domain
stringclasses 17
values | text
stringlengths 1.02k
326k
| word_count
int64 512
512
|
|---|---|---|
s2orc
|
addresses
L = ⌈(L[^L] * )⌋.(5)
The generic author template A stands for A l and A u . The two are applied sequentially. A three-block layout, for instance, will be
B 3 = ⌈(B s )L{0, 7}(B s )L{0, 7}(B s )⌋.(6)
The set of author A and layout B templates is sufficient to correctly extract an 83% of the authors in the data set. To extract the remaining, the patterns ⌈LnnL⌋ and ⌈LnnnL⌋, and the corresponding all-uppercase cases, must be disambiguated.
IV. ADPARTICLES AND LEXICONS
Most of the ⌈LnnL⌋ and ⌈LnnnL⌋ patterns in the text that are not actual proper names are parts of uppercase titles spanning multiple lines. Others are publisher's tags, such as Open Access, and a few of them are addresses. An analysis of over one hundred thousand titles has identified the most frequent words as being of, the, and, in, for, from, with, to, and on. On average, preposition of appears on any title, and on in one of every ten titles. These high-frequency words are encoded as ⌈a⌋, and are referred here as adparticles, meaning that they are connected to, or connect other words. Lexically, adparticles would be adpositions, adverbs, articles, conjunctions, coverbs, prepositions, or some verbal forms such as using. Adparticles possess, therefore, the desirable property of permitting to safely scape subsequent words. Adparticle scape templates are listed in Table II, together with a case example.
Additionally, a common name lexicon has been recompiled to disambiguate cases as the previously mentioned Open Access, or noisy Email Alerts, which might appear when texts are extracted from abstract web pages. The lexicon is composed of frequent prefixes, and it is used to lowercase words before encoding the text. The prefixes are obtained according to the procedure described in Section V, in order to avoid lowercasing actual proper names. Effective lexicons are domain specific, as the word frequency is. Approximately, fifty prefixes have been sufficient to correctly extract all the authors from the 2350 item data set.
V. REMARKS
Data Set. Author name and layout templates have been identified based on the title page of 2350 scientific works.
They include a variety of journals and publishers, in addition to self-published drafts and preprints. Most of these works have a single-block author layout. Approximately 400 works have a multi-block layout. The set is a curation from an initial set of 2600 works. Exclusion was due to either an extremely poor conversion to plain text, or due to the existence of infrequent patterns that would conflict with general templates. Disregarded patterns are single-letter last names, four-word names, lack of separator among coauthors, and line breaks between fore and last name.
Common Name Lexicon. To lowercase common words without conflicting with real proper names the following procedure has been devised. Given a list of author names, and a list of common word candidates, the shortest prefix of each candidate that is not an author prefix is recorded. In this way, a list of unique shortest prefixes is obtained, together with the cumulative frequency of each. The most frequent prefixes are
| 512 |
reddit
|
parents are the only real model of close human interaction I've ever had. I became really worried recently that I, too, am endlessly negative and critical to everyone around me, and that people dislike me and avoid me the same way I want to avoid my mother, because that's how I treat myself internally and that's the only model of behavior I've ever known. I brought this up to someone, and they told me that while they could see a little bit of the harshness / signs of perfectionism, they could also see that by simply asking the question I am being very self-aware about it, which will go a long way with preventing it from being a serious issue. That's a big key, I think. My parents are not self-aware or introspective at all - if I say anything critical about my mother, she perceives it as an attack and hits back.
I had a guy tell me this the day after I gave him a blowjob/we made out. He has hsv-2! I really liked him and was an idiot and dated him for two months (not because he had it but because he lied about something very Important and I let it slide). I've been tested and didn't get it. It's honestly not that big of a deal... As long as your refrain from activities while you have an outbreak.
Agreed about Morrison's Justice League, but I'll take Rucka over him pretty much all day every day, I think Rucka puts more emphasis on character interactions than Morrison does and his dialogue is more fluid and organic. I didn't like Smith on batman as much as I thought I would, I think his style fits Green arrow much better.
https://www.accc.gov.au/business/pricing-surcharging/displaying-prices >Restaurants, cafes & bistros > Restaurants, cafes and bistros that charge a surcharge on certain days do not need to provide a separate menu or price list or have a separate price column with the surcharge factored in. However, the menu must include the words “a surcharge of [percentage] applies on [the specified day or days]” and these words must be displayed at least as prominently as the most prominent price on the menu. > If the menu does not have prices listed, these words must be displayed in a way that is conspicuous and visible to a reader. These measures apply to pricing for both food and beverages.
Just because you wouldn't find it offensive doesn't mean nobody would. It's great that you're confortable with that, it really is, and it'll make your life easier. But not everyone is like you. If you're the sort of person who says that other people are wrong for getting offended, then that's kind of a dick move. If you genuinely think that nobody is offended by it, then you're just wrong. There's not really any other options if you think calling mentally ill people "messed up" is acceptable. Edit: You actually nearly got there with your last sentence. Of course I don't think that their condition reflects on their moral character, that part
| 512 |
StackExchange
|
(.*),
You can also place information inside the capture group so all data up to and including your pattern is extracted.
Q:
Blank Option Text using $(dropdown).append(new Option("Joe Blow", 1, true, true) in IE 9
The following code works correctly in both Chrome and Firefox. In IE 9 the options are appended, but the Text is always blank.
function populateDeveloperDropDownViaSkillProfileSpecificAjaxcall(dropdown, selectedProfileId, selectedDeveloperId)
{
$(dropdown).prepend("<option value=''></option>");
$.getJSON(ajaxActionToGetFilteredDeveloperList, { skillProfileId: selectedProfileId, "selectedDeveloperId": selectedDeveloperId },
function (data) {
var opt;
//Returns a List of ASP.NET MVC SelectListItem serialized to JSON
$.each(data, function (k, v) {
if (v != undefined && v.Selected == true) {
opt = new Option(v.Text, v.Value, true, true);
}
else {
opt = new Option(v.Text, v.Value);
}
$(dropdown).append(opt);
});
}
);
}
Does anybody see something that I'm doing wrong or have a work-around for this? Apologies if this is a dumb error, but I've spent several hours on it and I'm just banging my head at this point.
A:
This could be related to a weird issue affecting past IE versions; to overcome it, I would try to force IE to update the option text after it has been appended:
if (v != undefined && v.Selected == true) {
opt = new Option(v.Text, v.Value, true, true);
}
else {
opt = new Option(v.Text, v.Value);
}
$(dropdown).append(opt);
$(opt).text(v.Text);
I don't know if this is the cause of your issue or not, but it is better to try.
Q:
TextField only accept numeric and store in ArrayList
I have a textField which only accept numeric number in two decimal places and I want it store in ArrayList....How can I do that?
private JTextField textField;
textField = new JTextField();
textField.setBounds(126, 105, 46, 14);
contentPane.add(textField);
textField.setColumns(10);
NumberFormat numberFormat = NumberFormat.getNumberInstance(Locale.getDefault());
DecimalFormat decimalFormat = (DecimalFormat) numberFormat;
decimalFormat.setGroupingUsed(false);
textField = new JFormattedTextField(decimalFormat);
textField.setColumns(15);
double b = textField.getText(); //Change type of b to string
ArrayList<Double> myVector=new ArrayList<Double>();
myVector.add(b);
A:
Your b is a double type, whereas getText doesn't return a double.
You need to change it to double before you assign it to that variable.
double b = 0;
try
{
b = Double.parseDouble(textField.getText().toString());
}
catch(NumberFormatException e)
{
System.out.println("Invalid number!");
}
ArrayList<Double> myVector=new ArrayList<Double>();
myVector.add(b);
Q:
Align two divs near each other
I am trying to align two divs next to each other and am having some problems with it. I looked up many questions in stack overflow relating to this but nothing seems to help me.
Anyone can see anything wrong with my code? The second div starts off lower down than the first one, and I also want a gap between the two
Thanks in advance
(I tried with and without the vertical align: top)
#parent {
width: 96%;
}
#Div1 {
float: left;
width: 46%;
left: 1%;
border: 1px solid rgba(0, 0, 0, 1);
vertical-align: top
}
#Div2 {
float: left;
width: 46%;
left: 49%;
border: 1px solid rgba(0, 0, 0, 1);
vertical-align: top
}
<div id="parent">
<div id="Div1">some text</div>
<div id="Div2">some more text</div>
<br style="clear: both;" />
</div>
A:
You better use flexbox instead of float: left float: right. Flexbox will make your life
| 512 |
gmane
|
ones in IE9. See
difference below:
However the most problematic thing is no change can be applied to the star
in the input box no matter if using for example font "DFKai-SB" in all font
boxes in the Chrome settings. The font used for this input box is
still "Arial Unicode MS".
Conclusion...Chrome suffers from it's settings easily gets overridden by
environment settings in a quite problematic way.
Solution...implentation of a setting for unicode glyph fonts only or some
other way to control the font selection easier.
Regards
majstang
Hello,
it's an interesting problem.
The "toBefore" and "toAfter" properties are not supported by TOPCASED.
So, the solution is to watch the value of the "fragment" property.
But it doesn't work on my sequence diagram.
The MessageOccurrenceSpecifications are not in the good order.
I got: MOS3, MOS5, MOS1, MOS2, MOS4, MOS7, MOS8, MOS6, BES1, BES2 and BES3.
But it should be: MOS1, MOS2, MOS3, MOS4, MOS5, MOS6, MOS7, MOS8, ... (it is the order that I see in the diagram on Eclipse after I open the UMLDI file).
I attach the UML and UMLDI files.
Are you sure that the property "fragment" of the enclosing
Interaction is an ordered list?
Why it doesn't work with my UML file?
Thank you.
Regards.
Hello,
Lately I was looking at bug #76252 which is about HebrewCalendar.
I think I found the source of the bug, but also found that it is
pretty complex for me to understand the whole correct things...
so if anyone familiar with Hebrew Calendar could fix it, I'd be
so grateful.
The source of the problem I think is in CCHebrewCalendar class in
mcs/class/System.Globalization/CalendralCalculations.cs.
CCHebrewCalendar.fixed_from_dmy() expects that for Hebrew month
under 7 it needs to add days of from 8th month to 12th or 13th month.
I think it could be either 7 or 8.
However, if I rewrite this method as to do that, it causes infinite
loop since last_day_of_month() internally calls long_heshvan() and
short_kislev(). They both internally call days_in_year() which calls
fixed_from_dmy() - and thus it causes infinite loop.
As long as I wikipedia it, the formula to compute days in Kislev
and Cheshvan (Heshvan) is pretty complex. It should not be like
current code which determines the number of days in chicken-and-egg
computation.
http://en.wikipedia.org/wiki/Hebrew_calendar
Atsushi Eno
This series is a major rework of previously submitted libbpf
patches [0] in order to add global data support for BPF. The
kernel has been extended to add proper infrastructure that allows
for full .bss/.data/.rodata sections on BPF loader side based
upon feedback from LPC discussions [1]. Latter support is then
also added into libbpf in this series which allows for more
natural C-like programming of BPF programs. For more information
on loader, please refer to 'bpf, libbpf: support global data/bss/
rodata sections' patch in this series.
Thanks a lot!
Well...I was going to check just that but I checked and the server I thought
was a 5.1.2 server turns out that I upgraded it to 6.3...so I don't have
anything in my lab here to check. But based on the combined knowledge
| 512 |
StackExchange
|
Jan 15 18:58:49 monitor puppet-master[14218]: No fqdn at /etc/puppet/modules/system/manifests/motd.pp:29 on node nodeY
Of course after next puppet agent iteration, everything is fine. I have no idea how to find cause of this issue. Problem is common to all 5 nodes.
I'm 100% sure that it's not related to cron.
A:
I've seen this issue on RedHat/CentOS. The puppet agent on the client machine would run out of file descriptors due to some ruby/puppet bug not closing them. After hitting the 1024 fd limit, it would not be able to run facter anymore, so the facts would be missing.
If subsequent puppet runs from the same process don't fail, it probably is a different problem, but it might be worth checking out. In my case puppet agent would log about not being able to start facter, and in /proc/PIDOFPUPPETD/fd there'd be 1024 file descriptors.
A:
I found source of my problem. It was my nagios plugin, that checks if puppet agent works and listen for connections (I run puppet agent with listen=true)
It looks like if there is more than 1 connection to puppet agent in one time, puppet can't gather facts. For example if my osfamily is "Debian", it returned just generic "Linux".
How I tested? I run 2 loops, with commands that connect to:
https://127.0.0.1:8139/production/facts/no_key
Example result:
OK: connection with puppet agent works (facter: 1.6.17, kernel: 2.6.32-5-amd64, os: Debian)
OK: connection with puppet agent works (facter: 1.6.17, kernel: 2.6.32-5-amd64, os: Debian)
OK: connection with puppet agent works (facter: 1.6.17, kernel: 2.6.32-5-amd64, os: Linux)
OK: connection with puppet agent works (facter: 1.6.17, kernel: 2.6.32-5-amd64, os: Debian)
OK: connection with puppet agent works (facter: 1.6.17, kernel: 2.6.32-5-amd64, os: Debian)
If I run loop with only 1 command, it works every time.
I'm not sure if it's really puppet problem, or something deeper (ruby modules), but to fix this issue, I need to stop connecting to puppet agent server.
Q:
Define overlap elements or elements not contained in subsets
I would like to check which strategy would be the most efficient to compute the problem described below
I have one set Q and two subsets L and R. I have three cases.
1) L ∩ R != 0. In this case, I want to get the array of overlapped elements. In the example below, the resultant set would be R = {4, 5}.
Q = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9}
L = {0, 1, 2, 3, 4, 5, *, *, *, *}
R = {*, *, *, *, 4, 5, 6, 7, 8, 9}
2) L ∩ R = 0. In this case, I want to get Q \ (L ∪ R). In the example below, the resultant set would be R = {4, 5, 6}.
Q = {0, 1, 2, 3, 4, 5, 6, 7, 8, 9}
L = {0, 1, 2, 3, *, *, *, *, *, *}
R = {*, *, *, *, *, *, *, 7, 8, 9}
3) Q \ (L ∪ R) = 0. In this case, I want to get the index
| 512 |
reddit
|
Bring it on. What a band! What a song.
I said after expenses. My expenses in Norway, each month for me, girlfriend and 2 kids was about $6k - $6,5k USD a month. Now in Bulgaria, we all use about half of that altogether, and then add the fact that I only pay 13% and not the low-mid 40's% in tax, there's a lot of money left over
Once there was this person and their name was Cloup. Cloup had a body type that resembled a dumpling. As it turns out, Cloup really liked dumplings and Cloup ate dumplings for breakfast, lunch, and dinner. And don’t forget dessert! Cloup craves variety in her dumplings and so she went to dumpling school to learn how to spice up her dumpling life. When Cloup got to dumpling school, the staff and administration were in such shock because they had never ever in their life seen anyone who looked so much like a dumpling. As a whole she looked like a dumpling, but you could also break her body down into smaller dumpling like shapes. Not only did she have a twinkle in her eye, but she also had a dumpling reflecting in her pupil. Fat and buttery. When she smiled her cheeks inflated and creased at the edges, exactly the way a velveeta cheesy stuffed dumpling would. The staff and administration wanted so badly to poke her cheeks in hope that rich orange dumpling cheese would ooze out from between her lips and down her chin like a delightful cheesy river. In awe, they offered Cloup a tray of cheesy stuffed dumplings and they closely observed her as she opened her greasy mouth to accept the dumpling and to embrace it into the warm void of her mouth. She opens her mouth and takes a big bite of the cheesy dumpling and to their surprise she reveals a toothless mouth and she sucks in the dumpling with a vacuum like sound. They watched as the dumpling erupts in her mouth, watching as it rapidly disappears down her gullet. Her buttery dumpling like fingers garb the 24 last dumplings on the tray and repeats. The staff and administration enthusiastically offer Cloup the honorable job of being the dumpling school mascot. They collectively decide that Cloup doesn’t need a dumpling costume because she is a dumpling. On the first day of dumpling school they sat Cloup down in the gymnasium, set up chairs for all students to watch, and eagerly placed 22 trays of dumplings in front of Cloup. They then explained to the students that as their first assignment they were to watch and take notes as this living, breathing dumpling inhales its own species. The entire student body sat for 30 minutes and silently observed Cloup eat 22 trays of dumplings. When Cloup was finished, a member of the staff took a needle and popped Cloup, like a big greasy pimple. The ground shook and rich orange dumpling cheese erupted everywhere. The students bathed in the cheese and from that moment on, every student at
| 512 |
reddit
|
them, then I just shoot them without waiting for lock on. It works great for me since Titanfall can get very visually hectic, and pilots move so damn fast its hard to keep track of them.
I have a lot of close friends I do bits with. It's fun. I do improv and sketch comedy as a hobby, but I find this type of bit really works best with people who you've known for years. The better you know and understand them, the easier it will be to do a bit. But I agree, it's usually the funniest and most enjoyable type of conversation you can have.
He's not complaining yet, but I did warn him they will still get smaller. Of course he says he loves me at whatever size and he won't complain because he just wants me to be happy, but I think he'd take curvy with bigger boobs over skinny with smaller boobs if he had the choice 😆
Hey everyone, Ill be moving to Salt Lake City in September. I ll be working in downtown section (corner of main street and 200 S) so I'll be looking for something close to that or a short commute. Do you guys have any recommendations for neighborhoods in that area? Is it a nice part of town? Would it be worth buying as opposed to renting there? Have condo values been going up? A little bit about me. I am moving from Atlantic City NJ. I am a decent skier and I am exciting to get better in the coming years. I am not LDS, but I don't drink or smoke so I am not into the party scene. I drive a 2013 Prius (will that be ok to drive up to the mountains on snow days if I buy decent tires?). Thanks!
Next time you're in the throes of your sexual fantasies, remember what I wrote. It is about the power. It is not a natural, genetic disposition. You are sexually aroused by dominance of the most despicable kind, and you would do the world a favor by working on forming healthy power dynamics in adult relationships. Your mistake is thinking that your fate is written in stone. It is most certainly not, and when you can admit that it isn't natural, you can actually change and move beyond it. If you hold onto this notion that you were born a pedophile, you will be what you believe.
Shit, I'm late but still When I was younger, I went on this huge trip with my entire sophomore year to this very wooded area in the south of my country. While we were there I had a little accident, and after crashing into a bush full of thorns, I got a nasty set of cuts on my knee. Thing is, it looked like I'd been clawed/bitten by something, so whenever someone asked me what happened, I'd make a stupid joke about X animal attacking me while everyone was sleeping. One girl comes up to me, asking about my knee (scars were still pretty
| 512 |
OpenSubtitles
|
"This might hurt you, Captain." ""m sorry." "Dashing." " Robert." " Thomas." "Captain Shaw." "I was so proud when I heard." "They had no choice." "All the other otticers are dead." " And Forbes?" " lmpossible, as always." "He's here somewhere." "How about you?" "Working tor your tather, helping him with the resettlement... tor the Freedmen's Relief Association." "There's a shortage of housing." "Robert!" "Are you all right?" "Yes. "m sorry." "Darling, there's someone who wishes to meet you." "General Hunter rounded up a bunch ot slaves... called them contraband and put them in camps like cattle." "The War Department decided to issue them pikes rather than guns." "Ot course they deserted." "So would I." "Robert." "Governor, you know my son Robert." " Good to see you again." " Governor Andrew." "Robert, have you met Frederick Douglass?" "Mr. Douglass." "I understand you were at Antietam." "A great and a terrible day." "I could use your help." "The governor is proposing to raise a regiment ot Negro soldiers." "No." "It was not just my idea." "Mr. Douglass" "We will offer pride and dignity... to those who have known only degradation." " Colored soldiers." "Just think of it." " Wonderful." "I've submitted your name to be commissioned colonel... of the 54th Massachusetts lntantry." "Thank you, Governor." "That's-- lt's a wondertul idea." "Excuse me." "Well done, Shaw." " Splendid job, young man." " Bravo, Robert." "What's the matter?" "Too much punch?" "I know how much you'd like to make colonel, but a colored regiment?" "You know how popular that would be?" "Handing out guns to a thousand coloreds?" "Hey, Robert." "What's wrong?" "I'm gonna do it." "You're not serious." " I want you to come with me." " Me?" "And you?" "Can you picture me in charge ot a regiment?" "Picture me in charge ot anything." "I would be honored to have you." "Then you're an idiot." "Rob, is it true?" "There's to be a colored regiment?" "So it seems." "Then I am your first volunteer." "Present arms!" "How do we look, Colonel?" "We gonna whup the Secess'?" "When do we get the blue suit?" "Yeah, the blue suit." "Ready to whip them Rebs." "When are we gonna get to fight?" "Are we really gonna get to tight this time?" "Attention!" "Morning." "Good morning, gentlemen." "I am Colonel Robert Gould Shaw." "I am your commanding otticer." "It is a great pleasure to see you all here today." "It is my hope that the same courage... spirit and honor... which has brought us together... will one day restore this Union." "May God bless us all!" "Form companies?" "We will commence with forming companies." "Company otficers, take charge." "You recruits will report to your respective otticers... by the letter of your company in alphabetical order... which is in the top lett-hand corner of your muster sheet." " Good book, brother?" " Yes, it is, actually." "Name's SearIes." "Thomas Searles." "Jupiter Sharts, sir." "What it about, that book?" "It's a collection ot essays-- Fourier, Emerson... all the transcendentalists." "It got pictures?" " Teach me?" " Yes, "d be
| 512 |
ao3
|
hello child
**ShoutNo:** why am i here?
**ShoutNo:** why do i keep getting added to these weird group chats?
**ShoutNo:** why are you pretending to be a villain?
**Dabi:** who the FUCK says im pretending?
**ShoutNo:** Midoriya? Bakugou? Mina? Why
**Dabi:** what the fuck are you talking about
**ShoutNo:** I’m so tired of this. None of it makes any sense.
**Dabi:** what the fuck kid im trying to intimidate you here stop it
**ShoutNo:** Is this like the time when Kaminari tried to fight a toaster?
**ShoutNo:** Why am I here?
**Dabi:** w
**Dabi:** your friend did what
**ShoutNo:** You know. Everyone in class was there
**Dabi:** wait.
**Dabi:** You think I’m one of your friends from school, right?
**ShoutNo:** yes?
**Dabi:** Alright. Tell me everyone’s weaknesses.
**ShoutNo:** If you say “Endeavor” in my classroom at least three people will break something.
**ShoutNo:** If you say anything vaguely homosexual everyone will have the opposite reaction. Everyone.
**ShoutNo:** Kaminari can’t spell the word “traitor” right so no one believes he’s the bad guy
**ShoutNo:** Midoriya is probably All Might’s illegitimate love child
**ShoutNo:** Hagakure starts crying when placed in front of mirrors.
**ShoutNo:** Bakugou farts in his sleep and the farts are made of nitroglycerin. Dont ask how we know
**ShoutNo:** sero’s elbows can bend both ways but they get stuck sometimes
**ShoutNo:** Kouda’s rabbit talks back sometimes.
**ShoutNo:** Mina’s can’t see pink. its the only color she cant see
**ShoutNo:** Kirishima will start crying when facing tiny animals
**ShoutNo:** Aizawa is afraid of Bees so kouda made one follow him around for a day and now Aizawa has a hive of bees that do his bidding
**ShoutNo:** Stray cats live in our dorm. There’s so many. At least seven.
**ShoutNo:** Midoriya's allergic to cats.
**ShoutNo:** his sneezes are very cute.
**Dabi:** fuck i can’t exploit dankness like no wonder no one can take you down holy shit that’s some powerful shit
**ShoutNo:** i don’t understand
**Dabi:** it’s okay i was stupid when i was your age too
**Dabi:** it’s true ask fuyumi
**ShoutNo:** I don’t understand
**Dabi:** I know
**Dabi:** I’m your brother
**ShoutNo:** Natsuo?
**Dabi:** no the other one
**ShoutNo:** Shinsou?
**Dabi:** who the fuck is that
**ShoutNo:** Bakugou?
**Dabi:** oh my god what the fuck
**Dabi:** how many kids did dad have while i was gone
**Dabi:** it hasn’t been that long has it
**ShoutNo:** I dont have any other brothers.
**Dabi:** what if i send you a picture of a gravestone
**ShoutNo:** bitch
**ShoutNo:** Touya?
**Dabi:** bitch yourself thy names dabi now
**ShoutNo:** like “dab”i or dobby the harry potter house elf?
**Dabi:** im working on that part
**ShoutNo:** arent you a villain or something
**Dabi:** idk or something
**Dabi:** anyways good chat
**Dabi:** tell fyumi she’s a bitch but shes doing great sweetie
**Dabi:** kick endeavors kneecaps in for me
**Dabi:** bye bitches
**ShoutNo:** what the fuck just happened
**Notes for the Chapter:**
> Like my shit if you like my shit. Say hi if you want me to say hi back. Run away if you want me
| 512 |
realnews
|
for all meals at restaurants reviewed on this page. Unless specified, the writer does not accept hosted meals prior to the review's publication.
WASHINGTON (Reuters) -
U.S. President Donald Trump offered help to a terminally ill infant an ocean away in a Twitter post on Monday after his parents lost a legal battle to give him experimental therapy in the United States.
The baby, 10-month-old Charlie Gard, has been at the center of a long legal battle between his parents, who wanted him to undergo an American therapy trial, and specialists at the hospital in London who said the treatment was experimental and would not help.
"If we can help little #CharlieGard, as per our friends in the U.K. and the Pope, we would be delighted to do so," Trump said in a morning Twitter post.
The baby, who will be 11 months old on Tuesday, suffers from a rare genetic disorder that has left him unable to move his arms, legs or to breathe unaided. He has a form of mitochondrial disease – a genetic condition that causes progressive muscle weakness and brain damage.
Trump waded in to the complex case as his fellow Republicans in the U.S. Senate struggled to reach consensus on a healthcare reform plan that would slash spending on healthcare for low-income Americans.
It was unclear how the U.S. president would propose to help in the case.
The baby's parents, Chris Gard and Connie Yates, launched a fundraising appeal to help pay for his doctors' bills in the United States. They have raised 1.3 million pounds ($1.68 million) from more than 83,000 donations, according to his Gofundme page.
Britain's Supreme Court ruled last month that going to the United States for treatment would prolong the baby's suffering without any realistic prospect of helping him. The court would not allow an American doctor found by the couple to be identified and details about the therapy were not available.
The parents asked the European Court of Human Rights to overturn the ruling, but that court last week declined to intervene.
Trump weighed in on Charlie Gard a day after Pope Francis.
“The Holy Father is following the case of little Charlie Gard with affection and emotion and expresses his closeness to his parents. He is praying for them, hoping that their desire to accompany and care for their own child to the end is not ignored,” according to statement from the Vatican on Sunday.
UK Prime Minister Theresa May's spokesman, asked about the Trump tweet, said it was a very sensitive case and their thoughts are with Charlie’s family.
* Annualised Q2 GDP revised to +2.5 pct vs preliminary +4.0 pct
* Q2 GDP grows 0.6 pct qtr/qtr vs preliminary +1.0 pct
* Capex rises 0.5 pct qtr/qtr vs preliminary +2.4 pct (Adds analyst quote, detail)
By Leika Kihara
TOKYO, Sept 8 (Reuters) - Japan’s economic growth in the second quarter was much slower than seen in a stellar preliminary reading, government data showed on Friday, confounding hopes for a long awaited pick-up in domestic demand.
The downgrade was
| 512 |
realnews
|
contention.
Iran's International Atomic Energy Agency (IAEA) ambassador Ali Asghar Soltanieh gestures as he attends a meeting at the IAEA headquarters in Vienna June 8, 2012. REUTERS/Herwig Prammer
“The Agency must be able to revisit areas as their work progresses and as new information becomes available,” the 27-nation EU said in a statement to the IAEA’s 35-nation board.
The IAEA’s immediate priority is gaining access to the Parchin military complex southeast of Tehran, where it believes Iran built a steel vessel in 2000 for high explosives tests and may now be cleaning the site of any incriminating evidence.
Iran says Parchin is a conventional military facility and has dismissed such suggestions as “ridiculous.”
Diplomats and analysts say Iran may offer the IAEA increased cooperation as a bargaining chip in its negotiations with world powers, which resumed in April after a 15-month hiatus and are to continue in the Russian capital on June 18-19.
Those talks are aimed at defusing tension over Iran’s nuclear program that has led to increasingly tough Western sanctions on Iran, including an EU oil embargo from July 1, and created fears of a war in the region.
Full transparency and cooperation with the IAEA is one of the elements the world powers - the United States, Russia, France, Britain, China and Germany - are seeking from Iran.
But they also want Iran to halt its higher-grade uranium enrichment, which Tehran says it needs for a research reactor but which also takes it closer to potential bomb material.
For its part, Iran wants sanctions relief and international recognition of what it says is its right to refine uranium.
“Parchin access is not among the key concessions that the six powers are seeking from Iran in Moscow,” said nuclear proliferation expert Mark Fitzpatrick of the International Institute for Strategic Studies, a think-tank in London.
“They are focused on confidence-building measures that would limit Iran’s ability to make a sprint for a nuclear weapon.”
The Emmys air on Sunday night. There were so many great performances this year on so many great shows that among the nominees, it's difficult to decide who should win. But it's easier to figure out who will win, based on precedent and overall buzz. For example, "The Handmaid's Tale" is a a critic favorite in the outstanding drama, outstanding lead actress, and outstanding supporting actress categories, but it will likely lose to NBC's massive commercial and critical hit, "This Is Us." We put together a list of our Emmy predictions, along with who we think should win. So if you're excited to see the best contenders among all the nominees this year, look no further. Sign up for Business Insider's newsletter: What you need to know every day delivered right to your inbox. Here's our list of who will win the Emmys, and who should: View As: One Page Slides
DRAMA SERIES THE NOMINEES: "Better Call Saul" "The Crown" "The Handmaid's Tale" "House of Cards" "Stranger Things" "This Is Us" "Westworld"
WILL WIN: "This Is Us"
SHOULD WIN: "The Handmaid's Tale" "The Handmaid's Tale" is relevant,
| 512 |
s2orc
|
TTTCAGCTTTTATTGCATTTATTAGTTCATTAATATTAATTTAAACATGTAACAATGATGT ATAAATAAAACTGGATGAAGAAATTAGACTAAGTTACCGGTCTTTTCACTTTTAAGTATT AACGCCTGCTTAAACTGTTGCTATTCATTAATTTGTAGTTATTTTTATGTAAATTTTTGCT ATATTATCACAACTTTATATACTGTGCTGGACATGTCAGGTGGAAATGATGGTATCCGTT GTAGACACGACATTGAATGGGCCGGTGTAAAATAAGAGTTCGCCTTTCTTAACATTTAA GATGTGCTCAGATTAACCGTGTTTTAACGGCTATAAACTTGACTCGACAGTTTCAAGGAT GTATATTTGTGAGGCATGTTACACACTTGCTGGATAGCCGGCATGGGAAGTTCTTTGTGC AGGCAGTGCTGCAGAAGGGTGTGACCTACTTTAGCTAACCGGCTAACTTAACCAGCGTT CACCTTCTGTAAACCTGGTGAATCTAACTCACTTATTCGATCACTAAACCATCAAAGATG AGTTTTTCGTTCACTTTCAGCACATAAAACATTTTTAGTGAATACTGGCGCTTTATAATG GCGCATGCAGCCTTTCAGTCTTCCCTTAAAACTGACGATTAGTCAAGTAACAGTTATTTC ATTCACTATTAAAGCGTTTCGAAATATAAGGTGTGGTCAATTTTAATAACTGGCGTAAA GCGTTCCGGATGCATTTGAACTCCTATAATTGTGTCGAACAGTAATTTTTCTTAAAACTA ATTGATAAAGACTAGAATATAAAAGTGAATGGGCTGACTGTGATCTCTCACAAGTGCTT TTGCACAAGTCTGCTCTTATGGAGTCATTTGAAGTGACTGCAGATCTGTGACGCAGTAAT GTTGGGCAGACACCCGTCGAAATTCGGTTGCGTAATTGATACCAGGCGAGGATGAAAG AGGATGTAAAACTTCATTCGTGTAGAATTTTTAGGGAGTGGCCCTGGCGTGATGAATGT CGAAATCTGTTCCTTTTTACTGAACCATACGACTCTGGCTGAGTGCCACCCCGCCGGCAG CCGCAAAGCGGCTCAATCCATTGCCTTTTATGGTAATAATGAGAGAATGCAGAGGGACT TCCTTTGTCTGGCATATCTGAGGCGCGCATTGTCACTCTAGCACCCACTAGCGGTCAGAC TGTAGAATGCAGCATGAAACAGGAAGTTGACTCCACATGGTCACATGCTCGCTGACACT TTCTTACATGGCAGCAGTGCACTTCAAAAACACACTTCACTCTGTTTTACAGTTCAGCCA TGGATGATGAAATTGCCGCACTGGTTGTTGACAACGGATCCGGTATGTGCAAAGCTGGA TTCGCTGGAGATGATGCTCCCCGTGCTGTCTTCCCATCCATTGTGGGTCGCCCCAGACAT CAGGTGAGAGATGGAGGATAAACGATTTTGGGCTGACTGATTTTAATATGAATTTTCAT GCTTTTATTCTCTAGTTCCTGAACATTTTACAAAAATTAACATGCTTTTCTTCGTTACAGG GCGTCATGGTCGGTATGGGACAGAAGGACAGCTATGTTGGTGACGAGGCTCAGAGCAA GAGGGGTATCCTGACCCTGAAGTACCCCATCGAGCACGGTATTGTCACCAACTGGGACG ATATGGAGAAGATCTGGCATCACACCTTCTACAACGAGCTGCGTGTTGCCCCAGAGGAG CACCCCGTCCTGCTCACAGAGGCCCCCCTGAACCCCAAAGCCAACAGGGAAAAGATGA CACAGGTGGGTTTTTGGCTAGCAAATGGTGCTTTGAAGTCTCTTGTCTGTCCTGTTACCT CATTTAAGTTCTCCTCTTCATTCGTTCACTTCCTCCAGGCTTTGTTTCCTCTGAGCTCCTG AGTTTCTCATCTTTTGCTGGAAGCAGCAGGTTATCTATACTTTTGCCTGCCTGTTTTGCAG TCTCCTCTGCACTCTGATTCTTTGTGCACTTTTGTTTCTTTACTCTAGATTTTCAACTAACC CCTGCATGGGTGTGTGGATGATGTGCTGTAACTTTTTGAGCATTGGTTAACTTCTCCTCT CTCGTTACAGATCATGTTCGAGACCTTCAACACCCCTGCCATGTACGTTGCCATCCAGGC TGTGCTGTCCCTGTATGCCTCTGGTCGTACCACTGGTATCGTGATGGACTCTGGTGATGG TGTCACCCACACTGTGCCCATCTACGAGGGTTATGCCCTGCCCCATGCCATCCTCCGTCT GGACTTGGCTGGCCGTGACCTGACTGACTACCTCATGAAGATCCTCACCGAGAGAGGCT ACAGCTTCACCACCACAGCTGAGAGGGAAATTGTCCGTGACATCAAGGAGAAGCTCTG CTATGTGGCTCTTGACTTCGAGCAGGAGATGGGCACCGCTGCTTCCTCCTCCTCCCTGGA GAAGAGCTATGAGCTGCCTGACGGACAGGTCATCACCATTGGCAATGAGAGGTTCAGG TGCCCAGAGGCTCTGTTCCAGCCATCCTTCTTGGGTAGGTTTCCTGACAAACGTTACCTG GTGTGTGTACTCTAGATTTGATTTGAAGGAGAATTGAAGAACCAAGGTTAACCTTTTTTT CTCTTGCTCTGCAGGTATGGAGTCTTGCGGTATCCATGAGACCACCTTCAACTCCATCAT GAAGTGTGATGTCGACATCCGTAAGGACCTGTATGCCAACACTGTATTGTCTGGTGGTA CCACCATGTACCCTGGCATTGCTGACAGGATGCAGAAGGAGATCACATCCCTGGCCCCT AGCACAATGAAAATCAAGGTGAGCTGTGGTCTGAACTTTGACCCTTAACACTCATATCA GTCTGTAACTGAATGCATATGCAACTCGTGCATTGTGCTAATCATTTGTTTCTCCACAGA TCATCGCCCCACCTGAGCGTAAATACTCTGTCTGGATCGGAGGTTCCATCCTGGCCTCCC TGTCCACCTTCCAGCAGATGTGGATTAGCAAGCAGGAGTACGACGAGTCTGGACCATCC ATCGTCCACCGCAAATGCTTCTAAACGGACTGCTACCACTTCACGCCGACTCAAACTGC GCAGAGAAAAACTTCAAACGACAACATTGGCATGGCTTTTGTTATTTTTGGCGCTTGACT CAGGATCTAAAAACTGGAACGGTGAAGGTGACGGCAATGTTTTTTGGCAAATAAGCATC CCCGAAGTTCTACAATGCATCTGAGGACTCAATGGTTTTTGTTTTGTTTCTTTAGTCATTC CAAATGTTTGTTAAATGCATTGTTCCGAAACTTATTTGCCTCTATGAAGGCTGCCCAGTA ATTGGGAGCATACTTAACATTGTAGTATTGTATGTAAATTATGTAACAAAACAACGTCT GGGTTTTGTACTTTTCAGCCTTAAAATCTTGGGTTATTTTTTTTTCTTTTTTTTTTTTTTTTT TTTTTTTTTTTTCTTTGTTCCAAAAAACTAAGCTTTACCATTCAAGATGTAAAGGTATCCA TTCTCCCCCTGGGCATATTGTAAAAGCTGTGTGGAACGTGGCGGTGCCAGACATTTGGT GGGGCCAACCTGTACACTGACTAATTCAATTCCAATAAAAGTGCACATGTGTAAGACAT CATATTCCTGTGTGACCTCCTGTGTTGGTGCTGAATGAACTTGAGTAGAAGTATATTATA TTTAATAAAACTAGTCTTTGATCTTCTTCGTGTTGTAATTACACTTTATTGGAGTATGCTC TTCAGTTCCAGAGCACTTGGGTGAAAGAAGATAAATGGGTTTTCTTGACCTGATCAAAC AGGGTTATCAGGGTGTTGTAGGTGGCTTTAACAAACTCAAATCTTTCAATTTGAGCTTAA AATGGTGTACATGGCAAATAACTTGCTCTTAAATGCTTTCAAATGCTCAAACTAACACA AATTGGGCTTTTATCAAGCTTATTTACATGTTTCCTTCATAAATGTAGCTTCAAACTGCTT TTAATTGGCCTTCACTGTTTACATGGGATAAAACCACACCAAAGCTTTGAGAACACCCT TTAAAAATGGAGGTCAATGTCAGTTTTATGCTTGTGCATATAAACTCCAATATCAAGAC ATTTAATGCCAGCGTTACTGTGGGAAATTTTAAGCATATGGGGAAAGTAGCCAAGTTTT AATCAACAGGTGAAGACTATAATTTTTACGGAGCTAAGTTAAATTAAGTTTATTAATCT GTTCATTGCGTCTTTAGTGAGCTGTTGTGAGTGAATACAAATTTATATTTGTGCCTTTAG ACTGAAGTTTGAACGTTATGAGAGAGCATTATGCCGCCTCATGGTCAGATGGTGTTATA TTTTAATTTGCACTTCACGTAACTGTACAGCAGATGGCGCTACATACACATGAAACGAA ATTCTTGATGCTTTGATTTGAGGAAACATGAACACAGACTCATAGTAACTCAATCAAGG TGCAAGAGACTGTGTTTTCTCTTGGGAAGAGTACAAAAAATTCAGTAAGTGACATGAAA TAGAATAACAAAACGTGGCACATATCCAATTTGTGCTAACAATATACACTAATAACTGG CTGCTGTTTTTAGGTTGATCCTGGTGAGCTTGAACTTTGGTTATTGATGTAGTAGATACT TATAAAGATGGGTGCCCTAGTTGCATATGATTTACTGCAAGCTGCTTCTCGTCTGACAGC ACTTGATGAAAAATGATCAAGAGATTTTCCTGCTGTGTACATCTGTGCATGTGTAGAGT ATGACACACCAGTTTCCAGCTCTCTCTACGGAGCAGAAGAAGGAGCTTTCCACAATTGC CCAGCGTATTGTGGCAACTGGAAAAGGCATCTTGGCTGCAGATGAGTCCACAGGCACCA TGGCAAATCGCTTTCAGAAGATAAATGTGGAGAACACCGAAGAGAACCGTCGTAGCTTT CGTGACCTCCTCTTCTCTGTAGACAATTCTATCTCTGAAAGTATTGGCGGTGTCATTTTTT TCCACGAAACACTGTACCAGAAATCAGACAAAGGAGTTCTGTTTCCAAAAGTCGTCAAG GACAAGGGCATCGTAGTTGGTATCAAGGTGGACAAAGGCACAGCGGGCCTGGGCGGTA CAAATGGAGAGACAACCACACAAGGATTGGATGGTCTTTCTGAACGCTGTGCCCAGTAC AAAAAGGACGGTTGTGACTTTGCCAAGTGGCGTTGTGTACTTAAGATCTCTGACGGCTG CCCCTCTGCTCTTGCAATTGCTGAAAACGCTAACGTTCTTGCCAGATATGCCAGCATTTG CCAACAGAATGGCTTGGTTCCCATTGTAGAGCCTGAGATCCTCCCAGACGGAGATCATG ATCTGCAACGGTGCCAGTATGCCACTGAGAAGGTCCTGGCGGCTGTGTACAAAGCTCTC TCTGACCACCATGTGTATCTGGAGGGAACTCTGCTCAAACCAAACATGGTCACTGCTGG ACACTCCTGCACCAAGAAGTACACCCCCCAGGAGGTCGCCATGGCAACAGTTACTGCTC TCAGACGCACTGTGCCAGCTGCTGTACCTGGCATCTGCTTCCTCTCTGGTGGTCAAAGTG AGGAGGAGGCCTCTCTGAATCTGAATGCCATGAACCAGCTTCCCCTGCACAGACCCTGG AAGCTGAGCTTCTCTTATGGCCGTGCTCTCCAGGCCTCGGCTCTTGCTGCATGGAAGGG ACAAGCAGCGAACAAGAAGGCTGCACAGGATGCCTTTGTCACACGTGCCAAGATCAAT AGTCTTGCATCACAAGGCGAATACAAACCCTCAGGCCAGGCTGACCAAGCATCTAAAC AGTCCCTCTTTACTGCCAGCTATGTCTACTAAATCCAACAACAAACAACAGCAACTTGTT CTGGACAATACAAAATTTACATGCAAACATACCAAAAGATATTGAAGAAGATCTGACA AATAGGGGTTGCACAGACTAGTCGACTTTAATGCTCTCCCATGACGCTTTAAGCTTGAC GTCGACTTGTCGCTGATCATGGGGCGCAACAGGAACAGGATCTTTGAAGTCCGCTTTTA CACTCTGTTTCAAACAGTTAAAATGACGAATAAATGCATACAACATGTTTGATTATACC ATCTGGAGCTTATTGTACATCTAAGTTAATCACCGTTCTAAATGCACTGCTGCACTGTAA TGCACACAGACAGACAGCTCGCACATCACGCGCAGATCGTACACACAGAAAGTAGCGC AGATATGTATTGTCAACACTGTTCTGTGATTTAGCAATAAAATAGCTTAGAAACTGAAA TGTTCTAGCATATATTTCTTAGTAACTAAAACATACATTCATATAAATGTCATTTTTAAT GCGCTACTTTATCTGTATATGATTTAGAAGGAGCAGAAACCTGTGAGAAATATAACAAC CCAAAGACAAAAGAACGGATAAAAATGATTATGTAGGTGCAATAGCCTTGTAGGCAGC GTTGTGTCATATGCCATAACTGTACACAAGGCAACCCACGTTCGAGTCAGATCCATCCA TCTACTCGAGGTTCAGGCTTATTTGTTAATTAATGACATCATCAGCGACTAGTTGACGTC GACTTAAAAACATCTGAAGTTGTTTAACCCCTACTGACAACACATTAATGTGTACACTT GTTAATTGTACTAAAAGGAATGTTCTACCAAGATGACTCAAACAGACCCTGGATTAGTT TCATTTTTAATTCATGGCACTAACTAATGCTTTTCATTTTGAATAAATCATACATTTTATT TGAGTTGATTTCTTCTGTAAACATTAAGGTGGGAGTTGTTTAGTCAACCATTTTGTTGTG CTCTACTTTACTAAGAACCAACATGTAAATTGACATGTTTAAATGTTTAAAACCTAAAA AGTAATGTGCCTTTGCATCTGATGTCAACTGGTCTCTCTGACTTCCACAGCAGACTGAAA AAAAGATGCTGAAGGGTCAGTTTTCAATAAGGTTGAAGAGCTTCAAAATGTCATGAAGG TTTTTCTCTCTTGCTTCATCTGCTGCTGTCCTTTCCCAAACATCAGCAATCTGATAGGGCA GAGACAAATTATACATGTTACAGGTTGAGAGTTATGGCTTATTCTCTCTTAGGTTCATTT CGACCCGAAATTCATTTTCATTTTTAAAAATTTAGTTTTCATCGGGGTGGTCCAAGACCT GGTATAAAGACATTATGAATCAGTACCAAACTTTGCAAACTGACTAGTCCACCAAAGAT GTGACTTACAAGCTATACATAAGAAATAGTACAGATTTGACATTTTTAGACATGACTAA CCACACTGAGTGCAATCTTCTAATTTTCTGTGATGACTGAAAGACAAGTTACAACAAAA ATTTGAGATCAGATAATCAATTTAATGTCAACCAGTTATGCAAAATTATTAGTTTCTTAC CCCTCGTATATATCCCAGTATGCCAATTTCTTTGCCAGCTTGCAAATTGCAACAAGCACT TTGTTGCAATCTGAGGTGTGGGCAAGCTCAGGTGTAAGAGCAGTGCGACATGACACTTT GGGGCGTGTCTAGACGGGGGCATCTCAGCAGGTGCAGCTGTAAACATTCACCCTCATGT GCTCCAAACTCGTAAGACTTTCTTCTGTGGACAGGGTCGTTCTTGGTGCGGTGCAACTGG TGCGACCGCAGGCTAACAGATCAATGATTCATCTTTCACAGCAATGATATGTGCATACT AAAATGCATTAAGTTTGTAAATTTAATTGAACAAAGCAGTGCTCTGATTTATTGGGTCA AAATAAGGTACTGCAATTTAAGCTTTGTTTACAATTCAAATGTAGGATCACAATCCAAA TGGTGAAATCTATAACAATGAAATGCTTCTTTTCTTTTCAAGGCATAAAATAGACAAAA ATCAAAGTGCAACACTCACCTAAACACTTTAATCTAAACATAAGTGCTTTTCAACTACA TTATATCTGTAGACAACAACAGAGATTACTGCTGTTTTGTAATACTTTTATAATCGATAT GTGTCAGCTGGATCACTGGGATGTAAATTTAACTAATTATCCTTAAAGTGCCTGTTCATC AAAAGGTTTAAAATAGCTGTCCCAAGAAACTATCACCACATGTACTCTTCAACTGCACT GACGTTATATTCAAAGCAGTTGATGGTGCACCTCATGATGCTTGATCAAGACGGTCTTGT CATTTTCACTCCTTCTTGTTTCCCCATTTGGCCATCTTGCCGTTCACAGGTGTTTTCATGA ACTTGCTTGACTTCATGTATTCTGCAATCTTCTCAAGACTCTCAAAGCGCTCCAGGAAAC ATCTAAGGTTTTTGTAGTTATCCAAGCATGCTGGTTCATACATACGATGCTGATCCAACA ACTCGTACATGATGAAATCCACAAATGTGATCTTGTCCCCAGCAAACCACTTCCTGTCA CCAAGGAAGTCAGAGAACTGCTTTAGAGTTCCTGGCAGATTCTCATCGTAACATGATTT GTTTGTGTCAAACTCTCTATAGCAGAGCTGAACAAAACCATTGCGGAAGTCCATCGCCT GATTCTCCAAGATGTCAACTCTCACCTGCTCTTCTTCAGTTTCCCCACAGAGGTTGTTTTT GCGGGCGATGTATCTCATTATGGCATTGCTTTGGACTACCTTGGTGTCACCATCCACTAG GTAGGGCAAATTAGGAAAGTCCAGCCCAAGTTTGAATTTCTCATTTAACCAACAGCTTC TGTCATAGTCGGGAGCGTCACCACAAGTATAGAACTTATCCTCATACTTAGTACCAGTG TATTCCAACAGCAGACGGATTGGTTGAGCAAGCCCGCGTATATCCCAATATGCCAATTT CATTGCCATCTTGCAACAGGCTTCAAAATGAAGTGCAGCCAGGAGCAGCGGAATGGAG GAGGGGGTGTGGGGGCGCACGTGGTTCTGTGCGGTTGGGCAAAGAGCTTAGAACCCAA GAG Reverse Complement CTCTTGGGTTCTAAGCTCTTTGCCCAACCGCACAGAACCACGTGCGCCCCCACACCCCCT CCTCCATTCCGCTGCTCCTGGCTGCACTTCATTTTGAAGCCTGTTGCAAGATGGCAATGA AATTGGCATATTGGGATATACGCGGGCTTGCTCAACCAATCCGTCTGCTGTTGGAATAC ACTGGTACTAAGTATGAGGATAAGTTCTATACTTGTGGTGACGCTCCCGACTATGACAG AAGCTGTTGGTTAAATGAGAAATTCAAACTTGGGCTGGACTTTCCTAATTTGCCCTACCT AGTGGATGGTGACACCAAGGTAGTCCAAAGCAATGCCATAATGAGATACATCGCCCGC AAAAACAACCTCTGTGGGGAAACTGAAGAAGAGCAGGTGAGAGTTGACATCTTGGAGA ATCAGGCGATGGACTTCCGCAATGGTTTTGTTCAGCTCTGCTATAGAGAGTTTGACACA AACAAATCATGTTACGATGAGAATCTGCCAGGAACTCTAAAGCAGTTCTCTGACTTCCT TGGTGACAGGAAGTGGTTTGCTGGGGACAAGATCACATTTGTGGATTTCATCATGTACG AGTTGTTGGATCAGCATCGTATGTATGAACCAGCATGCTTGGATAACTACAAAAACCTT AGATGTTTCCTGGAGCGCTTTGAGAGTCTTGAGAAGATTGCAGAATACATGAAGTCAAG CAAGTTCATGAAAACACCTGTGAACGGCAAGATGGCCAAATGGGGAAACAAGAAGGAG TGAAAATGACAAGACCGTCTTGATCAAGCATCATGAGGTGCACCATCAACTGCTTTGAA TATAACGTCAGTGCAGTTGAAGAGTACATGTGGTGATAGTTTCTTGGGACAGCTATTTTA AACCTTTTGATGAACAGGCACTTTAAGGATAATTAGTTAAATTTACATCCCAGTGATCCA GCTGACACATATCGATTATAAAAGTATTACAAAACAGCAGTAATCTCTGTTGTTGTCTAC AGATATAATGTAGTTGAAAAGCACTTATGTTTAGATTAAAGTGTTTAGGTGAGTGTTGC ACTTTGATTTTTGTCTATTTTATGCCTTGAAAAGAAAAGAAGCATTTCATTGTTATAGAT TTCACCATTTGGATTGTGATCCTACATTTGAATTGTAAACAAAGCTTAAATTGCAGTACC TTATTTTGACCCAATAAATCAGAGCACTGCTTTGTTCAATTAAATTTACAAACTTAATGC ATTTTAGTATGCACATATCATTGCTGTGAAAGATGAATCATTGATCTGTTAGCCTGCGGT CGCACCAGTTGCACCGCACCAAGAACGACCCTGTCCACAGAAGAAAGTCTTACGAGTTT GGAGCACATGAGGGTGAATGTTTACAGCTGCACCTGCTGAGATGCCCCCGTCTAGACAC GCCCCAAAGTGTCATGTCGCACTGCTCTTACACCTGAGCTTGCCCACACCTCAGATTGCA ACAAAGTGCTTGTTGCAATTTGCAAGCTGGCAAAGAAATTGGCATACTGGGATATATAC GAGGGGTAAGAAACTAATAATTTTGCATAACTGGTTGACATTAAATTGATTATCTGATC TCAAATTTTTGTTGTAACTTGTCTTTCAGTCATCACAGAAAATTAGAAGATTGCACTCAG TGTGGTTAGTCATGTCTAAAAATGTCAAATCTGTACTATTTCTTATGTATAGCTTGTAAG TCACATCTTTGGTGGACTAGTCAGTTTGCAAAGTTTGGTACTGATTCATAATGTCTTTAT ACCTAAACAAATAAAATAAATAAAAAAAGGTCACGGATAGTCAGGGGTGTTTAAAATT TAACATGCTTTAGCTGGGGTGTGGTTACAGTTCATCATGCTACTGTAATTACGACGAAAC TATCTAGATAACGAGCCACAATACGCCTGTCGGAAAACATCTAACTCACAAAAGGTAG AAATTAAAAGAAATCAAACATGTCATCAGCAAAAGGAGTCGCTATTGGCATTGACCTG GGCACCACCTACTCCTGTGTGGGGGTGTTTCAGCATGGAAAGGTGGAGATCATCGCCAA TGACCAGGGGAACAGAACAACACCCAGCTATGTTGCCTTCACAGACACAGAGAGGCTC ATTGGAGATGCAGCTAAAAACCAGGTGGCCATGAACCCCAACAACACTGTGTTTGATGC CAAGAGGCTGATTGGCAGGAAGTTTGATGACCCAGTTGTGCAGTCTGACATGAAGCACT GGTCCTTCAAAGTGGTCAGTGATGGAGGAAAACCAAAGGTTCAAGTCGAATACAAAGG AGAAAACAAGACATTTAATCCTGAAGAAATTTCCTCAATGGTCCTGGTGAAGATGAAGG AGATTGCTGAAGCTTATCTGGGGCAGAAGGTGACAAACGCAGTTATCACAGTTCCTGCC TATTTCAATGACTCCCAGAGGCAAGCCACTAAAGACGCCGGAGTAATCGCTGGGCTCAA CGTCCTCAGAATCATCAACGAGCCCACAGCTGCAGCCATCGCCTACGGCCTTGACAAAG GCAAAGCAGCAGAACGCAACGTCCTGATCTTTGACCTGGGTGGAGGCACCTTTGACGTG TCCATCCTGACCATTGAAGACGGCATCTTTGAGGTGAAGGCCACAGCCGGAGACACCCA TCTGGGTGGCGAGGACTTTGACAACCGCATGGTGAATCACTTTGTAGAAGAATTCAAGA GGAAGCACAAGAAGGACATCAGTCAGAACAAGAGGGCACTGAGGAGGCTGCGGACAG CGTGTGAGCGAGCCAAGAGAACCCTCTCCTCCAGCTCTCAGGCCAGCCTTGAGATCGAC TCGCTGTACGAGGGCATCGACTTCTACACGTCCATCACCAGAGCGCGCTTTGAAGAGAT GTGCTCAGACCTCTTCAGGGGAACACTGGAGCCTGTGGAGAAAGCCCTGAGAGACGCC AAGATGGACAAGTCTCAGATCCATGACATCGTTCTGGTTGGTGGATCAACAAGAATCCC AAAGATCCAGAAGCTTCTGCAGGATTTCTTCAACGGCAGGGACTTGAACAAGAGCATCA ACCCAGATGAGGCAGTGGCTTACGGTGCAGCGGTGCAAGCCGCCATCCTCATGGGTGAC ACATCTGGAAATGTCCAGGACCTGCTGCTGCTGGATGTGGCTCCTCTGTCCCTGGGTATT GAAACCGCCGGTGGAGTCATGACGGCCCTCATCAAACGCAACACCACCATCCCCACCA AACAGACCCAGACCTTCACCACCTACTCTGACAACCAGCCCGGTGTCCTGATCCAGGTG TACGAGGGAGAGAGGGCCATGACTAAAGACAACAACCTGCTGGGTAAATTTGAGCTGA CAGGAATTCCACCTGCACCCCGTGGAGTCCCGCAGATTGAAGTGACCTTTGACATCGAC GCCAACGGAATCCTAAATGTGTCCGCGGTGGACAAAAGCACTGGAAAAGAGAACAAGA TCACCATCACCAATGACAAGGGCAGACTGAGCAAAGAGGACATTGAGAGAATGGTGCA GGAAGCAGATCAGTACAAAGCTGAAGATGATCTGCAAAGAGAGAAGATTGCTGCCAAA AACTCCCTGGAGTCTTACGCCTTCAACATGAAGAACAGTGTGGAAGATGAGAACCTGAA AGGCAAGATCAGCGAAGATGACAAGAAGAAAGTTATTGAAAAATGTAACGACACCATC AGCTGGCTAGAGAACAACCAGCTGGCTGATAAGGAGGAGTATGAACATCAGCTGAAGG AGCTGGAGAAAGTCTGCAACCCAATCATCACTAAGCTTTATCAGGGAGGGATGCCAGCT GGAGGCTGTGGAGCTCAGGCACGTGGAGGATCAGGGGCCGCTTCCCAGGGACCAACTA TTGAAGAGGTGGATTAAAGCACCTTATGAACTCAATGCTGCAGGGACTGATTTCAATCT TTTCTCTTTGGTTCTTCTATTTTTTTTCAGACCTCATTACAATATGATTCCTCTTTTTTACC TGCGGCACATCTATCTCATAAGCTGCAGGTCTAGGATGACAAGTGCAATATGGGGAAGA AAGTGTCTACATTATTACAAGTCCTCAACATTTGTGGGGAGGCAACAAATACCAAATAT AAATTCTAGAATTACAACACACAGCGGTTTACACTGAATGCACACATTCAGACTACAAC GGGACACACATAAACACTTAAGCAACAATCATAACAGGAACCGTCATTACTGCTGATGT CAACCTTTTGCTCATAACGAATGGAAATATCTTGAATGAGAAACTCTTTTGGTAATTTGA TAGAAGAAAAACAGATGGATGTGTATGAGTGAACAGGGCTGTGTTTCCCAAAAGCATT GTAAGCCTAAGTAGATCGTAGAACCATTGCTAGAACCATTGCAACCAATAGTCTCTATG ATCAACTTAGCTCACAATGCTTTTGGGAAACTCAGCCCAGGTCAGGAAGTCTAGCACAG CATACTGTTAGCTGTCCATAGAGAGTGGAGTAGTTGTCTTTTGCATCCACAATAGGTTAT AGAATGCTGAGTGAATAAGGATGACAGCTTCTTGGGAGACGAGCACCCAGCCTCTGGCT GAAGAGCCTCAGAGCGCTTAAACATTGCTGAGGGCATCAACACCAGGCAACACTTTACC CTCCAGCAGCTCCAGACTGGCTCCACCTCCTGTGCTGACATGACTGACCTTGTCTTCTGT GTCCCACTTGGCACAGCAGGTTGCTGTGTCTCCCCCACCAATAATGGTGATGCAGCCAT TTTTGGTCGCTTCCACAACTTTATCCATCAAGTTCTTGGTTCCACGAGAAAAGTTGTCCC ATTCGAACACACCAACAGGTCCGTTCCACACAATCTGCTTGGCTCTGGCTACAGCCTCC GCATAGAGCTTTGAGCTCTCAGGACCACAGTCCAGACCCATCCAGCCAGCTGGAATACC ATCTGCTACTGATGCGGTCCCTGTTGCCGCCTTCTCGTCAAACTTGTCTGCAGTGATGAA GTCAACAGGAAGTGAGATCTTAACGCCATTCTTCTCTGCTTTAGCCATGAGGTCTTTCAC AATTTTGGCACCCTCTTCATCATACAAGGAAGTGCCGATCTCCATGTTCTTGAGAACCTT GAGGAAGGTAAAGGCCATTCCTCCACCAATGATCATCTCATTCACCTTGTCCAACATGT TGTTGATCAGCTGAATCTTATCTTTGACCTTGGCCCCCCCAAGAATGGCCAGGAAAGGC CTCTGTGGTTTCTCGAGGGCCATGGCAAAGTAGTCCAGCTCCTTCTTCATTAGAAAACCA GCTGCCTTCTGAGGGAGATTCACTCCAACCATGGAGCTGTGAGCTCTGTGCGCAGTTCC AAAGGCATCATTGACGTAAACATCACCCAGCTTGGACAATGAGGCTCTGAAAGAATCG ATTTCCGCTTGACTTGCTTTGGTCTTGTTCCCCGATGCATCTTTGCCCTTGCCCTCCTCAG CCAGATGGAAACGCAGGTTCTCCAGCAGAATGACAGAACCTGCAGGTGGGTCTGCACA GGCTTTCTCCACATCTGGACCCACACAGTCCTTCAGGAACTGAACATCTTTTCCCAGCAG GCTCTTGAGTTCTGCAGCCACAGGCTCCAGAGAGTACTTGTCTGGCATGGGGACTCCAT CAGGACGGCCCAAGTGGCTCATCAGGACAACAGCTTTGGCCCCATTATCTAAGCAGTGC TGAATTGATGGGACTGCAGCCTTGATTCTCTGATTATTTGTTATTGTCTTGTCTTTCATAG GGACATTGAAGTCAACCCTCATGATCACGCGTTTTCCTTTCACATCCACCTTGTCCAAAG TGAGTTTGTTTGACAGAGACATTTTGGCTGTAGATTTGCAGAAAAACTCCTATACTGGTG TGGTGCAGTGCAGCTGGGTATGTTCCCGAATGAGAGTGACCTTAGCTTGATGCTGATGC ACATAGTGTGGG Reverse Complement CCCACACTATGTGCATCAGCATCAAGCTAAGGTCACTCTCATTCGGGAACATACCCAGC TGCACTGCACCACACCAGTATAGGAGTTTTTCTGCAAATCTACAGCCAAAATGTCTCTGT CAAACAAACTCACTTTGGACAAGGTGGATGTGAAAGGAAAACGCGTGATCATGAGGGT TGACTTCAATGTCCCTATGAAAGACAAGACAATAACAAATAATCAGAGAATCAAGGCT GCAGTCCCATCAATTCAGCACTGCTTAGATAATGGGGCCAAAGCTGTTGTCCTGATGAG CCACTTGGGCCGTCCTGATGGAGTCCCCATGCCAGACAAGTACTCTCTGGAGCCTGTGG CTGCAGAACTCAAGAGCCTGCTGGGAAAAGATGTTCAGTTCCTGAAGGACTGTGTGGGT CCAGATGTGGAGAAAGCCTGTGCAGACCCACCTGCAGGTTCTGTCATTCTGCTGGAGAA CCTGCGTTTCCATCTGGCTGAGGAGGGCAAGGGCAAAGATGCATCGGGGAACAAGACC AAAGCAAGTCAAGCGGAAATCGATTCTTTCAGAGCCTCATTGTCCAAGCTGGGTGATGT TTACGTCAATGATGCCTTTGGAACTGCGCACAGAGCTCACAGCTCCATGGTTGGAGTGA ATCTCCCTCAGAAGGCAGCTGGTTTTCTAATGAAGAAGGAGCTGGACTACTTTGCCATG GCCCTCGAGAAACCACAGAGGCCTTTCCTGGCCATTCTTGGGGGGGCCAAGGTCAAAGA TAAGATTCAGCTGATCAACAACATGTTGGACAAGGTGAATGAGATGATCATTGGTGGAG GAATGGCCTTTACCTTCCTCAAGGTTCTCAAGAACATGGAGATCGGCACTTCCTTGTATG ATGAAGAGGGTGCCAAAATTGTGAAAGACCTCATGGCTAAAGCAGAGAAGAATGGCGT TAAGATCTCACTTCCTGTTGACTTCATCACTGCAGACAAGTTTGACGAGAAGGCGGCAA CAGGGACCGCATCAGTAGCAGATGGTATTCCAGCTGGCTGGATGGGTCTGGACTGTGGT CCTGAGAGCTCAAAGCTCTATGCGGAGGCTGTAGCCAGAGCCAAGCAGATTGTGTGGA ACGGACCTGTTGGTGTGTTCGAATGGGACAACTTTTCTCGTGGAACCAAGAACTTGATG GATAAAGTTGTGGAAGCGACCAAAAATGGCTGCATCACCATTATTGGTGGGGGAGACA CAGCAACCTGCTGTGCCAAGTGGGACACAGAAGACAAGGTCAGTCATGTCAGCACAGG AGGTGGAGCCAGTCTGGAGCTGCTGGAGGGTAAAGTGTTGCCTGGTGTTGATGCCCTCA GCAATGTTTAAGCGCTCTGAGGCTCTTCAGCCAGAGGCTGGGTGCTCGTCTCCCAAGAA GCTGTCATCCTTATTCACTCAGCATTCTATAACCTATTGTGGATGCAAAAGACAACTACT CCACTCTCTATGGACAGCTAACAGTATGCTGTGCTAGACTTCCTGACCTGGGCTGAGTTT CCCAAAAGCATTGTGAGCTAAGTTGATCATAGAGACTATTGGTTGCAATGGTTCTAGCA ATGGTTCTACGATCTACTTAGGCTTACAATGCTTTTGGGAAACACAGCCCTGTTCACTCA TACACATCCATCTGTTTTTCTTCTATCAAATTACCAAAAGAGTTTCTCATTCAAGATATTT CCATTCGTTATGAGCAAAAGGTTGACATCAGCAGTAATGACGGTTCCTGTTATGATTGTT GCTTAAGTGTTTATGTGTGTCCCGTTGTAGTCTGAATGTGTGCATTCAGTGTAAACCGCT GTGTGTTGTAATTCTAGAATTTATATTTGGTATTTGTTGCCTCCCCACAAATGTTGAGGA CTTGTAATAATGTAGACACTTTCTTCCCCATATTGCACTTGTCATCCTAGACCTGCAGCT TATGAGATAGATGTGCCGCACTGGAATTATTATAATGGCTAATGTTAGACCCAGGTGAG TCAGTTGTTCTATACGTGTGTAAGTGAATAAAATGGATAAAGACAACCTCTCCGTGGTC CTGCACTCTAAAGGAGATATCAGACTGGAACAGCGCCCGATCCCGGAGCCCGGACCAA ATGATGTTCTACTTCAGATGCACTCTGTGGGAATTTGTGGATCAGACGTGCACTATTGGC AGAACGGCCGCATCGGGGACTATGTAGTGAAACAGCCCATGATACTGGGACATGAAGC CTCTGGTCGTGTGGTGAAAGTGGGATCTGATGTGATGCACCTCAAACCAGGAGACAGAG TTGCCGTTGAGCCTGGAGTTCCTCGTGAAGTAGACGAGTTCTTTAAATCTGGACACTAC AACCTTTCTCCCAGCATATTCTTCTGTGCCACTCCTCCAGATGATGGAAACCTGTGCAGA TACTACAAACACAGTGCTAACTTCTGCTACAAACTTCCCGATAATGTGACTTATGAGGA GGGAGCCCTGATTGAGCCCCTGTCAGTGGGCATTCATGCCTGCAGGAGGGCAGGAGTCA CTCTTGGAAGCTCAGTGTTTGTCTGCGGTGCAGGACCAATTGGACTAGTTTCTTTGTTGG CGGCCAAAGCCATGGGTGCTTCGCAAGTAATAATAAGTGACTTGTCCTCTGATCGGCTT GCCAAGGCTAAAGAGATCGGAGCAGACTTCCTGCTTCATGTGAAGAAAGAGGATGGAC CACAGGACATAGCCAAAAAAGTGGAGGGAATGCTGGGTTGCATGCCTCAAATCAGCAT TGAATGCACTGGAGTGCAGAGCAGCATTCAAACAGCCATCTATGCTACTCATTCAGGAG GAGTGGTGGTGTTGGTTGGGCTTGGTACTGAGATGACCACCATACCTCTTCTGAATGCA GCAGTCAGAGAAGTTGACATCAGAGGCGTATTCCGCTACTGTAATACCTGGCCGGTGGC CATTGCTATGTTGGCATCTAAGAAGGTGAACGTCAAGCCACTGGTCACCCACCGTTTCC CGCTGGAGCAGGCTGTACAGGCCTTTGAGACCACCCGTCAGGGTCTTGGGGTTAAAGTT ATGTTAAAATGTGACAAGAATGACCAGAACCCATGAGATCAATTACTAGGCCCACATCT GATTATTGCCTTGCTACAGTCACTTGAATACATTTGTTTAACCCAGCTGATTTTGACAAT AACCTCACTATCTTGTCTCAGGTACAGCAGTCACAGGAATTCAGTGACTACTCTTTACAG TAATTATTTATAATTTAATTTTCTTTGTCATTTATGAATCATGAAAAGTGTTAAAATTGTA TGCAACATTGTCAGAGTGCAGTTTTTAATGGCATGCTAGAATAATAGCAGATCATTTTTA CAGCTTACTTACCTTGATCTTGTTCACAAAAAATGAATCTTTATCAAACTTCAGTTGTCT GTGTCATTATTTTAAGTACAGTTCTCATAGCCACGAGAGCACAGTGCACATTTTTAATCA ACTTGAATGACCAACCGAGAAA
Figure S1 Figure S1 .
S1S1Effects of dietary emodin on immune response in M. amblycephala 30 mg kg -1 dietary emodin significantly increased the respiratory burst and TNF-α activity, plasma Leucocyte myeloperoxidase (MPO) activity, white blood cell (WBC), plasma superoxide dismutase (SOD) activity, and plasma malondialdehyde (MDA) content. Results indicate that the non-specific immunity as represented by the parameters tested was improved in M. amblycephala juvenile fed diet supplemented with 30 mg kg -1 emodin.
Figure S2 Figure S2 .
S2S2Effects of dietary emodin on disease resistance to Aeromonas hydrophila in M. amblycephala
G:\...\C6_MSMS_1041.6664_13.t2d G:\...\C6_MSMS_1256.7070_17.t2d G:\...\C7_MSMS_1069.4493_20.t2d4700 Reflector Spec #1 MC[BP = 1373.7, 3467]
1373.7266
1764.9792
1069.4496
824.4149
870.5368
1542.7953
1867.9629
840.4348
1159.6320
1283.6306
1033.5132
1633.8580
1296.6909
1558.7631
952.4701
2211.1726
2068.1624
1744.8462
1202.6440
1102.5874
1580.8440
1827.9272
1398.7734
1307.6749
861.0783
1027.5637
1143.6254
1903.9810
2105.1052
1722.8650
1217.6554
1491.7654
1574.7926
2261.2524
2743.4226
1833.9185
1339.6818
938.4985
1407.7970
1649.8611
2437.3296
851.4070
1014.5547
2051.0823
2189.1736
2545.3193
2353.3811
2613.1917
1957.0524
2952.4697
3178.6697
3091.6028
3343.1814
3730.2305
3812.8179
3423.6406
3567.7161
D7_MS
799.0
1441.8
2084.6
2727.4
3370.2
4013.0
Mass (m/z)
3.5E+4
0
10
20
30
40
50
60
70
80
90
100
% Intensity
4700 Reflector Spec #1 MC[BP = 1744.8, 34645]
1744.8007
1123.5176
1788.8949
| 512 |
StackExchange
|
}
li.off ul{display:none; }
.linkhover:hover {text-decoration:underline; }
.linkxp:hover {text-decoration:underline; }
#theDiv, #theDiv1, #theDiv2, #theDiv3, #theDiv4, #theDiv5, #theDiv6, #theDiv7, #theDiv8 {
padding:10px;
float:right;
margin:0px 50px 0 0;
width:300px;
height:500px;
border:1px solid #000;
display:none;
}
JavaScript
$(window).load(function(){
$(".theLink").hover(
function () {
$("#theDiv").fadeIn();
},
function () {
$("#theDiv").fadeOut();
}
);
});
$(window).load(function(){
$(".theLink1").hover(
function () {
$("#theDiv1").fadeIn();
},
function () {
$("#theDiv1").fadeOut();
}
);
});
$(window).load(function(){
$(".theLink2").hover(
function () {
$("#theDiv2").fadeIn();
},
function () {
$("#theDiv2").fadeOut();
}
);
});
$(window).load(function(){
$(".theLinka").hover(
function () {
$("#theDiv3").fadeIn();
},
function () {
$("#theDiv3").fadeOut();
}
);
});
$(window).load(function(){
$(".theLinka1").hover(
function () {
$("#theDiv4").fadeIn();
},
function () {
$("#theDiv4").fadeOut();
}
);
});
$(window).load(function(){
$(".theLinka2").hover(
function () {
$("#theDiv5").fadeIn();
},
function () {
$("#theDiv5").fadeOut();
}
);
});
$(window).load(function(){
$(".theLinkb").hover(
function () {
$("#theDiv6").fadeIn();
},
function () {
$("#theDiv6").fadeOut();
}
);
});
$(window).load(function(){
$(".theLinkb1").hover(
function () {
$("#theDiv7").fadeIn();
},
function () {
$("#theDiv7").fadeOut();
}
);
});
Here is a link to a live view;
http://tubebackgrounds.co.uk/uni/demo/explanation.html#
As you can see, if you hover over the list style too quickly when they are being displayed, the other ones show up. I'm wondering if it is possible to use an if statement so only one
$(window).load(function(){
$(".theLink").hover(
function () {
$("#theDiv").fadeIn();
},
function () {
$("#theDiv").fadeOut();
}
);
});
can be enabled at once? Or maybe a way to make the fadeIn and fadeOut quicker.
A:
part of the issue is just your css. you have each of your divs (#theDiv, #theDiv1, #theDiv2, etc...) floated next to each other. so when you hide one, the next one will pop up in its place. if you set their display propety to display:block you will set what I am saying. What you really want is those divs to be stacked one on top of another, like a deck of cards, then fade then in and out. To achieve this try adding this css:
#content {
position:relative;
}
#theDiv, #theDiv1, #theDiv2, #theDiv3, #theDiv4,#theDiv5, #theDiv6, #theDiv7, #theDiv8 {
border: 1px solid #000000;
display: none;
height: 500px;
margin: 0 50px 0 0;
padding: 10px;
position: absolute;
right: 0;
width: 300px;
}
now you javascript should work fine. you could make the javascript a bit nicer by using @beerwin suggestion and using a callback. that way the div fading in will only fadin once the previous one has faded out
Q:
Returning asynchronous results from inside a node vm, using contextify
I'm using contextify ( https://www.npmjs.com/package/contextify ) to run asynchronous 'untrusted' scripts in a node sandbox. The same issue will apply to Node 0.12+ vm.runInContext().
Contextify = require('contextify');
rp = require('request-promise');
var myCode = "rp('http://www.google.com').then( function (htmlString) { RESULT = htmlString })"
defaultContext = { rp: rp, setTimeout : setTimeout, console: console }
vm = Contextify( defaultContext )
vm.run( myCode );
vm.RESULT
//undefined
Are there any undocumented functions, or events that allow me to know when the vm has executed everything?
Or is there a clever way to wrap this request-promise function so that I get a message outside the vm?
A:
Simply create an anonymous function to handle the callback to be passed through.
Contextify = require('contextify');
rp = require('request-promise');
| 512 |
StackExchange
|
be plenty strong-enough for the task.
simulate this circuit – Schematic created using CircuitLab
at the top R3 provides C/20 charge current suitable for a 800mAh NiMH cell,
D2 and R4 provide power when ther usb charger is connected, allowing the micrcontroller to operate without using the boost converter.
below that, on the left is a boost conveerter driven by poin PA1, set PA! low for a few cycles then set it high-impedance to allow the energy from L1 to feed C1
On the right is a voltage checking circuit, when needed set PB2 high and read PB1 depending on the voltage in C1 PB1 will either read high or low, when you know enough set PB2 low to save energy. .
You will find that this circuit switches state well below the marked zener voltage, some experimentation may be needed.
Q:
A Topology containing every infinite subset of a an infinite set is discrete.
Is the following proof correct?
Proposition. Let $X$ be an infinite set and $\tau$ be a topology on $X$. If every infinite subset of $X$ is in $\tau$, prove that $\tau$ is a discrete topology.
Proof. Assume $x\in X$, since $X$ is infinite, surely there must exist an $a_1\in X$ such that $a_1\not\in\{x\}$, and by the same reasoning a $b_1\in X$ such that $b_1\not\in\{x,a_1\}$, continuing in this manner, we affirm that there exist $a_1,b_1,a_2,b_2,\dots,a_k,b_k,\dots$ in $X$ such that
$$
\begin{cases}
a_1\not\in\{x\}\\
b_1\not\in\{x\}\cup\{a_1\}\\
a_2\not\in\{x\}\cup\{a_1\}\cup\{b_1\}\\
b_2\not\in\{x\}\cup\{a_1,a_2\}\cup\{b_1\}\\
\vdots
\\
a_k\not\in\{x\}\cup\{a_1,a_2\dots,a_{k-1}\}\cup\{b_1,b_2,\dots,b_{k-1}\}\\
b_k\not\in\{x\}\cup\{a_1,a_2\dots,a_{k-1},a_{k}\}\cup\{b_1,b_2,\dots,b_{k-1}\}
\end{cases}
$$
Now define $A = \bigcup_{r=1}^{\infty}\{a_r\}\cup\{x\}$ and $B = \bigcup_{r=1}^{\infty}\{b_r\}\cup\{x\}$, from hypothesis $A,B\in\tau$ and since $\tau$ is a topology on $X$, we have $A\cap B\in\tau$ as well, but from the above construction, it is evident that $\bigcup_{r=1}^{\infty}\{a_r\}\cap \bigcup_{r=1}^{\infty}\{b_r\} = \varnothing$, consequently $A\cap B = \{x\}$. In summary every $\{x\}\in\tau,\forall x\in X$, appealing to proposition $1.1.9$
$\blacksquare$
Note: $1.1.9$ is the result that any topology $\tau$ on a set $X$ containing $\{x\}\in\tau,\forall x\in X$, is a discrete topology.
A:
It is fine. I would do it as follows:
Take $x\in X$. I want to prove that $\{x\}\in\tau$. To do so, I will consider two cases:
$X$ is countable: Then $X\setminus\{x\}=\{a_1,a_2,a_3,\ldots\}$ for some bijective sequence $(a_n)_{n\in\mathbb N}$. Now, take$$A=\{x\}\cup\{a_{2n}\,|\,n\in\mathbb{N}\}\text{ and }B=\{x\}\cup\{a_{2n-1}\,|\,n\in\mathbb{N}\}.$$
$X$ is uncountable: Then let $C$ be a countable subset of $X\setminus\{x\}$. Now, take$$A=\{x\}\cup N\text{ and }B=\{x\}\cup N^\complement.$$
In both cases, $A,B\in\tau$ (since both sets are infinite) and therefore $\{x\}=A\cap B\in\tau$.
Q:
How to use * or + with brackets in regular expressions in Python?
There are multiple space separated characters in the input eg: string = "a b c d a s e "
What should the pattern be such that when I do re.search on the input using the pattern, I'd get the j'th character along with the space following it in the input by using .group(j)?
I tried something of the sort "^(([a-zA-Z])\s)+" but this is not working. What should I do?
EDIT
My actual question is in the heading and the body described only a special case of it:
Here's the general version of the question: if I have to take in all patterns of
| 512 |
Pile-CC
|
the schedule wouldn't be blown.
Where I work, the schedule is determined by the actual developers, and the features are finalized at the beginning of the program. If development stays on schedule, then management doesn't interfere (why interfere if there are no problems?). The conditions you state I'm certain exi
I've had developers work for me that think they know everything there is to know, refuse to listen to any advice, and basically try to write software only in the way they believe it should be done, completely ignoring the needs and requirements of the system lead and the customer. Throw in to the mix some elitism and a complete lack of ability to communicate without insulting an derogatory statements, and you've got a profile of a large percentage of current software developers.
I think I know your problem you keep hiring noobs right from college and are giving them large of tasks with little oversight. If your employees do not follow your direction then either you're and idiot because you don't know where you are going or you're an idiot because you don't know how to manage your personnel. There are many excellent developers you just have to properly interview candidates so you can weed out the morons there are idiots in every profession and the good managers know how to spot t
So I'm not a programmer because I don't accept crappy buggy code? Get real. I've 20 years of real-time mission critical coding experience; I know what constitutes good code and architecture, and what is bad.
Software developers need to learn they have to ARCHITECT code. You cannot just hop in and start writing code without a plan. It would be the same as trying to build a house without blueprints, just nailing up wood at one of the corners.. It will kind of look like a house when done, but will have lots of problems. Code is the same thing.
And some managers need to learn that coding takes time!!!!
I was on a project where 98% of the time was design and Analysis and then I was supposed to code it in the few remaining days/hours.
The waterfall model IS NOT valid for less than multi-year projects.
Or at least incompetent can NOT use waterfall model.
Tim S.
:) That's the problem with many of the projects I've seen: No time for requirements gathering, no time for testing, and deployment should take less than a day. So no matter how well you design and execute your design - you end up with last minute poorly thought out enhancements and any testing done happening from a developers standpoint instead of an end user's.
You are a person in power over a program with missing QA, poor communication, where you try to control technology instead of what gets produced, a program you yourself describe as a "colossal mess", and where you are describing those you work with as "arrogant".
Do you think there may be more problems with your program?
I'm in charge of a program where the ONLY
| 512 |
gmane
|
snmpwalk on it and look through that and it seems that it does not pick up the interfaces either. I am a real newbie to all this all I can say is it was working last week and now it is not. any ideas on how or why this is happening and how to solve it. the only idea I have is to remove the SNMP from the router and add it again.
any help will be greatly appreciated.
Hayden Katzenellenbogen
[email protected]
Does anybody else have the problem where not all the emails are
delivered to your mail client?
It seems I often find I receive emails that refer to other emails which
I haven't received. (For instance, I have not yet received Brandon
Franklin's email in which he states that Jason's design is no good.)
Eventually they arrive, but often hours later.
- Linus
I was just playing around with Google Maps for some teaching purposes
entirely unrelated to our work here, but in the process, came across
something interesting. Here's a screenshot:
[image: Picture 17.png]
So the idea here is that individual users can edit the map data. But the
edits are separated between "my edits" (the user changes) and "community
edits" (the ones approved for addition to the general database). The former
then get cued for approval (which is an obvious bottleneck here; tons of
stuff pending).
It strikes me this is really consistent with my thoughts about the CSL
repository. The main differences would be in how we visualize the changes. I
could imagine a standard set of metadata, and the changes would be rendered
on the finished references and citations.
Bruce
Hi guys,
Wondering how you get the RAW data out of a PowerTap.
Have used the CSV files from PowerAgent etc, but one of the
applications i have can import the .RAW file from a PowerTap.
Found an application that works over a com port to download the data,
but wondered if there was an easier way.
Thanks
Will
Hello,
Here's a patch against PHP_4 that provides a new function called
apache_get_scoreboard(). The function returns an array containing
current scoreboard.
The idea behind this is to provide a flexible way to dump Apache
scoreboard. There are several applications that I can think of : a tool
such as Apache::VMonitor (ie mod_status page on steroïds), dumping the
scoreboard in XML format for a monitoring application (that would also
generate graphs representing Apache activity), or text format for a
command-line tool, etc.
There's a drawback though, which somewhat breaks the "rule" (if any)
"write once run everywhere" because Apache scoreboard structure depends
on the platform and on the version of Apache. I chose however for
simplicity to do a strict mapping of the structure.
I've attached a supersimple test script.
This is my first PHP hack so comments are welcome,
Thank you,
Olivier
I'm trying to get SBCL running on my sparcstation, and having a
few difficulties. I made an initial stab at parms.lisp for the
address space(s) settings, and found I had to hack globals.h
slightly. (sparc is not
| 512 |
reddit
|
staffs and flags in the crowd when I was at bonnaroo...they are really good to spot yourself in videos of the events
Hi! We don't have a P.O box set up, and players wouldn't feel comfortable having their address put out in the public. I can't say it's possible to send something at this exact moment, your best bet would be to give the gift directly to Ryu at the Riot studio in Berlin. I'll see if we can figure something out if you really want to send something to him.
I would advise you to stay as far away from flash as possible. there are other options to get the same results. HTML5 and CSS3 are wonderful things. in regards to your spinning cd thing. check out this article on how to make elements spin using CSS3. and follow /u/moshbeard's help for using html5 to play the audio. Good luck.
Lemmie dig into my archive and see..And oddly enough for me being a west coast fan, a friend of mine in S.C was the one who introduced me to Kendrick lol.. Backstreet Freestyle Was the best track on the album.. Just listen to the track... The beat is undeniable...The rest is fyahhhh
What if niantic makes the game not requiring continuously location update. Perhaps the game can sample the location every 10 minutes, or when the user presses the manual refresh location button. Someone may be able to use this feature to leave a spot but still able to continue to farm the pokemon for 10 minutes. That is really not a very big deal, while the phone temperature and battery drain is a much bigger deal.
I think you're making too much of it. People who say "god damn it" rarely ACTUALLY mean "I invoke my deity to send this thing to eternity in hell." If you really have an issue with "religious" words you'll just have to find substitutes, and if the substitutes seems comical... I guess you'll have to stop cursing. Personally, I love a good invective "Jesus-fucking-christ!" and I'm a die-hard atheist.
I did the Mystery Disc when they had the $5 gift card add-on. I was ordering a max-weight Opto Anchor and as a mystery disc received a 153g 'snB'. From its rim/behavior, I'm guessing it's a Banshee, or something very similar. But at 153g, it's completely useless to me.
I'm not saying we *can*, as of now, already make a computer that reasons as well as a human. But extrapolating from the current state of science, we can safely say (and it's not EY who'll disagree) that we *will* be able to make a reasoning AI in the foreseeable future. Meanwhile, giving your AI emotion is not something I believe we have clues as to how to do, so far.
Here's my 2 cents: I would prefer a livestream, now before you all start down voting hear me out. With Livestreams we get more content and we get it quicker, the crackers would stream the whole starting process where as if they were recording not every moment would be captured. If
| 512 |
reddit
|
n vertices as part of their job very false try harder to find what actually motivates your students and the math behind it... for instance you think someone can work on building a self-driving car without understanding linear algebra?
Ugh! I can put that dumb cunt into place if you need me to...I'm def southern in upbringing and legacy. Pffft! But she wouldn't know cuz she's dumb as fuck. I also hate the "out country you" bull. I have a non accent as far as dumb hicks are concerned but apparently it comes out to northerners pretty strong. I traveled a lot in child hood but only in the southern states so it's not any identifiable accent. Drives me nuts how peeps can be such asses and claim southern! You can usually tell where a Texan was raised but I was raised Texas/New Mexico/Oklahoma.
I have only got this to say. "i expected to be neg modded but this is just my opinion" well he was been extremely unprofessional the time he decided to jump onto to twitter and reddit. http://i.imgur.com/YrBdQ.jpg http://i.imgur.com/OrFOh.jpg Its not his fault that he got robbed. No one wants to be robbed, not even you who is reading this comment. "just think if that happened to you. How much stuff is in your house/flat" that is important. However it is is fault that hes made an image of himself as an ass hat. with replying to comments "Fuck you" will make anyone who has only seen half of the story turn around and go "Fuck you too...". I hope the best to him. people learn from his mistakes.
I live near Baltimore and I would recommend Anderson Valley Gose, Weyerbacher Tarte Noveau, and Union Gose. Those have what I have seen in six packs around here regularly. Make a trip to stateline liquor if you can in Elkton, worth the drive. Sour Monkey from Victory was nice, tried that recently and comes in bombers if you dont want a six pack.
I've been on Estradiol patches since Halloween. Started with a .01 microdose. They didn't see any estrogen from the bloodwork. Now I'm on .1 mg. A week after starting the .1 mg my nipples started to hurt. I was instructed to put them on my lower abs (in the ovaries area). I put Tegaderm on top of them and now I have zero water issues. I can have it on my belt-line, it doesn't matter. Side note: I also switched from 50mg of Spiro to 100mg around the same time. Side note 2: I haven't tried any other forms of estrogen.
If you take the Bible to be a verbatim account of history I'd think it's completely rational to believe that Noah's ark story is not accurate. How does that disprove Christianity? Not all Christians believe in the Bible verbatim. My Catholic school taught us "Let there be light" to mean that was god kickstarting the Big Bang Theory. You may "think that is false because the given the choice of a universe created from nothing, and a universe
| 512 |
YouTubeCommons
|
now so after 317 we will commit to inflate the amount of hairstyle that we have right now and so many other details like freckles moles scars and even the makeup may be something that we will want to adapt as a separate layer of complexity so that you may reach out an even more complex level of characterization for your own avatar the star citizen character creator is at the center of your ability to express yourself in the persistent universe and these updates that are coming in alpha 317 are just the next step in allowing everyone to one day create an avatar that is truly representative of the player underneath and up next we move from the human control to the ai operated yeah i like their i like their character creator it's rather bare bones at the moment well i wouldn't say not completely bare bones but i like the improvements that they've got coming along i like the improvements that they've got coming with an update on planetary navmesh the technology that looks to unlock npcs from their static locations and allow them to travel service side much the same way you do they used to do that uh back before they rebooted star citizen back i think it was in it twenty 2014 or 2015 they rebooted development of star citizen into this new direction of an mmo originally it was going to be more of a single-player game with multiplayer elements to it where the npcs actually flew in and out of the star ports you could see their ships flying in out just like in elite dangerous like the npcs do in lake dangerous but um they stopped that when they redid the game to create this vast open world game they want to go back to that and where the npcs are traveling in and out of the of the star port they actually are going somewhere they're actually going to a job they actually have work that they do they are either mining or they are you know pirates or um their security bounty hunting whatever the npcs aren't just going in and out and just disappearing like they are in uh you know dangerous where they're just they're just their show the npcs and star citizen will actually have a reason for being where they are what we currently have is star citizen is a lot of really cool environment but pretty much no ai we want to make the world alive and reactive to the player what we are building right now is the planetary navigation deck that is an extension of our current system i heard recently that they actually had to make some bathrooms in ships larger because the ai needed slightly larger areas to move around in for their pathing so they needed they needed a bigger [ __ ] to be able to have ai finally on the planets we planted the navigation mesh at this stage we are at what we call phase zero the engineering phase
| 512 |
Pile-CC
|
us at [email protected] with a description of what you need hauling Calgary to the dump. Note: Emails are checked only once per day. Call our dispatch for immediate service. We can in most cases give a precise estimate over the phone for garbage disposal Calgary. We will also give on-site quotes for Garbage Dump Service Calgary. Note:
Calgary garbage removal Loads can be taken on the spot after quote is accepted
Quotes can be provided on site and junk removal services calgary can be removed on a later date
Q4: How do I book an appointment for Roll Off Waste Bins Calgary service? A: Call our dispatchor email us at [email protected] with a description of what you need for garbage pickup Calgary. Note: Emails are checked only once per day. Call our dispatch for immediate service. We can in most cases give a precise estimate over the phone.
Q5: Do I have to be on site for a waste garbage disposal Calgary quote? A: If a phone number is provided and the load of garbage is outdoors you do not have to be on site. However, in most cases it is preferred to have the customer there on site.
Q6: Do I have to be on site for a Bin Service garbage bins Calgary Delivery? A: Yes. Our bin deliveries are paid on delivery in most cases. The customer is also able to direct the driver where to place the bin.
Q7: Do I have to be on-site until all the junk pick up Calgary is removed?A: No. In some cases we have removed the waste and the customer has gone to another appointment. Note: Payment is made when customer leaves site.
Q8: How large is your garbage bins Calgary?A: We use different size containers when loading depending on the customers needs. Our truck load capacity is 30 cubic yards which will easily handle most any job. 680-BINS can easily take:
couches
appliances
furniture
renovation debris
mattresses
hide-a-beds
appliances
hot water tanks
couches
exercise equipment
decks
fences
sheds
car parts
flooring
lumber
drywall
sporting goods
golf bags
skis
old bikes
Barbecues
propane tanks
fridges
freezers
water coolers
cabinets
vanities
old toilets
carpet
underlay
bathtubs
flux capacitors
Residential garbage
commercial waste
roofing shingles
flat top tar and gravel roofs
shake roofs
dirt
gravel
concrete
That is, we can take very large loads giving you more efficiency.
Q9: How big is a cubic yard? A: a cubic yard is 3 feet by 3 feet by 3 feet.
Q10: Do I have to do any of the Calgary waste disposal? A: You never load on our junk removal jobs. Our guys are there to help you. We do the loading while you relax. We stay until the job is complete.
130 Bay Street, Staten Island
$3,150,000
Prime street to street development opportunity in the heart of Saint George. Property faces commercial street which allows for maximum C4-2 FAR in special Saint George district. Building was most recently used as office building. Preliminary plans are available for renovated office building with rear parking lot. This parcel
| 512 |
ao3
|
loud thud.
Byron did everything his brain was urging him not to, he opened the door.
In response, Rusty stood from his chair and stumbled backward. Almost afraid it was some villain coming to get him.
“Orpheus, ah.. Hi?” He said, capping his dry erase marker.
“Mr. Venture I was uh.. I was going to procure some milk from your fridge and I just.. I saw the light.”
“No, yeah.. That’s... That’s fine..” Rusty sat back down.
Byron entered the lab fully now, closing the door behind him. “May I uh.. Speak to you about something?”
“Look, Orpheus I’m rather busy there’s a deadline coming up soon..” Rusty took off his glasses and started cleaning them with a rag on the counter.
“Byron.” He stated, staring at the ground.
“Didn’t know if you were comfortable with that.”
“I am.”
“Byron-“
Then, everything hits her. Everything she's lived through up until this moment. Her life is flashing before her eyes, and she feels like she is going to die. She wishes she could see her family right now. She wishes she could see Allie and Steve and Natasha again. She wishes she could tell Bucky that she is in love with him.
Bucky walks up behind John Dover Jr and hits him over the head. Dover gets distracted and lets go of the rope around Wanda's neck. Wanda falls to the floor and tries to calmly catch her breath, raising her hand to touch her throat. It's easier said than done. Bucky and Dover Jr are in the middle of a fight when Dover Jr trips over Wanda in the floor. He hits his head on a table in Wanda's room and is knocked out. Bucky quickly checks Dover's pulse before checking on Wanda.
"Is he still alive," Wanda asks in short, rigid breaths.
"Yes."
"Do you remember him?"
"No. Not until he mentioned it," Bucky responds."Are you okay?"
"Yes."
Bucky is trying to help Wanda back to her feet when she sees the older Dover pointing a gun towards Bucky. She starts to panic.
"James!" Wanda says and pushes Bucky out of the way. A gunshot goes off.
"Wanda? Wanda! Are you hurt?" He asks.
"No! I'm fine!" She responds.
They turn to look at the man who shot the gun off, and they see him laying on the floor.
"Dad?" They hear a voice behind them. John Dover Jr rushes over to his father whose head is splattered on the wall behind him. "Dad! I-I didn't mean to! I-I didn't mean to!" He turns to Wanda and Bucky. "Look what you made me do! I'm going to kill you!"
Bucky raises his gun quickly and two gun shots go off. John Dover Jr falls to the ground. Dead. Bucky looks beside him, and Wanda is on the ground. A bullet in her chest.
**Notes for the Chapter:**
> So things are gonna be alright! It's gonna be a weird transition from this chapter to the next because the next chapter starts the resolution, and I wanted to make it a different
| 512 |
reddit
|
no longer slut shame for one thing. I don't have bitterness towards women and a result of constant rejection like some guys have. But the red pill? Nah, they've bastardised a good thing and taken it too far. It's full of the small minded and the vengeful. I have a love and admiration of women, the people on the red pill seem to just want to fuck them to get one up on them or to dominate them.
You have to use the same PSN ID in order to transfer your character from PS3 to PS4. If you want to transfer that character, you'll have to add your old account to your PS4, make sure it's linked on Social Club, and transfer your character. [Here's Rockstar's support page on the subject](https://support.rockstargames.com/hc/en-us/articles/202892778).
Sure thing! I plan on stopping by the post office on Monday to pick up some boxes/envelopes to see which can be used to ship the dress, so I'll have a better idea of shipping price then. Let me know if you have any questions about the dress! The measurements on my dress form are about 33-26-36, and the dress is pretty snug on it. It came with two thin detachable straps (like bra straps) that I'll put in a little ziploc bag so they don't get lost.
Child support doesn't even have to go to the child. The mother or father (in next to no circumstances) is not required to provide any proof that the paid child support is going towards the child's well-being or benefit. At least in my state of the US it's not. My LTR's mom has $70k in child support from the last 16 years of my LTR's childhood in a retirement fund for herself, and had no intention on using it on her daughter. Fucking skag.
iPhones sum up Apple very well. I would say that OSX is actually a very good operating system, it's just very limited with everything it can do. I would say with the UI for iPhones and Androids (having used more Androids than iPhones) the operating system for iPhones is better, it's just far more limited. Because of this, I understand both sides of the Android vs. IOS debate.
I don't think I've ever experienced heartbreak like this before. He told me that I needed to be more self sufficient and that my depression and abandonment issues weren't my fault but they were my responsibility. He told me he'd be open to dating in the future. This is what I needed to hear, to be honest. This is the first man I've been with that I haven't gone with because I want to be with someone. I wanted to be with him because of him. Now I'm kicking my negative thought patterns, sorting out my eating issues and falling in love with myself. I'm getting my anti depressants increased on Monday. Even if it doesn't work out with him, I'm going to be out of the negative mindset and self-hatred. So although I'm sad about him breaking up with me, I'm positive about the
| 512 |
gmane
|
aggressive caching (and preferably a pre-caching mechanism) to avoid
the latency issues
.
For me the best bet would be to get a dedicated server running CF so that
you could access the SQL directly if you wanted to or you could use CF as a
façade to manage a Web Service or XML interface to the data. It would also
allow me to run my own server for clients so I can charge the hosting fees
and pay for the server colo fees
This could also be used to pay for a
server lease from Dell (although they have a really sweet Dual P4 Xeon box
for about 4800 fully tricked out
2U)
Anyway, hope that this helps!
Cheers,
Jeff
This meeting summary:
http://www.redhat.com/archives/fedora-docs-list/2008-May/msg00125.html
... is see the result of the last few months of discussion amongst the
steering committee members, new and old.
We are moving to a lighter-weight leadership model. Those who want to
lead, show up and do so. You lead and learn with your actions.
Currently, elections are a distraction, leave out out interested people,
and make good people feel guilty when they are unable to participate in
their elected position.
In the future, as the subProj grows, we may need to elect leaders to
represent different voices in the overall Fedora community. We'll do
that when the time comes.
This is really the way Docs has always been -- those who show up to do
often end up helping make the decisions. The are effectively the
steering committee. Enshrining those folks with an election isn't
required right now.
Disagree? Show up and influence the thinking. That's how it works.
Meanwhile, our focus as a Fedora subProject is on:
* Enabling Fedora contributors with content specific for that audience
* Garden and care for all of the wiki
Thanks,
hey,
i'm just programming a shopping list for my flat-sharing-folks and
want to distribute shopping-lists as appointments onto our cellular
phones.
well, i have some early testing experience with bluez about 2 years
ago (with multisync). but now i just want to send an appointment
(.ics file) to my device (i.e Siemens S55) and accept it there as
appointment in my calendar.
i tried to send a single .ics file via obexftp, but it's just placed
on the file-system of my phone. no question whether i want to import
it to the calendar.
does anyone have a hint, how i should send this and in what format?
i think it should work for any device (same as early irda sending
appointments/vcards).
kind regards,
ralph.
Bestsellers for SEPTEMBER 2004
Hardcover
1) ABARAT: DAYS OF MAGIC, NIGHTS OF WAR by Clive Barker *
2) INCUBUS DREAMS by Laurell K. Hamilton *
3) HIGH DRUID OF SHANNARA: TANEQUIL by Terry Brooks *
4) JONATHAN STRANGE & MR NORRELL by Susanna Clarke
5) DUNE: BATTLE OF CORRIN by Herbert & Anderson *
6) SANDSTORM by James Rollins *
7) THE CAT'S PAJAMAS by Ray Bradbury *
8) JUST A GEEK by Wil Wheaton *
9) GOING POSTAL by Terry Pratchett *
10)
| 512 |
Gutenberg (PG-19)
|
* *
The APPROBATION of Monsieur _Andry_, Counsellor, Lecturer, and Regal
Professor, Doctor, Regent of the Faculty of Medicine at _Paris_, and
Censor Royal of Books.
I Have read, by order of the Lord Keeper of the Seals, this _Natural
History of Chocolate_, and I judge that the Impression will be very
necessary and useful for the Publick. Given at _Paris_ this 5th of
_April, 1719_.
THE
Natural HISTORY
OF
CHOCOLATE.
Of the Division of this Treatise.
I Shall divide this Treatise on Chocolate into three Parts: In the
_First_, after I have given a Description of the _Cocao Tree_, I shall
explain how it is cultivated, and give an Account how its Fruit is
prepared: In the _Second_, I shall speak of the Properties of
_Chocolate_; and in the _Third_, of its Uses.
PART I.
CHAP. I.
The Description of the _Cocao-Tree_.
The _Cocao-Tree_ is moderately tall and thick, and either thrives, or
not, according to the Quality of the Soil wherein it grows: Upon the
Coast of _Caraqua_, for instance, it grows considerably larger than in
the Islands belonging to the _French_.
Its _Wood_ is porous, and very light; the _Bark_ is pretty firm, and of
the Colour of _Cinnamon_, more or less dark, according to the Age of the
Tree. The _Leaves_ are about nine Inches long, and four in breadth,
where they are broadest; for they grow less towards the two Extremities,
where they terminate in a point: their Colour is a little darkish, but
more bright above than underneath; they are joined to Stalks three
Inches long, and the tenth part of an Inch broad. This Stalk, as it
enters the Leaf, makes a strait Rib, a little raised along the Middle,
which grows proportionably less the nearer it comes to the End. From
each side of this Rib proceed thirteen or fourteen crooked Threads
alternately.
As these Leaves only fall off successively, and in proportion as others
grow again, this Tree never appears naked: It is always flourishing, but
more especially so towards the two _Solstices_, than in the other
Seasons.
The _Blossoms_, which are regular and like a Rose, but very small, and
without smell, proceed from the Places from which the old Leaves fall,
as it were in Bunches. A large Quantity of these fall off, for hardly
Ten of a Thousand come to good, insomuch that the Earth underneath seems
cover'd over with them.
Every _Blossom_ is joined to the Tree by a slender Stalk half an Inch or
a little more in length; when it is yet in the Bud, it is one Fifth of
an Inch broad, and about one fourth or a little more in length: when it
was least, in proportion to the Tree and the Fruit, the more strange it
appeared to me, and more worthy of Attention[a].
When the Buds begin to blow, one may consider the _Calix_, the
_Foliage_, and the Heart of the Blossom. The _Calix_ is formed of the
Cover of the Bud, divided into five Parts, or Leaves, of a very pale
flesh-colour.
| 512 |
reddit
|
to clear your head and learn to be happy on your own. People get so caught up with finding "the one" but in reality the concept of "the one" is just that, a concept. Take your time dude, heal and love yourself first and foremost - later if she comes back and you want to give it a go then go for it, but don't whatever you do take her back just because of all the good times : you definately deserve more than just good memories.
I’ve been playing POE for 2.5 months now, and just capped off Race with a lvl 91 RF Jugg, my best character so far. I was able to fairly easily clear t10/t11 maps, with drops preventing me from going further (and likely noob-ness) I was able to cap the race with obtaining Beastiary Wings, and ended up with 10 exalts, with 9 being gained in last 24 hours. (of course). My final race character: https://pastebin.com/SL8asMst Contemplating 3.3.0, I am pondering what optimal progression could be, and here are my initial thoughts: (Types of characters played thus far: RF, TS/Barrage MF, F-Pulse totem, F-bolt, Melee Skeleton, Tectonic Jugg) -Sunder or ED starter, to push into late yellow maps -RF Marauder (TBD ascendancy) to push into red maps, and 3.3.0 progression against bosses -TBD fast mapper (TS mf bow / EK / Cyclone / BF-Reave /???) ?1: Forming reliable groups is somewhat of a mystery. I know the community has been around for a while, but it seems getting into a group of players who would accept an inexperienced end-game player is challenging at best. How can this be overcome? ?1b: Do most people solo in maps? (maybe my grouping assumption is wrong) ?2: Are the 2-3 builds shown above typical for players in a league? I seemed to run out of time to progress further in the race.
Writing time aside, I think it's too soon to say whether AFFC/ADWD are inferior books compared to ASOS. ASOS was centered around a comparatively very narrow set of characters whose plotlines had already been given 2 books' worth of setup. AFFC/ADWD cover a much larger set of characters, including some in places/regions that have previously gotten very little POV attention (Iron Islands, Meereen) or none at all (Dorne, the Dreadfort, Maidenpool). After the next 2 books are finished, we may all come to regard AFFC/ADWD as being comparable to AGOT/ACOK as far as action and pacing are concerned.
Cześć Miks, ;) I've never knew you're into puzzle games. I was impressed by the level design of Grid Mania and whole game was better than I expected from the announcement. How would you describe working with Qubic Games as your publisher rather than your employer? How was the relationship different from your perspective? Also, how many times did your game bounced out of lotcheck? Pozdro
I was at a wedding where the bride didn't make it down the aisle. She was still in love with her ex, and took off with him. The reception still went on. The grooms mother
| 512 |
YouTubeCommons
|
in your skin it's not a bogus skin brushing technique it's not a ridiculous massage treatment or weird vibrating machine and it's not some wacky diet or crazy weightlifting gym workout routine but it is real and true information that you will use right now you might be wondering who I am to be sharing this critical material with you so here's my scoop my name is Joey Atlas I two degrees in exercise physiology and I'm a women's body enhancement specialist with clients in 193 countries I've been quietly helping women banish cellulite from their lower bodies for the past 23 years and today I'm helping you do the same now let's get right into what you need to know you're extremely confused about cellulite you've heard crazy things like oh it's your genetics or once you have it you can never get rid of it well that's all wrong you're deeply frustrated because everything you've tried has not worked you're fed up with all the empty promises the Quick Fix scams and the sleazy treatment ripoffs you want something that works works now and works quickly and will allow you to stay smooth tight and sexy forever how do you feel when you think about putting on a bikini or you simply look at yourself naked in the mirror do you feel angry depressed hopeless envious of other women who don't have cellulite maybe you feel old maybe you feel that your self-esteem and your self-confidence are totally gone or maybe you're just downright frustrated and pissed off because you know there's an answer to your problem but you just need to find it Well you just found it and take a deep breath right now breathe in breathe out now close your eyes for a few seconds and imagine this picture yourself about five or or 6 weeks from now you step out of the shower you towel off and as you're rubbing your favorite moisturizer on your naked lower body you look in the mirror and it hits you boom your cellulite is gone as in wiped out for good and your lower body is Silky Smooth tightly toned and stunningly sexy all because you finally figured out the answer you've been searching for you need to realize this the cellulite product in treatment industry is your enemy they don't want you to get rid of cellulite because when you do they lose a customer and when they lose a customer they lose a lot of money you were probably very hopeful maybe even desperate for at least one of those cellulite products to help you but none of them could and here's why every proposed Solution on the market tries to make you believe that cellulite is a skin or a fat issue which is not true at all here's the truth the the appearance of cellulite is a muscle fiber issue and since all products and treatments are aimed at fixing your skin or your lower body fat content they can never work it's physiologically impossible
| 512 |
gmane
|
air traffic management, which is a much different (and
more important) beast than providing user services.
-Wes
Not sure how many people like the build script I made, but I thought I
would let everyone know of some changes that have happened.
Well after the initial post someone registered opensoekris.com and has
gotten together with me to make this little script a real live breathing
project.
Well made some updates and some changes and released a new version (
1.0.7 ) which can be found at http://www.oneinsane.net/~insane/soekris
Please look at the CHANGELOG for the changes and the TODO to see what is
planned in the future.
-Ron
not sure if it is for ipsec wg, or dnsext wg...
the meaning of "gateway" field is not clear enough. i can guess that
it is IPsec gateway for IPsec tunnelling, but 2nd example "An example
of a node, 192.0.2.38 that has published its key only." (gateway field
being ".") confuses me. what does it mean?
what kind of value should i put into "gateway" field if i want to
ask people to do transport mode IPsec?
maybe, draft-ietf-ipseckey-rr-02.txt should refer some other document
like draft-richardson-ipsec-opportunistic-11.txt for its actual
usage/meaning?
itojun
Hello,
I am quite new to using Tapestry and building web applications and I have a few
questions regarding deploying and running my own Tapestry application.
What are the required steps after I have created my own example with the
necessary files HTML Template, Page Specification, Java classes,
( .java, .application, Home.page, Home.html) in order to run them ?
The tutorial contains a JAR file with the source code, and a WAR file with the
class files to deploy Java code etc to the server. I feel I have a good
understanding of the Tapestry framework and it's construction. I have followed
the documentation, ppt presentations, etc but I do not seem to find information
about how to get from creating the application files up to compiling, deploying
and running them. I am also not very familiar with Ant or the creation of JAR
and WAR files.
Could someone summarise the required steps for me or let me know where to find
information on it?
I would appreciate any advice or help,
Kind regards,
Andrea
Hi,
The per bucket locking patches (conntrack_[arefcount|locking|nonat]) in
patch-o-matic-ng cvs has been updated: a nasty NAT related bug has been
fixed in arefcount and the nonat case has been revised. Thanks to Willy
for the NAT bugreport and to Patrick for pointing out the problems with
the nonat patch.
A short summary of the features, modifications in the patches:
- The refcount patch prepares the introduction of
per bucket conntrack locking by separating expectation
locking completely off from conntrack locking. That means
a new global lock is introduced (ip_conntrack_expect_lock)
which protects the global and local expectation lists
and entries. When ip_conntrack_expect_lock is read-locked,
the ip_conntrack_expect_tuple_lock is used to protect the
tuples in the expectations, because the tuples may be changed
by NAT.
Besides the new lock, reference counting is formalized so that
an expectation holds a reference count on
| 512 |
Pile-CC
|
Cooper were considered better prospects at the time of the draft.
Now I would rate them like this.
1. Justin Smoak
2. Pedro Alvarez
3. Brett Wallace
4. Eric Hosmer
5. IKE DAVIS
6. Yonder Alonso
7. David Cooper
8. Kyle Skipworth
Smoak is the most polished hitter of the bunch, and Alvarez could be a HUGE superstar type bat. The seperation from 3 through 6 is minimal. Wallace is good, but he may not have a true position. Hosmer's stats are awful, but he has the most potential of any player in this group. Davis is the slickest fielder and the safest bet. Also, his 15 homers this year should really shhh the experts who said he could not hit for power. Alonso and Cooper should be solid, with Alonso having more star potential. Skipworth needs to learn how to hit, and is so far off from any sort of impact.
I know the comparison for Davis is Lyle Overbay, but I don't like it. Davis should hit for more power. He will strike out a little more and have a slightly lower OBP with a better average. Maybe more of an Adam Laroche.
WVBR is the Voice of the Big Red, bringing you the latest news and insight from the Cornell and professional sports worlds. From 93-Second Sports Shots to game updates and summaries to the latest team and player transactions and news, you'll find the latest expert analysis right here from the WVBR Sports team.
DailyHerald.com > Cook County NewsCopyright 2020 Daily Herald, Paddock Publications, Inc.http://www.dailyherald.com/news/county/cook/
en-usSun, 7 Jun 2020 04:39:49 -0400June 6 COVID-19 cases per county; search by ZIP codehttp://www.dailyherald.com/news/20200606/june-6-covid-19-cases-per-county-search-by-zip-code
http://www.dailyherald.com/article/20200606/news/200609147Sat, 6 Jun 2020 18:07:50 -0400Since the outbreak began, there have been 64,585 cases in the suburbs, 51% of the state's total.June 5 COVID-19 cases per county; search by ZIP codehttp://www.dailyherald.com/news/20200605/june-5-covid-19-cases-per-county-search-by-zip-code
http://www.dailyherald.com/article/20200605/news/200609192Fri, 5 Jun 2020 18:34:16 -0400Since the outbreak began, there have been 64,585 cases in the suburbs, 51% of the state's total.Cook County rejects taller fences at truck lot near Elk Grovehttp://www.dailyherald.com/news/20200604/cook-county-rejects-taller-fences-at-truck-lot-near-elk-grove
http://www.dailyherald.com/article/20200604/news/200609567Fri, 5 Jun 2020 08:15:16 -0400With a nod to Elk Grove Village trustees, Cook County commissioners have rejected a truck repair company's plans to install taller fences around unincorporated property it rents on the village's border.State urges tests for those who've been in large groups amid 116 new COVID-19 deathshttp://www.dailyherald.com/news/20200604/state-urges-tests-for-those-whove-been-in-large-groups-amid-116-new-covid-19-deaths
http://www.dailyherald.com/article/20200604/news/200609591Thu, 4 Jun 2020 18:34:43 -0400As cases of COVID-19 rose by 929 and deaths increased by 116 Thursday, officials urged people who participated in large events to get tested for the respiratory disease.June 4 COVID-19 cases per county; search by ZIP codehttp://www.dailyherald.com/news/20200604/june-4-covid-19-cases-per-county-search-by-zip-code
http://www.dailyherald.com/article/20200604/news/200609555Thu, 4 Jun 2020 18:33:03 -0400Since the outbreak began, there have been 63,968 cases in the suburbs, 51% of the state's total.National Guard troops helping Schaumburg, Aurora policehttp://www.dailyherald.com/news/20200604/national-guard-troops-helping-schaumburg-aurora-police
http://www.dailyherald.com/article/20200604/news/200609599Thu, 4 Jun 2020 14:07:55 -0400Illinois National Guard troops are assisting police in Schaumburg and Aurora amid concerns with vandalism and looting that has occurred in some towns. Lt. Col. Brad Leighton, director of public affairs for the Illinois National Guard, said the troops are doing "critical site security" at Woodfield Mall and at spots
| 512 |
s2orc
|
rock, (mg (cm 2 s À1 ) À1 ). 2.3.9 Reaction rate of HPAAT. The calcium carbonate rocks were encased in epoxy resin, leaving only one side exposed for which the area (S) was 5 cm 2 . The CO 2 gas produced by the reaction of the polymer acid solution and the calcium carbonate rocks was collected using a CO 2 gas-collecting device. 10 The acid-rock reaction rate was calculated using the volume of the collected CO 2 . [27][28][29] The formula used is as follows:
u ¼ n ðCaCO 3 Þ Â M ðCaCO 3 Þ s  t ¼ n 2  M ðCaCO 3 Þ s  t ¼ V 2 1000V 1  M ðCaCO 3 Þ s  t ¼ 0:00409V 2 s  t(5)
In which, u is the reaction rate of the HPAAT acid and the carbonate rock (g cm À2 min À1 ), n (CaCO 3 ) is the amount of CaCO 3 in mol, M (CaCO 3 ) is the molar mass of CaCO 3 in g mol À1 , n 2 is the amount of substance of CO 2 in mol, V 2 is the volume of CO 2 gas per unit of reaction time (mL), V 1 is the molar volume at 25 C, S is 5 cm 2 , and
Crystallization of Anhydrous Copper Sulfate From Sulfuric Acid-Ammonium Sulfate Mixtures
May-June 1964 (November 26, 1962)
Faul M Gruzensky
Crystallization of Anhydrous Copper Sulfate From Sulfuric Acid-Ammonium Sulfate Mixtures
JOURNAL O F RESEARCH of the National Bureau of Standards-A. Physics and Chemistry
683May-June 1964 (November 26, 1962)
Introduction
Anhydrous e US0 4, isostructural with orthorh ombic ZnS0 4, is o ( particuhr in ter est because of i t an tiferromag netic proper ties at low temperatures . Fundamental irwestigations on this compound would be gr eatly enb an ced i( single crystal specimens were readilyayailable. K okkoros and R en tzeperis [1 ] 1 ob tained CUS0 4 sin gle crystals up to 1 mm. in leno·th by evaporation of an aqueous solu tion ob tained "by d~ssol.'T~ng CuSO,·5H 2 .O in water and addin g H 2S0 4 , C onditlOl1 S under wluch t be a nhydro us salt m ay be obtained from an aq ueous solution have b een describ ed in the early li terature [2]. Kreines [3], in ,w effor t to prepar e crystal sp ecimens o( this salt for magnetic susceptibility a nd aniso tropy st udi es dissol ve~ CUS0 4 in molten (NH 4)2S0 4; th en , by co ntrollmg th e r ate of decomposition of the sol vent , he was able to obtain single crystaJs of C uSO,j weig hing up to 2 mg. Like many ot her s ulfa tes, ('US04 undergoes decomposition before t he melting point is r eached so that growth from t he melt under Ilormallaboratory conditions is precluded. The use of a nonaqueo us solvent appears to b e th e most promisin g approach , and exp eriments
| 512 |
reddit
|
shadow-removed. And I guess I just don't see where I'm saying discrimination against a minority is okay. > statistically, heteronormativity is pretty accurate. It's more statistically accurate than saying "men have more upper body strength than women". > > When something is the case 95% of the time, I don't understand why it's a problem to talk about it as being the usual case.
Wow that is so oversimplified it hurts. What's bad about having a defensive style? We always had wold-class defenders, some say the best, the likes of Scirea, Baresi, Maldini, Nesta, Cannavaro, Barzagli, Chiellini, and that to me is a mark of pride, along with, historically, our keepers. Of course our playstile emphasises what we are best at. A good defence might not always make for exciting matches, but it can win you a lot of them, even against stronger teams. And come on Germany was definitely a harsh pick, some may argue the harshest, you can't cherrypick that out because of that "boogeyman" bs and pretend it was a given win because they never beat us yet (yeah losing at penalties counts as a draw in the rules, so they haven't beaten us yet ^^). They were, and often are, the tournament favourites. Also, yeah Zidane is a great player and probably a nice dude, but there is a difference between what he did on the pitch and what Materazzi did. Insulting someone is definitely between the rules, happens all the time, headbutting someone is not. he let Marco get under his skin and he psychologically collapsed, he took out himself, nobody pointed a gun at his head forcing him to headbutt an opponent. Yeah it was probably Marco's plan, yeah it could be counted as "dishonourable", but all's fair in love and war (and football)
Car repairs are the worst for unnecessary markups. So much wasted money for "labor" that isn't really that hard if you take the time to learn how and invest in a few tools. Any preventative maintenance you can do yourself means you are more likely to do it at the proper intervals and could potentially save hundreds later on. Never pay a garage or dealership to: do an oil change, rotate tires, change the cabin or engine air filters, replace wiper blades, "top off fluids," or change a battery. Once you get more confident even things like replacing break pads are not that difficult.
Hey all, I was wondering what happens when you guys have episodes. Of course it depends on the emotions you feel while having an episode, as well, what triggered you. But what, in general, happens to your body, mind, and thoughts when you feel you're having an episode? How do you deal with episodes when they sprout and how do the people around you handle them?
I'm glad the option is available for people who want it. I plug my phone in quite a lot, actually...I have a dock on my desk, a mount in the car, and cord next to the bed. It's a 6s with a dying battery,
| 512 |
gmane
|
to have the user install a random device. There's ones
out there
for Solaris all the way back to version 2.5.1
However, keep in mind that all but the latest /dev/random devices out there
do
not generate very good random numbers, the newer ones use the Yarrow engine,
but the very best ones also derive randomness from the hardware random
number
generators on some of the CPUs (ie: the VIA C3 Nehemiah, the Intel 82802
ie x810 chipset) or from devices like the following SG100:
http://www.protego.se/sg100_en.htm
Ted
I have no idea what i have done to make this happen, but it seems like i can't view images and some html files on my Apache 2.0.46 webserver..
If i create a new folder and make a index.html file with just some text in it, it works fine..
But when the file get's more info in it, then i get "page cannot be found"..
I tested an IRC stats program which generates a page with statistics from an irc channel, i couldn't see the index.html it made, so i copied everything over to another webserver and it worked fine there..
And now the images in my CS server statistics (Psychostats www.psychostats.com) can't be seen either..
It's mainly one image that i can't see.. so i copied the adress to it and entered that in the address field but i couldn't see it there either..
But, when i removed the http:// i could see it..
Nothing about this in the error.log
In access.log i have:
192.168.0.2 - - [01/Jul/2003:11:37:23 +0200] "GET /stats/cstitle.gif HTTP/1.1" 200 8443
192.168.0.2 - - [01/Jul/2003:11:37:28 +0200] "GET /stats/cstitle.gif HTTP/1.1" 200 8443
hi ,
i just wanna be clear in the concepts of core and shard ?
a single core is an index with same schema , is this wat core really is ?
can a single core contain two separate indexes with different schema in it ?
Is a shard refers to a collection of index in a single physical machine
?can a single core be presented in different shards ?
- JAME
Thanks Andrew, that was very helpful.
Just to make sure I understand what you wrote:
Multiple filters of the same type are treated as OR conditions.
Multiple filters of different types are teated as AND conditions.
I can specify the email subject line in the Notification name field. Is there a way to change the embedded title of the email from “MaDDash: Test Email Report” to something else? I put in a title field in the notification section of my yaml hoping that would override it but that didn’t work.
-George
Hi,
I noticed that in Jira all versions are considered to be "Unreleased". Glenn, or any other administrator of the FOP project, you should be able to access a "Manage Versions" link. There, you could "Release" versions 0.95, 1.0 & 1.1 and set their release date.
I would also delete the "all" version because one may select multiple versions in the "affects" or "fix for" fields. Finally, you might wish to update the steps one follows to create
| 512 |
StackExchange
|
initialized from the shared x. Something like this, for example:
x = (double *) malloc (solution * sizeof(double));
#pragma omp parallel for
for (double *y = x; ...
(x is shared and y is private by default). That serves the scenario where you want each thread to have a private pointer to the same shared space.
Note, however, that the memory to which x points is shared no matter what. If you want each thread to have its own, separate, dynamically-allocated space, then each one needs to allocate such space itself (and subsequently to free that space). Even in that case that allocated space is technically shared, but if the threads do not publish any pointers to their allocated spaces then other threads will be unable to access them.
Q:
Differences between ActionScript 2.0 & 3.0...?
I'm new to Flash development so please forgive the simplicity of this question...
I'm developing a simple Flash animation using Flash Professional CS5 and I'm writing some ActionScript code. I noticed there's a choice between using different versions of ActionScript.
Wondering what the key differences are between 2.0 and 3.0...?
A:
If your new to the language, go with the latest version. The chances of running across a browser with an outdated player are very small, and the standard embed pattern will notify the user anyway. There are way too many differences to list, but AS3 was, to me, a huge upgrade, in both the language and the player. There is simply no good reason to write anything in AS2. JMHO.
Q:
Typecasting an object in C#
Assume I have a method which returns object of class A
A getItem(int index)
Now I have following line of code, (I assume B is subclass of A)
B b = (B) obj.getItem(i);
but before this I have to make sure that I can typecast it into B as getItem can return object of some other subclass, say C, of A
Something like this
if(I can typecast obj.getItem(i) to B) {
B b = (B) obj.getItem(i);
}
How I can do this?
A:
Two options:
object item = obj.getItem(i); // TODO: Fix method naming...
// Note: redundancy of check/cast
if (item is B)
{
B b = (B) item;
// Use b
}
Or:
object item = obj.getItem(i); // TODO: Fix method naming...
B b = item as B;
if (item != null)
{
// Use b
}
See "Casting vs using the 'as' keyword in the CLR" for a more detailed comparison between the two.
Q:
Penalty kick after time expires - should the referee play rebounds on for longer?
It is well known that a soccer referee should allow any team to play a penalty even if a period of play has ended.
Should the referee allow the team who has the penalty to continue the penalty kick rebound, or, should they blow the final whistle soon after the penalty is taken, since there is no time remaining?
A:
Law 7.4, from the IFAB Laws of the Game, states
If a penalty kick has to be taken
| 512 |
StackExchange
|
repeated for every mailbox synchronization attempt...
It's a strange error and is easily resolved by removing the offending index file. However, I'm curious about the root cause of the error and locked-state and if there's something I can modify on the configuration side to prevent it.
In other situations, I've only had a handful of BB devices to deal with. In this case, 80 new Blackberries were added, and this locking has an impact on system load and performance.
A:
The mbox storage format keeps the entire folder in a single unindexed file, requiring Dovecot to use complicated locking even for read access. This causes problems with multiple clients, especially when they attempt to keep the folder selected in order to wait for IDLE notifications, used by most modern IMAP clients.
(Also, the .imap.index file is an addition by Dovecot to avoid some performance issues, and often gets out of sync if an external delivery agent updates the folder.)
Consider switching to Maildir format, which has no such issues with locking. Dovecot has instructions (for v1.x).
Q:
strcat appending multiple times when called in loop
The strcat function is working fine when called for the first time but when the broker goes down and it's attempting to reconnect it is appending the value twice. I am not able to figure out the problem as i am writing C code for the first time.
void reconnect() {
while (!client.connected()) {
const char* cid = clientID.c_str();
if (client.connect(cid)) {
const char* sTopic = strcat("clm/",cid);
client.publish(outTopic, sTopic);
client.subscribe(sTopic);
} else {
// Wait 5 seconds before retrying
for(int i = 0; i<5000; i++){
delay(1);
}
}
}
}
It is called in the loop method
void loop() {
if (!client.connected()) {
reconnect();
}
}
The value of sTopic for the first time is clm/5C:CF:7F:3D:5B:F6 but when the broker restarts and the client connects again it is clm/5C:CF:7F:3D:5B:F65C:CF:7F:3D:5B:F6
What could be the reason for the same ?
A:
strcat won't allocate any memory for the new string. So what really happens is that the location where the string constant "clm/" is stored gets the id appended.
In other words the second time around it's as if you passed "clm/5C:CF:7F:3D:5B:F6" as first parameter.
To fix that you need to supply a proper buffer for strcat to do its work:
if (client.connect(cid)) {
char[64] sTopic ={0};
strcat(sTopic , "clm/");
strcat(sTopic , cid);
Q:
Authorization adapter was not found in cakePHP
I'm trying to move my code from local to server
when i try to login into the application
Here is my AppController
class AppController extends Controller{
/* Determines what logged-in users access to */
var $components = array('Auth','Session');
public function isAuthorized($user){
return true;
}
public function beforeFilter(){
$userdetails = array();
$this->Auth->autoRedirect = false;
$this->Auth->loginAction = array('controller' => 'users', 'action' => 'login');
$this->Auth->loginRedirect = array('controller' => 'matches', 'action' => 'index');
$this->Auth->authorize = 'controller';
$this->Auth->authError= 'You need permissions to access this page';
$this->Auth->allow('users');
$this->set('Auth',$this->Auth);
$userdetails = $this->Auth->user();
$this->set('myUser', $userdetails['username']);
$this->set('myRole', $userdetails['user_role_id']);
$this->set('pStatus', $userdetails['password_status']);
}
}
Here is my Login Action in UsersController
public function login(){
$this->Auth->autoRedirect = false;
$id =
| 512 |
OpenSubtitles
|
"NOT experiments" "Swine!" "Let go!" "Donevia is the main target of the anarchists." "After a bad quarter, the bad publicity does not do good." "Currently, activists are protesting in front of the head office - and require that human trials will be terminated immediately." "The new Weapons Act with firearms are illegal throughout the country." "Please call 08-911-911, if you see anything." "The new Weapons Act with firearms are illegal throughout the country." "Why do you have guns?" "Vihollisemme are armed." "He was again closed." "Olimme front Donevian." "Thank you, Reda." "Anouk, thank enoasi." "Fascist." "Hemmetin brat." "One day, he goes too far." "Ai shall he go too far?" "Look." "Operating result of EUR 22 billion." "Amnesty estimates that kokeissanne have been killed this year, 2 000 people." "When will this end?" "Kyse of accidents." "Participants are aware of the risks, and the families receive compensation." "People are not forced to anything." "They do not tell you of the risks." "All of this just because of better performance-enhancing drugs." "Reda, Boris has a new boss." "Where the former had to?" "Jailed." "He had had too much trouble." "Do not stay here." "One of must tell the truth." "Shit the truth." "What about justice?" "I like more money." "What took you?" "Do not want to still the key?" "No thank you." "I'm not offering it to others." "Thank you for helping my niece." "Hi, Anna." "Hey." "Well?" "Portion size change will not help." "What is your reading?" "More than 10 000." "You do not know the exact readings?" "Better that you do not know." "We have to be convincing." "The government wants to stop the tests." "They are waiting for the results." "I received the results." "More than 10 000 dead?" "Tell fighter to." "He was at the top ten years ago." "Mediocre, but know how to fight." "He is perfect for the display." "In order for the government capitulates, one win is not enough." "We make it special." "13 March arena battles take place European Championship qualifying matches." "Included Panzer, arenas serial killer - which represents the Perk-laboratories." "Reda, sit down." "I have something for you." "What is it about?" "This will help you win." "Is that you're behind this?" "Whose bread are you?" "This is your chance to get your career in a new rise." "I do not want to die." "Who talked about the death of anything?" "Why me?" "You are just a loser." "Earn more if I take a loser like if I take someone better." "Try it for yourself." "I will see what happens." "The product does not work for all." "We have already tested it on you." "We asked Tyrolta your blood." "The results were excellent." "I refuse longer tell." "Come on, Reda." "We can beat this allocation." "Do not be stupid!" "This is your chance." "then remain a loser." "Prozyxin help you stay free." "How's it going, Zito?" "There it is." "Bought for this still?" "Ostetaan." "What about this?" "No." "Printing is stopped tomorrow." "What about this?" "I promised to sell the kiosk and you will
| 512 |
gmane
|
ATI FireGL 5200 (as far as I know). I don't want to use fglrx because
I really want to use MergedFB, with which it is incompatible (as far
as I know). Is anyone working on open-source support for the FireGL
5200? If not, is it reasonable to think I could do something about it
(with no experience in this area)?
Thanks in advance,
Hi Folks,
We have received requests to update the version of Microsoft* Visual Studio* to 2015 (Update 1) for building the EDK II BaseTools Win32 Binaries.
We would like to make this change by the end of next week (Friday, Jan. 29th, 2016).
Please let us know if you believe there is an issue with making this change before next Thursday (28 Jan 2016).
Thanks,
Larry Hauch
I was curious as to the status of GTK+ 2.2. Personally, I want to
eventually get libsigc++ 1.2, gtkmm 2.2, libglademm, and gconfmm on OS
X so I can work on Gabber2 on my powerbook without booting to Linux.
Are there any particular stumbling blocks with GTK+ 2.2? If there are
problems with GTK+ on OS X, then it probably would be a good idea to
let the GTK+ people know so that future releases (maybe even 2.4) are
better prepared...
Julian
Thanks Chuck and Steve.
I went through the notes you have pointed out. Good resources.
The Basic LTI option is the right option. However, it may not fit well for my requirement. Please correct me if I'm wrong. Using Basic LTI, I can register a URL (e.g. www.mywebsite.com\content.htm<http://www.mywebsite.com/content.htm>) and let it pass specific parameters to this external website. In my requirement, I do not have a constant URL. It varies with different content ID (e.g. www.mywebsite.com?contentid=1<http://www.mywebsite.com?contentid=1>) each time I post a URL. Please let me know if I can register a varying URL through the Basic LTI tool provider. Also, I cannot pre-register these URLs. The URLs should be dynamically generated by the external web app and sent to the Sakai Courses by calling a Web Service method.
Later, when clicked, the URLs should pass user details to the external web app to make sure the request is coming from Sakai and the user is already logged into Sakai.
The external application that I'm working with is .NET based. If there are Web Services, I could call from the .NET application to add or remove the links to/from Sakai. I couldn't find existing web services that add or remove URLs to/from a specific course. Are you suggesting I should write a new Web Service following these examples?
If Basic LTI provider can support this varying URL requirement, I would like to go with that. Otherwise, please help me finding or writing the right Web Services to achieve this functionality.
Thanks,
Raj
I am trying to interface and OOpic-R and a Parallax H-bridge to drive a motor. I have the motor controller pulse and ground lines connected to pins 17 (pulse) and GND on the H-bride connector strip on the OOPic. The H-bridge Requires 9.2khz to operate and I wasn't sure if
| 512 |
StackExchange
|
simply use a Binary tree.
Q:
how to implement a skip list
I was wondering how to implement a skip list in python.
I have made a linked list but I'm having trouble on how to create the different levels of a linked list and how i would go about iterating through every level of the list when searching or inserting nodes into the list.
A:
You can read John Shipman's nicely-written pure-Python implementation, which even includes detailed explanations on how he built it, from the top-level design down to how the classes were implemented, including things like a discussion on how to provide a nice Pythonic interface.
You can also search PyPI, where there are multiple additional implementations.
Or you can read the Wikipedia entry or the original paper, both of which have detailed explanations and pseudocode that you can translate into Python.
Your existing question is way too general. But if, after reading the relevant information, you have specific questions ("What does this part of Shipman's code do", "What does this line of pseudocode in Pugh's paper means, and how do I translate it to Python", "What exactly is a 'cut list'", etc.), then you can ask on SO.
Q:
Symfony datetime field format
I have a datetime field in a form which I want to give format mask yyyy-mm-dd hh:mi, and I use the following code:
$builder->add('beginDate', 'datetime', array('widget' => 'single_text',
'date_format' => 'yyyy-MM-dd HH:i'))
But what I get in form field is something like this:
2014-08-25T22:37:37Z
I would like something like:
2014-08-25 22:37
Can I get this?
I've seen this and this but didn't find a real example for hours (24 hour format) and minutes
thank you
A:
Have you tried the following date_format in your datetime definition?
'yyyy-MM-dd HH:mm'
instead of what you have now:
'yyyy-MM-dd HH:i'
I think you're mixing PHP date format options with the RFC format options the symfony form builder expects, according to the documentation. Peruse the accepted RFC datetime formats to see how to tweak it.
A:
You should use the format option which accepts HTML5 DateTime format.
$builder->add(
'beginDate',
'datetime',
array(
'widget' => 'single_text',
'format' => 'yyyy-MM-dd HH:mm'
)
)
The format option should be used instead of date_format when using widget = single_text.
A:
Why don't you try this?
$builder
->add('beginDate', 'date', array(
'widget' => 'single_text',
'format' => 'yyyy-MM-dd H:mm',
));
Q:
Variable implemented in a function name
Since I couldn't find a solution for my problem anywhere, I'll ask it here:
basically, I am trying to create a basic function for AD where I have a variable inside of the function name - in my case, its this one:
"Get-AD$FilterItem"
Where $FilterItem would be User, Computer, Group etc., so I don't have to make the same function for every single AD item.
But I can't get it working, it always gives me
...: The term 'get-ad$filteritem' is not recognized...
what to do?
A:
quick reply
$i="user"
$f="get-ad$i"
&$f username
Q:
What is a UITapAndAHalfRecognizer?
I notice that when I cycle through the gesture recognizers of a UITextView and output
| 512 |
reddit
|
parts at Missouri S&T not a bad machine but it is old and incredibly difficult to maintain. I have no idea if it is still around but there used to be a factory with a 100 or so of these running production parts
I'll look in to it. But what I am doing is probably a bit different than commercial. there is no money, there is no prouct like with farming and ag. I'm basically flying over a park and taking some video for my own personal use. if I get some ideas even better. Its a big open space I might as well be doing it for fun....because I really dont need to do it, it will make it more entertaining and hopefully spot something in the process! i will take a gander closer at the laws...every description for "commercial" seems murky at best in the research I have done
This is applies to many things beyond depression, but is a good idea for any interpersonal interactions. Whatever you do, do not reroute a conversation to be about you when somebody has a problem. Do not tell people what you went through, or would do. It is not the same. Don’t always tell people how to fix it; you may think you’re being helpful but people often just want to vent and have their issue acknowledged as an issue. And do not offer help you are not willing to follow through on; ie: “call me any time” if you’re never going to pick up the phone. Also, “Let me know if you need anything,” is much less likely to be something somebody will do than take you up on an offer for a specific act.
Jesus Christ this is actually the first article I have read that talks about the stupid shit De5 goes through. Dont know what that says about my reading choices but hey. I wont say my opinion on her case but damn, kawawa naman siya. People are berating her for things that had nothing to do with what her politics is about
Thanks a ton! Ill be sure to start small and keep an eye on my PH etc. I understand that with these small tanks it really is easy to mess things up big time. I have the lights on 9 Hours a day now so I will shorten it up and see if all this helps. Does Purigen happen to come in small packets that I could squeeze in my HOB? just googled i and it appeared to come in jars. I appreciate the complement on the aquascaping. Thanks.
What? Why limit who you date based on race? How is this even relevant? Judge by character, please. I currently date a Chinese girl, but my ex was half-white half-black and was one of the biggest blessings of my life. She restored my faith in women and helped me have confidence in myself.
Also the two good situation is a problem. I'm in two leagues and in one i have Rodgers who did well and the other Jordy nelson who
| 512 |
StackExchange
|
can be shortened to
.Where(child => child.Books.Contains(Convert.ToInt32("Huck........"))
but calling Convert.ToInt32("Huck........") isn't going to hand you the Id of a book with the title "Huck........". It's going to convert the string to a number with somewhat useless results.
Q:
How to run spring boot fat jar with minimal memory?
Here is our maven MediSpan project. Actually it's a REST web service. Its return JSON object for Drug Drug Interaction query through GPI code for a specified patient. Here is an sample of an rest query:
http://localhost:8017/mspn/query?pid=1000&
gpis=83-20-00-30-20-03-10&gpis=64-99-10-02-12-03-20
Here is the structure of our project:
/opt/java/spring/boot/fat/jar/project/chorke─mspn─server/
├─ MediSpan.Documents.Monograph.css [ 1,697 Byte]
├─ MediSpan.Documents.Monograph.xslt [ 35,167 Byte]
├─ bitronix-tx-mgr-log-001 [ 2,097,173 Byte]
├─ bitronix-tx-mgr-log-002 [ 2,097,173 Byte]
└─ chorke─mspn─server.jar! [26,022,610 Byte]
├─ medispan/ [ 443,756 Byte]
├─ META-INF/ [ 33,702 Byte]
├─ org/springframework/boot/loader/ [ 165,003 Byte]
├─ com/chorke/ [ 27,633 Byte]
├─ application.properties [ 501 Byte]
├─ application.yml [ 2,234 Byte]
├─ MediSpan.Foundation.Config.xml [ 14,939 Byte]
├─ MediSpan.Foundation.Text.xml [ 9,003 Byte]
├─ log4j.xml [ 2,254 Byte]
└─ lib/ [25,688,056 Byte]
├─ aopalliance-1.0.jar
├─ btm-2.1.4.jar
├─ c3p0-0.9.1.2.jar
├─ camel-core-2.15.2.jar
├─ camel-jasypt-2.15.2.jar
├─ camel-quartz2-2.15.2.jar
├─ camel-spring-2.15.2.jar
├─ camel-spring-javaconfig-2.15.2.jar
├─ chorke-comn-spring-2.0.00-SNAPSHOT.jar [ 11,698 Byte]
├─ chorke-mspn-entity-2.0.00-SNAPSHOT.jar [ 13,486 Byte]
├─ chorke-mspn-parser-2.0.00-SNAPSHOT.jar [ 15,921 Byte]
├─ chorke-mspn-persis-2.0.00-SNAPSHOT.jar [ 23,328 Byte]
├─ chorke-mspn-utlity-2.0.00-SNAPSHOT.jar [ 25,684 Byte]
├─ commons-lang3-3.3.2.jar
├─ commons-logging-1.1.1.jar
├─ ehcache-core-2.6.11.jar
├─ jackson-annotations-2.4.6.jar
├─ jackson-core-2.4.6.jar
├─ jackson-databind-2.4.6.jar
├─ jasypt-1.9.2.jar
├─ javax.transaction-api-1.2.jar
├─ jaxb-core-2.2.11.jar
├─ jaxb-impl-2.2.11.jar
├─ log4j-1.2.17.jar
├─ medispan-business-5.1.10.jar
├─ medispan-concepts-5.1.10.jar
├─ medispan-conditions-5.1.10.jar
├─ medispan-documents-5.1.10.jar
├─ medispan-interactions-5.1.10.jar
├─ medispan-screening-5.1.10.jar
├─ medispan-utility-5.1.10.jar
├─ mybatis-3.2.8.jar
├─ mybatis-ehcache-1.0.2.jar
├─ mybatis-spring-1.2.2.jar
├─ ojdbc6-11.2.0.3.jar
├─ org.apache.servicemix.bundles.cglib-2.1_3_7.jar
├─ quartz-2.2.1.jar
├─ slf4j-api-1.7.12.jar
├─ slf4j-log4j12-1.7.12.jar
├─ snakeyaml-1.14.jar
├─ spring-aop-4.1.6.RELEASE.jar
├─ spring-beans-4.1.6.RELEASE.jar
├─ spring-boot-1.2.4.RELEASE.jar
├─ spring-boot-actuator-1.2.4.RELEASE.jar
├─ spring-boot-autoconfigure-1.2.4.RELEASE.jar
├─ spring-boot-starter-1.2.4.RELEASE.jar
├─ spring-boot-starter-actuator-1.2.4.RELEASE.jar
├─ spring-boot-starter-tomcat-1.2.4.RELEASE.jar
├─ spring-context-4.1.6.RELEASE.jar
├─ spring-context-support-4.1.6.RELEASE.jar
├─ spring-core-4.1.6.RELEASE.jar
├─ spring-expression-4.1.6.RELEASE.jar
├─ spring-jdbc-4.1.6.RELEASE.jar
├─ spring-jms-4.1.6.RELEASE.jar
├─ spring-messaging-4.1.6.RELEASE.jar
├─ spring-tx-4.1.6.RELEASE.jar
├─ spring-web-4.1.6.RELEASE.jar
├─ spring-webmvc-4.1.6.RELEASE.jar
├─ tomcat-embed-core-8.0.23.jar
├─ tomcat-embed-el-8.0.23.jar
├─ tomcat-embed-logging-juli-8.0.23.jar
└─ tomcat-embed-websocket-8.0.23.jar
Here is the command of running this fat jar project and their matrix:
# without setting java option
java -jar chorke-mspn-server.jar
Started BootstrapApplication in 41.824 seconds (JVM running for 42.807)
Memory Used: 532,858 kbytes
Committed: 751,616 kbytes
Max: 1,847,808 kbytes
9502 classes loaded
Working fine.
# setting java option for 1024 MB
java -Xmx1024M -XX:MaxPermSize=768M -XX:+CMSClassUnloadingEnabled \
-jar chorke-mspn-server.jar
Started BootstrapApplication in 42.134 seconds (JVM running for 43.084)
Memory Used: 160,016 kbytes
Committed: 422,912 kbytes
Max: 932,352 kbytes
9505 classes loaded
Working fine.
# setting java option for 512 MB
java -Xmx512M -XX:MaxPermSize=384M -XX:+CMSClassUnloadingEnabled \
-jar chorke-mspn-server.jar
Started BootstrapApplication in 42.385 seconds (JVM running for 43.358)
Memory Used: 244,280 kbytes
Committed: 463,360 kbytes
Max: 465,920 kbytes
9503 classes loaded
Working fine.
# setting java option for 256 MB
java -Xmx256M -XX:MaxPermSize=192M -XX:+CMSClassUnloadingEnabled \
-jar chorke-mspn-server.jar
Started BootstrapApplication in 42.202 seconds (JVM running for 43.174)
Memory Used: 244,280 kbytes
Committed: 463,360 kbytes
Max: 465,920 kbytes
9503 classes loaded
threw exception [Handler processing failed; nested exception is java.lang.OutOfMemoryError: GC overhead limit exceeded] with root cause
java.lang.OutOfMemoryError: GC overhead limit exceeded
at java.lang.Integer.valueOf(Integer.java:642)
at medispan.foundation.convert.ValueType.asValue(Unknown Source)
at medispan.foundation.dataaccess.providers.sql.SQLProvider.executeForResults(Unknown Source)
at medispan.foundation.dataaccess.providers.sql.SQLDataAccessProvider.innerExecuteForCollection(Unknown Source)
at medispan.foundation.dataaccess.DataAccessProvider.executeForCollection(Unknown Source)
at medispan.business.dataaccess.BusinessDataAccessManager.load(Unknown Source)
at medispan.business.dataaccess.QueryPropertyValues.getPropertyValue(Unknown Source)
at medispan.business.dataaccess.QueryPropertyValues.getInnerValue(Unknown Source)
more..
This application consist with
| 512 |
StackExchange
|
it isn't persistent, it wasn't of much help. Can't setup JDBCJobStore because, this will require huge code changes to my existing code base.
In light of such a scenario,
I have the following queries:
If I use Spring's built in @Schedule annotation will my jobs be persistent..? I don't mind if the jobs get scheduled after the application starts. All I want is the jobs to not lose their details and triggers.?
If not, are there any other alternatives that can be followed , keeping in mind that I need to schedule multiple jobs with my scheduler.?
If yes, how can I achieve this.? My triggers are different each job. For e.g I might have a job that is scheduled at 9AM and another at 8.30AM and so on.
If not a scheduler, then can I have a mechanism to handle this.?
One thing, I found is that the documentation for Quartz isn't very descriptive. I mean it's fine for a top level config, but configuring it on your an application is a pain. This is just a side note. Nothing to do with the question.
Appreciate the help. :)
A:
No, Spring's @Schedule-annotation will typically only instruct Spring at what times a certain task should be scheduled to run within the current VM. As far as I know there is not a context for the execution either. The schedule is static.
I had a similar requirement and created db-scheduler (https://github.com/kagkarlsson/db-scheduler), a simple, persistent and cluster-friendly scheduler. It stores the next execution-time in the database, and triggers execution once it is reached.
A very simple example for a RecurringTask without context could look like this:
final RecurringTask myDailyTask = ComposableTask.recurringTask("my-daily-task", Schedules.daily(LocalTime.of(8, 0)),
() -> System.out.println("Executed!"));
final Scheduler scheduler = Scheduler
.create(dataSource)
.startTasks(myDailyTask)
.threads(5)
.build();
scheduler.start();
It will execute the task named my-daily-task at 08:00 every day. It will be scheduled in the database when the scheduler is first started, unless it already exists in the database.
If you want to schedule an ad-hoc task some time in the future with context, you can use the OneTimeTask:
final OneTimeTask oneTimeTask = ComposableTask.onetimeTask("my-onetime-task",
(taskInstance, context) -> System.out.println("One-time task with identifier "+taskInstance.getId()+" executed!"));
scheduler.scheduleForExecution(LocalDateTime.now().plusDays(1), oneTimeTask.instance("1001"));
See the example above. Any number of tasks can be scheduled, as long as task-name and instanceIdentifier is unique.
A:
@Schedule has nothing to do with the actual executor. The default java executors aren't persistent (maybe there are some app-server specific ones that are), if you want persistence you have to use Quartz for job execution.
Q:
Unity OnTriggerEnter2D sometimes doesn't work
I have problem with triggers in my 2D game in Unity. I want to make enemy die when he triggers with player's weapon. The problem is there are two colliders attached to enemy (tagged "Enemy"):
one is box2d collider which is used as normal collider
second is sphere collider which is set as trigger and is used in script to check whether there is a player in range
I got sword object, which has sprite renderer, box collider (set as trigger) and script:
void OnTriggerEnter2D(Collider2D other)
{
if(other.tag
| 512 |
realnews
|
of 10 oil train derailments a year in the next 20 years, as more oil is transported by rail.
"We look forward to working closely with the DOT to develop rules that make our communities and those that protect communities safer from deadly rail explosions," said Schaitberger.
Right Side News Reports from the Federation for American Immigration Reform (FAIR) in this March 14th, 2011 Legislative Weekly. FAIR tracks pending immigration laws in the United States which can impact homeland security in positive or negative ways and are a valued resource
Immigrant Job Numbers Grow as American Employment Declines
Napolitano: DHS Granted Deferred Action to Nearly 900 Illegal Aliens in 2010
Utah Legislature Passes Series of Immigration Bills; Includes Amnesty
Washington and New Mexico to Continue Issuing Driver’s Licenses to Illegal Aliens
Immigrant Job Numbers Grow as American Employment Declines
On Thursday of last week, the House Judiciary Committee’s Immigration Subcommittee met to hear testimony on the effect of immigration on the American job market. The hearing, entitled “New Jobs in Recession and Recovery: Who Are Getting Them and Who Are Not,” is especially relevant given that many Americans are still struggling to find work in the midst of our nation’s weak economy.
At the hearing, Dr. Rakesh Kochar, Associate Director for Research at the Pew Hispanic Center, testified that in the year following the official end of the recession (June 2009), foreign-born workers gained 656,000 jobs while native-born workers lost an additional 1.2 million jobs. Foreign born workers, he said represent 15.7% of the total American workforce and that the immigrant share of the U.S. working-age population is rising. (See Pew, Hispanic Center, After the Great Recession: Foreign Born Gain Jobs; Native Born Lost Jobs, Oct. 29, 2010) As of last year, he said, at least 8 million unauthorized immigrants participated in the U.S. labor market. (Pew Hispanic Center, “Unauthorized Immigrant Population: National and State Trends, 2010“)
Economist Heidi Shierholz, from the Economic Policy Institute, testified that despite the fact that economists have declared an official end to the recession, there are still 5.4 percent fewer jobs available than when the recession began in 2007. Shierholz argued that the immigration system is completely unresponsive to the economic cycle. “For example, in 2010, the unemployment rate in construction was over 20 percent, but the Department of Labor nevertheless certified thousands of H-2B visas for construction workers. This defies logic,” she said. Part of immigration reform, she concluded, would take into account the actual needs of the economy and its ability to accept additional workers.
Additional testimony came from Steven Camarota, Director of Research for the Center for Immigration Studies, and Greg Serbon, State Director of Indiana Federation for Immigration Reform and Enforcement (IFIRE). Camarota voiced concern that jobs created over the past decade are primarily going to foreign-born workers, while the number of working-age natives with jobs has fallen dramatically. Mr. Serbon spoke out about against the plethora of visa programs which allow non-immigrants to work in America and the prevalence of non-immigrant temporary visa holders overstaying the authorized visa time.
Chairman of
| 512 |
StackExchange
|
`percent`
FROM `feedback` WHERE `booking` != '0' GROUP BY `booking`;
The key was putting the WHERE condition within the sub-query SELECT COUNT (*) (and also on the end). This means that the total to divide by is given without the '0' entries.
Q:
Float within media query not working on input after display: block
With the below code the input should be on the same line as the text when the viewport is larger than 320px. It works as expected on the first page load (when media query is activated), but after the viewport is resized below 320px the float: left will not work anymore, even if the viewport is enlarged again.
Expected result when viewport >= 320px
After resizing viewport < 320px
Result when viewport is resized back to >= 320px
This behaviour is only exhibited when the following conditions are satisfied:
Browser is Google Chrome
Floated element is an input (any type)
float rule is within a media query
Floated element defaults to display: block with no media query applied
float rule is disabled (either by resizing the viewport or within dev tools) then enabled again
I am using Chrome 41.0.2272.101 (64-bit) on Ubuntu 14.04. The behaviour is not exhibited in Firefox 38.0 on the same platform. I have not tested any other browsers.
.text {
display: inline-block;
}
input {
display: block;
}
@media only screen and (min-width: 320px) {
input {
float: left;
}
}
<div class="text">Text</div>
<input type="text">
You can try it out here: https://jsfiddle.net/ws2guLrq/1/
A:
This may be what you are looking for, make use of max-width instead and switch the arguments around.
.text {
display: inline-block;
}
input {
float: left;
}
@media only screen and (max-width: 319px) {
input {
float: none;
}
}
If I understood your question correctly then this is what you want, I have only tested this in Chrome.
Q:
Mongodb find query with $near and coordinates not working
I'm trying to make use of some geolocation functionality in mongodb. Using a find query with $near doesn't seem to work!
I currently have this object in my database:
{
"Username": "Deano",
"_id": {
"$oid": "533f0b722ad3a8d39b6213c3"
},
"location": {
"type": "Point",
"coordinates": [
51.50998,
-0.1337
]
}
}
I have the following index set up as well:
{
"v": 1,
"key": {
"location": "2dsphere"
},
"ns": "heroku_app23672911.catchmerequests",
"name": "location_2dsphere",
"background": true
}
When I run this query:
db.collectionname.find({ "location" : { $near : [50.0 , -0.1330] , $maxDistance : 10000 }})
I get this error:
error: {
"$err" : "can't parse query (2dsphere): { $near: [ 50.0, -0.133 ], $maxDistance: 10000.0 }",
"code" : 16535
}
Does anyone know where I'm going wrong? Any help would be much appreciated!
A:
It seems you need to use the GeoJSON format if your data is in GeoJSON format too, as yours is. If you use:
db.collectionname.find({
"location": {
$near: {
$geometry:
{ type: "Point", coordinates: [50.0, -0.1330] }, $maxDistance: 500
}
}
})
it should work. I could replicate your error using GeoJSON storage format for the field, but what the docs call
| 512 |
goodreads
|
her to give him a call if she ever wants to share her secrets on fighting vamps. When Val and her sister Jennifer get home Val gets in trouble from her mom and step-dad for it. What is her punishment? The kick her ass out of the house and fire her from her job at the family book store. Totally fair, right?
She drives off pissed and stops by the river to do some thinking and that is where she hooks up with a cute little terrier. But it's not just a terrier. He's also part hellhound. Val feels a rapport with the dog, Fang. She herself is part demon. Part Succubus from her fathers side. That's why she hunts vamps. To try and appease her lust demon with the hunt. She is able to communicate with Fang by way of mind and that is one smart ass dog, let me tell you! They decide to "hang' together. Now Val has to find a place to live and a job.
She calls Dan and gets a job through him and by the next day she has a place to stay, rooming with Dan's sister Gwen. Things are looking up for her and Fang. And then things veer off course again. She finds out that her sister is becoming a part of a vampire movement to find Val. However, Jennifer gets in over her head. And Dan finds out that she, Val, is part succubus. Does she save her sister? Does she lose her job? Is she able to keep Dan as a friend? Read it and find out my friend...
I liked it...
Backworlds, I must say I adore this story. M Pax creates a great read with wonderful imagery. I can't forget Craze. I wanted to see so much good happen for him after the way things started off for him. I mean, dang, dad...betrayal much??? I look forward to reading more of Craze's adventures.
It was an alright book.
This book, first published in 1999, is all over the place because of the recently released film, starring Harry Potter alum Emma Watson. But I had never read the book. It's written as letters to an unknown person from a boy named Charlie, the wallflower of the title. Charlie's writing and naivete make it clear that something is "off" about him, but it isn't clear what that something is. Through the letters he tells the story of his best friend committing suicide, and then of some older kids taking him under their wing and helping him heal. The stories and characters are powerful and unforgettable, made all the more so by Charlie's unusual voice and narration. I haven't yet seen the movie, but having read the book, I can see why the filmakers persisted with this story even 13 years later.
http://scribbleandhum.blogspot.com/
Author Rick Bass recomended this book as part of the Rocky Mountain Land Library's "A Reading List For the President Elect: A Western Primer for the Next Administration."
An excellent introduction to the field of social psychology! Learned some intresting things on why
| 512 |
StackExchange
|
trying to return
["2000.10", "1276.21", "1356.75"]
This array will return all of the prices of Object 2. However, you can see that that Object 2 does not include the date of "2019-10-08", so I need to return the price of that date from Object 1. These object lengths are dynamic, but Object 1 will always be longer than Object 2, since I am getting missing values from Object 1.
The array that is returned will always be the size of Object 1. The problem I am facing is looping through and checking prices based on indexes.
My attempt was to loop through Object 1, then check to see if the dates matched for each index. However, I ran into issues when the dates didn't match, so the index was out of sync.
A:
You can use a Map and map
Create a Map from second array using date as key
Loop through first array, if date is available on Mapper use value from Mapper for corresponding date, else use the price of current element
let a = [{"date": "2019-10-07","price": "1313.01"},{"date":"2019-10-08","price": "1276.21"},{"date": "2019-10-09","price": "1257.75"}]
let b = [{ "date": "2019-10-07","price": "2000.10"},{"date": "2019-10-09","price": "1356.75"}]
let mapper = new Map(b.map(({ date, price }) => [date, price]))
let final = a.map(({ date, price }) => {
return mapper.has(date) ? mapper.get(date) : price
})
console.log(final)
Q:
Posting messages from a service worker to a client page
Today we can find many examples of sending message from a service worker to a client, but always following the reception of a message event in the service worker.
I would like to know if we can send messages independently of this event? And if yes, how? I tried few things, without success...
In my case, it's for redirect a client to a new page when my service worker receives a push event.
A:
client.js :
const swListener = new BroadcastChannel('swListener');
swListener.onmessage = function(e) {
console.log('swListener Received', e.data);
};
service-worker.js
const swListener = new BroadcastChannel('swListener');
swListener.postMessage('This is From SW');
A:
The interface for Client.postMessage() is described at https://github.com/slightlyoff/ServiceWorker/issues/609. Unfortunately, it is not fully implemented in Google Chrome as of version 45, though I'd expect it to make it into a version at a later date.
When the functionality's available, you could use self.clients.matchAll() to obtain a list of any open pages that are being controlled by the service worker, and call the postMessage() method on the specific client that you care about. You need to keep in mind that it's entirely possible that there won't be any tabs open with a page controlled by your service worker, in which case you'd want to do something like open a new client page with your target URL.
But, there's a method that's probably more appropriate for your use case (though also not currently support in Chrome 45): WindowClient.navigate(), which will instruct an open tab controlled by your service worker to navigate to a different URL on the same origin.
Q:
com.allanbank.mongodb Java Mongodb Async driver error - Could not bootstrap a connection to the MongoDB servers
I'm implementing web services using google guice
| 512 |
gmane
|
sheets.
A third option would be to replace all the translatable strings with
variables, and define these variables in an external file, one file for
each language. Each report xslt file would then begin with an import of
the translatable string variables for a particular language.
Has anyone done anything like this? Has anyone any thoughts on how this
could be done?
Thanks!
Hi All,
Hope you are doing well.
I have one requirement where my need is about developing the notifications
for the Remedy incidents which are in 'pending' status with only a valid
status reason as 'customer', excluding all other status reasons.
As we all know, in pending status, SLA clock stops, but here my requirement
is.
I want to develop a mechanism where Remedy system(ITSM specially service
Desk) shoots notification emails on an interval of:
1. 1st notification after 24 hours when ticket is in pending status with
status reason as Customer
2. 2nd notifications after 48 hours when ticket is in pending status with
status reason as Customer.
3. 3rd notification after 72 hours and will automatically moves the pending
status to resolved with some resolution remarks.
Basically, main objective of this funationality is to alert the customer
that some information is awaited from his/her end and after above
notifications, ticket will be marked as resolved as no actions were
performed from customer end.
Where i got stuck is, since, the ticket is in pending status, how can i
calculate the time interval for considering 24, 36 & 72 hours.
Hence, looking ahead for your much needed suggestions to achieve this
functionality, if it is possible.
Hope, anyone has achieved this in past.
Please suggest.
Regards
Hari Vishwakarma
Hi,
I am looking to replace a quirk of our old PBX system functionality with
asterisk but after searching, archives, wiki, etc.. I cannot figure out
how.
Here is what I would like to do:
PhoneA is a SIP hard phone, phoneB is an analogue phone connected to a
SIP ATA. When an incoming call comes in, I would like to ring both
phones, but if phoneA is answered first, I would like phoneB to be
answered as well and left in a "off hook" state so that when someone
picks up the receiver of phoneB, they can hear and participate in the
conversation between the calling party and phoneA.
I believe I would have to put both phones in a MeetMe conference, but
how to I "auto-answer" phoneB when phoneA has answered the call?
I suspect that this may not be possible with asterisk, but would like
confirmation of that.
Thanks in advance.
-m
I've found that Gnome is not very stable in Fedora, at least not with
dual monitors.
If I use Xinerama I can't get the panel(s) to show up at all.
Without Xinerama they come up, but any attempt to modify the panel on
the secondary monitor crashes and restarts the window manager.
I'm running Fedora Core 1 with all updates and a Matrox G550 dual video
display.
Hugh
Hello all,
For years, at least since
| 512 |
realnews
|
you think your past influenced your decision to work with them? Absolutely. I relate to them because of my own feeling of abandonment, struggle to survive and being touched by the criminal justice system. Writing is what healed you, so now you’re helping them heal in the same way. Exactly. Writing is so healing and we use it as a way to transform ourselves. We have the best time. W hat is your viewpoint on money and wealth now? I don’t think there’s anything wrong with having money or seeking to live a big life, but I do believe in ethical and moral boundaries with money. When you cross an ethical and moral line, that’s where greed comes in and I certainly don’t believe in living a greedy life. Follow Emily on Twitter: @EmLaurence
Please enable Javascript to watch this video
FAIRFIELD TOWNSHIP -- Sweet corn season is in full swing in Pennsylvania.
"Nothing better than Pennsylvania grown corn," Linda Gardner said.
Hungry shoppers lined up at Snyder's Quality Sweet Corn near Montoursville to grab it by the bagful.
"Just having a cookout and going to grill out some corn and steaks and hope to have a good time," Gardner said.
Owner Scott Snyder says his stand opened last week. His employees pick it fresh every day.
"I have 12 different varieties and they come on at different times, and some of them repeat themselves," Snyder said.
Snyder says, even though the corn crop is good and normal this year, he says it is a little late. He blames that on the weather.
"We had some hard frost in May and it slowed the season down a little bit, so we got started a little later than normal," Snyder said.
The Walter family lives in Chicago, but vacations in Lycoming County every year. Erin Walter says they always stop by Snyder's to pick up enough corn to last them all year.
"We just get sweet corn at home and the prices are different. I think it's more expensive at home and the quality isn't as good. We're looking forward to having some," Walter said.
Snyder says sweet corn season runs through mid-September.
Live + Same Day Cable News Daily Ratings for Tuesday, February 19, 2013
P2+ (000s) 25-54 (000s) 35-64 (000s) Total Day FNC 1,170 229 475 CNN 406 141 203 MSNBC 465 127 221 CNBC 193 54 98 FBN 58 11 28 HLN 316 107 182 Primetime P2+ (000s) 25-54 (000s) 35-64 (000s) FNC 2,127 375 770 CNN 656 221 335 MSNBC 867 212 431 CNBC 180 71 97 FBN 61 21 27 HLN 504 209 318 Net Morning programs (6-9 AM) P2+ (000s) 25-54 (000s) 35-64 (000s) FNC FOX & Friends 1,151 302 539 CNN Early Start/Starting Point 282 138 177 MSNBC Morning Joe 410 154 225 CNBC Squawk Box 144 31 79 HLN Morning Express w/ Meade 194 103 147 Net 5PM P2+ (000s) 25-54 (000s) 35-64 (000s) FNC FIVE, THE 1,848 269 750 CNN SITUATION ROOM 598 178 302 MSNBC HARDBALL WITH C. MATTHEWS 656 138 276 CNBC
| 512 |
YouTubeCommons
|
on their ship they're going to have some consideration for separating those weapons out so they're not firing at the same time because again even if you're a kilometer distance when two ships are flying at high speed one of these two weapons is destined to miss and generally speaking most players when they're running lasers and multi cannons on a ship will opt to put gimbals on for the multi cannons and leave their laser weapons fixed i'm a little bit lazy and i like to use gimbals on both because it does lower the amount of power you have to shunt to your weapons and that gives you a little bit more freedom to do some other things in combat that you'll want to be aware of and i'll get to that in a minute but the the synergy that pulse lasers and multi-cannons have is really really good and as you start to get more familiar with how these weapons work and with how your ship works you're going to be able to start playing with this dynamic you can for example go from a pulse laser to something like and i'm going to put it down here the multicannon slot for contrast something like a burst laser now you'll notice here the pulse laser does 14 damage per second gimballed the burst laser is 16 damage per second gimbal so you do get a damage output increase but you also get a requisite increase in the amount of energy that you have to commit to the weapon burst lasers are the number two boy in these scenarios so if you've got a whole bunch of weapons capacitor in combat and you don't end up having situations where you have to take a break and charge it or dump a whole bunch of pips into the weapons capacity to keep your hard points turning out then you can consider upgrading from a pulse laser to a burst laser and if you really have your power management nailed down then you can switch from a burst laser to a beam laser this is the highest demand weapon in the entire game if you're putting beam lasers on your ship for energy as your energy weapon then then you've got to really know what you're doing because the beam laser is the highest damage output it's up here at 20.3 compared to the burst laser 16.6 just so you can see the comparison to a pulse laser you're getting just under six more dps and that can add up in a fight beam lasers put out the most damage but they also put out the most heat they do offer you the most opportunity to inflict damage on target because they perpetually fire and are inflicting constant damage and that the advantages of that when you're only getting a couple of seconds to fire on a target or a snap snap glancing blow across your target's cross section a beam laser can get you more but it's going to cost you
| 512 |
amazon
|
remote which is D.O.A., this a cheap alternative to some other options out there.
This Granny mystery is different from many other mysteries I normally read. I fell in love with all of the ladies and truly didn't know the outcome until the last chapter.
I highly recommend this book if you are like me looking for characters that you will fall in love with and for a change of pace from your everyday murder mysteries.
The glasses are unique an comfortable to drink from
the coax fit right inside and now is no longer a tripping hazard.
finally I can listen to patients hearts properly and get a blood pressure first time around. Can't go wrong with a littman!
So far, so good. Been wearing them around to "break in" but are comfortable right out of the box. Headed out to Desolation Wilderness in a few weeks and these will get the full test then!
This bag is amazing! It is exactly what I expected. The quality is fabulous. Good buy coach.
Great product. completely satisfied thanks:)
Got some for my birthday, then got some for my sister for Christmas. We both love them. Great way to geek out.
Bought these as a upgrade for my T10 samsung mp3 player. i had a pair of sony earbuds prior to these and they worked and sound nice but i wanted something with a little more punch and these JVC's fit the bill. I purchased a Fiios E6 mini amplifier (also a really cool item) and ran it with my T10 and with these JVC earbuds (even without amp) they sound VERY nice. Very clear with good bass. I like my music loud, but clear. I can crank this system up almost all the way before you notice any sort of distortion. I paid about $20 for my Sony's and $55 for my JVC's. Are they worth the extra $35? I'm pretty frugal with my money, but i would have to say yes. i also love the design. They fit a little differently than typical earbuds, but they are well thought out. Perfect for walking and or recumbant bike as they don't fall out like others. I am a Sony man. I have EVERYTHING Sony, but JVC did these right. Would have given 5 stars but I'm very picky and always think products could be better...or maybe a little better price.
Yo, this album is great. Rather you are "ridin high", or if you need some of that kick back and chill music. The beats will take you to another planet, and the lyrics will bring you back to earth. Lots of underground heads here showing off their verbal assult over Keelay and Zaire's mind bending beats.
Best Tracks:
2-Take A Ride
3-Addicts For Real
6-Wake Up
7-I'm On Swerve
10-The Times (Check Out Video)
12-Trapped
15- Ridin High
If you haven't read the original book, it's definitely worth reading. It focuses just on the marital relationship and staying in love. If you have read it, than the first section of this book will largely be a quick refresher of that book. The
| 512 |
gmane
|
proposal for implementing IAX2 in ekiga got accepted with google's
summer of code.
To give an update (I'll try and keep you guys regularly posted as to
what's happening, any problems etc.).
Currently I have been looking at the code to gain an understanding of
ekiga and opal's code and design. Also obviously checking out the IAX2
code in opal :). From what I have seen and got working, I will work on
getting IAX2 going in ekiga first. The main part of this will obviously
involve writing a gnome meeting endpoint for IAX2.
One key problem I have identified is the accounts code. The protocols
are tightly integrated with how it works. I could either refactor this
code to loosen the integration or hack iax2 support in there and
refactor it later ;). The advantage of this refactored will be when
someone wants to add Xmpp/libjingle support, or some other protocol down
the track.
Well, please tell me your thoughts and comments on this project.
-Stephen
Hello,
I saw a mail last week asking for examples/docs for wrapped/document style service. I would like to try to do this. So as a start I wanted to know what are the examples provided. I didn't find any in the axis/samples.
However in the user guide there is a good explaination and some code for a PurchaseOrder. I couldn't find sample code for this as well.
Now my question is should I start by writing a example for this PurchaseOrder or deos it already exit?
Thanx,
Dimuthu.
Hello,
Can anyone tell me why certain quicktime (.mov) formats do not seem to
convert to FLV.
Do I need to flag --enable-x264 when I complile ffmpeg for Quicktime
support?
If anyone can let me know what config options I need to focus on to get
Quicktime codec support in ffmpeg - I would really appreciate it.
Thank you,
Ryan
Hello There,
Due to the fact that the [# TO #] range search works lexographically, I am
forced to build a rather large boolean query to get range data from my
index.
I have an ID field that contains about 500,000 unique ids. If I want to
query all records with ids [1-2000], I build a boolean query containing all
the numbers in the range. eg. id:(1 2 3 ... 1999 2000)
The problem with this is that I get the following error :
org.apache.lucene.queryParser.ParseException: Too many boolean clauses
Any ideas on how I might circumvent this issue by either finding a way to
rewrite the query, or avoid the error?
Thanks in advance,
Shawn.
Hello Stackists,
I'd like to announce my candidacy for the OpenStack Technical Committee.
I'm running because I don't think that the diversity of perspectives
amongst TC members reflects the diversity of our community. We're
fortunate to have a few people whose brilliance often transcends the
scope of their day-to-day focus, but I don't think that can outweigh the
fact that (by my, arguable, count) 12 out of 13 are focused primarily on
Nova and the projects (including cross-project efforts) that evolved
directly out of it.
| 512 |
reddit
|
a camp and loot to save gear for next time you die, look for other peoples camps, PvP, and so on. lots more trees of choices are open to spend your time in the game and keep you entertained with goals. right now in standalone is gear up then maybe get some higher tear gear then PvP. once again im not complaining that this content is not in the standalone yet as i know and understand that its early in development. I think the main problem people have and the problem i have is that the core problems that they got away with in mod are still prevalent in the standalone which is fine when your moding/breaking a game to do something it was not intended to do but when you create a standalone and people pay money for the game I personally expected them to get the basics fixed, working, and reliable first.
SPOILER ALERT I like it - good job! I'd probably explore the Black Spider's origin - maybe leading to some Underdark exploration. Maybe the research on the forge they need was stolen by his unknown Drow patron. The Drow could be inciting the Orcs to create a distraction for some secret purpose
Hmmn Well,They both have their own uniqueness but I can say there's quite a few similarities (Except the use of weapons of course lol) They're both really good games.Ratchet And Clank is the game that made me fall in love with the Platformer Genre. A Hat In Time is something that's like the old days kind of Platformers but offers alot of refreshing things.
So many other games already have an option for blitz/auto repeat from the get go. If we can do it once manually, I dont see why not. Saves me god knows how long autoing the easiest droplet zone and having my phone batteru die mid way because i'll go to sleep with it at 8% and leave time out at max time limit.
I'm a fairly experienced opiod user. Have a high tolerance. But honest to God I've never even tried weed. I recently got a small amount and want to give it a try, possibly mixing it with some norcos. First what can I expect first time trying weed. Am I going to freak out or something? I've heard first time taking weed you freak out, but it's not like I've never been high before (just not on weed). I'm hoping it's just chill and relaxing. Also is it alright to pop a few norcos as well? Especially for my first time? I'm doing this alone in my home probably later tonight. Any advice of what to expect is appreciated I literally have no fucking idea what I'm doing lol.
We fucked up with not having a backup. He might've not been a savior but under him (maybe not because, but under) we were literally brought out of the shitter. Two consecutive playoffs since the nineties is not something to sneeze at. And he obviously brought fucking DEFENSE. WARRIORS DEFENSE, WHAT??? And if
| 512 |
ao3
|
him with the threat of a paddling in her gaze.
Bucky stared at him for a long moment, pale eyes rimmed in red. Finally, he spoke. “Do you want your cat’s eye back?” he whispered, still squatting as though he might have to leap up and run.
_That’s a stupid question,_ Steve nearly said, because it was. “’Course not,” Steve said, instead, because that was the right answer. “How are you supposed to lose to me without a shooter?” he grumbled, and kept his mouth shut when his Ma gathered Bucky up to dress him in one of Steve’s nightshirts and some wool leggings. But the world was as it should be, because Bucky cleared his plate and kicked Steve’s calf under the table, and smiled when Steve’s Ma kissed them both goodnight.
(Because loving Steve meant blood in your mouth and pain under your ribs. But there was apple pie and cold milk to wash out the taste of blood—and Steve never landed a hit without shattering his own heart most of all.)
Looking down into a chasm that seemed to be filled with fire.
Darkspawn. Thousands of them.
Standing on a bridge, overlooking the horde, it roared.
_The archdemon._
Blasting out a gout of fire, a hissing whisper barely reached his ears.
—ROTG—
Daylen rolled over and sat up, mopping his forehead with his sleeve and brushing his hair back out of his eyes.
“Bad dreams, huh?”
Daylen looked over to see Alistair sitting next to the cooking pot, watching him. “It seemed so real.”
“Well it is real, sort of. You see, part of being a Grey Warden is being able to hear the darkspawn. That’s what your dream was. Hearing them. The archdemon, it…talks to the horde, and we feel it just as they do. That’s why we know this is really a Blight.”
Daylen stood and stretched. “Why didn’t Duncan just tell everyone that?”
“He did,” Alistair said quietly. “He said he felt the archdemon’s presence. Everyone just assumed he was guessing. It takes a bit, but eventually you can block the dreams out. Some of the older Grey Wardens say they can understand the archdemon a bit, but I sure can’t. Anyhow, when I heard you thrashing around, I thought I should tell you. It was scary at first for me, too.”
Daylen rolled his eyes, uncomfortable with how much had been kept from him. “Any other surprises I should know about?”
“Other than dying young and the whole defeat-the-Blight-alone thing? No, I’m all tapped out for surprises. Anyhow, you’re up now, right? Let’s pull up camp and get a move on.”
Daylen nodded, and Alistair began breaking down his section of the camp. Turning around, he almost ran into Leliana. “Oh, hello there. Almost didn’t see you.”
“Well, here I am,” she replied brightly. “Something you wanted to talk about?”
“What would someone like you be doing in Lothering’s chantry?”
“What is meant by ‘someone like me’?”
“They don’t teach you to fight like that in the cloister,” Daylen said. “Do they?”
“Did you think
| 512 |
s2orc
|
carried on conjugative plasmids and harbored by transmissible genetic elements such as insertion sequences and transposons that speed up their dissemination in bacterial community [17]. Quinolones and fluoroquinolones are broad-spectrum antimicrobial agents extensively used in poultry disease treatment. This widespread use has been associated with a worldwide increase in levels of resistance to such agents, especially in Gram-negative bacteria species in the past decade [18,19]. Globally, many serotypes of S. enterica have developed resistance to NA and reduced susceptibility to fluoroquinolones due to chromosomally mediated mutations in the quinolone resistance-determining regions of the DNA gyrase and topoisomerase IV genes that lead to target modification [20]. Recently, quinolone resistance was found in Salmonella to be mediated by the acquisition of plasmid-encoded genes (plasmid-mediated quinolone resistance [PMQR]), including qnr genes, efflux pump mechanisms (qepA and oqxAB), and fluoroquinolone-modifying enzyme (aminoglycoside acetyltransferase) encoded by the aac (6') Ib-cr gene [21][22][23]. Equally important, several researchers have detected qnr genes and ESBLs in the same bacterial isolates [22][23][24], this coexistence of resistance determinants may select for quinolone resistance and increase the prevalence of ESBL genes in the bacterial population [25][26][27]. In Iraq, the molecular characterization of PMQR and ESBL genes in Salmonella from broiler chickens has not been conducted. Therefore, the detection of such resistance genes has veterinary and medical importance to guide the implementation of surveillance and control programs, locally and on a national scale.
In the present study, MDR strains of NTS isolated from broiler chickens in Middle Euphrates region of Iraq were screened for PMQR (qnrA, qepA, oqxAB, qnrC, qnrB, qnrS, qunD, and aac(6`)-Ib-cr) and ESBL (blaTEM, blaSHV, blaCTX-M, and blaOXA) genes.
Material and Methods
Ethical approval
Fecal cloacal swabs were collected from broiler chickens as part of normal surveillance. The farm owners gave oral permission for their farms to be included in this study. No interventions were needed in this study, so there is no need for ethical approval.
Study period and location
This study was conducted from October 2017 to March 2018 in four Middle Euphrates Governorates (Al-Najaf, Al-Muthanna, Al-Qadisiyyah, and Babylon).
Bacterial isolates
This study only included chickens from broiler farms. A total of 40 NTS isolates were recovered from 37 flocks (five samples for each flock, 185 samples total) that belong to 28 broiler farms. Briefly, all NTS isolates were incubated by enrichment method and subcultured onto a chromogenic medium (CHROMagar Company, Paris, France). Next, suspected colonies were identified by Gram staining; biochemical identification using Simmons citrate, triple sugar iron, urease, and lysine iron agar tests [28]; and invA gene amplification by polymerase chain reaction (PCR), as previously described [29,30]. Isolates were then stored in Luria-Bertani (LB) broth (Oxoid, UK) with 15% glycerol at −20°C. Frozen isolates were thawed and streaked on CHROMagar Salmonella agar (CHROMagar Company).
Antimicrobial susceptibility testing
Measurement of the antibiotic susceptibility of NTS isolates was performed by the standard disk-diffusion method in Mueller-Hinton agar (Himedia, India) in accordance with guidelines recommended by Clinical and Laboratory Standards [26]. Antimicrobials tested were ampicillin (AMP, 30 µg), amoxicillin/ clavulanic (AMC, 20/10 µg), CTX (30 µg), ceftriaxone (CRO, 30 µg),
| 512 |
Gutenberg (PG-19)
|
whirlwind free;
O'er sea and land, and foreign strand,
Who would not a wanderer be!
"To the far off scenes of our youthful dreams
With a lightsome heart we go;
On the willing hack, or the charger's back,
Or the weary camel slow."
Thus sang the wayfarer to himself as he urged a potentially willing, but
certainly very tired hack along the stony, sandy road which wound
gradually up the defile; now overhanging a broad, dry watercourse, now
threading an expanse of stunted juniper--the whole constituting a most
depressing waste, destitute alike of animal, bird--or even insect--life.
The wayfarer sang to keep up his spirits, for the desolation of the
surroundings had already begun to get upon his nerves. He was
thoroughly tired out, and very thirsty, a combination of discomfort
which is apt to get upon one's temper as well. His steed, a sorry
quadruped at best, seemed hardly able to put one leg before another,
wearied out with a long day's march over arid plains, where the sun
blazed down as a vast burning-glass upon slabs of rock and mounds of dry
soil, streaked white here and there with gypsum--and now the ascent,
gradual as it was, of the mountain defile had about finished both horse
and rider.
Twice had the latter dismounted, with a view to sparing his worn-out
steed by leading it. But the exasperating quadruped, in shameful
disregard of the superabundant intelligence wherewith popular
superstition persists in endowing that noble--but intensely stupid--
animal the horse, flatly refused to be led; standing stockstill with
every attempt. So his efforts in the cause of combined humanity and
expediency thus defeated, the wayfarer had no alternative but to keep
his saddle, where, sitting wearily, and with feet kicked limply from the
stirrups, he now and then swung a spur-armed heel into the bony ribs--
which incentive had about as much effect as if applied to an ordinary
jog the while he went on half singing, half humming, to himself:
"There's a charm in the crag, there's a charm in the cloud,
There's a charm in the earthquake's throe;
When the hills are wrapt in a moonlit shroud
There's a charm in the glacier's snow.
"We bask in the blaze of the sun's bright rays
By the murmuring river's flow;
And we scale the peak of the mountain steep,
And gaze on the storms below.
"For use around a snug camp fire, that would be an excellent traveller's
song," said this one to himself--"But in the present instance I fear it
will be `gaze on the storms _above_,' and I don't like it."
Away up the pass a dark curtain of cloud, ominous and now growing inky
black in the subdued light following upon sunset, seemed to justify the
wayfarer's foreboding. It was distant enough as yet, but hung right
over what would surely be the said wayfarer's path.
"No, I don't like it," he went on, talking out loud to himself as he
frequently did when travelling alone. "It looks very like a night in
the open; nothing to eat,
| 512 |
gmane
|
you want to add that lacks some schema component: location-less
features, etc. Using an organism called "all organisms" or
computed organism, or what ever is most appropriate is valuable
added information (or call it "null").
- Don
Hi (this has got noobie all over it),
I have set up Mandrake 10 with DHCPD. The clients are Windows XP and
get an IP number correctly. When I try to resolve names/IP from the XP
clients everything works OK. But when I try to resolve names from the
Linux server it can't find the XP clients.
The dhcpd.leases file has the client host names correctly. I havent
set up NAMED yet, do I need this to make it work properly? Can the
DHCPD do local host name resolutions? Is ther a simple NAMED (BIND)
howto that explains how to get DNS to server local network addresses
and cache the internet addresses?
Thanks
Dear all,
Did anybody of you tried etching glass 7740 wafer? I want to etch it through
and the thickness of the wafer is 0.5mm. Can I use HF to etch it? what kind
of PR or film can be used to be etching mask? And how long will it take?
Thank you in advance.
Best regards,
Lanzy
Hello,
I´ve rebuilt the libjitsi.jar using 283 source code removing the MJPG
support in the directshow protocol.
Using this jar everything works as expected.
I guess the current windows binary (at least x86) of jndirectshow.dll from
release 282 and 283 doesn´t match the source code.
Maybe the jndirectshow.dll wasn´t rebuilt when adding MJPG support?
Cheers,
René
"Competing visions of agrarian reform" is a title that can stand by
itself, is actually a part of the title or subtitle (including spine
title, etc.) and still refers directly and appropriately to the book or
item. In the case of the second 246 below, I would view that as
incorrect, because the item is not "American Modernism", it is a
"Companion to American Modernism".
Dru Edrington
Librarian IV
Public Utility Commission
1701 N. Congress Ave.
Austin, TX 78711-3326
512-936-7075
I have a form where the user enters a date into a text input field. I need
to convert this text to a date and put it in a field in a mySQL database.
Is there an easy way to do this? Do I have to tear the string appart and
create a date out of the parts? Someone must have a fiunction that will do
this work already right?
Thanks for your help
- Anthony
Is there anyway to have Squid parse an html document that has been requested
and begin downloading any inline images under the assumption that they will
be requested? I think it would help speed up slow or high traffic websites.
Not?
I work for an ISP and we get complaints that Ebay is slow at times. I just
wandered if if something like that would help. Not even sure where the
bottle neck is at though.
Matt
As Anne-Marie asked me to post a quick example of how to use QPicture to
display SVG
| 512 |
reddit
|
other people. He doesn't have to play to a passive crowd, but instead has a more active participant/partner to bounce off of.
Get an FM transmitter! I have an 05' Camry and it plugs into the power outlet. You find a low station that's just static and then you set the transmitter to that station and plug the aux cord into your device and it plays over the radio. You do get static occasionally, especially on the interstates, but its a cheap alternative to have an aftermarket radio installed.
Dude I feel you, I'm the same way. What I've found works for me are either jump rope intervals with a weighted jump rope, or prowler sled pushes. If I run 8 sprint with the prowler sled, 20sec on 90sec off, I'm completely gassed and know I got my cardio in. I don't know what kind of equipment you have access to, but if there isn't a prowler, flip a plyo box upside-down, set it on a towel, put 3 45lb played in it, push. Search conditioning for power lifters and strongmen. There are a lot of things you can do that aren't as boring as running.
Hey akali (top) main here, here's how i'm setup : runes : Hybrid pen Mars, Armor/lvl seals, cdr/lvl glyphs, AP quints Masteries : 23/5/2 build : Always start with either boots-4 or cloth-5 depending on the matchup, then rush hextech revolver unless you're against a riven/pantheon where you need an early seeker to survive. The sooner you complete your gunblade the better. Then Deathcap/zonhyas -> Negatron (you'll probably need that) ->deathcap/zonhyas -> void staff -> Ga/banshees. Get cdr boots whenever you want to, just get them (unless you really need tenacity) Laning: Early laning sucks, you'll loose almost every matchup unless you're able to get a double Q proc trade so just focus on getting as much CS and xp as possible. Once you're 6 you'll ideally want to back, buy, get charges and come back to lane to cheese. In lane, throw a Q and then wait 5 s, then just Ult+E+Q+AA+finish him off. Congratz you just got a kill, now you snowball, it works 95% of the time since people don't know akali. gg if you know how to roam and your team isn't too far behind.
For about the last six years my birthday comes and goes without notice to any one other than my grandmother. The last few birthdays when I had a boyfriend, they always seemed to really screw up my birthday for some reason. I spent my 24th birthday in New Zealand (American). I only had a few friends - my boyfriend of a few months and my best work mate. My boyfriend and I at the time had little money, however, when I woke up in the morning I had breakfast in bed and a present waiting for me. He had bought me a pearl bracelet and a pearl necklace. I couldn't figure out how he afforded it. I later found out he pawned his camera for cash. That night we
| 512 |
Gutenberg (PG-19)
|
in a high wind, for even in the most gusty storms there is no
whipping action. In the longer spans, the cables hang absolutely parallel
and sway in a most deliberate manner from 12 to 25 feet out of line.
[Illustration: HARTWELL NO. ONE.]
[Illustration: DETAIL OF DERRICK CONSTRUCTION.]
Inasmuch as fuel economy is of little importance, since either waste
gas or oil can be used, a large drop in the distributing system is
permissible, and a radius of three or four miles from the power-house
can be economically attained by the use of 210 to 250 volt lamps on the
three-wire direct-current system. At present the maximum distance is 255
miles, and four voltages of lamps are employed. The derricks are wired on
the two-wire system with No. 14 T. B. W. P. medium, hard-drawn wire, care
being taken to keep all wires on the outside of derrick house wherever
possible. Although the wires and insulators have been in some cases
completely sprayed and saturated with oil from the gushers, no troubles
of insulation have been experienced.
At the time this work was started, there was a small plant on the Pinal
Oil Company’s property near by, where keyed sockets were used until one
of the drillers was injured by a gas explosion caused by turning off
one of the lights. This, of course, suggested the care necessary to
guard against such accidents. In the present installation, double-pole
fuses were constructed for each derrick and tank house, by using two
weatherproof sockets and Edison plug fuses, all inclosed in a gauze
cylinder like a Davy mine lamp. Switches for tank house and derricks
were also inclosed in gauze. In wiring the derricks, sleeves were used
for splicing, so that in the whole system no solder nor torch was used.
Specially designed heavy wire lamp guards and portables, with wires
inclosed in cotton-covered garden hose, are other features of the derrick
wiring. When drilling is commenced, the derrick is wired for eleven
lights. Tank houses, some fifteen or twenty in number, are wired with a
light over each tank.
[Illustration: POWER-HOUSE.]
The power-house is of only passing interest, being designed for
reliability and minimum first cost, and with the idea of transplanting
it to some new location should future conditions dictate. The view shows
two 10×10 Shepherd engines, clutched to either end of a shaft, from which
two 45-kilowatt, 250-volt, direct-current Westinghouse generators are
belted. In case of accident to one generator, a switch on the switchboard
converts the 3-wire to a 2-wire system, using the two outside wires as
one, and the neutral as the return conductor. Three 48×14 fire-tube
boilers supply steam at 125 pounds pressure. The power-house is in a
perennially cool location on a hill crest, so that it could be made small
and cozy.
The system has been in uninterrupted and satisfactory operation for
two years. The only trouble during the time was caused by one wire of
one span breaking, due to an imperfection in splicing. The section has
long-continued and severe winds, much rain and
| 512 |
Github
|
and the algorithms that work with them must limit their assumptions to the requirements provided by that type of iterator. It may be assumed that an input iterator may be dereferenced to refer to some object and that it may be incremented to the next iterator in the sequence. This is a minimal set of functionality, but it is enough to be able to talk meaningfully about a range of iterators `[First, Last)` in the context of the class member functions.
### Constructors
|Constructor|Description|
|-|-|
|[hash_map](#hash_map)|Constructs a `hash_map` that is empty or that is a copy of all or part of some other `hash_map`.|
### Typedefs
|Type name|Description|
|-|-|
|[allocator_type](#allocator_type)|A type that represents the `allocator` class for the `hash_map` object.|
|[const_iterator](#const_iterator)|A type that provides a bidirectional iterator that can read a **`const`** element in the `hash_map`.|
|[const_pointer](#const_pointer)|A type that provides a pointer to a **`const`** element in a `hash_map`.|
|[const_reference](#const_reference)|A type that provides a reference to a **`const`** element stored in a `hash_map` for reading and performing **`const`** operations.|
|[const_reverse_iterator](#const_reverse_iterator)|A type that provides a bidirectional iterator that can read any **`const`** element in the `hash_map`.|
|[difference_type](#difference_type)|A signed integer type that can be used to represent the number of elements of a `hash_map` in a range between elements pointed to by iterators.|
|[iterator](#iterator)|A type that provides a bidirectional iterator that can read or modify any element in a `hash_map`.|
|[key_compare](#key_compare)|A type that provides a function object that can compare two sort keys to determine the relative order of two elements in the `hash_map`.|
|[key_type](#key_type)|A type describes the sort key object that constitutes each element of the `hash_map`.|
|[mapped_type](#mapped_type)|A type that represents the data type stored in a `hash_map`.|
|[pointer](#pointer)|A type that provides a pointer to an element in a `hash_map`.|
|[reference](#reference)|A type that provides a reference to an element stored in a `hash_map`.|
|[reverse_iterator](#reverse_iterator)|A type that provides a bidirectional iterator that can read or modify an element in a reversed `hash_map`.|
|[size_type](#size_type)|An unsigned integer type that can represent the number of elements in a `hash_map`.|
|[value_type](#value_type)|A type that provides a function object that can compare two elements as sort keys to determine their relative order in the `hash_map`.|
### Member functions
|Member function|Description|
|-|-|
|[at](#at)|Finds an element in a `hash_map` with a specified key value.|
|[begin](#begin)|Returns an iterator addressing the first element in the `hash_map`.|
|[cbegin](#cbegin)|Returns a const iterator addressing the first element in the `hash_map`.|
|[cend](#cend)|Returns a const iterator that addresses the location succeeding the last element in a `hash_map`.|
|[clear](#clear)|Erases all the elements of a `hash_map`.|
|[count](#count)|Returns the number of elements in a `hash_map` whose key matches a parameter-specified key.|
|[crbegin](#crbegin)|Returns a const iterator addressing the first element in a reversed `hash_map`.|
|[crend](#crend)|Returns a const iterator that addresses the location succeeding the last element in a reversed `hash_map`.|
|[emplace](#emplace)|Inserts an element constructed in place into a `hash_map`.|
|[emplace_hint](#emplace_hint)|Inserts an element constructed in place into a `hash_map`, with a placement hint.|
|[empty](#empty)|Tests if a `hash_map` is empty.|
|[end](#end)|Returns an iterator that addresses the location succeeding the last element in a `hash_map`.|
|[equal_range](#equal_range)|Returns a pair of iterators, respectively, to the first element in
| 512 |
reddit
|
only edit to the footage I did was lengthening the video by 50% in Gopro Studio. Next time I film a night time lapse I'll be pointing the go pro to the west end of the sky rather than the east. The town is east of my location which was creating the toxic light.
I wish I looked more childlike, as that is the ideal here. Women here have almost no ass compared to me. Mine is so disproportionately huge. Like I am a 30-23-36 and that giant butt and my thick thighs make me angry. I don't want to look like a woman tbh. Plus, pants come in only 4 sizes here, and it makes me feel fat to have to wear a size L (Large).
I saw your [tweet](https://twitter.com/nickjgraves/status/471570114735652864) saying that you were going to stay up to finish this after reading his [blog post](http://urealms.tumblr.com/post/87086102047/getting-caught-up). Very awesome of you to do that, and that art is stellar. EDIT: In addition, everyone should read that blog post of Rob's. It really puts into perspective how hard he works for our laughter and entertainment and was super inspiring to me.
That was my attitude when I owned a PC as well, but I've found working on Mac provides more stability (i.e. less cryptic error messages, programs freezing up) and generally a better workflow (easier to drag and drop and bounce between applications quickly). Ultimately, this is a fairly subjective issue, but I definitely would not go back to PC for doing graphics work.
Man, after seeing that i felt so bad lol. And super regretful, because I saw Chloe once in LA at the mall, and my sister and I were like in gleeful surprise, but we were too shy to approach her and we didnt want to bother her cus I think she was with her brothers, and ya know, we wouldve felt dickish just going up to someone when they were spending time with their family. But now I'm thinking we shouldve, she might have appreciated it lol
Hey Monero developers and community! We are Guarda, a team working on developing a new generation of secure mobile light wallets. We would be really excited about working with Monero, but haven't received any feedback from core developers upon sending personal emails about collaboration. We believe Monero community could really benefit from a tailor-made mobile app and would be happy to discuss the details with a member of Monero Team. Hoping to hear back or to be directed to a proper communication channel!
That could very well be, but with a 1.3 K/D i dont think so to be honest. Before the game i played him i joined one where he was already at 19 kills when i loaded in and he won it with a big lead to the second guy so he probably isn´t bad either, just mad.
If you don’t get the definition of a term from a dictionary, then how are you defining a gun. Okay, let’s say you’re defining a gun by other means then by your logic I should be able
| 512 |
s2orc
|
therapeutic hypothermia and/or cooling therapy in patients with acute traumatic brain injury. The SRs were published within a small range of time (15 years) and included 0 to 37 RCTs. Two of the included SRs 21,26 were judged as having an overall high confidence in the results, with none of the AMSTAR-2 items judged as inadequate.
The methodological quality assessment was very limited in more than half of the included SRs, as 53.3% had critically low overall confidence in the results and 13.3% had low overall confidence in the results. Additionally, critical items were judged inadequate, frequently. Item 1, related to the objective and the research question developed was judged adequate in only 40% of the SRs. Moreover, the transparency and
Visualizing Information Bottleneck through Variational Inference
Cipta Herwana [email protected]
New York University
New York University
Abhishek Kadian [email protected]
New York University
New York University
Visualizing Information Bottleneck through Variational Inference
The Information Bottleneck theory provides a theoretical and computational framework for finding approximate minimum sufficient statistics. Analysis of the Stochastic Gradient Descent (SGD) training of a neural network on a toy problem has shown the existence of two phases, fitting and compression. In this work, we analyze the SGD training process of a Deep Neural Network on MNIST classification and confirm the existence of two phases of SGD training. We also propose a setup for estimating the mutual information for a Deep Neural Network through Variational Inference.
Introduction
Deep Neural Networks (DNNs) have found wide application on large-scale tasks like visual object recognition (Krizhevsky et al. [2017]), machine translation (Wu et al. [2016]) and reinforcement learning (Silver et al. [2016]). The success of DNNs in many areas has led to a growing interest in trying to explain their performance. Tishby and Zaslavsky [2015] proposed to analyze DNNs through the Information Bottleneck lens. Shwartz-Ziv and Tishby [2017] analyzed the information plane of a small neural network on a toy problem and reported two phases of a neural network trained using SGD, fitting and compression. In our work we test the hypothesis of Information Bottleneck theory for Deep Learning on a tougher problem of image classification.
For our experiments we need a way to estimate the mutual information between the input and the output of a hidden layer. Alemi et al. [2016] proposed a variational approximation to the Information Bottleneck. We also build upon the Variational Autoencoder derivation (Kingma and Welling [2013]) to propose an alternative MI upper bound for a teacher-student model.
We use the variational estimates to test the Information Bottleneck hypothesis of two phases of DNN training, fitting and compression. We find that the two phases are present in the training of a 4 layer DNN on MNIST classification task. Our results show that the claims of Information Bottleneck theory about Deep Learning hold true for a deep VIB network.
Our paper begins with a discussion of Information Bottleneck theory and it's application to analyze DNNs (section-2). In section-3 we define the classification problem and leveraging variational inference to calculate mutual information. We also derive the mutual information upper bounds
| 512 |
ao3
|
your way a scrape here, slash there, so you can retrace your steps or someone can follow more easily. Ants! Did you know that ants won’t cross a line drawn in chalk? Stops them in their tracks and they turn away.
Then there's the sound chalk makes against the board, even the smell.
The thing is try and describe the smell of chalk, it’s distinct, but ask someone to describe how it smells, and they struggle to put it into words.
The feel of it is easier the fine dustiness, like silk against your skin, permeating every fold, crease and pore as it clings to you like another layer. A layer that marks everything you touch.
But Ian Edgerton, FBI agent, sniper, tracker, instructor, he can tell you what chalk smells like.
Earthy... natural, that’s how Ian would describe the smell of chalk, not the harsh chemical smell of whiteboard markers.
Chalk to Edgerton is Professor Charles Eppes.
The smell and marks always mean Charlie, his hands covered in that fine layer of dust, even when he used a chalk holder, you can still see where he had been, what he had touched, dust in his hair from where he run a hand, a smudge on his chin, the pen on his desk, the collar of his jacket... more important to Ian, was the rainbow of colors Charlie would leave on his skin, white, yellow, pink, green, marking where he touched him.
Dust on his hips as Charlie held him as his cock slipped between eager lips, to swallow him down, as he worked him like he was new mathematical equation that he had yet to fully test.
Dust in Ian’s hair and on his shoulders when their roles were reversed, until Charlie finally lost control coming down his throat, and Ian would swear he tasted like salt and chalk.
The marks Ian loved seeing most were on the sheets where Charlie fisted his hands as he bowed his head, tilted his hips, spread his knees a little wider as he begged Ian for more to take him deeper, harder, until the only noises he was making were the husky moans and gasps that filled the air like fine particles chalk dust...
Ian missed chalk.
“Sir, may I help you?”
Ian turned his head to see a young shop assistant, with a perplexed look on her face, “Um yes, do you have any chalk that isn’t dustless?”
The girl, her name tag said Dessi, actually blinked. “Not dustless?”
Ian nodded.
“We might have some old stock out back, would you like me to look?”
Again he nodded, “Yes, thank you.”
**~*~**
Charlie closed his office door behind him, sometimes he hated being the Chair of the Mathematics Department, budgets, faculty meetings, but at least now he had a real say in how things were done, the curriculum, helping to mold the young minds of the future.
Tonight he just wanted to go home have dinner with his dad maybe Don had come over to watch the game, a good bottle of wine,
| 512 |
reddit
|
and work.
Hello reddit !!!!, today I'm looking for arab ladies , for I'm an arab myself and having rp's with people from around the world is great , but it never hits home, so that's what I want to do today an rp with an arab lady kinks:dry humping ,ageplay , romance, incest and slow burn , and many others limits:scat, non con , blood, watersports,bdsm, rape you can message me anytime :) I hope to hear from you soon !!!!!
If you are interested in understanding more, here is some background information which you should look at before deciding what's really happening with the latest "Russia hacking" timeline. Rather than starting with Wikileaks or Guccifer 2.0 which I'm sure some may have doubts about authenticity, why not start with official FBI releases and interview transcripts. Read the **FBI release** on Clinton's email server, specifically [p. 56 in the Part 4 of 6 release](http://web.archive.org/web/20170203160045/https://vault.fbi.gov/hillary-r.-clinton/hillary-r.-clinton-part-04-of-06/view). The FBI have since [removed the documents from their website](https://vault.fbi.gov/hillary-r.-clinton/hillary-r.-clinton-part-04-of-06/view) and [Wikipedia deleted the article on the 7th Floor Group](https://en.wikipedia.org/wiki/Wikipedia:Articles_for_deletion/7th_Floor_Group) several days after its creation. Here is [an article](https://wearechange.org/who-wikipedia-fbi-deletes-7th-floor-group/) outlining what happened. 17th February 2017, the 7th Floor staff [were disbanded by the Trump administration](https://www.mintpressnews.com/rex-tillerson-purges-remnants-of-shadow-govt-at-state-department/225066/) by newly appointed Secretary of State, Rex Tillerson. This was the beginning of "draining the swamp". [New FBI Hillary Clinton Email Documents: 5 Fast Facts You Need to Know](http://heavy.com/news/2016/10/hillary-clinton-fbi-emails-investigation-private-server-crimes-indicted/) Be warned, it really is a rabbit hole.
Haha, what? >Teenagers kill themselves over intense media all of the time where the hell are you getting this 'fact' from? I found solace in 'intense' media that reflected what I was experiencing, it was actually enlightening and meaningful for me to find thoughtful, honest literature and movies about adolescence and/or childhood - I have never heard of someone killing themselves because a book was too intense exploring these emotions and thoughts with literature can be one of the best things you can do for your personal growth it is so condescending and strange to say that teenage brains cannot handle it. a growing (or fully matured) brain will always benefit from varying perspectives.
I remember my dad picking me up (not easy as he's around 50 and I'm 18) when we tied it up and he ended up hurting his back and then I remember going to give him a hug when aaron scored the winner and I ended up tackling him into the sofa which ended up breaking. It was my little brothers birthday and he had a party but neither my dad or myself went, it was a pretty destructive day in my house but still one of the best days I could remember.
They wanted to get the game out and they didn't want to put more money into an openGL/UNIX port. It always comes down to money. It's not like it's just impossible to write graphics for osx. It's just different than windows (but the same as Linux!). From a business perspective it probably just wasn't worth it.
Why exactly? This is such an US-centric view. I actually know it only because of
| 512 |
s2orc
|
kettle, and be a chamber of steam-water distillation when steam filter was put in the kettle.Samples were directly contacted with water inside kettle during heating in hydrodistillation process, while in steam-water distillation, samples were steamed in the same kettle and contacted with hot water vapours only. Each distillation process employed 2 kg of cananga flowers with the amount of water as much as 20 L. Steam-water distillation required maximum of 2 hour distillation to avoid an empty kettle since water was run out after 2 hours. Hydrodistillation method was run for longer time of distillation up to 3 hours since water still presented in kettle at the end of distillation.
Cananga essential oil was separated from aqueous phase in distillate using separatory funnel. Cananga oil was presented in upper layer (organic phase), while lower layer contained aqueous phase which commonly called as cananga water. Cananga oil was then added for a few of magnesium sulfate anhydrate to absorb water residues left in the oil. Further, this cananga oil was subjected on chemical analysis using GCMS (Gas Chromatography Mass Spectrometry).
Results and Discussion
Hydrodistillation of cananga flowers resulted in cananga essential oils with percent yield of 0.33% (1 hour), 0.46% (2 hours), and 0.67% (3 hours), while steam-water distillation for 2 hour process has produced 0.60% of cananga oil. Previous research by Ferdiansyah et al [24] showed that eight hour steam distillation of cananga flower results in 1.95% of cananga oil, while Rachmawati [23] also obtain 1.066% of cananga oil from similar process to Ferdiansyah et al [24]. Quality of those cananga oils were analyzed based on their chemical compound compositions using GCMS [14,15,21]. Based on previous research by Buccellato [3] and Ekundayo [13], it was mentioned that high quality of cananga oil relies on the content of esters and its marker compounds, such as methyl benzoate and benzyl acetate, two dominant esters in cananga oil, and also β-linalool. Table 1 listed the number of chemical compounds together with their percentages presented in cananga oils. Some esters presented in these cananga oils were methyl benzoate, benzyl acetate, benzyl salicylate, geranyl format, benzyl benzoate, and geranyl acetate (as major esters). Therefore, it can be summarized in Table 2 that one hour and two hour hydrodistillation contained 32.88% and 22.36% of esters, respectively, while in two hour steam-water distillation contained only 19.60% of esters. Interestingly, β-linalool could be obtained in significant amount only from steamwater distillation method as much as 8.89%, while from one hour hydrodistillation obtained only for 0.17%. No β-linalool can be found in cananga oil resulted from longer time of hydrodistillation processes.
It also can be seen from Table 2 that oxygenated hydrocarbons were much higher in hydrodistillation for an hour process (56.14%), and were reduced significantly in a longer time of distillation processes (two hours and three hours). Steam-water distillation for 2 hours brought about 42.75% of oxygenated hydrocarbons which much higher than hydrodistillation product in similar time of distillation process. Oxygenated hydrocarbons content was important to know since it was responsible for bioactivity of cananga oil.On the other hand, non-oxygenated
| 512 |
s2orc
|
1979), Pringsheim's Medium (Pringsheim, 1946), Allen and Arnon Medium (Allen and Arnon, 1955) and Chu's 10 Medium (1942).
Results and Discussion
Effect of culture medium on Blue Green Algal flora
All the three culture medium was tested for growth of blue green algae and observed that the all culture medium supported better growth of BGA during investigation.
The average numbers of Blue Green Algal colonies isolated using different culture media are presented in table 1 (a, b, c and The data also indicated that the soils analyzed were rich in Blue Green Algal population. This study also indicated the role of different culture medium for isolation. The above study reveals that the paddy field of Gondia district were rich in Blue Green Algal isolates. Tiwari (1972) studied the Blue Green Algal flora of various satates of India and recorded more number of Algal floras in culture condition compared to natural condition. Gajbhiye (2010) reported maximum growth of BGA in BG-11 medium followed by Bristol's and Fogg's medium. Latha Madhavi (2014) observed the highest number of algal colonies in modified Bristol's medium followed by Beneck's and Tamiya's medium. BG-11 medium supported the growth of Lyngbya bipunctata properly and Allen and Arnon medium also supported the growth after 20 to 25 days while Fogg's and Zorrouk's medium supported the growth at very low rate (Nehul, 2014). Variation in the culture medium supporting the growth of Blue Green Algae have been reported by Sharma and Kerni (1992), Nehul (2014) and Das and Sharma (2015).
d). Total six culture medium were used for isolation Blue Green Algal colonies and recorded the observation at interval of 15, 30, 45 and 60 days after inoculation. The other media used recorded moderate number of Blue Green Algal colonies whereas Fogg's medium (12.49, 21.04, 28.94 and 39.56) was least preferred for the growth of BGA. Out of eight taluka Sadak Arjuni (33.54) harbours highest colonial growth at 15 DAI followed by Salekasa (31.23) and Deori (31.57) taluka while lowest colonies observed in Tirora (22.14). The data indicated that different soils exhibited variation in Blue Green Algal Population.Among the media used the highest number of
algal colonies were found in Allen and Arnon
medium (42.09, 45.56, 47.02 and 48.51) at 15,
30, 45 and 60 days after inoculation followed
by Modified Bristol's medium (33.54, 45.55,
46.37 and 47.69) and Pringsheim's medium
(32.76, 40.45, 43.41 and 47.19).
Table . 1
.(a) Number of Blue Green Algal colonies on different algal media at 15 DAISr.
No.
Sampling
sites
Number of Blue Green Algal colonies on different media/ g
Total mean
Modified
bristol
medium
Fogg's
medium
BG-11
medium
Pringsheim
medium
Allen
and
Arnon
medium
Chu's-
10
medium
1
Salekasa
36.83
10.52
29.25
39.78
47.36
23.67
749.72 31.23
2
Deori
39.46
21.04
30.25
34.2
42.1
22.36
757.76 31.57
3
Amgaon
27.62
11.84
28.94
38.15
42.09
28.94
710.38 29.59
4 Goregaon
35.51
15.78
27.62
32.89
42.1
27.62
726.17 30.25
5
Gondia
35.52
7.89
38.15
34.25
46.04
22.36
736.9 30.7
6
Tirora
26.31
10.52
24.99
19.73
32.89
17.09
531.46 22.14
7
Sadak
Arjuni
42.1
17.1
31.57
38.15
| 512 |
Pile-CC
|
(including nearly six in ten Republicans) found convincing the counter argument that this is not realistic. Asked how likely it is that the other permanent members of the UN Security Council would agree to this plan, a majority said that it was not likely. Asked how likely it is that Iran would agree to return to negotiations and make concessions, eight in ten said it was not likely.
The argument for using military threats against Iran to give up its nuclear enrichment program and allow anytime/anywhere inspections was found unconvincing by a modest majority, while the argument against it was found convincing by more than seven in ten. Eight in ten thought it was not likely that Iran would capitulate in response to such threats.
After considering the various arguments and options, panelists reassessed the options separately. Approving of the deal was found slightly more acceptable or tolerable, and not approving of the deal slightly less so.
Panelists were finally asked whether they would recommend that their Members of Congress approve of the deal. Those that did not recommend approval were offered other options. Ultimately 55% recommended approval, including 72% of Democrats, 61% of Independents and 33% of Republicans. Twenty-three percent recommended ramping up sanctions, 14% seeking to renegotiate the deal, and 7% using military threats.
Peru’s Central Bank Warning: Will it Affect South America’s Cryptomarket?
Some South American countries have widely accepted the use of cryptocurrencies more than others. The cryptomarket growth in this region has been linked to the need for citizens to find ways to make ends meet. Peru has experienced an increase in the use and trading of virtual currencies and is positive about its prospects.
However, the Central bank in Peru has warned that cryptocurrencies, due to their unpredictability and unstable nature, are risky for investors. The bank outlined that the value of virtual currencies is not based on tangible assets, but on the trust of individuals, hence their uncertainty.
The bank also noted that virtual currencies are used in illegal activities such as terrorism, money laundering and are also vulnerable to fraud. But how is this warning likely to affect the growth of cryptocurrency market in Peru and South America in general? Qupon‘s CEO, Joseph Oreste holds that government warnings against cryptocurrencies could capture the attention of academicians.
He says, “With regard to price stability, perhaps there will soon be some initiatives by academia to publish articles on how to stabilize cryptocurrencies. As with all currencies, how to deter fraud and criminality without inhibiting the flow of commerce will be an important challenge for regulatory bodies to manage within the decentralized crypto community.”
The Reactions
But this is not the first time warnings against cryptocurrencies have been issued by governments. Over time, various central banks in different countries have issued warnings in regard to cryptocurrencies. These warnings are mostly necessitated by fluctuations of virtual currency prices that cause regulatory authorities to be concerned.
The warnings, according to financial institutions are aimed at preventing the use of digital currencies in illegal activities, safeguarding investors and users from
| 512 |
reddit
|
say a special on processed ham (yea it's not steak, but it works well for sandwiches when you're hungry) buy say 3 pounds at whatever thickness suits you (I usually go thinner) and ask for them to separate them in 1/2lb to 1lb bags (depending on how fast you use up the meat). When you get home freeze all but one bag. Frozen meat will keep fairly well and you save money really well.
I've don't use Facebook and I hate how they infested so many web pages with their 'like' shit; but I'm not getting the prevalent end of the world attitude here... so now there's some big money behind it... If they stay focused on the tech what's the big deal? Why the doom and gloom?
I highly recommend working on throwing and running, with some plyometrics in there too, hills, piles of short sprints are good. Throwing practice will make the best gains to your game though. Disc golf is good too, helps with power and edge control. A pretty quick workout I like to do is called terrible 20's - I put 2 cones 50 meters apart, do 20 push-ups, run to the other cone and do 19 sit-ups, 18 push-ups, 17 sit ups etc. down to zero. Time how long it takes you and go for speed. If you want to do physical type workouts, look up cornerback and wide receiver drills and training programs - those guys move pretty well.
I'm a staunch gay marriage supporter, but how can you compare buying food and supporting a company that is against gay marriage with a group of terrorists that raped, pillaged, and murdered millions of people for decades. I agree that their is a cognitive dissonance by the fact that they got civil rights and don't care to give it to others. You only sound like an asshole when you make inane comparisons like that. Signed a black man with a slew of gay friends and relatives.
"Let us consult the Book of Armaments, chapter two, verses nine through twenty-one. And the Lord spake, saying, 'First shalt thou take out the Holy Pin. Then shalt thou count to three, no more, no less. Three shall be the number thou shalt count, and the number of the counting shall be three. Four shalt thou not count, neither count thou two, excepting that thou then proceed to three. Five is right out. Once the number three, being the third number, be reached, then lobbest thou thy Holy Hand Grenade of Antioch towards thy foe, who, being naughty in My sight, shall snuff it.'"
I was gonna roast him after this game but I guess you can say I'm gonna take it easy since he made that game tying 3 before OT.. I hope I'm not the only one but I'm so over Barnes. Anyone else hoping some other team maxes him out and hopefully Lacob is smart enough to not match. If that's the case.. What SF's would you guys love to see to replace Barnes?
You’re very welcome. I was in the exact
| 512 |
StackExchange
|
would like to apply to a PhD program in France, but I am having trouble understanding the admission process. How should/could I submit my application?
Is it proper to contact the Professor I would like to work with and ask about any openings? If yes, what should I include in my mail?
I am only familiar with the admission process in US institutions.
A:
TL;DR: in France you have to find first the supervisor, then you apply for a funding. If you have a funding of your own, you have to find a supervisor to be admitted. In both cases : you need the supervisor first.
There is various things to know when you apply for a PhD in France :
It is forbidden to be a PhD without having funding. In France a PhD student is considered both as a student and an employee.
The funding can be a state funding, an industrial funding, a funding on a research contract (either from a national funding agency or a company), or you can also do your PhD while working elsewhere (some teachers in secondary schools are doing their PhD this way).
Industrial funding and research contract are basically given to the supervisor, who can choose alone amongst all candidates. So for PhD with those fundings you have to contact directly the targeted supervisors.
State funding is given by a committee to a bundle (candidate, subject), this means that a professor, with a subject, has to find a candidate and then propose to the committe this candidate on his subject. Then the candidate is on his own : (s)he will generally have to send an application letter, with a reference letter from the supervisor, and if (s)he is shortlisted, (s)he will have to make a short presentation (either on location or using skype or a similar service).
Last case: you are funded on your own (job, external funding for foreigners). Even in this case, the procedure is that you find the supervisor, then you apply.
A:
I'm a PhD candidate in France (economics) and yes, you can (and, in fact, must) contact a professor first. He or she will then direct you to source for funding and through the whole administrative process (the funniest part...).
Q:
Merge Two Dictionaries that Share Same Key:Value
I know this can be done with lists, but I'm just trying to figure out how to do this with dictionaries.
Basically, it'll go like this:
dict1 = {'a': 10, 'b': 12, 'c': 9}
dict2 = {'a': 10, 'b': 3, 'c': 9}
def intersect(dict1, dict2):
combinDict = dict()
....
print(combinDict)
{'a': 10, 'c':9}
So I only want the keys with the same value added into a new dictionary.
Any help?
A:
You want the intersection of the items:
dict1 = {'a': 10, 'b': 12, 'c': 9}
dict2 = {'a': 10, 'b': 3, 'c': 9}
print dict(dict1.viewitems() & dict2.items())
{'a': 10, 'c': 9}
For python 3 you just want to use items:
dict(dict1.items() & dict2.items())
dict1.items() & dict2.items() returns a set of key/value pairings that are common to both dicts:
In
| 512 |
goodreads
|
this universe who doesn't like this.
Here you go guys!--
Official Trailer!!
https://www.youtube.com/watch?v=4sewk...
Excerpt:
I'm exhausted. I don't even want to get out of bed, but today is Breyson's memorial service. I stand from the bed and look at my small figure in the mirror. I've lost weight from the constant pregnancy sickness and not being able to eat from the depression. I have done nothing but lay in the bed in his oversized tee shirt. My hair is dirty and I haven't showered since I got home from the hospital.
A knock sounds at my door and opens before I can respond. One look at me and Adalynn allows a tear to fall down her face. I haven't spoken with her or anyone else for that matter. "Why didn't you tell me?" One sentence and I know exactly what she's referring to. "Don't shut me out Kinzleigh. I can help you get through all of this, but only if you let me in."
I feel numb. Everything she says goes in one ear and out the other; nothing sticks. My energy has completely left me. I don't even have the energy to shower which is why I haven't. I feel like someone walked by, reached inside and removed my soul from the confinements of my body; leaving nothing but a shell. Tears have become an expectation on a regular basis. I don't even try to wipe them away anymore.
I just stare at her blankly; no expressions to give. She walks over to me and wraps me in her arms. Her outfit goes with the way I feel; black and dark; the symbolic color for death. "When did you find out?"
I don't want to think about the baby right now. I like pretending it's not there. "After we dropped Breyson off at the airport." I can't even say it without crying all over again. I still can't believe this has become my life. How am I supposed to go back to school or cheerleading? I'll never be happy again.
She tightens her hold around me. "I'll never tell anyone until you're ready. You know I'll help you right? You don't have to go through this alone; any of it. You're my best friend and you're family to me." I know she expects the Kinzleigh she knows and loves to come back at some point, but that girl is long gone; a vapor in the wind. All I can do is recluse inside myself and try to hold on to what little bit of sanity I have left. "Come on and I'll help you get ready. You need a bath."
As embarrassing as it was to have someone help you bathe, I can't seem to find the will to care. I guess times like these are when you discover who your true friends are. I pull on my long black maxi dress and a pair of sunglasses to hide my reddened eyes. I imagine to an outsider I look like I'm on drugs. Since I've been taking my nausea medication I
| 512 |
realnews
|
a Taser, authorities said. Shortly after he was subdued, the suspect went into cardiac arrest and died, authorities said. No officers were injured.
[email protected], 562-499-1305
News services contributed to this report.
DAYTONA BEACH — Despite winning Saturday night’s Coke Zero 400 at the Daytona International Speedway, Tony Stewart still isn’t a fan of the current rules package for the two restrictor-plate tracks.
He seems to be in the right place at the right time at Daytona and its sister track at Talladega, Ala., but he’s not sure why. It’s a mystery why he seems to miss all the big crashes. And when it comes to winning, he generally has the right strategy — even if he doesn’t fully understand it.
“I’m still voting for a figure-eight race here,” he said.
Stewart started 42nd after his car failed post-qualifying inspection. His team probably will be penalize for having an illegal air duct under the driver’s seat, but he turned the deficit into his fourth victory in the last eight summer races at Daytona.
Saturday night’s race was everything that’s good and bad about racing with restrictor plates. The plates are used at Daytona and the Talladega Superspeedway to reduce speeds for safety reasons. They also tend to bunch up the field, which usually leads to multi-car crashes.
Stewart’s biggest problem with the current rules is Saturday’s race was no different.
Matt Kenseth led a 30-car conga line for most of the first 200 miles. Drivers were content with putting as many miles behind them before making a move. The closer the race came to a conclusion, the crazier things got.
It started with a six-car crash shortly past the halfway mark. It continued with an eight-car crash a few laps later and a 14-car chain-reaction in the final 10 laps. Stewart drove around trouble in the first two crashes and was just ahead of the problems in the stretch drive.
Kenseth led the final restart with Roush Fenway Racing teammate Greg Biffle serving as his wingman. Stewart managed to pry them apart in the second turn of the final lap. The divide and conquer approach worked with Stewart pulling away in the final mile with Jeff Burton running second and Kenseth settling for third.
As the lead pack ran off the fourth turn, Biffle bumped Kevin Harvick’s car and that set off an 18-car crash at the finish line.
“I don’t even remember what happened that last lap,” Stewart said. “You know, it’s hard. I mean, it’s hard. The great thing about it is that 43 cars all have the same shot at winning the race. But that’s also part of what makes it frustrating, too.
“You know, it’s just being at the right place at the right time, and when those last two big wrecks happened we were in the right spot. We were ahead of them both times.”
NASCAR and fans didn’t like restrictor plate rules package a year ago because drivers grouped up in two-car tandems. Cars now have smaller radiators and front grilles to keep cars from running nose-to-tail.
| 512 |
goodreads
|
are my own. I am disclosing this in accordance with the Federal Trade Commission's 16 CFR, Part 55.
** spoiler alert **
This book fulfills the "comic written in the last three years" category of the Book Riot Read Harder Challenge-2 2016.
I enjoyed reading this book, but in retrospect, it left me with a sad feeling, like those Facebook posts that show your friends having a great time without you. I wonder why my life is like that, and then I realize, "Oh yeah, I have an illness." There ya go.
Taking the book on its merits, and not regarding it through the prism of my envy of the author's life, I can say it's a really good book about wedding planning, especially if you're going to DIY your own.
I enjoyed the writer's style of writing, and her drawings and text were well-executed and easy on the eyes. I don't read comics as a rule, but I might reconsider after reading this book.
This was a funny and upbeat peek into the world of wedding planning and pre-marital difficulties that made a positive impression on me. I would be interested in reading more books by this author.
Lucy Knisley addressed the issues bisexual folks have when describing their relationships to others, which I very much appreciated, since I've encountered similar experiences such as she describes. Ms. Knisley also had a conflicted experience in planning her wedding, since so many of the traditions and customs surrounding weddings are rooted in patriarchy and superstition. I liked the way she resolved this problem, by inventing traditions created with her fiance, and keeping some old traditions.
Great for girls (especially those who love superheroes!)
It's ok for a short story. Not many twists or turns though. Not sure what to think about this author. The story is mostly about 2 sisters who have inherited a pub in a small town and decide to fix it up.
Most of this is common sense or just silly tips. Some were helpful, but it is assumed that you know absolutely nothing about cycling. If you have been riding a few months or years, it will probably be pretty redundant to what you already know. If you have never ridden a bike before, it might have some good info.
I couldnt get past the written conversation... I tried though
Loved it but can't believe how fast I read it
This one was funny too!
I'm only giving this short 3 stars because this was quite a good story all the way up until that ending...
I'm just going to say it... What the fuck?? I mean really! Could you not give the reader just a little something more? Sorry but for me this was a big buildup to a total letdown. Way too many things left unanswered. That just sucks!
Unfortunately,One Day was the 1st book which I've completed in English...Poor pen,simple story
By this time if a reader is a follower of the alphabet series, one would already realize the pace at which Ms. Grafton tells her story. She has been very consistent so far from
| 512 |
ao3
|
But, with this under my belt, I think it'll be easier. So, let me know what you think, flame policy is located on my profile and will always stand in effect and thank you so much for reading!
>
> End Transmission
Jungkook let out a soft ‘oh’ as recognition shined through his eyes. He noticeably sagged. “Already? I thought we would wait a little longer.”
“I thought you wanted to tell them?” Jimin asked in confusion. He clearly remembered the younger saying it a while back.
“Well yeah. But that doesn't mean I'm looking forward to it. It's exhausting to think about.” Jungkook frowned and crossed his arms. “I think Taehyungie hyung and Jin hyung know mine has something to do with fire.”
“What makes you think that?”
“One time, I freaked out at the bakery because Tae-Tae hyung tried to make cupcakes in the microwave for “science purposes” and burned them. He left the metal spoon in the bowl and it made a small fire with lots of smoke. I saw all the smoke and Jin hyung had to stop me from crying so much. They never brought it up, but I can see how hesitant they are to bring me around fire now.”
Jimin didn't know about that incident happening but then again, he didn't know what Jungkook got into when he was with other pack members. “Maybe you should tell Yoongi hyung first. He’s the pack alpha and your mate. He has a right to know before everyone else,” Jungkook murmured.
“That wouldn't be fair to the others though,” Jimin immediately said. He wanted to tell them at the same time instead of picking and choosing someone. But he could definitely see where Jungkook was coming from. “You think so?”
The younger nodded. “He’s your boyfriend. Keeping him in the loop is important for your relationship.” Jimin paused. He made a small sound of confusion before turning his full attention to the bunny. He and Yoongi weren’t dating. Sure they kissed a lot. They cuddled every chance they got. Their pda was crossing the line between being friends and being in a relationship. Yet, they weren’t a couple.
Jimin blushed. “We aren’t dating, Bun,” he mumbled. It was embarrassing to say that out loud to his brother. They weren’t a couple and it put a damper on his mood. He didn’t realize that Yoongi never ask him to be his but now that he did, he felt a pang of hurt hit him. “He never asked,” he said to himself.
Jungkook’s head tilted in confusion and his ears twitched. “Does he have to? You guys already act like a couple. You’re always together and you kiss way too much. You scent him almost everyday and you talk even when you aren’t together. Hyung, you’re wearing Yoongi hyung’s hoodie but I doubt you even noticed.”
Jimin looked down at the hoodie and was surprised that he was, in fact, wearing the alpha’s hoodie. He couldn’t recall when he’d gotten it or how he didn’t notice it wasn’t his upon
| 512 |
YouTubeCommons
|
called has putter dr. Luke this monument is located next to the highway it is a complex of Hindu and Jain temple located on the west bank of malacca river in gagal district [Music] [Applause] [Music] since the previous day was too much of journey we got up late we checked out and we kept our luggage in the counter in the same hotel then we started the day with a nice breakfast [Music] the first place we visited was bündchen curry temple which is seven kilometer from badami this temple is a very famous temple dome is visiting this temple if you're visiting madam [Music] the next place we visited is the badami cave which is the most awaited place to be visited the entrance ticket is around 34 apiece per person badami cave temple are the complex of Hindu and Jain cave temple located in Bahama town there are four different caves to be visited the first cave is dedicated to God Shiva second cave is dedicated to god Vishnu third cave is dedicated to God maha vishnu and fourth cave is dedicated to Jane cave which is the smallest cave among all the cubes so the next place was badami museum so bothame museum is new to the badami caves and the ticket is around Fido please since the photography is prohibited I couldn't take any tips or any videos so Baba me port is also nearby to the Nevada mean museum since it was raining heavily I couldn't go to Veronica : [Music] so the next place we visited was Bhootnath temple which is one of the famous temple in the town so Buettner temple is situated in between the Bahama caves and badami food so right in front of Buettner temple there is a beautiful pleasantly by name Agastya Lake the day to finally came to an inn all the monuments we visited will be closed by 6:00 p.m. later we headed back to hotel and it was nice of them that they provided us an accommodation to help ourselves change later we had over dinner and use them to the best point and I also forgot to mention the fare of the bus from Bangalore to bottom and bother me to bond or the overall the bus ticket was around thousand five fifty rupees so the overall budget of the entire trip was worth person was around 3200 rupees hope you liked watching this video and please do like and subscribe my channel till then take care bye bye [Music]
Bridge over Troubled Water by Paul Simon Arranged by Kirby Shaw. Choir Director: Nathan Poole Pianist: Charmaine Bacon
our conjecture that there is a lost yet once highly Advanced ancient civilization could be proven Beyond doubt by one continent in particular anarctica for many Millennia this land has been encased perfectly preserved laying beneath miles of ancient ice the perir re map something which we have discussed in the past has long been argued prove just that long claimed as showing that of the land mass of
| 512 |
nytimes-articles-and-comments
|
event, what would you suggest the Democrats do? Appeal to the better nature of Republicans? Raise the spectre of another round of impeachment hearings? Demand the invocation of the 25th Amendment?
The Murkowski playbook:
1. Make a statement about how you are "considering carefully", "thinking deeply", or "struggling" with a vote or issue.
2. Follow McConnell's instructions. (Yeah! In a state that suffers so dreadfully from domestic abuse she got permission to oppose Kavanaugh, once it was clear the GOP didn't need the vote. How brave.)
Excellent take. Thank you. I’v been to state conventions and I agree with you, it’s messy but it works most of time. Isn’t that a pretty good description of modern participatory democracy? The only caveat I have is that Frank has a point concerning the loss of even the barest assumption of legitimacy in these processes. Also, as an aside, I think that it’s harder to hack a convention where real people are talking to each other than a voting machine or a Facebook post.
Cheers
@Peach Melba - no matter what a school district decides, the children are part of an experiment.
If the school reopens, and there is little virus present in the community, we will be learning about how it spreads in groups of kids, and whether schools increase the presences in the community. We will learn different things depending on whether there is space, distancing, ventilation, masks.
If the schools open in an area of moderate to high spread, we will learn different things - especially about space, distancing and masks.
If schools do not open, we will learn about the impact of social isolation, remote learning and the ability of children to learn with facilitation from no one or non-educators. And the effect on children of different ages.
Dr. Fauci was stating nothing more than fact. He was not advocating for experimenting on our children, but making it very clear that no one understands the whole impact of children on the spread of infection, or the cost of not having children in social school environments.
Fundamentally, the pandemic is a disaster, and the long term impact on school children not at all understood.
@James "This is my problem with your stance, is that there is no timeline." Remember Dr. Birx announcing the three phases? Even though the CDC under Trump has not issued fully detailed or sufficiently strict guidelines for reopening (apparently because the ones the CDC came up with don't suit Trump's reelection strategy), it HAS issued guidelines that suggest a timeline -- and suggesting one is the best we can do for now: <a href="https://www.cdc.gov/coronavirus/2019-ncov/community/index.html" target="_blank">https://www.cdc.gov/coronavirus/2019-ncov/community/index.html</a>
"I know I am not the only one thinking these thoughts. " It's time. You've been thinking about what the spark could be in your community. Act on it. For me here in Wisconsin, I am going to see if it works to turn our little recently built neighborhood support network into an absentee ballot machine for November. What will work where YOU are?
@mrc this is because we don't value education or critical thinking. Even in college
| 512 |
gmane
|
clarity and might also be a
structure that we could approach the UAWG about using (For them the
third item could be something like "Additional browsing support SC").
4. We could then tighten up the old A.0.1 wording to make it clear that
conforming to WCAG usually satisfies the SC's for *user interface
"chrome"* and *rendered content display* but not the "SC for additional
authoring support".
5. This has the happy side effect that we can tighten up some wording in
A.2.9 (the "preview" checkpoint) that has been bugging me: "the preview
meets all of the checkpoints in Part A.". This made less sense when our
success criteria included authoring related things but with these broken
out into their own SC category, we can be more specific that we meant
SC's for *user interface "chrome"* and *rendered content display*.
Optional 6. We might also consider bringing in a reference to UAAG as
JUST ONE OF THE OPTIONS (ie. conforming to UAAG would not be necessary)
for conforming with the SC's for *user interface "chrome"* and *rendered
content display* but (as with WCAG) not the "SC for additional authoring
support". (I suggest this because authoring tools built on browser
rendering engines might be interested in killing two birds with one stone)
Thoughts?
Cheers,
Jan
http://www.cnn.com/2007/US/07/26/spaceport.blast/index.html?eref=rss_topstories
LOS ANGELES, California (CNN) -- An explosion at an airport home to
Scaled Composites -- the builder of the first private manned rocket
to reach space -- killed two people and left four seriously hurt
Thursday, a Kern County Fire Department official says.
It happened at the Mojave Air and Space Port during a test of a new
rocket motor for SpaceShipTwo -- a spaceship being built for Virgin
Galactic, Richard Branson's space tourism company, a source said. The
Hi everybody,
I was able to built ITK 2.4.1 and then I tried to recompile my
applications and I get the "undefined reference to
`itk::Statistics::DenseFrequencyContainer::DenseFrequencyContainer"
error message.
One of my applications is a highly modified version of the
LandmarkInitializedMutualInformationRegistration example from ITK
applications. I am also attaching two cmake files to the message.
Any suggestions will be highly appreciated.
Thx.
George
Hi all,
I'm using an activation spec where maxSessions=maxMessagesPerSessions=1.
Using a client application I'm sending a TextMessage to the queue
The MDB consumes some messages and then the messages start piling up in the queue and never get dispatched.
I restarted the server, redeployed the application but no message is dispatched anymore.
I'm using ActiveMQ 4.1.2 as embeded in Apache Geronimo 2.1.1.2 (and can't change it).
I'm using maxSessions=1 as the message is really a notification and wanted to avoid processing the same notification concurrently.
Do you have any suggestions? This is really a blocker now.
Thank you
Cristian
Hello All,
I am working with a customer on a solution where ZFS looks very
promising. The solution requires disaster recovery and the chosen
technology for providing DR of services in this organisation is Veritas
Cluster Server.
Has anyone implemented ZFS with Veritas Cluster Server to provide
high-availability for ZFS pools and datasets? I understand that Sun
Cluster is
| 512 |
realnews
|
the 103-game history of the Granddaddy of Them All.
Deontay Burnett, who had three TD catches, caught a tying 27-yard scoring pass from Darnold with 1:20 left to cap an 80-yard drive in 38 seconds with no timeouts available.
Leon McQuay III then intercepted a long pass by Trace McSorley and returned it 32 yards to the Penn State 33 with 27 seconds left to set up Boermeester, who missed two earlier field goals.
The junior confidently drilled the Rose Bowl winner, and he sprinted away to celebrate amid pandemonium in the packed stadium.
"It's beautiful," McQuay said. "This is a special group of guys. Oh man, this is the time to step up. This is the time to make plays."
McSorley passed for 254 yards and threw two of his four touchdown passes to Chris Godwin for the Nittany Lions (11-3), whose nine-game winning streak ended in heartbreaking fashion.
Saquon Barkley rushed for 194 yards and two TDs for the Nittany Lions (12-2), who followed up their 21-point comeback in the Big Ten title game with another ferocious rally.
With one jaw-dropping play after another from two talent-laden offenses, the teams obliterated the combined Rose Bowl scoring record in the third quarter, surpassing Oregon's 45-38 victory over Wisconsin in the 2012 game.
The Nittany Lions' offensive stars put together a highlight reel for the ages during a 28-point third quarter. After trailing 27-21 at the break, Penn State scored three touchdowns on its first three snaps of the second half: a stunning 72-yard run by Barkley, a jaw-dropping bobbled 79-yard catch by Godwin and a 3-yard TD run by McSorley after an interception return.
THE TAKEAWAY
Penn State: The Nittany Lions' magical season culminated in an extraordinary heartbreaker, but this collapse won't hurt their prospects for 2017 and beyond. Penn State is firmly back on the national stage, and a wealth of talent will return to defend the Big Ten title.
USC: The defense had been remarkable since USC's 1-3 start to the season, but it couldn't stop Penn State's big-play stars. Darnold made sure it didn't matter, and he'll be back next year as an immediate Heisman Trophy candidate looking to add more achievements while raising his profile in the pantheon of Trojans quarterbacks.
UP NEXT
Although both teams will have gaps to fill from departing stars, Penn State and USC should both be among the top preseason candidates to get to the College Football Playoff next season. After this postseason showcase for recruits and fans, the future is bright for two proud programs firmly restored to their former glory.
American Eagle Outfitters, Inc. (NYSE:AEO) today announced its entry into the United Kingdom, as the Company further expands its global presence with the opening of three new company owned and operated stores. The American Eagle Outfitters stores will be located in the Bluewater premier mall in Kent, England, as well as the Westfield Group’s London and Stratford City shopping centers in London, England. The stores opening in the Westfield centers will include an aerie presence in shop-in-shop form. All of
| 512 |
realnews
|
and are required to keep detailed records of customers' surfing habits. Like most Arab countries, Syria blocks all Israeli websites.
Internet censorship in the United Arab Emirates, another Middle Eastern blackspot, is "substantial", according to the ONI. Reporters Sans Frontieres (RSF) categorises it as "an enemy of the internet". In 2006 the government passed a law against "information crimes". It criminalises "those providing the web with content that harms public order or moral values". The maximum punishment is five years in prison.
The telecoms regulator blocks websites deemed offensive to local culture or values. Pornography and gambling sites are blocked by local telecoms providers.
Tunisia is in ONI's "pervasive" category and on RSF's "internet enemy" list. The secular, western-backed North African republic blocks thousands of websites. "The Tunisian government has realised that censorship is not working the way it wanted it to," says blogger Sami ben Gharbia. "The flow of dissident information into Tunisia is a fact and censorship is simply not succeeding in stopping it. The government is updating its policy from a simple blocking of dissidents' websites and blogs to a much more aggressive one, that includes hacking and deleting websites and filtering emails."
Your browser does not support iframes.
It seems like everyone – including the GOP – is attempting to stop the runaway political train that is Donald Trump, the Republican presidential front-runner. And the last line of defense for Trump’s opponents may be in July at the Republican National Convention in Cleveland.
Trump has garnered the political spotlight during this presidential election cycle by using inflammatory rhetoric, coded language, bombastic statements, and inciting violence at his rallies, forcing the Republican establishment to push back against his candidacy.
NewsOne Now panelist Steve Munisteri, a three-term Texas GOP State Chairman, broke down the math that could set up a brokered Republican convention and stop Trump from capturing the nomination.
Munisteri told Roland Martin on Wednesday’s edition of NewsOne Now, “Gov. John Kasich does have a path to the nomination.”
“If Marco Rubio could release his delegates (there are 154 unbound delegates), so if you add those to Kasich’s total, he would have a comparable number to Ted Cruz,” Munisteri said, adding, “If you subtract the 154 unbound delegates from the 1,009 delegates that are left — Trump has to win about 63 percent of the delegates that can be bound, about 53 percent of the overall delegates.”
Munisteri continued, “There’s still going to be a Stop Trump movement; it will probably go to a contested convention, less Trump win some win or take all” states.
Lauren Victoria Burke agreed with Munisteri’s breakdown of the delegate math, saying, “There is some math that is going to be very interesting” leading up to the Republican Convention.
She continued, “The question is for the Republicans at their convention: are they going to have the big fight that it looks like they’re going to have, because frankly I don’t think they can tell the person who has the most votes and the most delegates that they won’t be the nominee.”
Watch Roland Martin
| 512 |
reddit
|
families. The money involved in caring for a baby is crazy. The store was full of kids. So much running around and so much talking. I heard so many parents telling their constantly babbling kids to be quiet. I heard a man tell his son to have respect for his sleeping baby brother and be quiet. 😂 Lately I've been afraid that because of being CF I'll never have a partner and my corpse will be found eaten by rats. That's cool. I don't want kids. Edit: I was looking at brand names at Target in larger quantities. The smaller packs of things are cheap but won't last long. it was confirmed by a friend with kids how ridiculously expensive baby stuff can be.
Just a typical example of deep throating my parents' beliefs. Luckily I began to snap out of it on my own around the beginning of middle school, because I have empathy. Also luckily, I didn't know any gay people until I had come full circle and became accepting. I don't like to think about how I could've made someone feel.
lol, you actually think war can be stopped? Thats hilarious, if you think that, then why is war still a thing thousands of years after it started? You really believe the whole opium conspiracy bullshit? Thats pretty pathetic, just as bad as believing in the US went to war for oil. What war were you a part of?
"The Vex won't spare the City. They won't even thank you. But that's the thing about Light. You never know where it'll shine." This is just saying that even though they tricked you into coming to the vault and saving them from the taken they won't spare the City let alone thank you for it.
Hmm yeah that seems like a good idea or have one of each for a role besides tank I hate tanking... probably would lean more towards a Pally... Wish I would’ve went druid but already have a rogue so no point of feral as it’s pretty much the same type of role with bleeds/stealth.
Friday Night Lights! High school shows can so very easily become stale because they either follow the characters to university or contrive a way to keep them around, and the second batch of kids are never as good. FNL is the exception -- I love the East Dillon Lions kids.
PSR is one of my top favorite tools along with Fiddler and Wireshark/Netmon/Message Analyzer. There is nothing worse than getting a snip of just the error message with no context as to how you got to that point and what you did. A problem statement of "I got this error in OWA" doesn't help much unless you show me what you were doing when you got that error.
Reviewed dozens and dozens and dozens. Ordered and returned a dozen. Bags can be so damn expensive. Ended up with a cheap one from Kohl's, it was under $50, cute. Look for the Simply Vera Wang brand. For reference, I carry a large bath towel, a gym
| 512 |
reddit
|
as a team. You state that you've talked to her about this, tried to find solutions for childcare, and possibly talked to her about not doing most of the household management, etc. What has been her response? If nothing has changed, and you've been absolutely clear about your needs and expectations (assuming that you're also contributing equally) then there is a major problem here with her attitude. She needs to be working towards solutions as much as you are, if not more, since this slightly falls more into her lap than yours. You both need more training and education, and you've got to formulate a plan on how to execute that. Talk to her about why she fears making changes to her lifestyle. Is she unable? Unwilling? Make it clear that the future of the family and your ability to provide is at risk and needs to be addressed. She can't escape this, and she shouldn't want to either. I think this needs to be your first step, is figuring out her attitude towards all this and making sure it aligns with yours and to the betterment of your future.
Yeah Definitely saw that a lot It's one of the many culminating reasons they are terrible at apologies, yet still give them. I've heard of some real apologies (with plenty of sorry I offended you type ones sprinkled in) from her. But she was never able to get over how she initially felt even if she could logically see where she was wrong. She had a partial grasp on this, but never made a real effort to change. Plenty of examples of this throughout our 6 years.
Only a redditor could read an article about anthrax-carrying missiles (as improbable as that sounds) from NK and then *somehow* take a dig at the USA for being “warmongers.” Do any of you actually plan what you’re going to say or does the nonsense just flow down to your fingers before you have a chance to stop it?
Me and my friends all have wings in our server and have built an arena in survival where we fly and shoot arrows at each other/mobs, pretty fun. Also going on flying trips across multiple biomes is a fun way to get to those super far away woodland mansions on the cartographer maps. Flying around the end world collecting dragon heads and wings for display is fun too.
>In my line of work, data retention is of the utmost importance In my work there is no need to keep data for longer than the one year legal requirement. Not once have we had to access a single document from archives, and if there ever is a problem it would be found before the one year expiry. I'm not talking about where you work, or the field of work that is, or the particular needs and requirements of whatever it is you may be used to. I'm talking about one field of work where what I have described is the logical way to do things. I haven't once said
| 512 |
StackExchange
|
level - this is where rethrowing may be useful). All other exceptions either need to be logged so you can debug why they happened, or shouldn't be happening in the first place (for example - make sure you validate user input, etc.). If you catch all exceptions, you'll never really know why you're getting the exceptions you're getting and, thus, cannot fix them.
Updated Response
In response to the update of your question (particularly in how you want to handle the save case), my question to you would be - why are you using exceptions as a means of determine the path your program takes? For example, let's take the "FileNotFoundException." Obviously that can happen at times. But, instead of letting a problem happen and notifying the user about it, before saving (or doing whatever) with the file, why not check first that the file can be found. You still get the same effect, but you aren't using exceptions to control program flow.
I hope this all makes sense. Let me know if you have any additional questions.
A:
When you re-throw with the original exception as inner exception, you lose the original stack trace, which is valuable debugging information.
I will sometimes do what you are suggesting, but I always log the original exception first to preserve the stack trace.
A:
I don't see a problem with what you are doing. The reason for wrapping exceptions in a custom exception types is to create an abstraction between layers of code -- to translate lower-level errors into a higher-level context. Doing this relieves the calling code from having to know too much the implementation details of what Save does.
Your update #1 is an example of the calling code having to know way too much about the implementation details of Save(). In response to your second update, I agree 100%
PS
I'm not saying to do this in every scenario where you encounter exceptions. Only when the benefit outweighs the cost (usually at module boundaries).
Example scenarios for when this is especially useful: you are wrapping a 3rd party library, you don't yet know all the underlying exceptions that might be thrown, you don't have the source code or any documentation, and so on.
Also, he is wrapping the underlying exception and no information is lost. The exception can still be logged appropriately (though you'll need to recursion your way through the InnerExceptions).
Q:
Architecture/Design - Where to store app configuration?
I am building a web app in Laravel.
I have many app configuration options, such as:
prices of paid plans
maximum days on trial mode
maximum number of points a free user can have
default email sender address
These options are used thoughout the app and should be available most of the time. I'm thinking on having a 'config' database table to store and a config object to access the data... Would that be a good solution? If not, how else should I do this?
A:
There are generally two possibilities for such configuration:
app/config http://laravel.com/docs/4.2/configuration
config tables in DB
Which
| 512 |
Gutenberg (PG-19)
|
the school dates back to the closing years of the
sixteenth century, when a reaction set in against the Chinese classicism
of the Ashikaga period. This manifested itself in the choice of Japanese
instead of Chinese subjects, and in novel treatment in which features of
both the classic Kano and Tosa styles were combined, but which in many
respects broke away from academic traditions. The reputed leader of the
revolt was Iwasa Shoi, better known as Matahei, son of the Daimyo of
Itami; but other distinguished artists, notably Kano Sanraku, also painted
pictures in the new manner, which was not then held to constitute a
distinct school. The subjects being drawn from the life of the people,
these pictures were called Ukiyoe. E is the Japanese term for a picture or
drawing.(1) Ukiyo, as originally written, had a Buddhistic signification
and was applied to the secular as distinguished from the ecclesiastical
world. Literally the word means "the miserable world," but as now used it
may be more accurately translated as "the passing (or floating) world of
every-day life."
Perhaps for the reason that Ukiyoe themes were not considered quite
dignified, and because they did not express poetic ideas, the Ukiyo
paintings of Matahei and his contemporaries and successors, though prized
and much sought after, were seldom signed, and the identification of their
authorship is a matter of extreme difficulty. For more than half a century
works in this manner continued to be produced in considerable numbers, but
the movement did not crystallize into a school until, in the person of
Hishikawa Moronobu, a leader appeared to give it form and direction.
Moronobu was an artist of rare distinction. His paintings were eagerly
sought by the daimyos and the wealthier samurai. But Moronobu was a man of
the people, and it was as a designer of book illustrations and later of
ichimai-ye, or single-sheet prints, that he gave the impetus to Ukiyoe.
For fifty years or more prior to his time books with engraved
illustrations had been published in Japan, but they were comparatively few
and the illustrations were poor and crudely executed. The twelve drawings
Moronobu made for a book of instruction for women in etiquette and
hygiene, published in 1659, marked a decided advance. This, so far as we
know, was the first of a long series of books illustrated by him. Their
popularity was deservedly great, and by them his fame became wide-spread.
The illustrations were printed in black from blocks similar to those from
which the text was printed, and were characterized by fine broad treatment
and a rather wiry but strong and expressive outline.
About 1670 Moronobu began to issue large single-sheet prints which could
be affixed to screens or mounted as kakemono. These prints, which were
impressions in black from one block only, are known as sumi-ye--_sumi_
being the Japanese name for Chinese--or, as we incorrectly call it,
India--ink. They were designed to be coloured by hand, and apparently a
part of the edition was so coloured before being placed on sale by the
publishers. At first
| 512 |
OpenSubtitles
|
these things am I doing?" " Sixty." " How many have I done?" " Three." " Three?" " Yeah, this is what I'm talking about." " Your system's slowing me down." " I don't have a system." " You're kidding?" " You ready?" "Hey, can't we have color codings and stickers, priority lists?" " Can I get a little bureaucracy going?" " What are you doing?" "I'm doing basically what the president does." "Ask people for things and then thank them for things." "Let's go." "Take the calls to the mansion." "I'll meet you there after this." "We had a couple of cats when the kids were kids named Mr. Finch and Mrs. Wilburforce or something, I can't remember." "You know, I've never really liked human names for animals." " Really?" " Yeah." "Okay." "Well, I can't believe my kids didn't think to ask you what to name the cats." "But they used to bring mice into the house and show them to me." "This is how I'm starting to feel about the Swiss." "Yeah." " Morning." " Good morning, Mr. President." "Tell me about the boy." "He and a guardian have crossed into Kandahar." "A UN plane is on the ground." "It's gonna leave at 11:45 Zulu if you say okay." " Eleven forty-five?" " Yes, sir." " That's 11 minutes from now." " Yes, sir." "This meeting's premature." " We should wait 10 minutes." " Yes, sir." "This meeting doesn't go in the Sit Room anymore, okay?" "I don't know why it's here." "This isn't a military operation." " It's a secure room." " My office is a secure room too, isn't it?" "Please, somebody tell me it is, or I gotta go pack some stuff." " You see my point?" " What about the organs?" " The organs are in Zurich." " I'm sorry, that sounded funny to me." "I'm the kid in bio who laughed all the time." " Then on to Paris on Swiss Air." " Coach?" " I don't..." " Then New York?" " Yes, sir." " The heart and lungs get here first." "They can last about 40 hours, the flight from Tehran's 15." "What's left is to line up a doctor and get the funding." " Go around the room." " If it leaks, you got clerics." "It sends a message to the reformists." "At a time when they're breaking 70 percent in local elections." "If you're looking for ways to temper support to the Shiites, I don't..." " A benevolent power must..." " This isn't the time." "Don't forget the Shehab program and the transport corridors along the Silk Route." "How old is
"You liked the tile" "And the master bedroom suite?" "And you like the way the french doors open out to the deck?" "Yes, I love everything so far." "I especially love that I didn't have to do anything." "Meow." "Meow." "That's right, Zola." "That's what a cat says." "Honestly, when the house is done, just bring me out for the big reveal." "You want a big reveal?" "I want a
| 512 |
YouTubeCommons
|
rules of Stephen the third but the latter was forced from Rome and sought the aid of Charlemagne after two unanimous elections Charlemagne son Louis the pious intervened in a bitterly disputed election in favour of pope eugene ii thereafter the process was returned by apostolic constitution to the status quo circa 769 reincorporating the lay Roman Nobles who continued to dominate the process for 200 years and requiring the Pope to swear loyalty to the Frankish ruler the consecration of Pope Gregory the fourth was delayed for six months to attain
it's hard it's really really hard go in understanding that most people go in with the wrong attitude i'm gonna just go do this it's easy no it's hard expect challenges to come setbacks to come trials to come hardship is hard it's hard to be successful but i'm exactly where i wanted to be because i realized i gotta commit my very being to this thing i gotta i gotta breathe it i gotta eat it i gotta sleep and until you get there you'll never be successful in life but once you get there i guarantee you the world is yours so work hard and you can have whatever it is [Music]
I have a budget of 5000 rupees but all the writing jackets I've looked at so far have level one protector do you know any jacket which has level two protect us under five thousand well your wish has been granted my friend Axor just released their 5000 rupee ads or flow riding jacket that riding jacket comes at the 5000 rupee price point but has C Level 2 protectors on the elbow shoulders and the back and it also comes
okay so welcome to your flipped classroom activity uh we got some code here and we got our you know friendly faces and uh this is uh uh an introduction to fragments and also a little bit of navigation so um here we've got a four image fragment it's uh has that great name because uh it's got four images and when you click on an image you'll notice that it takes over the entire phone which is called immersive mode in uh in android and you know there's a little bit to uh to manage immersive mode when you when you click it again it goes away so i am i'm immersed in uh this little creature's eyes um i'm immersed in fear so um that that really is all of the functionality of the flipped classroom so in that sense it's fairly straightforward just to take a quick look over here at the at some of the code you know you've got an oncreate and we're doing something here which is bad we are doing a lot of work on the main thread but we don't know that much about threads yet and we don't know how to how to put this work in the background but eventually we will but notice also that uh this um these these jpegs are in the assets directory
| 512 |
gmane
|
don't think we will be limited by Moore's law for
#2..
If we utilize existing technology existing in Hw and software
methodology,
we can change the game on #2.
Sue Hares
The votes have been counted. In total, 52 people have voted for one or more
categories. We have not seen any irregularities. There were no ties, so we
did not need the tie-breaking rules.
In the comments, we noted some negative feelings. There were too many
shames/scandals, the interest in participating at World Championships was
low, and most World Records survived this season quite easily. Or was it
because our expectations were too high?
Anyway, first the results of the best skater per country
Votes in category Best Skater from ARGENTINA
A bit more competition for Jose....
1. FAZIO, Jose -- ARG 22 votes
2. CAICEDO MEJIA, Jennifer -- ARG 13 votes
Votes in category Best Skater from AUSTRALIA
And a lot more Australians this season...
1. LOSE, Joshua -- AUS 19 votes
2. MUIR, Sophie -- AUS 15 votes
3. GREIG, Daniel -- AUS 5 votes
4. SOUTHEE, Ben -- AUS 1 vote
Votes in category Best Skater from AUSTRIA
But less Austrians.
1. ROKITA, Anna -- AUT 33 votes
2. PICHLER, Christian -- AUT 3 votes
3. BITTNER, Vanessa -- AUT 1* vote
Votes in category Best Skater from BELARUS
This was not a clear-cut decision. Let us see what the new indoor-rink in
Minsk can do next season.
1. RADKEVITSJ, Svetlana -- BLR 12 votes
2. JASENOK, Julija -- BLR 9 votes
3. MIKHAJLOV, Vitalij -- BLR 8 votes
4. SADOVSKAJA, Ksenija -- BLR 2 votes
5. ROMANENKO, Anna -- BLR 1* vote
Votes in category Best Skater from BELGIUM
1. SCHILDERMANS, Kris -- BEL 23 votes
2. DEYNE, Wim de -- BEL 5 votes
GYSEL, Pieter -- BEL 5 votes
4. SANDE, Quinten van de -- BEL 1* vote
Votes in category Best Skater from BRAZIL
First time this award...
1. SOUZA, Felipe de -- BRA 29 votes
Votes in category Best Skater from CANADA
1. NESBITT, Christine -- CAN 21 votes
2. GROVES, Kristina -- CAN 15 votes
3. GIROUX, Mathieu -- CAN 3 votes
HUGHES, Clara -- CAN 3 votes
GREGG, Jamie -- CAN 3 votes
6. MORRISON, Denny -- CAN 2 votes
7. WOTHERSPOON, Jeremy -- CAN 1* vote
GELINAS-BEAULIEU, Antoine -- CAN 1* vote
Votes in category Best Skater from CHINA
1. WANG, Beixing -- CHN 38 votes
2. JIN, Peiyu -- CHN 2 votes
YU, Fengtong -- CHN 2 votes
4. SUN, Longjiang -- CHN 1 vote
Votes in category Best Skater from COLOMBIA
1. ECHEVERRI, Camillo -- COL 29 votes
Although Echeverri also entered for Canada.
Votes in category Best Skater from CZECH REPUBLIC
1. SÁBLÍKOVÁ, Martina -- CZE 44 votes
2. ERBANOVA, Karolina -- CZE 2 votes
Votes in category Best Skater from DENMARK
1. GRAGE, Cathrine -- DEN 38 votes
2. BAK, Sara -- DEN 4 votes
Votes in category Best Skater from ESTONIA
Again progress for Estonia this season.
1. MARKUS, Mart -- EST 14 votes
2. ALUSALU,
| 512 |
DM Mathematics
|
Suppose 7*i - 3*i = -4*c + 3992, 4*i - 2*c = 3974. Let h = i + 1017. Is 6/4*h/6 a prime number?
True
Is (-4)/16 - (-97735920)/192 a prime number?
False
Is 2880647/42 + -4 + (-275)/(-66) a composite number?
True
Suppose -14608 = 10*q + 13152. Let l = q - -4061. Is l composite?
True
Suppose 0 = -29*d - 28*d - 4788. Let p be (-22)/(-4)*(-19 + -3). Let h = d - p. Is h prime?
True
Is (-9 - -3) + 334103/(22/2) composite?
False
Let y(u) = 13 + 0*u + 17 + 5*u. Let t be y(-7). Let c = 12 + t. Is c composite?
False
Suppose c - 104448 = 4*k - 14367, 450321 = 5*c + k. Is c prime?
False
Let u = -367783 + 599964. Is u a c
Expand (24*t + 3 - 4 - 37*t)*(-2*t**2 + 2 - 2).
26*t**3 + 2*t**2
Expand 2*g - g - 5 + 86*g**2 - 83*g**2 + (-1 + 2 + 1)*(3*g**2 - g**2 - 6*g**2).
-5*g**2 + g - 5
Expand (-5 + 7*d**2 + 5)*(-4 + 3 + 0)*(-4*d**2 - 3*d**2 + d**2).
42*d**4
Expand (-2*r**3 + 2*r**3 - 2*r**3)*(1 - 1 + 1)*(8070 - 8070 + 226*r).
-452*r**4
Expand (-845 + 450 + 486)*(a**3 + 0*a**3 - 3*a**3).
-182*a**3
Expand (-3 - 2 + 4 + (0 + 0 + 2)*(-6 + 3 + 1))*(-9*v - 12*v - 3*v).
120*v
Expand -3*j + 3*j - j**2 + (j - 2 + 2)*(0 + 1 - 3)*(-16*j - 50*j - 3*j).
137*j**2
Expand 4 - 2*z**5 - 4 - 6*z**5 + 3*z**2 - 3*z**2 + (-4*z**3 + 2*z**3 + 4*z**3)*(-z**2 + 12*z**2 + 9*z**2).
32*z**5
Expand (5*n**3 + 0*n**3 - 3*n**3)*(10 - 12 + 19)*(4 + 1 - 4).
34*n**3
Expand (10 - 59 - 9)*(-1 + 5 - 2)*(0*a**5 + 3*a**5 - 2*a**5).
-116*a**5
Expand 3*n**2 - n**2 + n**2 + (5 - 5 - 4*n)*(1 - 3 + 4)*(8*n - 4*n - 19*n).
123*n**2
Expand (4 + 0 - 5)*(-2 + 4 - 1)*(167*l + 2*l**3 - 164*l + 6*l**3).
-8*l**3 - 3*l
Expand (0 - 5 + 0)*(4*r**2 + 133 - 133 - r).
-20*r**2 + 5*r
Expand (-1 + 1 + k)*(-177 + 72 + 83).
-22*k
Expand (-3*y**2 + 3*y**2 + 2*y**2)*(17 - 17 - 16*y).
-32*y**3
Expand (0*c**3 - 2*c**3 + 5*c**3)*(-129*c**2 + 1 + 118*c**2 - 2 - 14*c).
-33*c**5 - 42*c**4 - 3*c**3
Expand -3*o + 3*o - o - 2*o - 4*o + 0*o + (-1 + 1 + 1)*(-2*o + 0*o + o) - 3*o + 5*o - 3*o - 2 + 2*o + 2 - 2*o - 4 - o + 2*o.
-8*o - 4
Expand (13 - 72 + 1 + (-1 + 3 - 3)*(1 + 2 - 2))*(-3*c**3 - 2*c + 2*c).
177*c**3
Expand (2*u - 5*u + u)*(-3 + 4 - 7)*(-5*u - u**2 - 42 + 42).
-12*u**3 - 60*u**2
Expand (2 - 6 + 2)*(-142*w - 120*w + 120*w).
284*w
Expand (1
| 512 |
StackExchange
|
known whether they can be done in polynomial time: we don't know whether PSPACE = P. If you can prove for a single PSPACE-complete problem that it can be done in polynomial time, or that it cannot, you will be famous in computing science forever. In practice, for such problems, we have no better than exponential algorithms.
To answer your second question: parsing context-sensitive grammars is PSPACE-complete, so it takes exponential time in practice; it takes only polynomial time for growing context-sensitive grammars.
Q:
Need to display certain values for all columns start with 'BB%', 'ZZ%' for ID , ID2, ID3, ID4
Name ID ID2 ID3 ID4 Match
1 BG234560 BB78458745
2 AC678900 BB7868877 ZZ5421896
3 AT9808744 BB546897
4 989878AC BBIIT9807 ZZ5874896
5 A9045678 BB748596
6 BB98076 AC9800876 ZZ2536987
7 ZZ8793456 YY879654 BB4587961
8 UIT90876 ZZ365289
9 BH98048474 YYCC123456 BB6584123
10 FT7849562 ZZ56980T ZZ6952314
11 3TY875759 BB258963
12 333IY78698 ZZ5463214
13 548I345 ZZ56980T BB254879
14 OPQ4567 BB45678 BB258963
15 2345YYY BB58214785
Name ID ID2 ID3 ID4 Match
2 AC678900 BB7868877 ZZ5421896
4 989878AC BBIIT9807 ZZ5874896
6 BB98076 AC9800876 ZZ2536987
7 ZZ8793456 YY879654 BB4587961
10 FT7849562 ZZ56980T ZZ6952314
13 548I345 ZZ56980T BB254879
14 OPQ4567 BB45678 BB258963
declare @Drug table ([Name] int, ID varchar(64), ID2 varchar(64), ID3 varchar(64), ID4 varchar(64), [Match] varchar(64))
insert into @Drug ([Name], ID, ID2, ID3, ID4, [Match])
select 1, 'BG234560', null, null, null, 'BB78458745' union all
select 2, 'AC678900', 'BB7868877', null, null, 'ZZ5421896' union all
select 3, 'AT9808744', null, null, null, 'BB546897' union all
select 4, '989878AC', null, 'BBIIT9807', null, 'ZZ5874896' union all
select 5, 'A9045678', null, null, null, 'BB748596' union all
select 6, 'BB98076', 'AC9800876', null, null, 'ZZ2536987' union all
select 7, 'ZZ8793456', 'YY879654', null, null, 'BB4587961' union all
select 8, 'UIT90876', null, null, null, 'ZZ365289' union all
select 9, 'BH98048474', null, 'YYCC123456', null, 'BB6584123' union all
select 10, 'FT7849562', 'ZZ56980T', null, null, 'ZZ6952314' union all
select 11, '3TY875759', null, null, null, 'BB258963' union all
select 12, '333IY78698', null, null, null, 'ZZ5463214' union all
select 13, '548I345', null, 'ZZ56980T', null, 'BB254879' union all
select 14, 'OPQ4567', 'BB45678', null, null, 'BB258963' union all
select 15, '2345YYY', null, null, null, 'BB58214785'
select *
from @Drug
where ID like 'BB%'
and ID like 'zz%'
and ID2 like 'BB%'
and ID2 like 'zz%'
and ID3 like 'BB%'
and ID3 like 'zz%'
and ID4 like 'BB%'
and ID4 like 'zz%'
But this gives no output
A:
Try this
select *
from Drug
where 'BB' IN (LEFT(ID,2), LEFT(ID2,2), LEFT(ID3,2), LEFT(ID4,2))
OR 'ZZ' IN (LEFT(ID,2), LEFT(ID2,2), LEFT(ID3,2), LEFT(ID4,2))
Q:
Only first radio button can be selected with inline-block applied to labels
Here's a series of three radio buttons wrapped in label elements. display: inline-block is applied to labels. For some reason only the first label can be selected, although on Firebug all labels appear well separated:
Fiddle
A:
You must use 1 ID for each label FOR.
Also you need a group name which must be the same as in the other options.
<label for="pa_couleur1">
<input type="radio" name="color" id="pa_couleur1" value="blanc">blanc
</label>
<label for="pa_couleur2">
<input type="radio" name="color" id="pa_couleur2" value="bleu">bleu
</label>
<label for="pa_couleur3">
<input type="radio" name="color" id="pa_couleur3" value="marron">marron
| 512 |
realnews
|
when cornerback Antonio Cromartie – who was returning the punt because Jim Leonhard was a bit banged up – muffed the fair catch and Leodis McKelvin recovered at New York’s 36. McKelvin injured his ribs on the play and left the game.
Fitzpatrick went for a big play right away, throwing a ball up deep down the right sideline to former Jets wide receiver Brad Smith, who appeared to get a hand on it, along with Cromartie, and tapped the ball up, grabbed it out of the air as the defender fell and took off into the end zone for a career-best 36-yard touchdown that tied it at 21 with 2:11 remaining in the third quarter.
Notes: David Nelson had the Bills’ other touchdown, an 8-yard catch that gave Buffalo a 7-0 lead late in the opening quarter. … Jets DE Mike DeVito left in the third quarter with a right knee injury, and Ryan had no update on the severity. … Former Bills first-rounder Aaron Maybin had two of the Jets’ three sacks. He had none in two unproductive seasons in Buffalo. … Fitzpatrick became the fifth QB in team history with 50 TD passes, joining Jim Kelly, Joe Ferguson, Jack Kemp and Drew Bledsoe.
Microsoft was just socked with another blow in China. The Central Government Procurement Center has banned the use of Windows 8 on government computers. Reuters reports that computer security relating to Windows XP was cited as the reason.
Like many others, the Chinese government is not happy with Microsoft for ending Windows XP support. The antiquated operating system still powers 50% of China’s desktop market, according to Reuters.
This latest setback comes as Microsoft is struggling in the massive market. Even though computer sales in China matches that of the U.S., the company earned much less revenue, matching that of a smaller market such as the Netherlands.
The company warned for years that support was ending and that companies should upgrade to the latest Microsoft operating system. Yet there were still holdouts for various reasons — but why fix something that’s not broken?
Microsoft is in a tough spot. Microsoft needs to adequately prop-up its latest operating system, but Windows XP will continue to power vital systems that deserve security patches. China is seemingly turning its back on Microsoft until this is resolved.
via press release:
“Community”, “Mad Men” top inaugural PAAFTJ
Television Awards nominations
The NBC comedy and the AMC drama lead their fields with ten and eight nominations in the first edition of the award; other nominees include period miniseries, late night programs, and animated shows.
The Pan-American Association of Film & Television Journalists (PAAFTJ), a newly founded organization representing over 500 journalists from all across the Americas, has today announced nominations for the inaugural edition of the PAAFTJ Television Awards, honoring the finest achievement in US television programming in the 2011/12 TV season. The winners of the PAAFTJ Television Awards will be announced on July 8, 2012.
Nominations were spread across a total of 85 shows from all major broadcast networks plus 15
| 512 |
s2orc
|
selectivity was almost 100% in all experiments, which was because separating carbon and hydrogen prevents the generation of CH 4 .
2.2. Descriptor Calculation. Data from the periodic table, Python Materials Genomics (pymatgen), 25 and the Materials Project 26 were used to represent structural information for the metal oxides. Periodic table data were collected from the Chemistry Handbook and papers 27,28 and included atomic mass, electron count, peripheral electron count, atomic radius, ionic radius, ionization energy, electronegativity, work function, and surface energy. Pymatgen includes data for atomic mass, atomic orbitals, atomic radius, boiling point, density of solid, liquid range, melting point, molar volume, thermal conductivity, and electronegativity for metallic elements. The Materials Project data includes energy, energy per atom, volume, formation energy per atom, band gap, and density. Periodic table data and pymatgen descriptors were obtained for each atom, and weighted averages were determined using the molar rates; similarly, Materials Project descriptors were obtained for each metal oxide, and weighted averages determined using the molar rates.
2.3. Regression Model. Partial least-squares (PLS), 29 ridge regression (RR), 30 least absolute shrinkage and selection operator (LASSO), 31 elastic net (EN), 32 linear support vector regression (LSVR), 33 nonlinear support vector regression (NLSVR), linear Gaussian process regression (LGPR), random forest (RF), 34 light gradient boosting machine (light-GBM), 35 and GPR methods were used to build the mathematical models.
The prediction accuracy was evaluated by double crossvalidation (DCV). 36 The sample was first divided by the number of outer folds. One group was used for validation, and the remaining groups were used for cross-validation (CV) (inner folds) to optimize the hyperparameters and then predict the data for validation. This was done for all groups. The prediction accuracy of the mathematical model was evaluated by comparing the actual and predicted Y-values of the outer CV. For comparison, the coefficient of determination (R 2 DCV ), mean absolute error (MAE DCV ), and root-mean-square error (RMSE DCV ) were used, as respectively given by
= ∑ − = y y n RMSE ( ) i n i i DCV 1 ( ) DCV ( ) 2(5)
where y (i) is the Y-value of the i-th sample, y DCV (i) is the predicted Y-value of i-th sample by DCV, y average is the average of the Y-values, and n is the number of samples.
2.4. Transfer Learning. Transfer learning is a method to improve the prediction accuracy and efficient learning of a mathematical model by transferring knowledge from other data. To improve the prediction accuracy of the mathematical model in this study, we used OVFE values, which are considered to be correlated with the extents of CO 2 and H 2 conversion. OVFE is the energy released when oxygen atoms are released from metal oxides and is typically calculated by density functional theory calculations. In this study, we used the OVFE values of 45 compounds reported by Deml et al. 37 In several transfer learning algorithms, we focused on the frustratingly easy domain
Can photoscreening effectively detect amblyogenic risk factors in children with neurodevelopmental disability? PMID: *****
Neena R
| 512 |
goodreads
|
explains exactly how he knew what would go wrong. The entire climax of the book was cheapened for me by Malcolm/Crichton's preaching about the ills of science. It really caused me to slog through the later portions of the book.
I haven't watched the movie in nearly as many years as it's been since I last read the book, but from what I recall of the film it was superior to the novel. I may have to get my hands on a copy just to see if I'm correct. Spielberg added tons of little touches that made the movie more interesting. The mild love triangle between Grant, Sattler, and Malcolm made their interactions more compelling and fun to watch. Grant's dislike of children made the scenes in which he was trapped with the kids and his growing relationship with them all the more meaningful. Hammond's character was also much cooler in the movie. Instead of an evil billionaire he was more of an eccentric grandfather tragically obsessed with his own showmanship and bringing a little magic into the world. Hopefully I'll get to re-watch the movie in a few days and I'll be less disappointed with how it holds up to my recollections.
Fond memories of the movie version coupled with Malcolm's constant anti-science prattling left me with a novel that couldn't possibly live up to the nostalgia I had built up around it.
Gils! Just finished reading this book yesterday, and I'm still feeling awesome!
1. Open ending is the best ending ever! (Though I wish Uncle Rick wrote at least one epilog for Leo's back, cuma biar gampang kalo mau bikin fic canon...)
2. I cannot complain about the PoVs. I do love Pery's and Annabeth's, but guess Uncle Rick want us to think that this is NOT Percy Jackson's Series! This is Heroes of Olympus! (I especially can't complain about Nico's PoV. Walaupun tetep gak se"dark" yang gue kira.)
3. Also realized that Jason, Piper, and Leo's adventure began this series in The Lost Hero, and the series was fnished by theirs (after all, mereka bertiga yang bertarung di udara untuk mengalahkan Gaea.)
4. Gak ngerti sama karakterisasi Reyna. I mean, gak pernah ada ciri yang menunjukkan kalau dia adalah orang yang se'lembut' itu! Mungkin gue harus baca ulang dari buku pertama.
5. Karakter Will Solace terlalu dipaksakan (or I'm just being jealous of him because of Nico's case.). Tapi beneran aneh, tiba-tiba muncul, sok akrab sama Nico, lalala, trilili, jeng jeng! Jadi sama Nico.
6. Makin cinta sama Leo. I think my OTP changed to Caleo or Lelypso or whatever they call it.
7. NEVER TRUST PROPHECY! EVER!
That's all!
NB: Mungkin selanjutnya gue akan membuat fic Leo-Calypso.
NB 2: Masih gak rela Nico sama cowok... Mending saa Reyna...atau sama gue sekalian hahaha
Sometimes you can tell when a book is self-published. In this case, you can't.
OPEN MINDS is a unique story with wonderful world building. I love (really love!) that Susan made up new words and slang to go with this imaginary futuristic world. She also surprised
| 512 |
ao3
|
machines.
Inside is best the pits of hell, frames still screaming lay in pieces on the floor or hang from the ceiling, they are off all ages sparklings younglings elderly, but in the center of it all was a femmeling the only intact frame there hung by cables, she looked alive with glowing ice blue optics and a white colored plating, all polished and clean…. The beginnings of an alt settling in, the femmeling looked innocent and pure. But she was dead the sparkling of the owner of the refinery before it was decommissioned, after she fell to her death into one of the machines then the murders started, all of the workers died first. The doors had shut tight and locked, the whole place was to have said to have caught on fire killing all who was trapped... The building looked fine nothing out of place not even a burn mark to show for the fire it looked well kept other the the now burned and melted frames the littered the floor nothing strange seemed to happen, until a group of younglings went in that is, this was the first of the many murders to come the horrified screams ending when a sparklings voice called out for help, saying it was lost sometimes it would call for it’s sire…
Soon those calls would come when ever someone who didn’t know better would come up to it saying the femmes frame would move not unlike a puppet saying again and again “will you come play with me? Can you help me?” if they were smart the listened to an old worker one spared due to needing to see a medic for virus so not needing to go to work simply tried to keep others from ending up there. He soon became known as the geezer, an old mech he always was near the place and mechs would give him food as a thank you for warning them, even the enforcers seemed to look the other way when it came to that building having lost so many for not listening.
The frame hung by it’s cables a tear slipping out of one of its optics as a dark shadow stalked up to it with wheezing breaths soon ripping into the bodies adding to the screams of those who were trapped there still feeling the damage, there was another tear as the sparklings soul was forced to listen and watch this thing rip into the bodies as the thing was occupied the trapped spark went to the entrance and called out
“Help me! Please help me! Papa? Help I’m lost!” this went on as an old man made sure no one went near the building one of her papa’s workers she forgot the name it had been so long this went on until she felt the creature come back and grab the soul pulling back to the body again to use as a puppet, just as it had since her death, so the child let out one last blood curdling scream that seemed to
| 512 |
gmane
|
my
Kensington TurboBall does not fully function (common on most KVMs).
HTH but YMMV
Sincerely,
R. McFarlane
So I guess I'm nearly ready to get this wiki going -- still need to find a
way to have people register, and am still reconsidering where to put the
Action Bar.
BUT if y'all could check it out and tell me any glaring errors you see or
future problems I might be setting myself up for. I'm a newbie to pmwiki
and am sure I've made all sorts of errors.
Thanks!
Hi all,
below is a possible replacement for rcs.c's rcs_expand_keywords.
Since my use case doesn't care about time zones, the rcs_set_tz is
missing, but otherwise it should work without further changes.
The memrchr might need to be replaced with an inline loop, but that's
one of the few saner GNU extensions recently...
Most importantly, this actually has a readable version of the $Log$
handling.
Joerg
Hi,
I've searched the net andfound basicly 2 threads talking about the message:
ng_mppc_decompress: too many (4094) packets dropped, disabling node
in FBSD 6.3
http://lists.freebsd.org/pipermail/freebsd-bugs/2008-April/030183.html its
a pr 123045
and 5.4. http://markmail.org/message/lptpp4qmiwksazxc
basicly suggested to set define MPPE_MAX_REKEY to a higher values
and found somewhere a patch that changes it to variable rather than using
it as macro
i saw no answer indicating this really solves the problem.
did anyone have a solution tothe problem? i'm suffering from it even i have
about 200 concurrent connections, as i read MPD+FREEBSD usually can utilize
thousands of sessions.
Thanks in advance,
Hi,
I'm using the SEM package to estimate a model with a binary variabele as
dependent variable.
In the literature I have to use then the correlation matrix, made by
function hetcor(). Literature also says that the standard errors are not
correct then.
My question is if somebody knows what the impact is on the estimated
coefficients.
If I want to calculate the estimated probability I see a large difference
if I'm using the covariance-matrix of the correlation-matrix. And I'm
wondering if this is because of the standard errors.
I hope somebody can help me.
Best,
Tryntsje
Hello!
I use Openssl 0.9.6c on Windows 2000.
I use SMIME functions available and created my ATL COM which has 2 main functions :Encode and Decode.
When I Sign or Encrypt messages with size about 3MB , the CPU usage goes up to 100%.
Is it possible something to be done about this? Even if it will slow the process a little bit?
Thanks !
Maya
Hi folks,
packagekit-qt now covers 99.9% of the 0.2 API. Daniel is now working on
the ui (I'll help him a bit), and considering is motivation and the
screenshots we've already got, I think that the KDE4 ui will be nice. Of
course, there'll be things to discuss, as for the gpk-application UI,
but we should get something functionnal soon enough.
For those wondering what is the 0.01% left : it's one function in
Transaction : GetLastPackage. Thanks to who can explain me the purpose
of this function (does it return a package_id ?).
The git repo
| 512 |
reddit
|
of the big prizes, but each person in attendance got a nice gift bag, which contained a hat, Run the Jewels pins, lanyard, Gears 4 COG, and a code for the Ultimate Edition of the game. This was in addition to a t-shirt and Run the Jewels stickers.
I will address this in the video I'll make. I'd like to make a couple this clear now though, **A TRINKET IS NEVER A SUBSTITUTE FOR A WARD! NEVER**. Plus with the added pressure you put on bottom it forces two things. 1. Their jungle has to spend more time ganking bottom lane because of the amount of pressure I am applying. 2. Your jungle can focus on ganking top and middle because you are applying so much pressure to your lane. effectively by this you are setting up your lanes for success and setting up their jungle for failure. Why? Because you are a tanky mother fucker that's why. Good luck being able to kill me or my ADC.
wtf? He hasn't even spewed really anything. All he's saying is that some things don't add up or make sense with the official story. I realize most people find it quite difficult to wrap their head around the possibility of some sort of conspiracy especially when we're talking about a situation where children may have been murdered...but can you honestly say that the official story adds up? You mention 20 dead kids and point out that the conspiracy theory is unprovable, but to be fair, there is just as much proof of any children being killed as there is proof of a conspiracy...meaning none. Have you seen any pictures of the site? Any footage of little bodies being taken away from the school or treated at triage centers? No, you haven't. Have you not seen the aerial footage? The closest any ambulance gets to the school is 2 blocks away at the fire house. An elementary school shooting is the most terrible thing imaginable, but just because you're told something has occurred in a certain way does not necessarily mean that it did happen and in that way. Also, you're not even making any sort of counter argument. You're just being a huge dick.
Oh wow..the one Im looking at is the DA-01, its only $240 on amazon. I was quoted just under $500 installed. Looks really clean though. *edit* it was the DA02 but he told me the price was $300. What model do you have? I'm wondering what the differences are now. Want to get a good'n lol
Would it be too ambitious or tedious to try to add this function to an already existing iOS app? Such as the Loadouts app or the Events app? Edit: not to say that this isn't a great app! I just remember hearing that the cost of publishing an app on the App Store is very expensive and maybe a way to bypass that is to team up with another app?
Yep, that's a familiar feeling. It's kind of a shame feeling, I think? Being naked in public feeling.
| 512 |
goodreads
|
definitely recommend it for fans of the genre or those looking for a fun series about mermaid mythology.
Disclosure: I received a copy of the book in exchange for an honest review.
A short quick read. I do love Mythology. This book is about Medusa and Aphrodite. Two great characters for sure. The book kept me wanting to read more. * I received this book from the publisher in exchange for an honest review*
picked this up because i think i read some of these books as a kid? - and i always like revisiting books from my childhood. but i had to stop reading after this sentence:
"The other school was built by the Cherokee people a long time ago and has a Cherokee teacher and nothing but Cherokee pupils, which is what Tsa'ni likes. He will never learn very much if he does not get out into the world of the white people."
No thanks!!
3.5 stars
Fast-paced and genre-busting, I mostly enjoyed Pines. It's compelling and makes you want to read until you reach the end and "know" what the heck is going on. A secret service agent wakes up after an accident he can barely remember in a town where things just seem off. He tries and fails to get both answers from residents, and to get out of the actual town itself. This book (part 1 of 3) is his journey to the discovery of the secrets of Pines. I felt parts were a stretch, but it's a novel after all:) I will definitely read the next one in the series, but won't be in a huge hurry to do so. You are left with some conclusion here, but also a look to what the future books might focus on.
I was introduced to this book in middle school and have loved it ever since. An amazing and fun book that I would recommend to anyone--especially children. Enchanting, fun, and really lovely. I have no clue why this hasn't been made into a movie yet, cause it would be a winner.
For some reason I considered giving this four stars, but honestly, why should I? I read Midwinterblood in one sitting, I still can't think of a single flaw, and it kind of changed my life. This deserves a full five and a place on my favorites list.
Marcus Sedgwick is such an odd writer. His books don't quite have a genre. Are they sci-fi? Are they magical realism? Are they suspense? Maybe. Partially. But those genre labels don't come close to describing his books. The only other book I can even compare to the two of his books that I've read might be Where Futures End by Parker Peevyhouse, another one that I loved. I feel like I need to establish a new genre for his works alone. I can't recommend this to you by genre; I can only say
Originally posted on Adria's Romance Reviews
* A copy of this book was and provided by the publisher via NetGalley for the purpose of an honest review. All conclusions are my
| 512 |
Pile-CC
|
their parents found out, they set him on fire and killed him...Freddy Krueger’s physical appearance has remained largely consistent throughout the film series, although minor changes were made in subsequent films. He wears a striped red-and-green sweater (solid red sleeves in the original film), a dark brown fedora, his bladed glove (see below), loose black trousers (brown in the original film), and worn working boots, in keeping with his blue collar background. His skin is scarred and burned as a result of being burned alive by the parents of Springwood, and he has no hair at all on his head as it was presumably all burned off. In the original film, only Freddy’s face was burned, while the scars have spread to the rest of his body from the second film onwards. His blood is occasionally a dark, oily color, or greenish in hue when he is in the Dreamworld. In the original film, Freddy remains in the shadows and under lower light much longer than he does in the later pictures. In the second film, there are some scenes where Freddy is shown without his glove, and instead with the blades protruding from the tips of his fingers. As the films began to emphasize the comedic, wise-cracking aspect of the character, he began to don various costumes and take on other forms, such as dressing as a waiter or wearing a Superman inspired version of his sweater with a cape (The Dream Child), appearing as a video game sprite (Freddy’s Dead), a giant snake-like creature (Dream Warriors), and a Hookah smoking caterpillar (Freddy vs. Jason).
In New Nightmare, Freddy’s appearance is updated considerably, giving him a green fedora that matched his sweater stripes, skin-tight leather pants, knee-high black boots, a turtleneck version of his trademark sweater, a dark blue trench coat, and a fifth claw on his glove, which also has a far more organic appearance (see below). Freddy also has fewer burns on his face, though these are more severe, with his muscle tissue exposed in numerous places. Compared to his other incarnations, this Freddy’s injuries are more like those of an actual burn victim. For the 2010 remake, Freddy is returned to his iconic attire, but the burns on his face are intensified with further bleaching of the skin and exposed facial tissue on the left cheek, reminiscent of actual third degree burns.
Not all animals understand what a human means when he points at something. Dogs get it, as do several other domesticated animals. Now we can add African elephants to that list.
The pointing test, known as the “object-choice” task, is one of the ways that scientists investigate whether animals, including humans, understand social cues. The set-up is simple: A reward, often food, is placed in one of two containers, and then an experimenter points at the container with the reward. If the animal b...
Gluten-Free Mini Maple Teff Waffles (Vegan, Allergy-Free)
The toasty sweet flavor and aroma of maple will have you jumping out of bed for breakfast! These Gluten-Free Mini Maple Teff Waffles are vegan, top-8
| 512 |
StackExchange
|
have to persist with reflection, e.g. to call ShowDialog method:
Dim method As System.Reflection.MethodInfo = _type.GetMethod("ShowDialog")
_result = method.Invoke(_manageComplexProperties, New Object() {_parentForm})
Q:
TurfJS dissolve not working as expected
Why are these two overlapping polygons not dissolving?
I would expect the smaller polygon to dissolve into the larger but instead two individual features remain.
See fiddle for code example.
http://jsfiddle.net/dejz01v4/1/
var fc = {
"type": "FeatureCollection",
"features": [
{
"type": "Feature",
"geometry": {
"type": "Polygon",
"coordinates": [
[
[
150.17271290842746,
-29.193230273074025
],
[
150.17257345522282,
-29.193108533004093
],
[
150.1727182733164,
-29.192982109706982
],
[
150.17270215866807,
-29.192968041897586
],
[
150.17271288752295,
-29.19295867580919
],
[
150.1727021587057,
-29.192949309735507
],
[
150.17270752313314,
-29.192944626690444
],
[
150.17270215872455,
-29.192939943653187
],
[
150.17272897728134,
-29.192916531551397
],
[
150.1727236093082,
-29.192911845401085
],
[
150.17273433816308,
-29.192902479307552
],
[
150.17272360934587,
-29.192893113228752
],
[
150.17273433820074,
-29.19288374713351
],
[
150.1727236093835,
-29.192874381052984
],
[
150.17273433823837,
-29.192865014956038
],
[
150.17272360942113,
-29.192855648873806
],
[
150.172734338276,
-29.192846282775147
],
[
150.17272360945876,
-29.192836916691203
],
[
150.1727289738862,
-29.192832233641017
],
[
150.17272360947757,
-29.19282755059861
],
[
150.17292964332185,
-29.1926476866836
],
[
150.1731356771661,
-29.19282755059861
],
[
150.17313031275748,
-29.192832233641017
],
[
150.17313567718492,
-29.192836916691203
],
[
150.17312494836767,
-29.192846282775147
],
[
150.17313567722255,
-29.192855648873806
],
[
150.17312494840533,
-29.192865014956027
],
[
150.1731356772602,
-29.192874381052984
],
[
150.17312494844296,
-29.19288374713351
],
[
150.17313567729784,
-29.192893113228752
],
[
150.1731249484806,
-29.192902479307563
],
[
150.17313567733547,
-29.192911845401085
],
[
150.17310885885686,
-29.19293525748209
],
[
150.17311200495152,
-29.192938003964272
],
[
150.17312269806632,
-29.192928669089078
],
[
150.17312806069813,
-29.1929333505593
],
[
150.17313342332992,
-29.192928669089078
],
[
150.1733394577387,
-29.193108533004093
],
[
150.17313342332992,
-29.19328839723457
],
[
150.17312806069813,
-29.193283715756138
],
[
150.17312269806632,
-29.19328839723457
],
[
150.17310664054025,
-29.193274379311145
],
[
150.17310349870607,
-29.193277122070054
],
[
150.17311422756094,
-29.19328648812936
],
[
150.17308740551783,
-29.193309903236564
],
[
150.17311422765505,
-29.193333318374158
],
[
150.17309277002056,
-29.19335205045138
],
[
150.1731142277303,
-29.193370782554606
],
[
150.17310349891306,
-29.19338014858978
],
[
150.17311422776794,
-29.193389514639673
],
[
150.17310886335932,
-29.19339419765641
],
[
150.17311422778675,
-29.19339888068093
],
[
150.1730981345609,
-29.193412929729856
],
[
150.17311422784323,
-29.19342697879959
],
[
150.17309277020874,
-29.19344571085969
],
[
150.1731142279185,
-29.193464442945796
],
[
150.17308740587538,
-29.19348785801237
],
[
150.1731142280126,
-29.193511273109337
],
[
150.17310886360397,
-29.193515956120518
],
[
150.1731142280314,
-29.19352063913948
],
[
150.1731088636228,
-29.193525322150222
],
[
150.17311422805022,
-29.193530005168746
],
[
150.17310349923298,
-29.19353937118939
],
[
150.17311422808785,
-29.193548737224752
],
[
150.1731034992706,
-29.19355810324369
],
[
150.17311422812548,
-29.19356746927734
],
[
150.1729081927946,
-29.193747333507826
],
[
150.17270215746373,
-29.19356746927734
],
[
150.1727128863186,
-29.19355810324369
],
[
150.17270215750136,
-29.193548737224752
],
[
150.17271288635627,
-29.19353937118938
],
[
150.17270215753902,
-29.193530005168746
],
[
150.17270752196643,
-29.193525322150233
],
[
150.1727021575578,
-29.19352063913948
],
[
150.17270752198525,
-29.193515956120518
],
[
150.17270215757662,
-29.193511273109337
],
[
150.17272897971384,
-29.19348785801237
],
[
150.17270215767073,
-29.193464442945796
],
[
150.17272361538048,
-29.19344571085969
],
[
150.172702157746,
-29.19342697879959
],
[
150.17271825102833,
-29.193412929729856
],
[
150.17270215780246,
-29.19339888068093
],
[
150.1727075222299,
-29.19339419765641
],
[
150.17270215782128,
-29.193389514639673
],
[
150.17271288667615,
-29.19338014858978
],
[
150.1727021578589,
-29.193370782554606
],
[
150.17272361556866,
-29.19335205045138
],
[
150.17270215793417,
-29.193333318374158
],
[
150.17272898007135,
-29.193309903236564
],
[
150.17270215802827,
-29.19328648812936
],
[
150.17271288688315,
-29.193277122070054
],
[
150.1727021580659,
-29.19326775602546
],
[
150.17270752249337,
-29.193263072994938
],
[
150.17270215808475,
-29.193258389972222
],
[
150.17271288693962,
-29.193249023910344
],
[
150.17270215812238,
-29.193239657863177
],
[
150.17271290842746,
-29.193230273074025
]
]
]
},
"properties": {
"color": "#1F77B4"
}
},
{
"type": "Feature",
"properties": {
"color": "#1F77B4"
},
"geometry": {
"type": "Polygon",
"coordinates": [
[
[
150.1730713119909,
-29.193174095428574
],
[
150.17311422741042,
-29.193211559693207
],
[
150.1729081927946,
-29.193391423923693
],
[
150.1727021581788,
-29.193211559693207
],
[
150.17274507359832,
-29.193174095428585
],
[
150.17270215832934,
| 512 |
s2orc
|
wide range of aspects, including party affairs of students, student communities and associations, awards and attendance loans, school roll affairs (suspension or dropping out of school), graduation and employment, student behaviors management, dormitory management and so on. As for management nature, their work can be divided into student organization management and guidance, student enrolment management for university autonomy, authorized or entrusted education administration management and civil affairs management for civil subjects (Li Hua, 2014).
There is no fixed structure in the classification of vocational qualities and there are overlapping parts in the previous researches on college counselors' competence characteristic groups, vocational abilities and quality accomplishment. Western universities emphasize the administrator, leadership and education ability of student affairs management. However, in China, people lay emphasis on their ideological and political morality, professional knowledge guidance, and transferable skills for organizing, coordinating, serving and promoting student development as well as their personal mental health. An essential requirement for the professionalization of counselors is its long-term feature, continuity, stability and extensive social identity. With the basic features of stability and long-term, counselor becomes a stable and long-term role. Only then can we talk about the issue of their professionalization (Zhu Ping, 2007), because this issue is beneficial for correctly positioning the relationship between counselors and students, implementing the scientific quantifying of moral education in universities and improving the overall quality of counselors.
Figure 1 .
1Three-Factor Model of Chinese college counselors' personal quality (SEM)
Table 2 .
2Test reliabilityAs the above research objects were only from Guangdong province and cannot represented the whole of China. Furthermore, the author wanted to reduce the questionnaire items contained in the model. So, in 2018, we increased the number of research objects which were from Guangdong, Hunan, Guizhou, Heilongjiang and other regions' universities and colleges. We expanded the sample size
DOMAIN THEORY AND MIRROR PROPERTIES IN INVERSE SEMIGROUPS
24 Jan 2013
Paul Poncet
DOMAIN THEORY AND MIRROR PROPERTIES IN INVERSE SEMIGROUPS
24 Jan 2013
Inverse semigroups are a class of semigroups whose structure induces a compatible partial order. This partial order is examined so as to establish mirror properties between an inverse semigroup and the semilattice of its idempotent elements, such as continuity in the sense of domain theory.
INTRODUCTION
The branch of order theory called domain theory was initiated in the early 1970's with the pioneering work of Dana S. Scott on a model of untyped lambda-calculus [27]. Of special interest among the class of domains are continuous semilattices. This is partly due to the "fundamental theorem of compact semilattices", which identifies continuous complete semilattices and compact topological semilattices with small semilattices (see Jimmie D. Lawson [10,11] for an early form of this result, Hofmann and Stralka [9] for the original statement, Lea [14] for an alternative proof; see also Gierz et al. [6,
]).
A generalization of semilattices is the concept of inverse semigroup; it dates back to the 1950's with the works of Wagner [29], Liber [16], and Preston [24]. An inverse semigroup is naturally endowed with a compatible partial order (called intrinsic), and many authors have
| 512 |
YouTubeCommons
|
the teachers we had to talk with the teachers kids treated me okay i got a little special treatment you know but for the most part kids they treated me fine and when i got to high school it was a whole different ballgame when i got his popularity he was in high school dad [ __ ] high school sweetheart you know this [ __ ] man i was nerdy like i had the glasses and then i transitioned into contacts my junior year and all that stuff so when i would see him it was kind of like you know to my friend he got a girlfriend but um what i would say what junior year senior year people really started finding out yeah i didn't believe it they didn't you you said that's that girl that was on the big moment how did he was on this side what did they do high school was a trip did you get any bullying no somebody you know it was cool with everybody you had the people that didn't like me i didn't really care you had the ones that was the non-believers didn't really care either then you had the ones that were in the music industry that knew that recorded at my daddy's studio it was like nah you good we got you nowhere else then you had just the ones that wanted to just say hey i sat with her i took a picture with you but i was cool with everybody i didn't have any problems um i wasn't a problem child because my dad didn't have a problem coming up to the school yeah he didn't either but in high school it was just kind of like you seen bar baby they treated me like a celebrity but it was kind of like oh she cool you brunetta yeah she cool she's singing too i wanted talent shows wow so i mean they would they would show mad like north shore show mad love on talent shows i get up there and do my little [Music] the teachers rock with me but um high school was okay middle school just kind of scared me because i didn't know what was gonna happen i didn't know if i was gonna get in trouble by running i'm sorry daddy called my first name but let me ask you so so when when when big mo died uh how was that how was i and well let's not talk about that let's talk about you getting older and him still you know you and him having that relationship what was that like um i would get calls um they kept in touch with my grandmother a lot so i would get calls um making sure that those grades never dropped you know if your grades drove you're gonna have a problem with all of us yeah and that just wasn't from mo that was from all of them like all of them like uncle screw well uncles girl used to pop up at
| 512 |
reddit
|
weapons because we already have a UI for attachments that are attached to a weapon. Edit: Basically I don't see the reason to have attachments that are already on a weapon in our backpack. It's just more to filter through.
Wow, that's a ton of extremely helpful input! Thanks a lot! Let me provide a bit more context and maybe you might be able to help me narrow down the choices and figure out where I can make compromises... What I'm trying to achieve is the ability to live-stream bands' performances and jam sessions with as few additions to my existing hardware as possible . I view it as a free/cheap promotional service for local musicians as well as an occasional hobby for myself. I don't intend to make much profit - if any - so any purchases I make need to be cost-efficient and justifiable. I can currently sync the audio from my DAW with the video signal before they're streamed together. However its imperative that the signal latency *into* the DAW is unified across all inputs, making me apprehensive about the ADA8200 pre-amp solution. * Is there any way to artificially increase the latency of individual inputs on the Tascam with enough precision to accurately match the incoming signals from the ADA8200? ** Could this be done pre-DAW in order to remain CPU-efficient. * If it's possible, then how could I identify if another more affordable interface would be capable of the same thing? I'll start looking for affordable powered mixers with direct analog outs, but all of the other options seemed too costly. Any other suggestions?
Having nothing much else to do to pass the time, they engaged in frequent conversation with each other about whatever tickled their fancy. Well, one year, a sapling took root between the two trees and having not much else to talk about, they argued about the sapling for years. "It's a son of a beech," the beech would say. "No, it's a son of a birch," the birch would say. And back and forth they would go. Well one year, when the sapling was starting to get big and tall, a woodpecker happened to fly along and land on the beech. The beech, seeing an opportunity to settle this argument once and for all, said, "Hey, woodpecker. I need a favor. I want you to fly over to that young tree there, and tell me whether that tree is a son of a beech or the son of a birch." Well, the woodpecker not having much else to do said, "Sure thing!" and flew over to the young tree and gave it six good taps. *-tap tap tap-* *-tap tap tap-* And flew back. "Well?" the birch said. "Well?" the beech said. "Is it a son of a beech, or the son of a birch?" The woodpecker said, "Neither." "Neither!?" "That, my friends," the woodpecker said, "is the best piece of ash I've ever put my pecker in."
Yep me too, mostly for older generation though. For most I say we met online, I'm not
| 512 |
nytimes-articles-and-comments
|
him and future presidents in check. The Trumpublicans in the Senate are on the verge of unleashing presidential power that will certainly upend our constitutional system for good. They ought to think about how future generations will get that genie back into the bottle.
@NM
Not enough has been written about Trump’s use of blatant propaganda techniques, and how people are swayed by them without even knowing it--why hasn’t this been exposed? A friend in Germany texted yesterday to ask this question. She basically wanted to know why the US is allowing a Hitler to rise and hypnotize (her word) so many people.
Obamagate is one of Trump's most narcissistic and cold distractions. There are over 85,000 deaths of our citizens and he remains obsessed with just one person who is stuck in his warped and threatened psyche. While Obama represents "amazing grace" around the world Trump is the tragic epitome of a national and international disgrace." President Obama tweeted his response to these preposterous accustions in just one word-"Vote." His predecessor must be defeated by large margins or he will likely denounce the election as rigged causing civil discord and even demanding the result to be determined by the Supreme Court. The former president might add a few more words to his counter tweet-- "Vote and vote in the largest numbers in history to remove this disgrace of a little man from dismantling the democracy we have known for decades." Mitch McConnell has told him to "shut his mouth" by breaking with the tradition of speaking out about a predecessor. Does that same tradition not apply to Trump who has broken with it hundreds of times by demonizing his predecessor? Please Mr. President, keep speaking the unvarnished truth over the next months. We need to hear your reasoned voice now more than ever.
Donald Trump is the last person I want to hear from about our current crisis. Going back to his efforts to evict African Americans from the family's real estate holdings in NYC, he is a HUGE part of the problem. He reads statements written by staff members, doesn't understand what he's reading and certainly doesn't believe what he's reading. You can hear it in the shallowness of his voice compared to the full throated poison he spews at his rallies. I want to tell him: Enough. Go away.
If only the US government controlled property and liberty the same way China does, then we could be as great as they are!! Perhaps we can increase our GDP by using political prisoners (you know... Trumpers) as slave labor as well, and tighten up the spread of information by locking down the internet so most people will only see government-approved info.
Maybe then we can be the same prime immigration destination that China is, as sooooo many people have left so much behind to start a new life in China over the past 200 years. Sure, American exceptionalism is just a silly idea.
We must remember that despite his bellicose rhetoric this US president remains woefully ignorant of the importance of culture. He filled
| 512 |
realnews
|
monopolies made no sense in the 1970s and make even less sense in the age of the internet and easily obtained competing quotes,” he adds.
“When governments interfere in insurance markets, in the policy that should result from actuarial calculations, governments subvert the sound basis for such risk management,” Milke writes.
Related: Intact CEO hopes B.C. is ‘starting to think about introducing more competition’ in auto insurance
What suggests that “continual decisions” made since the end of competition four decades ago – before 1973, he notes auto insurance was provided by 183 private enterprise companies – includes the political shielding of riskier cohorts from actuarially based risk premiums and political interference in rate setting.”
The result of this “is that political interference, thus, skews insurance premiums higher for lower risk cohorts such as females and older drivers,” Milke notes.
The report’s other five options, combined with competition, for policymakers include the following:
status quo + tinkering: policy reform include legislative changes that would direct ICBC to take into account only actuarial realities, which in practice, would lead to rate increases for young males and reductions for, among others, females, older families and seniors;
“liquor store” model, ICBC + competition: ICBC to be retained, but with mandatory (basic) insurance opened up for competition to the private sector;
sell/give away shares (or both) to public, ICBC + competition: has potential, but might be sub-optimal, since an insurance company with an existing portfolio owned by every British Columbian would face great political pressure to retain the existing monopoly on basic automobile insurance and competition in the basic coverage might be thwarted;
privatize ICBC “AT&T”-style + full competition: province could subject ICBC to a break-up of its various components, thus creating smaller companies in competition with each other and critically in competition for consumers; and
shutter ICBC + full competition”: ICBC could be wound down with full competition allowed in B.C., mimicking the current Alberta competitive market for basic and optional insurance.
“We need to look at real reforms to our auto insurance system in B.C., otherwise drivers will continue to get gouged by a politically-manipulated monopoly,” CTF’s B.C. director Kris Sims notes in a press release.
“Limiting payouts to injured British Columbians and hitting them with photo radar are terrible options. Let’s break the monopoly and let competition help keep rates in check,” Sims emphasizes.
Greenpeace has been a fly in the ointment of the consumer electronics industry with its Greener Electronics Guide, which has delivered some harsh scores to gadget-makers over the years. Now, the group is tackling the IT industry: Greenpeace says the IT industry has shown “inadequate leadership in tackling climate change,” and it has launched the “Greenpeace Cool IT Challenge,” which ranks IT firms like Sun (s JAVA), IBM (s IBM), Cisco (s CSCO) and Microsoft (s MSFT) according to their climate change fighting efforts.
Advertisement
As with the first surveys of gadget makers, not a single IT firm out of the more than a dozen featured scored above a 30 out of a score of 100. Basically, Greenpeace failed the
| 512 |
ao3
|
had been creaming his pants over for the last three months and it was their day, Diego had told Klaus that it was his day. Anything that he wanted was his.
And there was one thing floating in the back of Klaus’ mind.
_ Dump Jackson, be with me instead. _
But he stayed silent, only screaming when he saw something on screen and clutching Diego's hand.
The clutch had turned into Diego wrapping their fingers together, kissing the back of his hand. Klaus froze..
“Diego. No. Boyfriend.”
Diego didn't let go, he pulled Klaus closer.
“I'm sorry. I know. I just… Klaus…”
“If you didn't have a boyfriend, I wouldn't mind this but Diego, you're with someone who loves you. This, this is cheating.”
* ~•
They moved to some swanky little restaurant. that Klaus was way underdressed for. The hostess didn't say anything but Klaus didn't like the look that she gave Diego and the smile that he returned in the process.
“Anything you want, Klaus. It's on me.”
Klaus grinned, his eyes scanned the menu and he settled on the surf and turf. Diego had the same.
It was silent as they waited for the the food.
“I know that you said that we couldn't fuck unless I dumped Jackson and I got that, I understand completely. But Klaus, baby I-- I think I want to…”
Was this happening? Was Klaus about to get the answer, the words that he wanted to hear for so long?
“Klaus?”
Both Diego and Klaus turned their gaze to a man standing next to their table. 6'1, with sandy blonde hair and a dazzling smile. Blue eyes bore into Klaus.
It took Klaus a while to realize who he was.
“Heinrich?” Klaus stood up to wrap the man in a hug, and in turn, Heinrich placed a kiss on his cheek.
“It's been so long Klaus! Look at you!”
Heinrich pulled back to take Klaus in, scanning over his form and Heinrich licked his lips.
“Still that skinny little thing. Always good for dominating.”
Klaus blushed, he glanced at Diego, who was clenching his fists.
“Easy, tiger.”
Heinrich glanced over at Diego. His eyes narrowed at the man. “Boyfriend?”
“Kind of. Used to fuck. It's our---”
“Birthday.” Heinrich added. “I remember. Happy birthday, Klaus.”
“If you don't mind.” Diego stood up. He reached for Klaus. “We have plans that I would love to get back to.”
Heinrich smirked and he held out a card for Klaus to take. “When you get a chance, call me? I would love to have fun with you again.”
Heinrich walked away, leaving the two of them alone.
“Who was that guy?”
“No one.”
“No one? He seemed really friendly towards you. Did you and he…. Did the two of you used to fuck?”
Klaus shrugged. “Yeah. So what? That's really none of your business. We're supposed to be having fun, Diego. We should get back to that.”
+
The ceremony for Ben turned out to be a lot more than Klaus expected. for Klaus than he thought.
| 512 |
realnews
|
top of the crease, where Kreider tapped it in for his team-leading 24th goal.
Subscribe to Newsday’s sports newsletter Receive stories, photos and videos about your favorite New York teams plus national sports news and events. By clicking Sign up, you agree to our privacy policy.
Host Henrik
The Rangers got together at Henrik Lundqvist’s place to watch the Super Bowl.
“I think it’s the third time we did the Super Bowl,’’ he said. “It’s nice. We get everybody together and watch the game.’’
Though the game was a snoozer, it didn’t seem to bother anyone.
“At least it was a tight game,’’ Lundqvist said. “At least it made it a little exciting, I thought. It was all defense, but it’s good enough.’’
Claesson closer
Defenseman Freddie Claesson, out with a shoulder injury since Jan. 12, participated at the team’s morning skate while wearing a red no-contact jersey.
Updated
Premier Anna Bligh says an interim report on Queensland Health (QH) payroll problems shows contingency plans were not in place.
However, Ms Bligh says improvements recommended by the auditors KPMG after the first two pay runs have all been implemented.
"We expect to see similar improvements every pay round and everybody's back pay or adjustments made as quickly as possible," she said.
She says Health Minister Paul Lucas has rolled up his sleeves and done all that is humanly possible to overcome the problems.
Mr Lucas has criticised well-paid senior bureaucrats involved in the payroll debacle and future reports will analyse what went wrong.
"One of the things that I'm looking forward to very much, both from KPMG and also the auditor-general, is to make sure that we are fully appraised of what went wrong here," he said.
"We're entitled when people sign off - senior people on big money - sign-off on something ready to go live, that we can expect it to go live."
But Opposition Leader John-Paul Langbroek says that is not good enough.
"We didn't need this report to see that Paul Lucas failed abysmally," he said.
Topics: health-administration, government-and-politics, public-sector, states-and-territories, health, doctors-and-medical-professionals, health-policy, healthcare-facilities, brisbane-4000, australia, qld, bundaberg-4670, cairns-4870, gladstone-4680, longreach-4730, mackay-4740, maroochydore-4558, mount-isa-4825, rockhampton-4700, southport-4215, toowoomba-4350, townsville-4810
First posted
We're not sure who would be getting on Jack Osbourne's case after he assisted in the rescue of a drowning woman earlier this week in Hawaii, but...it takes all kinds, apparently.
In response to some folks who were "oddly hostile and rude" to the newly married father of a 5-month-old daughter, Osbourne took to Facebook to clarify the roles he and a buddy played on the beach that day.
"I never said I was the sole contributor in the rescue," he asserted. "In fact, I haven't said anything at all. The last thing I want to do is take all of the credit when in fact there were a few people who helped save her life."
Get the details on Jack Osbourne's Hawaiian nuptials
Top Entertainment Photos
In fact, it was Osbourne's wife, Lisa Stelly, who proudly tweeted about her hubby's rescue efforts.
Osbourne writes that he
| 512 |
reddit
|
that they see all around them every day. You tried to make an underhanded concern troll jibe at someone, mucked it up with a horrible analogy, and got called on it.
They won't be doing native t2s any time soon and here's why. If they released Thanos or SW t3 next update, every t3 they would release after that would harbour no interest from players. Everyone would recommend saving t3 mats for these big powerhouses, and ignore all the other small time t3s, because regardless of how much of an improvement they get, they'll always be beaten by SW and Thanos' t3s. This means that NM would lose out on selling T3 packs to players and only the elite whales of whales would be inclined to t3 everyone. By saving the big T3s till the end, NM het to keep making profit from selling packs to players who want their favourite t3s or who want better t3s each update.
Sounds silly, but own whatever you do. You spill your drink on the floor? No big deal, apologize and clean it up with a smile. Bump into a hot guy on accident, say sorry, flash a smile, and keep walking. Have to give a presentation? Get the hell up there and tell the people what you know. I always used to be super awkward, but then one day I was so miserable and friendless, I said to myself, " What the fuck do I have to lose? I'm confident playing sports but nowhere else? Fuck that." So I just decided that if people were going to tease me about something, I at the very least wouldn't give them the satisfaction of letting them know I was embarrassed.
I have miconazole cream to use on my face. Currently I rub it into the affected areas - nose, chin. Is this ok, or am I supposed to rub it over my whole face? In addition to the problems on my nose and chin, I get redness on my entire cheeks, but not sure if that is seborrheic dermatitis or Rosacea or something else.
>uses certain phrases to denote a statistical certainty, which is explained in the report. Lol - "Unless otherwise stated, the Intelligence Community's judgments are not derived via statistical analysis." https://www.dni.gov/files/documents/ICA_2017_01.pdf#page=23 Their methodology assigns a number akin to probability masses to the statements, but they don't actually do any type of real statistical analysis. Their methodology is for propaganda purposes.
It started long before then. An interesting note they made is that over the last 50 years, this trendline is almost unbroken. You can't even see where the recessions were. The unemployment rates goes up and down with recession, but the number males out of work long term, mostly older males is always going up
Team Snagem is currently low on members and actively recruiting!
I'm sure you've all had the itch when you see a trainer or gym leader send out a Pokemon you really want. The itch to snag it up and make it yours then and there. Well at Team Snagem we
| 512 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.