</td><td rowspan=1 colspan=1> <0.0001</td></tr><tr><td rowspan=1 colspan=1> Peak V o 2, mL · kg −1min −1</td><td rowspan=1 colspan=1> 31.1±2.7</td><td rowspan=1 colspan=1> 17.7±1.1</td><td rowspan=1 colspan=1> <0.0001</td></tr><tr><td rowspan=1 colspan=1> AT, mL · kg −1min −1</td><td rowspan=1 colspan=1> 17.8±2.0</td><td rowspan=1 colspan=1> 10.8±0.4</td><td rowspan=1 colspan=1> <0.001</td></tr><tr><td rowspan=1 colspan=1> Peak V e, L/min</td><td rowspan=1 colspan=1> 92±7</td><td rowspan=1 colspan=1> 63±5</td><td rowspan=1 colspan=1> <0.001</td></tr><tr><td rowspan=1 colspan=1> Peak oxygen pulse, mL/beat</td><td rowspan=1 colspan=1> 14.5±1.1</td><td rowspan=1 colspan=1> 10.2±0.7</td><td rowspan=1 colspan=1> <0.001</td></tr><tr><td rowspan=1 colspan=1> Peak V e/V o 2</td><td rowspan=1 colspan=1> 39.1±1.7</td><td rowspan=1 colspan=1> 48.0±3.0</td><td rowspan=1 colspan=1> <0.05</td></tr><tr><td rowspan=1 colspan=1> Peak V e/V o 2</td><td rowspan=1 colspan=1> 30.2±1.2</td><td rowspan=1 colspan=1> 36.7±1.6</td><td rowspan=1 colspan=1> <0.01</td></tr></tbody></table>
Chemosensitivity and the Ventilatory Response to Exercise
The V̇ e/V̇ oslope during exercise in the HTR patients was positively correlated to peripheral chemosensitivity at rest, expressed as the ratio between the rise in ventilation and the reduction in oxygen saturation during the 3 minutes of hypoxia normalized for body surface area, as shown inFigure 3( r=0.57; n=16; P<0.05). The V̇ e/V̇ co 2slope during exercise in HTRs was also directly related to central chemosensitivity at rest, expressed as the ratio between V̇ eand Pet co 2during the 3 minutes of hypercapnia (R Spearman=0.50, P<0.05).
CaptionFigure 3.Linear regression between the ventilatory responses to exercise expressed as the slope between V̇ eand V̇ co 2during exercise (slope V̇ e/V̇ co 2) and peripheral chemosensitivity at rest (expressed as ventilation per saturation, normalized for body surface area) in HTRs.
The V̇ e/V̇ co 2slope in HTRs was related to peak Pet co 2( r=0.67, P=0.0001), but it was not related to peak V d/V t( r=0.25, P=0.36).
Discussion
The original finding of this study is that peripheral chemoreceptor sensitivity is increased in HTRs and may contribute to abnormally increased V̇ eduring exercise in HTRs. To the best of our knowledge, this is the first study to assess chemoreflex control after cardiac transplantation.
Previous studies have shown that patients with congestive heart failure present with a high V̇ e/V̇ co 2ratio during exercise,11and this is associated with a poor prognosis.22The increase in the V̇ e/V̇ co 2ratio during exercise in congestive heart failure is explained by altered ventilation/perfusion matching23and by early lactic acidosis,23but also by increased chemoreceptor gain for both Pa o 2and Pa co 2. 17,22,24This augmented exercise-induced increase in ventilation in congestive heart failure is related to impaired autonomic and baroreceptor control as manifested by increased MSNA,17decreased HR variability, and increased BP variability with predisposition to arrhythmia and sudden death.25Our present study shows that heart transplantation does not restore normal peripheral chemoreceptor function.
Peripheral Chemoreflex Sensitivity
The increased peripheral chemoreflex sensitivity we observed in our HTRs cannot be explained by differences in resting oxygen saturation between the HTRs and referent subjects or by left ventricular systolic dysfunction in the patients. The trend toward a larger baseline V̇ eand lower Pet co 2in the presence of identical oxygen saturations in HTRs suggests that these patients also present with increased chemoreflex sensitivity under resting normoxemic conditions. These results are in keeping with our previous observation that HTRs compared with controls present with higher resting peripheral chemoreceptor drive with increased sympathetic nervous system tone under normoxemic conditions,26which further suggested altered chemoreflex control in HTRs. Hyperventilation inhibits the sympathetic nerve response to chemoreflex activation through activation of pulmonary stretch afferents.27Our observation of increased sympathetic nerve response to hypoxia in the presence of increased V̇ esupports the importance of peripheral chemoreflex enhancement of MSNA after cardiac transplantation. It is unlikely that the lower Pet co 2in the HTRs can explain our findings. If anything, the slightly lower Pet co 2would have hampered the ventilatory and sympathetic response to hypoxia in the HTRs.
There are several possible explanations for the enhancement of peripheral chemoreceptor sensitivity in HTRs. First, denervation of the transplanted heart and associated cardiopulmonary baroreceptor dysfunction could increase peripheral chemoreceptor sensitivity by a mechanism similar to the cardiopulmonary baroreceptor unloading by changes in body position in healthy subjects.28Second, impairment of arterial baroreceptor sensitivity by chronic cyclosporine intake29may attenuate inhibitory stimuli toward peripheral chemoreceptors30and result in a net increase in the sensitivity to hypoxia. Third, systemic arterial hypertension may enhance peripheral chemoreceptor sensitivity to an extent similar to that in patients with essential hypertension.31Finally, mechanisms associated with increased peripheral chemoreceptor sensitivity in heart failure 12,17,22,24could have a lingering effect on chemoreceptor function in patients after cardiac transplantation.
Central Chemoreflex Sensitivity
This study also demonstrates that HTRs have a normal ventilatory and MSNA response to hypercapnia while maintaining an abnormal response to isocapnic hypoxia. It is interesting to speculate why central chemoreceptor sensitivity is normalized while peripheral chemosensitivity remains altered in this group of patients. One possible cause of this apparent discrepancy may relate to the inhibitory interaction between the arterial and cardiopulmonary baroreceptors and the peripheral chemoreceptors. In HTRs, cardiac baroreceptor afferents are cut and become dysfunctional. Arterial baroreceptor sensitivity is impaired because of chronic cyclosporine uptake.29The close proximity of baroreceptor and chemoreceptor neurons in the solitary and paramedian reticular nuclei in the medulla could explain the interactions between these reflexes 30,32; however, such an interference between baroreceptors and central chemoreceptors has not been described. Thus, although the surgical procedure improves cardiac function, which may favor normalization of central chemoreceptor sensitivity, it also alters inhibitory loops and necessitates drug treatments, which may suppress baroreflex restraint on peripheral chemoreflex control. This issue requires further investigation.
Exercise Hyperpnea
Our results are consistent with observations that cardiac transplantation does not normalize exercise hyperpnea after cardiac transplantation.14The exact mechanisms of the increased ventilatory response to exercise in HTRs remain unclear. Ventilation perfusion abnormalities resulting in increased dead space ventilation from an attenuated cardiac chronotropic response to exercise, respiratory muscle weakness, and hypoperfusion have been suggested to explain exercise hyperpnea in HTRs.14Our HTRs disclosed a V d/V tratio similar to that of the referent group at the beginning and end of the ergospirometry. However, because the use of Pet co 2instead of Pa co 2may lead to underestimation of V d/V t, 33,34we cannot exclude that increased V d/V tcontributed to exercise hyperpnea in our HTRs. Nevertheless, we believe that the V d/V tcontribution to exercise hyperpnea is likely to be of minor importance in HTRs. This is based on the following observations. First, we estimated Pa co 2in HTRs and control subjects using the following formula: Pa co 2=5.5+(0.9×Pet co 2)−(0.0021×V t), as suggested by Jones et al.19This method of Pa co 2estimation is used in clinical studies on heart failure patients when only end-tidal Pet co 2is measured.35Afterward, we recalculated V d/V tusing Pa co 2in the Bohr equation. Although we observed a small difference between V d/V tin the patients and control subjects at rest, we still could not find a significant difference between the 2 groups at peak exercise ( P=0.84). Second, the V̇ e/V̇ co 2slope correlated strongly with peak Pet co 2, but it was not related to peak V d/V tin HTRs. This further suggests that increased ventilation during exercise in HTRs is an integral part of deranged cardiorespiratory control rather than an impaired ventilation/perfusion matching in the lungs. 36
Another important finding of our study is that exercise hyperpnea, assessed by the V̇ e/V̇ co 2slope, is related to chemoreceptor sensitivity to hypoxia after transplantation. This is in accordance with previous observations that peripheral chemoreceptors, which sense the oscillations in H+-Pa co 2, K+, catecholamines, and body temperature,37play an important modulatory role in the regulation of ventilation during exercise. 2,4–7The ventilatory response to exercise in normal humans, 2,5as well as in patients with heart failure,11is positively related to chemosensitivity determined in resting conditions. Our study extends this observation to HTRs and suggests that increased peripheral chemoreflex sensitivity and exercise hyperpnea share common pathophysiological mechanisms in these patients.
The last interesting finding is that central chemosensitivity at rest is also related to ventilatory response to exercise in HTRs. The ventilatory response to hypercapnia correlates to the ventilatory response to exercise in normal subjects and athletes 4,5,10; we extend this observation to patients after heart transplantation. However, the ventilatory response from central chemoreceptors was strictly normal in these HTRs. Thus, central chemoreceptor sensitivity contributes to ventilation during exercise but cannot explain the exercise hyperpnea.
In conclusion, our study is the first to demonstrate increased peripheral chemoreceptor sensitivity in HTRs. The increased ventilatory response to exercise observed in HTRs is related to resting peripheral chemoreflex hypersensitivity.
Study Limitations
A positive correlation between the ventilatory response to hypoxia and exercise V̇ e/V̇ co 2does not necessarily imply a cause-effect relationship because of the complex pathophysiology that sustains exercise hyperpnea. Other potential limitations to our study are the fact that the data analysis was not performed in a blinded fashion; the possibility that hypertension, almost always accompanying heart transplantation, may have contributed to our findings; and, as discussed above, the absence of Pa co 2measurements.
This study was supported by Pfizer (Dr Ciarka), the Stefan Batory Foundation (Dr Ciarka), the Foundation for Cardiac Surgery (Drs Ciarka and van de Borne), the National Fund for Research-Belgium (Drs Naeije and van de Borne), the Emile Saucez–René Van Poucke Foundation (Dr van de Borne), and the David et Alice Van Buuren Foundation (Dr van de Borne). We are indebted to Françoise Pignez for drawing the figures and to Annette Fiasse for excellent technical support.
None.
Footnotes
Correspondence to Agnieszka Ciarka, Department of Cardiology, Erasme Hospital, 808 Lennik Rd, 1070 Brussels, Belgium. E-mail [email protected]
References
1Prabhakar NR, Peng YJ. Peripheral chemoreceptors in health and disease. J Appl Physiol . 2004; 96: 359–366. Crossref Medline Google Scholar
2Martin BJ, Weil JV, Sparks KE, McCullough RE, Grover RF. Exercise ventilation correlates positively with ventilatory chemoresponsiveness. J Appl Physiol . 1978; 45: 557–564. Crossref Medline Google Scholar
3Kobayashi T, Sakakibara Y, Masuda A, Ohdaira T, Honda Y. Contribution of peripheral chemoreceptor drive in exercise hyperpnea in humans. Appl Human Sci . 1996; 15: 259–266. Crossref Medline Google Scholar
4Martin BJ, Sparks KE, Zwillich CW, Weil JV. Low exercise ventilation in endurance athletes. Med Sci Sports . 1979; 11: 181–185. Medline Google Scholar
5Rebuck AS, Jones NL, Campbell EJ. Ventilatory response to exercise and to CO 2rebreathing in normal subjects. Clin Sci . 1972; 43: 861–867. Crossref Medline Google Scholar
6Asmussen E, Nielsen NM. Pulmonary ventilation and effect of oxygen breathing in heavy exercise. Acta Physiol Scand . 1958; 43: 365–378. Crossref Medline Google Scholar
7Briggs H. Physical exertion, fitness and breathing. J Physiol . 2004; 54: 292–318. Google Scholar
8Nattie E. CO 2, brainstem chemoreceptors and breathing. Prog Neurobiol . 1999; 59: 299–331. Crossref Medline Google Scholar
9Berger AJ, Mitchell RA, Severinghaus JW. Regulation of respiration (first of three parts). N Engl J Med . 1977; 297: 92–97. Crossref Medline Google Scholar
10Andreas S, Morguet AJ, Werner GS, Kreuzer H. Ventilatory response to exercise and to carbon dioxide in patients with heart failure. Eur Heart J . 1996; 17: 750–755. Crossref Medline Google Scholar
11Chua TP, Clark AL, Amadi AA, Coats AJ. Relation between chemosensitivity and the ventilatory response to exercise in chronic heart failure. J Am Coll Cardiol . 1996; 27: 650–657. Crossref Medline Google Scholar
12Chua TP, Ponikowski P, Coats AJ. Chemoreflexes in heart failure. Circulation . 1997; 96: 2090–2091. Medline Google Scholar
13Nanas SN, Terrovitis JV, Charitos C, Papazachou O, Margari Z, Tsagalou EP, Kassiotis C, Tsolakis E, Toumanidis S, Nanas JN. Ventilatory response to exercise and kinetics of oxygen recovery are similar in cardiac transplant recipients and patients with mild chronic heart failure. J Heart Lung Transplant . 2004; 23: 1154–1159. Crossref Medline Google Scholar
14Marzo KP, Wilson JR, Mancini DM. Effects of cardiac transplantation on ventilatory response to exercise. Am J Cardiol . 1992; 69: 547–553. Crossref Medline Google Scholar
15Mark AL, Victor RG, Nerhed C, Wallin BG. Microneurographic studies of the mechanisms of sympathetic nerve responses to static exercise in humans. Circ Res . 1985; 57: 461–469. Crossref Medline Google Scholar
16Somers VK, Mark AL, Zavala DC, Abboud FM. Contrasting effects of hypoxia and hypercapnia on ventilation and sympathetic activity in humans. J Appl Physiol . 1989; 67: 2101–2106. Crossref Medline Google Scholar
17Narkiewicz K, Pesek CA, van de Borne PJ, Kato M, Somers VK. Enhanced sympathetic and ventilatory responses to central chemoreflex activation in heart failure. Circulation . 1999; 100: 262–267. Crossref Medline Google Scholar
18Wasserman K, Hanssens JE, Sue D, Stringer W, Whipp B. Principles of Exercise Testing and Interpretation. 2nd ed. Philadelphia, Pa: Lippincott Williams & Wilkins; 2005. Google Scholar
19Jones NL, Robertson DG, Kane JW. Difference between end-tidal and arterial P co 2in exercise. J Appl Physiol . 1979; 47: 954–960. Crossref Medline Google Scholar
20Hirshman CA, McCullough RE, Weil JV. Normal values for hypoxic and hypercapnic ventilatory drives in man. J Appl Physiol . 1975; 38: 1095–1098. Crossref Medline Google Scholar
21Rebuck AS, Rigg JR, Kangalee M, Pengelly LD. Control of tidal volume during rebreathing. J Appl Physiol . 1974; 37: 475–478. Crossref Medline Google Scholar
22Ponikowski P, Chua TP, Anker SD, Francis DP, Doehner W, Banasiak W, Poole-Wilson PA, Piepoli MF, Coats AJ. Peripheral chemoreceptor hypersensitivity: an ominous sign in patients with chronic heart failure. Circulation . 2001; 104: 544–549. Crossref Medline Google Scholar
23Wasserman K, Zhang YY, Gitt A, Belardinelli R, Koike A, Lubarsky L, Agostoni PG. Lung function and exercise gas exchange in chronic heart failure. Circulation . 1997; 96: 2221–2227. Crossref Medline Google Scholar
24Ponikowski P, Chua TP, Piepoli M, Ondusova D, Webb-Peploe K, Harrington D, Anker SD, Volterrani M, Colombo R, Mazzuero G, Giordano A, Coats AJ. Augmented peripheral chemosensitivity as a potential input to baroreflex impairment and autonomic imbalance in chronic heart failure. Circulation . 1997; 96: 2586–2594. Crossref Medline Google Scholar
25Ponikowski P, Francis DP, Piepoli MF, Davies LC, Chua TP, Davos CH, Florea V, Banasiak W, Poole-Wilson PA, Coats AJ, Anker SD. Enhanced ventilatory response to exercise in patients with chronic heart failure and preserved exercise tolerance: marker of abnormal cardiorespiratory reflex control and predictor of poor prognosis. Circulation . 2001; 103: 967–972. Crossref Medline Google Scholar
26Ciarka A, Najem B, Cuylits N, Leeman M, Xhaet O, Narkiewicz K, Antoine M, Degaute JP, van de Borne P. Effects of peripheral chemoreceptors deactivation on sympathetic activity in heart transplant recipients. Hypertension . 2005; 45: 894–900. Link Google Scholar
27Kara T, Narkiewicz K, Somers VK. Chemoreflexes: physiology and clinical implications. Acta Physiol Scand . 2003; 177: 377–384. Crossref Medline Google Scholar
28Hildebrandt W, Ottenbacher A, Schuster M, Baisch F, Bartsch P. Increased hypoxic ventilatory response during hypovolemic stress imposed through head-up-tilt and lower-body negative pressure. Eur J Appl Physiol . 2000; 81: 470–478. Crossref Medline Google Scholar
29Shaltout HA, Abdel-Rahman AA. Cyclosporine induces progressive attenuation of baroreceptor heart rate response and cumulative pressor response in conscious unrestrained rats. J Pharmacol Exp Ther . 2003; 305: 966–973. Crossref Medline Google Scholar
30Somers VK, Mark AL, Abboud FM. Interaction of baroreceptor and chemoreceptor reflex control of sympathetic nerve activity in normal humans. J Clin Invest . 1991; 87: 1953–1957. Crossref Medline Google Scholar
31Somers VK, Mark AL, Abboud FM. Potentiation of sympathetic nerve responses to hypoxia in borderline hypertensive subjects. Hypertension . 1988; 11: 608–612. Link Google Scholar
32Miura M, Reis DJ. The role of the solitary and paramedian reticular nuclei in mediating cardiovascular reflex responses from carotid baro- and chemoreceptors. J Physiol . 1972; 223: 525–548. Crossref Medline Google Scholar
33Guazzi M, Marenzi G, Assanelli E, Perego GB, Cattadori G, Doria E, Agostoni PG. Evaluation of the dead space/tidal volume ratio in patients with chronic congestive heart failure. J Card Fail . 1995; 1: 401–408. Crossref Medline Google Scholar
34Matsumoto H, Osanai S, Nakano H, Akiba Y, Onodera S. Ventilatory responses in patients with essential hypertension. Jpn J Physiol . 1991; 41: 831–842. Crossref Medline Google Scholar
35Guazzi M, Belletti S, Tumminello G, Fiorentini C, Guazzi MD. Exercise hyperventilation, dyspnea sensation, and ergoreflex activation in lone atrial fibrillation. Am J Physiol Heart Circ Physiol . 2004; 287: H2899–H2905. Crossref Medline Google Scholar
36Johnson RL Jr. Gas exchange efficiency in congestive heart failure II. Circulation . 2001; 103: 916–918. Crossref Medline Google Scholar
37Ward SA. Control of the exercise hyperpnoea in humans: a modeling perspective. Respir Physiol . 2000; 122: 149–166. Crossref Medline Google Scholar
Circulation
Circulation
Circulation
0009-7322
1524-4539
Lippincott Williams & Wilkins
CLINICAL PERSPECTIVE
17 01 2006
Heart failure is characterized by decreased exercise capacity and abnormally increased ventilatory response to exercise. The ventilatory response to exercise, however, remains comparable to that of patients with moderate heart failure after successful heart transplantation. Several mechanisms such as chronotropic incompetence, increased dead space ventilation in the presence of ventilation-perfusion abnormalities, and abnormal muscle reflex regulation can account for this observation. Pulmonary function also can affect pulmonary gas exchange and increase ventilation once the critical value of lung diffusion capacities is attained. We tested the hypothesis that exercise hyperpnea is related to an abnormal chemoreceptor regulation after transplantation. Our study demonstrates that HTRs have an increased peripheral chemoreceptor sensitivity and that this hypersensitivity is related to exercise hyperpnea. Central chemosensitivity was not increased but was similarly related to exercise hyperpnea. These findings reveal that chemoreflex regulation and exercise intolerance are linked by common regulatory mechanisms. The clinical impact of this finding is that it calls for further research on therapeutic interventions that may affect chemoreflex sensitivity and improve exercise tolerance. Whether exercise training, specific cardiovascular medications, or the treatment of associated conditions can improve chemoreceptor sensitivity in HTRs is not known. Whether improvements in chemoreflex control can translate into less exercise intolerance after transplantation also needs further investigation. This research may enable clinicians to better choose among different treatment modalities to become more successful in improving exercise tolerance after transplantation.
| https://www.ahajournals.org/doi/10.1161/CIRCULATIONAHA.105.560649 |
(PDF) A logarithmic-depth quantum carry-lookahead adder
PDF | We present an efficient addition circuit, borrowing techniques from the classical carry-lookahead arithmetic circuit. Our quantum carry-lookahead... | Find, read and cite all the research you need on ResearchGate
A logarithmic-depth quantum carry-lookahead adder
July 2004
Quantum Information & Computation6(4)
DOI: 10.26421/QIC6.4-5-4
Source
arXiv
Authors:
<here is a image 1937ee36a50dd27a-fa33d150fae83bfe>
Thomas G. Draper
<here is a image f2f62089ad6ff61c-d19572ff1996375a>
Samuel A. Kutin
Samuel A. Kutin
<here is a image f2f62089ad6ff61c-d19572ff1996375a>
Eric M. Rains
Eric M. Rains
<here is a image cc4ce65f5db5a157-f6bf05a4f2da2b6a>
Krysta Marie Svore
Microsoft
Abstract
We present an efficient addition circuit, borrowing techniques from the classical carry-lookahead arithmetic circuit. Our quantum carry-lookahead (QCLA) adder accepts two n-bit numbers and adds them in O(log n) depth using O(n) ancillary qubits. We present both in-place and out-of-place versions, as well as versions that add modulo 2^n and modulo 2^n - 1. Previously, the linear-depth ripple-carry addition circuit has been the method of choice. Our work reduces the cost of addition dramatically with only a slight increase in the number of required qubits. The QCLA adder can be used within current modular multiplication circuits to reduce substantially the run-time of Shor's algorithm.
<here is a image 175d1bd4b7439d95-754927124da715c1>
arXiv:quant-ph/0406142v1 20 Jun 2004
A Logarithmic-Depth Quantum Carry-Lookahead
Adder
Thomas G. Draper ∗ Samuel A. Kutin † Eric M. Rains ‡
Krysta M. Svore §
February 1, 2008
Abstract
We present an efficient addition circuit, borrowing techniques from
the classical carry-lookahead arithmetic circuit.Our quantum carry-
lookahead ( qcla ) adder accepts two n -bit numbers and adds them in
O (log n ) depth usingO ( n ) ancillary qubits.We present both in-place and
out-of-place versions, as well as versions that add modulo 2 n and modulo
2 n
− 1.
Previously, the linear-depth ripple-carry addition circuit has been the
method of choice.Our work reduces the cost of addition dramatically
with only a slight increase in thenumber of required qubits.The qcla
adder can be used within current modular multiplication circuits to reduce
substantially the run-time of Shor’s algorithm.
1 Introduction
With the advent of Shor’s algorithms forprime factorization andthe discrete
logarithm problem, itis necessary to design efficient quantum arithmetic cir-
cuits.Previous quantum addition circuits include thequantum ripple-carry
adder of Vedral, Barenco, and Ekert [7], which has recently been improved [1],
and the transform adder[2].Both of these approaches have depth linear in the
number of input bits.We present a new adder whose depthis logarithmic in
the number of input bits.The circuit size, and the number of ancillary qubits
needed, are linear in thenumber ofinput bits.
Our technique is derived from classical methodsthat perform in time loga-
rithmic in the number of input bits. The classical carry-lookahead ( cla ) adder
∗ 6013 Pontiac Street, Berwyn Heights, MD 20740. [email protected]
† Center for Communications Research,805 Bunn Drive,Princeton, NJ 08540.
[email protected]
‡ Mathematics, University ofCalifornia, Davis, 1 Shields Avenue, Davis, CA 95616–8633.
[email protected]
§ Department of Computer Science, Columbia University, 1214 Amsterdam Avenue, New
York, NY 10027–7003. [email protected]
1
[6, 5, 8] computes the carry bits in a tree-like structure, yielding a logarithmic-
depth circuit.We can exploit this same structure todesign a quantum cla
( qcla ) circuit to add two n -bit numbers in O (log n ) depth.The qclaadder
works in Z , and can be modified to add (mod2 n ) or (mod 2 n − 1).
The theoryof carry-lookahead addition has been knownfor fifty years [6],
and has appeared incircuit design textbooks [4, pp. 158–161],[3, pp. 84–91].
Why, then, is this paper necessary?What are the challenges of adaptingthe
cla technique to a quantum circuit?There are several constraints we have to
consider:
• Reversibility:We are limited to operations which do not destroy informa-
tion.
• Erasure:If we use scratch space, we must explicitly erase it.We will not
be able totake advantage of quantum interference if our circuit leaves
extra information in scratch registers.
• Space-boundedness:We wish to minimize the use of ancillae.
• Bounded fan-out:At a given time, we can only use awire as an input to
a single quantum gate.To use multiple copies of a bit, we must explicitly
perform a fan-out operation, which increases thesize and depth of the
circuit, and may increase the necessary space.
In Section 2.2, we discuss the classical theory ofcarry-lookahead addition;
we then adapt this theory to the quantum setting in Sections3 and 4.Next, in
Section 5, we discuss various modified versions of the addition problem:how to
add (mod 2 n ) or (mod 2 n − 1), how to compare, and how to take an incoming
carry bit asinput.The complexities ofthe various circuits are summarized in
Table 1 on page 19.Finally, we close with some thoughts on future work.
2 Preliminaries
We first describe our notation throughout this paper.We then discuss the
classical carry-lookahead adder.
2.1 Notation
We write thebinary expansion of a number r as r = r n − 1r n − 2 ···r 0 , where r 0
is the low-order bit.
We generally represent negative numbers using two’s-complement arithmetic,
in which the bitwise complement r ′ is equal to − r − 1.In Section 5.5, we consider
one’s-complement arithmetic ,in which r ′ = − r .Note that, in this latter scheme,
the all-zeros bit string and all-ones bitstring both represent zero, so we have to
be careful whendesigning reversible one’s-complement arithmetic circuits.
In our circuit diagrams, time runs from left to right.We use the standard
notation for quantum circuit operations: ⊕ for negation, and • for a control.
2
In this paper, our circuits are composed of not gates (alsocalled negations),
controlled- not(controlled- not ) gates, and Toffoli gates.A controlled- notgate
has a single control qubit connected toa not gate on the target qubit.A Toffoli
gate has two qubits controlling the application of a not gate to the target qubit.
Hence, all of our circuits are classical reversible circuits.
We will refer to the two inputs to our addition circuit as a and b .Our goal is
to compute the sum s , either in place (on top of b ) or out of place.We compute
s by first finding c , the carry bits , such that s = a ⊕ b ⊕c .(If one computes the
sum using standard school-book addition,then c is the sequence of carries.)
We let w ( n ) denote the number of ones inthe binary expansion of n . We
observe that
n − w ( n ) =
∞
X
i =1 j n
2 i k . (1)
We denote log 2 simply by log.
2.2Classical carry-lookahead addition
In this section, we describe the classical carry-lookahead addition circuit and our
motivation for using acarry-lookahead structure.The cla adder [5] sums two
n -bit numbers in O (logn ) depth.In this arithmetic circuit, partial information
about theincoming carry bits is exploited toavoid a linear-time ripple-carry
computation.The carry bit string can be computed using a tree structure to
greatly reduce the number of requiredoperations.
The key ingredient is the carry status on an interval, denoted C [ i, j ]. This
status can take one of three values: k represents “kill,” g represents “generate,”
and p represents “propagate.”We begin witha discussion ofthe carry status
C [ i, i + 1].
Suppose we are adding a and b , and we have computed thecarry bit c i . The
next carry bit c i +1is themajority function MAJ( a i , b i, c i ).The base case for
this process, c 0 , is assumed to be 0—see Section 5.2 for discussion of the more
general problem where c 0 is an input bit.
When a i = b i , we can determinethe carry bit c i +1 without knowing c i.
Specifically, if a i = b i = 0, then the outgoing carry bit c i +1 is automatically
“killed” and we set c i +1 = 0; we say that C [ i, i +1] = k .Similarly, if a i = b i = 1,
then a carrybit is “generated” and c i +1 = 1with carry status C [ i, i + 1] = g.
If a i 6 = b i , then we cannot determine c i +1 without knowing c i .In this case,
the carry c i is “propagated” and we set c i +1 = c i with carry status C [ i, i +1] = p.
Figure 1 summarizes this computationof the carry status.
Given C [ i − 1 , i ] and C[ i, i +1], we can compute thecarry status C[ i − 1 , i+1].
The calculation is shown in Figure2;we use ⊛ to denotethe carry status
operator.If C [ i − 1 , i + 1] = k , then either a carry is killedat position i , or it
would be propagated atposition i but has been killed at position i − 1. Either
way, if C [ i − 1 , i + 1]= k , we know that c i +1 = 0.Similarly, if C [ i − 1 , i + 1]= g,
we know that c i +1 = 1.If C [ i − 1 , i + 1]= p , we conclude that c i +1 = c i − 1.
3
a i b i c i +1 C [ i, i + 1]
0 00k
0 1 c i p
1 0 c i p
1 11 g
Figure 1:The carry statusof a i and b i.
C [ i, i + 1]
⊛ k p g
k kkg
C [ i − 1 , i ] p k p g
g kgg
Figure 2:The carry status assignments C [ i − 1 , i + 1]giventhepreviousand
current carry status values.
The carry status operator ⊛ shown in Figure 2 allows us tomerge intervals:
for any k satisfying i < k < j,
C [ i, j ] =C [ i, k ] ⊛C [ k, j ].
The choice of k does not affect the answer, since ⊛ is associative.By successively
doubling the sizes of intervals, we can use this approach to compute C [ i, j ] for
any i, j in logarithmic depth.
We now describe the computation of the carry bits in detail.Since C [ i, j]
can take three values, we must specify an encoding of C [ i, j ] in bits.We define
p [ i, j ] to be 1 when C [ i, j ] = p , and we define g [i, j ] to be1 when C [ i, j ] = g.
The relationship between C [ i, j ], p[ i, j ], and g[ i, j ] isdepicted in Figure 3.Note
that, in particular, we never have p [ i, j ]= g[ i, j ] = 1.
C [ i, j ] p [ i, j ] g [i, j ]
k 0 0
g 0 1
p 1 0
Figure 3:The carry status C [ i, j ] encoded in two bits p[ i, j ] and g[ i, j].
For any i, j , p [ i, j ] is 1 if acarrypropagates frombit position i to bit position
j , and 0 otherwise.Note that this occurs if and only if a ℓ ⊕ b ℓ = 1 whenever
i ≤ ℓ < j .For any k between i and j , a carry bit ispropagated from bit i to bit
j if a carry bit ispropagated from i to bit k ,andthen also propagated from bit
k to bit j .Thus, the computation of the propagate bits, for any i < k < j , is
p [ i, j ] =p [ i, k ] ∧p [ k, j ] . (2)
4
Next, we consider g [ i, j ].This quantity is 1 when a carry is generated be-
tween bit positions i and j .The computation of the generate bits, for i < k< j,
is
g [ i, j ] =g [ k, j ] ∨ (g [ i, k ] ∧ p [ k, j ])
= g [ k, j ] ⊕( g[ i, k ] ∧ p[ k, j]) .(3)
That is, either a carry bit is generated between bits k and j , or a carry bit is
generated between bits i and k andthen propagated from bit k to bit j . The
second expression follows from theobservation that g [ k, j ] and p[ k , j ] cannot
both be equal to 1.
For all j> 0, p [0 , j ] is 0, and g[0 , j ] is the carry bit c j .By successively
doubling the sizes of the intervals under consideration, we can compute all carry
bits in logarithmic depth.
3Reversible computation of carry status
We are now ready to build a quantum adder usingthe cla technique. We first
explain how we can compute the carry statusreversibly.
The circuit of this section has two input arrays, each of length n : P 0 , initial-
ized to P 0 [ i ] = p[ i, i + 1],and G ,initialized to G[ i ] = g[ i − 1 , i ].Note that the
array P 0 is 0-based, butthe array G is 1-based.We also use n − w ( n ) − ⌊ log n ⌋
ancillary bits, initialized to zero.
At the end of the computation, we want G [ i ] = g[0 , i ] = c i .We also need to
erase our scratch work:we must ensure that, when we’re done, P 0 [ i ] = p[ i, i + 1 ]
and the ancillary bits are reset to zero.
We will have roughly ⌊ log n ⌋ rounds each of four different types:
1. P -rounds:Compute p [ i, j ] values into the ancillary space.
2. G -rounds:Set G [ j ] = g[ i, j ]; for each j , we choose a particular ivalue. 1
3. C -rounds:Set G [ j ] = c j.
4. P − 1 -rounds:Erase the work done inthe P -rounds.
We first describe the sequence of gates, and then we compute the circuit depth.
In P -round t , we compute all p -values of the form p [ i, j ] where i = 2 t mand
j = i + 2 t .We refer to these values as P t [ m ], for 1 ≤ m < ⌊ n/ 2 t ⌋ .We store
these ⌊ n/ 2 t ⌋ − 1 values in our ancillary space.By (1), the total spaceneeded
for all of the P -rounds is n − w ( n ) − ⌊ log n ⌋ bits.We do not need to compute
values of the form p [0 , 2 t ], since no carry isgenerated at 0; in particular, when
t = ⌊ log n ⌋ , no computation is done.
We compute p [ i, j ] using (2),with k = 2 t m + 2 t − 1 .Note that both p[ i, k]
and p [ k, j ] were computed in P -round ( t − 1), so we can write p [ i, j ] to the
1 We have i = ( j − 1) ∧ j , where − denotes subtraction in Z and ∧ denotes bitwise and.
5
appropriate location usingone Toffoli gate.Thetotal number of gates isthus
n − w ( n ) − ⌊ logn ⌋ .
In G -round t , we compute all g -values of the form g [ i, j ] where i = 2 t m
and j = i + 2 t .We store this value in the location G [ j ].We use (3), with
k = 2 t m +2 t − 1 .Since g [ k, j ] is already in location G [ j ]afterG -round ( t − 1), we
can do this computation with asingle Toffoli gate, combining g [ i, k ] (computed
in G -round ( t − 1)) and p [ k, j ] (computed in P -round ( t − 1)).The total number
of gates is n − w ( n).
In C -round t , we compute all g -values of the form g [0 , j ] with j = 2 t m+2 t − 1.
We begin with the maximum t for which some j exists, t = log 2 n
3 =1 +
log n
3 , and work ourway down to t = 1.We use (3) with k = 2 t m . Since
g [ k, j ] is already inlocation G [ j ], we again need just oneToffoli gate:we require
p [ k, j ] (computed in P -round ( t − 1)) and g [0 , k ] (computed in C -round ( t + 1)
or earlier).The total number of gates is n − ⌊ log n ⌋ − 1.
Finally, in the P − 1 -rounds, we simply repeat the same Toffolis as in the
P -rounds, in reverse order.
In summary, we must perform the following steps:
1. P -rounds.For t = 1 to ⌊ log n ⌋ − 1:for1 ≤ m < ⌊ n/ 2 t ⌋:
P t [ m ] ⊕ =P t − 1 [2 m ]P t − 1 [2 m + 1].
2. G -rounds.For t = 1 to ⌊ log n ⌋ :for0 ≤ m < ⌊ n/ 2 t ⌋:
G [2 t m + 2 t ] ⊕ =G [2 t m + 2 t − 1 ]P t − 1 [2 m + 1].
3. C -rounds.For t = log 2 n
3 down to1:for 1 ≤ m≤ ( n − 2 t − 1 ) / 2 t :
G [2 t m + 2 t − 1 ] ⊕ =G [2 t m ]P t − 1 [2 m ].
4. P − 1 -rounds.For t = ⌊ log n ⌋ − 1 down to1:for 1 ≤ m < ⌊ n/ 2 t ⌋:
P t [ m ] ⊕ =P t − 1 [2 m ]P t − 1 [2 m + 1].
The circuit consists of
4 n −3 w ( n ) − 3 ⌊ log n ⌋ − 1 (4)
Toffoli gates.
It would seem that the circuit described above would require roughly 4log n
time-slices.However, we can overlap some of thecomputation.
We start with P -round 1,which usesthe arrays P 0 and P 1 .Then, P -round
2 uses thearrays P 1 and P 2 .Note that G -round 1 uses the arrays G and P 0;
hence, we can run G -round 1 in thesame time-slice as P -round 2.In general,
we can run P -round ( t + 1)and G -round t in parallel.
Similarly, once we have run C -round t , we are done using P t − 1 .While we
run C -round ( t − 1), we can run P − 1 -round t , which uses P t − 1 to erase P t . We
6
run C -round 1 inparallel with P -round 2;we then need one additional time-slice
to run P -round 1.
So, the circuit has a depthof
⌊ log n ⌋ + j log n
3 k + 3 . (5)
For n ≤ 3, expression (5) overcountsthe depth, since there are no P -rounds.
4The complete quantum addition circuit
We are now ready to describe our quantum carry-lookahead addition circuit.
We first discuss theout-of-place version in Section 4.1, andthen the in-place
version in Section 4.2.
The out-of-place version produces n + 1bitsofoutput,anduses n − w ( n ) −
⌊ log n ⌋ ancillae.Thedepthis2 log n + O (1) and the size is 8 n − O (log n ) gates.
The in-place version produces 1 bit of output, and uses 2 n − w ( n ) −⌊ log n ⌋−1
ancillae.Thedepthis4 log n + O (1) and the size is 16 n − O (log n ) gates.
Table 1 on page 19 summarizes thecomplexities of these two adders, as well
as the variants discussed in Section 5.
4.1Addition out of place
We would like to add two n -bit numbers, a and b , stored inarrays Aand B . We
need n + 1bitsfor theoutput, denotedby Z , and n − w ( n ) − ⌊ log n ⌋ancillary
bits, denoted by X .We assume that Z and X are initialized to zero.In the
end, we want Z to contain the quantity s = a + b.
The key relation is thatthe sum s is equal to a ⊕ b ⊕ c , where c is the carry
string.Hence, the key step in ouralgorithm isto compute c ,using the technique
of the previous section.We compute the carry string c 1 through c n into the bits
Z [1] throughZ [ n ].
The out-of-place qcla adder proceeds as follows:
1.For 0 ≤ i < n , Z [ i + 1] ⊕ = A[ i] B[ i ].This sets z i +1 = g[ i, i + 1].
2.For 1 ≤ i < n , B [ i ] ⊕ = A[ i ].This sets B[ i ] = p[ i, i + 1]for i > 0, which is
what we need to run our addition circuit.
3.Runthe circuit ofSection 3,using X as ancillary space.Upon completion,
Z [ i ] = c i for i ≥ 1.
4.For 0 ≤ i < n , Z [ i ] ⊕ = B[ i ].Now, for i > 0, Z[ i ] = a i ⊕ b i ⊕ c i = s i . For
i = 0, we have Z [ i ] = b i .
5.Set Z [0] ⊕ = A [0].For 1 ≤ i < n , B [ i ] ⊕ = A[ i ]. This fixes Z [0], and resets
B to its initial value.
7
00 ee s 0
a 0 r a 0 r
b 0 r b 0 r
0 e r g [0 , 1] e s 1
a 1 r r a 1 r
b 1 r e r p [1 , 2] r e
0 e e r g [0 , 2] r e s 2
a 2 r r a 2 r
b 2 re r p [2 , 3] r r r e
0 e r p [2 , 4] e
0 e r g [2 , 3] e e s 3
a 3 r r a 3 r
b 3 re r r p [3 , 4] r r e
0 e e e r g [0 , 4] r r e s 4
a 4 r r a 4 r
b 4 re r p [4 , 5] r r r e
0 e r p [4 , 6] r r e
0 e r g [4 , 5] e e s 5
a 5 r r a 5 r
b 5 re r r p [5 , 6] r r e
0 e r p [4 , 8] e
0 e e r g [4 , 6] e r e s 6
a 6 r r a 6 r
b 6 re r p [6 , 7] r r r e
0 e r r p [6 , 8] r e
0 e r g [6 , 7] e e s 7
a 7 r r a 7 r
b 7 re r r p [7 , 8] r r e
0 e e ee g [0 , 8] r r e s 8
a 8 r r a 8 r
b 8 re r p [8 , 9] r r r e
0 e p [8 , 10] r e
0 e r g [8 , 9] e e s 9
a 9 r r a 9 r
b 9 re r r p [9 , 10] r r e
0 e e g [8 , 10] e s 10
Figure 4:Out-of-place qcla adder for 10 bits. P -rounds and P − 1 -rounds are
shown in blue. G -rounds are red, and C-rounds are green.
8
Aside from Step 3,each step occurs in a single timeslice.So, by (5), the
overall depth of the circuit is
⌊ log n ⌋ + j log n
3 k + 7 ,
where three of the time-slicescontain controlled- not s and the rest contain Tof-
folis.For n ≤ 3, the depth is slightly lower.
By (4), the circuit contains
5 n −3 w ( n ) − 3 ⌊ log n ⌋ −1
Toffoli gates and 3 n − 1 controlled-NOTs.
The circuit for n = 10is depicted inFigure 4.
4.2Addition in place
For the in-place circuit, we begin the same way as above:we compute the carry
string c into n − 1 ancillary bits (plus one outputbit for the high bit).The total
ancillary space required is 2 n − w ( n ) − ⌊ log n ⌋ − 1.We then write the low nbits
of the sum on topof b .The keynew step is the erasure of the low n − 1 bits of
the carry string c.
Recall from Section 2.1 that we are using two’s-complement arithmetic:
r ′ + r ≡ − 1(mod 2 n ) .
So, writing s = a + b,
a + s ′ ≡a − a − b − 1 ≡ b ′ (mod 2 n ) .
Let d be the carry string generated by a and s ′ .We have
a ⊕ s ′ ⊕ d = b ′
a ⊕ ( a ⊕ b ⊕ c ) ⊕ ( − 1) ⊕ d =b ⊕ ( − 1)
c = d.
So the carry string d ,generated by adding a and s ′ , is simply c .After we
compute s , we can complement it, and then run the circuit of Section 3 in
reverse to erase c.
The in-place qcla adder proceeds as follows.We denote the n − 1 ancillae
which store the carry stringas Z [1] ,...,Z [ n − 1], and the remaining ancillae as
X .The output bit is labeled Z [ n ].
1.For 0 ≤ i < n , Z [ i + 1] ⊕ = A[ i] B[ i ].This sets Z[ i + 1] = g[ i, i + 1].
2.For 0 ≤ i < n , B [ i ] ⊕ = A[ i ].This sets B[ i ] = p[ i, i + 1]for i > 0. Also,
B [0] = s 0 .
3.Runthe circuit ofSection 3,using X as ancillary space.Upon completion,
Z [ i ] = c i for i ≥ 1.
9
a 0 r rr
b 0 r eer e s 0
0 e r r r e
a 1 r rrr r
b 1 r e r e e e r ere s 1
0 e e r r r r r e e
a 2 r rrr r
b 2 re r r r eee r r r ere s 2
0 e r e e r e
0 e r e r e r e
a 3 r rrr r
b 3 re r r r eee r r r ere s 3
0 e eer r r r r r re e e
a 4 r rrr r
b 4 re r r r eee r r r ere s 4
0 e r rree r r r e
0 e r e r e r e
a 5 r rrr r
b 5 re r r r eee r r r ere s 5
0 e r eer e
0 e e r e r r r e r e e
a 6 r rrr r
b 6 re r r r eee r r r ere s 6
0 e r rree r r r e
0 e r e r e r e
a 7 r rrr r
b 7 re r r r eee r r r ere s 7
0 e eee r r r r e e e e
a 8 r rrr r
b 8 re r r r eee r ere s 8
0 e r e
0 e r e r e e
a 9 r r
b 9 re r r r e s 9
0 e e e s 10
Figure 5:In-place qcla adder for 10 bits. P -rounds and P − 1 -rounds areshown
in blue. G -rounds are red, and C-rounds are green.
10
4.For 1 ≤ i < n , B [ i ] ⊕ = Z[ i ].Now B[ i ] = s i.
5.For 0 ≤ i<n − 1, negate B [ i ].Now B contains s ′.
6.For 1 ≤ i<n − 1, B [ i ] ⊕ = A[ i].
7.Runthe circuit of Section 3 in reverse. 2 Upon completion, Z [ i + 1]= a i s ′
i
for 0 ≤ i<n − 1, and B [ i ] = a i ⊕ s ′
i for 1 ≤ i < n .
8.For 1 ≤ i<n − 1, B [ i ] ⊕ = A[ i].
9.For 0 ≤ i<n − 1, Z [ i + 1] ⊕ = A[ i] B[ i].
10.For 0 ≤ i<n − 1, negate B [ i].
Each step other than 3 and 7 has depth 1.By (5), the overall depth is
⌊ log n ⌋ +⌊ log( n − 1) ⌋ + j log n
3 k + log n − 1
3 + 14 ,
where two of the time-slices contain negations, four contain controlled- not s,
and the rest contain Toffolis.For some values of n ≤ 6, the depth is slightly
lower.
By (4), the circuit contains
10 n − 3 w( n ) − 3 w( n − 1) − 3 ⌊ log n ⌋ − 3 ⌊log( n −1) ⌋ −7
Toffoli gates, 4 n − 5 controlled-NOTs, and2 n − 2 negations.
In Figure 5, we show a samplein-place qcla adder for the case n = 10.
5 Extensions
We now discuss various modified versions of thecircuit.The simplest isone
which adds (mod 2 n ); we simply skip the computation of the high bit.With
slightly more work, we can add (mod2 n − 1).
There are other constructions which use thelog-depth adderas asubroutine.
For these, it is useful to allow the adder to take one additional bit, an incoming
carry. In this case, we wish to compute a + b+ y , where y is either 0 or 1.
Another useful subroutine in an addition (ormodular addition) circuit is
comparison:Is a ≥ b ?Equivalently, is the high bit of a − b zero?We discuss
how one can use the log-depth adder to subtract, and we show that a comparator
is of comparable complexity to anout-of-place adder.
2 In Step 7, we actually reverse the ( n − 1)-bit adder, since we should not erase the high
carry bit.See Section 5.1 for more discussion.
11
5.1Addition (mod 2 n)
It is straightforward to add (mod2 n ); we simply do not compute the high bit of
the sum.The only question is:what are the exact savings, in depth and circuit
size?
Since we do not need to compute c n , we can simply run the circuit of Sec-
tion 3 onthe low-order n − 1 bits of a and b .For the out-of-place adder, this
circuit leaves c n − 1 in Z [ n − 1], so we also need to apply the gates Z[ n −1] ⊕ = a n − 1
and Z [ n − 1] ⊕ = b n − 1 ; we therefore add two additional controlled- not s. For
n > 1, this doesnot increase the depth.
So, the out-of-place (mod2 n ) adder produces n output bits,and uses ( n −
1) − w ( n −1) − ⌊ log( n −1) ⌋ ancillae.The depth is ⌊log( n −1) ⌋ + log n − 1
3 + 7
when n ≥ 4, and the circuitconsists of 5 n − 3 w ( n − 1) − 3 ⌊log( n −1) ⌋ −6
Toffolis and 3 n − 2 controlled-NOTs.
For the in-place adder, we follow the steps in Section 4.2.However, in Step 1,
our loop now stops at i = n − 2, and,in Step 3, we run the ( n − 1)-bit adder.
Thus, the in-place (mod 2 n ) adder uses2 n − 2 − w ( n − 1) − ⌊log( n −1) ⌋
ancillae.Thedepthis2 ⌊ log( n − 1) ⌋ +2 log n − 1
3 + 14when n ≥ 5, and the
circuit size is 10 n − 6 w ( n − 1) − 6 ⌊log( n −1) ⌋ − 12 Toffolis, 4 n − 5 controlled-
NOTs, and 2 n − 2 negations.
5.2Addition with incoming carry
Suppose we want our adder to take 2 n + 1bitsofinput: a , b ,and a single
bit y , representing an incoming carry. This is useful in various hybrid addition
circuits, where we break the problem up into smaller pieces.
We can accomplish this by adding the ( n + 1)-bitnumbers2 a + y and 2 b + y,
whose sum is 2( a + b+ y ).So, the cost is roughly the same as that of an ( n + 1)-
bit add.However, we use fewer operations on thelow-order bit—we simply
start with c 1 = y .The additional input bit y replaces one output bitfor the
out-of-place adder, and one ancillary bit for the in-place adder.
For the out-of-place adder, we save one Toffoli and two controlled-NOTs over
the usual ( n +1)-bit adder.For the in-place adder, we save two Toffolis, one
controlled-NOT, and two negations.
The same analysis applies tothe (mod 2 n ) adder ofSection 5.1.
5.3 Subtraction
It is straightforward to use our circuit to compute a − b . First,complement all
bits of a .Then, add as usual; we compute a ′ + b .At the end,complement all
bits of a and all outputbits.The result, assumingtwo’s-complement arithmetic,
is then
( a ′ + b) ′ = ( − a − 1 + b) ′ = a − b.
A similar argument holds for one’s-complement arithmetic.
Hence, the cost of subtraction is essentially the same as the cost of addition.
We add two time-slices, both consisting only of negations.
12
5.4 Comparison
Suppose we wish tocompare two numbers a and b .We compute the high bit
of a − b .As in the subtractor, we first complement a .We then run the qcla
adder forward until we have found the high bit of a ′ + b , and then we reverse
the preceding computation.This gives us a qcla comparator.
If n = 2 k for some k , then the above idea works well; we find the high bit
at the end of the G -rounds, halfway through theout-of-place add.However,
for n = 2 k − 1, we do not compute the highbit until after we’re done with the
C -rounds.If we just use this simple approach, the depth of our circuit turns
outtobe2 ⌊ log n ⌋ + 2 w ( n ) +5.We would prefer to design a comparator which
hasdepth2 log n + O (1).
So, we have to be more careful.Let k = ⌈ log n ⌉ .Ifwe just do and undo the
P -rounds and G -rounds, we cancompare two 2 k -bit numbers in depth roughly
2 k .So, we can padour n -bit numbers by adding zeros to the front, and then
use the compare circuit for2 k -bit numbers.
After we complement a , we will have p [ i, j ] = 1for j > i ≥ n and g[ i, j ] =
0 for j > i ≥ n .We do not explicitly compute these values in our circuit;
effectively, we compile the values into the circuit.
Overall, the comparator uses2 n − ⌊ log( n −1) ⌋ − 3 ancillae.For the explicit
discussion, we suppose our input is stored in the n -long bit arrays A and B . We
have n − 1 ancillary bits denoted Z [1] ,...,Z[ n − 1], and n − ⌊log( n −1) ⌋ −2
additional ancillae denoted by X .The output bit isdenoted Z [ n ]. We proceed
as follows:
1.For 0 ≤ i < n , negate A [ i].
2.For 0 ≤ i < n , Z [ i + 1] ⊕ = A[ i] B[ i].
3.For 1 ≤ i < n , B [ i ] ⊕ = A[ i].
4.Do the P -rounds for the 2 k -bit adder using space X ; write only the values
we cannot deduce at compile-time.
5.Do the G -rounds for the2 k -bit adder; apply only those gates which affect
Z [ n ].
6.Undo the G -round gates which did not write to Z [ n].
7.Do the P − 1 -rounds forthe 2 k -bit adder, erasing X.
8.For 1 ≤ i < n , B [ i ] ⊕ = A[ i].
9.For 0 ≤ i<n − 1, Z [ i + 1] ⊕ = A[ i] B[ i].
10.For 0 ≤ i < n , negate A [ i ].Also negate Z[ n].
Step 5 contains n − 1 Toffoli gates, in depth ⌊ log( n −1) ⌋ + 1.Step6is
equivalent to inverting the G -rounds for an ( n − 1)-bit adder, and contains
n − w ( n − 1)− 1 Toffoli gates in depth ⌊ log(n − 1) ⌋ .
13
Steps 4 and 7 each consist of n − ⌊ log( n −1) ⌋ − 2 gates.In each case, the
depth would be ⌊ log( n −1) ⌋ , but each P -round after thefirst (and each P − 1-
round before thelast) can be done inparallel with a G -round.
The total depthfor the comparator is
2 ⌊ log( n − 1) ⌋ + 9 ,
where two of the time-slices containnegations,two contain controlled-NOTs,
and the restare Toffolis.The overall circuit sizeis
6 n − 2 ⌊ log( n − 1) ⌋ − w ( n − 1) −7
Toffoli gates, 2 n − 2 controlled-NOT gates,and 2 n + 1negations.When n ≤ 4,
we have slightly overcounted the depth and size.A sample comparison circuit
for n = 7 appearsinFigure 6.
If we wish to allow an incoming carry, we use the same technique as in
Section 5.2.We use an ( n +1)-bit comparator, except that the carry input
replaces one of the ancillae, and we save two negations and two Toffolis.
It may seem strange that an n -bitcompare would require more gates than
an n -bit out-of-place add.After all, we’re solving a simpler problem;we want
one bit of the ( n + 1)-bitanswer.
One way to look atthis phenomenon is that, when we compute thehigh bit
of the sum, we are effectively usingotheroutputbits asancillary space.If we’re
“only” doing a compare, we need extra gates to erase this space.One explicit
example of this is Step 9 of the compare, where we erase the generate array. For
the out-of-place add,the generate array has turnedinto our answer, and need
not be erased.
5.5Addition (mod 2 n
− 1)
Recall from Section 2.1 that we have been working in two’s-complement arith-
metic, where r ′ + r = − 1.With a slight increase in depth, we canmodify our
circuit to work in one’s-complement arithmetic,where r ′ + r = 0.Equivalently,
we can view one’s-complement addition as addition (mod 2 n − 1).This may
prove useful for some applications, particularly when 2 n − 1 is prime.
Note that, in one’s-complement arithmetic, 0can berepresented either by
the all-zeros bit string or the all-ones bit string.For in-place reversible compu-
tation, we cannot have a + ~
0 = a and a + ~
1 = a .We will first describe our adder
in general terms, andthen discuss how we can handle this zero problem.
First, consider the computationof c 0 .In the one’s-complement setting, we
can no longer assume c 0 to be 0; the low bit of the sum is affected by whether or
not we have an overflow.We have an overflow if and only if a + b ≥ 2 n ; hence,
we get c 0 = g [0 , n].
If n = 2 k for some k , then we have computed c 0 at the end of the G-
rounds.How do we compute the othercarry bits?One approach follows from
the cyclic invariance of addition (mod 2 n − 1):We note that multiplication by
2 j corresponds toa cyclic shift by j .So, if we could simultaneously add at all
14
a 0 e rre
b 0 r r
0 e rr e
a 1 er rr r e
b 1 r e rr e r
0 e e rre e
a 2 er rr r e
b 2 re rr e r
0 e r r e
0 e rr e
a 3 er rr r e
b 3 re r rr r e r
0 e e e re e e
a 4 er rr r e
b 4 re rr e r
0 e rre
0 e rr e
a 5 er rr r e
b 5 re r rr r e r
0 e r e
0 e e re e
a 6 e rrre
b 6 r e r r re
0 e e e e ( b > a )?
Figure 6: qcla comparator for 7bits. P -rounds and P − 1 -rounds are shown in
blue; G -rounds and G − 1 -rounds are red.
15
possible cyclic shifts, we would compute all of the carry bits.This approach
would have logarithmic depth, but would require Θ( n log n ) ancillary space.
A second idea is to view c 0 as an incoming carry g [ −∞ , 0].Our carry string
is then given by c i = g [ −∞ , i ].Another way to lookat this identity is that we
are wrapping around:tocompute c i , we start at the zero position, work upto
n , and then wrap back around and keep going up to i .This is the same as the
cyclic shift, except that we are counting one region twice; it is not hard to see
that this cannot affectour overall answer.
To do this wrap-around, we will needpropagate bits of the form p [0 , 2 t ]. Af-
ter we complete the P -rounds and G -rounds, we have computed c 0 = g [ −∞ ,0].
We now add a new round:using c 0 and p [0 , 2 k − 1 ], we use one Toffoli gate to
compute c 2 k − 1 = g [ −∞ , 2 k − 1 ].From here on, we do our usual C -rounds, except
that each contains one extra gate computing c 2 t .Uponcompletion,we have
successfully computed the carry string.
If n is not a power of 2, we need to do a bit more work to make sure we
compute c 0 at the end of the G -rounds.We use the same technique as in
Section 5.4.
5.5.1Out-of-place addition (mod 2 n
− 1)
The above description,combined with the general approach in Section4.1, yields
an out-of-place one’s-complement adder.We produce n bits of output, and use
n − 2 ancillae.
The overall depth is
2 ⌊ log( n − 1) ⌋ + 8 ,
where three of the time-slices contain controlled-NOTs and the rest are Toffolis.
For n ≤ 2, the depth is slightly lower.
The circuit contains 5 n − 6 Toffoli gates and 3 n controlled-NOT gates.
Suppose we use the above circuit to add two numbers a and b which sum
to 2 n − 1.Since a ⊕ b = ~
1,the generatearray willbe initializedto ~
0 and the
propagate array to ~
1.Hence thecarrystringwillbe ~
0, and the sum will be
outputas ~
1.Hence, we say that this circuit uses the ~
1 representation of zero.
Onecancheck that,if oneof theinputsis ~
1, the circuit also adds correctly. 3
Itmightseem morenatural torepresent zeroas ~
0.We can modify the out-
of-place circuit as follows:at theend of the P -rounds, we xor p [0 , n ] into c 0
(this requires one additional Toffoli gate).So, after the G -rounds, we will have
c 0 = g [0 , n ] ⊕ p [0 , n ].We then compute the C -rounds as before.Now, if a ⊕ b = ~
1,
thecircuitwilloutput ~
0 as the sum; we have thus given a circuit which uses the
~
0representationofzero.Again,wecancheck that,ifoneorbothinputsare ~
0,
the circuit performs correctly.
The out-of-place one’s-complement adderusingthe ~
0 representation requires
n − 2 ancillae.The circuit contains 5n − 5 Toffoli gates and 3 n controlled-
NOT gates.For some n , the depth goes up by one; it depends on whether
3 In fact,thiscircuitis alsocorrectwhenexactly oneoftheinputs is ~
0.But, if both inputs
are ~
0, weoutput ~
0 ratherthan ~
1.
16
the computation of p [0 , n ] can bedone simultaneously with the penultimate
G -round.For n ≥ 4, the depth can bewritten as
⌊ log( n − 1) ⌋ + log n − 1
3 + 10 ,
where three of the time-slices contain controlled-NOTs and the rest are Toffolis.
5.5.2In-place addition (mod 2 n
− 1)
Following Section 4.2, we next construct an in-place one’s-complement adder.
We require 2 n − 2 ancillary bits: n − 2 for computing thepropagate bits, and
n for the carry string.We first compute thecarry string into our ancillae, and
then write the sum ontop of b .Next,to erase thecarry string, we negate b,
undo the addition computation, and fix b at the end.
As in the out-of-place version, we need to be careful about the representation
of zero.The complementation of b introduces a slight wrinkle:if we do our first
additionusing ~
0 to represent zero, then weneed to undo a ~
1-based addition.If
we doourfirstadditionusingthe ~
1circuit,weneedtoundothe ~
0 circuit.
Hence,regardlessofwhetherwerepresentzeroby ~
0or ~
1, the cost of the
circuit is the same:we require 2 n negations, 4 n controlled-NOTs, and 10 n − 11
Toffolis.For n ≥ 4, the depth is:
3 ⌊ log( n − 1) ⌋ + log n − 1
3 + 18 ,
where two of the time-slices contain negations, four contain controlled-NOTs,
and the rest contain Toffolis.
Figure 7 depicts a sample in-place one’s-complement qcla adder for the case
n = 7.
6Conclusions and future work
In conclusion, we have developed an efficient addition circuit using classical
carry-lookahead techniques.Our qcla adder sums two n -bit numbers in-place
using 2 n − w ( n ) − ⌊ log n ⌋ − 1ancillaryqubitsindepth4 log n + O (1). This
improves upon the previous best known additioncircuits,which require linear
depth.Our work dramatically improves the run-time ofthearithmetic circuits
required in Shor’s algorithm.
The complexities of thevarious circuits in this paper aresummarized in
Tables 1 and 2.In Table 1, we assume n = 2 k ; in Table 2, we give the general
formulas.For simplicity, we count only Toffoli gates and Toffoli time-slices.
Since some of theformulas are incorrect for small n ,we assume n ≥ 7.We also
include two different ripple-carry adders [7, 1].
It would beinteresting to applyasimilar tree-like approach to other arith-
metic problems, such as modular addition and multiplication.Itwould also
be interesting to build a logarithmic-depth addition circuit using only O (log n)
ancillae, or to prove that no such classical reversible circuitexists.
17
0 e e e e rrr r rrr e e e
a 0 r rrr r
| https://www.researchgate.net/publication/2193063_A_logarithmic-depth_quantum_carry-lookahead_adder |
Puma Exploration Reports up to 121.50 g/t Gold in Grab Samples* From Last 2021 Surface Exploration Results – Insidexploration
Puma Exploration Reports up to 121.50 g/t Gold in Grab Samples* From Last 2021 Surface Exploration Results
RIMOUSKI, Quebec, March 22, 2022 — Puma Exploration Inc. (TSXV: PUMA, OTC: PUXPF) (the “Company” or “Puma”)is pleased to report that additional surface samples collected at its Williams Brook Gold Project in New Brunswick, Canada, last fall have returned high-grade gold. Four (4) grab samples* that graded above100 g/t Au (>3 oz/t Au)are located above Puma’s current drilling area (see Figure 1). Results from the last 566 grab samples collected as part of Puma’s Fall 2021 stripping program at the O’Neil Gold Trend (“OGT”) have now been received. High-grade gold results will continue to be used to identify drilling targets in the Company’s ongoing 10,000 m drilling program.
Figure 1
From the last 566 samples collected at the OGT last fall and reported today, 66 (11.6%) show gold grades above1.00 g/t Au. Of these, 21 returned gold grades above10.00 g/t Au(see Table 1). The average grade of this last batch (all 566)of results, ranging from below detection limit up to121.50 g/t Au, is2.01 g/t Au.
Based on the Company’s previous success drilling high-grade gold areas identified at surface (grab samples* of241.00 g/t Au, 199.00 g/t Au, 57.40 g/t Aureturned5.55 g/t Au over 50.15 mat depth , see Sept. 15, 2021 News Release), today’s results confirm and expand Puma’spriority targets in its ongoing 10,000 metres drilling program.
Table 1: Selected grab sample gold results above 10 g/t Au
Sample ID Au-GRA22 Sample ID Au-GRA22 Sample ID Au-GRA22 Sample ID Au-GRA22
D248399 12.35 D248468 18.15 D248210 24.50 D279887 106.50
D249004 15.40 D248469 35.20 D248215 13.70 D279897 57.30
D249049 25.60 D248483 20.10 D248217 38.00 D279898 102.50
D248458 51.80 D248490 13.35 D248243 19.00 D279899 121.50
D248460 52.20 D248491 58.30 D248404 21.40 D279900 101.50
D248467 77.70
*The reader is cautioned that grab samples are selective by nature and may not represent the true metal content of the mineralized zone.
UPDATE ON CURRENT DRILLING PROGRAM
The objective of the 2022 drilling program is to test the OGT along its 750 metres strike length and confirm the depth extension of the high-grade gold-bearing quartz veins found on surface (see Figure 2). To date, nineteen (19) holes have been drilled for a total of 2,390 metres.
The holes, so far, were collared northeast of the Lynx Gold discovery, where a wide gold mineralized zone was identified by drilling last summer, including the intersection of 5.55 g/t Au over 50.15 m in hole WB 21-02 (see Sept. 15, 2021 News Release). The drilling targets areas where surface samples have returned significant gold grades (> 1 g/t Au). Two thousand five hundred (2,500) core samples have been sent to the laboratory for assaying. Results are pending and will be released when received.
The systematic drilling will continue toward the O’Neil Gold Zone, located 250 meters southwest of the Lynx Gold zone, targeting the contact between the sediments and the rhyolite.
Figure 2
QUALIFIED PERSON
Dominique Gagné, PGeo, a qualified person as defined by Canadian National Instrument 43-101 standards, has reviewed and approved the geological information reported in this news release.
ON-SITE QUALITY ASSURANCE/QUALITY CONTROL (“QA/QC”) MEASURES
Grab samples were bagged, sealed and sent to the facility of ALS CHEMEX in Moncton, New Brunswick, where each sample was dried, crushed, and pulped before being fire assayed (Au-ICP21). The remaining coarse reject portions of the samples remain in storage for further work or verification as needed. As part of its QA/QC program, the Company inserts external gold standards (low to high grade) and blanks for every batch of surface samples. All samples over 10 g/t gold or with abundant visible gold are analyzed with gravity finish (Au-GRA22). Check assays are routinely performed for samples with visible gold to ascertain the gold content of the mineralization zone.
COVID-19 PRECAUTIONS
Puma has developed and implemented precautions and procedures compliant with Québec and New Brunswick’s health guidelines. Strict protocols are in place to ensure the safety of all staff, thereby reducing the potential for community contact and spreading of the virus.
ABOUT PUMA EXPLORATION
Puma Exploration is a Canadian-based mineral exploration company with precious metals projects located near the Famous Bathurst Mining Camp (BMC) in New Brunswick, Canada. The Company is committed to itsDEARstrategy (Development, Exploration, Acquisition and Royalties) to generate maximum value for shareholders with low share-dilution.
| https://insidexploration.com/puma-exploration-reports-up-to-121-50-g-t-gold-in-grab-samples-from-last-2021-surface-exploration-results/ |
Treatment of Severely Obese Children and Adolescents Employing "Family-based Behavioral Social Facilitation Treatment" - Full Text View - ClinicalTrials.gov
Treatment of Severely Obese Children and Adolescents Employing "Family-based Behavioral Social Facilitation Treatment"
ClinicalTrials.gov Identifier: NCT02687516 Recruitment Status :
Completed First Posted : February 22, 2016 Last Update Posted : September 27, 2021
Sponsor:
University of Bergen
Haukeland University Hospital
Washington University School of Medicine
Information provided by (Responsible Party):
Petur B Juliusson, University of Bergen
Study Details
Study Description
Brief Summary:
This study aims to evaluate the effectiveness of Family-based behavioral social facilitation therapy (FBSFT) in the treatment of severe obesity in children and adolescents compared to treatment as usual (TAU). The FBSFT condition includes 17 weekly family-based treatment sessions at the hospital obesity clinic followed by monthly follow-up sessions with their local nurse and follow-up sessions at the hospital every third month for 2 years. The treatment targets both child and parent life-style; eating habits, physical activity, sedentary activity and sleep habits. Behavior modification techniques are employed; such as self-monitoring, goal setting, reward systems, problem solving and stimulus control. In addition, FBSFT focuses on facilitating lifestyle change across different settings (family, friends, school and community) and harnessing social support for healthy habits, which is considered important for long-term weight control. The TAU condition involves an assessment day with the multidisciplinary team (pediatrician, dietician, physical therapist and psychologist) at the hospital obesity clinic. Further a session with the nurse at the hospital clinic making a plan for behavioral lifestyle changes followed by monthly follow-up sessions with their local nurse and follow-up sessions at the hospital clinic every third month for one year.
SAMPLE AND STUDY DESIGN. The sample will consist of children and adolescents (aged 6-18) referred to the Obesity Outpatient Clinic at Haukeland University Hospital. Criteria for admission to the clinic is an (IOTF) isoBMI of > 35, or a isoBMI > 30 with obesity related co-morbidity. Based on current clinic data, estimations suggest that about 60 families of children with severe obesity will be referred to the Obesity Outpatient Clinic every year and be offered treatment. Recruitment will start in February 2014 and will continue in 2015 and 2016. After consenting to participation and completion of the initial assessments the families will be randomized to either FBSFT or treatment as usual (TAU). After one year the families randomized to TAU will be offered the FBSFT treatment. Measurement points for the most important outcome measures will be pre-treatment, post-treatment (at approximately 6 months), at 12 months, 18 months and 24 months.
OUTCOME VARIABLES. Anthropometrical measures: Height, weight and waist-circumference, DXA-scans and bio-impedance measurements for determining the distribution of fat and muscle tissue. Physiological measures: Blood samples will be drawn in the morning after an overnight fast. Including measurements of total-cholesterol, HDL, LDL, TG, ASAT, ALAT, gamma-GT, bilirubin, creatinin, HbA1c and fasting insulin, c-peptide and glucose, TSH, fT4, CRP. Cortisol measurements from saliva and urine. Measurement of bloodpressure. Food records: The parents will be instructed to help their children to keep a diary of food and beverage intake for five days. They will use an electronic kitchen scale to weigh the food. Physical activity: Physical activity and sleep will be measured by using accelerometers. Psychological measures: The Child Behavior Checklist (CBCL) is a 138-item rating scale assessing behavioral and emotional symptoms in children/youth. Children's Depression Inventory (CDI). CDI is a 27-item self-report test assessing symptoms of depression in children (7-17 years). Self-Perception Profile for Children (SPPC). SPPC is a self-report measure of self-perception in children aged 8 to 14 years. The Dutch Eating Behavior Questionnaire Child version (DEBQ) is a measure of disturbed eating patterns in children and youth. The Youth Eating Disorder Examination-Questionnaire (YEDE-Q) is a self-reported measure of eating patterns and eating disorder psychopathology. OTHER MEASUREMENTS INCLUDED. The Parenting Scale (PS) is a 30-item questionnaire designed to measure different parental disciplines with children/youth. The scores on three sub-scales are calculated - Laxness, Overreactivity and Verbosity. The Barriers to Treatment Participation Scale (BTPS). The 44-item scale is developed and validated to address drop-out from treatment with out-patient psychological treatment of children and adolescents. Child and parent acceptability of the treatment will be measured by the FBSFT Acceptability Questionnaire.
STUDY AIMS:
To evaluate the effect of FBSFT compared to TAU for treatment of severe childhood and adolescent obesity in an ordinary health care setting on BMI, BMI SDS, body composition, cardio-metabolic health, eating habits, physical activity as well as psychological well-being.
To identify predictors of treatment success and treatment drop-out with a focus on family variables and mental health.
To evaluate treatment (FBSFT) implementation and treatment acceptability for children, parents and health care workers and experienced barriers to treatment, and how these factors influence children's and parents' treatment response.
Layout table for study information Study Type : Interventional
(Clinical Trial) Actual Enrollment : 120 participants Allocation: Randomized Intervention Model: Crossover Assignment Masking: None (Open Label) Primary Purpose: Treatment Official Title: Treatment of Severely Obese Children and Adolescents in Common Health Care Settings: An Effectiveness Study Employing "Family-based Behavioral Social Facilitation Treatment" Actual Study Start Date : February 2014 Actual Primary Completion Date : January 2021 Actual Study Completion Date : May 2021
Resource links provided by the National Library of Medicine
MedlinePlus related topics: Family Issues
U.S. FDA Resources
Arms and Interventions
Arm Intervention/treatment Experimental: Family-based behavioral social facilitation therapy. The FBSFT condition includes 17 weekly family-based treatment sessions at the hospital obesity clinic followed by monthly follow-up sessions with their local nurse and follow-up sessions at the hospital every third month for 2 years.The treatment targets both child and parent life-style; eating habits, physical activity, sedentary activity and sleep habits. Behavior modification techniques are systematically employed; such as self-monitoring, goal setting, reward systems, problem solving and stimulus control. In addition, FBSFT focuses on facilitating lifestyle change across different settings (family, friends, school and community) and harnessing social support for healthy habits, which is considered important for long-term weight control. Behavioral: Family-based behavioral social facilitation therapy Family-based Behavioral Social Facilitation Treatment (FBSFT) is founded on the principles of standard family-based behavioural therapy for obesity. FBSFT targets life-style behaviors (diet, physical activity and sedentary activity) in a family setting. FBSFT includes some cognitive elements that are considered important in relation to behavioural change for instance problem solving and cognitive restructuring. FBSFT has an intensive treatment phase including weekly family meetings with therapists over 17 consecutive weeks. Further monthly or bi-weekly follow-up sessions with a focus on social facilitation and maintenance of healthy habits are recommended. The dietary guidance of FBSFT is based on the "Traffic light diet" in which foods are organized into GREEN, YELLOW and RED groups. Activity guidance of FBSFT uses the same system: GREEN activities have the highest intensity and should be engaged in most often, YELLOW activities sometimes, and RED activities. Active Comparator: Treatment as usual The TAU condition involves an assessment day with the multidisciplinary team (pediatrician, dietician, physical therapist and psychologist) at the hospital obesity clinic. Further a session with the nurse at the hospital clinic making a plan for behavioral lifestyle changes followed by monthly follow-up sessions with their local nurse and follow-up sessions at the hospital clinic every third month for 12 months. After 12 months they will be offered treatment by family-based behavioral social facilitation therapy (as in the other treatment arm). Behavioral: TAU - Treatment as usual This is the default treatment at the obesity clinic. After initial evaluation by paediatrician, nurse, nutritionist and physiotherapist, a "contract" is written including weight goal, nutritional plan and activity plan. Follow up monthly in primary Health care and every 3rd month at the obesity clinic.
Outcome Measures
Primary Outcome Measures
:
Change in weight status, assessed as BMI, BMI standard deviation scores (SDSs) and percentages above the IOTF cut-off for overweight (%IOTF-25) [ Time Frame: BMI will be measured at baseline and after 3, 6, 9, 12, 15, 18 and 24 months. ]
Height, weight will be measured by trained assessors at the Obesity Outpatient Clinic.
Change in waist circumference [ Time Frame: Will be measured at baseline and after 3, 6, 9, 12, 15, 18 and 24 months. ]
Will be measured by trained assessors at the Obesity Outpatient Clinic
Change in %body fat assessed by Bio-impedance [ Time Frame: Measurements will be done at baseline, 6 months, 12 months, 18 months and 24 months ]
Bio-impedance measurements of body composition will be conducted at the Obesity Outpatient Clinic using InBody 720.
Change in % body fat assessed by DXA [ Time Frame: Measurements will be made at baseline, at 6 months, at 12 months, at 18 months and at 24 months. ]
DXA-scans for determining the distribution of fat and muscle tissue will be conducted at the Department of Rheumathology at Haukeland University Hospital.
Change in Blood samples and cortisol measurements [ Time Frame: measurements will be done at baseline, 6 months, 12 months, 18 months and 24 months ]
Blood samples will be drawn in the morning after an overnight fast. Including measurements of total-cholesterol, HDL, LDL, TG, ASAT, ALAT, gamma-GT, bilirubin, creatinin, HbA1c and fasting insulin, c-peptide and glucose, TSH, fT4, CRP. Cortisol measurements from saliva and urine. A bio-bank for the storing and registering of biological materials is approved.
Change in blood pressure [ Time Frame: Will be measured at baseline, 6 months, 12 months, 18 months and 24 months ]
Blood pressure will be measured by the pediatrician at the obesity clinic
Changes in eating habits - Food diary [ Time Frame: Measurements will be obtained at baseline, 6 months, 12, months, 18 months and 24 months ]
The parents will be instructed to help their children to keep a diary of food and beverage intake for five days including two weekend days. They will use an electronic kitchen scale to weigh the food.
Changes in physical activity and sleep patterns - Accelerometers [ Time Frame: Measurements will be made at baseline, 6 months, 12 months, 18 months and 24 months ]
Physical activity and sleep patterns will be measured by using accelerometers. Accelerometers are small devices that register movement. The accelerometers that will be used in this study are worn on the non-dominant wrist and resemble a watch. The accelerometers record all uni-axial movement over 0.05G in one-minute epochs
Changes in psychological parameters - The Child Behavior Checklist (CBCL)/Youth self-report (YSR) [ Time Frame: Measurements will be obtained at baseline, at 6 months, 12 months, 18 months and 24 months ]
The Child Behavior Checklist (CBCL) is a 138-item rating scale assessing behavioural and emotional symptoms in children that has both a child/youth and parent form.
Changes in psychological parameters - Children's Depression Inventory (CDI) [ Time Frame: Assessments at baseline, at 6 months, 12 months, 18 months and 24 months ]
Children's Depression Inventory (CDI). CDI is a 27-item self-report test assessing the cognitive, affective and behavioural symptoms of depression in children (7-17 years).
Changes in psychological parameters - Self-Perception Profile for Children (SPPC). [ Time Frame: Assessments at baseline, at 6 months, 12 months, 18 months and 24 months ]
Self-Perception Profile for Children (SPPC). SPPC is a self-report measure of self-perception or self-esteem in children aged 8 to 14 years and is widely used for research purposes. The questionnaire includes 36 statements and the children are asked to evaluate to which degree the statement fits their thoughts about themselves.
Changes in eating habits - The Dutch Eating Behavior Questionnaire Child version (DEBQ) [ Time Frame: Assessments at baseline, at 6 months, 12 months, 18 months and 24 months ]
The Dutch Eating Behavior Questionnaire Child version (DEBQ) is a measure of disturbed eating patterns in children and youth (41). DEBQ consists of 3 sub-scales: emotional eating, external eating and restrained eating.
Changes in eating habits - The Youth Eating Disorder Examination-Questionnaire (YEDE-Q) [ Time Frame: Assessments at baseline, at 6 months, 12 months, 18 months and 24 months ]
The Youth Eating Disorder Examination-Questionnaire (YEDE-Q) is a self-reported measure of eating patterns and eating disorder psychopathology. The YEDE-Q was designed to include measurements of binge eating in youth which have been poorly covered in other self-report measures of eating pathology.
Other Outcome Measures:
The Parenting Scale (PS) [ Time Frame: Assessment at baseline, 6 months, 12 months, 18 months and 24 months ]
The Parenting Scale (PS) is a 30-item questionnaire designed to measure different parental disciplines with children and youth. The scores on three sub-scales are calculated - Laxness, Overreactivity and Verbosity.
The Barriers to Treatment Participation Scale (BTPS). [ Time Frame: Assessment at 4 months after enrollment or point of deciding to end treatment for the FBSFT arm ]
The Barriers to Treatment Participation Scale (BTPS). The 44-item scale is developed and validated to address drop-out from treatment with out-patient psychological treatment of children and adolescents. Scores are distributed across 4 sub-scales: (1) Stressors and obstacles that compete with treatment, (2) treatment demands and issues, (3) perceived relevance of the treatment, (4) therapeutic relationship.
FBSFT Acceptability Questionnaire. [ Time Frame: Measurement at 6 months after enrollment for the FBSFT arm ]
Child and parent acceptability of the treatment will be measured by the FBSFT Acceptability Questionnaire. The measure consists of two subscales: satisfaction and perceived utility. This measure has been informed by assessments used in a treatment study for pediatric obesity in the UK, which evaluates degree to which participants were pleased with the intervention and the extent to which they perceived components to be helpful
Eligibility Criteria
Top of Page Study Description Study Design Arms and Interventions Outcome Measures Eligibility Criteria Contacts and Locations More Information
Information from the National Library of Medicine
Choosing to participate in a study is an important personal decision. Talk with your doctor and family members or friends about deciding to join a study. To learn more about this study, you or your doctor may contact the study research staff using the contacts provided below. For general information, Learn About Clinical Studies.
Layout table for eligibility information Ages Eligible for Study: 6 Years to 18 Years (Child, Adult) Sexes Eligible for Study: All Accepts Healthy Volunteers: No
Criteria
Inclusion Criteria:
The sample will consist of children and adolescents (aged 6-18) referred to the Obesity Outpatient Clinic at Haukeland University Hospital by their general practitioner.
Criteria for admission to the clinic is an (IOTF) isoBMI of > 35, or a isoBMI > 30 with obesity related co-morbidity.
Both the child and at least one of the parents agrees to actively participate in the treatment.
Exclusion Criteria:
Severe somatic or psychiatric illness that makes adherence to the treatment program impossible.
Somatic conditions, syndromes or medications that lead to pathological weight gain.
Participation in other obesity treatment programs.
Contacts and Locations
Information from the National Library of Medicine
To learn more about this study, you or your doctor may contact the study research staff using the contact information provided by the sponsor.
Please refer to this study by its ClinicalTrials.gov identifier (NCT number): NCT02687516
Locations
Layout table for location information Norway Haukeland University Hospital Bergen, Norway, 5020
Sponsors and Collaborators
University of Bergen
Haukeland University Hospital
Washington University School of Medicine
Publications automatically indexed to this study by ClinicalTrials.gov Identifier (NCT Number):
Skjakodegard HF, Danielsen YS, Morken M, Linde SF, Kolko RP, Balantekin KN, Wilfley DE, Juliusson PB. Study Protocol: A randomized controlled trial evaluating the effect of family-based behavioral treatment of childhood and adolescent obesity-The FABO-study. BMC Public Health. 2016 Oct 21;16(1):1106. doi: 10.1186/s12889-016-3755-9.
Layout table for additonal information Responsible Party: Petur B Juliusson, MD/PhD, University of Bergen ClinicalTrials.gov Identifier: NCT02687516 History of Changes Other Study ID Numbers: 2013/1300/REK Vest First Posted: February 22, 2016 Key Record Dates Last Update Posted: September 27, 2021 Last Verified: September 2021
Keywords provided by Petur B Juliusson, University of Bergen:
Treatment Child Obesity Behavioral treatment
U.S. National Institutes of Health
| https://clinicaltrials.gov/ct2/show/study/NCT02687516 |
Notice of copyright infringement | Statista
Find statistics, consumer survey results and industry studies from over 22,500 sources on over 60,000 topics on the internet& #39;s leading statistics database
Skip to main content
statista.com
statista.es
statista.de
statista.fr
Prices & Access
Single Accounts
Business Solutions
Academia and Government
Statistics
All Industries
Consumer Goods & FMCG
Internet
Media & Advertising
Retail & Trade
Sports & Recreation
Technology & Telecommunications
Transportation & Logistics
Travel, Tourism & Hospitality
Most-viewed Statistics
Recent StatisticsPopular Statistics
Facebook: quarterly number of MAU (monthly active users) worldwide 2008-2023
Quarterly smartphone market share worldwide by vendor 2009-2023
Number of apps available in leading app stores Q3 2022
OPEC oil price annually 1960-2023
Big Mac index worldwide 2023
Topics
Topic Overview
Smartphones - statistics & facts
Social media - Statistics & Facts
Top Report
View Report
Industry Overview
Reports
Report Shop
Search our report database
Digital & Trend reports
Overview and forecasts on trending topics
Industry & Market reports
Industry and market insights and forecasts
Companies & Products reports
Key figures and rankings about companies and products
Consumer & Brand reports
Consumer and brand insights and preferences in various industries
Politics & Society reports
Detailed information about political and social topics
Country & Region reports
All key figures about countries and regions
Find your information in our database containing over 20,000 reports
New
Market Insights
Market forecast and expert KPIs for 1000+ markets in 190+ countries & territories
Explore Market Insights
Consumer
Digital
Mobility
Consumer Insights
Insights on consumer attitudes and behavior worldwide
2,000,000+ interviews
15,000+ brandsExplore Consumer Insights
Company Insights
Business information on 70m+ public and private companies
100+ industries
200+ countries and territories
Explore Company Insights
eCommerce Insights
Detailed information for 35,000+ online stores and marketplaces
70+ KPIs per store
Revenue analytics and forecastsExplore eCommerce Insights
Daily Data
Services
The Statistics Portal
Directly accessible data for 170 industries from 150+ countries and over 1 Mio. facts.
About Statista
Why trust Statista
First Steps and Help Centre
Live webinars & recordings
Tools
Business Plan Export
Publication Finder
Statista Services
Statista Q
Customized Research & Analysis projects:Statista Q
askStatista
Get quick analyses with our professional research serviceaskStatista
Statista R
The best of the best: the portal for top lists & rankings:Statista R
Statista Content & Design
Transforming Data into Design:
Customized infographic service
Presentation Design
Animated videos
Whitepapers, E-Books, etc.
Statista Content & Design
nxt statista
Strategy and business building for the data-driven economy:nxt statista
Single Accounts
Business Solutions
Academia and Government
Popular Statistics
Topics
Markets
Reports
Market Insights
Consumer Insights
Company Insights
eCommerce Insights
Daily Data
Content & Design
Research projects
Ask Statista
Business Plan Export
Publication Finder
Statista R
DE
ES
FR
Notice of copyright infringement
Information on when we delete personal data, the countries where we save data (e.g., US, EU, Singapore), and the companies we collaborate with can be found in ourprivacy statement.
Home
About Statista
Career
Contact
Help & FAQ
Report Bug
Our Media Partners
Privacy
Imprint
Menu
Prices & Access
Popular Statistics
Industries
Daily Data
Content & Design projects
Research projects
AskStatista
statista.de
statista.es
statista.fr
Cookie Consent Manager
General Information
General Information
When you visit any website, it may store or retrieve information on your browser, mostly in the form of cookies. This information might be about you, your preferences or your device and is mostly used to make the site work as you expect it to. The information does not usually directly identify you, but it can give you a more personalized web experience. Because we respect your right to privacy, you can choose not to allow some types of cookies. Click on the different category headings to find out more and change our default settings. However, blocking some types of cookies may impact your experience of the site and the services we are able to offer.
More information
Necessary Cookies
Necessary Cookies
Always Active
These cookies are necessary for the website to function and cannot be switched off in our systems. They are usually only set in response to actions made by you which amount to a request for services, such as setting your privacy preferences, logging in or filling in forms. You can set your browser to block or alert you about these cookies, but some parts of the site will not then work. These cookies do not store any personally identifiable information.
Functional Cookies
Functional Cookies
Functional CookiesInactive
These cookies enable the website to provide enhanced functionality and personalisation. They may be set by us or by third party providers whose services we have added to our pages. If you do not allow these cookies then some or all of these services may not function properly.
Performance Cookies
Performance Cookies
Performance CookiesInactive
These cookies allow us to count visits and traffic sources so we can measure and improve the performance of our site. They help us to know which pages are the most and least popular and see how visitors move around the site. All information these cookies collect is aggregated and therefore anonymous. If you do not allow these cookies we will not know when you have visited our site, and will not be able to monitor its performance.
Targeting Cookies
Targeting Cookies
Targeting CookiesInactive
These cookies may be set through our site by our advertising partners. They may be used by those companies to build a profile of your interests and show you relevant adverts on other sites. They do not store directly personal information, but are based on uniquely identifying your browser and internet device. If you do not allow these cookies, you will experience less targeted advertising.
Back
Vendor Search
ConsentLeg.Interest
checkbox labellabel
checkbox labellabel
checkbox labellabel
Name
cookie name
checkbox labellabel
By clicking “Accept all,” you agree to the storage of cookies on your device to improve website navigation, analyze website usage, and assist with our marketing efforts. If you click on "Only necessary," only cookies that are required for technical reasons to operate the website will be used.Privacy Statement
| https://www.statista.com/statistics/report-content/statistic/1087177 |
Genealogy | Free Full-Text | Maternal Lineages during the Roman Empire, in the Ancient City of Gadir (C& aacute;diz, Spain): The Search for a Phoenician Identity
Phoenicians were probably the first eastern Mediterranean population to establish long-distance connections with the West, namely the Iberian Peninsula, from the final Bronze to the early Iron Age. For a long time, these colonies all over the Mediterranean Sea directly depended on an important city administration, Gadir, the most important metropolis in the Western Mediterranean. Modern archaeological excavations were discovered in Cadiz (Spain), the ancient city of Gadir, as well as possible Phoenician burial places. The purpose of the present work is the molecular study of 16 individuals, (V–IV millennium B.C, V A.D.) from several burial places found in Cadiz, attempting to disclose their maternal biogeographical ancestry. Furthermore, the determination of a possible biological link between two individuals found buried together was also an objective of this investigation. Of all the 16 analyzed individuals, eight of them produced positive results. Three main lineages were found: HV0, H and L3b. In general, the results support an Eastern origin for this set of individuals, reinforcing the theory of a Phoenician origin. Due to their historical period, in some cases, it was not possible to discard a Roman origin. Finally, the maternal kinship between two individuals found buried together was discarded.
Maternal Lineages during the Roman Empire, in the Ancient City of Gadir (Cádiz, Spain): The Search for a Phoenician Identity
Carlos González Wagner 3,4 ,
Manuel Calero-Fresneda 5 ,
Sara Palomo-Díez 1,2 ,
César López-Matayoshi 1,2,6 ,
Inês Nogueiro 7 ,
Ana María López-Parra 1,2 ,
Elena Labajo González 1 ,
Bernardo Perea Pérez 1 ,
José María Gener Basallote 8 ,
Juan Miguel Pajuelo 9 and
Eduardo Arroyo Pardo 1,2
1
Legal Medicine, Psychiatry and Pathology Department, Medicine School, Complutense University of Madrid, 28040 Madrid, Spain
2
Forensic Sciences Group, Forensic Genetics and Toxicology, Health Research Institute of the Hospital Clínico San Carlos (IdISSC), 28040 Madrid, Spain
3
Departamento de Historia Antigua, Facultad de Geografía e Historia, Complutense University of Madrid, 28040 Madrid, Spain
4
Centro de Estudios Fenicios y Púnicos, Department of Ancient History, Faculty of Geography and History, Complutense University of Madrid, 28040 Madrid, Spain
5
Departamento de Medicina, Hospital Universitario de Puerto Real, 11510 Cádiz, Spain
6
Departamento de Ciencias Celulares y Moleculares, Universidad Peruana Cayetano Heredia, San Martín de Porres 15102, Peru
7
IPATIMUP (Institute of Molecular Pathology and Immunology of the University of Porto), I3s (Instituto de Investigação e Inovação em Saúde, Universidade do Porto), 4200-135 Porto, Portugal
8
Ayuntamiento de Cádiz, Plaza de San Juan de Dios S/N, 11005 Cádiz, Spain
9
Tripmilenaria S.L., 11005 Cádiz, Spain
Author to whom correspondence should be addressed.
Genealogy 2023 , 7 (2), 27; https://doi.org/10.3390/genealogy7020027
(This article belongs to the Special Issue Family Identities: How Genetics Is Contributing to Genealogical (Re)search )
Abstract
Phoenicians were probably the first eastern Mediterranean population to establish long-distance connections with the West, namely the Iberian Peninsula, from the final Bronze to the early Iron Age. For a long time, these colonies all over the Mediterranean Sea directly depended on an important city administration, Gadir, the most important metropolis in the Western Mediterranean. Modern archaeological excavations were discovered in Cadiz (Spain), the ancient city of Gadir, as well as possible Phoenician burial places. The purpose of the present work is the molecular study of 16 individuals, (V–IV millennium B.C, V A.D.) from several burial places found in Cadiz, attempting to disclose their maternal biogeographical ancestry. Furthermore, the determination of a possible biological link between two individuals found buried together was also an objective of this investigation. Of all the 16 analyzed individuals, eight of them produced positive results. Three main lineages were found: HV0, H and L3b. In general, the results support an Eastern origin for this set of individuals, reinforcing the theory of a Phoenician origin. Due to their historical period, in some cases, it was not possible to discard a Roman origin. Finally, the maternal kinship between two individuals found buried together was discarded.
Keywords:
Phoenicians
;
Iberia Peninsula
;
maternal lineage
;
mtDNA sequencing
;
kinship
1. Introduction
The multidisciplinary genetic, anthropological and archaeological study of ancient samples constitutes the most direct way of knowing historical populations and their particular movements. The Iberian Peninsula has long been a unique part of the ancient world. Despite its distancing from the rest of Europe, it has been consistently a connection of trade, commerce and cultural relationships ( Dietler and López-Ruiz 2009 ).
From the Bronze Age to the Renaissance, explorers and traders used the Peninsula as the transition between the Mediterranean and the rest of the world ( Dietler and López-Ruiz 2009 ). Phoenicians were possibly the first eastern Mediterranean people to establish long-distance connections with the west, from the final Bronze to the early Iron Age. Their expansions and settlements increased in the south and Levant coast of the Iberia Peninsula, as well as in the Atlantic fringe ( Tsirkin 1997 ; Arruda 2009 ; Groot 2012 ). With the Phoenicians, regional trade networks were dramatically enlarged resulting in an enormous economic, social and cultural development that changed not only the history of Iberia, but also had a great impact on the whole of Mediterranean history ( Dietler and López-Ruiz 2009 ; Valério et al. 2012 ; Amadori et al. 2016 ).
Over the centuries, historians have tried to understand the Phoenicians’ origins ( Aubet 2001 ; Groot 2012 ; Padró 2012 ). Padró ( 2012 ) mentions that the Phoenicians were Canaanites, justifying this based on their language (Canaanite) and the fact that “Phoenicians” called themselves Canaanites ( Aubet 2001 ; Groot 2012 ; Padró 2012 ). It is thought that both Hebrews and Phoenicians were descendants of the Proto-Canaanites ( Padró 2012 ).
For a long time, Phoenician colonies all over the Mediterranean Sea directly depended on the Gadir administration, the most important metropolis in the Western Mediterranean (
Padró 2012
), located in the South of the Iberian Peninsula, which is now situated in the city of Cádiz. Recent archaeological expeditions discovered several burial places in this city that belong to the Roman Empire (I B.C, I A.D; and IV–V A.D centuries), which showed a lifestyle and burial characteristics similar to the Phoenicians. Nevertheless, this assumption should be taken with caution, since the presence of the Phoenicians in the Iberian Peninsula was shared with other populations, such as Tartessics, Punics, and Romans, so the human remains may or may not have a Phoenician origin.
Concerning the molecular analysis of the “Phoenician origin”, there are few investigations dealing with their possible maternal ancestry. For instance, Zalloua et al. ( 2008 ) investigated the Phoenician male traces in more than a thousand samples, but in extant populations ( Zalloua et al. 2008 ). On the other hand, in 2016, Matisoo-Smith et al. ( 2016 ) described for the first time the results of a molecular investigation on an ancient Phoenician sample. In their study, one individual was found in North Africa, and through the next-generation sequencing (NGS) technique, they were able to identify a European lineage by comparing it with modern populations ( Matisoo-Smith et al. 2016 ).
From the molecular point of view, populations living geographically close and/or with recently shared ancestry will present similar haplotypes that are grouped by relatedness into genetic haplogroups (
Cavalli-Sforza and Feldman 2003
;
Emery et al. 2015
). Thus, the association between a geographical region and a mitochondrial DNA (mtDNA) provides the basis for using mtDNA haplogroups to deduce an individual’s genetic maternal biogeographical origin (
Shriver and Kittles 2004
). Moreover, the mtDNA information should be complemented by the other mitochondrial single-nucleotide polymorphism (SNP) information, since they are haplogroup specific, usually outside the HVI and HVII regions. Besides technical and theoretical caveats, such an analysis should be carefully interpreted, since mtDNA results cannot be extrapolated to the rest of the genome, namely the paternal lineages or autosomal ancestry, inferred through the study of the Y-chromosome or ancestry-informative markers, respectively (
Romanini et al. 2015
). An extra difficulty with regard to the analysis of ancient genomes is related to the possible contamination of exogenous DNA, the presence of inhibitors of the PCR reaction, as well as the frequent absence of results that may be due to the poor state of the conservation of DNA due to fragmentation, oxidation, and hydrolysis, among others.
The purpose of the present work was to study 16 individuals considered archaeologically “Phoenicians” found in different burial places in the ancient city of Gadir (Cádiz, Spain), at a molecular level, in order to disclose their maternal biogeographical ancestry. To perform this, the molecular analysis of HVI and HVII mitochondrial regions, and other specific haplogroup polymorphisms were performed. Furthermore, the determination of a possible kinship between the two individuals buried together was also an objective of this investigation.
Archaeological Data
In the present work six different parts of the ancient city of Gadir were studied ( Supplementary Material Table S1 (S.M. Table S1) ). This work will describe the most significant ones from an archaeological point of view, such as the necropolis of “Campo de Hockey” (“Hockey Field”), the Roman section and the “Solar do Antigo Teatro Cómico” (“ Manor of the Old Comic Theater ”).
One of these sections studied here, called “Campo de Hockey” (Cádiz, Spain), has revealed to have had a high population, and been verified in the lower area of the site as a singular and extensive Neolithic necropolis with 83 individuals. The typology of funerary structures is varied and ranges from the simplest burials (deposited directly in the ground or simple graves) (
Figure 1
), to the most monumental burial mounds or tombs. The burial ritual consisted of individual burials, with the subjects deposited in a fetal position, lying on their right or left side and with their hands placed at chest level or under their faces. Likewise, three double and two triple burials have been located. The necropolis is the result of careful planning. Despite the numerous individuals buried, the structures are not usually built on previous burials. The burial mounds and the vertical slabs (as a stele) of many of these burials would serve as signaling elements (
Vijande et al. 2007
).
Figure 1. “Campo de Hockey” aerial view of various burials in a simple grave. Source: Vijande et al. ( 2007 ).
Despite the simplicity of the grave goods, the presence of some extremely interesting exotic objects, such as variscite, turquoise or amber, must be pointed out ( Vijande et al. 2007 ).
Although the stratigraphy has delimited 10 periods of occupation of Gadir, the most interesting from an archaeological point of view belongs to the Roman and Phoenician periods. During the Roman periods, between the second half of the 2nd century B.C., important remains began to be found. In imperial times, from the 1st century, the remains found give an idea of the complete occupation of the site. There are two buildings, which appear to have been part of a dry cleaner and a salting factory ( Gener and Núñez 2015 ).
The other part of the site belongs to the oldest stage, the Phoenician Gadir, which, although there seem to be indications of a possible previous occupation, is from the year 820 B.C. to 720 B.C., when a large part of what was the Phoenician city was discovered. At the depth of 9 m, there are architectural remains of eight houses, distributed in two terraces and organized around two paved streets ( Figure 2 ) ( Gener and Núñez 2015 ).
Figure 2. Planimetry of the Phoenician houses and 3D reconstruction, 820–760 B.C. Source: Gener and Núñez ( 2015 ).
In several buildings, the location of what would be kitchens with the remains of a
tannur
-type oven can be appreciated. Parts of the layout of the streets can also be seen, the first being the oldest and widest, and the second narrow and zigzag. The houses used to have a rectangular shape and could reach more than one floor. The main materials used for their construction were oyster stone, clay and lime. The distribution of each house is typical of Phoenician houses, with the main quadrangular room being larger and usually taller. The rest of the rooms were distributed around this one, such as the kitchen, workshops, or the rooms. In one of the houses, it was possible to observe a probable pottery workshop (
Figure 3
), where the remains of a potter’s wheel, large containers filled with dye and bone, and ivory utensils for decorating ceramics were found. Another important finding was the discovery of archaeological elements in Phoenician writing (
Figure 4
).
Figure 3. Planimetry and various archaeological finds. Source: Gener and Núñez ( 2015 ).
Figure 4. Graphites with a Phoenician script. Source: Gener and Núñez ( 2015 ).
Below the Roman dry cleaner and salting factory, about 6–7 m into the north–west sector of the excavation, there was a Phoenician wall from the 6th century B.C. At a distance of 6–8 m from the wall, several individuals dating from Phoenician times appear. Among them, individuals 9, 10, 11 and 12 were studied in the present investigation.
2. Materials and Methods
2.1. Anthropological Records
In this study, 16 individuals belonging to different periods were studied (
S.M. Table S1
), from the 5th–4th millennium B.C. to the 4th–5th A.D., all found in the region known during Phoenician times as Gadir, modern Cádiz (Spain). The external condition of the human remains was not homogeneous, differing from individual to individual.
Figure 5
shows individual 9 as an example, found in one of the sections of this study, the “Solar del Antiguo Teatro Comico”, together with the planimetry where he was found. In
S.M., Figures S1–S3
the other three individuals found in this section, individuals 10, 11 and 12, can be seen. Additionally, in the Supplementary Material, there is a description of all of the individuals’ samples considered morphologically suitable for the present study (
S.M. Table S1A,B
). In general, the samples show considerable external deterioration, with some of them, mainly bone, being considerably porous. Regarding the dental samples, despite showing a certain degree of deterioration, the majority showed an intact color and appearance without fissures.
Figure 5. Planimetry and photographs of individual 9 found in one of the corners of the building. Source: JM Pajuelo and JM Gener Basallote.
A Complex Burial: The Case of Individuals 8i and 8ii
Individuals 8i and 8ii were found buried together, and it was not possible to collect more information. For example, it was not possible to determine the individuals’ sex by anthropological methods ( S.M. Table S1 ).
2.2. Ancient DNA Analysis
2.2.1. Sampling Process
In the present study 41 tooth samples were analyzed, corresponding to a total of 16 individuals ( S.M. Table S1 ).
Due to the high chance of external contamination, all of the procedures were carried out in dedicated decontaminated rooms, where, prior to each analysis, the environments were disinfected with pure bleach, 70% ethanol, and ultraviolet radiation for at least 12 h. Genetic analyses were performed according to the authenticity criteria described by Pääbo et al. ( 2004 ). Depending on the availability of samples, two or three teeth from each individual were then selected to replicate the experimental process. Samples were selected to avoid pieces with cracks, cavities and caries, preventing the destruction of human genetic material by bacteria or fungi and contamination.
2.2.2. DNA Extraction
A previous step common to both methods is the external cleaning of the bone and dental samples. This is carried out using aluminum oxide under pressure, using a sandblaster (Dentalfarm
®
). Subsequently, each sample was irradiated with UV (λ = 256 nm) for 30 min on each side.
DNA extraction was performed with two distinct procedures, to compare the attained results: one sample with a destructive method (method A) and the other tooth with a non-destructive one (method B). The extraction methodology with the two methods is used routinely in the laboratory as a way of guaranteeing that different methods always produce the same results, and both methods have been previously proven to allow obtaining the same efficiency in the extraction of genetic material (
Gomes et al. 2015
). When access was obtained to a third tooth, the first two samples were analyzed with method A, and the third with B.
Method A: Destructive Procedure
After their external cleaning, samples were pulverized with a freezer mill and filled with liquid nitrogen. Then, the extraction technique was carried out following the guidelines published by Rohland and Hofreiter ( 2007 ). This procedure is based on the use of silicon dioxide and the use of three distinct buffers: extraction, which allows for the release of DNA from the cells; washing, which aims to separate the DNA from the other cell components; and finally a binding buffer that facilitated the association between silica and DNA.
Method B: Non-Destructive Technique
In this technique, the complete sample was processed without the pulverizing step. The extraction protocol was followed according to Gomes et al. ( 2015 ), also with the extraction, washing and binding buffers, used to perform the DNA extraction in method A.
2.2.3. mtDNA Amplification
Two short overlapping sequences (175 bp and 170 bp) from mtDNA hypervariable region 1 (HVR1), as well as two overlapping sequences from HVR2 (119 bp and 100 bp) were analyzed, performing the amplifications with the QIAGEN Multiplex PCR Kit (Qiagen©). The amplification conditions used are those contained in the laboratory’s standard work protocols for samples in an advanced state of degradation. Specifically: 95 °C 15 min; 94 °C 30 s; 55 °C 1 min 30 s; 72 °C 1 min (40 cycles); and 72 °C 10 min. Primer sequences used for the HVR1 and HVR2 amplification are described in
Table S2
. Additionally, a biological sample from all the geneticists in the laboratory was also extracted and amplified to control any possible local contamination.
After amplification, all samples were visualized on a 1% agarose gel to see whether or not there was amplification, using an allelic ladder (Biotools
®
) and verify the fragment specificity. The amplified samples were then purified with ExoSAP-IT™ PCR Product Cleanup Reagent (Thermo Fisher Scientific) and sent to Macrogen
®
for sequencing with the respective primers of each amplification, both forward and reverse. Finally, the sequence analysis was performed using the MutationSurveyour v4.0.9 software (SofGenetics
®
), noting not only the polymorphisms found, but also the quality of each sequence indicated by the software, from 0 to 100. From all the sequences analyzed for each individual, a consensus haplotype was determined (
Table 1
), where each polymorphism found was confirmed at least three times in independent amplification sequences.
Table 1. mtDNA haplotypes achieved for the 16 studied individuals, including the most probable maternal haplogroup.
2.2.4. mtDNA Haplogroup Estimation
The estimation of each haplogroup was performed as follows:
(a) Consulting the phylogenetic tree PhyloTree, using HaploGrep ( Kloss-Brandstatter et al. 2011 ; van Oven 2015 ). This online application indicates an estimated probability of the individual belonging to a specific haplogroup, according to his/her DNA sequence.
(b) Assignment of each haplotype to a biogeographical population ( Prieto et al. 2011 ) using the EDNAP Mitochondrial DNA Population Database (EmPOP) ( Parson and Dur 2007 ), which was also accessed for estimating the most probable biogeographical ancestry of the sample.
(c) Accessing the phylogenetic tree PhyloTree directly ( van Oven 2015 ; van Oven and Kayser 2009 ) and checking the defining mutation(s) of each haplogroup.
2.2.5. Specific Haplogroup SNP Amplification
A set of haplogroup-specific SNPs located in other mitochondrial regions was selected to confirm the detected haplogroups, only considering the individuals with HV1- and/or HV2-positive results. The amplification was performed according to Gamba et al. ( 2012 ). Table S3 displays the studied SNP results.
The results were considered consistent only when it was possible to obtain the same sequence by at least two independent amplifications from the same tooth extract. Such a procedure was carried out in all samples, and full concordance of the results was checked.
2.3. Statistical Analysis
A multinomial statistical analysis was carried out by the Calculation Center of the Teaching and Research Support Center of University Complutense of Madrid (Spain), considering the obtained set of results (5 individuals belonging to one mitochondrial haplogroup, 2 individuals to another, and 1 individual to a third group), and the probability that such a group had been sampled from a particular population. Therefore, two different analyses were computed. The first one was performed with three modern metapopulations (African, European, and Eastern), and the second one with specific populations within the former three: “French”, “Sardinian”, “North Italian”, “Tuscan”, “French Basque”, “Bedouin”, “Mandenka”, “Yoruba”, “Mozabite”, “Druze”, “Palestinian”, and “Yakut” (
Emery et al. 2015
). To compute the relative population frequencies, haplogroup information was consulted by
Emery et al.
(
2015
) in both cases.
To evaluate the obtained results for the metapopulations, a likelihood ratio (LR) approach was undertaken. The LR approach consists of the calculation of a quotient between probabilities of the same event, considering two exclusive hypotheses (H1 and H2, for example, H1: This set of eight individuals has a European biogeographical ancestry, and H2: This set of eight individuals has an African biogeographical ancestry). Thus, LR was calculated as:
L R = ( E v i d e n c e ∣ H 1 ) ( E v i d e n c e ∣ H 2 )
3. Results
3.1. Result Quality
Although the archaeological reports stated that, in general, the samples were in an acceptable condition, during the cleaning and extraction procedures, some fragility and poor integrity were observed. The quality of the sequences analyzed, obtained through the MutationSurveyour v4.0.9 software (SofGenetics ® ), varied for method A between 0 and 54, and for method B between 0 and 63, so we consider the performance of both methods to be similar. Thus, there are more accentuated differences between individuals than between methods. Normally, sequences with a quality between 0 and 20 had to be repeated more times for a correct reading of the polymorphisms, in some cases having to repeat four times. For example, for individual 11 G, it was necessary to perform four DNA amplifications to obtain legible and satisfactory quality sequences.
3.2. Biogeographical Ancestry
In
Table 1
, the mtDNA haplotypes achieved for the 16 studied individuals are shown. Such information refers to A and B extraction techniques and shows three possible results: “no result”, when it was never possible to obtain a sequence; “without consensus”, when positive, but different results were obtained in distinct amplifications considering the same or different samples of the same individual. When it was possible to define a haplotype, the consensus sequence was described.
Table 1
also shows the mtDNA profiles of the researchers who worked with the samples in the laboratory. No matches were observed when comparing researchers with archaeological samples.
Haplogroup-Specific SNP Results, Haplogroup Assignment, and Phylogenetic Analysis
Considering the 16 individuals, eight produced positive results. However, in several cases where it was not possible to assign just one haplogroup using HaploGrep ( Kloss-Brandstatter et al. 2011 ; van Oven 2015 ), the EmPOP ( Parson and Dur 2007 ) database was accessed to point out the most probable biogeographical ancestry.
Considering the mitochondrial transmission pattern (excluding cases of heteroplasmy), one individual will exhibit only one haplotype, belonging to a specific biogeographical ancestry. In those cases, where both HaploGrep and EmPOP indicate more than one haplogroup possibility, the obtained sequences in fact exhibit mutations that are present in more than one maternal lineage.
The results of the haplogroup-specific SNP analysis can also be consulted in Table 1 , specifying the SNP result, as well as the haplogroup indicated by the SNP result.
3.3. Statistical Analysis
Concerning the statistical analysis, S.M. Table S4 (Supplementary Material) contains the results from both multinomial studies. Here it is possible to observe that the most probable origin for the considered set of individuals was the Eastern metapopulation (probability = 9.2 × 10 −7 ). However, when dealing with specific populations, the highest result was obtained for the Mozabites (probability = 2.6 × 10 −5 ).
Taking into account the three metapopulations and the LR calculation among them, the highest LR value indicates that it is more probable to obtain this set of individuals from an Eastern metapopulation (LR = 1.2543 × 105) than from an African or European population ( Table 2 ).
Table 2. LR values obtained for the biogeographical ancestry determination.
4. Discussion
4.1. Results of the Quality and Authenticity
Apart from the recommended procedures, when dealing with ancient and/or critical DNA (
Gomes et al. 2019
), three methods were performed in the present work to verify signs of contamination in the final sample sequences. The first one was the confirmation of a total absence of DNA amplification in negative controls; the second procedure was the direct comparison between obtained results from samples and the research team haplotypes. However, mutations 263G or 315.1C are quite frequent in modern Europeans, though we have no information about their frequency in past populations. Therefore, the third process to detect signs of contamination was based on the observation of each polymorphism in the samples, in at least three independent amplifications.
On the other hand, the deterioration of the samples was also verified in the number of amplifications necessary to obtain each fragment and to confirm each polymorphism. Indeed, fewer amplifications were necessary in the case of the 119 bp fragment than in the case of the 255 bp fragment ( S.M. Table S2 ).
Concerning the comparison between both extraction methods, on the one hand, the fact that the same sequences were obtained with particularly different extraction methods increases the confidence in the obtained results. On the other hand, the fact there were more differences between individuals than between methods is also understandable, since, as mentioned before, the state of conservation of many of the biological samples was quite precarious, especially the oldest ones. This is also understandable, taking into account that the individuals would be in similar physicochemical conditions, so one of the factors that could affect the conservation of the genetic material would be the passage of time and the consequent loss of genetic information (
Gomes et al. 2019
). Excepting individuals 13G and 14G, samples with positive results were those belonging to the periods between I B.C and IV–V A.D, the most recent samples. Those from previous periods did not show positive results, or it was not possible to obtain a consensus result.
4.2. Biogeographical Ancestry
4.2.1. The HV0 Lineage
Five of the eight individuals exhibit the HV0 mitochondrial lineage. The HV mitochondrial haplogroup is a major clade within haplogroup R0, characterized by the 14766C mutation, which comprises at least 18 subclades (
De Fanti et al. 2015
), including HV0. Analyzing the mitochondrial information provided by
Emery et al.
(
2015
), it is important to note the frequency of the HV mitochondrial haplogroup in the Near East, considering the current localization of ancient Phoenicia, i.e., Lebanon. Although genetic drift episodes can indeed change genetic frequencies, the reconstruction of an eventual genetic portrait of the ancient Phoenicians could be approached through the analysis of modern population(s). Bottleneck episodes, such as catastrophic events of natural origin (earthquakes, seaquakes, for example) or from human nature (such as war events) lead to the alteration of genetic frequencies in a given place, due to population movement, as well as the deaths that it causes. For this reason, it is particularly interesting that one of the lineages found in the studied individuals from Phoenician times, HV0, coincides with one of the lineages of which the frequency is currently the highest in Lebanon, ancient Phoenicia. Even knowing that the probability of the occurrence of bottleneck-type events such as those mentioned above is very high, there seems to be a coincidence between the individuals of the Phoenician period of Gadir and one of the most prevalent lineages in Phoenicia (modern Lebanon).
Analyzing the Iberian Peninsula and according to Barral-Arca et al. ( 2016 ), the actual frequency of the macrohaplogroup R is higher in the northern half of the Iberian Peninsula than in the South. In line with previous information, the frequency of the HV0 haplogroup finds a peak frequency in the actual Basque region (North of Spain) ( Barral-Arca et al. ( 2016 )), but it is not a very frequent lineage when considering the whole Iberian Peninsula ( Nogueiro et al. 2015 ). Although Mairal et al. ( 2013 ) found a moderate HV0 lineage frequency in Miranda do Douro, Portugal (8.3%), and Zamora, Spain (8.4%), Nogueiro et al. ( 2015 ), when investigating Jewish Sephardic lineages in Portugal, a significant incidence of this mitochondrial lineage was found. Indeed, it is mentioned that 93% of the analyzed mtDNA genomes in the Jewish community of Belmonte (Portugal) correspond to the HV0b lineage ( Nogueiro et al. 2015 ). Historically, the migratory route followed by Sephardic Jews, extended along the coast of the Mediterranean and could have accompanied the Phoenician and other maritime dispersions, in accordance with the proposal for the dissemination of the Y-chromosome J haplogroup, in particular, subgroup J2 advanced by Di Giacomo et al. ( 2004 ) and Zalloua et al. ( 2008 ). This is relevant data, since both Phoenicians and Jews have a similar origin ( Padró 2012 ). Israelites seem to have been associated with the Canaanite culture. This relationship manifests itself in several aspects: technological, linguistic, and ethnological. The Canaanites, indigenous people of that area, were Semites and resulted possibly from a mixture of different groups: the Amorites, nomadic shepherds, also Semites; the Hittites, non-Semitic, who occupied part of Syria and Mesopotamia; the Amalekites, nomads from southern Palestine; and the Philistines, who occupied the Mediterranean coast south of Jerusalem ( Aubet 2001 ; Levy-Coffman 2005 ). In the Iberian Peninsula, the most ancient discovery concerning Jewish evidence has been related by Graen ( Friedrich-Schiller-Universitaet Jena 2012 ), and concerns “an excavation site in the south of Portugal, close to the city of Silves (Algarve)”, dated 482 A.D. This probably means that both Phoenicians and Jews coincided in the Iberian Peninsula, beyond their geographical proximity in the Near East.
However, considering the dating of the samples, four out of the five individuals (8iG, 8iiG, 9G and 12G) belong to the Roman Empire period in the Iberian Peninsula, and according to Di Bernardo et al. ( 2009 ), the HV0 haplogroup could also be found in the ancient Roman Empire. This could signify that these human remains were Romans who lived in Iberia and who adopted a Phoenician lifestyle.
Finally, considering not only the genetic information, but also evidence found in the burial sites, such as the type of tomb or the ornamental ceramics, all data seem to indicate that the buried individuals have a Phoenician ancestry.
Multiple Burials: The Case of 8iG and 8iiG Individuals
One of the objectives of this work was to detect a (possible) biological link between 8iG and 8iiG. Since they were found buried together, the genetic study aimed to help understand if they were buried together due to a biological kinship between them. By comparing the obtained sequences from both individuals, it was possible to conclude that they do not share the same maternal lineage. It is possible to discard biological relations, such as mother–son/daughter; siblings; maternal half-siblings, or other maternal kinship. Therefore, there are three main hypotheses: (a) the individuals are related by a paternal kinship, such as father–son/daughter, or paternal grandparent–grandson/granddaughter; (b) the individuals were united by marriage; (c) there were social, but not biological bonds between both individuals. From the molecular point of view, it is impossible to state what kind of relationship they shared.
4.2.2. The H Lineage
Considering individuals 11G and 15G, they are both dated as belonging to the IV–V A.D centuries, and it was possible to determine that the most probable macro-haplogroup for them both was H. This haplogroup, characterized by G2706A and T7028C polymorphisms, has an important representation in western Eurasia ( Roostalu et al. 2007 ) nowadays. Roostalu et al. ( 2007 ) indicate that in the present Lebanese population, the haplogroup H1 has a considerable frequency ( Roostalu et al. 2007 ; Emery et al. 2015 ). Such evidence could support a Phoenician lineage in both 11G and 15G individuals.
Nevertheless, the H haplogroup also has a significant frequency in Europe ( Emery et al. 2015 ; Zalloua et al. 2018 ), and regarding the actual Iberian Peninsula, the H haplogroup has a higher frequency in the Atlantic facade, decreasing its presence towards the Mediterranean and Andalusian regions ( Barral-Arca et al. 2016 ). The evidence of this haplogroup is also described, not only in present European individuals but also in past populations, such as the ancient Roman population ( Töpf et al. 2006 , 2007 ; Gamba et al. 2008 ; Di Bernardo et al. 2009 ; Martiniano et al. 2016 ). It should also be considered that before the Roman Empire, the natives of the Iberian Peninsula had close contact with the earlier Phoenician settlers ( Tsirkin 1997 ; Zalloua et al. 2018 ).
Another interesting fact has to do with the anthropological record that indicated that 11G had a probable African origin. Ottoni et al. mention that H1 is one of the most prevalent haplogroups in North Africa ( Ottoni et al. 2010 ). They also suggest that this haplogroup could have been carried out by migration from Europe, especially from the Iberian Peninsula to North Africa.
In the study performed by Zalloua et al. ( 2018 ) of possible Phoenician individuals from the island of Ibiza (Spain), this macrohaplogroup predominates, which may indicate, on the one hand, that there was a deep presence of European “natives” in Phoenician cities, or that, in fact, it is a lineage that was also common in the Phoenician population.
Thus, considering all the information for 11G and 15G individuals, it is not possible to simply discard any hypothesis. On the one hand, we have archaeological evidence that points to a Phoenician culture, yet, on the other hand, the molecular evidence does not allow for the Near East ancestry to be discarded, nor Tartessic, Roman or other European maternal origins. Regarding 11G, the African hypothesis should also be taken into account.
4.2.3. The L3 Lineage
The L3 lineage (characterized by the A769G, A1018G and C16311T mutations) is one of the African macro-haplogroups, which is currently common in Northeast Africa ( Harich et al. 2010 ), in contrast with the other two African macro-haplogroups (L1 and L2) ( Kujanova et al. 2009 ). According to Wallace et al. ( 1999 ), L3 forms the bridge between African and European–Asian mtDNAs, being more related to the Eurasian haplogroups than to the African clusters, L1 and L2 ( Maca-Meyer et al. 2001 ). In fact, two of its sub-haplogroups—M and N—diverged and are carried by most humans outside of Africa ( Wallace et al. 1999 ).
Considering our results, the individual 10G shows L3b lineage. The presence of this haplogroup in one individual found in the South of the Iberian Peninsula could be explained by two hypotheses. First, the trade of the goods between North Africa and Phoenician cities, made the migration of people between both places plausible; second, the slave trade among Phoenician colonies ( Fernández Uriel et al. 2000 ).
4.3. Statistical Analysis
The statistical analysis was based on the hypothesis that this set of individuals has been sampled together, as if they were all contemporary or, in other words, that the haplotype of the most recent individual is the same as that of his ancestor, who was a contemporary of the most ancient individual. This can be assumed since mitochondrial DNA is a lineage marker, and it is not expected that the haplotype would change along the same lineage over time. Even if mutational events occur, the expected result would be the appearance of private mutations and should not affect the individual’s haplogroup classification.
In general, the results support an Eastern origin for this set of individuals. Nonetheless, when dealing with specific populations, the most probable ancestry is a North African population. Considering table
S.M. Table S4
, it is possible to observe that only three specific populations have the H, HV0 and L3 haplogroup frequencies greater than 0.0001: Bedouin, Mozabite, and Palestinian populations. The Mozabite population, a Berber ethnic group inhabiting the northern Sahara, was the one presenting higher frequencies among the three metapopulations, for the three considered haplogroups. Hence, assuming the plausibility of the presented hypothesis and considering the Mozabite geographical location, this population could also be a possible origin for these individuals.
Finally, our results contrast with those obtained by Matisoo-Smith et al. ( 2016 ), who identified the U6 haplogroup, pointing to European ancestry, while in our study we identified three main lineages (HV0, H and L3), which could be ascribed to Europe, Near East and North Africa.
The analysis of these individuals does not allow the peremptory confirmation that their origin was from the Near East. The data that best support this theory is the archaeological evidence found in burial places. However, even though these individuals are not contemporaneous, we can verify that, for example, the maternal lineage HV0 and H are transversal throughout the different periods studied in this work and are still present in the modern Lebanese population ( Emery et al. 2015 ), where ancient Phoenicia was situated.
Although the genetic evidence is not homogeneous for all individuals, the archaeological evidence seems to demonstrate that individuals, even those not belonging to a Phoenician biological “lineage”, maintained the same rituals and traditions, even in terms of infrastructure and ways of writing.
Gomes et al.
(
2021
) discuss what the term “Family” means, explaining not only the biological, but also its social meaning. In this case, the same criterion could be applied, considering the fact that individuals identifying themselves as Phoenicians could not be related to a genetic lineage, but to oral and written tradition and to the feeling of belonging to a certain society.
5. Conclusions
Of the analyzed individuals, eight of them generated positive results. Five were classified within the HV0 mitochondrial lineage, the frequency of which is fairly considerable in the Near East. On the other hand, two of the eight belong to the macro-haplogroup H, which has a valuable representation in western Eurasia nowadays. Finally, the last analyzed individual presents the L3b lineage, one of the African macro-haplogroups currently widespread in Northeast Africa. In the present study, it is extremely complex to be able to associate a particular lineage identity with the individuals in question. Given the period to which they potentially belong, they may be descendants of the Phoenician ancestral population, or they may already, at a genetic level, come from another gene pool, from the Iberian Peninsula or not, considering the different Roman trajectories along its expansion. In general, the results support an Eastern origin for this set of individuals, reinforcing the theory of a possible Phoenician origin. However, due to their historical period, in some cases, it was not possible to discard a Roman origin.
The results obtained in this research are notably significant. In some cases, the archaeological record can demonstrate that, despite belonging to a distinct biological pool, individuals maintain their ancestral rituals and traditions, feeling that they belong to the ancient Phoenician genealogy.
Supplementary Materials
The following are available online at
https://www.mdpi.com/article/10.3390/genealogy7020027/s1
, S.M. Table S1—Morphological description of the individuals that were subjected to genetic analysis; S.M. Table S2. Primers used for the HV1 and HV2 mtDNA region amplifications; S.M. Table S3. Haplogroup-specific SNPs set with their respective sequence; S.M. Table S4. Multinomial-obtained results for the three considered metapopulations (African, Europe and Eastern populations) and the thirteen specific populations. The presented frequencies were obtained by consulting
Emery et al.
(
2015
). S.M. Figure S1. Planimetry and photographs of individual 10 found in the “Solar del Antiguo Teatro Cómico”. Source: JM Pajuelo and JMGener Basallote. S.M. Figure S2. Planimetry and photographs of individual 11 found in the “Solar del Antiguo Teatro Cómico”. Source: JM Pajuelo and JMGener Basallote. S.M. Figure S3. Planimetry and photographs of individual 12 found in the “Solar del Antiguo Teatro Cómico”. Source: JM Pajuelo and JMGener Basallote.
Author Contributions
Conceptualization, C.G., C.G.W., M.C.-F., J.M.G.B. and J.M.P.; methodology, C.G., S.P.-D. and C.L.-M.; software, C.G.; formal analysis, C.G.; investigation, C.G., C.G.W., M.C.-F. and I.N.; resources, C.G.W.; data curation, C.G., C.G.W., M.C.-F. and I.N.; writing—C.G. and I.N.; writing—review and editing, C.G., M.C.-F., I.N., A.M.L.-P., E.A.P., S.P.-D. and C.G.W.; supervision, C.G.W. and M.C.-F.; project administration, C.G.W.; funding acquisition, C.G.W., E.L.G., B.P.P. and E.A.P. All authors have read and agreed to the published version of the manuscript.
Funding
References
Amadori, Maria Dvc, Paola Fermo, and Paloma Pallante. 2016. Archaeometric researches on the provenance of Mediterranean Archaic Phoenician and Punic Pottery. Environmental Science and Pollution Research 24: 13921–49. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Arruda, ana Margarida. 2009. Phoenician Characterization on the Atlantic Coast of the Iberian Peninsula . Chicago: The University of Chicago Press. [ Google Scholar ]
Aubet, Maria Eugenia. 2001. The Phoenicians and the West: Politics, Colonies and Trade . Cambridge: Cambridge University Press. [ Google Scholar ]
Barral-Arca, Ruth, Sara Pischedda, Alberto Gómez-Carballa, Ana Pastoriza, Ana Mosquera-Miguel, Manuel López-Soto, Federico Martinón-Torres, Vanesa Álvarez-Iglesias, and Antonio Salas. 2016. Meta-Analysis of Mitochondrial DNA Variation in the Iberian Peninsula. PLoS ONE 11: e0159735. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Cavalli-Sforza, Luca, and Marcus Feldman. 2003. The application of molecular genetic approaches to the study of human evolution. Nature Genetics 33: 266–75. [ Google Scholar ] [ CrossRef ]
De Fanti, Sara, Chiara Barbieri, Stefania Sarno, Federica Sevini, Dario Vianello, Erika Tamm, Ene Metspalu, Mannis van Oven, Alexander Hübner, Marco Sazzini, and et al. 2015. Fine Dissection of Human Mitochondrial DNA Haplogroup HV Lineages Reveals Paleolithic Signatures from European Glacial Refugia. PLoS ONE 10: e0144391. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Di Bernardo, Giovanni, Stefania Del Gaudio, Umberto Galderisi, Antonio Cascino, and Marilena Cipollaro. 2009. Ancient DNA and family relationships in a Pompeian house. Annals of Human Genetics 73: 429–37. [ Google Scholar ]
Di Giacomo, Fabio, Luis Popa, Nejat Akar, Nicholas Anagnou, Juraj Banyko, Radim Brdicka, Guido Barbujani, Franco Papola, Giovanni Ciavarella, Franceso Cucci, and et al. 2004. Y chromosomal haplogroup J as a signature of the post-neolithic colonization of Europe. Human Genetics 115: 357–71. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Dietler, Michael, and Carolina López-Ruiz. 2009. Colonial Encounters in Ancient Iberia: Phoenicians, Greek, and Indigenous Relations . Chicago: Press UoC. [ Google Scholar ]
Emery, Leslie, Kevin Magnaye, Abigail Bigham, Joshua Akey, and Michael Bamshad. 2015. Estimates of continental ancestry vary widely among individuals with the same mtDNA haplogroup. American Journal of Human Genetics 96: 183–93. [ Google Scholar ] [ CrossRef ]
Fernández Uriel, Pilar, Carlos González Wagner, and Fernando López Pardo. 2000. Editor Intercambio y comercio preclásico en el Mediterráneo. In I coloquio del Centro de Estudios Fenicios y Púnicos (CEFYP) . Madrid: Actas del I coloquio del CEFYP. [ Google Scholar ]
Friedrich-Schiller-Universitaet Jena. 2012. Oldest Jewish Archaeological Evidence on the Iberian Peninsula. Available online: http://www.uni-jena.de/en/News/PM120525_Schrifttafel.html (accessed on 14 October 2022).
Gamba, Cristina, Eva Fernández, Alexis Oliver, Miriam Tirado, Carlos Baeza, ana María López-Parra, and Eduardo Arroyo-Pardo. 2008. Population genetics and DNA preservation in ancient human remains from Eastern Spain. Forensic Science International: Genetics Supplement Series 1: 462–64. [ Google Scholar ] [ CrossRef ]
Gamba, Cristina, Eva Fernandez, Miriam Tirado, M. F. Deguilloux, M. H. Pemonge, P. Utrilla, M. Edo, M. Molist, R. Rasteiro, L. Chikhi, and et al. 2012. Ancient DNA from an Early Neolithic Iberian population supports a pioneer colonization by first farmers. Molecular Ecology 21: 45–56. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Gener, osé María, and Carlos Núñez. 2015. Gadir Archaeological Site. In The Phoenician Origin—Making off . Cádiz: Ayuntamiento de Cádiz. [ Google Scholar ]
Gomes, Cláudia, María Fondevila, Concepción Magaña-Loarte, Juan Fernández-Jiménez, José Fernández-Serrano, Sara Palomo-Díez, Carlos Baeza-Richer, Ana María López-Parra, and Eduardo Arroyo-Pardo. 2019. An unusual kinship case from the Spanish Civil War (1936–1939) Ancient versus degraded sample’s investigation. Forensic Science International: Genetics Supplement Series 7: 690–91. [ Google Scholar ] [ CrossRef ]
Gomes, Cláudia, Sara Palomo-Díez, ana María López-Parra, and Eduardo Arroyo-Pardo. 2021. Genealogy: The Tree Where History Meets Genetics. Genealogy 5: 98. [ Google Scholar ] [ CrossRef ]
Gomes, Cláudia, Sara Palomo-Díez, Jordi Roig, ana María López-Parra, Carlos Baeza-Richer, Angel Esparza-Arroyo, Juan Gibaja, and Eduardo Arroyo-Pardo. 2015. Nondestructive extraction DNA method from bones or teeth, true or false? Forensic Science International: Genetics Supplement Series 5: e279–82. [ Google Scholar ] [ CrossRef ]
Groot, Beatrijs de. 2012. Testing Hybridity in Early Iron Age Iberia: Using Ceramics and Theory to Explain the Significance of Phoenician Colonialism . Leiden: Leiden University. [ Google Scholar ]
Harich, Nourdin, Marta D. Costa, Verónica Fernandes, Mostafa Kandil, Joana B. Pereira, Nuno M. Silva, and Luísa Pereira. 2010. The trans-Saharan slave trade—Clues from interpolation analyses and high-resolution characterization of mitochondrial DNA lineages. BMC Evolutionary Biology 10: 138. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Kloss-Brandstatter, Anita, Dominic Pacher, Sebastian Schönherr, Hansi Weissensteiner, Robert Binna, Günther Specht, and Florian Kronenberg. 2011. HaploGrep: A fast and reliable algorithm for automatic classification of mitochondrial DNA haplogroups. Human Mutation 32: 25–32. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Kujanova, Martina, Luisa Pereira, Verónica Fernandes, Joana Pereira, and Viktor Cerny. 2009. Near eastern neolithic genetic input in a small oasis of the Egyptian Western Desert. American Journal of Physical Anthropology 140: 336–46. [ Google Scholar ] [ CrossRef ]
Levy-Coffman, Ellen. 2005. A mosaic of people: The Jewish story and reassessment of the DNA evidence. Journal of Genetic Genealogy 1: 12–33. [ Google Scholar ]
Maca-Meyer, Nicole, Ana González, José Larruga, Carlos Flores, and Vicente M. Cabrera. 2001. Major genomic mitochondrial lineages delineate early human expansions. BMC Genetics 2: 13. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Mairal, Quim, Cristina Santos, Marina Silva, Sofia Marques, Amanda Ramos, Maria Pilar Aluja, Antonio Amorim, Maria João Prata, and Luis Alvarez. 2013. Linguistic isolates in Portugal: Insights from the mitochondrial DNA pattern. Forensic Science International: Genetics 7: 618–23. [ Google Scholar ] [ CrossRef ]
Martiniano, Rui, Anwen Caffell, Malin Holst, Kurt Hunter-Mann, Janet Montgomery, Gundula Müldner, Russell L. McLaughlin, Matthew D. Teasdale, Wouter van Rheenen, Jan H. Veldink, and et al. 2016. Genomic signals of migration and continuity in Britain before the Anglo-Saxons. Nature Communications 7: 10326. [ Google Scholar ] [ CrossRef ]
Matisoo-Smith, Elizabeth A., Anna L. Gosling, James Boocock, Olga Kardailsky, Yara Kurumilian, Sihem Roudesli-Chebbi, Leila Badre, Jean-Paul Morel, Leïla Ladjimi Sebaï, and Pierre A. Zalloua. 2016. A European Mito-chondrial Haplotype Identified in Ancient Phoenician Remains from Carthage, North Africa. PLoS ONE 11: e0155046. [ Google Scholar ] [ CrossRef ]
Nogueiro, Inês, João Teixeira, António Amorim, Leonor Gusmao, and Luis Alvarez. 2015. Echoes from Sepharad: Signatures on the maternal gene pool of crypto-Jewish descendants. European Journal of Human Genetics 23: 693–99. [ Google Scholar ] [ CrossRef ]
Ottoni, Claudio, Giuseppina Primativo, Baharak Hooshiar Kashani, Alessandro Achilli, Cristina Martínez-Labarga, Gianfranco Biondi, Antonio Torroni, and Olga Rickards. 2010. Mitochondrial haplogroup H1 in North Africa: An early Holocene arrival from Iberia. PLoS ONE 5: e13378. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Pääbo, Svante, Hendrik Poinar, David Serre, Viviane Jaenicke-Despres, Juliane Hebler, Nadin Rohland, Melanie Kuch, Johannes Krause, Linda Vigilant, and Michael Hofreiter. 2004. Genetic analyses from ancient DNA. Annual Review of Genetics 38: 645–79. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Padró, Josep. 2012. Os Fenícios. In Grande História Universal—Os Grandes Impérios Orientais , 4. 1ª ed. Edited by C. M. Abón. Madrid: Ediclube, pp. 47–63. [ Google Scholar ]
Parson, Walther, and Arne Dur. 2007. EMPOP—A forensic mtDNA database. Forensic Science International: Genetics 1: 88–92. [ Google Scholar ] [ CrossRef ]
Prieto, Lourdes, Bettina Zimmermann, Ana Goios, Ana María Rodriguez-Monge, Greiciane Paneto, Cíntia Alves, Antonio Alonso, Cíntia Fridman, Sergio Cardoso, Grabiela Lima, and et al. 2011. The GHEP-EMPOP collaboration on mtDNA population data—A new resource for forensic casework. Forensic Science International: Genetics 5: 146–51. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Romanini, Carola, Magdalena Romero, Mercedes Salado Puerto, Laura Catelli, Christopher Phillips, Rui Pereira, Leonor Gusmão, and Carlos Vullo. 2015. Ancestry informative markers: Inference of ancestry in aged bone samples using an autosomal AIM-Indel multiplex. Forensic Science International: Genetics 16: 58–63. [ Google Scholar ] [ CrossRef ]
Roostalu, Urmas, Ildus Kutuev, E.-L. Loogväli, Ene Metspalu, Kristiina Tambets, M. Reidla, Elza K. Khusnutdinova, Esien Usanga, Toomas Kivisild, and Richard Villems. 2007. Origin and expansion of haplogroup H, the dominant human mitochondrial DNA lineage in West Eurasia: The Near Eastern and Caucasian perspective. Molecular Biology and Evolution 24: 436–48. [ Google Scholar ] [ CrossRef ]
Shriver, Mark, and Rick A. Kittles. 2004. Genetic ancestry and the search for personalized genetic histories. Nature Reviews Genetics 5: 611–18. [ Google Scholar ] [ CrossRef ]
Töpf Ana, Thomas Gilbert, John Dumbacher, and Rus Hoelzel. 2006. Tracing the phylogeography of human populations in Britain based on 4th-11th century mtDNA genotypes. Molecular Biology and Evolution 23: 152–61. [ Google Scholar ] [ CrossRef ]
Töpf, Ana L., Thomas Gilbert, Robert Fleischer, and Rus Hoelzel. 2007. Ancient human mtDNA genotypes from England reveal lost variation over the last millennium. Biology Letters 3: 550–53. [ Google Scholar ] [ CrossRef ]
Tsirkin, Juli. 1997. The Phoenicians and Tartessos. Gerión Revista de Historia Antigua 15: 243. [ Google Scholar ]
Valério, Pedro, Rui Silva, Maria Fátima Araújo, António Soares, and Luis Barros. 2012. A multianalytical approach to study the Phoenician Bronze technology in the Iberia Peninsula—A view from the Quinta do Almaraz. Materials Characterization 67: 74–82. [ Google Scholar ] [ CrossRef ]
van Oven, Mannis. 2015. PhyloTree Build 17: Growing the human mitochondrial DNA tree. Forensic Science International: Genetics Supplement Series 5: e392–94. [ Google Scholar ] [ CrossRef ]
van Oven, Mannis, and Manfred Kayser. 2009. Updated comprehensive phylogenetic tree of global human mitochondrial DNA variation. Human Mutation 30: E386–94. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Vijande, Eduardo, Antonio Sáez, Salvador Domínguez-Bella, Juan Jesús Cantillo, Antonio Sáez, Milagros Macías, Ana Juliá, Ésther Sánchez, Antonio Barrena, and Lourdes Lorenzo. 2007. Anuario arqueológico de Andalucia . Junta de Andalucía: Conserjería de Cultura. [ Google Scholar ]
Wallace, Douglas C., Michael D. Brown, and Marie Lott. 1999. Mitochondrial DNA variation in human evolution and disease. Gene 38: 211–30. [ Google Scholar ] [ CrossRef ]
Zalloua, Pierre, Catherine Collins, Anna Gosling, Simone Biagini, Benjamí Costa, Olga Kardailsky, Lorenzo Nigro, Wissam Khalil, Francesc Calafell, and Elizabeth Matisoo-Smith. 2018. Ancient DNA of Phoenician remains indicates discontinuity in the settlement history of Ibiza. Scientific Reports 8: 17567. [ Google Scholar ] [ CrossRef ]
Zalloua, Pierre A., Daniel E. Platt, Mirvat El Sibai, Jade Khalife, Nadine Makhoul, Marc Haber, Yali Xue, Hassan Izaabel, Elena Bosch, Susan M. Adams, and et al. 2008. Identifying Genetic Traces of Historical Expansions: Phoenician Footprints in the Mediterranean. The American Journal of Human Genetics 83: 633–42. [ Google Scholar ] [ CrossRef ]
Figure 1. “Campo de Hockey” aerial view of various burials in a simple grave. Source: Vijande et al. ( 2007 ).
Figure 2. Planimetry of the Phoenician houses and 3D reconstruction, 820–760 B.C. Source: Gener and Núñez ( 2015 ).
Figure 3. Planimetry and various archaeological finds. Source: Gener and Núñez ( 2015 ).
Figure 4. Graphites with a Phoenician script. Source: Gener and Núñez ( 2015 ).
Figure 5. Planimetry and photographs of individual 9 found in one of the corners of the building. Source: JM Pajuelo and JM Gener Basallote.
Table 1. mtDNA haplotypes achieved for the 16 studied individuals, including the most probable maternal haplogroup.
Individual mtDNA Position Range mtDNA Haplotype HAPLOGREP EMPOP Frequency (17 March 2023) Haplogroup-Specific SNP Result Assigned Haplogroup Consensus Haplogroup 1G --- No result --- --- --- --- --- 2G --- No result --- --- --- --- --- 3G --- Without consensus --- --- --- --- --- 4G --- Without consensus --- --- --- --- --- 5G --- Without consensus --- --- --- --- --- 6G --- Without consensus --- --- --- --- --- 7G 123–320; 16,105–16,399 195C 198T 263G 309.1C 16269G 16298C HV0b 86.18% HV0b 1/42,210 14766C HV0 HV0 7028T HV0 8iG 8–128; 16,105–16,280 72C HV0b 100% HV0b 413/40,258 14766C HV0 HV0 7028T HV0 8iiG 10–390; 16,105–16,399 72C 195C 198T 263G 309.1C 16269G 16298C HV0b 89.02% HV0b 0/39,355 14766C HV0 HV0 7028T HV0 9G 8–73; 127–391; 16,105–16,399 72C 195C 198T 263G 315.1C 16269G 16298C HV0b 89.02% HV0b 1/39,355 7028T HV0 HV0 10G 55–127; 135–378; 740–769; 16,231–16,399 73G 263G 315.1C 750G 16278T 16362C L3b 100% L3b 17/4300 10873C L3 L3 10398A No result 8701A No result 11G 8–390; 16,105–16,399 152C 263G 315.1C H1c H 290/39,355 7028C H H 12G 126–390; 16,105–16,399 195C 198T 263G 309.1C 16269G 16278T 16298C 16362C HV0b 80.1% HV0b 0/41,708 7028T HV0 HV0 13G ---- Without consensus --- --- --- --- --- 14G ---- No result --- --- --- --- --- 15G 8–390; 16,105–16,399 263G 315.1C H2a2a 100% H 1237/39,355 7028C H H Researcher C. 8–390; 16,105–16,399 T152C, A263G, 309.1C, 315.1C, T16304C H5 H5 --- --- --- Researcher S. 8–390; 16,105–16,399 A55G, C150T, T239C, A263G, 309.1C, 309.2C, 315.1C, T16362C H6a H6a --- --- ---
Table 2. LR values obtained for the biogeographical ancestry determination.
| https://www.mdpi.com/2313-5778/7/2/27/xml |
Stomach Anatomy
Overview
The stomach is the first intra-abdominal part of the gastrointestinal (GI), or digestive, tract. It is a muscular, highly vascular bag-shaped organ that is distensible and may take varying shapes, depending on the build and posture of the person and the state of fullness of the organ (see the image below). The stomach lies in the left upper quadrant of the abdomen.[1, 2]
Stomach and duodenum, coronal section.
Gross Anatomy
The thoracic esophagus enters the abdomen via the esophageal hiatus of the diaphragm at the level of T10. The abdominal portion of the esophagus has a small intra-abdominal length (2-3 cm). The esophagogastric junction (cardia), therefore, lies in the abdomen below the diaphragm to the left of the midline at the T11 level.
The cardiac notch (incisura cardiaca gastri) is the acute angle between the left border of the abdominal esophagus and the fundus of the stomach, which is the part of stomach above a horizontal line drawn from the cardia. The body (corpus) of the stomach leads to the pyloric antrum (at the incisura angularis). The pyloric antrum narrows toward the right to become the pyloric canal, surrounded by the pyloric sphincter, which joins the duodenum at the L1 level (transpyloric plane) to the right of the midline (see the image below).
Stomach and duodenum, coronal section.
The anterior surface of stomach is related to the left lobe (segments II, III and IV) of the liver, the anterior abdominal wall, and the distal transverse colon. The posterior surface of the stomach is related to the left hemidiaphragm, the spleen, the left kidney (and adrenal), and the pancreas (stomach bed).
The omental bursa (lesser sac) lies behind the stomach and in front of the pancreas; it communicates with the greater sac (main peritoneal cavity) via the omental (epiploic) foramen (of Winslow) behind the hepatoduodenal ligament (HDL; the free edge of the lesser omentum).
The convex greater curvature of the stomach starts at the left of the cardia and runs from the fundus along the left border of the body of the stomach and the inferior border of the pylorus. The concave lesser curvature starts at the right of the cardia as a continuation of the right border of the abdominal esophagus and runs a short distance along the right border of the body of the stomach and the superior border of the pylorus. The junction of the vertical and horizontal parts of the lesser curvature is called incisura angularis. Lesser curvature is shorter in length than the greater curvature.
The stomach and the first part of the duodenum are attached to the liver by the hepatogastric ligament (the left portion of the lesser omentum) containing right and left gastric vessels, to the left hemidiaphragm by the gastrophrenic ligament, to the spleen by the gastrosplenic/gastrolienal ligament containing short gastric vessels, and to the transverse colon by the gastrocolic ligament (part of the greater omentum) containing epiploic (omental) vessels. Few peritoneal bands may be present between the posterior surface of the stomach and the anterior surface of the pancreas. Part of the greater omentum hangs like an apron from the transverse colon, with 4 layers of the peritoneum (often fused): 2 layers go downward from the stomach and then run upward to be attached to the transverse colon.
Blood supply
The celiac trunk (axis) arises from the anterior surface of the abdominal aorta at the level of L1. It has a short length (about 1 cm) and trifurcates into the common hepatic artery (CHA), the splenic artery, and the left gastric artery (LGA).
The LGA runs toward the lesser curvature of the stomach and divides into an ascending branch (supplying the abdominal esophagus) and a descending branch (supplying the proximal stomach). The CHA runs toward the right on the superior border of the pancreas and gives off the gastroduodenal artery (GDA), which runs down behind the first part of the duodenum. After giving off the GDA, the CHA continues as the proper hepatic artery.
The right gastric artery (RGA), a branch from the proper or common hepatic artery, runs along the lesser curvature from right to left and joins the descending branch of the LGA to form an arcade along the lesser curvature between the 2 leaves of peritoneum of the lesser omentum. This arcade gives off multiple small arteries to the body of the stomach. The GDA gives off the PSPDA and then divides into the right gastro-omental (gastroepiploic) artery (RGEA) and the anterior superior pancreaticoduodenal artery (ASPDA); it also gives off the small supraduodenal artery (of Wilkie). The RGEA runs along the greater curvature from right to left.
The splenic artery runs toward the left on the superior border of the distal body and tail of pancreas and gives off the left gastro-epiploic (gastro-omental) artery (LGEA), which runs from left to right along the greater curvature and joins the RGEA to form an arcade along the greater curvature between the two leaves of peritoneum of the greater omentum. This arcade gives off multiple small arteries to the body of the stomach.
The greater curvature arcade formed by the RGEA and the LGEA provides several omental (epiploic) branches to supply the highly vascular greater omentum. The splenic artery also gives off 3-5 short gastric arteries that run in the gastro-splenic (gastro-lienal) ligament and supply the upper part of the greater curvature and the gastric fundus. Few small posterior gastric arteries may arise from the splenic artery. The stomach has a rich network of vessels in its submucosa.
The left gastric (coronary) vein drains into the portal vein at its formation (by the union of the splenic and superior mesenteric veins). The right gastric and right gastro-omental veins drain into the portal vein. The left gastro-omental vein drains into the splenic vein, as do the short gastric veins.
The pylorus is marked by a prepyloric vein (of Mayo), which lies on its anterior surface. The gastrocolic trunk (GCT) of Henle is present in a large number of cases and lies at the junction of the small bowel mesentery and the transverse mesocolon. It may drain branches from the middle colic, and ASPDV and right gastro-omental veins.
The short gastric arteries and veins are sometimes collectively referred to as the vasa brevia.
Lymphatic drainage
Lymph nodes draining the stomach are numbered and divided into 4 levels, as follows:
Level I (perigastric lymph nodes) - Right paracardiac (1), left paracardiac (2), along lesser curvature (3) along greater curvature (4), suprapyloric (5), infrapyloric (6)
Level 2 - Along LGA (7), along CHA (8), along celiac axis (9), at splenic hilum (10), along splenic artery (11)
Level 3 - In hepato-duodenal ligament (12), behind duodenum and pancreas head (13), at the root of small bowel mesentery (14)
Level 4 - Mesocolic (15), paraaortic (16)
Nerve supply
The esophageal plexus of vagus (para-sympathetic) nerves lies in the posterior mediastinum below the hila of the lungs. It divides into 2 vagal trunks that enter the abdomen along with the esophagus through the esophageal hiatus in the left dome of diaphragm. The right (posterior) vagus is behind and to the right of the intra-abdominal esophagus, whereas the left vagus is in front of the intra-abdominal esophagus.
The right vagus gives off a posterior gastric branch called the criminal nerve of Grassi, which traverses to the left and supplies the cardia and fundus of the stomach; the nerve is so called because it is often missed during vagotomy and is then responsible for recurrence of peptic ulcer. The right vagus gives off a celiac branch (which supplies the pancreas and the small and large bowel), and the left vagus gives off a hepatic branch (which supplies the liver and the gallbladder).
After giving off the celiac and hepatic branches, respectively, the right and left vagal trunks continue along the lesser curvature of the stomach (in close company with the vascular arcade formed by the left and right gastric vessels) as the posterior and anterior gastric nerves of Latarjet, which supply the corpus (body) of the stomach, the antrum, and the pylorus.
Sympathetic nerve supply to the stomach comes from celiac ganglia (T5-T9).
Anatomy on diagnostic imaging
The stomach and duodenum are evaluated radiologically with barium studies using fluoroscopy. It should be noted that on computed tomography (CT), the cardia is on a lower horizontal plane than the dome of the fundus is.
Endoscopic anatomy
Cardia (esophagogastric junction), incisura angularis, and pylorus are very well seen on upper GI endoscopy (UGIE).
Physiological anatomy
Stomach is a reservoir; its size and shape changes from time to time depending on the volume of its contents (food/fluid). The shape and position of the stomach also changes with the position of the patient, whether erect or supine. A large J-shaped stomach can descend as low down as into the pelvis.
Severe pain in any part of the body (eg, headache, ureteric colic due to stone) may give rise to pylorospasm and reflex vomiting.
Microscopic Anatomy
The esophagus is lined with nonkeratinized stratified squamous epithelium, which changes into columnar epithelium in the stomach. The columnar cells in all of the stomach secrete mucin; the chief (zymogenic) cells in the fundus secrete protein digesting pre-enzyme pepsinogen; the parietal (oxyntic) cells in the body (corpus) of the stomach secrete acid (H+ ions) and intrinsic factor; and the G cells in the antrum secrete gastrin (which in turn acts on parietal cells).
The innermost lining of the stomach wall is mucosa, which consists of columnar epithelium, lamina propria, and muscularis mucosa. Submucosa contains a rich network of blood vessels and Meissner’s nerve plexus. The smooth muscles of the stomach are arranged in 3 layers: inner oblique (unique to stomach), middle circular (forms the pylorus), and outer longitudinal. These muscles are supplied by the Auerbach’s nerve plexus. Serosa is the visceral peritoneum that covers most of the stomach. Mucosa and submucosa are thrown into several longitudinal folds called rugae.
The lower esophageal sphincter (LES), or gastroesophageal sphincter, is not a true (anatomic) sphincter; however, the pylorus is a true sphincter composed of circular muscles.
Wall layers on ultrasonography
Endoscopic ultrasonography (EUS) is a newer technical tool for evaluating stomach. An ultrasound probe is mounted at the tip of an upper gastrointestinal (GI) endoscope, which is passed into the stomach. The wall of the stomach is seen as 5 alternating layers, as follows:
Mucosa (hyperechoic)
Lamina propria (hypoechoic)
Submucosa (hyperechoic)
Muscularis propria (hypoechoic)
Serosa (hyperechoic)
EUS is very helpful in the diagnosis and staging of early gastric cancer and for evaluation of gastric varices in portal hypertension.
Pathophysiologic Variants
Congenital hypertrophic pyloric stenosis seen in infants presents as pyloric obstruction at 2-4 weeks of life.
Other Considerations
Common diseases of the stomach include peptic (gastric) ulcers and gastric tumors/cancers (eg, adenocarcinoma, lymphoma, GI stromal tumor [GIST]). Historically, the most common operations performed on the stomach were those for peptic ulcer disease. Today, the most common procedures performed on the stomach include bariatric procedures (eg, gastric band, sleeve gastrectomy, gastric bypass). Various types of gastrectomies are performed for gastric tumors and cancers.
Types of vagotomy include truncal, selective, and highly selective.
In truncal vagotomy (TV), both anterior and posterior vagal trunks are divided as they enter the abdomen. In selective vagotomy (SV), the anterior and posterior vagi are divided below their hepatic and celiac branches, respectively. The nerve supply to the viscera (eg, liver, gallbladder, common bile duct [CBD], pancreas, and small and large bowel) is preserved. In highly selective vagotomy (HSV; also referred to as proximal gastric vagotomy [PGV] or parietal cell vagotomy [PCV]), the anterior and posterior nerves of Latarjet are preserved, which maintains the nerve supply to the antrum and pylorus. TV and SV denervate the antrum and pylorus and necessitate a drainage procedure (gastrojejunostomy or pyloroplasty); HSV does not require drainage.
Parietal cell mass is increased in Zollinger-Ellison syndrome, resulting in hypersecretion of acid. Antrectomy removes the G cells and results in reduction of acid production by taking away stimulation of parietal cells by gastrin.
The artery involved in a bleeding duodenal ulcer is gastroduodenal artery, which runs vertically down behind (posterior to) the first part of the duodenum.
Pseudocyst of the pancreas is a collection of fluid that develops in the lesser sac behind the stomach. The anterior wall of the pseudocyst is in close approximation to the posterior wall of the stomach; the pseudocyst can be easily drained into the stomach (cystogastrostomy) either surgically or endoscopically.
Because of the shorter length of the lesser curvature, obtaining adequate proximal and distal margins in a growth situated along the lesser curvature may be difficult without performing a total gastrectomy.
The stomach can be mobilized after division of the left gastric artery (proximal to its bifurcation) and left gastroepiploic artery and can survive on the right gastric artery and right gastroepiploic artery, to be taken through the mediastinum into the neck (even as high as the pharynx) after total esophagectomy. The vascular arcades on the lesser and greater curvatures have to be preserved.
Esophagogastric anastomosis is done to the fundus—the highest point of the mobilized stomach.
When making a gastrotomy (incision) in the wall of the stomach, vessels are encountered in the submucosal plane—these must be controlled with suture, diathermy, or any other energy device.
The lesser sac is opened by dividing the gastrocolic omentum between the greater curvature of the stomach and transverse colon—this exposes the body and tail of the pancreas, with splenic artery running on its upper (cranial) border. The gastrocolic omentum is opened towards its left, away from the middle colic vessels, where it is thinner and broader.
The spleen is at risk for injury when short gastric vessels are divided during mobilization of the fundus and the upper part of the greater curvature of the stomach. Similarly, fundus of the stomach can be injured when short gastric vessels are divided during splenectomy.
The transverse mesocolon, containing middle colic vessels, or the transverse colon itself may be involved in stomach cancer. Posterior infiltration of stomach cancer occurs into the pancreas.
A vascular flap of greater omentum based on an epiploic artery can be used to provide cover to an anastomosis in the abdomen (eg, esophagogastric, biliary enteric, pancreaticoenteric).
Contributor Information and Disclosures
Author
Vinay K Kapoor, MBBS, MS, FRCSEd, FICS, FAMS
Professor of HPB Surgery, Mahatma Gandhi Medical College and Hospital (MGMCH), Jaipur, India
Vinay K Kapoor, MBBS, MS, FRCSEd, FICS, FAMS is a member of the following medical societies: Association of Surgeons of India, Indian Association of Surgical Gastroenterology, Indian Society of Gastroenterology, Medical Council of India, National Academy of Medical Sciences (India), Royal College of Surgeons of Edinburgh
Chief Editor
Thomas R Gest, PhD
Professor of Anatomy, University of Houston College of Medicine
Thomas R Gest, PhD is a member of the following medical societies: American Association of Clinical Anatomists
References
Agur AMR, Lee MJ, Grant JCB. Grant’s Atlas of Anatomy. 10th ed. London, UK: Lippincott Williams and Wilkins; 1999.
Gray H, Lewis WH. Gray’s. Anatomy of the Human Body. 20th ed. New York, NY: Bartleb; 2000.
Decker GA, Plessis D Du. Lee Mcgregor’s Synopsis of Surgcial Anatomy. CRC Press;
Grant JCB, Basmajian JV, Slonecker CE. Method of Anatomy: A Clinical Problem-Solving Approach. 11th ed. London, UK: Williams and Wilkins; 1989.
Romanes GJ. Thorax and Abdomen. Cunningham's Manual of Practical Anatomy. 15th ed. New York, NY: Medical Publications, Oxford University Press; 1986. Vol. II:
Romanes GJ. Head, Neck and Brain. Cunningham's Manual of Practical Anatomy. 15th ed. New York, NY: Oxford Medical Publications, Oxford University Press; 1986. Vol. III:
Sinnatamby CS. Last's Anatomy: Regional and Applied. 10th ed. Edinburgh: Churchill Livingstone; 1999.
| https://emedicine.medscape.com/article/1899301-print |
Middle Knowledge and Original Sin | Reasonable Faith
Dr. William Craig answers weekly Questions and Answers on Christian Doctrine and apologetics. Read question Middle Knowledge and Original Sin here.
#649 Middle Knowledge and Original Sin
Q
Dear Dr Craig,
Thank you, first of all, for this wonderful treasure trove of Christian philosophy that you have compiled here on your website. Having recently rediscovered my faith after sixteen years of atheism, your articles and videos have been immensely helpful to me in ensuring that my beliefs have a solid and consistent philosophical framework. I would like to revisit the question of original sin from a perspective that was not addressed in questions #549 and #560, which were on the same topic, and focus on your argument in favor of Adam's "apt representation" of us based on God's middle knowledge.
You write in #549: "Lest anyone complain that Adam was a bad representative, we can say that God via His middle knowledge knew that, had we been in Adam’s place, we would have done the same thing. So Adam does not fail to represent us accurately before God and so serves as an apt representative on our behalf." I find this answer problematic for the following reason: Adam's choice was made in the context of a world before the fall of man. Therefore, Adam's nature was not yet tainted by original sin, and with his untainted free will, he truly, genuinely could have chosen otherwise. This untainted freedom is, indeed, the basis for his culpability.
To say that every human being on Earth would have made the same choice as Adam (according to God's middle knowledge) either (a) anachronistically ascribes post-fall corruption to one's free will regarding a choice actually made pre-fall, or (b) denies genuine free will altogether. It seems to me that (b) is an unavoidable conclusion from the following: (1) The guilt of original sin necessarily applies to all human beings after Adam. (2) If genuine free will is presupposed, then neither the truth nor the falsity of the counterfactual statement "If I had been in place of Adam, I would have made the same choice" can be necessary. However, if (1) is true, then it is necessarily true that all humans – including all future humans not even born yet – would have made the same choice as Adam. Otherwise it remains possible that he was not an apt representative for all humans, which would remove the justification for the universal guilt caused by original sin. Therefore, in this scenario, there was no free will even before the fall.
I would very much appreciate your thoughts on this to see where I went wrong in my reasoning, if I did. Thank you!
Antti
Finland
Dr. craig’s response
A
You’re right, of course, Antti, that Adam’s choice was made in a state of innocence without the corrupting influence of sin that we experience. But you need to understand that when in discussions of middle knowledge, we imagine a person being in different circumstances and asked to choose, we emphatically are notimagining what would happen if a person, say, went back in a time machine, bringing with him all his present baggage, and made the choice. Rather we are imagining that you (instead of Adam) were the first man created in a state of innocence, never having known sin. What would you have done? Of course, you don’t know, but according to the doctrine of middle knowledge, God knows. And my suggestion is that He chose to create only persons who He knew would make the same choice as Adam. Therefore His appointing Adam to act as your representative is not unfair of God. Adam ably represents you: he did exactly what you would have done.
So the scenario does not (a) anachronistically ascribe post-fall corruption to one's free will regarding a choice actually made pre-fall. Does it (b) deny genuine free will altogether? Not at all! The whole point of middle knowledge is that God knows what people would freely do in any circumstances in which they might find themselves. You are correct in asserting
(2) If genuine free will is presupposed, then neither the truth nor the falsity of the counterfactual statement "If I had been in place of Adam, I would have made the same choice" can be necessary.
Counterfactuals of freedom are contingentlytrue, not necessarilytrue. But when you assert
(1) The guilt of original sin necessarily applies to all human beings after Adam.
you seem to be confusing the fact that after Adam’s fall all his natural descendants inherit a corrupted nature, so that they cannot avoid sin, with what they would have freely done if they had never been corrupted in the first place but had been in Adam’s place instead. In that situation they need not sin but may freely choose what to do, as Adam did. It is correct to say that it is possiblethat Adam should fail to be an apt representative, but given His middle knowledge, God knew that that possibility would not be actualized.
- William Lane Craig
| https://www.reasonablefaith.org/question-answer/P620/middle-knowledge-and-original-sin |
Biosensors | Free Full-Text | Liquid Metal-Based Electronics for On-Skin Healthcare
Wearable devices are receiving growing interest in modern technologies for realizing multiple on-skin purposes, including flexible display, flexible e-textiles, and, most importantly, flexible epidermal healthcare. A ‘BEER’ requirement, i.e., biocompatibility, electrical elasticity, and robustness, is first proposed here for all the on-skin healthcare electronics for epidermal applications. This requirement would guide the designing of the next-generation on-skin healthcare electronics. For conventional stretchable electronics, the rigid conductive materials, e.g., gold nanoparticles and silver nanofibers, would suffer from an easy-to-fail interface with elastic substrates due to a Young’s modulus mismatch. Liquid metal (LM) with high conductivity and stretchability has emerged as a promising solution for robust stretchable epidermal electronics. In addition, the fundamental physical, chemical, and biocompatible properties of LM are illustrated. Furthermore, the fabrication strategies of LM are outlined for pure LM, LM composites, and LM circuits based on the surface tension control. Five dominant epidermal healthcare applications of LM are illustrated, including electrodes, interconnectors, mechanical sensors, thermal management, and biomedical and sustainable applications. Finally, the key challenges and perspectives of LM are identified for the future research vision.
Liquid Metal-Based Electronics for On-Skin Healthcare
by Jinwei Cao 1,2,3,† , Xin Li 4,† , Yiwei Liu 1,2,* , Guang Zhu 3,* and Run-Wei Li 1,2,*
1
Zhejiang Province Key Laboratory of Magnetic Materials and Application Technology, Ningbo Institute of Materials Technology and Engineering, Chinese Academy of Sciences, Ningbo 315201, China
3
Department of Mechanical, Materials and Manufacturing Engineering, University of Nottingham Ningbo China, Ningbo 315100, China
4
School of Integrated Circuits and Beijing National Research Centre for Information Science and Technology (BNRist), Tsinghua University, Beijing 100084, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Biosensors 2023 , 13 (1), 84; https://doi.org/10.3390/bios13010084
Received: 18 November 2022 / Revised: 27 December 2022 / Accepted: 28 December 2022 / Published: 3 January 2023
(This article belongs to the Special Issue Liquid Metal Based Biosensors and Bioelectronic Devices )
Abstract
:
Wearable devices are receiving growing interest in modern technologies for realizing multiple on-skin purposes, including flexible display, flexible e-textiles, and, most importantly, flexible epidermal healthcare. A ‘
BEER
’ requirement, i.e., biocompatibility, electrical elasticity, and robustness, is first proposed here for all the on-skin healthcare electronics for epidermal applications. This requirement would guide the designing of the next-generation on-skin healthcare electronics. For conventional stretchable electronics, the rigid conductive materials, e.g., gold nanoparticles and silver nanofibers, would suffer from an easy-to-fail interface with elastic substrates due to a Young’s modulus mismatch. Liquid metal (LM) with high conductivity and stretchability has emerged as a promising solution for robust stretchable epidermal electronics. In addition, the fundamental physical, chemical, and biocompatible properties of LM are illustrated. Furthermore, the fabrication strategies of LM are outlined for pure LM, LM composites, and LM circuits based on the surface tension control. Five dominant epidermal healthcare applications of LM are illustrated, including electrodes, interconnectors, mechanical sensors, thermal management, and biomedical and sustainable applications. Finally, the key challenges and perspectives of LM are identified for the future research vision.
;
epidermal healthcare
1. Introduction
Wearable devices are of paramount importance for human life in such an era of everything being interconnected, smart, and intelligent [ 1 , 2 , 3 , 4 ]. In addition, they are usually employed on human epidermal skin to realize various applications such as flexible displays [ 5 ], flexible e-textiles [ 6 , 7 ], e-skin [ 8 ], optoelectronic skin [ 9 ], and, most importantly, human healthcare [ 10 ]. Especially in the post-pandemic era (COVID-19), more researchers are dedicated to designing distinctive devices for real-time on-body signal monitoring, including electrocardiography (ECG) [ 11 ], electromyography (EMG) [ 12 ], blood pressure [ 13 ], respiration [ 14 ], temperature [ 15 ], etc. To realize these functions, flexible conductors that possess conformability, conductivity, stretchability, and durability upon the dynamic deformations of human skin are highly required [ 16 ]. These conductors enable the perception, collection, or even procession of epidermal signals by the differentiation of electrical potential, the transmission of electrons, and the identification of mechanical deformations or chemical micro-environments as various sensors [ 17 ].
For conductive materials on the epidermal system (
Figure 1
), three basic requirements need to be met in fabrication and designing processes, named the ‘
BEER
’ requirement. 1. Biocompatibility: Biological compatibility is most significant for on-skin applications, especially for in vivo and in vitro biotoxicity. The conductive materials should be nontoxic to ensure the safety of the epidermal system. In addition, air-permeability and thermal comfort are important to prevent skin lesions and inflammation while ensuring long-term comfortable wearing. 2. Electrical elasticity: The conductive materials should be designed with satisfying strain tolerance to maintain their functions in on-skin scenarios. In more detail, the conductors should show stable conductivity under stretching and recovering. 3. Robustness: The epidermal system provides a dynamic deformation scenario for on-skin conductive materials. Under long-term dynamic stretching, bending, and twisting, the conductors or electrodes are supposed to maintain their conductivity for long-term use, and the biosensors should present robust sensitivity.
Through the ‘ BEER ’ requirement, a series of conductive materials and devices are being proposed and developed to constitute a smart wearable healthcare monitoring system [ 18 ]. As opposed to carbon-based conductive materials [ 19 , 20 ], metal-based conductive materials have sprung up with the anticipation of their high conductivity [ 17 ]. Rigid-metal conductive materials with various morphologies are emerging as processable conductive components, including nanoparticles (e.g., Au nanoparticles) [ 21 ], fibers (e.g., Ag nanowires) [ 22 ], plates (e.g., Ag flakes) [ 23 ], and their combinations (e.g., Ag nanoparticles and flakes) [ 24 ]. However, the poor toughness of rigid conductive materials would cause a dramatic drop in conductivity due to the fracture or separation of them during elongation. The reason lies in the Young’s modulus mismatch between rigid conductive fillers and a soft matrix that forms an unstable and easy-to-fail interface.
Different from rigid-metal conductive materials, liquid metal (LM) with its high fluidity at room temperature is a possible solution and has emerged as a promising conductive material, e.g., mercury (Hg), francium (Fr), cesium (Cs), gallium, rubidium (Rb), etc. ( Figure 2 A) [ 25 , 26 , 27 , 28 ]. Generally, Hg is the most common but toxic, and Fr, Cs, and Rb are rare and violently reactive or radioactive, which makes them inappropriate for on-skin conductive materials. Ga-based liquid metal shows high processibility and possesses no vapor pressure, negligible solubility in water, and nontoxicity [ 29 , 30 ]. In addition, Ga-based LM presents excellent conductive properties of (3.4–6.7) × 10 6 S/m under stretching [ 31 ]. These properties highlight Ga-based liquid metal as a significant intrinsically stretchable conductive material candidates that fully meets the ‘ BEER ’ requirement for epidermal electronics.
Many efforts have been devoted to design novel LM-based epidermal electronics that can be conformably attached onto skin for ECG, EMG, or EEG collection ( Figure 1 ). Some LM-based sensors are fabricated by mimicking the function of various sensory receptors. As a result, pressure, strain, pain sensors, and other functional circuits for temperature and perspiration monitoring to serve as artificial skin have been designed [ 32 , 33 , 34 ]. In addition, blood pressure and blood pulsation in subcutaneous tissue could also be identified with a pressure sensor to monitor subtle physiological changes [ 35 ]. Prior to the applications of LMs, the representative properties of LMs will be thoroughly discussed in terms of their physical properties (conductivity, surface tension, thermal conductivity, etc.), chemical properties (oxidation, surface modification, reaction with metals, catalytic medium, etc.), and biocompatibility. In the meanwhile, various technologies for LM modification, LM patterning, circuit fabrication, and device assembly are also introduced. The challenges and opportunities of LM-based conductive materials and devices are discussed with proposed solutions and future directions.
Figure 2. The fundamental physical properties of LMs. ( A ) Physical properties of water and typical metals. Data from Tang et al. [ 25 ], Chen et al. [ 26 ], Zhu et al. [ 27 ] and Chen et al. [ 28 ]. ( B ) A freestanding 3D tower of liquid metal droplets [ 29 ]. Copyright: (2013) WILEY-VCH. ( C ) Comparison of the maximum strain conductivities of different flexible conductors [ 36 ]. Copyright: (2018) WILEY-VCH. ( D ) Summary of the thermal conductivity for various materials as a function of the strain limit to Young’s modulus ratio [ 37 ]. Copyright: (2017) National Academy of Sciences.
Figure 2. The fundamental physical properties of LMs. ( A ) Physical properties of water and typical metals. Data from Tang et al. [ 25 ], Chen et al. [ 26 ], Zhu et al. [ 27 ] and Chen et al. [ 28 ]. ( B ) A freestanding 3D tower of liquid metal droplets [ 29 ]. Copyright: (2013) WILEY-VCH. ( C ) Comparison of the maximum strain conductivities of different flexible conductors [ 36 ]. Copyright: (2018) WILEY-VCH. ( D ) Summary of the thermal conductivity for various materials as a function of the strain limit to Young’s modulus ratio [ 37 ]. Copyright: (2017) National Academy of Sciences.
2. Properties of Liquid Metals
LMs exhibit a variety of distinct physical, chemical, and biological properties, which offer a unique application advantage in epidermal healthcare monitoring [
26
]. In this section, the fundamental properties of LM, including physical and chemical properties, which facilitate on-skin applications will be comprehensively introduced. The fundamental physical characteristics of liquid metal mainly consist of the melting point, electrical conductivity, fluidity, plasticity, viscosity, wettability, etc. On the other hand, the chemical properties that are related to the fabrication of LM-based circuits will be discussed, including oxidation, alloying, chemical reduction, and electrochemical reduction. More importantly, the biocompatibility of LM for in vivo and in vitro uses will be discussed to prove the feasibility of LM-based electronics for long-term epidermal applications.
2.1. Physical Properties
The main physical properties of water and various common LMs are presented in
Figure 2
A. Gallium (Ga), with its weak Ga-Ga bonds and large interatomic distance, is hence susceptible to having its crystal structure broken by heat, exhibiting a melting point of 29.8 °C. However, Ga’s boiling point is approximately 2400 °C because its p-shell contains reactive and unpaired valence electrons [
38
]. As a result, Ga is stable and reasonably safe to use due to its high boiling point and low melting point. Gallium can be alloyed with other metals such as Indium (In), Tin (Sn), and Cadmium (Cd). Then, the melting point of the resulting alloys can be influenced by different components and proportions. Interestingly, gallium-based binary and ternary alloys may have melting points that are even lower than those of the element itself [
26
]. For example, Galinstan, which is composed of 68.5% Ga, 21.5% In, and 10% Sn, melts at a low temperature of 13.2 °C and the eutectic gallium–indium alloy (EGaIn), which typically has a composition of 78.6% Ga and 21.4% In, melts at 15.4 °C.
For stretchable electronics applications, the wettability of LM is the main factor for processing possibility and feasibility on stretchable substrates. The wettability is dominantly dependent upon the viscosity and surface tension. The excellent fluidity of LM comes from its low viscosity property (1.37 × 10
−3
Pa·S for EGaIn), which is merely twice larger than that of water [
27
]. Due to the high surface tension of LM (620 mN/m), LM droplets, unfortunately, have a high contact angle with a substrate and tend to be in a spherical state on the platform. Collin Ladd and colleagues demonstrate that it is possible to direct-write a low-viscosity liquid metal at room temperature into a stable free-standing 3D array of droplets by utilizing the features of low viscosity and substantial surface tension (
Figure 2
B) [
29
]. The microstructure of LM was stabilized by a thin passivating oxide coating that formed on its surface immediately.
LM shows similar electrical conductivity performance to other pure rigid metals. The electrical conductivity, the ability to conduct electric current, of LM is 3–6 × 10 6 S/m, which is much larger than non-metallic conductive materials such as carbon-based materials, conductive paste, and conductive grease [ 17 ]. The highly conductive LM guarantees low and steady electrical resistance when working as an interconnector and circuit. Liquid metal can be injected or blended into hollow fibers and prepolymers to enable the mass production of conductors with robust stretchability and negligible stress–strain cyclic hysteresis [ 39 , 40 ]. The conductivity at the maximum strain of various stretchable conductors is compared in Figure 2 C, where LM is located in the upper-right area that means a combination of excellent conductivity and stretchability [ 36 ].
Thermal conductivity is another important physical property of LMs. The thermal conductivity of pure Ga is 33.68 W/m·K in liquid form and 33.49 W/m·K in solid form, which is 56 times higher than that of water (0.6 W/m·K) [
37
]. Due to the decreased phonon transport dynamics, the elastomer’s thermal conductivity often decreases as it softens. As a result, there is a trade-off between elastic modulus and thermal conductivity. This dilemma can be solved by using LMs for thermal transport thanks to their high thermal conductivity (26.4 W/m·K at 30 °C) and liquidity. Based on this superiority, a series of thermal conductive composites were developed via elastomers mixed with LMs [
41
]. The resulting composites greatly outperformed any other soft materials with an amazing combination of low stiffness (100 kPa), high strain limit (>600%), and metal-like thermal conductivity (up to 9.8 W/m K) (
Figure 2
D). Moreover, the thermal conductivity of LMs or low melting points of alloys have been demonstrated to be further improved by the inclusion of nanoparticles with superior thermal conductivity, and the thermal conductivity of nanofluids rises with increasing nanoparticle content. As a result, LMs have received a lot of interest in fields such as thermal interface materials, heat dissipation chips, and, particularly, in fields of high-power sectors.
2.2. Chemical Properties
Pure LMs typically possess original smooth surfaces. However, once exposed to air due to oxidation, the surface of LMs spontaneously produce a solid oxide film, which substantially alters their surface behavior. A schematic illustration of the structure of an LM is shown in Figure 3 A [ 42 ]. In ambient conditions, the LM always presents a core-shell structure. The shell is a gallium oxidation layer (Ga 2 O 3 ) that protects the inner bulk LM core [ 43 ]. Liu’s team has demonstrated that the GaIn 10 -based liquid metal ink can generate outstanding wettability with nearly any desired materials, including epoxy resin board, glass, plastic, silica gel plate, paper, cotton, fabric, and more materials that have various levels of surface roughness [ 44 ]. Previous investigations have demonstrated that the amphoteric oxide layer on liquid metal particles could be eliminated in an acidic or alkaline solution. Guo et al. discovered that the EGaIn adhered to the polymethacrylates (PMA) glue could be removed with an HCl solution through this chemical reaction ( Figure 3 B) [ 45 ]. Additionally, the chemical connection between the PMA glue and EGaIn could be destroyed with the HCl solution in addition to removing the oxide layer. Furthermore, electrochemistry can also be used to reduce liquid metal oxides. As seen in Figure 3 C, the oxide skin stabilizes the structure of an LM puddle dissolved in the electrolyte; however, when the metal is subjected to a reductive potential, the oxide is removed, and the metal beads up due to its high surface tension [ 46 ].
The LM’s chemical, interfacial, and rheological properties are greatly impacted by the solid structure of the oxide layer, which also adds more binding sites for functionalization. Strong forces between thiol and gallium caused the LM nanoparticles to lose some of their thick gallium oxide shells, which allowed for the exceptionally uniform dispersion of liquid metals in a bulk matrix ( Figure 3 D) [ 47 ]. Interestingly, the liquid-metal-embedded sulfur polymer exhibited amazing electrical conductivity even at low volume percentages of LM due to the uniform dispersion. Similar research has shown that ultrasonic hydrogen doping in the presence of a radical initiator causes the oxide skin to become highly conductive and flexible ( Figure 3 E) [ 48 ]. In addition, Ga can be alloyed with different metals. A new type of stretchable electronic conductors made of biphasic solid–liquid thin metal films was developed by Arthur Hirsch et al. [ 49 ]. The intermetallic compound AuGa 2 was created when the gold film was entirely alloyed with the evaporated gallium, as seen in Figure 3 F. After that, a heterogeneous film made of clusters of the solid intermetallic alloy AuGa 2 and supercool liquid gallium was produced on the surface of the AuGa 2 after the thermal evaporation of the liquid gallium. Additionally, the liquid metal alloy EGaIn or Galinstan and aluminum (Al) still exhibited the Rehbinder effect ( Figure 3 G) [ 50 ]. Al was securely adhered to the EGaIn because Al is susceptible to amalgamation with EGaIn. Al can be penetrated by EGaIn or Galinstan by removing the oxide skin of Al, which would further induce the redox reaction of Al in NaOH solution.
The surface oxidation layer is a naturally occurring two-dimensional (2D) material, and the capacity of liquid metals to catalyze reactions as well as the surface layering property both offer novel ways to create 2D materials. Figure 3 H illustrates the transfer of the oxide skins (2D In 2 O 3 ) from a molten indium metal droplet to the surface of 300 nm SiO 2 silicon wafers. Then, in a solution of polysulfide radical anions, 2D In 2 O 3 is converted into 2D In 2 O 3 -xSx. Sulfur atoms take the place of oxygen atoms during the process. In addition, the LM can also offer an active catalytic reaction platform. To facilitate the LiPS’s redox process, Qi et al. presented a unique dynamic electrocatalytic method using the liquid metal ( Figure 3 I) [ 51 ]. The major active catalytic core was made of Sn atoms that were dynamically dispersed throughout the liquid Ga matrix. Ga offers a particularly active environment, nevertheless, to preserve the long-term integrity of the catalytic system. By this mechanism, liquid-phase binary alloys show more options for use as electrocatalysts in high-specific-energy Li-S batteries. Additionally, green carbon capture and conversion can be achieved by employing LM mixed with Ga and the resilient intermetallic Ag-Ga structures ( Figure 3 J) [ 52 ]. A closed cyclic catalytic system was established to convert CO 2 into solid carbon with an efficiency of 92%.
Figure 3. The fundamental chemical properties of LMs. ( A ) Illustration of the architecture of the oxidized liquid metal particle [ 42 ]. Copyright: (2014) American Chemical Society. ( B ) The schematic diagram of the liquid metal removed with HCL solution [ 45 ]. Copyright: (2018) WILEY-VCH. ( C ) Application of a reductive potential to the liquid metal removes the oxide [ 46 ]. Copyright: (2015) WILEY-VCH. ( D ) Scheme of the surface interactions between LM droplets with polysulfide loops (R-Sn-R) and thiol terminal groups (R-SH), and cross-sectional scanning electron microscope (SEM) image of the liquid-metal-embedded sulfur polymer [ 47 ]. Copyright: (2019) WILEY-VCH. ( E ) The process of hydrogen doping introduced by ultrasonication [ 48 ]. Copyright: (2021) Springer Nature. ( F ) Growth of biphasic gold–gallium thin films on a PDMS membrane [ 49 ]. Copyright: (2016) WILEY-VCH. ( G ) The Rehbinder effect between liquid metal alloy EGaIn or Galinstan and aluminum [ 50 ]. Copyright: (2015) WILEY-VCH. ( H ) Synthesis of 2D indium oxysulfide [ 53 ]. Copyright: (2021) The Royal Society of Chemistry. ( I ) Schematic illustration of the catalytic strategies using dynamic liquid metal electrocatalysts [ 51 ]. Copyright: (2022) WILEY-VCH. ( J ) Schematic illustration of the CO 2 conversion process. The formation/detachment of the carbon flakes and the generation/escape of O 2 are indicated [ 52 ]. Copyright: (2022) WILEY-VCH.
Figure 3. The fundamental chemical properties of LMs. ( A ) Illustration of the architecture of the oxidized liquid metal particle [ 42 ]. Copyright: (2014) American Chemical Society. ( B ) The schematic diagram of the liquid metal removed with HCL solution [ 45 ]. Copyright: (2018) WILEY-VCH. ( C ) Application of a reductive potential to the liquid metal removes the oxide [ 46 ]. Copyright: (2015) WILEY-VCH. ( D ) Scheme of the surface interactions between LM droplets with polysulfide loops (R-Sn-R) and thiol terminal groups (R-SH), and cross-sectional scanning electron microscope (SEM) image of the liquid-metal-embedded sulfur polymer [ 47 ]. Copyright: (2019) WILEY-VCH. ( E ) The process of hydrogen doping introduced by ultrasonication [ 48 ]. Copyright: (2021) Springer Nature. ( F ) Growth of biphasic gold–gallium thin films on a PDMS membrane [ 49 ]. Copyright: (2016) WILEY-VCH. ( G ) The Rehbinder effect between liquid metal alloy EGaIn or Galinstan and aluminum [ 50 ]. Copyright: (2015) WILEY-VCH. ( H ) Synthesis of 2D indium oxysulfide [ 53 ]. Copyright: (2021) The Royal Society of Chemistry. ( I ) Schematic illustration of the catalytic strategies using dynamic liquid metal electrocatalysts [ 51 ]. Copyright: (2022) WILEY-VCH. ( J ) Schematic illustration of the CO 2 conversion process. The formation/detachment of the carbon flakes and the generation/escape of O 2 are indicated [ 52 ]. Copyright: (2022) WILEY-VCH.
2.3. Biocompatibility
Due to their high biocompatibility, typical low-melting alloys that contain Ga, In, Sn, and Bi elements have been used in a variety of biomedical and health technologies [ 54 ]. Among them, Ga and its compounds are attracting the most attention for research and clinical applications in the medical field [ 55 ]. The Ga-based electronics exhibited less tissue inflammation in the brain and ultra-softness on the skin in [ 56 ]. The low cytotoxicity of LM-based materials was verified by culturing L-929 cells for 3 days ( Figure 4 A) in [ 57 ]. The quantification of the live/dead-stained cells showed a high viability of almost 95%, and after a 3-day culturing, the absorption at 570 nm in the MTT assay increased obviously, which shows the feasibility of LM-based materials for biomedical uses. The biocompatibility of LM can be further enhanced by applying an alginate coating to delay the formation and release of harmful cations [ 58 ]. To verify the cytocompatibility and biocompatibility of LM, a 14-day in vitro experiment was conducted in [ 59 ]. The fluorescent images of the primary hippocampal neurons at 14 days and the live/dead labeling of hippocampal neurons at 7 days in vitro both further confirm the biocompatibility of LM ( Figure 4 B). In addition, biocompatibility was demonstrated by in vivo tests. A new liquid-metal-based nanoscale formulation for drug delivery to promote improved anticancer therapy was also disclosed by Lu et al. [ 60 ]. A necropsy on the mice was conducted, which noted that there was no obvious organ damage due to applying the LM ( Figure 4 C). No visible tissue damage was seen in tissues from the heart, brain, and muscle as well. As a result, the LM-NP/L showed no clear toxicity at the treatment dose, which was very positive for the use of LM-NP/L as a nanomedicine.
3. Fabrication Strategies of LMs for Epidermal Health Monitoring
As new-generation functional materials, low-melting liquid metal preparations are becoming increasingly significant. For stretchable electronics, liquid metals or their alloys provide a superior alternative for conductive and functional components due to their high conductivity and excellent fluidity. The high surface tension of alloys and their poor wettability with many substrates severely restrict the patterning of LMs, and for the mass production of LM-based electronics, there are still a lot of problems that need to be overcome, especially in the most-adopted printing technology. To create acceptable functional materials based on gallium or its alloys, numerous techniques have been developed, including microfluidics, surface modification, lowering surface tension via the additions of metals or elastomer materials, and printing. The application range of the low-melting liquid metals has been further enlarged to accommodate varied needs thanks to these technologies, which have not only allowed for the modification of their physical properties but also introduced a variety of new functionalities. This chapter summarizes the fabrication methods of functional LM materials for stretchable electronics.
3.1. Conductive Composites with Pure LM
Printing or injecting pure LM into a channel with a certain shape to create a functional circuit is a common technique for creating liquid metal microfluidic electronics. The atomically thin layer of liquid metal oxides exposed in the air can support a maximum surface stress of 0.5–0.6 N/m [ 61 ]. Boley et al. demonstrated a liquid metal alloy direct writing technology for making stretchy electronics on a small scale ( Figure 5 A) [ 62 ]. The liquid metal sticks to the flexible substrate due to the great adhesion of the oxide layer. The high surface tension of liquid metal restricts the resolution of the patterns to about 100 µm, even though this method validates the viability of one-step liquid metal patterning. By injecting Galinstan into perfluoroalkoxy alkane tubing, Lin and his team proved how to create liquid metal fibers that had excellent electrical and mechanical properties ( Figure 5 B) [ 63 ]. Then, by digitally embroidering the liquid metal threads into garments, electronic textile systems with near-field wireless power and communication capabilities were constructed. The article demonstrated the fabrics’ resistance to wear and tear even after being put through numerous washing and drying cycles as well as repeated stress and strain operations.
LM microchannels can be created in two-dimensional platforms by injecting liquid metal into prefabricated channels. Dickey et al. discovered that EGaIn presents the properties of elastic materials until applied with ~0.5 N/m surface stress, at which point the EGaIn can be pressed quickly (within 1s) to fill the channels. For microfluidic channels, a larger critical surface stress would be required, i.e., ~0.6 N/m, which is remarkably similar to the surface tension of EGaIn [ 61 ]. Figure 5 C shows a vacuum-driven approach for filling a PVA microchannel with LM [ 64 ]. This method involves drilling two outlets at the microchannel’s ends, closing the holes with deposited LM droplets, and then degassing the entire apparatus. Due to the negative pressure that is created when the device is exposed to the atmosphere between the sealed microchannel and the environment, LMs are pumped into the PVA microchannel. As a result, it is easy to create transient circuits using LMs as the electronic circuit and PVA as the packaging material. Similar to this, Galinstan was injected into premade PDMS microchannels to create a wearable diaphragm pressure sensor [ 65 ]. It is worth noting that the removal of LM from the microchannels is difficult due to the adhesion of the oxide. By applying a reductive potential to the LM in the electrolyte, the capillary action can be reduced (also called “recapillarity”) with the removal of the surface oxide on LM [ 66 ] ( Figure 5 D). Then, the LM can withdraw in the direction of the cathode. In this way, the control of the capillary behavior of LM can be applied to the pumping of flow motion in the microchannel [ 67 ].
Figure 5. The fabrication strategies of conductive circuits with pure LM. ( A ) The direct writing system and the high-resolution wires directly written with LM [ 62 ]. Copyright: (2014) WILEY-VCH. ( B ) Illustration of the digital embroidery process using liquid metal fibers [ 63 ]. Copyright: (2022) Springer Nature. ( C ) Schematic illustration of the fabrication and recycling process of the room temperature LM-based PVA-encapsulated, recyclable, transient circuits [ 64 ]. Copyright: (2019) WILEY-VCH. ( D ) Schematic and photograph of the recapillarity-induced withdrawal of LM from microchannels [ 66 ]. Copyright: (2014) National Academy of Sciences.
Figure 5. The fabrication strategies of conductive circuits with pure LM. ( A ) The direct writing system and the high-resolution wires directly written with LM [ 62 ]. Copyright: (2014) WILEY-VCH. ( B ) Illustration of the digital embroidery process using liquid metal fibers [ 63 ]. Copyright: (2022) Springer Nature. ( C ) Schematic illustration of the fabrication and recycling process of the room temperature LM-based PVA-encapsulated, recyclable, transient circuits [ 64 ]. Copyright: (2019) WILEY-VCH. ( D ) Schematic and photograph of the recapillarity-induced withdrawal of LM from microchannels [ 66 ]. Copyright: (2014) National Academy of Sciences.
3.2. Strechable Composites with Micro- or Nano-Sized LM
Micro- and nano-sized LM droplets are fabricated to realize easier access to the application of LM [ 68 ]. The size of LM can be regulated by the fabrication methods, including inkjet directly, inkjet in solution, mechanical stirring, atomization process, ultrasonic treatment, thermal evaporation, etc. Monodisperse and spherical microdroplets with a diameter of roughly 3 mm were fabricated by extruding and rolling LM droplets on graphene sheets ( Figure 6 A) in [ 69 ]. An outer layer of densely packed graphene sheets was created because of the quick uptake of the graphene sheets by the LM droplets’ surface. Based on the concepts of flow injection and self-breakage, Yu and his collaborators present a procedure for injecting liquid metals into matching solutions to produce liquid metal microparticles with a diameter of ~300 μm ( Figure 6 B) [ 70 ]. A lot of liquid metal droplets are immediately created as the plunger is pressed. This results from a balance between the surrounding solution’s shear force and the liquid metal’s surface tension. This study paves the way for the mass production of liquid metal microdroplets and particles in a very straightforward manner.
Simple mechanical stirring or blending with other functional materials can likewise distribute liquid metal bulks into liquid metal micro–nano droplets. Low melting point metal alloys are mechanically stirred under fluid flow to produce tiny particles ( Figure 6 C) [ 42 ]. By vigorously swirling, the oxide layer can be broken, allowing more and more metals to oxidize, creating a uniformly spread mixture of the liquid metal and its oxide. By shearing in an acidic liquid medium, they were able to create smooth liquid core–shell particles ranging in size from 6.4 nm to over 10 µm.
The atomization of LM enables its applications in patterning on multi-substrates via spray deposition. Figure 6 D illustrates the production steps of an atomization-patterning liquid alloy both for liquid alloy patterning and further rigid components’ hybrid integration [ 71 ]. This is also a universal fabrication approach for producing high-quality patterns of LM with improved shape definition. In cases of physical vapor deposition, Galinstan can be transited from the condensed phase (Galinstan bulk liquid) to the vapor phase (Ga, In, and Sn atoms) and then back to a thin condensed film on the targeted objects [ 72 ]. Li and colleagues effectively created LM particle films using secondary thermal evaporation without reducing the surface tension in addition to managing the behavior of liquid metals with microchannels ( Figure 6 E) [ 72 ]. After being exposed to air to generate an oxide layer, the sample of liquid metal with one layer is once more coated with LM. On top of the oxide layer, the second layer of LM e-cells is created to realize the conductivity of the LM-based line.
In addition, a straightforward ultrasonication method in the presence of organic solvents may be used to turn LM into nanoparticles to produce numerous functionalities. The walls of a Petri dish are struck by LM during the process of ultrasound. This dispersion is mostly caused by the considerable energy that the LM gained during the collision with the wall. When the surface tension of LM is unable to contain the energy, the LM droplets break down into smaller nanoparticles to decrease the energy. Most of this ultrasonic dispersion occurs in liquid environments where emulsifiers are present. As seen in Figure 6 F [ 73 ], cavitation is created by applying an ultrasonic probe to a mixture of liquid metal bulks, thiols, and ethanol. This causes localized extremes in pressure and temperature to occur within a very short amount of time. Under the influence of oscillating shear force, the LM body that was supported by the oxidation layer in this instance is quickly split into several LM nanoparticles. After this, the LM nanoparticles with the ultrasonic treatment could be composited into elastomers using electrospraying [ 74 ], air spraying [ 75 ], and so forth ( Figure 6 G,H).
In the meantime, the surface oxidation layer of LM serves as an ideal stage for the functionalization and polymerization of the LM nanoparticles [
76
]. Thiolated ligands can easily and robustly assemble on the surface of the developing LM nanoparticles [
77
]. Furthermore, the spherical LM nanoparticles are stable due to the defense provided by the thiolated ligands and the rapid oxidation of the surface. Additionally, it is simple to add certain functional radical groups to liquid metal nanoparticles and encapsulate them in a nanocapsule. As seen in
Figure 6
I, carboxylic acid-ended polydimethylsiloxane was used to modify the surface of EGaIn nanoparticles. It is possible to create dense EGaIn nanoparticles in a PDMS matrix with efficient thermal transfer by crosslinking with the surface-modified EGaIn nanoparticles. In addition, the dipole–dipole interactions between LM and elastomers were studied to enhance their electrical and mechanical stability [
78
]. A coaxial wet-spinning method was proposed to continuously create super-elastic EGaIn sheath–core microfibers with both high and ultra-stable conductance to address the issue of leakage of conductive materials in liquid metal fibers. The core of the microfiber is made of a combination of the same fluoroelastomer and percolated EGaIn nanoparticles, while the sheath is made of a double-network fluoroelastomer with excellent elasticity.
Figure 6. The fabrication strategies of LM-based conductive composites with size effect. ( A ) Schematic showing the generation process of graphene-coated liquid metal droplets [ 69 ]. Copyright: (2018) WILEY-VCH. ( B ) Device for injectable liquid metal droplets fabrication, and the inset image is the bottom view of liquid metal micro-droplets using a microscope [ 70 ]. Copyright: (2014) WILEY-VCH. ( C ) Schematic illustration of the SLICE process showing transformation of EGaIn into micro- and nanoparticles [ 42 ]. Copyright: (2014) American Chemical Society. ( D ) Manufacturing processes for liquid alloy microfluidic wireless power transfer [ 71 ]. Copyright: (2015) Springer Nature. ( E ) Thermal deposition process of liquid metal for liquid metal particle film and characterizations of liquid metal particle films under different preparation conditions [ 72 ]. ( F ) Schematic illustration of the preparation route for liquid metal nanodroplets [ 73 ]. Copyright: (2016) WILEY-VCH. ( G ) Schematic of electrospray of LM nanoparticles [ 74 ]. Copyright: (2022) WILEY-VCH. ( H ) Schematic illustration of air spray printing of LM slurry [ 75 ]. Copyright: (2017) WILEY-VCH. ( I ) Schematic illustration of the preparation of the surface-modified EGaIn nanoparticle elastomer [ 77 ]. Copyright: (2021) WILEY-VCH.
Figure 6. The fabrication strategies of LM-based conductive composites with size effect. ( A ) Schematic showing the generation process of graphene-coated liquid metal droplets [ 69 ]. Copyright: (2018) WILEY-VCH. ( B ) Device for injectable liquid metal droplets fabrication, and the inset image is the bottom view of liquid metal micro-droplets using a microscope [ 70 ]. Copyright: (2014) WILEY-VCH. ( C ) Schematic illustration of the SLICE process showing transformation of EGaIn into micro- and nanoparticles [ 42 ]. Copyright: (2014) American Chemical Society. ( D ) Manufacturing processes for liquid alloy microfluidic wireless power transfer [ 71 ]. Copyright: (2015) Springer Nature. ( E ) Thermal deposition process of liquid metal for liquid metal particle film and characterizations of liquid metal particle films under different preparation conditions [ 72 ]. ( F ) Schematic illustration of the preparation route for liquid metal nanodroplets [ 73 ]. Copyright: (2016) WILEY-VCH. ( G ) Schematic of electrospray of LM nanoparticles [ 74 ]. Copyright: (2022) WILEY-VCH. ( H ) Schematic illustration of air spray printing of LM slurry [ 75 ]. Copyright: (2017) WILEY-VCH. ( I ) Schematic illustration of the preparation of the surface-modified EGaIn nanoparticle elastomer [ 77 ]. Copyright: (2021) WILEY-VCH.
3.3. Surface Tension Reduction through the Mixture
The high surface tension of LM can be reduced through a mixture of elastomers or other metal particles. The final composites would possess high viscosity that facilitates the processability of LM-based conductive networks. On the one hand, an elastic conductor with good conductivity and stretchability is created using highly conductive and flexibly deformable LM fillers. LM can be blended directly with polymers in addition to combining with metal to create elastic conductors. Galinstan and PDMS were combined and stirred to create an LM-based composite elastic conductor with a 3D-Calabash Bunch conductive network structure, as shown in Figure 7 A [ 32 ]. Based on this kind of LM-based elastomer, conductive circuits can be fabricated by using a variety of techniques, including stamp printing [ 79 ], inkjet printing [ 80 ], etc. In [ 79 ], a nanoclay was introduced into an LM system to prepare a low-fluid and highly adhesive composite. The nanoclay clumps were gradually wrapped with the Ga 2 O 3 layer and distributed in the LM ( Figure 7 B). This composite was also an ideal direct-printable ink for in situ fast stamp patterning. In addition, Wang et al. demonstrated that increasing the proportion of liquid metal in printing ink can result in a printing method with excellent resolution ( Figure 7 C) [ 81 ]. The cause is that as the LM filling fraction rises, internal friction between these two liquid phases develops and works against the flow of the [email protected] composite.
In some cases, mechanical stress was required to induce the rupture of LM particles and form conductive networks. The relationship between the LM particles and different elastomers was systematically studied in [
82
]. Zhou et al. showed that LM–silicone ink, a concentrated mixture of LM microdroplets and silicone elastomer, demonstrates originally electrically isolated but outstanding printability with excellent resolution for direct printing (
Figure 7
D) [
83
]. Despite it being originally nonconductive, LM–silicone can be made conductive through pressing or freezing. The activated composite would possess excellent conductivity and a significant electrical response to strain.
LM mixtures that are fabricated via the addition of other rigid metal particles, such as copper, gold, silver, and nickel (Ni), exhibit low viscosity and are easily processible as well [ 84 ]. Further to this, the addition of nickel or iron can further introduce the magnetic properties that enable the precise control of LM wire, high-resolution patterns, remote self-healing circuits, etc. [ 26 ]. The Ni particles would be wrapped with a Ga 2 O 3 layer as they are mixed with the EGaIn, as in [ 85 ] ( Figure 7 E). This mixing process would accelerate the oxidation of LM and finally lower the surface tension of LM. LM-based stretchable coils and circuits can be fabricated by directly screen printing of LM on Ecoflex. In addition, the high-resolution of LM patterns was developed by introducing magnetic microparticles into the LM in [ 86 ] ( Figure 7 F). A shadow mask was applied onto the targeted hydrogel, under which a magnet was used for attracting and aggregating the magnetic microparticle-doped LM onto the shadow mask. The proposed LM-based circuit would be fabricated with the removal of the shadow mask. The combination of LM, elastomer, and rigid metal particles was developed to realize a multifunctional composite. A liquid-metal-filled magnetorheological PDMS with iron microparticles and LM is reported in [ 82 ] ( Figure 7 G). This composite achieved a novel positive piezoconductive effect that decreases the electrical resistance dramatically upon any deformations, presenting promising potentials for flexible sensors and responsive thermal interfaces.
It is challenging to combine printing since the melting points of conductive metal and non-conductive ink in conventional 3D printing differ by hundreds or even thousands of degrees Celsius at the same time. The current 3D printing of high melting point metal has stringent requirements for processing conditions and the associated machinery. The drag adhesion effect of a liquid metal with a low melting point can compensate for this. The viability of printing and assembling functional devices by using low-melting LM inks was proved completely in [
87
]. The necessary material and processing for stretchable 3D interconnections on soft substrates with high resolutions are then introduced by Park et al. (
Figure 7
H) [
88
]. By adding carbon nanotubes to the liquid metal, the low mechanical strength of the liquid metal is overcome, improving the mechanical strength of the composite. The minimal diameters for the composites, which can be 3D printed, are around 5 μm.
Figure 7. The surface tension reduction of LM via mixture. ( A ) Scanning electron microscope (SEM) cross-sectional view of the prepared LM-based composite elastic conductor with the desired 3D-Calabash Bunch conductive network structure in PDMS matrix [ 32 ]. Copyright: (2018) WILEY-VCH. ( B ) Schematic and the cross-sectional SEM of conductive nanoclay (scale bar: 20 mm) [ 79 ]. Copyright: (2021) The Royal Society of Chemistry. ( C ) Schematic depiction of the fabrication process for creating [email protected] stretchable, wearable electrically driven heaters [ 80 ]. Copyright: (2019) WILEY-VCH. ( D ) Activation of the printed electrical route through pressing and freezing [ 83 ]. Copyright: (2019) WILEY-VCH. ( E ) Schematic of Ni-GaIn amalgam, and the digital photograph for screen printing by a rolling brush [ 85 ]. Copyright: (2018) WILEY-VCH. ( F ) Schematic of high-resolution patterning of magnetic microparticle-doped LM via magnetic field control [ 86 ]. Copyright: (2019) WILEY-VCH. ( G ) Production of the liquid metal-filled magnetorheological elastomer [ 89 ]. Copyright: (2019) Springer Nature. ( H ) Schematic of the 3D direct printing system of CNT/LM composites (left), and the SEM images of 3D-printed CNT/LM composites [ 88 ]. Scale bars, 100 μm. Copyright: (2019) American Chemical Society.
Figure 7. The surface tension reduction of LM via mixture. ( A ) Scanning electron microscope (SEM) cross-sectional view of the prepared LM-based composite elastic conductor with the desired 3D-Calabash Bunch conductive network structure in PDMS matrix [ 32 ]. Copyright: (2018) WILEY-VCH. ( B ) Schematic and the cross-sectional SEM of conductive nanoclay (scale bar: 20 mm) [ 79 ]. Copyright: (2021) The Royal Society of Chemistry. ( C ) Schematic depiction of the fabrication process for creating [email protected] stretchable, wearable electrically driven heaters [ 80 ]. Copyright: (2019) WILEY-VCH. ( D ) Activation of the printed electrical route through pressing and freezing [ 83 ]. Copyright: (2019) WILEY-VCH. ( E ) Schematic of Ni-GaIn amalgam, and the digital photograph for screen printing by a rolling brush [ 85 ]. Copyright: (2018) WILEY-VCH. ( F ) Schematic of high-resolution patterning of magnetic microparticle-doped LM via magnetic field control [ 86 ]. Copyright: (2019) WILEY-VCH. ( G ) Production of the liquid metal-filled magnetorheological elastomer [ 89 ]. Copyright: (2019) Springer Nature. ( H ) Schematic of the 3D direct printing system of CNT/LM composites (left), and the SEM images of 3D-printed CNT/LM composites [ 88 ]. Scale bars, 100 μm. Copyright: (2019) American Chemical Society.
3.4. LM–Elastomer Interface Enhancements
The high surface tension of LM makes it difficult to spread onto elastomer surfaces. The interfacial interactions between LM and elastomer have attracted huge attention recently due to the requirement for more stable electrical components. Main strategies have been developed for the enhancement of LM–elastomer interface interactions, i.e., hydrogen bond introduction, self-adaptable scaffold, and alloying process introduction.
Hydroxyl groups’ (−OH) introduction is the key to enabling the interactions with the Ga
2
O
3
layer outside the LM [
90
]. Hydrogels provide numerous hydroxyl groups associated with water and also control the stretchability of a hydrogel [
91
] (
Figure 8
A). The LM can be directly spread onto the chemically cross-linked hydrogel and patterned into various electrodes and circuits. An autonomous surface reconciliation of LM was observed on the hydrogel surface even at a stain of 1500%. The ultra-low electrical resistance and resistance variation of LM on hydrogel verified its potentials in microelectronics. In addition, polymethacrylate (PMA) is another polymer that shows an excellent affinity for LM due to the hydrogen bonding between the aliphatic groups of PMA and the Ga
2
O
3
oxidation layer (
Figure 8
B). Underlaying with polyurethane (PU), LM conductive fibers were fabricated for stretchable conductors and wearable sensors.
The structure design of LM–elastomer interfaces is another strategy for enhanced interactions. The mechanism lies in the formation of the Laplace capillary force around each microvoid of elastomer scaffolds ( Figure 8 C) [ 74 ]. This force would attract the LM film and achieve a mechanical balance upon the gravitational force. The superiority of this strategy is based on the structure design without other material modifications. As a result, a highly adaptable interface would be constructed for robust electrical performance under dynamic deformations. A similar phenomenon can be observed in the [email protected] structure and [email protected] structure [ 57 , 92 ].
A room-temperature interfacial alloying process occurred as an LM contacted other metals such as Au and Ag. The new compositions of AuGa 2 clusters, AgNP-Ga-In clusters and the supercool LM surrounding them were fabricated correspondingly in [ 49 , 93 ]. This alloying process overcomes the cohesive forces by allowing LM to diffuse and form a continuous conductive film, which further enables the high-resolution fabrication of electronic tattoos, 3D hydrographic transfer films, etc. A sub-micron-scale and all-soft LM-based electrode was developed by applying the hybrid lithography process in [ 94 ]. Between the LM and PMMA, a deposited Ti/Au layer was fabricated to enhance the adhesion and wetting characteristics of LM ( Figure 8 D). The overall electronic devices can be encapsulated with a size of only 3 mm × 3 mm on the fingernail. In addition, the alloying of LM is further exemplified by the interaction between copper (Cu) and LM. Compared with the LM on pure SEBS, the contact angle of LM on Cu decreased to 30° from 130° to verify the enhanced wettability through an interfacial alloying reaction in [ 95 ]. Thus, the LM line resolution could be reduced to ~50 μm. The Cu pattern could be selectively patterned with LM and construct a 4 × 4 electrodes array for conformal attachments to internal organs and a walnut with a complex surface morphology.
Figure 8. Enhancement strategies for LM–elastomer interfaces. ( A ) Schematic of the interactions between Ga2O3 layer with -OH groups on hydrogel upon stretching [ 91 ]. Copyright: (2020) Wiley-VCH. ( B ) Schematic and cross-section SEM of PPE fiber coated with PMA and LM [ 96 ]. Copyright: (2020) American Chemical Society. ( C ) Schematic of LM-nanofiber scaffold interface under stretching [ 74 ]. Copyright: (2022) Wiley-VCH. ( D ) Micro-morphologies of patterned Au ( left top ) and EGaIn on Au ( left bottom ). Scale bar: 40 μm. The encapsulation of the EGaIn structures on a fingertip [ 94 ]. Copyright: (2020) Springer Nature. ( E ) Optical microscopy images of the LM line array ( left ) with contact angle images of the LM on SEBS and copper ( left inset ), and digital photography of the conformal attachment of an LM-based electrode array [ 95 ]. Copyright: (2022) AAAS.
Figure 8. Enhancement strategies for LM–elastomer interfaces. ( A ) Schematic of the interactions between Ga2O3 layer with -OH groups on hydrogel upon stretching [ 91 ]. Copyright: (2020) Wiley-VCH. ( B ) Schematic and cross-section SEM of PPE fiber coated with PMA and LM [ 96 ]. Copyright: (2020) American Chemical Society. ( C ) Schematic of LM-nanofiber scaffold interface under stretching [ 74 ]. Copyright: (2022) Wiley-VCH. ( D ) Micro-morphologies of patterned Au ( left top ) and EGaIn on Au ( left bottom ). Scale bar: 40 μm. The encapsulation of the EGaIn structures on a fingertip [ 94 ]. Copyright: (2020) Springer Nature. ( E ) Optical microscopy images of the LM line array ( left ) with contact angle images of the LM on SEBS and copper ( left inset ), and digital photography of the conformal attachment of an LM-based electrode array [ 95 ]. Copyright: (2022) AAAS.
4. Applications
4.1. Electrode for Biomedical Signal Collections
The intrinsic function of LM-based materials for epidermal healthcare is conduction, through which devices can collect physiological signals based on electrical potential differences and serve as conductive wires for the connection of various sensors [ 91 ]. ECG is a painless and non-invasive strategy for individual heart performance and a standard process in modern cardiovascular medicine [ 97 ], using electrodes on the skin to monitor the electrical changes of the cardiac muscle depolarization and repolarization during the cardiac cycle (commonly known as the heartbeat). An LM electrode was directly attached to the human epidermis for reliable ECG data collection ( Figure 9 A). Due to the superelasticity of LM, the low-noise ECG signals were maintained robust when the electrode was stretched or compressed, which was unachievable for commercial electrode patches [ 57 ]. For a large area of electrical circuits, a 12-lead ECG circuit was printed on a knitted T-shirt for cardiac activity monitoring ( Figure 9 B). The LM circuits enable stable ECG signal collection during sitting, lying, and walking. In addition, the R-R intervals under sleeping conditions were calculated and plotted through the Lorenz strategy to diagnose the health condition of the volunteer.
In addition to ECG monitoring, LM-based electrodes can be applied in EMG and EEG signal collection. An electronic tattoo was demonstrated with Ag-In-Ga trances that present high conductivity and conformability to nondevelopable 3D surfaces (
Figure 9
C) in [
98
]. This tattoo can be easily placed over a human forearm by hydroprinting to collect EMG signals, which can be subsequently applied as a human–machine interaction to control a robot hand prosthetic. In addition, precise EEG recording is always a challenge due to its weak signal. A kirigami-structured LM paper that is conductor-exposing and ultrathin was fabricated and attached to a human forehead for real-time EEG signal recording (
Figure 9
D) in [
99
]. Three different frequency bands of EEG in three mental states were differentiated with fast Fourier transform, i.e., beta wave (~24 Hz), alpha wave (~12 Hz), and delta wave (~24 Hz) for thinking, closing eyes, and sleeping, respectively.
Figure 9.
The LM-based electrode for real-time physiological signal collection. (
A
) Schematic illustration of LM-based monolithic stretchable electronics in which the top layer is the electrode for ECG monitoring [
57
]. Copyright: (2021) Springer Nature. (
B
) Image of LM-based 12-lead ECG monitoring system on a knitted T-shirt (
left
) and the Lorenz plot of ECG under the sleeping condition of the volunteer [
100
]. Copyright: (2022) American Chemical Society. (
C
) The LM electronic tattoo for EMG signal acquisition on a forearm (
left
) and capacitive sensor mesh on a 3D hand model. Copyright: (2018) American Chemical Society [
98
]. (
D
) Schematic diagram of the real-time EEG recording in the mental state of sleeping, and the frequency distribution of EEG with fast Fourier transform [
99
]. Copyright: (2022) American Chemical Society.
Figure 9. The LM-based electrode for real-time physiological signal collection. ( A ) Schematic illustration of LM-based monolithic stretchable electronics in which the top layer is the electrode for ECG monitoring [ 57 ]. Copyright: (2021) Springer Nature. ( B ) Image of LM-based 12-lead ECG monitoring system on a knitted T-shirt ( left ) and the Lorenz plot of ECG under the sleeping condition of the volunteer [ 100 ]. Copyright: (2022) American Chemical Society. ( C ) The LM electronic tattoo for EMG signal acquisition on a forearm ( left ) and capacitive sensor mesh on a 3D hand model. Copyright: (2018) American Chemical Society [ 98 ]. ( D ) Schematic diagram of the real-time EEG recording in the mental state of sleeping, and the frequency distribution of EEG with fast Fourier transform [ 99 ]. Copyright: (2022) American Chemical Society.
4.2. Interconnectors for Functional Circuits
Serving as stretchable circuits and connectors, LM composites exhibit exceptional electrical robustness and high conductivity upon on-skin deformation, making them a potential candidate for a wearable biosensor. Skin-attachable biosensors are of significance for healthcare monitoring and disease diagnoses such as diabetes and rehabilitation [ 101 ]. Carbon nanotubes (CNTs) can form an electrostatic interaction with LM particles with the help of negatively charged polyelectrolytes (poly(sodium4-styrene sulfonate) (PSS)) ( Figure 10 A) [ 102 ]. Based on this, an intrinsic electrical conductivity was imposed for carbon nanotubes on LM particles (CMP) whilst coated on human skin. After functionalization with glucose oxidase, alcohol oxidase, and lactate oxidase, the CMP-based working electrode realized the measurement of glucose, ethanol, and lactate. Additionally, the respiratory activity monitoring of humans plays a critical role in non-invasive medicine. An LM electrode can be applied to an epidermal respiration sensor for monitoring the level of relative humidity and the concentration of NO gas exhaled by humans ( Figure 10 B) [ 103 ]. Through this, different respiratory patterns were distinguished based on the water amount and potential lung diseases (e.g., asthma) can be diagnosed timely.
Then, the LM-based circuit would facilitate multifunctional sensors when equipped with various rigid chips, e.g., real-time temperature monitoring, near-field communication (NFC)/radio frequency identification devices (RFID), and interconnectors with a PCB board. To reduce the surface tension and improve the wettability for more processibility, a nickel and EGaIn mixture was developed to be printed as an electronic tattoo on human skin (
Figure 10
C) in [
104
]. When connected with a temperature sensor chip, the Ni-EGaIn conductor could realize a stable conductivity upon the movement of the wrist and real-time temperature monitoring of the epidermal research area. Moreover, an LM-based wireless electronic tattoo that is sticky and intrinsically conductive was designed for a more complex device fabrication (
Figure 10
D) in [
105
]. The wrist movement monitoring device was realized through a microcontroller, resistance, Bluetooth, and a strain sensor that were connected with a sticky LM conductor (SLMC), which could form both electrical and mechanical connections once the rigid chipsets or soft tissues contacted it.
Moreover, an LM-fiber-based textile electronic system was designed for near-field powering and communication [ 64 ], where LM fibers worked as an NFC relay with an inductor and a thermal sensor embroidered into the textile underarm ( Figure 10 E) in [ 63 ]. The axillary temperature can be continuously and correctively monitored as compared with a thermometer with a range from 25 to 55 °C. It is worth noting that the data stream would stay stable even if the textile operated in a wet environment, thanks to the water-proof encapsulation of elastomer. In addition, another LM-based battery-free sensor was illustrated for the bedsore healthcare system ( Figure 10 F) in [ 106 ]. The fluidity and conductivity make it possible to form a 3D hemisphere-shaped wireless power transmission component to connect with a pressure-sensitive sensor for the identification of different heel laying positions on the different hardness of the floors. Additionally, with the NFC reader, continuous pressure measurements were collected stably due to the conductive robustness of LM under dynamic deformations.
Figure 10. The multifunctional epidermal healthcare biosensors that are enabled with LM-based conductors. ( A ) Schematic of Pt-decorated CNT-attached LM particles (CMP) for on-skin e-tattoo ( left ). The photograph of CMP-based biosensor for sweat chemistry [ 102 ]. Copyright: (2022) WILEY-VCH. ( B ) Schematic illustration of LM electrode-assisted gas sensor with SnS 2 ( left ). The sensitivity of gas sensors regarding NO gas concentrations [ 103 ]. Copyright: (2021) AAAS. ( C ) Schematic illustration of the structure of nickel–EGaIn conductive materials ( left ), and the photographs of the temperature monitoring circuit connected with LM conductors [ 104 ]. Copyright: (2019) WILEY-VCH. ( D ) Schematic of the structure of the intrinsically sticky LM conductor and photographs of its applications in stretchable conductive interfaces [ 105 ]. Copyright: (2022) WILEY-VCH. ( E ) Battery-free textile thermal monitoring system with LM fiber patterns for battery-free thermal monitoring and calibration of measured temperature with a commercial reference thermometer [ 63 ]. Copyright: (2022) Springer Nature. ( F ) Photographs of the LM-based heel-shaped wireless battery-free pressure sensor and pressure signals during various foot postures [ 106 ]. Copyright: (2021) AAAS.
Figure 10. The multifunctional epidermal healthcare biosensors that are enabled with LM-based conductors. ( A ) Schematic of Pt-decorated CNT-attached LM particles (CMP) for on-skin e-tattoo ( left ). The photograph of CMP-based biosensor for sweat chemistry [ 102 ]. Copyright: (2022) WILEY-VCH. ( B ) Schematic illustration of LM electrode-assisted gas sensor with SnS 2 ( left ). The sensitivity of gas sensors regarding NO gas concentrations [ 103 ]. Copyright: (2021) AAAS. ( C ) Schematic illustration of the structure of nickel–EGaIn conductive materials ( left ), and the photographs of the temperature monitoring circuit connected with LM conductors [ 104 ]. Copyright: (2019) WILEY-VCH. ( D ) Schematic of the structure of the intrinsically sticky LM conductor and photographs of its applications in stretchable conductive interfaces [ 105 ]. Copyright: (2022) WILEY-VCH. ( E ) Battery-free textile thermal monitoring system with LM fiber patterns for battery-free thermal monitoring and calibration of measured temperature with a commercial reference thermometer [ 63 ]. Copyright: (2022) Springer Nature. ( F ) Photographs of the LM-based heel-shaped wireless battery-free pressure sensor and pressure signals during various foot postures [ 106 ]. Copyright: (2021) AAAS.
4.3. Mechanical Sensors
Through the structure design of LM-based electronics, mechanical sensors can be fabricated based on the mechanisms of capacity, resistance, piezoelectricity, triboelectricity, etc. When fabricated as a capacitive sensor, LM could serve as the electrode with high conductivity or the diametric layer with a non-conductive and high-dielectric constant. An LM-based highly robust electrode was fabricated with electrospinning and electrospray, after which a capacitive sensor array, named an adaptive human–machine interactive system, was designed via the particle activation of the original composite ( Figure 11 A) in [ 74 ]. This array could be attached to the back of a hand to input commands to a computer. Additionally, this LM-based capacitive sensor remained functional even under stretching. This e-skin exhibits promising potentials for fabricating biocompatible epidermal pressure sensors for perception enhancement of burned skin. On the other hand, LM-based composites were developed for high-dielectric layers in a capacitive sensor. Through independently controllable LM droplet size and volume loading in elastomers, the dielectric constant can be coordinated and reach a high relative permittivity of 60, which is 16 times that of unfilled elastomers ( Figure 11 B). An all-soft capacitive sensor with tunable sensitivity was demonstrated for the gesture quantification of the proximal interphalangeal. In addition, the solid–liquid phase transition of the gallium microgranule-based dielectric layer could facilitate a wide range and high sensitivity of the sensors ( Figure 11 C) [ 35 ]. This temperature-dependent rigid-soft mode conversion provides a 97% lower minimum and 262% higher detectable pressure, compared with the detection range of human skin. As a result, subtle blood pulsation and body weight can be detected simultaneously.
Resistance-based sensors are also preferred for epidermal sensing among LM-based electronics [ 86 ]. The structure of LM strips is commonly applied to amplify resistance change as a function of strain or pressure. A hydrogel-based soft electrode via the stencil printing of LM presents a self-shaping ability that can actively deform into 3D configurations of objects, such as human fingers ( Figure 11 D) [ 107 ]. By simultaneously integrating eight sensing units (LM strips), the sensor could monitor the direction and amplitude of bending motion. In addition, it is possible to fabricate the strain sensor as a multi-layer structure for more potential applications. The mixture of LM microdroplets and silicone elastomer, named LM–silicone ink, was developed to produce stretchable electronics via direct ink writing ( Figure 11 E) [ 83 ]. A multilayer of a soft strain sensor was printed directly, possessing exceptional repeatability and ideal linearity. Another geometrical strain sensor, with a cylindrical shape, was printed and embedded in gloves to realize hand gesture recognition. Furthermore, the fundamental mechanism of the resistance increment upon pressure is based on the cross-section reduction in this process. A continuous conductive line could be patterned onto elastomer or other super-metallophobic substrates via magnetic field control on an LM and magnetic microparticle composite ( Figure 11 F) in [ 80 ]. Encapsulated by the biocompatible Ecoflex, this LM line could achieve a sensitivity of 0.37 kPa −1 and be used for the real-time measurement of carotid arterial pressures.
Figure 11. Epidermal mechanical sensors assisted by capacity and resistance. ( A ) Schematic illustration of LM electrode-based human–machine interactive system and photographs of on-skin pressure sensor array that shows potential for perception enhancement for burned skin [ 74 ]. Copyright: (2022) WILEY-VCH. ( B ) Schematic of LM dielectric layer for the capacitive sensor to evaluate strain deformations ( left ). The capacitance variation of grasping balls with different sizes [ 108 ]. Copyright: (2019) American Chemical Society. ( C ) Schematic illustration of the sensing mechanism for rigid and soft mode ( left ), and the optimal images for measurement of subtle pressure and large loads induced by carotid artery pulse and human weight, respectively [ 35 ]. Copyright: (2022) WILEY-VCH. ( D ) The photograph of the morphing process of the LM-based hydrogel sensor ( left ) and the schematic of it for bending and azimuth angle measurement of a rubber tube [ 107 ]. Copyright: (2021) WILEY-VCH. ( E ) Schematic of LM-based multilayer soft electronics [ 83 ]. Copyright: (2019) WILEY-VCH. ( F ) Schematic illustration of LM patterning operation step ( left ). The photograph and plot for the monitoring of carotid arterial pressure ( right ) [ 80 ]. Copyright: (2019) WILEY-VCH.
Figure 11. Epidermal mechanical sensors assisted by capacity and resistance. ( A ) Schematic illustration of LM electrode-based human–machine interactive system and photographs of on-skin pressure sensor array that shows potential for perception enhancement for burned skin [ 74 ]. Copyright: (2022) WILEY-VCH. ( B ) Schematic of LM dielectric layer for the capacitive sensor to evaluate strain deformations ( left ). The capacitance variation of grasping balls with different sizes [ 108 ]. Copyright: (2019) American Chemical Society. ( C ) Schematic illustration of the sensing mechanism for rigid and soft mode ( left ), and the optimal images for measurement of subtle pressure and large loads induced by carotid artery pulse and human weight, respectively [ 35 ]. Copyright: (2022) WILEY-VCH. ( D ) The photograph of the morphing process of the LM-based hydrogel sensor ( left ) and the schematic of it for bending and azimuth angle measurement of a rubber tube [ 107 ]. Copyright: (2021) WILEY-VCH. ( E ) Schematic of LM-based multilayer soft electronics [ 83 ]. Copyright: (2019) WILEY-VCH. ( F ) Schematic illustration of LM patterning operation step ( left ). The photograph and plot for the monitoring of carotid arterial pressure ( right ) [ 80 ]. Copyright: (2019) WILEY-VCH.
Mechanical sensors based on other mechanisms, such as electromagnetic induction, electrical induction, triboelectricity, and piezoconductivity, were also applied in flexible on-skin healthcare, where the LM mainly serves as a conductive element. A liquid metal spiral coil was developed to harvest electrical energy under a permanent magnetic field, forming a self-powered stretchable sensor (
Figure 12
A) in [
109
]. When it comes to mechanical deformation, the energy conversion occurs with an output of 2 mA short-circuit current based on Faraday’s law of electromagnetic induction. Hand trembles (e.g., of Parkinson’s disease) can be successfully detected in terms of amplitude and speed characteristics, which exhibits promising potentials in the real-time detection of hand tremors or deviant finger movements. Alternatively, electrical inductive sensors are based on the inductance variation in response to changes in geometric parameters. ecause induction is usually related to the length, diameter, and number of coils, a deformable conductive fiber that consists of hollow thermoplastic polyurethane fibers with LM inside was developed and manufactured into a helical coil to monitor finger gestures (
Figure 12
B) in [
110
]. The inductance increased with the increase in the bending angle.
In addition, electromagnetic interference shielding effectiveness (SE) is a significant parameter for electromagnetic pollution prevention. A multifunctional electromagnetic film was developed with a magnetic LM droplet-filled elastomer (
Figure 12
C) in [
111
]. Upon elongation, the SE of this film significantly increases with a linear response. Therefore, this layer was designed as an off/on switchable component in a wearable strain sensor on a human elbow, combined with another functional layer of flexible micro-antennas. The remote electromagnetic source would pass through this shielding film as unstretched and be blocked as the elbow bends.
Triboelectric nanogenerators and sensors are based on the contact electrification and electrostatic induction effect [
112
]. A stain-insensitive intrinsically conductive LM sheath–core microfiber was developed using a coaxial wet-spinning process (
Figure 12
D) [
78
]. For the fabrication of a single-electrode mode sensor, the LM core needs to be connected to the ground. Then, the electrification occurs at the interface of the elastomer sheath (electronegative surface) and human skin (electropositive surface) where they contact each other, after which the electron movements in the LM core are induced with the separation of these two surfaces. We note that this triboelectric self-powered sensor, attached to a human wrist, could monitor real-time wrist movement.
The mechanism of positive piezoconductivity for LM-based composites was proposed through an LM-filled magnetorheological elastomer, which consists of LM microdroplets and magnetic microparticles ( Figure 12 E) in [ 89 ]. It is unique that the resistance of the sensor remains high in a relaxed state and drops sharply when it suffers from any mechanical deformations. As a result, the movement of human joints can be detected with excellent stability for wearable devices.
Other novel structure designs of LM components pave pathways for the detection of algesthesia by taking advantage of its fluidity and self-healing properties [ 34 ]. More importantly, a LM-based damage-detection sensor provides a potential for a skin-mimic after-injury protection mechanism when it is controlled by an artificial synapse ( Figure 12 F) in [ 72 ]. In this sensor, the LM particle film fabricated with physical vapor deposition was the key component for damage detection. The mechanism relies on the resistance decrease from the rupturing of LM particles at the damage point.
Figure 12. Mechanical sensors based on other mechanisms such as electromagnetic induction, electromagnetic shielding, electrical induction, triboelectricity, and piezoconductivity. ( A ) Photograph of the sensor on a finger ( left ). The output of sensor under hand trembling at slow, medium, and fast speed ( right ) [ 109 ]. Copyright: (2022) Elsevier. ( B ) Schematic of deformable conductive fiber fabricated from LM embedded into hollow elastomer tubes, and the design parameters of the helical inductive sensor ( left ). The inductance variation with the bending of the finger [ 110 ]. Copyright: (2021) Royal Society of Chemistry. ( C ) Schematic of the wearable strain sensor on an elbow ( left ), and signals induced by the micro-antennas layer responding to the deformation of the elbow [ 111 ]. Copyright: (2022) Elsevier. ( D ) The mechanism of the triboelectric sensor ( left ) and photograph when it was attached to a human wrist accompanied with corresponding voltage output [ 78 ]. Copyright: (2021) AAAS. ( E ) The application of the LM-based piezoconductive elastomer for finger bending detection [ 89 ]. Copyright: (2019) Springer Nature. ( F ) Schematic of the damage-detection sensor with the injury protection mechanism [ 72 ]. Copyright: (2022) WILEY-VCH.
Figure 12. Mechanical sensors based on other mechanisms such as electromagnetic induction, electromagnetic shielding, electrical induction, triboelectricity, and piezoconductivity. ( A ) Photograph of the sensor on a finger ( left ). The output of sensor under hand trembling at slow, medium, and fast speed ( right ) [ 109 ]. Copyright: (2022) Elsevier. ( B ) Schematic of deformable conductive fiber fabricated from LM embedded into hollow elastomer tubes, and the design parameters of the helical inductive sensor ( left ). The inductance variation with the bending of the finger [ 110 ]. Copyright: (2021) Royal Society of Chemistry. ( C ) Schematic of the wearable strain sensor on an elbow ( left ), and signals induced by the micro-antennas layer responding to the deformation of the elbow [ 111 ]. Copyright: (2022) Elsevier. ( D ) The mechanism of the triboelectric sensor ( left ) and photograph when it was attached to a human wrist accompanied with corresponding voltage output [ 78 ]. Copyright: (2021) AAAS. ( E ) The application of the LM-based piezoconductive elastomer for finger bending detection [ 89 ]. Copyright: (2019) Springer Nature. ( F ) Schematic of the damage-detection sensor with the injury protection mechanism [ 72 ]. Copyright: (2022) WILEY-VCH.
4.4. Thermal Management
Thermal management is becoming increasingly important to meet the basic requirement of human thermal comfort and other medical healthcare strategies [ 113 ]. For on-skin electronics, two kinds of devices are dominantly attractive in research, i.e., heat dissipation and thermal therapy devices. Through programming the LM microstructure, oriented LM droplets in elastomer were fabricated as a soft heat sink ( Figure 13 A) in [ 77 ]. Compared with the pure elastomer region, the oriented-LM regions present a lower maximum temperature (40 °C) due to their higher thermal conductivity. In addition, a Janus structure of LM-based composite was developed via the self-assembly density deposition of LM droplets ( Figure 13 B) in [ 114 ]. The thermal profile of the LM-rich side was 9 times higher than that of polymer-rich insulating side, i.e., 0.525 and 0.0606 W m −1 K −1 , respectively. This unique characteristic of thermal conductivity difference shows its potential for on-body thermal management textiles or energy-saving buildings.
Continuous thermal therapy and warmth retention are the most common strategies for the applications of conformal and conductive composites on skin based on joule heating [ 115 ]. LM-based conductors can exhibit rapid responses in heating upon applied voltage due to their intrinsically exceptional conductivity and flexibility. An [email protected] composite was patterned in a serpentine geometry as a stretchable thermal heater using direct printing ( Figure 13 C) [ 81 ]. The dynamic conductive stability of [email protected] meets the requirements of wearable thermotherapy in the scenario of doing exercise. Thus, a [email protected] heater in a palisade shape with an optimal sinusoidal structure was prepared and applied to the thermal treatment of the articulatio genus. In addition to the joule heating, the high conductivity also contributes to the enhancement of the absorption and reflection of electromagnetic (EM) waves, which may eventually promote the shielding effectiveness of the on-skin electronics ( Figure 13 D) [ 116 ]. The EM interference shielding and rapid joule heating can be simultaneously achieved for human body protection and therapies.
Figure 13. The LM-based electronics for epidermal thermal management. ( A ) Schematic of the multilateral printed heat sink with four regions ( left ), and the temperature of the LEDs on four regions ( right ) [ 41 ]. Copyright: (2022) WILEY-VCH. ( B ) Schematic of the LM-based Janus film for thermal management ( left ), and the infrared image of their thermal management [ 114 ]. Copyright: (2019) The Royal Society of Chemistry. ( C ) Schematic of the [email protected] heater in a palisade shape for articulatio genus thermal treatment [ 81 ]. Copyright: (2019) WILEY-VCH. ( D ) Schematic illustration of the electromagnetic interference shielding and joule heating ( left ). The joule heating performances of the device under different voltages [ 116 ]. Copyright: (2020) American Chemical Society.
Figure 13. The LM-based electronics for epidermal thermal management. ( A ) Schematic of the multilateral printed heat sink with four regions ( left ), and the temperature of the LEDs on four regions ( right ) [ 41 ]. Copyright: (2022) WILEY-VCH. ( B ) Schematic of the LM-based Janus film for thermal management ( left ), and the infrared image of their thermal management [ 114 ]. Copyright: (2019) The Royal Society of Chemistry. ( C ) Schematic of the [email protected] heater in a palisade shape for articulatio genus thermal treatment [ 81 ]. Copyright: (2019) WILEY-VCH. ( D ) Schematic illustration of the electromagnetic interference shielding and joule heating ( left ). The joule heating performances of the device under different voltages [ 116 ]. Copyright: (2020) American Chemical Society.
4.5. Other Biomedical and Sustainable Applications
Other aspects of LM-based applications that are important in epidermal healthcare electronics have also been explored, including biosensing and energy supplying, epidermal micro-environment care, and epidermal protection (wound healing and anti-microbial applications). A silver–LM island–bridge structure was constructed with the advantages of both mechanical and electrical resiliency under dynamic deformations (
Figure 14
A) in [
117
]. This structure presents reliable electrochemical stability for the sensing of potassium hexacyanoferrate (III) after cyclic elongation in uniaxial and biaxial directions. More importantly, the potential of this structure for on-skin applications was further demonstrated through epidermal biofuel cell fabrications, in which the bioenergy from sweat metabolites can be collected.
In addition, the wound healing and anti-microbial applications for epidermal protection are significant, especially in the post-pandemic era (COVID-19). An LM-based wet-adhesive electronics that can conformally adhere to the skin during a 48-hour wearing period with sports and showers (
Figure 14
B) was constructed in [
118
]. The biocompatible and self-adhesive property of LM-based electrodes enables the acceleration of wound healing through stable pulsed electrical stimulation. Compared with untreated areas, the wound area with electrical stimulation was much smaller and showed a more mature epidermis after 10 days. This further proves the promising potential of LM-based electronics in epidermal medical healthcare. In addition, for on-skin antimicrobial and antiviral applications, Gallium–LM particles were applied to reduce Cu ions for the formation of LMCu particles, which exhibit exceptional adhesion to fabrics and antibacterial, antiviral, and antifungal properties (
Figure 14
C) [
119
]. The LMCu coatings presented a thickness of several micros and were proved to contain three crystalline substances, i.e., Cu
2
O, Cu, and CuGa
2
. Coated with LMCu, the fabrics displayed broad-spectrum efficacy against Gram-positive and Gram-negative bacterium, fungi, and respiratory RNA human viruses.
In addition, the increasing electronic waste has gained considerable attention and urgent requirements for recyclable, degradable electronics [
120
]. LM possesses the intrinsic characteristic of recyclability through mechanical, chemical, or electrochemical treatment in the aforementioned oxidation layer removal process. By employing a degradable elastomer that serves as a structure supportive component for LM-based materials, the whole device can exhibit easy access to recyclable electronics. A water-soluble PVA/fructose substrate was applied to LM-based LED arrays (
Figure 14
D) in [
121
]. After 205 s of immersion in water, the whole film was completely dissolved and the LED chips, LM droplets, and PVA solution could be recollected separately.
The gas permeability of LM-based epidermal electronics is of significance for on-skin moisture comfort for long-term applications. Although LM is an intrinsically impenetrable barrier for gases (air and water vapor), porous LM conductive networks have been developed with textile or scaffold structures. An LM fiber mat was fabricated to achieve high permeability and stretchability via a pre-stretching process to a strain of 1800% ( Figure 14 E) in [ 57 ]. In this process, the original planar LM film was transferred to a mesh-like porous structure for gas and moisture permeability. A similar methodology was applied in an LM super-lyophilic fibrous scaffold with a high mass loading of LM by the wetting-enhancement of Ag ( Figure 14 F) in [ 122 ]. Through a simple pre-stretching, a porous structure of LM can be formed for permeability. To achieve the gas permeability without any mechanical stimulus, an LM nanomesh was introduced onto electrospun microfibers to realize intrinsic conductive and gas permeability, simultaneously, ( Figure 14 G) in [ 123 ]. By dropping LM on the SEBS scaffold and controlling the rotation speed of the composite, the permeability and conductivity of LM nanomesh can be coordinated.
Figure 14. The LM-based electronics for other biomedical and sustainable applications. ( A ) Schematic of the LM island–bridge structure for wearable electrochemical devices ( left ), and the photograph of this device for on-skin sensing and energy applications [ 117 ]. Copyright: (2020) WILEY-VCH. ( B ) Schematic illustration of LM-based adhesive composite in the applications of wound healing, ECG, and joint motion monitoring ( left ), and the wound healing experiments on the back of mice with pulse electrical stimulation ( right ) [ 118 ]. Copyright: (2020) WILEY-VCH. ( C ) Schematic of LM–copper coating on a fabric ( left , inset: the LMCu patterns on the fabric) and the proposed antimicrobial mechanism of LMCu coated on the fabric [ 119 ]. Copyright: (2021) WILEY-VCH. ( D ) Photographs of the recycling process for LM-based LED array [ 121 ]. Copyright (2019) WILEY-VCH. ( E ) Schematic illustration of the LM fiber mat via pre-stretching processing [ 57 ]. Copyright: (2021) Springer Nature. ( F ) Schematic illustration of porous LM super-lyophilic scaffold via pre-stretching [ 122 ]. Copyright: (2021) WILEY-VCH. ( G ) The fabrication of intrinsic highly permeable LM micromesh [ 123 ]. Copyright: (2022) American Chemical Society.
Figure 14. The LM-based electronics for other biomedical and sustainable applications. ( A ) Schematic of the LM island–bridge structure for wearable electrochemical devices ( left ), and the photograph of this device for on-skin sensing and energy applications [ 117 ]. Copyright: (2020) WILEY-VCH. ( B ) Schematic illustration of LM-based adhesive composite in the applications of wound healing, ECG, and joint motion monitoring ( left ), and the wound healing experiments on the back of mice with pulse electrical stimulation ( right ) [ 118 ]. Copyright: (2020) WILEY-VCH. ( C ) Schematic of LM–copper coating on a fabric ( left , inset: the LMCu patterns on the fabric) and the proposed antimicrobial mechanism of LMCu coated on the fabric [ 119 ]. Copyright: (2021) WILEY-VCH. ( D ) Photographs of the recycling process for LM-based LED array [ 121 ]. Copyright (2019) WILEY-VCH. ( E ) Schematic illustration of the LM fiber mat via pre-stretching processing [ 57 ]. Copyright: (2021) Springer Nature. ( F ) Schematic illustration of porous LM super-lyophilic scaffold via pre-stretching [ 122 ]. Copyright: (2021) WILEY-VCH. ( G ) The fabrication of intrinsic highly permeable LM micromesh [ 123 ]. Copyright: (2022) American Chemical Society.
5. Conclusions and Perspectives
To summarize, LM, especially for Ga-based alloys, with high conductivity and excellent stretchability provides a huge potential for next-generation epidermal healthcare devices. For stretchable electronics in the epidermal system, the ‘
BEER
’ requirement, i.e., biocompatibility, electrical elasticity, and robustness, is proposed in this review and for the guidance of future epidermal devices and systems. Before the discussion of the fabrication strategies of LM, the fundamental physical, chemical, and biocompatible properties of LM were thoroughly discussed. Consequently, four dominant LM strategies for the fabrication of LM electronics through size effect and surface reduction processes were comprehensively illustrated. Through these methodologies and technologies, a variety of on-skin healthcare applications of LM-based electronics was exhaustively discussed in five parts, i.e., electrodes for biomedical signal collections, interconnectors for functional circuits, mechanical sensors with various mechanisms, thermal management, and other biomedical sustainable applications. Although landmark progress has been achieved and widespread applications have been explored in epidermal healthcare, there are still several bottleneck challenges that limit the further development of LM-based electronics. Here, we list some major challenges and potential solutions as follows:
Leakage and encapsulation: Without the protection of an elastomer sheath or encapsulation, the leakage of LM would easily occur in deformations or under pressure. This has been a tricky issue in the practical application of LM-based electronics for a long time, especially for epidermal uses. Although the Ga-based LM was proved to be low cytotoxic, the residual LM after use and the leakage during dynamic deformations would affect the electrical resistance of the circuit or cause a short circuit. There are three main strategies for the leakage inhibition of LM, i.e., encapsulation, structure design, and size effect. The most common way to prevent the leakage of LM is based on physical encapsulation with elastomers. The encapsulation layers serve in the form of a condensed elastomer film [ 95 ], electrospun mat [ 124 ], and sheath for the core conductive fibers [ 78 ]. Second, other nanomaterials and novel structures have been introduced to LM conductive networks, such as the carbon nanofiber protection layer on LM particles in [ 125 ] and the microgrooves design for the abrasion resistance of LM in [ 126 ]. In addition, the size effect of LM was developed very recently, and the LM leakage issue can be addressed in an LM-elastomer mixture with the LM sized <5 μm [ 127 ]. The continuous rupture of LM particles upon mechanical stimuli can be prevented due to this size effect.
The mechanism of the modification of low viscosity LM: As discussed above, one of the effective methods for the surface tension reduction of LM is the mixture of LM and other rigid metal particles, including iron, copper, and nickel. The schematic model of the composites’ microstructure was provided to illustrate how the additive metal particles were wrapped with the gallium oxidation layer in [ 128 ]. In addition, the oxide skins of LM were continuously broken up through repetitive mechanical stirring to form Ga x O y particles as well as internal air holes [ 129 ]. However, there is no sufficient evidence to illustrate the mechanism of viscosity regulation and the interactions between Ga x O y components, Ga and In atoms through SEM, X-ray photoelectron spectroscopy (XPS), and energy-dispersive spectrometry (EDS). The potential solutions would go alongside other advanced characterization methodologies, including molecular dynamics simulation, atom probe tomography, etc.
The robust interfaces between LM-based circuits and semiconductor chips: Interconnection plays a significant role in robust on-skin electronics, and the interconnection enhancement between an LM and commercial semiconductor chips could definitely promote the development of hybrid electronics that could be potential candidates for high-density, multifunctional, and smart on-skin electronics. The current strategies involve developing intrinsically sticky conductors by compositing LM particles and adhesive elastomer [ 105 , 127 ]. LM-rich and elastomer-rich areas were formed on the surface of this composite. In addition, a biphasic LM with a mixture of liquid and crystalline solids was applied for a reliable low-resistance interface with rigid electronics in [ 130 ]. Other strategies that can realize high-precision circuits without crosstalk or short-circuiting upon dynamic deformations should be further studied.
The package of the whole epidermal healthcare system: LM-based electronics present tremendous potential in preventative medicine in the post-pandemic period. Nevertheless, an epidermal system that fuses the function and information among all LM-based epidermal devices is needed. In the future, a package of LM-based healthcare systems could be achieved. When patients encounter some general sickness or are willing for a health status check, LM-based healthcare devices could collect their physiological signals by cloud-medicine-assisted wearable devices efficiently and immediately. In these cases, the cooperation of various sensors, electrodes, signal collection and processing, and wireless connections should be extensively considered.
Author Contributions
Conceptualization, J.C.; original manuscript preparation, J.C. and X.L.; review and editing, R.-W.L., Y.L. and G.Z. All authors have read and agreed to the published version of the manuscript.
Funding
This work was partially supported by the National Natural Science Foundation of China (Grant Nos. 52127803, 51931011, 51971233, 62174165, M-0152, U20A6001, U1909215, and 52105286), the External Cooperation Program of the Chinese Academy of Sciences (Grant Nos. 174433KYSB20190038, 174433KYSB20200013), the Instrument Developing Project of the Chinese Academy of Sciences (Grant No. YJKYYQ20200030), the K.C. Wong Education Foundation (Grant No. GJTD-2020-11), the Chinese Academy of Sciences Youth Innovation Promotion Association (Grant No. 2018334), the “Pioneer” and “Leading Goose” R&D Program of Zhejiang (Grant No. 2022C01032), the Zhejiang Provincial Key R&D Program (Grant No. 2021C01183), the Natural Science Foundation of Zhejiang Province (Grant No. LD22E010002), the Zhejiang Provincial Basic Public Welfare Research Project (Grant No. LGG20F010006), the Ningbo Scientific and Technological Innovation 2025 Major Project (Grant Nos. 2019B10127, 2020Z022), and the Ningbo Natural Science Foundations (Grant No. 20221JCGY010312).
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
Not applicable.
Conflicts of Interest
The authors declare no conflict of interest.
References
Wang, J.; Wang, C.; Cai, P.; Luo, Y.; Cui, Z.; Loh, X.J.; Chen, X. Artificial Sense Technology: Emulating and Extending Biological Senses. ACS Nano 2021 , 15 , 18671–18678. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Kim, J.; Campbell, A.S.; de Ávila, B.E.-F.; Wang, J. Wearable biosensors for healthcare monitoring. Nat. Biotechnol. 2019 , 37 , 389–406. [ Google Scholar ] [ CrossRef ]
He, K.; Liu, Y.; Yu, J.; Guo, X.; Wang, M.; Zhang, L.; Wan, C.; Wang, T.; Zhou, C.; Chen, X. Artificial Neural Pathway Based on a Memristor Synapse for Optically Mediated Motion Learning. ACS Nano 2022 , 16 , 9691–9700. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Feng, H.; Li, H.; Xu, J.; Yin, Y.; Cao, J.; Yu, R.; Wang, B.; Li, R.; Zhu, G. Triboelectric nanogenerator based on direct image lithography and surface fluorination for biomechanical energy harvesting and self-powered sterilization. Nano Energy 2022 , 98 , 107279. [ Google Scholar ] [ CrossRef ]
Park, J.-E.; Kang, H.S.; Baek, J.; Park, T.H.; Oh, S.; Lee, H.; Koo, M.; Park, C. Rewritable, Printable Conducting Liquid Metal Hydrogel. ACS Nano 2019 , 13 , 9122–9130. [ Google Scholar ] [ CrossRef ]
Meng, K.; Zhao, S.; Zhou, Y.; Wu, Y.; Zhang, S.; He, Q.; Wang, X.; Zhou, Z.; Fan, W.; Tan, X.; et al. A Wireless Textile-Based Sensor System for Self-Powered Personalized Health Care. Matter 2020 , 2 , 896–907. [ Google Scholar ] [ CrossRef ]
Lv, Z.; Wang, C.; Wan, C.; Wang, R.; Dai, X.; Wei, J.; Xia, H.; Li, W.; Zhang, W.; Cao, S.; et al. Strain-Driven Auto-Detachable Patterning of Flexible Electrodes. Adv. Mater. 2022 , 34 , e2202877. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Li, X.; Fan, Y.J.; Li, H.Y.; Cao, J.W.; Xiao, Y.C.; Wang, Y.; Liang, F.; Wang, H.L.; Jiang, Y.; Wang, Z.L.; et al. Ultracomfortable Hierarchical Nanonetwork for Highly Sensitive Pressure Sensor. ACS Nano 2020 , 14 , 9605–9612. [ Google Scholar ] [ CrossRef ]
Gong, Y.; Zhang, Y.-Z.; Fang, S.; Liu, C.; Niu, J.; Li, G.; Li, F.; Li, X.; Cheng, T.; Lai, W.-Y. Artificial intelligent optoelectronic skin with anisotropic electrical and optical responses for multi-dimensional sensing. Appl. Phys. Rev. 2022 , 9 , 021403. [ Google Scholar ] [ CrossRef ]
Xu, J.; Li, H.; Yin, Y.; Li, X.; Cao, J.; Feng, H.; Bao, W.; Tan, H.; Xiao, F.; Zhu, G. High sensitivity and broad linearity range pressure sensor based on hierarchical in-situ filling porous structure. npj Flex. Electron. 2022 , 6 , 62. [ Google Scholar ] [ CrossRef ]
Choi, S.; Han, S.I.; Jung, D.; Hwang, H.J.; Lim, C.; Bae, S.; Park, O.K.; Tschabrunn, C.M.; Lee, M.; Bae, S.Y.; et al. Highly conductive, stretchable and biocompatible Ag-Au core-sheath nanowire composite for wearable and implantable bioelectronics. Nat. Nanotechnol. 2018 , 13 , 1048–1056. [ Google Scholar ] [ CrossRef ]
Liu, Z.; Wang, X.; Qi, D.; Xu, C.; Yu, J.; Liu, Y.; Jiang, Y.; Liedberg, B.; Chen, X. High-Adhesion Stretchable Electrodes Based on Nanopile Interlocking. Adv. Mater. 2016 , 29 , 201603382. [ Google Scholar ] [ CrossRef ]
Yin, Y.M.; Li, H.Y.; Xu, J.; Zhang, C.; Liang, F.; Li, X.; Jiang, Y.; Cao, J.W.; Feng, H.F.; Mao, J.N.; et al. Facile Fabrication of Flexible Pressure Sensor with Programmable Lattice Structure. ACS Appl. Mater. Interfaces 2021 , 13 , 10388–10396. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Yu, P.; Li, X.; Li, H.; Fan, Y.; Cao, J.; Wang, H.; Guo, Z.; Zhao, X.; Wang, Z.; Zhu, G. All-Fabric Ultrathin Capacitive Sensor with High Pressure Sensitivity and Broad Detection Range for Electronic Skin. ACS Appl. Mater. Interfaces 2021 , 13 , 24062–24069. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Yin, Y.; Wang, Y.; Li, H.; Xu, J.; Zhang, C.; Li, X.; Cao, J.; Feng, H.; Zhu, G. A flexible dual parameter sensor with hierarchical porous structure for fully decoupled pressure–temperature sensing. Chem. Eng. J. 2021 , 430 , 133158. [ Google Scholar ] [ CrossRef ]
Matsuhisa, N.; Chen, X.; Bao, Z.; Someya, T. Materials and structural designs of stretchable conductors. Chem. Soc. Rev. 2019 , 48 , 2946–2966. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Choi, S.; Han, S.I.; Kim, D.; Hyeon, T.; Kim, D.-H. High-performance stretchable conductive nanocomposites: Materials, processes, and device applications. Chem. Soc. Rev. 2018 , 48 , 1566–1595. [ Google Scholar ] [ CrossRef ]
Wang, X.; Liu, Z.; Zhang, T. Flexible Sensing Electronics for Wearable/Attachable Health Monitoring. Small 2017 , 13 , 1602790. [ Google Scholar ] [ CrossRef ]
Jiang, Y.; Liang, F.; Li, H.Y.; Li, X.; Fan, Y.J.; Cao, J.W.; Yin, Y.M.; Wang, Y.; Wang, Z.L.; Zhu, G. A Flexible and Ultra-Highly Sensitive Tactile Sensor through a Parallel Circuit by a Magnetic Aligned Conductive Composite. ACS Nano 2022 , 16 , 746–754. [ Google Scholar ] [ CrossRef ]
Li, X.; Cao, J.; Li, H.; Yu, P.; Fan, Y.; Xiao, Y.; Yin, Y.; Zhao, X.; Wang, Z.L.; Zhu, G. Differentiation of Multiple Mechanical Stimuli by a Flexible Sensor Using a Dual-Interdigital-Electrode Layout for Bodily Kinesthetic Identification. ACS Appl. Mater. Interfaces 2021 , 13 , 26394–26403. [ Google Scholar ] [ CrossRef ]
Kim, Y.; Zhu, J.; Yeom, B.; Di Prima, M.; Su, X.; Kim, J.-G.; Yoo, S.J.; Uher, C.; Kotov, N.A. Stretchable nanoparticle conductors with self-organized conductive pathways. Nature 2013 , 500 , 59–63. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Fan, Y.J.; Li, X.; Kuang, S.Y.; Zhang, L.; Chen, Y.H.; Liu, L.; Zhang, K.; Ma, S.W.; Liang, F.; Wu, T.; et al. Highly Robust, Transparent, and Breathable Epidermal Electrode. ACS Nano 2018 , 12 , 9326–9332. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Jin, H.; Matsuhisa, N.; Lee, S.; Abbas, M.; Yokota, T.; Someya, T. Enhancing the Performance of Stretchable Conductors for E-Textiles by Controlled Ink Permeation. Adv. Mater. 2017 , 29 , 201605848. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Matsuhisa, N.; Inoue, D.; Zalar, P.; Jin, H.; Matsuba, Y.; Itoh, A.; Yokota, T.; Hashizume, D.; Someya, T. Printable elastic conductors by in situ formation of silver nanoparticles from silver flakes. Nat. Mater. 2017 , 16 , 834–840. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Tang, S.-Y.; Tabor, C.; Kalantar-Zadeh, K.; Dickey, M.D. Gallium Liquid Metal: The Devil’s Elixir. Annu. Rev. Mater. Res. 2021 , 51 , 381–408. [ Google Scholar ] [ CrossRef ]
Chen, S.; Wang, H.-Z.; Zhao, R.-Q.; Rao, W.; Liu, J. Liquid Metal Composites. Matter 2020 , 2 , 1446–1480. [ Google Scholar ] [ CrossRef ]
Zhu, L.; Wang, B.; Handschuh-Wang, S.; Zhou, X. Liquid Metal–Based Soft Microfluidics. Small 2019 , 16 , 1903841. [ Google Scholar ] [ CrossRef ]
Chen, S.; Liu, J. Pervasive liquid metal printed electronics: From concept incubation to industry. Iscience 2021 , 24 , 102026. [ Google Scholar ] [ CrossRef ]
Ladd, C.; So, J.H.; Muth, J.; Dickey, M.D. 3D printing of free standing liquid metal microstructures. Adv. Mater. 2013 , 25 , 5081–5085. [ Google Scholar ] [ CrossRef ]
Li, G.; Wu, X.; Lee, D.-W. Selectively plated stretchable liquid metal wires for transparent electronics. Sens. Actuators B Chem. 2015 , 221 , 1114–1119. [ Google Scholar ] [ CrossRef ]
Zhang, M.; Yao, S.; Rao, W.; Liu, J. Transformable soft liquid metal micro/nanomaterials. Mater. Sci. Eng. R Rep. 2019 , 138 , 1–35. [ Google Scholar ] [ CrossRef ]
Yu, Z.; Shang, J.; Niu, X.; Liu, Y.; Liu, G.; Dhanapal, P.; Zheng, Y.; Yang, H.; Wu, Y.; Zhou, Y.; et al. A Composite Elastic Conductor with High Dynamic Stability Based on 3D-Calabash Bunch Conductive Network Structure for Wearable Devices. Adv. Electron. Mater. 2018 , 4 , 1800137. [ Google Scholar ] [ CrossRef ]
Chen, B.; Cao, Y.; Li, Q.; Yan, Z.; Liu, R.; Zhao, Y.; Zhang, X.; Wu, M.; Qin, Y.; Sun, C.; et al. Liquid metal-tailored gluten network for protein-based e-skin. Nat. Commun. 2022 , 13 , 1206. [ Google Scholar ] [ CrossRef ]
Markvicka, E.J.; Tutika, R.; Bartlett, M.D.; Majidi, C. Soft Electronic Skin for Multi-Site Damage Detection and Localization. Adv. Funct. Mater. 2019 , 29 , 1900160. [ Google Scholar ] [ CrossRef ]
Lee, S.; Byun, S.; Kim, C.Y.; Cho, S.; Park, S.; Sim, J.Y.; Jeong, J. Beyond Human Touch Perception: An Adaptive Robotic Skin Based on Gallium Microgranules for Pressure Sensory Augmentation. Adv. Mater. 2022 , 34 , 2204805. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Wang, C.; Wang, C.; Huang, Z.; Xu, S. Materials and Structures toward Soft Electronics. Adv. Mater. 2018 , 30 , e1801368. [ Google Scholar ] [ CrossRef ][ Green Version ]
Bartlett, M.D.; Kazem, N.; Powell-Palm, M.J.; Huang, X.; Sun, W.; Malen, J.A.; Majidi, C. High thermal conductivity in soft elastomers with elongated liquid metal inclusions. Proc. Natl. Acad. Sci. USA 2017 , 114 , 2143–2148. [ Google Scholar ] [ CrossRef ][ Green Version ]
Lin, Y.; Genzer, J.; Dickey, M.D. Attributes, Fabrication, and Applications of Gallium-Based Liquid Metal Particles. Adv. Sci. 2020 , 7 , 2000192. [ Google Scholar ] [ CrossRef ][ Green Version ]
Zhu, S.; So, J.-H.; Mays, R.; Desai, S.; Barnes, W.R.; Pourdeyhimi, B.; Dickey, M.D. Ultrastretchable Fibers with Metallic Conductivity Using a Liquid Metal Alloy Core. Adv. Funct. Mater. 2012 , 23 , 2308–2314. [ Google Scholar ] [ CrossRef ]
Zheng, R.-M.; Wu, Y.-H.; Xu, Y.-H.; Liu, S.-Q.; Liu, H.-Z.; Wang, P.-P.; Deng, Z.-F.; Chen, S.; Liu, L. Advanced stretchable characteristic of liquid metal for fabricating extremely stable electronics. Mater. Lett. 2018 , 235 , 133–136. [ Google Scholar ] [ CrossRef ]
Haake, A.; Tutika, R.; Schloer, G.M.; Bartlett, M.D.; Markvicka, E.J. On-Demand Programming of Liquid Metal-Composite Microstructures through Direct Ink Write 3D Printing. Adv. Mater. 2022 , 34 , 2200182. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Tevis, I.D.; Newcomb, L.B.; Thuo, M. Synthesis of Liquid Core–Shell Particles and Solid Patchy Multicomponent Particles by Shearing Liquids Into Complex Particles (SLICE). Langmuir 2014 , 30 , 14308–14313. [ Google Scholar ] [ CrossRef ] [ PubMed ][ Green Version ]
Bark, H.; Lee, P.S. Surface modification of liquid metal as an effective approach for deformable electronics and energy devices. Chem. Sci. 2021 , 12 , 2760–2777. [ Google Scholar ] [ CrossRef ]
Gao, Y.; Li, H.; Liu, J. Direct Writing of Flexible Electronics through Room Temperature Liquid Metal Ink. PLoS ONE 2012 , 7 , e45485. [ Google Scholar ] [ CrossRef ]
Guo, R.; Tang, J.; Dong, S.; Lin, J.; Wang, H.; Liu, J.; Rao, W. One-Step Liquid Metal Transfer Printing: Toward Fabrication of Flexible Electronics on Wide Range of Substrates. Adv. Mater. Technol. 2018 , 3 , 1800265. [ Google Scholar ] [ CrossRef ]
Khan, M.R.; Trlica, C.; Dickey, M.D. Recapillarity: Electrochemically Controlled Capillary Withdrawal of a Liquid Metal Alloy from Microchannels. Adv. Funct. Mater. 2014 , 25 , 671–678. [ Google Scholar ] [ CrossRef ]
Xin, Y.; Peng, H.; Xu, J.; Zhang, J. Ultrauniform Embedded Liquid Metal in Sulfur Polymers for Recyclable, Conductive, and Self-Healable Materials. Adv. Funct. Mater. 2019 , 29 , 1808989. [ Google Scholar ] [ CrossRef ]
Veerapandian, S.; Jang, W.; Seol, J.B.; Wang, H.; Kong, M.; Thiyagarajan, K.; Kwak, J.; Park, G.; Lee, G.; Suh, W.; et al. Hydrogen-doped viscoplastic liquid metal microparticles for stretchable printed metal lines. Nat. Mater. 2021 , 20 , 533–540. [ Google Scholar ] [ CrossRef ]
Hirsch, A.; Michaud, H.O.; Gerratt, A.P.; de Mulatier, S.; Lacour, S.P. Intrinsically Stretchable Biphasic (Solid-Liquid) Thin Metal Films. Adv. Mater. 2016 , 28 , 4507–4512. [ Google Scholar ] [ CrossRef ][ Green Version ]
Zhang, J.; Yao, Y.; Sheng, L.; Liu, J. Self-fueled biomimetic liquid metal mollusk. Adv. Mater. 2015 , 27 , 2648–2655. [ Google Scholar ] [ CrossRef ]
Qi, Y.; Li, N.; Zhang, K.; Yang, Y.; Ren, Z.; You, J.; Hou, Q.; Shen, C.; Jin, T.; Peng, Z.; et al. Dynamic Liquid Metal Catalysts for Boosted Lithium Polysulfides Redox Reaction. Adv. Mater. 2022 , 34 , 2204810. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Tang, J.; Tang, J.; Mayyas, M.; Ghasemian, M.B.; Sun, J.; Rahim, M.A.; Yang, J.; Han, J.; Lawes, D.J.; Jalili, R.; et al. Liquid-Metal-Enabled Mechanical-Energy-Induced CO 2 Conversion. Adv. Mater. 2021 , 34 , 2105789. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Kim, N.C.; Xian, L.M.; Ali, Z.; Azmira, J.; Murdoch, B.J.; Enrico, D.G.; Rebecca, O.-T.; Sumeet, W.; Aaron, E.; Khanh, T.V.; et al. Ultrathin oxysulfide semiconductors from liquid metal: A wet chemical approach. J. Mater. Chem. C 2021 , 9 , 11815–11826. [ Google Scholar ] [ CrossRef ]
Wang, Q.; Yu, Y.; Liu, J. Preparations, Characteristics and Applications of the Functional Liquid Metal Materials. Adv. Eng. Mater. 2017 , 20 , 1700781. [ Google Scholar ] [ CrossRef ]
Sun, X.; Yuan, B.; Wang, H.; Fan, L.; Duan, M.; Wang, X.; Guo, R.; Liu, J. Nano-Biomedicine based on Liquid Metal Particles and Allied Materials. Adv. NanoBiomed Res. 2021 , 1 , 2000086. [ Google Scholar ] [ CrossRef ]
Byun, S.-H.; Sim, J.Y.; Zhou, Z.; Lee, J.; Qazi, R.; Walicki, M.C.; Parker, K.E.; Haney, M.P.; Choi, S.H.; Ahnsei, S.; et al. Mechanically transformative electronics, sensors, and implantable devices. Sci. Adv. 2019 , 5 , eaay0418. [ Google Scholar ] [ CrossRef ][ Green Version ]
Ma, Z.; Huang, Q.; Xu, Q.; Zhuang, Q.; Zhao, X.; Yang, Y.; Qiu, H.; Yang, Z.; Wang, C.; Chai, Y.; et al. Permeable superelastic liquid-metal fibre mat enables biocompatible and monolithic stretchable electronics. Nat. Mater. 2021 , 20 , 859–868. [ Google Scholar ] [ CrossRef ]
Li, X.; Li, M.; Zong, L.; Wu, X.; You, J.; Du, P.; Li, C. Liquid Metal Droplets Wrapped with Polysaccharide Microgel as Biocompatible Aqueous Ink for Flexible Conductive Devices. Adv. Funct. Mater. 2018 , 28 , 1804197. [ Google Scholar ] [ CrossRef ]
Dong, R.; Wang, L.; Hang, C.; Chen, Z.; Liu, X.; Zhong, L.; Qi, J.; Huang, Y.; Liu, S.; Wang, L.; et al. Printed Stretchable Liquid Metal Electrode Arrays for In Vivo Neural Recording. Small 2021 , 17 , e2006612. [ Google Scholar ] [ CrossRef ]
Lu, Y.; Hu, Q.; Lin, Y.; Pacardo, D.B.; Wang, C.; Sun, W.; Ligler, F.S.; Dickey, M.; Gu, Z. Transformable liquid-metal nanomedicine. Nat. Commun. 2015 , 6 , 10066. [ Google Scholar ] [ CrossRef ][ Green Version ]
Dickey, M.; Chiechi, R.; Larsen, R.J.; Weiss, E.A.; Weitz, D.A.; Whitesides, G.M. Eutectic Gallium-Indium (EGaIn): A Liquid Metal Alloy for the Formation of Stable Structures in Microchannels at Room Temperature. Adv. Funct. Mater. 2008 , 18 , 1097–1104. [ Google Scholar ] [ CrossRef ]
Boley, J.W.; White, E.L.; Chiu, G.T.-C.; Kramer, R.K. Direct Writing of Gallium-Indium Alloy for Stretchable Electronics. Adv. Funct. Mater. 2014 , 24 , 3501–3507. [ Google Scholar ] [ CrossRef ]
Lin, R.; Kim, H.-J.; Achavananthadith, S.; Xiong, Z.; Lee, J.K.W.; Kong, Y.L.; Ho, J.S. Digitally-embroidered liquid metal electronic textiles for wearable wireless systems. Nat. Commun. 2022 , 13 , 2190. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Teng, L.; Ye, S.; Handschuh-Wang, S.; Zhou, X.; Gan, T.; Zhou, X. Liquid Metal-Based Transient Circuits for Flexible and Recyclable Electronics. Adv. Funct. Mater. 2019 , 29 , 1808739. [ Google Scholar ] [ CrossRef ]
Gao, Y.; Ota, H.; Schaler, E.W.; Chen, K.; Zhao, A.; Gao, W.; Fahad, H.M.; Leng, Y.; Zheng, A.; Xiong, F.; et al. Wearable Microfluidic Diaphragm Pressure Sensor for Health and Tactile Touch Monitoring. Adv. Mater. 2017 , 29 , 1701985. [ Google Scholar ] [ CrossRef ] [ PubMed ][ Green Version ]
Khan, M.R.; Eaker, C.B.; Bowden, E.F.; Dickey, M.D. Giant and switchable surface activity of liquid metal via surface oxidation. Proc. Natl. Acad. Sci. USA 2014 , 111 , 14047–14051. [ Google Scholar ] [ CrossRef ][ Green Version ]
Tang, S.-Y.; Khoshmanesh, K.; Sivan, V.; Petersen, P.; O’Mullane, A.P.; Abbott, D.; Mitchell, A.; Kalantar-zadeh, K. Liquid metal enabled pump. Proc. Natl. Acad. Sci. USA 2014 , 111 , 3304–3309. [ Google Scholar ] [ CrossRef ][ Green Version ]
Xu, D.; Cao, J.; Liu, F.; Zou, S.; Lei, W.; Wu, Y.; Liu, Y.; Shang, J.; Li, R.-W. Liquid Metal Based Nano-Composites for Printable Stretchable Electronics. Sensors 2022 , 22 , 2516. [ Google Scholar ] [ CrossRef ]
Chen, Y.; Zhou, T.; Li, Y.; Zhu, L.; Handschuh-Wang, S.; Zhu, D.; Zhou, X.; Liu, Z.; Gan, T.; Zhou, X. Robust Fabrication of Nonstick, Noncorrosive, Conductive Graphene-Coated Liquid Metal Droplets for Droplet-Based, Floating Electrodes. Adv. Funct. Mater. 2018 , 28 , 1706277. [ Google Scholar ] [ CrossRef ]
Yu, Y.; Wang, Q.; Yi, L.; Liu, J. Channelless Fabrication for Large-Scale Preparation of Room Temperature Liquid Metal Droplets. Adv. Eng. Mater. 2013 , 16 , 255–262. [ Google Scholar ] [ CrossRef ]
Jeong, S.; Hjort, K.; Wu, Z. Tape Transfer Atomization Patterning of Liquid Alloys for Microfluidic Stretchable Wireless Power Transfer. Sci. Rep. 2015 , 5 , srep08419. [ Google Scholar ] [ CrossRef ] [ PubMed ][ Green Version ]
Li, F.; Gao, S.; Lu, Y.; Asghar, W.; Cao, J.; Hu, C.; Yang, H.; Wu, Y.; Li, S.; Shang, J.; et al. Bio-Inspired Multi-Mode Pain-Perceptual System (MMPPS) with Noxious Stimuli Warning, Damage Localization, and Enhanced Damage Protection. Adv. Sci. 2021 , 8 , 2004208. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Ren, L.; Zhuang, J.; Casillas, G.; Feng, H.; Liu, Y.; Xu, X.; Liu, Y.; Chen, J.; Du, Y.; Jiang, L.; et al. Nanodroplets for Stretchable Superconducting Circuits. Adv. Funct. Mater. 2016 , 26 , 8111–8118. [ Google Scholar ] [ CrossRef ]
Cao, J.; Liang, F.; Li, H.; Li, X.; Fan, Y.; Hu, C.; Yu, J.; Xu, J.; Yin, Y.; Li, F.; et al. Ultra-robust stretchable electrode for e-skin: In situ assembly using a nanofiber scaffold and liquid metal to mimic water-to-net interaction. InfoMat 2022 , 4 , e12302. [ Google Scholar ] [ CrossRef ]
Mohammed, M.G.; Kramer, R. All-Printed Flexible and Stretchable Electronics. Adv. Mater. 2017 , 29 , 1604965. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Yan, J.; Malakooti, M.H.; Lu, Z.; Wang, Z.; Kazem, N.; Pan, C.; Bockstaller, M.R.; Majidi, C.; Matyjaszewski, K. Solution processable liquid metal nanodroplets by surface-initiated atom transfer radical polymerization. Nat. Nanotechnol. 2019 , 14 , 684–690. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Bark, H.; Tan, M.W.M.; Thangavel, G.; Lee, P.S. Deformable High Loading Liquid Metal Nanoparticles Composites for Thermal Energy Management. Adv. Energy Mater. 2021 , 11 , 2101387. [ Google Scholar ] [ CrossRef ]
Zheng, L.; Zhu, M.; Wu, B.; Li, Z.; Sun, S.; Wu, P. Conductance-stable liquid metal sheath-core microfibers for stretchy smart fabrics and self-powered sensing. Sci. Adv. 2021 , 7 , abg4041. [ Google Scholar ] [ CrossRef ]
Wu, P.; Wang, Z.; Yao, X.; Fu, J.; He, Y. Recyclable conductive nanoclay for direct in situ printing flexible electronics. Mater. Horiz. 2021 , 8 , 2006–2017. [ Google Scholar ] [ CrossRef ]
Ma, B.; Xu, C.; Chi, J.; Chen, J.; Zhao, C.; Liu, H. A Versatile Approach for Direct Patterning of Liquid Metal Using Magnetic Field. Adv. Funct. Mater. 2019 , 29 , 1901370. [ Google Scholar ] [ CrossRef ]
Wang, Y.; Yu, Z.; Mao, G.; Liu, Y.; Liu, G.; Shang, J.; Qu, S.; Chen, Q.; Li, R.-W. Printable [email protected] Stretchable Heater with High Stretchability and Dynamic Stability for Wearable Thermotherapy. Adv. Mater. Technol. 2018 , 4 , 1800435. [ Google Scholar ] [ CrossRef ]
Liu, Y.; Ji, X.; Liang, J. Rupture stress of liquid metal nanoparticles and their applications in stretchable conductors and dielectrics. npj Flex. Electron. 2021 , 5 , 11. [ Google Scholar ] [ CrossRef ]
Zhou, L.y.; Fu, J.z.; Gao, Q.; Zhao, P.; He, Y. All-Printed Flexible and Stretchable Electronics with Pressing or Freezing Activatable Liquid-Metal–Silicone Inks. Adv. Funct. Mater. 2019 , 30 , 1906683. [ Google Scholar ] [ CrossRef ]
Hao, Y.; Gao, J.; Lv, Y.; Liu, J. Low Melting Point Alloys Enabled Stiffness Tunable Advanced Materials. Adv. Funct. Mater. 2022 , 32 , 2201942. [ Google Scholar ] [ CrossRef ]
Guo, R.; Wang, X.; Chang, H.; Yu, W.; Liang, S.; Rao, W.; Liu, J. Ni-GaIn Amalgams Enabled Rapid and Customizable Fabrication of Wearable and Wireless Healthcare Electronics. Adv. Eng. Mater. 2018 , 20 , 1800054. [ Google Scholar ] [ CrossRef ]
Xu, C.; Ma, B.; Yuan, S.; Zhao, C.; Liu, H. High-Resolution Patterning of Liquid Metal on Hydrogel for Flexible, Stretchable, and Self-Healing Electronics. Adv. Electron. Mater. 2019 , 6 , 1900721. [ Google Scholar ] [ CrossRef ]
Wang, L.; Liu, J. Compatible hybrid 3D printing of metal and nonmetal inks for direct manufacture of end functional devices. Sci. China Technol. Sci. 2014 , 57 , 2089–2095. [ Google Scholar ] [ CrossRef ]
Park, Y.-G.; Min, H.; Kim, H.; Zhexembekova, A.; Lee, C.Y.; Park, J.-U. Three-Dimensional, High-Resolution Printing of Carbon Nanotube/Liquid Metal Composites with Mechanical and Electrical Reinforcement. Nano Lett. 2019 , 19 , 4866–4872. [ Google Scholar ] [ CrossRef ]
Yun, G.; Tang, S.-Y.; Sun, S.; Yuan, D.; Zhao, Q.; Deng, L.; Yan, S.; Du, H.; Dickey, M.D.; Li, W. Liquid metal-filled magnetorheological elastomer with positive piezoconductivity. Nat. Commun. 2019 , 10 , 1300. [ Google Scholar ] [ CrossRef ][ Green Version ]
Liao, M.; Liao, H.; Ye, J.; Wan, P.; Zhang, L. Polyvinyl Alcohol-Stabilized Liquid Metal Hydrogel for Wearable Transient Epidermal Sensors. ACS Appl. Mater. Interfaces 2019 , 11 , 47358–47364. [ Google Scholar ] [ CrossRef ]
Park, J.; Kang, H.S.; Koo, M.; Park, C. Autonomous Surface Reconciliation of a Liquid-Metal Conductor Micropatterned on a Deformable Hydrogel. Adv. Mater. 2020 , 32 , e2002178. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Wang, M.; Ma, C.; Uzabakiriho, P.C.; Chen, X.; Chen, Z.; Cheng, Y.; Wang, Z.; Zhao, G. Stencil Printing of Liquid Metal upon Electrospun Nanofibers Enables High-Performance Flexible Electronics. ACS Nano 2021 , 15 , 19364–19376. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Tavakoli, M.; Malakooti, M.H.; Paisana, H.; Ohm, Y.; Marques, D.G.; Lopes, P.A.; Piedade, A.P.; Almeida, A.T.; Majidi, C. EGaIn-Assisted Room-Temperature Sintering of Silver Nanoparticles for Stretchable, Inkjet-Printed, Thin-Film Electronics. Adv. Mater. 2018 , 30 , 1801852. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Kim, M.-G.; Brown, D.K.; Brand, O. Nanofabrication for all-soft and high-density electronic devices based on liquid metal. Nat. Commun. 2020 , 11 , 1002. [ Google Scholar ] [ CrossRef ][ Green Version ]
Wang, S.; Nie, Y.; Zhu, H.; Xu, Y.; Cao, S.; Zhang, J.; Li, Y.; Wang, J.; Ning, X.; Kong, D. Intrinsically stretchable electronics with ultrahigh deformability to monitor dynamically moving organs. Sci. Adv. 2022 , 8 , eabl5511. [ Google Scholar ] [ CrossRef ]
Chen, G.; Wang, H.; Guo, R.; Duan, M.; Zhang, Y.; Liu, J. Superelastic EGaIn Composite Fibers Sustaining 500% Tensile Strain with Superior Electrical Conductivity for Wearable Electronics. ACS Appl. Mater. Interfaces 2020 , 12 , 6112–6118. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Dong, W.; Cheng, X.; Xiong, T.; Wang, X. Stretchable bio-potential electrode with self-similar serpentine structure for continuous, long-term, stable ECG recordings. Biomed. Microdevices 2019 , 21 , 6. [ Google Scholar ] [ CrossRef ]
Lopes, P.A.; Paisana, H.; De Almeida, A.T.; Majidi, C.; Tavakoli, M. Hydroprinted electronics: Ultrathin stretchable Ag–In–Ga E-skin for bioelectronics and human–machine interaction. ACS Appl. Mater. Interfaces 2018 , 10 , 38760–38768. [ Google Scholar ] [ CrossRef ]
Li, X.; Zhu, P.; Zhang, S.; Wang, X.; Luo, X.; Leng, Z.; Zhou, H.; Pan, Z.; Mao, Y. A Self-Supporting, Conductor-Exposing, Stretchable, Ultrathin, and Recyclable Kirigami-Structured Liquid Metal Paper for Multifunctional E-Skin. ACS Nano 2022 , 16 , 5909–5919. [ Google Scholar ] [ CrossRef ]
Guo, R.; Li, T.; Wu, Z.; Wan, C.; Niu, J.; Huo, W.; Yu, H.; Huang, X. Thermal Transfer-Enabled Rapid Printing of Liquid Metal Circuits on Multiple Substrates. ACS Appl. Mater. Interfaces 2022 , 14 , 37028–37038. [ Google Scholar ] [ CrossRef ]
Nyein, H.Y.Y.; Bariya, M.; Tran, B.; Ahn, C.H.; Brown, B.J.; Ji, W.; Davis, N.; Javey, A. A wearable patch for continuous analysis of thermoregulatory sweat at rest. Nat. Commun. 2021 , 12 , 1823. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Lee, G.; Woo, H.; Yoon, C.; Yang, C.; Bae, J.; Kim, W.; Lee, D.H.; Kang, H.; Han, S.; Kang, S.; et al. A Personalized Electronic Tattoo for Healthcare Realized by On-the-Spot Assembly of an Intrinsically Conductive and Durable Liquid-Metal Composite. Adv. Mater. 2022 , 34 , 2204159. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Huang, Y.; Yang, F.; Liu, S.; Wang, R.; Guo, J.; Ma, X. Liquid Metal-Based Epidermal Flexible Sensor for Wireless Breath Monitoring and Diagnosis Enabled by Highly Sensitive SnS 2 Nanosheets. Research 2021 , 2021 , 9847285. [ Google Scholar ] [ CrossRef ]
Guo, R.; Sun, X.; Yao, S.; Duan, M.; Wang, H.; Liu, J.; Deng, Z. Semi-Liquid-Metal-(Ni-EGaIn)-Based Ultraconformable Electronic Tattoo. Adv. Mater. Technol. 2019 , 4 , 1900183. [ Google Scholar ] [ CrossRef ]
Tang, L.; Yang, S.; Zhang, K.; Jiang, X. Skin Electronics from Biocompatible In Situ Welding Enabled by Intrinsically Sticky Conductors. Adv. Sci. 2022 , 9 , 2202043. [ Google Scholar ] [ CrossRef ]
Choi, J.; Han, C.; Cho, S.; Kim, K.; Ahn, J.; Orbe, D.D.; Cho, I.; Zhao, Z.-J.; Oh, Y.S.; Hong, H.; et al. Customizable, conformal, and stretchable 3D electronics via predistorted pattern generation and thermoforming. Sci. Adv. 2021 , 7 , eabj0694. [ Google Scholar ] [ CrossRef ]
Hao, X.P.; Li, C.Y.; Zhang, C.W.; Du, M.; Ying, Z.; Zheng, Q.; Wu, Z.L. Self-Shaping Soft Electronics Based on Patterned Hydrogel with Stencil-Printed Liquid Metal. Adv. Funct. Mater. 2021 , 31 , 2105481. [ Google Scholar ] [ CrossRef ]
Tutika, R.; Kmiec, S.; Haque, A.B.M.T.; Martin, S.W.; Bartlett, M.D. Liquid Metal–Elastomer Soft Composites with Independently Controllable and Highly Tunable Droplet Size and Volume Loading. ACS Appl. Mater. Interfaces 2019 , 11 , 17873–17883. [ Google Scholar ] [ CrossRef ][ Green Version ]
Li, S.; Cao, P.; Li, F.; Asghar, W.; Wu, Y.; Xiao, H.; Liu, Y.; Zhou, Y.; Yang, H.; Zhang, Y.; et al. Self-powered stretchable strain sensors for motion monitoring and wireless control. Nano Energy 2021 , 92 , 106754. [ Google Scholar ] [ CrossRef ]
Xiong, Y.; Xiao, J.; Chen, J.; Xu, D.; Zhao, S.; Chen, S.; Sheng, B. A multifunctional hollow TPU fiber filled with liquid metal exhibiting fast electrothermal deformation and recovery. Soft Matter 2021 , 17 , 10016–10024. [ Google Scholar ] [ CrossRef ]
Liang, F.; Zhao, X.J.; Li, H.Y.; Fan, Y.J.; Cao, J.W.; Wang, Z.L.; Zhu, G. Stretchable shape-adaptive liquid-solid interface nanogenerator enabled by in-situ charged nanocomposite membrane. Nano Energy 2019 , 69 , 104414. [ Google Scholar ] [ CrossRef ]
Hu, R.; Liu, Y.; Shin, S.; Huang, S.; Ren, X.; Shu, W.; Cheng, J.; Tao, G.; Xu, W.; Chen, R.; et al. Emerging Materials and Strategies for Personal Thermal Management. Adv. Energy Mater. 2020 , 10 , 1903921. [ Google Scholar ] [ CrossRef ]
Zhang, P.; Wang, Q.; Guo, R.; Zhang, M.; Wang, S.; Lu, C.; Xue, M.; Fan, J.; He, Z.; Rao, W. Self-assembled ultrathin film of CNC/PVA–liquid metal composite as a multifunctional Janus material. Mater. Horiz. 2019 , 6 , 1643–1653. [ Google Scholar ] [ CrossRef ]
Fan, Y.J.; Yu, P.T.; Liang, F.; Li, X.; Li, H.Y.; Liu, L.; Cao, J.W.; Zhao, X.J.; Wang, Z.L.; Zhu, G. Highly conductive, stretchable, and breathable epidermal electrode based on hierarchically interactive nano-network. Nanoscale 2020 , 12 , 16053–16062. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Yi, P.; Zou, H.; Yu, Y.; Li, X.; Li, Z.; Deng, G.; Chen, C.; Fang, M.; He, J.; Sun, X.; et al. MXene-Reinforced Liquid Metal/Polymer Fibers via Interface Engineering for Wearable Multifunctional Textiles. ACS Nano 2022 , 16 , 14490–14502. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Silva, C.A.; Lv, J.; Yin, L.; Jeerapan, I.; Innocenzi, G.; Soto, F.; Ha, Y.; Wang, J. Liquid Metal Based Island-Bridge Architectures for All Printed Stretchable Electrochemical Devices. Adv. Funct. Mater. 2020 , 30 , 2002041. [ Google Scholar ] [ CrossRef ]
Cheng, J.; Shang, J.; Yang, S.; Dou, J.; Shi, X.; Jiang, X. Wet-Adhesive Elastomer for Liquid Metal-Based Conformal Epidermal Electronics. Adv. Funct. Mater. 2022 , 32 , 2200444. [ Google Scholar ] [ CrossRef ]
Kwon, K.Y.; Cheeseman, S.; Frias-De-Diego, A.; Hong, H.; Yang, J.; Jung, W.; Yin, H.; Murdoch, B.J.; Scholle, F.; Crook, N.; et al. A Liquid Metal Mediated Metallic Coating for Antimicrobial and Antiviral Fabrics. Adv. Mater. 2021 , 33 , e2104298. [ Google Scholar ] [ CrossRef ]
Li, F.; Qin, Q.; Zhou, Y.; Wu, Y.; Xue, W.; Gao, S.; Shang, J.; Liu, Y.; Li, R.-W. Recyclable Liquid Metal-Based Circuit on Paper. Adv. Mater. Technol. 2018 , 3 , 1800131. [ Google Scholar ] [ CrossRef ]
Guo, R.; Sun, X.; Yuan, B.; Wang, H.; Liu, J. Magnetic liquid metal (Fe-EGaIn) based multifunctional electronics for remote self-healing materials, degradable electronics, and thermal transfer printing. Adv. Sci. 2019 , 6 , 1901478. [ Google Scholar ] [ CrossRef ] [ PubMed ][ Green Version ]
Zhuang, Q.; Ma, Z.; Gao, Y.; Zhang, Y.; Wang, S.; Lu, X.; Hu, H.; Cheung, C.; Huang, Q.; Zheng, Z. Liquid–Metal-Superlyophilic and Conductivity–Strain-Enhancing Scaffold for Permeable Superelastic Conductors. Adv. Funct. Mater. 2021 , 31 , 2105587. [ Google Scholar ] [ CrossRef ]
Ma, X.; Zhang, M.; Zhang, J.; Wang, S.; Cao, S.; Li, Y.; Hu, G.; Kong, D. Highly Permeable and Ultrastretchable Liquid Metal Micromesh for Skin-Attachable Electronics. ACS Mater. Lett. 2022 , 4 , 634–641. [ Google Scholar ] [ CrossRef ]
Dong, J.; Peng, Y.; Nie, X.; Li, L.; Zhang, C.; Lai, F.; He, G.; Ma, P.; Wei, Q.; Huang, Y.; et al. Hierarchically Designed Super-Elastic Metafabric for Thermal-Wet Comfortable and Antibacterial Epidermal Electrode. Adv. Funct. Mater. 2022 , 32 , 2209762. [ Google Scholar ] [ CrossRef ]
Li, X.; Li, M.; Xu, J.; You, J.; Yang, Z.; Li, C. Evaporation-induced sintering of liquid metal droplets with biological nanofibrils for flexible conductivity and responsive actuation. Nat. Commun. 2019 , 10 , 3514. [ Google Scholar ] [ CrossRef ][ Green Version ]
Zhang, J.; Ma, B.; Chen, G.; Chen, Y.; Xu, C.; Hao, Q.; Zhao, C.; Liu, H. Surface-Embedded Liquid Metal Electrodes with Abrasion Resistance via Direct Magnetic Printing. ACS Appl. Mater. Interfaces 2022 , 14 , 53405–53412. [ Google Scholar ] [ CrossRef ]
Lee, W.; Kim, H.; Kang, I.; Park, H.; Jung, J.; Lee, H.; Park, H.; Park, J.S.; Yuk, J.M.; Ryu, S.; et al. Universal assembly of liquid metal particles in polymers enables elastic printed circuit board. Science 2022 , 378 , 637–641. [ Google Scholar ] [ CrossRef ]
Tang, J.; Zhao, X.; Li, J.; Guo, R.; Zhou, Y.; Liu, J. Gallium-Based Liquid Metal Amalgams: Transitional-State Metallic Mixtures (TransM 2 ixes) with Enhanced and Tunable Electrical, Thermal, and Mechanical Properties. ACS Appl. Mater. Interfaces 2017 , 9 , 35977–35987. [ Google Scholar ] [ CrossRef ]
Wang, X.; Fan, L.; Zhang, J.; Sun, X.; Chang, H.; Yuan, B.; Guo, R.; Duan, M.; Liu, J. Printed Conformable Liquid Metal e-Skin-Enabled Spatiotemporally Controlled Bioelectromagnetics for Wireless Multisite Tumor Therapy. Adv. Funct. Mater. 2019 , 29 , 1907063. [ Google Scholar ] [ CrossRef ]
Liu, S.; Shah, D.S.; Kramer-Bottiglio, R. Highly stretchable multilayer electronic circuits using biphasic gallium-indium. Nat. Mater. 2021 , 20 , 851–858. [ Google Scholar ] [ CrossRef ]
Figure 1. The ‘ BEER ’ requirement for flexible electronics for on-skin healthcare and the extensive applications of LM-based electronics in on-skin biomedical signals collection, on-skin microenvironment monitoring, bodily-kinesthetic recognition, thermal management, and other vital signs.
Figure 4. The biocompatibility of LMs. ( A ) The quantification of the live/dead-stained L-929 cells ( left ) and the absorption at 570 nm in MTT assay after 1–3 days of culturing [ 57 ]. Copyright: (2021) Springer Nature. ( B ) Fluorescent images of primary hippocampal neurons cultured on control tissue culture and liquid-metal-based neural electrodes at 14 days in vitro, and live/dead images of the hippocampal neurons on liquid-metal-based electrodes [ 59 ]. Copyright: (2015) WILEY-VCH. ( C ) Histology evaluation of the major organs (liver, spleen, and kidney) of LM-injected mice and control groups at different time points. Scale bars, 100 mm. d, days [ 60 ]. Copyright: (2015) Springer Nature.
Figure 4. The biocompatibility of LMs. ( A ) The quantification of the live/dead-stained L-929 cells ( left ) and the absorption at 570 nm in MTT assay after 1–3 days of culturing [ 57 ]. Copyright: (2021) Springer Nature. ( B ) Fluorescent images of primary hippocampal neurons cultured on control tissue culture and liquid-metal-based neural electrodes at 14 days in vitro, and live/dead images of the hippocampal neurons on liquid-metal-based electrodes [ 59 ]. Copyright: (2015) WILEY-VCH. ( C ) Histology evaluation of the major organs (liver, spleen, and kidney) of LM-injected mice and control groups at different time points. Scale bars, 100 mm. d, days [ 60 ]. Copyright: (2015) Springer Nature.
| https://www.mdpi.com/2079-6374/13/1/84/html |
The Great Moon Hoax Was Simply a Sign of Its Time | At the Smithsonian| Smithsonian Magazine
Scientific discoveries and faraway voyages inspired fantastic tales—and a new Smithsonian exhibition
The Great Moon Hoax Was Simply a Sign of Its Time
Scientific discoveries and faraway voyages inspired fantastic tales—and a new Smithsonian exhibition
From the Italian version of The Great Moon Hoax. Leopoldo Galluzzo,
Altre scoverte fatte nella luna dal Sigr. Herschel
(Other lunar discoveries from Signor Herschel), Napoli, 1836
Smithsonian Institution Libraries
Anyone who opened the pages of the New York Sunon Tuesday, August 25, 1835, had no idea they were reading an early work of science fiction—and one of the greatest hoaxes of all time.
In that issue began a six-part series, now known as theGreat Moon Hoax, that described the findings ofSir John Herschel, a real English astronomer who had traveled to the Cape of Good Hope in 1834 to catalog the stars of the Southern Hemisphere. But according to the Sun, Herschel found far more than stars through the lens of his telescope.
The 19th century was “the time before we knew everything,” saysKirsten van der Veenof the Smithsonian Institution’sDibner Library of the History of Science and Technology. “Science was very accessible,” she says. Common people of the time could easily read about scientific discoveries and expeditions to far-off places in the pages of newspapers, magazines and books. So the Herschel tale was not an odd thing to find in the daily paper. And that the series was supposedly a supplement to the Edinburgh Journal of Scienceleant it credibility.
But careful readers could have picked up hints early on that the story was unreal. On the first day, for example, the author claimed that Herschel had not only discovered planets outside our solar system and settled once and for all whether the moon was inhabited but also “solved or corrected nearly every leading problem of mathematical astronomy.” The story then described how Herschel had managed to create a massive telescope lens 24 feet in diameter and 7 tons in weight—six times larger than what had been the largest lens to date—and carted it all the way from England to South Africa.
Then the tale began to delve into the lunar discoveries made with the colossal telescope: First there were hints of vegetation, along with a beach of white sand and a chain of slender pyramids. Herds of brown quadrupeds, similar to bison, were found in the shade of some woods. And in a valley were single-horned goats the bluish color of lead.
From the Italian version of The Great Moon Hoax. Leopoldo Galluzzo,
Altre scoverte fatte nella luna dal Sigr. Herschel
(Other lunar discoveries from Signor Herschel), Napoli, 1836
Smithsonian Institution Libraries
More animals were documented in part three, including small reindeer, mini zebra and the bipedal beaver. “It carries its young in its arms like a human being, and moves with an easy gliding motion.” But the real surprise came on day four: creatures that looked like humans, were about four feet tall—and had wings and could fly. “We scientifically denominated them as Vespertilio-homo, or man-bat; and they are doubtless innocent and happy creatures,” the authorwrote.
Like the1938 radio programbased on H.G. Wells’ War of the Worlds, the stories in the New York Sunhad not been published as an attempt to fool anyone, but the writer “underestimated the gullibility of the public,” van der Veen says. Years later, after confessing to authorship of the series, Richard Adams Locke said that it was meant as a satire reflecting on the influence that religion had then on science. But readers lapped up the tale, which was soon reprinted in papers across Europe. An Italian publication even included beautiful lithographs detailing what Herschel had discovered.
“In the years between 1780 and 1910, scientific disciplines were coming into their own, and whole new frontiers of discovery were emerging,” saysDoug Dunlopof theSmithsonian Libraries. “The public was engaged with science at an unprecedented level. Fiction writers were inspired, too, preemptively exploring these new worlds, using science as a springboard.”
Iconographic Encyclopaedia of Science, Literature, and Art by Johann Georg Heck, New York, 1851 Smithsonian Institution Libraries
And Locke was not the only writer to perpetuate a hoax on an unsuspecting readership. Shortly before Locke’s story appeared in the Sun,Edgar Allan Poewrote his own tale,“The Unparalleled Adventure of One Hans Pfaall,”which was published in the June 1835 issue of the Southern Literary Messenger. Poe later accused Locke of stealing his idea. That isn’t certain, but Poe’s story did inspire—and even appear in—Jules Verne’s From the Earth to the Moon.
Similar to how thescience of black holesinformed the 2014 blockbuster Interstellar, discoveries of that period inspired writers during this time, though most, including Verne, labeled their works as fiction. Mary Shelley, for instance, incorporated the science of surgeonLuigi Galvaniinto her novel Frankenstein. In the late 1700s, Galvani had experimented with electricity on animals. And those readers that didn’t want to tackle an entire book could turn to illustrated dime novels such as the Frank Reade Weekly Magazine—several issues of which are on display at the museum.
“Through this exhibition, we want to highlight the impact of scientific discovery and invention,” says Dunlop, “and we hope to bridge the gap between two genres often seen as distinct.”
"Fantastic Worlds: Science Fiction, 1780-1910" is on view through October 2016 at the National Museum of American History in Washington, D.C.
| https://www.smithsonianmag.com/smithsonian-institution/great-moon-hoax-was-simply-sign-its-time-180955761/ |
Foods | Special Issue : New Insights in Microbial Diversity of Fermented Foods
Foods, an international, peer-reviewed Open Access journal.
Special Issue "New Insights in Microbial Diversity of Fermented Foods"
Special Issue Editors Special Issue Information Keywords Published Papers
A special issue of Foods(ISSN 2304-8158). This special issue belongs to the section "Food Microbiology".
Deadline for manuscript submissions: 30 November 2023 | Viewed by 2218
Special Issue Editors
Guest Editor
Department for Sustainable Food Process, Faculty of Agriculture, Food and Environmental Sciences, Università Cattolica del Sacro Cuore, Piacenza, Italy
Interests:
food microbiology; lactic acid bacteria (LAB); gut microbiota; probiotics; metagenomics; nutrigenomics
Special Issues, Collections and Topics in MDPI journals
Special Issue in Foods : Safety of Processed Meat Products
Dr. François Bourdichon
Guest Editor
Department for Sustainable Food Process, Faculty of Agriculture, Food and Environmental Sciences, Università Cattolica del Sacro Cuore, Piacenza, Italy Interests: food safety; food fermentation; food cultures
Special Issue Information
Dear Colleagues,
Fermented foods represent many food products produced across diverse cultural and geographic backgrounds and consumed worldwide. Microbial consortia associated with such products, including bacteria, fungi, and viruses, are key to the quality and safety of fermented foods, whether they act as fermentation starters or non-starters. While many studies have examined the composition of the microbial communities in fermented foods, in-depth investigations of the microbiomes, microbiota and microbial metabolites are still scarce. This Special Issue highlights research on microbiota structure and function in fermented food products, with a focus on the interaction between microorganisms and raw materials. We seek papers making a significant contribution to uncovering microbial activities and processes that affect the organoleptic, nutritional, and functional characteristics of the final products.
Dr. Vania PatroneDr. François Bourdichon Guest Editors
Manuscript Submission Information
Manuscripts should be submitted online atwww.mdpi.combyregisteringandlogging in to this website. Once you are registered,click here to go to the submission form. Manuscripts can be submitted until the deadline. All submissions that pass pre-check are peer-reviewed. Accepted papers will be published continuously in the journal (as soon as accepted) and will be listed together on the special issue website. Research articles, review articles as well as short communications are invited. For planned papers, a title and short abstract (about 100 words) can be sent to the Editorial Office for announcement on this website.
Submitted manuscripts should not have been published previously, nor be under consideration for publication elsewhere (except conference proceedings papers). All manuscripts are thoroughly refereed through a single-blind peer-review process. A guide for authors and other relevant information for submission of manuscripts is available on theInstructions for Authorspage. Foodsis an international peer-reviewed open access semimonthly journal published by MDPI.
Please visit theInstructions for Authorspage before submitting a manuscript.
TheArticle Processing Charge (APC)for publication in thisopen accessjournal is 2400 CHF (Swiss Francs).
Submitted papers should be well formatted and use good English. Authors may use MDPI'sEnglish editing serviceprior to publication or during author revisions.
Keywords
microbiota
metabolites
food safety
food security
sensorial attributes
health
Published Papers (2 papers)
Research
Bacterial and Fungal Communities Are Specifically Modulated by the Cocoa Bean Fermentation Method
by Rebecca Ghisolfi , Francesca Bandini , Filippo Vaccari , Gabriele Bellotti , Cristian Bortolini , Vania Patrone , Edoardo Puglisi and Lorenzo Morelli
Foods 2023 , 12 (10), 2024; https://doi.org/10.3390/foods12102024 - 17 May 2023
Abstract
Cocoa bean fermentation is carried out in different production areas following various methods. This study aimed to assess how the bacterial and fungal communities were affected by box, ground or jute fermentation methods, using high-throughput sequencing (HTS) of phylogenetic amplicons. Moreover, an evaluation [...] Read more.
Cocoa bean fermentation is carried out in different production areas following various methods. This study aimed to assess how the bacterial and fungal communities were affected by box, ground or jute fermentation methods, using high-throughput sequencing (HTS) of phylogenetic amplicons. Moreover, an evaluation of the preferable fermentation method was carried out based on the microbial dynamics observed. Box fermentation resulted in higher bacterial species diversity, while beans processed on the ground had a wider fungal community. Lactobacillus fermentum and Pichia kudriavzevii were observed in all three fermentation methods studied. Moreover, Acetobacter tropicalis dominated box fermentation and Pseudomonas fluorescens abounded in ground-fermented samples. Hanseniaspora opuntiae was the most important yeast in jute and box, while Saccharomyces cerevisiae prevailed in the box and ground fermentation. PICRUST analysis was performed to identify potential interesting pathways. In conclusion, there were noticeable differences between the three different fermentation methods. Due to its limited microbial diversity and the presence of microorganisms that guarantee good fermentation, the box method was found to be preferable. Moreover, the present study allowed us to thoroughly explore the microbiota of differently treated cocoa beans and to better understand the technological processes useful to obtain a standardized end-product. Full article
(This article belongs to the Special Issue New Insights in Microbial Diversity of Fermented Foods )
by
Giorgia Rampanti ,
Ilario Ferrocino ,
Joanna Harasym ,
Roberta Foligni ,
Federica Cardinali ,
Agnieszka Orkusz ,
Vesna Milanović ,
Irene Franciosa ,
Cristiana Garofalo ,
Cinzia Mannozzi ,
Massimo Mozzon ,
Andrea Osimani and
Lucia Aquilanti
Foods 2023 , 12 (1), 169; https://doi.org/10.3390/foods12010169 - 29 Dec 2022
Abstract
Queijo Serra da Estrela is a PDO Portuguese cheese produced through coagulation of raw ewe’s milk using cardoon ( Cynara cardunculus L.) flowers. The present research was aimed at depicting an up-to-date and comprehensive overview of the microbiota of Queijo Serra da Estrela [...] Read more.
Queijo Serra da Estrela is a PDO Portuguese cheese produced through coagulation of raw ewe’s milk using cardoon ( Cynara cardunculus L.) flowers. The present research was aimed at depicting an up-to-date and comprehensive overview of the microbiota of Queijo Serra da Estrela cheese. To this end, viable counting and metataxonomic analysis were carried out on cheeses sampled from four Portuguese artisan producers. Physico-chemical and morpho-textural analyses were also performed, together with the analysis of volatile organic compounds (VOCs). Finally, non-starter lactic acid bacteria (NSLAB) isolated from the cheeses were characterized for their enzymatic activities using a semi-quantitative method. According to the metataxonomic analysis, Lactococcus lactis and Lactococcus piscium were the species occurring at the highest relative abundance. The isolates collected from the cheeses were assigned to Enterococcus durans , Enterococcus faecalis , Enterococcus faecium , Enterococcus lactis , Levilactobacillus brevis , Latilactobacillus graminis , Leuconostoc mesenteroides , and the Lacticaseibacillus casei group. The enzymatic characterization of these cultures highlighted esterase, aminopeptidase, acid phosphatase, beta-galactosidase, alpha-glucosidase, and beta-glucosidase among the major enzymatic activities. Fungal populations were dominated by Debaryomyces hansenii and Kurtzmaniella zeylanoides ; however, species rarely found in cheese (e.g., Candida boidinii, Vishniacozyma victoriae , and Starmerella ) were also detected. The volatile compounds characterizing the analyzed cheeses were carboxylic acids and esters, followed by carbonyl compounds and alcohols. Full article
Foods ,
EISSN 2304-8158,
Published by MDPI
| https://www.mdpi.com/journal/foods/special_issues/9F16B04277 |
Search Results - NHS
The Birches;44 Newbold Road;Elm Lodge Care Home;Riverdale Care Home;Bank Close House;Laurieston House;Liberty House;Meadow Grange;The Callywhite Care Home;Heather Vale
Results for Care home without nursing in Old Brampton
Store Old Brampton as your main location for future visits?
Showing 11-20 of 742 results
Care-home-without-nursing details Address & contact details NHS.UK users rating Care Quality Commission inspection ratings Registered manager in post Food hygiene rating Size of care home More about NHS.UK users rating More about Care Quality Commission inspection ratings More about Registered manager in post More about Food hygiene rating More about Size of care home Details NHS.UK users rating Care Quality Commission inspection ratings Registered manager in post Food hygiene rating Size of care home The Birches238703 Add The Birches to shortlist Address & contact detailsTel: 01246 20295518 Gladstone RoadChesterfieldDerbyshireS40 4TE2.6 miles away NHS.UK users rating More about NHS.UK users rating No ratings yet Rate it yourself Care Quality Commission inspection ratings More about Care Quality Commission inspection ratings Good Visit CQC profile Registered manager in post More about Registered manager in post Yes registered manager in post Food hygiene rating More about Food hygiene rating No rating available Size of care home More about Size of care home Small 7 beds 44 Newbold Road10182954 Add 44 Newbold Road to shortlist Address & contact detailsTel: 0124689901244 Newbold RoadChesterfieldDerbyshireS41 7PL2.7 miles away NHS.UK users rating More about NHS.UK users rating No ratings yet Rate it yourself Care Quality Commission inspection ratings More about Care Quality Commission inspection ratings Good Visit CQC profile Registered manager in post More about Registered manager in post Yes registered manager in post Food hygiene rating More about Food hygiene rating No rating available Size of care home More about Size of care home Small 9 beds Elm Lodge Care Home246388 Add Elm Lodge Care Home to shortlist Address & contact detailsTel: 01246456755Stand RoadChesterfieldDerbyshireS41 8SJ2.8 miles away NHS.UK users rating More about NHS.UK users rating No ratings yet Rate it yourself Care Quality Commission inspection ratings More about Care Quality Commission inspection ratings Requires Improvement Visit CQC profile Registered manager in post More about Registered manager in post Yes registered manager in post Food hygiene rating More about Food hygiene rating 5 Very good Size of care home More about Size of care home Medium 46 beds Riverdale Care Home6795169 Add Riverdale Care Home to shortlist Address & contact detailsTel: 01246275003Sheffield RoadChesterfieldDerbyshireS41 7LL2.9 miles away NHS.UK users rating More about NHS.UK users rating No ratings yet Rate it yourself Care Quality Commission inspection ratings More about Care Quality Commission inspection ratings Good Visit CQC profile Registered manager in post More about Registered manager in post Yes registered manager in post Food hygiene rating More about Food hygiene rating 5 Very good Size of care home More about Size of care home Medium 40 beds Bank Close House238710 Add Bank Close House to shortlist Address & contact detailsTel: 01246208833Hasland RoadHaslandChesterfieldDerbyshireS41 0RZ3.4 miles away NHS.UK users rating More about NHS.UK users rating No ratings yet Rate it yourself Care Quality Commission inspection ratings More about Care Quality Commission inspection ratings Requires Improvement Visit CQC profile Registered manager in post More about Registered manager in post Yes registered manager in post Food hygiene rating More about Food hygiene rating 5 Very good Size of care home More about Size of care home Medium 27 beds Laurieston House238705 Add Laurieston House to shortlist Address & contact detailsTel: 01246238213118 Hady HillHadyChesterfieldDerbyshireS41 0EF3.7 miles away NHS.UK users rating More about NHS.UK users rating No ratings yet Rate it yourself Care Quality Commission inspection ratings More about Care Quality Commission inspection ratings Good Visit CQC profile Registered manager in post More about Registered manager in post Yes registered manager in post Food hygiene rating More about Food hygiene rating No rating available Size of care home More about Size of care home Small 5 beds Liberty House3994727 Add Liberty House to shortlist Address & contact detailsTel: 0124620257228 The GreenHaslandChesterfieldS41 0LJ4.0 miles away NHS.UK users rating More about NHS.UK users rating No ratings yet Rate it yourself Care Quality Commission inspection ratings More about Care Quality Commission inspection ratings Requires Improvement Visit CQC profile Registered manager in post More about Registered manager in post Yes registered manager in post Food hygiene rating More about Food hygiene rating No rating available Size of care home More about Size of care home Small 7 beds Meadow Grange238603 Add Meadow Grange to shortlist Address & contact detailsTel: 01142891110Homesfield RoadDronfieldDerbyshireS18 8WS4.2 miles away NHS.UK users rating More about NHS.UK users rating No ratings yet Rate it yourself Care Quality Commission inspection ratings More about Care Quality Commission inspection ratings Good Visit CQC profile Registered manager in post More about Registered manager in post Yes registered manager in post Food hygiene rating More about Food hygiene rating 5 Very good Size of care home More about Size of care home Large 60 beds The Callywhite Care Home5065232 Add The Callywhite Care Home to shortlist Address & contact detailsTel: 01246 291515Callywhite LaneDronfieldDerbyshireS18 2XD4.2 miles away NHS.UK users rating More about NHS.UK users rating No ratings yet Rate it yourself Care Quality Commission inspection ratings More about Care Quality Commission inspection ratings Requires Improvement Visit CQC profile Registered manager in post More about Registered manager in post Yes registered manager in post Food hygiene rating More about Food hygiene rating No rating available Size of care home More about Size of care home Medium 39 beds Heather Vale238708 Add Heather Vale to shortlist Address & contact detailsTel: 080 0032 8750Heather Vale RoadHaslandChesterfieldDerbyshireS41 0HZ4.3 miles away NHS.UK users rating More about NHS.UK users rating No ratings yet Rate it yourself Care Quality Commission inspection ratings More about Care Quality Commission inspection ratings Requires Improvement Visit CQC profile Registered manager in post More about Registered manager in post Yes registered manager in post Food hygiene rating More about Food hygiene rating 4 Good Size of care home More about Size of care home Medium 39 beds
| https://www.nhs.uk/service-search/other-services/Care-home-without-nursing/Old-Brampton/Results/577/-1.498/53.243/1832/16107?ResultsOnPageValue=10¤tPage=2&distance=25&isNational=0&totalItems=743 |
Convalescent Plasma vs. Standard Plasma for COVID-19 - Full Text View - ClinicalTrials.gov
Convalescent Plasma vs. Standard Plasma for COVID-19
The safety and scientific validity of this study is the responsibility of the study sponsor and investigators. Listing a study does not mean it has been evaluated by the U.S. Federal Government.
Read our disclaimer for details.
ClinicalTrials.gov Identifier: NCT04344535 Recruitment Status :
Terminated (Insufficient eligible and consenting patients) First Posted : April 14, 2020 Results First Posted : December 6, 2021 Last Update Posted : December 6, 2021
Sponsor:
Stony Brook University
Information provided by (Responsible Party):
Elliott Bennett-Guerrero, Stony Brook University
Study Details
Study Description
Top of Page Study Description Study Design Arms and Interventions Outcome Measures Eligibility Criteria Contacts and Locations More Information
Brief Summary:
The purpose of this study is to find out if transfusion of blood plasma containing antibodies against COVID-19 (anti-SARS-CoV-2), which were donated from a patient who recovered from COVID-19 infection, is safe and can treat COVID-19 in hospitalized patients.
Antibodies are blood proteins produced by the body in response to a virus and can remain in the person's bloodstream (plasma) for a long time after they recover. Transferring plasma from a person who recovered from COVID-19 may help neutralize the virus in sick patients' blood, and/or reduce the chances of the infection getting worse.
Condition or disease Intervention/treatment Phase COVID Biological: Convalescent Plasma Biological: Standard Donor Plasma Phase 1 Phase 2
Study Design
Layout table for study information Study Type : Interventional
(Clinical Trial) Actual Enrollment : 82 participants Allocation: Randomized Intervention Model: Parallel Assignment Masking: Quadruple (Participant, Care Provider, Investigator, Outcomes Assessor) Masking Description: Staff in Transfusion Services (Blood Bank) at Stony Brook will be unblinded so they can collect, store, and dispense either convalescent plasma or standard plasma. They will affix an approved label with all required information, e.g. bar code, blood type, expiration date, and will indicate that the bag contains convalescent plasma/standard plasma. Primary Purpose: Treatment Official Title: Convalescent Plasma to Reduce Complications Associated With COVID-19 Infection: A Randomized Trial Comparing the Efficacy and Safety of High-Titer Anti-SARS-CoV-2 Plasma vs. Standard Plasma in Hospitalized Patients With COVID- 19 Infection Actual Study Start Date : April 8, 2020 Actual Primary Completion Date : January 1, 2021 Actual Study Completion Date : February 1, 2021
MedlinePlus related topics: COVID-19 (Coronavirus Disease 2019)
Arms and Interventions
Top of Page Study Description Study Design Arms and Interventions Outcome Measures Eligibility Criteria Contacts and Locations More Information
Arm Intervention/treatment Active Comparator: Convalescent Donor Plasma Biological: Convalescent Plasma 450-550 mL of plasma containing anti-SARS-CoV-2 antibody titer ideally > 1:320, but meeting minimum titer per FDA Guidelines for convalescent plasma. Placebo Comparator: Standard Donor Plasma Biological: Standard Donor Plasma 450-550 mL of plasma with low titer to anti-SARS-CoV-2 antibodies
Outcome Measures
Top of Page Study Description Study Design Arms and Interventions Outcome Measures Eligibility Criteria Contacts and Locations More Information
Primary Outcome Measures
:
28 Day Ventilator Free Days [ Time Frame: 28 days post randomization ]
Number of days a patient is receiving mechanical invasive ventilation through 28 days post randomization. Patients who die during this time period are assigned 0 ventilator free days.
Secondary Outcome Measures
:
90 Day All-cause Mortality [ Time Frame: 90 days ]
All cause mortality from randomization until 90 days post randomization
Eligibility Criteria
Choosing to participate in a study is an important personal decision. Talk with your doctor and family members or friends about deciding to join a study. To learn more about this study, you or your doctor may contact the study research staff using the contacts provided below. For general information, Learn About Clinical Studies.
Layout table for eligibility information Ages Eligible for Study: 18 Years and older (Adult, Older Adult) Sexes Eligible for Study: All Accepts Healthy Volunteers: No
Criteria
There are 2 groups of research subjects: plasma donor and recipients
Volunteer plasma donors can donate Convalescent Plasma if they:
have adequate antibody levels against COVID-19 per FDA Guidelines
have had no symptoms of COVID-19 for at least 14 days
meet routine plasma donation criteria
Inclusion Criteria for Plasma Recipients:
Adults 18 years of age or older
Hospitalized with PCR+ COVID-19 infection
If female must not be pregnant and/or breastfeeding.
Exclusion Criteria for Plasma Recipients:
Unable to randomize patient within 14 days of admission to Stony Brook Hospital (or any other hospital if a transfer to Stony Brook Hospital).
In the treating physician's opinion, the patient cannot tolerate a 450-550 mL infusion of plasma over up to 8 hours (4 hours max per unit), even if prophylaxed with intravenous diuretic
Contraindication to transfusion or history of prior reactions to blood transfusions
Contacts and Locations
To learn more about this study, you or your doctor may contact the study research staff using the contact information provided by the sponsor.
Please refer to this study by its ClinicalTrials.gov identifier (NCT number): NCT04344535
Locations
Layout table for location information United States, New York Stony Brook University Hospital Stony Brook, New York, United States, 11794
Sponsors and Collaborators
Stony Brook University
Investigators
Layout table for investigator information Principal Investigator: Elliott Bennett-Guerrero, MD Stony Brook Hospital
Study Documents (Full-Text)
Documents provided by Elliott Bennett-Guerrero, Stony Brook University:
Study Protocol and Statistical Analysis Plan [PDF] October 16, 2020
Publications automatically indexed to this study by ClinicalTrials.gov Identifier (NCT Number):
Piechotta V, Iannizzi C, Chai KL, Valk SJ, Kimber C, Dorando E, Monsef I, Wood EM, Lamikanra AA, Roberts DJ, McQuilten Z, So-Osman C, Estcourt LJ, Skoetz N. Convalescent plasma or hyperimmune immunoglobulin for people with COVID-19: a living systematic review. Cochrane Database Syst Rev. 2021 May 20;5(5):CD013600. doi: 10.1002/14651858.CD013600.pub4.
Bennett-Guerrero E, Romeiser JL, Talbot LR, Ahmed T, Mamone LJ, Singh SM, Hearing JC, Salman H, Holiprosad DD, Freedenberg AT, Carter JA, Browne NJ, Cosgrove ME, Shevik ME, Generale LM, Andrew MA, Nachman S, Fries BC; Stony Brook Medicine COVID Plasma Trial Group. Severe Acute Respiratory Syndrome Coronavirus 2 Convalescent Plasma Versus Standard Plasma in Coronavirus Disease 2019 Infected Hospitalized Patients in New York: A Double-Blind Randomized Trial. Crit Care Med. 2021 Jul 1;49(7):1015-1025. doi: 10.1097/CCM.0000000000005066.
Layout table for additonal information Responsible Party: Elliott Bennett-Guerrero, Professor of Anesthesiology, Stony Brook University ClinicalTrials.gov Identifier: NCT04344535 History of Changes Other Study ID Numbers: SBU-COVID19-ConvalescentPlasma First Posted: April 14, 2020 Key Record Dates Results First Posted: December 6, 2021 Last Update Posted: December 6, 2021 Last Verified: December 2021 Individual Participant Data (IPD) Sharing Statement: Plan to Share IPD: No
Layout table for additional information Studies a U.S. FDA-regulated Drug Product: Yes Studies a U.S. FDA-regulated Device Product: No
Additional relevant MeSH terms:
Layout table for MeSH terms COVID-19 Pneumonia, Viral Pneumonia Respiratory Tract Infections Infections Virus Diseases Coronavirus Infections Coronaviridae Infections Nidovirales Infections RNA Virus Infections Lung Diseases Respiratory Tract Diseases
For Patients and Families
U.S. Department of Health and Human Services
| https://clinicaltrials.gov/ct2/show/NCT04344535 |
Coral Reef of Key Biscayne Developers | District Court of Appeal of Florida | 07-13-2005 | www.anylaw.com
Research the case of Coral Reef of Key Biscayne Developers, from the District Court of Appeal of Florida, 07-13-2005. AnyLaw is the FREE and Friendly legal research service that gives you unlimited access to massive amounts of valuable legal data.
Coral Reef of Key Biscayne Developers
911 So.2d 155 (2005) | Cited 1 time
| District Court of Appeal of Florida | July 13, 2005
Before CORTINAS, ROTHENBERG, JJ., and BARKDULL, Senior Judge.
We review a petition for writ of certiorari filed by Coral Reef of Key Biscayne Developers, Inc. ("petitioner") challenging a court order disqualifying all of its counsel of record. 1The sole basis for the disqualification was the trial court's conclusion that the petitioner's counsel acquired useful information and an unfair tactical advantage from privileged documents afforded by a court order, which was subsequently quashed by this court. See Butler, Pappas, et. al. v. Coral Reef of Key Biscayne Developers, Inc., 873 So. 2d 339 (Fla. 3d DCA 2003). Because the trial court's order departs from the essential requirements of the law, we grant the petition for writ of certiorari. See Marcus & Marcus, P.A. v. Sinclair, 731 So. 2d 846 (Fla. 3d DCA 1999).
This case arises from an insurance dispute, which has been extensively litigated since 2000. The petitioner owns a rental apartment complex in Key Biscayne, Florida, and had obtained property insurance from Lloyd's Underwriters at London ("respondent"). In the fall of 1999, the petitioner submitted insurance claims to the respondent for the cost of repairing property damage due to hidden decay. Both parties retained adjusters. The respondent agreed to pay approximately $550,000 to commence repairs on the property, but held back $4.76 million.
In September 2000, the petitioner, represented by attorney Gonzalo Dorta, brought an action against the respondent to recover the held-back insurance funds. In January 2001, the respondent's counsel, Butler, Pappas, et al. ("Butler Firm"), sent a letter to the petitioner denying its claim and accusing the petitioner of attempting to commit insurance fraud.
Pertinent to this case are the affidavits of Jon Stettin, the respondent's independent adjuster, and Frank Inguanzo, the petitioner's adjuster. Both of their affidavits indicated that the underlying motive and reason for the accusation of fraud in the respondent's letter was to intimidate and coerce the petitioner.
Initially, the trial court reviewed these affidavits and found that the petitioner had met its burden of piercing the attorney-client privilege based on the crime-fraud exception. The trial court entered an order compelling discovery of the communications between the respondent and the Butler Firm. On a petition for writ of certiorari, we quashed the trial court's order and reinstated the attorney-client privilege, effectively finding that the petitioner's counsel should have never seen any of the documents. See Butler, Pappas, 873 So. 2d at 343.
Subsequently, the respondent moved to disqualify all of the petitioner's attorneys from the proceedings on the ground that they obtained an unfair advantage from their review of confidential documents. The trial court granted the respondent's motion and entered an order disqualifying all of the petitioner's individual attorneys, as well as their respective law firms.
Florida courts have consistently held that disqualification of a party's chosen counsel is an extraordinary remedy. See Whitener v. First Union Nat'l Bank of Fla., 901 So. 2d 366 (Fla. 5th DCA 2005); Alexander v. Tandem Staffing Solutions, Inc., 881 So. 2d 607 (Fla. 4th DCA 2004); Cunningham v. Appel, 831 So. 2d 214 (Fla. 5th DCA 2002); Allstate Ins. Co. v. Bowne, 817 So. 2d 994 (Fla. 4th DCA 2002); Arcara v. Philip M. Warren, P.A., 574 So. 2d 325 (Fla. 4th DCA 1991). Moreover, motions for disqualification are viewed with skepticism because disqualification impinges on a party's right to employ a lawyer of choice, and such motions are often brought for tactical purposes. Alexander, 881 So. 2d at 609. Since the remedy of disqualification strikes at the heart of one of the most important associational rights, it must be employed only in extremely limited circumstances. Kusch v. Ballard, 645 So. 2d 1035 (Fla. 4th DCA 1994).
We review whether the trial court departed from the essential requirements of law in disqualifying the petitioner's counsel. See Schultz v. Schultz, 783 So. 2d 329, 330 (Fla. 4th DCA 2001). Although the trial court's discretion is limited by applicable legal principles, this court will not disturb the trial court's findings of fact unless those findings are not supported by competent substantial evidence. Id.
Florida courts have squarely addressed the standard for disqualification of counsel due to the receipt of privileged documents through "inadvertent disclosure." See Sinclair, 731 So. 2d 846; Abramar Housing & Dev., Inc. v. Lisa Daly Lady Decor, Inc., 724 So. 2d 572 (Fla. 3d DCA 1998). In "inadvertent disclosure" cases, disqualification of counsel may result if the attorney receiving the documents gains an unfair tactical advantage by virtue of that disclosure. See Abramar, 724 So. 2d at 573. The trial court applied this standard in its order disqualifying the petitioner's attorneys.
We hold that a higher standard must apply for disqualifying counsel when the privileged documents are received pursuant to a court order that is subsequently vacated. Contrary to the "inadvertent disclosure" cases, the mere possibility of an unfair tactical advantage cannot give rise to the drastic remedy of disqualification in cases where the disclosure results from a court order.
In so holding, we are persuaded by the Supreme Court of Texas' decision in In Re Nitla S.A. de C.V., 92 S.W.3d 419 (Tex. 2002). In that case, the court considered the appropriate standard for granting a motion to disqualify counsel where the plaintiff's counsel received the privileged documents by a court order that was subsequently quashed. Id. at 420. The court found that, under those circumstances, the party moving to disqualify counsel must show that (1) the opposing counsel's review of the privileged documents caused actual harm to the moving party, and (2) disqualification is necessary because the trial court lacks means to remedy the moving party's harm. Id. at 423.
Notably, many courts also emphasize that due to the extraordinary nature of disqualification, even if a lawyer violates a disciplinary rule or engages in unethical conduct to retrieve the privileged documents, the party seeking disqualification must demonstrate that the opposing counsel's conduct caused severe prejudice that warrants disqualification. See, e.g., Nitla, 92 S.W.3d 419; In Re Bivens, 2005 WL 980589 (Tex. App. 2005); Holland v. The Gordy Co., 2003 WL 1985800 (Mich. Ct. App. 2003); Kusch, 645 So. 2d 1035.
Here, as in Nitla, the respondent failed to proffer before the trial court any evidence of actual harm caused by opposing counsel's review of the privileged documents. See Nitla, 92 S.W.3d at 423 (finding that privileged documents that enable the plaintiff's counsel to identify four new harmful witnesses to depose did not constitute actual harm). As "most devastating," the respondent's brief cited to an opinion letter from the Butler Firm to the respondent's representative detailing the Butler Firm's recommendation on whether to deny the petitioner's insurance claim. However, much of the content in the opinion letter was disclosed to the petitioner in the respondent's letter denying coverage. The respondent further argued that it was harmed because the privileged documents discussed whether the denial letter should be issued under the letterhead of the respondent, the Butler Firm, or the respondent's independent adjuster. We find that this information does not constitute actual harm and, in any event, its disclosure could be remedied by the trial court limiting all testimony pertaining to the communications in those documents.
Disqualification is a severe measure, and the respondent failed to meet its burden of showing that disqualification is necessary because the trial court lacks any lesser means to alleviate the harm. See Bowne, 817 So. 2d at 999; Swensen's Ice Cream Co. v. Voto, Inc., 652 So. 2d 961, 962 (Fla. 4th DCA 1995). Since we are dealing with privileged documents, we decline to set out in this opinion the specific procedures to be implemented to preserve the confidentiality of the information. We leave this to the trial court for determination, noting only that there are various measures that the trial court could employ, such as returning the documents to the respondent, destroying the copies, and/or restricting evidence related to the privileged information.
It bears repeating that we do not face a situation where a lawyer obtained privileged information inadvertently and then utilized it improperly. Undoubtedly, there are some situations when a party's lawyer reviews another party's privileged documents outside the normal course of discovery and, therefore, must be disqualified. See Abramar, 724 So. 2d at 574 (finding that the respondent's inadvertent disclosure of documents, followed by the plaintiff's recalcitrance in rectifying the disclosure, warranted disqualification of plaintiff's counsel).
We note that the disclosure of privileged information could have been avoided had the trial court 2issued a protective order to seal the information while the respondent sought immediate appellate review of the order compelling discovery of the documents. See Haines v. Liggett Group, 975 F.2d 81, 97 (3d Cir. 1992). Nevertheless, focusing on the trial court's refusal to seal the documents during the appeal process would unjustifiably sanction the petitioner for following the trial court's order.
Accordingly, we grant the petition for writ of certiorari, quash the order, and remand the cause with directions that the trial court enter an order denying the respondent's motion to disqualify the petitioner's counsel.
Certiorari granted; order quashed; and cause remanded.
1. The petitioner's counsel of record are Gonzalo R. Dorta, Geoffrey Marks, Bart Billbrough, Ervin A. Gonzalez, Manuel Kadre, and their respective law firms.
2. This was addressed by a prior trial judge.
| https://www.anylaw.com/case/coral-reef-of-key-biscayne-developers/district-court-of-appeal-of-florida/07-13-2005/_asgSmYBTlTomsSBHxXr |
Notice of copyright infringement | Statista
Find statistics, consumer survey results and industry studies from over 22,500 sources on over 60,000 topics on the internet& #39;s leading statistics database
Skip to main content
statista.com
statista.es
statista.de
statista.fr
Prices & Access
Single Accounts
Business Solutions
Academia and Government
Statistics
All Industries
Consumer Goods & FMCG
Internet
Media & Advertising
Retail & Trade
Sports & Recreation
Technology & Telecommunications
Transportation & Logistics
Travel, Tourism & Hospitality
Most-viewed Statistics
Recent StatisticsPopular Statistics
Facebook: quarterly number of MAU (monthly active users) worldwide 2008-2023
Quarterly smartphone market share worldwide by vendor 2009-2023
Number of apps available in leading app stores Q3 2022
OPEC oil price annually 1960-2023
Big Mac index worldwide 2023
Topics
Topic Overview
Smartphones - statistics & facts
Social media - Statistics & Facts
Top Report
View Report
Industry Overview
Reports
Report Shop
Search our report database
Digital & Trend reports
Overview and forecasts on trending topics
Industry & Market reports
Industry and market insights and forecasts
Companies & Products reports
Key figures and rankings about companies and products
Consumer & Brand reports
Consumer and brand insights and preferences in various industries
Politics & Society reports
Detailed information about political and social topics
Country & Region reports
All key figures about countries and regions
Find your information in our database containing over 20,000 reports
New
Market Insights
Market forecast and expert KPIs for 1000+ markets in 190+ countries & territories
Explore Market Insights
Consumer
Digital
Mobility
Consumer Insights
Insights on consumer attitudes and behavior worldwide
2,000,000+ interviews
15,000+ brandsExplore Consumer Insights
Company Insights
Business information on 70m+ public and private companies
100+ industries
200+ countries and territories
Explore Company Insights
eCommerce Insights
Detailed information for 35,000+ online stores and marketplaces
70+ KPIs per store
Revenue analytics and forecastsExplore eCommerce Insights
Daily Data
Services
The Statistics Portal
Directly accessible data for 170 industries from 150+ countries and over 1 Mio. facts.
About Statista
Why trust Statista
First Steps and Help Centre
Live webinars & recordings
Tools
Business Plan Export
Publication Finder
Statista Services
Statista Q
Customized Research & Analysis projects:Statista Q
askStatista
Get quick analyses with our professional research serviceaskStatista
Statista R
The best of the best: the portal for top lists & rankings:Statista R
Statista Content & Design
Transforming Data into Design:
Customized infographic service
Presentation Design
Animated videos
Whitepapers, E-Books, etc.
Statista Content & Design
nxt statista
Strategy and business building for the data-driven economy:nxt statista
Single Accounts
Business Solutions
Academia and Government
Popular Statistics
Topics
Markets
Reports
Market Insights
Consumer Insights
Company Insights
eCommerce Insights
Daily Data
Content & Design
Research projects
Ask Statista
Business Plan Export
Publication Finder
Statista R
DE
ES
FR
Notice of copyright infringement
Information on when we delete personal data, the countries where we save data (e.g., US, EU, Singapore), and the companies we collaborate with can be found in ourprivacy statement.
Home
About Statista
Career
Contact
Help & FAQ
Report Bug
Our Media Partners
Privacy
Imprint
Menu
Prices & Access
Popular Statistics
Industries
Daily Data
Content & Design projects
Research projects
AskStatista
statista.de
statista.es
statista.fr
Cookie Consent Manager
General Information
General Information
When you visit any website, it may store or retrieve information on your browser, mostly in the form of cookies. This information might be about you, your preferences or your device and is mostly used to make the site work as you expect it to. The information does not usually directly identify you, but it can give you a more personalized web experience. Because we respect your right to privacy, you can choose not to allow some types of cookies. Click on the different category headings to find out more and change our default settings. However, blocking some types of cookies may impact your experience of the site and the services we are able to offer.
More information
Necessary Cookies
Necessary Cookies
Always Active
These cookies are necessary for the website to function and cannot be switched off in our systems. They are usually only set in response to actions made by you which amount to a request for services, such as setting your privacy preferences, logging in or filling in forms. You can set your browser to block or alert you about these cookies, but some parts of the site will not then work. These cookies do not store any personally identifiable information.
Functional Cookies
Functional Cookies
Functional CookiesInactive
These cookies enable the website to provide enhanced functionality and personalisation. They may be set by us or by third party providers whose services we have added to our pages. If you do not allow these cookies then some or all of these services may not function properly.
Performance Cookies
Performance Cookies
Performance CookiesInactive
These cookies allow us to count visits and traffic sources so we can measure and improve the performance of our site. They help us to know which pages are the most and least popular and see how visitors move around the site. All information these cookies collect is aggregated and therefore anonymous. If you do not allow these cookies we will not know when you have visited our site, and will not be able to monitor its performance.
Targeting Cookies
Targeting Cookies
Targeting CookiesInactive
These cookies may be set through our site by our advertising partners. They may be used by those companies to build a profile of your interests and show you relevant adverts on other sites. They do not store directly personal information, but are based on uniquely identifying your browser and internet device. If you do not allow these cookies, you will experience less targeted advertising.
Back
Vendor Search
ConsentLeg.Interest
checkbox labellabel
checkbox labellabel
checkbox labellabel
Name
cookie name
checkbox labellabel
By clicking “Accept all,” you agree to the storage of cookies on your device to improve website navigation, analyze website usage, and assist with our marketing efforts. If you click on "Only necessary," only cookies that are required for technical reasons to operate the website will be used.Privacy Statement
| https://www.statista.com/statistics/report-content/statistic/288829 |
UiTM Postgraduate Tracking System (UPTrackS) Adoption of Blockchain for Postgraduate Good Goverance Practice Universiti Teknologi Mara (UiTM) | Request PDF
Request PDF | On Jan 1, 2022, Aman Mohd Ihsan Bin Mamat and others published UiTM Postgraduate Tracking System (UPTrackS) Adoption of Blockchain for Postgraduate Good Goverance Practice Universiti Teknologi Mara (UiTM) | Find, read and cite all the research you need on ResearchGate
UiTM Postgraduate Tracking System (UPTrackS) Adoption of Blockchain for Postgraduate Good Goverance Practice Universiti Teknologi Mara (UiTM)
DOI: 10.2139/ssrn.4141413
Aman Mohd Ihsan Bin Mamat
Siti Farhana Zakaria
Universiti Teknologi MARA
Article
Tang Xianbin
Wu Qiong
The most powerful and crucial concept today is a sustainable digital economy. This research is aimed to investigate the predictors of a sustainable digital economy in China. In addition, the mediating roles of social reforms and economic policies were investigated between good governance and a sustainable digital economy. This cross-sectional research considered partial least square–structural equational modeling (PLS-SEM) as an analysis technique. The data were collected from 317 managerial staff of the e-commerce industry in China via a self-structured questionnaire. A random sampling technique was applied in the data collection process. Results showed that good governance positively impacts the sustainable digital economy, social reforms, and economic policies. Additionally, an increase in social reforms and economic policies led to a sustainable digital economy in China. Social reforms and economic policies partially mediated the relationship between good governance and a sustainable digital economy. This research contributes to the body of knowledge by identifying components of a sustainable digital economy and examining whether good governance may aid in attaining a sustainable digital economy. Nowadays, research on the sustainable digital economy has got attention from policymakers and researchers around the globe. These outcomes suggest several ways to improve the sustainable digital economy in China. This research is not without limitations, such as cross-sectional and based on responses of the respondents. Several research avenues were discussed and can be influenced by many factors for future perspectives.
The Relationship of Good University Governance and Student Satisfaction
Article
Full-text available
Oct 2019
Mr Muhsin
s. Martono
Ahmad Nurkhin
Ahmad Fadhly Arham
The purpose of this paper is to examine the relationship of good university governance, teaching quality of lecturers and student satisfaction. It also aims to examine the effect of learning facilities on good university governance and student satisfaction. 361 students of the Faculty of Economics, Semarang State University, were involved in this study using proportionate random sampling. Then, to gather the data, a questionnaire was distributed, and the data were analyzed by applying SEM-PLS. The results showed that good university governance, teaching quality of lecturers, and learning facilities had a positive and significant effect on student satisfaction. The teaching quality of lecturers is proven to be influenced by good university governance. In addition, learning facilities also have a significant effect on good university governance.
Modern Bureautration Models
Article
Full-text available
Jan 2018
H. A. Jamaluddin
Article
Full-text available
Oct 2017
Muhamed Turkanović
Marko Hölbl
Kristjan Košič
Aida Kamisalic
Blockchain technology enables the creation of a decentralized environment where transactions and data are not under the control of any third party organization. Any transaction ever completed is recorded in a public ledger in a verifiable and permanent way. Based on blockchain technology, we propose a global higher education credit platform, named EduCTX. This platform is based on the concept of the European Credit Transfer and Accumulation System (ECTS). It constitutes a globally trusted, decentralized higher education credit and grading system that can offer a globally unified viewpoint for students and higher education institutions (HEIs), as well as for other potential stakeholders such as companies, institutions, and organizations. As a proof of concept, we present a prototype implementation of the environment, based on the open-source Ark Blockchain Platform. Based on a globally distributed peer-to-peer network, EduCTX will process, manage and control ECTX tokens, which represent credits that students gain for completed courses such as ECTS. HEIs are the peers of the blockchain network. The platform is a first step towards a more transparent and technologically advanced form of higher education systems. The EduCTX platform represents the basis of the EduCTX initiative which anticipates that various HEIs would join forces in order to create a globally efficient, simplified and ubiquitous environment in order to avoid language and administrative barriers. Therefore we invite and encourage HEIs to join the EduCTX initiative and the EduCTX blockchain network.
Re-inventing PTPTN study loan with blockchain and smart contracts
Conference Paper
Full-text available
May 2017
Haneffa Muchlis Gazali
Rusni Hassan
Rizal Mohd Nor
Hafizur M.M. Rahman
An Introduction to the Blockchain and Its Implications for Libraries and Medicine
Article
Matthew B Hoy
The blockchain is a relatively new technology used to verify and store transaction records for online cryptocurrencies like Bitcoin. The system is redundant and distributed, making it difficult for transactions to be rescinded, duplicated, or faked. Beyond online currencies, the blockchain has potential uses in health care, education, and many other fields. This column will briefly describe what the blockchain is and how it is being used, potential future uses that may be of interest to librarians and medical practitioners, and some of the problems with the system.
A Theoretical Extension of the Technology Acceptance Model: Four Longitudinal Field Studies
Article
Full-text available
Feb 2000
Viswanath Venkatesh
Fred D. Davis
The present research develops and tests a theoretical extension of the Technology Acceptance Model (TAM) that explains perceived usefulness and usage intentions in terms of social influence and cognitive instrumental processes. The extended model, referred to as TAM2, was tested using longitudinal data collected regarding four different systems at four organizations (N = 156), two involving voluntary usage and two involving mandatory usage. Model constructs were measured at three points in time at each organization: preimplementation, one month postimplementation, and three months postimplementation. The extended model was strongly supported for all four organizations at all three points of measurement, accounting for 40%--60% of the variance in usefulness perceptions and 34%--52% of the variance in usage intentions. Both social influence processes (subjective norm, voluntariness, and image) and cognitive instrumental processes (job relevance, output quality, result demonstrability, and perceived ease of use) significantly influenced user acceptance. These findings advance theory and contribute to the foundation for future research aimed at improving our understanding of user adoption behavior.
The counterfeit degree certificate: application of blockchain technology in higher education in India
Article
May 2022
Libr Hi Tech News
Sanjay Kumar Jha
Purpose
In this work-in-progress, the application of blockchain technology (BT) in higher education in India – involving academic institutions, students and verifiers – in the wake of fake degrees (racket) being issued at a large scale from universities across the country is being investigated. This paper considers providing new methods of database system in education, and implementing the new BT in education can increase transparency and security in the education system.
Design/methodology/approach
This study used interview methodology (asking interview participants a series of informal questions to obtain knowledge).
Findings
Private and public sector organizations have many challenges to overcome in synchronizing and aligning their digital transformation efforts to enable the network effects to take hold. India’s policymakers, civil society leaders, senior business leaders and entrepreneurs are building strong clusters to help the country be the leader of the next era of the internet as a platform that helps transform human affairs for the benefit of the citizens. Executives can contribute to the digital ecosystem by creating open and collaborative cultures where knowledge and innovation are shared with the industry for the benefit of the masses and, more so, to establish quality and communication standards. They also can contribute by staying open to change, embracing digital adoption and transformation within their management models and infrastructure. It is time for institutions to rethink their processes and governance structures to become more agile and innovative players. The success of a harmonious digital identity ecosystem relies on staying ahead of the organization’s digital curve. As a first step to provide better quality in the provision of public services, Secure Key Technologies’ blockchain-based ecosystem (securekey.com) allows multiple partners to strengthen the authentication and provides identity attribute validation as a fabric of trust and as a solid foundation to embrace a new digital era. Secure Key Technologies’ vision for the future of digital identities redefines the ways both consumers and businesses approach identity verification and the sharing of key personal information. The challenges identified in the education system be it the difficulty in authenticating certifications and documents, tracking intellectual property and in accessibility can be better managed through blockchain implementation.
Originality/value
Digital certificates produced using blockchains are the most secure and efficient method being adopted by many countries across the globe (Grech and Camilleri, 2017). Tamper-proof blockchain records consist of three components or layers: the first contains the signed hash of the content, the second contains all the data and images and the third is the presentation and styling of the data. The verification process is relatively simple; the hash of the recipient is compared to the hash stored on the blockchain if they match the document is verified.
Transparency and accountability in digital public services: Learning from the Brazilian cases
Article
Feb 2022
GOV INFORM Q
DOUGLAS MORGAN FULLIN SALDANHA
Cleidson Nogueira Dias
Siegrid Guillaumon
The transparency and accountability of systems and algorithms aims to protect the user against undesirable or harmful results and to ensure the application of laws appropriate to digital environments. Thus, the objective of this study is to evaluate the transparency and accountability provided to citizens in three of the main digital public services (e-services) offered by the federal administration of Brazil (ComprasNet, Sisu and Naturalizar-se) locally recognized for their significant relevance and stage of development and use. Services were evaluated from eight perspectives: accessibility; awareness; access and repair; accountability; explanation; origin of data, privacy and fairness; auditing; validation, accuracy and testing. Adopting a qualitative approach through comparative case studies, this research contributes to information practices theory (construction of a model for assessing transparency and accountability in digital public services). The results obtained show the need to inform the user of possible bias and damage arising from these systems, which are not readily perceived; just as the need to clarify the benefits that arise from the collection of private data are not. This shows that computational models can be distorted as a result of biases contained in their input data, or algorithms. This paper contributes through an innovative combination of dimensions, as a tool to evaluate transparency and accountability of government services.
Building Blocks for Blockchain Adoption in Digital Transformation of Sustainable Supply Chains
Article
Nov 2021
Funlade Sunmola
Patrick Burgess
Albert Tan
Global supply chains shift to meet exceeding expectations in supply chains lead to the need for digital technologies in supply chain management. Industry 4.0 has emerged in sustainable supply chain systems, blockchain is prominent, with the potential of immutable transparent data. Blockchains present potential to disrupt supply chains through digital transformation by enabling provenance, visibility, relationships, collaboration, lower costs, and enabling real-time trusted data. Scholars are increasingly investigating blockchain adoption, with an emphasis on technology acceptance modelling. Current research is valuable to understand potentials of blockchain technology in supply chains however, there is limited work on the building blocks for blockchain adoption in digital transformation of supply chains. This study aims to investigate through a systematic literature review and case studies, the building blocks for blockchain adoption in digital transformation of sustainable supply chains. Blockchain adoption in supply chain management is receiving increasing attention, along with highlights of critical factors. This paper offers a building block model that is in three main phases; pre-adoption, adoption, and the post adoption. The model indicates that adoption context, blockchain technology platform offerings, strategic responses, and adoption readiness are some key building blocks, particularly at the pre-adoption phase. Trust and supply chain network, firm resources, and blockchain costs are all considered critical in the considerations of the building blocks. In addition, aligning supply chain objectives with blockchain systems is critical and so is blockchain compatibility. Law and governance are amongst the two prominent challenges in blockchain adoption and should be considered as part of the building blocks for blockchain adoption.
Decentralized digital governance using block chain technology
Mar 2020
S.S. Heera
J. Shreya
S. Moushmi
K.V. Kalaban
The Effectiveness and transparency in government process and service delivery mechanisms is extremely important that can be achieved using blockchain technology.A Blockchain may be a decentralized arrangement which does not require any outsider association within the center. This acts as a huge advantage as it reduces the risk of tampering, fraud and cybercrime. All the government details are connected through a chain network and so no modification and any kind of alteration possible. An open blockchain network has no centralized authority where the information in it is open for anyone and everyone to see and the data can only be added in the blockchain with time sequential order. Even though there is a constant development in technology and adaptation towards cloud storage there is still manual handling of files and sometimes the documents are misplaced, lost since the files are stored physically and also there is a misled communication between the participants in consideration of one instance such as money transactions The blockchain implementation in the government organization would give tremendous benefit to the government administration, resulting in better service delivery to the citizens.
Digital Europe 2030: Designing scenarios for ICT in future governance and policy making
Article
Jan 2011
GOV INFORM Q
Gianluca Misuraca
David Broster
Clara Centeno
The article outlines a set of visionary scenarios on how the European society could develop by 2030 by using advanced ICT tools and modelling techniques and integrating them into governance processes and policy making mechanisms. These scenarios have been designed through a foresight exercise conducted by the Institute for Prospective Technological Studies (IPTS) as part of the CROSSROAD Project, a support action of the European Commission's 7th Framework Programme. After presenting the conceptual framework and methodological approach followed, the scenario design framework developed and the resulting views of what the European Information Society might be by 2030 are presented. The article follows with a discussion of the implications of the scenarios design in terms of key areas of expected change and grand challenges to be addressed. It concludes by identifying policy challenges and proposing possible future research directions in the domain of ICT for governance and policy modelling needed to build a truly open Digital Europe twenty years from now.
An intelligent model of transparent governance in policymaker organizations with the approach of good governance
Jan 2020
R Sepehrnia
Blockchain Technology and Smart Universities
Jan 2019
T J Gopane
Discover more about: Blockchain
Preprint
State of Open Access penetration in universities worldwide
March 2020
Nicolás Robinson-Garcia
Rodrigo Costas
Thed Van Leeuwen
The implementation of policies promoting the adoption of an Open Science culture must be accompanied by indicators that allow monitoring the penetration of such policies and their potential effects on research publishing and sharing practices. This study presents indicators of Open Access (OA) penetration at the institutional level for universities worldwide. By combining data from Web of ... [Show full abstract] Science, Unpaywall and the Leiden Ranking disambiguation of institutions, we track OA coverage of universities' output for 963 institutions. This paper presents the methodological challenges, conceptual discrepancies and limitations and discusses further steps needed to move forward the discussion on fostering Open Access and Open Science practices and policies.
ROPS Design Evolution with Respect to the Requirements of the Strength Test Procedures
Valda Rondelli
Enrico Capacci
Bruno Franceschetti
A. Guarnieri
A standardised strength test for Rolling Over Protective Structures (ROPSs) fitted on agricultural tractors was first introduced in 1967 and was based on a dynamic procedure (OECD Code 3). A static test procedure for protective structures, currently adopted worldwide, was added in 1983 (OECD Code 4) in order to resolve some limitations of the dynamic procedure. The advent of narrow track tractors ... [Show full abstract] required the adoption of ad hoc ROPS standardised static testing procedures for these special tractors (OECD Codes 6 and 7, 1991). Static ROPS tests provide a sequence of loadings, determined on the basis of the tractor reference mass while ensuring a survival volume for driver protection in the event of a tractor rollover. Over the years, the procedure requirements in terms of force and energy applied and clearance zone to be respected have remained substantially unchanged. In the meantime, agricultural tractors have undergone a deep technological evolution in design and normal operation in the field. In this context, it was considered appropriate to assess if, over the years, the ROPSs tested according to the static procedure have undergone a similar evolution in design and in the mountings on the tractor chassis to evaluate if the modifications affect the performance and the requirements of the testing procedure. The ROPSs fitted on standard and narrow track tractors tested at the University of Bologna in the last twenty-five years according to OECD Codes 4 and 7 were analysed. The ROPSs considered were the four-pillar frame and the cab types. The evolution of the ROPS design over time was evident. Cabs in both standard and narrow track tractors normally replaced the four pillar frames. In standard tractors, the ROPS cabs were progressively integrated to the tractor platform and the rear mudguards, and the latest application seems to be represented by cabs which were suspended on the rear of the tractor chassis. In narrow track tractors, a similar trend in terms of progressive integration of the cab to the tractor platform and the rear mudguards was observed but low profile highly rounded cabs exemplify the most modern approach. Different behaviour of the ROPSs was observed during the official strength tests. The cabs integrated to the tractor platform showed a shift in the vertical reference plane during lateral loading, affecting survival volume evaluation. Difficulties in identifying the loading points, in the case of low profile highly rounded cabs, were evident with respect to specific Code provisions.
Full-text available
Adoption of Blockchain in Health Care
September 2020 · Journal of Medical Internet Research
Mark Gaynor
Janet Tuttle-Newhall
Jessica Parker
| https://www.researchgate.net/publication/363011087_UiTM_Postgraduate_Tracking_System_UPTrackS_Adoption_of_Blockchain_for_Postgraduate_Good_Goverance_Practice_Universiti_Teknologi_Mara_UiTM |
SAE MOBILUS
LNG Fuel Differentiation: DME/LNG Blends for HPDI Engines
Max Kofod Content regarding Max Kofod - Royal Dutch Shell Content by authors affiliated with Royal Dutch Shell ,
Fenna Sleeswijk Visser Content regarding Fenna Sleeswijk Visser - Shell Global Solutions International BV Content by authors affiliated with Shell Global Solutions International BV ,
Paul Bosma Content regarding Paul Bosma ,
M.P.W. van Erp Content regarding M.P.W. van Erp - Shell Global Solutions International BV Content by authors affiliated with Shell Global Solutions International BV ,
Stuart MacDonald Content regarding Stuart MacDonald - Shell Global Solutions Content by authors affiliated with Shell Global Solutions ,
Sebastiaan Thierry Content regarding Sebastiaan Thierry - Shell Global Solutions Content by authors affiliated with Shell Global Solutions ,
Sander Gersen Content regarding Sander Gersen - DNV GL Content by authors affiliated with DNV GL ,
Martijn Van Essen Content regarding Martijn Van Essen - DNV GL Content by authors affiliated with DNV GL ,
Gerco van Dijk Content regarding Gerco van Dijk - DNV GL Content by authors affiliated with DNV GL
Journal Article
2020-01-2078
ISSN: 2641-9637 , e-ISSN: 2641-9645
DOI: https://doi.org/10.4271/2020-01-2078
Published September 15, 2020 by SAE International View list of content related to the publisher(s) in United States
Sector:
Commercial Vehicle Content related to Commercial Vehicle
Topic:
Dimethyl ether (DME) Content related to Dimethyl ether (DME) ,
Natural gas Content related to Natural gas ,
Fuel consumption Content related to Fuel consumption ,
Greenhouse gas emissions Content related to Greenhouse gas emissions ,
Heavy trucks Content related to Heavy trucks ,
Fuel injection Content related to Fuel injection ,
Methane Content related to Methane ,
Engines Content related to Engines
Event: SAE Powertrains, Fuels & Lubricants Meeting Journal article presented at SAE Powertrains, Fuels & Lubricants Meeting
Citation: Kofod, M., Sleeswijk Visser, F., Bosma, P., van Erp, M. et al., "LNG Fuel Differentiation: DME/LNG Blends for HPDI Engines," SAE Int. J. Adv. & Curr. Prac. in Mobility 3(1):287-298, 2021, https://doi.org/10.4271/2020-01-2078 .
Language: English
Abstract:
With increased awareness and scrutiny of greenhouse gas (GHG) emissions, the heavy-duty truck industry is on the lookout for solutions that can maximize GHG savings, through either lowering fuel consumption and lowering methane slip. This paper focuses on whether it is possible to provide a differentiated Liquefied Natural Gas (LNG) that supports the further improvement of a High-Pressure Direct Injection (HPDI) Engine. Desired improvements from this LNG blend are the lowering or substitution of the pilot Diesel use of the current HPDI engine, the lowering of the raw exhaust gas methane concentration and any additional performance improvements. Sixty-five substances were identified that could potentially be blended into cryogenic methane thus creating a differentiated LNG fuel. This paper goes through the process of additive selection and then focuses primarily on the results for using Dimethyl Ether (DME) as an LNG component, one of the candidate substances, but also showcases some of the other potential additives.
To study the autoignition properties of DME/LNG blends, autoignition delay times were simulated and then measured in a Rapid Compression Machine at engine conditions. The results were used to optimize the chemical mechanism that is used as input into a High-Pressure Direct Injection engine model. It was found that more than 5 vol% DME is required to reach a significant reduction in the autoignition delay time at typical operating conditions. The engine modelling results were also used to determine the initial conditions for HDPI engine tests using a modified 15L-Westport engine.
These engine tests showed that an LNG/DME blend could potentially be used to develop a mono-fuel HPDI engine. However, it was found that although the mono-fuel concept works for high load conditions with the existing HPDI engine, further research is needed to enable stable combustion at lower loads and idling while keeping DME proportions at levels that could be dissolved in LNG. It was also found that higher proportions of DME in the LNG could lead to a reduction of the methane slip.
Product Code Document Title File Type Download 2020-01-2078 LNG Fuel Differentiation: DME/LNG Blends for HPDI Engines Download File Type Download
Citation Download RefMan (MAC / WIN) Download RefWorks (MAC / WIN) Download EndNote (MAC / WIN) Download BibTeX (MAC / WIN)
File Format: .xlsx .csv Text Number of Results: Selected 25 50 100 All(upto 1000) Select Fields to Export Item Number Content Type Title Author(s) Affiliation(s) Publisher Publish Date Abstract/scope Citation DOI Submit
| https://saemobilus.sae.org/content/2020-01-2078/ |
Black Skimmer | Audubon Field Guide
The strange, uneven bill of the skimmer has a purpose: the bird flies low, with the long lower mandible plowing the water, snapping the bill shut when it contacts a fish. Strictly coastal in most...
Guide to North American Birds Find a Bird
Breeding adult and downy young. Photo: Jim Gray/Audubon Photography Awards
Priority Bird
Black Skimmer
Rynchops niger
Conservation status In late 19th century, eggs were harvested commercially, and adults were killed for their feathers, leading to a reduction of Atlantic Coast populations; good recovery of numbers since. Still very sensitive to disturbance in nesting colonies. Range expanding in west. Family Gulls and Terns Habitat Mostly ocean beaches, tidewater. Favors coastal waters protected from open surf, such as lagoons, estuaries, inlets, sheltered bays. Locally on inland lakes in Florida and at Salton Sea, California. Nests on sandy islands, beaches, shell banks. In South America, occurs far inland along major rivers.
The strange, uneven bill of the skimmer has a purpose: the bird flies low, with the long lower mandible plowing the water, snapping the bill shut when it contacts a fish. Strictly coastal in most areas of North America, Black Skimmers are often seen resting on sandbars and beaches. Unlike most birds, their eyes have vertical pupils, narrowed to slits to cut the glare of water and white sand. Flocks in flight may turn in unison, with synchronized beats of their long wings. The world's three species of skimmers are sometimes placed in their own separate family, although they are clearly related to the terns.
Photo Gallery
Feeding Behavior
Well-known for its skimming habit, furrowing the water with lower mandible, the upper mandible snapping down immediately when contact is made with a fish. Finds food by touch, not by sight; often forages in late evening or at night, when waters may be calmer and more fish may be close to surface. Rarely may forage by wading in very shallow water, scooping up fish.
Eggs
4-5, sometimes 3, rarely 6-7. Variable in color, whitish to buff to blue-green, marked with dark brown. Incubation is by both sexes (male may do more), 21-23 days. Young: Both parents feed young, by regurgitation. Upper and lower mandibles of young are same length at first, so they are able to pick up food dropped on the ground by parents. Young wander in vicinity of nest after a few days; if danger threatens, may attempt to look inconspicuous by lying flat on beach, even kicking up sand to make a hollow to lie in. Able to fly at about 23-25 days.
Young
Both parents feed young, by regurgitation. Upper and lower mandibles of young are same length at first, so they are able to pick up food dropped on the ground by parents. Young wander in vicinity of nest after a few days; if danger threatens, may attempt to look inconspicuous by lying flat on beach, even kicking up sand to make a hollow to lie in. Able to fly at about 23-25 days.
Diet
Mostly fish. Feeds mostly on small fish that live just below surface of water. Also eats some small crustaceans.
Nesting
Breeds in colonies. Courtship not well studied, may involve zigzagging flight with two or more males pursuing one female. Nest site on ground on open sandy beach, shell bank, sandbar; sometimes on gravel roof. Nest is shallow scrape in sand.
Illustration ©David Allen Sibley.Learn more about these drawings.
Text © Kenn Kaufman, adapted from Lives of North American Birds
Migration
Withdraws from northern part of breeding range in winter. Sometimes pushed north along coast by tropical storms, rarely driven inland. Has colonized southern California (from western Mexico) since 1960s, now nests at Salton Sea and San Diego.
All Seasons - Common
All Seasons - Uncommon
Breeding - Common
Breeding - Uncommon
Winter - Common
Winter - Uncommon
Migration - Common
Migration - Uncommon
See a fully interactive migration map for this species on the Bird Migration Explorer.
Songs and Calls
Short barking notes.
typical barks at colony
churring calls at nest
Audio © Lang Elliott, Bob McGuire, Kevin Colver, Martyn Stewart and others. Learn more about this sound collection .
How Climate Change Will Reshape the Range of the Black Skimmer
Audubon’s scientists have used 140 million bird observations and sophisticated climate models to project how climate change will affect this bird’s range in the future.
Zoom in to see how this species’s current range will shift, expand, and contract under increased global temperatures.
Climate threats facing the Black Skimmer
Choose a temperature scenario below to see which threats will affect this species as warming increases. The same climate change-driven threats that put birds at risk will affect other wildlife and people, too.
Warming scenario:
+1.5 ℃ +3.0 ℃
Why these temperatures?
What is a season?
The species is projected to shift mostly out of the conterminous 48 states, for which threats data are available.
| https://www.audubon.org/field-guide/bird/black-skimmer?site=ms&nid=4166 |
Henning v. United States Ins. Co. - Missouri - Case Law - VLEX 899758401
0: [object Object]. 1: [object Object]. 2: [object Object]. 3: [object Object]. 4: [object Object]
Henning v. United States Ins. Co.
Court United States State Supreme Court of Missouri Writing for the Court WAGNER Citation 47 Mo. 425 Parties ROBERT M. HENNING et al., Appellants, v. THE UNITED STATES INSURANCE COMPANY, Respondent. Decision Date 31 March 1871
47 Mo. 425
ROBERT M. HENNING et al., Appellants, v. THE UNITED STATES INSURANCE COMPANY, Respondent.
Supreme Court of Missouri.
March Term, 1871.
[47 Mo. 426]
Appeal from St. Louis Circuit Court.
A parol contract of insurance, such as (we say) was made with defendant in March, 1864, acted upon and carried into effect as it was, is binding and enforceable at law. That such a contract may be made, and that it binds the corporation, though without writing, has been repeatedly decided by courts of the highest authority, viz: Kennebec Co. v. Augusta Insurance & Banking Co., 6 Gray, Mass., 204; First Baptist Church v. Brooklyn Fire Ins.Co., 18 Barb. 75; 19 N. Y. 305; Halleck v. Ins. Co., 2 Dutch., N. J., 268-76; Mobile Marine Dock & Mutual Ins. Co. v. McMillan & Son, 31 Ala. 711; Commercial Mutual Marine Ins. Co. v. Union Mutual Ins. Co., 19 How. 318 , 321.
The rule laid down by Judge Curtis in 19 Howard, which has been adopted in Massachusetts, New York, New Jersey and Alabama, is entirely compatible with the statute law of Missouri.
Under the act of 1845 (R. C. 1845, p. 232, § 8), the capacity of a corporation to make a parol contract, and the liability of a corporation to be bound by an implied contract, differs in no respect from that of an individual or natural person. This section is part of the charter of the defendant. All corporations created after the passage of that act are subject to the disabilities and restrictions of the general law on the subject. But as to this provision in section 8, it is believed that it became operative immediately on its passage, with respect to all existing corporations. When, in 1855, the charter of the defendant was given,
[47 Mo. 427]
the seventh and fifteenth sections of the act of 1845 were declared to be not a part of its charter. This is quite equivalent to saying that the other sections of that act were applicable to the new company.
So far as the case of Plahto v. Merch.& Manuf. Ins. Co. ( 38 Mo. 248 ) is concerned, it is submitted that all which is said in that instance respecting the non-validity of verbal contracts for insurance is obiter dictum; the question was not presented to the court then, whether such a contract was binding. No reference appears to the authorities now cited, and indeed the decision is rather one that asserts the general rule that is common to natural and artificial persons alike than one which exempts a body politic from liability. The more recent case of Mound City Mutual Ins. Co. v. Curran, 42 Mo. 374 , agrees with Plahto v. Merch.& Manuf. Ins. Co., supra, and it was no doubt upon the authority of these cases that the Circuit Court decided the case at bar. But the precise point which this case presents has now been argued for the first time before this court. If there is a contradiction between the law declared by the courts of Massachusetts, New York, New Jersey, Alabama and the United States, and that which has been laid down obiter by this court on a matter of commercial law which ought to be uniform throughout the land unless controlled by positive statute, we are well warranted in asking this court to pause before making a different rule inflexible. According to the decision of this case the rule will henceforth be fixed in Missouri.
Geo. P. Strong,for appellants.
It was competent for the parties, by their course of dealing, to show the sense in which they used the terms employed in their contract, and to give the contract a construction different from the natural and ordinary signification of the words used in it. It was also competent for them to vary the terms of the contract by parol. (Chapman v. Black, 5 Scott, 530, 533; Bunce v. Beck, 43 Mo. 266 ; Eyre v. Marine Ins. Co., 5 Watts & Serg. 122; Mead v. De Golyer, 16 Wend.632; Chit. Cont. 89; Protective Ins. Co. v. Wilson, 6 Ohio St. 533, 560; 25 Barb.189; 23
[47 Mo. 428]
How. 420; Kennebec Co. v. Augusta Insurance & Banking Co., 6 Gray, 204, 214; Mobile Marine Dock & Mutual Ins. Co. v. McMillan & Son, 31 Ala. 711; Warren v. Ocean Ins.Co., 16 Me. 439.) It was competent for the parties to make a valid contract of insurance by parol, and such contract ought to be enforced. (First Baptist Church v. Brooklyn Ins.Co., 18 Barb. 69; same case, 31 N. Y. 305; Kennebec Co. v. Augusta Insurance & Banking Co., supra; Mobile Marine Ins. Co. v. McMillan & Son, supra; Com.M. M. Ins. Co. v. Union M. Ins. Co., 19 How. 318 ; 11 Paige Ch.555; 4 Sandf. Ch. 408; Palm, Adm'r, v.The Medina Ins. Co., 20 Ohio, 529; E. Carver Co. v. Manuf.Ins. Co., 6 Gray, 214.)
The case in Ohio (16 Ohio, 148), and that of The Mound City Co. v. Curran, 42 Mo. 374 , are not in point. In them the policy had become absolutely dead, and the decisions merely hold that in the absence of all proof of authority it was not competent for the secretary, either orally or by writing, to issue what in effect was a new policy. In the case at bar there was a valid subsisting policy, all the time so treated and so regarded by both parties, and one that the courts would enforce. In this case it was mutually agreed that defendant's policy should cover just such risks as those now insured for, and both parties acted upon this construction for years and until this loss. The plaintiffs entered upon the policy books all their shipments, irrespective of the points of shipment or of destination, and the defendant accepted the risks and received the premiums. No such proof appeared in the Ohio case, nor in the Mound City case, supra, nor did any such facts appear in the Plahto case, 38 Mo. 248 . In the latter case both parties had expressly stipulated that the policy should only cover certain risks “in such sums, on property, from and to such places and on board such vessels, as shall be specified by application and mutually agreed upon and written on this policy.” When this policy was signed, some matters were left open, but, by its express terms, before it could take effect everything must be closed; there must be an application, a mutual agreement, and a writing of the risk upon the policy. Nothing of this kind was required of Henning &
[47 Mo. 429]
Woodruff. They were authorized and required to enter all their shipments. Neither party could refuse to be bound. Justice Holmes recognized the distinction in the Plahto case, 38 Mo. 255 Bodley was the secretary and general agent of defendant and had authority to make such a contract. He had been making just such contracts for nine years, and the defendant had received the benefits growing out of them. These benefits, during the last eighteen months prior to the loss in this case, had amounted to $50,000. All this the company received, without a word of dissent, upon contracts of insurance almost identical with that upon which this suit was founded. Such dealings, assented to by the corporation, were proof sufficient of authority in the agent; and from such a course of dealing the law will imply the authority of the agent, and also the existence of the contract itself. (Bank of the United States v. Dandridge, 12 Wheat.68, 70; Gen. Stat. 1865, p. 327, § 6; Mechanics' Bank v. Bank of Columbia, 5 Wheat. 326 ; Bank of Vergennes v. Warren, 7 Hill, 91, 94; Bank of Columbia v. Patterson, 7 Cranch, 305; 27 Conn. 538, 554; 6 Barb.576.)
The provisions of the charter in the case at bar ought not to be so construed as to exclude the power to make such contracts as that sued on. They were...
| https://case-law.vlex.com/vid/henning-v-united-states-899758401 |
Combination ranibizumab + bromfenac and ranibizumab injection alone in Age-Related Macular Degeneration - Clinical Trials Registry - ICH GCP
This open-label, randomized, Phase II research study will look to see whether an investigational treatment combining bromfenac ophthalmic drops with ranibizumab...
Combination Ranibizumab and Bromfenac for Neovascular Age-related Macular Degeneration
This open-label, randomized, Phase II research study will look to see whether an investigational treatment combining bromfenac ophthalmic drops with ranibizumab intravitreal injection is safe and effective for treating wet AMD as compared to ranibizumab alone.
Study Overview
Status
Completed
Conditions
Age-Related Macular Degeneration
Intervention / Treatment
Drug: combination ranibizumab + bromfenac
Drug: ranibizumab injection alone
Detailed Description
Age Related Macular Degeneration (AMD) is the leading cause of blindness in adults over the age of 50 years.
It can cause permanent loss of eyesight due to deterioration of the macula.
Ranibizumab monotherapy is currently the standard of care in neovascular AMD patients.
Inflammation is believed to play an important role in AMD.
Currently, MD's are investigating modulating the inflammation component of AMD with intra-ocular steroids although there is a high rate of steroid associated adverse events, such as glaucoma, cataracts and endophthalmitis.
Bromfenac is a non-steroidal anti-inflammatory drug (NSAIDS) and is currently approved for the treatment of inflammation following cataract surgery.
In combination with intravitreal ranibizumab, bromfenac may also provide anti-inflammatory effects and may be a safer alternative to steroids.
Study Type
Interventional
Enrollment (Anticipated)
30
Phase
Phase 2
Contacts and Locations
This section provides the contact details for those conducting the study, and information on where this study is being conducted.
Study Locations
United States
Oregon
Portland, Oregon, United States, 97239
Casey Eye Institute at Oregon Health & Science University
Participation Criteria
Researchers look for people who fit a certain description, called eligibility criteria. Some examples of these criteria are a person's general health condition or prior treatments.
Eligibility Criteria
Ages Eligible for Study
50 years and older (ADULT, OLDER_ADULT)
Accepts Healthy Volunteers
No
Genders Eligible for Study
All
Description
Inclusion Criteria:
Ability to provide written informed consent and comply with study assessments for the full duration of the study
Age > 50 years
Patients with active neovascular AMD
If the patient has bilateral disease and qualifies for the study, both eyes may be included
Exclusion Criteria:
Pregnancy (positive pregnancy test) or lactation Premenopausal women not using adequate contraception.
Any other condition that the investigator believes would pose a significant hazard to the subject if the investigational therapy were initiated
Current or recent participation in another simultaneous investigational drug trial may be exclusionary at the investigator's discretion
Concurrent eye disease in the study eye that could compromise visual acuity (e.g., diabetic retinopathy, advanced glaucoma)
Previous intravitreal steroid or anti-VEGF therapy within last 3 months.
Patients with a concurrent corneal epithelial disruption or erosion
Patients with immune deficiencies that would affect the ability of the cornea to heal
Patients with a known sensitivity to any component of the formulations under investigation
Study Plan
This section provides details of the study plan, including how the study is designed and what the study is measuring.
How is the study designed?
Design Details
Primary Purpose: TREATMENT
Allocation: RANDOMIZED
Interventional Model: PARALLEL
Masking: NONE
2
Arms and Interventions
<table><tr><th> Participant Group / Arm</th><th> Intervention / Treatment</th></tr><tbody><tr><td> EXPERIMENTAL: 1 Combination Ranibizumab intravitreal injection plus bromfenac ophthalmic drops</td><td> Drug: combination ranibizumab + bromfenac ranibizumab injection in study eye each month for 4 months then as needed each month for 8 months.
Plus one drop of bromfenac in the study eye twice per day, each day, for 12 months.</td></tr><tr><td> ACTIVE_COMPARATOR: 2 ranibizumab injection alone.</td><td> Drug: ranibizumab injection alone ranibizumab injection in study eye each month for 4 months then as needed each month for 8 months</td></tr></tbody></table>
What is the study measuring?
Primary Outcome Measures
<table><tr><th> Outcome Measure</th><th> Time Frame</th></tr><tbody><tr><td> Assessment of ocular adverse events, including uncontrolled inflammation, endophthalmitis, and retinal tear/detachment, abnormal sensation in eye, conjunctival hyperemia, eye irritation, eye pain, eye pruritus, eye redness, headache, and iritis Time Frame: monthly</td><td> monthly</td></tr></tbody></table>
Secondary Outcome Measures
<table><tr><th> Outcome Measure</th><th> Time Frame</th></tr><tbody><tr><td> Mean change in visual acuity at 3, 6 and 12 months Time Frame: every 3 months</td><td> every 3 months</td></tr></tbody></table>
Collaborators and Investigators
This is where you will find people and organizations involved with this study.
Sponsor
Oregon Health and Science University
Collaborators
Genentech, Inc.
Investigators
Principal Investigator: Peter J. Francis, MD, PhD, Oregon Health and Science University
Study record dates
These dates track the progress of study record and summary results submissions to ClinicalTrials.gov. Study records and reported results are reviewed by the National Library of Medicine (NLM) to make sure they meet specific quality control standards before being posted on the public website.
Study Major Dates
Study Start
December 1, 2008
Primary Completion (ACTUAL)
September 1, 2010
Study Completion (ACTUAL)
September 1, 2010
Study Registration Dates
First Submitted
December 8, 2008
First Submitted That Met QC Criteria
December 8, 2008
First Posted (ESTIMATE)
December 9, 2008
Study Record Updates
Last Update Posted (ESTIMATE)
July 22, 2011
Last Update Submitted That Met QC Criteria
July 20, 2011
Last Verified
October 1, 2009
Keywords
| https://ichgcp.net/clinical-trials-registry/NCT00805233 |
Localised swelling of the tongue: a rare case of isolated angiokeratoma in a child | BMJ Case Reports
<here is a image 85feadde3a8185d2-06ecf5309b5be371 PDF >
Images in…
Localised swelling of the tongue: a rare case of isolated angiokeratoma in a child Free
http://orcid.org/0000-0002-3727-3366 Ottavio Adorisio 1 ,
Francesca Diomedi Camassei 2 and
Francesco De Peppo 1
1 Pediatric Surgery, Bambino Gesù Pediatric Hospital, Rome, Italy
2 Laboratories-Pathology Unit, Bambino Gesù Pediatric Hospital, Rome, Italy
Correspondence toDr Ottavio Adorisio; [email protected]
http://dx.doi.org/10.1136/bcr-2021-247552
Dentistry and oral medicine
Mouth
Oral and maxillofacial surgery
Description
A 13-year-old boy, affected by cystic fibrosis, presented with a red, small lesion of the posterior part of the tongue (figure 1A). The lesion was 7×4 mm in size. The mass was slightly tender on palpation, firm and not bleeding on manipulation. The remaining physical examination was unremarkable. Under general anaesthesia, the patient underwent the removal of the lesion. The histopathological examination showed, at the H&E staining, a parakeratinised stratified squamous epithelium with enlarged blood vessels (figure 1B). Connective tissue revealed numerous large dilated blood-filled spaces lined by endothelial cells encircled by a chronic inflammatory infiltrate (figure 1C). Lymphatic vessels dilatation was also present (figure 1D). The final diagnosis of solitary angiokeratoma of the tongue was obtained.
<here is a image 83cb433d31d4de51-b184b076fbf4688f>
Figure 1
(A) Clinical picture showing the isolated swelling of the tongue. (B) Histopathological picture of angiokeratoma, H&E staining, revealing a parakeratinised stratified squamous epithelium with enlarged blood vessels; (C) large dilated blood-filled spaces lined by endothelial cells encircled by a chronic inflammatory infiltrate; (D) lymphatic vessels dilatation using CD31 as a marker.
Mibelli first described the first case of angiokeratoma, involving fingers and toes in an adult patient, in 1889.1The angiokeratoma is a rare benign vascular lesion that usually involves arms and legs.2The pathogenesis of angiokeratomas is still unknown. It has been reported congenital origin due to an overlying arteriovenous fistula, or traumatic pathogenesis with the onset of lymphangioma localised after local injuries.3Usually, the lesion appears as well-demarcated swelling due to a large dilated blood vessel located in the subcutaneous tissue. The male/female ratio is 2:1. In the great part of cases, angiokeratoma appears as dark-red or blue-black, macular/papular lesions, which do not blanch on pressure. Oral involvement is frequently seen in syndromes such as Klippel-Trenaunay-Weber syndrome, Cobb syndrome and other mixed vascular malformations.3Only eight cases of isolated angiokeratoma of the tongue in adult patients have been reported in the literature.2To date, only four cases of angiokeratoma circumscriptum of the oral cavity in children have been described in the literature.4–6
Usually, the lesions are present since birth, but in some cases, may occur during childhood as in other cases and even in adulthood, especially in the case of traumatic aetiology. The natural course is usually benign, the only clinical features may be bleeding, discomfort or cosmetic alterations. Angiokeratoma appears in the oral cavity, often associated with systemic diseases and represents multiple papules in buccal mucosa and tongue causing dysphagia or drooling; but in our case, the patient has cystic fibrosis, which, upon reviewing the literature, seems not to have any relationship with the angiokeratoma.5In our case, the lesion was solitary and there were no other lesions on the skin or in the oral cavity. The main differential diagnoses are haemangioma, lymphangioma and malignant melanoma.
Angiokeratoma may be treated with complete surgical excision, cryotherapy or laser ablation and no surgical complications have been reported in the literature or in our patient.6 7Usually, no recurrences have been described but, recent reports suggest the possibility of a recurrence.7In our case, after surgical excision, no recurrence is found after a 2-year follow-up. Isolated angiokeratoma of the tongue is a rare disease in children and, in most cases, this lesion may have a syndromic aetiology. Surgery is the treatment of choice to resolve both symptoms and histopathological diagnosis.
Patient's perspective
I am very happy about the care received by my son. I hope that the publication of this article will help other doctors and patients to recognize and treat this condition.
Learning points
Solitary angiokeratoma of the oral cavity is very rare in paediatric patients.
Localisation of the tongue is very infrequent.
Even in the presence of a solitary angiokeratoma of the tongue, the exploration of thorax, abdomen, arms and legs is mandatory to rule out the presence of syndromic diseases.
Ethics statements
Patient consent for publication
Parental/guardian consent obtained.
References
↵
Bakshi SS
. Angiokeratoma of tongue. J Pediatr Hematol Oncol 2017; 39: 407. doi:10.1097/MPH.0000000000000748 pmid:http://www.ncbi.nlm.nih.gov/pubmed/28060116
↵
Aggarwal K,
Jain VK,
Jangra S, et al
. Angiokeratoma circumscriptum of the tongue. Indian Pediatr 2012; 49: 316– 8. pmid:http://www.ncbi.nlm.nih.gov/pubmed/22565076
↵
Kandalgaonkar S,
Tupsakhare S,
Patil A, et al
. Solitary angiokeratoma of oral mucosa: a rare presentation. Case Rep Dent 2013; 2013: 812323 doi:10.1155/2013/812323 pmid:http://www.ncbi.nlm.nih.gov/pubmed/23936686
↵
Kumar MV,
Thappa DM,
Shanmugam S, et al
. Angiokeratoma circumscriptum of the oral cavity. Acta Derm Venereol 1998; 78: 472. doi:10.1080/000155598442854 pmid:http://www.ncbi.nlm.nih.gov/pubmed/9833054
↵
Vijaikumar M,
Thappa DM,
Karthikeyan K, et al
. Angiokeratoma circumscriptum of the tongue. Pediatr Dermatol 2003; 20: 180– 2. doi:10.1046/j.1525-1470.2003.20221_2.x pmid:http://www.ncbi.nlm.nih.gov/pubmed/12657024
↵
Green JB,
Roy S
. Angiokeratoma circumscriptum of the dorsal tongue in a child. Int J Pediatr Otorhinolaryngol Extra 2006; 1: 107– 9. doi:10.1016/j.pedex.2006.01.001
OpenUrl Google Scholar
↵
Sion-Vardy N,
Manor E,
Puterman M, et al
. Solitary angiokeratoma of the tongue. Med Oral Patol Oral Cir Bucal 2008; 13: E12– 14. pmid:http://www.ncbi.nlm.nih.gov/pubmed/18167473
Footnotes
ContributorsOA treated the patient and drafted the manuscript. FDC performed the pathological evaluation. FDP drafted and supervised the paper.
FundingThe authors have not declared a specific grant for this research from any funding agency in the public, commercial or not-for-profit sectors.
Case reports provide a valuable learning resource for the scientific community and can indicate areas of interest for future research. They should not be used in isolation to guide treatment choices or public health policy.
Competing interestsNone declared.
Provenance and peer reviewNot commissioned; externally peer reviewed.
| https://casereports.bmj.com/content/15/3/e247552 |
(PDF) Protective Masks During the SARS-COV-2 Pandemic: Is there a Relationship with Temporomandibular Disorders? An Observational Cross-sectional Survey
PDF | Background Wearing protective face masks has been one of the indispensable measures to prevent droplets and aerosol particles transmission during... | Find, read and cite all the research you need on ResearchGate
Preprint
PDF Available
Protective Masks During the SARS-COV-2 Pandemic: Is there a Relationship with Temporomandibular Disorders? An Observational Cross-sectional Survey
June 2022
DOI: 10.21203/rs.3.rs-1803858/v1
License
CC BY 4.0
Authors:
<here is a image b99b83315ce79f9b-0b42484f53eca71d>
Fabrizia d'Apuzzo
University of Campania "Luigi Vanvitelli", Naples, Italy
<here is a image 56f90790d6c4ce73-2706510eab34b333>
Rossana Patricia Rotolo
Università degli Studi della Campania "Luigi Vanvitelli
<here is a image b6d3152b70b1b489-06b4dfc4b1966032>
Ludovica Nucci
Università degli Studi della Campania "Luigi Vanvitelli
<here is a image f2f62089ad6ff61c-d19572ff1996375a>
Vittorio Simeon
Vittorio Simeon
Abstract and Figures
Background
Wearing protective face masks has been one of the indispensable measures to prevent droplets and aerosol particles transmission during the SARS-CoV-2 pandemic. This observational cross-sectional survey investigated the different types and modalities of protective mask wearing and the possible association with referred temporomandibular disorders by respondents.
Methods
An online-questionnaire was developed, calibrated and administered anonymously to subjects with an age of ≥ 18 years. It consisted of different sections: demographics, type and wearing modalities of the protective masks, pain in the preauricular area, noise at the temporomandibular joints and headache. Statistical analysis was performed with R software.
Results
The questionnaire received 665 replies mainly from participants aged 18–30 years (315 males, 350 females). 37% of participants were healthcare professionals, 21.2% of them were dentists. 334 subjects (50.3%) mostly used the Filtering Facepiece 2/ Filtering Facepiece 3 (FFP2/FFP3) mask, and 578 (87%) wore the mask with two elastics behind the ears. 400 participants referred pain while wearing the mask, and 36.8% of them referred pain with a consecutive use of more than 4 hours (p = 0.042). 92.2% of participants did not report any TMJ noise. 57.7% of subjects referred headaches associated with the FFP2/FFP3 (p = 0.033).
Conclusions
This survey highlighted the increased referred presence of orofacial pain in the preauricular area and temporal headache associated with a prolonged use of protective face masks for more than 4 hours during the SARS-CoV-2 pandemic.
<here is a image 4c84cb9cd61139fd-1fea8c39822eaa99>
Sample characteristics and behaviors …
Figures - available via license: Creative Commons Attribution 4.0 International
Page 1/16
P r o t e c t i v e M a s k s D u r i n g t h e S A R S - C OV - 2
P a n d e m i c : I s t h e r e a R e l a t i o n s h i p w i t h
T e m p o r o m a n d i b u l a r D i s o r d e r s ? A n Ob s e r v a t i o n a l
C r o s s - s e c t i o n a l S u r v e y
F a b r i z i a d ’ A p u z z o
University of Campania Luigi Vanvitelli
R o s s a n a P a t r i c i a R o t o l o
University of Campania Luigi Vanvitelli
L u d o v i c a N u c c i
University of Campania Luigi Vanvitelli
V i t t o r i o S i m e o n
University of Campania Luigi Vanvitelli
G i u s e p p e M i n e r v i n i ( g i u s e p p e . m i n e r v i n i @ u n i c a m p a n i a . i t )
University of Campania Luigi Vanvitelli
L e t i z i a P e r i l l o
University of Campania Luigi Vanvitelli
V i n c e n z o G r a s s i a
University of Campania Luigi Vanvitelli
R e s e a r c h A r t i c l e
K e y w o r d s : SARS-CoV-2, COVID-19, protective face masks, FFP2 / FFP3, temporomandibular joints,
orofacial pain, joint noise, headache, temporomandibular disorders
P o s t e d D a t e : August 16th, 2022
D OI : https://doi.org/10.21203/rs.3.rs-1803858/v1
L i c e n s e : This work is licensed under a Creative Commons Attribution 4.0 International License.
Page 2/16
A b s t r a c t
B a c k g r o u n d
Wearing protective face masks has beenone of the indispensable measuresto prevent droplets and
aerosol particlestransmission during the SARS-CoV-2 pandemic.This observational cross-sectional
survey investigated the different typesand modalities of protective mask wearing and the possible
association with referred temporomandibular disorders by respondents.
M e t h o d s
An online-questionnaire was developed, calibrated and administeredanonymously to subjectswith an
age of ≥18 years. Itconsisted ofdifferent sections: demographics, type and wearing modalitiesof the
protective masks, pain in the preauricular area, noise at the temporomandibular joints and headache.
Statistical analysis was performed with Rsoftware.
R e s u l t s
The questionnaire received 665 replies mainly from participants aged 18–30 years (315 males, 350
females). 37% of participants werehealthcare professionals, 21.2% of them were dentists. 334 subjects
(50.3%) mostly used the Filtering Facepiece 2/ Filtering Facepiece3 (FFP2/FFP3) mask, and 578 (87%)
worethe mask with two elastics behind the ears.400 participants referred pain while wearing the mask,
and 36.8% ofthem referred painwith a consecutiveuse of morethan 4 hours (
p
= 0.042). 92.2% of
participants did not report anyTMJ noise. 57.7% of subjects referred headaches associated with the
FFP2/FFP3 (
p
= 0.033).
C o n c l u s i o n s
This survey highlighted the increased referred presence of orofacial pain in the preauricular area and
temporal headache associated with a prolonged use of protective face masks for more than 4 hours
during the SARS-CoV-2 pandemic.
B a c k g r o u n d
SevereAcuteRespiratory Syndrome Coronavirus 2 (SARS-CoV-2) was identied as the cause of a
pneumonia epidemic that affected primarily the city of Wuhan in December 2019, and that in a few
weeks spread rapidly throughout China. In the early months of 2020, the virus spread around the world,
thus, the World Health Organization (WHO) declaredthe CoronaVirus Disease-19 (COVID-19) pandemic
condition, this decision was supported bythe high infectivity and the high rate of contagion (1).
Page 3/16
COVID-19 represents one of the most complex respiratory disease outbreaks in human history. The virus
can affect anyone; however, it was reported a higher rate of casesamong the immunocompromised, the
elderlypersons,and pregnant women. Therefore, it led to international health, economic, psychological
and social crises (1–3).
Infection occurs through human-to-human aerosol particles, mainly through droplets, contaminated
hands or surfaces.
Considering the transmission routeand characteristics of SARS-CoV-2, the most effective prevention and
control methods toght the diseaseare the use of surface disinfectants with alcohol, physical distancing
and personal protective equipment. Forthese reasons, wearing masks is an indispensable measureto
prevent droplets and possible aerosol particles transmission, as well as reduce hand-to-face contact(4).
The use of protective masks is needed for healthcareworkers,the general population in public settings
and on board of modes of transport,in cramped conditions, vulnerable populations, as well as for people
with COVID-19 symptoms(WorldHealth Organization, 2020) (5–6).
The protective masks are associated with general mild discomfort, however, no studies on the correlation
with temporomandibular disorders (TMD) have been reported (7–9).
Thus, the aim of this study was to investigatethe possible association betweenthe protective masks
wearing extended over time and the referral of diversetypes of disorders and/or discomforts affecting the
craniofacial complex.
M e t h o d s
An online survey was designed to investigatethe possible association betweenthe extended useof
protective masks after the usual routineuse of the protective during the pandemic, and the referred
symptoms of TMD among the general population according to the standard Diagnostic Criteria for
Temporomandibular Disorders(DC/TMD)symptoms questionnaire (10).
Each subject was informed on the study design and authorized theuse of their anonymous data by
responding the online questionnaire.
Prior to the beginning ofthe study, an expert panel composed ofthreeorthodontists and an expertin
survey research from the University ofCampania
Luigi Vanvitelli
reviewed the survey questionnaire.
Feedback obtained from this group was used to modify the survey for content and validity, and the nal
version was redacted.
A sample sizes of500 subject achieved 90% power to detect a differencebetweenthe group proportions
of 0.15. The proportion in group 1 (no prolonged used)was assumed to be, conservatively, of 0.5 under
the null hypothesis. The test statistic used was thetwo-sided Fisher's Exact Test, with a signicance level
of 0.05. An additional 20% was added to account for dropout-inates enrolment resulting in a minimum
sample of 626 subjects.
Page 4/16
The survey was designed and made available on the free online tool“Google Form” tocollect thecustom-
designed questionnaire responses anonymously.
A pilot study was conducted considering all questions includedin the survey in a sample of 10 subjects
to test the questionnaire delivery. The participants in the pilot study answered the survey, the outcomes
revealed that the online questionnaire was deemed appropriate and no changes were necessary.
The participants were recruited using sponsored posts on the main social media channel (Facebook) and
through the link sent by the authors (FDA, RPR, LN, GM) on Messenger and WhatsApp redirecting them to
a custom-designed questionnaire.
The data were collected overthe course of six months, from October 2020 to April 2021. The only
inclusion criteria were all subjectswith an age of ≥18 years.
The questionnaire included 13 multiple-choice questions with only one possible answer. The front page
of each survey included thestudy title and a brief explanation ofits objectives. The rst part gathered
demographic information, including gender, age and occupation. In the second part, the items focused on
the useof protective masks. Indetail, the data investigated werethe consecutive time and the total hours
of wearing over theday; the type of mask the participants usuallywear among surgical, FFP2/ FFP3, or
others; thewearing modality (with two lacesbehind the ears, one or two lacesbehind the neck, with two
laces verticallyon the head).
The last section focused on the presenceof anysymptoms affecting thetemporomandibular joint (TMJ)
and the facial muscles. Participants wereasked about pain perception and noise in the anterior region to
the ears and headache in the temporal region while wearing or talking with the mask.
S t a t i s t i c a l m e t h o d s
Categorical data wereexpressed as number and percentage, while continuous variables as either median
and interquartile range or mean and standard deviation, based on theirdistribution assessed bythe
Shapiro–Wilk test.
Chi-squared or Fisher’s exact tests was used to evaluate association for dichotomous/categorical data
(e.g., between the referred symptoms and the different use of the protective mask), depending on sample
size.
A p-value <0.05 was considered as statistically signicant. All analyses were performed using statistical
software STATAv16 (StataCorp. 2019. College Station, TX: StataCorp LLC).
R e s u l t s
The questionnaire received 665 replies (315males and 350 females); 2 replies were eliminated dueto
incompletedocumentation in the demographic section. Most of the participants wereaged 18–30 years
Page 5/16
(44.7%). 246 participants (37%) were healthcareprofessionals, 21.2% of professionals were general
dentists(Table1).
334 subjects(50.3%) referred using mostly the protective mask FFP2/FFP3, whereas the surgical mask
This study describes the phenomenon of TMDsymptoms as preauricular pain, joint sounds and
headaches associated with the useofprotective masks during the SARS-CoV-2 pandemic when they were
mandatory (11). Generally,the protective face mask is well tolerated with minimal adverseeffectsthat
can be summarized as vague discomfort caused by a combination of dicult breathing, increasein
temperature, humidity, CO2 due to mask tightness, and facial dermatoses(12–18).
The participants reported amajor use of FFP2/FFP3 compared to the other types of masks with two
elasticsbehind the earsfor lessthan 4 consecutive hours. Consequently, the preauricular pain presence
was assessed as pre-existing or new and relating to how much the masks were used in terms ofhours.
Moreover, they reported avoiding talking while wearing anytype of face masks. This might be related to
an amplied tension in the periauricular areathat occursin the facial movements during the phonation.
Anothersignicant outcomeis the headacheassociated in particular with the hours of use of the mask.It
is assumed to beatension-type headache caused by increased contraction of the craniofacial muscles.
A surveyof Lim ECH et al. analyzed the correlation between headache and protective masks FFP2/FFP3
among healthcare workersduring the SARS outbreak in 2003–2004. In this investigation, 37.3% of
respondents reported headaches while wearing theface mask, 37.3% of them had pre-existing
headaches, 31.6% migraine headaches, 54.4% tension-type headaches, 13.9% unspecied headaches. It
was found an association between pre-existing headaches and the prolonged wearing of FFP2/FFP3
masks. Noheadache subtype was found as a predisposing factor toheadaches associated with
protective masks (8). The etiopathogenesis of headache associated with the masks could be related to
hypoxemia, hypercapnia, mechanical factorsor stress (17–19).
Only mechanical factors related to the protective masks,more easily usable, weredetected. However, the
partial pressuresof carbon dioxide and oxygen were notevaluated in this study. Cervicogenic headaches,
that is a subtype of headache describing headaches arising from the neck, are usually associated with
primary cervical disease (17–21). It might be assumed that in peoplewho wear themask with the elastic
bands behind the neck,this kind of headache could be caused bythe pressure of the elastic on the neck
or back head supercial nerves, therefore this condition could aggravate a pre-existing cervical disorder
and exacerbatethe headache associated with protective masks.
No statistically signicant data on the presence of joint noise was found in our study. Indeed, masks
seem to not cause joint damage because boththe forceapplication quantity and duration are not enough
high to create articular injuries.
However, the application method with one ortwo bands pulling the mandible in the anteroposterior
direction could result in a chin cup effect with greater compression of the retrodiscal tissue. This could
explain the augmented pain in the joint area reported by people in the questionnaire. This research did not
include otherfactors usually related to TMD such as psychological distress and sleep disturbances (22,
Page 13/16
23) as well as possible previously diagnosed structural and anatomical anomalies related to the TMJs
(24, 25) which may inuence the orofacial pain. Some limitations maystill be linked to the online survey
delivery. The use of social networksmay have created a restricted sample since respondents were usually
young adults and users of these platforms and there are some missing data maybe due to some
diculties in understanding the questions orinattention in performing thequestionnaire. Moreover, data
werereported byrecruited subjects and therefore, they are susceptible to a diverse and subjective
interpretation of the items. The kind of response could also have depended on the moment when
participants replied, for example, whetheror not they werewearing the mask at the time.Furthermore, no
information on the assumption of anyanti-inammatory drugs for the referred orofacial symptoms were
asked (26,27).
Thus, future prospective studies should be designed to evaluate the association of headaches,
psychological distress, sleep disturbances and pre-existing TMJ disorderswith the use of protective
masks compared to a healthycontrol group, in orderto aware thescientic community to the possible
undesirable effects of prolonged use of masks.
C o n c l u s i o n s
This survey highlighted the presenceof orofacial pain and temporal headache associated with the useof
protective face masks during the SARS-CoV-2 pandemic. Most of the respondents referred to mainly use
the FFP2/FFP3 masks with two elasticsbehind the ears. A statistically signicant correlation was found
between the prolonged useofFFP2/FFP3 masks for morethan 4 hours and painin the anteriorregion to
the ears. Thus, further clinical prospective clinical trials may be useful to assessthe TMDonset and
prevalenceconsequently to the mandatory useof protective masks.
A b b r e v i a t i o n s
COVID-19: CoronaVirus Disease-19
DC/TMD: Diagnostic Criteria for Temporomandibular Disorders
FFP2/FFP3:Filtering Facepiece 2/ Filtering Facepiece3
TMD:Temporomandibular disorders
TMJ: Temporomandibular joint
SARS-CoV-2: Severe Acute Respiratory Syndrome Coronavirus 2
WHO: World Health Organization
D e c l a r a t i o n s
E t h i c s a p p r o v a l a n d c o n s e n t t o p a r t i c i p a t e
Page 14/16
The study was conducted in accordance with theDeclaration of Helsinki Ethical Principles. All
participants were informedabout the study objectives. By clicking on ‘submit’ the subjects consented to
participate in the study. Informed consent was obtained from all participants. Names, emails, or any other
personal identiers were not included in the data collected. The study presented does not report any
experimental protocol, thereforeit was not necessary to request approval from the Ethics Committee of
University of Campania Luigi Vanvitelli.
C o n s e n t f o r p u b l i c a t i o n
Not applicable.
A v a i l a b i l i t y o f d a t a a n d m a t e r i a l s
The datasets used and/or analysed during the current study are available from the corresponding author
on reasonable request.
C o m p e t i n g i n t e r e s t s
The authors declarethat they have no competing interests.
F u n d i n g
None.
A u t h o r s ' c o n t r i b u t i o n s
All authors contributed tothis article. VG, LP and FdA conceptualized the study, developed the
methodology and supervised the project.RPR and GM collected the data and drafted of the manuscript.
VS analyzed the data. LN was involved in validation, visualization and revised the manuscript.All authors
read and approved thenal manuscript.
A c k n o w l e d g e m e n t s
Not applicable.
R e f e r e n c e s
1. World Health Organization. WHO Director-General's remarks at the media brieng on 2019-nCoV.
https://www.who.int/director-general/speeches/detail/who-director-general-s-remarks-at-the-media-
brieng-on-2019-ncov-on-11-february-2020 (2020). Accessed 11 Feb 2020.
2. Gebru AA, BirhanuT, Wendimu E, Ayalew AF, Mulat S, Abasimel HZ, Kazemi A, TadesseBA, Gebru BA,
Deriba BS, Zeleke NS, Girma AG, Munkhbat B, Yusuf QK, Luke AO, Hailu D. Global public health
signicances, healthcare perceptions ofcommunities,treatments, prevention and control methodsof
COVID-19.Hum Antibodies. 2021;29(2):129–137.
Page 15/16
3. Pascarella G, Strumia A, Piliego C, Bruno F, Del Buono R, Costa F, Scarlata S, Agrò FE. COVID-19
diagnosis and management: a comprehensive review. J InternMed. 2020;288(2):192–206.
4. Kandel N, Chungong S, Omaar A, Xing J. Health security capacities in the context ofCOVID-19
outbreak: an analysis of International Health Regulations annual reportdata from 182 countries.
Lancet. 2020;395(10229):1047–1053.
5. Tirupathi R, Bharathidasan K, PalabindalaV, SalimSA, Al-Tawq JA. Comprehensive review of mask
utility and challenges during theCOVID-19 pandemic.Infez Med. 2020;28(suppl 1):57–63.
. Wang J, Pan L, Tang S, Ji JS, ShiX. Mask use during COVID-19: A risk adjusted strategy. Environ
Pollut. 2020;266(Pt 1):115099.
7. Fennelly KP.Personal respiratory protection against Mycobacterium tuberculosis. Clin Chest Med.
1997;18(1):1–17.
. Lim EC, Seet RC, Lee KH, Wilder-Smith EP,Chuah BY, Ong BK. Headachesand the N95 face-mask
amongst healthcare providers. Acta Neurol Scand. 2006;113(3):199–202.
9. Khoo KL, Leng PH, Ibrahim IB, Lim TK. The changing face of healthcare worker perceptions on
powered air-purifying respirators during theSARS outbreak. Respirology. 2005;10(1):107–10.
10. Schiffman E, Ohrbach R, TrueloveE, Look J, Anderson G, Goulet JP, List T, Svensson P, Gonzalez Y,
Lobbezoo F, MichelottiA, Brooks SL, Ceusters W,Drangsholt M, Ettlin D, Gaul C, Goldberg LJ,
Haythornthwaite JA, HollenderL, Jensen R, John MT, De Laat A, de Leeuw R, Maixner W, van der
Meulen M, Murray GM, Nixdorf DR, Palla S, Petersson A, Pionchon P, Smith B, VisscherCM,
Zakrzewska J, Dworkin SF; International RDC/TMD Consortium Network, International association
for Dental Research; Orofacial Pain Special Interest Group, InternationalAssociation for the Study of
Pain. Diagnostic Criteria for Temporomandibular Disorders (DC/TMD) for Clinical and Research
Applications: recommendations of the International RDC/TMDConsortium Network* and Orofacial
Pain Special Interest Group †. J Oral Facial Pain Headache. 2014;28(1):6–27.
11. Inchingolo AD, DipalmaG, Inchingolo AM, Malcangi G, Santacroce L, D'Oria MT,Isacco CG, BordeaIR,
Candrea S, Scarano A, Morandi B, Del Fabbro M, Farronato M, Tartaglia GM, Balzanelli MG, Ballini A,
Nucci L, Lorusso F, Taschieri S, Inchingolo F. The 15-Months Clinical Experience of SARS-CoV-2:A
LiteratureReview of Therapies and Adjuvants. Antioxidants (Basel). 2021;10(6):881.
12. Tan KT, Greaves MW. N95 acne. Int J Dermatol. 2004 Jul;43(7):522–3.
13. Nash JM. Psychologic and behavioral management of tension-type headache: treatment procedures.
CurrPain Headache Rep. 2003;7(6):475–81.
14. Thatiparthi A, Liu J, Martin A, Wu JJ. AdverseEffects of COVID-19 and Face Masks: A Systematic
Review. J Clin AesthetDermatol. 2021;14(9 Suppl 1):S39-S45.
15. Nwosu ADG, Ossai EN, Onwuasoigwe O, Ahaotu F. Oxygen saturation and perceived discomfort with
face mask types, in the era ofCOVID-19: a hospital-basedcross-sectional study. Pan Afr Med J.
2021;39:203.
1. Koh E, Ambatipudi M, Boone DL, Luehr JBW, Blaise A, Gonzalez J, Sule N, Mooney DJ, He EM.
Quantifying face mask comfort. J Occup Environ Hyg. 2022;19(1):23–34.
Page 16/16
17. Dirol H, Alkan E, Sindel M, Ozdemir T, Erbas D. The physiological and disturbing effects of surgical
face masks in the COVID-19 era. Bratisl Lek Listy.2021;122(11):821–825.
1. Priya K, Vaishali PNA, Rajasekaran S, Balaji D, Navin RBN. Assessment of Effects on Prolonged
Usage of Face Mask by ENT Professionals During Covid-19 Pandemic. Indian J Otolaryngol Head
Neck Surg. 2021:1–5.
19. Headache Classication Committeeof the International Headache Society (IHS). The International
Classication of Headache Disorders, 3rd edition (betaversion). Cephalalgia. 2013;33(9):629–808.
20. Alreshidi NM, Alghamdi S, Shibily F, Mahsoon A, Alasmee N, SharifL, Tajuddin A, Siddiq N. The
Association between Using Personal Protective Equipment and Headache among Healthcare
Workers in Saudi Arabia Hospitals during the COVID-19 Pandemic. Nurs Rep.2021;11(3):568–583.
21. VermaS, Tripathi M, Chandra PS. Cervicogenic Headache: Current Perspectives. Neurol India.
2021;69(Supplement):S194-S198.
22. Reis PHF, Laxe LAC, Lacerda-Santos R, Münchow EA. Distribution of anxiety and depression among
different subtypes of temporomandibular disorder: A systematic review and meta-analysis. J Oral
Rehabil. 2022;49(7):754–767.
23. Al-Jewair T, Shibeika D, Ohrbach R. Temporomandibular Disorders and Their Association with Sleep
Disorders in Adults: A Systematic Review. J Oral Facial PainHeadache.2021;35(1):41–53.
24. Minervini G, Nucci L, Lanza A, Femiano F, Contaldo M, Grassia V. Temporomandibular disc
displacement with reduction treated with anteriorrepositioning splint: a 2-year clinical and magnetic
resonance imaging (MRI) follow-up. J Biol Regul Homeost Agents. 2020 Jan-Feb;34(1 Suppl.
1):151–160.
25. d’Apuzzo F, Minervini G, Grassia V, Rotolo RP, Perillo L, Nucci L. Mandibular Coronoid Process
Hypertrophy: Diagnosis and 20-Year Follow-Up with CBCT, MRI and EMG Evaluations. Applied
Sciences[Internet]. 2021;11:4504.
2. Moccia S, NucciL, Spagnuolo C, d’Apuzzo F, Piancino MG, Minervini G. Polyphenols as Potential
Agentsin the Management of Temporomandibular Disorders. Applied Sciences[Internet]
2020;10(15):5305.
27. Montinaro F, Nucci L, d'Apuzzo F, Perillo L, Chiarenza MC, Grassia V. Oral nonsteroidal anti-
inammatory drugs as treatment of joint and muscle pain in temporomandibular disorders: A
systematic review.Cranio. 2022:1–10.
ResearchGate has not been able to resolve any citations for this publication.
The physiological and disturbing effects of surgical face masks in the COVID-19 era
Jan 2021
<here is a image 5fdd630961ec8d2e-1db5d8608349422a> Hulya Dirol
<here is a image 4021d13e9f1bc666-7adaff99ad0923b1> Ege Alkan
<here is a image a956524a4bbece5c-754ddc70be20c3bc> Muzaffer Sindel
D. Erbas
Background:
In the COVID-19 pandemic, the concern about mask-harmful effects disturbed mask-adherence. However, it is not certain whether the masks cause cardiopulmonary overload.
Objective:
To investigate the physiological and disturbing effects of surgical face masks during exercise.
Method:
The study was conducted in a tertiary hospital with 100 healthy volunteers between September 2020 and January 2021. Individuals with impaired walking, cardiopulmonary disease, and smoking were not included in the study. Initially, respiratory rate (RR), heart rate (HR), oxygen saturation (SpO2), end-tidal carbon dioxide (EtCO2) were measured. Participants underwent 6-minute walking test (6MWT) with and without surgical masks. Mask-discomfort questionnaire was applied before and after 6 MWT with the mask.
Results:
Surgical masks during 6 MWTs significantly increased HR, RR, and EtCO2 levels (p<0.001). Walking distance (p<0.001) and SpO2 level (p=0.002) were significantly decreased with mask. In Mask-Discomfort Questionnaire, humidity, temperature, resistance, salinity, odor, fatigue (p<0.001), and itching (p=0.001) scores significantly increased after 6MWT with mask.
Conclusion:
In healthy volunteers, HR, RR, EtCO2 were increased, and SpO2 and walking distance were decreased in the short-term, light exercise performed with the surgical mask. Findings support the concern that masks may cause cardiopulmonary overload (Tab. 3, Fig. 1, Ref. 17). Text in PDF www.elis.sk Keywords: COVID-19, masks, physiology, psychological side effects, questionnaire.
Assessment of Effects on Prolonged Usage of Face Mask by ENT Professionals During Covid-19 Pandemic
| https://www.researchgate.net/publication/362729339_Protective_Masks_During_the_SARS-COV-2_Pandemic_Is_there_a_Relationship_with_Temporomandibular_Disorders_An_Observational_Cross-sectional_Survey |
SHERLAND, Christopher (1593-1632), of Northampton and Gray's Inn, London | History of Parliament Online
SHERLAND, Christopher (1593-1632), of Northampton and Gray's Inn, London
Published in The History of Parliament: the House of Commons 1604-1629 , ed. Andrew Thrush and John P. Ferris, 2010 Available from Cambridge University Press
Dates
1624
1625
1626
1628
Family and Education
bap. 28 Apr. 1593,1o.s. of Thomas Sherland (Shurland) of Wells Hall, Milden, Suff. and the M. Temple, London and Anne, da. of Sir Christopher Yelverton† of Easton Maudit, Northants.2 educ. G. Inn, entered 1604, called 1617; Queen’s, Oxf. 1607, BA 1610.3 m. Jane, da. and coh. of Edward Oglethorpe of Newington, Oxon. and Smithfield, London, s.p.4 suc. fa. c.1610.5 d. Feb. 1632.6
Offices Held
Commr. gaol delivery, Northampton 1621-9,7recorder and freeman 1623- d.;8reader, Staple Inn, 1623, G. Inn 1626, bencher 1627- d.9
Feoffee for impropriations 1625- d.;10member, Providence Is. Co. 1630- d.11
Biography
Sherland’s family acquired manorial property in Suffolk in Tudor times, though most of it was sold by his father.12Sherland himself was born and raised in the household of his maternal grandfather, Sir Christopher Yelverton, at Easton Maudit, on the Northamptonshire border with Buckinghamshire. The latter’s son and heir, Henry Yelverton*, diverted Sherland’s early ambitions from the church to the law,13and another uncle, Edward Sherland, of Gray’s Inn, bequeathed Sherland his chamber there in 1609, as well as various properties, which were to be held by Yelverton until Sherland reached his majority.14While at Gray’s Inn, Sherland came under the influence of the eminent puritan divine, Richard Sibbes, who termed him a ‘general scholar’, with ‘good skill in that we call elegant learning, and controverted points of divinity’.15His marriage linked him to a number of families of similar outlook, notably those of John Hampden* and Oliver Cromwell*. He quickly established a reputation as a rising lawyer, and succeeded Yelverton, on the latter’s strong recommendation, as recorder of Northampton in 1623.16As such, and in accordance with borough custom, he was elected to Parliament the following year, and served in every subsequent assembly until his death.17The similarity between his surname and that of Henry Sherfield, who also sat in all four of the parliaments to which Sherland was returned, has caused occasional confusion in the parliamentary records, particularly for 1628-9; in at least two cases contemporary diarists erroneously attributed speeches to Sherland that were in fact delivered by Sherfield.18
In the 1624 Parliament Sherland was named to five committees. Their subjects included legal bills to prevent delays arising from the removal of legal actions from inferior courts (9 Mar.) and reverse certain outlawries (12 April).19In the grand committee for grievances on 16 Apr. he gave his first recorded speech, which took the form of a plea to ‘question every canon’ issued by Samuel Harsnett, bishop of Norwich who was accused of suppressing preaching in his diocese, on the grounds that ‘if thus food for the soul be restrained, the people perish’.20Sherland was added to the committee appointed to investigate the corruption of the master of Corpus Christi in Oxford, Dr. Anyan, on 1 May.21Returning to attack Harsnett two days later, Sherland claimed that the bishop ‘cannot but be a certain friend to popery that is doubtful for religion’.22That same day he also reported the estate bill of a Northamptonshire landowner, Sir Richard Barnaby.23During the debate of 13 May on Harsnett’s fellow-Arminian, Richard Montagu, Sherland moved for a meeting between the judges and divines to define schism.24Two days later he was one of those ordered to prepare a conference on Harsnett.25On the same day, 15 May, Sherland reported the private bill of his kinsman Sir James Ward aliasFermor, although he had not been appointed to its committee.26
As one of the four lawyers who served as feoffees for impropriations, Sherland was outstandingly successful in raising funds to purchase tithes and benefices for the support of a godly ministry.27In Charles I’s first parliament, Sherland augmented his earlier assault upon Arminianism. On 7 July he moved for the immediate punishment of Montagu for repeating his attack on predestination, and was named to the committee to draft the charge.28He was appointed to the committees for the subscription bill (27 June), and for a bill to allow clergymen to take farms (11 July).29The session, relocated to Oxford as a result of the plague in London, rapidly foundered upon the question of supply for war, which Sherland argued on 11 Aug. was ‘out of our way’ since two subsidies had already been granted; he therefore moved to ‘decline this dispute of giving’.30He made a further major contribution to the supply debate on 12 Aug., the last day of the Parliament, effectively demolishing the arguments in favour of another grant.31Sherland began by defending the Commons’ reliance on precedents, which he described as ‘the life and rule of parliaments’. He then warned that ‘by the easiness of subjects to supply, princes become more careless of their revenue and expense’, and foresaw that if this happened, it would lead to ‘tumults and commotions’ among the people. Sherland dismissed the mounting attacks in the Commons on Buckingham, ‘for... who knows not that nothing can be done without permission of the king?’ This being the case, he argued that supply was futile, for kings refused ‘to make merchandise of their justice’. Sherland complained of the support and countenance given to Arminianism, and considered that the enforcement of the recusancy laws would enable Charles ‘to subsist of himself, as his predecessors have done’. He therefore moved for a Remonstrance to be submitted to the king. It was unusual for a man with so little parliamentary experience to speak with such force, and (Sir) John Eliot* commended him as a Member ‘more studied yet than practised in the affairs of that assembly or the world’, whose words had ‘put the courtiers beyond hope’.32
In the second Caroline Parliament Sherland achieved greater prominence. His numerous committee appointments included one ‘to consider of all points concerning religion’ (10 Feb. 1626) and that for privileges (11 February).33As a member of the latter, he argued on 14 Feb. that the election of Sir Edward Coke* for Norfolk, then sheriff of Buckinghamshire, was dubious and contrary to precedent. He nevertheless conceded that without Coke ‘we want a part of the soul of the House’, a feeling that was widely shared, as the Commons ultimately avoided deciding the question of Coke’s membership one way or the other.34Sherland was probably the author of a bill against ‘temporal simony’ and the procuring of judicial places, which was refused a reading on 15 Feb. because no breviate had been delivered to the Speaker.35Religion as ever remained high on his agenda, and he was accordingly appointed to committees for bills concerning simony (14 Feb.), recusancy (23 Feb.), and adultery (4 March).36He continued to instruct the House against the evils of Arminianism. Montagu’s book had been condemned by the leading Calvinist theologians of the day, Bishop Morton and Dr. Preston, and on 6 Mar. Sherland reported optimistically that the Arminians had been trounced at the York House conference. This he claimed to have been told by Morton himself, though he admitted that there were ‘many rumours spread to the contrary’. In fact the Arminians had emerged triumphant, having succeeded in wooing Buckingham to their side. Despite the inaccuracy of his speech, Sherland was appointed to help prepare for a conference on the subject with the Lords.37He was also among those ordered to consider bills to regulate citations from ecclesiastical courts (9 Mar.) and to reduce the number of clerical magistrates (10 March).38He served on the inquiry into the excommunication of Sir Robert Howard*, upholding Howard’s claim of privilege and indulging in ‘a rare attack on the authority of the court of High Commission’. The Commons, he urged on 21 Mar., should discipline any Members involved in passing sentence, and refer the others to the Lords.39
On 8 Mar. Sherland expressed total dissatisfaction with the Council of War’s account of its proceedings, and moved that its members might be questioned individually, beginning with those of lowest rank.40In the supply debate two days later he promised that ‘whatsoever the king’s noble resolutions are, the House will not be defective in the prosecution thereof’; but he added that the timing of the subsidy was not of such crucial importance as the ‘necessity for the speedy removal of the cause [of] the evils among ourselves’. He acknowledged that there was ‘great occasion for us to extend our high and liberal hand to the king’. However, he felt that merely to grant supply without advising the king on its use would be fruitless: ‘if we give as we have given, we may look for the event as it has been. In going on with this business which we are now about, we may also go through with the others: the evils, causes, and remedies in their order’.41
He took a firmer line over the royal favourite Buckingham than in the previous Parliament, interpreting the king’s command to forbear further proceedings as an attempt to ‘fetter our liberties’.42After the Easter recess he was named to a select committee to put the case into proper form (21 Apr.), and the following day he asserted that if common fame was sufficient ground for a case against an individual, much more so was it ‘in a case that concerns the life and soul of the Commonwealth, which though we cannot call legal treason yet we may call it real treason’.43He assisted Edward Whitby to prepare the articles for Buckingham’s impeachment, and when Whitby was taken ill, presented them himself to the Lords on 10 May.44After apologizing for his inadequacy, and explaining that he had been ‘snatched as a bush to stop a gap’, his first point against the duke was that the sale of honours deprived the Crown of ‘one fair and frugal way of rewarding great deserving servants, who will never be satisfied with what they see so much slighted, and so easily purchased’. In terms similar to the ‘temporal simony’ bill that had been promoted in February, he then went on to condemn the sale of judicial office, a delicate matter since his uncle Yelverton notoriously owed his judgeship to Buckingham. Typically, having made these salient accusations, he could not resist departing from his brief to add matters of religion to the charges against the favourite, whom he described as a ‘great man, ... the principal patron and supporter of a semi-Pelagian, demi-Popish faction, dangerous to the church and state, lately set on foot among us’, which in his eyes was undoubtedly Buckingham’s gravest transgression.45In his last recorded speech in this Parliament, on 22 May, Sherland moved that any bill to confirm the Commons’ privileges should be declaratory rather than enactive, since then neither the Lords nor the king could object to it; and complaining of the loss of time, he proposed to ‘let this Remonstrance rest awhile ... the business of the Commonwealth are pressing’.46
In the next Parliament Sherland continued to play an active role. He began the session by professing warm affection for Charles, upon receipt of the latter’s message of 4 Apr. 1628 requesting supply and assuring them of his respect for their liberties.51Only four days later, however, Sherland gave a long and widely reported speech, against billeting as ‘the most grieving grievance that ever was’, and a thing ‘against the fundamental liberty of the kingdom ... not only against law, but in a transcendent manner’. To this he added the observation that ‘the law respects men’s persons, much more a man’s house, being his castle to preserve his person’. He told the House that troops commanded by a Catholic had been billeted in Northampton before the general election, an event that had been taken by the townsmen ‘to frustrate the hope of this Parliament’.52The following day, Sherland condemned as a coward the recorder of Wells, John Baber*, for levying money for billeting, and moved for his expulsion from the House, in a speech that attracted considerable publicity.53Sherland was one of those ordered on 16 Apr. to manage a conference on the liberty of the subject, and to a committee to examine the records (17 Apr.), though he later argued against drawing up a bill to reiterate the substance of Magna Carta and other precedents (28 April).54On 26 Apr. he described the prerogative as a branch of Common Law, and declared that if a man were imprisoned by order of the king a writ should be issued on which the judges would be obliged to enter the reason for his imprisonment.55
Sherland was more conciliatory towards the king personally than many of his political associates, perhaps because his sister was married to a courtier, Sir William Salter. On 3 May he unsuccessfully urged the House to accept the king’s promise to confirm its liberties with a bill at Michaelmas, and meanwhile to proceed with supply. ‘Thus we lay a great trust in the king, and he does trust us again, and we may apply ourselves to prepare the preamble to the bill of subsidies’.56He insisted, however, on 13 May and again a week later that the oath administered by the Forced Loan commissioners should be described as unlawful.57He reinforced this on 19 May, when he emphatically rejected the Lords’ other amendments to the Petition of Right: ‘I never saw any such petition with any such terms of diminution and excuse in the petition. There is no bitterness in this, only truth laid down in as good terms as maybe, and rather wondered that we have kept this temper’.58When the petition was finally ready, Sherland again urged the Commons, in the debate on how to present it to Charles, to proceed with ‘ingenuity and plainness’ and to ‘trust the king’s word’ (27 May).59
As ever, Sherland’s chief concern was with religion, though he did not always adhere to the usual puritan line. On 22 Apr. he opposed a bill to facilitate marriages in Lent, arguing that the present regulations were ‘counsels of mature deliberation and ancient marks of our Church. Therefore I think that we need not esteem ourselves wiser than our fathers, who have not complained to us, neither need we commit it to posterity’.60On 23 Apr. he reported a bill permitting parishioners to attend sermons in other churches; and after further amendments it was engrossed two days later.61He showed an unusual degree of sympathy towards clergymen accused of immorality, arguing on 16 May that a bill allowing them to be tried by jury might become
a snare for pious and godly men ... If ignorant or knavish witnesses that see a good minister reel or stagger by any imperfection, and shall give evidence of this to an ignorant jury, it may undo a good minister. He had rather see three ill ministers go unpunished than one good minister should suffer by it.
62
Sherland served on the committee for the subscription bill (23 Apr.), on which he again took a liberal line, arguing on 21 May that men should not be ‘enforced to subscribe that every title in the Book of Common Prayeris as infallible as scripture, when I know that many things in the Psalms are not translated according to meaning’.63
It was the danger to religion that came first to Sherland’s mind on hearing the king’s message of 5 June forbidding the Commons to meddle with state, government or ministers. He responded in the outraged vein of many Members: ‘we are so nearly married to misery that we must either now speak, or else forever hold our peace hereafter. Is it not plain that all courses have tended to innovate religion?’ He then described the miserable failure of Buckingham’s attack on the Ile de Ré as a victory for Spain, for by ‘the late expeditions that spent our men and money ... we united France and Spain and ruined ourselves’. In complaining that ‘the heads and chief parties of the papists [are] at Court, nay, great at Court’, Sherland made what was has been described as a ‘new intellectual link’, between Arminianism and alteration in government. The lengthy course of theological education he and others had given the Commons since as early as 1624 finally succeeded in rousing the House against the Arminians, who he said ‘run in a string with the papists, and flatter greatness to oppress the subject’. He concluded by sparing Charles: ‘we know the king’s heart is clear and straight, but he is surprised by others’.64
Accordingly Sherland was appointed to draw up the impeachments of the anti-Calvinist vicar of Witney, Richard Burgess (12 May), and of Montagu (13 June), and chaired the committee of a bill to prevent recusants from sending their children abroad for their education (2 June), which he reported on 17 June.65On 16 June he spoke in favour of a bill to facilitate the transfer of impropriate tithes to the incumbent, which he argued would benefit individual churches even if it diminished bishops’ revenues.66Having spoken at a conference with the Lords later that afternoon on the commission for excises to raise money by levying impositions, which Charles subsequently agreed to cancel, Sherland argued on 24 June that a Remonstrance against Tunnage and Poundage would achieve nothing, and would merely lead to new impositions.67Two days later the session was adjourned.
In the second session Sherland was named to committees for the revived bill to allow people to hear sermons outside their parishes (23 Jan. 1629), and for bills against the sale of judicial offices (23 Jan.), and corrupt presentations to livings and university posts (23 February).68On 26 Jan. he reasserted his belief in a plot to undermine both religion and government, alleging ‘it is the desire of some few that labour to bring in a new faction of their own; and so they drop into the ears of His Majesty ... designs that stand not with public liberty, and tell him that he may command what he listeth and do what he pleaseth with goods, lives and religion’. This conspiracy he believed was specifically anti-puritan, and he denounced it as ‘treason in the highest degree’.69Three days later, in response to the contentious allegation by his Northampton colleague Richard Spencer* that the Lambeth Articles had been suspended, Sherland moved that the Commons declare the Anglican religion to be based on the Thirty-Nine Articles as explained and interpreted before the rise of Arminianism.70On 5 Feb. he was ordered to take the chair in the committee to examine the anti-puritan petition of William Aleyne, although Selden eventually made the report.71His last contribution to debate, on 11 Feb., was to support the maiden speech of his wife’s kinsman, Cromwell, who raised the example of anti-papist preaching being suppressed, despite the efforts to the contrary of one Dr. Beard. Sherland ‘spake much unto the credit’ of Beard, ‘an orthodox man’, who had been summoned and reprimanded by the Arminian Bishop Neale.72
Before the end of the year Sherland had collected £100 for the feoffees for impropriations,73and in 1630 he became a founder member of the Providence Island Company.74Early in 1631 he defended some of those who had refused to compound for knighthood.75In his will, dated 5 July 1631, Sherland left £400 to the feoffees for impropriations, £100 to Sibbes’s college, St. Catharine’s, Cambridge, 200 marks to the corporation of Northampton to be invested to provide work for the poor, and 40 marks to the poor of Easton Maudit, where he was born. Hampden, his ‘trusty and assured good friend’ was appointed joint executor, but later refused to act. The overseers were John Crewe* and Richard Knightley*.76Sherland added a final codicil on 7 Feb. 1632 and died shortly thereafter, as the will was proved less than three weeks later; he was buried in St. Andrew’s, Holborn.77Sibbes, who preached at his funeral, described him as ‘a man of an excellent sweet temper ... tractable and gentle, yet immovably fixed to his principles of piety and honesty; he was exact in his life, but not censorious, very conscionable and religious, but without any vain curiosity’.78Sherland, who had no children, was the first and only member of his family to sit in Parliament. His widow married Thomas Ball, a moderate puritan who held two livings in Northampton.79
Ref Volumes: 1604-1629
Authors: Virginia C.D. Moseley / Rosemary Sgroi
Notes
1. Northants. RO, M263, [Easton Maudit par. reg.] f. 38.
2. Add. 19149, f. 25.
3. GI Admiss .; Al. Ox .
4. E.A. Webb, Recs. St. Bartholomew’s Smithfield , ii. 269-70.
5. PROB 6/8, ff. 18, 111.
6. Add. 19149, f. 25.
7. C181/3, f. 39; 181/4, f. 44.
8. Northampton Bor. Recs . ed. J.C. Cox, ii. 105.
9. PBG Inn , 246, 258, 274, 276.
11. CSP Col. 1574-1660 , p. 123.
12. W. Copinger, Suff. Manors , i. 159; iii. 283; vii. 150.
13. Add. 19149, f. 25.
14. PROB 11/114, f. 26.
15. R. Sibbes, The Saints Cordialls (1637), p. 206.
16. Northampton Bor. Recs . ii. 105
17. VCH Northants . iii. 17.
18. CD 1628 , i. 38-9, ii. 45; CD 1629 , p. 37.
19. CJ , i. 680b, 763a.
20. ‘Holland 1624’, ii. f. 36.
21. CJ , i. 781a.
22. ‘Holland 1624’, ii. f. 75.
23. CJ , i. 696b.
24. ‘Earle 1624’, f. 182.
25. CJ , i. 705a.
26. Ibid. 704b.
27. E.W. Kirby, ‘The Lay Feofees: a study in militant puritanism’, JMH , xiv. 4, 6.
28. Procs. 1625 , pp. 334, 335.
29. Ibid. 253, 368.
30. Ibid. 468.
31. Ibid. 474-5, 477-8.
32. Ibid. 21-3, 565-7; C. Russell, PEP , 251-2.
34. Ibid. 38, 41.
35. Ibid. 45; Russell, 278.
36. Procs. 1626 , ii. 32, 102, 196.
37. Ibid. 206-7, 359; Russell, 29, 31, 298.
38. Procs. 1626 , ii. 238, 246.
39. Ibid. 61, 332, 334; Russell, 27.
40. Procs. 1626 , ii. 230, 232.
41. Ibid. 251, 273, 322, 351.
42. Ibid. 419-20.
43. Ibid. iii. 38, 47, 50-1.
44. Ibid. 140, 147, 202, 219.
45. Ibid. i. 394, 445, Lansd. 93, ff. 103-6; C.G.C. Tite, Impeachment and Parl. Judicature , 190, 191, 193, 198.
46. Procs. 1626 , iii. 303, 305.
47. Ibid. 346.
48. Ibid. 405, 414.
49. Ibid. 444.
50. Ibid. 265, 267; J. Eliot, De Jure Maiestatis and Letter Bk . ii. 6-7.
51. CD 1628 , ii. 313.
52. Ibid. 361-2, Procs. 1628 , vi. 64-5.
53. CD 1628 , ii. 378, 385, 388, 392; Procs. 1628 , vi. 183.
54. CD 1628 , ii. 480, 487, 510; iii. 142.
55. Ibid. iii. 99, 108, 111-2, 116.
57. CD 1628 , iii. 395, 397, 493, 498, 504.
58. Ibid. 468, 478, 481.
59. Ibid. 627, 630, 632.
60. Ibid. 26.
61. Ibid. 42, 71.
62. Ibid. 432, 433, 439, 441, 442.
63. Ibid. 44, 514, 519, 521.
64. Ibid. iv. 116, 120, 125, 130, 132; Russell, 29, 379.
65. CD 1628 , iii. 369; iv. 51, 291, 345.
66. Ibid. iv. 335.
67. Ibid. 449.
68. CJ , i. 921b, 922a, 932b.
69. CD 1629 , pp. 15-16; Russell, 407-8.
70. Ibid. 117.
71. CJ , i. 927a; CD 1629 , p. 129.
72. CD 1629 , p. 193.
73. Kirby, 10.
74. A.P. Newton, Colonizing Activities of Eng. Puritans , 70.
75. T. Birch, Ct. and Times of Chas. I , ii. 96.
76. PROB 11/161, f. 80v-1.
77. J. Stow, Survey of London (1633), p. 873.
78. Sibbes, 209.
| https://www.historyofparliamentonline.org/volume/1604-1629/member/sherland-christopher-1593-1632 |
Morning Ethics Warm-Up, 1/5/2018: Brrrrrrr!… “Hey!”… Duh!… And “WHAT?” | Ethics Alarms
Confront it, Fix it, and Remember it....
G-g-g-good M-m-m-morning!
1 Enforcing societal standards in the cold.
Today, as we ran errands in 13 degree weather and gusting winds to fetch my sick son some chicken soup and DayQuil, my wife witnessed the following episode at the 7-11. With a long line behind him, a man stood at the register meticulously picking lottery numbers. A woman in line confronted him directly, saying, “
You came out in this cold just to waste your money on the lottery? You’re sick. Save your money. Be responsible. Get help”
Brava.
Driving home, we saw many parents walking their children to Alexandria schools (which delayed their opening here two hours.) At an intersection near the school across a parking lot from our home, my wife and I saw a young girl, maybe seven or eight, with her father, about to cross the street. The girl had a winter jacket on and a hat, but only thin leggings and—get this—sneakers with
no socks.
The wind chill outside here is estimated at -4.
We didn’t say anything to the father. Should we have? I think so.
2. More state lottery ethics.
Speaking of unethical state lotteries, which could only become ethical if the states eliminated them, you will recall
Item #4 in the 12/28/17 warm-up
, about how South Carolina had bollixed up its lottery and is deciding whether to stiff the winners, since there were far too many of them thanks to computer programming error. That state needs to follow the ethical example of Connecticut.
After an error was discovered in how the drawing was handled—involving 100,000 tickets—
the lottery posted a notice
on its official website saying there was indeed a problem with the drawing, and that “due to an error in the range of tickets eligible for the Super Draw drawing, a second drawing will take place shortly. HOLD ALL TICKETS.” Later it announced, through this statement from Interim Lottery President & CEO Chelsea Turner:
Due to human error, 100,000 ticket numbers were not included in this morning’s Super Draw drawing. Our goal, first and foremost, is to make our players whole. In order to do so, a second drawing will take place shortly that includes the corrected ticket number range.
All winning tickets from both drawings will be honored.
3. Bias makes you forgetful, too.
.. The Resistance news media is engaged in an orgy of Trump-Hate porn as juicy rumors and sausage-making stories drip out of the new tell-all book by Michael Wolff, now being treated as virtual Boswell in matters Trump after years of being regarded by the same journalists as a sleaze-merchant. The ugly spectacle did inspire some brain cells to fire and reveal a long forgotten scandal from another White House’s dirty laundry.
Retired general Hugh Shelton, late of the Joint Chiefs of Staff, wrote in his 2010 book “Without Hesitation,” that while Bill Clinton was in the White House, a key component of the president’s nuclear launch protocol—the launch codes!
— went missing. “The codes were actually missing for months. This is a big deal,” the general wrote. “We dodged a silver bullet.” The card with code numbers on it that allow the President to access a briefcase, called the “football, ” and launch a nuclear attack was lost by a Clinton aide. Once a month, Defense Department officials conduct an in-person verification to make sure the President has the right codes. Twice in a row, Shelton wrote, a White House aide told the Pentagon checker that the President was in a meeting but gave a verbal assurance that the codes were with him. He was lying.
In 2000, according to Shelton, when the time came to replace the codes with a new set, “the President’s aide admitted that neither he nor the President had the codes. They had completely disappeared.” You know, like in the GEICO commercial…
Explained The Atlantic
when Shelton’s book first came out:
Here’s the reality: Losing that identifier card had the potential to create a vast disruption in nuclear command and control procedures.
So Al Gore gets “the call” because Clinton can’t properly ID himself. Gore is confused, lives in Washington, knows the President is fine. He tells NORAD to hold while he tracks down the President, who can’t verify his own identify anyway. Precious minutes (and I do mean precious, seconds count in the nuke business) are lost while civilian and military leadership sort things out.
And that says nothing of the fact that the President would be in gross violation of his duties by allowing the VP to execute an order that is lawfully the President’s to make. Once a strike is authorized by the NCA, the Chairman and Vice Chairman of the Joint Chiefs of Staff pass the order to the U.S. Strategic Command through the NMCC, or through an alternate command site, like Site R in Liberty Township, PA, or through an airborne platform known as TACAMO, which stands for “Take Charge and Move Out.”
Do you recall a big deal being made out of this in 2010? I don’t. This is the first time I ever heard that story. Apparently the New York Times didn’t recall either, since it realted the story this week as if it was the first the paper had heard of it. Shelton was unethical to relate it at all, but at least he waited ten years after Clinton had left office. He also went on the record, and is, oh, about 100 times more credible than the unnamed sources, as well as the named ones, that Wolff relied on. Needless to say, this is a lot more serious than the alleged chaos in the Trump White House before General Kelly arrived on the scene, but in 2010 the news media and the Democrats had no interest in embarrassing the Clintons while Hillary was at State and Obama was in the White House, and the news media had not yet deteriorated in a 24-7 hate propaganda machine determined to undermine public trust in their elected President.
Share this:
Twitter LinkedIn
Facebook Reddit Print
Email
Like this: Like
Loading...
Related | https://ethicsalarms.com/2018/01/05/morning-ethics-warm-up-1-5-2018-brrrrrrr-hey-duh-and-what/?replytocom=495818 |
Edinburgh | Historic Hospitals
Extract from John Thomson's Atlas of Scotland 1832. Reproduced by permission of the National Library of Scotland ASTLEY AINSLIE HOSPITAL, GRANGE LOAN David Ainslie of Costerton, Midlothian, died in 1900 leaving the residue of his estate for 'the purpose of creating, endowing and maintaining a hospital or institution for the relief and behoof of the convalescents in the…
Edinburgh
Extract from John Thomson’s
Atlas of Scotland
1832. Reproduced by permission of the National Library of Scotland
ASTLEY AINSLIE HOSPITAL, GRANGE LOAN
David Ainslie of Costerton, Midlothian, died in 1900 leaving the residue of his estate for ‘the purpose of creating, endowing and maintaining a hospital or institution for the relief and behoof of the convalescents in the Royal Infirmary of Edinburgh’. In 1921 a Board of Governors was formed to carry out the bequest. The hospital opened in about 1923, the original site having been acquired in 1921 comprising a golf course and the four villas of Millbank, Southbank, Canaan House and Canaan Park with Morelands House and St Roque House being acquired later.
Extract from the revised 2nd edition OS map of 1932-3. Reproduced by permission of the National Library of Scotland
At the core of the present hospital site are the three remaining villas, of simple classical style, and a gate lodge with good decorative ironwork. Canaan House dates from
c
.1805 with additions of 1877. Canaan Park, of
c
.1845, has substantial additions dating from 1922 by
John Jerdan
as part of its conversion to hospital use.
Canaan Park, photographed in 2007. It was the home of John Stuart Stuart-Forbes from about 1853-60; he was killed in action at the battle of Little Bighorn – Custer’s Last Stand – © Copyright M J Richardson and licensed for reuse under this Creative Commons Licence
St Roque was also originally built
c
.1845 with St Roque Lodge dating from
c
.1870.
“Astley Ainslie Hospital, Edinburgh” by Kim Traynor Own work. Licensed under CC BY-SA 3.0 via Wikimedia Commons
Canaan House became the administration department and various hospital blocks were constructed on the site, mostly byAuldjo Jamieson & Arnott,between 1925 and 1939. Designed as a convalescent home, it developed to provide for patients who required longer care and supervision after illness or surgery and to build up patients’ strength before treatment. It became a leading rehabilitation centre and established a pioneering training school for occupational therapy. The hospital continues (2015) to provide rehabilitation services both for in-patients and out-patients. [ Sources:A. Miles, University of Edinburgh Journal, Vol.III, 1929-30:http://www.lhsa.lib.ed.ac.uk/exhibits/hosp_hist/astley_ainslie.htm]
BEECHMOUNT HOSPITAL, 102 Corstorphine RoadBeechmount House, a loosely classical mansion built in 1900 to designs byJohn Watson, was bequeathed to the Royal Infirmary of Edinburgh in 1926 and opened as an auxiliary hospital c.1928.
Extract from the 2nd-edition OS map, revised in 1905. Reproduced by permission of the National Library of Scotland
The Infirmary managers had initially considered reconstructing and equipping the house as a radiological institute. However, when the infirmary was recognized by the National Radium Commission as the National Radium Centre for Edinburgh, Beechmount was designated as an auxiliary hospital with accommodation for 40 patients before and after receiving radium treatment in the Infirmary.
Aerial photograph of Beechmount House, taken in March 2015 by RCHAMS © Crown Copyright: RCAHMS
The hospital was transferred to the National Health Service in 1948 and latterly was used as a convalescent home mostly for elderly patients. It closed in 1989-90 and returned to private ownership.The individual columns along the driveway were originally used as gas-lights; the hole through the shafts for the flow of gas can still be seen. [ Sources:A. Logan Turner, Story of a Great Hospital, Edinburgh, 1979, p.337]
BRUNTSFIELD HOSPITALThe founding of the hospital was due to the endeavours of Dr Jex-Blake and Dr Elsie Ingils, to provide medical care for women and clinical experience for young women doctors. The Bruntsfield Hospital opened in 1899 in the converted Bruntsfield Lodge (originally Greenhill Cottage), which and been the Edinburgh home of Dr Sophia Jex-Blake since 1883.
Extract from the 1877 OS large-scale town plan. Reproduced by permission of the National Library of Scotland
She was the first woman general medical practitioner in Scotland and began practice at No. 4, Manor Place in June 1878. In September of that year Jex-Blake opened the Edinburgh Provident Dispensary for Women and children in Grove Street. In 1885 it expanded to provide six beds and was renamed the Edinburgh Hospital and Dispensary for Women and Children. When Dr Jex-Blake retired in 1899 and moved away from Edinburgh the managers of this small hospital acquired her home. Bruntsfield Lodge, and converted it into an eighteen-bed general hospital for women.
Former Bruntsfield Hospital, Whitehouse Loan, photographed in 2012 by Kim Traynor. Licensed under CC BY-SA 3.0
In the same year Dr Elsie Inglis and the Medical Women’s Club opened a seven-bed hospital which was later known as the Hospice. These two institutions amalgamated in 1910. A new ward block was added to the complex, designed by
Arthur Balfour Paul
, which was opened by Queen Mary on 18 July 1911. In the later 1920s the hospital acquired No. 1 Bruntsfield Crescent, which had been owned by Professor James Lorimer, father of one of the best known of Scottish architects, Sir Robert Lorimer.
A ward in Bruntsfield Hospital decorated for Christmas in 1933, photograph from the collection of RCAHMS
The hospital was transferred to the National Health Service in 1948, but closed in 1989. In the 1990s the site was redeveloped for housing, retaining the former lodge. [For historic photographs of Bruntsfield Hospital, see also Lothian Health Services Archivesflickr page]
CHALMERS HOSPITAL, LAURISTON PLACEChalmers Hospital opened in February 1864. It was designed c.1861, byJohn Dick Peddie,of Peddie and Kinnear, in an elegant Italianate style with a central three‑storey block over a raised basement, flanked by two‑storey wings.
Former Chalmers Hospital , Lauriston Place, photographed in 2011 © Copyright kim traynor and licensed for reuse under this Creative Commons Licence
George Chalmers (1773‑1836), a plumber in Edinburgh, left the residue of his estate, amounting to around £30,000, to the Dean and Faculty of Advocates for the purpose of founding a ‘New Infirmary or Sick and Hurt Hospital’. In 1854, once the funds had accumulated to £70,000, Lauriston House was purchased with seven and a half acres of land behind it extending down to the meadows. On part of the land the hospital was begun in 1860, and Chalmers Street was formed on part of the ground which was then feued for housing development. Lauriston House was let as a school.
Extract from the 1877 OS large-scale town plan. Reproduced by permission of the National Library of Scotland
Work began in 1861 to erect a hospital with 48 beds in four wards. The polished ashlar exterior was considered to secure the building from impurities. The central block contained the staff accommodation and Nightingale-style wards were in the wings – these were built over an open basement to allow air to circulate and prevent damp. Between the wards and the central block were large open staircases, and the wards themselves were 54ft by 25ft and 16ft high, with a fireplace and a range of five windows on each side. Beds were placed against the wall, between the windows. Floors were of polished oak, the skirtings of Parian cement. Each ward had 12 beds and had its own bathroom and water closet at the far end. The two lower wards were opened in 1864 to non‑paying patients and the upstairs wards opened in 1872 to paying patients.
The building contractors were W & D. McGregor, masons; J & R Wilson, Leith, Wrights; J. Craigie & Sons, plasterers; J. Low, plumber; J. Young & Co., slaters. Cooking and heating apparatus were prepared by Mr Parnell, painting by Mr Moxon. The clerk of works was J. B. M’Fadzean. The cost, including the layout of the grounds was a little over £7,000. ( Sources: The Builder,3 Oct 1863, p.706)
CITY HOSPITAL, GREENBANK DRIVEThe City Hospital was built between 1897 and 1903 as the City Infectious Diseases Hospital to designs by the City Architect,Robert Morham.
City Fever Hospital, Colinton Mains viewed from across a ploughed field. Old postcard © H. Martin, reproduced with permission of H. Martin
It was of a similar scale than Ruchill Hospital in Glasgow with two ranks of ward pavilions ranged around the central administration building. Built of red sandstone on a site opposite the earlier Craiglockhart Poorhouse, these large complexes were relatively isolated when they were built.
The City Hospital, aerial photograph taken in 1948 by Aero Pictorial, from the RCAHMS collection
In 1871 Edingburgh Town Council had prepared Canongate Poorhouse for an epidemic hospital and after the Royal Infirmary refused to admit smallpox and cholera patients, premises in King’s Stables Road and part of the poorhouse in Forrest Road were converted for use as a temporary hospital for use in an emergency. The Royal Infirmary continued to cater for other infectious diseases and when Bryce’s new infirmary buildings were completed in 1879, the old Surgeons Hall was used to accommodate infectious cases.
City Hospital, Edinburgh , photographed in 1988 by alljengi reproduced under creative commons licence CC-BY-SA 2.0
In 1881 the Town Council purchased William Adam’s old infirmary building in Infirmary Street, together with the two surgical hospitals in High School Yards, to house fever patients during epidemics. In 1884 the old infirmary building was demolished and in the following year the Council bought from the Infirmary the Old Surgeon’s Hall and finally took over responsibility for the treatment of all cases of infectious diseases. These buildings remained in use as the City Fever Hospital until the new hospital opened in 1903.
The former City Hospital, from an OS map of 1958. Reproduced by permission of the National Library of Scotland
In 1913 accommodation was added for TB patients. The hospital closed in 1999. [
Sources:
A. Logan Turner, Story of a Great Hospital, Edinburgh, 1979, p.237: see also Lothian Health Board
blogspot
]
The Nurses’ Home, photographed by RCAHMS probably in 1996 © RCAHMS
A ward pavilion, City Hospital, photographed by RCAHMS in 1996 © RCAHMS
CORSTORPHINE HOSPITAL, CORSTORPHINE ROAD
The Corstorphine Hospital opened in July 1867 as the Edinburgh Royal Infirmary Convalescent Home.
Extract from the 2nd-edition OS Map, revised in 1893. Reproduced by permission of the National Library of Scotland
The symmetrical Italianate Home has an imposing setting on the hillside facing south. It was built to designs by
Peddie and Kinnear
of Edinburgh at the behest of William Seton Brown, who anonymously proposed founding such an institution in the summer of 1864. It cost £12,000 and provided accommodation for about 50 patients. In 1893 two wings were added by Kinnear and Peddie, as the firm had by then become. The extension was funded by a bequest of £13,000 from Mr James Nasmyth, engineer, and increased the accommodation by a further 40 beds.
Corstorphine Hospital, from an old postcard
By the early years of the 20th century the hospital had become known as Convalescent House. It was transferred to the National Health Service in 1948 and continued to function as an auxiliary hospital associated with the Royal Infirmary. It closed for extensive modernisation in the late 1950s or early 1960s, during which time a new, two-storey nurses’ home was built. It re-opened in May 1962. It then comprised four open wards with a total of 100 beds, and three single rooms attached to each of the main wards. Service kitchens were situated at the entrance to the wards, and in the centre of each ward was a linen and store room. The north wings of the building were enlarged and upgraded to provide sanitary and utility accommodation and a self-service staff dining room. On the south side of the building, reinforced-concrete balconies were built enclosed with aluminium and glass curtain walling to create dining, day and recreation rooms. The original floors were found to be badly decayed and were replaced in reinforced concrete and heavy quality linoleum laid for most of the floor coverings.
A part of the south front of Corstorphine Hospital, photographed by Leslie Barrie in September 2013, showing the 1960s enclosed balconies.
The nurses home (since demolished) was built in the grounds in front of the hospital, partly from reconstructed stone and partly of harled brick. Twenty bedrooms, two bed-sitting rooms, four study rooms, a lounge and the usual ancillary rooms were provided, along with a laundry on the ground floor.
The hospital closed in 2014. Housing was built on the site of the nurses’ home (Kaimes Court) and a new nursing home built on the garden to the east. Plans to convert the former hospital into housing were approved in January 2019. [ Sources:A. Logan Turner, Story of a Great Hospital,Edinburgh, 1979, p.175: The Hospital,vol.58, no.7 July 1962, p.491:BBC News10 January 2019, retrieved online 17.04.19: see also Edinburgh Cityplanning filesfor details of the redevelopment.]
CRAIGLOCKHART HOSPITAL (Edinburgh Hydropathic)Built in 1877-9 as a hydropathic institution to designs byPeddie & Kinnear. ( Sources: British Architect,25 April 1879; The Builder,20 Oct 1877, 11 Oct 1879; Building News,10 April 1880)
“Craiglockhart Hydropathic main view” by Brideshead – Own work. Licensed under Public Domain via Commons –
Extract from the 2nd-edition OS map, revised in 1893. Reproduced by permission of the National Library of Scotland
CRAIGLOCKHART POORHOUSE, CRAIGHOUSE ROAD
Built in 1867‑1869 to designs by
George Beattie and Son
as the new City Poorhouse, it replaced the existing poorhouse in the Old Town. Like St Cuthbert’s poorhouse the old buildings had become unsatisfactory and a move to a new site with new buildings was needed.
Central block of the former Craiglockhart Poorhouse, later Greenlea Old People’s home. (The city hospital was on a separate site to the south.) ‘Former City Hospital {sic}, Craiglockhart’ photographed in 2009 © Copyright kim traynor and licensed for reuse under this Creative Commons Licence
Unlike Peddie and Kinnear’s Craigleith Poorhouse (now the Western General Hospital), Craiglockhart is still relatively unchanged. It is comparable to many of the larger poorhouses such as that of Govan (now {1990} Glasgow’s Southern General Hospital), Greenock (now {1990} Ravenscraig Hospital) and Aberdeen (now {1990} Woodend Hospital). The large central octagonal tower marks the entrance and from there it was arranged symmetrically to achieve the required male/female segregation and the plan was minutely devised to allow for the maximum classification. There were separate departments for children, including school‑rooms. For the sick, an infirmary was provided and a distinction was made between paupers of good and dissolute character. So there are areas marked out on the plan such as ‘doubtful old men’ and ‘dissolute women’. The site was basically divided into three areas with a lunatic asylum to the west, the main poorhouse in the centre and the infirmary to the east.
Plan of lands at Craiglockhart, the property of the parochial board of Edinburgh, 11 August 1880. Reproduced by permission of the National Library of Scotland
Extract from the 2nd-edition OS Map, revised in 1893. Reproduced by permission of the National Library of Scotland
The poorhouse section consisted of five blocks linked by corridors. The central block had a large section behind for the dining‑hall, kitchen and stores and the eastern most block had a further block to the rear. The buildings were constructed of the local sandstone with Scottish baronial details. A competition had been held for the architect of the new building, the winning design by Beattie, had the motto ‘Comfort for the Poor and Care for the Ratepayer’. [ Sources: The Builder, 14 Oct. 1865, p.727: Scottish Record Office, plans RHP 30842/1‑55, RHP 30843/1‑17. See alsoworkhouses.org]
DEACONESS HOSPITAL, PLEASANCEThe Hospital opened in 1894 in a red sandstone block designed by Hardy and Wight, situated next to the St Ninian’s Mission. In 1888 a scheme was approved by the General Assembly for the organisation of women’s work in the church which included the Women’s Guild and the Order of Deaconesses. In the following year the St Ninian’s Mission was opened as an institution for training Deaconesses for missionary work at home and abroad. The hospital was founded to provide practical training in nursing for the Deaconesses.
Former Deaconess Hospital , photographed in 2012 © Copyright kim traynor and licensed for reuse under this Creative Commons Licence
The very Reverend Professor A. H. Charteris was largely responsible for setting forth the scheme and in 1912 a Memorial Church was opened adjacent to the Mission and the Hospital, designed by
J. B. Dunn
(now Kirk o’Field). In 1897 and 1912 the hospital was extended to increase the original accommodation of 24 beds to 42 beds.
Extract from the 25 inch OS map revised in 1931. Reproduced by permission of the National Library of Scotland
In 1934 a major reconstruction scheme was begun and a floor added to the original block byA. F. Balfour Paul. The new block, the Lord Sands Memorial Wing, was opened in 1936 by the Duke and Duchess of York.
DOUGLAS HOME, LAUDER ROAD, EDINBURGHA home for ‘crippled children’ was founded in 1872, and by 1878 occupied a detached house at No.20 North Mansion House Road, in the Grange area of Edinburgh. The local residents objected to the establishment of such an institution in their neighbourhood, but as no alternative suitable house was found, there the home remained for nearly fifty more years. In 1907 it treated 33 children, nearly all of whom came from Edinburgh. The home could accommodate 24 children at a time, and there was a charge of 4 shillings a week for their care. It took children aged between three and twelve years’ of age, suffering from hip-joint, spinal and other diseases that required a longer period of treatment and nursing than would usually be expected in other hospitals. It was not for incurable cases, and each child was assessed by a medical officer.
No.20 North Mansion House Road,
from the OS Town Plan of 1876. The blue marker is on the garden of No.20. Reproduced with the permission of the National Library of Scotland
Income for the home came from the fees charged, from subscriptions and bequests. Regular fund-raising events were held, from bazaars to concerts. In about 1926-7 the Home moved to a larger house not far away at No.2 Lauder Road. Then called West Thorn, it had been home to the Douglas Family from about 1913. Mr and Mrs Douglas also had a house at Largs, called Haylee. Mr Douglas was the son of General Sir John Douglas, G. C. B. of Glenfinart, Argyllshire, and their son, Captain Archibald J. A. Douglas, was in the 5th Camerons during the First World War. The house was large, with nine bedrooms, two with dressing rooms, four public rooms, stables and coach house, as well as a four-roomed apartment for the coachman. After the house had been acquired by the Home for Crippled Children the name was changed to Douglas House, probably after the former occupants, but it is a common enough name. Alterations to the house were carried out by the architects J. M. Dick Peddie & Walker Todd in 1928, the drawings for which are in Historic Environment Scotland Archives. By the late 1930s the home had 35 beds and was managed by the Edinburgh Cripple and Invalid Children’s Aid Society. It was described as well appointed and equipped in 1942, when it was included in the Scottish Hospitals Survey.
Douglas House
, from Bartholomew’s Post Office Map of Edinburgh for 1932-3. Reproduced with the permission of the National Library of Scotland
At the outbreak of the Second World War the home was evacuated to the country and Douglas House was taken over under the Air Raid Precautions Scheme in Edinburgh as a First Aid and Gas Cleansing post. In 1944 Edinburgh Corporation carried out alterations to the Home to form a wartime nursery.
Douglas House
from the large-scale OS Map surveyed in 1947. Reproduced with the permission of the National Library of Scotland
In about 2003 Douglas House was converted into private flats, and featured in an article in The Scotsmanin 2012. The article states that the house was bequeathed to the Sick Children’s Hospital in 1931 which renamed the property Douglas House to commemorate the generosity of its benefactor. As yet I have found no evidence for this, but I have not investigated the records of the Sick Children’s Hospital, which are at Lothian Health Services Archives. If anyone can enlighten me on this, please do get in touch.
Sources, Edinburgh Evening News,2 July 1878, p.2; 14 May 1885; 26 Dec. 1925;March 1913; 5 Oct 1915; 8 Dec 1927: PP,Report of the Royal Commission on the Poor Laws and Relief of Distress, 1909, Appendix vol.XV. Report to the Royal Commission on the Poor Laws and Relief of Distress on endowed and voluntary charities in certain places, and the administrative relations of charity and the Poor Law. A. C. Kay and H. V. Toynbee, Cmd. 4593, London, p.303: The Scotsman,9 Sept 1939; 15 April 1944: Scottish Hospitals Survey, Report for the South Eastern Region1942:Dictionary of Scottish Architects: Fiona Reid, ‘Interiors….’ The Scotsman,14 Oct 2012 accessed online 11.06.2022.
EASTERN GENERAL HOSPITAL, SEAFIELD ROAD, LEITHThe Eastern General Hospital was built as Leith Poorhouse, to designs byJ. M. Johnston, in 1903‑7.
Extract from the 2nd edition OS map, revised in 1912-13. Reproduced by permission of the National Library of Scotland
Aerial photograph of the Eastern General taken in 1954 by Aero Pictorial, from the RCAHMS collection
The plans below for a Tb block may not have been executed, as a building of this plan form seems absent from the OS map and the aerial photograph above. Circular wards, or in this case octagonal wards, were seldom built but often proposed by architects.
Johnston’s elevations and plans for the ‘phthisical block’ – i.e. for patients with tuberculosis. From RCAHMS .
The buildings had, in 1990, an unusually modern appearance which is emphasised where the original windows have been replaced by modern glazing. The group of tall blocks were white‑harled with red dressings. The poorhouse was built in two sections, originally the poorhouse section and hospital section, but almost immediately the poorhouse section was converted into additional hospital accommodation. It was the last poorhouse to be built in Scotland, opening just prior to the damning Royal Commission on Distress Report of 1909 which criticised almost every aspect of the poorhouse system throughout Scotland.
The husk of the admin block, photographed in 2007 by RCAHMS
The hospital closed in 2007 and the site cleared for a housing development. [ Sources: Architect & Building News, 10 Oct. 1930, p.509; The Scotsman,19 January 2007. See alsoworkhouses.org]
EDINBURGH DENTAL HOSPITAL, 30-31 CHAMBERS STREETThe Dental Hospital opened in its new building in Chambers Street in 1927, designed byBegg & Lorne Campbell. The origins of the hospital were laid in 1860 with the opening of the Edinburgh Dental Dispensary at No.1, Drummond Street. The dispensary subsequently moved to Cockburn Street and in 1873 the first dental hospital and school was established which was incorporated in 1892. In 1894 it moved again to premises in Chambers Street, purchasing the adjacent building in 1903. At this stage plans were drawn up for an extension to be built between the buildings and the pavement.
The Dental Hospital in School in Brown Square, Chambers Street © RCAHMS
In 1925 work began on the new purpose‑built hospital.
Edinburgh Dental Hospital, Chambers Street, photographed in 2001 © RCAHMS
It was transferred to the National Health Service in 1948, and the following year building plans, deferred at the outbreak of the Second World War, were set on foot. The new hospital and school were completed in 1953, to designs byR. Rowand Anderson, Kininmonth & Paul.
ELSIE INGLIS MEMORIAL HOSPITAL, SPRING GARDENS (closed 1989)The Elsie Inglis Maternity Hospital opened in July 1925 and was designed byHarold Ogle Tarbolton. It maximises its fine site overlooking Salisbury Crags in the design, with a sun balcony running across the south front.
Former Elsie Inglis Memorial Maternity Hospital, photographed in 2011 © Copyright kim traynor and licensed for reuse under this Creative Commons Licence .
Dr Elsie Inglis was one of Edinburgh’s best known medical women. In 1899, with the Medical Women’s Club, Elsie Inglis opened a seven‑bed hospital and a nursing home for women in George Square. This expanded in 1904 when they moved to premises in the High Street and became known as the Hospice. It provided accommodation mainly for the poorer women of Edinburgh during their pregnancy and confinement. In 1910 the Hospice amalgamated with the Bruntsfield Hospital. During the First World War Elsie Inglis worked with the Scottish Women’s Hospitals movement establishing units in France, Serbia, Russia, Corsica and Greece. She worked mainly in Serbia and Russia.
Extract from the 25-inch OS map revised in 1931. Reproduced by permission of the National Library of Scotland
The maternity hospital was built as a memorial to her work. Also on the site were a brick‑built nurses’s home and out‑patients’ block. The hospital closed in 1988, and a nursing home was built on the site, reusing some hospital buildings and retaining the name of Elsie Inglis, a part of the former hospital was refurbished as a nursery. The nursery and nursing home are now joined by new housing developments on the site. [Photographs of the hospital taken in the 1930s can be seen on the Lothian Health Services Archivesflickrpage.]
EYE, EAR & THROAT INFIRMARY, CAMBRIDGE STREETThe Eye Dispensary for Edinburgh was established in 1822 and in 1834 a separate Eye Infirmary was founded. In 1883 departments of Ear, Nose and Throat were added and it became the Eye, Ear and Throat Infirmary of Edinburgh. In 1922 it amalgamated with the Dispensary and moved to a house in Cambridge Street. In‑patient care ceased in 1949, the service concentrating instead on an orthoptic clinic, artificial eye centre and school eye service. These were transferred to the Princess Alexandra Eye pavilion when it opened in 1969.
GOGARBURN HOSPITAL, GLASGOW ROADGogarburn House, dated 1893, designed byJames Jerdanis situated to the west of the site, a cream‑harled Scots Renaissance style house with stone dressings. It was purchased by Edinburgh Corporation in c.1920 and used temporarily as a convalescent home for children. By 1924 female mental defectives were accommodated in the converted house and in the following year the stable block was adapted for male patients.
Aerial photograph of Gogarburn Hospital, taken in 2001 before redevelopment ©RCAHMS E 08408
The foundation stone of the new Gogarburn Hospital was laid in 1929 by the Duchess of York. The buildings were designed by
Stewart Kaye
on the colony system, by this time the established plan form for mental hospitals in Scotland. It comprised separate villas, administration and admission wards and a school as well as various ancillary buildings. The principal buildings seem rather dreary now, predominantly of a brown render with grey stone dressings, drowning the simplified classical detail. This seems a shame when it is an interesting hospital, the earliest use of the colony plan in a mental deficiency hospital and forming a contrast to the vast Lennox Castle Hospital, which was designed with less apparent sympathy for the patients.
Extract from the 6-inch OS map, revised 1938. Reproduced by permission of the National Library of Scotland
Later additions were built byE. J. MacRae, including two villas for children in 1936. During the Second World War the Colony was incorporated in the Emergency Medical Scheme and in 1948 it was transferred to the National Health Service. A new children’s unit was added in 1970.
KINGSTON CLINIC, see Scottish National Neurasthenic Hospital
LEITH HOSPITAL (closed 1987)Leith Hospital opened in Mill Lane c.1850 in a building designed byPeter Hamilton.
Extract from the 2nd-edition OS map, revised in 1894. Reproduced by permission of the National Library of Scotland
This building, now {1990} with an additional upper storey, is at the core of a series of later additions ranging in size and style. The most attractive of these is the fine children’s wing built as a war memorial in the 1920s, in a stripped Tudor style with twin gables flanking the rich carving over the centre three bays. The hospital was founded by the amalgamation of the casualty hospital established in 1837 and the Dispensary which was set up in 1815 by the Edinburgh and Leith Humane Society (founded in 1788). The hospital comprised medical and surgical wards for men, women and children and an accident unit. In 1873‑5 the hospital was extended by
James Simpson
to the north‑east. In 1886 the Hospital Directors granted Dr Sophia Jex Blake permission to allow her female medical students to attend the hospital for clinical instruction.
Old Leith Hospital and Infirmary , Mill Lane, photographed in 2011. © Copyright kim traynor and licensed for reuse under this Creative Commons Licence
A new block was added to the south and a nurses’ home in 1898‑ 1903 byW. N. Thomson, and a further new building provided in 1923‑7 byGeorge Simpson. The hospital was transferred to the National Health Service in 1948 and finally closed in 1987. The War Memorial Wing and Cowan Hall were adapted to provide an out‑ patient department. Lothian Health Board aim to provide a Community Hospital on the site. The future of the existing buildings is uncertain {1990}. [ Sources:Christine Hoy, A Beacon in Our Town, Edinburgh, 1988.]
LIBERTON HOSPITAL, LASSWADE ROADThe oldest part of the hospital opened in 1906, designed byJ. Dick Peddie and G. Washington Browne. Together with the Longmore Hospital, which opened in 1875, it constituted the Royal Edinburgh Hospital for Incurables. In 1963 a new four‑storey geriatric hospital was built next to the original building, designed byJohn Holt.
LONGMORE HOSPITAL, SALISBURY PLACEBegun in 1880 to designs byJ. M. Dick Peddie,the Longmore Hospital for Incurables was named after Mr J. A. Longmore, whose trustees provided £10,000 for the building fund.
Longmore Hospital, photographed by Cowie & Seaton, from RCAHMS
The Edinburgh Association for Incurables was founded in 1874 and the first hospital opened in February 1875. In 1903 a Royal Charter was granted and three years later the Liberton Hospital opened. Jointly these hospitals formed the Royal Edinburgh Hospital for Incurables. It is a stylish, classical building with a long, elegant street facade. The central bay is surmounted by a pediment and coupled columns distinguish the upper floor of the flanking bays. [ Sources:Buildings of Scotland, Edinburgh, 2nd ed. 1988, p.636: Lothian Health Board Archives, Annual Reports]
MINTO HOUSE MATERNITY HOSPITAL, CHAMBER STREET (demolished)Established around 1829 by Professor Syme.
NORTHERN GENERAL HOSPITAL, FERRY ROAD, LEITH(demolished)Built as the Leith Public Health Hospital for infectious diseases, it opened in 1896. It was also known as East Pilton Hospital.
Extract from the 2nd-edition OS map revised in 1905. Reproduced by permission of the National Library of Scotland
It was designed by George Simpson, on a large site just beyond the western boundary of Leith. When the plans for the hospital were first drawn up George Simpson was working with his father, James, but the latter died not long after and the work was seen through by the son. The buildings were of brick, the wards in detached pavilions described at the time as being on the ‘cottage system’. The administration block was three storeys high, the ward pavilions and ancillary buildings of one storey. The site, extending to around 9 acres, was purchased for £4,000 and building costs amounted to around £46,000.
The interiors were described as bright and pleasant with the walls and ceilings painted with ‘Duresco’, and finished in enamel ‘in a great variety of tints’. The grounds were laid out with walks and recreation grounds for nurses and patients.
The principal contractors were James Kinnear, Leith, mason and brickwork; Drysdale and Gilmour, Leith, Joiner and carpenter work; Patrick Knox & Sons, Edinburgh, plumbers; Charles Mitchell, Leith, painter; W. R. Clapperton & Co Edinburgh, furnishings; Maule & Son, Edinburgh, napery; R. & E. Simon, Leith, ironmongery furnishings.
Extract from the 2nd-edition OS map revised in 1931. Reproduced by permission of the National Library of Scotland
During the First World War the hospital was commandeered by the Admiralty. It may have been at this time that the ward huts were built to the west of the site (see map above). [ Sources: Edinburgh Evening News,11 Sept 1896, p.4]
PRINCESS MARGARET ROSE ORTHOPAEDIC HOSPITAL, FROGSTON ROAD WEST (demolished)The foundation stone of the hospital was laid in 1929 and the first two wards opened in June 1932.
Extract from the 6-inch OS map, revised in 1932. Reproduced by permission of the National Library of Scotland
Designed byReginald Fairlieas a centre for the treatment of crippled children in the south‑east of Scotland, it featured sanatoria‑style ward blocks, open to the south with screens to keep the snow out. This type of hospital accommodation was necessary at a time when the major causes of crippling in children were TB and osteomyelitis. The third ward opened later in 1932 and a fourth was built in 1936. Additions to the hospital were made in the 1960s byMorris & Steedmanfor the South East Regional Hospitals Board.
The hospital closed in 2000, as part of the restructuring of health services in Edinburgh made following the building of the new Royal Infirmary. The site was sold for housing in 2002. The nurses’ home was converted into flats, but plans to adapt one of the ward blocks were scrapped following a fire. [ Sources:Buildings of Scotland, Edinburgh, 2nd ed., 1988, p.568: Lancet, 20 March 1929:Lothian Health Services Archives]
ROYAL EDINBURGH HOSPITAL, TIPPERLIN ROADThe original buildings byRobert Reidhave now been demolished and the oldest section of the hospital remaining dates from 1842 byWilliam Burn. The Royal Edinburgh is one of the most historically important hospitals in Scotland, playing a key role in the development of treating mental illness. The Craighouse development at the turn of the century was also of great importance in emphasising the significance of surroundings in the cure of mental disease.
Extract from Kirkwood’s map of Edinburgh, 1817. Reproduced by permission of the National Library of Scotland.
The foundation of the hospital originated with the death of the poet, Robert Ferguson, in the City Bedlam on 16 October 1774. He died tragically aged 24. Dr Andrew Duncan had been his medical attendant and after Ferguson’s death he resolved to try to establish a hospital for the mentally ill. In 1792 an appeal was launched but the response was small. In 1806 Parliament granted 2,000 from confiscated estates following the Jacobite Rising of 1745. This enabled the site at Morningside to be purchased. Plans were prepared by Robert Reid for the new asylum. He devised a courtyard plan consisting of four large blocks, each effectively resembling a modest neo‑Classical house, one each side of the square, with square lodges at the corners. The plan was intended to facilitate the classification of the patients. Reid produced a pamphlet on his Observations on the Structure of Hospitals for the Treatment of Lunatics &c. which compares closely with the slightly later writings of William Stark of 1810 concerning the construction of the Glasgow Royal Asylum. Like Stark, Reid visited several asylums and hospitals for lunatics in different parts of England. Classification was the key to the plan:
To admit of proper separation of patients into different classes, according to their condition and circumstances, this asylum should consist of several buildings, in some respects detached from each other. Distinct classes of patients, according to their rank in life, and the payment which their relations agree to make to the Institution for their accommodation and maintenance, should be placed in separate houses: and each of these buildings should be so constructed as to admit of a complete separation not only of the sexes but also of patients of the same sex, according to the condition of their disease, as being furious, tractable, incurable or convalescent.
These were the same criteria for classifying patients which persisted throughout the century, and the emphasis on the segregation of the classes was always as strong as that for the proper serration of different mental conditions.
Edinburgh Lunatic Asylum, East House, captioned ‘sketch showing the range of buildings which form one side of the square’ from RCAHMS
Reid’s design was on a larger scale than could have been built with the funds available. Aware of this, he concluded his pamphlet by drawing attention to the plan’s ‘peculiar advantage, that each part is separate and independent, and may be put to immediate use, as soon as it is finished’. Two wings of Reid’s building were built, and the first patient was admitted on 19 July 1813. Lack of funds not only prevented the rest of the plans being carried out but also prevented the managers from admitting pauper lunatics, which had, from the start, been one of its aims.
Extract from the OS Large-scale Town Plans 1876. Reproduced by permission of the National Library of Scotland
Additions were made in 1819‑1821 under the guidance of Reid, with modifications of the original plan, since ‘he has had an opportunity of visiting with a discerning eye almost every commodious asylum for the Insane which has lately been built whether in England, in Scotland or in Ireland’ as the Annual Report for 1821 declared.
The accommodation of paupers was proposed again in the 1820s and the managers considered that a separate house should be provided for this class. Reid prepared plans for such a building but they were eventually abandoned and in 1837 new plans were acquired from William Burn, consisting of the extension of the existing buildings. In 1840 a further new set of plans were drawn up by Burn for the West House. They relate most closely to Stark’s Dundee asylum being an H‑plan with central kitchen and dining hall to the rear. Only part of Burn’s plan was built initially, opening on 6 August 1842.
Extract from the OS Large-scale Town Plans 1876. Reproduced by permission of the National Library of Scotland
The new department contained wards for pauper lunatics and comprised three parts; a main wing of three stories with twelve dormitories and their accompanying workrooms, day-rooms, washing and bathrooms and six sick rooms, a separate single storey building for noisy patients of two large and six small dormitories and the kitchen and laundry. The new building was soon filled and after the patients from the City Bedlam had been admitted extension was necessary. The first addition by Burn in 1845 still left the accommodation inadequate despite many further minor alterations. By 1853 David Bryce was acting as the architect to the asylum and he produced plans for a new kitchen department at the East House as well as the completion of Burn’s West House, the south‑west wing remaining to be built. He also planned an octagonal building, a separate building for noisy patients, and a new wash‑house for the West House. These additions were completed in 1857.
William Burn’s West House, viewed from the south, from RCAHMS
In 1873 Dr Thomas Smith Clouston was appointed Physician Superintendent. At this time
W. L. Moffatt
was acting as architect to the asylum and he carried out various improvements. In 1877 the mansion house and estate of Craighouse was purchased and over the next 40 years the building activity at the hospital was centred there. The Craighouse development is considered separately below, and resulted in the demolition of Robert Reid’s original buildings in 1896. The hospital continued to expand its horizons after the opening of Craighouse. In 1929 an important development was made with the opening of the Jordanburn Nerve Hospital, where patients were informally admitted, and in 1931, a children’s clinic was established.
West House, Dining Hall, from RCAHMS
In 1948 the hospital was transferred to the National Health Service and in 1965 the Andrew Duncan Clinic was opened, designed byJohn Holt.He also designed the nine‑storey block for the University of Edinburgh’s Psychiatry Department on the site. These more recent additions have been less than sympathetic to the West House which has now lost most of its original impact. [ Sources:Lothian Health Board Archives, plans, Annual Reportsand Minutes.]
ROYAL EDINBURGH HOSPITAL, THOMAS CLOUSTON CLINIC,CRAIGHOUSE, CRAIGHOUSE ROADOld Craighouse dates from 1565, the date appearing over the original entrance doorway. Macgibbon and Ross noted that the house appeared to have been built by the Symsones. A new wing was added in 1746. In 1877 Craighouse estate was purchased by the Royal Edinburgh Asylum and adapted for the accommodation of higher class patients.
Extract from the 2nd edition OS Map revised 1893. Reproduced by permission of the National Library of Scotland.
From 1889 to 1894 work on the new buildings was carried out to designs bySydney Mitchell, these comprised the New Craighouse, East and West Hospital blocks, Queen’s Craig, South Craig and Bevan House. Dr Thomas Clouston was the key figure in the development of Craighouse. He had been appointed as Physician Superintendent to the Royal Edinburgh Asylum in 1873 and in his first Annual Report commented on the state of the buildings:
As regards our structural arrangements we are undoubtedly behindhand somewhat. We need more accommodation for those who wish the benefits of the institution and can pay high boards… we should be prepared to extend our benefits to the wealthiest …our poorhouses are palatial buildings and in the new asylums for paupers through the country no expense has been spared to make them cheerful and comfortable.
Aerial photograph taken by RCAHMS in 2015 of Old Craighouse (top right) and New Craighouse.
Once Clouston had established patients at Old Craighouse in 1878 he began planning the development of the site in a new and bold way:
Craighouse site affords ample room for many villas of various kinds, surrounding a central block for recent acute cases, kitchens, dining and public rooms. In the construction of these a principle might be adopted which has never yet been fully carried out in asylums, viz of adaptation of each house or part of house to the varied needs and mental conditions of its inhabitants … an asylum so constructed should contain all the medical appliances that would be likely to do good, it should have a billiard room, gymnasium, swimming‑bath and work rooms.
The scheme was long in the forming, in the Annual Report for 1885 Clouston comments that he has been devoting his attention to the principles of construction of hospitals for the better classes of the insane in the last years. He had visited asylums in America and other parts of Britain. In particular the Royal Asylums at Montrose, Dundee, Perth, Glasgow and Dumfries and in England the asylums at Northampton, Cheadle, Gloucester and St Ann’s Health Registered Hospital, the Bethlem Royal Hospital and two private asylums in London. By 1887 Sydney Mitchell had been appointed as architect. Work began in 1889 and the foundation stone of New Craighouse was laid on 16 July 1890 by the Earl of Stair. The scheme comprised five principal buildings. The main building or New Craighouse was situated to the west of Old Craighouse and further west again was the west hospital block, Queen’s Craig. To the south of these were the East Hospital, Bevan House and South Craig. New Craighouse was formally opened on 26 October 1894 by the Duke of Buccleuch and Queensberry. South Craig Villa, Bevan House and the Ladies Hospital had already been occupied for some time. The achievement was phenomenal, and on such a vast scale that it remains unrivalled in hospital architecture in Scotland. Variety was the key to the design, variety of style, colour and texture achieved through the finishes, the materials, the varied roof line and every conceivable means. Inside it was sumptuously furnished and fitted up. After 1972 the buildings became the Thomas Clouston Clinic, named after the individual whose personal ideals were embodied in the site. [ Sources:Lothian Health Board Archives, Annual Reports of Royal Edinburgh Hospital: RCAHMS, National Monuments Record of Scotland, drawings collection: The Builder, 7 Jan. 1888, p.16; 15 June 1889, p.442; 10 March, 1894, p.203.]
ROYAL HOSPITAL FOR SICK CHILDREN, SCIENNES ROADThe Sick Children’s Hospital was officially opened on 31 October 1895. It was designed byGeorge Washington Browne, a leading architect in Edinburgh and formerly a partner of R. Rowand Anderson, he also designed other public buildings including the Edinburgh City Library. The hospital, built of bright red sandstone, has a tall three‑ storey and attic central block with twin, shaped gables and an ornate triumphal arch doorpiece.
Administration block of the Royal Hospital for Sick Children, illustrated in
Academy Architecture
1895 p.61
The children’s hospital in Edinburgh first opened in 1860 in a house in Lauriston Lane with 20 beds. A Royal charter was granted in 1863 and the hospital moved to Meadowside House where it remained until an outbreak of typhoid in 1890 when the patients were temporarily relocated in Morningside College. The managers decided that Meadowside House was unsuitable and a new building required. They purchased the former Trades Maiden Hospital and on the site erected the present building in 1892.
Sick Kids Hospital, Edinburgh by Stephencdickson – Own work. Licensed under CC BY-SA 4.0 photographed in 2014
The hospital opened in 1895, it was designed on a U‑plan with central administration section. The ward pavilions are three stories high terminating in balconies between the turrets.
General view of the entrance, photographed around 1900 by Bedford Lemere © RCAHMS
One of the most charming features of the hospital are the murals in the mortuary chapel by
Phoebe Traquair, painted in 1885 at Meadowside House, which were transferred to the new building. They are typical of the Edinburgh Arts and Crafts Style which she adopted.
Detail of mural in mortuary chapel, photographed in 1982 © RCAHMS
In 1903 Washington Browne added an out‑patients’ department in Sylvan Place. In 1906 Muirfield House at Gullane was built as a convalescent home (see separate entry in Lothian). The hospital was extended from 1959 with a new lecture hall and operating theatre designed byCullen, Lochhead & Brownof Hamilton, a well established firm in hospital design. [ Sources: The Builder, 1 Jan. 1898.]
ROYAL INFIRMARY OF EDINBURGH, INFIRMARY STREET(Demolished) Built to the design ofWilliam Adam, the foundation stone of this, the first purpose‑built hospital in Scotland, was laid in 1738 and the first patients admitted in December 1741. In 1725 the first steps were taken towards establishing an infirmary by the Royal College of Physicians. Funds were raised by public subscription and a small house was rented at the head of Robertson’s Close. This first modest building was formally opened on 6 August 1729 and was the first infirmary in Scotland. In 1733 Glasgow countered with its Town’s Hospital but from the first this was designed to be primarily a workhouse with limited medical attendance. In the same year the question of new premises for the Edinburgh Infirmary was already under consideration. In November 1736 a Royal Charter was granted and the Infirmary acquired the ground of Thomson’s Yards from the trustees of George Watson’s Hospital as a site for the new building. The managers planned to provide a hospital with 280 beds but with limited funds needed to build piecemeal. In April 1738 the Infirmary managers published a memorandum detailing their intentions:
the building ought to be solid and erected of the most durable material, not slovenly, and yet that very little or no expense should be paid out in useless ornament… In order to form the plan in the best manner, they applied to William Adam, architect who has generously assisted them with a plan of the whole work which, when finished, will conveniently accommodate two hundred patients allowing each patient a bed.
The foundation stone was laid on 2 August 1738 and work commenced on the east section of the central block. By January 1739 work was already well advanced. Despite the decision to build in stages, fund raising was so successful that it was decided to proceed with the rest of the plan and a second ceremony of laying the foundation stone was held on 14 May 1740 for the west half of the building. The whole was finally completed in 1748, the year of William Adam’s death. Materials for the infirmary included timber from London and lime from England and unglazed paving tiles from Holland. The design was quite simple, on a U‑plan facing north, of three storeys and attic. The main block measured 210 feet in length and the wings each 70 feet long. It accommodated 228 patients distributed in wards with twelve beds in the wings and 24 beds in the main block. The centre bay projected twelve feet and was surmounted by a raised attic and cupola, containing the operating theatre, which had accommodation for 200 students and could also serve as a chapel. The cupola could also be used as an astronomical laboratory. Medical cases were accommodated on the lower two floors together with some cells for lunatics and surgical cases were located on the upper two floors, being closer to the operating theatre. The symmetrical plan allowed for the equal division of male and female patients. The infirmary was heated by open fires and a mains supply of water was connected in 1743. On the facade a statue of George II was added in 1755, since moved to Lauriston Place.
Various additions were made to the Infirmary, these included a new wing to the west in 1791‑2, and the acquisition of the old High School in High School Yards in 1829, which was then converted into a surgical hospital, opening in 1832. In 1833 the managers of the infirmary also acquired the old Surgeons’s Hall which was used as a fever hospital. The remaining buildings in the square were acquired over the next few years. In 1848 a more major building extension and alteration scheme was begun by David Bryce. A new surgical hospital and new kitchen and laundry and wash‑house were needed as well as a new drainage system. The new surgical hospital was built on ground between the original infirmary and the Surgeon’s Hall. It was of three storeys and attic and was linked with the earlier Surgical Hospital by waiting rooms. Altogether there was accommodation for 128 surgical beds and a further nineteen beds for eye patients. The new hospital opened on 30 April 1853. However, conditions were still unsatisfactory overall and in 1864 Bryce was requested to prepare a report on the condition of the old infirmary. The report recommended that a new building should be provided. At this stage there was no thought of abandoning the site and Bryce drew up plans for a new medical hospital on the existing site. By 1866 Bryce’s new Surgical Hospital was condemned as unhealthy and of having been built on a bad principles, perhaps in response to the emerging pavilion‑plan wards being highlighted in the national press and the architectural journals, particularly The Builder. Once it had been accepted that both the medical and surgical hospitals needed to be replaced it was only a matter of time before a new site was proposed for a new combined medical and surgical hospital, this was agreed to in March 1869.
The old infirmary buildings lingered after the opening of Bryce’s new Royal Infirmary in Lauriston Place, they were purchased by the Town Council and used during fever epidemics and as the City’s infectious diseases hospital until the new City Hospital opened in 1903. William Adam’s original infirmary was demolished in 1884. [Sources: records of the infirmary are held byLothian Health Services Archive. Logan Turner, Story of a Great Hospital, Edinburgh, 1979: The Royal Infirmary of Edinburgh, Edinburgh,1929. SeeThe History of High School Yardsfor more about the buildings and history of the buildings here.]
ROYAL INFIRMARY OF EDINBURGH, LAURISTON PLACENow superseded by new Royal Infirmary at Little France, the former buildings have been partly demolished and partly converted to a mixed use development known as Quarter Mile, with modern infill designed by Foster + partners.
The main building of the former Edinburgh Royal Infirmary at Lauriston Place was designed by
David Bryce
and built from 1870 to 1879. It incorporated part of William Adam’s George Watson’s Hospital of 1738‑41. It replaced the former Royal Infirmary building designed by William Adam which opened in 1748. The foundation stone of the new infirmary was laid in 1870. David Bryce died before it was completed and his son John Bryce remained as the superintending architect. It was planned on the Nightingale model of St Thomas’s Hospital, London, but where the riverside site had produced a long range of pavilions in London, in Edinburgh, the shape of the site, coupled with the incorporation of the old George Watson’s Hospital, led to an asymmetrical arrangement of the ward pavilions. The roughly square site, sloping southwards to the meadows, created a logical split into the surgical hospital section, facing Lauriston Road, and the medical section to the south facing, the Meadows. The kitchen and stores were situated in the middle of the site behind the administration section. Originally there were four pavilions in each half, with three wards in each pavilion. Each ward was self‑contained, having its own waiting rooms, nurse’s room, physician’s room, bathrooms, lavatories and kitchen. Each pavilion contained a lift for patients and a lift for stores. The administrative department in the centre of the surgical section incorporated the remains of George Watson’s Hospital. The furnishing of each ward was undertaken by a different group from the Infirmary Managers to the domestic servants and from the Writers to the Signet to the Brewers.
The London Illustrated News
at the time of the opening described the Infirmary as the largest in the United Kingdom and probably the best planned. Its nearest contemporary rival in Scotland was the Glasgow Western Infirmary which had opened in 1874 designed by James Burnet Senior also on the pavilion plan.
Southern ward pavilions photographed April 2015 © Harriet Richardson
Despite the apparent vastness of the new Infirmary it was not long before additions and alterations were necessary. Sydney Mitchell & Wilson added a nurses’ home in 1890, the laundry in 1896, and the Diamond Jubilee Pavilion in 1897. In 1900 they designed two new pavilions for ear, nose and throat and ophthalmic patients. Early this century the major addition was the Simpson Memorial Maternity Pavilion by Thomas W. Turnbull of 1935. After the Infirmary was incorporated into the National Health Service the desire for new buildings was first accomplished with the Princess Alexandra Eye Pavilion on Chalmers Street built in 1971 by Alison & Hutchison. The redevelopment of the site commenced with the new block, Phase I, designed in 1965 by Robert Matthew, Johnson‑Marshall & Partners. Work on the Lauriston Building commenced in 1976. [ Sources:Buildings of Scotland, Edinburgh, 2nd ed., 1988, p.259‑61: Logan Turner, Story of a Great Hospital, Edinburgh, 1979. For images of the Laurston building see Lothian Health Services Archivesflickr page]
ROYAL INFIRMARY OF EDINBURGH, Simpson Memorial Maternity Pavilion (Demolished)The pavilion was constructed in 1935 byThomas W. Turnbull, withJames Milleracting as consultant. It is an imposing steel framed building faced with concrete, as is the Florence Nightingale Nurses’ Home which was built at the same time. The Pavilion was officially opened on 1 March 1939.
The Simpson Memorial had its origins in the Edinburgh Lying‑in Hospital which opened in Park Place in November 1793. This was financed by Professor Hamilton and then by his son, James, until his death in 1839. It moved in 1843 and occupied five further sites before becoming the Edinburgh Royal Maternity and Simpson Memorial Hospital, in commemoration of the achievements in obstetrics of Sir James Young Simpson who died in 1870. The resultant building, designed byD. Macgibbon & T. Ross,opened in May 1879 and is now the School of Radiology, at No.79 Lauriston Place. The first ante‑natal clinic in Britain was opened there in 1915 as a result of the work of James Haig Ferguson. After the First World War buildings in Lauriston Park and Graham Street were acquired to try to combat overcrowding but this was not satisfactorily overcome until the new Pavilion was provided in the 1930s.
ROYAL VICTORIA HOSPITAL, CRAIGLEITH ROADThe present hospital dates from 1966 byAlan Reiach & Partners. Two blocks were incorporated from the earlier hospital buildings bySydney Mitchellfrom 1906. These were the east lodge and the administration block. The founding of the Royal Victoria Dispensary marked the origins of Edinburgh’s tuberculosis scheme. It opened in 1887 and claimed to be the first anti‑tuberculosis dispensary in the world. A hospital for consumptives was established later. It originally operated from Craigleith House after its conversion in 1894. The house was demolished in the 1960s to make way for the present new buildings. From 1903‑6 five pavilions and a large administration block and dining hall were built on the ground adjoining the house. These sanatorium buildings formed a model for later sanatoria in Scotland. The floors of the wards were raised several feet from the ground so that the intervening air space ensured dryness and additional ventilation. Each pavilion was constructed on a half‑butterfly‑plan with two wards flanking centrally placed offices and lavatories. Open fireplaces provided the sole means of heating. There were also numerous shelters in the grounds for the open‑air treatment of patients. In the administration block, which survives on the site, was located the central dining hall for the patients. It was an airy room with an open beamed roof and decorated joists. It also contained the kitchen and offices, staff dining room and the Matron and Resident Physicians’s quarters. It is a picturesque building with its dominant tower and rich carving, showing powerful Scots Vernacular and seventeenth‑century influence. By 1960 the need for extensive hospital accommodation for TB had declined. Since 1966 a new hospital complex has been built on the site. [ Sources: Building News, 7 December 1894, p.802: T. N. Kelynack (ed.), Tuberculosis Year Book and Sanatoria Annual, Vol.1, 1913‑14: Lothian Health Board Archives, Annual Reports.]
ST RAPHAEL’S HOSPITAL, Blackford Avenueprivate hospital, established by the Roman Catholic Church. Kilravock Lodge, a private house designed by MacGibbon & Ross around 1874 was enlarged as a hospital around 1925-6. A separate Art Deco wing was added to designs by J. Douglas Miller. The foundation stone was laid on 3 October 1934 by the Archbishop of St Andrews and Edinburgh.
The Art Deco wing, St Raphael’s, photographed by Francis Caird Inglis. © RCAHMS
A year later the Archbishop returned to perform the opening ceremony. In the 1960s a new wing was added to the west, and to the rear of the east ward wing. Further additions were carried out at the rear of the 1930s block in the 1970s or early 80s. [ Sources:Buildings of Scotland , Edinburgh,p.599; The Scotsman, 22Sept 1934 p.1; 23 Oct 1935, p.1]
SCOTTISH NATIONAL NEURASTHENIC HOSPITAL, CRAIGEND PARK, LIBERTONThe house, Craigend Park, was designed by Pilkington & Bell for William Christie, a tailor and built in 1867-9. It was converted into a hospital for shell-shocked soldiers and sailors in 1917, opening as the Scottish National Neurasthenic Hospital in March 1918.
Craigend Park, aerial photograph by R. Adam, RCHME taken in 2015
The hospital closed in 1925, and later became a school, before re-opening as the Kingston Clinic – a centre for naturopathy, or nature cure – in 1938. It ran for fifty years, finally closing in 1988.
SOUTHFIELD HOSPITAL, LIBERTONSouthfield House was designed in 1875 byJohn Chesser. This baronial style mansion house with its dominant turrets and quantity of crowstepped gables was acquired as a country branch for the Royal Victoria Sanatorium in Edinburgh, in about the 1920s and ward blocks were built in the grounds designed byAuldjo Jamieson & Arnottin 1930. [ Sources:Lothian Health Board Archives, Annual Reports of Royal Victoria Hospital, Edinburgh: RCAHMS, National Monuments Record of Scotland, drawings collection, plans of Southfield House.]
WESTERN GENERAL HOSPITAL, CREWE ROADThe Western General Hospital began its life as the replacement St Cuthbert’s Poorhouse, which opened in 1868. It was designed byPeddie and Kinnear.
Aerial photograph taken by RCAHMS in 2014 of the Western General
The first poorhouse for St Cuthbert’s parish opened in 1761 on the site of the Caledonian Hotel. In 1865 Henry Littlejohn, the City Medical Officer, reported that the building was insanitary and ordered improvements. It was suggested that St Cuthbert’s should combine with the Canongate parish, which also had a poorhouse, and build a new one between them. However, this was not accepted and the new St Cuthbert’s Poorhouse was built on land purchased from the Fettes Trust. After it opened it was renamed the Craigleith Hospital and Poorhouse.
Extract from the 2nd-edition OS Map, revised in 1893. Reproduced by permission of the National Library of Scotland
During the First World War it was taken over by the army for casualties and in 1929, with the Local Government (Scotland) Act, Edinburgh Town Council took over and it became the Western General Hospital. D. & J. Bryce had extended the buildings in 1880 but the main alterations on the site came in the twentieth century. In around 1920 a recreation hall was added, in 1935 a nurses’ home was built and the pathology block was built in 1939. Before the outbreak of the Second World War plans had been prepared for a new hospital on p-to-date lines on the site, of which these additions had formed a part, but war put a stop to the reconstruction.
The Boiler House, photographed
c.
1978, from the RCAHMS Spence, Glover and Ferguson collection
Perspective view of proposed boiler house from mid-1950s, from RCAHMS Spence, Glover and Ferguson collection
After the hospital was transferred to the National Health Service in 1948, a great many additions were made to the site by the South Eastern Regional Hospitals Board through the 1950s and 60s, under the guidance of the Regional Board’s architect,John Holt.
In 1957 a radiotherapy department was opened, furnished with one of the few linear accelerators in Britain at that time. William Wellwood was the architect in charge under John Holt. It was largely built with a reinforced-concrete frame, the floors above and below the treatment level being solid, reinforced-concrete slabs, the others hollow tile set in reinforced-concrete rib panels. The out-patients’ departments and workshops, however, were built with load-bearing cavity construction. Spandrel panels in the main block were faced with Westmoreland green slate slabs, and the lower walls finished in plum-coloured facing bricks. The south gable wall was finished with Blaxter stone slabs. It had about 100 beds and hostel beds, dining areas for staff and patients, X-ray, diagnostic and therapeutic rooms, operating theatre suite, and research laboratories. The main ward block was of four storeys, with four-bed wards located on either side of a corridor.
In December 1959 a new neurosurgical block was opened, designed by Basil Spence and Partners in association with Holt. The Architects’ Journalnoted that:
‘Exceptional conditions required it to be built up in the air, so to speak, and there is evident endeavour to exploit this situation visually in the design of the [reinforced concrete] frame and cantilevers. Materials throughout are of the highest quality and very various, so one might expect this to be a relatively costly building – which it is.‘ [ AJ,10 Dec 1959, p.683.]
One of the more unusual additions to the site was the Scottish Hospitals Centre. Designed by Holt, and completed by 1966.
The Western General in 1948, from the 25 in OS map. Reproduced by permission of the National Library of Scotland
These alterations continued after the 1974 reorganisation of the Health Service when the Western came under the management of the newly created Lothian Health Board and included the new library built in 1979 which finally covered the facade of the old poorhouse. [ Sources:Buildings of Scotland, Edinburgh, 2nd ed. 1988, p.531‑2: Scottish Record Office, plans, RHP 30841/1‑62: Architectural Review,1 April 1957, p.266See alsoworkhouses.org]
WOODBURN SANATORIUM, CANAAN LANEEstablished c.1899 and from around 1900 run by Dr Isabella Mears (1853-1936) and her husband Dr W. P. Mears. A purpose-built sanatorium was erected to the north of the house in 1899-1900 (a building application was submitted by a Mrs Elizabeth Macgregor ‘or Gray’ in June 1899), but the house itself had previously been run as a nursing and convalescent home.
Extract from the 25-inch OS map surveyed in 1905-6. Reproduced by permission of the National Library of Scotland.
Isabella Mears was a pioneering woman, being the tenth woman on the General Medical Register – she had to take her final exams in Dublin, having studied Medicine at Edinburgh University. Before her work at Woodburn Sanatorium, Isabella had been a medical missionary in China. The sanatorium and Woodburn House later became a part of the Astley Ainslie Hospital. [
Sources:
information kindly supplied by Galen Bartholomew:
Dundee Advertiser,
2 May 1896, p.1:
Edinburgh Evening News,
1 June 1899, p.3]
| https://historic-hospitals.com/gazetteer/edinburgh/?like_comment=9341&_wpnonce=4788c1b17a |
Encounters with the Young British Artists | Christie's
Critic and broadcaster Andrew Graham-Dixon recalls the brave, ambitious, uncompromising generation of artists that so appealed to George Michael | Christie's’
If you want to make things happen, you’ve got to have faith
Andrew Graham-Dixon recalls his encounters with the YBAs, an ambitious and uncompromising generation of British artists whose rebellious spirit appealed so strongly to George Michael
It was the late 1980s and I had just started working as an art critic when I heard about a new group of artists who were doing things differently. They were fresh out of art school but they weren’t waiting around for commercial galleries to show their work. They were taking things into their own hands, doing deals, getting hold of cheap warehouse spaces and putting on their own exhibitions. They gave them names like New Wave albums:
Freeze
,
Modern Medicine
,
Gambler
. They were making British art, but not as we knew it.
Their work was bewilderingly various. There were photographs of bullet wounds by
Mat Collishaw
, as well as sculptures made out of things like rubber gloves, or polythene bags filled with water and tied with string, by I can’t remember who. There were the cooler than cool paintings of
Gary Hume
, who used household gloss on panel to make pictures that looked like the doors of a hospital ward, banged forever shut.
Mat Collishaw (b. 1966), Burnt Almonds, Heinrich & Eva, executed in 2000, this work is number one from an edition of three. 3D lenticular transparencies, steel and lightbox. 48 x 51 in (121.9 x 129.5 cm). Estimate: £5,000-7,000. This lot is offered inThe George Michael Collection Evening Auctionon 14 March 2019 at Christie’s in London
Gary Hume (b. 1962), In the Park, painted in 1997. Enamel on aluminium panel. 78 x 59 in (198.1 x 150 cm). Estimate: £40,000-60,000. Offered inThe George Michael Collection Evening Auctionon 14 March 2019 at Christie’s in London
And then there was
A Thousand Years
, the work with which a young man called
Damien Hirst
first made his mark: a huge double vitrine with a severed cow’s head in one half and a seething cloud of flies in the other, the two divided by an Insect-O-Cutor, the whole amounting to the replication of a life cycle in miniature, designed to last six weeks, by which time the cow’s head had been devoured by the flies, which had in turn blitzed themselves to oblivion on the elements of the electric grill. It was a spectacular work and an open invitation to headline-writers. ‘Holy Cow’. ‘Damien’s Flies Undone’. Etcetera.
Damien Hirst (b. 1965) The Immaculate Heart ♥ Sacred, executed in 2008. Acrylic, painted stainless steel, stainless steel, resin, silicone, sterling silver barbed wire, monofilament, bull's heart, dove's wings and formaldehyde solution. 36 x 24 x 11½ in (91.5 x 61 x 29.2 cm). Estimate: £120,000-180,000. Offered inThe George Michael Collection Evening Auctionon 14 March 2019 at Christie’s in London
Here was a generation hell-bent on putting an end to the polite insularity of British art, a generation which, like no other in living memory, appeared to be disarmingly fluent in the languages of international contemporary painting, sculpture and installation. The most obvious precedents for Hume’s paintings were the work of the American minimalists, while Hirst’s most easily identifiable forerunner was German, namely
Joseph Beuys
, melancholic
meistersinger
of the art of the vitrine.
Damien Hirst (b. 1965), Saint Sebastian, Exquisite Pain, executed in 2007. Glass, painted stainless steel, silicone, arrows, crossbow bolts, stainless steel cable and clamps, stainless steel carabiner, bullock and formaldehyde solution. 126⅝ x 61⅜ x 61⅜ in (321.6 x 155.8 x 155.8 cm). Estimate: £1,000,000-1,500,000. Offered inThe George Michael Collection Evening Auctionon 14 March 2019 at Christie’s in London
And yet the Young British Artists, or YBAs as they would become known some years later — the label was invented long after their emergence — were rooted in their own time and place, sharing a set of concerns that could not easily be divorced from their Britishness.
Hirst’s obsessive interest in death and decay, in anatomy and dissection, had hallowed native antecedents in a strain of English art that gave rise both to
Hogarth
— think of the dog gnawing the remains of the dissected corpse in
The Four Stages of Cruelty
— and to
George Stubbs
, whose frieze-like depictions of thoroughbred horses on blank backgrounds,
Whistlejacket
being the most famous of them, are the uncanny prefigurations of Hirst’s own creatures preserved for ever in formaldehyde.
Damien Hirst (b. 1965), Saint Bartholomew, executed in 2006. Glass, painted MDF, aluminium, acrylic, fish and formaldehyde solution. 24 x 36 x 6½ in (61.1 x 91.5 x 16.5 cm). Estimate: £250,000-350,000. Offered inThe George Michael Collection Evening Auctionon 14 March 2019 at Christie’s in London
Tracey Emin, not strictly a first-generation YBA but a member of the second wave, was another with at least one foot in the past. Her confessional tapestries, embroidered with outbursts of rage or melancholy effusions of pathos, might be seen as a disaffected post-feminist equivalent to the samplers once created by English ladies of a certain age to while away their spinsterhood. I always thought her infamous work My Bedwas very English too, like an Agatha Christie whodunnit in object form: where’s the body?
Order the souvenir catalogues and tote bagfor The George Michael Collection
As well as naked ambition, there was a strong element of political disaffection at work among the YBAs, reflecting a belief that there was something rotten in the state of Britain during those years, as the Thatcher government writhed in its final death throes.
Tracey Emin (b. 1963), I KNOW I KNOW I KNOW, executed in 2002.This work is number one from an edition of three plus two artist’s proofs. Red and blue neon. 44⅜ x 102⅞ in (112.7 x 261.3 cm). Estimate: £40,000-60,000. Offered inThe George Michael Collection Evening Auctionon 14 March 2019 at Christie’s in London
Hirst’s close friend at the time,
Michael Landy
, worked with found junk and the paraphernalia of market stalls to create parodic images of Thatcher’s much trumped free-market economy.
Market
, his masterwork of 1990, the year of her fall from power, turned an entire warehouse into a marketplace formed from modular units of plastic crating and greengrocer’s grass — a cheapskate, tongue-in-cheek dystopian version of
Donald Judd’s minimalist utopia in the Texan desert complex of Marfa
.
Landy would later take his distaste for the spiritual vacuity of a world dominated by market economics to such lengths as to become, in all but name, the Francis of Assisi of the YBA generation: in 2001 he took over a temporarily vacant department store in London’s Oxford Street and made it the
mise en scène
for
Break Down
, an installation that lasted for several weeks, in the course of which he systematically destroyed and pulped every single one of his personal possessions (including several works of art by his friends, which by then were worth six-figure sums).
Michael Landy photographed with his work Break Down, 2001. Artwork: © Michael Landy. Commissioned by Artangel. Courtesy the artist and Thomas Dane Gallery. Photo: Hugo Glendinning
Meanwhile, Landy’s partnerGillian Wearingwas making a series of profoundly moving and upsetting quasi-documentaries in which she explored the plight of those left behind by Thatchernomics: Drunk(1997-99), in which she collaborated with a group of alcoholics to portray the actual texture of their wasted lives, all darkness with the occasional flash of very black humour, was the most bleakly compelling of her essays in this sourly reflective mode.
Abigail Lane’s distressingly hyperrealised sculpture of a half-naked down-and-out, Misfit, of 1994, was another powerful expression of this strain of socio-political discontent among the YBAs. But its earliest manifestation had been a work created by a rather older sculptor, just a year before the spate of warehouse shows that announced the advent of the YBA phenomenon.
This wasRichard Wilson’s 20:50, first shown at Matt’s Gallery in East London in 1987: an installation that would later become one of the signature works of the New British Art (as it was then known), thanks to the fact that Charles Saatchi, who bought and showed so much of the early work of the YBAs, acquired and subsequently reinstalled it in the Saatchi Gallery on Boundary Road.
Angus Fairhurst (1966-2008), A Couple of Differences Between Thinking and Feeling II, executed in 2003. This work is number three from an edition of three. Arm: 12¼ x 47¼ x 26⅜ in (31 x 120 x 67 cm). Estimate: £30,000-50,000. Offered inThe George Michael Collection Evening Auctionon 14 March 2019 at Christie’s in London
What did 20:50consist of? A forbidding lake of sump oil, into which the viewer was encouraged to walk, like Moses at the parting of the Red Sea, along a channel/walkway/gangplank cut through the middle of that dark, reflective pool. It was a sculpture made from oil, once the lifeblood of a now-dead industrial past: a dark reflection on the state of modern Britain if ever there was one, and a kind of talisman for the YBAs, even if its creator had never been part of their group.
What was it that made the YBAs so exceptional? I think it was their combination of ambition and determination
I was in my late twenties when I first started writing about the YBAs, just a few years older than most of them. I got to know many of them quite well, and co-curated the first exhibition of their work at a public institution (rather than a warehouse). That show was called
Broken English
, with work by Damien Hirst, Michael Landy,
Rachel Whiteread
and Gary Hume, among others, and was put on at the Serpentine Gallery in London’s Kensington Gardens in 1991.
What I remember most vividly from the time I spent with them then is the spirit of friendly competition that existed between all of them. They were rivals, in a way, but fiercely loyal to one another at the same time. They all promised to give me a work of art, but Michael was the only one who did: a trolley full of junk from his series
Closing Down Sale
. A year or two later, my cleaner mistook it for rubbish and threw it away. A few years after that, Michael told me to insure it because it was worth a small fortune. He thought it was hilarious when I told him it had gone to the dump.
Gary Hume (b. 1962), American Tan XXIV, executed in 2006-2007. Household gloss on aluminium. 78¾ x 63 in (200 x 160 cm). Estimate: £40,000-60,000. This lot is offered inThe George Michael Collection Evening Auctionon 14 March 2019 at Christie’s in London
Damien was the consummate showman of the group, but even he was occasionally upstaged during the early years. In 1992, I remember embarking on a road trip to Kassel to see the quinquennial survey of contemporary art known as Documenta. I made the trip together with
Michael Craig-Martin
— who had taught many of the YBAs at Goldsmiths — and Karsten Schubert, who was Rachel Whiteread’s dealer at the time. I remember the three of us winding up at a huge schloss somewhere outside Kassel where Damien had taken over an outhouse of some kind, in which he was showing what I remember as a slide show of wounds, or diseased flesh, or something of that kind.
Michael Craig-Martin (b. 1941), Untitled (GOD), painted in 2002. Acrylic on canvas. 42 x 36 in (106.7 x 91.4 cm). Estimate: £18,000-25,000. Offered inThe George Michael Collection Evening Auctionon 14 March 2019 at Christie’s in London
Whatever it was, it was eclipsed by the work of the New York wunderkind
Jeff Koons
, who had created
a puppy dog the size of a building
in the courtyard of the German castle — a puppy dog entirely made out of geraniums. No one even bothered to go and look at Damien’s chamber of horrors. I think it was the only time I have ever seen him nonplussed. But he got over it. He was on an unstoppable roll: earlier that same year he had exhibited
The Physical Impossibility of Death in the Mind of Someone Living
, otherwise known as The Shark, at Charles Saatchi’s gallery.
What was it that made the YBAs so exceptional? I think it was their combination of ambition and determination. It was bold to think of the shark. But then Damien persuaded Saatchi to pay for it. He
got it done
. Likewise, it was brave of Michael to think of destroying everything he owned, of stripping himself back to the condition of a man who has nothing. But it was even braver to carry it through, as he did, without compromise.
Sarah Lucas (b. 1962), New Religion (violet), executed in 2001. This work is one of five unique versions. Neon. 15 x 21 x 71¼ in (38 x 53.3 x 180.9 cm). Estimate: £40,000-60,000. This lot is offered inThe George Michael Collection Evening Auctionon 14 March 2019 at Christie’s in London
For me, the milestone creation of that whole fascinating time remains, paradoxically, the one work of art that hasn’t survived except in the memory. I am thinking of
Rachel Whiteread’s House, of 1993–94
: a cast made of the interior spaces of an entire, real, derelict house, in a benighted area of East London, then left in situ, all too briefly, as matter for our contemplation; a strange and ghostly monument, of sorts, to the generations of ordinary people who had made their lives there. To have thought of the sculpture was remarkable, but to achieve it was truly astonishing.
I recently attended a celebration of
House
held by James Lingwood of the Artangel Trust, enabler of Rachel’s work, in a restaurant near the place where the sculpture once briefly stood — until its demolition, just three months after its unveiling, on the orders of a singularly unenlightened council planning officer. The event marked the 25th anniversary of its destruction. I found myself wondering where all those years had gone.
Rachel Whiteread photographed while at work on House, 1993. Photo: Nicholas Turpin/The Independent/REX/Shutterstock. Artwork: © Rachel Whiteread
Listening to Rachel’s speech that evening, it was clear that she still regards that sculpture as her masterpiece. And I was interested to hear from Nicholas Serota, who was also present, that ‘ Housereally changed everything’. I couldn’t help speculating whether, by that, he meant to suggest that without the sea change in attitudes brought about by Rachel’s work he might have found it much harder to work his own miracle, namely the founding of Tate Modern in a disused power station opposite St Paul’s Cathedral.
Not only did Rachel and her contemporaries decisively alter the course of British art, they profoundly altered global perceptions of it. Before the YBAs, Britain was regarded as a backwater by even the most dedicated followers of artistic fashion. After the YBAs, Britain, and London in particular, would be regarded as a genuine power to be reckoned with in the world of contemporary art.
I have one other vivid memory that seems relevant here, from just a few years after what could be called the heyday of the YBAs. It was 2005 and I was at the Gagosian Gallery in Manhattan, where Damien was exhibiting a group of works that marked something of a departure for him: a series of photo-realist canvases quite unlike the sculptures for which he was already known.
How did it come to pass? Creativity is a large part of the answer. Belief is just as important
People were unsure what to make of them; but there was no doubting the clamour, the sense of event. Everyone in the room seemed to be a celebrity, and all the celebrities were queuing up to talk to Damien. I saw Iggy Pop, looking like one of the ancients, stooped over, staring at the floor, standing there just waiting to have a word with Damien the maestro. I remember thinking that things really
had
changed: Iggy Pop, waiting to speak to Damien Hirst, like a courtier at the levee
of Louis XIV!
a star, so much so that even rock stars wanted a piece of him.
Tracey Emin (b. 1963), George Loves Kenny, executed in 2007, this work is unique. Soft pink and pale blue neon. 42½ x 42 in (107.9 x 106.7 cm). Estimate: £40,000-60,000. Offered inThe George Michael Collection Evening Auctionon 14 March 2019 at Christie’s in London
What more compelling proof of this great change could there be than the very existence ofGeorge Michael’s rich and fastidiously chosen collection, mostly of work by Damien, Rachel and their peers? A formidable trove of contemporary British art, put together with great sensitivity by a hugely successful British pop star. It might not seem so strange, nowadays, that such a thing might have come to be, that a man like him would have spent his money on all this.
But when I think back to when I started writing about art, when I turn the clock back 30 years, I really do believe it could never have happened in those early days. How on Earth
did
it come to pass? Creativity is part (a large part) of the answer. But I think belief is just as important. If you want to make things happen — well, in the words of the song, you’ve got to have faith.
Order the souvenir catalogues and tote bag for The George Michael Collection. The collection is on view in a special multi-media exhibition at Christie's London (8 King Street, SW1Y 6QT) from 8-15 March. Admission is free of charge
Post-War & Contemporary Art | Auction Preview
Main image:
Damien Hirst and Danny Chadwick photographed with Hirst’s 1990 work A Thousand Years, at Young British Artists I, a group exhibition at the Saatchi Collection, London, March 1992. Photo: Alan Davidson/REX/Shutterstock. Artwork: © Damien Hirst and Science Ltd. All rights reserved, DACS 2019
| https://www.christies.com/Features/Encounters-with-the-Young-British-Artists-9705-1.aspx |
Symmetry | Free Full-Text | Gain-Loss Evaluation-Based Generic Selection for Steganalysis Feature
Fewer contribution feature components in the image high-dimensional steganalysis feature are able to increase the spatio-temporal complexity of detecting the stego images, and even reduce the detection accuracy. In order to maintain or even improve the detection accuracy while effectively reducing the dimension of the DCTR steganalysis feature, this paper proposes a new selection approach for DCTR feature. First, the asymmetric distortion factor and information gain ratio of each feature component are improved to measure the difference between the symmetric cover and stego features, which provides the theoretical basis for selecting the feature components that contribute to a great degree to detecting the stego images. Additionally, the feature components are arranged in descending order rely on the two measurement criteria, which provides the basis for deleting the components. Based on the above, removing feature components that are ranked larger differently according to two criteria. Ultimately, the preserved feature components are used as the final selected feature for training and detection. Comparison experiments with existing classical approaches indicate that this approach can effectively reduce the feature dimension while maintaining or even improving the detection accuracy. At the same time, it can reduce the detection spatio-temporal complexity of the stego images.
Gain-Loss Evaluation-Based Generic Selection for Steganalysis Feature
by Ruixia Jin 1,† , Yihao Wang 2,† , Yuanyuan Ma 3,* , Tao Li 3 and Xintao Duan 3
1
SanQuan Medical College, Xinxiang 453003, China
2
College Software, Henan Normal University, Xinxiang 453007, China
3
College Computer & Information Engineering, Henan Normal University, Xinxiang 453007, China
*
Author to whom correspondence should be addressed.
†
They contributed equally to this work and should be considered co-first authors.
Symmetry 2021 , 13 (10), 1775; https://doi.org/10.3390/sym13101775
Abstract
Fewer contribution feature components in the image high-dimensional steganalysis feature are able to increase the spatio-temporal complexity of detecting the stego images, and even reduce the detection accuracy. In order to maintain or even improve the detection accuracy while effectively reducing the dimension of the DCTR steganalysis feature, this paper proposes a new selection approach for DCTR feature. First, the asymmetric distortion factor and information gain ratio of each feature component are improved to measure the difference between the symmetric cover and stego features, which provides the theoretical basis for selecting the feature components that contribute to a great degree to detecting the stego images. Additionally, the feature components are arranged in descending order rely on the two measurement criteria, which provides the basis for deleting the components. Based on the above, removing feature components that are ranked larger differently according to two criteria. Ultimately, the preserved feature components are used as the final selected feature for training and detection. Comparison experiments with existing classical approaches indicate that this approach can effectively reduce the feature dimension while maintaining or even improving the detection accuracy. At the same time, it can reduce the detection spatio-temporal complexity of the stego images.
Keywords:
steganalysis feature components
;
feature selection
;
distortion factor
;
information gain ratio
;
contribution degree
1. Introduction
Steganography, another term for covert communication, is a technique for the hidden messages in objects that do not easily arouse suspicion and then sending them to the intended recipients, and it has received widespread attention in the field of information security in recent years [ 1 , 2 , 3 , 4 , 5 , 6 , 7 , 8 , 9 , 10 , 11 , 12 , 13 , 14 ]. The digital medium “steganography” was used by illegal organizations to covertly communicate and engage in activities that hazard national security. Steganalysis, the corresponding attack technique, is to extract the hidden messages in order to counter steganography and protect national security [ 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 , 23 , 24 , 25 , 26 ].
With digital media developing rapidly, improving the speed and accuracy of steganalysis has become a pressing problem. Therefore, the digital image adaptive steganalysis algorithm is the direction that researchers are currently focusing on, mainly by extracting the steganalysis features [ 27 , 28 , 29 , 30 , 31 , 32 ], and using the integrated classifier for training and detection, which can provide a detection effect. At present, researchers have developed a series of high-dimensional steganalysis algorithms. For example, Holub et al. [ 27 ] proposed the 8000-D DCTR feature of low complexity (fast) extracted from the used DCT residuals, Song et al. [ 28 ] proposed the 17,000-D GFR feature, in which the Gabor filter can provide steganalysis from different scales, Kodovský et al. [ 29 ] proposed the 22,510-D CC-JRM feature established by a set of sub-model systems covering the joint distribution of spatial and frequency domain DCT coefficients with extensive statistical correlation, and Fridrich et al. [ 30 ] proposed the 34,671-D SRM feature of the complete spatial domain rich model. Although high-dimensional steganalysis features achieve high detection accuracy for image-adaptive steganography, the adaptive steganalysis algorithm extracts steganalysis features with high dimension, which leads to high spatio-temporal complexity for detecting the stego images and affects the development of fast steganalysis. Therefore, how to select the feature components that contribute to detecting, so as to reduce the steganalysis feature dimension and the spatio-temporal complexity of detecting the stego images, has become the focus of the current steganalysis research.
At present, researchers have conducted a series of studies on the selection and dimension reduction of steganalysis features [ 30 , 33 , 34 , 35 , 36 , 37 ]. These methods can be classified into general and specific steganalysis feature selection methods depending on the objects to which the feature selection methods are applied. General methods are suitable for measuring a variety of steganalysis features, measuring the contribution of feature components to detection of the stego images, and selecting the feature vector with a large contribution to detecting of the stego images for training and detection. Typical methods in this type are the following. Qin et al. [ 33 ] proposed a method with no parameter limit, which is simple to use, and in which it is easy to understand the results of the PCA (abbreviated as PCA-D method). This method calculates the covariance matrix and the feature values and feature vector of the covariance matrix, and finally determines the number of selected feature components by determining the number of principal components. However, this method has poor effect on the nonlinear structures data. Ma et al. [ 34 ] proposed a feature selection method based on decision rough set α -positive domain simplification. The method not only reduces the feature dimension but maintains the detection accuracy of the stego images; however, the feature selection depends on the classifier results, which leads to a high time complexity of the selection. In our previous contribution [ 35 ], we proposed a feature selection method (abbreviated as CGSM method) based on comprehensive criteria, which combine the difference function and correlation, and select the feature components with large difference and delete the feature components with weak correlation, which slightly improves the detection accuracy of the stego images and reduces the feature dimension.
Specific methods are suitable for a certain steganalysis feature. Though the calculation for this class of selection methods is simpler than those for the general class, it has a narrower scope of application. Typical methods of this kind are outlined here. Fridrich et al. [
30
] proposed a series of SRM feature selection methods for airspace-rich models, and most of these take each sub-model of SRM as a subset and then select the features based on the diversity of classifiers. Among them, the BEST-q-CLASS method has the best detection performance in selecting features, reducing the feature dimension and improving the detection accuracy of SRM steganalysis features. However, this method ignores the redundancy between subsets when selecting features, so the feature dimension is still high after selection. Yang et al. [
36
] proposed an algorithm for GFR feature subspace selection based on Fisher’s criterion (abbreviated as Fisher-G method). The method is able to select more efficient feature subspaces to improve the detection performance of GFR features on the stego images in a targeted way, however, it does not improve the detection accuracy of the stego images significantly when the quality factor is high. Yu et al. [
37
] proposed a multi-scale GFR feature selection method based on the SNR criterion combined with an improved Relief algorithm (abbreviated as SRGS method), which deletes useless and low-contribution feature components and significantly reduces the feature dimension while maintaining the detection accuracy. However, it has no obvious effect on other steganalysis features.
So far, some studies have achieved different steganalysis feature selection effects [ 28 , 33 , 34 , 35 , 36 , 37 ], such as CC-PEV, GFR, CC-JRM, SRM and J+SRM features. However, the existing methods for DCTR feature selection effect are not satisfactory, the selected feature dimension is still too high, the detection accuracy is reduced too much, and so on.
In order to reduce the feature dimension of DCTR without affecting the detection of the stego images, this paper attempts to propose a DCTR feature selection method based on different criteria with gain-loss (abbreviated as S-FUND method). First, we try to give a measurement algorithm based on distortion and information gain ratio according to which we measure the difference between the covers and stegos for each steganalysis feature component. Second, by setting the threshold, we delete the feature components with a small contribution measured by at least one of the two criteria. Finally, the preserved feature components are used as the final selected steganalysis feature for training and detection. This method is expected to reduce the spatial complexity of detecting the stego images by reducing the feature dimension while maintaining or even improving the detection accuracy, and to reduce the time complexity of detecting the stego images by avoiding the dependence on classification results.
The rest of this paper is organized as follows: Section 2 describes the related work. Section 3 outlines a measurement algorithm for the difference of steganalysis feature components. Section 4 proposes a multi-criteria-based feature selection method. Section 5 analyzes the effect of DCTR features based on S-FUND method proposed in this paper for detecting of the stego images through a series of experimental comparisons. Section 6 further discusses the experiment in this paper. Finally, Section 7 summarizes the whole paper.
2. Related Work
Distortion is a measure of the difference between the original signal and the altered signal [
38
], and it is defined as the square root of the ratio of the total harmonic energy to the fundamental energy by the following formula.
K = P − P 1 P 1 = ∑ n = 2 ∞ P n P 1 ,
(1)
where
P 1
and
P
represent the fundamental energy and the total signal energy, respectively, and
P n
represents the energy of the
n
th harmonic. The larger the
K
value, the greater the ratio of total harmonic energy to fundamental energy, i.e., the greater the difference between harmonic energy and fundamental energy, and thus the better to distinguish harmonic energy from fundamental energy.
The information gain ratio improves the measure of the difference between features [
39
], and solves the problem of information gain bias to take more features, which is defined as the ratio of the information gain value to the entropy
H Y ( X )
of the value of dataset
X
for feature
Y
, with the following formula.
g R ( X , Y ) = g ( X , Y ) H Y ( X ) ,
(2)
g ( X , Y ) = H ( X ) − H ( X | Y ) ,
(3)
H ( X | Y ) = H ( X , Y ) − H ( X ) ,
(4)
where
g ( X , Y )
represents the information gain value between dataset
X
and feature
Y
,
H ( X )
and
H ( Y )
represent the entropy values of training dataset
X
and feature
Y
, respectively,
H ( X | Y )
represents the uncertainty of
X
given known
Y
.
H Y ( X ) = − ∑ i = 1 n | X i | | X | log 2 | X i | | X |
,
n
is the number of
Y
values,
| X |
represents the number of samples in the
X
. The smaller the value of
g R ( X , Y )
, the smaller the degree of uncertainty in
Y
decreasing with
X
, i.e., the smaller the difference between them.
In previous research, researchers have often used one criterion first to select some of the features that are useful for detecting the stego images (written as “First Selection”), and then using another criterion for a second selection based on the “First Selection” [ 33 , 34 , 35 , 36 , 37 ]. Although this does reduce the feature dimension, the two criteria are used sequentially, i.e., one criterion is measured ahead of the other, so that there are inconsistencies in the measurement using the two criteria.
For example, Yu et al. [
37
] proposed the SRGS method to reduce the feature dimension. First, the effective SNR criterion is improved, and valuable feature components are selected. On this basis, the Relief algorithm is improved, the redundant feature components in the remaining feature components are deleted. Afterwards, the valuable and non-redundant feature components are finally selected. However, in the SRGS method, when using the Relief algorithm, some components retained by the SNR criterion are unable to be measured by other criteria. There is the same dilemma in [
34
,
35
]. This requires the reliability of the selected features to be further improved.
Therefore, it is necessary to find a more rigorous method for selecting valuable feature components to further reduce the feature dimension and improve the detection accuracy.
3. Measure of Difference
The greater the difference between the cover and stego features, the better it is for distinguishing the cover features from the stego features, and thus the better it is for detecting the stego images. On the contrary, feature components with little and no difference between the cover and stego features are considered useless features. These features lead to the feature dimension increasing, resulting in unnecessary detection time and cost, which is detrimental to the application of steganalysis and hinders its development. Therefore, the feature components which contribute to distinguishing the cover and stego images are selected as possible. In order to measure the difference between the cover and stego images for steganalysis, distortion factor and information gain ratio are introduced in this paper.
3.1. Distortion-Based Measurement
When hiding messages are embedded by the steganography algorithm, some of the feature components of the covers are changed, which makes the difference between the cover and stego features. Considering that not all feature components change to the same degree, the greater the difference between the cover and stego features, the better the distinction factor between them. We improve Equation (
1
) so that it can measure the distortion factor of the cover images before and after steganography, as follows.
K i = f i C − f i S f i C = ∑ j = 1 n ( f i j C − f i j S ) f i C ,
(5)
where
f i C
and
f i S
represent the values of the
i
th steganalysis feature in the cover and stego images, respectively,
f i j C
and
f i j S
represent the value of the
i
th steganalysis feature component in
j
th the cover images or the stego images, respectively. The larger the
K i
value, the more distortion factor that occurs in the cover images when the information is embedded in the images, the greater the difference between the cover and stego features, the more favorable the feature component is for detecting the stego images, and the more it should be preserved.
3.2. Information Gain Ratio Based Measurement
In order to measure the difference between the cover and stego features of a steganalysis feature component in many aspects, this subsection introduces the information gain ratio.
In previous work, researchers have used information gain to measure the difference of feature components between the cover and stego features, with the following equation.
g ( f i S , f i C ) = H ( f i S ) − H ( f i S | f i C ) ,
(6)
H ( f i S | f i C ) = H ( f i S , f i C ) − H ( f i S ) ,
(7)
where
g ( f i S , f i C )
represents information gain value of the feature component between the cover and stego images,
H ( f i C )
and
H ( f i S )
represent information entropy values of feature components between the cover and stego images, respectively,
H ( f i C ) = − ∑ j = 1 n | f i j C | log 2 | f i j C |
,
H ( f i S ) = − ∑ j = 1 n | f i j S | log 2 | f i j S |
,
H ( f i S | f i C )
represents conditional entropy values of the feature components in the stego images under the condition that the values of the feature components in the cover images are known,
H ( f i S | f i C ) = − ∑ j = 1 n | f i j C | log 2 | f i j S |
. The larger the
g ( f i S , f i C )
value, the greater the information gain of the steganalysis feature components between the cover and stego images, and thus the greater the difference between them, and then the better it is for detecting stego images.
However, it is known from previous research that when the feature number is large, it is easier to obtain a more definite subset based on this feature division, i.e., a lower
H ( f i S | f i C )
value, and because the value of
H ( f i C )
is a certain, the information gain is greater. Therefore, if information gain is used as the basis for feature selection, there is a problem of bias towards selecting features with more values. In order to solve this problem, this paper uses the information gain ratio to measure the difference of feature components between the cover and stego images. The information gain ratio of feature components can be defined as the ratio of
g ( f i S , f i C )
value to the partial entropy of the feature component in the cover images with respect to it in the stego images. We improve Equation (
2
) so that it can measure the difference in the feature components between the cover and stego images as follows.
g R ( f i S , f i C ) = g ( f i S , f i C ) H f i C ( f i S ) ,
(8)
H f i C ( f i S ) = − ∑ j = 1 n | f i j C | | f i j S | log 2 | f i j C | | f i j S | = − ∑ j = 1 n f i j C f i j S log 2 f i j C f i j S ,
(9)
where
H f i C ( f i S )
represents the partial entropy of the value of the feature component in the cover images with respect to it in the stego images. A larger
g R ( f i S , f i C )
value indicates that the feature component should be preserved.
In the next section, we describe in detail the algorithmic steps and performance analysis of the proposed S-FUND method in this paper.
4. S-FUND Method
Based on the above, this paper proposes an S-FUND method, which treats the two criteria for measuring the difference between the cover and stego features as the same. First, two criteria are used to measure the difference between the cover and stego features. Afterwards, the feature component with the larger difference in order is deleted. Finally, the preserved feature components are used as the final feature.
4.1. Specific Algorithm
We present the specific algorithm of S-FUND method according to the main steps described above, as shown in Algorithm 1.
Algorithm 1 Specific algorithm of S-FUND method
Input:
The original feature F = [ f 1 , f 2 , f 3 , ⋯ , f N ] ;
Output:
Final selection of steganalysis feature based on S-FUND method F ′ = [ f 1 ′ , f 2 ′ , f 3 ′ , ⋯ , f m ′ ] , where m is the final feature dimension;
1:
for i = 1 to N do
2:
for j = 1 to n do
3:
Using Equation ( 5 ) to measure the sum of the i th feature component differences between the cover and stego images (written as ∑ j = 1 n ( f i j C − f i j S ) );
4:
Using step 3 and Equation ( 5 )
⇒ Computing the K i value of the i th feature component between the cover and stego images;
5:
end for
6:
end for
7:
Feature components arranged in descending order according to K i value in step 4 F 1 = [ f 1 1 , f 2 1 , ⋯ , f N 1 ] ;
8:
for i = 1 to N do
9:
for j = 1 to n do
10:
Using Equation ( 7 ) to calculate the H ( f i C | f i S ) value of the feature component in the cover images with respect to it in the stego images;
11:
According to the H ( f i S | f i C ) value from step 10, using Equation ( 6 )
⇒ Calculating the g ( f i S , f i C ) value of the feature component between the cover and stego images;
12:
Using Equation ( 9 ) to calculate the H f i C ( f i S ) value of the feature component in the cover images with respect to the value of the feature component in the stego images;
13:
According to the g ( f i S , f i C ) value in step 11, the H f i C ( f i S ) value in step 12, using Equation ( 8 )
⇒ Calculating the g R ( f i S , f i C ) value of the feature component between the cover and stego features;
14:
end for
15:
end for
16:
According to the g R ( f i S , f i C ) value in step 13, steganalysis feature components in descending order F 2 = [ f 1 2 , f 2 2 , ⋯ , f N 2 ] ;
17:
Setting threshold T ;
18:
for i = 1 to N do
19:
Sorting results according to steps 7 and 16
⇒ Calculating the difference between the kth feature component ranked according to the two criteria (written as f 1 m s = f 1 1 − f 1 2 );
20:
end for
21:
Deleting the feature components which the absolute value of the ranking difference is greater than the threshold
T
;
f 1 m s ⇒ preserve f 1 m s < T delete f 1 m s ≥ T
(10)
22:
Preserving the m -dimensional eligible component for training and detection as the final selected feature.
Thus, in this paper, we measure the difference between the cover and stego features using distortion factor and information gain ratio. This method reduces the feature dimension significantly, thus reducing the spatio-temporal complexity of detecting the stego images.
Next, Figure 1 is given, which is based on Algorithm 1, and visually depicts S-FUND method process to select the steganalysis features.
Figure 1. Process of the S-FUND method.
In the next subsection, we analyze the time complexity of each of the main steps in S-FUND method and compare it with the time complexity of the classification results relying on Fisher’s linear discriminant integrated classifier to give the readers a better understanding of the performance of this method.
4.2. Performance Analysis
The time complexity of the main steps of the proposed S-FUND method is analyzed separately, and the time complexity of other existing classic methods are compared, as shown in Table 1 .
Table 1. Time complexity analysis of the specific steps and other classic methods.
There is no nested relationship between the steps in
Table 1
, so the time complexity of the S-FUND method proposed in this paper is equal to the maximum time complexity of all the steps. When
O ( N log 2 N ) ≤ O ( N n )
, i.e.,
log 2 N ≤ n
, the time complexity of the S-FUND method is
O ( N n )
; when
log 2 N > n
, the time complexity of the S-FUND method is
O ( N log 2 N )
. However, existing feature selection methods rely on the classification results of the Fisher linear discriminant integrated classifier [
40
], which has a time complexity of:
O ( FLD ) = O ( L N trn d sub 2 ) + O ( L d sub 3 )
(11)
where
L
represents the number of individual learners,
N trn
represents number of training sets per type,
d sub
represents subspace dimension, so the time complexity of this class of selection methods is
O ( FLD depend )
must be greater than or equal to
O ( FLD )
, i.e.,
O ( FLD depend ) ≥ O ( L N trn d sub 2 ) + O ( L d sub 3 )
. Thus, the time complexity of the selection method that relies on Fisher Linear Discriminant integrated classifier results is much greater than
O ( N n )
or
O ( N log 2 N )
. Because the DCTR feature dimension is 8000,
n < N
and
log 2 N < N
. The time complexity of S-FUND method is less than that of PCA-D, Steganalysis-
α
, Fisher-G and SRGS methods, and it is similar to that of the CGSM method.
Therefore, the S-FUND method greatly reduces the running time complexity and improves the efficiency of detecting the stego images.
4.3. Threshold Analysis
In order to have a better selection of S-FUND method, we need to explain the threshold T in Algorithm 1.
Based on previous work and experimental experience, when the DCTR feature is reduced to about 40% of the original by different methods, they all show worse detection effect than the original, and the detection effect will decrease as the feature dimension decreases. In this method, when the feature dimension is reduced to about 40% of the original, the threshold is 0.15.
Therefore, we initially set
T = 0.15
, if
f 1 m s
is greater than
T
, that is,
f 1 m s > 0.15
, it means that the contribution degree of the feature components measured by the two criteria is quite different. Thus, the two feature components are removed to reduce the feature dimension. We are able to obtain the value of
T
, i.e.,
T = 0.15 , 0.14 , 0.13 , … , 0.02 and
0.01
by setting the steps of 0.01. Then, by comparing the detection accuracy under these thresholds
T
, S-FUND method with the highest detection accuracy is selected as the final detection effect under this payload. In this way, more valuable feature components can be selected, and the feature dimension will be greatly reduced without affecting the detection accuracy, so as to achieve the purpose of feature selection for steganalysis.
5. Experimental Results and Analysis
In order to detect the performance of the S-FUND method proposed in this paper, a series of selection and comparison experiments were conducted using 8000-D DCTR feature [ 27 ]. All experiments were run in MATLAB R2018a with an Intel i7-8550U CPU and an 8G RAM computer to ensure that the different methods could be fairly compared. Experimental result figures were processed and generated in OriginPro 8.5.
5.1. Experimental Setup
The computer software, hardware, image library and steganalysis features used in all the experiments in this paper are the same to ensure that the different methods can be compared fairly and more reliably.
We performed a series of operations on the BOSSbase 1.01 image library of the website (BOSSbase 1.01 image library from the URL: http://dde.binghamton.edu/download/ , accessed on 3 March 2020) to prepare for the next experiments, with the following steps.
(1) Converting 10,000 images in PGM format from the BOSSbase 1.01 image library into JPEG images with a compression quality factor of 95 (QF = 95).
(2) Generating 10,000 JPEG cover images using SI-UNIWARD [ 6 ] steganography to generate 10,000 × 5 = 50,000 images with payload of 0.1, 0.2, 0.3, 0.4 and 0.5 (bpAC).
(3) The DCTR [ 27 ] extraction algorithm was used to extract 8000-D steganalysis features from the cover and stego images, and 10,000 × (1 + 5) = 60,000 steganalysis features were obtained. The reason for this is that the cover images become stego images after embedding information, training and detection are paired, that is, the images are symmetric.
Steganalysis effect depends not only on the types of steganalysis features, but also on the different steganography schemes and payloads. Early steganography schemes can be accurately detected by high-dimensional steganalysis features (detection accuracy can reach more than 80%), such as LSB, nsF5 [ 1 ], and so on. In recent years, adaptive steganography has achieved low embedding jitter, such as SI-UNIWARD [ 6 ]. Solving the ones difficult to detect is the focus of this paper. Moreover, the detection accuracy of the same steganalysis features will be higher with the increase of payloads.
Meanwhile, the steganographic images with high payloads can be visually distinguished to a certain extent, which loses the significance of steganalysis, thus, the payloads of this paper are 0.1, 0.2, 0.3, 0.4 and 0.5. The specific experimental object settings are shown in Table 2 .
Table 2. Experimental subject setup.
Kodovský et al. [
40
] proposed the FLD ensemble classifier based on random forest algorithm and Monte Carlo thought, and it is widely used to train and detect for steganalysis feature selection [
33
,
34
,
35
,
36
,
37
]. Therefore, the FLD integrated classifier is used in this paper, which can achieve the purpose of fair comparison between different methods. Firstly, one-half of the cover image features and their corresponding stego image features with different payloads are randomly selected from each feature set as the training set. Afterwards, the remaining cover image features and their corresponding stego image features with different payloads are used as the test set. The error rates in this integrated classifier are calculated as
P E = min P FA P FA + P MD N TS = min P FA P FA + P MD 2 ,
(12)
where
P FA
and
P MD
represent the false alarm rate and missed detection rate, respectively,
N TS
represents the number of test sets, because the test set contains a cover image set and a stego image set, i.e.,
N TS = 2
. The error rate represents the ratio of the number of classification errors to the total number of tested feature components. The lower the detection error rate, the better the selected feature components are at detecting the stego images. In order to show more intuitively the results of the comparison experiment, we use the following equation—
P A ¯ = 1 − P E ¯
to convert the detection error rate obtained by the classifier into detection accuracy.
P A ¯
represents average detection accuracy—the larger
P A ¯
value is, the better the selected features are for detecting the stego images.
The experiment consisted of four parts:
1.
Comparison experiment based on the S-FUND method before and after the selection of DCTR steganalysis feature [ 27 ] ( Section 5.2 );
2.
Comparison experiment with Random-D method ( Section 5.3 );
3.
Comparison experiment with CGSM method [ 35 ] ( Section 5.4 );
4.
Comparison experiment with PCA-D method [ 33 ] ( Section 5.5 ).
5.2. Selection Experiment
Holub et al. [ 27 ] proposed an 8000-D DCTR image steganalysis feature. The feature is a first-order statistic of the quantized noise residuals obtained from the decompressed JPEG image using 64 discrete Cosine transform kernels. The DCTR feature has lower dimension and computational complexity, and better detection performance.
In order to obtain the detection accuracy of the S-FUND method, we set
T
= 0.15, 0.14, 0.13, …, 0.02 and 0.01 by setting the steps of 0.01, if
f 1 m s
is greater than
T
, the two feature components are removed to reduce the feature dimension.
In the S-FUND method, we delete the steganalysis feature components that differ more than the threshold values measured by two criteria. Firstly, in order to effectively reduce the feature dimension, we consider the difference between the two criteria greater than 15% of the original feature dimensions to be large, and for 8000-D DCTR feature, we delete the component of steganalysis features with a difference greater than 8000 × 15% = 1200 dimensions. The experimental results for the selected feature dimensions and detection accuracy are shown in Table 3 .
Table 3. Comparison of experimental results before and after feature selection based on the S-FUND method.
In
Table 3
, ‘Dim’ represents the feature dimension, and represents the detection accuracy. From
Table 3
, it can be seen that the S-FUND method can significantly reduce the feature dimension while maintaining or even improving the detection accuracy at different payloads. For example, when payload = 0.1, the selected features based on S-FUND method can achieve a detection accuracy of 0.5270, which is 0.31% higher than the original, and the selected feature is 3462 dimensions lower than the original feature dimension. Moreover, when
T = 0.04
, while maintaining the detection accuracy of the stego images, the feature dimension selected based on S-Fund method is only 30.44% of the original. When payload = 0.2, 0.3, the features selected based on S-FUND method can all reduce the DCTR feature dimension to different degrees, and the detection accuracy is improved by 0.49% and 0.16%, respectively. Moreover, the features selected based on S-FUND method are only 29.79% and 51.79% of the original while maintaining the detection accuracy of the stego images, which reduces the spatio-temporal cost of classifier training.
In order to compare the selection of DCTR steganalysis feature by S-FUND method more visually, the feature dimension and detection accuracy before and after selection are shown in Figure 2 below.
Figure 2. Comparison of the S-FUND method for DCTR feature selection before and after selection.
In Figure 2 , the horizontal axis represents threshold value and the vertical axis represents the corresponding feature dimension and detection accuracy, and the five lines from top to bottom represent the effects of the DCTR features selected at five different payloads, and the points of optimal performance at each payload are processed and labeled with values. It can be clearly seen from the figure that the S-FUND method can maintain or even improve the detection accuracy of DCTR feature while significantly reducing the feature dimension, which proves the effectiveness of the S-FUND method.
5.3. Comparison Experiment with Random-D Method
In order to make a fair comparison between the different methods, the experimental setup of this comparison experiment is the same as in Section 5.1 . For different payloads, the following is a comparison of the detection accuracy of the selected features of S-FUND method and the selected features of Random-D method for the stego images. We let the feature dimensions selected by the Random-D method be equal to the corresponding feature dimensions selected by S-FUND method, and compare their detection accuracy; the comparison results are shown in Table 4 .
Table 4. Comparison of experimental results before and after feature selection based on the S-FUND method.
It can be seen from Table 4 that the S-FUND method has better detection accuracy than Random-D method when DCTR feature is reduced to the same dimension at different payloads. For example, when payload = 0.3, the detection accuracy of the features selected by the S-FUND method is 0.52%, 0.61%, 0.83%, 0.97%, 0.98% and 0.98% higher than that of the Random-D method by reducing the feature dimension to 5653, 4745, 3801, 2750, 1826 and 848 dimensions, respectively.
In order to compare the effects of S-FUND method and Random-D method on the selection of DCTR feature more visually, we created Figure 3 based on Table 4 .
Figure 3. Comparison with Random-D method selected DCTR feature.
In Figure 3 , the horizontal axis represents the number of feature dimensions, and the vertical axis represents the corresponding detection accuracy. Five line graphs from top to bottom represent the effects of DCTR features selected by S-FUND and Random-D selection at five different payloads. From Figure 3 , we can see that the S-FUND method has better detection accuracy than the Random-D method at different payloads.
Additionally, we found that as the number of selected features decreases, the difference in detection accuracy between the two methods of the stego images increases. For example, when payload = 0.1, the difference between the two methods increases from 0.32% to 1.3%. The reason for this phenomenon may be the following: as the number of selected features decreases, the useful features will more likely be deleted by Random-D, while the useless features will be deleted by S-FUND. Therefore, as the number of selected decreases, the difference between the detection accuracy of the stego images based on the features selected by S-FUND method and Random-D selection method will increase.
5.4. Comparison Experiment with CGSM Method
Wang et al. [
35
] proposed a method for steganalysis feature selection based on the difference function and Pearson’s correlation coefficient. The method first presents a difference function-based feature measurement algorithm to measure the difference between the cover and stego features. Afterwards, the Pearson correlation coefficient is improved to measure the correlation between the feature components and the image classification result. Finally, the feature component with large difference function is selected and the feature component with small Pearson correlation coefficient is deleted. This method is able to select the effective feature components to improve the detection performance of the stego images, however, there is a sequence between the two algorithms, which makes it difficult to avoid selecting useless features or deleting valuable features.
For the DCTR steganalysis feature with different payloads, the following is a comparison between the S-FUND method and the CGSM method when the same feature dimensions are selected, and the comparison results are shown in Table 5 .
Table 5. Comparison of experimental results with CGSM-selected DCTR feature.
It can be seen from Table 5 that S-FUND method has better detection accuracy than CGSM method when the selected DCTR feature is reduced to the same dimensions by both the S-FUND method and the CGSM method at different payloads. For example, when payload = 0.1, the detection accuracy of selected features of the stego images by S-FUND method is 0.12%, 0.43%, 0.56%, 0.89%, 1.16% and 1.6% higher than that of CGSM method when the feature dimension is reduced to 5791, 4826, 3936, 2872, 2015 and 849.
In order to compare the selection effects of S-FUND and CGSM methods on the DCTR steganalysis features more visually, we made Figure 4 based on Table 5 .
Figure 4. Comparison with CGSM method selected DCTR feature.
In
Figure 4
, the horizontal axis represents the feature dimension and the vertical axis represents the corresponding detection accuracy. Five line graphs from top to bottom represent the effects of S-FUND and CGSM methods for selecting DCTR feature at five different payloads. From
Figure 4
, it can be seen that the S-FUND method has better detection accuracy than the CGSM method when both methods are reduced to the same dimensions under different payloads. Simultaneously, as the number of selected features decreases at different payloads, the difference in detection accuracy between the two methods increases—for example, when payload = 0.1, the difference in detection accuracy between the two methods increases from 0.12% to 1.6%.
Furthermore, we found that the difference in detection accuracy of the stego images between the features selected by the two selection methods is greater at high payloads. For example, when payload = 0.1, 0.2, 0.3, 0.4 and 0.5, the differences are 1.6%, 1.6%, 1.85%, 2.25% and 1.87%, respectively. The reason for this phenomenon may be that more information is embedded in the high payload, and the difference between the cover and stego features is larger, which makes it easier to detect the stego images with the features selected by S-FUND method. Therefore, at high payloads, the difference in detection accuracy of the stego images with the features selected by S-FUND method is larger than that of CGSM method.
5.5. Comparison Experiment with the PCA-D Method
Qin et al. [
33
] proposed the PCA-D method which has no parameter restrictions, is simple to use, and the results are easier to understand. However, the method is not efficient and is less effective for data with nonlinear structure. The main process is: Firstly, each feature component is subtracted from its respective mean. Secondly, the covariance matrix and the eigenvalues and eigenvectors of the covariance matrix are calculated. Thirdly, the feature values are sorted in descending order. Finally, the number of principal components (the number of selected feature components) is determined, and the feature component is selected as the final selected feature vector, and the comparison experimental results between the S-FUND and the PCA-D methods are shown in
Table 6
.
Table 6. Comparison of experimental results with PCA-D-selected DCTR feature.
As can be seen from
Table 6
, the DCTR features selected by S-FUND methods have better detection accuracy than those selected by PCA-D method for the cover images when the DCTR feature is reduced to the same dimensions at different payloads by the two methods. For example, when payload = 0.2, the detection accuracy of S-FUND method is 0.02%, 1.83%, 0.95% and 1.2% higher than that of the PCA-D method when the feature is reduced to 5739, 4790, 3870 and 2790 dimensions, respectively. When payload = 0.4, using the two methods, the detection accuracy of the features selected by S-FUND method is 2.39%, 2.85%, 1.79% and 0.87% higher than that of the PCA-D method by reducing the feature dimensions to 5531, 4608, 3690 and 2664 dimensions, respectively.
In order to compare more intuitively the effects of the selected features of S-FUND and PCA-D methods for DCTR feature, we created Figure 5 based on Table 6 .
Figure 5. Comparison with PCA-D-method-selected DCTR feature.
In
Figure 5
, the horizontal axis represents the feature dimension, the vertical axis represents the corresponding detection accuracy, and the five line graphs from top to bottom represent the effects of S-FUND and PCA-D methods for selecting DCTR feature at five different payloads. From
Figure 5
, it can be seen that the S-FUND method has better detection accuracy than the PCA-D method when the two methods are reduced to the same dimension at different payloads. For example, when payload = 0.1, the feature dimensions selected by the two methods are 5791 and 2435, and the differences in detection accuracy are 1.54% and 0.95%. When payload = 0.3, the feature dimensions selected by the two methods are 5653 and 2280 and the differences in detection accuracy are 2.00% and 0.51%. When payload = 0.5, the feature dimensions selected by the two methods are 5192 and 2621, and the differences in detection accuracy are 4.25% and 1.23%.
6. Discussion
The S-FUND method has also been used in other steganalysis feature selection experiments, such as CC-JRM. Therefore, the method in this paper is a general feature selection method for steganalysis. It is worth mentioning that the contribution of this paper is not only the introduction of distortion and information gain ratio to measure the difference of feature components between the cover and stego images, but also the idea that the two criteria are considered at the same time.
Last but not least, since this work considers the two criteria at the same time, they need to measure the same kind of criteria, that is, they either measure the contribution degree, or both measure the degree of similarity, or both measure redundancy, and so on. The different kinds of criteria in this task force have certain limitations. Regarding the CGSM method and the SRGS method, one involves measuring the similarity between the feature components, and the other measuring the uselessness of the feature component. Such criteria cannot be applied by this paper. In the next work, we are expected to propose a novel method for different kinds of standards. When the kinds of criterion are different, the combination of the these can be carried out—this method considers to combine the similarity between feature components and the value of the component. Among the two feature components with similarity, the component with a small contribution is deleted.
7. Conclusions
In order to effectively reduce the number of DCTR steganalysis feature while maintaining or even improving the detection accuracy of the stego images, this paper proposes a feature selection approach based on distortion factor and information gain ratio. First, the distortion factor and information gain ratio are improved to measure the difference of each steganalysis feature component between the cover and stego images. Second, two measurement values of each feature component are arranged in descending order. Based on the above, the feature components with large different ranking according to the two measurements are deleted. Finally, the preserved feature components are used as the final feature vector. This approach can effectively reduce the DCTR feature dimension while maintaining or even improving the detection accuracy of the stego images, thus reducing the spatial complexity of detecting the stego images. Moreover, by comparing the time complexity of S-FUND method and the selection method that relies on the FLD classifier results, it is demonstrated that the approach in this paper can greatly improve the operational efficiency, thus reducing the time complexity of the classifier to detect the stego images and reducing the cost of detection.
We have conducted a large number of comparison experiments to indicate that DCTR feature selected by S-FUND method substantially reduce the feature dimension while maintaining or even improving the detection accuracy of the stego images. And then, we compared S-FUND method with Random-D, CGSM, and PCA-D methods to indicate that the features selected by S-FUND method are more detection accurate of the stego images. For example, in the comparison experiments with PCA-D method, the features selected by the S-FUND method up to 4.25% more higher than PCA-D method for the stego images.
Author Contributions
Conceptualization, R.J., T.L. and Y.M.; methodology, Y.W.; validation, X.D. and Y.M.; formal analysis, X.D. and T.L.; investigation, Y.W.; resources, Y.W. and Y.M.; data curation, Y.W.; writing—original draft preparation, Y.W.; writing—review and editing, Y.W.; visualization, Y.M.; supervision, R.J. and Y.M.; project administration, R.J.; funding acquisition, R.J. and Y.M. All authors have read and agreed to the published version of the manuscript.
Funding
This work was supported in part by the National Natural Science Foundation of China under Grant (NO.61772176, NO.62002103, NO.61976082), by the Key Scientific and Technological Project of Henan Province under Grant NO.202102210165, by the Training Plan of young backbone teachers in colleges and universities of Henan Province under Grant NO.2017GGJS214, by the Key Scientific Research Project of Henan Provincial Higher Education under Grant (NO.19B510005, NO.20B413004), by the Key Scientific Research (Soft Science) Project of Higher Education Institutions of Henan Province under Grant NO.19A880030, and by the Key R&D and Promotion Special (Soft Science) Project of Henan Province under Grant (NO.202400410088, NO.212400410109).
Conflicts of Interest
The authors declare no conflict of interest.
References
Fridrich, J.; Pevný, T.; Kodovský, J. Statistically Undetectable JPEG Steganography: Dead Ends, Challenges, and Opportunities. In Proceedings of the 9th ACM Multimedia and Security Workshop, Dallas, TX, USA, 20–21 September 2007; pp. 3–14. [ Google Scholar ]
Sarkar, A.; Solanki, K.; Manjunath, B.S. Further Study on YASS: Steganography Based on Randomized Embedding to Resist Blind Steganalysis. In Proceedings of the Security, Forensics, Steganography, and Watermarking of Multimedia Contents X, San Jose, CA, USA, 27–31 January 2008. [ Google Scholar ]
Sachnev, V.; Kim, H.J.; Zhang, R.Y. Less Detectable JPEG Steganography Method Based on Heuristic Optimization and BCH Syndrome Coding. In Proceedings of the 11th ACM Workshop on Multimedia and Security, Princeton, NJ, USA, 7–8 September 2009; p. 131. [ Google Scholar ]
Filler, T.; Fridrich, J. Gibbs Construction in Steganography. IEEE Trans. Inf. Forensics Secur. 2010 , 5 , 705–720. [ Google Scholar ] [ CrossRef ][ Green Version ]
Holub, V.; Fridrich, J. Designing Steganographic Distortion Using Directional Filters. In Proceedings of the IEEE Workshop on Information Forensic and Security, Costa Adeje, Spain, 2–5 December 2012. [ Google Scholar ]
Holub, V.; Fridrich, J.; Denemark, T. Universal Distortion Function for Steganography in an Arbitrary Domain. EURASIP J. Inf. Secur. 2014 , 1 , 1–13. [ Google Scholar ] [ CrossRef ][ Green Version ]
Liao, X.; Yu, Y.B.; Li, B. A New Payload Partition Strategy in Color Image Steganography. IEEE Trans. Circuits Syst. Video Technol. 2020 , 30 , 685–696. [ Google Scholar ] [ CrossRef ]
Sedighi, V.; Cogranne, R.; Fridrich, J. Content-Adaptive Steganography by Minimizing Statistical Detectability. IEEE Trans. Inf. Forensics Secur. 2016 , 11 , 221–234. [ Google Scholar ] [ CrossRef ][ Green Version ]
Luo, W.Q.; Huang, F.J.; Huang, J.W. Edge Adaptive Image Steganography Based on LSB Matching Revisited. IEEE Trans. Inf. Forensics Secur. 2010 , 5 , 201–214. [ Google Scholar ]
Lu, W.; Chen, J.J.; Zhang, J.H. Secure Halftone Image Steganography Based on Feature Space and Layer Embedding. IEEE Trans. Cybern. 2020 , 99 , 1–14. [ Google Scholar ] [ CrossRef ] [ PubMed ]
Cheddad, A.; Condell, J.; Curran, K. Digital Image Steganography: Survey and Analysis of Current Methods. Signal Process. 2010 , 90 , 727–752. [ Google Scholar ] [ CrossRef ][ Green Version ]
Qin, C.; Chang, C.C.; Huang, Y.-H. An Inpainting-Assisted Reversible Steganographic Scheme Using a Histogram Shifting Mechanism. IEEE Trans. Circuits Syst. Video Technol. 2013 , 23 , 1109–1118. [ Google Scholar ] [ CrossRef ]
Filler, T.; Judas, J.; Fridrich, J. Minimizing Additive Distortion in Steganography Using Syndrome-Trellis Codes. IEEE Trans. Inf. Forensics Secur. 2011 , 6 , 920–935. [ Google Scholar ] [ CrossRef ][ Green Version ]
Fridrich, J.; Goljan, M.; Lisonek, P. Writing on Wet Paper. IEEE Trans. Signal Process. 2005 , 53 , 3923–3935. [ Google Scholar ] [ CrossRef ]
Zhang, R.; Zhu, F.; Liu, J. Depth-Wise Separable Convolutions and Multi-Level Pooling for an Efficient Spatial CNN-Based Steganalysis. IEEE Trans. Inf. Forensics Secur. 2020 , 15 , 1138–1150. [ Google Scholar ] [ CrossRef ]
Ye, J.; Ni, J.Q.; Yi, Y. Deep Learning Hierarchical Representations for Image Steganalysis. IEEE Trans. Inf. Forensics Secur. 2017 , 12 , 2545–2557. [ Google Scholar ] [ CrossRef ]
Avcibas, I.; Memon, N.; Sankur, B. Steganalysis Using Image Quality Metrics. IEEE Trans. Image Process. 2003 , 12 , 221–229. [ Google Scholar ] [ CrossRef ][ Green Version ]
Li, Z.Y.; Bors, A.G. Selection of Robust and Relevant Features for 3-D Steganalysis. IEEE Trans. Cybern. 2020 , 50 , 1989–2001. [ Google Scholar ] [ CrossRef ] [ PubMed ][ Green Version ]
Denemark, T.; Boroumand, M.; Fridrich, J. Steganalysis Features for Content-Adaptive JPEG Steganography. IEEE Trans. Inf. Forensics Secur. 2016 , 11 , 1747–1757. [ Google Scholar ] [ CrossRef ]
Luo, X.Y.; Liu, F.L.; Lian, S.G. On the Typical Statistic Features for Image Blind Steganalysis. IEEE J. Sel. Areas Commun. 2011 , 29 , 1404–1422. [ Google Scholar ] [ CrossRef ]
Ker, A. Steganalysis of LSB Matching in Grayscale Images. IEEE Signal Process. Lett. 2005 , 12 , 441–444. [ Google Scholar ] [ CrossRef ][ Green Version ]
Lyu, S.; Farid, H. Steganalysis Using Higher-order Image Statistics. IEEE Trans. Inf. Forensics Secur. 2006 , 1 , 111–119. [ Google Scholar ] [ CrossRef ]
Holub, V.; Fridrich, J. Random Projections of Residuals for Digital Image Steganalysis. IEEE Trans. Inf. Forensics Secur. 2013 , 8 , 1996–2006. [ Google Scholar ] [ CrossRef ]
Lie, W.; Lin, G. A Feature-based Classification Technique for Blind Image Steganalysis. IEEE Trans. Multimed. 2005 , 7 , 1007–1020. [ Google Scholar ]
Sullivan, K.; Madhow, U.; Chandrasekaran, S. Steganalysis for Markov cover data with applications to images. IEEE Trans. Inf. Forensics Secur. 2006 , 1 , 275–287. [ Google Scholar ] [ CrossRef ]
Yuan, C.S.; Xia, Z.H.; Sun, X.M. Coverless Image Steganography Based on SIFT and BOF. J. Internet Technol. 2017 , 18 , 437–442. [ Google Scholar ]
Holub, V.; Fridrich, J. Low Complexity Features for JPEG Steganalysis Using Undecimated DCT. IEEE Trans. Inf. Forensics Secur. 2015 , 10 , 219–228. [ Google Scholar ] [ CrossRef ]
Song, X.F.; Liu, F.L.; Yang, C.F. Steganalysis of Adaptive JPEG Steganography Using 2D Gabor Filters. In Proceedings of the 3rd ACM Workshop on Information Hiding and Multimedia Security, Portland, OR, USA, 17–19 June 2015; pp. 15–23. [ Google Scholar ]
Kodovský, J.; Fridrich, J. Steganalysis of JPEG Images Using Rich Models. In Proceedings of the SPIE, Electronic Imaging, Media Watermarking, Security, and Forensics XIV, Burlingame, CA, USA, 22–26 January 2012. [ Google Scholar ]
Pevný, T.; Fridrich, J. Merging Markov and DCT Features for Multiclass JPEG Steganalysis. In Proceedings of the SPIE, Electronic Imaging, Security, Steganography, and Watermarking of Multimedia Contents IX, San Jose, CA, USA, 28 January–1 February 2007; pp. 1–14. [ Google Scholar ]
Kodovský, J.; Fridrich, J. Calibration Revisited. In Proceedings of the 11th ACM Multimedia and Security Workshop, Princeton, NJ, USA, 7–8 September 2009; pp. 63–74. [ Google Scholar ]
Qin, J.H.; Sun, X.M.; Xiang, X.Y. Principal Feature Selection and Fusion Method for Image Steganalysis. J. Electron. Imaging 2008 , 18 , 033009. [ Google Scholar ]
Ma, Y.Y.; Luo, X.Y.; Li, X.L. Selection of Rich Model Steganalysis Features Based on Decision Rough Set α -Positive Region Reduction. IEEE Trans. Circuits Syst. Video Technol. 2019 , 29 , 336–350. [ Google Scholar ] [ CrossRef ]
Wang, Y.H.; Ma, Y.Y.; Jin, R.X.; Liu, P.; Ruan, N. Comprehensive Criteria-Based Generalized Steganalysis Feature Selection Method. IEEE Access 2020 , 8 , 154418–154435. [ Google Scholar ] [ CrossRef ]
Yang, C.F.; Zhang, Y.; Wang, P. Steganalysis Feature Subspace Selection Based on Fisher Criterion. In Proceedings of the IEEE International Conference on Data Science and Advanced Analytics, Tokyo, Japan, 19–21 October 2017; pp. 514–521. [ Google Scholar ]
Yu, X.Q.; Ma, Y.Y.; Jin, R.X.; Xu, L.G.; Duan, X.T. A multi-scale Feature Selection Method for Steganalytic Feature GFR. IEEE Access 2020 , 8 , 55063–55075. [ Google Scholar ] [ CrossRef ]
Ortega, A.; Ramchandran, K. Rate-distortion Methods for Image and Video Compression. IEEE Signal Process. Mag. 2002 , 15 , 23–50. [ Google Scholar ] [ CrossRef ]
Dai, J.H.; Xu, Q. Attribute Selection Based on Information Gain Ratio in Fuzzy Rough Set Theory with Application to Tumor Classification. Appl. Soft Comput. 2013 , 13 , 211–221. [ Google Scholar ] [ CrossRef ]
Kodovský, J.; Fridrich, J.; Holub, V. Ensemble Classifiers for Steganalysis of Digital Media. IEEE Trans. Inf. Forensics Secur. 2012 , 7 , 432–444. [ Google Scholar ] [ CrossRef ][ Green Version ]
Figure 1. Process of the S-FUND method.
Figure 2. Comparison of the S-FUND method for DCTR feature selection before and after selection.
Figure 3. Comparison with Random-D method selected DCTR feature.
Figure 4. Comparison with CGSM method selected DCTR feature.
Figure 5. Comparison with PCA-D-method-selected DCTR feature.
Table 1. Time complexity analysis of the specific steps and other classic methods.
Steps/Method Step/Algorithm/Reference Time Complexity Calculate distortion factor Steps 1–6 O ( N n ) Calculate infor gain ratio Steps 8–15 O ( N n ) Descend order by distortion Step 7 O ( N log 2 N ) Descend order by infor gain ratio Step 16 O ( N log 2 N ) Delete feature components Steps 17–21 O ( N ) Preserve of eligible components Step 22 O ( k ) S-FUND method Algorithm 1 O ( N n ) or O ( N log 2 N ) PCA-D method [ 33 ] O ( N 3 ) Steganalysis- α method [ 34 ] O ( L N trn d sub 2 ) + O ( L d sub 3 ) CGSM method [ 35 ] O ( N n ) or O ( N log 2 N ) Fisher-G method [ 36 ] O ( N 2 ) SRGS method [ 37 ] O ( N 2 m )
Table 2. Experimental subject setup.
Subject Image library Image pixel Image type Image format Setup BOSSbase 1.01 512 × 512 Grayscale image JPEG Subject Quality factor Payloads Steganography Extraction Setup 95 0.1, 0.2, 0.3, 0.4, 0.5 SI-UNIWARD [ 6 ] DCTR [ 27 ] Subject Number of covers Number of stegos Training features Testing features Setup 10,000 × 1 10,000 × 5 10,000 ÷ 2 10,000 ÷ 2 Number of steganalysis features 10,000 × (1 + 5) = 60,000
Table 3. Comparison of experimental results before and after feature selection based on the S-FUND method.
Payload Dim/ P A ¯ Origin 0.15 0.14 0.13 0.12 0.11 0.10 0.09 0.08 0.07 0.06 0.05 0.04 0.03 0.02 0.01 0.1 Dim 8000 5791 5601 5378 5114 4826 4538 4255 3936 3623 3254 2872 2435 2015 1451 849 P A ¯ 0.5239 0.5253 0.5265 0.5256 0.5254 0.5268 0.5270 0.5262 0.5257 0.5253 0.5251 0.5246 0.5239 0.5221 0.5208 0.5202 0.2 Dim 8000 5739 5552 5320 5062 4790 4497 4184 3870 3539 3178 2790 2383 1895 1347 822 P A ¯ 0.5256 0.5289 0.5290 0.5272 0.5290 0.5297 0.5305 0.5302 0.5289 0.5278 0.5276 0.5272 0.5260 0.5244 0.5228 0.5200 0.3 Dim 8000 5653 5434 5224 5001 4745 4446 4143 3801 3452 3106 2750 2280 1826 1352 848 P A ¯ 0.5385 0.5395 0.5394 0.5392 0.5380 0.5374 0.5395 0.5385 0.5364 0.5355 0.5355 0.5352 0.5340 0.5318 0.5287 0.5252 0.4 Dim 8000 5531 5310 5085 4873 4608 4317 4013 3690 3339 3036 2664 2275 1778 1332 813 P A ¯ 0.5700 0.5689 0.5692 0.5698 0.5676 0.5673 0.5666 0.5643 0.5648 0.5624 0.5596 0.5580 0.5563 0.5521 0.5472 0.5414 0.5 Dim 8000 5192 4971 4758 4548 4315 4055 3789 3530 3261 2953 2621 2181 1756 1304 807 P A ¯ 0.6291 0.6219 0.6221 0.6196 0.6182 0.6204 0.6172 0.6150 0.6137 0.6119 0.6108 0.6089 0.5900 0.5892 0.5803 0.5740
Table 4. Comparison of experimental results before and after feature selection based on the S-FUND method.
Table 5. Comparison of experimental results with CGSM-selected DCTR feature.
Dim 0.1 Dim 0.2 Dim 0.3 Dim 0.4 Dim 0.5 CGSM S-FUND CGSM S-FUND CGSM S-FUND CGSM S-FUND CGSM S-FUND 5791 0.5241 0.5253 5739 0.5246 0.5289 5653 0.5372 0.5395 5531 0.5682 0.5689 5192 0.6218 0.6219 5601 0.5234 0.5265 5552 0.5252 0.5290 5434 0.5384 0.5394 5310 0.5679 0.5692 4971 0.6214 0.6221 5378 0.5231 0.5256 5320 0.5243 0.5272 5224 0.5355 0.5392 5085 0.5666 0.5698 4758 0.6195 0.6196 5114 0.5222 0.5254 5062 0.5236 0.5290 5001 0.5369 0.5380 4873 0.5641 0.5676 4548 0.6183 0.6182 4826 0.5225 0.5268 4790 0.5256 0.5297 4745 0.5360 0.5374 4608 0.5642 0.5673 4315 0.6166 0.6204 4538 0.5211 0.5270 4497 0.5227 0.5305 4446 0.5340 0.5395 4317 0.5614 0.5666 4055 0.6141 0.6172 4255 0.5219 0.5262 4184 0.5227 0.5302 4143 0.5340 0.5385 4013 0.5588 0.5643 3789 0.6097 0.6150 3936 0.5201 0.5257 3870 0.5238 0.5289 3801 0.5344 0.5364 3690 0.5569 0.5648 3530 0.6056 0.6137 3623 0.5199 0.5253 3539 0.5239 0.5278 3452 0.5321 0.5355 3339 0.5556 0.5624 3261 0.6019 0.6119 3254 0.5185 0.5251 3178 0.5216 0.5276 3106 0.5309 0.5355 3036 0.5504 0.5596 2953 0.5963 0.6108 2872 0.5157 0.5246 2790 0.5186 0.5272 2750 0.5270 0.5352 2664 0.5449 0.5580 2621 0.5892 0.6089 2435 0.5132 0.5239 2383 0.5154 0.5260 2280 0.5214 0.5340 2275 0.5401 0.5563 2181 0.5854 0.5900 2015 0.5105 0.5221 1895 0.5136 0.5244 1826 0.5210 0.5318 1778 0.5329 0.5521 1756 0.5784 0.5892 1451 0.5063 0.5208 1347 0.5061 0.5228 1352 0.5142 0.5287 1332 0.5284 0.5472 1304 0.5691 0.5803 849 0.5042 0.5202 822 0.5040 0.5200 848 0.5067 0.5252 813 0.5189 0.5414 807 0.5553 0.5740
Table 6. Comparison of experimental results with PCA-D-selected DCTR feature.
Dim 0.1 Dim 0.2 Dim 0.3 Dim 0.4 Dim 0.5 PCA-D S-FUND PCA-D S-FUND PCA-D S-FUND PCA-D S-FUND PCA-D S-FUND 5791 0.5099 0.5253 5739 0.5089 0.5289 5653 0.5201 0.5395 5531 0.5450 0.5689 5192 0.5796 0.6219 5601 0.5111 0.5265 5552 0.5147 0.5290 5434 0.5209 0.5394 5310 0.5409 0.5692 4971 0.5840 0.6221 5378 0.5070 0.5256 5320 0.5117 0.5272 5224 0.5197 0.5392 5085 0.5408 0.5698 4758 0.5776 0.6196 5114 0.5099 0.5254 5062 0.5118 0.5290 5001 0.5225 0.5380 4873 0.5396 0.5676 4548 0.5846 0.6182 4826 0.5148 0.5268 4790 0.5114 0.5297 4745 0.5211 0.5374 4608 0.5388 0.5673 4315 0.5867 0.6204 4538 0.5148 0.5270 4497 0.5199 0.5305 4446 0.5264 0.5395 4317 0.5457 0.5666 4055 0.5874 0.6172 4255 0.5070 0.5262 4184 0.5172 0.5302 4143 0.5202 0.5385 4013 0.5461 0.5643 3789 0.5904 0.6150 3936 0.5133 0.5257 3870 0.5194 0.5289 3801 0.5215 0.5364 3690 0.5469 0.5648 3530 0.5865 0.6137 3623 0.5143 0.5253 3539 0.5169 0.5278 3452 0.5262 0.5355 3339 0.5475 0.5624 3261 0.5911 0.6119 3254 0.5147 0.5251 3178 0.5159 0.5276 3106 0.5241 0.5355 3036 0.5493 0.5596 2953 0.5889 0.6108 2872 0.5156 0.5246 2790 0.5152 0.5272 2750 0.5293 0.5352 2664 0.5493 0.5580 2621 0.5966 0.6089 2435 0.5144 0.5239 2383 0.5188 0.5260 2280 0.5289 0.5340 2275 0.5511 0.5563 2181 0.5894 0.5900
| https://www.mdpi.com/2073-8994/13/10/1775/html |
The Science of Sarcasm? Yeah, Right | Science| Smithsonian Magazine
How do humans separate sarcasm from sincerity? Research on the subject is leading to insights about how the mind works. Really
SCIENCE
The Science of Sarcasm? Yeah, Right
In an episode of "The Simpsons," Professor Frink, left, demonstrates his latest creation: a sarcasm detector. ©2003 THE SIMPSONS and TTCFFC ALL RIGHTS RESERVED FOX
In an episode of “The Simpsons,” mad scientist Professor Frink demonstrates his latest creation: a sarcasm detector.
“Sarcasm detector? That’s a reallyuseful invention,” says another character, the Comic Book Guy, causing the machine to explode.
Actually, scientists are finding that the ability to detect sarcasm really is useful. For the past 20 years, researchers from linguists to psychologists to neurologists have been studying our ability to perceive snarky remarks and gaining new insights into how the mind works. Studies have shown that exposure to sarcasm enhances creative problem solving, for instance. Children understand and use sarcasm by the time they get to kindergarten. An inability to understand sarcasm may be an early warning sign of brain disease.
Sarcasm detection is an essential skill if one is going to function in a modern society dripping with irony. “Our culture in particular is permeated with sarcasm,” says Katherine Rankin, a neuropsychologist at the University of California at San Francisco. “People who don’t understand sarcasm are immediately noticed. They’re not getting it. They’re not socially adept.”
Sarcasm so saturates 21st-century America that according to one study of a database of telephone conversations, 23 percent of the time that the phrase “yeah, right” was used, it was uttered sarcastically. Entire phrases have almost lost their literal meanings because they are so frequently said with a sneer. “Big deal,” for example. When’s the last time someone said that to you and meant it sincerely? “My heart bleeds for you” almost always equals “Tell it to someone who cares,” and “Aren’t you special” means you aren’t.
“It’s practically the primary language” in modern society, says John Haiman, a linguist at Macalester College in St. Paul, Minnesota, and the author of Talk is Cheap: Sarcasm, Alienation and the Evolution of Language.
Sarcasm seems to exercise the brain more than sincere statements do. Scientists who have monitored the electrical activity of the brains of test subjects exposed to sarcastic statements have found that brains have to work harder to understand sarcasm.
That extra work may make our brains sharper, according to another study. College students in Israel listened to complaints to a cellphone company’s customer service line. The students were better able to solve problems creatively when the complaints were sarcastic as opposed to just plain angry. Sarcasm “appears to stimulate complex thinking and to attenuate the otherwise negative effects of anger,” according to the study authors.
The mental gymnastics needed to perceive sarcasm includes developing a “theory of mind” to see beyond the literal meaning of the words and understand that the speaker may be thinking of something entirely different. A theory of mind allows you to realize that when your brother says “nice job” when you spill the milk, he means just the opposite, the jerk.
Sarcastic statements are sort of a true lie. You’re saying something you don’t literally mean, and the communication works as intended only if your listener gets that you’re insincere. Sarcasm has a two-faced quality: it’s both funny and mean. This dual nature has led to contradictory theories on why we use it.
Some language experts suggest sarcasm is used as a sort of gentler insult, a way to tone down criticism with indirectness and humor. “How do you keep this room so neat?” a parent might say to a child, instead of “This room is a sty.”
But others researchers have found that the mocking, smug, superior nature of sarcasm is perceived as more hurtful than a plain-spoken criticism. The Greek root for sarcasm, sarkazein, means to tear flesh like dogs.
According to Haiman, dog-eat-dog sarcastic commentary is just part of our quest to be cool. “You’re distancing yourself, you’re making yourself superior,” Haiman says. “If you’re sincere all the time, you seem naive.”
Sarcasm is also a handy tool. Most of us go through life expecting things to turn out well, says Penny Pexman, a University of Calgary psychologist who has been studying sarcasm for more than 20 years. Otherwise, no one would plan an outdoor wedding. When things go sour, Pexman says, a sarcastic comment is a way to simultaneously express our expectation as well as our disappointment. When a downpour spoils a picnic and you quip, “We picked a fine day for this,” you’re saying both that you had hoped it would be sunny and you’re upset about the rain.
We’re more likely to use sarcasm with our friends than our enemies, Pexman says. “There does seem to be truth to the old adage that you tend to tease the ones you love,” she says.
In an episode of "The Simpsons," the Comic Book Guy's sarcasm causes Professor Frink's sarcasm detector to implode. ©2003THE SIMPSONS and TTCFFC ALL RIGHTS RESERVED FOX
But among strangers, sarcasm use soars if the conversation is via an anonymous computer chat room as opposed to face to face, according to a study by Jeffrey Hancock, a communications professor at Cornell University. This may be because it’s safer to risk some biting humor with someone you’re never going to meet. He also noted that conversations typed on a computer take more time than a face to face discussion. People may use that extra time to construct more complicated ironic statements.
Pexman said she has encountered children as young as 4 who say, “smooth move, mom” at a parent’s mistake. And she says parents who report being sarcastic themselves have kids who are better at understanding sarcasm.
There appear to be regional variations in sarcasm. A study that compared college students from upstate New York with students from near Memphis, Tennessee, found that the Northerners were more likely to suggest sarcastic jibes when asked to fill in the dialogue in a hypothetical conversation.
Northerners also were more likely to think sarcasm was funny: 56 percent of Northerners found sarcasm humorous while only 35 percent of Southerners did. The New Yorkers and male students from either location were more likely to describe themselves as sarcastic.
There isn’t just one way to be sarcastic or a single sarcastic tone of voice. In his book, Haiman lists more than two dozen ways that a speaker or a writer can indicate sarcasm with pitch, tone, volume, pauses, duration and punctuation. For example: “Excuse me” is sincere. “Excuuuuuse me” is sarcastic, meaning, “I’m not sorry.”
According to Haiman, a sarcastic version of “thank you” comes out as a nasal “thank yewww” because speaking the words in a derisive snort wrinkles up your nose into an expression of disgust. That creates a primitive signal of insincerity, Haiman says. The message: These words taste bad in my mouth and I don’t mean them.
In an experiment by Patricia Rockwell, a sarcasm expert at the University of Louisiana at Lafayette, observers watched the facial expressions of people making sarcastic statements. Expressions around the mouth, as opposed to the eyes or eyebrows, were most often cited as a clue to a sarcastic statement.
The eyes may also be a giveaway. Researchers from California Polytechnic University found that test subjects who were asked to make sarcastic statements were less likely to look the listener in the eye. The researchers suggest that lack of eye contact is a signal to the listener: “This statement is a lie.”
Another experiment that analyzed sarcasm in American TV sitcoms asserted that there’s a “blank face” version of sarcasm delivery.
Despite all these clues, detecting sarcasm can be difficult. There are a lot of things that can cause our sarcasm detectors to break down, scientists are finding. Conditions including autism, closed head injuries, brain lesions and schizophrenia can interfere with the ability to perceive sarcasm.
Researchers at the University of California at San Francisco, for example, recently found that people with frontotemporal dementia have difficulty detecting sarcasm. Neuropsychologist Katherine Rankin has suggested that a loss of the ability to pick up on sarcasm could be used as an early warning sign to help diagnose the disease. “If someone who has the sensitivity loses it, that’s a bad sign,” Rankin says. “If you suddenly think Stephen Colbert is truly right wing, that’s when I would worry.”
Many parts of the brain are involved in processing sarcasm, according to recent brain imaging studies. Rankin has found that the temporal lobes and the parahippocampus are involved in picking up the sarcastic tone of voice. While the left hemisphere of the brain seems to be responsible for interpreting literal statements, the right hemisphere and both frontal lobes seem to be involved in figuring out when the literal statement is intended to mean exactly the opposite, according to a study by researchers at the University of Haifa.
Or you could just get a sarcasm detection device. It turns out scientists can program a computer to recognize sarcasm. Last year, Hebrew University computer scientists in Jerusalem developed their “Semi-supervised Algorithm for Sarcasm Identification.” The program was able to catch 77 percent of the sarcastic statements in Amazon purchaser comments like “Great for insomniacs” in a book review. The scientists say that a computer that could recognize sarcasm could do a better job of summarizing user opinions in product reviews.
The University of Southern California’s Signal Analysis and Interpretation Laboratory announced in 2006 that their “automatic sarcasm recognizer,” a set of computer algorithms, was able to recognize sarcastic versions of “yeah, right” in recorded telephone conversations more than 80 percent of the time. The researchers suggest that a computerized phone operator that understands sarcasm can be programmed to “get” the joke with “synthetic laughter.”
Now that really would be a useful invention. Yeah, right.
| https://www.smithsonianmag.com/science-nature/the-science-of-sarcasm-yeah-right-25038/?all&no-ist |
Where to start developing FTP client for WINCE? | Forum for Electronics
Hi, I am to develop an FTP client to windowsCE which should be integrated into an application - do anybody of you know where i should start ? and is...
Where to start developing FTP client for WINCE?
Hi, I am to develop an FTP client to windowsCE which should be integrated into an application - do anybody of you know where i should start ? and is there any resources available out there for developers ? I know the RFC's - i were wondering about something a little more precise, snippets and specifically targeted on CE. CE 5.0 - developing in C/C++ Does anyone know where I can find an FTP client for Windows CE? Is there an FTP client API available for Windows CE? While an FTP client is documented in the Windows CE help, no FTP client actually ships with OEM devices. I have heard two explanations for this. One, given at CE DevCon 99, was that it was up to the OEM to ship or leave out FTP support, and most left it out. The other is mentioned in the CE documentation. While FTP functions are documented, there is a statement in the remarks section: "Inetftp.dll is available only for Intel x86 processors." pls help me with some suggestions. thanks®ards john
wince ftp Win32 simple FTP client.
ftps006.zip hi tcsa 35 can you provide me some technical details about implementing FTP client for WINCE?will the code run on emulator?i will need the capability to transfer files from/to a remote CE device over TCP/IP network. So I figure FTP is the way to go. Do you know where I can download/purchase an FTP server for CE? The sample FTP server in Platform Builder only has light security and can't transfer binary files. I prefer to put the sample FTP client on the CE devices rather than servers? any suggestions?
ftp client wince Hi, I'm provide the sample FTP server and client examples for windowsce. code can run on emulator and arm platform Enjoy
api ftp wince
Hello tcsa35,
I want to download a file via FTP. I tried two different ways:
1. Using the Internet* functions
At first I opened an internet session with InternetOpen. After that
I opened an URL with InternetOpenUrl to which I passed the fully
qualified URL (e.g.
ftp://myserver.com/dir1/dir2/dir3/myfile.dat
).
Then I read the data with the function InternetReadFile and wrote it
This basically works. But InternetReadFile always returns true, even
if the remote file doesn't exists; in this case the received data is HTML
code that describes the error (Yes, I'm aware of the fact that the
Internet Explorer is being used for this).
The API reference unfortunately states that the Ftp* functions are
only available on the x86 platform (hu, what about the promissed
platform independence of Windows CE?!).
2. I found a FTP class on PocketPC Developer Network
(**broken link removed**) that implements
the FTP by itself. This approach also works and it returns error codes
on failure.
Now my questions are:
* Is there another approach for doing this?
* Which approach would you recommend?
Anyway, if possible, I would like to use functions that are available
on a device by default or part of the Windows CE API.
ftp to win ce over ras hi tcsa35 can you send me some details about basics in FTP?i need to know about the FTP client model for WINCE.do you have the book " Essential Wininet"? can you send me some technical documentation on FTP client?have you worked on WINCE?which book would you suggest me for implementing FTP client?
c++ ftp windows ce hi john2020, You can find more info about using specific WinInet FTP command in this book Addison Wesley - Pocket PC Network Programming
wince access ftp from code
hi tcsa35
i already have this book,it's readily available in this forum EDA upload/download section.i need some technical articles related to FTP client and FTP server.i searched on this,but am unable to find specific to it.if you have implemented FTP server and client for WINCE,can you send me some information?am new to WINCE,am currently in the process of learning WIN32 API,Winsock API.can you help me get this book?
"Essential Winlnet: Developing Applications Using the Windows Internet API with RAS, ISAPI, ASP, and COM" By Aaron Skonnard.
Published by Addison Wesley Professional.
Series: The Addison-Wesley Microsoft Technology Series.
http://www.bookpool.com/sm/0201379368
**broken link removed**
**broken link removed**
I would be grateful if you could send me some related information on FTP client and server for Windows CE.
wince 5.0 ftp client hi, The Ftps006.zip that I atached to you is working FTP server for Windows CE with source code, what more do you want? Just look the source code! Enjoy
ftp client for windows ce intel x86 In platform builder 5 there is classes to work with FTP in WINCE. you can see MSDN 2005, there is some help in this regards. Also there are a lot of technical point in MIKE HALL site. If you are newbie in windows CE, watch his movies about WINCE.
api ftp ce thank you
wince ftp client code You can find more info about using specific WinInet FTP command in this book"Addison Wesley - Pocket PC Network Programming ",this is a book good,your can to read it because very interesting
| https://www.edaboard.com/threads/where-to-start-developing-ftp-client-for-wince.56535/#post-253577 |
Recent Publications in Music | IAML
Show Search
Show Show only items where Author any -T, Ice ., 山下敏彦 ., Ren ., Flameboy ., 武藤芳照 ., 田中康仁 3 Rhythm Girls ; Claude Dauphin Abalia-Marijuán, Andrea Abbate, Carolyn Abbott, Lynn Abe, Takahito Abel, Samuel D. Abellán-Chuecos, Isabel Abelli, Torbjörn Abels, Birgit Abiodun, Femi Ábrahám, Márta Abraham, Ibrahim Ábrahám, M Abraham, Adam Abrahams, Frank Abramovich-Gomon, Alla Abrams, Howie Abrams, Alan E. Abril, Carlos R. Abromeit, Kathleen A. Abromont, Claude Abromont, Claude Acaster, James Acker, Aleksandra Ackfeldt, Anders Ackland-Snow, Nicola Acsai, Roland Ádám, Vajna Ádám, Vincze Ádám, Ignácz Ádám, Réger Adams, David Adams, Julia R. Adamson, Samuel Adedeji, Samuel Olufemi Adelmann, Dale Adelson, Robert Adesokan, Akinwumi Adkins, Monty Adler, Roberta Adler, Steven Adler-McKean, Jack Adlington, Robert Adolphe, Bruce Adorno, Theodor Wiesengrun Adorno, Theodor Wiesengrun Adorno, Th W Adorno, Theodor W. Adrian, Louise Adrienne, Kaczmarczyk Adrovicz, I Aduonum, Ama Oforiwaa Afolayan, Adeshina Afro Celt Sound System (Musical group) Afuera-Heredero, Ángeles Afzal-Khan, Fawzia Agamennone, Maurizio Agawu, Kofi Ágnes, Sas Ágnes, Gádor Ágnes, Pécsváradi Ágnes, Korondi Ágnes, Virághalmy Aguilar, Ananay Aguilar, Carlos Aguilera, Christian Agurto, Andrés Espinoza Agustín-Aquino, Octavio A. Ahern, Patricia Åhlén, Carl-Gunnar Ahlers, Michael Ahlers, Michael Ainge, Liana Airey, Don Akademie der Künste (Berlin, Germany) Akegi, Shigeo Åkesson, Ingrid Akhamrich, Elayachi Akino, Jun'ichi Akiyama, Kuniharu. Ákos, Gocsál Ákos, Widhager Ákos, Fodor Ákos, Windhager Akperi, Yemi Aksoy, Can Akuno, Emily Achieng' Akuno, Kali Akutagawa, Masumi. Akutsu, Taichi al-Mulk, Hibat Allāh ib Albertine, V Albéniz, Laura Albiez, Sean. Albiez, Sean Albrecht, Theodore Albright, Daniel Alcántara-Moral, Antonio Aleixo, Ricardo Alekhina, Marii︠a︡ Alembert, Jean Le Rond d' Alev, Simeon Alexander, Dan Alexander, Phil Alexander, Prince Charles Alexandersson, Monica Frick Alford, Marmaduke Alge, Barbara Alier, Roger Alim, Samy Alim, Samy Alin, Cecilia Rydinger Allain, Moose Alldritt, Keith Allen, Lily Allen, Roger Allen, Tony Allen, Dave Allen, Glenn Seven Allen, Michael Allen, Kevin Alleyne, Mike Allis, Michael Allison, Brian Allix, Dick. Allué-Montilla, Iván Almasy, Jessica Almqvist, Heléne ALONSO, Diego TOMÁS. Alonso, Alicia Alonso-Calero, José-maría Alonso-Ponga, José Luis Alperson, Philip Altenburg, Detlef Altimari-Adler, Donna M. Altman, John Aluede, Charles Álvarez-Blanco, Nuria Álvarez-Cañibano, Antonio Álvarez-Celaya, Laura Álvarez-Fernández, Miguel Alves, Bill Alwakeel, Ramzy Amacher, Maryanne Amaral, P Amdisen, Eva Mosegaard Amédée, Patricia Juste Amici della Scala, Amnesty International United Kingdom. Amo, Ion-Andoni Amoros, Luis Gimenez Amos, Tori Ampene, Kwasi Amrein, Emilie Amundson, Michael A. Anastasi, Alessandra Anatone, Richard Ander, Owe Andersen, Christopher P. Andersen, Martin Paarup Anderson, Julian Anderson, James Anderson, Michael Alan Anderson, Laura Anderson, Christopher Anderson, Ange Andersson, Bengt Andersson, Eleonor Andersson, Ingvar Andersson, Mats Andersson, Patrik dirigent Anderton, Chris Anderton, Abby Anderton, Chris. Anderton, Bill. András, Oplatka András, Kecskés L. András, Sinkó András, Barabás Andrea, Asztalos Andrea, Horváth Andrea, Kovács Andreasen, Mogens. Wenzel Andreasen, Mogens Wenzel Andreasen, Mogens Wenzel Andreasen, Mogens Wenzel. Andreasson, Sten. Andreica, Oana Andrés, Ramón Andrew, Debra Andrews, Frank Andrews, Frank. Andrews, Richard Andrews, Gavin J. Andrés-Bailón, Sergio de. Andrés-Fernández, David. Andrianopoulou, Monika Andrikos, Nikos Anesiadis, Alexandros Anglés, Magda Angster, J Angulo-Díaz, Raúl Anido, Raquel Anita, Lanszki Anna, Dalos Anna, Laskai Anna, Princzinger Anna, Baranyi Anna, Pardi Annecharico, Matt Anniss, Matt Annuss, Evelyn Ansdell, Gary Antal, Molnár Antal, Miskei Antal Doráti Centenary Society, Anthony, Barry. Anthony, Brendan Antille, Alain. Anton-Bruckner-Institut Linz, Antonio, Ossa-Martínez; Marco Antović, Mihailo Aoki, Steve Aoki, Shinji Apatoff, Ben Apfelstadt, Hilary Apolloni, Alexandra M. Appel, Stacey. Appignanesi, Richard Applin, Chloe Apter, Jeff Aquila, Richard Aquilina, Shaun Aragione, Gabriella. Aragon, Andrea Arai, Kōjun. Aramaki, Mitsuko Arambarri, Ana Arance, Isabel Aranda-Doncel, Juan Arató, G Araujo, Daniel Nevárez Arce-Bueno, Julio-C. Archambault, Gilles Archer, Stuart Gordon Archer, Carol Bramley Archer-Capuzzo, Sonia Archilla-Segade, Héctor Arditi, David Arena, James Ares-Yebra, Javier Argerich, Martha Aries, Julia Arjona-González, María Victoria Armagh Pipers Club. Armstrong, Craig Armstrong, Lindsay Arnborg, Beata Arnold, Jonathan Arnold, Billy Boy Arnold, R. J. Árpád, Kékesi Kun Arrandale, Karen Arriaga-Sanz, Cristina Arsenty, Richard Artists Space (Gallery), Arts Council of Northern Ireland. Arvidsson, Alf Arvidsson, Mats Ash, Niema Ashbee, Andrew Ashby, Arved Mark Ashley, Robert Ashmolean Museum, Asia, Daniel Asim, G'Ra Askenfelt, Anders Askerøi, Eirik Askew, Scilla Asociación Española de Profesores de Liturgia ǂb Jornadas Asociación Española DmásI: Danza e Investigación, Asp, Karl. Aspden, Suzanne. Aspden, Suzanne Asperján, G Asquith, John. Assmann, Jan Assmann, Jan. Associated Board of the Royal Schools of Music (Great Britain) Associated Board of the Royal Schools of Music (Great Britain), Association pour le rayonnement de l'Opera de Paris, Associazione amici della Scala, Astell, Brian Astuti, Kun Setyaning Asztalos, B Asztalos, B Atalay, Nejla Melike. Atanasova, Zheni Georgieva Atkins, Ronnie Atkinson, Brian T. Atkinson, Paul Atkinson, Craig Atkinson, David Atletić, Zvonko Atre, Prabhā Atsu, Kanae Attah, Tom Attard, Joseph Atterbom, Daniel Attila, Retkes Attila, Horváth Attila, Kovács Attlee, Helena Attwood, Tony Auber, D. F. E. Audissino, Emilio Auenmüller, Jakob. Auerbach, Brent Lawrence Auslander, Philip Austin, Larry Australian Capital Territory. Australian Music Centre, Avins, Styra. Aviñoa, Xosé Ayats-Abeyà, Jaume Ayyagari, Shalini R. Azevedo, Cláudia Aziz, Andrew Álvarez-García, Francisco-José Álvaro-Ocáriz, José Andrés Āhamada, Ābbāsauddīna Ålander, Jonas B., Scott Derek Baade, Christina. Baadsgaard, Niels Ole Baba, Yūji. Baber, Katherine A. Babić, Petra Baca, Max Bach, Johann Sebastian Bach, Johann Sebastian Bach-Archiv Leipzig, Bäckström, Charlotta Bacon, Reginald W. Bade, Patrick. Bader, Rolf Badiz, Phill Badman, Keith Badura-Skoda, Eva Baginska, Agnieszka. Bagińska, Agnieszka Bagińska, Agnieszka Bagnall, Tony Bai, Wei = 白玮 Bailey, Angela Bailey, Julius Bailey, Owen Bailey, Candace Bailey, Trenton Bailey, Thomas Bey Willia Bailie, Stuart. Baird, Amee. Bakan, Michael B. Baker, Sarah Baker, David C. Baker, Andrea Baker, Felicity Baker, Trevor Baker, Stuart Baker, Geoffrey Baker, Josh Balázs, I Balázs, Mikusi Balázs, I Balázs, Lévai Balázs, István Balázs, Czinege Ádám Baldwin, Olive. Balić, Vito Bálint, Sárosi Balkir, Elif Ballantyne, Patricia H. Ballard, Lincoln Ballico, Christina Balliro, Linda Balls, Richard. Balls, Richard Balmer, Paul Balmer, Paul. Balmer, Yves Balmori, Isabel Balogh, P Balough, Teresa Balsach, Llorenç Baltazar, Marie Bálványos, A Bamberger, Jeanne Shapiro Bambrick, Spencer Bamichas, Pyrros Ban, Brankica Ban, Junrong = 板俊荣 Banchs, Edward Banfield, Stephen Bánföldi, T Banister, Eric Bank, Katie Banks, Jon Banks, Jack Bannan, Nicholas. Bannan, Nicholas Bánosi, György Banowetz, Joseph Bantock, Cuillin Baptista, Todd R. Baraldi, Filippo Bonini Baranello, Micaela Baranyi, F Baranyi, A Baranyi, A Barber, Chris Barber, Felicia Raphael Ma Barberá-Soler, José-Miguel Barbieri, Marija Barchester (Firm) Barchester Nordoff Robbins Initiative. Barclay, Muriel Barclay, Michael Bardine, Bryan. Bardon, Jonathan Barger, Judith Bargfrede, Allen Barilier, Etienne. Barjau-Riu, Eustaquio Barker, Garry Barker, Derek Barlow, Helen Barlow, Gary Barna, G Barna, Emília Barnes, Jimmy. Barnes, Stella Barnes, Jim Barnes, Grace Barnes, Paul Barnes, Jimmy Barnes, Geoff Barnett, Andrew Barnett, Anthony Barnett, Neil Barney, Katelyn Barockorchester Stuttgart, Barone, Stefano Baroni, Mario Barrett, Dawson Barrett, Douglas Barrett, Marcia Barrett, Margaret S. Barry, Robert Barry, Sam Barry, Barbara. Barsi, E Bartenstein, Fred Barth, Richard Bartha, Dénes Barthel-Calvet, Anne-Sylvie Bartholdy, Felix Mendelssoh Bartig, Kevin Bartlett, Jon Bartlett, Ian Bartmanski, Dominik Bartók, Béla Bartók, B Bartók, Jn. Béla Bartolome, Sarah J. Barton, Frances A. Barwick, Linda Barz, Gregory F. Basford, John Bassani, Florian Bastianelli, Jérôme Bastlová, Eliška Bate, Seth Bates, Eliot Bateson, Catherine V. Bathurst, Ralph Batista, Antoni Batstone, Leah Battentier, Andy Battier, Marc Battier, Marc Bauer, Amy Marie Bauer, Amy Baulcomb, Andrew. Baumann, Franziska Baumgartner, Michael Bavan, Yolande Bavington, Peter Baxter, Jamie Reid. Baxter-Moore, Nicolas Bayle, Laurent Bazayev, Inessa Bádue, Alex Bärtsch, Nik BBC Radio 4, Beach, Nick. Beach, David Beal, Amy C. Beale, Sam Beale, Charles Bean, margaret Bear Family Records (Firm), Beard, Mark Beare, Charles Beasley, Kimberly Eckel Beasley, James P. Beaster-Jones, Jayson Beaster-Jones, Jayson Beatty, Bob Beaucage, Réjean Beaujour, Tom Beaulne, Jean Beaumont, Mark Beausang, Ita Beaven, Zuleika Becce, Giuseppe Beck, Bolette Daniels Becker, Reinhard Beckerman, Michael. Beckh, Hermann Beckham, Victoria Beckley, Pat Bedford, Steuart Bedford, David Beecroft, Norma Beer, Laura E. Beer, Cheryl. Beffa, Karol Begbie, Jeremy Beghelli, Marco Beghin, Tom Begnal, Michael S. Bego, Mark Beith, Richard Beitia-Bastida, María-Ángeles Bejarano-Pellicer, Clara Bekker, Paul Béla, Mihály Béla, Bartók Béla, Szerényi Béla, ifj. Bartók Bélaó, Bartók Belgiojoso, Ricciarda Belgrave, Melita Belina, Anastasia Belina-Johnson, Anastasia Belk, Adolphus G. Belkind, Nili Belknap, Daniel Bell, Celeste Bell, Andy Bell, Ian Bellamy, Olivier Beller-McKenna, Daniel Bellomia, Valeria Bellstorf, Arne. Bempéchat, Paul-André Ben-Or, Nelly Benac, Eric Benavides, Ana Bence, Csatári Bendrups, Dan Benedetti, Evangeline Benedict, Cathy Benge, Alfie. Bengtson, Matthew Bengtsson, Bo C. Benini, Romain. Beniscelli, Alberto Benitez, J. Benitez, Vincent Perez Benjamin, Walter Benn, Jane Benn, Tom Bennett, Dawn Bennett, Andy Bennett, Margaret Bennett, Marie Josephine Bennett, Austin Bennett, Hunter Bennett, J. R. Sternda Bennett, Christopher Bennett, Tony Bennett, Peter Bennett, Samantha Benninghoff, Martin Benoit, Dratwicki Benoit-Otis, Marie-Hélène Benoliel, Bernard Benson, Dudley Bent, Margaret Bentley, Charlotte Benward, Bruce Bérczes, László Béres, József Beres, Karen Béres, Klára Berg, Håkan Berg, Christopher Berger, Tore Berger, Karol Berger, Harris M. Berger, Bengt "Beche" Berger, Anna Maria Buss Berger, Dorita S. Berggren, Jannie Bergland, Kristi Berglund, Carl Johan Bergonzi, Louis Bergsman, Steve Bergström, Rolf Bergua-Cavero, Jorge Berkers, Pauwke. Berlanga-Fernández, Miguel-Ángel Berlász, Melinda Bermbach, Udo Bermejo-Gregorio, Jordi. Bernal-Romero, Manuel Bernard, Sheila Curran Berne, Peter. Berner, Elias Bernhard, Christian Bernhart, Walter Bernius, Frieder Bernstein, Zachary Bernstein, Lawrence F. Berrill, Simon Berrill, Mairead Berry, Jo. Berry, Denny Berry, Mark Berson, Ginny Bertei, Adele Bertoglio, Chiara Bertrand, Loïc Besley, Adrian Besser, Jonathan Besson, Vincent Bestley, Russell Beswick, Katie Betancourt, Manuel Bettoni, Willy Betzwieser, Thomas Bextor, Robin Bey, Henning Beye, Alassane Beyer, Anders Beynon, Carol Bezić, Nada Bécue, Aurélien. Běhanová, Michaela Bianchi, Frederick W. Biancorosso, Giorgio Bible Society Australia, Bibliothèque nationale de France, Bibliothèque-Musée de l'Opéra (France), Bichta, Tomasz. Bickford, Tyler Biddle, Ian D. Biddlecombe, George Bieber, Justin Bienstock, Richard Biersdorfer, J. D. Big Orkney Song Project. Bigand, Emmanuel. Biggi, Maria Ida Billington, Scott Billström, Rebecca Dobre Binder, Katrin Bingham, Emily Biojout, Jean-Philippe Birath, Eric Birch, Will Bird, Chris Bird, Elléa Bird, Martin Birgit, Haberpeuntner Birkett, Danielle Birkin, Kenneth. Birnbaum, Jacqueline C. Bíró, V Bishop, Paula J. Bishop, Julia C. Bishop Grosseteste University. Bisschoff, Lizelle. Bitoun, Julien Bizet, Georges Bjälesjö, Jonas Björkman, Jenny Björnberg, Alf Björkman, Christer Black, Ron Black, Pauline. Black, Bob Black, Don Black, Brendan Blacking, John Blackwell, Chris. Blackwell, Chris Blair, Linda Nicole Blake, Mark Blake, Mark Blaney, John. Blanque-López, Elena Blau, Dick Blauner, Andrew Blay, Philippe Blaževac Pajkov, Mato Blažeković, Zdravko. Bläsing, Bettina Blenkinsop, Ian Bloechl, Olivia Ashley Blomberg, Göran Blomstedt, Herbert Bloom, Jerry. Bloom, Peter Bloxam, Mary Jennifer Blum, Jordan Blum, Arne Blum, Stephen Boakye, Jeffrey Bobetko, Sanja Majer Bockris, Victor Boczkowska, Ewelina Bodkin-Allen, Sally. Bodkin-Allen, Sally Bodley, Lorraine Byrne Bodley, Lorraine Byrne Bodor, A Boehm, Thomas Boffone, Trevor Bofill-Levi, Anna Bogdanović, Dušan Boge, Pernille Boghossian, Paul. Bohlman, Andrea F. Bohlman, Philip V. Bohman, Stefan Bohn, James Matthew Boisselier, Louise Bokelman, Marina Boland, Susan Bolderman, Leonieke Boldizsár, Fejérvári Bolesławska, Beata Bollen, Andy Bollinger, Nick Bolton, Michael Bólya, Anna Mária Bombera, K Bombi, Andrea Bonastre, Francesc Bonavitacola, Lauren Bonde, Lars Ole Bonde, Lars Ole. Bonds, Mark Evan Bonds, Mark Evan. Bonin, Christin Bónis, Ferenc Bónis, F Bónis, F Boniszewska, Halina Maria Bonjack, Stephanie Bonnette-Bailey, Lakeyta M. Bonomo, Joe Bonynge, Richard. Boom, Frank G. Boomhower, Daniel F. Boon, Marcus Booth, Stanley Booth, Roger Borbála, Menus Borchard, Beatrix. Borchard, Beatrix Borchmeyer, Dieter. Bordas-Ibáñez, Cristina Borenstein, Eliot Borg, Margareta Borg, Bobby Borgo, David Borin, Per Borio, Gianmario Börjesson, Staffan Born, Georgina Borrego-Gutiérrez, Esther Borromeo, Agostino. Borsi, F Borthwick, Stuart Bortot, Davide Boss, Jack Forrest Boss, Jack Bossis, Bruno Bostridge, Ian. Boström, Mathias Botella-Nicolás, Ana-María Both, Arnd Adje Bothén, Christer Bottà, Giacomo Boucher, David Boucher, Paul Boucher, Lucy Boudreault-Fournier, Alexandrine Bouffard-Veilleux, Mickaël Boughton House (England), Bouissou, Sylvie Bouissou, Sylvie Boukobza, Jean-François Boulanger, Nadia Boulez, Pierre Boulez, Pierre. Boullier, Nigel Bourbon, Andrew Bourdaghs, Michael K. Bourg, Adrien. Bourgeois, John R. Bourke, CHris Bouthinon-Dumas, Brigitte Bouvier, Xavier Bovet, Guy. Bowen, Jim Bowen, Meirion Bowers, Jane M. Bowie, David Bowler, Dave Bowman, Judith Bowring, Lynette Boyce-Tillman, June Boydell, Brian Boydell, Barra Boyle, Kerry Boynton, Susan Božanić, Zoran Bozó, P Bozó, Péter Bozza, Anthony Bòrd na Gàidhlig (Scotland) Böck, Lois Braae, Nick Bracey, Earnest N. Brackett, Nathan Brackett, David Braddock, John-Paul Bradler, Katharina. Bradley, Catherine A. Bradley, Ian C. Bradley, Kate Bradley, Regina N. Bradley, Deborah Bradley, Lloyd Bradley, Francis R. Bradshaw, Bill Braggins, Sheila. Braguinski, Nikita Bramley, Constance May Brand, Benjamin David Brandner, Hans Brandt, Line Brandt, Per Aage Brandtner, Agnes Brar, Dhanveer Singh Brauer, Juliane. Brauer-Benke, József Brav, Ludwig Bravo-Ramón, Javier Bray, Lucinda Breihan, Tom Breitkopf und Härtel Breitman, David Brendel, Alfred Brendel, Alfred. Brennan, Matt Brewer, Claire Brewer, Mary Kathryn Brewer, Charles E. Brewer, Jon. Brewster, Bill. Briain, Lonán Ó Bricusse, Leslie Briley, Ron Brimmer, Jude. Brindle, Reginald Smith Brinzing, Armin British Academy. British Automobile Racing Club, British Film Institute. British Flute Society, British Music Society, Brito-López, José Britt, Fanny Brittan, Michael Britten, Benjamin Britten, Beth Britten-Pears Foundation. Broad, Stephen. Brocken, Michael Brockett, Clyde W. Brodsky, Warren Brohée, Jean-François Broman, Per F. Bronson, Fred Brook, Peter Brooke, Ian Brooker, Will Brooks, William. Brooks, Kix Brooks, Jeanice Brooks, Daphne Brooks, Kinitra Dechaun Brooks, Christopher Antonio Brophy, Brigid Broughton, Frank. Brown, Greg Brown, Michael Brown, Allan Brown, Jeremy Brown, DeForrest Brown, Jake. Brown, William Paul Brown, Michael L. Brown, Steven Caldwell Brown, Jen Jewel Browne, Sarah Elizabeth Browner, Tara Browning, Birch Brownlee, Lawrence Brownlee, Clint Brownstein, Carrie Broyles-González, Yolanda Bruce, Robert J. Brückner, H Brueggemann, Walter Bruford, Jon Brugarolas-Bonet, Oriol Brugués-Comellas, Luís Bruhn, Siglind Brunström, Johanna Österling Brunt, Shelley Brunt, Shelley Brusila, Johannes Brügge, Joachim Bryan, John Bryan, Daphne Bryngelsson, Peter Bryngelsson, Peter. Brzozowska, Blanka Brøvig-Hanssen, Ragnhild. Buccleuch Living Heritage Trust, Buchanan, Dorothy Buchanan, Donna Anne. Buchberger, Milovan Bucht, Gunnar Bucht, Gunnar Buck, David N. Buckland, Sidney Buckley, David Buckley, John Buckley, Ann Buckoke, Peter Bucur, Voichita Bucuvalas, Tina Budds, Michael J. Budtz, Paul-Jørgen Bueno-Camejo, Francisco Carlos Bueno-López, Ana-María Bugge, Nikolaj Bugos, Jennifer A. Bugyis, Katie Ann-Marie Buhler, James Büky, V Bullock, Philip Ross Bullock, Darryl W. Bullock, Darryl W. Bullock, Philip Ross. Bunch, Ryan Bundesen, Michael Bungey, Darleen. Bunzel, Anja Burchell, Jenny Burchell-Haslett, Maya Burden, Michael Burford, Mark Burford, Michelle Burford, Michèle Louise Burger, Jeff Burgess, Tim Burgess, Richard James. Burgess, Thomas De Mallet Burgh, Theodore W. Burgos-Bordonau, Esther Burian, Al Burk, Ian. Burke, Carolyn. Burke, Andrew Burke, Patrick Burke, Robert Burke, Chris Burkholder, Peter Burnard, Pamela Burnard, Pamela. Burney, Susanna Burns, Lori Burns, Mila Burns, Ken Burns, Robert Burridge, Stephanie Burrows, George Burrows, Terry Burrows, Donald Burrows, Donald. Burrows, Marc Burrows, John Burton, Jim Burton, Justin Adams Burton-Hill, Clemency. Burton-Hill, Clemency Burzynska, Jo Buscatto, Marie Busch-Salmen, Gabriele. Buschor-Kotzor, Gloria Bushard, Anthony Bushell, Garry Buskin, Richard Butke, Marla Butler, Katherine Butler, Geoff Butler, Mark J. Butler, Lynn Edwards Butt, John Butterworth, Neil Buttigieg, Bob Butz, Karel Buurman, Erica Büning, Eleonore Byers, Jim Bygdéus, Pia Bynog, David M. Byrman, Gunilla Byrne, John Byrne, Alan Byrne, David Byrne, Kevin James Byron, Tim Byström, Mikael C Pintér C., Melanie C.H. Beck Verlag Caballero, Carlo Cabañas-Bravo, Miguel Cabeza-Carrillo, Mauricio Cacciari, Massimo. Cacciari, Massimo Cáceres-Piñuel, María Cadagin, Joseph Cadalanu, Marie Caddeo, R. Caddy, Davinia Cadrin, Paul Cadwallader, Allen Clayton Caeyers, Jan Caeyers, Jan Café Royal Books, Cage, John Cain, Michael Scott Cain, Tim Cairns, Peter Cairns, David Calandín-Hernández, Emilio Calcraft, R. P. Calderón-Urreiztieta, Carlos E. Caldwell, John. Caldwell, John Calero-Carramolino, Elsa Calhoun, Scott D. Callahan, Mathew Callahan, Michael Calle-Albert, Ignacio Calvi, Juan-C. Calvocoressi, M. D. Camal, Jerome Camba, Julio Cameron, Samuel Camões, José. Camp, Gregory Louis Campagne, Augusta. Campaign Choirs Writing Collective, Campbell, Sean Campbell, Brett Campbell, Murray Campbell, Patricia Shehan Campbell, Mark V. Campbell, Edward Campion, James Campion, Chris Campos, Rémy. Canadell, Roger Canadian Museum of History, Candoni, Jean-François. Canfield, Jack Canham, Nicole Cannon, Alexander M. Cano, Rubén. López Cano, María José Cantagrel, Gilles Cantagrel, G Canter, Marc. Cantillon, Zelmarie Cantor, Paul Cantwell, David. Cañas, Miguel Cao, Baoming = 曹保明 Cao,Cuifang = 曹翠芳 Capaldi, James Capdepón-Verdú, Paulino Capelán-Fernández, Montserrat Capone, Phil. Cappelletto, Sandro Capuzzo, Guy Cárdenas, José Cardew, Cornelius Cardó, Antón Cardwell, Bruce Carenco, Céline. Carl, Robert Carlaw, Margaret Carlberg, Anders Carlberg, Anders Carli, Alice Carlile, Brandi Carlin, Peter Ames Carlin, Marcello. Carlos, Cèster Carlson, Gretchen L. Carlsson, Wilhelm Carlsson, Sven Carlsson, Leif Carmona-Jimenez, Susana Carnes, Aaron Carniel, Jessica Caron, Jean-Luc Carpallo-Bautista, Antonio Carr, Maureen Carr, Thomas M. Carr, Cheryl Slay Carr, Charmian Carr, Paul Carrasco-Benítez, Marta Carrasco-Peña, José-Luis Carredano, Consuelo Carrer, Pinuccia Carreras-López, Juan-José Carreres, Vicente Carrero-Santamaría, Eduardo. Carrico, Alexandria Carrigan, Jeanell Carrillo, Raquel Rojo Carroll, Rachel. Carson, Samuel Andrew Carter, Moragh. Carter, Stephanie Carter, Nathan Carter, Tim Carter, Shayne Cartwright, Angela Caruna-Puig, Társilo Carus-Verlag Carvalho, Sara Casablancas-Domingo, Benet Casares-Rodicio, Emilio Cascelli, Antonio Cascudo, Teresa Cascudo, Teresa Case, George Casey, Ivor Cash, Johnny Cash, John Carter Cashman, David Cashmore, Ellis Caskel, Julian Cassano, Graham Cassar-Daley, Troy Cassia, Cristina Cassidy, Paul Cassling, Robin Castaldo, Gino. Castelo-Branco, Salwa El-Shawan Castill, Sergio Castillo, Sergio Castillo-Garsow, Melissa Caston, Emily Castro, Rachel Castro, David Cataliotti, Robert H. Cateforis, Theo Cathcart, Jenny Catholic Church. Catterall, Stephen Cattermole, Jennifer Cattermole, Jen Cavallini, Ivano Cave, Nick Cavell, Richard Cavett, Esther Cawley, Jessica Cayuela-Vera, Georgina Cazelais, Normand Cámara-de-Landa, Enrique. Cecchi, Alessandro Cecil, Desmond Celenza, Anna Harwell Celmins, Martin Cenciarelli, Carlo Cenizo-Jiménez, José Centino, Nicholas Francisco Central Council of Church Bell Ringers. Centre d'études supérieures de la Renaissance, Centre d'études supérieures de la Renaissance. Centre for the Study of Manuscript Century, Douglas Ceramella, Nick Ceredigion Young Farmers Clubs, Çeşmeli, Fikret Chaachoo, Amin Chabot, Sébastien Chabrowski, Igor Iwo. Chadwick, Stephen. Chagas, Paulo C. Chaillou, Christelle Chakraborty, Soubhik Chandler, Ivan Chang, Jeff Changeux, Jean-Pierre Chaopman, Ian Chapin, Keith Moore Chaplin, Felicity Chaplin, Michael. Chapman, Janice L. Chapman, David F. Chapman, Ian. Chapman, Con Charatsē, Liana Charkiolakēs, Alexandros Charlesworth, Chris Charlton, Katherine Charlton, Kay Charlton, David Charnas, Dan Charnock, Ruth Charrier, Michelle Charrieras, Damien Charteris, Richard. Chase, Duane Chatzipapatheodoridis, Constantine Chaves, Rui Che, Cathay Cheek, Timothy Chen, Zilu Chen, Bingyi = 陈秉义 Chen, Chaoyou = 陈朝友 Chen, Junhui = 陈浚辉 Cheng, William Chennell, Paul Cherlin, Michael Cheyne, Peter. Cheyne, Peter Chiantore, Luca Chiantore, Luca Chiara, Maria Luisa Dall Chiche, Marina. Chiesa, Carlo Childers, Jim Chimènes, Myriam Chinchilla-Minguet, Jose-Luis Chinmoy, Sri Chinouriri, Bridget. Chiparo, Erin Chitando, Ezra. Chiu, Remi Chlupaty, Richard Cho, Young-mee Yu Choi, JungBong Chonghaile, Deirdre Ní Chow, JunYi Chow, Yiu Fai Chrisp, Pete Christensen, Lars Christensen, Jean Christensen, Thomas. Christensen, Bernhard Christensen, Beth Christensen, Anette Christensen, Thomas Street Christian, Heather Christian, Schwarzenegger Christman, Mark Christoforidis, Michael Christoforidis, Michael Christopher, Michael Christopher, Roy Christophers, Harry Chronicle Prism, Chua, Daniel K. L. Chung, Fanny M. Y. Chunn, Mike Church, Joseph Chūsei runesansu ongakushi kenkyūkai. Chvála, Emanuel Ciantar, Philip. Cilleruelo-Gutiérrez, Lourdes Cimini, Amy Cinema Organ Society. City of London Phonograph and Gramophone Society, City of London Phonograph and Gramophone Society. Clague, Mark Clam-Gallasův palác. Clares-Clares, María-Esperanza Clark, Walter Aaron Clark, Caryl Leslie Clark, Maribeth Clark, S. H. Clark, Walter Aaron Clark, Hamish Douglas Clark, Rob CLark, Garahm CLark, Kevin Clark, Nicholas Clark, Suzannah Clark, Graham Clark, Allen Clark, Michael Clark, John L. Clark, Jane Osborn Clark, Joe C. Clark, Jane Osborn. Clarke, Martin Clarke, Eric F. Clarke, Heather Blasdale Clarke, Eric Clarke, Max Clarke, David Classic FM (Radio station : London, England) Clauhs, Matthew Clausius, Katharina Clausó-García, Adelina Clausson, Malin Clayton, Stuart. Cleeve, Sam Clegg, Mindy Clegg, Johnny Cleland, Kent D. Clemente-Estupiñán, Damián-Ignacio Clements, Ann Callistro Clements-Cortes, Amy Clemons, Clarence. Clerk, Carol Cleveland, Susannah Clément, Jean-Yves Clinton, George Cloonan, Martin Cloonan, Martin Clouzot, Martine Clover, Joshua Clubbe, John Coady, Christopher Cobbold, Marika. Cobo-Parra, Pedro Cochran, Timothy B. Cochrane, Tom Cockburn, Bruce Cocker, Jarvis. Cockrell, Dale Coe, Richard N. Coelho, Victor Coello, Alejandro Coffey, Dan Coggins, Owen Coghlan, Alexandra Cohan, Steven Cohen, Sheldon Cohen, David Cohen, Sara Cohen, Mary L. Cohen, Jason Cohen, Annabel J. Cohen, Samuel S. Cohen, Leonard Cohen, David Cohen, Ronald D. Cohen, Brigid Maureen Cohen-Levinas, Danielle. Coifman, David. Cole, Karen Anthony Cole, Ross Colella, Alfonso Coleman, Lindsay Coleman, Hilary. Coleman, Colin Coleman, Jeremy Coleman, Nick. Coleman, James K. Collazo-Albizu, Ibis Collier, Terry Collier, David Collin, Jacques Collins, Dan Collins, Mike Collins, Nick Collins, Sarah Collins, Nicolas Collins, Andrew Collins, Anita Collins, John Collins, Marcus Collins, Shirley Colton, Lisa Coluzzi, Seth J. Colwell, Richard Combe, Dominic Combe, Dominic. Comber, John Comini, Alessandra. Comité de Expertos en Digitalización de Archivos Sonoros Community Music Wales (Charity) Comunn na Clarsaich, ConBrio Verlagsgesellschaft mbH Condon, Denis Cone, James H. Connaughton, Marcus Conners, Peter H. Connolly, Cynthia Connolly, Tristanne J. Connon, Derek F. Connon, Derek F. Connor, Geraldine Conor, Erin Conrad, Charles P. Constantine, Martin Constantine, Elaine Contostavlos, Tulisa Contzius, Ari Cook, Malcolm Cook, Karen M. Cook, Nicholas Cook, James Cook, James Cooke, Ashley Cooke, Mervyn Cooke, Phillip A. Coolidge, Rita Coombes, Elizabeth Cooper, Mick Cooper, Frank Rudy Cooper, Peter Michael Cooper, Barry Cooper, David Cope, Andrew L. Coplan, David Copland, Aaron Copley, A. R. H. Coppola, Francis Ford Copsey, Tony Corbellari, Alain Corbett, Ian Corbett, John Corbett, George Corcoran, Michael Cordier, Seeverine Cordier, Adeline. Corigliano, John Corlaix, Omer Cormac, Joanne Cornelia, Szabó-Knotik Cornelius, Jens. Corner, Philip Cornett, Vanessa Corona, León F. Garcí Corredoira, Pilar Diez del C Corso Corswarem, Émilie Cortés-Izquierdo, Antonio Coscarelli, Joe Cosgrove, Charles H. Costal-Fornells, Anna Costas, Daniel Varacalli Coste, Claude Cott, Jonathan Cotter, Bobb Cotticelli, Francesco Cottrell, Stephen Coufalová, Gabriela Coulter, Phil Coupe, Stuart Cousins, john Couture, Ariane Couture, François Covach, John Rudolph Covell, Roger Cox, Gordon Cox, Gareth Cóndor, María Cradduck, Lucinda. Craggs, Stewart R. Cram, David Cramer, Lyn Crary, Dan Craske, Oliver Crass (Musical group), Crawford, Scott Crawford, Eric Sean Cray, Ed Creasey, D. J. Creed, Jason. Creekmur, Corey K. Cregan, Jim Cremaschi, Alejandro Cremata, Radio Crespi, Paola Crews, Rita Crisafulli, Chuck Crist, Stephen A. Crnković, Danijel Crochetière, Jacques Crocus, Anita Croft, Malcolm Cronquist, Ulf Cross, Eric Cross, Jonathan Cross, Burnett Cross, Charles R. Crossland, Ken Crossley, John Crossley, Nick Crostini, Barbara Crouse, Richard Crow, Kimberly. Crow, Robert J. Crowe, Jessica Crowther, Andrew Cruces-Roldán, Cristina Csaba, Varga Csaba, Deseő Csaba, Bálint Csatári, B Csatári, B Csáky, Moritz Cseh, Tamás Csengery, Kristóf Cserkuti, Dávid Csilla, Prthő-Verner Csinta, S Csobó, PGy Csobó, Péter György Csomasz-Tóth, K Csonka, SzB Csonka, SB Csúri, Á Cuadrado-Méndez, Francisco-José Cuadrado-Méndez, Francisco Cuevas, Abel Cuffaro, Daniele. Culshaw, Peter Cummings, Simon Cummins, Kevin Cummins, Kevin. Cunningham, John Patrick Cunningham, George Cunningham, Martin G. Cureses-Vega, Marta Ćurin, Vedrana Milin Curkpatrick, Samuel Curnow, Wysatn Curren, Thomas S. Currie, Gabriela Ilnitchi Curry, Robert Curtin, Gemma Cusack, Carmen M. Cusick, Suzanne G. Cuyler, Antonio C. Cvoro, Uros. Cymdeithas Cerdd Dant Cymru, Cypess, Rebecca Cyrino, Marina Pereira Czagány, Zsuzsa Czagány, Z Czibula, Katalin Cziffra, Gy Čapek, Josef Čurda, Martin D'Arcy, John. D'Arcy, Gabby. D'Eith, Bob D'Errico, Mike D'Evelyn, Charlotte D'Urso, Alexandra da Michito, Gō Da Ponte, Lorenzo Da Ponte Institut für Librettologie, Don Juan Forschung und Sammlungsgeschichte, Dack, John. Dada, Christian Dahl, Eric Dahl, Per Dahlström, Fabian Dai, Mingzhong = 戴明忠 Dakoli, Elida Dalagna, Gilvano Dale, Pete Dale, Jon Daley, Michelle. Dallin, Sara Dalmonte, Rossana Dalos, A Dalos, A Dalton, David Daltrey, Roger Damschroder, David Dan, Norihiko. Dane, Barbara Dániel, Lipták Dániel, Nagy Daniele, Sabaino Daniels, David Daniels, Neil Danielsen, Anne. Danielson, Eva Danielsson, Eva Dankić, Andrea Danmaigoro, Ahmed Daňhelová, Lenka Kuhar Daramola, Olusanjo Matthew Ab Darchen, Sébastien Darcy, Emily. Darias-Heras, Victoriano Darke, Graham Darlington, Andrew Darlow, Mark Dascher, Helge Dave, Nomita Daverne, Gary David, Hiley Dávid, Kalmár David, Catalunya Dávid, Sándor Davidian, Teresa Maria Davidović, Dalibor Davidson, Eric Davidson, Jane W. Davidson, Jane W. Davie, Anthony Davies, Tudor Davies, Peter Maxwell Davies, Joe Davies, Carol A. Davies, Hunter Davies, Gary Davies, Fflur Aneira Davies, Hunter Davies, Gena Davies, Helen Davis, James A. Davis, Andy Davis, Stephen Davismoon, Stephen Dawe, Gerald Dawe, Kevin Dawidoff, Nicholas Dawson, Angela J. Dawson, Michael Robert Wil Dawson-Bowling, Paul Day, Barry Day, Kiku Day, Morris Day, Timothy Day-O'Connell, Sarah Dayan, Peter Dayre, Eric De Alba-Koch, Beatriz De Barra, Séamas De Benedictis, Angela Ida De Bruin, Leon R. de Diego-Romero, Javier De Ferranti, Hugh De Filippi, Sebastiano de Graaf, Pia Schmidt de Jokisch, Barbara Hoos de Kloet, Jeroen de Larochellière, Luc De Lucca, Valeria De Man, Brecht De Médicis, Francois. de Paor-Evans, Adam De Quadros, André de Raymond, Louise. Bernard de Villiers, Nico de Vries, Fred De Vries, Fred de Zeeuw, Hans De-Castro, Paula De-la-Llana, Antonio Bayona Dean, Laura Dean, Sue Dean-Myatt, William Deane, Raymond Deans, Jan Deaville, James Andrew Debouverie, Sophie Debussy, C Deby, Zsoldos Gábor Decker, Billy Decker, Todd R. Deeming, Helen Deer, Joe Deflem, Mathieu Degas, Edgar Dejans, Peter. Dékány, Endre del Álamo-Caballero, Lamberto del Canpo, Patxi Delaere, Mark DelDonna, Anthony Delevante, Bob Delgado, Sonia. Gonzalo Delgado-Calvete, Carlos Delisle-Crevier, Patrick Dell, Helen Dell, Christopher DeLorenzo, Lisa C. DeMarcus, Jay Demeter, Júlia Demeter, T Demović, Miho Denécheau, Pascal Denécheau, Pascal Denisoff, Serge Denk, Jeremy Dennis, Kaylum Dennison, Patricia DeNora, Tia. DeNora, Tia Densley, Tucker. Densmore, John Dent, Tom Dent, Edward J. Denyer, Frank Denzler, Bertrand Derkert, Jacob Dermoncourt, Bertrand. Derrington, Philippa Dervan, Michael Desblache, Lucile Desbruslais, Simon Deschênes, Bruno. Deseő, C DeSimone, Alison Clark Desmond, Karen Deters, Sarah Dettmar, Kevin J. H. Deuster, Bettina Deutsch, Walter Deutsche Bibelgesellschaft Devenish, Louise Devereux, Eoin. Devereux, Eoin Devidayal, Namita Devienne, François Devine, Campbell Devine, Kyle Devine, Patrick Dewey, Chris Dexter, Keri Dey, Sangeeta Dezső, Szauer Dětský pěvecký sbor Radost Praha, Dherbier, Yann-Brice. Di Benedetto, Marianne Diallo, David Diamond, Beverley Diamond, Charlotte Dias, José Díaz, Jorge Díaz-González, Joaquín Díaz-Mayo, Rosa-María Díaz-Olaya, Ana-María Díaz-Olaya, Ana Díaz-Pérez, Ignacio Dibben, Nicola Dibben, Nicola. Dibble, Jeremy DiBiase, Allan DiBlasi, Alex DiCenso, Daniel J. Dickey, Lisa Dickinson, Peter Dickinson, James Luther. Didier, Béatrice Dietz, Dan Dietz, Bill Díez-Antolinos, Luis Díez-Puertas, Emeterio DiFranco, Ani Dillane, Aileen. Dillon-Krass, Jacquelyn Dimery, Robert. Dimery, Robert Dines, Michael Dines, Michael. Dingle, Christopher Philip. Dingle, Christopher Philip Dinkel, Philippe DiNucci, Celeste DiPiero, Dan Dismanův rozhlasový dětský soubor, Ditchfield, David Dixon, Beau Dixon, Gavin Dixon, Ian Díaz, Joaquín. Díaz, Nelson Varas Díaz, Juan Diego Díaz-Olaya, Ana-María Djupsjöbacka, Tove Dlamini, Sazi Dlamini, Sazi Do, Jane Dobewall, Mareike Dobiáš, Dalibor Dobney, Jayson Kerr. Dobozy, B Dobozy, B Dobrea-Grindahl, Mary Dobszay, Á Dobszay, L Dobszay, Éászló Dobszay, L Dochartaigh, Seoirse Ó Doctor, Jennifer R. Dodd, Rose. Dodd, Julian Dodgion, Dottie Dodgson, Paul Doe, Julia Doffman, Mark Doggett, Peter Doggett, Peter. Doheny, James. Doherty, Harry. Doherty, Matt Doherty, Conor Dohnányi, E Dóka, Krisztina Dokalik, Dietmar Dokter, Julia Doky, Niels Lan Dolan, Emily I. Dolan, Therese Dolp, Laura Dombi, J Dombiné, J Domingo-Montesinos, Isabel-María Domínguez-López, Juan-José Domínguez, Freddy Cristóba Domínguez-Moreno, Áurea Domokos, M Domokos, Z Domoney, Kelly. Dömötör, Endre Dömötör, Zs Dompnier, Bernard Don Juan Archiv Wien. Donaldson, William Donau-Universität Krems. Dong, Lorraine. Dong, Arthur E. Donlon, Denise Donnelly, K. J. Donnelly, Stephen E. Donnelly, Ryann Doonan, Simon Dóra, Schneller Dóra, Pál-Kovács Dorbayani, Mosi Dore, Florence Dorf, Samuel N. Dorfman, Jay Dori, Dafna Dorottya, Németh Dorset, Erik Dougherty, William Patrick Doughty, Karolina Douglas, Tana Douse, Cliff Dovchin, Sender Dovercourt, Jonny Dow, Rosie Dowling, Martin W. Downes, Julia. Downes, Lawrence Downes, Stephen C. Downes, Andy Downing, Antonio Michael. Downing, K. K. Doyle, Alan Doyle, Tom Doyle, David M. Dózsa, K Dr. Rolf von Bockel Drabløs, Per Elias Drach, Saša Dragheim-Lauritsen, Tejs Dragonová, Martina Draheim, Joachim Drake, Nick J. Draper, Jason. Dratwicki, Alexandre. Drecki, Jacek Roman Drees, Stefan Drever, John Levack Dreyfus, Kay Driscoll, Jim Driscoll, Colin Driscoll, Christopher M. Dromey, Christopher Droumeva, Milena Drudy, Andy Drury, Sara A. Mehltre Drury, Jeffrey P. Mehltre Drury, John Drüner, Annie-Laure Drüner, Ulrich Dryden, Lynn Drysdale, John D. Du, Xinping = 杜新平 Dubber, Andrew. Dubois, Pierre DuBreuil, Alexandre Duch, Michael Francis Duchesneau, Michel Dudrah, Rajinder Kumar Dueck, Jonathan Duff, Jeff Duffett, Mark Duffy, Timothy Duffy, Michael J. Duffy, Michelle Dufour, Denis. Dufour, Valérie Dugan, Franjo Dukay, Barnabás Dukay, B Dunbar, Julie C. Duncan, Dayton Duncan, Stuart P. Duncan, Cheryll Duncan, Cheryll. Dunedin Dancers. Dungan, Myles Dunkel, Mario. Dunn, Henry Dunsby, Jonathan Durakoglu, Aysegul Duraković, Lada Durkin, Rachael Durney, Daniel Durrand, Mark Dusinberre, Edward Dümling, Albrecht Dürrfeld, Peter. Dvořák Society for Czech and Slovak Music, Dwyer, Benjamin Dyck, Kirsten Dyer, Joseph Henry Dylan, Bob Dyndahl, Petter. Eagle, Douglas Spotted Eames, Michael Earle, Ben Earles, Andrew Easlea, Daryl. Easlea, Daryl Eavis, Michael Eavis, Emily Ebenezer, Lyn. Eberhardt, Markus Ebrecht, Ronald. Echard, William Echeverría, María del Puy Pe Ecke, Andreas Eckes, Jutta Eckhardt, M Eckhardt, Mária Ecsedi, Zsuzsa Ed.), Ossa-Martínez; Marco Anto Edel Germany GmbH Edexcel (Organization) Edgar, Kate. Edgar, William Edgar-Hunt, Robert Edinburgh University Library. Edith Cowan University. EDITION GORZ Edjabe, Ntone Edling, Anders. Edling, Cecilia Wahlströ Edling, Anders Edlund, Bengt Edström, Olle Edwards, Janet. Edwards, Scott Lee Edwards, Christine Egan, Sean Egea, Susana Egeland, Ånon Egey, Emese Eggenschwiler, Byron Eglinton, Mark Ehmann, Julia Ehrlich, David Ehrlich, Robert Eigeldinger, Jean-Jacques. Eigeldinger, Jean-Jacques Eilish, Billie Eisel, John C. Eisendle, Reinhard Ejeby, Bo Eken, Cecilie Ekenberg, Anders Ekho Verlag Eklund, Christer. Eklund, Karl Johan Elek, Koloh Elgar, Edward Elgar, Alice Elias, Berner Elie, Paul Elixir Piping and Drumming (Firm), Elkins, Elizabeth Elliott, Paul Elliott, David J. Elliott, Richard Ellis, Katharine Ellis, Karen Ellis, Sarah Ellis, Carl Ellis, Sarah Taylor Ellison, Curtis W. Ellison, Barbara Ellsworth, Therese. Ellsworth, Jane Elms, Anthony Előd, Juhász Elowsson, Anders Elphick, Daniel Elsby, Jon Elsea, Peter Elvira-Esteban, Ana Isabel Elvira-Esteban, Ana-Isabel Emile, Wennekes Emília, Barna Emmerson, Simon Emmery, Laura V. Emőke, Sántha Encabo, Enrique. Encabo-Fernández, Enrique Encabo-Fernández, Enrique Ender, Daniel Ender, Daniel. Endō, Tōru Endre, Halmos Endre, Hegedűs Engelbrecht, Henrik Engl, Stefan Engleheart, Murray English, T. J. English, Helen J. English, Lawrence. English Hymnal Co., English National Opera, English National Opera. Englund, Axel Englund, Axel Engström, Andreas Enikő, Gyenge Eno, Brian Enstice, Wayne Eősze, L Eötvös, P Epstein, Dan Epstein, Marcia Jenneth Epting, Chris Érdi, T Erdmann, Hans Erickson, Kris Ericson-Roos, Catarina Erika, Nyerges Erika, Simon Erika, Fernbach Eriksen, Dorthe Eriksen, Jan Eriksson, Gunnar Eriksson, Jeanette Eriksson, Karin L. Eriksson, Karin. Eriksson, Maria Eriksson, Josef Eriksson, Magnus Eriksson, Åke Eriksson, Torbjörn Eriksson, Maria Erlmann, Veit Ernő, Kiss Erricker, Jane Erwin, Max Escuer-Salcedo, Sara Eshbach, Robert Whitehouse Espada, Martín Espeland, Magne I. Espiña-Campos, Yolanda Espínola, Francisco Espinosa, Santiago Esse, Melina Essex, David Esteve-Faubel, José María Esteve-Roldán, Eva Esteve-Roldán, Eva Estévez-Sola, Juan A. Eszter, Gombocz Ethniko kai kapodistriako panepisti̲mio Etter, Brian K. Etxebeste-Espina, Elixabete Etxeverria-Jaime, Jesús European Cantors Association, Éva, Fehér Éva, Kelemen Éva, Bieliczkyné Buzás Éva, Fehérné Sulyok Éva, Kondicsné Kovács Evans, Mark Evans, Timothy Evans, Julie Evans, Bob Evans, Steve Evans, Elfed Evans, David Evans, Mike Evans, David T. Evans, Tristian Everett, Walter Everett, William A. Everett, Andrew Everist, Mark. Everist, Mark Everley, Dave Evertsson, Maria Ewens, Hannah Eybl, Martin. Eybl, Martin Eydmann, Stuart Ezaki, Kimiko Ezquerro-Esteban, Antonio Fabényi, J Faber, Phillip Faber, Phillip. Fábián, Éva Fabian, Dorottya Facci, Serena. Fadipe, Israel A. Fadnes, Petter Frost Fagan, Gerald Fagerström, Eskil Fagius, Jan Fagius, Gunnel Fahlander, Thomas Faiman, David Fairbrass, Fred Fairbrass, Richard Fairchild, Charles Fairclough, Pauline Fairclough-Isaacs, Kirsty Fakir, Abdul Falco, Raphael Falconer, Tim Falkman, Carl Johan Fallon, Robert Falola, Toyin Falthin, Annika Falus, A Fan, Linlin = 范琳琳 Fancourt, Daisy Fang, Xiao = 方晓 Fanni, Hende Fanning, David Fano, Michel Fantappiè, Francesca Fantini, Bernardino. Fargeton, Pierre Fargion, Janet Topp Fariza, Paulina Farkas, Z Farkas, Z Farkas, Iván Farncombe, Tom. Farnsworth, Brandon Farr, Ray Farraj, Yasamin Farrell, Isabel Fassler, Margot Elsbeth Fast, Susan. Fast, Barbara Fatou, Kandé S Faulds, Katrina Faulk, Barry J. Faulkner, Simon Faulkner, Robert Faure, Michel Fauré, Gabriel Fauser, Annegret Fay, Brendan Fazakas, I Fazekas, G Fazekas, Gergely Fazekas, G Fearnley, James Featherstone, Sally Federico, Gabriel Fedoszov, J Fedrová, Stanislava Fein, Michael Fejérvári, Boldizsár Fejérvári, B Fejős, J Fekete, A Fekete, Károly Feldman, Zev. Feldman, Morton. Feldman, Morton Feldman, Heidi Carolyn Feldman, Evan Feldman-Barrett, Christine Jacqueline Feldstein, Ruth Fell, Mark Fell, Alex Fellani, Matin Felton, Dickie. Feneyrou, Laurent Fenlon, Ian Fenlon, Iain Fenton, Kathryn Fényes, G Ferenc, Verseghy Ferenc, Liszt Ferenc, Szénási Ferenc, Rátkai Ferenc, Apró Ferenczi, I Ferge, Béla Ferguson, Paul Ferić, Mihael Fernandes, Cristina Fernández, Gabriel Fernández-de-Latorre, R. Fernández-Manzano, Reynaldo Ferrada-Noli, Nicholas Ringskog Ferraguto, Mark Ferraiuolo, Augusto Ferrari, Brunhild Ferrari, Giordano. Ferreira, Manuel Pedro Ferreiro-Carballo, David Ferrer-Cayón, Jesús Ferrero, Lena Kagg Ferrett, D Ferri-Durà, Jaime. Ferris, William R. Fertel, Rien Ferzacca, Steve Festival de Música Antigua de Úbeda y Baeza Feurzeig, Lisa Feustle, Maristella Fèis Rois. Fhuartháin, Méabh Ní Fiala, Michele Fiddes, Luke Fiegel, Eddi. Field, Kim Fields, Kenneth Fifer, Julian Fifield, Christopher Fifield, Christopher Figueiredo, Marcio Figueroa, Michael A. Filippi, Daniele V. Fillerup, Jessie Fillion, Éric Fink, Jesse Finnerty, Adrian Finney, John Finscher, Ludwig Finzi, Gerald Fiore, Ivana Fiorentino, Giuseppe Fischer, Rebecca Fischer, Paul Fischlin, Daniel. Fischlin, Daniel Fišer, Ernest Fisher, Elizabeth Fisher, Mark Fiskvik, Anne Margrete Fitch, Fabrice FitzGerald, Martin Fitzgerald, Mark Fitzner, Frauke Fitzpatrick, Rob. Fjord, Jens Viggo Flack, Michael Flannagan, Andy Fleet, Paul Fleischer, Rasmus Fleischmann, Ruth Fleischmann, Tilly Fleischmann, Walter Fleming, Michael Jonathan Fleming, Simon Fletcher, Tom Fletcher, K. F. B. Fletcher, Tony. Fletcher, Tony Flintoff, Brian Flom, Jonathan Floquet, Oreste Flores-Fuentes, Juan Floridou, Georgia A. Floros, Constantin Flōrou, Louiza Flotzinger, Rudolf Floyd, James Michael Floyd, J. B. Floyd, Samuel A. Floyd, Richard Flury, Roger Flynn, Amanda Flynn, Patricia Földváry, MI Foley, Catherine E Foley, Catherine E. Foley, Byron Folkehojskolernes Forening i Danmark Fong-Torres, Ben Fong-Torres, Ben. Fonseca, Anthony J. Font-Batallé, Montserrat Fontán-del-Junco, Manuel Fontijn, Claire Anne Foon, Anthony Forbidden City (Nightclub: San Francisco, Calif.) Ford, Robert Ford, Charles Ford, Elizabeth Forde, Eamonn Foreman, Lewis. Forgács, Robert Forkel, Johann Nikolaus Forrest, Arick. Forrest, Nigel. Forsberg, Jan Foršek, Goran Forsell, Jacob Forsén, Arne Forssell, Jonas Forster, Robert Forster, Robert Fortey, Bryn. Fosbraey, Glenn Fosbraey, Glenn. Foss, Hubert J. Foss, Dora. Foster, Stephen Collins Foster, Mick Foster, Mo. Foster-Peters, Kelly-Jo Foulk, Ray Foulk, Caroline Foulkes, Julia L. Foundling Museum, Fouter-Fouter, Vera Fowke, Philip Fowler, Gene Föllmi, Beat A. Fraga-Suárez, Fernando Fraile-Gil, José Manuel. Fraile-Prieto, Teresa Frame, Pete Frampton, Peter Frances-Hoad, Cheryl Francfort, Didier. Franke, Leander Franke, Leander. Frankel, Emile Franklin, Neil Franklin, Dan Franks, Don Franziska, Diehr Fraser, Neil Fraser, Benjamin Fratini-Serafide, Roberto Frayssinet-Savy, Corinne Fredriksson, Niclas Fredriksson, Daniel Freeman, Phil Freeman, Dean Freeman, Peter Freeman, Robert Freestone, Brian D. Frego, R. J. David Frehley, Ace. Freiburghaus, Gabriela French, Stewart French, Mark Frenkel, A Frenz, Barbara Freund, Julia Friberg, Anders Frid, Emma Friddle, David Friedberg, Jeffrey Frieden, Ken Friedl, Erika Friedler, M Friedman, Allan Jay Friedmann, Jonathan L. Friedrich, Á Friehs, Julia Teresa Frierson-Campbell, Carol Friesen, Orin Frigyesi, Judit Frith, Simon Fritsch, Melanie Froehlich, Hildegard C. Frolova-Walker, Marina Frölich, Emilia. Frühauf, Tina Fry, Robert W. Fu, Hong = 傅鈜 Fuchs, Emily Fuchs, Dieter Fuente-Charfolé, José-Luis Fügedi, J Fugelso, Karl Fuhrich, Edda Fuhrmann, Wolfgang Fukuoka, Madoka. Fukuoka, Shōta. Fukushima, Kazuo Fukushima, Mutsumi Fuller, Nicholas Lester Fuller, Sophie Fundación Juan March, Fung, Victor. Furia, Philip G, Németh Gaar, Gillian G. GABARRÓN-TORRECILLAS, Antonio-Francisco Gabbard, Krin Gábor, Vásárhelyi Gábor, Barna Gábor, Eredics Gábor, Turi Gábor, Winkler Gábor, Simon Géza Gábor, Sarbak Gábor, Presser Gábriel, Szoliva Gabriēl, Angelos Gabriella, Gilányi Gaddy, K. R. Gademan, Göran Gádor, Ágnes Gádor, Á Gadpaille, Michelle Gagné, Nicole V. Gagné, David Gaifem, Monica Gaines, Jim Gaitanos, Kōstēs Galán-Bueno, Carlos Galán-Gómez, Santiago Galbraith, Patrick W. Galiana-Gallach, Josep Lluis Galicia-Poblet, Fernando Galilea, Carlos Galindo, João Maurício Galindo-Pozo, Miguel Gall, Zlatko Gall, Gregor Gallagher, Miriam Gallardo, Gemma Gallardo-Saborido, Emilio José Gallego, Antonio Gallet, Bastien Galloway, Vic Galpérine, Alexis Galuszka, Patryk Galvin, Anthony Gambetta, Beppe Gamble, Steven Gammond, Peter Gann, Kyle Gannon, Charles Gant, Andrew Gao, Tian = 高天 Garay, Ramón Garbage (Musical group), Garbayo-Montabes, Francisco-Javier Garber, Michael G. Garcia, Carlos-Benito García, Eliseo Garcia-Arevalo-Alonso, Julia García-Asensio, Enrique García-Gómez, Génesis García-Herrera, Vanessa García-Lorca, Federico García-Mahíques, Rafael García-Manzano, Julia-Esther García-Martínez, Rafael García-Matos-Alonso, María-Carmen García-Molero, Hayda García-Molina, Rafael García-Peinazo, Diego Garcia-Testal, Elena García, Esperanza Rodrígue García-López, Olimpia García-Montalbán, Antonio. Garda, Michela. Gardiner, John Eliot Gardiner, Michael C. Gardiner, John Eliot Gardner, Elysa Gardner, Robert Gardner, Abigail Gardner, Matthew Gárdonyi, Zs Gargagliano, Arlen Garneau, Michel Garner, Anita Faye Garnham, A. M. Garrett, Peter. Garrett, Valerie. Garrido, Sandra Garrido, Waldo Garrido-Aldomar, Miguel Garrido-Domené, Fuensanta Garry, Catherine Garst, John F. Gartz, Thomas Mera Garza, Luis Díaz-San Gasch, Stefan Gaspar-Grandal, Jacobo Gaston-Bird, Leslie Gatenby, Phill Gates, Rachael. Gatsioufa, Paraskevi. Gatti, Tom Gaulier, Armelle Gault, Brent M. Gault, Dermot. Gauthier, David. Gauthier, Mary Gautier, Théophile Gavanas, Anna Gavin, James Gayraud, Agnès Gazarik, Richard Ge Sang Qu Jie = 格桑曲杰 Gebhardt, Nicholas Geck, Martin Geck, Martin. Geesin, Ron Gégény, I Gehlawat, Ajay Gelabert, Cesc Gelbart, Matthew Gembero-Ustárroz, María Gemmell, Keith. Genborg, Catrin Gentil, Nicky Geoffroy-Schwinden, Rebecca Dowd GeoMotion Group. George, Thandi George-Warren, Holly Georgi, Oliver Georgiev, Kiril. Georgii-Hemming, Eva Gerald Coke Handel Foundation, Gerald Coke Handel Foundation. Gergely, Hubai Gergely, Fazekas Gergely, Szilvay Gergely, Z Gerhard, Roberto Germain, Emmanuelle Germano, William P. Gerothanasi, Stamatia Gerup, Martin Gerup, Anders Gethers, Peter Getman, Jessica Giannini, Juri Giannini, Juri Giannopoulos, Emmanouēl Gibbard, Alun Gibbon, Sarah Jane Gibbons, William Gibbs, Christopher H Gibson, Barry. Gibson, Chris Gibson, Kirsten Gibson, Corey Gibson, Colin Gibson, David Giddens, Rhiannon Giddings, Steve Gidman, Jean Giese, Detlef. Gilabert, Gastón Gilányi, G Gilányi, Gabriella Gilbert, Joël Gilbert, W. S. (Willia Gilbert, Susie Gildart, Keith Gilkes, Cheryl Gill, Denise Gill, Andy. Gill, Craig. Gill, Jon Ivan Gillan, Matt Gilles-Kircher, Susanne. Gillespie, Robert Gillett, Christopher Gillies, Richard Louis Gillies, Anne Lorne Gillin, Edward John Gilling, David F. Gilling, Tom Gillon, Les Gilman, Sander L. Gilmore, Tom Gilmore, Ruth Wilson Gilmore, Joe Gilroy, Andrea Gilson, D. Giménez-Morte, Carmen Ginell, Cary Giner, Bruno Ginger, Charlie Giovanni, Varelli Girard, Philippe Girardi, Michele Giray, Selim Giroud, Vincent. Giroud, Vincent Girsberger, Russ Giselbrecht, Elisabeth Gittins, Ian. Gittins, Ian Giuffre, Liz Giuntini, Roberto Giuriati, Giovanni Gladsø, Svein Glass, Philip Glatthorn, Austin Glauert, Amanda Glazer, Mitch. Gleeson, Clare Glennie, Evelyn Gligo, Nikša Glinsky, Albert Glitsos, Laura Glover, Jane Gluck, Bob Glyn, Gareth Glynn, Stephen. Gobbato, Angelo Goddard, Simon Goddard, Michael Goddard, Simon. Godefroy, Cécile Godin, Gérald Goertzen, Chris Goertzen, Valerie Woodring Goialde-Palacios, Patricio Goldberg, Michael Goldberg, Meira Goldberg, Tatjana Golden, Reuel Goldin-Perschbacher, Shana Golding, Rosemary A. Goldman, Jonathan Goldman, Vivien Goldmark, K Goldschmidt, Henrik. Goldschmitt, K. E. Goldsmith, Melissa Ursula Daw Goldstein, Jack. Golia, Maria Golovlev, Alexander Golub, Peter Gombos, L Gombos, L Gombos, László Gómez-Cifuentes, Blanca Gómez-Fernández, Lucía Gomez-Gallego, Alonso Gómez-Muntané, María- Carmen Gomm, Eric Gon, Federico Gonin, Frédéric. Gonnard, Henri. Gonzales, Chilly Gonzales, Chilly Gonzalez, Sara González-Barrionuevo, Herminio González-Lapuente, Alberto González-León, Julia-Edna González-Martínez, Juan-Miguel González-Mira, Pedro González-Ribot, María José Gonzalezné, V Gonzalo, Jaime González, Francisco González-Barba-Capote, Eduardo González-Serrano, Carlos Javier. Good-Perkins, Emily Goodall, Howard. Goodman, Alice Goodman, Elizabeth Goodman, Alice. Goodman, Fred Goody, Matthew Goody, Matthew Goodyear, David Turnbull Gopinath, Sumanth S. Gordienko, Anastasia Gordon, Lisa Gordon, Anna Gordon, Alastair Gorfinkel, Lauren Gorman, Paul Goron, Michael Gottlieb, Jane Gottlieb, Iris Gouk, Penelope. Gouk, Penelope Gould, Jonathan Govan, Chloe. Govan, Chloe Gowen, Bradford Gómez, Francisco Gómez-Castellano, Irene Gómez-Cruz, Camilo. Gómez-Muntané, María del Carmen Gómez-Rodríguez, José-Antonio Götte, Ulli Graakjær, Nicolai Graber, Naomi Grabowski, Stephan Grabócz, Márta Grace, Delilah. Gracon, David Gradowski, Mariusz Graffin, Greg Graham, Ben Graham, Stephen Graham-Jones, Ian Grainger, Percy GRAMMY Museum. Grana, Natalie Douglass Granger, Brian Cornelius Grant, Colin Grant, Nevin Grant, Jane Grapes, Dawn Grapes, Dawn Grasse, Jonathon Grassl, Markus Grassl, Markus. Grau, Anna Kathryn Graves, Eben Graves, Milford Gravestock, Joy. Gray, Timothy Greager, Rosemary Great Britain. Green, Jeffrey. Green, Ben Green, Robert A. Green, Andy Green, Johnny Green, Helen Green, Ian Green, Nick Green, Jenny Green, Alan Green, Jesse Green, Lucy Green, Lucy Green, Laura Gayle Greenacombe, John Greenberg, Yoel Greenberg, Keith Elliot Greene, Taylor Greene, Tom Greene, Jeffrey Greene, Richard Leighton Greenfield, Edward Greenfield, Thomas Allen Greenman, Ben Greer, David Gregor, Neil Gregory, Georgina. Gregory, David Gregory, Glenn Gregory, Georgina Greig, Donald Grenier, Line Grennell, Katherine GRGIĆ, Velimir Gribenski, Fanny Gridley, Mark C. Grieg, Rebecca Grier, James Grierson, Tim. Grierson, Tim Griffin, Michael J. Griffin, Michael Griffiths, Daniel Grigg, Simon Grillo, Jerry Grimaldi, Marco Grimalt, Joan Grimes, Nicole. Grimley, Daniel M. Grimshaw, Mark Gripentrog, Helmuth Griscom, Richard. Grocke, Denise Erdonmez Grogan, Christopher Grogan, Suzie Gróh, Gállné Groos, Arthur. Groote, Inga Mai Groothuis, Marijke Grosen, Peter Grove, George Grover-Friedlander, Michal Grozdits, K Gruber, Gernot Gruhn, Wilfried Grushkin, Paul Grünewald-Schukalla, Lorenz Grzebałkowska, Magdalena Gschwandtner, Harald Gu, Yumie = 谷玉梅 Gudmundsdottir, Helga R. Guerpin, Martin Guerra, Paula Guerriero, Leila Guesdon, Jean-Michel Guesnet, François Guest, John F. Guglielmetti, Yohann Guigné, Anna Kearney Guilbault, Jocelyne Guildhall School of Music and Drama (London, England) Guildhall School of Music and Drama (London, England), Guillaumier, Christina Guillot, Matthieu. Guilloux, F. Guilmard, Jacques-Marie Guiltenane, Christian. Guionnet, Jean-Luc Gullberg, Anna-Karin Gullbrandsson, Robin Gullö, Jan-Olof Gumplowicz, Philippe Gunji, Masakatsu Gunn, Jacky Gunnarson, Anna Charlotta Gunnarsson, Ulrika Gunrem, Michael E. Guns n' Roses (Musical group). Guo, Jie = 郭洁 Gurd, Sean Alexander Gurke, Thomas Gusau, Sa'idu Muhammad Gustafson, Klas Gustafsson, Henrik Gustafsson, Magnus Gustafsson, Lars H. Guthrie, Kate Guthrie, Nora Guthrie, Woody Gutiérrez-Carreras, Pablo Gutiérrez-Carreras, Pablo. Gutiérrez-Cordero, María Rosario Guy, Nancy Guzy-Pasiak, Jolanta Gwizdalanka, Danuta. Gyenge, E Gynne, Göran Gyöngyi, Mátai Gyöngyvér, Hortobágyi Gyöngyvér, Havas Györffy, M György, Solti György, Csobó Péter György, Nagy György, Hegedüs György, Szomory György, Jókúti György, Gyarmati György, Rusznák György, Székely Győri, L Győri, Zsolt Gyula, Hegedűs Gyula, Ajtonyi Gyula, Juhász Haapala, Tuomo Haas, Anita Hackett, Jon Haddon, Alfred C. Haering, Sylvia Ingeborg Haffner, Herbert Hagen, Trever Hageneder, Fred. Hagerman, Frans Hagestedt, Jens Hagiya, Yukiko Haglund, Rolf Haglund, Magnus Hagmann, Lea Hahn, Christopher Haikawa, Mika Hainge, Greg Hair, Ross Hajdók, J Håkanson, Knut Håkansson, Kenny Halász, Péter Halford, Rob Halfyard, Janet K. Hall, Clare Hall, Þorbjörg Daphne. Hallag, Alexander Hallam, Julia Hallam, Susan. Hallgren, Scott W. Halligan, Benjamin. Halligan, Benjamin Halling, Ingmarie Halliwell, Martin. Halliwell, Michael Hallman, Diana R. hAllmhuráin, Gearóid Ó Halper, L Hamanaka, Masatoshi Hamann, Martin Hamann, Donald L. Hamberlin, Larry Hambro, Camilla Hamelman, Steven L. Hamer, Laura Hamilton, Katy Hamilton, Duncan Hamilton, Kenneth Hamilton, Andy Hamilton, David A. Hamlyn, Nick Hammarlund, Rolf Hammarlund, Ingrid Hammarlund, Jan Hammer, Ken Hammerstein, Oscar Hammond, Alan Hammond, Nicholas Hampe, Michael Hampson, Thomas Hampton, Andy Hampton, Nick Hanberry, Gerard Hancock, Herbie Hancox, Grenville Handel House Trust, Hanenberg, Peter Hanke, Maureen. Hanna, Emma Hannah, Jonny Hanns-Werner, Heister Hansén, Stig Hansen, Mads Hansen, Adam. Hansen, Lene Halskov Hansen, Pil Hansen, Kai Arne Hara, Nobuo. Harada, Theresa Harada, Kaori Hardasmal, Sergio Hardi, R Harding, Charlie Harding, J. T. Harding, Phil Hardy, Martha Hargittai, Esther Hargreaves, David J. Hargreaves, Sam Harkins, Paul Harley, John Harmsen, Sophie Harnoncourt, Nikolaus. Harper, Nancy Lee Harper, Sally Harper, Ben Harper, Ellen Harper, Adam. Harper-Scott, J. P. E. Harpham, Geoffrey Galt Harrandt, Andrea Harrán, Don Harries, Judith Harrington, James Harris, Paul Harris, Craig Harris-Warrick, Rebecca Harrison, Peter T. Harrison, Danny Harrison, Sarah Harrison, Brady Harrison, Carol Harrison, Chris Harsent, David Harsløf, Olav Hart, Chris Hart, Colin Hart, Chaz Harte, Frank Hartenberger, Russell Hartl, Karla Hartley, John Hartmann, Astrid Pernille Hartmann, Annette Hartnoll, Paul Hartnoll, Phil Hartse, Joel Heng Hartt, Jared C. Hartyányi, Judit Harvard, Paul Harvey, Peter Harvey, Ryan Harwell, Jonathan H. Harwood, Robert W. Hascher, Xavier Haskins, Rob Hassler-Forest, Dan Haste, Cate Haste, Cate Hasted, Nick. Hasted, Nick Hasted, J. B. Hastey, Britt Hasty, Christopher Hasty, Christopher Francis Hatschek, Keith Hatter, Jane D. Hatzius, Lynn. Haupt, Adam Hauschka, Thomas Haute école de musique (Geneva, Switzerland), Haute école spécialisée de Suisse occidentale, Havas, Ádám Have, Iben Havelková, Tereza Havers, Richard Havránková, Lucie. Hawkey, James Hawkins, Kris Hawkins, Stan Hawkins, Rosa Hawkshaw, Susan Haworth, Rachel Hay, Chris Hayes, Aaron Haynes, Grace Hayslett, Bryan Hayton, Jeff Hayward, Philip Hayward, Mark. Hazlewood, Dave. Hâf, Mererid He, Fang He, Rong = 何荣 He, Yan = 何言 He, Yanshan = 何艳珊 He, Zipu = 何滋浦 Head, Raymond Head, Matthew Head, Paul Heal, Jamie Heath, Chris Heatley, Michael Heber, Noelle M. Heble, Ajay. Heble, Ajay Heble, Edited by. Edited Heckendorff, Nastasia Hédi, Sztanó Hedman, Dag Hedwall, Lennart Hegarty, Paul. Heile, Björn Hein, Morten Hein, Hartmut Hein, Ethan Heine, Christiane Heinemann, Michael. Heintz, Joachim Heintze, James R. Heisser, Jean-François Heister, Hanns-Werner Heisz, Tommy Heldt, Guido Helguera-Villa, Enrique Hellaby, Julian Hellín-Rubio, Inés Hembree, Mark Hemmingsen, Piers A. Henderson, George L. Henderson, Justin Henderson, David Henderson, Amy Henderson, John Hendler, Glenn Hendrickx, Marc Hendrikx, Eric. Hendrikx, Eric Hendrix, Janie Hendrix, Michael Henke, Matthias Henley, Darren. Hennessy, Sarah Henry, Dollie Henry, Pierre Henrysson, Harald Hensher, Philip Henson, David Hentschel, Linn Hentschel, Christian. Hepworth, David Hepworth-Sawyer, Russ Heras, Beatriz Herbert, Trevor Herbert, Peter J. F. Herbert, Ruth Herbert, Martin Herbert, Emily Herbert, Trevor. Herczka, Ferenc Herencsár, V Hergyán, T Herissone, Rebecca. Herle, Anita Herman, Arne Herman, Debbie Herman, Pawel Hermano-Ahullo, Ramón Hermes, Kirsten Hernández-Jaramillo, José Miguel J.M. Hernández-Sonseca, Carmen Hernández-Urculo, Zaida Hernández, Rafael Figueroa Hernández, David Heron-Allen Society. Herpy, Miklós Herren, Graley Herrmann, Timo Jouko Herrmann-Schneider, Hildegard Hersch, Charles Hersh, Kristin Hersh, Kristin. Herstand, Ari Hertzman, Marc A. Herzfeld, Gregor Herzig, Monika Hesmondhalgh, David Hess, Alan Hess, Juliet Hesse, María Hesselink, Nathan Hetény, J Heter, Storm Hewitt, Paolo Heydon, Rachel Heylin, Clinton Heylin, Clinton. Hérault, Catherine. Hibberd, Sarah Hibbett, Ryan Hichens, Mark Hickey, Helen Hickman, Sally. Hickmott, Sarah Hicks, Anthony Hidalgo, Danielle Antoinette Hiekel, Jörn Peter Hiemke, Sven Hiesel, Stefanie. Higgins, Lee Higuchi, Akira Hijleh, Mark Hill, Sarah Hill, Michael. Hill, Kevin Hillman, Neil Hills, Helen Himonides, Evangelos Himonides, Evangelos. Hindemith, Paul Hindemith-Stiftung, Hindle, David Hinson, Maurice Hintermaier, Ernst. Hirai, Mitsuru. Hirai, Nataria emi. Hiramatsu, Hideki. Hirata, Akiko. Hirata, Keiji Hirota, Ritsuko. Hirsch, Lily E. Hirsch, Marjorie Wing Ho, Tung-Hung Ho, Wai-chung Hoad, Catherine Hoag, Melissa E. Hoban, Wieland Hoch, Matthew Hochmiller, Susan Hochradner, Thomas. Hochradner, Thomas Hodge, Daniel White Hodges, Natalie Hodges, David Hodges, Chas Hodges, Donald A. Hodgkinson, Tom Hodgson, Jay Hodkinson, Mark Hoeckner, Berthold Hoefnagels, Anna Hoefnagels, Anna. Hofer, Johann Hoffman, Stewart Hoffmann, Bettina Hoffsten, Louise Hofman-Sretenović, Neda Hofmann, Alex Hogen, Hildegard. Hogg, Katharine Hogmark, Esbjörn Hogwood, Christopher Hojby, Jeanette Holbrook, Ann Norton Holden, Raymond Holden, Wendy Holdhus, Kari Holdhus, Kari. Holgersson, Per-Henrik Hollai, Keresztély Holland, Simon Hollerung, G Holley, Chuck Hollitzer Wissenschaftsverlag Holm-Lupo, Jacob Holman, Peter Holmberg, Henric Holmes, Martin Holmes, Matthew. Holmes, Ramona Holmes, Thom Holmgren, Carl Holmgren, Ola Holmgren, Claes Holmquist, Göran Holmquist, \AAke Holoman, DK Holroyd, Arthur Holt, Thomas J. Holt, Macon Holtsträter, Knut Holzer, Andreas Holzer, Andreas. Homan, Shane Homan, Shane Homer, Sheree Hong, Barbara Blanchard Honing, Henkjan Honrado-Pinilla, Alberto (Ed.) Honrado-Pinilla, Alberto Hood, Alison Hood, Danielle Hook, Peter Hooper, Ellen Hooper, Michael Hoover, Sarah Adams Hoover, Timothy R. Hope, Cat Hope, James Hopkin, Bart Hopkins, Adrian Hopkins, Antony Hopkins, Adrian. Hopper, Jessica Hopwood, Mererid Horák, M Horan, Geraldine Horgas, J Hori, Tomohei. Horlacher, Gretchen Grace Horlor, Samuel Hormigón-Vicednte, Laura Hormigón-Vicente, Laura Horn, Charles E. Horn, David Hornby, Nick. Hornby, Emma Horne, Gerald Horne, Craig. Horne, William P. William Horowitz, Mark Eden Horton, Julian Horton, Peter Horton, Julian Horvat, Hrvoje Horváth, Attila Horváth, A Horváth, Breinichné Horváth, ML Horz, Andrea Hoshino, Yukiyo Hosken, Daniel W. Hoskins, Robin HOskins, Robert Hoskisson, Darin Hoskyns, Barney Hosmer, Brian C. Hosono, Takaoki. hosono, shinji Hotta, Eri Hou, Jiancheng Hou, Lemeng = 侯乐萌 Hough, Stephen Houghton, Mick Housley, Paul Houston, Cissy Houston, Kerry Hovánszki Mária Howard, Deborah. Howard, Stephen Howard, Chris Howard, Keith Howard, Mark Howard, Jack. Howard, Alan Howard, Richard Bothway. Howard, David M. Howden, Martin Howe, Zoë Howe, Richard Howell, Mark Howland, John Hoy, Rory Höhn, Jiří Hölderlin, Friedrich Hrubín, František Hsu, Wei-En Huan Ping Xian Di Fang Zhi Ban Gong Shi = 黄平县地方史志办公室 Huang, Patrick Huang, Jianmin = 黄剑敏 Huber, David Miles Hudes, Quiara Alegría Hudson, Paul Huebner, Steven. Huehns, Colin Huet, Pierre Hughes, David W. Hughes, Shirley Hughes, Marian Beech Hughes, Brian Hughes, Diane Hughes, Owain Arwel Hughes, Charles L. Hughes, Gareth Pritchard Hugill, Andrew Huguet, Joan Campbell Huitker, George. Hultberg, Cecilia K. Hultén, Mårten Nehrfors Humphreys, Alastair Humphries, Glen Humphries, Patrick. Hunsaker, Leigh Anne Hunt, John Hunt, Helena Hunter, David Hunter, Dave Hurley-Glowa, Susan Margaret Hurrell, Nancy Hurwitz, David Huseynova, Aida Hutchence, Tina Hutchinson, Sydney Huygens, Christiaan Hünten, Franz Hyde, Jenni Hyde, Derek Hyden, Steven Hyldgaard, Rikke Hyman, Nicola. Hyman, Robert. Hyōki, Satoru Hytönen-Ng, Elina. Høgel, Sten Hørdum, Søren. Iazzetta, Fernando Ibn Ḥayyān, Abū Marwān H Iddon, Martin Ideguchi, Akinori Ideland, Jens Igbi, Oghenemudiakevwe Iges, José Iges-Lebrancón, José Iglesias-Iglesias, Iván Iglesias-Martínez, Nieves Ignácz, Á Ignácz, Ádám Ihnat, Kati Ikushima, Mikiko Ilari, Beatriz Senoi Ilić, Ivana Ilona, Ferenczi Ilona, Kovács Immler, Christian Impett, Jonathan Impey, Angela Imre, Harangozó Imre, Romsics Imre, Olsvai Information Resources Management Association, Ingalls, Monique Marie Ingalls, Monique Marie. Ingemark, Camilla Asplund Ingham, Chris. Ingham, Chris Ingham, Michael Inglis, Ian Inglis, Brian Ingolfsson., Árni Heimir Ingólfsson, Árni Heimir Ingraham, Mary I. Ingram, Catherine Inomata, Tokiwa Inose, Chihiro Inoue, Takahiro Inōe, Sayuri. Institute of Measurement and Control. International Conference Music Theory and Analysis (9 ; 2011 ; Beograd) International Council for Traditional Music. Study Group on Music and Dance in Southeastern Europe. Symposium (6 ; 2018 ; Sinj) International Music Education Research Centre. International Musicological Society International Society for Music Education. Internationale Richard-Strauss-Gesellschaft Internationale Stiftung Mozarteum Salzburg. Iommi, Tony. Iott, Sheryl Iovene, Paola Ippolito, J. M. Irby, Samantha Ireland, Brian Irons, Yoon Irvine, Thomas Irwin, William Irwin, Colin. Irwin, Colin Isacoff, Stuart Isacsson, Jonas Isakoff, Katia Ishida, Yutaka Isnard, Vincent. Isserlis, S Isserlis, Steven István, Pávai István, Bátori László István, Németh István, Kilián István, Gróf István, Korody-Paku István, Elmer István, Kereszty István, Balázs István, Mustos István, Bogárdi Szabó István, Gáti István, Berczelly Istvandity, Lauren Isusi-Fagoaga, Rosa Ittzés, M Ittzés, Mihály Ittzés, M Ittzésné, K Iturrioz-Petralanda, Nekane Iván, Cs Ivarson, Karin Iverson, Jennifer Ivković, Želimir Ž. Izabella, Bartalis Jaccard, JL Jacke, Christoph Jacks, Will H. Jacks, David Jackson, Amy S. Jackson, Laura Jackson, Andrew Grant Jackson, Seth Jackson, Sam Jackson, Maureen Jackson, Paul R. W. Jackson, Larisa Petrushkev Jackson, Daniel M. Jackson, Jake Jackson-Kew, Meryl Jackson-Tretchikoff, Julie Jacobs-Jenkins, Branden Jacobsen, Stine Lindahl Jacobshagen, Arnold Jacobson, Laurie Jacobsson, Mats Jacobsson, Stig Jacotine, Keshia Jacques, Annie Jaeger, Bertrand Jaffé, Daniel Jagger, Mick Jago, Marian Jakelski, Lisa. Jámbor, F Jambou, Louis James, Martin James, Alex James, Martin James, Barrington Jampol, Joshua. Jan, Steven B. Jancsó, J Janjik, Monika Jurić Jankovich, Richard. Jankowsky, Richard C. János, Weiss János, Sebők János, Sipos János, Béres János, Dombovári János, Fügedi János, Bereczky János, Bibor Máté János, Szabó Ferenc János, Dézsi János, Bojti Jansen, Emile Jansen, Guy Jansson, Sven-Bertil Jansson, Per Åke Jansson, Mikael Jansson, Dag Jara, Víctor Jarbouai, Leila. Jarman, Freya Jarrick, Arne Jarvis, Trevor Jas, Eric Jaschke, Artur C. Jasen, David A. Jauset-Berrocal, Jordi-Àngel Jávorszky, B Jávorszky, BS Jávorszky, Béla Szilárd Jay, Norman JayZ, JayZ Jazzforeningen Jazzinstitut Darmstadt Jäger, Markus Jeanneret, Christine Jedrzejewski, Franck Jefferies, Graeme Jena, Stefan Jena, Stefan. Jenkins, Delyth Jenkins, Willard Jenkins, Mark Jenkins, Jeff Jenkins, Katrina E. Jenkins, Jim Jenkins, Steve Jenkins, Paul Jennex, Craig. Jennings, Sarah Jennings, Ros Jensen, Oskar Cox Jensen, Kurt Balle Jensen, Erik Jensen, Anne Ørbæk Jensen, Jacob Wendt Jensenius, Alexander Refsum Jepson, Louisa Jerković, Berislav Jerold, Beverly Jersild, Margareta Jethro Tull (Musical group), Jewell, Alan. Jian, Miaoju Jiang, Ying = 蒋英 Jimenez, Javier Jiménez, José Luis Jin, Tielin = 金铁霖 JLS (Musical group), Jnr., HOwie Morrison Johann, Lurf Johansen, Geir Johansen, Guro Gravem Johansson, Karin Johansson, Anna Johansson, Ola Johansson, Carina Johler, J John, Elton John, Elton John, Corner John, Graham St. John, Emma John Ireland Charitable Trust. John Merrill Foundation, Johnson, Sherry. Johnson, Stephen Johnson, Mark Johnson, Christopher Johnson, Sherry Johnson, Joan Johnson, Carol Johnson, Jake Johnson, Bruce Johnson, David Johnson, Julian Johnson, Henry Mabley Johnson, Curtis D. Johnson, Alan Johnston, Tom Johnston, Jean Johnston, Roy Johnston, Ben Johnston, A. J. B. Jonasson, Camilla Jonášová, Milada Jones, John Jones, Richard Jones, Jacqueline Jones, Rickie Lee Jones, Tudur Huws Jones, Gerry Jones, Joseph E. Jones, Barry O. Jones, Peter Jones, Kenney Jones, Kimberly A.. Jones, Ellis Jones, Thomas C. Jones, Danny Jones, J. S. Jones, Dylan Jones, David Wyn Jones, Nicholas Jones, Tom Jones, Lesley-Ann Jones, Mark Jones, Lesley-Ann Jonsson, Göran Jonsson, Bengt R. Jorba, Miquel Jordan, W. D. Jordan, Randolph Jordansson, Leif Jorgensen, Ian Jorgensen, Hanna Rose Jornadas de Zarzuela (4ª. 2016. Cuenca) Jovanović, Jelena Jovanovic, Rob. Jovanović, J Joyce, Sandra Joynson, Vernon Joynson, Vernon József, Szécsi József, Krénusz József, Fülöp József, Kozák József, Gál József, Béres József, Terék József, Brauer-Benke Józsefné, Dombi Jóri, Anita Jóri, Anita Ju, Kelin = 巨克林 Jubin, Olaf Judd, Harry Judit, Rácz Judit, Bogár Judit, Pokoly Juhász, Z Juhász, E Juhász, Zoltán Julia, Jaklin Júlia, Torda Julia, Craig-McFeely Júlia, Demeter Julich-Warpakowski, Nina Julien, Pauline Julien, Olivier Julin, Don. Jullander, Sverker Jung, Eunji Jung-Kaiser, Ute Juranić, Zoran Jurecic, Boštjan Jurij, Snoj Juslin, Patrik N. Juslin, Patrik N. Juslin, Patrik N Justice, Deborah Justice, Jacob Jørgensen, Jørgen Wenndorf K., Marquis H. Ka'ai, Tania Kaastra, Linda T. Kabeláč, Miloslav Kabir, Ayesha Kaczmarczyk, Adrienne Kádár, AJ Kagerland, Peter Kahn, Ashley Kahr, Michael Kaijser, Lars Kaiser, Martin Maxmilian Kajanová, Yvetta Kajfeš, Davor Kakubari, Wataru Kaldewey, Helma Kalinak, Kathryn Marie Kalish, Gilbert Kallberg, Jeffrey Kallio, Alexis Anja Kallis, Vasilis Kalman, Julie Kalmár, A Kaltmeier, Olaf Kälvemark, Torsten Kamilla, Dévai Nagy Kamlah, Ruprecht. Kammerchor Stuttgart, Kamp, S Kanbe, Satoru. Kanda, Kunihiko Kane, John Kaneko, Naoki Kaneko, Jun Kanellopoulos, Panagiotis A. Kanellopoulos, Panagiotis A. Kanellopoulou, Jenny Kania, Andrew Kanneh-Mason, Kadiatu Kapilow, Robert Káplán, Szofia Kapp, Reinhard Kapralova Society, Kaprálová, Vítězslava Kapronyi, Teréz Karath, Kym Karczag, M Kardamēs, Kōstas Kardaras, Chrēstos D. Kardos, Leah Karjalainen, Toni-Matti Karl, Kügle Karlin, Jason G. Karlík, Filip Karlsen, Sidsel Karlsen, Sidsel. Karlsson, Ove Karlsson, Petter Karlsson, Katarina A.. Karlsson, Lars Karnes, Kevin Károly, Libisch Károly, Fekete Károly, Sziklavári Karousos, Charalampos Kárpáti, J Karpf, Juanita Kartawidjaja, Yakub E. Karwen, Bernd. Kaschub, Michele Kasinitz, Philip Kasser, Tim Kassler, Michael Kassler, Jamie Croy Kastine, Jeremy Kata, Rácz Katalin, Juhász Katalin, Marczell Katalin, Paksa Katalin, Lázár Katalin, Kim Katalin, Szvitacsné Marton Katalinić, Vjera Katayama, Takeshi. Kathy-Horváth, L Katona, Zoltán Katona, Kerry Katz, Pamela. Katz, Jared Katz, Mark Kauffman, Deborah Kaufman, Will Kaufman, Brian Kawasaki, Mizuho Kay, Maria. Kay, Sarah Kayaki, Tōru Kaye, Lenny Kayes, Gillyanne. Kärjä, Antti-Ville Kärki, Kimi Kealing, Bob Kearney, Mark. Kearns, Robin A. Kearns, Peter Kecskeméti, I Kecskés, A Keefe, Simon P. Keegan, Josephine Kehrer, Lauron J. Keijser, Roland Kelemen, É Kelhoffer, James A. Keller, Hans Kelley, Robin D. G. Kelly, Ursula Anne Marga Kelly, Lynne Kelly, John Ellis Kelly, Steven N. Kelly, Barbara L. Kelman, Kristina Kemp, Shirlie Kemp, Martin Kendall, Roger Allen Kendall, David J. Kendall-Davies, Barbara Kennaway, James Gordon Kennaway, George. Kennedy, Gerrick Kennedy, Kate Kennedy, Ruth Kennedy, Michael Kennedy, Matthew Kennedy, James Kennedy, Victor Kenyon, Nicholas Kerékfy, M Kerékfy, Márton Kereszti, F Kerékfy, Márton Kermode, Mark Kernodle, Tammy L. Kerr, Andrew Kerr, Maureen Kerridge, Adrian Kershaw, Doug Kertz-Welzel, Alexandra Kettle's Yard Gallery. Kevorkian, Tanya Keys, Alicia Khannanov, Ildar Damirovich Kheshti, Roshanak Kidde, Geoffrey Kidner, Lisa. Kidney, Christine Kielich, Gabrielle Kielman, Adam Kierkegaard, Soren Kiiru, Kahithe Kijas, Anna E. Kikuchi, Kazuhiro Kildea, Paul Francis Kildea, Paul Francis. Kilpatrick, Emily Kilpatrick, Stephen. Kilpiö, Kaarina Kim, Helen Kim, Hyelim Kim, K Kim, Seung-A Kim, Youn Kim, Ji Kim, Youn. Kimu, Yujin. Kimura, Ryō Kinchin-Smith, Sam Kinder, Keith William King, Peter King, Liesl King, Greg King, Julian King, Elaine King, Richard King, Chris Thomas Kinga, Jálics Kinga, Povedák Kingsbury, Paul Kinsella, Ray Kinsley, Lloyd Kirby, Sarah Kirchschlaeger, Peter G. Kirilov, Kalin Kirkland, Kevin H. Kirkman, Phil Kirkman, Andrew Kishikawa, Masanori Kisiel, Marine Kiss, Gábor Kiss, G Kiss, L Kiss-Dobos, L Kitchen, John Kitts, Thomas M. Kitts, Alex. Kiwan, Nadia. Kjaer, Morten Kjelland, James Kjellberg, Erik Kjellberg, Soren Kjus, Yngvar Kjær, Signe Jensen Kladder, Jonathan R. Klaess, John Klape, Michael Klára, Hamburger Klára, Móritz Klára, Bodza Klára, Bajnai Klára, Kisdi Klára, Hamburger Klarin, Suzana Klassen, Judith. Klassen, Judith Klauk, Stephanie Klaus, Illmayer Klause, Inna Klavan, Spencer A. Klein, Bethany Klein, Amanda Ann Klein, Axel Klein, Axel Kleinman, Judith Klemen, Terézia Klenke, Kerstin Klingspor, Edward Kloepfer, Inge Kloiber, Rudolf Klotz, János Knakkergaard, Martin Knapp, Alexander Knauer, Wolfram Knecht, Anna Stoll Knee, Sam. Knešaurek, Ante Knight, Richard Knight, Peter Knighton, Tess Knights, Carol. Knox, David Blake Knutsson, Jonas Knysak, Benjamin. Knyt, Erinn E. Kobari, Yūki Kobayashi, Yasuharu Kobayashi, Atsushi Kobayashi, Chigusa Kobenhavns Drengekor Koch, Julie Tandrup Koch, Christian Koch, Hans-Albrecht Koço, Eno. Koço, Eno Koelsch, Stefan. Koenig, Joan Koglin, Daniel Kohlhase, Thomas Kohlhase, Thomas Koike, Makoto. Kojima, Masami. Kojima, Yasunori Kokkidou, Maiē Kokkōnēs, Giōrgos Kokuritsu bunraku gekijō. Kokuritsu Gekijō. Kolar, Miriam A. Komara, Edward M. Komlós, K Köncse, Heverdle Péterné Kondō, Jō Kong, Siu-hang Konold, Wulf Koo, Sunhee Koops, Lisa Kopanitsanos, Kōnstantinos Kopec, Rudolf Kopecký, Jiří Koppány, Zsolt Koprek, Katarina Kordík, Pavel Kordík, Pavel Kordt, Inge Kordt, Asta Kornberger, Monika Korsakova-Kreyn, Marina Korvig, Hanne Koshikakezawa, Mai. Kosser, Michael Kōstantzos, Giōrgos Kostelanetz, Richard Kotarba, Joseph A. Kotnik, Vlado Kotschack, Jan Kotzor, Günter Kourousēs, Stavros Kovács, A Kovács, M Kovács, J Kovács, József Kovács Eszter Kovarsky, Jerry Kozinn, Allan Köchel, Ludwig König, José Manuel Izq Kraaz, Sarah Mahler Kraebel, A. B. Krahn, Carolin Kramer, Lawrence Kramer, Richard Kramer, Howard. Krapljanov, Marina Perica Krarup, Bertel Kraus, Beate Angelika Krause, S Krause, Bernard L. Kravitz, Lenny Kreitner, Kenneth Kremer, Jon Kreutz, Gunter Kreutz, Gunter Krieg, Gustav A. Kristensen, Erik Laugesen Kristóf, Csengery Kristoferson, Lars A. Kritzas, Vyrōnas Kroeger, Karl Kroeker, Joel Krogh, Mads Krohn, Tarek Kroll, Mark Krolo, KRešimir Kromhout, Melle Jan Kronenburg, Robert Kronenburg, Robert. Kronland-Martinet, Richard Kroó, G Kroupa, Jiří Krowicki, Marek Kröncke, Dietrich. Kröplin, Eckart Krpan, Erika Krueger, Alan B. Krukowski, Damon Krummacher, Christoph Kruse, Joakim Olsson Kruth, John Kubieniec, Jakub Kucinskas, Darius Kuhn, Will Kuijken, Barthold. Kund, Laura Kunitachi College of Music Kunitachi Ongaku Daigaku. Kunitachi-Ongaku-Daigaku. Kurihara, Utako. Kurkela, Vesa Kurth, Ernst Kurtzman, Jeffrey G. Kusz, V Kutschke, Beate Kuuse, Anna-Karin Kuyper-Rushing, Lois. Küssner, Mats B. Kvarnhall, Victor Kym, Min La Barbara, Joan La Chioma, Daniela la Nāśida, Kāmā Labbé, Stéphane Labia, Julien Labozár, A Labrado, silvia Labrador, Germán Lacasse, Serge Lacey, Jordan Lachmann, Frank M. Lacombe, Hervé Lacôte, Thomas Laederich, Alexandra Lafrance, Roger Laing, Dave. Laird, Paul R Laird, Paul R. Lajić, Mihajlović Danka Lajos, Főkövi Lajos, Miller Lakatos, R Laki, P Lalitte, Philippe Laloue, Christine Laloy, Louis Lamb, Andrew Lambe, Stephen Lammers, T. J. Lampert, V Lancashire, Terence Lanctôt, Jacques Lanczkor-Kocsis, K Landau, Carolyn Landerer, Christoph. Lanegan, Mark. Lang, Michael Lang, Zoë Alexis Lang, Jeff Lange, Uffe. Langenbruch, Anna Langford, Jeffrey Alan Langlois, Tony. Lanza, Joseph Lapine, James Lapine, James. Large, Carol Cash Larsen, Christian Larson, Katherine Rebecca Larsson, Christina Larsson, Hugo Laskai, A Laskai, Anna Laskaratos, Andreas Lasocki, David Lasuén, Sergio László, Somfai László, Böhm László, Szalkai László, Molnár László, Dubrovay László, Stacho László, Harsányi László, Domján László, Csányi László, Tóth László, Dobszay László, Lakatos László, Vikárius László, Emmert László, Gombos László, Heltay Lásztity, P Lásztity, Péró Latham, Sean Lathos, James Lattarico, Jean-François. Laubhold, Lars E. Laukvik, Jon. Laurence, Felicity. Lavigne, Laurent Lavocah, Michael Lavranos, Charilaos Law, Michael John Law, Jay Lawlor, Helen Lawrence, Ian Lawrence, Michael Lawson, Francesca R. Sborgi. Lawson, Colin Laxéll, Conny Laxer, Daniel Robert Layden, Joe. Lázár, Katalin Lázaro-López, José-Ángel Le, Tuan Hung Le Colleter, Thomas Le Menestrel, Sara le Pistone, Daniè Le Roux, François Le Vot, Gérard Lea, Kovács Leach, John Leach, Elizabeth Eva Leach, Elizabeth Eva Leach, Robert Leach, Gerald Leaf, David Leal, César Andrés Leary, James P. Leaver, Robin A. Lebrun, Barbara Ledbury, Mark Lederer, Victor Ledesma-Gómez, Francisco Ledsham, Ian Lee, Ric Lee, Michael Lee, Colin Lee, Julin Lee, Jonathan Rhodes Lefferts, Peter Legg, Barnaby. Legge, Nancy J. Leguay, Jean-Pierre Lehmberg, Lisa J. Leibnitz, Thomas Leibnitz, Thomas Leigh, Spencer Leijonhufvud, Susanna Leijonhufvud, Susanna. Leijonhufvud, Jonas Leikin, Anatole Leila, Rásonyi Leistra-Jones, Karen. Lejon, Kjell O. U. Leković, Biljana Leloup, Jean-Yves Lemaire, Frans C Leman, Marc Lemay, Denyse Lempesē, Litsa Lencsés, L Lendvay, Domonkos Leneman, Helen Lenneberg, Hans Lennon, John Lenti, Vincent A. Lenz, Risto León-Ara, Agustín León-Rodríguez, Ángel-Luis Leonard, Maurice. Leonard, Anne Leonard, Kendra Preston Leong, Daphne Leopold, Silke Leppert, Richard D. Lerch-Kalavrytinou, Irmgard Lerena-Gutiérrez, Mario LeRoy, Dan Lesaffre, Micheline Lesner, Frej Vammen Lespinasse, Patricia G. Lester, Paul Lestidau, shane Letchford, Michael Letellier, Robert Ignatius. Letellier, Robert Ignatius Letham, Andy Lethem, Jonathan Levaux, Christophe Leve, James Levenson, Steven Levente, Váradi Levente, Király Leverton, Marc Levey, Marie Therese Levi, Erik. Levine, Victoria Lindsay LeVine, Mark Levinson, Jerrold Levitin, Daniel J. Levitz, Tamara Levy, Daniel Lewenhaupt, Carl-Gustaf Lewin, David Lewin-Lane, Stephanie Lewis, Eric Lewis, George Lewis, Tony Lewisohn, Mark. Lewisohn, Mark Lewitová, Iris Urwin Lewsey, Jonathan Leza-Cruz, José-Máximo Lécroart, Pascal. Lévinas, Michaël. Li, Xiaoti Li, Dan Li, Lizhe = 李丽哲 Li, Mei = 李玫 Li, Xiaoqin = 李晓芹, Xiaoqin Libera, Luca Della Libin, Kathryn L. Libreria musicale italiana, Lichdi, Tilman Licht, Alan. Lídia, Nádori Lidija, BAjuk. Lidskog, Rolf Lie, John Liebersohn, Harry Lifter, Rachel Ligeti, György Ligeti, György Light, Ronald Light, Alan Lih, Emelyn Lih, Ariadne Lihoreau, Tim. Lili, Békéssy Lilla, Tóth Lilliestam, Lars Lin, Jennifer Lin, Hsun Linaberry, Robin Lind, Stephanie Lind, Magnus Lindahl, Andreas. Lindaryd, Christina Lindberg, Erik Lindberg, Boel Lindblad, Adolf Fredrik Lindblad, Katarina Lindgren, Monica Lindmayr-Brandl, Andrea Lindner, Andreas Lindsay, Bruce Lindsay-Douglas, Carole Lindskog, Sven Lindvang, Charlotte Linford, Brian Ling, John. Lingan, John Link, Dorothea Link, John Linnarsson, Bengt "Bella" Lionáird, Iarla. Ó Lipenga, Ken. Lipovac, MArijan Lipscomb, Scott David Lishka, Gerald R. Lisius, Peter H. Lissy, Raimund. List, Garrett Lister, Linda. Lister, Warwick Litchfield, Jack Literska, Barbara Little Fish (Musical Group) Little Mix (Musical group), Littrell, David Ault Liu, Dongsheng Liu, April Liu, Boyuan = 刘伯远 Liu, Qian = 刘芊 Liu, Rong = 刘蓉 Liu, Zaisheng = 刘再生 Liu,Jingqiu = 刘晶秋 Livernois, Jonathan Lívia, Fuchs Lívia, Hajdú Livingston, Paul Livingstone, Jim Livstrand, Anita Ljungar, Hedvig Llano, Samuel. Llewellyn, Siân Llewelyn-Jones, Iwan. Llorens-Gómez, Juan-Bautista Lloyd, Stephen Lloyd, Delyth Medi Lloyd, David Lloyd-Williams, Pegi. Llueca, Robert Ferrer Lluis-Puebla, Emilio Llyr, Brychan Lo, Patrick Lobanova, Marina Loch, G Loch, Siggi Lochhead, Judith. Locke, Jesse Locke, Matthew Lodes, Birgit Lodge, Mary Jo Loedel, David Loew, Dave Loges, Natasha Loges, Natasha. Loggins, Kenny Lomholt, Helge Lönegård, Petter Long, Pat Long, Jianguo = 龙建国 Longuenesse, Pierre. Lonnert, Lia Lopez, Ken López-Cano, Rubén López-Fernández, Miguel López-Fernandez, Raquel López-Rodríguez, Javier-María Lóránt, Péteri Lord, Russell Lorenzo, Daniel Lorenzo, Rubén Lornell, Kip Lott, Marie. Sumner Lotz, Rainer E. Love, Joanna K. Love Music Hate Racism (Campaign), Lovegrove, William. Lovelock, James Lovesey, Oliver Low, Alban Löwdin, Bjarne Lowe, Melanie Diane Lowe, Lisa A. Lowerre, Kathryn Lowry, Ray Loyrette, Henri Loyrette, Henri Loza, Steven Joseph López, Francisco López-García, Pedro Ignacio López-Íñiguez, Guadalupe Lösch, Conny Lösel, Steffen. Lu, Qian = 卢前 Lubin, Tom Jackson Luca, Tiszai Luciani, Antonio Riccardo Lucier, Alvin Ludke, Karen Ludwig, Anna Ludwig, Mark Lue, Jack. Lukács, G Lum, Chee Hoo Luna-López, Inés-María Lund, Tobias. Lundberg, Mattias Lundberg, Mattias Lundberg, Dan Lundberg, Dan. Lundblad, Jonas Lundblad, Jonas Lundman, Tony Lundman, Tony Lundström, H\aakan Luo, Linka = 罗林卡 Lutch, Mitchell. Luther, Martin Lutzu, Marco Luyk, Sean. Lütteken, Laurenz. Lütteken, Laurenz Lyddon, Clare. Lyhne, Erik Lynan, Peter. Lynch, Michael Lynch, Tosca Lynott, Philomena Lynskey, Dorian. Lyon, Eric Lysaker, John T. Løppenthin, Thomas Løvgreen, Geraint. M., Weigl David Ma, Lingyuan = 马凌元 Ma, Shuhao = 麻书豪 Maalsen, Sophia Mabary, Judith Mabit, Alain Mabuchi, Akiko Macafee, Caroline MacDonald, George MacDonald, Raymond A. R. Macdonald, Ronan MacDonald, Simon Macdonald, Hugh Macdonald, Sherry MacDonald, Bruno Macdonald, Ronan. MacDonald, I MacDougall, Eveline Mace, Angela R. MacFarlane, Thomas MacFarlane, Stuart Macfarlane, Malcolm MacGlone, Una Machado, Bernardo Fonseca Machalíková, Pavla MacInnes, Sheldon Mackay, Robin MacKenzie, Gina Masucci Mackenzie, Bridget MacKenzie, Malcolm MacLaren, Leon Maclean, Emma Maclear, Kyo MacLeod, Rebecca B. MacLeod, Dewar MacMahon, Bernard MacMillan, James MacMillan, Douglas Maconchy, Elizabeth Maconie, Stuart Maconie, Robin MacQuaile, Brendan Macquarie University. MacRae, Stuart Madden, Caroline Madden, April Maddocks, Andrew Madrid, Alejandro L. Madsen, Gerda Madsen, Clifford K. Maes, Pieter-Jan Magdolna, Jákfalvi Magee, Sean Magee, Wendy Maggs, Alan Magnat, Virginie Maguire, Simon Magyar, Gabriella Vönöczky Magyar, Zoltán Mahlert, Ulrich Mahnkopf, Claus-Steffen Mahoney, Barbara P. Mahoney, John P. Mai, Anne-Marie Maiello, James Vincent Maier, Carla J. Mainsbridge, Mary Mair, Bethan. Maire, José Luis Maire, José-Luis Maison des sciences de l'homme de Dijon, Majer-Bobetko, Sanja Majid, Roohi Major, John Roy Makary, Suzanne Mäkinen, Kalevi Makor (Community organization) Malamut, Liza Maliangkay, Roald Malins, Steve Malmborg, Jan Malone, Bill C. Malone, Bobbie Malone, Gareth Maloy, Rebecca Maltais, Michel. Manasseh, Sara. Manchado-Torres, Marisa Mandel, Howard Mandics, G Manferto, Valeria. Manganye, Nelson Nyiko Mangaoang, Áine Manghani, Sunil Mankowitz, Gered Mann, Fraser Mann, Larisa Kingston Mann, Kenton Mannerbjörk, Tord Manning, Céline Frigau Manning, Harriet J. Manoury, Philippe Mantere, Juha Markus Mantie, Roger Mantzourani, Eva. Maojo, Víctor Maor, Eli Mapaya, Mawanda Geoff Maple, Amanda Maras, Alessandro. Marcel-Berlioz, Laure Marcelić, Sven March, Richard Marchal-Ninosque, France Marchal-Ninosque, France Marchant-Rivera, Alicia Marco, Tomás Marco-Aragón, Tomás Marcone, Stephen Marcos-Martínez, José Ramón Marcus, Greil Marcus, Greil. Margaret, Bent Margetts, Lisa Marginson, Karen Margotin, Philippe Mária, Mohayné Katanics Mária, Domokos Mária, Bólya Anna Mária, Szabóné Lukáts Mária, Prokopp Mária, Pintér Csilla Mária, Nagy Lajosné B Marienberg, Evyatar Marietta, Bukáné Kaskötő Marin, Mikael Marín-López, Javier Marín-López, Javier (Ed.) Mariño, Cecilia Gil Marjatta, Pap Kinga Marks, Glen Márkus, T Marley, Bob Marley, Ziggy Marly, Michelle Marosi, L Marquard, Helen Marquard, Reiner Marrington, Mark Mars, Annette Marsden, Bernie Marsh, Kathryn Marsh, Charity Marshall, Melanie L. Marshall, Scott M. Marshall, Em. Marshall-Luck, Em Marsi, József Marsico, Federica Marstal, Henrik Marston, Nicholas Márta, Rubin Márta, Szabó Márta, Vargáné Darabos Márta, Hallerné Horváth Martens, Marie Martens, Marie Martí-Martínez, Cristina Martienssen-Lohmann, Franziska Martin, Andrew R. Martin, Kameelah L. Martin, Tenley Martin, Tony Martin, Denis Martin, Ian F. Martin, Jonny Martin, Benjamin Martin, Darryl Martin, E Martín-Ballester, Carlos Martín-López, David Martínez, Alejandro Martínez-Fresno, Beatriz Martinez-García, Sílvia Martínez-Lombo, Julia-María Martínez-Martínez, María-Luisa Martínez-Miura, Enrique Martínez-Peláez, Agustín Martiniello, Marco Martinů, Bohuslav Martínez, Alejandro Martínez-Gil, Carlos Márton, Karczag Márton, A Márton, Mészáros Márton, Kerékfy Maru Fuku Gallery. Maruhashi, Motoi. Maruyama, Tadāki. Marvin, Roberta Montemorra Marx, Wolfgang Marx, Richard Marx, Hans Joachim Maschka, Robert Masnikosa, Marija Mason, Joseph W. Mason, Kaley Massaro, John Massey, George W. Massimo, Richard Massip, Catherine Matamoro, Blas Máté, Botos Máté, Cselényi Matej, Santi Matetić, Milovan Mateveke, Pauline. Matheis, Frank Mather, Joanna Mathew, Nicholas Mathias, Rhiannon Mathieson, Kenny. Matía-Polo, Inmaculada Matis, Benjamin Matisz, L Matsuyama, Shin'ya. Matthews, David Matthews, Elizabeth Matthias, John Mattsson, Christina Matusky, Patricia Ann Mátyás, Bolya Matzkov, George Mauceri, John Maul, Michael Maunder, C. R. F. Maurer-Zenck, Claudia Maus, Fred Everett Maw, David Nicholas Maxile, Horace J. Maxwell, Ian May, Trine Mayas, Magda Mayuzumi, Rintarō. Mazey, Paul Mazierska, Ewa Mazo-Vivar, Alejandro Mazzola, G. Mazzolini, Marco. Mboya, Michael Mcakley-Crump, Jared McAlpine, Kenneth B. McAulay, Karen E. McAuley, Tomás. McAuley, Tomás McAvoy, Mark McBride, Nigel McBride, Jerry L. McCabe, Ste McCaleb, Murphy McCallum, Cathy. McCann, Timothy J. McCann, Bryan J. McCann, Séan McCarrey, Scott McCarter, Jeremy McCarthy, Jim McCarthy, Daniel William McClelland, Ryan C. McCleod, Ken McCloy, Nicola McCoy, Charlie McCurdy, Iain McCutcheon, John McDermott, John McDonald, Grantley McElhone, Kevin. McElhone, Kevin McEwen, Jérémie McFalls, Laurence McFerran, Katrina McGarrigle, Jane McGarrigle, Anna McGeary, Thomas McGee, Kristin A. McGee, Kristin A. McGeeney, Andy McGhee-Anderson, Kathleen McGillis, Ian. McGourty, Allison McGregor, Richard McGuire, John McGuire, Sam McHale, Maria McHugh, Dominic McIntosh, Solveig McIntyre, Michael McIntyre, Sir Donald McIsaac, Julie McIver, Joel. McIver, Joel McKagan, Duff. McKay, Tristan McKee, Jessica McLaughlin, Noel McLean, Brian McLintock, Maria McLoone, Martin Mclver, Joel McManus, Eva McMaster, Graham McMurtrie, John McNab, Ken McNab, Ken. McNally, J. McNeil, Rhoderick. McNutt, Randy McParland, Robert McParland, Stephen J. McPhail, Graham McPhail, Graham McPherson, Gary. McPherson, Suzanne McPherson, Gary McQuarrie, Fiona McQueen, Brett McQuiston, Kate McRae, Richard McShane, Angela J. McTavish, Anni McTyre, Ruthann Boles McVeagh, Diana M. McVicar, Ewan. Mealy, Todd M. Mecke, Ann-Christine Meconi, Honey. Medgyesy, N Medić, Milena Medić, Ivana Medlyn, Margaret Medlyn, Margaret Meehan, Norman Mehta, Jehanne Meinhof, Ulrike Hanna. Meïmoun, François. Melbourne, Hirini Meldrum, Molly Melinda, Berlász Mellard, Jason Mellish, Liz Mellor, Andrew Melrose, Andrew Melton, Joan Melton, William Melville, Caspar Mendelson, Joe Mendieta, Eduardo. Menéndez-Torrellas, Gabriel Menéndez-Torrellas, Gabriel. Menger, Pierre-Michel Menyhért, Elek Menzies, Heather Mera, Miguel Merchán-Sánchez, Javier Mercier, Johanne Mercury, Freddie. Mercz, N Meredith, Sharon Merkle, Judith A. Merlin, Christian Mernin, John Merrill, John N. Merriman, Andy Merritt, Justin Wayne Mersereau, Bob Mersereau, Bob Mertens, Gerald Messiaen, Olivier Messiaen, Olivier. Mészáros, E Metastasio, Pietro Metropolitan Museum of Art (New York, N.Y.) Metten, Joseph-André. Metting, Fred Meyer, Stephen C. Meyerbeer, Giacomo Meyhoff, Turi Kjestine Mezei, J Mezey, J Mező, Imre Ménard, Johanne Michel, Annemarie. Michels, Ulrich Michelsen, Morten Michigan Publishing (University of Michigan), Middlesex University, Midnight Beast (Musical group) Midžić, Seadeta Miell, Dorothy. Mihajlović-Marković, Jelena mihály, Berndt Mihalyi, Aleksandar Miholić, Irena Mikami, Tadashi Mikić, Vesna Mikkelborg, Helen Davies Miklós, A Miklós, Szabó Miklós, Dolinszky Miklós, Mózner Mikusi, B Milam, Brent Milanković, Vera Milán, Juan Luis Miles, K. G. Miles, Barry Milholt, Thomas Milin-Ćurin, Vedrana Milinković, Radmila Military Wives (Musical group), Milka, A. Milković, Kristina Milla, Samir Millard, A. J. Millen, Peter Miller, Cordelia. Miller, John Miller, Josephine L. Miller, Terry E. Miller, Monica R. Miller, Stephen Miller, Daniel Milloy, Steve Mills, Richard Mills, Peter Mills, Gayla M. Millward, Stephen. Milsom, David Milward, John Minder-Jeanneret, Irène. Mingus, Charles Minors, Helen Julia Miranda, Lin-Manuel Miranda, Eduardo Reck Miranda, Eduardo Reck. Miranda, Laura Miranda-González, Laura Mirka, Danuta Misaki, Tetsu Miscevic, Pierre Mishra, Jennifer Missinne, Stefaan. Mitchell, James Leonard Mitchell, Joni Mitchell, Leanne Mitchell, Philip Rewse Mitchell, Kevin D. Mitchell, Julia. Mitchell, Michael Mitchell, Lindsay Mitchell, Laura. Mitchell, Alastair Mitchell, Julia Mitchell, Debby. Mitchell, Tony Mitsui, Tōru Miyamoto, Momoe Mlađenović, Tijana Popović Mockingbird Foundation. Modin, Madeleine Moesbol, Jesper Moffat, KIrstine Mohammed, Sharifah Faizah Sye Mohr-Pietsch, Sara Mohrs, Rainer. Moir, Zack Moisala, Pirkko Mojalefa, Mawatle Jerry Mojžíšová, Olga Mokdad, Linda Y. Molinari, Cecilia Molleson, Kate Moloney, Mick Moluvsky, Grov Molyneux, Claire Mona, I Monge, Luigi Monié, Wilhelm Montagnier, Jean-Paul Montalembert, Eugène de. Monteagudo, Susana Montero-Aroca, Juan Montes, Beatriz C Montgomery, Ted Montgomery, Alan Montgomery, Alice Montiel, Mariana Montoro-Bermejo, Amparo-Dolores Montoya-Rubio, Juan-Carlos Moody, Ivan Mooney, Kevin Edward Moore, Christopher Moore, Robin D. Moore, Jerrold Northrop Moore, Allan F. Moore, Timothy J. Moore, David Moore, Rachel Moore, Allan F. Moore, S. K. Moore, Marcus Moore, Thurston Moorer, Allison Moortele, Steven Vande Mora, Kiko Morabito, Fabio. Morabito, Fulvia Moraes, Vinícius de. Moraga-Guerrero, Eva Morales, Luisa Morales, Jorge Moran, Michael Morán, Raquel. Morbio, Vittoria Crespi Mordue, Mark Morea, Marisa Morecambe, Gary Moreda-Rodríguez, Eva Moreno, Manuel Moreno, Abel Moreno-Díaz, Juan-Manuel Moreno-Mengíbar, Andrés Moreno-Tello, Rafael Moretti, Laura Moretti, Maria Rosa Morgan, Nicholas Travers Morgan, Robert P. Morgan, Tom Morgan, John Morgan, Sally Morgan, Harry Móricz, K Morita, Shigeru. Morita, Toki Mörk, E Morley, Paul Morley, Michael Morley, Paul. Moro-Vallina, Daniel Morrell, Roberta Morris, Dennis Morris, Ron Morris, Stephen Morris, John Morris, David Morrison, Hannah Morrison, Van Morrison, Simon A. Morrison, Simon Alexander Morrison, Howard Hiwaroa Morrow, Guy. Morrow, Charlie Morte-García, Carmen Mortensen, Viggo Morucci, Valerio Morvay, Z Moser, Vincent. Moskovitz, Marc MOSKOVITZ, MARC D. Moss, Marissa R. Moss, Hilary Moss, Gemma Mota-Zurdo, David Mottram, Helen Mottram, Tony Mouillot, François Mould, Stephen Moy, Ron Moylan, William Moylan, Terry Moynahan, Brian Mozart, Wolfgang Amadeus Mōri, Yoshitaka Mörck, Erkki Mpukalas, Pantelēs S. Mthembu, Sihle Mucha, Jiří Muchitsch, Veronika Mueller, Adeline Muggs, Joe Mugmon, Matthew Muir, Stephen Muirhead, Stella Mukherji, Somangshu Muldoon, Paul Muldoon, Roland Muldoon, Paul. Mulholland, Paul Mullaney-Dignam, Karol Mullen, Phil Muller, Stephanus Mulligan, Gerry Munárriz-Ortiz, Jaime Munch, Jens Mungons, Kevin Municio, Juan Ignacio Po Muñiz-Bascón, Luis-Magín Munk, Hans Münnich, Stefan Munns, Geoff Muñoz, Luis Antonio Munstedt, Peter Alan. Murakami, Haruki Murdoch, Stuart. Murga-Castro, Idoia (Ed.) Murga-Castro, Idoia Murphy, Regina. Murphy, Colleen Murphy, Michael Murray, Christopher Brent Murray, Nadia Murray, Conrad Murray, Peter Murray, Charles Shaar. Musawa, Sanyinnan Muse, Mary Museum, Otago Museum of the City of New York, Musée d'art contemporain de Montréal, Musée d'Orsay (Paris). Musgrave, Michael Music, Graham Music Library Association, Music Library Association. Music Managers Forum. Music Masters' and Mistresses' Association, Music Teachers' Association (Great Britain) Musical Box Society of Great Britain, musicales, Comité de experto Musikforschung, Donau-Universität Krems. Zen Musikhögskolan i Malmö. Musiko Musika. Mustapha, Shu'aibu Mutonya, Maina Wa Mühlegger-Henhapel, Christiane Müller, L. J. Müller, Christian A. Münster, Robert Myers, Arnold Myers, Marc Myler, Thomas Mylius, Jørgen Mylōnas, Kōstas Mynett, Mark. Myrick, Nathan Nadrigny, Pauline Nagano, Kent Nagata, Yasushi Nagel, Julie Jaffee Nagy, M Nagy, Norbert Nagy, I S. Nahshon, Edna Nainby, Keith Naish, Stephen Lee Naitō, Yoshihiro. Nakagawa, Yūsuke. Nakagawa, Stephanie Nakahara, Yusuke Nakai, Yu Nakajima, Tsuneo. Nakamizo, Kazue Nakamizo, Kazue Nakamura, Atsushi Nakamura, Setsuya Nakano, Masaaki. Nakano, Masanori. Nakano, Masaaki Naked, Bif Nama, Adilifu Namoradze, Nicolas Nanayakkara, Gowri Nanton, Philip. Naranjo, Claudio Narushima, Terumi Nash, Graham Nater, Urs National Association for Music Education. National gallery of art (Washington, D.C.). Nattiez, Jean-Jacques Naughton, Nuala Navarre, Jean-Philippe. Navarro-Coba, María Dolores Navarro-Sanler, Ioshinobu Naylor, Marvin B. Nápoles, Jessica Ndabeni, Esinako Ndiaye, Souleymane Ndéné Neal, Mark Anthony Neale, Margo Neate, Wilson. Needs, Kris Neef, Sonja. Neff, Severine Negri, Eleonora. Negropontēs, Giannēs Neibaur, James L. Neidhöfer, Christoph Neil, Linda Neill, Andrew. Nelson, Steven G. Nelson, John Nemes, G Németh, István Csaba Németh, István Nényei, S Nersessian, Vrej Nersessian, Vrej Nettl, Bruno Neue Bachgesellschaft Neumayr, Eva Neumayr, Eva. Neumeyer, David New World Symphony Steel Orchestra (Leeds, England) Newby, Tim Newkey-Burden, Chas Newkey-Burden, Chas. Newsome, Roy Newton-John, Olivia Nézet-Séguin, Yannick Ngema, Vusabantu Ngqungwana, Musa Nguyen, Thanh Thuy Nichol, Elizabeth Nicholls, Sue Nichols, Jason Nichols, David Nicholson, Winifred NicLeòid, Norma. Nie, Shengzhe Nieden, Gesa Zur Niederauer, Martin Nielinger-Vakil, Carola Nielsen, Steen Kaargaard Nielsen, Per Reinholdt Nielsen, Soren Steen Nielsen, Nanette Nielsen, Helle Broberg Nielsen, Lars Brix Nielsen, Thorkil Green Nielsen, Steen Kaargaard Nielsen, Jens-Emil Nielsen, Charlotte Svendler Nielsen, Henrik Nielson, Lisa Niemi, Patti Nieto, Alejandro Miranda Nieto-López, Albert Nieto-Sánchez, José-Antolín Nightingale, Claudine Nightingale, Benedict Nihon chenbaro kyokai. Nihon Gakkō Ongaku Kyōiku Gissen Gakkai. Nikolaeva, Olga Nilsson, Mats Nilsson, Ann-Marie. Nilsson, Leo Nilsson, Birgit Nimmo, Vanessa Elizabeth Nimmo, Lisa Niranjana, Tejaswini Nisser, Per Olof Nix, John Nkwi, Walter Gam Noble, Jennifer Noble, Jonathan Nocilli, Cecilia Noda-Gómez, Talio Noémi, Maczelka Noeske, Nina Nogueira, Isabel Noguero, Joaquím Nolan, David Nollan, Valeria Z. Nones, Alberto. Nonken, Marilyn Nono, Luigi Nóra, Kallai Norbert, Medgyesy S. Norbert, Vass Nordgård, Daniel. Nordhoff, H Nordoff Robbins (Charity) Nordström, Gunnar Norgren, Lars Noringriis, Christian Steen Noringriis, Astrid Steen Norizuki, Toshihiko Norling, Sara Norman, Philip Norman, Philip Norregaard, Kjeld Norris, John Northern Ireland Council for the Curriculum, Examinations and Assessment. Northrop, Chloe Norton, Kay Norton, Tessa Norton-Hale, Robin. Notley, Margaret Anne Novak, Slobodan Prosperov Novak, Jelena Novak, John K. November, Nancy Nowak, Raphaël Nowak, Manfred Nowlin, Bill Noya-Miranda, Francisco-Javier Noyer, Paul Du Nugent, Josie Nummelin, Sammi Nunes, Andrew Núñez, Yaz NWV Verlag GmbH Nyakudya, Munyaradzi. Nyblom, Sofia Nyland, Berenice Nyman, Michael Nyongó, Tavia Amolo Ochi Nyssen, Françoise NZ, Recorded Music O'Brien, Lucy O'Brien, Christopher O'Brooin, Jette Friis O'Brôin, Jette Friis O'Connell, John O'Connor, Karen O'Connor, Garry O'Connor, Barbara O'Connor, Hazel O'Connor, Sinéad O'Connor, David O'Connor, Sinéad. O'Dair, Marcus O'Donnell, Mary Louise O'Flynn, John O'Flynn, John O'Grady, Deirdre O'Hagan, Peter O'Hagan, Sean O'Hagan, Peter. O'Hanlon, Seamus O'Hara, Ben O'Keeffe, Linda O'Keeffe, John O'Malley, Michael O'Marde, Dorbrene O'Meally, Robert G. O'Meara, Mary. O'Neill, Berrie O'Neill, Michael O'Regan, Susan O'Regan, Jadey O'Reilly, Michael O'Reilly, Graham Ó'Sé, Seán O'Shea, Mick O'Sullivan, John O'Toole, Kit O'Toole, Michael Oakenfold, Paul Oakes, Meredith. Obal, Beatrix Obana, Takashi. Obert, Kerrie. Oblastní galerie v Liberci, Ocaña-Fernández, Almudena Ochs, Phil Ockelford, Adam Oda, Toyoji Odam, George Odell-Miller, Helen Oertel, David W. Oeser, Hans-Christian Ógáin, Ríonach Uí Ogas, Ogi Ogisi, Arugha A. Ogston, Derek Ogus, A. I. Ohriner, Mitchell Öhrström, Bill Öhrström, Hjalmar Öhrström, Eva Oikelome, Albert Okazaki, Brooke McCorkle Okorie, Chijioke Ifeoma Olander, Ann Olaosun, Ibrahim E Oldham, Andrew Loog Oldknow, A. J. Oleksiuk, Olga Olga, Géczy Olga, Szalay Olivarez, Vanessa Oliveira, Julia Andrés. Oliver, Sarah Oliver, Paul Oliveros, Pauline Olivier, Philippe. Olleros, Manuel Rey - Olleson, Philip. Olm, James Olofsson, Kent Olofsson, Börje Olsen, Jens Skou Oltra-García, Héctor Omojola, Bode. Omote, Kiyoshi Ondaatje, Christopher One Direction (Musical group), Ong, Min-Yen Ono, Mitsuko. Ono, Yōko Onsman, Andrys Onyebadi, Uche Oost, Regina B. Open Book Publishers, Open Eye Gallery (Edinburgh, Scotland) Opéra national de Paris, Oppedisano, Tony OPRA Cymru, Ordoulidēs, Nikos Ordoulidēs, Nikos Orejuela, Fernando Oriol, Élodie Orkney Singers. Ormsby, Barrie Orringer, Nelson R. Ortega, Fernando Ortega-Castejón, José-Francisco Ortuño-Stühring, Daniel Orzech, Rachel Osatinski, Amy S. Osborn, Brad Osborne, John Osborne, Richard. Osborne, Richard Osborne, Evelyn Ossa-Martínez, Marco-Antonio Österholm, Peo Östman, Lars Öström, Anna Otašević, Olga Ott, Pamela. Otte, Andreas P. Ottervik, Jennifer Ottosson, Åse Ouellette, Antoine Ouellette, Ouellette. Antoine Ouyang, Lei Ou’Yang, Yuanxiang = 欧阳园香 Over, Berthold Owen, Leah Owen, Michael Owen, Meurig Owens, Samantha. Owens, Ulysses Owens, Samantha Oxfordshire Folk Dance Association, Ozawa, Seiji Ozsvárt, V Ōishi, Yasuo Ōuchi, Fumi Örebro universitet Österreichischer Rundfunk Österreichisches Volksliedwerk P-Orridge, Genesis Pacciolla, Paolo Pace, Ian Paddison, Max Paddison, Max. Padgett, Ray Padura, Leonardo Page, Christopher Pai, Megan Pairon, Lukas Paisner, Daniel Paixao, Ana. Paksa, Katalin Paksa, K Pál, Vannai László Pál, Richter Pál, Horváth Palacios, Julian Palacios-Nieto, María Palásthy, I Palazzetti, Nicolò Palestine, Charlemagne Palfy, Cora S. Pallàs-Mariani, Laura Palm, Anders Palm, Carl Magnus Palma, Daniele Palmer, Martyn Palmer, Rob Palmer, Chris Palmer-Edwards, Paul Palmić, Ramiro Palmqvist, Morgan Palomino, Pablo Pålsson, Anders Pan, Fangsheng = 潘方圣 Panagl, Oswald. Panagl, Oswald Panay, Panos A. Pandolfi, Mariella Pang, Yan Paniagua, Carlos Pantarotto, Martina Pantin, Rachel Paoletti, Matteo Papadaki, Artemis Papadopoulos, Athanase Papakhian, Ralph Papakōstas, Giannēs Papanikolaou, Eftychia Paphides, Pete Papp, Márta Papp, A Papp, M Papp, Tibor Parallel, CHarlotte Paraschivescu, Nicoleta Pardo-Cayuela, Antonio Pardo-Salgado, Carmen Parfitt, Richard Parisi, Paolo Park, Brandon J Parker, Mara Parker, Roger Parker, Gary R. Parker, Mark Parks, Gregory Parr, Sean M. Parra, Fernando Parralejo-Masa, Francisco Parri, Annette Bryn. Parsons, Laurel Parsons, George Pärt, Arvo Parton, Dolly Pasek, Benj Pasler, Jann. Pastor-Comín, Juan-José Patell, Cyrus R. K. Patēniōtēs, Nikos Paterson, Justin Paterson, Linda Patner, Andrew Patterson, Laurie Patterson, Patrick M. Pattie, David Pauk, G Paul, Justin Paul-Hindemith-Institut, Pávai, István Pávai, I Pavanello, Agnese Paweł, Gancarczyk Pawlowski, Amy Payette, Corey Payette, Jessica Payman, Kylie Payne, Emily Payne, Joel Paytress, Mark Paz, Eilon Peacock, Kenneth Peacock, James Peacock, Sara Pears, Peter Pearson, Tanya Pearson, Robert Pearson, Kat Peart, Neil Pecher-Havers, Katharina. Peck, Robert William Péczely, A Peddie, Ian Pedersen, Susanne Clod Pedersen, Birgitte Stougaard Pedersen, Inge Nygaard Peer, Stefanie van de. Pega, Bárbara Varassi Pegolotti, James A. Peham, Ch Pehrsson, Clas Pejrolo, Andrea. Pelegrín-Colomo, María-Teresa Pelkey, Stanley C. Pelletier, Cathie Pemberton, Rollie Penberthy, Ian Pender, Rick Pennick, Faith Pennsylvania State University Press, Pensaert, Anna Peque-Leoz, Iñigo Peralta, Miquel Perchard, Tom Perera, Treshani Peretz, Jeff Perez, Michael V. Perez-Ávila-Alonso, Beatriz Pérez-Fernández, Julián-Jesús Pérez-García, Álvaro Pérez-Ruano, Fernando Pérez-Senz, Javier Pérez-Zalduondo, Gemma Peričić, Denis PerićKempf, Bosiljka Peritz, Jessica Gabriel Perkins, Martin Perkovi, Katja Radoš Perković, Ivana Perković, Ante Perlmutter, Julian Perlovsky, Leonid I. Perón-Pérez, Tania Perone, James E. Perreault, Isabelle Perreault, Russell Perrin, Roland Perrott, Lisa Perry, Warren Perski, Kerstin Persson, Mikael Persson, Marie Länne Persson, Åke Pessarrodona-Pérez, Aurelia Péter, Árendás Péter, Ordasi Péter, Erdei Peter, Beate. Péter, Tóvay Nagy Péter, Várnai Péter, Korniss Péter, Spangel Péter, Horváth Péter, Galát Péter, Bozó Peter Lang GmbH Péteri, J Péteri, L Petermayr, Klaus Peters, Eleanor Peters, Chuck Peters, Rainer. Petersen, Birger. Peterson, Christopher W. Pétery, L Petipa, Marius Petra, Péter Petravić, Ivana Petri, Michala Petric, Joseph Petričić, Dušan Petrocelli, Paolo Petrović, Ankica Petrović, Milena Pettan, Svanibor Pettersson, Mats Petty, Jonathan Christian Péan, Stanley Pfisterer, Andrea Pfleiderer, Martin Phair, Liz Phelan, Helen Phelan, J. P. Phelps, Anthony Philharmonie de Paris, Philips, Deborah Phillips, Stephanie Phillips, George Harwood Philp, Jude Philp, David Piatti, Pierantonio. Picard, Timothée. Picard, Anna Picasso, Pablo Pickering, Kenneth Pickhan, Gertrud Piekut, Benjamin Piéjus, Anne Pignato, Joseph Michael Pike, Lionel Pike, Chris Pilar, Daniel Pilkington, Steve Piller, Eddie Piñera-García, Antonio Pinn, Anthony B. Pinson, Joe. Pintér, Márta Zsuzsanna Pinzino, Mary Ellen Piper Verlag Pirenne, Christophe Pisfil, Sergio Pitkin, Stephen Pitlochry Festival Theatre. Pitts, Stephanie Piusz, Balogh Péter Pizà, Antoni Pla-Candela, Vicente Plasketes, George Platt, Nicholas Plavin, Zecharia Pleasance, Helen Please, Benedict Plesner, Maja Pliego-de-Andrés, Víctor Ploquin, Florent Plummer, Declan Pogue, David Poidevin, Aurélien. Pokoly, J Pokoly, J Pokoly, Judit Poldiaeva, Elena. Polischuk, Derek Kealii Pollens, Stewart Pollock, Emily Richmond Polo-Pujadas, María-Magdalena Polonsky, Antony Polvall, Tomas Polzonetti, Pierpaolo. Ponce, Walter Pontara, Tobias Pontara, Johanna Ethnersson Poós, Z Poplawska, Marzanna Popoff, Martin Popp, Susanne Porath, Jason. Porcile, François Porro-Fernández, Carlos-Antonio Port, Ian S. Portelli, Alessandro Porter, Bethany Porter, Cole Porter, Mark James Porter, Wendy Porter, Eric Pospíšil, Milan Post, Jennifer C. Poston, Ken Potočki, Željka Potter, John Potter, Elizabeth Potter, Caroline Potter, Keith poulakis, Nikos Poulenc, Francis Poulsen, Anya Mathilde. Poulton, Alan J. Pound, Jeremy Povedano-Jiménez, Miguel-Ángel Powell, Bryan Powell, Neil Powell, Sean Robert Powell, Baden Powell, Bryan. Power, Martin Power, Nina Power, Martin J. Power, Martin J. Powers, Harold Powers, Kid Congo Powery, Luke A. Powrie, Phil Poynter, Dougie Pozderac-Chenevey, Sarah. Pozderac-Chenevey, Sarah Pratchett, Terry. Pratiwi, Winda Suci. Preece, D. A. Prehn, Anette Prelić, Velibor Premerl, Nada Presas-Villalba, Adela Prestel Verlag Pretor-Pinney, Gavin Prévost, Eddie. Price, Margo Price, Jayne. Pricz, Istvánné Priest, Deborah Prins, Jacomien. Printz, Sebastian Prior, David Prior, Helen M. Prior, Polly Pripp, Oscar Pripp, Oscar. Pritchard, Matthew Prosén, Martina Prucher, Susanne. Psychosozial-Verlag Puaud, Gaëtan Public and Commercial Services Union, Puckey, Nicola Pueyo-Roy, Mercedes Pughe, Fflur. Pugni, Cesare Pugni, Cesare Puille, Stephan Purcell, Adam Purcell, Henry Purdy, Stephen Purvis, Georg Pushkin, Aleksandr Sergeevich Pusz, Ryszard Jan Pyzik, Agata Qi, Desan = 漆德三 Qian, Huirong Qian, Renping = 钱仁平 Quash, Ben Queen (Musical group) Queipo-Gutiérrez, Carolina Quenoy, Paul Du Quin, Sara Quin, Tegan Quinn, Iain Quintero, Michael Birenbaum Quirk, Justin Quist, Ned Quist, Amanda Rabaka, Reiland Rabaseda-Matas, Joaquim Rabin, Kenn Rabinovitch, Gérard Race, Hugo. Rachwal, Maria Noriega Racin, Laura Reed Radcliffe, Mark Radeta, Igor Radić, Jana Radigales-Babi, Jaume Radosta, John M. Rae, Caroline Rae, Casey Raggi, Guiseppina Rahbee, David Raihle, Jan Raine, Sarah Rainer, Bernhard Rajalu, Rachel Rák, Béla Rakos, M Ramaut, Alban Ramaut-Chevassus, Béatrice Rambarran, Shara Ramet, Sabrina P. Ramey, Maria. Raminger, Kathrin Ramírez-Río, José Ramnarine, Tina K. Ramos-Altamira, Ignacio Ramos-Jiménez, Ismael Rampe, Siegbert Ramsey, Guthrie P. Ramshaw, Sara Ramsten, Märta Ramsten, Märta. Randall, Mac. Randles, Clint Rangell, Leo Ránki, A Rannie, Mary. Ransome, Antony Ranville, Errol Rao, Zongyi Raphael, Amy Rash, Felicity J. Rasmus, Greiner Rasmussen, Sasha J. Rasmussen, Karl Aage. Rasmussen, Karl Aage Rasmussen, Kristian Ratcliff, Maurice. Rathey, Markus Rathkolb, Oliver Ratliff, Ben Rauch, Arianna Warsaw-Fan Raussert, Wilfried Raustiala, Kal Ravenscroft, Brenda Rawson, Thérèse Casadesus Ray, Randy Raykoff, Ivan Raynaldy, Romain Raynaud, Philippe Razzle, Raz Read, Peter Reale, Steven Reali, Christopher M. Réber, L Rebés, Josep-María Rebstock, Matthias. Rebuschat, Patrick. Recorded Books, Inc. Reddan, James Reddington, Helen. Reddington, Helen Redfern, Sophie Redhead, Steve Redmond, Shana L. Reed, Anthony Reed, Philip Reed, Alexander Rees, David Rees, James A. Rees, Paul Rees, Lucy M. Rees, Owen Rees, David A. Reeves, Gareth Réfi, Zs Regina, Gulyás Rehding, Alexander Rehding, Alexander Rehnqvist, Karin Reibel, Emmanuel Reibel, Emmanuel. Reiber, Joachim Reibl, Tina Reich, Steve Reichmann, Angelika Reid, Jamie Reid, Gary B. Reid, Shaheem Reilly, Diane J. Reimann, Heli Reimer, Bennett Reinhard, Strohm Reinhardt, Max Reininghaus, Till Reinsch, Paul N. Reising, Russell. Reiss, Joshua D. Reit, Claes Réka, Kővári Ren, Damin = 任达敏 Reniers, Dominique Renihan, Colleen Renner, Ursula Renno, Frédérique Renoff, Greg Renshaw, Mary. Rentmeester, Casey Reo, Don. Reside, Doug Residenz Verlag Restall, Matthew Rétfalvi, B Retief, Hanlie Reul, Barbara M. Reul, Barbara M. Reula-Baquero, Pedro Révbíró, T Reveillac, Jean-Michel Revers, Peter Reverter, Arturo Révész, D Reyes, Manu Reyland, Nicholas. Reynolds, Dwight Fletcher Reynolds, Christopher A. Reynolds, Andy. Reynolds, Karen Reynolds, Simon Reynolds, Andy Reynolds, Rou Reynolds, Roger Rheault, Michel Rhodes, James Rice, Paul F. Rice, Paul F. Richard, Robert Richard, André. Richards, Rosemary Richards, Eleanor Richards, Annette Richards, Keith Richards, Catherine Richardson, John Richardson, Peter Richardson, Michael S. Richter, P Richter, Bernhard Ridley, Aaron Riedel, Friedlind Rieger, Eva Riemer, Anatol Stefan Ries und Erler Riethmüller, Albrecht Rietveld, Hillegonda C. Rieuwerts, Sigrid Rigg, Tony Rigtrup, Malene Riis, Thomas Laurence Riley, Peter Riley, Herlin Riley, Christine Riley, Tim Rilke, Rainer Maria Rincón-Rodríguez, Nicolás Ringer, Mark Ringsmut, Martin Ringuet, Chantal Ringuet, Chantal Rink, John Risi, Clemens Riskó, K Ritter, Marian Ritter, Rüdiger Ritterman, Janet. Ritz, David Rival, Robert Rivard, Michel Rivard, Michel. Rivera, Chiquis Rizo-Valero, David Rizvi, Sajid. Rizzardi, Veniero Ro, Ronin. Roach, Archie Robert, Schumann Roberts, Sheena. Roberts, Stephen B. Roberts, Wesley. Roberts, Michael Symmons Roberts, Robert Wyn Roberts, Alun Roberts, Chris Robertson, Robert. Robertson, J. I. S. Robertson-Kirkland, Brianna E. Robinson, Keith Robinson, Suzanne Robinson, Richard Robinson, Billy Robinson, Roxy Robinson, Bradford Robinson, Dylan Robinson, Robin C. Robinson, Thomas Robson, Andrew Roca-Vidal, Fausto Rocconi, Eleonora Rock, Mick Rock Against Racism (London, England), Rocke, Stephanie Rodeia, Kristelle Rodgers, David Rodgers, Nile. Rodgers, Mary Rodham, Steve Rodilla-León, Francisco Rodman, Ronald W. Rodmell, Paul Rodrigo, Joaquín Rodrigues, Maria da Anuncia Rodriguez, Mauricio Rodriguez, Hernan A. Rodríguez-Riva, Lucía Rodríguez, Eva Moreda Roen, David Roesler, Ulrike Roesner, David. Rogan, Josh Rogers, Susan Rogers, Holly Rogers, Allyson Rogers, Jim Rogerson, Ben. Rohmig, Stefan Roig-Francoli, Miguel A. Roig-Francolí, Miguel A. Rolland, Romain Rolland, Romain Roller, Alfred Rollins, Scott Román, Gun Rommen, Timothy Rona, Jeff Rondón, César-Miguel Rone, Vincent E. Ronstadt, Linda Ronström, Owe Ronström, Owe Rooke, Deborah W. Roos, Hilde Ros-Vilanova, Agustí Rosa, Tendero Rosabal-Coto, Guillermo Rosand, Ellen Rose, Caryn Rose, Stephen Rosenberg, Neil V. Rosenboom, David Röshammar, Martin Ross, Alex Ross, Mary Jane Ross, Alex Ross, Sarah M. Rossi, Jérôme Rossini, Giacomo Rossitter, Joe Rost, Henrike. Roswitha, Jong Roth Family foundation. Rothenberg, David J. Rothenberg, David Rotondi, Jim Roud, Stephen Rougvie, Doris. Routledge (Firm), Rovira, James Rowden, Clair Rowe, Paula. Rowell, David Rowland, Steve Rowley, Eddie Rowley, Scott Rowley, Sarah Rowley, Jennifer Rowohlt Taschenbuch Verlag Rowohlt Verlag Roy, Elodie A. Royal Albert Hall, Royal Albert Hall. Royal College of Music (Great Britain), Royal Conservatoire of Scotland. Royal Northern College of Music. Royal School of Church Music (London, England), Royal Scottish Country Dance Society. Royal Welsh College of Music and Drama. Royl, Ekkehart. Royster, Francesca T. Roza, Greg Rozier, Charles C. Rozina, Palić Jelavić Rónai, András Rösner, Isolde. Deleyto Rubiales-Zabarte, Gorka Rubin, Jay Rudasné, M Rudbäck, Niklas Rudén, Jan Olof Ruditsa, Roman Rudolf, Gusztin Rudolf, Tóth János Ruehl, Kim Ruiz, Fran Ruiz, María Jesús Ruiz-Celaá, María Rosa Ruiz-Zanón, Francisco Ruiz-Zúñiga, Alessandra Ruland, Jim Rumen, István Csörsz Rumph, Stephen C. Rungwald, Helge Runningdeer, Islene Rusbridger, Alan Ruschkowski, Klaudia Rushton, Julian. Russell, Andrew Russell, Richard Russell, Bruce Russell, Scarlett Russo, Frank A. Russomanno, Stefano Rust, Victor. Rustin-Paschal, Nichole Rutherford, Susan. Rutherford, Susan Rutherford-Johnson, Tim Ruwe, Donelle Rae Růžičková, Zuzana Rydberg, Enar Merkel Rzewski, Frederic S., Norbert Medgyesy Saah, Jim Saarikallio, Suvi Saavedra, Luis Sabe, Bashir Abu Sabo, Anica Sacaluga-Rodríguez, Ignacio Sachs, Harvey Sacks, Oliver W. Sadler, Graham Sadoff, Ronald Saether, Eva Saffle, Michael Sagaseta-Ariztegui, Aurelio Saint-Dizier, Patrick Saint-Georges, Henri Saint-Saëns, Camille Saintilan, Paul Saitō, Yoshiomi Saitō, Hideki Sajewski, Mallory Sakagawa, Naoya. Sakallieros, Giōrgos Sakamoto, Mariko. Sakamoto, Ryūichi. Saker, Marilyn Nadine Sakka, Laura Stavroula Salamone, Frank A. Salawu, Abiodun Salazar, Adolfo Saldaña, Lilliana Patricia Salewicz, Chris Salhi, Kamal. Salisbury, Leila Saljuqi, Nasruddin Salkind, Micah E. Salmerón-Infante, Miguel salmon, Elizabeth Salmon, Thomas Salvi, Dario Samarotto, Frank Sampath, Vikram Samper-García, Josefa Sampsel, Laurie J. Samuels, Sefton Sanchez-Behar, Alexander Sánchez-López, Virginia Sánchez-López, Israel Sánchez-Sánchez, Germán Sandercoe, Justin. Sanders, Kent Sanders, Kenny Sanders, Ernest H. Sanderson, Ana. Sanderson, Caroline. Sanderson, Caroline Sandford, Christopher Sandgren, Patrik Sandifer, Charles Philip Sándor, Márki Sándor, Solymossy Sándor, Kármán Sándor, Mátyás Sándor, Tatár Sándor, Varga Sanfilippo, Katie Rose M. Sangens Hus Sangfællesskaber for Alle (projekt) Sanjek, David Sanjuán-Mínguez, Ramón Sanna, Raninen Sano, Katsuya Santa, Matthew Santaella, Mayco A. Santelli, Robert Santi, Matej Santos, Andeline Dos Sapiro, Ian Sappenfield, Jess Sardar, Ziauddin Sarkissian, Margaret Sarlo, Dario Sarno, Giulia Sárosi, B Sarrazin, Natalie Rose Sas, Á Satō, Masayuki Saunders, Jo Sauveur, Joseph Savage, Jonathan. Savage, Jonathan Savage, Jon Savidge, Phil Savvidou, Paola Sawasaki, Masahiko Sawler, Harvey Sawyers, Pascoe Saylor, Eric Sánchez, María José Mar Sánchez, Martha I. Chew Scanes, Stephen Scanlan, John Scannell, John. Scannell, Paddy Scarfe, Gerald. Scaricaciottoli, Emiliano Scarlatti, Domenico Schaal-Gotthardt, Susanne Schab, Alon Schader, Luitgard Schaeffner, André Scharen, Christian Scharff, Christina Scharling, Pia Bohr Schatzberger, Lesley Schauser, Soren Schäfer, Siegfried Schedel, Margaret. Scheding, Florian Scheer, Christopher M. Scheller, Jörg. Scherer, Klaus R. Schiefelbein, Torge. Schiff, András Schikaneder, Emanuel Schildt, Maria Schildt, Maria Schiller, Rina Schiotz, Aksel Schirm, Christian Schlagel, Stephanie P. Schleuse, Paul Schmelz, Peter John Schmid, Manfred Hermann Schmidt, Patrick Schmidt, Patrick Schmidt, Patrick K. Schmidt, Randy Schmidt, Siegrid Schmidt, John R. Schmidt-Beste, Thomas. Schmierer, Elisabeth Schmitt, Jean-Claude Schneider, Magnus Tessing Schneider, Markus Schneider, Nicola Schneider, Magnus Tessing Scholz, Anna Schonning, Klaus Schoop, Monika E. Schrag, Brian Schrammel, Josef Schrammel, Johann Schreffler, Gibb Schreiber, Brad Schroff, Neil Schuchardt, Erika Schueneman, Bruce R. Schultz, Marianne Schultz, Rima Lunin Schulze, Holger Schumann, Robert Schumann, Robert Schuring, Martin Schuttenhelm, Thomas Schwab, Andrea. Schwab, Andrea Schwander, Lars Schwartz, Stephen. Schwartz, Jessica. Schwartz, Jeff Schwarz, Ralf-Olivier Schweickle, David John Schwetter, Holger Sciannameo, Franco Sciullo, Nick J. Scollo, Etta Scotland. Scott, Mark Scott, Kevin Scott, Derek B. Scott, Jonathan Scott, Patricia. Scott, Paul Scott, Margaret. Scott, Robert Scott-Heron, Gil Scott-Maxwell, Arline Scottish Opera, Scottish Opera. Scottish Text Society. Scowcroft, Philip L. Scripp, Larry Scruton, Roger Seago, Allan Seales, Chad E. Seaman, Gerald R. Seaton, Douglass Seckerson, Edward. Seddon, Laura. See, Lisa. Seedorf, Thomas Seeger, Pete Seeley, Paul Seeman, Sonia Tamar Segall, Christopher Segarra-Muñoz, Dolores (Ed.) Segretto, Mike Seibt, Oliver Seidenfaden, Kirsten Juul Seidlitz, Kirsten. Seinen, Nathan Sekkelund, Kaj Sekkyōbushi no Kai, Selander, Marie Selby, Anna. Selby, Richard Seldas-Fernández, Inmaculada Selvik, Randi M. Semerádová, Pavla Senelick, Laurence Senfl, Ludwig Senō, Rie. Seo, Maria K. Sequeira, Jessica Seravalli, Cristina Serna, Desi Sernestrand, Martin Seroff, Doug. Seroussi, Edwin Seroussi, Edwin Serrano-Betored, Pilar Sesigür, Onur Setchell, Martin Setchell, Jenny Severn, John R. Sexton, Paul Sexton, Paul Séité, Yannick Shadle, Douglas W. Shahriari, Andrew C. Shakai Hyōronsha. Shakespeare, William Shapey, Rachel Shapiro, Peter Sharkey, Elizabeth Sharp, Avery T. Sharp, Johnny. Sharpe, Graham Shaw, John M. Shaw, Julia T. Shaw, Lisa Shaw, Misti Shaw-Miller, Simon Shay, Anthony Shaylor, Andrew. Shears, Barry Sheehy, Daniel Sheinbaum, John J. Sheinberg, Esti Sheinkop, Eric. Shelemay, Kay Kaufman. Shelton, Robert Shelvock, Matthew T. Shen, Bo = 申波 Shennan, Jennifer Shenton, Andrew Shephard, Tim Shepherd, Fiona Shepherd, Roger Shepherd, John Sheppard, James Sheppard, William Anthony Sheridan, Simon Sheridan, Maureen. Sherinian, Zoe C. Sherlock, Tom Sherr, Richard Shiba, Sukeyasu Shibata, Minao. Shields, Nathan Shields, Hugh Shields, Lisa Shiffman, Victor Shimer, Joan Carr. Shin, Mick Shin sannin no kai. Shinjō, Wataru. Shiota, Lisa Shipley, Ian Shipton, Alyn Shir, Jay Shiratori, Hiroyasu. Shirley, Ian. Sholl, Robert Shopland, Norena Shore, Paul J. Showbiz, Grant Shōchiku Kabushiki Kaisha, Shroff, Neil. Shroff, Neil Shuker, Roy Shulman, Alon Shupe, Abigail Si Chaun Yin Yue Xue Yuan Zuo Qu Xi = 四川音乐学院作曲系 Sieder, Erika L. Siegert, Christine Siemens-Hernández, Lothar Sillito, Kenneth Sills, Helen Sills, James Šilobod-Bolšić, Mihael Silver, Christopher Silverman, Marissa Silverthorne, Diane V. Simándi, K Simeone, Nigel Simeone, Nigel. Simkin, Stevie Simmons, Caleb Simmons, Patrick Simmons, Sylvie Simon, GG Simon, Julia Simon, E Simon and Schuster, Inc., Simpson, David Sims, Robert Sinatra, Barbara. Sinclair, Adrian Sinkovics, G Sinnamon, Sarah Siôn., Pwyll ap Sir Arthur Sullivan Society, Sirotin, Peter Sisilianos, Giōrgos Sistema Scotland. Sisters of Saint Joseph, Sjögren, Carl Sjöstrand, Heléne Sjöstrand, Eva Skageg\aard, Ellinor Skara stiftshistoriska sällskap. Skåraeus, Eva Škarica, Siniša Skácel, Jan. Skelchy, Russell P. Skellett, Paul Skilbeck, Nicholas Skillen, Paul Skinner, Mike Skinner, Frederick W. Skinner, Tony Skoglund, Bo Škojo, Tihana Skoogh, Francisca Škoro, Miroslav Skou, Birthe Skoutella, Avra Pieridou Slade, Nicola Slethaug, Gordon Slezské zemské muzeum v Opavě, Sloan, Nate Sloane, Carol Slobin, M Slobin, Mark Sloboda, John A. Slouka, Petr Sly, Gordon Cameron Smalls, Alexander Smart, Austen Smart, Sue. Smart, Scott Smedegaard, Clara Smetana, Bedřich Smit, Christopher R. Smith, Thomas Ruys Smith, Ayana O. Smith, Meaghan Smith, Graham Smith, Eleanor Smith, Barry Smith, Fred Smith, Janice P. Smith, Danyel Smith, Ruth Smith, Neil Thomas Smith, Mark E. Smith, Sean Smith, Jeremy L. Smith, Patti. Smith, Muriel Smith, Stephen Decatur. Smith, Kenneth M. Smith, Brenda Smith, Joseph. Smith, Gareth Dylan Smith, Laura Smith, Richard Digby Smith, Graeme Smith, Gareth Dylan. Smith, John Arthur Smith, Gillian Smith, Lindy Smith, Richard Langham Smith, David J. Smith, Peter Smith, Peter L. Smith, Patti Smith-Borne, Holling Smitt, Thorkil Smyth, Gerry Snedden, Andrew John Sneeringer, Julia Snell, Adrian Snell, Merrie Sneum, Jan Snickars, Pelle Snowden, Jackie Snowdon, Jasper Whitfield. Snowdon, William. Snyder, Andrew Sobaskie, James William Sociedad Española de Musicología Society for Education, Music and Psychology Research. Soden, Oliver Söderqvist, Dan Sófalvi, Emese Soho Theatre + Writers' Centre. Soldier, Dave Soler-Campo, Sandra Solís, Ted Solomon, Norman Solomon, Jason W. Solomon, Kate Solomos, Makis Soma, Salamon Somerset Archaeological and Natural History Society. Somfai, L Somfai, László Sommer, Isabella. Sondheim, Stephen Sonesson, Eva Song, Pei Song, Myoung-Sun Sonnichsen, Tyler Sonnleitner, Klaus. Soprano-Manzo, Virginia Soret, Marie-Gabrielle Sorozábal-Mariezkurrena, Pablo Sorrell, Neil. Sorrento, Anna Sounac, Frédéric SoundLINCS (Organization) SoundLINCS (Organization), Sounes, Howard Southall, Brian Southcott, Jane Southey, Roz Soveral, Madalena Söderman, Johan Söhnel, Marion Spagnola, Lawrence J. Spalding, Esperanza Sparkes, Brian A. Sparkes, Diana Sparrer, Walter-Wolfgang Speck, Christian Spedding, Patrick Speers, David Spelman, Nicola. Spence, Simon Spence, Simon. Spewack, Samuel Spewack, Bella Cohen Spicer, Mark Stuart. Spiegel, Deborah Spilker, Hendrik Storstein Spinks, Tansy. Spirer, Jeff Spiro, Neta Špoljarić, Borko Spracklan-Holl, Hannah Frances Ma Spracklen, Karl Spree, Eberhard. Sprigge, Martha Sprigman, Christopher Springer-Verlag GmbH Springsteen, Bruce Sprogforeningen Spruce, Gary. Stables, Ryan Stachel, Peter Stadnicki, Daniel Akira Stafford, Caroline Stafford, David Stahl, Geoff Stahl, Geoff Stakelum, Mary Stakelum, Mary. Stålberg, Thomas Staley, Sam Stålhammar, Börje Stanley, Bob Stanley, Billy Stanley, Roy Stanović, Adam. Stanton, Travis W. Stanyon, Miranda Stapells, Victoria Starr, Larry Starr, Mark. State Library of Western Australia. Statham, Craig. Stăvaru, C Steege, Benjamin Steel, Gary Steel, Daniel Warren Steele, Robert. Steen, Ole Steen, Bill Steen, Michael Steen, Michael. Steensen, Steen Chr. Steenstrup, Kristian Stefanović, Ana Stegmann, Bernd Steichen, James Steindorf, Eberhard Steindorf, Eberhard. Steiniz, R Steinke, Darcey Steinmann, Michael Steinmetz, Uwe Stelzer, Cornelia Stenberg, Ulf Stenström, Johan Stephen, Tom Stephens, Matthew Stephens, Matthew Stepniak, Michael Sterling, Cheryl Stern, Lewis M. Sternfeld, Jessica Steuernagel, Marcell Silva Stevens, Brian David Stevens, Robin Sydney Stevens, Carolyn S. Stevenson, Mick. Stevenson, Richard Stewart, Lezley J. Stewart, Andrew Stewart, Rod. Stévance, Sophie Stimeling, Travis D. Stinnerbom, Leif Stinson, Kathy Stipčević, Ennio Stipčević, Ennio Stjerna, \AAsa Stockigt, Janice B. Stockton, Will. Stockwell, Peter Stoecker, Philip Stohn, Stephen Stojkanović, Zvezdana Stokes, Laura K. T. Stolz, Barbara Ann Stone, Scott Stone, Jonathan W. Stone, Ruth M. Storch, Antonio Maria (Fot Stott, Alan Stott, Maren Stowell, Robin. Stowell, Robin Stowman, William Stöckler, Eva Maria Stöckli, Matthias Strachan, Zoe. Strakoš, Jan Strand, Karin Strange, John Strank, Willem Stras, Laurie Strasfogel, Ian Stratton, Jon Straub, Dorothy A. Strauss, Richard Straw, Will Streissguth, Michael Strickson, Adam. Strickson, Adam Strimple, Nick Stroak, Alison Strobel, Magdalena Stroeher, Vicki P. Stroeher, Vicki P. Strohm, Reinhard Strong, Catherine Struan, Douglas Strunk, Espen Stryker, Mark Stubbs, David Studdert, Will Studham, Susan Studwell, William E. Stueart, Jerome. Stumpf, Carl Stumpf, A Suarez, Ernest Sublette, Ned Suchet, John Suddath, Ananda Sugano, Fuyuki Sugiyama, Chizuru. Sugiyama, Chizuru Sukita, Masayoshi Šuljić, Anton Sullivan, Arthur Sullivan, Randall Sullivan, Chris Sullivan-Burke, Rory Sulyok, Imre Summers, Tim Sundström, Anders Sundström, Anders Gabriel Survilla, Maria Paula Susan, Rankin Sutcliffe, Dean Sutherland, Andrew Sutherland, Robert Sutton, Silvia Hamui Suwa, Haruo Suzuki, Yuri. Suzuki, Ben Svedberg, Roger Svenska Akademien, Svenska kyrkan Hägersten. Svich, Caridad Swafford, Jan Sweeney, Matthew Sweeney, Gareth Sweers, Britta Swick, Bill Swift, Taylor Syddansk Universitet Sylivos, Thanasēs Sylvestersen, Helene Lund Sylvia, Sass Symons, David Synek, Jaromír Szabó, FJ Szabó, S Szabó, B Szabó, Balázs Szabó-Knotik, Cornelia Szádoczki, V Szakács, György Szalai, Béla Szalay, Olga Szalsza, Piotr Szatmary, David P. Szélpál-Bajtai, É Szemere, Anna Szenczi-Molnár, A Szendrei, J Szerényi, Béla Sziklavári, Ki Sziklavári, K Szilágyi, E Szilágyi, Ágnes Szilárd, Jávorszky Béla Szilvia, Leidemann Szirányi, J Szirányi, G Szokolay, Sándor Szoliva, G Szőllőssy, Ágnes Szomory, G Szomory, Gy Szomory, Gy Szpirglas, J. Szturcová, Monika Szuster, Julja Szvorák, K Szwed, John F. Szwed-Walczak, Anna. Sæther, Eva Sørensen, Lis Sørensen, Inger. Sørensen, Inger Sørensen, Kaare Šafránek, Miloš Šedivá, Eliška Šedivý, Dominik Štědronská, Markéta Tadday, Ulrich Tägil, Ingela Tait, John. Takahisa, Mai. Takahisa, Mai Takakura, Hiroki Takei, Kyōzō. Takemura, Yoshiaki. Takenaka, Tōru Takeshita, Ai. Takeuchi, Tsutomu Takeuchi, Michitaka Takeuchi, Michitaka. Takii, Keiko Talam, Jasmina Talle, Andrew. Tallián, T Tallián, Tibor Tamás, Balogh Tamás, Demeter Tamás, Bódiss Tamás, Clementis Tamás, Berki Tamás, Hajnáczky Tamás, Clemetis Tamplin, Jeanette Tamvakos, Thomas Tan, Daphne Tan, Shzr Ee. Tan, Sooi Beng Tan, Siu-Lan Tan, Gesheng = 檀革胜 Tanaka, Haruhisa. Tao, Peng = 陶鹏 Tarasov, Nikolaj Tardy, László Tari, Lujza Tari, L Tarling, Nicholas Tarling, Nicholas Tarnow, Volker Tartakowsky, Danielle Taruffi, Liila Taruskin, Richard Tassell, Nige Tate Gallery Liverpool. Tatlow, Ruth Tatro, Kelley Tau, Michael Taube, Evert Távolodó, Marton László Tawn, Anne Tawn, Brian Taylor, Timothy Dean Taylor, Dennis Taylor, Richard. Taylor, Sarah Taylor, Simon Taylor, Catherine Taylor, Tony Taylor, Richard Taylor, Jeremy E. Taylor, Rachelle Taylor, Deems Taylor, Benedict Taylor, Neil Taylor, Thomas Tchaikovsky, Peter Ilich Tchaikowsky, André Tcharos, Stefanie Stella Te Uru Waitakere Contemporary Gallery Teal, Kimberly Hannon Team (Theater troupe) Tebbutt, John Teitelbaum, Richard Teitelbaum, Benjamin R. Tejada-Tauste, Torcuato Tejre, Örjan Téllez, José-Luis Tempah, Tinie Temperley, Nicholas. Templeman, Ted Tenney, James Tenorio-González, María-Paz Teparić, Srđan Terauchi, Naoko Terefenko, Dariusz Terék, József Ternhag, Gunnar Ternhag, Gunnar Terray, B Tesler-Mabé, Hernan Testa, Matthew Tewari, Swarima Tewari, Sudhu Thachuk, Steven Thanner, Lisa Thaut, Michael Thedens, Hans-Hinrich Thieblot, Gilles Thiel, Markus. Thiellay, Jean. Thiellay, Jean-Philippe Thiellay, Jean-Philippe. Thistlethwaite, Nicholas Thom, Paul Thomas, Paul A. Thomas, Andy Thomas, André J. Thomas, Adrian Thompson, Ben Thompson, Peter Thompson, Laura Thompson, Gael Thompson, Robin Thompson, Merlin B. Thompson, Clifton Thompson, Brian Christophe Thompson, Christopher Thompson, Shirley J. Thompson, Wendy Thompson's Gallery (London, England), Thomson, Margie Thomson, Elizabeth Thomson, Kenneth Thomson, Mary. Thomson, Margie Thomson, Matthew P. Thomson, Graeme Thorau, Christian Thormählen, Wiebke. Thormählen, Wiebke Thorn, Tracey Thornton, Richard Thorpe, Vicki Thrasher, Alan R. Thronton, Daniel Thue, Mette Thurlow, John Thurston, Tim Tibor, Galambos Tibor, Legát Tibor, Boros Tibor, Pintér Tibor, Borsos Tibor, Frank Tichenor, Scott Tiderman, Jennie Tiemeyer, Daniel. Tiemeyer, Daniel Tierney, Helen Tihamér, Vujicsics Tillberg, Adriana Di Lorenzo Tillman, Joakim Tillman, Joakim Tillmann, Barbara. Tímea, Szűcs Tímea, Murzsa Tinker, Claire. Tinsley, Justin Tippet, David Tippett, Michael Titlebaum, Michael Tito-Martínez, Manuel Titon, Jeff Todd Titus, Barbara Tjernberg, Per Tobeck, Christina Toccafondi, Anna Todd, Larry. Todd, Larry Toft, Tim Toft, Robert Toft-Nielsen, Frank Tofte, Marianne Togden, Doc Tohver, Berit Toivakka, Svetlana Tojo, Satoshi Tokay, Serâ Tokita, Alison Tokuzen, Yoshikazu. Tolokonnikova, Nadezhda Tolstrup, Jesper Tom, Kenneth Tomašević, Katarina Tomašević, K Tomasovszki, K Tomes, Susan Tomić, Viktoria Franić Tomita, Yo. Tommins, David Jim Tonelli, Chris Tong, Lei = 童雷 Tongiorgi, Duccio Tonković, Željka Toop, David Topp, Gary Torell, Kurt Torp, Lisbet Torp, Lisbet Torrado, José Antonio Torre-Molina, María José Torre-Molina, María-José Torrent-Centelles, Vicent Torres, Esperanza Torres-Clemente, Elena Torsén, Peter Tortella-Casares, Jaume Tortora, Daniela Torvinen, Juha Tótfalusi, I Tóth, Á Tóth, GJ Tóth, M Toulson, Rob Touriñán-Morandeira, Laura Townsend, P. D. Townsend, Devin Townshend, Pete. Townshend, Pete Toyotake, Rodayū Toyotake, Rodayū Tozer, Malcolm Tófalvy, Tamás Töfferl, Sabine Tracey, Hugh Trageser, Martin Traiger, L Trainer, Adam Trapp, Carl Henrik Trautner-Suder, Christa Travis & Emery Music Bookshop, Travn, Danni Treece, Dave Treece, Dave. Trelawny, Petroc Trethewey, Kenneth R. Trew, Jonathan Tribe, Colin Trifunović, Bogdan Trikoupis, Athanasios Trillo, Roberto Alonso Trippett, David Trotta, Felipe Trottier, Danick. Tröndle, Martin Tröster, Sonja Trujillo-Pacheco, Víctor-M. Trulsson, Ylva Hofvander Trunk, Jonny Tsai, Eva Tsapidis, John. Tschmuck, Peter. Tsioulakis, Ioannis Tsuchida, Eizaburō. Tsukada, Ken'ichi. Tsumura, Fumihiko. Tučkar, Zoran Tucker, April Tucker, John Tuksar, Stanislav Tullberg, Markus Tunbridge, Laura Tuncel, Yunus Tunley, David Tura New Music. Turbet, Richard Turbow, Jason Turek, Ralph Turkalj, Zlatko Turković, Hrvoje Turnbull, Gillian Turner, Kristen M. Turner, Frank Turner, Richard Brent Turner, Debbie Turner, Alwyn W. Turner, Elizabeth Turner, Steve Turner, Patrick Tusa, John Tutti, Cosey Fanni Tuxen, Erik Tuxen, Henrik Tweedy, Jeff Tyler, Steven Tyrrell, John Tŷ Cerdd (Organization), Uchida, Kensuke Udom, Buisi Udow, Michael W. Udvari, K Ueda, Yōko Ueda, Yasushi. Ueki, Yukinobu Ueno Gakuen Daigaku. Ugray, Máriásné- Uhde, Katharina Uings, James UK Intellectual Property Office, Ukuleles (Musical group) Ulhôa, Martha Ullén, Fredrik Ullman, Anna. Ullsten, Alexandra Ulrich, George Ulrich, Charles Ulster Historical Foundation, Um, Hae-kyung Umeå universitet. Umurhan, Osman Uniting Church in Australia. Universidad Internacional de Andalucía Universidad Politécnica de Valencia. Universität Wien. University College of Wales (Aberystwyth, Wales). University of Hawaii at Manoa. University of Hull, University of London. University of Michigan. University of Pennsylvania. University of Salford, University of Sheffield. University of Southampton, University of York. Unnerbäck, Axel Unseld, Melanie. Unseld, Melanie Unterberger, Richie Upholt, Boyce Urchueguía, Cristina Urkevich, Lisa Urquhart, Peter Whitney. Usher, Shaun Utz, Christian Ústav dějin umění AV ČR, Vaarzon-Morel, Petronella Väätäinen, Hanna Vadillo-Pérez, Eneko Vail, Mark Vajk, Á Val, Fernán Valenzuela, Juan-Ignacio Valkare, Gunnar Vallejo-Cisneros, Antonio Vallely, Brian. Vallely, Eithne. Vallely, Fintan Valus, Poschné Vambe, Maurice Taonezvi Vámos, M van Beethoven, Ludwig Van Boer, Bertil H. van Delden, Ate van der Steen, Bart van Drimmelen, Peter van Elferen, Isabella Van Halen, Alex van Kan, Mischa Van Rij, Inge van Rijk, Elena Abramov- van Steensel, Leon Van Straten, Frank VanderPloeg, Libby Vanderzweerde, Robert Vandome, Nick VanHandel, Leigh Varelli, Giovanni Varga, Sándor Varga, Norbert Varga, Ildikó Varga, Bálint András Varga, István Vargas, Alejandro Alberto Te Vargyas, G Várjon, D Várjon Dénes Vásárhelyi, J Vásáry, Tamás Vásáry, T Vass, Bence Vass, N Vaucher, Gee Vazquez, Alexandra T. Vázquez, Elena Vazsonyi, Nicholas Vear, Craig Večković, Stjepan Vega-Barrio, José-María Vega-Pichaco, Belén Véghelyi, B Vela-del-Campo, Juan Ángel Vela-González, Marta Velasco-Maíllo, Santiago Vella, Francesca Venegas, Mauricio Venn, Edward Ventura, David Vera, Billy Vera, Lampert Verbei, Wim Verbuč, David Verburgh, Thierry P. F. Verdi, Giuseppe Verdier, Véronique Veres, B Vergo, Peter. Vergōtēs, Nikolaos Verlag Bibliothek der Provinz Verlag Christoph Dohr - "Haus Eller" Verlag Kiepenheuer & Witsch Verlag Klaus-Jürgen Kamprad Vermoesen, Noëmie Vernallis, Carol Vernon, Paul Veronika, Kusz Veselinovič-Hofman, Mirjana Vesić, Dušan Vesterberg, Henrik Vesterberg, Heidi Veverka, Karel Vialette, Aurélie Vicente-Delgado, Alfonso Vick, Liza Vickers, David Vickers, Graham. Vickers, Justin Victoria, Heidi Vidić, Ana Vignoles, Julian Vikárius, L Viktória, Ozsvárt Viktória, Kondi Viljoen, Martina Villanueva-Benito, Isabel Villanueva-Serrano, Francesc Vilmos, Fedor Vilmos, Gryllus Vincenzi, Marco. Vinciane, Trancart. Vinciguerra, Jean-Michel Vines, Nicholas Vinocour, Lev Viola, Bíró Virtanen, Timo Viskontas, Indre Vivien, Apjok Vivien, Szőnyi Vo, Nancy Voegelin, Salomé Vogel, Gunther Vogel, Joseph Voices Foundation, Voigt, T Voit, V Volek, Tomislav Volgsten, Ulrik Volgsten, Ulrik Volpert, Megan A. von Gertten, Iwa Sörenson von Hofmannsthal, Hugo von Meck, Nadezhda Filaretovn von Roth, Dominik von Westernhagen, Louisa Vonderau, Patrick Vondráček, David Vönöczky, Gábor Vorderman, Carol Vos, Stephanie Voss, Steffen Vourch, Marianne Vrečko, Stjepan Vrisk, Katarina Všetičková, Gabriela Vučić, Miroslava Vujicsics, Marietta Vuksanović, Ivana Vulliamy, Ed Vuust, Peter Wada, Takashi Wade, Stephen Wade-Matthews, Max Wagner, Thomas Wagner, Bryan Wagner, Richard. Wagner, Richard Wagner, Matthieu Wagner, Richard Wagstaff, John Wahlqvist, Niklas Wainwright, Martha Wakefield, Colin. Waksman, Steve Wald, Elijah Wald-Fuhrmann, Melanie. Waldingbrett, Ingrid Waligórska, Magdalena Walker, STan Walker, Norman Walker, Stan Walker, Alan Walker, Lucy Walker, Jason P. Walker, Ian Walker, David Walker, James Walker, Michael Walker, A Walkling, Andrew R. Wallace, John Wallace, Robin Wallén, Göran Wallis, John Wallmark, Zachary Wallrup, Erik. Wallrup, Erik Wallrup, Erik Walls, Peter. Walsh, Stephen Walsh, Michael J. K. Walter, Meinrad Walter, Meinrad Walter de Gruyter GmbH & Co. KG Walthaus, Asing Walton, Chris Walton, Andrew Walton, Benjamin Walton, Chris Wan, Shuangwu Wang, Li Wang, Jing Wang, Jing Wang, Klavier J. Wang, Guiping Wang, Helen Wang, Chenwei Wang, Ka Wang, Oliver Wang, Hui = 王辉 Wang, Jin = 王进 Wang, Liping = 王黎平 Wang, Lixin = 王丽新 Wang, Min = 王敏 Wang, Peiyu = 王培瑜 Wang, Yaohua = 王耀华 Wang, Yarui = 王娅蕊 Wang, Yimeng = 王艺萌 Wang, Zonglin = 王纵林 Wannamaker, Rob Ward, Philip. Ward, Miranda. Ward, Christopher Wardhaugh, Benjamin Ware, Evan Warner, Daniel Warner, Andrea Warner, Alan Warren, Jeff R. Warren, Andrew Warwick, Dionne. Warwick, Jacqueline C. Wash, Martha Washabaugh, William Washida, Kiyokazu Watanabe, Yawara. Watanabe, Tamotsu Waterman, Bryan Waterman, Christopher Alan Waters, Keith Waters, Robert Watkins, Huw Watkins, Jane Watkinson, David Watson, Jada E. Watson, Laura Watson, Jada Watson, Allan Watson, Philip Watt, Paul Way, Lyndon C. S. Webb, Michael D. Webb, Jimmy Webb, Sioned Webb, Martin Weber, Zdenka Weber, William Webster, Patrick Webster, Emma Webster, Peter Richard Weel, Liva Wehn, Jan Weid, Jean-Noël von der. Weidinger, Hans Ernst. Weinel, Jonathan Weinstein, Anna Weiss, Jernej Weissglas, Birgitta Östlund Weissman, Dick Weitzman, Simon Welander-Berggren, Elsebeth Welch, Graham Welin, Cissi Weliver, Phyllis Wellings, Ben Wellington, Tony Wellmann, N Wellmer, Albrecht Wells, Christi Jay Welsh, Louise Welsh Association of Male Choirs. Welsh Folk-Song Society. Weltman, Sandy Wendler, Merete Wennberg, S Wenner-Gren Foundation for Anthropological Research. Wente, Allison Rebecca Werger, Carola Werley, Matthew Michael Werner, Goebl Wernlid, Eva Wertheimer, Alfred Wertheimer, Melissa E. West, Christopher West, Chad Wester, Bertil Westerlund, Heidi Western, Tom Westhoff, Ben Westminster Media Forum, Westrup, Laurel Westvall, Maria Wetterqvist, Anna Wheaton, R. J. Whedon, Joss Wheeldon, Marianne Whidden, Lynn Whineup, Tony Whitall, Susan. White, Danny White, Danny White, Harry. White, Michael White, Vernon White, Bryan White, Paul. White, Paul White, Matthew White, Timothy White, Harry White, John Whitehead, Gillian Whiteley, Sheila Whiteley, Jon Whiteoak, John Whitfield, Sarah Whitfield, Sarah Whiting Society of Ringers, Whitmer, Mariana Whitney, Karl Whittaker, Jason Whittaker, Sheila Whittall, Arnold Whyton, Tony Wicke, Peter Wickström, David-Emil Widdess, Richard Wide, Steve Widmer, Gerhard Wieczorek, Sławomir Wiegand, Gottfried Wienbibliothek im Rathaus, Wiener Institut für Strauss-Forschung, Wiener Volksliedwerk Wiens, Kathleen Wiersema, Robert J. Wierzbicki, James Eugene Wiesenfeldt, Christiane Wiffen, Charles. Wiggins, Jackie. Wiggins, Phil Wikström, Per Wikström, Patrik Wilbourne, Emily Wilcher, Phillip Wilcox, Beverly Wild, Andrew Wild, David Anthony. Wilder, Alec Wilding, Philip Wildmann, Daniel Wilentz, Sean Wilfing, Alexander. Wilfing-Albrecht, Meike. Wilheim, A Wilkie, Katie Wilkins, Frances Wilky, Pete Will, Richard James Willard, Timothy D. Wille, Irmgard Willemetz, Jacqueline. Willert, Søren Williams, Alastair Williams, James Williams, David A. Williams, Grace Williams, Katherine Williams, Stuart Williams, John Williams, Joseph Williams, Liz Williams, Alex Williams, Georgina Williams, David A. Williams, Hermine Weigel Williams, James Gordon Williams, Jonathan. Williams, Quentin Williams, William Lewis Williams, Jane Q. Williams, Sean Williams, Sarah F. Williams, David Anson Williamson, Brian Williamson, Victoria Williamson, John Williamson, Nigel Willin, Melvyn J. Willingham, Lee Willis, Peter Willis, Victoria Willson, Rachel Beckles. Willsteed, John Wilsmore, Robert Wilson, Blake McDowell Wilson, Mary Wilson, Joe Wilson, Brian Wilson, Christopher R. Wilson, Scott Wilson, Jason Wilson, Brett Wilson, Jen Wilson, Charles Wilson, Nick Winans, BeBe Windhager, Ákos Windhager, K Winehouse, Mitch. Winfried, Pauleit Winkler, Heinz-Jürgen Winkler, Amanda Eubanks Winnett, Susan Winslow, Luke Winter, Tomáš Winters, Ben Winterson, Julia Wintle, Christopher Wintle, Christopher. Wipplinger, Jonathan O. Wise, Stuart Wiseman, Bob Wiseman-Trowse, Nathan Wistreich, Richard. Wistreich, Richard Withers, Deborah M. Wittkowski, Désirée Witulski, Christopher Witvliet, John D. Wladika, Michael Wode Psalter Project Team. Woitas, Monika Wolf, Richard K. Wolf, Norbert Christian Wolf, Stacy Ellen Wolfe, Paula Wolff, Christoph Wolff, Loup. Wolff, Christian Wolin, Ada Wolke Verlagsgesellschaft mbH Wolkowicz, Vera Woller, Megan Wollman, Elizabeth L. Wolman, Baron. Womack, Kenneth Wong, Samuel Shengmiao Wong, Casey Philip Wood, Alistair Wood, David. Wood, Jo Wood, Caroline Woodcock, Rob. Woodford, Paul Woodhead, Leslie Woodhouse, Susi Woods, Clyde Adrian Woods, Paul A. Woodward, Ian Woodward, Keren Woody, Robert H. Woolaver, Lance Wooldike, Mogens Wooley, David Freeman. Woolf, Ray Woolford, Julian Woollacott, Ron Woolley, Robin E. H. Woolley, Andrew Wottle, Martin Woznicki, Lisa M. Wöllner, Clemens. Wrangsjö, Björn Wright, Jon Wright, James K. Wright, Lesley Alison Wright, David C. H. Wright, Michael Wright, Ruth Wright, Ruth. Wright, Samuel Wright, Dan Wright, Adrian Wright, Owen Wright, Joshua K. Wright, Julie Lobalzo Wright, Mark Peter Wu, Jiayue Cecilia Wu, Dequn = 吴德群 Wu, Ye = 吴叶 Wurnell, Mats Wyatt, Robert Wylde, Zakk Wyndham-Jones, Guy. Wynne, Ben X, King of Castile Xepapadakou, Avra Xiang, Hengfang = 项衡方 Xiang, Xiaogang = 项筱刚 Xiang, Yang = 项阳 Xiao, Dongfa = 肖东发 Xiao, Mei = 萧梅 Xiao, Wenli = 肖文礼 Xie, Jiaxing = 谢嘉幸 Xie, Yongxiong = 谢永雄 Xin, Xuefeng = 辛雪峰 Xiong, Qi = 熊琦 Xiong, Xiaoyu = 熊小玉 Xu, Chengbei Xu, Delei = 徐德雷 Xu, Ximao = 徐希茅 Xue, Ming = 薛明 Yakupov, Alexander N. Yamada, Kōsaku. Yamada, Chieko Yamada, Takafumi Yamaguchi, Mutsumi Yamakawa, Shizuo Yamamoto, Hiroko Yamamoto, Hiroyuki Yamashita, Hiroaki Yang, Zoua Sylvia Yang, Dingwang = 杨丁旺 Yang, Heping = 杨和平 Yang, Sai = 杨赛 Yang, Xifan = 杨曦帆 Yao, Zhihui = 姚志辉 Yard, Ryan Yawson, Jude Yeaman, G. E. Yearsley, David Gaynor Yearsley, David Gaynor Yeo, Douglas Yewdall, Julian Leonard Yi, Yŏng-mi Yi, Shucheng = 易述程 Yip, Joyce Yoon, Sunmin Yoon, Jean Yordanova, Iskrena Yordanova, Iskrena. York St John University. Yorkshire Association of Change Ringers. Yorkston, James. Yoshida, Tamao Yoshida, Yukako. Yoshida, Minosuke Yoshihara, Mari Yoshikami, Miyuki Yoshizaki, Masaki. You, Jingbo = 尤静波 Young, John Bell Young, Miriama Young, La Monte Young, Rob Young, Toby Young Classical Artists Trust. Young Musician Hebrides (Organization) Ystad, Sølvi Yu, Jun Yu, Danhong = 余丹红 Yuan, Quanyou Yudkin, Jeremy Yue, Kaifeng = 乐开丰 Yun, Isang Yusta, Miguel Ángel Yuste-Martínez, Luis Yusuke, Nakahara Zackrisson, Lasse Zadig, Sverker. Zaeri, Mehrdad Zagorski-Thomas, Simon Zakić, Mirjana Zamora-Caro, Katerine Žanić, Ivo Zapke, Susana Zarate, Rebecca Zatkalik, Miloš Zauner, Michelle Zazulia, Emily Zdanowicz, Gina Zebec, Tvrtko Zeck, Melanie Zeller, Regine. Zembylas, Tasos Zepf, Markus Zeppetelli, John Zerbe, Michael J. Zervos, Giōrgos Zhang, Deyu = 章德瑜 Zhang, Wei = 张巍 Zhang, Xiaoxia = 张笑侠 Zhang, Xin = 张欣 Zhang, Yingfen = 张迎芬 Zhang, Yishan = 张翼善 Zhang, Zhongqiao = 张仲樵 Zhang, Zonghong = 张宗红 Zhao, Sitong = 赵思童 Zhao, Talimu = 赵塔里木 Zhao, Zhi'an = 赵志安 Zheng, Yan = 郑艳 Zhong, Enfu = 钟恩富 Zhou, Danny Zhou, Ji = 周吉 Zhou, Liang = 周亮 Zhu, Hengfu = 朱恒夫 Zhu, Jian'er = 朱践耳 Zhu, Lixing = 朱理惺 Zhu, Yujiang = 朱玉江 Zhuo, Sun Zi, Yin = 紫茵 Zicari, Massimo Ziegler, Robert Ziegler, Lulu Ziemer, Hansjakob Ziemska, Joanna Zilli, Anna Zimmerman, Lee Zimmermann, Walter Zohn, Steven David Zöldi, Gergely Zoltán, Császár Zoltán, Bicskei Zoltán, Molnár Zoltán, Szabó Zoltán, Tumpek Zoltán, Göllesz Zoltán, Kodály Zoltán, Gergely Zoltán, Csermák Zolten, Jerome Zombie, Rob. Zomparelli, Elena Zon, Bennett. Zon, Bennett Zondi, Nompumelelo Bernadette Zornica Hagyományőrző Egyesület Zouhar, Vít Zoumpoulakēs, Petros Zsófia, Borz Zsombor, Németh Zsuzsa, Kővágó Zsuzsa, Czagány Zsuzsa, Czagány Zsuzsanna, Erdélyi Zsuzsanna, Pintér Márta Zsuzsanna, Domokos Zsuzsanna, Réfi Zsuzsanna, Glavina Zsuzsanna, Bálint Zsuzsanna, Szepesi Zubillaga, Igor Contreras Zuckermann, Moshe. Zunigo, Xavier. Zurmühl, Sabine Žuvela, Sanja Kiš Zürcher Hochschule der Künste Østergaard, Per Јанковић-Бегуш, Јелена Маринковић, Соња 국남., 배 음악사연구회 川﨑, 瑞穂 Type any Book Miscellaneous Conference Proceedings Journal Website Web Article Audiovisual Thesis Conference Paper Report Journal Article Presentation Term any Year any 2023 2022 2021 2020 2019 2018 2017 2016 2015 2014 2013 2012 2011 2009 2001 Keyword any 7 (CaQQLa)201-0000282 (CaQQLa)201-0001542 (CaQQLa)201-0004568 (CaQQLa)201-0005777 (CaQQLa)201-0009248 (CaQQLa)201-0010484 (CaQQLa)201-0013983 (CaQQLa)201-0013986 (CaQQLa)201-0017854 (CaQQLa)201-0022164 (CaQQLa)201-0032589 (CaQQLa)201-0038053 (CaQQLa)201-0038355 (CaQQLa)201-0041435 (CaQQLa)201-0046052 (CaQQLa)201-0046054 (CaQQLa)201-0046163 (CaQQLa)201-0053875 (CaQQLa)201-0066316 (CaQQLa)201-0070033 (CaQQLa)201-0081252 (CaQQLa)201-0093787 (CaQQLa)201-0117737 (CaQQLa)201-0164320 (CaQQLa)201-0164324 (CaQQLa)201-0278656 (CaQQLa)201-0343563 (CaQQLa)201-0356887 (CaQQLa)201-0387198 (CStmoGRI)aat300054453 (CStmoGRI)aat300133089 (DE-588)1025655834 (DE-588)1033525375 (DE-588)1036986756 (DE-588)1161203737 (DE-588)4000626-8 (DE-588)4000988-9 (DE-588)4002922-0 (DE-588)4005184-5 (DE-588)4006851-1 (DE-588)4009279-3 (DE-588)4009667-1 (DE-588)4017129-2 (DE-588)4019791-8 (DE-588)4020470-4 (DE-588)4028532-7 (DE-588)4028535-2 (DE-588)4028814-6 (DE-588)4030736-0 (DE-588)4032009-1 (DE-588)4032010-8 (DE-588)4032359-6 (DE-588)4034128-8 (DE-588)4035964-5 (DE-588)4037220-0 (DE-588)4037944-9 (DE-588)4038639-9 (DE-588)4040357-9 (DE-588)4040802-4 (DE-588)4040814-0 (DE-588)4040837-1 (DE-588)4040851-6 (DE-588)4040876-0 (DE-588)4041282-9 (DE-588)4043582-9 (DE-588)4045660-2 (DE-588)4047689-3 (DE-588)4047704-6 (DE-588)4049716-1 (DE-588)4053548-4 (DE-588)4054021-2 (DE-588)4054023-6 (DE-588)4056449-6 (DE-588)4059596-1 (DE-588)4060087-7 (DE-588)4061916-3 (DE-588)4062127-3 (DE-588)4063852-2 (DE-588)4075121-1 (DE-588)4075127-2 (DE-588)4075128-4 (DE-588)4076232-4 (DE-588)4113615-9 (DE-588)4124099-6 (DE-588)4124195-2 (DE-588)4124348-1 (DE-588)4126097-1 (DE-588)4126228-1 (DE-588)4127833-1 (DE-588)4128844-0 (DE-588)4129964-4 (DE-588)4130545-0 (DE-588)4132033-5 (DE-588)4132716-0 (DE-588)4137558-0 (DE-588)4138396-5 (DE-588)4142730-0 (DE-588)4142731-2 (DE-588)4143388-9 (DE-588)4156941-6 (DE-588)4160637-1 (DE-588)4164043-3 (DE-588)4168452-7 (DE-588)4170810-6 (DE-588)4173750-7 (DE-588)4190578-7 (DE-588)4194747-2 (DE-588)4234451-7 (DE-588)4268614-3 (DE-588)4284512-9 (DE-588)4402219-0 (DE-588)4416923-1 (DE-588)4430771-8 (DE-588)4474644-1 (DE-588)4493304-6 (DE-588)4572889-6 (DE-588)7503845-6 (DE-588)7540312-2 (DE-601)104376317 (DE-601)105611859 (DNLM)D003405 (DNLM)D009147 (DNLM)D012961 (DNLM)D013995 (FrPBN)11932562 (FrPBN)11933916 (FrPBN)11935310 (FrPBN)11936006 (FrPBN)11938730 (FrPBN)11945386 (FrPBN)11949597 (FrPBN)11953379 (FrPBN)11955125 (FrPBN)11965597 (FrPBN)11979470 (FrPBN)12141134 (FrPBN)12350700 (FrPBN)12478242 (FrPBN)12519252 (FrPBN)13162912 (FrPBN)13568108 (FrPBN)16580339 (FrPBN)16647041 (JTNDL)001312938 (KR-SlNLK)KSH1998002357 (KR-SlNLK)KSH1998002721 (KR-SlNLK)KSH1998011567 (KR-SlNLK)KSH1998014248 (KR-SlNLK)KSH1998023547 (KR-SlNLK)KSH1998039925 (KR-SlNLK)KSH1998040434 (KR-SlNLK)KSH2000016889 (KR-SlNLK)KSH2001018388 (local)tlcaut2130744396598900 (local)tlcaut8174309141121700 (local)tlcaut8174309288046600 (NL-LeOCL)075616017 (NL-LeOCL)075630001 (NL-LeOCL)294896791 (NL-LeOCL)294908617 (NL-LeOCL)294909591 (NL-LeOCL)294926844 (NL-LeOCL)294926887 (NL-LeOCL)29493233X (NL-LeOCL)294933638 (OCoLC)fst00794496 (OCoLC)fst00794562 (OCoLC)fst00794949 (OCoLC)fst00795936 (OCoLC)fst00796146 (OCoLC)fst00796147 (OCoLC)fst00796172 (OCoLC)fst00796296 (OCoLC)fst00796328 (OCoLC)fst00796510 (OCoLC)fst00797511 (OCoLC)fst00797734 (OCoLC)fst00798734 (OCoLC)fst00798800 (OCoLC)fst00798853 (OCoLC)fst00798985 (OCoLC)fst00799012 (OCoLC)fst00799028 (OCoLC)fst00799049 (OCoLC)fst00799115 (OCoLC)fst00799123 (OCoLC)fst00799179 (OCoLC)fst00799191 (OCoLC)fst00799208 (OCoLC)fst00799210 (OCoLC)fst00799221 (OCoLC)fst00799273 (OCoLC)fst00799335 (OCoLC)fst00799340 (OCoLC)fst00799357 (OCoLC)fst00799457 (OCoLC)fst00799477 (OCoLC)fst00799509 (OCoLC)fst00799524 (OCoLC)fst00799525 (OCoLC)fst00799563 (OCoLC)fst00799648 (OCoLC)fst00799666 (OCoLC)fst00799689 (OCoLC)fst00799698 (OCoLC)fst00799703 (OCoLC)fst00799734 (OCoLC)fst00806181 (OCoLC)fst00806183 (OCoLC)fst00806688 (OCoLC)fst00807040 (OCoLC)fst00807114 (OCoLC)fst00807348 (OCoLC)fst00807417 (OCoLC)fst00808105 (OCoLC)fst00809468 (OCoLC)fst00809565 (OCoLC)fst00809593 (OCoLC)fst00809611 (OCoLC)fst00810218 (OCoLC)fst00810329 (OCoLC)fst00810660 (OCoLC)fst00810769 (OCoLC)fst00810849 (OCoLC)fst00810975 (OCoLC)fst00810978 (OCoLC)fst00813666 (OCoLC)fst00814030 (OCoLC)fst00815058 (OCoLC)fst00815314 (OCoLC)fst00815319 (OCoLC)fst00815400 (OCoLC)fst00815413 (OCoLC)fst00815447 (OCoLC)fst00815756 (OCoLC)fst00815801 (OCoLC)fst00815831 (OCoLC)fst00817247 (OCoLC)fst00817274 (OCoLC)fst00817559 (OCoLC)fst00817807 (OCoLC)fst00817986 (OCoLC)fst00818137 (OCoLC)fst00818620 (OCoLC)fst00821281 (OCoLC)fst00821634 (OCoLC)fst00821688 (OCoLC)fst00821764 (OCoLC)fst00821814 (OCoLC)fst00822040 (OCoLC)fst00822051 (OCoLC)fst00822442 (OCoLC)fst00822463 (OCoLC)fst00822522 (OCoLC)fst00822597 (OCoLC)fst00823880 (OCoLC)fst00824280 (OCoLC)fst00824287 (OCoLC)fst00825412 (OCoLC)fst00825429 (OCoLC)fst00825864 (OCoLC)fst00825896 (OCoLC)fst00825930 (OCoLC)fst00826017 (OCoLC)fst00826049 (OCoLC)fst00826066 (OCoLC)fst00826176 (OCoLC)fst00826508 (OCoLC)fst00826561 (OCoLC)fst00829987 (OCoLC)fst00830669 (OCoLC)fst00832149 (OCoLC)fst00832172 (OCoLC)fst00832504 (OCoLC)fst00832970 (OCoLC)fst00833604 (OCoLC)fst00833747 (OCoLC)fst00833880 (OCoLC)fst00833971 (OCoLC)fst00834005 (OCoLC)fst00835040 (OCoLC)fst00835045 (OCoLC)fst00835046 (OCoLC)fst00835056 (OCoLC)fst00835063 (OCoLC)fst00835072 (OCoLC)fst00835073 (OCoLC)fst00836484 (OCoLC)fst00836550 (OCoLC)fst00837202 (OCoLC)fst00837629 (OCoLC)fst00837776 (OCoLC)fst00837954 (OCoLC)fst00837964 (OCoLC)fst00837984 (OCoLC)fst00837990 (OCoLC)fst00839252 (OCoLC)fst00840083 (OCoLC)fst00840134 (OCoLC)fst00840962 (OCoLC)fst00841633 (OCoLC)fst00843939 (OCoLC)fst00846086 (OCoLC)fst00846087 (OCoLC)fst00847290 (OCoLC)fst00847613 (OCoLC)fst00847651 (OCoLC)fst00847741 (OCoLC)fst00848465 (OCoLC)fst00848959 (OCoLC)fst00849314 (OCoLC)fst00850401 (OCoLC)fst00850521 (OCoLC)fst00851938 (OCoLC)fst00851939 (OCoLC)fst00852158 (OCoLC)fst00852220 (OCoLC)fst00854393 (OCoLC)fst00854835 (OCoLC)fst00855249 (OCoLC)fst00855726 (OCoLC)fst00855745 (OCoLC)fst00856384 (OCoLC)fst00856546 (OCoLC)fst00856573 (OCoLC)fst00857249 (OCoLC)fst00858366 (OCoLC)fst00858519 (OCoLC)fst00858523 (OCoLC)fst00858524 (OCoLC)fst00858525 (OCoLC)fst00858527 (OCoLC)fst00858536 (OCoLC)fst00858541 (OCoLC)fst00858549 (OCoLC)fst00859107 (OCoLC)fst00859660 (OCoLC)fst00859831 (OCoLC)fst00860809 (OCoLC)fst00860816 (OCoLC)fst00860830 (OCoLC)fst00860841 (OCoLC)fst00862177 (OCoLC)fst00862295 (OCoLC)fst00862708 (OCoLC)fst00862898 (OCoLC)fst00862985 (OCoLC)fst00863011 (OCoLC)fst00863272 (OCoLC)fst00863280 (OCoLC)fst00863388 (OCoLC)fst00864197 (OCoLC)fst00864229 (OCoLC)fst00865723 (OCoLC)fst00866501 (OCoLC)fst00866540 (OCoLC)fst00867085 (OCoLC)fst00869279 (OCoLC)fst00870243 (OCoLC)fst00870518 (OCoLC)fst00871098 (OCoLC)fst00871101 (OCoLC)fst00871172 (OCoLC)fst00871522 (OCoLC)fst00871620 (OCoLC)fst00871628 (OCoLC)fst00871630 (OCoLC)fst00871642 (OCoLC)fst00871649 (OCoLC)fst00871761 (OCoLC)fst00871769 (OCoLC)fst00871995 (OCoLC)fst00872033 (OCoLC)fst00872055 (OCoLC)fst00872107 (OCoLC)fst00872274 (OCoLC)fst00872276 (OCoLC)fst00872297 (OCoLC)fst00872992 (OCoLC)fst00872993 (OCoLC)fst00873937 (OCoLC)fst00874069 (OCoLC)fst00874075 (OCoLC)fst00874563 (OCoLC)fst00874582 (OCoLC)fst00874600 (OCoLC)fst00874815 (OCoLC)fst00875327 (OCoLC)fst00875441 (OCoLC)fst00875626 (OCoLC)fst00876692 (OCoLC)fst00878748 (OCoLC)fst00880635 (OCoLC)fst00881405 (OCoLC)fst00881424 (OCoLC)fst00881435 (OCoLC)fst00881442 (OCoLC)fst00881829 (OCoLC)fst00881949 (OCoLC)fst00882393 (OCoLC)fst00882417 (OCoLC)fst00882438 (OCoLC)fst00882641 (OCoLC)fst00884401 (OCoLC)fst00884777 (OCoLC)fst00885007 (OCoLC)fst00885014 (OCoLC)fst00885019 (OCoLC)fst00885046 (OCoLC)fst00885059 (OCoLC)fst00885285 (OCoLC)fst00885362 (OCoLC)fst00885382 (OCoLC)fst00886455 (OCoLC)fst00887402 (OCoLC)fst00887459 (OCoLC)fst00887466 (OCoLC)fst00887472 (OCoLC)fst00887519 (OCoLC)fst00887533 (OCoLC)fst00888429 (OCoLC)fst00888559 (OCoLC)fst00888702 (OCoLC)fst00889115 (OCoLC)fst00892032 (OCoLC)fst00893717 (OCoLC)fst00893951 (OCoLC)fst00894731 (OCoLC)fst00894814 (OCoLC)fst00895158 (OCoLC)fst00895764 (OCoLC)fst00897086 (OCoLC)fst00897468 (OCoLC)fst00897546 (OCoLC)fst00899028 (OCoLC)fst00899041 (OCoLC)fst00899047 (OCoLC)fst00899048 (OCoLC)fst00899057 (OCoLC)fst00899678 (OCoLC)fst00900295 (OCoLC)fst00900579 (OCoLC)fst00900596 (OCoLC)fst00901974 (OCoLC)fst00902116 (OCoLC)fst00902579 (OCoLC)fst00902728 (OCoLC)fst00902945 (OCoLC)fst00903005 (OCoLC)fst00903134 (OCoLC)fst00903205 (OCoLC)fst00903252 (OCoLC)fst00903371 (OCoLC)fst00903596 (OCoLC)fst00903623 (OCoLC)fst00903769 (OCoLC)fst00904885 (OCoLC)fst00906927 (OCoLC)fst00907363 (OCoLC)fst00907367 (OCoLC)fst00907371 (OCoLC)fst00907372 (OCoLC)fst00907457 (OCoLC)fst00907809 (OCoLC)fst00908239 (OCoLC)fst00908309 (OCoLC)fst00908467 (OCoLC)fst00908880 (OCoLC)fst00911989 (OCoLC)fst00912517 (OCoLC)fst00912527 (OCoLC)fst00912563 (OCoLC)fst00912655 (OCoLC)fst00912787 (OCoLC)fst00915437 (OCoLC)fst00915613 (OCoLC)fst00915894 (OCoLC)fst00915906 (OCoLC)fst00916005 (OCoLC)fst00916097 (OCoLC)fst00916186 (OCoLC)fst00916874 (OCoLC)fst00917055 (OCoLC)fst00917152 (OCoLC)fst00917348 (OCoLC)fst00917959 (OCoLC)fst00918097 (OCoLC)fst00918886 (OCoLC)fst00919926 (OCoLC)fst00920130 (OCoLC)fst00920710 (OCoLC)fst00920831 (OCoLC)fst00921619 (OCoLC)fst00921890 (OCoLC)fst00922735 (OCoLC)fst00922744 (OCoLC)fst00923329 (OCoLC)fst00923345 (OCoLC)fst00923786 (OCoLC)fst00923794 (OCoLC)fst00923953 (OCoLC)fst00923955 (OCoLC)fst00928323 (OCoLC)fst00928587 (OCoLC)fst00928637 (OCoLC)fst00928643 (OCoLC)fst00928703 (OCoLC)fst00929383 (OCoLC)fst00929396 (OCoLC)fst00929402 (OCoLC)fst00929409 (OCoLC)fst00929513 (OCoLC)fst00929535 (OCoLC)fst00929707 (OCoLC)fst00929724 (OCoLC)fst00929849 (OCoLC)fst00929875 (OCoLC)fst00929959 (OCoLC)fst00929968 (OCoLC)fst00929987 (OCoLC)fst00930038 (OCoLC)fst00930184 (OCoLC)fst00930303 (OCoLC)fst00930306 (OCoLC)fst00932632 (OCoLC)fst00933892 (OCoLC)fst00934540 (OCoLC)fst00934799 (OCoLC)fst00935174 (OCoLC)fst00936137 (OCoLC)fst00936186 (OCoLC)fst00936219 (OCoLC)fst00936376 (OCoLC)fst00936407 (OCoLC)fst00937713 (OCoLC)fst00939117 (OCoLC)fst00939197 (OCoLC)fst00939496 (OCoLC)fst00939609 (OCoLC)fst00941680 (OCoLC)fst00941797 (OCoLC)fst00942860 (OCoLC)fst00945026 (OCoLC)fst00945034 (OCoLC)fst00947121 (OCoLC)fst00947450 (OCoLC)fst00947514 (OCoLC)fst00947816 (OCoLC)fst00948632 (OCoLC)fst00949142 (OCoLC)fst00949145 (OCoLC)fst00949190 (OCoLC)fst00949191 (OCoLC)fst00949233 (OCoLC)fst00950645 (OCoLC)fst00951519 (OCoLC)fst00951531 (OCoLC)fst00951547 (OCoLC)fst00951648 (OCoLC)fst00951661 (OCoLC)fst00953374 (OCoLC)fst00953395 (OCoLC)fst00953443 (OCoLC)fst00954135 (OCoLC)fst00955623 (OCoLC)fst00957084 (OCoLC)fst00957200 (OCoLC)fst00957201 (OCoLC)fst00957237 (OCoLC)fst00957600 (OCoLC)fst00958338 (OCoLC)fst00959755 (OCoLC)fst00959821 (OCoLC)fst00960242 (OCoLC)fst00960370 (OCoLC)fst00960688 (OCoLC)fst00960937 (OCoLC)fst00961031 (OCoLC)fst00961111 (OCoLC)fst00961166 (OCoLC)fst00962006 (OCoLC)fst00962620 (OCoLC)fst00963030 (OCoLC)fst00963107 (OCoLC)fst00963285 (OCoLC)fst00963353 (OCoLC)fst00963494 (OCoLC)fst00963520 (OCoLC)fst00963736 (OCoLC)fst00964385 (OCoLC)fst00966906 (OCoLC)fst00967235 (OCoLC)fst00967541 (OCoLC)fst00967690 (OCoLC)fst00968306 (OCoLC)fst00968311 (OCoLC)fst00968458 (OCoLC)fst00970228 (OCoLC)fst00970257 (OCoLC)fst00971386 (OCoLC)fst00972484 (OCoLC)fst00974414 (OCoLC)fst00974430 (OCoLC)fst00975769 (OCoLC)fst00976084 (OCoLC)fst00976327 (OCoLC)fst00977053 (OCoLC)fst00977128 (OCoLC)fst00977173 (OCoLC)fst00977374 (OCoLC)fst00977562 (OCoLC)fst00978912 (OCoLC)fst00978919 (OCoLC)fst00978920 (OCoLC)fst00978930 (OCoLC)fst00979776 (OCoLC)fst00979993 (OCoLC)fst00980593 (OCoLC)fst00980715 (OCoLC)fst00981283 (OCoLC)fst00981509 (OCoLC)fst00982165 (OCoLC)fst00982175 (OCoLC)fst00982179 (OCoLC)fst00982185 (OCoLC)fst00982191 (OCoLC)fst00982203 (OCoLC)fst00982204 (OCoLC)fst00982205 (OCoLC)fst00982208 (OCoLC)fst00982214 (OCoLC)fst00982535 (OCoLC)fst00982591 (OCoLC)fst00982861 (OCoLC)fst00983135 (OCoLC)fst00983314 (OCoLC)fst00983458 (OCoLC)fst00984188 (OCoLC)fst00985527 (OCoLC)fst00985596 (OCoLC)fst00985605 (OCoLC)fst00985607 (OCoLC)fst00985692 (OCoLC)fst00986987 (OCoLC)fst00986996 (OCoLC)fst00988020 (OCoLC)fst00988587 (OCoLC)fst00989615 (OCoLC)fst00989621 (OCoLC)fst00989674 (OCoLC)fst00992183 (OCoLC)fst00992214 (OCoLC)fst00994701 (OCoLC)fst00996032 (OCoLC)fst00996497 (OCoLC)fst00997341 (OCoLC)fst00997539 (OCoLC)fst00998024 (OCoLC)fst00998254 (OCoLC)fst00998260 (OCoLC)fst00999799 (OCoLC)fst00999824 (OCoLC)fst00999955 (OCoLC)fst01000005 (OCoLC)fst01000172 (OCoLC)fst01000579 (OCoLC)fst01001952 (OCoLC)fst01003543 (OCoLC)fst01003996 (OCoLC)fst01004033 (OCoLC)fst01004036 (OCoLC)fst01004379 (OCoLC)fst01004540 (OCoLC)fst01004795 (OCoLC)fst01005355 (OCoLC)fst01007080 (OCoLC)fst01007547 (OCoLC)fst01007815 (OCoLC)fst01008230 (OCoLC)fst01008346 (OCoLC)fst01008399 (OCoLC)fst01008566 (OCoLC)fst01010136 (OCoLC)fst01010443 (OCoLC)fst01011204 (OCoLC)fst01011269 (OCoLC)fst01011357 (OCoLC)fst01012163 (OCoLC)fst01012221 (OCoLC)fst01013149 (OCoLC)fst01014893 (OCoLC)fst01015389 (OCoLC)fst01015767 (OCoLC)fst01015903 (OCoLC)fst01015915 (OCoLC)fst01016298 (OCoLC)fst01018304 (OCoLC)fst01018843 (OCoLC)fst01019089 (OCoLC)fst01019132 (OCoLC)fst01019150 (OCoLC)fst01019249 (OCoLC)fst01019979 (OCoLC)fst01021341 (OCoLC)fst01022845 (OCoLC)fst01023299 (OCoLC)fst01024421 (OCoLC)fst01024455 (OCoLC)fst01024512 (OCoLC)fst01025462 (OCoLC)fst01025752 (OCoLC)fst01026871 (OCoLC)fst01026940 (OCoLC)fst01026948 (OCoLC)fst01027201 (OCoLC)fst01027209 (OCoLC)fst01027218 (OCoLC)fst01027285 (OCoLC)fst01027353 (OCoLC)fst01027357 (OCoLC)fst01027416 (OCoLC)fst01028521 (OCoLC)fst01028816 (OCoLC)fst01028836 (OCoLC)fst01030269 (OCoLC)fst01030272 (OCoLC)fst01030277 (OCoLC)fst01030279 (OCoLC)fst01030303 (OCoLC)fst01030309 (OCoLC)fst01030314 (OCoLC)fst01030319 (OCoLC)fst01030321 (OCoLC)fst01030327 (OCoLC)fst01030328 (OCoLC)fst01030329 (OCoLC)fst01030347 (OCoLC)fst01030350 (OCoLC)fst01030365 (OCoLC)fst01030366 (OCoLC)fst01030367 (OCoLC)fst01030370 (OCoLC)fst01030372 (OCoLC)fst01030374 (OCoLC)fst01030382 (OCoLC)fst01030385 (OCoLC)fst01030391 (OCoLC)fst01030393 (OCoLC)fst01030394 (OCoLC)fst01030395 (OCoLC)fst01030397 (OCoLC)fst01030398 (OCoLC)fst01030403 (OCoLC)fst01030408 (OCoLC)fst01030411 (OCoLC)fst01030414 (OCoLC)fst01030415 (OCoLC)fst01030417 (OCoLC)fst01030418 (OCoLC)fst01030421 (OCoLC)fst01030425 (OCoLC)fst01030426 (OCoLC)fst01030442 (OCoLC)fst01030444 (OCoLC)fst01030445 (OCoLC)fst01030453 (OCoLC)fst01030456 (OCoLC)fst01030464 (OCoLC)fst01030465 (OCoLC)fst01030470 (OCoLC)fst01030471 (OCoLC)fst01030473 (OCoLC)fst01030476 (OCoLC)fst01030477 (OCoLC)fst01030478 (OCoLC)fst01030479 (OCoLC)fst01030482 (OCoLC)fst01030485 (OCoLC)fst01030486 (OCoLC)fst01030488 (OCoLC)fst01030489 (OCoLC)fst01030490 (OCoLC)fst01030492 (OCoLC)fst01030493 (OCoLC)fst01030494 (OCoLC)fst01030504 (OCoLC)fst01030505 (OCoLC)fst01030506 (OCoLC)fst01030515 (OCoLC)fst01030520 (OCoLC)fst01030524 (OCoLC)fst01030527 (OCoLC)fst01030529 (OCoLC)fst01030538 (OCoLC)fst01030542 (OCoLC)fst01030543 (OCoLC)fst01030546 (OCoLC)fst01030549 (OCoLC)fst01030552 (OCoLC)fst01030555 (OCoLC)fst01030565 (OCoLC)fst01030567 (OCoLC)fst01030568 (OCoLC)fst01030569 (OCoLC)fst01030572 (OCoLC)fst01030576 (OCoLC)fst01030580 (OCoLC)fst01030583 (OCoLC)fst01030586 (OCoLC)fst01030592 (OCoLC)fst01030593 (OCoLC)fst01030595 (OCoLC)fst01030603 (OCoLC)fst01030614 (OCoLC)fst01030615 (OCoLC)fst01030617 (OCoLC)fst01030620 (OCoLC)fst01030624 (OCoLC)fst01030626 (OCoLC)fst01030628 (OCoLC)fst01030633 (OCoLC)fst01030634 (OCoLC)fst01030635 (OCoLC)fst01030641 (OCoLC)fst01030649 (OCoLC)fst01030650 (OCoLC)fst01030653 (OCoLC)fst01030654 (OCoLC)fst01030666 (OCoLC)fst01030670 (OCoLC)fst01030671 (OCoLC)fst01030677 (OCoLC)fst01030687 (OCoLC)fst01030688 (OCoLC)fst01030695 (OCoLC)fst01030696 (OCoLC)fst01030698 (OCoLC)fst01030701 (OCoLC)fst01030702 (OCoLC)fst01030706 (OCoLC)fst01030715 (OCoLC)fst01030722 (OCoLC)fst01030728 (OCoLC)fst01030735 (OCoLC)fst01030763 (OCoLC)fst01030772 (OCoLC)fst01030773 (OCoLC)fst01030774 (OCoLC)fst01030779 (OCoLC)fst01030788 (OCoLC)fst01030806 (OCoLC)fst01030807 (OCoLC)fst01030811 (OCoLC)fst01030814 (OCoLC)fst01030816 (OCoLC)fst01030822 (OCoLC)fst01030830 (OCoLC)fst01030837 (OCoLC)fst01030844 (OCoLC)fst01030850 (OCoLC)fst01030853 (OCoLC)fst01030856 (OCoLC)fst01030859 (OCoLC)fst01030862 (OCoLC)fst01030863 (OCoLC)fst01030867 (OCoLC)fst01030874 (OCoLC)fst01030876 (OCoLC)fst01030877 (OCoLC)fst01030878 (OCoLC)fst01030879 (OCoLC)fst01030882 (OCoLC)fst01030891 (OCoLC)fst01030893 (OCoLC)fst01030904 (OCoLC)fst01031229 (OCoLC)fst01032927 (OCoLC)fst01033342 (OCoLC)fst01033379 (OCoLC)fst01033413 (OCoLC)fst01033433 (OCoLC)fst01033448 (OCoLC)fst01033761 (OCoLC)fst01033799 (OCoLC)fst01033902 (OCoLC)fst01036315 (OCoLC)fst01036946 (OCoLC)fst01037081 (OCoLC)fst01037817 (OCoLC)fst01037820 (OCoLC)fst01038354 (OCoLC)fst01038370 (OCoLC)fst01038373 (OCoLC)fst01038410 (OCoLC)fst01041006 (OCoLC)fst01041386 (OCoLC)fst01042524 (OCoLC)fst01042535 (OCoLC)fst01042537 (OCoLC)fst01042847 (OCoLC)fst01042909 (OCoLC)fst01043442 (OCoLC)fst01045395 (OCoLC)fst01046145 (OCoLC)fst01046150 (OCoLC)fst01046151 (OCoLC)fst01046163 (OCoLC)fst01046164 (OCoLC)fst01046168 (OCoLC)fst01046170 (OCoLC)fst01046174 (OCoLC)fst01046184 (OCoLC)fst01046191 (OCoLC)fst01046197 (OCoLC)fst01046213 (OCoLC)fst01046219 (OCoLC)fst01046423 (OCoLC)fst01046426 (OCoLC)fst01046675 (OCoLC)fst01046981 (OCoLC)fst01047284 (OCoLC)fst01047286 (OCoLC)fst01047287 (OCoLC)fst01047289 (OCoLC)fst01047290 (OCoLC)fst01047574 (OCoLC)fst01047576 (OCoLC)fst01047586 (OCoLC)fst01047598 (OCoLC)fst01047613 (OCoLC)fst01047772 (OCoLC)fst01047884 (OCoLC)fst01048193 (OCoLC)fst01049454 (OCoLC)fst01050151 (OCoLC)fst01051471 (OCoLC)fst01051719 (OCoLC)fst01051907 (OCoLC)fst01052183 (OCoLC)fst01053079 (OCoLC)fst01053407 (OCoLC)fst01054170 (OCoLC)fst01055120 (OCoLC)fst01055975 (OCoLC)fst01057468 (OCoLC)fst01057640 (OCoLC)fst01057725 (OCoLC)fst01057731 (OCoLC)fst01057758 (OCoLC)fst01057852 (OCoLC)fst01057874 (OCoLC)fst01057887 (OCoLC)fst01058562 (OCoLC)fst01058899 (OCoLC)fst01060522 (OCoLC)fst01060777 (OCoLC)fst01060969 (OCoLC)fst01061283 (OCoLC)fst01061600 (OCoLC)fst01061605 (OCoLC)fst01061714 (OCoLC)fst01063351 (OCoLC)fst01063355 (OCoLC)fst01063360 (OCoLC)fst01063363 (OCoLC)fst01063366 (OCoLC)fst01063372 (OCoLC)fst01063376 (OCoLC)fst01063400 (OCoLC)fst01063403 (OCoLC)fst01063404 (OCoLC)fst01063409 (OCoLC)fst01063416 (OCoLC)fst01063496 (OCoLC)fst01064458 (OCoLC)fst01064977 (OCoLC)fst01066938 (OCoLC)fst01066990 (OCoLC)fst01066993 (OCoLC)fst01067691 (OCoLC)fst01067778 (OCoLC)fst01067940 (OCoLC)fst01068574 (OCoLC)fst01071344 (OCoLC)fst01071422 (OCoLC)fst01071423 (OCoLC)fst01071424 (OCoLC)fst01071436 (OCoLC)fst01071443 (OCoLC)fst01071448 (OCoLC)fst01071451 (OCoLC)fst01071452 (OCoLC)fst01071454 (OCoLC)fst01071457 (OCoLC)fst01071460 (OCoLC)fst01071467 (OCoLC)fst01071469 (OCoLC)fst01071470 (OCoLC)fst01071471 (OCoLC)fst01074219 (OCoLC)fst01074564 (OCoLC)fst01076585 (OCoLC)fst01077865 (OCoLC)fst01078060 (OCoLC)fst01078065 (OCoLC)fst01078957 (OCoLC)fst01079397 (OCoLC)fst01079826 (OCoLC)fst01079869 (OCoLC)fst01080772 (OCoLC)fst01080980 (OCoLC)fst01081220 (OCoLC)fst01081222 (OCoLC)fst01081224 (OCoLC)fst01081228 (OCoLC)fst01081233 (OCoLC)fst01081276 (OCoLC)fst01083707 (OCoLC)fst01084152 (OCoLC)fst01084153 (OCoLC)fst01084156 (OCoLC)fst01084233 (OCoLC)fst01084834 (OCoLC)fst01084845 (OCoLC)fst01086507 (OCoLC)fst01086508 (OCoLC)fst01086509 (OCoLC)fst01086654 (OCoLC)fst01086854 (OCoLC)fst01087186 (OCoLC)fst01087222 (OCoLC)fst01087224 (OCoLC)fst01087233 (OCoLC)fst01087378 (OCoLC)fst01087567 (OCoLC)fst01088504 (OCoLC)fst01089951 (OCoLC)fst01089955 (OCoLC)fst01089957 (OCoLC)fst01089960 (OCoLC)fst01090391 (OCoLC)fst01091314 (OCoLC)fst01091560 (OCoLC)fst01091586 (OCoLC)fst01092797 (OCoLC)fst01093058 (OCoLC)fst01093204 (OCoLC)fst01093233 (OCoLC)fst01093763 (OCoLC)fst01094443 (OCoLC)fst01094518 (OCoLC)fst01094813 (OCoLC)fst01095573 (OCoLC)fst01096567 (OCoLC)fst01097281 (OCoLC)fst01097285 (OCoLC)fst01097489 (OCoLC)fst01099153 (OCoLC)fst01099155 (OCoLC)fst01099179 (OCoLC)fst01099204 (OCoLC)fst01099205 (OCoLC)fst01099221 (OCoLC)fst01099223 (OCoLC)fst01099230 (OCoLC)fst01099238 (OCoLC)fst01099252 (OCoLC)fst01100080 (OCoLC)fst01100109 (OCoLC)fst01100133 (OCoLC)fst01100137 (OCoLC)fst01100148 (OCoLC)fst01101147 (OCoLC)fst01103131 (OCoLC)fst01103140 (OCoLC)fst01103212 (OCoLC)fst01103213 (OCoLC)fst01103229 (OCoLC)fst01103600 (OCoLC)fst01104198 (OCoLC)fst01104208 (OCoLC)fst01104210 (OCoLC)fst01104663 (OCoLC)fst01104716 (OCoLC)fst01106255 (OCoLC)fst01107642 (OCoLC)fst01108566 (OCoLC)fst01111361 (OCoLC)fst01111441 (OCoLC)fst01111468 (OCoLC)fst01111876 (OCoLC)fst01112351 (OCoLC)fst01112580 (OCoLC)fst01112665 (OCoLC)fst01113135 (OCoLC)fst01113403 (OCoLC)fst01114481 (OCoLC)fst01114483 (OCoLC)fst01114588 (OCoLC)fst01114725 (OCoLC)fst01115198 (OCoLC)fst01116068 (OCoLC)fst01116126 (OCoLC)fst01117972 (OCoLC)fst01119301 (OCoLC)fst01119311 (OCoLC)fst01119315 (OCoLC)fst01119319 (OCoLC)fst01119327 (OCoLC)fst01119337 (OCoLC)fst01119498 (OCoLC)fst01119873 (OCoLC)fst01120577 (OCoLC)fst01120581 (OCoLC)fst01120582 (OCoLC)fst01122251 (OCoLC)fst01122310 (OCoLC)fst01122346 (OCoLC)fst01122603 (OCoLC)fst01122616 (OCoLC)fst01122877 (OCoLC)fst01123753 (OCoLC)fst01123875 (OCoLC)fst01123961 (OCoLC)fst01124185 (OCoLC)fst01125233 (OCoLC)fst01125798 (OCoLC)fst01125800 (OCoLC)fst01126004 (OCoLC)fst01126056 (OCoLC)fst01126057 (OCoLC)fst01126120 (OCoLC)fst01126122 (OCoLC)fst01126319 (OCoLC)fst01126336 (OCoLC)fst01126343 (OCoLC)fst01126347 (OCoLC)fst01126381 (OCoLC)fst01126468 (OCoLC)fst01126469 (OCoLC)fst01126497 (OCoLC)fst01126730 (OCoLC)fst01126930 (OCoLC)fst01126935 (OCoLC)fst01126939 (OCoLC)fst01126957 (OCoLC)fst01126961 (OCoLC)fst01126988 (OCoLC)fst01127002 (OCoLC)fst01127003 (OCoLC)fst01127006 (OCoLC)fst01127018 (OCoLC)fst01127019 (OCoLC)fst01127029 (OCoLC)fst01127031 (OCoLC)fst01127034 (OCoLC)fst01127043 (OCoLC)fst01127057 (OCoLC)fst01127060 (OCoLC)fst01128842 (OCoLC)fst01130204 (OCoLC)fst01131341 (OCoLC)fst01131556 (OCoLC)fst01131562 (OCoLC)fst01132076 (OCoLC)fst01134967 (OCoLC)fst01135307 (OCoLC)fst01135316 (OCoLC)fst01135426 (OCoLC)fst01136037 (OCoLC)fst01136581 (OCoLC)fst01136594 (OCoLC)fst01136597 (OCoLC)fst01137217 (OCoLC)fst01137268 (OCoLC)fst01140547 (OCoLC)fst01140874 (OCoLC)fst01140894 (OCoLC)fst01140966 (OCoLC)fst01140968 (OCoLC)fst01141189 (OCoLC)fst01141766 (OCoLC)fst01141908 (OCoLC)fst01141911 (OCoLC)fst01142255 (OCoLC)fst01142948 (OCoLC)fst01144236 (OCoLC)fst01144616 (OCoLC)fst01145806 (OCoLC)fst01145808 (OCoLC)fst01146957 (OCoLC)fst01147461 (OCoLC)fst01149217 (OCoLC)fst01149230 (OCoLC)fst01149273 (OCoLC)fst01149315 (OCoLC)fst01149318 (OCoLC)fst01149370 (OCoLC)fst01149379 (OCoLC)fst01149404 (OCoLC)fst01149559 (OCoLC)fst01151043 (OCoLC)fst01151053 (OCoLC)fst01151056 (OCoLC)fst01151110 (OCoLC)fst01152480 (OCoLC)fst01152492 (OCoLC)fst01152534 (OCoLC)fst01153053 (OCoLC)fst01153125 (OCoLC)fst01153142 (OCoLC)fst01153202 (OCoLC)fst01153237 (OCoLC)fst01154833 (OCoLC)fst01155558 (OCoLC)fst01156795 (OCoLC)fst01157384 (OCoLC)fst01158060 (OCoLC)fst01158447 (OCoLC)fst01158942 (OCoLC)fst01159607 (OCoLC)fst01159656 (OCoLC)fst01159657 (OCoLC)fst01159810 (OCoLC)fst01160932 (OCoLC)fst01163191 (OCoLC)fst01165132 (OCoLC)fst01166160 (OCoLC)fst01166186 (OCoLC)fst01167140 (OCoLC)fst01167193 (OCoLC)fst01167350 (OCoLC)fst01167358 (OCoLC)fst01167443 (OCoLC)fst01167457 (OCoLC)fst01167477 (OCoLC)fst01167688 (OCoLC)fst01168378 (OCoLC)fst01168379 (OCoLC)fst01168739 (OCoLC)fst01168754 (OCoLC)fst01168778 (OCoLC)fst01168779 (OCoLC)fst01170066 (OCoLC)fst01170245 (OCoLC)fst01173272 (OCoLC)fst01174006 (OCoLC)fst01174825 (OCoLC)fst01175513 (OCoLC)fst01176568 (OCoLC)fst01176947 (OCoLC)fst01177410 (OCoLC)fst01177510 (OCoLC)fst01177524 (OCoLC)fst01177540 (OCoLC)fst01177595 (OCoLC)fst01177933 (OCoLC)fst01178069 (OCoLC)fst01178070 (OCoLC)fst01178121 (OCoLC)fst01178179 (OCoLC)fst01178180 (OCoLC)fst01178182 (OCoLC)fst01178321 (OCoLC)fst01178475 (OCoLC)fst01178528 (OCoLC)fst01178661 (OCoLC)fst01178761 (OCoLC)fst01179191 (OCoLC)fst01180422 (OCoLC)fst01180525 (OCoLC)fst01181345 (OCoLC)fst01181375 (OCoLC)fst01183539 (OCoLC)fst01184124 (OCoLC)fst01184548 (OCoLC)fst01185046 (OCoLC)fst01185275 (OCoLC)fst01198495 (OCoLC)fst01199123 (OCoLC)fst01199220 (OCoLC)fst01199252 (OCoLC)fst01199528 (OCoLC)fst01199907 (OCoLC)fst01200152 (OCoLC)fst01200344 (OCoLC)fst01200424 (OCoLC)fst01200490 (OCoLC)fst01200515 (OCoLC)fst01200642 (OCoLC)fst01200895 (OCoLC)fst01200897 (OCoLC)fst01200999 (OCoLC)fst01201219 (OCoLC)fst01201277 (OCoLC)fst01201586 (OCoLC)fst01201692 (OCoLC)fst01201927 (OCoLC)fst01201928 (OCoLC)fst01202058 (OCoLC)fst01204623 (OCoLC)fst01352350 (OCoLC)fst01352356 (OCoLC)fst01352360 (OCoLC)fst01352902 (OCoLC)fst01353096 (OCoLC)fst01353235 (OCoLC)fst01353732 (OCoLC)fst01353853 (OCoLC)fst01353854 (OCoLC)fst01353970 (OCoLC)fst01353986 (OCoLC)fst01354086 (OCoLC)fst01354281 (OCoLC)fst01354410 (OCoLC)fst01354981 (OCoLC)fst01355139 (OCoLC)fst01424542 (OCoLC)fst01425676 (OCoLC)fst01426007 (OCoLC)fst01426631 (OCoLC)fst01427033 (OCoLC)fst01430242 (OCoLC)fst01695168 (OCoLC)fst01696781 (OCoLC)fst01711075 (OCoLC)fst01721067 (OCoLC)fst01721329 (OCoLC)fst01728849 (OCoLC)fst01728966 (OCoLC)fst01729905 (OCoLC)fst01730057 (OCoLC)fst01730059 (OCoLC)fst01730794 (OCoLC)fst01736271 (OCoLC)fst01736351 (OCoLC)fst01736353 (OCoLC)fst01736393 (OCoLC)fst01736402 (OCoLC)fst01736409 (OCoLC)fst01736447 (OCoLC)fst01736512 (OCoLC)fst01737000 (OCoLC)fst01737344 (OCoLC)fst01737434 (OCoLC)fst01737863 (OCoLC)fst01738271 (OCoLC)fst01738318 (OCoLC)fst01738370 (OCoLC)fst01738522 (OCoLC)fst01738575 (OCoLC)fst01738576 (OCoLC)fst01738664 (OCoLC)fst01739544 (OCoLC)fst01739814 (OCoLC)fst01740018 (OCoLC)fst01740103 (OCoLC)fst01740186 (OCoLC)fst01741098 (OCoLC)fst01741116 (OCoLC)fst01741439 (OCoLC)fst01742793 (OCoLC)fst01742988 (OCoLC)fst01742997 (OCoLC)fst01743287 (OCoLC)fst01743755 (OCoLC)fst01744486 (OCoLC)fst01745036 (OCoLC)fst01745096 (OCoLC)fst01745151 (OCoLC)fst01745661 (OCoLC)fst01745773 (OCoLC)fst01745778 (OCoLC)fst01745833 (OCoLC)fst01745937 (OCoLC)fst01746685 (OCoLC)fst01746828 (OCoLC)fst01746866 (OCoLC)fst01747045 (OCoLC)fst01748108 (OCoLC)fst01748148 (OCoLC)fst01748265 (OCoLC)fst01748296 (OCoLC)fst01748732 (OCoLC)fst01748748 (OCoLC)fst01748915 (OCoLC)fst01749295 (OCoLC)fst01749492 (OCoLC)fst01749649 (OCoLC)fst01749743 (OCoLC)fst01750095 (OCoLC)fst01750279 (OCoLC)fst01751455 (OCoLC)fst01751716 (OCoLC)fst01752057 (OCoLC)fst01754136 (OCoLC)fst01758756 (OCoLC)fst01761748 (OCoLC)fst01761933 (OCoLC)fst01761957 (OCoLC)fst01762200 (OCoLC)fst01763777 (OCoLC)fst01763878 (OCoLC)fst01763941 (OCoLC)fst01763975 (OCoLC)fst01765240 (OCoLC)fst01765256 (OCoLC)fst01765315 (OCoLC)fst01765319 (OCoLC)fst01765569 (OCoLC)fst01765741 (OCoLC)fst01766047 (OCoLC)fst01766776 (OCoLC)fst01767755 (OCoLC)fst01767934 (OCoLC)fst01799660 (OCoLC)fst01860265 (OCoLC)fst01892738 (OCoLC)fst01893386 (OCoLC)fst01893393 (OCoLC)fst01893419 (OCoLC)fst01893503 (OCoLC)fst01894521 (OCoLC)fst01894787 (OCoLC)fst01895615 (OCoLC)fst01895683 (OCoLC)fst01895802 (OCoLC)fst01896303 (OCoLC)fst01896406 (OCoLC)fst01896475 (OCoLC)fst01896513 (OCoLC)fst01902315 (OCoLC)fst01902870 (OCoLC)fst01903473 (OCoLC)fst01904822 (OCoLC)fst01905136 (OCoLC)fst01906993 (OCoLC)fst01907091 (OCoLC)fst01907412 (OCoLC)fst01909911 (OCoLC)fst01909930 (OCoLC)fst01909979 (OCoLC)fst01910288 (OCoLC)fst01911104 (OCoLC)fst01919741 (OCoLC)fst01919811 (OCoLC)fst01919896 (OCoLC)fst01920644 (OCoLC)fst01920673 (OCoLC)fst01920679 (OCoLC)fst01921257 (OCoLC)fst01922143 (OCoLC)fst01922164 (OCoLC)fst01923039 (OCoLC)fst01923073 (OCoLC)fst01931149 (OCoLC)fst01938475 (OCoLC)fst01938521 (OCoLC)fst01941157 (OCoLC)fst01941368 (OCoLC)fst01941371 (OCoLC)fst01941560 (OCoLC)fst01941579 (OCoLC)fst01941594 (OCoLC)fst01981815 (OCoLC)fst01982664 (OCoLC)fst01982867 (OCoLC)fst01982968 (OCoLC)fst01983556 (OCoLC)fst01984643 (OCoLC)fst01985211 (OCoLC)fst01985212 (OCoLC)fst01985432 (OCoLC)fst02002164 (OCoLC)fst02002373 (OCoLC)fst02002466 (OCoLC)fst02002519 (OCoLC)fst02002793 (OCoLC)fst02003022 (OCoLC)fst02003446 (OCoLC)fst02003652 (OCoLC)fst02007100 (OCoLC)fst02008407 (OCoLC)fst02010845 (OCoLC)fst02015230 (OCoLC)fst02018884 (OCoLC)fst02020202 (OCoLC)fst02020403 (OCoLC)fst02020404 (OCoLC)fst02021107 (OCoLC)fst02021978 (OCoLC)fst02022009 (OCoLC)fst02023092 (OCoLC)fst02023366 (OCoLC)fst02024003 (OCoLC)fst02027038 (OCoLC)fst02029199 (OCoLC)fst02031393 (OCoLC)fst02032989 (OCoLC)fst02033725 (OCoLC)fst02033891 (OCoLC)fst02033893 (OCoLC)fst02033910 (OCoLC)fst02040679 (RERO)A021003248 (RERO)A021096923 (RERO)A022509224 (RERO)A024797456 (uri) http://id.loc.gov/authorities/subjects/sh2008108258 (uri) http://id.loc.gov/authorities/subjects/sh85088762 (uri) http://id.worldcat.org/fast/fst01033799 13th century 15e siècle 15e siècle. 15th century 15th century. 16. century 16e siècle 16e siècle. 16th century 16th century. 17e siècle 17e siècle-18e siècle 17e siècle. 17th century 17th century. 17the century 18. století. 18.-20. století. 18.century 1814-1918 18e siècle 18e siècle. 18th century 18th century. 18th-20th centuries. 19. century 19.-20. století. 1900-1945. 1901-1910 1911-1920 1914 May 16- Auckland Boys' Choir -- History. Organists -- New Zealand -- Auckland -- Biography. Organists -- New Zealand -- Wellington -- Biography. 1914-1918 New Zealand music and the war; Patriotic music New Zealand History 20th century; World War 1914-1918 New Zealand Songs and music 1915 -2001 Ciricism and interpretation; Maori (New Zealand people) Music; Music New Zealand history and criticism; Puoro. reo 1918-2013 1919 -; Sound recording executives and producers New Zealand Biography; Sound recording industry New Zealand History; 1920-30's 1921-1930 1931-1940 x History and criticism. 1941-1950 1941-1950. 1943- Jackson 1944-2015. Composers -- New Zealand -- Biography. 1951-1960 1951-1960. 1952- anecdotes; Setchell 1955-2011; Popular music New Zealand History 1960-1969. 1961-1969. 1961-1970 1961-1970. 1970-1979. 1971-1980 1971-1980. 1978-1985 1980s 1981-1990 1981-1990. 1983- 1990-.... 1991-2000 1991-2000. 1993- 1996- career in popular music; Popular; music New Zealand 2011 - 2020; Rock musicians New Zealand biography; Singers New Zealand biography 19e siècle 19e siècle. 19th century 19th century. 19th-20th centuries. 20 century Croatia 20. století. 2001-2010 2001-2010. 2011-2020 2011-2020. 20e siecle. 20e siècle 20e siècle. 20th century 20th century & contemporary classical music. 20th century. 21e siècle 21e siècle. 21st century 21st century. 500-1400 500-1400. 600-1500 (Moyen Âge) 880-02 880-03 880-04 880-05 880-06 880-07 880-08 880-09 aat Aboriginal Australians Aboriginal Australians. Academic achievement Academic achievement. Accompaniments. Accordage. Accordion Accordion music Achille Lauro Hijacking Incident, 1985 Acoustical engineering. Acoustics Acoustics & Sound. Acoustics and physics Acoustics and physics. Acoustics. Acoustique et physique Acteurs Acting Acting in musical theater. Acting in opera. Acting. Action and adventure films Activité politique. Activity programs Activity programs. Actors Actors. Actresses Actresses. Actrices Actrices de cinéma Adaptations Adaptations cinématographiques. Adaptations. Addicts Addicts. Adolescents Adolf, Paul, 1863-1943 Adopted children Adoptees Adult child sexual abuse victims Advanced supplementary examinations Advertising Advocating Aesthetics Aesthetics in literature. Aesthetics, Modern. Aesthetics. Aesthetics; Music Theory Affect (Psychology) Afghan War, 2001- Afghanistan Africa Africa, Eastern Africa, North Africa, North. Africa, Southern. Africa, Sub-Saharan Africa, Sub-Saharan. Africa, West Africa. African American art. African American authors African American authors. African American bisexuals. African American celebrities African American celebrities. African American comedians. African American country musicians. African American feminists African American feminists. African American gays African American gays. African American gospel singers African American guitarists African American guitarists. African American jazz musicians African American jazz musicians. African American journalists African American journalists. African American lesbians. African American musicians African American musicians. African American Muslims. African American opera company executives African American punk rock musicians. African American radio stations African American radio stations. African American rock musicians African American rock musicians. African American singers African American singers. African American sound recording executives and producers African American transgender people. African American women African American women authors. African American women entertainers African American women in popular culture. African American women jazz singers African American women musicians African American women musicians. African American women political activists African American women singers African American women singers. African American women social reformers African American women social reformers. African Americans African Americans in musical theater. African Americans in popular culture. African dance music African history. African influences. African music African popular music African. Africans Afrique du Nord Afrique du Sud Afrique du Sud. Afroamerican music Afrobeat Afrofuturism. Age factors. Aging Agoraphobia aiatsisl aiatsiss Akustik. al-Andalus Alabama Albania Albert de Vleeshouwer Alberta Album covers Album covers. Aleatory music Alejo Carpentier Alernative rock musicians New Zealand Dunedin biography Alexander technique. Alfonso X Allemagne Allemagne (Est) Allemagne (Ouest) Alternative country music. Alternative country musicians Alternative country musicians. Alternative education. Alternative Medicine. Alternative rock music Alternative rock music - New Zealand - History and criticism Alternative rock music New Zealand Dunedin alternative rock music New Zealand Dunedin Exhibitions Alternative rock music. Alternative rock musicians Alternative rock musicians New Zealand Christchurch; Artists New Zealand Christchurch history and criticism; Music New Zealand Christchurch history and criticism Alternative rock musicians. Alternative treatment. Alzheimer disease Amateur theater Amateur theater. Amateurs' manuals. Ambient music. America America. American essays American essays. American influences. American literature American poetry American poetry. Americana Americana (Music) Americans in opera. Amerikansk poesi-- historia Américains d'origine éthiopienne Américains d'origine mexicaine Amérique Amérique du Nord. Amérique latine. Amérique. Amis (Taiwan people) Amitié Amours Amusements Analyse et appréciation. Analyse musicale Analyse musicale. Analysis, apperciation. Analysis, appreciation Analysis, appreciation. Ancient Ancient Greece ancient music Andalusia Andalusian influences. Anderson, Stig, 1931-1997 Andes Andes Region Anecdotes. Angel Barrios Angels Angleterre Anglican Communion Anglikanische Kirche Animal sounds. Animals Animals and civilization. Animals in the performing arts. Animals. Animated films Animated films. Animēshon. Anka Horvat Années soixante (Vingtième siècle) Anniversaries Anthem Anthropology Anti-fascist movements Anti-fascist movements. Anti-racism Antifascisme Antigua and Barbuda Antiphon Antiphonar Antiphons (Music) Antisemitism Antisemitism. Antitrust law. Anxiety Anxiety in music. Apple computer. Applied ethnomusicology. appreciation Appreciation. Appréciation. Arab countries Arab-Israeli conflict Arabian Peninsula Arabs Architects Architecture Architecture, Domestic Architecture, Domestic. Archival materials. Archival resources. Archival sources Archives Archives. Argentina Argentina. Aristocrazy Arkadien Armenia (Republic) Army Arrangement (Music) Art ART / American / African American. ART / General ART / History / Contemporary (1945-) art and education Art and literature Art and literature. Art and music Art and music. Art and religion. Art and the war. Art appreciation Art appreciation. Art dramatique. Art et musique Art et musique. Art festivals art group history Art in music. Art museums. Art noir américain. Art patronage. Art pedagogy Art schools Art schools. Art sonore Art therapy Art therapy. Art, Chinese Art, Modern Art-thérapie Art-thérapie. Art. Artificial intelligence Artificial intelligence. Artificial life Artistes Artistes transgenres Artistic education Artistic relationships Artistic Research Artists Artists as teachers. Arts Arts and society Arts and society. Arts du spectacle Arts, American Arts, Black. Arts, Czech Arts, Czech. Arts, Indic Arts, Modern Arts, Modern. Arts, Renaissance. Arts, Spanish Arts. ascl Ashanti (African people) Asia Asia. Asian Americans Asian Americans. Asian influences. Aspect de l'environnement. Aspect économique Aspect moral. Aspect physiologique. Aspect politique Aspect politique. Aspect psychologique Aspect psychologique. Aspect religieux. Aspect social Aspect social. Aspectos psicológicos Associations Atonality. Attachment behavior in children. Attention-deficit hyperactivity disorder. Attitudes Attitudes. Atua Reo; Kaitito waiata reo; Mahi a Rehia reo; Maori (New Zealand people) Music history and criticism; Musical instruments New Zealand; Puoro reo reo; Purakau reo; Taonga puoro reo Auckland Amateur Operatic Society history Auckland Boys Choir history Auckland Music Theatre history Auckland Operatic Society history Auckland; Organists New Zealand Auckland; Saint Marks Choir (Auckland Audio en continu Audio-visual materials Audiovisual Media Auditions. Auditory hallucinations. Auditory perception Auditory perception. Aufführung Auftritt August Abramović Adelburg August Adelburg Abramović Australia Australia |x History Australia. Australian Capital Territory Australie Austria Austria. Authenticité (Philosophie) Authenticity (Philosophy) Authors Authors and music. Authors, American Authors, American. Authors, Austrian Authors, Austrian. Authors, Canadian Authors, English Authors, French-Canadian Authors, French-Canadian. Authors, German Authors, German. Authors. Authorship Authorship. Autism Autism in adolescence Autism in adolescence. Autism in children Autistic children Autobiographie. autobiographies Autobiographies as Topic Autobiographies','Carter, Shayne Autobiographies. autobiography (genre) Autobiography. Autobiography: arts & entertainment Automatic control Automobile racing Automobiles Autonomisation. Autorschaft Autriche Autriche. Avant-garde (Aesthetics) Avant-garde (Music) Avante-garde (Music) New Zealand Awards Ästhetik Background music; Sociology of music Badalić Bagpipe Bagpipe music Bagpipe music, Arranged. Bagpipe music. Bagpipe. Bagpipers Bagpipers. Balkan Peninsula Balkan Peninsula. Ballader Ballades Ballads Ballads, English Ballads, English. Ballads, Japanese. Ballads, Scots Ballads. Ballet Ballet dancers Ballet dancers in art Ballet dancing. Ballet. Ballets Ballets. Ballroom dancing Ballroom dancing. Ballrooms Baloković Band music Bandes dessinées. Bands (Music) Bands (Music) Ireland Banjo Banjo. Bankers Barbados Barbados. Barcelona Bards and bardism. Baritō. Barnes, Jimmy. Baroque Baroque music Baroque music (c 1600 to c 1750). Barroco Barroque Bars (Drinking establishments) Bartók Bartol Đurđević/Jurjević Bass guitar Bass guitarists Batterie (Instrument de musique) Batteurs (Instrumentistes) Battle of Szigetvár Bawdy songs beat music Beatles. Bedeutung. Beethoven, Ludwig van, 1770-1827 Behavior modification. Bel canto Bel canto. Belarus Belarus. Belfast (Northern Ireland) Belgium Bell ringers Benefit performances Benet Casablancas Benjamin Britten Benson Bereavement Berghain Berliner Festspiele. Berlioz, Hector, 1803-1869 Bernard Herrmann Bernholm, Jonas, 1946- Berwald, Franz, 1796-1868 Bestandserhaltung Bible Bible films Bible in music. Bibliographie. Bibliographies & Indexes. bibliography Bibliography of bibliographies. Bibliography. Biblioteca Musical Víctor Espinós Bibliothécaires musicaux Bibliothéconomie musicale bicssc Bif Naked Big bands Binder's volumes (Music) Bio-bibliography Bio-bibliography. Biogaphy. Biographical sources Biographie (Genre littéraire) biographies biographies (literary works) Biographies as Topic Biographies. Biography BIOGRAPHY & AUTOBIOGRAPHY BIOGRAPHY & AUTOBIOGRAPHY / Adventurers & Explorers BIOGRAPHY & AUTOBIOGRAPHY / Artists, Architects, Photographers. BIOGRAPHY & AUTOBIOGRAPHY / Composers & Musicians BIOGRAPHY & AUTOBIOGRAPHY / Composers & Musicians. BIOGRAPHY & AUTOBIOGRAPHY / Cultural, Ethnic & Regional / Hispanic & Latino. BIOGRAPHY & AUTOBIOGRAPHY / Diversity & Multicultural. BIOGRAPHY & AUTOBIOGRAPHY / Entertainment & Performing Arts. BIOGRAPHY & AUTOBIOGRAPHY / General. BIOGRAPHY & AUTOBIOGRAPHY / Historical BIOGRAPHY & AUTOBIOGRAPHY / LGBTQ+. BIOGRAPHY & AUTOBIOGRAPHY / Music BIOGRAPHY & AUTOBIOGRAPHY / Music. BIOGRAPHY & AUTOBIOGRAPHY / Personal Memoirs BIOGRAPHY & AUTOBIOGRAPHY / Personal Memoirs. BIOGRAPHY & AUTOBIOGRAPHY / Rich & Famous. BIOGRAPHY & AUTOBIOGRAPHY / Social Activists. BIOGRAPHY & AUTOBIOGRAPHY / Women. BIOGRAPHY & AUTOBIOGRAPHY BIOGRAPHY & AUTOBIOGRAPHY / Composers & Musicians BIOGRAPHY & AUTOBIOGRAPHY / Personal Memoirs biography and work Biography as a literary form. Biography Bach J.S. Biography Canada Biography. Biography: general. Biologie Biology Biology teachers Biology teachers. Birds Birds. Birdsongs Birdsongs. bisacsh bisacsh. Black & Asian studies. Black Canadian women Black English (Dialecte) Black English. Black people Black power Black power. Blackface entertainers Blacks Blacks. Bluegrass festivals Bluegrass festivals. Bluegrass music Bluegrass music. Bluegrass musicians Bluegrass musicians. Bluegrasses Bluegrasses. Blues Blues (Music) Blues musicians Blues musicians. Blues-rock music Blues-rock music. Body BODY, MIND & SPIRIT / General BODY, MIND & SPIRIT / Parapsychology / General. Boîte à rythmes Bollinger Bonbons Book industries and trade Books of hours Books of hours. Bop (Music) Bow music Bow songs Bowed stringed instruments Bowie, David, 1947-2016 Bowie, David, 1947-2016. Bowing. Boy bands Boy bands. Boys Brahe, Per, d.y., 1602-1680 Brain Brain stimulation Brain stimulation. Brand name products. Branding (Marketing) branding. Brass band music Brass bands Brass bands. Brass ensembles Brass ensembles. Brass instruments Brass instruments. Brazil Brazil, Southeast Brazil. Brésil Brian Boydell Britanniques. British British & Irish history. British Columbia British Columbia. Broadsides Broadsides. Bruit Bruits. btr Buchanan, Dorothy, 1945 - Buchbinderei. Budapest Buddhism Buddhist chants Buddhist chants. Budgie (musical group) Buildings. Bulgaria Bunkazai hogo. Bunraku. burials Bushi. BUSINESS & ECONOMICS / Careers / General BUSINESS & ECONOMICS / Development / General BUSINESS & ECONOMICS / Economics / Comparative BUSINESS & ECONOMICS / Industries / Media & Communications Industries BUSINESS & ECONOMICS / International / Economics BUSINESS & ECONOMICS / Leadership BUSINESS & ECONOMICS / Management. BUSINESS & ECONOMICS / Nonprofit Organizations & Charities Business Aspects. Butai bijutsu. Buyō-Indoneshia. Byzantine influences. Cabo Verde Cadence Cadiz (Spain) Cahman, Hans Heinrich 1640-1699 Cahman, Johan Niclas, 1670-1737 Cajun music Cajun music. Cajuns California Californie Calligraphy. Calypso musicians Cameroon Cameroon. Cameroun Cameroun. Canada Canada. Canadian poetry Canadian poetry (English) Canary Islands Candy Cantatas Cantatas, Sacred Cantatas, Sacred. Cantatas, Secular. Cantates profanes. Canticles cantor books Cantors Cantors (Church music) Capitalism Capitalism. Capitalist realism (Economic theory) Care and hygiene Career development Caribbean Area Caribbean Area. Carnatic music Carnatic music. Carnival Carnival music; Historical context; Spanish Rebublic Carnival. Carols, English Carols, English (Middle) Carols, German Carols, German. Case studies. Castile Castrati. Castrats. Cataloging of music. Catalogs and collections Catalogs. catalogue of the exhibition Catalogues Catechisms. Catedral de Tarragona Cathedrals Cathedrals; Music chapells; Repertoire; 19th Century Cathedrals; Music chapells; Repertoire; Villancico; Eightheenth Century Catholic Church Catholic Church. Catholics cct Cebu Provincial Detention and Rehabilitation Centre. Celebrities Celebrities in popular culture Celebrities. Celebrity impersonators Celebrity impersonators. Cellists Biography Cello Cello and piano music Cello and piano music. Cello players; Jazz Celtic harp Celtic music Celtic music. Celts Cembalo Cemeteries Cemeteries. Censorship Censorship. Censure Centers for the performing arts Cerdd dant Cerebro. Cerveau Çeşmeli, Fikret, 1963- Célébrités noires américaines Célébrités noires américaines. Chamber music Chamber music. Chamber music; Trios; 19th Century; 20th Century Change ringing Change ringing. Changements. Changes (Bell ringing) Chansons Chansons allemandes (Moyen haut allemand) Chansons anglaises Chansons folkloriques Chansons folkloriques tchèques Chansons françaises Chant Chant choral Chant choral. Chant grégorien Chant. Chanteurs Chanteurs de glees Chanteurs noirs américains Chanteurs noirs américains. Chanteuses Chanteuses de jazz Chanteuses noires américaines Chanteuses noires américaines. Chanting chants Chants Chants et musique Chants sacrés Chants. Chapelles (Musique) Chapels (Music) Characters and characteristics in opera. Cheesemaking Chefs d'orchestre Chefs d'orchestre. Chefs de police Chiiki shakai. Child development Child development. Children Children in art Children in art. Children of immigrants children songs Children with autism spectrum disorders Children's choirs. Children's drawings Children's drawings. Children's plays, English. Children's plays. Children's poetry, Czech Children's poetry, Czech. Children's songs Children's songs, English Children's songs, English. Children's songs, Scots. Children's songs. Children. Childrens songs Chile Chile. Chills (Musical group) Exhibitions China China. Chine Chine. Chinese Chinese Americans Chinese Americans. Chinese influences. Chiptune Chiptunes Chiptunes. Choir books Choir conducting choir history choir music Choir singing choirhistory choirpedagogue Choirs (Music) Choirs (music) New Zealand history Chopi (African people) Choral conducting. Choral conductors Choral conductors New Zealand Choral conductors New Zealand history Choral conductors. Choral music Choral music New Zealand Auckland history Choral music. Choral singing Choral singing New Zealand history Choral singing. Choral societies Choral societies. Chord diagrams. Chords (Music) Choreographers Choreographers; Marius Petipa Choreography Choreograpic Notation; Laban method; Dance Choruses, Sacred (Mixed voices) Choruses, Sacred. Choruses, Secular (Mixed voices) with orchestra Chosŏnjok Christian biography. Christian drama, English. Christian ethics. Christian life Christian life. Christian theology. Christianity Christianity and culture Christianity and culture. Christianity. Christians Christmas music Christmas music. Chronic pain Chronology. Chunn, Mike Church archives Church bells Church bells. Church buildings Church history Church jazz Church music Church music. Church musicians church song book Chœurs d'enfants. Chœurs profanes (Voix mixtes) acc. d'orchestre Cinema Cinema directors Cinéma Cinéma et musique. Circus music. Cirkusmusik Cities and towns Cities and towns; Musical activity City planning. City sounds City sounds. Civil rights Civil rights movements Civil rights movements. Civil rights. Civil War Civilisation Civilisation baroque Civilization Civilization, Baroque Civilization, Baroque. Civilization, Confucian Civilization, Confucian. Civilization, Medieval Civilization, Medieval. Civilization. církevní hudba. Članci Clarinet Clarinet music Clarinet. Clarinetists Clarinettistes Clasical Dance Clasicism Clasicism; Composers; Eighteenth Century; Luis Misón Classic mithology Classical antiquities. Classical music Classicism in music. Claudio Monteverdi Clausulas (Part songs) Clavichord Click tracks. Climat Climate Change climate change. Climatic changes. Cloth or Hardcover. Clothing Cloud computing. Coal miners Coastal ecology. Coastal ecosystem health. Coasts codex codicology Cognition in children Cognition in children. Cognition. Cognitive neuroscience. Cohen, David Cohen, Leonard Cold War Cold War. Collaboration. Collage (Art) collage (technique) Collage. Collected letters Collectibles. Collection development. Collection management. Collective memory Collective memory and motion pictures Collective memory in music. Collective memory. Collectors and collecting Collectors and collecting. College musicals College students with disabilities College teaching Collier, Terry, musician, Career in music Colombia Colonialism & imperialism. Colorado. Comedians Comédies musicales Comic books, strips, etc. Commerce Commerce. Commercial products Commercialism. Communication in ethnology Communication in politics Communication in politics. Communication, International Communism and music Communism and music. Communisme et musique Community arts projects Community development Community music Community music. Community theater Community theater. Compact discs Competition, Unfair. Competitions Compline music. Composer Composers Composers & Musicians. Composers - Hungary Composers - Spain Composers - Spain; Granados Composers -- New Zealand -- Biography. Composers New Zealand anecdotes; Composers New Zealand Bopgraphy Composers New Zealand Biography Composers' spouses Composers' spouses. Composers- New Zealand Composers--Spain Composers. Composers; Biographies; Ludwig van Beethoven Composers; Biographies; Romanticism; 19th Century; Marcial del Adalid Composers; Cinema Composers; Contemporary Music - Spain Composers; Contemporary Music; Pablo Composers; Musical drafts; Beethoven Composers; Soundtracks; Wolciech Kilar Compositeurs Compositeurs de musique de film Composition (Music) Composition (Musique) Composition (Musique) par ordinateur. Compositrices Compositrices. Computational intelligence. Computer art. Computer Communication Networks. Computer composition Computer composition (Music) Computer game music. Computer Imaging, Vision, Pattern Recognition and Graphics. Computer music Computer music. Computer network resources. Computer networks. Computer programs. Computer sound processing. Computers and Education. Concentration camp inmates Concentration camp inmates as musicians Concentration camps Concert agents Concert programs Concert tours Concert tours. Concertos Concertos (Keyboard instrument) Concertos (Piano) Concertos (Viola) Concerts Concerts rock Concerts rock. Concerts. Conditionnement Conditions sociales. Conduct of life. Conducting Conducting. Conductors Conductors (Music) Conductors (Music) - Hungary Conductors (Music) -- New Zealand -- Biography. Conflict of generations Conflict of generations. Conflit interpersonnel Confucian influences. Congo (Democratic Republic) Congress. Congresses Congresses. Congrès. Conjoints Conjunto music Conjunto music. Consciousness. Conservation et restauration. Conservatories of music Conservatories of music. Consolidation and merger of corporations Construction Construction. Consumption (Economics) Contemporary Christian music Contemporary Christian music. Contemporary Christian musicians Contemporary Dance; Choreographers contemporary music Contemporary music; Composers; Spain Contingency (Philosophy) contmporary beat music Contraltos Contrebassistes Contrôleurs MIDI. conversation COOKING / Regional & Ethnic / American / Western States. COOKING / Regional & Ethnic / Mexican. Cooper, Alice - criticism and interpretation Copla Copla; Spanish song Copla; Spanish song; Sociopolitical context; Francoism Copyright Copyright and electronic data processing. Copyright infringement. Copyright New Zealand Copyright. Cork Cork (Ireland) Cornemuseurs Corps humain dans la musique. Correspondance. correspondence Correspondence. Cosmopolitanism Cosmopolitanism. Costume Counseling of. Counterculture Counterpoint Country (Musique) Country dancing Country dancing. Country life Country music Country music. Country musicians Country musicians New Zealand Biography; Pickett Country musicians. Couples Courage. Coureurs de bois Court music Courts and courtiers Courts and courtiers. Cousins, John, 1943 -career in music Cover versions Cover versions. COVID-19 (Disease) COVID-19 Pandemic, 2020- Creation (Literary, artistic, etc.) Creative ability in business Creative ability in business. Creative ability. Creativity Credo (Music) Credo (Musique) Cree women Création (esthétique) Cricket Crime in music. Crime organisé Criminal psychology. critical edition Criticism and interpretation Criticism and interpretation. Critique musicale Critiques musicaux Croatia Croatia - Medjimurje Croatia Records Croatia. Croatian art music Croatian language Croatian Music Croatian Music Cuture in 19. Century Croatian Music Institute Croatian popular music Croatian traditional music Croatian trditional musical instruments Croatian Writerw Croatie Cross-cultural studies. Crowd funding. Crusades Crusades. Crusell, Bernhard, 1775-1838 CSound (Computer program language) Cuba Cuban Americans Cuban Americans. Cuisine américaine d'origine mexicaine. Cultural appropriation Cultural appropriation. Cultural context Cultural diplomacy Cultural diplomacy. Cultural exchanges Cultural identities Cultural Identity Cultural industries cultural life in Hungary Cultural Management. Cultural policy. Cultural property Cultural property. Cultural relationships Cultural societies Cultural studies. Culturally relevant pedagogy Culturally relevant pedagogy. Culturally sustaining pedagogy. Culture Culture populaire Culture populaire. Culture. Cuplé Curatorship. Curiosités et merveilles Curiosities and wonders Curiosities and wonders. Curricula Curricula. Curriculum change. Curriculum planning. Customs and practices. Cylinder recordings Cyprus Cyprus. Czech Republic Czech Republic. Czechia Czechia. Czechoslovakia Czechoslovakia. Czechs Czechs. czenas Česko Česko. Dadaism. Dalmatia Dance Dance and race Dance and race. Dance and the Internet Dance and the Internet. Dance halls Dance halls. Dance History Dance in motion pictures, television, etc. Dance in opera Dance music Dance music. Dance notation. Dance research Dance teaching Dance therapy Dance. Dance; Audiovisual arts; Copyrights; Law Dance; Choreographers; Women Dance; Choreographers; Women; Letters Dance; Classical dance; Choreographers Dance; Disabilty Dance; Escuela Bolera Dancers Danemark. Dans l'art Danse Danse, Musique de Danses de société Danseuses Data processing Data processing. Deadheads (Music fans) Deaf Deaf musicians. Deafness Death Death in music. Death. Decolonization Decolonization. Deconstruction. Dementia Dementia. Denazification. Denmark Denmark. Denshi ongaku-Rekishi. Denshi ongaku. Depeche Mode Deregulation Deregulation. Design Design and construction. Desire Desire in music. Devčić Natko Devotional literature, Indic Devotional literature, Indic. Décors Déesses hindoues Dépendants dějiny opery Dholi Dialectical behavior therapy. Diaries Diaries. Diario de Barcelona Dictatorship Diction Diction. Dictionaries Dictionaries. Difference (Philosophy) in music. Diffusion of innovations Digital audio editors. Digital electronics. Digital media Digital music players Digital rights management Digital rights management. Digital scores Digitalization Dimmer (musical group) Dinaric Region Dinner theater Dinner theater. Dionysia. Diplomatic relations. Diplomatie culturelle Diplomats Direction chorale. Directories. Dirigenter Disaster relief Disaster relief. Disasters Disc jockeys Disc jockeys. Disco (dans) Rave Modern dansmusik – historia Modern dansmusik – sociala aspekter Populärkultur – historia Disco music Discographie. Discographies. Discography Discography. discourse analysis Discrimination against people with disabilities. Diseases Diseases in opera. Diseases. Disinfection. Diskjockeyer Diskursanalyse Dissemination of music Dissemination of music. Diversity in the workforce Diversity in the workplace Divine office Divine office (Music) Do-it-yourself work Documentary films Dohnányi Domenico Scarlatti Domkyrkor Domnérus, Arne, 1924-2008 Don Juan (Legendary character) Don Quijote Doo-wop (Music) Double bass Double bassists Double bassists. Double Happys (musical group) Double-bassists Douglas Lilburn Dōwa. Dōyō-Nihon. Drama Drama. Dramatic music Dramatic music. Dramatisk och scenisk musik Dramatists, American Dramatists, English Dramatists, German Dramaturgie. Dramaturgy Dramaturgy. Droit d'auteur Droit d'auteur. Drottningar Musik – historia S{\aa}ngerskor – historia Kulturliv – historia Drug addicts Drug addicts. Drugs and popular music. Druids and druidism. Drum Drum and bugle corps. Drum circles Drum circles. drum language. Drum machine Drum machine. Drum set Drum set. Drum. Drummers Drummers (Musicians) dřevěné dechové nástroje. Dublin Dubrovnik dude Dudley Dufva, Petter, 1756-1836 dulcimer Dunedin Choral Society History Dutch Dutch. Dwarfs (Persons) Dylan, Bob, 1941- Dynamics. Dysphonie. Ear training. Early childhood education Early childhood education. Early modern history: c 1450/1500 to c 1700. Early modern, 1500-1700 Early music Early printed books Early works to 1800. East and West in art. East Asia East Asia. East Asians East Indian diaspora. Easter Easter Island Easter music. Easter Rising Eastern Europe Ecomusicology. Economic aspects Economic aspects. Economic conditions Economic conditions. Economic history. Economics, Finance, Business & Management. Economics. Ecrivains québécois eczenas Edition Edo period, 1600-1868. Edo period. Education EDUCATION / General EDUCATION / Higher EDUCATION / Multicultural Education EDUCATION / Special Education / General EDUCATION / Special Education / General. Education and state Education and state. Education, Elementary Education, Elementary. Education, Higher. Education, Humanistic. Education, Primary Education, Primary. Education, Secondary Education, Secondary. Education, Urban. Education. Education; Pedadogy Educational change. Educational sociology Educational sociology. Educational Technology Educational technology. Effect of human beings on. Effects pedals Effects pedals. Effets physiologiques. Effets pysiologiques Eiga ongaku. El Sistema (musikpedagogik) El Sistema (musikpedagogik) – historia election campaigns. Electric guitar Electric guitar makers Electric guitar makers. Electric guitar. Electricity Electroacoustic music Electroacustic music; Sound art; Criticism Electronic apparatus and appliances Electronic composition. Electronic dance music Electronic dance music. Electronic instruments, Digital. Electronic music Electronic music. Electronic musical instrument makers Electronic musical instrument makers. Electronic musical instruments Electronic musical instruments. Electronic reference sources. Electronic sound control. Electronica (Music) Elegiac poetry, English Elegiac poetry, English. Elektroakustisk musik Elektronisk musik Elektronmusikstudion Elementary school teaching. Elever Elgitarr – historia Gitarr – historia Ellington, Duke, 1899-1974-- influenser Elvis Presley Elvis Presley impersonators Elvis Presley impersonators. Embellishment (Vocal music) embne Emeralds Emeralds. Emigration and immigration Emigration and immigration. Emotions Emotions in art. Emotions in children. Emotions in music Emotions in music. Emotions in the performing arts Emotions in the performing arts. Empathy. Employees Empowerment Encyclopedias Encyclopedias. Encyclopédies. End of the world. Engeki-Nihon. Engeki-Roshia. Engelskspråkiga författare-- historia Engineering instruments Engineering instruments. England England, North East England, North East. England, Northern England. English English language English literature English literature. English New Zealand. Hymns English poetry English-speaking countries Enka Enka. Enlightenment Enlightenment. Enregistrements de terrain (Musique) Enrique Enrique Granados Enseignement Enseignement axé sur l'apprenant. Enseignement secondaire. Enseignement supérieur. Enseignement. Ensemble (Exécution musicale) Ensemble playing Ensemble playing. Entertainers Entertainers New Zealand Entertainers New Zealand Biography Entertainers. Entertainment & Performing Arts. Entrepreneurship Entrepreneurship. Entretiens. Environmental aspects Environmental aspects. Equipment and supplies Equipment and supplies. Erard piano. Ergonomi Eric Ericson Eriksson, Josef, 1872-1957 Ernő Dohnányi Errors of usage Esclavage Esclaves Essays. Estland Estonia Estonians Estonians. Etats-Unis ethics (philosophical concept) Ethiopia. Ethiopian Americans Ethiopian Americans. Ethiopians Ethiopians. Ethnic festivals -- New Zealand. Ethnic identity. Ethnic performing arts Ethnic relations. Ethnic Studies Ethnicity in music Ethnicity in music. Ethnological museums and collections Ethnological museums and collections. Ethnology Ethnomusicologie Ethnomusicologie. Ethnomusicology Ethnomusicology. Ethnomusicology; Folklore; Songbooks Etnicitet Etnologi Musiketnologi Kulturmiljöv{\aa}rd Folkmusik Folkmusikuppteckningar eucharist Eurasia Eurasia. Eurasie. Europe Europe, Central Europe, Eastern Europe, Eastern. Europe. European influences. Eurovision Song Contest Eurythmics. Evangelicalism Evangelicalism. Evangelists Evangelists. Events (Philosophy) Evolutionary computation. Evolutionary psychology. Examinations Examinations. Executors and administrators Executors and administrators. Exercices (Éducation musicale) exercises etc. Exécution Exécution (musique) Exécution. Exhibition catalogs exhibition catalogue Exhibitions Exhibitions. Exoticism in music. Expériences paroxystiques. Expression (Philosophy) Expression in art. Extreme metal (Music) Écoles secondaires Écomusicologie. Écosse. Écoute (Philosophie) Écrits de musiciens rock. Écrivaines noires américaines. Écrivains autrichiens Éditeurs audionumériques. Éditeurs de musique Édition Éducation holistique. Éducation humaniste. Éducation. Église catholique Église luthérienne Église luthérienne. Églises protestantes. Électronica (Musique) Électrophones États arabes États-Unis États-Unis (Sud) États-Unis. Éthiopie. Éthiopiens Étude et enseignement Étude et enseignement. Études de cas. Facsimiles. Facteurs d'orgues Facteurs liés à l'âge. Facture Facture. Faculty of Music in Belgrade Fair use (Copyright) Fairy tales Faith. Fame Families Families. Family relationships Fan magazines Fan magazines. Fandangos Fanfares (Orchestres) Fängelser Musik och samhälle Fans (Persons) Fantasy fiction Fantasy fiction. Fantasy films Fantasy games. Fanzines Farm life Farmers Fascism and culture Fascism and culture. Fascism and music Fascism and music. Fascisme et musique Fashion Fashion designers Fashion in art. fast Fathers and daughters Fathers and daughters. Fathers and sons Fathers and sons. Faust (Legendary character) Fågelsång. Feasts for the Blessed Virgin Mary. Federico García Lorca Feliks Petančić Femininity in music. Femininity in popular culture Femininity in popular culture. Feminism Feminism & Feminist Theory. Feminism and literature Feminism and literature. Feminism and music Feminism and music. Femmes dans l'industrie musicale. Femmes dans la musique. Femmes mécènes de la musique Femmes sauvages dans la littérature. Femmes violonistes Fender guitar Fender guitar. Fernsehproduzent. Festivals Festivals de musique Festivals. Féminisme et musique. Fiddle tunes Fiddle tunes. Fiddlers Fiddlers. Fiddling Field recordings Fife and drum corps Fife and drum corps music Fife and drum corps music. Fife and drum corps. Fifre et tambour, Musique de Filipino American youth Filipino Americans Film Film adaptations. Film catalogs. Film composers Film composers. Film music Film soundtracks Film soundtracks. Film theory & criticism,Film: styles & genres,Opera. Film, Musique de Filmmusik Filmmusik Animerad film Publiker Filmmusik, USA. Filmmusik. Filmska umjetnost filosofi Musik – sociala aspekter Finance, Personal. Fingering Fingering. Finland Finlandssvenskar Finn, Liam Finn, Neil Flageolet Flamenco Flamenco dancers; Biographies Flamenco dancers; Homosexuality; Gender studies Flamenco music Flamenco singers Flamenco; Ethnomusicology; Work songs Flight in art. Flöjt Musikframträdanden Florida Floride Flute Flute music Flute music. Flute players Flute players. Flûte à bec Flying Nun Records - History 20th century Flying Nun Records - History; Sound recording industry - New Zealand - History; Rock musicians - New Zealand; Music trade - New Zealand - history Flying Nun Records history Folk art Folk art. folk custom Folk dance folk dance in Hungary Folk dance music Folk dance music. folk dance research Folk dancing Folk dancing, Irish Folk dancing, Irish. Folk dancing, Scottish. Folk dancing. folk epics folk instrument Folk music folk music collection Folk music festivals Folk music festivals. folk music history Folk music Hungarian folk music research Folk music Southern Slavs in Hungary Folk music symphosyum Folk music, Irish. Folk music. folk musical instruments Folk musicians Folk musicians. folk musicof South Slavs in Hungary Folk poetry, Arabic Folk poetry, Bakhtiari. Folk poetry, Greek (Modern) Folk poetry, Italian Folk poetry, Italian. Folk singers Folk singers. Folk songs Folk songs, Aboriginal Australian Folk songs, Arabic Folk songs, Bakhtiari. Folk songs, Chinese Folk songs, Czech Folk songs, Czech. Folk songs, English Folk songs, English. Folk songs, Indonesian Folk songs, Indonesian. Folk songs, Japanese Folk songs, Japanese. Folk songs, Kannada. Folk songs, Korean Folk songs, Ladino Folk songs, Ladino. Folk songs, Manx. Folk songs, Nenets Folk songs, Old French Folk songs, Scots Folk songs, Scots. Folk songs, Scottish Gaelic Folk songs, Welsh. Folk songs. Folk-rock music Folk-rock music. folkdance Folkliga koraler Folklore Folklore. Folklorists Folkmusik Folkmusik Spelmän Folkmusik-- historia Folkmusik-- sociala aspekter folksongs folktradition Folkvisor-- forskning Fonds d'archives. Food in music Food in music. Football (Soccer Association Football) Forecasting. Foreign influences. FOREIGN LANGUAGE STUDY / Multi-Language Phrasebooks. Förenta staterna Forests and forestry. formal analysis Formation. Former Yugoslav republics Former Yugoslav republics. Foster children Fourrures Fragmente. fragments. France France, Southern France, Southern. France. Francoism Francoist dictatorship Franjo Ksaver Kuhač = Franz Ksaver Koch Frankrike Franz Joseph (František) Gläser Franz Xaver Kleinheinz Französisch Frederick May Free jazz Free jazz. French influences. French language French poetry French poetry. French. Friendship Friendship. From Scratch(Musical Group) Fue. Functor theory. Fundamentalism Fundamentalism. Funds Preservation Funeral consultants Funeral music Funeral music. Funeral service Funk (Music) Funk musicians Fur trade Fur trade. Fur traders Futurism (Literary movement) Futurism (Music) Fuzzy logic. Gagaku Gagaku. gaita Gakufu-Rekishi. ganga Gangsta rap (Music) Gangsters Gangsters. Garamut García family Gardberg, Tom, 1941- Gasshō. Gay culture Gay culture. Gay men Gay men. Gay musicians Gay musicians. Gay musicologists Gehörslära Geijutsu-Indoneshia. Geishas. Geistliche Musik. Gender Gender identity in music Gender identity in music. Gender nonconformity Gender nonconformity. Gender studies Gender studies, gender groups. Gender studies: women. Gender studies; Pedagogy Gender-nonconforming people Gender-nonconforming people. General & world history. General certificate of education examination (Great Britain) General. Generation Y. Generation Z Genetic algorithms. Genres & Styles genusaspekter. George Frideric Handel Georgia Gerald Dawe German influences. German language German literature German literature. German poetry German speaking countries German. Germany Germany (East) Germany (West) Germany. Gesang Geschlechterrolle Gestes dans la musique. Gestion numérique des droits Gestion. Gesture in music. Géorgie (État) Gēmu sofuto. Ghana Ghana. Ghāna Ghāna. Gidayūbushi. gipsy musicians Girei. Girl groups (Musical groups) Gitarrer-- historia Giuseppe Verdi Glam metal (Music) Glam rock music Glam rock music. Glam rock musicians Glasgow glazbeni nakladnici - Hrvatska - 20/21. st. Glee clubs Glee clubs. Globalisierung Globalization Globalization. Gluck-Piccinni controversy. gnd God (Christianity) Godfrey Gong Gospel Gospel music Gospel music. Gospel musicians Gospel musicians. Gospel singers Gospel singers. Govori Grading and marking (Students) Grainger, Percy, 1882-1961 Grammar. Grande-Bretagne Grande-Bretagne. Graphic novels. Greager, Richard, Great Britain Great Britain. Greece Greece. Greek Americans Greek influences. Greek literature Greek music Greek poetry, Modern Greek poetry, Modern. Greeks gregorian Gregorian chants Gregorian chants. Group identity Group identity in the performing arts Group identity. Groupes rock Groupes vocaux Groupies Growth Growth. Grunge (Musique) Grunge music Grunge music. gtt Guadeloupe Guadeloupe. Guerre mondiale, 1939-1945 Guidebooks. Guides touristiques (Personnes) Guinbri Guinea. Guitar Guitar makers Guitar makers. Guitar music Guitar music (Blues) Guitar music (Rock) Guitar music. Guitar teachers Guitar. Guitare Guitare, Musique de. Guitaristes Guitarists Guitarists. Gullahs Gunnar, Eriksson, 1936- Guralnick, Peter Gymnasieskolan Gypsy musicians Hagström Hainichi mondai. Haiyū. Håkanson, Knut, 1887-1929 Hallucinations and illusions. Handbooks, manuals, etc. Hardcore (Music) Hardcore (Musique) Hardcore musicians Harmonica Harmonica music. Harmonica players Harmonica players. Harmonicistes Harmonie (musique) Harmonie. Harmony Harmony of the spheres. Harmony. Harp Harp music Harpistes Harpists Harpists. Harpsichord Harpsichord. Harpsichordists Hassaniyya dialect Hate groups. Hawaii. Hayes, Roland, 1887-1977. hälsoaspekter. HEALTH & FITNESS / Healthy Living HEALTH & FITNESS / Work-Related Health Health and hygiene. Health aspects Health aspects. Health facilities Hearing Hearing Aids Hearing aids. Hearing impaired. Hearing. Heavy Metal Heavy metal (Music) Heavy metal (Musique) Heian period, 794-1185 Heike monogatari. Heritage tourism Heroines in opera. Higashinihon daishinsai. higher education. Hindu goddesses Hindu goddesses. Hindu music Hindu music. Hinduism Hindustani music Hindustani music. hip-hop Hip-hop dance Hip-hop in art. Hip-hop. Hiphop (musik) Samhällskritik Feminism Antirasism Musiksociologi Musik – sociala aspekter Hispanic Americans Histoire Histoire et critique Histoire et critique. Histoire. Histoires, intrigues, etc. Historia historia. Historically informed performance (Music) Historiographie Historiography historiography Croatia Historiography. History History & Criticism. HISTORY / Africa / South / Republic of South Africa. HISTORY / African American HISTORY / Asia / General HISTORY / Australia & New Zealand. HISTORY / Europe / France. HISTORY / Europe / Great Britain / General. HISTORY / Europe / Spain & Portugal HISTORY / Europe / Western HISTORY / General. HISTORY / Jewish HISTORY / Latin America / South America. HISTORY / Modern / General HISTORY / Oceania. HISTORY / Social History HISTORY / Social History. HISTORY / United States / 19th Century. HISTORY / United States / 20th Century. HISTORY / United States / General HISTORY / United States / State & Local / South (AL, AR, FL, GA, KY, LA, MS, NC, SC, TN, VA, WV) History and criticism History and criticism. History and criticsm. History and critisicm. History in literature. History in opera. History in popular culture History in popular culture. History of music history of opera History. Högstadiet Holistic education. Holistic Health Holocaust survivors Holocaust, Jewish (1939-1945) Homages Homeland in music. Homes and haunts. Homes. homoit Homosexualité et musique. Homosexuality Homosexuality and music. Homosexuality and popular music Homosexuality and popular music. Homosexuality. Hongrie Hongrie. Honnête homme Horn (Musical instrument) Horror films Horror films. Horses Hospital care. Hospital patients Hospitalers Hospitalers. Hospitals Hospitals. House music House music. Hōgaku-Rekishi. Hōgaku. hrvatska poezija - 20/21. st. - antologije http://id.loc.gov/authorities/subjects/sh2008106048 http://id.loc.gov/authorities/subjects/sh85069833 http://id.worldcat.org/fast/871620 http://id.worldcat.org/fast/871649 http://id.worldcat.org/fast/982165 http://id.worldcat.org/fast/982175 http://id.worldcat.org/fast/982185 https://id.kb.se/term/sao/Kultur https://id.kb.se/term/sao/Kulturhistoria https://id.kb.se/term/sao/Musik https://id.kb.se/term/sao/Musikhistoria https://id.kb.se/term/sao/Nazism%20och%20musik https://id.kb.se/term/sao/Orgel https://id.kb.se/term/sao/Propaganda--historia https://id.kb.se/term/sao/Reggae https://scigraph.springernature.com/ontologies/product-market-codes/I13022 https://scigraph.springernature.com/ontologies/product-market-codes/I14002 https://scigraph.springernature.com/ontologies/product-market-codes/I18067 https://scigraph.springernature.com/ontologies/product-market-codes/I21000 https://scigraph.springernature.com/ontologies/product-market-codes/I22005 https://scigraph.springernature.com/ontologies/product-market-codes/I24032 Huang zhong (Musical instrument) hudba hudebniny hudební kritici hudební kritika hudební sbírky hudební skladatelé hudební skladatelky hudební vzdělávání hudební život hudebníci Hugo Badalić Human body Human body in music. Human body. Human evolution. Human geography. Human rights Human rights workers Human rights workers. Human rights. Human sacrifice in opera. Human-animal relationships Human-computer interaction. Humaniora och konst. Humanism Humanism in music Humanism in music. Humanism. Humanisme dans la musique. Humanists Humanities and the Arts. Humor in music. Humor. Hungarian hungarian composers Hungarian folk music Hungarian Folk songs Hungarian folksongs Hungarian music life hungarian musiciians hungarian musicology hungarian pop music Hungarian song Hungary Hungary. Hurdy-gurdy. Husband and wife. Hydroponics Hymnes Hymnes. Hymns Hymns, English Hymns, English. Hymns, Pitjantjatjara. Hymns, Welsh. Hymns. IAML Ian McGillis Iberian Peninsula Iceland Iconography Identification Identification (Religion) Identification. Identité sexuelle dans la musique. Identity (Psychology) in adolescence Identity (Psychology) in adolescence. Identity politics. Identity. Ideology Igor Illinois Illumination of books and manuscripts. Illustrators Imagery (Psychology) Imagination. Imitation (Littérature) Imitation in literature. Immigrants Immigrants. Impresarios Impression Impression. Imprésarios Improvisation (Music) Improvisation (Musique) Improvisation in art Ina Boyle Incas Incas. Inclusive education Inde Inde (Sud) Inde. Indexes. India India, South. India. Indian influences. Indian women activists Indian women singers Indians of North America Indie culture. Indie pop music Indigenous musicians Indigenous peoples Individual Composer & Musician. Individual composers & musicians, specific bands & groups. Indonesia Indonesia. Industrial music Industrial music. Industrie Industrie de la musique et du son. Industrie. Influence (Literary, artistic, etc.) Influence africaine. Influence américaine. Influence. Information literacy Information resources Informatique. Ingénieurs du son Inlärning Inscriptions. Installations sonores (Art) Institute of Registered Music Teachers of New Zealand Institute of Registered Music Teachers of New Zealand history Institutional care institutional history Instruction & Study Instruction and study Instruction and study. Instrumental music Instrumental music. instrumental works Instrumentation and orchestration Instrumentation and orchestration. Instrumentation et orchestration Instruments à clavier Instruments à cordes Instruments de musique Instruments de musique électroniques Intangible property Intelectual property Intellectual life Intellectual life. Intellectual property Intelligence artificielle. Intercultural communication Intercultural communication. Interfaith worship. Interior decoration Interior decoration. Intermediality. International relations. International trade. Internationalism Internationalism. Interpersonal conflict Interpersonal conflict. Interpretation Interpretation (Phrasing, dynamics, etc.) Interpretation and construction Interpretation and construction. Interracial adoption Intertextuality. Interviews Interviews. Inuit Invective in music. Iolo Morganwg iPad (Computer) iPhone (Smartphone) iPod (Digital music player) Iran Iraq Ireland Ireland. Irish Irish American soldiers Irish American soldiers. Irish American. Irish Americans Irlandais Irlandais. Irlande Irlande. Irony in music. Irving, Dorothy, 1927- Islam Islam Semiotik Hiphop Islam. Islamic arts Islamic countries Islamic countries. Islamic influences. Islamic music Islamic music. Islands. Isle of Man Isle of Man. Israel Israel. Israël. Italian language Italian Opera Italian poetry Italian poetry. Italie Italie. Italy Italy. Itálie Ivan Kukuljević Sakcinski Ivan pl. Zajc Ivan Zajc Jacinto Guerrero Jacinto Valledor Jack Jam bands Jam bands. Jamaica Jamaica. Jamaicans Jamaïque Jamaïque. James Goodman James Wilson Japan Japan. Japanese drama Japanese drama. Japanese influences. Japanese literature Japanese poetry Japon. Japonism Järnbruk-- historia Jay-Z. Jazz Jazz au cinéma. Jazz clubs Jazz dance. Jazz dans la littérature. Jazz festivals jazz history in Hungary Jazz history in Spain Jazz in Croatia Jazz in literature. Jazz in motion pictures. Jazz musicians Jazz Musicians - New Zealand jazz musicians - New Zealand - anecdotes; Clark Jazz musicians. Jazz New Zealand jazz record history Jazz singers Jazz singers. jazz theory Jazz vocals Jazz-- historia Jazz. Jazzklubbar Jazzmusiker Jazzmusiker Basister Tonsättare Jefferies, Graeme Jelena Zrinska=Ilona Zrínyi Jenny Jeux vidéo, Musique de Jew's harp Jewelry Jewelry theft Jewelry theft. Jewelry. Jewish composers Jewish composers. Jewish jazz musicians Jewish music Jewish musicians Jewish musicians. Jewish studies. Jewish theater Jews Jews in the performing arts Jews, German Jews, German. Jews. jlabsh/4 Joan Denise Moriarty Job stress. Joe Dolan John Barry John Beckett John Buckley John Egan Jojk Folkmusikuppteckningar Josep Mestres-Quadreny Journalism (Film & Media) Journalism. Journalists Jōruri Jōruri-Rekishi. Jōruri. Judaism Judaïsme. Judenverfolgung Jugaku. Jugoton Juifs Jukebox musicals Jukebox musicals. Jungian psychology. Jusqu'à 1500 Jusqu'à 1901 Jusqu'à 1931 Justice sociale Justice sociale. Juvenile Juvenile literature. K-pop Kabuki Kabuki music Kabuki music. Kabuki plays Kabuki plays. Kabuki-Rekishi. Kabuki. Kageki. Kagura Kagura. Kaitito waiata reo Korero taumata Kaiwaiata. Kamengeki. Kansas Karl Goldmark Kashu. Kayō. Keiongaku. Kentucky Kenya Kenya Nairobi Kenya. Kerry Kevin (trumpeter) - anecdotes - Keyboard instrument music Keyboard instrument music. Keyboard instruments Keyboard instruments. Keyboard music Keyboard players Keyboards (Music) Keybord music Kildare Kinematografija Kirchenmusik Kirtana (Hinduism) Klangfärg Improvisation (musik) Preparerat piano Klangkunst. Klapa singing Klarinettister Klassische Musik Klassische Musik. Klassisk musik Konserter (framträdanden) Pianister Scenframträdanden Nervsystemet Prestations{\aa}ngest Klassisk musik-- historia Klassisk musik-- mottagande Klezmer music Klezmer music. Knowableness. Knowledge, Theory of (Religion) Knowledge, Theory of. Kokusai bunka kōryū. Komponist Komponistin Komposition (musik) Komposition Musikframträdanden Kompositörer Konserter (framträdanden) Rock Könsmaktsordning Könsroller Konst Konst. Konstfilosofi Konstmusik Konstnärlig forskning Konstnärligt skapande Konzert Kördirigering Korea Korea (South) Korea. Korean Americans Korean language materials. Körer-- historia Körledning Körsång-- forskning Körsångng Körs{\aa}ng – sociala aspekter Körs{\aa}ng – psykologiska aspekter Kōrero taumata. Kŏmunʼgo music Kŏmunʼgo music. Kranjčević Vladimir Kropp och själ Kultur. Kulturell identitet Migration Musik – sociala aspekter Kulturförderung Kulturhistoria. kulturni kapital ; vrijednosti ; mladi ; kulturna potrošnja ; glazbeni ukus ; televizijske preferencije ; Jadranska Hrvatska (cultural capital ; values ; youth ; cultural consumption ; taste in music ; television preferences ; Adriatic Croatia) Kulturpolitik Kulturpolitik Offentliga sektorn Musikliv Kurt Weil Kuyō. Künste Kvarner Kvinnliga musiker Kvinnliga tonsättare Kvinnliga tonsättare Tonsättare Kvinnoförtryck Musik – historia – genusaspekter Kvinnor i musiken – historia Kvinnlighet – historia Kärlekss{\aa}nger – historia – genusaspekter Kwansei Gakuin Glee Club Kyōdo geinō. kyōdogeinō Kyōgen Kyōgen plays Kyōgen plays. Kyōgen-Rekishi. Kyōgen. Kyrkomusik Kyrkomusik – historia Kyrkomusiker. Kyrkos{\aa}ng Kyrkomusik Labor productivity Labour law Laienspiel Landscape architecture. Landscapes in music. Language Language acquisition. Language and languages Language and languages. LANGUAGE ARTS & DISCIPLINES LANGUAGE ARTS & DISCIPLINES / Alphabets & Writing Systems. LANGUAGE ARTS & DISCIPLINES / Composition & Creative Writing LANGUAGE ARTS & DISCIPLINES / Grammar & Punctuation. LANGUAGE ARTS & DISCIPLINES / Linguistics / General. LANGUAGE ARTS & DISCIPLINES / Linguistics / Syntax. LANGUAGE ARTS & DISCIPLINES / Publishing LANGUAGE ARTS & DISCIPLINES / Readers. LANGUAGE ARTS & DISCIPLINES / Spelling. Language. Large type books. Larsson Gothe, Mats, 1965- Last years of a person's life. Latin America Latin America. Latin drama (Comedy) Law LAW / Jurisprudence Law and legislation Law and legislation. Lawyers lcgft Leadership. Learning Learning disabled children Legacies Legal status, laws, etc. Leisure Lent Lenten music Leonard Cohen Lesbian musicians Lesbian musicians. Letters Letters. Lésions et blessures. LGBT LGBT Studies. LGBT. LGBTQ+ musicians. Liberalism Libraries and minorities Libraries and minorities. Libraries. Librarinaship Library Library fund raising Library fund raising. Library outreach programs libreto Librettists Libretto Libretto Librettologi Libretto. Librettos Librettos. Licenses lidové hudební nástroje Lied Lieu (Philosophie) Life cycle, Human Lifestyle, sport and leisure / Sports and outdoor recreation / Active outdoor pursuits / Walking, hiking, trekking likovi kao alegorija nacije Lindblad, Adolf Fredrik, 1801-1878 Lindh, Björn J:son, 1944-2013 Lisa; Pearl (musical group Listening Listening (Philosophy) Listening. Literacy LITERARY COLLECTIONS / Essays. Literary collections. LITERARY CRITICISM LITERARY CRITICISM / American / Asian American & Pacific Islander. LITERARY CRITICISM / American / General LITERARY CRITICISM / American / General. LITERARY CRITICISM / European / English, Irish, Scottish, Welsh LITERARY CRITICISM / European / English, Irish, Scottish, Welsh. LITERARY CRITICISM / Feminist. LITERARY CRITICISM / General. LITERARY CRITICISM / Modern / General. LITERARY CRITICISM / Poetry Literary sources Literary themes, motives. Literatur Literature Literature on music. Literature, Modern Literature, Modern. Littérature Liturgical drama; Religious festivities; Oral tradition liturgical songs Liturgics. Liturgie. Liturgies liturgy. Livres d'heures Livret (Musique) Ljudeffekter Ljudevit Gaj Ljudkonst Loggers Logging. Logiciels. Logistik Streamad media Programvara Musikbranschen – tekniska aspekter Loisir loneliness Longitudinal studies. Lorde Loss (Psychology) Louisiana Louisiane Love poetry, Scottish. Love songs Ludwig van Luis de Pablo Lullabies. Lumber trade. Lur (Iranian people) Lute Lutheran Church Lutheran Church. Luthiers Lyric writing (Popular music) Lyricists Lyricists. Lyrics. Maček Ivo Machine learning. Madrid Madrigal. Madrigaler. Madrigalkomödie. Madrigals Madrigals. Maintenance and repair Maintenance and repair. Makerspaces Maksimilijan Vrhovac Malawi Malawi. Malaysia Male actors. Male musicians Male singers Male singers. Malec Ivo Malerei Malta Malta. Män Man-woman relationships. Management. Mandolin Mandolinists Mandolinists. Manners and customs Manners and customs. Manuel de Falla manufacture of musical instruments. Manuscripts Manuscripts, German Manuscripts, German. Manuscripts, Latin (Medieval and modern) Manuscripts. Manuscrits latins médiévaux et modernes Maori (New Zealand people) Maori (New Zealand people), Maori in the performing arts Maori; Maori (New Zealand people) - music; wood instruments - New Zealand; Birds - New Zealand - songs and music Marcus, Greil Markedness (Linguistics) Marketing Marketing. Marque (Linguistique) Marriage. Marshall Islands Marshall Islands. Marshallais Marshallese Martin P. anecdotes Martin, Hans, 1934- Masculinité dans la musique. Masculinity Masculinity in music. Maskanda Maskanda. Mass Mass (Music) Mass media Mass media and music Mass media and music. Mass media; Broadcasting Massachusetts Masses Mastering (Sound recordings) Materialität. materiality. Materials and instruments Materials and instruments. Materials. Mathematics MATHEMATICS / Applied MATHEMATICS / General Mathematics. Mathematik Mathématiques Mathématiques. Matsuri-Miyagiken. Matsuri-Nihon. Matsuri-Tōhoku chihō. Matsuri-Tōkyōto chiyodaku. McIntyre, Donald, 1934 McPherson, Suzanne Meaning (Philosophy) Means of communication. Mechanical aids. Mechanical musical instruments Media Studies. mediaeval music. MEDICAL MEDICAL / Alternative Medicine medicine Medicine and art. Medicine. Medieval influences. Medieval music Medieval. Medievalism in opera. Medievalism. Mediterranean Region. Melancholy in music. Melbourne Melbourne (Vic.) Melodi Svenska skillingtryck – historia Svenska skillingtryck – sociala aspekter – historia Svenska skillingtryck – politiska aspekter – historia Melodic analysis. Melodrama. memoir. memoires Memorials Memorials. Memory Memory in motion pictures. Memory in old age. Memory. Men's choirs Mennonite Church Canada. Mensch Mensural notation. Mental disorders Mentoring. Messe (Musique) Messes Messiah Mesure et rythme Mesure et rythme. Metaphor in musical criticism. Metaphysics. Metaphysique. Methodology Methodology. Methods Methods (Blues) Methods (Rock) Methods. Metronome. Mexican American cooking. Mexican Americans Mexican-American Border Region Mexican-American Border Region. Mexicans Mexico Mexico. Mexique Mezzo-sopranos Mécénat Médias et musique. Médias numériques Mémoire Mémoire collective Méthodes statistiques. Méthodologie Michael W. Balfe Michigan Microphone Microphone. Microtones. Middle Age Middle age. Middle Age; Carmina Burana Middle Ages Middle Ages, 600-1500 Middle Ages, 600-1500. Middle Ages. Middle East Middle East. Middle West Middle West. MIDI (Standard) MIDI controllers. migrations Miguel de Cervantes Miguel Fisac Miklós Zrinyi Mil neuf cent soixante-huit. Militärmusiker Military music Military occupation Military occupation. Military participation Military spouses Mills and mill-work Mind and body. Mindfulness (Psychology) Minimal music Minimal music. Minorités dans les arts du spectacle. Minorities Minorities in the performing arts. Minstrel music Minstrel show Minwa. Minzoku ongaku. Miscellanea. Miscellanées. Misogyny in music. Mississippi Mississippi River Valley mixed choir Mixed reality. Mod culture (Subculture) Modality (Linguistics) Modan dansu-Rekishi. Models (Persons) Modern Age - Spain Modern dance Modern dance music Modern dance music. Modern dance. Modern history to 20th century: c 1700 to c 1900. Modernism (Art) Modernism (Literature) Modernism (Music) Modulation (Music) Modulation (Musique) Moguchai͡a kuchka (Group of composers) Monarchy Monastic and religious life Monasticism and religious orders Mongolia Mongolia. Mongolie Mongolie. Mongols Monism. Monisme. monography Monologues with music (Chorus with orchestra) Monsters. Moog synthesizer. Moral and ethical aspects. Morale pratique. Mormons Mörne, Arvid, 1876-1946. Sjömansvisa Morocco Morocco. Morrison, Howard Motets Motets. Motette Motherhood and the arts. Mothers Mothers. Motion detectors Motion picture actors and actresses Motion picture actors and actresses. Motion picture music Motion picture music. Motion picture plays Motion picture plays. Motion picture producers and directors Motion picture theater managers Motion pictures Motion pictures and music Motion pictures and music. Motion pictures and opera. Motion pictures and the war. Motion pictures and transnationalism. Motion pictures in psychotherapy. Motion pictures, Hindi Motion pictures. Motiv Motocyclisme Motorcycling Mouvements des droits de l'homme Movement education. Movement, Aesthetics of. Mozambique Mozambique. Mozarabic chants Mozarabic rite (Catholic Church) Mozart Mridanga MUISC / Genres & Styles / Rock. Multi-sided platform businesses Multiagent systems. Multicultural education. Multiculturalism Multiculturalism. Munich Biennale For New Music Theatre. Munster Murai Jurica MUS020000. Museology & heritage studies. Museu de la Música de Barcelona museum history Museum Studies. Museum techniques. Museums Museums of Instruments Music Music & Sound Studies. Music - Church music - Hymns, Choruses and Carols. music - private collctions- New Zealand Music - private collections - Australia Music -- New Zealand -- Dunedin -- History and criticism. MUSIC / Business Aspects MUSIC / Discography & Buyer's Guides. MUSIC / Essays. MUSIC / Ethnic MUSIC / Ethnomusicology MUSIC / Ethnomusicology. MUSIC / General MUSIC / General. MUSIC / Genres & Styles / Ballet MUSIC / Genres & Styles / Blues MUSIC / Genres & Styles / Classical MUSIC / Genres & Styles / Classical. MUSIC / Genres & Styles / Dance. MUSIC / Genres & Styles / Folk & Traditional MUSIC / Genres & Styles / Folk & Traditional. MUSIC / Genres & Styles / General MUSIC / Genres & Styles / Heavy Metal. MUSIC / Genres & Styles / Jazz MUSIC / Genres & Styles / Jazz. MUSIC / Genres & Styles / Latin. MUSIC / Genres & Styles / Opera MUSIC / Genres & Styles / Opera. MUSIC / Genres & Styles / Pop Vocal MUSIC / Genres & Styles / Pop Vocal. MUSIC / Genres & Styles / Punk MUSIC / Genres & Styles / Punk. MUSIC / Genres & Styles / Rap & Hip Hop MUSIC / Genres & Styles / Rap & Hip Hop. MUSIC / Genres & Styles / Reggae MUSIC / Genres & Styles / Rock MUSIC / Genres & Styles / Rock. MUSIC / Genres & Styles / Soul & R 'n B. MUSIC / History & Criticism MUSIC / History & Criticism. MUSIC / History & Criticism. MUSIC / History ; Criticism. MUSIC / Individual Composer & Musician MUSIC / Individual Composer & Musician. MUSIC / Instruction & Study / Appreciation MUSIC / Instruction & Study / Composition MUSIC / Instruction & Study / General MUSIC / Instruction & Study / General. MUSIC / Instruction & Study / Songwriting MUSIC / Instruction & Study / Songwriting. MUSIC / Instruction & Study / Theory MUSIC / Instruction & Study / Theory. MUSIC / Instruction & Study / Voice MUSIC / Instruction & Study / Voice. Music / Italy / 16th century / History. MUSIC / Lyrics MUSIC / Lyrics. MUSIC / Musical Instruments / Guitar. MUSIC / Musical Instruments / Piano & Keyboard MUSIC / Musical Instruments / Piano & Keyboard. MUSIC / Musical Instruments / Strings MUSIC / Musical Instruments / Strings. MUSIC / Philosophy & Social Aspects. MUSIC / Printed Music / Percussion MUSIC / Printed Music / Percussion. MUSIC / Printed Music / Vocal MUSIC / Printed Music / Vocal. MUSIC / Recording & Reproduction MUSIC / Recording & Reproduction. MUSIC / Reference MUSIC / Reference. MUSIC / Religious / Christian MUSIC / Religious / General MUSIC / Religious / Jewish music academy music aesthetics music amateurism Music and anthropology. Music and antisemitism Music and antisemitism. Music and architecture. Music and aristocracy Music and children Music and children. Music and crime. Music and Culture (Music) Music and dance Music and dance. Music and diplomacy Music and diplomacy. Music and geography Music and geography. Music and globalization Music and globalization. Music and history Music and history. Music and identity politics. Music and intergenerational communication. Music and language Music and language. Music and literature Music and literature. Music and magic Music and magic. Music and Media (Music) Music and medicine Music and mythology Music and older people. music and painting Music and philosophy Music and philosophy. Music and politics music and potry Music and race Music and race. Music and rhetoric. Music and science Music and science. Music and sports. Music and state Music and state. Music and technology Music and technology. Music and text Music and the conflict. Music and the Internet Music and the Internet. Music and the war. Music and tourism Music and tourism. Music and transnationalism Music and transnationalism. Music and war Music and war. Music and youth Music and youth. Music appreciation Music appreciation. Music archaeology Music archaeology. music archive Music as recreation. music association Music Association of Ireland Music audiences. Music avantgarde Music Biographies (Music) Music by African American composers Music by African American composers. Music by black composers Music by women composers Music by women composers. Music chapells Music collections Music criticism Music critics Music critics New Zealand biography Music critics. music dictionary Music Documentation Music Drama Music Education Music education; Pedagogy music esthetic Music fans Music fans. Music festivals Music festivals. Music for people with mental disabilities. Music for people with visual disabilities. Music for the developmentally disabled. Music for the hearing impaired. Music history Music history and criticism music history in Hungary Music History; Occult sciences; Secret societies Music in advertising Music in advertising. Music in art Music in art. Music in Christian education Music in churches Music in churches. Music in Dubrovnik Music in education Music in education. Music in historic house museums. Music in intercultural communication Music in intercultural communication. Music in literature. Music in prisons Music in prisons. Music in synagogues Music in the Bible Music in the Bible. Music in the home Music in the home. Music in the theater Music in the theater. Music in universities and colleges Music in universities and colleges. Music instruction and study Music Instruments Music journalists Music journalists. Music libraires Music librarians Music librarians. Music librarianship Music librarianship. Music libraries Music libraries. music life Music life history music life in Hungary Music Linguistics Music Management. Music manuscripts Music memorizing. music migrations Music museums Music museums. Music New Zealand Auckland history and criticism music New Zealand Invercargill history and criticism Music patronage Music patronage. music pedagogy Music performance Music printing Music printing. Music publicity Music publicity. Music publishers Music publishers. Music publishing Music publishing. Music recording & reproduction. Music reviews & criticism. Music rooms and equipment music school Music stores Music students Music study and teaching New Zealand Christchurch history Music teachers Music teachers New Zealand biography Music teachers. Music teaching Music television Music thanatology. Music theater Music theater. Music Theatre New Zealand Auckland History Music theorists Music theory Music theory. Music therapists Music therapy Music therapy for children Music therapy for children. Music therapy for families Music therapy for older people. Music therapy for teenagers. Music therapy New Zealand Case studies; Music therapy; New Zealand poetry 21st century Music therapy. Music trade Music trade New Zealand Music Trade New Zealand 20th Century Music trade. Music videos Music videos. Music › Genres & Styles › Pop Vocal Music, Greek and Roman Music, Greek and Roman. Music, Influence of Music, Influence of. Music, Slovenian Music--20th century--Analysis Music--21st century--Analysis music--instruction and study--New Zealand; Educational change--New Zealand; Education Music--Latin America Music-halls Music-halls (Variety theaters, cabarets, etc.) Music-halls (Variety-theaters, cabarets, etc.) music-halls New Zealand 20th Century Music-halls. Music. Music: Genres & Styles / Classical. Music: History & Criticism. Music: Individual Composer & Musician. Music: styles & genres. Musica ficta. Musical ability in children Musical ability. Musical accompaniment Musical accompaniment. Musical aesthetics Musical analysis Musical analysis. Musical applications Musical applications. Musical bow Musical canon Musical canon. Musical chapells Musical creation Musical criticism Musical criticism. Musical dictation. Musical education Musical Encoding Musical films Musical films. Musical form Musical genres Musical groups Musical groups. Musical heritage management Musical heritage; Oral tradition; Ethnousicology musical instrument Musical instrument collections Musical instrument makers Musical instruments Musical instruments & instrumental ensembles. Musical instruments collections Musical instruments, Ancient Musical instruments. Musical instruments; Archeological sources; Islamic art; Al-Andalus Musical intervals and scales Musical intervals and scales. Musical inventions and patents. Musical landmarks Musical landmarks. Musical Libraries musical life Musical manuscripts Musical memory Musical meter and rhythm Musical meter and rhythm. musical migrations Musical New Zealand Auckland history Musical notation Musical notation. musical papers Musical perception Musical perception. musical performance Musical pitch Musical practice Musical scores, lyrics & libretti Musical settings Musical settings. Musical sources Musical structure musical tales Musical teaching Musical temperament Musical temperament. Musical theater Musical theater producers and directors Musical theater. Musical theatre New Zealand Auckland history Musical thought Musicalproduktion Musicals Musicals New Zealand Auckland History Musicals. Musician angels Musicians Musicians -- New Zealand -- Biography. Musicians -- New Zealand -- Portraits. Musicians -- New Zealand -- Tauranga -- History. Musicians as artists. Musicians as authors. Musicians Career Musicians Musicians in art Musicians in art. Musicians Interviews Musicians with disabilities Musicians with disabilities. Musicians' spouses. Musicians. Musiciennes Musiciennes country Musiciennes de jazz Musiciennes de jazz. Musiciennes. Musiciens Musiciens artistes. Musiciens country Musiciens country noirs américains. Musiciens d'orchestre Musiciens dans l'art. Musiciens de bluegrass Musiciens de jazz Musiciens de rhythm and blues Musiciens de rock alternatif Musiciens homosexuels. Musiciens noirs americains Musiciens noirs américains Musiciens rock Musiciens rock. Musiciens sourds. Musiciens transgenres. Musiciens. Musicologie Musicologie. Musicologists Musicologists. Musicologists; Felipe Pedrell Musicologists; Lothar Siemens Musicology Musicology. Musicology; Cultural history; José Subirá Musicology; Latin studies; Colonial Period Musicology; Music pedagogy Musicotherapy Musicothérapeutes Musicothérapie Musicothérapie pour personnes âgées. Musicothérapie. musictheory Musictherapy; Medicine Musik Musik i massmedia Musikinspelningar – historia Musik och samhälle – historia Musik Musikhistoria Musik och dans Musik och samhälle Invandrare Musiksociologi Folkmusik – sociala aspekter Musik och samhälle Musikframträdanden Koreografi Genus (socialt kön) Gester – sociala aspekter Gester – genusaspekter Musik och samhälle-- historia Musik-- historia Musik-- idéhistoriska aspekter Musik-- sociala aspekter Musik-- teori, filosofi Musik. Musik/Mittelalter. Musikalische Analyse Musikalische Semiotik. Musikalität Musikalitet Musikalitet Sinnen och förnimmelser Musikanschauung Musikdruck Musiker Musiker Ungdomar Datorspel Digitalisering Musikundervisning Musiker-- genusaspekter Musiker-- historia Musikethnologie Musiketnologi Musikfestivaler Musikfilosofi Instrumentalmusik Musikforskare Museimän Folkhögskolelärare Musikgeschichte. Musikgrupper – historia Musikhistoria Musikhistoria Klassisk musik Barockmusik Reception Musikhistoria Orkester – historia Kör – historia Musikhistoria Reformationen och konst Hymner Psalmer Psalmer (musik) Musikhistoria. Musikhören Musikinspelning Konserter (form) Musikinspelningar-- historia Musikinstrument Musikjournalismus. Musikkritik Musikkritikerin Musiklärare Musikleben Musikmuseer och instrumentsamlingar Musikphilosophie. Musikpolitik Musikproducenter Musikproduzent Musikprogram Musikpsykologi Musikrörelsen Musikskolor Kulturskolor Musiksociologi Musiksociologi Musikanläggningar – historia Ljud{\aa}tergivning – historia Musikteori Musikteori. Musiktheorie Musiktheorie. Musikundervisning Musikundervisning Grundskolan Musikundervisning Grundskolan Lärarutbildning Musikundervisning Social rättvisa Musikundervisning-- historia Musikundervisning. Musikvetenskap Musikvetenskap Musik – teori Musikvetenskap. Musikwahrnehmung Musikwirtschaft Musikwissenschaft. Musique Musique (Loisirs) Musique à programme. Musique cajun Musique carnatique Musique celtique Musique chorale Musique concrète Musique concrète. Musique d'église Musique dans les prisons. Musique de chambre Musique de compositeurs noirs américains Musique de compositrices Musique et architecture. Musique et criminalité. Musique et diplomatie Musique et enfants Musique et enfants. Musique et guerre. Musique et histoire Musique et histoire. Musique et Internet. Musique et langage. Musique et littérature Musique et littérature. Musique et mondialisation Musique et philosophie Musique et philosophie. Musique et politique. Musique et race Musique et race. Musique et sciences Musique et sciences. Musique et technologie Musique et technologie. Musique expérimentale Musique expérimentale. Musique folklorique Musique hindoustani Musique industrielle Musique industrielle. Musique mesurée. Musique patriotique Musique populaire Musique pour groupes Musique psychédélique Musique religieuse Musique répétitive Musique sérielle. Musique traditionnelle Musique underground Musique vocale Musique. Musiques du monde Muskuloskeletala systemet. Muwashshah Muwashshah. muziekonderwijs. Muziektherapie Múscia. Música Música- Música. Münchner Biennale Für Neues Musiktheater. Mythology, Greek, in music. Mythology, Japanese Mœurs et coutumes. N.Z) history Narration (Rhetoric) Narrative Narrative in music. National characteristics in motion pictures. National characteristics, American. National characteristics, British National characteristics, British. National characteristics, English. National characteristics, German. National characteristics, Irish. National characteristics, Portuguese. National characteristics, Spanish. national in music National music National music. National socialism National socialism and motion pictures. National socialism and music. National socialism in popular culture. National socialism. National songs National-socialisme et musique Nationalbewusstsein Nationalbewusstsein. Nationalhistorical Opera Nationalism Nationalism in music Nationalism in music. Nationalism in opera. Nationalisme dans la musique Nature Nature and nurture. Nature dans la musique. Nature in popular culture. Nature sounds. Navarra Nazism och musik Nazism och musik. Nazisme Nazisme et musique. ndlsh Near-death experiences. Necrologies. Negro spirituals Neil W. (Neil Willas) Nentsy Neo-Nazism. Neoliberalism Netherlands Neue Musik. Neural networks (Computer science) Neurobiología Neurobiology. Neurofisiología. Neurofysiologi Neurosciences Neurosciences cognitives. Neurosciences. Neurovetenskap New England New Guinea. New Irish Chamber Orchestra New Jersey New Mexico new music New Music. New South Wales New South Wales, Northwestern. New Spain New wave music New wave music. New York (État) New York (State) New Zealand New Zealand biography New Zealand Copyright Act 1994 New Zealand social life and customs 20th century New Zealand Symphony Orchetsra anecdotes: Violists Netherlands Biography; Violists New Zealand biography New Zealand. Newar (Nepalese people) Newfoundland and Labrador Newfoundland and Labrador. Newspaper editors Newspaper publishing Ngyemboon (African people) Nick; Musicians - New Zealand - Biography; music journalists - New Zealand - biography; popular music - New Zealand - 1971 - 1980 Nicolás Ledesma Nielsen, Carl, 1865-1931 Nigeria Nigeria. Night. Nightclubs Nightingale Nightingale. Nightlife. Nihon-Rekishi-Azuchi momoyama jidai. Nihon-Rekishi-Meiji jidai. Nihon-Rekishi-Muromachi jidai. Nihon-Rekishi-Taishō jidai. Nihon-Taigai kankei-Roshia. Nikola Šubić Zrinjski Nikola Šubić Zrinjski in arts Nikola Šubić Zrinski Nikola Zrinski = Miklós Zrinyi VII Nimmo Nineteen eighties. Nineteen fifties Nineteen seventies. Nineteen seventy-three, A.D. Nineteen sixties Nineteen sixties. Nineteen sixty-eight, A.D. Nineteen sixty-four, A.D. Nineteen sixty-nine, A.D. Nineteen sixty-seven, A.D. Ningyō jōruri-Rekishi-Nenpyō. Ningyō jōruri. Nitchū sensō. nli nlksh Noël, Musique de Noirs américains Noirs américains dans la culture populaire. Noise Noise (Musique) Noise (Philosophy) Noise in art. Noise music Noise music. Noise rock (Music) Noise. Non material heritage Norberto Almandoz North America North America. North Carolina Northern Ireland Northern Ireland. Norway Nostalgia in motion pictures. Nostalgia in music. Notation Note Nouvelle-Zélande Nouvelle-Zélande. Nova Scotia Nova Scotia. novi val <rock glazba> - Jugoslavija Nō Nō music Nō music. Nō plays Nō plays. Nō. Nōgaku-Rekishi. Nōgaku. Nōkan Nōkan. Nuclear weapons Nuns Nuns. Nyckelharpa Nyckelharpa Instrumenttillverkning (musikinstrument) Instrumentmakare (musikinstrument) Nystroem, Gösta, 1890-1966 NZ) ; women musicians New Zealand Biography Obituaries. Oboe Oboe players Oboe players. Occupation militaire Occupied territories. Ocean Ocean. Odes, Italian Office divin (Musique) Ohio Oiseaux Old age homes old Hungarian melodies Old-time music Old-time music. older men Older musicians Older musicians. Older people Olive Smith One-hit wonders. Ongaku kyōiku-Benran. Ongaku kyōiku. Ongaku ryōhō. Ongaku-Afurika. Ongaku-Chūgoku. Ongaku-Nihon. Ongaku-Wasei. Ongaku. Ongakuka. Ongakukai. Online social networks Ontario Open access Oper Opera Opera -Spain Opera and transnationalism Opera and transnationalism. Opera audiences opera characters. Opera coaching. Opera companies Opera companies. Opera company executives Opera composers; Dramaturgy; Giacomo Puccini Opera Dans Naturen – i operan Opera in art. Opera in popular music. Opera Kvinnliga tonsättare Opera Missisauga opera Mozart opera Nikola Šubić Zrinjski Opera programs Opera programs. Opera singers Opera singers New Zealand biography Opera singers; Biographies opera tales opera Zrinyi Opera – historia Opera-- historia Opera--Spain Opera. Opera; Contemporary Music; Work analysis; Moses und Aaron Operalibretto Dramaturgi Operas Operas instruction and study Operas, Chinese Operas. Operasångerskor Operas{\aa}ngare Operatunity (musical group) history Operetta Operetta. Operngestalt operní postavy. opery Opéra Opéra comique Opéra comique. Opéras Opéras français Opérette Opérette. Optical data processing. Oral communication. Oral poetry; Secular music Oral tradition Oratorios orchestra Orchestra. Orchestral conducting Orchestral music Orchestral music. Orchestral music; Musical analys; Ravel's Bolero Orchestral musicians Orchestre Orchestre, Musique d' Orchestres symphoniques Oreille organ Organ (Musical instrument) Organ (musical instrument); Organ (musical instrument) anecdotes; Organists anecdotes; Setchell Organ builders Organ builders. Organ music Organ music. Organ notation Organ pipes Organ pipes. Organette Organistes Organists Organists. Organizational change. Organized crime Organized crime. Organology Organs Orgel Orgel-- historia Orgel. Orgelbyggare orglar Orglar. Orgue Orientalism Orientalism in music Orientalism in opera. Orientation professionnelle. Origin. Originalité dans la littérature. Originality in literature. Orishas. Orkestrar Amatör- och hobbyverksamhet Pedagogik Orthodoxy Oto. Otter hunting Outlaws in music. Outlines, syllabi, etc. Ouvrages illustrés. Overture Overuse injuries Oz (Imaginary place) P'ansori Pacific Coast (U.S.) Pacific Islander American opera company executives Pacifique, Côte du (États-Unis) Package tours Package tours. Packaging Painters Painters; Joan Miró Painting, British Pakistan. Palau Paleography, Musical Paleography, Musical. Palestine Palestine. Palliative treatment. Pan-Hispanism. Panjabis (South Asian people) Pantomimes. Papal courts. Papau New Guinea Papua New Guinea Parapsychologie Parapsychology Parapsychology. Parent and child Parenting Parenting. Parents of autistic children Parkinson's disease Paroliers Pärt, Arvo, 1935- Partimenti. Partitions. Partiturläsning Parts. Pasticcio Patients Patients. Patriotic music Patriotic music. Patronage Pavle Stefanović (1901-1985) Pays musulmans. Paysages sonores (Musique) Pâturins Peadar Ó Riada Peak experiences. Pedagoger Pedagogical forum of Performing Arts Pediatrics. Penmanship Penmanship. Pennsylvania Pentecostal churches Pentecostal churches. People with disabilities and the performing arts. People with disabilities in music. People with social disabilities People with visual disabilities Per Brahe den yngres hovkapell Perception de la musique. Perception in animals. Percussion ensembles Percussion ensembles (Musical groups) Percussion ensembles. Percussion instruments Percussion instruments. Percussion music Percussion Music New Zealand Percussion music. Percussionists Percussionists New Zealand biography Percussionists. Percy French Performance Performance art Performance art. Performance artists Performance poetry Performance poetry. Performance practice (Music) Performance. Performances Performances. Performing Performing arts PERFORMING ARTS / Acting & Auditioning PERFORMING ARTS / Business Aspects PERFORMING ARTS / Dance / Classical & Ballet. PERFORMING ARTS / Film & Video / History & Criticism PERFORMING ARTS / General PERFORMING ARTS / General. PERFORMING ARTS / Reference PERFORMING ARTS / Television / History & Criticism PERFORMING ARTS / Theater / Broadway & Musical Revue PERFORMING ARTS / Theater / General PERFORMING ARTS / Theater / History & Criticism PERFORMING ARTS / Theater / History & Criticism. Performing arts festivals Performing arts. Pergament, Moses, 1893-1977 Periodicals Periodicals. Persephone (Greek deity) Persona (Psychoanalysis) Personal archives Personal Memoirs. Personal narratives. Personnages. Personnes âgées Personnes noires Persuasion (Rhetoric) Peter -- Influence. Choral conductors -- New Zealand -- Biography. Choirs (Music) -- New Zealand -- History. Choral singing -- New Zealand -- History Peterson-Berger, Wilhelm, 1867-1942 Pédagogie culturellement adaptée. Pédales d'effets Phänomenologie Phenomenology and music. Phenomenology. Phil Coulter Philip Lynott Philippines. Phillips, Martin, 1963-exhibitions Philology Philosophie et esthetique. Philosophie et esthétique Philosophie et esthétique. Philosophie. Philosophy Philosophy and aesthetics Philosophy and aesthetics. Philosophy od Dance philosophy of music Philosophy, Ancient. Philosophy, German Philosophy, German. Philosophy. Philosophy: aesthetics. Phonograph Phonograph. Photograph collections. Photographers Photographers. Photography Photography & photographs PHOTOGRAPHY / Collections, Catalogs, Exhibitions / General PHOTOGRAPHY / Subjects & Themes / Celebrity. Photography, Artistic. Photography. Physical fitness for children. Physicians in opera. Physicists Physiological aspects Physiological aspects. Physiological effect. physiology. Pianister Pianistes Pianists Pianists. Pianists; Women in music; Biographies Piano piano festival Piano makers Piano makers. Piano mécanique Piano mécanique, Musique de Piano music Piano music (1 hand) Piano music (Boogie woogie) Piano music (Jazz) Piano music. Piano music; Piano players; Musical education Piano scores. Piano teachers Piano teachers New Zealand biography Piano teachers. Piano with instrumental ensemble Piano with instrumental ensemble. Piano, Musique de Piano, Musique de (1 main) Piano. Pianola rolls Pictorial works Pictorial works. Pilar Bayona Pioneers Pipe bands Piracy (Copyright) Pirate radio broadcasting Pirated editions Pisma Pitjantjatjara language C6. Place (Philosophy) Place (Philosophy) in music. Plagiarism in music Plagiarism in music. Plague Plane chant Planning. Plantation life Plasticité neuronale. Platinisme. Plato Play Play. Player piano Player piano music Player piano music. Player piano. Plogman, Charles, 1966- Poeter Poetry Poetry. Poets Poets, American Poets, Canadian Poets, Canadian (English) Poets, Canadian 20th Century Poets, English Poets, Italian Poets, Italian. Poets, Welsh Poets. Poètes italiens Poésie française Poésie syrienne Poétesses pohřby Pojkar Poland Poland. Polical aspects. Police Police chiefs Police chiefs. Poliphony political action. Political activity Political activity. Political and social views Political and social views. Political aspects Political aspects. Political ballads and songs Political context Political culture POLITICAL SCIENCE / International Relations / Diplomacy POLITICAL SCIENCE / Public Policy / Cultural Policy political songs. Political Transition Politicians Politics Politics and culture Politics and government. politics and music Politique culturelle. Politique gouvernementale Politique gouvernementale. Politisches Engagement Politisk musik historia Politisk musik Musik – politiska aspekter Politiska aspekter. Polka (Dance) Pologne Polskor-- historia Polyphonic chansons Polyrhythm. Pop Feminism och musik pop music pop music in Hungary Pop-- historia Pop-Culture Poplular music Popmusik Popmusik-- historia Popular culture Popular culture. Popular music Popular Music (Music) Popular music 1962-1970; Popular music 1971-1980; Popular music Australia Discography; Popular music New Zealand Discography; Popular music history and criticism Popular music and art music. Popular Music Australia history and Criticism popular music Croatia Popular music fans. Popular music genres Popular music genres. popular music New Zealand History Popular MUsic New Zealand history and Criticism Popular music writing and publishing problems Popular music, easy listening. Popular music. Popular works. Popular-music archives Popular-music archives. Populärmusik Judar i musiken Populärmusik Kvinnliga musiker Pop Pop – genusaspekter Populärmusik-- genusaspekter Populärmusik-- politiska aspekter -- historia Populärmusik-- sociala aspekter popularna glazba - Hrvatska - diskografije Populärmusik Portrait photography. Portraits Portraits. Portugal Portugal. Portuguese influences. Portuguese-speaking countries. Positive psychology. Post-punk music Post-punk music. Postcolonialism and music Postcolonialism and music. Postcolonialism and the arts Postcolonialism. Postcolonialisme et musique. Posters Posters, British. Posters. Posthumanism. Postmodernism. Power (Social sciences) Practicing (Music) Pratique de l'exécution (Musique) prayers Prayers and devotions Prayers and devotions. Preschool music Press Press - Spain Press secretaries prevention & control Prevention. Prédicateurs Présentation de soi. Primary Primitive and early church, ca. 30-600. Printed Music Printers Prisoners and prisons, Austrian. Prisoners and prisons, British. Prisons Private collections Private collections. Private schools Problem children Problem youth Problems, exercises, etc. Process control. Process theology. Processionale. Processionals (Liturgical books) Processions, Religious. Producteurs d'enregistrements sonores Producteurs et réalisateurs de cinéma Production and direction Production and direction. Production et mise en scène Production et réalisation Production music Productivité Professeurs de chant Professeurs de chant. Professeurs de musique Professeurs de violon Proggrock Proggrock Musikrörelsen Musiksociologi Musikgrupper – historia Program music Programmes d'études Progressive rock music Pronunciation. Propaganda Propaganda-- historia Propaganda. Prosodic analysis (Linguistics) Protection Protection. Protest movements Protest movements. Protest songs Protest songs. Protestant churches. Protestantism & Protestant Churches. Protestsånger-- historia Protestsong Prothèses auditives. Provenance Provenance. Psalmer Psalmhistoria Teologi Psalmody Psalmody. psalms Psalms (Music) Psicology of music psihološka karakterizacija likova Psychanalyse et musique. Psychedelic rock music Psychedelic rock music. Psychic trauma Psychic trauma in children Psychic trauma in motion pictures. Psychoacoustics. Psychoanalyse Psychoanalysis and music. Psychoanalysis. Psycholinguistics. Psychological aspects Psychological aspects. Psychological testing. Psychologie Psychologie du soi. Psychologie. Psychology PSYCHOLOGY / Cognitive Psychology PSYCHOLOGY / History PSYCHOLOGY / Mental Health. PSYCHOLOGY / Psychotherapy / General. Psychology of Music Psychology. Psychology: emotions. Psychotherapy and music. Psychotherapy. Psychothérapie et musique. Public worship Puerto Ricans Puerto Ricans. Punk Punk (Mouvement) Punk (Musique) punk - Jugoslavija - 1977/1980 Punk culture Punk culture. Punk rock Punk rock music Punk rock music - New Zealand - pictorial works Punk rock music. Punk rock music; Political context Punk rock musicians Punk rock musicians. Puppeteers Puppeteers. Puropaganda. Puyana Qi (Chinese philosophy) Qin music Qin music. quality of life Quantum computing. Quantum theory Quatuor à cordes. Quatuors sacrés a cappella. Queensland Queer musicology. Querelle des Bouffons. Questions and answers. Québec (Province) Quotations Quotations, maxims, etc. Quotations. Qupai. Race au cinéma. Race à l'opéra. Race identity Race identity. Race in motion pictures. Race in musical theater. Race in opera. Race relations. Racism in language Racism in language. Radiation Radicalism in music. Radio and music. Radio broadcasters Radio broadcasters. Radio broadcasting Radio broadcasting. Radio in popular culture Radio in popular culture. Radio in propaganda Radio in propaganda. Radio programs, Musical Radio stations Radio stations. Rafael Rafael Puyana Raga Raga. Ragas Ragtime music Railroad travel Railroads ram Rap (Music) Rap (Musique) rap music Rap musicians Rap musicians. Rapanui (Easter Island people) Rappeurs Rappu(Ongaku) Raukar Mladen Rave (Subculture) Rave culture Rave culture. Razgovori Rāga (Compositions musicales) Rāga (Forme musicale) Readers Readers. Rebetika Rebetika. recepcion Recherche record history Record labels Record labels. Recorded accompaniments (Drum set) Recorder (Musical instrument) Recording & Reproduction. Recording and reproducing Recording and reproducing. Recovering alcoholics REFERENCE REFERENCE / Bibliographies & Indexes Reference librarians Reference. Reformation Reformationen. Refugees Refugees. Reggae Reggae music Reggae music. Reggae musicians Reggae. Regionalism Regionalism in music. Regionalism. Registers. Rehabilitation. Reinassance Relations with Jews. Relations with women. Religion RELIGION / Christianity / General. RELIGION / Christianity / Theology / General RELIGION / Ethics RELIGION / General RELIGION / Islam / History. RELIGION / Spirituality Religion. Religion: general. Religions - Christianity. Religiös musik Musik – religiösa aspekter Religious Religious aspects Religious aspects. Religious drama, French religious history Religious songs Remix Remixes Remixes. Remixing Remixing. Renaissance Renaissance. rennaisance Rennnaisance reo reo Maori (New Zealand people) Music repatriace Repatriation Repatriation. repertory Repetition in music. Reprises de chansons Republic Spain rero Research research history Research Institutions Research. Researchers Resilience (Personality trait) Restaurering-- historia restoration Retro (Style) in popular music. reviewer Reviews Reviews. Revivals Revivals. Revues Rezeption Réalité mixte. Réalité virtuelle. Récit filmique. Rédacteurs en chef Réformatrices sociales noires américaines Réforme. Régionalisme dans la musique. Résilience (Trait de personnalité) Rhyming games. Rhythm and blues music Rhythm and blues music. Rhythm and blues musicians Rhythm and blues musicians. Rhythm. Rice planting rites Rice planting rites. Ritchie Rites and ceremonies Ritsuryo shinsho. Ritual Ritual dances Rituals Rituals. Rizumu. Rock Rock & Pop music Rock & Pop music,Individual composers & musicians, specific bands & groups,Music reviews & criticism. Rock & Pop music,Music,Literature & literary studies. Rock & Pop music. Rock & Pop music Rock (Musique) Rock alternatif rock and roll Rock concerts Rock concerts New Zealand pictorial works Rock concerts. rock glazba - Hrvatska - enciklopedije rock glazba - Jugoslavija - 1977/1983. Rock groups Rock groups - New Zealand - History Rock groups. Rock music Rock Music New Zealand Christchurch Interviews Rock music $z Canada $x History and criticism. Rock music - Croatia Rock music - New Zealand - pictorial works Rock music -- New Zealand -- Christchurch -- History -- 20th century -- Pictorial works. Rock music England History and criticism Rock music fans Rock music festivals Rock music festivals. Rock music in art. Rock music New Zealand Rock music New Zealand History Rock music United States history and criticism Rock music. Rock musicians Rock musicians - Australia - Biography. Rock musicians - New Zealand - biography Rock musicians England Rock musicians New Zealand biography Rock musicians New Zealand pictorial works Rock musicians' spouses Rock musicians' writings. Rock musicians. rock poezija - Hrvatska - antologije popularna glazba - tekstovi Rock-- historia Rockabilly music Rockabilly musicians Rockabilly musicians. Rockabilly subculture Rockabilly subculture. Rockmusik Rockmusik-- historia Rockmusiker Romances (Music) Romania Romanies Romanies. romantic topos Romanticism Romanticism in music Romanticism in music. Romanticism. Rome Rome (Italy) Rory Gallagher Roscrea Rotorua Branch History Royal Courts Rôle parental. Rôle selon le sexe dans la musique. Rugs Rugs. Rural development Rural journalism Russia Russia (Federation) Russia. Russian Russian opera Russie Ruždjak Marko Ryukyuans Sacred & religious music. Sacred music Sacred music. Sacred music; Contemporary music; Avantgarde Sacred songs Sacred songs. Sacred vocal ensembles, Unaccompanied. Sacred vocal music Sacred vocal music. Sacred vocal quartets, Unaccompanied. Saibara Saibara. Saigai fukkō. Sailors Saint Cecilia's Day Saint Cecilia's Day. Saitamaken Salamanca (Spain) Salons Salons littéraires Salons. Salsa Salsa (Music) Salvationists Sambas Sammlung Sampler (Musical instrument) Samurai Sångare Sånger Sångerskor Sångrösten – genusaspekter Sångteknik – genusaspekter Sångtexter-- historia Santé et hygiène. sao Saxofonister Saxophone music Saxophonistes Saxophonists Saxophonists. Sänger. Scandinavia Scandinavia. Scapigliatura scenic works Scenisk konst Schenkerian analysis Schenkerian analysis. Schizophrenics Schlager Visor Scholar Music Scholar Music; Folklore; Musical influence; Béla Bartók; Manuel de Falla Scholarships, fellowships, etc. school dramas School music Schultheater SCIENCE / Acoustics & Sound Science fiction Science fiction in music. Science fiction. Science-fiction dans la musique. Science-Fiction-Film Science-Fiction-Literatur Sciences sociales. Scores Scores. Scotland Scotland. Scots Scottish Gaelic language Scottish Travellers (Nomadic people) Scottish wit and humor, Pictorial. Sea songs Seán Ó Riada sears Sebastián Durón Sebő Ferenc Secondary secondary education. secondary--Curricula--New Zealand Seishin bunseki. Sekaishi-Nijisseiki. Sekkyō jōruri. Sekkyōbushi. Selbstbezüglichkeit Self Psychology Self psychology. SELF-HELP / Creativity. SELF-HELP / Substance Abuse & Addictions / General. Self-presentation. Self. Semantics semiotics Semiotics. Senegal Senritsu. Senses and sensation Sentimentalism in music. Sequencer (Musical instrument) Serbian composers Serbian folk music Serbian music Sergiu Celibidache serial music. Serialism (Music) Service books (Music) Services for. Sevilla Cathedral Sex Sex and popular music. Sex discrimination against women. Sex in music Sex in music. Sex in opera. Sex in popular culture. Sex on television. Sex role in music. Sexism in music. Sexual minorities Sexual minorities in popular culture Sexual minorities in popular culture. Sexual minority culture Sexuelle Orientierung sfit Shakespeare Shamanism Shamisen music Shamisen music. shashinshū sheet music Shinto Shinto shrines Shinto shrines. Shoes Show business; Music life; Propaganda; Spanish Civil War Shōka. Shōmyō Shōmyō. Shroff Shūjigaku. Sibelius, Jean, 1865-1957 Sibyls Siècle des Lumières Sight-reading (Music) Sight-singing. Siglo XX. Silent film music Silk Road Simulcasting of opera. Singapore Singapore. Singen Singers Singers $z Canada $v Biography Singers New Zealand singers New Zealand biography Singers, Canada Singers. Singing Singing education Singing games. Singing group Singing in motion pictures. Singing instruction and study Singing technique gender aspect Singing. Singspiel. Singstimme Sitar players Ska (Music) Skådespelare Skillingtryck Skillingtryck Tryckerier – historia Skivbolag-- historia Skivomslag-- historia Slagverk Slagverkare Slavery Slaves Slovenia Slovinsko Soccer Soccer fans Social & cultural history. Social action Social action. Social aspects Social aspects. Social change Social change. Social classes. Social conditions Social conditions. Social conflict Social constructionism. Social interaction Social interaction in infants Social isolation. Social justice Social justice and education Social justice and education. Social justice. Social life and customs Social life and customs. Social media Social media. Social movements Social networks. Social Psychology. Social reformers Social Science SOCIAL SCIENCE / Anthropology / Cultural SOCIAL SCIENCE / Anthropology / General SOCIAL SCIENCE / Ethnic Studies / African American Studies SOCIAL SCIENCE / Ethnic Studies / American / African American & Black Studies. SOCIAL SCIENCE / Ethnic Studies / American / Hispanic American Studies. SOCIAL SCIENCE / Ethnic Studies / General. SOCIAL SCIENCE / Folklore & Mythology SOCIAL SCIENCE / Folklore & Mythology. SOCIAL SCIENCE / Gay Studies SOCIAL SCIENCE / Gender Studies SOCIAL SCIENCE / General SOCIAL SCIENCE / Media Studies SOCIAL SCIENCE / Media Studies. SOCIAL SCIENCE / Popular Culture SOCIAL SCIENCE / Sociology / General SOCIAL SCIENCE / Women's Studies Social Sciences Social sciences. Socialism and motion pictures Socialism and music. Socialist realism in music. Socialization. Societies, etc. Society Society & Social Sciences. Sociolinguistics Sociological aspects. Sociologie de l'éducation. Sociologie. Sociology Sociology of music Sociology of music; Urban music Sociology of music; War; Middle East Sociology of Religion. Sociology, Urban. Sociology. Söderholm, Olle, 1945-2001 Soft drinks Software engineering. Software Engineering/Programming and Operating Systems. Software samplers. Software sequencers. Software synthesizers. soldier Soldiers Soldiers. Solfeggio Solo albums (Sound recordings) Solo cantatas. Son (Philosophie) Sonata form. Sonata. Sonatas (Organ) Sonatas (Viola) Sonate Sones Song cycles Song cycles. Song festivals songbook Songbooks songcomposer Songs Songs (Low voice) with piano Songs and music Songs and music. Songs in literature. Songs with guitar. Songs, Cornish Songs, English Songs, English. Songs, French Songs, French. Songs, German Songs, German (Middle High German) Songs, German. Songs, Hebrew Songs, Irish Songs, Italian. Songs, Japanese Songs, Occitan. Songs, Old French Songs, Old French. Songs, Ryukyuan Songs, Ryukyuan. Songs, Scots Songs, Scottish Gaelic Songs, Scottish Gaelic. Songs. Songsters Songwriters; Political Commitment; Francoism Sopranos (Chanteurs) Sopranos (Singers) Soul music Soul music. Soul musicians Sound Sound (Philosophy) Sound Archives Sound Archives; Private collections; Piano rolls Sound art Sound art. Sound effects. Sound engineers Sound engineers. Sound in art Sound in art. Sound in motion pictures. Sound installations (Art) sound installations. Sound recording executives and producers Sound recording executives and producers. Sound recording industry Sound recording industry - New Zealand - History Sound recording industry New Zealand Sound recording industry. Sound recordings Sound recordings Album covers New Zealand Exhibitions Sound recordings for English speakers. Sound recordings in musicology Sound recordings in musicology. Sound recordings. Sound recordings; Fernández-Shaw Sound Studies. Sound studios. Sound. Sounds Sounds. Soundscapes (Music) Soundscapes (Music); Middle Age; Reinassance Soundtracks Soundtracks; Movies source description Sources. South Africa South Africa. South America South Asia. South Asians South Carolina Southeast Asia Southeast Asia. Southern States Southern States. Soviet Union Soviet Union. Soziale Gerechtigkeit Spain Spain. Spanish Civil War Spanish Civil War; Songs; Propaganda Spanish generation of 27 spanish guitar Spanish language Spanish poetry Spanish songs Special education Special education. Special needs Spectral music Spelmän Kvinnliga spelmän Folkmusik Spiritual healing. Spiritual life Spirituality. Spirituals (Songs) Split Split Enz (music group) Sportswriters Spouses Sprache Springhill Mine Disaster, Springhill, N.S., 1958 Springsteen, Bruce, 1949- Sri Lanka. Stage guides. Stage lighting. Stage managers Stage Music Stage music; Opera; Zarzuela; Dance Stage-setting and scenery Stage-setting and scenery. Stagehands Stagehands. Stahuljak Stalin prizes Stan Standards Stanley Stanley Brothers. Star Trek films Star Trek films. Star Trek television programs Star Trek television programs. Statistical methods. Statistical physics. Statistics. Statut juridique. Steel bands (Music) Step dancing Stereotypes Sterilization. Stil in Music Stolen generations (Australia) Stories, plots, etc. Storytelling Stradivarius violin Straightjacket Fits(musical group) Stratégie de marque. Stratocaster Stravinsky Streamad media Internet och musik Musikbranschen Företag – historia Streaming audio Street music Street music. Street musicians Street musicians. Stress management. String quartet String quartet--Congresses String quartet. String quartets Stringed instrument bows Stringed instrument makers Stringed instruments Student-centered learning. Student-owned business enterprises. Studies Studies and exercises (Rock) Studies and exercises. Studije Study and teaching Study and teaching (Early childhood) Study and teaching (Elementary) Study and teaching (Higher) Study and teaching (Middle school) Study and teaching (Secondary) Study and teaching. Study guides. Style Style manuals. Style, Musical Style, Musical. Style. Stylistic influence Subculture Subculture. Subjectivity in music. Sublime, The Sublime, The, in literature. Sublime, The, in music. Sublime, The. Substitute teaching Suburban life in popular culture Suburban life in popular culture. Subversive activities in mass media. Sufi music Sufi music. Sufism Suites (Harpsichord) Šulek Stjepan Suomi Surgical instruments and apparatus Surrealism and music Surrealism and music. sustainable development Svenska författare Svenska operas{\aa}ngerskor Operas{\aa}ngare Sverige Sverige-- Medelpad -- Timrå Sverige-- Småland -- Växjö Sverige-- Småland -- Visingsborg Sverige-- Stockholm Sverige-- Uppland Sverige-- Uppland -- Lövstabruk swd Sweden Sweden. Swing (Music) Switzerland Symbolism in music. Symbolism in opera. Symmetry Symphonic music Symphonic poem. Symphonies Symphonies (Chamber orchestra), Arranged Symphonies (Chamber orchestra), Arranged. Symphonism; Repertory Symphonism; Repertory; 20th Century; 21th Century Symphonism; Repertory; Ludwig van Beethoven Symphony Symphony orchestras Symphony orchestras. Symphony. Synagogue music Synesthesia Synthesizer (Musical instrument) Synthesizer music Synthétiseur Syrie. Szörényi Levente S{\aa}nger – historia Romanser – historia T-shirts Taarab (Music) Tables Tables. Taegŭm music Taegŭm music. Taegŭm. Taiko. Taiwan Taiwan aborigines Tales talijanski prepjev Tambour Tang Dynasty (China) Tango musicians. Tangos Tanzania Taoist music Taoist music. Tarot. Taube, Evert, 1890-1976 Taube, Sven-Bertil, 1934- Tài tử Tchèques Teacher-student relationships Teacher-student relationships. Teachers Teaching Teaching Methods & Materials Teaching pieces. Teaching. Technical aspects Technique Techno Techno music Technological innovations Technological innovations. Technologie éducative. Technology TECHNOLOGY / Acoustics & Sound Technology. Teenage girls Tejano music Tejano music. Tejano musicians Tejano musicians. Television Television actors and actresses Television and music Television and state Television broadcasting Television broadcasting of music Television broadcasting of music. Television broadcasting of sports Television comedies. Television composers Television composers. Television music Television music. Television personalities Television producers and directors Tempérament (musique). Tempo (Music) Temps Temps dans la musique. Temps. Tennessee tenors Tenors (Singers) Terminologie. Terminology. Terms and phrases. Testament Testing. Tests psychologiques. Texas Texas. Text Textbooks. Textes Textes. Texts Texts. Télévision et musique Télévision, Musique de Thailand Thailand. Thaïlande The arts: general issues. Theater Theater - Broadway & Musicals. Theater and society Theater and society. Theater and state Theater and state. Theater management Theater organ Theater programs Theater. Theaters Theaters. Theatre Royal thema Thematic catalogs (Music) Themes, motives. Theology Theology. Theory of Jazz Theory of music Theory of music & musicology. Therapeutic use. Theses Thèmes, motifs littéraires. Théâtre Théâtre (Genre littéraire) Théâtre et société Théâtre musical Théâtre musical contemporain Théâtre musical contemporain. Théologie. Théorie musicale Thin Lizzy Third stream (Music) Tiere timbre (acoustics concept) Timbre. Time Time in art. Time in music. Time. Tinie Tempah Tintype To 1400 To 1500 To 1500. To 1901 To 1931 To 1961 To 500. To 794 Tohoku Earthquake and Tsunami, Japan, 2011 Toledo Tom McBride Tonadilla Tonadillas. Tonalité Tonality Tonality. Tonåringar tone Tone color (Music) Tonewoods. Tonic sol-fa. Tonsättare Tonsättare Klassisk musik Tonsättare Korrespondens Tonsättare Kvinnliga tonsättare Tonsättare Musik – politiska aspekter Tonsättare Organister Barockmusik – historia Tonsättare Trubadurer Visdiktning – historia Tonsättare-- historia Tonsättare. Tonstudio Tony Torres Strait. Totalitarianism and music Totalitarianism and music. Tour guides (Persons) Tourism Tourism. Tourist guide Touristes Tourists Tourists. Tournées (Arts du spectacle) Toxicomanes Tōnan ajia. Traditional dance Traditional instruments traditional music traditional songs Traductions Training of. Trance (Underground dance music) Transgender artists Transgender artists. Transgender musicians Transgender musicians. transgenderism. Transgenrisme. Translating and interpreting Translations Translations into Latin. Translations into Spanish. Translations of choral works Translators Translators. Transpersoner Jämställdhet Könsidentitet Elektroakustisk musik Feminism och musik Musik och teknik Musikundervisning Transsexualism Traumatisme psychique Travel TRAVEL / United States / West / Mountain (AZ, CO, ID, MT, NM, NV, UT, WY) Travel in popular music. Travel writing. Travel. Treatment. Trials, litigation, etc. Tribute bands (Musical groups) Tricksters. Trinity College Dublin Trio sonatas Trio sonatas. Trombonistes Trombonists Trombonists. Trompette Troubadour songs Troubadours Trouvère songs. Trubadurer TRUE CRIME / Organized Crime. Trumpet Trumpet players Tuba Tuba. Tuk (Music) Tuning Tuning. Tunisia Tunisia. Turbo-folk (Music) Turcs dans la littérature. Turkey Turkey. Turkiet turkish folk music Turkish-Ottoman Music Culture Turks in literature. Turntablism Turntablism. Turntablists Turntablists. Twelve-tone system Twelve-tone system. Twentieth century. Types de voix (Chant) Tyskland Tyskland-- Berlin Ṭanbūr U boj, u boj Uilleann pipe Uilleann pipe music Ukraine. ukslc Ukulele Ukulele music (Rock) Ukulele music. Umweltfaktor Uncanny, The (Psychoanalysis) Underground dance music Underground music Underground music. Underground music; Music periodicals Underhåll Unemployment Unemployment in literature. unification of Italy United States United States in opera. United States. Universities and colleges unknown Unterhaltungsmusik Unterhaltungsmusik. Uppförandepraxis (musik) Musikhistoria Uppland Uppland-- Österlövsta socken (socken/stad) -- Lövstabruk (by/område) Urban life Urheberrecht URSS User interfaces (Computer systems) User Interfaces and Human Computer Interaction. usical engagement Uzbekistan. úmrtí. Van Morrison Vanuatu. Varaždin-glazba varhaníci Variety Shows, Music Hall, Cabaret Vaudeville Vendetta Vendetta. Veranstaltung Vercoe Verdi, Giuseppe Verism Versification. Vespers (Music) Vibration Vibration. Video catalogs. Video game composers Video game composers. Video game music Video game music. Video games Video recording Video recordings Videospielmusik Vie religieuse et monastique Vieillissement Vietnam Vietnam War, 1961-1975 Vietnam, Southern Vietnam, Southern. Vietnam. Viêt-nam (Sud) Villancicos (Music) Villes Viol music Viola and piano music Viola d'amore. Viola da gamba Viola da gamba music Viola music Violence in music. Violin Violin makers Violin music Violin music. Violin teachers Violin teachers. Violin. Violine Violinists Violinists in Hungary Violinists. Violists Violoncello Violoncello. Violoncellomusik Violoneux Violonistes Viols Virtual reality. Virtuosity in musical performance. Vissångare Visual communication Visual communication. Visualization. Vladimir (1869-1938) Vocal groups Vocal groups. Vocal improvisation (Music) Vocal music Vocal music. Vocalization Vocational education. Vocational guidance Vocational guidance. Voice Voice (Philosophy) Voice culture. Voice Disorders Voice disorders. Voice teachers Voice teachers. voice training Voice types (Singing) Voice. Voix Vokal jazz Manskvartett S{\aa}ngare Volkslied. Volksmusik Volkstümliche Musik Voyages and travels. Voyages à forfait Voyages. Vukovar výroba hudebních nástrojů. Wagner, Richard Wales Wales, South Wales. Walker Walking Waltzes Waltzes. War of Independence Washington (D.C.) Washington (State) Waterford Web-based instruction. Wedding music. Weddings well-being Well-being. Welsh Wennberg, Siv, 1944- West (U.S.) Western Western countries Western films Western films. Western influences. Western Sahara Western. White people White supremacy movements. Wiener Philharmoniker Wild women in literature. Wills. wind music wind orchester Wine Witch hunting Wizard rock Wolfe Tones (Musical group) Wolfgang Amadeus Woman composers biography Womanism. Women Women alternative rock musicians Women alternative rock musicians. Women authors Women authors, American Women authors. Women blues musicians Women civil rights workers Women civil rights workers. Women comedians Women composers Women composers New Zealand Biography Women composers, Black Women composers. Women composers; Biographies; Exile; María Teresa Prieto Women composers; Biographies; María de Pablos Women composers; Piano music; Spain Women conductors (Music) Women country musicians Women country musicians. Women drummers (Musicians) Women entertainers Women executives Women folk musicians Women in Dance Women in music Women in music. Women in opera. Women in television broadcasting Women in the music trade Women in the music trade. Women jazz musicians Women jazz musicians. Women jazz singers Women jazz singers. Women lyricists Women lyricists. Women music patrons Women music patrons. Women music teachers Women music teachers. Women musicians Women musicians. Women painters Women performance artists Women philanthropists Women pianists Women pianists. Women poets Women poets. Women popular music fans. Women punk rock musicians Women punk rock musicians. women rap musicians Women rock musicians Women rock musicians. Women singers Women singers. Women social reformers Women sound engineers Women sound engineers. Women sound recording executives and producers Women sound recording executives and producers. Women television personalities Women violinists Women violinists. Women's music Women, Black Women, Celtic Women. Wood. woodwind instruments. Work catalogues Working class World history. World music World music. World War World War 1914-1918 World War, 1914-1918 World War, 1939-1945 World War, 1939-1945. World. Worship. Wounds and injuries. Wörterbuch Writers Writers; Generation of '27 Writing Writing and publishing Writing and publishing. Writing. Written communication Yaozoku. Yew Yiddish Yoruba (African people) Young adults Youth Youth development. Yugoslavia breakdown Zagreb Zajc Zajc Ivan Zarzuela Zarzuela. Zarzuela; Sound recordings; Mechanical instruments Zealandia Performances Zeichentrickfilm. Zheng Zheng music Zingen Zither Zora Zrinjski Zulu (African people) Zulu music Zydeco music ] Đàn tranh Đorđević 고전 음악[古典音乐] 교수 학습 방법[敎授学习方法] 교육 프로그램[敎育 러시아 문학 문학 평론文学评论 문화 예술 교육[文化艺术敎育] 서양 음악[西洋音乐] 심리학[心理学] 유아 음악 교육[幼儿音乐敎育] 음악 교육[音乐敎育] 음악(교과과목)[音乐] 음악(예술)[音乐] 음악사[音乐史] 작곡가[作曲家] 전기(인물)[传记] 클래식[classic] レコード音楽. 医学. 埼玉県 文学 流行歌. 演剧. 神楽 舞踊. 音楽.
Found 294 results Author Title
[ Type
] Year
Filters: First Letter Of Title
is E [Clear All Filters]
Book
Darchen, Sébastien , Damien Charrieras , and John Willsteed
. Electronic Cities : Music, Policies And Space In The 21St Century /
. Cham, Switzerland: Palgrave Macmillan, 2021.
https://www.vlebooks.com/vleweb/product/openreader?id=none&isbn=9789813347410 (link is external)
.
Leloup, Jean-Yves , Gemma Curtin , and Maria McLintock
. Electronic : From Kraftwerk To The Chemical Brothers /
. United Kingdom : London : Design Museum Publishing, 2020.
Iverson, Jennifer
. Electronic Inspirations : Technologies Of The Cold War Musical Avant-Garde /
. United States: New York, NY : Oxford University Press, 2019.
Collins, Nick , Margaret. Schedel , and Scott Wilson
.
Electronic Music
, 2013.
Reveillac, Jean-Michel
. Electronic Music Machines : The New Musical Instruments /
. United Kingdom ; : London : Wiley-ISTE, 2019.
Kuhn, Will , and Ethan Hein
. Electronic Music School : A Contemporary Approach To Teaching Musical Creativity /
. New York, NY, United States: Oxford University Press, 2021.
http://dx.doi.org/10.1093/oso/9780190076634.001.0001
(link is external)
.
Butler, Mark J
. Electronica, Dance And Club Music
. Farnham: Ashgate, 2012.
Sándor, Kármán , and Marczell Katalin
. Életem Ritmusa
. Cegléd: Magyar Ütőhangszeres Kultúráért Alapítvány, 2020.
István, Berczelly , and Spangel Péter
. Életúton Berczelly Istvánnal
. Az Operaház Örökös Tagjai
. Az Operaház Örökös Tagjai. Budapest: M. Áll. Operaház, 2019.
Elgar, Edward , Martin Bird , and Paul Chennell
. The Elgar Family Diaries, 1908-1910
. Vol. v. 5. United Kingdom : Rickmansworth : Elgar Works, 2020.
Kelly, John Ellis
. Elgar's Best Friend : Alfred Rodewald Of Liverpool /
. First edition., 2013.
Drysdale, John D
. Elgar's Earnings
, 2013.
János, Béres
. Elindultam Hosszú Útra : Gagybátor, Wellington, San Francisco
. Budapest: Szerző, 2020.
János, Béres
. Elindultam Hosszú Útra : Gagybátor, Wellington, San Francisco
. Budapest: EMB, 2021.
Link, John
. Elliott Carter's Late Music
. Cambridge, United Kingdom ;: Cambridge University Press, 2022.
Nagy, I S
. Elmegyek : Máté Péter Emlékére
. Budapest: K.u.K. K., 2015.
Noémi, Maczelka
. Előadások, Írások, Tanulmányok
. Szeged: JATEPress, 2020.
Kearns, Peter
. Elton John : Every Album, Every Song 1969 To 1979 /
. United Kingdom: Tewkesbury : Sonic Bond Publishing, 2019.
Restall, Matthew
. Elton John's Blue Moves
. United Kingdom : London : Bloomsbury Academic, 2020.
Schiller, Rina
. The Elusive Celt : Perceptions Of Traditional Irish Music Communities In Europe /
. Oxford, United Kingdom; New York, United States: Peter Lang, 2021.
https://www.vlebooks.com/vleweb/product/openreader?id=none&isbn=9781800795747 (link is external)
.
Wertheimer, Alfred , Warren E. Perry , and Amy Henderson
. Elvis 1956
, 2013.
Casey, Ivor
. Elvis And Ireland
. Ireland: Ireland: Appello Press, 2013.
Kealing, Bob
. Elvis Ignited : The Rise Of An Icon In Florida /
. United States: Gainesville, FL : University Press of Florida, 2017.
Crouse, Richard
. Elvis Is King : Costello's My Aim Is True /
. Vol. #4, 2015.
Gaar, Gillian G
. Elvis Remembered : 1935-1977 : The Authorized Box Set From The Graceland Archives /
, 2012.
Pages
« first ‹ previous 1 2 3 4 5 6 7
8 9 … next › last »
Events
European Forum on Music
- 8 Jun 2023
-
Budapest, Hungary
47th ICTM World Conference
- 13 Jul 2023
-
Legon, Ghana
2023 IAML Congress
- 30 Jul 2023
-
Cambridge, United Kingdom
IFLA General Conference and Assembly
- 21 Aug 2023
- Rotterdam, Netherlands
CIMCIM Annual Meeting
- 30 Aug 2023
-
Netherlands
Full list of events
Advertisement
Back to the top
A Javascript-enabled browser is required to navigate the site. If you have any questions, contact us (link sends e-mail)
! Wenn Sie noch Fragen haben, schicken Sie uns eine Mail (link sends e-mail)
. S'il vous plaît n'hésitez pas à nous contacter (link sends e-mail)
si vous avez des questions.
Follow us: | https://www.iaml.info/rpim?f%5Btg%5D=E&o=asc&page=4&s=type |
Development of a Potential TiO 2 -Nanofiber Platform for Isolation of Circulating Tumor Cells of Nasopharyngeal Carcinoma | Request PDF
Request PDF | Development of a Potential TiO 2 -Nanofiber Platform for Isolation of Circulating Tumor Cells of Nasopharyngeal Carcinoma | Background: Nasopharyngeal carcinoma (NPC) is a malignancy susceptible to local recurrence and distant metastasis. Circulating tumor cells (CTCs)... | Find, read and cite all the research you need on ResearchGate
Development of a Potential TiO 2 -Nanofiber Platform for Isolation of Circulating Tumor Cells of Nasopharyngeal Carcinoma
December 2017
Journal of Nanoscience and Nanotechnology 17(12):9095-9100
DOI: 10.1166/jnn.2017.13874
Authors:
Yu-Jin Zeng
Sheng-Wei Lee
Taipei Veterans General Hospital
Abstract
Background: Nasopharyngeal carcinoma (NPC) is a malignancy susceptible to local recurrence and distant metastasis. Circulating tumor cells (CTCs) was reported to be associated with cancer prognosis. However, the technique of isolation of CTCs still remains challenging. The aim of this study was to develop an effective platform for isolation of CTCs of NPC. Methods: Self-organized titanium oxide (TiO2) nanofibers of different densities were fabricated by electrospinning method. Anti-EpCAM antibodies were further conjugated on the TiO2 nanofibers to capture NPC CTCs in vitro and evaluated by immunofluorescence. Scanning electronic microscopy (SEM) was utilized for observation of cell morphology. Results: The results demonstrated that high-density TiO2 nanofibers showed better NPC CTCs capturing performance than the low-density ones. Besides, SEM revealed good contact of CTCs with TiO2 nanofibers. Moreover, TiO2 nanofibers prepared with higher concentration of anti-EpCAM antibody showed better cell capturing ability. Conclusion: The high-density TiO2 nanofibers conjugated with anti-EpCAM antibodies can capture the CTCs of NPC effectively, which may have the potential for future clinical application.
... anti-EpCAM to capture epithelial and mesenchymal CTCs [21]. For this purpose, various materials like chitosan [53], TiO 2
[54]
, etc. are also commonly used as a nanofiber platform. Therefore, based on the desired purpose and embedded markers, the using materials in work have a broad spectrum with various efficiency. ...
Nanostructure Materials: Efficient Strategies for Circulating Tumor Cells Capture, Release, and Detection
Article
Aug 2021
Sahar Asghari
Fatemeh Barati
Manizheh Avatefi
Matin Mahmoudifard
It has been proved that most of the deaths due to cancer are related to metastasis. This process occurs through the separation of cells from the primary tumor and maintenance in the circulation systems in the body. Finally, if the condition for the relocalizing of them in other sites becomes appropriate, they produce new tumors in various parts of the body. The number of these circulating tumor cells (CTCs) in the blood is very rare. So, detecting and counting them is difficult, but very vital. There are various techniques for the detection of CTCs, which along with them, nanomaterials are suitable tools for this purpose due to their small sizes and unique properties. Because of the high efficiency of these materials, it is possible to exceed the other mentioned methods. In this review, we aim to render a comprehensive study about recent advances in the capture and subsequent release of the CTCs using different types of nanomaterials.
... Besides these typical applications, several others are reported in the literature. Electrospun TiO 2 nanofiber mats are used to capture circulating tumor cells [nasopharyngeal carcinoma (NPC)] which are associated with cancer prognosis but are hard to isolate with other methods
[43]
. Hollow TiO 2 nanofibers can be used in sensing, energy, or health applications, especially due to the physical properties, such as increased electronic transport properties and shorter electron diffusion length which allows for an enhanced charging-discharging rate [44]. ...
Photocatalytic Properties of TiO2 Composite Nanofibers Electrospun With Different Polymers
Chapter
Oct 2018
Timo Grothe
Robin Böttjer
Daria Wehlage
Andrea Ehrmann
... Besides these typical applications, several others are reported in the literature. Electrospun TiO 2 nanofiber mats are used to capture circulating tumor cells [nasopharyngeal carcinoma (NPC)] which are associated with cancer prognosis but are hard to isolate with other methods
[43]
. Hollow TiO 2 nanofibers can be used in sensing, energy, or health applications, especially due to the physical properties, such as increased electronic transport properties and shorter electron diffusion length which allows for an enhanced charging-discharging rate [44]. ...
Photocatalytic Properties of TiO2 Composite Nanofibers Electrospun With Different Polymers
Chapter
Oct 2018
Timo Grothe
Robin Böttjer
Daria Wehlage
Andrea Ehrmann
Dual-function nanostructured platform for isolation of nasopharyngeal carcinoma circulating tumor cells and EBV DNA detection
Article
Jul 2019
BIOSENS BIOELECTRON
Sheng-Wei Lee
Yi-wei Chen
Edward C Kuan
Ming-Ying Lan
Circulating tumor cells (CTCs) and plasma levels of Epstein-Barr virus (EBV) DNA are sensitive prognostic tools for monitoring disease status in nasopharyngeal carcinoma (NPC) patients. Herein, we introduce a novel and low-cost platform for capturing CTCs, the Si nanowires/microscale pyramids (NWs/MPs) hierarchical substrate, which could capture NPC cells in vitro and also detect EBV DNA at very low concentrations. In this study, Si NWs/MPs hierarchical substrates with varying wire length were fabricated using a metal-assisted chemical etching method. Anti-EpCAM antibodies were further conjugated on the substrate for capturing NPC CTCs in vitro. Capture efficiency was evaluated using immunofluorescence and scanning electronic microscopy (SEM) was utilized to understand cell morphology. The Si NWs/MPs substrate was also transformed into a Surface enhanced Raman scattering (SERS) substrate by coating with Ag nanoparticles (AgNPs) for detection of EBV DNA by Raman spectroscopy. The results demonstrated that Si NWs/MPs with 20 min of etch time had the best capturing performance. Additionally, SEM observations revealed good contact of CTCs with Si NWs/MPs substrates. Moreover, the AgNPs-coated NWs/MPs substrate was shown to be a sensitive EBV DNA detector, by which the DNA detection limit can reach up to 10-13M. In conclusion, the Si NWs/MPs platform not only exhibits superior cell capturing ability, but also can sensitively detect EBV DNA at very low concentrations. This platform has great potential to become a promising diagnostic tool for monitoring disease status and prognostication of NPC patients.
May 2012 · Advanced Materials
Nangang Zhang
Yuliang Deng
Qidong Tai
[...]
Xing-Zhong Zhao
A nanostructured platform combining an electrospun TiO(2) nanofiber-deposited substrate and a cell-capture agent is created by S. S. Guo, K. Liu, H.-R. Tseng, B. Xiong, X.-Z. Zhao, and co-workers. The platform, described on page 2756, realizes the capture of significant amounts of circulating tumor cells. The enhanced local topographic interactions between the horizontally packed TiO(2) ... [Show full abstract] nanofiber-deposited substrates and the extracellular matrix scaffolds, in addition to anti-EpCAM/EpCAM biological recognition, contributes to the significantly enhanced capture efficiency as compared to flat surfaces.
| https://www.researchgate.net/publication/320432036_Development_of_a_Potential_TiO_2_-Nanofiber_Platform_for_Isolation_of_Circulating_Tumor_Cells_of_Nasopharyngeal_Carcinoma |
Intravenous anti-D as a treatment for immune thrombocytopenic purpura (ITP) during pregnancy | Request PDF
Request PDF | Intravenous anti-D as a treatment for immune thrombocytopenic purpura (ITP) during pregnancy | This pilot study assessed the safety and efficacy of intravenous anti-D in eight Rh(D)-positive women with immune thrombocytopenic purpura (ITP)... | Find, read and cite all the research you need on ResearchGate
Article
Intravenous anti-D as a treatment for immune thrombocytopenic purpura (ITP) during pregnancy
October 2003
British Journal of Haematology123(1):142-6
DOI: 10.1046/j.1365-2141.2003.04567.x
Source
PubMed
Authors:
<here is a image 1937ee36a50dd27a-fa33d150fae83bfe>
Marc Michel
Assistance Publique – Hôpitaux de Paris
<here is a image f2f62089ad6ff61c-d19572ff1996375a>
Maria V Novoa
Maria V Novoa
<here is a image f2f62089ad6ff61c-d19572ff1996375a>
James B Bussel
James B Bussel
Abstract
This pilot study assessed the safety and efficacy of intravenous anti-D in eight Rh(D)-positive women with immune thrombocytopenic purpura (ITP) during the second and third trimesters of pregnancy. The median pretreatment platelet count was 28 x 109/l. The patients received one to seven anti-D infusions at a mean dose of 62.7 micro g/kg, and the response rate to anti-D was 75%. A haemoglobin decrease of > 2.0 g/dl occurred only once. Fetal hydrops was not identified by ultrasonography. The direct antiglobulin test was positive in three out of seven Rh+ newborns, none of whom was anaemic or jaundiced. Anti-D is effective and appears to be safe for both mother and fetus.
... 224 Recommendations for the treatment of maternal ITP 1. Counseling for women with ITP wishing to become pregnant is recommended (Grade C recommendation). 2. A platelet count between 20 and 30 3 10 9 /L in a nonbleeding patient is safe for most of pregnancy. A platelet count $50 3 10 9 /L (see separate anesthesia recommendation below) is preferred for delivery (Grade C recommendation). 3. Initial treatment is with oral steroids or IVIg (Grade C recommendation). 4. IV anti-D in Rh(D)-positive nonsplenectomized women appears to be well tolerated and effective based on results from a small pilot study
225
(Grade B recommendation, evidence level IIb); however, this may potentially cause maternal or fetal hemolysis. 5. IVIg can provide a rapid, but often very transient, increase in platelet count and can be used to urgently increase platelet counts during bleeding or for delivery (Grade B recommendation). ...
... If available, IV anti-D in Rh(D)-positive nonsplenectomized women appears to be well tolerated (by mother and fetus) and is effective in the second and third trimesters based on results from a small pilot study (evidence level III).
225
Monitoring is required for neonatal jaundice, anemia, and DAT positivity after delivery. Anti-D is not available in Europe. ...
Updated international consensus report on the investigation and management of primary immune thrombocytopenia
Article
Full-text available
Nov 2019
<here is a image 99d2f92bc1eb4b93-2236412d08a260ae> Drew Provan
Donald M. Arnold
<here is a image 1937ee36a50dd27a-fa33d150fae83bfe> James B Bussel
David J. Kuter
Over the last decade, there have been numerous developments and changes in treatment practices for the management of patients with immune thrombocytopenia (ITP). This article is an update of the International Consensus Report published in 2010. A critical review was performed to identify all relevant articles published between 2009 and 2018. An expert panel screened, reviewed, and graded the studies and formulated the updated consensus recommendations based on the new data. The final document provides consensus recommendations on the diagnosis and management of ITP in adults, during pregnancy, and in children, as well as quality-of-life considerations.
... 204-207 (2017) Güth et al. [16] showed that the clinical management of pregnancy, delivery, and puerperium in patients with thrombocytopenia needs a close cooperation of experienced hematologists, obstetricians, anesthesiologists, pediatricians, and other specialists in this field. In parallel, Veneri et al. [17], Provan et al. [18], Won et al. [19], Michel et al.
[20]
, and Sieunarine et al. [21] in their studies have suggested that optimum management of thrombocytopenia in pregnancy requires collaboration among the obstetrician thoroughbred in the management of thrombocytopenia, the hematologist, the obstetric anesthetist, and the neonatologist, and treatment on this disorder is largely based on the risk of maternal hemorrhage. Their labors also showed obstetric anesthetists commonly recommend a platelet count of at least 75 × 10 9 /L to allow administration of spinal or epidural anesthesia. ...
... Their labors also showed obstetric anesthetists commonly recommend a platelet count of at least 75 × 10 9 /L to allow administration of spinal or epidural anesthesia. Some of the researchers like hematologists believe that a platelet count of at least 50 × 109/L is sufficient to permit for cesarean section [17][18][19]
[20]
[21]. Furthermore, the suggestions for management of the pregnancy in another study by Myers [22] revealed that mothers with congenital thrombocytopenia must attend a specialist center for receiving a disintegrin and metalloproteinase with thrombospondinlike repeats 13 supplementations regularly all over the course of pregnancy and post-partum, and also indicated that they must be monitored throughout pregnancy to help predict the requirement for collaborator therapy and consequence. ...
Report on the management of thrombocytopenia in obstetric patients: A retrospective study
Oct 2017
<here is a image 314053a5a8f4a500-b96b5a8bc87878ee> Mehri Seifoleslami
Milad Javanbakht
Thrombocytopenia occurs to approximately 8%-10% of pregnant women and this condition is a notable source of morbidity and mortality during pregnancy. In the recent years, our comprehension of thrombocytopenia has progressed on pregnancy. Nevertheless, there has not been adequate information about thrombocytopenia outcomes in obstetric patients. With regard to this topic, we reviewed published reports as an update from the managements on these cases. Nevertheless, recommendations for management of delivery in obstetric women with thrombocytopenia are based on several hypotheses requiring critical analysis. For this cause, we reviewed the management of pregnant patients with thrombocytopenia treated over a period of 37 years.
... However, corticosteroid could increase the risk of gestation diabetes, hypertension, placenta previa and abruption of the placenta. For such complications, some prefer starting IVIG or anti-Rh(D) instead of corticosteroid but no strong recommendations or guidelines [7][8][9]
[10]
Steroid induced hypertriglyceridemia in pregnant lady with immune thrombocytopenia – case report
Rehab Y Al-Ansari
Faisal Ahmed Abu shaigah
<here is a image 1937ee36a50dd27a-fa33d150fae83bfe> Laila Alromaih
Moutaz Osman
Background
Hypertriglyceridemia is a medical condition defined as fasting triglyceride level more than 150 mg/dl. It could be due to either familial or acquired cause as in obesity, metabolic syndrome, diabetes mellitus type 2, alcohol consumption, decrease exercise or drug affects. Drugs such as corticosteroids rarely induced hypertriglyceridemia, for that we are reporting this case.
Case presentation
We are reporting a 35 years old pregnant lady diagnosed with immune thrombocytopenia and started on prednisolone 1mg/kg per oral once a day. Two months later, while on 20 mg of prednisolone, she presented to the emergency department with epigastric pain, nausea and vomiting for 15 days. Physical examination showed dry mucosa, new xanthelasma over both eyelids and epigastric tenderness with palpable suprapubic gravida uterus; otherwise, was unremarkable. Blood samples were highly lipemic, and laboratory investigations showed high triglycerides (TG) of greater than 73 mmol/L, mild diabetic keto acidosis with normal other chemistry including hepatic, renal, and pancreatic panel. She was treated by diet restriction, insulin infusion, Fenofibrate, and Omega 3 as well as rapid tapering down of prednisolone.
Conclusion
Corticosteroid-induced hypertriglyceridemia is an uncommon condition and could be fatal, especially in high-risk cases. Unfortunately, no guidelines support a regular screening for lipid profile prior to initiating steroid therapy. However, we are suggesting a further study and creating a recommendation to mandate screening for lipid profile along with fasting blood sugar prior to initiating steroid therapy, especially in high-risk cases as in pregnancy.
... In a small pre-test, it was found that Rh(D)-positive patients with ITP without splenectomy tolerated intravenous anti-D well, and this effect was particularly significant in the middle and late pregnancy, where it was effective and safe for both mother and neonate at doses of 50-75 μg/kg
(10,
11). In the ITP guide published by blood in 2019 do not include the above therapy in the recommended list of first-line treatments for ITP in pregnancy, but it is an option for non-pregnant adults and children with ITP, and it is not currently recommended in the Chinese guidelines. ...
Diagnostic Ideas and Management Strategies for Thrombocytopenia of Unknown Causes in Pregnancy
Objective
To summarize the clinical characteristics and treatment options together with the maternal and neonatal prognoses in women with different degrees of thrombocytopenia of unknown causes during pregnancy.Materials and Methods
One hundred twenty-nine cases meeting the inclusion and exclusion criteria were retrospectively analyzed. Patients were divided into group A (50*109/L) and group B (50*109/L to 100*109/L) according to the lowest level of platelet count during pregnancy. Patients were divided into those found to have thrombocytopenia in the relatively early, middle, and late stages according to the detection period of maternal thrombocytopenia during pregnancy.ResultsThere were 72 cases in group A, and 57 cases in group B. There existed statistically significant differences in terms of the proportion of primipara, the proportion with a history of thrombocytopenia, and the median length of pregnancy between the two groups (p < 0.05). The proportion of patients with severe thrombocytopenia as an indication for cesarean delivery was higher in group A than in group B (p < 0.05). More cases were detected at the relatively early stages of pregnancy in group A than in group B (p < 0.05). There was no difference in neonatal hemorrhage and events of thrombocytopenia between the two groups.Conclusion
Patients with platelet counts below 50*109/L were mostly primipara with a history of thrombocytopenia, most often detected at a relatively early stage of pregnancy, and continued pregnancy might lead to aggravation of the disease. Combination therapy was required for patients with platelet counts below 30*109/L to maintain the platelet counts within a safe range. Cesarean delivery was selected to terminate the pregnancies, and platelet counts should be raised above 50*109/L before surgery. Close monitoring was required for those with platelet counts above 30*109/L. There was no direct correlation between the maternal and neonatal platelet counts.
... 13,14 Intravenous anti-D in Rh(D)-positive women with intact spleen has demonstrated benefit in small pilot studies; however, its use is associated with the risk of maternal and fetal hemolysis.
15
Rituximab is labeled as category C by the United States (US) Food and Drug Administration (FDA) for use during pregnancy and is recommended only for very severe cases. 14 Likewise, azathioprine is another drug that can be used for ITP during pregnancy; however, it is also labelled category C by the US FDA. 14 Vinca alkaloids, mycophenolate, and danazol are teratogenic and are contraindicated in pregnancy. ...
Thrombopoietin receptor agonist for treatment of immune thrombocytopenia in pregnancy: a narrative review
<here is a image 7149bd94ae305ca2-e5f9ea24ba5fcdc9> Nikki Agarwal
<here is a image 1c173c4079308e27-974b4757ab06b8c3> Ankit Mangla
The treatment of immune thrombocytopenia (ITP) in adults has evolved rapidly over the past decade. The second-generation thrombopoietin receptor agonists (TPO-RAs), romiplostim, eltrombopag, and avatrombopag are approved for the treatment of chronic ITP in adults. However, their use in pregnancy is labeled as category C by the United States Food and Drug Administration (FDA) due to the lack of clinical data on human subjects. ITP is a common cause of thrombocytopenia in the first and second trimester of pregnancy, which not only affects the mother but can also lead to thrombocytopenia in the neonatal thrombocytopenia secondary to maternal immune thrombocytopenia (NMITP). Corticosteroids, intravenous immunoglobulins (IVIGs) are commonly used for treating acute ITP in pregnant patients. Drugs such as rituximab, anti-D, and azathioprine that are used to treat ITP in adults, are labeled category C and seldom used in pregnant patients. Cytotoxic chemotherapy (vincristine, cyclophosphamide), danazol, and mycophenolate are contraindicated in pregnant women. In such a scenario, TPO-RAs present an attractive option to treat ITP in pregnant patients. Current evidence on the use of TPO-RAs in pregnant women with ITP is limited. In this narrative review, we will examine the preclinical and the clinical literature regarding the use of TPO-RAs in the management of ITP in pregnancy and their effect on neonates with NMITP.
... There was no signiicant diference in the fetal composite outcome between the IVIG and corticosteroid groups [15]. Experience with anti-RhD therapy in pregnant women is limited and is not recommended as irstline therapy because of the potential risk of acute hemolysis in the mother and the fetus
[16]
. Patients who fail to respond to either steroids or IVIG can be treated with oral azathioprine as its use in pregnancy is safe. ...
Maternal and Fetal Outcomes of Pregnancy in Patients with Immune Thrombocytopenia
<here is a image 1937ee36a50dd27a-fa33d150fae83bfe> Rajesh Kashyap
<here is a image 8f37b33eceef0d1d-ef8e0c21299474df> Akanksha Garg
<here is a image a7e1598f6b1667eb-b162891e50e1ed3d> Mandakini Pradhan
Introduction:
Immune thrombocytopenia (ITP) complicates 1–2 cases/10,000 pregnancies in India. Management of these patients is a challenge as it is associated with potential risks of maternal bleeding episodes and neonatal alloimmune thrombocytopenia (NAITP).
Objective:
To study the maternal and fetal/neonatal outcome of pregnancy in Indian patients with ITP and identify the risk factors for NAITP.
Materials and Methods:
In this retrospective study, all ITP patients with pregnancy who were diagnosed and treated at our center over 8 years (2010–2018) were evaluated for their hematological, obstetrical, and fetal outcomes.
Results:
Twenty-nine pregnancies in 27 ITP patients were studied. The mean interval between the diagnosis of ITP and each pregnancy was 29 ± 14.9 months. The mean baseline platelet count was 0.18 ± 0.05 X 109/L. Twenty-seven (93.1%) cases were treated with oral prednisolone. Twenty deliveries (69.0%) were vaginal and 9 (31.0%) deliveries were by cesarean section. There were no major bleeding episodes during pregnancy or delivery.
The mean neonatal platelet count was 1.23 ± 0.58 × 109/L at birth. NAITP was seen in 3 (3.5%) neonates. No bleeds or intracranial hemorrhages were observed. Only maternal platelet count < 50 X 109/L at delivery showed a statistical correlation with NAITP (p = 0.022). There was no positive correlation between NAITP and the duration of maternal ITP, the timing of ITP onset, or type of treatment. Conclusion:
Successful outcome of pregnancies in ITP patients is possible, and the risk of maternal bleeding and NAITP is low.
... In comparison to our study findings with a mean APGAR of 7 at 1 minute and 8 at 5 minutes another study with mean gestateonal age of 38 weeks and birth weight 2.9 kgs had APGAR scores>8.
25
Wyszynski et al notice at least one major malformation in 7.8% of pregnancies with ITP, 2.9% has osetiumsecundum ASD, 5.3% hypospadiasis, 1.7% PDA. 21 Our study had 1.8% of pregnancies with facial dysmorphism and 1.8% with coarctation of aorta in foetus (p<0.001b). ...
Pregnancy outcomes of mothers with immune thrombocytopenia
Background: It has been proposed that, thrombocytopenia is the most common haematological abnormality in
pregnancy after anaemia. The incidence of severe immune thrombocytopenia (ITP) in pregnancy has been difficult to
report because of the rarity of the disease. Objectives were to determine the prevalence, pregnancy outcomes,
treatment modalities of ITP mothers over five years in a tertiary health care hospital in South India.
Methods: Our study was a retrospective record study, which looked into various aspects of obstetrical outcomes and
complications in ITP mothers. Records of the in-patient medical record department (MRD) folders of patients with
ITP who delivered at St. Johns Medical Hospital, Bangalore were studied.
Results: We identified 53 patients with ITP with a mean age of 25.6+4.6 years, age of diagnosis of ITP at 21.1+5.9
years and gestational age of 36.2+3 weeks. In our study 17 (32%) were acute and 36 (67.1%) were chronic ITP. In our
study 39.6% had history of at least one prior pregnancy loss. Patients with ITP at 35-37 weeks were induced with
PGE1 (35.7%) in comparison to those with PGE2 (p≤0.001). Post-partum haemorrage (PPH) was seen in 7.5% of the
pregnancies and all four were mothers with chronic ITP. Severe preeclampsia in ITP mothers was seen in 2 (66.7%).
Conclusions: Chronic ITP in pregnancy poses more risks to mother and foetus as seen with the higher chance of PPH
etc. Mothers with ITP should be screened antenatally as the chances of anomalies are high in the foetus.
Keywords: ITP, APGAR score, Prednesolone, Platelettransfusion, Intrauterine device, Lower segment caesarean
section
... Comme pour toutes les grossesses, le mode dřaccouchement optimal doit être déterminé par une indication obstétricale. Une cible arbitraire d'un nombre de plaquettes de 80 000 / µL est souvent appliquée, plusieurs études rétrospectives ne montrant aucune complication associée à une anesthésie régionale chez les parturientes avec un nombre de plaquettes <100 000 / µL [146],
[147]
, [148]. ...
POUR L'OBTENTION DU DOCTORAT EN MÉDECINE
My thesis is a retrospective study about 34 cases of thrombocytopenia during pregnancy, many etiologies was responsible of it and the treatment was different for each case.
... Anti-RhD Ig is generally not used as a first-line agent because of concerns for acute hemolysis and anemia, but has been used in refractory cases throughout pregnancy with successful outcomes.
25
If anti-RhD (50-75 g/kg) is administered, the neonate should be carefully monitored for a positive direct antiglobulin test, anemia, and jaundice because the Ab may cross the placenta. ...
Thrombocytopenia in pregnancy: is this immune thrombocytopenia or…?
<here is a image 1937ee36a50dd27a-fa33d150fae83bfe> Terry Gernsheimer
Thrombocytopenia is a common finding in pregnancy. Establishing the diagnosis of immune thrombocytopenia (ITP) in a pregnant patient is similar to doing so in a nonpregnant patient, except that the evaluation must specifically rule out other disorders of pregnancy associated with low platelet counts that present different risks to the mother and fetus and may require alternate distinct therapy. Many of the same treatment modalities are used to manage the pregnant patient with ITP, but others have not been determined to be safe for the fetus, are limited to a particular gestational period, or side effects may be more problematic during pregnancy. The therapeutic objective differs from that in chronic ITP in the adult because many pregnant patients recover or improve spontaneously after delivery and therefore maintenance of a safe platelet count, rather than prolonged remission, is the goal. Thrombocytopenia may the limit choices of anesthesia, but does not guide mode of delivery, and the fetus is rarely severely affected at birth. Patients should be advised that a history of ITP or ITP in a previous pregnancy is not a contraindication to future pregnancies and that, with proper management and monitoring, positive outcomes can be expected in the majority of patients.
... For severe cases of ITP that are refractory to steroids and IVIG, splenectomy may be considered in the second trimester. There is minimal safety data on anti-D immunoglobulin and azathioprine in pregnancy, and these agents should only be considered as last resort
(Michel et al. 2003;
Alstead et al. 1990;Price et al. 1976). Other commonly used agents in nonpregnant patients with ITP (mycophenolate mofetil, cyclophosphamide, cyclosporine A, rituximab, thrombopoietin receptor agonists, and dapsone) are not recommended. ...
Hemostasis and Thrombosis in Pregnancy
In developing countries, the leading cause of maternal death is postpartum hemorrhage, and in industrialized nations, the leading cause of maternal death is venous thromboembolism. Furthermore, there are several other hematologic maladies that may present additional challenges in maintaining the health and well-being of the mother and child during pregnancy, delivery, and the postpartum period. In this chapter, we discuss the hematologic disease states that most commonly complicate pregnancy and offer insight into the diagnosis and management of these conditions.
... A study looking at eight pregnant women with ITP, and a median pre-treatment platelet count of 28 Â 10 9 /l, demonstrated a response rate of 75% with intravenous Anti-D immunoglobulin.
5
Another paper reported on a single case of a patient responding to IV Anti-D treatment after failing treatment with standard IVIg and corticosteroids. 6 Plasma exchange is rarely used to treat ITP, although is an effective way to reduce circulating anti-platelet autoantibodies in emergency situations. ...
Refractory severe immune thrombocytopenia in a twin pregnancy
| https://www.researchgate.net/publication/9079179_Intravenous_anti-D_as_a_treatment_for_immune_thrombocytopenic_purpura_ITP_during_pregnancy |
Perez, Concha, 1915-2014 | libcom.org
A short biography of the Spanish anarchist militant Concha Perez
Perez, Concha, 1915-2014
Concha Perez
A short biography of the Spanish anarchist militant Concha Perez
Author
Nick Heath
Concha had a happy childhood but her family could not afford to keep her at school and she went out to work in a graphic arts workshop at the age of thirteen. She became active in the libertarian movement and at last received an education in the schools-cum-clubs-cum social centres of the ateneos, run by anarchists to raise the educational level of the working class. She attended the Ateneo Libertario Faros (Lighthouse Libertarian Ateneo) and the Ateneo Agrupación Humanidad (Humanity Association). One of her friends there was the anarchist militant José Virgili Martorell, later known as Barcelona’s Public enemy no 1 because of his bank robberies for the cause. She only learnt as late as 2011 that he had been arrested and executed in 1941 by the Franco regime.
In April 1931, with the coming of the republic, she participated with her family in the liberation of detainees from the prisons and in the demonstration for a lowering of rents on the Placa Sant Jaume. In 1932, she he joined the Iberian Anarchist Federation (FAI) and a year later she was arrested and detained for carrying a hidden pistol to another anarchist on a picket line during the insurrectional strikes. She spent five months in prison for this. She learnt how to use bombs and pistols as self-defence against the attacks of the police.
She left home in 1935 because she insisted during an argument with her mother that her brother Pepe share household tasks. She worked as a machinist in a carpentry workshop, where she was a CNT delegate, and helped set up a rationalist school the Escuela Eliseo Reclus in the neighbourhood of Torrassa where she now lived. A few days before the outbreak of the civil war she joined the Revolutionary Committee of the Les Corts neighbourhood, where the first barricades went up and where armoured trucks were constructed.
She knew the Mujeres Libres grouping but she never joined it, insisting that her place was alongside anarchist males where she would fight for respect despite dominant macho attitudes.
Concha Pérez took part in the attack on the Pedralbes barracks (to be re-named the Bakunin Barracks) and the seizure of a convent. She also assisted in the opening of the gates of the Modelo prison. She was part of the armed group Los Aguiluchos (The Young Eagles) of Les Corts, a centuria (100 militia) with seven women in its ranks.
After fighting on the fronts of Caspe and Belchite where she saved the life of a comrade, she returned to Barcelona with the prohibition of women from the fighting. She had fought in the Sur-Ebro Column, one of whose leaders, the anarchist Antonio Ortiz, was to boast that he had been the first to expel women from his column. On the front Concha fought alongside the redoubtable anarchist women Carmen Crespo, Maria Rius and Libertad Rodenas. She never forgot her friend Martirio Romero of Cordoba, a female militant of the Libertarian Youth and the CNT since the age of 17 who fought on the Huesca front, was captured by the Francoists, tortured and sentenced to death, to have this commuted at the last moment but not to be released until 1945.
In Barcelona she worked as a labourer in a factory producing arms.
During the May Days of 1937 in Barcelona, she volunteered for reconnaissance work but was wounded in an ambush by the Stalinists on the Plaza Catalunya on May 3rd. A metal fragment remained in her leg for many years.
With the defeat of the Republic, in December 1938, she left Barcelona and crossed the border and was subsequently confined in the concentration camp at Argelès. Later, she worked as a volunteer nurse in a camp, where he met the socialist doctor Madrid Alonso Isidoro, who for a time was her partner, and with whom she had her only child, born in Marseilles.
She returned to Barcelona in September 1942, where she had to leave her son in foster care in an orphanage .Then the family of Jewish origin who she worked for as a maid helped her regain custody of the child.
In Barcelona, Concha met up with an old friend from the Ateneo Faros, Mauricio Palau, who had just spent four years in prison. They began a relationship that lasted 30 years. They set up a stall in the neighbourhood market of Sant Antoni, where they sold jewellery and lingerie that they had made themselves and which served as a meeting place for anarchists during the Franco regime.
After the death of Franco, she participated in the organization of the first neighbourhood associations and the resurgence of the CNT. In 1997, she was one of the founders of Mujeres del 36 (Women of 36) sponsored by the City of Barcelona, which gathered together women that had taken part in political and social movements during the civil war in Barcelona. Her final days were spent in a retirement home at Barceloneta, where she had many anarchist visitors. She died at dawn on April 17th, 2014 at the age of ninety nine.
Nick Heath
Sources:
http://www.generalisimofranco.com/GC/mujer_miliciana/008.htmhttp://gimenologues.org/spip.php?article601http://elditalanafra.blogspot.co.uk/2010/11/homenatge-personal-concha-perez-collado.htmlhttp://www.acracia.org/Acracia/Concha_Perez_Collado.htmlhttp://www.elperiodico.com/es/noticias/sociedad/muere-concha-perez-una-ultimas-milicianas-cnt-guerra-civil-3252702http://www.memorialibertaria.org/spip.php?article2037
women
Nick Heath
anarchists
Spain
Spanish civil war
biographies
Federación Ibérica de Juventudes Libertarias (FIJL)
Federación Anarquista Ibérica (FAI)
Concha Perez
| https://libcom.org/article/perez-concha-1915-2014 |
Scientists unlock the mystery surrounding a tale of shaggy dogs -- ScienceDaily
Researchers have produced the first clear evidence that textiles made by the indigenous population of the Pacific coast of North America contained dog hair.
Scientists unlock the mystery surrounding a tale of shaggy dogs
Summary:
Researchers have produced the first clear evidence that textiles made by the indigenous population of the Pacific coast of North America contained dog hair.
Researchers from the University of York have produced the first clear evidence that textiles made by the indigenous population of the Pacific coast of North America contained dog hair.
In recent years, scientists have hotly debated whether textiles such as blankets and robes made by the skilful Coast Salish weavers before contact with Europeans were made of dog hair as oral histories have claimed.
Coast Salish oral tradition refers to a special dog which was bred locally until the mid 19 thcentury for its woolly hair or fleece for use in the textile industry.
Using highly sensitive equipment at the University's Centre for Excellence in Mass Spectrometry, York researchers from BioArCh (Departments of Biology, Archaeology and Chemistry) analysed the protein composition of 11 textiles in different locations, representing 25 samples in total.
Researchers found evidence of dog hair in the robe of fur and six of the woven textiles, primarily in a blend with goat hair.
However, the results published in the journal Antiquity, show there is no real proof of a preference for dog hair in high status fabrics and the researchers did not find any textiles made entirely of dog hair. Instead, researchers conclude that dog hair appears to have been used to supplement mountain goat hair, possibly as a bulking material.
Surprisingly too, the results also indicate that commercial sheep wool was also incorporated into textiles in the 19 thcentury. Previous investigations had implied that sheep wool was not used in Salish weaving.
The research was led by Dr Caroline Solazzo, a Marie Curie Research Fellow from York's Department of Archaeology, and a former Postdoctoral Fellow at the Museum Conservation Institute at the Smithsonian Institution.
Dr Solazzo said: "Dogs have a long history of interaction with humans, from companionship to guarding and hunting; but raising dogs for fibre production was a unique cultural adaptation in the Pacific Northwest. It is perhaps the unusual strategy that has led some to doubt the use of dog wool.
"We found dog hair in all textiles produced before 1862, but it was absent from blankets woven in the late 19 thcentury to early 20 thcentury. Noticeably, dog hair is absent from all plain twill-woven ceremonial-type blankets, indicating a strong preference for mountain goat hair, in both aesthetic and technical aspects."
Bio-archaeologist Professor Matthew Collins, from York's Department of Archaeology, said: "Protein mass spectrometry is a useful new tool for the study of textiles, and indeed cultural artefacts composed of proteins, such as silk, wool, ivory, leather, bone and parchment, in which the original source of production is difficult to identify.
"Despite the minute quantities of fibres used, the analytical sensitivity of the instrumentation at York was able to reveal the use of dog hair in Salish weaving."
The Coast Salish peoples are indigenous to the Pacific Northwest coastal areas of northern Washington and southern British Columbia, and are particularly notable for their large, finely woven blankets. In pre-contact times, the blankets were important items and their gift and distribution were present in all aspects of social life. As well as having a functional use, they were important in ceremonies such as marriages and funerals.
Co-author Susan Heald, Senior Textile Conservator, from the Smithsonian's National Museum of the American Indian, said: "Salish weaving is undergoing a resurgence. With this revival it is crucial to have the use of dog hair in older blankets confirmed.
"The research at York has finally provided confirmation for the Coast Salish oral history of the use of dog hair. It appears that dog hair mixed with goat wool was used in every day textiles, with goat hair alone being used in ceremonial textiles."
The existence of a woolly dog is supported by historic accounts of 18 thcentury European explorers. The dogs were reported to be corralled on small islands off the coast to prevent inter-breeding with short-haired village dogs. The dog disappeared less than 100 years after the first contact with Europeans.
Dr Solazzo said: "Based on our results, the description of textiles in museum collections as 'dog hair blankets' should be reconsidered; in no case did we find a textile made solely of this fibre. It may have been the case that pure dog hair blankets were once more common, but considered of lower value and consumed in use and lost."
Story Source:
Materialsprovided by University of York. Note: Content may be edited for style and length.
MLA
University of York. "Scientists unlock the mystery surrounding a tale of shaggy dogs." ScienceDaily. ScienceDaily, 27 November 2011. <www.sciencedaily.com/releases/2011/11/111124150355.htm>.
| https://www.sciencedaily.com/releases/2011/11/111124150355.htm |
Global Energy Efficient Glass Market Research Report 2023(Status and Outlook)
Global Energy Efficient Glass Market Research Report 2023(Status and Outlook) Global Energy Efficient Glass Market Research Report 2023(Status and Outlook) Report Overview Energy-efficient glazing is the term - Market research report and industry analysis - 34166916
Global Energy Efficient Glass Market Research Report 2023(Status and Outlook)
<table><tbody><tr><td colspan=2> Best Price Guarantee</td></tr><tr><th> Price</th><td> from $2,800</td></tr><tr><th> Length</th><td> 134 Pages</td></tr><tr><th> Publisher</th><td> Bosson Research</td></tr><tr><th> Published Date</th><td>May, 2023</td></tr><tr><th> SKU</th><td> BOSS17937966</td></tr></tbody></table>
Table of Contents
Description
Related Reports
Global Energy Efficient Glass Market Research Report 2023(Status and Outlook)
Report Overview
Energy-efficient glazing is the term used to describe the double glazing or triple glazing use in modern windows in homes.
The energy efficient glass market has been segmented on the basis of coating into hard coat and soft coat. The hard coated energy efficient glass market is projected to register the highest CAGR during the forecast period. This high growth is attributed to its low emissivity, durability, and easy availability for installation.
The Global Energy Efficient Glass Market Size was estimated at USD 21750.00 million in 2022 and is projected to reach USD 26388.28 million by 2029, exhibiting a CAGR of 2.80% during the forecast period.
Bosson Research’s latest report provides a deep insight into the global Energy Efficient Glass market covering all its essential aspects. This ranges from a macro overview of the market to micro details of the market size, competitive landscape, development trend, niche market, key market drivers and challenges, SWOT analysis, Porter’s five forces analysis, value chain analysis, etc.
The analysis helps the reader to shape the competition within the industries and strategies for the competitive environment to enhance the potential profit. Furthermore, it provides a simple framework for evaluating and accessing the position of the business organization. The report structure also focuses on the competitive landscape of the Global Energy Efficient Glass Market, this report introduces in detail the market share, market performance, product situation, operation situation, etc. of the main players, which helps the readers in the industry to identify the main competitors and deeply understand the competition pattern of the market.
In a word, this report is a must-read for industry players, investors, researchers, consultants, business strategists, and all those who have any kind of stake or are planning to foray into the Energy Efficient Glass market in any manner.
Global Energy Efficient Glass Market: Market Segmentation Analysis
The research report includes specific segments by region (country), manufacturers, Type, and Application. Market segmentation creates subsets of a market based on product type, end-user or application, Geographic, and other factors. By understanding the market segments, the decision-maker can leverage this targeting in the product, sales, and marketing strategies. Market segments can power your product development cycles by informing how you create product offerings for different segments.
Key Company
Saint-Gobain
AGC
Nippon Sheet Glass
Central Glass
SCHOTT
Sisecam Group
Guardian
Vitro Architectural Glass
Morley Glass & Glazing
Metro Performance Glass
CSG Holding
Taiwan Glass
Abrisa Technologies
Bendheim
Fuso Glass
Market Segmentation (by Type)
Hard Coat
Soft Coat
Market Segmentation (by Application)
Public Service
Industrial
Commerical
Geographic Segmentation
North America (USA, Canada, Mexico)
Europe (Germany, UK, France, Russia, Italy, Rest of Europe)
Asia-Pacific (China, Japan, South Korea, India, Southeast Asia, Rest of Asia-Pacific)
South America (Brazil, Argentina, Columbia, Rest of South America)
The Middle East and Africa (Saudi Arabia, UAE, Egypt, Nigeria, South Africa, Rest of MEA)
Key Benefits of This Market Research:
Industry drivers, restraints, and opportunities covered in the study
Neutral perspective on the market performance
Recent industry trends and developments
Competitive landscape & strategies of key players
Potential & niche segments and regions exhibiting promising growth covered
Historical, current, and projected market size, in terms of value
In-depth analysis of the Energy Efficient Glass Market
Overview of the regional outlook of the Energy Efficient Glass Market:
Key Reasons to Buy this Report:
Access to date statistics compiled by our researchers. These provide you with historical and forecast data, which is analyzed to tell you why your market is set to change
This enables you to anticipate market changes to remain ahead of your competitors
You will be able to copy data from the Excel spreadsheet straight into your marketing plans, business presentations, or other strategic documents
The concise analysis, clear graph, and table format will enable you to pinpoint the information you require quickly
Provision of market value (USD Billion) data for each segment and sub-segment
Indicates the region and segment that is expected to witness the fastest growth as well as to dominate the market
Analysis by geography highlighting the consumption of the product/service in the region as well as indicating the factors that are affecting the market within each region
Competitive landscape which incorporates the market ranking of the major players, along with new service/product launches, partnerships, business expansions, and acquisitions in the past five years of companies profiled
Extensive company profiles comprising of company overview, company insights, product benchmarking, and SWOT analysis for the major market players
The current as well as the future market outlook of the industry concerning recent developments which involve growth opportunities and drivers as well as challenges and restraints of both emerging as well as developed regions
Includes in-depth analysis of the market from various perspectives through Porter’s five forces analysis
Provides insight into the market through Value Chain
Market dynamics scenario, along with growth opportunities of the market in the years to come
6-month post-sales analyst support
Chapter Outline
Chapter 1 mainly introduces the statistical scope of the report, market division standards, and market research methods.
Chapter 2 is an executive summary of different market segments (by region, product type, application, etc), including the market size of each market segment, future development potential, and so on. It offers a high-level view of the current state of the Energy Efficient Glass Market and its likely evolution in the short to mid-term, and long term.
Chapter 3 makes a detailed analysis of the market's competitive landscape of the market and provides the market share, capacity, output, price, latest development plan, merger, and acquisition information of the main manufacturers in the market.
Chapter 4 is the analysis of the whole market industrial chain, including the upstream and downstream of the industry, as well as Porter's five forces analysis.
Chapter 5 introduces the latest developments of the market, the driving factors and restrictive factors of the market, the challenges and risks faced by manufacturers in the industry, and the analysis of relevant policies in the industry.
Chapter 6 provides the analysis of various market segments according to product types, covering the market size and development potential of each market segment, to help readers find the blue ocean market in different market segments.
Chapter 7 provides the analysis of various market segments according to application, covering the market size and development potential of each market segment, to help readers find the blue ocean market in different downstream markets.
Chapter 8 provides a quantitative analysis of the market size and development potential of each region and its main countries and introduces the market development, future development prospects, market space, and capacity of each country in the world.
Chapter 9 introduces the basic situation of the main companies in the market in detail, including product sales revenue, sales volume, price, gross profit margin, market share, product introduction, recent development, etc.
Chapter 10 provides a quantitative analysis of the market size and development potential of each region in the next five years.
Chapter 11 provides a quantitative analysis of the market size and development potential of each market segment (product type and application) in the next five years.
Chapter 12 is the main points and conclusions of the report.
1 Research Methodology and Statistical Scope
1.1 Market Definition and Statistical Scope of Energy Efficient Glass
1.2 Key Market Segments
1.2.1 Energy Efficient Glass Segment by Type
1.2.2 Energy Efficient Glass Segment by Application
1.3 Methodology & Sources of Information
1.3.1 Research Methodology
1.3.2 Research Process
1.3.3 Market Breakdown and Data Triangulation
1.3.4 Base Year
1.3.5 Report Assumptions & Caveats
2 Energy Efficient Glass Market Overview
2.1 Global Market Overview
2.1.1 Global Energy Efficient Glass Market Size (M USD) Estimates and Forecasts (2018-2029)
2.1.2 Global Energy Efficient Glass Sales Estimates and Forecasts (2018-2029)
2.2 Market Segment Executive Summary
2.3 Global Market Size by Region
3 Energy Efficient Glass Market Competitive Landscape
3.1 Global Energy Efficient Glass Sales by Manufacturers (2018-2023)
3.2 Global Energy Efficient Glass Revenue Market Share by Manufacturers (2018-2023)
3.3 Energy Efficient Glass Market Share by Company Type (Tier 1, Tier 2, and Tier 3)
3.4 Global Energy Efficient Glass Average Price by Manufacturers (2018-2023)
3.5 Manufacturers Energy Efficient Glass Sales Sites, Area Served, Product Type
3.6 Energy Efficient Glass Market Competitive Situation and Trends
3.6.1 Energy Efficient Glass Market Concentration Rate
3.6.2 Global 5 and 10 Largest Energy Efficient Glass Players Market Share by Revenue
3.6.3 Mergers & Acquisitions, Expansion
4 Energy Efficient Glass Industry Chain Analysis
4.1 Energy Efficient Glass Industry Chain Analysis
4.2 Market Overview of Key Raw Materials
4.3 Midstream Market Analysis
4.4 Downstream Customer Analysis
5 The Development and Dynamics of Energy Efficient Glass Market
5.1 Key Development Trends
5.2 Driving Factors
5.3 Market Challenges
5.4 Market Restraints
5.5 Industry News
5.5.1 New Product Developments
5.5.2 Mergers & Acquisitions
5.5.3 Expansions
5.5.4 Collaboration/Supply Contracts
5.6 Industry Policies
6 Energy Efficient Glass Market Segmentation by Type
6.1 Evaluation Matrix of Segment Market Development Potential (Type)
6.2 Global Energy Efficient Glass Sales Market Share by Type (2018-2023)
6.3 Global Energy Efficient Glass Market Size Market Share by Type (2018-2023)
6.4 Global Energy Efficient Glass Price by Type (2018-2023)
7 Energy Efficient Glass Market Segmentation by Application
7.1 Evaluation Matrix of Segment Market Development Potential (Application)
7.2 Global Energy Efficient Glass Market Sales by Application (2018-2023)
7.3 Global Energy Efficient Glass Market Size (M USD) by Application (2018-2023)
7.4 Global Energy Efficient Glass Sales Growth Rate by Application (2018-2023)
8 Energy Efficient Glass Market Segmentation by Region
8.1 Global Energy Efficient Glass Sales by Region
8.1.1 Global Energy Efficient Glass Sales by Region
8.1.2 Global Energy Efficient Glass Sales Market Share by Region
8.2 North America
8.2.1 North America Energy Efficient Glass Sales by Country
8.2.2 U.S.
8.2.3 Canada
8.2.4 Mexico
8.3 Europe
8.3.1 Europe Energy Efficient Glass Sales by Country
8.3.2 Germany
8.3.3 France
8.3.4 U.K.
8.3.5 Italy
8.3.6 Russia
8.4 Asia Pacific
8.4.1 Asia Pacific Energy Efficient Glass Sales by Region
8.4.2 China
8.4.3 Japan
8.4.4 South Korea
8.4.5 India
8.4.6 Southeast Asia
8.5 South America
8.5.1 South America Energy Efficient Glass Sales by Country
8.5.2 Brazil
8.5.3 Argentina
8.5.4 Columbia
8.6 Middle East and Africa
8.6.1 Middle East and Africa Energy Efficient Glass Sales by Region
8.6.2 Saudi Arabia
8.6.3 UAE
8.6.4 Egypt
8.6.5 Nigeria
8.6.6 South Africa
9 Key Companies Profile
9.1 Saint-Gobain
9.1.1 Saint-Gobain Energy Efficient Glass Basic Information
9.1.2 Saint-Gobain Energy Efficient Glass Product Overview
9.1.3 Saint-Gobain Energy Efficient Glass Product Market Performance
9.1.4 Saint-Gobain Business Overview
9.1.5 Saint-Gobain Energy Efficient Glass SWOT Analysis
9.1.6 Saint-Gobain Recent Developments
9.2 AGC
9.2.1 AGC Energy Efficient Glass Basic Information
9.2.2 AGC Energy Efficient Glass Product Overview
9.2.3 AGC Energy Efficient Glass Product Market Performance
9.2.4 AGC Business Overview
9.2.5 AGC Energy Efficient Glass SWOT Analysis
9.2.6 AGC Recent Developments
9.3 Nippon Sheet Glass
9.3.1 Nippon Sheet Glass Energy Efficient Glass Basic Information
9.3.2 Nippon Sheet Glass Energy Efficient Glass Product Overview
9.3.3 Nippon Sheet Glass Energy Efficient Glass Product Market Performance
9.3.4 Nippon Sheet Glass Business Overview
9.3.5 Nippon Sheet Glass Energy Efficient Glass SWOT Analysis
9.3.6 Nippon Sheet Glass Recent Developments
9.4 Central Glass
9.4.1 Central Glass Energy Efficient Glass Basic Information
9.4.2 Central Glass Energy Efficient Glass Product Overview
9.4.3 Central Glass Energy Efficient Glass Product Market Performance
9.4.4 Central Glass Business Overview
9.4.5 Central Glass Energy Efficient Glass SWOT Analysis
9.4.6 Central Glass Recent Developments
9.5 SCHOTT
9.5.1 SCHOTT Energy Efficient Glass Basic Information
9.5.2 SCHOTT Energy Efficient Glass Product Overview
9.5.3 SCHOTT Energy Efficient Glass Product Market Performance
9.5.4 SCHOTT Business Overview
9.5.5 SCHOTT Energy Efficient Glass SWOT Analysis
9.5.6 SCHOTT Recent Developments
9.6 Sisecam Group
9.6.1 Sisecam Group Energy Efficient Glass Basic Information
9.6.2 Sisecam Group Energy Efficient Glass Product Overview
9.6.3 Sisecam Group Energy Efficient Glass Product Market Performance
9.6.4 Sisecam Group Business Overview
9.6.5 Sisecam Group Recent Developments
9.7 Guardian
9.7.1 Guardian Energy Efficient Glass Basic Information
9.7.2 Guardian Energy Efficient Glass Product Overview
9.7.3 Guardian Energy Efficient Glass Product Market Performance
9.7.4 Guardian Business Overview
9.7.5 Guardian Recent Developments
9.8 Vitro Architectural Glass
9.8.1 Vitro Architectural Glass Energy Efficient Glass Basic Information
9.8.2 Vitro Architectural Glass Energy Efficient Glass Product Overview
9.8.3 Vitro Architectural Glass Energy Efficient Glass Product Market Performance
9.8.4 Vitro Architectural Glass Business Overview
9.8.5 Vitro Architectural Glass Recent Developments
9.9 Morley Glass andamp; Glazing
9.9.1 Morley Glass andamp; Glazing Energy Efficient Glass Basic Information
9.9.2 Morley Glass andamp; Glazing Energy Efficient Glass Product Overview
9.9.3 Morley Glass andamp; Glazing Energy Efficient Glass Product Market Performance
9.9.4 Morley Glass andamp; Glazing Business Overview
9.9.5 Morley Glass andamp; Glazing Recent Developments
9.10 Metro Performance Glass
9.10.1 Metro Performance Glass Energy Efficient Glass Basic Information
9.10.2 Metro Performance Glass Energy Efficient Glass Product Overview
9.10.3 Metro Performance Glass Energy Efficient Glass Product Market Performance
9.10.4 Metro Performance Glass Business Overview
9.10.5 Metro Performance Glass Recent Developments
9.11 CSG Holding
9.11.1 CSG Holding Energy Efficient Glass Basic Information
9.11.2 CSG Holding Energy Efficient Glass Product Overview
9.11.3 CSG Holding Energy Efficient Glass Product Market Performance
9.11.4 CSG Holding Business Overview
9.11.5 CSG Holding Recent Developments
9.12 Taiwan Glass
9.12.1 Taiwan Glass Energy Efficient Glass Basic Information
9.12.2 Taiwan Glass Energy Efficient Glass Product Overview
9.12.3 Taiwan Glass Energy Efficient Glass Product Market Performance
9.12.4 Taiwan Glass Business Overview
9.12.5 Taiwan Glass Recent Developments
9.13 Abrisa Technologies
9.13.1 Abrisa Technologies Energy Efficient Glass Basic Information
9.13.2 Abrisa Technologies Energy Efficient Glass Product Overview
9.13.3 Abrisa Technologies Energy Efficient Glass Product Market Performance
9.13.4 Abrisa Technologies Business Overview
9.13.5 Abrisa Technologies Recent Developments
9.14 Bendheim
9.14.1 Bendheim Energy Efficient Glass Basic Information
9.14.2 Bendheim Energy Efficient Glass Product Overview
9.14.3 Bendheim Energy Efficient Glass Product Market Performance
9.14.4 Bendheim Business Overview
9.14.5 Bendheim Recent Developments
9.15 Fuso Glass
9.15.1 Fuso Glass Energy Efficient Glass Basic Information
9.15.2 Fuso Glass Energy Efficient Glass Product Overview
9.15.3 Fuso Glass Energy Efficient Glass Product Market Performance
9.15.4 Fuso Glass Business Overview
9.15.5 Fuso Glass Recent Developments
10 Energy Efficient Glass Market Forecast by Region
10.1 Global Energy Efficient Glass Market Size Forecast
10.2 Global Energy Efficient Glass Market Forecast by Region
10.2.1 North America Market Size Forecast by Country
10.2.2 Europe Energy Efficient Glass Market Size Forecast by Country
10.2.3 Asia Pacific Energy Efficient Glass Market Size Forecast by Region
10.2.4 South America Energy Efficient Glass Market Size Forecast by Country
10.2.5 Middle East and Africa Forecasted Consumption of Energy Efficient Glass by Country
11 Forecast Market by Type and by Application (2024-2029)
11.1 Global Energy Efficient Glass Market Forecast by Type (2024-2029)
11.1.1 Global Forecasted Sales of Energy Efficient Glass by Type (2024-2029)
11.1.2 Global Energy Efficient Glass Market Size Forecast by Type (2024-2029)
11.1.3 Global Forecasted Price of Energy Efficient Glass by Type (2024-2029)
11.2 Global Energy Efficient Glass Market Forecast by Application (2024-2029)
11.2.1 Global Energy Efficient Glass Sales (K MT) Forecast by Application
11.2.2 Global Energy Efficient Glass Market Size (M USD) Forecast by Application (2024-2029)
12 Conclusion and Key Findings
Energy Efficient Glass
| https://www.marketresearch.com/Bosson-Research-v4252/Global-Energy-Efficient-Glass-Research-34166916/ |
State v. Eric P. Russell
<table><tbody><tr><td> A party may file with the
Supreme Court a petition to review an adverse decision by the Court of
Appeals. � See� 808.10 and Rule809.62, Stats.</td><td> This opinion is subject to
further editing. �If published, the
official version will appear in the bound volume of the Official Reports.</td></tr></tbody></table>
No. �94-3356-CR
STATE
OF WISCONSIN ��������������IN COURT OF
APPEALS
�DISTRICT I �����������
�����������������������������������������������������������������������������������������������������������������������
STATE OF WISCONSIN,
����������������������� ����������������������� �����������Plaintiff-Respondent,
����������� �����������v.
ERIC P. RUSSELL,
����������������������� ����������������������� �����������Defendant-Appellant.
����������������������������������������������������������������������������������������������������������������������
�����������������������APPEAL from a judgment
and an order of the circuit court for Milwaukee County: ��JEFFREY A. KREMERS, Judge. � Affirmed.
�����������������������Before Wedemeyer, P.J.,
Fine and Schudson, JJ.
�����������������������PER CURIAM. ��Eric P. Russell appeals from a judgment,
entered after a jury convicted him of second-degree sexual assault of a child,
contrary to � 948.02(2), Stats. �He also appeals from an order denying his
postconviction motions. �Russell claims:
(1) that he received ineffective assistance of trial counsel; and
(2) that the trial court erroneously exercised its sentencing
discretion. �Because Russell received
effective assistance of trial counsel and because the trial court did not
erroneously exercise its sentencing discretion, we affirm.
I. BACKGROUND
�����������������������Russell was charged with
sexually assaulting a fourteen-year-old girl, Sharon F. �The case was tried to a jury. �During the trial, Detective Edward Benish
volunteered his opinion that Sharon was telling the truth. �Instead of objecting to Benish's statement,
Russell's trial counsel chose to deflate the objectionable testimony on
cross-examination.
�����������������������Sharon's stepmother also
testified during the State's case. �She
explained that when Sharon gets scared, Sharon often says �I don't know� in
response to questions. �At the close of
the trial, the jury was instructed with the pattern instruction on reasonable
doubt, Wis J I�Criminal140
(1991). �Russell was convicted and
sentenced to eight years in prison.
�����������������������Russell filed
postconviction motions alleging ineffective assistance of trial counsel and improper
sentencing. �The trial court denied his
motions. �He now appeals.
II. DISCUSSION
A. Ineffective
Assistance Claims.
�����������������������The United States
Supreme Court set out the two-part test for ineffective assistance of counsel
under the Sixth Amendment in Strickland v. Washington, 466
U.S. 668 (1984). �The first prong of Stricklandrequires that the defendant show that counsel's performance was deficient. � Id.at 687. �This demonstration must be accomplished
against the �strong presumption that counsel acted reasonably within
professional norms.� � State v.
Johnson, 153 Wis.2d 121, 127, 449 N.W.2d 845, 848 (1990). �The second Stricklandprong
requires that the defendant show that counsel's errors were serious enough to
render the resulting conviction unreliable. � Strickland, 466 U.S. at 687. �In reviewing the trial court's decision, we accept its findings
of fact, its ��underlying findings of what happened,�� unless they are clearly
erroneous, while reviewing �the ultimate determination of whether counsel's
performance was deficient and prejudicial� de novo. � Johnson, 153 Wis.2d at 127-28,
449 N.W.2d at 848.
�����������������������First, Russell claims
that trial counsel was ineffective because he failed to object to Benish's
statement that Sharon was telling the truth. �We reject this claim. �Although
Benish's statement may have violated the rule announced in State v.
Haseltine, 120 Wis.2d 92, 96, 352 N.W.2d 673, 676 (Ct. App. 1984) (that
no witness should be allowed to opine as to whether another witness is telling
the truth), trial counsel's strategy of attacking the statement on
cross-examination was within the range of professionally competent assistance.
�����������������������As documented by the
record, trial counsel was effective in his cross-examination of Benish on this
point. �Trial counsel queried: �You
really can't tell me whether or not [Sharon is] telling the truth, the absolute
truth?� �Benish responded: ��No, sir.� �We have previously held that trial counsel's decision to forego an
objection based on his intent to impeach the statement at a later time
constitutes effective performance. � State
v. Vinson, 183 Wis.2d 297, 307-08, 515 N.W.2d 314, 318-19 (Ct. App.
1994). �We conclude that trial counsel's
strategy in the instant case was to avoid drawing unnecessary attention to the
statement volunteered by Benish because he felt cross-examination would more
effectively refute it. �Such strategy
does not constitute deficient performance.
�����������������������Next, Russell claims
that his trial counsel should have objected to the stepmother's testimony
regarding Sharon's typical reaction to questions. �Russell asserts that this testimony was irrelevant. �However, he does not offer any citation to
authority to support his argument and, therefore, we decline to consider
it. � See State v. Pettit,
171 Wis.2d 627, 646-47, 492 N.W.2d 633, 642 (Ct. App. 1992) (appellate court
may decline to address issues that are inadequately briefed; arguments that are
not supported by legal authority will not be considered).
�����������������������Finally, Russell claims
that his trial counsel should have objected to the pattern jury instruction on
reasonable doubt because it conflicts with the standard of proof for criminal
cases described in In re Winship, 397 U.S. 358 (1970). �Our supreme court recently addressed and
rejected this contention in State v. Avila, 192 Wis.2d 870,
886-89, 532 N.W.2d 423, 429-30 (1995). �Accordingly, we cannot fault trial counsel for failing to object to a
jury instruction that our supreme court has held is not objectionable.
B. Sentencing
Discretion.
�����������������������Russell claims that the
trial court relied on improper factors in imposing sentence. �Specifically, he claims that the trial
court's reference to the victim's lower mental age was improper because that
fact was not a part of the record, and that the trial court imposed a greater
sentence because Russell refused to admit guilt.
�����������������������Our standard of review
when reviewing a criminal sentencing is whether or not the trial court
erroneously exercised its discretion. � State
v. Plymesser, 172 Wis.2d 583, 585 n.1, 493 N.W.2d 367, 369 n.1 (1992).
�����������������������Russell claims that the
trial court's reference to Sharon's mental age of ten years was improper
because there was no basis in the record to support such a statement. �We disagree. �The sentencing transcript demonstrates that Sharon's stepmother
represented to the trial court that Sharon's mental age was ten years. [1] �In addition, at the sentencing hearing, the
prosecutor referred to similar representations contained in the presentence
investigation report. �This is
sufficient for the trial court to reference this fact and accordingly, we
conclude that the trial court did not erroneously exercise its discretion in
considering this factor. � See Dawson
v. Delaware, 503 U.S. 159, 164 (1992) (a sentencing court is ��largely
unlimited either as to the kind of information [it] may consider, or the source
from which it may come��).
�����������������������Russell also claims that
the trial court's reliance on Russell's refusal to admit guilt was
improper. �We disagree. �Relying on this factor is improper only when
the trial court bases its sentencing decision exclusively on the defendant's
refusal to admit guilt. � State v.
Carrizales, 191 Wis.2d 85, 96, 528 N.W.2d 29, 34 (Ct. App. 1995). �It is clear from the record that the trial
court in the instant case did not rely solely on Russell's failure to admit
guilt when it imposed sentenced. �The
trial court discussed Russell's refusal to admit guilt as it related to his
rehabilitation needs, which is appropriate. � See State v. Baldwin, 101 Wis.2d 441, 459, 304
N.W.2d 742, 752 (1981) (defendant's refusal to admit guilt may be relevant to
sentencing factor regarding the defendant's need for rehabilitation). �Further, the record demonstrates that the
trial court �considered the three
primary factors: �the gravity of the
offense, the character of the offender, and the need to protect the public,
when it imposed sentence. � State
v. Harris, 119 Wis.2d 612, 623, 350 N.W.2d 633, 639 (1984).
�����������������������Accordingly, we cannot
say that the trial court erroneously exercised its sentencing discretion.
�����������������������By the Court. �Judgment
and order affirmed.
���� [1] The stepmother told
the sentencing court: ��When I first met
Sharon, she was 13. �However, judging by
her behavior, if I as a mother were asked to estimate her age as all mothers
do, I would have said she was nine or ten. �Her behaviors were consistent with that age group.�
| https://www.wicourts.gov/ca/opinion/DisplayDocument.html?content=html&seqNo=8409 |
Study explores link between shark nose shape, size and sensitivity of smell: Researchers first to quantify olfactory organ morphology in fine detail -- ScienceDaily
Differences in sharks' olfactory systems are of interest not only because of their reputation for having an incredible sense of smell but also because they have been around since before the dinosaurs. They managed to thrive in every known marine habitat for millions of years -- their sense of smell may have been key. A study is the first to quantify olfactory organ morphology by examining rosette shape and other internal structures among a diverse set of shark species using dissections, phylogenetic comparisons, and a fairly new technique, called diffusible iodine?based contrast-enhanced computed tomography imaging. Results reveal that the organs did not change in shape or number of lamellae throughout the life stages, suggesting that olfaction is a key sensory modality throughout the life of elasmobranch fishes.
Study explores link between shark nose shape, size and sensitivity of smell
Researchers first to quantify olfactory organ morphology in fine detail
Summary:
Differences in sharks' olfactory systems are of interest not only because of their reputation for having an incredible sense of smell but also because they have been around since before the dinosaurs. They managed to thrive in every known marine habitat for millions of years -- their sense of smell may have been key. A study is the first to quantify olfactory organ morphology by examining rosette shape and other internal structures among a diverse set of shark species using dissections, phylogenetic comparisons, and a fairly new technique, called diffusible iodine?based contrast-enhanced computed tomography imaging. Results reveal that the organs did not change in shape or number of lamellae throughout the life stages, suggesting that olfaction is a key sensory modality throughout the life of elasmobranch fishes.
Sharks have reputations as "super smellers" that use olfaction to detect odors related to finding prey and mates, communicating with their own species and avoiding predators. Their olfactory system is unique because it is separate from the respiratory system, unlike humans. Sharks and other fish use gills to facilitate the uptake of oxygen, while two nares or nostrils on the shark's head take in odors from the environment.
Despite general similarities among elasmobranch species' (sharks, rays and skates) olfactory systems, the morphology or structure of their olfactory organ, or "rosette," differs substantially. Located in their snouts, the multi-lamellar (layered tissue) rosette is covered with both non-sensory and sensory tissue that responds to distinct odor molecules in an aquatic environment. The number, size and arrangement of lamellae differ among elasmobranch species, but the functional consequences for these differences are not fully understood.
Researchers have not yet been able to correlate organ size and complexity to odor sensitivity in teleosts (ray-finned fishes) nor elasmobranchs. Differences in sharks' olfactory systems are of particular interest not only because of their reputation for having an incredible sense of smell but also because these remarkable animals have been around since before the dinosaurs. They somehow managed to thrive in every known marine habitat for millions of years -- their sense of smell may have been key to their success.
Researchers from Florida Atlantic University are the first to quantify olfactory organ morphology by examining rosette shape and other internal structures among a diverse set of shark species using dissections, phylogenetic comparisons, and a fairly new technique, called diffusible iodine-based contrast-enhanced computed tomography (diceCT) imaging.
Results, published in the Journal of Morphology ,reveal that the organs did not change in shape or number of lamellae throughout the life stages, suggesting that olfaction is a key sensory modality throughout the life of elasmobranch fishes.
Overall, researchers found more lamellae in rosettes with an elongated shape than in organs with a short and wide shape. Phylogenetic analyses showed that 2D shape and lamellar count are critical to understanding rosette variations in unrelated species.
Researchers also used in situvalues of rosette volume and 2D shape from diceCT to assess the impacts of dissection on morphological measurements. Rosette measurements from dissected organs did not differ significantly compared to those from CT scans, supporting the validity of both methods.
"From our CT scans, we used raw data files that have 2D x-ray images. We then created 3D reconstructions to visualize the data. As such, we were able to examine the internal morphology from the top of the head to the tip of the snout from different angles," said Aubrey Clark, corresponding author and a doctoral student in FAU's Biomechanics Lab within the Charles E. Schmidt College of Science. "Think of this method as taking a stack of sticky notes and removing them one at a time to see the sticky note underneath. It is incredibly useful to help us understand the internal morphology in situor as it exists naturally inside the shark because dissections can alter structures."
Among the species studied included the bonnethead sharks ( S. tiburo) with rosettes that are narrow and elongated; the common thresher sharks ( A. vulpinus) and shortfin mako sharks ( I. oxyrinchus), which share similarities in their rosettes: a shape that is almost as wide as it is long, a thicker raphe, fewer lamellae and wider interlamellar distances; and blacktip sharks ( C. limbatus) and Atlantic sharpnose sharks ( R. terraenovae) with rosettes that are intermediate to the two aforementioned groups. Other members of the hammerhead shark family have long, thin olfactory organs, similar to the bonnethead shark.
"The shape and internal structure should be considered when characterizing olfactory rosettes in sharks in future studies because fineness ratio (2D shape) and lamellar number were the largest contributors to our phylogenetic analyses," said Marianne E. Porter, Ph.D., senior author and an associate professor, Department of Biological Sciences, FAU's Charles E. Schmidt College of Science. "Data from our study also should be used to further investigate rosette variation among elasmobranch species by examining the hydrodynamics of the olfactory system with 3D models and quantifying the physiological impacts of flow on odorant binding."
Study co-author is Tricia Meredith, Ph.D., director of research, FAU's A.D. Henderson University School and FAU High School, and an assistant research professor in FAU's College of Education.
Video:https://youtu.be/zyr8SMkWiu8
Story Source:
Materialsprovided byFlorida Atlantic University. Note: Content may be edited for style and length.
Journal Reference:
Aubrey Clark, Marianne Porter, Tricia Meredith. Morphometric analysis of the elasmobranch olfactory rosette. Journal of Morphology, 2022; 283 (11): 1464 DOI: 10.1002/jmor.21514
| https://www.sciencedaily.com/releases/2022/11/221129112710.htm |
ENDOMETRIN- progesterone insert
Drug interactions, ingredients, warnings, and packaging details.
ENDOMETRIN- progesterone insert
ENDOMETRIN by
Drug Labeling and Warnings
ENDOMETRIN by is a Prescription medication manufactured, distributed, or labeled by Ferring Pharmaceuticals Inc., Sharp Corporation, QPharma, Pharmaceutics International Inc., Pharmacia and Upjohn Company LLC. Drug facts, warnings, and ingredients follow.
Drug Details [ pdf ]
HIGHLIGHTS OF PRESCRIBING INFORMATION
These highlights do not include all the information needed to use ENDOMETRIN safely and effectively. See full prescribing information for ENDOMETRIN. ENDOMETRIN ® (progesterone) Vaginal Insert 100 mg Initial U.S. Approval: 2007
INDICATIONS AND USAGE
ENDOMETRIN ®is a progesterone indicated to support embryo implantation and early pregnancy by supplementation of corpus luteal function as part of an Assisted Reproductive Technology (ART) treatment program for infertile women. (1)
DOSAGE AND ADMINISTRATION
The dose of ENDOMETRIN is 100 mg administered vaginally two or three times daily starting the day after oocyte retrieval and continuing for up to 10 weeks total duration. Efficacy in women 35 years of age and older has not been clearly established. The appropriate dose of ENDOMETRIN in this age group has not been determined. (2.1)
DOSAGE FORMS AND STRENGTHS
100 mg vaginal insert ( 3 )
CONTRAINDICATIONS
Previous allergic reactions to progesterone or any of the ingredients of ENDOMETRIN Vaginal Insert ( 4 )
Undiagnosed vaginal bleeding ( 4 )
Known missed abortion or ectopic pregnancy ( 4 )
Liver disease ( 4 )
Known or suspected malignancy of the breast or genital organs ( 4 )
Active arterial or venous thromboembolism or severe thrombophlebitis, or a history of these events ( 4 )
WARNINGS AND PRECAUTIONS
Life-threatening arterial or venous thromboembolic disorders may occur during hormone treatment, including treatment with ENDOMETRIN. Discontinue ENDOMETRIN if any of these are suspected. ( 5.1 )
Observe patients with a history of depression closely. Consider discontinuation if symptoms worsen. ( 5.2 )
ENDOMETRIN is not recommended for use with other vaginal products (such as antifungal products) as this may alter progesterone release and absorption from the vaginal insert. ( 5.3 )
ADVERSE REACTIONS
The most common adverse reactions reported (greater than 2%) were post-oocyte retrieval pain, abdominal pain, nausea, and ovarian hyperstimulation syndrome. (6)
This leaflet summarizes the most important information about ENDOMETRIN. To report SUSPECTED ADVERSE REACTIONS, contact Ferring Pharmaceuticals Inc. at 1-888-FERRING (1-888-337-7464) or FDA at 1-800-FDA-1088 or www.fda.gov/medwatch.
See 17 for PATIENT COUNSELING INFORMATION and FDA-approved patient labeling.
Revised: 1/2018
Table of Contents
FULL PRESCRIBING INFORMATION: CONTENTS *
1 INDICATIONS AND USAGE
2 DOSAGE AND ADMINISTRATION
2.1 General Dosing Information
3 DOSAGE FORMS AND STRENGTHS
4 CONTRAINDICATIONS
5 WARNINGS AND PRECAUTIONS
5.1 Cardiovascular or Cerebrovascular Disorders
5.2 Depression
5.3 Use of Other Vaginal Products
6 ADVERSE REACTIONS
6.1 Clinical Studies Experience
6.2 Expected Adverse Reaction Profile Seen with Progesterone
7 DRUG INTERACTIONS
8 USE IN SPECIFIC POPULATIONS
8.1 Pregnancy
8.3 Nursing Mothers
8.4 Pediatric Use
8.5 Geriatric Use
10 OVERDOSAGE
11 DESCRIPTION
12 CLINICAL PHARMACOLOGY
12.1 Mechanism of Action
12.3 Pharmacokinetics
13 NONCLINICAL TOXICOLOGY
13.1 Carcinogenesis, Mutagenesis, Impairment of Fertility
14 CLINICAL STUDIES
14.1 Luteal Supplementation During Assisted Reproductive Treatment Study
16 HOW SUPPLIED/STORAGE AND HANDLING
17 PATIENT COUNSELING INFORMATION
17.1 Vaginal Bleeding
17.2 Common Adverse Reactions with Progesterone
17.3 Coadministration of Other Vaginal Products
* Sections or subsections omitted from the full prescribing information are not listed.
1 INDICATIONS AND USAGE
ENDOMETRIN ®(progesterone) is indicated to support embryo implantation and early pregnancy by supplementation of corpus luteal function as part of an Assisted Reproductive Technology (ART) treatment program for infertile women.
2 DOSAGE AND ADMINISTRATION
2.1 General Dosing Information
The dose of ENDOMETRIN is 100 mg administered vaginally two or three times daily starting the day after oocyte retrieval and continuing for up to 10 weeks total duration. Efficacy in women 35 years of age and older has not been clearly established. The appropriate dose of ENDOMETRIN in this age group has not been determined.
3 DOSAGE FORMS AND STRENGTHS
100 mg vaginal insert is a white to off-white oblong-shaped tablet debossed with "FPI" on one side and "100" on the other side.
4 CONTRAINDICATIONS
ENDOMETRIN is contraindicated in individuals with any of the following conditions:
Previous allergic reactions to progesterone or any of the ingredients of ENDOMETRIN [ see Description (11) ] Previous allergic reactions to progesterone or any of the ingredients of ENDOMETRIN [ see Description (11) ]
Undiagnosed vaginal bleeding Undiagnosed vaginal bleeding
Known missed abortion or ectopic pregnancyKnown missed abortion or ectopic pregnancy
Liver diseaseLiver disease
Known or suspected malignancy of the breast or genital organsKnown or suspected malignancy of the breast or genital organs
Active arterial or venous thromboembolism or severe thrombophlebitis, or a history of these eventsActive arterial or venous thromboembolism or severe thrombophlebitis, or a history of these events
5 WARNINGS AND PRECAUTIONS
5.1 Cardiovascular or Cerebrovascular Disorders
The physician should be alert to earliest signs of myocardial infarction, cerebrovascular disorders, arterial or venous thromboembolism (venous thromboembolism or pulmonary embolism), thrombophlebitis, or retinal thrombosis. ENDOMETRIN should be discontinued if any of these are suspected.
5.2 Depression
Patients with a history of depression need to be closely observed. Consider discontinuation if symptoms worsen.
5.3 Use of Other Vaginal Products
ENDOMETRIN should not be recommended for use with other vaginal products (such as antifungal products) as this may alter progesterone release and absorption from the vaginal insert [ see Drug Interactions (7)].
6 ADVERSE REACTIONS
6.1 Clinical Studies Experience
Because clinical trials are conducted under widely varying conditions, adverse reaction rates observed in the clinical trials of a drug cannot be directly compared to rates in the clinical trials of another drug and may not reflect the rates observed in practice.
The safety data reflect exposure to ENDOMETRIN in 808 infertile women (74.9% White, 10.3% Hispanic, 5.4% Black, 5% Asian, and 4.6% Other) in a single Assisted Reproductive Technology 10 week clinical study conducted in the U.S. ENDOMETRIN was studied at doses of 100 mg twice daily and 100 mg three times daily. The adverse reactions that occurred at a rate greater than or equal to 2% in either ENDOMETRIN group are summarized in Table 1.
Table 1: Number and Frequency of Reported Adverse Reactions in Women Treated with ENDOMETRIN in an Assisted Reproductive Technology Study Body System ENDOMETRIN 100 mg twice daily (N=404) ENDOMETRIN 100 mg three times daily (N=404) Preferred Term Gastrointestinal Disorders Abdominal pain 50 (12%) 50 (12%) Nausea 32 (8%) 29 (7%) Abdominal distension 18 (4%) 17 (4%) Constipation 9 (2%) 14 (3%) Vomiting 13 (3%) 9 (2%) General Disorders and Administration Site Conditions Fatigue 7 (2%) 12 (3%) Infections and Infestations Urinary tract infection 9 (2%) 4 (1%) Injury, Poisoning and Procedural Complications Post-oocyte retrieval pain 115 (28%) 102 (25%) Nervous System Disorders Headache 15 (4%) 13 (3%) Reproductive System and Breast Disorders Ovarian hyperstimulation syndrome 30 (7%) 27 (7%) Uterine spasm 15 (4%) 11 (3%) Vaginal bleeding 13 (3%) 14 (3%)
Other less common reported adverse reactions included vaginal irritation, itching, burning, discomfort, urticaria, and peripheral edema.
6.2 Expected Adverse Reaction Profile Seen with Progesterone
ENDOMETRIN is also expected to have adverse reactions similar to other drugs containing progesterone that may include breast tenderness, bloating, mood swings, irritability, and drowsiness.
7 DRUG INTERACTIONS
No formal drug-drug interaction studies have been conducted for ENDOMETRIN. Drugs known to induce the hepatic cytochrome-P450-3A4 system (such as rifampin, carbamazepine) may increase the elimination of progesterone.
The effect of concomitant vaginal products on the exposure of progesterone from ENDOMETRIN has not been assessed. ENDOMETRIN is not recommended for use with other vaginal products (such as antifungal products) as this may alter progesterone release and absorption from the vaginal insert [ see Warnings and Precautions (5.3)].
8 USE IN SPECIFIC POPULATIONS
8.1 Pregnancy
ENDOMETRIN has been used to support embryo implantation and maintain clinical pregnancy in one clinical study. The live birth outcomes of these pregnancies were as follows:
Among the 404 subjects treated with ENDOMETRIN twice daily, 143 subjects had live births consisting of 85 singletons, 56 twins, and 2 triplets. In this treatment group, 13 subjects had a spontaneous abortion, 1 subject had an ectopic pregnancy, and 7 subjects reported fetal birth defects (3.4% based on 203 livebirths).
Among the 404 subjects treated with ENDOMETRIN three times daily, 155 subjects had livebirths consisting of 91 singletons, 60 twins, and 4 triplets. In this treatment group, 22 subjects had a spontaneous abortion, 4 subjects had an ectopic pregnancy, and 7 subjects reported fetal birth defects (3.1% based on 223 livebirths).
Birth defects reported in the ENDOMETRIN twice daily group included: one fetus with a cleft palate and intrauterine growth retardation, one fetus with spina bifida, three fetuses with congenital heart defects, one fetus with an umbilical hernia, and one fetus with an intestinal anomaly.
Birth defects reported in the ENDOMETRIN three times daily group included: one fetus with an esophageal fistula, one fetus with hypospadias and an underdeveloped right ear, one fetus with Down's Syndrome and an atrial septal defect, one fetus with congenital heart anomalies, one fetus with DiGeorge's syndrome, one fetus with a hand deformity, and one fetus with cleft palate.
For additional information on the pharmacology of ENDOMETRIN and pregnancy outcome information [ see Clinical Pharmacology (12) and Clinical Studies Sections (14)].
8.3 Nursing Mothers
Detectable amounts of progesterone have been identified in the milk of nursing mothers. The effect of this on the nursing infant has not been determined.
8.4 Pediatric Use
This drug is not intended for pediatric use and no clinical data have been collected in children. Therefore, the safety and effectiveness of ENDOMETRIN in pediatric patients have not been established.
8.5 Geriatric Use
No clinical data have been collected in patients over age 65.
10 OVERDOSAGE
Treatment of overdosage consists of discontinuation of ENDOMETRIN together with institution of appropriate symptomatic and supportive care.
11 DESCRIPTION
ENDOMETRIN (progesterone) Vaginal Insert contains micronized progesterone. ENDOMETRIN is supplied with polyethylene vaginal applicators.
The active ingredient, progesterone, is present in 100 mg amount along with other excipients. The chemical name for progesterone is pregn-4-ene-3,20-dione. It has an empirical formula of C 21H 30O 2and a molecular weight of 314.5. Progesterone exists in two polymorphic forms. The form used in ENDOMETRIN, the alpha-form, has a melting point of 127-131°C.
The structural formula is:
Each ENDOMETRIN Vaginal Insert delivers 100 mg of progesterone in a base containing lactose monohydrate, polyvinylpyrrolidone, adipic acid, sodium bicarbonate, sodium lauryl sulfate, magnesium stearate, pregelatinized starch, and colloidal silicon dioxide.
12 CLINICAL PHARMACOLOGY
12.1 Mechanism of Action
Progesterone is a naturally occurring steroid that is secreted by the ovary, placenta, and adrenal gland. In the presence of adequate estrogen, progesterone transforms a proliferative endometrium into a secretory endometrium. Progesterone is necessary to increase endometrial receptivity for implantation of an embryo. Once an embryo is implanted, progesterone acts to maintain a pregnancy.
12.3 Pharmacokinetics
Absorption
Progesterone serum concentrations increased following the administration of the ENDOMETRIN Vaginal Insert in 12 healthy pre-menopausal females. On single dosing, the mean C maxwas 17.0 ng/mL in the ENDOMETRIN twice daily group and 19.8 ng/mL in the ENDOMETRIN three times daily group. On multiple dosing, steady-state concentrations were attained within approximately 1 day after initiation of treatment with ENDOMETRIN. Both ENDOMETRIN regimens provided average serum concentrations of progesterone exceeding 10 ng/mL on Day 5. The pharmacokinetic results are summarized in Table 2.
Table 2: Mean (±Standard Deviation) Serum Progesterone Pharmacokinetic Parameters Pharmacokinetic Parameter (unit) ENDOMETRIN 100 mg twice daily (N=6) ENDOMETRIN 100 mg three times daily (N=6) C max Maximum progesterone serum concentration. T max Time to maximum progesterone serum concentration. C avg Average progesterone serum concentration. AUC 0-24 Area under the drug concentration versus time curve from 0-24 hours post dose. C min Minimum progesterone serum concentration. Single Dosing C max (ng/mL) 17.0 ± 6.5 19.8 ± 7.2 T max (hr) 24.0 ± 0.0 17.3 ± 7.4 AUC 0-24 (ng∙hr/mL) 217 ± 113 284 ± 143 Day 5 of Multiple Dosing C max (ng/mL) 18.5 ± 5.5 24.1 ± 5.6 T max (hr) 18.0 ± 9.4 18.0 ± 9.4 C min (ng/mL) 8.9 ± 4.5 10.9 ± 6.7 C avg (ng/ml) 14.0 ± 4.8 15.9 ± 4.3 AUC 0-24 (ng∙hr/mL) 327 ± 127 436 ± 106
Distribution
Progesterone is approximately 96% to 99% bound to serum proteins, primarily to serum albumin and corticosteroid binding globulin.
Metabolism
Progesterone is metabolized primarily by the liver, largely to pregnanediols and pregnanolones. Pregnanediols and pregnanolones are conjugated in the liver to glucuronide and sulfate metabolites. Progesterone metabolites that are excreted in the bile may be deconjugated and may be further metabolized in the gut via reduction, dehydroxylation, and epimerization.
Excretion
Progesterone undergoes renal and biliary elimination. Following injection of labeled progesterone, 50-60% of the excretion of metabolites occurs via the kidney; approximately 10% occurs via the bile and feces. Overall recovery of the labeled material accounts for 70% of an administered dose. Only a small portion of unchanged progesterone is excreted in the bile .
13 NONCLINICAL TOXICOLOGY
13.1 Carcinogenesis, Mutagenesis, Impairment of Fertility
Nonclinical toxicity studies to determine the potential of ENDOMETRIN to cause carcinogenicity or mutagenicity have not been performed. The effect of ENDOMETRIN on fertility has not been evaluated in animals.
14 CLINICAL STUDIES
14.1 Luteal Supplementation During Assisted Reproductive Treatment Study
A randomized, open-label, active-controlled study evaluated the efficacy of 10 weeks of treatment with two different daily dosing regimens of ENDOMETRIN (100 mg twice daily and 100 mg three times daily) for support of implantation and early pregnancy in infertile women participating in an Assisted Reproductive Technology treatment program. Efficacy was assessed on the endpoint of ongoing pregnancies, defined as the presence of at least one fetal heartbeat seen on ultrasound at 6 weeks post-embryo transfer. The study randomized to ENDOMETRIN 808 infertile women (74.9% White; 10.3% Hispanic, 5.4% Black, 5% Asian, and 4.6% Other) between 19 and 42 years of age (mean age 33) who had a body mass index <34 kg/m 2at screening.
The ongoing pregnancy rates for subjects treated with both dosing regimens of ENDOMETRIN were non-inferior (lower bounds of the 95% confidence interval of the difference between ENDOMETRIN and the active comparator excluded a difference greater than 10%) to the ongoing pregnancy rate for subjects treated with the active comparator. The results of this study are shown in Table 3.
Table 3: Ongoing Pregnancy Rates * in Patients Receiving ENDOMETRIN for Luteal Supplementation and Early Pregnancy While in an Assisted Reproductive Technology Treatment Program ENDOMETRIN 100 mg twice daily ENDOMETRIN 100 mg three times daily * Ongoing pregnancy defined as the presence of at least one fetal heartbeat seen on ultrasound at 6 weeks post-embryo transfer. Number of subjects 404 404 Ongoing pregnancy: n (%) 156 (39%) 171 (42%) 95% Confidence Interval of pregnancy rate [33.8, 43.6] [37.5, 47.3] Pregnancy rate percentage difference between ENDOMETRIN and comparator -3.6% 0.1% 95% Confidence Interval for difference vs comparator [-10.3, 3.2] [-6.7, 6.9]
Subjects participating in the study were stratified at randomization by age and ovarian reserve (as measured by serum FSH levels). The ongoing pregnancy rates for these subgroups are shown in Table 4.
Table 4: Ongoing Pregnancy Rates in Age- and Ovarian Reserve-Defined Subgroups Receiving ENDOMETRIN for Luteal Supplementation and Early Pregnancy While in an Assisted Reproductive Technology Treatment Program ENDOMETRIN 100 mg twice daily ENDOMETRIN 100 mg three times daily Subjects age < 35 years (N) 247 247 Ongoing pregnancy: n (%) 111 (45%) 117 (47%) Pregnancy rate percentage difference between ENDOMETRIN and comparator 0.5% 2.9% 95% Confidence Interval for difference vs. comparator [-8.3, 9.3] [-5.9, 11.7] Subjects 35-42 years of age (N) 157 157 Ongoing pregnancy: n (%) 45 (28%) 54 (34%) Pregnancy rate percentage difference between ENDOMETRIN and comparator -10.1% -4.4% 95% Confidence Interval for difference vs. comparator [-20.3, 0.3] [-14.9, 6.3] Subjects with FSH < 10 IU/L (N) 350 347 Ongoing pregnancy: n (%) 140 (40%) 150 (43%) Pregnancy rate percentage difference between ENDOMETRIN and comparator -2.0% 1.2% 95% Confidence Interval for difference vs. comparator [-9.3, 5.3] [-6.1, 8.5] Subjects with FSH between 10 and 15 IU/L (N) 46 51 Ongoing pregnancy: n (%) 16 (35%) 20 (39%) Pregnancy rate percentage difference between ENDOMETRIN and comparator -12.2% -7.7% 95% Confidence Interval for difference vs. comparator [-31.0, 7.7] [-26.6, 11.6]
In subjects under the age of 35 or with serum FSH levels less than 10 IU/L, results from both dosing regimens were non-inferior to the results from the comparator with respect to ongoing pregnancy rates. In women age 35 and older and in women with serum FSH levels between 10 and 15 IU/L, the results with respect to ongoing pregnancy rates for both dosing regimens of ENDOMETRIN did not reach the criteria for non-inferiority.
Subjects who became pregnant received study medication for a total of 10 weeks. Patients over 34 kg/m 2were not studied. The efficacy of ENDOMETRIN in this patient group is unknown.
16 HOW SUPPLIED/STORAGE AND HANDLING
Each ENDOMETRIN Vaginal Insert is a white to off-white oblong-shaped insert debossed with "FPI" on one side and "100" on the other side. Each ENDOMETRIN (progesterone) Vaginal Insert, 100 mg, is packed individually in a sealed foil pouch. These pouches are available in cartons packed:
21 vaginal inserts with 21 disposable vaginal applicators (NDC: 55566-6500-3 )
Store at 20 - 25°C (68 - 77°F); excursions permitted between 15 - 30°C (59 - 86°F).
MANUFACTURED FOR:FERRING PHARMACEUTICALS INC.PARSIPPANY, NJ 07054
6485-03Revised: 01/2018
17 PATIENT COUNSELING INFORMATION
SeeFDA-Approved Patient Labeling (17.4).
17.1 Vaginal Bleeding
Inform patients of the importance of reporting irregular vaginal bleeding to their doctor as soon as possible.
17.2 Common Adverse Reactions with Progesterone
Inform patients of the possible side effects of progesterone therapy such as headaches, breast tenderness, bloating, mood swings, irritability, and drowsiness.
17.3 Coadministration of Other Vaginal Products
Inform patients that ENDOMETRIN is not recommended for use with other vaginal products.
17.4 FDA-Approved Patient Labeling
PATIENT PACKAGE INSERT
IMPORTANT: For Vaginal Use Only .
Read the patient information that comes with ENDOMETRIN ®(progesterone) before you start to use it and each time you get a refill. There may be new information. This leaflet does not take the place of talking with your doctor about your medical condition or treatment. Your doctor may do a physical exam before prescribing ENDOMETRIN.
What is ENDOMETRIN?
ENDOMETRIN is a vaginal insert that contains the hormone progesterone. ENDOMETRIN is for women who need extra progesterone while undergoing treatment in an Assisted Reproductive Technology (ART) program.
Progesterone is one of the hormones essential for helping you to become and to stay pregnant. If you are undergoing ART treatment, your doctor may prescribe ENDOMETRIN to provide the progesterone your body needs.
Who should not use ENDOMETRIN?
Do not use ENDOMETRIN if you:
Are allergic to anything in ENDOMETRIN. See the end of this leaflet for a complete list of ingredients.
Have unusual vaginal bleeding that has not been evaluated by a doctor.
Currently have or have had liver problems or cancer of the breast or genital organs.
Have or have had blood clots in the legs, lungs, eyes, or elsewhere in your body.
ENDOMETRIN may not be right for you. Before starting ENDOMETRIN, tell your doctor about all your health problems.
Tell your doctor about all the medicines you take including prescription and nonprescription medicines, vaginal products, vitamins, and herbal supplements.
Some medicines may affect ENDOMETRIN.
Know what medicines you take. Keep a list of your medicines to show to the doctor and pharmacist.
How should I use ENDOMETRIN?
Use ENDOMETRIN exactly as prescribed. The usual dose of ENDOMETRIN is one insert placed in your vagina 2 to 3 times a day for up to a total of 10 weeks, unless your healthcare provider advises otherwise.
Place an ENDOMETRIN insert in your vagina with the disposable applicator provided.
Follow the steps below:
Unwrap the applicator.
Put one insert in the space provided at the end of the applicator. The insert should fit snugly and not fall out.
Place applicator with the insert into the vagina while you are standing, sitting, or when lying on your back with your knees bent. Gently place the thin end of the applicator well into the vagina.
Push the plunger to release the insert.
Remove the applicator and throw it away in the trash.
Other information for using ENDOMETRIN
If you forget a dose of ENDOMETRIN, take the dose as soon as you remember, but do not use more than your daily dose.
Call your doctor if you use too much ENDOMETRIN.
Do not use any other vaginal products when you are using ENDOMETRIN.
What are the possible side effects of ENDOMETRIN?
Common side effects seen with ART and ENDOMETRIN included pelvic pain after surgery, abdominal pain, nausea, and swollen ovaries (ovarian hyperstimulation syndrome).
Other reported side effects included abdominal bloating, headache, urinary infections, uterine cramping, constipation, vomiting, tiredness, and vaginal bleeding.
Vaginal products with progesterone may also cause vaginal irritation, burning, and discharge.
Serious Risks of Progesterone
Progesterone can increase your chance of getting blood clots. Blood clots can be serious and lead to death.
Serious blood clots include those in the:
legs (thrombophlebitis)
lungs (pulmonary embolus)
eyes (blindness)
heart (heart attack)
brain (stroke)
Call your doctor or get medical help right away if you have:
persistent pain in the lower leg (calf)
sudden shortness of breath
coughing up blood
sudden blindness, partial or complete
severe chest pain
sudden, severe headache, vomiting, dizziness, or fainting
weakness in an arm or leg, or trouble speaking
yellowing of the skin and/or white of the eyes indicating possible liver problem
Other risks of progesterone use include:
headache
breast tenderness
bloating or fluid retention
mood swings and depression
irritability
drowsiness
Call your doctor immediately if you have abnormal vaginal bleeding.
These are not all the side effects with ENDOMETRIN. Ask your doctor or pharmacist for more information.
How should I store ENDOMETRIN?
Store ENDOMETRIN at room temperature, 20 - 25°C (68 - 77°F); excursions permitted between 15 - 30°C (59 - 86°F).
Do not use ENDOMETRIN after the expiration date that is printed on the carton.
Keep ENDOMETRIN and all medicines out of the reach of children.
General information about ENDOMETRIN
Medicines are sometimes prescribed for purposes other than those listed in a Patient Information Leaflet. Do not use ENDOMETRIN for a condition for which it was not prescribed. Do not give ENDOMETRIN to other women, even if they have the same condition as you do. It may harm them.
This leaflet summarizes the most important information about ENDOMETRIN. If you would like more information, talk with your doctor. You can ask your doctor or pharmacist for information about ENDOMETRIN that was written for healthcare professionals. For more information call Ferring Pharmaceuticals Inc. at 1-(888)-FERRING or 1-(888)-337-7464.
What are the ingredients in ENDOMETRIN?
Active Ingredient: progesterone
Inactive Ingredients: lactose monohydrate, polyvinylpyrrolidone, adipic acid, sodium bicarbonate, sodium lauryl sulfate, magnesium stearate, pregelatinized starch, and colloidal silicon dioxide
MANUFACTURED FOR:FERRING PHARMACEUTICALS INC.PARSIPPANY, NJ 07054
6485-03Revised: 01/2018
PRINCIPAL DISPLAY PANEL
PRINCIPAL DISPLAY PANEL - 100 mg Carton
NDC:55566-6500-3
Endometrin ®(progesterone) Vaginal Insert 100 mg
Contents:21 vaginal inserts with 21 disposable vaginal applicatorsEach insert contains 100 mg progesterone, USP
FOR VAGINAL USE ONLY
Rx only
Usual Dosage:See enclosed package insert for dosage andcomplete Prescribing Information.
This carton contains instructions intendedfor the patient.
FERRING PHARMACEUTICALS
INGREDIENTS AND APPEARANCE
ENDOMETRIN progesterone insert Product Information Product Type HUMAN PRESCRIPTION DRUG Item Code (Source) NDC: 55566-6500 Route of Administration VAGINAL Active Ingredient/Active Moiety Ingredient Name Basis of Strength Strength PROGESTERONE (UNII: 4G7DS2Q64Y ) (PROGESTERONE - UNII: 4G7DS2Q64Y ) PROGESTERONE 100 mg Inactive Ingredients Ingredient Name Strength LACTOSE MONOHYDRATE (UNII: EWQ57Q8I5X ) POVIDONE K30 (UNII: U725QWY32X ) ADIPIC ACID (UNII: 76A0JE0FKJ ) SODIUM BICARBONATE (UNII: 8MDF5V39QO ) SODIUM LAURYL SULFATE (UNII: 368GB5141J ) MAGNESIUM STEARATE (UNII: 70097M6I30 ) STARCH, CORN (UNII: O8232NY3SJ ) SILICON DIOXIDE (UNII: ETJ7Z6XBU4 ) Product Characteristics Color white Score Shape OVAL (Oblong) Size Flavor Imprint Code FPI;100 Contains Packaging # Item Code Package Description Marketing Start Date Marketing End Date 1 NDC: 55566-6500-3 1 in 1 CARTON 06/21/2007 1 NDC: 55566-6500-2 21 in 1 CARTON 1 NDC: 55566-6500-1 1 in 1 BLISTER PACK; Type 0: Not a Combination Product Marketing Information Marketing Category Application Number or Monograph Citation Marketing Start Date Marketing End Date NDA NDA022057 06/21/2007 Labeler - Ferring Pharmaceuticals Inc.
(103722955) Establishment Name Address ID/FEI Business Operations Sharp Corporation 143696495 pack( 55566-6500 ) Establishment Name Address ID/FEI Business Operations QPharma 508638848 manufacture( 55566-6500 ) , pack( 55566-6500 ) Establishment Name Address ID/FEI Business Operations Pharmaceutics International Inc. 878265586 manufacture( 55566-6500 ) Establishment Name Address ID/FEI Business Operations Pharmacia and Upjohn Company LLC 618054084 API MANUFACTURE( 55566-6500 )
Trademark Results [ENDOMETRIN]
Mark Image Registration | Serial Company Trademark Application Date ENDOMETRIN 76550621 3443316 Live/Registered Ferring B.V. 2003-10-09 ENDOMETRIN 75597207 2807600 Live/Registered FERRING B.V. 1998-11-30
This site is not affiliated with or endorsed by the FDA.
| https://fda.report/DailyMed/2ba50fa9-b349-40cb-9a4b-1af8faa4ec09/ |
Complainant / The Courier-Mail | Australian Press Council
Complainant / The Courier-Mail
The Press Council considered a complaint about three online articles published in The Courier-Mail, headed “Brisbane house flipper’s alleged secret life as drug trafficker" 8 July 2021, "’Hectic’: House flipping accused drug kingpin’s texts, associates" 8 July 2021 and "’WTF just happened?’: ANOM text messages revealed" 24 July 2021.
The articles reported on court proceedings of the complainant’s partner who had been charged for allegedly being involved in serious criminal activities. In reporting on the proceedings, the articles also reported the serious criminal enterprise in which the complainant’s partner and others were allegedly involved. The article headed “Brisbane house flipper’s alleged secret life as drug trafficker" reported that “A million-dollar Brisbane house flipper who has virtually no online presence is alleged by police to have been living a secret life as a high-level wholesale drug trafficker” and the article headed "’Hectic’: House flipping accused drug kingpin’s texts, associates" reported “Details of the police claims against Adelaide-born Spurling were revealed in documents filed in the Supreme Court in Brisbane as part of his successful bail application on June 22 charges of trafficking in cannabis and ice and gun trafficking”. The article headed "’WTF just happened?’: ANOM text messages revealed" reported “Text chats between Queensland men who believed they were shielded by using an encrypted app will form the basis of police allegations they plotted million dollar drug deals”.
The complainant said the 8 July 2021 articles included the names, occupations and suburbs of residence of the accused’s close relatives. The complainant said the articles also included personal information including details of her relationship with her partner, her employment details, a photograph of her as well as the name and age of their infant child. The complainant said the 24 July 2021 article also included a photograph of her as well as her employment details. The complainant said that while she acknowledged that court hearings and outcomes can be reported on, the inclusion of such personal and sensitive information was not necessary for the full, fair and accurate reporting of the alleged crime or legal proceedings. The complainant said the articles have had a direct impact on her personal and professional reputation and have caused great angst and anxiety for all the relatives involved. The complainant also said the publication of personal details and locations of various named relatives had caused serious concerns for their safety, given the seriousness of the allegations.
In response, the publication said the articles report on court documents that are available to any member of the public prepared to pay the relevant court fees. The publication said the complainant’s partner and his legal representatives made a decision to highlight the stability of his family and longstanding connections to Queensland to support his bid for bail. The publication said the court documents on which the articles are based, are replete with references to the information the complainant has expressed concern with and noted that at least one the court documents would appear to have been prepared with the complainant’s full cooperation and consent.
The publication also said that as the complainant is a solicitor, she would have been aware that once the court documents were filed, these documents would become public documents and could not only be reported on as part of a fair report but also accessed and read by any member of public who chose to apply for the court file. The publication said while it appreciates that the reports may have impacted the complainant’s reputation, this will remain true irrespective of whether the articles continue to be published or not as her partner stands charged with serious alleged drugs offences. The publication added that although the complainant would appear to have consented to her daughter’s name and date of birth being included in at least one of the court documents, it subsequently amended the articles to remove such references.
Conclusion
The Council’s Standards of Practice applicable in this matter require publications to take reasonable steps to avoid intruding on a person’s reasonable expectations of privacy unless doing so is sufficiently in the public interest (General Principle 5) and to avoid causing or contributing materially to substantial distress or prejudice, or a substantial risk to health or safety, unless sufficiently in the public interest (General Principle 6). They also require that unless otherwise restricted by law or court order, open court hearings are matters of public record and can be reported by the press. Such reports need to be fair and balanced. They should not identify relatives or friends of people accused or convicted of crime unless the reference to them is necessary for the full, fair and accurate reporting of the crime or subsequent legal proceedings (Privacy Principle 7).
The Council notes the complainant had a reduced expectation of privacy as the information about which she expressed concern is based on publicly available court documents. The Council also considers that to the extent that those named in the article did have a reasonable expectation of privacy, this was outweighed by strong public interest in open justice, including the freedom of the press to report on matters of public importance, such as the legal proceedings associated with alleged criminality. Accordingly, the Council finds no breach of General Principle 5.
The Council also finds that to the extent the complainant and the named relatives were distressed by the publication of personal information, this was outweighed by the strong public interest in reporting on serious criminal activity and associated legal proceedings. However, the Council does not consider it was necessary or sufficiently in the public interest to include the name and the age of the complainant’s infant child. Accordingly, General Principle 6 was breached in this respect. The Council welcomes the publication’s subsequent amendment to the articles to remove such references.
Publications must take reasonable steps to:
Avoid intruding on a person’s reasonable expectations of privacy unless doing so is sufficiently in the public interest.
Avoid causing or contributing materially to substantial offence, distress or prejudice, or a substantial risk to health or safety, unless doing so is sufficiently in the public interest.
PP7. In accordance with Principle 6 of the Council's Statement of General Principles, media organisations should take reasonable steps to avoid causing or contributing materially to substantial offence, distress or prejudice, or a substantial risk to health or safety, unless doing so is sufficiently in the public interest. Members of the public caught up in newsworthy events should not be exploited. A victim or bereaved person has the right to refuse or terminate an interview or photographic session at any time. Unless otherwise restricted by law or court order, open court hearings are matters of public record and can be reported by the press. Such reports need to be fair and balanced. They should not identify relatives or friends of people accused or convicted of crime unless the reference to them is necessary for the full, fair and accurate reporting of the crime or subsequent legal proceedings.
| https://presscouncil.org.au/document/1817-complainant-thecouriermail/page/22 |
(PDF) Steht die Welt allen offen? Bologna und die internationale Mobilität der Studierenden
PDF | On Jan 1, 2012, Claudia Finger published Steht die Welt allen offen? Bologna und die internationale Mobilität der Studierenden | Find, read and cite all the research you need on ResearchGate
Steht die Welt allen offen? Bologna und die internationale Mobilität der Studierenden
Research Report
Steht die Welt allen offen? Bologna und die
internationale Mobilität der Studierenden
WZBrief Bildung, No. 20
Provided in Cooperation with:
WZB Berlin Social Science Center
Suggested Citation: Finger, Claudia (2012) : Steht die Welt allen offen? Bologna und die
internationale Mobilität der Studierenden, WZBrief Bildung, No. 20
formprozesses wird die Steigerung der rä umlichen Mobili tät von Studierenden
als Ziel immer wieder hervorgehoben – zul etzt mit der konkreten Ziel marke von
mindestens 20 Prozent (Kom muniqué der Leuvener Fol gekonferenz 2009). Sei t der
Folgekonferenz i n Prag 2001 wird außerdem die sogenann te soziale Dimension des
Reformprozesses thematisiert, also „di e Stärkung des sozialen Zusammenhal ts so-
wie [der] Abbau sozialer und Geschl echterungl eichheiten auf nati onaler und euro-
päischer Ebene“ (Europäische Bildu ngsminister 2003, S. 1).
Diesem sozialen Aspekt in der Förderung von Studi erenden kommt all erdings nicht
nur weniger Umfang und Aufmerksamk eit zu (vg l. Powel l et al. 2012) – sie wird
außerdem weitgehend unabhängig von der Fr age der international en Mobilitä t dis-
kutiert. Nur an zwei Stellen (Pr ag 2001 und Leuven 2009) werden beide Themen-
bereiche explizi t zusammengeführt. Hi er wird deutlich, dass die Entscheidung fü rs
Studieren im Ausland auch von sozial en Faktoren abhängt. Formul iert wird das Ziel,
dass nicht einfach die Zahl der A uslandssemester erhöht, sondern auch die sozial e
Zusammensetzung derer, die sie nutzen, verbreitert werden muss.
Immer noch gehen Studierende, deren Eltern kei nen akademischen Abschluss ha-
ben, sel tener ins Ausland (für Deutschland vg l. Lörz/Kra wietz 2011). Ein A uslands-
aufenthalt wäh rend des Studiums erweitert den indi viduellen Erfah rungs- und
Wissensschatz und d ie Sprachkenn tnisse, er sendet posi tive Signale an potenziel le
Arbeitgeber (vgl. Schomburg 2009). Eine Benach teiligung bestimm ter sozialer Grup-
pen bedeutet also eine V erl etzung der Chancengleichhei t.
Die Inhalte des Bologna-Prozesses mögen einen stark en normativen Druck a us-
deutschen Hochschulsystem trotzdem etwas bewegt ha t: ob sich also der An teil mo-
biler Studierender aus sozial u nterrepräsentierten Gruppen i m Zuge des Bologna-
Prozesses tatsächlich erhöh t hat.
Deutsche Reaktionen auf die Mo bilitä ts-Forderungen von Bologna
Auf der rhetorischen Ebene stießen di e Bologna-Forderungen, d ie Mobilitä t von
Studierenden zu steigern und zugl eich sozial durchlässiger zu gestalten, bei zentra-
len Akteuren des deutschen Hochschulsystems a uf positive Resonanz. Im Jahr 2004
forderte der Deutsche Akademische Austauschdi enst, dass bis 2010 etwa 50 Prozent
der deutschen Studierenden einen T eil ihres Studi ums im Ausland verbracht haben
sollten (vg l. D AAD 2004). A ußerdem rät die K ultusministerk onferenz, „wirtschaftlich
oder sozial benachteiligte Menschen so wie Menschen mit besonderen Bedürfn issen
oder mit Migra tionshintergrund stärk er in die Mobil itätsprogramme ei nzubeziehen
und zusätzliche Un terstützungen in Form erhöhter Fördersä tze in Erwägung zu zie-
hen“ (KMK 2010).
Steht d ie W el t al len offen?
Bologna und d ie
in ternational e Mobi li tät
Eine konkrete Maßnahme m it dem Ziel, ein breiteres Spektrum von Studierenden
es Studierenden aus eink ommensschwächeren Elternhä usern, ihre Förderu ng mit
ins Ausland zu nehmen (zunächst erst nach ei nem Jahr an einer deutschen Hoch-
schule, mittlerweil e für die Dauer eines gesam ten Studiums). Zusä tzlich wird ein
Auslandszuschlag gewährt, dessen Höhe vom Ziel land abhängt. W eiterhin fördern
das Bundesministerium für Bild ung und Forschung und der D AAD in zunehmendem
Maße International isierungs- und Mobili tätsprogramme, so dass der Konk urrenz-
druck um interna tionale Studienplä tze abgenommen haben dürfte. Die Anzahl der
Individualstipendi en des DAAD stieg von etwa 12.000 Anfang der 1990er Jahre auf
über 25.000 im Jahr 2009.
Diese konkreten V er änderungen und die optimistische Rhetorik der Bo logna-
Papiere könn ten einen positiven Einuss auf die Mobili tätsentscheidungen sozial
benachteiligter Stud ierender gehabt haben. All erdings wird andererseits immer
häuger darauf hingewiesen, dass une xible und stark verschulte Studienpläne so -
wie ein hoher Prüfungsdruck der Mobi lität von Stud ierenden zunehmend im W ege
stehen. Dies k önnte vor all em Studierende aus nichtakademischen El ternhäusern
treffen, di e sich ein durch einen Auslandsaufen thalt verlängertes Studium oft nich t
leisten kön nen.
Die interna tionale Mobil ität der deu tschen Studierenden
seit Bologna
Hat sich nun das Mobil itätsverhal ten deutscher Studierender, insbesondere jener
mit nicht akadem isch gebildeten Eltern, im Zuge des Bologna-Prozesses verändert?
Diese Frage wurde am W ZB mithilfe der Daten der 15. (1997) und 18. (2006) Sozial er-
repräsentati ve Befragung der an deutschen Hochsch ulen immatrik ulierten Studie-
renden, di e seit 1951 alle d rei Jahre wiederholt wird. So lassen sich Trends über die
Zeit hin weg beobachten und zum Beispiel di e Fragen beantworten, ob sich die An-
zahl international mobiler Studierender sei t Beginn des Bologna-Prozesses erhöht
hat oder ob sich die Zusam mensetzung der Gruppe mobiler Studierender ver ändert
hat. Di e folgenden Ergebnisse spiegeln einen Zwischenstand wider , da der Bologna-
Prozess ja nicht nich t abgeschlossen ist. Einschr änkend muss außerdem angemerkt
werden, dass sicher nich t alle V er änderungen seit Anfang der 2000er Jahre auf
Bologna zurückgeführt werden k önnen. Als zen traler Reformprozess, der auch vo-
rangegangene und par allele En twicklungen integrierte, hat er aber auf jeden Fal l
einen bedeutenden Anteil an den V eränderungen.
Um der kürzeren Regelstudienzei t bei den neu eingeführten Bachelor-Studiengän-
gen im V ergleich zu den noch parall el laufenden „trad itionellen“ Stud iengängen (Di-
plom, Magister , Staatse xamen) Rechnung zu tr agen, wurden nu r Studierende bis zu
ihrem achten Semester in d ie Analysen einbezogen. Eine gesonderte Untersuchung
von Master-Studierenden ist mit den 2006er-Da ten aufgrund der geringen Fallzahl
leider noch nicht mög lich. Auslandsaufenthal te für ein gesamtes Studium k önnen
ebenfalls nicht erfasst werden, da nur Studierende, die an deu tschen Hochschulen
immatrik uliert sind, befragt wurden. Die fo lgenden Ergebnisse beziehen sich daher
auf Studierende bis zum achten Semester , di e an deutschen Hochschulen einge-
schrieben sind.
Wie die Abbi ldung zeigt, ist der An teil international mobiler Studierender im Jah r
Schomburg, Ha rald (Hg.) (2009): Gener ation Vielfalt. Ausgewählte Ergebn isse des
Projekts „Studienbed ingungen und Berufserfolg“. Kassel: INCHER, online: www.
wissenschaft.nrw.de/objekt-pool/do wnload_dateien/studieren_in_nrw/Bachelor/
KOAB_BER LIN_BERICHt_Okt_2009.pdf (Stand: 18.04.2012).
Wuttig, Siegbert (2004): „Die Umsetzung der EU-Progr amme mit Hochschulbezug i n
Deutschland“. In: DAAD (Hg.): Di e International e Hochschule. Mobi lität i n Europa. Ein
Handbuch für Poli tik und Praxis, Bd. 6. Bi elefeld: W . Bertelsmann V erlag, S . 35-47.
Impressum
Wissenschaftszentrum Berl in
für Sozialforschung
Social Science Research Center
Berlin
Herausgeberin:
Prof. Jutta All mendinger Ph.D.
Redaktion:
Dr. Paul Stoop
Gabriele Kammerer
Produktion:
Ingeborg Weik-K ornecki
Reichpietschufer 50
10785 Berlin
Telefon +49 (30) 25491-0
Telefax +49 (30) 25491-684
[email protected]
... In the context of these reforms of teacher training programs all over Germany, it also often occurred that the new programs turned out more rigid and inflexible than the previous models, sometimes being likened to school rather than university programs (for example in Ricken 2010, p. 118). Going against the spirit of the Bologna Declaration, the new, more structured Bachelor and Master-degree teacher training made it more challenging for students to find the time to travel and spend semester abroad
(Finger 2012
). ...
Leadership and French Principals: An Unthinkable and Paradoxical Moral Agency
Chapter
Jul 2021
Romuald Normand
French principals are exposed to paradoxes. Their ethics and values lead them to maintain a republican moral stance by affirming their attachment to public services and secularism. Their membership to a professional group within a bureaucratic organization does not predispose them to endorse managerial ideas and practices. However, as the New Public Management enters the education system, they are increasingly being required to focus on school organization and improvement. They have therefore to assume hybrid roles and responsibilities, between administration, management, and leadership, while the organizational structure remains relatively inflexible, and resources such as support are lacking. This creates a series of tensions that are presented in this chapter along with the moral agency that many principals adopt in their relationships within schools. Between hierarchical prescription and autonomy, between cooperation and conflict, between citizenship and pedagogy, they seek ways for capacity building and school improvement in a civic and egalitarian perspective. Although they are trained mainly as administrators and State representatives, they learn by doing to become managers and leaders without much recognition for their creativity and innovation. They also hardly reflect on themselves as leaders despite leadership practices that can be observed in their daily activities.
... In the context of these reforms of teacher training programs all over Germany, it also often occurred that the new programs turned out more rigid and inflexible than the previous models, sometimes being likened to school rather than university programs (for example in Ricken 2010, p. 118). Going against the spirit of the Bologna Declaration, the new, more structured Bachelor and Master-degree teacher training made it more challenging for students to find the time to travel and spend semester abroad
(Finger 2012
). ...
Entre evidence-based education et jugement professionnel, quel futur pour les enseignants et leurs savoirs ?
Chapter
Dec 2020
Vincent Dupriez
Branka Cattonar
View
... Studierende, die aus einem akademischen Elternhaus kommen, gehen während ihres Studiums häufiger ins Ausland als Studierende, deren Eltern keinen Hochschulabschluss erworben haben
(Finger 2012;
Lörz et al. 2016). Da studienbezogene Auslandserfahrungen -seien es Auslandssemester, Summer Schools oder Praktika -aber die weitere Karriere positiv beeinflussen (Kratz/Netz 2016), können auf diesem Weg soziale Ungleichheiten vom Bildungssystem auf den Arbeitsmarkt übertragen werden. ...
Neue Ungleichheiten im deutschen Hochschulsystem? Internationale Studierendenmobilität zwischen 1991 und 2012
Article
Full-text available
Nov 2016
Claudia Finger
Nicolai Netz
New Public Management and Its Effects in the Teaching Profession: Recent Trends in Spain and Catalonia
Chapter
Full-text available
Jul 2018
Antoni Verger
Marcel Pagès
Recent educational reforms and legislative changes in both Catalonia and Spain have been inspired by New Public Management (NPM). Accordingly, policy ideas such as school autonomy and accountability—including test-based accountability and the evaluation of teachers’ performance—have strongly framed the education policy debate, as well as tangible educational transformations at the school level. The objective of this chapter is two-fold. First, the chapter analyses how NPM and, with it, new forms of education evaluation and accountability have been adopted and tailored within the Spanish context, with a focus on the Catalan region. Second, the chapter analyses how accountability policies are contributing to reconfigure the teaching profession and teachers’ daily work in this region.
Education Policies, the Teaching Profession and Teacher Training in Germany—The Ever-Evolving 16-Piece Mosaic
Chapter
Jul 2018
Pierre Tulowitzki
Michael Krüger
Marvin Roller
Over the last decades, several international developments have influenced the German school system and several corresponding practices and standards. Three major developments were the results of early TIMMS and PISA studies, the global movement towards inclusive education and the Bologna process. This has affected teachership and professional standards of the teaching profession as well. The German education system is deeply characterized by the federal autonomy: the 16 German states, called the “Bundesländer” (often abbreviated “Länder”), have the authority to make their own educational policies. This is linked to the so-called “Kulturhoheit der Länder” (“sovereignty of the states regarding cultural matters”) which is part of the German “Grundgesetz”, the basic law or constitution of Germany. It is, therefore, of no surprise that there is considerable variation between the individual states, making for a very complex education system overall. This chapter presents a brief overview of the evolution of teacher training in Germany as well as three major international phenomena that have influenced it, namely the so-called PISA shock, the movement towards inclusion and the Bologna Process. First, the German education system itself is very briefly introduced, including a short historical perspective on its evolution and an introduction to the autonomy of the German federal states with regard to matters of education. This is followed by a short presentation of teacher training in Germany. Next, the teaching profession in Germany is briefly characterized. In addition, aspects of the professional development of teachers and school leaders are presented and discussed. All of this is done against the backdrop of three major international impulses for change.
Europe’s Stratified Social Space: Diagnosis and Remedies
Article
Dec 2012
Helmut Anheier
Mariella Falkenhain
For some 60 years now, various measures have been introduced to bring Europeans together as citizens, based on the idea that increased cross-border encounters would create familiarity, generate a sense of community, facilitate economic activities and ultimately bring about a shared identity, however fragile at first. Town twinning and numerous exchange and mobility programmes of many kinds are cases in point. These programmes typically were anchored in the municipal, educational and vocational realms. While these mechanisms functioned well, some seem to be losing their innovative capacity; yet all reveal a structural middle-class bias. On the whole they systematically exclude those groups among which the rise of Euro-scepticism and support for anti-European political parties is the strongest, particularly the less well-educated and the new precariat. With the fiscal crises reducing the capacity of many EU member states to support the European Project financially, what mechanisms or policy instruments could, in the sense of social engineering, strengthen social bonds across borders and re-energise Europe’s social space?
Early transitions and tertiary enrolment: The cumulative impact of primary and secondary effects on entering university in Germany
Mar 2012
ACTA SOCIOL
Martin Neugebauer
Steffen Schindler
Our aim is to assess how the number of working-class students entering German universities
can effectively be increased. Therefore, we estimate the proportion of students from the
working class that would successfully enter university if certain policy interventions were in
place to eliminate primary effects (performance differentials between social classes) and/or
secondary effects (choice differentials net of performance) at different transition points. We
extend previous research by analysing the sequence of transitions between elementary school
enrolment and university enrolment and by accounting for the impact that manipulations at
earlier transitions have on the performance distribution and size of the student ‘risk-set’ at subsequent
transitions. To this end, we develop a novel simulation procedure which seeks to find
viable solutions to the shortcomings in the German data landscape. Our findings show that
interventions are most effective if they take place early in the educational career. Neutralizing
secondary effects at the transition to upper secondary school proves to be the single most
effective means of increasing participation rates in tertiary education among working-class students.
However, this comes at the expense of lower average performance levels.
| https://www.researchgate.net/publication/277232223_Steht_die_Welt_allen_offen_Bologna_und_die_internationale_Mobilitat_der_Studierenden |
$6 in 1915 → 2018 | Inflation Calculator
The 3.17% inflation rate means $6 in 1915 is equivalent to $149.25 in 2018. This inflation calculator uses the official US consumer price index.
$6 in 1915 is worth $149.25 in 2018
Value of $6 from 1915 to 2018
$6 in 1915 is equivalent in purchasing power to about $149.25in 2018, an increase of $143.25 over 103 years. The dollar had an average inflation rate of 3.17% per yearbetween 1915 and 2018, producing a cumulative price increase of 2,387.43%.
This means that prices in 2018 are 24.87 times as high as average prices since 1915, according to the Bureau of Labor Statistics consumer price index.
The inflation rate in 1915 was 1.00%. The inflation rate in 2018 was 2.49%. The 2018 inflation rate is lower compared to the average inflation rate of 3.84% per year between 2018 and 2023.
Contents
Overview
Buying Power of $6
Inflation by City / Country
Inflation by Spending Category
Formulas & How to Calculate
Comparison to S&P 500 Index
Data Source
Inflation from 1915 to 2018
Cumulative price change
2,387.43%
Average inflation rate
3.17%
Converted amount $6 base
$149.25
Price difference $6 base
$143.25
CPI in 1915
10.100
CPI in 2018
251.230
Inflation in 1915
1.00%
Inflation in 2018
2.49%
$6 in 1915
$149.25 in 2018
USD inflation since 1915
Annual Rate, the Bureau of Labor Statistics CPI
Buying power of $6 in 1915
This chart shows a calculation of buying power equivalence for $6 in 1915 (price index tracking began in 1635).
For example, if you started with $6, you would need to end with $149.25 in order to "adjust" for inflation (sometimes refered to as "beating inflation").
When $6 is equivalent to $149.25 over time, that means that the "real value" of a single U.S. dollar decreases over time. In other words, a dollar will pay for fewer items at the store.
This effect explains how inflation erodes the value of a dollar over time. By calculating the value in 1915 dollars, the chart below shows how $6 is worth less over 103 years.
According to the Bureau of Labor Statistics, each of these USD amounts below is equal in terms of what it could buy at the time:
Dollar inflation: 1915-2018 Year Dollar Value Inflation Rate 1915 $6.00 1.00% 1916 $6.48 7.92% 1917 $7.60 17.43% 1918 $8.97 17.97% 1919 $10.28 14.57% 1920 $11.88 15.61% 1921 $10.63 -10.50% 1922 $9.98 -6.15% 1923 $10.16 1.79% 1924 $10.16 0.00% 1925 $10.40 2.34% 1926 $10.51 1.14% 1927 $10.34 -1.69% 1928 $10.16 -1.72% 1929 $10.16 0.00% 1930 $9.92 -2.34% 1931 $9.03 -8.98% 1932 $8.14 -9.87% 1933 $7.72 -5.11% 1934 $7.96 3.08% 1935 $8.14 2.24% 1936 $8.26 1.46% 1937 $8.55 3.60% 1938 $8.38 -2.08% 1939 $8.26 -1.42% 1940 $8.32 0.72% 1941 $8.73 5.00% 1942 $9.68 10.88% 1943 $10.28 6.13% 1944 $10.46 1.73% 1945 $10.69 2.27% 1946 $11.58 8.33% 1947 $13.25 14.36% 1948 $14.32 8.07% 1949 $14.14 -1.24% 1950 $14.32 1.26% 1951 $15.45 7.88% 1952 $15.74 1.92% 1953 $15.86 0.75% 1954 $15.98 0.75% 1955 $15.92 -0.37% 1956 $16.16 1.49% 1957 $16.69 3.31% 1958 $17.17 2.85% 1959 $17.29 0.69% 1960 $17.58 1.72% 1961 $17.76 1.01% 1962 $17.94 1.00% 1963 $18.18 1.32% 1964 $18.42 1.31% 1965 $18.71 1.61% 1966 $19.25 2.86% 1967 $19.84 3.09% 1968 $20.67 4.19% 1969 $21.80 5.46% 1970 $23.05 5.72% 1971 $24.06 4.38% 1972 $24.83 3.21% 1973 $26.38 6.22% 1974 $29.29 11.04% 1975 $31.96 9.13% 1976 $33.80 5.76% 1977 $36.00 6.50% 1978 $38.73 7.59% 1979 $43.13 11.35% 1980 $48.95 13.50% 1981 $54.00 10.32% 1982 $57.33 6.16% 1983 $59.17 3.21% 1984 $61.72 4.32% 1985 $63.92 3.56% 1986 $65.11 1.86% 1987 $67.49 3.65% 1988 $70.28 4.14% 1989 $73.66 4.82% 1990 $77.64 5.40% 1991 $80.91 4.21% 1992 $83.35 3.01% 1993 $85.84 2.99% 1994 $88.04 2.56% 1995 $90.53 2.83% 1996 $93.21 2.95% 1997 $95.35 2.29% 1998 $96.83 1.56% 1999 $98.97 2.21% 2000 $102.30 3.36% 2001 $105.21 2.85% 2002 $106.87 1.58% 2003 $109.31 2.28% 2004 $112.22 2.66% 2005 $116.02 3.39% 2006 $119.76 3.23% 2007 $123.17 2.85% 2008 $127.90 3.84% 2009 $127.45 -0.36% 2010 $129.54 1.64% 2011 $133.63 3.16% 2012 $136.39 2.07% 2013 $138.39 1.46% 2014 $140.64 1.62% 2015 $140.80 0.12% 2016 $142.58 1.26% 2017 $145.62 2.13% 2018 $149.25 2.49% 2019 $151.88 1.76% 2020 $153.75 1.23% 2021 $160.97 4.70% 2022 $173.85 8.00% 2023 $180.22 3.66%*
* Compared to previous annual rate. Not final. See
inflation summary
for latest 12-month trailing value.
Download as CSV/Excel
This conversion table shows various other 1915 amounts in 2018 dollars, based on the 2,387.43% change in prices:
Conversion: 1915 dollars in 2018 Initial value Equivalent value $1 dollar in 1915 $24.87 dollars in 2018 $5 dollars in 1915 $124.37 dollars in 2018 $10 dollars in 1915 $248.74 dollars in 2018 $50 dollars in 1915 $1,243.71 dollars in 2018 $100 dollars in 1915 $2,487.43 dollars in 2018 $500 dollars in 1915 $12,437.13 dollars in 2018 $1,000 dollars in 1915 $24,874.26 dollars in 2018 $5,000 dollars in 1915 $124,371.29 dollars in 2018 $10,000 dollars in 1915 $248,742.57 dollars in 2018 $50,000 dollars in 1915 $1,243,712.87 dollars in 2018 $100,000 dollars in 1915 $2,487,425.74 dollars in 2018 $500,000 dollars in 1915 $12,437,128.71 dollars in 2018 $1,000,000 dollars in 1915 $24,874,257.43 dollars in 2018
Inflation by City
Inflation can vary widely by city, even within the United States. Here's how some cities fared in 1915 to 2018 (figures shown are purchasing power equivalents of $6):
San Francisco, California : 3.39% average rate, $6 → $186.06 , cumulative change of 3,001.06%
Seattle, Washington : 3.34% average rate, $6 → $176.76 , cumulative change of 2,846.03%
New York : 3.27% average rate, $6 → $165.56 , cumulative change of 2,659.40%
Boston, Massachusetts : 3.22% average rate, $6 → $157.20 , cumulative change of 2,519.94%
Philadelphia, Pennsylvania : 3.16% average rate, $6 → $147.90 , cumulative change of 2,365.00%
Detroit, Michigan : 3.13% average rate, $6 → $143.10 , cumulative change of 2,285.06%
Houston, Texas : 3.12% average rate, $6 → $142.70 , cumulative change of 2,278.35%
Chicago, Illinois : 3.12% average rate, $6 → $142.39 , cumulative change of 2,273.11%
San Francisco, California experienced the highest rate of inflation during the 103 years between 1915 and 2018 (3.39%).
Chicago, Illinois experienced the lowest rate of inflation during the 103 years between 1915 and 2018 (3.12%).
Note that some locations showing 0% inflation may have not yet reported latest data.
Inflation by Country
Inflation can also vary widely by country. For comparison, in the UK £6.00 in 1915 would be equivalent to £602.14 in 2018, an absolute change of £596.14 and a cumulative change of 9,935.66%.
In Canada, CA$6.00 in 1915 would be equivalent to CA$130.48 in 2018, an absolute change of CA$124.48 and a cumulative change of 2,074.73%.
Compare these numbers to the US's overall absolute change of $143.25 and total percent change of 2,387.43%.
Inflation by Spending Category
CPI is the weighted combination of many categories of spending that are tracked by the government. Breaking down these categories helps explain the main drivers behind price changes.
This chart shows the average rate of inflation for select CPI categories between 1915 and 2018.
Compare these values to the overall average of 3.17% per year:
Category Avg Inflation (%) Total Inflation (%) $6 in 1915 → 2018 Food and beverages 3.96 5,351.74 327.10 Housing 4.26 7,250.21 441.01 Apparel 2.06 713.30 48.80 Transportation 3.30 2,741.46 170.49 Medical care 4.76 11,948.87 722.93 Recreation 1.09 206.89 18.41 Education and communication 1.90 594.13 41.65 Other goods and services 5.10 16,633.13 1,003.99
The graph below compares inflation in categories of goods over time. Click on a category such as "Food" to toggle it on or off:
For all these visualizations, it's important to note that not all categories may have been tracked since 1915. This table and charts use the earliest available data for each category.
Inflation rates of specific categories
Medical Care
·
Housing
·
Rent
·
Food
·
More
Inflation-adjusted measures
S&P 500 price
·
S&P 500 earnings
·
Shiller P/E
How to calculate inflation rate for $6, 1915 to 2018
Our calculations use the following inflation rate formula to calculate the change in value between 1915 and 2018:
CPI in 2018 CPI in 1915
×
1915 USD value
=
2018 USD value
Then plug inhistorical CPI values. The U.S. CPI was 10.1 in the year 1915 and 251.23 in 2018:
251.23 10.1
×
$6
=
$149.25
$6 in 1915 has the same "purchasing power" or "buying power" as $149.25 in 2018.
To get the total inflation rate for the 103 years between 1915 and 2018, we use the following formula:
CPI in 2018 - CPI in 1915 CPI in 1915
×
100
=
Cumulative inflation rate (103 years)
Plugging in the values to this equation, we get:
251.23 - 10.1 10.1
×
100
=
2,387%
Comparison to S&P 500 Index
The average inflation rate of 3.17% has a compounding effect between 1915 and 2018. As noted above, this yearly inflation rate compounds to produce an overall price difference of 2,387.43% over 103 years.
To help put this inflation into perspective, if we had invested $6 in the S&P 500 index in 1915, our investment would be nominallyworth approximately $138,379.17in 2018. This is a return on investment of 2,306,219.49%, with an absolute return of $138,373.17 on top of the original $6.
These numbers are not inflation adjusted, so they are considered nominal. In order to evaluate the realreturn on our investment, we must calculate the return with inflation taken into account.
The compounding effect of inflation would account for 95.98% of returns ($132,816.02) during this period. This means the inflation-adjusted realreturn of our $6 investment is $5,557.15. You may also want to account for capital gains tax, which would take your real return down to around $4,724 for most people.
Investment in S&P 500 Index, 1915-2018 Original Amount Final Amount Change Nominal $6 $138,379.17 2,306,219.49% Real Inflation Adjusted $6 $5,563.15 92,619.13%
Information displayed above may differ slightly from other S&P 500 calculators. Minor discrepancies can occur because we use the latest CPI data for inflation, annualized inflation numbers for previous years, and we compute S&P price and dividends from January of 1915 to latest available data for 2018 using average monthly close price.
For more details on the S&P 500 between 1915 and 2018, see thestock market returns calculator.
Data source & citation
Raw data for these calculations comes from the Bureau of Labor Statistics' Consumer Price Index(CPI), established in 1913. Price index data from 1774 to 1912 is sourced from ahistorical studyconducted by political science professor Robert Sahr at Oregon State University and from the American Antiquarian Society. Price index data from 1634 to 1773 is from the American Antiquarian Society, using British pound equivalents.
About the author
Ian Webster is an engineer and data expert based in San Mateo, California. He has worked for Google, NASA, and consulted for governments around the world on data pipelines and data analysis. Disappointed by the lack of clear resources on the impacts of inflation on economic indicators, Ian believes this website serves as a valuable public tool. Ian earned his degree in Computer Science from Dartmouth College.
| https://www.in2013dollars.com/us/inflation/1915?amount=6&endYear=2018 |
Griffith's Primary Valuation Records, Co. Carlow
Richard Griffith, a geologist based in Dublin, became Boundary Commissioner in 1825 and Commissioner of Valuation in 1827. The results of his great survey, the Primary Valuation of Ireland, were published between 1847 and 1864.
Griffith’s Primary Valuation Records, Co. Carlow
From the 1820s to the 1840s a complex process of reform attempted to standardise the basis of local taxation in Ireland. The first steps were to map and fix administrative boundaries through the Ordnance Survey and the associated Boundary Commission. The next step was to assess the productive capacity of all property in the country in a thoroughly uniform way. Richard Griffith, a geologist based in Dublin, became Boundary Commissioner in 1825 and Commissioner of Valuation in 1827. The results of his great survey, the Primary Valuation of Ireland, were published between 1847 and 1864. The valuation is arranged by county, barony, Poor Law Union, civil parish and townland, and it lists every landholder and every householder in Ireland.
Occupier_sur_name Immediate_lessor Townland County Doyle Thomas Browne, John T. Clonogan Carlow Doyle Thomas, jun. Browne, John T. Clonogan Carlow Foley Matthew Browne, John T. Clonogan Carlow Hickey Denis Browne, John T. Clonogan Carlow Hickey James Browne, John T. Clonogan Carlow Hopkins William Browne, John T. Clonogan Carlow Leary James Browne, John T. Clonogan Carlow Mellon William Browne, John T. Clonogan Carlow Murphy Catherine Browne, John T. Clonogan Carlow Murphy Margaret Browne, John T. Clonogan Carlow Redmond James Browne, John T. Clonogan Carlow Whelan John, Rev. Browne, John T. Clonogan Carlow Bolger James Browne, Robert C. Downings Carlow Bolger Patrick Browne, Robert C. Downings Carlow Brennan Patrick Browne, Robert C. Downings Carlow Brennan Peter Browne, Robert C. Downings Carlow Browne John Browne, Robert C. Downings Carlow Byrne George Browne, Robert C. Downings Carlow Byrne Mary Browne, Robert C. Downings Carlow Codd George Browne, Robert C. Downings Carlow Connors James Browne, Robert C. Downings Carlow Disney Frances Browne, Robert C. Downings Carlow Dowse John Browne, Robert C. Ballymurphy Carlow Doyle Patrick Browne, Robert C. Downings Carlow Edge William Browne, Robert C. Downings Carlow Edge William Browne, Robert C. Kilmagarvoge Carlow Fitzgerald Anne Browne, Robert C. Ballymurphy Carlow Hopkins Jane Browne, Robert C. Kilmagarvoge Carlow Keating Patrick Browne, Robert C. Downings Carlow Masterson Anne Browne, Robert C. Downings Carlow M'Gear Martin Browne, Robert C. Downings Carlow M'Grath Patrick Browne, Robert C. Kilmagarvoge Carlow Neill Edward Browne, Robert C. Downings Carlow Neill Eliza Browne, Robert C. Downings Carlow Neill John Browne, Robert C. Downings Carlow Power John Browne, Robert C. Ballymurphy Carlow Smith Samuel Browne, Robert C. Kilmagarvoge Carlow Tomlin Edward Browne, Robert C. Downings Carlow Walsh Stephen Browne, Robert C. Downings Carlow Wedock James Browne, Robert C. Downings Carlow Baulke John Bruen, Henry Coolroe Carlow Baulke John Bruen, Henry Orchard Carlow Brien William Bruen, Henry Coolroe Carlow Clear Moses Bruen, Henry Coolroe Carlow Cosgrave Nicholas Bruen, Henry Orchard Carlow Jordan John Bruen, Henry Coolroe Carlow Kavanagh Andrew Bruen, Henry Orchard Carlow Lyons Patrick Bruen, Henry Coolroe Carlow M'Donald Martin Bruen, Henry Coolroe Carlow M'Donald Martin Bruen, Henry Orchard Carlow M'Donnell Peter Bruen, Henry Orchard Carlow Moore John Bruen, Henry Coolroe Carlow Morris George Bruen, Henry Woodlands Carlow Murphy Andrew Bruen, Henry Coolroe Carlow Prendergast James Bruen, Henry Coolroe Carlow Prendergast Richard Bruen, Henry Coolroe Carlow Watchhorn Francis Bruen, Henry Coolroe Carlow Bulger James Bulger, Elizabeth Mill street, Tullow Carlow Byrne Mary Bulger, Elizabeth Mill street, Tullow Carlow Byrne Timothy Bulger, Elizabeth Mill street, Tullow Carlow Hagarty Patrick Bulger, Elizabeth Mill street, Tullow Carlow Hutton James Bulger, Elizabeth Mill street, Tullow Carlow Lamb Michael Bulger, Elizabeth Mill street, Tullow Carlow Lambert John Bulger, Elizabeth Mill street, Tullow Carlow Neill William Bulger, Elizabeth Mill street, Tullow Carlow Smith Alice Bulger, Elizabeth Mill street, Tullow Carlow Whelan Michael Bulger, Elizabeth Mill street, Tullow Carlow M'Namara Michael Bulger, John Bridge street, Tullow Carlow Murphy Martin Burnett, Robert Tullowphelim Carlow Allen Denis Butler, Thomas, Sir Bart Leany Carlow Allen John Butler, Thomas, Sir Bart Leany Carlow Beale George Butler, Thomas, Sir Bart Leany Carlow Beale John Butler, Thomas, Sir Bart Leany Carlow Brophy Martin Butler, Thomas, Sir Bart Leany Carlow Carroll Martin Butler, Thomas, Sir Bart Leany Carlow Cummins Edward Butler, Thomas, Sir Bart Leany Carlow Cummins James Butler, Thomas, Sir Bart Leany Carlow Cummins James, jun. Butler, Thomas, Sir Bart Leany Carlow Cummins John Butler, Thomas, Sir Bart Leany Carlow Cummins Robert Butler, Thomas, Sir Bart Leany Carlow Donohoe John Butler, Thomas, Sir Bart Leany Carlow Donohoe Thomas Butler, Thomas, Sir Bart Leany Carlow Doyle John Butler, Thomas, Sir Bart Leany Carlow Doyle Mary Butler, Thomas, Sir Bart Leany Carlow Fenlon Thomas Butler, Thomas, Sir Bart Leany Carlow Foley Michael Butler, Thomas, Sir Bart Leany Carlow Groves John Butler, Thomas, Sir Bart Leany Carlow Groves Richard Butler, Thomas, Sir Bart Leany Carlow Kenny James Butler, Thomas, Sir Bart Leany Carlow Loughlin Maurice Butler, Thomas, Sir Bart Leany Carlow Lyons Judith Butler, Thomas, Sir Bart Leany Carlow Manning Joseph Butler, Thomas, Sir Bart Leany Carlow M'Donnell Hugh Butler, Thomas, Sir Bart Leany Carlow Minnion William Butler, Thomas, Sir Bart Leany Carlow Morris George Butler, Thomas, Sir Bart Woodlands Carlow Rose Edward Butler, Thomas, Sir Bart Leany Carlow Smith Charles Butler, Thomas, Sir Bart Leany Carlow Smith Frances Butler, Thomas, Sir Bart Leany Carlow O'Brien Edward Byrne, Catherine Old Chapel lane, Tullow Carlow M'Nally Charles Byrne, Denis New Chapel lane, Tullow Carlow
My tables are sorted alphabetically by Occupiers’ name – any Immediate Lessor may be listed numerous times throughout a parish. Immediate Lessor names are not sorted alphebetically
In those instances when a person is listed twice in the same townland and the Immediate lessor was the same for each entry I have the occupiers name once and indicated how many times that name occurs in that townland beside it.
I have excluded the name of Immediate Lessors of Vacant properties when that person was already listed as being an Immediate Lessor in the same townland. The names of Immediate Lessors of vacant properties are included if that person was not listed as an Immediate Occupier previously in that townland.
In those instances when a person is listed twice in the same townland and the Immediate lessor was the same for each entry I have the occupiers name once and indicated how many times that name occurs in that townland beside it. I have excluded the name of Immediate Lessors of Vacant properties when that person was already listed as being an Immediate Lessor in the same townland. The names of Immediate Lessors of vacant properties are included if that person was not listed as an Immediate Occupier previously in that townland.
The Immediate Lessor is the person who owns or leases the property from the Landholder. The Occupier is the person who leases the land from the Immediate Lessor. The Occupier, in turn, may sub-let part of the property that they are listed as being the Occupier of, in which case, their name is then listed in the Immediate Lessor column. You need to see the original pages of the Griffiths Valuation which lists the type of property being leased.
| https://www.from-ireland.net/griffiths-primary-valuation/carlow/?http%3A%2F%2Fhttp%253A%252F%252Fhttp%25253A%25252F%25252Fhttp%2525253A%2525252F%2525252Fhttp%252525253A%252525252F%252525252Fhttp%25252525253A%25252525252F%25252525252Fpg=1&pg=2pg=2pg=3pg=4pg=3pg=3 |
People v. Bryan, Docket No. 77-3006 - Michigan - Case Law - VLEX 892460330
0: [object Object]. 1: [object Object]. 2: [object Object]. 3: [object Object]. 4: [object Object]. 5: [object Object]
Michigan
People v. Bryan, Docket No. 77-3006
<table><tbody><tr><td> Court</td><td> Court of Appeal of Michigan (US)</td></tr><tr><td> Writing for the Court</td><td> CYNAR</td></tr><tr><td> Citation</td><td> 284 N.W.2d 765,92 Mich.App. 208</td></tr><tr><td> Decision Date</td><td> 05 September 1979</td></tr><tr><td> Docket Number</td><td> Docket No. 77-3006</td></tr><tr><td> Parties</td><td> PEOPLE of the State of Michigan, Plaintiff-Appellee, v. Thomas J. BRYAN, Defendant-Appellant. 92 Mich.App. 208, 284 N.W.2d 765</td></tr></tbody></table>
Page 765
284 N.W.2d 765
PEOPLE of the State of Michigan, Plaintiff-Appellee,
v.
Thomas J. BRYAN, Defendant-Appellant.
Docket No. 77-3006.
92 Mich.App. 208, 284 N.W.2d 765
Court of Appeals of Michigan.
Sept. 5, 1979.
Rehearing Denied Oct. 29, 1979.
Released for Publication Nov. 9, 1979.
Page 767
[92 MICHAPP 212] James R. Neuhard, State App. Defender by Lynn Chard, Detroit, for defendant-appellant.
Frank J. Kelley, Atty. Gen., Robert A. Derengoski, Sol. Gen., Eugene C. Penzien, Pros. Atty., Thomas J. Rasdale, Asst. Pros. Atty., for plaintiff-appellee.
Before V. J. BRENNAN, P. J., and BRONSON and CYNAR, JJ.
CYNAR, Judge.
Following a jury trial in early May of 1977, defendant was convicted of assault with intent to commit murder, M.C.L. § 750.83; M.S.A. § 28.278, and assault with intent to rob while armed, M.C.L. § 750.89; M.S.A. § 28.284. On June 13, 1977, he was sentenced to concurrent terms of 25 to 40 years imprisonment on each count. Defendant now appeals as of right.
The charges against defendant arose out of an incident in Bay City on the evening of April 7, 1976, in which the complainant, Albin Trojanowicz, was struck on the head with a hammer and stabbed with a knife. Defendant and two others, Brian Miller and Rick Miller, were arrested and bound over on assault charges as a result of this incident. Defendant was tried separately from the other defendants.
At the trial Donald Elder testified that he was drinking with defendant and the Millers on the afternoon of the offense. At one point defendant suggested that he and Elder "go and raise some hell and get in trouble", but Elder declined this offer.
[92 MICHAPP 213] Diane Blair testified that she was riding in a car with defendant and the Millers on the evening of the offense. Defendant was in possession of a knife at that time. When the occupants of the car noticed a man who appeared drunk walking down the street, either defendant or Brian Miller suggested that they "roll" him. Defendant and Brian Miller left the car, the latter carrying a hammer, and Rick Miller drove to his mother's house. The witness further testified that shortly thereafter defendant and Brian Miller appeared, both with bloody hands. At that time defendant said that they had killed a man and Brian Miller admitted striking someone with a hammer. Defendant and Brian Miller then washed and concealed the hammer. Ilene Miller, the mother of the two codefendants Miller, testified that she noted blood on defendant's hand and that she helped defendant dispose of a knife and a hat he had been wearing.
The complainant, Albin Trojanowicz, died prior to trial from causes not related to the assault and his preliminary examination testimony was read into the record at trial. He testified that he was walking home that evening when he was attacked by what he thought were two men. He stated that he was hit on the head and struck in the stomach. He testified that he remembered blood splashing and then recalled nothing until he awoke in the hospital. Medical testimony established that the complainant had been struck on the head and stabbed on
Page 768
the side. He had bled profusely and would have died had he not been treated.
Unknown to the occupants of the car that evening, an undercover operation in an unrelated matter, consisting of several officers, had spotted the vehicle. They saw two men leave the vehicle but did not witness the assault. When a passerby [92 MICHAPP 214] discovered the complainant and contacted the police, a bulletin was put out on the car. Twenty-five minutes later the vehicle was stopped. At the time defendant was its only occupant. The arresting officers noticed blood near the driver's side of the car and on defendant's shoes. Evidence at trial showed that this blood type matched the blood type of the victim. Both the knife and the hammer were retrieved and admitted as exhibits at trial.
Defendant's defense was that of intoxication. He claimed he had consumed 25 to 30 beers and a pint of schnapps on the day in question and that he did not intend to commit the crimes. He did admit striking the victim in the chest, allegedly in response to something he had said, but denied possessing a knife at that time. The arresting officers testified that defendant did not appear intoxicated to them.
Defendant also introduced evidence to explain the blood found in the car and on his shoes. Defendant's brother, Mark Bryan, testified that on April 4, 1976, he had been in a fight and knocked unconscious. When he awoke defendant was holding his head. Medical records indicated that the blood found on the tennis shoes, Levi's, and on the automobile at the time of defendant's arrest matched the blood type of defendant's brother.
I. Use of defendant's statements.
Defendant initially alleges that the prosecution denied defendant a fair trial by its use of statements made by defendant shortly after arrest.
At trial Sergeant Edward LaPlant, one of the arresting officers, testified that he asked defendant what had happened shortly after his arrest. Defense counsel objected before the officer could state defendant's response to the question. He requested a mistrial, claiming that the prosecutor had told [92 MICHAPP 215] him that defendant had made no statements. In response the prosecutor agreed that he had said there were no statements by defendant. However, he added that he had never said there were no "remarks" made by defendant at the time of his arrest.
After considerable argument by counsel, defendant's motion for a mistrial was denied. The trial judge did order a Walker 1hearing to determine the voluntariness of the alleged statements. In the course of this hearing Sergeant LaPlant testified that defendant was advised of his Miranda 2rights at the time of his arrest. He testified that immediately thereafter defendant denied having done anything wrong. He further stated that later on he talked to defendant at the police station. However, at that point the witness was cut off by the prosecutor who stated:
"I have to hold it here for a second. All I asked him was what did he say at the scene when he was arrested, and so that's where we are at this point. Anyhow, there was subsequent questioning at the station, but we hadn't gotten to that bridge yet."
Subsequently, defense counsel waived the production of another officer who was present at the scene of the arrest. The trial judge ruled that the statements made by defendant were voluntary. The prosecutor then indicated that he intended to present additional evidence of statements made to another officer, Sergeant Lochinski. This led to an exchange between counsel and the trial judge as to the need for an additional Walker hearing. At one [92 MICHAPP 216] point defense counsel accused the prosecution of trickery and asserted that all statements should be disclosed at one time. In response the following exchange occurred:
Page 769
"PROSECUTOR: In fact, your Honor, I think that Mr. Caprathe is making a mountain out of a mole hill, I'm sufficiently satisfied with the evidence at this time. At this time, I'll abjure the use of any statements. I believe they're admissible. It's not worth the hassle.
"THE COURT: I'm concerned with the statement you made prior to this. You said in view of the fact they do not want them presented you will not present the exculpatory statements.
"PROSECUTOR: Yes. I'll leave the whole area alone. No statements from the defendant.
"THE COURT: All right. That eliminates all problems, doesn't it?"
Later in the trial, defendant chose to testify in his own behalf. In the course of cross-examination the following exchange occurred:
"Q What did you first tell the police, by the way, when they arrested you?
"A I told them I didn't know nothing about it.
"Q Told them you didn't know nothing about it, right?
"A Yes.
"Q And later on did you change your story a little bit?
"A That's just it. I can't remember what happened at the police station.
"Q Did you tell the police the story that you had given your car to Brian Miller and that he had dropped you off at the house, and that Brian and Ricky and Diane had driven somewhere? Did you tell them that story?"
At this point defense counsel objected on the [92 MICHAPP 217] ground that no Walker hearing had been held to determine the voluntariness of this latter statement. The objection was overruled and the cross-examination continued as follows:
"Q Did you make that statement to the police?
"A Not that I know of.
"Q But did you give them that story?
"A Not that I know of.
"Q Did you tell them Brian Miller had come back to the house with Ricky and Diane and stopped the car there and told you, 'Hey, things look bad. You better get out of here.'
"A Would you repeat that?
"Q Did you tell the police that they had dropped you off at the house, they had come back a short time later, Brian borrowed your car from you, said, 'I need to use it for a while.' He came back a short while later and said, 'Hey, things look really bad. You better get out of here.'
"A No, I didn't.
"Q You didn't make that statement to them, or you don't remember?
"A I don't remember it, no."
It is clear from this record that the prosecutor handled this case in a less than exemplary manner. By telling defense counsel that defendant had made no "statement" at the time of his arrest, he forestalled the holding of a Walker hearing until the middle of trial, an obviously inconvenient time for such a hearing. Moreover, his explanation for his prior comment, differentiating "statements" from "remarks", is not convincing.
We further find fault with his tactic of withholding at the ordered Walker hearing the fact of defendant's subsequent statement. It should have been obvious to him at this point that the trial judge would order a Walker hearing for Any statement[92 MICHAPP 218] made by defendant. Nor was it proper for the prosecutor to make use of defendant's statements after...
13 practice notes
People v. Akins, Docket No. 240359 United States Court of Appeal of Michigan (US) 19 Febrero 2004 ...offense of assault with intent to rob while armed, People v. Patskan, 387 Mich. 701, 714, 199 N.W.2d 458 (1972); People v. Bryan, 92 Mich.App. 208, 225, 284 N.W.2d 765 (1979). Thus, attempted robbery is established every time assault with intent to rob while armed is established. Patskan, s......
Glenn v. Bergh, CASE NO. 2:14-CV-11908 United States United States District Courts. 6th Circuit. United States District Court (Eastern District of Michigan) 12 Enero 2015 ...they are necessarily included offenses to assault with intent to rob while armed. Petitioner relies on the case of People v. Bryan, 92 Mich. App. 208, 225; 284 N.W.2d 765 (1979), in which the Michigan Court of Appeals held that attempted armed robbery is a necessarily lesser included offens......
People v. Holmes, Docket No. 78-819 United States Court of Appeal of Michigan (US) 1 Julio 1980 ...of his own testimony and therefore cannot successfully claim that he was prejudiced by this witness's response. See People v. Bryan, 92 Mich.App. 208, 284 N.W.2d 765 (1979). Finally, we reject defendant's argument that his habitual offender sentence must be vacated in accordance with People......
People v. Cummings, Docket No. 199226 United States Court of Appeal of Michigan (US) 31 Marzo 1998 ...and for resentencing or, if the prosecution desires, for a retrial on the charge for which the defendant was convicted. People v. Bryan, 92 Mich.App. 208, 225-226, 284 N.W.2d 765 (1979). Accordingly, we vacate the conviction and remand for further proceedings consistent with this opinion. I......
13 cases
People v. Akins, Docket No. 240359 United States Court of Appeal of Michigan (US) 19 Febrero 2004 ...offense of assault with intent to rob while armed, People v. Patskan, 387 Mich. 701, 714, 199 N.W.2d 458 (1972); People v. Bryan, 92 Mich.App. 208, 225, 284 N.W.2d 765 (1979). Thus, attempted robbery is established every time assault with intent to rob while armed is established. Patskan, s......
Glenn v. Bergh, CASE NO. 2:14-CV-11908 United States United States District Courts. 6th Circuit. United States District Court (Eastern District of Michigan) 12 Enero 2015 ...they are necessarily included offenses to assault with intent to rob while armed. Petitioner relies on the case of People v. Bryan, 92 Mich. App. 208, 225; 284 N.W.2d 765 (1979), in which the Michigan Court of Appeals held that attempted armed robbery is a necessarily lesser included offens......
People v. Holmes, Docket No. 78-819 United States Court of Appeal of Michigan (US) 1 Julio 1980 ...of his own testimony and therefore cannot successfully claim that he was prejudiced by this witness's response. See People v. Bryan, 92 Mich.App. 208, 284 N.W.2d 765 (1979). Finally, we reject defendant's argument that his habitual offender sentence must be vacated in accordance with People......
People v. Cummings, Docket No. 199226 United States Court of Appeal of Michigan (US) 31 Marzo 1998 ...and for resentencing or, if the prosecution desires, for a retrial on the charge for which the defendant was convicted. People v. Bryan, 92 Mich.App. 208, 225-226, 284 N.W.2d 765 (1979). Accordingly, we vacate the conviction and remand for further proceedings consistent with this opinion. I......
| https://case-law.vlex.com/vid/people-v-bryan-docket-892460330 |
Crystals | Free Full-Text | First-Principles Simulation—Nano-Theory
First-principles (or ab initio) simulation is one of the most significant theoretical approaches to study and model systems at the atomistic level [...]
First-Principles Simulation—Nano-Theory
by Paolo Restuccia
Department of Chemistry, Imperial College London, 82 Wood Lane, London W12 0BZ, UK
Crystals 2021 , 11 (8), 855; https://doi.org/10.3390/cryst11080855
Received: 20 July 2021 / Accepted: 21 July 2021 / Published: 23 July 2021
(This article belongs to the Special Issue First-Principles Simulation — Nano-Theory )
First-principles (or ab initio) simulation is one of the most significant theoretical approaches to study and model systems at the atomistic level. Based on solving the fundamental equations of quantum mechanics without any additional assumption or approximation, it has gained relevance in recent decades in many technological fields for materials design and discovery, such as condensed matter physics and nanotechnology, and to unravel macroscopic properties of materials by studying their atomistic and electronic behaviour. The current wide use of first-principles simulations as a predictive and investigative tool is possible due to the higher efficiency of computational resources and the introduction of user-friendly and open-source software packages, which allows performing calculations with hundreds of atoms unfeasible to realise until a few years ago.
This Special Issue on “First-Principles Simulation—Nano-Theory” covers some aspects of the most recent updates about researches involving first-principles simulations. We present eleven original studies investigating phenomena for basic research or technological applications employing state-of-the-art approaches in ab initio calculations.
The first paper by Song et al. [
1
] focuses on studying structural and photoelectric properties of zincblende InGaN alloys. Through Density Functional Theory (DFT) calculations, the authors discovered that an increased concentration of In atoms leads to a lower bandgap and a redshift in both the imaginary part of the dielectric function and the absorption coefficient, thus enhancing the absorption of visible light and providing theoretical evidence for applying this material in optoelectronic and photovoltaic devices. The study of structural, electronic and optical properties through first-principles simulations is a usual topic also explored by Shafei et al. [
2
] in their study of kaolinite, muscovite, and montmorillonite crystals, three common clay minerals whose understating of their mechanical properties is essential for their technological applications. Another paper on optoelectronic properties is the one by Liu et al. [
3
], in which the authors studied through DFT+U simulations how the electronic properties of indium tin oxide films change when the thickness of the film is varied and how this affects the electric resistivity of the material. The study of electronic structure DFT simulations is also performed by Hu et al. [
4
] in their study of redox magnetism and electrochromism of a cyclometalated triruthenium complex with triarylamine by means of Monte Carlo and DFT calculations, where they found specific spin and adsorption states that suggest the use of this complex as an electrochromic material for electric field detection. First-principles simulations are also used in combination with experiments to unravel the atomistic origin of specific processes, as in the paper by Zhang et al. [
6
]. The authors performed tribological tests and first-principles calculation of ZrB
2
/Mo multilayers to understand the relation between the hardness of this material and its coefficient of friction, finding that the compound stability is the crucial factor to determine its mechanical properties. Sometimes, theoretical calculations provide helpful insights when experimental evidence show conflicting results; this is the case in the paper by Liu et al. [
7
], where DFT calculations reveal the most favourable adsorption configuration of water molecules on a NaCl(001) surface. It is also possible to calculate reaction and adsorption energies with DFT calculations as in the manuscript by Tian et al. [
8
], where the authors studied the different adsorption behaviour of three pyridine amide additives (Nicotinamide, Pyridine-2-formamide and Pyridine-4-formamide) on Pt(111) surface and found that these molecules react by forming a protective film which avoids the diffusion of atoms to the surface of the growth centre. Cao et al. [
9
] employed a different approach widely used in the theoretical community: first, they performed classical Molecular Dynamics calculations, which are less computationally expensive, of water impurity in transformer oil; then, they selected specific time frames and local regions to study the electronic properties of the system (such as the density of states and the electron density) and have a clearer picture of the breakdown process of the transformer oil. First-principles simulations allow for performing complex studies involving water/ice systems and their vibrational spectra, as conducted by Yu et al. [
10
] in their paper where they studied the hydrogen bond vibrations modes of hydrogen-disordered structures of ice, which is a very useful approach for the interpretation of the experimental spectra. Finally, the recent development of high-throughput first-principles techniques widened the possibility of materials design: the paper by Al-Fahdi et al. [
11
] reports a novel high-throughput framework for creating new carbon allotropes with different mechanical properties and ultrahigh hardness. This approach can be helpful in the future not only for the screening of specific materials properties but also for the discovery of new compounds.
Funding
This research received no external funding.
Conflicts of Interest
The author declares no conflict of interest.
References
Song, J.; Luo, Z.; Liu, X.; Li, E.; Jiang, C.; Huang, Z.; Li, J.; Guo, X.; Ding, Z.; Wang, J. The Study on Structural and Photoelectric Properties of Zincblende InGaN via First Principles Calculation. Crystals 2020 , 10 , 1159. [ Google Scholar ] [ CrossRef ]
Shafei, L.; Adhikari, P.; Ching, W.Y. DFT Study of Electronic Structure and Optical Properties of Kaolinite, Muscovite, and Montmorillonite. Crystals 2021 , 11 , 648. [ Google Scholar ] [ CrossRef ]
Hu, R.; Zhang, W.C.; Sun, W.F. First-Principles Electronic-Structure Study of Graphene Decorated with 4d-Transition Atoms. Crystals 2021 , 11 , 29. [ Google Scholar ] [ CrossRef ]
Li, L.; Wang, Y.; Chen, M.Y.; Zhang, J.; Liang, J.Q.; Liu, H.Q.; Sun, Y.X.; Song, W.; Sun, W.F. First-Principles Study on Redox Magnetism and Electrochromism of Cyclometalated Triarylamine-Core Triruthenium Complex. Crystals 2021 , 11 , 57. [ Google Scholar ] [ CrossRef ]
Zhang, T.; Dong, L.; Wu, J.; Li, D. Modulation Effect of Hardness on the Friction Coefficient and Its Mechanism Analysis of ZrB2/Mo Multilayers Synthesized by Magnetron Sputtering. Crystals 2021 , 11 , 69. [ Google Scholar ] [ CrossRef ]
Liu, X.Y.; Cao, J.W.; Qin, X.L.; Zhu, X.L.; Yu, X.H.; Wang, X.C.; Yuan, X.Q.; Liu, Y.H.; Wang, Y.; Zhang, P. A Computational Validation of Water Molecules Adsorption on an NaCl Surface. Crystals 2021 , 11 , 610. [ Google Scholar ] [ CrossRef ]
Tian, G.; Du, H.; Zhang, H. First Principle Analysis on Pyridine Amide Derivatives’ Adsorption Behavior on the Pt (111) Surface. Crystals 2021 , 11 , 98. [ Google Scholar ] [ CrossRef ]
Cao, B.; Dong, J.W.; Chi, M.H. Electrical Breakdown Mechanism of Transformer Oil with Water Impurity: Molecular Dynamics Simulations and First-Principles Calculations. Crystals 2021 , 11 , 123. [ Google Scholar ] [ CrossRef ]
Yu, X.H.; Qin, X.L.; Dong, X.T.; Cao, J.W.; Zhu, X.L.; Wang, H.C.; Sun, Y.J.; Xu, Z.X.; Zhang, P. Studies of Hydrogen Bond Vibrations of Hydrogen-Disordered Ice Ic. Crystals 2021 , 11 , 668. [ Google Scholar ] [ CrossRef ]
Al-Fahdi, M.; Rodriguez, A.; Ouyang, T.; Hu, M. High-Throughput Computation of New Carbon Allotropes with Diverse Hybridization and Ultrahigh Hardness. Crystals 2021 , 11 , 783. [ Google Scholar ] [ CrossRef ]
Restuccia, Paolo. 2021. "First-Principles Simulation—Nano-Theory" Crystals11, no. 8: 855.
https://doi.org/10.3390/cryst11080855
| https://www.mdpi.com/2073-4352/11/8/855/xml |
Mechanisms of Cell Death in Spinal Muscular Atrophy - Full Text View - ClinicalTrials.gov
Mechanisms of Cell Death in Spinal Muscular Atrophy
The safety and scientific validity of this study is the responsibility of the study sponsor and investigators. Listing a study does not mean it has been evaluated by the U.S. Federal Government.
Read our disclaimer for details.
ClinicalTrials.gov Identifier: NCT01754441 Recruitment Status :
Completed First Posted : December 21, 2012 Last Update Posted : February 21, 2020
Sponsor:
Nemours Children's Clinic
Information provided by (Responsible Party):
Matthew E. R. Butchbach, Ph.D., Nemours Children's Clinic
Study Description
Brief Summary:
Spinal muscular atrophy is a genetically based disease that affects motor neurons in the spinal cord and leads to muscle wasting and weakness. The gene found to be responsible for the underlying disease is called the SMN or survival motor neuron gene. Individuals with SMA are either missing a copy of the gene or have a mutation in the gene. Although the gene has been identified, how it actually causes the motor neurons to die and leads to muscle wasting and weakness is not completely understood. The investigators have found that skin cells from children with SMA tend to be more susceptible to cell death when exposed to cell death inducing agents. In this protocol, The investigators wish to study the mechanisms by which these cells die when exposed to these agents and how this may be related to the gene defect and the disease.
Condition or disease Spinal Muscular Atrophy
Detailed Description:
Spinal muscular atrophy (SMA) is a neuromuscular disease characterized by degeneration of motor neurons and progressive muscle atrophy. The disease is one of the most common genetic causes of infant death. The gene responsible for SMA, survival motor neuron (SMN), exists in humans as two nearly identical copies (SMN1 and SMN2). Only deletion or mutation(s) of the telomeric copy of the gene (SMN1) causes the disease. The SMN protein has been known to function in assembly of the RNA splicing complex, however, the mechanism(s) by which SMN-deficiency causes cell death in SMA are not clear. The long-term goal is to understand the mechanism(s) of motor neuron death in SMA and develop a means of prevention. SMN protein has been reported to have some survival promoting functions in cultured cells. Preliminary studies show that skin fibroblasts from SMA patients are more sensitive to certain death promoting stimuli than control fibroblasts. The investigators hypothesize that the SMN protein is directly involved in cell survival and that loss of this survival function of SMA results in motor neuron death in SMA. The investigators will use fibroblasts from SMA patients, fibroblasts from controls without SMA, motor neuron-like cell lines (such as NSC-34) and rodent primary motor neuron cultures as model systems to test our hypothesis. The investigators will determine the effect of expression of SMN protein in regulating cell death of SMA fibroblasts. The investigators will further investigate the role of SMN in neuronal cell survival. Finally, the investigators will determine biological pathway(s) of SMN-mediated cell protection. Results from the proposed studies will provide insight into the mechanism(s) by which SMN protects cells from death and how a decrease in SMN function leads to the SMA phenotype. Ultimately, the obtained information could lead to develop therapeutic strategies for SMA.
Study Design
Layout table for study information Study Type : Observational Actual Enrollment : 25 participants Observational Model: Other Time Perspective: Prospective Official Title: Mechanisms of Cell Death in Spinal Muscular Atrophy Study Start Date : May 2008 Actual Primary Completion Date : February 2020 Actual Study Completion Date : February 2020
MedlinePlus Genetics related topics: Spinal muscular atrophy
MedlinePlus related topics: End of Life Issues Spinal Muscular Atrophy
Genetic and Rare Diseases Information Center resources: Spinal Muscular Atrophy Amyotrophic Lateral Sclerosis
Groups and Cohorts
Outcome Measures
Primary Outcome Measures
:
SMN localization in SMA fibroblasts [ Time Frame: up to 2 years ]
Established fibroblast lines from SMA patients will be immunolabeled with antibodies directed against SMN and examined for changes in the nuclear localization of SMN in gems.
Secondary Outcome Measures
:
SMN isoform mRNA levels [ Time Frame: up to 2 years ]
The levels of full-length SMN and SMNdelta7 (lacking exon 7) mRNA transcripts will be measured using quantitative PCR.
Protein levels of putative SMA phenotypic modifiers [ Time Frame: up to 2 years ]
The levels of previously identified modifiers of SMA clinical phenotype (i.e. plastin-3 and ZPR-1) will be examined by immunoblot.
cell viability in response to DNA damaging agents [ Time Frame: up to 2 years ]
The responsiveness of SMA fibroblasts to DNA damaging agents such as camptothecin, etoposide, bleomycin and actinomycin D will be measured using cell viability assays
SMN protein levels [ Time Frame: up to 2 years ]
SMN protein levels will be measured by immunoblot.
The responsiveness of SMA fibroblasts to cell death-inducing agents such as staurosporine, tunicamycin and hydrogen peroxide will be examined using cell viability assays.
SMN2 copy number [ Time Frame: up to 2 years ]
SMN2 copy number will be determined by quantitative PCR of genomic DNA isolated from established fibroblast lines.
Biospecimen Retention: Samples With DNA
Skin biopsy specimens
Eligibility Criteria
Top of Page Study Description Study Design Groups and Cohorts Outcome Measures Eligibility Criteria Contacts and Locations More Information
Information from the National Library of Medicine
Choosing to participate in a study is an important personal decision. Talk with your doctor and family members or friends about deciding to join a study. To learn more about this study, you or your doctor may contact the study research staff using the contacts provided below. For general information, Learn About Clinical Studies.
Layout table for eligibility information Ages Eligible for Study: up to 21 Years (Child, Adult) Sexes Eligible for Study: All Accepts Healthy Volunteers: Yes Sampling Method: Non-Probability Sample
Study Population
This study will enroll Children with Spinal Muscular Atrophy (SMA)
Criteria
Inclusion Criteria:
Diagnosis of SMA confirmed by neurologist
Exclusion Criteria:
Not seen as a patient at a participating Nemours facility
Contacts and Locations
Top of Page Study Description Study Design Groups and Cohorts Outcome Measures Eligibility Criteria Contacts and Locations More Information
Information from the National Library of Medicine
To learn more about this study, you or your doctor may contact the study research staff using the contact information provided by the sponsor.
Please refer to this study by its ClinicalTrials.gov identifier (NCT number): NCT01754441
Locations
Layout table for location information United States, Delaware Alfred I. duPont Hospital for Children Wilmington, Delaware, United States, 19803 United States, Florida Nemours Children's Specialty Care, Jacksonville Jacksonville, Florida, United States, 32207
Sponsors and Collaborators
Nemours Children's Clinic
Investigators
Layout table for investigator information Principal Investigator: Matthew ER Butchbach, Ph.D. Nemours Biomedical Research
More Information
Top of Page Study Description Study Design Groups and Cohorts Outcome Measures Eligibility Criteria Contacts and Locations More Information
Publications of Results:
Stabley DL, Harris AW, Holbrook J, Chubbs NJ, Lozo KW, Crawford TO, Swoboda KJ, Funanage VL, Wang W, Mackenzie W, Scavina M, Sol-Church K, Butchbach ME. SMN1 and SMN2 copy numbers in cell lines derived from patients with spinal muscular atrophy as measured by array digital PCR. Mol Genet Genomic Med. 2015 Jul;3(4):248-57. doi: 10.1002/mgg3.141. Epub 2015 Mar 21.
Stabley DL, Holbrook J, Harris AW, Swoboda KJ, Crawford TO, Sol-Church K, Butchbach MER. Establishing a reference dataset for the authentication of spinal muscular atrophy cell lines using STR profiling and digital PCR. Neuromuscul Disord. 2017 May;27(5):439-446. doi: 10.1016/j.nmd.2017.02.002. Epub 2017 Feb 6.
Layout table for additonal information Responsible Party: Matthew E. R. Butchbach, Ph.D., Research Scientist, Nemours Children's Clinic ClinicalTrials.gov Identifier: NCT01754441 History of Changes Other Study ID Numbers: 82008 First Posted: December 21, 2012 Key Record Dates Last Update Posted: February 21, 2020 Last Verified: February 2020 Individual Participant Data (IPD) Sharing Statement: Plan to Share IPD: Undecided Plan Description: De-identified data will be made available after publication.
Keywords provided by Matthew E. R. Butchbach, Ph.D., Nemours Children's Clinic:
Spinal Muscular Atrophy SMA Motor Neuron Abnormalities
Additional relevant MeSH terms:
Layout table for MeSH terms Muscular Atrophy Muscular Atrophy, Spinal Atrophy Pathological Conditions, Anatomical Neuromuscular Manifestations Neurologic Manifestations Nervous System Diseases Spinal Cord Diseases Central Nervous System Diseases Motor Neuron Disease Neurodegenerative Diseases Neuromuscular Diseases
U.S. Department of Health and Human Services
| https://clinicaltrials.gov/ct2/show/NCT01754441 |
Genome-Wide Analyses Revealing a Signaling Network of the RcsC-YojN-RcsB Phosphorelay System in Escherichia coli | Journal of Bacteriology
ABSTRACT In Escherichia coli, capsular colanic acid polysaccharide synthesis is regulated through the multistep RcsC→YojN→RcsB phosphorelay. By monitoring a hallmarked cps::lacZ reporter gene, we f...
Genome-Wide Analyses Revealing a Signaling Network of the RcsC-YojN-RcsB Phosphorelay System in Escherichia coli
Authors: Daisuke Hagiwara, Masahito Sugiura, Taku Oshima , Hirotada Mori, Hirofumi Aiba, Takafumi Yamashino , Takeshi Mizuno [email protected] Authors Info & Affiliations
DOI: https://doi.org/10.1128/jb.185.19.5735-5746.2003
ABSTRACT
In
Escherichia coli
, capsular colanic acid polysaccharide synthesis is regulated through the multistep RcsC→YojN→RcsB phosphorelay. By monitoring a hallmarked
cps
::
lacZ
reporter gene, we first searched for physiological stimuli that propagate the Rcs signaling system. The expression of
cps
::
lacZ
was activated when cells were grown at a low temperature (20°C) in the presence of glucose as a carbon source and in the presence of a relatively high concentration of external zinc (1 mM ZnCl
2
). In this Rcs signaling system, the
rcsF
gene product (a putative outer membrane-located lipoprotein) was also an essential signaling component. Based on the defined signaling pathway and physiological stimuli for the Rcs signaling system, we conducted genome-wide analyses with microarrays to clarify the Rcs transcriptome (i.e., Rcs regulon). Thirty-two genes were identified as putative Rcs regulon members; these genes included 15 new genes in addition to 17 of the previously described
cps
genes. Using a set of 37 two-component system mutants, we performed alternative genome-wide analyses. The results showed that the propagation of the zinc-responsive Rcs signaling system was largely dependent on another two-component system, PhoQ/P. Considering the fact that the PhoQ/P signaling system responds to external magnesium, we obtained evidence which supports the view that there is a signaling network that connects the Rcs system with the PhoQ/P system, which coordinately regulates extracellular polysaccharide synthesis in response to the external concentrations of divalent cations.
Escherichia coli
and other enteric bacteria are capable of synthesizing an extracellular polysaccharide capsule, called colanic acid. A large number of genes are involved in capsular polysaccharide synthesis (
36
). The major gene cluster involved in colanic acid synthesis is located at 45.8 min on the canonical
E. coli
K-12 genetic map (
38
). The 5′-proximal gene cluster consists of the
wza
,
wzb
, and
wzc
genes, which are followed by the
wca
operon consisting of about 20 genes (
http://www.genolist.pasteur.fr/Colibri/
). The locus containing these genes was previously referred to as the
cps
operons (the capsular polysaccharide synthesis genes are referred to as
cps
genes for clarity below). The expression of these
cps
genes is coordinately regulated in response to a variety of environmental cues. Nevertheless, the physiological stimuli that induce capsular polysaccharide synthesis are not fully understood.
Extensive genetic studies have revealed that in E. colithere is a complex signaling circuitry that modulates expression of the cpsgenes (for reviews, see references13and39). Together with the RcsA transcription factor and the Lon protease (10,44), the RcsC-mediated histidine (His)→aspartate (Asp) phosphorelay system appears to play a major role in transcriptional regulation of the cpsgenes. By analogy with other His→Asp phosphorelay systems (1,25), a unique model has been formulated for the multistep Rcs signaling system, in which the RcsC hybrid sensor His kinase senses certain environmental stimuli (42). The downstream signaling component is YojN (a histidine-containing phosphotransfer HPt factor), which serves as an intermediate for the phosphorelay. Eventually, the RcsB response regulator acquires a phosphoryl group from YojN, and the phosphorylated RcsB functions as a DNA-binding transcriptional regulator, which together with RcsA transcribes the cpsgenes. It has been suggested previously that another factor (RcsF) also plays a role in the Rcs signaling system (11). However, the importance of this putative outer membrane lipoprotein remains to be determined.
Interestingly, the Rcs signaling system is common in the sense that there are homologous systems not only in other enteric bacteria but also in nonenteric bacteria, including Salmonella entericaserovar Typhi, Vibrio cholerae, Klebsiella pneumoniae, Erwinia amylovora, Proteus mirabilis, and Pseudomonas aeruginosa.In S. entericaserovar Typhi, the Rcs signaling system modulates differential expression of an invasion protein (designated Sip), flagellin, and Vi antigen (2). The synthesis of certain extracellular polysaccharides in K. pneumoniaeand E. amylovorais also regulated through the Rcs signaling systems (4,28). The dimorphic and motile gram-negative bacterium P. mirabilisalso uses the Rcs signaling system to regulate its characteristic swarming behavior (3,15), like E. coli(17,42). The recently released genome sequences of both V. choleraeand P. aeruginosarevealed that each of these bacteria has a homologous Rcs signaling system (18,41). These findings indicate that the multistep RcsC→YojN→RcsB phosphorelay system is evolutionarily conserved in a wide variety of bacteria, in which this common adaptive response system is often associated with bacterial virulence and/or pathogenesis.
Needless to say,
E. coli
is the organism of choice for gaining general insight into the molecular mechanism underlying the common Rcs signaling systems. A thorough understanding of the
E. coli
Rcs signaling mechanism would answer the general question of why many virulent and/or pathogenic bacteria have the common Rcs signaling systems. To investigate this, we performed genome-wide analyses of the
E. coli
Rcs signaling system by using microarrays. We also employed a set of 37 two-component system mutants, in which each of the
E. coli
two-component systems was knocked-out one by one (
32
). The results of this study revealed not only a new view of the Rcs regulon but also an intriguing signaling linkage between the Rcs and PhoQ/P two-component systems in response to external divalent cations (zinc and magnesium).
MATERIALS AND METHODS
Bacterial strains and media.
E. coliK-12 strain ST001 and derivatives of this strain were the main organisms used. The ST001 strain [ cps:: lacZ thi araΔ( pro-lac)] was constructed from CSH26 (19), as described previously (42). Another CSH26 derivative, strain GY37 [ katE:: lacZ thi araΔ( pro-lac)], was also used (49), as was the MG1301 strain carrying the mgrB:: lacZgene on the chromosome (21). A set of 37 two-component mutants was constructed previously in the E. coliK-12 strain BW25113 background (32) (see Fig.6) by using the standard E. coligenetic procedures and/or the recently developed rapid procedures for constructing deletion mutants (7). The mutant alleles were each transferred into the ST001 background, one by one. In this study, a Δ rcsFderivative of ST001 was constructed by using the procedures used to construct deletion mutants (7). In this construct, the kanamycin resistance cassette replaced the entire rcsFgene. The primers used to construct an appropriate deletion cassette were 5′-CTCCTGATTCAATATTGACGTTTTGATCATACATTGAGGAAATACTATGGTGTAGGCTGGAGCTGCTTC and 5-GCCTATTTGCTCGAACTGGAAACTGCTCATTTCGCCGTAATGTTAAGCGATTCCGGGGATCCGTCGACC. The E. colicells were grown mainly at either 37 or 20°C in EB medium, which contains 1.8% (wt/vol) Eiken's broth (Eiken Chemical Co. Ltd., Tokyo, Japan) and 0.4% glucose in 50 mM morpholinepropanesulfonic acid (MOPS) buffer (pH 7.0). When required, zinc, magnesium, and other divalent cations were added. Occasionally, Luria-Bertani medium was also used.
Enzyme assay.
β-Galactosidase activity was measured by Miller's method, with slight modifications (23). The cells were grown as described above (except as noted below). They were suspended in 250 mM sodium phosphate (pH 7.1) for accurate measurement of cell density. A portion of a cell suspension was used for a β-galactosidase assay after permeabilization with toluene.
RNA isolation.
Cells were grown as described above or as described below. They were harvested at the mid-logarithmic growth phase. Total RNA was isolated with an RNeasy Maxi kit (Qiagen), as recommended by the supplier.
Preparation of E. coliDNA microarrays.
Custom glass slide microarrays (from Takara Shuzo, Kyoto, Japan) were spotted with 4,095 PCR products corresponding to full-length E. coliopen reading frames, together with human β-actin genes as a negative reference. PCR products were generated by using a clone bank containing E. coligenes in the Archive vector as the template, as described previously (26). Other details were the same as those described previously (31,32).
Preparation of labeled cDNA, hybridization, and data capture and analysis.
Appropriate pairs of RNA samples were prepared, and one sample was labeled with Cy3 and the other sample was labeled with Cy5. Each preparation was then tested twice by performing a microarray analysis. Thus, two values were obtained for each gene (or spot). The procedures used for hybridization, data capture, and data analysis were essentially the same as those described previously (
31
,
32
). Briefly, by subtracting the local background value, we first corrected the intensity of each spot. In addition, a mean value for the intensity of the 24 negative control spots (human β-actin gene) was determined, together with the standard deviation (SD). Then spots were classified into three groups. For group 1 both the Cy3 signal intensity and the Cy5 signal intensity were greater than the mean plus one SD for the negative control. For group 2 either the Cy3 signal intensity or the Cy5 signal intensity was greater than the mean plus one SD for the negative control. For group 3 both the Cy3 signal intensity and the Cy5 signal intensity were less than the mean plus 1 SD for the negative control. Initially, we normalized spots classified in group 1 by defining the mean of the ratios (Cy5/Cy3) for all spots as 1.0. Group 2 spots with high Cy3 or Cy5 intensity values were selected. Group 3 spots were ignored as undetectable. Genes with significantly different expression were then selected by using the following criteria, provided that similar values were obtained in the two independent hybridizations. We basically selected genes that showed relative Cy5/Cy3 ratios that were <0.5 and genes that showed relative Cy5/Cy3 ratios that were >2.0 in both hybridizations as being down and up, respectively.
RESULTS
External stimuli that propagate the Rcs signaling system.
Except for osmotic shock (37), physiological stimuli that activate the Rcs signaling system have not been fully defined yet. We attempted to identify such external stimuli for the Rcs signaling system. An approximately 800-bp nucleotide sequence that contained the promoter of the colanic acid synthesis wza-wzb-wzcgene cluster was fused to the lacZgene (40,46). Then the fusion gene was introduced into the E. colichromosome at the λ attsite; the resulting strain was designated ST001, and the reporter gene was designated cps:: lacZ(42). We then searched for growth conditions under which the cps:: lacZreporter gene was induced in a manner dependent on the Rcs signaling system. We found that when ST001 cells were grown at a low temperature (<20°C) in the presence of 0.4% glucose, the reporter gene was activated significantly (Fig.1Aand B). The basal medium contained 1.8% nutrient broth in 50 mM MOPS buffer (pH 7.0) (designated EB medium). When the cells were incubated at 20°C in EB medium containing 0.4% glucose, the level of β-galactosidase activity was significantly increased, while such induction of cps:: lacZwas not seen in the absence of glucose (Fig.1A) or at 37°C (Fig.1Cand D). In these experiments, the cells were precultured at 37°C overnight. However, it should be noted that even if the cells were precultured at 20°C, essentially the same results were obtained. Thus, a cold shock appeared not to be implicated in this event.
The induction was dependent on the Rcs signaling components, RcsC and YojN (Fig.
1A
). As shown in Fig.
1A
, the colonies on EB agar plates containing 0.4% glucose produced large amounts of extracellular polysaccharides at 20°C and thus exhibited mucous and glittering morphologies on the solid medium. This suggested that not only expression of the
wza-wzb-wzc
cluster genes but also expression of the whole system of colanic acid production was activated under these growth conditions. We also found that glucose was the most effective carbon source, and the other carbohydrates tested were not as effective (Fig.
1E
).
External zinc is also an effective stimulus.
Although glucose serves as a stimulus for the Rcs signaling system, the observed β-galactosidase activity was only about 50 U, suggesting that the cps:: lacZreporter gene in ST001 may not be fully induced under these conditions. After extensively searching for other external stimuli, we found that addition of zinc (1 mM ZnCl 2) to EB medium resulted in marked induction of the cps:: lacZreporter gene at 20°C in a manner dependent on the RcsC function (Fig.2Aand B). A lower concentration of zinc (0.5 mM) was also effective (data not shown), and these concentrations of zinc in EB medium were not deleterious for growth of cells (Fig.2B). In these experiments, the cells were precultured at 37°C overnight. However, it should be noted that even if the cells were precultured at 20°C, essentially the same results were obtained. Other divalent cations tested, including magnesium (30 mM MnCl 2) and nickel (1 mM NiCl 2), did not serve as stimuli (Fig.2Cand D). The effects of glucose and zinc on the cps:: lacZreporter gene were additive (Fig.2A). Thus, we found that the Rcs-mediated expression of cps:: lacZwas fully induced under certain physiological growth conditions, namely, when cells were grown at a low temperature in the presence of glucose as a carbon source and in the presence of a relatively high concentration of external zinc. It should be noted that the levels of induction of cps:: lacZfound in this study were much higher than the level of induction by an osmotic shock. As reported previously (42), the induction by an osmotic shock was less than 10 U under our experimental conditions.
RcsF is an essential component of the Rcs signaling system.
It was previously suggested that the
rcsF
gene product might be a component of the Rcs signaling system (
11
). RcsF was inferred to be an outer membrane lipoprotein. It was reported that when the
rcsF
gene on a multicopy plasmid was introduced into
E. coli
cells, the
cps
genes were markedly induced in a manner dependent on the Rcs signaling system, even at 37°C. In this study we confirmed this with ST001 (Fig.
3A
). Indeed, the expression of
cps
::
lacZ
was markedly elevated, provided that the
rcsF
gene on a multicopy plasmid was introduced into ST001. This event was completely dependent on each component of the Rcs signaling system (Fig.
3A
). Nevertheless, our results do not necessarily mean that RcsF is an essential component of the Rcs signaling system, because the multicopy
rcsF
gene was used in this experiment. Since we succeeded in identifying certain physiological growth conditions under which the
cps
genes were reproducibly induced, we were able to critically examine the longstanding question of whether RcsF is an essential component of the Rcs signaling system. A Δ
rcsF
derivative of ST001 was constructed, in which the entire coding region on the chromosome was deleted (see Materials and Methods). This derivative was then examined with regard to expression of
cps
::
lacZ
in response to external zinc at 20°C (Fig.
3B
). The results showed that the
rcsF
gene is an essential component of the Rcs signaling system, as far as signal transduction in response to glucose and zinc is concerned. Assuming that RcsF is an outer membrane protein, the following framework of the Rcs signaling system was formulated: RcsF (outer membrane protein)/RcsC (inner membrane protein) → YojN → RcsB/RcsA → Rcs regulon (target genes).
Genome-wide microarray analyses with special reference to the Rcs signaling system.
Based on the framework and physiological stimuli that propagate the Rcs signaling system, we conducted genome-wide analyses with microarrays in order to characterize the Rcs regulon more extensively. Custom glass slide microarrays were spotted with PCR products corresponding to 4,095 full-length
E. coli
open reading frames (Takara Shuzo). This
E. coli
whole-genome microarray has been successfully employed in previous studies (
31
,
32
). With this microarray system, systematic profile analysis of transcriptomes was carried out after one RNA sample was labeled with Cy3 and the other RNA sample was labeled with Cy5 (Fig.
4
). First, the labeled transcripts were prepared from ST001 cells grown in glucose-containing EB medium at 20°C in the presence of zinc (1 mM), and they were compared with the transcripts from cells grown in the absence of zinc. This microarray analysis revealed the genes whose expression was induced by zinc (zinc-up genes). Second, the transcripts of ST001 (wild-type) cells grown at 20°C in the presence of glucose and zinc were compared with those of a mutant derivative of ST001 (Δ
rcsC
) grown under the same conditions. This microarray profile analysis revealed the genes whose induction was mediated by the RcsC function (Δ
rcsC
-down genes). To obtain reproducible data, a Δ
rcsF
mutant was also employed. The transcripts of ST001 (wild-type) cells grown at 20°C in the presence of glucose and zinc were compared with those of a mutant derivative of ST001 (Δ
rcsF
) grown under the same conditions. This microarray profile analysis revealed the genes whose induction was mediated by the RcsF function (Δ
rcsF
-down genes). When the data were considered together, we could systematically compile the genes whose expression was regulated through the RcsF/RcsC→YojN→RcsB signaling system in response to glucose and zinc.
The results of the intensive microarray analyses are schematically summarized in Fig.4. First, 213 genes were identified as zinc-up genes. As expected, the cps:: lacZgene in ST001 was found in these genes (a critical internal reference for the reliability of the microarrays). Also, it was not surprising that such a large number of genes were affected by zinc, because when grown in the presence of external zinc, E. colicells must change their physiologies in various ways. Second, 58 genes were identified as Δ rcsC-down genes, and 35 of these genes overlapped zinc-up genes (Fig.4A). These zinc-induced genes were assumed to be the genes whose expression is mediated by the RcsC function. Similarly, 120 genes were identified as Δ rcsF-down genes, and 49 of these genes overlapped zinc-up genes (Fig.4B). Then the 35 Δ rcsC-down and 49 Δ rcsF-down genes were compared with each other. Strikingly, 32 genes were found in both groups (Fig.4C). In addition to these genes, the cps:: lacZgene was recovered in this group, as mentioned above. Thus, we assumed that these 32 genes are most likely the genes whose expression is under control of the Rcs signaling system, directly or indirectly (these genes were tentatively referred to as Rcs regulon genes) (Fig.4D).
It should be noted that 23 of the 58 Δ
rcsC
-down genes were not found in the zinc-up gene group. This fact may suggest that zinc and glucose regulate each set of genes through the Rcs signaling system. It may also be noteworthy that a much larger number of genes (120 genes) were affected in the Δ
rcsF
mutant than in the Δ
rcsC
mutant (58 genes). This fact may suggest that RcsF is also implicated in an as-yet-unknown regulatory system which is not dependent on the Rcs signaling system. In any event, these intriguing findings remain to be elucidated.
In addition to the
cps
genes, many other genes appear to be members of the Rcs regulon.
To examine the putative Rcs regulon genes more closely, the 32 genes discovered are listed in Fig.4D. First, most of the known cpsgenes were identified as putative Rcs regulon members, as expected. These genes include the wzcgene, as well as the wcaoperon genes (46). Altogether, 17 of the cpsgenes were successfully identified as Rcs regulon members. In addition to these cpsgenes, the same microarray analyses revealed that 15 non- cpsgenes were putative Rcs regulon members. Some of these genes (eight genes) have previously been characterized to some extent, as noted in Fig.4D. They included three of the osmgenes (8,12,20,29,50). The bdmgene was characterized as the gene relevant for biofilm formation (33), whereas spywas shown to be a spheroplast-inducible gene (16,34). The katEgene encodes an RpoS-dependent catalase (designated HPII) (43,49).
As noted above, the 15 non- cpsgenes, including 7 uncharacterized ygenes, seem to be Rcs regulon members. It may be noted that two of these genes, the bdmand osmCgenes, are located next to each other on the chromosome but are oriented in opposite directions (Fig.4). Also, the spyand ydjRgenes appear to constitute an operon. As mentioned above, RcsB (together with RcsA) is a crucial DNA-binding regulator for the Rcs regulon. Previously, a consensus sequence (TAAGAATATTCCTA) was proposed as the RcsA/RcaB (heterodimer) recognition site (47). We searched for putative RcsA/RcsB recognition sites in the presumed promoter regions of the newly identified target genes. Many of these genes, if not all of them, have a short nucleotide sequence similar to the RcsA/RcsB recognition site in the appropriate promoter region (Fig.5A). However, some of the putative recognition sites are located far from the corresponding ATG initiation codons (e.g., katE, yajI, and yggE). Also, some of the promoters might also have an RcsB recognition site, which is independent of RcsA. Therefore, verification of RcsB and/or RcsA recognition sites in these putative Rcs regulon genes must await further inspection, which should include determination of each transcription start site. To address this issue further, an E. colistrain (designated GY37) carrying a katE:: lacZfusion gene on the chromosome was employed (49). The expression profiles of the katE:: lacZfusion gene were examined in terms of the Rcs signaling system (Fig.5B). Indeed, expression of katE:: lacZwas induced in response to external glucose and zinc at 20°C. The induction of katE:: lacZwas severely impaired in a set of rcsmutants.
It should be emphasized that the proposed Rcs regulon genes are tentative, because in theory, the microarray analyses did not arrow us to discriminate whether a given gene that was identified is indeed the direct target of the transcriptional regulator in question. In this strict sense, some of the proposed Rcs regulon genes may or may not be direct targets of the Rcs signaling system. For example, the Rcs signaling system might somehow affect the activity of RpoS at the level of transcription, translation, or protein stability, which in turn could affect expression of the
katE
gene indirectly. With such limitations in mind, however, the microarray analyses performed in this study consistently revealed the set of 32 genes whose expression is under control of the Rcs signaling system directly or indirectly. In any case, the Rcs regulon genes, proposed above, appeared to be positively regulated by the Rcs signaling system. Theoretically, one can search for genes whose expression is negatively regulated by the Rcs signaling system. Such genes should be classified as zinc-down, Δ
rcsC
-up, and Δ
rcsF
-up genes. However, no such gene was revealed by our microarray data (data not shown). Thus, the Rcs signaling system acts mainly in positive regulation of the downstream target genes.
Another genome-wide analysis.
The genome-wide microarray analyses revealed a view of the Rcs regulon, as mentioned above. To further characterize the Rcs signaling system, we next took another genome-wide approach, as follows. We employed a set of 37 deletion mutants with mutations in the E. colitwo-component systems (24,25), in which each individual two-component gene was knocked out, one by one (32), as shown in Fig.6. In most of the mutants, an operon comprising a pair of sensor/regulator genes was deleted [for instance, Δ( envZ/ompR) and Δ phoQ/P]. In other instances, each corresponding sensor or regulator gene was deleted singly (for instance, Δ arcA). These 37 mutants were constructed previously, and they have been subjected to systematic analyses with microarrays previously (32). In this study, each of the mutant alleles was transferred into ST001 carrying the cps:: lacZreporter gene. For each derivative, expression of the cps:: lacZreporter gene was examined after cells were grown for 12 h at 20°C in EB medium containing glucose and zinc (Fig.6). The results showed that as in the rcsmutants, the levels of induction of cps:: lacZwere considerably reduced in the following genetic backgrounds: Δ arcA, Δ( envZ/ompR), and Δ phoQ/P. Rcs-mediated cps:: lacZexpression was not significantly affected in the other genetic backgrounds. The results suggested that the Rcs signaling system might have linkage to some other phosphorelay systems.
To critically examine this possibility, the time course of cps:: lacZinduction was monitored in each genetic background in question (Fig.7). In both the Δ arcAand Δ( envZ/ompR) backgrounds (Fig.7Cand D), a slightly different cps:: lacZexpression profile was obtained compared with that of the wild type (Fig.7A). In particular, the levels of expression at 12 h for Δ arcA(ca. 200 U) and Δ( envZ/ompR) (ca. 200 U) were significantly lower than the level of expression in the wild-type background (ca. 300 U). These observations were consistent with the findings shown in Fig.6, and thus the ArcA and/or EnvZ signaling system might have a link to the Rcs signaling system. However, the apparent effects of these mutants were subtle; thus, they were not characterized any further in this study. In contrast, the induction of cps:: lacZwas more severely impaired in the Δ phoQ/Pbackground (Fig.7E). Both the PhoQ sensor and PhoP regulator components were required for full induction of cps:: lacZin response to zinc (Fig.7Fand G). These results suggested that the PhoQ/P two-component genes might also be crucial determinants for regulating the cpsgenes in response to external zinc. In other words, there might be an intimate link between the Rcs and PhoQ/P signaling systems.
Evidence for close linkage between the Rcs and PhoQ/P signaling systems.
We remembered the well-documented fact that the PhoQ/P signaling system functions in response to external magnesium (for a review, see reference
14
). The phosphatase activity of PhoQ is modulated (or activated) through direct binding of magnesium ions to the PhoQ sensor, and thus the activity of the cognate PhoP response regulator is repressed at high concentrations of magnesium (
45
). The critical question then is, how do we explain the observed linkage between the PhoQ/P and Rcs signaling systems in response to zinc? We assumed that the PhoQ/P signaling system somehow functions upstream of the Rcs signaling system in response to zinc. If this is so, one can predict that the following events will occur: the
cps
::
lacZ
induction by zinc at 20°C in EB medium should be eliminated by the presence of a high concentration of magnesium in the medium, and the PhoQ/P signaling system should be attenuated under these conditions. The results of a critical examination of this hypothesis are shown in Fig.
8A
. Indeed, induction of
cps
::
lacZ
by zinc (1 mM) was not observed, provided that magnesium (30 mM) was added concomitantly to the medium. This effect was dependent on the concentration of magnesium added (Fig.
8B
).
This observation led us to envisage that the PhoQ sensor, not the RcsC sensor, might sense the external zinc signal. In other words, it was assumed that a high concentration of magnesium is a negative signal for the PhoQ sensor, whereas zinc might act as a positive signal. To test this idea, we examined expression of the mgrBgene, which is one of the hallmark targets of the PhoQ/P signaling system (21). When MG1301 cells carrying the mgrB:: lacZgene on the chromosome were grown at 20°C in EB medium with a high concentration of magnesium (30 mM MgCl 2), the expression of mgrB:: lacZwas severely repressed, as expected (Fig.9A). In magnesium-limited EB medium, however, a high, constitutive level of β-galactosidase activity was detected, also as expected (45). Interestingly, provided that zinc (1 mM) was added to the medium, the levels of β-galactosidase activity were further increased (Fig.9A). These results were best explained by assuming that the PhoQ/P signaling system responded not only to external magnesium but also to zinc, particularly when the concentration of external magnesium was relatively low. This event was confirmed by measuring expression of mgrB:: lacZwith various concentrations of magnesium in the presence of zinc (Fig.9B). The results were completely consistent with the view that the PhoQ sensor is capable of responding to both magnesium and zinc in such a way that a high concentration of zinc stimulates the PhoQ function, while a high concentration of magnesium inhibits the PhoQ sensor.
Critical genome-wide microarray analyses.
The results described above supported the presence of the plausible zinc→PhoQ/P signaling→Rcs signaling→Rcs regulon pathway, through which zinc propagates the Rcs system in a PhoQ/P-dependent manner. To critically examine this possibility, we conducted the following microarray analysis. Transcripts in ST001 (wild-type) cells grown at 20°C in the presence of glucose and zinc were compared with transcripts of a mutant derivative of ST001 (Δ
phoQ/P
) grown under the same conditions. This microarray profile analysis should have revealed the genes whose expression was mediated by the PhoQ/P function (Δ
phoQ/P
-down genes). A total of 100 genes were identified as such genes, and 61 of these genes overlapped zinc-up genes (Fig.
10A
; also see Fig.
4
). These zinc-induced genes were assumed to be the genes whose expression is mediated by the PhoQ/P function. More importantly, it was found that 25 of the previously identified 32 Rcs regulon genes were included in the Δ
phoQ/P
-down group (Fig.
10B
). In other words, only seven genes (e.g.,
wcaF
and
wcaK
) had escaped the microarray analysis. When the intrinsic limitations of the microarray were considered, this result supported the presence of the zinc→PhoQ/P signaling→Rcs signaling→Rcs regulon signaling pathway.
DISCUSSION
In this study, the Rcs phosphorelay signaling system in E. coliwas characterized with a genome-wide viewpoint. Several intriguing views emerged from this analysis, as summarized in Fig.11(1). Not only the three Rcs phosphorelay factors but also RcsF was demonstrated to be a crucial component of the Rcs signaling system (Fig.3) (2). The resulting RcsF/RcsC→YojN→RcsB/RcsA signaling system was propagated under certain physiological growth conditions, namely, when cells were grown at a low temperature in the presence of glucose as a carbon source and in response to a relatively high concentration of external zinc (Fig.1and2) (3). By using microarray analyses, a view of the Rcs regulon was clarified by identifying a number of putative new target genes whose expression is positively regulated by the Rcs signaling system (Fig.4). In addition to the well-known cpsgenes, a number of apparently unrelated genes, including osmB/C/Y, were suggested to be the members of Rcs regulon (Fig.4and5) (4). The results of another genome-wide examination revealed a close linkage between the Rcs and PhoQ/P signaling systems, the latter of which is known to respond to external magnesium (Fig.6and7). The results of this study supported the occurrence of the zinc (magneiusm)→PhoQ/Psignaling→Rcs signaling→Rcs regulon pathway (Fig.8to10). Collectively, the results obtained in this study provided deeper insight into the E. coliphosphorelay systems, with special reference to the Rcs signaling system (Fig.11).
Microarray analysis is a powerful technique for systematically revealing the transcriptomes of organisms of interest. In E. coli, a large number of microarray data are accumulating rapidly (9,30,31,32,51). Previously, we have taken such genome-wide approaches to obtain a whole picture of the transcriptomes for the E. coliphosphorelay systems (32). To further extend our knowledge, in this study we used the same approach with special reference to the Rcs signaling system. The microarray analyses consistently revealed the members of the Rcs regulon. In addition to the known cpsgenes (17 genes), the results suggested that a number of new targets (15 genes) seemed to be activated through the Rcs signaling system. We need to confirm this assumption for each gene by another means, one by one. However, this view was based on the results of four independent microarray analyses (zinc-up, Δ rcsC-down, Δ rcsF-down, and Δ phoQ/P-down). Furthermore, we confirmed that the katEgene is regulated by the Rcs signaling system (Fig.5), and the osmCgene has recently been reported to be under control of the Rcs signaling system (6,8). In any case, the newly identified genes apparently are not relevant to colanic acid synthesis. Interestingly, however, many of them were predicted to encode cell envelope-associated proteins. These proteins include three putative lipoproteins (OsmB, YajI, and YggG), three putative periplasmic proteins (OsmY, Spy, and YggE), and two inner membrane proteins (OsmC and PhnQ). Thus, the Rcs signaling system may play more sophisticated roles in addition to its role in colanic acid synthesis. In fact, we previously showed that the Rcs signaling system is somehow involved in modulation of a characteristic behavior of E. colicells during colony formation on the surfaces of agar plates, namely, swarming. It is also worth mentioning that the bdmgene is a biofilm-associated gene (33), and another gene ( yggE) is an autoinducer-responsive gene implicated in quorum sensing (9). Thus, the Rcs signaling system might also be involved in characteristic E. coliphysiological processes, such as swarming, biofilm formation, and/or quorum sensing.
The finding that there is intimate linkage between the Rcs and PhoQ/P signaling systems is intriguing since these signaling systems together respond to certain external divalent cations (zinc and magnesium) (Fig.
11
). We do not know the molecular mode through which these two systems are linked. However, all of our results consistently supported the following presumed scheme: zinc and magnesium (stimuli) → PhoQ/P → X → RcsC/YojN/RcsB (where X is an unknown factor). Most likely, zinc directly signals PhoQ by modulating the kinase and/or phosphatase activities of PhoQ, and this zinc effect is counteracted by the magnesium effect, although the possibility that zinc directly modulates the RcsC sensor cannot be ruled out. It should also be noted that the Δ
phoQ
sensor mutant still responded to external zinc, albeit to a very low extent (Fig.
7G
). This might suggest that there is an as-yet-unknown senor signal for PhoR in response to zinc in the absence of the cognate PhoQ sensor. In any case, this residual activity was not affected by magnesium in the medium (data not shown). Also, expression of the
rcsC
,
yojN
, or
rcsB
gene might be dependent on the PhoQ/P functions. This is unlikely, because expression of these genes is not affected in the presence of the Δ
phoQ/P
mutation (Fig.
10
). The proposed scheme shown in Fig.
11
is based on these intensive considerations.
Interestingly, this scheme led us to remember the well-documented PhoQ/P→[PmrD]→PmrB/A signaling network reported for an S. entericaserovar (for a review, see reference14). In S. enterica, the PhoQ/P signaling system activates the PmrB/A signaling system during growth in the presence of a low magnesium concentration. In principle, the PmrB/A system is known to respond to external iron (5,48). The unique gene product PmrD connects these two systems in such a way that the PhoQ/P signaling system regulates the production of PmrD, and the resulting protein activates the PmrB His kinase (22). Indeed, E. coliK-12 has an analogous set of genes, pmrD, pmrB(also called basS), and pmrA(or basR) (27). In the presumed zinc (stimulus)→PhoQ/P→X→RcsC/YojN/RcsB pathway, a hypothetical factor (X) might play a role similar to that of PmrD. Through both the PhoQ/P→Rcs and PhoQ/P→PmrB/A signaling networks, E. colicells might be able to coordinately adapt to the states of external divalent cations, such as magnesium, iron, and zinc.
Many isolates of E. colisynthesize the slime polysaccharide colanic acid (references35and36and references therein). Small amounts of this capsule molecule are made by most E. colistrains, but certain growth conditions occasionally lead to dramatic increases in synthesis. Although the physiological role of colanic acid is still unclear, capsules are the outermost structures on an E. colicell, and they may play a critical role in interactions between the bacterium and its environment by providing mechanisms for the cell to avoid host defenses in the intestinal tract. Capsules may also be important in the ability of E. colito survive in extraorganismic environments. From the physiological point of view, the findings of this study showed that the environmental cation states, including the external levels of zinc and magnesium, appear to be critical environmental signals for capsular polysaccharide synthesis. The presumed framework shown in Fig.11provided several insight into the physiological role of the Rcs signaling system. It should be noted that the PhoQ/P signaling system regulates not only certain magnesium transporter genes but also genes involved in lipopolysaccharide modification (e.g., pagP) (14). Accordingly, the PhoQ/P→Rcs signaling network might allow E. colicells to coordinately regulate cell surface polysaccharide (capsular polysaccharide and lipopolysaccharide) synthesis in response to the environmental states of divalent cations, such as magnesium and zinc. As elegantly proposed by Groisman (14) for the PhoQ/P→PmrB/A network in response to external magnesium and iron, the newly proposed PhoQ/P→Rcs network in response to external magnesium and zinc might also be important in natural habitats for maintenance of cell surface integrity and proper cell-cell interactions. These physiological processes might be crucial for swarming behavior on solid medium, quorum sensing, and/or biofilm formation, as mentioned above.
In summary, the genome-wide analyses performed in this study provided not only specific insight into the Rcs signaling system but also general insight into the
E. coli
phosphorelay systems. Since one can already see the impact of genome-wide analyses, such analyses for other phosphorelay systems should shed light on the global network of the His→Asp phosphorelay signal transduction systems in
E. coli
.
FIG. 1.
<here is a image 7e79e0cef1db8848-eb9fb6673c12e305>
FIG. 1. β-Galactosidase activity, determined by monitoring the cps:: lacZreporter gene. (A) ST001 (wild-type) cells were grown overnight in EB medium at 37°C. Aliquots were inoculated into fresh EB medium with and without 0.4% glucose and incubated at 37°C for 1.5 h, and then the cultures were transferred to a lower temperature (20°C). During growth at the lower temperature, β-galactosidase activities were monitored. As references, mutant derivatives of ST001 (Δ rcsCand Δ yojN) were also examined. (Insets) ST001 cells were grown on EB medium at 20°C (on agar plates) in the presence and absence of glucose (0.4%) for 48 h. The resulting colonies were photographed. (B) Growth curves for the cells which were examined in theexperiments whose results are shown in panel A. The symbols are the same as those used in panel A. OD 660, optical density at 660 nm. (C) Culture incubated at 37°C as described above, as a control. (D) Growth curves for the cells which were examined in the experiment whose results are shown in panel C. The experiments were carried out at least three times, and the results of representative experiments are shown. (E) ST001 cells were grown at 20°C for both 8 and 12 h as described above in EB medium supplemented with either glucose (Glu), fructose (Fru), galactose (Gal), pyruvate (Pyr), or maltose (Mal) at a concentration of 0.4%. Then β-galactosidase activities were measured. Under both experimental conditions consistent results were obtained, and representative data (12 h) are shown.
FIG. 2.
<here is a image 4a44ebd43b0d7afb-9227af94b0650c4e>
FIG. 2. β-Galactosidase activity, determined by monitoring the cps:: lacZreporter gene. (A) ST001 (wild type) and a derivative of this strain (Δ rcsC) were grown as described in the legend to Fig.1. In these experiments, glucose and/or zinc (1 mM ZnCl 2) was added, as indicated. β-Galactosidase activities were measured during growth at 20°C. The experiments were carried out at least three times, and the results of representative experiments are shown. (B) Growth curves for the cells which were examined in the experiment whose results are shown in panel A. The symbols are the same as those used in panel A. OD 660, optical density at 660 nm. (C) ST001 cells were grown at 20°C for both 8 and 12 h (see panel D) in glucose-EB medium containing a divalent cation (1 mM ZnCl 2, 1 mM CuSO 4, 1 mM NiCl 2, 10 mM CaCl 2, or 30 mM MgCl 2). Then β-galactosidase activities were measured. Under both experimental conditions consistent results were obtained, and representative data (12 h) are shown. (D) Growth curves for the cells which were examined in the experiment whose results are shown in panel A. For an explanation of the symbols, see panel C.
FIG. 3.
<here is a image 7b91ea9ca4feebe0-35772aa602002ba0>
FIG. 3. β-Galactosidase activity, determined by monitoring the cps:: lacZreporter gene. (A) ST001 (wild type [WT]) and mutant derivatives of this strain (Δ rcsC, Δ yojN, and Δ rcsB) were transformed with a multicopy plasmid harboring the rcsFgene. The resulting cells (+plasmid), together with the control cells (WT), were grown in glucose-EB medium for 8 and 12 h at 37°C. Then β-galactosidase activities were measured. Under both experimental conditions, consistent results were obtained, and representative data (8 h) are shown. (B) ST001 (wild type) and mutant derivatives of this strain (Δ rcsCand Δ rcsF) were grown for 12 h at 20°C in glucose-EB medium with and without zinc, as described in the legend to Fig.1. Then β-galactosidase activities were measured. Under both experimental conditions consistent results were obtained, and representative data (12 h) are shown.
FIG. 4.
<here is a image 483706a103ab24c1-7fd86d8e81ec1e6b>
FIG. 4. Schematic representation of microarray data obtained with mutants with mutations in the Rcs signaling system. Three types of microarray analyses were carried out. First, the transcriptome of ST001 (wild-type) cells grown for 8 h at 20°C in EB medium containing 0.4% glucose and 1 mM ZnCl 2(labeled with Cy5) was compared with that of cells grown in the absence of zinc (labeled with Cy3). The data analyses revealed that 213 genes showed mean values for Cy5/Cy3 that were greater than 2. These genes were assumed to be the genes whose expression was up-regulated by zinc (designated zinc-up genes). Second, the transcriptome of Δ rcsCcells grown at 20°C in EB medium containing 0.4% glucose and 1 mM ZnCl 2(labeled with Cy5) was compared with that of ST001 (wild-type) cells grown under the same conditions (labeled with Cy3). The data analyses revealed that 58 genes showed mean values for Cy5/Cy3 that were less than 0.5. These genes were assumed to be the genes whose expression was down-regulated in the Δ rcsCbackground (designated Δ rcsC-down genes). Similarly, 120 Δ rcsF-down genes were identified. Based on the microarray data, each overlapping set of genes was analyzed, as shown in panels A and B. These independent analyses revealed the putative Rcs regulon members, shown in panel C. (D) Putative Rcs regulon genes. The 17 cpsgenes are located together in cpsoperons on the E. colichromosome. The 15 non- cpsgenes are located at different positions on the chromosome, although the bdmand osmCgenes and the spyand ydjRgenes are located next to each other, as indicated by arrows. The microarray data used in this study are available as supplemental data at the following web site:http://www.agr.nagoya-u.ac.jp/%7emicrobio/. Also, to gain additional ideas for each gene, see the web site of Colibri (http://www.genolist.pasteur.fr/Colibri/). CPS, capsular polysaccharide.
FIG. 5.
<here is a image 49990cb388b376ea-e2af068eb91363ed>
FIG. 5. Putative RcsA/RcsB recognition sequences in the Rcs regulon genes and β-galactosidase activity as determined by monitoring the katE:: lacZreporter gene. (A) Using the previously proposed RcsA/RcsB recognition consensus sequence (TAAGAATATTCCTA) (47), we searched for nucleotide sequences similar to the consensus sequence in each promoter region of the non- cpsgenes (see Fig.4D). The numbers in parentheses indicate the position (last nucleotide) of the 14-nucleotide sequence; the first nucleotide of the inferred ATG initiation codon of the gene in question was defined as position 1. (B) Strain GY37 carries the katE:: lacZreporter gene (49). This wild-type strain and mutant derivatives (Δ rcsC, Δ yojN, and Δ rcsB) were grown in EB medium containing 0.4% glucose and 1 mM ZnCl 2at 20°C, as described in the legend to Fig.1. β-Galactosidase activities were measured during growth.
FIG. 6.
<here is a image e56e86b5c13bf0bd-3bcf5b8b26fbe3ca>
FIG. 6. β-Galactosidase activity, determined by monitoring the cps:: lacZreporter gene in a set of 37 two-component system mutants. ST001 (wild type) and 37 two-component system mutants (each designated by a gene designation[s]) were grown in EB medium containing 0.4% glucose and 1 mM ZnCl 2at 20°C for 12 h, as described in the legend to Fig.1. Then β-galactosidase activities were measured. The experiments were carried out three times, and the data shown are means. The basS/Rmutant cells did not grow well in the medium used. ND, not determined.
FIG. 7.
<here is a image 53c367ef3027208a-485c20e7fa0a031e>
FIG. 7. β-Galactosidase activity, determined by monitoring the cps:: lacZreporter gene in two-component mutant backgrounds. ST001 (wild type) and mutant derivatives of this strain were grown in EB medium containing 0.4% glucose and 1 mM ZnCl 2at 20°C, as described in the legend to Fig.1. Then the β-galactosidase activities were measured at intervals. (A) ST001 (wild type); (B) ST001(Δ rcsC); (C) ST001(Δ arcA); (D) ST001[Δ( envZ/ompR)]; (E) ST001Δ phoQ/P; (F) Δ phoQ; (G) Δ phoP.
FIG. 8.
<here is a image 466f4a2f30364bb4-e9d9eabd3f5133a4>
FIG. 8. β-Galactosidase activity, determined by monitoring the cps:: lacZreporter gene with cells grown in the presence of both magnesium and zinc. (A) ST001 cells were grown at 20°C in EB containing 0.4% glucose and 1 mM ZnCl 2with and without 30 mM MgCl 2(also see the legend to Fig.1). During growth, β-galactosidase activities were measured. (B) ST001 cells were grown at 20°C in EB containing 0.4% glucose and 1 mM ZnCl 2, as well as different concentrations of MgCl 2. After 8 and 12 h of incubation, β-galactosidase activities were measured. Under both experimental conditions consistent results were obtained, and representative data (12 h) are shown.
FIG. 9.
<here is a image 1549ae1ec8776a08-acbb374622719a42>
FIG. 9. β-Galactosidase activity, determined by monitoring the mgrB:: lacZreporter gene with cells grown in the presence of both magnesium and zinc. (A) MG1301 cells carrying the mgrB:: lacZreporter gene were grown at 20°C in EB medium containing 0.4% glucose with and without 1 mM ZnCl 2and/or 30 mM MgCl 2. During growth, β-galactosidase activities were measured. (B) MG1301cells carrying the mgrB:: lacZreporter gene were grown at 20°C in EB medium containing 0.4% glucose and 1 mM ZnCl 2with different concentrations of MgCl 2. Then β-galactosidase activities were measured after 8 and 12 h of incubation. Under both experimental conditions consistent results were obtained, and representative data (12 h) are shown.
FIG. 10.
<here is a image 7b35d46cffa86b84-820b5a96cfddc90c>
FIG. 10. Schematic representation of microarray data obtained with a mutant with a mutation in the PhoQ/P signaling system. Microarray analyses were carried out as indicted. The transcriptome of Δ phoQ/Pcells grown at 20°C in EB medium containing 0.4% glucose and 1 mM ZnCl 2(labeled with Cy5) was compared with that of ST001 (wild-type) cells grown under the same conditions (labeled with Cy3). The data analyses revealed that 100 genes showed mean values for Cy5/Cy3 that were less than 0.5. These genes were assumed to be the genes whose expression was down-regulated in the Δ phoQ/Pbackground (designated Δ phoQ/P-down genes). (A) Uncovered genes were compared with zinc-up genes (see Fig.4). This analysis allowed us to select 61 Δ phoQ/P-down genes, whose zinc-responsive expression was assumed to be mediated by the PhoQ/P signaling system. (B) Genes compared with genes belonging to the Rcs regulon (see Fig.4). Note that most of the Rcs regulon members were also found to be Δ phoQ/P-down genes. The microarray data used in this study are available as supplemental data at the following web site:http://www.agr.nagoya-u.ac.jp/%7emicrobio/.
FIG. 11.
<here is a image 44e6d4eb1074efe2-6b6b43f1c24158a4>
FIG. 11. Proposed organization of the PhoQ/P-Rcs signaling network. The magnesium-regulated PhoQ/P signaling system appears to function upstream of the Rcs signaling system. The results of this study suggested that the PhoQ/P signaling system is activated by an external zinc signal, resulting in activation of the Rcs signaling system. The function of RcsF is not clear in this model. However, RcsF is essential for the regulatory system (see Fig.3), and the rcsFmutation is epstatic to the phoQmutation (data not shown). We propose that such a sophisticated PhoQ/P-Rcs signaling network ensures that E. colicells properly regulate the cell surface structures by modifying lipopolysaccharide (LPS) and/or capsular polysaccharide (CPS) in response to the external states of crucial divalent cations (magnesium and zinc). Details are discussed in the text.
Acknowledgments
This study was supported by grants-in-aid from the Ministry of Education, Culture, Sports, Science and Technology of Japan (to T.M.) and from CREST of Japan Science and Technology (to H.M.).
We thank R. Utsumi for providing an E. colistrain ( mgrB:: lacZ).
REFERENCES
1.
Appleby, J. L., J. S. Parkinson, and R. B. Bourret.1996. Signal transduction via the multi-step phosphorelay: not necessarily a road less traveled. Cell86 :845-848.
Crossref
PubMed
ISI
Google Scholar
a [...] with other His→Asp phosphorelay systems
b [...] from this analysis, as summarized in Fig.
2.
Arricau, N., D. Hermant, H. Waxin, C. Ecobichon, P. S. Duffey, and M. Y. Popoff.1998. The RcsB-RcsC regulatory system of Salmonella typhidifferentially modulates the expression of invasion proteins, flagellin and Vi antigen in response to osmolarity. Mol. Microbiol.29 :835-850.
a [...] (designated Sip), flagellin, and Vi antigen
b [...] component of the Rcs signaling system (Fig.
3.
Belas, R., R. Schneider, and M. Melch.1998. Characterization of Proteus mirabilisprecocious swarming mutants: identification of rsbA, encoding a regulator of swarming behavior. J. Bacteriol.180 :6126-6139.
a [...] its characteristic swarming behavior
b [...] 1 and
4.
Bereswill, S., and K. Geider.1997. Characterization of the rcsBgene from Erwinia amylovoraand its influence on exopolysaccharide synthesis and virulence of the fire blight pathogen. J. Bacteriol.179 :1354-1361.
a [...] regulated through the Rcs signaling systems
b [...] 4 and
5.
Chamnongpol, S., W. Dodson, M. J. Cromie, Z. L. Harris, and E. A. Groisman.2002. Fe(III)-mediated cellular toxicity. Mol. Microbiol.45 :711-719.
6.
Conter, A., R. Sturny, C. Gutierreze, and K. Cam.2002. The RcsCB His-Asp phosphorelay system is essential to overcome chlorpromazine-induced stress in Escherichia coli. J. Bacteriol.184 :2850-2853.
7.
Datsenko, K. A., and B. L. Wanner.2000. One-step inactivation of chromosomal genes in Escherichia coliK-12 using PCR products. Proc. Natl. Acad. Sci. USA97 :6640-6645.
a [...] for constructing deletion mutants
b [...] used to construct deletion mutants
8.
Davalos-Garcia, M., A. Conter, I. Toesca, C. Gutierrez, and K. Cam.2001. Regulation of osmCgene expression by the two-component system rcsB-rcsCin Escherichia coli. J. Bacteriol.183 :5870-5876.
a [...] osm genes
b [...] under control of the Rcs signaling system
9.
DeLisa, M. P., C. F. Wu, L. Wang, J. J. Valdes, and W. E. Bentley.2001. DNA microarray-based identification of genes controlled by autoinducer 2-stimulated quorum sensing in Escherichia coli. J. Bacteriol.183 :5239-5247.
a [...] of microarray data are accumulating rapidly
b [...] gene implicated in quorum sensing
10.
Ebel, W., and J. E. Trempy.1999. Escherichia coliRcsA, a positive activator of colanic acid capsular polysaccharide synthesis, functions to activate its own expression. J. Bacteriol.181 :577-584.
11.
Gervais, F. G., and G. R. Drapeau.1992. Identification, cloning, and characterization of rcsF, a new regulator gene for exopolysaccharide synthesis that suppresses the division mutation ftsZ84in Escherichia coliK-12. J. Bacteriol.174 :8016-8022.
a [...] plays a role in the Rcs signaling system
b [...] be a component of the Rcs signaling system
12.
Gordia, S., and C. Gutierrez.1996. Growth-phase-dependent expression of the osmotically inducible gene osmCof Escherichia coliK-12. Mol. Microbiol.19 :729-736.
13.
Gottesman, S., and V. Stout.1991. Regulation of capsular polysaccharide synthesis in Escherichia coliK-12. Mol. Microbiol.5 :1599-1606.
14.
Groisman, E. A.2001. The pleiotropic two-component regulatory system PhoP-PhoQ. J. Bacteriol.183 :1835-1842.
a [...] magnesium (for a review, see reference
b [...] serovar (for a review, see reference
c [...] lipopolysaccharide modification (e.g., pagP
d [...] and zinc. As elegantly proposed by Groisman
15.
Gygi, G., M. Rahman, H. C. Lai, H. C., R. Carlson, J. Guard-Petter, and C. Hughes.1995. A cell-surface polysaccharide that facilitates rapid population migration by differentiated swarm cells of Proteus mirabilis. Mol. Microbiol.17 :1167-1175.
16.
Hagenmaier, S., Y. D. Stierhof, and U. Henning.1997. A new periplasmic protein of Escherichia coliwhich is synthesized in spheroplasts but not in intact cells. J. Bacteriol.179 :2073-2076.
17.
Harshey, R. M., and T. Matsuyama.1994. Dimorphic transition in Escherichia coliand Salmonella typhimurium: surface-induced differentiation into hyperflagellate swarmer cells. Proc. Natl. Acad. Sci. USA91 :8631-8635.
18.
Heidelberg, J. F., J. A. Eisen, W. C. Nelson, R. A. Clayton, M. L. Gwinn, R. J. Dodson, et al.2000. DNA sequence of both chromosomes of the cholera pathogen Vibrio cholerae. Nature406 :477-483.
19.
Ishige, K., S. Nagasawa, S. Tokishita, and T. Mizuno.1994. A novel device of bacterial signal transducers. EMBO J.13 :5195-5202.
20.
Jung, J. U., C. Gutierrez, F. Martin, M. Ardourel, and M. Villarejo.1990. Transcription of osmB, a gene encoding an Escherichia colilipoprotein, is regulated by dual signals. J. Biol. Chem.265 :10574-10581.
21.
Kato, A., H. Tanabe, and R. Utsumi.1999. Molecular characterization of the PhoP-PhoQ two-component system in Escherichia coliK-12: identification of extracellular Mg 2+-responsive promoters. J. Bacteriol.181 :5516-5520.
22.
Kox, L. F., M. M. Wosten, and E. A. Groisman.2000. A small protein that mediates the activation of a two-component system by another two-component system. EMBO J.19 :1861-1872.
23.
Miller, J. H.1972. Experiments in molecular genetics. Cold Spring Harbor Press, Cold Spring Harbor, N.Y.
24.
Mizuno, T.1997. Compilation of all genes encoding two-component phosphotransfer signal transducers in the genome of Escherichia coli. DNA Res.4 :161-168.
25.
Mizuno, T.1998. His-Asp phosphotranfer signal transduction. J. Biochem. (Tokyo)123 :555-563.
26.
Mori, H., K. Isono, T. Horiuchi, and T. Miki.2000. Functional genomics of Escherichia coli. Res. Microbiol.151 :121-128.
27.
Nagasawa, S., K. Ishige, and T. Mizuno.1993. Novel members of the two-component signal transduction genes in Escherichia coli. J. Biochem. (Tokyo)114 :350-357.
28.
Nassif, X., N. Honore, T. Vasselon, S. T. Cole, and P. J. Sansonetti.1989. Positive control of colanic acid synthesis in Escherichia coliby rmpAand rmpB, two virulence-plasmid genes of Klebsiella pneumoniae. Mol. Microbiol.3 :1349-1359.
29.
Oh, J. T., Y. Cajal, M. E. Skowronska, S. Belkin, J. Chen, T. K. van Dyk, and M. K. Jain.2000. Cationic peptide antimicrobials induce selective transcription of micFand osmYin Escherichia coli. Biochim. Biophys. Acta15 :43-54.
30.
Oh, M. K., L. Rohlin, K. C. Kao, and J. C. Liao.2001. Global expression profiling of acetate-grown Escherichia coli. J. Biol. Chem.277 :13175-13183.
31.
Oshima, T., W. Wada, Y. Kawagoe, T. Ara, M. Maeda, Y. Masuda, et al.2002. Genome wide analysis of deoxy-adenosine methltransferase-demidated control of gene expression in Escherichia coli. Mol. Microbiol.45 :673-695.
32.
Oshima, T., H. Aiba, Y. Masuda, S. Kanaya, M. Sugiura, B. L. Wanner, et al.2002. Transcriptome analysis of all two-component regulatory system mutants of Eschierichia coliK-12. Mol. Microbiol.46 :281-291.
Google Scholar
33.
Prigent-Combaret, C., O. Vidal, C. Dorel, and P. Lejeune.1999. Abiotic surface sensing and biofilm-dependent regulation of gene expression in Escherichia coli. J. Bacteriol.181 :5993-6002.
34.
Raffa, R. G., and T. L. Raivio.2002. A third envelope stress signal transduction pathway in Escherichia coli. Mol. Microbiol.45 :1599-1611.
35.
Rick, P. D., and R. P. Silver.1996. Enterobacterial common antigen and capsular polysaccharides: cellular and molecular biology, p. 104-122. InF. C. Neidhardt, R. Curtiss III, J. L. Ingraham, E. C. C. Lin, K. B. Low, B. Magasanik, W. S. Reznikoff, M. Riley, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coliand Salmonella: cellular and molecular biology, 2nd ed. ASM Press, Washington, D.C.
36.
Roberts, I. S.1996. The biochemistry and genetics of capsular polysaccharide production in bacteria. Annu. Rev. Microbiol.50 :285-315.
37.
Sledjeski, D. D., and S. Gottesman.1996. Osmotic shock induction of capsule synthesis in Escherichia coliK-12. J. Bacteriol.178 :1204-1206.
38.
Stevenson, G., K. Andrianopoulos, M. Hobbs, and P. R. Reeves.1996. Organization of the Escherichia coliK-12 gene cluster responsible for production of the extracellular polysaccharide colanic acid. J. Bacteriol.178 :4885-4893.
39.
Stout, V.1994. Regulation of capsule synthesis includes interactions of the RcsC /RcsB regulatory pair. Res. Microbiol.145 :389-392.
40.
Stout, V.1996. Identification of the promoter region for the colanic acid polysaccharide biosynthetic genes in Escherichia coliK-12. J. Bacteriol.178 :4273-4280.
41.
Stover, C. K., X. Q. Pham, A. L. Erwin, S. D. Mizoguchi, P. Warrener, M. J. Hickey, et al.2000. Complete genome sequence of Pseudomonas aeruginosaPAO1, an opportunistic pathogen. Nature406 :959-964.
| http://journals.asm.org/doi/full/10.1128/jb.185.19.5735-5746.2003 |
Walt Disney: Scumbag? | Animation World Network
Walt Disney: Scumbag?
Really, Harvey, that's what you've been insinuating here. That's the underlying suggestion: that because Disney can be see to be a bad person, that his work is therefore "bad".
Where have I insinuated that Disney cartoons are bad because Walt is bad?
I don't think I've even mentioned the production aspect other than to say that Walt is "animation history's greatest producer."
Besides, most of the greatness of Disney cartoons was due to the innovations of the artists he'd hired: you know, the people he screamed at and abused, the people he promised to pay and then didn't, the people that were picketing him, the people whose lives he ruined through HUAC.
Where have I insinuated that Disney cartoons are bad because Walt is bad?
I don't think I've even mentioned the production aspect other than to say that Walt is "animation history's greatest producer."
Besides, most of the greatness of Disney cartoons was due to the innovations of the artists he'd hired: you know, the people he screamed at and abused, the people he promised to pay and then didn't, the people that were picketing him, the people whose lives he ruined through HUAC.
There's your insinuation again.
Yes, he did these things to people.
If you walk through Disneyland tomorrow, what will you think Harvey-- how nice the park is, or how nasty the man was? That's my point.
And you didn't answer my other, more relevant, questions.
"We all grow older, we do not have to grow up"--Archie Goodwin ( 1937-1998)
How is that an insinuation "that because Disney can be see [SIC] to be a bad person, that his work is therefore 'bad'"?
How do you reconcile your accusation that I believe Disney cartoons are bad with the fact that I wrote "the greatnessof Disney cartoons" in the very post that you cited as evidence?
Harvey, unbunch the panties, pal. You've posted this topic for a reason.......and you're not being clear about the reason.
Its old news as far as Disney goes--and if you are just discovering the info for the first time, welcome to the club--membership card is in the mail.
Was Disney a bit of a creep at times? Yes.
Beyond that.........what else?
Is it to pick a fight in the boring dog-days of summer, or is there some ulterior message you want to communicate on this?
If you think I'm accusingyou of something......get over yourself. Your point is coming across as muddled on this.
Disney's a bad guy to some people..............so what?
Is it just to discuss how much of a creep he's claimed to be?
Again, my questions put to your points remain unanswered...
Why is it worth the bother to drag up this Disney dirt.........yet again?
Punch-line, Harvey......send us the punch-line............ please!
"We all grow older, we do not have to grow up"--Archie Goodwin ( 1937-1998)
*edited for personal attack
just wait for it Ken...now that you've dared contest his opinion, he'll label you a troll and put you on his blocked list (akin to a child putting his fingers in his ears, shutting his eyes and going "blah blah blah" over the conversation)...and I'm not speaking as just a jilted lover either.
..mother told me there'd be days like this
Oh, I know...........I've heard of this ( and of Harvey) before.
I'm giving him the fair chance to come across differently, just as I would with anyone. All in the interest of fair discussion.
I'll give Harvey enough credit to assume that he's not the run-of-the-mill attention-seeker like we all see across the length and breadth of the internet. He's seems like a pretty smart guy for the most part, so I'm a weeeee bit wary here.
If he's got something to say.....a point to put across, I'll be happy to read what he has to say.
But if that's not what he's lookin' for........well, me barbs o' scorn are always ready and they be plenty pointy.
"We all grow older, we do not have to grow up"--Archie Goodwin ( 1937-1998)
just wait for it Ken...now that you've dared contest his opinion, he'll label you a troll and put you on his blocked list (akin to a child putting his fingers in his ears, shutting his eyes and going "blah blah blah" over the conversation)...and I'm not speaking as just a jilted lover either.
..mother told me there'd be days like this
I'm trying to be respectful of the moderator's wish, but this flame-baiter keeps needling me.
*edited
I'm trying to be respectful of the moderator's wish, but this flame-baiter keeps needling me.
Would one of the babysitters please shut this jabbering infant up so the big people can have a conversation?
Harvey, just put him on Ignore and proceed. Makes your life simpler that way.
"We all grow older, we do not have to grow up"--Archie Goodwin ( 1937-1998)
It's becoming immensely clear why Meriwether was banned from the Animation Nationforums *edited
Why is it worth the bother to drag up this Disney dirt.........yet again?
Hitler was a bad guy that destroyed people lives, but he's not around anymore to defend himself so why don't we just quit beating a dead holocaust horse? Can't we just respect him for the great public speaker and painter that he was?
When you play Wolfenstein 3D, do you think "what a revolutionary and addictive game," or do you insist on dwelling on the sordid, trivial actualities of the real Hilter? Can't you just forget about all that and have fun?
Y'know, its when people stop thinking for themselves that forums like these cease being enjoyable. The writings on the cyber-wall here....
"We all grow older, we do not have to grow up"--Archie Goodwin ( 1937-1998)
Ken, for me they stop being enjoyable when certain people show a distinct lack of a sense of humour...not naming any names here (to respect the Mod's wishes) but SOME folks need to take le cornichon a l'aneth out of their ass and lighten up...if you ever get old enough (and talented enough) to work in a real studio and you walk around with the nose in the air attitude that everything you say is gold and the rest of us humans are all stupid stupid stupid, you will quickly be the target of every caricature artist in the place (and there are plenty)...we've gotten rid of more mama's boys that way.
..now, who wants gum??
tropical pete and his guava five
(now appearing at the El Mocambo)
Hitlerwas a bad guy that destroyed people lives, but he's not around anymore to defend himself so why don't we just quit beating a dead holocaust horse? Can't we just respect him for the great public speaker and painter that he was?
Y'know, itswhen people stop thinking for themselvesthat forums like these cease being enjoyable. The writings on the cyber-wall here....
But then who was thinking for Saj: thisguy?
... check out more of der fuhrer Disney's hilarious (if it weren't so insane) rant ...
Hitler was a bad guy that destroyed people lives, but he's not around anymore to defend himself so why don't we just quit beating a dead holocaust horse? Can't we just respect him for the great public speaker and painter that he was?
Just so I understand - you're now equating Hitler with Disney? The slaughter of millions is somehow roughly equivalent to yelling at employees?
Sheesh
Your point is coming across as muddled on this.
Why do I have to have a point? Isn't it enough to want to discuss an interesting topic?If I have a point, that point is "discuss it," contrary to your point, "don't discuss it."
Why is it worth the bother to drag up this Disney dirt.........yet again?
Actually, we haven't yet had a thread that focuses on all of Disney's pro-Nazi and anti-labor activities. Disney at HUAC has been mentioned here and there. One of the first threads I created, when I joined AWN three years ago, listed some of Disney's HUAC quotes. It was the first time Phacker had heard of it and she was shocked, which proves that this isn't readily-available history. The fact that some people will learn something about animation history's most important figure is enough of a reason to bring it up.
Just so I understand - you're now equating Hitler with Disney? The slaughter of millions is somehow roughly equivalent to yelling at employees?
He's not equating. He's comparing:big difference.If I compare a banana to an apple, that doesn't mean I'm saying a banana is the same thing as an apple.(P.S. I'm not equating Disney with bananas.)
He's not equating. He's comparing:big difference.
No, what he did was replace Disney with Hitler and animation with public speaking and painting. That's equating.
But how 'bout we let saj answer the question I asked of him? Or are you so desperate for an argument that you've got to shoulder your way into parts of the conversation that don't address you?
No, what he did was replace Disney with Hitler and animation with public speaking and painting. That's equating.
Is this true, Saj? Are you saying that speakingand animationare equal? How could you say something so outrageous? Don't you realize that with speakingyou use your mouth and with animationyou use your hands? How can those two things be the same? For shame! :(
LMAO! Poor Harvey; no one's taking his bait, and he's getting desperate...
Funniest thing I've read in a while :D
LMAO! Poor Harvey; no one's taking his bait, and he's getting desperate...
Funniest thing I've read in a while :D
How 'bout we let saj answer the question I asked of him? Or are you so desperate for an argument that you've got to shoulder your way into parts of the conversation that don't address you?
BWAHAHAHAHA! Oh, my sides!! :D
Ken, I'm going to have to assume that since you didn't provide any of my quotes that insinuate that bad Walt equals bad cartoons, that you're retracting that argument, and rightly so.Why do I have to have a point? Isn't it enough to want to discuss an interesting topic?If I have a point, that point is "discuss it," contrary to your point, "don't discuss it."
Actually, we haven't yet had a thread that focuses on all of Disney's pro-Nazi and anti-labor activities. Disney at HUAC has been mentioned here and there. One of the first threads I created, when I joined AWN three years ago, listed some of Disney's HUAC quotes. It was the first time Phacker had heard of it and she was shocked, which proves that this isn't readily-available history. The fact that some people will learn something about animation history's most important figure is enough of a reason to bring it up.
He's not equating. He's comparing:big difference.If I compare a banana to an apple, that doesn't mean I'm saying a banana is the same thing as an apple.(P.S. I'm not equating Disney with bananas.)
Harvey, don't dance, man--you are lousy at dancing and I cannot keep up with your feet. Instead of trying to slide around this thing, why not say something conclusively? I ask you to make a point because you come across as making no point at all with this and seem evasive in answering.
Without intending to insult you, this appears to be trolling. Provocation via a controversial topic design to polarize viewpoints. You KNOW there's going to be different camps on this subject--so you know what the outcome is going to be--given the personalities that frequent these forums.Why would any sensible person enter a community of people and pose a subject that polarizes them without reason for gain to the community?Why discuss this? Tell us what this will gain the forums?
Look over the 10 pages of this thread and ask yourself that.If you really wanted to have a topic, why not ask if Disney affiliations with these groups and his actions would taint his life-works if the public at large knew of them? Or does the public care?Use your head, man.
You've gotten 10 pages of some of us saying that we KNOW this is the case with Disney, and we don't care. The rest are people call this "spade" of a thread the other name for shovel and, by crikey, I'm starting to agree with them. I'm not throwing anymore bones your way after this.
"We all grow older, we do not have to grow up"--Archie Goodwin ( 1937-1998)
It would probably be better for the thread if I ignored your post, Ken, but - since you're bowing out of the discussion - I'll do you the honor of answering your final questions.
I ask you to make a point because you come across as making no point at all with this and seem evasive in answering.
Ken, we have been over this already: If this thread was about me making a point, I would not have ended the subject title with a question mark. I'm not trying to trick anybody. If I end a subject title with a question mark, it's because I have a question, rather than a point.
example:question: How do you draw ?point: This is how you draw.
Besides, you have not answered all of my questions either. If I "seem evasive,"you seem equally so.And as DSB stated a few posts earlier, "I am under no obligation to discuss this topic to anyone's satisfaction beyond my own." Bravo, DSB.
Without intending to insult you, this appears to be trolling. Provocation via a controversial topic design to polarize viewpoints.
Ken, there is no conspiracy. You can rest easy tonight. Soviet troopers will not be parachuting into your backyard.
Why discuss this? Tell us what this will gain the forums?
You tell me. Why do you, Ken, continue to discuss it? How does your participation advance the forums?
If you really wanted to have a topic, why not ask if Disney affiliations with these groups and his actions would taint his life-works if the public at large knew of them? Or does the public care?Use your head, man.
It is not my responsibility to pose every possible debate point and counter-argument for this topic. And why would I ask a question for which the answer is so obvious?
Q:Would it hurt Walt's image if the Disney Company posted Walt's Nazi affiliations in his online bio?A:uhhhhh ...
I'm not throwing anymore bones your way after this.
Two hundred sentences later, you finally have a good idea.
EDIT:Ken, I'm sorry that my discussion with you deteriorated to such a state. I look forward to discussing less passionate subjects with you in the future. best, Harvey :)
Ken,Two hundred sentences later, you finally have a good idea.
well that's better than the 1,856 postings you've made that havent had any.
I know that APE wont be deleting this because it is no more harmful than HH's comment to Ken..just gentle joshing, a harmless poke in the ribs between old mates, kicking back after a hard day over a couple of root beer floats and some connie francis on the juke box.
Not what I said at all, although I'm not surprised at the twist you put on it. I'm not going to bother re-hashing it, because it would be pointless.
I looked really hard and can't find the twist, although I'm not surprised that you would back away from defending that statement.
Oh well, let's move on, shall we?
The point is that some on this forum are going to make exceptions for Disney that they wouldn't make for other historical figures, and ignore Disney's faults and attack those who discuss his faults. Because those people are so emotionally entangled in the "Uncle Walt" myth and Disney culture, they view any criticism of Disney as a personal attack on them.
First off, the quote above is exactly what I see going on here.
Nextly, I'll respond to the call that I somehow clarify the idea behind my last post by saying that I find it, frankly, embarrasing that someone (DSB) would pretend that he didn't understand the point of the post in order to purposefully complicate the discussion. You're better than that, so why did you do it?
Regardless, Harvey's quote above is a stripped-down, eco-friendly and sanitized-for-your-protection version of the same idea: for what reason is critique of Walt Disney's ethical violations and downright assitude forbidden (or at least "unimportant") to you? It's easier to criticize Bill Clinton, Ken Lay, Robert Tipton or Hitler because they didn't make beloved cartoons.
If you stillhaven't a clue as to why this is a viable and relevant topic, I'll give you just one starter point to help you along:
If Disney's entertainment empire was built on practices that included union busting, homophobia, xenophobia, "burn-the-witch"-mentalities and outright unpatriotism against fellow countrymen all in the guise of a family-centric and wholesome facade, how does this history impact the legacy of the Disney empire and it's grip on global culture?
Discuss.:rolleyes:
Wow - Harvey and Sajera seem to think they know exactly what I think and believe. So let me make sure I understand - because I don't automatically jump on the "Disney was evil" bandwagon, that somehow makes me a standard bearer for the "he can do no wrong" camp?
It's ironic that Harvey chose to include a picture of Joe McCarthy in the first post. It's exactly how he's behaving.
Just so you mindreaders get it right - I'm no Disney apologist. The man was far from perfect. He was also far from the evil despot you are attempting to portray him as. It's not my job or my goal to make excuses for him, but I will point out when factual inaccuracies are presented as "truth," as any intellectually honest person should.
I will point out when factual inaccuracies are presented as "truth," as any intellectually honest person should.
In the interest of "intellectual honesty," once again, the "factual inaccuracy" you pointed out was from a quote that I hadn't even included in post #1.
You failed to actually find anything inaccurate within post #1.
In other words, you weren't debating the topic I had presented. You created a strawman (a false opposition) that you could easily knock down.
After all, nobody thinks Disney is or isn't a scumbag based on the date he was born. :rolleyes:
It's ironic that Harvey chose to include a picture of Joe McCarthy in the first post. It's exactly how he's behaving.
So that's "exactly" how I'm behaving?
Did I drag you before a committee and force you to answer questions about your past activities?
Am I ruining your life by accusing you of being a communist?
Am I claiming that your rants are harmful to America?
That is a disgustingpersonal attack by someone who is consistently unable to back up his accusations or defend his arguments. You should really be ashamed of yourself, DSB.
If you are going to scream "WITCHHUNT!" when someone challenges one of your positions, maybe you shouldn't be engaging in any debate whatsoever.
Maybe you should stick to answering the "how do I draw" threads.
So that's "exactly" how I'm behaving?
Did I drag you before a committee and force you to answer questions about your past activities?
Am I ruining your life by accusing you of being a communist?
Am I claiming that your rants are harmful to America?
That is a disgustingpersonal attack by someone who is consistently unable to back up his accusations or defend his arguments.
Once again, the classic Harvey literalist response. I'm surprised you didn't include a dictionary definition of "exactly". You know full well what I'm saying, yet you choose to deflect my point with literalism. And I'm the one avoiding the subject? I guess everything's going to be a personal attack now, eh? :rolleyes:
Methinks you doth protest too much. What's wrong Harv; getting frustrated because no one's rising to take your bait?
From what I can see, nobody's refuting the information itself, just the manner in which it's being presented, so... the whole debate idea began to crumble from the get-go.
This information would have been better laid out as a statement of interest rather than fuel for discussion. And at this point, the topic has been lost, vague as it was in the first place.
Shrug.
| https://www.awn.com/comment/1042913 |
(PDF) Reduced serum high-density lipoprotein cholesterol levels and aberrantly expressed cholesterol metabolism genes in colorectal cancer
PDF | Background: Colorectal cancer (CRC) is a common malignant tumor of the gastrointestinal tract. Lipid metabolism, as an important part of material... | Find, read and cite all the research you need on ResearchGate
Reduced serum high-density lipoprotein cholesterol levels and aberrantly expressed cholesterol metabolism genes in colorectal cancer
May 2022
DOI: 10.12998/wjcc.v10.i14.4446
License
CC BY-NC 4.0
Authors:
<here is a image f2f62089ad6ff61c-d19572ff1996375a>
Jin-Hua Tao
Jin-Hua Tao
<here is a image f2f62089ad6ff61c-d19572ff1996375a>
Xiao-Tong Wang
Xiao-Tong Wang
<here is a image f2f62089ad6ff61c-d19572ff1996375a>
Wei Yuan
Wei Yuan
<here is a image f2f62089ad6ff61c-d19572ff1996375a>
Jia-Nan Chen
Jia-Nan Chen
Abstract and Figures
Background:
Colorectal cancer (CRC) is a common malignant tumor of the gastrointestinal tract. Lipid metabolism, as an important part of material and energy circulation, is well known to play a crucial role in CRC.
Aim:
To explore the relationship between serum lipids and CRC development and identify aberrantly expressed cholesterol metabolism genes in CRC.
Methods:
We retrospectively collected 843 patients who had confirmed CRC and received surgical resection from 2013 to 2015 at the Cancer Hospital of the Chinese Academy of Medical Sciences as our research subjects. The levels of serum total cholesterol (TC), triglycerides, low-density lipoprotein cholesterol (LDL-C), high-density lipoprotein cholesterol (HDL-C), LDL-C/HDL-C and clinical features were collected and statistically analyzed by SPSS. Then, we used the data from Oncomine to screen the differentially expressed genes (DEGs) of the cholesterol metabolism pathway in CRC and used Gene Expression Profiling Interactive Analysis to confirm the candidate DEGs. PrognoScan was used to analyze the prognostic value of the DEGs, and Search Tool for the Retrieval of Interacting Genes was used to construct the protein-protein interaction network of DEGs.
Results:
The serum HDL-C level in CRC patients was significantly correlated with tumor size, and patients whose tumor size was more than 5 cm had a lower serum HDL-C level (1.18 ± 0.41 mmol/L vs 1.25 ± 0.35 mmol/L, P < 0.01) than their counterparts. In addition, TC/HDL (4.19 ± 1.33 vs 3.93 ± 1.26, P < 0.01) and LDL-C/HDL-C (2.83 ± 1.10 vs 2.61 ± 0.96, P < 0.01) were higher in patients with larger tumors. The levels of HDL-C (P < 0.05), TC/HDL-C (P < 0.01) and LDL-C/HDL-C (P < 0.05) varied in different stages of CRC patients, and the differences were significant. We screened 14 differentially expressed genes (DEGs) of the cholesterol metabolism pathway in CRC and confirmed that lipoprotein receptor-related protein 8 (LRP8), PCSK9, low-density lipoprotein receptor (LDLR), MBTPS2 and FDXR are upregulated, while ABCA1 and OSBPL1A are downregulated in cancer tissue. Higher expression of LDLR (HR = 3.12, 95%CI: 1.77-5.49, P < 0.001), ABCA1 (HR = 1.66, 95%CI: 1.11-2.48, P = 0.012) and OSBPL1A (HR = 1.38, 95%CI: 1.01-1.89, P = 0.041) all yielded significantly poorer DFS outcomes. Higher expression of FDXR (HR = 0.7, 95%CI: 0.47-1.05, P = 0.002) was correlated with longer DFS. LDLR, ABCA1, OSBPL1A and FDXR were involved in many important cellular function pathways.
Conclusion:
Serum HDL-C levels are associated with tumor size and stage in CRC patients. LRP8, PCSK9, LDLR, MBTPS2 and FDXR are upregulated, while ABCA1 and OSBPL1A are downregulated in CRC. Among them, LDLR, ABCA1, OSBPL1A and FDXR were valuable prognostic factors of DFS and were involved in important cellular function pathways.
<here is a image 8bba6974c74d40ff-3011aa8e05427d61>
Relationship between colorectal tumor size and serum cholesterol level …
<here is a image 8be2f6e08039b272-eae8667ee7d2142c>
Relationship between colorectal tumor staging and serum cholesterol levels …
Figures - available via license: Creative Commons Attribution-NonCommercial 4.0 International
WJCC https://www.wjgnet.com 4446 May 16, 2022Volume 10Issue 14
World Journal of
Clinical Cases
W JCC
Submit a Manuscript: https://www.f6publishing.com World J Clin Cases2022 May 16; 10(14): 4446-4459
DOI: 10.12998/wjcc.v10.i14.4446ISSN 2307-8960 (online)
ORIGINAL ARTICLE
Retrospective Study
Reduced serum high-density lipoprotein cholesterol levels and
aberrantly expressed cholesterol metabolism genes in colorectal
cancer
Jin-Hua Tao, Xiao-Tong Wang, Wei Yuan, Jia-Nan Chen, Zhi-Jie Wang, Yun-Bin Ma, Fu-Qiang Zhao, Liu-Yuan
Zhang, Jie Ma, Qian Liu
Specialty type: Gastroenterology
and hepatology
Provenance and peer review:
Unsolicited article; Externally peer
reviewed.
Peer-review model: Single blind
Peer-review report’s scientific
quality classification
Grade A (Excellent): 0
Grade B (Very good): B, B
Grade C (Good): 0
Grade D (Fair): 0
Grade E (Poor): 0
P-Reviewer: Bordonaro M, United
States; Cheng KC, Taiwan
Received: March 8, 2022
Peer-review started: March 8, 2022
First decision: March 24, 2022
Revised: March 27, 2022
Accepted: April 20, 2022
Article in press: April 20, 2022
Published online: May 16, 2022
Jin-Hua Tao,Jia-Nan Chen,Zhi-Jie Wang,Fu-Qiang Zhao,Qian Liu, Department ofColorectal
Surgery, National Cancer Center/Cancer Hospital,Chinese Academy of Medical Sciencesand
Peking Union Medical College, Beijing 100021, China
Xiao-TongWang,WeiYuan,Liu-YuanZhang,JieMa, StateKeyLaboratoryofMolecular
Oncology, ClinicalImmunologyCenter, NationalCancerCenter/Cancer Hospital,Chinese
Academy of Medical Sciences and Peking Union Medical College, Beijing 100021, China
Yun-Bin Ma, Department ofAbodominal Surgery,Beijing SanhuanCancer Hospital,Beijing
100122, China
Correspondingauthor:QianLiu,MD,ChiefDoctor,DepartmentofColorectalSurgery,
National Cancer Center/CancerHospital, ChineseAcademy of MedicalSciences andPeking
Union Medical College, No.17 Panjiayuan Nanli,Chaoyang District, Beijing 100021,China.
[email protected]
Abstract
BACKGROUND
Colorectal cancer(CRC)isacommon malignanttumorofthe gastrointestinal
tract. Lipid metabolism, as an important part of material and energy circulation, is
well known to play a crucial role in CRC.
AIM
To exploretherelationshipbetweenserumlipids andCRCdevelopmentand
identify aberrantly expressed cholesterol metabolism genes in CRC.
METHODS
We retrospectively collected843 patientswho had confirmedCRC andreceived
surgicalresectionfrom2013to2015attheCancerHospitaloftheChinese
Academy of MedicalSciences asour research subjects.The levelsof serum total
cholesterol (TC), triglycerides, low-density lipoprotein cholesterol(LDL-C), high-
density lipoproteincholesterol(HDL-C),LDL-C/HDL-Candclinical features
were collectedand statisticallyanalyzed bySPSS. Then,we usedthe datafrom
Oncomine to screenthe differentiallyexpressed genes(DEGs) of thecholesterol
metabolism pathwayinCRCandusedGeneExpressionProfilingInteractive
Tao JH et al. Aberrant cholesterol metabolism in colorectal cancer
WJCC https://www.wjgnet.com 4447 May 16, 2022Volume 10Issue 14
Analysis to confirm the candidate DEGs.PrognoScan was used to analyze theprognostic value of
theDEGs,andSearchToolfortheRetrievalofInteractingGeneswasusedtoconstructthe
protein–protein interaction network of DEGs.
RESULTS
The serum HDL-C level in CRC patients was significantly correlated with tumor size, andpatients
whose tumor size was more than 5 cm had a lower serum HDL-C level (1.18 ± 0.41 mmol/L vs1.25
± 0.35 mmol/L, P< 0.01) than their counterparts. In addition, TC/HDL (4.19 ± 1.33 vs3.93 ± 1.26, P
< 0.01) and LDL-C/HDL-C (2.83 ±1.10 vs2.61 ± 0.96, P< 0.01) were higher in patientswith larger
tumors. ThelevelsofHDL-C( P<0.05),TC/HDL-C( P<0.01) andLDL-C/HDL-C( P<0.05)
varied indifferent stages ofCRC patients,and thedifferences weresignificant. Wescreened 14
differentiallyexpressedgenes(DEGs)ofthecholesterolmetabolismpathwayinCRCand
confirmed thatlipoproteinreceptor-relatedprotein 8(LRP8),PCSK9,low-densitylipoprotein
receptor (LDLR), MBTPS2 and FDXR areupregulated, while ABCA1 and OSBPL1Aare downreg-
ulated incancertissue.HigherexpressionofLDLR(HR=3.12,95%CI:1.77-5.49, P<0.001),
ABCA1 (HR =1.66, 95%CI:1.11-2.48, P= 0.012) andOSBPL1A (HR= 1.38, 95%CI:1.01-1.89, P=
0.041) all yielded significantly poorer DFS outcomes. Higher expression of FDXR (HR = 0.7, 95%CI:
0.47-1.05, P=0.002) wascorrelated withlonger DFS.LDLR, ABCA1, OSBPL1Aand FDXRwere
involved in many important cellular function pathways.
CONCLUSION
Serum HDL-Clevelsare associatedwithtumor sizeandstage inCRCpatients. LRP8,PCSK9,
LDLR, MBTPS2and FDXR areupregulated, whileABCA1 andOSBPL1A aredownregulated in
CRC. Among them, LDLR, ABCA1, OSBPL1Aand FDXR were valuable prognosticfactors of DFS
and were involved in important cellular function pathways.
Key Words: Colorectal cancer; High-density lipoprotein cholesterol; Cholesterol metabolism; Prognosis
©The Author(s) 2022. Published by Baishideng Publishing Group Inc. All rights reserved.
Core Tip: Cholesterol metabolism is closely relatedto colorectal cancer (CRC). In thisstudy, we explored
the association betweenserum high-density lipoproteincholesterol and tumorcharacteristics inpatients
with CRC, identified differentiallyexpressed genes inthe cholesterol metabolism pathwayand analyzed
the prognosticvalue ofthesedifferentially expressedgenes inCRC.These findingsprovide cluesfor
further research on cholesterol metabolism and CRC.
Citation: Tao JH,Wang XT, YuanW, Chen JN,Wang ZJ, MaYB, ZhaoFQ, Zhang LY,Ma J, LiuQ. Reduced
serum high-densitylipoproteincholesterollevelsand aberrantlyexpressedcholesterolmetabolismgenes in
colorectal cancer. World J Clin Cases2022; 10(14): 4446-4459
URL: https://www.wjgnet.com/2307-8960/full/v10/i14/4446.htm
DOI: https://dx.doi.org/10.12998/wjcc.v10.i14.4446
INTRODUCTION
Colorectal cancer (CRC) is a commonmalignant tumor of the gastrointestinal tract.It ranks third in the
incidence ofmalemalignanttumorsintheworldandsecondin femalemalignanttumors [ 1 ].The
occurrenceanddevelopmentofCRCinvolvemultipledysregulatedgenesandcomplicated
physiological processes. Lipidmetabolism, as animportant part ofmaterial and energycirculation, is
well known to play a crucial role in CRC.
Numerous studies have found that lipidabnormalities are closely related toCRC. There have been a
number ofreports inthe literatureregardingthe relationshipbetween abnormalserum lipidlevels,
including total cholesterol(TC), triglycerides(TGs), low-densitylipoprotein cholesterol (LDL-C)and
high-density lipoproteincholesterol (HDL-C),and CRC [ 2, 3 ],butthereis noconsistent conclusionat
present. Most ofthese studiesfocus on thedifferent lipidlevels between healthypeople andpatients
with CRC,butit isdifficultto clarifythespecificcausal relationshipbetweenlipid alterationsand
cancer. Additionally, research on the underlying mechanism is relatively scarce.
Many studies have shown that somekey enzymes and transporters in metabolic pathwaysplay very
important roles in various cancers [ 4 ].Dysregulation of these genes causes altered metabolic phenotypes
that influencethenutrient,energyandsignaltransductionbalanceincells. However,onlyafew
Tao JH et al. Aberrant cholesterol metabolism in colorectal cancer
WJCC https://www.wjgnet.com 4448 May 16, 2022Volume 10Issue 14
metabolic genesare presentlyknownto bedirectly implicatedinCRC, especiallyinthe cholesterol
metabolism pathway, andthere is still muchmore to learnabout the causalrole of metabolicgenes in
cancer.
In this study, we conducted a retrospective analysis of the relationshipbetween serum TC, TG, HDL-
C, LDL-Candclinicalcharacteristics inpatientswithCRCand exploredpotentialCRC-associated
cholesterol metabolic genesusing a series ofbioinformatics databases andtools. We aimedto provide
more evidenceon thealterationsin cholesterolmetabolism andidentifypotential cancer-associated
metabolic genes in CRC.
MATERIALS AND METHODS
Ethics statement
The current research was approvedby the Institutional ReviewBoard. Informed consent was obtained
from all participants for the use of the clinical information in this research.
Patient characteristics
This retrospectivestudy enrolled atotal of843 patientswith CRCwho underwentsurgical resection
between January 2013and December 2015at the CancerHospital of theChinese Academy ofMedical
Sciences (Beijing,China). Theaverage patientageat surgerywas 59years, 498weremale, 345were
female, 348 cases were coloncancer, and 495 caseswere rectal cancer. Tumor stagingconformed to the
eightheditionoftheAmericanJointCommitteeonCancer/UnionInternationalControlCenter
(AJCC/UICC) TNM staging manual (2017). A total of 151, 296, 340 and56 cases were found to be stages
I, II, III andIV, respectively. Patientswith diabetes or hyperlipidemiawere excluded. Theserum lipid
information (TC, TG, HDL-C, andLDL-C), body mass index(BMI (weight/height 2and kg/m 2 )),tumor
size (< 5 cm/≥ 5 cm), and smoking and drinking history (yes/no) of these patients were collected.
Statistical analysis
The levels of TC, TG, HDL-C, LDL-C,TC/LDL-C, TC/HDL-C and LDL-C/HDL-C are presented as the
mean ± SD and were comparedusing the independent sample ttestbetween different groups of tumor
size (< 5cm/≥ 5cm). Ananalysis of variance(ANOVA) wasused tocompare thedifferences among
stages. A covariance analysis was used to compare multiple variables. Differencesbetween groups with
P < 0.05 were regarded as statistically significant.
Oncomine database analysis
The Oncominedatabase( https://www.oncomine.org), anonlinedatabase consistingofpreviously
published and open-access microarray data [ 5 ],was used to identify the transcription level of cholesterol
metabolism pathway genesin CRC. Theanalysis type selectedwas “Cancer vsNormal Analysis”,the
cancer type as“Colorectal cancer”, thedata type was “mRNA”,and the GOconcept was "Cholesterol
metabolism" intheanalysisofdifferentiallyexpressedgenes(DEGs)inthecholesterolmetabolic
pathway in CRC compared with normal tissues.
Candidate DEG validation
The expressionof DEGsin CRCwas analyzedusingGene ExpressionProfiling InteractiveAnalysis
(GEPIA). GEPIA isan interactive webserver for estimatingthe mRNA expressiondata in TheCancer
Genome Atlas (TCGA) and Genotype-Tissue Expression (GTEx) dataset projects[ 6 ].
Prognostic value analysis
PrognoScan ( http://www.prognoscan.org/) is a comprehensive online platform forassessing potential
tumor biomarkers and therapeutic targets [ 7 ].To analyze the prognostic values of specific DEGs in CRC,
the PrognoScanplatformwas usedtodisplay disease-freesurvival(DFS). TheHRsandlog-rank P
values are presented on the webpage.
Protein–protein interaction network generation
We builtaprotein–proteininteraction (PPI)networkforlow-densitylipoprotein receptor(LDLR),
FDXR,ABCA1andOSBPL1AusingSearchTool fortheRetrievalofInteractingGenes(STRING,
http://string-db.org/ ), anonlineresourcesearchtool fortheretrievalof interactinggenes,which
include physical and functional associations[ 8 ].
Tao JH et al. Aberrant cholesterol metabolism in colorectal cancer
WJCC https://www.wjgnet.com 4449 May 16, 2022Volume 10Issue 14
RESULTS
Factors related to serum lipid levels in CRC patients
Several well-known factors areassociated with serum lipid levels,such as sex, age,BMI and history of
smoking and drinking. We considered all of these factors and found that serum HDL-C level, TC/HDL-
C andLDL-C/HDL-C weresignificantly correlatedwith tumorsizeand stagein patientswith CRC
( Table 1 ).
Comparison of serum lipid levels in CRC patients with different tumor sizes
We definedtumorsizeasa tumorsinglediametermoreor nomorethan5cmaccording tosome
previous studies in CRC. Theresults showed that theserum HDL-C (1.18 ± 0.41mmol/L vs1.25 ±0.35
mmol/L, P<0.01) levels werelower in patientswith a largertumor, while TC/HDL-C(4.19 ± 1.33 vs
3.93 ± 1.26, P< 0.01) andLDL-C/HDL-C (2.83 ±1.10 vs2.61± 0.96, P<0.01) were higher,as shown in
Table 2 .
Comparison of the serum lipid levels in patients with CRC at different stages
Theanalysis ofvarianceregardingserumlipidlevelsofpatientswithCRCandstagesin Table 3
revealed significantcorrelations betweenthelevels ofHDL-C,TC/HDL-C andLDL-C/HDL-C and
tumor stages. The levels of HDL-Cin patients with stage I (1.3± 0.35 mmol/L), II (1.22 ±0.38 mmol/L)
and III(1.2 ±0.37 mmol/L)disease weregradually reduced,and theserum HDL-Clevel inpatients
with stage IV disease (1.24 ± 0.37 mmol/L) wasslightly higher than that in patients with stage IIand III
disease. The differences were significant ( P< 0.05). TC/HDL-C and LDL-C/HDL-C gradually increased
instageItostageIIIinpatientswithCRCanddecreasedinstageIVpatients,withsignificant
differences ( P< 0.05).
Screening of cholesterol metabolism pathway DEGs in CRC
According to thecase analysis results,we deducethat changes inHDL-C levels inpatients withCRC
may be associated withabnormal expression of cholesterol metabolismpathway genes in CRCtissues.
AnonlineanalysiswasperformedusingOncomine.BycomparingtheDEGsofthecholesterol
metabolism pathwayinSkrzypczakCRC, wefoundthat themRNAlevelsof lipoproteinreceptor-
related protein 8 (LRP8)( P= 7.77E-17,fold change = 3.04),MBTPS2 ( P=2.11E-10, fold change =1.73),
PCSK9 ( P= 2.48E-7, fold change = 2.15), LDLR ( P= 2.90E-5, fold change = 1.88),FDXR ( P= 1.71E-4, fold
change = 1.54), APOL1 ( P= 2.14E-4, fold change =1.33), and CELA3A ( P=3.17E-4, fold change = 1.16)
were upregulated inCRC tissue,as shownin Figure 1A .The mRNA levelsof OSBPL1A( P=1.7E-11,
fold chance = -2.37), VLDLR ( P= 6.17E-8,fold change = -2.18), SREBF2 ( P=1.01E-6, fold change = -1.4),
SORL1 ( P= 8.37E-6, fold change = -1.91), HDLBP ( P= 5.75E-5, fold change = -1.25), ABCA1 ( P= 2.13E-4,
fold change =-1.74) and APOL2( P= 2.75E-4,fold change =-1.21) weredownregulated in CRCtissue
( Figure 1B ).
Identification of candidate DEGs
DEGs inCRC werereanalyzedusing GEPIAbasedon TCGAand GTExdatasetsfor transcriptomic
analysis. TheresultsdemonstratedthatLRP8, PCSK9,andLDLRwereupregulated inCRCtissue
compared withnormaltissue ( Figure 2A - C ),whileMBTPS2and FDXRshowedsignificantly higher
expression only in rectal cancer and colon cancer, respectively ( Figure 2Dand E ).ABCA1 and OSBPL1A
were downregulatedinCRCtissue ( Figure 2Fand G ),consistentwiththeresultsfromOncomine.
CELA3A wasdownregulated ( Figure 2H ),and SORL1wasupregulatedincancer tissue ( Figure 2I ),
which is the reverse of the above results. The expression levels of APOL1, VLDLR, HDLBP, SREBF2 and
APOL2 were comparablebetween cancerand normal tissuesaccording tothe GEPIA analysisresults
( Figure 2J - N ). Therefore, we identified LRP8,PCSK9, LDLR, MBTPS2, FDXR, ABCA1and OSBPL1A as
dysregulated in CRC.
Prognostic value of DEGs
Using theonlineKaplan–Meier survivalanalysistool PrognoScan,wediscovered thathighmRNA
expression of LDLR [hazard ratio (HR) = 3.12, 95% confidence interval (CI): 1.77-5.49, P< 0.001], ABCA1
(HR = 1.66,95%CI: 1.11-2.48, P= 0.012) andOSBPL1A (HR =1.38, 95%CI: 1.01-1.89, P= 0.041)was an
unfavorable prognostic factor for disease-free survival(DFS) in CRC patients ( Figure 3A - C ),while high
mRNA expression of FDXR (HR = 0.7, 95%CI:0.47-1.05, P= 0.002) was a favorableprognostic factor for
DFS ( Figure 3D ).Unfortunately, LRP8, PCSK9 and MBTPS2 expression could not be used to predict DFS
outcome according to the results of this analysis, as shown in Figure 3E - G.
PPI network of DEGs with prognostic value
LDLR, FDXR, ABCA1 and OSBPL1A were analyzed by STRING to construct protein–protein interaction
networks ( Figure 4)andpredictotherpossiblerolesthattheymay playinadditiontocholesterol
metabolism. The results implied that FDXR was also involved in xenobiotic metabolic processes, cellular
responses to xenobiotic stimuli and oxidation–reduction processes. ABCA1 was shown to be involved in
Tao JH et al. Aberrant cholesterol metabolism in colorectal cancer
WJCC https://www.wjgnet.com 4450 May 16, 2022Volume 10Issue 14
Table 1 Factors related to serum cholesterol levels in patients with colorectal cancer
ProjectGenderAge (60 year)BMI (24 kg/m 2)SmokingDrinkingStageTumor size (5 cm)
TC0.0010.3730.5020.5750.6060.448 0.360
TG0.1880.912< 0.0010.9170.3780.7680.852
HDL-C< 0.001< 0.001< 0.0010.0080.4960.0420.016
LDL-C0.0270.4980.0780.6300.8790.250 0.929
TC/LDL-C0.5440.5750.1180.7550.7500.797 0.259
TC/HDL-C0.0310.001< 0.0010.0200.0990.0080.019
LDL-C/HDL-C0.0670.014< 0.0010.0750.2540.0180.008
TC: Total cholesterol; TG: Triglyceride; HDL-C: High-density lipoprotein cholesterol; LDL-C: Low-density lipoprotein cholesterol.
Table 2 Relationship between colorectal tumor size and serum cholesterol level
Project (size) < 5 cm ( n= 560)≥ 5 cm ( n= 283) Pvalue
TC4.62 ± 0.954.56 ± 0.910.354
TG1.38 ± 0.81.36 ± 0.950.782
HDL-C1.25 ± 0.351.18 ± 0.410.009
LDL-C3.06 ± 0.863.06 ± 0.820.965
TC/LDL-C1.56 ± 0.261.53 ± 0.240.242
TC/HDL-C3.93 ± 1.264.19 ± 1.330.009
LDL-C/HDL-C2.61 ± 0.962.83 ± 1.10.004
TC: Total cholesterol; TG: Triglyceride; HDL-C: High-density lipoprotein cholesterol; LDL-C: Low-density lipoprotein cholesterol.
Table 3 Relationship between colorectal tumor staging and serum cholesterol levels
Project (stage) I ( n= 151)II ( n= 296)III ( n= 340)IV ( n= 56) Pvalue
TC4.61 ± 0.864.55 ± 0.884.65 ± 1.014.30 ± 0.940.395
TG1.44 ± 0.951.31 ± 0.791.4 ± 0.871.09 ± 0.850.228
HDL-C1.3 ± 0.351.22 ± 0.381.2 ± 0.371.24 ± 0.370.045
LDL-C3.01 ± 0.783.04 ± 0.83.11 ± 0.912.81 ± 0.850.427
TC/LDL-C1.57 ± 0.181.54 ± 0.221.55 ± 0.31.58 ± 0.250.689
TC/HDL-C3.78 ± 1.173.96 ± 1.154.19 ± 1.443.65 ± 1.290.006
LDL-C/HDL-C2.5 ± 0.952.66 ± 0.972.8 ± 1.062.4 ± 1.010.014
TC: Total cholesterol; TG: Triglyceride; HDL-C: High-density lipoprotein cholesterol; LDL-C: Low-density lipoprotein cholesterol.
the steroid hormone-mediatedsignaling pathway,and OSBPL1A wasinvolved in antigenprocessing
and presentation ofexogenous peptideantigens viaMHC classII, microtubule-basedmovement and
vesicle-mediated transport.
DISCUSSION
Cholesterol is the mostabundant steroid compound inthe human body andis essential for membrane
biogenesis, signal transduction, cell proliferation anddifferentiation [ 9 ].When cholesterol is deficient in
humans, the normalcell physiological processis disrupted, cellular rigidityis increased, andthe cells
Tao JH et al. Aberrant cholesterol metabolism in colorectal cancer
WJCC https://www.wjgnet.com 4451 May 16, 2022Volume 10Issue 14
Figure 1 Comparison ofconcept: “Cholesterol metabolism- go biological process”in skrzypczak colorectal. A: Upregulated expressionof
genes in the cholesterol metabolism pathway of colorectal cancer (CRC); B: Downregulated expression of genes in the cholesterol metabolism pathway of CRC.
Tao JH et al. Aberrant cholesterol metabolism in colorectal cancer
WJCC https://www.wjgnet.com 4452 May 16, 2022Volume 10Issue 14
Figure 2 Identification of candidate differentially expressed genes. The mRNAexpression of differentially expressed genes between tumor and normal
Tao JH et al. Aberrant cholesterol metabolism in colorectal cancer
WJCC https://www.wjgnet.com 4453 May 16, 2022Volume 10Issue 14
tissues was plotted by GeneExpression Profiling Interactive Analysis(GEPIA) with data from theThe Cancer Genome Atlas database.A-C: Lipoprotein receptor-
related protein 8, PCSK9, and low-density lipoprotein receptor (LDLR) were upregulated in colorectal cancertissue compared with normal tissue; D, E: MBTPS2 and
FDXR showed significantly higher expression only inrectal cancer and colon cancer, respectively; F,G: ABCA1 and OSBPL1A were downregulated in CRCtissue,
consistent with the results from Oncomine; H: CELA3A was downregulated; I:SORL1 was upregulated in cancer tissue, which is the reverse ofthe above results; J-
N: The expression levels ofAPOL1, VLDLR, HDLBP, SREBF2 and APOL2were comparable between cancer andnormal tissues according to theGEPIA analysis
results.
are easilyfractured.Cholesterol isprovidedby thedietbut canalsobesynthesized bytheliver in
humans anddistributedthroughoutthebody vialow-densitylipoprotein(LDL)andhigh-density
lipoprotein (HDL)transporters [ 10 ],such asLDL-cholesterol (LDL-C)and HDL-cholesterol(HDL-C).
Cancer hasbeenassociated withcholesterol,as cholesterolcan directlyinfluencecell physiological
functionandisalsotheobligatoryprecursorofsteroidhormones,whichareinvolvedintumor
promotion and tumor death [ 10 ].Hypercholesterolemia was shown to promote mammary tumor growth
and invasiveness in several mousetransgenic models [ 11 ],suggesting that cholesterol orits metabolites
promote CRC.
A large number of epidemiological statistics and basic researchsuggest that the uptake of cholesterol
and serum cholesterol levels areclosely related to theoccurrence, development and prognosis ofCRC,
but thereis noconsistent conclusionthus far. Themain focusof thesestudies wasthe associationof
blood concentrations oftotal cholesterol (TC)in relation to CRCrisk. Findings fromthree prospective
studies on TCconcentrations have beeninconsistent, showing eithera positive associationwith CRC,
colon and rectalcancer risk [ 12 ],no associationwith therisk of coloncancer buta positive association
with the riskof rectalcancer in menonly [ 13 ],or noassociation atall [ 14 ].Regarding triglyceride (TG)
concentrations, threecohort studiesfound nosignificant associationswith theriskof CRC,colon or
rectal cancer.Data ontheir relationshipwiththe clinicalfeatures inCRCpatients arescarce. Inthis
study, we found that both TC and TG levels were not associated with the cancer type (colon/rectal, data
not shown), tumor size or tumor stage in CRC patients.
HDL-C,as anindispensableformofcholesterol,playsaveryimportantroleinsomediseases,
including arteriosclerosis [ 15 ],and has been asubject of intense research incancer. However, studies of
the link betweenHDL-C levels and CRChave also ledto contrasting results.Yang et al [ 16]found that
serum HDL-C level reduction was associated withan increased risk of cancer, including CRC. Jafri et al
[ 17] conductedalargemeta-analysis ofrandomizedlipid-altering trialsandobserveda significant
inverse association between baseline HDL-Clevels and the riskof developing cancer. In ourstudy, we
found thatHDL-C isdecreased inCRCpatients withlarger tumorsandadvanced stages.Although
these findings do not seem to have reached a definitive conclusion on whether lowserum HDL-C levels
should be considered a markerof the presence of canceror a possible causative factor,several possible
mechanisms exist bywhich serum concentrationsof HDL-Cmay be directlyor indirectly involvedin
colorectal carcinogenesis. Decreased concentrations of HDL-C have been related to increased circulating
concentrations of proinflammatorycytokines suchas interleukin6 (IL-6)and tumor necrosisfactor-a
receptors, which can stimulate cell growth and cellular proliferation and inhibit apoptosis [ 18 ].Increased
HDL-C levels are associated with increased concentrations of anti-inflammatory cytokines such asIL-10
[ 19 ], which inhibit the productionof these proinflammatorycytokines [ 20]. These observations suggest
that HDLmaymodulate coloncarcinogenesisthroughinflammatory pathways.Anotherproposed
pathway is through modulation of oxidative stress becauseHDL displays antioxidative activities and is
believed to confer protection against oxidation of LDL-C [ 21 ,22 ].Alow concentration of HDL-C leads to
more oxidizedLDL-C [ 23 ],whichhas beendescribedasa causeofincreasedintracellular oxidative
stress, aprocess thatis involvedin thepathogenesis ofcancer [ 24 ].However, asoncogenic processes
enable cancer cells to synthesizetheir own cholesterol, which canbe further metabolized andtake part
in whole-body circulation, and tumor development may also disruptintestinal homeostasis, the change
in serum HDL-C levels can be a result of CRC from this perspective.
Investigationsatthelaboratorylevelhaverevealedamorecomplexmapoftheinfluenceof
cholesterol metabolism on the promotion or suppression of CRC that could account for theseconflicting
studies. Metabolicreprogramming isa commonhallmark oftumors [ 25 ].Inaddition tothe Warburg
effect, tumor cellsalso undergolipid remodeling,which is mostlycharacterized byaberrant de novo
lipogenesis and cholesterogenesis due to oncogenic-driven lipogenic enzyme overexpression [ 26 ].In this
study, analysis of abnormallyexpressed cholesterol metabolism-related genesin CRC showed thatthe
upregulated genes are mainlyinvolved in the synthesisand uptake of cholesterol,while the downreg-
ulated genesaremainly concentratedinthe channelsof cholesteroltransport.Related totheactive
characteristics, the abnormalexpression ofthese genes isconducive tomaintaining intracellular high
cholesterol levels to ensure the growth of material and energy needs.
Low-density LRP8andLDLRarecell surfacereceptorsandfunction insignaltransductionand
endocytosis of specific ligands. LRP8 participates in thedevelopment and metastasis of several cancers,
such asgastriccancer [ 27]andmelanoma [ 28 ].Somestudieshave reportedtherelationship between
LDLRandCRCatthe invitroandanimallevels [ 29, 30 ].However,researchontheunderlying
mechanism is stillscarce. MBTPS2 encodesa membrane-bound zincmetalloprotease, an endoplasmic
Tao JH et al. Aberrant cholesterol metabolism in colorectal cancer
WJCC https://www.wjgnet.com 4454 May 16, 2022Volume 10Issue 14
Figure 3 Correlation of differentially expressed gene expression and disease-free survivalin patients with colorectal cancer. The survival curves
comparing the patients with high (red) and low (blue) expression were plotted from the PrognoScan database.A-C: High mRNA expression of low-density lipoprotein
receptor, ABCA1 and OSBPL1A was an unfavorable prognostic factor for disease-free survival (DFS) in colorectal cancer(CRC) patients; D: High mRNA expression
of FDXR was a favorable prognostic factor for DFS in CRCpatients; E-G: Lipoprotein receptor-related protein 8, PCSK9 and MBTPS2 expression couldnot be used
to predict DFS outcome according to the results of this analysis.
Tao JH et al. Aberrant cholesterol metabolism in colorectal cancer
WJCC https://www.wjgnet.com 4455 May 16, 2022Volume 10Issue 14
Figure 4 Protein–protein interaction network of differentially expressed genes withprognostic value. Interacting nodes are displayed in colored
circles using Search Tool for the Retrieval of Interacting Genes v10.0. A:Low-density lipoprotein receptor only involved in cholesterol metabolism pathway; B: FDXR
was also involved in xenobiotic metabolic processes, cellular responses to xenobiotic stimuli and oxidation–reduction processes; C: ABCA1 was shown to be involved
in the steroid hormone-mediated signaling pathway; D: OSBPL1A was involved in antigen processing and presentation of exogenous peptide antigens viaMHC class
II, microtubule-based movement and vesicle-mediated transport.
reticulum membraneprotein,that exhibitsadual function [ 31 ].Ontheone hand,MBTPS2activates
sterolregulatoryelement-bindingproteins(SREBPs),whicharekeytranscriptionfactorsthat
subsequently promote theexpression ofcholesterol-related genes [ 32 ].On theother hand,as MBTPS2
can respond to stress in the endoplasmic reticulum and cause cellsto cope with stressful conditions, the
dysregulation ofMBTPS2canleadtoseverediseaseinhumans [ 33, 34 ].PCSK9isa secretedserine
protease that is involvedin the posttranscriptional regulation ofLDR, which can promoteintracellular
degradation in acidic subcellular compartments [ 35 ].Regarding its LDLR-decreasing function, a study in
cancer research showedits inversecorrelation withLDLR expression [ 36 ].However, inour study,we
found that PCSK9 and LDLRare both upregulated inCRC, which is very intriguing.The role of FDXR
in CRC has been exploredin some studies [ 37 ,38]before; inour analysis, we also confirmedan increase
in FDXR expression,while thehigh expressionlevel isa favorable prognosticfactor forDFS inCRC.
ATP-bindingcassettetransporter(ABCA1)isatransmembraneproteinresponsibleforreverse
cholesterol transportandsynthesisofHDL-C [ 39 , 40 ].Boththeoverexpressionandthedecreasein
ABCA1 areassociated withtumorigenesis [ 41 ,42 ].OSBPL1A wasreportedto beinvolved inABCA1-
mediated pathways of cholesterol efflux and could also impact the biogenesis of HDL-C inthe liver and
intestine [ 43 ]; thus, the relationshipbetween the downregulated expressionof these twogenes and the
decrease in serum HDL-C in CRC is worthy of attention.
Tao JH et al. Aberrant cholesterol metabolism in colorectal cancer
WJCC https://www.wjgnet.com 4456 May 16, 2022Volume 10Issue 14
CONCLUSION
Overall, in thisstudy, we foundthat serum HDL-Clevels are differentin CRC patientswith different
stages and tumorsizes. LRP8,PCSK9, LDLR, MBTPS2and FDXR areupregulated, whileABCA1 and
OSBPL1AaredownregulatedinCRC.Amongthem,LDLR,ABCA1,OSBPL1AandFDXRwere
valuable prognosticfactorsof DFS.Ourfindings providehypotheticaland biologicalcharacteristic
insight into the role of cholesterol metabolism in CRC, and further molecular-level studies are needed to
elucidate potential mechanisms.
ARTICLE HIGHLIGHTS
Research background
Colorectal cancer (CRC) is a commonmalignant tumor of the gastrointestinal tract.It ranks third in the
incidenceofmalemalignanttumorsintheworldandsecondinfemalemalignanttumors.The
occurrenceanddevelopmentofCRCinvolvemultipledysregulatedgenesandcomplicated
physiological processes. Lipidmetabolism, as animportant part ofmaterial and energycirculation, is
well known toplay acrucial rolein CRC.Numerous studieshave found thatlipid abnormalitiesare
closely related to CRC. Mostof these studies focus onthe different lipid levels betweenhealthy people
andpatientswithCRC, butitisdifficulttoclarifythespecificcausalrelationshipbetweenlipid
alterations and cancer. Additionally, research on the underlying mechanism is relatively scarce.
Research motivation
In previous studies, we found that CRC is closely related to serum cholesterol levels, but the specific key
genes thataffectthe occurrence,development andprognosisof CRCareunknown. Theaimof this
study was to explore more evidence for altered cholesterolmetabolism and to identify potential cancer-
related metabolic genes in CRC.
Research objectives
The objective isto explorethe relationship betweenserum lipidsand CRC developmentand identify
aberrantly expressed cholesterol metabolism genes in CRC.
Research methods
We reviewed843 CRCpatientsand collectedserumtotal cholesterol(TC), triglycerides(TGs),low-
density lipoprotein cholesterol(LDL-C), high-densitylipoprotein cholesterol (HDL-C),LDL-C/HDL-
Statistical analysisofClevelsandclinical characteristicswasperformedbySPSS. Meanwhile,we
screened the differentiallyexpressed genes (DEGs)of cholesterol metabolismpathways in CRCusing
the database data of Oncomine, andconfirmed candidate DEGs using GEPIA.PrognoScan was used to
analyze the prognostic value ofDEGs, and Search Tool forthe Retrieval of InteractingGenes was used
to constructthe protein–proteininteractionnetwork ofDEGs tofinallyunderstand therelationship
between CRC and cholesterol metabolism.
Research results
Serum HDL-C levels in CRCpatients were significantly correlatedwith tumor size, and serumHDL-C
levels werelower in patientswith tumorslarger than5 cm,on thecontrary, TC/HDL[4.19 ±1.33 vs
HDL-C (2.83 ± 1.10 vs2.61 ± 0.96, P< 0.01)] was higher. Therewere significant differences inthe levels
of HDL-C ( P< 0.05), TC/HDL-C ( P< 0.01) andLDL-C/HDL-C ( P<0.05) in CRCpatients of different
stages, and the differences were statistically significant. The authors screened 14 differentially expressed
genes (DEGs)withthe mostsignificant cholesterolmetabolicpathways inCRCand confirmedthat
lipoprotein receptor-related protein 8 (LRP8), PCSK9, low-density lipoprotein receptor (LDLR), MBTPS2
and FDXRwere up-regulatedincancer tissues,whileABCA1 andOSBPL1Awere down-regulated.
LDLR (HR= 3.12,95%CI:1.77-5.49, P<0.001), ABCA1(HR =1.66,95%CI: 1.11-2.48, P= 0.012)and
OSBPL1A (HR= 1.38,95% CI:1.01-1.89, P=0.041)) incancer tissuehigh expressionof allproduced
significantly poorer DFS results. Higher expression of FDXR(HR = 0.7, 95%CI: 0.47-1.05, P=0.002) was
associated withlongerDFS. LDLR,ABCA1,OSBPL1A,and FDXRarealso involvedinmanyother
important cellular functional pathways.
Research conclusions
Serum HDL-C levels are closely related to tumorsize and stage in CRC patients. In CRC,LRP8, PCSK9,
LDLR, MBTPS2, andFDXR genes wereup-regulated, while ABCA1and OSBPL1A geneswere down-
regulated. Meanwhile, LDLR,ABCA1, OSBPL1Aand FDXR genesare valuable prognosticfactors for
DFS and participate in other important functional pathways of cells.
Tao JH et al. Aberrant cholesterol metabolism in colorectal cancer
WJCC https://www.wjgnet.com 4457 May 16, 2022Volume 10Issue 14
Research perspectives
Only afew metabolicgenes arepresentlyknown tobe directlyimplicatedin CRC,especially inthe
cholesterol metabolism pathway, and there is still much more to learn about the causal role of metabolic
genes in CRC. By studying the mechanism ofkey genes in the cholesterol metabolism pathway inCRC,
more treatment options for CRC can be provided.
FOOTNOTES
Author contributions: Tao JH, Wang XT, Yuan W, Ma J, and Liu Q designed the research; Chen JN, Wang ZJ, Ma YB,
Zhao FQ, and Zhang LY collected the data; Tao JH, Wang XT, and Yuan W analyzed the data; Tao JH, and Wang XT
wrote the paper; and All authors contributed to this manuscript.
Institutional review board statement: The current research was approved by the Institutional Review Board.
Conflict-of-interest statement: The authors declare that there are no conflicts of interest related to this study.
Data sharing statement: No additional data are available.
Open-Access: This article is an open-access article that was selected by an in-house editor and fully peer-reviewed by
external reviewers. It is distributed in accordance with the Creative Commons Attribution NonCommercial (CC BY-
NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license
their derivative works on different terms, provided the original work is properly cited and the use is non-
commercial. See: https://creativecommons.org/Licenses/by-nc/4.0/
Country/Territory of origin: China
ORCID number: Jin-Hua Tao 0000-0003-4703-9271; Jia-Nan Chen 0000-0002-6673-6884; Zhi-Jie Wang 0000-0003-2930-
4668 ; Yun-Bin Ma0000-0001-6709-568x ; Fu-Qiang Zhao0000-0003-0676-8371 ; Qian Liu0000-0003-2510-3113 .
S-Editor: Ma YJ
L-Editor: A
P-Editor: Li X
REFERENCES
Torre LA , Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J, Jemal A. Global cancer statistics, 2012. CA Cancer J Clin2015;
65 : 87-108 [PMID: 25651787DOI: 10.3322/caac.21262]
1
Barrington WE , Schenk JM, Etzioni R, Arnold KB, Neuhouser ML, Thompson IM Jr, Lucia MS, Kristal AR. Difference
in Association of Obesity With Prostate Cancer Risk Between US African American and Non-Hispanic White Men in the
Selenium and Vitamin E Cancer Prevention Trial (SELECT). JAMA Oncol2015; 1: 342-349 [PMID: 26181184DOI:
10.1001/jamaoncol.2015.0513 ]
2
Liu B , Wen P, Gu X, Weng R, Liu S. Elevated serum triglyceride predicts recurrence of colorectal polyps in patients with
advanced adenomas. Lipids Health Dis2020; 19: 211 [PMID: 32967679DOI: 10.1186/s12944-020-01388-3]
3
Pastushenko I , Mauri F, Song Y, de Cock F, Meeusen B, Swedlund B, Impens F, Van Haver D, Opitz M, Thery M,
Bareche Y, Lapouge G, Vermeersch M, Van Eycke YR, Balsat C, Decaestecker C, Sokolow Y, Hassid S, Perez-Bustillo A,
Agreda-Moreno B, Rios-Buceta L, Jaen P, Redondo P, Sieira-Gil R, Millan-Cayetano JF, Sanmatrtin O, D'Haene N, Moers
V, Rozzi M, Blondeau J, Lemaire S, Scozzaro S, Janssens V, De Troya M, Dubois C, Pérez-Morga D, Salmon I, Sotiriou C,
Helmbacher F, Blanpain C. Fat1 deletion promotes hybrid EMT state, tumour stemness and metastasis. Nature2021; 589:
448-455 [PMID: 33328637DOI: 10.1038/s41586-020-03046-1]
4
Rhodes DR , Yu J, Shanker K, Deshpande N, Varambally R, Ghosh D, Barrette T, Pandey A, Chinnaiyan AM.
ONCOMINE: a cancer microarray database and integrated data-mining platform. Neoplasia2004; 6: 1-6 [PMID: 15068665
DOI: 10.1016/s1476-5586(04)80047-2]
5
Tang Z , Li C, Kang B, Gao G, Zhang Z. GEPIA: a web server for cancer and normal gene expression profiling and
interactive analyses. Nucleic Acids Res2017; 45: W98-W102 [PMID: 28407145DOI: 10.1093/nar/gkx247]
6
Zheng H , Zhang G, Zhang L, Wang Q, Li H, Han Y, Xie L, Yan Z, Li Y, An Y, Dong H, Zhu W, Guo X. Comprehensive
Review of Web Servers and Bioinformatics Tools for Cancer Prognosis Analysis. Front Oncol2020; 10: 68 [PMID:
32117725 DOI:10.3389/fonc.2020.00068 ]
7
Szklarczyk D , Franceschini A, Wyder S, Forslund K, Heller D, Huerta-Cepas J, Simonovic M, Roth A, Santos A, Tsafou
KP, Kuhn M, Bork P, Jensen LJ, von Mering C. STRING v10: protein-protein interaction networks, integrated over the tree
of life. Nucleic Acids Res2015; 43: D447-D452 [PMID: 25352553DOI: 10.1093/nar/gku1003]
8
Vona R , Iessi E, Matarrese P. Role of Cholesterol and Lipid Rafts in Cancer Signaling: A Promising Therapeutic
Opportunity? Front Cell Dev Biol2021; 9: 622908 [PMID: 33816471DOI: 10.3389/fcell.2021.622908]
9
Silvente-Poirot S , Poirot M. Cancer. Cholesterol and cancer, in the balance. Science2014; 343 : 1445-1446 [PMID:
24675946 DOI:10.1126/science.1252787 ]
10
Tao JH et al. Aberrant cholesterol metabolism in colorectal cancer
WJCC https://www.wjgnet.com 4458 May 16, 2022Volume 10Issue 14
Tie G , Yan J, Khair L, Messina JA, Deng A, Kang J, Fazzio T, Messina LM. Hypercholesterolemia Increases Colorectal
Cancer Incidence by Reducing Production of NKT and γδ T Cells from Hematopoietic Stem Cells. Cancer Res2017; 77:
2351-2362 [PMID: 28249902DOI: 10.1158/0008-5472.CAN-16-1916]
11
Loke YL , Chew MT, Ngeow YF, Lim WWD, Peh SC. Colon Carcinogenesis: The Interplay Between Diet and Gut
Microbiota. Front Cell Infect Microbiol2020; 10: 603086 [PMID: 33364203DOI: 10.3389/fcimb.2020.603086]
12
Mayengbam SS , Singh A, Pillai AD, Bhat MK. Influence of cholesterol on cancer progression and therapy. Transl Oncol
2021; 14: 101043 [PMID: 33751965DOI: 10.1016/j.tranon.2021.101043]
13
Fang HJ , Shan SB, Zhou YH, Zhong LY. Diabetes mellitus and the risk of gastrointestinal cancer in women compared
with men: a meta-analysis of cohort studies. BMC Cancer2018; 18: 422 [PMID: 29661174DOI:
10.1186/s12885-018-4351-4 ]
14
Stadler JT , Wadsack C, Marsche G. Fetal High-Density Lipoproteins: Current Knowledge on Particle Metabolism,
Composition and Function in Health and Disease. Biomedicines2021; 9[PMID: 33808220DOI:
10.3390/biomedicines9040349 ]
15
Yang C , Tian G, Mi J, Wei X, Li X, Wang W, Wang B. Causal relevance of circulating high-density lipoprotein cholesterol
with cancer: a Mendelian randomization meta-analysis. Sci Rep2015; 5: 9495 [PMID: 25820350DOI: 10.1038/srep09495]
16
Gu JN , Yao S, Cao YH, Deng SH, Mao FW, Jiang HY, He YT, Li XY, Ke SQ, Li HL, Li H, Liu XH, Liu HL, Wang JL,
Wu K, Liu L, Cai KL. Novel parameter based on lipid indicators ratio improves prognostic value of plasma lipid levels in
resectable colorectal cancer patients. World J Gastrointest Surg2021; 13: 689-701 [PMID: 34354802DOI:
10.4240/wjgs.v13.i7.689 ]
17
Song M , Mehta RS, Wu K, Fuchs CS, Ogino S, Giovannucci EL, Chan AT. Plasma Inflammatory Markers and Risk of
Advanced Colorectal Adenoma in Women. Cancer Prev Res (Phila)2016; 9: 27-34 [PMID: 26511487DOI:
10.1158/1940-6207.CAPR-15-0307 ]
18
Dong Y , Zhou J, Zhu Y, Luo L, He T, Hu H, Liu H, Zhang Y, Luo D, Xu S, Xu L, Liu J, Zhang J, Teng Z. Abdominal
obesity and colorectal cancer risk: systematic review and meta-analysis of prospective studies. Biosci Rep2017; 37[PMID:
29026008 DOI:10.1042/BSR20170945 ]
19
Chen H , Zheng X, Zong X, Li Z, Li N, Hur J, Fritz CD, Chapman W Jr, Nickel KB, Tipping A, Colditz GA, Giovannucci
EL, Olsen MA, Fields RC, Cao Y. Metabolic syndrome, metabolic comorbid conditions and risk of early-onset colorectal
cancer. Gut2021; 70: 1147-1154 [PMID: 33037055DOI: 10.1136/gutjnl-2020-321661]
20
Zeljkovic A , Vekic J, Mihajlovic M, Gojkovic T, Vladimirov S, Zeljkovic D, Spasojevic-Kalimanovska V, Trifunovic B.
Revealing the Role of High-Density Lipoprotein in Colorectal Cancer. Int J Mol Sci2021; 22[PMID: 33805921DOI:
10.3390/ijms22073352 ]
21
Valencia C SY , Isaza M CA, Henao B J, Beltrán A L, Loango N, Landázuri P. Arylesterase activity of paraoxonase 1
(PON1) on HDL 3and HDL 2: Relationship with Q192R, C-108T, and L55M polymorphisms. Biochem Biophys Rep2021;
26 : 100971 [PMID: 33778169DOI: 10.1016/j.bbrep.2021.100971]
22
Tabata S , Yamamoto M, Goto H, Hirayama A, Ohishi M, Kuramoto T, Mitsuhashi A, Ikeda R, Haraguchi M, Kawahara K,
Shinsato Y, Minami K, Saijo A, Toyoda Y, Hanibuchi M, Nishioka Y, Sone S, Esumi H, Tomita M, Soga T, Furukawa T,
Akiyama SI. Thymidine catabolism promotes NADPH oxidase-derived reactive oxygen species (ROS) signalling in KB
and yumoto cells. Sci Rep2018; 8: 6760 [PMID: 29713062DOI: 10.1038/s41598-018-25189-y]
23
Bleve A , Durante B, Sica A, Consonni FM. Lipid Metabolism and Cancer Immunotherapy: Immunosuppressive Myeloid
Cells at the Crossroad. Int J Mol Sci2020; 21[PMID: 32823961DOI: 10.3390/ijms21165845]
24
Hanahan D , Weinberg RA. Hallmarks of cancer: the next generation. Cell2011; 144 : 646-674 [PMID: 21376230DOI:
10.1016/j.cell.2011.02.013 ]
25
Cotte AK , Aires V, Fredon M, Limagne E, Derangère V, Thibaudin M, Humblin E, Scagliarini A, de Barros JP, Hillon P,
Ghiringhelli F, Delmas D. Lysophosphatidylcholine acyltransferase 2-mediated lipid droplet production supports colorectal
cancer chemoresistance. Nat Commun2018; 9: 322 [PMID: 29358673DOI: 10.1038/s41467-017-02732-5]
26
Wolfe K , Kamata R, Coutinho K, Inoue T, Sasaki AT. Metabolic Compartmentalization at the Leading Edge of Metastatic
Cancer Cells. Front Oncol2020; 10: 554272 [PMID: 33224873DOI: 10.3389/fonc.2020.554272]
27
Pencheva N , Tran H, Buss C, Huh D, Drobnjak M, Busam K, Tavazoie SF. Convergent multi-miRNA targeting of ApoE
drives LRP1/LRP8-dependent melanoma metastasis and angiogenesis. Cell2012; 151: 1068-1082 [PMID: 23142051DOI:
10.1016/j.cell.2012.10.028 ]
28
Wang C , Li P, Xuan J, Zhu C, Liu J, Shan L, Du Q, Ren Y, Ye J. Cholesterol Enhances Colorectal Cancer Progression via
ROS Elevation and MAPK Signaling Pathway Activation. Cell Physiol Biochem2017; 42: 729-742 [PMID: 28618417
DOI: 10.1159/000477890]
29
Chaudhary J , Bower J, Corbin IR. Lipoprotein Drug Delivery Vehicles for Cancer: Rationale and Reason. Int J Mol Sci
2019; 20[PMID: 31847457DOI: 10.3390/ijms20246327]
30
Nemer G , Safi R, Kreidieh F, Usta J, Bergqvist C, Ballout F, Btadini W, Hamzeh N, Abbas O, Kibbi AG, Shimomura Y,
Kurban M. Understanding the phenotypic similarities between IFAP and Olmsted syndrome from a molecular perspective:
the interaction of MBTPS2 and TRPV3. Arch Dermatol Res2017; 309: 637-643 [PMID: 28717930DOI:
10.1007/s00403-017-1762-z ]
31
Caengprasath N , Theerapanon T, Porntaveetus T, Shotelersuk V. MBTPS2, a membrane bound protease, underlying
several distinct skin and bone disorders. J Transl Med2021; 19: 114 [PMID: 33743732DOI:
10.1186/s12967-021-02779-5 ]
32
Saral S , Vural A, Wollenberg A, Ruzicka T. A practical approach to ichthyoses with systemic manifestations. Clin Genet
2017; 91: 799-812 [PMID: 27377997DOI: 10.1111/cge.12828]
33
Wang H , Humbatova A, Liu Y, Qin W, Lee M, Cesarato N, Kortüm F, Kumar S, Romano MT, Dai S, Mo R, Sivalingam S,
Motameny S, Wu Y, Wang X, Niu X, Geng S, Bornholdt D, Kroisel PM, Tadini G, Walter SD, Hauck F, Girisha KM,
Calza AM, Bottani A, Altmüller J, Buness A, Yang S, Sun X, Ma L, Kutsche K, Grzeschik KH, Betz RC, Lin Z. Mutations
in SREBF1, Encoding Sterol Regulatory Element Binding Transcription Factor 1, Cause Autosomal-Dominant IFAP
Syndrome. Am J Hum Genet2020; 107: 34-45 [PMID: 32497488DOI: 10.1016/j.ajhg.2020.05.006]
34
Tao JH et al. Aberrant cholesterol metabolism in colorectal cancer
WJCC https://www.wjgnet.com 4459 May 16, 2022Volume 10Issue 14
Eslami SM , Nikfar S, Ghasemi M, Abdollahi M. Does Evolocumab, as a PCSK9 Inhibitor, Ameliorate the Lipid Profile in
Familial Hypercholesterolemia Patients? J Pharm Pharm Sci2017; 20: 81-96 [PMID: 28459663DOI: 10.18433/J36C8N]
35
He M , Hou J, Wang L, Zheng M, Fang T, Wang X, Xia J. Actinidia chinensis Planch root extract inhibits cholesterol
metabolism in hepatocellular carcinoma through upregulation of PCSK9. Oncotarget2017; 8: 42136-42148 [PMID:
28178673 DOI:10.18632/oncotarget.15010 ]
36
Haerian MS , Haerian BS, Molanaei S, Kosari F, Sabeti S, Bidari-Zerehpoosh F, Abdolali E. MTRR rs1801394 and its
interaction with MTHFR rs1801133 in colorectal cancer: a case-control study and meta-analysis. Pharmacogenomics2017;
18 : 1075-1084 [PMID: 28691890DOI: 10.2217/pgs-2017-0030]
37
Druck T , Cheung DG, Park D, Trapasso F, Pichiorri F, Gaspari M, Palumbo T, Aqeilan RI, Gaudio E, Okumura H, Iuliano
R, Raso C, Green K, Huebner K, Croce CM. Fhit-Fdxr interaction in the mitochondria: modulation of reactive oxygen
species generation and apoptosis in cancer cells. Cell Death Dis2019; 10: 147 [PMID: 30770797DOI:
10.1038/s41419-019-1414-7 ]
38
Huang K , Jo H, Echesabal-Chen J, Stamatikos A. Combined LXR and RXR Agonist Therapy Increases ABCA1 Protein
Expression and Enhances ApoAI-Mediated Cholesterol Efflux in Cultured Endothelial Cells. Metabolites2021; 11[PMID:
34564456 DOI:10.3390/metabo11090640 ]
39
Song G , Lin Q, Zhao H, Liu M, Ye F, Sun Y, Yu Y, Guo S, Jiao P, Wu Y, Ding G, Xiao Q, Qin S. Hydrogen Activates
ATP-Binding Cassette Transporter A1-Dependent Efflux Ex Vivo and Improves High-Density Lipoprotein Function in
Patients With Hypercholesterolemia: A Double-Blinded, Randomized, and Placebo-Controlled Trial. J Clin Endocrinol
Metab 2015; 100 : 2724-2733 [PMID: 25978109DOI: 10.1210/jc.2015-1321]
40
Bi DP , Yin CH, Zhang XY, Yang NN, Xu JY. MiR-183 functions as an oncogene by targeting ABCA1 in colon cancer.
Oncol Rep 2016; 35: 2873-2879 [PMID: 26935154DOI: 10.3892/or.2016.4631]
41
Chou JL , Huang RL, Shay J, Chen LY, Lin SJ, Yan PS, Chao WT, Lai YH, Lai YL, Chao TK, Lee CI, Tai CK, Wu SF,
Nephew KP, Huang TH, Lai HC, Chan MW. Hypermethylation of the TGF-β target, ABCA1 is associated with poor
prognosis in ovarian cancer patients. Clin Epigenetics2015; 7: 1 [PMID: 25628764DOI: 10.1186/s13148-014-0036-2]
42
Ilnytska O , Lai K, Gorshkov K, Schultz ML, Tran BN, Jeziorek M, Kunkel TJ, Azaria RD, McLoughlin HS, Waghalter M,
Xu Y, Schlame M, Altan-Bonnet N, Zheng W, Lieberman AP, Dobrowolski R, Storch J. Enrichment of NPC1-deficient
cells with the lipid LBPA stimulates autophagy, improves lysosomal function, and reduces cholesterol storage. J Biol Chem
2021; 297: 100813 [PMID: 34023384DOI: 10.1016/j.jbc.2021.100813]
| https://www.researchgate.net/publication/360628039_Reduced_serum_high-density_lipoprotein_cholesterol_levels_and_aberrantly_expressed_cholesterol_metabolism_genes_in_colorectal_cancer |
Differential Expression of Protease-Activated Receptors-1 and -2 in Stromal Fibroblasts of Normal, Benign, and Malignant Human Tissues - The American Journal of Pathology
P2031-2041,
Differential Expression of Protease-Activated Receptors-1 and -2 in Stromal Fibroblasts of Normal, Benign, and Malignant Human Tissues
Address reprint requests to Dr. Michael R. D’Andrea, The R. W. Johnson Pharmaceutical Research Institute, Welsh and McKean Rds., Spring House, PA 19477
Affiliations
Drug Discovery, The R. W. Johnson Pharmaceutical Research Institute, Spring House, Pennsylvania
Claudia K. Derian
Affiliations
Drug Discovery, The R. W. Johnson Pharmaceutical Research Institute, Spring House, Pennsylvania
Rosemary J. Santulli
Affiliations
Drug Discovery, The R. W. Johnson Pharmaceutical Research Institute, Spring House, Pennsylvania
Patricia Andrade-Gordon
Affiliations
Drug Discovery, The R. W. Johnson Pharmaceutical Research Institute, Spring House, Pennsylvania
DOI: https://doi.org/10.1016/S0002-9440(10)64675-5
The serine proteases thrombin and trypsin are among many factors that malignant cells secrete into the extracellular space to mediate metastatic processes such as cellular invasion, extracellular matrix degradation, angiogenesis, and tissue remodeling. The degree of protease secretion from malignant cells has been correlated to their metastatic potential. Protease activated receptors (PAR)-1 and -2, which are activated by thrombin and trypsin respectively, have not been extensively characterized in human tumors
in situ
. We investigated the presence of PAR-1 and PAR-2 in human normal, benign and malignant tissues using immunohistochemistry and
in situ
hybridization. Our results demonstrate PAR-1 and PAR-2 expression in the tumor cells, mast cells, macrophages, endothelial cells, and vascular smooth muscle cells of the metastatic tumor microenvironment. Most notably, an up-regulation of PAR-1 and PAR-2 observed in proliferating, smooth muscle actin (SMA)-positive stromal fibroblasts surrounding the carcinoma cells was not observed in normal or benign conditions. Furthermore,
in vitro
studies using proliferating, SMA-positive, human dermal fibroblasts, and scrape-wounded human dermal fibroblasts demonstrated the presence of PAR-1 and PAR-2 not detected in quiescent, SMA-negative cultures. PAR-1 and PAR-2 in the cells forming the tumor microenvironment suggest that these receptors mediate the signaling of secreted thrombin and trypsin in the processes of cellular metastasis.
Malignant cells solicit the help of other cell types, such as stromal fibroblasts, mast cells, monocytes, and vascular cells, to facilitate their invasion into the surrounding tissue
1
Gregoire M
Lieubeau B
The role of fibroblasts in tumor behavior.
because unrestrained growth of the tumor, by itself, does not result in invasion and metastasis.
2
Liotta LA
Steeg PS
Stetler-Stevenson W
Cancer metastasis and angiogenesis: an imbalance of positive and negative regulation.
Cell. 1991; 64 : 327-336
The interface between the invading malignant cells and the hosting stromal cells, referred to as the tumor microenvironment (TME),
3
O'Meara RAQ
Coagulative properties of cancers.
Ir J Med Sci. 1958; 394 : 474-479
possesses a vast array of well-orchestrated cell signaling molecules which function to facilitate the ability of the proliferating tumor front to invade the stroma, as well as to degrade and remodel the extracellular matrix.
1
Gregoire M
Lieubeau B
The role of fibroblasts in tumor behavior.
Cancer Metastasis Rev. 1995; 14 : 339-350
Crossref
Scopus (119)
Of the many factors secreted by tumor cells, the two proteolytic enzymes, thrombin and trypsin, have been correlated to the stage and type of carcinoma and are associated with cell invasion and extracellular matrix degradation.
4
Koivunen E
Saksela O
Itkonen O
Osman S
Huhtala M-L
Stenman U-F
Human colon carcinoma, fibrosarcoma and leukemia cell lines produce tumor-associated trypsinogen.
Int J Cancer. 1991; 47 : 592-596
Crossref
PubMed
Scopus (92)
,
5
Walz DA
Fenton JW
The role of thrombin in tumor cell metastasis.
Invasion Metastasis. 1995; 14 : 303-308
Furthermore, the ratio of proteases to their inhibitors in the TME can favor capillary sprout elongation and lumen formation during angiogenesis.
2
Liotta LA
Steeg PS
Stetler-Stevenson W
Cancer metastasis and angiogenesis: an imbalance of positive and negative regulation.
Cell. 1991; 64 : 327-336
Abstract
Scopus (2644)
Thrombin is known to influence the behavior of all of the cells identified within the TME. For instance, thrombin activates platelets to adhere to other cells or extracellular matrix, increases vascular permeability and expression of adhesion molecules, attracts monocytes, stimulates mitogenic activity of endothelial cells and fibroblasts, and degranulates mast cells.
6
Dennington PM
Berndt MC
The thrombin receptor.
Clin Exp Pharmacol Physiol. 1994; 21 : 349-358
Crossref
Scopus (31)
,
7
Grand RJA
Turnell AS
Grabham PW
Cellular consequences of thrombin-receptor activation.
Biochem J. 1996; 313 : 353-368
Crossref
PubMed
Scopus (326)
,
8
Hollenberg MD
Protease-mediated signaling: new paradigms for cell regulation and drug development.
Trends Pharmacol Sci. 1996; 17 : 3-6
Abstract
,
9
Razin E
Marx G
Thrombin-induced degranulation of cultured bone marrow-derived mast cells.
J Immunol. 1984; 133 : 3282-3285
Thrombin also influences the rate of deposition of connective tissue proteins and the development of tissue fibrosis during normal wound healing; a process similar to cellular metastasis.
10
Carney DH
Mann R
Redin WR
Pernia SD
Berry D
Heggers JP
Hayward PG
Robson MC
Christie J
Annable C
Enhancement of incisional wound healing and neovascularization in normal rats by thrombin and synthetic thrombin receptor-activating peptides.
J Clin Invest. 1992; 89 : 1469-1477
Crossref
PubMed
Scopus (135)
,
11
Chambers RC
Dabbagh K
McAnulty RJ
Gray AJ
Blanc-Brude OP
Laurent GJ
Thrombin stimulates fibroblast procollagen production via proteolytic activation of protease-activated receptor 1.
J Biochem. 1998; 333 : 121-127
Many of thrombin’s effects are mediated through the seven transmembrane G-protein coupled receptors, protease-activated receptor (PAR)-1, via proteolytic cleavage of the amino-terminal extension unveiling a new amino terminus that activates the receptor through a tethered peptide ligand mechanism.
12
Vu TK
Hung DT
Wheaton VI
Coughlin SR
Molecular cloning of a functional thrombin receptor reveals a novel proteolytic mechanism of receptor activation.
Cell. 1991; 64 : 1057-1068
Scopus (2680)
In vitro
studies have demonstrated increased tumor cell adhesion to endothelium, extracellular matrix and platelets, enhanced metastatic capacity of tumor cells, and activated cell growth and stimulation of angiogenesis in response to thrombin and PAR-1 agonist peptides.
13
Nierodzik ML
Kajumo LR
Karpatkin S
Effect of thrombin treatment of tumor cells on adhesion of tumor cells to platelets in vitro and tumor metastasis in vivo.
Cancer Res. 1992; 52 : 3267-3272
,
14
Nierodzik ML
Bain RM
Liu L-X
Shiviji M
Takeshita K
Karpatkin S
Presence of the seven transmembrane thrombin receptor in human tumour cells: effects of activation on tumour adhesion to platelets and tumour tyrosine phosphorylation.
Br J Haematiology. 1996; 92 : 452-457
Crossref
PubMed
Scopus (67)
,
15
Klementsen B
Jorgensen L
Mechanisms involved in the early interaction between HeLa cells, platelets and endothelial cells in vitro under the influence of thrombin.
APMIS. 1997; 105 : 391-401
Crossref
PubMed
Scopus (6)
,
16
Wojtukiewicz MZ
Tang DG
Ben-Josef E
Renaud C
Waltz DA
Honn KV
Solid tumor cells express functional tethered ligand thrombin receptor.
Cancer Res. 1995; 55 : 668-674
,
17
Wojtukiewicz MZ
Tang DG
Ciarelli JJ
Nelson KK
Waltz DA
Thrombin increases the metastatic potential of tumor cells.
Int J Cancer. 1993; 54 : 793-806
Crossref
Scopus (109)
Google Scholar
,
18
Tsopanglou NE
Maragoudakis ME
On the mechanism of thrombin-induced angiogenesis: inhibition of attachment of endothelial cells on basement membrane components.
Angiogenesis. 1997; 1 : 192-200
Crossref
Google Scholar
PAR-1 has been localized in smooth muscle cells,
19
Zhong C
Hayzer DJ
Corson MA
Runge MS
Molecular cloning of the rat vascular smooth muscle thrombin receptor. Evidence for in vitro regulation by basic fibroblast growth factor.
J Biol Chem. 1992; 267 : 16975-16979
Abstract
Full Text PDF
PubMed
Google Scholar
pancreas tumor cells,
20
Kaufmann R
Schafberg H
Nowak G
Proteinase-activated receptor-2-mediated signaling and inhibition of DNA synthesis in human pancreatic cancer cells.
Int J Pancreatol. 1998; 24 : 97-102
PubMed
Google Scholar
,
21
Rudroff C
Schafberg H
Nowak G
Weinel R
Scheele J
Kaufmann R
Characterization of functional thrombin receptors in human pancreatic tumor cells (MIA PACA-2).
Pancreas. 1998; 16 : 189-194
Crossref
PubMed
Scopus (41)
Google Scholar
carcinoma and melanoma cell lines
16
Wojtukiewicz MZ
Tang DG
Ben-Josef E
Renaud C
Waltz DA
Honn KV
Solid tumor cells express functional tethered ligand thrombin receptor.
Cancer Res. 1995; 55 : 668-674
PubMed
Google Scholar
and recently in human mast cells.
22
D'Andrea MR
Rogahn CJ
Andrade-Gordon P
Localization of protease-activated receptors-1 and -2 in human mast cells: indications for mast cell amplification cascade.
Biotech Histochem. 2000; 75 : 85-90
Crossref
PubMed
Scopus (109)
In breast carcinoma cells, the level of PAR-1 expression has been correlated to the degree of invasiveness.
23
Even-Ram S
Uziely B
Cohen P
Grisaru-Granovsky S
Maoz M
Ginzburg Y
Reich R
Vlodavsky I
Bar-Shavit R
Thrombin Receptor overexpression in malignant and physiological invasion processes.
Nat Med. 1998; 4 : 909-914
Crossref
PubMed
Scopus (408)
Google Scholar
Furthermore, B16F10 melanoma cells, transfected with PAR-1, enhanced thrombin-treated tumor cell adhesion to fibronectin 2.5-fold
in vitro
and pulmonary metastasis as high as 39-fold
in vivo
compared to the control thrombin-treated tumor cells.
24
Nierodzik ML
Chen K
Takeshita K
Li J-J
Huang Y-Q
Feng X-S
D'Andrea MR
Andrade-Gordon P
Karpatkin S
Protease-activated receptor 1 (PAR-1) is required and rate-limiting for thrombin-enhanced experimental pulmonary metastasis.
Blood. 1998; 92 : 3694-3700
Crossref
PubMed
Google Scholar
Trypsin can stimulate fibroblasts to secrete procollagen, stimulate mast cells to degranulate, and is secreted by numerous tumor cell lines that are correlated with the stage and histological type of carcinoma.
4
Koivunen E
Saksela O
Itkonen O
Osman S
Huhtala M-L
Stenman U-F
Human colon carcinoma, fibrosarcoma and leukemia cell lines produce tumor-associated trypsinogen.
Int J Cancer. 1991; 47 : 592-596
Crossref
PubMed
Scopus (92)
Google Scholar
,
25
Koshikawa N
Yasumitsu H
Nagashima Y
Umeda M
Miyazaki K
Identification of one- and two-chain forms of trypsinogen 1 produced by a human gastric adenocarcinoma cell line.
J Biochem. 1994; 303 : 187-190
Google Scholar
,
26
Koshikawa N
Yasumitsu H
Umeda M
Miyazaki K
Multiple secretion of matrix serine proteases by human gastric adenocarcinoma cell line.
Cancer Res. 1992; 52 : 5046-5053
PubMed
Google Scholar
,
27
Hirahara F
Miyagi Y
Miyagi E
Yasumitsu H
Koshikawa N
Nagashima Y
Kitamura H
Minaguchi H
Umeda M
Miyazaki K
Trypsinogen expression in human ovarian carcinomas.
Int J Cancer. 1995; 63 : 176-181
Crossref
PubMed
Scopus (67)
Google Scholar
Some of the actions of trypsin are mediated by a second protease-activated receptor known as PAR-2.
8
Hollenberg MD
Protease-mediated signaling: new paradigms for cell regulation and drug development.
Trends Pharmacol Sci. 1996; 17 : 3-6
Abstract
Full Text PDF
PubMed
Scopus (75)
Google Scholar
,
28
Nystedt S
Emilsson K
Larsson A-K
Strombeck B
Sundelin J
Molecular cloning and functional expression of the gene encoding the human proteinase-activated receptor 2.
Eur J Biochem. 1995; 232 : 84-89
Crossref
PubMed
Scopus (304)
| https://ajp.amjpathol.org/article/S0002-9440(10)64675-5/fulltext |
Aviation Accident Summary CEN14LA445
In-Depth Access to the NTSB Aviation Accident Database and Final Reports from international accident investigation branches on iPhone/iPad.
Aviation Accident Summaries
Aviation Accident Summary CEN14LA445
Bethel, OH, USA
Aircraft #1
N65692
FRANKE ROLAND SKY RAIDER
Analysis
The pilot departed from a private airstrip that was located on a farm and was bordered by 50-foot-tall trees. He stated that the engine lost power during the initial climb and before the airplane had sufficient altitude to clear the tree line. In an attempt to avoid the trees, the pilot initiated a left turn with the intention of landing in the farm field. The pilot did not recall any further events related to the accident. The airplane's damage was consistent with a nose-low attitude at impact resulting from an aerodynamic stall while maneuvering after a loss of engine power. A postaccident airframe examination did not reveal any anomalies consistent with a preimpact failure or malfunction. An engine examination revealed that the carburetor had separated from the engine, and the carburetor fuel bowl had separated from the carburetor housing. The carburetor fuel bowl retaining spring clip was dislodged from one of the housing casting holes. Because the carburetor was separated from the engine and the retaining clip was dislodged from the housing casting holes, the investigation was unable to determine whether the carburetor bowl retaining clip was fully engaged before impact. No other anomalies were identified with respect to the engine.
Factual Information
On August 19, 2014, about 1700 eastern daylight time, an experimental amateur-built Franke Sky Raider airplane, N65692, impacted terrain following a loss of engine power after takeoff from a private airstrip near Bethel, Ohio. The pilot sustained serious injuries. The airplane was substantially damaged. The airplane was registered to and operated by the pilot under the provisions of 14 Code of Federal Regulations Part 91 as a personal flight. Visual meteorological conditions prevailed for the flight, which was not operated on a flight plan. The local flight was originating at time of the accident.The pilot reported that he departed from the private airstrip toward the west. The airstrip was located on a farm, which was bordered by 50-foot tall trees. He stated that the engine lost power during the initial climb before the airplane had sufficient altitude to clear the tree line in his flight path. In an attempt to avoid the trees, he initiated a left turn with the intention of landing in the farm field. The pilot did not recall any further events related to the accident. However, he did note that the turn may have resulted in an aerodynamic stall.
The airplane came to rest inverted, oriented on a west heading. Ground impact scars were located about 15 feet north of the main wreckage. The nose was crushed aft and fragmented. The right wing had separated from the fuselage at the root; it was located adjacent to the fuselage at the accident site. The right wing exhibited damage at the wing tip and root. The left wing remained attached to the fuselage; the outboard one-half span was crushed aft. All flight controls remained attached to the airframe and the control cables were intact. The elevator control rod was fractured near the forward end, in the vicinity of the cockpit control stick. The appearance of the fracture surface was consistent with an overstress failure.
Both wing fuel tanks contained a sufficient quantity of fuel. Visual examination of samples taken from each fuel tank did not reveal the presence of any water or sediment. No anomalies consistent with a preimpact failure or malfunction with respect to the airframe were observed.
The engine remained attached to the engine mount. The engine mount was deformed consistent with impact forces. Both of the propeller blades had separated from the hub at the blade roots; they were located at the accident site. Internal engine continuity was confirmed through crankshaft rotation, and compression was obtained at each cylinder. The carburetor was separated from the engine, but remained attached by the main fuel line and throttle cable. The carburetor fuel bowl retaining spring clip was dislodged from one of the casting holes. The fuel bowl, floats, and fuel screen had separated from the carburetor and were located in the vicinity of the carburetor. The exterior of the fuel bowl exhibited a cylindrical impression consistent in size to the wire diameter of the retaining spring clip. The fuel bowl did not appear to exhibit any other damage. In addition, the cork gasket on the carburetor housing, intended to seal the fuel bowl to the housing, appeared to be deteriorated condition. No other anomalies were noted with respect to the engine.
The accident airplane was a single-engine, two-place, high wing design, with a conventional (tailwheel) landing gear configuration. It was powered a 40-horsepower Rotax 447 SCDI two cylinder, two stroke, engine. The airplane was issued an experimental airworthiness certificate in November 2007. According to the airworthiness certificate application, the airplane was manufactured in 2001 and had accumulated 45 hours at the time of the application. (It was being certificated as an existing aircraft that did not meet the requirements for an ultralight aircraft.) According to the pilot's statement, the airplane had accumulated about 85 hours total time at the time of the accident. The most recent condition inspection was completed in March 2014, with about 1 hour flight time since that inspection.
Probable Cause and Findings
The pilot's inadvertent aerodynamic stall while maneuvering after a loss of engine power during initial climb. Contributing to the accident was the total loss of engine power for reasons that could not be determined because the investigation could not determine during postaccident examination whether any anomalies existed prior to the accident.
Source:NTSB Aviation Accident Database
| https://www.accidents.app/summaries/accident/20140821X40824 |
Unconscious Biases: Racial Microaggressions in American Indian Health Care | American Board of Family Medicine
Melissa L. Walls , John Gonzalez , Tanya Gladney
and Emily Onello
The Journal of the American Board of Family
Medicine
March 2015, 28 (2) 231-239; DOI: https://doi.org/10.3122/jabfm.2015.02.140194
Melissa L. Walls
the Department of Biobehavioral Health and Population Sciences, University of Minnesota Medical School-Duluth, Duluth, MN (MLW); Department of Psychology, Bemidji State University, Bemidji, MN (JG); Department of Sociology and Criminal Justice, University of St. Thomas, St. Paul, MN (TG); Department of Family Medicine/Community Health, University of Minnesota Medical School-Duluth, Duluth, MN (EO). Find this author on Google Scholar Find this author on PubMed Search for this author on this site
John Gonzalez
the Department of Biobehavioral Health and Population Sciences, University of Minnesota Medical School-Duluth, Duluth, MN (MLW); Department of Psychology, Bemidji State University, Bemidji, MN (JG); Department of Sociology and Criminal Justice, University of St. Thomas, St. Paul, MN (TG); Department of Family Medicine/Community Health, University of Minnesota Medical School-Duluth, Duluth, MN (EO). Find this author on Google Scholar Find this author on PubMed Search for this author on this site
Tanya Gladney
the Department of Biobehavioral Health and Population Sciences, University of Minnesota Medical School-Duluth, Duluth, MN (MLW); Department of Psychology, Bemidji State University, Bemidji, MN (JG); Department of Sociology and Criminal Justice, University of St. Thomas, St. Paul, MN (TG); Department of Family Medicine/Community Health, University of Minnesota Medical School-Duluth, Duluth, MN (EO). Find this author on Google Scholar Find this author on PubMed Search for this author on this site
Emily Onello
the Department of Biobehavioral Health and Population Sciences, University of Minnesota Medical School-Duluth, Duluth, MN (MLW); Department of Psychology, Bemidji State University, Bemidji, MN (JG); Department of Sociology and Criminal Justice, University of St. Thomas, St. Paul, MN (TG); Department of Family Medicine/Community Health, University of Minnesota Medical School-Duluth, Duluth, MN (EO). Find this author on Google Scholar Find this author on PubMed Search for this author on this site
Article Figures & Data
References Info & Metrics
PDF
Abstract
Purpose:
This article reports on the prevalence and correlates of microaggressive experiences in health care settings reported by American Indian (AI) adults with type 2 diabetes mellitus (T2DM).
Methods:
This community-based participatory research project includes two AI reservation communities. Data were collected via in-person article-and-pencil survey interviews with 218 AI adults diagnosed with T2DM.
Results:
Greater than one third of the sample reported experiencing a microaggression in interactions with their health providers. Reports of microaggressions were correlated with self-reported history of heart attack, worse depressive symptoms, and prior-year hospitalization. Depressive symptom ratings seemed to account for some of the association between microaggressions and hospitalization (but not history of heart attack) in multivariate models.
Conclusions:
Microaggressive experiences undermine the ideals of patient-centered care and in this study were correlated with worse mental and physical health reports for AIs living with a chronic disease. Providers should be cognizant of these subtle, often unconscious forms of discrimination.
Cross-Cultural Care Patient-Centered Care
Populations Underserved
Despite countless calls to action to address health equity issues, there remain persistent and in some cases widening gaps in health status between the most advantaged and disadvantaged members of society. One striking illustration of racial/ethnic health disparities is found among American Indian/Alaska Native (AIAN) communities across the United States, who suffer among the highest rates of poor physical and mental health including type 2 diabetes mellitus (T2DM), cardiovascular problems, suicide, and mental distress. 1
Numerous factors are implicated as key contributors to health disparities in general, including social exclusion and marginalization, poverty, stress, and other critical social determinants of health. 2 , 3
In the clinical arena, evidence from the National Health Care Quality and Disparities Report reveals that AIANs received worse health care than whites on approximately one third of quality care indicators. 4
Compared with all other racial/ethnic groups included in the report, AIANs reported the smallest proportion of improvement across these quality measures.
One response to such trends has been renewed focus on culturally safe (sometimes referred to as culturally “competent”), patient-centered medical care and increased awareness of the harmful health impacts of racism and discriminatory treatment for patients from diverse groups. Less understood are the elusive yet damaging effects of microaggressive experiences. Microaggressions describe the frequent, subtle (often unconscious) indignities expressed in relation to one's gender, race, sexual orientation, or otherwise-marginalized social position. 5
The potential impact of microaggressions in clinical encounters is notable given the provider-patient relationship and inherent power differential wherein authority and prestige favors the clinician. When a health care provider commits a microaggression, the exchange may undermine attempted provision of care, trust may be broken, and the visit becomes a source of patient stress. Microaggressions are possible in any intercultural exchange and are liable to be enacted by all of us, including the most caring, sensitive providers. Thus, there is great impetus for critical self reflection and broadened understanding of microaggressions to achieve high-quality, culturally safe care.
Although a growing literature explores the consequences of health care-related discrimination in multiple forms, investigation of microaggressive health care experiences specifically has received almost no empirical attention. In this study, we examine the prevalence of microaggressive experiences in health care settings and their association with health outcomes and behaviors for a sample of AI adults living with T2DM.
Literature Review
The relationship between stress and health is well established. 6 ⇓ ⇓ ⇓ ⇓ ⇓ – 12
Psychosocial stress can adversely affect health in two major ways: directly, through neurochemical pathways; and indirectly, by promoting unhealthy behaviors. An intimate understanding of the sociocultural contexts of stress is key to adequately conceptualizing and measuring the “stress universe,” 13
a term used to describe exposure to variable forms of stressors. Interwoven within this context for people of color including AIs are experiences of discrimination acting as powerful stressors due to their unpredictable and uncontrollable nature. 14
Only within the last 15 or so years has the link between discrimination and health been seriously considered as contributing to health disparities, whether occurring in everyday situations 15 ⇓ – 17
or when accessing health care services. 18 ⇓ – 20
For example, a review by Pascoe and Richman 21
found that perceived discrimination is a significant predictor of disparities in hypertension, cardiovascular disease, diabetes, and respiratory conditions for racial minorities.
Numerous state, federal, and international reports reveal significant levels of racial discrimination by health care providers and within health systems and cite these factors as key mechanisms of health inequities. 18 , 22 ⇓ – 24
Members of racial minority groups are known to experience significantly more perceived discrimination from their providers than white patients, and provider discrimination predicts poorer health and less health care utilization. 20
Health care professionals' unconscious biases toward racial ethnic minorities are also prevalent and negatively affect clinical relationships, patient satisfaction, quality of care, and communication style, 22 , 25 , 26
thus contributing to worse health. A relatively recent framework for understanding these less overt biases is referred to as microaggressions. 5 , 27
Microaggressions are commonly occurring indignities, slights, or insults that send a message of derogatory or negative status to members of marginalized groups. 27
Microaggressions take on many forms. In a clinical relationship a provider may, for example, minimize racial/cultural issues; subtly communicate stereotypic assumptions; or overidentify with the patient's cultural background, at times due to assumed similarities with oppressive experiences. 28
Attempts to call attention to such events may elicit additional microaggressive responses (eg, “you are being oversensitive,” or, “you are pulling the ‘race card’.”). Because microaggressions are frequently “invisible” and unconscious, many are unlikely to examine their own role and impact as a microaggressor. 5
To fully appreciate the potential effects of microaggressive stressors, each should be considered not as an isolated event, but as an instance within a broader pattern of oppression and discrimination. With regard to AI experiences, Sue asserts, “Microaggressions are linked to a wider sociopolitical context of oppression and injustice (historic trauma)…. For American Indians, their everyday lives are filled with reminders that their lands were unfairly seized from them, that they were forced onto reservations, and that physical and cultural genocide were visited on them.” 5
Thus, one single microaggressive experience might in and itself be stressful, and may also bring forth reminders of traumatic historic and ongoing oppression and mistreatment.
Among myriad health disparities endured by AI communities is the fact that AIs are more than twice as likely to have T2DM than non-Hispanic Whites. 29
This disparity persists even after controlling for age, gender, other risk factors, and lifestyle characteristics. 30
Given that diabetes care recommendations include regular follow-up with primary care providers to monitor disease management, engage in patient education, and track glycated hemoglobin (A1C) levels, 31
T2DM prognosis is particularly prone to consequence if the patient/provider relationship is damaged by microaggressive encounters. For instance, research in the area of racial discrimination in health care systems (but not microaggressions specifically) established a link between health care discrimination and higher A1C levels among diabetic patients. 32
Others have shown health care discrimination to be associated with increased diabetes-related complications and worse diabetes care. 33
In sum, discrimination and possibly microaggressions in health settings, particularly those enacted by health care providers, may contribute to worse health, decreased service utilization, and reduced treatment compliance. AIs endure disproportionate rates of numerous chronic diseases including T2DM, which requires frequent formal service utilization for disease monitoring and management. As such, AI communities may offer great insight into the ways in which microaggressions affects health behaviors and outcomes.
Methods
The Mino Giizhigad (A Good Day) Study is a community-based participatory research project with the Lac Courte Oreilles and Bois Forte Bands of Chippewa 1
and the University of Minnesota. Both tribal communities wish to be named in public dissemination of research findings. The central purpose of the study was to describe the impact of mental health on diabetes-related outcomes among Ojibwe adults with T2DM. Tribal government support was obtained before applying for project funding. The project began with community feasts and forums to discuss the study goals, obtain community feedback, and the establishment of Community Research Councils (CRCs). CRCs and University team members were active participants in the entire research process, including measurement adaptation and data collection and analysis. The University of Minnesota Institutional Review Board (IRB) and Indian Health Services National IRB reviewed and approved study methodologies.
Each community is home to its own tribal health clinic, and each employs one diabetes nurse educator. Both sites offer glucose testing and monitoring equipment, basic nutrition and exercise education, and coordinate community outreach initiatives including school-based healthy living programming. Participants for the current study were randomly selected from each reservation's health clinic records. Inclusion criteria were: patients 18 years or older, T2DM diagnosis, and self identified as AI. Our goal was to invite 300 patients (150 per site) to achieve a final sample size with adequate statistical power for planned multivariate analyses. Clinic partners used probability sampling to generate a random sample of 150 patients from their lists. Selected patients were mailed a welcome letter, brochure, and contact card with mail and phone-in options to decline participation. Because of budget limitations, the project design was limited to self report survey data. Trained community interviewers contacted nondeclining recruits to schedule the survey interviews. Participants were given a pound of locally cultivated wild rice and a $30 cash incentive. Article-and-pencil interviewer administered surveys were completed in participants' location of choice, often in private spaces within homes. The time to complete each survey ranged between approximately 1.5–3 hours.
Identifying information linked to surveys was removed and replaced with an identification number by on-site project coordinators before sending to the university. Survey data were entered and verified in electronic format by University research assistants. Of an initial eligible sample of 289 individuals (11 patients were ineligible because they did not have diabetes and/or were not AI), 218 participants completed surveys for a final study response rate of 75.4%.
Measures
The University and community-based research team collaboratively reviewed, generated, and/or adapted all survey measures. Our central independent variable for this manuscript, Microaggressions, includes participants' indication of having ever experienced six ethnicity-related microaggressions from health care providers. Questions were adapted from the Racial Microaggressions in Counseling Scale 28
. Summed yes/no responses to the six items were used to compute an index of microaggressions in health care ranging from 0–6 (Cronbach's α = 0.85).
We assessed associations between microaggressions and three health/behavioral health outcomes. Depressive symptoms are measured by scored responses (0 = not at all, 1 = several days, 2 = more than half the days, 3 = almost every day) to nine items (PHQ-9 35
) assessing symptoms of depression experienced in the 2 weeks before survey participation. We used a summed continuous score of this variable ranging in value from 0–27. Heart attack is indicated by participant reports of having ever been told by a provider that they had experienced a heart attack. Past-year hospitalizations are measured by responses to a question asking participants how often had been a patient in a hospital overnight during the 12 months before their interview. To adjust for skewness, we truncated the hospital variable values to range from 0–2.
Several control variables were also included. Gender is coded 0 = male, 1 = female. Although all participants in this study sought medical care at clinics located on reservation, some lived off reservation lands. We controlled for this with a dummy variable where 0 = off reservation and 1 = on reservation. Per capita household income was measured by asking respondents to indicate their overall household income within $10,000 ranges. The final measure included the midpoints of these ranges divided by the number of people living within households. We also controlled for the number of years the participant had diabetes, the clinic site from which the patient was recruited (location = 0 or 1), and self-reported age in years.
Results
Descriptive statistics for study variables are displayed in Table 1
. The mean age of participants was 56.5 years and slightly over half of the sample was female. Average duration since T2DM diagnosis was approximately 15 years. Exactly 20% of the sample reported being hospitalized within the year before their interview date (the mean value of the continuous hospitalization variable used in analysis = 0.27). The mean value of microaggressions = 1.1, indicating that on average, respondents reported a little more than 1 microaggression experienced in health care settings.
View this table:
View inline
View popup
Table 1.
Descriptive Statistics for Self-Reported Survey Data from American Indian Patients with Type 2 Diabetes
Table 2
provides Pearson's r correlation coefficients to illustrate bivariate relationships among all study variables. The microaggressions index was significantly and positively associated with self-reported heart attack history, past-year hospitalization, and depressive symptoms. None of the control variables were significantly associated with reported health care microaggressions in these bivariate correlations. Age was negatively associated with reports of depressive symptoms and positively related to history of heart attack.
View this table:
View inline
View popup
Table 2.
Bivariate Correlations (Pearson's r) Among Study Variables for American Indian Adults Living with Type 2 Diabetes
Table 3
provides a breakdown of self-reported microaggressions experienced in health care settings. The most frequently reported microaggression related to stereotypes: “my health care provider sometimes seemed to have stereotypes about my cultural group, even if he or she did not express them directly.” Endorsements ranged from 16–21.8% for the individual items. We also calculated a count of the prevalence of reporting any of the experiences and found that 36% of the sample experienced a microaggressive encounter in health care environments.
View this table:
View inline
View popup
Table 3.
American Indian Patient's Self-Reported Experiences with Microaggressions in Healthcare Settings
Regression results are presented in Table 4
with ordinary least squares regression for the continuous outcomes and logistic regression for the binary outcome, heart attack. The six control variables (age, gender, on/off reservation, clinic location, years living with diabetes, and per capita household income) and the microaggression variable were all regressed on each health/behavioral health outcome. After inclusion of control variables (Model 1, Table 4
), microaggressive experiences were significantly and positively associated with depressive symptoms (β = 0.19, P
< .01), past-year hospitalizations (β = 0.15, P
< .05), and history of heart attack (OR = 1.30, P
< .05). Age was negatively associated with depressive symptoms and positively associated with heart attack history. Participant location was significantly associated with heart attack and hospitalizations, with those seeking treatment at community two more likely to report each of these issues.
View this table:
View inline
View popup
Table 4.
Results of OLS and Logistic Regression Analyses
To control for the possibility that those experiencing depressive symptoms may view provider treatment more negatively than those are not, we included depressive symptoms as independent variables in Model 2 ( Table 4
) for the two clinical outcomes. We also calculated an interaction term between depressive symptoms and microaggressive experiences given their positive, significant association. We first review results when ‘heart attack’ is the dependent variable. As shown, after accounting for the control variables and microaggressions, patients reporting depressive symptoms were more likely to also report a history of heart attack. The inclusion of depressive symptoms in Model 2 slightly reduces the strength of the association between microaggressions and self-reported heart attack (OR = 1.32 in Model 1; OR = 1.28 in Model 2), though the association remained statistically significant. The interaction term for depressive symptoms by microaggressions was not significant in this model (not shown).
Turning to the Hospitalization model, the association between microaggressions and past-year hospitalization was no longer significant after inclusion of depressive symptoms. The interaction term for depressive symptoms by microaggressions was significant and is plotted
Figure 1
. The predicted coefficient for the dependent variable (past-year hospitalization) is diplayed on the y-axis. The illustration in
Figure 1
reveals that patients reporting more microaggressions and more depressive symptoms were most likely to also report past-year hospitalization. Furthermore, hospitalization reports varied substantially by depressive symptom ratings for those higher on the microaggression scale. Depressive symptoms had less of an effect on hospitalizations among those reporting fewer microaggressions as shown in the bottom, diamond-shaped labeled line of
Figure 1
. | https://www.jabfm.org/content/28/2/231?ijkey=db31766abb82c42c0695cd42870893319cebac59&keytype2=tf_ipsecsha |
HUMANGGP:003836 - FACTA Search
Query: HUMANGGP:003836 (
FVIII
)
3,104
document(s) hit in 31,850,051 MEDLINE articles (0.00 seconds)
We have previously documented raised levels of factor VIII von Willebrand factor antigen ( FVIII vWF Ag), an endothelial product, in patients with vascular diseases and suggested that levels of this relate to disease activity. No one has yet investigated patients with Raynaud's phenomenon (RP) alone to see if the severity of vasospastic attacks relates to FVIII vWF Ag. We studied 22 patients with RP. None of these patients fulfilled diagnostic criteria for a connective tissue disease but all had severe symptoms which warranted referral to hospital. We measured the FVIII vWF Ag and the procoagulant factor VIII ( FVIII :c) levels in these patients. FVIII :c is not an endothelial product and is released by different mechanisms, thus it forms an active control to FVIII vWF Ag. FVIII vWF Ag measurements were carried out using the Laurell method and FVIII :c was assessed using the technique described by Nilsson. Patients were asked to complete diaries over a 2-week winter period. The frequency and duration of all Raynaud's attacks were recorded. There were significant positive correlations between FVIII vWF Ag and the total number and duration of RP attacks over the 2-week period (P less than 0.005, r = 0.67 and P less than 0.05, r = 0.40, respectively; Spearman's rank correlation). No correlation was found between levels of FVIII :c and the same clinical parameters. It has been suggested that patients with clinical evidence of vascular damage have elevated plasma levels of FVIII vWF Ag. Our present study has demonstrated correlations between FVIII vWF Ag levels and the clinical severity of vasospasm in patients with RP.(ABSTRACT TRUNCATED AT 250 WORDS)
...
PMID:Factor VIII von Willebrand factor antigen levels correlate with symptom severity in patients with Raynaud's phenomenon. 174 98
This study assayed serum levels of FVIII Rag as a marker of endothelial injury in patients not only with frank connective tissue disease but also in those presenting with Raynaud's phenomenon and in families of those with systemic sclerosis. Elevated levels of FVIII Rag were found in 62% of patients with systemic sclerosis (SS), 38% with systemic lupus erythematosus (SLE), 67% with mixed connective tissue disease (MCTD) and in 17% with primary Raynaud's phenomenon. Twenty per cent of first degree relatives of patients with SS also demonstrated high levels of FVIII Rag and certain antibodies, namely those reacting with U1RNP and the centromere. The association between elevated FVIII Rag and antibodies linked to Raynaud's and vasculitis lends support to antibody involvement in pathogenesis. High levels of FVIII Rag in family members may reflect an increased susceptibility of endothelium to injury particularly since relatives also have a higher frequency of clinical features such as Raynaud's phenomenon.
...
PMID:Factor VIII related antigen in connective tissue disease patients and relatives. 228 86
We describe a 51-year old-woman with haemorrhagic syndrome manifested as spontaneous bruising, and prolonged and abundant menstrual bleeding. She had hed these symptomes for six months prior to admission, but denied lifelong bleeding tendency. Gynaecological examination revealed a myomatouse uterus. Occasionally, the patient had crops of erythemo-exudative skin lesion which were shown on biopsy to represent urticarial (leukocytoclastic) vasculitis. No evidence of systemic connective tissue disease was found. Haemostasis testing revealed: prolonged bleeding time, decreased platelet adhesiveness to glass beads, lowered FVIII : C, absence of ristocetin-induced platelet aggregation and unmeasurable FVIII : Af and vWf. There was no evidence for an inhibitor to FVIII : C. However, patient's plasma, when mixed ana partes equales with normal plasma, reduced the FVIII : Ag and vWf level to 48% and 46% respectively, as compared to the mixture of normal plasma and buffer. When incubated at room temperature, patient's washed platelets spontaneously released vWf and aggregated in the presence ristocetin. However, when patient's plasma was added aggregation was inhibited. On the basis of these findings and the lack of anamnestic data suggestive of congenital haemorrhagic disorder, we concluded that the patient had acquired von Willebrand disease due to an inhibitor to vWf and FVIII : Ag, associated with urticarial vasculitis and myomatouse uterus. To our knowledge, this association has not yet been reported.
...
PMID:[Acquired von Willebrand disease in a patient with urticarial vasculitis and myomatouse uterus]. 2121 30
Development of autoantibodies against coagulation factors is an uncommon bleeding disorder associated with cancer, autoimmune conditions, pregnancy, or no apparent disease. Spontaneous FVIII inhibitors are the most frequently encountered; those against FXI have been only anecdotally reported. We report a case of acquired FXI inhibitor presenting as fatal intracranial spontaneous bleeding in an elderly patient with history of cancer and previous transfusions. Few cases of acquired FXI inhibitor have been reported in association with connective tissue disease , cancer, or surgery. Bleeding includes mucocutaneous bleeding, postsurgical hemorrhage, or life-threatening events. Treatment consists of arresting the bleeding and inhibitor eradication. High degree of suspicion is essential to promptly diagnose and treat this uncommon condition.
...
PMID:Acquired Factor XI Inhibitor Presenting as Spontaneous Bilateral Subdural Hematoma in an Elderly Patient. 2543 98
| http://www.nactem.ac.uk/facta/cgi-bin/facta3.cgi?query=HUMANGGP%3A003836%7C111111%7C0%7C0%7C105933%7C0%7C10 |
Subsets and Splits