text
stringlengths 105
4.44k
| label
int64 0
9
| label_text
stringclasses 10
values |
|---|---|---|
Tetracyclics are cyclic chemical compounds that contain four fused rings of atoms, for example, Tröger's base.
Some tricyclic compounds having three fused and one tethered ring (connected to main nucleus by a single bond) can also classified as tetracyclic, for example, ciclazindol.
Tetracyclic compounds have various pharmaceutical uses, such as:
*tetracycline antibiotics
**Doxycycline
**Tigecycline
**Omadacycline
**Eravacycline
*tetracyclic antidepressants
**Benzoctamine
**Loxapine
**Mazindol
**Mianserin
**Mirtazapine | 0 | Organic Chemistry |
Haloalkanes generally resemble the parent alkanes in being colorless, relatively odorless, and hydrophobic. The melting and boiling points of chloro-, bromo-, and iodoalkanes are higher than the analogous alkanes, scaling with the atomic weight and number of halides. This effect is due to the increased strength of the intermolecular forces—from London dispersion to dipole-dipole interaction because of the increased polarizability. Thus tetraiodomethane () is a solid whereas tetrachloromethane () is a liquid. Many fluoroalkanes, however, go against this trend and have lower melting and boiling points than their nonfluorinated analogues due to the decreased polarizability of fluorine. For example, methane () has a melting point of −182.5 °C whereas tetrafluoromethane () has a melting point of −183.6 °C.
As they contain fewer C–H bonds, haloalkanes are less flammable than alkanes, and some are used in fire extinguishers. Haloalkanes are better solvents than the corresponding alkanes because of their increased polarity. Haloalkanes containing halogens other than fluorine are more reactive than the parent alkanes—it is this reactivity that is the basis of most controversies. Many are alkylating agents, with primary haloalkanes and those containing heavier halogens being the most active (fluoroalkanes do not act as alkylating agents under normal conditions). The ozone-depleting abilities of the CFCs arises from the photolability of the C–Cl bond. | 0 | Organic Chemistry |
In its simplest form, photosynthesis is adding water to to produce sugars and oxygen, but a complex chemical pathway is involved, facilitated along the way by a range of enzymes and co-enzymes. The enzyme RuBisCO is responsible for "fixing" – that is, it attaches it to a carbon-based molecule to form a sugar, which can be used by the plant, releasing an oxygen molecule along the way. However, the enzyme is notoriously inefficient, and just as effectively will also fix oxygen instead of in a process called photorespiration. This is energetically costly as the plant has to use energy to turn the products of photorespiration back into a form that can react with . | 5 | Photochemistry |
Dissolved load can provide valuable information about the rate of soil formation and other processes of chemical erosion. In particular, the mass balance between the dissolved load and solid phase is helpful in determining surface dynamics. In addition, dissolved load can be used to reconstruct the climate of the Earth in the past. This is because chemical weathering is the major contributor to the dissolved load of a stream. The chemical weathering of silicate rocks is the primary sink for carbon dioxide in the atmosphere, because atmospheric carbon dioxide is converted into carbonate rocks in the carbonate–silicate cycle. Carbon dioxide concentrations are the primary control of the greenhouse effect, which determines the temperature of the Earth. | 9 | Geochemistry |
A second application in cement for the bulk material analyzer is raw mix proportioning. An analyzer placed just upstream of the raw mill can monitor the chemistry of the raw mix and automatically trigger an adjustment in the proportions of the reclaimed stockpile and the correctives. By doing so, the plant is able to reduce the variability in the raw mix, and later on the kiln feed. Consistent kiln feed chemistry in turn leads to lower fuel consumption per ton of clinker produced. | 3 | Analytical Chemistry |
Dead zones are hypoxic (low-oxygen) areas in the world's oceans and large lakes. Hypoxia occurs when dissolved oxygen (DO) concentration falls to or below 2 mg of O/liter. When a body of water experiences hypoxic conditions, aquatic flora and fauna begin to change behavior in order to reach sections of water with higher oxygen levels. Once DO declines below 0.5 ml O/liter in a body of water, mass mortality occurs. With such a low concentration of DO, these bodies of water fail to support the aquatic life living there. Historically, many of these sites were naturally occurring. However, in the 1970s, oceanographers began noting increased instances and expanses of dead zones. These occur near inhabited coastlines, where aquatic life is most concentrated.
Coastal regions, such as the Baltic Sea, the northern Gulf of Mexico, and the Chesapeake Bay, as well as large enclosed water bodies like Lake Erie, have been affected by deoxygenation due to eutrophication. Excess nutrients are input into these systems by rivers, ultimately from urban and agricultural runoff and exacerbated by deforestation. These nutrients lead to high productivity that produces organic material that sinks to the bottom and is respired. The respiration of that organic material uses up the oxygen and causes hypoxia or anoxia.
The UN Environment Programme reported 146 dead zones in 2004 in the world's oceans where marine life could not be supported due to depleted oxygen levels. Some of these were as small as a square kilometer (0.4 mi), but the largest dead zone covered 70,000 square kilometers (27,000 mi). A 2008 study counted 405 dead zones worldwide. | 9 | Geochemistry |
Acyl chlorides react with low-valent metal centers to give transition metal acyl complexes. Illustrative is the oxidative addition of acetyl chloride to Vaska's complex, converting square planar Ir(I) to octahedral Ir(III): | 0 | Organic Chemistry |
The alkynylation reaction of aryl halides using aromatic acetylenes was reported in 1975 in three independent contributions by Cassar, Dieck and Heck as well as Sonogashira, Tohda and Hagihara. All of the reactions employ palladium catalysts to afford the same reaction products. However, the protocols of Cassar and Heck are performed solely by the use of palladium and require harsh reaction conditions (i.e. high reaction temperatures). The use of copper-cocatalyst in addition to palladium complexes in Sonogashiras procedure enabled the reactions to be carried under mild reaction conditions in excellent yields. A rapid development of the Pd/Cu systems followed and enabled myriad synthetic applications, while Cassar-Heck conditions were left, maybe unjustly, all but forgotten. The reactions remarkable utility can be evidenced by the amount of research still being done on understanding and optimizing its synthetic capabilities as well as employing the procedures to prepare various compounds of synthetic, medicinal or material/industrial importance. Among the cross-coupling reactions it follows in the number of publications right after Suzuki and Heck reaction and a search for the term "Sonogashira" in SciFinder provides over 1500 references for journal publications between 2007 and 2010.
The Sonogashira reaction has become so well known that often all reactions that use modern organometallic catalyst to couple alkyne motifs are termed some variant of "Sonogashira reaction", despite the fact that these reactions are not carried out under true Sonogashira reaction conditions. | 0 | Organic Chemistry |
* Advantages
** By using uniform droplets to deliver therapeutic payloads to specific locations in the body, researchers can achieve greater precision and control over drug delivery while also minimizing toxicity and harmful side effects. For example, these droplets can be quickly loaded during the polymerization process and can be varied in porosity to control the time it takes to release a drug. Microdroplets-based drug delivery also has a significant advantage over traditional systems in that they can minimize side effects, reduce the need for invasive procedures, and even improve a drug's efficacy. Overall, microdroplet-based drug delivery systems show great promise for revolutionizing medicine with significant potential for targeted drug delivery.
* Limitations
** Nevertheless, it is essential to note some common challenges associated with microdroplet-based drug delivery systems, including their biocompatibility, toxicity, and scalability. The biocompatibility and toxicity of Microdroplets are essential to consider because these can affect a drug's safety and overall efficacy, causing unwanted side effects and possibly death. On the other hand, scalability is another crucial challenge to consider because this aspect can lead to increased manufacturing costs, problems with quality control, and limitations in equipment used. All in all, even with great promise to revolutionize targeted drug delivery, researchers must keep in mind the biocompatibility, toxicity, and scalability of microdroplet-based drug delivery systems when using them. | 1 | Biochemistry |
Triphenylphosphine dichloride is usually prepared fresh by the addition of chlorine to triphenylphosphine.
:PhP + Cl → PhPCl
Both reagents are typically used in solution to ensure the correct stoichiometry.
PhPCl can also be obtained by the reaction of iodobenzene dichloride (PhICl) and triphenylphosphine.
Alternatively, PhPCl can be obtained by chlorination of triphenylphosphine oxide with, for example, phosphorus trichloride, as in Grignard's original 1931 synthesis. | 0 | Organic Chemistry |
Sulfones are prepared under conditions used for Friedel–Crafts reactions using sources of derived from sulfonyl halides and sulfonic acid anhydrides. Lewis acid catalysts such as and are required.
Sulfones have been prepared by nucleophilic displacement of halides by sulfinates: | 0 | Organic Chemistry |
The first "pure" Bose–Einstein condensate was created by Eric Cornell, Carl Wieman, and co-workers at JILA on 5 June 1995. They cooled a dilute vapor of approximately two thousand rubidium-87 atoms to below 170 nK using a combination of laser cooling (a technique that won its inventors Steven Chu, Claude Cohen-Tannoudji, and William D. Phillips the 1997 Nobel Prize in Physics) and magnetic evaporative cooling. About four months later, an independent effort led by Wolfgang Ketterle at MIT condensed sodium-23. Ketterle's condensate had a hundred times more atoms, allowing important results such as the observation of quantum mechanical interference between two different condensates. Cornell, Wieman and Ketterle won the 2001 Nobel Prize in Physics for their achievements.
A group led by Randall Hulet at Rice University announced a condensate of lithium atoms only one month following the JILA work. Lithium has attractive interactions, causing the condensate to be unstable and collapse for all but a few atoms. Hulet's team subsequently showed the condensate could be stabilized by confinement quantum pressure for up to about 1000 atoms. Various isotopes have since been condensed. | 7 | Physical Chemistry |
Elementoid clusters are ligand-stabilized clusters of metal atoms that possess more direct element-element than element-ligand contacts. Examples of structurally characterized clusters feature ligand stabilized cores of Al, Ga, and Pd. | 7 | Physical Chemistry |
Many different affinity media exist for a variety of possible uses.
Briefly, they are (generalized) activated/functionalized that work as a functional spacer, support matrix, and eliminates handling of toxic reagents.
Amino acid media is used with a variety of serum proteins, proteins, peptides, and enzymes, as well as rRNA and dsDNA. Avidin biotin media is used in the purification process of biotin/avidin and their derivatives.
Carbohydrate bonding is most often used with glycoproteins or any other carbohydrate-containing substance; carbohydrate is used with lectins, glycoproteins, or any other carbohydrate metabolite protein. Dye ligand media is nonspecific but mimics biological substrates and proteins. Glutathione is useful for separation of GST tagged recombinant proteins. Heparin is a generalized affinity ligand, and it is most useful for separation of plasma coagulation proteins, along with nucleic acid enzymes and lipases
Hydrophobic interaction media are most commonly used to target free carboxyl groups and proteins.
Immunoaffinity media (detailed below) utilizes antigens and antibodies high specificity to separate; immobilized metal affinity chromatography is detailed further below and uses interactions between metal ions and proteins (usually specially tagged) to separate; nucleotide/coenzyme that works to separate dehydrogenases, kinases, and transaminases.
Nucleic acids function to trap mRNA, DNA, rRNA, and other nucleic acids/oligonucleotides. Protein A/G method is used to purify immunoglobulins.
Speciality media are designed for a specific class or type of protein/co enzyme; this type of media will only work to separate a specific protein or coenzyme. | 3 | Analytical Chemistry |
* Grüner, George. Density Waves in Solids. Addison-Wesley, 1994.
* Review of experiments as of 2013 by Pierre Monceau. [https://arxiv.org/abs/1307.0929 Electronic crystals: an experimental overview]. | 7 | Physical Chemistry |
The James Webb Space Telescope uses radiative cooling to reach its operation temperature of about 50 K. To do this, its large reflective sunshield blocks radiation from the Sun, Earth, and Moon. The telescope structure, kept permanently in shadow by the sunshield, then cools by radiation. | 7 | Physical Chemistry |
Synapses are functional connections between neurons, or between neurons and other types of cells. A typical neuron gives rise to several thousand synapses, although there are some types that make far fewer. Most synapses connect axons to dendrites, but there are also other types of connections, including axon-to-cell-body, axon-to-axon, and dendrite-to-dendrite. Synapses are generally too small to be recognizable using a light microscope except as points where the membranes of two cells appear to touch, but their cellular elements can be visualized clearly using an electron microscope.
Chemical synapses pass information directionally from a presynaptic cell to a postsynaptic cell and are therefore asymmetric in structure and function. The presynaptic axon terminal, or synaptic bouton, is a specialized area within the axon of the presynaptic cell that contains neurotransmitters enclosed in small membrane-bound spheres called synaptic vesicles (as well as a number of other supporting structures and organelles, such as mitochondria and endoplasmic reticulum). Synaptic vesicles are docked at the presynaptic plasma membrane at regions called active zones.
Immediately opposite is a region of the postsynaptic cell containing neurotransmitter receptors; for synapses between two neurons the postsynaptic region may be found on the dendrites or cell body. Immediately behind the postsynaptic membrane is an elaborate complex of interlinked proteins called the postsynaptic density (PSD).
Proteins in the PSD are involved in anchoring and trafficking neurotransmitter receptors and modulating the activity of these receptors. The receptors and PSDs are often found in specialized protrusions from the main dendritic shaft called dendritic spines.
Synapses may be described as symmetric or asymmetric. When examined under an electron microscope, asymmetric synapses are characterized by rounded vesicles in the presynaptic cell, and a prominent postsynaptic density. Asymmetric synapses are typically excitatory. Symmetric synapses in contrast have flattened or elongated vesicles, and do not contain a prominent postsynaptic density. Symmetric synapses are typically inhibitory.
The synaptic cleft—also called synaptic gap—is a gap between the pre- and postsynaptic cells that is about 20 nm (0.02 μ) wide. The small volume of the cleft allows neurotransmitter concentration to be raised and lowered rapidly.
An autapse is a chemical (or electrical) synapse formed when the axon of one neuron synapses with its own dendrites. | 1 | Biochemistry |
Zolghadr and co-workers presented a fluorescent two-hybrid system that uses two hybrid proteins that are fused to different fluorescent proteins as well as LacI, the lac repressor. The structure of the fusion proteins looks like this: FP2-LacI-bait and FP1-prey where the bait and prey proteins interact and bring the fluorescent proteins (FP1 = GFP, FP2=mCherry) in close proximity at the binding site of the LacI protein in the host cell genome. The system can also be used to screen for inhibitors of protein–protein interactions. | 1 | Biochemistry |
The synthesis reported by Bodwell/Li (racemic, 2002) was a formal synthesis as it produced a compound already prepared by Rawal (no. 5 in the Rawal synthesis). The key step was an inverse electron demand Diels–Alder reaction of cyclophane 1 by heating in N,N-diethylaniline (dinitrogen is expulsed) followed by reduction of double bond in 2 to 3 by sodium borohydride / triflic acid and removal of the carbamate protecting group (PDC / celite) to 4.
The method is disputed by Reissig (see Reissig synthesis). | 0 | Organic Chemistry |
While the original effort failed to produce useful products, follow-on work in Europe did produce usable astronomical detectors
but without apparent use of this technology. In other areas, however, the approach seems to be competitive, with prior art for making various end-products, since it has been used as a fabrication step for experimental devices and structures. Many groups have used the approach to grow homoepitaxial diamond and subsequently release the thin-films with a variety of "lift-off" processes.
It has also been considered in contexts such as carbon microelectromechanical systems production and different materials applications, for example with non-contacted palladium deposition and extensions. While not citing Marchywka et al.'s original paper, these continue to cite non-contactedness as a feature,
"The electrode assembly and the conductive surface may be positioned in close proximity to, but without contacting, one another". references a much earlier patent covering related attempts to achieve non-contacted electro-etching, "The present invention relates to a method of and apparatus for electrochemically processing metallic surfaces of workpieces arranged in a contact-free manner with regard to the cathode and anode[...]."
The effect has been mentioned in passing with regard to novel devices such
as quantum coherent devices while patents on emerging uses for amorphous carbon
and
diamond thermal conductors by manufacturers of high density electronic chips reference the related lift-off technology. | 7 | Physical Chemistry |
There are two primary approaches to the organic synthesis of catenanes. The first is to simply perform a ring-closing reaction with the hope that some of the rings will form around other rings giving the desired catenane product. This so-called "statistical approach" led to the first synthesis of a catenane; however, the method is highly inefficient, requiring high dilution of the "closing" ring and a large excess of the pre-formed ring, and is rarely used.
The second approach relies on supramolecular preorganization of the macrocyclic precursors utilizing hydrogen bonding, metal coordination, hydrophobic effect, or coulombic interactions. These non-covalent interactions offset some of the entropic cost of association and help position the components to form the desired catenane upon the final ring-closing. This "template-directed" approach, together with the use of high-pressure conditions, can provide yields of over 90%, thus improving the potential of catenanes for applications. An example of this approach used bis-bipyridinium salts which form strong complexes threaded through crown ether bis(para-phenylene)-34-crown-10.
Template directed syntheses are mostly performed under kinetic control, when the macrocyclization (catenation) reaction is irreversible. More recently, the groups of Sanders and Otto have shown that dynamic combinatorial approaches using reversible chemistry can be particularly successful in preparing new catenanes of unpredictable structure. The thermodynamically controlled synthesis provides an error correction mechanism; even if a macrocycle closes without forming a catenane it can re-open and yield the desired interlocked structure later. The approach also provides information on the affinity constants between different macrocycles thanks to the equilibrium between the individual components and the catenanes, allowing a titration-like experiment. | 6 | Supramolecular Chemistry |
The Boltzmann constant ( or ) is the proportionality factor that relates the average relative thermal energy of particles in a gas with the thermodynamic temperature of the gas. It occurs in the definitions of the kelvin and the gas constant, and in Plancks law of black-body radiation and Boltzmanns entropy formula, and is used in calculating thermal noise in resistors. The Boltzmann constant has dimensions of energy divided by temperature, the same as entropy. It is named after the Austrian scientist Ludwig Boltzmann.
As part of the 2019 redefinition of SI base units, the Boltzmann constant is one of the seven "defining constants" that have been given exact definitions. They are used in various combinations to define the seven SI base units. The Boltzmann constant is defined to be exactly . | 7 | Physical Chemistry |
In polymer chemistry, the kinetic chain length () of a polymer is the average number of units called monomers added to a growing chain during chain-growth polymerization. During this process, a polymer chain is formed when monomers are bonded together to form long chains known as polymers. Kinetic chain length is defined as the average number of monomers that react with an active center such as a radical from initiation to termination.
This definition is a special case of the concept of chain length in chemical kinetics. For any chemical chain reaction, the chain length is defined as the average number of times that the closed cycle of chain propagation steps is repeated. It is equal to the rate of the overall reaction divided by the rate of the initiation step in which the chain carriers are formed. For example, the decomposition of ozone in water is a chain reaction which has been described in terms of its chain length.
In chain-growth polymerization the propagation step is the addition of a monomer to the growing chain. The word kinetic is added to chain length in order to distinguish the number of reaction steps in the kinetic chain from the number of monomers in the final macromolecule, a quantity named the degree of polymerization. In fact the kinetic chain length is one factor which influences the average degree of polymerization, but there are other factors as described below. The kinetic chain length and therefore the degree of polymerization can influence certain physical properties of the polymer, including chain mobility, glass-transition temperature, and modulus of elasticity. | 7 | Physical Chemistry |
Another way to form primitive compartments that may lead to the formation of a protocell is polyesters membraneless structures that have the ability to host biochemicals (proteins and RNA) and/or scaffold the assemblies of lipids around them. While these droplets are leaky towards genetic materials, this leakiness could have facilitated the progenote hypothesis. | 9 | Geochemistry |
The presence of conserved moieties can affect how computer simulation models are constructed. Moiety-conserved cycles will reduce the number of differential equations required to solve a system. For example, a simple cycle has only one independent variable. The other variable can be computed using the difference between the total mass and the independent variable. The set of differential equations for the two-cycle is given by:
These can be reduced to one differential equation and one linear algebraic equation: | 1 | Biochemistry |
A chafery is a variety of hearth used in ironmaking for reheating a bloom of iron, in the course of its being drawn out into a bar of wrought iron.
The equivalent term for a bloomery was string hearth, except in 17th century Cumbria, where the terminology was that of the finery forge.
A finery forge for the Walloon process would typically have one chafery to work two fineries (but sometimes one or three fineries).
Chaferies were also used in the potting and stamping forges of the industrial revolution. | 8 | Metallurgy |
A review in 2013 came to the result that infants resulting from IVF (with or without ICSI) have a relative risk of birth defects of 1.32 (95% confidence interval 1.24–1.42) compared to naturally conceived infants. In 2008, an analysis of the data of the National Birth Defects Study in the US found that certain birth defects were significantly more common in infants conceived through IVF, notably septal heart defects, cleft lip with or without cleft palate, esophageal atresia, and anorectal atresia; the mechanism of causality is unclear. However, in a population-wide cohort study of 308,974 births (with 6,163 using assisted reproductive technology and following children from birth to age five) researchers found: "The increased risk of birth defects associated with IVF was no longer significant after adjustment for parental factors." Parental factors included known independent risks for birth defects such as maternal age, smoking status, etc. Multivariate correction did not remove the significance of the association of birth defects and ICSI (corrected odds ratio 1.57), although the authors speculate that underlying male infertility factors (which would be associated with the use of ICSI) may contribute to this observation and were not able to correct for these confounders. The authors also found that a history of infertility elevated risk itself in the absence of any treatment (odds ratio 1.29), consistent with a Danish national registry study and "implicates patient factors in this increased risk." The authors of the Danish national registry study speculate: "our results suggest that the reported increased prevalence of congenital malformations seen in singletons born after assisted reproductive technology is partly due to the underlying infertility or its determinants." | 1 | Biochemistry |
Tin deposits exist in many parts of South America, with minor deposits in southern Peru, Colombia, Brazil, and northwestern Argentina, and major deposits of exploitable cassiterite in northern Bolivia. These deposits were exploited as early as 1000 AD in the manufacture of tin bronze by Andean cultures, including the later Inca Empire, which considered tin bronze the "imperial alloy". In North America, the only known exploitable source of tin during ancient times is located in the Zacatecas tin province of north central Mexico which supplied west Mexican cultures with enough tin for bronze production. | 8 | Metallurgy |
Acylium ions are cations of the formula . The carbon–oxygen bond length in these cations is near 1.1 Å (110-112 pm), which is shorter than the 112.8 pm of carbon monoxide and indicates triple-bond character.
The carbon centres of acylium ions generally have a linear geometry and sp atomic hybridization, and are best represented by a resonance structure bearing a formal positive charge on the oxygen (rather than carbon): . They are characteristic fragments observed in EI-mass spectra of ketones.
Acylium ions are common reactive intermediates, for example in the Friedel–Crafts acylation and many other organic reactions such as the Hayashi rearrangement. Salts containing acylium ions can be generated by removal of the halide from acyl halides:
Acyl radicals are readily generated from aldehydes by hydrogen-atom abstraction. However, they undergo rapid decarbonylation to afford the alkyl radical:
Acyl anions are almost always unstable—usually too unstable to be exploited synthetically. They readily react with the neutral aldehyde to form an acyloin dimer. Hence, synthetic chemists have developed various acyl anion synthetic equivalents, such as dithianes, as surrogates. However, as a partial exception, hindered dialkylformamides (e.g., diisopropylformamide, HCONiPr) can undergo deprotonation at low temperature (−78 °C) with lithium diisopropylamide as the base to form a carbamoyl anion stable at these temperatures. | 0 | Organic Chemistry |
Under the Acronym Biofector the European Union supports the Research of Bioeffectors under the leadership of the University of Hohenheim. Coordinator Guenter Neumann, Projectmembers: Jiří Balík, Borbala Biro, Karl Fritz Lauer, Uwe Ludewig, Torsten Müller, Alessandro Piccolo, Manfred G. Raupp, Kornelia Smalla, Pavel Tlustoš, Markus Weinmann.
The results of the project will be evaluated by the members of the Association Biostimulants in Agriculture (ABISTA) and provided agriculture for use and EU institutions for the legislative and registration procedures.
Other Biostimulants Organisations are European Biostimulant Industry Council, International Biocontrol Manufacturers' Association and Annual Biocontrol Industry Meeting. | 1 | Biochemistry |
Another advantage of poly(pseudo)rotaxanes is the ability for long-term release of drugs or genes. Some polyrotaxanes can used to form a physical hydrogel, which is called supramolecular hydrogel. In these cases, a three-dimensional physically crosslinked network formed by the poly(pseudo)rotaxanes, can be obtained, which is able to retain a large amount of water inside this network. If water-soluble drugs or genes are added in the solution, it could be capsulated in the supramolecular hydrogels. Also, functional units can be employed in the units of the poly(pseudo)rotaxanes, which enhances the interaction between the poly(pseudo)rotaxanes and capsulated drugs/genes and provides the carriers with other predetermined functions. As the network is further swollen in the water-based environment, part of the carrier will be dissolved gradually, so the capsulated drug or gene can be released from the hydrogels over a long period of time. | 6 | Supramolecular Chemistry |
Due to the inert pair effect of the heavy, organometallic compounds of Bi (III) show Lewis acid properties given the lower ability of the 6s electron pair to mix with molecular orbitals and form σ-bonds. The search for non-toxic equivalents of boronic acids in advancing the Suzuki-Miyaura carbon-carbon coupling reactions and expand the scope of carbon-nitrogen and carbon-oxygen coupling ones turned chemists' attention to organometallic bismuth chemistry. Two catalytic mechanisms were proposed in the C-C bond formation catalyzed by bismuth organometallic compounds. The major difference arises from the rate of the oxidative addition to Pd(0) into a C-Bi bond or C-O one, yielding cycles A and B, respectively (see image). | 0 | Organic Chemistry |
Kennedy J. P. Orton (1872 - 1930) was a British chemist. Initially he studied medicine at St. Thomas Hospital, but there he became interested in chemistry and moved to St. Johns College, Cambridge. He then obtained a Ph.D. summa cum laude in Heidelberg under Karl von Auwers, before working for a year with Sir William Ramsey at University College, London. He was then lecturer and demonstrator of Chemistry at St. Bartholomew's Hospital, before in 1903 being appointed Professor of Chemistry at University College of North Wales, Bangor, where he headed the department until his death. He was elected a Fellow of the Royal Society in 1921.
Besides being a chemist, he was a keen climber and ornithologist, and a biannual ornithological lecture was endowed in his name. | 7 | Physical Chemistry |
The simplest method of manufacturing the molding of a disk in one piece is a possibility for some systems. A more complex method of media manufacturing is for the media to be constructed layer by layer. This is required if the data is to be physically created during manufacture. However, layer-by-layer construction need not mean the sandwiching of many layers together. Another alternative is to create the medium in a form analogous to a roll of adhesive tape. | 5 | Photochemistry |
Until 1969 there was no obvious relationship except that the two methods lead to the same predictions. As noted earlier, the Woodward–Hoffmann method requires symmetry. But in 1969 and 1970 a general formulation was published, namely, A ground-state pericyclic change is symmetry-allowed when the total number of (4q + 2) and (4r) components is odd. The 1969–1970 Woodward–Hoffmann general formulation is seen to be equivalent to the Zimmerman Möbius–Hückel concept. Thus each (4r) component provides one plus-minus overlap in the cyclic array (i.e. an odd number) for 4n electrons. The (4q + 2) component just makes certain that the number of electrons in symmetric bonds is 4n + 2.
The equivalency of the more recent formulation of the Woodward–Hoffmann rules has been discussed. | 7 | Physical Chemistry |
PTT utilizes photothermal transduction agents (PTAs) which can transform light energy to heat through photothermal effect to raise the temperature of tumor area and thus cause the ablation of tumor cells. Specifically, ideal PTAs should have high photothermal conversion efficiency (PCE), excellent optical stability and biocompatibility, and strong light adsorption in the near-infrared (NIR) region (650-1350 nm) due to the deep-tissue penetration and minimal absorption of NIR light in the biological tissues. PTAs mainly include inorganic materials and organic materials. Inorganic PTAs, such as noble metal materials, carbon-based nanomaterials, and other 2D materials, have high PCE and excellent photostability, but they are not biodegradable and thus have potential long-term toxicity in vivo. Organic PTAs including small molecule dyes and conjugated polymers (CPs) have good biocompatibility and biodegradability, but poor photostability. Among them, small molecule dyes, such as cyanine, porphyrin, phthalocyanine, are limited in the field of cancer treatment because of their susceptibility to photobleaching and poor tumor enrichment ability. Conjugated polymers with large π−π conjugated skeleton and a high electron delocalization structure show potential for PTT due to their strong NIR absorption, excellent photostability, low cytotoxicity, outstanding PCE, good dispersibility in aqueous medium, increased accumulation at tumor site, and long blood circulation time. Moreover, conjugated polymers can be easily combined with other imaging agents and drugs to construct multifunctional nanomaterials for selective and synergistic cancer therapy.
The CPs used for tumor PTT mainly include polyaniline (PANI), polypyrrole (PPy), polythiophene (PTh), polydopamine (PDA), donor−acceptor (D-A) conjugated polymers, and poly(3,4-ethylenedioxythiophene):poly(4-styrenesulfonate) (PEDOT:PSS). | 5 | Photochemistry |
The context of a photogeochemical reaction is implicitly the surface of Earth, since that is where sunlight is available (although other sources of light such as chemiluminescence would not be strictly excluded from photogeochemical study). Reactions may occur among components of land such as rocks, soil and detritus; components of surface water such as sediment and dissolved organic matter; and components of the atmospheric boundary layer directly influenced by contact with land or water, such as mineral aerosols and gases. Visible and medium- to long-wave ultraviolet radiation is the main source of energy for photogeochemical reactions; wavelengths of light shorter than about 290 nm are completely absorbed by the present atmosphere, and are therefore practically irrelevant, except in consideration of atmospheres different from that of Earth today.
Photogeochemical reactions are limited to chemical reactions not facilitated by living organisms. The reactions comprising photosynthesis in plants and other organisms, for example, are not considered photogeochemistry, since the physiochemical context for these reactions is installed by the organism, and must be maintained in order for these reactions to continue (i.e. the reactions cease if the organism dies). In contrast, if a certain compound is produced by an organism, and the organism dies but the compound remains, this compound may still participate independently in a photogeochemical reaction even though its origin is biological (e.g. biogenic mineral precipitates or organic compounds released from plants into water).
The study of photogeochemistry is primarily concerned with naturally occurring materials, but may extend to include other materials, inasmuch as they are representative of, or bear some relation to, those found on Earth. For example, many inorganic compounds have been synthesized in the laboratory to study photocatalytic reactions. Although these studies are usually not undertaken in the context of environmental or Earth sciences, the study of such reactions is relevant to photogeochemistry if there is a geochemical implication (i.e. similar reactants or reaction mechanisms occur naturally). Similarly, photogeochemistry may also include photochemical reactions of naturally occurring materials that are not touched by sunlight, if there is the possibility that these materials may become exposed (e.g. deep soil layers uncovered by mining).
Except for several isolated instances, studies that fit the definition of photogeochemistry have not been explicitly specified as such, but have been traditionally categorized as photochemistry, especially at the time when photochemistry was an emerging field or new facets of photochemistry were being explored. Photogeochemical research, however, may be set apart in light of its specific context and implications, thereby bringing more exposure to this "poorly explored area of experimental geochemistry". Past studies that fit the definition of photogeochemistry may be designated retroactively as such. | 5 | Photochemistry |
Prp24 has a molecular weight of 50 kDa and has been shown to contain four RNA recognition motifs (RRMs) and a conserved 12-amino acid sequence at the C-terminus. RRMs 1 and 2 have been shown to be important for high-affinity binding of U6, while RRMs 3 and 4 bind at lower affinity sites on U6. The first three RRMs interact extensively with each other and contain canonical folds that contain a four-stranded beta-sheet and two alpha-helices. The electropositive surface of RRMs 1 and 2 is a RNA annealing domain while the cleft between RRMs 1 and 2 including the beta-sheet face of RRM2 is a sequence-specific RNA binding site. The C-terminal motif is required for association with LSm proteins and contributes to substrate (U6) binding and not the catalytic rate of splicing. | 1 | Biochemistry |
The C-terminal glucase enzymatic unit contains extra binding sites, which allows for it to bind to larger substrates for catalytic digestion. It was originally understood that maltase-glucoamylase's crystalline structure was inherently similar throughout the N and C-termini. Further studies have found that the C-terminus is composed of 21 more amino acid residues than the N-terminus, which account for its difference in function. Sucrase-Isomaltase –– located on chromosome 3q26–– has a similar crystalline structure to maltase-glucoamylase and work in tandem in the human small intestine. They have been derived from a common ancestor, as they both come from the same GH31 family. As a result of having similar properties, both of these enzymes work together in the small intestine in order to convert consumed starch into glucose for metabolic energy. The difference between these two enzymes is that maltase-glucoamylase has a specific activity at the 1-4 linkage of sugar, where at SI has a specific activity at the 1-6 linkage. | 1 | Biochemistry |
This reaction shows the oxidation of p-cresol in a sulfate-enriched environment. P-cresol was seen to be the easiest to degrade through the sulfate-enriched environment, while m-cresol and o-cresol where inhibited. In the chart above, p-cresol was oxidized under an anaerobic sulfate reducing condition and formed four different intermediates. After the formation of the intermediates, the study reported further degradation of the intermediates leading to the production of carbon dioxide and methane. The p-hydroxylbenzyl alcohol, p-hydroxylbenzaldehye, p-hyrdoxylbenzoate, and benzoate intermediates all are produced from this oxidation and released into the sediments. Similar results were also produced by different studies using other forms of oxidation such as: iron-reducing organisms, Copper/Manganese Oxide catalyst, and nitrate- reducing conditions. | 7 | Physical Chemistry |
Flashover is one of the most feared phenomena among firefighters. Firefighters are taught to recognize the signs of imminent rollovers and flashovers and to avoid backdrafts. For example, there are certain routines for opening closed doors to buildings and compartments on fire, known as door entry procedures, ensuring fire crew safety where possible. | 7 | Physical Chemistry |
In exceptionally preserved fossils, such as those of the Burgess shale, soft parts of organisms may be preserved. Since these fossils are often compressed into a planar film, it can be difficult to distinguish the features: a famous example is the triangular extensions in Opabinia, which were interpreted as either legs or extensions of the gut. Elemental mapping showed that their composition was similar to the gut, favoring that interpretation. Because of the thinness of carbon films, only low voltages (5-15 kV) can be used on them. | 3 | Analytical Chemistry |
The International Standard for making artificial seawater can be found at ASTM International. The current standard is named ASTM D1141-98 (The original standard was ASTM D1141-52) and describes the standard practice for the preparation of substitute ocean water.
The ASTM D1141-98 standard comes in a ready-made artificial seawater form or a "Sea Salt" mix that can be prepared by engineers and hobbyists. Generally, the ready-made artificial seawater comes in 1 gallon and 5 gallon containers, whereas the "Sea Salt" mix comes in 20lb pails (makes approximately 57 gallons) and 50lb pails (makes approximately 143 gallons). | 9 | Geochemistry |
"Polarity" is a gene expression mechanism in which transcription terminates prematurely due to a loss of coupling between transcription and translation. Transcription outpaces translation when the ribosome pauses or encounters a premature stop codon. This allows the transcription termination factor Rho to bind the mRNA and terminate mRNA synthesis. Consequently, genes that are downstream in the operon are not transcribed, and therefore not expressed. Polarity serves as mRNA quality control, allowing unused transcripts to be terminated prematurely, rather than synthesized and degraded.
The term "polarity" was introduced to describe the observation that the order of genes within an operon is important: a nonsense mutation within an upstream gene effects the transcription of downstream genes. Furthermore, the position of the nonsense mutation within the upstream gene modulates the "degree of polarity", with nonsense mutations at the start of the upstream genes exerting stronger polarity (more reduced transcription) on downstream genes.
Unlike the mechanism of attenuation, which involves intrinsic termination of transcription at well-defined programmed sites, polarity is Rho-dependent and termination occurs at variable position. | 1 | Biochemistry |
* O. K. Berdiev
* I. N. Khlopin
* Boris Kuftin
* Gorislava Nikolaevna Lisit︠s︡yna
* Mikhail Evgenievich Masson
* Vadim Mikhailovich Masson
* G. E. Markov
* Alexey Okladnikov
* Viktor Sarianidi | 8 | Metallurgy |
Neuraminidase inhibitors are useful for combating influenza infection: zanamivir, administered by inhalation; oseltamivir, administered orally; peramivir administered parenterally, that is through intravenous or intramuscular injection; and laninamivir which is in phase III clinical trials.
There are two major proteins on the surface of influenza virus particles. One is the lectin haemagglutinin protein with three relatively shallow sialic acid-binding sites and the other is enzyme sialidase with the active site in a pocket. Because of the relative deep active site in which low-molecular-weight inhibitors can make multiple favorable interactions and approachable methods of designing transition-state analogues in the hydrolysis of sialosides, the sialidase becomes more attractive anti-influenza drug target than the haemagglutinin. After the X-ray crystal structures of several influenza virus sialidases were available, the structure-based inhibitor design was applied to discover potent inhibitors of this enzyme.
The unsaturated sialic acid (N-acetylneuraminic acid [Neu5ac]) derivative 2-deoxy-2, 3-didehydro--N-acetylneuraminic acid (Neu5Ac2en), a sialosyl cation transition-state (Figure 2) analogue, is believed the most potent inhibitor core template. Structurally modified Neu5Ac2en derivatives may give more effective inhibitors.
Many Neu5Ac2en-based compounds have been synthesized and tested for their influenza virus sialidase inhibitory potential. For example:
The 4-substituted Neu5Ac2en derivatives (Figure 3), 4-amino-Neu5Ac2en (Compound 1), which showed two orders of magnitude better inhibition of influenza virus sialidase than Neu5Ac2en5 and 4-guanidino-Neu5Ac2en (Compound 2), known as Zanamivir, which is now marketed for treatment of influenza virus as a drug, have been designed by von Itzstein and coworkers. A series of amide-linked C9 modified Neu5Ac2en have been reported by Megesh and colleagues as NEU1 inhibitors. | 0 | Organic Chemistry |
In 1938, he married Irja Pullman; they had two daughters: Siiri Anna (b. 1939) and Jean Kirsten (b. 1944). In 1946, he married Eudoxia Muller, an artist and technician whom he met at the Polaroid Corp. This marriage, which lasted until 1972, produced a daughter, and a son: Crystal Elisabeth (b. 1947), and Eric Richard Arthur (b. 1953). | 4 | Stereochemistry |
The thermal expansion coefficients depends on the modification of zirconia as follows:
* Monoclinic: 7·10/K
* Tetragonal: 12·10/K
* YO stabilized: 10,5·10/K | 7 | Physical Chemistry |
An MPS gas is a mixture of two or more of propane, butane, butadiene, methylacetylene (propyne, CHC≡CH) and propadiene (CH=C=CH). They are marketed under different names including: "MPS", "Chem-O-Lean", "Apachi Gas", "FG-2 Gas", "Flamex" and "natural gas". The most commonly known type of MPS gas is the discontinued MAPP gas.
As a fuel gas, it burns hotter than propylene, propane or natural gas. | 0 | Organic Chemistry |
The partition coefficient, abbreviated P, is defined as a particular ratio of the concentrations of a solute between the two solvents (a biphase of liquid phases), specifically for un-ionized solutes, and the logarithm of the ratio is thus log P. When one of the solvents is water and the other is a non-polar solvent, then the log P value is a measure of lipophilicity or hydrophobicity. The defined precedent is for the lipophilic and hydrophilic phase types to always be in the numerator and denominator respectively; for example, in a biphasic system of n-octanol (hereafter simply "octanol") and water:
To a first approximation, the non-polar phase in such experiments is usually dominated by the un-ionized form of the solute, which is electrically neutral, though this may not be true for the aqueous phase. To measure the partition coefficient of ionizable solutes, the pH of the aqueous phase is adjusted such that the predominant form of the compound in solution is the un-ionized, or its measurement at another pH of interest requires consideration of all species, un-ionized and ionized (see following).
A corresponding partition coefficient for ionizable compounds, abbreviated log P , is derived for cases where there are dominant ionized forms of the molecule, such that one must consider partition of all forms, ionized and un-ionized, between the two phases (as well as the interaction of the two equilibria, partition and ionization). M is used to indicate the number of ionized forms; for the -th form () the logarithm of the corresponding partition coefficient, , is defined in the same manner as for the un-ionized form. For instance, for an octanol–water partition, it is
To distinguish between this and the standard, un-ionized, partition coefficient, the un-ionized is often assigned the symbol log P, such that the indexed expression for ionized solutes becomes simply an extension of this, into the range of values . | 7 | Physical Chemistry |
In the electronics industry, octafluoropropane is mixed with oxygen and used as a plasma etching material for SiO layers in semiconductor applications, as oxides are selectively etched versus their metal substrates.
In medicine, octafluoropropane may compose the gas cores of microbubble contrast agents used in contrast-enhanced ultrasound. Octafluoropropane microbubbles reflect sound waves well and are used to improve the ultrasound signal backscatter.
It is used in eye surgery, such as pars plana vitrectomy procedures where a retina hole or tear is repaired. The gas provides a long-term tamponade, or plug, of a retinal hole or tear and allows re-attachment of the retina to occur over the several days following the procedure.
Under the name R-218, octafluoropropane is used in other industries as a component of refrigeration mixtures.
It has been featured in some plans for terraforming Mars. With a greenhouse gas effect 24,000 times greater than carbon dioxide (CO), octafluoropropane could dramatically reduce the time and resources it takes to terraform Mars.
It is the active liquid in PICO-2L dark matter bubble detector (joined PICASSO and COUPP collaborations). | 2 | Environmental Chemistry |
Simulation and modeling techniques are often combined with experimental methods to characterize structures of amorphous materials. Commonly used computational techniques include density functional theory, molecular dynamics, and reverse Monte Carlo. | 7 | Physical Chemistry |
qPCR using reverse transcription (RT-qPCR) can be used to detect GMOs given its sensitivity and dynamic range in detecting DNA. Alternatives such as DNA or protein analysis are usually less sensitive. Specific primers are used that amplify not the transgene but the promoter, terminator or even intermediate sequences used during the process of engineering the vector. As the process of creating a transgenic plant normally leads to the insertion of more than one copy of the transgene its quantity is also commonly assessed. This is often carried out by relative quantification using a control gene from the treated species that is only present as a single copy. | 1 | Biochemistry |
In 1908, Lawrence Joseph Henderson derived an equation to calculate the hydrogen ion concentration of a bicarbonate buffer solution, which rearranged looks like this:
In 1909 Søren Peter Lauritz Sørensen introduced the pH terminology, which allowed Karl Albert Hasselbalch to re-express Henderson's equation in logarithmic terms, resulting in the Henderson–Hasselbalch equation. | 7 | Physical Chemistry |
There have been several efforts to map eukaryotic interactomes through HTP methods. While no biological interactomes have been fully characterized, over 90% of proteins in Saccharomyces cerevisiae have been screened and their interactions characterized, making it the best-characterized interactome. Species whose interactomes have been studied in some detail include
* Schizosaccharomyces pombe
* Caenorhabditis elegans
* Drosophila melanogaster
* Homo sapiens
Recently, the pathogen-host interactomes of Hepatitis C Virus/Human (2008), Epstein Barr virus/Human (2008), Influenza virus/Human (2009) were delineated through HTP to identify essential molecular components for pathogens and for their host's immune system. | 1 | Biochemistry |
A novel myokine osteonectin, or SPARC (secreted protein acidic and rich in cysteine), plays a vital role in bone mineralization, cell-matrix interactions, and collagen binding. Osteonectin inhibits tumorigenesis in mice. Osteonectin can be classed as a myokine, as it was found that even a single bout of exercise increased its expression and secretion in skeletal muscle in both mice and humans. | 1 | Biochemistry |
The United States Environmental Protection Agency has set a maximum contaminant level for benzene in drinking water at 0.0005 mg/L (5 ppb), as promulgated via the U.S. National Primary Drinking Water Regulations. This regulation is based on preventing benzene leukemogenesis. The maximum contaminant level goal (MCLG), a nonenforceable health goal that would allow an adequate margin of safety for the prevention of adverse effects, is zero benzene concentration in drinking water. The EPA requires that spills or accidental releases into the environment of 10 pounds (4.5 kg) or more of benzene be reported.
The U.S. Occupational Safety and Health Administration (OSHA) has set a permissible exposure limit of 1 part of benzene per million parts of air (1 ppm) in the workplace during an 8-hour workday, 40-hour workweek. The short term exposure limit for airborne benzene is 5 ppm for 15 minutes. These legal limits were based on studies demonstrating compelling evidence of health risk to workers exposed to benzene. The risk from exposure to 1 ppm for a working lifetime has been estimated as 5 excess leukemia deaths per 1,000 employees exposed. (This estimate assumes no threshold for benzene's carcinogenic effects.) OSHA has also established an action level of 0.5 ppm to encourage even lower exposures in the workplace.
The U.S. National Institute for Occupational Safety and Health (NIOSH) revised the Immediately Dangerous to Life and Health (IDLH) concentration for benzene to 500 ppm. The current NIOSH definition for an IDLH condition, as given in the NIOSH Respirator Selection Logic, is one that poses a threat of exposure to airborne contaminants when that exposure is likely to cause death or immediate or delayed permanent adverse health effects or prevent escape from such an environment. The purpose of establishing an IDLH value is (1) to ensure that the worker can escape from a given contaminated environment in the event of failure of the respiratory protection equipment and (2) is considered a maximum level above which only a highly reliable breathing apparatus providing maximum worker protection is permitted. In September 1995, NIOSH issued a new policy for developing recommended exposure limits (RELs) for substances, including carcinogens. As benzene can cause cancer, NIOSH recommends that all workers wear special breathing equipment when they are likely to be exposed to benzene at levels exceeding the REL (10-hour) of 0.1 ppm. The NIOSH short-term exposure limit (STEL – 15 min) is 1 ppm.
American Conference of Governmental Industrial Hygienists (ACGIH) adopted Threshold Limit Values (TLVs) for benzene at 0.5 ppm TWA and 2.5 ppm STEL. | 2 | Environmental Chemistry |
Viaspan was the trademark under which the University of Wisconsin cold storage solution (also known as University of Wisconsin solution or UW solution) was sold. Currently, UW solution is sold under the Belzer UW trademark and others like Bel-Gen or StoreProtect. UW solution was the first solution designed for use in organ transplantation, and became the first intracellular-like preservation medium. Developed in the late 1980s by Folkert Belzer and James Southard for pancreas preservation, the solution soon displaced EuroCollins solution as the preferred medium for cold storage of livers and kidneys, as well as pancreas. The solution has also been used for hearts and other organs. University of Wisconsin cold storage solution remains what is often called the gold standard for organ preservation, despite the development of other solutions that are in some respects superior. | 1 | Biochemistry |
3-Iodophenol (m-iodophenol) is an aromatic organic compound. 3-Iodophenol participates in a variety of coupling reactions in which the iodide substituent is displaced. Well cited examples include thiolate and amine nucleophiles.
3-Iodophenol can be prepared by oxidative decarboxylation of 3-iodobenzoic acid: | 0 | Organic Chemistry |
In 2009, researchers developed siRNAs capable of targeting both polo-like kinase 1(PLK1) and kinesin spindle protein(KSP). Both proteins are important to the cell-cycle of tumor cells, PLK1 involved with phosphorylation of a variety of proteins and KSP integral to chromosome segregation during mitosis. Specifically, bipolar mitotic spindles are unable to form when KSP is inhibited, leading to arrest of the cell cycle and, eventually, apoptosis. Likewise, inhibition of PLK1 facilitates mitotic arrests and cell apoptosis. According to the study, a 2 mg/kg dose of PLK1-specific siRNA administered for 3 weeks to mice implanted with tumors resulted in increased survival times and obvious reduction of tumors. In fact, the median survival time of treated mice was 51 days as opposed to 32 days for the controls. Further, only 2 of the 6 mice treated had noticeable tumors around the implantation site. Even so, GAPDH, a tumor-derived signal, was present at low levels, indicating significant suppression of tumor growth but not complete elimination. Still, the results suggested minimal toxicity and no significant dysfunction of the bone marrow. Animals treated with KSP-specific siRNA, too, exhibited increased survival times of 28 days compared to 20 days in the controls. | 1 | Biochemistry |
In 1954, research into the chemistry of ferrocene began at the Department of Organic Chemistry at Moscow State University and at INEOS under the direction of Nesmeyanov. It turned out that the functional derivatives of ferrocene react similarly to aromatic compounds. However, it has been shown that the electronic effects of the substituents are transmitted through the metallocene core by an inductive mechanism, and therefore have a lesser effect than on benzene derivatives. Research on ferrocene and its derivatives made it possible to create a number of photosensitive compositions that allow obtaining a stable image on paper, fabric, plastics and metals, and also led to the creation of a new drug, ferrocerone, which fights diseases associated with iron deficiency. On the basis of cymantrene, Nesmeyanov proposed a new antiknock agent for motor gasoline. | 0 | Organic Chemistry |
Kinetic fractionation of dissolved iron occurs as a result of diffusion. When isotopes diffuse, the lower mass isotopes diffuse more quickly than the heavier isotopes, resulting in fractionation. This difference in diffusion rates has been approximated as:
In this equation, D and D are the diffusivities of the isotopes, m and m are the masses of the isotopes, and β, which can vary between 0 and 0.5, depending on the system. More work is required to fully understand fractionation as a result of diffusion, studies of diffusion of iron on metal have consistently given β values of approximately 0.25. Iron diffusion between silicate melts and basaltic/rhyolitic melts have given lower β values (~0.030). In aqueous environments, a β value of 0.0025 has been obtained. | 9 | Geochemistry |
TPVs can provide continuous power to off-grid homes. Traditional PVs do not provide power during winter months and nighttime, while TPVs can utilize alternative fuels to augment solar-only production.
The greatest advantage for TPV generators is cogeneration of heat and power. In cold climates, it can function as both a heater/stove and a power generator. JX Crystals developed a prototype TPV heating stove/generator that burns natural gas and uses a SiC source emitter operating at 1250 °C and GaSb photocell to output 25,000 BTU/hr (7.3kW of heat) simultaneously generating 100W (1.4% efficiency). However, costs render it impractical.
Combining a heater and a generator is called combined heat and power (CHP). Many TPV CHP scenarios have been theorized, but a study found that generator using boiling coolant was most cost efficient. The proposed CHP would utilize a SiC IR emitter operating at 1425 °C and GaSb photocells cooled by boiling coolant. The TPV CHP would output 85,000 BTU/hr (25kW of heat) and generate 1.5 kW. The estimated efficiency would be 12.3% (?)(1.5kW/25kW = 0.06 = 6%) requiring investment or 0.08 €/kWh assuming a 20 year lifetime. The estimated cost of other non-TPV CHPs are 0.12 €/kWh for gas engine CHP and 0.16 €/kWh for fuel cell CHP. This furnace was not commercialized because the market was not thought to be large enough. | 7 | Physical Chemistry |
Energy accounting is a system used in energy management systems to measure and analyze energy consumption to improve energy efficiency within an organization. Organisations such as Intel corporation use these systems to track energy usage.
Various energy transformations are possible. An energy balance can be used to track energy through a system. This becomes a useful tool for determining resource use and environmental impacts. How much energy is needed at each point in a system is measured, as well as the form of that energy. An accounting system keeps track of energy in, energy out, and non-useful energy versus work done, and transformations within a system. Sometimes, non-useful work is what is often responsible for environmental problems. | 7 | Physical Chemistry |
The most common method to calculate the surface stresses is by calculating the surface free energy and its derivative with respect to elastic strain. Different methods have been used such as first principles, atomistic potential calculations and molecular dynamics simulations, with density functional theory most common. A large tabulation of calculated values for metals has been given by Lee et al. Typical values of the surface energies are 1-2 Joule per metre squared (), with the trace of the surface stress tensor in the range of -1 to 1 . Some metals such as aluminum are calculated to have fairly high, positive values (e.g. 0.82) indicating a strong propensity to contract, whereas others such as calcium are quite negative at -1.25, and others are close to zero such as cesium (-0.02). | 7 | Physical Chemistry |
Grotthuss was born in 1785 in Leipzig, Electorate of Saxony, Holy Roman Empire, during an extended stay of his parents away from their home in northern Grand Duchy of Lithuania. He showed interest in natural sciences and went to study first in Leipzig and later in Paris at the École Polytechnique. Several renowned scientists taught at the École Polytechnique at that time, including Antoine François, comte de Fourcroy, Claude Louis Berthollet and Louis Nicolas Vauquelin.
Because of some tensions in the relations between Russia and France, Grotthuss had to leave for Italy where he stayed at Naples for one year. The discovery of the first electric cell in 1800 by Alessandro Volta provided the scientists a source of electricity which was used in various laboratory experiments around Europe. The electrolysis of water, acids and salt solutions was reported, but a good explanation was missing. Grotthuss actively contributed to this area both in terms of electrolysis experiments and their interpretation. During his stay in Italy, he published his work on electrolysis in 1806. His idea that the charge is not transported by the movement of particles but by breaking and reformation of bonds was the first basically correct concept for the charge transport in electrolytes; it is still valid for the charge transport in water, and the current proton hopping mechanism is a modified version of the original Grotthuss mechanism.
The following two years Grotthuss spent in Rome, some other Italian cities, and Paris, and then went back to Russia via Munich and Vienna. From 1808 on he lived at the estate of his mother in northern Lithuania. There he conducted research on electricity and light with the limited research equipment he could assemble. Grotthuss committed suicide in the spring of 1822 during a depression caused by health problems. | 5 | Photochemistry |
4-Hydroxyestradiol (4-OHE2), also known as estra-1,3,5(10)-triene-3,4,17β-triol, is an endogenous, naturally occurring catechol estrogen and a minor metabolite of estradiol. It is estrogenic, similarly to many other hydroxylated estrogen metabolites such as 2-hydroxyestradiol, 16α-hydroxyestrone, estriol (16α-hydroxyestradiol), and 4-hydroxyestrone but unlike 2-hydroxyestrone. | 1 | Biochemistry |
In coordination chemistry, a transition metal NHC complex is a metal complex containing one or more N-heterocyclic carbene ligands. Such compounds are the subject of much research, in part because of prospective applications in homogeneous catalysis. One such success is the second generation Grubbs catalyst.
Historically, N-heterocyclic carbenes were thought to mimic properties of tertiary phosphines. Many steric and electronic differences exist between the two ligands. Compared to phosphine ligands, NHC ligands' cone angle is more complex. The imidazole ring of the NHC ligand is angled away from the metal center, yet the substituents at the 1,3 positions of the imidazole ring are angled towards it. The presence of the ligand inside of the metal coordination sphere affects the metal reactivity. In terms of electronic effects, NHC are often stronger sigma donation. | 0 | Organic Chemistry |
Modern lacUV5 is seen in the BL21(DE3) strain, which carries both a lac operon with the standard promoter and a lacUV5 operon split by the DE3 prophage (and as a result driving the T7 RNA polymerase instead). The two important mutations are underlined.
lacUV5 TCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCT
LacZ TCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATTGTGTGAAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCT
position ^-35 ^-10 ^+1 | 1 | Biochemistry |
The phenomenon of limited cellular division was first observed by Leonard Hayflick, and is now referred to as the Hayflick limit. Significant discoveries were subsequently made by a group of scientists organized at Geron Corporation by Gerons founder Michael D. West, that tied telomere shortening with the Hayflick limit. The cloning of the catalytic component of telomerase enabled experiments to test whether the expression of telomerase at levels sufficient to prevent telomere shortening was capable of immortalizing human cells. Telomerase was demonstrated in a 1998 publication in Science' to be capable of extending cell lifespan, and now is well-recognized as capable of immortalizing human somatic cells.
Two studies on long-lived seabirds demonstrate that the role of telomeres is far from being understood. In 2003, scientists observed that the telomeres of Leachs storm-petrel (Oceanodroma leucorhoa') seem to lengthen with chronological age, the first observed instance of such behaviour of telomeres.
A study reported that telomere length of different mammalian species correlates inversely rather than directly with lifespan, and concluded that the contribution of telomere length to lifespan remains controversial. There is little evidence that, in humans, telomere length is a significant biomarker of normal aging with respect to important cognitive and physical abilities. | 1 | Biochemistry |
SOFIA comprises a multiwell plate sample container, an automated means for successively transporting samples from the multiwell plate sample container to a transparent capillary contained within a sample holder, an excitation source in optical communication with the sample, wherein radiation from the excitation source is directed along the length of the capillary, and wherein the radiation induces a signal which is emitted from the sample, and, at least one linear array. | 1 | Biochemistry |
The galvanic series (or electropotential series) determines the nobility of metals and semi-metals. When two metals are submerged in an electrolyte, while also electrically connected by some external conductor, the less noble (base) will experience galvanic corrosion. The rate of corrosion is determined by the electrolyte, the difference in nobility, and the relative areas of the anode and cathode exposed to the electrolyte. The difference can be measured as a difference in voltage potential: the less noble metal is the one with a lower (that is, more negative) electrode potential than the nobler one, and will function as the anode (electron or anion attractor) within the electrolyte device functioning as described above (a galvanic cell). Galvanic reaction is the principle upon which batteries are based.
See the table of standard electrode potentials for more details. | 8 | Metallurgy |
In vitro transcription (IVT) is performed on a linearized DNA plasmid template containing the targeted coding sequence. Then, naked mRNA or mRNA complexed in a nanoparticle will be delivered systemically or locally. Subsequently, a part of the exogenous naked mRNA or complexed mRNA will go through cell-specific mechanisms. Once in the cytoplasm, the IVT mRNA is translated by the protein synthesis machinery.
There are two identified RNA sensors, toll-like receptors (TLRs) and the RIG-I-like receptor family. TLRs are localized in the endosomal compartment of cells, such as DCs and macrophages. RIG-I-like family is as a pattern recognition receptor (PRR). However, the immune response mechanisms and process of mRNA vaccine recognition by cellular sensors and the mechanism of sensor activation are still unclear. | 1 | Biochemistry |
* X-ray photoelectron spectroscopy
* Auger electron spectroscopy
* Electron energy loss spectroscopy
* Ultraviolet photoelectron spectroscopy | 7 | Physical Chemistry |
Copepods are assigned to the class Copepoda within the superclass Multicrustacea in the subphylum Crustacea. An alternative treatment is as a subclass belonging to class Hexanauplia. They are divided into 10 orders. Some 13,000 species of copepods are known, and 2,800 of them live in fresh water. | 2 | Environmental Chemistry |
* High energy costs currently associated with generating and transporting hydrogen offsite.
* Presently generated from natural gas still dependent on fossil fuels (although any combustible hydrocarbon can be used).
* Production from biomass is highly land-intensive
* Energy density (by weight or volume) one half of that of gasoline and 24% less than ethanol
* Handling
** If no inhibitors are used, methanol is corrosive to some common metals including aluminum, zinc and manganese. Parts of the engine fuel-intake systems are made from aluminum. Similar to ethanol, compatible material for fuel tanks, gasket and engine intake have to be used.
** As with similarly corrosive and hydrophilic ethanol, existing pipelines designed for petroleum products cannot handle methanol. Thus methanol requires shipment at higher energy cost in trucks and trains, until new pipeline infrastructure can be built, or existing pipelines are retrofitted for methanol transport.
** Methanol, as an alcohol, increases the permeability of some plastics to fuel vapors (e.g. high-density polyethylene). This property of methanol has the possibility of increasing emissions of volatile organic compounds (VOCs) from fuel, which contributes to increased tropospheric ozone and possibly human exposure.
* Low volatility in cold weather: pure methanol-fueled engines can be difficult to start, and they run inefficiently until warmed up. This is why a mixture containing 85% methanol and 15% gasoline called M85 is generally used in ICEs. The gasoline allows the engine to start even at lower temperatures.
* With the exception of low level exposure, methanol is toxic. Methanol is lethal when ingested in larger amounts (30 to 100 mL). But so are most motor fuels, including gasoline (120 to 300 mL) and diesel fuel. Gasoline also contains small amounts of many compounds known to be carcinogenic (e.g. benzene). Methanol is not a carcinogen, nor does it contain carcinogens. However, methanol may be metabolized in the body to formaldehyde, which is both toxic and carcinogenic. Methanol occurs naturally in small quantities in the human body and in edible fruits.
* Methanol is a liquid: this creates a greater fire risk compared to hydrogen in open spaces as Methanol leaks do not dissipate. Methanol burns invisibly unlike gasoline. Compared to gasoline, however, methanol is much safer. It is more difficult to ignite and releases less heat when it burns. Methanol fires can be extinguished with plain water, whereas gasoline floats on water and continues to burn. The EPA has estimated that switching fuels from gasoline to methanol would reduce the incidence of fuel related fires by 90%. | 2 | Environmental Chemistry |
Many metal alkoxide compounds also feature oxo-ligands. Oxo-ligands typically arise via the hydrolysis, often accidentally, and via ether elimination: | 0 | Organic Chemistry |
He was born in Moscow. He had two brothers Vasily (1904) and Andrei (1911) and a sister Tatyana (1908) (two born sisters died in infancy). His father (Nikolai Vasilyevich Nesmeyanov), graduated with excellence Vladimir Gymnasium, and then the Faculty of Law of Moscow University. He became interested in enlightenment and was working as a public teacher in the village of Bushov (Tula province) for 10 years. He had married in 1898 and worked at the Moscow city government, then he was a director Bakhrushinsky orphanage in Moscow (1901 – 1917). Alexander's mother, Lyudmila Danilovna (1878 – 1958), was a multi-talented teacher. At ten years Alexander became a vegetarian, and in 1913 he stopped eating fish. It was not easy to follow this conviction, especially in the famine years of 1918 – 1921, when roach and herring were an essential food product. He had become interested in various branches of biology: entomology, hydrobiology, ornithology and from the age of thirteen became interested in chemistry. | 0 | Organic Chemistry |
To show the visitors how Birminghams iron industry developed, the main museum displays a wide range of Tannehill artifacts that have survived. Visitors, through paying a visit to the museum, can learn from the graphic exhibits how iron was made by 13 different iron companies and six rolling mills and how Alabamas iron-making industry made this state the arsenal of the Confederacy. Although Alabamas iron and steel industry experienced rapid growth during the post-war decades, Alabamas iron production had already occupied a central position in the countrys iron supply before the war ended. In the last two years of the Civil war, iron produced by Alabama furnaces accounted for 70% of the Confederate iron supply. To demonstrate the significant role Alabama played during the war , the museum displays a large number of wartime ironworks, including cookware, rifles and other weapons used by US soldiers (e.g. a 52 Cal. U.S. Spencer Repeater), cast-iron water pipes, CS artillery projectiles, the original parts of the Six Mile Bloomery Forge manufactured in 1860s, as well as a part of the Steve Phillips Collection. Notably, the artillery shells manufactured from 1862 to 1865 at the Naval Gun Works are also preserved in this museum, and this exhibition is considered as the Souths largest collection of artillery shells. In addition to the wartime iron relics, the museum preserves and demonstrates substantial numbers of historical artifacts that have witnessed the development of Alabama's iron and steel industry, such as a cast iron water pipe made in Birmingham during the 1880s.
The Iron and Steel Museum of Alabama not only displays iron relics but also preserves archaeological artifacts uncovered in this region. The site houses Walter B. Jones Centre for Industrial Archaeology, a state geologist and archeologist who devoted his lifetime to investigating Alabamas mineral and fossil fuel resources (Garrison, 2001) His geological and archaeological works are well preserved by many museums and historical institutions, including the University of Alabamas Jones Museum at Moundville Archaeological Park, as well as the Iron and Steel Museum of Alabama. In addition to the preservation of the archaeological works written by Walter Jones, the museum is further famous for its conservation of more than 10,000 archaeological artifacts that were discovered from 8 major on-site archaeological investigations from 1956 to 2008. It is noteworthy that the main museum building also houses a small research library. In this library, those who are interested in investigating the iron-making history in this country (e.g. historical researchers, scholars, and students) can find many historical archives, published materials, records, as well as first-hand accounts. | 8 | Metallurgy |
During his life, Pigulevsky became the author of more than 200 publications. He was the author of several monographs, including:
"Essential oils"
"Formation and transformation of essential oils and resins in conifers"
"Chemistry of Terpenes" | 0 | Organic Chemistry |
Hemoglycin (previously termed hemolithin) is a space polymer that is the first polymer of amino acids found in meteorites. | 9 | Geochemistry |
Pol III is unusual (compared to Pol II) by requiring no control sequences upstream of the gene, instead normally relying on internal control sequences - sequences within the transcribed section of the gene (although upstream sequences are occasionally seen, e.g. U6 snRNA gene has an upstream TATA box as seen in Pol II Promoters).
There are three classes of Pol III initiation, corresponding to 5S rRNA, tRNA, and U6 snRNA initiation. In all cases, the process starts with transcription factors binding to control sequences and ends with TFIIIB (Transcription Factor for polymerase III B) being recruited to the complex and assembling Pol III. TFIIIB consists of three subunits: TATA binding protein (TBP), a TFIIB-related factor (BRF1, or BRF2 for transcription of a subset of Pol III-transcribed genes in vertebrates), and a B-double-prime (BDP1) unit. The overall architecture bears similarities to that of Pol II. | 1 | Biochemistry |
Stiction refers to the characteristic of start-and-stop–type motion of a mechanical assembly. Consider a mechanical element slowly increasing an external force on an assembly at rest that is designed for the relative rotation or sliding of its parts in contact. The static contact friction between the assembly parts resists movement, causing the spring moments in the assembly to store mechanical energy. Any part of the assembly that can elastically bend, even microscopically, and exert a restoring force contributes a spring moment. Thus the "springs" in an assembly might not be obvious to the eye. The increasing external force finally exceeds the static friction resisting force, the spring moments, released, impulsively exert their restoring forces on both the moving assembly parts and, Newton's Third Law, in reaction on the external forcing element. The assembly parts then impulsively accelerate in motion with respect to each other though resisted by dynamic contact friction (in this context very much less than the static friction). However, the forcing element cannot accelerate at the same pace, fails to keep up and loses contact. The external force on the moving assembly momentarily drops to zero for lack of forcing mechanical contact even though the external force element continues its motion. The moving part then decelerates to a stop from the dynamic contact friction. The cycle repeats as the forcing element motion catches up to contact again. Stick, store spring energy, impulsively release spring energy, accelerate, decelerate, stop, stick. Repeat.
Stiction is a problem for the design and materials science of many moving linkages. This is particularly the case for linear sliding joints, rather than rotating pivots. Owing to simple geometry, the moving distance of a sliding joint in two comparable linkages is longer than the circumferential travel of a pivoting bearing, thus the forces involved (for equivalent work) are lower and stiction forces become proportionally more significant. This issue has often led to linkages being redesigned from sliding to purely pivoted structures, just to avoid problems with stiction. An example is the Chapman strut, a suspension linkage. | 7 | Physical Chemistry |
Lactose synthase is an enzyme that generates lactose from glucose and UDP-galactose.
It is classified under .
It consists of N-acetyllactosamine synthase and alpha-lactalbumin. Alpha-lactalbumin, which is expressed in response to prolactin, increases the affinity of N-acetyllactosamine synthase for its substrate, causing increased production of lactose during lactation.
N-acetyllactosamine synthase falls under the category of beta-1,4-galactosyltransferase, a type-II membrane protein found in the Golgi. Alpha-lactalbumin is a Ca binding protein specific to mammary glands. Beta-1,4-galactosyltransferase consists of the catalytic component and alpha-lactalbumin consists of the regulatory component of lactose synthase. Alpha-lactalbumin promotes glucose binding to beta-1,4-galactosyltransferase. The beta-1,4-galactosyltransferase catalytic component consists of two flexible loops: small loop and large loop. The small loop consists of a Trp residue (Trp314) with surrounding glycine residues, meanwhile the large loop makes up amino acid residues 345 to 365. The Trp residue in the small loop moves allowing for the sugar nucleotide to be locked into the binding site. This causes a conformational change in the large loop which then creates sites for oligosaccharide and metal ion binding, and protein-protein interactions for alpha-lactalbumin. | 1 | Biochemistry |
Bürgi–Dunitz angle theory was initially developed based on "frozen" interactions in crystals, while most chemistry takes place via collisions of molecules tumbling in solution; remarkably, the theories of the , with the complexity they reflect, evolved not from crystallographic work, but from studying reaction outcomes in such practical reactions as addition of enolates to aldehydes (e.g., in study of diastereoselection in particular aldol reactions). In applying both angles of the nucleophile trajectory to real chemical reactions, the HOMO-LUMO centered view of the Bürgi-Dunitz angle, , is modified to include further complex, electrophile-specific attractive and repulsive electrostatic and van der Waals interactions that can alter and bias toward one substituent or the other (see above). As well, dynamics are at play in each system (e.g., changing torsional angles) and are implicitly included in studies of reaction outcomes in solution, as in the early studies of ,—though not in crystallographic structure correlation approaches as gave birth to the BD concept.
Finally, in constrained environments (e.g., in enzyme and nanomaterial binding sites), these angles, when characterized, appear to be quite distinct, an observation conjectured to arise because reactivity is not based on random collision, and so the relationship between orbital overlap principles and reactivity is more complex. For instance, while a simple amide addition study with relatively small substituents gave an of ≈50° in solution, the crystallographic value determined for an enzymatic cleavage of an amide by the serine protease subtilisin gave an of 8°, and a compilation of literature crystallographic values for the same reaction in different catalysts clustered at 4 ± 6° (i.e., only slightly offset from directly behind the carbonyl, despite significant dissymmetry of the substrate electrophiles). At the same time, the subtilisin was 88° (quite distinct from the hydride-formaldehyde value of 107°, see the Bürgi–Dunitz article), and angle values from the careful literature compilation clustered at 89 ± 7° (i.e., only slightly offset from directly above or below the carbonyl carbon). | 7 | Physical Chemistry |
Transfer RNAs, which are RNAs that participate in translation, contain the greatest number of modifications of any type of RNA, with up to one-fourth of the nucleosides in these molecules containing some sort of modification in eukaryotes. There are several known reasons for the wide variety of modifications found in tRNA. First of all, such modifications allow for easier differentiation between different tRNA molecules, such as separating the initiator tRNA from elongator tRNA. Moreover, they increase overall tRNA stability. Some studies have shown that the modifications of tRNA can be dynamic and adaptive to the changes of the environment. Examples include methylation of cytosine groups by tRNA methyltransferase (Trm4) in response to the depletion of nutrients in the body. The tRNA's cruciform structure is incredibly important to its overall function and such a complicated structure is maintained by post-transcriptional modifications. A primary example of this is the methylation of guanosine at junctions within the tRNA structure. These methylguanosine impact the overall tertiary structure by disrupting any potential canonical hydrogen bonding (hydrogen bonds that are conventional Watson-Crick base pairs), thus creating a loop at the core of the tRNA. Other modifications are integral for creating and maintaining the extreme bends in the structure. | 1 | Biochemistry |
Although the sequence of steps involved in the assembly of the PIC can vary, in general, they follow step 1, binding to the promoter.
# The TATA-binding protein (TBP, a subunit of TFIID), TBPL1, or TBPL2 can bind the promoter or TATA box. Most genes lack a TATA box and use an initiator element (Inr) or downstream core promoter instead. Nevertheless, TBP is always involved and is forced to bind without sequence specificity. TAFs from TFIID can also be involved when the TATA box is absent. A TFIID TAF will bind sequence specifically, and force the TBP to bind non-sequence specifically, bringing the remaining portions of TFIID to the promoter.
# TFIIA interacts with the TBP subunit of TFIID and aids in the binding of TBP to TATA-box containing promoter DNA. Although TFIIA does not recognize DNA itself, its interactions with TBP allow it to stabilize and facilitate formation of the PIC.
# The N-terminal domain of TFIIB brings the DNA into proper position for entry into the active site of RNA polymerase II. TFIIB binds partially sequence specifically, with some preference for BRE. The TFIID-TFIIA-TFIIB (DAB)-promoter complex subsequently recruits RNA polymerase II and TFIIF.
# TFIIF (two subunits, RAP30 and RAP74, showing some similarity to bacterial sigma factors) and Pol II enter the complex together. TFIIF helps to speed up the polymerization process.
# TFIIE joins the growing complex and recruits TFIIH. TFIIE may be involved in DNA melting at the promoter: it contains a zinc ribbon motif that can bind single-stranded DNA. TFIIE helps to open and close the Pol II’s Jaw-like structure, which enables movement down the DNA strand.
# DNA may be wrapped one complete turn around the preinitiation complex and it is TFIIF that helps keep this tight wrapping. In the process, the torsional strain on the DNA may aid in DNA melting at the promoter, forming the transcription bubble.
# TFIIH enters the complex. TFIIH is a large protein complex that contains among others the CDK7/cyclin H kinase complex and a DNA helicase. TFIIH has three functions: It binds specifically to the template strand to ensure that the correct strand of DNA is transcribed and melts or unwinds the DNA (ATP-dependent) to separate the two strands using its helicase activity. It has a kinase activity that phosphorylates the C-terminal domain (CTD) of Pol II at the amino acid serine. This switches the RNA polymerase to start producing RNA. Finally it is essential for Nucleotide Excision Repair (NER) of damaged DNA. TFIIH and TFIIE strongly interact with one another. TFIIE affects TFIIH's catalytic activity. Without TFIIE, TFIIH will not unwind the promoter.
# TFIIH helps create the transcription bubble and may be required for transcription if the DNA template is not already denatured or if it is supercoiled.
# Mediator then encases all the transcription factors and Pol II. It interacts with enhancers, areas very far away (upstream or downstream) that help regulate transcription.
The formation of the preinitiation complex (PIC) is analogous to the mechanism seen in bacterial initiation. In bacteria, the sigma factor recognizes and binds to the promoter sequence. In eukaryotes, the transcription factors perform this role. | 1 | Biochemistry |
Besides the polar lipids, the outer layer of MFGM contains a number of glycosylated and non-glycosylated proteins. Proteomic analysis has revealed at least 191 different known proteins in human MFGM, and comparable numbers in bovine milk protein concentrates. While quantitatively these only represent 1% to 2% of total milk protein content, MFGM proteins are of significant interest because many are known to have bioactive and potentially beneficial properties; almost half of identified proteins have membrane/protein trafficking or cell signaling functions. The glycosylated proteins, including mucins (MUC-1, MUC-4, MUC-15), butyrophilin, lactadherin, and CD36, have been suggested to enhance triacylglyceride digestion efficiency. Furthermore, lactadherin and MUC-1, in addition to the non-glycosylated protein xanthine oxidase, have been shown or suggested in preclinical studies to possess antimicrobial properties. | 1 | Biochemistry |
When excretion of bilirubin glucuronide by the kidney is detected in the urine through urine examination, meaning that a conspicuous amount of conjugated bilirubin is present and circulating in the blood. | 1 | Biochemistry |
Poly(3-hydroxybutyrate-co-3-hydroxyvalerate), commonly known as PHBV, is a polyhydroxyalkanoate-type polymer. It is biodegradable, nontoxic, biocompatible plastic produced naturally by bacteria and a good alternative for many non-biodegradable synthetic polymers. It is a thermoplastic linear aliphatic polyester. It is obtained by the copolymerization of 3-hydroxybutanoic acid and 3-hydroxypentanoic acid. PHBV is used in speciality packaging, orthopedic devices and in controlled release of drugs. PHBV undergoes bacterial degradation in the environment. | 1 | Biochemistry |
In a molecule, both the electrons and nuclei experience similar-scale forces from the Coulomb interaction. However, the nuclei remain at nearly fixed locations in the molecule while the electrons move significantly. This picture of a molecule is based on the idea that nucleons are much heavier than electrons, so will move much less in response to the same force. Neutron scattering experiments on molecules have been used to verify this description. | 7 | Physical Chemistry |
From the figure above, it can also be seen that the interaction between two consecutive AOs is attenuated by the incremental twisting between orbitals by , where is the angle of twisting between consecutive orbitals, compared to the usual Hückel system. For this reason resonance integral is given by
where is the standard Hückel resonance integral value (with completely parallel orbitals).
Nevertheless, after going all the way around, the Nth and 1st orbitals are almost completely out of phase. (If the twisting were to continue after the th orbital, the st orbital would be exactly phase-inverted compared to the 1st orbital). For this reason, in the Hückel matrix the resonance integral between carbon and is .<br />
For the generic carbon Möbius system, the Hamiltonian matrix is:
Eigenvalues for this matrix can now be found, which correspond to the energy levels of the Möbius system. Since is a matrix, we will have eigenvalues and MOs. Defining the variable
we have:
To find nontrivial solutions to this equation, we set the determinant of this matrix to zero to obtain
Hence, we find the energy levels for a cyclic system with Möbius topology,
In contrast, recall the energy levels for a cyclic system with Hückel topology, | 7 | Physical Chemistry |
Cell–cell interactions are highly specific and are tightly regulated. Genetic defects and dysregulation of these interactions can cause many different diseases. Dysregulation that leads to leukocyte migration into healthy tissues can cause conditions such as acute respiratory distress syndrome and some types of arthritis. The autoimmune disease pemphigus vulgaris results from autoantibodies to desmoglein and other normal body proteins. The autoantibodies disrupt the adhesion between epithelial cells. This causes blisters of the skin and mucous membranes. Mutations in the connexin genes cause 8 human diseases including heart malformations and neurosensory deafness. | 1 | Biochemistry |
The atmophile elements are H, C, N and the noble gases.
Atmophile elements (also called "volatile elements") are defined as those that remain mostly on or above the surface because they are, or occur in, liquids and/or gases at temperatures and pressures found on the surface. The noble gases do not form stable compounds and occur as monatomic gases, while nitrogen, although it does not have a stable configuration for its individual atoms, forms a diatomic molecule so strong that all oxides of nitrogen are thermodynamically unstable with respect to nitrogen and oxygen. Consequently, with the development of free oxygen through photosynthesis, ammonia was oxidised to molecular nitrogen which has come to form four-fifths of the Earths atmosphere. Carbon is also classed as an atmophile because it forms very strong multiple bonds with oxygen in carbon monoxide (slowly oxidised in the atmosphere) and carbon dioxide. The latter is the fourth-largest constituent of the Earths atmosphere, while carbon monoxide occurs naturally in volcanoes and has a residence time in the atmosphere of a few months.
Hydrogen, which occurs in the compound water, is also classed as an atmophile. Water is classified as a volatile, because most of it is liquid or gas, even though it does exist as a solid compound on the surface. Water can also be incorporated into other minerals as water of crystallization (e.g. gypsum) or as hydroxyl groups (e.g. talc), giving hydrogen some lithophile character.
Because all atmophile elements are either gases or form volatile hydrides, atmophile elements are strongly depleted on earth as a whole relative to their solar abundances owing to losses from the atmosphere during the formation of the Earth. The heavier noble gases (krypton, xenon) are the rarest stable elements on Earth. | 9 | Geochemistry |
The British Non-Ferrous Metals Research Association was a research group in the United Kingdom during the 20th century, bringing together public and privately funded research into metallurgy. The name was abbreviated officially to B.N.F.M.R.A. (the organisation was normally known as ‘The BNF’ during its life). It was formed in 1920 by members of the British Non-Ferrous Metals Federation which represented the commercial interests of British manufacturers of coppers and copper alloys, lead, zinc and other non-ferrous metals and their alloys, latterly including titanium. Robert Hutton was appointed director in 1921. | 8 | Metallurgy |
Molecular motors are natural (biological) or artificial molecular machines that are the essential agents of movement in living organisms. In general terms, a motor is a device that consumes energy in one form and converts it into motion or mechanical work; for example, many protein-based molecular motors harness the chemical free energy released by the hydrolysis of ATP in order to perform mechanical work. In terms of energetic efficiency, this type of motor can be superior to currently available man-made motors. One important difference between molecular motors and macroscopic motors is that molecular motors operate in the thermal bath, an environment in which the fluctuations due to thermal noise are significant. | 6 | Supramolecular Chemistry |
In vascular plant biology, electro-osmosis is also used as an alternative or supplemental explanation for the movement of polar liquids via the phloem that differs from the cohesion-tension theory supplied in the mass flow hypothesis and others, such as cytoplasmic streaming. Companion cells are involved in the "cyclic" withdrawal of ions (K) from sieve tubes, and their secretion parallel to their position of withdrawal between sieve plates, resulting in polarisation of sieve plate elements alongside potential difference in pressure, and results in polar water molecules and other solutes present moved upward through the phloem.
In 2003, St Petersburg University graduates applied direct electric current to 10 mm segments of mesocotyls of maize seedlings alongside one-year linden shoots; electrolyte solutions present in the tissues moved toward the cathode that was in place, suggesting that electro-osmosis might play a role in solution transport through conductive plant tissues. | 7 | Physical Chemistry |
Aldehyde substituents suffer nucleophilic addition in the presence of organolithium compounds; however, adducts of aldehydes with lithium diamines can serve as effective directing groups for lateral lithiation. Subsequent treatment with an electrophilic primary alkyl halide and elimination of the diamine provides functionalized aryl aldehydes.
Tertiary amides are highly effective directing groups. After treatment of the resulting benzylic anion with an aldehyde, cyclization leads to lactones. Carboxamides, in which the amide is attached to the aromatic ring through nitrogen rather than carbon, are also effective directing groups.
Related O-aryl carbamates are good directing groups; upon warming, the resulting organolithiums undergo rearrangement to benzylic amides (the Snieckus-Fries rearrangement) via migration of the carbonyl carbon from oxygen to carbon.
Secondary N-aryl carbamates (along with secondary amides, ketones, and other directing groups containing acidic hydrogens) must be treated with two equivalents of organolithium reagent for lateral lithiation to occur. In the case below, sec-butyllithium is used to avoid competitive addition to the Boc group.
Sulfonamides require two equivalents of an organolithium reagent for lateral lithiation, but represent a useful class of directing groups. Treatment with ketones leads to tertiary alcohols in high yield. | 0 | Organic Chemistry |
Succinate is formed in E. coli in several steps.
Phosphoenolpyruvate (PEP), a glycolysis pathway intermediate, is carboxylated by the enzyme PEP carboxylase to form oxaloacetate.
This is followed by the conversion of oxaloacetate to malate by the enzyme malate dehydrogenase. Fumarate hydratase then catalyses the dehydration of malate to produce fumarate.
phosphoenolpyruvate + HCO → oxaloacetate + phosphate
oxaloacetate + NADH + H → malate + NAD
malate → fumarate + HO
The final reaction in the formation of succinate is the reduction of fumarate. It is catalysed by the enzyme fumarate reductase.
fumarate + NADH + H → succinate + NAD
This reduction is an anaerobic respiration reaction in E. coli, as it uses electrons associated with NADH dehydrogenase and the electron transport chain. ATP is generated by using an electrochemical gradient and ATP synthase. This is the only case in the mixed acid fermentation pathway where ATP is not produced via substrate-level phosphorylation.
Vitamin K, also known as menaquinone, is very important for electron transport to fumarate in E. coli. | 1 | Biochemistry |
* Investigation of the phenomena of stereoisometry in the series of limiting carbonaceous compounds. - Odessa: type. A. Schulze, 1891. - 190 p.
* Materials for the study of the genesis of silt deposits [Rev. ed. acad. N. D. Zelinsky]. - M.-L .: Publishing House of Acad. Sciences of the USSR, 1939. - 200 p.
* Coal as a means of combating asphyxiating and poisonous gases: An experimental study of 1915-1916. / N. D. Zelinsky and V. S. Sadikov. - M.-L .: Publishing House of Acad. Sciences of the USSR, 1941. - 131 p.
* Selected Works, vols. 1-2, M.-L., 1941;
* The great Russian chemist A. M. Butlerov (1828-1886) / Acad. N. D. Zelinsky; with the participation of M. M. Azarin. - M .: Publishing House of Moscow. islands of naturalists, 1949. - 241 p.
* Higher fatty acids and their relationship to tubercle bacilli / Acad. N. D. Zelinsky and Assoc. L. S. Bondar. - M .: Publishing House of Moscow. islands of naturalists, 1951. - 84 p.
Collection of works, vol. 1-4, M., 1954-1960 | 0 | Organic Chemistry |
Subsets and Splits