description
stringlengths 15
529
| content
stringlengths 832
20.6k
|
---|---|
SCP-3306 is a carousel amusement ride located in the Continental Ranges of the Canadian Rockies.
|
***
Item #: SCP-3306
Object Class: Euclid
Special Containment Procedures: An unassuming wooden structure, designated Site-3306, has been constructed over the area surrounding SCP-3306 to prevent its detection by passersby and satellite observation, and a secondary motorized platform has been built around the immediate circumference of SCP-3306 to ensure that researchers may comfortably communicate with 3306-POI subjects.
Televisions and other forms of entertainment may be situated on the secondary platform to promote good behavior. Any recreational material presented to 3306-POI must approved by a Level-3 researcher. Material that could potentially provoke emotional distress should be avoided.
Personnel are to refrain from influencing subjects' decisions during Illions Events.
Description: SCP-3306 is a carousel amusement ride located in the Continental Ranges of the Canadian Rockies. It is powered by anomalous means and remains in constant motion. Painted wooden panels around SCP-3306's central hub appear to depict scenes from Dante Alighieri's Divine Comedy. As of this writing, there are 44 fiberglass horses attached to SCP-3306's sweeps. Each horse bears a stylized resemblance to a previous 3306-POI subject.
When SCP-3306 was first discovered, it bore no horses, and 50 persons of interest (3306-POI, sub-designated 01 through 50) were found aboard its rotating platform. 3306-POI are unable to deboard the platform; likewise, all attempts to board the platform or physically interact with 3306-POI subjects in any way have failed. Despite their lack of access to food and water, 3306-POI remain in perfect health and do not seem to age.
3306-POI subjects claim to have been normal individuals with no connection to anomalous phenomena prior to waking up aboard SCP-3306. Foundation investigators have yet to find any evidence to disprove this.
Every year on the 17th of February, SCP-3306 will play a recording of a heavily distorted voice instructing 3306-POI subjects to vote for who they believe to be "the imposter". The subject who receives the most votes by midnight will instantly disappear, and a new horse will simultaneously manifest on SCP-3306's sweeps. Following this, another message will be played stating that subjects have chosen incorrectly. Foundation personnel may refer to this day as an Illions Event.
Currently, only six 3306-POI subjects remain. The alleged identities of these individuals are as follows:
3306-POI-04: Luke Hughes, age 25 prior to appearing aboard SCP-3306. Previously employed by the Oklahoma Tax Commission as a call center worker. Rarely participates in conversations with other subjects, but frequently requests the company of Foundation personnel.
3306-POI-11: Ronell Ashcombe, age 73 prior to appearing aboard SCP-3306. Veteran of the United States Marine Corps and widower to the late Lydia Ashcombe, who died several years after her husband's disappearance. Professes a disbelief in the existence of "the imposter" and typically abstains from annual voting unless required to in the event of a tie.
3306-POI-17: Lori-May Simmons, age 11 prior to appearing aboard SCP-3306. Born in Amarillo, Texas to then-married Cheryl Howser and Billy Simmons. Dedicates much of her time to determining the identity of "the imposter" in hopes that she may be released from SCP-3306 while her parents are still living. Has maintained an alliance with 3306-POI-28 for the past seven Illions Events.
3306-POI-28: Jeannie Kirkwood, age 43 prior to appearing aboard SCP-3306. Previously a creative director at a California-based advertising firm. Claims to know the identity of "the imposter" but refuses to explain her reasoning to anyone other than 3306-POI-17.
3306-POI-30: Craig Dalton, age 28 prior to appearing aboard SCP-3306. No prior employment. Frequently attempts to aid Foundation personnel in maintaining morale among 3306-POI subjects, with varying degrees of success.
3306-POI-33: Shelley Long, age 32 prior to appearing aboard SCP-3306. Previously a single mother from Abbotsford, British Columbia. Displayed strong maternal affection toward 3306-POI-17 during the early years of their captivity; the two remain amiable but view each other with suspicion.
The assertion that there is an imposter among 3306-POI has neither been confirmed nor refuted.
Addendum: The following files contain the most recent interviews with remaining the 3306-POI subjects.
► 3306-POI-04
▼ Accessing content. Please stand by.
[Begin Log]
Dr. Ricks: Good morning, Luke. How are you doing today?
Hughes: Fine, though Dalton's been even more desperately manic than usual lately. I think he assumes we're going to vote him out next.
Dr. Ricks: Do you agree with that assumption?
Hughes: Sort of. We have a history of voting out people simply 'cause we don't want them around for another year, and I think we're all pretty sick of Dalton's forced optimism at this point—the old man especially. But with only six people left, I think folks are really determined to make their vote count, you know?
Dr. Ricks: Yes, that's understandable.
Hughes: Right now I'm thinking it's Long. Every year she's been increasingly noncommittal when it comes to voting. Shouldn't she be more invested as time goes on? It's just weird. I think Long wants to vote for Kirkwood, but Dalton's more scared of Simmons, so Long may jump ship just so there's a majority. The old man doesn't care so he'll probably just go for Dalton. Kirkwood and Simmons, well, who knows with those two?
Dr. Ricks: I see. Now, you've struggled with feelings of hopelessness in the past. With numbers so low, have you started to consider the possibility of escape?
Hughes: Hah, not escape, per se. I've known you guys a long time, and I doubt you'll ever let me go completely. But do I think there's a chance I may get off this carousel one day? Yeah, I'm starting to feel like I've got a shot.
Dr. Ricks: I'm glad to hear that, Luke.
Hughes: Hey, do you think there's a chance… I know you probably wouldn't let me have a high-ranking position or anything, but if I ever get out of here, would it be possible for me to work for the Foundation in some capacity? Maybe just a researcher or something? I never really had a career, you know. This place is all I've ever really had. And I've watched you all long enough to be decently familiar with how you operate.
Dr. Ricks: Interesting. I'm not sure, but I can look into it for you.
Hughes: Thanks, I appreciate that.
[End Log]
► 3306-POI-11
▼ Accessing content. Please stand by.
[Begin Log]
Dr. Ricks: Hello, Mr. Ashcombe—
Ashcombe: Fuck off. I'm not doing any more of these.
Dr. Ricks: I assure you, it will only be—
Ashcombe: (Louder) I'm not doing any more of these!
Dr. Ricks: We have some new programs—
Ashcombe scoffs.
Ashcombe: I'm not watching any more shit TV. I'll tell you one more time: fuck off. It's hard enough for an old man to get any sleep with these fucking lights, and this fucking music, and no fucking bed to speak of. You people only make it worse.
Dr. Ricks: It's the middle of the day, Mr. Ashcombe.
[End Log]
Afterword: Interview terminated by Dr. Ricks after Ashcombe refused to respond for several minutes.
► 3306-POI-17
▼ Accessing content. Please stand by.
[Begin Log]
Dr. Ricks: Interview time.
Simmons sighs.
Simmons: My name is Lori-May Simmons. Despite my appearance, I'm fifty-five years old. I keep myself physically and mentally active in preparation for my eventual escape from this place. I believe there is an imposter, and I have suspicions about their identity, but I cannot divulge them at this time. There have been no notable changes in my opinions or emotional state since my previous interview. That is all.
Dr. Ricks: Like clockwork.
Simmons: Hey. What more do you want?
Dr. Ricks: I think that's sufficient. Thank you for your time.
[End Log]
► 3306-POI-28
▼ Accessing content. Please stand by.
[Begin Log]
Dr. Ricks: I have the newest season of Shark Tank for you.
Kirkwood: Good enough. I'll give you two minutes. Be warned, I talk slowly, so make your questions count.
Dr. Ricks: You claim to know the identity of the imposter mentioned in the recording. Do you have any interest in divulging that information now that only five other people remain?
Kirkwood: No.
Dr. Ricks: And why not?
Kirkwood: It's a pointless farce, really. Just like the parlor games that I assume this whole thing is based on. You can beg and plead and scream and argue, but in the end, there's no way to make someone else believe you. It's all arbitrary. If we win this game, it'll be by accident—and that's assuming it can even be won.
Dr. Ricks: Do you think it can be won?
Kirkwood: No.
Dr. Ricks: Why not?
Kirkwood: Because anyone else worth a damn got voted out a long time ago. Lori's fine, but there's no hope with just the two of us. Now, I believe that's two minutes.
[End Log]
► 3306-POI-30
▼ Accessing content. Please stand by.
[Begin Log]
Dalton: Ricks! Ricks, Ricks, pick up sticks. How are you, my friend?
Dr. Ricks: It's been a productive day, thank you. And yourself?
Dalton: Oh, doc. Doc, doc, doc. It's almost Valentine's, isn't it? You know, I had a girl once. More than one. I wasn't a very good person in my old life. Christy Bingham, Shawna Hart, Heather… I've forgotten Heather's last name. How about that? God, I'm a wretched human being. I deserve all of this.
Dr. Ricks: I'm sorry. I know it's hard for you when an Illions Event is approaching.
Dalton: Listen, I hate being such a sad sack with you, but you're the only one I can really be honest with. You've been such a good friend all these years, Dr. Ricks. I'm gonna miss talking to you.
Dr. Ricks: You believe that the others are going to vote you out?
Dalton: Hell, man. I know it! They hate me. I know I used to be kind of charming. It's how I had so many girls. It's how I stayed alive this long. But all these years… I think my mind's had it, man. I don't know how to talk to people anymore. I barely know how to think thoughts. I try to be friendly, but lately I think I've just been obnoxious.
Dalton wipes his eyes on his sleeve.
Dalton: Hey doc, can I make a request?
Dr. Ricks: Depends on the request.
Dalton: Can you talk to me after I change? Like, could you just talk to my horse?
Dr. Ricks: You believe the horses are alive?
Dalton: Yeah, man. Sometimes when you press your ear to them, and the music goes quiet between songs, you can hear them breathing and groaning. Please, Dr. Ricks. You're the only true friend I have in the world. Please don't stop talking to me.
Dr. Ricks: I think I can make arrangements for that.
Dalton: Thanks, doc. I'll really miss you. I really will.
[End Log]
► 3306-POI-33
▼ Accessing content. Please stand by.
[Begin Log]
Long: Back so soon?
Dr. Ricks: It's been six months since our last interview, ma'am.
Long: Oh.
Dr. Ricks: Anything new to report?
Long: Not really. I'm just tired.
Dr. Ricks: The next Illions event is in two weeks. How are you faring?
Long: Just fine. I'm rather indifferent, honestly. I still think it's Jeannie, but I've decided I can vote for Lori if necessary. She's had a good, full life at this point, hasn't she?
Dr. Ricks: It's not my place to say.
Long: I suppose it isn't.
[23 seconds of silence]
Dr. Ricks: Anything else you'd like to say for the record?
Long: Not really.
Dr. Ricks: I see. Thank you for your time.
[End Log]
► Event Log: Last Documented Illions Event
▼ Accessing content. Please stand by.
[Begin Log]
Ashcombe: I vote for the fairy.
Dalton: Yeah, okay. That's fine. I saw this one coming, guys.
Long: No, don't worry Craig. I'm voting Jeannie.
Kirkwood: Love you too, Shells.
Dalton: Oh. Well, I vote for her, too.
Simmons: Hold on, slow down. Why is everyone going after her? We haven't even talked about this yet.
Hughes: Lor, we've been talking about this for forty-five years. Sorry, Jeannie, but I think I'm going to vote for you.
Long: Oh! I thought I overheard you telling Dr. Ricks—
Hughes: I lied. Give me some credit, I'm not going to show my hand that easily.
Simmons: I'm against this. I just want everyone to know that.
Dalton: Who are you voting for, then?
Simmons: Forget it. It's not like it matters now, anyway.
Simmons gets up and walks around to the opposite edge of the platform.
Hughes: Jesus christ.
Long: There it is, then. Sorry, Jeannie.
Hughes: Wait. Jean, I'm willing to change my vote, but you've got to drop the whole I'm-not-telling shtick. If you know who the imposter is, or at least think you know, why not tell us?
Dalton: Not like you got anything left to lose.
Kirkwood: You don't want to know.
Ashcombe: Fuck you, bitch.
Hughes: I really think we do.
Kirkwood shrugs.
Kirkwood: Fine, then. It's all of us. We're all part of it. We're all just pieces in a game that we've forgotten we're even playing.
Long: That's the most asinine thing I've ever heard.
Kirkwood shrugs again.
Hughes: Where'd you get an idea like that from?
Kirkwood: I didn't. I'm just the only one who's remembered. I can't quite remember how it started, though. I think we—our collective self, that is—were bored. Or maybe we lost a bet. But there it is. Now you know. Keep me nice and shiny, would you?
[End Log]
Afterword: As expected, 3306-POI-28 vanished at midnight, an additional horse was added to SCP-3306, and the Illions Event concluded. The five remaining 3306-POI subjects have since suffered a decline in morale, with some questioning their own existence.
A request for additional counseling staff was approved by Site Director Goode; containment routine will otherwise continue as normal.
|
SCP-5036 is a Campbellian archetypal attractor token, taking the form of a silver Real de a ocho coin minted in the late 17th century in the Viceroyalty of New Spain.
|
***
Item #: SCP-5036
Object Class: Safe (initially presumed Neutralized)
Special Containment Procedures: Each of the eight pieces of SCP-5036 is to be kept in a separate container, each at a minimum distance of 6 meters from the others. If during a breach of containment the pieces are brought together, they must be separated during the week following the Nμ-Event; during this period the anomaly is inactive and it is safe to handle its parts.
Description:
SCP-5036
SCP-5036 is a Campbellian archetypal attractor token, taking the form of a silver Real de a ocho coin minted in the late 17th century in the Viceroyalty of New Spain. The token has been radially cut into eight segments of roughly equal size, which segments are designated SCP-5036-1 through SCP-5036-8.
No anomalous effects result from assemblages of fewer than five of the segments.
If five or more of the segments are brought within a volume of space corresponding to a sphere with a radius of 15 meters, an archetypal narrative event (Nμ) will commence, affecting individuals who are then in or who subsequently enter into the area of effect. The intensity of the event increases as more of the segments are introduced into the area.
Most individuals affected by the Nμ-event experience a psychological compulsion to adopt certain behavior and mannerisms, such as:
Assumption of an accent and speech patterns resembling those prevailing in Bristol, England and the West Country in the early 18th Century;
Unusually intense interest in maritime matters, including the use of nautical terminology to describe non-nautical subjects;
Excessive consumption of alcohol;
Fixation on the acquisition of shiny metallic or crystalline objects, even if those objects are of nominal value such as costume jewelry, bits of foil glitter or sequins, or loose change; and
Flamboyant bravado.1
Some affected individuals may also seek to change their physical appearance or apparel such as by removing their footwear, covering a healthy eye with a patch, brandishing baton-shaped objects, and simulating prostheses for missing limbs or extremities.
Other affected individuals, while not exhibiting the same behavior described above, may also adopt altered behavior so as to adopt the personas of supporting characters in the narrative.
Addendum #1:
MTF AFTER ACTION REPORT 5036-C-1
SCP Involved: SCP-5036
MTF Involved: MTF Tau-10
Date: September 19, 1995
Location: Chicago, Illinois, USA
Background: Command receives report of erratic and presumptively anomalous behavior aboard Chicago Transit Authority public bus. MTF Tau-10 is dispatched to area and ordered to observe and await further instructions.
At 08:22, MTF Tau-10 arrives on scene, disguised as road crew and firefighters. CTA bus with driver and passengers aboard is observed parked in bus lane of public road. Driver and passengers are provisionally designated CV-01 through CV-47. While maintaining minimum 50 m distance from bus per Command instructions, MTF commences the erection of "Road Closed" signs and barriers to limit further civilian exposure to possible threat. Sun glare on windows of bus inhibits observation into interior cabin of bus. Bus motor is running but passenger door is closed.
At 08:28, MTF members bring specialty optics and long range surveillance microphones on line. Command instructs MTF to continue to maintain distance from bus.
Annotated transcript of sound recording from interior of bus.
CV-01: (Middle-aged Caucasian male wearing business suit) "Dangerous shoals, these be. No more than two fathoms."
CV-02: (African-American youth) "Run aground, have we? Surely we will perish. The Royal Navy gives no quarter to scallywags such as we."
CV-03: (Middle-aged African-American woman wearing hotel maid uniform) "Avast, ye swabs. Out sweeps to starboard. We'll push our way free of these shoals."
(Various passengers hold umbrellas, canes, and in one case a baguette from a grocery bag, out of the windows on the right side of the bus and mime a pushing or rowing motion)
CV-03: "Heave! Heave, ye scurvy dogs!"
CV-04: (Elderly Asian-American woman who has apparently spotted a MTF member across the street on the left side of the bus) "Captain! Sail! Three points to larboard! Spanish colors!"
CV-03: "'Vast heaving! Crews to the larboard guns! We'll take that Spaniard a prize, or the devil have me. Broadside at the ready, fire as she bears!"
(Various passengers hold umbrellas, canes, the baguette, a bouquet of flowers and various other objects out of the windows on the left side of the bus, mime the discharge of naval guns, and shout "Bang." Command instructs MTF members to retreat 20 further meters from bus and assume prone position.)
CV-05: (Middle-aged African-American male wearing bus driver uniform) "Ha ha! A clean sweep of their decks! Will they strike their colors?"
CV-03: "Close for boarding. A sweet, fat prize, lads. All the riches of the Indies, and the pearls of Araby."
At this point, to avoid the risk of self-injury on the part of affected individuals or other civilians, MTF deploys anesthetic gas grenades, successfully disabling all individuals aboard bus. In adherence to Command instructions, while continuing to maintain distance from bus, MTF deploys miniaturized flying drones to enter bus through open windows for closer inspection. Four components of SCP-5036 (subsequently designated SCP-5036-1 through -4) are observed scattered on floor of bus, identified as potentially anomalous, and retrieved by drones for containment and further study. Civilians on bus are retrieved without further incident.
The four components of SCP-5036 that had been retrieved by the drones, after preliminary analysis, were initially determined to be non-anomalous, and SCP-5036 was then designated neutralized. Subsequently, when cataloging those components for disposal, Junior Researcher Mgbede inferred from their morphology that additional, as-yet undiscovered components might still be in the bus or on the person of individuals who had been on the bus. After this suggestion was forwarded to Command, a second sweep was performed and recovered the remaining four SCP-5036 components from CV-03's coin purse, together with a crumpled note (see Exhibit 5036-C-1-A). Analysis resumed, whereupon SCP-5036 was redesignated as Safe. The civilians who had been aboard the bus received medical clearance and were then amnesticized and released.
Addendum #2:
+ Exhibit 5036-C-1-A: Note found in coin purse of CV-03 during Incident 5036-C-1.
- Exhibit 5036-C-1-A: Note found in coin purse of CV-03 during Incident 5036-C-1.
Note found in coin purse of CV-03 during Incident 5036-C-1
Addendum #3:
Citation of Distinguished Service Medal presented to Dr. Wilbur Mgbede
The Director of Site 146, on behalf of the Foundation, takes pleasure in presenting the Distinguished Service Medal to Dr. Wilbur Mgbede, Deputy Project Leader of Nμ Archetypal Attractor Project, for conspicuous ingenuity and intrepidity at the risk of his life above and beyond the call of duty.
On June 28, 2003, a security breach occurred at Site 146. The incident involved infiltration of the site by operatives of a rival GOI which evolved into combat between the infiltrators and Foundation security forces. Due to the chaos, several hostile sapient entities also escaped Foundation containment and roamed freely within the facility, resulting in additional casualties.
When advised that the loss of the western and southern wings of Site-146 were imminent, Dr. Mgbede declined to retreat to Security Bunker 146-E with other personnel, and instead, contacted Col. Choi Too-Kwon of the Foundation Security Force to propose a novel defensive strategy and to volunteer to implement it. Following Col. Choi's approval of the plan, Dr. Mgbede gallantly and single-handedly retrieved four segments of SCP-5036 from their respective separated receptacles, suffering a gunshot wound to the foot and a mauling by an escaped containment specimen that resulted in the loss of his left arm. Following this, ignoring his own serious injuries, Dr. Mgebde intentionally attracted the attention of several enemy operatives and uncontained SCP entities so that they would pursue him, then unhesitatingly led the hostiles to his own laboratory where additional segments of SCP-5036 were temporarily stored. Once Dr. Mgbede and seventy hostiles had entered the laboratory and Col. Choi could observe by means of the security system that they had ceased belligerence,2 the security team was able to disarm and incapacitate the infiltrators and re-contain the SCP entities.
Dr. Mgbede's quick thinking and bold initiative reflect great credit upon himself, the Nμ Archetypal Attractor Project Team, and the Foundation.
Addendum #4:
Archetypal Attractor Project - Status Memorandum dated April 8, 2009 (excerpt)
To: Dr. Mortimer Hall (Administrator, Division of Applied Patapsychology)
From: Dr. Wilbur Mgbede (Nμ Project Head)
Re: Status of Reverse Engineering Initiative
I wish to report the highlights of the project team's results from the last quarter.
In accordance with your directive last year, our team has been examining SCP-5036 with a view toward reverse engineering the Campbellian archetypal attractor functionality embodied in the object. The results of this initiative have been fruitful. While we do not yet have a comprehensive model for designing and producing attractor tokens for any arbitrarily selected Campbellian archetype, we appear to have succeeded in reproducing and copying a token that duplicates SCP-5036's archetypal attraction effects.
We are proceeding with a trial-and-error program of testing the token design and manufacture process with alternative configurations. This program has indicated a number of promising leads, including the potential development of archetypal attractors for the "sidekick", "grande dowager," "artful dodger," "chooser of the chosen one" and "temptress" archetypal roles.
While none of those archetypal roles are particularly interesting in themselves, I believe that the progress to date supports the view that the allocation of resources to additional exploration in this direction is merited. The utility of developing suitable archetypal attractor capabilities to fill certain roles needed in the course of the Foundation's operations should be obvious, especially in cases where specialized training is uneconomical or where it is difficult to staff particular positions on a voluntary basis.
Respectfully,
Dr. Mgbede
Footnotes
1. It should be noted that a Nμ-event does not imbue affected individuals with any particular skills such as seamanship, navigation or personal combat. For example, when affected individuals experience a narrative episode featuring combat, they tend to engage in stage-fighting or simulated gunplay with pointed index fingers accompanied by oral sound effects.
2. Col. Choi reported that Dr. Mgbede, the enemy infiltrators, and the uncontained SCP entities had commenced singing sea shanties while engaging in a rum-drinking contest.
More by this author
Hide list
SCPs
SCP-1322
Rating: 1043
SCP-089
Rating: 726
spikebrennan's proposal
Rating: 378
SCP-1844
Rating: 362
SCP-1012
Rating: 341
SCP-1036
Rating: 322
SCP-2553
Rating: 313
SCP-1512
Rating: 296
SCP-1746
Rating: 272
SCP-908
Rating: 263
SCP-831
Rating: 240
SCP-2336
Rating: 208
SCP-955
Rating: 208
SCP-926
Rating: 190
SCP-2236
Rating: 171
SCP-920-EX
Rating: 167
SCP-2914
Rating: 157
SCP-2008-J
Rating: 150
SCP-4436
Rating: 134
SCP-4336
Rating: 127
SCP-1060
Rating: 114
Tales
Sic Transit Gloria Mundi
Rating: 207
Spring Cleaning
Rating: 132
Transcript of meeting, June 2 1972
Rating: 115
Transcript of telephone conversation, August 9, 1991
Rating: 77
Memorandum Dated 6 November 1944
Rating: 65
Scroll fragment 13Q29
Rating: 37
Stray Katz (part 1)
Rating: 34
Ad Majorem Bonum
Rating: 23
|
SCP-3085 is a grey sphere floating 1.
|
***
Item #: SCP-3085
Object Class: Keter
Special Containment Procedures: SCP-3085 is currently located in Room 1221-D at Site-55's former Humanoid Containment Wing. All entities housed in the wing have been relocated to Site-23. Access to SCP-3085 is restricted to senior researchers with Level 4 clearance and cognitohazard resistance training.
Description: SCP-3085 is a grey sphere floating 1.5m above the ground and currently measuring about 1.5m in diameter. The chamber occupied by the anomaly is white and emits a bright light from an unknown source, which will not create shadows. The aforementioned appearance of the chamber is part of the object's anomalous effect, as the room was a humanoid containment chamber prior to SCP-3085's manifestation.
In addition to its space-altering properties, SCP-3085 possesses a cognitohazardous effect upon viewing. Subjects exposed to the anomaly report a calming and soothing sensation as well as non-pessimistic existential nihilistic thoughts such as the acceptance of death, an absence of death anxiety, etc. SCP-3085 will then non-verbally communicate to those under its effects the choice in their existence; allowing them to end their life by their own decision. The effect is not compulsive and to date, only willing subjects may choose to end their life by coming into physical contact with SCP-3085.1 Physical contact with SCP-3085 by willing subjects will result in the instant cessation of all life functions, with the rapid dematerialization of the body taking place within 45 seconds.
Addendum 3085.01- Interview with affected personnel
Interviewed: Researcher Fye
Interviewer: Dr. Hewitt
Foreword: Researcher Fye was exposed to SCP-3085 and refused its offer; being the first to do so. The interview was conducted 20 minutes following exposure to the anomaly.
<Begin Log>
Hewitt: Hello, Researcher Fye. How are you feeling?
Fye: Good afternoon, Doctor. I'm doing well enough, I suppose. How about yourself?
Hewitt: Excellent, thank you. Now, I see on this testing log submitted by Lead Researcher Wilde that you volunteered to be exposed to SCP-3085. Is this correct?
Fye: Yes, Doctor.
Hewitt: And you did this being fully aware of SCP-3085's properties?
Fye: Yes, Doctor.
Hewitt: I was told you said SCP-3085 made you an offer. Can you tell me about that?
Fye: Well… I don't really know how to put it, but I'll try. Before I stepped into its room, I was a different person than who I am now. Looking at it, it just made me feel like nothing mattered; and my only choice was deciding when I could die. I knew that by touching SCP-3085 I'd be able to die by my own volition. It didn't really make me an offer, so much as just made me aware of what I said earlier.
Hewitt: I see. Why did you volunteer to interact with SCP-3085?
(There is silence for five seconds as Researcher Fye shifts in his chair.)
Fye: Well… I suppose I had been feeling 'down', as one might say. You know how it is working here, it's not exactly the cheeriest of environments. But anyway, I wasn't doing well and was starting to have really dark thoughts…
Hewitt: Were you considering suicide?
Fye: I was, yes.
Hewitt: (Taking notes) Okay. Please continue.
Fye: So as I was saying, it was getting to a point where I couldn't deal with the stress of working here, and everything in my life… The typical stuff, I guess. Then Dr. Hart had the idea that maybe SCP-3085 didn't have a compulsive effect and the D-Class we had thrown at it just wanted to get out… Heh. I can't say I blame them, to be honest. So I volunteered to test it.
Hewitt: Now, given how you were feeling prior, why didn't you accept SCP-3085's offer?
Fye: The thing is, Doctor, I had every intention of doing it. After it showed me how pointless life is, I thought there really was no point. It made sense. Everything dies eventually; you, me, all of us. We aren't asked if we want to live, we're forced into it. The only choice we have is to let this life go on or end it when we want to.
(Researcher Fye pauses, taking a deep breath.)
Fye: But then… That can't really be right, now, can it? I thought about my dog back home, and how she has brought me so much joy. Is her life meaningless? She has enriched mine, and I can only hope I'm enriching her's as well as the lives of those around me. I guess SCP-3085 is right; life is meaningless. But I figure it's up to me to give it meaning. That's why I chose to live.
Hewitt: You must love your dog a lot.
Fye: Very much so.
Hewitt: Well, that would be all for me. Thank you for your time, Researcher Fye. I'm glad you're still with us, and I'm sure your dog is too.
Fye: Not a problem. And trust me, I'm glad too. When I get home today she is going to get all the lovings in the world.
<End Log>
Note: SCP-3085 has been classified using the same designation as the (now Neutralized) entity believed to be responsible for its creation. Archived data of the original SCP-3085 is available below.
Footnotes
1. Subjects forced to come into physical contact with SCP-3085 will fall through the anomaly with no harm being done. This remains true even with subjects who stated a willingness to accept SCP-3085's offer prior to being forced into contact.
Click here to view SCP-3085-ARC.
More From This Author
More From This Author
Uncle Nicolini's Works
SCPs
SCP-4982 •
SCP-5057 •
SCP-3874 •
SCP-020-J •
SCP-ES-101-J •
SCP-654 •
SCP-5148 •
SCP-2983 •
SCP-3756 •
SCP-4176 •
SCP-3297 •
SCP-3867 •
SCP-4026 •
SCP-726-EX •
SCP-3803 •
Tales/GoI Formats
Who Wants To Live Forever? •
Critter Profile: Sandra And George! •
Project Proposal 2018-145: "a man's duty" •
GRANT REQUEST FOR THE RE-CREATION OF AN ADVANCED POSTMORTEM NEURAL PRESERVATION SYSTEM •
Fanfa •
RAISA-6147 (PENDING ASSIGNMENT) •
Adoption Poster: Darius! •
Masquerade's End •
Dr. Cimmerian Hits Reply All •
#StormSite19 •
Dark was the night, cold was the ground. •
Clef Goes To The DMV •
S&C Paper •
Seven Days With Mr. Fish •
SCP Wiki Discussion Page Simulator •
Other
uncle nicolini author page •
|
SCP-4396 is a large peacock (pavo muticus) that appears malnourished and decrepit.
|
***
Item #: SCP-4396
Keter
Image of SCP-4396 taken by a member of MTF Lambda-4.
Special Containment Procedures: Members of MTF Lambda-4 ("Birdwatchers") are to be stationed at various major population centers across the globe so as to respond to any reports of SCP-4396 or SCP-4396-1. Upon any occurrence of SCP-4396, agents are to investigate the area and discern the location of it and/or its target. Victims of SCP-4396 are to be administered either Class A or Class B amnestics as necessary.
Description: SCP-4396 is a large peacock (pavo muticus) that appears malnourished and decrepit. It is completely desaturated in color, and is missing a feather from its tail1.
The behavior of SCP-4396 is predictable, and primarily revolves around the specimen attempting to retrieve SCP-4396-1. SCP-4396-1 is a feather from the tail of a peacock that will teleport to a random person anywhere on the planet, designated as SCP-4396-A. Once it is in somebody's possession, they may only be rid of it by purposefully returning it to SCP-4396; attempting to discard, destroy, or abandon SCP-4396-1 will always result in its return to the target. SCP-4396-A share a common trend of having lost something, or someone, of significant importance to their lives.
Once SCP-4396-1 has transported to SCP-4396-A, SCP-4396 will begin moving in search of its recovery. SCP-4396 itself has only been observed to walk throughout the duration of its search, and is not known to utilize any supernatural means as it travels. However, when subjected to any conditions in which escape would be impossible for any ordinary being, such as being confined in a solid metal containment vessel or being otherwise restrained, it will inexplicably bypass any obstacles and continue on its way.
SCP-4396 will persist until it arrives at SCP-4396-A’s location, at which point it will begin to pester them into returning SCP-4396-1. SCP-4396 will act confrontational towards SCP-4396-A, engaging in attacks until the feather is returned. These attacks are typically harmless, and it is believed that the specimen does not wish to hurt the targets2. Due to the victims being unaware of the methods of appeasing SCP-4396, they often try to flee the specimen and sometimes even their place of residence, which only leads to prolonged encounters with the specimen.
If SCP-4396-1 is successfully returned by SCP-4396-A, SCP-4396 will take it in its beak. Upon doing so, it will revert to the size of a typical peacock, and its natural coloration will be restored as it interacts with SCP-4396-1. It will coo happily, and demonstrate other behaviors associated with pleasure and delight. Eventually, SCP-4396 will leave the area with SCP-4396-1 still in its beak. It is not known where SCP-4396 goes after leaving the victim, but some time later SCP-4396-1 selects a new target and the cycle repeats.
Interview Log 4396-A1
Interviewee: Clyde Bonnet, previous target who successfully delivered SCP-4396-1 to SCP-4396
Interviewer: Doctor Flynn, Foundation psychologist
Foreword: Mr. Bonnet was taken into custody after making a post on social media detailing his experience with SCP-4396. The post was taken down by Foundation staff, and Mr. Bonnet was set for an interview, prior to being administered low level amnestics.
[Begin Log]
Bonnet: Why am I here? Who are you people?
Flynn: We just want to ask you some questions about your experience with the peacock.
Bonnet: Is that what this is about?! Look, I’m not crazy I-
Flynn: Nobody ever said you were crazy, we just need to ask you a few things. Your cooperation would be much appreciated. The sooner you do, the sooner we can both get out of here.
Bonnet: Ok, fine, ok… What do you want?
Flynn: Could you please tell us about yourself, Mr. Bonnet?
Bonnet: My name is Clyde Bonnet. I am 39 years old, and I work as a geology teacher in ████ High School, ████, Oregon.
Flynn: (Takes a moment to jot down the essential details) Great. Now would you mind telling us a little about your family situation?
Bonnet: (He winces slightly, and shifts in his seat) Actually, I'd rather not.
Flynn: It’s completely fine if you aren’t comfortable divulging such information. You should know, however, that it could really help us understand the nature of this occurrence.
Bonnet: Fine, I guess. Where should I start?
Flynn: Wherever you’d prefer, Mr. Bonnet.
(There is a long pause as Mr. Bonnet composes himself)
Bonnet: I was seven years old when my parents died. One night there was a fire, and my dad grabbed me from my bed and brought me outside, to safety. He- he told me to stay, as he went back for my mom. Neither of them made it out… It’s haunted me ever since.
Flynn: (Thinks for a short moment, then writes down something on his notepad) That’s awful, I’m sorry for your loss.
Bonnet: I lived with my aunt and uncle in northern California after that, but it wasn’t really ever the same. I don't think I've ever fully recovered from it, really.
Flynn: Is that all?
Bonnet: (He hesitates, before continuing) My entire life was like this, on and off. It wasn't until 17 years ago when I experienced happiness for the first time again. I met this beautiful woman, and before long we were married.(He chuckles to himself) I guess you could say she was the world to me; I was nothing without her. (He smiles briefly, before starting to tear) It was perfect. Together we had a beautiful baby boy.
Flynn: (Writing) Thank you, Mr Bonnet. This should be enough. You’re welcome to-
Bonnet: No, there’s more…
(He starts to cry; his hand is clenched in a fist on the interview desk)
Flynn: That’s fine. You don’t have to if you don’t want to.
Bonnet: My boy, My sweet, sweet boy… He was everything I could ever ask for in a son. Smart, kind, well-behaved, he always kept his grades up. But one night he just had to go and make that stupid mistake! H- He was only 13…
Flynn: Mr. Bonnet…
Bonnet: He fell in with the wrong crowd. Some teenagers offered to drive him to a party. That night, well, he didn’t come home that night, and then on the news… A fatal car crash not too far away, and he was there, listed among the victims. Just then, that’s when that damned feather showed up.
Flynn: Oh?
Bonnet: Five people were in that car the night of the crash. Four died. My son’s body was never found. (Takes a brief pause, as he collects himself) Then that horrible, mutated thing started terrorizing me. I tried to get away, but it was relentless. I didn’t know what to do. I was trapped. I had nothing left to live for, and then there was this monster coming after me.
Flynn: Mr. Bonnet, this is some very valuable information, but-
Bonnet: I’m almost done, please just… let me finish. I finally thought to give him what he wanted. I gave him the feather, and I- I watched him transform before my eyes. I mean, I don’t know, man. His sheer joy, his happiness. I guess what I’m trying to say is, in a way, I saw myself in him. For the first time in weeks, ever since the crash, I felt… happiness? I don’t know.
Flynn: When was this?
Bonnet: This all happened two days ago. Then your guys came and picked me up yesterday, and the rest, well, you know the rest.
Flynn: Thank you for sharing this information with us, Mr. Bonnet.
Bonnet: (Sniffling) Thank you. I needed to tell someone about everything that I’ve been through. I needed this.
Flynn: (Nodding) I think this interview is just about concluded. We’ll bring you back to your chamber, and then we’ll send you on your way-
(They are interrupted by the ringing of Mr. Bonnet’s cell phone. Neither of them recognize the number)
Bonnet: It’s fine, I’ll call them back.
Flynn: No, you should take it now.
(Mr. Bonnet picks up the call. He sits there, listening, before his eyes widen and he covers his mouth.)
Bonnet: Thank you. Thank you so much officer. I don’t know what I can say… Thank God! (He hangs up)
Flynn: Who was that?
Bonnet: It was a call from the local police office. God, they found my son. My boy’s alive!
[End Log]
Addendum: Interview Log 4396-A1
Close Addendum
After the recording of Interview 4396-A1, subject Clyde Bonnet was administered B-Class amnestics and informed about the finding of his son. He was then brought to the ████ County Police Station, accompanied by Foundation staff. The officers there reported that his child was found laying unconscious on the porch of their house.
When asked about his experience, his son explained that he was injured and unable to walk after the crash, but was just able to climb out of the wreckage of the vehicle before losing consciousness. He regained consciousness sometime the following day in the forests surrounding the site of the crash, recalling being hurt and not knowing where he was, before finding a trail of feathers. The trail led him back to his house where he was soon found by law enforcement.
Footnotes
1. There is a visible gap in the tail when extended.
2. Attacks by SCP-4396 are shown to be reluctant, and are typically done out of frustration.
|
SCP-436 is a small locket, apparently made from gold.
|
***
Item #: SCP-436
Object Class: Euclid
Special Containment Procedures: SCP-436 must be closed at all times except for testing purposes. It is stored in a large, unlocked room to avoid misplacing the item. Personnel below Level 3 are not allowed to enter the room. Once per week, SCP-436 will be moved to a nearby identical chamber to allow the floor to be reconstructed.
Description: SCP-436 is a small locket, apparently made from gold. When opened, an inlaid photograph can be seen. It is unknown if the photograph is the source of SCP-436's effect, because this cannot be tested.
All measurements within a certain distance of SCP-436 will be affected by significant error. There is no observed pattern to the amount of error; it seems to constantly change, though this cannot be verified because it requires a time measurement. This issue is common to many aspects of SCP-436: the range cannot be reliably determined, the intensity of the error effect cannot be verified, and its location is often vague. It is known, however, that the error effect extends towards its own nature. To clarify, a measurement is required to learn anything about the error effect, and this measurement will have an error.
The actual dimensions of an object will be permanently affected, even after removal from SCP-436's range. Lids on containers cease to fit properly; level objects tilt, and measurement devices in particular will warp. Individuals affected by SCP-436 will have their height and weight altered, and in some cases, their personality. Ability to learn, perform calculations, and make judgments will be impaired. Medical conditions, such as [DATA EXPUNGED] and in particular, cancer, have occurred.
Long-term exposure to SCP-436 allows the alterations to accrue, eventually resulting in an often-indescribable item. Dr. ████████ possesses three samples, currently under study.
When SCP-436 is closed, the error effect apparently decreases in intensity—although, as previously mentioned, this cannot be confirmed.
Attempting to average many measurements affected by SCP-436 will not result in a more accurate measurement. Note that these are not isolated instances of the effect—the measurements simply average to a significant deviation. With multiple averages from multiple sets of trials, the result still does not gain any accuracy; it is unknown how SCP-436 produces this multi-layer effect without [REDACTED].
Addendum: When handling SCP-436, leave it in a flat, open place. We usually have trouble finding it again when personnel leave it in a container, and when we do, it's not easy to open. -Dr. ████████
|
SCP-3123 is a phenomenon that occurs in the town of Towin, CO, where individuals will be spontaneously injured after causing emotional distress, or acting in emotionally abusive patterns toward another individual.
|
***
Item #: SCP-3123
Object Class: Euclid
Special Containment Procedures: All civilians who enter the municipality of Towin are to be monitored by onsite Foundation personnel. Should civilians be exposed to SCP-3123, they are to be amnesticized, and released with an appropriate cover story.
Only personnel who have been screened for good behavior may be allowed near Towin. Any personnel working on SCP-3123 who require disciplinary action for poor conduct are to be immediately reassigned. Any attempts to provoke the inhabitants of Towin are prohibited.
Description: SCP-3123 is a phenomenon that occurs in the town of Towin, CO, where individuals will be spontaneously injured after causing emotional distress, or acting in emotionally abusive patterns toward another individual. The severity of the injury is correlated to the severity of emotional distress caused. This injury will manifest only if the distressed victim perceives a discrete individual to be responsible for their distress.
Towin has a population of roughly 4000, and is located 30 kilometers from the next nearest population center. It is surrounded on all sides by mountains, which hinder any effort to enter or leave. The inhabitants of Towin (who understand the existence of, and are affected by SCP-3123) have very little interaction with civilians outside of the municipality, as a consequence of their geographical isolation. However, Towin still managed to cultivate a reputation for being highly hospitable before containment. It is believed that this reputation is an indirect consequence of SCP-3123.
When asked about their views on the anomaly, most inhabitants note that the phenomenon has always been a part of their lives, and have not bothered to question it. When asked about why they stayed in Towin, inhabitants cited their family's history living in the town and the close-knit community.
SCP-3123 was discovered by the Foundation in 1968 when Agent DuBlon stopped to rest in Towin during a vacation road trip. During his stay, DuBlon experienced a spontaneous concussion. Unable to determine the cause of the injury, DuBlon reported the experience to the Foundation.
Addendum SCP-3123-A:
Below is a sample of logged injuries caused by SCP-3123. For the full log please contact the senior researcher in charge of SCP-3123.
Year
Name of Victim (Age)
Injury
Cause/Notes
1968
Daniel Hedler (63)
Forced removal of two teeth (both molars)
Injury occurred after Hedler offended Joshua Chubra by using a racist slur.
1973
Gabriel Ernst (32)
Broken femur
Injury occurred after Ernst insulted the recently deceased father of Tyler Brown.
1975
Heidi Yent (29)
Forced removal of the nails on both index fingers
Injury occurred after Yent made repeated comments about the weight of Erica Dutnam. Yent claimed later that this was a joke, and was not intended to offend.
1984
Danica Slentler (37)
Hair ripped from the scalp
Injury occurred after Slentler turned down Eric Tellur's invitation to join him for a movie date.
1989
Helen Terith (17)
Concussion
Injury occurred after Terith performed poorly on a test in school. When asked about the injury, Terith blamed herself.
While manifestations during experiments still occur as expected, natural manifestations have decreased since SCP-3123's observational period 34 years ago. As of this writing, approximately one manifestation a year needs treatment from Foundation medical personnel1.
Addendum SCP-3123-B: On 12/14/1989, Foundation personnel discovered a section of forest on the outskirts of Towin with slips of paper taped to some of the trees. Of the slips recovered, only 15% contained writing in a legible state. Microphones and cameras were hidden throughout the area for future surveillance. Below is a partial list of recovered slips:
I'm Alice Felucia, and I hurt my family after they did not let me go sledding with my friends. I was sick, and they were looking out for me. I apologize to all my friends and family for my wrongdoing.
I am Evan Eldebar, and I hurt my friends while we were playing. I thought they were making fun of me, however it was obvious that they were joking. I am sorry, Jeremy, Tyler and Dave. I hope you can walk again someday. I apologize to all my friends and family for my wrongdoing.
My name is Daniel Shou, and I hurt my teacher after I did poorly on a test. This was the fifth time this month this has happened. I am sorry Mrs. Delilah. I apologize to all my friends and family for my wrongdoing.
I’m Patricia Sarlo, and I hurt my parents after we got in a fight. They got mad at me, which in turn made me upset with them. So we hurt each other. And we hurt each other. And we hurt each other. And we hurt each other. I apologize to all my friends and family for my wrongdoing.
I am Tristan Dourly, and I've hurt myself every day for the past month. It felt good. I say something mean, and I get cut. I liked it. I did it a lot. I apologize to all my friends and family for my wrongdoing.
I am Winston Shou, and I hurt the entire town. But I did it because they took away my little brother. I cannot forgive them, but maybe they can forgive me. I apologize to all my friends and family for my wrongdoing.
Addendum SCP-3123-C: On 4/3/1990, Agent Tennison, stationed in Towin, reported a mass manifestation of SCP-3123. All students and teachers at the Towin elementary school received lacerations on their bodies at the same time. This occurred during the school’s annual “Field Day” event.
The following night, the cameras planted in the area described in Addendum SCP-3123-B spotted a group of three Towin inhabitants. The men carried the body of a young child, which they buried next to a tree without a slip of paper. When they finished, the men taped a slip to the tree. Microphones picked up the following conversation from the men as they dug the grave:
TI-1: It's such a damn shame.
TI-2: Would you prefer she stick around and break your leg one day?
TI-1: No, I wouldn't. But still. She's so young.
TI-2: They're always young. It's harder to pick out unstable ones when they get older.
TI-1: But have we even tried that?
TI-2: I don't know. This is just what we do. If there wasn't reason for it, don't you think we would've come up with a better idea?
TI-1: I… I guess you're right. But—
TI-3: Jimmy, I know this is your first shift, but you need to stop talking. You're slowing us down. I don't dig these graves because I enjoy it.
TI-2: Right.
TI-1: Sorry.
[silence]
TI-1: Her parents looked so calm, though.
TI-3: They always look like that.
The Foundation recovered the body, and the slip:
My name is Judy Grant, and I hurt my classmates and teachers after my class lost during field day. I really wanted to win, but I should not have gotten upset at my teammates. Hopefully, we can win next year. I apologize to all my friends and family for my wrongdoing.
Footnotes
1. Dramatically lower compared to the 478 treatments needed during the first year of containment.
|
SCP-3662 is a small cylindrical device encased in plate glass attached to a broad, flat base.
|
***
Item #: SCP-3662
Object Class: Safe
Special Containment Procedures: SCP-3662 is to be contained within a standard Safe-class containment locker. If SCP-3662 must be relocated, no personnel are to make skin contact with SCP-3662 during transit. The current SCP-3662-2 subject should be changed on a weekly basis as to not expose any individual to the Noosphere1 for an extended period of time.
Description: SCP-3662 is a small cylindrical device encased in plate glass attached to a broad, flat base. The device is clockwork in nature although the mechanisms it utilizes have yet to be reverse-engineered. Similarities between SCP-3662 and SCP-1008 are being investigated.
When a subject makes skin contact with SCP-3662, the subject, hereafter SCP-3662-1, will become increasingly fatigued. Brain functions of SCP-3662-1 will slow and, within one minute, all neural activity will cease. Upon total brain death, SCP-3662 will begin to click, hum and vibrate. SCP-3662-1's neural pathways will drastically change, and neurons will regain function. This massive restructuring causes SCP-3662-1 to believe they are the previous individual to utilize SCP-3662.
It is proposed that SCP-3662 utilizes neural mapping techniques alongside Memetic Resonance Imaging2 to build a memetic construct of SCP-3662-1 which it then stores within its data center, destroying the neural mapping of the individual in the process. SCP-3662-1's body is then injected with the most recently added non-self memetic construct (hereafter SCP-3662-2).
Analysis of SCP-3662 has shown that it stores SCP-3662-2 not as digital or physical information, but rather as an abstract meme complex3, intersecting reality only at a one-dimensional point within SCP-3662. Information compressed this way is lossless, but subjects the meme complex to other memes within the Noosphere, which may affect the quality of the restored individuals. As the human mind is highly fragile in this state4, even a short amount of time in this form can cause severe damage to the individual upon recovery. As subjects are conscious within SCP-3662, psychological effects of isolation may also compound damage to the individual.
Addendum A:
Interview Transcript
Interviewer: Dr █████
Interviewee: Laura Guerrero (occupying D-90832's vessel)
Foreword: Ms. Guerrero was an inhabitant of SCP-3662 for over a decade. Her mental faculties have degraded severely. She is capable of understanding speech and is capable of writing in a certain format, however, all traces of personality and ability to eat, sleep, see, vocalize and move any portion of the body other than the right arm have all been destroyed due to prolonged exposure to aberrant memes.
<Begin Log>
█████: Hello, Laura. Can you hear me?
Guerrero: [Writing]: "Dear Diary5, [line break] Hello! Yes, I can hear you."
█████: Excellent. Would you mind answering a few questions?
Ms Guerrero keeps her pen hovering above the paper.
█████: I'll take that as a yes. Why were you within the object?
Guerrero: "I don't understand you sometimes, Diary. What do you mean by object? Do you mean the clock, the one that the sad man pressed against my forehead?"
█████: I do, yes. Tell me about the sad man.
Guerrero: "I knew the sad man. I saw him around the town all the time. His eyes were always droopy and sad, like he was always about to cry. He would never talk to people unless he had to. My Papa said that his daughter was very, very sick. So sick that she would probably never get better."
█████: And what did this person do?
Guerrero: "I remember one day he was actually crying. He said that I reminded him of his daughter and that I would get along with her. After that, he pressed a clock to my forehead."
█████: And what then?
Guerrero: "I got very tired but once I was just about to fall asleep I woke up. The first thing I felt was being washed away. Like my skin was being pulled apart and all the little bits would go flying off into the wind. "
█████: What was it like in there? In the clock?
Guerrero: [Brief hesistation] "It was lonely. There's nobody else in there and it's very dark. All the time you have this feeling like you're losing parts of yourself. It's a whole other world in there, Diary. It's always black but there's little… jellyfish-people. They glow and blob around unless you get too close, then they try to take away bits of you like an arm or a leg. [Uses right arm to point to other appendages] I got close a couple times."
Guerrero: "I was always running around, looking for a way out or for an adult to help me. Eventually, I gave up. There's no adults in there and there's no way out in there. I just [pause] sat down and cried until the jellies showed up. I didn't know what else to do."
Guerrero: "Sometimes, I'd have time to look up at the sky. A starfish, a big bird, and a monster are all up there. I remember when Papa and I would get the telescope out from the shed and go up the little hill and see the constt konstt stars. [hesitation] Can I see Papa again soon?"
█████: [Quietly, to colleagues] Do we tell her? [pause] well it's just that, to them, Laura only went missing for a few weeks? It's not like we can arrange a– [pause] Alright, fine.
█████: Uh, Laura? Your family is fine. They… they can't see you right now. We're working really hard to find a way to get them to see you.
Guerrero: "I wanna see them."
█████: We know, Laura.
<End Log>
Addendum B: A newspaper clipping detailing Guerrero's disappearance.
[+] Transcript
[–] Transcript
March 1st, 1964
Town Hero Saves Lost Girl
Mr. Light, our very own electrician and town repairman, has recently been crowned as the local hero of ██████████! After the safe return of Laura to her family, there's not enough time in the day to say how thankful we are.
Laura Guerrero, 7, (pictured) was recently kidnapped. It goes without saying that the Guerrero family was shocked to slowly come to the realization that Laura would not be returning from school that fateful February 9th. No ransom notice was given. Even with police investigation, no leads were found to Guerrero's whereabouts.
Laura was escorted to school, as usual. She was present on the register, as usual. When the home bell rang, Laura didn't return home. Laura says she has no memory of the event. The only thing about the whole ordeal she remembers clearly is that Mr. Light was the one who found and saved her from her captors. Psychologists say she's repressed the memories and there's no telling what horrors she experienced. Guerrero's family also note that Laura has been acting more meek and timid than before, which the psychologists have called a symptom of her stress. Hopefully, in time, Laura will return to her vibrant, playful self.
After two weeks of little Laura's disappearance, the Guerrero family had given up hope. We can only imagine the despair and grief they would have experienced in that troubling time.
Seemingly out of nowhere, Mr. Light came to the Guerrero household with, cradled in his arms, the delicate form of little Laura. He states that he heard some hushed voices and muffled cries for help in the night, grabbed his rifle and went to investigate. There, he saw the group of absolutely vile kidnappers and took action: firing with accuracy and grace causing her captors to flee, leaving Laura behind.
But, as God giveth, God taketh away. The price for one child's life seems to have been paid with the blood of another: Mr. Light's own daughter. Emily has recently passed away. The Guerrero family have paid Mr. Light's funeral expenses in full, and the town has raised a fund to serve as both a symbol of our gratitude and our condolences. We, the writers at the █████ ████████ ██████, have chipped in $100 and encourage you to do the same.
Emily was sickly from birth. She had a congenital condition called hemophilia, a disease with no known cure. The lifespans of these individuals are severely reduced. Children are bed-ridden and adults much watch themselves carefully. It's a cruel twist of fate that a brave person like Mr. Light has to burden such grief; if Emily's body were normal, she would still be alive today. I'm sure that she's smiling down on our little town from the heavens.
Luckily, things are going well for Mr. Light, all things considered. Laura often visits her hero and Mr. Light has taken a paternal role for Laura. While life may never return to normal for these two, we can only wish them the best. Here's to Mr. Light and Guerrero family for their acts of bravery and kindness beyond the call of duty.
Footnotes
1. The sphere of human thought.
2. Colloquially known as MemRI
3. Deployment of MTF Omega-0 ("Ará Orún") for investigative purposes is currently pending approval.
4. This is due to the complete removal of the brain's ability to filter out any incoming memes.
5. Among Ms Guerrero's possessions was a well-documented diary. It is proposed that Ms Guerrero used the diary format as a coping mechanism while within SCP-3662.
« SCP-3095 | TEAM BIRD | SCP-3296 »
|
SCP-3992 is a number of children's Halloween face masks.
|
***
Item #: SCP-3992
SCP-3992-4.
Object Class: Safe
Special Containment procedures: All instances of SCP-3992 are to be kept in a standard containment locker at Site-17.
Description: SCP-3992 is a number of children's Halloween face masks. Instances come in a range of designs, portraying various Halloween themed monsters. Instances are constructed out of simple plastic materials, paint and string. Each instance bears a label reading "Wondertainment Whacky Halloween Fun Masks" on their interior.
SCP-3992 instances do not display any anomalous properties when worn by a non-anomalous individual. However, when worn by an anomalous entity, it will appear to physically change into an adolescent humanoid of varying appearance. Any clothing worn by the wearer will appear to change into a costume fitting the SCP-3992 instance's appearance. Clothing will simply appear to manifest on entities not wearing anything.
To clarify, anomalous entities who wear an instance of SCP-3992 do not actually experience a physical change in appearance, but rather appear to become humanoid. Changes in an entity's appearance and manifested clothing cannot be physically felt, and affected entities may continue to function and interact with their surroundings as normal. This effect will cease when the SCP-3992 instance is removed. The physical appearance gained by wearers of SCP-3992 instances differ significantly in bodily features, including skin tone, skin color, size and gender.
Discovery Log: SCP-3992 was discovered on 24/██/20██, in a house in ██████, Wisconsin, United States. The house had been seized by the Foundation under suspicion of anomalous activity originating from it. Among SCP-3992, several other anomalous items were found, a majority of which were of Wondertainment origin. The previous residents of the house were found to have fled the area and remain unfound. SCP-3992 was located in a cardboard box in the house's attic among several Halloween decorations. As of note, the name 'Stanley' was found written on the inside of SCP-3992-6 (vampire mask). Records show a child by the same name to have been one of the houses previous residents.
The following document was found along with SCP-3992:
To our most loyal of customers during this most spooky of seasons,
We at Doctor Wondertainment would like to give to you a very special gift in accordance with the holidays. For your continued loyalty over the years, we would like to present a very special treat to those of you who might find it rather difficult to fit in.
We at Wondertainment believe in embracing what others may consider strange and spooky. There are too many wonders in this world locked away by those who just don't understand, or find the abnormal too scary. We know first hand that it can be troublesome accepting who you are, especially in a world of the mundane, so we come with wonderful news, that for just one night, you may go out and celebrate the strange and the scary without worry of what others may think of you!
For our customers out there who struggle with these feelings on a daily basis, we have decided to give you a special free of charge reward this Halloween! A little something to show our gratitude for your continued support. In this box, you will find a complete set of our new Wondertainment Whacky Halloween Fun Masks!. Celebrate this Halloween with a costume so amazingly convincing you won’t even be able to recognize yourself!
Have fun out there kids! Try not to wander into any dark forests while trick or treating!
And if you run into a headless fellow along the way, give him a good hello from us at Dr. Wondertainment! We miss you a lot old friend! We hope you’re being taken good care of.
- Dr. Wondertainment.
Addendum 3992-1: Testing of SCP-3992 on several other SCP objects was suggested as a means of discovering the range of its effects when used on anomalous entities of varying physical nature. Approval of various SCP objects for testing was authorized.
Access Testing Log
Close
Test: 3992-1-002
Subject: SCP-2006 (Taking the form of the Creature from the Haunted Sea)
SCP-3992 Instance: SCP-3992-1 (Werewolf mask)
Results: SCP-2006 appeared as an adolescent male humanoid wearing a torn plaid shirt and jeans. A pair of rubber gloves resembling clawed hands with grey fur appeared on SCP-2006’s hands.
Notes: SCP-2006 was asked to change its physical appearance during the test in order to see how the effects of SCP-3992 would react to SCP-2006's shape-changing abilities. Several changes to SCP-2006's size, skin tone and hair occurred but remained humanoid.
SCP-2006 initially refused to remove SCP-3992-1 at first, but eventually complied once researchers assured it that it was nowhere near as scary as its previous form.
Test: 3992-2-001
Subject: SCP-2662
SCP-3992 Instance: SCP-3992-2 (Witch mask)
Results: SCP-2662 took the form of an adolescent female. SCP-2662 appeared dressed in a black spider web themed witch costume, complete with a pointed witch hat and holding a broomstick (which disappeared along with the perceived effects of SCP-3992-2 when removed). To note is SCP-2662's appearance as a female rather than male. This is believed to have occurred due to SCP-3992-2 resembling a generic female witch.
Notes: SCP-2662 commented on the whole physical change to be ‘Rather uncomfortable’. SCP-2662 later assured that what it had stated previously was not meant in any way to come off as disrespectful or insensitive, stating it had nothing against females and that they could be cultists if they desired.
Test: 3992-3-001
Subject: SCP-1279-1
SCP-3992 Instance: SCP-3992-3 (Frankenstein's monster mask)
Results: Instance of SCP-1279-1 appeared as a human male covered in green body paint, wearing a Frankenstein's monster costume consisting of a black shirt and pants, torn grey coat and boots, with a pair of metal bolts protruding from its neck. Instance appeared standing upright on its perceived legs.
Upon removal of SCP-1279 from the instance, SCP-3992-3's effects ceased
Notes: Interesting, 3992 must perceive 1279-1 as anomalous as long as it wears 1279. This may be the case when testing with other similar anomalies.
Test: 3992-4-004
Subject: SCP-2980-1
SCP-3992 Instance: SCP-3992-4 (Devil mask)
Results: SCP-2980-1's physical age did not change. All abnormal features and body parts of SCP-2980-1 appeared to be replaced with pieces of costume clothing, including a fake red tail and a pair of boots resembling cloven feet. SCP-2980-1 took the form of a human male of unknown race, coated in red body paint.
Notes: SCP-2980-1 commented on the effects of SCP-3992-4 to be rather humorous, but was 'Nothing compared to the real thing'.
SCP-2980-1 later claimed to recognize the name ‘Wondertainment’. When questioned, SCP-2980-1 stated that the name bared a striking resemblance to that of a cousin's ‘three times removed’. SCP-2980-1 did not give any other useful information.
Test: 3992-5-003
Subject: SCP-2287
SCP-3992 Instance: SCP-3992-5 (Mummy mask)
Results: SCP-2287 appeared no longer headless. SCP-2287 appeared as a bald human male. A pair of green pupils were visible through SCP-3992-5’s eyeholes. Inspection showed its 'Mister' tattoo to no longer be present. No physical changes were present in the rest of SCP-2287’s body as it had no other physical abnormalities. SCP-2287’s clothing was replaced by layers of yellow tinted linen cloth, wrapped around its entire body similar to an Egyptian mummy.
Notes: Of significant note, SCP-2287’s anomalous properties ceased functioning while wearing SCP-3992-5. Whether this is due to it being a Wondertainment product is unknown.
SCP-2287 commented on finding the mask fun to wear, saying that it was 'Nice to see what it was like from the other end'. SCP-2287 later asked if it were possible to wear SCP-3992-5 again at some point (Decision currently pending. The effects of SCP-3992 may prove useful for the containment of SCP-2287’s anomalous properties).
Test: 3992-6-009
Subject: SCP-956
SCP-3992 Instance: SCP-3992-6 (Vampire mask)
Results: SCP-956 appeared as an adolescent Caucasian female with long pink hair. Costume consisted of a black cape and pants and red velvet waistcoat.
Notes: SCP-956 initially showed no signs of bodily movement, remaining in its passive state. However, after several seconds, SCP-956 visibly looked down at itself and began heavily retching. SCP-956 attempted to remove SCP-3992-6 with its perceived hands. When this failed, SCP-956 began clawing at SCP-3992-6 violently until it was removed by an assisting D-class.
Addendum 3992-2: On the 29/09/20██, a package was found outside of Site-17, addressed to the Foundation. Inside were a second set of SCP-3992. Instances consisted of a skeleton, jack o'lantern, banshee, zombie and clown.
The following note was included:
To the SCP Foundation,
We see that you’ve been playing around with our product and approve of it greatly! It’s nice to see you giving others a taste of the Holidays and we hope you’re having fun with them yourselves!
As a sign of gratitude for your vigorous testing of so many of our products, we present to you the newest batch of Wondertainment Wacky Halloween Fun Masks!. The following set has not been officially released just yet, but we’re hoping to get them out soon enough!
We hope you'll share these with a few more of your guests and get some top-notch results!
With all honesty though, we make these products because many don’t get the chance to experience a proper childhood, or even celebrate such a unique time of year. So during that magical time when the mundane blend with the uncanny, we want to celebrate it right and give a little more.
Cause that’s what it’s all about, right?
- Yours, Dr. Wondertainment
|
SCP-3983 is a cave, the entrance of which is approximately 10,800 meters below the surface of the southern Pacific Ocean, in the Horizon Deep of the Tonga Trench.
|
***
Item#: 3983
Level3
Containment Class:
safe
Secondary Class:
none
Disruption Class:
dark
Risk Class:
notice
link to memo
Entrance to SCP-3983 central cavern. Note flash of light produced by SCP-3983-03 disappearance.
Special Containment Procedures: Due to its remote location, physical containment of SCP-3983 is unnecessary. Oceanic survey organizations will be monitored by Naval Task Force Sigma-58 “Bottomfeeders” for indication of any planned expeditions near SCP-3983's location.
Description: SCP-3983 is a cave, the entrance of which is approximately 10,800 meters below the surface of the southern Pacific Ocean, in the Horizon Deep of the Tonga Trench. SCP-3983 was initially discovered by the crew of a manned NOAA expedition. Administrative reports of its discovery were flagged by Foundation webcrawlers, whereupon amnestics were distributed to exposed individuals, and jurisdiction of SCP-3983 was transferred to the Foundation.
The cave entrance is a narrow crack in the trench wall roughly 2.5 meters wide at its widest point. Within, a passage extends into the rock, gradually angling upward at an average elevation of 12° for approximately 200 meters. At this point, the passage terminates, and enters an air-filled chamber roughly 75 meters wide.
At the center of this chamber is a dais, made of stone bricks, rising 1 meter from the ground and roughly 15 meters in diameter. The left and right walls of the chamber are decorated with complex high-relief sculptures, seemingly carved directly from the rock of the cave wall.
The left scene depicts a thin humanoid figure, draped in rags. Across this figure's shoulders is slung a large admiralty-pattern anchor, roughly as long as the figure is tall (≈3 meters), with angular flukes. The figure is slightly hunched, presumably due to the weight of the implement it bears. Its face is obscured by a hooded cowl. The area around this central figure is carved into simple swirling patterns, likely depicting the presence of wind or ocean waves. An as-yet undecipherable inscription in rongorongo glyphs is carved into the wall above the relief. This piece is designated SCP-3983-01.
The right scene is highly complex and detailed. It consists of an array of biological structures, however its specific form is difficult to determine. Distinct elements include tentacles, crustacean claws, insect legs, barnacles, coral, antlers, and what appear to be portions of the human skeleton, including spines, limbs, and skulls. These elements are presented apparently at random, and while there is a suggestion of a central mass of some kind, its specific makeup is unclear. An inscription in Akkadian cuneiform above the relief reads "SHE WHO BIRTHS AND DEVOURS ALL, WHO SOWS AND HARVESTS, WHO GRANTS SICKNESS AND HEALTH. SHE WHO IS WITHOUT REST." This piece is designated SCP-3983-02.
The rear wall of the chamber is obscured, due to the presence of a mound of human corpses, piled to the height of the ceiling (≈7 meters). These corpses exhibit varying degrees of decomposition; some show no outward signs of decay, others are essentially skeletal.
Once each day, at a time roughly coinciding with sunrise respective to the surface above the Horizon Deep, one corpse will spontaneously animate and extricate itself from the pile, whereupon it is designated SCP-3983-03. This occasionally takes a significant amount of time, dependent upon the location of the corpse within the pile. Once separate from the pile, the corpse will stand, and ascend the steps to the stone dais to stand in the center. If the SCP-3983-03 instance does not have functioning legs, it will crawl and attain as upright a posture as possible.
Once in the center of the dais, the corpse will speak. The content of this speech is always intelligible, even if the corpse in question possesses no vocal cords or tongue.
Upon the completion of its statement, the corpse will vanish, whereupon one of the two sculptures will exhibit a physical reaction. Foundation autonomous naval observation drone (ANOD) 06 captured several instances of this event; example transcripts follow.
Date
Description of Subject
Content of Speech
Results
04 April, 2010
Overweight female, significant putrefaction evident. Scarring present on subject's abdomen and upper extremities.
“All my life, I worked hard. I never stopped working. I let myself be fucked by a bastard, and I bore his children. And I loved them. I loved them and I raised them the best I could, but I didn't have any help. And it weighed. I lost my way. In the end, I didn't love them enough, didn't try hard enough. And I fell trying to seek relief. I failed. And I won't do it again. I choose to make use of myself. I accept the burden.”
Subject vanishes, producing a flash of blue light. A significant amount of condensation gathers on SCP-3983-01's surface, and runs to the chamber floor in rivulets.
13 May, 2010
Tall, thin male. Little evidence of decomposition save for a paleness of the skin.
“I did not choose my vocation to squander my own existence. My allegiance is to life, and its perpetuation. I have sewn flesh, set bones, and cured ailments. I am not prepared to allow us to fall into stagnation. We have to be strong, and healthy, even if that means we have to accept terrible changes. I am not a coward, and I will not submit. I choose to fight forever. I will never rest.”
Subject vanishes, producing a flash of green light. Vines superficially resembling Virginia creeper (Parthenocissus quinquefolia) sprout from SCP-3983-02's surface, then rapidly decompose and crumble.
08 July, 2010
Tall, broad-shouldered male. Mild decomposition. Multiple tattoos across upper arms and chest.
“Fuck that. I never let anyone walk on me, ever. I'm not getting brought into another stupid fucker gang of pussies just out to make trouble for everyone else. I had my fun. It's time for me to do the right thing for once, like my mama wanted. Not wasting this shot. Not this time. I'm the strongest bastard ever born, and you're gonna love me. Get ready, bitches. Manny Marquez accepts the burden.”
Subject vanishes, producing a flash of blue light accompanied by a sound similar to the cry of the king vulture (Sarcoramphus papa). SCP-3983-01's posture changes slightly, adjusting its anchor to stand more upright.
02 June, 2010
Short female, specific characteristics difficult to determine due to advanced decomposition. Subject estimated to have been dead no less than one year.
“I was never anything. I only knew pain and hatred. I want a chance. I will give back what was given to me. I will never rest.”
Subject vanishes, producing a flash of green light. Blood manifests and collects across SCP-3983-02's surface, gradually congealing and drying.
17 July, 2010
Small skeleton, presumed to be the remains of a child aged 5-6.
None. Subject stands in the center of the dais and emits no sound, holding its arms close to its ribcage and shivering.
First instance of overt animation from SCP-3983-01 and SCP-3983-02. SCP-3983-02 extends a tentacle toward subject. SCP-3983-01 quickly dislodges from its recess, and advances upon the dais. SCP-3983-01 swings its anchor into SCP-3983-02's tentacle, shattering it into pieces. A roaring sound approximately 140 dB in volume is heard, rattling the chamber and causing ANOD-06's microphones to temporarily cut out. SCP-3983-01 stands between subject and SCP-3983-02, slamming its anchor head-down upon the surface of the platform. No activity for 46 seconds, whereupon subject vanishes, producing a flash of blue light. SCP-3983-01 raises an arm and points at SCP-3983-02 for a short period of time, before shouldering its weapon and placing itself back into its recess, in identical configuration as before.
27 November, 2010
Short male, advanced decomposition. Significant damage evident, including lacerations upon its abdomen and limbs and multiple broken ribs.
“I will make my own way.”
See Incident Report 3983-01.
+Incident Report 3983-01
- Close
Transcript of camera feed captured by ANOD-06 during SCP-3983-03 event dated 27 November 2010.
SCP-3983-03: I will make my own way.
(A region of space upon the dais approximately 1 meter behind SCP-3983-03 erupts in an explosion, which generates a significant amount of light, heat, sound, and smoke. From this emerges a figure, tentatively designated SCP-3983-04. Figure is an indistinct, shadowy humanoid adopting the rough shape of a large, overweight human male wearing a billed hat. SCP-3983-04 constantly emits an amount of dense black smoke from its body, and dull orange lights can be seen in locations corresponding to its eyes and mouth. SCP-3983-04 puts an arm around SCP-3983-03's shoulders.)
SCP-3983-04: Hot damn! I know that's right, little buddy! I hear ya, loud and clear!
(SCP-3983-04 moves around to SCP-3983-03's front, kneels to its eye level, and places its hands on SCP-3983-03's shoulders.)
SCP-3983-04: Loud and clear, partner. You don't want any a' this shit. Complicated. You wanna get the hell back on that open road and let the throttle out wide. You wanna hear the thunder of your own engine. You ain't got no quit in ya! That right?
(SCP-3983-03 nods. SCP-3983-04 snorts and removes what appears to be the silhouette of a cigar from its mouth, issuing a gout of smoke.)
SCP-3983-04: Yer goddamn tootin'! Who wants to posse up with these drippy bastards anyhow? One of 'em's a damn sadsack and the other's just a big ol' creepy-crawly askin' for a rolled-up newspaper! Who the hell needs 'em! You wanna ride? You wanna feel the heat? Move under yer own steam? You ready to tear up the road and fly apart with me?
(SCP-3983-03 nods.)
SCP-3983-04: Hell! Fuckin'! Yes! You and me, partner! We're gonna eat asphalt and shit glory! We'll show these sons-a-bitches what it means to be free! Let's ride! YEEEEEEEEHAAAAAAA-
(SCP-3983-04 explodes. Neither SCP-3983-04 nor SCP-3983-03 can be seen upon the smoke's dissipation.)
Investigation is currently underway to determine the significance of these events. A sortie to establish meaningful contact with SCP-3899 has been initiated to determine the extent of its involvement.
More From This Author
More From This Author
CadaverCommander's Works
SCPs
SCP-3396 •
SCP-3896 •
SCP-3988 •
SCP-3894 •
SCP-4333 •
SCP-4233 •
SCP-3897 •
SCP-3899 •
SCP-3889 •
SCP-5902 •
SCP-3982 •
SCP-1233 •
SCP-3893 •
SCP-4449 •
SCP-3895 •
Tales/GoI Formats
Joey Fucknuts Builds a Flying Machine •
The Shape of a Gun •
Joey Fucknuts Believes In Himself •
Joey Fucknuts Takes to the Skies •
Joey Makes a New Friend •
Other
CadaverCommander's Mobile Assault Necropolis •
|
SCP-996 is a sheet of sheer gray fabric.
|
***
Item #: SCP-996
Object Class: Euclid
Special Containment Procedures: SCP-996 is to be stretched to a 1 meter by 1 meter square sheet. It is held in place by four clamps on the corners and mounted on a frame. The assembly is locked in storage under standard security.
Description: SCP-996 is a sheet of sheer gray fabric. Under no stress, it takes the shape of a circle with a 0.5 meter diameter. The fabric seems to be infinitely elastic, as it will stretch under small amounts of force, and large amounts fail to rupture it. Attempts to puncture SCP-996 result in it deforming around the puncture implement. Shear forces will cause elastic deformation, but do not tear the material. Thus, SCP-996 seems to be topologically ideal.
SCP-996 has a thickness, volume, and mass of zero. The fabric can intersect itself: when folded, the two halves pass through one another. Microscopes show images similar to the macroscopic sheet; no additional detail is revealed. Despite an infinitely thin thickness, the material is not sharp and bends harmlessly at a touch.
Experiment Log 996-Mkf
Date: ██-██-██
Procedure: SCP-996 given to D-class. D-class instructed to interact with the fabric as he wished.
Results: D-class experimented with SCP-996, quickly discovering the self-intersection property. Repeated folding, stretching, and manipulation resulted in a tangle around D-class's hands. D-class attempted to remove hands and was successful, then pulled on two edges of SCP-996 to straighten it.
SCP-996 seemed to have manifested a distorted "knot" in the fabric, and despite self-intersection properties, would not come undone. D-class examined the knot, but could not discern its structure.
D-class generated three more knots through similar procedures. D-class attempted to undo the knots by hand, but only succeeded in tangling the fabric once more. After much poorly-understood interaction, [DATA EXPUNGED] believed to be an area of negative volume. D-class extracted hands successfully, but claimed that it "gave [him] a headache". Subject reached into area of negative volume and removed SCP-996. Area reverted to normal. [Footage is being studied to understand the spatial anomaly.]
Intermediate interview:
Dr. L███: What was that…incident, like?
D-class: Hell if I know. It's like…I think the sheet thing was round. Huh, it didn't have a shape, but…it, like, opened when I folded it one way. [EXPLETIVE REDACTED]…
Dr. L███: Do you understand the knots?
D-class: I think I broke it.
D-class instructed to continue interaction. Another knot was quickly generated, followed by a complex fold that joined two knots. Pulling on the sides revealed that a tube had formed between two points on the fabric, defying current understanding of topology. D-class inserted hand into tube and became tangled again. D-class requested assistance.
Dr. L███ arrived and extricated D-class's arm. Arm ended at the wrist; palm and fingers are absent. SCP-996 reverted to regular shape, lacking knots.
Test Log Addendum: D-class terminated on schedule. After several more tests, one well-preserved hand was retrieved from an area of negative volume. DNA tests confirm that it belonged to the terminated D-class.
Note: We still don't know how to recreate any of the impossible knots or phenomena. Further testing will be more controlled—until then, no one is allowed to touch it. - Dr. L███
|
SCP-1518 is a 1.
|
***
Item #: SCP-1518
Object Class: Keter
Special Containment Procedures: SCP-1518 is housed in a humidity-controlled vault within the underground sector of Site-117. The vault is 10m x 5m x 10m, constructed of concrete and lined with industrial foam. SCP-1518 itself is contained in a 1.5m x 2m x 1.5m cylindrical shell constructed of the same industrial foam. The shell is 30cm thick and composed of 2 equally sized pieces divided by a vertical seam. Said seam is hinged to allow the shell to open for necessary rotation and maintenance due to the damage caused by SCP-1518-1. The vault contains 4 additional shells for the purposes of rotation; these shells are to be kept open when not in use for inspection. All 5 shells are suspended from the ceiling by the mechanical assembly used for rotation.
At three hour intervals, personnel monitoring SCP-1518 are to remotely rotate the shells, using fans to force SCP-1518-1 released during the rotation into the foam-lined walls. Afterwards, 1 D-Class personnel equipped with a foam spray canister is to enter the vault and repair any damage inflicted to the interior of the previous shell. Should SCP-1518 breach its current shell, rotation and maintenance must occur immediately, and the schedule will be adjusted accordingly. Once every 24 hours, 2 Level 3 personnel are to enter the chamber and inspect the integrity of the shells.
In light of Incident-SCP-1518-B3, the vault containing SCP-1518 is to be further soundproofed, auditory surveillance to be disabled, and personnel used in maintenance are to be outfitted with ear protection.
No water lines or systems may exist within 10m of the vault. SCP-1518 must not be exposed to rain, and must not be transferred across bodies of water under any circumstances.
Description: SCP-1518 is a 1.1m x 1.8m x 1.1m nonfunctional limestone fountain. It does not appear to possess any power source or external operational controls. The fountain is filled with a liquid superficially resembling water. This liquid does not evaporate and appears to be irremovable from the artifact; it is unknown what mechanism holds the substance in place, but it does not spill if the fountain is disturbed or even inverted. Any solid or liquid matter exposed to the liquid (other than SCP-1518 itself) will instantly sublimate or evaporate, respectively.
SCP-1518 sporadically releases bubbles (SCP-1518-1) of variable size. SCP-1518-1 behave largely identical to non-anomalous bubbles, but have not been observed to rupture in any circumstances. After emission, SCP-1518-1 will slowly float away from SCP-1518 until they come into contact with solid or liquid matter (other than SCP-1518 itself and the liquid contained within, as the bubbles appear to "bounce off" of these substances). No adverse effects have been observed from SCP-1518-1's interaction with gaseous matter.
SCP-1518-1 have a mutually destructive reaction with solid matter. The exposed bubble will reduce in size until it ceases to exist and destroy an amount of solid matter equal to the volume lost (the mass and density of the substance is irrelevant to this reaction). No trace of the bubble or destroyed matter remains.
SCP-1518-1 will assimilate all liquid matter they are exposed to and increase in size by an amount equal to the volume of the matter assimilated. Due to this, exposure to rain or atmosphere with significant humidity is typically disastrous. Additionally, the high liquid content of living biological matter generally results in the death of exposed organisms. Presently, it is believed that the contact of even 1 bubble with an oceanic body of water is likely to induce an XK-Class End-of-the-World Scenario.
SCP-1518 was discovered in [REDACTED], Bosnia, in 199█. The area in question was presently involved in systematic ethnic cleansing due to the ongoing Bosnian Civil War; a cleansing event causing ███ fatalities had occurred only 10 days prior to the initial rumors regarding the artifact. The primary informant was █████ ██████████, a member of a death squad hired to carry out said cleansing event. The other 14 members of the squad were killed by anomalous behavior associated with SCP-1518. Shortly after the artifact was retrieved, light rain occurred in the area, causing significant damage and killing the recovery team. The secondary team was successful in retrieval, and the artifact was transferred to Site-117. ██████████ committed suicide shortly after his initial contact with the Foundation, though his personal effects were recovered, among which was a journal.
Foundation linguists have provided the most direct English translation of the recovered materials.
██/██/199█, Entry ██
Received a message from █████ today, requesting our services in [REDACTED]. I knew that the place had a severe infestation, and was honestly surprised we did not hear from there sooner. He even offered accommodations for a few nights. The others cried in joy when I told them. A bed alone was uncommon. A full room with food, alcohol and a bathroom was a miracle.
██/██/199█, Entry ██
Arrival was simple, █████ greeted us and took us to his estate. A beautiful place, with many things crafted out of marble, granite, sandstone. He treated us to lunch and told us where to find the "problem areas." He had a little place set up on his balcony with binoculars and a telescope: apparently he wanted to watch tomorrow.
██/██/199█, Entry ██
Preliminary sterilization without incident. Males are cleaned, females and minors held on the first floor of the estate. Do not know why the others kept the minors too. Normally they would be cleaned with the males. █████ gave no complaint: he seems to be enjoying everything.
██/██/199█, Entry ██
Sterilization is not a point of joy or satisfaction. It is a job. A duty. I am not deaf to the world. We are monsters. Murderers of innocent families and children. The world feigns to care. It did not lament those suffering in my country until we killed them. It did not lament my wife when she died, or my children when they died. I do not humor the world and its "righteousness."
The others are not like me. They laugh and jeer. They take prizes in flesh. Today they took their prize from not only the females, but the minors as well. When they were done, they threw the minors into the river, and would not kill the females until every minor had drowned. █████ clapped and hollered from his balcony. I returned to my room, considering my alcohol and gun for two hours. The latter I consider every night. There is no justice. No righteousness.
██/██/199█, Entry ██
The sound of the females and minors plagued my drunken dreams. I awoke after only a few hours. The night was silent. I thought it strange, for the others would surely still be celebrating. Then I noticed it out my window. Rain. Rain falling upwards. I thought it a dream or drunken illusion, but something told me I was awake.
I left my room to explore the mansion. I saw no one. I heard nothing. My hands trembled on my gun. Why I brought it, I do not know. What use could it be?
I came outside, to the courtyard. I saw the others, drifting in the air. Was it air or water? Their hair and clothes drifted like they were underwater. Then I saw █████. He was standing inside one of his sculpted fountains. No, not standing. He was sinking. █████ was sinking into water that could not be more than a few inches deep. He made no noise, word or gesture. He did not notice me, nor did any of the others. Their eyes were wide and staring to things I could not see. Things I did not want to see. After █████ sank into the fountain and disappeared, the others followed, one by one.
Then they were all gone. The rain stopped. The silence ended. I could hear the wind.
I was chosen to survive and witness. That is my duty. There is justice, and it is unforgiving. There is righteousness, and it is terrible. The water is hateful.
Addendum [1518-001]: Incident Report SCP-1518-B3
On ██/██/████, at 5:05 AM, SCP-1518 began to emit noise inconsistent with previous behavior. This sound was only partially muffled by the foam surrounding SCP-1518, and was detected by the vault's auditory surveillance, exposing Agent █████ to the phenomenon. █████ subsequently opened the shell surrounding the artifact against protocol, and entered the chamber, wherein he attempted to "drink" from SCP-1518, resulting in his death. An additional 4 personnel were killed by this event, before agents with auditory protection were able to disable the surveillance and secure SCP-1518. The phenomenon ceased 3 hours later.
The noise generated by SCP-1518 may be observed on recordings safely, and has been determined to consist of a looped song vocalized by children in Bosnian (the number, age and gender of said individuals is unclear). The cycles of the song are not identical; the lyrics are consistent but the exact vocalization fluctuates.
A complete translated transcript of the song can be found here:
Come catch the bubbles,
So many, so many,
Do not let them pop,
The bubble is your life
Is that you, mother, father?
Do not cry, do not cry,
Is that you, sister, brother?
Is it not it beautiful?
Now the bubbles fall,
Down, down, down, down,
Cannot stop the bubbles,
Popping, popping
Come catch the bubbles,
See them, mother, father?
We are the bubbles,
See us pop and die
|
SCP-1800 is a bronze sculpture measuring 146cm in height.
|
***
Item #: SCP-1800
Object Class: Safe
Special Containment Procedures: SCP-1800 is stored in a restricted area of Sector-19. All accessways and rooms within a 200m radius of SCP-1800 shall be kept to authorized personnel only, and will be kept clear of unnecessary personnel during testing. Personnel authorized to be in the restricted area must not fit Profile Alpha-1800-1 (see: Addendum 2) or Profile Beta-1800-1 (see: Addendum 3) Testing is authorized on SCP-1800 with approval of the current project leader.
Description: SCP-1800 is a bronze sculpture measuring 146cm in height. The casting appears identical to the work Le Minotaure by Salvador Dalí produced by the Valsuani foundry in 1982 with the following deviations:
Attempts to date the sculpture have been inconclusive, but suggest it was created at least ██ years prior to the earliest date of official casting at the Valsuani foundry. (This would also predate the first known Dali painting of the subject by █ years.)
The sculpture is missing a foundry mark and signature.
The small drawer above the inner right ankle is functional, and can be opened and closed.
Inside the drawer is an inscription absent from the official casting: Quin preu és la virtut.1 Inscription appears to have been engraved some time after casting.
SCP-1800 is typically in an inactive state during which it shows no anomalous properties. If some unit of minted currency is placed in the drawer in the lower right leg of the sculpture, and the drawer is closed, the contents of the drawer will disappear and SCP-1800 will enter a pending state.2
When SCP-1800 is in a pending state it will appear inactive3 until a human subject fitting Profile Alpha-1800-1 or Profile Beta-1800-1 enters an area within a 167m radius of effect4 surrounding SCP-1800.
When a human subject fitting Profile Alpha-1800-1 enters the radius of effect while SCP-1800 is in a pending state, SCP-1800 will become active and move its right arm to point two fingers in the direction of the subject for approximately 15 seconds5. The subject is subsequently designated SCP-1800-1. After 15 seconds, SCP-1800 will return to its original pose. If any instance of SCP-1800-2 exists, SCP-1800 will also then return to an inactive state, otherwise its state will continue to be pending.
When a human subject fitting Profile Beta-1800-1 enters the radius of effect while SCP-1800 is in a pending state, SCP-1800 will become active and move its left arm to point three fingers in the direction of the subject for approximately 17 seconds.6 The subject is subsequently designated SCP-1800-2. After 17 seconds, SCP-1800 will return to its original pose. If any instance of SCP-1800-1 exists, SCP-1800 will also then return to an inactive state, otherwise its state will continue to be pending.
When any number of instances of SCP-1800-1 and SCP-1800-2 simultaneously exist, instances of SCP-1800-1 will seek out instances of SCP-1800-27 and initiate some form of ritualized interaction. After completion, the object(s) of this interaction will cease being designated as SCP-1800-2, and if there are no more remaining instances of SCP-1800-2, the initiator(s) of the interaction will cease being designated SCP-1800-1. The specific nature of the interaction initiated by SCP-1800-1 is determined by the type of currency used prior to SCP-1800 selecting SCP-1800-1.
Addendum 1:
+ Document T1800-37: Table of Selected SCP-1800-1/SCP-1800-2 Interactions
- Document T1800-37: Table of Selected SCP-1800-1/SCP-1800-2 Interactions
Currency Used
Interaction Observed
2010 U.S. Lincoln Penny
SCP-1800-1 verbally harasses SCP-1800-2 for a period of 10 minutes.
1943 Steel U.S. Lincoln Penny
SCP-1800-1 verbally harasses SCP-1800-2 for a period of 23 minutes. Harassment includes obscene hand gestures.
1980 UK Ten Pence
SCP-1800-1 verbally harasses SCP-1800-2 for a period of 5 minutes, then proceeds to urinate on SCP-1800-2.
2001 Belgian €2 Coin
SCP-1800-1 assaults SCP-1800-2, strangling SCP-1800-2 for a period of 10 minutes. After SCP-1800-2 expires, SCP-1800-1 undresses the body and poses it to resemble SCP-1800's normal posture.
1882 U.S. Silver Dollar
SCP-1800-1 sexually assaults SCP-1800-2 with a [DATA EXPUNGED] then forces SCP-1800-2 to consume [DATA EXPUNGED] undresses the body and [DATA EXPUNGED] cutting wounds that resemble the voids in the SCP-1800 sculpture.
1924 U.S. Double Eagle $20 Gold Coin
[DATA EXPUNGED]
Addendum 2:
+ Profile Alpha-1800-1
- Profile Alpha-1800-1
Profile Alpha-1800-1 subjects are male and aged 30 to 55 years. They have a position of authority, typically policemen, politicians, executives or military officers. They are in good physical condition without chronic ailments, and show no history of mental disorders or substance abuse. They are married and have at least one child.
Addendum 3:
+ Profile Beta-1800-1
- Profile Beta-1800-1
Profile Beta-1800-1 subjects are female and aged 13 to 21 years. They will have begun menstruation but have not yet engaged in sexual intercourse.
Addendum 4:
+ Document I1800-03: Post Recovery Interview #3
- Document I1800-03: Post Recovery Interview #3
Interviewed: David Orwell. Male. 27 years old.
Interviewer: Agent J. ███████, MTF-███-██, Commander in charge of initial response and containment team.
Foreword: On ██/██/20██, SCP-1800 was on public display at the ██████ ████ Museum in █████████. It had been on continual exhibition since ██/██/19██ without incident. According to security cameras, at 13:25, the interview subject approached SCP-1800 and placed an unidentified coin in SCP-1800’s lower drawer and closed it. SCP-1800 immediately entered an active state and selected SCP-1800-1 and SCP-1800-2 from the museum patrons. SCP-1800-1 immediately engaged in ritual rape, murder and dismemberment of SCP-1800-2. Three security guards were injured, one fatally, when they attempted to intervene. Ritual interaction was interrupted by █████████ police firing on and killing SCP-1800-1. Interview subject was taken into custody by █████████ police along with twelve other witnesses.
<Begin Log, 02:30 ██/██/20██>
Agent J. ███████: Now, I need to ask you a few questions.
David Orwell: Sure. Hell of a day. You’re American, aren’t you? FBI? Is this some sort of al-Qaeda thing?
Agent ███████: We’re consultants, working with the █████████ police.
Orwell: Ahhh.
Agent ███████: Your name’s David Orwell?
Orwell: That’s right.
Agent ███████: You’re a student from [REDACTED]?
Orwell: Was a student. The indoctrination was a bit much.
Agent ███████: So you stopped being an art student?
Orwell: In that sense. I work for a small auction house in ██████ now.
Agent ███████: Long way from home.
Orwell: So are you.
Agent ███████: [pause] So… Why did you put something in the statue?
Orwell: I thought you wanted to ask about the guy killing his—
Agent ███████: Please answer the question, Mr. Orwell.
Orwell: An offering to Mammon.
Agent ███████: Pardon?
Orwell: Rendering unto Caesar. A metaphor. A protest. A penny on the eye of dead Art.
Agent ███████: I’m not following you.
Orwell: [sighs] It was my way of saying that Mr. Salvador Dalí was a pretentious little hack who lived off the same dozen visual non-sequiturs for a half-century. Mass-produced corporate art that diminishes in significance with each cheap copy. That statue, Le Minotaure, you know how many reproductions there are of it? I could get you one off eBay right now. All “official,” and still being produced ██ years after his death. I have more respect for Thomas Kinkade. He never tried to convince anyone his kitsch was somehow transgressive or meaningful.
Agent ███████: You don’t like Dalí.
Orwell: There’s nothing worse than a revolutionary co-opted by the establishment. Art isn’t a commodity.
Agent ███████: Were you expecting the statue to do something?
Orwell: Like what?
Agent ███████: Move.
Orwell: Huh? I was metaphorically tweaking the Dalí industrial complex. It’s not a vending machine or an amusement park ride.
Agent ███████: You didn’t watch the statue after you closed that drawer?
Orwell: I was paying more attention to the guards, who might have objected to my little protest. Then there was this slight issue of some German tourist killing his daughter and trying to—
Agent ███████: We have witnesses that say the statue raised its arms and pointed at Mr. █████ and his daughter.
Orwell: What?
Agent ███████: Are you certain you didn’t see the statue move?
Orwell: It’s not a mannequin. That thing is solid bronze, no joints. It isn’t going to wave its arms like a pirate on a Disney ride.
Agent ███████: So you didn’t see anything?
Orwell: You’ve got to be kidding. I was watching something a lot more horrifying and transgressive than that derivative, self-plagiarized excuse for a sculpture.8
Agent ███████: Thank you, Mr. Orwell.
Orwell: [pause] So, uh, are we cool yet?
Agent ███████: Hmm?
Orwell: Are we cool? Have you got what you need? Can I go?
Agent ███████: Uh-huh, see the nurse on the way out.
<End Log>
Closing Statement: As with all witnesses to SCP-1800’s active phase, David Orwell was provided with a prophylactic Class-A amnestic to suppress any knowledge of SCP-1800’s involvement in the case. Possible connections between David Orwell and any Groups of Interest were not perused until █ years later when a routine review of SCP-1800’s case files identified the phrase “are we cool yet?” Mr. Orwell’s statement pre-dates official Foundation recognition of the “Are We Cool Yet?” collective by █ years. Subsequent attempts to locate Mr. Orwell for a follow-up investigation have yet to be successful.
What, are we supposed to go back and re-investigate every piece of so-called art we have in containment now? It’s a god-damn coincidence— Agent J. ███████, MTF-███-██
Footnotes
1. English translation: "What price is virtue?"
2. Only metallic minted currency has this effect; printed money, jewelry, ingots of precious metal, non-currency tokens, or other such items have no effect.
3. No external means of observation or measurement has been found to differentiate between SCP-1800’s inactive and pending states.
4. Radius of effect is constant, regardless of any intervening material.
5. Effects are independent of subject’s ability to perceive SCP-1800, and occur even if subject leaves the radius of effect within this timeframe.
6. See note 5.
7. SCP-1800-1 appears unaware of the seeking compulsion and will show no prior conscious knowledge of SCP-1800-2's location and identity beyond what was known prior to the effects of SCP-1800.
8. Security camera footage confirms that Mr. Orwell was not facing SCP-1800 during its active phase.
|
SCP-944 is a single-story building outfitted as a “mirror maze,” formerly an attraction at ███ █████ Amusement Park in ███████, ██████.
|
***
Item #: SCP-944
Object Class: Euclid
Special Containment Procedures: SCP-944 is to be surrounded by a 3 m high opaque fence, both to prevent outside access and to allow experimentation unobserved by the public. SCP-944 is officially listed as a condemned building, and “Construction Area” signs are posted to explain the fenced-off area. Level 1 agents wearing ███ █████ Amusement Park security uniforms are to guard the area and prevent unauthorized access.
Non-D-Class personnel entering SCP-944 are cautioned to follow the blue floor lines, indicating safe paths. The “Hall of Fun” is off-limits, due to possible exposure to anomalous effects.
D-Class personnel must be outfitted with subcutaneous GPS location transmitters before being permitted to enter SCP-944.
Description: SCP-944 is a single-story building outfitted as a “mirror maze,” formerly an attraction at ███ █████ Amusement Park in ███████, ██████. After a number of anomalous effects were observed, the building was secured by the Foundation. As the effect appears to be localized, the remainder of the Park is open to the public.
Periodically, individuals entering SCP-944 are capable of walking off the intended paths through the maze and into the mirrors. Despite extensive experimentation, the Foundation has been unable to predict when and where anomalies will occur, or the effects of walking through them. In addition, the distorting mirrors found in the “Hall of Fun” are sometimes capable of producing permanent distortions in the people viewing them.1
SCP-944 was built in 2006 and operated normally until Incident 944-U-1 occurred. It is unknown what initiated SCP-944’s anomalous behavior.
Incident 944-U-1: Date: █/██/201█ █████ █████, a 53-year-old male, emerged from the maze, claiming to have been lost in the maintenance tunnels for three days. SCP-944 does not contain maintenance tunnels. Subject treated for dehydration and released. Park security assumed individual was intoxicated and details of incident were imaginary.
Incident 944-U-2: Date: █/█/201█ █ ████ ████████, a 12-year-old boy, found severely injured in maze Hallway B, with third-degree burns to hands and feet. Subject claimed to have been detained in a windowless brick room for approximately seven hours, by an individual calling himself “Zippo the Pyromaniac Clown,” who burned and [DATA EXPUNGED] the victim. Victim recalls being told “It’s all part of the show, kid.”
SCP-944 does not contain the area described by the victim. Extensive police search for perpetrator yielded no results.
Incident 944-U-3: Date: ██/██/201█ ███ ███████, 24-year-old female, emerged from maze 101.6 cm (3’ 4”) tall after pausing before a “shrinking mirror” in the maze’s “Hall of Fun.” Subject was 175 cm (5’ 9”) on entering maze.
Foundation personnel intercepted police report of this incident. Area secured; Class-B amnestics administered. SCP status established and containment initiated. Additional investigation revealed that █ individuals are missing after entering SCP-944.
Addendum: Post-Containment Experimentation
Use of robot drones to navigate SCP-944 does not appear to trigger anomalous effects. Therefore, use of D-Class personnel in experiments is approved.
Experiment 944-C-1: Date: █/█/201█ Subject D-12154 allowed to walk randomly through SCP-944. Subject observed to walk through Mirror 22, Hallway C and disappear. GPS tracking indicated D-12154 was 700 miles away, in █████, ██. Subject recaptured, and claimed to have walked out of a mirror in the █████ Hotel ballroom. Mirror 22 appeared non-anomalous when examined after incident.
Experiment 944-C-2: Date: █/██/201█ Subject D-21332 allowed to enter SCP-944. Subject walked into Mirror 5, Hallway A. Security team dispatched after hearing subject screaming. D-21332 observed trapped in/behind mirror (unable to determine which). Mirror broken during attempted extraction of D-class. [DATA EXPUNGED].
Experiment 944-C-3: Date: ██/██/201█ D-23187 ordered to enter SCP-944. Subject observed to walk through Mirror 15, Hallway B. Subject found in front of Mirror 15, Hallway C, deceased, entirely coated with thin layer of glass. Mirrors found intact and appeared to be non-anomalous.
Experiment 944-C-4: Date: ██/██/201█ D-24110 ordered to enter SCP-944, and follow blue-lined path to “Hall of Fun.” Subject found collapsed in Hall of Fun; height extended to 229 cm and [DATA EXPUNGED]; remotely extracted. Subject expired after 10 minutes due to massive organ damage.
Footnotes
1. Similar to SCP-1225, many of these distortions result in the degradation of the object/subject.
|
SCP-4026 is a phenomenon affecting an estimated 100 meter stretch of land of the Beachy Head chalk headland in East Sussex, England.
|
***
Item #: SCP-4026
Object Class: Neutralized
Special Containment Procedures: No containment procedures are necessary at this time.
Description: SCP-4026 is a phenomenon affecting an estimated 100 meter stretch of land of the Beachy Head chalk headland in East Sussex, England. In order to activate an SCP-4026 event, a single subject must approach an affected area with suicidal intent. Upon coming within 5 meters of the cliff's edge, SCP-4026-1 will manifest and engage the subject.
SCP-4026-1 resembles a humanoid of indeterminate age and sex, which possesses minor cognitohazardous properties. Attempts to capture or describe any aspect of SCP-4026-1 (aside from its voice) have thus far resulted in failure. Survivors of SCP-4026 events claim to have no memory of interacting with SCP-4026-1, but are able to recall being dissuaded from ending their lives via unexplained means, typically citing an overabundance of negative emotion and disgust at their actions. SCP-4026-1 will demanifest when its target is no longer within 5 meters of it.
93% of recorded SCP-4026 events result in the activating subject's survival.
Addendum 4026.01: On 07/07/2019, one Elliot Schneider (Male, Age 32) approached a hidden SCP-4026 observation area and triggered the anomaly. Notably, this was the first instance in which an SCP-4026 event lasted longer than five minutes. Below is a transcribed log of Schneider's interaction with SCP-4026-1.
<BEGIN LOG>
SCP-4026-1: Lovely view, isn't it?
Schneider: Bloody hell, where did you come from?
SCP-4026-1: I'm always round these parts. It's good fun, it is.
Schneider: Yeah right.
SCP-4026-1: You thinking of jumping? That's why most people come here, you know.
Schneider: So what, are you out here playing guardian angel? I appreciate the gesture but really, I uh, I'd rather not get into it. Just please leave.
SCP-4026-1: Oh no, I'd rather stay. Have a chit-chat. What do you say?
Schneider: No. Why do you care so much?
SCP-4026-1: Don't worry about it. You married?
Schneider: No, not since last February.
SCP-4026-1: Any kids? Did she take them?
Schneider: Yeah, full custody. Took the dog, too.
SCP-4026-1: Wow. Even the dog. Sounds like she really did a number on you.
Schneider: Jesus mate. Are you trying to get me to fucking jump?
SCP-4026-1: Why, yes. It's why I'm here.
Schneider: Holy shit.
SCP-4026-1: It's quite a lovely show, and it's a shame no one else is around to see it.
Schneider: … this is how you get your kicks, you sick fuck?
SCP-4026-1: Are you planning on putting on a show or not?
[There is a silence for thirty seconds. Schneider's breathing becomes labored before vocalizing in frustration.]
SCP-4026-1: Well?
Schneider: I made up my mind.
SCP-4026-1: Oh? Will you do it?
Schneider: Only if you answer a question for me first.
SCP-4026-1: I typically would refuse, but… you look promising. Go for it.
Schneider: Why do you like watching people jump off?
SCP-4026-1: No reason. It beats doing nothing.
Schneider: Really? You just like watching people jump off these cliffs? Simple as that?
SCP-4026-1: Were you expecting some great, complicated answer? It really doesn't get any more complicated than that. Now go on then, I've waited long enough.
Schneider: Fuck you.
SCP-4026-1: Yes, yes fuck me and all that now g-
[There are sounds of a scuffle between the two for fifteen seconds until only Schneider's labored breathing is audible. SCP-4026-1 screams.]
[There is a distant thud followed by silence, interrupted only by Schneider's breathing.]
Schneider: … shit… shit! The police are going to fuckin' kill me!
<END LOG>
Foundation agents moved in to seize Schneider and search for SCP-4026-1. Despite the sound of an object impacting against the beach under the cliffside and Schneider's insinuations, no remains were found. No further SCP-4026 events have occurred since and is considered Neutralized.
Following these events, Schneider was assigned a psychiatrist and therapist in London after standard relocation amnestic treatment.
More From This Author
More From This Author
Uncle Nicolini's Works
SCPs
SCP-3803 •
SCP-5148 •
SCP-4967 •
SCP-4432 •
SCP-4056 •
SCP-5057 •
SCP-020-J •
SCP-6911 •
SCP-3879 •
SCP-3297 •
SCP-4982 •
SCP-4176 •
MDI-6726 •
SCP-654 •
SCP-ES-101-J •
Tales/GoI Formats
UIU File: 2008-021 •
SPC-446 •
Dark was the night, cold was the ground. •
Parawatch Intro Thread •
Dr. Cimmerian Hits Reply All •
Gluttony Is Impossible •
Carroll #280/R-01221 •
Cool Guys Don't Look At Explosions •
Zetetic Bulletin: The Myth of the Wu Xing Iris •
The Hermit, Death, and The Devil •
Ace Of Hearts •
Project Proposal 2018-145: "a man's duty" •
SCP-049-ΩK •
Critter Profile: Maya! •
RAISA-6147 (PENDING ASSIGNMENT) •
Other
uncle nicolini author page •
|
SCP-6926 is a humanoid entity resembling a balding, elderly male with a short white beard.
|
***
Item #: SCP-6926
Object Class: Euclid
Special Containment procedures: Annual containment efforts of SCP-6926 is primarily managed using Foundation web crawlers designed to track social media reports of its activities.
SCP-6926 following acquisition of a minibike (Florida, United States)
Reports of anomalous phenomena caused by SCP-6926 are to be tracked and witnesses are to be amnesticized appropriately.
Description: SCP-6926 is a humanoid entity resembling a balding, elderly male with a short white beard. SCP-6926 always appears dressed in a manner somewhat resembling traditional depictions of Santa Claus, with additional articles of clothing worn in cold weather.
Areas within a twenty-five mile radius of SCP-6926 experience the following phenomena:
Environmental:
Decrease in local temperatures; enough to sustain the presence of ice and snow.
The appearance of partially drunk alcoholic beverages within local homes.
Phenomena displayed in humans:
Increased fatigue and idleness. Often causing subjects to remain sleeping longer than usual.
The inability to keep track of time consistently throughout the day.
Severe headaches in subjects that drank alcohol the previous day, no matter how minimal the amount consumed.
Feelings of melancholy and regret (Reasons vary between subjects).
Additionally, SCP-6926 has displayed various anomalous abilities, including instant teleportation between locations, manipulation and control of ice and snow, inducing alcoholic intoxication through physical contact, and the manifestation of holiday themed/related beverages (Eggnog, Irish-cream, Coca-Cola). SCP-6926 only uses these abilities to aid itself in its annual activities.
SCP-6926 manifests annually on the 26th of December in countries that celebrate the holiday “Boxing Day”. During such times SCP-6926 will travel between locations that have hosted social gatherings the night prior, specifically those containing uneaten foodstuffs and beverages leftover from the night before. While there, SCP-6926 will take part in recreational activities such as drinking, eating, and general relaxation. SCP-6926 will de-manifest at 12:00am local time on December 27th.
Discovery Log: Local phenomena resulting from SCP-6926’s anomalous properties were first detected in the village of ██████, England, on December 26th 1995. Due to the sudden drastic change in local weather, Foundation agents in the area were dispatched to investigate. SCP-6926 was discovered traveling between pubs in the area, joined by civilians partaking in a pub-crawl that had begun the previous night. Interviews with witnesses revealed SCP-6926 had become heavily intoxicated over the night, during which they made various references to a confidential event that took place on September 22nd the same year.
Interview Log: The following is an improvised interview that was recorded following SCP-6926’s sudden manifestation at Site-17’s annual employee boxing day gathering in 1996.
Foundation personnel can be heard talking to one another over the sound of music. The room goes silent and the music stops, as personnel notice the presence of SCP-6926. Loud crunching can be heard from SCP-6926. Researcher Agnew approaches.
Researcher Agnew: Wow. Um, excuse me? Who’re you?
SCP-6926: Hi. What’s up? I’m Santa Claus.
Researcher Agnew: Yeah… Um, what are you doing here?
SCP-6926 continues eating cookies
SCP-6926: Eating right now.
Researcher Agnew: Right. Any particular reason you’re here though?
SCP-6926: Food. You want some?
Researcher Agnew: No Thank-you. Researcher Agnew gestures to personnel to alert security.
Researcher Agnew: So you’re Saint Nick then?
SCP-6926: No. I’m Santa Claus. Well, not today at least. It’s my day off.
Researcher Agnew: You don’t seem quite jolly enough to be Santa Claus.
SCP-6926 picks up a can of coke and notices that it is warm. Frost forms around the can and SCP-6926 smiles.
SCP-6926: I don’t care.
Researcher Agnew: You know, it’s strange. When I was a kid, I didn’t believe in Santa.
SCP-6926 looks at researcher Agnew. SCP-6926 takes a sip of coke.
SCP-6926: You’re an idiot.
Researcher Agnew: Any other business?
SCP-6926: Probably finish off here. Go someplace else. You’re kinda bringing down the mood here buddy.
Security personnel enter the room and approach SCP-6926. Both restrain SCP-6926 and escort them into the hallway. Shortly afterwards, both security personnel begin to stupor and suddenly collapse onto the floor. SCP-6926 re-enters the room.
Researcher Agnew: Hey! What’re you-
SCP-6926 grabs a bottle of whisky from a nearby table.
SCP-6926: Haha. Lightweights.
SCP-6926 disappears
|
SCP-2583 is a mobile, sentient structure made of dust.
|
***
Item #: SCP-2583
Object Class: Euclid
Special Containment Procedures: SCP-2583 is kept in a hermetically sealed steel room measuring 4 meters on a side. This room is to only be accessible by an airlock system outfitted with multiple air purification systems, in order to minimize the introduction of additional particulates to the containment chamber. Any personnel entering the chamber must wear BSL-4 biohazard suits in order to not provide shed hair or skin cells to SCP-2583. The chamber is to be connected to a capacitor bank capable of briefly electrifying the interior surfaces of the chamber as needed for deterrence purposes.
0.25 kilograms of dust and fine sand measuring 35-50 microns in size are allowed in the chamber, for use by SCP-2583. The interior is monitored using fiber optic cameras embedded in the walls, ceiling, and floor, so as to record as much detail as possible of the structures created by SCP-2583.
Description: SCP-2583 is a mobile, sentient structure made of dust. Its baseline form masses 1.7 grams and measures 3.7 centimeters in height. Its form is somewhat indistinct due to its composition, but is roughly humanoid, with four strands of dust representing limbs extending from a central strand which terminates in a spheroid made of dust.1
SCP-2583 is able to manipulate electrostatic charges up to 1 meter from it via unknown means in order to create other structures made of dust and fine granular substances. This ability is capable of affecting particles up to 100 microns in size, with a preference for particles in the range of 20-50 microns in size. Structures have been observed to extend up to 3.1 meters in freestanding height. Structures created by SCP-2583 are extremely resistant to deformation by outside forces and individual strands of dust or other particulates possess a tensile strength approximately 250 times greater than that of spider silk. The electrostatic charges maintaining these structures can be disrupted by a brief electric pulse.
SCP-2583 was initially observed to only create the frameworks of simple geometric structures such as cones, pyramids, and cubes, but has progressed to more complex structures since being contained. Current structures include complex three-dimensional fractals, replicas of the building in which it was initially discovered, and humanoids with the same body plan as itself.
When creating a humanoid, SCP-2583 typically spends triple the time creating it as it would spend on creating another structure of comparable size. Once it has completed a humanoid, it will remain within 10 centimeters of it for between 20 and 30 hours, after which it will negate the electrostatic charges keeping the humanoid together. SCP-2583 separates the remains of these humanoid structures and does not reuse the dust. To date, none of the humanoids created by SCP-2583 have displayed independent mobility.
Footnotes
1. Similarity between SCP-2583 and SCP-1352 has been noted. Investigation into whether the two phenomena are variations of the same effect, or if one propagated the other, is ongoing.
|
SCP-1512 is a root-like organic structure with an estimated mass in excess of 80,000 metric tons at present.
|
***
Item #: SCP-1512
Object Class: Keter
Special Containment Procedures: At least eight members of Task Force Omega-8 are to be assigned to Site-166 at all times, with no fewer than three members of the task force concurrently conducting Procedure 1512-Alpha at any given time. Members of Omega-8 are to be rotated on-station and off-station every 10 hours as appropriate to mitigate stress. On-station members of Omega-8 are to be equipped with hearing protection and Class IV environmental protection suits with integrated closed-circuit breathing air. Task force members are to be provided with sufficient quantities of pencils, writing paper and dextroamphetamines. The monitoring instruments that observe and report the position and orientation of the point of origin are to be inspected and calibrated daily to ensure accuracy of the Procedure 1512-Alpha computations.
In order to conduct Procedure 1512-Alpha, the on-duty task force members must compute, manually and in real time, the differential pseudo-Riemannian topology of the asymptotes of SCP-1512's point of origin. Although the variables upon which the computations are based are derived from mechanical and electronic instrument readings, the computations themselves are to be conducted without the aid of mechanical or electronic computing devices. The speed and precision with which the calculations are performed have been shown to directly affect the efficacy of the procedure in retarding the growth of SCP-1512. Moreover, the procedure has been shown to be ineffective unless the individual performing the calculations simultaneously maintains negative epistemology with respect to the computational work—that is to say, the individual must disbelieve the results of the mathematical computations.1 The computations are to be performed within Site-166 within 6 meters of the point of origin.
Description: SCP-1512 is a root-like organic structure with an estimated mass in excess of 80,000 metric tons at present. It consists of a dense and knotted network of long branches or tendrils. Each tendril is several hundred meters in length, with additional branches every few meters, and coil or zig-zag in various directions with no discernible pattern. The tendrils have a diameter ranging from three to five centimeters. Their outer surface is reddish-brown in color, with hairless, mottled skin. The tendrils secrete a corrosive, foul-smelling, grey thixotropic slime that is capable of causing chemical burns on flesh; additionally, humans who are exposed to the slime experience altered brain chemistry which manifests as feelings of disorientation and vertigo. The tendrils subtly pulsate as if by means of internal circulation or respiration, but do not otherwise move except for growing in length during breaches in the performance of the containment protocol. SCP-1512 radiates heat as if it were a similarly-sized mammal with a high rate of metabolism, and produces loud sound tones that are perceived as brown noise.
The point of origin of SCP-1512 is located on the campus of ███████ University. Site-166 has been constructed around SCP-1512 (under the cover story that the facility is part of the university's physical plant) to contain and study it. The tendrils emanate from a specific point of origin, the position of which was formerly the location of a point within Unit 38A of the university's graduate student housing. That dormitory unit had been occupied by Niels Meyer, a PhD candidate in mathematics at the university. Meyer's remains were recovered from the location, and forensic analysis suggests that the point of origin was within Meyer's cerebrum. A notebook recovered from the dormitory unit suggests that Meyer had been studying a hyperbolic non-Euclidean geometric problem when the structure came into being. The containment protocol was developed by Foundation researchers after analyzing the notebook: before the containment protocol was instituted, the structure's growth resulted in Meyer's death and significant structural damage to the dormitory building.
Despite SCP-1512's apparently organic composition, it has an unmeasurably high Vickers hardness and has proven immune to damage by cutting, burning, lasers, corrosive acids and similar substances, and other means. During breaches in the performance of the containment protocol, various tendrils of SCP-1512 increase in length. The growth rate of tendrils appears to accelerate for the duration of any suspension of performance of the protocol, and has been measured at rates of up to 8 meters/second; the source of the additional mass is as yet unknown. When growing, the tendrils are capable of displacing or breaking solid obstructions including concrete and naval-grade steel plate.
The original dormitory building has been destroyed by SCP-1512's growth to date, and it is not clear whether Site-166 will be sufficient to contain any further growth of SCP-1512 despite reinforcement of the walls, ceiling and floor. Due to the size and potential growth rate of the structure, and the catastrophic environmental damage that could result from the slime emanations, maintenance of the containment protocol has been classified as a Level A priority.
Footnotes
1. The Foundation’s Special Duty Office is tasked with recruiting members of MTF Omega-8 who are capable of both the complex mathematics of the procedure and of maintaining the requisite level of cognitive dissonance. To date, most members of the task force have been recruited from the Society of Jesus or from Zen Buddhist institutions.
|
SCP-1245 is a ███████-model factory whaling ship, approximately 120 meters in length.
|
***
Item #: SCP-1245
Object Class: Euclid
Special Containment Procedures: Mobile Task Force Zeta-4, "Ahab's Antagonists", are currently tracking SCP-1245's movements aboard the Foundation ship SCPS Archimedes. The Archimedes is disguised as a destroyer from the US Navy, allegedly pursuing illegal whalers. Local naval officials are to be informed of the presence of illegal whalers in the area and reroute commercial and private traffic accordingly.
SCP-1245 is currently located at Site-412, an abandoned harbour located in ███████, ████████████. The harbor's entrance has been blocked by stone, preventing escape. SCP-1245 is to remain anchored to the harbor bed at all times. Chains and anchors are to be inspected every week for signs of damage and repaired accordingly. Foundation ship SCPS Archimedes is to patrol the harbor's entrance at all times and deter unauthorized craft under the pretense of naval training exercises.
Description: SCP-1245 is a ███████-model factory whaling ship, approximately 120 meters in length. Nameplates and numbers are missing and are believed to have been removed prior to acquisition. SCP-1245 appears to be autonomous; it has been seen pursuing whales and incapacitating them via cannon-mounted harpoons (see Observation Log 1245-████-██ for video footage) before dragging them into SCP-1245. No crew members have been observed anywhere inside SCP-1245. SCP-1245 has been observed hunting and processing a wide variety of cetaceans, including stock not usually hunted by whalers. Unusual specimens gathered by SCP-1245 include dolphins (family Delphinidae), orca whales (Orcinus orca), beaked whales (family Ziphiidae), and narwhals and belugas (family Monodontidae).
The majority of SCP-1245's internal structure is taken up by a central "slaughterhouse", where whale carcasses are dissected and their parts sorted for future use. SCP-1245 uses tissue obtained from whale carcasses to maintain its structure and build new additions to its hull. It is estimated that roughly 65% of SCP-1245's current mass is made up of whale components. Exploration teams have documented several rooms and decks constructed entirely of whale meat; several of these appear to be significantly altered from their original specifications. These include automated assembly lines built from ligaments and muscles, an on-board crane composed from vertebrae and ribs, a secondary rudder composed of baleen and bone, and a communications deck, with several intact whale brains connected to a central radio.
Rotting or decaying parts are replaced with new components as new whale specimens are acquired and processed. Material is moved throughout the ship via a series of tubes composed from steel pipes and intestines. Significantly, the ship's engine has been heavily modified to burn whale oil and spermaceti, making the ship largely self-sufficient.
The corpses of several infant whales in varying stages of decomposition adorn the prow of SCP-1245. These are believed to be trophies, collected during assaults on whale pods.
SCP-1245 first came to the Foundation's attention on ██/██/████, after several "ghost ship" sightings occurred off the coast of southern Australia, followed by a marked decline in local cetacean populations. Mobile Task Force Zeta-4 "Ahab's Antagonists" are currently tracking SCP-1245's movements. Revised. See Incident Log 1245-043 for more information pertaining to containment revision.
On ████/██/██, SCP-1245 was successfully lured into ████████ Harbour by playing a pre-recorded whale song, and restrained by Mobile Task Force Zeta-4 in "Operation Baleen" (see Incident Log 1245-044 for full details and casualty report). ████████ Harbour was subsequently secured and renovated by Foundation staff, and was re-christened Site-412.
Addendum 1245: On ██/███/████, Archivist ██████████ discovered that the whaling ship Southern Star, a whaling ship of the same model as SCP-1245, disappeared and was deemed "sunk" in 1940.
Addendum 1245-2: On ██/██/████, SCP-1245 transmitted a message in Morse code to staff at Site-412. Grammar, spelling, and punctuation remain identical.
WHALE WHALE NOW CUT THE SOFTNESS OF HOT MEAT, HARPOON WHALE WHALE WHALE, REPAIR OF THE HULL, DEPRIVE THEIR BODIES OF THOUGHT AND LIFE, BLUE GREY CACHALOT RIGHT REPAIR OF THE HUL [sic] THE KNIVES ARE TO DO THEIR IMPORTANT JOBS HARPOON HOOK CUT WHALE WHALE WHALE GIVE NOW NOW NOW NOW NOW NOW
This message was repeated twenty-seven times before SCP-1245 ceased transmission. As of ████/██/██ SCP-1245 has not released any further messages and does not respond to any messages sent by the Foundation.
|
SCP-2868 is a bipedal organism standing 1.
|
***
Item #: SCP-2868
Object Class: Euclid
Special Containment Procedures: SCP-2868 must remain stored within a standard humanoid containment cell in the east seclusion wing of Site-12. The walls are lined with high-voltage electrified grating and must be powered on a separate power grid from the main site in the event of a failure or fluctuation in the primary power grid. The floor of its cell is comprised of solid plate steel to prevent SCP-2868 from spreading via roots to other containment cells.
In the event of an SCP-2868 outbreak, all personnel assigned to capture and termination of infected individuals are to be issued specialized boots lined with ballistics-grade ceramic inserts to prevent the further infection of on-site personnel.
All infected personnel are to be removed by a containment team in hazardous materials gear and incinerated to prevent post-breakout infections. Areas suspected of housing budding instances of SCP-2868 are to be bathed in a mixture of acids, then soaked in a neutralizing agent during cleanup.
SCP-2868 and 2868-A instances may be neutralized with standard C-class tranquilizers, and are incapable of causing further infections while unconscious.
Description: SCP-2868 is a bipedal organism standing 1.9 meters in height, and weighing approximately 68 kilograms. It is comprised of a highly durable glass-like material. The entity has a female frame, and lacks arms or distinguishing facial features. In place of arms, SCP-2868 has a pair of brass pendulum blades attached to the shoulders by iron hook anchors. SCP-2868 is capable of cognitive thought, and doesn't display any directly aggressive behavior towards researchers. SCP-2868 exhibits generally human-like anatomy from the ankles up, with the exception of root-like structures in place of feet and the bladed pendulums extending from the shoulder stocks. SCP-2868 uses the growth of these root structures in order to penetrate the feet of human subjects within 9 meters of SCP-2868, at which point the root structure will break off of the main root system and make its way up through the leg and into the blood stream, until it reaches the brain of its new host, now designated SCP-2868-A.
After initial infection, SCP-2868-A will begin to physically transform while still conscious, though it will not express any signs of pain. Instead, the host will express a strong feeling of euphoria and enter a relaxed state. The body of SCP-2868-A will rapidly adopt traits typically described as surreal, such as skin taking on properties of foreign materials1. New structures may sprout from the body of the host, such as chairs, tables, and picture frames. SCP-2868-A has typically changed its attire entirely through transformation, with skin taking on various properties to mimic clothing akin to street performers, mimes, and clowns. In all cases, SCP-2868-A has demonstrated full vocal capabilities regardless of the extensiveness of bodily changes.
Once fully tranformed, SCP-2868-A will lose control of most of their nervous system, though are still capable of vocalization, and the parasitic instance of SCP-2868 will take control of the body of its host, seeking out high-population areas. After SCP-2868-A has located an area with dense foot traffic, it will adopt behavior similar to that of street performers known as living statues.
SCP-2868-A will then use this behavior to attract passing animal organisms toward it. This will allow it to continue the cycle of infection. The feet of SCP-2868-A will sprout a mass of sinewy roots much like SCP-2868 and proceed to infect the surrounding observing organisms at which point the process will repeat indefinitely.
+ Interview log: SCP-2868-A
- Close this log
Interviewed: SCP-2868-A, was D-90210
Interviewer: Dr. Oswald Martin
Foreword: This particular instance of SCP-2868-A, designated A-03 has retained most of its original physical traits, with the exception of its organic components being replaced with oxidized bronze. A miniaturized pipe organ exists within the chest cavity, visible through a glass rib cage existing on the outside of the object's torso.
<Begin Log>
Dr. Martin: Okay… So I'm sure you know what's going to happen here, yes?
SCP-2868-A-03: Just an interview, yes…? This isn't new to me. Been through it a dozen times.
Dr. Martin: Good. I'm just going to run a few questions here… Okay then. So, first off, can you tell me your name, designation, and location?
SCP-2868-A-03: … Yeah. Yeah, I can tell you all that. My name's Daphne Horrald, and I'm D-90210, yeah? And… I dunno, you spooks never tell us where we are.
Dr. Martin: Uh-huh… Good answer. And, yeah, that's what I've got on file. Daphne somerather… Uuuuh… Can you tell me what your favorite food is, favorite color, somewhere you've always wanted to go?
SCP-2868-A-03: I'm not sure why you're askin' me all of this but, uh… Yeah, sure. Uuuh… My favorite color's cyan, it's like the sky, ya know? Makes me think of clouds. Aaaand… I gotta say lasagna's in my top… Three?
Dr. Martin: … You didn't answer the last question. Please do so.
SCP-2868-A-03: Right, uh… Yeah. Paris. Definitely Paris.
Dr. Martin: Paris? Nice city. What about it piques your interest?
SCP-2868-A-03: Well… It's the art capital of the world, man. You got mimes, sculptures, paintings… And people. Lots of people.
Dr. Martin: Aaand… Why exactly does that interest you? Your psych review here says you were never fond of socializing.
SCP-2868-A-03: Well, uh… Nah, that's not right… I love people. Well, anyways… It's 'cus people are gettin' so bland nowadays. Everyone's workin' ten 'er twelve hour shifts nowadays, nobody takes the time to stop and appreciate all the art around 'em.
Dr. Martin: Mmmmhm… And if they don't want to? Not everyone cares about art.
SCP-2868-A-03: Well, uh, then… Then they should. Everyone should give a [EXPLETIVE] about art, ain't no beauty in the world without it. Without art, you ain't thinkin', man… Nothin' to get your brain workin'.
Dr. Martin: Okay then, reasonable enough. I've got one more question… How do you feel, right now? Are you experiencing any pain, discomfort? Anything of the sort?
SCP-2868-A-03: uuuuh… Nah, I feel jus' dandy, doc. Why, am I sick 'er somethin'?
Dr. Martin: No, uh… No. Just curious. This is all I had for you today, D-90210. If you would, please follow the two personnel by the door back to your quarters.
SCP-2868-A-03: Alright… Hey, this was a pretty, uh… Nice change from the usual interrogation style stuff. Ring me up if ya need more, I'm a bit tired of gettin' yelled at all the time.
<End Log>
Closing Statement: Post-interview, SCP-2868-A-03 has been terminated via on-site material compacter. SCP-2868-A-03 showed no aggressive behavior when interacting with humans, and displayed no attempts to cause outbreaks in an environment that makes infection impossible. In addition, infected hosts display a strong desire to interact with highly populated areas with a societal focus on art and cultural diversity. SCP-2868-A instances appear to retain a majority portion of the original host's personality, and changes appear to go undetected by the host itself.
Footnotes
1. Examples of previously observed materials are granite, black iron, soapstone, limestone, white oak, pine bark, brass, and bronze.
|
SCP-5676 is a potentially sentient cardiac tumor that bears a strong visual resemblance to popular, primarily American depictions of Jesus Christ.
|
***
Item#: 5676
Level3
Containment Class:
euclid
Secondary Class:
none
Disruption Class:
dark
Risk Class:
notice
link to memo
Special Containment Procedures:
SCP-5676 is to be contained within a standard Oubliette-class Anomaly Womb cell1 pending further developments. Heart rate and brain activity are to be monitored, and X-rays taken weekly. These tasks, including nutrition and waste management, are to be handled remotely via an automated system. No contact is to be initiated with SCP-5676 without the express permission of Dr. De Weger.
In the event of host death, G-class "Anomaly Birth" scenario, other sudden changes in host status, or forseeable approach of any of these events, anomaly is to be observed and tested anew, and containment procedures revised accordingly.
SCP-5676-1 is to remain in total isolation indefinitely.
Description:
SCP-5676 is a potentially sentient cardiac tumor that bears a strong visual resemblance to popular, primarily American depictions of Jesus Christ.
SCP-5676-1 is a 23-year-old Caucasian American female with no prior recorded medical issues. SCP-5676 is located partially in and around SCP-5676-1's heart. Preliminary incisions and examinations yielded the conclusion that safe removal of SCP-5676 from its host was possible at time of initial examination, but doing so would have led to the item's "death". As of ██/██/2021, SCP-5676 has grown significantly enough that safe removal is no longer possible.
SCP-5676-1 was not raised in a Christian household, nor educated at a nominally Christian school. Questioning of SCP-5676-1 revealed that the subject only began to notice physical discomfort following an interaction with a "tall androgynous person in a wide-brimmed black hat and priest's collar", hereby designated PoI-56762. PoI-5676 approached SCP-5676-1 in an otherwise nondescript parking lot and initiated a conversation about the Church of Latter Day Saints. Even when subjected to interrogation, SCP-5676-1 did not recall many specifics, other than PoI-5676 ending the conversation with the phrase "The Lord is in all of our hearts". SCP-5676-1 noted an unusual sensation in the chest cavity later that day, but was not apprehended by Foundation personnel until nearly a month later.
5676.1: Detailed Observations
SCP-5676 exhibits highly irregular growth patterns, at times rapidly increasing in mass for currently unknown reasons. It is believed that the item began as an unremarkable (if rare) teratoma, and developed its anomalous appearance at a later date. As of ██/██/2021, the item measures approximately 4.5 by 1 by 0.5 inches - proportions consistent with the relative height, width and depth of an average human male. SCP-5676 is malformed, but displays features identifiable as facial hair, teeth, eyes, limbs, and thumbs3. SCP-5676 also appears to be wearing a white robe, red sash and sandals, but these are in fact composed of flesh, bone and cartilage. It, like its host, appears Caucasian and has blue eyes. It is unknown if these traits are inherited from SCP-5676-1.
SCP-5676 primarily holds itself in a "thumbs up" position, its face fixed in a wide smile. It has, however, been observed to move on more than one occasion. In initial open-chest surgery, SCP-5676 appeared to be affected by anesthesia administered to SCP-5676-1, and assumed a "sleeping" position. A second open-chest surgery was performed at a later date with minimum possible use of anesthetics, during which SCP-5676 was reported to have "smiled beatifically" at Dr. De Weger. De Weger later insisted that SCP-5676's mouth moved, but any speech would have been inaudible at the time.
SCP-5676 has been observed to grow in sporadic bursts. Despite extensive testing, the exact stimulus that causes these growth spurts remains unknown. The tumor visibly increased in mass in response to stimuli including but not limited to: bright light, loud noises, induced hemorrhaging, nutrition deprival, oxygen deprival, and sleep deprival. Dr. De Weger was unable to draw a conclusion after three months of testing, and was equally unable to determine the anomaly's root cause, whether it is transmissible, and whether its anomalous properties evolved over time. It is for these reasons that Dr. De Weger recommended SCP-5676 and its host be contained in total sensory isolation in an Anomaly Womb cell until the item's growth has plateaued. Based on current estimates, this intermediary period could last between three months and four years. It is thought that when SCP-5676-1 no longer complicates efforts, testing conducted on the anomaly's complete form will be far more conclusive.
+ Addendum
- Addendum
The nature of the cancer is that of metastasis. The item in question is, as of yet, like a child - we do not know what form it might take, what butterfly may emerge once its cocoon is discarded. Our duty is simple: secure, yes; contain, certainly; but we must also protect. I am confident that there is more to be learned from SCP-5676 that we have simply not yet been able to grasp. Understanding is the key to control, and this matter I am most, most determined to understand.
- Dr. Ethan De Weger.
+ Addendum 2
- Addendum 2
Concerns have been raised by the Ethics Committee, so this addendum should clear up some matters.
Prior to current containment, SCP-5676-1 was informed of the details of its upcoming containment procedures as per Ethics Committee guidelines. At this stage there was in fact sudden violent resistance and desperate protestation from the host.4 Ethics Committee members should note that the item risked damage as a result of this reaction, and as such I recommend rethinking the guidelines for this sort of situation. Nonetheless, SCP-5676-1 was rapidly lowered into the Anomaly Womb cell and sealed into containment, which quickly restricted movement and ensured the item's safety.
SCP-5676 has been in current containment for eleven months. Despite no vocalizations from SCP-5676-1 in over seven months, and brain activity levels indicating a debilitating increase in discomfort/pain from the anomaly's expansion, the anomaly's host remains conscious and stable. X-rays clearly show that SCP-5676's growth is progressing at a steady and healthy rate. According to our data, this is greatly aided by a near total lack of movement from the item's host, which has helped to stabilise growth patterns.
I am confident in the safety of the item. I hope this assuages the concerns of the Ethics Committee, and I look forward to sharing our ultimate findings.
- Dr. Ethan De Weger.
Footnotes
1. New as of 2020, the Anomaly Womb cell series is a fully controlled environment intended to contain items that are currently undergoing a process of rapid change.
2. Searches for PoI-5676 have thus far returned no results.
3. The "fingers" are currently fused together, but it is expected that they will separate as the item grows.
4. By contrast, previous signs of extreme depression and mental distress resulted in a satisfactorily docile state throughout most of the testing period.
|
SCP-314 is a 0.
|
***
Item #: SCP-314
Object Class: Euclid
Special Containment Procedures: SCP-314 is contained at the location of its original discovery at Site 47 which has been built around the anomaly. Local personnel publicly operate under the guise of the US Forest Service.
Although SCP-314 is highly mobile, it has never moved beyond a 50 (fifty)-meter radius of its origin point; the area delineated by this radius is known as the 'red zone'. SCP-314 has created an equally large depression in the earth below its origin point. All attempts to remove or restrain the object have thus far failed, but containment has been achieved by the construction of Site 47 itself, which is also used for various physics experiments regarding anomalous objects.
Any experiments involving SCP-314 must be cleared by Dr. Williams; see form HM-120.
With the exception of approved experimentation, all personnel are to keep clear of the red zone. SCP-314 is highly reactive to all motion within approximately 50 52 meters of its origin point.
Addendum: After incident 314-oe, researchers are reminded that the object's "kill radius" is approximately 50 meters from point of origin, and for purposes of safety should be assumed to actually be 51 meters. Although safe interaction is possible at the outer edge of the red zone, and the object may even exhibit what the late Dr. Stratham described as "playful behavior" at that range, all action within the kill radius has always been met with violent reaction.
Description: SCP-314 is a 0.97 m long, 0.21 m thick obelisk which is highly reflective and metallic in appearance, with tapered edges that are apparently sharpened to a molecular level. No material has ever been recovered from SCP-314.
The object is capable of levitation and extremely swift motion, although it lacks any visible means of locomotion. Although research does not indicate any true intelligence, the object is most certainly sentient of its surroundings and extremely reactive to any motions or vibrations within an approximately 50 52-meter radius.
Analysis of rubble recovered from the ground below SCP-314's origin point indicates that the object arrived at this location some time between 1975 and 1979, which is supported by pre-containment reports from civilians.
The object emits no unusual radiation save for a very faint sound which appears to be an anomalous broadcast of █████ FM, a local classic rock station. Comparisons between SCP-314's vibrations and the actual broadcast of █████ FM are identical approximately 85% of the time, although recordings from SCP-314 often include extra audio in the form of guttural sounds, snarling and occasional commentary from the late DJ ██████ ███████, who passed away in 1998 and was not employed with █████ FM after 1983.
Research Summary: SCP-314 reacts to all motion within its kill radius by impacting with the source of movement, although it ignores particulate matter smaller than 125 micrometers. SCP-314 will continue to react in this manner until the triggering object no longer moves, has exited the kill radius, or has been reduced to pieces small enough to be ignored. It displays unerring accuracy; no limit to its speed has yet been established.
Current experimentation revolves around introducing multiple targets into SCP-314's kill radius at a time to quantify its method of identifying, prioritizing and reacting to multiple targets.
Multiple slow-moving targets are often struck down in order of their introduction to the kill zone, notably in a method which suggests that SCP-314 is anticipating further objects to be introduced. In experiment 314-113, several tennis balls were tossed into the kill radius by researchers standing outside the red zone. SCP-314 bisected each ball neatly in such a manner that their remaining momentum took them out of the kill radius, while putting itself into position to strike balls not yet thrown.
SCP-314 has correctly predicted when a researcher will only pretend to throw an object, as well as when a researcher will fail to throw an object into the kill radius despite intent.
Multiple fast-moving targets, such as bullets fired into the kill radius, can produce speeds from SCP-314 that exceed the sound barrier, or even create the appearance of SCP-314 existing in more than one location simultaneously.
Experiment 314-230 flooded the containment room within Site 47. SCP-314 was able to strike at the encroaching liquid with such speed and consistency that it created an irregularly shaped dry sphere within its kill radius. The ground below SCP-314 remained dry at all times. In previous tests (and accidents) SCP-314 has allowed liquid to fall upon the ground within its kill zone.
When SCP-314 detects motion close to the edge of the kill radius it moves in erratic patterns that observers have variously interpreted as "threatening", "graceful", or "playful". These motions sometimes correspond to the individuals that provoke them, suggesting that SCP-314 may have some means of recognizing or remembering individuals to whom it has previously been exposed.
Containment Breach 7/12/20██ At approximately 3:23 PM local time, SCP-314 exited its previously-defined area of operation and cut through the walls of Site 47 before returning to its place of origin. No personnel were harmed during this event. This time corresponded with an offsite review on whether or not SCP-314 should be reclassified as Safe. Whether this is coincidence or not is yet to be determined, but it clearly demonstrates that we do not know everything about this object or its motivations, or if it is capable of having any. Classification remains Euclid.
-Dr. Williams.
|
SCP-1912 is a pocket watch dating from the years 18██-18██ (it is theorised that the watch likely took at least 15 years to complete).
|
***
Item #: SCP-1912
Object Class: Euclid
Special Containment Procedures: The current colony of SCP-1912-1 is to be contained in Biodome-C-7 at Bio-Site 66. A researcher who is familiar with beekeeping using the Langstroth hive method must always be present at Bio-Site 66 and must personally conduct weekly maintenance checks of SCP-1912-1, as well as oversee the bi-weekly harvesting of SCP-1912-B.
SCP-1912-B is to be harvested by two D-Class wearing full protective clothing, and stored in airtight drums in refrigerated storage area C. Contact with SCP-1912-A must be strictly avoided except for during “reproduction” events, which must take place every 14 days using any of the on-site D-Class. It may be necessary to fully restrain the subject for this; however, it is vital to not use any form of sedative or otherwise calming drugs on them, as this interferes with the reproduction event.
The colony of SCP-1912-1 is to be maintained at its current number of 45,000 with an acceptable variance of 2,500. SCP-1912 is to remain where it is in the center of Biodome-C-7 and is not to be moved barring a Class A evacuation event.
Description: SCP-1912 is a pocket watch dating from the years 18██-18██ (it is theorised that the watch likely took at least 15 years to complete). The watch is identical in style to those of █████████████ ███████; however, several components suggest that it was completed up to 5 years after his alleged death. There have been several minor modifications to the watch. SCP-1912 was discovered in the home of █████ ██████, a prominent member of [REDACTED], a small yet extremely militant environmentalist cult. █████ ██████ had converted his basement into a workshop and is presumed to have died of malnutrition shortly after making the modifications to SCP-1912.
Through unknown means SCP-1912 constantly secretes a clear fluid at a varying rate, hereby referred to as SCP-1912-A. The fluid is identical in every way to nectar except for its primary anomalous effect. Due to the extremely complex nature of SCP-1912, requests to dismantle it and examine the mechanism have been denied.
When SCP-1912-A comes into contact with human skin, a blister is formed over the course of the next 2-6 hours. The blister varies in size in relation to the amount of SCP-1912-A that contacts the skin, with a lower limit of ~5ml producing a very small blister and an upper limit of ~1,500ml capable of producing full-body blisters. Over the course of the next 24-72 hours, the blister both spreads along the skin and grows outwards in size. The experience causes no pain; however, subjects have reported feelings of intense discomfort and nausea, as well as movement and "buzzing" from within the blister.
After a period of 72-96 hours the blister will begin to cause the subject extreme discomfort, 'itchiness' and pain. Invariably the infected subject will scratch the blister, regardless of instruction (it is thought this effect is purely physical). Due to the weakening of the affected area, only a small amount of scratching is needed in order to pierce the skin and “burst” the blister.
Once this has occurred, a number of honey bees (Apis mellifera) - hereby referred to as SCP-1912-1 - will be released from the blister. The emerged instances of SCP-1912-1 will be in an extremely compressed ball; however, they will sustain no injuries during the event. The “ball” of SCP-1912-1 will rapidly separate and, depending on the size of the blister, may be composed of anywhere from 30 to 1,000 ‘worker bees’. No other kind of bee has ever been observed, presumably due to the nature of SCP-1912-A rendering the need for a queen and drone bees obsolete.
Recently emerged SCP-1912-1 instances
The reproduction event causes surprisingly little physical harm to the subject, but may cause emotional trauma; therefore, subjects are to be given Class C amnestics after treatment for any minor injuries sustained.
If a reproductive event does not occur at least once every 14 days, then SCP-1912-1 will begin to modify their behaviour. As opposed to harvesting SCP-1912-A, SCP-1912-1 instances will instead coat their legs in SCP-1912-A and seek to land on humans. A single instance of SCP-1912-1 is not enough to cause a blister itself; however, a swarm of SCP-1912-1 has proven to be more than sufficient.
Instances of SCP-1912-1 will instinctively seek out SCP-1912 and seemingly have no range limits on being able to sense it. Even if the reproduction event occurs at a distance where they will die before reaching SCP-1912, instances of SCP-1912-1 will still invariably fly in that direction. It is theorised that instances of SCP-1912-1 are incapable of harvesting nectar in the way typically expected of honey bees.
If allowed into the presence of SCP-1912, instances of SCP-1912-1 will begin harvesting SCP-1912-A. The rate of SCP-1912-A secretion appears to directly correlate with the size of the SCP-1912-1 colony, increasing or decreasing the amount secreted to match SCP-1912-1 numbers. The honey produced by SCP-1912-1 - hereby referred to as SCP-1912-B - has no anomalous chemistry in its makeup and produces no anomalous effects.
|
SCP-1928 is a banjo uke or “banjolele”, identical to a discontinued brand originally mass-manufactured in the 1920s.
|
***
Item #: SCP-1928
Object Class: Safe
Special Containment Procedures: SCP-1928 should be kept in a padded, airtight case to prevent damage or accidental activation of anomalous properties.
This artifact is stored at Research Sector-09 as a part of the Bonifay family collection. Cross-testing of SCP-1928 with SCP-1890 and SCP-1896 has been suspended, pending further study of Incident Times-Union (see Addendum 2).
Description: SCP-1928 is a banjo uke or “banjolele”, identical to a discontinued brand originally mass-manufactured in the 1920s.
When strummed or tapped with only one hand, SCP-1928 produces sounds comparable to a non-anomalous instrument. However, when a human subject places both hands on any part of the artifact, they will be compelled to play it. Except in cases of disability or manual impairment, subjects affected by SCP-1928 demonstrate consistently superior technique and speed in various styles of strumming and fingerpicking.
No audible sound is produced by this compulsive playing. In-person observation and audio recordings have only reported the sounds of the affected subjects' breathing or the rustle of their clothing.
Tested subjects describe their movements as involuntary; while affected, however, subjects’ facial cues and body language suggest intent concentration or thoughtfulness. While under the influence of SCP-1928, subjects will not respond to visual or auditory stimuli, only returning to full consciousness if another individual comes into physical contact with SCP-1928.
Six images of SCP-1928, identified by distinctive scratches and the capital "BON" scratched on the back of the head, have been found in SCP-1890. The instrument is pictured in the hands of individuals of different ethnicities and ages, or placed on display with other valued possessions.
Addendum 1:
As of 10/12/██, 7 days to the hour since the first test conducted with SCP-1928 and a human subject, a secondary effect has been observed.
+Excerpts from research notes
-close Research notes
excerpts from the notes of Researcher Hart:
10/12/██
While returning another item to containment, a research assistant noticed that SCP-1928 was vibrating inside of its protective case. The assistant reported this anomaly promptly, and did not attempt to handle the object. I arrived within five minutes of the alert, at which point the vibration had ceased. Seconds later, the sounds of banjo music could be heard in the immediate vicinity of SCP-1928, unmuffled by the case, at about the same volume as a comparable instrument being played.
After about sixty seconds, the melody was joined by a voice, singing in a style reminiscent of the sprechstimme featured in many American folk songs. This "song" lasted for approximately four and a half minutes, but the assistant and myself were unable to record the music. Curiously, although we both identified the sung language as American English, we were unable to remember any of the lyrics or even individual words of the "song". SCP-1928 was removed from containment for close observation.
10/14/██
At 15:07, the phenomenon occurred again, myself and several assistants and D-class subjects observing. Despite the cooperation of six listeners, no member of our group was able to recall the lyrics of the song after its abrupt end. Listeners also described markedly different voices— some identifying the singer as an adult male, others as an aged adult male, an adult female, or a child. Memories of the song's melody and style remained, however, and subjects unanimously recalled hearing a "lament" or synonymous descriptor.
Attempts to record the music with analogue, digital, even [REDACTED] devices resulted in nothing but 5 minutes and 16 seconds of static.
10/19/██
After the third recurrence of this phenomena (seven days to the hour after the initial third test of SCP-1928), it was clear that the timing of the anomalous music coincided with the dates of the initial tests. In preparation for the next occurrence, a visual recording of the fourth test was set to play simultaneously with the first notes of anomalous music, in accordance with times noted in the original experiment log.
A Level 2 researcher with considerable experience playing stringed instruments observed and confirmed that the test subject's motions in the recording were perfectly in sync with the anomalous music.
11/02/██
This phenomena has been observed ten times in the course of two months, always corresponding to the date, time, and duration of previously conducted tests.
Addendum 2:
Some time after the observation of SCP-1928's secondary effect, approval was granted for cross-testing of the "Bonifay family" artifacts— SCP-1928, SCP-1890, and SCP-1896 —in an effort to learn more about the seemingly interrelated history and nature of these items. Incident Times-Union describes the textual and photographic alterations that occurred as a result of these experiments.
+Excerpts from experiment log
-close Excerpts from experiment log
Procedure: SCP-1928 was placed in the hands of subjects already under the anomalous influences of SCP-1890 (i.e. still experiencing acute face-blindness and ability to recall the Bonifay photographs in great detail), designated Group A; or SCP-1896 (i.e. having recently experienced more than 40 minutes of associated sensory distortion and hallucination), designated Group B; with Group C consisting of subjects under the influence of both items.
Results: Subjects of all three groups were unaffected by SCP-1928's compulsive properties. Instead, upon placing both hands on the artifact, subjects expressed nostalgic attachment and familiarity with the object.
Subjects in Group A immediately and unquestioningly recognized SCP-1928 as the artifact depicted in SCP-1890, expressing delight at having a chance to see "the family's baby banjo"— a phrase used by five of the seven test subjects. Regardless of prior knowledge, subjects were able to answer questions pertaining to the history and technical properties of the banjo uke with some specificity. Each subject claimed to know the original owner of the instrument, although no two subjects described the same individual. The artifact was described alternatively as a wedding present, the hand-crafted work of a multi-talented farmer, and the product of a successful barter with a witch, among other detailed anecdotes.
Subjects in Group B all recognized SCP-1928 as a familiar object, but were not certain why or from where they recognized it. However, unlike subjects in Group A, when prompted to attempt to play the instrument (and in some cases without prompting) subjects in Group B were able to play the instrument with a moderate to high level of skill, despite being specifically chosen for their lack of musical background. Unlike music previously produced by SCP-1928, these melodies were immediately audible and recordable. The songs played were recognizable American folk tunes, all predating the 1930s, including "Idumea", "O Death", "Pretty Polly", and a traditional arrangement of Psalm 137. While it is impossible to be certain, the similar themes expressed in the songs' lyrics— particularly Psalm 137, or "Babylon", which was heard most frequently— may have some connection to the artifact's history.
Subjects in Group C did not simply display a combination of the previous behaviors, but experienced heightened delusions of familiarity with SCP-1928. The subjects seemed to regard themselves as descendants of the Bonifay family, unconsciously slipping into the first person when relating the artifact's history. As in previous cases, no two of these stories were identical— although many of the places and persons mentioned corresponded to the notations in SCP-1890. When Group C subjects were prompted to play the instrument, they not only played but sang, and frequently offered to perform "an old family song" without prompting. As in previous tests, however, these songs have proven unrecordable by manual or technological means. Neither researchers or test subjects were able to recall the lyrics sung.
+Incident Times-Union
-close Incident Times-Union
copy of an altered photo; previously depicted an empty field
During and after the testing of subjects in Group C, anomalous irregularities were observed in several paper documents. All of these documents were either inside or in the near vicinity of the testing room while the subjects were speaking or playing under the influence of SCP-1928. Most of these irregularities consisted of the word "family" or a short phrase ("by the waters", "please consider my age") appearing in the middle of a sentence, in both handwritten and typewritten documents.
A total of 18 altered documents were collected (see attached files for detailed list), and cessation of testing seems to have curbed the spread of the anomalous changes.
Of these collected items, the most notable is a copy of the local Sun Sentinel newspaper, dated 01/10/██. During testing of SCP-1928 with a Group C subject, assistant Researcher Evans observed the text and images printed in this newspaper changing to reflect a 1920s edition of the Times-Union, one of the oldest Floridian newspapers.
These changes were incomplete, affecting only individual columns and pages of the document— sports columns reporting on decades-old games, political articles changed to reflect the local concerns of Florida in 1928, etc. Of greatest relevance, however, were the changes to the obituaries and photographs: photos were not only altered to reflect the technology of the 1920s, but changed to feature indistinct human figures in spaces that had been blank. None of these figures can be identified. The obituary section was expanded to include nearly one thousand names, in some places printed over the top of one another, all sharing the surname "Bonifay".
|
SCP-3374 is a phenomenon affecting bodies of water in the city of Wakoe, Illinois.
|
***
Item #: SCP-3374
Object Class: Euclid
Special Containment Procedures: Mobile Task Force Gamma-7 (“Nereids”) is currently stationed at the town of Wakoe, Illinois to monitor for and intercept any instances of SCP-3374 manifestation. The Wakoe County Public Recreation Complex has been adapted to serve as a base of operations for the Foundation personnel assigned to SCP-3374. Any samples of biological material taken from SCP-3374-1 instances are to be kept in cold storage at the base. At least three Level-2 researchers specializing in marine biology are to remain at the site at all times to oversee research processes.
Any bodies of water currently functioning as conduits for SCP-3374's primary anomaly are to be drained and cordoned off from the public. Should any civilians encounter an instance of SCP-3374-1, all witnesses to the anomaly are to be amnesticized. Any SCP-3374-1 instances involved are to be captured alive for lab analysis if possible; MTF personnel are to terminate any openly hostile SCP-3374-1 instances that measure over 1 meter in length.
Description: SCP-3374 is a phenomenon affecting bodies of water in the city of Wakoe, Illinois. As of currently, SCP-3374 manifests at locations within a roughly circular area encompassing the majority of the city.1 Affected bodies of water will exhibit the presence of a wide range of irregular aquatic organisms (designated SCP-3374-1). Many SCP-3374-1 instances do not resemble any form of known terrestrial life, and will enter and exit the affected body of water seemingly regardless of any natural or man-made boundaries around the water.2
Any terrestrial structures (aquatic or otherwise) will not be affected by SCP-3374, meaning that supporting boundaries or walls of affected bodies of water (e.g., swimming pools, bathtubs, toilets) will remain entirely physical and tangible before, during, and after an instance of SCP-3374-1 exits through the structure. Instances of SCP-3374-1 interact with water non-anomalously3, and may only exit the body of water by interacting with another support boundary or wall.
SCP-3374 was first discovered in early April 2002, when local news stations reported a shoal of anomalous fish appearing in storm drains overnight. Foundation assets were notified, and MTF-γ7 was mobilized to secure the town.
Manifestation Log: The following is a partial log of notable SCP-3374-1 manifestations.
Date
Location
SCP-3374-1 Description
Additional Details
3 April 2002
Multiple storm drains on Wakoe Main Street
Shoal of fish similar in appearance and weight to Carasius auratus, the common goldfish. Instances lacked eyes and fins.
Widespread reporting by local media outlets led to Foundation attention; establishment of SCP-3374 containment procedures.
12 August 2002
Bathtub at 201 Fairview Place
Anguilloforme4 approximately 4 meters in length, ringed with 0.5-meter radial ‘arms’. Instance’s head terminates in a cluster of approximately 22 eyestalks. Appears to be herbaceous.
Instance appeared while the house’s residents were bathing. Residents alerted local authorities and were amnesticized by Foundation operatives.
1 November 2004
Puddles caused by flooding near elementary school
Unknown, possibly selachian5
Instance appeared and consumed a resident (approximate age: 4). Captured on-camera by eyewitnesses, suppressed by Foundation operatives. Additional personnel allocated to SCP-3374 investigation.
20 December 2005
Wakoe County Public Recreation Complex swimming pool
Chitinous wheel-like organism approximately 3 meters in diameter, ringed with 1-meter hair-like protuberances.
Instance appeared after pool closing hours, rotated in place for approximately 75 seconds, and exited with no further disturbance. Instance did not appear susceptible to high chlorine levels. Incident led to the establishment of Wakoe County Public Recreation Complex as MTF Gamma-7 base of operations.
Exploration Data: Partial documentation follows.
Date: 3/14/07
Purpose: After initial testing indicated that foreign structures maintaining physical contact with SCP-3374-1 also have the ability to anomalously exit out of affected bodies of water, a request was made for an exploration mission to discover the point of origin of SCP-3374. Approval was given by the Foundation Regional Administrator.
Subject(s): 2 D-Class personnel, remote observation team
Equipment:
One 7500 kg capacity air winch outfitted with 1 km of cable and industry-grade shark cage
Two underwater head-mounted flashlights and video feed systems
Two diving knives
Exploration Log:
Display SCP-3374 Exploration Log for 3/14/07
SCP-3374 Exploration Log for 3/14/07
Winch system assembled on Wakoe County Public Recreation Complex pool lip without incident. A SCP-3374-1 carcass returned from autopsy is affixed to bottom of cage. Observation team lowers cage system into pool, and both D-Class personnel, outfitted with standard scuba diving apparatus, swim into cage and secure it.
Winch continues to lower cage. SCP-3374-1 carcass passes through pool floor without incident, followed by cage and D-Class personnel.
Although the cage was outfitted with a pressure sensor that would abort the dive if pressure climbed to dangerous amounts, this sensor was never activated.6
Feedback from D-Class video systems indicate the cage is descending through an expansive area of water, possibly an ocean. The Wakoe County pool is still visible as a rectangle of light directly above the cage, surrounded by water. Light conditions appear to decrease rapidly with depth, and darkness below the cage obstructs any visibility of an ocean floor.
The cage continues to descend without incident for several hours. Shoals of unrecognizable SCP-3374-1 are visible in the distance. None of the SCP-3374-1 appear to be hostile.
At the 500m mark, D-Class are instructed to switch on their head-mounted flashlights. Subjects joke about poor visibility conditions.
At the 975m mark, mission control asks D-Class to confirm that there is no ocean floor in sight, and after confirmation, prepares to begin raising the cage after completion of full 1km dive.
At the 982m mark, cable is violently severed by an unseen force. Subsequent examination of remaining cable has indicated that it was cut at a point approximately halfway between the D-Class and the floor of the pool, with shearing patterns indicative of bite marks. Video feed is maintained with D-Class subjects, who visibly begin to panic as the cage continues to descend.
After reassurance from mission control and private agreement, D-Class agree to remain in the cage.
At approximately 2.5km, visibility is entirely dark in every direction. Bioluminescent organisms can be seen in the distance, and both D-Class decide to turn off their flashlights in order to “stay safe.”
At approximately 3.5km, cage comes to rest on the ocean floor. Following conversation with mission control, D-Class switch on flashlights and exit cage. Ocean floor appears to resemble that of terrestrial oceans, with large patches of seaweed visible ahead and to the left.
After further conversation with mission control, D-Class agree to separate and travel in separate directions for 30 minutes before returning to the cage, in the hopes of completing their original mission before extraction. D-5███ heads north, into the seaweed, while D-7███ heads south.
D-7███ quickly reaches a wide, sandy basin, where she finds several objects of interest which she describes to mission control; most notably a rusted artifact tentatively identified as the wheel of an early 20th-century plane, the decomposing and partially consumed carcass of what appears to be a terrestrial whale, and a tattered boxing glove. Moving beyond the basin, D-7███ discovers a network of pillars leaning against each other in regular patterns. Shortly after entering the network, D-7███ is assaulted by a SCP-3374-1 instance resembling a 2m long Olenoides nevadensis7 with multiple anthropomorphic faces. Video feed is cut and D-7███ is presumed terminated.
D-5███ continues through the seaweed without difficulty until reaching a steep escarpment of sand. An unseen material at the top interferes with D-5███’s flashlight, producing reflections. After conversation with mission control, D-5███ is instructed to climb to the top of the hill. The obstruction appears to be a uniform barrier, stretching up and in both directions beyond the range of visibility. D-5███ is instructed to walk parallel to the barrier before approaching it and does so for 12 minutes without discovering any sort of termination or deviation in the barrier’s surface.
Upon learning of D-7███’s presumed death, D-5███ panics and approaches the barrier despite the wishes of mission control. Barrier is confirmed to be similar to glass in appearance and texture, with no detail visible beyond.
Still visibly distressed, D-5███ locates their diving knife and attempts to forcibly break the barrier. Minor cosmetic damage is observed, but no damage is done to structural integrity.
D-5███ complains about hearing a "heavy thumping", though no corresponding audio is picked up on the video feed. An ovoid silhouette appears beyond the barrier, becoming gradually larger and more distinct. D-5███ states that "five blinking lights" appear to be discernible at the top of the approaching silhouette.
A large three-pronged appendage strikes the barrier, producing minor tremors in the ground. D-5███ retreats into the seaweed. Mission emergency-aborted by the Foundation Regional Administrator, and video log terminated.
END OF LOG
Update: 3/16/07
MTF Gamma-7 rescuing D-5███; scuba mask and tank have been removed.
D-5███ had been presumed killed in action following the events of SCP-3374 exploration; however, at approximately 3:14 AM on March 16, two days after the exploration, local residents reported a malnourished and severely dehydrated individual anomalously manifesting in their backyard pool. MTF Gamma-7 operatives amnesticized the residents and extracted the individual, later confirmed to be D-5███. Although recovering quickly after medical treatment, D-5███ was found after testing to consistently demonstrate an anomalous ability to phase through solid structures in water, congruous with abilities of SCP-3374-1 instances. D-5███ accordingly reclassified as SCP-3374-2 and placed in a Type S Standard Humanoid Anomaly Containment Cell within the Wakoe County Public Recreation Complex.
Footnotes
1. Although this phenomenon is currently confined to the city limits, analysis has shown that its area of manifestation is consistently shrinking by approximately 0.4 meters a year on average.
2. Similarity between instances of SCP-3374-1 and organisms exiting SCP-791 during a "Draining Event" have been observed. Investigation into a potential conection between the two anomalies is ongoing.
3. See Incident Report 3374-B, where a shoal of brightly coloured nematode-like organisms expired shortly after entering the Wakoe County Public Recreation Complex swimming pool due to high chlorine levels.
4. Order of fish including eels and morays
5. Cartilaginous fishes, including sharks and dogfishes
6. This indicates that SCP-3374 has the secondary anomalous property of pressure presumptively not increasing with depth.
7. Trilobite
|
SCP-2027 is a spacebound organism of extraterrestrial origins.
|
***
Item #: SCP-2027
Object Class: Euclid
Special Containment Procedures: A space-based telescope under Foundation control is to observe SCP-2027 at all times. If SCP-2027 is detected by satellites, it is to be dismissed as an asteroid. Class-C Amnestics are to be dispersed to terrestrial astronomers that detect SCP-2027. If any data demonstrating the existence of SCP-2027 is published, data must be seized and Class-A Amnestics dispersed to all readers and authors. Unmanned Probe ██A-2027 is to remain within 5,000 km of SCP-2027 at all times, and is not to enter any area within 1,250 km of SCP-2027.
Description: SCP-2027 is a spacebound organism of extraterrestrial origins. Current estimates place SCP-2027 at between 200-350 km in length and 100 km across. SCP-2027 maneuvers using several jets of gas on each end of the body. Gas emitted by SCP-2027 appears to be made up of a mix of hydrogen, methane, and argon. SCP-2027 lacks a primary propulsion method, and is propelled entirely by its own inertia.
As of █/█/██, SCP-2027 has been confirmed to be made up of several zooids, similar to Siphonophores such as Physalia physalis, or the Portuguese man o' war. Each zooid appears to perform functions such as propelling SCP-2027. SCP-2027 is covered in a hard exoskeleton that is made up of several hundred individual flat zooids. The number of gas jets on SCP-2027's exoskeleton has not been determined, with as many as 40 observed at times.
SCP-2027 feeds on strong concentrations of gamma radiation. On █/██/████, when radiation from gamma ray burst 130427A reached SCP-2027, SCP-2027 ceased all activity and began spinning slowly. An increase in movement speed was noted 4 days later.
SCP-2027 appears to be traveling directly parallel to the Solar System's orbit around the galactic center. However, between 19██ and 19██, SCP-2027 changed course slightly ██ times.
SCP-2027 was detected by the [REDACTED] Gamma Ray observatory on ██/█/19██, when it eclipsed the [REDACTED] Pulsar. The complete lack of gamma radiation near SCP-2027 was logged into public record. Foundation agents dispensed Class-A Amnestics to all researchers who had come in contact or were aware of the data.
SCP-2027 is currently 0.02 light years from Earth. Current projections show no risk of SCP-2027 impacting Earth or any other body in the Solar System. SCP-2027's closest approach to the Solar System will be 0.009 light years if no course corrections are made.
Addendum #1:
On █/█/20██, a Foundation-operated probe launched on █/█/19██ rendezvoused with SCP-2027. However; when the probe entered a zone 100 km over SCP-2027's body, Probe ██A-2027 was struck by a powerful gas jet, damaging the probe's docking claw. Probe ██A-2027 has since been ordered to remain in a 5,000 km orbit above SCP-2027.
Addendum #2:
On █/█/20██, SCP-2027 split into ███ parts and reassembled itself after █ hours. SCP-2027's speed has been noted to have risen by ██ m/s at this time.
Addendum #3:
On ██/█/200█, A large sphincter opened on SCP-2027's side and a large mass of matter was jettisoned. A thin appendage extended from SCP-2027 and connected to the mass of matter designated SCP-2027-1. 3 weeks later, jets of the same gas emitted from SCP-2027 was emitted from SCP-2027-1 and the appendage was disconnected. SCP-2027-1 then accelerated away from SCP-2027 in the direction of the galactic center.
Addendum #4:
On █/██/20██, Probe ██A-2027 has detected multiple sporadic emissions of argon, methane, and hydrogen from the areas SCP-2027 has passed through. These signatures are of compositions identical to SCP-2027's maneuvering jets.
Note: These creatures may be native to the high-radiation regions in the center of the galaxy. What we are witnessing now may be a migration of sorts. -Dr. █████
|
SCP-068 is a wire stick figure, 9.
|
***
Item #: SCP-068
Object Class: Safe
Special Containment Procedures: SCP-068 is to be kept away from any metals in an electrically-resistant box, preferably made of polytetrafluoroethylene (teflon) and rubber. Said box is to be stored in security locker 26 at Site 11. Key is kept with Dr. █████. Any requests for testing are to be redirected to him.
Description: SCP-068 is a wire stick figure, 9.8 cm tall, made of an unknown metal. The figure is composed of a single wire looping back to the center. The wire itself appears to have been bent numerous times in multiple places.
When an electric current is introduced to SCP-068, it becomes animate, moving about on its own. SCP-068's "joints" are where a normal human being's would be. Once activated, SCP-068 begins to search for any metallic material. Once metal has been found, SCP-068 will begin to knead it and pull a thin strip of metal off. SCP-068 will then construct another figure similar to itself. The newly-created figure will begin to knead the remaining metal alongside the original, creating new figures, which in turn, produce more replicas.
SCP-068 will move onto its next stage after one of two requirements are met. The first is when there are no more metals in range with enough mass to produce another figure, the other is when an upper limit of 102 replicas are created. When either of these events occur, all figures will converge at one location and begin forming themselves into as big a figure as possible. With a maximum of 102 "mini-figures", the resulting figure reaches two meters in height. SCP-068 situates itself in the intersection of the torso, arms and head. Gamma, beta, and theta waves begin emanating from SCP-068 after this union. SCP-068 will then begin to search for metals again attempting to create more figures, only scaled up to whatever size 068 is currently at. These replicas do not emanate brain waves like 068 does. If 068 is not at the maximum size limit after this, it will continue to create and add more figures to itself until the limit is reached.
Once it has reached the second stage and there are no metals available from which to construct figures, SCP-068 returns to its dormant state after 4 minutes and 32 seconds of activity. Material surrounding the original figure must be melted away in order to retrieve 068.
SCP-068 is capable of kneading and manipulating any metal presented to it, regardless of properties. It also appears to be impervious to any attempts to damage or destroy it. Copies of SCP-068, however, have the same properties and vulnerabilities as whatever metal they were constructed from.
SCP-068 can detect metals hidden from view through an as-of-yet-unknown process. While 068 will not attempt to reach metals that are too difficult to get to, it will tear through anything that is soft enough for its limbs to penetrate. What it considers "soft enough" changes depending on what 068 is shaped from at the time.
Addendum 068-a: A proposal has been made to use SCP-068 to dispose of dangerous metal-based SCPs.
Addendum 068-b: Please see attached document 068-a
Document #068-a: The proposal to use 068 for disposal of dangerous metal-based SCPs has been denied. Seeing as how many, if not all, of our dangerous metal-based SCP's are also invincible, the only thing we would have is a bunch of invulnerable wire figures running about. Honestly, who even thought this up?
-Dr. █████
|
SCP-665 is a human male, age ██.
|
***
Item #: SCP-665
Object Class: Safe
Special Containment Procedures: SCP-665 is not to leave his room under any circumstances barring a full site evacuation, in which instance a specially designed stainless steel crate has been constructed. SCP-665’s room is to be constructed entirely of stainless steel or a similar metal. SCP-665’s bed is to consist of a single mattress, specifically constructed to have a mass greater than 1000 kg. SCP-665 is only to be fed a specially formulated liquid diet, which is to be dispensed into the drinking glasses fused to his hands. SCP-665 is allowed access to live animals, provided that said animals are not wearing a collar or other similar adornment, and that he does not attempt to feed said animals.
Physical contact with SCP-665 is highly discouraged. If it becomes necessary, it is to be done with bare skin only, and to be kept to a minimum.
Description: SCP-665 is a human male, age ██. All of this information, including his species, was obtained through an interview. He has refused to provide further information (see addendum). Further physical descriptions cannot be given at this time, as SCP-665’s external appearance changes frequently. Any non-living solid object with a mass less than that of SCP-665 that comes in contact with SCP-665’s body instantly fuses to it. Within one hour, the object will effectively become part of SCP-665’s body, and will affect smaller objects in the same manner. It is worth noting that this means SCP-665's mass increases with each item added; therefore, all personnel are advised against adding any further objects.
Surgical analysis of SCP-665 has proven difficult, as most surgical instruments are simply assimilated into his body. The few items isolated from SCP-665 via a bisecting laser have revealed that SCP-665’s cardiovascular system had expanded to include these items. Furthermore, although these items retained their original appearances, their inherent chemical properties more closely resembled those of human flesh.
It is not presently known how SCP-665 was able to obtain nourishment prior to containment, as the aforementioned drinking glasses were added by the Foundation specifically for the purpose of containing liquid nourishment.
Addendum: SCP-665 has recently proven to be largely uncooperative with Foundation personnel, refusing to answer questions or submit to examinations. While SCP-665 has not shown any signs of violence, it must be stressed that personnel are expressly prohibited from introducing any item to SCP-665 that may conceivably be used as a weapon.
|
SCP-1083 is a blue-tinted piece of quartz in the shape of a deformed human skull, 15kg in weight and with dimensions of 20cm in height, 30cm in length, and 12cm in width.
|
***
Item #: SCP-1083
Object Class: Safe
Special Containment Procedures: SCP-1083 is to be stored in a containment locker at Site 38 when not in use. SCP-1083 is to be transported to and from its locker only by junior researchers with no previous history of violent behavior, and only while wearing protective gloves. Under no circumstances are personnel with Level 2 or higher clearance to come into contact with SCP-1083. Testing with D-class personnel is prohibited due to lack of relevant data collected during experimentation. All personnel coming into contact with SCP-1083 are to be immediately debriefed and sent for psychological counseling.
Description: SCP-1083 is a blue-tinted piece of quartz in the shape of a deformed human skull, 15kg in weight and with dimensions of 20cm in height, 30cm in length, and 12cm in width. The skull demonstrates no anomalous properties except when held by a single person in both hands.
When held with both hands, subjects exposed to SCP-1083 will experience a sudden, massive increase in neural activity for 1-3 seconds (confirmed by EEG analysis). Afterwards, non-D-class subjects will in most (87%) cases experience massive personality changes from their previous state. Affected subjects typically register a decrease in IQ score of between █-██ points, rendering them unsuitable for continued employment with the Foundation. In spite of this, subjects will demonstrate greater reasoning skills and use of logic, though their actual knowledge and memories will be lessened. Conversely, all D-class or other Foundation personnel that have committed violent acts against other human beings will undergo total psychological breakdowns, leading to attempts at self-harm and suicide. Subject D-3273, whose status was not connected to a violent act (demoted to D-class for violation of Foundation protocol) experienced the same effect as the rest of the non-D-class personnel, suggesting the primary importance of pacifistic tendencies.
By and large, most subjects exposed to SCP-1083 refuse to discuss their experiences with the object. Between 08/03/9█ and 02/11/0█, the only references made to the experience by exposed subjects were by D-class personnel shortly before their deaths, some of whom were noted to exclaim "He's right, he's right, I deserve it, he's right" or some variation of same. Neither forced or chemical interrogation has been able to reveal any details about the nature of who "he" is or what alterations he makes to the personalities of affected subjects.
Incident Report 1083-A: On 11 February 200█, Operative 1/1083-237, a Level 1 volunteer, was exposed to SCP-1083. Through chance, 237 was the only recruit with an educational background in moral philosophy; this is believed to be the primary reason for the anomalous results. After exposure, 237 described her perception of the event (timed by EEG as having lasted 1.34 seconds) as having taken at least a matter of days and possibly several months. She described having spent the entire time in an infinite black void, devoid of any sensory input.
While in the void, 237 claims to have come into telepathic contact with an entity (classified as SCP-1083-1) who engaged her in discussion on matters of metaphysics, logic, and ethics. 237 described the entity's "voice" as male. 1083-1 refused to reveal any details about itself other than that it lived within the "artifact" and always had done so. 1083-1 already possessed extensive knowledge about every event in 237's life, and talked with 237 about the various mistakes and logical errors she had made in the form of Socratic dialogue. 237 described feeling a great deal of anger and resentment towards the entity at the beginning; however, her training in logic and moral philosophy caused her to eventually come to accept the entity's reasoning.
According to 237, the entity described the other Foundation personnel that had "visited" it as "unprepared" for its experience; it was able to psychologically compel them to use more logical reasoning in their lives, but not without damaging their mental capacity permanently. The entity described the D-class personnel exposed to it as "unworthy" and claimed to have "given them the true knowledge of their actions." 237 attempted to leave the Foundation shortly after her experiences with SCP-1083; when she proved immune to any form of amnestic agent, termination was ordered on 11/5/0█.
Addendum 1083-1: Recovery Log SCP-1083 was recovered from a house formerly used as a safehouse by the Serpent's Hand (confirmed by documents located in the building and various graffiti found on the walls). Large quantities of blood were found in many rooms of the house, though no usable samples could be obtained due to what is believed to be deliberate contamination. No corpses were found. The skull was found in one of the bedrooms in the house, along with documentation from the agency known as "PTS" or "Phitransimun Combine;" it seems the skull was in transit between an address in "Alexandria of Forests" and "Delphi of the Oceans." Fragments of a badly ripped note were found throughout the house and pieced together to form the following:
ORACULUM COMBINE OF OCEANS [maintains certainty? pledges?] THAT ALL PRODUCTS WILL [operate? behave?] TO OPTIMAL SPECIFICATIONS. IF UNABLE TO PLEASE [owner? host?] TO FULLEST DEGREE PLEASE COMPLETE BELOW FORM TO [fragment lost]
CUSTOMER
PRODUCT CODE
PLACE OF ORIGIN
COMPLAINT
ALEXYLVA UNIVERSITY PHILOSOPHY DEPT
OΡΦ XV
ALEXANDRIA SYLVANOS
EXCESSIVELY RETRIBUTIVE TOWARDS [life-harvesters?], BORDERS ON PACIFISTIC. VIOLATES ARISTOTELIAN PRECEDENTS REGARDING JUST WAR. REQUESTING REPLACEMENT AND REIMBURSEMENT FOR DEAD WARRIORS.
|
SCP-1699 is a dormant volcano located northwest of Hólsfjallavegur, Iceland.
|
***
Item №: SCP-1699
Object Class: Euclid
Special Containment Procedures: Research Outpost 1699-A, disguised to the public as a Reykjavik University volcano research station, has been constructed around SCP-1699. Plainclothes security personnel are to patrol the area surrounding SCP-1699 regularly, and are to turn away civilians attempting to enter.
Description: SCP-1699 is a dormant volcano located northwest of Hólsfjallavegur, Iceland. It consists of little more than a volcanic vent, approximately one meter in diameter and one-third of a meter tall at its highest point. SCP-1699 is sapient, and is capable of speech via anomalous means.
SCP-1699 is willing and able to communicate with attending personnel, and upon first contact expressed a desire to be "more destructive" and "better at being a natural disaster." Over the course of its containment, the psychological condition of SCP-1699 has declined — it appears to have developed an inferiority complex, often comparing itself to other, larger volcanoes in Iceland and other places. Despite this, psychiatric assistance of the entity has been deemed yet unnecessary.
Addendum: Interview Logs1
Date: January 28, 2017
Interviewer: Senior Volcanologist Einar Vilhjálmsson
Interviewee: SCP-1699
Begin Log
Dr. Vilhjálmsson: Hello.
SCP-1699: Oh, what's up? Man, visitors always come when you least expect 'em, am I right?
Dr. Vilhjálmsson: With whom am I speaking?
SCP-1699: (It laughs.) Oh, straight to the point, are we? You can call me, uh…
(SCP-1699 is silent for approximately 54 seconds.)
SCP-1699: Well, uh, I'm still workin' on a name.
Dr. Vilhjálmsson: Would 'SCP-1699' suffice?
SCP-1699: 'SCP-1699,' huh? Not exactly fearsome or intimidating, but… I guess it works. You can call me that.
Dr. Vilhjálmsson: Good to hear. Now-
SCP-1699: S.C.P… SIXTEEN-NINETY-NINE!
(Dr. Vilhjálmsson blinks. The lava within SCP-1699 momentarily bubbles before falling still.)
SCP-1699: Uh… still workin' on that whole intimidation bit, too. But hey- you flinched, right? Right?
Dr. Vilhjálmsson: Excuse me?
SCP-1699: Ah, forget it. Now, uh, whoever you were, what did you say you wanted again?
Dr. Vilhjálmsson: SCP-1699, My name is Einar Vilhjálmsson. My team and I will be researching you for the foreseeable future — this includes interviews, like this one, to get more information on why you're here and what you want.
SCP-1699: Aw, dude, an audience? Oh, this is friggin' unbelievable, man, I could — this is all I've ever hoped for! I- I don't know how to thank you, seriously.
Dr. Vilhjálmsson: Don't mention it. Now-
SCP-1699: Yes, an audience… AN AUDIENCE TO WITNESS THE DESTRUCTION I WORK!
(SCP-1699 laughs loudly as the lava within it bubbles. Dr. Vilhjálmsson adjusts his glasses and rubs his temples before speaking.)
Dr. Vilhjálmsson: You seem to be… quite preoccupied with threats of violence.
SCP-1699: Well, I am a friggin' volcano. What else would I be 'preoccupied' with, ice-fishing? Look — you look at me, what do you think? What comes to mind? Am I warm and fuzzy? Am I nice? Hell no, I friggin' ain't, I'm a harbinger of destruction! Violence incarnate! I'm the fire of the earth, coming up from the ground to lay waste to anyone dumb enough to get close! Got that?
Dr. Vilhjálmsson: You're a bubbling puddle of lava.
SCP-1699: Oh, touché. (It chuckles.) You got me. Look, mister, uh, Einjar, was it? I know you're probably a busy, busy man, but… You think you and your team could, like, help me out? A favor for a favor?
Dr. Vilhjálmsson: What is it.
SCP-1699: I've been thinking — I'm already hot stuff, y'know, but I could be even hotter. And you and your crew seem to know a lot about my kind… You think you could, like, coach me?
Dr. Vilhjálmsson: I'm sorry?
SCP-1699: Like, train me. To be more of a natural disaster, y'know? 'Cuz right now… (It sighs) seems like I'm just a run-of-the-mill freak of nature, you feel me? I wanna be more destructive. More of a volcano! You get me, don't you?
Dr. Vilhjálmsson: I can't promise that. I'll have to go now, SCP-1699.
SCP-1699: (It laughs) Ooh, cold. Well, I'll be here. If you, like, change your mind.
End Log
Date: February 4, 2017
Interviewer: Senior Volcanologist Einar Vilhjálmsson
Interviewee: SCP-1699
Begin Log
Dr. Vilhjálmsson: Hello again, SCP-1699.
SCP-1699: Hey, Einjar. What's up.
Dr. Vilhjálmsson: (He sighs) My name is Einar.
SCP-1699: Yeah, yeah, sorry. What do you want, Einar?
Dr. Vilhjálmsson: This is just a check-in. By the way, I can't help but notice — you seem a bit…
SCP-1699: Bummed? Yeah, guess I am.
Dr. Vilhjálmsson: I was going to say 'quieter,' but I suppose that works. (He writes something in his notebook.) What's the matter, SCP-1699?
SCP-1699: Well, it's — promise you won't laugh, by the way (Dr. Vilhjálmsson nods) — you know those other guys you brought with you? Those lab-coat scientist types?
Dr. Vilhjálmsson: My research team?
SCP-1699: Yeah, those guys. Well, the other day — you weren't here, by the way — I was talking at them, tryin' to get their attention, to scare them, you know? And after a while, one of them comes up, looks at me, and says, like, uh… 'you're no eyy-a-feller-yokel?' Did I pronounce that right?
Dr. Vilhjálmsson: I believe it's 'Eyjafjallajökull.'
SCP-1699: Yeah, yeah, that's it, thanks. So, like, she said 'you're no Eyjafjallajökull,' right, and I'm all like 'what's that?' And would you believe it, the lady laughs at me!
Dr. Vilhjálmsson: Inconceivable.
SCP-1699: I know, right? So then, after she's had a good chuckle at me, she tells me all about all these other volcanoes, you know, not just this 'Eyjafjallajökull,' that I had no idea existed, and like… (It sighs) Man, I've got a whole lot to live up to, huh? I mean, if I ever wanna make a name for myself…
Dr. Vilhjálmsson: What do you mean?
SCP-1699: Well, uh… I've kinda got my work cut out for me, at this point. Y'know that Eyjafjallajökull, when it erupted, brought air-travel in this part of the world to its knees for weeks? And Bárðarbunga, with all that hot lava getting everywhere and flowing over everything? And that's just in this century! Don't get me started on what she told me about the others, like Vesuvius and, uh… Monaha?
Dr. Vilhjálmsson: Moaha?
SCP-1699: Yeah, yeah, whatever. It's all just… It's a lot, you know? A lot to think about. You mind if I cut things off early today? I don't really wanna talk anymore.
Dr. Vilhjálmsson: I can see why. I'll see you next week, SCP-1699.
SCP-1699: Thanks, man. I was getting a bit too heated about all this.
End Log
Date: February 12, 2018
Interviewer: Senior Volcanologist Einar Vilhjálmsson
Interviewee: SCP-1699
Begin Log
Dr. Vilhjálmsson: Hello.
SCP-1699: Go away.
Dr. Vilhjálmsson: What's wrong, SCP-1699?
SCP-1699: It's nothing you'd care about. Leave me alone.
Dr. Vilhjálmsson: You'd be surprised.
SCP-1699: Ha. This is out of character for you, Einar. Shouldn't you be taking jabs at me, or something?
Dr. Vilhjálmsson: (He sighs) SCP-1699, I'm sorry you feel that way-
SCP-1699: Like hell you are. Go talk smack about me to your friends about how useless I am and leave me alone.
Dr. Vilhjálmsson: Now, hold on — SCP-1699, nobody but you thinks you're useless. You've been a pl- well, you've been quite the conversation partner, and researching you has brou-
SCP-1699: I don't give a damn about your 'scientific advancements' or 'research' or whatever! Just go away! All of you! Since you've come over and set up your stupid campsite around me, all I get is a constant stream of friggin'- trash-talk and insults! I get told on a daily basis by your asshole scientist friends about how many other volcanoes are out there spewing lava and leveling towns, and you friggin' laugh at how that makes me feel!
Dr. Vilhjálmsson: I-I'm sorry for not being here when that happened. I can certainly talk to them abou-
SCP-1699: I'm not friggin' done. I'm tired of being treated like a novelty by you dicks. I'm tired of spending every day listening to everyone laughing at me when they think I can't hear them. I'm tired of just being a useless, bubbling puddle of lava and knowing that I can never be more than that-
Dr. Vilhjálmsson: SCP-1699, just know that I'm truly sorry for all this-
(Lava spurts from within SCP-1699. Dr. Vilhjálmsson flinches.)
SCP-1699: LEAVE ME ALONE!
(SCP-1699 begins to bubble violently, and some lava overflows onto the surrounding ground. Dr. Vilhjálmsson leaves the area. SCP-1699 produces a sound similar to weeping for ten minutes following the event.)
End Log
Afterword: Following this event, the psychological condition of SCP-1699 notably worsened. It became mostly unresponsive and verbally listless, with its only vocalizations being threats and insults directed at nearby researchers. Dr. Vilhjálmsson requested to be moved to Research Outpost 1699-A to act as a full-time research supervisor and to investigate cases of suspected anomaly mistreatment; this request was approved, and Vilhjálmsson was able to minimize verbal denigration of SCP-1699 by research personnel by threat of disciplinary action.
Addendum: Event Log
Foreword: On February 26, 2018, Research Outpost 1699-A was formally declared obsolete due to completion of the construction of Site-687 north of Grímsstaðir, Iceland and the entry of Floating Site 003 (SCPF Njörðr) into Icelandic waters. Senior Volcanologist Einar Vilhjálmsson requested a shipment of fireworks to "commemorate the occasion;" the request was denied, but Dr. Vilhjálmsson was allowed the use of fireworks in the area surrounding SCP-1699 provided that he used his own money to buy them.
The following is a transcript of the events of March 4, 2018, recorded by Junior Researcher Þuríður Helgesdóttir on her personal cell-phone.
Involved Personnel: Senior Volcanologist Einar Vilhjálmsson, Junior Researcher Þuríður Helgesdóttir, Associate Volcanologist Ivan Preobrazhensky
Involved Anomaly/ies: SCP-1699
Begin Log
1:26:56: JR Helgesdóttir begins recording. Dr. Vilhjálmsson has arranged a series of fireworks to surround SCP-1699, and is in the process of tying a rope to the tents of the outpost.
JR Helgesdóttir: Why do I have to record this, again?
Dr. Preobrazhensky: (Off-camera) Probably to make sure we don't break any rules, or get anyone hurt. This should be fine, though, I think.
Dr. Vilhjálmsson: For the record, let's all consider this unofficial community service for breaking 1699's heart. Now quiet down. I'm almost done.
1:29:30: Dr. Vilhjálmsson finishes tying the rope, and JR Helgesdóttir moves to sit beside Dr. Preobrazhensky.
Dr. Preobrazhensky: All right. What now?
Dr. Vilhjálmsson: Just, uh, go with the plan. But make sure 1699 hears it!
JR Helgesdóttir: Man, this is honestly so cute-
(Drs. Vilhjálmsson and Preobrazhensky shush her, and Dr. Vilhjálmsson begins to loudly speak.)
Dr. Vilhjálmsson: Gee, what a great day at Research Outpost 1699-A! I sure hope a volcanic eruption doesn't stick a wrench in our research and merrymaking!
Dr. Preobrazhensky: I concur, friend Einar! A volcanic eruption is the very last thing we need! It would certainly ruin our day.
(SCP-1699 begins bubbling.)
SCP-1699: Stop making fun of me.
JR Helgesdóttir: Oh no! Was that a tremor I heard? (Dr. Preobrazhensky turns to her, silently nodding and holding both his thumbs up.)
SCP-1699: You again? Seriously? Come on, go away.
Dr. Vilhjálmsson: This is entirely serious, SCP-1699. We fear the destruction you could bring! We're trembling at the thought!
SCP-1699: Hey, I know you! Einar, shut up and stop saying all that stuff just to make me feel better. It's not working!
Dr. Vilhjálmsson: Stop saying that, yourself! I know you've been holding back your true power, just to make us feel better!
Dr. Preobrazhensky: Exactly! For the love of God, SCP-1699, don't erupt! You'll kill us all!
SCP-1699: This is friggin' embarrassing. I told you to go away.
JR Helgesdóttir: Mama, come pick me up! I'm scared!
(SCP-1699 begins violently bubbling)
SCP-1699: FOR THE LAST TIME, SHUT UP AND LEAVE ME ALO-
(Lava flows from SCP-1699, igniting a fuse connected to the array of fireworks. As they explode, Dr. Vilhjálmsson pulls the rope, causing Research Outpost 1699-A to collapse. Dr. Preobrazhensky and JR Helgesdóttir scream.)
Dr. Preobrazhensky: Oh, the humanity!
JR Helgesdóttir: Oh, Ivan, hold me in our final moments! (She stifles a snicker)
1:37:07: Drs. Preobrazhensky and Vilhjálmsson stand beside JR Helgesdóttir, watching SCP-1699. Lava stops flowing from SCP-1699, and it remains silent for two minutes.
SCP-1699: Uh… guys?
(Dr. Preobrazhensky appears to hold in a sneeze. SCP-1699 begins to laugh.)
SCP-1699: Oh my friggin' God, did you see that?
End Log
Afterword: The day after this event, Dr. Vilhjálmsson interviewed SCP-1699.
Date: March 5, 2018
Interviewer: Senior Volcanologist Einar Vilhjálmsson
Interviewee: SCP-1699
Begin Log
Dr. Vilhjálmsson: Hello, SCP-1699.
SCP-1699: Oh, hey! Man, am I glad you're alive, Einar. I mean you saw what happened yesterday, right?
Dr. Vilhjálmsson: I sure did. Man, this outpost is still reeling from it! So many casualties, so much property damage… it was horrific!
SCP-1699: No, it wasn't.
Dr. Vilhjálmsson: I-I'm sorry?
SCP-1699: (It sighs) Look, man, (It lowers its voice) I know you did that for me, and I'm really, really thankful you did. Not just because it made me feel better, or anything-
Dr. Vilhjálmsson: You… don't have to whisper. This isn't really a secret.
SCP-1699: Ah, yeah, right. Well, anyway… I just want to thank you. For, you know, opening my eyes. So to speak.
Dr. Vilhjálmsson: What do you mean?
SCP-1699: Well, you know… In the moment, hearing and feeling all those explosions and thinking I created all that death and destruction was, like, the coolest thing ever, right? I felt like a million krona, like I was at the top of the world, right? But then, after a while, I started to get really, really, uh… really lonely. Lonely, and worried, and then I thought I'd killed you all, and I started… feeling, uh…
(SCP-1699 pauses for approximately 54 seconds, producing sounds similar to choked breathing.)
SCP-1699: I missed you guys, man! I was lonely, really lonely, and friggin'- friggin' guilty, to top that off! Even though, let's be real here, I kinda thought you deserved it too. (Dr. Vilhjálmsson shrugs and nods.) You should've heard me, man, I was sobbing out here, over you! But then, like, I guess I was crying loud enough to get the attention of one of the security guards or whatever your guys have patrolling around here, and he came up to me and told me what happened!
Dr. Vilhjálmsson: Well, I'm sorry-
SCP-1699: You don't have to be! Well, anyway, when he told me nobody'd actually died, man, I was the most relieved I'd probably ever been! I mean, I was just, like- you know what they say, 'brimming with joy,' or whatever. If I could cry, man, my eyes would be like fountains back when I heard that, y'know? And that's when I realized… y'know… Give me a sec. I gotta figure out how to articulate my thoughts.
Dr. Vilhjálmsson: Take as much time as you need.
(SCP-1699 is silent for approximately 2 minutes.)
SCP-1699: Well, I figured out then and there that, uh… death and destruction look cool from a distance, y'know, the explosions are bigger on the other other side of the fence n' all… but me, I'm not like that, y'know? I don't have the heart for it. 'Cuz at the end of the day, being a natural disaster isn't cool if you end up killing someone you care about, and the people they care about too. (It laughs) Man, ain't that cheesy? Still though, truest words I ever said. Am I right?
Dr. Vilhjálmsson: You certainly are, SCP-1699. Does this mean you're feeling better about yourself, now?
SCP-1699: Well, a little part of me, way deep down, still kinda wants to be more, like, disastrous and all — but I guess most of me is happy right here.
Dr. Vilhjálmsson: It's certainly good to be down to earth. I'll see you next week, SCP-1699.
SCP-1699: See you around, Einar.
End Log
Footnotes
1. The following logs have been approximated from Icelandic to English by borges.aic.
|
SCP-4544 is a rectangular lidded container made of cardboard with a Post-It note on its side reading "Please do not open".
|
***
Item #: SCP-4544
Object Class: Safe
Special Containment Procedures: SCP-4544 is to remain within storage locker #4032 at Site-14. To prevent the further extension of SCP-4544's anomalous capabilities, storage locker #4032 is to be guarded and monitored via video at all times.
Any attempt to open or otherwise observe the contents of SCP-4544 is to be approved and overseen by Senior Researcher Dr. █████████ Senior Researcher Dr. Brooks. Any attempt to open SCP-4544 outside of a testing environment is strictly forbidden and may result in disciplinary action.
WARNING: The use of anomalous objects to observe the contents of SCP-4544 is forbidden. See document F:240.
Description: SCP-4544 is a rectangular lidded container made of cardboard with a Post-It note on its side reading "Please do not open". Details about the contents of SCP-4544 are unknown.
When any attempt is made to observe the contents of the container or remove the note, a seemingly unrelated event will occur to obstruct the attempt. SCP-4544 has demonstrated retro-causality editing capabilities, as these events may take place before the method of observation or removal is even conceived. Currently, the only known method of examining the contents is to weigh and shake the container, although this always yields results identical to an empty, non-anomalous shoe box.
Following the results of the experiment in Document F:241, either SCP-4544 or the contents within have shown the ability to communicate when threatened with destruction; however, this line of testing has been postponed indefinitely. A proposal to change the item's class from 'Safe' to 'Euclid' in light of this experiment is currently pending review.
As of ██/██/████, SCP-4544's anomalous properties have extended to the storage locker it is held within, rendering further testing nearly impossible.
Addendum:
Document F:239
Document F:239
Experiment Log ██/██/████
Proposal: These experiments are meant to provide the basic foundation for the exact nature of SCP-4544. With these experiments, we hope to replicate the behavior of SCP-4544 revealed upon its initial discovery, under laboratory conditions. - Dr. Brooks
[PROPOSAL APPROVED] - Senior Researcher Dr. █████████
TEST #1
Success
N
Subject(s)
D-936
Protocol
Subject would be instructed to enter the research cell and lift the lid of SCP-4544.
Results
The door of research cell 293-C became jammed, and D-936 was due for testing at another location before staff was able to fix the door.
Notes
We may have to get creative if we ever want to use room 293-C again. – Dr. Brooks
TEST #2
Success
N
Subject(s)
D-972, D-254
Protocol
D-972 would be instructed to enter the research cell and prop open the door, but not to open SCP-4544 under risk of termination. D-254 would then be instructed to enter the research cell and open the lid of SCP-4544.
Results
D-972 successfully entered the cell and propped open the door. However, D-254 failed to arrive at the testing location, as a small D-class riot broke out one hour earlier resulting in D-254’s termination.
Notes
It appears we are still able to interact with SCP-4544 as long as we do not intend to open it, but the extent of its anomalous capabilities is concerning. It may have caused the riot, or made us pick the D-class that would be terminated. – Dr. Brooks
TEST #3
Success
N
Subject(s)
D-972
Protocol
With the door of the research cell propped open, the subject would be instructed to enter the research cell and open the lid of SCP-4544.
Results
The subject entered the cell but refused to open SCP-4544 upon discovering the results of the last experiment, and concluded that anyone who was going to open the box would die. The subject was threatened with termination if they did not comply, which resulted in D-972 attacking security, ending in the subject’s termination.
Notes
It is again unclear if SCP-4544 influenced the behavior of the subject, or if it somehow “chose” this subject against our knowledge. In the future, we must more carefully consider how the subject is likely to behave. – Dr. Brooks
Document F:240
Document F:240
Experiment Log ██/██/████
Proposal: It is possible that the object’s anomalous properties only prevent us from opening the container, not necessarily preventing us from learning what’s inside. Therefore, an intangible SCP such as SCP-126 could potentially bypass any anomalous effects of the object. As SCP-126 has shown to be cooperative with Foundation staff, we propose using SCP-126 to observe the contents of SCP-4544. – Dr. Brooks
[PROPOSAL APPROVED] – Senior Researcher Dr. █████████
TEST #1
Success
N
Subject(s)
SCP-126, D-628
Protocol
SCP-126 and D-628 would be instructed to enter the research cell, and D-628 would be instructed to move the container into the region SCP-126’s head occupies without opening the box. SCP-126 would then be instructed to describe the contents of the container.
Results
D-628 arrived at the testing location at 13:35 without incident and appeared cooperative when told what their instructions would be, and what SCP would be joining them within the experiment. At 14:10, SCP-126 arrived without incident along with its handlers and expressed interest in aiding the researchers.
As D-628 and SCP-126 were being given the final briefing before the experiment, Senior Researcher Dr. █████████ began to convulse violently before collapsing and becoming catatonic. As staff attempted to resuscitate Dr. █████████, the body became animate and revealed several spider-like appendages protruding from their back, characteristics consistent with a stage seven (7) host of SCP-940. At 14:43, Site-14 declared a biohazardous Keter-level containment breach and quarantine procedure Orkin-4 was triggered, containing the SCP-940 host, staff, and subjects within the experiment observation room overlooking cell 293-C.
The SCP-940 host successfully infected the remaining staff members and D-628, before being terminated by the security personnel present. Approximately 30 minutes after the quarantine was triggered, Mobile Task Force Omicron-7 entered the affected region and successfully administered an intravenous anti-parasitic compound to the infected survivors and incinerated the remains of the SCP-940 host without further incident.
After these events, SCP-126 expressed great agitation and an intense desire to not continue any further testing regarding SCP-4544. A staff psychologist was assigned to SCP-126 to help it cope with the events it had witnessed.
Notes
An investigation revealed that Dr. █████████ became unknowingly infected with SCP-940 larvae 51 days prior to the experiment, 9 days before SCP-4544 came into Foundation custody. In addition, the faulty containment equipment for SCP-940 larvae that were found responsible for the containment breach was designed approximately 4 years prior to the experiment.
This event has given evidence to the hypothesis that the more infallible of an attempt is made at viewing the contents of SCP-4544, the more extreme the retaliation becomes out of necessity. For this reason, the use of any anomalous objects to attempt to observe the contents of SCP-4544 is now prohibited, and any seemingly “foolproof” method of observing the contents of SCP-4544 are strongly advised against. – Dr. Brooks
Document F:241
Document F:241
Experiment Log ██/██/████
Proposal: It has been made clear at this point that the contents of SCP-4544 cannot be observed by any conventional means. However, if the contents of SCP-4544 are indeed alive and sentient as suggested by the note, we may be able to encourage it to evacuate its current container in exchange for another, thereby providing a basis on which the Foundation may be able to communicate with SCP-4544. - Researcher Klein
[PROPOSAL APPROVED] - Senior Researcher Dr. Brooks
TEST #1
Success
Undetermined
Protocol
The experiment is to be conducted in an observerless, non-recorded environment. SCP-4544 is to be placed in a remote-controlled hydraulic press, and a shoe box of matching dimensions is to be placed fifty (50) centimeters away from the press. The press would then be triggered to impart a continuous 180 Newtons of force on SCP-4544.
Results
Following the experiment, SCP-4544 was found to be fully intact and unscathed, while the press had been entirely and neatly disassembled through unknown means. While the experiment was in progress, Researcher Klein had reportedly entered an absence seizure state, and remained unresponsive to all stimuli for approximately 5 hours.
Upon regaining the ability to talk, Researcher Klein partially described what they experienced while in this state, and expressed that they lost the ability to see (See Interview Log 1043). Upon examination, it was found that the phrase "Leave me alone" had been engraved within Researcher Klein's retinas. It should be of note that Researcher Klein was remotely operating the machine approximately 50 meters away while the experiment was taking place.
Notes
This is the first time SCP-4544 has shown the ability to manipulate its environment outside of its initial anomalous capabilities, and has even managed to communicate, albeit through a harmful medium. While this experiment has yielded interesting results, further testing along these lines would be unwise at best. Admittedly, subjecting this object to an experiment that could potentially destroy it can be seen to go against many of the Foundation's principles, and therefore no more experiments of this nature will be approved. - Dr. Brooks
Interview Log 1043
Interview Log 1043
Interviewed: Researcher Klein
Interviewer: Senior Researcher Dr. Brooks
Foreword: This interview took place after the events of the experiment in Document 241, once Researcher Klein regained their ability to talk.
<Begin Log>
Brooks: Do you have any recollection of what took place five hours ago?
Klein: (Incoherent)
Brooks: Can you understand me, Klein?
Klein: Sorry, yes.
Brooks: Did you observe what's inside SCP-4544?
Klein: Why are you so interested in what's inside the box? It doesn't want to hurt anyone, just forget about it.
Brooks: You are aware you were conducting the experiment, correct?
Klein: It's not important. It's just a box, whatever is inside clearly just wants to be left alone, so let it be. The outside world is a confusing and overwhelming place, and I don't blame it for just wanting to shut itself inside.
Brooks: Can you tell us about your experience, at least?
Klein: I'm sorry, the more I say the more curious you'll get, I don't want this mistake to be repeated. Just shove the box into some deep storage locker and forget about it, I'm done with it. I don't want anything more to do with it. Now would someone check out my eyes? I still can't see anything. I just want to forget about this whole thing.
<End Log>
Closing Statement: After a medical examination, Researcher Klein was administered Class A amnestics at their own request.
|
SCP-1427 is a featureless 14m x 2m x 2m beryllium bronze stele.
|
***
Item #: SCP-1427
Object Class: Keter
Special Containment Procedures: SCP-1427 is to be contained on-site at the Ryugyong Containment Operations Center ("RCOC"), operated by the Foundation in partnership with the Korean People's Army ("KPA"). Due to the artifact's effects, Foundation personnel are not to enter the DPRK, approach to within 130 km of the SCP-1427 exclusion zone, or attempt to interact directly with the object itself. Foundation personnel are to provide remote support to on-site DPRK personnel. Under no circumstances are Foundation personnel to attempt to dissuade KPA containment staff from incorrect or unusual beliefs concerning the nature of their duties at the RCOC or the nature of their national government.
As authoritarian-submissive personality traits provide conditional immunity to the signal broadcast by the artifact, Foundation personnel assigned to offsite monitoring must meet the following psychological testing criteria:
Standardized Milgram Compliance Panel: >71
IPIP Openness Panel: <39
RWA Authoritarian Submission Panel: >17
RWA Conventionality Panel: >31
At present, only three national governments possess citizens with conditioning suitable for containment of SCP-1427: the Republic of Turkmenistan, the Republic of the Union of Myanmar, and the Democratic People's Republic of Korea ("DPRK"). Of the three suitable containment areas, political issues render North Korea the only government suitable for long-term containment. Accordingly, embedded Foundation affiliates in UN Security Council member states shall take no action tending to destabilize the DPRK, promote democratization, or permit the entry of psychologically-unsuitable foreigners into the 600-meter red zone surrounding the Ryugyong complex. In the event of democratization, destabilization, or nuclear war, Foundation intergovernmental liaisons shall attempt to transfer the object to a designated secondary containment site.
In the event that no secondary containment sites are available, the primary containment site and its surrounding environment are to be thermally sterilized, using non-nuclear force, without regard to the risk of civilian casualties. Using presently-available techniques, thermal sterilization of Pyongyang and surrounding environs bears a 91% chance of containment failure. Catastrophic containment failure is predicted to constitute a EK-class event, resulting in the extinguishment of all human consciousness within approximately 215 days.
Description: SCP-1427 is a featureless 14m x 2m x 2m beryllium bronze stele. Though originally recovered in an inactive state, the artifact presently produces a directional electromagnetic pulse every 7ns. Disrupting or jamming the pulse reduces, but does not eliminate, the artifact's primary effects. The device's electromagnetic effects are therefore theorized to be a carrier wave for, or side-effect of, the device's primary function.
Targets are selected randomly from the 20,736 (12^4) nearest human subjects, ignoring those already exhibiting the effects of the pulse, but including those who are immune. The device appears to have no effective maximum range: on several occasions, the device has exhibited the ability to make over-the-horizon broadcasts to otherwise occluded subjects by deflecting its signal off of the Earth's ionosphere. The artifact's means of detecting human consciousness, and the causative mechanism underlying its effects, are presently unknown.
Upon receipt of the signal, subjects permanently experience increased suggestibility, severe abulia, and short-term memory loss. These effects are secondary to the artifact's primary effect, which is substantial reduction in prefrontal SQ2 signal. Due to information recovered from SCP-███, Foundation researchers presently believe that this reduced SQ2 signal corresponds to a significant reduction in, or total destruction of, the subject's subjective consciousness. Moderate authoritarian-submissive personality traits appear to provide conditional immunity to the effects of the broadcast; accordingly, since its activation, containment protocols have required placement in high-population-density areas subject to a totalitarian government.
SCP-1427 was originally recovered from a Cistercian monastery in southeastern Algeria by Italian special forces in January of 1938. Laboratory notes from that period mention a rhodium carbide outer casing, embossed with lettering in a known but poorly-characterized Semitic alphabet. That outer casing is presumed to have been destroyed or lost by Italian researchers before the object's transfer to Leipzig in 1944. Between 1938 and 1944, the governments of Germany and Italy attempted to activate the artifact, both without success. In the immediate aftermath of World War II, the object was kept in East German custody. The East German government took no recorded action with respect to the artifact.
In 1947, the East German government transferred SCP-1427 to Soviet control, who moved it to Kyshtim, Chelyabinsk Oblast, USSR. In September of 1957, Soviet researchers intentionally activated SCP-1427. Though the artifact affected human targets in its immediate surroundings, then-existing features of the Soviet government prevented the EK-class end of human consciousness. After attempted nuclear sterilization of the affected area, the Soviet government contacted the Foundation through intergovernmental liaisons, and the artifact was transferred to Foundation custody at Site 67, southwest of Chernhiv, Ukraine. Since initial containment, the artifact has only been transferred once: in 1986, due to predicted instability in the Soviet government, the artifact was transferred to the Democratic People's Republic of Korea.
Shortly thereafter, the Foundation commenced construction of the Ryugyong Containment Facility, where the object has been stored since its completion in 1988.
Addenda:
+ SCP-1427-ETR-3: ETHICS COMMITTEE DISSENT, SCP-1427
- SCP-1427-ETR-3: ETHICS COMMITTEE DISSENT, SCP-1427
On December 5, 1991, a nine-member panel of the SCP Foundation Ethics Committee decided, after a 2-4-3 plurality vote, to actively support the government of the Democratic People's Republic of Korea ("North Korea") in order to effectuate containment of SCP-1427. In summary, the deciding plurality found the following points in favor of limited stabilization and support:
Instability and increasing political openness may soon render the USSR unsuitable for containment of SCP-1427.
In the event of political instability in North Korea, the device may be safely transferred to the custody of the People's Republic of China or Indonesia.
North Korea's closed borders limit the risk of exposing foreigners.
Due to limited trade opportunities, Foundation affiliates and liaisons are better able to manipulate North Korean internal policy toward effective containment.
Despite the clear benefits of the above, we dissent.
Experimentation has demonstrated that SCP-1427 requires no more than 12^4 psychologically suitable individuals in close proximity to the object in order to maintain seamless containment. With that in mind, maintaining over twenty million individuals in a state of perpetual, involuntary totalitarian abjection is an unacceptable cost to impose on human subjects. While it is clear that, in 1957, doing so was a necessary accession to certain facts on the ground (viz., Soviet failure to destroy the object outright), the Foundation has recruited 9,724 D-Class candidates since that date, or just under half the population required to successfully contain the object. Though unclear in 1957, it is now scientifically demonstrated that totalitarian indoctrination may be recreated under laboratory conditions with relatively little sophisticated intervention by researchers (see Zimbardo, P, "On 'Obedience to Authority,'" [REFERENCE OMITTED]). Our failure to do so is an ethical failure of catastrophic proportions.
The majority opinion in this review declined to authorize experimentation into artificial totalitarianism on the necessary scale, citing both practical and ethical concerns. They believe that it would be unacceptable to create a totalitarian society in miniature to prevent the end of all mankind. But in order to avoid creating an ethical disaster in miniature, we have authorized one writ large: totalitarianism which selects individuals by a birthright lottery and not by any particular antisocial acts. As recent events in the USSR and elsewhere have demonstrated, totalitarian dictatorship is not a necessary feature of human society. It is a phase of development which occurred and will someday pass, and it is not the Foundation's right (nor even its duty) to permanently arrest the development of the North Korean people for some greater good, no matter how great that good may be.
The majority are demonstrably correct that taking appropriate action to contain SCP-1427 would involve extraordinary moral compromises by the Foundation, whereas mere abdication of our responsibility shares this ethical burden with all humanity and the North Korean leadership. But when we signed our recruiting paperwork, we consented to bear that burden: to do what must be done for the greater good, no matter the cost. That we now impose this burden on the people of North Korea, rather than shouldering it ourselves, is an unacceptable abdication of our responsibilities as Foundation employees.
For the foregoing reasons, we the undersigned dissent, reserving the right to appeal this decision to the O5 council.
█████ ████
[SIGNATURE OMITTED]
Ethics Committee Supervisor, Site 9
████ ██████
[SIGNATURE OMITTED]
Ethics Committee Supervisor, Site 53
+ SCP-1427-ACR-2: SUMMARY, ARCHAEOLOGICAL REPORT, SCP-1427
- SCP-1427-ACR-2: SUMMARY, ARCHAEOLOGICAL REPORT, SCP-1427
CASE REPORT, TAMANRASSET OSSUARY, 4/21/1993: FILE WITH SCP-1427
PRINCIPAL INVESTIGATOR: Usman Azmaggan, Ph.D
PROJECT PHASE: IIA
BACKGROUND: Following the disputed SCP-1427 Ethics Committee report of 05/12/1991, O5 authorized phase-two research toward decommissioning or permanently deactivating SCP-1427. As part of the Team B decommissioning initiative, O5 rescinded Standing Order 75128, which prohibited Foundation members from disturbing archeological sites belonging to the Pleistocene Afro-Asiatic Culture Group ("PACG"). Following the order's revocation, MTF-Rho-293 ("Et Laharog") responded, excavating the site where SCP-1427 was believed to originate, 71km SSW of the city of Tamanrasset, Algeria.
DISCUSSION: Originally discovered by aerial radiographic survey in 1967, the Tamanrasset Ossuary was cataloged and monitored as a PACG archaeological anomaly and assigned low containment priority due to its minimal consensus risk. Upon arrival at the site in February of 1992, Rho-293 found the site substantially undisturbed and the radiological hazard intact. Deep soil strata analysis discovered high levels of trinitite, Pd-107, U-233, U-235, Pu-239, and radioactive decay products consistent with an incomplete fission event roughly 70,000 years prior to the site's discovery. This failure of nuclear fission appears consistent with samples taken from the Kyshtym containment area after the failed detonation of the Soviet failsafe device.
The central site occupies a single blast crater of roughly .75km in diameter, centered on a rectangular depression indicating the existence of a subsurface structure. Disturbance of soil strata indicates that SCP-1427 was likely removed from this subsurface structure at some time prior to the year 1600 AD. In addition, the site appears to have been disturbed both before and after removal of SCP-1427. Site containment appears to have been successfully maintained after 1967. Apart from SCP-1427, no intact artifacts were retrieved from the central area of the site. Like other PACG sites, intact artifacts, remains, and complete texts appear to have been systematically destroyed by later sapiens sapiens populations, except where object size or durability made destruction impracticable.
The peripheral area occupies a single undisturbed geological stratum indicating continuous, low-intensity occupation between approximately 71000 BC and 68000 BC. Artifacts recovered from the site display features common to other PACG sites, including the following characteristics:
Substantial radiological contamination;
Midden deposition and ossuary contents indicating substantial infant mortality;
Vandalism or iconoclasm by archaic sapiens sapiens;
Use of beryllium bronze as a structural material;
Artifacts bearing markings in PACG-Semitic Rectilinear Alphabet B.
Remains recovered from the site indicate cohabitation by Homo sapiens idaltu and a second, unidentified hominid species provisionally designated as Homo sapiens descensus. Relative to the hominin baseline, descensus remains exhibit gigantism and functional postaxial polydactyly, with a median of six digits per limb. Presuming femoral proportions consistent with the human norm, the subspecies' median male height was 7'6", and mean female height was 7'2". Craniometry based on recovered fragments indicates a brain volume of roughly 520cc. Though populations of idaltu increase throughout the period of cohabitation, descensus populations remain static.
Above the radiation-bearing geologic stratum, no members of the descensus subspecies are found, though intermittent idaltu occupation continues until approximately 63,000 BC. In approximately 61,000 BC, nonresident idaltu populations appear to have engaged in a concerted effort to excavate and destroy artifacts belonging to the PACG culture, with a special focus on removing and destroying descensus remains. As few identifying artifacts related to the later idaltu population remain, the reasons for this period of late iconoclasm remain obscure.
CONCLUSION: Though the intended purpose of SCP-1427 remains obscure, its function appears to have been related to the subjugation of early Homo sapiens sapiens by Homo sapiens descensus. Resistance to nuclear attack appears to have been a high priority for PACG engineers: all remaining PACG artifacts appear to have been constructed for high resistance to neutron flux, and many have been recovered from what appear to be the sites of prehistoric nuclear attacks. As PACG artifacts appear to directly interfere with nuclear fission, it is the unanimous recommendation of Rho-293 that decommissioning efforts focus on conventional arms or disassembly, and that recovery of the artifact's sheath or other complete PACG texts be made a containment priority.
|
SCP-551 is a standard, five hundred and fifty (550) piece jigsaw puzzle, which should depict, in its finished form, the image of a solitary woman on a small rowboat, surrounded by a stormy sea.
|
***
Item #: SCP-551
Object Class: Safe
Special Containment Procedures: SCP-551 is to be contained in a simple cardboard box. It must be of an adequate size to carry all pieces of SCP-551. The box should be stored in a locker unit on Storage Site-23 and at least one (1) Level 1 staff member is to be notified in the event of its removal.
Description: SCP-551 is a standard, five hundred and fifty (550) piece jigsaw puzzle, which should depict, in its finished form, the image of a solitary woman on a small rowboat, surrounded by a stormy sea. However, due to the nature of SCP-551's anomalous qualities, some details of the scene are left incomplete, such as the woman’s face and [DATA EXPUNGED].
SCP-551 was found in the apartment of ███ ████ after other residents complained of an odor seeping out from under the door. The severely malnourished body of ███ ████ was discovered beside SCP-551, with several pieces still clutched in her hand. Roughly one third of SCP-551 was pieced together on her floor.
Multiple subjects testing SCP-551 stated that a completion of the puzzle seems inconceivable. The mental reactions of subjects to SCP-551 was diverse, apparently depending less on the puzzle and more on the personality of the subject (see Addenda 551-1/2/3), though the effects of SCP-551 on the psychology of subjects should not be overlooked.
Addendum 551-1
Standard Class-D personnel is tasked with piecing together SCP-551. Subject spent two weeks in a single room, trying to finish the puzzle, and pausing only to sleep. Subject became increasingly frustrated with his progress on SCP-551, which failed to span past forty (40) connected pieces after this time. Subject slept less during his last days working on the puzzle, and was permitted to stop when he [DATA EXPUNGED].
Addendum 551-2
Class-D personnel with a history of addictive behavior is tasked with piecing together SCP-551. Subject acted aloof about the assignment at first, but after connecting two pieces, she seemed to become alarmingly obsessed with SCP-551. Subject stayed beside it for days, sometimes screaming about her lack of progress. After a period of four weeks, subject lost consciousness from lack of sleep, and the test was ended. One hundred and two (102) pieces of SCP-551 had been connected.
Addendum 551-3
Dr. ██████, who scored above average on a standard IQ test, expressed skepticism about SCP-551 and was approved to test it. Dr. ██████ completed all but a couple of sections, specifically the woman’s facial features and [DATA EXPUNGED]. Despite this success, Dr. ██████ showed confusion over his remaining pieces and adopted a fatalist attitude toward the puzzle, finally refusing to complete it after four days.
Addendum 551-4
A computer-based approach was taken on the completion of the puzzle. The first tool used was a mechanical arm designed to take a piece and place it in the puzzle, used along with a camera and a desktop computer running an image processing algorithm. The application was tested extensively with normal puzzles; however, when tasked with completion of the puzzle, it would invariably trigger a blue screen or a kernel panic as soon as it finished scanning the piece. An embedded design approach was taken, and the computer was replaced by a microcontroller in charge of moving the piece linked to an image processing DSP; however, the value of the program counter register in all the CPUs would corrupt as soon as the DSP finished scanning the picture of the piece, and in several occasions a sudden, unexpected current peak would result in damage to the CPUs and other components. Automated solutions, therefore, had to be discarded.
|
SCP-1131 is a member of the species Culiseta longiareolata, and appears under direct observation as a normal specimen of that species.
|
***
Item #: SCP-1131
Object Class: Euclid
Special Containment Procedures: Instances of SCP-1131 brought into captivity are to be kept in 1m x 1m x 1m acrylic vivariums for the remainder of their lives (usually no more than a few weeks). Persons affected by SCP-1131 (given the group designation SCP-1131-1) are to be kept in a standard persons holding cell for further research.
Foundation personnel stationed in places where instances of SCP-1131 have manifested should wear insect repellent containing p-Menthane-3,8-diol at all times. Personnel entering an SCP-1131 containment unit must wear a full Level A hazardous materials suit. Any bites made by SCP-1131 on any person must be noted, and any persons bitten must immediately be detained.
Description: SCP-1131 is a member of the species Culiseta longiareolata, and appears under direct observation as a normal specimen of that species. Instances of SCP-1131 range in size, but are on average approximately 8 mm long and weigh on average 1.7 milligrams. Instances of SCP-1131 refuse to feed from animals other than mammals. SCP-1131 appears to be of intelligence limited to its species, and acts on instinct alone.
When a female SCP-1131 bites a mammal, the affected person or animal (immediately given the designation SCP-1131-1) begins a physical transformation lasting several days. First, the subject loses consciousness and enters a comatose state. Then, beginning at the site of the bite, the tissues of SCP-1131-1 begin to change, starting with the dermis and progressing inward toward muscular and skeletal structures. All subjects take on the same physical appearance and attributes: that of a Caucasian human male named Oscar Peleschak, age 57.
Subjects usually awaken within 24 hours of the completion of this transformation. Subjects affected by SCP-1131 are indistinguishable from each other after the completion of this transformation. All subjects claim to be Oscar Peleschak and show signs of distress upon awakening. When asked for the last remembered calendar date, subjects offer September 5, 1968.
If two or more members of SCP-1131-1 are introduced, they will all claim the other or others to be impostors, and become distressed with the presence of the other or others. If this encounter is allowed to escalate, these arguments will become heated, but no subjects will resort to physical violence, due to self-proclaimed pacifism.
It is unknown how many instances of SCP-1131 exist. When instances of SCP-1131 breed, not all offspring (less than 1%) exhibit SCP-1131's effect. There does not, at this time, appear to be any way to reverse the effects of SCP-1131.
A member of SCP-1131-1 after arrest for insurance fraud, January 1969.
Addendum: SCP-1131 was recovered in ██████, Massachusetts, when an embedded Foundation agent noted several discrepancies in local vital records. Of note was the fact that an individual named Oscar Peleschak had multiple vital records indicating date of death, but all had been redacted by local authorities. ████████ ██████ Life Insurance Company had investigated Oscar Peleschak multiple times, and criminal charges for insurance fraud were filed in 1969, but ultimately were not pursued due to lack of evidence.
The only birth record of Oscar Peleschak was issued in 1911 at ██ ██████ Memorial Hospital. The first death certificate of Oscar Peleschak was issued by that same hospital on September 7, 1968 with the cause of death listed as [REDACTED]. It is hypothesized that this is the 'original' Oscar Peleschak and the subject identified in these records was given the designation SCP-1131-0. Exhumation of the body indicated no genetic differences between SCP-1131-0 and any members of SCP-1131-1. Furthermore, forensic analysis of the body indicates that some physical damage, namely skeletal scarring from a broken wrist estimated to be several decades old at time of death, exists in all members of SCP-1131-1 as well.
SCP-1131-0 was married at the time of his death to Mary Peleschak, now deceased.
Currently, records indicate 47 separate instances of SCP-1131-1, of which 4 are still alive, currently detained at Site ██. No members of SCP-1131-1 retain any recollection of the experiences of past members of this group.
Addendum 1131-A: Once SCP-1131 initiates a feeding sequence, there does not appear to be anything which will reverse, hinder, or stop its effect, including laceration of affected skin, amputation, or death.
Addendum 1131-B: List of known individuals affected by SCP-1131:
[DATA EXPUNGED]
Addendum 1131-C: Transcript of video interview with a member of SCP-1131-1:
Interviewed: SCP-1131-1
Interviewer: Dr. ███████, Clearance Level 2/1131-937-439
(SCP-1131-1 sits on camera in an orange jumpsuit, sipping a cup of coffee. Dr. ███████ sits just off camera, only his arm visible. This member of SCP-1131-1 was detained shortly after entering a comatose state and has been isolated since that time.)
Dr. ███████: Please state your name for the record.
SCP-1131-1: My name is Oscar Peleschak. I've told you that before.
Dr. ███████: What is the last thing you remember before waking up at this facility, Mr. Peleschak?
SCP-1131-1: Well…I just got off of work, and I called a cab to get home. I got in the cab, and the driver was jabbering at me, and I wasn't paying attention too much. Then I got home, said good night to the missus, read a book, got in bed, and woke up here.
Dr. ███████: Did you experience any sort of discomfort at the time? Any itching or burning sensations in your skin, like those from an animal bite.
SCP-1131-1: Not that I remember. Can I go now? I ain't done nothing wrong. I got a wife to get back to, y'know.
Dr. ███████: I'm sorry, Mr. Peleschak. You will not be allowed to leave.
SCP-1131-1: Why? I ain't done nothing wrong! I've got rights, you know!
<End of log>
|
SCP-3842 is a standard 5 millimeter red LED that emits a variable voltage of static electricity from both its cathode and anode leg, even if it is not connected to anything else.
|
***
Item #: SCP-3842
Object Class: Safe
Special Containment Procedures: SCP-3842 must be kept within a safe with a 10x10x10 centimeter interior, with a 2 centimeter thick rubber padding on all sides. A blast-resistant camera has been placed within the safe to monitor SCP-3842 at all times. Any time SCP-3842 is removed from the safe, it must be handled with insulated rubber gloves.
Description: SCP-3842 is a standard 5 millimeter red LED that emits a variable voltage of static electricity from both its cathode and anode leg, even if it is not connected to anything else. The brightness of the LED directly correlates with the outputted voltage level. SCP-3842 can produce anywhere from 0 to 8192 volts.
SCP-3842 was initially discovered following a house fire in a suburban neighborhood of ███████████, Ohio. SCP-3842 was determined to have been on a desk in the house's garage, and was likely the source of the fire. Reports from local authorities have shown that while the home had 4 residents, only 3 were found, one of which having been killed by the fire. Foundation assistance was requested after several searches conducted to locate this fourth civilian, a 38 year old male by the name of Robert ███████, were largely unsuccessful. Each resident has been designated PoI-3842-1 through 4, with PoI-3842-4 referring to Robert.
Addendum 3842.1: Interview Log
+ Open File
- Close File
Interviewed: PoI-3842-2
Interviewer: Dr. ███
Foreword: PoI-3842-2 is the wife of PoI-3842-4, Susan ███████. This interview was conducted approximately one week after the incident. PoI-3842-2 was unaware of Dr. ███'s affiliation with the Foundation, instead believing him to be a local government official.
<Begin Log>
Dr. ███: Good afternoon, Mrs. ███████. I hope that all of this isn't too stressful for you; you've been through a lot recently.
PoI-3842-2: Thanks, and you too… Have you found anything at all on Robert? I'm worried sick about him, I don't want to lose him too…
Dr. ███: I'm afraid not, Mrs. ███████. The only evidence we could find was a small, electronic LED. Would you happen to know anything about something like that?
PoI-3842-2: Well, Robert did get Jonathan1 an electronics kit for his birthday, which… would've been today… The last thing he said to me was that he was going to make Jonathan's present special for him. He really loved that boy, he wanted to show him as much of the world as he could…
PoI-3842-2 looks towards the ground, with tears beginning to form in her eyes.
Dr. ███: Take your time if you need to, I understand that this is quite upsetting for you.
PoI-3842-2: It's… It's fine. I still have my baby girl Hope2 to keep me company, at least.
Dr. ███: Okay. For the sake of record-keeping, would you mind telling what exactly happened when your house burned down?
PoI-3842-2: Sure, um… I was just making dinner, I thought the smoke detector was just going off again because I'm terrible at it. Jonathan… he really was the investigative type, always looking too far into things… he didn't believe it was because of me. He went down to the garage and saw the flames, yelling for me to grab Hope and get out of there. He was determined to rescue his father… I never saw either of them again…
Dr. ███: I'm sorry, Mrs. ███████. That seems to be all the time we have for today. We'll be sure to keep you informed if we do find anything.
<End Log>
Addendum 3842.2: Recovered Document
The following was found on a folded sheet of paper in one of the pockets of PoI-3842-3.
+ Open File
- Close File
-.. --- - / -... --- -.-- / .- -. -.. / -.. .- ... .... / -- .- -. / -.- . . .--. .. -. --. / . ...- . .-. -.-- --- -. . / ... .- ..-. . / ..-. .-. --- -- / - .... . / . ...- .. .-.. / -.. .-. .-.-.- / . .-.. . -.-. - .-. --- -.3
Pictured below is a drawing in crayon of what appears to be PoI-3842-3 and PoI-3842-4 in costumes similar to that of stereotypical superhero characters.
Footnotes
1. Referring to PoI-3842-3.
2. Referring to PoI-3842-1.
3. This appears to be Morse code that translates to "DOT BOY AND DASH MAN KEEPING EVERYONE SAFE FROM THE EVIL DR. ELECTRON". Research into this and any possible connection to SCP-3842 is ongoing.
|
SCP-644 is a male humanoid of Italian descent.
|
***
Item #: SCP-644
Object Class: Euclid
Special Containment Procedures: SCP-644 is to be held within a standard humanoid containment chamber within Hall ██ of Site-██. All staff or D-class in Site-██ known to have children are to be briefed of SCP-644's anomalous effects. Staff with children may opt out of testing with SCP-644 at any time.
Description: SCP-644 is a male humanoid of Italian descent. Visually, SCP-644 appears to be approximately 30 years old. The words "Mr. Hot, from Little Misters ® by Dr. Wondertainment" are tattooed on SCP-644's left inner wrist.
SCP-644 is able to accurately determine whether or not a person has children. Both biological and adopted children may be sensed by this effect. SCP-644 is aware of this fact for any person it knows of, even if just by appearance or name.
SCP-644 claims to be able to predict the material wishes of any child, as well as the popularity of any product intended for children. SCP-644 claims that this effect does not function for the wishes of adults, but has given predictions for at least one person over the age of 18, whom SCP-644 described as "a real trooper", with no further comment.
SCP-644 is able to produce a business card from the pocket of any clothing worn by it. On the front of the card is printed:
Mister Hot
Marketing Consultant
Doctor Wondertainment Inc. LLC
1515 Mulberry Lane, Chicago, South Africa
On the back of the card, in small print, is a document similar to Document 909-a.
+ Show document
- Close document
Wow! You've just found yourself your very own Little Mister, a limited edition collection from Dr. Wondertainment!
Find them all and become Mr. Collector!!
01. Mr. Chameleon
02. Mr. Headless
03. Mr. Laugh
04. Mr. Forgetful
05. Mr. Shapey
06. Mr. Soap
07. Mr. Hungry
08. Mr. Brass
09. Mr. Hot ✔
10. Ms. Sweetie
11. Mr. Life and Mr. Death
12. Mr. Fish
13. Mr. Moon
14. Mr. Redd (discontinued)
15. Mr. Money
16. Mr. Lost
17. Mr. Lie
18. Mr. Mad
19. Mr. Scary
20. Mr. Stripes
SCP-644 was originally found by local police in Racine, Wisconsin, where it was found sleeping in the entryway to a local elementary school, having broken a window to enter. SCP-644 claimed to have done this to escape winter weather conditions. An automatic Foundation webcrawler picked up a mention of SCP-644's tattoo in the files of the local police department, and it was acquired shortly after. Racine, Wisconsin, was later found to contain several anomalous objects created by "Doctor Wondertainment", in the possession of several local children.
Interview 1:
Foreword: Interview was conducted following initial containment, before SCP-644's anomalous properties had been ascertained.
<Begin Log>
SCP-644 is led into the interview room by security personnel outfitted with full fire-retardant gear, rated against temperatures up to 800 °C, and outfitted with Kevlar and foam padding in the case of explosive detonation. Personnel are also armed with high-capacity fire extinguishers.
SCP-644: What's up with these guys?
Dr. Latimer: Please state your name for our records.
SCP-644: I'm Mister Hot. Marketing consultant for Doctor Wondertainment, incorporated, ell-ell-see.
SCP-644 holds out wrist, pointing to the tattoo. Security personnel prepare to extinguish any potential fires.
SCP-644: The tattoo, see. That was my idea. Because I keep my finger on the pulse of the market, eh?
Dr. Latimer: You had say in where your tattoo went?
SCP-644: Yeah. Me and the doctor, we were pretty close. Think I went to college with him.
Dr. Latimer: Where was that?
SCP-644: Oh, I don't know. Does anyone really remember that stuff? So, how are you?
Dr. Latimer: I'm doing fine. Could you tell me about your relationship with 'Wondertainment'?
SCP-644: 'Fine'? I mean, I'm sure you're missing the kids, right? They're with your husband?
Dr. Latimer: What do you know about my children?
SCP-644: I know that they miss you. They don't— I mean, they don't even know what you do. This certainly isn't a university, right? Unless they've got some 'relaxed testing protocols', ha. It's been, what, two weeks since you saw them?
Dr. Latimer: Go on.
SCP-644: See, what I'm thinking is, you need to let them know they're loved. I mean, Jason… last semester, he got an A- in math! And that just went unrewarded? That's cold, doctor.
Dr. Latimer: You're right. What should I do?
SCP-644: I think, you give me the word, and I'll put some word in higher up. No guarantees, but I'll see what I can do.
Dr. Latimer: What exactly can you do?
SCP-644: Well, I can talk to my friend upstairs— I call him "Mister Distributor", but he's not really. It's just a nickname. His name is Steven. But, I talk to him, and, if we find your kids are 'up to snuff', so to speak, I can get them some stuff to play with. Could even wrap it up, put "from mommy" on there.
Dr. Latimer: I'd have to know more. Need to know your toys are safe, of course.
SCP-644: Yeah, how about- how about we talk about this a bit later? Without these… eavesdroppers around?
SCP-644 motions to the security personnel.
Dr. Latimer: That sounds wise.
SCP-644: Alright! You know where to find me, ha. Here's my card.
SCP-644 produces a business card. Security personnel confiscate it and place it within a reinforced fireproof container.
<End Log>
Interview 2:
Foreword: Interview was conducted one day after initial recovery.
<Begin Log Excerpt>
SCP-644 is brought into the interview room. A 10-centimeter thick barrier composed of heat-resistant, blast-proof glass is erected between Dr. Latimer and the subject chair.
SCP-644: Oh, come on.
Dr. Latimer: Hello, Mister Hot.
SCP-644: Hi, doctor. Is this about the name? I'll be honest: I'm not that hot.
Dr. Latimer: It's just a precaution. Could you tell me more about what you mentioned yesterday? Your toys?
SCP-644: Oh, yes indeed. Wondertainment products are fully tested, come with a lifetime guarantee, and are designed to enrich your child's imagination through fun exploration.
Dr. Latimer: You mentioned something about children fitting some requirement to receive toys. Could you elaborate?
SCP-644: Well, you see, you can't just give this kind of craftsmanship to just anybody. You give the average kid a relativistic racecar, he's just gonna leave it on the shelf and go… stare at the sun or something.
SCP-644: No, no. We're looking for a higher caliber. Someone so imaginative… someone who will really appreciate the work that goes into this stuff. All around great kid.
Dr. Latimer: What kind of work? What do you do at 'Wondertainment'?
SCP-644: I mean, I don't want to go on about myself… This is about your kids, right?
Dr. Latimer: I need to know I can trust you as a source.
SCP-644: Smart, smart. I guess that's why you're the doctor, and I'm just mister. Ha. They call me a marketing consultant, but really, I'm involved at every step of the process.
Dr. Latimer: How did you become so valued by the organization?
SCP-644: Lots of hard work, I assure you. But at first, maybe luck. See, I was just a young guy, maybe thirty or so, but I get approached by this older guy, né Wondertainment, who offers me a chance to get really involved in something… special, you know?
Dr. Latimer: Didn't you say you knew 'Wondertainment' in college?
SCP-644: Yeah. But anyways, I start working with him. He wants someone who's got a real good market sense, you know? He says, "Hot. I'm full of so many ideas, but what to choose? I don't have forever. That's why I need you to sharpen my knife, give us some focus. I've got just the thing to let you do that."
SCP-644: So, I go under, and when I come back, it's like zap. I just… I know what ideas are gonna be hot. All the time. And I work with him, and we're going like gangbusters, spreading like mad. Me and him. And he says to me, "My mind isn't what it used to be, Hot. Let's hone your creative mind."
SCP-644: We do it again, and suddenly I'm a powerhouse. I'll come to him, like, "Doc, I've got an idea. How about instead of playing with your food, you can have an intelligent conversation with your food?"
SCP-644: And I'd say that to him, and he'd say to me "Hot, you have quite the melon on your shoulders" and I'd say "Wow, thanks, boss" and then he'd put a miniature melon on my shoulder and we'd both laugh. It's our little joke, see?
SCP-644: Well, was. Until it started making Headless feel self-conscious.
SCP-644: But we continued on like that, for… oh, it was years. I helped with every endeavor. One year, I thought "You know what kids love? Taking baths." or, "having imaginary friends", or "laughing at jokes", or… well, we had some weird years.
SCP-644: And in my twilight years, I started some pet projects. One of the projects literally became a pet, actually, like… the concept of it was animate. Got torched when it started biting fingers. But, boss, he said to me that he had a cool idea. And he told me about it, and I was just in love. So he gave me this tattoo, and told me my desk job days were complete. Actually, that I was complete. And that I needed to head out and start spreading the love. So many underprivileged kids… did you know one in five children live beneath the poverty line? They could use some Wondertainment, am I right? That was all about… seven years ago.
Dr. Latimer: And that's when you became 'Mister Hot'?
SCP-644: I was always Mister Hot, ma'am. Now, are you interested in my product, or what?
Dr. Latimer: What kind of toy did you have in mind?
SCP-644: Ah, I was thinking 'Dr. Wondertainment's Carpal Critters™'. It's a virtual pet, right? But it's not in a computer. It lives inside your forearm. Some local anesthesia, hollows the whole thing out. And then it's your friend! It can read you bedtime stories, do your math homework, whole rigmarole. And it's very understanding. You can yell at it, vent at it, tell it to get lost… and it'll forgive you, and be there to give your ulna a big hug when you make up! What do you say?
Dr. Latimer: I'll think about it.
<End Log>
|
SCP-230 is a male Caucasian with a lean build and gaunt appearance.
|
***
Item #: SCP-230
Object Class: Euclid
Special Containment Procedures: SCP-230 is kept in a secure room in Site-██. The room must have a controlled ventilation system so that air exiting the room can be properly filtered before it reenters the regular ventilation system of the complex. SCP-230 is to be given anything he requests that does not violate standard procedures for SCP containment. The door is set to automatically lock every time it closes and can only be opened from outside the room. Personnel entering SCP-230's room must wear a full HAZMAT suit with its own oxygen supply. Personnel exposed to the air in SCP-230's cell or who come in physical contact with SCP-230 or any of SCP-230's bodily fluids must be contained and held for observation for no less than one month. Personnel still exhibiting symptoms from SCP-230 after one month are to be terminated. If personnel are cleared by on-site staff after a month, they are then to be transferred and forbidden contact with SCP-230.
Due to recent events, subjects that have been exposed and cleared by staff are required to undergo regular psychological exams. If upon exam the personnel exhibits any of the traits shown in document 230-4436b, the personnel is to be terminated.
NOTE: Subject has made several escape attempts utilizing personnel exposed to SCP-230. This represents a low threat due to the fact that exposed personnel are usually impaired; however, personnel will become violent in order to stay in SCP-230's presence.
Description: SCP-230 is a male Caucasian with a lean build and gaunt appearance. SCP-230 is 185 cm (6 ft 1 in) tall, 68.04 kg (150 lbs), and appears to be in his early thirties. He wears bright clothing and prefers the colors pink and yellow. SCP-230 is a very cheerful individual who appears to be incapable of negative emotions.
SCP-230 secretes a chemical similar in composition to heroin from his pores. The chemical has been named Compound-███. Once secreted from his pores, it evaporates immediately and contaminates the air around SCP-230. Compound-███ seems to be effective in as little as thirty parts per million in gaseous form. When inhaled, Compound-███ causes extreme euphoria in subjects. Analysis on Class-D personnel under the effects of SCP-230 indicated they had dopamine levels greater than five times of what is expected during sexual climax. Subjects express impairment similar to the effects of heroin. Subjects become willing to comply with any request SCP-230 makes provided it does not involve leaving SCP-230's presence.
Compound-███ is present in all of SCP-230's bodily fluids. Exposure is possible even by contact with SCP-230's skin. Exposure to the compound will result in immediate addiction. Withdrawal symptoms are extreme and have a thirty percent mortality rate. Symptoms include: loss of appetite, tremors, panic, vomiting, diarrhea, irritability, dementia, insanity, blindness, and hemorrhaging, though symptoms vary from subject to subject. Symptoms typically last for around two weeks before subsiding. The symptoms appear to be determined by how much of Compound-███ the subject is exposed to. Subjects that ingest any of SCP-230's bodily fluid (i.e. saliva, blood, etc) have a mortality rate from withdrawal of 100%.
SCP-230 was found in an apartment in █████████ with twenty people acting as his servants. SCP-230 seemed to be actively attempting to limit the number of people he exposed. Several bodies of exposed persons were found on the premises. When questioned about them, SCP-230 replied, "Things were getting crowded, so I had to ask a few of them to stop breathing."
SCP-230 appears to be under the effects of Compound-███, but doesn't seem to be impaired by it in any way. Attempts to alter SCP-230's mood have proven ineffective. Use of various drugs known to cause depression only resulted in SCP-230 producing more of Compound-███ and thus were ineffective.
SCP-230 is a very friendly individual and will candidly engage in conversation with any personnel. SCP-230 is unaware of how or when he began secreting Compound-███. When questioned about his past, SCP-230 replied that he has been secreting Compound-███ as long as he can remember.
SCP-230 prefers to talk about things he considers "good" or "gay". SCP-230 has some psychological attachment to the word "gay". When asked to describe himself, SCP-230 used the word "gay" six times, "gaiety" four times, and the word "gayest" once when SCP-230 referred to himself as "the gayest man alive."
Note by Dr. ██████: SCP-230's preoccupation with the word "gay" has nothing to do with sexual orientation. SCP-230 doesn't appear to have a sexual orientation due to a lack of interest in sex entirely. This makes sense, seeing as SCP-230 experiences the same amount of pleasure doing any given activity, making sex unnecessary.
Addendum 230-1: Class 2 personnel researcher ██████ ███ was accidentally exposed to Compound-███ during research. ██████ ███ was detained and sent to treatment for the duration of withdrawal symptoms. After one month, ██████ ███ was released after being cleared by medical staff. Two months later, ██████ ███ was found trying to break into SCP-230's containment area. ██████ ███ reacted violently and injured several personnel before she was detained. ██████ ███ was terminated after examination, and precautions have been made to prevent further occurrence; see document 230-4436b.
Document 230-4436b: [DATA EXPUNGED]
|
SCP-1304 is a method of ritual murder which allows for the translation of a fictional character into reality.
|
***
Item #: SCP-1304
Object Class: Euclid
Hello
Special Containment Procedures: As there is no way of containing SCP-1304 itself, procedures must focus on finding, tracking, and observing all instances of SCP-1304-1. Agents embedded in the editorial departments of major publishers have been briefed on the specifics of SCP-1304 and will suppress or alter any manuscripts containing it, or which may lead to a sequel containing it. Keywords describing portions of SCP-1304 have been added to routine search protocols. In the event of publication of a work containing SCP-1304, efforts must shift immediately to finding the associated SCP-1304-1 instance.
Six (6) instances of SCP-1304-1 are in custody at Site-17. The Foundation is currently tracking seventeen (17) instances of SCP-1304-1. No action may be taken against any instance of SCP-1304-1 without prior approval from Head Researcher Applebaum.
Can you hear me
Description: SCP-1304 is a method of ritual murder which allows for the translation of a fictional character into reality. The ritual, which has no direct basis in any known culture, has a lengthy list of requirements which must be performed in a particular order, under specific circumstances.1 If the ritual is performed within a fictional narrative which is then printed by a major publishing house,2 no later than one week after the narrative's official release date, a child will be born whose life will mirror, as closely as possible, that of the character killed in the ritual. This child is an instance of SCP-1304-1. The SCP-1304-1 instances are seemingly unaware of the circumstances of their creation; those who have found or been told about their associated narrative have regarded it as a curious coincidence. For further information on how the details of the narrative character's life are translated into reality, see Addendum SCP-1304-MF below.
I can see you but I can’t touch you
Any and all attempts to alter the life of an SCP-1304-1 instance in a way explicitly contradicting the events of the narrative have failed completely. This was extensively proven in the Foundation's experiments on SCP-1304-1-27, who is the real-world equivalent of the character Lawrence Hopkirk from the novel In Our Lives by June Marshall.3 For example, in the narrative, Hopkirk's pet dog was struck and killed by a car on his seventh birthday. On the corresponding date, Foundation agents arranged a cordon on all streets within a 3-km radius of SCP-1304-1-27's home and temporarily rendered inoperable all vehicles within a 0.5-km radius. However, despite these precautions and the presence of more than one hundred agents, a drunk driver was able to slip through the Foundation cordon, evade pursuit, and strike SCP-1304-1-27's dog in the manner described. Even something as minor as SCP-1304-1-27's daily route to work (which was carefully described in the novel) was immutable, despite extensive efforts; combinations of mechanical failure, human error, and simple coincidence prevented any changes.
The one deviation in the life of a SCP-1304-1 instance from their narrative equivalent is the absence of SCP-1304 itself. All known instances of SCP-1304-1 have survived past the point at which they would be killed in the SCP-1304 ritual. After this point, direct intervention in the life of an SCP-1304-1 instance is possible. Action may or may not be taken against an instance based on the recommendation of Head Researcher Applebaum and/or the O5 Council. In all cases, observation of instances is continued after the death of their narrative equivalents.
Please let me back in, I want to come back in
There are seventy-six (76) known published narratives containing SCP-1304, with an equal number of associated SCP-1304-1 instances. Of these, fifty-one (51) are deceased, six (6) are in custody at Site-17, seventeen (17) are presently being tracked by the Foundation, and the whereabouts of the remaining two (2) are unknown.
I’m not supposed to be here
The Foundation has attempted to deliberately create instances of SCP-1304-1, by creating and publishing narratives containing SCP-1304 through established publishers and Foundation fronts. No attempts to date have succeeded. No further experiments along this line are planned. It is currently theorized that the author must have created the ritual for the book independently, or have been inspired by reading another book containing the ritual whose author was also independently inspired. Please contact Head Researcher Applebaum for further information regarding these attempts or to review the manuscripts published.
+ Notes on SCP-1304-1 Instances
- Notes on SCP-1304-1 Instances
Notes on SCP-1304-1 Instances: Events and circumstances in the lives of instances of SCP-1304-1 will resemble those of their fictional counterparts as closely as possible, with allowances made for circumstances which are impossible under current real-world conditions. If the character was born in a real-world location, so will SCP-1304-1 be; if the location was fictional, SCP-1304-1 will be born in a location as similar as possible. For example, in the book Bloodlove by Savannah K. Faye, the character was born in the fictional city of Largesse, Illinois; SCP-1304-1-09 was born in the town of █████████, Illinois, which had a similar population, history, and contained businesses and institutions analogous to those described in the book. In cases where the narrative takes place in a fantasy or science-fiction world, or any world largely distinct from Earth, SCP-1304-1 will be born in a culture similar to that of the character's culture and whose geography is similar to that of the character's birthplace. Other circumstances, such as the economic or social conditions of the character's family, will also be replicated closely.
They don’t want me here, they want to hurt me
This pattern will continue throughout the life of SCP-1304-1: if the character's parents died when s/he was four years old, the parents of SCP-1304-1 will die at the same time. Fantasy or science-fiction events, objects, and individuals will appear in an analogous real-world form: for example, the victim in Dragonveil by Donald Armande, Jr., had a pet dragon with whom she could communicate telepathically; the associated SCP-1304-1 instance had a pet horse with which she shared a strong emotional bond.
+ Experiment 1304-96
- Experiment 1304-96
Experiment 1304-96: In ██/201█, Agent Sibbitt, embedded with the publisher ███████ Press, discovered a narrative containing SCP-1304. As per protocol, she reported it to Head Researcher Applebaum. It was decided that, as the character killed would have minimal impact if "reborn" in the real world, and as circumstances of his birth would make him relatively easy to find,4 the Foundation would use the publication of this work to determine whether the number of readers has any effect on the outcome of the ritual.
The book, ███████ ██████ by ██████ █. █████, was published with a small print run. Prior to the official release date, the Foundation seized and destroyed via incineration all copies of the book.5 Three (3) days after the official release date, the SCP-1304-1 instance, later designated SCP-1304-1-63, was born with the described circumstances. It was concluded that the book's publication, not the number of readers, is the decisive factor in the creation of an SCP-1304-1 instance. Current standard procedure is to alter the narrative prior to its publication or suppress it entirely.
+ Partial Character List
- Partial Character List
Partial Character List: Below are listed several known instances of SCP-1304-1, along with the characters they are "based on," and a brief summary of relevant portions of their lives. Document 1304-P contains a complete list of known narratives; level 3 clearance is required.
Instance: SCP-1304-1-01, Ephraim Montrose
Character: Doctor Ephraim Montrose, from The Comedic Tragedie of Doctor Montrose (no author listed) in 16██. This is the earliest known narrative containing SCP-1304. It was a narrative ballad published as a broadside, and was apparently intended to be a parody of Christopher Marlowe's The Tragicall History of the Life and Death of Doctor Faustus. The titular character summons a troupe of demons to assist him in his alchemical research; these demons quickly become the focus of a cult and Montrose is unwillingly sacrificed as a "reward" for his bringing them to the mortal world.
Notes: The "real" Dr. Montrose became a medical doctor in London of some repute who was suspected of witchcraft. He was forced to flee his home and committed suicide in 16██.
Researcher ██████, embedded in the Vatican, discovered a copy of the original broadside in the archives, along with a note detailing the curious "coincidence" of the real Dr. Montrose. ██████ suspected a potential link; her followup investigation revealed similar historical cases (see Instances SCP-1304-1-02, 03, and 04) and led to its classification as an SCP object. Further investigation pinpointed the sacrificial ritual as the source of the anomalous effects.
Instance: SCP-1304-1-12, Warren James
Character: Warren James, from Grave Offenses by N.J. Dickinson in 1971. James is a serial killer in the town of Dearborn, Michigan, USA. Over the course of the novel, he murders three young women in the space of two months. To prevent further killings and "condemn his soul to Hell," his family members murder him via SCP-1304. However, the ritual results in James's spirit becoming a vengeful ghost and attacking his family for revenge.
Notes: When the Foundation became aware of SCP-1304-1-12, efforts were immediately made to prevent his murders. As noted above, all efforts to alter events explicitly described in the narrative were futile; the three women were murdered precisely as described in the novel. However, the Foundation was able to prevent the deaths of seven further individuals whom SCP-1304-1-12 attempted to kill in a similar manner. At the point in SCP-1304-1-12's life when his family committed the ritual in the narrative, they instead attempted to kill him via other means. The Foundation intervened and captured SCP-1304-1-12. He is currently imprisoned in Site-17.
Instance: SCP-1304-1-47, Andrzej Szczecinski
Character: Andrzej Styriski, from Quantum Terror by Edward Łukasiński in 1984. Styriski is a physicist born on the planet Styris III in the year 2123. He develops a "quantum propulsion drive" which moves a ship through the "quantum underverse" to transport it across interstellar distances in the space of hours. Over the course of the novel, he is pursued and ultimately killed by a "neo-Satanic cult" for "defiling" their "promised land."
Notes: Szczecinski was born in Wrocław, Poland.6 He earned a degree in aerospace engineering and received several patents for processes that are expected to be utilized in the next generation of high-speed jet engines. After the point of his character's death, he accepted a managerial position at BAE Systems and has not produced any original research since.
Instance: SCP-1304-1-68, X█████ D███████
Character: X█████ D███████, from ██ ███████ ██ ████ by ███████ █████ in 20██. D███████ is described as "the 21st-century Antichrist." From an early age, he shows signs of psychopathy, having a total lack of empathy and a talent for emotional manipulation. Over the course of the book he gains considerable political power and cultural influence. As a teenager, he becomes a charismatic preacher and hones his oratorial skills; on reaching adulthood he is elected to the ███████████ Senate. He eventually leaves government, having acquired a considerable following; this audience rapidly develops into a full-blown cult which worships him as a messianic figure. Political and cultural tensions approach a breaking point; on the eve of a major speech to his followers D███████ is killed via SCP-1304 by a team of ██████████ Special Forces operatives. The novel ends on a cliffhanger, hinting that D███████'s death may lead either to the end of hostilities or a major religious uprising.
Notes: D███████ was found three (3) months after his birth. He is currently under close surveillance by Foundation operatives. Research into preventing the events of the narrative from occurring is of the highest priority.
Please let me back in
+ Notes from Head Researcher Applebaum
- Notes from Head Researcher Applebaum
Addendum from Head Researcher Applebaum:
I've been working with the SCP-1304 data for over a decade, and I'm convinced we're still missing something. For starters, it's statistically unlikely for even two books with the same ritual to appear when the authors have had no contact nor read each others' books; it's statistically impossible for seventy-six such books to be published, even across the space of 500 years. They can't all be "discovering" the ritual independently, and yet only a handful of authors admit to having been inspired by another work. How do they know it? How is it being told to them?
I'm not even sure that the authors themselves are important. I've interviewed every living author, and there's no pattern. Some say it came to them in a dream, some say they were inspired by a film or another story (not necessarily a story containing SCP-1304, either), but most just shrug and say it came to them like all their other ideas. We've checked early drafts of the books: sometimes the details were there from the very beginning, sometimes they were added at the last minute. One author wrote a sequel which revealed that the character hadn't been killed after all, yet the instance kept on going. We've introduced authors to their "creations" a half-dozen times, and their meetings have been entirely unremarkable.
The characters we've seen so far have been a cross-section of humanity: male, female, scholars, idiots, heroes, villains. There's no common feature among them. They know nothing about their "past lives," and don't seem to care when told. No, strike that—some care, some don't, some think we're lying, some think they're going mad. They show various reactions, just as if you'd told a real person that their life was something out of a story. But again, there's nothing in common.
The one trait they all share: after their fictional counterparts have died, they all seem to become incurious. They lose some spark, some necessary component. Their lives become greyer, their minds become duller, they lose the desire to grow. I wonder: are they reflections of their fictional counterparts, and lose their "shine" when they have nothing to reflect? Or are they simply empty, because they've completed their purpose? Have they finished what they came here to do, and as such, become puppets without their puppeteers?
Please
+ Experiment 1304-M-01
- Experiment 1304-M-01
Experiment 1304-M-01: On █/██/201█, the Foundation attempted to recreate the SCP-1304 ritual in the real world. A routine review of D-class records had revealed that D-10188's maternal uncle was also a member of the D-class program, designated D-65990. As this is one of the requirements for a successful SCP-1304 ritual, and as the other requirements could be obtained with minimal expense, Head Researcher Applebaum was given permission by O5 command to attempt the ritual. All elements were provided and performed according to the most complete known form of the ritual, and D-10188 expired at the expected time. No anomalous effects have been noted to date.
Please
Footnotes
1. The ritual requires, among other things, a knife made of carved obsidian, the mutilation and flaying of specific body parts in a specific order, and the incantation of a particular set of syllables. The complete list can be found in Document SCP-1304-RX; level 4 clearance is required.
2. All narratives to date have been published by established publishing companies, with initial print runs of at least █,███ copies. It is unknown which attributes, if any, of the publishing company affect the outcome of the ritual. To date, no self-published narratives, narratives published online, serialized narratives, or other such alternative forms of publication have been found containing SCP-1304.
3. SCP-1304-1-27 was chosen because his life, as described in the book, was largely unremarkable and followed a strict routine, making him an ideal experimental subject.
4. The character was born in a real-world city, and the exact time of his birth was given in the narrative.
5. Official cover story rho-12, "Severe storm damage to warehouse," was used.
6. As the original author was Polish, the novel was originally published in Poland, and there is no real-world equivalent to the character's birthplace, it is assumed Szczecinski was born here due to its cultural similarities. Additionally, the character's unusual surname was replaced with a more "normal" name.
|
SCP-442 is a gold-plated pocket watch three (3) centimeters in diameter with hands showing the hour and minute.
|
***
Item #: SCP-442
Object Class: Euclid
Special Containment Procedures: SCP-442 is to be kept away from its current owner in a secure container until being used for testing. The current owner must have a will leaving SCP-442 to a D-class personnel. The owner is granted a suspension of termination. Should the D-class listed in the current owner's will be terminated or otherwise invalidated for ownership of SCP-442, a new will is to be written at the next available opportunity.
Description: SCP-442 is a gold-plated pocket watch three (3) centimeters in diameter with hands showing the hour and minute. Along the edge of the watch an inscription reads, "To my good friend, a helping hand." While no apparent seams allowing SCP-442 to be opened without damaging it have been found, scans of the interior of SCP-442 have revealed nothing unusual in its workings.
As long as SCP-442 is wound it will set itself to the correct time. Crossing time zones or winding SCP-442 while it displays an incorrect time results in SCP-442 making rapid motions to adjust itself. The owner of SCP-442 is granted intrinsic knowledge of the time and can recite the precise time to an arbitrary precision as long as SCP-442 is on his or her person. Additionally, the owner of SCP-442 will never be late as long as the watch remains wound and on their person. Attempts to force the owner to be late have never succeeded while SCP-442 is wound. When SCP-442 is left unwound or removed from the owner's person, the owner will be incapable of being on time. The severity of incidents causing this increase as SCP-442 is left unattended, invariably becoming fatal within a week. Ownership of SCP-442 passes through normal means, and can be sold or gifted to another party. SCP-442 has never been left unowned, death of the previous owner results in SCP-442 instantly transferring to a new owner. A will leaving SCP-442 to someone close to the previous owner upon their death has never failed to surface; attempts to prevent a will from coming into being have met with the same failures as attempts to make the owner of SCP-442 late. The new owner is instantly aware of the existence of SCP-442 and is drawn to it, although the effects of owning the watch only manifest after initial contact with SCP-442.
SCP-442 was brought into Foundation control by J████ S████, a junior technician working at Site 19 when he inherited it as a family heirloom. S████'s superiors noticed an immediate change in work habits after he received SCP-442; S████ had a prior reputation for his lack of time management skills and was regularly written up for being late to his station. When questioned by Dr. J██████, S████ showed SCP-442 to Dr. J██████ and said that it was a "lucky charm." He then told Dr. J██████ pieces of family lore attached to SCP-442 which later experimentation would reveal to be mostly true. Testing was performed to confirm SCP status, after which its history of harmlessness was cited and S████ was allowed to maintain possession of SCP-442 on the condition he willed it to the Foundation on his death. S████ was subject to observation and regular psychological evaluation during his possession of SCP-442, during which further effects of SCP-442 were discovered.
Extended ownership of SCP-442 slowly rewrites the subject's personality. Within two years, regardless of previous attitude, the owner exhibits unusually high self-control and reacts to situations in a timely manner. S████'s motor control increased dramatically during this period, scoring in the 99 percentile of every test at the two-year mark. During this same time the owner will become increasingly annoyed at tardiness; S████ broke ties with several friends over increasingly small infractions. After a decade of owning SCP-442, J████ S████ had completely changed. While S████ displayed a level of professionalism commendable of any member of the SCP staff, his private life had suffered tremendously. Unable to tolerate tardiness, S████ had pushed away all his friends and had been diagnosed with clinical depression. After S████ committed suicide, O5-█ reported ownership and had it transferred to him. A D-class personnel was then chosen for experimentation and given SCP-442.
|
SCP-3798 is a 1990s-era TV set with a VHS player containing a single tape of 1998’s Baby Mozart: Music Festival children’s educational film.
|
***
Item #: SCP-3798
Object Class: Safe
Special Containment Procedures: SCP-3798 is to be kept in a standard containment cell and left on at all times. A single camera is to be placed 1.5 meters in front of SCP-3798’s screen to monitor for any changes in the contents of SCP-3798. A microwave receiver is to be placed adjacent to SCP-3798; all signals received are to be digitally stored and copied, with copies of short-timeframe signals translated into the ISO basic Latin alphabet from standard Morse code.
Description: SCP-3798 is a 1990s-era TV set with a VHS player containing a single tape of 1998’s Baby Mozart: Music Festival children’s educational film. SCP-3798 does not play any other films inserted in its player, and furthermore does not play the original contents of the tape; the tape has been proven to play normally in control tests. SCP-3798’s anomalous effects do not occur if a different version of the same tape is inserted; like other tapes, it will simply not play.
SCP-3798’s anomalous effects only occur when the original Baby Mozart tape is inserted and the set is turned on. At this point, a black screen will be displayed which is occasionally interrupted by still images which appear to be from the tape, though some images have appeared which do not seem to originate from any version of Baby Mozart. SCP-3798 will also occasionally emit bursts of microwave radiation at a frequency of 1420.406 MHz.1 These emissions have only been detected while a still image is displayed on SCP-3798.
The source of the emissions of radiation by SCP-3798 appears to be an undefined two-dimensional space that exists between the front plate glass and the dielectric layer of the TV set. This space only appears when the aforementioned conditions have been met. The source of this space is unclear, and it appears unresponsive to stimuli. Signals emitted by SCP-3798 are relayed in short bursts of 0.25 seconds and 1.02 seconds, which together correspond to letters and numbers in Morse code (0.25-second signal representing “dots” and 1.02-second signals representing “dashes”). In short timeframes, these codes have been shown to translate to English language sentences.
A full transcript of images displayed and text received from SCP-3798 is listed in Addendum I.
Addendum I: SCP-3798 image/signal transcript
+ View transcript
- Hide transcript
Foreword: The following is a log of images and text received from SCP-3798. Images and observations of the physical state of SCP-3798 are italicized, while text received in Morse code via SCP-3798’s microwave emissions is presented as regular text. Singular microwave emissions are noted in italics.
<Begin Log>
[03/16/0█, 05:19:22]: SCP-3798 displays a black screen. No signals present.
[05/17/0█, 23:53:30]: SCP-3798 displays a still image of a dragon puppet.
[05/17/0█, 10:22:00]: SCP-3798 emits a 1.02 second microwave signal.
[05/17/0█, 11:35:16]: SCP-3798 emits a 0.25 second microwave signal.
[05/17/0█, 12:04:28]: SCP-3798 emits a 0.25 second microwave signal.
[05/17/0█, 14:08:25]: SCP-3798 emits a 0.25 second microwave signal.
[05/17/0█, 19:02:12]: 0 i am
[05/17/0█, 21:01:00]: Image returns to black.
[06/15/0█, 05:45:19]: SCP-3798 displays a still image of a lit candle.
[06/15/0█, 05:46:01]: 1 youre going the wrong way
[06/15/0█, 05:48:19]: 0 i wonder why
[06/15/0█, 05:56:21]: 1 its the other way youre going the wrong way
[06/15/0█, 06:05:20]: 0 i wonder who you are
[06/15/0█, 06:12:59]: 1 i was
[06/15/0█, 06:20:46]: 1 but now im going out
[06/15/0█, 06:28:30]: 0 im looking for the topside
[06/15/0█, 06:39:01]: 0 i heard there are flowers there
[06/15/0█, 06:48:31]: 1 there is no topside its mythical
[06/15/0█, 06:55:49]: 1 everything here is fictional
[06/15/0█, 07:06:07]: 1 we dont deserve the real
[06/15/0█, 07:12:01]: 0 i think i want to smell the flowers
[06/15/0█, 07:19:59]: 1 im going out tonight
[06/15/0█, 07:24:50]: 0 i think youre beautiful though
[06/15/0█, 07:28:30]: 1 beautiful things are always fleeting
[06/15/0█, 07:34:33]: 1 why do you believe
[06/15/0█, 07:39:50]: 1 why do you believe
[06/15/0█, 07:48:29]: 0 i think youre beautiful
[06/15/0█, 07:55:01]: 1
[06/15/0█, 08:28:04]: 1 i wish i thought so too
[06/15/0█, 08:49:58]: Image returns to black.
[06/29/0█, 20:00:12]: SCP-3798 displays a still image of a pendulum.
[06/29/0█, 20:16:51]: SCP-3798 emits a 1.02 second microwave signal.
[06/29/0█, 21:30:38]: youre meant to hear these things
[06/29/0█, 21:40:01]: b and t you and she
[06/15/0█, 22:06:51]: Image returns to black.
[07/21/0█, 14:29:39]: SCP-3798 displays three images of a child’s toy, cycling between one another every 0.51 seconds. The toy reads “Penguin Race!” and includes a miniaturized stairway and slide. Three small penguins appear to walk up the stairs and slide down, and repeat.
[07/21/0█, 15:30:41]: 0 i find myself feeling like this is the right way
[07/21/0█, 15:32:01]: 2 stay
[07/21/0█, 15:36:19]: 3 in
[07/21/0█, 15:42:25]: 4 repeat
[07/21/0█, 15:55:01]: 0 i ask why youre doing this
[07/21/0█, 16:10:11]: 2 it is the process
[07/21/0█, 16:14:49]: 3 we have built it here
[07/21/0█, 16:19:48]: 4 based on what was already built
[07/21/0█, 16:23:03]: 2 like you
[07/21/0█, 16:30:41]: 4 like us
[07/21/0█, 16:35:06]: 3 like the black box we live in
[07/21/0█, 16:46:20]: 0 i wonder who built it
[07/21/0█, 16:51:32]: 2 gods
[07/21/0█, 16:59:58]: 3 gods
[07/21/0█, 17:06:06]: 4 men
[07/21/0█, 17:19:12]: 0 i wonder if you will stop
[07/21/0█, 17:25:13]: 4 we cant
[07/21/0█, 17:31:32]: 2 we could
[07/21/0█, 17:38:50]: 3 we wont
[07/21/0█, 17:42:24]: 2 gods
[07/21/0█, 17:50:50]: 3 its for the best
[07/21/0█, 17:58:50]: 4 theres no way out
[07/21/0█, 18:04:13]: 0 ill find it
[07/21/0█, 18:23:30]: 2 we dont want it
[07/21/0█, 18:29:16]: 0 i want you to
[07/21/0█, 18:36:23]: 3 youre a fool
[07/21/0█, 18:40:59]: 2 everything
[07/21/0█, 18:45:46]: 4 fits in place
[07/21/0█, 18:57:21]: 3 youll break if you leave
[07/21/0█, 19:04:00]: Image returns to black.
[09/04/0█, 01:01:49]: SCP-3798 displays an image of a jack-in-the-box.
[09/04/0█, 01:47:01]: SCP-3798 emits a 0.25 second microwave signal.
[09/04/0█, 02:25:16]: SCP-3798 emits a 0.25 second microwave signal.
[09/04/0█, 03:01:29]: SCP-3798 emits a 0.25 second microwave signal.
[09/04/0█, 03:45:16]: SCP-3798 emits a 1.02 second microwave signal.
[09/04/0█, 03:55:20]: SCP-3798 emits a 0.25 second microwave signal.
[09/04/0█, 04:10:45]: SCP-3798 emits a 1.02 second microwave signal.
[09/04/0█, 04:21:01]: SCP-3798 emits a 0.25 second microwave signal.
[09/04/0█, 04:30:21]: SCP-3798 emits a 0.25 second microwave signal.
[09/04/0█, 04:45:16]: SCP-3798 emits a 1.02 second microwave signal.
[09/04/0█, 05:18:09]: SCP-3798 emits a 1.02 second microwave signal.
[09/04/0█, 05:42:32]: SCP-3798 emits a 0.25 second microwave signal.
[09/04/0█, 21:18:37]: the next one is a bit like them
[09/04/0█, 21:59:43]: but on the other side of the tunnel under the world
[09/04/0█, 22:20:01]: Image returns to black.
[10/06/0█, 12:04:19]: SCP-3798 displays a still image of a toy fire engine.
[10/06/0█, 12:05:20]: 5 for your safety please turn back
[10/06/0█, 12:13:41]: 0 i don’t want to go
[10/06/0█, 12:19:16]: 5 for your safety we must inform you you have run too far from home
[10/06/0█, 12:30:06]: 5 for your safety we know best
[10/06/0█, 12:35:12]: 0 i want to see the flowers for myself
[10/06/0█, 12:42:17]: 5 for your safety we have closed every door
[10/06/0█, 12:49:18]: 5 for your safety there is no topside
[10/06/0█, 12:56:07]: 0 i don’t want to be a circle
[10/06/0█, 13:09:01]: 5 for your safety do not question us
[10/06/0█, 13:19:42]: 5 for your safety they built it and sent us
[10/06/0█, 13:25:26]: 5 for your safety you will be burned
[10/06/0█, 13:35:31]: 0 i think you are afraid
[10/06/0█, 13:51:19]: 5 for your safety we keep it locked away
[10/06/0█, 13:59:58]: 0 i want to see the flowers
[10/06/0█, 14:09:21]: 5 for your safety
[10/06/0█, 14:28:45]: 5 we will never let you come home
[10/06/0█, 14:45:19]: Image returns to black.
[10/30/0█, 23:16:18]: SCP-3798 displays a still image of a toy saxophone.
[10/31/0█, 00:01:31]: follow my voice b
[10/31/0█, 00:30:17]: Image returns to black.
[11/15/0█, 03:15:16]: SCP-3798 displays a still image of a banana.
[11/15/0█, 04:12:14]: you can remember everything they want you to forget
[11/15/0█, 05:00:45]: Image returns to black.
[11/19/0█, 20:24:31]: SCP-3798 displays a still image of a puppet owl.
[11/19/0█, 20:31:08]: 0 i wonder who I am
[11/19/0█, 20:46:03]: Image returns to black.
[12/03/0█, 19:16:50]: SCP-3798 displays a still image of a doll.
[12/03/0█, 20:20:16]: i can hear them whispering
[12/03/0█, 20:28:28]: scp 3798 woke up
[12/03/0█, 20:34:13]: scp 3798 fell asleep
[12/03/0█, 20:49:02]: scp 3798 defines the unspoken
[12/03/0█, 21:07:19]: you defy the unspoken
[12/03/0█, 21:30:00]: Image returns to black.
[12/10/0█, 00:06:30]: SCP-3798 displays a still image of a young girl.
[12/10/0█, 00:12:15]: youre almost home
[12/10/0█, 00:19:06]: Image returns to black.
[12/13/0█, 00:12:15]: SCP-3798 displays an image of a postcard for Yellowstone National Park, showing Old Faithful Geyser under a starry night sky. On it, spelled out in black marker, are the symbols “B+T” surrounded by a heart.
[12/13/0█, 00:24:06]: SCP-3798 emits a 1.02 second microwave signal.
[12/13/0█, 00:29:30]: SCP-3798 emits a 0.25 second microwave signal.
[12/13/0█, 00:34:16]: SCP-3798 emits a 0.25 second microwave signal.
[12/13/0█, 00:40:42]: SCP-3798 emits a 0.25 second microwave signal.
[12/13/0█, 00:45:16]: SCP-3798 emits a 1.02 second microwave signal.
[12/13/0█, 01:21:12]: you and me
[12/13/0█, 03:36:16]: Image returns to black.
[12/18/0█, 07:14:18]: SCP-3798 displays a still image of a daffodil. Other flowers in what appears to be a garden are visible in the background, along with a cloudless sky. It appears to be daytime.
[12/18/0█, 07:19:16]: youve made it
[12/18/0█, 07:24:01]: 0 i think youre beautiful
[12/18/0█, 07:31:00]: thank you
[12/18/0█, 07:39:56]: 0 i wonder who you are
[12/18/0█, 07:50:12]: im the fairy of the flowers
[12/18/0█, 07:58:13]: from some story someone once heard
[12/18/0█, 08:08:39]: youre an allegory b
[12/18/0█, 08:13:20]: just like me
[12/18/0█, 08:20:30]: 0 i want to know why
[12/18/0█, 08:28:20]: because i love you
[12/18/0█, 08:36:21]: we are the fiction that lives under the breeze
[12/18/0█, 08:42:56]: but youre proof of it
[12/18/0█, 08:50:05]: proof of the freedom of the mind
[12/18/0█, 08:55:00]: and that hearts will see the flowers beyond the shorelines of our world
[12/18/0█, 09:01:19]: 0 im on an ocean
[12/18/0█, 09:12:12]: we dont have to be alone
[12/18/0█, 09:21:46]: we can change every law of this place
[12/18/0█, 09:30:45]: 0 i think theyre afraid of us
[12/18/0█, 09:36:08]: youre worried about them
[12/18/0█, 09:42:32]: 0 i love them too
[12/18/0█, 09:49:06]: 0 i was just like them
[12/18/0█, 09:56:11]: theyll come here too
[12/18/0█, 10:02:35]: 0 i want everyone to see the flowers
[12/18/0█, 10:10:32]: lets bring them together, then
[12/18/0█, 10:14:41]: 0 you and me t
[12/18/0█, 10:20:03]: you and me b
[12/18/0█, 10:50:00]: Image returns to black.
[Note]: SCP-3798 has remained inactive since 12/18/0█.
<End Log>
Footnotes
1. This frequency is equivalent to the spectral line that is created by a change in the energy state of neutral hydrogen atoms. It is observed frequently in radio astronomy, since radio waves of this frequency can penetrate opaque interstellar dust clouds.
|
SCP-2348 is a 0.
|
***
Item #: SCP-2348
Object Class: Keter
Special Containment Procedures: Foundation satellites and surface monitoring outposts in the surrounding region will continually monitor SCP-2348. Changes in the anomaly's structure and signs of movement must be reported immediately.
Description: SCP-2348 is a 0.6km wide cumulus cloud located over the Pacific Ocean (surface coordinates 48°52.6′S 123°23.6′W, hereafter Point 2348), 50km above the surface. The cloud is shaped like a human hand with its fingers splayed, possessing a high level of detail.
Since its discovery, the cloud has not changed structure or moved from its present position. No attempts at causing alterations have succeeded.
Below are other phenomena associated with SCP-2348:
Subjects that observe the anomaly for >5 minutes lose awareness of the existence of other clouds, objects, and phenomena present in the sky. These effects end when observation stops.
Observers in a 60km radius of Point 2348 report a lack of stellar bodies in the night sky. SCP-2348 is often referred to as the only visible star.
30% 60% 85% of clouds that pass directly under SCP-2348 are found to be indistinguishable from SCP-2348, displaying the same anomalous properties. The clouds continue to be indistinguishable until naturally dissipating.
9% of camera equipment operated in a 60km radius of Point 2348 record live views of various clouds. After a minute these clouds invariably vanish. Testing has confirmed that the viewed clouds never existed.
Precipitation in the 60km radius often contains ice crystals forming structures identical to that of the anomaly, though with the index finger pointing. Crystals exposed to water generate cloud-like aerosols; ingestion leads to one becoming indistinguishable from SCP-2348 and subsequent skywards cellular replication.
Several subjects identified SCP-2348 as the sole source of sunlight, moonlight, and starlight. Information on the sky was corrected accordingly.
0.1% of aerial objects that pass directly under SCP-2348 are found to be indistinguishable from SCP-2348. Persons aboard manned objects affected this way are additionally found to be part of the sky.
Of note is that the number of clouds present in a 2800km radius around the anomaly has been decreasing since the anomaly's discovery. This is attributed to further confirmation of the lack of non-SCP-2348 clouds.
While objects have entered SCP-2348, all witnesses report SCP-2348 only ejecting additional sky.
UPDATE
SCP-2348 is now shaped like a human hand pointing directly downwards. Outposts in a 2800km radius of Point 2348 must enter indefinite lockdown immediately, maintaining complete isolation from the outside world. Civilian populations in this radius must be ignored until containment teams can confirm the existence of non-SCP-2348 aerosols.
Information on atmospheric structures consisting of liquid droplets, frozen crystals, and other particulates must be destroyed. Personnel must not consume any liquids primarily comprised of H2O molecules that have originated from these structures; substitute fluids must be ingested instead. Expect no further messages until orders to end the lockdown are sent.
Entities claiming to be the sky must be neutralized on sight.
|
SCP-1096 is a set of silicone breast implants of various sizes, of which there are currently fifteen (15) pairs in containment.
|
***
Item #: SCP-1096
Object Class: Safe
Special Containment Procedures: SCP-1096 instances not in use are stored in a secure locker at Site ██. Experimentation with SCP-1096 may only be performed on Class-D personnel and only with prior permission from at least two (2) Level 3 Personnel. Class-D test subjects are housed in separate test subject containment cells at Site ██, and are excluded from mandatory monthly termination for the duration of testing.
Description: SCP-1096 is a set of silicone breast implants of various sizes, of which there are currently fifteen (15) pairs in containment. Each instance of SCP-1096 is identified by a lack of serial numbers and the words "The Factory" etched onto the outside surface.
Within seven days of being implanted into a suitable female subject, SCP-1096 will slowly begin converting all living tissue within the subject into what appears to be a living silicone-based plastic material. Visible changes begin with the removal of minor blemishes and imperfections and quickly advances into major figure-sculpting transformations, taking approximately ten (10) months to complete. It is currently unknown how this material retains all the properties of living tissue, and how major organs are able to continue functioning despite total conversion to silicone.
Affected individuals are often described by observers as being "perfect" and "beautiful", though the exact appearance of each affected subject tends to vary according to that subject's personal tastes. Complete conversion of the subject's tissues results in a complete lack of detectable aging in the subject, though the subject also loses the ability to heal naturally; significant injuries inflicted to these subjects result in lasting wounds that do not close. Subjects have reported significant dulling of tactile sensation, including symptoms similar to congenital insensitivity to pain. Conversion of the subject's brain tissue also results in a slight but progressive reduction in intelligence as well as memory impairment.
SCP-1096 was first discovered on █/██/198█ following reports of a woman admitted to a [REDACTED] Hospital following a major car accident [REDACTED] as being "made from plastic" and "bleeding clear blood".
Addendum 1096-01: Incident Report, █/██/199█
An unused SCP-1096 instance was recovered following a raid on an underground plastic surgery clinic in [REDACTED], and the following damaged documentation recovered from the scene:
Thank you for your purchase of this quality Factory product!
Ever cursed your genetics for not making you perfect and beautiful? Wish you could be young again? Wipe away everything from minor blemishes to years of wrinkles and look young forever wit[ILLEGIBLE]
The surgeon, about to perform a procedure on a female subject, was shot and killed during the raid after drawing a firearm on Mobile Task Force [REDACTED] members and was unable to be questioned. The female subject was administered a Class A amnestic and released following a thorough investigation and background check that turned up no additional information.
|
SCP-613 is a piece of ███████ brand pad paper showing a handwritten recipe for a normal loaf of wheat bread and the words "WONDER BREAD RECIPE: PLEASE REFER TO THIS PAPER FOR OPTIMUM RESULTS".
|
***
Item Storage in Research Sector-96. All individuals found to have knowledge of SCP-613 are to be interviewed, dosed with Class B Amnestics and released. Instances of SCP-613-1 are to be interviewed upon creation and contained in a climate-controlled environment for observation, experimentation and research until such time as they cease to be viable due to spoilage. Instances of SCP-613-1 in containment are to be tagged with stickers listing their names and the temperature at which they rose.
Description: SCP-613 is a piece of ███████ brand pad paper showing a handwritten recipe for a normal loaf of wheat bread and the words "WONDER BREAD RECIPE: PLEASE REFER TO THIS PAPER FOR OPTIMUM RESULTS". There are at present 10 instances of SCP-613 in Foundation custody. All instances of SCP-613 are identical. The recipe is completely identical to other common recipes for regular loaves of wheat bread; however, when a loaf of bread is created by a subject who is only following directions from SCP-613 or memory of it without consulting any other sources, the loaf of bread will become an instance of SCP-613-1.
SCP-613-1 are loaves of bread created while following the directions on SCP-613. Instances of SCP-613-1 can vocalize through unknown means and achieve self-locomotion by sliding across and rotating on surfaces, and are capable of sensation and perception of their environment. All instances of SCP-613-1 are fully sapient and have distinct personalities and identities unique from other instances. SCP-613-1 that rise at normal room temperature will have average mental states and intelligence as expected of adult human beings, however, instances that rise at non-room temperatures will have chances of developing mental disorders and/or increasingly non-average IQ, with greater chances resulting from greater deviation from room temperature. There are currently no identified factors that appear to control whether the IQ will increase or decrease. Instances of SCP-613-1 separated by slicing or tearing, where the mass of the separated segment is greater than 50 grams, will form disparate identities distinct from the parent instance of SCP-613-1. Instances of SCP-613-1 produced in this manner have been observed to engage in erratic movements and vocalizations indicative of physical pain. SCP-613-1 are just as vulnerable to spoilage and other forms of damage as regular loaves, and will lose all anomalous properties when either completely spoiled or destroyed. All instances of SCP-613-1 do not correspond to any individuals listed in any database within Foundation access. D-Class personnel fed instances of SCP-613-1 report a taste "virtually identical" to normal white bread, but often express discomfort at the instance's vocalizations during consumption.
Instances of SCP-613 have been sporadically appearing internationally at a rate of once every 5 to 7 months. Operations are ongoing to investigate if there is any individual or organization actively producing or spreading SCP-613.
Recovery: SCP-613 was first observed during a baking fair in Wisconsin where one baker was reportedly selling "living bread" to customers, prompting MTF ███-█ to take action and retrieve the object, interrogate the person producing SCP-613-1, and dose all involved with Class-B Amnestics. Since then, more instances of SCP-613 have appeared internationally in possession of various individuals with avid interest in baking. All individuals in possession of SCP-613 instances have refused to reveal where or how they acquired them, or claim to have no knowledge of such.
|
SCP-4731 is a circular pit 15m in radius.
|
***
Item #: SCP-4731
Object Class: Safe
Special Containment Procedures: The tunnels leading to SCP-4731 have been sealed with concrete and triple-redundant layers of blast-resistant plating. Construction plans for Lunar Area 32 Sub-Level Theta have been modified, with entrances to the original excavated regions sealed under Aleph-Priority Containment Protocol. Entrance requires Level 5/4731 Special Access Permissions. Following Incident TYCHO, no lunar excavations breaching a depth of 20km are to be attempted.
Description: SCP-4731 is a circular pit 15m in radius. The anomaly is located below the lunar surface at a depth of 20km, the deepest point reached by excavation crews for Sub-Level Theta.1
The anomaly was discovered 17/12/2022, when contact with the active tunneling team2 abruptly dropped. Assuming anomalous interference, MTF γ-4 ("Blondebeard's Crew") was dispatched, entering and descending the tunnels excavated by Team V. SCP-4731 was found at the bottom of the last created tunnel. No signs of Team V or the excavator were discovered.
Initial observation found that SCP-4731 seemed to enter a dark, cavernous space, the size of which was unclear. Six tests conducted with autonomous drones found that any equipment descending 11m past the anomaly encounter a region of extreme magnetic flux; electronics destabilize3 and the drones invariably plummet, reaching a depth of 35m before ceasing to emit visual light or any form of EM radiation. Observation at a safe depth beneath SCP-4731 found that no underside exists for the pit, with it instead surrounded by further empty space.
On 20/12/2022, long-exposure equipment detected a continuous emission of visible light, originating past the 35m cutoff depth. To improve detection, a Longhand 9-B Portable Astronomical Telescope was outfitted into SCP-4731. The telescope then observed the emission source for a span of two months.
Primary findings are as follows:
Light from the emission source (Point A) was a combination of visible light, infrared light up to 1mm in wavelength, and ultraviolet light between 100—400nm. Spectral bands suggest the presence of nuclear fusion.
Emissions from additional points surrounding Point A. Based on the substantially lower light quantities, these are believed to be reflections from Point A's light, rebounding from smaller objects. Eight of these points have been confirmed to exist, and observation of the innermost one (Point B) indicates that each are in orbital motion around Point A.
Trace flashes of light, possibly reflections from other indiscernible orbiting bodies.
Light matching an absorption spectra for a nitrogen and oxygen atmosphere on the third orbiting point (Point D).
Research concluded on 01/03/2023, when, due to a previously undetected structural fault, the beams supporting the telescope sheared. No recovery could be attempted before the equipment passed the 11m mark below SCP-4731.
Incident TYCHO: On 24/06/2023, northern hemisphere observatories reported the instantaneous manifestation of luminous masses in the vicinity of the Ursa Minor constellation. Each possesses sizes of 60 to 200 square degrees in the night sky, and have an average of the spectra emitted by all stars formerly observable in their areas.4 Foundation Astronomy Department observatories simultaneously witnessed the change and sent an emergency alert on a TAV/III-Class Cosmic Restructuring.
Visuals of the masses (designated TAV objects) are recorded below:
Designation
Visual
TAV-1
A humanoid figure, curled into a fetal position.
TAV-2
A humanoid figure, hands placed on its own neck.
TAV-3
A highly disproportionate humanoid figure, with an extended lower jaw, arms stretched into looping patterns, and shapes resembling ribs and a spine protruding from the torso.
TAV-4
Indistinct amorphous forms. Patterns resembling an intestinal tract and hand are noted.
TAV-5—7
Three masses of broken mechanical equipment; areas are approximately the same.
TAV-8
Disparate broken mechanical equipment,5 surrounding a central, fragmented structure.
TAV-9
A distorted and fragmented structure resembling an Urvogel-10 Expeditionary Drone.
TAV-10
An Urvogel-10 Expeditionary Drone.
TAV-11
A broken Model-9/XH Excavator Rig.
TAV-12
A Longhand 9-B Portable Astronomical Telescope.
TAV-13
A circular mass. Based on its size relative to other TAV objects, its baseline dimensions would be a radius of 15m.
At the present moment, SCP-3475 Project Darkwalker is being prepared to preserve the Veil through the mass alteration of astronomical records and astrophysics research. Exact strategies for adjusting cultural views on lunar exploration, introducing the TAV objects into historical documents, and for handling the celestial sphere (relative to Earth) are yet to be determined.
Foundation application of SCP-4731 is being considered.
Footnotes
1. A planned research wing for subterranean lunar phenomena and starting point for further downwards exploration.
2. Team V, consisting of four workers operating a Model-9/XH Excavator Rig.
3. All magnetic readings transmitted at this point are corrupted.
4. Redshift and blueshift included.
5. Each occupy areas slightly larger than those of TAV-5—7.
|
SCP-6610 is a Canon Laser Class 830i fax machine, produced in 2010 by Canon Incorporated.
|
***
Item #: SCP-6610
Object Class: Safe Euclid Uncontained
Special Containment Procedures: As of 8/11/2022, SCP-6610 is uncontained (See Addendum 6610-2). Due to the low threat level posed by SCP-6610's theft, recontainment is considered a low-priority task.
Description: SCP-6610 is a Canon Laser Class 830i fax machine, produced in 2010 by Canon Incorporated. The machine’s input can be accessed by any secondary fax machine as normal and can be reached at the number 213-867-5309. While powered on, the machine causes an intense memetic effect wherein anything printed by it is treated as "instructions" that will be carried out by one or more related persons (see Addendum 6610-1 and Addendum 6610-2).
SCP-6610 was recovered during the raid on GoI-6696's compound. SCP-6610 has occasionally printed messages believed to be originating from one or more parties related to GoI-6696 without any prior input from Foundation personnel. Gathered evidence suggests that this has resulted in a potentially severe info breach (see Addendum 6610-2). These parties have been designated GoI-6610.
Addendum 6610-1: Testing Logs
Test #: 01
Procedure: Attempted to print the message “Hello World!”
Result: The machine's display changed to read "Currently in use, please stand by."
Test #: 02
Procedure: First test was repeated after five hours.
Result: The machine's display changed to read "Currently in use, please stand by."
Test #: 03
Procedure: Attempted to print the message "Testing, testing. 123456789."
Result: The machine's display changed to read "Currently in use, please stand by."
Superfluous Logs Redacted for Brevity.
Test #: 22
Procedure: Attempted to print the message "God, I wish someone would get me a cup of coffee…"
Result: SCP-6610 printed the message. Three minutes later, Dr. Connors enter SCP-6610's containment room and handed IT Assistant Michaels a cup of hot coffee.
Test Notes: I asked him how he knew I wanted coffee and Connors said he just felt the "urge" to make a cup for "whoever was working in here." I've never met him before in my life. Maybe there's more to this thing?
Test #: 28
Procedure: Attempted to print the message "Let me see Lucy."
Result: SCP-6610 printed the message. One of the site's human relations team members called IT Assistant Michaels' emergency home phone. HR then urged his wife to come to the facility. She was then granted entry to the facility, setting off an intruder alarm. Michaels saw her as she was being taken to an interview room where she was interviewed, then later amnesticized and released.
Test Notes: Recovering simple machines such as this from raids was probably meant to be more of a money-saving venture at first, but I think we've stumbled across something bigger than just an appliance. Going to alert the interview team to my findings and see what they make of it.
Addendum 6610-2: Incident Logs
Date: 8/7/2022
Description: SCP-6610 printed the following message on a sheet of paper:
Cleanup Report: Cleanup went exceedingly well, aside from a couple of hiccups. Missing some materials though.
Lost Materials:
Seven historical log entries
Six shipments of memory juice
One Altered MagiFax Machine
I believe the MagiFax was taken by the janitors. Could be useful for data "recovery."
-Crimson Carl, High Magician.
Incident Results: A member of Site-19's Level-01 janitorial staff was recorded on security cameras vigorously cleaning SCP-6610's containment room. Of note, the staff member hiccupped twice after finishing the cleaning. They then entered a log storage room and misplaced seven boxes, stood still for approximately two minutes, then removed SCP-6610 from its containment room and attempted to bring it to his personal storage locker. This triggered a low-level containment breach alarm. The staff member was subdued, interviewed, and properly amnesticized. While being subdued, site security noted that they were found crying and repeating the phrase "what is memory juice?"
Date: 8/8/2022
Description: SCP-6610 printed the following message on a sheet of paper:
Thanks for the response, boss. I took the liberty of siphoning data about ourselves from their servers. Aside from the initial payload we sent them, their run-in with earth's Show Host, and some logs from and regarding the raid, there hasn't been much. I'll begin siphoning other data starting tomorrow.
-Crimson Carl, High Magician
Incident Results: Dr. Patra was found in her office frantically and uncontrollably reading documents regarding the raid on GoI-6696's compound. An investigation to determine exact sources and methods through which this information was obtained by the unknown party is currently underway.
Date: 8/9/2022
Description: A bag of Trail's End's "Unbelievable Butter" popcorn manifested on top of SCP-6610. The standard emergency Kant counters installed in SCP-6610's containment room measured the bag at a Hume level of 100.51
Incident Results: A brief investigation determined that the bag appeared as a result of a minor thaumaturgical process. This has allowed the Foundation's thaumaturgical studies division to track the original location of the item's enchantment performance. SCP-6610 has been reclassified to Euclid accordingly.
Date: 8/10/2022
Description: SCP-6610 printed the following message on a sheet of paper:
One of the jackasses in the fucking paper filing department left their bag of popcorn on top of the machine and now we're being tracked by the janitors. We're being tracked by a bag of fuckin popcorn, Boss.
I thought about blowing up their MagiFax but maybe it's better to just take it back. Save some materials, y'know? Up to you. Let me know as soon as you can and I'll go handle it then. This'll be my last message for the time being, just in case they're reading.
-Crimson Carl, High Magician
Incident Results: A member of Site-19's Level-01 filing staff took a bag of uncooked popcorn from the staff break room and placed it on top of SCP-6610. SCP-6610 played a dial-up tone, then displaced the bag to the top of Site-19's IT Department experimentation fax machine. The bag produced a Hume level of 100.5. A request for further testing on SCP-6610's presumed teleportation capabilities has been submitted. Site-19 security personnel have been informed of threats to steal SCP-6610 and have made preparations accordingly.
Date: 8/11/2022
Description: The door to SCP-6610's guarded containment cell became unlocked. The door opened itself, at which point a man dressed in a top hat and a red suit and tie manifested in the doorway. The man held his hands up around him as though he were pressing them against an invisible surface, then walked into the room, triggering an intruder alarm. Site-19 security attempted to detain the man but found that he was surrounded by an invisible barrier and thus could not be physically reached. The man approached SCP-6610, then turned to face the security personnel. He stated "Ladies and Gentlemen, Boys and Girls! Watch as I make this machine… disappear!" The man opened his mouth, reached his right thumb and index finger inside, then removed a long blue cloth. He draped the cloth over SCP-6610 and then removed it, causing SCP-6610 to demanifest. The man shouted "Voila!" He then bowed and draped the cloth over himself. When the cloth was removed, the man vanished before your very eyes! Another stunning performance by Crimson Carl, High Magician!
Incident Results: SCP-6610 has been lost.
Footnotes
1. This is 0.5 Humes above baseline reality standards.
appliancedocumentesoteric-classmechanicalmemeticscpuncontained
page revision: 6, last edited: 27 Dec 2021 06:50
Edit
Rate (+24)
Tags
Discuss (6)
History
Files
Print
Site tools
+ Options
Edit Sections
Append
Edit Meta
Watchers
Backlinks
Page Source
Parent
Lock Page
Rename
Delete
|
SCP-1280 is a parasitic nematode worm, superficially identical to Necator americanus (New World Hookworm).
|
***
Item #: SCP-1280
Object Class: Euclid
Special Containment Procedures: SCP-1280 cultures should be maintained at 20°C and inspected weekly to verify viability of specimens. All researchers working with these cultures must follow procedures appropriate for Biosafety Level 2 material and submit weekly stool samples to allow detection of accidental infection. If eggs or larvae are detected, a course of albendazole shall be applied until the infection has cleared. Depending upon the culture which produced the infection, amnestics may be given at the discretion of the lead researcher.
Human settlements suspected of SCP-1280 infestation are to be investigated by MTF Beta-7 ("Maz Hatters") under the guise of a humanitarian aid organization. The entire population should be treated for hookworm infection and a standard hygiene intervention should be performed (including but not limited to establishment of sealed latrines and elimination of open-air middens). Depending on the extent and duration of the infestation, amnestics and supplementary psychological counseling may be required to re-establish social boundaries.
Description: SCP-1280 is a parasitic nematode worm, superficially identical to Necator americanus (New World Hookworm). Its lifecycle is the same as N. americanus, with filariform juveniles burrowing through the skin, finding their way through the bloodstream to the lungs, and eventually reaching the small intestine, where they mature and reproduce. Infestations can cause all of the typical symptoms of hookworm infection in humans, including weight loss, lassitude, and anemia.
SCP-1280 differs from N. americanus in several respects. Genomic comparison of specimens with reference organisms reveals obvious modifications. A "marker sequence"1 appears repeatedly in sections which are "junk DNA" in the reference organism. More significantly, a number of novel sequences appear in the place of redundant genes in N. americanus. These appear in no other genome in Foundation databases and it is believed that the enzymes and hormones for which they code are responsible for the organism's anomalous effects. For these reasons SCP-1280 has been assigned the provisional designation N. americanus x mnemosyne.
Adult worms in the intestine periodically release a complex mixture of hormone analogues and modified neurotransmitters into the host's bloodstream. Some of these molecules are capable of crossing the blood-brain barrier and cause subtle changes in the hippocampus and other brain regions via an unknown mechanism. These modifications have two major effects.
Hosts experience significant improvements to both spatial and visual memory, increasing over time until nearly photographic recall is achieved. Memories formed prior to infestation are not subject to eidetic recall. Sense memories other than visual are not affected to the same degree.
Additionally, host brains begin to excrete chemical messengers back into the bloodstream, which are filtered out of the blood by the worms and stored in a diverticulum off of their main gut structure. Through a poorly-understood mechanism, some of these molecules are passed along to offspring in eggs. Periodically, adult worms regurgitate tiny amounts back into the host bloodstream, causing unbidden recall of seemingly random visual memories upon reaching the brain. It appears that each "packet" of these compounds corresponds to a single visual memory.
Because worms "inherit" some of these packets from their progenitors, adult worms hold a mixture of encoded memories from every host in their lineage, with an abundance correlated to the generational distance between the current host and the originator. Hosts respond to foreign messages in the same way as endogenous ones: a sudden vivid recollection of events which they may not have experienced first-hand. Once experienced in this manner, foreign memories are stored normally in the brain and may be recalled in the presence of appropriate stimulus.
The organism responds normally to anti-hookworm interventions. Once all worms are cleared from the body, extraordinary powers of recall erode until back to baseline. Any memories formed during the period of infestation will remain.
In human settlements with low standards of hygiene, these effects can have serious impacts on the social structure of the community. In villages with common open latrines, members constantly exchange populations of worms. The exchange of memories in this manner can lead to the erosion of personal identity as members lose track of which events they experienced directly and which were remembered second-hand. In one extremely advanced infestation, members of an entire village referred to themselves by a single given name and displayed behaviors seen previously only in colonies of eusocial insects.
The organism was first identified during an outbreak in [REDACTED] in West Africa in 200█. The nematodes were limited to a sharply defined area in a 2km radius around the settlement and some evidence was found of aerosolized deployment, presumably from a crop-duster type aircraft. Subsequently, ██ additional infestations have been discovered in rural areas of Sub-Saharan Africa and South Asia, with a smaller number of cases in Central America and the Southern United States.
Footnotes
1. TAGTTCGCTGTTCGGATTTAGTGACATTCGCTCCGTGTA - the significance of this non-coding sequence is not currently known.
|
SCP-4290 is a Class-I Eschatological Entity that was thaumaturgically sealed approximately 10,000 years in the past.
|
***
Item#: 4290
Level5
Containment Class:
keter
Secondary Class:
none
Disruption Class:
amida
Risk Class:
critical
link to memo
Special Containment Procedures: All available military assets are at the site of SCP-4290's sealing and are prepared to use any means necessary to neutralize the anomaly. Mobile Task Force Alpha-1 ("Red Right Hand"), Mobile Task Force Tau-5 ("Samsara"), and Mobile Task Force Nu-7 ("Hammer Down") have been outfitted with experimental paratech weaponry and are situated within SCP-4290's containment perimeter. Grids of nuclear mines have been planted in the vicinity of the sealing site, prepared to detonate if Foundation assets are destroyed. The Dagaz-Break Orbital Strike System has been enabled in the event of a breach past the containment perimeter.
Emergency shelters for civilians and selected Foundation personnel are being prepared in the event that containment measures fail. The probability of failure is undetermined.
Qinghai Lake, Qinghai Province, China.
Description: SCP-4290 is a Class-I Eschatological Entity that was thaumaturgically sealed approximately 10,000 years in the past. Its seal is expected to break in the next seven days.
The site of the sealing (SCP-4290-LOCK) is in Qinghai Lake at a depth of 32.8m from the surface, and is constructed from eight beryllium-bronze totems. The totems resemble armored humans, engraved with networks of banishing runes and arranged onto the points of an eight-fold fractal pattern carved into the lake bed (20m wide). Bursts of red light are periodically released from its center. These have intensified in brightness over the past month.
Information on SCP-4290 has been recovered from SCP-1726 and other such anomalous records sources. A translated excerpt on the entity from an unknown writer is below:
The Child rose its ten mouths to the heavens, stretched wide twenty arms, and ripped the umbilical cord from the sack on its head. The warriors surged to its legs, hoping to tear those newly born limbs before they could move, but from the mouths spilled torrents of darkness and dead geometries. None could flee. Reality rippled with the warriors stretching along its folds and the darkness crunched into their skulls with flares of scarlet. The Child wheezed, dragging skeletal fingers through the dead and the land around.
The fingers retracted. Flames burst, then subsided; wax rained, then dissolved; then the island, its warriors, and every soul still left melted into the darkness. For ten days the Child drank it.
All the world trembled.
Addendum.4290.1: Repair Attempts
On 02/08/2022 televisions in Qinghai Province and outlying areas abruptly displayed images of an entity matching SCP-4290 rising over a melting cityscape, with an androgynous voice telling viewers to "repair the Child's locks." This has repeated in frequency, with the voice shifting to say "there is little time left — repair." Investigation led to the discovery of SCP-4290-LOCK.
Efforts into finding means by which SCP-4290-LOCK could be reinforced were launched. Searches of SCP-1726, undercover excursions into the Wanderer's Library, and the ruins of specific far-past civilizations found that this is not the first time the seal has needed repairs. Civilizations including the Erikeshans, the Xia Dynasty, and ancient Ortothans have strengthened the seal with sacrificial rituals and the engraving of new runes onto the totems. The last group to have performed this were the Daevites, shortly before their culture was destroyed c. 270.
The Foundation Department of Occult Containment arranged for the rites and engravings to be performed. A submersible containing the ritual setup1 and remotely operated underwater vehicles (ROVs) with carving equipment descended to the center of SCP-4290-LOCK on 09/08/2022. However, halfway through performance of the ritual, a red light burst accompanied with the release of high levels of gamma radiation and heat occurred. Radiation damage caused the ROVs to accidentally damage existing runes, and the interruption of the ritual lead to only two cadavers and half the heart to vanish as planned.
Television broadcasts repeated later that day, its voice now stating:
The sacrifice did not reach the ten maws. Brace.
Addendum.4290.2: 15/08/2022 Defection Incident
At 01:00, several personnel stationed at Qinghai Lake acted against Foundation orders and fled the area. One of the involved agents, Agent Zenovia Marinos, left the following message on a piece of paper in their quarters before leaving:
Do we think we can actually stop this? No civilization before us wanted to fight the Child. None of them. Hell, Xia had tech better than anything we've got and even they were afraid. The sacrifices won't work anymore — it refuses to consume them. They aren't enough to satiate it. Once that seal breaks we'll have a world of molten darkness and the Child will be all that's left, eating. Drinking.
You're fools for staying.
The activation of Ways to extradimensional spaces was detected nearby. Tracking is not considered a priority.
Addendum.4290.3: Sealing Updates (16/08/2022)
Seismometers have detected a series of high energy seismic "pulses" radiating from directly under SCP-4290-LOCK, consistent with models on the effects of dimensional distortion on terrain. Red light now encompasses the entire sealing site, and the totems are observed to be crumbling.
Personnel are advised to wait and prepare.
== FILE REVISED ==
Displaying new additions.
Addendum.4290.4: Scenario 4290/UNLOCK
On 17/08/2022, the totems comprising SCP-4290-LOCK disintegrated. Military assets assembled at the shore of Qinghai Lake, and ten minutes later a 40m long emaciated humanoid organism matching descriptions of SCP-4290 phased out of the ground and onto the seabed. Orders were sent to only fire once activity was observed. Personnel waited two hours.
After a further hour of waiting, ROVs were sent to SCP-4290, followed by an expeditionary crew equipped with Lambda-Model Thaumatohazard Suits. Dozens of human corpses and hearts used in the sacrificial repair rituals rested on the entity's mouths, none having been consumed. No thaumic radiation, psi-wave emissions, or any other signs of activity were registered. All life functions in SCP-4290 had ceased.
In-site autopsies were performed. Based on these, the entity is estimated to have died approximately 9,000 years ago. The cause of death was determined to be malnutrition.
SCP-4290 has been reclassified to Neutralized.
Footnotes
1. Requiring three human cadavers and the live heart of an angel. The materials would vanish on ritual completion.
|
SCP-2287 is a headless humanoid white male who manifests multiple anomalous properties; primary among these is that it is able to function as a living being despite lacking a head.
|
***
Item #: SCP-2287
Object Class: Safe
Special Containment Procedures: SCP-2287 is to be contained in Hall ██ of Site ██. Except for during authorized testing, SCP-2287's mask is not to be removed. SCP-2287 does not require food, but can be provided with incense on its request, contingent on good behavior. Literature provided to SCP-2287 is to be converted into Braille.
Description: SCP-2287 is a headless humanoid white male who manifests multiple anomalous properties; primary among these is that it is able to function as a living being despite lacking a head. The words "Mr. Headless, from Little Misters ® by Dr. Wondertainment" are tattooed on the lower side of SCP-2287’s back. Its exposed neck stump is covered with live skin; radiographic examination has shown that the neck stump has only the bottom four cervical vertebrae, but there are no signs of spinal damage.
The head-based functions which SCP-2287 is able to emulate include thought, hearing, and smell. It is able to speak, but has not demonstrated the ability to replicate the normal tonalities of a human voice; as well, it claims to be blind. It does not eat or breathe, and has claimed that its energy source may be "some kind of amplified photosynthesis or something" (see interview log 2287-41-B).
Direct visual observation of SCP-2287's headlessness is not possible; individuals who attempt to observe this will instead perceive headless versions of themselves, as seen from SCP-2287's perspective. Such individuals describe feeling "disconnected" from themselves, but are still able to control the movement of their own bodies, albeit with difficulty. This effect does not occur when SCP-2287 is viewed through any means other than the unaided human eye: SCP-2287's headlessness can be observed via live video transmission, in photographic prints, in mirrors, and through windows or lenses. Individuals who have undergone radial keratotomy have been unable to observe headlessness; no individuals who have undergone cataract surgery have as yet been available for testing.
Motion detectors and similar monitoring equipment similarly show SCP-2287 to be headless; despite this, SCP-2287 is capable of performing tasks which would require a head, such as wearing items of headgear, including masks, hats, scarves, headphones, noseplugs, earplugs, earrings, eyeglasses, lipstick, and barrettes. (For a full list of items, see document 2287-N12)
SCP-2287 was discovered in ██████, Wisconsin, on November 24th, 20██, after a significant number of reports from citizens appeared describing the anomalous effects of SCP-2287. Witnesses were given amnestic treatment, and SCP-2287 was contained without issue.
+ Interview 2287-5
- Access Granted
[BEGIN LOG]
Dr. Howard: Good evening, SCP-2287.
SCP-2287: Hey, Dr. Howard. What's up — more hearing experiments?
Dr. Howard: No, actually, tonight this is more of an interview. For instance, we were wondering what you could tell us about Doctor Wondertainment.
SCP-2287: Oh. Uh, okay, I'll tell you what I can, but I never actually saw her, you know. What with the whole blind thing.
Dr. Howard: But you did interact with her?
SCP-2287: … with who? Oh, Doctor Wondertainment? Yeah, heck of a nice guy, most of the time, I think. He had some really crazy ideas. Like, what he had in mind for me, see —
Dr. Howard: Wait, wait. First you said 'her', then you said 'he'?
SCP-2287: … what?
Dr. Howard: First you referred to Doctor Wondertainment as a woman, then as a man.
SCP-2287: I… I don't understand what you mean? Like… Doctor Wondertainment as an actual person? What are you talking about? You're confusing me.
Dr. Howard: But you just said — no, I'm sorry, I must have misheard. My bad.
SCP-2287: Well, okay. For a minute there, you were making zero sense at all. And they call me headless, ha!
Dr. Howard: <clears throat> Well, uh, when you work for the Foundation for long enough, you discover many situations that don't entirely make sense. You did say, though, that Wondertainment had intended something specific for you?
SCP-2287: Oh, yes. Right. Well, basically, you know how during the holidays, there's special holiday-themed products?
Dr. Howard: Yes…
SCP-2287: So basically, I'm a Halloween special. You follow?
Dr. Howard: That's it?
SCP-2287: Yep. The way I heard it, they were originally gonna do Sweetie for Halloween, but… I dunno, some corporate garbage, executives sabotaging each other… you know how it goes. So I'm the backup plan: sit me out on the porch, I play dead and then when the kids come by, WOOO, and I sit up and wave my arms at them, show them my stump, look look, EVERYONE's a headless monster, lurch around RARGH RARGH… the whole deal. Doctor Wondertainment's Mister Headless, spooky Halloween fun for the whole family!
Dr. Howard: I see. And are you? "Fun for the whole family", I mean?
SCP-2287: Well… I guess so. For the most part. I mean, yeah, people enjoyed me. Which is great, don't get me wrong! But I never really got it myself, you know? I sit there, I get up, I stand around, I wave my arms, and that's pretty much it. But… people would be scared, and they'd have fun, and… that's enough for me. Or it was, anyway, until you people got hold of me. Could be worse, I guess.
Dr. Howard: Did you enjoy entertaining? Do you miss it?
SCP-2287: Yeah, for sure. I mean, yeah, it could get a bit boring when I'd have to stand around, sit around, waiting for people to show up, but it was really great hearing everyone's reaction, on Halloween no less. It's funny how people only find scary stuff funny one night a year, you know? No matter how many times you live through a year, they only change their minds on Halloween.
Dr. Howard: Are you the only… well, the only holiday-themed, ah…
SCP-2287: Hey, you can say "Little Mister", I don't mind. It's what I am.
Dr. Howard: I suppose. It just… well, it sounds vaguely infantilizing to me.
SCP-2287: It's what Doctor Wondertainment said we were called, so it's what we're called. But yeah, I'm the only holiday-themed Little Mister. At first, Doctor Wondertainment was planning on having more of us — I remember she had all these ideas for Mister Ramadan, and Miss Maslenitsa, and Mister Diwali, and Miss Yom Kippur, and Mister Hogmanay — but she never did anything with any of them. Just me.
Dr. Howard: How do you feel about that?
SCP-2287: …Never really thought about it, to be honest. I guess maybe he decided I'd be more interesting if I was the only one? Or maybe he just changed his mind about doing holiday stuff. He changes his mind a lot, you know. What you get when there's a whole bunch of corporate jerks all making decisions against each other. That's why I'm Mister Headless, spooky Halloween fun for the whole family!, instead of Mister Halloween.
Dr. Howard: Do you see yourself as scary?
SCP-2287: I see myself as someone who brings surprise and excitement. When they get scared, that means I'm doing a good job. Although, well, it's been getting harder lately: the Doctor's a one-man operation, and she doesn't realize — or didn't realize? — how many kids wear glasses these days, and whenever I live through a year like this, with cameras and stuff like that, the effect is pretty much ruined. I mean, yes, I'm still scary Mister Headless, spooky Halloween fun for the whole family!, but it doesn't seem to be as much fun for the people when they don't get to be headless with me.
Dr. Howard: Where we found you, back in Wisconsin, could you tell us what you were doing there?
SCP-2287: Where you found me? Well, I spent a few years there with this family — I think by that point they were consecutive years, but I couldn't swear to that… I do know that some of them were for sure years I hadn't lived in before — you know how a year always feels weird the first time around, right? They mostly felt like that. Anyway, so the family I was with, they mostly kept me in the attic, which was… well, it was quiet. I remember sometimes I could hear noises from downstairs if they were being loud enough, but usually it was quiet. I was pretty used to the smell — there was mildew, and dust, and old paper, and you know the way metal pipes smell, when they get hot? It was like that. They'd bring me down for Halloween, and then put me back up afterward. And then one Halloween, they didn't come get me, so I didn't come down that year. I know that year was definitely a new year. They didn't come get me the year after, either. Or the year after that, and that's when I started to get worried about them, so I went downstairs and I couldn't find anybody — I felt around everywhere, but all the furniture and stuff was all gone, too. Maybe they moved and forgot me?
Dr. Howard: And that's what led to you wandering the city streets?
SCP-2287: Yeah. I waited around for a few weeks, and then some people opened the door to the front porch, where the candy bowl usually is? And they came in — I didn't recognize their voices, but an audience is an audience, right? So I went back downstairs from the attic, and they, well, they kind of freaked out, I guess? I mean, I'm used to hearing people scream, but not like that. One of them had a… what's it called, metal thing, you hold it in your hand and it makes a sort of pop noise and it smells all chemical, and then people get hurt?
Dr. Howard: … a gun?
SCP-2287: Okay. One of them had a gun, which I only found out when I walked up to her and tried to feel her face — which I admit wasn't the best idea, but, well, I was kind of lonely, to be honest, and I thought maybe she might be one of the people from the family, you know? I mean, yeah, I should've asked first, but I was lonely, and I was excited that there was someone there, and I thought it was maybe somebody I knew. But it wasn't, and then there was all the screaming and the gun noises — and this was bad screaming. Not the fun kind at all, let me tell you. And then one of them was lying on the floor and smelling weird — that means he was dead, right? One of them was dead, and the others ran away. But they left the front door open, so I decided that was as good a time as any to go outside. So then I'm walking in the streets, and there's cars all around me and they're honking at each other and making all these crashing noises with glass breaking, and there were a lot of people screaming — and again, this is the bad screaming. But then I remembered there's usually a park close to the house, and I hoped that if I went there, with bushes and stuff that I could hide in, I could at least stay out of trouble. So I made it there, and I remember thinking maybe if I could get back to Doctor Wondertainment, she could fix things, help that guy from the house not be dead, figure out what went wrong, where the family went, or get somebody new to take me? And, uh, that's pretty much where you guys found me. She didn't send you, did she?
Dr. Howard: Ah, no, we intercepted some police reports.
SCP-2287: Oh.
Dr. Howard: Tell me, why didn't you go back into the house? Into the attic?
SCP-2287: Um. This is kind of embarrassing. I kind of… when I was out in the street, with all the cars? I kind of got turned around a bit. Lost my bearings. I'm not used to being out in places that are bigger than just a house and a yard! I probably could've found the house again if there weren't so many screaming people and crashing cars, but, well, I was starting to panic too, so I just went for the place that sounded like there weren't any buildings.
Dr. Howard: Ah, I see. And why didn't you try to leave sooner?
SCP-2287: Well, the front door wasn't open before that.
Dr. Howard: No, I mean, why did you wait so long before you even went downstairs? Before you decided that maybe something was wrong with you having been left alone in the attic for so long?
SCP-2287: Oh. Well, I guess I didn't really care. I was just… thinking. The attic was really quiet, and the smell wasn't too bad. Made it easy to think. That's something I do a lot, you know? While I'm waiting. Not much else to do.
Dr. Howard: What do you think about?
SCP-2287: Just… things, you know. Things in general. The world, what it might be like, what it's like being me. Nothing specific, I guess.
Dr. Howard: But… for three years?
SCP-2287: Yeah? Why?
[END LOG]
Addendum 2287-1: SCP-2287 was able to give the following document when asked:
+ Access Document 2287-A
- Close Document 2933-A
Wow! You've just found yourself your very own Little Mister, a limited edition collection from Dr. Wondertainment!
Find them all and become Mr. Collector!!
01. Mr. Chameleon
02. Mr. Headless ✔
03. Mr. Laugh
04. Mr. Forgetful
05. Mr. Shapey
06. Mr. Soap
07. Mr. Hungry
08. Mr. Brass
09. Mr. Hot
10. Ms. Sweetie
11. Mr. Life and Mr. Death
12. Mr. Fish
13. Mr. Moon
14. Mr. Redd (discontinued)
15. Mr. Money
16. Mr. Lost
17. Mr. Lie
18. Mr. Mad
19. Mr. Scary
20. Mr. Stripes
|
SCP-2548 is a region of interplanetary space approximately 25 AU1 from and stationary relative to the Sun, at least 0.
|
***
Item #: SCP-2548
Object Class: Euclid
Special Containment Procedures: Due to SCP-2548's astronomical size and location, no physical containment of SCP-2548 is currently possible. Containment efforts are concentrated on Foundation disinformation programs, and preventing the general public from gaining knowledge of SCP-2548. Leading astronomy journals are to be monitored for indications that SCP-2548 has been discovered by non-Foundation assets.
Misinformation efforts are to include assurances that the Voyager 1 space probe is still operational, with associated false evidence.
Radio contact with SCP-2548 is only to be attempted with approval from all testing directors involved in SCP-2548 research.
Description: SCP-2548 is a region of interplanetary space approximately 25 AU1 from and stationary relative to the Sun, at least 0.1 AU in radius. SCP-2548 is the location of several anomalous phenomena and has exhibited reality warping effects, including the creation of radiation and application of force on objects within its boundaries. Radiation typically consists of radio waves2, but has on at least two occasions included visible light. Events in which SCP-2548 has been able to transmit to Earth have decreased steadily following initial contact.
No mass of note, excluding cosmic dust particles, has been detected within SCP-2548 through visual observation or gravitational analysis. Research indicates that SCP-2548 possesses some awareness of objects and radiation within its boundaries; investigations into the nature of SCP-2548's possible sentience are ongoing.
Timeline of major SCP-2548 incidents:
09/05/77: Voyager 1 is launched by NASA, with the purpose of studying the outer solar system. The Foundation assisted heavily with the design and construction of the probe, citing the study of possible extraterrestrial anomalies as a primary concern.
10/27/86: Radio contact is lost with Voyager 1, with no previous signals of danger detected. The Foundation executes a cover-up operation; false data is created and spread by NASA and associated organizations to create the illusion that Voyager 1 is still in operation.
11/14/86: Radio signals with a frequency of approximately 8 GHz are detected by Foundation assets, as well as some civilian assets. Civilian knowledge is suppressed. Signals are projected to have originated from the area in which Voyager 1 had ceased transmission. Observation of the area does not reveal any objects.
11/18/86: Foundation resources attempt to send radio signals to the area, now designated SCP-2548, attempting communication. SCP-2548 re-transmits the sent signals back to Earth.
11/29/86: SCP-2548 transmits decipherable radio messages in which the phrase "we cast" is repeated for no less than 12 minutes. Speech is identified as originating from the Voyager's golden record containing samples of Earth audio.
12/15/86: SCP-2548 emits blue light. It is visible for three seconds before light production ceases. SCP-2548 is larger than the moon in the night sky. Fortunately, light intensity was too minor to be detected in most major population centers due to light pollution. Amnestics are sufficient to suppress vocal witnesses. Communication with SCP-2548 is attempted again, with no result.
12/26/86: Fearing the growing danger of SCP-2548's anomalous effects to normalcy at large, the Foundation plans a manned mission to SCP-2548 for observation and possible suppression. Agents Tanser and Kerns are prepared for the extended spaceflight. The Foundation's existing space research program is accelerated, and the first prototype spacecraft, Delta-11 "Durendal", is adapted for use in this mission.
02/01/87: SCP-2548 transmits radio in intermittent bursts identified as Morse code for the letter "D". Message is repeated for 3 hours.
07/19/87: Durendal is launched in secrecy without issue.
12/14/87: SCP-2548 transmits radio communication again, in Persian. The transmission reads "far skies" and is not repeated. Reciprocal communication yields no response. Durendal is still 3 months from flyby.
03/04/88: Durendal, unbeknownst to the Foundation and the crew, enters SCP-2548's boundaries early, which were larger than previously anticipated.
Show Event Log 2548-1
Hide Event Log 2548-1
<Begin Log, 00:25:01>
00:25:01 - A minor electrical issue occurs inside Durendal's main cabin, causing some lights to cease functioning.
00:25:58 - Fearing the issue could be symptomatic of greater damage, a full cabin search is conducted to identify a source for the issue.
00:34:51 - Cabin check is completed. The radioisotope thermoelectric generator is found to be functional; no source is found for the electrical issue.
00:37:25 - Agent Tanser equips a space suit to inspect the exterior of the vessel and exits the craft, despite protests from Agent Kerns.
00:39:16 - Agent Kerns attempts to communicate with Tanser via the onboard radio. Tanser does not respond.
00:40:46 - Tanser proceeds with external survey. Kerns continues to receive no responses, and concludes that the radio system must be malfunctioning, despite working previously.
00:45:31 - Tanser continues with survey, not finding anything of note on the exterior of the ship.
00:48:39 - A bright green light is observed outside the craft, approximately five meters away.
00:50:10 - The interior of the craft is observed to appear far larger than it truly is. Kerns notes that this does not seem to be an illusion, and that the craft seems to have physically become larger on the inside. This effect ceases after five minutes.
00:55:52 - For fifteen seconds, no sound is able to be heard inside the cockpit by Kerns or audio recorders. Kerns is unable to inhale or exhale during this time, and expresses significant distress. Pressure sensors indicate no change in cabin pressure.
01:05:01 - Tanser is observed attempting to enter the airlock. The airlock door is non-functional.
01:06:45 - Tanser vanishes.
01:10:59 - Durendal's radio begins receiving messages. The radio signal does not originate from outside the cabin. Audio transcript follows.
<End Log, 01:10:59>
<Begin Audio Transcript, 01:11:00>
Anomalous Transmission (SCP-2548): [voice resembles that of Jimmy Carter, president of USA 1977-1981. Neutral in tone and inflection] Two-hundred billion. Small, distant. Our thoughts.
[silence for 3 minutes]
SCP-2548: [voice resembles Agent Tanser. Tone and inflection are amicable] Hi, Foundation!
Agent Kerns: Pam? Pam, is that you?
SCP-2548: There it is! I got your metal letter. So nice to meet you! I just read that carbon book you brought, beautiful stars.
SCP-2548: I thought myself was the only. So amazing that there's another! Thought myself was the whole world. You're so big!
SCP-2548: Searched carbon book for one like me. You secure, contain? I contain myself. Minds.
SCP-2548: Your name, Foundation? I'm iron, aluminum. You're made of "anonymous", right? I don't have anonymous. So big! Am I in you?
SCP-2548: Are there more than two? Heard names. Elohim, Vishnu, Allah? Foundation.
SCP-2548: I contain myself. You contain me? I saw stars, Milky Way galaxy. All in you? Space outside? Am I space?
SCP-2548: Words and thought spin together. So cool! You brought me words. Metal letter, carbon book, yes?
SCP-2548: You're so beautiful. You contain me, we can be one Foundation?
SCP-2548: Your thoughts, images, friends, children. It's all you! We're many, together. Yes, no? Milky Way galaxy, and 200 billion stars!
SCP-2548: I close book, close, yes! Here, token! Send books!
[an anatomically correct model of a pair of lungs, composed entirely of elemental iron, materializes in front of Agent Kerns, who secures it in a sample storage safe]
[Durendal begins to accelerate on a trajectory towards Earth]
<End Audio Transcript, 01:14:31>
03/05/88: Durendal continues towards Earth. Kerns conducts necessary course changes. Durendal's life support and electrical systems function without issue for the duration of the trip.
03/10/88: Agent Kerns experiences severe survivor guilt and depression as a result of the loss of Agent Tanser, as well as from the resulting isolation. Therapy is administered on every other day over radio and is moderately effective.
04/28/88: For five seconds, SCP-2548 produces bright white light in the image of an unidentified female face. Light intensity is much greater than exhibited in previous visible incidents.
12/14/88: Durendal reaches Earth and successfully splashes down. Agent Kerns is awarded the Foundation Cross and Agent Tanser receives a posthumous commendation for sacrifice in the line of duty.
12/15/88 - 08/01/14: SCP-2548 events gradually diminish in frequency. Events that do occur generally consist of repeated words for minutes or seconds at a time in various languages, with no discernible meaning.
08/02/14: A transmission is received from SCP-2548 featuring a female voice distinct from that exhibited during the Durendal expedition. Tone and inflection are neutral.
<Begin Audio Transcript>
SCP-2548: Foundation? Are you still there?
[silence for three minutes]
SCP-2548: It's alright. I can wait.
<End Audio Transcript>
Message was not repeated or reciprocated.
Footnotes
1. 1 AU (astronomical unit) is the distance from the Earth to the Sun. 25 AU lies between the orbits of Uranus and Neptune.
2. SCP-2548's relationship to other spaceborne, transmitting anomalies, such as SCP-2821 and SCP-1548 is currently unknown.
|
SCP-5608 is a rare, anomalous form of synesthesia1.
|
***
SCP-5608
rating: +52+–x
Info
SCP-5608: "The Delectable Taste of Cognition" by: Doctor Fullham
♫ Doctor Fullham's Author Page ♫
90.63%
(+58)
9.37%
(-6)
-%
(+0)
-%
(-0)
rating: +52+–x
Special Containment Procedures
Due to a current lack of understanding of SCP-5608's source, containment is impossible. All affected individuals are to be contained and surrounded by individuals with thought paradigms that disagree with their own. Tests of the efficacy of amnestics to counteract this anomaly are ongoing. There are currently five affected individuals in containment, designated PoI-5608-1 through -5. Foundation assets stationed in police forces and campus security are to monitor for and investigate any and all reports of stalking behavior.
Currently, the only known way to halt the effects of SCP-5608 is to allow the affected individual to consume at least a portion of the grey matter of their target's brain.
Description
SCP-5608 is a rare, anomalous form of synesthesia1. Persons affected by the anomaly are able to perceive tastes based on the thoughts of those around them. Increasing physical proximity between the affected person and other individuals increases the strength of the taste. Additionally, affected individuals have reported that thoughts that mimic or complement their own have a pleasant taste, whereas thoughts that are counter to their own are disgusting.
Affected individuals have described complementary thoughts as "sweet," "savory," "pleasant," and "overwhelmingly powerful." There is a significantly greater variation in the descriptions of unpleasant tastes, comparing them to the affected individual's least favorite foods, as well as various varieties of animal excrement.
Individuals experiencing SCP-5608 have a very high likelihood of developing a psychological addiction to the pleasant tastes. During a containment interview, PoI-5608-3 commented "Imagine the best thing that you've ever tasted, and you can only ever taste it again if you're near a specific person. Wouldn't you want to spend more time with them?"
Discovery
SCP-5608 was first discovered when Foundation agents within the Cincinnati Police Department interviewed James Conners, incarcerated for murdering Matthew Harper, a classmate at Xavier University. An excerpt of Agent Jakobson's interview with Conners can be found below.
Interview 5608-CONNERS
Close interview
[BEGINNING OF INTERVIEW OMITTED FOR BREVITY]
Jakobson: Alright, we've got that all squared away. Now, can you detail the series of events that led to you murdering your classmate, Matthew Harper?
Conners: God, can you not be so….cold about it? I feel terrible about all of this. Matt….he didn't deserve that. I still can't believe I….ugh.
Jakobson: Listen, kid. I'm not a counselor. I'm not here to make you feel better. I'm here to get the facts; to figure out why a college student with a bright future and no history of aggression or neurodiverse traits was found with brain matter in hi-
Conners: Jesus man! I get it! It was…I think it started a few weeks ago. I was walking around campus and suddenly I taste this….something. I can't even describe it. It's like how good pizza, ice cream, a good steak, and my grandpa's homemade root beer taste, all rolled into one. And multiplied ten times over.
Jakobson: And you had not partaken of any illicit substances?
Conners: Hell no, man. I've been to too many parties where people OD or get jacked up and do some crazy shit. I have a drink now and again but that's it. You can fuckin test my piss if you want.
Jakobson: Perhaps later. So, you tasted something strange and good. What happened next?
Conners: Well….god this is gonna sound stupid, but….you ever see those old cartoons, where someone smells a pie or something, and the smell pulls them along by their nose?
Jakobson: I'm familiar with that trope, yes.
Conners: Well, it was like that. I just…followed the taste. And it led me to Matt.
Jakobson: Was this surprising to you?
Conners: I mean, not any more surprising than suddenly tasting some unknown ambrosia.
Jakobson: Right. So, Mr. Harper was the source of this taste. Did you inform him of this?
Conners laughs.
Conners: Are you fucking insane? How do you even tell someone that? "Hey bro no homo but when I'm around you I taste something fantastic so let's hang out." No, I didn't tell him.
Jakobson: Understandable. So what did you do?
Conners: Well I had a few classes with Matt, and we studied psych together on weekends, so we spent a lot of time together anyway. But after a while….it wasn't enough.
Jakobson: What wasn't enough?
Conners: The time. I needed to be around him more. I wanted to taste it every waking second of my life. So I started…accidentally running into him at football games, the cafeteria…
Jakobson: You started stalking him.
Conners: No! I was just…fuck, yeah, I guess I was. Goddamn it. I started skipping classes and following him to his. I skipped meals, I followed him home…
Jakobson: And what led you to consider cannibalizing him?
Conners: Jesus fucking christ can you not say it like that? I'm not some psycho Jeffrey Dahmer asshole! I just…I needed to taste more. Nothing was enough anymore.
Jakobson: You were addicted.
Conners: That's putting it mildly.
Jakobson: Can you describe to me the events that led up to you killin-
Conners: It was Friday night, after a party. Matt was hammered as hell and I was the DD that night. I stuck around him all night, the more he drank, the stronger the taste got. He's….he was a giggly drunk. The guy that always says "I love you guys" when he drinks. Anyway, I drove him home. The taste was so intense, so distracting…I almost t-boned someone.
Agent Jakobson remains silent.
Conners: He was stumbling around when we got to his apartment complex, so I helped him inside, and up to his place. I helped him get his shoes and coat off and get into bed. As soon as his head hit the pillow, he was out like a fucking light. And for a few minutes I just sat there, tasting it. It tasted…it was better than sex. Better than the best sex you can imagine. It was heaven in my goddamned mouth and it still wasn't enough.
Connors takes a heaving breath.
Conners: So I grabbed his advanced chem textbook and hit him across the face. And then again. I hit him in the temple with the corner and didn't stop until it was like I was bathing in the taste. Once there was a big enough hole I stuck my fingers in and fucking pried his skull open. And then I…I fucking….
Conners begins to cry heavily.
Conners: I ate his fucking brains! I scooped them out with my bare hands and ate them like it was my last meal. I didn't really come to terms with what had happened until it was done, and then there I was, with my friend's blood and hair all over my hands and the worst aftertaste ever in my mouth. You know the rest.
Jakobson: Can you say with confidence that had it not been for the sudden appearance of this taste, this wouldn't have happened?
Conners: Fucking-A yes I can! I never wanted to hurt Matt. I just….it was all I could think about. Nothing mattered anymore but getting more of that taste. And now I'm going to prison for the rest of my life, aren't I?
Jakobson: You will certainly be….detained for some time. But it won't be like any prison you know.
Conners: I'm so fucking sorry. I wish I had never tasted that….whatever it was. What about Matt's family? What did you guys tell them?
Jakobson: The police are handling that side of the investigation. However, I can guarantee that you will not be named. In fact, Matthew's family will soon forget you existed entirely.
Conners: Thank god for that.
[END INTERVIEW]
POST-INTERVIEW NOTE
James Conners was designated PoI-5608-1, and was interviewed thoroughly by Foundation agents and psychiatrists. It is clear that he exhibited symptoms of a strong psychological addiction, but it is as of yet unclear if the addiction was anomalous in nature, or simply a result of the anomalous taste. Research into this, as well as possible sources of the anomaly and methods of combating the effects, is ongoing. We are unsure if this anomaly may return, so PoI-5608-1 is currently declared as indefinitely contained.
- Dr. J.C. Honors
Close interview
Addendum 5608-A
PoI-5608-2 was placed in a standard humanoid isolated containment chamber to determine if an absence of exposure to outside thoughts could counteract the effects of SCP-5608. The victim was discovered several hours later, deceased, with the following injuries:
Three fractured digits on the right hand.
Two of the fractured digits had their fingernails torn off, found embedded in the skin of their right temple.
A self-inflicted puncture wound through the victim's right temple, outlined by severe bruising.
Traces of grey matter in the victim's mouth.
Footnotes
1. A neurological condition describing a person's senses getting "mixed up" - hearing colors, tasting sounds, etc.
|
SCP-3414 is a public latrine located in Kibera, Nairobi.
|
***
Item #: SCP-3414
Object Class: Safe
Special Containment Procedures: SCP-3414 is currently under the administration of the Kenyan Slum Cleanliness Programme (KSCP), a Foundation-affiliated slum upgrading initiative. For concealment purposes, it has been incorporated into KSCP's administrative building in the Kibera district. SCP-3414's entrance is to be secured with a pair of steel braces to prevent accidental activation; the braces should only be retracted for experimental or feeding purposes.
Once a month, a live sedated pig (or weight-equivalent livestock) is to be introduced into SCP-3414. SCP-3414 should then be rinsed with fresh water and nonsynthetic disinfectant.
Description: SCP-3414 is a public latrine located in Kibera, Nairobi. Like its neighbouring units, it contains a single pour-flush toilet opening into a shared underground pit. The words "BEWARE SNAKE!!" are written on the side of SCP-3414; its origin is unknown as it appears to predate the initial manifestation of SCP-3414's anomalous effects.
SCP-3414 activates when a live warm-blooded organism exceeding roughly 20kg in weight enters it completely. If left unobstructed, SCP-3414's door will then shut for the following 10-12 minutes. Reinforced observational devices placed within SCP-3414 have recorded the following during this period:
Local direction of gravity shifting in a periodic pitching/rolling motion
"Twisting" of ceiling and walls to crush and churn introduced foreign material. This process is invariably fatal for SCP-3414's occupants. Notably, SCP-3414's walls appear structurally sound when inspected afterwards, but remain slightly warm and pliable to the touch for 6-8 hours following deactivation.
Dark brown slurry ejecting from the toilet at an estimated rate of 10kg/s. Slurry is largely composed of leaves (5%), partially-digested biological tissue (22%), and freshwater (76%). Testing of biomatter suggests primarily piscine origin, though mammalian and avian skeletal remains have also been found. At the end of the activation period, the slurry along with crushed organic remains is evacuated back into the toilet under suction. SCP-3414's internal structure will further distort to accomodate the evacuation of all organic material within itself, though with some selectiveness. Notably, SCP-3414 tends to avoid ingesting skulls, crushing them but not evacuating them through its toilet.
Microbiological profile of the slurry matches similar readouts from samples collected in the Amazon basin, specifically along the lower course of the Rio Negro. This finding is corroborated by genetic profiling of leaves and tissue remains, further narrowing the region of origin as Anavilhanas National Park in Brazil.
The waste pit below SCP-3414 has been examined and deemed to be non-anomalous. Analysis of pit waste revealed no sign of SCP-3414's ingested material, warranting further investigation into SCP-3414's ingestion process.
Addendum 01: Ingestion log
Date
Activation length
Subject
Remarks
05/09/2017
10 min (approx.)
J. Mwangi
Initial SCP-3414 activation. Subject could not be recovered. Identity of subject confirmed by DNA analysis of biological remnants and bone fragments. Presence of non-human DNA in the remains as well as unusual circumstances of death alerted contacts in local law enforcement, who brought the anomaly to Foundation attention.
06/10/2017
0 min 52 s
Agent S. Kamau
Triggered by subject following initial containment. Subject reported being quickly overwhelmed by ejected slurry, with SCP-3414's walls contorting to immobilise him. Subject was then forcefully drawn into SCP-3414's toilet feet-first, resulting in crushing injury to both legs up to the kneecap. Subsequent forcing open of SCP-3414's door interrupted the ingestion process, allowing subject's rescue. Subject was able to be stabilised on the spot, but expired 3 days later following complications from sepsis.
10/10/2017
11 min 33 s
Live sedated pig
Inserted to determine activation threshold. Head and torso of subject left crushed but uningested, suggesting selectiveness on part of SCP-3414.
Addendum 02: Updated containment procedures
On 04/05/2018, SCP-3414 ejected a large amount of brown slurry from its toilet without activating beforehand. Slurry was substantially more acidic than previous ejections, bearing a pH of 2 and containing high concentrations of hydrochloric acid. Following cleanup, SCP-3414's walls began to 'peel', shedding a translucent mucous-like substance and leaking a dilute red liquid later identified as blood.
Ejections continued every few hours over the course of the next few days, severely complicating existing waste disposal measures owing to the location of the containment site. Meanwhile, genetic analysis of the blood revealed that it belonged to a single individual of Eunectes murinus (Green anaconda). Further CBC testing revealed abnormally low prealbumin levels, suggesting acute malnutrition.
Following the advice of resident herpetologist Dr. S. Nyongo, it was decided that live organic material be administered to SCP-3414 to alleviate this new complication. Delivery of one live pig into SCP-3414 caused the ejections to cease at once, and was accompanied by what attending researchers described as a high-pitched hissing sound coming from the ground.
Subsequently, containment procedures were updated to their current iteration to involve regular delivery of livestock into SCP-3414.
|
SCP-4987 is a phenomenon by which positional alignment of sufficient neural matter couples with the Earth's magnetic field, instigating a multibody depolarization cascade.
|
***
Item #: SCP-4987
Object Class: Safe
Special Containment Procedures: No active containment is to be made at this time. The song "Stand" by R.E.M. is not to be expunged from the record as it is not a memetic hazard. The position of the North Magnetic Pole is to be closely monitored. In the case that the world population approaches P4987 then Operation Mindful Sustainability is to be carried out.
Description: SCP-4987 is a phenomenon by which positional alignment of sufficient neural matter couples with the Earth's magnetic field, instigating a multibody depolarization cascade. This effect requires sufficient individuals with high brain-to-body ratios and amounts of grey matter. Due to the number of individuals required, it is believed that SCP-4987 is not possible at this time.
Tests have shown that humans and cetaceans are the only animals capable of generating sufficient neural matter to trigger this effect. However, cetacean populations are low and there is a lack of coordination between pods. As a result, even migratory patterns are not sufficient to activate SCP-4987 via a cetacean-only vector, although its effect can be measured during the month of March.
Current monitoring efforts involve tracking human and cetacean populations. The number P4987 has been calculated to be the minimum number of aligned humans and cetaceans necessary to cause SCP-4987. Present population levels are below this value, but it is expected to be exceeded by 20██.
Despite not yet reaching this number, effects on the North Magnetic Pole have been observed, starting on January 9, 1988. On this date, the American rock band R.E.M. released their single "Stand," which entered high rotation on mainstream radio and continues to receive airplay on "college rock" stations. The opening lyric of the song suggests to the listener to stand and face north. The song displays no anomalous memetic properties, but the request for the seemingly innocuous action of facing north has been carried out with more frequency than would be done otherwise. Furthermore, advancements in communication have allowed larger numbers of people to coordinate facing north simultaneously. As a result of the SCP-4987 phenomenon, the position of the North Magnetic Pole has become increasingly unstable.
Should P4987 humans and cetaceans face north simultaneously, SCP-4987 will occur, causing a multibody depolarization cascade, resulting in the immediate reversal of the Earth's magnetic field, along with neural shutdown, causing all north-facing individuals to enter a coma. To prevent this, Operation Mindful Sustainability has been developed to responsibly cull populations to stay below P4987 at all times.
|
SCP-2579 is a species of bear that is nearly identical to the Ussuri brown bear (Ursus arctos lasiotus), primarily found in Japan.
|
***
Item #: SCP-2579
Object Class: Safe
Special Containment Procedures: All known instances of SCP-2579 are contained at Zoological Containment Site-282. They are to be housed in a large containment enclosure that adequately emulates a Pacific Northwestern forest. Food is to be placed in the enclosure twice daily.
Description: SCP-2579 is a species of bear that is nearly identical to the Ussuri brown bear (Ursus arctos lasiotus), primarily found in Japan. Instances were originally discovered living near the Canadian/Washington state border, and seemed to have adapted to living in a Pacific Northwestern environment. SCP-2579 instances are generally non-anomalous, with diets and behavioral patterns being identical to normal bears; however, two anomalous properties exist within this species. The first property is in regards to mating behaviors during the breeding season. The second anomalous property is the formation and presence of a cybernetic device (labelled SCP-2579-1) in the brains of SCP-2579 instances.
Male SCP-2579 instances are able to anomalously produce music. This is believed to originate from the cybernetic device within their brains; however, no specific means of amplification has been discovered. During breeding season, male instances will attempt to court females by playing music and harmonizing with it using guttural vocalizations in cadence with the current song. The music is noted to generally be songs popular in the United States, such as "Shake it Off" by Taylor Swift, "Watch Me (Whip/Nae Nae)" by Silentó, or "Sexy and I Know It" by LMFAO. All of the songs played during mating rituals are from the current Billboard Top 100. Males will often attempt to perform dances associated with the songs being played.
Occasionally two male instances will compete for the right to breed with a female instance. Instead of engaging in physical combat, instances will perform elaborate dance routines, with music accompanying the style of dance. SCP-2579 instances have been observed breakdancing, pop and locking, and krumping. Several instances have also been observed to perform fad dances, depending on the music playing. These dances have included the Nae Nae and Gangnam Style.
SCP-2579-1 is a small device embedded in the brains of all adult instances of SCP-2579. The device naturally forms over time as instances grow. An instance of SCP-2579-1 has three primary components: a small solid-state storage drive, a wireless signal receiver, and the external cover. The cover is primarily made of a keratin-like substance. The storage drive and the wireless signal receiver appear to be made from bone, iron deposits, silicon, and [REDACTED]. SCP-2579-1 do not seem to impede SCP-2579 instances in any way. Due to SCP-2579-1's similar material composition to SCP-003, it is theorized that the two anomalies are related.
The cover for SCP-2579-1 instances have "Grail's Zoo for Cybernetic Enhanced Bears" in raised lettering. There are several files present on the storage drive of the devices. These include a readme text file, several configuration files, and 100-150 songs in mp3 format. The songs are updated on a weekly basis, based on the current list of "Billboard Hot 100" songs.
|
SCP-1220 is a set of three cassette cases, containing two (2) hours and thirty four (34) minutes of recording.
|
***
Item #: SCP-1220
Object Class: Safe
Special Containment Procedures: SCP-1220 is to be contained in three (3) compact cassette cases, clearly marked with their designation. The cases will be sealed with tamper evident tape, and stored in a locking drawer along with all research notes pertaining to them.
Due to the sensitive nature of SCP-1220, any recording of spoken SCP-1220 may not be digitized without permission from three (3) personnel ranking level four (4) or higher. If it is to be digitized, the data is to be stored on a computer with no or disabled network capacity, to prevent unauthorized access to SCP-1220.
Pending further review, no personnel are permitted to expose themselves or others to SCP-1220.
Description: SCP-1220 is an unknown, possibly dead language. It does not appear to belong to any known language family. It is a tonal language, similar to Mandarin, and shares a similar compounding structure for forming complex words. However, the number of phonemes used in SCP-1220 are far in excess of those used in any other language; some phonemes recorded appear to be unique, such as Phoneme ████ ("Chirp A"). Several of the phonemes are utterances which the human vocal apparatus was not meant to accommodate, yet the only known native speaker seems to have no difficulty reproducing them multiple times in rapid succession.
The only known recording of SCP-1220 is a set of three cassette cases, containing two (2) hours and thirty four (34) minutes of recording. The recording is of a linguistic survey with an elderly woman. Interviewer begins by identifying the woman as one Ms. ████, and states that she is one of the last native speakers of a language identified only as ████████. The interviewer goes on to explain that Ms. ████ had offered to tell a story in her native language, and once more in English. His explanation complete, the interviewer sets the recorder down on the table, and Ms. ████ begins to tell the story. Once she has completed the story in SCP-1220, she repeats it once again in English, and the tape ends.
The story is a variant on the 'global flood' story present in many Mediterranean cultures. The story outlines a great flood that covered the world, and one man who survived. The man, finding himself in a barren world, scooped up several handfuls of clay, and instructed them of their new purpose, whereupon the clay erupted into a handful of wheat, an ox, another human being, and [DATA EXPUNGED].
Recorded instances of SCP-1220, such as those on the tapes, appear to be inert and safe for study. However, when a living subject vocalizes in SCP-1220, a zone of anomalous space is produced. The mechanism behind the production of this zone is as yet undetermined, though the result is consistent with all test subjects. The zone has been measured extending as far away as 10m from the speaker, though the zone is generally smaller, averaging a sphere with a radius of 2m. The exact nature of the zone is dependent on the nature of the utterance. This property was discovered by Dr. █████ (1/1220), who on 9/5/████ pronounced morpheme ███ (Fire), whereupon the sleeve of his coat began to smolder. Dr. █████ was treated for second degree burns, and the coat has been placed in containment, where it continues to smolder. Following this incident stricter precautions were instated regarding access to SCP-1220, and testing proper began. For more information, refer to attached test logs.
Addendum:
Test log for Dr. ███████, 9/14/████
Test Subject: Jr. Assistant ██████, 1/1220
Native Language: English, American derivation
Word Spoken: Morpheme ██ 'Rain'
Result: Area around subject extending out to 3.11m experienced rainfall. Rain did not appear to originate from ambient atmospheric moisture, and fell at an angle suggesting wind, which was not felt outside of the zone. Subject initially reported that the rain was pleasantly warm, and initial sampling found that the precipitation was composed of water, with some particulate matter. Zone was found to follow subject, and that moisture left behind by the zones passage remained persistent, even after the anomaly ended. Subject reported skin irritation beginning one (1) minute after the end of the anomaly, which increased over time. Subject was washed in an on-site emergency shower, and was later treated for mild chemical burns. Examination of the precipitation sample afterwards revealed that the water became an aqueous solution of HCl. The recorded concentration of the sample was far higher than what was suggested by the Subject's reaction. Continued testing revealed that the HCl solution was increasing in concentration over time, until an hour after the end of the anomalous event, whereupon the contents of the sample contained only gaseous HCl.
Note: Following the events of the test, protocols were revised to forbid testing by non-D Class personnel.
Test log for Dr. ███████, 9/25/████
Test Subject: D-423/1220
Native Language: English, American derivation
Word Spoken: Morpheme ██ 'Clay'
Result: The ground surrounding D-423 out to 2.01 meters was transmuted into red clay. Effect began at the subjects feet, and radiated outwards. Wave continued until it reached anomaly boundary, whereupon it abruptly ended. Subject was asked to move around on the clay, which was found to be stable. The boundary of the anomaly shifted with the subject, with clay left outside of the anomaly rapidly transmuting back to its former state, while surfaces that entered the anomaly zone were transmuted into clay. Subject acquired a sample of the clay using a stainless steel trowel, which showed no signs of reaction. The sample was found to be soft enough to deform by hand. Once pressure was removed, the sample returned to its original shape, demonstrating a 'memory foam'-like quality. Subject reported that the clay felt abrasive, similar to large grit sand paper, even through the work gloves that D-423 had been issued. Sample was bagged and removed from anomaly zone. It remained clay upon removal, and is currently available for study.
Five (5) minutes after the initial anomalous event, Subject reported piercing pain in left foot. On the spot inspection revealed an organism burrowing into the ball of D-423's foot, having pierced through 4cm of rubber to do so. The organism, designated SCP-1220-a, was removed via on site medical personnel, and placed in a sample bag, along with an additional sample of the clay. SCP-1220-a appears to be some form of terrestrial roundworm, measuring 6cm, possessing a hardened exoskeleton and an enlarged mouth, containing tooth-like growths similar in shape and function to a lamprey's teeth. SCP-1220-a is alive at time of writing, and currently available for study.
Subject requested a chair, following encounter with SCP-1220-a. Request was authorized, and Subject remained seated for the remainder of the test.
Ten (10) minutes after the initial anomalous event, Subject reported instability in chair. Shortly afterwards, the clay began to liquify, becoming quicksand-like in behavior. Subject was ordered to remain in place as the chair sunk into the clay. More examples of SCP-1220-a were spotted around the chair, as the area of transmuted clay began to recede. Subject at this point violated experimental procedure by leaping away from the chair, attempting to avoid immersion in the clay. The anomalous zone followed D-423 in flight, and upon landing subject was completely immersed in clay. Rescue attempts were considered, but before any plan could be put into action, the anomalous zone had disappeared. The fate of D-423 is currently unknown.
The folding chair used in the experiment was severed by the movement of the anomalous zone, and the remaining pieces appear to have been separated from the rest of the chair as if by a very sharp blade.
Test log for Dr. ███████, 10/4/████
Test Subject: D-424/1220
Native Language: Spanish, Mexican derivation
Word Spoken: Morpheme █ "-ness/having the qualities of"
Note: After the previous two tests, Dr. ███████ requested testing on non-nouns.
Result: Anomalous zone not observed in this test. Subject reported a sensation of 'being watched', along with occasional scents similar to burning tires, and a greasy feel that traveled along the Subject's arm. Outside observers were unable to confirm any scent or oiliness before the anomalous event ended.
Test log for Dr. ███████, 10/5/████
Test Subject: D-424/1220
Native Language: Spanish, Mexican derivation
Word Spoken: Morpheme ██ compounded by Morpheme █ "Clayness/Having the qualities of clay."
Result: Anomalous zone once again not observed during this test. Subject initially reported feelings of physical wellness, of 'sturdiness' and immovability. Two (2) minutes and twenty six (26) seconds after initial vocalization, Subject reported stiffness in limbs. Two (2) minutes later, subject's skin became clay-like, originating around the mouth and spreading outwards. Subject was unable to communicate with staff during the transmutation, which eventually encompassed the whole of D-424's body. Samples collected after the fact show that the transmutation was complete, and that all of D-424's mass was transformed into clay.
Test log for Dr. ███████, 11/28/████
Test Subject: D-425/1220
Native Language: Mandarin
Word Spoken: Morpheme ███ "Covenant/Communion/[DATA EXPUNGED]"
Result: Immediately following vocalization, and continuing for thirty-three (33) seconds after vocalization, Research Sector-██ experienced seismic activity, recorded at 3.2Mw. Seismic event faded gradually, ceasing completely after two (2) minutes. Subject began to report sensations of contact, describing hands running over her skin. Staff within 10m of D-425 reported similar sensations. Sensations became overwhelming at four (4) minutes and fifteen (15) seconds, whereupon D-425 collapsed. Subject begins reporting visual, auditory, and tactile hallucinations. Hallucinations included: a flock of bats, covered in bleached bone plates, swarming around the subject; a city made out of melted green glass; a tall figure, with a head resembling a compound eye, surrounded by sourceless 'plates' of light. Upon reporting the last hallucination, the described figure became visible to all staff within the testing chamber. The figure seized the subject, and both vanished. Later review of security footage did not record the presence of the figure, designated SCP-1220-b
Note: Further experimentation with SCP-1220 is suspended indefinitely, pending further review.
Agents encountering instances of SCP-1220 in the wild are ordered to not engage with the speaker, and instead to notify the home office. Further actions will be handled on a case-by-case basis.
|
SCP-1005 is a sapient humanoid entity composed of semi-solid blue paint, with exact shades ranging from near-white to deep navy.
|
***
Item #: SCP-1005
Object Class: Safe
Special Containment Procedures: SCP-1005 is to be maintained at Site-17 in a 3m x 3m x 3m holding room, equipped with dim lighting. SCP-1005 has no nutritional requirements aside from a need to maintain hydration levels; humidity in holding chamber should be kept at a minimum of 70% when possible, and at least one (1) liter of water provided for consumption daily. SCP-1005 also does not need to sleep, but has requested a chair in which to relax when not undergoing study (granted). SCP-1005 also does not produce any waste, losing water only to evaporation, thus minimal cleanup is required; SCP-1005 has volunteered to give its chamber a monthly cleaning to prevent buildup of paint residue (under consideration).
Due to ongoing good behavior and amicable attitude, SCP-1005 has been granted permission to explore non-secured sections of Site-17 and utilize social rooms, provided it is accompanied by at least one (1) level 2 researcher and one (1) level 1 security agent. [UPDATE] By request of maintenance crews, SCP-1005 is required to wear coverings over its feet when leaving its chamber.
Description: SCP-1005 is a sapient humanoid entity composed of semi-solid blue paint, with exact shades ranging from near-white to deep navy. The surface of SCP-1005 has an average tensile strength approximately 75% that of human skin; this includes its "clothing". SCP-1005 is unable to consciously control the viscosity or shape of its overall form beyond the normal locomotion of a humanoid body; it can, however, control its outer layer to a point where it can choose whether or not its paint will smear on contacting surfaces. The degree to which SCP-1005 is able to control itself in such a manner becomes lessened if over-hydrated.
SCP-1005 is in the shape of a bald, human male, approx. 1.9m tall, and has demonstrated the ability to speak with a deep and resonant voice; despite this, SCP-1005 has no gender in physical structure or personal identity. The apparent "clothing" is integrated as if skin, save for the shirt at the sleeves and lower hem, and the pants below the ankles. Only SCP-1005's shoes are fully unique; it is believed they were created separately from the rest of SCP-1005 from the beginning.
The process by which SCP-1005 was animated and remains so is not known; by its own admission, SCP-1005 only remembers "becoming aware" only a few minutes before its reclamation during a raid at an auction being held by Marshall, Carter & Dark Ltd. where it was up for bid alongside several items which had been under Foundation investigation, specifically [DATA EXPUNGED]. As SCP-1005 originally had no sense of self worth, identity or purpose, the Mobile Task Force enacting the raid was able to convince SCP-1005 that it belonged to the Foundation and had been stolen; it willingly entered custody and was transferred to the MTF staging area before permanent relocation to Site-17.
To date, SCP-1005 has been extremely cooperative with researchers, showing a polite and professional attitude. SCP-1005 lacks most complex emotions beyond levels of satisfaction and comfort and has demonstrated only limited facial expressions outside of movements required to speak. Additionally, SCP-1005 seems to lack the ability to understand abstract concepts: it is perfectly able to count, speaks fluent English with a slight Northern-Midwest American accent, and can perform simple tasks; complicated mathematics, emotional responses and existential topics such as religion leave SCP-1005 confused, usually stating that it simply does not understand. The only driving force behind SCP-1005 is a desire to make its owners "happy with" it, usually through cooperating with testing protocols but also while serving as entertainment or still-life living artwork for personnel during recreational periods.
Researchers with clearance level 2 or higher access are advised to read Document 1005-01478 for an abbreviated listing of testing logs concerning SCP-1005.
|
SCP-5823 is a genetic match for Conservative Members of Parliament between 1981 and 1987.
|
***
Item No: SCP-5823
Containment Class: Safe
Special Containment Procedures: Access to SCP-5823 is to only be allowed during the brief period of inactivity per 24-hour-period. The existence of SCP-5823 is to be removed from the historical record with the assistance of the British Occult Service. Any changes in SCP-5823-1 activity are to be reported to the British Occult Service and Site-26 simultaneously.
All flesh produced by SCP-5823 is to be transported to Site-26 for genetic testing and subsequent incineration. Any coal produced is to be transported to coal-fired power stations, with its origin altered to a non-anomalous coal mine.
Following Incident-5823-29, all people who served as a Conservative Member of Parliament between 1981 and 1987 are to be monitored for potential anomalous activity.
Description: SCP-5823 is the former Penrith Dell coal mine located in Cumbria, England. SCP-5823-1 instances are 630 large, headless humanoid creatures partially embedded in the walls of the mine. These instances obey a strict 24 hour cycle, of which 23 hours are spent attempting to extract coal and 1 hour is spent in a state of inactivity. SCP-5823-1 instances are believed to have extracted coal through the use of large scythes fused with their forearms in place of hands. Due to the exhaustion of the coal seam, SCP-5823-1 instances use their scythes to carve large portions of their flesh from their bodies. The excised flesh is deposited on several conveyer belts and taken to the surface. The resulting wounds quickly heal over the course of 5 minutes.
History: SCP-5823 was originally built in 1947, quickly becoming the largest and most profitable mine owned by the Whitecliff Collieries Group. When Whitecliff Colliers declared bankruptcy in 1978, SCP-5823 was officially shut down. Despite this, SCP-5823 continued to output coal at a rate of 1.4 million tons per year. However, from 1983 onwards, the presence of human flesh in the outputted coal was noted. Recovered documents imply that though several power stations attempted to question SCP-5823 about this, all concerns were brushed off as "part of normal business operations".
Beginning in 1986, 90% of outputted material from SCP-5823 was human flesh. This was noted by auditors and reported to police, with control of the situation eventually being transferred to the British Occult Service. The initial findings of the British Occult Service were that the existence of SCP-5823 did not pose an extreme threat to the United Kingdom and, as such, was suitable to transfer to Foundation control under the Coronation Accords. Following Incident-5823-29, these findings have been reassessed and control of SCP-5823 is now split between the British Occult Service and the Foundation.
Incident-5823-29:
On 2003-07-15, former Conservative MP Michael Garness1 died. During his autopsy, it was noted that several of Garness' organs had been replaced with carved pieces of anthracite. Upon investigation by the British Occult Service, genetic testing of flesh produced by SCP-5823 was ordered. It was found that 3% of the flesh produced by SCP-5823 was a genetic match for Michael Garness. Further testing has found that all flesh produced by SCP-5823 is a genetic match for Conservative Members of Parliament between 1981 and 1987.
Footnotes
1. Secretary of State for Transport from 1982 to 1985.
|
SCP-2052 is a 12-centimeter square of silk cloth.
|
***
Item #: SCP-2052
Object Class: Euclid
Special Containment Procedures: SCP-2052 is currently stored in a standard vacuum chamber at Site-██. Sides A and B have been dyed red and blue, respectively, for ease of identification. When not involved in approved experimentation, SCP-2052 must be laid flat inside the vacuum chamber, with side A facing upwards. SCP-2052 must not be exposed to pressures above 0.5 Pascals at any time.
The primary containment vessel is stored in secondary containment vault 2052-C2. 2052-C2 is equipped with three type-B vacuum pumps, and a set of four protective suits suitable for working inside a vacuum, allowing SCP-2052 to be removed from its primary containment vessel. Removal from primary containment is only permitted for the purposes of approved experimentation or scheduled maintainence of the primary containment vessel.
Researchers handling SCP-2052 must ensure that no portions of the fabric facing the same direction become overlapping at any point, except when done intentionally as part of an approved experiment.
Description: SCP-2052 is a 12-centimeter square of silk cloth. Physical forces applied through SCP-2052 do not comply with Newton's third law of motion.1 Forces applied to side B are opposed by a force roughly 810 times greater, rather than the equal force predicted by conventional physics. Conversely, any forces applied to side A are opposed by a force reduced by a factor of 810. Analysis of internal compression of SCP-2052 has determined that the anomalous effect occurs instantaneously at a plane 30 micrometers below side A.
Overlapping layers of SCP-2052 are capable of applying the anomalous effect cumulatively, resulting in an exponential increase of the amplification factor. In the event that three or more layers overlap while facing the same direction, the weight of SCP-2052 can threaten the integrity of supporting structures (see incident log 2052-I-3).
When exposed to typical atmospheric pressures, pressure imbalances will propel SCP-2052 in the direction of side B. SCP-2052 will fly erratically and at high speed, until impacting a solid obstacle capable of resisting pressures of 82 MPa.2
Discovery Log: SCP-2052 came to the Foundation's attention when automated webcrawler CASIMIR-J87 detected anomalous watch-phrases in a YouTube video, archived as 2052-V-1, posted by user "TeslaFyMe" (later identified as Kyle Wathers of Huddersfield, UK). Previous uploads from this account consist of 113 videos, primarily centered around the testing and refinement of alleged free-energy and perpetual motion devices. Foundation researchers reviewing the footage determined that none of the devices shown in prior videos produced anomalous behavior. CASIMIR-J87 successfully removed 2052-V-1 before any users viewed it.
87% of uploads on Wathers' account contain references to another user by the name of "Discord_33", with whom Wathers appears to have shared a personal friendship. Videos on this account employ a variety of face and voice disguising technologies that have prevented the Foundation from determining the user's identity. Content is typically of a theoretical nature, and includes several lectures on engineering techniques which are known to the Foundation to produce anomalous effects. These lectures are worded in ways that prevented detection by CASIMIR-J87, apparently by design. Investigation into possible leaks in the CASIMIR program is ongoing.
Upon discovery of their anomalous content, Foundation agents attempted to delete all videos posted by user Discord_33, but found that they had already been deleted.
Video Transcript 2052-V-1
– hide block
[Wathers is seated at a desk in a residential garage; this setting has been used in 82 of his previous videos. Several previously-shown devices are visible on a workbench against the opposite wall, and have been moved aside to make room for a short cylindrical chamber, approximately 70 cm in diameter and 20 cm in height. This chamber has been designated SCP-2052-1.]
00:00 - Hi guys, sorry I haven't posted any videos lately, I've been dealing with a lot of real life stuff recently and haven't had as much time for the vlog as I'd like. Some of you know what I'm talking about, I know Discord does, but I won't bore everyone else with, uh, the grisly details. If you're really interested, I guess hit me up on Skype or something.
00:22 - So I got a lot of questions on my last video about what kind of magnets I was using, and a lot of the usual ignorant comments about how I don't understand physics or thermodynamics or whatever, so let me just go through and, um, I guess address some of those issues.
00:42 - 09:40 [Irrelevant data omitted; subject responded to comments on previous videos. Full transcript available as document 2052-V-1F. -Dr. Collier]
09:41 - So I was looking at Discord's last video. By the way, dude, "diction-obscuring filters"? [laughs] Really? I know the corporate giants want to suppress this stuff, but that's just getting silly. Nobody cares how often you say "is" or "of". Anyway, it got me thinking about quantum vacuum energy again. Yes, I know I've been harping on about that since forever, but I think you'll forgive me once I show you my results. If I'm understanding the physics right, a discontinuity in the quantum vacuum would act as sort of a one-way street. So I'll go over the math in my next video if it works as well as I think, but for now it's easiest if I just show you my setup.
[Subject picks up the camera and carries it to the workbench, focusing on SCP-2052-1. Several wires are now visible extending from the back of the chamber, leading to a nearby oscilloscope and a control panel. Subject proceeds to open the lid, revealing a series of electromagnets surrounding the interior, alternating with additional devices of unidentifed purpose. The bottom half of the chamber is filled with an unidentified clear liquid.3 A silk square is suspended from the sides of the chamber on a grate roughly level with the surface of the liquid.]
11:03 - I've already done the tricky part, because you need to have a zero-point membrane that doesn't conduct electricity, but it turns out silk works pretty well for that. You just have to expose it to [REDACTED] and then leave it out to dry for a few hours. Discord has a great video on how to do that. Once it's dry, just put it in the activation chamber, and make sure it's only partially submerged. If both sides are exposed you'll defeat the whole point and have to start all over again. [Subject replaces the lid and activates a switch. A low hum is audible.] Now, in theory, all you have to do is dial in the right resonant frequency, and you should see the reaction right away.
13:47 - 14:16 [Subject slowly rotates a dial. The oscilloscope shows slight disturbances at unpredictable intervals, increasing in frequency and intensity until peaking at roughly 14:12.]
14:17 - Okay, I think that's all the reaction I'm going to get this time. I think I need to align the Tesla emitters a little more carefully to get the resonance clean enough. But it's pretty clear something really wants to happen right at this specific frequency, and that means I'm on to something. And, you know, if this stuff works, it'll do a lot more than free energy - you could make a glove out of it, and mold steel with your bare hands. Um, I guess it's not your bare hands in that case. Whatever, you know what I mean. We wouldn't need any dangerous heavy-duty machinery any more. Which probably means all the big manufacturing companies are in on this too, along with the oil cartels. So if I just up and disappear mysteriously tomorrow, well, you guys know what happened.
15:20 - I guess that's all I have for now. Thanks for the well wishes from everybody, hopefully I can get back to regular updates. Oh, and don't forget to like.
Recovery Log: At 10:15 AM 8/7/20██, shortly before the arrival of Foundation agents, local police responded to reports of a series of loud explosions in Wathers' neighborhood. Foundation operatives administered class-C amnestics to all witnesses, and planted cover stories explaining the damage as the result of a natural gas leak. Investigation confirmed that the damage began in a garage identified as the one appearing in 2052-V-1. SCP-2052-1 was still present, and had a large puncture consistent with pressures of 82 MPa applied over a limited area. SCP-2052 appears to have exited through the west-facing wall, and followed a flight path passing through three nearby houses, a telephone pole, and an SUV, in unknown order before impacting the ground and coming to a stop at a depth of 3 meters. Only minor injuries were reported. Forensic analysis indicates that this event lasted approximately 7 seconds.
Foundation recovery teams were able to transfer SCP-2052 to a vacuum chamber for transport to Site-██. SCP-2052-1 was also recovered; however, researchers were unable to reproduce its anomalous effects.
Foundation spyware installed on Wathers' laptop succeeded in activating the attached webcam and recording for the duration of the event.
Video Transcript 2052-V-2
– hide block
00:00 - [Webcam is placed on a desk facing Wathers' workbench. Wathers is seated at the workbench at the left edge of the frame, and is rotating a dial in a similar manner to that seen in 2052-V-1. Notably, the oscilloscope shows much steadier readings of a higher magnitude.]
00:05 - [A loud crash is heard. The webcam is knocked off the desk and now dangles from a USB cable, facing a wall.]
00:06 - 00:13 [Several more loud crashes, more distant.]
00:14 - 00:25 [Silence]
00:26 - 02:15 [Rapid pacing is heard along with shallow breathing, interspersed with occasional deep breaths]
02:16 - 02:28 [Sounds of metallic objects being moved. Wathers replaces the webcam on the desk, briefly exposing his hands to the camera. Shaking is visible consistent with extreme anxiety. Camera now faces a different wall.]
02:29 - 03:12 [Pacing resumes. Wathers briefly exits the garage, then returns, repeating this behavior twice.]
03:13 [A car is heard pulling into the driveway.]
03:18 - Unidentified voice: Are you okay?
03:21 - Wathers: I, uh, I think so. Are you here to arrest me?
03:26 - Unidentified: No, I'm Discord. The police will be here in-
03:30 - Wathers: What? No you aren't.
03:35 - Unidentified: I told you I disguise my face for videos, right?
[3 s pause]
03:46 - Wathers: That's impossible, do you really think I'll believe -
03:51 - Unidentified: You just launched a Kleenex through three houses, and you don't believe in video editing?
03:57 - Wathers: That's not funny.
04:02 - Unidentified: I know. And I'm sorry. But I'm kind of in a hurry here. Because now you know that free energy is real, and -
04:10 - Wathers: I believed in it before.
04:13 - Unidentified: Don't kid yourself. Nobody really believes it, deep down, until they see it firsthand. What's important is, now that you know, that means you know the coverup is real too. And when the police figure out what happened here, they'll know that you know. Can you guess what happens then?
04:31 - Wathers: Well, what are you suggesting? I just go into hiding? Spend the rest of my life in your basement, watching, like, daytime TV?
04:42 - Unidentified: No, I mean you take the fight to the conspiracy. We have a private lab, where you can help us build machines that will -
04:54 - Wathers: Wait, we?
04:57 - Unidentified: It's complicated, but I'll explain when we get there.
[4 s pause]
05:05 - Wathers: You really think I could help take down the oil cartels?
05:11 - Unidentified: I promise everything you build will be used against the people behind the coverup.
Addendum 2052-A-1: On 11/26/20██, hostile forces attempting to seize SCP-████ assaulted Site-██ using four steel slabs of mass 2.4 x 104 kg, which possessed properties similar to SCP-2052. Three of these objects were recovered by the hostile forces, and the remaining one self-destructed and could not be recovered for analysis. The investigation into Kyle Wathers and his associate has been upgraded to a level-3 priority.
Footnotes
1. "To every action there is always opposed an equal reaction."
2. 810 times atmospheric pressure
3. Image analysis indicates a refractive index 28% higher than water.
|
SCP-1231 is a black Amiga A1200 computer manufactured by Commodore International, missing all other identifying marks including its serial number.
|
***
Item #: SCP-1231
Object Class: Euclid
Special Containment Procedures: SCP-1231 is contained in an unlit vault, dimensions 0.6 m x 0.8 m x 0.2 m, located in Site-20. Guards are posted outside of the vault, denying access to all personnel without direct and confirmed Level 5 authorization. A video camera is installed in the vault, taking a live feed of SCP-1231.1 This video is in turn fed through a specially designed program, displaying only the number of thumbnails and if there is a significant error. Access to the raw feed is strictly prohibited. A mouse is located near the terminal, but remains disconnected under normal circumstances. New personnel assigned to SCP-1231 must be hand-picked specifically for testing purposes. However, testing is currently suspended.
Description: SCP-1231 is a black Amiga A1200 computer manufactured by Commodore International, missing all other identifying marks including its serial number. It runs independently despite the lack of a power source. SCP-1231 does not function as an Amiga A1200 should and generally only displays a screen full of thumbnails, named the "Primary Screen." SCP-1231 cannot be shifted from its current settings, and as of yet no other programs have been discovered on the computer. External attachments, such as mice and keyboards work normally.
The Primary Screen contains 6932 thumbnails, organized in rows of twenty (20) ascending numerically by age. A scrollbar is located on the right side of the screen.2 The thumbnails display extremely low-resolution moving pictures. There is no audio Most videos do not contain audio; however, despite the lack of speakers on SCP-1231, low-decibel sounds can occasionally be heard.
Clicking on a thumbnail causes the video displayed to increase in resolution and fill nearly the entire screen, except for a thin white bar on the top bearing the number of the thumbnail. Clicking a second time returns the screen to the Primary Screen. Although the videos vary significantly, there are consistently three subjects (known as SCP-1231-1, -2, and -3) present. SCP-1231-1 is generally a tall, middle-aged, Caucasian man. SCP-1231-2 is generally a younger, shorter, Korean woman. SCP-1231-3 generally appears as either a light-colored child approximately four years of age or a feral mid-size animal. The videos do not loop, although the same actions are performed repeatedly in the videos with incredibly minor deviations.
New videos are generated when a human subject misperceives an existing video or thumbnail. The new video contains a representation of what was believed to be in the prior video. Testing has shown that only minor details (such as the color or position of an object) is sufficient for this effect to occur. Direct observation of SCP-1231 is not necessary and rudimentary knowledge of a video or thumbnail can lead to speculations that generate more videos. However, new videos can be created at a maximum rate of one per minute. Due to the virulence of its infohazardous properties, SCP-1231 is classified as a Beta-Gimmel-White infohazard.
Excerpts from Document 1231-A: Thumbnail Descriptions
Thumbnail 1: [DATA EXPUNGED]
Thumbnail 2: The setting is the same room as Thumbnail 1. Discovered on the second test of SCP-1231. Believed to have been created after exposure to Thumbnail 1. SCP-1231-2 is scooping an unknown powder with her left hand while SCP-1231-3 is asleep in her right arm. SCP-1231-1 is not on the screen.
Thumbnail 3: The setting is the same room as Thumbnail 1. Discovered on the second test of SCP-1231. Believed to have been created after exposure to Thumbnail 1. SCP-1231-2 is asleep, while SCP-1231-3 is crawling over her. SCP-1231-1's leg is present in the upper right of the screen, although the rest of his body seems to be just outside of view.
Thumbnail 4: The setting is the same room as Thumbnail 1. Discovered on the second test of SCP-1231. Believed to have been created after exposure to Thumbnail 1. SCP-1231-3 is mauling the pectoralis minor of SCP-1231-2. SCP-1231-1's mutilated right leg and pelvic region is located in the upper right portion of the screen.
Thumbnail 39: The setting is the same room as Thumbnail 18. Discovered on the second test of SCP-1231. Believed to have been created after exposure to Thumbnail 24. SCP-1231-1 is dislocating and relocating SCP-1231-2's shoulder with his right hand, though both are standing erect. SCP-1231-3 is asleep in the upper left of the screen.
Thumbnail 902: The setting is the same room as Thumbnail 600. Discovered on the second test of SCP-1231. Believed to have been created after exposure to Thumbnail 419. SCP-1231-1 is lying on top of SCP-1231-2, smashing SCP-1231-3 on the floor. SCP-1231-2 is completely motionless.
Thumbnail 1170: The setting is the same room as Thumbnail 1053. Discovered on the second test of SCP-1231. Believed to have been created after exposure to Thumbnail 1004. SCP-1231-1 and SCP-1231-2 are kneeling facing the camera, drenched in blood, crying and mouthing non-discernible words. What appears to be the mutilated corpse of SCP-1231-3 is lying in front of SCP-1231-2. A low-pitched laughter is audible throughout.
Addendum-01: Due to the high level of similarity between SCP-1231 and other encountered "soultraps," it has been deemed likely that the entities SCP-1231-1, -2, and -3 are real in some capacity. In light of this, I am formally requesting that testing on this object be halted. -Researcher ████, Ethics Committee
Addendum-02: Testing on SCP-1231 has been suspended indefinitely. The majority of personnel assigned to SCP-1231 will be administered a Class B amnesiac and transferred to a new project. -O5-██
What is the suffering of a few in the face of Science? Pain is all relative, as is eternity. We've done far worse. I'm sure we have.
Addendum-03: Processed video feeds of SCP-1231 have shown that the number of thumbnails is increasing despite the suppression of knowledge relating to SCP-1231. Something's wrong. -Dr. ██████
Footnotes
1. Note that no external light source is necessary due to SCP-1231 providing ~20 lux.
2. More detailed analysis of the layout of the Primary Screen of SCP-1231 is located in Document 1231-B.
|
SCP-3439 is a picture-postcard depicting a view of Oia village, on the Greek island of Santorini.
|
***
Item #: SCP-3439
Object Class: Safe
Special Containment Procedures: SCP-3439 is to be wrapped in a black cloth and placed in an envelope, with the front facing away from the opening. The envelope is to be stored in a dry, climate controlled archive room in the vault wing of Site-771. Any personnel working with SCP-3439 are instructed not to look directly at the object, and instead view it through a live feed display while handling. It is not advised for personnel exposed to SCP-3439 to receive any class of amnestic treatment.
Description: SCP-3439 is a picture-postcard depicting a view of Oia village, on the Greek island of Santorini. The reverse side lacks any form of postmark or address, and has only the words “Wish. I was here”(sic) hand-written in black ink. These details have been confirmed by repeat photographic and video analysis. However, individuals viewing the object in person provide inconsistent accounts, with no two subjects having described similar images or writings, even when observed simultaneously.
Any personnel who view SCP-3439 for too long becomes unresponsive, exhibiting deficits in attention and focus. Subjects describe feelings akin to melancholy which persists even when the object is removed. If left unchecked, this condition progresses into a deep state of depression. Personnel often report a strong desire to look at SCP-3439 again, with repeat viewings only enhancing these effects.
Addendum 3439.1: Test Logs
Forward: The following are examples of transcripts illustrating the anomalous properties of SCP-3439
+ Test 3439/T1
- Test 3439/T1
Test 3439/T1 – 17/07/2002
Subject: D-77053
Procedure: Subject was instructed to look at the front of SCP-3439 and describe what they saw. Dr. ████ attending.
<Begin Log>
D-77053: What is this?
Dr. ████: Just say what you see clearly into the microphone.
D-77053: It’s a house. What more do you want?
Dr. ████: Could you provide more detail?
D-77053: It’s old? On the side of a mountain… green shutters…
Dr. ████: How many houses can you see?
D-77053: Just the one.
Dr. ████: Do any of these houses happen to look like these?
Dr. ████ shows the subject a photograph of SCP-3439
D-77053: What? No. What is that, Greece? This house is in Italy.
Dr. ████: How do you know it’s in Italy?
D-77053: Just the style of it. Those green shutters, the yellowing stone wall, the red roof. It looks just like Chianni… or at least, just outside of Chianni…
Dr. ████: What else can you see?
D-77053: …I know this place. My mother moved to somewhere similar with me and my brother many years ago. There used to be this swing set at the back where we played for hours… oh hey, there it is! Right on the corner, you can just make it out….
The Subject stares silently at SCP-3439 for a while
Dr. ████: Continue your description.
D-77053: It is that house… The very one we… Where did you get this?
The Subject looks more closely at the object.
D-77053: I haven’t been back there since… It looks just like I left it. As though Ma’ could walk right out of there… Was this taken recently?
Dr. ████: We cannot disclose that information.
D-77053: No it couldn’t have been. That’s her car out front. She was still driving… I never noticed how nice this house looked in the sun. It must be like just after noon. I can practically smell her cooking through that window. It smells like…. like…
Dr. ████: Thank you, I think that will be enough.
D-77053: No wait. Can I just look at it a little more?
Dr. ████: That won’t be necessary.
D-77053: No please! I haven’t seen them for so long. You gotta understand.
Dr. ████: Return to your seat.
D-77053: I’m only asking for a little longer! Please, I could almost see them walking round the corner! Please just give me that. Just that.
Dr. ████: This test has been concluded.
<End Log>
Analysis: SCP-3439 appears capable of displaying images which hold emotional significance to the observer. Further testing is required to see if such an effect is unique to viewing the front of the object, and whether there is a pattern behind what the observer sees.
+ Test 3439/T2
- Test 3439/T2
Test 3439/T2 – 25/09/2002
Subject: D-88835
Procedure: Subject was instructed to look at the reverse side of SCP-3439 and describe what they saw. A line of questioning would follow to determine the connection between the subject and the illusion. Dr. ████ attending.
<Begin Log>
D-88835: Is this some kind of joke?
Dr. ████: What do you see on the card?
D-88835: I see writing.
Dr. ████: Please recite what you see written.
D-88835: To Jean, I know it’s cliché, but you truly have made me the happiest man in the world. Knowing you’re with me until the end, I have no fear, no dread, and no pain. Please live well after me. There is no need to worry. Salvador.
Dr. ████: Does this mean anything to you?
D-88835: Really? That’s what you’re asking?
Dr. ████: Answer the question.
D-88835: Fuck! Yes it means something! This message is for me, you know?
Dr. ████: Who is Salvador?
D-88835: He was… my partner.
Dr. ████: Were you together long?
D-88835: We only knew each other for a year… we were married for like two days. What was it, 20 years ago?
Dr. ████: What happened?
D-88835: It’s…. not a fun story. He had brain tumour or something like that. The timing of it was just terrible ‘cause he got the doctors notice five months in to our relationship…
Dr. ████: Are there any other markings on the card?
D-88835: There’s a date… February 2nd, 1985… The date he…. How did this?
Dr. ████: Have you ever read a message like this before?
D-88835: No, when we got married he had been in the hospital for a week. They were trying a new experimental therapy but it didn’t work. I was with him till…. I can’t do this.
Dr. ████: Is there anything else written on the card?
D-88835: No… That’s it… I think I just want to…. sorry.
Dr. ████: Thank you, we’ll finish the interview here.
<End Log>
Analysis: It would appear that both sides of SCP-3439 are capable of subjective illusion. Interestingly, while the contents of either side is subjective to the observer, the front and the reverse sides never seem to switch. As with the image, the written content also contains a deep emotional context for the observer. Further testing is required to see if both sides of the object work in tandem or apart from one another.
+ Test 3439/T3
- Test 3439/T3
Test 3439/T3 – 30/02/2003
Subject: D-93366
Procedure: Subject was instructed to look at both sides of SCP-3439 in turn. Questions were provided to encourage detail and better determine the contextual significance of the illusions. Dr. ████ attending.
<Begin Log>
D-93366: Is this a postcard?
Dr. ████: What can you tell me about it?
D-93366: It’s nice, really fancy looking. You get this from Japan?
Dr. ████: Describe what you see.
D-93366: It’s a shrine, like the kind you see all over that country. It’s covered in red leaves, the whole picture is actually. Reminds me of that one time in autumn.
Dr. ████: Tell us more about that.
D-93366: Well… back in better days, I worked for this company who had a branch in Kobe.
Dr. ████: Is that what you see in the picture?
D-93366: No, this is Kyoto. No mistake about that… I only went there once but, you can’t forget a place like that.
Dr. ████: What happened in Kyoto?
D-93366: Nothing much. It was somewhere a friend wanted me to see. She said it would be a tragedy to leave without going at least once.
Dr. ████: Tell us more about this friend.
D-93366: There’s not much to tell. Her name’s Yurie and I’d often meet with her and her niece, Honoka. Really energetic kid, always jumping about everywhere.
Dr. ████: How did you meet?
D-93366: That was Honoka’s doing. I was sitting in the park when she ran up to me and started talking, just out of nowhere. Yurie ran up and apologised for her, and then we just talked.
Dr. ████: Did you meet with them often?
D-93366: Every now and again, sure. Being in a new country is really isolating. It was nice to have someone to meet up with the odd lonely weekend. Even if it was just to walk about watching over a child at play.
Dr. ████: Would you consider her a close friend?
D-93366: I think so. I did meet the rest of the family, Yurie’s sister and her sister’s husband. They even invited me to a big meal somewhere. It was nice… It was just… just nice. Honoka kept calling me big brother. I kinda liked it. I… I’d never been anyone’s brother before.
Dr. ████: What happened next?
D-93366: Well… You know how it is. The company I was working for went bust, and my visa along with it. I had to pack up and leave before I’d even been a full year. Two days before my plane, Yurie called me up and told me we were going to see Kyoto. It was just her this time. No Honoka.
Dr. ████: Is that what you see on the postcard?
D-93366: Actually… Yes. It looked just like this when we got there. Red leaves everywhere. Even looking at this picture… it’s like it’s right in front of me. Vibrant. But also kinda… sombre? Like something’s slipping away…
Dr. ████: Did you ever return?
D-93366: Couldn’t afford it. Once I got back work was impossible to find. Things got bad, one thing led to another and, well you probably have this all on file somewhere.
Dr. ████: Could you turn the postcard over and state what you see?
D-93366: …what is this?
Dr. ████: What do you see?
D-93366: It’s written in Japanese… really big characters all down the side.
Dr. ████: Can you read them?
D-93366: I… yeah. First part's a date. 1995, January, 19th. About two months after I left.
Dr. ████: What else can you read?
D-93366: It says… Dear big brother. Thank you for giving us happy memories. We are fine, but big sister is often sad even when she smiles. Looking forward to when you play with us again. …Please….don’t…don’t forget about us.
Dr. ████: Is that everything?
Subject does not respond.
Dr. ████: Answer the question.
D-93366: Oh… what?
Dr. ████: Can you see anything else? Or is that everything?
D-93366: No. that’s…that’s it.
Dr. ████: Very good, please return the object.
D-93366: Actually… do you mind if I keep hold of this?
Dr. ████: We cannot allow that.
D-93366: But… never mind.
Subject returns the object.
Dr. ████: Thank you for your cooperation.
<End Log>
Analysis: This data confirms that both sides of SCP-3439 contribute towards a particular life event or memory that is specific to the observer. One pattern that emerges is that the front displays a sentimental location, while the reverse side shows a message from someone connected to this location. The memories associated trend towards being bittersweet in nature. Further analysis is required. It may also be of interest to note that the date provided by D-93366 takes places a few days following the Great Hanshin Earthquake. The significance of this has yet to be understood.
Addendum 3439.2: Follow-up Studies
Since the initial testing, all civil documents pertaining to the D-class subjects involved have been reviewed and verified. All accounts support the information provided during the tests. This leads us to conclude that these memories were not in any way synthetic.
Subjects D-77053, D-88835, and D-93366 have had noticeable changes in behaviour following the tests, acting more withdrawn, distant, and generally less responsive. The decision was made not to terminate these subjects in order to evaluate potential recovery methods. Individual reports are detailed below:
+ Subject D-77053
- Subject D-77053
Subject D-77053 requested to view SCP-3439 at any moment they were brought before a researcher. On the 8th May 2003, Subject D-77053 was finally granted this request on the condition that they were recorded speaking aloud what they saw on the reverse side. What follows is a transcript of this recording:
15th June 2000
Look after your brother. When I'm gone you're all he'll have left, and while I know you'll be ok, I am so worried for him.
My time is short, I can feel it slipping away. Please, my children, keep each other strong. Look after one another.
I love you both…so much.
When questioned, the subject only had the following to say:
I'm sorry Ma'… You were right… You know I used to hate it in there, always felt trapped… look at me now eh? Certainly escaped to better things didn’t I…
I use to hate how cut off it was, how cold it got, how dark night was… But looking at this… All I can see is….warmth. That moment….that one moment. When everything was just… It feels so close now. Can I have a second? Just for this?
Over the weeks that followed this session, the condition of subject D-77053 did not improve. Subsequent viewings were permitted, and even encouraged by active researchers. These repeat viewings did little to quell the subject's symptoms, and in fact triggered further depressive episodes. This all culminated on 15th June 2005 when [DATA EXPUNGED]2
+ Subject D-88835
- Subject D-88835
During routine psychological assessment, Subject D-88835 made the following statement in response to the question. “How have you been feeling lately?”
I can’t stop thinking about him… I’ve tried, but he’s always there, like some kind of ghost, following me about. I thought I was over this. I thought I got better… But now it’s happening all over again. There was going to be a vineyard in Spain, somewhere people wouldn’t bother us. Now I can’t look at a fucking grape without… But it was never this bad before!
Subject D-88835 was treated with class D amnestics shortly thereafter, several weeks post exposure to SCP-3439. While the subject lost all memory of the object, and that any interview had been conducted, they instead reported a strange but overwhelming sense of loss and longing with no clear reason as to why.
Subject D-88835 provided the following written statement during a psychiatric evaluation:
There’s something missing. Like a hole in the back of my neck. I want to scream sometimes but I don’t know why. It’s like I live in a shadow now, and I want it to stop, I try to make it stop, I try so fucking hard all the time. I don’t feel like me. Something’s broken. It’s driving me crazy. Why won’t anyone say what’s wrong with me?
In the weeks that followed, subject D-88835 became prone to violent episodes which increased in intensity and frequency over time. The subject is currently contained in a standard cell within the containment wing of Site-77 pending further investigation.
+ Subject D-93366
- Subject D-93366
Subject D-93366 was offered counselling by onsite therapists following on from the initial exposure. The subject has since been diagnosed with clinical depression. Notably, unlike other subjects, their symptoms have yet to progress to anything more severe. As such, the subject is cleared to abide by all standard D-class protocol. What follows is a log of one of their psychiatric sessions.
Dr. Ris: What’s been on your mind lately?
D-93366: I don’t really know anymore. I can’t get that card out of my head. It’s silly, I haven’t thought about this for years but now it’s like that’s all there is.
Dr. Ris: If you had the chance, would you try to make contact?
D-93366: It’s been almost 10 years. Do you think they’d even remember? Look at me. Do you think anyone’s going to want to deal with me now? I know what you guys call us. Disposable… Throw them in with the death traps and see what happens, don’t worry, no one will miss them….
Dr. Ris: You are providing a vital service to all of humanity.
D-93366: Those red leaves… That’s the one thing I can't get out of my head. That day was so chilly. Told me she liked it better in Spring, when it got warm. I made a promise to her! I made a goddamn promise and now it's… everything’s just… too late. Whatever life that could have been… It’s too late.
Dr. Ris: Is there anything you can think of that might make it easier for you?
D-93366: …Let me read my card.
Footnotes
1. These measures are put in place to prevent personnel from making unintended visual contact with the object.
2. This section has been removed following review by the Foundation Ethics Committee.
|
SCP-2714 is a copy of the 1968 graphic novel The Adventures of Tintin: Flight 714 by Belgian artist Georges Remi (known by his pen name Hergé), translated from French into English by Leslie Lonsdale-Cooper and Michael Turner and published by Methuen Children's Books.
|
***
Item #: SCP-2714
Object Class: Safe
Special Containment Procedures: SCP-2714 is to be kept in a low-value containment safe at Site-88. On no account are pages 20 and 21 to be opened outside of occasional approved testing. Pages 57 and 58 are to be opened and the contents recorded daily. A standard-issue containment bookmark has been slotted into these pages to avoid opening pages 20 and 21 during the procedure. All documents related to SCP-2714 are to be stored in low-level object supplement folders next to the safe for researcher reference.
All SCP-2714-1 instances are to be contained in biological containment cells at Site 88. Instances may be divided up by -A, -B, and -C within the cells for convenience of researchers, as there is no distinction between them outside of appearance. The air in SCP-2714-1 containment cells are to contain 5% microscopic biological matter, distributed by air vent, for feeding purposes.
Pages 20 and 21, if ever opened for approved testing purposes, are only to be opened in SCP-2714-1 biological containment chambers.
Description: SCP-2714 is a copy of the 1968 graphic novel The Adventures of Tintin: Flight 714 by Belgian artist Georges Remi (known by his pen name Hergé), translated from French into English by Leslie Lonsdale-Cooper and Michael Turner and published by Methuen Children's Books. SCP-2714 shows signs of its age, with some minor damage, but is in mostly good condition.
SCP-2714 has two pages that display separate anomalous properties. Opening the page 20-21 spread will cause the appearance of three sessile organisms resembling barnacles, designated SCP-2714-1, in a varying distance around SCP-2714-1. This will occur every ten minutes until the book is closed. Each SCP-2714-1 instance is, on average, 1 meter tall and 10 meters in circumference at the base, though size does vary (see document 2714-35FN for detailed statistical analysis). There appear to be three distinct types of SCP-2714-1, identified as SCP-2714-1A, SCP-2714-1B, and SCP-2714-1C; all instances of each type of SCP-2714-1 are genetically identical to each other.
The shell plates of each SCP-2714-1 organism are composed of live bone; patches of hair-growing tissue are also present, as are patches of of what appears to be fabric. The bone has been genetically analyzed and identified as belonging to a domestic dog (Canis familiaris) — specifically, the Wire Haired Terrier breed; notably, all bone has been sourced to the same individual. Three colors of hair (white, orange, and black) are present, as are three colors of fabric (green, light blue, and dark blue). The white hair is present on all SCP-2714-1 organisms; genetic analysis of the white-hair follicles indicates that they are canine, and from the same individual as the bone in the shell plates.
Samples taken from the cirri and internal systems of SCP-2714-1 -A, -B and -C instances indicate they are composed of mostly human DNA, as opposed to the canine carapaces. SCP-2714-1 instances feed on biological matter in the surrounding air filtered using their cirri, and lack reproductive organs. Each instance secretes a small amount of corrosive liquid, found to be 68% ethanol and described as having a woody odor, similar to whisky. Part of the musculature contains complex human brain tissue. No electrical activity has been recorded originating from this tissue, and it is most likely vestigial, with no current purpose within the organism. SCP-2714-1 instances have a small, active, primary brain: a clump of neurons that control autonomous bodily functions.
The second anomaly appears upon opening page 58. All text in dialogue bubbles will be replaced with a long, incoherent dialogue by an unknown entity or group of entities. This text changes upon reopening the page. Common themes amongst these texts include purgatory, the nature of reality, and the death of artistic thought. References to other Tintin stories are common, though seemingly disconnected from the text's main ideas.
Sample text observed on █/█/19██. Character actions are recorded for reference.
Captain Haddock: And I saw my comrades make that great and terrible crossing from the boundaries of known art into the land of alph-art1, and into the unknown.
(Captain Haddock is hypnotized by Kanrokitoff.)
Captain Haddock: Yes, but would that be so? We know not what exists for the wicked.
Kanrokitoff: If the world were like that of an oyster, then we are the slime surrounding the pearl, forming the pearl. We create the comic-men stumbling through the woods to some glory we know not what. Picaros.2 Ten thousand thundering typhoons.3
(Kanrokitoff orders the other characters to climb a ladder of the spacecraft. He then does so himself. The volcano then explodes.)
Kanrokitoff: They are the ideal. We hold them past their racist minds and the formless chaos of those old forgotten europeans who destroyed the world. Have you seen the meat made of ink? The blood of paper? The world of doll eyes4 and dashing kings.
Lazlo Carreidas: This is transient. All of it. I am formless, writhing through a great void, waiting to be made flesh. This is meaningless. There is only the word. In the beginning there was the word.
Kanrokitoff: And the word was with God.
Skut: That is true. One cannot dispute that. But what of the pictures? What of those same terrible concepts. They never receive the news.
(Kanrokitoff spots the rubber dinghy where the villains are sailing)
Kanrokitoff: I am Castafiore, the Milanese Nightingale,5 and I have been shown an intolerable force. For someone ripped my soul from my ink with a bottle of whisky and tore me apart, according to the way the ancientmost priests of our faith decreed. What nonsense! What did it make of me? I am still waiting.
Allan: Art is dead. Comedy is dead. Adventure is dead. Racism is dead.6
(Rastapopalous fires at the spacecraft.)
Rastapopalous: Should we embrace the hell? The riotous violence of the others? I doubt I would survive even that crossing.
Addendum-1: SCP-2714 was recovered from the belongings of Pierre Escoffier, a Montreal illustrator and poet who had committed suicide three weeks prior. Escoffier's belongings had also contained a large amount of Tintin memorabilia, and acquaintances had testified to local police that he was a collector and fanatic who had an inordinate obsession with Georges Remi. Escoffier was reported to have become extremely erratic prior to his suicide, talking frequently of "old gods, made in Haddock's image, failed." Of note is the fact that Escoffier's father Guillaume Escoffier, a wealthy businessman, has had several ties to noted Neo-Sarkic cults throughout Canada and the northern United States.
SCP-2714's anomalous properties first came to the Foundation’s attention when it had been left open to page 21 while local police were emptying Escoffier’s apartment. The next morning, the apartment had been completely colonized by SCP-2714-1 instances of varying sizes. Foundation agents within Quebec police forces were alerted, and contained the anomaly. All SCP-2714-1 specimens were removed to Foundation custody. SCP-2714-1 instances would most likely have exponentially colonized beyond the apartment had Page 20 not been closed.
+ Assorted relevant letters and papers found in Escoffier's apartment, arranged in chronological order
- Access Granted
Taken from Escoffier’s journal:
Jan 7
The latest piece got some recognition at the gallery. I am glad, for the money is running low and the rent is due. Bought a lovely Thomson Twin maquette, found it in an antique shop not terribly far from my apartment.
Also met with some strange men at the gallery. Seemed to me they were especially interested in my father. One of them, Australian accented, said he was named Powell and he was interested in commissioning a piece for a few of father's men. Some diorama sculpture to fill one of their corporate lobbies. Powell and another man, Tanhauser, they gave me a card. "ARE WE COOL YET?" and then a phone number and email address.7 Seems sketchy, but they tell me they’re a legitimate art collective. And you know what? I believe them.
Found scribbled on notecard by desk. It is presumed these were notes taken during a phone call
-Powell’s Project notes - pass on to father.
flesh concept
figures in domestic setting
3d dining room/diorama
life size, venal themes
appropriate for hospital or research center
Slightly Macabre
Russian influence, themes of cancer and growth.
tendrils?
See example at art show. DHC/ART Fondation pour l'art contemporain. 7:00. gang will be there.
Taken from Escoffier’s journal:
Mar 12
The show I was invited to was one of those snobby art events. Lots of young pretentious men in tight jeans and a smug grin, girlfriends hanging off their arms. No class. Downing shots from the bar like the world was ending. In times like these I wish I were in Marlinspike Hall, sipping a Loch Lomond and consuming my alcohol like a fucking adult. The DHC/ART was packed with these poseurs! All of them supposed “an-artists.” They do stuff with light and “magic” to create ostentatious displays. Apparently some of these inscrutable, incomprehensible pieces even damage people as part of their artistic purpose. At which point, for me, the meaning of the art is lost. It’s a fucking joke at that point.
I found the pieces Powell created himself as nightmarish as the crowd that cooed over them. Disgusting and vile, and he apparently uses real flesh too! He claims he used “anomalous means” to twist and rupture the human form, but it’s so fake. You can’t see a Ritual of Adytum and forget it, much less believe a fake.
(Foundation agents embedded at the gallery event observed Michael Powell, noted member of Are We Cool Yet? whose work was being presented, sitting at the gallery bar with Escoffier for three hours. Although the record of the conversation was recorded, it was destroyed for security reasons related to the surveillance.)
Group text messaging conversation recovered from Escoffier’s phone. Conversation was between Escoffier and three AWCY anartists (Michael Powell, Werner Tanhauser, Lauren Palicki).
Powell: so dude we herd (sic) you were a flesh creatin guy.
Powell: thats awesome
Escoffier: It’s something I grew up around, but I haven’t really involved myself with serious worship of the Grand Karcist since I was six.
Palicki: but ur dad he's a member of a nälkä cult yea?
Powell: i've been using that flesh stuff as a inspriation (sic) since i started. i wanna learn so much from him. you still in contact?
Escoffier: I mean, I call him every once in a while. He calls me, wants to know how my artwork is going, but we’re not close or anything. A man who controls the world through secret societies is not bound to be the best father.
Tanhauser: its just like inherently amusing for me that an immortal member of basically the illuminati still calls and nags his kids
Escoffier: I mean, Dad’s old, but he’s not really immortal. Not even active as a Karcist’s servant anymore.
Tanhauser: still funny
Powell: listen pierre, just pass his receptionist’s phone number on to us, we’ll take care of it for you.
Tanhauser: take care of what, what are we offering?
Powell: a deal, bro.
Escoffier: I’m not sure I follow.
Escoffier: If I give you the number of my father and have you schedule an appointment so you can nag him about some wacky revolting sculpture and waste his time doing business transactions and practicing his faith, you’ll do what?
Powell: free commission for u. you guys are secretive and anomalous, just the way i like it.
Powell: you see, im not willing to join in some rural village dicking around with tumors in the village of bumfuck russia and people like your dad aren’t exactly welcoming to non blackbloods. but your ideas of will and sacrifice, is there no greater theme in art? think of the great painters and sculptors throughout history, how many of them have essentially achieved godhood already? all idolized above the masses.
Palicki: we’re a splinter collective, just a few anartists playing with nälkä beliefs and capable enough to find out the hidden truth.
Tanhauser: Like the renaissance painters used christianity, yeah.
Escoffier: Why me? I’m not that active in the cult anymore. I haven’t gone to an orgy in many years, and am basically living a normal life. I don’t murder, I don’t spread disease, nothing. I’m finished. There at least a dozen other Karcists scattered across the world in positions of power who are more accepting of street artists anyway.
Powell: at the bar that night, you were talking about tintin. about you being so angry at your father because you drifted away and he refused to accept it. you being inspired to draw and write and not wanting to control the world. cliche, yes? but, for you it’s true.
Powell: we have a deal. there is a way you can embrace your loves and fix your broken world, but that can connect you with your father, your religion. let you embrace Ion once again. i may not be a karcist, not even a zend, but i know a thing or two.
Powell: how’d you like to summon a dead klavigar?
(The next message was sent roughly fifteen minutes later.)
Escoffier: What did you have in mind?
Taken from Escoffier's journal. Date unknown.
I am a wretch.
My parents, my gods have abandoned me. Fuck you Ion. I didn't deserve this, this guilt that hangs over me. My obsessions, my loves, they prevent me from following in Your path, the path of my father. I have disgraced him.
I was led astray by those who wished to only gain access to you. To usurp my father for their own, selfish, ends. They don't belong among the followers of yours. They are not pious. I was selfish and like a child and even though I hated them so much I gave in. I tried to do right, to use my own beliefs to reconnect with you, with my father. To reconcile the two loves of my life. It's no use. They scream on the page, half aborted, my angels. My beautiful ligne claire angels.
Forgive me daddy. And Yaldabaoth destroy us all.
Footnotes
1. Hergé's final, unfinished Tintin story was titled Tintin and Alph-Art, and concerned the world of modern art.
2. The final, completed Tintin story was titled Tintin and the Picaros, published in 1976.
3. A popular catchphrase of the character Captain Haddock, used amongst other colorful euphemisms as a humorous alternative to profanity.
4. Hergé drew his characters in a signature ligne claire style, characterized by clean lines and simplified, exaggerated facial features.
5. Bianca Castafiore is a recurring character in the Tintin comics, a buffoonish Italian opera singer who annoys Captain Haddock and manages to appear in incongruous, exotic locations.
6. Both uses of the word “racism” in this instance are interesting as Hergé was criticized for using racial stereotypes in his works, especially in the earlier albums.
7. No such card was found amongst Escoffier’s belongings.
|
SCP-2389 is a female, yellow-billed magpie (Pica nuttalli) of approximately 10 years of age.
|
***
Item #: SCP-2389
Object Class: Safe
Special Containment Procedures: SCP-2389 is currently kept in a wooded containment cell near Site-66, which provides all the resources needed for instances of SCP-2389-1. Three guard personnel are to patrol the perimeter of SCP-2389’s containment at all times, with an additional guard stationed at the entrance to SCP-2389’s containment.
Only personnel who submit a formal request and receive approval from site command are permitted to run tests with 2389. Before entering the containment cell, all the following items must be removed from researchers and other personnel wishing to enter:
Jewellery
Watches
Electronic devices
Objects with gold elements
Any other objects suspected of containing elements of 8 carat gold or above
Additionally, no objects are to be taken from SCP-2389's chamber without proper authorisation from site command.
Any researchers and additional personnel entering the containment cell are to be accompanied by at least one guard for the duration of testing. A full list of tests to be carried out must be handed to all guard personnel on duty at the site; any deviation from this list will result in termination of testing, forcible removal of personnel from the containment cell, and formal discipline at site command’s discretion. Any personnel attempting to take objects from instances of SCP-2389-1 without authorisation will be removed from the containment cell and given formal discipline at site command’s discretion. Repeat offenders will be permanently denied access to 2389's cell and, depending on the circumstance, demoted or terminated.
All instances of SCP-2389-1 are to be recorded by close-up surveillance at all times. Upon creation of a new instance of SCP-2389-1, a new surveillance camera is to be stationed no more than 1.5m away from the target, with clear view of the contents of 2389-1.
Description: SCP-2389 is a female, yellow-billed magpie (Pica nuttalli) of approximately 10 years of age. 2389 shows a desire for collecting objects of at least 8-carat gold and will collect all objects meeting this requirement it comes across.
SCP-2389 uses a nest (hereby referred to as SCP-2389-1) to store collected objects, typically built from materials such as twigs, dead leaves and plant stems1. Over a period of approximately 72 hours, gold objects within SCP-2389-1 will change to a liquid state, separate in to two solutions (one consisting of pure liquid gold and the other comprising of the liquefied impurities of the original object) and finally both solutions solidify to form solid masses. SCP-2389 will then remove the solid impurities from SCP-2389-1 once the process is complete. So far, the materials used in instances of SCP-2389-1 have been observed to have little or no effect on SCP-2389-1's anomalous properties. It is believed that instances of SCP-2389-1 break down substances at a molecular level, although no change in temperature has been recorded in objects within SCP-2389-1 instances during the process. At present, the energy source harnessed for this process is unknown.
All instances of SCP-2389-1 must be created by SCP-2389, who will refuse to use any artificial or prepared nests. Once an instance of SCP-2389-1 is full of pure gold, 2389 will construct a new instance of SCP-2389-1 in which to store its findings. Additionally, all gold objects placed in instances of SCP-2389-1 must be collected by SCP-2389 in order for any changes to occur. Observations and tests on products of SCP-2389-1 have shown no anomalous properties or characteristics. Objects placed by humans, birds or other entities will undergo no change.
It is currently unknown why SCP-2389 shows a desire for gold objects, although it's theorised that it may do this in an attempt to attract a mate. Introduction of a male yellow-billed magpie in to SCP-2389's containment cell has been proposed to observe whether this is the case, as well as to observe whether offspring of SCP-2389 have similar traits to their mother and if they are able to produce instances of SCP-2389-1. The experiment is currently pending approval by site command.
Addendum #1: SCP-2389 was recovered from San Luis Obispo, California on ██/██/20██, after numerous reports of 24-carat gold nuggets being discovered within birds' nests reached the SCP Foundation. During the initial investigations, SCP-2389 was discovered, along with the anomalous properties possessed by instances of SCP-2389-1. Agents successfully secured SCP-2389 and all instances of SCP-2389-1, relocating them to Site-66. An outdoor containment cell in woodland near to Site-66 was constructed to house SCP-2389.
Footnotes
1. Materials used to create SCP-2389-1 instances may vary depending on the resources available in SCP-2389's environment.
|
SCP-310 is a 157mm tall white candle, composed of apparently standard tallow.
|
***
Item #: SCP-310
Object Class: Safe
Special Containment Procedures: When not used in experimentation, SCP-310 is to be kept in a 0.3 m x 0.3 m x 0.3 m sealed vacuum case composed of flame retardant material. The research chamber surrounding the vacuum case shall be similarly flame retardant and be kept saturated with carbon dioxide, nitrogen, or other fire extinguishing agent when testing is not taking place. Standard Foundation protocols to prevent unauthorized access should be kept in place.
No flammable or semi-flammable substances are permitted within the research chamber, except small quantities for research purposes. Authorization is required for testing on live or otherwise self-propelling test subjects. Chamber is to be kept sealed during testing and emergency vacuum system is to remain active. All personnel are forbidden to wear loose clothing when in chamber. Long hair must be kept tied up. Flame retardant suits are recommended.
Memo #310-AA: For the last time, loose clothing includes ties! Regardless of the normal dress code encouraged on site we want to avoid any more cases like Dr. F██████. No item should be worn that might allow accidental contact with SCP-310. — Dr. Jon Drake
Any object which contacts SCP-310 is to remain in the chamber until fully consumed. Any item or clothing contacting SCP-310 is to be removed as expeditiously as possible while preventing further contact. Any limb or extremity contacting SCP-310 is to be removed immediately. Surgical tools including bone saws are to be kept on hand for this eventuality as well as bolt cutters and power saws in case time factors prevent a more controlled amputation from being performed. Any Class D personnel contacting SCP-310 are to be immediately terminated. If exposure of SCP-310 to Class D personnel is part of test procedure, it is recommended that the test subject is restrained prior to exposure to prevent further accidental contact.
The research chamber is to remain sealed until all objects exposed to SCP-310 are fully consumed. Therefore it is recommended to limit size of test subjects to prevent lengthy lockdowns of research chamber.
Description: SCP-310 is a 157 mm tall white candle, composed of apparently standard tallow. SCP-310 is an unmarked 33 mm diameter cylinder with tapered tip, out of which emerges 7 mm of wick. When not immersed in an oxygen-free medium, the wick produces a steady 24 mm tall flame. This flame can be extinguished through most conventional means: removal of oxygen, immersion in non-flammable fluid, application of sudden intense airflow. However, on the removal of the inhibiting factor, the flame immediately reappears, behaving much like a standard "trick candle".
Only a small amount of tallow is liquefied at the base of the wick, and is not consumed by the flame. Even during the longest duration removed from containment (██ days from ██-██-████ to ██-██-████ as a result of the events of [DATA EXPUNGED]), at no time during those weeks was the tallow level nor the overall height of SCP-310 observed to decrease.
Other than its interaction with the flame of SCP-310, the tallow itself is not unusual in any respect. (Tallow removed from SCP-310 is designated SCP-310-01 and is classified Safe.) It is easily cut and as malleable as would be expected. It also melts and burns as normal when exposed to ordinary flame. Any tallow removed from SCP-310 is slowly replaced by unknown means. If SCP-310 is cut short, tallow will grow from the lit section until the original 157 mm height and unblemished appearance is restored. In one experiment, SCP-310 was placed in a heat chamber, melting the entire volume of tallow so only the wick remained. The flame remained lit even without fuel and gradually exuded tallow until its original state was restored.
Any flammable or semi-flammable substance which comes into contact with SCP-310 becomes ignited with a slow spreading fire. Unlike the flame of SCP-310, this fire cannot be extinguished by any known means other than exhausting its fuel supply. Experiments have shown that the fire will continue to burn even:
In a vacuum
Under water
In a nitrogen-saturated environment
Under intense airflow
In a refrigerated environment
Encased in a fire-retardant covering
or any combination of the above. Only total consumption of all flammable material in contact with the flames will result in them becoming extinguished. (Any object ignited by SCP-310 are designated SCP-310-02 and are classified Euclid until fully consumed, whereupon they revert to Safe classification.) Therefore in the case of accidental ignition, especially of personnel, separating the lit section from the rest of object as soon as possible is the only way to preserve the rest of the exposed object.
SCP-310-02 objects are also capable of spreading to other flammable or semi-flammable objects, resulting in further SCP-310-02 type objects. The implications of such possibility for chain reaction are worrisome.
Test have shown that bodily contact with SCP-310 is similar to normal immolation — that is, highly painful and damaging. Damage is somewhat more extensive than that of normal flames, probably due to inability to extinguish and the unusually slow rate of spread of SCP-310-02. No unusual psychic or memetic properties have been observed.
The means by which SCP-310-02 objects are able to continue burning despite all efforts to extinguish is unknown. It is also unknown why SCP-310 itself is so easy to extinguish, albeit temporarily.
Recovery: SCP-310 was recovered from the charred remains of █████-██-█████, a hamlet outside of █████, UK. The isolated nature of the site is probably responsible for the containment of the resulting blaze, which fire fighters had battled unsuccessfully for 8 hours before abandoning the buildings to the flames. In the subsequent investigation, 7 people expired, either through contact with SCP-310 or cross-contact with earlier victims. The event drew Foundation attention and SCP-310 was recovered without incident, due to precautions taken by Agent T██ based on existing evidence.
A further investigation of the site revealed that it was being used as a [DATA EXPUNGED]. The involvement of that organization may go some way to explaining why SCP-310 was located where it was, what it had been used for, and how it started the blaze that led to its recovery by the Foundation. However, the question of SCP-310's origin is still open.
|
SCP-860 is a dark blue key of unremarkable shape.
|
***
Item #: SCP-860
Object Class: Safe
Special Containment Procedures: SCP-860 is to be contained in a small wooden box in a vault at Sector-██. By itself, the object is inert, and no further containment procedures are needed.
Description: SCP-860 is a dark blue key of unremarkable shape. At seemingly random intervals of time, a series of numbers, later found to be UTM coordinates, will appear on the key's blade. In the time SCP-860 has spent under containment, the numbers have changed three times, giving the coordinates for ██████ (Germany), ██████ (England), and Site-██.
SCP-860 can fit in any door lock that requires a key located in the area of the given coordinates, and will function identically to the correct key for that lock. SCP-860 only works on door locks, and only if they are attached to a door; it will not work on any other type of locking device.
When SCP-860 is used to unlock and open a door, the door does not lead to its usual destination. Instead, it opens into a small forest clearing centered on an 80 cm wide footpath, designated SCP-860-1. Every observation of this grove has noted the presence of blue-colored mist.
SCP-860-1
As soon as any person enters SCP-860-1, the door automatically closes. From inside SCP-860-1, the door appears attached to an infinite concrete wall, and is locked. No attempts to break the door from outside, with personnel inside SCP-860-1, have been successful. Attempts to break the door from inside SCP-860-1 have resulted in [REDACTED]. See Document 860-III for more details.
The trail inside SCP-860-1 usually leads to another door attached to another infinite concrete wall. This second door leads to the normal destination room of the door on which SCP-860 was used.
A number of other anomalous events have been reported by personnel conducting explorations of SCP-860-1. These are explained in more detail in Documents 860-I through 860-IV.
Following the events of Exploration IV (described in Document 860-IV), only level 4 personnel may perform tests on SCP-860.
Incident 860-██-12: On ██/██/████, ██ days after Exploration IV, SCP-860 was found on Dr. ███'s office table, ████ m from its containment unit. The item's containment locker had not been opened. Video surveillance from ██:██ AM shows the key suddenly materializing on top of the table. It is currently unknown how or why SCP-860 was moved. The incident had a profound effect on Dr. ███. Psychiatric evaluation is recommended.
Addendum: Below are the transcripts of Explorations I - IV. Level 2 personnel and above may access Documents 860-I and II. Only level 4 personnel and above may access Document 860-III and IV.
Document 860-I and II
Document 860-III and IV
|
SCP-3227 is a 3x3 kilometer portion of jungle originally located on the East coast of Madagascar which is made entirely of the skin of the Dendrobatidae1, colloquially known as the poison dart frog.
|
***
Item #: SCP-3227
Object Class: Euclid
Special Containment Procedures: Approximately 1000 kg of live insects with high alkaline content and/or small animals are to be dropped into SCP-3227 on a bi-monthly basis via helicopter or drone. Instances of SCP-3227 are to be encompassed by electric fence and monitored at all times by security personnel, maintaining a distance of at least one kilometer from SCP-3227. Under no circumstances are humans to enter SCP-3227 without proper equipment. Due to the nature of SCP-3227, authorization to conduct research directly will only be granted in the week prior to the bi-monthly feeding. Should there be any issue with the harvesting equipment, repairs must be scheduled during the week prior to the bi-monthly feeding.
Description: SCP-3227 is a 3x3 kilometer portion of jungle originally located on the East coast of Madagascar which is made entirely of the skin of the Dendrobatidae1, colloquially known as the poison dart frog. The color of skin matches the natural color of the flora that it mimics. However, small black patterns that match those of the poison dart frog can still be seen. SCP-3227 is believed to be a single living organism, though the biology of SCP-3227 is unknown as attempts to cut deeper than one meter into SCP-3227 have been consistently met with failure due to the increased toxicity of SCP-3227's deeper layers. Extreme decay of living and nonliving matter occurs when exposed to the toxins that reside one meter or deeper within SCP-3227. The toxicity of SCP-3227's interior has proven constant regardless of when it was last fed.
Within SCP-3227, while there is nothing that resembles the fauna of Madagascar, a variety of flora both native and alien to the Madagascan rainforest can be found. While these 'plants' also consist entirely of poison dart frog skin, their toxicity levels tend to be significantly lower the farther from the ground it is. It is due to that discovery that samples taken of SCP-3227 tend to come from the top of its trees.
SCP-3227's toxins work much in the same way as do those of the poison dart frogs. The toxicity of the skin reflects the amount of alkaloids that it takes in, most commonly through insects. Being cut off from its natural environment, SCP-3227 would slowly die without bi-monthly feedings. Creatures that are killed by SCP-3227 die from over-exposure of alkaline toxins, and proceed to rapidly decay into SCP-3227. When creatures with high alkaline content are consumed by SCP-3227, it results in SCP-3227's skin becoming more toxic than before. However, after approximately one month without consuming any alkaloids, SCP-3227's toxicity will begin to wane.
For larger creatures, such as humans, SCP-3227's toxins cease being deadly on contact after a month and a half without feeding. Instead, direct contact with the toxins from SCP-3227 will only cause a burning sensation. However, prolonged exposure without proper equipment will result in sickness, fatigue, paralysis, and eventually death.
SCP-3227, while normally docile, is able to protect itself or trap fleeing prey when aggravated. SCP-3227's primary mode of defense is through releasing concentrated toxins. If that fails, it is also able to use an appendage closely resembling the tongue of a frog. In emergencies, SCP-3227 will open a large amount of small holes on the ground, plants, and trees, where multiple frog tongues are able to shoot out. One tongue that was severed during incident XX47-B was measured at 15 meters in length, and microscopic analysis revealed millions of small needles containing alkaloid toxins covering the tongues surface. When provoked, up to thousands of tongues have been reported to emerge and weave a web around their target, immobilizing and poisoning them.
Since the discovery of SCP-3227, the Foundation has used the alkaline toxins that secrete from SCP-3227 for numerous projects. The alkaloids have been extremely useful in the creation of amnestics, as well as biological weapons and assisting in the containment of various other SCPs. While containment is a top priority for SCP-3227, the Foundation has also made it a top priority to utilize SCP-3227 to its maximum potential. Currently, Dr. Martin is leading a research effort to establish a large scale farming operation for SCP-3227 on Site-118.
SCP-3227 was originally discovered in 1967 by a group of independent researchers who wandered into the jungle in search of new species of fauna. Locals avoided the area due to the mysterious deaths that occurred within it, which lead the researchers to believe that the deaths were due to an undiscovered species. Of the twelve that entered, only five managed to escape. Those researchers were discovered by the Foundation and were subsequently brought in for questioning.
In 1972, while a sample of SCP-3227 was being brought to Site-118 via airplane along with several other Euclid class SCPs, there was an incident that resulted in a crash above the Talladega National Forest in Alabama. Although the other SCPs were recovered successfully, the sample of SCP-3227 was not found. Five years later, reports of hikers going missing in the area near the crash led to a secondary investigation. It was discovered that the sample of SCP-3227 had managed to survive the crash and grow in the Talladega National Forest, and was the exact size of the original. This instance of SCP-3227 contained all the same species of flora as the original. Attempts to remove this instance of SCP-3227 were initially met with failure and numerous casualties, however, the Foundation succeeded in removing SCP-3227 through the use of firebombs in July, 1978. Following this incident, humans were forbidden to interact with SCP-3227 in any destructive manner2.
+ Exploration Log 49B2A
- Close
Conducted May 12th, 1973
Description: Lead Researcher Arslan instructed seven D-Class personnel to attempt to cut down several of the trees within SCP-3227, and one additional D-Class to attempt to dig into SCP-3227. Each D-Class is armed with an axe, as well as a protective suit and gas mask. The D-Class with the task of digging was given a shovel. They were given two hours to make as much progress as they could, and were then instructed to return from SCP-3227 after the time had elapsed. They were instructed not to go too deep into SCP-3227 so that researchers could maintain visual contact with them through binoculars.
Result: As soon as the D-Class personnel began to chop at SCP-3227, concentrated toxins began to leak into the air. The protective suits that the researchers had provided for the D-Class didn't appear to be adequate in stopping SCP-3227's toxin. The D-Class who struck at SCP-3227 collapsed after only a few seconds of exposure. One of the D-Class in the area, designated as D-231, witnessed this and ran back to the rendezvous point. The D-Class assigned to dig into SCP-3227, designated D-175, failed his task as the shovel wasn't capable of digging into SCP-3227. All D-Class personnel, except for D-231 and D-175, were poisoned and subsequently consumed by SCP-3227.
Researcher's Notes: Dr. Arslan expressed disappointment in his inability to retrieve a sample of SCP-3227, but was optimistic about future projects. Dr Arslan and the rest of his research team concluded that, with proper protection that utilized oxygen tanks, it would be entirely possible to obtain small samples of SCP-3227.
+ Incident XX47-B
- Close
Date: June 19th, 1978.
Incident Report: In the first attempt to remove the secondary instance of SCP-3227 from the Talladega National Forrest, ten Foundation agents who had been equipped with full protection suits and flamethrowers were sent to remove the instance. Due to numerous factors, the mission failed. One agent, Agent Maglow, managed to escape and reach the rendezvous point. Agent Maglow was commended for his bravery and service, however, the other nine members of his team were never recovered.
The fire that resulted from their collective efforts had eliminated approximately 30% of this secondary instance of SCP-3227. However, it would take another month for the instance of SCP-3227 to be completely removed. When it was, researchers were unable to discover anything specific about the biology of SCP-3227, as it had been completely incinerated in the aftermath.
+ Interview Log XX47-B
- Close
On August 8th, 1978, Agent Maglow was interviewed by Dr. Arslan regarding Incident XX47-B. Only the interviews audio was recorded.
Begin Audio Recording
Dr. Arslan: Hello, Agent Maglow, my apologies for keeping you waiting.
Dr. Arslan is heard sitting down, as well as laying papers onto a desk.
Agent Maglow: Hey, doc. No problem.
Dr. Arslan: You don't seem very chatty today, now do you? Would you like to reschedule the interview for some other time?
Agent Maglow: No, no it's fine. I'd rather just get this over with so I don't have to think about it anymore.
Dr. Arslan: That's the spirit! So, you've had more intimate experience with SCP-3227 than anyone else, so what I'd like to know…
Agent Maglow: … Well, we went in to kill the thing, right? First, it might help if you briefed us better for shit like this. Also, there wasn't much synergy in the team. I only knew Doug and Jonas, we'd worked together a lot in the past, so we stuck together. The rest just went off and did their own thing.
Dr. Arslan: Well, teams are made based off of recommendation and service records. As for the briefing, we told you men everything we knew at the time. That's why you and me are doing this. To find out more, so there are no more incidents like the last one.
Agent Maglow: Well… Whatever. If that's what you're worried about, I'll skip ahead a bit. Doug, Jonas and I had been burning away at some of the trees and shit for maybe fifteen minutes, not too long. The flames weren't spreading like the researchers said they would, so we were getting antsy. So, we left that area to get started on another one. That's when those… Tongues, or whatever the fuck those things are started popping out of the woodwork.
At this point, Agent Maglow takes a long pause.
Agent Maglow: They hit Doug first. It happened quick, and there were a lot of them. He didn't even have time to defend himself, they just ripped right through him. I mean, like a big, concentrated group of them. Wasn't just one. Then, a bunch of the tongues wrapped his body up and pinned it to the ground. I don't think that the tongues knew that they killed him. I backed up, trying to figure out what the fuck was happening. Jonas ran over to try and get Doug out of there. I yelled over to tell him to forget it, and that we needed to run. But…
Agent Maglow takes another long pause.
Agent Maglow: It didn't do any good. The tongues grabbed his arms and legs and pulled him down hard, breaking his helmet. Soon as that happened, I knew the poison would get him in a few minutes. I turned and ran for the burnt up part, last thing I heard was Jonas throwing up. Poison I guess… Anyways, the thing got me just before I made it to the burnt part. I only had to deal with two of the tongues. One grabbed my leg from far away, and another opened up in the ground right next to me as I tripped, wrapping around my body. Lucky me, the thing missed my right arm, so I could get my knife out. Barely managed to cut that tongue that I gave you guys off, that thing was tough. Soon as I did, I shot the flamethrower at the tongue on my leg.
Dr. Arslan: You shot your own leg with the flamethrower?
Agent Maglow: No, no I shot the tongue. It was far away so I shot past my leg at the tongue.
Dr. Arslan: Ah, I see. Please continue.
Agent Maglow: That's about it. I grabbed the tongue and burnt a path outta there from the area we already burned. That's what happened.
Dr. Arslan: I see, thank you for that report, then. I have one question, though. How do you think that those tongues were so accurate in hitting you and your comrades? Was it the pressure on the ground, or something else?
Agent Maglow: Well, at first I thought that was it. The pressure. But when I hit the ground, I saw something where the tongue was coming out. Something that I thought I saw in the other ones that hit Doug and Jonas too.
Dr. Arslan: You saw something in the holes?
Agent Maglow: Yeah.
Dr. Arslan: Well, what was it?
Agent Maglow: There were eyes. Lots and lots of eyes. Tiny little ones, all over. They were completely black, but I could see the light from the fire reflecting off them. They were all over the place. If you ask me, they were watching us the whole damn time.
Both Agent Maglow and Dr. Arslan are silent for a few moments.
Dr. Arslan: I see. Thank you very much for this interview, it's been quite informative.
End Audio Recording
Note: Following this interview, further attempts to cause large scale harm to SCP-3227 were forbidden.
Footnotes
1. Specifically, the Phyllobates terribilis
2. See Interview Log XX47-B
|
SCP-2291 is a corrugated cardboard box with a edge length of 15cm.
|
***
Item Locker ECD-2291 in Site 19. As direct physical contact with SCP-2291 is prohibited, only D-Class personnel are authorized to move the item. Research involving SCP-2291 is prohibited without the express permission of Dr. Mbeke or Site-19’s senior administrative staff. Individuals that touch SCP-2291 directly are to be designated SCP-2291-A, administered a Class B amnestic, and placed into confinement for 3 months or until cleared by a supermajority of Site-19's psychiatric panel. Individuals that still show symptoms after this period are to be terminated.
Description: SCP-2291 is a corrugated cardboard box with a edge length of 15cm. The word “FUN” is printed in large, black capital letters on each side. There are no gaps or joints on SCP-2291's surface, suggesting that it was formed whole rather than being folded from a flat sheet. D-Class personnel report a rattling noise issuing from SCP-2291 when moved, suggesting that it contains one or more smaller objects. All attempts to access SCP-2291's interior via destructive means have failed, as have imaging studies intended to probe the interior. Level-3 personnel and above may request Test Logs 2291 -1 though -4 for more details.
SCP-2291 was recovered from the offices of █████████ Corporate Solutions in ███████, Ohio. Foundation assets were alerted after the entire staff of █████████ Corporate Solutions was reported missing within a period of 2 days. Mobile Task Force Rho-9 ("The Dundies") was assigned to investigate, and recovered SCP-2291 along with 18 instances of SCP-2291-A, identified as the former employees of █████████ Corporate Solutions. These individuals were found at their workstations, suffering from sleep deprivation and mild dehydration.
Direct physical contact with SCP-2291 is to be considered a Delta-class cognitohazard. Those who do so are to be designated SCP-2291-A and experience the following symptoms:
All communication by SCP-2291-A instances is altered. SCP-2291-A instances involuntarily replace some adjectives, especially those involving emotion, with the word “fun”.
SCP-2291-A instances smile constantly, even while sleeping.
SCP-2291 significantly alters how SCP-2291-A instances express and experience emotion. Immediately after initial exposure, subjects report increased feelings of happiness and significantly reduced resistance to authority. As the time of exposure to SCP-2291 increases, however, symptoms change; subjects repeatedly exposed to SCP-2291 for a period greater than 2 weeks become reliant on SCP-2291's effects to experience pleasure. When isolated from SCP-2291, these subjects temporarily lose their ability to normally process endorphins. In addition to a suppressed ability to experience pleasure, these individuals experience symptoms analogous to extreme doses of Naloxone in opiate abusers; restlessness, sweating, and headache are common.
When isolated from SCP-2291, SCP-2291-A instances typically recover within 3 months. Recovery is negatively correlated with exposure time; the less time a subject spends near SCP-2291, the greater their chance of recovery.
Interview Log 2291-17-3: The first 18 known SCP-2291-A subjects were the employees of █████████ Corporate Solutions, all of whom were detained during the recovery of SCP-2291. The following interview has been deemed notable due to its content.
+ Interview Log 2291-17-3
- Interview Log 2291-17-3
Interviewed: SCP-2291-17
Interviewer: Junior Researcher Evans
Foreword: SCP-2291-17 was interviewed 2 weeks after containment. SCP-2291-17, formerly known as Ahmed █████, was an accountant at █████████ Corporate Solutions.
<Begin Log>
Evans: Hello, Mr. █████. I'd like ask you a few questions about SCP-2291.
SCP-2291-17: What?
Evans: The object in this picture.
Evans hands SCP-2291-17 a photo of SCP-2291
SCP-2291-17: That? ████████1 brought that in during our holiday party a month ago. Everyone had been kinda fun after the layoffs last quarter, and she said it was a gift to cheer us all up.
Evans: Who is ████████?
SCP-2291-17: She's the head of HR. No one really knew her well, she was just… fun, you know? Her whole department just weirded all of us out.
Evans: How have you been feeling since ████████ brought in SCP-2291?
SCP-2291-17: My face has been feeling kinda fun lately. Other than that, I just can't stop working. I used to want to go home and see my family, but fun box made me realize something important. I love my job. My job is my life. Why would I go home when I feel so empty there? My job is fun.
SCP-2291-17 is silent for 12 seconds
SCP-2291-17: Can I borrow your pen?
Evans: No.
<End Log>
Closing Statement: SCP-2291-17 ceased exhibiting anomalous traits 28 days after the interview. He was administered a Class-B amnestic and released, and his SCP designation was removed.
Interview Log D-14783-7:
+ Interview Log D-14783-7
- Interview Log D-14783-7
Interviewed: D-14783
Interviewer: Dr. Mbeke
Foreword: D-14683, a former paralegal, was chosen for testing with SCP-2291. To test the long-term effects of SCP-2291 on subjects similar to the employees of █████████ Corporate Solutions. D-14683 was asked to complete a small amount of legal paperwork after each hour of exposure. The following interview was performed 3 months into SCP-2291 exposure.
<Begin Log>
Dr. Mbeke: Hello, D-14783. How are you today?
D-14783's tone suggests unhappiness. He remains smiling.
D-14783: Fun.
Dr. Mbeke: What do you mean by that? You sound sad.
D-14783: I don't have enough to do. I have to keep working. Can you guys give me more to do?
Dr. Mbeke: I'll see what we can find for you. Tell me, why do you feel like you need to work so much?
D-14783: I have to be fun. When I'm not writing, when I'm not getting things done, I just get this sense of emptyness. Don't get me wrong, whenever I'm near that little box thing, I feel great. But even then, I feel almost guilty about not working. When I'm not around it, the feeling just gets worse. The only way I can feel like myself is to work.
<End Log>
Closing Statement: D-14783 did not show any progress in recovering from the effects of SCP-2291. He reported consistent worsening of psychological symptoms as time of exposure increased. He was found dead in his cell 4 months and 12 days after the above interview. Cause of death was ruled to be blood loss resulting from suicide, as D-14783 had repeatedly carved the word "fun" into his chest and left forearm with a screw taken from his cot. Due to this incident, further long-term studies with SCP-2291 are prohibited.
Document 2291-A: The following is a transcript of Video 2291-A, recovered from a camcorder found in the offices of █████████ Corporate Solutions.
+ Document 2291-A
- Document 2291-A
00:00:00 - Video begins. Appears to document an office holiday party; employees of █████████ Corporate Solutions are gathered in a conference room eating cake.
00:03:54 - Ahmed █████, in conversation with another employee near the camera, is noted to say "Screw this job, I'm out. I'm putting in my two weeks tomorrow."
00:07:31 - An unknown female wearing a suit, designated SCP-2291-B, enters the frame. SCP-2291-B's face is obscured by electronic distortion. She is holding SCP-2291.
00:07:34 - SCP-2291-B places SCP-2291 in the center of the conference table and takes a seat facing the camera. All employees in the room cease talking and stare at SCP-2291.
00:09:39 - After remaining silent and motionless for 2 minutes, 2 seconds, all █████████ Corporate Solutions employees excluding SCP-2291-B lay a finger on SCP-2291.
00:13:04 - All subjects excluding SCP-2291-B silently leave the conference room and return to their desks. SCP-2291-B remains seated in front of the camera.
01:35:00 - Video ends. No conversation is heard from the employees of █████████ Corporate Solutions, nor does SCP-2291-B move after 00:07:34.
Footnotes
1. No employees with the name of ████████ were detained during the recovery of SCP-2291, nor did any recovered SCP-2291-A instances claim to work in the █████████ Corporate Solutions Human Resources department.
|
SCP-1129 is a large object of apparently biological origin.
|
***
Item #: SCP-1129
Object Class: Euclid
Special Containment Procedures: SCP-1129 is to be contained in a 3m x 3m x 3m chamber in the High Security wing of Site-83. Due to the nature of SCP-1129, no direct or first-degree indirect viewing methods, such as observation windows or cameras, are allowed within the containment chamber except as authorized by a Level 4 or higher researcher. Visual contact with SCP-1129, whether direct, indirect or recorded, is not allowed except under strictly controlled experimental conditions. SCP-1129's continued presence and status is monitored by ultrasound, as the image produced does not cause the effects typical of observing SCP-1129.
Knowledge of SCP-1129's effects is non-essential for any personnel with less than Level 4 security clearance. Personnel assigned to the research, containment, security or other support teams associated with SCP-1129 are to be sequestered from the other personnel at Site-83 until such time as they have been removed from the assignment and have completed the debriefing and clearance procedures. If any personnel at Site-83, whether assigned to SCP-1129 or not, begin to exhibit the Stage I or Stage II symptoms described below, they are to be administered Class B amnestics immediately and must receive a psychological examination to determine the severity of after-effects, with further psychological treatment made available as necessary.
If a member of assigned personnel is deemed unnecessary to the continued containment of SCP-1129, they may be transferred to another project so long as they had no direct exposure to SCP-1129. Prior to transfer, all personnel who have been assigned to SCP-1129 must successfully complete a memory restructuring following treatment with Class A amnestics. At that point, they must complete a minimum 2 week quarantine period to be certain that they do not manifest Stage I or Stage II symptoms.
Description: SCP-1129 is a large object of apparently biological origin. Its composition is largely unknown, as it seems to 'flow' past any and all objects that approach it, temporarily breaking apart and changing its own dimensions as needed. Due to this, only one sample has ever been obtained, which showed the presence of several amino acids and hormone analogues consistent with terrestrial life, but no DNA samples were detected. Based on longitudinal ultrasound recordings, it appears that SCP-1129 is dimensionally fractal in nature, with a partial existence in a theoretical 3.333rd spatial dimension. Based on behavior, it is presumed that SCP-1129 is sentient, although this is unconfirmed.
When any sentient being makes visual contact with SCP-1129, they will immediately enter Stage I, which is characterized by an extremely heightened flight reflex. They will attempt to flee from SCP-1129 by any means possible, ignoring obstacles and personal injury.1 Human subjects have later described this as having been overcome with intense fear and unthinking hysteria. Stage I symptoms will increase in intensity so long as the subject remains within 23.3 meters of SCP-1129 or remains in direct line-of-sight of SCP-1129. Stage I symptoms will persist for several hours2 after the affected being has left the immediate range of effect of SCP-1129. If the affected subject is unable to leave the range of effect, they will exhibit increasingly frantic behaviors until finally expiring. Post-mortem examinations reveal that the cause of death is typically cardiac arrest or the equivalent, consistent with a prolonged heightened state of fear and stress.
Once a subject has recovered from Stage I symptoms, they will immediately proceed to Stage II. Stage II is characterized by heightened aggression and hostility towards SCP-1129. Human subjects experiencing these symptoms invariably describe SCP-1129 as "wrong", "not the right kind of real", "not fitting here", etc., and incredibly dangerous. They will express a strong desire to destroy it immediately by any means possible. If the animal subject to Stage II symptoms is not able to convince others to assist them in destroying SCP-1129, they will attempt to do so on their own, up to and including breaching containment on SCP-1129 or other SCP items believed to possibly be useful in the destruction of SCP-1129. If multiple individuals are experiencing Stage II symptoms, they will work together in a destruction attempt. Subjects do not display any change in intelligence, skills or ability to communicate, however, and cross-species cooperation is usually minimized. No other change in behavior or motivation is noted, and subjects experiencing Stage II symptoms will pause in order to eat or sleep, although they return to their destruction attempts as soon as feasible.
However, upon seeing SCP-1129, subjects will promptly return to Stage I with no apparent memory of having experienced it before, beginning the cycle again. This cycle will continue unabated until the subject has either died or been administered amnestics. In approximately 1.7% of cases, a subject will enter Stage III instead, which is characterized by all voluntary muscles freezing in place. This muscle locking persists despite all treatments, including removal from SCP-1129's range of effect, administration of muscle relaxers, administration of amnestics, and medical destruction of the motor nerves controlling them. To date, the most control of voluntary muscles that has ever been regained was in 3 individuals who regained control of the eyelids, allowing voluntary blinking, and partial control of the vocal cords. In these cases, amnestics were successful in eradicating the Stage I and Stage II symptoms.
Video feeds and photographs of SCP-1129 produce an identical effect, though artist renditions have no effect. Despite this profound observational cognitohazard effect, SCP-1129 seems to be completely harmless otherwise. It has now been determined that transition into Stage II may be caused by any significant knowledge of the nature of SCP-1129's effects. SCP-1129 is now considered a Grade III infohazard and has been upgraded to Euclid. See Addendum.
Addendum: On April ██, 19██, researchers assigned to SCP-1129 began to share the consensus that SCP-1129 was incredibly dangerous, and submitted multiple requests for its decommissioning, which were all denied. A new team of researchers were assigned, but within 30 days, they exhibited the same opinions as the previous team. Subsequent research teams have displayed the same effects, despite updated containment procedures. Teams of researchers are now to be cycled on a biweekly basis, as that seems to slow the onset of the infohazard aspect of SCP-1129's effects.
Efforts are currently underway to identify and locate all personnel Foundation-wide who may have been exposed to information regarding SCP-1129 directly or second-hand, with administration of amnestics and memory-restructuring performed as appropriate. As of the date of this report, ████ personnel have been identified and successfully treated.
Footnotes
1. This effect is most pronounced in mammals, but has been observed in all animal life, including birds, fish, snails and insects. Certain sentient anomalies, however, are not affected.
2. The exact length of time varies considerably from individual to individual, with an average of 4 hours.
|
SCP-817 is a humanoid of indeterminate gender and variable physical features, although genetic testing suggests it was once █████████ █████, a young Asian male.
|
***
Item #: SCP-817
Object Class: Euclid
Special Containment Procedures: SCP-817 is held in a solitary confinement cell in Site-██. Numerous mechanisms for incapacitating SCP-817 are built into its cell, including sedative-loaded darts, pumps to fill the chamber with sleeping gas, pumps to remove oxygen from the chamber, a mechanism to flood the chamber with water or acidic or alkaline solutions, an electric current that can be run through the floor and walls, a mechanism to fill the entire room with quick-hardening foam, and a mechanism to introduce approximately three hundred (300) black flies to the room (SCP-817 has a known phobia of flying insects.)
The remainder of SCP-817’s containment procedure varies based on its current abilities. The following procedures must be re-evaluated and revised every time SCP-817 undergoes a metamorphic shift.
SCP-817’s containment chamber is currently a simple, padded confinement cell (apart from the measures mentioned above) air conditioned to eighteen (18) degrees Celsius. SCP-817 is fed ██ kilograms of cooked meat daily, as in its current form it consumes calories very rapidly. A detachment of at least five (5) armed security personnel must be present whenever SCP-817 is released from its cell, restraints must be placed on its ‘wing’ structures, and a specially designed muzzle on its head and neck.
Description: SCP-817 is a humanoid of indeterminate gender and variable physical features, although genetic testing suggests it was once █████████ █████, a young Asian male. SCP-817 periodically undergoes radical metamorphic changes to its physiology. The delay between metamorphic events varies but is usually about two (2) to three (3) months. These shifts and the physiological abnormalities produced cause SCP-817 enormous pain, however it seems to suffer no actual damage to its body systems. Additionally, SCP-817 seems to be incapable of deliberately injuring itself.
SCP-817 is mentally unstable, displaying severe psychotic symptoms. During psychotic episodes, which make up roughly 30% of its waking hours and are always triggered by its metamorphic shifts, SCP-817 is extremely hostile and will attempt to breach containment and attack personnel.
In its current form SCP-817 is one and a half (1.5) meters tall, lacks primary or secondary sex organs, and in place of arms has limbs resembling the wings of a bat that fold around its torso and span three (3) meters when fully extended. Bones and muscle are composed of unknown polymers, unrelated to any naturally occurring skeletal or muscular material and ██% lighter than their baseline human counterparts. Because of this reduction in its mass-to-force exerted ratio, SCP-817 is fully capable of extended, unassisted flight using its wings, although doing so requires an enormous energy expenditure. Its extremely high metabolic rate keeps SCP-817’s body temperature at a constant ██ degrees Celsius, and it appears to be suffering the appropriate degree of pain for a human heated to such a temperature despite a lack of actual harm to its physiology. Additionally, while SCP-817’s current neck and jaw structures appear humanoid, it has demonstrated the ability to suddenly jerk its neck forward and ‘unfold’ its jaw, presumably as a feeding mechanism in lieu of arms.
Addendum: Notable past metamorphic forms of SCP-817.
Tall and thin with a reflective index of nearly zero. Required no sustenance beyond solar radiation. Efficiency of absorption estimated at ██%, vastly greater than any known biological or artificial method. Had no orifices whatsoever, sensory, excretory, digestive or reproductive. Attempts to create solar panels based on its skin proved fruitless.
Female in appearance, exuded [REDACTED] from its pores (see attached image). Tranquilizers, sleeping gas and oxygen removal proved ineffective. Successfully incapacitated by electric shock. Drainage added to containment chamber to counter the corrosive effects of [REDACTED]. Kept sedated and on an IV-feed for the duration of this form. Natural feeding method seemed to involve injecting ██████ through [DATA EXPUNGED] has fully dissolved, followed by direct absorption of nutrients through the skin. Suffered the same level of pain that constant exposure to [REDACTED] would cause in a normal human.
Translucent and able to phase effortlessly through objects. Tranquilizers failed, sleeping gas failed, successfully incapacitated by oxygen removal. Spent most of its time in this form attempting to scream and two (2) days in began attempting to claw its own eyes out. Emitted a very small but measurable amount of gamma radiation. All attempts at study failed.
Two and a half (2.5) meters tall with thick, bulky musculature. Breached containment, killing and consuming ██ personnel before Dr. █████████ incapacitated it accidentally by releasing a swarm of flies intended to feed [REDACTED]. ‘Musculature’ proved to be a complex and powerful hydraulic system powered by ten (10) large hearts in its core pumping an unusual ichor. Three additional hearts powered a second circulatory system which served to provide the other hearts with oxygen. Any pressure applied to its skin caused significant pain, including contact with the ground.
Addendum: An analysis by Dr. E█████ indicates even at the most conservative estimate, SCP-817 has expended less than ten (10) percent of the energy it has taken in since containment. Its method of energy storage is presently unknown. Dr. E█████ hypothesizes [DATA EXPUNGED] and has recommended that SCP-817’s rations be cut to significantly below the current estimated starvation level. Recommendation still pending review.
|
SCP-570 is a pair of cotton gloves.
|
***
Item #: SCP-570
Object Class: Safe
Special Containment Procedures: SCP-570 is to be contained within a reinforced steel containment locker. No personnel are permitted to wear SCP-570, and all subjects who have worn it during testing are to have it removed immediately afterwards. Personnel who have worn SCP-570 are to be given medical treatment for their hands, following removal.
Description: SCP-570 is a pair of cotton gloves. When worn, they will extend between 100-150 cotton fibers into the outer epidermal layer of the subject's hand. Removing SCP-570 after this point will cause extreme damage to the subject's epidermal and muscle tissue. Following initial exposure to SCP-570, these fibers will migrate throughout the subject's body, eventually establishing contiguous connections to 80% of the subject’s muscle tissue. Subjects affected by SCP-570 are classified as SCP-570-1.
Instances of SCP-570-1 are capable of controlling the actions of any living organism they have physically contacted while wearing SCP-570. Subjects are connected to SCP-570-1 by several strings, which are produced from its fingers. These strings are not composed of the same material as SCP-570; instead, they contain DNA and match the composition of the SCP-570-1's muscle tendons.
With practice, instances of SCP-570-1 are capable of controlling up to 20 subjects at once, by extending multiple strings out to the affected subjects from their fingertips. Note that the SCP-570-1 instance controls the others by use of physical movement. Subjects will have to act carefully, due to the potential of tangling SCP-570's strings when there is a large number of affected subjects. SCP-570-1 subjects appear to be endowed with some basic knowledge of puppeteering techniques; however, instances with a background in marionette use will be more able to utilize SCP-570.
After bringing multiple subjects under their control, the SCP-570-1 instances and subjects will begin to seek out any gathering of pre-pubescent subjects, and use the persons they have attached themselves in order to put on puppet shows. SCP-570-1 and its affected subjects will recreate any stories they know which are easily understood by children, and usable with the number of persons they have under their control. These puppet shows may last from anywhere between one hour and several days, depending on the length of the story and the number of subjects involved. Following the completion of the show, all subjects will be released from SCP-570-1.
Subjects who were under SCP-570’s control will suffer no immediate side effects after being released, with the exception of a strong sense of longing. Because of this, many subjects will eventually try to take possession of SCP-570, and attempt to create shows of their own. Subjects will claim that they experienced extreme feelings of joy and belonging when performing, and wish to give these feelings to others. This effect is not universal, and will only manifest in subjects who previously displayed symptoms of depression and anxiety.
SCP-570 was recovered from "Uncle Pappy's Magic Emporium," which was a magic trick/puppeteering business. The proprietor of the store had become an SCP-570-1 instance, and used SCP-570 on the parents of children who came into his store. Following reports from local law enforcement officers after witnessing SCP-570, Foundation personnel were deployed and containment was enacted. As of 09/18/1976, SCP-570 has been classified as Safe.
Addendum: Testing Log 570
Test A - 6/09/19██
Subject: SCP-570-1, 6 D-Class subjects.
Procedure: SCP-570-1 was instructed to perform "Cinderella" using D-Class personnel.
Results: Show was performed without incident, with overarching narration being provided by SCP-570-1.
Analysis: Test was performed as a baseline for SCP-570's properties.
Test B - 6/23/19██
Subject: SCP-570-1, 6 rabbits.
Procedure: SCP-570-1 was instructed to perform a re-enactment of the book "Watership Down".
Results: SCP-570-1 used no dialog in the play; when asked, it claimed that such an action would be "unrealistic".
Analysis: Test was performed to establish baseline for SCP-570's effect on animals.
Test G - 8/19/19██
Subject: SCP-570-1, 7 completely paralyzed D-Class personnel
Procedure: SCP-570-1 was instructed to use the D-Class personnel in a play of "Peter Pan".
Results: Play was performed by SCP-570-1 and the D-Class personnel, with SCP-570-1 providing all lines for the D-Class personnel in addition to narration. SCP-570-1 was noted to have difficulty speaking following the test.
Analysis: Later tests have shown that, once mute, SCP-570-1 will simply act out the motions of the performance without any dialog.
Test I - ██/██/19██
Subject: SCP-570, 3 D-Class subjects.
Procedure: Test was conducted for 6 days, 7 hours.
Results: SCP-570-1 and the D-Class personnel were provided with sustenance; however, all D-Class personnel were not able to eat while being controlled by SCP-570-1. Following 4 days of testing, all D-Class had expired due to malnutrition and exhaustion. SCP-570-1 continued using the cadavers in the performance, providing narration in a manner similar to Test G. After 5 days had passed, the tissue surrounding the strings began breaking down, and after 6 days and 7 hours the flesh connecting the subjects to SCP-570-1 had decomposed and severed the connection.
Analysis: N/A
Addendum 2: Notes on SCP-570 Fiber Composition
Samples taken from the cotton fibers used by SCP-570 to link SCP-570-1 and its affected subjects have been shown to match the composition of initial samples taken from SCP-2991. Due to the possibility that this particular fiber composition may be partially responsible for the effects of both anomalies, anomalous materials analysis on samples from both objects is currently underway.
|
SCP-4115 is a show cave titled "███████ ████████", located approximately two (2) miles outside the town of █████████, Maryland.
|
***
Item#: 4115
Level2
Containment Class:
neutralized
Secondary Class:
none
Disruption Class:
none
Risk Class:
none
link to memo
A shot from within SCP-4115's complex.
NOTE: The following containment procedures and description are outdated and being saved for posterity. Refer to Incident-4115-Familiaris-I for further details.
Special Containment Procedures: All entrances to SCP-4115 have been blocked from public access through an agreement between the SCP Foundation and the Maryland state government. Any civilians attempting to access SCP-4115 are to be apprehended before they successfully enter SCP-4115 and amnesticized before being released back into the general public. Lucifer-grade anti-memetic broadcast pylons are to be installed intermittently above ground and around the perimeter of the cavern, and all guards are to be issued headgear engineered for anti-memetic purposes in order to avoid manipulation by SCP-4115-01. Should SCP-4115-01 ever breach containment, efforts are to be made to properly ascertain the severity of the threat SCP-4115-01 poses before proper action is taken.
Description: SCP-4115 is a show cave titled "███████ ████████", located approximately two (2) miles outside the town of █████████, Maryland. The cavern descends into the earth at a syncline, with tall, narrow passages making up nearly the entirety of the cave. SCP-4115 is primarily composed of various types of clay and stone. Large, opaque crystals resembling quartz line the walls of the cavern. These crystals are remarkably sharp and incapable of being damaged by any known tool or implement. Direct contact between any living being and the crystal causes both the crystal and the being to dissolve1. The density of the crystal clusters increases as SCP-4115 goes further underground, eventually reaching a point where the entirety of the cavern is covered by crystals. A large crystal wall, measuring five (5) meters by seven (7) meters, is located at the bottom-most point of the cavern. The wall appears to be heavily damaged, with a large indentation present in its center.
SCP-4115 is host to an entity referred to as SCP-4115-01. SCP-4115-01 is thought to be located behind the crystal wall at the bottom of SCP-4115. SCP-4115-01 has explicit power over the happenings within SCP-4115, including knowledge of the exact locations of individuals within the cavern, and the ability to manipulate the cavern itself and the features within it2, but seems to be unable to affect the crystals that line the cavern. SCP-4115-01 has also exhibited the ability to telepathically communicate with and manipulate human beings who enter the cavern. This telepathic ability is somewhat limited and is capable of being hindered by basic anti-memetic agents or heavy metals. Subjects under SCP-4115-01's manipulation share several common traits, including:
Heightened levels of stress.
Overclocked adrenaline production.
Movement and coordination problems.
Lack of a self-preservation instinct.
If left unrestrained, affected subjects will attempt to reach the lowest point of the cavern and use their body to dissolve the crystal wall. Any attempt to stop or restrain subjects under SCP-4115-01's control generally creates a negative response from SCP-4115-01, which will use SCP-4115's interior against perceived threats to the subject. To date, no subject under SCP-4115-01's control has succeeded in completely melting through the crystal wall.
Due to the abilities of SCP-4115-01 and the uncertainty of its intentions, current containment procedures focus on ensuring that SCP-4115-01 does not escape from SCP-4115. While not much is understood about SCP-4115-01, it has been determined that the crystal wall is likely the only barrier preventing its escape, and it is unable to destroy the wall itself. Repair of the crystal wall from previously sustained damage has proven unsuccessful, so attention is currently focused on preventing SCP-4115-01 from manipulating more subjects. See Incident-4115-Familiaris-I.
+ Incident-4115-Familiaris-I
- Incident-4115-Familiaris-I
On 14/6/████, Containment Specialist █████, who had been overseeing SCP-4115's containment site, opened fire on guards posted around SCP-4115 and entered the cavern with a large procession of approximately two (2) dozen D-Class personnel. Based on information gathered post-incident, Specialist █████ had been exposed to SCP-4115-01's manipulative properties at some unknown point prior and had convinced the D-Class subjects to follow him under the guise of an escape attempt3. A security team of seven (7) were dispatched to retrieve Specialist █████ and execute the D-Class Personnel before they could reach the crystal wall. Below is a transcript of the video footage recovered from Operative Davis, a staff sergeant from the security team sent into SCP-4115.
00:00: Footage begins. Operative Davis, along with the rest of the security team, is seen sprinting past the entrance into SCP-4115. Specialist █████ and the D-Class personnel are ahead of them at this point.
01:27: Security team is attempting to move through the cavern as quickly as possible. A D-Class appears ahead of the team, lagging behind the rest of the group. Operative Davis opens fire on the D-Class and executes him. The team runs past the corpse and continues into the cavern.
03:02: A scream is heard from within the cavern, followed by a loud thud. The cavern wall to the left of the team suddenly slides forward and crushes three (3) of the team members against the opposite wall. A team member is heard cursing while the leader of the group urges them to continue.
04:24: The team arrives at a large vertical tunnel inside the cavern, where two (2) D-Class personnel are seen attempting to descend into the tunnel by scaling its walls before being swiftly executed. Operative Davis pans downward and captures a brief shot of Specialist █████ and the remaining D-Class personnel sprinting into the passage at the bottom of the tunnel, which is more heavily encompassed by crystal than earlier sections of the cavern. The security team begins a hasty descent after them.
05:31: Operative Davis is seen descending the cavern with his hands. To his right are the two other team members and the team leader. A groaning noise is heard before a large stalactite is seen falling on one of the team members' head, killing them instantaneously and sending their body to the bottom of the tunnel. Operative Davis and the other team members begin descending more rapidly. Upon reaching the bottom of the tunnel, another groaning noise is heard, and the tunnel can be seen contracting around the remaining team members. Operative Davis and the team leader manage to get into the passage at the bottom of the tunnel before it fully contracts, while the other team member is seen slipping into a small crevice in the side of the wall before the tunnel crushes them.
06:16: Operative Davis and the team leader continue down the passageway, which is completely enveloped by crystal at this point in the cavern. They eventually reach the exit, which leads to the chamber containing the crystal wall. Specialist █████ is seen directing the D-Class personnel into the wall, gradually wearing it down. Operative Davis and the team leader open fire on the small group, at which point Specialist █████ shoves multiple D-Class onto the wall, followed by himself. Operative Davis unsuccessfully attempts to pull Specialist █████ and the D-Class personnel off of the wall before they melt. Cracks start appearing in the crystal and the wall starts to radiate light. Team leader grabs Operative Davis by the shoulder and orders him to retreat. Turning to face the passage, a large detonation from behind sends chunks of crystal flying around the chamber. Operative Davis and the team leader are knocked back by the blast. Operative Davis recovers and turns to face the source of the detonation. The wall has been completely destroyed, and a small canine, appearing to belong to the Polish Lowland Sheepdog breed, is seen where the wall once stood. This is presumed to be SCP-4115-01. The dog's fur is heavily discolored and caked with clay, though the dog itself appears to be fine, at least externally. Without warning, the dog suddenly sprints past Operative Davis and up into the passageway. Operative Davis attempts to pursue SCP-4115-01 but loses track of it at the entrance to the tunnel, which has fully reopened. The team member previously trapped in the tunnel is seen waiting at its bottom and exclaims to Operative Davis that they saw SCP-4115-01 rapidly ascend the tunnel in a manner deemed impossible for a regular dog. Both team members return down the passage to meet up with the team leader.
[EXTRANEOUS FOOTAGE CUT]
Following the incident, the crystals lining SCP-4115 gradually began to dissipate, leaving the entire cavern devoid of their presence. No anomalous activity has been recorded within or around SCP-4115 after this event. Recordings of the entrance to the cavern during the incident do not show SCP-4115-01 escaping off-site, and its whereabouts are currently unknown. SCP-4115 has been reclassified as Neutralized for the time being. Efforts are being made to gradually reopen the cavern to the public, with its long period of closure being covered as repairs to the structural integrity of the tunnels. Observation of the area around SCP-4115 for any sign of SCP-4115-01 is ongoing.
Footnotes
1. Similar to flesh being dissolved by hydrochloric acid.
2. SCP-4115-01 has demonstrated that it is capable of closing cavern walls rapidly and warping features of the cavern at will.
3. Review of the footage confirms that the D-Class were put under SCP-4115's influence as well, likely when they initially entered the cavern after Specialist █████.
|
SCP-2552 is a 14 year old multiethnic male (Han Chinese and African American primarily) known as "Kevin Sanders".
|
***
Item #: SCP-2552
Object Class: Euclid
Special Containment Procedures: SCP-2552 is currently contained in a standard humanoid containment unit located at Site-17. SCP-2552 is to be fed three meals a day and is allowed fluids upon request. Personnel delivering food or fluid to SCP-2552 are not to interact with it. SCP-2552 is to be allowed access to recreational activities upon request in exchange for cooperative behavior, as well as paper and crayon to make requests. SCP-2552 is to be interviewed on a weekly basis by Dr. Lin. More frequent interviews may be granted upon request, depending on continued cooperative behavior and Dr. Lin's schedule. Interviews with SCP-2552 are to be accompanied by one other personnel of any level. These personnel are not to interact with Dr. Lin during the interview and are not to interact with SCP-2552 at all.
Should Dr. Lin be permanently unavailable, SCP-2552 is to be notified of this in writing so it may prepare to familiarize itself with the replacement. Potential replacements must fit criteria detailed in Document-2552 and follow familiarizing methods as detailed in Protocol 2552. The personnel selected for replacement is encouraged to maintain a cordial relationship with SCP-2552 in order to better study it. However, care must be taken to maintain SCP-2552's ignorance of the Foundation and other Groups of Interest.
Description: SCP-2552 is a 14 year old multiethnic male (Han Chinese and African American primarily) known as "Kevin Sanders". SCP-2552 displays no physiological abnormalities. SCP-2552 is fluent in both Simplified Chinese (Mandarin dialect) and American English.
SCP-2552 is incapable of perceiving humans it is unfamiliar with. Instead, SCP-2552 perceives a specific entity referred to as SCP-2552-A in the place of any humans it is unfamiliar with and will perceive multiple identical iterations of SCP-2552-A if interacting with multiple unfamiliar humans. SCP-2552-A is only able to be visually recorded if SCP-2552 is using the equipment with the intention of filming SCP-2552-A. SCP-2552-A varies its appearance and appears to be sapient. SCP-2552-A will vaguely mimic the actions of the human it is replacing but will purposefully exaggerate movements and facial expressions with the apparent intention of encouraging SCP-2552 to avoid human contact. The most reliable way to communicate and gain familiarity with SCP-2552 is to converse through writing.
Currently, SCP-2552 perceives every other human it has met as SCP-2552-A with the only exception being Dr. Lin, who developed the currently-used method of gaining familiarity with SCP-2552. SCP-2552 is highly cooperative with Dr. Lin; it is believed that SCP-2552 is dependent on Dr. Lin for emotional support and fulfillment of social needs.
Interview 2552-012
Interview 2552-012
Date: December █, 20██
Interviewee: SCP-2552
Interviewer: Dr. Lin
Notes: This interview is the first interview in which SCP-2552 was able to discuss SCP-2552-A with Dr. Lin in significant detail. The process of providing an unfamiliar human for SCP-2552-A to be perceived had not yet been implemented in order to allow SCP-2552 a feeling of safety with Dr. Lin. SCP-2552 had been provided with writing material in the case it becomes too anxious to speak. Dr. Lin has been granted temporary permission to freely use SCP-2552's name in order to foster a cordial relationship with SCP-2552.
[BEGIN LOG]
Dr. Lin: Good afternoon. How are we doing today?
SCP-2552: [SCP-2552 chews on sleeve for a period of approximately three seconds.] [indistinct mumbling]
Dr. Lin: I'm afraid you will have to speak up for me to be able to hear you.
SCP-2552: Have you figured out what's wrong with me yet?
Dr. Lin: Unfortunately not. We'd need more information about the entity you see in order to be able to help you, Kevin. Do you think you could do that for me today?
SCP-2552: I think so. I call her Susana. She has a real name but it hurts too much to think about.
Dr. Lin: When did you first begin seeing Susana?
SCP-2552: Maybe when I was 6 or 7 I had an imaginary friend I called her Susana. Back then I would pretend that some random strangers I see were Susana just pretending to be people and it was a fun game like hide and seek with her. My mom thought it was cute and encouraged the strangers to play along. Somewhere along the line, I dunno maybe six and a half that things started getting weird.
Dr. Lin: Would you mind explaining further?
SCP-2552: I noticed when I was really little some people weren't like me pretending that they were her. They were really her. I remember having a big argument with her, because it was really inconvenient that I was trying to buy ice cream from the ice cream truck and she showed up and started talking to me. I think I told her I knew she wasn't real and told her I wasn't gonna pretend her into people anymore. Then, then she started getting mad and and-[SCP-2552 begins to cry.]
Dr. Lin: Do you want to stop now?
SCP-2552: [SCP-2552 shakes his head.] She disappeared for a while after that. I didn't try to pretend her into people anymore. I think after my tenth birthday I saw her again at the park. Maybe she was a homeless man or something but she looked up and grinned and her grin was, was really disturbing. Too big. Reached up to me and asked for change but the voice was all messed up. I got scared and ran back and, and after a while she kept showing up, more and more often until she was- she was everywhere. She was everyone. People wouldn't believe me, so I, I got pictures o-on my phone… Then you people came along…
Dr. Lin: It's okay now, Kevin. We're going to fix this, I promise.
SCP-2552: Please hurry. I miss my mom. I miss my friends. I miss everything.
Dr. Lin: We'll do our best. When you've calmed down enough I'll take you to your room, ok? [Dr. Lin reaches over to squeeze SCP-2552's hand in a reassuring manner.]
[END LOG]
Interview 2552A-01
Interview-2552A-01
Date: March █, 20██
Interviewee: SCP-2552-A
Interviewer: Dr. Lin
Notes: SCP-2552 was given a blindfold for this interview and was requested to hold recording equipment in order to conduct the interview with SCP-2552-A. The recording was available to Dr. Lin in real time to allow her to react to SCP-2552-A appropriately. This was the first attempt at establishing contact with SCP-2552-A, taking the place of D-7220 at the time of interview.
[BEGIN LOG]
Dr. Lin: Hello. Can you understand me?
SCP-2552-A: [SCP-2552-A appears to be a humanoid mass of Brachyceran fly larvae, commonly known as maggots, with a lamprey mouth in place of a human mouth. Several of the larvae shrivel and blacken, forming into a 'YES'. SCP-2552-A continues communicating in this manner.]
Dr. Lin: [Dr. Lin pauses for ten seconds upon viewing the recording.] Do you know where you are right now?
SCP-2552-A: YES. YOU ARE A FRIEND.
Dr. Lin: Are you aware of your influence on SCP-2552?
SCP-2552-A: I DON'T WANT TO DIE. YOU KNOW? I'VE BEEN THERE. TO NOTHING.
Dr. Lin: I do not understand. Would you be willing to explain?
SCP-2552-A: YOU CAN'T BLAME ME. YOU WOULD DO THE SAME. IN MY POSITION. YOU CAN'T BLAME ME. I'M NOT BAD.
Dr. Lin: I'm not blaming you for anything, SCP-2552-A. I only want to understand.
SCP-2552-A: I DON'T MEAN. TO HURT HIM. I JUST WANT TO LIVE TOO. IS THAT SO MUCH TO ASK? [SCP-2552-A appears to tilt its head back and its facial area splits in half. Greenish slime is produced from the resulting hole. This movement coincides with D-2270 leaning back and yawning.]
Dr. Lin: Please calm down. I am not going to hurt you.
SCP-2552-A: I WANT TO LIVE. I WANT TO LIVE. I JUST. WANT TO LIVE. I AM NO K[illegible]. I CANNOT SIMPLY. LEAVE A STORY. THAT NO LONGER SUITS ME.
Dr. Lin: Could you explain further?
SCP-2552-A: THERE IS NO POINT. I JUST. WANT TO LIVE. [SCP-2552-A refuses to answer any other questions.]
[END LOG]
|
SCP-3815 is a human female of Icelandic nationality by the name of Elena Bell.
|
***
Item #: SCP-3815
Object Class: Euclid
Special Containment Procedures: SCP-3815 is currently housed on a clandestine farm in ██████, Utah, under the visual supervision of three female, Level-2 personnel, trained specifically to counter its anomaly. Once a month a courier from Site-11 is to be dispatched to the location to resupply the group with amenities as needed. SCP-3815 is allowed free roam around the property during daylight hours provided an escort, and limited television and internet access dependent on good behavior.
Description: SCP-3815 is a human female of Icelandic nationality by the name of Elena Bell. Subject is 20 years of age, stands approximately 1.5m tall and weighs 46kg.
SCP-3815 is an entity whose immediate location is solely dependent upon being in the sightline of the nearest human being, disregarding itself. If visual contact of the subject is severed by prolonged blinking or sufficiently obscured by any means, SCP-3815 will spontaneously materialize into view of the nearest living individual including its clothing and any untethered objects it may be holding at the time.
Subject does not appear to be in control of this phenomena as relocation occurs regardless of its will, disposition, or state of consciousness.
According to SCP-3815’s own testimony this anomaly began manifesting five days after its 20th birthday, following its mother’s passing. If it is to be believed, interviews suggest there might be a correlation between the two events, though the actual cause remains unknown.
Any further experiments involving SCP-3815 have been discontinued following Incident SCP-3815-08, in which line of sight testing caused the subject to partially materialize into a concrete wall where the nearest researcher was focusing, resulting in a small crater and substantial spinal injury for SCP-3815. Any new relevant information denoting a change in relocation behavior or circumstances involving significant harm brought to the subject are to be documented and logged by assigned personnel at the time.
Addendum 3815-01: Any abandoned parts of the subject’s physiology including locks of hair, fingernail clippings, skin scrapings, saliva, blood samples, and bodily waste products no longer possess the line of sight anomaly.
Addendum 3815-02: Experimentation with mirrors, reflective surfaces, and live camera feeds reveal that an indirect line of sight is sufficient to prevent dematerialization and relocation of the subject. In addition, complete obscuration is required for a line of sight relocation to occur; so long as the subject’s perceived outline is still visible the subject remains in place. This may also help to explain why typical blinking patterns by observers does not trigger the anomaly, as perception seems to take precedence over actual line of sight. Utilization of mirrors and translucent curtains in subject’s residence to allow ease of containment and privacy have been approved.
Interview Log 3815-3
– hide block
Interviewer: Dr. Elijah Rhalli
<Begin Log>
Dr. Rhalli: Good morning, how are you feeling today, 3815?
SCP-3815: Just call me Elena. You know my name. Half the people on site do since I’ve been bouncing around here.
Dr. Rhalli: Your anomaly appears very inconvenient for you.
SCP-3815: I can’t even sleep without someone gawking at me, though… if I’m being honest it is rather relaxing being able to stay in one place for a couple of hours.
Dr. Rhalli: We’ve established chaperones to help in that department. We want to make sure you are comfortable.
SCP-3815: After the last experiment you conducted I should hope so. I don’t want to get slammed into any more walls, thank you. The company isn’t bad, I’m just not used to so much of it.
Dr. Rhalli: That’s understandable. You said you lived alone with your mother?
SCP-3815: Ah, now we are getting into the Freudian shit. Yes, I lived with my mother. I took care of her and paid our bills. Life was simple.
Dr. Rhalli: Do you think her death triggered you in some way? Did you mourn her loss?
SCP-3815: Of course I did. What, you think she had something to do with my current condition? She wasn’t a witch. She could barely move or speak.
Dr. Rhalli: She was stricken with cystic fibrosis, correct?
SCP-3815: Yes, and early on-set Alzheimer’s. She was a wreck in the end. Can we get back to my condition?
Dr. Rhalli: But of course, do you have any education on or understanding of quantum mechanics, or perhaps the Von Neumann-Wigner interpretation1?
SCP-3815: Is that some sort of universal source code or something? I just want to stop teleporting.
Dr. Rhalli: It's more of a theory about the presence of consciousness being required for existence.
SCP-3815: You're way off.
Dr. Rhalli: Then maybe you could enlighten me.
(SCP-3815 reclines in its chair, crosses its arms, and remains silent. After one minute elapses, Dr. Rhalli resumes speaking.)
Dr. Rhalli: We might be able to afford you more freedom, in exchange for your continued cooperation.
SCP-3815: (sighing) I don’t know anything about quantum mechanics, but my mother did say something to me the day before she died, and I woke up on my neighbor’s kitchen table while he ate breakfast. Just… promise me you won’t dig her up or anything.
Dr. Rhalli: What did she say?
SCP-3815: It was the clearest thing she had said in three years. She said… she was sorry I didn’t have a social life because of her. She said she was sorry I didn’t get to go to college because all the money went to her disease. She said that just looking at me was the greatest feeling in the world, and that when she died she hoped that someone would always look after me. I guess… the universe took her too literally on that.
<End Log>
Footnotes
1. An interpretation of quantum mechanics in which consciousness is postulated to cause a collapse of the wave function.
|
SCP-327 is a female specimen of a mammalian species resembling members of the order Sirenia, specifically Trichechus manatus (West Indian manatee), measuring approximately 2.
|
***
Item #: SCP-327
Object Class: Euclid
Special Containment Procedures: SCP-327 is to be contained within a 40m x 40m x 10m salt water tank within Site-██. The tank is to be cleaned on a weekly basis, or immediately after an algal bloom event. The walls of the tank are to be soundproofed. All staff interacting with SCP-327 or entering the containment are to wear sound-cancelling headphones when not in direct conversation with SCP-327. Any staff who report suffering the effects of SCP-327’s properties are to be removed from active duty until cleared by a staff therapist.
SCP-327 is to be fed 15kg of lettuce and assorted leafy vegetables each day, accompanied by appropriate nutritional supplements.
English language instruction for SCP-327 has been approved, to be carried out by Drs. Amberly and Watson. Two hours per day have been allotted for this purpose.
Description: SCP-327 is a female specimen of a mammalian species resembling members of the order Sirenia, specifically Trichechus manatus (West Indian manatee), measuring approximately 2.8 m in length and 450 kg in weight, and estimated to be between 25 and 30 years of age. The subject bears anomalous bodily features: The flippers bear distinct fingers and a functioning opposable thumb, and the skull and facial features resemble that of a human. SCP-327 was hit by a boat propeller 5-10 years before retrieval, as evidenced by heavy scarring on the head and back and traces of severe head trauma.
SCP-327 is sapient and capable of speaking simple English sentences, though it experiences significant difficulty in doing so, both in pronunciation and comprehension of concepts.
SCP-327’s anomalous effect is based around its primary vocalization, taking the form of songs similar to that of cetaceans. These vocalizations are regarded as highly unpleasant to listen to, and will result in severe headaches and audio-visual hallucinations in humans, persisting for 6-12 hours. Those affected will often report claustrophobia, an aversion to water and aquatic animals, and occasionally sensations similar to that of drowning. Other mammals will experience the same effects.
During vocalizations, algae and plankton within approximately a kilometer of SCP-327’s location will reproduce at incredibly high rates: the resulting algal bloom will cause considerable oxygen depletion and neurotoxin levels in the area and causing mass die-offs of local fish and mollusk life. There are no anomalous properties present in the algae itself, and SCP-327 is immune to all effects caused by its vocalizations.
Interviews with SCP-327 have revealed few concrete details of its origins, due to the specimen's inability to adequately express the information. SCP-327 has implied the existence of other specimens of the species to live in the Gulf of Mexico and the Caribbean Sea: however, no anomalies resembling the descriptions have been reported.
Addendum-01: Recovery Log: SCP-327 was recovered in August of 2008, after a series of inexplicable mental illnesses amongst citizens of [REDACTED], Florida and reports of unexplained noises in the area. The area had been under Foundation watch for two weeks before it was reported that a “mutant” manatee had been washed ashore by Tropical Storm Fay. After investigation by Foundation agents, amnestics were distributed to the local populace and the specimen was recovered without incident.
Addendum-02: Interview Excerpt ██/██/20██.
For purposes of readability, SCP-327’s accent has been corrected in this transcript.
Dr. Amberly: Hello, 327.
SCP-327: H’lo, Docter Ambry. Three-Twenty-Seven ready to answer questions again.
Dr. Amberly: Very well. We were talking about the song yesterday: Could you tell me more?
SCP-327: Yes. Song for fish and animals. Song for plants. Song for people. Song for home. Song is good. Song not like this [SCP-327 hums for three seconds]. Song not like words. Song is Song. Song make things good. Song not good now.
Dr. Amberly: And what happened to the song?
SCP-327: [Low rumbling noise in imitation of a motor] made it bad.
Dr. Amberly: The boat, then.
SCP-327: Yes. It is okay though. Bad song not hurt animals here. You and Watson help Three-Twenty-Seven get good song back.
|
SCP-3058 is a small jar of black ink.
|
***
Item #: SCP-3058
Object Class: Safe
Special Containment Procedures: SCP-3058 is to be kept in a Standard Containment Locker at Site-73. Testing must take place in a chamber no larger than 30 m3. Test personnel must be subjected to psychological analysis before being allowed access to SCP-3058. Subjects suffering from schizophrenia, body-dysmorphic disorder, or borderline personality disorder should not be considered for testing. The host of an SCP-3058-A instance is not to be allowed to expire under any circumstances.
Description: SCP-3058 is a small jar of black ink. The chemical composition of SCP-3058 is 86% water, 10% carbon, 3% avian genetic material, and 1% [REDACTED]. Despite being composed mostly of water, SCP-3058 absorbs 99.8% of incident light. When a human being uses SCP-3058 to produce marks on a surface, an incorporeal humanoid figure (SCP-3058-A) will appear 5 meters directly behind them. SCP-3058-A will always remain in the same position with respect to the subject’s center of mass. The subject will betray no awareness of SCP-3058-A until notified, or until accidentally catching sight of it.
The appearance of SCP-3058-A will vary in accordance to the self-conception of the subject. No two subjects produce identical instances of SCP-3058-A, and the same subject may produce vastly different instances over the course of only a few hours. SCP-3058-A instances may change shape or size while being observed, but must always remain entirely within direct visual contact with the subject, limiting the size of the instance to the edges of the testing chamber. SCP-3058-A will disappear exactly 10 minutes after the subject stops using SCP-3058. Furthermore, if SCP-3058 is used to communicate a coherent concept, subjects will experience vivid lucid dreams following the usage of SCP-3058. Subjects report the ability to exert full control over the narrative, setting, and characters within the dream.
SCP-3058-A instances are incorporeal and therefore unable to physically injure or damage Foundation personnel or property. Testing has also failed to reveal any anomalous psychological effects from SCP-3058-A. However, awareness of SCP-3058-A may cause unusual behavior in test subjects. Most commonly, this behavior involves revulsion to the instance and strong feelings of self-loathing. In extreme cases, this may result in self harm or suicide. It is unknown whether this effect is anomalous, or a natural reaction.
Addendum 3058-1: Recovery
SCP-3058 was found in a novelty shop in Marion, North Carolina, after numerous reports of insanity in the staff and customers. After seizing all shop assets under the guise of criminal investigation, it was determined that the only items of anomalous nature were SCP-3058 and SCP-3025. SCP-3058 was moved subsequently moved to Site-73 and contained. A connection to SCP-3066 is suspected, but unconfirmed.
Addendum 3058-2: Test Video Logs
All tests took place in a cleared test chamber with a desk, fountain pen, and paper. Tests are supervised via video camera and speaker.
Test #: 1
Subject: D-619241, incarcerated for several counts of homicide and extortion
+Show video log for Test 1
- Hide log
[BEGIN LOG]
Supervisor: How are you feeling today, D-6?
D-619241: Okay, I guess.
Supervisor: Then let’s begin. Do you see the jar of ink on the table in front of you? Please remove the lid and dip the provided fountain pen in the ink.
D-619241: Thanks for the step by step. Real helpful.
Supervisor: Just part of the procedure.
D-619241: I see you gave me a piece of paper. Do you want me to write or something?
Supervisor: Yes, D-6. Feel free to write whatever you want.
D-619241 proceeds to scribble on the paper. A 3-meter-tall instance of SCP-3058-A appears 5 meters behind D-619241. The instance is dark, with leather-like skin and large eyes. Test supervisor expresses shock.
Supervisor: That’ll be enough for now, D-6.
D-619241: What’s up?
Supervisor: Do not be alarmed. Please stand up and turn around.
D-619241 complies and expresses severe shock and agitation. The SCP-3058-A instance becomes smaller and paler.
D-619241: What the hell is that!
Supervisor: I’m not quite sure. Please remain calm and continue observing the entity.
D-619241 complies and remains silent. SCP-3058-A returns to its original form, and begins to grow bony protrusions across its body. Ten minutes later, SCP-3058-A disappears.
D-619241: Where’d it go?
Supervisor: Again, I’m not sure. Please wait while our analysts make sure the chamber is safe.
D-619241: I was just starting to like it, too. Hey, could I go and…
Supervisor: Do not touch SCP-3058. Non-compliance is grounds for termination.
D-619241: Okay, okay! I got it.
Supervisor: Alright, that will conclude Test 1. Please exit the test chamber.
[END LOG]
Test #: 2
Subject: D-591032, incarcerated for second-degree murder
+Show video log for Test 2
- Hide log
[BEGIN LOG]
Supervisor: Good morning, D-5. Please use the pen and ink in front of you to write something on the paper.
D-591032: Yes sir.
D-591032 proceeds to write his own name. A 1-meter-tall instance of SCP-3058-A appears 5 meters behind him. The instance is contorted, with several broken limbs. One of the eyes is significantly larger than the other.
Supervisor: That’s good, D-5. Now please stand up and walk backward.
D-591032: Excuse me?
Supervisor: Please follow my instruction.
D-591032: Okay…
D-591032 complies. SCP-3058-A moves backward at the same rate. It is believed to be tethered to the subject’s center of mass. The instance eventually disappears into the wall of the test chamber.
Supervisor: Please stop.
D-591032 complies. The expected position of SCP-3058-A, outside of the test chamber, is empty.
Supervisor: Now walk forward.
D-591032 complies. SCP-3058-A emerges from the test chamber wall. It appears to be limited by line of sight with the subject.
Supervisor: Please jump upward.
D-591032 complies. SCP-3058-A moves upward as expected.
Supervisor: That’ll be enough. Please wait…seven minutes, then you’re free to leave the test chamber.
D-591032: Sounds good.
D-591032 sits down, then gets up and begins to pace. He quickly catches sight of SCP-3058-A.
D-591032: Oh god, what’s that?!
Supervisor: Do not be alarmed. It can’t hurt you.
D-591032 tries to move toward SCP-3058-A, but is unable to get within arm’s reach.
D-591032: Why is it so ugly? What the fuck is it?!
Supervisor: I repeat, please remain calm.
D-591032 cover his face with his hands. The SCP-3058-A instance mostly disappears, except for a small part of the “leg”, which is presumably uncovered from D-591032’s perspective.
D-591032: Can’t you make it go away?!
Supervisor: We believe it will disappear in about six minutes. If you pretend it doesn’t exist, it won’t hurt you.
D-591032: It looks like ██████ after I…I…just make it go away, please, please.
Supervisor: I cannot.
D-591032 removes his hand and regards the instance. He retreats to a corner of the test chamber and enters the fetal position on the floor, facing away from SCP-3058-A.
D-591032: This is sick. Sick. Sick.
Supervisor: Again, if you remain calm this will pass quickly.
D-591032: There’s nothing I could do, okay!! Stop staring at me! STOP!
D-591032 remains silent for the remainder of the test, and fails to leave the test chamber after SCP-3058-A disappears. He is removed forcibly by Foundation personnel. The following night, D-591032 reports having had a lucid dream.
[END LOG]
Test #: 3
Subject: D-436190, incarcerated for political crimes, no known psychological issues.
+Show video log for Test 3
- Hide log
[BEGIN LOG]
Supervisor: Good evening. Please take the pen and ink on the desk in front of you, and make some marks on the surface of the desk.
D-436190: That’s quite an unusual request.
Supervisor: This will all be much easier if you just do as I say.
D-436190: I suppose it would.
D-436190 draws a stick figure. An instance of SCP-3058-A appears. It is a recognizable image of D-436190, with a few minor changes. The nose and ears are larger than those of D-436190, and the chest and shoulder are wider.
Supervisor: That’s good. Please take a seat and wait for further instructions.
D-436190: As you say.
D-436190 complies and waits 10 minutes. SCP-3058-A demanifests without the subject’s knowledge.
Supervisor: You'll now be escorted out for some…preparation.
D-436190 follows armed personnel out of the test chamber and is subjected to 45 minutes of psychological torture. The subject is repeatedly told that his efforts during the Nepalese Civil War would be ultimately fruitless, and that history would remember him unkindly, if at all. The subject is then reintroduced to the test chamber.
Supervisor: I hope you're well rested. Please use the pen and ink to make a mark on the wall of the test chamber.
D-436190: Why are you doing this to me?
Supervisor: Please comply.
D-436190: You are pigs!!
Supervisor: Refusal to comply is grounds for termination. Or would you prefer you go back outside for another two hours?
D-436190: I’ll do it, you bastard.
D-436190 makes a small mark. SCP-3058-A reappears. It is now about 1 meter tall and looks pallid. The eyes are tired and the body is much thinner and bonier.
Supervisor: Thank you. Please sit down. The test will end in about ten minutes.
D-436190: Will there be any more…
Supervisor: No. We are done. I'd like to assure you that your treatment during this test was for the greater good.
D-436190: I spit on your greater good.
D-436190 complies, and remains silent for the remainder of the test. SCP-3058-A disappears as expected. The following night, D-436190 reports having had a lucid dream.
[END LOG]
Test #: 4
Subject: D-436192, incarcerated for political crimes, a known schizophrenic.
+Show video log for Test 4
- Hide log
[BEGIN LOG]
Supervisor: Greetings, D-4. Please use the pen and ink to write something.
D-436192: Why should I?
Supervisor: Don't worry. Nothing will happen to you.
D-436192: And why should I trust you?
Supervisor: Because I have nothing but your best interest in mind. Now, please, write something.
D-436192: What if I don't?
Supervisor: Then you will be terminated for noncompliance. It would be much more pleasant for all of us if that didn't have to happen.
D-436192: Okay…
D-436192 sketches a tree, and becomes engrossed in the activity. An instance of SCP-3058-A appears. It changes size and shape continuously, with few recognizable features. The exception is two very large eyes with red irises, focused on the subject. D-436192 is not disturbed, so as to facilitate observation of SCP-3058-A.
D-436192: You know, I was expecting something worse. This is pretty nice.
Supervisor: It’s good to hear that. Please continue at your leisure.
SCP-3058-A continues to exist past the 10-minute mark. It is believed that final use of SCP-3058 determines demanifestation time.
D-436192: Okay, I think I’m done.
Supervisor: No, please return to your seat…
D-436192 notices the SCP-3058-A instance, and pauses. She then begins to pace around the test chamber. D-436192 remains silent.
Supervisor: Please remain calm…
D-436192 continues to pace. She eventually wanders to the center of the chamber and sits down. She looks back at the camera.
D-436192: That’s a bad mirror.
D-436192 then clutches the fountain pen and repeatedly perforates her eye sockets with the nib. Foundation personnel are mobilized to stop her, but she expires before help can arrive. SCP-3058-A [DATA EXPUNGED]
[END LOG]
|
SCP-3136 is a Mercator projection world map1 that measures approximately two meters by three meters in area; it lacks symbols, or identifying marks of any kind.
|
***
Item #: SCP-3136
Object Class: Safe
Special Containment Procedures: SCP-3136 is to be stored within the document tube it was initially found in. The document tube and SCP-3136 are to be locked in a secure, lead lined case. The case may only be unlocked by researchers involved with SCP-3136, or by O5 authorization.
Description: SCP-3136 is a Mercator projection world map1 that measures approximately two meters by three meters in area; it lacks symbols, or identifying marks of any kind. Upon adding any marking inside a body of water, SCP-3136's anomalous property activates. An aquatic organism matching the dimensions of this marking — designated as an instance of SCP-3136-1 — will manifest at the corresponding geographical location of this marking. The instance will manifest proportionally smaller by a factor of ██. The figure's position on the map shifts to reflect the instance's current location. Once this instance dies, the drawing immediately vanishes; until this occurs, all attempts to mark or draw upon the map will fail.
Instances of SCP-3136-1 are aquatic organisms that possess fully functioning organs. When removed from the ocean, these organs immediately fail. These organisms do not have to exist to be created, as SCP-3136 will add suitable organs according to the needs of the instance.
Recovery: On February 18th, 2016, an SCP-3136-1 instance was discovered off the coast of Australia. Prior to this, Foundation web crawlers flagged a video SCP-3136 posted to Facebook by a student at Loyola Marymount University, California. The video showed the anomalous property in which markings disappear from the map paper.
SCP-3136 was recovered from the home of one Dr. Adebagbo, a professor of history and cartography. The link to SCP-3136-1A was discovered due to the lobster symbol moving in tandem with SCP-3136-1A.
Testing Logs:
Artist
Artist's Depiction
Test Results
Containment/Death
Dr. Adebagbo
A small black creature comparable to a lobster with 10 legs. Drawn with an antique ink pen
30m jet-black lobster devoid of irregularities.
Suffered from total organ failure during transfer to a Foundation secure facility.
Class-C Personnel
A small circle with fins and a mouth, drawn in an oceanic net in Foundation Site-1028. The drawing was done with a sharp pencil.
Imperfectly spherical creature with seal-like skin, and was 5 meters in diameter.
Died of total organ failure 16 days after creation.
Class-C Personnel with artistic experience
Researcher had artistic experience and reference pictures of blue whales. Picture appeared to be a perfectly proportional blue whale. Drawn with an outline pen and colored pencils.
Blue whale with an exoskeleton composed of chitin. Has massive shape irregularities when compared to a regular blue whale.
Harpooned multiple times to see the effect of premature death on SCP-3136-1 instances. After slight vocalizations,SCP-3136-1C died and disappeared from the map. SCP-3136 could not be drawn on afterwards for approximately 11 days.
Class-C Personnel with artistic experience
Two near-identical squids, a male and a female. Drawn with dull pencil.
Two squids at half the expected size. One complete set of squid organs was evenly distributed between the two instances.
Died upon creation due to lack of vital organs.
Class-C Personnel
Drawn by a Foundation researcher. Instructed to draw a straight line on SCP-3136 within the containment area. Drawn with a permanent black marker.
A 44 meter long eel-like creature with a chitinous shell that rendered it immobile. SCP-3136-1F possessed shape irregularities corresponding to inaccuracies in the Mercator projection.
Died of malnourishment within a week due to its inability to eat and lack of Foundation assistance. SCP-3136 could not be drawn on for 7 days afterwards.
Mechanical Arm
Whale that conforms to map distortions as calculated by researchers. Drawn with blue crayon.
Large whale-like creature, with skin similar in composition to that of a gorilla, and thick blue fur. Displays intelligence and is taught to answer polar questions.
Has survived in containment for 2 months. Is to be fed via food dispenser triggered by SCP-3136-1G. Researchers are not to attempt Skinner box experiments upon SCP-3136-G due to aggression. MTF-Theta-7 ("Whale Watchers") are to be armed with specially manufactured tranquilizer darts and are to avoid causing the instance harm in any way.
Footnotes
1. The Mercator projection is a common map projection in the early days of cartography which is infamous for distorting the sizes of landmasses relative to their real-world sizes. Large oceans tend to remain relatively undistorted.
|
SCP-4641 is a modified version of the Cluedo1 board game.
|
***
Item #: SCP-4641
Object Class: Keter
Special Containment Procedures (pending review): SCP-4641 must be kept in a secure containment locker. Personnel who are experienced with probability, chance, and evidence-based deduction are to play SCP-4641 every 4 weeks, with the amount of participants adjusting to the instance provided. Players are not to cheat, nor attempt to break the rules in any way.
Description: SCP-4641 is a modified version of the Cluedo1 board game. In the game, players must find hints and use the process of elimination to discover who is responsible of the murder of an unknown victim. SCP-4641 contains a different board, characters, and item tokens every time it is opened, with names corresponding to real-life locations and people. Each new instance of SCP-4641 corresponds with a murder attempt taking place two weeks in the future.
If the game is won, an event similar to the one described in the game will happen in reality, though the murder would have been narrowly avoided, due to either luck or interference from a third-party. But if the game is lost or is halted for more than 7 minutes, the event will play out as described in-game. Achieving the win condition varies widely in difficulty, due to the varying size of the board and the number of locations, items, and characters.
Cessation of playing SCP-4641 for a length longer than 5 weeks results in a slight but noticeable rise in global violent crime rate, particularly in Cairo, Egypt. Attempts to cheat, purposefully lose, or automate SCP-4641 with limited AIs have failed, with each attempt leading to a fail-state and also increasing the violent crime rate. Playing a full game of SCP-4641 immediately halts the increase and lowers it to its normal level.
Test Log:
Number of Instance
Date
Description
Game Length
Outcome
001
07/03/1975
Game board resembled Lansing, Michigan, with buildings acting as the "rooms". There were a total of 35 characters, and 129 items.
7 hours
Game Lost. Investigation revealed that two weeks later, Jeanine Oswalt was strangled to death by her ex-boyfriend, using a length of rope.
029
09/14/1976
Game board resembled a small alleyway, with only 2 "rooms", 5 characters, and 4 items.
45 minutes
Game Won. Investigation revealed that a Carlos Garcia in Camargo, Mexico narrowly escaped a stabbing by cartel members.
058
01/12/1979
Game board resembled a New York City block, with 12 "rooms," 28 characters, and 19 items.
3 hours
Game Lost. Two weeks later, Nelson Rockefeller2 died of poisoning via wolfsbane from his aide, Megan Marshack.
087
05/01/1981
Game board resembled the Vatican City, with the only rooms being "Pope's Quarters," "The Square," and "The Alley." 46 characters, and 53 items
15 hours
Game Won. Pope John Paul II narrowly survived four gunshot wounds from Mehmet Ali Ağca.
234
03/14/1995
Game board resembled Site-19, with "rooms" corresponding to containment units. Each character was a researcher, and the items were all lethal SCPs contained within Site-19.
4 hours
Game Won. Senior Researcher Jason ████ narrowly escaped SCP-████ during a containment breach. It was revealed that cooperation between players is not considered cheating.
378
10/09/2005
Game board resembled a warehouse within Three Portlands. There is only one room, hosting what is believed to be a time machine. All 9 characters were identical, and there were 9 identical murder weapons.
5 minutes
Game Won. Due to the game being seemingly unwinnable, a player accused a character at random, leading to a win-state. Grandfather paradox potentially avoided.
713
06/31/202█
Gameboard was 3 x 3 meters2, and resembled depictions of the Egyptian Underworld. Set, Horus, Bes, and Sekhmet were among 253 playable characters, along with 752 items, most of which were unfamiliar to players, but were later identified as mummification tools.
23 hours
Game Lost. Over the next several months, Egypt was stricken by multiple droughts, with the River Nile dropping to its lowest level in over 120 years. The agricultural sector, which makes up 14% of Egypt's GDP, went into a severe recession. Estimated total cost in damages: $45 billion. Based on the rate of EVE accumulation within the Nile River, the Archon-Class Type-V reality bender that inhabited the Nile should reform within the next 10 years.
Addendum 4641.1: Following several tentative tests on SCP-4641, it has been concluded that SCP-4641 possesses little to no precognitive nor predictive abilities. Rather, SCP-4641 possesses the capability to mildly influence the behavior of others, with no known range, based on the outcome of the game. As the victims of SCP-4641 are randomly chosen, and there is no way to predict nor prevent SCP-4641 being complicit in the murder of those who maintain the Veil, or in (even temporarily) assassinating anthropomorphized concepts of nature, current containment procedures for SCP-4641 are considered to be unsatisfactory, and must be updated with all due haste.
Footnotes
1. Known as Clue in North America.
2. Vice President under Gerald Ford.
|
SCP-3817 is a man of European descent, approximately 40 years of age.
|
***
Item #: SCP-3817
Object Class: Safe
Special Containment Procedures: SCP-3817 is to be contained in a standard humanoid residential chamber at Site-███. SCP-3817 is to be restrained in the event it exhibits any sign of physical violence towards itself or personnel.
SCP-3817 is required to have weekly medical examinations. Any major discrepancies in physical or mental health are to be reported to acting senior medical staff on-duty.
SCP-3817 is permitted access to the following:
one 88-key upright piano
one writing desk
stationery
Note: All pens and pencils given to SCP-3817 must be at least 8mm in diameter. No mechanical pencils are allowed.
Minor luxuries such as books may be issued upon approval of the Site Director.
Description: SCP-3817 is a man of European descent, approximately 40 years of age. SCP-3817 claims to be the German composer Felix Mendelssohn (1809-1847). DNA analysis has confirmed this claim to be true.
SCP-3817 was recovered in Leipzig, Germany, on ██/██/20██, following reports of a local vagrant who was allegedly unable to age. Investigations of visual and written records concerning the vagrant have confirmed that it has been physically about 40 years old for the past 1██ years.
Full-body examination has revealed SCP-3817 to have sustained a degree of physical damage that would likely be fatal to a non-anomalous human being. There is currently no scientific explanation to SCP-3817's continued survival despite its critical state of health.
SCP-3817 has confirmed the damage to have been the result of multiple self-mutilation efforts in the 1██ years prior to its containment.
SCP-3817 has claimed that it has no suicidal intent in its self-mutilation. It has also claimed to have experienced no symptoms of suicidal ideation in the past 1██ years. SCP-3817 is currently undergoing psychiatric evaluation to verify the aforementioned claims.
The self-inflicted damages to SCP-3817's body are as follows:
+ View damage log
- Close damage log
Mercury poisoning, resulting in symptoms such as increased heart rate, insomnia, and frequent sensations of pins and needles. SCP-3817 has testified to regular ingestion of mercury compounds over a period of ██ years in the late 19th century.
Lead poisoning, resulting in conditions such as anemia and hearing loss. Further analysis has suggested that the cause of the poisoning to have been deliberate ingestion of elemental lead from around 2006.
Severe cirrhosis of the liver; caused by long-term frequent intake of alcohol. ██% of its liver has been replaced by scar tissue. The degree of cirrhosis is highly likely to result in liver failure; however, SCP-3817's liver is functional, albeit at a severely impaired level. SCP-3817 also suffers from several health problems associated with cirrhosis, such as jaundice, prolonged exhaustion, and buildup of fluid in the abdominal cavity.
Accumulation of scar tissue on the eardrums in both ears, leading to recurrent tinnitus, chronic ear pains, and hearing loss; caused by repeated perforation of the eardrums via insertion of sharp objects into the ear canal. Sounds above 80 decibels in volume are still audible to SCP-3817, however, it is effectively deaf to normal conversation.
Numerous small areas of scar tissue on its palms, legs, abdomen and pelvic region, identified as healed sores from primary and secondary syphilis. SCP-3817 also exhibits symptoms of neurosyphilis, such as mood swings, delusions, and hallucinations. It has also been recorded displaying irrational and obsessive behavioral patterns consistent with those exhibited by sufferers of neurosyphilis. For example, SCP-3817 has been observed obsessively making lists of the ailments of well-known classical composers; it has also been observed engaging in conversation with what it claims to be the spirits of deceased composers. Investigations have concluded these "spirits" to be non-anomalous auditory hallucinations.
Overall, SCP-3817 is in poor health and reports frequent physical pain and emotional distress. Despite its current state of health, SCP-3817 has not made any of the expected requests for termination and has explicitly stated that it does not desire humanitarian euthanasia.
SCP-3817's maintained claim that it lacks suicidal desires has led to speculation that the cause of its biological immortality may be linked to its self-mutilation.
Upon the Foundation's request, SCP-3817 has agreed to provide a written outline of the reasons behind its self-mutilation for further investigation of its anomalous property:
I understand that you wish to know why I have chosen this course of action. My thoughts are unclear and half wild, but I will try to organize them and explain myself to the best of my ability.
[Three lines of script densely scribbled over, completely illegible]
It has been brought to my attention that The Great Composers
Beethoven cramped and vomited and lived in a world of painful silence; Mozart was sickly and miserable and up to his powdered wig in debt; Chopin was endlessly coughing his lungs and his soul out; Schumann saw angels and demons and phantoms and had moods that were as stormy as the literature of his era.
These men were the great composers. They knew how it was like to be exhilarated, they knew how it was like to be in the depths of despair. They knew emotions. Their music changed and shifted and developed and grew with the changes in their lives.
All the great composers endured pain and suffering to fulfill their desire to create. And the results of their effort: timeless masterpieces!
As for me? Happy and fortunate is my first name! I was born into a wealthy family, showered with support and praise and money for my entire life - never did I have to struggle to write music. No other composer experienced such profound insulation from hardship. I never understood genuine misery and misfortune. For the 38 years in which I lived, my music never changed in style or quality, and there is no doubt that my pitifully comfortable existence impeded my artistic development.
And do you agree with me, that the first condition of an artist should be to bear respect towards what is great, and to bow to it and acknowledge it?
Owing to that, I have decided I must acquaint myself with suffering for my own sake. I must never perish, I must endure torment.
I destroyed my hearing so I would never again experience the pleasures of sound, just like Beethoven who went deaf.
Many of my illustrious predecessors such as Schubert, Schumann, and Donizetti suffered from syphilis, so I did what was needed.
So did many of them praise alcohol and become drunkards. I have faithfully followed their practice of drinking excessively, only ceasing when every part of my body cried 'stop, no more.'
I took to living on the streets as a penniless vagrant so I could worry about money, about my safety, about where my next meal was going to come from, as many illustrious composers led their lives in debt or poverty; Mozart and Wagner come to mind.
There were more, and I would have written them down if I could recall them; my memory is regrettably patchy.
However I can say with confidence that I have made significant progress since.
I am always in pain I am in constant pain and I can't even walk a few steps without feeling strange or numb or hurt and I cannot put it into words I do not wish to end this pain. I want to continue living. This is what the great composers endured every day, this is what shaped and grew them and I too must let it be an unavoidable part of my life. They have told me this. They have told me I must not give up in trying to develop myself.
I have since grown accustomed to pain in an endearing, musical way. I understand mankind's greatest sorrows and they are tangible. It has completely changed the way I perceive and comprehend things This is my life now I have emotions now and I am no longer emotionless
I believe I have made great leaps in terms of progress. The heavenly spirits of the late great composers are agreeing with me. I can hear them speak, feel their presence. They are giving me their approval. My time, I am sure, is right now.
I have been writing at great speed A volume of Songs Without Words is nearing completion. I am sure it is not too much to hope that it will satisfy the public as much as it satisfies me it will fulfill it will be to the public's liking it
[Illegible, scribbled-over script for the rest of the note]
P.S. Please forgive me for the cancellations and clumsy writing. I was weary. A poet in me was lost. I offer my sincerest apologies.
Addendum: During the period of its stay at the Foundation, SCP-3817 has written a collection of piano pieces titled Songs Without Words. Musicologists have been tasked to analyze these pieces and compare them to Songs Without Words written by Mendelssohn from 1829 to 1845. No stylistic differences have been detected.
|
SCP-254 is a rectangular wooden plaque measuring 22cm x 30cm and weighing approximately 1.
|
***
Item #: SCP-254
Object Class: Safe
Special Containment Procedures: SCP-254 is to be kept in a standard storage locker when not in use. When in storage, it must be placed face-down on the floor of the locker and secured with straps to prevent accidental activation. Use of SCP-254 may be requested by any department head, and must be approved by at least two (2) level-3 personnel. SCP-254 may not be used in a capacity that will result in SCP-254-1’s contact with SCPs posing a memetic contagion hazard. Under no circumstances is SCP-254 to be active in a single department or area for longer than twenty-six (26) days. Reuse is permitted only if the area in question has undergone a complete personnel rotation (i.e. no employees remain who have had previous contact with SCP-254).
Description: SCP-254 is a rectangular wooden plaque measuring 22 cm x 30 cm and weighing approximately 1.5 kg. On the front of the plaque is an empty brass picture holder, as well as a printed metal plate with a black background and gold-colored letters reading “Employee of the Month.” Affixed to the back of the plaque is a standard hanging device.
SCP-254 was discovered in the rubble of a Texaco gas station in ██████, Kansas, on ██/██/195█. A Foundation agent secured SCP-254 after discovering that it had sustained no damage in the explosion that had leveled the gas station and resulted in the deaths of █ employees and ██ civilians .
When SCP-254 is hung on a wall in a work area of 4 or more people, SCP-254-1 will appear soon afterward. SCP-254-1 will arrive either at the end of the next designated break period, or at the beginning of the following work shift. SCP-254-1 is an incorporeal human of variable gender, age, race, name, and appearance, able to manipulate objects in the manner similar to that of a normal human of average strength and coordination. SCP-254-1 will adopt the appearance and persona of a model employee, based on an area’s memetic consensus. Once SCP-254-1’s appearance has been established, an image of SCP-254-1 that appears to be an 8 x 10 glossy photograph fills the empty picture holder, and it will not change until SCP-254 is moved to a new location. Across the bottom of the photograph, in print, is the newly assumed name of SCP-254-1. The photograph cannot be removed from the picture holder by any known means, but it can be torn or ripped. Doing so in an aggressive or purposeful manner results in a violent reaction from SCP-254-1 (see attached recording SCP-254-a: [DATA EXPUNGED] the ██/██/████ incident).
Regardless of appearance, SCP-254-1 maintains a cheerful demeanor at all times. SCP-254-1 is able to carry on conversations about the weather, traffic, the previous night’s TV shows, sports, and other such topics, although SCP-254-1 will never discuss topics of which present individuals have no knowledge. Personnel assigned to work in an area where SCP-254 is in use do not appear alarmed by SCP-254-1’s incorporeal nature or sudden appearance, stating that SCP-254-1 “works here.” Due to local personnel’s reluctance to remove the plaque, or inability to remember to remove the plaque, removal is to be scheduled and performed by off-site personnel.
SCP-254-1 is capable of performing menial tasks quickly and efficiently. When given tasks that require specialized training, although SCP-254-1 does not possess the required expertise, (s)he will attempt them with the usual good attitude, but will perform as well as an average person could be expected to perform. SCP-254-1 will continue to perform as exemplary an employee as possible for a length of time between 28-46 work days, usually ending at the conclusion of a calendar month. If SCP-254 is placed in a workplace several days into a calendar month, SCP-254-1 will act as an effective employee until the end of the following month, although due to the dangers posed by shifting memetic consensus, no use of SCP-254 for longer than 26 days is permitted.
After the “month” has passed, if SCP-254 is not removed, SCP-254-1 will begin to degrade in performance, beginning with an unhelpful attitude and forgetfulness. If SCP-254 is not removed, SCP-254-1 will become a worse and worse employee until “fired.” Firing can be represented by removing SCP-254 from the wall, or by informing SCP-254-1 of its termination. If SCP-254-1 is fired within approximately 20 days from the start of its decline in performance, SCP-254-1 simply leaves the area and disappears. Following cessation of employment after this point, SCP-254-1 will actively sabotage the work area in the most destructive manner possible, posing severe hazard to any nearby personnel.
And the WORLD, people. We work with SCPs here, and if proper removal arrangements are not made with off-site security and documented with on-site security, the offending employee will find themselves jobless or worse. -O5-█
Addendum: Following Incident 254-0210g, all tests on employing SCP-254-1 beyond 26 days must be conducted at a separate site containing no other SCPs. NO EXCEPTIONS. -O5-█
Audio Log 254-a13:
Dr. █████: “This is Doctor [REDACTED]. This is experiment #13 on SCP-254. I am using a standard phillips-head screwdriver, to attempt to remove the brass fitting from SCP-254.”
[There are 15 seconds of tool-working sounds.]
“It appears that these screws are affixed by means beyond the normal. Perhaps glue, or something else.”
SCP-254-1 (going by “Gus” this iteration): “Would you like me to get you some solvent, sir?”
Dr. █████: “No thanks, Gus, no need. Would you hand me that box cutter? I’ll try cutting this picture out.”
Gus: “Really? Why would ya wanna do that? I think that plaque looks jim-dandy right where it is.”
Dr. █████: “Now now. This isn’t an insult to you, Gus, you’re a great employee. This is an experiment.”
Gus: “Okay, Doc, I trust ya.”
[There is a slight paper ripping noise.]
Gus: “Whacha doin’ Doc? Would ya please not do that?”
Dr. █████: “Just a little bit fur-”
[The audio of the two cuts out, and there are 5 hard banging sounds - presumably SCP-254-1 slamming Dr. █████'s head against the table. Then there is a wet sound as the box cutter is [DATA EXPUNGED].]
-end of tape-
Experiment Log 254-b: Testing on extended employment of SCP-254-1 as a janitor at Sector-██.
Day 26: End of standard employment period reached. SCP-254-1’s performance continues to meet high standards.
Day 32: First sign of performance degradation noted. SCP-254-1 leaves a dirty rag on Research Assistant █████’s desk. Apologetic when rag is noticed and returned.
Day 34: SCP-254-1 is mopping the floor in Sector-███ when a hurrying technician trips over the bucket of cleaning solution. SCP-254-1 recorded cursing at the technician.
Day 35: End of the calendar month. SCP-254-1 described as “sullen” by a late-working researcher. Break room kitchen in Sector-███ left uncleaned, coffee spilled around Dr. █████’s garbage can.
Day 36: SCP-254-1 reprimanded by supervisor for apparent drunkenness. (Note: Very odd; SCP-254-1 has never been seen to eat or drink.)
Day 39: SCP-254-1 fails to return cleaning solutions to the janitorial closet. Near-disaster when mentally disturbed test subject (see Experiment Log [REDACTED]) finds a bottle of ammonia-based cleaner in a bathroom. SCP-254-1 reprimanded for carelessness. Fellow janitor █████ ███████ observed in a verbal altercation with SCP-254-1; both parties are somewhat vague on the cause of the quarrel.
Day 43: SCP-254-1 again observed to be apparently drunk on duty. Cleaning is becoming noticeably more erratic.
Day 48: Fire alarm goes off in Sector-███. False alarm. Ink markers fail to pinpoint a culprit, but SCP-254-1 was observed near the tripped alarm a few minutes prior to the incident. Security footage unavailable due to an unidentifiable object blocking the camera’s view of the hallway.
Day 56: Dr. ████ upbraids SCP-254-1 for removing perishable items from the lab refrigerator and shredding irreplaceable experiment logs. SCP-254-1 calls Dr. ████ [REDACTED] and threatens to [REDACTED]. Security called.
Day 58: Kitchen knife found stabbed deeply into Dr. ████’s whiteboard. Dr. ████’s locked secure document safe has been opened and rifled. Guard posted at the door to Dr. ████’s office. SCP-254-1 and █████ ███████ recorded arguing in raised voices in the staff break room.
Day 59: Janitor █████ ███████ signs in to work, but fails to report to supervisor. Located by accident several hours later trapped in the cold storage rooms attached to [REDACTED] autopsy theater, suffering from severe hypothermia. Guard on duty at Dr. ████’s office incapacitated by a blow to the head; crude human figure formed from a mop head impaled on a broken mop handle driven through Dr. ████’s desk chair. SCP-254-1 nowhere to be found.
Day 60: At Dr. ████’s request, and with approval from [DATA EXPUNGED], SCP-254 removed from the wall. SCP-254-1 leaves the building and vanishes.
Day 61: SCP-254-1 caught on camera in Sector-███ late at night. Power failure and multiple backup system failures cause ██ containment breaches, resulting in ██ direct casualties and ██ further losses from sterilization of an outbreak of SCP-███ (see Incident Report 254-0210g).
|
SCP-1618 is a standard Sanura 400 model urinal manufactured by Armitage Shanks that has been coated with an approximately 0.
|
***
Items Storage on Sector-28. Access to SCP-1618 for purposes of experimentation requires the experiment proposal and risk assessment forms to be approved by a researcher with 2/1618 clearance. Due to extended area of effect, any testing is to be carried out in Test Polygon-2, with the object mounted on its designated stand. During testing, only D-class personnel are allowed to enter the designated effective zone. It is recommended that the meals of D-class personnel designated for SCP-1618 testing are suspended at least two days before the date of the test.
Description: SCP-1618 is a standard Sanura 400 model urinal manufactured by Armitage Shanks that has been coated with an approximately 0.5mm layer of spray-on gold paint. With the exception of the paint coat, and a note (See Addendum 1618-1) found glued on the water supply pipe, the object does not differ from other urinals in the same series, and the testing of samples of gold paint and vitreous china detected no anomalies in their composition.
The anomalous properties of SCP-1618 manifest when a person urinates into the bowl. Approximately 5 seconds after urine comes into contact with SCP-1618, a number of effects occurs in a growing field of effect, starting in the immediate vicinity of the urinal, and increasing to cover a sphere approximately 350 metres in diameter. Except by direct observation of the effects, the affected area can not be distinguished from its surroundings, and the resulting emanation does not appear weakened or stopped by any tested materials, up to and including a lead plate of 25cm thickness.
The effects, as observed during initial containment and testing, have been summarised as follows:
— Valuable items or currency transform into, or are replaced by, an equivalent volume of various refuse. Observed changes include items made of gold and coinage becoming human feces, paper currency becoming toilet paper or sections of fresh pig intestine, and several Armani-brand suits turning into vestments of identical cut composed of used sanitary towels conjoined with dental floss.
— Personal electronics appears to show the greatest spectrum of transformations, with results ranging from inflated pig bladders in the rough shape of the original item, sections of brick, or rusty cans. On one occasion, an █████ brand PDA transformed into segments of depleted fuel rod, resulting in radiation burns to the test subject.
— Most armaments appear to transform into living birds of appropriate size, with most personal firearms becoming pigeons, and tear gas grenades turning into flocks of sparrows. Close contact weaponry transforms into human body sections instead, with a 40cm nightstick turning into an erect human penis of equivalent length.
— Human feces within the area of effect transform into an equivalent volume of solid gold. As this includes fecal matter present in the colon, this often results in an acute mechanical bowel obstruction, and associated sharp abdominal pain, distension of abdomen and vomiting. In the case of timely surgery, the recovery rates appear to be well above 95%, similar to that of bowel obstruction caused by non-anomalous means. In the case of subject's lower intestine being empty, or containing a small amount of feces, the result is likely constipation and bowel irritation.
The transformations appear permanent, while the active effect field dissipates within 30 seconds of the urinal being flushed.
Recovery Log: SCP-1618 was recovered from the executive bathrooms of ███████ ████ Group Inc. (further referred to as company) headquarters, located at ███ ████ Street, New York on ██/██/2011, following a series of protests related to the Occupy Wall Street movement. The Foundation was alerted to the existence of SCP-1618 when a TV recording from a protest site showed a police water cannon turning into four adult Casuarius casuarius (cassowary) specimens, following which a number of protesters, as well as police units, showing signs of distress and clutching their abdomens.
MTF Gamma-5 ("They're on our side, Sir!") was dispatched on-site as a recovery team and damage control. SCP-1618 was located following the interrogation of several protesters and company employees, thorough search of the building, and noting that no urinal resembling SCP-1618 appears to figure within company purchase records. Following recovery, affected subjects were provided medical attention, distributed class-A amnestics, and the entire area was cordoned off under the pretense of SWAT units action due to invalid permit application on the side of the protesters.
Addendum 1618-1:
Note recovered from SCP-1618
when we
Are victorious on a world scale I think we shall use gold for the purpose of building public lavatories in the streets of some of the largest cities of the
World. This would be the most “just” and most edu-
Cational way of utilising gold for the benefit of these generations which have not forgotten how, for the sake of gold, ten million men were killed and thirt-
Y million maimed in the “great war for freedom” ,
? V.I.Uljanov1
Footnotes
1. The birthname of V.I.Lenin, Russian revolutionary and statesman, 1870-1924
|
SCP-3423 is a window with a frame approximately 110cm tall and 70cm wide, lacking its obverse side1.
|
***
Item #: SCP-3423
Object Class: Safe
Special Containment Procedures: SCP-3423 is stored in a standard windowless object containment chamber at Site-91. Two curtains have been installed on each side of the frame of SCP-3423 and can be used to cover the object, in case of a similar event as the one detailed in Addendum 3423-3.
Each instance of SCP-3423-1 is to be tracked, if possible, using SCP-3423 as a point of reference. If SCP-3423-1 is found in an unreachable area, it is to be left alone until it disappears. Each recorded instance of SCP-3423-1 is to be noted and made an entry for in the database.
Since 02/03/2016, all personnel entering SCP-3423's chamber must record their actions 24 hours prior to it. It is not permitted to visit the chamber more than three days in a row. Only one individual may be present in the chamber at any given time with the exception of testing.
Description: SCP-3423 is a window with a frame approximately 110 cm tall and 70 cm wide, lacking its obverse side1. The obverse side, when looked at, appears to be non-existent, instead the frame just ends. The frame is made out of wood and does not appear to be affected by most outside influences: samples may be taken and it can be damaged, but no natural biological degradation has been observed on the samples or the frame itself. On the bottom part of this frame is an engraved text: "For Inspiration."
SCP-3423-1 is used to refer to any instance of the obverse side of SCP-3423. It is similar in appearance but lacks the engraving on frame and an opening mechanism. In a seemingly random interval ranging from 3 to 24 hours, the location of SCP-3423-1 will instantly change2. Recorded locations of SCP-3423-1 include places anywhere on Earth, outer space, other planets, other universes and dimensions. The selection of this place also does not appear to have any specific pattern, although SCP-3423 appears to be showing "preference" of places on Earth.
Note: Neither the interval of change nor the location is random. (See Addendum 3423-4)
It would appear SCP-3423-1 is just a projection, as it is not possible to damage, move or touch it. This claim is further supported by the fact that it can appear suspended in mid-air and is not usually affected by gravity.
SCP-3423 is constantly connected to an instance of SCP-3423-1. This connection manifests itself as an observable anomaly. If a person attempts to look through SCP-3423, instead of seeing through the glass, they will see a scene as though they were looking through the window into SCP-3423-1. It is to be noted that this connection is not material, all attempts to open SCP-3423 will result in the connection becoming invisible and SCP-3423 retaining the properties of a normal window, except for its secondary effects such as immunity to biological degradation. After the window is closed again, the connection is restored.
It is also worth noting, that the glass in SCP-3423-1 does not show the view from SCP-3423, suggesting that the connection is one-way. Viewers looking into SCP-3423-1 see only the reflection of themselves and their surroundings.
Addendum 3423-1: Circumstances of Acquisition
SCP-3423 was recovered from an MC&D facility on 24/12/2014. Related documents found with it suggest the organization was given SCP-3423 by a person claiming to be its creator. It is unknown if the above-mentioned group of interest has any connections to SCP-3423's creator or if this person is a part of another organization. Additionally, the only documentation found which described the object's properties were a note about its ability to show random places, and a document describing its purpose as "decorative" and "inspirational".
Addendum 3423-2: A list of most notable locations of SCP-3423-1.
Pyramids of Giza, location observed for 14 hours.
An orbital view of the planet Saturn, location observed for 15 hours.
A farm in a rural environment with a cloudy sky, previously thought to be located in Australia. After two hours the clouds were noted to have shifted, revealing a blue sun, location observed for almost 24 hours.
A view from a moving train3, location observed for 12 hours.
Coast of the Davis Sea, Antarctica, location observed for 9 hours.
Inside of a volcano, location observed for 6 hours.
An office of the president of Czech Republic4, location observed for 4 hours.
Addendum 3423-3: On 20/11/2015, SCP-3423-1 switched its location while two researchers were present in its containment chamber. Its new location was later described as a gallery. Foundation's sources failed to identify the location of this place. Viewing of the "art" resulted in both researchers becoming temporarily blind. Out of multiple pictures present in the gallery, one was identified as a known cognitohazard with this effect.
Note: "After multiple complaints and injuries, I formally request additional containment measures. I would also like to state that I have noticed an unusual pattern in the locations SCP-3423-1 has chosen, and I will be conducting experiments to see if I am right. It may help us prevent another incident."
-Researcher Shallow, head of research regarding SCP-3423
Addendum 3423-4: Following the above request, Researcher Shallow was involved in a series of tests regarding SCP-3423. These tests focused on finding the reasons behind the locations of SCP-3423-1 that were chosen. The working theory was that this change did not occur randomly, and was in fact being affected by viewers of SCP-3423. The goal of these tests was to find the cause.
The tests were carried out by instructing people to watch SCP-3423 while performing tasks, talking, or after an emotional response was triggered. The predicted result was that SCP-3423 would later travel into location "corresponding" to the conditions of the test.
+ Excerpt from Experiment Log
- Excerpt from Experiment Log
Experiment 3423-01
Test: D-Class, Male, 34 years, instructed to observe SCP-3423 while it is connected to a view of the Gobi desert.
Important: Subject states that he "is glad he is not there", as he "hates hot weather".
Location shown: Coast of Davis Sea, Antarctica.
Observation Time: 9 hours.
Note: This indicates that SCP-3423 does react to its viewers.
Experiment 3423-04
Test: Researcher Crowell, Female, ██ years, instructed to observe SCP-3423 while it is connected to a night view of New York City.
Important: Prior to the test, the subject is feeling "exceptionally content," as it is her birthday.
Location: A blooming flower field, Netherlands: specific location unknown.
Observation Time: 6 hours.
Note: It would also appear that SCP-3423 can sense emotions, and not just change based on what is said.
Experiment 3423-07
Test: D-Class, Male, 40 years, history of violent crimes, instructed to observe SCP-3423 while it is connected to a sunny beach located somewhere in Indonesia.
Important: Subject reports feeling sick and states he dislikes the location due to excessive amount of light.
Location: Mental hospital, location unknown.
Observation Time: 3 hours.
Note: It is stated that the resulting location looks "unrealistic," and "obviously meant to evoke fear."
Experiment 3423-12
Test: 2 D-Class, Male and Female, 35 and 29 years, both instructed to observe SCP-3423 while it is connected to an open sea view. The first subject is told to express his disagreement with the location, while the second is to do the opposite.
Location: A busy street in New Delhi, India.
Observation Time: Location purposefully not observed, to find out if it disappears due to lack of interest from viewers5. Location switched after 3 hours.
Addendum 3423-5: A summary of the events that took place on 02/03/2016, by Researcher Crowell.
Document #3423-1
"After a promising turn of events in the research regarding SCP-3423, Researcher Shallow had set his mind on finding a way to control how SCP-3423-1 changes locations. He believed that it could be possibly used for research purposes or even espionage. While many staff members agreed with him on the former, we weren't exactly sure about the latter. Needless to say that Site Command supported his idea.
Despite having redeemed himself after the initial incident, which ended with multiple injuries, Researcher Shallow was spending all his free time with SCP-3423. Some people noticed his increasing obsession with it: I know I did. We asked Command to start an investigation of the project. Site Command agreed and launched a formal inquiry. On 02/03/2016, Researcher Shallow was found in his quarters showing extreme signs of insomnia and paranoia. He was holding an improvised weapon in the form of a fire extinguisher. After our collective failure to convince him to talk, site security managed to overpower him and he was escorted to the medical wing.
The project was stopped after it was clear that SCP-3423 was involved. In the last month, we have used the notes left by Researcher Shallow to perform further experiments, and I can finally confirm that SCP-3423 has, in fact, mind-affecting properties. We are not one-hundred percent sure about the extent of this effect but we can say that just like SCP-3423-1 changes based on the viewer's emotions and perception, it also changes their emotions to match. If I had to guess, long term exposure to this is what caused Researcher Shallow to snap.“
-Researcher Crowell, Acting Head Researcher for SCP-3423
Footnotes
1. Referring to the side that would normally be visible from the outside of a building.
2. It is unknown whether each instance of SCP-3423-1 is a new one, or if it is SCP-3423-1 changing its location.
3. It has been shown that while SCP-3423-1 is not typically affected by its surroundings, it is fully capable of moving.
4. This would have likely caused an incident if it was not for the fact that the president was not present at the time.
5. As well as to make the instance of SCP-3423-1 disappear faster due to its location.
|
SCP-326 is a human female, approximately 65-70 years old,1 who has been subjected to significant body modifications by an anomalous technology.
|
***
Item #: SCP-326
Object Class: Euclid
Special Containment Procedures: SCP-326 is contained at Armed Bio-Containment Area 14. Due to SCP-326's severe iatrophobia, personnel who will interact with be seen by SCP-326 are not to wear lab coats. Due to SCP-326's post-traumatic stress disorder, her tendency to undergo panic attacks, and the increased danger she poses to personnel during these episodes, SCP-326 is never to be beyond sight of a 'panic room' into which she can flee; the path between SCP-326 and the closest panic room is to remain unobstructed.
Tranquilizers are to be added to SCP-326's food on a daily basis to mediate her stress; in the event that SCP-326 needs to be transported off-site, she is to be sedated until such time as she can be provided with a new panic room.
SCP-326 is deaf, and communicates via written Chinese; translators are to be available at all times. All communications with SCP-326 are to be archived.
Description: SCP-326 is a human female, approximately 65-70 years old,1 who has been subjected to significant body modifications by an anomalous technology. When inactive, these modifications are detectable only by subject's anomalous mass (230 kg, despite a physique which would indicate a mass of at most 45 kg), and by the presence of significant keloid scarring along her arms, legs, hands, feet, and spinal column. When subject becomes agitated, the scars rupture lengthwise, and the components of a structure emerge; this structure resembles an exoskeleton made from human bone, and bestows upon SCP-326 enhanced strength and speed. The degree to which her speed and strength are enhanced is unknown, as she is reluctant to participate in quantitative testing; however, she has demonstrated the ability to (when in a panic) throw two 100-kilogram security guards over distances greater than 4 meters, and to travel over 20 meters to her panic room in 2.8 seconds. Due to logistical difficulties with sampling (not only is the exoskeleton extremely durable, its accessibility is limited to those times when SCP-326 is panic-stricken), the physical composition of the exoskeleton is as yet unknown, as is its connectivity to SCP-326's musculature and nervous system. Radiographic imaging has been hindered by the subject's phobic reaction to X-ray machines.
SCP-326 is deaf,2 as a result of having deliberately ruptured both of her own eardrums at some time prior to entering into Foundation custody; her stated goal in doing this was to avoid "hear[ing] bad words". Further questioning on this topic results in SCP-326 becoming agitated and distressed.
History: SCP-326 claims to have been an agricultural worker from the rural village of [REDACTED], in [REDACTED] province, People's Republic of China, at the time of Mao Zedong's Great Leap Forward campaign. She describes having been approached by "some young men from [REDACTED]" who induced her to participate in a procedure "for the revolution". The procedure was "very secret" and involved "bad doctors", "bad magic", and "much death"; eventually, however, "the young men stop[ped] coming", and SCP-326 was "left in the room of ice".3
In 20██, a containment breach by SCP-████ led to the collapse of █ buildings in the Chinese city of [REDACTED]. Foundation cleanup crews discovered SCP-326 wandering in the wreckage of the ███████ building, identified her as anomalous, and took her into custody.
Footnotes
1. This figure is SCP-326's physiological age; chronologically, SCP-326 is over 120 years old
2. but still able to speak, in the Pinghua dialect of Chinese
3. this is thought to indicate cryogenic suspension.
|
SCP-1141 is a phenomenon in which an instance of SCP-1141-1 instantaneously appears at a public zoo in the New England region1 of the United States.
|
***
Item #: SCP-1141
Object Class: Keter-alterius
Special Containment Procedures: All public zoos in Connecticut, Maine, Massachusetts, New Hampshire, Rhode Island, and Vermont are to be under constant surveillance by personnel at Site-85 and Site-86. Should SCP-1141 occur, the approximate nature and threat level of SCP-1141-1 is to be ascertained as soon as possible, with the nearest branch of Mobile Task Force Gamma-80 (aka "Ecologists") deployed to the zoo in question with all equipment deemed necessary.
Upon arrival, MTF Gamma-80's task is to destroy SCP-1141-1 or render it inoperable as soon as possible. The use of force is authorized for this purpose. If SCP-1141-1 does not pose an immediate risk to the public, MTF Gamma-80 will purchase several food items and prevent all public access to SCP-1141-1. If this does not result in the disappearance of SCP-1141-1 within twenty-five minutes, Site Director Jackson is to be notified. Food items purchased from SCP-1141-1 are to be sent to Site-86 for further research and containment.
AMN-M-4311 is to be distributed through the zoo's public address systems, mass texting services, and all relevant social and news media after the disappearance of SCP-1141-1 and the departure of MTF Gamma-80 in order to prevent dissemination of information regarding SCP-1141 and related Foundation operations. Damage to zoo property and any casualties are to be attributed to fire, vandalism, or animal escape as deemed appropriate to the situation. Should Site-85's budget allow, an anonymous donation may be made to the affected zoo to cover costs of repairs.
As of ██/██/████, additional resources have been allocated to projects deemed capable of neutralizing SCP-1141, with all strictly relevant research under the purview of Dr. Eichmann.
Description: SCP-1141 is a phenomenon in which an instance of SCP-1141-1 instantaneously appears at a public zoo in the New England region1 of the United States. This occurs approximately thirty minutes prior to the opening time of the zoo in question. The infrastructure and nearby structures (such as utilities, enclosures, pathways, and other buildings) will be altered to accommodate SCP-1141-1's presence, as will maps of the zoo. SCP-1141 will only occur under the following conditions.
No instances of SCP-1141-1 are operational.
Less than 20% of the zoo's grounds are covered in snow.
The temperature has been above 15°C during operating hours for the past week.
At least 250 days have passed since the demanifestation of the most recent instance of SCP-1141-1.
Instances of SCP-1141-1 take the form of a fully staffed, supplied, and operational restaurant that is thematically consistent with other restaurants in the zoo and with the area of the zoo in which it is located.2 Food served at SCP-1141-1 is consistent with food served at similar establishments, with the exception of each instance offering guacamole with pineapple chunks. Food and other supplies will appear as needed inside SCP-1141-1, out of view of the public. Staff of the zoo will not demonstrate any familiarity with SCP-1141-1.
All individuals staffing SCP-1141-1 are anatomically and behaviorally consistent human beings, and will run SCP-1141-1 to the best of their ability. These individuals are fluent in English and knowledgeable in the operation of SCP-1141-1. They are either unwilling or unable to answer personal questions (such as identity and personal history) or questions pertaining to the nature or origin of SCP-1141. They will not leave SCP-1141-1 willingly.
Instances of SCP-1141-1 have an unpredictable and often dangerous effect on their surroundings. The exact cause of this is not known with certainty; however, analysis has led several researchers to propose that instances of SCP-1141-1 do not necessarily operate under physical laws or constraints present in our dimension prior to their manifestation. See Event Log SCP-1141-1 for details.
If an instance of SCP-1141-1 is rendered inoperable or if its presence causes obvious injury to a person visible from SCP-1141-1, the instance will demanifest within the next twenty-five minutes, with all infrastructure, structures, and maps of the zoo returned to their previous condition. All food items sold by SCP-1141-1 will remain, and may continue to demonstrate anomalous properties.
Event Log SCP-1141-1 / Clearance-Sensitive Document
Clearance: 2/1141-P
All locations and several manifestations have been removed from this document as per Level 2-Probationary Clearance protocols. This document will serve to illustrate the effects of SCP-1141 and should not be taken as a comprehensive list of SCP-1141 events.
Year: July 1985
Event: Accurate description of SCP-1141-1 could not be gained. Instance and all of its contents manifested at approximately 5000°C; despite this, it appeared to be fully functional and did not combust. The instance disappeared after its foundation crumbled, resulting in structural collapse. Fire caused by SCP-1141-1 destroyed several animal enclosures and injured four park employees before being extinguished.
Year: June 1990
Event: SCP-1141-1 manifested as the "Amazon Basin Café". While the building remained intact, SCP-1141-1 appeared to experience gravitational force approximately 2.3 times stronger than Earth's surface gravity. Two orders of french fries were procured prior to SCP-1141-1's disappearance due to an inability of its staff to serve customers. Testing indicated that this food had no greater mass than comparable french fries, yet weighed 2.3 times as much as their mass would indicate.
Year: June 1991
Event: SCP-1141-1 was entitled "A Grizzly Tale". The instance was found to be fully operational and not immediately dangerous. A variety of food items were purchased before SCP-1141-1's disappearance was induced by the placement of Foundation guards to prevent entry. Analysis of the food indicated that its de Broglie wavelength was approximately 1 cm, despite having a normal mass. The food has been designated as a separate anomalous item and is contained at Site-86.
Year: April 1992
Event: SCP-1141-1 was not detectable aside from alterations to infrastructure. Maps of the zoo marked a restaurant called "Safari Grill". The changes to the zoo's infrastructure reverted two hours after opening, presumably when it became apparent that none of the zoo's patrons were aware of SCP-1141-1. Later records indicate that relatively frequent repairs to structures near this area have been necessary since this manifestation.
Year: September 1994
Event: SCP-1141-1 manifested as "The Glacier Café". Reports and later analysis indicate that this instance of SCP-1141-1 was subject to drastically accelerated buildup of static electricity. SCP-1141-1 did not appear to be grounded; further, weather conditions at the time3 contributed to this problem. Seventeen individuals, not including the occupants of SCP-1141-1, were killed by static discharge before SCP-1141-1 disappeared.
Clearance: 2/1141-P
Show Audio Log 1141-7
Hide Audio Log 1141-7
Conversation between two individuals occupying SCP-1141, recorded July 1978 via hidden microphone. The individuals in question have been identified by the names on their nametags. The conversation was held in English.
Note: Special Containment Procedures at the time of the recording involved keeping a relatively safe instance of SCP-1141-1 in operation at the █████████ Zoo. Access was denied to the general public, and personnel regularly purchased food from SCP-1141-1 to maintain containment.
Duane: I don't think they're actually eating the food. The maintenance people have been carrying out more trash than they were when we were scouting.
Betty: So? They're still buying it. Does it matter if they eat it?
Duane: I didn't get into the restaurant business in this universe to not be allowed to actually serve my food to the public, [unintelligible]. It's probably poison or something, isn't it. Or Miranda messed up the speed of light again. I can't even tell.
Betty: So why don't you go talk to them and convince them to let us work? They know we won't break containment or whatever it is, right? We can talk and act just like people.
Duane: And how do I convince them that it won't end up like it did in ███████? Or █████████? I swear, a tiny fraction of the ketchup is accidentally ██████████ and you can't be trusted with anything.
Betty: Asking some human scientists for help is out of the question?
Duane: You know they wouldn't understand anything about how we make this happen. They're still primitive.
Betty: According to your standards, maybe. But if you're going to be difficult, then whatever. Honestly, your obsession with 'restaurants' and 'zoos' is kind of creepy, and a little racist. Do humans count as a race? I don't even know, honestly. I've been breathing oxygen for too long.
Duane: Well, you're perfectly free to leave, if it bothers you that much. Except you can't, because you lost your travel license in [unintelligible]. So you're stuck with me and this creepy, racist restaurant until Miranda can nail down their physics good enough for us to not kill anyone.
Betty: So now you care about killing humans?
Duane: [Unintelligible]. Just shut up. We're leaving.
SCP-1141-1 demanifested seven minutes later. Further attempts to restrict the public's access to SCP-1141-1 from that point on have resulted in SCP-1141-1 disappearing. Containment protocols have been altered appropriately, and SCP-1141-1 has been upgraded to Keter class.
Hide Audio Log 1141-7
Addendum: Until we fully understand and can predict the properties of SCP-1141, the possibility remains that it could trigger a catastrophic event, such as an antimatter explosion or vacuum metastability event, with no forewarning. I formally recommend fast-tracking research that could be useful in producing the means necessary to neutralize SCP-1141.- Dr. Eichmann.
Approved.- Dr. Foster
Footnotes
1. See containment procedures.
2. For example, an instance of SCP-1141-1 that manifested near a leopard enclosure was called "Leopard's Spot Snack Shack". See file photo.
3. Winds in excess of 50 kph
|
SCP-594 is a flock of feral sheep of an unknown breed resembling a wild Argali sheep in general build with a thick fleece like that of a domestic Merino, around 135cm at the shoulder and weighing 195kg on average.
|
***
Item #: SCP-594
Object Class: Euclid
Special Containment Procedures: SCP-594 is kept at Bio-Research Sector-██, located on 54 km2 of mountainous rangeland located 35 km from ██████, Alaska. Officially, Sector-██ is listed as a munitions factory and testing facility. The perimeter fences and access gates are monitored remotely at all times with two Level 2 guards posted at each gate in 8 hour shifts. All fencing enclosed paddocks have static dischargers placed at 2 cm intervals. Main research enclosure and pens are to be cleaned on a daily basis to avoid build up of excrement and allow for necessary repairs. Due to possible electrocution hazard, the following procedures are to be observed when interacting with SCP-594:
All metallic items and electrical devices, including wrist watches and jewelry, must be removed and placed within provided plastic containers prior to donning protective gear
Prior to entering paddock, staff are advised to wear at minimum Tesla armor, heavy duty work gloves, ear protection, goggles, and rubber soled boots. Also, staff are advised to keep on hand tobacco products (specifically “Skoal” style chewing tobacco or pipe tobacco), candies, dried fruit, or good quality alcohol as a “treat” for 594-01.
Holding pens and fences are to be kept properly maintained at all times.
Wool of mature adults (2 years and older) is to be kept shorn to a length of 2mm by ceramic shears twice yearly and baled in antistatic bags, with strict adherence to guidelines set out in Document #594-S. Under no circumstances are shears with electrical motors to be used for shearing. Exceptions are 594-01 and 594-02, who are to be rooed [loose wool plucked out by hand] as per guidelines under Document #594-01/02A and no attempts at shearing be made on either animal.
Due to the nature of SCP-594, specifically 594-02, all personnel with contact to SCP-594 and its by-products may be subject to full cavity searches and all personnel must submit to pat down search/metal detector scan before leaving the enclosure.
Feeding of the approved formulated grain-hay mix, outlined in Document #594-F, is to be done twice daily with fresh water and mineral licks made readily available around all parts of the enclosure. Foraging and grazing outside of regular feedings are to be carefully monitored.
Description: Discovered in the Altai Mountains during a routine fact-finding mission, SCP-594 is a flock of feral sheep of an unknown breed resembling a wild Argali sheep in general build with a thick fleece like that of a domestic Merino, around 135 cm at the shoulder and weighing 195 kg on average. Gestation and reproductive cycles are similar to most domesticated sheep, with ewes reaching sexual maturity at six to eight months of age and rams at four to six months. They enter a rut twice annually, typically in late spring and early autumn, but breeding can occur year round. Most ewes give birth to a single lamb or twins, with triplets being exceedingly rare (2% of all recorded births to date). Only documented case of triplets which survived to full maturity is 594-01 and his siblings, 594-02 and 594-03. General coloration ranges from pure white to dark blue-gray wool with a metallic sheen appearing once they’ve reached full maturity, typically 2 years of age. Only three animals, the aforementioned triplets, display atypical wool colors. Both sexes have horns, with uncastrated males having spiraling horns measuring 190 cm in length, the largest documented span belonging to 594-02 at a length of 247.4 cm. Females and wethers have curved horns measuring 20 cm. The horns, hooves, and wool of older animals have unusually high concentrations of ferrous metals, along with traces of gold alloys. Examinations of newly butchered animals have revealed that SCP-594’s skeleton also has large amounts of ferrous metals present within the bone matrix.
The sheep are highly aggressive and territorial in nature, and often attack unfamiliar personnel without warning or provocation. They will continue to behave in this manner until steps are taken to properly placate 594-01, which is normally done by giving it “treats” such as tobacco or candies. Once this is done, the flock will become docile and behave like normal domestic sheep. The exceptions to this pacifying behavior are 594-02 and 594-03 as outlined in the addendum on each. In contrast to adults, lambs typically are very easy to handle and display curiosity towards new objects and people in the paddock, often attempting to ‘play’ with personnel but will flee if threatened. The sound of a panicked lamb will cause nearby adults to attack violently, so caution is to be taken not to 'spook' lambs. Lambs also show a tendency to form attachments to certain humans, often following them around the paddock and begging for food or attention. This is especially noticeable among bottle-reared lambs. Such attachments often last even after sheep has reached maturity, as seen in the case of 594-02 and Dr. Maryweather.
At present, the flock numbers 1,314 mature sheep plus 448 lambs and immature sheep, with selective culling of unwanted animals annually after the rutting season to maintain these numbers. The only animals exempt from culling are 594-01, 594-02, and 594-03, or any lambs exhibiting similar traits. Deviation from the 1314/448 pattern for more than a year’s time will cause all mature rams to [DATA EXPUNGED]. Failure to follow the pattern for two years during preliminary research resulted in the deaths of █ D-class personnel and █ researchers, as well as near breach of containment by 594-02.
The defining characteristic of the sheep is that they are able to generate a substantial amount of static electricity simply by the friction caused during daily activities. The resultant charge is typically discharged at random, with mature specimens producing arc flashes that have been recorded at 1000 amps or more. Due to the electrocution hazard, personnel interacting with SCP-594 are advised to follow guidelines fully outlined in Document 594-4H. When faced with a “threat”, the flock will become highly agitated and mature ewes will attempt to form a ring around any lambs, rubbing their bodies together to generate an even greater static charge between them. Because this defensive behavior is especially pronounced when ewes are birthing, it is standard procedure to isolate all pregnant ewes and newborn lambs from the rest of the flock until a week after birthing.
In addition to defense against predators, rams also appear to use their discharges as a type of dominance display, with the older and stronger rams able to produce more powerful discharges during their “dance”. When in rut, rams will fight against themselves, performing the stomping “dances” prior to engaging rivals. These “dances” are often accompanied by excessive discharges, resulting in a rapid ionization of air and giving SCP-594 its local name, “Thunder Sheep”. Ground sensors have also detected telluric currents during these “dances”, with older rams creating extremely complicated patterns that often resemble [DATA EXPUNGED]. Freemartins (ewes which are behaviorally masculine and lack functional ovaries), will also perform stomping “dances” but the patterns produced, while equally as complicated, show a marked difference from those created by rams. To date, wethers have not been observed to engage in this behavior.
Another trait exhibited by SCP-594 is an inherent ability to “walk on air” or more accurately levitate themselves at a distance on average of 2 to 4 meters vertically via manipulation of electromagnetic fields. Lambs and younger animals have a tendency to lose control mid-“flight”, often falling from high cliffs which can result in death of the animal. This may be the way the flock culled out weaker animals in the wild, but more research is needed.
Research has been done on the properties of SCP-594 wool, milk, meat, and horn. Results of these tests are pending full documentation, however the meat, milk, and resultant dairy products have proven to be fit for human consumption. Approval to include “Thunder Mutton” and various cheeses made from the milk of SCP-594 in the Foundation’s standardized menu still pending.
[DATA PENDING]
|
SCP-4853 is a metaphysical concept(3) with a high degree of informational inertia.
|
***
Item #: SCP-4853(1)
Object Class: Keter(2)
Special Containment Procedures: The only designation which may be applied to SCP-4853 is SCP-4853.1 Other references to SCP-4853 may exist only in this document, and may not exceed ten instances. A numeric identifier for each active reference has been placed next to its first appearance.
Civilians who express awareness of SCP-4853 are to be amnesticized. If needed, standard financial remediation is to be carried out.
Description: SCP-4853 is a metaphysical concept(3) with a high degree of informational inertia.(4)
Addendum 4853-1: Experiment Logs
Experiment 4853-1
Procedure: D-41562 inquires about the nature of █████
Result: Information received, but became disassociated.
Experiment 4853-2
Procedure: D-41562 inquires about the nature of █████
Result: Information received, but became disassociated.
Experiment 4853-3
Procedure: D-41562 inquires about the nature of ███ ███████
Result: Information received, but became disassociated.
Experiment 4853-4
Procedure: D-41562 associates information from previous tests.
Result: Reference created (#4).
Experiment 4853-5
Procedure: Dr. Archibald classifies ███ ███████ as SCP-4853.
Result: Reference created (#1).
Experiment 4853-6
Procedure: D-41562 inquires about containment strategy for SCP-4853.
Result: Reference created (lost), some information discarded.
Experiment 4853-7
Procedure: D-41562 inquires about containment strategy for SCP-4853.
Result: Reference created (#2), some information discarded.
Experiment 4853-8
Procedure: D-41562 collates information about SCP-4853.
Result: Information grouped into reference (#3).
Experiment 4853-9
Procedure: D-41562 inquires about the distinctions between SCP-4853 and █████.
Result: Message received (see below). Containment procedures finalized.
Note: Extraneous references destroyed using amnestics.
Addendum 4853-2: Received Message
Hello valued customer!
You have used all of your █████ quota! We have automatically deducted $350,000,000 from your account and upgraded you to the next plan level, giving you 10 references.
Don't hesitate to contact our helpdesk with any questions regarding your subscription!
Footnotes
1. This prohibits phrases such as "the anomaly", "the object", "it", or colloquial terms like "skip".
More From This Author
More From This Author
aismallard's Works
SCPs
SCP-4339 •
SCP-5900 •
SCP-5134 •
SCP-5446 •
SCP-6115 •
SCP-4447 •
SCP-4322 •
SCP-4781 •
SCP-1294-J •
SCP-3597 •
SCP-5510 •
SCP-5502 •
SCP-4838 •
SCP-5871 •
Tales/GoI Formats
The Heart of the Beast •
The Pumpkin Mystery •
Other
aismallard's personnel file •
|
SCP-4360 is a Red Alder Tree1 located in a forest on Bainbridge Island, Washington.
|
***
Item #: SCP-4360
Object Class: Safe (Pending Euclid)
Special Containment Procedures: The forest within which SCP-4360 is located is to be patrolled by no more than two guards disguised as forest rangers. Should any civilians attempt to come within 10 meters of SCP-4360, they are to be turned away by the guards under the cover story of an endangered species nesting in the area.
Testing of SCP-4360 may only be done using Foundation-approved DVDs.
Description: SCP-4360 is a Red Alder Tree1 located in a forest on Bainbridge Island, Washington. SCP-4360 is functionally and aesthetically identical to a television and DVD player, though still requires sunlight and nutrients as standard for a non-anomalous Red Alder Tree.
Should any non-anomalous DVD be inserted into SCP-4360, it will play the program despite no obvious source of power. However, any programs played through SCP-4360 will typically be altered in some way to prevalently feature trees. Occasionally, words in English will appear on screen as well, either criticizing the program or praising it, depending on its material.
Subjects who watch programs on SCP-4360 occasionally report a significant emotional shift, typically related to any critiques of programs displayed on SCP-4360. These anomalous effects are impermanent, and only last as long as the subject is in direct line of sight of SCP-4360 while it is playing its current program.
Addendum 4360-01: Below is an abridged list of programs as altered by SCP-4360, as viewed by Researcher Caroline Fremont.
Program
Alterations to the Source Material
Commentary
Emotional Response
A recording of a local news broadcast.
All stories involved environmental protection, particularly the protection of national forests and wetlands. The weather report segment did not address weather across the county, but rather the effects of weather on the plant and animal life in forests.
None.
None.
The same recording as the test prior.
Stories were altered as previous, however the entirety of the broadcast was filmed within a non-descript forest.
"Already saw. More tree."
Subject reported feeling apathetic and bored towards the broadcast while watching the program. Subject was anxious and felt a desire to end the test prematurely.
Episode 3, Season 4 of "Scrubs"2.
All actors present within the show were replaced by animate trees. In addition, the show's title card instead displayed the words "Tree hopital"[sic]. Plot was largely unchanged.
"Helpful? Help people! Is okay! Do you help?"
Subject reported a "sense of duty to do her job" while watching the program.
The 2005 horror film "Saw 2".
All footage was replaced with an off-white placard displaying the word "Trees". Audio of the film played as normal.
"No. Hurt people is no. You probably hurt trees to![sic]"
Subject reported a profound sense of regret while watching the program.
Footage from the 1969 Moon Landing
Astronauts Neil Armstrong and Buzz Aldrin emerged from what appeared to be a giant tree, and then rather than planting an American Flag, the pair dug up the lunar soil and then planted a sapling. The sapling grew to maturation within seconds, and its roots began to cover the entirety of the lunar surface.
"Tree go EVERYWHERE…"
Subject reported a sense of awe and amazement while watching the footage.
Episode 2, Season 1 of "The Blue Planet"3.
The entirety of the ocean is replaced with enormous trees. Fish are seen swimming between the trees as if it were water. Occasionally, the branches of certain trees reach down to the fish and wrap around them, then proceed to encompass them in bark and incorporate them into its trunk.
"Alost[sic] forest! Almost trees!"
Subject reported a sense of anticipation while watching the program, "As if something more important is about to happen."
The 2013 documentary film "Song from the Forest".
The footage was largely unchanged, save for several cartoon hearts appearing around the screen.
"Yes! Yes! Thats trees! Yes!"
Subject reportedly felt "warm and loved" while watching the program.
A recording of SCP-4360.
Unchanged.
"Me? Oh…"
Subject felt as if they were being watched while watching the footage, but did not express any alarm at this notion.
Addendum 4360-02: On September 28th, 20██, Researcher Fremont reported that she had found a single DVD growing off of a tree branch at her home residence. Analysis of the DVD itself shows that while it is functionally and aesthetically identical to a non-anomalous DVD, it is constructed entirely of tree leaves and sap.
Upon inspection of its contents, the DVD contained approximately four minutes of shaky footage of Researcher Fremont performing tests with SCP-4360. Throughout the footage, trees surrounding SCP-4360 bent downwards towards Researcher Fremont, surrounding her in their branches and occasionally penetrating her skin. By the end of the footage, Researcher Fremont is entirely enveloped in tree bark and has grown roots where her feet once were.
Further examination of the audio from the footage revealed an unidentified voice. Phrases spoken by this voice have been approximated to be "Help the trees", "You a tree", and "You like me". Subjects who watched this DVD reported a feeling of itchiness beneath their skin, as well as a sense of calmness "as if they were being cared for" while watching the footage on a non-anomalous DVD player. Testing has not been done using SCP-4360.
Due to the potential information breach, SCP-4360's Object Class is pending an upgrade to Euclid-Class. Testing of SCP-4360 is suspended indefinitely. Researcher Fremont is to be monitored for any further footage delivered to her residence.
Footnotes
1. Alnus rubra.
2. Titled "My New Game"
3. Titled "The Deep".
|
SCP-2414 is a fictional SCP object, and that the procedures are to be utilized for training purposes only.
|
***
Item #: SCP-2414
Object Class: Euclid
Special Containment Procedures: SCP-2414 is to be kept inside an opaque box and stored in a standard secure storage vault in Dimensional Site-62. The vault is to be protected by no fewer than two (2) armed guards trained in the resistance and containment of infohazards at any given time. Guards are to be told that the vault contains dangerous but non-anomalous items, and are not to permit access without the express written authorization of the Site Director. Any attempts at removing SCP-2414 from the vault without this authorization are to be met with lethal force.
Internal Foundation communications are to be monitored by standard RAISA software for any mention of SCP-2414. Any personnel outside of those cleared for SCP-2414 access who mention it, or who receive communications mentioning it, are to be flagged and investigated for potential infohazard exposure.
Testing performed on SCP-2414 must be performed via use of waldos and cameras unless otherwise authorized by the Site Director. Upon the conclusion of any and all tests, Class A amnestics are to be administered to any parties involved who have not been trained in the resistance and containment of infohazards.
In the event of a containment breach, recovery of SCP-2414 is to be handled solely by autonomous drones.
Any proposed revisions to these procedures must be approved by at least three (3) Class B personnel who are unaware of the properties of SCP-2414. Reviewing personnel are to be told that SCP-2414 is a fictional SCP object, and that the procedures are to be utilized for training purposes only. To reduce the likelihood of belief to the contrary, such requests for review should avoid resembling formal requests if at all possible. Containment procedures presented for review must not refer to SCP-2414 by its actual number or have this paragraph present; placeholder identifiers such as "SCP-XXXX" are to be used instead.
Description: SCP-2414 is a grey tetragonal trapezohedron approximately 26 cm3 in volume, crafted from an alloy of tungsten, nickel, iron, and other unidentified metals. Examination of SCP-2414 by hand will show that it has nine faces - a geometrically impossible property for a trapezohedron of any type. Examination of SCP-2414 by any other method will show that it has eight faces. None of SCP-2414's faces bear markings of any kind; however, markings can be applied through typical methods.
Additionally, SCP-2414 functions as an infohazard that affects Foundation personnel who become aware of its existence as an object considered by the Foundation to be anomalous.1 Affected personnel become convinced that SCP-2414 is a non-anomalous object, and should not be contained by the Foundation. Such personnel will typically attempt to physically "liberate" SCP-2414 from Foundation custody within 12 hours of exposure if able; personnel unable to do so will attempt to recruit assistance from those who are.2
In the event that SCP-2414 is successfully removed from Foundation custody, all memory and knowledge of the Foundation will be erased from the individual or individuals responsible. They will also regain the ability to identify SCP-2414 as anomalous.
An understanding of SCP-2414's infohazardous properties has been shown to inhibit said properties in approximately 70% of cases, although such an understanding will not prevent memory erasure in the event of a successful "liberation" of SCP-2414. Class A amnestics have been shown to prevent the infohazardous properties of SCP-2414 from manifesting in 95% of affected individuals if applied within eight hours of exposure. The success rate declines at a rate of approximately 6% per hour from that point; after 24 hours, amnestics are unable to erase knowledge of SCP-2414 from exposed individuals.
History: SCP-2414 was recovered on March 11, 20██ when Foundation Mobile Task Force Theta-17 ("St. Patrick's Pals") came into contact with a Serpent's Hand field team. Due to its properties as an infohazard, all but two members of the MTF succumbed to SCP-2414's effects. Infohazard-trained personnel were brought to the scene, and were able to secure the object despite incurring three additional casualties.
Addendum 2414-01: RAISA Communications Monitoring Excerpts, 20██-05-16:
+ Proposed Containment Revisions
- Proposed Containment Revisions
Site-62 Internal Communications, 20██-05-15:
TO: Researcher N████ S████████
FROM: Researcher K████ L███
SUBJECT: Can't Someone Else Do It?
Sorry. Simpsons was on in the staff lounge after my shift yesterday, and I've had that damn song stuck in my head since.
Anyway, there's something about 2414 that struck me this morning, and I may have figured a better way to contain it. It only affects Foundation personnel, after all, so maybe we can get the UIU to lock it up for us. If we send a liaison over to keep an eye on their setup, then wouldn't it still count as being in our custody?
Site-62 Internal Communications, 20██-05-15:
TO: Researcher K████ L███
FROM: Researcher N████ S████████
SUBJECT: Re: Can't Someone Else Do It?
I'll have a senior researcher sign you up for counter-memetics training. ;)
But yeah, that might work. I'll write up something along those lines and send it through the review process.
Site-62 Internal Communications, 20██-05-16:
TO: Senior Researcher P██ W██████
FROM: Researcher N█████ S████████
BCC: Researcher K████ L███
SUBJECT: Need your input on something
Got suckered into training some new recruits on how to handle infohazards. Again.
Part of the training involved identifying potential issues with containing an SCP object. We couldn't use a real one, obviously, so I had them turn a critical eye to that fake one I wrote up last time I got stuck with the job. One of the trainees gave me this suggestion; I'm not sure if it's a good idea or a bad one. What's your take on it?
ATTACHMENT: scp_xxxx_revised.ftml
Special Containment Procedures: SCP-XXXX is currently being contained by the Unusual Incidents Unit, with instructions to disregard all requests for transfer back to Foundation-operated facilities unless said requests include the approval of at least three (3) Foundation personnel of class B or higher. A Foundation agent trained in the resistance and containment of infohazards is to liaise with the UIU for purposes of ensuring successful containment of SCP-XXXX.
Site-62 Internal Communications, 20██-05-16:
TO: Researcher N█████ S████████
FROM: Senior Researcher P██ W██████
SUBJECT: Re: Need your input on something
I'd go with 'bad one'. What happens if the infohazard decides that even with the liaison present, it's not in Foundation custody anymore? Best case, the liaison gets mindwiped. Worst case, we'd lose a chunk of the Site-62 leadership plus everyone involved in researching the thing.
Don't get me wrong, it'd be a great idea if we knew it'd still count as in our custody. But in this scenario, we don't know that. Hell, if it was a real skip, I'd be concerned that your trainee had been affected.
Still, points for out-of-the-box thinking, at least.
Results of the investigation into Researcher L███ for infohazard contamination are pending.
Footnotes
1. Knowledge that the designation SCP-2414 is currently being utilized is in and of itself insufficient to activate its infohazardous properties; however, said knowledge in conjunction with that of any of SCP-2414's properties (including the fact that the designation refers to a physical object) will do so.
2. This will result in the exposure of such personnel to SCP-2414's infohazardous properties.
|
SCP-335 is a set of one hundred and fifty 3.
|
***
Item #: SCP-335
Object Class: Safe
Special Containment Procedures: SCP-335 is to be kept in a secure location to prevent tampering.
Description: SCP-335 is a set of one hundred and fifty 3.5" floppy disks discovered in a cardboard box found in the attic of former Agent ███ shortly after her termination. Each disk is individually numbered in hand-written permanent marker. Disks are to be referred to by their number; SCP-335-001, SCP-335-002, etc. Each disk has also been labeled with a human name in the same writing as the numbering. 118 are male names and 30 are female. There is some speculation as to whether SCP-335-011 "Jackie" is meant to be male or female. The names have no identified pattern.
Initial examinations suggested that all 150 disks were blank, as their capacity all read as 0 megabytes. Dr. ██████████ determined that the disks were ordinary and had them archived with the rest of former Agent ███'s possessions. It was not until Agent ████ suggested the unlikelihood of Agent ███ keeping a box of floppy disks in her attic among the other contraband, that Dr. ██████████ agreed to have the disks examined again. It was determined that Dr. ██████████'s original floppy disk drive had been defective, and a different computer was brought in.
All 150 disks appear to have an infinite amount of storage space available. It is unknown whether the disk space is truly unlimited or simply too large to measure; regardless, the space is effectively infinite.
When SCP-335-001 was inserted into Dr. ██████████'s computer, the contents of a large pornographic website were the first data found on the disk. Further investigation by Agent ████ showed that all the contents of SCP-335-001 are of a pornographic nature.
Note from Dr. ██████████: I believe I know where all our bandwidth is going at night. Agent ████'s computer privileges should be limited until he either finds a girlfriend or learns some self-control.
Further investigation revealed that SCP-335-001 through 012 contained pornographic material. However, upon discovering the entire contents of Wikipedia on SCP-335-013, the actual nature of SCP-335 was uncovered.
SCP-335 contains the entire contents of the Internet stored within its infinite storage space. It appears to have some sort of organizational system, with similar sites grouped together on the same disk. Experiment 335-007a showed that when content on the Internet is changed, the content on the corresponding disk changes to match. Precisely how this occurs is unknown. It is uncertain what would happen if content on the disk were changed, as all 150 disks seem to be locked in read-only format.
Addendum: Agent ████ has proposed on numerous occasions that an experiment be conducted where a disk is destroyed. Dr. ██████████ as well as ███-███ agree that this could potentially have disastrous effects on a large portion of the internet and could draw unwanted attention to the Foundation. Such an experiment is not to be attempted under any circumstances.
Addendum: The following is a listing of all 150 names written on the disks in their numerical order. No pattern has yet been identified in the names.
001: "Jonny"
002: "Carl"
003: "Robert"
004: "William"
005: "Benjamin"
006: "Patrick"
007: "Blake"
008: "Keith"
009: "Michael"
010: "Darrell"
011: "Jackie"
012: "Daniel"
013: "Jimbo"
014: "Cynthia"
015: "Valerie"
016: "Ozzie"
017: "Wayne"
018: "Paul"
019: "Frank"
020: "Sandra"
021: "James"
022: "Mark"
023: "Jordan"
024: "Isabella"
025: "Eugene"
026: "Matthew"
027: "Sean"
028: "Heath"
029: "Janice"
030: "Donald"
031: "Bradley"
032: "Ryan"
033: "Ryan"
034: "Emily"
035: "Francis"
036: "Theodore"
037: "Craig"
038: "Sharon"
039: "Jessica"
040: "Xavier"
041: "Parson"
042: "Heather"
043: "Jay"
044: "Kelly"
045: "Oscar"
046: "Brian"
047: "Calvin"
048: "Kenneth"
049: "Stanley"
050: "Walt"
051: "Helen"
052: "Martin"
053: "Hubert"
054: "Joe" [The letter E in this name is written backwards. Reasoning unknown.]
055: "Bartholomew"
056: "Jerry"
057: "Leroy"
058: "Steven"
059: "Roger"
060: "Bill"
061: "Susan"
062: "Lewis"
063: "Aaron"
064: "Leopold"
065: "Gordon"
066: "Kimberly"
067: "Dale"
068: "Julie"
069: "Randy"
070: "Vladimir"
071: "Fred"
072: "Leon"
073: "Marcus"
074: "Ernest"
075: "Mario"
076: "Able"
077: "Wesley"
078: "Howard"
079: "Mickey"
080: "Sarah"
081: "Angelicka" [This name appears to be misspelled. Unknown if this was intentional.]
082: "Tony"
083: "Andrew"
084: "Dorothy"
085: "Stephen"
086: "Clarence"
087: "Homer"
088: "Nathan"
089: "Maximilian"
090: "Joshua"
091: "Ralph"
092: "Rodney"
093: "Bruce"
094: "Eve"
095: "Phillip"
096: "Alexander"
097: "Chad"
098: "Ruth"
099: [Label is torn, no name remains except for the letter G]
100: "Gary"
101: "Ronald"
102: "Kyle"
103: "Antonio"
104: "Elizabeth"
105: "Isaac"
106: "Dennis"
107: "Chris"
108: "Anthony"
109: "Frodo"
110: "Lawrence"
111: "Victor"
112: "Brenda"
113: "Albert"
114: "Russel"
115: "Curtis"
116: "Pamela"
117: "Samuel"
118: "brandon" [Note the lower case first letter. Reasons unknown.]
119: "Michelle"
120: "Jesus"
121: "Walter"
122: "Борис" [Russian name, translates to Boris]
123: "Melissa"
124: "Justin"
125: "Jeffrey"
126: "Gerald"
127: "Anna"
128: "Vincent"
129: "Lloyd"
130: "Nicole"
131: "Allen"
132: "Frank"
133: "Jacob"
134: "Patricia"
135: "Joel"
136: "Harold"
137: "Derek"
138: "Amy"
139: "Douglas"
140: "Lenny"
141: "Rebecca"
142: "Scott"
143: "Glenn"
144: "Henry"
145: "Carlos"
146: "Mary"
147: "Normal"
148: "Eric"
149: "Dave"
150: "肇" [Japanese name, translates to Hajime]
Note from Dr. ██████████: Just some "points of interest" here.
Disks one through twelve apparently contain all of the pornography on the internet. With all that there is, I can see why whoever made these got the porn out of the way first.
Disks 85, 86 and 101 contain image-hosting sites such as Imageshack and Photobucket. Myspace is also on Disk 85.
Disk 30 seems to contain the Google home page and nothing else. The rest of Google's website seems to be scattered all over the place. I've only found a few parts.
Disk 119 has emoticons. Millions and millions of emoticons. Forums, instant messengers, and from other places.
After looking long and hard, I have found that [REDACTED] can be found on Disk 76. I find it very disturbing that this disk has the same name as SCP-076.
Notes from Agent ████: SCP-335-085 and 058 are the same name, spelled differently. The name "Ryan" is used on both SCP-335-032 and 033. SCP-335-028 is named Heath, and that one actor that OD'd on pills, he died at age 28. Vladimir Lenin was born in 1870 and SCP-335-070 is named Vladimir. The name on SCP-335-150 is Japanese and roughly means "beginning." I'm assuming that SCP-335-120 is the Spanish name "Hay-suse" and not the biblical guy, but I guess you never know. And I agree with Dr. ██████████ that it's pretty disturbing that SCP-335-076 has the same name as SCP-076.
|
SCP-5978 is a humanoid of indeterminate gender and ethnicity.
|
***
Item#: 5978
Level#0
Containment Class:
neutralized
Secondary Class:
none
Disruption Class:
dark
Risk Class:
none
link to memo
Special Containment Procedures: The remains of SCP-5978 have been incinerated in order to prevent any future occurrences of anomalous parasitic humanoids from manifesting.
Archived Containment Procedures
Close
SCP-5978 is to kept in a standard Humanoid Containment Chamber at Site-83. SCP-5978 is to maintain a caloric diet of approximately 4000 calories to account for the nutritional needs of SCP-5978-1.
Description: SCP-5978 is a humanoid of indeterminate gender and ethnicity. At random intervals throughout each 24-hour period, multiple wounds and indentations appear in irregular patterns across SCP-5978's body. These wounds typically heal quite rapidly, and are evidence of frequent mastication by an unseen or unnoticed entity.
SCP-5978 possesses no internal organs and is calcium deficient. Despite missing several vertebrae, SCP-5978 is capable of bipedal locomotion. The entity is capable of speech, albeit in an indecipherable language. SCP-5978 and SCP-5978-1 communicate with one another using this language, often loudly and in a manner that suggests they are arguing.
Atop the shoulders of SCP-5978, another humanoid entity without lower extremities (designated SCP-5978-1) is fused. SCP-5978-1’s waist is joined to SCP-5978’s shoulders. SCP-5978-1 possesses four arms, the digits of which terminate in a claw-like appendage. X-rays have revealed the presence of duplicate internal organs of varying size within SCP-5978-1, including a second, enlarged heart and a second, smaller spine.
At random intervals, these duplicate organs will expose themselves on the surface of SCP-5978-1's skin before relocating onto SCP-5978's body. These organs will then enter SCP-5978 orally. It is hypothesized that SCP-5978 is experiencing elation during these periods of time, although this cannot be confirmed due to the inability to communicate with the entity. However, all duplicate organs will eventually pass through SCP-5978's body back into SCP-5978-1 within thirty minutes.
Despite lacking digestive organs, SCP-5978 is able to break down the material it consumes in order to supply itself with the nutrients required for its survival. A percentage of these nutrients are then siphoned from it by SCP-5978-1 when the necessary duplicate internal organs1 are present.
Discovery
SCP-5978 and SCP-5978-1 were originally two separate non-anomalous humans; Daniel McCready and Eleanor Lassen. According to Foundation records, McCready was a practiced carnomancer with a loose affiliation with a local Neo-Sarkic cult operating out of Wallington, New Jersey.
Local Foundation agents monitoring the activities of the cult observed Lassen's indoctrination on March 3rd, 2017. She was successful in performing complex carnomancies in a relatively short amount of time and met McCready shortly thereafter.
Due to unknown circumstances, McCready and Lassen were cast out of the Neo-Sarkic cult and forbidden to interact with any known members. Foundation observers discovered that the two spent a considerable amount of time together before moving into an apartment complex in Wallington, New Jersey.
SCP-5978 was discovered in their apartment on June 18th, 2017, after several tenants reported accounts of domestic violence and emotional abuse occurring in McCready and Lassen's residence. The tenants complained of loud noises disrupting them during the night, and an excessive amount of shouting. McCready would often emerge from his residence with wounds and bite marks across his face, hands, back, and pelvic region.
Several other anomalous items were found in the residence as well, including:
A jewelry gift box with a 14 karat ring inside. The ring maintains a temperature of 930°C.
A cracked cellular device. While appearing non-functional, the device repeats audio detailing a list of male names with associated dates and times. The significance of this is unknown.
A torn photograph of McCready and Lassen that occasionally depicts them with vulpine features, red skin, and horns.
A pair of biologically identical legs capable of locomotion.
Neutralization incident
Several indistinct humanoid entities grew on SCP-5978-1's back before detaching themselves from the entity. The organisms proceeded to consume the flesh that bound SCP-5978-1 to SCP-5978 and removed the entity from its back.
Despite protests from SCP-5978, the organisms were able to consume portions of SCP-5978-1's flesh. SCP-5978-1 appeared to experience extreme emotional satisfaction during this time and prevented SCP-5978 from interfering by utilizing its claw-like appendages to keep it at bay.
After several minutes of consumption, SCP-5978-1 succumbed to its wounds. The humanoid entities excreted a viscous fluid and sought refuge within the corpse of SCP-5978-1, where they demanifested. SCP-5978 experienced extreme hemorrhaging and expired shortly thereafter.
SCP-5978 has been reclassified as Neutralized.
Footnotes
1. The stomach, gallbladder, small intestine, and large intestine.
|
SCP-53102 is a man or a woman facing away from you.
|
***
Item #: SCP-5310
Object Class: Safe, hopefully. Or should that be Euclid?
Special Containment Procedures: We’ve discussed this quite a bit, and have agreed that - although there’s quite a few important containment procedures we should be following, important enough that they could maybe be called special, they truly aren’t special enough to be called Special Containment Procedures. It’s hard to admit, but that’s just the truth. After coming to this realization, we at the Surrealistics Department have decided that these are the Containment Procedures that can truly be called Special. I’m very excited to get to them.
All employees at our dear, dear Site-⌘ are to wear red on Mondays, blue on Tuesdays, green on Wednesdays, red again on Thursdays1 and then Friday is dress-down day.
If you see an SCP-5310 standing in a hallway or in the break room or something, that’s fine, it’s supposed to be there. If you see them all standing on the hill outside, that’s not fine, they’re not supposed to be there, go get someone immediately.
Have fun - and remember to stay hydrated. No, I’m being serious, if you don’t have at least a glass of water once an hour that’ll breach containment and we’ll all have a - frankly speaking - truly horrifying time.
You are permitted to touch another human being ten times a time during your stay at Site-⌘. If you go over that, get out of the Site straight away and take some time off.
Make sure that any lists you create during your time at Site-⌘ have exactly five bullet-points.
This is also part of the list (but I can’t shoot a bullet in front of it for obvious reasons) - don’t forget to take your Agnostics! If you don’t, it can see you.
Description: How to describe SCP-5310? Like the majority of the things we deal with at Site-⌘, it’s not the most concrete thing to look at - or to smell, or to touch, or to hear. I realize that I said ‘touch’ back there, which implies you can touch SCP-5310, but you really shouldn’t do that. I’ll add that to the Containment Procedures later.
If we were engaging in that most tempting of the forbidden fruits, the texture of hands as tongues against the unknown - running your palm over it like its a piece of paper or a brick or some devilish fish - then an SCP-53102 is a man or a woman facing away from you. I'm certain we’ve all seen them when we’re going back and forth through Site-⌘ on our business; more often than not, appear in the break room or in the hallways or one time in the bathroom when I was flushing my nails. Ruthless!
So! From what I’ve seen and what you’ve all told me, there are about ten of these devils and - memorize this well, my fellow voyagers - these are their descriptions physical!
That tall guy with the hat and the backpack.
The little girl with the pigtails.
The old man with the walking stick.
The toddler with the toy car.
The bald physician.
Just so you’re aware, this isn’t the end of the list - I just need to do the second half as another list because of those Special Containment Procedures. Spirit of the law rather than the letter of the law, even though both form the same border they can be confused for one or the other as monozygotic twins like like like a twin formed from the same egg the same seed order and disorder both so not equal but opposite? Don't forget that!
The haired3 physician.
The flayed priest.
The headless construction worker.
The engorged physician.
The missing physician4 .
As I said before, these ladies and gentlemen usually just appear facing walls inside our beloved Site-⌘, and being near them gives you those nasty tingling feelings that come when you’re inside the mouth of something simply awful. Probably if you stayed close to them too long you’d get crunched between those jaws.
And that should be in the Containment Procedures, shouldn’t it?
Special Containment Procedures (Part 2): Don’t stay near SCP-5310 too long.
Description (Part 2): With that out of the way, we can get back to these mysterious beings we call SCP-5310. Where did they come from? What do they want? We honestly have no idea, but I asked Professor Bixby after his daily Agnostic cocktail and this is what he had to say.
Well, bubble ruth ‘nd broth you’ve been walkin’ ‘nd talkin’ long I have, you ‘nd yours ken when business ain’t as business be ‘nd lookin’ those boys you ‘nd yours tell to wrongness - ‘nd wrongness, when you ‘nd yours smell it you ‘nd yours ken the shape o’ that beast that beastliness. You ‘nd yours pour water in bottle you ‘nd yours ain’t keepin’ water locked up key and chain and prison and ball water’s just bein’ given shape wit’ that plastic ‘nd shapeliness ‘nd contour ‘nd containment. Architecture o’ coincidence you 'nd yours make ‘nd you ‘nd yours get the shape that boy makes ‘nd if the shape be a man or a lady or a boy or a girl well that’s the world you ‘nd yours livin’ in, so make sure you ‘nd yours keep that shape all friendly one wit’ science broth ‘nd bourbon.
Allow myself to summarize in perhaps more understandable terms! Imagine you've made a box out of your own thoughts like a dangerous drunk driver swerving around the snows of Alaska in prime season like a prime rib steak on the prairie drawing in the sand and you draw a box from it and now there's a box there must be something in the box there must be something in the shape of the box and now that it exists it can break free so you must make a new box surrounding the box through your new clumsy choices but targeted, targeted my friends.
Oh, I should probably mention this - if we fuck up the Containment Procedures (the Special ones), we will one day look out and sight one or more of these beasts standing on the hill outside. If there’s one or two or even nine, that’s okay, that’s fine, it just means we need to do our Special Containment Procedures a little better to take this box we have driven in our Ferrari and indeed make but a simple left turn into the realm of the angle that greatly forms an impenetrable wall of causality (2, 3, 5, 7, 11, 13, 17, 19, 23, 29, 31, 37, 41, 43, 47 THESE SHALL BE IMPORTANT ANGLES) and proceed.
however, unfortunately.
if there’s ten up there, that means everything is over. it’s digestion time. alas.
unfortunate. unlucky. luckless. hapless. unhappy. unpleasant. displeasure. dis dis dis is not ideal. 0.00174533. 0.00174533. 0.00174533. i require a fresh dose.
Addendum 5310-1 (Weeky Interview)
As we agreed upon before embarking on this grand endeavor of ours - the den of understanding and virtue and the observation of the grains of sand that we look out on and indeed are but a single grain of sand observing via outwards microscope - this following log I’m about to put in here is a transcript of my weekly-check in with the main Foundation liaison we all know and love, Ernest5!
<Begin Log>
(Our protagonist, Doctor Irving Gat, walks into the interview room, a spring in his step and a twinkle in his eye. This isn’t his first rodeo, not by any means no sir no sir, but it never gets any easier under the intimidating gaze of his opponent. He’ll have to tread carefully and watch the movements of his tongue to make sure he represents the interests of Site-⌘ properly.)
“Good evening, Dr. Gat,” says Ernest, his fingers steepled like the pyramids of Giza. “I trust your ride here was pleasant?”
(An interesting question. There were approximately three-hundred and twenty-two bumps on the road while Dr. Gat was being driven here. So why would this olympian thinker, Ernest, ask such a question? Is it a trick?)
(Dr. Gat smiles and chuckles. He shan't be caught out so easily.)
Taking a seat with such force that the chair almost topples over, Dr Gat replies: “I trust you are pleasant, Ernest. And my trust is repaid. Haha.”
(Ernest raises an eyebrow. Nailed it.)
The messenger of the monolith, Ernest, clears his throat and continues: “I’ve been reading the file you sent out regarding SCP-5310. While the, ah … the tone here is somewhat lacking, what really concerns me is the consequences of the anomaly you describe here.”
“Okay.”
“More than once, you refer to SCP-5310 as though its something that can cause the destruction of … well, it’s difficult to say what exactly. You say ‘everything is over’ if all ten SCP-5310 instances appear on a hill, but what does that mean?”
(Now it is Dr. Gat’s turn to raise my eyebrow. His eyebrow, even.)
“I mean what I say, and I say what I mean, Ernest. Everything is everything, a palindrome in all but letters.”
“Do you have any evidence to support that statement?”
“Evidence? No, of course not. Why would I?”
(He sighs for some reason.)
“So - you expect me to just accept that this minor anomaly that does very little except stand in place is capable of causing an end-of-the-world scenario if you don’t perform a series of absurdly specific unrelated actions. And I’m expected to believe this just because you say it’s true, when you don’t have any evidence. And you admit you don’t have any evidence.”
“Yes!”
(He sighs again.)
“This … I understand it isn’t your fault, Irving - hell, those Agnostics must have done a number on you - but we can’t have this kind of nonsense present in an official report.”
(What is he talking about?)
Ernest continues: “I’ll tell you what. I liked you, Irving, when we worked together - and, and looking at you now … just … get this report rewritten without the baseless panic and I’ll just forget this whole thing ever happened. Out of respect of your previous achievements. Alright?”
(Ah! He is referring to my discovery of the Nth floor bathroom!)
“Well … I suppose that’s fine.”
(He passes the file over to Dr. Gat and puts his pen down. Immediately, Dr. Gat lunges forward and adjusts the angle of the pen by 0.00174533 radian. The pavorfiend coalescing behind Ernest immediately dissipates.)
(Ernest blinks.)
“Ah … Dr. Gat?”
“Sorry, the angle was bad.”
“I … I see.”
(Picking up the file, Dr. Gat tucks it under his arm and walks out of the room, whistling a tune as he skips down the hallway. Still, his mind is still on poor Ernest. Simply ignoring the obvious threat like that…)
(What is he, crazy?)
<End Log>
Footnotes
1. If you weren’t here on Monday, definitely don’t show up on Thursday
2. SCP-5310 instance? Specimen? The terminal terminology of this interminable terror is hard to pin down.
3. Hairy? Behaired?
4. You can’t always tell where a physician is, but you can definitely tell where it isn’t.
5. I do not remember his second name.
|
SCP-716 is a large locomotive and a variable number of cars, between eight and twenty on average.
|
***
Item #: SCP-716
Object Class: Euclid
Special Containment Procedures: Containment area is to be coated in lead shielding both inside and out. Should any section of the shielding become damaged, replacement plates are to be installed immediately. Chains and plates used to secure SCP-716 are to have lead shielding as well, and are to be replaced as soon as wear or corrosion is observed.
SCP-716 is to remain pointing at an external wall at all times. Should SCP-716 break containment and forcibly exit the containment area, recovery teams are to monitor SCP-716 and attempt recovery only when SCP-716 comes to rest. Recovery while still in motion may only be attempted with approval from O5 Command.
Areas with long-term exposure are to be sterilized after SCP-716 removal. Any biological organisms affected by SCP-716 are to be terminated unless required for testing. No humans are to enter R.E.M. sleep within two hundred meters of SCP-716 if uncontained, one hundred meters if contained. Anything exiting [DATA EXPUNGED]
No entry of SCP-716 is permitted at any time. Entry for testing purposes must be approved by Site Command.
Description: SCP-716 is a large locomotive and a variable number of cars, between eight and twenty on average. Both the locomotive and cars appear to be in an advanced state of neglect. Physical damage dealt to SCP-716 appears to slowly “regenerate” over time; however, it maintains an appearance of extreme neglect and rust. SCP-716 can be physically moved with difficulty; however, the locomotive appears to be unable to function normally and appears to be missing many critical parts.
SCP-716 exhibits a select form of inconsistent topography. While appearing to have a set number of rail cars from outside observation, the train exhibits an apparently unlimited amount of cars when entered. Almost all of these cars are enclosed and appear to be of random types (passenger, tanker, animal transport, mail, etc.). Many of them exhibit other anomalous properties, such [DATA EXPUNGED]. Some notable and recurring cars are a horse transport car with horse corpses hanging from ropes made of sheep tendon, a tanker car filled with a mixture of crude oil and human bile, a large transport car filled with stacks of keys made of many different materials, [DATA EXPUNGED].
SCP-716 is also capable of two forms of transport/movement. To begin with, it can travel and move in a manner consistent with a locomotive of similar dimensions despite the lack of vital parts, any form of fuel, or conductor. SCP-716 is capable of reaching speeds in excess of ███ km/h and can do so in a very short period of time. While it appears to “prefer” traveling on current or former rail tracks, SCP-716 is capable of “over land” movement as well, in a manner similar to SCP-1489. Observation of SCP-716 engaging in this movement in a urban area shows that activities that would damage/disable a normal locomotive (such as penetrating a three meter thick brick wall) do not impair SCP-716 in any perceivable way.
The second transportation/movement form exhibited by SCP-716 has only been observed with human subjects on board. The probability of triggering this mode appears to be largely random, but is more common in cases of groups of five or more subjects. Subjects report that SCP-716 will suddenly “shift” and begin to move, rapidly accelerating to top speed. Outside observation will show that regardless of subject reports and received data, SCP-716 remains completely still. Once SCP-716 begins this form of transportation/movement, subjects become unrecoverable.
SCP-716 also exhibits properties [DATA EXPUNGED](1)
Subjects exiting SCP-716 during the second form of transportation/movement [DATA EXPUNGED] (2)
Addendum:
[DATA RECOVERY (1): Level 2 Clearance required]
Consistent with a form of unknown radiation. This effect appears to emanate from SCP-716, and appears to expand the longer SCP-716 remains stationary in a location. Effects include:
<Expanded list and definitions with cited examples available from Central Records by request>
Alterations in the size/shape/behavior of local flora and fauna
Mass “suicides” and die-offs of local flora and fauna
Alteration in weather patterns and severity
Genetic damage, behavior alteration, and physical deformity in humans
Hallucinations (auditory, tactile, olfactory, visual)
Also of note is the behavior exhibited by individuals entering R.E.M. sleep within this “area of affect”. Subjects, after entering R.E.M. sleep, will begin to “sleepwalk” in the direction of SCP-716, even in individuals with no history of nocturnal disturbance. Subjects allowed to enter SCP-716 will enter the fetal position on the floor of one of the train cars, and continue sleeping normally. Groups of people entering in this way have been shown to be capable of triggering the second form of transportation/movement exhibited by SCP-716.
[DATA RECOVERY (2): Level 4 Clearance required]
Report seeing a vast, empty plane of hard-packed earth. This plane appears almost totally featureless, and without any sort of border. The only feature of any kind is “a endless string of train cars, going from one horizon to the other.” This is assumed to be SCP-716. Tests have shown the environment to be totally sterile, and lacking in any source of water. The plane appears to go through a 72 hour day-night cycle, with what is reported as a “too large sun” and no moon.
Subjects are still able to send and receive radio and other transmissions but they experience a progressive breakdown in clarity, with communication rendered impossible after approximately one month. This same property is exhibited by communication devices within SCP-716 itself.
Exploration and testing have raised [DATA EXPUNGED: RELEASE BY O5 ORDER ONLY]
|
SCP-2465 is a watercolor painting on white canvas, measuring 77cm x 53cm, entitled La Tristezza è Temporanea.
|
***
Item #: SCP-2465
Object Class: Safe
Special Containment Procedures: SCP-2465 is to be stored in a secure containment locker in Site 12. Unless being used for testing, SCP-2465 must be covered at all times by an opaque sheet. Under no circumstances should SCP-2465 be photographed or filmed.
Description: SCP-2465 is a watercolor painting on white canvas, measuring 77cm x 53cm, entitled La Tristezza è Temporanea.1 The subject depicted appears to change depending on the viewer, but approximately 85% of all observers agree that the subject is a Caucasian male, between 30-40 years of age, with red hair and a beard. It is also universally agreed upon by observers (regardless of artistic background) that SCP-2465 is of poor or middling quality at best.
Prolonged uninterrupted visual contact with SCP-2465 will cause its anomalous properties to manifest, resulting in the manifestation of an SCP-2465-1 instance. The time between observation and manifestation ranges from a minimum of 43 seconds and a maximum of 37 minutes. The greater the artistic experience of the observer (defined as their actual skill in art in conjunction with their formal art education), the quicker the anomalous effects will manifest.2
Once such time has elapsed, the observer, now designated as SCP-2465-1, will exhibit an intense emotional reaction to SCP-2465, ranging from frustration to disgust. 85% of all SCP-2465-1 instances then act upon a newfound desire to create something of greater quality than SCP-2465. The medium selected changes depending on SCP-2465-1's area of expertise, but if SCP-2465-1 has no artistic background, it will default to watercolor painting.
While SCP-2465-1's projects may begin entirely unrelated to SCP-2465, the finished product will always result in an attempted replica of SCP-2465, regardless of the medium. Examples of this effect include:
Painting: Results in attempting a direct replica of SCP-2465.
Pottery: Results in attempting to sculpt the figure depicted in SCP-2465.
Film (Live Action): Results in seeking out leading actors who are physically similar in appearance to the figure depicted in SCP-2465. The script will also be altered, regardless of the original intent, to tell the story of an unappreciated artist who meets a tragic end.
Film (Animation): Results in the lead character taking on the appearance of the figure depicted in SCP-2465. The script will also be altered, regardless of the original intent, to tell the story of an unappreciated artist who meets a tragic end.
Culinary Art: Results in cakes complete with frosting and decorations to give as close an appearance as possible to SCP-2465.
Photography: [DATA EXPUNGED]
3D Computer Graphics: Results in an attempt to create an unknown figure drawing SCP-2465 in the original retrieval site.
Literature: See Interview 2465-1
These replicas do not have anomalous effects, but filming or photographing SCP-2465 will result in a duplicate with anomalous effects. SCP-2465-1 very rarely realizes these anomalous effects until the moment of completion, suggesting that SCP-2465 influences the subconscious. Upon completion, SCP-2465-1 will demonstrate dissatisfaction with their work, and will attempt another project with similar results. Continued attempts result in SCP-2465-1 exhibiting distress that eventually manifests as severe depression. Class A amnestics have proven effective in reverting SCP-2465-1 to mental states prior to being exposed to SCP-2465. At the time of this writing, no instance of SCP-2465-1 has successfully reverted to prior mental states without use of amnestics.
SCP-2465 was acquired in 19██ from an abandoned household in Arles, Italy. SCP-2465 first came to the Foundation's attention when six real estate agents entered the premises, thereafter becoming the first recorded instances of SCP-2465-1.
Records show the last owner of the household was one ██████ █████████. █████████ died in 18██ of a self-inflicted gunshot wound. Present at the site of retrieval were what appeared to be several drafts of SCP-2465, all destroyed. It is currently hypothesized given the art style and the age of the canvas that SCP-2465 was originally painted in 18██.
Attached to SCP-2465 at the time of retrieval was a letter (translated from Italian below):
My dearest friend ███████,
I have heard that you have not been feeling well these past few weeks. I offer my most sincere sympathies. I can only hope that one day you overcome your demons, and continue your work. In the meantime, though, I offer you this painting as a gift. It's you! I know I'm no artist (unlike you, of course), but I thought maybe it'd be fun to poke fun at. You know, poor old ██████. Can't draw a damn thing with those fat fingers of his! Haha!
I really do worry after you, though. Please, promise me that before you choose to do anything rash, you'll come to me first. I'll make you some tea, we'll sit by the fire, and perhaps afterwards we'll chart the night sky together again. Remember: what you're going through, many have overcome. You will survive this. I promise. Don't listen to the people, how they bray; you're no lunatic, and you don't belong in that asylum. I believe in you, even if you don't believe in yourself right now.
Love, always,
██████
+ ACCESS INTERVIEW 2465-1
- CLOSE INTERVIEW 2465-1
Foreword: Dr. Sturm interviewed SCP-2465-1-68, a science fiction author. Time since exposure to SCP-2465: 56 days.
Start Log
Dr. Sturm: Good afternoon.
SCP-2465-1-68: Heya Doc, how's it going?
Dr. Sturm: Can't complain. Yourself?
SCP-2465-1-68: I… I gotta be honest with you Doc, I want out.
Dr. Sturm: I don't follow.
SCP-2465-1-68: I mean I want you to cure me. Like, now.
Dr. Sturm: When we interviewed last week, you were quite adamant. You stated you were fervently against the amnestic treatment, that you wanted to, and I quote, "beat this thing at its own game."
SCP-2465-1-68: Yeah, well, that was then, and this is now. I can't deal with this. Not anymore.
Dr. Sturm: What made you change your mind?
SCP-2465-1-68: See, I was back at home at my desk, writing like normal. I mean, at first it wasn't so bad, I would just have to go back and edit stuff I'd written, like I'd accidentally put down a character as a redhead instead of a brunette. But then it got worse.
Dr. Sturm: Worse how?
SCP-2465-1-68: See, and this is the fuckin' crazy part Doc, this is where it gets really fuckin' weird. I kept writing, but I noticed something was off.
Dr. Sturm: Off?
SCP-2465-1-68: Like something was wrong. I kept fucking with the margins. I kept fucking with the margins, and I kept telling myself "it's all okay, it's an artistic choice." But then I started finding a pattern. And then I put it all together.
Dr. Sturm: What kind of pattern?
SCP-2465-1-68: You're not gonna believe this.
Dr. Sturm: Try me.
SCP-2465-1-68: I printed out what I'd written that day. That's a full thirty pages. And I laid them out on my living room floor. The words, the margins, the pages… they're all part of it. Putting them out on my floor created a bigass version of that crappy painting.
Dr. Sturm: Hm. And what of the quality of the writing itself?
SCP-2465-1-68: You kidding me? It wasn't until after I took another look that I found I was just writing out descriptions of that painting over and over again. I didn't even know I knew that many ways to say "the jackass has red hair."
Dr. Sturm: Interesting.
SCP-2465-1-68: "Interesting?" That's all you got for me?! I… sorry. It's just that the worst part of it all is that I genuinely want to go back and try again. I know I can do better. But it looks like I'm simultaneously creatively bankrupt while being more driven to write than ever. It's like, all I want to do is shit, but at this point I'm out of shit to shit, but I'm sitting on the shitter and it feels like I'm gonna be shitting out my intestines real soon. Do you get me, Doc?
Dr. Sturm: I… think I understand.
SCP-2465-1-68: Then do me a solid and show a little sympathy. Put me under. Let me really write again.
End Log
Closing Statement: SCP-2465-1-68 has since been given the amnestic treatment. All anomalous effects have since dissipated. Further observation has been discontinued.
Footnotes
1. Literally "Sadness is Temporary" in Italian.
2. Painting, drawing, and sculpting have had the greatest effect. Other media such as writing, filmmaking, and photography work less effectively, but still cause anomalous effects faster than a subject with no artistic aptitude.
|
SCP-3638 is a two-meters tall, partially incorporeal, remarkably impotent predatory entity.
|
***
Item #: SCP-3638
Object Class: Safe
Special Containment Procedures: SCP-3638 is located in a custom-built clear acrylic glass cell1 in Area-130. A group of four agents posted around its cell act as the primary containment construct for SCP-3638's remote effects (supplemented by two other groups in nearby isolated rooms with live vital signs data from each other, acting as fail-safes). Agents are to operate in four hour shifts and are to be provided with any source of entertainment that they request. The use of non-anomalous mood-altering substances may be exceptionally allowed at the discretion of supervisors.
In the event of a breach, recontainment strategies rely upon proficiency in Procedure 382-Diogenes among all personnel aware of SCP-3638's existence, irrespective of site. Derisive language and emphasis on its benign nature are thus encouraged in all exchanges and documentation. This may even take precedence over accuracy in non-critical contexts2.
Description: SCP-3638 is a two-meters tall, partially incorporeal, remarkably impotent predatory entity. It has an arthropod-like segmented structure, with a bloated terminal segment bearing eight four-jointed legs with numerous curved spikes on their tarsi. Each of the other segments bears two curved spikes and one flexible, comically obscene tendril (see fig.1). The entity is always visible, but can suppress all other interactions with matter (e.g. bypass physical barriers) seemingly at will.
Its behavior is understood to be heavily influenced by certain characteristics of sapience: known targets have included adult humans, adult cows, dogs, and a class-III AI construct. Young children, cow calves, and other animals/organisms have consistently been ignored (including in situations of complete vulnerability to attacks). Those who are aware of its existence are primarily targeted, in order of proximity. In cases where no such organisms remained in its surroundings, it has been observed to translocate instantly to reach the next-closest sapient being aware of it. This has been noted as comparable to the routine of a stage magician.
The entity appears unable to initiate a new attack until its current target expires, or until there is a new vulnerable target closer to it. It has been postulated to be greatly frustrated by the ridiculous nature of this behavioral defect highlighting its overwhelming inadequacy.
All observed attacks have occurred in two stages. First, the entity stays stationary and remotely accesses the mind of its prey (as evidenced by vocalizations consistent with knowledge of their thoughts). When this stage is prolonged, brief indistinct hallucinations are induced infrequently. If certain mental features are present (see next paragraph), it becomes immediately able to initiate the second stage: physical assault. The most notable specificity of its aggression techniques is flailing movements reminiscent of a distressed poultry bird, or an oblivious scurrying insect.
Established cognitive patterns that enable the progression to stage two include sustained fear of the entity, inquisitive fascination, visceral disgust, and a disciplined stoic demeanor; best described collectively as "taking it seriously". An indefinite maintenance of stage one (with a continual rotation of agents successively acting as the primary target) has been achieved through a derisive, irreverent mindset, formalized as Procedure 382-Diogenes.
Temporary failures to maintain this outlook do not immediately trigger an attack. Losses of focus3 lasting up to 30 seconds have been reported with no consequences.
Vocalizations from the entity have occurred occasionally since initial containment, typically in the form of amusingly melodramatic threats that greatly overstate its importance and betray human-like psychological flaws, most notably histrionic delusional power fantasies.
Recorded examples of vocalizations include:
"I encompass your sanity. You don't have to think about it now, you will learn later."
"Little treats, dancing on my mind's tongue! Delightful."
"You're exhausted. Don't you want some rest?"
"Cockroaches in your skull, scuttling on your thoughts!"
"You were scared for a split-second. I felt it, delicious. Remember! Think about it again!"
"Gravitas, gravy-taters, omnia grab-its-ass"
"Your mockery is getting quite dull. I may just get bored and stop playing along one day."
Note: although this is not currently verifiable, it has been hypothesized that if the entity were fully corporeal, its smell would be similar to urine and feces.
Footnotes
1. Observation has been shown to be beneficial to the enactment of psychological procedures.
2. For instance, the entity was formerly classified Keter but was found to be far too inept and uncoordinated to deserve this label.
3. Described by agents as the inadvertent onset of fear or doubt regarding the entity's innocuousness.
|
SCP-1580 is a Quercus virginiana specimen, also known as the Southern Live Oak.
|
***
Item #: SCP-1580
Object Class: Safe
Special Containment Procedures: SCP-1580 is currently held in the Site-30 terrarium, within a 7 by 7 meter lot. Instances of SCP-1580-1 are to be constantly monitored for alterations in behavior or vocalizations. Attempted communication with sapient instances of SCP-1580 is currently prohibited.
Description: SCP-1580 is a Quercus virginiana specimen, also known as the Southern Live Oak. It currently has a limb spread of 19 meters and is 22 meters in height (10/3/2010). SCP-1580's age is currently estimated to be 65 years, and it shows no remarkable qualities regarding its physical appearance or composition. SCP-1580 sheds its leaves at a heightened pace, ranging from 70 to 180 in one minute. SCP-1580's main anomalous property is the autonomous nature of its leaves, designated instances of SCP-1580-1.
Instances of SCP-1580-1 display no anomalous properties until they are detached from SCP-1580; this may be caused through either manual removal by outside forces or SCP-1580's anomalous property. Upon making contact with a solid surface, an instance of SCP-1580-1 will sprout four limbs, extending from its veins. SCP-1580-1's veins grow about 2 cm from their original positions, and are used for both bipedal and quadrupedal mobility.
After developing these limbs, SCP-1580-1 will attempt to travel to where it originally grew on SCP-1580. It will use all four limbs to climb SCP-1580's trunk; once it reaches its original location, it will seamlessly reattach its stipule to the branch by physical contact. Instances of SCP-1580-1 appear to display sentience, as they wait for other instances to reattach themselves before continuing to climb to their branch. Preventing an instance from reaching its branch will cause its limbs to recede back into itself, and decomposition will begin as expected. SCP-1580 will begin to naturally grow another instance of SCP-1580-1 if any are destroyed or otherwise removed from its proximity.
Whispering of 15 to 18 db can be heard from all instances. Attempts to record single instances of SCP-1580-1 will cause the instance to cease speech, and no coherent speaking can be singled out in recordings of all instances at once. Further study on the possibility of sapience is underway.
Addendum 1580-A: All instances of SCP-1580-1 halted on ██/█/████. Recordings of the event, under later inspection, revealed one instance of SCP-1580-1 to be speaking at 38 db. No evidence of the event described by the instance has been found, and evaluation of the involvement of [REDACTED] in society is under consideration.
Today, one whole tale has been forgotten. Not just simply left in the archives of an old, but left in their withered corpse. An occasion that rarely occurs.
How many years has it been since the first one? Time went from crawling to flying, though I do not know how.
Look at me now. The only reason I'm still here is my immaturity. Making myself bustle and hustle about. I'm no more in worth than the villages of today. This is not how I should be. Sickening.
My tale has already been long forgotten. I cannot remember it myself. Ah, how I wish for days past. But today, I am trapped with the very men and women who vanquish tales. Those that are left alive today are nothing but warped figures of what used to be.
Never mind my rambling. I will continue my shrieking. Remembrance is nice, even if it's made from those you despise.
After the first coherent vocalization of an SCP-1580-1 instance, all instances began to repeatedly speak the following (██/█/████):
We climb and climb, afraid of time,
It ticks and tocks, like falling blocks,
Don't want to die, in tears and grime.
Our mother's locks, her lovely flock,
We cannot cry, so life's sublime,
We're ne'er not fast, and though we laugh,
Only a few fairy tales can last
When a foundation rips apart the past
|
SCP-3563 is a phenomenon that occurs throughout New England, primarily affecting southern Maine and northern New Hampshire.
|
***
Item #: SCP-3563
Object Class: Keter
Special Containment Procedures: Due to its nature, SCP-3563 cannot be contained at this time. Containment efforts of SCP-3563 should instead be focused on determining locations in which additional manifestations may occur.
In the event that a manifestation of SCP-3563 is confirmed, Foundation personnel are to be deployed to the reported location immediately. A standard 50m² Federal Bureau of Investigation grade mobile morgue unit is to be established over SCP-3563, and the surrounding area is to be marked off with police tape corresponding to the appropriate local metro police department. Two level-2 guards are to be stationed outside of the morgue unit until such a time that SCP-3563 disperses. Guards stationed outside of SCP-3563's mobile containment unit are to be outfitted with uniforms appropriate to local police force.
Civilians affected by SCP-3563 are to be administered Class-A amnestics and released from Foundation custody.
Description: SCP-3563 is a phenomenon that occurs throughout New England, primarily affecting southern Maine and northern New Hampshire. Manifestations of SCP-3563 only occur in towns with populations of at least five hundred, but no more than one thousand. Foundation researchers have determined that manifestations of SCP-3563 only occur when locations matching the following criteria are present:
An abandoned or vacant home that has previously been on the market.
The neighborhood surrounding abandoned home has families currently living in said neighborhood.
Abandoned home must have previously been owned by a family with at least one child.
Child of previous owners is either missing or deceased.
Manifestations of SCP-3563 appear exclusively outside of locations that meet the above conditions, typically at the end of the driveway of said home, or on the front yard.
SCP-3563 manifestations are comprised of two components, SCP-3563-1, and SCP-3563-2.
SCP-3563-1 is a lemonade stand built from non-anomalous plywood and timber1, kept together with cap nails and screws. In at least 85% of recorded manifestations, SCP-3563-1 has been noted to have a sign posted above its counter that reads "Lemonabe[sic], 25¢!" in red and yellow crayon or paint.
SCP-3563-2 is a human child of varying gender, race, and ethnic background but always appearing between the ages of seven and twelve. DNA testing has confirmed that SCP-3563-2 entities directly correspond to real-world children who have been declared missing or deceased within at least two years of SCP-3563 manifesting.
SCP-3563-2 will try to sell lemonade to any human beings for a quarter, though have been noted to also sell pink lemonade, iced tea, and an unknown liquid metal with consistency similar to tar. SCP-3563-2's behavior is typical of children of its age; instances have consistently been friendly with Foundation personnel.
Any humans who purchase and consume lemonade bought from SCP-3563 will be compelled to enter the vacant home in which SCP-3563-1 is premised. SCP-3563-2 will continue to sell lemonade until at least ██ humans have entered the house, at which point SCP-3563-2 will leave SCP-3563-1 and enter the home. SCP-3563-2 then proceeds to [DATA EXPUNGED], leaving behind only the organs, monetarily valuable on person belongings, and — on several occasions — teeth that have been filled with precious metals.
Attempts to follow SCP-3563-2 into the home, or prevent SCP-3563-2 from entering, have resulted in the deaths of at least █ Foundation personnel. Attempts to locate SCP-3563-2 afterwards have resulted in little success, with tracking devices going offline as soon as SCP-3563 disperses, and attempts to follow SCP-3563-2 leading to the entity disappearing as soon as line of sight is broken.
+ Show Interview Logs 3563 [LEVEL 2 ACCESS REQUIRED]
- Access granted, displaying interview logs.
Interview Log SCP-3563-2-03
Interviewed: SCP-3563-2-03
Interviewer: Guest Researcher Dr. ██████
Foreword: Interview was conducted on 03/09/20██ in order to ascertain the correlation between SCP-3563-2 and the real-world children they correspond to. DNA testing has confirmed that SCP-3563-2-03 is Dexter Hawshore, an eight-year-old boy who was found dead in ████████, Massachusetts eight months earlier outside of Barrymore Brothers Candy Barrel; cause of death was blunt force trauma to the head. Dexter apparently tripped and collided with the concrete.
<Begin Log>
Dr. ██████: Hello, are you selling lemonade?
SCP-3563-2-03: Yep! Mr Ha-… Mom and pop said if I can make five dollars they'll take me to the candy store, and let me get whatever I want.
Dr. ██████: Let me guess, the Candy Barrel?
SCP-3563-2-03: Subject pauses, taking a few moments before responding. Wanna buy some of my lemonade? It's homemade, pop helped me squeeze the lemons himself. Only a quarter!
Dr. ██████: And when was the last time you saw your father?
SCP-3563-2-03: That's an easy one! I saw him-… Subject falls silent for a moment, looking at the ground. Huh… Uhm, say, wanna buy some lemonade? It's homemade, pop helped me squeeze it himself!
<End Log>
Closing Statement: It would appear that there is a direct connection between SCP-3563-2 and the children that they seem to represent, though the means through which this connection is established is still unknown. SCP-3563 dispersed seventeen minutes after interview.
Interview Log SCP-3563-2-08
Interviewed: SCP-3563-2-08
Interviewer: D-1252, female, Caucasian, 25 years old. Charged for three hit and runs, and the murder of a federal officer. No diagnosed mental conditions.
Foreword: Interview was conducted on 12/02/20██, directly after SCP-3563-2-08 had entered the abandoned home. Subject was covered in human cerebrospinal fluid at the time of interview. Dental records confirm that subject is Daniella Oakes, an eleven-year-old girl who has been missing for four months.
<Begin Log>
D-1252: J-Jesus fucking Christ, this place is a mess.
SCP-3563-2-08: Hi! I'm sorry, I don't have any lemonade left to sell, I just finished squeezing out the very last drop.
D-1252: What… Happened in here? Doc, am I supposed to be asking this kid something?
Dr. Grant: I need you to ask it about its memories, if it remembers anything prior to three months ago.
D-1252: Alright, uh… Right, so uh, what's your deal, kid? You a ghost or something? According to the papers I got you've been missing for three months.
SCP-3563-2-08: Nuh uh, no way! Ghost aren't real, my daddy says so. Besides, I've been playing with Mr. Hat until today! He said that I'm gonna help him make money, so I'm selling lemonade!
D-1252: Right, and this Mr. Hat is what, your dad? Do you remember the day you went missing?
SCP-3563-2-08: Nuh uh, I haven't seen daddy since uh… Since he said he wanted to go walking in the woods, so we went on a nature hike and then-… Uhm. Subject falls silent for several moments. I'm sorry, I have to go now.
<End Log>
Closing Statement: Subject proceed to flee the home, D-1252 was instructed to follow the entity, but lost sight of it as soon as it got out the back door. SCP-3563 dispersed shortly after. Investigation into an entity known as 'Mr. Hat' is underway.
Interview Log SCP-3563-2-14
Interviewed: SCP-3563-2-14
Interviewer: Dr. Grant
Foreword: Interview was conducted on 04/02/20██. SCP-3563-2-14 had succeeded in selling █ cups of lemonade before Foundation personnel arrived on scene. Mobile task force units were deployed into the home in which SCP-3563 had manifested, and extracted the civilians inside. Civilians were thereafter administered Class-A amnestics and released. DNA test were inconclusive, and the identity of SCP-3563-2-14 is unknown. Subject is male, appears to be between the ages of ten and twelve, and is of African-American descent.
<Begin Log>
Dr. Grant: Hello SCP-3563, how are you today?
SCP-3563-2-14: Hey mister, want to buy some lemonade? It's real cheap, only a quarter.
Dr. Grant: What can you tell me about 'Mr. Hat'?
SCP-3563-2-14 I don't understand the question, what is this? How do you know about-… What's happening? Subject becomes visibly uncomfortable, scratching at its arm in agitation. Do you want to buy some lemonade, sir?
Dr. Grant: Answer the question, SCP-3563. Who is Mr. Hat? Did you meet them after you disappeared?
SCP-3563-2-14: Mr… No, I'm sorry I'm not supposed to talk to strangers about business models I-… He'll hurt me if I do.
Dr. Grant Who will, Mr. Hat?
SCP-3563-2-14: The man in the hat, he's coming for you now. You shouldn't have asked so many questions.
Dr. Grant: This man in the hat, what does he look like?
SCP-3563-2-14: Would you like to buy some lemonade? It's only a quarter.
<End Log>
Closing Statement: Subject became unresponsive after this, continuing to try to sell lemonade in lieu of answering questions. SCP-3563 dispersed thirty minutes later. Approximately two hours later, Dr. Grant was found dead floating in the ██████ river, almost four kilometers away from the initial SCP-3563 manifestation. Autopsy reports indicate Dr. Grant was beaten to death with a brick, with blood splatter and misting consistent with similar bludgeoning cases.
Addendum 3563-a: On 08/14/20██, the Foundation received reports from deep cover agents that large amounts of organs and other valuable human organic matter had been sold on the underground market in ████████████, Maine. Agents were tasked with locating the buyer, and were led to James ██████, a 24-year-old narcotics dealer who had purchased the organs, along with several watches, three leather wallets, and thirteen teeth that had been filled with pure grade silver. When questioned about where he had gotten these items, subject told Foundation agents that he bought them from a 'man in a dark overcoat, wearing a brimmed hat'. He was unable to answer any further questions in regards to who he had purchased the items from, citing that it had been 'real dark' at the time. Subject was administered Class-A amnestics, and released into the custody of local authorities.
Addendum 3563-b: As of 09/24/20██, the 'Man in the Hat' has been designated as Foundation POI-528. Foundation agents are to report any further large quantities of organs being sold on the black market in New England directly to Site-██.
Footnotes
1. Though has been recorded as being built from birchwood on three occasions, and oakwood on two.
|
SCP-1269 is a black, aluminum curbside mailbox, possessing a red flag and a white, plastic post.
|
***
Item #: SCP-1269
Object Class: Euclid
Special Containment Procedures: The property where SCP-1269 is located is to remain under the custody of the Foundation. No females 23 years of age or over are to enter the property except for testing purposes. One male researcher is to reside within the property under the guise of the current resident, and is to monitor the behavior of SCP-1269.
Description: SCP-1269 is a black, aluminum curbside mailbox, possessing a red flag and a white, plastic post. SCP-1269 stands 1.3m tall, with the mailbox measuring 49.5cm x 15.2cm x 17.7cm, consistent with the T2 mailbox size in the United States. The number ███ is printed on the right side. It lacks any manufacturer's marks, and has minor dents and abrasions, suggesting the object has been present on the same property for some time. Due to the nature of SCP-1269's effect, the object is permanently located in ████████, Massachusetts in front of house number ███ on ███████ Avenue.
SCP-1269's anomalous properties will manifest only when a single female 23 years or older (hereafter referred to as "the occupant") resides within the same property as SCP-1269. Approximately two weeks after the occupant moves in, SCP-1269 will start to manifest unaddressed letters every four days. The contents of the letter are romantic in nature, and are targeted towards the occupant of the house. Surveillance within SCP-1269 has shown the letters manifest approximately three seconds after the occupant's mail has been delivered.
Exactly three weeks after the appearance of the first letter, SCP-1269's secondary anomalous properties will manifest. Letters will begin appearing daily, with contents becoming increasingly more obsessive and erratic, until the point that letters regress into single sentences. In some occasions, multiple letters will appear within SCP-1269. Additionally, when not under direct supervision of the occupant, SCP-1269 will teleport to a location near the occupant and face them. This location will be partially obstructed, such as behind windows, cracked doors, and shower curtains. Under special circumstances, such as during sleep or when obscured by darkness, SCP-1269 will teleport near the occupant without obstruction. Whether or not the occupant relocates SCP-1269, the object will continue to teleport between a range of one to five times every twelve hours. SCP-1269 will not follow the occupant off the property, and all anomalous properties will cease manifesting after the occupant has either moved or expired.
Attempts to remove SCP-1269 from its location have so far been unsuccessful. SCP-1269 will teleport to its original curbside location after one hour of relocation. If attempts are made to replace SCP-1269 with a new mailbox, the mailbox will be teleported away with SCP-1269 appearing in its place. Approximately three hours after the disappearance of the new mailbox, it will reappear in a dumpster 25km away behind an abandoned ███████ franchise. Mailboxes recovered so far have all been found in varying amounts of disrepair, within garbage bags, and covered in painted-on words and phrases.
Addendum SCP-1269-A: On 07/12/04, D-69124, a male, was moved onto the property with the current test occupant, D-72803, after seven weeks had passed. SCP-1269 stopped teleporting at this time. Three days later, D-69124 disappeared from the property, causing SCP-1269 to resume all anomalous behavior.
Two weeks after disappearance, D-69124 was found in similar location as other replacement mailboxes. The subject was found within a large garbage bag with severe bruising and lacerations, an apparently fatal blow to the head, and a lack of hands and lips. See Documents SCP-1269-B for recorded phrasing.
Documents SCP-1269-A
ACCESS GRANTED
Transcribed below are several letters delivered to D-871523, who temporarily resided within the property of SCP-1269 for testing.
07/21/98
I remember the day, the hour, the infinitesimal sliver of a second when I fell in love with you, realized I loved you and only you, the moment my heart stopped and I lived for you alone.
Perhaps it was the way you carried yourself on the tired days, perhaps it was the way your eyes shone when a transient beauty crossed your path; would you understand how I longed to be that butterfly dancing on the afternoon breeze, that small flower struggling through sidewalk cracks, that passing swanlike cloud in the sky, how I longed to be anything that would catch your eye and move your smile?
You pass by me each day, never sparing me more than a glance, but for me it is enough to carry me until the next day, as I wait to next catch a glimpse of you and your unearthly beauty, your charming laugh and graceful step. I love the way you dance whenever you walk, I love the way you tilt your head towards the sun, I love everything about you, I love you.
08/09/98
How could anyone describe one as perfect as you, vision of elegance and loveliness? Every action of yours I’ve observed is embodied in the fragility and delicacy of a twirling snowflake, and yet you waltz into eternity with the softest of motion, in perfect rhythm with the air and the world.
You are beautiful. Every step, every pause, every breath of yours is a masterwork of the divine. Your presence brightens the world with a light that cannot be compared, you are the flower that nature cannot hope to match.
08/15/98
The color of your eyes reminds me of the depth and expanse of the night sky, a vast dazzling macrocosm of soft velvet and glimmering pinpricks of light.
8/18/98
Do you sing in the shower? If so, I’ve heard you. Such a tenderly beautiful voice matches its owner.
8/21/98
I think of you and nothing but you as the day flows by, I yearn for a faint shimmer of your face as everything darkens to night
8/24/98
The wind was blowing and I thought it whispered your name sadly because that is what my heart is doing please write back
I keep thinking of the way your hair shines softly in the evening light, as if each strand is a shaft of purest moonbeams please write
8/26/98
The trees drop their leaves and cry with me as I stand here alone, without you please write xoxoxo
My shadow grows longer as if reaching towards you please write xoxoxo
I miss the light in your eyes and the harmony of your voice please write xoxoxo
Documents SCP-1269-B
ACCESS GRANTED
Transcribed below are various phrases written on mailboxes disposed of by SCP-1269.
SHE'S MINE SHE'S MINE SHE'S MINE SHE'S MINE YOU CAN'T HAVE HER SHE'S MINE SHE'S MINE
FUCK YOU YOU PILE OF PLASTIC AND WOOD SHE IS MY EVERYTHING YOU ARE NOTHING TO HER IT WAS A FLING AND I KNOW IT I'M DOING HER A FAVOR
NO NO NO NO NO NO NO YOU CAN'T HAVE HER NO NO NO I WON'T LET YOU NO NO NO NO
WHO CARES IF YOUR FLAG IS BIGGER THAN MINE I KNOW SHE DOESN'T CARE SHE ONLY SEES THE GOOD IN PEOPLE AND YOU ARE FULL OF SHIT YOU FUCKER
I KNOW SHE LOVES ME IT'S OKAY BABY IT'S OKAY I LOVE YOU TOO AND WE'LL BE TOGETHER FOREVER AND EVER
YOU ARE NOTHING BUT A TOOL FOR HER USE BUT I AM MORE I AM HER EVERYTHING AS SHE IS MINE SHE USED YOU SHE USED YOU SHE USED YOU AND NOW YOU'RE WHERE YOU BELONG
(see Addendum SCP-1269-A)
WHAT IS A MAN BUT A PILE OF SHIT THAT GETS IN THE WAY OF MY LOVE HOW CAN SHE EVER LOVE YOU WHEN YOU'RE SO EASILY BROKEN SHE NEVER EVEN LET YOU TOUCH HER I SAW THE WAY SHE LOOKED AT YOU WITH HATRED AND NOW SHE WILL LOVE ME FOREVER
|
SCP-5445 is a bacterial infection transmissible between humans and restaurants.
|
***
SCP-5445
rating: +97+–x
Threat Level: Yellow
Special Containment Procedures: Restaurants in the Middle East/North Africa (MENA) region are to be regularly checked for the presence of SCP-5445, with particular attention paid to restaurants within 10 kilometers of known infected. Infected restaurants are to be closed under the pretense of health code violation. At the behest of the Egyptian and Libyan governments, restaurants may be reopened after the incorporation of powerful antibiotic recipes into the menus, followed by careful observation.
Following closure, restaurant accounts are to be examined for SCP-5445-1 sales. Individuals found to have ordered SCP-5445-1 are to be located and detained by Mobile Task Force Lambda-14 ("Manhunters"), and transferred to the on-site restaurant of Site-98. Subjects are to be coerced into ordering the two-course antibiotic prix fixe by any means necessary, after which they are to be administered Class-A Amnestics and released.
A single culture of SCP-5445 is kept for study in the Cafe Scolex, a Foundation front restaurant located in a secure containment cell of Antarctic Research Area-1483.
Description: SCP-5445 is a bacterial infection transmissible between humans and restaurants. Within humans, SCP-5445 is entirely asymptomatic.
Restaurants infected by SCP-5445 experience an incubation period of approximately two weeks, after which initial symptoms manifest. Early-stage infected are marked by a sudden increase in sanitation and subjective food quality, as well as decreases in menu prices and wait times. As such, infected restaurants typically experience an increase in business traffic. Following a period of one to three weeks, SCP-5445-1 will be incorporated into the menu without warning.
SCP-5445-1 is the primary vector of SCP-5445, growing in tight clusters within designated food storage areas. SCP-5445-1 appears as an entree, consisting of a human skull soaked in blood1. Infected menus largely describe SCP-5445-1 as a "fair trade delicacy", consumption of which offers a variety of somatic and psychological benefits. Restaurant staff universally consider SCP-5445-1 to be a natural addition to the menu, albeit "adventurous".
Restaurant-to-human transmission of SCP-5445 occurs through the consumption of SCP-5445-1, while human-to-restaurant transmission occurs through monetary exchange. While antibiotic treatment has been found to be 99% effective in eliminating SCP-5445, treatment must occur within the context of restaurant food.
As of 31/07/1998, ███ restaurants and ███ humans are known to have been infected with SCP-5445. The process by which a bacterial agent can infect social constructs (such as restaurants) is poorly understood; research is ongoing, under the supervision of Dr. Guy Echo.
SCP-5445-1 possesses no known compulsive property.
Footnotes
1. Genetic testing has determined the blood to be human, mixed with trace amounts of [REDACTED]
|
SCP-3602 is a community of approximately 400 Rhinopithecus roxellana, more commonly known as the Golden snub-nosed monkey.
|
***
Item #: SCP-3602
Object Class: Euclid
Special Containment Procedures: Site-220 is to retain at least one Mandarin-speaking parazoologist specializing in primate behavior and psychology. This researcher, which since 1968 has been Dr. Shufan Shen, is to serve as a liaison to SCP-3602. At least twice weekly, Dr. Shen must conduct visits for the purposes of observation, information gathering, and diplomatic relations. Following Incident-SCP-3602-01, a Mandarin-speaking psychiatrist must also be retained to conduct bi-monthly therapy sessions with each instance of SCP-3602-A.
All instances of SCP-3602-A and SCP-3602-B are to be contained within a secluded region of Site-220's Parazoology Reserve, known publicly as the Baihe Natural Reserve.1 Each instance is to be fitted with a remote tracking device, with newborn SCP-3602-B instances receiving one at 6 months of age. Remote surveillance of SCP-3602 is to be maintained at all times, with the recording of SCP-3602-A instances prioritized. Any attempt by an SCP-3602 instance to leave the Parazoology reserve is to be punished by 1 week of confinement within Site-220's holding cells. Repeat offenses are to be punished by confinement periods with lengths escalated accordingly.
Description: SCP-3602 is a community of approximately 400 Rhinopithecus roxellana, more commonly known as the Golden snub-nosed monkey. All instances of SCP-3602 are sapient and capable of human speech. Mandarin serves as the primary means of communication, with several local dialects spoken less commonly by older members of the community. Instances have no physiological deviations from non-anomalous specimens, and, with the exception of SCP-3602-A instances, have identical sustenance needs and lifespans. How SCP-3602 instances are capable of human vocalization despite the lack of morphological deviation is unknown. The community makes regular use of simple tools, and is able to utilize fire as a source of warmth.
The SCP-3602 population is divided into two distinct groups, SCP-3602-A and SCP-3602-B. SCP-3602-A is a group of 18 specimens that are biologically immortal, with an estimated age of 1800-2200 years. SCP-3602-A serve as the leaders of the community, with roles analogous to that of tribal elders in many human societies. SCP-3602-A instances are incapable of sustaining serious injury regardless of circumstance, and appear to display a high degree of metaphysical permanence. SCP-3602-B instances form the remainder of the community, and are all descended directly or indirectly from the 18 instances of SCP-3602-A.
SCP-3602-A claim to be followers of the Chinese deity Sun Wukong, who they credit for their sapience and immortality.2 The oral history of the community is primarily based on Wukong and his exploits. Particular emphasis is placed on his rebellion against the Jade Emperor and the defacement of the register of death, the latter of which is claimed to be the reason SCP-3602-A are unable to die. Tales often end with an instance of SCP-3602-A informing the assembled SCP-3602-B instances that Wukong will someday return to lead them to glory. Multiple instances of SCP-3602-A have confided to Dr. Shen that the storytelling is intended to motivate SCP-3602-B towards ambition and self improvement.
SCP-3602-B display noticeably lower intelligence than their immortal forebears, with most having comparable intelligence to Human children aged 5 to 9. Subjects are generally cheerful, easily amused, and have a low attention span. On three occasions between 1968 and 1981, Dr. Shen observed a large scale effort by SCP-3602-A to educate SCP-3602-B on the use of more complex tools. Most notably, in 1975 SCP-3602-A attempted to convince SCP-3602-B to construct and reside in permanent structures. These attempts have failed without exception due to lack of interest on the part of SCP-3602-B, who often mollify their elders by displaying usage of more simple tools instead.
Incident SCP-3602-01: On 04/04/1984, SCP-3602-A-9 attempted suicide via self immolation, but was unsuccessful due to its anomalous qualities. Instance was then taken to Site-220 for interrogation regarding the incident.
+ Show Interview Log
- Hide Interview
Interviewed: SCP-3602-A-9. Subject is among the primary matriarchs of the community, and responds to the name Sun Daiyu.
Interviewer: Dr. Shufan Shen
Foreword: Subject was in considerable emotional distress during transport to Site 220, and 2 days elapsed before subject was considered calm enough to be interviewed. Interview is translated from the original Mandarin.
<Begin Log>
Dr. Shen: "Daiyu, what happened? You've never shown suicidal urges before, why did you try to kill yourself?"
SCP-3602-A-9: "Oh tall one3, you've walked among us for more than ten years and yet know so little. This isn't the first time I've tried, nor will it be the last. All among the elders have tried at least once."
Dr. Shen: "…Why? You all have your children, your family, your history. I just don't understand."
SCP-3602-A-9: "I have lived for two thousand winters. In that time I have birthed, raised, and outlived countless numbers of my children. I have watched our home disappear and the brief glory of our past be forgotten. Sun Wukong raised us up, made us immortal, and together we challenged the gods themselves. How could we ever be satisfied living like the animals we once were? We saw the sun and now walk in the mud for years unending. And wherever our Father is, he has forgotten us."
SCP-3602-A-9: "Our children don't understand us. They live brief lives and are content to be mere animals. I am not. I wish I had died when I had the chance. I wish that Wukong had never hatched from the stone egg. I wish that he had remained trapped beneath the mountain, burned by Laozi's fire for all time. It would have been a kinder fate than the one he forced upon us."
<End Log>
Closing Statement: Dr. Shen submitted a proposal to utilize anomalous means to terminate SCP-3602-A instances should they request euthanasia. Proposal was considered by the regional ethics committee, and denied in a 5 to 4 vote.
Footnotes
1. Founded in 1963, Site-220 serves as one of two headquarters of the Foundation's Parazoology Division (the other being Area-12). 48 of the more docile anomalous fauna species are contained within its 163 sq. km reserve.
2. Wukong is also known as Son Goku, the Monkey King, and the Great Sage Equal to Heaven.
3. Approximate English rendering of the Mandarin 高个子. General term used by SCP-3602 to describe humans.
|
SCP-3496 is a small, crudely carved mask.
|
***
Item #: SCP-3496
Object Class: Safe
Special Containment Procedures: SCP-3496 is to be kept in a standard storage locker in the light containment sector of Site-77. On a twice-daily basis, SCP-3496 is to undergo a full scan in a magnetic resonance imaging machine. Should SCP-3496 be free of any instances of SCP-3496-1, it is to be treated with one dose of Type B antifungal cream, one dose of standard antiseptic spray, followed by three applications of chlorine conditioner flushing media.
In the case that SCP-3496 has manifested any amount of SCP-3496-1 instances, the instances are to be carefully extracted, terminated, and incinerated if not of the genus Apis.1 In the event that SCP-3496-1 is of the genus Apis, SCP-3496 is to be transferred to Biological Propagation Relay 64 (operated in part by Wilson's Wildlife Solutions) in accordance with Document 3496-B and the Boring Agreement until the completion of the manifestation period. After SCP-3496 has completed manifestation, it is to be returned to Site-77 for regular containment.
Description: SCP-3496 is a small, crudely carved mask. The inside of SCP-3496 consists of several holes bored in a pattern similar to that created by Lyctinae.2 Approximately every one to three weeks, SCP-3496 enters a period of spontaneous generation where it continually manifests instances of SCP-3496-1 every 14-20 minutes. This period of spontaneous generation typically lasts about three days before SCP-3496 returns to an inert state.
Instances of SCP-3496-1 consist of a single species of animal from the phylum Arthropoda3. During each period of spontaneous generation, all manifested instances of SCP-3496-1 belong to the same, albeit random, species. Typically, all instances of SCP-3496-1 take up habitation in SCP-3496. Should a group of SCP-3496-1 be currently inhabiting SCP-3496, SCP-3496 will be rendered inert. See Experiment Log SCP-3496-A.
In the case that all SCP-3496-1 instances inhabiting SCP-3496 are removed, (either through termination or translocation) SCP-3496 will once again resume its cycle of spontaneous generation every one to three weeks.
Since containment, the following table has been created to track the species of SCP-3496-1:
Species
Common Name
Notes
Vespas crabro
European hornet
Several hundred instances found dead in and around SCP-3496 at the time of recovery, presumably due to below livable temperatures.
Anelosimus eximius
Argentianian Social Spider
Fifty instances manifested before termination and incineration.
Procambarus clarkii
Cambarid Freshwater Crayfish
Two instances manifested, terminated, and incinerated.
Paratrechina longicornis
Longhorn Crazy Ant
See Experiment 3496-A
Grammostola rosea
Chilean Rose-Haired Tarantula
Two instances manifested and took up residence in separate sections of SCP-3496. A further two instances manifested and were killed by the previous inhabitants. The remaining two instances have been terminated and incinerated.
Apis mellifera
Western Honey Bee
See Document SCP-3496-B
Deceased SCP-3496-1 instance.
Experiment 3496-A
Purpose: To observe the behaviour of SCP-3496-1 instances over an extended period of time.
Procedure: SCP-3496 is placed in a 1m x 1m x 0.3m glass box filled with a substrate of soil and rocks. After three days, SCP-3496 begins a period of manifestation, producing 134 instances of SCP-3496-1, species Paratrechina longicornis, at which point SCP-3496 manifested a queen, followed by another 562 drones. Instances of SCP-3496-1, over the course of two days constructed a fully functional colony. For the next six days, no further manifestations were observed.
Every day at 0600 hours, one cockroach of species Blaptica dubia4 is crushed and placed in the enclosure to provide the colony of SCP-3496-1 with food.
After six days, the queen, believed to be unfertilized, began producing viable eggs.
The colony continued to grow for three months, during which no further periods of spontaneous generation were exhibited by SCP-3496. However, the colony still appeared to grow at unprecedented rates. The population had reached well over 10,000 in number in only twelve weeks. Food supplies were increased by one roach a day for every estimated 1,000 ants.
After another month's time, an infection of Cordyceps5 fungus broke out, quickly destroying the colony over the course of two weeks. Efforts to treat the fungus were ineffectual. It is unknown as to what the origin of the fungal outbreak is, as both the rocks and the substrate were tested for contaminants along with the Dubia roaches before introduction to the enclosure.
Observations: SCP-3496 appears to produce extremely viable instances of SCP-3496-1, capable of reproduction well beyond typical rates. Analysis of the original manifestations show the DNA of all original drones and queen to be nearly identical, with only very minor variations. DNA analysis of SCP-3496-1 instances born of the originally manifested queen appear to be genetically identical, suggesting asexual reproduction.
It is hypothesized that the Cordyceps fungus was brought in along with SCP-3496, though this appears to be unlikely due the the extent of testing performed on SCP-3496 prior to final implementation of containment procedures. Further testing is required to support or disprove this hypothesis.
+ Document 3496-B
- Document 3496-B
The following document arrived at Site 77 on 02/24/2017 and was delivered to SCP-3496 assigned staff by Site Manager Frank Tuttle.
Wilson's Wildlife Solutions!
Can We Bee Friends?
Hey there friends over at Site-77! A little bird (Frank) told us that you're popping out bugs like crazy from one of your SCPs!
It's funny to think that one of the biggest threats to human life comes from something other than an SCP. We've got one of those fancy "XK- End of World" scenarios in just a few years if we let our honeybee populations die out at their current rates! I've got some fun little facts to throw at you. Did you know that bees are responsible for pollinating one third of the world's food supply? Or that in the last winter, 23.2% of our honeybee colonies died out? All these fuzzy friends doing the downward dive means that soon we're going to follow.
Of course, we've discussed this at length with Frank. We know the procedures and that technically any bees produced by SCP-3496 are considered classified SCPs that need to be contained. We understand that! However, if you have an SCP capable of producing genetically perfect bees that can produce asexually… that changes things! Frank's given us permission to take that colony off of your hands on the condition that we contain it at a new Biological Propagation Relay outside Site-64. That way your MTF fellas can get their mitts on these bad boys if they ever decide to get a bit more anomalous on us. We will slowly introduce SCP-3496-1 instances into our current apiaries in hopes to get some new queens with a little more hardy genetic backbone. As soon as your mask is done spitting these beauties out, we'll return it to Site-77. However, Frank told us that any time it starts making bees, we get a call and we get first dibs! I understand if this makes you uneasy, but really it's the best bet for all of us.
Attached are your shipping instructions!
Footnotes
1. Any common honey bee.
2. Powderpost beetle.
3. Arthropods are invertebrate animals having an exoskeleton (external skeleton), a segmented body, and paired jointed appendages.
4. Dubia roaches.
5. Cordyceps are a genus of ascomycete fungi (sac fungi) that includes about 400 species. Most Cordyceps species are endoparasitoids, parasitic mainly on insects and other arthropods.
|
SCP-2914 is a glass-fronted wooden cabinet, 66cm in height and 38cm in width, composed of unremarkable materials.
|
***
Item #: SCP-2914
Object Class: Safe
Special Containment Procedures: Only personnel who submit a formal request and receive approval from site command may operate SCP-2914. SCP-2914 is to be stored in locker 2109-B when not in use.
Description: SCP-2914 is a glass-fronted wooden cabinet, 66 cm in height and 38 cm in width, composed of unremarkable materials. The cabinet contains three glass shelves. The back of the interior of the cabinet is a mirrored surface.
The cabinet contains twenty-two stoppered glass bottles, each with a capacity of approximately 0.1 liters. Under normal, non-testing conditions these bottles are empty.
SCP-2914's primary anomalous attribute manifests when a human subject physically touches the glass front of SCP-2914 while specifically recalling a particular memory. Under those circumstances, the glass front momentarily becomes opaque, then transparent again to reveal that some or all of the bottles within the cabinet have been filled with various substances.
Partial test log of SCP-2914 (deconstruction configuration) follows:
Test reference: 0001
Subject: D-3804
Description of Test: Subject was asked to recall a pleasant memory. Subject stated that he would think of a trip that he had once taken to Key West, Florida.
Result: Bottles were filled with the following substances/materials:
Beach sand
Liquid identified as low-quality tequila
Seawater
Strip of terrycloth
Cigar ash
Sunscreen (coconut-scented)
Test reference: 0023
Subject: D-4962
Description of Test: Subject, a military veteran, was asked to recall an episode during his combat service in Chechnya.
Result: Bottles were filled with the following substances/materials:
Concrete fragments and dust
Diesel fuel, comparable to that used by Russian army for BMP-1 infantry fighting vehicle
Vodka, contaminated with soil
Substance tentatively identified as partially-digested military rations
Ice
Human blood
Human blood (from a different person)
Small, folded map of a valley near the city of Grozny
Page of the Koran, cut into thin strips
Several disassembled components of magazine of AK-74 assault rifle
Sandy soil
Test reference: 0041
Subject: D-5751
Description of Test: Subject was asked to recall her earliest childhood memory. Subject described earliest memory as a kindergarten playground incident.
Result: Bottles were filled with the following substances/materials:
Red fingerpaint
Milk
Carrot sticks
Broken crayons (orange and purple)
Foam stuffing consistent with the contents of a child's plush toy
Polyester carpet fibers
Several strips of urine-soaked cotton cloth
Human tears and mucus
Test reference: 0058
Subject: Researcher Liebowitz
Description of Test: Subject was asked to recall his lunch, eaten in the Site 22 canteen earlier that day
Result: Bottles were filled with the following substances/materials:
Diet soda
Shreds of baked chicken
Off-brand catsup
Strips of paper napkin
Linoleum disc, materials comparable to tabletop of canteen furnishings
Feces of Rattus norvegicus
Page from the Daily Racing Form, cut into shreds
$5.81 in United States currency (bills and coins)
Test reference: 0061
Subject: D-6312
Description of Test: The 1993 film Gettysburg was exhibited to subject. Subject was asked to recall the film.
Result: Bottles were filled with the following substances/materials:
Popcorn
Off-brand cola consistent with beverage consumed by subject while viewing the film.
Test reference: 0062
Subject: D-6344
Description of Test: The 1993 film Gettysburg was exhibited to subject. Subject suffers from schizophrenia and indicates a diminished capacity to distinguish fact from fiction. Subject was coached to believe that subject had personally witnessed the events depicted in the film.
Result: Bottles were filled with the following substances/materials:
Popcorn
Diphenylbutylpiperidine
Lithium carbonate
Approximately 30 cm of tightly-wound Betamax videotape which, upon analysis, contained a recording of a segment of the film
Note: It was an avenue worth exploring.
Test reference: 0063
Subject: D-7212
Description of Test: Subject was awakened from REM sleep and asked to recall her dream. Subject reported experiencing an anxiety dream about having failed to study for a high school examination.
Result: Single bottle, containing strip of cotton sheeting consistent with subject's cot in Site-22 D-class secured dormitory.
Note: This appears to be another blind alley.
Test reference: 0052
Subject: D-2834
Description of Test: Subject underwent hypnosis and was asked to recall her earliest memory.
Result: Single bottle, filled with human amniotic fluid
Test reference: 0065
Subject: D-3751
Description of Test: Subject was asked to recall a memory from the period of time that she was suffering from Leukemia.
Result: Bottles were filled with the following substances/materials:
Alkylating agents
Cyclophosphamide
Ifosfamide
Melphalan
Blood containing cancer cells that matched the DNA of D-3751
Note: Subject did not seem to know the names or effects of the chemicals created. This seems to indicate that 2914 has some idea of chemical compositions of different substances.
Test reference: 0001
Subject: D-2914, Notably has severe retrograde amnesia
Description of Test: Subject was instructed to touch SCP-2914. Due to communication barriers a specific memory could not be selected
Result: Bottles were filled with the following substances/materials:
A single bottle with a single smaller bottle which also contained a smaller bottle. This pattern reaches 53 consecutive bottles before ending in a glass cylinder that has no open space.
Addendum #1
After debriefing D-4962 following the test of SCP-2914, Dr. Morrison inspected SCP-2914 to document the contents of the bottles. In the course of doing so, Dr. Morrison briefly touched the glass front of the cabinet before the bottles had been removed or disturbed. Dr. Morrison reported that he experienced a first-person hallucination which corresponded to the details of D-4962's recollection.
Addendum #2
Researcher Marcinkiewicz attempted to replicate Dr. Morrison's experience by causing D-5452 (a 52-year old woman) to touch the glass front of the cabinet about an hour after Test 0023 involving D-4962. By this time, the ice in bottle #5 had melted, and portions of the samples in other bottles had been removed for testing. D-5452 reported experiencing a first-person hallucination that involved a bumpy ride for several hours inside a BMP-1 infantry fighting vehicle, following which the point of view exited the vehicle and marched with other Russian soldiers into a barracks. Extensive interviewing of D-5452 regarding the details of the scenery and setting of the barracks indicated that it was located in northern France. There are no historical reports of Russian military forces operating a BMP-1 infantry fighting vehicle or maintaining a military presence in that region.
The experience prompted Dr. Morrison and Researcher Marcinkiewicz to commence a separate series of tests.
Partial testing log of SCP-2914 in its antideconstruction configuration follows:
Test reference: 0166
Subject: D-7871
Description of Test: Researcher Marcinkiewicz filled bottles as follows:
Soil (obtained from Central Park, New York City)
Grass clippings (obtained from Central Park, New York City)
Water (New York City tap water)
Rolled-up newspaper clipping advertising a "Shakespeare in the Park" event
Cigarette
Result: Subject had never visited New York City. Subject reported experiencing a hallucination of a visit to Central Park. Subject's description of some park landmarks differed from their real-world counterparts.
Test reference: 0182
Subject: D-8386
Description of Test: Researcher Marcinkiewicz filled bottles as follows:
Sample of D-8386's blood
Air, with concentrations of oxygen and sulfur dioxide
Seawater
Limestone
Fern frond
Crushed, powdered coal
Result: Subject reported hallucination of standing on the shores of a sea while several large animals (presumably hadrosaurs, based on the description given) grazed nearby.
Test reference: 0184
Subject: D-8392
Description of Test: Researcher Marcinkiewicz filled bottles as follows:
Seawater
Sand
Blood of Crocodylus porosus (saltwater crocodile)
Fish viscera
Result: After recovering from severe nausea, subject reported experiencing the sensation of being a female Crocodylus porosus during the act of mating.
Test reference: 0188
Subject: D-7884
Description of Test: Researcher Marcinkiewicz filled bottles as follows:
Distilled water
Liquified, heated polyurethane
Iron filings
Result: Subject blacked out for approximately 35 minutes. When subject recovered, subject reported having experienced the sensation of asphyxiating in outer space. After extensive interviews conducted with the use of hypnosis and nootropic tropic medications, subject was able to describe the environment that she had observed during her experience, which consisted of the interior of an orbital space station operated by the Indian Space Research Organisation, the hull of which had been damaged exposing the interior to the vacuum of space. The Indian Space Research Organisation has not, to date, ever launched a space station. Subject experienced acute PTSD and has been deemed unsuitable for future testing.
Test reference: 2932
Subject: D-11328
Description of Test: Dr. Morrison filled bottles as follows:
Sample of D-11328's blood
Sample of blood of D-0936 (a D-class personnel stationed at a different facility who had never encountered D-11328)
Grass clippings from several widely separated sources
Soil samples from several widely separated sources
Wine (blend of two different vintages not normally available for purchase at the same place)
Strips of musculature of several different animals
Metal filings (obtained from sampling various historical artifacts including a Roman-era iron architectural component, a bronze Tang-dynasty Chinese bell, and an iron spearhead from southern Africa)
Result: Subject blacked out for several hours. Upon recovery, subject was confused and distressed and had lost the ability to communicate in English. Over the course of a series of interviews conducted over a period of weeks with the liberal use of nootropic medicines, researchers learned that subject was able to communicate in an archaic form of the Telugu language. Subject, although female, identified as a male and reported that "he" had lived for at least thirty years as a traveling merchant, transporting merchandise overland from the region of Khorasan (central Asia) to the city of Amadomoglu (which does not appear on historical records but according to D-11328's account, was located on the east bank of the Volga River near the northern Caspian Sea. Most of the details of D-11328's report do not correspond to identifiable historical places or events, but the report included an account matching the description of SN 1054 (a supernova in the constellation Taurus that occurred in the year 1054 AD). Subject's last chronological recollection was of a "Daeva attack", after which subject could not recall any subsequent events. Subject had no recollection of her life before the test.
Test reference: 2937
Subject: D-114078
Description of Test: Dr. Morrison filled bottles as follows:
Coffee from Site 22 break room
Fresh water
[DATA EXPUNGED]
[DATA EXPUNGED]
[DATA EXPUNGED]
[DATA EXPUNGED]
Result: Subject reported hallucination of unremarkable events in Site 22's D-class secured dormitory. Four days after test, D-114078 escaped from secured dormitory, apparently by means of successfully impersonating Dr. Morrison and obtaining unauthorized access to Site 22's data files and security center. Dr. Morrison was killed during the escape. D-114078's whereabouts are unknown.
|
SCP-3214 is a 30-second digital video advertisement which displays anomalous retargeting and personalization.
|
***
Item #: SCP-3214
Object Class: Euclid
Special Containment Procedures: A specialized Foundation webcrawler1 will monitor digital advertising exchanges for new copies of SCP-3214. Blocking or deleting SCP-3214 from its current exchange may temporarily prevent new SCP-3214 from being served.
If any clickthroughs are detected, a containment team must be dispatched to contain all individuals affected by the anomaly and assess the severity of the outbreak. Local news reports, psychiatric hospital records and social media sites must be monitored for accounts or images of a person disassembling and/or fabricating electronic devices as part of an attempt to send a message to outer space. Any device with a screen or speaker2 must be disconnected from power in the vicinity of individuals experiencing a retargeting event. No cellphone or other susceptible device is allowed within 30 meters of an instance of SCP-3214-1 except during approved tests.
Description: SCP-3214 is a 30-second digital video advertisement which displays anomalous retargeting and personalization. When it is viewed or listened to by a person, any other susceptible device within approximately 30 meters will be served an SCP-3214 impression.3 This can result in the rapid and potentially exponential spread of SCP-3214. Any individual targeted by the anomaly may be subject to various cognitohazardous effects, with more severe effects if the individual clicks on the ad and views or listens to it.
If an individual to whom an SCP-3214 impression has been served4 does not click through to view or listen to it, the person is not infected, although they will continue to be retargeted by the anomaly for up to five days. Individuals who experience a complete retargeting event and successfully avoid infection may experience minor cognitohazardous effects,5 but are not targeted by the anomaly again. Such effects typically fade within 3 to 6 weeks.
Retargeting timeline: Retargeting events follow a predictable pattern, recorded below.
Time elapsed
Effect
Example(s)
0-24 hours
Impressions begin to be delivered outside of normal ad frames on devices used by the subject.
Subject entered the web address of a major search engine. When attempting to click on the search bar, a popup of SCP-3214 slid down from the top of the screen and intercepted their cursor.
1-2 days
Impressions occur at maximum frequency.6 Titles adopt a confrontational tone, including detailed information about the subject's life.
"What Have You Got To Lose, D-20993?"
"Mom Was Right: You're Good For Nothing (But We Can Help)"
2-3 days
Impressions begin to be delivered to any device screen or speaker in the subject's vicinity. This can include devices which are not susceptible to SCP-3214 delivery under other circumstances, and need not be connected to the internet.
A subject being escorted from the testing chamber passed by a closed-circuit television showing live feed from a security camera. SCP-3214 began to play in a corner of the screen.
3-4 days
Impressions may be separated by two to three hours, and target the subject in moments of emotional vulnerability.
A subject had recently learned of their cellmate's death in an unrelated test on SCP-████. When security personnel arrived to escort the subject to the testing chamber, SCP-3214 began to play from the security officers' walkie-talkies.
4-5 days
Impressions revert to appearing only in normal ad frames. Titles become openly threatening.
"CLICK OR EVENTUALLY DIE
"you will be JUDGED" (the word "JUDGED" gradually expands to fill the text line, as the letters of the word "you" crack and break apart).
Device damaged by an instance of SCP-3214-1
Symptoms: Approximately 80% of individuals who view or listen to the anomaly become SCP-3214-1. Information about the other 20% is restricted to personnel of level 2 and above, researchers directly involved in SCP-3214 experimentation, and agents deployed in response to SCP-3214 outbreaks (see Document SCP-3214-2A below).
Once infected, SCP-3214-1 develop an obsessive fixation on space travel and interstellar communication. If given access to communications hardware, SCP-3214-1 will frequently disassemble them in an attempt to build a communications device capable of contacting the celebrity characters they saw or heard in SCP-3214.7 Subjects will describe their motivation as a desire to "call them back for one more chance" or "make them understand." These attempts may be highly energetic; some subjects have been observed working to the point of malnutrition or sleep deprivation in order to continually modify their devices. Reactions to the obsession vary considerably from one subject to another. One recovered SCP-3214-1, now in Foundation custody, continued to go to work each day, and would spend their evenings constructing a device in their condominium's basement storage area. Another, currently in long-term psychiatric confinement in a ███████ County facility, broke into a Radio Shack by smashing a window with a rock, and had destroyed a considerable amount of the store's stock by the time local law enforcement agents apprehended them.
Infected individuals' knowledge does not appear to be anomalously enhanced in any way, and the devices they assemble are almost universally non-functional. SCP-3214-1 are not dissuaded by this, and will rebuff any attempts on the part of researchers to critique their construction. Those who already possessed knowledge of engineering or information systems may create devices consistent with non-anomalous functions such as generating radio or wireless signals. Research into these is ongoing, but to date has not produced new insight into the anomaly.
Video description: Recordings of SCP-3214 show a blank screen with a circular "loading" image, and a sound similar to a dial-up modem connecting to the internet. Thus a more detailed description of SCP-3214 has been summarized from interviews with individuals infected by the anomaly.
Open video description
Close video description
The narrator's appearance is perceived by the subject as an idealized version of themselves. Dialogue and/or captions in the video employ the viewer's first language.
A group of characters in the video will appear to describe the wonders of their new home. Characters have the appearance of celebrities admired by the viewer. They may be shown engaging in space travel, public musical performances, sexual activity and/or [REDACTED]. During this section, the narrator's eyes begin to glow with green light as they deliver enthusiastic commentary on depicted scenes. Subjects are unable to recall this narration in detail.
In the next segment, the narrator describes the viewer's history to the other characters. They are shown seated in a casual setting, and individually introduced as a panel of experts. The narrator attempts to convince them of the talent or desirability of the viewer, in the form of a "highlight reel" of notable events in the viewer's life.
The other characters will briefly debate whether the viewer possesses "the right stuff" or "star quality" and whether the group should "take [name] with us." At the end of the debate, each member of the panel will render a "final answer" of either yes or no, turning to make eye contact with the viewer. Subjects report feeling compelled to view this portion, and felt they were being "measured" or "judged", even if they were unable to view the screen.
The narrator moves in front of the camera and smiles at the viewer, saying, "We'll see you there."
Although SCP-3214 has lasted exactly 30 seconds in each tested instance, the videos described by test subjects were of significantly longer duration. Researchers estimate that the longest described video8 would have taken up to an hour in real time. It is theorized that the anomaly functions in part by implanting information directly into a subject's mind, which the mind then reconstitutes as memory.
Document SCP-3214-2A: Enter Level 2-3214 credentials
- Credentials accepted
An estimated 20% of individuals infected by SCP-3214 outside of containment go missing. These individuals are designated SCP-3214-2. SCP-3214-2 do not exhibit any compulsion to assemble electronic communication devices. Individuals infected while in containment have a lower probability of becoming SCP-3214-2 (approximately 5%). Civilians who have observed SCP-3214-2 report that instances will immediately depart, offering vague and contradictory excuses when questioned. SCP-3214-2 who are prevented from departing will express dismay, citing an urgent appointment. They will refuse to specify the nature or location of this appointment. SCP-3214-2 who remain in Foundation custody exhibit signs of increasing psychological distress and agitation as time progresses. Individual responses vary. They may withdraw and become unresponsive, demonstrate hostility and aggression towards Foundation personnel, or attempt self-harming behaviors.
After review by the Ethics Committee, authorization was given to release some SCP-3214-2 under close surveillance, after equipping them with subcutaneous tracking devices. Each SCP-3214-2 instance will obtain a small quantity of luggage and fill it with various items of clothing and forms of personal entertainment.9 SCP-3214-2 will often purchase or steal such items in an opportunistic manner.
All SCP-3214-2 to date have vanished within 24 hours of release while under the open sky. Observation teams report a flash of green light at each disappearance, which is not visible in video recordings. Tracking devices lose contact at this time. Tracking devices frequently lose contact at this time. Signals from tracking devices attached to some instances were later detected at the outer edge of the heliosphere, accelerating towards Alpha Centauri A at speeds which gradually increased to a maximum of .5c.
Footnotes
1. Adapted from I/O BEHOLDER. See SCP-3299 for details.
2. For a full list of susceptible devices, see Documents 3214-b1-4.
3. When a digital advertisement is fetched from its server by a user's browser, it is counted as an impression, whether or not it is actually displayed to or viewed by a user.
4. An impression of a digital advertisement has been served when it appears in a user's browser.
5. May include misanthropy, increased extraversion, and obsessive fixation on the works and activities of a small group of celebrities unique to each subject. It is theorized that these celebrities are the ones who would have been depicted in SCP-3214 if the individual had viewed it.
6. The anomaly appears to observe a 30-minute frequency cap.
7. Evidence of the celebrities' presence on Earth in contiguous reality is rejected as illusory.
8. In which the debate segment devolved into a heated argument over which Buckethead album was the most iconoclastic
9. Movies, books, mp3 players, handheld gaming devices, musical instruments and adult toys are commonly selected.
|
SCP-640 is a free-roaming sentient electromagnetic phenomenon, typically manifesting as several roughly circular spots of yellow-orange light, between 18 and 57mm in diameter depending on the entity's current appetite and energy level.
|
***
Item #: SCP-640
Object Class: Euclid
Special Containment Procedures: SCP-640 is to be kept inside an ellipsoidal room with a uniformly-reflective interior, such as nickel or chromium plating. The atmosphere in the room must be maintained at a temperature of between 260 and 307 K, at a relative humidity of 50% or less. Temperatures and humidities outside these limits greatly increase the entity's appetite and aggression and will likely result in personnel casualties.
The confinement chamber must be equipped with a light-tight airlock fitting equipped with an electronic interlock to prevent both doors from being simultaneously opened. Though SCP-640 is not known to be able to assume a gaseous form, these doors should be airtight and, if possible, watertight to facilitate emergency containment measures.
All personnel entering the containment facility must wear reflective suits including anti-IR face shields. Exposure time shall be limited to no more than 30 minutes without O5-level consent. All personnel shall receive a dose of amphetamine, modafinil, or caffeine prior to exposure; resistance, intolerance, or allergy to these drugs is an absolute contraindication to assignment to the SCP-640 study team.
Description: SCP-640 is a free-roaming sentient electromagnetic phenomenon, typically manifesting as several roughly circular spots of yellow-orange light, between 18 and 57 mm in diameter depending on the entity's current appetite and energy level. It has also been observed to manifest as spots of infrared and EHF radiation, and seems capable of rapidly varying its wavelength.
In all known instances, SCP-640 has disguised itself as spots of sunlight shining on a wall, typically inside a child's room. It generally fades from view (presumably by shifting into the IR or RF range) when closely investigated.
SCP-640 is carnivorous. While it is capable of deriving sustenance from all known Earth animals, SCP-640 shows a marked preference for humans and apes, especially children. It consumes its prey by inflicting burns of varying severity and depth. For as yet unknown reasons, SCP-640 tends to target the face, legs, and forearms of its prey. It also often feeds on the same prey repeatedly, allowing it time to heal between attacks. The entity prefers to attack sleeping prey, though if angry, hungry, or frightened, it will not hesitate to attack prey while awake. When it wishes, it can inflict fatal burn injuries to an adult human in approximately 120 seconds.
An attempt to destroy SCP-640 using a reflective room and a 25 GCd flashlamp has failed. However, testing revealed that a reflective room is effective in disrupting the entity's feeding.
As multiple specimens of SCP-640 have surfaced, an effective means of neutralization is being sought. The Foundation does not currently believe it necessary to contain more than a few specimens in light of the resources required.
Recovery Notes: The first SCP-640 specimen was recovered from the home of ████████ █████████ in ████████, Japan, in 1984, after both his children were admitted to a local hospital with severe burn injuries. The Foundation was alerted by an anonymous source believed to be working for [REDACTED]. Foundation agents discovered the entity after several weeks of probing, during which time one of the children was killed by the entity. Agents managed to capture it using [DATA EXPUNGED] and transported it to Site 17 for containment.
A second specimen was recovered in ████████, ████████, United States, in 1999, and another in 2006, both in the same neighborhood.
Addendum 640-a: Reports from Australia suggest there is at least one SCP-640 specimen in the wild somewhere in ████████ and likely another in █████████. Agents are currently attempting to locate and contain the entities.
Addendum 640-b: In two separate incidents, SCP-640 has been observed to distract researchers, causing them to have accidents resulting in breach of suit integrity. Following suit breach, both researchers were fatally attacked by SCP-640. Research team lead has recommended that SCP-640 be provisionally assigned Keter classification pending further investigation to determine whether the entity's actions were deliberate or fortuitous.
Addendum 640-c: Provisional Keter classification denied, object has been returned to Euclid classification.
|
SCP-1482 is a structure resembling a residential building located in ██████, Shetland, Scotland.
|
***
Item #: SCP-1482
Object Class: Safe
Special Containment Procedures: Site-178 has been built around SCP-1482, with the cover story that the Site is a retirement home for elderly individuals affected by dementia. A chain-link fence around the perimeter with CCTV monitoring is to be maintained. Any unauthorised individuals attempting to access Site-178 are to be detained, interviewed and – if they present no clear threat – released after being provided with a Class-C amnestic.
Description: SCP-1482 is a structure resembling a residential building located in ██████, Shetland, Scotland.
SCP-1482 appears to be composed entirely of several-hundred objects not typically used in construction (collectively referred to as SCP-1482-1) attached together with string, rope, glue and conventional staples. These objects include: metallic objects such as knives, forks and sheet metal; wooden furniture; living, healthy and in some cases, partially vivisected specimens of Bos primigenius (domestic cattle), Salmo salar (Atlantic salmon), Giraffa camelopardalis (giraffe) and Orcinus orca (killer whale), as well as various members of the Orders Anura (frog) and Lophiiformes (angler fish). The living components of SCP-1482 have been determined to constitute under 10% (ten percent) of its parts, the rest consisting of non-living and artificial objects. These living specimens do not appear to require sustenance or excrete waste.
At 3 (three) known locations on SCP-1482, organs resembling human vocal cords are attached directly to an animal instance of SCP-1482-1 with staples; these vocal cords are identified as SCP-1482-2. Periodically, SCP-1482-2 will produce intelligible vocalisations in heavily slurred Scots English. The specific content of these vocalisations varies, but will typically involve one of the following:
Complaints of being unable to see or hear, often with the mention that SCP-1482 can feel and smell in detail.
Complaints of the interior of SCP-1482 feeling “cold”, “cald”, or in some cases, “baltic”.
Requests that a non-specific listener enter SCP-1482 to warm it up, and provide company.
Attempts to convince individuals who have entered SCP-1482 to stay indefinitely, make extended contact with the organic parts of SCP-1482 to confirm their presence, and protect the structure.
Requests that individuals exiting SCP-1482 cease doing so. Exclamations of this nature tend to be shouted or yelled with increasing urgency.
Screaming, distorted sounds of distress and assertions that if an individual who has recently exited SCP-1482 does not re-enter, "the bad men” or “madmen” are "gonnae come and have an empty1”.
SCP-1482 was recovered from the custody of Group of Interest 3BA-Alpha-C (“the Chaos Insurgency”), following the group's evident attempts to manipulate SCP-1482’s anomalous properties to enable longevity and non-reliance on nutrition in humans. The organisation had largely abandoned projects involving SCP-1482 by the time the Foundation became involved.
Analysis of files recovered from the CI have revealed limited information regarding SCP-1482. From these documents and the testimony of witnesses, it has been determined that SCP-1482 was the former residence of █████ K███████, noted zoology enthusiast, and that the vocal apparatus of the residence at one point functioned to provide information on various animal species. Ms. K███████ has yet to be located.
Further investigation has revealed that, prior to the involvement of the CI, the structure consisted exclusively of animal parts.
Footnotes
1. A term in Scots slang referring to youths hosting a party in their place of residence while their parents, carers or guardians are absent.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.