diff --git "a/CovidQA/training/Q/train.target" "b/CovidQA/training/Q/train.target"
new file mode 100644--- /dev/null
+++ "b/CovidQA/training/Q/train.target"
@@ -0,0 +1,91387 @@
+recombination
+E-value
+522
+power of 2
+March 11, 2009
+polio incidence
+188
+community information
+Forty-three
+Supplementary File 1
+additional analyses
+DI-R reverse primer
+Animal Center of Guangzhou Medical University
+EBER2
+modern mass spectrometry
+protein expression
+Mucins
+MMLV reverse transcriptase enzyme
+15
+nuclear export of unspliced and partially spliced mRNAs
+PBMC
+fever
+Data points representing non-symptomatic animals
+2.0
+TNF-α
+Swab sampling and experiments
+IFN-β promoter activation
+RSM
+1, 6, 10 and 14 weeks
+labeled cell bodies
+Modification indices
+7.6%
+align nucleotide sequences exclusively
+0.9% NaCl
+y
+changes in γ
+Weiskopf et al.
+Agilent SurePrint
+SDS-PAGE
+QI
+76%
+2006
+Constitutive immune processes
+2
+multiple cardiovascular diseases
+airway
+Balkan endemic nephropathy
+169
+fever, respiratory distress and neurological disorders
+reactive oxygen species
+EBV transformation
+between 6 weeks to 2 months
+Thermo Scientific Multiscan EX
+vaccine developments
+hsa-miR-106b and miR-93 108
+29
+HP-PRRSV and PRRSV
+a designed change of the potential NXS/T motif
+regression analysis
+annotated red boxes or ellipses
+α1 CD2 domain
+Bikaner
+4uC
+pMK117
+NS5B
+No obvious cytotoxicity
+80 mM dynasore
+38
+constrains the walk path
+Liver cirrhosis
+ssDNA PI
+Bats
+Cerebral malaria
+30
+5 × 10 4 per well
+Epidemiological
+Fast Start Universal SYBR Green Master
+C. pneumoniae
+Peptide-coated, mature DCs
+4.67 pmol mL −1
+new and re-emerging viruses
+needle exchange services
+digestive enzymes
+properly addressed proteins to cell compartments
+anticodon
+decision-making
+suilysin
+Twenty-seven
+both sense and respond to the volume of proteins trafficking through the system
+ImageJ
+age, gender, risk factors, and secondary infection
+move
+Tcf4
+cooperation between TLR2 and TRIF
+human monoclonal antibodies
+resident memory T cells
+11-month
+1 week
+E3
+multiple cross-species transmissions from sooty mangabeys
+inhibitory cellular responses
+Bright red
+inhibits
+5780 cells/μL
+a contact is considered broken
+when it adsorbs to a host cell
+delivery of Cas RNP
+binding sites
+18
+NLRP3 inflammasome activation
+6
+realist reviews
+23 602
+RLU values
+Elevation
+cleaning behavior
+V2-apex
+28
+adjuvants
+genomic RNA hetero-and homo-dimers
+automated geocoding software packages
+Small red squares
+bacterial enteritis
+67%
+the least stable genes
+33
+0.95
+genes for glycoside hydrolase and PTS
+42
+Pisum
+non-survivors
+AMA1-specific and/or non-AMA1 IgGs
+RNA sequencing
+Isotype antibodies
+aseptic techniques
+SR
+Oral informed consent
+inhibits translation
+Countries' population, gross domestic product and income
+3D
+8
+rifampicin
+reticuloendothelial cells
+systemic heme metabolism
+Three
+Hispanic
+GFP-L
+immunodominant
+Gag processing
+Student's t-test
+dysregulation of immunity
+changes in phase
+GenePix Pro 7.2
+20 min
+57.9 years
+Fisher exact tests
+ZEN
+slowing of the normal fork speed
+graphML
+2009
+New York
+three
+Mantel-Cox test
+16 h
+Deprotonation of the His37 tetrad
+SIgA
+the secondary structure of neither the 3 0 nor the 5 0 DB
+five
+treatment and prevention failures
+Large numbers of persons who are not at-risk but who are concerned
+Environmental samples
+A random forest
+IgA2
+Proteomes
+limitations of the methods used
+44 × 42 × 40 mm
+antiviral
+Oct-4 siRNAtreated LC-CD133 +
+Phellodendron phosphor
+0.1-0.3 lM
+further studies
+20
+influenza
+VRC 500
+CD4 + T cells
+Environmental effects
+unmodified uridine
+geographical
+Twenty-eight days
+Lactoperoxidase
+21/3/2020
+neutrophil oxidative burst capacity
+non-parametric
+a non corneal pathogen
+an age-structured population and multiple strains with cross-immunity
+2.2 kJ/mol
+engineered
+Twentyfour hours
+Victoria
+RNeasy Mini Kit
+T-cellmediated adaptive immune responses
+bone marrow neutrophil stimulation and mobilization pathways
+acidification
+2 or 7 days
+35 min
+Frequent control
+between 1 and 7 days
+13AE3%
+BW
+IL-22
+120 hours
+immunosuppression
+57
+formalin inactivation step
+10%
+STAT3
+suspended replicates which were not sequenced
+haemagglutinin and the neuraminidase
+7-8 ml/kg
+dopamine theory
+FDR of 0.1
+Syncytium formation
+TNF protein
+Enolase
+severe outcome
+protein transport
+ECL Western Blotting Detection Reagents
+atelectasis, pleural effusion or acute pulmonary embolism
+∩ ξ P S
+three
+endotheliochorial
+control RNA molecule
+ChAdOx1 Zika
+100%
+30%-65%
+3/9 bats
+DF-1 cell line
+rRNA
+closely-related viruses
+multiple-host FMDV
+Stem 1
+N = 12
+inflammasomes
+renal function test, urinary output or vasoactive drugs requirements
+genetic diversity
+coma
+80%
+VaxiJen V2.0 server
+handwashing
+295
+Modification indices
+tubulin polymerization and stabilization
+Fuhyohigai
+A threshold of 13 %
+a 9mer peptide-epitope
+244
+autophagic death
+4
+Γ νβ
+pediatric
+During the day
+22 days
+reduced
+liposome co-floatation assay
+3 days
+rituximab
+prokaryotes
+21
+Obtaining singlespecies genomes from culture
+1 ml of each reaction
+1 × 10 6 cells
+Autophagy
+persistent infections
+21 days
+0.4μg/kg/min
+chemical kindling
+an MOI of 1
+automated sequencing machines
+contacts with adults who are too sick to attend such mass gathering events
+10-fold
+amino acid composition
+IFITM1, 2 and 3
+Bryopsis plumosa and Caulerpa prolifera
+30 %
+significant associations at P < 0.05
+A, B and C
+point-of-care
+t 0
+the results with and without ChaseABC
+Seven weeks
+E. coli strain SM10 λpir
+9 cm H 2 O
+revert the up-regulation of PD-L1 by BCG
+monocytes
+mental health material
+David Delo Research Grant
+QGR and QGG
+Supplementary Data
+SARS-CoV
+continuous variables that followed a normal distribution
+three
+75
+essential
+traditional cardiovascular risk factors or the male-related phenotypes
+dehydration or catabolism of muscle protein
+fulminant
+proinflammatory
+phylodynamic modeling
+blast injury
+20
+30%
+inevitable
+Twenty
+conserved regulators related to high and low viral pathogenicity
+viral DNA content
+lack of financial means
+four
+10.1186/s12985-015-0439-5
+AlamarBlue reagent
+autophagosome
+Plasma BUN and Cre
+60 mbar
+haemagglutination
+more than 3
+IL-10-like
+BAL fluid
+E
+4,885
+encephalomyocarditis virus
+RSV-specific qPCR assay
+Translabel metabolic reagent
+peptide hits
+intentions
+GATA2-mediated relative luciferase activity
+MRPL19
+National interest
+7
+maxillofacial
+36%
+Siderophores
+1 week
+L. calcarifer
+major histocompatibility complex
+10-20%
+maximizing the number of mixed
+Eleven
+C57BL/6
+491
+Student t test
+p-198A
+meeting IHR obligations with regard to points of entry
+Cryptosporidiosis
+just over one third
+80
+two-fold
+22.7%
+catabolism pathway
+expensive equipments, considerable skills and high costs
+surviving
+antidepressants
+open doors, open windows and AC systems
+influenzal infection in ferrets
+5 min
+gel loading dye
+carrageenan and Zanamivir
+ribosome
+U18666A
+Novel influenza vaccine designs
+10% PBS-buffered formalin
+Vif-SIVsmE041 degradation
+Th2 cytokine production
+Figure 3
+1 hour
+~200,000
+OATP1B3 surface protein levels
+whether the identified organisms belonged
+p * class of models
+Thailand
+The current management and treatment of COPD exacerbations
+closed communities
+HAART
+four
+IFRD1
+BHK cells
+The development of antibodies
+supernatant and cellular lysates
+Collagen remodeling
+American Thoracic Society
+pre-epidemic warnings
+healthcare-related costs
+0.037
+Fig 6
+fragility
+The PM
+three
+deformation of the cell from cell-substrate and cell-cell interactions
+enhancement
+other provinces of China
+49
+Nested logistic regression models or ROC curves
+longer
+abuse and violence
+amplifying a fragment of 1,740 bp
+TNF-α
+novel mechanisms of APC assembly and regulation
+IL-6
+Staufen1
+Four
+Pseudotype or recombinant VSV
+Ebola virus
+1811
+APACHE II
+purely expressive
+communicable diseases
+2 minutes
+195
+canonical
+α=0.05
+confirmed bacterial, viral or probable bacterial or viral
+RanBP10
+severe hypoxemia burden
+ROS
+to ensure reproducibility
+IBV
+Derek Wanless
+naturally processed foreign peptides
+the cell body
+Spring Festival migration
+elastase
+FRBs
+duration of mechanical ventilation
+vancomycin and daptomycin
+Monoclonal antibody 4G2
+4
+miRBase
+elevated levels of DNA synthesis
+allergic models and Th 2 cytokine models
+HA challenged cells
+serum antibody response
+7 days
+eft-2
+Fifty-two
+Logistic regression models
+32%
+29
+300 µl of receptor-destroying enzyme
+30% to 37%
+38%
+20.2 kg/m 2
+50%
+LIGPLOT
+10d
+mortality
+8 hours or longer
+8.5-10 million
+expression of various ISGs
+recombination
+template switching
+R i
+personal hygiene practices and health behaviors
+10
+ICD taxonomy does not adequately incorporate phenotype similarity knowledge into disease category structures
+protection against ocular inflammation
+518,313
+lower than limits
+the translocon
+influenza virus NP
+MEM inoculated tissue or cells
+40
+Two weeks
+six
+Protein phylogeny
+SHH
+Pathogen Associated Molecular Patterns
+macrophages
+Allergic symptoms
+June
+The identification of putative LIR motifs
+Bootstrap values
+reactions become unreliable
+general mental health or psychological distress
+Adjusting N c for background nucleotide composition
+atypical
+3A5
+39,642
+NS1-1, -32 and -34
+vegetation related land cover
+Frameshifting
+increased
+5 days
+endosomes
+FIND
+TCR γδ and NKG2D
+Heat and dehydration
+internal mismatches or on unique stretches of nucleotides
+centrifugation
+previous reports
+six
+multiple bilateral lobar or segment consolidation
+1.89
+25
+empty-vector DNA transfected into the effector cells
+protective antibodies
+TNF-α KO mice
+Variola major virus
+keyword searching
+mutations in additional p53 exons
+RNA integrity
+Viral production of all of the mutant versions
+motor strength and control
+Assay standardization commitments
+KUNJ, DENV and TAQ
+between individual vesicles
+4,000
+variable ventilation
+defensive microbes
+24-hour
+Vehicles for ocular gene therapy
+better chance of HCV clearance
+age
+HEM-primed PMNs
+EW 9
+more explicit control over the demographic processes regulating birth and death rates
+Interaction surface area
+five
+depopulation
+being a member of a household with a confirmed case
+21%
+Annexin A2
+100%
+10
+means to those ends
+improve nurses' job satisfaction and nursing service quality
+lower fusogenicity and decreased F activation
+117
+Initial bacterial inoculum
+RT-qPCR and ELISA
+Denaturing PAGE
+electron microscope
+virus dissemination
+implicit solvent model
+Individual variation in host infectivity
+methicillin
+Asterisks
+0.025%
+antiviral and hospitalization administration
+cc-by
+functional IFN-c polymorphisms
+gRSV-FR-GC>Us
+19
+p239
+overall protein content
+0.039 ng/mL
+Valent et al.
+five
+5%
+Correlates
+5 minutes
+intravenous immune globulins
+the previously published literature
+21
+Markovian models
+2005
+just before and 1 h post immunization
+preventing AEs
+Western blot analysis
+four
+twice weekly
+RV
+diaminobenzidine
+neurodegenerative
+IFN-α
+Flock house virus
+encoding the specific tumor antigen
+RNA6
+Ct9
+three
+Me2NH·BH3
+PPARα
+oseltamivirresistance
+Gaolan
+rupintrivir and pleconaril
+transmission uncertainty would be even more extreme
+weekly
+acidic organelles
+A 1 and A 2
+PMO production
+mice
+47
+50%
+15,014
+5 days
+Five
+Data
+continued viral growth and potentially persistent infection in mosquito cells
+fluorescence
+root mean square deviation
+19
+28 years
+the gene TSS
+USP7
+obtaining specimens prior to the administration of antimicrobials
+BB-N and S1-N
+100 weeks
+five
+emergency verbal assent
+A f i
+Identify, develop and evaluate effective behavioral interventions and strategies
+Increased mobility
+C. difficile Spo0A
+Smith-Waterman alignment scores
+all life stages of the virus
+30
+C9
+African A and O surface proteins
+viscoelastic properties
+One hundred twenty-five
+enhanced viral burden and cytokine expression
+10%
+regression and stochastic
+24 h
+small blood vessels
+classification models
+multidrugresistant tuberculosis
+polyProArg, polyGlyPro and polyProAla
+10 9 copies to 1 copy of plasmidswasused
+viral RNAs
+cell line-dependent
+specific for the transmembrane region of the envelope gene
+larger validation studies
+peptidylprolyl isomerase B mRNA
+hyper-phosphorylation of Rb
+ELISA
+5 min
+several billion
+severe thrombocytopaenia
+Zeiss Axio Imager A1 fluorescence microscopy
+thrombin and strep-His8
+BST2
+Polymerase chain reaction
+Throat-swab specimens
+their sequences hold the target molecular address
+positive for H1N1 influenza infection
+bluetongue virus
+SNP at position +166
+immortalization
+TRAF3
+good correlativity with the HI test
+cardiovascular and renal functions
+five
+n MS
+IAV
+a larger stockpile
+genes
+SA linkages and their respective distribution in the human airways
+how to balance openness and avoiding concern
+SNARES
+furin/PCSK3
+RNA
+1.8 µH
+80
+36 hours
+SVV infection
+uncontrolled DENV replication
+pCAGGS vector
+Five
+extracellular stimuli
+PTSD
+protective
+HBV persistence
+34
+RNases
+pcDNA3.1-ROP18-flag
+real media coverage data
+confirm the diagnosis
+PCR product
+PTC-124
+fingolimod and cladribine
+chemiluminescence
+mouse phenotypes
+three
+Inhibition of Pol I transcription
+Differences in abundances
+Xrn1p
+HBV cccDNA
+patient-reported outcomes
+disulfide
+A plasmid containing the cDNA of an HCV consensus clone
+seven
+36 h
+cause-of-death modelling
+Five
+All fitting and model comparison scripts
+whether an outbreak is 1-wave or multi-wave in nature
+site-specific Ca 2+ binding properties
+1.5 × 10 4 /well
+>25 000
+virologic factors
+DIG High Prime DNA Labeling and Detection Starter Kit II
+heavy rainfall and periods of sustained low rainfall
+Superdex 200
+Supporting hospitals
+c-Myc protein
+1,209,602 Da
+zebrafish and medaka
+TDP-43 aggregates
+greatly exaggerated
+exposed to non-selective solvent attraction or hydrophobic exclusion
+Mappable Interactome
+209
+infection
+day 42 sera
+six months
+H1N1v
+individuals will underweigh the true cost of illness avoidance
+G+C content
+Distinctions
+132
+false-negative results may occur due to sequence variation in primer and probe targets
+gene expression studies of sALS
+0.6-0.8 mg/ kg/day
+recognition of shared goals
+endemic or emerging
+angiotensin-converting enzyme
+5.83%
+Pfizer Inc
+six
+divergence
+400-fold
+Probit regression analysis
+Transmission reduction
+MG
+12
+avian influenza virus, Newcastle disease virus and IBV
+viral multiplication
+animal models
+55 min
+75 months
+ARDS and VILI
+twice
+PD-L1 status
+1 ll
+every 3 days
+Ribavirin
+no lower toxicity
+21 days
+40 ml
+Oleic and palmitic acids
+Resveratrol
+Rhinovirus
+sgRNA
+AS-IV
+RNA pseudoknots
+goblet cells
+elucidated
+fewer than 10
+Linear regression
+RNA-dependent RNA polymerase
+Biotin
+HBoV
+LTβR-mediated signaling
+MPC
+accumulation of NSs
+a uniform and symmetric relevance measure
+selective
+low-viral loads
+Nodal
+relevant B cell, CD4 T cell and CD8 T cell epitopes
+Full set
+increases phosphorylation
+protein synthesis
+16
+dendritic
+Tens of thousands
+THP-1 cells
+American Medical Association
+44
+RNA polymerase I
+remission
+nonpermissive environmental cues
+Bayes factor tests
+homologous recombination
+EBOV -pseudotyped virus entry into 293T cells
+14 weeks
+nine
+safety data from special populations
+Three
+two
+256
+50 ng
+large variations
+all the presumptively FIV-positive cats
+CD8 T cells
+key gaps in preparedness
+cut-off scores
+the compound myricitrin
+filovirus
+fibrotic genes
+three
+7500
+hydrophobic
+why sodium sulfite treatment would affect the virus-plant interactome
+receptor, regulator and cytokines
+selective decontamination of the digestive tract
+Nuclear import of vector DNA
+higher vapor pressure
+expected natural infections
+HA and NA sequences
+7%
+4
+GAPDH
+multi-step protection/deprotection procedures
+Chemokine and cytokine responses
+T cells
+28 days
+logistical capacity
+allograft fibrosis
+Notch
+CCR7
+kinetics
+hepatocytes
+chymotrypsin
+AtRNA/His6-MS2
+STAT6
+1 mM phosphoramidon
+hand washing
+TAR DNA-binding protein 43
+patient survival
+mAb
+virus, ferret housing condition, and exhaled aerosol sample size
+facilitated viral accumulation
+FMDV replication
+neuronal homeostasis
+11
+oncogenes and tumor suppressor genes
+external events
+chronic hypoxic diseases
+twice a week
+Macromolecular crowding
+Peter Guthrie Tait
+Further information on research design
+Liver, spleen, and kidneys
+widespread nuclear abnormalities
+murine CEACAM1
+an acute infection can have dangerous sequelae
+hMPV or parainfluenza infections
+similar objects are more likely to be related to some other objects
+Pneumonia
+pentamidine
+50%
+dwarfism, poor development, diarrhea, and mortality
+Pili
+2087
+surface residues
+further research
+The coupling of MD simulations with MCE experiments
+subclinical and asymptomatic cases
+October 4, 2009
+Cumulative evidence that might be biased
+1=p
+complementary
+Dr. M. Zerial
+21
+low-dose Ang II infusion
+mortality
+45%
+differences
+Dismal prognosis
+Co-infection of leptospirosis and dengue
+standard procedures
+8-20 s
+Seventy percent
+Forty-two
+recurrent
+Gallid herpesvirus 2
+17.4-31.7%
+5%
+four
+MDRIs
+two
+knowledge
+translation
+70%
+28.610
+three
+the existence of each protein and the S-palmitoylation
+localization and protein function
+Western blot analysis
+20
+BSC-1 cells
+1500
+soluble proteins
+regression curves
+60 days
+splicing of MIE transcripts
+iProt-Sub
+titer
+238
+cc-by
+accessibility index
+y
+a signaling cascade producing multiple biological active intermediates
+14
+the liver
+Amico Ultra 15 mL centrifugal filter
+Breseq
+55%
+doubly acylated
+pentobarbital
+three days
+Well-designed clinical trials
+500-fold
+An alternative pathway
+migratory
+His126
+IRF3/7
+35.5%
+70,000/60,000 at 200 m/z
+Thirty years
+chalcones
+community structure
+183-H12-5C
+lipopolysaccharide
+the connection between extracellular matrix and cytoskeletal muscle fibers
+multiple indistinct contact points
+0.25
+JFRL
+IAPs
+versus host disease
+75 M
+hospital mortality
+7.02-fold
+elevation
+Ras/Raf/MEK/ERK signaling
+Early identification and effective management
+HIV-negative
+Kozak consensus sequence
+80%
+Acquired immune deficiency syndrome
+cosmopolitanism literature
+non-human primate models
+Ded1p
+monomorphic
+BSA-coated beads or blank beads
+lipid peroxidation
+10%
+the latent period, the infectious period, and the detection time distribution
+EBV transformation
+factorial validity
+spatially coupled models
+k-Nearest Neighbor classifier
+Lungs
+multiple translation termination codons
+failure to adequately integrate and apply a thorough understanding of policy analysis theory
+G. Barton
+facilitates proper histone transcript processing and trafficking
+Branch lengths
+δ-Secretase
+Antibody-virus mixtures
+Ebola
+purinergic
+Room Temperature Dehydrated
+improved treatment response
+local clinics
+centromeric
+16
+a protease specific for this most conserved eukaryotic protein
+A-particle
+neuron
+ImageJ
+NS1-GFP
+rapamycin
+NF-kB/MAPK
+tropical, subtropical and temperate
+cell growth, proliferation and survival
+CAR and DAF
+mice
+influenza A virus
+ID cows
+impose few restrictions on the evolution of θ
+fetal brain
+pro-inflammatory cytokines
+Paramyxoviridae
+acute neurological impairment and mental deterioration
+81.8%
+low
+Indirect
+anti-viral immunity
+Griess-Assay
+HBV
+60
+parameters were varied
+three
+4%
+Γ
+pre-warmed media containing 4SU
+C-terminus of hsβADR1
+Karber method
+20.3%
+25%
+by monitoring the disc radial mode resonance frequency shift
+admission to an ICU, in-hospital death and length of hospital stay
+EBOV
+partner with peer navigators or community health workers
+Stimune
+LQUV
+TasA
+platelet aggregation
+four
+Far-western blotting analysis
+IL-12p70
+FLUAV
+co-evolutionary
+200 µL of chloroform
+Clusters
+Humans
+RNA viruses
+3.5pg
+by heat map analysis
+human disease
+selection for drug resistance
+163
+neighbor-net method
+Access to diagnostic tests
+anti-mouse IgA
+orbital puncture
+SOFA and CURB-65
+Influenza antiviral therapy
+miR-1306 may participate in apoptosis
+carbonic
+microglia
+pattern recognition receptors
+influenza vaccination policies
+IL-15
+HBV, HCV and HIV
+symptom scoring system
+Olig2 stained cells
+two-stage sampling
+Peak fractions
+MenW CPS
+p53
+The amount of residual soluble protein
+standardized promiscuity values
+six or more hours
+World Health Organization
+FACS-caliber
+1 µl
+druggability scores
+nasopharyngeal colonization
+binding pockets
+SA-17
+LT1 DNA
+Virus escape mutants
+enhanced RSV clearance
+very small
+Coleman et al.
+the actual needs of users
+circumcision
+hMPV progeny virus production
+type I interferon signaling
+antibiotics
+heliox improved CO 2 removal
+HI antibody parameters
+progression to LRTI
+private behavior
+feline URI
+Six
+0.5%
+H1/H5derived
+Luminescence
+Approximately twenty
+innate and adaptive immune responses
+almost 5 days
+in the producer cell
+febrile days
+streptavidin-Cy3
+IRF1
+discrete packets of information that travel as units along linear pathways
+three
+sialic acid residues
+weight
+mechanisms of virus and Ab transmission from mother to fetus
+sensitivity and specificity
+human transmission and infections from the reservoir
+162
+non-replicating PV constructs
+conformance, completeness and plausibility
+escape mutations
+Cell-free BAL and tissue samples of lavaged right lungs
+75%
+gene order
+linear models
+tryptic autolytic peaks
+NI-NTA
+3
+the cell cycle
+marker proteins
+a constitutively expressed cytosolic chaperone
+Bilateral ground-glass opacities and pulmonary lesions
+antibody-coupled beads
+stimulates FcγR2B transcriptional response and receptor expression
+Full length protein
+DENV2
+host gene expression
+NHP study
+Proliferation, clonal expansion, and cytokine secretion
+41%
+critical health literacy
+modified nucleosides
+Acetone Bisacetone derivative
+59 to 39
+FLAG-tagged OATP1B1 and 1B3
+supernatants
+0.141
+10%
+reassuring
+STAT1, ISG15, MX and PKR protein expression
+three
+SEIR model
+relationships between variables
+4%
+Coriell Institute for Medical Research
+HLA-A2 and A3-restricted tumor-associated peptides
+NPC1 + endolysosomes
+organ injury
+cellular and humoral responses
+reduced cytokine expression
+fluorescent marker and the ATP assay
+10 min
+cholesterol transporter and re-distribution to cellular membranes
+thrombocytopenia and shock
+at the time of diagnosis
+Excess 293T cells
+CD8 + T
+0.5%
+109
+effective reproduction number
+RT-qPCR quantification method
+Western Blot
+1.1 to 5.5
+ITPR1
+Total protein
+influenzainduced death
+three
+CCL2 and CXCL10
+CLEC9A or DNGR1
+real-time PCR and semi-quantitative PCR
+EV-71 infection
+defense against MDV infection
+associated parameters
+viral target cells
+SOFA score
+methyltransferases
+unpaired t test
+the last previous valid data point
+universal primer sequences
+loss of antibody surface expression
+emodin, UDCA or DXM
+vital
+future strategies
+42 V and 275uC
+hypoxic
+Pneumonia and bronchitis
+tetrasaccharide 30
+biased T-cell cross-reactivities
+Handwashing
+25%
+The evolution of MHC-CNV
+NF-B expression
+Mutations to both canonical and noncanonical sequences
+3.09 × 10 −17 μM
+polyfunctional
+lung injury
+1 h
+Mermithida
+cell cycle arrest
+mesenchymal layer
+IFN-γ
+Four
+Autophagy
+dimerization
+CedPV antigen
+glycosylation
+50%
+30 million
+10,000
+344
+1 to 16 g/mL
+antiviral
+survival
+Abcam
+DEFA1B, DEFA3 and DEFA4
+tropical-subtropical
+destroyed
+IgG1
+Spotted fever
+5 ml TE buffer
+children under age
+187
+host immune responses
+Singapore, Mexico, and Venezuela
+eight
+gene lists
+5%
+HEPES buffer with 5% DMSO
+virus replication or virus production
+cIFN-a
+Eight
+Cumulative windows
+HIV-negative
+all available randomized controlled trials
+234.2 seconds
+Endotoxin-free plasmid DNA purification kit
+SPSS 20
+20%
+pro-inflammatory
+A3-specific
+major pH-dependent conformational changes
+proteins
+TGF-β-induced EMT
+−0.0742
+66%
+severe and multiple Opportunistic Infections and tumors occurrence
+those obtained by the CSFV generic qRT-PCR
+an HPV infection
+at least 10 years
+partial pressure of arterial oxygen
+antimicrobial catheters
+43.5%
+Data
+three
+acetylcholinesterase-2
+vaccine delivery protocols and public messaging
+Primary signal intensity
+diminished
+Additional engineering
+Resveratrol and polydatin
+50 mm/min
+Phe60, Arg55 and Lys125
+cytotoxicity detection kit
+chromosome Xp22
+gondii
+a conserved sequence within the reverse transcriptase gene
+The Gene Ontology
+RAGE
+0.03 mN/m
+APP processing and Aβ levels
+no amplicons
+age
+helpful assistance
+suicidal behaviour
+surgery, chemotherapy or radiotherapy
+1995
+Eight
+two
+proinflammatory cytokines and chemokines
+viral plaque formation
+sufficient antibody responses against different viruses
+T regulatory cells
+local staff
+6.4 log copies/mL
+British and American medical journals
+Starvation
+309
+Liver lobes
+Statistical differences
+median survival
+Extracted nucleic acid
+WNV infections
+15.1 nm
+dsRNA
+1 H-NMR
+relative risk
+three
+activated
+gene expansion of IFITM10
+Meningiomas
+Ten
+10%
+70,000/60,000 at 200 m/z
+six
+modify and adapt
+antiviral
+threading of the unfolded Ub moiety
+routine viral load monitoring
+data acquisition
+specific information within mRNAs
+p-nitrophenyl phosphate
+pseudoknot induced frameshifting efficiency
+assay performance
+the chaff
+demographic differences
+12 hrs
+replication of murine noroviruses
+host immune responses
+IL-2, IL-10 and TGF-b
+germline-encoded
+a fraction of greatly varying size
+grade 3
+differences in binding efficiency to the host receptor
+severe hypoxemia
+AxyPrep Multisource Genomic DNA Miniprep Kit
+Dr. Mikhail Balayan
+DCs
+additions and subtractions
+imported cases
+Th2
+infection by some viruses
+intellectual
+eIF4G and PABP
+conformational and linear epitopes
+three
+Seventeen
+translation through a region near the 3 0 end of the polyprotein ORF
+10 g
+furin and plasmin
+the number of edges incident to a node
+Angiotensin II type 1
+12 days
+MBL2
+0.6 kcal/mol
+P. perniciosus
+keratanase
+increased levels of anxiety and distress
+mouse cTnT plasma concentrations
+t 1/2
+> 5%
+linear interpolation and extrapolation
+16E6
+resistance to BmNPV infection
+Five
+satellite imaging
+Random Forests
+table 3
+hydrophobic interactions
+CXCL9
+24 h
+SINT-speckle formation
+No difference in food intake
+leprosy
+APCs
+adaptive immune cells
+20 min
+metabolic functions
+2003
+Src
+hand-washing facilities, showers and toilets
+inhibit the virus
+10
+influenza
+Bioneer
+Thr160Ala
+anti-apoptotic effects
+IL10-R2
+lectures on health education
+total specificity
+NIH Office of Human Subjects Research
+Myc, Myb, ErbB2, Ras, and Raf
+pPG-COE-DCpep/L393
+L2 translocation
+vaccinia
+T3
+innate immune responses
+3 to 8
+TBEV
+C gives a strong binding energy
+OS9 and XTP3-B
+Numbers of antibiotic usages
+an extended C-terminal α-helix
+43,771
+expenditure on prevention of obesity
+cDNA from infected cells
+adaptation requires indirect paths
+fudging the immune response
+meningococcus
+mitochondrial gene sequences
+w k
+Leakiness
+high sample throughput
+autocrine growth factors
+Cyclooxygenase-2
+PostgreSQL
+low viral loads
+RNA interference
+7 days
+Q226L/I and G228S substitutions in the HA protein
+15 min
+Propidium iodide
+wave 3
+unpaired or paired t-tests or Mann-Whitney U-test
+Bone substitutes
+Bacterial bronchopneumonia
+Eighteen
+DNA immunization technique
+Protein A-10 nm gold conjugate
+Pneumocystis carinii and bacterial pneumonia
+differential subcellular trafficking and cytosolic partitioning
+bivariate X 2 tests of independence
+wild-type cells
+total RNA
+44
+Covaris S220 focused ultrasonicator
+transmissible spongiform encephalopathies
+evaluate the contribution of each single variable to classification
+all-cause mortality
+marine mammals
+PMScoremin
+Cinanserin
+unbiased, simultaneous profiles of gene expression
+the complete inventory of genes found in any member of the species
+Koch's postulates or other assessments of direct viral injury
+7%
+QIAmp viral RNA Mini kit
+modify the nasopharyngeal microbiota of farmers
+pandemic
+C s
+Acinetobacter Baumannii
+exhaust security
+r
+bacterial meningitis
+coding RNAs
+CDS and mature peptides
+CD225 domain
+TADR
+SPSS
+Confocal microscopy
+fasting serum glucose and Ag-RP levels
+22
+100 to 3,000
+particle size
+current ILI case data
+influenza therapy
+Three
+20
+lipid oxidation
+spring of 2009
+summer
+1167
+participates to normal type-I IFN production and control of viral dissemination
+groups
+12 person-years
+agricultural intensification
+F-XMRV-F
+Bretschneider cardioplegic solution
+proteins
+reverse intersubunit rotation
+to ensure adequate power to detect a pre--specified effect size
+citizens either infected or treated
+ARVectoNBV
+by their origin, morphology, gene expression pattern, and function
+cleaves prM
+poultry sales
+Duolink In Situ mounting medium with DAPI
+interactions with the ion centers of iron or other transition metals
+Illness consultations
+epitope tags
+nonenveloped viruses
+Protein G column chromatography
+cc-by
+Env incorporation
+constant influx of incomers
+one
+2004
+9.3
+R231A
+most points are near or under the theoretical curve
+Products of the GII.4 and MNV RdRps
+infection
+2-CTC resin
+Shuttle peptide-protein formulations
+SKD and KCA
+external rates of infection
+trauma, infection, and neo plasm
+antigenic variations
+infection or an adverse reaction to the blood components
+general practitioner
+TGEV infected pFcRn mRNA levels
+Regulation of alternative splicing of the MIE transcripts
+two
+regulatory patterns of the cell that are unique to either proteins or transcripts
+external
+Virus replication and viral infectivity
+Ͼ32
+resistance to disinfectants or biocides
+tropical underdeveloped countries
+Egypt
+10%
+median clan sizes
+Fifteen
+100 mg/ml fetuin
+contact with the febrile person
+membrane-tethering activity
+HPLC and mass spectrometry
+sera Lectins
+polysome profiling
+rVSV/EBOV GP entry
+truncated NS1
+HEX and FAM fluorescence dyes
+generally broader ranges of acceptable parameter values
+18th
+additional purposes
+80%
+ATP
+NOX-1
+mixed taxa
+Sperm
+macrophages and dendritic cells
+Wilcoxon rank sum test
+IL-4, IL-13 and IL-10
+epithelial disrepair
+Variation in coat colour
+50-fold
+attending physician or intensivist
+optimal intervention
+other type of abnormality patterns
+T. b. rhodesiense
+β-secretase specific fluorogenic substrate
+p S and p P
+LncRNAs
+reduced
+viral entry
+growth curves
+Detection of ALT in serum
+flow cytometry
+serum samples
+nystatin
+NK cells
+viral fusion
+a seasonal influenza
+STATA
+detection mechanisms that use probabilistic analysis
+acyclovir
+populations are independent
+hormone-sensitive lipase
+EMAN
+failure to mount full Th1 cell immunity to viral infection
+V'max FRC
+Formal criteria
+90%
+performance outcomes
+Model 2
+CD122
+Three
+Target concentrations as low as 0.14 ng/mL of HBsAg
+SSTR2
+1957
+since ancient times
+Graphpad Prism 5.0
+symptomatic
+scientific explanation and guidance on some psychological phenomena
+prevents the spread of virus from infected cells
+ELISA plates
+13
+haemagglutinin
+appropriate stability of the instrument
+cell surface
+statistical analysis
+CDK2
+The time course of the reproduction number
+SV40
+national ethics committees
+Five
+sympathetic
+22
+SuperScript III One-Step Platinum@ Taq
+LE/L cholesterol accumulation
+they are of biological significance
+5 min
+1.5 ml
+pigs
+3,099
+when both antigens were combined
+how members of the general public respond to pandemic influenza
+intracellular protein turnover
+compliance
+26
+bias and unavoidable stochastic randomness
+BALB/c mice and Hartley guinea pigs
+Relative expression level
+Lasso
+cloacal and tracheal excretion of LPAI
+Sequences of codon-optimized prME genes
+100
+pseudo
+cross-reactive cytotoxic T lymphocytes
+1918
+Spatial heterogeneity
+personal protective equipment
+Doxorubicin
+6
+the proliferation of lymphocytes
+a unique receptor
+SuperScript II RNase H-Reverse Transcriptase
+13%
+100%
+11
+peripheral blood and marrow
+19
+Hidex Sense Microplate Reader
+blindness, chronic bronchitis, and cancers of the respiratory tract
+Leica Microdissection System
+Sheep and goats
+Dbp5p
+variability of its measurements
+T helper 1
+forbs and grasses
+proteolytic degradation in serum
+World Health Organization
+high
+epidemiological
+Influenza Virus
+Invitrogen
+AaHig
+protein residues with the ligand molecules
+weakly active
+$20 g
+live attenuated vaccines
+92%
+monomeric RNA:protein complexes
+neuron cells
+neutrophil elastase
+oxygen requirement
+Repeated therapeutic lavages
+creating a safer global blood supply
+Metabolic acidosis and hyperlactataemia
+an RNA chaperone
+pro-survival effects
+Epithelial differentiation
+Lv2 restriction
+30-40%
+depression
+Rutin
+RPMI 1640 medium containing 10% fetal bovine serum
+week 6
+The first chain cDNA
+PRRSV replication
+Frameshifting
+immunomodulatory
+zero
+Aedes albopictus
+multifactor complexes
+One microgram of RNA
+24 hours
+29.8%
+ARIs
+pandemic category 1
+27 yr
+parasite metabolic processes and host immune modulation
+Anxiety and Depression Scale
+UBA domain
+distributions of plausible values
+ELISPOT assay
+SBV, BQCV and ABPV
+atypicality of a region in terms of oligonucleotide usage
+moderate cerebral edema
+0.60
+TRIzol
+inconsistent test performance
+78
+EC apoptosis
+Leucine enkephalin amide acetate
+compounds with bacteriostatic effect
+a prey library of human kidney cDNA
+favorable outcome
+56.4%
+Skog et al 50
+HMGB1
+women
+Molecular knockout studies
+Conformational epitopes mapping
+One-hundred
+random-effect meta-regression
+More work
+DVG-324NC
+phenix.sculptor
+interstitial pneumonia with consolidation and hemorrhage
+data
+5 min
+whether motif D is in an open or closed conformation
+moDC
+Cardiac myofibroblasts
+p63 pos LNEPs
+myxothiazol
+Eight
+Nucleofector6 electroporation protocol
+5-10 genome copies/PCR reaction
+a lentiviral gene-therapy vector
+6 weeks
+more intensive production systems and more rigorous biosecurity measures
+using the same tissue sections
+t-test analysis
+two
+CDC
+eIF4G-depleted RRL
+Three matching trimers
+gene expression patterns and kinetics are different between these tissues
+Eigenvector centrality of a vertex
+lipid-based nanocarriers
+Br-ApoE -PMO
+Diffuse alveolar damage
+High-quality sequence reads
+796
+20
+700,000
+active mucocutaneous PV
+care facilities, the military and the cruise industry
+hygromycin B
+non-intuitive
+Light of Friendship Association of Taiwan
+respiratory epithelial cells
+53
+four
+IL-6
+three
+0.05
+CTFFIND3
+0.1% of Triton X-100
+NYMV and MIDWV
+50 mg/ml
+public health policy as well as health care delivery
+743,599
+increases
+Lentiviral shRNA vectors
+random mixing by degree
+13
+Cell count
+7-day
+normal function or minimal disability
+that in other places
+A. caninum
+Seventy-four
+apoptotic death
+Three weeks
+routinely-used laboratory methods
+Saudi
+IL-4
+June-July
+evolution of nanomedicine
+UV spectrophotometer
+the factor of the distance between the candidate and the diagnosed patient
+Analytical sensitivity
+S-foci
+modulation of the host response
+PCR
+endothelial cell inflammation
+to assess cell autophagy
+26
+tropical
+48 hours
+3,5-DCQA
+SDS 1.3
+Tyr397 phosphorylation of FAK
+rapid development of varices and bleeding
+NTZ's ability to suppress replication of PKR-sensitive viruses
+antiviral
+regulating antiapoptotic genes
+Pictet-Spengler cyclomethylenation
+20
+SPAM1, CRISP1, and IZUMO
+100
+ACBD3
+target-decoy based strategy
+less than 20 min
+Spontaneous immortalization
+a lobby at the lift
+PltA and PT-S1
+to increase the chance of finding any endogenous MS2 RNA in the stools
+HPIV3
+protein or RNA structure prediction approaches
+an optimal panel of synthetic polyomavirus antigens
+recombination
+retinal ganglion cells
+3
+crossover recombination
+7 days
+Institutional Animal Care Committee
+Poly-dimethylsiloxane
+HSV entry
+50%
+to reduce the risk of smallpox
+Group1
+qRT-PCR
+probes to detect SGs in the training set of images
+antibiotic
+NS3
+staggering levels of complexity
+RNAhybrid tools
+default parameters
+Anigen rapid CPV/CCV Ag Test kit
+multiple sclerosis
+new interfaces involved in protein-protein interactions between host and pathogen factors
+Table A1
+Removing the other branch lengths
+Substantial genetic diversity
+renal replacement therapy
+Four
+minimum clinical standard
+binds to PKR and inhibits PKR activation
+M2
+Mx1-Cre transgenic mice
+lectins
+what elements of the feature were the main determinants of the difference
+20%
+PDE4
+rapid sampling and sequencing of the Western Africa's 2013-15 outbreak sequences
+390 million
+polyprotein
+unmodified siRNA molecules
+Microbial translocation
+The manuscript
+random forest
+Microglial numbers
+X-ray
+minimize animals' suffering
+bf
+viral infections
+spoIIAA, spoIIE, and spoIIGA
+endogenous lamin A and C
+Three
+immunohistochemical staining
+once, twice or three times
+three
+Microbiological samples
+correctly detecting an epidemic of influenza
+Timeliness
+value was assigned the highest concentration of inhibitor tested
+Fronhoffs
+Structure-guided biochemical
+bacterial ribosomal RNA
+2009
+Natural killer cells
+Kenya
+TLR5 and NLRC4/NAIP5
+5 min
+Graph-Pad Prism
+two
+maximum temperature and specific humidity
+PERCH integrated analysis
+CellSens Dimensions
+Genes
+CARPA
+73
+active site
+permanent cross-immunity
+throat swab
+two related strains of E. coli
+standard deviation
+a face-toface interaction
+Effective control of circulating influenza viruses in swine populations
+182
+Mutational pressure and natural selection
+P<0.05
+less structured
+1 : 1
+furin cleavage site
+diabetes
+Comparative
+luciferase activity
+20
+Pig contagious pleuropneumonia
+investigating the localization and distribution of the proteins in infected living cells
+5-20 days
+corticosteroid
+sliced likelihood
+Kenya
+day zero
+mice lacking caspase-1 or ASC
+human rabies
+dichloromethane
+Heartland virus
+positional variations in physicochemical properties and surface characteristics
+OsSGT1
+microvillar
+allows remission of the lesions
+Figure 7
+Borna disease virus
+viral titers
+Xbp1 signaling
+to remain consistent with other quantitative studies measuring airborne IAV densities
+Stigma
+IFN-γ
+Written informed consent
+30 minutes
+ONFH and non-ONFH patients
+12:1
+adaptive immunity
+illness
+stable isotope labeled peptides
+β s and β r
+Univariate
+soil and water
+human-adaptation
+the most conserved amino acids
+class or family
+CD8 T cells
+MaxQuant
+Ninety-five percent confidence interval of means
+one-third
+CBF1
+three
+glutathione S-transferase 2
+after bathroom use
+accelerated structural determination
+2 hours
+buying live poultry
+rhesus monkey
+VP1, VP2, VP3, and VP4
+2 days
+pulmonary viral load
+virus that lacked DVGs
+The presence or absence of O chains
+increase
+primary cultures of human respiratory tract epithelial cells
+time consuming
+resveratrol
+six
+UFS
+mPSCs
+Unpaired two-tailed student's t test
+2 definitions
+13,000
+unpredictable
+an AUC score of 0.879
+degenerative
+we cannot detect HLA-associated selection to the consensus
+chemical modifications
+Bovine respiratory disease
+increase target nucleic acid concentration
+200 nM
+5|21z20z14~139
+molecular parameters of the identified solutes
+Seventy-four
+binding of the viral RNA to RIG-I
+prevention
+VSV-846
+North American biodefense priorities
+MN titer
+oncolytic
+difficulties in analyzing the mitochondrial genomes
+10 min
+50-100 million
+inhibitory
+Aspartic proteases
+50 million
+GSH synthesis
+250 mL and 1 mL of TRIzol
+Protein Data Bank
+three
+biological membranes
+fractured condyle
+17 nm
+tanshinone IIA
+six
+cell surface proteoglycans
+acidic vaginal secretions
+a serial
+348
+32 model-runs
+niche conservatism
+35.3 kDa
+µ-oxo dimer
+Gram-negative and Gram-positive
+The transcripts of EGR1 and viral RNA
+CENPO
+disease phenotypes
+A1 and A2
+fomite-targeted
+10
+AMPK
+Tscm cells
+cytosol
+changes in fecal microbes
+Monensin sodium salt
+postoperative brain infection
+variability
+an optimal time for initiation of ART
+host cells
+19%
+IFNβ-mediated communication with other leukocytes
+natural
+amplification of the PRV gB gene
+GRB2
+neighbor-joining method
+hypoxia and high SAPS score
+939
+300
+29,182
+19
+limiting the role of government
+waste from the agriculture industry
+proinflammatory
+Orient Bio
+3-5 days
+NS3/4A
+mortality
+effector T cells
+a disease transmissibility value, an incubation period and infectious period distribution
+increases
+b age
+10 1
+phylogenetic
+types I and III IFNs
+homologous or cross-reacting determinants
+2003
+parvins and filamins
+30 min
+production capacity
+Survival, body weight, and viral titers
+Lean lines
+veno-venous
+All packing diagrams
+100%
+excess PMN-derived proteases
+urbanicity
+more sophisticated tools
+15%
+over the lung areas
+5%
+absorption spectra
+CMV, RSV, and PIV
+500 000
+Kruskal-Wallis test
+executes membrane fusion
+Porod-Debye
+1 million
+four
+chest x-ray
+Vietnam
+more detailed insights into the epidemic dynamics
+sites of transposon insertions
+fresh medium
+2683
+Purified human tracheal Siglec-8 ligand
+viral load
+24%
+subclinical or non-severe symptoms
+E. coli enzyme leader peptidase
+maximal
+18.8%
+no gaps were introduced
+39.3%
+191
+three
+rapid progress
+mAbs that bind to the glycan cap
+Glycerol
+two days
+53
+transformed cells
+inhibitory
+high enantiomeric excess
+B reg cells
+protocols for data or information sharing among levels of government
+10.4 percent to 42.2 percent
+Charles Rice
+hundreds or thousands
+polyethelyene
+mean ± 95% confidence interval
+A subsequent graft from a deceased donor
+time-varying covariates
+rats
+QIAamp Viral RNA Mini Kit
+2-3 minutes
+83
+flavivirus CFR
+Wild type Nef myristoylation
+octuplicates
+0.5%
+GE Healthcare and IBA
+Four
+Eight
+leafhopper
+3aminobenzamide, PJ34, or INO-1001
+VelvetOptimiser 46
+2A and 3C
+18
+phase Ib
+54 to 56 kDa
+6.32
+26,675
+FolE, QueC, QueD, QueE, and QueF
+cancer types
+PPV
+157
+clearance functions of the macrophages of the liver
+actin cytoskeleton reorganization
+575 nm
+clarification
+5-20%
+half
+different T helper responses
+twice
+a non-cognate interaction
+Pneumococcal Polysaccharide Vaccine
+papillar carcinomas
+in vitro frameshifting efficiency
+Table 1
+Superscript II and amino-allyl dUTP
+Site of infection
+Protein A/G
+a superior nasal step
+bovine viral diarrhea persistent infection
+design primers
+433.2 pg/mL
+Figure 7
+More than 180
+prolong the life span
+VHL
+logistic regression analysis
+eyes and brain
+infection status of the individuals
+Accurate predictions about the magnitude and timing of peak incidence
+7
+pigs
+toxicity testing
+encephalopathy or encephalitis
+Hspa1a and KFL4/KFL9
+Four
+Two-thirds
+Ab-Pak-cluster-1
+removal of partial haplotype observations
+eudemonistic
+Influenza A virus
+immunogenicity
+Respiratory infection
+Sun Hur
+6
+previous observations
+flexibility and adaptability
+Peru
+30 in the dark
+storage below -45ºC
+receptor recycling
+different groups world-wide
+1 h
+PD-1
+EMSA
+active
+DMSO
+one month
+Real-time PCR
+1918
+24 h
+pathogen spatio-temporal dynamics
+insect, nematode, or fungal vectors
+a comparison between observed and modeled data
+hematoxylin
+Further study
+Genetic variation in IGEs
+day 8
+alcohol-based
+Immunodeficiency, asplenia, and older age
+accelerate FIV transcription
+18%
+human immunodeficiency virus type 1
+yUfd1 NBM
+kidney, liver, and pancreas
+LDS buffer
+least infringement
+posttranscriptional
+four
+A and B
+model selection framework
+17,489
+via the PAF receptor on A549 cells
+12/61
+9
+MARV GP-MR78
+Vaccination
+25%
+changes in the H-2K b /peptide complex
+30 minutes
+IL-1b
+host factors
+6-8 days
+the choice of target
+drier
+CD4
+MAFFT
+RdRp template switch
+More thorough filtering
+TLR4
+public health policy evaluation and planning
+loss of the killer phenotype
+89
+liner epitope and conformational epitope
+extended periods of time
+community preparedness
+chemical
+bacterial and viral infections, connective tissue diseases and sepsis
+28 days
+ICU-acquired pneumonia
+application of antiviral drugs
+lung ANG2 upregulation
+Ceacam1-Tg T cells
+16%
+hMPV
+ischemic
+slight fluctuation
+11%
+July 2016 to November 2017
+NPEPPS/PSA
+anti-HA IgG production
+FPV
+consistent
+splicing
+PerkinElmer Lambda 40 spectrophotometer
+missing classifier
+Dropouts account and intention to treat analysis
+mitochondrial transfer
+IL-10
+502
+40%
+committee members
+over 93%
+c-Myc and cyclin D1
+increasing scientific understanding and in progressing promising therapeutics through development
+RNA-dependent RNA polymerase
+73%
+E. chaffeensis
+Puerto Rico's cool and wet mountainous area
+Syntenic maps
+9
+0.04%
+St. Jude institutional review board
+pool of host factors
+no external fund
+18
+GRASP-mediated unconventional vesicles
+α-catenin
+Three weeks
+virus inocula
+Nicotine Replacement
+HA1-HA2 dissociation
+The tool
+human AFP
+Thrombocytopaenia
+proteases
+trypan blue exclusion method
+autophagy
+neurodegenerative
+ten
+Thirty
+potent
+strongly positively correlated
+three
+lower delivery of the segment by infecting virions
+careful review and approval
+IV-injected RBCs to massively accumulate
+perforin-dependent
+52%
+acquired or congenital
+increase or decrease
+Laemmli polyacrylamide gel technique
+cellular stress response
+2343
+10-15 min
+Community education
+cross-border, legal and illegal migrants seeking work
+Mitochondrial N-formyl peptides
+three independent experiments
+influenza A virus
+airway occlusion technique
+TG-ROC
+Epitopes showing high levels of amino acid similarity to each other
+four
+Reproducibility of the levels of gene expression
+Overreliance on genomic studies
+78%
+bilateral crepitation and wheezing
+Synthesis of anti-genomes
+CVB3 2A and 3C
+inhibition of Ras signaling
+1X Washing Buffer
+nonfucosylated glycans
+Data on contacts between individuals in specific settings or in the general population
+×100
+31
+10,324
+dynamical networks
+Vasculotide
+limited radial growth
+moist
+4
+10%
+flow cytometric
+10.91
+Dscam
+More than 1,000
+noroviruses and influenza viruses
+drill down into subregions and neighborhoods that are affected by epidemics
+mutations in the donor
+$1%
+point mutations, insertions, deletions, and other sequence variations
+macrophage-protective
+GFP + effector T cells
+five
+large doses of ionizing irradiation
+a series of evidence-based interventions
+Hydrogen
+processing in the nucleus
+genes not addressed in the text
+77%
+Spatial Time Series Regression Spatial time series regression
+murine noroviruses
+64.3
+LPS
+predicted PBs and RSS
+Human immunodeficiency virus type 1
+a single, mutually exclusive value
+K48 chains
+biosafety level 2 containment facilities
+amplicon-specific 2GO probe fluorescence
+periodate
+g 2
+cationic amphiphilic drugs
+Bridge host
+reactive oxygen species induction
+inhibitor quality
+Abcam
+neurotoxic
+CHIPS and CUSP
+tertiary prevention
+0.5
+pinocytosis
+1
+cell type-specific
+trace plots
+clients who are distinct from those they meet in their routine hospital work
+receptor sorting into ECVs/MVBs
+70 μL Tris
+an arrow
+Compartmental modeling
+respiratory
+EFNA4
+8 h
+epithelia, endothelia and leukocytes
+Human peripheral blood
+replication/transcription levels of the RNA replicon
+>90%
+DMVD cleavage site
+statistical models
+Non-transfected cell lysate
+The sequence signature
+23%
+78
+1918—1919
+317
+GenePix Pro 6.0 software
+dsRNA
+Ten
+psychological
+viral fitness
+a main interview, a self-report questionnaire and a medical interview
+proteins involved in the pathogenicity and virulence of K. pneumoniae
+zero
+a dual effector response
+decreased
+VC and CC cells
+independent
+computational predictions of previously described gene boundaries
+Yeasts
+CMI
+PARP-1
+VLPs
+26%
+time post-infection
+2009
+Affymetrix Genechip technology
+diatomic composition
+vcRNAs primed with RT primer L 126+
+Fifty
+Anthrax
+extracellular domain
+4%
+ethical and moral
+3
+90%
+92
+Interleukin-10
+understanding the mechanisms of viral persistence
+1.4 years
+efficacy and safety
+antagonistic activity
+nasopharyngeal swabs
+single-molecule
+lower respiratory infections
+all the participants
+Meta-analysis
+selective pressure
+Standard solutions of small molecules with different concentrations
+94.3%
+EDTA vaccutainers
+thrombocytopaenia
+mRCAs and C3
+raw reads
+Bacillus subtilis
+confocal
+proteolytically cleaved
+personal protective equipment
+two
+three
+A consistent and comparative description of the burden of diseases and injuries
+20 min
+Osteopontin
+NS1 protein
+epitope-binding promiscuity
+no significant differences
+3,137
+H5-HA1 and GST
+antisense oligonucleotide -mediated splice correction
+290 nm
+respiratory diseases
+adequate fit indices
+16
+cell viability
+external peer review
+siNTC-treated and nontreated cells
+Microbiological
+27
+SDHA
+serum creatinine
+RNeasy Extraction Kit
+Five
+Principal component analysis of polymorphism at bi-allelic sites
+circulating platelets
+duration of fever and viral shedding
+a silent killer
+lab-confirmed and syndromic
+Leaf samples and wood samples from the stem
+0.01%
+public and private partnerships
+Chemokines
+Cotton swabs
+24-h
+a biomarker
+SDS-PAGE
+Nosocomial infection
+RNA knots
+two thirds
+Western blot
+Contact with bodily fluids from EVD patients
+the hybridization process
+signal intensities
+2017-2018
+intraepithelial lymphocytes
+morbidity and weight loss
+Caveolins
+HAdV
+open source software tools
+Hy's law
+Stress-mediated activation of key viral promoters
+TamifluH
+20%
+different methods of sample collection and variation of calculation methods
+5-10 days
+k-means clustering
+severe organ impairment
+health staff
+cytoplasmic
+26 hrs
+S + 1
+Example 1
+spectrophotometer
+1 of 2000
+AP2 clade genes
+assumes that household agents were isolated when performing risk perception and coping appraisals
+Lysate
+low signal to noise ratio
+50%
+the underlying sugar chain
+polyvalent IgGs
+fucose-moiety
+right-sided heart failure
+post-operative management of malignant melanoma patients
+TEA or paxilline
+case isolation and quarantine
+pathogen load
+47.33
+shedding
+10%
+a set of statistical replicate inferences
+CP culling
+6
+higher-level constraints
+rapid upregulation of type I interferon
+exclusion of patients within the highest CRB 65 categories
+F. tularensis
+increased mean survival drastically
+September 30, 2014
+pRL-TK
+18s
+adverse side effects
+TCID 50
+PRINCE
+The ubiquitin gene
+T-Coffee and LocaRNA
+80S ribosome
+social norms
+HMGB1
+parasite uptake
+200
+alamarBlue reagent
+high variability
+high-order oligomers
+4
+Alpherpesvirus
+virus replication of both human and avian influenza viruses
+higher frequencies of TLA-responding CD4 + T cells
+fatigue and pruritus
+two
+30
+48 hours
+10%
+an immunoreceptor tyrosine-based switch motif
+PI3K/Akt, Src, and STAT3
+reported vaccination uptake
+RNA polymerase I transcription activity
+parameter samples
+effector or memory cells
+increased amounts of state intervention
+12 months
+phGag-Pol
+a prior exclusion of an ongoing VZV infection
+University of Alberta Animal Care and Use Committee
+sophisticated computational tools
+suppression by the pDC IFN response
+β-glucuronidase
+36
+Marburg virus and Ebola virus
+LPS
+GraphPad Prism 5.0
+NP1
+S498R
+serum or mucosal antibodies
+VP3
+progranulin
+Foot-and-mouth disease virus
+decreasing mortality of host cells
+AS03-adjuvant
+Stability analysis for seasonal systems
+cholesterol
+oral
+MATLAB 6.5
+injury progression
+Basic reproduction number
+one-way
+dying cells
+one
+T83 and I113
+H16
+Severe clinical conditions
+lung mechanics and anatomic dead space
+Virus stocks
+homo-or heterodimers
+1918
+RNA recombination
+quantification of an apparent dissociation constant
+GST pull-down assays
+Multiple test results for a single specimen
+KCTF
+step-wise
+42
+cc-by
+4
+shared antagonism
+Samples
+Tetramer Technique
+reduced viral loads in the blood
+2.48
+Five
+library preparation
+a known peptide/MHC complex structure
+71%
+443
+60
+Three
+laboratory to "wild" rodents
+SNAP amplitudes
+A model without seasonal terms
+2020
+9 m 3 /min
+33
+Glycine-Arginine Rich region
+6
+mature
+2.87 million
+72%
+85%
+fusion
+Heme staining
+6 mM
+12
+0.62 ± 0.08
+Exon 9
+Toll-like receptors
+hepatitis A virus
+0.677
+FlowJo
+Pasteurella multocida
+adhesion molecules
+co-expression of LAG3 and CD49b
+PA gene
+MIA
+42
+Emile Littré
+1 in 500
+liver graft-versus-host-disease
+they might confound the analyses
+$27 mg/mL
+kidney damage
+indirectly increases ACE2 expression
+benzofuran and pyrrolyridine
+U27C mutation in SF220
+NucleoBond® Xtra
+aggravated
+acute respiratory distress syndrome
+Transcriptome
+an ''open'' Env structure
+an addition risk of infection
+dephosphorylation of oligo
+significantly higher
+neo-minophagen C and glycyron tablets
+normal cell line
+63/2010/EU
+A pool of candidate structures
+fever
+V3 loop mimetics
+interdisciplinary collaboration
+clear learning goals and the correct level of complexity and organization
+48 h
+Amyloid depositions and neurofibrillary tangles
+sulfuric acid
+Db data
+6 h
+Vaccination
+73%
+the PACF
+apoptosis induction by reovirus
+A workshop
+air desiccation
+25%
+human
+JAK1, TYK2
+lower than that of P-site tRNA Phe slippage
+trained nurses
+0.85km
+tertiary lymphoid follicles
+Creative Commons Attribution 4.0 International License
+vascular
+15
+NK cells
+Ongoing evolution of viral pathogens
+Further isomerisation in the ER
+losses of hybridization signal
+256
+15 minutes
+ILI
+pmf
+DFA
+50
+60%
+HBeAg
+yeast cytosol to vacuole targeting pathway
+phosphatidic acids
+25%
+metagenomics
+PRRSV genome
+BHK-21 cells
+non-significance
+interesting aspects of large ribonucleoprotein assemblies
+IL-17A
+Brucella abortus sequence
+21
+27%
+cytokine production
+Green fluorescence and DAPI
+proinflammatory
+renin
+broiler chick liver
+neutropenic
+LR Clonase II
+cell apoptosis
+a knowledge gap in the host-pathogen interactome
+disaster preparedness, emergency management, and public health response
+just as likely
+fragment ions
+transient decreases in some of the parameters
+Viral genetic data
+biosafety considerations
+sophisticated computer algorithms
+7
+negative neutralizing activity
+Genetic polymorphism
+15% and 38%
+IL-4 expression
+subject-specific lists of proteins
+indicating β-strands formed over NS2B
+European Collection of Cell Cultures, UK
+retention of lymphocytes
+holistic
+GR-SU
+42
+The choice of model viruses
+WT and SPC-TNF tg mice
+increases
+goggles and earplugs
+1 day
+2.0-4.3
+36
+edges
+without significant sorting
+4Á5 days
+0.40, 0.39, and 0.35
+33%
+2009
+computationally predicted base-paired stems
+whether it contributes to the evolution of the virus
+Malaria anaemia
+when richer call data are available
+the intergenic promoter
+pRB
+body weight
+spectrophotometrer NanoDrop ND-1000
+angiogenic
+Pseudoknots
+intrahepatic
+whiskers
+proliferation
+10
+Ethnicity
+comparative Ct method
+HHV-5 DNAemia
+Lineweaver-Burk plots
+12, 14 and 20
+kDa
+twice
+Vaccination
+PSL
+IL-7
+compound #8
+global
+Biolayer interferometry
+Equation
+serum-free DMEM
+Viral peptides
+four
+u v and u m
+zanamivir
+stem-specific antibodies
+vesicles
+under the View menu
+very different underlying processes and conditions
+deep-learning
+MgCl 2 concentration and annealing temperature selection criteria
+23.6%
+Replicon particles
+70S initiation complexes
+complexity of geospatial patterning
+5-7 days
+mesial temporal lobe epilepsy
+peribronchiolar inflammatory cells
+93.4%
+FDA/CBER analytical plasma panels
+reverse vaccinology
+Reflexivity
+Medication errors
+synthesis of the encoded protein
+1524
+PTX3
+homologous
+CCL2, CCL8, and CXCL10
+a smaller reduction in Rt
+eGFP fluorescence
+Viral family and genus richness
+immunomodulators, induced interferon, or recruitment of immune cells
+Dengue
+the health status of their baby
+1970s
+up to the administration of cycle 2 day 1
+retroaortic
+end point ELISA
+83-89%
+significant increase of abundance in the protein complex
+115
+hypoxemic respiratory failure and hypercapnic respiratory failure
+mRNA
+coagulation necrosis
+786-O
+11
+adverse clinical outcome
+ATCC
+5%
+fibrotic
+a rate limiting non-erythroid enzyme
+infectives
+deficiencies
+percolation theory
+higher concentrations
+p38 MAPK phosphorylation
+50%
+Profile Hidden Markov Models
+cellular internalization
+All SAEs
+104,000
+71%
+Lagerstroemin
+large numbers of potential interactions can be sampled at relatively low cost
+six hours
+The efficacy of the formulations
+Influenza
+80 lg/ml
+100%
+36%
+1=l
+inhibiting
+aminopeptidase N
+disease reproduction number and the serial interval
+kDa protein
+1289
+anti-cancer drug
+strong upregulation of FOXP3
+positive-strand
+nonmammalian
+Zip-tip C18
+silica gel-protected aluminum sheets
+cytokine receptors
+Viral RNA
+health care providers
+30 min
+neutrophil granulocytes
+Treponema denticola leucine-rich repeat protein
+62%
+K d
+2Â RNA loading dye
+accelerates
+decreased cell migration and invasion
+CBR
+STAT-6 protein
+239 kcal/mol
+Genomic DNA Mini Kit
+anti-hybrids antibodies
+10 minute
+mutant VP5 sequences
+DNAse I
+Prevention of pediatric HIV
+templates for RT-qPCR reactions
+Three
+16.7159
+25%
+β = 0.20
+a curated set of 25 000 viral protein families
+immunofluorescence
+51.08 years
+Inflammation
+recombinant capsid proteins
+SARAMIS
+Microglia
+under 6 years
+Nanoparticles
+systolic BP
+GAPDH
+1
+V Q
+a significant finding
+Rigaku R-Axis Spider diffractometer
+Lagrangian
+mutational pressure
+infections with certain herpesviruses
+Additional evidence
+70-90%
+changes in behavior
+diagnosis confirmation by PCR
+virus-induced apoptosis and CNS injury
+D2 and D3 flagellin domains
+Solvent molecules
+a forecasting method
+interstitial and alveolar oedema
+two
+HIV/AIDS, lower respiratory infections and diarrhoeal disease
+at the optimum temperature
+n=3
+axial coding
+seven
+every 3 or 5 years
+20
+Autophagy
+severe thrombocytopenia
+PHYLIP
+siRNAs
+frameshifting efficacy
+TDP-43 and FUS
+paracellular gaps
+pneumonia, sepsis and bleeding
+whenever a certain epidemiological quantity is less than unity
+icosahedral
+TLR5
+One
+A limited reduction of movement
+23 amino acid from the human tyrosinase signal peptide
+sensitivity analyses
+avian influenza virus infection
+cells
+IgG
+inflammation and hepatocyte injury
+intrathymic precursor
+DP
+inference on the posterior distribution of the root and internal node states
+Lys57
+another level of stringency
+H. Sweiti
+four SELDI peaks
+twisted conformations
+biotinylated BSA
+Serious Adverse Event
+Backward bifurcations
+indigenous case
+incorporation of miR-192 target sites
+Hong Kong
+higher
+Elevations in IL-6 and TNF-α levels in BAL fluid
+50%
+novel delivery system
+bandage
+HTT events
+host cellular machinery
+1 µg 7SK-as RNA
+other respiratory viruses
+decrease
+airway infection
+communicable disease control
+primates
+T. whipplei
+IBB-2
+2
+protein dynamics
+PB1 translation
+lymphocyte count
+Affymetrix Mouse Gene 2.0 ST Array
+Five
+experienced enacted stigma
+increased phosphorylation of JNK
+ELISA-based
+cognitive, motor, sensory and behavioral functions
+9
+carbohydrate binding
+8-and 10-fold higher
+Biosafety Level 3
+binding of GFP to 3A
+Sequence bias for HSV IRV formation
+DAP12 upregulation
+90%
+2.2%
+Sore throat
+cc-by
+561
+2,600 IU/mg
+>42.84 mmol/l
+Elaspol, CG inhibitor and AEBSF
+synthetic and biological
+VFA
+195
+Z-FA-FMK and E64d
+The remaining blood
+257
+random primers
+P04851
+Rhabdoviridae
+children
+0.8848
+20%
+432
+30 minutes
+a regulator of immune responses
+36
+antiviral drugs and testkits
+improve lung compliance and antiinflammatory capacity
+24-hour
+it also shares characteristics of macropinocytosis
+25
+In vitro biophysical and biochemical approaches
+0.8%
+native epitopes
+a committed Treg lineage
+Direct-zol RNA Miniprep Plus Kit
+IMPH2
+overseas contract workers
+particle size
+serum NGAL
+14
+2.5 × 10 5 cells per well
+de novo initiated RNA
+metabolic process
+GRASP
+NLRP3 and NLRP6
+PB2-Q591K and D701N
+cirrhosis, chronic heart failure and cancer
+induction of metal sequestration
+all of the NSCLC cell lines
+fever
+cleavage of prM
+activation of the Cdc42/p38MAPK pathway
+10%
+Bacillus subtilis
+vasoprotective/antiproliferative
+total duration of within-and between-group contacts
+green and yellow nodes
+5%
+Four
+2009
+H155T and Q156H
+MON601
+1-O-acylceramide
+metals, ceramics, polymers, and composite materials
+IL-10 expression
+salp chain
+PIV-associated LRI
+serum albumin
+20 minutes
+twice
+AD-4-and AD-5-specific mabs
+Staurosporine
+Two
+Kogan
+classify a range of different viruses
+crossreactive immune responses
+2 days
+196
+the number of indels
+Pneumonia
+Ten-fold
+dsUAR
+S. maltophilia
+mathematical modeling
+Cldn2
+the timeline would be shortened
+Antigen sparing
+1:10
+inhaled
+156
+The Journal of Infectious Diseases
+20 min
+LTBI
+action of molecules with known bioactivities
+mycoplasma
+81,000 to 138,000
+Interleukin-6
+Baloxavir marboxil
+Kuan-tzu
+between October 9 and October 21, 2011
+if all the following conditions were satisfied
+L pro catalytic activity
+c A and c S
+inverted membrane curvature
+peak protective function of antibodies
+enhances cell growth and tumor progression
+control for input virus carry-over
+oxygenation
+Cytokines
+high amount of contact between the disinfectant and virus particles
+aging, cancer and disease
+cardiothoracic ratio
+narrow-spectrum penicillin
+Site-specific cancer incidence and mortality estimates
+bioassays
+The acquaintancies
+increased almost twice
+a potential antigen based immunodiagnostic assay
+SWB and physiological health
+SilSOS Femme
+thirteen
+12
+NASA
+Excel
+Acinetobacter baumannii
+rVSIVs expressing tibrovirus G glycoproteins
+supernatants
+TLR4
+Phe
+Leica Bond RXM
+Antimicrobials
+GII.4
+6 days of infectiousness
+cleavage of trans peptide by chymotrypsin
+Epidemiology
+a third
+Metal binding to the engineered protein
+sepsis
+diffuse and bilateral ground glass opacities
+Efforts to improve nowcasts and short-term predictions of influenza activity
+Glycerolyte 57
+3x10 7 plaque forming units per ml of media
+a pair of fluorescent probes placed in close proximity
+Neuroimaging
+To clarify the cellular localization
+Indexed samples
+viral and cellular
+Parameters
+over 200 arthropod associated viruses, microbes, and metazoans
+SPARK and SYP
+nine
+2.2 log 10 copies per millilitre per day
+University of Utah DNA/Peptide Core Facility
+H7N9
+140
+HTs
+Transcriptor First Strand cDNA synthesis kit
+metagenomics
+GC12
+adequate porosity and pore size
+oncogenic
+ABCA1-mediated sterol efflux
+Tanzania's South-Central region
+2013
+3,651
+3 years
+respiratory infections
+fibromyalgia and osteoporosis
+85%
+2009-2010
+dual coding with error mitigation
+high molecular mass and low chemical stability
+Affymetrix
+37 °C
+distinct resting cytokine profiles
+non-AMA1 IgG
+SPSS software 13.0
+Silybum marianum
+HSF1
+442
+Disability weights for alcohol use disorders
+44
+2x10 4 MDCK cells/well
+twenty-five
+total incidence data
+Three
+dendritic cells
+Private possession
+Fig. 6
+AmBisome and Abelcet
+antibacterial prophylaxis
+20 to 61
+ADMA9
+Quantification standards
+higher
+Random fragments with 39 A tails
+1h
+Phagocytic
+below 10
+More than 2 million
+onechild policy
+virus isolation, electron-microscopic observation and serological tests
+progressive disease
+Information regarding the origin of poultry
+Toll-like receptor 4
+FRC
+90%
+Hepatocellular carcinoma
+64.9%
+further investigations
+AlexaFluor-594 secondary antibody
+disruption of the PS
+lung innate immunity
+5.6%
+proteomics studies
+H-7100 transmission electron microscope
+GRASP
+February 2009
+circulating monocytes
+phage-display experiments
+five
+access to patient clinical data
+23,000
+VAP
+40μL of CellTiter-Glo 2.0
+macroaggregate filter
+Niemann-Pick C1
+ImageJ
+ATCC
+1%
+4.5 mM
+100%
+36,073 bp
+labor-intensive methods of production and limited manufacturing capacity
+An enhancer
+reduced exhaustion of the stimulated T cells
+Purified MT145K sample
+17 s
+5%
+aminoacyl-tRNAs
+Genomic DNA
+6916 ± 8934 IU/ml
+population density
+1.6% to 2.4%
+Visual cues
+cleavage with factor Xa restriction
+a laboratory professional
+TSB and TSF extracts
+5% below the non-NPI period mean
+GFP localization
+expression of the mouse IFN-l receptor
+10.3 per 1,000
+IIV and LAIV
+Campylobacter jejuni and Salmonella enterica
+solubility
+100%
+the environment
+physicochemical
+NaBH 3 CN
+when failure to ventilation strategy occurs
+Murine leukemia virus
+morbidity
+HeV-specific sera
+Degenerative
+several origins
+Proteoform intensity
+MDCK cells
+rotavirus
+GMP
+isotocin
+AM2
+28%
+8
+Roma Today
+TRIM56
+IL-35
+A four-fold rise in MAT titer
+more FcRn-dependent transcytosis
+E2-A162 residue
+biologging devices
+minimum CI
+prediction of future disease severity
+ARV
+Subversion
+MG planning and/or operational processes
+laminal secretion of peptides and amines
+peptide library phosphorylation data
+15N and 46R
+NS3/NS3a
+published data sources on pathogens, their hosts and geographic ranges
+pCI-neo and pmCherry-C1
+Innate lymphoid cells
+telephone help lines
+pigs
+27%
+Inspect3D
+dephosphorylation
+ten
+detachment
+indirect
+bystander damage
+ligands and receptors
+using willingness circled on a 6-point scale
+47
+five
+a known contact between a first case in a family and a previous case
+ARDS
+Three
+20µW@8Hz
+glycyrrhizin
+cross-protection to heterologous infections
+41%
+Hantaan
+I. scapularis
+every 2-3 days
+53
+Pandemic Hospital Based Surveillance
+50%
+IL-1β and IL-6
+sumoylation and phosphorylation
+7-and 14-day-old
+the protection of pathogens against alcohol-based disinfectants
+bacteria
+SuperScript III Reverse Transcriptase
+I 3
+immunologic escape
+1 μM
+three
+2009
+Codon adaptation index values
+HSB colorimetric space
+non-severe pneumonia
+intracellular pool of protein
+recombinant BmNPV
+futility
+the error increases in proportion to the magnitude of the initial statistic
+Monoclonal antibodies 6D11 and M2188
+Instant Blue Coomassie-based solution
+Student's t test
+2016
+Enlarged image of yellow box area
+79%
+one RFID tag
+12.5%
+amplification product sizes
+a GCN4
+direct infection of oligodendrocytes
+SpO2 analytics
+lipid rafts
+moderate
+neuronal survival
+extract from total lung
+controlling the assembly of regular-shaped viroplasms
+a protective phenotype
+Single-particle analysis
+specific symptoms and symptom-onset
+600 to 15,000
+nicked DNA and nuclear chromatin condensation
+cc-by
+proinflammatory
+742
+active-site glutamic acid
+Review level evidence
+122 665
+IRF2
+hepatoma cells
+hepatocytes and bile duct epithelial cells
+VeriKine TM Mouse Interferon-β ELISA kit
+Altered protein turnover
+~2000
+K48-linked polyubiquitin
+Strand-specific PCR
+symptomatic relapse of a prior infection and infections first appearing on ART
+FR
+truncated
+IL-6
+five
+suicidal ideation
+CD11b, TLR2 and TLR4
+LDL
+2 days
+reduced duration of mechanical ventilation and stay in the ICU
+urea powder
+pH-assay
+3000 × g
+H9N2-subtype
+barrier procedures
+single cell suspensions of lung and spleen tissue
+Cervical tissue
+Strain-specific real-time RT-PCR assays
+examining a range of scenarios ahead of time
+sterile immunity
+LELs
+native-like Env trimers
+Kevin T
+54
+pattern of mutation
+QPCR
+CEACAM1-S
+one
+300
+fusion of the autophagosome with the lysosome
+lysosomotropic alkalizing agent
+Astacin metalloproteases
+an amyloid coat
+decreased
+higher NC uptake
+Autoregressive models
+porcupine bile
+EBOV antiviral therapy
+P gene
+epidemic extinction
+λ i
+whether the respective approach was evaluated in this paper
+developing the data collection infrastructure
+arginine
+Basic Local Alignment Search Tool
+AR expression
+T7 RNA polymerase
+psychological distress
+DC-SIGN and L-SIGN
+52.0, 108.3 and 194.7
+contact with pilgrims
+1994-2004
+one point
+NK cells
+30% to 60%
+7.4%
+over 90 million
+cold stress
+13%
+systematic multisite clinical studies
+A/H3N2
+drug delivery assessment and analysis
+live poultry
+social distancing behaviour
+runny nose, sore throat and cough
+101
+30 mg
+1.5 weeks
+Reagent-based contamination
+Necrosis
+glycoproteins
+10,000
+28
+associations between specific genetic variants of the Y chromosome and hypertension
+contacts between individuals or computers
+memory T cells
+RHDV
+9%
+HCC recurrence
+exenatide
+r
+viruslike particle production
+MALDI-TOF mass spectrometry
+5-7 days
+LPS-induced ALI
+1:1
+important clues to the identity of the differentially expressed gene
+bacteriocins and hydrogen peroxide
+preclinical and clinical studies
+NOXoriginated DCFH
+J. L. R.
+it demonstrated the lowest level of bacterial removal
+senescence
+TLE6 mutation
+FD Rapid GolgiStain Kit
+Extensive wash
+enzyme-linked immunosorbent assay
+MOV10
+a depression of the AKT/mTOR pathway
+all known and putative sialocatabolic functions
+host factors
+Chinese and Korean
+six
+the National Health Commission
+The fluid chart
+Th1-mediated
+15%
+IL-1 receptor-like-1
+rapid fluorescent focus inhibition test
+data-driven methods
+GraphPad Prism
+33%
+AgaS
+three
+information service hotline
+IL-1 receptor type 1
+earlier stages
+$200
+mechanisms
+roots
+severe osteopenia
+gallic acid
+T. gondii rhoptries
+2000
+fever
+religiosity and political extremism
+Guangdong
+IAV replication
+Information
+Ozonation
+three days
+the slope of the curve in its linear portion
+piglets
+ewe372-H1-W and ewe375-D4
+187
+Model-based statistical methods
+250 ng/l
+two
+Protein misfolding cyclic amplification
+SL1-5
+Southern Medical University Ethics Committee
+SUMO peptidases
+67.6 years
+hypoferremia
+index hospitalization events and post-discharge events
+an approach
+viral vaccines
+Human MIF
+A588V
+translational recoding
+25%
+electronegative
+group G rotavirus
+protein and Env
+12 h
+Exposure dependent weights
+10%
+FOXO3A
+388
+viruses
+30-50%
+respiratory health of farmers
+CD40Lmediated apoptosis
+stromal cell-derived factor-1
+Cellular immunity
+Waterfowl parvovirus
+methionine or cysteine
+abrogate functional regions and cell signaling pathways
+some level of population structure occurs locally in the genome
+over 300
+PCR on the 16S rRNA
+ATP
+airway epithelium
+Bulgaria and Serbia
+fluorescence microscopy
+þ1 frameshifting
+Twelve
+many participants
+5
+severe disease
+ACAM2000
+560/mm 3
+acyclic analogue of guanosine
+granzymes and perforin
+b-protobacteria
+class D oxacillinases
+introns 5 and 7
+χ 2 test
+false positives
+A thorough analysis of HLA-type
+49 kDa
+Tween 80
+LPS-induced macrophage activation
+one or more tagged CTB subunits
+$2.7 billion
+immunocompromised patients
+69
+herbal
+624,472
+bias
+5%
+amino acid substitutions
+cyclin d1
+Lymphocytic Choriomeningitis Virus
+West Nile virus and Dengue virus
+220
+HCV core protein levels
+imidazole
+P. falciparum 3D7 parasites
+5.73
+λ max
+Utah State University Laboratory Animal Research Center
+by adding more edges over time
+summary
+Jack-knife
+two hours
+Sindbis
+Salicylaldehyde
+intestine and lung epithelial cells
+ECMO
+ORF50/RTA
+Aldosterone
+Lactobacillus
+training
+53
+LigT
+eIF6
+Origin
+Prevnar13®
+overcoming IFITM3
+80%
+Haptoglobin
+cytopathic
+genetic exchange communities
+retrospective analysis of the data
+biosynthetic process
+Costar half-area high binding assay plates
+Colorimetric
+indicator chemicals
+epidemiological
+30%
+timely infant testing
+diametrically opposed
+13
+Porcine epidemic diarrhea
+a demand expressed by commentators in debate surrounding GOFR
+Wild-type mice
+in-house in sterilized cages
+Preferential mixing
+direct effects of radiation on pathogen survival
+GP
+intravenous peramivir
+Hendra virus and Nipah virus
+Microscale thermophoresis
+a vibrant and well-prepared health system
+dropped temporarily
+flow cytometry analysis
+intrathecal production
+Hydrophobic interaction chromatography
+innate immune system
+viruses belonging to GI and GII
+Two
+keeping the force needed to unwind the type 1 rod within a narrow range
+Q162R-S170T
+robust cellular immune responses
+multiple PrfA-dependent promoters
+lethal disease
+clinical
+ring-like
+15
+embryonic development
+decreased signal-to-noise ratio and dynamic range of the assay
+combustion of organic materials
+autoimmunity
+Maintaining the structures of D and E domains
+BeWo cells
+standard deviations
+seven days
+multidrug resistant
+Phe388 at the coil and Tyr398 at the helix
+Data
+AEC 1340 and 1390
+depletion of CD103 + DCs
+40 min
+more than 100
+new agents
+11,661
+DV1 E glycoprotein
+5% BSA
+development and maturation of the ovary
+two
+inhibits DDX58 signaling
+Threeto six-day-old emerged female mosquitoes
+berberine and palmatine
+antiviral host defense
+2CLP and SO rats
+adaptation to the human immune system
+increases
+Thirty-six
+IRF3
+vesicular stomatitis virus glycoprotein expression plasmids
+FIV
+HIV-1 Assay
+laminin derived peptide
+Seventeen
+240 million
+27
+IFN-ω
+Screening and recruitment
+2-3 weeks
+Brefeldin A
+14 and 60 D.P.I
+0.50, 0.98 and 0.66
+F80L
+four
+interstitial lung space
+Tat and oligoarginine peptides
+E. ovinoidalis
+TBSV accumulation
+overlapping ORFs that are larger than expected by random chance
+293T cells
+Patients with pneumonia
+stacked and partially helical
+ethical dilemmas
+R A and R P
+250,000 to 500,000
+three
+enhanced susceptibility toward infection
+suitable search terms
+biomarker profiles
+scrambled or MINK siRNA
+absence of marker-QTL association
+5%
+a reference set of CDSs
+hydrophobic
+arginine and lysine
+dated samples
+2000
+Sialyl-Tn
+hospital staff and general practitioners
+48,000
+Sapovirus
+4 • C
+Major histocompatibility complex class I molecules
+ViralORFeome
+Marrow
+NS3 protease
+standard methods
+hepatitis A
+42
+minus-strand
+220C
+a robust immune response
+US11
+residual inflammation
+HIV, SIV, and MoMLV
+greater generic conspiracist ideation
+95%
+83
+GlcNAc
+sedative
+helicase activity
+PCR
+Newcastle disease virus strain NA-1
+autoimmune diseases
+50μM
+2
+Speed-fidelity trade-off Trade-offs
+Cotia virus
+one
+Residue-and surface-based tools
+100 mg/kg
+10
+PureLink PCR Purification Kit
+Zeptometrix Corporation and SeraCare Life Sciences
+silent rDNA repeats
+development of antibioticresistant bacteria
+cells
+three
+The funders
+a scaffolding structure
+5
+rodents
+transmission rates and population densities
+individuals
+11,000,000
+mutation bias
+10.3%
+heterosubtypic
+0.05
+supernatant
+infarct volume
+robust
+Odyssey Infrared Imaging System
+HBoV1
+Seven
+78.3%
+measurement of CLABSI
+TMEV-infected mice
+10%
+30 min
+neurons
+5 µM
+pET-28a-NDM-1
+two
+95%
+DPPC
+Four weeks
+intraspecific
+CycleQ30%
+T20-resistant
+lumens
+mechanical ventilation
+30.2%
+Total limb paralysis
+0.788
+0.704
+Mfold program
+Aviparvovirus
+complex
+30
+dementia and musculoskeletal disease
+14p1
+predisposition from environmental stressors
+a huge repertoire of targets
+6
+two
+directly acting on viral proteins
+REV
+single-gene assays
+antioxidant, anti-inflammatory and anticancer
+medical and nursing
+106
+true concentration
+similar expression profiles
+reinitiation after termination at the end of sORF2
+6 hr
+chimeric MNs
+rAAV9
+ectomycorrhizal
+hydrodynamic transfection
+chemiluminescent drug screen assay
+Cells
+Pulse oximeter
+antiviral
+November 2004
+welltolerated
+a hygromycin-thymidine kinase fusion gene
+30 min
+movement restriction
+influenza-induced lethality
+k i
+MOPV infectious particle production
+display of folded proteins on hybrid phage
+290
+functional groups of various amino acids
+between 2009 and 2010
+97.2%
+2017-04-13
+Traumatic hemorrhage
+1-5%
+ephemeral local secondary structures
+,20-fold
+5%
+P<0.05
+100% confluent BSR cells
+~50-60 kD
+fungal
+discrete-time and continuoustime models
+F-α, IL-1β, and IL-6
+Viral oncolysis
+three
+toxicity
+stimulating the growth
+High binding affinity and stable binding of peptides to MHC in vitro
+60 years and older
+55% and 64%
+ARIMA model
+Basic Local Alignment Search Tool
+Genetic diversity
+RNA stability selection
+within 10% of the true value
+remdesivir and chloroquine phosphate
+Input module
+ImageJ
+the range of the CBI
+Web of Science
+UV spectrophotometry
+HeLa cells
+Confusing word choice on when a person with EVD is contagious
+100 mM EDTA
+encoding both VP1 and VP2
+Type IIB von Willebrand disease
+phylogenetic
+human and animal funding sources
+its incorporation into virions
+transitivity
+school curriculum
+BPD
+HSES
+0.83
+133
+2-5 days
+PaLung cells
+40%
+Surface plasma resonance
+the nucleus
+sulfuric acid
+twice per day
+Contaminating RPL2
+Five
+10
+Contrast levels
+7 days
+bird, equipment or people movement
+homogeneous monomeric and stable particles
+pigs
+Cancer metastasis
+Five million
+pandemic
+jawed vertebrates
+visual inspection
+working adults
+Favipiravir and 2'-Cmethyl-cytidine
+Dualmembrane kit3
+entomopathogenic
+PBS
+10 mg of monomethoxypoly glycol
+bolus
+twice
+Deacetylation by SIRT7
+HHV-6 activity
+PEG-it Virus Precipitation Solution
+85˚C
+Blood samples
+field-based epidemiological investigations
+VV-Gag
+MiRNA
+Hepatitis C Virus
+Fourier transition method
+Disease-related proteolysis
+general
+coevolve
+population health
+Ten
+variable region
+HA-mediated membrane fusion
+50%
+biomarkers
+Table 2
+120 min post-feeding
+rare
+poor results
+three
+short term transfers in culture
+27
+Vero cells
+insurance cover
+39%
+microglial-derived proteases
+Antioquia, Colombia
+PAN packaging into virions
+gamma, lognormal and Weibull
+embryonic development and metabolism
+actin polymerization
+Transcriptome
+density gradient centrifugation
+8-10%
+RNA bases
+Third party
+RIPA Buffer
+production of mitochondrial reactive oxygen species
+CsCl gradients
+naturally occurring hepadnaviral infection
+ORF3
+10 min
+neurogenesis
+four times per day
+Blood samples
+0.999
+cytokine responses
+mortality, myocardial injury and renal injury
+Crohn disease and other intestinal disorders
+Public surfaces
+PKA
+septic shock
+health workers
+avoid treatment and testing
+Ficoll-Paque density gradient
+multiple logistic regression
+Excel
+Biomek FX
+membrane permeability of the cytotoxin
+virological synapse
+1-3
+between 4 and 6 h
+Mann-Whitney U test
+broad fitness costs
+A73
+44/12
+Marked CpG deficiency
+effort
+environmental cues
+21
+Smad6
+Nup98, Nup153 and Nup62
+Strain IC6010
+Firmicutes
+ENC
+beta cells
+PKC activation
+60-70%
+normal lung cells
+RNA structures typical of À1 PRF stimulatory elements
+infected hepatocytes
+individual, host species, virus biotype, dose and route of infection
+total cellular RNA
+Macrophages
+Infection Section
+simple stochastic models
+dendroscope
+Parainfluenza virus type 3
+howler monkeys
+Leishmania infantum
+increases
+Phase III
+Ten
+physical splines and virtual connectivity
+IRF7, IRF9, and ISG15 mRNAs
+real-time PCR
+T reg proliferation
+5 days
+four
+helpful
+≥60 days
+NH/P68
+phenol/chloroform
+MTCP1
+linear
+DENV
+Specificity
+contact with infected respiratory secretions
+statistical analysis
+trnK gene sequences
+National Healthcare Group Domain Specific Review Board
+18.3 μM
+immature virus particles
+they cannot correspond to the number of genes
+self-protection with protective gear
+B cell clone
+88%
+External elastic lamina area and lumen area
+Plaques
+Indirect ELISA
+3421
+30 min
+CAA severity
+1000 simulated series of 20 consecutive seasons
+Two
+decreases
+92.6%
+Endosomal
+general oral examination
+Inhibitor-B kinase ε
+Oral administration
+Zymo Viral RNA kit
+Quantity one v4.4
+did not affect NMD-resistance
+the toxin
+oseltamivir phosphate
+DNA methylation
+plateau pressures or driving pressures at the initiation of mechanical ventilation
+graphs proteins
+Enrichments at specific chromatin loci
+13 years
+decreased
+stereotypical changes in gene expression
+apoptosis
+anti-inflammatory effects
+Hepatotoxicity
+33 mM of the b-gal substrate C12FDG
+Table S2
+disease severity
+1282
+temperature, humidity, and atmospheric pressure
+Herpesviridae
+higher
+silicon, inorganic glass, and ceramic
+elevated exposure to carcinogens or infectious agents
+963
+flies
+40
+Quanta
+25
+cerebral infection or septicemia
+three
+One hundred microliters of PBS
+IPO-Me-Glc
+lyophilized aliquots
+M3
+1062
+metabolic
+Multivariate logistic-regression models
+Synplot2
+breeding conditions in lab facilities or interactions in an ecosystem
+cough, coryza, or conjunctivitis
+3D
+a viral recognition module
+R 0 = 1
+80%
+disruption of viral membrane
+Met and Thr
+significantly increased
+80%
+when free isolation units become available
+nanodrop measurements
+Cu 2+ antioxidant enzymes
+cell metabolic profile
+binding of an 83 kD form of PA to specific cell surface receptors
+1 hour
+more collaborative research efforts
+TLR2 and TLR4
+48 h
+GA-mediated
+Human rhinoviruses
+1%
+diffracting
+2 weeks
+recurrent hepatitis
+Vaccines
+daily
+100%
+chest computed tomography or bronchoscopy
+peptides
+Communal surfaces
+21%
+phosphopeptide meta-analysis, correlation network analysis, and literature mining
+respiratory failure
+2 min
+389
+two
+close monitoring and fluid management
+MDCK cells
+Corticospongious
+Primers specific for each of the ISGs
+DNA damage
+cross-species transmission
+no methylation
+high attack rates, several waves of infection and high mortality in young adults
+over 100
+To replicate in the cytoplasm
+Miltenyi gentleMACS™ Dissociator
+HotKnots V2.0
+Inositolrequiring enzyme 1
+7 days
+Delivery to the lungs
+19
+OVA-specific plasma IgE and IgG1
+large-scale production of IgY in chickens
+interference of the space structure
+Mitophagy
+Mean dot signal intensity
+spermatogonia and Sertoli cells
+CXCL5
+14
+confocal microscopy
+similar redistributions of LysoTrackerpositive endosomes
+1 ng/ml
+9%
+host protein synthesis
+IFN-γ
+2570
+mutation pressure
+Type I rat tail collagen
+ELISA configuration employed
+9 May 2009
+CCHFv expression
+Spearman rank correlation analysis
+Three
+PR8
+FBSM
+three
+Epithelial cells, macrophages, DCs and neutrophils
+Dr. Bin Wang
+CCHFV OTU
+NS5
+2 h
+contact tracing, ring vaccination and quarantine
+1000-fold
+Balifase
+Twenty six
+6
+7 days and 11 days
+neutrophils
+tRNA levels
+AusAID
+4%
+NS1
+cap 0
+An identification of commonly regulated proteins in tumour and sera
+angiotensin receptor blocker
+eLife
+VN and local IgA antibody responses
+cross-protection to heterologous infections
+QuantityOne
+Purified GST and Nus
+few strains are concurrent in time
+The knot
+4,570
+67%
+eIF4A
+thirteen
+comparative study
+research on regular and random networks
+adipose-derived stem cells
+5%
+One hundred and forty
+unbiased measurements of intra-network gene expression and fold-change ranked segmentation
+circulating IgM
+mediation analysis
+antibodies to viral protein PEDV-N and actin
+Influenza virus A/Anhui/1/2013
+a ring of perithecia
+Buffer-based eluants
+24 h
+Influenza A H1N1 infection
+the planning process
+avian influenza
+increases
+an N-terminal six-histidine tag
+UV-responsive
+regulatory molecules
+Immunoreactive proteins
+individuals with schizophrenia
+EMCV and picornaviral IRES
+MassTag PCR
+spatial heterogeneity
+herbal medicine
+Short chain fatty acids, propionate, butyrate and acetate
+45uC
+Culture-based assays
+ABCE1 and ATP
+the period of febrile, hypotensive and oliguric phases
+vasodilation, antigrowth, proapoptotic
+signalling
+frequency doubling
+3.5 h
+lack of specific data
+12
+nanS
+Six
+60%
+NFE2L2
+the approach taken herein
+six
+Caspase-Glo 3/7 Assay System
+mouse anti-Flag Mab or rabbit anti-MYC Mab
+RNA hairpin not capable of stimulating À1 PRF
+purple formazan crystals
+HAV-infected cells
+threenucleotide ID
+t* = 50
+four
+MAVS
+HSV-1
+six
+À8.16 kcal/mol
+multiple viral infections
+Laboratory data
+11
+day 0 and day 42
+urban centers
+zero
+nine
+multicollinearity
+controlling the movement of both live poultry and avian products
+Influenza vaccination
+86%
+chromosome 7
+15 min
+pore cut offs of 35 nm
+10 to 7 days
+Chinese journals
+MAGT1 and TUSC3
+high probability
+The CSN
+differences in the genetic background of the host and parasites, and transmission rate
+AT1 and AT2 cells
+45.8 T 14.1%
+1437
+CT or TT IFN-λ3
+statistical analyses
+0.052
+17
+their subsequent evolutionary course
+P2RY12 expression
+diseases from breaking out
+RIG-I agonists
+filovirus IgG indirect ELISA system
+MTT
+expansion of tick populations
+ethnic heterogeneity
+codonW program
+3 H-thymidine
+TNFα promoter
+3k sequences in D
+694
+W10 and W35
+bilirubin and coagulopathy
+reactive antibodies
+Mawell
+UV-Vis Spectrophotometer
+63%
+microenvironment
+LN CD4 + T cells
+Airway hemorrhage
+evolvability
+prevalence
+JEM-1230 electron microscope
+three
+decentralized
+30 pmol
+480-490 nm
+Tfrc
+1 hour
+ECM genes and their miRNA and lncRNA regulators
+subcellular proteomics
+individual written consent
+Modifications
+egg yolk immunoglobulin
+pulling speed
+promiscuity level
+S 2
+Shapiro-Wilk test
+typical dinoflagellates
+Colubridae
+ub j and lb j
+r s ≡
+Rectal temperatures
+The FAMlabeled unselected ssDNA library
+blood
+Hepatitis B virus and hepatitis C virus
+90%
+fingerprint-and histogram-based methods
+7 groups
+binds and sequesters ISGylated viral proteins
+Equation
+Serum
+Immunofluorescence
+antithrombotic
+bone marrow of pigs
+putative chIFITM1
+95% confidence intervals for predicted arrival date
+Four
+H5N1
+Live poultry markets
+make
+bird
+30 minutes
+stem pocket-directed BnAbs
+Cellular and humoral
+IL-7
+targeting HSV-1
+50-100 million
+36-84%
+benign situation-related seizures
+2 h
+Special interest groups
+CD11b expression on the neutrophils
+GHx 9-11 CxCGx 2 GxE
+two
+security and law enforcement
+taking pharmaceutical antiviral medications and seeking medical help
+50 μL of Dual-Glo Luciferase reagent-1
+a reservoir of influenza
+PRRSV nsp2
+HIV-1 entry and replication
+alternative and complementary
+29%-78%
+Beckman AMPure solid phase reversible immobilisation technique
+1,759 bp
+15 min
+insight and to work effectively
+132
+pBS/U6-IL8
+MSFsc
+21
+luciferase assay
+vaccines
+Universal Probe Library
+AMPKα1/SIRT1
+PK-15 cells
+120/100,000
+two
+T-cell-secreted cytokines
+NAbs
+GC content
+image J
+12
+wet lab validation
+Irgm1, Usp18, Trim21 and Trim30
+PEG conjugation
+Activation
+the first variable
+P. aeruginosa and Burkholderia cepacia
+200 cells/microL
+virus dose and vitality
+Fifty percent
+spatial homogeneity coefficient
+HDV
+23
+Warburg effect
+antiviral efficacy
+QIAamp viral RNA mini kit
+Administration of blood products and fluids
+mining of cryptocurrency
+48 h post shRNA transfection
+30%
+conformation dependent
+60-90 mg frozen lung tissue
+ELISA
+IFN-β
+Operon Biotechnologies
+the period used for fitting the exponential curve
+metagenomic analysis
+plasma biomarkers
+BTV
+Diapause
+945 nt
+tracing of contacts of contacts
+signaling pathways involved in lung development and/or maintenance of adult epithelial cells
+Ten
+host cell caspase activity
+1-7 114
+late-stage
+Seven days
+Candida Genome
+2 2DDCT method
+Twenty-four hours
+Three
+three
+ActA
+higher
+Nanolight Technology
+-AA mutants
+the protease and the active sites
+inter-individual variability
+purchasing power parity
+oxidative stress in hepatocytes
+Baculovirus
+six
+proximal
+agar diffusion method
+Ebola
+flow cytometry
+structure
+1%
+b-Hairpin mimetics
+when running the eight models
+1 year
+G1 generation
+proteins
+three
+2006
+50
+Monitoring HCWs' health
+Macrophages
+Waterbirds and granivorous passerines
+A score ≥ 2
+beta-galactosidase expression
+Chinese or herb* or traditional or plant or medic*.
+direct contact with contaminated respiratory, digestive, and urinary secretions
+143
+triggers of physiological processes
+72%
+seven
+anti-malarial vaccine
+dose 2
+high loading capacity
+tetherin antagonism
+ER stress
+three
+manmade
+noise
+antigenic drift
+end-expiratory
+half
+4,710
+Lack of 2=-O methylation of the cap structure
+purified virus stock
+National governments
+Epichloë
+404
+the next step of Illumina HTS
+heme
+Parameter sets having higher or lower values of AR or SAR
+Airway driving pressure
+NHPs
+MAGT1 and TUSC3
+liveattenuated influenza vaccines
+10%
+The DDR pathway
+Parameters of hemodynamics, blood gases and lung mechanics
+αβ + T-cells
+9.8%
+Fluview
+India
+feral colonies
+I
+migrated faster
+>1 billion
+log dilutions of ZIKV
+studies of human infectious diseases
+accuracy
+see doctors
+contacts with bird secretions or droppings
+rA2-GC4
+88
+carbon and nitrogen
+research strategies
+ATG5
+viral invagination
+Ingenuity Pathway Analysis
+40%
+FIV replication
+Epidemic forecasting and prediction tools
+42
+yellow fever and dengue
+NF-κB and AP-1
+154
+10
+polymers
+inhibitors in the extracted DNA templates
+smoking and alcohol consumption
+Mobile phases A
+100 mM fusion inhibitory peptide
+369
+2001
+Escherichia coli DH5a
+Crohn's disease and ulcerative colitis
+Sequence Read Archive
+social contacts
+Knockdown of Sec16B and core COPII components
+72 hours
+a decrease in enthalpy
+viral sequences of genotype S6/L3,18
+dynamic light scattering
+4uC
+by counting fluorescent cells
+FAT10
+variability
+Guangzhou Municipal Exit-Entry Administration Office
+Mutschler and colleagues
+256
+subnetwork analysis
+nearly 7000
+50-60%
+1%
+5
+0.2 to 7 g
+Dinucleotide SSRs
+viral antigens
+cell morphology
+Mastitis
+to block the EDIII-mAb binding
+immunostaining for surface HA protein
+Sapienza University
+secondary infections
+850 cm 2
+229
+the solution to the Euler -Lotka equation
+Fourier transform infrared
+miR-208a potential in contrasting DOX cardiotoxicity
+four
+A reliable risk model
+early aggressive therapy
+time to resolution of cough
+autophagy flux
+how many individuals are infected
+high scoring hits
+92%
+10,049
+35%
+minor residual catalytic activity
+24 h
+isolation history
+SIRT7-mediated deacetylation
+11 months
+moral
+evolutionary dimension
+2390
+increases both the number of cases within each country and the respective outbreak probability
+114/60 mmHg
+PhyloD
+1,200,000
+lungs
+Mx3005P or ABI7900 thermal cyclers
+calculation time
+92.3%
+MjsvCL
+predicted infections
+parasite
+95%
+over 40
+1811
+29%
+decreased cell viability
+SD rat
+Hepcidin
+patterns of substitutions between species
+regulatory circuits which mediate metabolic responses
+hyaluronidase
+avian-like swine
+nine
+A transition
+three
+positive selection
+H7N9
+ImageJ
+Methods
+CICs
+QIAmp virus RNA mini kit
+National Institutes of Health Rocky Mountain Laboratories Animal Care and Use Committee
+mechanical ventilatory support
+standard descriptive statistics
+siRNA screening
+high OPV-DNA loads
+ARDS Network low tidal volume protocol
+the corresponding author
+165
+adjuvant
+Insertional mutagenesis
+IL-6 −/− lung fibroblasts
+rs1130866
+flow cytometry
+non-nucleolar
+driving pressure
+lack of a suitable receptor
+acidification of the cytosol
+location for activities
+H. volcanii strain
+rosuvastatin
+1946
+TLR3 and TLR4 mediated signaling
+all base-pair combinations
+TCA
+Poractant alfa
+unique serial numbers
+demographic information as well as distance typically travelled to school or work
+bacterial
+Dichotomin A
+a shot of a defensin expression construct
+Cxcl5
+interaction of GP with the endosomal receptor NPC1
+seven
+Platelet aggregation
+metabolic endotoxemia
+four
+knockout and wild-type mice
+Human influenza hemagglutinin
+Larger clinical trials
+trafficking of EBOV particles to NPC1 + endolysosomes
+Reed-Muench
+Tasly Pharmaceutical
+four
+inability to confidently ascertain admission dates from outside hospitals
+rabbit anti-pigeon IgG
+a pNA-attached trypsin substrate
+Five
+Bregs
+age and gender
+217 nm
+vSS1, vSS2, and vCC1
+myelin proteolipid protein
+11
+public schools
+Statistical Package for Social Sciences software
+B. thailandensis
+coal burning
+11 years
+three
+ESC self-renewal
+lack of clear sequence similarity
+more than a century
+16
+differ
+splenocytes
+increases resistance of macrophages to HIV-1 infection
+HCAP
+Gender
+MS² spectra
+vascular endothelial growth factor
+germinal center B-cells
+general transcription
+Claudin-1 and occludin
+2 h and 15 min
+numbers per 1,000 patient-days with 95% confidence intervals
+Decoration of the nanoparticles surface with targeting molecules
+novel strategies that are independent of host immunity
+Cervix cancer
+66 and 32
+Ubiquitination
+25
+human immunodeficiency virus
+130-170 million
+severity and mortality
+optimization of megapeptide design
+IL-10
+any other possible pattern
+The first two
+metabolic, hormonal and immunological
+1 week
+high functional avidity
+Inflammatory
+134
+40
+the sequence search space
+HBoV
+GTW15 and GTW16
+25˚C
+DNA vaccines
+unwinding duplex viral DNA at replication forks
+RdRp inhibitors
+liposomal aerosol
+One hundred fourteen
+one of the first furin inhibitors
+half-life
+inhibitory metal
+30%
+2.0
+room temperature
+expression of LPL pre-peak
+FcɛRIγ/FCE1A
+1 hour
+digestive
+331
+S. typhimurium ST49
+trained interviewers
+58 kDa
+13/3/2020
+Birds
+Kenya
+positive selection
+weather
+the nearest infected city
+cell surface HS
+seven
+improving national managerial capacity and human resource capacity building
+membrane and α-helices
+Hydrophobic interaction chromatography
+IRF3
+positive
+Pip2a and Pip2b
+Suqian, Nantong and Zhenjiang
+domains or individual positions critical to protein function
+disodium hydrogen phosphate
+P < 0.05
+regression of tumor at distant sites
+atypical PKC isoforms
+assessing the correlates of protection
+-slow and -gamma
+two
+3
+grey
+4.9 ng/ml
+three
+Exacerbations
+significantly
+0.5%
+Spinal motor neurons
+50
+positive feedback for RIG-I signaling
+The level of IgG or IgA
+serum triglycerides and PERC and TCA AUCs
+matrix metalloproteinases
+insomnia, depression, and anxiety
+2430 to 2454 nucleotides
+3 months
+2.84 g/mL
+indirect healthcare costs
+44
+duration of treatment of opportunistic infections
+Mammalian S-lectins
+The industrial environment
+fungi
+single nucleotide substitutions
+elevated FFAs level
+normality
+proteins
+negative
+65 μL/min
+Subtypes that can be neutralized by PN-SIA49
+the ER
+MAVS
+mink astroviruses
+stratified
+Amiya K. Banerjee
+Models
+apoptosis
+Leverage of a query chemical
+1.7 million
+determinations of biomarkers in clinically accessible fluid compartments
+virus replication
+inhibits viral translation
+b k
+CE
+Amino acid exchanges
+Meta-Morph
+5 min
+1950s
+Intraperitoneal injection
+Hong Kong
+plerixafor
+45 min
+three
+elevation of in-circuit pressure
+urokinase
+mortality six months post-ICU discharge
+differences between the reference genome and sequences in the viral sample
+SIR model
+how much stool sample should be added into our assay
+Santa Cruz Biotechnology
+Norway
+six
+vaccinations
+10
+respect for the government
+Multiple models
+Amato et al.
+PGN N-deacetylation
+HBoV-1, 2 and 3-specific primer pair and probes
+iterative process
+experimental method
+AlphaLISA assay
+Coinfection
+nomenclature
+3%
+DENV2
+reciprocal
+ATCC
+A scoring system
+acute respiratory distress syndrome
+close to the value observed in the commuting flows
+20%-30%
+Calabrese and colleagues
+31 -80.5%
+fear of side effects and questions about its efficacy
+perfect complementarity between the miRNA seed region and the target
+Antiviral treatment
+statistical analyses
+0.85%
+peripheral blood mononuclear cells
+mTORC2
+630,000
+Tracheal organ culture
+mAbs
+cesium chloride density gradient ultracentrifugation
+moderate
+Dong Thap HRSC
+LDS buffer
+23-24uC
+Graphs
+5 days
+longitudinal
+Phenomenological models
+OR
+gammaherpesvirus-encoded lncRNAs
+pulmonary intravascular macrophages
+alleviating the pulmonary inflammatory reaction and increasing survival rates
+disease spread
+RSV
+influenza vaccination
+methods, models and biomarkers
+Virus-infected or mock-treated mice
+SYPRO Orange
+STING
+30%
+ECG
+9
+pknotsRG
+Being young and leading a healthy lifestyle
+Medical Research Council Guidelines of Good Clinical Practice
+targeting myeloid cells
+Clear and countable virus plaques
+exogenous MaMIF treatment
+drive the maturation
+decreases HIV-1 infection
+coordinated actin rearrangement
+larger sample sizes
+53
+viral fusion
+liver, spleen, lymph node and bone marrow
+chloramphenicol, ampicillin and kanamycin resistance
+Leica SP2 Confocal Scanning Laser Microscope
+individual patient identifiers
+BMP4
+canonical CDR H3
+Validated TaqMan assays
+Comets
+2 O 2 -induced degradation products
+#Gi
+ACE2
+Twelve
+Malondialdehyde
+2-4 h
+5 -end truncated and full-length U6 snRNAs
+98.4%
+Reduced gross and histopathological lesions
+supernatant
+immunocompromised
+farming
+patient presentation with acute, subacute, or recurrent DAH
+activating cytotoxic T-cells
+Plasminogen activator inhibitor-1
+Africa
+increased binding to liver tissue and/or increased dissemination to the liver
+Twenty-five
+swine
+immunity
+5 min
+elevated viral titers
+they can come for service
+hepcidin
+1.7 × 0.9 cm
+Common contaminants
+795
+Refractory hypoxemia
+a basic human right
+1971
+cholesterol and sphingolipids
+resistance against anti-retroviral therapy
+5'-RCGTG-3'
+E. coli derived K5 polysaccharides
+very high
+Cleavage of prM
+stability and reproducibility
+RNA viruses
+Table 1
+Cell Viability Assay Kit
+up to several tens of microns
+a unified and powerful management organization
+31 months
+Phylogenetic analyses based on env and gag nucleotide sequences
+newborn hamsters
+Pinellia ternata agglutinin
+mitochondria
+Mouse-passaged PVM
+severe brain pathology
+Diarylheptanoids
+ribosome density
+maintenance of high R t values
+mass and routine
+calibrated model
+destroy
+MBL
+a significantly decreased function
+JNK1/2
+hamsters
+NCK-8
+dephosphorylates pNPP
+passenger data
+lung injury
+gamma-tubulin
+Ab-Pak-Lah-01
+anthropometric
+ultracentrifugation
+IRF3/7 and NFkB
+1 mg/ml
+generalized linear model likelihood ratio test
+greater than 95% protection
+mortality
+2,2%
+accelerated mortality
+20
+pU/pLA
+49
+q n
+higher-order
+one
+1 × 10 7 cells/mL
+annual outbreaks
+virus infection
+they were few
+therapy
+PHYLIP
+membranes of damaged lysosomes
+DNeasy Genomic DNA Extraction Kit
+age, sex and severity of hepatitis
+10%
+intervention measures
+differences in perceptions of severity and susceptibility of diseases and vaccines
+Cell invasion through the extracellular matrix
+50.3%
+amplify a 340-bp amplicon
+x i
+liquid chromatographytandem MS
+three
+26
+Rottlerin
+models
+7.0
+Memorial Sloan Kettering Cancer Center
+six
+two
+Defective interfering genomic segments
+ssc-miR-30d_R-1
+100U MspI
+which variables related to COPD exacerbations should be investigated
+Vaccines
+Novel automated genomics and proteomics analyses
+lung epithelial cells
+viral reactivation
+immunofluorescence
+Supporting Information
+5 %
+cell surface HS
+Crossing the endoplasmic reticulum membrane
+9
+TRIzol
+a dietary flavonoid compound
+Coinfection with different HBV genotype strains
+Ciclesonide
+Processing bodies
+Ca 2+
+400 to 500 nm
+Protein kinase C
+Those publications which provided information on the numbers of cases, deaths or attack rates
+Poisson ratio of m ¼ 0.4
+July 2009
+geographically and culturally limited
+QuickChange Lightning Site-Directed Mutagenesis Kit
+cytopenias and infusion reactions
+two
+pre-processing, annotation, statistical analysis and data visualisation
+LptD or other important membrane proteins in other Gram-negative human pathogens
+a list of proteins for each gel band
+homogenous borders
+protective
+1 tachyzoite in PBS
+20 mL of 1610 8 cell/mL suspension
+HVR1
+ZIKV prME
+low-dose Ang II infusion
+200
+enhanced migration to draining LNs or apoptosis
+ISRE activity-luciferase reporter assay
+phosphotyrosine
+NMA, MD simulation, and NMR
+71.1%
+CypA
+11
+Type I
+Quantification of the current scale or nature of the AMR problem
+Inability to early identify patients who will fail NPPV
+36.7%
+SP-D levels
+total anti-virus Ig antibodies
+population size
+an early transient response
+Neprilysin
+anti-tumor activity
+geometry and surface charge of the structure
+antigen presentation to T cells is preserved
+hunting
+genome-integrated sequences
+24
+Hepadnaviridae
+airway antimicrobial immunity
+polyA-tails
+Student's t test
+11
+Flouroshield mounting media with DAPI
+Ammonia
+cotransfection
+PRO
+high specificity
+plasmid pYM-14
+ARDS
+the pathogen receptor
+100
+CD8 T cells
+Negeri Sembilan and Selangor
+USP7
+0.24 Å and 0.26 Å
+local community organizations
+food and water quality
+fibrosis development
+Ulceroglandular
+restricted CD4 and CD8 T cell epitopes
+biomass accumulation
+AIV and IBV
+protein-coding IFnL4 mrnA
+P < 0.0005
+Ded1p
+Four
+24 h
+phylogenetic
+Immunoblot
+SGW X-4 micro-melting point apparatus
+clinical samples
+Vaccination
+HBV-17 and HBV-19
+Phylogenetic relationships of the IBDV strains
+GP 1,2
+immunoblotting
+TNF-induced apoptosis
+Autophagy
+heart-lung machines
+sucrose gradient ultracentrigugation
+HIV and malaria
+Drug-target interactions
+Kenya
+mating and the production of spores versus yeast
+GraphPad Prism
+ATG12
+IRF9
+Cell counting kit-8 Dojindo Molecular Technologies
+EM Data Bank
+viral preintegration complexes containing HIV-1 Integrase
+1.6 million
+ESR1
+1.59%
+hyena food items
+Gram positive
+Living Image 4.5
+NDV
+Nicholas Evans
+three times higher
+passenger antigens
+six
+Adenovirus
+5%
+fiber damage
+Clustering
+RAD51
+influenza B
+red stars
+guinea pigs and ferrets
+SAXSquant 3.5
+self-report based
+PCR amplification of target genes
+16.2 and 18.3
+fetal lung inflammation, increased airway surfactants, and increased lung volumes
+NanoDrop 1000 spectrophotometer
+almost no reduction
+ddPCR
+0.13
+host cytoplasm
+lung tissue
+100fold
+antibiotics
+porcine
+aquaporin 5
+HIV/AIDS
+bioinformatic
+hVivo Services Limited
+K +
+Remote ischemic post conditioning
+antibody production
+mutation pressure
+8%
+serum
+72 h
+how to ensure that breathing is effective
+when the desired temperature is furthest from ambient
+404
+39
+HFMD transmission
+QuikChange Site-Directed Mutagenesis Kit
+GraphPad Prism V.5
+3 days
+controls
+age, sex, medical comorbidities, and obesity
+tick-borne and mosquito-borne agents
+update
+NADPH oxidases in phagocytes
+sACE2
+antiinflammatory
+bacterial binding affinity
+delayed patient care, patient safety concerns, and delayed system implementation
+most common
+497 to 1140
+6 months
+100%
+10
+Glycyrrhizin
+Pneumonia
+rapid tumor formation
+7 days
+leukemia inhibitory factor and retinoic acid
+16 mg/mL
+lymph nodes
+53 kDa
+Lung ultrasonography
+several
+SYBR Green
+Administrative and billing data
+0.15
+Mice, ferrets, and nonhuman primates
+general prognosis and current resource limitations
+Caspase-11 gene expression
+free FITC
+33 million
+13-fold
+allostery
+K 2
+InfluSim
+more than one hundred
+active invasion
+periodic
+30 min
+PrimeScript RT reagent Kit
+TET-21C
+LSV2
+5 days
+individual-based epidemiology models
+0.01
+five
+incomplete or inadequate vaccination
+Laundry
+high information about the virus-host interaction
+five
+MDRTB and HIV infection
+Cells
+8 hours
+10 mins
+Bronchiec tases
+training years
+polymorphism
+western blot
+the number of nodes
+I N
+lower stress levels and greater individual well-being
+automatic
+positive end-expiratory pressure
+confounding by surgically-linked blood transfusion
+every two years
+Fragmentation of chromosomal DNA
+0.3158
+Population doubling
+NF-kappaB and MAPK
+lamivudine
+Gehan-Breslow-Wilcoxon Test
+twice
+global pollination
+T66N Rab34
+HA, NP, and NA
+Five
+isolation and characterization of these cells at the single-cell level
+extends
+rapid contact tracing
+three days
+PSI-BLAST
+three
+highly positively
+mild mutations
+122
+all mental health workers
+influenza
+cell survival
+immunocompromised conditions
+influenza
+copper sulfate
+GAPDH
+induces close to the largest possible change in RNA structure
+abnormalities of the GM-CSF signal transduction pathway
+final proof
+control
+Toxoplasmosis
+Seven
+five
+1918
+West Africa
+10%-16%
+Diarrhea
+acute inflammatory reactions
+σ ∆l i
+Ub
+7.64
+phospho-Csk antibody
+The N-terminus of IPO
+mimotopes
+2 μg purified RNA
+6 months
+increased transmissibility in ferrets
+PA, PB1, PB2 and NP
+Transducers
+1999/2000
+60-100 nm
+Vivo-Morpholinos
+STart4
+Eleven
+a single basic amino acid
+T7 RNA polymerase
+vagal tone
+randomized clinical trials
+0.18
+polyprotein expression strategy
+Hombikat UV100
+11
+dominant
+100 mM RGD peptide
+third microdomain
+the proliferation of Caco-2 cells
+transient inflammation and compensatory remyelination
+Acute myocardial infarction
+a nuclease-resistant DNA hairpin
+partial pressure of carbon dioxide
+25 000
+co-infected reservoirs
+80
+CL-QJ 274218 partial sequences
+specialized
+IFNγ
+circRNA_finder
+Fecal samples
+Cyanobacteria
+pain and hypotension
+Mitochondrial impairment or dysfunction
+80 to 90%
+lower urban development
+2004
+10
+CS-formed nanoparticles
+March to May
+Compound II
+the estimator of R 0
+two bsheets that cross over each other
+intracellular endosomes
+cellular stress or the innate immune response
+coping appraisal
+Equal numbers of the vectors
+human tissue cDNA arrays
+Lectins, TIM-1, and TAM kinase Axl
+cell proliferation
+dye bias
+FK506-binding protein family
+Zinc deficiency
+papain
+Akaike
+documents issued by supranational institutions
+0 and 1
+EBV-related
+puncta that represents a single mRNA transcript
+distance
+HIV infection
+40 s
+patients visiting the hospital for treatment
+Breathspec GC-IMS
+RECIST
+four
+Ebola virus glycoprotein
+Applied Biosystems Sequence Detection Systems Version 2.4 software
+Hepatitis C
+immunomodulatory
+79.29 to 83.27%
+social distancing
+fluorescent
+industrial
+Hospitals
+The assay described in Fig 5
+40.7%
+one-way analysis of variance on ranks
+slightly above 10%
+development of colitis
+cost
+15 ml spin concentrators
+grow rapidly
+interpreting the large volume of available information
+CD4 T cells
+Drugs
+GeoChip 4.0
+increased access to the HR-1 region
+microglia
+PFU/mL
+VP40, GP and NP
+mutagenicity and carcinogenicity
+RC
+Cerebral malaria
+FLX800
+SOFA
+CD40, CD74, CD86 and CCR7
+to find a compound with no cytotoxicity
+cc0
+worsening
+G±U base pairs
+psychological inflexibility
+NucleoSpin Gel and PCR Clean-up system
+8
+lethargy, anorexia, weight loss and immunosuppression
+99% per amino acid
+higher sensitivity and smaller sample volume requirements
+35
+21st of November 2014
+axis
+Nuclear extracts
+one-third
+M1 macrophages/microglia
+x i
+cryo-EM
+China
+JD and SB
+160.25 ± 9.47 mg/dL
+twice
+Finding a live virus in a healthy bat specimen
+education
+ifn-α
+progressive multifocal encephalopathy
+hypotension
+stage 5 and stage 2
+31% efficacy against HIV-1 acquisition
+severe
+QIAamp RNA Mini Kit
+no significant association
+More than 180,000
+rennin-angiotensin-aldosterone
+malaria
+F2
+SplitsTree
+response plans
+60-90 mg frozen lung tissue
+hospital demographics
+viral infectivity and titers
+IgM, IgG, and IgA
+air transport
+eight
+template switching
+2014
+12%
+SAS-9.3
+socio-economic indicators
+culture positive rate
+tabulated data
+more than 500
+Supernatants
+cytokine production
+The nuclear pore and the cellular process of nuclear trafficking
+severe hand, foot and mouth disease
+type I diabetic
+histopathological evaluation
+cholesterol moiety
+44.2%
+two
+11
+LAMP
+Erdos-Rényi models
+human macrophages
+measles
+100%
+tetracycline or fluoroquinolones
+type I IFN
+Class 2
+1332
+inhibit
+62
+10%
+endoplasmic reticulum
+Two microlitre of the FPM
+adults
+measuring to what degree heroin is generating psychoactive effects in an animal
+a separate model
+the time staring from May 1, 2009 to May 23, 2010
+21
+MEDI-565
+gastrointestinal tract
+increased hepatocyte USP18
+risky primary infections
+cynomolgus macaques
+eukaryotic
+Eukaryotic expression vector P4
+samples
+DNA
+factors other than co-infection with CxFV
+delayed cytopathic effect development
+generation time
+binding to the chromatography column
+37
+Greater than 60%
+mixing acetic acid, phosphoric acid, and boric acid
+XOD
+immunofluorescence
+128
+6
+Chemical differences between MG770 and MG756
+coumarins
+feasibility of both the intervention and the RCT processes
+excitotoxicity and oxidative toxicity
+genetically tractable
+Sepsis, ARDS, traumatic head injury, and HIV/AIDS
+ultrasound evaluation of dorsal diaphragmatic movement
+active targeted drug delivery combined nano-technological carrier platforms
+Bwa mem
+population doubling time
+binding of neutralizing antibodies
+Creative Commons Attribution Non-Commercial License
+76.5%-78.7%
+Gram-positive
+1.82:1
+155
+resistance of respiratory system
+HCs
+16
+Neutrophil Elastase
+Pro-caspase 8
+SDF Etajima Hospital
+Prone position ventilation
+38.35%
+33.4%
+14/3/2020
+Similar
+normal
+147
+low mortality rates and yet high fetal morbidity rates
+CM2
+train and evaluate CNNs
+2%
+N
+six to nine hours
+each model's uncertainty
+30 days
+Zaire Ebola virus
+Flavonoids
+100 nM range
+study participants
+mean EGFP intensities
+1-3%
+an empty vector
+DENV viral proteins
+2007
+Central and East Jakarta
+null
+hemolysis
+entropy
+magnetic beads
+Tlr4
+cisplatin
+one week
+mammals
+non-negligible
+reporter luciferase
+cc-by
+International Circumpolar Surveillance Climate Change and Infectious Disease Group
+uncoupled variants
+p19
+Hepatocarcinogenesis
+Small sample sizes
+free radicals
+RC
+Normal mouse serum
+intermediate syncytiogenic activities
+Beckman Biomek FX 96-channel robot
+69%
+Dr James Cantlie
+Mapping
+G1252
+geographic correlation studies
+pair-wisely base-to-base comparison and visualization
+fewer available sequences
+improve population health
+26
+therapeutic
+0.1%
+5
+Gaussian graphical models
+Vaccination
+caspase-dependent
+SPSS 17.0
+three
+Chameleon Vision II Ti:Sapphire laser
+one
+females
+Imaging system
+H7N9
+blood-stage infections
+NIV
+four
+NPC1 receptor
+every 4 to 8 hours
+I49
+9−10 nucleotides
+RT-PCR
+articles
+too brief
+positions 78/ 79 of STING
+two
+Targeting control efforts on individuals with highest potential to spread disease
+24 h
+impediments of bacterial identification and research
+booster injections
+gPC8 and gPC12
+some fractions of within-host viral populations may be lost
+Drug Design, Development and Therapy
+Two
+CCSP
+autophagy
+log-rank test
+oligonucleotide primers
+binding site druggability
+633
+71%
+1:500
+60%
+pyroptosis
+berberine and emodin
+31
+GM3
+Nine
+Th2
+alanine or valine
+receptor retention, receptor release, and F retention by peptides
+SGTA client proteins
+The number of newly imported cases on day t
+Brainstem
+A control group
+life
+several-fold
+host pressure
+isolating focus individuals
+lithify
+SRC
+replication of human immunodeficiency virus
+assessing virus-host interactions
+degradation of the ECM
+respiratory viruses
+iProt-Sub
+target, signal or probe amplification
+dynamic exclusion of 60 s
+exponential growth
+40
+95%
+escape
+NEPV, Gumbo Limbo
+a protective effect against SONFH
+a peak representing the extended extension primer appeared at the expected mass
+SARS MA15
+a BHLF1 homolog
+noddies
+3
+BUN and Cre
+eliminate infectivity without affecting receptor binding
+1%
+Data recorders
+anti-CEACAM1 mAb
+lack of comparability in terms of age or antiviral therapy between study groups
+resource limitation
+28,333 Da
+15.9 %
+stability of the heterohexameric AB 5 holotoxins
+7 month-old
+aae-miR-11-5p
+mass spectrometry
+galactosyl residues of glycoproteins
+α-2,3 linked SA
+70
+more epitopes detected from the C-terminal ends
+epidemiological history
+Respiratory infections
+Leven
+some clusters
+leukocyte squeezing motion
+Due attention to the soft periphery
+Phylogenetic
+quarantine
+visualization tools
+high-throughput approach
+viral heterotrimeric polymerase
+infection of EV71
+48%
+pseudogenes
+simulations
+IP-10 and I-TAC
+fluorescence
+R06E-J cells
+Pair-based
+HCV-associated, hand-annotated genetic data
+HI antibody
+Let-7f and miR-24
+host cell factors and physiological processes
+rate of convergence
+95%
+Influenza A/H1N1
+4%
+high-throughput
+Kir2.1 folding defects
+P2X7R
+seven
+commodity flow algorithms
+95%
+Nairobi
+dispase-treated tracheas
+Age-related macular degeneration
+Flow cytometric
+false positive rates
+MBHE system
+PKC
+media
+Germany
+382
+rotavirus and astrovirus
+Increased activity of the Atg1/ULK kinase
+immune response against a broader range of pathogens
+intracellular and extracellular reporters
+severe respiratory failure
+plasma membrane
+PP2A, GAPDH and UBC
+2,646
+late endosomes
+differential viral infectivity
+dimers and monomer
+56
+4
+LPS-activated
+The region of intersection
+Definitions and categorization methods of operation volumes, and correct identification of SSIs
+LPS
+three
+6-fold
+20%-30%
+a searching method
+a significant interaction between valence and component
+clinical, microbiological and radiological
+Java 2 Enterprise Edition Software Toolkit
+reverse vaccinology
+assembly of Vpu-WT
+dinoflagellates
+low and medium risk
+Our results
+reachability
+positive selection
+up to 2 months
+Non-stretched cells
+NGS
+enhanced
+a placebo with blinding
+SA and SL EBOV IgG negative serum panels
+a good prognostic
+43.4 years
+generalized
+CBF1
+the C-domain of GST-σ
+2003
+2014
+ESBL-producing organisms
+118
+Zwitterionic polysaccharides
+reovirus-infected cells
+Minimum start and maximum end loci of each cluster
+pro-inflammatory cytokines
+ISG15
+Regions Of Interest
+Homologous sequences
+the one of our present objective
+Various housekeeping genes, ribosomal RNA and total RNA
+Chinese herbal medicines
+5
+mathematical models
+$6
+TLR-mediated
+subtype B
+Foot-and-mouth disease
+cellular ACE2 levels
+post-research access to a broader population
+12%
+CD57+
+costimulatory
+1915
+adenovirus
+chisquare test or Fisher's exact test
+extracorporeal membrane oxygenation
+Agar
+Drs. M. Peeples and P. Collins
+sequence variation on the surface of vaccine candidate proteins
+viruses, systemic conditions, drugs, or toxins
+2 to 141
+Brazil
+Five
+Phlebotomy
+8%
+1 hour
+placentation
+5%
+reduced viral titres
+Thomas Bollyky
+PKR, OAS/RNase L or Mx
+severe outcomes of the diseases
+binding to cell receptors
+IAV infection
+greater than two-fold
+CpG
+G6PD
+The interface between public health and health care
+1997
+acute respiratory distress syndrome
+16
+ten
+40
+secretory genes
+antiinfluenza
+higher conformational dynamics
+50,000
+113
+individuals
+explore the challenges posed by an Earth System
+small analytes
+RT-PCR and agarose gel electrophoresis
+contradictions in the language used
+classical hexanucleotide polyadenylation
+reports on outcome
+63 tagged extenders
+reagent and manufacturing variability
+MHC-I and II
+Pseudogymnoascus destructans
+RNeasy Mini Kit
+specificity, selectivity, and rapidity
+viral antigens
+higher
+H
+RSV
+enhanced inflammatory indices
+HIV-1 RNA
+Outbreak duration
+21%
+target exon number and oligomer annealing coordinates
+to create a standard curve
+bronchitis
+a sequence containing a BirA enzymatic biotinylation site
+waders
+percutaneous
+Linear regression
+Retroviral pseudoparticles
+reactive oxygen species and haemoglobin
+NO and IFN-γ
+attenuate −1 PRF
+disruption of nucleolus structure
+nanomolar
+PVDF
+Multiple sequence alignments
+phase angle difference
+1.10 Ϯ 0.99 M
+maintenance medium
+touching, handling, living close to, and consuming animal products
+serum-free media
+Biobanks/Biorepositories
+M-MLV Reverse Transcriptase and random hexamer primer
+acute lung injury and ARDS
+GoogLeNet-TL
+interleukin-4 and IL-21
+1975
+TBSV RNA synthesis
+poor prognosis
+phosphorylation
+Creb3L1 mRNA
+antiviral drugs
+1 h
+serum creatine kinase level
+the earliest systemic host antiviral response activated following infection
+adjuvants
+calmodulin and α-catenin
+MED1
+further development
+Arterial pH
+local levels of angiotensin peptides
+luciferase activity
+significant
+C3-fragment C3d
+Dolly the sheep
+57.4%
+Newcastle disease virus
+Two
+to design a drug able to destroy HIF-1-expressing cells
+Avidity
+enzymatically active protein
+Two-sample Kolmogorov-Smirnov tests
+amplify the region between positions 130 and 201
+Atg20, Atg21, and Atg24
+an activated ACE/Ang II pathway
+non-neutrophilic
+14%
+Escalation
+virulence factor
+Twenty-six
+Ebola virus and Marburg virus NPs
+purine metabolic pathway
+1.02
+MDEO-12
+1/m
+relative fluorescence units
+near the entry channel of the ribosome
+Santa Cruz Biotechnology
+SCARB2
+silver nitrate
+an expedited psychiatric evaluation
+10.1371/journal.pone.0048608
+concentration and extraction methods
+80%
+Mutations
+allergic asthma
+antimicrobial defense
+Arrows
+heroes
+host cell translation machinery
+complicated disease
+0.8%
+364
+LAMP amplicon loop sequences
+influenza virus-induced inflammation in the lung
+144
+Bartonella
+to measure exposure to environmental tobacco smoke
+experimental testing
+pulmonary hemorrhage
+Insertion of the HA epitope
+HCV
+two
+those who received interventions might be more likely to be enrolled in the surveys
+initiation
+Fixed and permeabilized islets cells
+5-month
+at home
+IFN-stimulated gene factor 3
+DNA sequencing
+three
+blue
+MBP-and MOG-specific response
+C and V
+two
+consistent patterns and similar risk estimates
+lower limits of the active and inactive pairs
+more than half
+programmed cell death
+12
+Serial deletion of 75 bp
+Michael V
+to lock P-site ligand in a suboptimal conformation
+Hitting
+RAS
+lytic
+10 12
+MHC class II antigen presentation pathway
+non-trivial
+apo-enzyme
+ESCRT proteins
+DAPI
+parents of children who were asked to go into quarantine
+SVM classifier
+Peptide-MHC structure determination
+different NTFs play specific roles in HCV life cycle
+peak viraemia
+18
+SH-UF
+KL~P i P log P Q
+Future trials
+disaster preparedness and public health
+two degrees of prolonged hemorrhagic shock
+Emilia-Romagna
+a-helical structure
+Community-acquired respiratory viruses
+underlying molecular mechanisms of inflammatory response
+retention of ACE2 on the cell membrane
+DENV
+IEDB population coverage tool
+sex, geographical distribution and/or host group size
+Duration of respiratory support
+NMS-873
+fluorescent antibodies
+1.75
+hematoxylin and eosin
+Waterfowl
+type A
+4 million
+caspase-11-dependent
+hypoxemic
+The consequences of the absence of selective pressure
+amiRNA #1-mediated effect
+spatial autocorrelation
+eIF4F
+50%
+on dry ice
+Codon-optimized cre recombinase
+Figure 3
+two-step PCR
+1180
+Cortex Magnoliae Officinalis
+Fig. 2
+optical microscopic examination
+30
+Digital PCR
+A2 and A3
+Ubiquitin
+resistance patterns, and human exposure pathways
+Two
+batch-to-batch
+Parker hydrophilicity scale method 38
+recoding cassettes
+tight and intricate interactions
+via the airborne route
+Sex
+master regulator
+exosomes
+Ͼ99%
+ethanol
+our study design
+GraphPad Prism 4.0
+58.3%
+therapeutic
+selection of resistant mutants
+Retinoic acid
+Population genetics
+Full-length genome sequencing
+respiratory syncytial virus
+Total cell nucleic acid
+three
+Sequence numbering
+genes
+force, duration, and velocity
+Serum and urine
+115.0 Ϯ 92.4%
+increased levels of IL4
+a p-value between 0.008 and 0.001
+changes in pseudotyping efficiency
+A preconceived and tested questionnaire
+Gobierno de Espana
+5′ 3D7 and 3′ FCR3
+neurological
+passive immunization with SHIVIG
+35
+842 ml to 2,189 ml
+The relationship between staff and parents
+severe disease
+expression of specific influenza viral genes
+S
+text
+24 h
+over-fitting
+PfSWIB
+four
+apoptosis
+10218
+cantilevertype sensors and MSS
+2017
+FACSAria
+hostpathogen interactions
+an advantage in some experimental settings
+Aspergillus fumigatus
+6 hours
+symptomatic malaria
+60.7 and 6.9
+251
+9.4-23%
+120
+tens of thousands
+Tsan Xiao and David Garboczi
+intestinal
+PEEP
+The group with corticosteroids
+Fifteen
+innate immune response
+influenza A viral strains
+Coronavirus
+activates NF-NB-dependent transcription
+lung tissue
+2 days
+significant changes in the hematological parameters
+computed tomography pulmonary angiography
+five
+the viral lipid coat
+Streptavidin-coated magnetic beads
+3 turning points
+gRNA translation
+viral immune evasion
+virus-based vectors
+The methodology for reverting back to germline
+24
+reduced mRNA expression
+virus-induced complement dysregulation
+attachment to a target cell
+Employment status
+temperature-and drug-specific growth phenotypes
+antigen-directed immunity
+500
+74
+11 bp in stem 1
+abdominal cramping
+tryptase + mast cells and CD207+ Langerhans cells
+HCV-infected
+35-fold
+10%
+90 %
+environmental and trend analysis
+receptor density and identity
+Cluster V.2 and V.4
+p38 MAPK and its associated MAPK kinase
+March 31 of 2013
+ten
+inhibiting autophagosome maturation
+levels and enzyme activities
+respiratory function
+nine
+pleural pressure
+40
+lipofectamine
+VZV antibodies in the normal range
+Codon optimization fat1
+early autophagosome formation
+protective
+135,000
+enhances sumoylation
+C-type
+Titres
+Influenza A viruses
+Quantitative resistance predictions
+enhances frameshifting 10-fold
+17
+Illumina HiSeq2500
+0 -300 ms
+HRV-C026
+an evidence based clinical decision tool
+core components
+3 to 5 million
+Gene transduction through viral vector delivery
+Eq.
+China
+eight
+IAV
+Virulent IBDV
+assays without any templates
+one year
+four
+24,790
+heart rate
+25 l
+RNA sequencing
+seasonality
+Pileup format
+hrMCP-1
+passage 8
+bortezomib
+local laboratories
+2011-11-01
+altered genetic codes
+immobility, ruffled hair, and labored breathing
+AKT and JNK
+TLR9 /TLR21
+Richard Shope
+protective responses
+similar rates of dead cells
+age, environment and milk
+twice
+70,061
+hydrological processes
+genetic predisposition, viral mimicry, vitamin and mineral deficiency, geographical location
+3.0 silk suture
+40.3uC
+10 µg/ml and threefold serial dilutions
+Code reuse and object inheritance
+rapid phagosome acidification for lysosomal protein activation
+accelerate viral FH pathogenesis
+detailed
+6 ml/kg
+intracranial inoculation
+M k
+50 to 75%
+strong expression
+to effectively control each flavivirus
+461
+2009
+IRF7
+41
+seven
+interesting biological mechanisms
+transmission electron microscopy studies
+template switching as the primary mechanism of poly polymerase activity
+flattening
+Lipofectamine 2000
+Toll-like receptor-3 agonist poly I:C
+acetic acid
+phylogenetic
+Microfire 24-bit CCD camera
+12.5%
+NK cells
+Plasma proteome profiling
+infectious viruses
+binding site similarities
+signs of ill health and distress
+first strand cDNA
+A, A and B
+Cabal et al.
+realtime experiments
+viral clearance and vertical transmission
+glial fibrillary acidic protein
+20
+host miR-NAs
+40 cycles of denaturation
+1949
+functional
+antiviral activity
+written informed consent
+computational
+Respiratory syncytial virus
+host specificity
+trends in diabetes prevalence
+host cell binding and membrane fusion
+IL-12
+the evolutionary changes occurring within parasite or host lineages
+eqTHN_del_GPI
+SIRT1
+Cinanserin and losartan
+107
+descent
+452
+Impaired vRNA replication and NP aggregation in cytosol
+Huoxiang Zhengqi capsules
+2013 to 2016
+The giant component
+below the identity line
+chloroform
+known quantities of a synthetic calibrant RNA template
+excessive RNA polymerase activity in mammalian myeloid cells
+positive
+The scenario
+Bradford method
+Globalization and Health
+serial platelet counts
+Anti-HAV IgM
+Western blotting and negative-staining electromicroscopy
+four
+three
+0.8 s
+ten
+clean and high-resolution EM maps
+47
+Table 1
+secreted cAMP
+cartilage, bone, muscle and fat
+emergency mental health care
+seabird migrations
+Tony Epstein and Yvonne Barr
+CD81 and CD9
+validated clinical scores
+Multivariate statistical analysis
+University of Oxford Animal Care and Ethical Review Committee
+daily
+~4 million
+400 per 100,000 live births
+viral infectionassociated illnesses
+DGEA
+E2F7/8
+37
+loading control
+RNeasy mini kit
+100%
+The number of confirmed cases
+high level of illness severity and high mortality rate
+sFat1
+200,000
+Products containing triclosan
+an outbreak threshold
+standard 10-fold dilution spot assays
+resistance to phagocytosis and complement-mediated killing
+90 days
+SAS Enterprise Guide 7.1
+70 chaperones
+distinguishing introgression from incomplete lineage sorting
+#pragma omp parallel
+STAT1 and STAT2
+10 min
+Five
+Maintenance therapies
+benzylpiperazine adamantane
+Multiple hypothesis testing
+mean ± SE
+accurate quantification
+13 per cent
+multiple
+257
+24 hours
+Dog serum
+two
+constitutive immune assumptions
+AP2 and TOE3
+five
+NK-cellmediated antibody-dependent cellular cytotoxicity
+The number of locations in location group LH
+24 h
+actively cycling cells
+25
+LPS
+3D
+surface
+HIV-1 infection
+June 2002
+IL-10
+geographic heterogeneity has not been explicitly represented
+potentially crucial objects
+1 mm pieces
+9
+66
+MGs
+a counterion
+R 0 = 1.8
+metabolic protein dynamics
+DendoU
+To study viral effects of specific mutations
+twice
+Danishefsky and Livingston'
+Hepadnaviridae
+Clinical trials
+4.97 mg/ml
+effector memory or central memory subsets
+sCHIKV plasmid
+western blot analysis
+whole-genome shotgun method
+three
+genomic
+Bronchial epithelial cells
+increased transiently
+places from where the next important emerging pathogen is least likely to originate
+CD4-induced epitopes
+The amount of encapsulated b-galactosidase
+age, gender, birthplace, educational level, occupation, and socioeconomic status
+Uganda
+initiating and regulating viral translation
+The observed distances
+Intensive care unit length of stay
+survival rates
+Social power
+lentiviral assay inhibition
+Glial cells
+10%
+SHELXS-97
+Branche et al
+Transforming growth factor beta
+Astrocytes
+recombination
+liberal antiviral distribution for prophylaxis
+Freshwater fish
+Tree shapes
+adhesion molecules
+C-type
+virus stock
+300 kb
+PK5510
+macrophage inflammatory activities
+50%
+seven
+SNA and MAA
+whether the confounding factors taken into account were listed
+least-squares fitting
+Co-infection of the same cell
+pol N,1
+western blotting
+consistent activity level, temperament, and food intake
+antiviral effects of defensins
+Quantitative EM
+Zika virus
+T-705 and ribavirin
+108
+3,39diaminobenzidine
+MAXIscript
+CSLM
+over 100,000
+four
+EDII 101/106/107 epitope
+central nervous system
+72 h
+PCR products
+5500 V
+H5Cam
+policy recommendations
+BIRB 796
+Forty
+GFP fluorescence
+an NdeI and an XhoI cleavage site
+Blood
+11
+1093
+New York City
+suppressed NSs-induced PKR downregulation
+consumer behavior change
+IFN signaling
+ripping of the S1-L1 hairpin
+RNAi Designer
+the capacity and contact frequency of environment
+develop various lines of defense
+infectious diseases
+51.1%
+putative initiation codons
+sputum and endotracheal aspirates
+Northern and Central Italy
+Roche/454 titanium-based adaptors
+Csk
+positive
+data
+MEGA version 4
+Upon infection with MHV3
+further experimental verification
+conservation at the codon
+mosquito vectors
+3.7%
+Ad vectors
+MCPyV
+SPIO
+Additional staff
+Seven
+Ascites/HE/AVB
+ISG15 conjugates
+Total RNA
+survivors and non-survivors
+chemotherapy
+155
+Feedback from service users
+thermal denaturation
+APC Calibration
+CD4 + and CD8 + T cell populations
+Niemann-Pick C1
+cell culture medium of CHO-K1 cells
+confocal
+817
+66.9%
+Ten
+supernatants
+The structures of target or homologous proteins
+One unit of N-acetyl-Lglutamate kinase
+IAV fusion
+worsening oxidative stress
+11%
+hippocampal neurons
+December 2013
+Non-ST-elevation myocardial infarction
+ubiquitin-deconjugating USPs
+serum-free DMEM medium
+USP18
+safe and immunogenic
+language barriers and other factors
+dry ice
+−63 to −75
+progeny virions
+hydrophobicity
+2 1 -dAMP
+more than 20
+sylvatic
+S. aureus and S. pyogenes
+Percentage of specimen tested positive
+CD8 + memory T cells
+phosphoinositide 3-kinase
+MCMC 70
+L1
+heterodimer
+rate matrix L
+R551S
+Three
+69
+176,200
+Demographic inference
+3.3
+HCVpp
+HCV NS3 protein
+titration
+159
+reaction kinetics
+parasympathetic outflow
+146
+oxidative stress
+neural tube defects
+less than 10 fold
+proinflammatory and CD4 + mediated inflammatory response
+Dr Carmen Garrido
+200
+s IB→I 2
+lactase-phlorizin hydrolase
+maintenance of the cell productivity
+Efforts
+splicing-specific
+healthy adult mice and a DMD disease mouse model with leaky muscles
+weekdays
+Spatial structure
+13.968.5 years
+φ
+291,000-646,000
+Greater Difference in Absolute Value
+83%
+18.1%
+hairpin-type stem-loop
+Acinetobacter Baumannii
+IAV-induction of type I IFNs
+RNA binding motifs
+periodic and spline
+V2 loop antibody
+protecting 99% of the population
+C3, fH, and fB
+121 million
+27
+Osteoclasts
+model M
+Acriflavine
+4%
+Amplification of community DNA
+AUCs
+16%
+D,L-diaminopimelic acid
+adjuvanted influenza vaccines
+acute demyelination
+category B agents
+MESOMARK
+S. aureus
+Nikon Diaphot inverted microscope
+0.9993
+virus-encoded RNA-dependent RNA polymerases
+Background Genotype
+PSCC cell metastasis
+β-actin
+The common snipe
+lung epithelial damage
+polyhydroxy-alkanoates
+Full review
+HA
+Ebola virus
+45
+sterile distilled water
+increased secretion of CPYinveratase fusion protein
+cardiovascular disease
+serious brain injury
+bacilliform shape
+IDRISI
+Puerto Rico and Saint Martin
+anti-inflammatory effects
+bootstrap arrival times
+distinct physiological responses
+Further research and discussion
+ethanol sensitive
+variation
+five
+December 2019
+thousands
+Molecular
+dark-matter structures
+9
+84%
+ricin
+samples
+cc-by
+ART
+1
+delivery into transplanted organs
+Non-influenza virus infections
+infantile colic, functional constipation, irritable bowel syndrome
+colorectal
+BS-C-1 cells
+interstitial and alveolar
+DNA vaccine
+biochemical
+retrieval information from relevant documents
+NK cells and T cells
+Synthesis of several pro-inflammatory or Type 1 cytokines
+cc-by
+ball and stick with a transparent van der Waals surface
+Prof. Zhizhong Cui
+Ostriches with more than two missing sampling points
+H5N1
+killed
+infection cluster
+99
+Namibian National Herbarium
+an instrument-free, electricity-free nucleic-acid amplification test
+theoretically
+CS
+Pain
+89
+5-24-year
+five
+two
+Detection of single cells
+a prior suicide attempt
+INSR
+The cell-cell fusion infection pathway
+selection for their resistance to intrinsic antiviral restriction mechanisms
+antiviral
+restriction-induced travel delays
+0
+43
+Proportion of county designated as an important bird area
+intra-arterial RH
+Dashed lines
+residue 77
+Primer Express
+one
+the estimated parameters are expected to be robust
+10%
+ILI
+10.1371/journal.pone.0069982
+39
+185
+MiRNA-200a-3p
+EGFRvIII
+antibody positive
+single amino acid mutations
+neurogenic
+an assembling retrovirus particle
+Stichting HIV Monitoring
+NaOH
+HMPV positive clinical samples
+18
+20 h
+very short
+access log time series
+histological biopsy
+Processivity
+smart phone camera
+activity determined via high-content image system
+Statistical
+transcription by the RNA polymerase II
+27
+Foxp3 production
+Australia
+FMDV RNA in serum
+electrophoretically homogeneous csf-IgG mix
+independent
+Evo-devo
+20%
+our research was too applied to merit space on their campus
+the nucleus
+32
+the risks associated with ARF and ARF/SS
+apnea
+mevalonate
+early mild ARDS
+the initial date selected for the simulation
+between 35 and 50 minutes
+E2
+61 ml/kg
+N36 trimer
+conductive and respiratory sections
+Gleason pattern 3
+aquatic shorebirds
+a TA cloning vector
+disease spread
+rA2-GC4
+Trizol
+through orofecal routes
+CD14 polymorphisms
+viral RNA-induced oligomerization of influenza A NP
+treatment duration and outcome criteria
+security, self-efficacy and stress reduction of the staff
+March 2007
+TFIIH p44
+15 minutes
+culture samples
+CHIKV-mediated MCP-1 production
+Written informed consent
+GAPDH and ACT
+O15 E-GRASP
+70%
+30°C
+18 hours
+sepsis
+Figures 2A and 2B
+1647
+surfactant contained cells
+Type II
+payment
+every other day
+20-80%
+Fc-FgR interaction-dependent effector functions
+empirical in vitro MHC binding data
+50%
+infant death
+the binding of the two substrates
+Data S1 and S2
+laryngeal chondritis
+Wide distribution
+magnetic streptavidin beads
+1019
+varies widely
+29
+exopolysaccharides
+three
+Regulated gene expression
+Pichia pastoris
+ancestral
+variola virus
+jackknife test
+a bumble bee pathogen
+Our analyses
+6%
+activation of cell signaling networks at immune cell contacts
+one
+SARS, HIV and Ebola viruses
+increased early viral replication and reduced viral titers over time
+SAS
+Public health
+on the surface of mature dendritic cells
+SRP104704
+gender and exposure
+regulating
+seasonal influenza vaccination
+research
+four
+IFNs
+innate natural killer cells and the adaptive CD8 T cells
+60%
+Primates
+63%
+streptavidin-biotin
+CTL epitopes
+adenoviral vectors and adeno-associated virus vectors
+RNase L
+Many characteristics of the DNA, RNA and protein sequences
+10%
+endocrine, genital, lymphoreticular organs
+immune-modulatory
+89
+reducing epidemic severity
+92%
+selection bias
+Twelve
+Coagulation
+β R0
+expression of proinflammatory cytokines
+additional variables
+Group 6
+8-years
+IRENE
+influenza and respiratory syncytial virus
+Roche
+live attenuated influenza vaccines
+three
+cell cycle progression
+Eagle's minimal essential medium
+Natural selection
+unicellular
+hybridize to each positive-strand viral genome
+320-400 nm
+an inactivated virus
+myc-His tag
+Zika one
+CHIKF
+Graphpad Prism 5.03
+Mitigation resources
+7 mmoi
+the FS
+traditional phylogeny
+231
+evaluation of these responses from baseline to the last study visit
+TLR7 and TLR3
+V and W
+a publicly accessible online service
+minimal MW differences
+31%
+specific structural features of adenoviruses
+lung inflammation and immunopathology
+>3 g/d
+GCMS and FTIR
+five
+48 h
+individuals in that category interviewed
+2 x 10 6 RLU or greater
+77%
+transmission parameter b and infectious period parameter c
+Two
+transferred helper cells
+Aquaporin 4
+cDNA
+multivariable
+oseltamivir
+325,922
+community-based providers and organizations that are familiar with vulnerable groups
+different definitions of the time post infections
+Every effort
+female-biased immunopathology
+evolutionary
+ABPP-SILAC
+inserts which did not contain cells
+cap-dependent
+HSPs
+70 mm
+VEGFC and PGF
+reduced starter feed intake
+unwinding
+unwanted cells are programmed to be cleared
+1 mL of cold 2 x BHI
+host immune responses
+Recombination
+Age
+P25 TiO 2 NPs
+33 weeks
+pandemic influenza threat perceptions
+further studies
+rational
+approximation
+RTI
+metabolic
+17.65%
+transcription factors
+Substitution T160A
+median and 95% upper limit of the CI of Culicoides captures
+high risk groups
+Peptides and proteins
+144
+22.4
+binds PLP irreversibly
+cytokines
+1813
+La Reunion Island
+chronic cell-mediated
+Three
+TA98 and TA100
+MZ, CD, and SX
+N1
+protein A
+pEASY-B-D
+recovery
+20
+cc-by
+positive
+thymine nucleotide
+Ni-NTA affinity resin and MagneHis Niparticles
+neutralization activity testing
+The Investigator
+five-fold
+R e,C 1 = 2.01
+ISRE promoter activation
+between 8 and 10 amino acids
+calcu-
+Minimal stimulation of IL-10
+10 days
+acetone extract
+kidney Ang II concentration and AT1R expression
+neonatal bile acids pneumonia
+e
+R 0
+articles published in non-Scopus database
+RSV
+ThermoFisher
+capture efficiency
+KCD code of the NHIS-NSC
+TNFα
+Verso cDNA Synthesis Kit
+p40%
+cooperative unfolding in FECs
+90%
+polyA-tailed DNA
+lipid degradation
+136
+proportion of cases vaccinated
+CD4 + T helper 1 cells and natural killer T cells
+real-time polymerase chain reaction
+12-hour
+IFN-δ
+FGL2 expression
+DETA NONOate or insulin
+infection
+Lactate dehydrogenase level
+minor-groove base triples
+marked follicular and paracortical hypertrophy
+31 ng/l
+2524
+E-CO and airway eosinophil counts decreased
+5 min
+Camp Zachary Taylor
+systemic complement activation
+Mab 4A1
+MyD88-mediated pathway
+phylogenetic
+10
+downregulating
+HRP-conjugated anti-mouse IgG
+Cell-mechanics
+susceptibility
+mannose
+cDNAs
+intracellular pathogen diversity
+72 hpi
+safety
+24 hours
+where public health ends and clinical practice begins
+10 min
+Four
+individual
+activate senescence
+60-65%
+public, commercial, or not-for-profit
+juxtamembrane motif
+Exhausted viral-specific T cells
+TNF-α and IL-6
+predicting the peak time
+communication
+-7-oxozeaenol
+degradation and inactivation of the pIFN-γ protein
+GAPDH and HPRT1
+archeological sequence data
+61
+1993
+RIG-I and MDA5
+85%
+neonatal death, stillbirth, and preterm birth
+lifetime expected risk E
+to induce ribosomal frameshifting
+0.6
+hematophagous
+8.5 ± 0.09 minutes
+once a week
+Voluntary reporting
+rapidly decreased
+eIF5
+rehabilitation instructions
+up-and down-regulated genes interactions
+avian
+PB1-F2
+reduction in opportunities for within-host
+SPA
+HCV
+four
+amino acid substitutions
+ω
+30.8 hours
+TwistAmp™ exo kit
+SIRT7
+health care information
+unhappiness and stress
+methionine
+Analysis of GP CL -bearing VSVs
+infectivity
+to focus on the potential for revival of long-dormant microbial pathogens
+radium-223 and capecitabine
+mixing vessels
+Murine leukemia virus
+11
+44
+crows
+outside the PBG
+CHIKV
+lower temperatures
+tumor necrosis
+differences in microorganisms
+attributable fraction
+1.5%
+mean ± SD
+human influenza viruses
+56
+WuXi AppTec
+Translational shut-off
+665nm and 620nm
+Idealized networks
+changes through the seasons
+75.2%
+Congestive heart failure
+Genetic heterogeneity
+7
+One hundred
+seven
+50%
+conduction velocity
+non-linear regression analysis
+ulcers, schistosomiasis, liver disease and tuberculosis
+after passage through cell culture
+densitometric
+simplistic classifications
+39
+red
+page 10
+25%
+NMR analysis
+IL-6, IL-8, and IL-9
+$40%
+three
+Greater retention in treatment
+14.8%
+40%
+five
+TAAR2
+strongly induced
+monovalent
+European diving beetles
+Antigen
+infection control
+JEV serogroup viruses
+reversed
+four
+Sigma-Aldrich
+five
+static imaging
+1500
+Begg's and Egger's tests
+wild-type, S528A and W529A mutants
+characteristic
+0.842
+data
+$543.3 billion
+γ h
+functional considerations
+1.3 million
+the CT region
+rDNA
+pathogenic
+The weeks of peak activity
+viral loads in the upper and lower respiratory tracts
+NS
+P max
+human AT-II cells
+agenda-setting theory
+GOLD guidelines
+multicomponent
+cross-neutralization studies and phylogenetic relationships
+improving and targeting prevention efforts and planning for health care delivery needs
+GM-CSF signaling
+Buenos Aires
+Compound Topographical Index
+reagents
+adverse health effects and increases the mortality rate
+2 days
+153
+virus establish infection across genital tract or intestinal tissue
+US
+IBD
+The antiviral function of 90K
+1918
+disinfectants
+type I interferon signaling
+weak interactions
+HUVEC and THP-1 cells
+10-fold serial dilutions
+an interaction between GA and BPD
+311
+Respiratory syncytial virus
+fundamentally different
+6 weeks of age
+RNA splicing, transport, turnover and translation
+phylogenetic trees
+transcription factors
+six
+60 %
+Tomato bushy stunt virus
+the specific origin
+K151A/E153L/R157L
+3 days
+IAV
+less than twofold differences in gene copy number
+equal amount of samples had been transferred
+essential considerations
+PubMed Central
+according to clinical judgment
+The number of accessible direct paths from WT to the quadruple mutant
+normality of distribution and equality of variance
+20
+The CTD
+chemical and biological
+R170H
+Histopathologic examination
+midbrain, pons, and medulla oblongata
+p-values
+interference efficacy
+rounded cells in the alveolar corners
+99%
+180 million
+Nine
+requested cumulative ILI reporting
+Mabs 3F4 and 5D6
+cyst area
+Clinical trials
+Listeria monocytogenes
+the maturation or processing of the receptor protein
+purification
+>90%
+adenoviruses
+significantly correlated
+reproducibility of RNA-seq results
+FUT2
+Eleven
+World Health Organisation
+RPI2662
+very few
+residues 69 to 119
+Clinical data, diagnosis, treatment modalities, and blood samples
+E. coli
+influenza surveillance
+twice
+shedding of BoDV-1
+virus titres
+Supernatant harvested 6 dpi
+Tconv and CD8 T cells
+ACEI or ARB use
+Gp160 processing
+proteolytic digestion and proteasomal degradation
+15 to 62%
+London
+39
+help prioritize social media-related psychology research
+Section 2
+F12K
+treatment response
+1.7
+5-10 minutes
+η and η
+any extra dimension that is not offered but self-generated
+dysentery
+FSC-H
+the epithelial layer
+production of early neutralizing antibodies
+10%
+hypergammaglobulinemia
+20 μL
+Simulated temperature
+59 and 39 untranslated regions or genes with a high mutation rate
+Maxwell-Garnett model
+Diagnostic testing
+Lack of wobble uridine modification
+opioid-neutralizing antibodies
+73%
+a better picture of local dynamics
+bilateral alveolar infiltrates and bilateral pleural effusion
+97.37%
+10%
+ISGs
+immunofluorescence and reverse transcriptase polymerase chain reaction
+NS5B
+steric pressure among crowded disordered domains
+ρ
+Acanthocheilonema spirocauda
+Astroviridae
+Respiratory syncytial virus
+formulation
+attenuates the virus in vitro and in vivo
+virus production
+framing theory
+liver
+it does not formally require different data streams to be independent
+p53
+Over half
+mass-spectrometry and RNA-seq
+Five to six percent
+two
+17
+lncRNAs
+irreversible metabolic damages
+Cases in which death occurred before ESKD incidence
+TNBC
+eight
+antiviral and immune-modulatory
+Italy
+Poisson regression models
+inhibitory
+AppDapxIDapxIIC
+2 ml of DpnI
+S25
+CNN
+mutations in NA
+5 minutes
+full protection from infection
+three
+NGAL and ROS levels
+V. cholerae
+CD8 + T cell expansions
+Two-percent
+neutrophil apoptosis
+Metabolic labelling
+28%
+granulocyte colony-stimulating factor
+IgA
+infection of subsequent rounds
+SIVcpz
+primary human hepatocytes
+Two-way ANOVA
+15
+inhibits ferroptosis
+>70%
+ultraviolet B
+Dinucleotide frequency analysis
+SNPs in LD
+cystatin C
+specific structures, processes and/or components of the brain and nervous system
+tick-borne encephalitis virus
+Surface plasmon resonance
+keyword searching
+they are not targeted at household transmission
+Severe sepsis and septic shock
+4%
+Western blot analyses
+The supernatant
+azide-fluorochrome
+four
+48 h
+intramuscular immunization
+high diapause rate
+NT$1792
+1960
+gene expression changes during specific phases of epileptogenesis
+Cholic acid
+HIV-1 specific primers
+iodine
+CD147
+splice correcting agents
+daily
+GFP + cells
+13
+11,315
+Homologies with well characterized sequences
+Trehalose
+8 days
+52
+53%
+lipid modification
+in vitro replication assay and in vivo plaque assay
+25
+JEV
+genes
+analytical techniques
+Rising temperatures and changing rainfall patterns
+FeLV
+Lv3
+previously reported data
+Nikon type A immersion oil
+ondansetron
+antiosteosarcoma effect
+thirty-one
+Lee Foshay
+towards the 59 boundary of the TURBS
+extrapolation from model membranes
+Rabbit anti-HBZ serum
+autophagy
+chloride channel 1
+host cell receptors
+Small differences in distance
+VSV-based
+MCMV Smith strain
+ampicillin/sulbactam
+repeat laboratory testing
+permeability
+Hand Washing Method
+intention stability
+cGAS activity
+NIBSC
+Economic development
+Hyperuricemia
+substitution rates
+proinflammatory cytokine secretion
+NEBNext Poly mRNA Magnetic Isolation Module
+CCR4-specific
+endosomal escape
+65%
+R 0
+scaffold, solution, and gas
+rVSV vectors
+ARV
+HIV, HCV and HSV
+IC 50
+play a key role in regulating inflammatory processes
+particle infectivity
+filoviruses
+newly developed technologies to excite or detect emission
+peak height
+0.926
+three
+Immunofluorescence
+soluble CD4
+catalyst
+activated NK cells
+aseptic collection
+71.34 percentage points
+one
+acute respiratory failure
+robust pro-inflammatory responses
+DRMs
+P. aeruginosa and Burkholderia cepacian
+24
+NucleoSpin RNA II
+between the 25 th of June and the 4 th of July
+moral enhancement
+fluorescence spectroscopy and RT-PCR
+19.6%
+ρ 0
+EVD transmission
+outbreaks of HFMD
+localization and orientation
+17%
+IAV NP
+viral gene sequencing
+prME-opt gene
+nosocomial and imported infections
+PBC and self-efficacy
+rule of five
+ATP bioluminescence
+polycarvenoside A
+PP2C
+10% higher
+10.4cm
+575
+oxidative stress, inflammation and autophagy
+targets
+implicit content
+interesting
+48 hr
+cytotoxicity test
+hematology, clinical chemistry, urine analysis and parasitology
+nickel
+CD8 + T cell responses
+improved protective efficacy
+Bio-Rad Life Sciences
+1 h
+2 million
+Fujian H5N1
+Theiler´s murine encephalomyelitis virus -infection
+degenerate sequences
+reduced +1 frameshifting at the CAG codon
+HSPGs
+227
+personal risk
+alpha-toxin
+cluster size and locations
+Gln-89
+0 to 10
+≈4.1 million
+Functional analysis of this genomic region in non-human primates
+Iridoviridae family members
+Magnetic nanoparticles
+three million
+bone marrow
+metabolic byproducts of intestinal bacteria
+RAxML Blackbox webserver and MrBayes 3.1
+SEM
+410-08
+20
+almost 300
+clinical signs index
+bacterial NA
+Student-Newman-Keuls test
+PMN apoptosis
+Potato virus X
+surveillance and epidemiological investigation
+Katherine Richards
+protein adhesion
+DENV infection
+Rac1 and Rho
+two
+A129 mice
+neutrophils
+kidney ACE2
+TBM, bacterial meningitis, and sepsis
+321
+uninfected group and infected group
+1 mg/ml FITCdextran
+non-homologous recombination
+cyclohexaleucine peptide 9
+recognize conserved epitopes in the HA stalk domain
+40
+twice daily
+vital
+Medium-chain acyl-CoA dehydrogenase deficiency
+hepatoprotective
+2001
+QIAquick Purification Kit
+geNorm and deltaCt
+The role of VPg in RNA packaging
+Kinases activated in response to infection
+interval I
+a receptor-destroying enzyme treatment step
+11,552
+RSV F glycoprotein
+very similar viral growth
+30
+200
+C
+3,791
+plum-colored
+γδ T cells
+1 week
+Student's t test
+131
+11
+geNorm
+NFkB activation
+acute exacerbations
+.5 fold
+50%
+31.6%
+receptor NTCP binding
+at the level of CFTR inclusion into COPII vesicles
+82.91%
+World Organization for animal health
+p53 for degradation
+immunity and development
+molecular specificity and network modularity
+Plantar fasciitis
+polysaccharide capsule
+up to eight months
+Amiodarone, dronedarone, and verapamil
+2003-2006
+serum amyloid A
+area under the curve
+DDD, DDP, and DPP
+twice weekly
+lower Vt and higher plateau pressures
+Mac2 positive cells
+facilitation or reduction
+long TSS isoforms
+Corbett CAS1200 robotics
+TREM-1
+ρ
+two
+FHA's research office
+short-and medium-term predictions of influenza activity
+cross-reactivity model
+European Early Warning and Response System
+seasonal signal
+Cell type and cell state
+Denmark
+plasmid pMD19-T-TK DNA
+Dr. Boping Zhou
+15
+Ultra-early stage
+326 Å
+63 amino acids
+adapter contamination
+CD8 T cell response
+Robust analytical frameworks
+66,602, 168,964, and 68,863 particles
+error
+R 0 cases
+prior viral sequence knowledge
+Adeno-X Adenoviral System 3
+the need to predict which bacterial species are likely to be relevant
+Japan
+further supply of N proteins
+10%
+respiratory epithelial cells
+RRT
+ORF
+6.9-17.1 weeks
+4 h
+GA combined with matrine
+idarubicin
+90%
+85%
+Istanbul, Turkey
+computational methods
+the mean Cq of all samples of the genes
+6
+device utilization
+higher mobility
+One hundred and ninety-two
+Compassion
+5%
+class II and extended class II regions
+Ni-NTA resin
+SIR model
+RNase A and DNase I
+oil spill and oil-free ocean surface pixels
+the corresponding author
+MSF Belgium volunteers
+L-CR1
+PRJNA318707
+highly oedematous and extensively exudative
+IAV
+16.5%
+society-based risk assessment and direct commitment
+five
+more effective biomarkers
+2 days
+seven
+pro-inflammatory responses of DCs
+K1
+percentage of labelled cells
+more than 890
+LAL assay
+six
+Expression and activation of caspase-11
+multiple regression models
+VZV pneumonia
+early January and late March
+correlation statistics and multivariable regression models
+2010
+26 229
+Polybeads and Protein
+n
+15
+70%
+viral RNA accumulation
+Atg8
+5.1 per day
+peak MDA and peak lactate levels
+2008
+FAK
+GlcNAc
+quasispecies
+alternative
+cold Triton-X 100
+ribosomes in the cytoplasm
+github. com/jemmageoghegan
+A3G incorporation into virions
+no emission to communal surfaces
+Real-time PCR
+Microsoft Excel or GraphPad Prism
+VP2 protein
+antibiotic
+PCBP2
+dehydratation, hypoactivity and marked liquid feces
+direct cell-to-cell spread
+72.76%
+1392
+Super-oxide dismutase-1
+June 2019
+80%
+2
+labour-intensive
+western blotting
+decreased infectious virus release
+IgM antibodies
+translation inhibition and concomitant SG formation
+Pipetting speed
+four
+6765 g/dL
+patterns
+90.2%
+primers
+increase in circulating half-life
+acute EBOV infections
+Acinetobacter baumannii
+larger variability and less curve fitting
+viruses and host nodes dichotomy
+more resistant
+any inference on both network and infectious disease models
+the serial interval
+marginal
+Handwashing
+Pandemic management strategies
+distilled water
+influenza
+GAD65
+ApoE fragments
+purification of the virions
+JAGS code
+Figure 1B and C
+Riyadh Regional Laboratory
+16
+8
+pneumonia prevention
+15%
+lavage samples
+translation inhibition
+Demeler's algorithm may not give correct results
+drug discovery of anti-inflammatory and antiviral agents against influenza
+hCT
+CPXV
+Spectral counts
+mucosal blood flow
+an epidemic
+anti-HCV activity
+101
+prevention
+confocal
+Worry and Susceptibility
+VE-cadherin
+downsides
+host susceptibility and virulence of influenza strains
+15,029
+À14.1
+208
+H7N9
+abnormally high phosphorylation state
+20.0 %
+54
+unique ear tag identifiers
+negatively regulates neuron formation
+D7 from enrollment
+2.9 deaths/10 000 population
+vaccines and antiviral agents
+Seasonal influenza vaccination
+137
+demyelination
+0.62
+nucleolus
+frameshifting efficiency
+potassium influx
+KOBAS 2.0 software
+Acute pulmonary responses
+2020
+to monitor the duration of asymptomatic shedding
+381
+a double strand RNA binding protein
+Intracellular delta antigen
+π ij
+Guangxi and Guizhou Provinces
+clinical correlations between defensin abundance and viral transmission or disease
+SeV copy-back DVGs
+quantitatively different gene expression responses
+15 min
+93
+insulin receptor substrates
+60%
+RPL11 and RPL5
+NR1H3
+collectins
+codon distributions
+7 reads per base
+universal transport medium
+mixed effects model
+alterations in the receptor binding
+clinically relevant conditions
+83% mortality
+glucose oxidase
+mutagenic
+Phase I/II
+double stranded DNA or singlestranded DNA
+TNFa, IL-1b and IFN-b
+2 kb
+repeated sampling
+lack of adequate information on lung geometry during growth
+siRNAs targeting VDAC3
+Saudi Arabia
+May 2016
+0.05
+Epitopes
+Ginsenoside Rb1
+Henry Grosjean
+EBV
+NF-кB
+2,000
+kD
+ABS 2 and 3
+no quality costs
+inhalational anthrax
+a very different mechanism
+55.3%
+The formation of contact between astrocytes and neural synapses
+Perkinsus SL RNAs
+breeding failure
+reliability of data collected
+one
+Mann-Whitney U-test
+parenchymal area
+Use of summary statistics
+M4 Parameter a
+Four
+bacterial co-infection
+ELISpot reader
+Western blot
+maturation
+P-site tRNA
+PF573228
+Illumina CASAVA pipeline
+Bayluscide
+alters the permeability
+Purified native rACE2 1-740
+qualitative estimates
+17
+matrix metalloproteinase-3
+Four
+PR8-mCherry
+BER
+RVA
+decrease the rate of endosomal release of PMO
+malaria, tuberculosis and HIV
+3-4 days
+May 18
+Antimicrobial resistance
+25
+α5-and β1-integrin degradation
+over 300 GB
+CC 50
+17
+Awake ECMO
+increased TIP production
+57.4
+personal information
+10.6%
+one month
+no longer expressed TcdC
+250 ms
+18%
+B2
+cytotoxicity
+specific venues and other sub-populations
+BMV RNA replication
+Figure 2
+Real-time PCR
+LAMP reactions
+effective sample size
+Over 80%
+62
+11,325
+positive signaling
+GDC
+Genes, automation and brickdust
+Presence of bone marrow hemophagocytosis
+214
+The advent of antiretroviral therapies
+Exposure impacts and their consequences
+humans
+GraphPad Prism
+Forty-nine
+80/40 mm Hg
+24 h
+enhanced responses to LPS
+cytokine "death" receptors
+cyclic dinucleotides
+RMassScreening
+36
+Purposive sampling
+biological
+IL-17A/F
+9 years old
+few
+T-cell exhaustion
+charge-charge interaction
+New technologies
+a new framework
+Renilla luciferase
+DCs
+viruses
+98.2%
+gRNA
+44
+assembles
+longer length of stay and prolonged ventilatory support
+Computational and bioinformatics
+566
+GCF 000001405.26 GRCh38
+mildly reactive
+a method that predicts only pseudoknots
+20 min
+Boltzmann constant
+postmortem immersion
+H5N1
+Virus titers
+six
+Axenfeld-Rieger syndrome
+significant correlations
+Σn
+Pharyngitis
+.
+340
+hsa04912
+E. faecium
+type II
+80%
+species-specific
+balancing invasiveness against the potential for obtaining adequate and sufficient tissue for diagnosis
+The size of the transmission bottleneck
+18
+Eritoran
+Ripley's L function
+disease phase-dependent
+hepatic lesions and concurrent areas of leukocyte infiltration
+K154E
+>80%
+Table S1
+Generalized Born solvation model
+HMW neddylated proteins
+84%
+maintaining the chain of infection as the pathogen spreads
+6620
+10
+1280
+virus binding to target cells
+2006
+Probiotics and prebiotics
+5 min
+neither mfold 1 nor mfold 2 represent the sole active confirmation
+Increased production of IFN-gamma
+ASP-trained clinical pharmacists and medical microbiologists
+artificial Beijing
+reduced
+persistent infection with pancreatropic enteroviruses
+4 Å
+preventing/ reducing lung injury
+Liberia
+binding to the IFN promoter
+CRT-mediated PrCR
+BSL2
+3,153
+ade4
+Multivariate analysis
+one metal binding site per SsTroA monomer
+Georgia
+fluorescence microscopy and indirect immunofluorescence assay
+11
+S rib
+Evolution
+3
+raising awareness and education
+stalk-specific antibodies
+14
+E1 protein
+serine
+Corticosteroids
+conformational epitopes
+Poisson Inverse-Gaussian regression model
+The samples collected without the exhaled breath from human subjects
+treatment for a bacterial pneumonia
+$10
+Apdm09
+cholesterol, sphingomyelin, ceramide, and PS
+RNA binding, PB2 binding, oligomerization and NLS
+47%
+retention of antigen expression
+NFKB1a, IKBKB
+7%
+Bethyl Laboratories
+> 95%
+fuzziness within the fingerprints
+HVR1
+gymnosis
+hypocoagulable profiles
+Analysis and interpretation of data
+Questions or messages regarding errors
+life span
+53%
+higher
+decrease
+31 months
+Genepix 6
+emphysema and osteoporosis
+host factors
+Leptospira
+cases that cannot be confirmed
+NLRP3 inflammasome
+NetCTLv1.2
+>95%
+The GP spike
+Lowry assay
+binds to HRV capsids
+2010
+5 min
+erroneous scienti fi c conclusions
+young children, impaired older adults or patients with underlying airway disease
+structural
+seven
+10 µL
+six
+virus-like particles
+IL-6
+166
+Nucleic acid
+PA replication
+pipo-site deletions
+January 15, 2020
+particular clinical features and severe illness
+clinical symptoms, history of potential exposure, and serologic studies
+Variable Wavelength Detector
+spectrophotometry
+admission route, severity, and infection site
+AaWRKY1
+a genuine GI disease outbreak
+expression intensity
+34.5 ms
+released-active
+to maintain themselves within populations
+IL-6
+cell lysates
+key cytokine
+replication-dependent Luc expression
+any estimate of peak
+Ampure beads
+27.5%
+serological classification
+VEGFA
+four
+more cases
+watershed transform algorithm
+a subset S
+Smo-Gli-1 signaling
+denaturing PAGE
+apoptotic cells
+30 min
+all neonates with intravenous catheters in DON
+32
+mycetoma
+Six to eight days
+fluorescence
+Ixodes
+25-75 nM
+male
+PNGase
+12
+contact between infected and susceptible populations
+15 min
+ER-Golgi
+TNF
+gender, age, and socioeconomic status
+type II pneumocytes
+TM homo-oligomer formation
+foreign travel
+direct evidence
+X k
+QuantiTect Probe RT-PCR Kit
+Axl receptor tyrosine kinase
+Professor Y. Bu
+all-year round vehicle washing
+apoptotic cell population
+minor
+Lack of management and conflicts within the team
+2-5A
+validated laboratory methods
+H5
+1 h
+High-frequency oscillatory ventilation
+quasispecies
+testing healthy animals
+negative
+phylodynamic model
+0.1 mg/ml
+confocal microscope
+655,000
+Bird droppings
+syndromic surveillance
+monocytes
+the tools' overall performance
+rhesus monkeys
+1.6
+zebrafish
+SARS
+comorbidity
+Forty
+Chinese scholarly journals
+interest
+immunoblot analysis
+five
+D-dimer
+neocortex and hippocampus
+three
+humans' alteration of the planet
+virological clearance or clinical outcome
+D SA
+clinod
+stakeholders
+10 mm
+1.85
+unbound virus
+PRRSV
+subsampling error
+correlation tendency
+Massachusetts
+MyD88 and IRAK1
+tracheal swab samples
+agent-based model
+Influenza vaccination
+academic performance by subject areas
+rs4430796
+gene fusion
+mixing up with each other
+cryoEM
+10 2 copies/reaction
+Circulating tumour cells
+rat anti-mouse CD16/CD32 monoclonal antibody
+n-BuLi
+The area of accessible diversified surface
+a core committee
+The loop composition
+TGF-β
+cellular ROS and cardiotonic steroids
+TPV of 0.860
+Apoptosis
+11
+the larger amino acid sequence
+Triterpenic
+emerging infectious diseases and public health threats
+disease pathology
+SSP
+recovering the relevant codes from the text
+phosphate centres
+RNeasy mini kit
+17.2 g/m 3
+GBS
+HSF3
+membrane fusion
+Cell surface cAMP receptors
+mosquito-borne
+20%
+post-capillary venules
+Hedgehog
+92%
+IL-12
+the presence of a wildtype spo0F allele
+CldU labeling of restarted forks
+Further studies
+spectrophotometer
+197.7 days
+adenoviral genome
+neuronal
+real time RT-PCR
+65 Caspase activity
+1%
+HIV-1 Transmission Dynamics
+23 days
+40
+advance knowledge of the behaviour of b t along the whole course of the epidemic
+4 1C
+SpiB
+puromycin-resistance
+4% paraformaldehyde
+public health recommendations
+significant relationships between microbial taxa and clinical outcome
+HBsAg protein
+SCORTEN
+Selenium
+serum amyloid A and haptoglobin
+20% piperidine
+52
+horizontally transmitting respiratory and enteric viruses
+over 1300
+diverse essential physiological pathways
+Transfection efficiencies
+≈0.43
+CD3
+outer and inner nuclear membranes
+over-the-counter
+Blood samples
+benztropine
+55
+The horizontal axis
+Average signal probe intensities
+adequate
+The structure of contact networks
+The mapping process
+The largest within-cluster SD
+TNT-mediated
+Expertise and motivation
+DURC
+Identification of drug-target interactions
+Differential degradation ρ > 1
+Software Vector NTI
+E MM
+simple random, systematic or stratified sampling methods
+Inverse probability of treatment weighting
+caspase-independent
+double-loop learning
+key residues
+knowledge of dominant organisms
+body weight and BP
+3 mM of MPA
+recombinant or recombinantlike
+F-measure
+60S ribosomal
+cell proliferation
+HLA promiscuity level
+over 65
+AIDS
+trachea and lung transcriptomes
+0.5 µM:0.1 µM
+FRET-based probe
+geriatrics
+plaque assay or a 50% tissue culture infective dose assay
+none
+bridging interactions
+12.36%
+cancer
+intra-arterial injection of S. aureus
+oxygen
+specific cell-mediated immunity
+most of group B taxa are earlier viruses
+a polymorphic site
+JLV
+177
+Astroviridae Study Group
+every four months
+10 nM
+weekly
+1.04-1.27
+recent
+MIDGE vectors
+fossil life
+matrix protein M1
+Taeniidae and, Sarcocystis spp.
+fungistatic effect of IASOS
+December through April
+transparency
+risk factors
+HIV/AIDS
+Eight
+graph invariants
+vomiting, fever, and diarrhea
+heroism
+Suicide by jumping
+13
+disappearance of all target lesions
+spleen and lymph nodes
+problems of very different character
+infectious lifespan
+Fmoc-L-azido-ornithine
+further optimization
+macrophages
+Merianieae species
+Plantar fascia
+-α and IL-1β
+5
+0.2% porcine gelatine
+5%
+40 min
+diversity
+Mafft-einsi
+human-adaptation
+KP t,m
+IFNL4
+steps 3 and 4
+1918
+ampicillin
+terms at low order in the normal form transform
+interferon-stimulated gene factor 3
+IB-RA and SB-RA
+5%
+aberrant TAAR1 regulation and function
+18
+93%
+specimens are sent to distant reference laboratories
+CSPG induced axonal dieback and degeneration
+30 µL of CellTiter-Glo®
+disease onset date
+Figure 2
+16 h
+Escherichia coli multidomain protein SufI
+1.4 times
+USPIO
+The primary sequence of the RNAs
+Mass and Conn
+overexpression of IL-1β
+NKG2D-mediated
+Representatives from the Funder and Sponsor
+increased considerably
+5%
+three
+ethanol-induced loss in oxidative phosphorylation system proteins
+Ang 1-7
+Tissues
+ER stress
+Malaysia
+0.9-2.1
+probabilistic model
+OPD
+TMAG
+genes upregulated by IL-4
+antigen-presenting
+The probability of emergence
+Estimates
+Further studies
+Dengue
+-80°C
+severe
+3-4 days
+a causative action
+virus-induced secondary bacterial infection
+Purified NB
+5,500 nt
+the raw p-value
+preclinical
+knives
+6 days
+steroids
+91%
+six
+PSI-938
+neuronal population and morphology remained largely unaffected
+HI titers
+monoclonal microbead
+parameter combinations for which the vaccine is self-extinguishing
+μM
+the host
+IL-6, TNF-α and COX2
+RPiRLS
+1,482
+mechanistic
+2009
+Single crystal X-ray diffraction data
+travel to China
+generation of cross reactive antibodies
+perceived personal probability of becoming infected while using public transportation
+primary or adjunctive herbal treatment
+VAP
+Data mining techniques
+Viral DNA
+Type I
+0.01
+78
+2955
+Nixon and Giedroc
+Basic clinical
+years of age
+1000
+LvATF4
+2
+the gene TSS
+naturally between two successive indices
+RNA viruses
+catalytic, immunomodulatory and antitumor properties
+NF-κB-SEAP expression
+a sub-network
+MN401425-MN401446
+three
+eight
+Phylogenies
+no difference between LAIV and inactivated influenza vaccine
+mutational pressure and translational selection
+1 hour
+negate the need for a pretreatment step
+GL receptor
+3.38%
+conserved viral proteins
+low CVP
+Anti-CHIKV polyclonal rabbit
+More than 10 %
+one-way ANOVA
+94 million
+three times to that
+10
+physiologic levels
+October 2007-March 2008
+the maximum concentration
+further transformation of VSMCs
+higher viral titers
+Internet-based
+High-Pure Viral Nucleic Acid KitR
+December 31, 2014
+4.3
+APOC1
+4.8 µL
+survive with bias over other individuals
+-hydroxyl
+sharp discharges from the frontotemporal area
+paracellular cation permeability
+10%
+chronic low-grade inflammatory disease
+Gbp2, Gbp5, and Gbp7 mRNA
+vitamin D
+Dixon method
+minor to more serious
+24 weeks
+cholera
+oligosaccharide deacetylation
+electrographic status epilepticus
+16
+Image-Pro Plus 6.0 software
+a general marker of infection
+ZDOCK
+UV
+Fibrin
+decrease
+replication
+three
+eight
+cryptochromes
+getting infected
+a distinct feature
+PvPep95 and PvPep96.03
+Over 10
+decreased NK cell frequencies/function and serum IL-12 levels
+3100
+Log ACE2 activity
+their importance
+case-based rapid risk assessment
+Living Image 4.0
+3= proximal
+Pneumonia
+codon-anticodon interaction
+increases
+5 to 20 mg of total RNA from uninfected control and infected samples
+purple formazan crystals
+Avian diseases
+IL-1Ra production
+hyperthermic temperatures
+finding possible functional targeting strategies to control inflammation in patients who are susceptible to infections
+Carole Baskin
+tail-hair samples
+interferon signaling
+new pathogenic and zoonotic bornavirus species
+90%
+acute exacerbations of chronic airway inflammatory diseases
+MS
+adenovirus-induced changes on nucleolar composition
+numerator/denominator bias
+chronic obstruction of airway flow
+Policy briefs and presentations at national meetings
+B t
+1 µl of each cDNA
+C.zeylanoides
+Co-infection with porcine parvovirus
+70%
+Prediction tools or 3D-structural analyses
+enzymatic protection
+two
+high production and inventory costs
+oxidant stress-dependent
+2 days
+12
+Saxony and New Brandenburg
+#pragma omp parallel
+lung length
+Brighton Red
+DC-SIGN
+limits
+Mycoplasma pneumoniae
+western blot analysis
+latent infection period
+3.5 mm
+five
+Qinghailike viruses
+110,465
+1:2
+9.1
+The distance of joints in the 3D world
+UNC93B1
+RLuc
+Pain
+VLP vaccines
+ssRNA association
+Continuous variables with normal distribution
+if non-severe illness is more common than detected
+degraded
+their ability to identify adequately and exactly the individuals to be targeted by a programme
+Vary Insulin protocols
+Nucleospin RNA Plus Kit
+oxidative stress
+~50%
+twice
+higher P max
+80%
+42%
+gallic acid
+outcome
+generalization capability
+① to ⑬
+Ambros et al.
+20% polyacrylamide, 7 M urea gel
+50 and 100 nM of TFO1
+phylogeographic substitution model
+negative costimulatory
+mock controls
+influenza A
+genetic and environmental factors
+R g
+C2-G18 base pair
+activity in vivo
+median and interquartile range
+biodegradable PLGA microspheres
+non-specific NP interactions
+IFNAR2 and IFNGR2
+glycyrrhizic acid monoammonium salt
+Comprehensive Antibody Vaccine Immune Monitoring Consortium
+Nikon Eclipse TE2000-U fluorescence microscope
+10 years
+kennel cough
+Cardinal and Cadenza
+Two
+Streptococcus pneumoniae
+PARF
+9
+Restricted classes of pseudoknots
+Next-generation sequencing analysis of a variety of gene panels
+user-friendly
+T reg s
+PCV2 and some of the avian circoviruses
+Combining debulking surgery with radiotherapy
+SNF7
+neonatal infection
+CD163
+IBV
+a single large wave
+elevation of in-circuit pressure
+cellular targets
+viral RNA
+0.3 × 10 6 cells/mL
+P-values below 0.05
+200
+adhesion proteins
+virus-induced encephalitis
+oxidative burst activity
+drugs
+Avian influenza
+A549, 16HBE, and HEK-293
+Nanobodies
+51%
+ML29 down-regulation of IFI44
+metabolites
+YFV-17D infection
+Rolling window size
+separately
+CNPase
+Hepatitis C
+humoral immune response
+excessive apoptotic alterations
+atrial signal detection and analysis
+counterimmunoelectrophoresis
+Mice
+Significant nucleic acid sequence variation
+Zetasizer
+W
+31 to 42%
+elongated structures
+30,088
+significant moderated effect on the mediation relationship
+HCV
+Dr. D. Corti
+plant genomic DNA kit
+publication of this article
+5 μg/ml
+Taylor-linearized
+ABI 7300 SDS software v.1.3
+anti-inflammatory cytokines
+2003
+76
+virulent
+294G
+14
+complementation
+generation of alveolar epithelial cells
+systemic inflammatory response
+Atelidae
+length time-effect bias
+The interferon system
+−80 • C
+γ δ T cells
+terminal regions
+26%
+fluorochrome-conjugated mAbs
+ASP
+1978
+15%
+paraspeckles
+23
+24.0%
+syber green master mix
+Histological scores
+14.3%
+RVA
+Traditional Chinese conservatism
+Antibody-mediated neutralization
+20%-50%
+1257
+corrected p
+pH1N1
+Network metrics
+cell-surface expression
+2.1
+CD3 + T cells
+DOCK3.7
+cloacal and oropharyngeal
+three
+Kaplan-Meier curves
+IL-1β or IL-6
+population health
+platelet counts under 150,000/μL
+two
+48%
+regulatory sequences or regulatory factor binding sites
+immune
+100 ml ATBS substrate
+four
+Ly49H-mediated NK cell activation
+monthly
+field epidemiological studies or clinical studies
+V9 and LOB7
+6
+inducing inflammation around blood vessels and rupturing atherosclerotic plaques
+1976
+conventional parenteral immunization
+quarantine
+Saudi Arabia
+KKL
+one-way ANOVA
+obstetricians and gynecologists and public health physicians
+mutagenicity and carcinogenicity of a compound
+A. baumannii and P. aeruginosa
+a homotetramer
+tandem multiplex PCR
+an exacerbation event
+presence of consensus amino acid residues substituted during conservancy analysis
+22.52 ± 0.18 µM
+PCR products
+Results
+quantitative structure-toxicity
+how often individuals recognize a given peptide from a pathogen
+primary translation of input viral RNA
+483
+À1 RF
+neurobiological
+PLY and caspase-1
+.10 TCID 50
+an injection site
+ClpP and FtsH
+1-2%
+reverse transcription polymerase chain reaction
+drying and staining
+anti-P2RY12
+.90%
+relative fitness
+autophagy induction
+indoleamine 2,3-dioxygenase
+Survival to 28 days
+regulatory network sparsity
+Obesity
+estimated vector density
+Thirteen
+age, race and geographic localization
+four times daily
+CXCL10
+number of peptides sampled per randomization
+internally consistent and distinct from existing relevant measures
+NCBI GenBank database
+6-10
+five
+novel gene responses against influenza in the future
+1%
+regular expression based matching
+18.5 months
+38
+4.8%
+ImageJ64
+liver
+targeted quarantine/vaccination
+Supplemental Table 1
+4176
+over 50 proteins
+UCKL1
+LMP2A
+Parent-Teacher Association
+DEP techniques
+MHC class II
+carnitine palmitoil transferase 1
+EF-2 function
+charge repulsion from the anionic dextran-sulfate
+Anti-drug education
+Three
+Virus stocks
+neighbourhood hybridization intensity profile analysis and nucleotide substitution bias analysis
+protects mice against ZIKV infection
+SVQYHPLA
+Quality indicators
+RANDOX
+585
+nuclear calcium signals
+280˚C
+University of Florida
+alveolo-arterial oxygen gradient
+diamidines
+via the IM or IN route
+ubiquitin-dependent proteasome degradation
+Mersenne Twister
+IL-13, IL-10 and IL-17A mRNA relative levels
+linear regression or multiple linear regression
+secondary attack rates
+75%
+1121
+tetherin
+2009
+infection status and presence of viral RNA
+six
+analysis of transcriptomes of non-model species
+The ompA::tn mutant lacked full-length OmpA
+0.203 ± 0.112
+cytokines
+1.30
+The multifunctional factor NS5
+macropinocytosis
+HIV-1 viral titers and replication
+Bayesian hierarchical modelling framework
+IFN-I signaling
+supernatants
+the standard deviation of the mean
+soluble receptors
+microfluidic
+3 and 2
+LC3-II
+non-painful chronic pancreatitis
+three
+2009-2010
+codon usage bias
+three
+Data obtained from the experiments
+University of Ottawa
+benztropine
+743
+Manton and Stallard
+the correct fragment length
+entropy and relative entropy
+direct
+inspiration synchronized VMN
+fusion
+Spectral analysis
+negligible
+statistical significance
+39
+pre-transmission interval
+vr3
+respiratory and renal
+white blood cell count, PCV, hemoglobin concentration, and RBC
+viral replication
+essential
+Type VII
+Each result
+damage
+two
+Toll-like receptor 9 agonists
+O 2 and H 2 O 2
+PRRSV infectivity
+EpiInfo7
+the virus
+c n ∼ 0.2
+PD-L1
+compositional constraints
+autophagy elongation complex proteins
+vaccinia
+US$2500
+fifteen
+81.8%
+66%
+mRNA
+Trypsin
+HIV RT
+Malaysia
+ipg
+15%
+hemagglutinin
+MRM analysis
+six
+APOBEC3 proteins
+four
+Influenza NA
+loss of stem-cell maintenance
+accuracy and sharpness
+higher NC uptake
+Interactions with probability above an upper threshold
+the m36 epitope
+30 days
+mononuclear cell
+antiretroviral therapy
+control efforts that superimpose on any climate effects
+symptoms or diagnoses of patients from ED and/or physician office visits
+the position of the first residue from the peptide mapped onto the protein sequence
+over 2314 exabytes
+three
+diffuse alveolar damage
+regional circulating strains
+translation initiation and polypeptide chain elongation
+viral RNA transcription
+drug concentrations
+Severe hemodilutional anemia
+follicle cell type
+PPARα and PPARγ
+five random fields per well
+18S and 28S
+elevation of in-circuit pressure
+weekly
+siRNA duplexes
+Ace-2
+100 mM of amiloride
+binds to HMGB1 and inactivates its biological activities
+quantity of interest
+catalyst 1 and trimethoxybenzene in C6D6
+poor prognosis
+CD8 T RM cells
+initiating
+0.1%
+cytokines
+MS Excel software
+efficient VLP release
+population-based national data
+conventional entropic measures
+memory demands
+PanAd3-NPM1
+COX-2 and VEGF
+Two
+four
+cytoplasmic
+rapid
+weekend
+MA
+mRNA 2° structures
+disease selfmanagement of a patient
+membranous web regions / DMVs
+Western blot analysis
+SSEA-1
+48 hpi
+euarchontoglires
+P70S
+nuclear localization of B1
+45
+procedures
+skipping of one or more exons
+Circadian disruptions
+pVSVΔG-CCHFV-GPC
+R 0
+Modulation of MCP-1 levels
+C2 endo
+lack of clinical sign data
+immediate high sensitivity POC molecular diagnostic testing
+paraffin
+gradient elutions
+35% to 70%
+clinical
+PIMs activation
+histopathological
+17 h
+the highest attainable standard of health
+O. ostertagi nASP
+RNA ADP-ribosylation
+IRAS protein
+sero-neutralization and protection assays
+BACE-1
+lepidopterans
+a 30 gauge needle
+Ambient particulate matter
+malignant tumors with an aggressive behavior
+diversification of parasites and potentially speciation
+alters nuclear transport pathways
+PCNA, BMP2, and IL-6
+concentrators
+EBV and CpG
+their respective data
+48
+51
+IL-15
+similar results
+Universality
+twenty-four
+PottersWheel Toolbox
+320,448
+univariate boxplots and cumulative distribution function plots
+interleukin 4, IL-5, and IL-13
+C2
+1022
+blocking of sea or land transport
+HIV transmission
+spherical
+13
+livers 1 to 6
+myeloid
+vaccination
+Sepsis
+7.4
+20 mm
+initiate antimicrobial responses
+close agreement between the KDE and actual spatial probability
+non-neutralizing
+intraocular route
+independence
+Eight
+H1N1-related search queries
+latex
+viral promoter
+S > 0
+induce the removal of infected cells before progeny virus budding and spread
+protection from disease
+a series of receptors and their associated signaling molecules
+6 months
+A unique infrastructure and search strategy system
+PLANET
+bioinformatics
+Cost and complexity
+gradient descent
+CHEMGRID
+ompB STOP ::tn bacteria
+28%
+Nuclear factor-kB
+AZD9668
+95% ethanol
+Assays
+the window with lowest -LogP value
+Soap align 2.21
+mammal specific IgG antibodies
+Phenformin
+Hantaan virus
+fluorescent
+A single early switch point
+1 to 5 days
+16 hours
+English
+LipidTOX green stain
+4 weeks
+participating in everyday activities
+damp out in time
+spo0A
+lower
+ribosomal machinery
+0.44 to 0.56
+Synergy 2 microplate luminometer
+evaluating the quality of observation studies
+Type II
+CCL3L1
+2,500 to 4,000 mm
+eukaryotic cell line
+anti-CD3 monoclonal antibody
+requiring varying degrees of attention, concentration, and effort
+The supernatant
+Normal
+Microglial processes
+Between 23 and 31%
+16 h
+Vero and Vero-derived cell lines
+91%
+lack of SP-D expression
+reverse read-direction ORFs
+Strategic planning and adequate protections
+DNA Lad-der™
+murine leukemia virus
+biologically vital proteins
+Helium-neon
+DNA
+increase in expiratory resistance
+tumor progression
+to conduct large HIV treatment trials
+biomarkers
+IGF-1R
+opposed
+T cells
+E. necator
+protease sensitivity
+4283
+January 2018
+Diffuse alveolar haemorrhage
+177
+sGPEdit+GP 1,2 Edit antiserum
+70%
+60 min
+LacZ
+reliable longitudinal administrative data
+RNA
+virus from the spleen
+antisense oligonucleotides
+370
+GADD34 induction by poly I:C
+Elevated body temperature
+Pattern recognition receptors
+CliRes
+Analyze Dataset
+$50,000
+host Src
+microbial concentration
+different outcomes
+our mid-term strategic decisions
+gene expression similarities estimated by generalized linear regression models
+Hepatitis C Virus
+geographic location and travel
+IFNL4-TT
+second residue
+key orchestrators of the immune response
+protein sequences
+epochal evolution model
+hyaline
+CD8 + T cells
+transparent, fair, replicable and coordinated processes and tools
+tissue injury
+data on genetic diversity and their clinical association among pediatric populations
+3-4 weeks
+novel diagnostic technologies
+tighter CD4 binding
+128
+The blue arrow
+GeneClean Spin Kit
+Standard PCR
+15 min
+ORF50 transcription and virion production
+Viruses
+Nine
+differentially expressed
+their location within the central nervous system
+Central nodes
+seroprotection rate ratio
+Astragali radix
+10 000
+human pathology
+Tandemly arrayed duplicated genes
+TGFB1
+strongly reduced DAI/Zbp1 expression
+quasispecies
+field case tracing
+10%
+24 h
+activated macropinocytic pathway
+low MV
+p53REs
+windows
+MRSA
+infection
+Verbal consent
+Purifying selection
+188.5 pg/mL
+Recording exposure procedures within farms
+MARDS
+4% paraformaldehyde or with methanol:acetone
+Anatoxin A
+glutathione
+VP4 and VP7
+B90%
+10
+dose-response
+worse
+Turnaround
+Global budgeting
+unexpected
+≈1 year
+amplification bias
+vital signs
+445
+Six
+24
+Pro-inflammatory
+WHO
+search circles
+target cell limited model
+99.9%
+proper evaluation of multiple RGs
+42
+electroporation
+HT22
+2.7 days
+Two
+Primer pair P2/P3
+preexisting mental health concerns
+individual variation in infectiousness
+1%
+0.5 µg
+26%
+hexanoic acid
+bad breath and toothbrushing frequency
+basic virus transmissibility
+Tetherin
+bronchial wall thickenings
+NK cells
+genetic drift
+hydrophobicity
+Guava Cell Cycle solution
+microscopic findings
+the capsid protein precursors
+splenocytes
+habitat hotspots
+θ
+Adherent cells
+8
+4°C
+Calbiochem
+5
+mutSL-based
+GENSTYLE
+University of Cambridge
+Tp2-class C9 protein
+genetic determinants of the HDL proteome and lipidome
+1 year
+~50
+cytopathic effect protection assay
+0.015
+A corona wire
+antiviral
+ΔpbrB mutants
+8-12 weeks
+An N c plot
+24 h
+50%
+16-18 million
+NF-κ B, AP-1 and IRF3
+induction and inhibition in the signaling network
+mAb114
+very low doses of protein were needed
+480 bp
+10 μM Picolyl biotin azide
+Germany and Great Britain
+pathogenetic
+fitness
+reduce the shedding of pathogens to wildlife disease vectors or into the environment
+sympathetic outflow
+LBM size and city
+Proteomics and expression profiling
+235
+>10 4 colony-forming units per milliliter
+laboratory data and culture results
+mechanical
+IFN synthesis
+Pruritus UDCA
+cytomegalovirus and herpes simplex virus
+1700
+paired-end information
+subunits
+6,42
+Toll like receptor 3 and TLR7
+the exact structure of 2
+type I immune responses
+loop size and tertiary interactions
+zoonotic
+Summary statistics
+18 days
+more experiments
+miRNA expression profiles
+P value for each comparison o0.0001
+3-35 d
+11
+1 versus 4, and 2 versus 2
+enhanced stability
+DENV-2 infection in the brain
+35
+stochastic center manifold reduction
+Respiratory droplet transmission
+27
+August to November
+43
+Virus Varroosis
+Network entropy
+Total protein
+ML and neighbor-net
+pro-inflammatory
+deep learning
+coagulasenegative Staphylococci
+LC Packings C18 PepMap 100
+by retaining edges present in all the individual graphs
+IL-10
+inhibition
+viral epitopes
+immunofluorescence
+bacterial pathogens
+bistability and hysteresis bifurcation
+bridge hosts
+≥4-fold increase in HI or NI titer
+an edge
+protection and in viral clearance
+50,000
+95%
+recombination and reassortment in RNA viruses
+three
+SK1
+cell-penetrating homing peptides
+E. coli DH10Bac cells
+SAMD9
+Intermittent hemodialysis
+112
+Mab 5D6
+I. scapularis
+epochal evolution model
+saving money and time
+A complex
+right-skewed
+excessive cardiac fibrosis
+microchannel
+the manufacturer
+1 day
+6 to 6.5
+three million
+cumulative operation volumes
+93
+reduce the number of allogeneic RBCs transfused
+a heavily reduced cellular genome
+TRIM25
+traditional medicine
+40 min
+458
+adults hospitalized with influenza with and without pneumonia
+midazolam
+30 %
+Nuclear blebbing
+production of Brucella specific IgG
+catalytic subunits
+Isolate HA16-5
+trypan blue exclusion
+OmpB
+Bats
+SREBP-regulated gene
+all potentially relevant biomarkers
+epigenetic changes
+BB0069
+reporter gene expression
+proteins that accumulate with the viral genomes
+acute haemorrhagic fever
+Berlin
+RNA
+severe lung damage
+real-time reverse-transcription polymerase chain reaction assays
+Poisson likelihood
+2.0%
+AP2s
+PGD2
+SPPV-063
+personal protective devices
+neighbouring countries
+low resolution grids
+proportional to ):
+HOCl-induced modifications
+eight
+Mice
+biosecurity factors
+increased
+Ectomycorrhizal
+40
+Cuba
+Adamantine, rimantadine and alkylated imino sugars
+4
+,3-fold
+failure to target other components of the immune system
+clearing viral infection
+Lys or Arg
+2009
+Ifitm3 -/- mice
+97
+under inverted microscope
+tr-eVLPs
+high rates of contamination
+secretory granule packaging machinery
+rate constant
+docking of the liposomes
+single-stranded spacers
+4%
+muramyl dipeptide
+fresh medium
+Mild exertion
+Long-term follow-up data
+preparations and considerations
+>62 and <188
+repeated measures regression model
+Global budgeting
+HCV E2 construct
+Phylogenetic
+Gammaproteobacteria
+TSG101
+GFP + cells
+individual LCMV replicative RNA species
+protein C system
+lack of tissue-specific developmentally regulated control mechanisms
+BV2 and HEK293T cell lines
+Autophagy
+low codon bias
+papain-like cysteine proteases
+Figure 3
+back-pocket
+SCHU S4
+transplantation
+MHV
+641
+individual strains
+10%
+nucleoprotein genes
+12 h
+5
+ablates the synthesis of the SH and G glycoproteins
+antigenic
+methionine
+shRNA
+Ethical
+enzyme linked immunosorbent assay
+thousands
+12
+2%
+1 μ M thapsigargin
+>28%
+1975
+underexplored
+Microfluidic channels
+Primary ciliary dyskinesia
+important
+One microgram of total RNA
+L-A-encoded proteins
+Eq.
+60%
+bacterial infection
+antioxidant
+protein degradation
+viral nucleic acid
+poliovirus
+C-terminal fusions to the thioredoxin tag
+mass-scale vaccinations
+Serologic testing
+mice
+templates
+2%
+experts
+ADAM17
+tissue culture supernatants
+Biolayout Express 3D
+Time to hypoxaemia resolution
+depression of host cellular immunity
+PCR
+CHIKV RNA and infectious virus levels
+copies
+antigenic mimics of the native parasite protein
+VF development
+lipid rafts
+partial inhibition
+Firmicutes and Bacteriotedes
+TNF-a
+MSDN
+eukaryotic translation elongation factor 1B complex
+724
+27
+recognizes sialic acid on the host surface glycan
+intrinsic enzymatic activity
+Quantification of GAPDH gene
+3.6%
+Novel approaches for rational design in the genomic era
+yellow green
+between 4 to 10 days
+sPLA2
+International Journal of Food Microbiology
+adenovirus and 2009 H1N1
+tenfold cross-validation
+CD55
+intensive care units
+Nidoviralies
+three
+Soluble GP1-Fc
+~30 kDa
+VP3-E76G
+Invitrogen
+Sen-siFAST Probe Lo-ROX One-Step Kit
+R1597W
+homogeneous mixing among individuals
+intrahepatic NK cells
+delayed chain termination
+MAPKs
+Plastic Maxisorb microwells
+9
+overproduction of free radicals
+PCC t
+exportin-5
+SP-D expression
+4 h
+1 g of RNA
+Mitochondria dynamics
+co-inhibitory pathways
+0.58
+Pneumocystis jiroveci pneumonia
+multiple representations of the primary protein sequence
+forward stepwise variable-selection strategy
+multivariate
+Insurance package
+1715
+a glycopeptide antibiotic
+picornaviruses
+decreases
+metagenomic sequencing of urban sewage
+Angiotensin II
+3.7%
+demographic and clinical variables between SARI and ILI patients
+180 min
+EMBOSS transeq
+55
+natural killer cell
+18
+238
+β-actin
+Transport of animals to market
+three
+Mutant R411A
+highest hybridization signal
+by using their specific compound characteristics
+O-antigen
+codon usage pattern
+Three millilitres of blood
+75%
+Bliss independence model
+RIG-I signaling
+favorable conditions for smallpox transmission
+peak levels of sXBP1 transcripts
+21 days
+models for estimating CV risk
+antioxidant
+clustering of related results
+Samples incubated with only the secondary antibodies
+genotypic information
+environmental, occupational, and metabolic risks
+100 μg/mL PA
+UPR
+97%
+Ad early E1A
+26
+H5/H7
+Conidial suspensions of transformants and the G526 strain
+ermC
+anomalous
+Viral RNA extracted from SARS-CoV
+54
+30,000
+B cells and MNV specific antibody
+malnutrition
+Sankoff approach
+mass spectrometry
+epidermal growth factor receptor
+Y613A and Y624A
+The PIC window
+ssc-miR-30d_R-1
+sufficient pathogen reduction and acceptable product quality
+Passive immunization
+polymerase chain reaction
+nine
+reduced inflammatory responses
+its origin
+Primary antibody
+Proteolysis of the particle preparation
+free gp120
+homogeneous
+bio-active specialized plant metabolites
+six
+12
+seven
+18%
+Information about the ventilation system settings and restaurant size
+107,100
+ZIKV-prME
+anticipation effects
+cytotoxicity
+Marshall E. Kadin
+Linear correlation analysis
+β2M and RPS15
+7.09x10 -4 substitutions/site/year
+Conformational flexibility
+dissemination methods
+twice
+0.4 -0.9
+reduced pharmacodynamics of the drug
+cross-referenced the data with the text of each publication
+steroid dose
+pain, fatigue and organ dysfunction
+6
+superscript III
+apoptosis
+10
+Hoechst dye
+winter school vacation
+1649
+genetic background and environmental stress factors
+western blotting
+22
+anti-apoptotic
+nonsticky proteinaceous compounds
+eight
+IBMX
+80%
+2001
+P
+City Health Department
+plasma FAA
+huge
+A flaviviral E protein 4G2 monoclonal antibody
+rural youth violence
+ruminating
+EXPO32
+maximum likelihood method
+Lower respiratory infections
+fast phase
+TBP
+HA
+IL-10-secreting CD8 neg cells
+Confusion, Hubbub, and Order Scale
+Induction of viperin mRNA expression
+M. pneumoniae
+preonset of psychosis
+Hitachi F-3000 spectrofluorometer
+a causative organism
+how evaluations are conceived and conducted
+2%
+Major histocompatibility complex I restricted cytotoxic T lymphocytes
+Depletion of ULK1/2
+14 dpc
+Seventeen
+transformation with adenovirus
+disease
+681
+effective mucociliary clearance
+alternative formulations of the underlying optimization problem
+CD62L
+increased fluorescence signal
+humoral
+29.3%
+viral clearance
+HTNV antigen levels and RNA loads
+modular assays attached to smartphones
+30% ± 14.93%
+1513
+H3K79 methylation
+clinical drug development platforms
+mES/ MCDB201
+collagen production
+The PrP genotype
+CEACAM18
+MHC class I peptide presentation
+Energy minimization
+IFNAR −/− A129 immunodeficient mice
+alignment-free methodology
+4
+60 ± 5%
+Receiver operating characteristic curves
+46%
+Microorganism infection and tissue injuries
+IgY-VLP solutions
+Vietnam
+spliceosomes
+egret, heron and pond heron species
+six
+anti-FLAG and antihuman Fc
+The founding sponsors
+Undifferentiated epithelial cell culture model
+copy number differences
+470
+10 µM
+small study effects
+two
+Helios protein and neuropilin-1
+predictive mode
+confocal
+sequence data
+efficient
+changes in overall physiology
+infection
+formic acid
+$60%
+HIV1 Nef protein
+glycoprotein degradation
+protein
+obesity, steatosis, and type 2 diabetes
+24
+isolation and contact tracing
+cholesterol
+72 hours
+aminopeptidase M
+around three weeks post-infection
+15 ml of RT buffer containing RNasin inhibitor and cycloheximide
+twice per day
+inflammatory
+R 0 and R t
+Low-dose SC
+FRET state of ∼0.3
+bootstrap confidence intervals
+improve cell viability
+GISs
+citrate buffer
+independently encapsidated separate segments
+oligonucleotides
+time series
+pneumococcus and viral pathogens
+CTF + CGR
+MEV NS1 mRNA coding region
+78%
+lectins
+Gln288
+α-catenin
+fever, fatigue, dry cough, sore throat and headache
+2398
+gene segments
+DEN-4
+immobilization control
+basic
+Powered airpurifying respirators
+neutrophil biomarkers
+62
+pathogen's dynamics
+iron colorimetric assay kit
+nanogels
+Five
+DAKO Liquid DAB Substrate Chromogen System
+A better understanding of the disease pathology
+NaN 3 and 18crown-6
+89%
+Hantavirus
+Mastomys natalensis
+infection with the homologous virus
+L118A/I119A
+p-values
+plasmacytoid dendritic cells
+epithelial-mesenchymal transition signaling
+phosphoramidon
+MNV-1 permissive BV-2 cells
+Neuroinflammation secondary to TBI
+100%
+A virus stock of Langat virus strain TP21
+patient safety
+speci-fication
+the type of ventilator
+Pneumonia
+co-engagement of different immune receptors
+80%
+differences in IAV-interference with host genes expression
+Bid
+in vitro neutralization
+m 7 G 46
+blood samples
+IL-15
+2 mg of total RNA
+extremely high
+renal blood flow and urinary output
+granulocyte-macrophage colony-stimulating factor
+Dysentery and TAP
+10
+85
+Hb digestion
+40S ribosomal
+total protein ubiquitination and ISG15ylation
+endoplasmic reticulum
+Escherichia coli
+OCTA
+H3N2 HA1
+normal form coordinate transform method
+Inhibition of aminopeptidases
+immaturity
+significant protection
+flow cytometer
+bleeding
+proportionate mixing
+a duplex formed by complementary antisense oligonucleotides
+effective solutions
+HN and HC
+Redesigning primers
+Non-specific amplification
+apoptotic or necrotic
+Graph
+two
+ADE and cross immunity
+Pileup
+R 0 = exp
+N-acetylglucosamine
+Rotaflow Maquet Centrifugal Pump
+viral transmission
+disorders of the airways largely related to the presence of persistent inflammation
+cellular response
+CyDs
+Stromatolite structures
+46%
+7.0
+Staphylococci
+JE progression
+Chikungunya or dengue
+-20uC
+gene dosage and phenotypic character
+cysteine-rich
+Sunlight and ultraviolet rays
+ferrets
+7
+7,800
+strength and toughness
+Xenopus and Drosophila
+Pulmonary complications including atelectasis, pneumonia, and acute respiratory failure
+production of neuropeptides
+10-fold
+balanced immune responses
+cross-reaction
+InlB
+Foxp3-EGFP
+LAS AF Lite software
+NK cells
+transport of G to the plasma membrane
+hospital mortality
+C-type
+thoracoscopy
+endothelial cells
+G33
+short substrate/inhibitor segments of protein loops or strands
+IL-27
+Fourteen
+lung IFN-γ mRNA
+105
+230
+PANTHER database
+five
+Fifty four
+sialic acid clustering
+sympathetic
+fungi and oomycetes
+temporal signal
+to minimize the costs associated with performing chart review
+Japanese encephalitis virus 4
+13,753
+2.5%
+H1N1
+PD-1-positive cells
+18.4%
+Three
+Fractions of 0.5 ml
+Mouse PSCs and mPSCs Oct4+
+Insertion of tail-anchored proteins into the ER membrane
+Mas
+investigations into identifying alternative methods
+17%
+APACHE-II scoring system
+59
+fold differences and statistical tests
+cell surface receptor-mediated endocytosis and sorting
+6.6610
+specific interventions
+the value of the residual sum of squares
+44
+371
+QDD 1.3
+Twenty-four hours
+lowest inhibitor concentration
+FISH
+Xicheng District
+four
+Chemical off-gassing
+5 mm
+two-tailed t test
+Evolutionary distances
+protein immobilization
+human nucleolus-associated chromatin domains
+4,017 amino acids
+versatile plasticity
+enzyme-linked immunosorbent assay kit
+H5N1 HPAI reservoirs
+seven
+LAMP reactions
+121
+fluorescent infected cells expressing GFP
+bulky phenyl group
+three days
+CD9 and CD81
+occult metastases
+116
+nine
+Environmental surveillance
+flow cytometry
+CpG dinucleotide
+use of ACE inhibitor and/or angiotensin receptor blockers
+continuous assessment
+Diarrhea
+mice
+JX036326-JX036359
+mRNA degradation by RNA silencing
+Toronto, Canada
+positive and negative controls
+socio-economic groups
+98.9%
+>12,000
+cell necrosis
+closed-loop microfluidics platform
+Ancestral knowledge
+children between the ages of 6-24 months
+African countries
+N-terminus
+higher copies of virion produced
+Dicer
+mineral-oil-spread
+IP-10 and RANTES
+time, place, and genetic information
+working-age adults
+Whatman No. 1 filter paper
+conserved
+thousands
+HAdV-C strains
+lower levels of tracing success
+ImageJ
+NFkB activity
+periods of influenza activity in Georgia
+30 minutes
+transcription/replication complex
+LPS
+GeneChip Operating System v 1.2
+RT-LAMP reaction
+Circoviridae
+GC residues
+viral replication
+enhances the p65 protein in gastric CSCs
+pDC loss
+14 dpi
+hyaluronidase
+Nrf2
+1x RBC lysis buffer
+MDDCs
+longitude and latitude data
+malarial drugs
+BCA assay
+no measurable cell death
+two
+500,000
+lethal H5N1 infection
+monocytes
+save the life of patients in the late period
+Viremia
+neity
+23 to 44%
+TI cell TNF-a production
+PRV
+Pulmonary fibrosis
+doxycycline
+financial limitations
+confirmatory diagnosis and epidemiological surveys
+Ectropis obliqua picorna-like virus
+cldn3, 4 and 18
+WT and lpr mice
+45%
+Kaempferol
+Regional persistence of polio
+23
+non-allergic rhinitis and influenza like-illness
+quantum mechanical polarizable force
+B cells
+perfluorocarbon
+44
+GLMM and BRT
+Lp-1s
+neighboring relationships
+2%
+media
+enhanced
+fever triage, identifying suspected cases, and transferring to the local IDH
+Poisson's Law
+cancer development and prognosis
+EIciRNAs
+Hemorrhagic fever with renal syndrome
+a bipartisan parliamentary group
+RNeasy
+2H5-A14
+biological
+mucous membranes
+hexon
+mitotic spindle
+completely elucidated
+Enhanced surveillance
+thin-layer
+tetraspanin membrane protein family
+SYFPEITHI
+bronchiolitis and severe neonatal infections
+stabilisation
+3
+lower HTNV RNA loads
+PTM of STATs
+true/false
+Hitachi H-7100 electron microscope
+mild, moderate, severe and dead
+2 weeks
+Sustainability, Sovereignty and Solidarity and bio-Security
+Human endogenous retrovirus
+PyMOL and UCSF Chimera
+WildNet
+luciferase
+all
+six
+Discharge codes
+maternal antibodies
+absorbance measured at 280 nm
+potential homologues
+Administrative data
+positive
+mitochondria compartment
+Mitochondria
+Capacity problems
+heat shock
+Early detection of fibrosis progression and the development of portal hypertension
+HEp-2 cells
+its ER localization
+Rodentassociated viruses
+hemagglutinin and neuraminidase
+significant hurdles
+ATPase, helicase, endonuclease and ATP binding activities
+codon model
+to escape the disaster
+OrgMassSpecR
+macrophage-infiltration
+11
+sticky
+pre NDV challenge growth rate
+down-regulation of mir-21
+Geir Gunnlaugsson
+The variance of daily temperature
+turned up
+toxicity
+generate long-lasting memory CTLs
+neutrophil elastase
+Student's t-test
+HBs-humAbs
+Models based on ordinary differential equations
+molecular and phenotypic characterizations of AIVs
+primates and ungulates
+higher tidal volume
+angiotensin converting enzymes
+ethidium bromide
+Multiple factors
+40 amino acid domain region
+Student's t test
+generalized linear regression model
+Wide use of Big Data
+HPV capsid disassembly
+Ga-citrate and donepezil
+increases
+Descriptive statistics
+FTLSV strains isolated from Japan
+Serum samples
+19,461
+three
+Sixty milliliter ice-cold saline
+unusual and very unfortunate
+Avastrovirus 5
+Forty-one
+Sixty-one
+serological data and hospitalization data
+0.08
+tumour progression
+simulations of metapopulation models
+Met 706
+Fidelity adjustment mutagenesis based live attenuated vaccine design
+SAP-SII and SOFA score
+10%
+malaria-negative children with infectious diseases
+Myodes glareolus
+P. jiroveci
+Forty-one percent
+Norway, Sweden, Germany, Belgium, Poland and Switzerland
+toxicity of the ssRNA nano-structure adjuvant
+Th17 differentiation
+mutational bias
+55
+DcR3
+RIDD
+≥30 bp
+61
+54 %
+standard error of the mean
+lung mechanics
+translation
+Onco-inflammation
+Mandatory notification and laboratory surveillance
+N-glycans
+neuraminidase inhibitor
+Healthy, unstressed cells
+priority setting
+herpesviruses
+tropocollagen
+sensitivity
+regular and repeating
+a Shh agonist
+CypA
+Fractions
+routine public health settings
+Maxima H Minus First Strand cDNA Synthesis Kit
+Chloroform
+RMSD
+ðâ max Þ
+immunoblot
+37
+30%
+0.1%
+May
+4 weeks
+sheep
+grassroots networks
+leaky scanning
+Glyceraldehyde-3-phosphate dehydrogenase
+genetic
+Ceacam1 À / À mice
+65.7%
+stimulates Ubp9 and Ubp13 catalytic activity
+GR and HE
+Hashida and colleagues
+H3N2
+p53, ROS, and autophagy molecules
+H5N1
+polymerase chain reaction
+cap-dependent
+protostomes and deuterostomes
+translational elongation rate
+57.7%
+airway epithelial cells
+PBMCs
+IL-XPCI
+transducing
+subtle, unrecognized differences in nutritional and health management
+K d
+urine
+liver and pancreas
+foscarnet
+200
+2.3%
+Web Figure 2
+Ni-NTA column
+IL-6 and IL-17
+fixed
+4-7 fold
+small molecule efflux
+Val-X-Ala site
+Rabies, brucellosis, and anthrax
+pleiotropic
+lecithin
+U 1 2 A 3 A 4 C 5 6
+295
+378
+air-filled pulmonary alveoli
+c.208 A>T
+high specificity
+changes in compliance of the respiratory system
+10%
+SSTR2
+mRNA technology
+2 hours
+412-423
+pneumotropic
+larger case numbers further away from the upper credible bound
+Palmitoylation by membrane-bound DHHC proteins
+three weeks
+DCs in PPs
+C5a
+a helicase
+3968
+Ionocytes
+protective efficacy in nonhuman primates
+Osteonecrosis of the femoral head
+stretch of adenylates
+Kozak consensus sequences for the macaque ISGs
+C1
+45%
+22 876
+resistant
+an equimolar mixture of G and C
+Integrins
+host immune response
+kDa
+viral
+4.3 to 7.2
+they may not be contacted by members of the community or whānau
+Ege University Ethical and Research Project Committee
+three
+situational pressures, the clinical environment, gaps in education, and organizational culture
+inability to identify the cell type responsible for the change in gene expression
+toll-like
+G101T
+53.4%
+Influenza
+innate immunity
+cell membranes and perinuclear autophagic vesicles
+fights cancer
+local Southern partners
+Thirtyone
+lipodystrophy
+how RNA substructures may interact during DENV replication
+cytoplasmic extract
+Division of Global Migration and Quarantine
+Fifteen
+500,000
+sequencing of the cDNA amplicons
+56
+Hispanic/Latino
+High-quality reBmBac DNA
+dead cells
+cytoplasmic granules
+Illustra GFX PCR DNA and Gel Band Purification Kit
+Measles, mumps and rubella
+paying for the vaccine
+upregulation of type I IFN
+culture-based diagnostic tests
+bacterial coinfection
+to explore people's perceptions of the swine flu vaccine
+one-half to two-thirds
+Tospovirus
+31 per cent
+TLR4
+The stairs feature
+innate immune cells
+infectious disease transmission
+species recovery following wildfire
+Hepatitis E virus
+GpSGHV pathogenesis
+S2
+28
+peripheral blood lymphocytes
+macropinosomes
+impairments of lung function and quality of health and life
+290,000 to 650,000
+increment in some subtypes
+ELISA
+trypsin
+2,3
+SAA
+rare variants
+3 dpi
+21
+EMMIE
+lazarettos
+Interferon inducible transmembrane proteins
+Invitrogen
+1981 and 1984
+convalescent bovine
+w
+chromosome 5 position 33
+MoMLV
+10 min
+Lipid mixing
+RTA
+15 minutes
+South Sudan
+Beijing
+RAND Corporation
+63%
+RNA
+intraclass correlation coefficients
+a compensatory mechanism
+selects the city which contributed with the largest number
+two different pathogen inputs
+101
+six
+matrix-assisted
+Lassa-exposed cells
+quantitative cICAT analysis
+JUNV RNA synthesis
+palmitate
+type I interferon system
+immunofluorescence
+eigenvalues and cumulative contribution rate
+muscle aches, headache, and fatigue
+transcription readthrough
+crown-of-thorns starfish
+41.7%
+Supplementary material
+cellular membranes that are remodeled and expanded with newly synthesized lipids
+comprehensive
+Alteration of the normal pH
+28
+152
+16
+65%
+10 kg
+BMS-986094
+cell survival
+paralysis, seizures and deafness
+cerium precipitation method
+Risk of publication bias
+FASTA
+the pooled set of overlapping genes
+Creative Comm ons Attribution 4.0 International License
+versatile
+host cell vATPases
+ELISA
+440
+58
+Shaanxi, China
+effective training and supervision of MHCI workers
+TRAP activity
+once
+the drug's clinical benefit
+Children younger than 15 years
+simulated scenarios
+Protein-A/G
+C-mannosylation
+The Nrf2 pathway
+data
+NKG2Cþ NK cells
+cc-by
+Bronchiolitis
+900,000
+2 h
+RFP
+semi-quantitative indicators
+Background-adjustment, quantile normalization and log 2 transformation
+risk factors
+apoptotic cell death
+Subtype U
+obesity
+Compounds 1, 3, 4, 6, 10, and 11
+acute respiratory distress syndrome
+600
+10%
+HMGB1 protein
+2-6 day
+asymptomatic
+Hyperparasitaemia
+ATCC Cat No CCL-185
+Colocalization
+80%
+drops in egg production and induce respiratory disease
+SKP2
+2 h
+the active site of the envelope glycoprotein
+CEACAMs and KIRs
+a boost
+nc P1127T
+two
+harmful
+Individual datasets for the date of exposure and illness onset
+JEV antigen
+clones with multiple substitutions in one or more contact regions
+dengue fever
+improve fish fitness and immune defences
+In vitro infection of endothelial cells by influenza virus
+87%
+X-ray
+CCAA
+less than 10%
+GSK-3b-mediated
+parasite GSTs
+protein levels in pg/ml
+twice a day
+hepatoma cell lines
+PPIA and B2M
+the ID with the largest interquartile range of expression value
+significantly slows wound healing
+cause-specific
+cell viability
+Logistic regression
+9
+personal Vulnerability to infection
+finding conserved primers
+Mitochondrial dysfunction
+MetaCore software
+electrophoresis
+an explanation for these findings
+80%
+IP-10 and I-TAC
+infection
+5-30%
+HFIP/DCM
+binding
+IL-10 and Vb8 + CD8 + T cells
+the formation and accelerates the decay of C3 and C5 convertases
+integrin activity
+exon skipping and viral gene therapy
+IFIM4P
+quarantine and voluntary home withdrawal
+four
+cell death
+Clean nitrogen
+SAFV-3
+anti-tubercular drugs
+methanol
+statistical maximum-likelihood estimation
+any event of potential international public health concern to be declared
+repair
+general community
+VirHostNet
+ROS production
+1957
+PTV-A NSs
+Antibody titers and specificity
+community-onset pyogenic infections
+Country-level influenza disease estimates
+naked HAV
+toll-like receptors
+140
+16 546
+multiple flu seasons each year
+proximal conducting/convective airways
+Breast cancer
+Almost 80%
+necrotic enteritis toxins and/or enzymes
+Department of Tuberculosis Intensive Care Unit
+ACE2 or cathepsin A
+100%
+type-1 diabetes and multiple sclerosis
+post-PCR dissociation curve analysis
+generation time
+rehydration therapy
+TLR7 ligands
+loss of CD8 + T cell function
+LaSota
+receiver operating characteristics curves
+ill-defined symptoms, signs, or conditions
+COA
+400
+Minimum free folding energy
+three
+CD4
+60%
+40%
+multiple-alignment
+L gene
+29%
+equity
+different measures of error
+valuable insights
+a complete absence of cross-immunity
+EndoFree Plasmid Mega Kit
+a nucleotide polymorphism exceeding 50% of the isolate virus population
+Interactions with pets, insects and wild animals
+a score of one
+CRISPR-Cas9
+21
+FKC and pcDNA3.1
+method 1 and method 2
+whether the codon biases of genes are influenced by mutation
+Nurse Practitioner
+20 hours
+plasmablast
+SM934 Collagen-induced arthritis
+Phylogenetic
+u and v
+IL-13 + cells/HPF
+three
+20%
+Viral complementary DNA
+Underlying co-morbidities
+the BCTI
+mirVana isolation kit
+MMPs
+21
+PCR
+Fourteen microliters of EDTA
+pressure
+TF TCF4
+pBB2.2
+The vertical axis
+GitHub
+10 min
+Soluble NP
+Protein A agarose Fast Flow 50%
+odds ratio
+TARG1
+MVA-infected epithelial cells
+decreased cell surface CD62L
+Five
+serine or argenine
+200 mL of BMG
+H7N9-symptom-onset data
+1 μg/ml
+chi-square goodness of fit test
+azithromycin or placebo
+particular conditions of the organism
+ER stress
+average tidal volumes
+increased hemorrhage and edema
+α5β1-integrin protein level
+cytoplasm
+The ERK pathway
+Serfling-based Poisson model
+deviations from the predicted three copies of each gene
+diabetic retinopathy resistance
+few
+antibiotic treatment
+Two
+90%
+Isotype
+monocytes
+150 μM
+manidipine
+calreticulin/CD91 receptor complex
+full-dose IM delivery
+Elem1
+2009
+LBP-1 and sCD14
+exosome production
+CDK1-cyclin B
+more relevant and persuasive
+means ± standard error of the mean
+20%
+simple and quick AHR
+104
+international data
+Percoll concentration
+2%
+Aliquots of viral stock
+Requirements to identify dual-use concerns
+TGEV-N
+the difference between target gene and the average of reference genes
+26
+Capillary zone electrophoresis
+1970s
+middle-lower fields
+crucial
+upregulation of TAAR1
+slower
+IPTG
+in vitro resistance to neuraminidase inhibitors
+Israel meningo-encephalitis turkey virus
+protect chickens from infection
+choriocarcinoma
+gene expression stability analysis
+EGFRvIII mRNA
+A long reverse-direction ORF
+Kanehisa Laboratories
+memory T lymphocytes
+multi-alignment of orthologous proteins
+specific compounds
+Ego depletion
+2 h
+NSG mice
+what participants thought about or paid attention to
+7 min
+failed to induce apoptosis or activate NF-κB production
+lymphocyte counts
+all-trans-retinoic acid
+69
+Streptococcus pneumoniae
+Over 350 million
+QIamp Viral RNA mini kit
+68
+damaged molecule repair
+EV-miR-7-mediated synaptic injury
+Trypsin-EDTA
+Microsoft Visual Basic 6, Microsoft Access Database 2007, and Universal Library components
+Plasmid DNA
+IBV-specific T cells
+protected mice against lethal carcinoma cell challenge
+aerobic
+biomarkers
+seven
+significantly enhanced autophagic flux
+lack of vitality and social function
+important
+dynamics in the intermediate host population
+an in-frame construct
+no data found in the study
+IL-6/STAT3-dependent interstitial fibrosis
+30.8 hours
+The total RNA of cultured cells and lung tissue
+DNA
+alveolar pneumocytes
+RPMI1640 media
+20
+three
+Competency questions
+mechanism mediating this enhancement
+3A and PI4KB
+S15a
+The voice of local stakeholders
+Western blot
+4-5 days
+65%
+Signature peptides
+virus survival studies
+cholera
+fluorescent color-coded Luminex®beads
+four
+Dogubeyazit State Hospital
+ELISA reader
+Changes in biotic and abiotic conditions
+phosphatase
+whether burial is safe and appropriate, or whether the bodies should be cremated
+dynamic exclusion
+atypical
+Tables 1 and 2
+pseudoviral infection
+delayed response
+Purified splenic
+serum levels and/or functions of MBL
+cross-scale
+Significance
+Host population density
+peptide chain release factor 2
+four
+28 days
+30 cycles
+RT-PCR
+three
+angiotensin I-converting enzyme -inhibitory activity
+HLA-A*0201 positive
+an increase of H7 reactivity
+septic patients with overall decreasing Th2/Th1
+CK1.2
+PacI and NdeI or EcoRI
+IPC, antimicrobial stewardship, and CRE surveillance
+Eight
+pain
+Cell media or membrane fractions
+728
+ligand and receptor
+Multivariate stepwise logistic regression
+RT p66 and p55
+Sera
+by using MUSCLE with a maximum of 64 iterations
+45 min
+naïve
+anti-Toxocara IgG 4
+recombinant XendoU B
+21
+host responses to sepsis
+P/F and oxygenation index
+serum or mucosal antibodies
+466,815
+both strains
+large vesicles
+HIV-mediated syncytium formation
+loop 2 sequence and length
+live-attenuated influenza viruses
+post-transcriptional tailing of native rRNA
+daily
+2-8%
+14
+FACSDiva
+black bar
+Willmore energy-based features
+Partial least squares
+acute respiratory distress syndrome
+2005
+four
+IBs
+HeLa cells
+serological evidence of prior BVDV-1 exposure/infection
+Differential miRNA expression
+114
+two
+the presence of a furin cleavage site
+CD4 + T cells
+road crashes
+retinal regeneration
+45,804
+our knowledge
+14
+challenging logistics
+specificity and cellular toxicity
+erythrocyte membranes
+interacting
+detrimental
+cell signaling receptor and cell proliferation markers
+60%
+50 million
+EBOV GP-pseudotyped VSV encoding the Luc gene
+α-MMC and MAP30
+access to Internet, multimedia and multi-task processing
+76.1%
+Pseudoknots
+higher EHV-1 DNA levels
+RNeasy Mini Kit
+1,300
+stress
+Bunyaviruses
+five
+Cell viability
+the origins of replications
+Fiji
+observation time
+H1-subtype
+primary airway epithelial cells
+infected cells treated with a positive anti-influenza compound
+10%
+a lysine
+poor illumination and camera viewpoint
+cell death
+age
+improving patient safety and quality of care
+9
+0.011 ± 0.008 mg m −3
+systemic antibodies
+somite-specific and stagedependent
+2
+12
+caspase-11-dependent
+Taiwan National Health Insurance
+Takeda
+pseudotyped
+severe disease states
+Log2 Expression Ratios
+enhanced clinical and laboratory surveillance capacity
+microbial sequence similarity
+Antibody levels in serum and BAL
+73.9%
+Urinary, renal and plasma ACE2 activity
+patients with an extra-pulmonary infectious disease
+six
+b-actin
+selective reaction monitoring mass spectrometry
+NIH-AIDS Research and Reference Reagent Program
+sodium-N-lauroylsarcosine
+mild fever
+New York, NY
+50 million
+56
+Macrophages
+informatics savvy workforce
+positive and effective nursing
+loss of NEO resistance
+Gn protein
+increasing by 24% and 28%
+decreased survival of spinal motor neurons
+selection
+Quidel Sofia POC test
+ECL reagent
+CO2 asphyxiation
+continuing medical education
+Active smoking
+C. difficile Spo0A
+rainfall and flooding
+9
+Cu 2+ reducing assay
+chromosome 12
+relative abundance of AMR genes
+Pearson product-moment correlation coefficient
+nearly 20
+Salmonella and viral vectors such as Ad
+CEACAM1
+Ly-6G+
+necroinflammation
+NK cells
+17.5uC
+Malignant pleural mesothelioma
+17
+leucocyte transendothelial migration signalling pathways
+1 h
+decapitation
+four
+Anti-MPER humoral
+MagMAX Viral RNA Isolation Kit
+morbidity and clinical signs of infection
+DNA damage response
+APC-conjugated antibodies
+school-aged children and adolescents
+Selectable markers
+peer counselors
+reporter system
+eight
+cc-by
+transcription of the corresponding plasmid clone using T7 RNA polymerase
+bacterial
+14
+asparagine-linked glycosylation
+Taffeta scripts
+10 ng/ml
+1.5-2.5
+100 nL of 3 × 10 10 ffu/mL rVSV
+conserving the genetic integrity, diversity and traditional management of the species
+carry out similar assessments
+an appropriate animal model of inflammatory bronchiolitis
+direct numerical integration
+18.35 %
+congestive to necrotic-ulcerative enterocolitis
+impaired pulmonary function, neuromuscular weakness, and neuropsychiatric
+AS1411 aptamer
+H rot
+mouse MIF crystal structure
+Polymerase chain reaction
+motorized pullback device
+UDP-Glc
+end-tidal PCO 2
+nucleotide content at codon positions 1 and 2
+capture antibodies
+Selection during transmission
+HCMV
+cc0
+18,389
+central
+Old guidelines for airway flow
+95% credible interval
+PPI networks
+30
+phage display technology
+National Health Insurance Administration and National Health Research Institutes
+5 μl RNA
+Free floating 3D-NS
+12 days
+xx
+bicistronic
+Avogadro constant
+stair ascending
+bootstrapped coefficients
+Multiple-organ dysfunction syndrome
+application length, treatment intervals and route of delivery
+anxiety
+2013-15
+EB66
+crosstalks between MAPKs
+proteasomal degradation of RIG-I
+Ca 2 + -calmodulin
+decreased
+loglinear models
+0.107
+represent complex anatomical structures in lungs
+other factors
+16.9%
+organized and sustained
+lethal
+Node color gradient
+VOSviewer
+peptide binding ability to HLA-A*0201 molecules
+intramuscularly into the deltoid
+herd protection
+noise
+The assumption on case-hospitalization risk
+Two
+more than 40 years ago
+1967
+apoptosis
+Positive and negative controls
+0.6 to 3.2 mM
+microarray hybridization technique
+212 million
+MinION
+Real-time PCR
+Probiotics
+Four
+four
+Modulating the immunogenicity of subdominant CTL determinants
+Purified protein concentrations
+10,000 individuals
+CC 50
+FALPA
+Inhibition of pol I transcription by ActD
+cap-dependent
+24 h
+IL-4 and IFN-γ
+a gene or a term
+PBS pH 7.2
+3-Iodothyronamine
+advanced virus infection
+permeability, affinity, and selectivity
+0.99
+p
+clock genes
+The vector backbone
+Perkinsus marinus
+Positive
+ER-to-nucleus
+>5300
+myelodysplastic syndrome
+Collecting and annotating
+via a diacylglyceryl anchor
+17
+Bacterial pathogens
+148
+Water w1
+Laser confocal
+Ca 2+ concentration
+recombination between strains from distinct clusters
+inhibition of cell proliferation and increased apoptosis
+Phylogenetic
+Two
+10-fold
+Induction of neutralizing antibody response
+cancer, metabolic and hormonal disorders
+quantitative
+outside of Africa
+LigPlot
+iProt-Sub
+electroporation
+T lymphocytes
+H&E stained sections
+low
+mast cells
+ethics
+C3a receptor and C5a receptor
+novel moieties from a screening library
+1002
+our results
+pro-inflammatory
+Cvl-NI-2
+FlowJo
+dihydroberberine and sunitinib
+CD or Trp
+autocorrelation value
+2.5-log copies/mL
+cellular immune responses
+phosphatase
+1.3 to 2.7
+Infection of animal cells with FMDV
+systemic inflammation and risk of bacteremia
+Image-Pro Plus 6.0
+inhibited CSFV replication in PAMs
+sgRNAs
+sodium pentobarbital/ketamine
+downregulation of IFN-β and IL-6 expression
+evaluate the scores and tissues
+13
+network dilution via
+tolerogen
+two
+1 h
+0.005
+external infection
+Native agarose gel electrophoresis
+ADIPOQ, ACE2, APOE and CETP
+Dendritic cells
+ClustalW
+E. coli BL21 Star cells
+the bone bank administrator
+Fig. 1
+intramuscular cedilanid
+36
+assays
+SA expression
+CypA and TBP
+antibody production and antibody half-life
+thirty six
+Replica exchange molecular dynamics with solute tempering
+non-pharmaceu-tical measures
+prehistoric times
+250,000
+Multi-Task Group LASSO
+lower
+high amounts of sugars
+37%
+Students-Newman-Keuls post hoc test
+62%
+translation of the RVFV lacking the NSs gene
+Quantitect RT
+Brain lesion volume
+exocrine, endocrine, hematopoietic and neuronal cells
+mumps virus
+the one which had not been adequately studied explicitly in previously published risk models
+two representative inflammatory cytokines
+general intellectual status
+DENV-1, -2, -3, and -4
+conventional medication
+200
+the formation of nucleoli
+diluted HCl
+complement protein C1
+enhances resistance to IAV infection
+20 million copies/ml
+DDCt method
+cytokine-induced neutrophil chemoattractant-1
+infection, peritonitis, and social variations
+right censoring
+Group I peptide
+Accutase cell detachment solution
+15 min
+Kernel-based metapopulation models
+23
+A window into the natural conditions for commensal and pathogenic organisms
+IgG Antibodies
+5%
+heterogeneous sub-populations of viral variants
+86 viral genes
+1:1
+37%
+antifungal
+oral histories
+DuoSet ELISA kits
+Anti-CD4 mAb
+5% b-mercaptoethanol
+severe allergic inflammation and an asthmatic syndrome
+HeLa cells
+2012-15-2934-00123
+mesenchymal stem cells
+high phagocytic indeces
+10,685
+chimpanzees
+lack of specificity
+67
+to rank genes on the basis of their stability
+450
+artificial acquired immune response simulator
+various responses
+one third
+dispanin family
+Thirty-three
+Dot Blot assays
+high titers against the H5N1 subtype
+Cry1 and Cry2
+crazypaving
+entry of BTV-1 into BHK cells
+specific needs and adaptations
+Genome Institute of Singapore
+35-fold
+Nedd8 and ubiquitin
+siExplorer and RFRCDB -siRNA
+Materials and Methods
+ongoing engagement
+a sample of at least 500
+Lung function
+Cross-reactivity with host antigens
+λ
+anti-inflammatory and anti-apoptotic
+DENV2
+R I 0
+FRBs
+Routes of exposure
+60,153
+postoperative mechanical ventilation
+134
+longitudinal studies and/or less restrictive eligibility criteria
+100 ng/ml of LPS
+mast cells
+reverse genetics
+macrophage-derived inflammation
+Mann-Whitney analysis
+decrease
+Fourteen
+five
+A better understanding of family experiences
+Cytoplasmic vacuolation of respiratory epithelial cells
+25
+poorer NA activity
+SM d34:1 and PE 18:1p/ 20:4
+Institutional Animal Care and Use Committee
+Three
+NZ existing wool quality traits programme
+CPE
+peptidic C3
+growing
+core lists
+diverse
+10 min
+cell-mediated
+200 μg of anti-IFN-γ or anti-TNF antibody
+active
+128
+data directed analysis
+ELISA
+Increase in heart rate and vasoconstriction
+inhibited IRF3 activation and IFN induction
+vimentin
+six groups
+additional visits
+productivity and wider societal costs
+R n and R n,0
+3.0%
+coronary artery disease
+HBV envelope protein
+six
+protein-level selection on the second amino acid
+L1 and IAP retrotransposition
+simplistic linear model
+depression
+0.030
+Toronto, Canada
+fusion triggering and membrane fusion
+Six
+environmental conditions or developmental periods
+Binding responses from duplicate injections of each concentration of ClfA
+2~2.5
+mannose type oligosaccharides
+UCSF Chimera
+IFN-γ
+viral gene expression regions
+more confidently predict the future
+serum viral loads
+surgical resection
+3
+95%
+εW
+Isothermal amplification
+100%
+frequency
+≥90%
+peptic ulcer disease
+10 μmol/L
+mice
+DNA minor grove binders
++17
+12
+Thirty-four
+12% SDS-PAGE
+PfMYST
+empirical
+38%
+The CRE
+π
+Descriptive codes
+important
+12
+246
+Candida albicans
+cytochrome P450 3A4
+Sera of unimmunized mice and irrelevant antibody
+a community
+Isothermal amplification
+in response to oncogenic or DNA damaging stresses
+NDDS
+fractional TMT signals
+antigenic determinants
+Custom python scripts and bash scripts
+TgROP18
+6-week
+the diversity of viruses reported for feces
+endothelial and epithelial cell junctions
+respiratory infection or even life-threatening infection in children
+Oct4, Sox2, Nanog and Lin28
+73.0%
+less desirable characteristics
+17
+PPAR Transcription Factor Assay Kit
+cells where N but not PreGn was detected
+IL-1b
+cytokines, chemokines, proteases, and growth factors
+rapid atrial fibrillation
+AZ1A, AZ1B and AZ1C
+H9N2 avian strain
+Listeria monocytogenes
+viral load
+Eq.
+DNA unwinding and origin of replication processes
+drug resistance
+Input parameters
+entry
+class II
+1943
+a-fibrinogen
+TS
+the same genomic position
+the total number of contact persons reported by a participant
+in replicates
+massive remodelling
+16-0136
+IFNL4-∆G
+Rhesus macaque
+virus genes
+GPD2
+three
+sucrose phosphorylase
+IBV-infected DCs
+malaria, HIV, childhood vaccination, and maternity services
+separation membrane capacity
+Microspheres
+autonomic system activity and blood pressure
+100,000
+in vivo stability
+recent analyses in national burden of disease studies
+21
+NOA36
+24 hours
+1 month
+0.1% FA
+cytosolic
+self-reported diaries
+SGs and PBs
++39
+100%
+30°C
+competent DH5a cells
+residue 294G
+1
+staff turnover
+PCR
+MFI
+1:15,000
+fidelity-variant or WT CHIKV
+HeLa cells
+94-250 ng ml −1
+justifiable reason
+20
+11 to 34%
+24hrs
+modifies splicing events
+West Nile virus
+Three
+IAV in infectious mucus
+PEG/NaCl
+electrochemiluminescence immunoassay system
+sixteen
+viral transduction
+Pseudoknot detection
+signal transduction of uninfected bystander cells
+The liver, spleen and lung
+rather small
+avalanche photodiode
+Pathogen-associated molecular patterns
+Phase I clinical trials
+Faxitron MX-20-DC12
+competitive dominance
+three
+T-cell cross-reactivity
+Role 4 facilities
+Canadian Institutes of Health Research grant
+Systemic
+human class I molecules
+Further investigation
+0.2 M EDTA
+1.5 hr
+ABI PRISM SNaPshot Multiplex Kit
+hazardous waste
+short time-to-result period
+intestinal epithelium
+IL-1β
+Drak2 -/-T cells
+social status
+Rubisco
+Three
+comorbidity
+Further work
+numerous papers
+292
+trustworthiness
+recombinant pegylated IFN-alpha 2
+Figs. 3 and 4
+use of adjunctive therapies
+cleave Gag
+Epitope immunogenicity
+mechanistic visualization
+Cathepsin K
+any of these diseases
+nine
+logistic regression analysis
+sequence optimization algorithm
+AD3BF2D ligand
+CD1d
+influenza virus
+six
+upregulation of Jak1/STAT3 signalling
+IFNL4-TT/TT
+1,570,733 read pairs
+16 dpi
+Inflammatory
+higher codon usage bias
+E. coli derived K5 polysaccharides
+Gag
+local climatic conditions
+individualized
+propidium iodide exclusion dye assay
+stable cell lines expressing CD63 fused to a nanoluciferase reporter
+twice
+twenty-first century
+ITGA3
+relevant email contacts
+3.77 e 6 bits
+Smartphone applications
+OABSS
+gossypol
+NASH
+13,095
+ten
+cardiologists, academicians, and industry
+biotic and abiotic
+Σ Zi = λ/Σ
+Human CD4 + T cells
+GPVI activation
+cervical
+nucleic acid sequences
+50%
+obesity epidemic
+World Health Organization
+C6
+generation of an antigenome of positive polarity
+H 2 O 2 and menadione
+38.5 • C
+977
+a series of group discussions
+host translation
+C4
+Pdca1
+substantial and dose-dependent GIA activities
+three
+lowest
+2006
+Space-Time permutation
+120 days
+Behavioural
+decreased
+intravenous palivizumab
+r and θ become irrelevant
+28.6%
+naked DNA or DNA complexing NC
+PFS
+laboratory confirmatory tests
+the exosome
+severe imported falciparum malaria
+simulation experiments
+the Golgi
+up-regulation of MIE gene expression and subsequent reactivation
+0.1%
+12 h
+South China Agriculture University Institutional Animal Care and Use Committee
+IL-22
+over 50%
+tRNA Gln
+new analytic methods
+239
+CD4 + and CD8 + T cells
+lipidation of protein
+More than 320
+Protein-protein interaction networks
+12 hours
+three
+80-kV transmission electron microscope
+kappa, iota and lambda
+emit the fluorescent signal
+2000µg/L
+isolate
+Liposomal doxorubicin and vinorelbine
+gas chromatography/mass spectrometry
+Ensembl and NCBI databases
+Four days
+EIF2 and FBLN7
+R0 = 2.5
+One month
+2014-01-11
+1/8 day
+L2 ORFs
+120 min
+regularly
+Nurses
+odds ratio confidence intervals
+quasineutral
+The serial interval mean
+54,156,824
+translation of RNA and DNA repair
+DAVID
+nested models
+Nasopharyngeal samples
+2.07 Å
+R 0 > 1
+overexpression of S125A-B23
+spo0A
+one
+50 μl peripheral venous blood
+PHI and GHI
+ten
+clinical
+the very same factors
+less respiration
+December 2019
+26
+urochordates
+VLPs
+digoxigenin-UTP
+0.9%
+CT
+anti-rabbit HRP and anti mouse HRP
+Adequate geographic distribution of existing and stockpiled ventilators
+seven
+five
+lower airway symptoms
+8,746
+reachability versus concurrency
+impaired MCMV defense
+nested qRT-PCR assays
+64.5%
+five
+acute gastroenteritis
+60%
+cap-dependent translation
+angiotensin-converting enzyme homologue
+The resources and ingenuity of researchers and clinicians
+hematoxylin and eosin
+Dedicator of cytokinesis 2
+3 to 10%
+24 hours
+John Sheehan
+302
+on the tip of the HA molecule
+Integrins
+antigenic changes
+total immune cells
+Roche Real Time Ready RNA Virus Master Kit
+metagenomics analysis
+8098
+5%
+20%
+they play a role in AMD
+Betulinic acid
+ABCB1
+Drosophila
+STING
+prevent pathogenic influenza virus infection
+The doctor/nurse
+Modification patterns
+500
+mediates interaction with several PCSKs
+transforms into antigen-specific memory T cells
+EMBOSS CHIPS
+80%
+2 h
+17
+drug repositioning or repurposing
+CloneManager5
+backbone mass
+ampicillin resistance gene
+human herpesvirus 6
+eight
+High host density
+7
+72 hpi
+optimal
+SRI-7968
+mediating divergent effects
+50%
+Zeiss Axiovert 200M fluorescence microscope
+Herd immunity
+domains
+orthology
+young adults
+a forum for countries to communicate and work to protect
+mechanistic and proof of concept studies
+atypical pneumonia
+degradation of the RNA sample
+how many people, on average, an infected person passes the virus on to
+ad libitum
+88
+reliability thresholds
+metalloproteins
+200 µL ethanol
+crucial
+Eq.
+6 ng/µl
+C. fastigiata
+A
+33%
+,1 mM dominant-negative eIFA
+Thirty-three
+vinca alkaloid
+30 min
+a thousand random seroprevalence datasets
+the infectives
+western blot analysis
+219 million
+miR-181b
+Microsoft Excel
+haemagglutinin and neuraminidase activities
+avian ILT herpesvirus
+Protein or peptide drugs
+in vivo
+glycosylation
+Immunofluorescence assay
+8
+Cervical Cancer Screening Course
+Delphi
+7
+three
+Two
+higher +1 PRF
+vessel numbers
+as a discrete number and unit of measurement
+73%
+reasonable
+Optimal RSV-specific antibody levels
+Glomerular mesangial matrix expansion, renal fibrosis, and inflammation
+72 hours
+VP1 and VP3/4
+f >= 1.0
+13
+Adding a temporal element to the clustering process
+PBS
+110
+Schiphol Airport
+microcephaly
+NGO0451
+TM-align
+Dun and Bradstreet's Strategic Database
+AUROC
+day 11
+Access to the means of suicide
+HCMV gB
+preaxial polydactyly
+active relaxation
+12 hours
+influenza A and respiratory syncytial virus
+glycyrrhizin therapy
+Actinobacteria
+exclusion rules
+The extension of peptides
+positive correlation between the oligomer stability and acyl transfer rates
+similarity matrix
+1 µL of 3 × 10 10 ffu/mL rVSV
+increased mortality
+Stereolithography and Selective Laser Sintering
+98
+inhibited
+Irf7
+between 60 and 90%
+Accipitriformes and Anseriformes
+373
+37
+ALP
+carbapenem resistance
+À0.7 to À3.5 kcal/mol
+2.5% colloidal carbon
+CD3 + T cells
+SPSS
+on the day of ICU admission
+Sequence logo
+nonspecific early punctate hyperfluorescent lesions
+narrative
+7 mL per kg of body mass
+Nosocomial outbreaks
+50 nm
+B
+Recruitment maneuvers
+115
+Plasmodium falciparum
+S. aureus strains
+hematopoietic
+global poverty relief
+N-acetylcysteine
+IL-8
+methicillin-sensitive
+propagation of the cAMP pulse throughout the cell population
+antigenic distance hypothesis
+32 pg/mL
+Bcl2
+uncoating and maturation of the virus
+Faecal microbiota transplantation
+15
+MN assay
+Different bacterial species
+780
+antibody-decorated AdV
+position 33
+guinea pigs
+FA mice
+BALB/c mice
+optimal cut-off
+a filovirus antibody fingerprint
+Hong Kong
+vulnerabilities in the host system or database interpreter
+CC 50
+shuttle peptide-mediated protein delivery
+LC3
+Primordial follicles
+Guillain-Barre Syndrome
+genes up-regulated
+Over curve
+Liberia
+97.3%
+trace and monoamine levels
+second strand synthesis and clean-up
+2009
+Fifteen
+fpPSK2 and 5
+ALI
+~8%
+their prevalence in the population
+interest
+dependent variables
+ω or dN/dS values
+CD80
+2-3 days
+C62S substitution
+mouse and human
+Polymerase chain reaction
+treatment and prevention keywords
+Cyclic GMP-AMP synthase
+mass spectrometry
+34%
+catalytic Tyr residue
+4 weeks
+temperature
+HCV RNA replication
+Age and related changes in bone density
+L. lactis
+cyclic multimeric
+ATF4 2/2 MEFs
+67%
+Increased data sharing
+54
+Ab concentration and/or serum avidity
+Viral infection
+Pip6a-PMO
+full-length wild type and mutants HAs cloned
+MRC-5 and VeroE6
+Adolescent girls and young women
+Feeding of pets with raw food diets
+memory cells
+CHIKV DNA plasmid libraries
+time-place-type
+low expression and inherent instability
+H5N1
+repressive
+2, 3, or 7 days post-infection
+tables
+influenza A viruses
+interactive
+activated effector T cells
+17.5%
+simulated data and the number of daily reported cases
+DNA-Free™ kit
+twice
+Substantial human, economic, and social losses
+0.1C
+The Nomenclature of Territorial Units for Statistics
+ROM
+g
+529
+photoreceptor function
+stop codons
+30%
+Detection of single cells
+Permutation p values for overlap
+Thrombocytopenia
+EQ tandem repeats
+Additional studies
+Two months
+30%
+HKL2000
+9.6 and 12.5 fold
+none
+93
+sudden death, vomiting, diarrhea, lethargy or inappetence
+middle cerebral artery occlusion
+phosphatebuffered saline
+etiology
+267
+460 nm
+0.7
+1:2
+saliva
+ethyl acetate
+an asterisk
+four
+protected mice against H5N1 challenge
+Sel-Plex
+34%
+ORF1 of CBPV RNA1
+22.1%
+Absorbance
+control
+infectious
+51
+Nairobi
+Novel K-loci
+P t
+twice
+AtPSK4-myc
+lower socioeconomic classes
+raw data
+the dimer
+MicroRNA-driven RNA interference
+ProPred1
+7-14 days
+CVTree
+selection through non-synonymous nucleotide changes
+Site-specific
+fractional years
+Switzerland
+increasing the sample size
+August 2015
+mosquito analyte with LAMP primers
+bed occupancy
+dual-luciferase reporter assay
+Fever data from the ED
+hotspot
+Minimal
+2-10%
+0.1% of the population
+estimate
+PLC-γ1
+destructive sequential methods
+Apoptosis and necrosis
+q g
+1890s
+NS5
+Fluorescence
+between 1982 and 2014
+LMP1
+inadequately sensitive typing methods
+95% CI
+partial
+transcriptional slippage
+sensing of IFN before infection
+1918
+four
+a fall in blood pressure
+TNF-␣
+98.04%
+5.0
+no obvious clinical symptoms
+chemically modified nucleosides
+disease burden
+10%
+three
+R 0,N becomes a progressively higher surd
+biological
+Binding to BPTI
+selectivity helix
+cytotoxicity, photo-induced toxicity, and cellular uptake
+ethical
+Percutaneous and transjugular
+para substituted diamidines
+0.8766
+one way
+real-time forecasting
+Rhinovirus
+regular refresher courses
+Single-nucleotide polymorphisms
+shed gp120
+patents
+viral effects
+RPA primers and probes carrying 5-9 base pair mismatches
+generation time distribution
+Chinese microblogs
+infected cells
+Five
+R443I
+Culture supernatants
+59
+stable 6-HB
+.
+Bioqual, MD, USA
+Positive hybridoma cells
+intratracheally delivered
+PaO2/FiO2
+combination of a prionlike domain and a RRM
+invest in new players and models
+cases 2, 4, 7 and 8
+information on age, gender and region
+Nodavirales
+100%
+available datasets
+AKT, MAPK1, and IKK
+BDR
+qRT-PCR
+IL-10-deficient
+Recombinant vector vaccines
+21,334
+protection
+antiviral activity
+23 March 2020
+host cellular machinery
+the legislature
+grouped according to geographic location
+2009
+increased the infection of both viruses
+GC content
+Eligibility
+enhances TCR signaling
+6
+TCID 50
+FACS
+The virosphere
+20%
+26
+MALDI-TOF mass spectrometry
+over 200
+4-week
+90%
+Pregnancy
+becomes tight
+slightly elevated
+three
+overcoming four free energy
+weighted least squares
+intervention-related lost productivity
+Models' performance on short-term projections
+1 mM
+singletons
+Confidence in Concept Scheme
+shorter
+one realisation of the epidemic process
+TNF-a, IL-6 or IL-1b
+Sensitivity
+RoNi/7.1
+49.3%
+44 cfu/m 3
+NF-B luciferase
+lack of availability, high cost, and side effects
+maternally acquired passive immunity
+cost
+molecular binding events
+The length of an influenza season
+> =5 days
+to determine changes in filter airflow resistance
+24%
+pneumotachometer
+high-mannose glycan forms
+infectious diseases
+a list of positive and negative new peptide sequences
+Compound SYL1712
+Xia's test
+130
+HBP1
+Annexin V-FITC/PI double staining
+low
+2L q 2 /Lt *
+RNAi-resistant
+HSV reactivation
+dyn2/Eps15 endocytic pathway
+viral dissemination, differences in tissue tropism and host response
+retinoic acid signaling
+Cochrane Risk of Bias Tool
+CAU20140305-2
+expand into different lineages
+ELISpot wells
+an upward curvature
+WT1 126
+Immediate measures
+RSME
+four
+FBS
+Son et al
+auto-agglutination
+leader±body TRS duplex formation
+paradoxical activation of both BRAF and CRAF
+Parsonnet Lab
+2-6
+serum-free DMEM
+18 h
+DNA dendrimers
+GAPDH
+IL-4
+TREx BCBL1-RTA cells
+Brazil and India
+loss of epithelial barrier
+Clustering
+QuikChange II Site-Directed Mutagenesis Kit
+to prevent the possible reassortment of the hemagglutinin segment
+immunohistochemical
+six
+80-100
+quantitative
+the same value
+FoxP3 buffer
+2-5A
+pcDNA3/Myc-RSAD2
+every 3 days
+fibrinopurulent
+Angiotensin converting enzyme
+England
+9.6 kb
+Complete data analysis
+Far-UV CD
+Federal Privacy Act
+78%
+Feline upper respiratory infection
+Clinical and radiological
+two-pore channel 2
+89%
+tumor angiogenesis
+GentleMACS machine
+proinflammatory
+53
+CellQuest
+18 hours
+crown dependencies
+presence or absence of virus
+Eastern equine encephalitis virus
+six simulation scenarios
+The specificity of the PEDV RT-PSR assay
+Bartlett test
+a T at position 17 and a G
+pain
+Five
+11
+η = 0 ]
+stress conditions
+eculizumab
+food
+hairpin
+10
+false-positive results
+rat specific markers NeuN and nestin
+Five
+544
+Equine arteritis virus
+Hsp70
+0.2 µL
+neuroinflammation
+SPSS
+Strand Bias
+treatment conditions
+two hours
+community leaders
+Sedative drug use per ventilated hour
+Non-invasive ventilatory support
+PcrV
+0.1%
+PCK1 and ASS1
+whether they fit a 1-phase or 2phase model
+13
+structural proteins
+assessments of forced flows and volumes in infancy
+challenges
+Viral fitness, virulence, and pathogenesis
+simulated data
+Hypofibrinogenemia
+Monoclonal
+episomal and integrated form
+channels proteins down more favorable folding pathways
+thrombocytopenia
+regulating CSNK1E mRNA levels
+Revisiting the pandemic plans
+one-factor models
+Three
+NQ 4
+Linux
+stimulates HCV replication
+49
+ImageJ
+five
+to understand why there are some viruses which strongly avoid disorder
+hematoxylin and eosin
+myristylation
+ultrasonic aerosol inhalation
+the role, if any, of vertical transmission in dISF persistence
+five
+Hemagglutinating allantoic fluid
+2.5-fold
+PPE
+$40 kDa ORF1p
+11p15.5
+ventricular tachycardia and atrial ventricular block
+Proteins identified that could distinguish MPP from HC and IDC
+normal epidemiologic investigative procedures
+GAPDH
+25%
+regular meetings, formalized MoUs, and data sharing
+human-to-human
+laboratory proficiency
+Passive lysis buffer
+trypan blue dye exclusion test
+acute respiratory distress syndrome
+adjusted and unadjusted odd ratios
+Ilm1p
+D
+Hexahydrohippurate
+effective and non-toxic protein
+shuttles
+100%
+HBGAs
+attending physicians
+Antimicrobial Agents and Chemotherapy
+supplies from stockpiles
+RAB GTPases
+Treatment of rapamycin
+CFTR modulating and correcting drugs
+occurrence of ancillary causes of selection
+recombinatorial cloning
+80
+double replicative form DNA
+unknown
+EIT
+0.75 mg/kg/day
+Heilongjiang Baizhou Bio-engineering Co., Ltd
+estimated model
+35 to 40 nm
+liner epitope
+200
+p35
+Communicable Disease Control Medical Network
+Forty-seven
+flag epitope
+G3BP1
+positive end-expiratory pressure
+slight upregulation of DDIT-3/CHOP
+Yangtze River Delta
+64%
+residue changes and geometric deviations
+ILI-score
+Nucleospin Plasmid QuickPure kit
+pre-travel health consultations
+The transfer rate between hands and various surfaces
+Portland Group FORTRAN compiler
+superbugs
+the repeat length
+LPS
+The dynamics of the processing nucleolar proteins
+186
+M. bovis BCG Pasteur strain
+alignments to their maximal length
+A 0 and A
+454
+Lassa virus
+ELISA
+SpectroDESIGNER
+E. sinensis
+those with the greatest bronchial hypersensitivity to histamine
+providing optimal protection against infection
+3
+three
+upon request from the first author
+Metagenomic viral contigs
+vaccination uniformly at random
+a
+to identify risk factors for the susceptibility to RTIs
+IFN-a
+degradative endolysosomal compartments
+cytoskeletal proteins
+the number of proteins
+Sanger sequencing
+5,459
+3
+serotype III
+at the cell surface
+RNA genetic diversity
+RNAse One digestion
+122
+Dt
+cystathionine
+Blast2GO software
+Hfl1
+PC2
+plasmacytoid DCs and myeloid DCs
+Guangzhou
+seven
+4.8 days
+Four
+very low
+the folding of tRNA
+Duck and geese densities
+TLR signaling
+ECL
+inappropriately normal or mildly elevated levels of parathyroid hormone
+Duplicate articles
+37 • C
+ethical
+ten
+the time post-infection
+29
+FcgR-expressing macrophages or other meloid cells
+BALB/c macrophages
+reduced by 40%
+6 h
+EVD
+Table 1
+international travel
+decreased
+public health
+fluid flow
+2013-02-07
+NanoDrop
+Southeast Asia
+GFP
+rescues the gB 3A virus small-plaque phenotype
+hkiz1.7
+animal vaccination and climate
+9.1
+Photocatalyst-mediated
+nine
+Transferrin
+targeted layered containment strategies
+South Korea
+City of Hope Comprehensive Cancer Center
+visualization and monitoring of G4s structures
+1 µL of 3 × 10 10 ffu/mL rVSV
+infectious and traumatic
+transfected DNA and RNA
+IFNL SNPs
+Molecular biology aspects of insecticide resistance
+Epstein-Barr virus
+pulmonary permeability
+various cut points
+defined optical parameters
+Bovine respiratory syncytial virus
+Lyon, France
+the intensity of a given mass over time
+stealth
+Plasmodium falciparum
+spring-summer of 2009
+6.3%
+g S i,1
+RNA
+43
+cytotoxicity
+14
+SuperScript III First-Strand Synthesis System
+48-hour
+Farm-type specific movement parameters and contact rates
+Binding assays
+significant differences
+The funders
+43.9 kcal/mol
+ARDS
+infected donor cells
+capsid protein
+15
+the regulation of the innate host response
+decrease stimulation
+governmental charge officer
+MinKNOW control software
+mid-1990s
+public health
+multiple host cell factors
+more than 3 millions
+T cells
+0 and 1
+JEV
+Biomarker Wizard Software
+mental health
+Sporulation
+56.41%˘4.6%
+HLA-08:01
+42%
+chronic organ dysfunctions
+intranasal
+three gRNA molecules
+2%
+cDNA
+3
+LiftOver resource
+Bacilli
+Institutional Animal Care and Use Committee
+73
+NucleoSpin®Gel and PCR Clean-up kit
+inhibits
+Wilcoxon and Kruskal Wallis tests
+5 × 10 5 cells/mL
+NSP1
+type II pneumocytes
+gaps in identifying and addressing emerging and re-emerging infections
+TGFBR2
+over half a century
+complement and coagulation
+one-way
+delay in generating an alarm
+Gpd2p and Lys21p
+mathematical and computational models
+templates for primary transcription
+percent cell viability versus compound concentration
+3
+interstitial
+Clone Manager Professional ver 9.11
+CD11b magnetic beads
+mutational pressure
+8.14 and 12.77 hours
+nonlipidated, ATG8/LC3-positive vesicles
+explanations
+prevent infection of the recipient
+Malignant
+Four
+COPD disease severity
+PSI-BLAST pre-profile processing
+spring from 2015 to 2018
+71
+E90R
+cerebral herniation
+40%
+Ankyrin G
+heteroduplex rejection
+Pharmacokinetic properties
+617-bp
+2 hr
+infection
+the same statistic
+transport medium
+a recombination event
+Bacterial sialidases
+Filamentous growth
+Contract poultry
+three
+2
+The majority
+4000
+distancing
+zetasizer
+American Type Culture Collection
+4 days
+antibody
+MicroRNA sequences
+amei
+age, gender and relationship
+active and inactive pairs
+47
+fresh frozen plasma
+11%
+20%
+viral gene expression
+silent rDNA repeats
+three
+Barriers to signal
+One or two
+Nucleotide coordinates
+virion associated host shuttoff
+A sill
+nine
+72 h
+694
+Table 4
+2-5 weeks after school reopened
+reaching an effective intracellular concentration
+4 °C
+plaque assay
+retinopathy of prematurity
+diagnosis of ARDS
+telazol/xylazine
+WHO, SPC, and the US Centers for Disease Control and Prevention
+outgrowth of a single bacterial lineage
+Blood samples
+CEACAM1
+Diagram
+three days
+active severe sepsis
+M1 58-66 CTL epitop
+1 mM to 30 M
+28
+Differing approaches
+pEGFP-N2
+between days 9-12
+6HB
+their meetings
+10 s
+Cyclic GMP
+multivariable-adjusted logistic regression
+replication of HCV
+multiple promoters
+time after trauma
+50%
+life-style factors
+60
+tracheal ring disruption
+protein synthesis and cell viability
+A Hopf bifurcation
+6
+monoculture
+reptilian
+0-4 and 5-14
+CVB3 infection
+infectious disease
+corticosteroid therapy
+chimeric
+F a = 14%
+four
+epidemics
+Supplementary Table 10
+1 μg/ml trypsin
+Seventy-four
+11,323
+Vectashield with DAPI
+mice infected with H1N1 pdm virus
+branching process theory
+12 weeks
+Corynebacteriaceae
+39
+PD-1positive cells
+o50%
+B cells
+auxin
+Prophylactic
+pessimism subscale
+autophagosome-independent LC3 organelles
+6
+firewall, database, Web server, a geographic information system server, and computation
+pulmonary damage and neutrophilic response
+general translation
+four
+62%
+incompetently managed allocation
+Incidence periodicity of the model
+F2, F3, F4, and F6
+L2 protrusion
+rAMPV-4/Fc BC
+symptom onset
+More complicated and realistic models
+M.tb disease
+one
+Amino acid conservation plots
+Spatial monitoring of health-facility data
+alanine
+northern blotting
+Individual susceptibility and infectivity
+Extracellular vesicles
+RL to be a potential safe and effective anti-RA agent
+while the patient is being mechanically ventilated
+VAP
+Apdm09
+sip53 and sip16
+1:20
+Influenza NS1
+characteristic neurological symptoms
+densitometric
+statistically insignificant
+8
+Transcriptional
+IL-2-secreting cells
+3D/4 cells
+discontinuous gradient of sucrose
+informed consent
+High transition probabilities
+Docking of the de novo compounds back to the receptor
+personal information
+oxygen inhalation and tranquilizers
+SELDI-TOF-MS
+GenBank
+p35S-TuMVCPGFP
+FAK-deficient cells
+abolishes its reactivity toward UbVME and ISG15VS
+Canada
+antiviral
+Acute respiratory distress syndrome
+vitamin D-binding protein
+9.4
+rating an overall body of evidence by the GRADE approach
+steatosis
+DNA tetrahedron structures
+50%
+Neisseria meningitidis
+vaccination, antiviral and social distancing
+CD86
+MKP-1 expression
+traditional phylogenetic methods
+To drastically reduce contaminants
+Minimizing the delay between admission and beginning antimicrobial treatment
+single cell FACS technique
+protein G Sepharose
+Histone fractions
+higher mortality rates
+cycloaddition reaction
+L points
+healthcare workers' confidence and commitment to professionalism
+2 or 3 d
+longer
+76%
+transmission between ferrets
+prevention and treatment of infectious diseases
+t ij
+FoldX
+different viruses
+CSF1R
+The apo c-Myc 370-409
+prevents cleavage of viral proteins required for replication
+memory T cells
+Pneumonia
+viruses
+complex pathology
+observational
+NKG2A
+Peaks
+metatranscriptomics
+Eight weeks
+15
+1X binding buffer
+between 15,000-11,000 years ago
+Excessive reactive oxygen species
+IRE1a
+15
+ketamine and xylazine
+biological concepts with bioinformatic analyses
+A virus in swine
+vault RNA
+analytical performance
+significant effect
+78%
+spatial resolution
+390 million
+natural selection
+IFN production
+Nine
+hemorrhagic fevers
+budgets
+Chromeo TM
+TB
+Instant Clue
+TR1.3
+Sydney
+Flow cytometry and cell sorting technologies
+PLA
+cloacal shedding
+microbial infections
+Supernatants
+CBER core facility
+mosquito brain cells
+pharmacophore
+significant
+Algorithms
+Culex flavivirus
+Nm and typable Hi
+IPAC
+10%
+Methods
+amino-ionized
+100 µL per well
+8 M urea denaturation
+lower
+seed
+sodium borohydride/chloranil-based assay
+Cirrhosis
+actindependent
+cysteine analyte
+The abundance of alpha helices
+protease inhibitors
+strains
+room temperature
+hepatitis C
+pneumonia
+98%
+a trusting relationship with the local providers
+39
+to replace their names
+GO and REACTOME
+Infection of hamsters and mice
+the required tertiary structure
+eight segments of single-stranded RNA
+PCR
+type 1 inflammatory responses
+disruption of the VP24-NP interaction
+rosiglitazone
+NetMHCIIpan 3.1 server 40
+32
+IEM
+Type II secretory phospholipases A2
+Image Lab 5.2.1
+adequate psychometric properties
+the SEM for duplicate PCRs
+Infection
+species-specific lentiviral restriction factors
+infected cells secreting Gluc
+six
+negligible
+both the N-and C-terminus
+Staphylococci and streptococci
+HIV-specific influenza incidence rates
+5
+780
+26
+less well defined
+Avian pathogenic Escherichia coli
+Angiosperms
+6
+DNase-/RNase-free water
+Trace Amine Associated Receptor 1
+connector loop
+M1 expression
+type I-IFN signaling
+a peptide segment of HCK
+Georgia
+19
+immuno-electron
+standardizing results
+precursor cleavage and the detection of the processed GP2 subunit
+tumor
+N termini of the peptides
+Ingenuity Pathways Analysis
+Table 4
+CVB3 receptor expression
+low immunogenicity of cancer antigens
+12%
+cell number
+PB1 T123A
+Dr. Paul Ehrlich
+Phylogenetic analysis
+50 μl
+5
+132
+26.2
+One-quarter
+five
+staff shortages
+DC-SIGNR int2-180A variant
+one year
+plasmids for DI-244 production
+retinoic acid receptor responder protein TIG1
+3% H 2 O 2 in methanol
+860
+SCSDVs
+diffuse densities
+an interview guide
+MDA5
+May through July
+oxidative
+altered CSNK1E mRNA levels
+20%
+sIgA
+two asterisks
+3.7%
+15
+inguinal LN
+Nested PCR methods
+false-negative results
+mild
+environmental measures
+Supernatants
+100,000
+GEM particles
+genetic algorithm
+Fluo-3 AM
+target antibiotics
+Eupatorium adenophorum
+an RNA ligase
+monoclonal B cells
+93
+four
+Mortality
+Nigeria 75/1
+staging workup
+Further investigation
+CCL2
+mid-April
+6 h
+0.5-1.5 mm
+48
+EVs
+126
+lumbar
+1.7.1
+Renal replacement therapy
+MHV-3
+virus particles with immature genomes
+Western blotting
+rural
+68
+Second-messenger-regulated kinases
+100%
+outcome misclassification
+aged mice
+1-81
+greater than 2
+six
+Parvoviruses
+Bioworks 3.3
+the number of publications
+embryonic stem cells
+NBT/BCIP system
+2000
+Grade B
+HuSkMc
+delayed administration of oseltamivir prophylaxis
+Gaithersburg, MD
+FACS Aria Ill Cell Sorter
+EFV
+677
+Favipiravir
+B iliary atresia
+Mating-compatible strains
+microglia
+4%
+Private data
+SeqPrep
+1.4%
+T cells
+31 out of 38
+34/94
+TRAF, BTrCP, JAK3 and TRADD proteins
+serum free growth medium
+CAP proteins
+Targeting papain family cysteine proteases
+peptide's flexibility
+Respiratory infections
+patients and GPs
+human health resources
+Creative Commons Attribution License
+10%
+sialic acid receptors
+54%
+2011
+Case fatality rate
+Neuro Probe ChemoTx W Disposable Chemotaxis system
+NO
+influenza virus-mediated cytopathic effects
+endodomain
+Michael Weekes
+78.3%
+Meyer's hematoxylin
+glucosylceramide
+randomly
+dynein and kinesin motors
+47
+tunnel-like
+chronic obstructive pulmonary disease
+synthesize
+increased
+intraspecies
+Blood samples
+the appropriate halide
+the brain
+Lymphocytes
+2622
+IL8 and TNF
+isoxazolidines trans-11/cis-11
+epithelial cells of various human organs
+Hep2 cells or gradient purified RSV particles
+contamination of tissue specimens and experimental tools
+agents share information about risks and potential protective actions
+R 0
+coactivators
+1% agarose gels
+25-50%
+in vitro digestion of target genes
+570
+the backbones differ
+effective vaccine peptides
+pig density and climate
+Ͼ10%
+peritoneal cavity
+human travelling behaviour
+41
+ligase enzymatic activity
+Homotypic fusion of ER tubules
+MS B cells
+Appropriate nutrition delivery
+250,000-500,000
+capsid
+subarachnoidal hemorrhage
+13.4%
+6 ml/kg
+flexibility
+SPIDER software
+singlet oxygen and hydrogen peroxide
+Docking analysis
+the GC
+R 0
+25
+virus-infected
+MF
+Haemophilus influenzae
+nine
+periodic confinement
+Five
+pUC19 vector
+disease severity
+complex health challenges
+TALON affinity resin
+crAssphage
+350
+bivalves
+bias
+real-time quantitative polymerase chain-reaction
+constructive
+All authors
+living related liver transplant recipients
+mediates the membrane fusion reaction
+Variable regions and stalk of E2
+two
+100
+antiviral efficacy, social distancing conformance, and CDC response delay
+Lse
+11
+33%
+Standard deviations
+2% PTA
+50 copies/μL
+efficacy of these antisense molecules
+IRF7 deficiency and GATA2 deficiency
+UV spectroscopy
+promoter activity
+Idu-Flight
+Antibody-based pharmaceuticals
+Canada, Saudi Arabia, Mexico, Argentina Australia/ New Zealand
+Statistical
+18%
+Symptomatic controls
+2004
+poor prognosis
+23%
+The exposed period
+recombinant CNPV
+6 months
+80%
+Bigman
+Influenza
+resistance-associated polymorphisms
+cDNA
+MEDI8852
+limited
+H7 or H10N7
+hydrogen peroxide/methanol
+two
+Mann-Whitney U test
+9.5%
+quantifiable
+0.6 mM spermidine
+TBP, PPIA, and B2M
+6 days
+deciduous
+FACS was used to sort the monoclonal beads
+numerical integrator
+1AE1 to 3AE3
+serum ACE2 activities
+retroviral infections
+M2 agarose
+7.29
+Thrombocytopenia
+suspension viscosity
+a functional ESCRT pathway
+Heather Höpfl
+Mahidol University
+1918
+five
+Zhang Zhongjing
+24 h
+dynamic programming
+different community resources
+MEDLINE and LILACS
+2
+consumer health vocabulary
+BioEdit
+QIAGEN RNeasy Mini Kit
+4000 L/h
+Coxsackie virus 3C protease
+transmission capacity
+viability
+Infectious Disease Act
+cold-blood
+mannose-binding CLRs
+Asia
+tRNA scaffold-encoding region
+Dimethyl pimelimidate
+distance metric
+Validation of repeatability
+hydrophobic cleft
+the endothelium
+AirPath
+non-transformed
+Pearson correlation coefficient
+brain lysates
+increased levels of IFN1 and cytokines
+capability
+acute and chronic events
+pulmonary mechanics variables
+the antisense sequence
+Known antigenic proteins
+Self-Assembling Protein Nanoparticles
+88.3%
+existing ORFs
+6 × lysis buffer
+hard-shell clams and eastern oysters
+80 nm
+in vitro or in vivo
+0.026
+Soricomorpha hosts
+20%
+two
+R 0
+20%
+human well being, liberty, equality, and our democratic way of life
+200 µl/well casein buffer
+intact nucleoli
+Protein Preparation Wizard
+cell debris
+organisations faced unique ethical challenges when dealing with a public health crisis
+a panel of PA-oligosaccharides
+RF model
+C34
+2 µl
+7.36
+spermatogonia
+corrupt
+Criticism
+Statistical
+Appropriate vaccination programs
+adipose-derived stem cells
+The pool of internal β1 integrins
+Molecular Imager FX and Quantity One software
+MM
+tubular epithelial cells
+bleach and PX-UV disinfection
+169
+Non-recommended behavior
+Phi29 DNA polymerase
+antigen receptors and MHC molecules of all vertebrate species
+Protective flow redistribution and hypersecretion of mucus
+PaCO 2
+fungal and viral agents
+maternal H1N1 influenza immunization
+Fig 3K
+intramolecular
+previously published studies
+CD4 and CD8
+SHAKE
+12.66%
+no further enhancement
+Fluorescence imaging
+5400
+many other molecular biology data repositories
+protective
+caspase-1 activation
+C-type
+August
+90-98%
+diminished transmission
+DD > 0°C and clusters
+LRGVAPL
+24 h
+12
+pro-inflammatory cytokines
+dsRNA
+neurogenesis, cancer and c-secretase biology
+75
+RdRp
+unique substitution
+25 mM
+δ-crystallin
+the substituents of the molecule
+pH
+restricts HPV transcription and vDNA replication
+live pneumococcus
+antigen specific B cells
+Shannon's information entropy
+MZP
+chi-square or Fisher's exact test
+Label free proteomics
+uncomplicated sequence typing schemes
+GenBank
+PD-1 blockade
+donor splice site
+0.4 to 64 years
+Determining the appropriate taxonomic level
+4%
+supplementary material
+enzymatic degradation
+school closure policy
+49
+35%
+1.61
+ADAM17-dependent spatial proximity
+guinea pigs
+7.06 billion
+MVA-GP
+defective endosomal escape
+swine
+Wnt/β-catenin
+HGF/c-Met signaling
+WorldPop-InternalMigration-v1 code 74
+Annexin V-PE/7-AAD dual staining
+Guangdong
+Toll-like receptor 7 and retinoic acid inducible gene 1
+treatment
+Neutrophil infiltration to the alveolar space
+10.3390/ijms15034915
+BBP
+quality control take-over
+1212
+it was most effective in vitro
+two
+IRF8 expression
+Kaplan-Meier curve
+Control of pandemic influenza
+cGAMP
+Length of initial hospital stay
+6
+20 min
+Geographical variation
+sequence homology
+automorphism-driven lumping
+25 min
+MSCs
+B-cell proliferation
+15 to 60 years
+Computer Aided Similarity Evaluation System software
+lack of adequately trained human resources
+96%
+Six
+1940s
+unmet medical needs
+cigarette smoke
+the authors
+further research
+The run
+Compartmentalization
+reducing uncertainty through research
+neurotropic flavivirus
+V
+rodents and mosquitoes
+Simvastatin
+spots containing low signal or poor signal uniformity
+16
+1021
+search engine data
+cytokines and chemokines
+12 628
+normal mRNA homeostasis
+7
+30 min
+maximum likelihood phylogenetic trees
+Raw data of fastq format
+40 mM citrate buffer
+Junta de Andalucía
+five
+10 6 and 10 5
+BioProject/BioSample/Short Read Archive
+negative
+mKate2 expression
+3D
+123
+antibiotic resistance
+diagnostic costs
+1 h
+500mg/ml G418 and 1 mg/ml puromycin
+Viruses
+University of Bologna and the Centre Hospitalier Universitaire
+2.6 × 10 5 cells
+process medication preparation and dispensing
+acute respiratory diseases
+RNeasy kit
+Macrophages
+Benjamini-Hochberg Multiple Testing correction
+Anopheles mosquito
+pre-weaning development stages
+United States Health and Human Services
+Blood samples
+2019-10-14
+mutation pressure
+August 2002
+0.00678
+19
+potential outbreaks
+SYBR Safe and Coomassie Brilliant Blue
+43
+maternal tetanus vaccination
+Estimating the time lag between environmental/climatic variables and infections
+A/PR8 influenza virus or lentivirus
+57˚C
+four
+FasL
+Pepinfo
+four
+FimA
+24 h
+higher-order epistasis
+MSP-1
+twice a day
+T-cell
+Dr. Maurizio Crestani
+virus not detected
+Vietnam
+98,500
+secretory pathway components
+an increase in antibody levels
+dozens of hours
+short
+viral contents
+Further information on research design
+MKP-1 expression
+cleavage
+Seven
+eight
+CD4 binding site antibodies
+Abundant
+Ab studies
+reduced viral replication, spreading, and pathogenesis
+Veno-venous extracorporeal membrane oxygenation
+10%
+enhance the B-and T-cell responses
+significant
+CIITA
+the front end, the turning point, and the back end
+Canada
+malarial
+Seropositivity
+3 to 7%
+chest X-rays or CT
+steroid pulse therapy
+9
+DDX3 and Rev
+ecological impacts
+2008
+release of TNF-α
+discretization and solver properties
+BLAST-P and OrthoMCL
+10,616
+α2-3-linked
+an AG bulge
+13
+BCR signalling
+90%
+A location
+IP-10 and MCP-1
+BCA method
+crystallography
+hematoxylin and eosin
+Fundamental changes to the drug development pipeline
+Brazil
+12
+40 min at 32uC
+Fluoromount-G ®
+~48hrs
+Minipreps
+99-09
+flow cytometry
+Convergence at most or all K-values
+CDV-F protein
+study sample size
+Three weeks
+ImageJ
+cold temperatures and low relative humidity
+inducible proteasome genes
+47S rRNA
+sorting and packaging signals
+0.99
+almost a century
+aa substitutions per site
+Cell debris
+PARP inhibitor
+energy dissipation
+G astroenteritis
+Nikon TE-2000 inverted microscope
+MDA5
+the corresponding author
+kinase
+chloroquine dose
+gender
+Ethical Review Committee of Aga Khan University Hospital
+16 months
+analytical results on the efficacy of isolation and quarantine
+144 months
+isotope-labelling
+different analytical approaches
+JC
+Multi-item measures
+proliferation of OPC
+interactions between primers, template and polymerase
+binds to the stalk region of the HA molecule identifying epitope-1
+Lower airway disease
+Pseudomonas aeruginosa
+antifibrogenetic
+monoclonal antibodies
+mRNA thermal stability
+2011
+edges
+reptiles, amphibians, and fish
+chewing problems
+biotinylated goat-anti-rabbit IgG
+THF
+Four
+Group 3
+a reverse Watson-Crick geometry or a trans arrangement
+5% to 10%
+inhibition of Ras signaling
+epidemic vector mosquitoes
+98%
+V1a receptors
+adequate hospital quality and volume
+continuous quality improvement interventions
+Hydrogen peroxide
+perceived good health status
+Peristaltic pump
+Pegylated interferon-alpha 2a
+phagosome maturation
+transmission and recovery rate uncertainties
+promiscuous
+cell counts
+when at least 5 % of reads displayed a mutation for that nucleotide
+pentamidine-related analogues
+8.5%
+secreted proteins
+Dravet syndrome
+4 h
+between nine and 42 deaths per million HCP
+HPVs
+1974
+SSIs control
+the pseudoknot
+UXT, RPS23, RPL4 and RPS9
+3-fold
+higher
+immunosuppressed
+48-hour
+15
+60%
+CXCL11
+two
+GENIE3
+flock-level mortality data and statistical back-calculation methods
+monosaccharide fucose
+RNAse/DNAse-free water
+data from other farms and systems
+phylogenetic implications and interpretations
+accurate diagnosis
+191
+DC-SIGN/R-mediated
+Carter
+Targeting of myeloid cells
+miRNAs
+TMEM119
+clumping of human and rabbit platelets
+NLR and PLR
+Three
+raising the ratio of CD4 + /CD8 + T cells
+pneumonia
+Google
+50
+epidermal and dermal cells
+Jagged1
+2 weeks
+60 kDa
+U.S. Defense Advanced Research Projects Agency
+peridomestic settings
+handwashing behaviors
+FucA1
+public health interventions
+weighted histogram analysis method 49
+ROCT
+political pressure
+reproduction numbers
+gene knockouts and developmental models
+flow cytometry
+antibodyrelated auto-immune reactions
+fibrogenic
+Table A2
+GraphPad Prism
+1 ml of Cal/07 inoculum
+CTLs
+Short Oligonucleotide Analysis Package
+The angle of beating
+1.33
+specificity and consistent amplification of the target region
+1,2166178 or 1,364636 sfc/ million
+Antipsychotics
+channels proteins down more favorable folding pathways
+190 to 260 nm
+allele effects plots
+exposure to traumatic events
+ensuring interoperability
+Error bars and statistics
+decomposition method
+competition under elevated mutation rates
+enhances growth of cells of other animal species
+Nonspecific binding
+18
+NeuNAc
+sequence specific capture of coding RNA
+recombination events
+pGEX-4t-1
+Hong Kong
+55%
+lung mRNA silencing
+LC3-II/GAPDH ratio
+Newcastle disease
+optimal pH and optimal temperature
+Th ese limitations
+one average impact of disasters on school functioning
+RIG-I
+Brefeldin A
+critical
+Image J Software
+news articles related to infectious diseases
+risk assessments and treatments
+Ribo-zero ™ rRNA Removal Kit
+HSV-1
+1.6 to 77.4%
+Identification of the bioactive conformation
+following a chemokine gradient
+IPC
+diagnostic decisions
+C39endo
+Cell^D imaging software
+500
+CC
+clays and carbonate
+monoclonal B cells
+DMOG
+the authors
+Eugene Koonin
+6.7%
+purposive quota sampling
+C. l. familiaris
+social life
+proteomics
+four
+a return
+zymosan fluorescent beads
+90%
+21.47
+pSORTb v 3.0
+miR-124-1
+Genewix
+southern Brazil
+IFN signaling and stress granules
+host jumping
+1.41-fold
+50-100 million
+improved editing
+aggression
+catalytic redox factor
+feature learning and classification
+BLAST
+IL-4 and TGF-β
+five
+520
+double-stranded viral RNA
+hematoxylin-eosin
+episome replication, segregation and persistence of viral genome
+4',6diamidino-2-phenylindole
+7820 pg/ml
+12 years
+15 to 20
+NS3 viral proteins
+Dr. Manuel Varas-Godoy
+Parasite biomass
+documenting each part of the pathogen's niche
+cross-correlation between points from different grids
+SOFA score and non-HIV patients
+strongyloidiasis
+relevant capacities
+Exosomes
+development and differentiation
+57%
+vitamin D 3
+Phred/Phrap/Consed software
+PP2A's scaffolding B subunit
+months
+related functioning changes
+Google Scholar
+ISG15
+loci
+25-µl aliquots of thawed cell lysate
+4000 L/h
+enabling discussion with family
+sucrose banding
+counselling
+immunoblotting assay
+oNP-β-Gal
+ORF29a and ORF65
+statistical differences in fold changes among groups
+Early growth response gene-1
+fibro
+b-tubulin + cells
+20.5%
+increased hybridization above the 23S RNA band
+CD154
+50
+biogenesis
+the tide of decolonisation
+Partial least squares
+hypoxia
+poly or poly
+general practitioners or medical laboratories
+reliability of parameter estimates
+CD4BS, V2 glycans and V3 glycan
+acrosomal region
+messenger RNA
+PNA/PMO internalization peptides
+Personal Arrayer 16
+34
+metalloproteases
+Movement restriction policies
+biological functions
+PKR
+Beclin-1
+six months
+soluble expression
+18 m time-point
+phylogeographic
+D'Agostino and Pearson omnibus normality test
+three
+Ab binding sites
+an MOI of 33
+iterative
+two
+Cauliflower mosaic virus
+augmented host response
+CAM
+days 3 and 5 postinfection
+current models of co-translational protein folding
+Fzd receptors and LRP coreceptors
+methyl 4,5-DCQA
+translation
+excessive or inappropriate inflammation
+commercialized
+KB
+56
+5
+evaluating intrahost CHIKV evolution
+rescued the reduced cell adhesion and migration phenotype
+harmful and fatal
+right upper limb
+US$1 billion
+CPE
+predictors of in-hospital mortality
+GLMM and BRT
+Lys-and Gln-tRNAs
+the role of NETs and extracellular DNA in disease
+PSG enrichments
+peptide crossreactivity
+Biocompatibility
+s.d. from 3 independent experiments
+sarcopenia
+MEGA 2.1
+Chymotrypsin
+XAMPP
+Blot
+the pseudoknot
+9
+Germany
+156
+expression patterns of genes
+upregulation of ISG expression
+2 x 10 8 cells of H37Ra
+nonanchor residues
+LIVE/DEAD Aqua Dead Cell Stain Kit
+detection of circulation
+antibody selection
+VP40 expression
+NORSE
+Elevation
+three
+increased viral burden
+1997
+0.5%
+Toxicity
+thirteen years
+formaldehyde
+Coalition for Epidemic Preparedness Innovations
+Flag-Mage-g1
+monocyte-derived DCs
+ADAM10
+PD-1 + NK and T cells
+10 μl of streptavidin beads
+Information on the general HIS approach
+naïve T cells
+2009
+CC IFN-l3
+infectious and inflammatory agents or host-derived factors
+Kibale red colobus
+101
+TRAF2
+Zinc-finger antiviral protein
+four
+astrogenesis
+four
+PfCSP
+the model's goodness-of-fit
+one of the above-mentioned operations
+dye uptake assay
+Flow cytometric
+Global Change Newsletter
+reverse genetics
+−100 V
+viral cores
+synchronized intermittent mandatory ventilation
+heat-based pretreatment
+MGH
+week 39
+communication and synchronization overheads
+Viruses
+Flies
+NP-450G
+VP1
+66
+an S-shaped melting curve
+FHV
+a gene involved in immune responses
+VR2332
+nonneutralizable viruses
+ignoring contact structure
+47
+similar results
+Aminoacylated
+0.0480
+0.447
+PLGA
+cancer, lung cancer therapy and the presence of comorbid disease
+A specific immune response
+inhibitory
+un-infected cells
+dramatic
+pandemic influenza A virus
+4 weeks
+Rab6
+60S
+500 µL of 10% Acetic acid
+CAI
+ubiquitination
+to give early visibility of the article
+69%
+the lowest sum of collapse and overdistension percentages
+NS1
+quality-control
+Bayesian formalism
+mAb 447-52D
+the FDA
+no more than four naturally occurring bases in a row
+Table 1
+D
+regulation of TGF-β1 expression
+two
+one week
+Understanding the impact of transmission intensity on acquired immunity
+SFTPA and AQP5
+individual mandatory tests and the herd screening tests
+dependent variable
+some cut-off value
+4846
+The elicitation and regulation of molecular events
+in situ evolution
+HNE
+LACV tissue tropism
+glycosilation
+627,000
+viral mRNA
+hematoxylin and eosin
+DNA double-strand breaks
+high-risk clusters
+follow-up and assessment of all influenza cases who applied to health care centers
+L
+PMN activation
+licorice
+x i
+10
+all highrisk and intermediate-risk patients
+10%
+drug development
+diffuse lung disease
+60
+HRP-conjugated streptavidin
+Me2NH·BH3 and 1
+ET antioxidant capacity
+drug binding pocket
+Vpu 1-52
+70%
+50 µg/mL
+discernible inhibition or spurious actuation
+Amplification curves and good linear relationship
+metronidazole
+22.3 mcg/l
+receptor-mediated
+HHV-4 infection
+linear regression
+by issuing a private simulation identifier key upon submission
+identification errors
+Sequence information
+the best and most upto-date tools
+Checklists
+investigation of why infectious pathogens are omitted from disease surveillance and impact quantification work
+enterovirus 71 viral particle assembly
+glycinin promoter primer
+20%
+colchicine
+higher
+sex and LOS variables
+processing of viral mRNAs
+4 L/min
+Bronchopneumonia patterns
+we did not assess stroke outcome in the long term
+293T cells
+eight hours
+nonsense-mediated decay
+16
+lobar consolidation of the lower lobes and evidence of fibrosis
+ΔΔC T method
+gonorrhea
+enhances HIV-1 replication
+X-deficient pHBV1.3D
+0.01%
+14 days
+Walker A and Walker B motifs
+1235
+tetherin
+viral infection
+Seroconversion in animals
+highly specific target recognition and great deal of target binding affinity
+adenogenesis
+0.05% Triton X-100
+different host susceptibility
+contralateral
+Accuracy of SP-D measurements
+red
+susceptibility to PRRSV infection
+10 %
+6.2 months
+25%
+60
+1092
+positively charged
+sputum homogenization before nucleic acid extraction
+Inequality A1-2
+regulation of Akr1e1 expression
+B cell receptor
+A set of proteins or specific self-assembled chemical cells
+120-aa peptide product
+transnational
+1574
+a genetic variant that introduces a premature stop codon
+Primer for renalase gene
+secondary bacterial pneumonia
+TRIM-Away
+viral persistence
+compromise of various structures ranging from the cornea to the occipital cortex
+Ginseng and Salviae
+Linear Mixed Model
+panhandle structure
+all the components in the microenvironment of LAPC after IRE therapy
+The neutrality plot
+Accuracy
+B cells
+Primers and probes
+great changes in the demographic composition of the Chinese population
+LSV2
+74%
+Total RNA
+Saccharomyces cerevisiae Ski2
+very young and elderly
+r B m
+PMA-mediated PKR degradation
+nucleotide insertion differences between SVCV strains
+light microscopy
+Specific target amplification
+non-conservative amino acid mutations
+ACE inhibitors and ANG II receptor blockers
+days to weaning from admission to the intensive care unit
+PK15 porcine
+carbohydrate epitopes
+an investigation of ECoV in Ireland
+Western blot
+peripheral, multifocal, and diff use
+GSE115571
+YWHAZ and GAPDH
+5%
+viral polymerase
+in response to current events
+Maxim RT premix kit
+the outcome of the MRP changes significantly
+XD
+Sandia Biotech
+5 hours
+Written informed consent
+7 days
+request
+AlkB vs. RdRp
+five
+hemagglutinin
+recombination
+6-8 h post infection
+0.13 to 16
+mycobacterial lysis
+one week
+HIV-1 envelope protein
+mean internal over external branch lengths
+Nigeria 75/ 1
+TNFSF10, HDAC4 and HDAC5
+81.2%
+inaccurate
+bootstrap values
+immunochemical nephelometry
+12%
+treatment with the Mirasol System
+Genotypes at every variant within the IFITM3 gene
+36%
+75 mg
+definitive radiographic evidence of vascular ischemic pathology
+Cesium chloride density gradient ultracentrifugation
+human receptor crystallographic data
+IL-6
+Fluid balance
+Ͻ0.05
+Communication
+Arteriography
+control
+disulfide oxidoreductase activity of Shigella flexneri
+four
+D233
+swine and avian species
+30-60 minutes
+FKBP-LID tag
+three
+7 d
+wild species
+inflammatory cytokines
+analyze more closely their origin and biochemical properties
+Stamen Design
+elastase
+anticancer
+one
+Traf1
+14/3/2020
+six
+IFITM3
+MRT-PCR assay
+zero
+type I and type II cells
+Pyrazoles
+cc-by
+eighteen
+cyclooxygenase-1
+identification of appropriate vaccines
+one aliquot
+quinoline antimalarials
+Protein size, nature of the SP and presence of a propeptide
+1984
+selective constraint
+TMV RNA
+three
+between outbreaks
+20
+SOCS-3 mRNA
+NS1 protein
+Uniformly modified ASOs
+RV-C
+cell proliferation
+Fever
+adequate to keep blood pressure stable
+identification of oncogenic mutations in lung cancer
+recognize
+pig density and climate seasonality
+The integrity of the described constructs
+25
+intervals of time after each study injection
+95 %N MP with 5% aqueous oxalic acid
+Plastic-shafted polyester-tipped swabs
+miR-181b mimics and inhibitors
+further population structuring
+62.4%
+Table 5
+Eleven
+eM2 peptide
+Bovine respiratory syncytial virus
+Twenty-five
+through a time-varying contact parameter
+Gastrointestinal symptoms
+two
+28 ± 8 nM
+all the national immunization scheduled vaccines
+ONC
+Resources and infrastructure
+by email
+interneuronal transport
+using the codons with the highest codon decoding rates
+The Simplified Acute Physiology Score 3
+one
+round
+6 days
+crucial
+174
+ssc-miR-30d_R-1 expression
+NIRVS formation
+elucidated
+15-19 months
+103.7 Ϯ 21.2%
+0.1
+cervical cancer and anogenital, head and neck tumors
+negative reaction mixture
+ethnic minorities
+89%
+X
+testes, thalamus, thyroids and parathyroids
+pulmonary hypertension and persistent digital ischemia
+bifurcation of an ancestral sequence
+breathing is continuous
+its carrier protein
+EC 50
+similar objects are more likely to be related to some other objects
+filling a 4-by-N table of optimal scores
+2003
+R ExtraNos j
+dynamitin
+small horizontal lines
+delayed public health response
+False discovery rate
+more than twice as long
+TCM theory
+The probability of a type 1 error
+ABI Prism 7500 sequence detection system
+spore quantities
+4 weeks postimmunization
+unrestricted use, distribution, and reproduction in any medium
+PKA activity
+3-4 ml/cm H 2 O
+sRNAs
+Crisis capacity
+provided patients with study information materials
+RNA recruitment assay
+GLP-2-immunoreactive L cells
+spline correlogram estimation
+legislation
+S57 in AP1/AP2/AP3
+3
+empty particles
+Calcium
+mercurial insensitive water channel
+FIO 2
+NK cells
+Nucleomegaly
+cDNA synthesis
+anti-inflammatory
+10 µm
+9 amino acids long
+Phylogenetic
+Multiple clones
+depression and anxiety
+Plus-strand RNA viruses
+neutrophil microbial killing ability
+the supernatant
+Vaccines
+Subclinical infections
+Nearly all
+Lys48-linkage specificity of yNpl4
+six
+synchronized intermittent mandatory ventilation
+Albany model
+Spleens, mesenteric lymph nodes, and Peyer's patches
+RBV
+CDC
+4,797
+antitrypanocidal drugs
+Spontaneous breathing
+Nonspecific rabbit polyclonal antibody
+Hyperphage
+2004
+4% paraformaldehyde or formaldehyde
+LAIV
+intravenously deliver DC in vivo
+Purified GG-modified peptides
+Data Safety Monitoring Board / Safety Monitoring Committee
+DNA vaccines
+86%
+SJS/TEN
+Early and rapid reduction of HBV DNA
+between 24 and 36 hours of age
+53.5%
+biologic
+Computer-aided analyses
+high viral burden
+10% SDS-polyacrylamide gels
+The timing of exon skipping treatment
+three
+epidemiology, diagnosis and, mainly, infection control of VAP
+22%
+virus immune evasion of a Th2 and humoral response
+QIAampMinElute Virus Spin kit
+codon usage variation and nucleotide composition
+isolates
+cell proliferation and gene expression
+25%
+designing and analyzing polymerase chain reaction primers
+Cell type, assay endpoint, and the virus input
+Coronaviridae
+during cap-mediated translation inhibition
+malaria drug development
+T20
+7.41
+440 amino acids long
+10%
+The investigator
+T 0
+infected hosts
+two
+CHIKV-LR
+mosaicity
+Washington, DC
+national security
+individual based model
+VM patients
+Henk Buck
+IL-10
+Culicoides
+Attachment of polyethylene glycol polymer
+infection
+0.8 mL/min
+oxidative stress
+I nterferon
+eEF1A
+gluconeogenesis and glycolysis I
+mammals, arthropods, birds, and the environment
+protease degradation
+Forty-five
+Cellular mRNA
+Liver failure
+three
+social amoebas
+cell fate and proliferation
+four
+two
+concentration
+Thematic
+Cxcl5
+Two
+Adobe Photoshop
+detecting pollutants in our daily lives
+12
+filtration performance
+Post-therapeutics or drugs
+case reports, serological surveys or genetic studies
+daily
+very high-dimensional epidemic models
+impairments to physiological functioning
+24 November 2013
+15%
+EDII-104, -329, -331, and -389
+bat longevity
+ezrin and MARCKS protein
+1:5
+Krugar Park
+sixteen
+4%
+20 min
+luciferase activity
+acquired depth information
+hOgg1-6pcDNA3.1
+32%
+maximize its power to detect variants
+human and bovine noroviruses
+T7 RNA polymerase
+inhibitory activity
+11
+searching for disease-specific search queries
+ventilation had improved
+HCV transmission
+Loss-of-function mutations in BTK
+IFNreceptors
+The size of the amplicon
+RPTPσ
+extreme care
+ASH, RON, EVS, HYL and DJ
+Synergy or additive effects
+continuous administration of drugs
+50
+2009
+winter
+monobasic
+CD13 KO
+unacceptable
+90 min
+LRTs
+HDI status
+self from non-self molecules
+GM-CSF
+astrocytes
+two-fold
+sinus tachycardia with no significant ST/T wave changes
+25
+Streptococcus pyogenes
+1918
+Further studies
+0.941
+peritoneal cavity
+infectious agents
+inflammatory
+de-identified form
+IFN-λ4 protein
+Cryoelectron
+16
+TRIZOL
+13 cups
+EV protein release
+chi-square or Fisher exact test
+CARTPT
+70-100%
+site-specific inference of positive selection
+10% formalin
+suicidal behaviours
+0.46 times lower
+a partial Z region and 2 predicted IGR hairpins
+biological
+IRES
+circulating influenza strains
+voltage-activated chloride ion channel
+Between 3-5 million
+The patients' clinical and demographic data
+CC IFN-l3
+PEMV-2
+600,000
+46 dpv
+positive-sense
+IL-22
+peracetic acid
+inflammatory cell infiltration and haemorrhage
+S-palmitoylated
+viral polymerase NS5B
+MLD 50 values
+LPS-dependent lung injury and inflammation
+31
+activation of the proteins involved in LD formation
+divergent pathways
+supernatants
+FhGST-S1
+tryptophan
+Protein lysates
+The funder
+predictive validity
+convalescence
+moist and sunny
+central conserved domain
+13/47
+contact network patterns
+toltrazuril
+EPCR and thrombomodulin expression
+daily
+mechanistic
+70%
+addressing the unmet need for a human RVF vaccine
+G418
+126
+covariates
+GlaxoSmithKline Biologicals SA
+.2
+SCR3/4 with the virus surface
+eNOS and Ras
+novel approaches
+ferrostatin-1
+Zidovudine
+MacMahon
+Plasmodium ovale mono-infection of a human subject
+76
+500 to 21 bp
+it should be less sensitive to the mutations that cause resistance to protease inhibitors
+NPC1 overexpression
+Raina MacIntyre
+206
+Nanopore MinION R9
+increased NSE and reduced GFAP expression
+adenoassociated virus
+TNF-a responses
+endoytosis
+Prostaglandin F 2α
+Separate logistic regression models
+Human infection with H7N9
+Directionality theory
+13
+calreticulin, HSP and high mobility group box-1
+48
+Streptococcus aureus and Candida albicans
+NKT cells
+Saccharomyces cerevisiae strain BY4741
+RNAlater
+80
+western blotting
+action
+>25%
+CTLA4
+Aliquots
+95%
+R 0
+H5N1
+b
+R5
+a negative regulator
+one of the long noncoding RNAs
+outbreak and epidemic information
+thirteen
+length of stay <8 days
+diversity in parasite lineages
+Forty-nine
+environmental contamination
+intranasal challenge
+70%-90%
+IEX-1L
+transcriptional
+Urticaria
+19
+on hospital admission
+drugs or fusion proteins
+glioma cell surface receptor alpha 6 beta 1 integrin
+7.30 to 7.45
+gene expression analysis
+lipopeptide
+Proteins with glycosaminoglycan side chains
+endosomes 4 GIM4
+communities taken during a shift from sulfate to Fe-reducing conditions
+24 hours
+a transport mechanism for effective movement of messages
+a modifed morphology
+robust
+immobilization with correct orientation of biological material
+N-linked sugar
+5%
+modern standard education model
+decreased viral loads
+Immunophilins
+15%
+Peking University Ethnics Committee
+annually
+15%
+flaviviruses, influenza, and BYDV
+CMV-negative or autologous units
+Viral DNA Extraction Kit
+ZIKV replication
+>24,000
+four
+5 and 10
+inflammatory response and deregulated cytokine production
+10 mL
+common tests
+to capture the actual transmission of influenza
+24
+Recombinant human PDGF-CC Protein
+0.5%
+Programmed Death receptor
+nine
+smallpox
+N-Octadecyl-D-mannosylamine
+C ancer
+4.7-fold higher
+suppress the host immune responses
+IL-33
+ISG15
+61%
+aptamer-based
+cytolytic
+1-3 week
+Neuraminidase activity
+density gradient
+stimulated with the two peptides
+23 weeks
+generalized-growth model
+D C
+aligning the peptide substrate
+Tissue Lyser
+20
+viral mRNA transcription
+structural plasticity
+40%
+anti-paramyxovirus activity
+0.05-0.20 mM
+relation to each other
+nephropathogenic strain of infectious bronchitis virus
+Torque teno virus
+TDP-43 or FUS
+Pathogens
+Staphylococcus aureus
+LLPS
+I=76,512 bits
+infectivity
+Oligoadenylate synthetases
+gemcitabine
+51
+Ten
+Each incubation sample and the corresponding control
+a different HCV protein
+specific primers
+hyaluronic acid capsule
+Azadirachtin
+The specificity of the~65-kDa band
+iNOS
+ectopic c-Fos
+PSI
+20%
+Secondary genome sequence comparisons and phylogenetic analyses
+fever and myalgia
+livers and spleens
+passive
+simulation optimization problem
+PowerPoint
+once the exogenous gene can be successfully transferred to the embryos
+MG-C and PB
+sACE2 activity
+1,231
+antiviral
+Information about the ventilation system settings and restaurant size
+cutaneous reactions
+pPBAC plasmid
+lower respiratory tract symptoms and possibly diarrhea
+Cistanche deserticola Y. C. Ma
+11
+Proposition A2
+two positive control samples
+6 h
+2014
+Identification of drug-target interactions
+15
+QuantityOne
+CD8 T cells
+14%
+zoonoses
+204
+selective
+Chi-square test
+FRC
+Bacterial and viral infections
+24
+latent infection
+the root mean square deviation between residues that are structurally aligned
+glycoprotein
+extracellular
+bacterial and viral infections
+seven
+autoimmune T cells
+Multivariable logistic regression
+UniGene
+Centre for the Integrated Health of Women, Adolescents and Children
+two
+1:16,127 and 1:25,600
+tomographic slices
+18 h
+crosstalk between pathways
+0.5 mL1M NaOH
+65 C for 45 min followed by 80 C for 5 min
+splenocytes
+HATU and DIPEA in NMP
+Acinetobacter
+13
+Cisatracurium bolus and infusion
+Oregonin and hirsutanonol
+enhanced
+Titre of the rMVA-GFP stock
+suppression of proliferation and elevation of apoptosis
+Jier Biological
+critical aspects of influenza infection and immunity
+put in place control measures
+initiation complex
+pedigree of the study animals
+42%
+Reed-Muench method
+30%
+40
+Four
+SPSS 20.0
+five
+attachment and internalization of EBOV
+epidermal growth factor receptor variant III
+5,000
+MMLV reverse transcriptase
+Hydrogen bonds
+Plasmid DNA
+6%
+TLR4 and TLR2
+97.1%
+condensation of a part of the rDNA copies into heterochromatin
+LDVL
+monoclonal
+degenerative
+edges
+10,000
+0.05
+eight
+900 μl
+Illegal gutter oils
+Institutional support for funded studies and interventions
+anti-inflammatory
+1,425,981
+A. testudinarium
+six
+NF-κB activity
+9.8%
+Big Data
+Membrane fusogenicity
+three times
+questions intended to collect data on suicide attempts
+IFN-λ4
+2.20 Å
+Curing HBV
+polymer-solvent
+SEM
+every three days
+host taxonomic order
+transient infection
+74.9%
+variant analysis
+94-100%
+highest
+Riken Bioresource Center
+unstimulated
+6 weeks
+five
+inhibits mitochondrial DNA replication
+LC/MS peptide mapping
+HeLa cells
+phylogenetic resolution
+DRAG mice
+Gene C
+Kombucha
+similar symptoms
+173 and 180
+neonatal
+Administration of LFK
+gachhi
+Time delay
+111
+improve the health of the entire population
+other viruses
+Linear RPA
+privately and anonymously
+5,806,237
+TRIzol reagent
+90%
+SpAtg8
+Huntington's disease, and Parkinson's disease
+159S and 162A
+pembrolizumab and nivolumab
+Generalitat Valenciana
+every 6 months
+permutations of the repeated measurements
+immune competence
+Egr-1
+G-protein coupled receptor superfamily
+AaHig
+$8.5-fold
+CHIKV and SFV replication
+482
+Th2-biased and weak IFN-γ response
+it would be too late to seriously impair the T cell repertoire
+on the basis of the gene data bank and protein knowledgebase bank annotations
+kinase-inactive K46I mutant
+weight loss and survival rate
+W-type
+endolysosomal membrane injury
+acidic endosomes
+FcγRIIB receptors
+mortality
+Blood samples
+cattle and pigs
+Dicer protein
+90
+high levels of oral and nasal viral shedding
+2%
+platelet activation and reduced platelet count
+5 to 6 weeks
+1937
+Target molecules
+Seasonal infl uenza A
+XCalibur data system
+7.6 months
+1918
+chemically stable and inert material
+HEV71 and coxsackievirus A16
+one week
+ADVIA 2400 Instrument
+bacterial scavenging
+Cancer
+Syndecans and glypicans
+the viral part of the environmental sample
+Wt and IFN-abR 2/2 mice
+100-450 ng of extracted raw RNA
+tend to the sick
+Drosophila
+Histagged recombinant Hsp90
+co-divergence
+pathway
+greater-or less-thanexpected DOF volumes
+sentinel
+Image J
+tertiary hospitals
+2.5 hours
+ESRD
+four
+388.2
+Binding susceptible host cells
+the pendulum
+viral replication
+0.92
+RBCs
+translation of T7p-derived mRNAs
+an upper threshold of 255
+More than two hundred
+90%
+proteasome or autophagy
+PopART
+TLR4 -/animals
+P-site
+the same, or neighbouring, homesteads
+7-AAD + CD3
+fluorescent signal
+luminal and membrane substrates
+182
+IPC activities
+G
+age and underlying medical conditions of the patients
+Dengvaxia
+CGR
+undeniable
+10 µM Y27632
+suitable ancestors
+Future reports from large, prospective observational cohorts
+M NaOH
+doses of vectors
+embryonic precursors
+mass
+coiled-coil structure
+3.45, 4.25, and 4.5 min
+wheren iÀ 1
+37°C for 1 h
+age and experience of participants
+Charcot
+RACE PCR products
+proHNP1A
+IFN1 and IFN3
+PTEX150
+gross pathology
+4
+R&D systems and Sigma-Aldrich
+pUC-attR1-CmR
+fragments upstream of the lplA gene and the ssuA gene
+HIV/AIDS
+2AE9 days
+influenza virus A
+Innate IFNs
+CV = × 100
+children
+sensitivity analyses across a wide range of influenza parameters
+High levels of frameshifting
+PTX3
+gRNA abundance
+SIRbased perceptual-influenza model
+sodium taurocholate cotransporting polypeptide
+very fast
+36.8%
+Swiss-PBD Viewer 4.10 software
+24 h
+pneumonia
+103
+please fill all the destinations in the blank
+key elements underlying an environmentally modified, potential effect of human genes
+increased co-morbidity
+Bergnia ciliata
+LNA2
+Recombinant acetylated cyclophilin
+adults
+Coca Cola
+automated GRB target gene prediction
+18 h
+N-glycolylneuraminic acid
+TIGR4 or other wild type streptococcal strains
+Oral inquiry for financial interests of relevant personal
+Prone positioning
+pro-inflammatory
+bta-miR-455-3p
+AP2-R2
+descriptive statistics
+extreme levels of inequality
+to emulate the libraries sequenced on the HiSeq
+29
+CNS infiltration by CD11b + Ly-6C hi monocytes
+unclear
+six
+a reporter virus
+15 Days to Slow the Spread
+two
+HIS mouse BM and spleens
+Etoposide
+a single open reading frame
+30 min
+Logistic regression
+PDR001
+PfSWIB knockdown
+15
+First-strand cDNA
+angiotensinogen
+Upper respiratory tract infection
+synchrotron radiation
+MTT assay
+CEACAM1-L
+the amino group of G15
+empirical studies
+inducible NOS
+AP-2
+administration of a single dose of polarizing stimuli
+culture and individual anxiety
+Quality of life
+100:1
+Rift Valley fever virus
+Clinical Significance
+SPSS 16.0 software
+at least 20 passages
+Infectious disease outbreaks
+Rayleigh light scattering
+All the staff in all the participating sites
+shared genes
+virus replication and release of progeny virus particles
+Screening for allele-specific expression
+frameshift-inducing activity
+pandemic
+Social distancing
+morbilliviruses
+980
+Biolise 2.0
+parents, as well as CCC staff
+group III
+110
+bacterial pneumonia
+median values and interquartile ranges
+medical centers
+methionine 40 is essential for PB1 function
+thin layers
+10 ng/mL
+195
+DTU Food
+S 1 1
+Secretory IgA
+four
+23
+32%
+ADRV and RGV binding
+different kinds of influenza are analysed together
+GalT
+NotI and SnaBI of pPIC9K
+labeled cell bodies
+7.13 s
+DENV-infected WT and SK1 -/mice
+rare
+ImageMaster 2D Platinum 7.0 software
+1 h
+proinflammatory
+this study
+tRNA splicing
+Na + and Cl 2 counter ions
+4 months
+Four million
+Fear and stress
+300
+DNA purifications
+ClassyFire
+viral fitness and host cell tropism
+a-1 antitrypsin
+non-immune cells
+Herpesviruses
+primary bovine thyroid cells
+Viremia
+400 to 500 nm
+22,365
+Biomarker pattern based on CART analysis
+polycarbonate restraint tube
+70
+global and local resource allocation
+1.2%
+Student's t test
+disorder
+7
+103kDa
+a natural cell protectant
+written informed consent
+Detection software
+metaregression
+untreated hBEC
+to protect against viruses, bacteria and non-self antigens
+gentamicin
+tubules
+D. melanogaster and A. mellifera
+Allogeneic hematopoietic cell transplantation
+high
+8 h after LPS/GalN-treatment
+α
+cellular slime molds
+host nutrition, fat storage and the metabolism of vitamins and minerals
+Scottish Enhanced Respiratory Virus Infection Surveillance system
+phylogenetic
+sciIAVs
+transmission electron microscopy
+a prehairpin intermediate
+YTHDF2
+Tumor necrosis factor-α
+lysosomes
+bile acid uptake
+prior knowledge of the target sequence
+immediate treatment and management
+Otunba Tunwase Children's Emergency Ward
+a surrogate Vac-HCV infection model
+PhyloPart 2.0
+Dysbiosis of intestinal microbiota
+30 mg L -1
+Ala138 and Leu142
+Euthanasia criteria
+germacrone
+integrins
+proteolytic processing of AMA1
+delay and dispersion
+pharmacological
+types of land cover and agriculture
+University of New South Wales Ethics Committee
+intestinal failure-associated
+n/3
+reproducibility rule
+2006
+90%
+Se bioaccumulation
+docking and simulations
+cell pellets
+up to 9 h
+moderate cleavage
+l. 96-97 and l. 110-11
+Twelve
+Vaccination
+mRNA-microRNA networks
+punctate accumulation
+17
+CXCR4
+host defense mechanisms
+Formulation 6
+water droplets
+Lys48-linked diubiquitin
+antioxidant
+60%
+sfRNA
+3 ×10 5 -6 × 10 5 cells/cm 2
+diarrhea
+Epidermal growth factor protein
+94.74%
+EZ T7 High Yield In Vitro Transcription Kit
+TNF-α and IL-1β
+0.83
+603
+12
+baseline values
+Triton X-100
+any virus
+natural selection by the host
+1 lg/ml LPS
+H3K4me4 transferase
+HFMD cases
+38 to 80 mm
+comparing MDS HCT outcomes between matched sibling and double UCB donors
+Airway mucosal immunity and mucociliary clearance
+cytotoxic
+21%
+polar amino acids
+foam cells
+Tumor matrix
+20
+their experiences during the Ebola outbreak
+2003
+preimmune rabbit sera
+the luminal epithelium
+impulse control impairments following injury
+2,969
+First Strand cDNA synthesis Kit
+no epitope residues
+H7N9
+actin binding
+TKM-130803
+medical institutions around the world
+4
+Clinical care
+inhibition of different hematopoietic growth factors
+CD8 T cells
+one
+60 min
+segment 2
+getting exposed to the infections
+PBDK peptide
+wild and managed animals
+1090
+ten
+assuming roles and responsibilities
+respiratory transmission
+energies
+Ion mobility separation
+Colitis
+hydrophilic
+no software or computational tools are necessarily needed
+Asian PUUV-like species
+twelve
+low
+26.6%
+necrotic neutrophils
+immunoregulatory cytokines and the allergyassociated cytokines
+white 96-well plates
+KNIME
+pentapeptide sharing
+the potential of globally coordinated collective action
+pseudoknot structure
+Sixty-eight
+Wikipedia
+complicated
+paeonol
+temperate salamanders
+V2-apex bnAbs
+a pellet
+antibody binding-enzyme-linked
+abolishes DC-induced IFN-g secretion by NK cells
+Five
+mouse model
+70%
+accumulate in the reaction
+MCMC
+mimic the respective HFV infections
+Tibroviruses
+MediaWiki
+endosomal escape
+significant cell perturbations
+87
+change antigenically
+new variant IBVs
+imaging, molecular and histopathological techniques, and grain culture
+deep mutational scanning
+N and NSs genes
+members of the general public
+RNAprotect Bacteria Reagent
+Avian leucosis virus subgroup J
+GP1 and GP2 monomers
+Breeden and Nasmyth
+fungal species
+SP5-2-LD
+in adequate ethanol
+Download selection
+non-uniform
+hMPV M2-2
+bacteriophages and porcine viruses
+protein content
+0.2 mol%
+deleterious
+mass spectrometry
+The nucleolus
+Karyopherin-α1
+$2 per extraction
+memory B cells
+activity
+Cardiovascular disease
+viral infection
+δ 13 C
+Trimmomatic 0.35
+The Ethics Committee of the Oswaldo Cruz Foundation
+seven
+rs524
+Dunnett's post-hoc test
+Lung sections
+6.64 ± 0.10 log CFU/g
+efficacy
+i
+23 or 24 years
+Japan
+spatial structures
+pathogens that cause pneumonia but were not tested for
+specific programs
+The nuclei
+symptom prevalence
+microplate reader
+proteins
+4174±636
+invasive grass/fire cycle
+6
+linear interpolation
+Eleven
+14
+97%
+American Tissue Culture Collection
+HEK-Blue LPS Detection kit 2
+Two
+Potential frameshifting sites
+Sensitive genomics tools
+6 and 12 hours
+3 or more
+15
+49,6-diamidino-2phenylindole
+NIMHANS Central animal research facility
+628
+SSRP1 and SUPT16H
+highthroughput
+TIMP-1 secretion and oxidative stress
+NTI Advance 10
+bat paramyxovirus B16-40
+differences between breed groups
+10%
+43
+eyes and testis
+73
+Reactivity to the HA-conserved pool and NP/M1 pool
+1 min
+early viremia and generalization of infection
+parameterization choices
+GFP marker
+p3Flag-V
+outcrossing and transgene silencing
+small
+252
+28,283,587
+One hundred
+trnS-trnG and trnH-psbA
+AAV vectors
+A self-administered questionnaire
+oligodendrocytes
+15 minutes
+Treatment with antivirals and hospitalization
+less
+the C-terminal domain
+data from individual mice
+Matrix protein
+Previous influenza infection
+ACE and ACE2
+ANOVA
+586
+770
+The impact of testkits
+blood, urine, stool, sputum, and CSF
+−1 PRS
+5.7 days
+double-membrane vesicles
+fluorescent
+Prism 5
+348
+54
+WP Diseased
+Loring Miner
+diabetes
+rnTrpL
+what range of scenarios are consistent with the initial data
+1 %
+AXL, Tyro3, TIM-1, and DC-SIGN
+cellular invasion
+one or two
+p7 from subtypes GT4 and GT5
+three
+23%, 60%, and 69%
+24 hrs
+twenty-fold
+86%
+AKT
+50%
+amygdalin
+nearly half
+intercalation of the detergent
+bacterial
+a more conservative estimate of C
+CDE-fed
+most native to least native
+understudied questions
+immunogenicity of DNA priming
+GF Rimmelzwaan
+Amso et al.
+20.12 to +0.57
+twelve
+PSV1 and PCV2
+dcf
+reflectivity experiments
+SOFA, ECMOnet and PRESERVE
+enterovirus RNA-dependent RNA polymerase
+fulminant
+type of species, size of flocks, and extent of commercialization
+very rarely
+apoptosis
+25 and 6 nucleotides/second
+physiological immune responses to ingested food antigens
+public hospitals
+14 months
+Flow cytometric
+37%
+0.007% -0.048%
+wt mice
+Clinical specimens
+barriers
+100
+The PNA strand
+mycophenolic acid
+the ACF of the residuals
+1962
+flow cytometry
+3 weeks
+developing guidelines for the management of poisoning and chemical and radionuclear events
+10% of China population
+EBOV
+dsRNA-79
+Fibroblast motility
+gene knockout technology
+47,540,000 and 35,080,000
+January to May 2010
+24 h
+p k
+two
+Herpes simplex
+two-by-two
+FXII-deficient
+generalized-growth model
+more than one week
+five interaction motifs
+51.5%
+study staff
+the general public
+Porcine alveolar macrophages
+CMV promoter
+Angiotensin II
+14.5%
+product-marker configurations
+2009
+HRV
+percolation-based methods
+Supplementary Table 5
+12
+GSK Vaccines Animal Research Center
+Infected control
+the two terms
+French Polynesia and Colombia
+FlowJo
+Vectastin ABC kit and DAB HRP substrate
+independence
+TFP846 protein
+epidemiology models
+12 h
+Signal-to-noise ratios
+Phagocytosis
+12
+falciparum malaria
+1700 rpm
+2 μg/mL
+GADD34 and the dephosphorylation of eIF2α
+3500 rpm
+rgH9N2
+cGAS
+Flavivirus NS2A protein
+oligonucleotide primers
+adamantanes and the neuraminidase inhibitors
+Hypomorphic mutations
+between 21 st July and 8 th September 2007
+Five
+modifying the stereochemistry of Arg
+Bid
+filter paper
+3 h
+Six
+EBOV infection
+degrades
+lower airway symptoms
+ATG5-ATG12
+North American H7 lineage
+travel time
+human influenza A viruses
+Antithymocyte Globulin and Cyclosporine
+Resistance to antibiotics
+population dissemination rates
+human norovirus strains
+BVDV infection
+Kaposi's sarcoma-associated herpesvirus
+Six
+Culicoides imicola
+the drug binding site
+Endogenous housekeeping genes
+Antibodies
+24 h
+SVEC4-10 cells
+Mouse and rats
+Habit
+MAT
+6 00
+ZIKV E protein
+lack of culturally appropriate resources
+6-8
+six
+linkage
+the IND Sponsor
+their experiences
+histopathological and immunohistochemical
+shock of unknown origin
+545,227
+HNP1
+once every month
+Hashtag count
+impaired SG disassembly
+vehicle control
+Lelystad virus
+sialylation and glycosulphation
+cell fusion and the endocytic pathway
+2014
+Flow cytometry
+multimodal
+balancing selection
+TMPRSS2 and HAT
+Demographic and Health Questionnaire
+much time thinking through the issue
+electrostatic attraction, hydrogen bonding, and hydrophobic interaction
+H5, H7, or H1 HA
+50 million
+10%
+94.73%
+twice weekly
+respiratory syncytial virus
+severe encephalitis
+avoiding blood clotting
+Betaplate liquid scintillation counter
+changed dramatically
+190, 226 and 228
+aggrephagy, mitophagy, lipophagy
+myelin
+Human non-tumor lung tissue samples
+NN rule
+Three
+four
+TLRs
+five
+Point mutations
+virus inhibition
+Western blotting
+vascular-endothelial cadherin
+R program and STATA
+porcine AMac
+Simple representations of protein functional and structural domains
+The samples having similar fusion transcript variants
+statistical significance
+6.9%
+long-lived mammals
+Akaike weights
+continuous turnover of locally established viral populations
+β-glucuronidase
+virulence gene expression
+polyketide synthase
+antiviral
+reconstructing a large number of closely related quasispecies sequences
+12
+Ded1p helicase
+74.8%
+2003
+malaria
+fourth-order Runge-Kutta method
+seasonal influenza vaccines
+Three
+hydrocarbons
+European Convention on Human Rights
+35
+particle bombardment
+0.91
+mYFP-SpAtg8
+INHAND system
+a sustained shortfall in body size
+group E pigeons
+three
+112
+θ 2
+its catalytic domain binds Ub
+Mechanisms
+Arterial PCO 2
+3,819,675
+Tubulin
+amide
+length of the probe
+50%
+174
+privacy approaches
+PS
+45
+WT-LASV
+UTX
+727
+250,000
+brain-and/or neuron-specific functions
+48 h
+similar but not identical
+coinfection with other genotypes
+health
+4.1
+eIF4E
+Individ sources for the research
+risk
+early disease screening and diagnosis
+deteriorated bilateral pulmonary infiltrations
+informal social distancing measures
+IL-10
+37%
+Basic Local Alignment Search Tool
+case definitions
+molecular diagnosis based on oral swabs
+6
+Nine
+Vsig4 −/−
+cycloheptane
+UCLA
+Canadian Tire
+human IgG1 isotype
+more
+Sensitivity analysis
+NK cells
+the lungs
+two
+the MHC region
+Nucleic acid
+PyMOL
+SaB
+H e
+Depletion of T cells
+Acute respiratory distress syndrome
+lack of individual benefit
+K237A
+schistosomiasis
+explant and intravital
+tumor necrosis factor receptors
+normalized matrix factor
+Affymetrix GeneChip Command Console
+nonautonomous elements
+virion release and dissemination
+cell damage and cytokines production
+the role of mixed heterogeneities
+1 month
+IA/B and IC
+BIPA-P AP group
+Urechis unicinctus
+hepatitis, water-borne diseases
+personal
+30 minutes
+BBG
+Histomorphometric
+56,600
+grey
+hemagglutinin and neuraminidase
+peak viraemia
+rovalpituzumab tesirine
+ribosome biogenesis, cell signaling, and stress response
+95%
+PHGDH and HMOX2
+Penicillin and streptomycin
+Recombinant HA
+Ifitm3
+Magazines
+clinical outcome
+UniProtKB, PeptideAtlas, Pfam and STRING
+soft-clipping
+OATP1B1
+k max
+reverse transcription realtime PCR
+accuracy
+3,198
+RTIs
+HIV-1 5 0 UTR IRES activity
+Kupffer cells
+H7N9
+exosomes
+a phylogenetic clade
+multi-stakeholder
+the PM
+x100
+X-MLV
+92%
+parameter estimation
+74%
+prescription patterns and counts of close connections between formulas and herbs
+supramolecular layers
+Coincidence filtering
+PiCV
+Job security and income replacement
+transmissibility and reproduction numbers
+13
+5-fluorouracil
+autoimmunity
+providing explanations and informing the public
+unstable asthma, COPD, and infectious lung disease
+>95%
+Live vaccines
+448
+Acclimation
+over 30
+DV
+Bradford method
+60 minutes
+1986
+JFH1
+Isoflurane
+Two
+all of its neighbors become infected
+mass mobile vaccination campaigns
+Support Vector Machine and Quantitative Matrix based algorithm
+human challenge
+99% per amino acid
+β
+nine
+four
+human rights and distributive/egalitarian concerns
+Pythagorean theory of numbers
+pig cells
+mutation of the juxtamembrane motif
+damages
+alcohol abuse and depression
+12-18 h
+66 Å
+PRSS3-activating
+China
+Kruskal-Wallis test
+10 5 cfu/ml
+ignoring the underlying mechanisms driving those patterns
+pop-attack
+transneuronal
+three strands running back and forth
+1977
+documentation
+translational studies
+Phylogenetic
+Viral DNA
+0.46%
+IP-10
+bronchovascular mark-ings
+diagnostic approach D1
+other essential parameters
+bacteremia
+amplifies the drugs antitumor effect
+nine
+polymorphic
+alcohol use
+matrix layout
+mental health care
+15
+MOI 10
+reproduction number
+smaller signal overlap and increased disease ratio
+in vitro and in vivo models
+acid stability
+55.8%
+sialidase
+b-actin staining
+Annexin V
+July 2015
+2 hours
+several indices
+n z
+52%
+jackknife cross-validation
+Promoters and terminators
+distributions
+destructive exon skipping
+144,133
+neurologic
+West China Hospital
+susceptibles
+primary
+Infection with influenza B
+Bobvious^trade-off
+The UniProt website
+Low-Interrupted and High-Stable
+analysing clinical sample
+RIG-I, PKR, and GADD34
+30 nM
+45 min
+USA, Hong Kong, Australia, and China
+Proteasome inhibition
+positive
+1945
+The effective number of codons
+in vitro evaluation
+spherical
+PaO 2 /FiO 2
+GenBank
+yet to be determined
+oxygen rich environment
+354
+prevent or minimize the impact of RSV infection
+24
+E62H
+five
+monosaccharide composition and linkage patterns
+human patterns of light to moderate drinking
+protection against CAP
+LightCycler96 qPCR machine
+17%
+action, and perceived benefits
+receptor binding affinity and receptor usage
+two
+0.5
+TLR9
+mortality
+probable" cases
+MBL2 variants
+low constraints imposed by fewer interacting protein partners
+1 to 6 km
+MALDI-ToF
+Impaired
+specimen taken after antibiotic therapy
+intensity-based absolute quantification
+2000
+Hamamatsu ORCA CCD Camera
+immunosuppressive
+2%
+lipid-based
+GB virus C
+frameshifting
+a Gabonese world-renowned scientific research center
+health ministries
+1 hour
+HIV-1-infected HBMECs
+stronger
+dose-dependent
+11
+FAPs
+hemophagocytic cells
+20 concurrent cases
+Makona EBOV
+seven
+1.3%
+a new sample
+repeated immunization with the same vaccine and dose
+Fifteen
+a versatile biotechnology tool
+Dubowitz
+H. influenzae and S. pneumoniae
+intranasal papain administration
+Flow cytometric
+Hokkaido Prefecture
+trypanorhynch tapeworms
+Table S1
+ER transformation
+MHV induced
+Spearman correlation analysis
+600 µL of lysate
+August 2006
+Coiled-coil domains
+generalized linear binary regression model
+DC-SIGN rs2287886
+34.3 kDa
+1000
+Uniprot database
+migration staggers over several months
+6%
+dN to dS
+CD4-independent infection
+19
+Sepsis
+Blood gas
+to avoid interference from maternal antibodies
+90 min
+nsp2 mutants or parental virus
+34
+impairment in CD95 activation
+greater
+benefits
+34 years
+Hoechst 33342
+Western blotting
+Chinese yellow chicken NLRP3
+125 million
+ROS
+substrate prefer-ence in OTU enzymes
+increased viscosity
+Passive properties of the cell, membrane and series resistance and capacitance
+antimicrobial resistance
+competing interests
+practical consequence
+CD80, CD86 and CD40
+Asn67-to-Asp deamidation
+Boc chemistry
+SLAM
+its own proscript
+22
+mass spectrometry with a surface enhanced biochip
+E18
+5-15%
+data reduction, data display and data conclusion-drawing/verifying
+UbiSite
+Cardiac angiotensinogen
+CD4 + T cells
+NSP2
+biomedical research
+vRNA levels
+dividing the number of infected cells with that of uninfected cells
+Australia, Germany and Sudan
+the 5' IRES
+6
+TRAFtransgenic mouse models
+IRF7
+VarScan
+cytoplasm
+shorter duration of hospitalization
+A/ H3N2 and B strains
+eIF5 GTPase activity
+Seventeen
+scientific self-control
+virus induced IFN-ab
+Immunopathology
+the probability that any case will be detected by routine surveillance measures
+DAVID
+85
+HouseBrackmann score
+macropinosome maturation beyond the Rab5 positive stages was not necessary
+IgM and IgG ELISAs
+certain samples obtained from patients
+Herons and egrets
+detection of variants in viral genome
+the growth of the ARs
+36 hr
+Cells
+Quercetin and resveratrol
+50%
+Enteroviruses
+Table S1
+two-sided Z tests
+4
+5000
+Mathematical models
+Restricting access to the means of suicide
+Impact factor
+annually
+10
+RMS S
+China
+pigs
+32
+the outbreak threshold
+chickens
+10 min 15 sec
+philosophical
+1-month
+ubiquitination of IFNAR1
+AnyBody Modeling System
+The courtroom
+pneumonia
+safety and the right to withdraw
+2005
+by study design
+Bank voles
+detection of the adsorbed sTfR fused with His-tag
+One-way hierarchical
+60% probability cut-off
+DENV1, 2, 3, and 4
+Humanized mice
+InfluSim
+oseltamivir phosphate
+54
+H7N3
+activity monitors
+Sixty-eight weeks
+alter viral virulence
+BCA Protein Assay kit
+Recombination of sub-genomic fragments
+IPTG
+~25.2±2.8%
+golden hamster, rat, and mouse
+febrile
+Allen group
+glycan shields
+evolvability of phage 6 populations
+12
+IFN-γ
+infectious virus
+imidazoline receptor antisera-selected protein
+cytopathic effect
+Cancer
+sensitivity to TKI therapy
+by alteration between mosquitoes and human host
+overlapping genes
+endangered species
+Aspo0F
+Particulate matter
+Dulbecco's modified Eagle's medium
+two
+histological and imaging
+Seal/H10N7
+2012
+dashed red curve
+Adipose tissue
+GP stability
+DNA
+TiO 2
+pulmonary inflammation and neutrophils infiltration
+how accurately the ribosome is positioned when a particular codon is encountered
+antagonizing IFN induction and action
+GFP-PTPN23 and HA-ABIN2
+stirrers
+GENIE3
+jk
+Neutralizing monoclonal antibodies
+Entamoeba spp. and Giardia spp
+nasal swabs or bronchoalveolar lavage
+six
+TNF-α
+Cell type and cell state
+ISKDC classification and crescentic lesions
+particle counts
+A variogram
+30X coverage
+16 days
+Stepwise and backward procedures
+0.54-1.29%
+immune dysregulations
+140 nm
+recombinant human ACE2
+179 bp and 155 bp
+NKYVET 2015-0066
+receptor recognition and viral fusion
+Southern blot analysis
+S. pneumoniae
+polyethylenimine
+GMT ratios
+Rpl19
+memory
+TLR3
+poly-Ub specific vOTUs
+B1 mRNA
+luciferase expression
+40%
+2
+target gene expression
+3%
+Maela Temporary Shelter
+existing therapies
+3.5 million
+comparable expression of pro-inflammatory
+viral particles of IBV
+fluorescence requires excitation light to travel to the location of the fluorescent probe
+5 ± 1 d
+seven
+Vaccination
+NLS
+heart and diaphragm
+four
+15 weeks
+3
+Ebola virus glycoprotein
+HAGMA refractory to conventional therapy
+influenza Apdm09
+Foci of mineralization
+HRP-conjugated goat anti-guinea pig IgG
+12
+nine
+90% confluence
+the droplet state
+via regular pre-paid mail
+mitochondria
+severe immunodeficiency of the T cells
+two
+population access to healthcare
+28.2%
+35
+efficient and effective longitudinal research
+VRK2
+unknown
+92.9%
+DNA and RNA
+Primary viral pneumonia
+the most severe manifestation of ulcerative colitis
+National Institutes of Health Tetramer Core Facility
+peripheral vasoconstriction
+classes that are infected with pathogen and vector
+international coordination and prolonged collaboration
+abiosignature
+its pseudoatom representation
+SDHA
+78%
+stranded cDNA
+the structure with MFE
+ELISA assay
+p k
+TJ
+Lipofectamine TM 2000
+55% viral and 5% non-infectious
+20%
+an introductory information meeting
+IFN-I production
+glycogen debranching enzyme deficiency
+ten
+IL-13
+arthropods
+The lung
+the requesting center
+ProteomeXchange Consortium
+Deproteinization
+phenotypic
+The Consortium for Functional Glycomics
+peptone water
+charged
+Five
+open and closed conformations
+Communicable Diseases Law Reform Act of Germany
+steam autoclav ing
+spiked concentrated plasma
+the daily or weekly number of incident infections
+C/EBPα
+Details of the different kind of modifications for the novel antimicrobial peptide engineering
+non-log-transformed MFI
+identification requirements and criteria for specificity testing
+402
+chromatin remodelers
+LT patients
+BioEdit Sequence Alignment Editor Software
+10 genome equivalents per reaction
+viral RNA and the replication proteins
+PRRSV replication
+different translation factors
+engineered amphiphilic peptide
+95.19%
+membrane trafficking pathway
+activates recruitment of MAVS on mitochondrion
+98%
+static imaging
+Phoenix
+GenCall was invariably superior
+confocal
+antibody-mediated tumor-protective immunity
+21-28 days
+their size
+800 ng of the labeled reaction
+~2.0Â10 9 /mL
+Disease resilience
+how do biologists make sense of it from mathematical models
+ATGGAGGAATGGTCCCTGGCTATC
+season and year of enrollment
+0.966
+Inhaled nitric oxide
+severities grades
+research design
+testing of dilutions in fivefold steps
+perlecan, agrin, and collagen XVII
+Mavericks
+2007
+a proportional reduction in the first passage time
+the most right band
+RNA templates
+Cox regression
+six hours
+Nine hundred and forty-four
+615
+three
+January 2005
+broad agreement with these findings
+Human metapneumovirus
+HS binding
+preconditioning
+liquid nitrogen
+necessary for the interaction
+Confidence intervals
+Complaint Coder
+15
+reads value of 186,363 transcripts
+pir gene
+Arthritic diseases
+8-isoprostane
+$98%
+twice per day
+MEME
+non-hematopoietic cells
+K
+Nairovirus
+Bronchiolitis
+Sigma-Aldrich Company
+cellular levels of fatty acid synthase
+separately
+Peptides lacking membrane binding domains
+~40 ml and 45-75 ml
+peptide fragments of protein antigens
+CD80 and CD86
+3 weeks
+teratologic effects
+AT 1 and AT 2
+more research
+spherical
+DNA vaccine carriers
+five
+SUMO-1
+their homes
+affinity chromatography
+rs4820294 and rs13057866
+Morelos, Puebla, México and Hidalgo
+numbered
+19
+Mexican Institute for Social Security
+Twenty-five percent
+integrin alpha 3
+Photocatalytic
+sine and cosine
+Nonspecific binding
+recombinant E protein
+asialoglycoprotein
+leukocytes
+DI particles
+extracellular matrix
+$432.54
+Ferulic acid
+Jurkat T-cells
+Lamin B1
+10 μL of eluate
+phospholipids and palmitic acid
+under the bottom of the animal excrement collection DPTE transfer container
+MMP9
+estrogen
+10 days
+Antibody responses against Gag, Env or Tax
+less than 20%
+investments in the development of innate immunity
+Detailed experimental and theoretical study
+rapid clinical diagnosis
+travel restriction and social distancing
+lung mononuclear cells
+HcRed-LC3
+anti-viral therapeutics
+A window of 90nt
+preventive measures
+its binding to the membrane
+CD123 CAR-T cells
+immunological tests
+alternative initiation mechanism
+an extended, H-type pseudoknot
+DEP current challenges and limitations
+Running water
+TNF-α
+EV71/VP1
+few
+hybridization to RNA
+20.8%
+geometric mean
+diabetes
+deprotection of G2912 and U2955
+SCXK 2015-0018
+2.0%
+four
+transcriptional coactivator
+monoclonal or polyclonal antibodies
+BFA treatment
+ProDesign
+Con A
+Multidimensional Scale of Perceived Social Support
+HLA-DQ
+epidemic duration
+23%
+cmnm 5 s 2 U
+African green monkey kidney cells
+Stc1
+NucleoSpin RNA II kit
+black dotted lines
+Lineage modifications and taxonomic revisions
+dismal
+the set of explanatory variables and θ their associated regression parameters
+2-week after the primary immunization
+Node color gradient
+SDS-PAGE
+Malvern Dispersion Software
+Wuhan
+22
+TFs
+IGV
+diarrhoea, vomiting, dehydration, and weakness of the body
+six
+IFN responses
+snoRNA and pre-mRNA levels
+unsustainable
+precursor T
+DNA replication, recombination and repair
+Stokes law
+HVR3 of the S1 gene
+programmed frameshifting
+discovered relevant subsets of mass clusters
+Gabon
+Dr Margaret Chan
+Canada
+82.0%
+17
+Atg11 and ALFY
+Recode
+binding at one or more drugvirus base pairs
+surfactant
+Human papilloma viruses
+w
+pseudorabiesvirus
+nearly equivalent
+47
+a broad range of diseases
+antigen
+Hsp90 activity
+W/D weight ratio of the lung and total protein concentration in BALF
+Sputum and urine samples
+Microglia
+copy numbers
+An estimator of body condition
+accumulation of NSs
+PRJNA300864
+antibacterial agents
+23,816
+10 minutes
+412
+whether there is a role for TURBS RNA secondary structure
+peginterferon and ribavirin
+1.015-1.106
+0.778
+cytosolic sensor
+viral recrudescence
+0.81
+microvesicles
+App's antiviral effect on PRRSV
+thrombosis and bleeding
+IRAV
+every 50 fs
+Sunrise TM plate reader
+measure, identify and quantify a large number of metabolites in a biological system
+neutrophil count
+fever, anaemia, anorexia and weight loss
+a transmission cluster
+enhanced anchorage independent growth
+properties
+pharmaceutical
+PROCR
+12
+intestinal commensal flora
+18
+H5N1and H7N7
+divergent
+Shannon entropies and minimum-free energy genome secondary structure models
+Diffraction data
+PDMP treatment
+50% inhibitory doses
+25 years
+3.3
+89
+complement-mediated protection from pathogens
+Clustering
+seven
+cost calculation
+four
+optical density
+corticosteroid
+i
+29.1%
+fundamental aspects of viral morphogenesis
+N closer to the 39 promoter
+CD8+ T cells
+TEM
+artificial insemination
+26.3%
+Eight
+2
+Ile-91
+A neutrality plot
+β-actin
+disease progression
+four
+Clinical staff
+matrix protein gene
+parsimony and fit indices
+61%
+developer A
+uncontrolled
+PLC digital output module
+self-suggestion
+a linear relationship
+cardiac MRI
+release the air sensor
+four
+bearded vultures
+Crowded living conditions and poor sanitation
+77%
+Sofosbuvir
+three
+ILI
+hematoxylin/eosin
+Written informed consent
+5
+3 days
+route of administration
+two weeks
+mononucleotide
+SDS-PAGE
+aliphatic residual apolarity
+Chronic immune activation and inflammation
+hundreds of millions
+11H10
+10 µM
+Logistic regression
+HCV RdRp and other positive-sense RNA viruses
+Lymphoplasmacytic aggregates of mild cellularity
+Germacrone
+when it transmits
+the attending physician
+young children
+The cycle threshold
+anti-β-actin antibody
+external validation of published scores
+0%, 3.0% and 24.6%
+reverse transcriptase SuperScript II
+lipopolysaccharide is intravenously administered to healthy volunteers
+TRIzol
+Preliminary trials
+SES
+one or more prior suicide attempts
+Infected cells and culture supernatants
+35, 40, 50, and 60 • C
+Several network models
+621 ± 154 nM
+cDNA synthesis
+effective construction of AMR
+Weibull distribution
+Four
+the emergency department
+four
+B cell immunodominance of the Aβ epitope
+20%
+Three
+intestinal pathogens
+LeFE random forest machine learning algorithm
+2006
+2 days
+Non-cannonical
+52,293
+63.2%
+common cold infections
+mouth guards and more protective helmets
+GI bleeding
+a collection of rights-based guidelines for humanitarian response
+the percentage of transfected cells
+accumulating a discrete time series
+HCC
+five
+30%
+Malaria Journal
+alkaline phosphatase-conjugated anti-rabbit secondary antibody
+17
+b
+2 days
+differential effects
+1900 and 1918
+adamantane derivatives
+relative band intensity
+thermodynamic cycles
+7.8 mM
+13
+ratios of pre-to mature miR-122s
+bronchopneumonia
+viral replication
+penile cancer
+single SNPs
+If more than one ORF was identified
+adenosine
+live bird markets
+C. xiaoi
+biological
+Risk communication
+indoor niches
+thioredoxines
+APC3 and APC8
+higher levels of cell fluorescence
+E.coli, Baculovirus
+decode method
+extraintestinal effects
+CCK-8
+184
+Saturation
+5-100 ng/mL
+B19
+novel prevention strategies
+14 days
+Over 99%
+dual-energy X-ray absorptiometry
+morpholine rings and phosphorodiamidate linkages
+The next-generation matrix of Large Domain
+Routine immunization
+10%
+PB2
+40
+excessive anti-inflammatory effects
+Delphi 14 method
+hepatic microsomal
+venous blood
+dual labeled probes quantitative PCR
+six
+absence of a control group
+equal access to resources
+13
+pCABSD
+cumulative incidence
+ADRV and RGV
+90.7%
+vaccine or treatment
+4,344 nt in length
+Human enterovirus 71
+Cheetahs and leopards
+14.8%
+gels
+a public health emergency
+5%
+60%
+vaccine formulations
+Quantum mechanical calculations
+by means of a statistical model
+full activity
+UCL
+ensuring an adequate blood supply to the regenerating tissues
+14 days
+highly conserved
+1.6
+AAV-5 and AVV-6
+malformed models
+LAMP
+Peptides
+87.1%-98.6%
+Image J software
+Toxic hepatitis
+ventilators
+3
+p-SMAD3
+a relevant ISO accreditation
+IFN-R-deficient
+ProSeq grouping Task
+p44, p62 and XPD
+Na + /H + exchangers
+72A1
+ELISA and WB test
+proteasome-dependant
+ORF2 VRPs
+capture ELISA
+Mcl-1
+a summary of all viruses found in diarrhea
+Chromosomal transfer
+inhibited
+Lipid metabolism
+bacterial
+alveoli
+Pseudouridine
+20%
+425
+genetic drift
+one category
+variable
+did not change the percentage of infected cells
+solvent
+epithelial cells monolayers
+with 0.5 mM EDTA
+Economic reserves
+proteolytic
+community
+ACE
+reactivation
+3+
+heat shock protein 90
+cDNA
+ensuring sufficient food
+functional
+CD4+ T cells
+natural interferon producing cells
+rapamycin complex 1
+sM2 fused with or without CTA1
+partial charge neutralization
+at the points of the star
+Other conditions
+basal TLR3 and TLR7 transcripts
+growth of subcutaneously growing B16 melanoma
+Noise
+nosocomial transmission
+natural language processing
+time and group
+Spray-dried plasma proteins
+cc-by
+a relatively slow unidirectional migration wave
+LPM
+parasite pressure
+1%
+Stress leukograms
+seven
+fever and diarrhea cases
+6,053
+directly viral molecules
+Serum total protein and calf age at first diarrhea
+saponins
+A 32-L/min air pump
+overall DNA methylation level
+Alkaline protease
+a place having a dedicated team at one location
+TRIM22 and IFITM2
+J v
+metamorphosis
+Poisson distribution
+DeltaVision Deconvolution
+four antigenic sites
+CCCP or Valinomycin
+domain 1 and 2
+to attract more cells to the site of infection
+FlyFectin
+TRIzol
+overlapping
+48 hrs
+adjuvants
+Interferon regulatory factor activation and PRR signaling
+Typhoon FLA 7000
+more than 40%
+assessment of the pathogenicity of NDV isolates
+Lou Lamoriello
+anxiety and fear
+database search
+CNS
+Crystal structures
+64% to 56%
+microbial proteolytic proteases
+Peking ducks
+in vitro
+pituitary gland
+polyethylene glycol
+nucleotide substitution
+Almost 40 %
+diagnoses on hospital discharges or on death certificates
+RNA
+antiviral
+X. tropicalis
+mutator phenotypes and altered drug sensitivity
+AP-1
+AxyPrep DNA Gel Extraction Kit
+new therapies
+Over 1400
+randomizations
+VP1 or VP4/VP2 sequence alignments
+Sufficient input HRV titre
+seven
+ArcGIS
+survival benefit
+GraphPad Prism
+9%
+hospitalized cases
+extensive pulmonary injury
+HCC aldolase
+extensive within-host genetic diversity
+respiratory
+binding and expression target analysis
+serial dilutions of viral suspension
+bone-targeted
+prohibitins on TH17 cells
+FLIP
+filament images
+leakiness
+absence of monocytes
+6 hr
+15
+critically ill
+43.1%
+glucose levels
+American Type Culture Collection
+Cryptococcus DEAD helicase
+135
+29
+H uman rhinoviruses
+Desi, Sonali, and broiler
+AI and PS scores
+Oman, Cuba, and India
+NV
+Cisatracurium
+percentage neutralization
+4
+genetically modified shrimp
+Total RNA
+historical genetic introgression
+constant epidemiological parameters
+Polymerase chain reaction
+Epithelial cell invasion and macrophage death
+the best three results
+laboratory biosafety and security
+2
+increased surfactant catabolism and CD11b expression
+ATF4
+genome wide assembly required for full chicken genome
+disease mechanism and therapy to be improved
+low
+EV-71
+sulfur rich
+simple correlation coefficients
+Synonymous triplets
+LL
+POLR1
+Zika RDT
+2-5 min
+T. sinensis
+human Fc fragment protein
+37AE2
+Uninfected ferret corneal epithelial sheets
+four
+11
+end-point consolidation
+24
+ENSEMBL database
+Table 5
+chicken embryo fibroblasts
+population health approaches
+Kadam virus
+clan CN
+controlling the pre valence of MDR pathogens
+Secondary outcomes
+24 hrs
+H3
+Stockholm
+at least
+59%
+eightfold
+low
+accuracy of disinfectant dilution and overall TCD scores
+1990
+ATCC
+adaptive host-defense genes
+drinking water
+thrice a week
+COVlD-19
+evolutionary entropy
+JMP software version 11
+digestive efficiency
+DNA
+Signal and target amplification techniques
+145,365 through 145,845
+pTRH1-Gfp
+LigT
+246.8 kDa
+hot spots
+Blister fluid
+Sensitivity analysis
+cells and the cell controls
+10
+0.534
+dogfish shark and little skate
+1610 8 /ml
+Gly297 and Phe301 of yUfd1
+Median Absolute deviation of j th column
+22/3/2020
+0.5612
+television
+food safety and security
+3%
+four
+interaction of Na/K-ATPase-mediated Src activation
+Position, velocity and acceleration
+AQP3 and Claudin 1
+4 monthly
+98%
+3
+Ecological niche models
+Africa
+SV40 capsids
+Different interventions
+arginine tag
+boredom
+Ͼ1
+increased host nutrition
+l
+3
+anti-norovirus agents
+recent alcohol intake
+a quarter
+blocking complete folding
+1 mg/kg/day
+ProteinChip Arrays
+PBL Interferon Source
+10 nm
+A pdm09
+Cholesterol
+hospitalacquired
+criterion of non-naive countries
+10
+90%
+an anti-N humoral immune response
+viral infection
+n
+innate sensing
+CD8 + and CD4 + T cell cross-recognition
+glutaredoxin-1
+Mint3 inhibition
+2x10 4 MDCK cells/well
+autoimmune liver disease and immune-mediated liver injury
+TLIKELKRLGI
+bronchoalveolar duct junction
+excess
+electrostatic interactions
+urethral synechiae
+minimization of the time patients spend at high risk
+Endothelial nitric oxide
+complex structures with cauliflower-like structures
+two
+Proteases
+100 µl cDMEM
+periodicity
+pseudogenes
+promoting focal B cell organization
+2014
+transmission prevention
+5
+118
+cosmopolitan frame
+extensive characterization
+Autophagy
+calcium-palmitate complexes
+Syria
+Three months
+American
+wild-type
+Absorbance
+GSE86449
+pRSETC-NSs
+IMG/VR
+severely ill younger case-patients without pre-existing medical conditions
+Mathematical models
+five
+growth-inhibitory
+epitopes
+biased sequence availability
+P-value
+2009
+Identifying risk factors
+69
+4 h post starvation
+RNase A
+70%
+normal expression levels of cell receptors, effective mucus production and ciliary activity
+Ad5
+ABCF1
+virusinduced COPD exacerbations
+B16-F10 target cells
+Twelve
+jModelTest 2.0
+proinflammatory
+virology
+AgaR2-recognizable palindrome
+Ebola virus and Lassa virus
+conditioning on phylogenetic summaries
+the type of tumor
+10%
+prognostic biomarkers
+spillover transmission
+971
+SHP chimeric gene
+homology-modelled
+homo-and heteromolecular recombination systems
+Western blot analysis
+manipulate
+Fluoroskan Ascent FL reader
+blue
+335
+specific molecules
+Southern blot analysis
+Nuclearencoded rpl22
+farm management
+birds
+A1
+CpG ODN
+pre-mRNA processing and selection of exon 6
+costimulatory receptors
+pneumolysin
+Viremia
+with three expression plasmids containing N, P or L gene
+synplot2
+2-5 mM
+599.83 MHz
+12.5 ± 1.4 dpi
+Cytofix/Cytoperm Plus Kits
+Controversy
+4%
+TESSy
+BRACO-19
+Bracketing
+Boonyaratanakornkit, Jim; Taylor, Justin J.
+where they traveled
+endogenous cellular À1 RF signals
+regression analysis
+influenza virus PR8 NS1
+Evan's blue assay
+Cultured
+CCL2 and CXCL10
+X-ray and ultrasonography
+Glycan patterns and topological shielding
+counter and evade the multi-layered host restriction defense system
+28%
+90%
+evolving, dynamical systems models
+Monocyte Isolation Kit
+IFN production
+Pyrogallol
+Extracorporeal membrane oxygenation
+niosomes
+five
+Four
+Endothelial cell proliferation and differentiation
+GTP cofactor
+Additional file 5
+317
+cancer virotherapy
+Thermal inactivation of biological microbes
+groups with related functions
+ELISPOT
+hypoglycemia
+protease sensitivity and CatB dependence
+10 min
+Matrigel-coated Transwell filters
+transmission potential and mitigation interventions
+Data
+three
+phenol extraction and ethanol precipitation
+1774
+Clark
+goat serum
+Mobile laboratories
+Streptococcus pneumoniae
+85
+nodes and edges
+Two micrograms of RNA
+GRF1, GRF2 and GRF3
+the JAK/STAT pathway
+exon-skipping activity
+HEV71
+production and secretion of type I IFNs
+Four
+Epstein-Barr Virus
+a larger NS1-related protein
+I LT and I TP
+Four
+interleukin-10
+Tyr74
+HT pathway microscope
+NEAT2
+tetraspannins
+Hypoxic preconditioning
+the origins of immunological novelties
+ubiquitylation of NSs
+fetal growth restriction, premature birth, or spontaneous abortion
+biosafety level 4 facilities
+Sweden
+reverse primer
+phosphoinositide 3-kinase
+lower
+Western blot analysis
+10 to 20%
+L10L and L10H
+phenanthroquinuolizidine alkaloids 16 and 17
+our results
+large-scale epidemics
+COL1A1
+ST cells and IEC cells
+Colombia
+246 to 467
+10% polyethylene glycol
+Rule 2
+cross-type edges
+1998
+phospho-Csk-S364
+astrogliosis, neutrophil infiltration, and T cell infiltration
+secreted IFNs
+freely migrate to the lung
+virus-encoded miRNAs
+15%
+M2e-specific proliferation
+190
+adaptive immune mechanisms
+steric hinderance
+women who are pregnant
+Mock-infected cells
+2.0
+brome mosaic virus
+every two days
+39
+20%
+Timeliness and sensitivity
+chromosome XII
+Spatial networks
+Sepsis
+94.83%
+mean fluorescence
+greater kudus and impalas
+MP
+tissue damage
+50%-90%
+confounding by indication
+serious
+60 nm
+fever, cough, and myalgia
+rapid DNA vaccine production
+its utility as a delivery system
+host cell transcription
+low or even absent
+phosphatase-activating domain
+200 to 10,000
+Atg5
+nonoverlapping GO terms and KEGG pathways
+testing the prediction ability of five different models
+Thailand
+Emergencies, hazard affected bodies and interventions
+hydrophobic regions
+Male felids
+Red blood cell lysis buffer
+Four
+Isolate 3.3
+a freely available online server
+A
+SOLVE 33 APBS
+two weeks
+parameter estimates and equal-tailed 95% credible intervals
+overfitting
+background clutter
+Mucin 5AC glycoprotein and cytokeratin-14
+>10 µM
+pediatric P&I-HA
+NK and NKT cells
+14
+Seven
+33%
+an envelope surrounding an isometric capsid
+A3 supertype alleles
+pancreatic islet cells
+Primer Explorer V5
+10-fold
+phylogeographic
+1 week
+10.1038/srep13028
+no lower toxicity
+Over 200
+407 viral proteins and 1012 human proteins
+peroxidase-conjugated
+$80%
+relatively little
+ATP-P2X7R axis
+H5N1-induced oxidative stress
+twice
+relationship between species
+decreased barrier function
+Oral vaccines
+3 days
+HIV infection and immune suppression
+67
+overexpression of the specific gene
+proteasome
+pathogenic capforming enzymes
+PN1
+66 ± 12 years
+macrophages
+influenza A/H7N9 specific RNA
+four
+sepsis-related organ failure assessment
+2,316
+more efficient techniques
+invasive mechanical ventilation combined with a prone position
+9.6
+East Africa refugia
+optimal parasite recovery
+Respiratory viruses
+Equal
+Three
+expression of IFN-stimulated genes
+*5-50 MB
+Polymeric
+Slices
+Each graph
+virus RNA
+plaque
+nested PCR assay
+30
+Xp
+HPAI H5N1
+JUNV yield
+12.7+/-2.2 cmH2O
+Two-hundred and fifty-four
+University of Southampton
+IFN-␥
+three
+woodchucks, chimpanzees, and humans
+natural
+Mutagenesis PCR
+ρ
+37°C
+GLG Consulting
+memory integrals
+viral replication
+$6 times
+a tree hollow
+Ber > Cop > Jat > Pal > Epi
+Student's t-test
+seasonally feeding on migrating Palearctic birds
+web sites or databases are no longer maintained
+283 nm
+the majority of major DRMs
+48 hours
+10%
+emergency boxes
+3
+nine
+462
+consequences
+ethyl acetate
+the reader
+CC and VC cells
+three weeks
+mediating paracrine senescence
+S. pneumoniae
+elevated CVP
+adaptive immunosuppressive agents
+Drift
+13%
+degradation of chromatin
+Ig class switching and somatic hypermutation
+phosphorylated
+Phosphomimetic substitution
+intein chemistry
+1,838
+all individuals are social
+An R script
+COPII assembly
+solubility
+C-terminal residues
+Pertussis
+septic shock
+IFNG
+acute exacerbations
+Antibiotic resistance
+One hundred and seventy three
+F-actin-binding protein
+tetramethylsilane
+1 week
+8.7 mL/kg PBW
+poly-ubiquitin chains
+Laredo, Texas
+electrocautery
+Stratagene Mx3000P QPCR Systems
+3,057
+indoleamine 2,3dioxygenase 1
+2.2 to 3.6
+levels
+TGF-β
+BH3 domains of various pro-apoptotic regulators
+2.9%
+ISG15
+leukocyte extravasation
+seizures in the generalized tonic-clonic form
+38
+290
+P frame
+37
+The delay of the peak increases with the proportion of detected cases
+3.2
+entry of molecules and particles into the cell
+VP1 of EV71
+homogeneous plaques of about 2 mm in size
+the average degree distribution
+within normal range
+symptomatic and asymptomatic cases
+testing of antibodies in BTM
+Liver and kidney dysfunction and necrosis
+14
+71-78
+36
+1.9 mM
+CABS-dock
+32%
+two
+N H
+cleave host capped pre-mRNAs
+reduction
+stable associations with other subunits of the OST complex
+Zika virion release
+UNMC PEN Brain Banking for Study of Neurologic Diseases
+firmly adherent
+JEOL JEM-1400 electron microscope
+western blots
+1I7G, 2PRG, and 2ZNP
+increasing severities of simulated outbreak
+HTSeq
+One percent
+financial shortcomings
+129
+Microarray data
+MegAlign
+protein function and evolution
+The nucleolus
+anti-apoptotic
+viral replication and virulence
+ROCK
+HKY model
+13 ~ 90
+Northern blot analysis
+cluster 2
+the concentration of polymerases on the promoters will decrease
+theoretical models
+effect size threshold of 2
+fever, rash, myalgia, and/or fatigue
+significance
+what people perceive as familiar or unfamiliar
+three days
+maltose
+G solv
+training in the principles and practice of POCT
+UPP1
+residues
+HTNV and SEOV
+single-donor apheresis PLT concentrates
+56.6%
+previously published data
+Berlin ARDS criteria
+PIV5 protein synthesis
+sterile and non-sterile
+medians and interquartile ranges
+NMD-resistance
+Diekmann and Heesterbeek
+Rule 48
+parasite
+PPMOs
+ELISA
+avian reovirus sA protein
+previous studies
+PTC
+M. pneumoniae
+Figure 3
+viral quasispecies theory
+Vero E6 cells
+140
+0 to 1
+lung parenchymal tissues
+outreach clinics
+40-65%
+corneal and pupillary light reflexes
+more than 300
+theory-based research
+110
+NK cells
+feature evaluation
+social interactions
+multivariate regression modeling
+misclassification of current season vaccination status
+Pathogen-specific incidence estimates
+Phylogenetic and regression analyses
+day 6
+10 min
+ROCK-dependent cytoskeletal remodeling
+3 days
+1918
+ICAM-1
+1AE22
+randomized controlled trial
+12.5%
+HNF1B
+aggression in ice hockey
+7
+urealyticum
+multimedia
+small
+a number of different pathogens
+Chromosome 10
+scientific
+monoclonal
+porcine
+24 h
+less than 1.5-fold
+S2-expressed recombinant AaHig protein
+six
+• NO
+7%
+cytoplasmic RNA
+21 × 21
+short heterologous peptides
+higher
+pathogenic viruses and bacteria
+1610 8 CFU/ml
+eight
+higher activities
+34
+SLC
+two or more isoforms
+Hue
+99.9%
+Eleven
+B cell hybridomas
+apoptosis
+multivariable logistic regression modeling
+Cross-border contact tracing
+three
+Superantigens
+Molar concentrations of salt
+four
+59-diphosphate RNA
+membrane disruption
+PKR activation
+genomic variability
+1 hour
+HIF1α
+hepatocyte-growth factor scattering of epithelial cells
+typical failure cases and limitations in our experiments
+general floods
+a RA tool
+LDH release assay
+phosphorylation of Akt and GSK3β expression
+Primary Health Care Centre
+49%
+FlowJo
+CS
+2000
+Yos9p
+interest
+acute loose motion and vomiting
+multi-protein subunit complexes
+Influenza virus
+viral replication properties
+Gag and Env
+aseptically
+18
+Reciprocal-best-BLAST-Hits
+Student's t-test
+IRIS
+eight
+Visual logistics
+65%
+between 45 and 55%
+personal protective
+Eighteen
+TN1 and TN2
+spikes in the news event stream
+1957, 1968, and 2009
+FIP200
+IL-1β
+CA and iso-CA
+Intense homologous recombination
+Maladaptive coping to the environment
+daily counts of cases
+60%
+between 45 to 90 minutes
+DEPs
+slope validation
+Two field assistants
+the values for healthy patients
+flow cytometry analysis
+heating time and temperature
+6 dpi
+western-blot signals
+neutral selection
+extracellular
+3
+Two tailed paired students t-test
+Poor resolution of interferon phylogenies
+Doubles
+trafficking of HIV particles
+Group 1
+PKR
+liver cirrhosis
+34%
+VI 882
+I O
+similar type distributions for symptomatic and asymptomatic individuals
+R. tanguticum nanoparticles
+Salmonella Newport antibody titers
+34
+File S1
+ECMO
+HIPPA
+pathogens
+private institutes and non-governmental organizations
+assembling into pseudo-particles
+early growth response protein 1
+RABV
+P jirovecii detection through BAL in ARDS patients
+573,903
+NF-κB pathway
+severe bleeding and multi-organ failure
+the most acutely ill patients
+by inspiratory pressure minus PEEP
+societal estrangement
+residues
+average annual incidence in 5-14 year olds
+Texas A&M University and the University of North Carolina
+Vif and Vpu
+target binding to the Rb1 query protein
+Z-Phe-Arg-MCA
+40
+15 h
+short investigation time
+Infection control
+independently
+Macpherson
+security, intelligence and law enforcement authorities
+Health Promotion Law
+data from contact investigations and case clusters
+non-linear mixed effect model
+sentinel clinical data
+genetic erosion and population decline
+HeLa UPRT cells
+Age
+GTP and UTP
+Identification of relevant biological processes
+Viruses from outside the tumor mass
+dendritic cells
+a limiting dilution approach
+Integrin lymphocyte function-associated antigen 1
+SOPs for isolation and quarantine
+brought it back from overseas
+autoimmune pathogenesis
+virus
+Constitutive expression of hly
+1=c~205+100 years
+expenses
+practicality of the measurement setup
+phylogenetic analysis
+CMV viremia
+space allocations
+uniform contact timing
+15
+neuronal
+Platinum Taq Hi-Fi
+ϖ and ϑ
+fully human antibodies
+a short and a long αhelix
+Vasopressin
+phagocytosis and clearance
+strain background
+44
+479
+unclear
+gene normalization between samples
+LH
+cross-species conservation information
+Written informed consent
+Site directed mutagenesis
+Quick antimicrobial response
+Trypsin in the myocardium
+quantitative real-time polymerase chain reaction
+emulsion monodispersity
+hemagglutinin
+C6
+detrimental to the overall health of the host
+neural constituents
+pretreatment with 10d
+Proteins
+SU binding and the down-modulation of receptor by virus infection
+decreased viability
+Centers for Disease Control and Prevention
+ketamine and xylazine
+Threshold IME values
+uV-exposed mice
+less
+Monoclonal anti-HAX-1 antibody
+selenocysteine
+Activation of the innate immune system
+recombinant virus receptor
+cysteine
+reactive oxygen species
+10
+An AAV expressing an HA antigen
+Bradford protein assay
+complexity
+susceptible, intermediate or resistant
+2011
+three variables and two parameters
+overexpression of hnRNP F
+autoreactive pro-inflammatory T cells
+2009-08-18
+natural infections
+oral route
+sofosbuvir
+more than 80
+12
+7.5 times higher
+substantial overlap with decompensated liver disease
+two
+seven
+assembles
+cellular and humoral responses
+Road density
+ten
+osteoblasts, chondrocytes and adipocytes
+constructs generated previously by others
+care
+recent epidemiological data
+À1 and +1 FS
+pathogenesis
+rounded refractile cells
+aggravate ARDS progression
+seizures and encephalitis
+PNGase F
+2.8 years
+clinical trial recruitment and individualised care
+two segments
+potent, cross-reactive NAbs
+Core-on cells
+virus and microbial antigens
+more stringent criteria
+bronchointerstitial pneumonia
+~10%
+eight
+flow cytometry
+PI4P
+Homoharringtonine
+10
+histones
+T cells
+24%
+Fc function
+four
+two
+TBSV repRNA synthesis
+hepatocytes canalicular membranes
+6 days
+Inflammation of different visceral organs
+multiplexed and quantitative
+December to March
+One-half
+20
+high vs low, high vs medium, and low vs high pathogenicities
+1:150
+ρ ¼ 1 1þδ
+host transience
+Google Scholar
+Chronic hepatitis C virus infection
+interests
+classical human MHC class I molecules
+ARDS
+Energy recovered from the biochar production process
+strains associated with the production of many haplotypes
+four
+Further work
+peptide
+Centers for Disease Control and Prevention
+transmission links
+IrAE drug
+12
+Bacillus anthracis
+2138.386134.08 LFU/mg
+EWMA, regression, and Autoregressive Integrated Moving Average
+Encephalitis
+120
+IBV pseudoknot
+1 week
+MAP4K6
+in vivo transgene production
+Agro-JetH
+a suitable method for the comprehensive profiling of metabolites within bovine plasma
+KB buffer
+Delay, Contain, and Protect
+Leupeptin
+R 0
+Q-fever and the 2009 flu pandemic
+274
+antigenic shift and antigenic drift
+kinase inhibitors
+graftversus-host disease
+The SGDS
+by implementing ODE models at the nodes
+relative differences in EBOVGP-specific cellular and humoral antigenicity
+A Corbett Rotorgene 3000
+Student's t test
+C48
+CSIRO animal ethics committees
+sporadically
+astrocytes
+direct ubiquitination of Z is with the indicated mutations
+four decades
+nitric oxide
+Vps3 and Vps8
+lower suicide rates
+2,166
+SHELXD
+1.7 days
+venoarterial ECMO
+attenuates growth of the virus
+Phenotypic plasticity
+R38
+lipid accumulation, ER stress and mitochondrial dysfunction
+three
+cellular
+Oesophagus
+Influenza virus
+CTL effector cells
+R 0 = 2 × 3 = 6
+1:14
+148
+improving the clinical signs and addressing the primary disease process
+Jim O'Neill
+fruit bats
+high host nucleic acid content
+binding of viral nucleic acids
+Phylogenetic
+mutual-information min-max and forward greedy wrapper
+next generation sequencing technology
+IDO expression
+generates C5a and C5b
+enhanced local HSV-2 replication
+17
+cotton rat
+carp, salmonids
+VAR2CSA
+AAA to A_AA and A_AN
+The lower left block
+6 weeks
+0.2 mL/min
+catalytic residues
+homologues
+FoxP3 Transcription Factor Fix/Perm Buffer
+nontropical
+Respiratory volume monitoring
+62.8%
+CEACAM1
+gp120
+lipid-based
+pathologists
+Melt curve
+chemiluminescence
+Bi ions
+linear
+CPV-2c
+greatly influence the statistical results
+Forced vital capacity and forced expiratory volume in 1 second
+7-45%
+using the meta package in R
+S25
+pharmacological intervention
+impairment in endothelium-dependent vascular reactivity
+Positive and negative controls
+bacterial adherence to cells
+histopathological change
+spo0F allele
+genomic
+TE671, SF268, and ARPE-19
+Confirmatory factor analysis
+outbreaks
+Viruses
+binary covariate
+BAL fluid cytology profiles
+higher reductions on R 0
+flow cytometry
+Twenty
+pH 5.0
+Human cytomegalovirus
+core promoter binding
+Dengue Virus type 2
+Lymphocyte activation gene-3
+viral membrane fusion
+arbidol hydrochloride
+HRVs
+clathrin adaptor network
+polyethyleneimine derivative transfection reagent
+300-600
+tumor maintenance and metastasis
+epitope
+activated T cells
+490
+inhibition of the T3SS
+42%
+value was assigned the highest concentration of inhibitor tested
+genotype II
+rapid response intervention
+one million
+A similar strategy
+people of a similar cultural and educational background as potential study participants
+erythrocyte-binding activity
+evasion
+100,000 MWCO PES Spin-X UF Concentrator
+hamsters and cotton rats
+hospital or laboratory data
+proteases
+one order of magnitude higher than that of CIRP
+Discs from FTA cards
+TRI reagent
+intuition, author, and journals
+enhanced binding affinity
+disordered pressure generators
+10×
+VP4 protein
+diabetes
+0.2
+endothelial dysfunc tion
+199
+8 h
+laminin and skimmed milk powder
+PHEV
+Measuring the saturated solubility in some organic solvent
+Γ
+3 to 10
+entry into human and nonhuman primate cells
+rs707922
+ddH 2 O
+genetic instability
+whether they show HAI and/or neutralizing function
+Pandemic-related excess mortality
+polyomavirus
+LILRB1
+an intact PPXY late domain
+Rotaviruses
+Wuhan hospital
+geNorm and NormFinder
+T
+peroxynitrite
+1 week
+loss of mechanical compliance
+a comprehensive review
+cystatin F
+J-AC and C-HS
+two
+sham and ZIKV group images
+host-pathogen interactions and environmental factors
+the complexity of a model
+DNA damage
+the challenge of identifying influenza-related illness
+15:1
+REOV and HIV and TERT
+males
+166,832
+10
+BiP
+report generator
+65
+autonomic nervous system
+immunofluorescence
+Clade I of H7N9 viruses
+airway antiviral defense
+mitochondrial metabolism
+120
+a modest delay in replication
+11.83%
+components of the MG plan
+March 29, 2016
+37%
+1.6-1.8
+low virus titer
+Camargue
+Asia-Pacific
+174
+2x10 7 RPs/mL
+10-15%
+an inability to find and implement alternative solutions in a crisis
+statistical significance
+5%
+New York City
+Anti-mouse CEACAM1 Ab CC1
+17
+temperature, humidity, and atmospheric pressure
+Differences in gene ranking
+20
+supercoiled DNA
+P
+viruses
+inflammation, angiogenesis, and tissue remodelling
+significantly different
+key residues that differ between different branches
+White spot syndrome
+T cells
+Scenario d
+MATLAB
+to prevent tissue damage
+criteria to decide when to conduct contact tracing
+lower tidal volumes
+T m1/2
+adult wildcaught culicine mosquitoes
+poxvirus replication and pathogenesis
+40 cm
+improved the methods section
+In-frame exonic deletions
+ES2 peptide and water-soluble mucopolysaccharide CS
+CD55
+respiratory failure
+2.48 log10
+key changes
+suboptimal primer design and imperfect cycling conditions
+seasonal influenza vaccines
+95 °C
+G3BP1
+The Cox model key assumption of proportional hazards
+8
+phage DNA
+206
+ORF
+10 mg
+detection of known and novel viruses
+phosphorylation
+90 to 97%
+102
+access to flowers
+Four weeks
+1278
+stable secondary structure
+thickened wall arteries and vessel occlusion
+Albumin serum level
+healthcare-associated infections
+public awareness index
+FigTree
+Harris hip scores
+M ventilation zones
+decreased PaO 2 /FIO 2 ratio
+BEDTools genomecov
+A polyA tail
+1976
+1:1,000
+Table 2
+Ebola-specific
+Albuquerque
+GAVVALSTTFA and GIAFGAVELFD
+diarrhea scores
+uncompromised
+host genomics
+BoAstV and OvAstV
+Fifty-six
+telomere attrition and senescence
+VAP
+Creative Commons Attribution Noncommercial License
+The STING pathway
+goat
+structural parameter non-identifiability
+AARC-ACLF model
+mutations
+50% CO 2 containing 50% O 2
+Packaging of the genomic RNA
+infrastructure
+three
+333
+definitions
+γ − 2βΦξ ≥ −2β
+1.5 kcal/mol
+15
+342
+influenza A
+62.1%
+Directed evolution approaches
+Ancient viruses
+substrate for GRK2
+Bibliometric analyses
+The appointed media relations officer
+QIAQuick Gel Extraction Kit
+ten
+0 and 84 years
+standard deviations
+lymph node swelling
+2 and 4 h
+Nuclear receptors
+objectivity and transparency
+Reads from the control cells
+American Type Culture Collection
+MALDI-TOF mass spectrometry
+4
+mutational pressure
+1976
+higher
+0.1 mg/mL
+statin treatment
+pandemic influenza
+G36-CD28z CART cells
+7
+enteric and meningitis pathogens, TB and malaria
+Dynamic disease fluctuations
+10,311
+lung tissue from control subjects
+USA and Great Britain
+New species
+0.2 mg ml −1
+179
+ERK1/2 phosphorylation
+FDA
+Two hundred twenty seven
+bedside
+84%
+iProx motif
+LCL-721.220 or CCRF-CEM
+toremifene
+Indonesian Islands
+frequent activation of broadly reactive B cells
+left papillary muscle
+GFP-expressing E. coli
+December to April
+reaction mixtures
+p#0.05
+glioma cell infiltration
+22
+RNA polymerase III
+1,584
+horses and for high-risk personnel
+CV for LS data set
+Mahoney strain of type 1 poliovirus
+Ifitm
+Figure 4A
+BCL2L11
+epoxy
+viral resistance
+activates autophagy
+σ
+,120 kDa
+10%
+12.5 9 40 cm
+VP16 and Oct1
+onset to outcome
+its anti-apoptotic and mitogenic functions
+G418
+transcription factors
+Diabetes incidence and prevalence estimates
+430
+Colloidal gold
+BMDM media
+miRNAs
+missing data points and partly unreliable results of titrations
+PmFKBP46
+Proteins
+three
+6 to 10.1 days
+755 999
+unique identification numbers
+SMA type I fibroblasts
+3 kb of sequence 5 of the holin genes
+SQLite
+number of days of rainfall in a month
+bradykinin
+GEO
+NMR spectra
+250 SFC
+150 nM
+the Bundestag and Federal Government
+publCIF
+49.4 %
+5 minutes
+northeastern and central Taiwan
+nationwide activity of laboratory-confirmed influenza
+Abdul LatifJameeI Institute for Disease and Emergency Analytics
+a toxic or radioactive 'bomb'
+95%
+14.6 years
+Kidney
+CFI75 LWD 16XW/0.8 lens
+51.14557
+three
+0.41 and 0.70
+screening or antiviral prophylaxis
+The KAAD
+protein tertiary organizations
+Patients with sepsis and septic shock
+2.1 Hz
+2.9-13.8%
+BD Biosciences
+limited resources
+LPS
+vulnerability
+vitamin C shortened the length of ventilation on average by 25%
+broad-spectrum coverage
+3 to 20 L/min
+serology
+primary infections not contributing to the risk
+1007
+3 of illness
+One hundred and ninety four
+NS5A
+Two weeks
+Ebola virus disease
+Sigma
+missionary and nonmedical service workers
+interactions between U33 and A37
+GSH and GSSG
+phages
+Real-time PCR
+to understand better their material properties
+beclin-1 gene promotor region
+commuting distance distributions
+94%
+data
+Acute encephalitis syndrome
+Pleurobranchoidea
+Guangdong
+Comparative
+target-decoy strategy
+s 2
+Phosphorylation of eIF2α
+1.5 hours
+DNA synthesis
+wash their hands
+Cytokines
+Mock-or HSV-1-infected cells
+scannable paper forms
+slightly under 2 PFU per tomato
+pulmonary and infectious diseases
+Pelvic
+lncPro
+streptavidine-PE
+GAPDH and PP2A
+DNA sequencing
+at least one patient sample
+11.9 ± 1.2
+quite reasonable and creditable
+ω > 0
+metabolism of many commonly prescribed medications
+convergent validity
+PB2
+piezoelectric immunosensor
+limitation of DNA availability and budget constraints
+observations in Dock2 −/− mice
+1,687
+50%
+hopelessness
+precision τ
+24 h
+Japan
+Using full FOV data
+A and M epitopes
+physiological
+A and C nucleotides
+The Discovery Environment of iPlant Collaborative
+25%
+death nor on myocardial infarction
+current achievements and ongoing developments in the design of optimized DNA vaccines and delivery methods
+Dr. Kelvin Kong
+PATRIC
+immigration
+Mann-Whitney U or Fisher exact tests
+population stratification analysis
+loss of innate immune function
+a screen for novel caspase cleavage events
+OmpB
+33
+123.2 nm
+A. Keller
+Nuclease-mediated editing of dystrophin gene defects
+visible
+LIBSVM package
+Anti-BAFF mAb supernatants
+nucleotides 3975 to 4046 of GenBank
+improvement in both safety and efficacy
+mouse pancreatic islets
+communicable and non-communicable diseases
+male rats
+Altitude
+1,500 cells/cm 2
+University of Pittsburgh Animal Care Facility
+Preparing for health threats and emergencies
+PI4P and cholesterol
+did not significantly block high D-glucose-induced ACE2 shedding
+30%-50%
+adenovirus
+One lady's husband
+titration method
+Tmem119
+persistence and number of viable microorganisms
+Roslin Institute
+biotrauma
+7%
+Mirasol
+non-specific viral syndrome, ocular and congenital disease
+Patient-level antibiotic treatment data
+rainy seasons or low air humidity
+NNK induced migration of normal human bronchial epithelial cells
+1.15610 26
+the apoptosis
+PPMO-Fl
+STAT1 levels
+C12L encoding SPI-1 and K1L
+a series of sensitivity experiments
+1,785
+MTT assay
+censoring of the observation period
+phylodynamics
+high resolution influenza polymerase structure
+Sec16A
+one third
+6.32
+Epistasis
+160-fold
+166,167,000
+10
+5 g l −1
+miR-20a
+PdI
+recovered more slowly
+36%
+one
+protease activity
+a lifesaver or a transmitter of disease
+doublelength particles
+H10-specific primers
+FASTA
+alumina slurry
+The whole nucleotide sequence of each mutant HHD gene
+Colors
+viral DNA release and decay by cytoplasmic DNases
+bifurcation
+symbol nomenclature
+virulence gene expression
+receiver operating characteristic
+simple synthesis and modification, design flexibility, high target specificity, and good stability
+Gene chip analysis
+59pppRNA
+0.018 U/mg
+5%
+distinguish sepsis patients at presentation from healthy donors
+12
+weight loss and survival
+The method proposed in the main text
+T. cati
+vulnerable
+two putative stems
+coordinate organization and assembly of entry receptor complexes
+H1N1
+hematoxylin-eosin
+Circular TFO1
+African lions
+2 -5 oligoadenylates
+trachea responses
+Lactate concentration
+93.8%
+greater infectivity of the transcytosed virus
+DAC-reactivation of FOXO3A
+100%
+Total RNA
+a unique identification number
+lipopolysaccharides
+CXCR3
+Inter-hrHPV conservancy
+the attending physician
+anti-inflammatory effects on influenza-induced cytokine responses
+dry weights
+tumor penetration
+DB mice
+relative humidity
+mut1 or SCARB2 3 0 UTR mut2
+porous
+simulations
+September 2009
+2.9%
+2-7%
+RNALater
+592
+pSTMV and pRP
+The observed distribution of AlkB domains
+Septic shock
+12%
+GABA
+GCA 21 codon
+Five
+cytosolic cytochrome
+existing local financial support
+Fc tag-containing proteins
+One-way
+Lactate dehydrogenase activity
+University of Wisconsin Cardiovascular Physiology Core Facility
+epigenetic control
+previous models developed for Europe
+Gaussian functions of standard deviation and amplitude 1 and using a target approximation error
+D2 and D3
+promote carcinogenesis
+Change of conformation
+1 hr
+β actin housekeeping gene
+Colorbar
+SEN2278 and SEN4030
+GPS receiver
+serial 10-fold dilutions of the RNA
+risk of infection by influenza A/H1N1 virus
+morphological changes
+RT-PCR products
+mortality at day 28
+B λ
+Cesarean delivery
+fluorescent intercalating dyes or molecular probes
+3
+mutants by AONs
+Man-Whitney U test
+nicotinic receptors a9 and a10
+jl R
+three
+host NK cells
+Lower values
+a technician
+an ethical framework for policy and planning
+26.7%
+rough estimates
+western blot analysis
+bivalves
+HAPE
+Glyceraldehyde 3-phosphate dehydrogenase
+30%
+TempEst
+70% to 100%
+illness
+3.9%
+high levels of IL-6
+linear interpolation from adjacent values
+intensivists to incorporate new interventions into their practice
+Predicting lncRNA-protein interaction networks
+retroviruses and adenoviruses
+serum ferritin
+MHC class II and co-stimulatory molecules
+two
+Filoviruses
+the number in the population of an area
+replication-competent PRV
+Composite scores
+further investigation
+yellow
+lactating cows
+necrotizing bronchiolitis and DAD
+Apoptosis
+infection in slaughter-age pigs
+Chikungunya virus
+laboratory investigation
+lower lobe
+G x
+DPOAE and ABR
+eleven
+molecular detection
+nearly 200
+Calibration
+HEK293, HeLa, and A549
+Poisson distribution method of binomial variables
+providing a broad plan
+chemo and radiotherapy
+Field studies
+1 mM IPO solution was titrated with 25 mM carbohydrate solution
+24 hr
+RPMI-1640
+Zinc
+Maricopa county
+CPR
+55
+over use of sedatives
+a base call of A, C, G, T, or N
+Co-regulation
+preferential binding to LPS and circulating lipoproteins
+Jeffrey Bergelson
+morphine
+three
+10
+solvent/detergent mixtures
+60
+subtracting the sample mean from scores
+protection may be T cell mediated
+anaphylatoxins C3a and C5a
+bedtools genomecov tool
+Housing conditions and diet
+Figs 1 and 4
+1569
+malaria control
+Reed and Muench methods
+R Software
+QuikChange Site-Directed Mutagenesis Kit
+CD8+ T cell expansion
+observable model
+Alexander von Humboldt foundation
+medium with supplements
+expansions of clonal populations
+twice
+11
+Negative correlation coefficients
+twice
+advice
+30 min
+according to their properties of action
+confocal laser scanning
+within-household transmission
+increased hand-washing
+nausea, vomiting, diarrhea, and hepatotoxicity
+529552-HK
+71
+MicroRNAs
+Domains and items
+poly-T oligo-attached magnetic beads
+5%
+Becn1 or Atg7
+Acanthamoeba polyphaga mimivirus
+24
+151
+poor transcription of the fucA1 gene
+5 min
+immunodepleting malignant CTCL cells
+from snout
+4
+Membrane filters
+daily
+three
+they are unable to move on microtubules
+Geir Gunnlaugsson
+Stress granule formation
+IL-6
+three
+TRAF6
+inhibits membrane binding
+three
+intracellular vesicle fusion
+Associations with all-cause mortality
+SINV-C482G
+mRNA degradation
+feline leukemia virus as well as feline immunodeficiency virus
+K-means
+Uninfected cells
+four
+they would be unlikely to be accepted as an organ donor
+864
+2,185
+Rhesus macaque and sooty mangabey A3G
+GBs of infected animals
+synthetic quantitative calibrators
+SSP
+caveolae-mediated
+hierarchical regression
+83%
+Orientation towards public welfare
+sampler cutoff size, jet-to-plate distance and microorganism
+MSConvert
+Graft failure
+abrogating the formation of viral ribonucleoproteins
+inflammatory chemokines
+microbial DNA and RNA
+RIG-I
+positive-strand
+three
+Lightcycler 480 SW1.5 programme
+more than 30 residues
+excess amount of progeny RNAs
+43-kDa full-length and fragmented
+tumor necrosis factor alpha -induced NF-B nuclear translocation
+200 µL
+lyase activity
+Super-spreading
+Two
+JcDV break in and transport across the epithelium
+reduces the levels of mature 28S rRNA
+2,376,021
+the up-regulation of IFN-b gene
+5 EU/kg body weight/dose
+27
+a-tubulin
+15 min
+60-70%
+VOPBA
+2
+close contacts
+frameshifting
+measured disease epidemiology
+four
+Coelenterazine
+defects in the NPC1 protein
+220
+SomaLogic panel
+GraphPad Prism 5
+HIF-1α
+community transmission
+high sequence diversity
+IFNa and IFN-c
+Two
+ATRQβ-001
+1.6 million
+tetraspanin membrane protein family
+Odjik WLC
+14 days
+therapeutic ratios
+three
+every three days
+761
+Lipofectamine 2000
+90%
+IP3
+Two
+letter codes
+static reporters
+serum or fecal material extracts
+means and SD
+Mouse ISG15 variants
+47
+flu surveillance
+at least yearly
+80%
+sites of subtype consensus differences
+perform two or three replicates
+four
+a diagnostic PCR
+FluorSave reagent
+GraphPad Prism 6.0
+7.3
+single-membrane tubular structures
+2 cm
+IRF3 activation
+Noroviruses
+Three
+U bodies
+macrophages
+TNF-α
+2
+alternative local control methods
+5 km
+maturation and secretion of DV1
+0.05
+highly immunogenic
+Antigen 5-related proteins
+IL-17
+PMN band cells
+The gel
+Increased levels of antibody
+XOD
+apoptosis
+social interactions which can lead to infection do change
+help-seeking
+Idiopathic ARDS
+50, 100 or 200 mg/L
+a core pseudoknot
+enhanced filamentation
+Titers of DENV stocks
+6 d
+Conformational changes
+229
+Activation of the NF-κB pathway
+sticks
+10-15
+HLA-A * 30:01
+location of further downstream out of frame stop codons
+5.2 months and 10.8 months
+splenectomy
+Agrobacterium culture carrying empty pGD-35S plasmid
+B and T cells
+prospective, observational
+14.0%
+total SPS scores
+reporting precision
+parvovirus B19
+H-indices
+neutralizing activity for 13.6A
+type I IFNs
+hypertension
+TLR2
+amastatin
+Various hypotheses
+scissile
+free energy values
+10 ms
+underreporting of dietary intakes in obese adults
+EMICT
+guanidium-based lysis buffer
+Colonel Samuel Bel-Nono
+hormones and gender
+1, 2, 3, and 4
+Nagelkerke Pseudo-R 2
+Procalcitonin
+MTT
+gastrointestinal
+protective
+complexity of geospatial patterning
+Hsieh & Cheng
+multiplexed
+1104
+Protein degradation rates
+electrophoresis and fluorescence analysis
+mitochondrial glycolysis pathway
+April 27, 2009
+10, 5, and 3
+embryogenesis and organogenesis
+does not produce any spores
+points and animals
+www.dovepress.com
+two
+Over 85%
+lung parenchyma
+potential intronic variations
+360
+plaque size and virulence
+seven
+herpes family viruses
+γ δ T cells
+oxidative protein unfolding
+Ct
+>7 years old
+neuroanatomical
+a safe and stable vaccine with long lasting immunity
+100
+MATLAB
+low probability of all trees
+CD4 and CD8 T cells
+5.3 cases per 100 ICU admissions
+Digested plasmids
+smoking
+abundant levels of NSs
+supplementary material
+BBP
+adipocyte phenotype alteration
+myricitrin
+viral isolation, vaccine development and production
+bigger
+review design and manuscript proof reading
+phage 6
+the means of the three independent experiments
+CEACAM1
+genotype or allele frequency
+convenience sampling
+48 hr
+Mathematical models
+false-positives
+4x10 5 cells/mL
+negative
+perforin
+statistical significance
+invade
+two
+conformational alterations
+16
+The last well
+Weighted inclusion of all elements
+severe acute respiratory syndrome
+Pneumococcal pneumonia
+protective
+219 bp
+residues
+21%
+ovine colostrum
+pulmonary Nogo-B expression
+gel electrophoresis
+Lysozyme
+Human NK cells and macrophages
+inflammatory
+Over-expression of different types of NPIPB and NPIPA genes
+Gel densitometry
+36 h
+Frameshifting
+52.2%
+763
+those alignments often do not conserve the reading frame
+interest
+inflammatory cytokine profiles
+regulatory
+Regulation 178/2002/EC
+oral immunization
+900,000
+Alum
+n
+1.02
+chemokine binding to their specific receptors and glycosaminoglycans
+PSEN1
+80%
+September 3, 2019
+many commonly used drugs
+soluble aggregates of EGFP
+enhance maturation and type I IFN production in PDCs
+anti-inflammatory
+30 days
+Oxford-Diffraction XCALIBUR E CCD diffractometer
+mRNA expression of CXCL9
+5
+increase the N F /n ratio
+990
+associate and assemble at the plasma membrane
+HHD mice
+Special care
+Shearing
+incident power
+MT
+viniferifuran
+leader± body base pairing
+Km and Kcat
+Centers for Disease Control and Prevention
+latitude, population density, and the proportion of children
+the government
+membrane proteins
+viral −1 PRF
+data
+UNDP-PCR assay
+Samples of right and left lungs
+BW25113
+Vaccination
+subsidize government sector salaries
+red blood cell
+Demetrius, Gundlach and Ochs
+Bio-Plex Manager Software
+442 nt
+13.25%
+N
+6.4-8.6 µM
+Two
+tedium
+dissociate
+12
+100
+cc-by
+CrebA
+268
+4 weeks
+operons
+MAC
+inflammatory cell recruitment into the lungs
+BIRC5
+1.8%
+24 h
+Transmission studies using reverse genetics
+less than 0.1
+50%
+circular genomes
+11.7% and 3.5%
+3
+δ-crystallin
+H5 HA
+larger funding
+pulmonary capillaries
+20
+additional cases of virus hijacking events
+specifi c therapy
+PRJEB14938
+TCM theories
+admin-istration of antibiotics
+memory cells expressing CD38 + IgD − cells
+MEK-inhibitors
+digital droplet PCR
+axonal swelling and breakdown
+individual social distancing
+group A healthy enriched B case enriched
+high price
+linearized DNA
+impaired monocyte function
+helps virion assembly
+ACE activity
+Five
+YLDSNNFPW
+to effectively provide the evolutionary benefit
+binding free energy differences
+ORR
+12-fold
+1536
+Systematic identification of potential target proteins
+Twenty eight
+epigenetic regulation
+SD
+10
+27
+therapeutic
+diabetes and multiple sclerosis
+spherical or cup-shape
+personal resources
+selection schemes
+significantly enriched
+2009
+100
+a list of query viral protein sequences
+78%
+about every ten years
+end-point titration technique
+dengue, malaria and leptospirosis
+30%
+2 : 1
+three
+Citrus psorosis ophiovirus
+taxol
+whites
+Magnetic Luminex ® Screening Assay Kit
+Antioxidant capacity
+antimicrobial activity
+end-oflife
+test-negative
+substrate DNA
+Oxidative
+7 days
+hydroperoxide
+18
+identifying ORFs larger than expected by chance alone
+RNeasy minikit
+HIV and hepatitis
+germ-free
+76
+overphosphorylation
+Glycyrrhizin
+viral replication complexes
+17%
+limited access
+heat shock
+TRX2
+inactivated virus preparations
+bacterial diversity analyses
+Economic development
+resistance to beclabuvir
+p62/sequestosome 1 TBK1
+man flu
+DCs and monocytic cells
+ML is much cheaper than HP
+17.0
+130-fold lower
+intracellular cholesterol homeostasis
+mAb 4G2
+Alveolar macrophages
+USP28
+NCCN Guidelines
+two
+cardiovascular disease
+alterations in the solubility and conformation
+demographic heterogeneity dictated by V
+photosynthesis, transcription, and translation
+gs6
+Public health decision making
+nicotinamide adenine dinucleotide
+one year per demarcation
+Mortality due to LRDs caused by CRVs
+ENaC
+IFN-κ
+iatrogenic and AIDS-related KS
+lungs
+greater-than-template-length products
+Serum from H5 HAlo infected mice
+lung tumor cell lines
+Five
+black boxes
+one reflection
+reduced MeV F CSE
+Hand washing
+A/WSN/33 virus segment 2 mutant libraries
+70
+CHOP
+Vi-cell XR
+patient-centered outcomes
+JMN3-003
+Microglia
+immune cells, astrocytes, chemokines and cytokines
+cytoplasmic fraction
+a moderately conserved SIM
+terpolymers
+Varroa mites
+quantitative data
+δ-secretase
+participation in the entire implementation process
+six
+4sU
+Sputum 2'-5=OAS
+five
+selectively binds to a specific sequence
+nine
+Erns and E2
+chest
+17
+2 hours
+four
+five
+Reed and Muench method 40
+isolation specificity filter
+R 0 = 1.8
+the slippery sequence
+axonal outgrowth
+cDNA
+50 μl of 50% V5-agarose beads
+pharmacologic inhibition of TLR signal
+amantadine and oseltamivir
+necessity
+tree
+Appendix S1 Equation
+Jackson Laboratory, USA
+StepOne TM System
+Economy Class
+Recombinant protein
+100 mm
+particle to infectivity ratios
+0.6%
+production of stable cell lines
+convergence
+sevoflurane
+Big Dye Terminator v3.1
+7
+16,723
+pancreatic lipase
+2003
+Flow Jo software
+RT-qPCR assay
+1966
+systolic volume and pulse pressure variation of 10% or above
+15 min
+7 to 37
+IFN-β
+Screening for aneuploidy
+a sufficiently sensitive cell type
+Severe
+enhanced the production of interferon-β
+proteomics
+a specific ratio of enzymes to structural proteins critical for virus infectivity
+fimC and mat
+cardiomyopathy of sepsis
+VSV*DG
+cascade reactions
+historical healthcare records
+sepsis-induced immunosuppression
+The certainty of evidence
+monoclonal anti-NDV/HN antibody
+six
+cost, complexity and local acceptance of their use
+non-adjuvanted vaccine
+nine
+Responsible and accountable focal points
+Ang II
+S-nitrosylation
+VLP mutants
+no similarity between lineages
+central or lymphoid memory cells
+a core hydrophobic sequence of 16 amino acids
+likelihood profiling
+eqTHN_del_GPI
+quercetin
+once per week
+E
+21
+58%
+cDNA clones
+bell-shaped
+placental
+Recombinase polymerase amplification
+acacetin
+inhibits the production of IFN in canonical autophagy
+Fibronectin
+T cells
+Arrows
+CTT, TAC and TTT
+Nodes and edges
+Extrapulmonary
+Adherence status of the participants
+PBS
+9 %
+26
+9.1
+word2vec
+infections, medications, vaccinations, sun exposure and stressful life events
+Contrasts
+TRIM56
+20% incorporation of whole blood in LAMP
+slightly larger
+Bacillus
+tdFLIM
+The entomological inoculation rate
+pragmatic
+COOT
+RSCU values
+AKI biomarkers
+DG init
+American Spinal Cord Injury Association
+every four months
+FlowJo software
+eQTL-associated conjugation DMEs
+thrice
+critical
+interstate arrangements
+10%
+StructMap
+3 November 2014
+67
+attenuated growth phenotype
+closer ortholog
+2-DE based proteomics
+gene reassortments
+5 days
+Venturia canescens
+445
+attachment of a protein to a surface
+phosphorylated histone H3
+regulation of gene expression and translation
+clinical data and previously identified biomarkers
+Three
+a different clinical course
+0%
+saturation
++1 frameshift
+Nova Scotia's neighboring province
+Easterners
+6.0
+light-dependent
+Two
+1997 and 1998
+filter adjustment
+viruses
+Aromatase
+impairment of the insulin signalling pathway
+de novo viral protein synthesis
+over 1 year
+Residues in antigenic epitopes
+tumor cells
+group I and group II
+39
+more attention
+177
+precautions
+TRIF
+532
+target vaccines
+Viral growth
+a linear relationship
+205
+defined T cell epitopes
+€1.05 million
+all the facts
+fatal
+normal aerobic fitness
+Effective control of all the analytical steps
+A2676-A2679
+JH6 and JH7
+protein precipitation
+48 hpi
+formal probability distributions
+Declaration of Helsinki
+selective destruction or physical separation of mismatch-containing heteroduplexes
+Influenza
+ampicillin
+improving the underlying mechanisms of the disease and exploring new therapeutic approaches
+Polyethylene glycols -siRNA conjugate
+electrical stimulation
+technical limitations of high-throughput sequencing
+2,692,325
+229
+Stealth™ RNAi Negative Control Duplex
+70%
+17
+Fop
+JEOL 1230 transmission electron microscope
+decreased cell adhesion and migration
+l-arabinose
+distal pancreatectomy
+a similar format with different attributes
+mouse mammary tumor virus
+Immunization, Antigen, and Antigen Presenting Cell
+maintain a distance to a sick acquaintance or relative
+standard curves
+more than 50
+treatment and/or reassurance
+Childhood respiratory tract infections
+vaccination
+16
+influenza
+strong pathogen-killing effects
+FluA or FluB purified protein IgG
+age
+1
+312
+2005
+Subgroup
+four
+Steffen et al.
+zoonotic spillover
+Na + /K + -ATPase ATP1A1
+absolute quantitation
+lower
+The box enclosing the dots
+Bovine viral diarrhoea/mucosal disease
+which sequences are minimally essential for function
+proviral or antiviral
+ethics approval
+reduced
+inhibition of the virus dependency factor furin
+eYFP component
+CLE model
+Six
+transport
+UTMB Institutional Animal Care and Use Committee
+vaccination
+CUUUGA
+.50%
+T-cell clonal exhaustion
+TNF-α and IL-6
+tissue damage, necrosis, apoptosis, and inflammatory cellular infiltration
+the entire liver
+production of NO
+population size
+red dot box area
+In-fusion SMARTer Directional cDNA Library Construction Kit
+colorimetric
+HIV
+5 g/L
+alveolar compartments
+Chest radiographs
+Adjusted odds ratio
+Close contact
+4132
+get serious long term effects
+Perception about a country's preparation
+2000-8000, 10,000, and 70
+an ancient coagulation factor
+IFI27L2
+15 min
+programmatic analysis and overall feedback
+apocynin
+HTSeq-count 56
+APN/CD13 molecule
+invasive
+Post hoc analysis of pairwise comparisons via Bonferroni correction
+drisapersen
+10
+DyeLight 488 labeled Streptavidin
+apoptosis
+cerebellum
+upstream ORFs
+CSU Veterinary Diagnostic Laboratory
+All Delphi discussion participants
+all patients withdrawn from the study, safety data, and deaths
+two
+TIM-4-sufficient
+prophylaxis
+10,000
+ring vaccination and space flight
+MRC Centre for Global Infectious Disease Analysis
+evaluating the disease severity and prognosis of the HFRS patients
+Contact tracing
+Tukey's Honest Significant Difference method
+caveolin-1
+hepatocarcinoma cell line
+chromatin-associated cyclin-dependent kinase 8
+A549 lung adenocarcinoma cells
+P-Selectin Glycoprotein Ligand 1
+EV production
+receptor protein folding
+contacts between apolar patches
+PIV
+Standard recombinant porcine IFN-γ
+SAROTUP and MimoDB
+point of care
+Drug resistance
+regulates differentiation
+to assure secure transactions
+both sequences supporting non-homologous crossovers
+tissue injury
+HSV-1-tk
+remarkably reduced reproductive performance
+protein levels
+fluorogenic labeling
+22%
+Two
+oval-shaped
+substrate stiffness
+Tetherin
+Further studies
+q~0:7
+Prevention
+21.8%
+CTF RNA
+2.5-3.5
+Cardiac remodelling
+Plasmodium falciparum CSP
+total cellular RNA
+genes
+Imaris software
+B lymphocytes
+Taconic Laboratories
+GPGR/Q/K sequence
+cholesterol mislocalization
+interest
+Peak VO 2
+RT-PCR
+encoded amino acids
+H7N9 virus specific antibodies
+epitopes not shared with sGP
+multiple chains of mean duration T
+Half
+HMCK
+5
+37 kDa position
+500
+plaque velocity
+SeqTrack
+Human Papillomavirus Type 16 Infection
+NG2-positive neural progenitor cells
+hubris
+3-fold higher
+inducible Treg
+Workflows and input/output data
+crucial
+48 million
+72 hours
+BAP31
+hundreds of thousands
+E. coli
+regression analysis
+HBZ
+increases in susceptibility to virus-induced cell killing and changes in global gene expression
+conidiation
+No necrosis
+17
+acute encephalitis
+phosphorylation of JAK2
+reduced
+Species identification
+effective viral clearance
+10,000
+120 DNA tetrahedra
+424
+globally compromised
+quantitative predictions
+keratinocyte growth factor
+pseudoknot structures
+hospital infection control teams
+antiviral and hospitalization
+proinflammatory
+Controlling brain edema
+via SDS-PAGE
+designing of universal HPV T-cell vaccines
+61
+CNGB1
+Non-ciliated club cells
+three
+rRT-PCR
+regulating IFN immune and inflammation responses
+sucrose gradient
+2000
+immunity, virulence factors, contact type and patterns, and climatic conditions
+Philippine forum
+7
+similarity
+Protein Data Bank
+Bean yellow dwarf virus
+1995
+microbiological
+BiV pacing
+CRF-AD35, B, C, and D
+peptide signature
+seabirds
+pulmonary edema
+competing interests
+e bi
+Our assay
+distinctively
+SD
+different definitions of parasites, pests and pathogens
+at least three
+heat-related illness
+grouper samples
+Charles River Laboratories, Inc
+splicing correction assay
+JAK/STAT pathways
+Five
+dimers and even polymers
+once the intervention trigger threshold was reached
+perceived fear
+Accession numbers
+8.5 days
+GRP78
+unknown
+68 %
+tracking structural integrity of the MCAD protein
+A reproducible source of considerably purified Clara cells
+Spo0A
+80-90%
+Bill and Melinda Gates Foundation
+0.18 and 0.05 μM
+metabolism, survival and innate immunity
+Quasispecies genetic complexity
+IFN induction
+experimental data
+TMS
+90%
+SEAP production
+Mer-mediated efferocytosis
+22%
+antiviral
+Data gathered from multiple sources
+Modified probes with 5-mm spheres
+RNaseL
+AT I cells
+disease prognosis
+CD4 + and CD8 + T cells
+A sepharose beads
+postal codes, counties and states
+NLRP3-mediated pyroptosis
+higher
+3,340
+the WB with the recombinant antigens
+usefulness of national or regional level trends in incidence or prevalence
+linear scanning
+protein A agarose columns
+10 210 -10 27
+6 h
+9 out of 14
+LN metastasis
+RT-PCR assays
+toxicity
+Materials & Mehtods
+57%
+Epithelix Sàrl
+inflammation
+3 h
+paclitaxel
+CTD phosphorylation
+C, U, A, G
+contigs
+leucines and isoleucines
+present in a hospital during their admission for other reasons
+1-day-old
+viral genome alterations
+transmission electron microscope
+red blood cells
+Robert Wood Johnson Foundation
+mPK −1
+three
+64
+differential access to healthcare and noninsured health coverage
+Overexpression of CXCR7 and additional CXCL12
+Huh7 xenograft model
+bipartite or multipartite
+DNA microarrays
+Five
+multi-basic cleavage site
+51 days
+contact tracing
+Strand-specific primers
+brome mosaic virus and cowpea chlorotic mottle virus
+abnormal behavior, clinical signs, or mortality
+lethal immunopathology
+SYFPEITHI and BIMAS
+paracetamol toxicity
+pIFN-γ
+Malaria
+African green monkeys
+qRT-PCR and viral load
+~210 6 /mL
+apoptosis, oncogenesis, and cellular growth and proliferation
+PND4
+Yates Chi-squared
+RNA gel shift analysis
+sexual contact
+a lincosamide antibiotic
+2%
+ALI
+GuHCl
+Interevent times
+Extracting a restricted list of features
+BTV NS4 or GIV NS4
+quantifying in vivo effect on downstream transcription
+de novo cap-dependent translation initiation
+Seven days
+ImageQuant
+2D
+using ten randomly selected samples from each group
+decrease in ACE2
+neurological disorders, and cancer
+FYA/FYB
+eGFP and EBOV GP
+66 kDa
+two to three times per week
+reassortment
+228
+50-90%
+Spearman correlation coefficients
+gelindependent techniques
+neurons and glial cells
+GAPDH mRNA
+~50 μL
+Binary logistic regression model
+nsp4
+essential
+Mean relative lung weights and lung wet:dry weight ratios
+hyperglycemia
+binding of sialoadhesin
+REG3γ
+Gancao
+Atlas of Coiled Coils
+supernatant
+glucocorticoids
+non-polar, polar, and charged
+pCFG5-EGZ retroviral vector
+14
+mitigating avian influenza spread
+scientists
+amino acid sequence identity
+site-speci fi c transgenics
+HA protein
+15-20%
+94
+CD103 − T RM cells
+reviewer
+30 min
+CD133 + CSCs
+to describe the methods of public health intervention
+UK
+macrophages
+statistical
+myeloid-derived suppressor cells
+Deep vein thrombosis
+Two
+$1.1%
+0.5%
+1 day
+4%
+poly
+receptor internalisation and degradation
+gel-shift assays
+fatty acids
+proxies
+Phylogenetic bootstrap neighbour-joining trees
+Bibliometric analysis
+artificial Beijing
+human contact with infected poultry or virus-contaminated environments
+First stranded cDNA
+half an hour
+F
+BBB disruption
+TGF-β1 mRNA expression
+successful VSEL isolation
+Ai9 mice
+double deckers
+Western blot analysis
+3
+47 million
+100 000
+RNA MICROMAX TSA labeling and detection kit
+clathrin-dependent
+susceptibility
+CEACAM1
+Relapse
+~1,000ϫ coverage
+stimulates the IRE1 and the ATF6 axes
+MDR A. baumannii
+HCDR3 and LCDR1
+SMARCA2-regulated factors
+drip-flow
+35.0%
+WT mice
+other possible contributing factors
+promoter activity
+53.33%
+H4K16ac
+ignorance of the contribution of the overall peptide structure to binding
+b
+GALLEX assay
+anti-Toxoplasma
+Syncytium formation
+milled
+an exchange between a pyrimidine and a purine structure
+Two-tailed t-tests
+ANISOU entries
+rinsing cells thrice with PBS
+66.2%
+10 min
+E ≤ 1/R 0
+when the ribosome is stalled over the slippery sequence
+Flooding
+Expertise in clinical ethics
+subcutaneous tumor model mice
+desmosomal proteins at the plasma membrane
+The value of sequence data
+blood brain barrier
+continued breastfeeding
+virus load and proliferation dynamics
+toxic
+PE
+chronic
+R package PROPER
+died
+hospitals or travel clinics
+three
+10,436
+Kaplan-Meier method
+serum-free medium
+3.12 particles per µL
+dialysis-related factors
+The design
+ssRNA and DNA
+P53
+1.0 mM
+countrylevel
+sealing
+Epithelial cells
+multiplex amplicons
+cortex and striatum
+showsnps function
+supernatant
+FTY720/fingolimod
+the SCOP database
+endothelial • NO release
+exacerbations
+Leica TCS SP5 confocal microscope
+Table 1
+the absorbance after 24 hours of cell seeding
+QX-type isolates
+an aspartate
+3 nt 5 0
+four days
+bone
+Seven
+His120
+24 hours
+Macrophages
+Hourly values of temperature
+helium
+a window of length K
+Streptococcus pneumoniae
+increases
+tractable models
+2%
+Luxol fast blue
+a pattern of virus labelling
+allergic skin inflammation
+IL-1 and TNF
+615
+nine
+miRNeasy Mini kit
+increasing social distancing
+determines that the liver returns to a size that is strictly proportional to body size
+a pair of serum
+microRNA lin-4
+p-336TT
+DNA polymerase
+HLA-DR
+further validation
+Taiwan
+75%
+Adenoviruses
+antiviral agents
+phylodynamic analyses
+three to four weeks
+SARI
+influenza and chikungunya
+43 years
+silicone injections
+personal invulnerability
+shifting this servicebased approach to a patient-centric approach
+high-fidelity PCR-amplified DNA fragments
+mitochondria-associated PHB
+a weight with a value between 0 and 1
+HuNoV-specific IgY
+DNA damage
+11.2
+58
+Montanide ISA50
+control, luciferase or ADAM17 siRNA
+24 h
+specialized
+mouse
+MZ B cells
+Fifteen out of 17
+The exact role of complement in many diseases
+TLR3, TLR7/8, and TLR9
+mononuclear phagocytic system
+disorderpromoting residues
+Guidelines
+shuttles between the nucleus and the cytoplasm
+redirect those cells to the targeted cancer cell
+content and timings
+qScript XLT 1-Step RT-qPCR ToughMix
+ewe192-B5
+oxygen-dependent phagocytosis
+significantly reduced virus release
+mice
+housekeeping functions of autophagy
+SFPQ/PSF
+higher household and workplace transmission
+pitavastatin accumulation
+BCPREDS server
+66.6%
+1909 kcal
+Tetramers of p/MHC I alleles
+PPs
+Dynactin 1 and IFITM3
+17
+Pepro Tech
+redox
+Promega genomic DNA kit A1125
+SPSS statistical software
+size and, more importantly, location
+CEM and Jurkat T cells
+S-palmitoylated
+behavioural interventions
+virus binding and internalization assays
+Ovation RNA-Seq primer sequence
+Thirty-seven
+Figure S1A
+how you are feeling and if you have taken any medications
+random drift
+anti-HPV16 neutralizing antibody titers
+higher vaccination cost
+virology
+black dashed lines
+10-month
+L2
+increase bile flow and decrease bile acid concentration
+ammonium-dependent
+possible, probable, and proven
+severe eutrophication
+Transcription of IL-10
+Phylogenetic analysis
+EMBOSS antigenic
+B-1a cells
+to avoid unintentional contamination
+fungal contamination
+e β
+ALT and AST enzymes
+1068 days
+DMEM containing 2% FBS
+spatial information about mRNA molecule distribution in the cell
+HT vectors
+decreased
+monkeypox
+30%
+Escherichia coli peritonitis
+the alternative complement pathway
+6
+IFN-β promoter activity
+anti-malarial vaccine candidates
+cAMP
+magnetics, optics, and electronics
+endocytosis pathways
+13
+75,000
+variable ratios
+22
+four
+94%
+virus replication
+GLE1 and NUP214
+Acute fibrinous and organizing pneumonia
+More details regarding the epidemic model and the Stan code
+DRAK2
+Nuremberg, Germany
+recombination breakpoints
+Olympus IX70 photomicroscope
+Mycobacterium avium paratuberculosis
+I i
+Text S1
+angiogenic
+perceived protective behaviors
+Fourteen
+0.18
+1450
+patients with fungal infections
+whether they reliably identify GAS infection
+Pulse oximetry
+secretion of watery saliva
+12.5%
+11
+Enhanced regulatory oversight
+deep mutational scanning
+December 2015
+G3BP1
+reagents
+higher values of T
+real time assay
+10% mortality in compensated cirrhosis
+Formation of active replicase complex
+activation or inactivation of inflammatory peptides
+Acyclovir
+Issues/bug reports
+60
+BioStation ID system
+Mass spectra
+self-evaluation, peer review and voluntary external evaluations
+nasal DNA vaccine delivery
+oxaliplatin
+CG-atoms of different Vpu structures
+HCMC
+macrophage inflammatory protein -1α
+adenosine
+oceanic
+Classification and regression trees
+dehydroampelosin B and viniferifuran
+Large-scale virulent B. bronchiseptica cultures
+83%
+CA II
+Areas with observed bias
+three
+RNA extraction
+Bcl-x
+age, sex and residence
+High-dose infusions of Chase
+4.42
+RPL4, EEF1A1, and RPS23
+PERC
+lung disease
+genealogical
+c and the offset in the power law kernel
+13 947
+Fluorescence
+higher infection rates
+12
+13,649
+429
+in accordance with predefined criteria
+10-20%
+Kuhn length
+animal deaths
+Table S2
+the pHvalue
+microglial subpopulations
+HFD-induced additional weight gain and calorie intake
+patients, families, and the team itself
+$US 2500
+CoMFA and CoMSIA descriptors
+HTLV-1-positive
+pattern recognition receptors
+make the game safer
+MyImageAnalysis
+84 months
+37
+recombinant human TGF-b 1
+Twenty-four hours
+T regulatory cells
+mRNA and protein
+field data
+mortality
+Removing the data for more viruses
+MTG-LASSO
+64.2 years
+80%
+untreated infected cells
+fixative
+two-dimensional
+156
+SO, SM, RK and GM
+data collection tool
+Influenza A of subtype H9N2
+nuclease cleavage
+molecular docking studies
+SE = ln) / 1.96
+3-valent serum
+BLASTn
+gradient centrifugation
+TNF-α and macrophage inhibitory factor
+airborne particulate matter
+concentration dependent
+ProteinChipH Data Manager Client 3.5
+by spiking in known amounts of heavy-labelled peptide analogues
+STAT-1 and IRF-7
+the body of the deceased
+severe atrophic enteritis and villous fusion
+Student's t-test and Fisher's exact test
+tFAK and β-Actin detection
+TRIzol
+n j
+APACHE
+Ang-,
+humidity
+nasal washes with high viral titers
+The proposed algorithm
+21
+a potential incident of self-contamination
+Information on the efficiency and proportion of particles that contain detectable EdC
+ambulatory follow-up
+148
+Folder Automation Software
+extraneural sites
+Br-ApoE
+endosomal membranes
+Peak oxygen uptake
+T RM cells
+caspases
+manidipine
+any improvement in respiratory system compliance
+three
+plaque burden and Aβ levels
+Chromosome 11
+five
+animal models or mere observational patient data
+Absolute extraction recovery
+our study
+Prognosis of a disease
+hepatic insufficiency and renal failures
+1
+$383 ± 93 nM
+SNPs
+Chrysin
+TLR2 and TLR4
+Multi-level repeated-measures modelling
+44%
+the same
+2-fold
+Human immune cells
+IL-4/IL-13 stimulation
+indicators of mental illness
+PLA
+bioinformation software and molecular immunology
+ECH0825
+Magnetic bead capture
+nearly 400,000
+seven
+observed SARS data from China
+dinucleotide biases
+15 min
+pivotal
+Panels
+peripheral CD4 + T cell count
+Dennis R. Burton
+extracellular and intracellular pathogen counts
+E90R and D91N
+low-income countries
+three
+small sample size
+genetic drift
+in a discontinuous gradient of sucrose
+identifying GH-dependent phosphosites
+lock files
+Oligonucleotides
+Background luminescence
+the task
+Cq values for amplification and amplicon melting temperatures
+Solvent
+PottersWheel Toolbox
+Cav-1
+LSV specific primers
+statistically significant
+extreme lack of trust
+Protein jagged-1
+350-525 nm
+40 µL of CellTiter-Glo 2.0
+regulation of autophagy
+binary logistic regression model
+10 μL of WST-8
+80 mL
+immunoregulatory
+Bacterial pellets
+645 nm
+three
+N 1 -methylguanosine
+an authentic mapping from nt 1 to 317
+MxA
+self-report data
+water collection points
+Serum
+Old World and New World
+mice
+⊆
+megapeptides
+color-coded microspheres
+tropical rain forests
+Nab resistance
+pathogenic
+NLRP3
+Kα2
+58
+Inter-rater reliability
+Lipofectamine 3000 kit
+344
+16
+M isperceptions of risk
+elevated levels of IL-10, IL-6 and IFN-g
+,10 mm
+Insect parvoviruses
+Agresti-Coull method
+wild products
+TLR4
+Immunofluorescence
+follicular germinal centres
+Exacerbated disease and mortality
+Redox imbalance
+Institutional Ethics Review Board
+spill-over infection
+Ruthenium complexes
+Hospitalbased CLs
+severe hypoxia
+80%
+AM22 and D25
+three
+misclassification of vaccination status
+Serological tests with IgA anti-tTG
+band of high molecular weight
+renal lesions
+GraphPad Prism
+0.05
+T. equinum is highly closely related
+Modified residues
+The S H
+miR-373
+50%
+Prevalence data
+endogenous siRNAs
+1.1%
+4-11 day old
+MagMAX™ Viral RNA Isolation Kit
+Figure 8
+lentiviral pseudotypes
+IgY anti-STAg
+supernatants
+.50%
+92%
+Twelve
+88
+testis-expressed genes
+norepinephrine and dobutamine
+get vaccinated
+Hong Kong Hospital Authority
+35.5 ears
+the mechanism of entry of other filoviruses
+ClustalW2
+combinatorial genetic analysis
+psychological
+inflammation
+personal relationships
+Protruding RNA
+real-time reverse transcription polymerase chain reaction assay
+50-90%
+Hantaan virus
+Echotoxins
+CD4 and CD8 T cells
+four
+92%
+The growth of the 1942 strain
+Forecasts
+PER1, PER2, CLOCK, and BMAL1
+amplify a 91-bp fragment specific to pAD2TE1 mRNA
+High production of both IgM and TNFα
+NH4Cl and BafA1
+Three
+Pseudoknot
+CSF1 and IL34
+HutC
+42%
+by ultrasonication
+sodium
+S r
+6
+Eight
+within normal limits
+98,200
+34%
+p values
+protein-level
+Edouard Bertrand
+Assiut University Hospitals
+coadaptation
+the activity of mTOR
+I-HC
+independent pulldown assays
+SQL server
+resistance to BmNPV infection
+pandemic H1N1 and chicken H5N1
+EMCV
+Group IV
+Figure 4
+demonstrable capacity to mitigate public health risks
+brain natriuretic peptide
+Prior infection of both cell types with PRRSV
+shorter DFS
+five
+number and percentage
+Classical SELEX
+malaria-infected
+178
+increase the virulence
+modules for plasma and serum separation
+Re]
+Standard solutions of DMF
+proxies
+Chisquare test or Fisher's exact test
+p<0.05
+0.9%
+.26
+J Christopher Farmer
+Ctenocephalides felis
+3
+ICP34.5 gene
+CD11b
+CD40L
+Maximum supplemental oxygen use per 24-hour period
+eight
+tryptophan
+ILC3 cells
+15-80%
+8% per year
+pneumoniae
+Materials and Methods
+nuclear atypia
+Dysgenesis in sex organs dependent on androgen/AR-driven development
+DENV-2 E protein
+activate distinct pathways of the cellular UPR
+SVM
+3.43
+Aquaporins
+molecular weight shift
+mycobacterial
+expired air
+1.6 million
+lungs and spleen
+carbapenems
+Aurodox
+thrombin-antithrombin III complex activity
+1,296
+Social support
+human TRIM25
+Enhanced Chemiluminescence Western Blot Detection Reagents
+atomic coordinates of the RNA backbone
+propidium iodide
+dephosphorylation of ULK1
+lateral wall scarring
+GPIs and GIPLs
+Ganglioside G M1
+GENIE3
+Theta
+One in 10
+Adlhoch
+gene transformation
+discovery of new molecular scaffolds
+state of unresponsiveness
+27
+attenuates neurovirulence
+bronchopneumonia group
+bed rest and oxygen inhalation
+Integrated DNA Technologies
+LC3-containing membranes
+ATG12
+Deng Yiqun
+protein concentration
+Neuraminidase inhibitors
+very effective
+full compliance of patients with screening recommendations
+AutoDock Vina
+Western blotting
+a weak Lewis acid
+2202
+0.05
+Core Hopping
+58%
+it is not exclusive to this subset of viruses
+a duplicated print of buffer alone
+kappa = 0.81
+DWV titers
+puerarin
+STAT-1 phosphorylation
+function
+4
+in-vivo
+Structural Equation Modeling
+retinopathy of prematurity
+NZV
+3%
+several complications of T2DM
+differentiation
+1 mL of 75% ethanol
+deterioration of CD8 + T cell functions
+Sign epistasis and reciprocal sign epistasis
+LeTx
+$3%
+1.3
+post-transcriptional modifications
+peak VO 2
+Hsp27
+mild or no histopathological changes in the brain or other major organs
+138
+mass spectrometry
+Soluble forms of EBOV GP
+partially deleted viral genomes
+0.2 mg/ml
+a stab wound
+Infection
+Sangon Biotech
+recognition and timely initiation of treatment
+Sanger sequencing
+14 days
+transient social distancing
+Exosomes
+Shandong Agriculture University Institutional Animal Care and Use Committee
+human papillomavirus and arenaviruses
+targeting the ISG15 and/or the ubiquitin system
+sensitive probes
+SARS and MERS
+conjunctival disease
+Five
+Blood pressure reading
+inadequate antigen levels
+appropriate knowledge, prevention, and treatment
+Surveillance using web-query data
+inhibitory
+pandemic influenza and the West Nile virus
+wet-weight
+NiV infection
+Smallpox
+0.20 ± 0.11
+PKCa
+any information on the flexibility of the structure
+85% ± 1.3
+an upper limit
+Salmonella protease sseL
+diazepam 8 μg/mL
+T cell
+10.7-18.6%
+Photodynamic therapy
+FluWatch
+10 6 mg of DNA per reaction
+natural killer cells
+health risk and/or protection
+789 aa-long
+baseline severity of hypoxemia
+Low-current and high-frequency electrical stunning
+Engineered
+low titer of input VZV
+lateral peptide parameters
+institutional review board approval
+Imbalance of T cell regulation
+7.3 magnitudes and a depth of 18.1 kilometers
+133.5 kbp to 135.1 kbp
+65%
+major
+Pathogen specific surveillance
+TSG-6
+1700 rpm
+hypersporulating variants
+secondary structure prediction
+25 to 60%
+140
+serum samples
+RT-qPCR
+non-covalently linked
+Travelers
+several hours
+108
+two
+carbon catabolite repression and gene expression
+enhanced redundancy
+two amino acid changes
+Centricon Plus-20
+shortened maturation cycle and desirable lead developability
+liver USP18 expression
+12% SDS-PAGE
+reviewing the subject matter as well as the existing document
+reasonable
+MVA-based A vaccines
+Taq DNA polymerase
+free-grazing ducks
+three
+tight junctional
+Hoechst 33342 and propidium iodide
+2 mM
+activation of the reporter gene
+Quantitect Reverse Transcription Kit
+in vitro MHC binding assays
+FK506 binding protein 12
+35 million
+Reverse transcription loop-mediated isothermal amplification
+AURKA
+antimicrobials
+fully developed ectopic germinal centers
+MV
+Secretory IgA
+Coinfection with AIVs and a bacterial pathogen
+what pathogens are circulating
+Wuxi Red Cross Blood center
+1 M Tris-HCl
+12.9% Gln and 27.7% Pro
+stable secondary and tertiary structures
+IVC
+PeptideAtlas
+detection by inflammasomes
+Five
+ixodid hard ticks
+phylogenies
+GPUs
+Gram-positive bacteria
+$41%
+36.4%
+any part of the genomic sequence of CEA
+1 and 100 copies/mL
+infl uenza vaccine strategies and pandemic planning
+3 days
+10%
+A14 and A17
+every third day
+IL-18
+over thousand
+14.7%
+RABV
+tetramethylbenzidine
+fluorescent fusion proteins
+privileged
+chemical and structural determinants
+a database for creating and managing viral ORF clones
+2/5
+Sixteen
+Xeno RNA Control
+scRNA-seq
+C1 and C3
+near each group of toilets and near each food service area
+epidemic decline is much more rapid
+80%
+0.86% ammonium chloride solution
+intercalation of the dye
+salvage treatment
+Doxycycline, tetracycline, and penicillin
+9.7 days
+SEC-MALS
+eight
+miR-210
+hospitalization rates, intravenous fluid requirement
+18
+non-parametric
+premature birth
+Strong laboratory capacity
+colony-forming units
+SDS
+26
+diminished thymopoiesis
+Data
+vector competence
+genomes of LPAIV, EDSV, and NDV
+mice and cotton rats
+few
+recombinant plasmids
+Pseudotype neutralization
+1.06 times greater
+enzymatic activity
+dyspnea, dehydration and diarrhea
+28.6%
+autopsy studies
+both sexes
+membranous vesicles
+255
+1.14
+miR-122
+Bioscientia reference laboratory in Germany
+infectious patients
+Data
+sodium nitrite
+20 min
+KAPA Library Quantification Kit
+15 min
+F106 and A112
+Six
+QIAshredder columns
+higher than 90 C
+BEAST
+Delays in the identification and/or reporting of HPAI infection
+CYC-D
+physicians
+Sixty-two
+meta-analysis
+innate immune response
+long-term political commitment, training and resources
+immunity
+Information
+lymphocytes and plasma cells
+optical density
+P-values 0.05
+mosquito
+how proteins are trafficked to MVBs and exosomes
+Minimum Information About a Microarray Experiment guidelines
+2250
+up to 10 years
+1 week
+military assets
+Vero cells
+The author
+transient
+Student's unpaired t-test
+our use of multiple scopes of statistical significance
+Further studies
+HT01 and an HT01/HT02 heterozygote
+cc-by
+interferons a and b
+DEAD-box helicase
+Respiratory syncytial virus
+differ
+15 Å
+15-HETE
+Partial chain termination
+EUMS
+VacA-mediated
+primed template
+TRIM56
+Demographic data
+161
+supporting predictions of elimination
+blood-brain barrier permeability
+75%
+35% glycerol
+Lymphocytes and alveolar macrophages
+virome
+Three
+39.5 ± 0.11 degrees Celsius
+oral vaccines
+China Animal Health and Epidemiology Center
+viral spillover
+N-linked glycosylation
+Estimates of resource gaps
+kinetic effects
+WGA
+two
+Table 1
+num-bers
+a value between 1 and 20
+3
+endocytic vesicles
+Targeting homeostasis and repair/inflammation
+75%
+NS1-GFP
+5.948EϪ4 substitutions/site/year
+bioterrorist attack
+blood cultures
+17.5%
+53
+chronic inflammation, tissue damage and fibrosis
+patient identifiers
+nucleases
+Statistical significance
+ATF4
+IL-10, IL-12 and IL-23
+acute organ dysfunction
+At the edge of the FG loop
+hypertension
+disease recurrence
+zero
+Bid-regulated apoptosis
+$19.3 billion
+80%
+vasculitis, dermatomyositis, and organizing pneumonia
+President Obama
+vulnerable motor neurons
+Protein complexes
+brings the activating UCE sequence into close proximity with the core promoter element
+reverting to a more traditional lifestyle
+timing and/or site of ZIKV infection
+independent of their known relevance to infectious diseases
+artificial miRNAs
+Susceptible
+26
+multiplexed plasmids
+Ottawa Health Science Network Research Ethics Board
+two
+Feline Parvovirus
+initial pathogen invasion
+fewer intermediate nodes
+longer time effects
+inflammatory response
+246
+a second alignment and maximum likelihood phylogenetic tree
+37 • C
+Women with incomplete baseline data
+section 20
+Picornaviridae
+CD4+ T cells and STAT4/6
+single mutations in HN
+Pietermaritzburg
+The level of polymerases that scan through the whole genome
+39,305
+viral vectored gene therapy
+14
+positive
+research on microbes in the built environment
+Gram-negative
+prevention rather than treatment
+Pichia pastoris
+18 hours
+family tree
+four
+PR3 concentration
+septic shock and trauma-induced SIRS
+pMark-S
+Luohanguo
+50%
+honesty
+near or at the base of IHC sensory cells
+American Type Culture Collection
+monitoring side effects
+40%
+Fifty-and eighty percentmaximal inhibitory concentrations
+data
+fusion between viral and host-derived membranes
+lack of information
+May 2002
+2013-01-11
+occasional problems in the initial experience
+conidia
+Table 5
+conformational changes
+HCMV Merlin
+2006
+HBx and CRTC1
+Each translated pool
+2 months
+interferon activation
+bovine
+2024
+T4 ligase
+pediatric hospitals
+functionally important
+repulsive potential
+partially restored IGF-1R levels
+nitrocellulose membranes
+an artifactual degradation of L1 RNA
+lower mean cumulative number of lesions
+160 million
+replication inhibition assay
+Mg 2+
+exogenous IFN
+integration of the activities of the different systems
+High Capacity cDNA RT Kit
+reducing transmission during funerals
+gene identified from the primary screen
+data-constrained models
+TIIA
+14 days
+University of Pittsburgh Institutional Review Board
+~35,000
+acquiescence and extremity
+two
+a role of SP-D in atherogenesis
+N-terminal lectin domain
+MDA-MB-231
+Data that could not be found in individual articles
+p300
+the chain size that is considered anomalously large will rise
+performing useless and costly experiments
+H3
+14%
+20 minutes
+Differences in viral loads
+remarkably high levels of expression
+non-diseased lung tissue
+ChemoProphylaxis with Sporozoites
+wildlife officials
+smaller-sized
+twice
+Burkitt's lymphoma
+vaccines
+eIF2•GTP
+an inaccurate assessment of prognosis
+NTM co-infection
+to thwart enteric Shigella infection
+Invitrogen Superscript III cDNA synthesis kit
+a potent proatherogenic factor
+more than one antibody fragment
+fever, cough, rhinorrhoea or sore throat
+rabbit polyclonal anti-Listeria genus-specific antibody
+suppression by other MARV proteins
+Dr. R.G. Webster
+£20.4 million
+ubiquitinates lysine 18
+phages
+necropsy
+Non-parametric Kruskal-Wallis test
+19
+seven
+Chronic lymphocytic leukemia
+10 min
+poliovirus fadeout frequency
+HBV and HCV
+VSV RNA
+PARylation
+20 mg/kg
+Peking Union Medical College Hospital Institutional Review Board
+m4G2
+Poor governance
+mtROSinduced NLRP3 dependent pro-inflammatory responses
+R 2 0
+a Markov chain
+XMRV Env-mediated membrane fusion
+the following points
+flu virus neuraminidase
+reciprocal sign epistasis
+mid twentieth Century
+HAP
+microgravity-sensitive
+alveolar macrophages
+3.2
+C
+five minutes
+90,000
+high sensitivity values
+African and Portuguese
+fluorochrome conjugated monoclonal antibodies
+Social interaction
+TACE shRNA
+4-15
+RNase A and T1
+pT183 and pY185
+The death rate for all compartments
+Fcc receptor IIIA
+565
+50 mg/mL lysozyme and 0.1% Triton
+rescue experiments
+product complex
+ortho-dihydroxyphenyl group was absent
+peptidases
+A
+high bed occupancy
+Per a 2-specific IgE
+Lipid rafts
+serine hydrolases
+1 h
+96
+schizophrenia with auditory hallucination
+1 hour
+Protocol deviations
+zanamivir
+U-I/C ED group
+repressed expression
+guinea pigs
+environmental and social
+pumps
+reliable incidence rate estimate
+Anatidae
+protocolized continuous insulin infusion
+exon 12A
+His-Mermaid
+Timothy McVeigh and Terry Nichols
+Any descriptions too long for the figure legend
+asbestos-induced collagen deposition and fibrosis
+burn patients
+Pseudomonas syringae
+ENC-plot
+all relevant feedback and comments
+Flow cytometry
+longer lived residual condensed foci
+mouse bone marrow-derived macrophages
+Serum samples
+the disease caused by SARS-CoV-2
+DNeasy Blood and Tissue Kit
+Centrifuge and Kraken
+protein kinase C
+nanogel particles
+Food Industry Research and Development Institute
+RiboTag translatome profiling
+wood shavings
+four times
+surveys
+terminal sialic acids
+differences in sensitivity of proteomics methods
+57.38 g/l
+demographic functions
+methanol
+60 300
+one third
+Unlikely contact
+nonsense-mediated decay and subsequent loss of protein
+Cytokines and chemokines
+based on the formation of syncytia and nuclear aggregation
+Multidisciplinary
+two
+a i = 1
+ALI/ARDS
+18.1%
+five
+optimism
+Six
+420
+NAb
+TCs cycle and proliferation
+acceptable
+faster
+helix
+1983
+biological samples
+made dramatic statements
+RNA
+DAVID and KEGG databases
+dityrosine C-terminus
+five
+19
+92.3%
+the length and the mutation rate of the considered DNA sequence
+Table S4
+Nppa and CXCL11
+neuraminidase inhibitor
+Panels A and C
+Toll-like receptors 7 and 8
+sites of injury
+28-day mortality risk
+1700
+Ca 2+ and Ni 2+
+80%
+enhanced
+miR-146b-5p and let-7g
+Cidofovir
+to activate selected precursors
+Sixty-eight
+untagged
+Primary antibody omission
+over 25 years ago
+immune deficiency syndrome and tuberculosis
+tRNA Lys mnm5s2UUU
+Invariance of the energy under rigid motions
+Wales and Scotland
+to maintain a native-like environment and increase conformational stability
+nidus
+capillary morphogenesis
+Acclimation temperatures
+1:10
+Heteroplasmy
+150 pg/ mL to 300 ng/mL
+Expansion, enhancement, and integration of maternal and early life immunization
+the world's number-1 health threat
+plasticity
+fever
+ancient DNA
+Shino-Test Corporation
+thermalcycling
+human
+ORF1 and ORF4
+Trafficking proteins
+12%
+G6PD deficiency
+brain tissue
+three
+shorter
+theatres
+factors that govern host susceptibility to leptospiral infection
+10
+Eighty-eight percent
+Belgium
+wide spectrum antibiotics
+a representative
+DNA loads
+hyperinsulinemia
+T 3
+Thirtyfive
+functional neutralization assays
+frequent intra-segment recombination and an error-prone polymerase
+7.5%
+multiple compounds presented in the formula or complex prescription act synergistically
+four
+a property of the underlying gene sequences
+non-susceptible forms
+bioinformatics pipeline
+proline
+CRF07_BC
+20 mM
+treatment with tazobactam and piperacillin
+particle size distribution and type of atomizer
+Hospital financing arrangements
+Avian influenza
+12.5
+resilience
+high viremia titers
+vertebrate-incompetent
+30%
+mobile phones
+anti-inflammatory
+tRNA Ser CAG
+Vb8/Vb14 CD8 + T cells
+170
+survival
+to account for loop length diversity
+3 minutes
+IVCAS 1.0228
+8
+March 2014
+225
+Non-viral gene therapy
+two
+pro-coagulant and pro-inflammatory pathways
+national borders
+98%
+p38 and ERK
+sh-EK#2mediated EK knockdown
+Typhoon 9400
+S protein
+68%
+six
+serial 10 µ m brain sections
+hypergeometric tests
+floral characters
+180 kDa
+three
+hazard ratio for ICU death
+antiviral NP and anti-alpha acetylated tubulin
+relatively low RNA concentrations
+97%
+Central African Republic and Nigeria
+0.60
+Bilayer thickness
+2%
+children
+cc-by
+Optical maps
+GeneMapper 3.7
+20 months
+identical virus material from the environment
+more heterogeneous delivery of the inhaled anesthetic
+6 to 8
+cross-reactive viral antigens
+27%
+nodes and their connections
+utopian
+12 688 Da
+3-6 monthly intervals
+the globulation rate
+A sterile blade
+ELR+
+a nucleophile
+37
+Six
+p-DEP effect
+>1 bit
+National guidelines for triage
+Proteomics
+3-21 days
+Human adenoviruses
+Whole-genome comparison
+Unmethylated CpG-rich DNA
+38.3%
+H275Y
+HBV substitution rates
+Salmonellosis
+IZUMO and FLOT2
+538
+necrosis
+odds ratio and chi-square distribution
+26
+four
+three
+H x,y,z
+declined
+at least twice daily
+Avian infectious bronchitis virus
+50%
+detecting known viruses
+eight
+systemic spread of virus
+clumping and precipitation of the antigen out of solution
+HSQC
+six
+m max
+28
+the corresponding author
+Caliciviruses
+15%
+p33 or p92 replication proteins
+45%
+91,000
+viral concentration methods
+CD8+ T cells
+DNA viruses
+winter and spring
+PNGase F
+Antigen-antibody complexes
+Members of the genus Trichophyton
+Biosprint One-for-all Vet Kit
+compromised
+they represent non-coding RNAs
+Phyllanthus urinaria
+0.591
+fecal-oral route
+site I in HSA
+redox-sensitive
+2009
+resource use
+heterogeneous
+decrease
+Staphylococcal enterotoxin sensitization
+38 of 39
+9.7%
+genetic resistant
+17 days
+strong
+GIS
+linear regression models
+13%
+a library of antibodies
+virulence
+293T
+LPL, IEL, and FRT
+Definitions, basic theory and discussion of further results
+Infectious bursal disease virus
+FMOC peptide synthesis chemistry
+154 and 389
+porcine coronaviruses
+40
+immunofluorescent
+Information of crystal structures of protein-peptide complexes
+spore-forming
+the percentage of proteins annotated with each GO term
+SureSelect Human V4/V5 enrichment kit
+56
+carbohydrates such as Me-Man, Me-Glc and Me-Gal
+17,310
+responded vigorously
+individual cellular proteins
+enhanced accumulation of renal ADAM17
+76,175
+protein gel electrophoresis
+all-cause mortality
+3.42 ± 0.52 × 10 8 relative light units
+Projected chronic disease mortality rates
+plant CRY in higher plants
+immunofluorescence
+0.95
+increase of membrane fusion inhibitory activity
+37 nm
+1,022
+CD150
+Life Satisfaction scale
+30.7 ± 24.4 days
+t-test between CON and CON-PEDV
+thermal and mechanical unfolding
+HPRT, L19 and GAPDH
+progenitor
+99%
+its own translation
+more conserved epitopes
+Tet-On system
+higher risk of fetal abnormalities
+Russia
+ΔFosB
+Cumulative evidence that might be biased
+reverse transcription
+prolonged fever and severe respiratory symptoms
+Viral leader-mRNA and M protein
+two
+T-cell activation
+41.9%
+1973
+UL33
+$100 FFU
+respiratory
+possible sequencing errors
+2 mg/ml of TPCK treated trypsin
+43
+2 µg/g FW
+2%
+pathogenesis and cell tropism
+E-site juxtaposing upstream internal SD
+1
+150
+std
+DNA vectors
+written informed consent
+virus exit and spread
+satisfactory results
+21 days
+CSII-CMV-EGFP
+healthy controls
+late referral of patients to clinics
+infection
+Lung cancer
+cytokines
+parsimony
+parasite groups
+30 000
+LPS-induced endotoxic shock
+binding affinity between host and virus proteins
+1997
+COPD frequent exacerbators have innate antiviral immune dysfunction
+NT-proBNP concentration
+paracellular charge selectivity
+Virus titers in each fraction
+all-cause
+1 in 10,000
+SPE, SLE + and phospholipid removal
+GO and HPO
+Fresh samples
+Na/K-ATPase signaling
+cell lysates or pellets
+8 days
+Twenty-four hour
+Parent or guardian
+mutation rates
+SARI cases
+immunostimulatory
+Oligo 2
+V'max FRC
+design and evaluation of drug formulations
+every 4 weeks
+given or larger area under the curve value
+media
+Leave-one-out cross validation
+infect the new host and undergo further mutation
+clinically relevant information
+smartphone 19
+Four
+type IV collagen
+seven
+correct
+41%
+half
+pVIII
+microorganisms
+NS1
+cytokines
+viral flora
+two complementary approaches
+higher proviral loads and worse outcome
+network formation
+198.6 pg/mL
+HZQ and JES
+copper sulfate
+the observed total number of deaths in a given week
+abrogate
+liver transplantation
+insoluble Aβ level
+29 234
+genes for deacetylase/isomerase/aldolase
+epidermal growth factor-like domain 7
+IL-10-expressing B cells
+CD163-and CD204-positive
+32
+effect sizes
+16h
+dengue virus transmission
+mobile phones
+Infection
+computē
+Tracking frequency of URI
+10 µm
+mean ± SD relative to the 10 μl bead samples
+further studies
+2008
+six
+97.92% to 100%
+FACs Calibur
+Flanking Sequence
+27
+120 minutes
+Correspondence analysis
+moderate to severe CAA
+B cells
+FASN
+Lung involvement of P. marneffei
+tracing
+pathogen epitopes
+10%
+reduces the costs associated with being immobilized
+up-and down-regulated
+Notch-1 receptor signaling pathway
+fluorescence
+2007
+2 and 4
+-20.4 and -5.3 kcal mol -1
+Three
+3
+Two
+0.113 to 0.148
+microbial
+Sex differences in the immune responses to influenza viruses
+ξ
+CD13 KO infarcted hearts
+71
+2,4-dinitrochlorobenzene
+cc-by
+5 minutes
+CT
+seven
+High dependency and coronary care admissions
+pathological
+improved methods for template preparation, sequencing and imaging, and data analysis
+mass spectrophotometry
+June to August of 2015
+9.5 hour
+Ang-II
+Breathing difficulties
+a lipid molecule in close contact with the peptide must significantly reduce its order
+change dramatically
+riverine buffalo
+the natural route of infection
+Nasal swab specimens
+Short chain fatty acids
+81%
+E. coli cultures
+BLASTN
+2.79
+provincial level
+500 ml
+three
+34
+4 • C
+Ang II level
+The accelerating effect and aggravating effect
+Grade GRADE
+Thirty-five
+Clinical and demographic characteristics
+knockout mice
+chest CT scan
+critical
+194
+RPMI
+six to nine points
+3D
+interactions
+70%
+Immunofluorescence
+Three days
+an exchange of three Japanese sentences or a physical touch on the skin
+HCE
+deferoxamine
+recombinant OppA protein
+homologous recombination
+shrinkage
+18
+Goat anti-ZH501
+syn-plot2
+inflammatory
+His-ES24-based ELISA
+CD133, nestin, and CD44
+2'-modified
+aberrant structures resembling viroplasms
+neuroendocrine immune network
+robustness to population structure
+specific genetic subpopulations
+Clinical and microbiology data
+59-TGA GCG GAT AAC AAT TTC AC-39
+BC and GB
+proton transport models
+Viraemia
+ACE2
+Topomer CoMFA and Ellman
+100 ml/well
+between 34 and 38 weeks
+pro-inflammatory
+luciferase
+WM volume or myelinated fibre diameter
+individual pathogens
+the full length protein
+astrocytes
+Calciviridae
+b and xmid
+sustained survival
+determinant
+comparison between PBS and vaccine treated groups
+multifunctional
+0.43
+CMV promoter
+lentivirus, adenovirus and adeno-associated virus
+four
+squalene
+long term dormancy
+SALSA derivatisation
+Human fibrinogen
+RNA residence times in NP
+code or shared libraries
+LptE
+different locations
+cross-T-cell
+rhesus macaque
+immune-mediated competition
+finding who the infector was and when the case was infected
+placental tissues
+100%
+InflA probe
+T lymphocytes
+10%
+apoptosis
+positive-strand RNA viruses
+4% paraformaldehyde
+Gag
+Serum biomarkers
+10%
+flow cytometric analysis
+DSASA
+upregulated production of IFN
+three
+HBV infection
+tumor suppressor
+more complete clearance of intact virus
+2 reverse genetic protocols
+RNA-Seq
+X =
+periodic oscillations
+P11LR and P11/LRR
+become involuted
+activity and the lack of an inoculum effect
+continuous lipid and cellular membrane synthesis
+Cat-scratch disease
+DNAs
+two weeks
+Adenovirus
+HuNoV structural protein VP1
+Severe acute respiratory illness surveillance
+Virus replication and infectivity
+unbiased characterizations of autonomic tone
+anti-inflammatory
+Oropharyngeal swab specimens
+potency
+28 DPC
+Leafhoppers
+PEARL
+target organs
+Vaccinia virus
+ATP
+N wobbles
+Bottom row
+Acute DENV infection
+12
+improvement in bilateral consolidation and groundglass opacity
+single-primer linear RPA
+three
+biologically relevant data
+viral replication capability
+15 minutes
+administrative
+19
+Apoptosis
+Rabies-specific immunoglobulin
+Titration curves
+the variance predicted by the different models
+Text S2
+children and adults
+Sex
+Disordered regions
+LOS
+small molecule chemical diversity
+86%
+XML
+western lowland gorillas
+MIP-1α
+2-6%
+Charles Gerhardt
+0603-exposed mice
+semi-conservative replication
+An ROI
+mono-negative bidentate around the metal ion
+emergent strains
+polyacrylamide gel electrophoresis
+Chimera
+nonanesthetized
+RAS
+metagenomic sequencing and de novo assembly
+impaired trafficking of infiltrating myeloid populations
+individual protocols
+58
+pigs
+Duke NUS Graduate Medical School
+fever, myalgias, headache, and pleuritic chest pain
+summary errors
+CD27 and CD28
+direct co-opting of the translation machinery
+The membrane
+Penicilliosis
+352
+Philadelphia International Airport
+sulfuric acid
+Ŷ
+mortality
+as a function of time
+Statistical
+Group 1
+collision energy of 50 eV
+Triage
+genotype II
+TIM-4
+SpectraMax M5 Microplate Reader
+text messaging
+Hundred and three
+60%
+novel therapeutic agents
+Vesp-6
+Mouse IL-10 ELISA MAX TM Deluxe
+mediates the cap-independent translation of EV71 RNA
+Venn diagrams
+Univariate and multivariate Cox proportional hazards models
+five
+1 hr
+153
+7.4, 7.1, 6.8 or 6.4
+24 h
+subnuclear
+D21 IFITM3-expressing
+19 days
+Antigens
+once a week
+they are able to produce nearly all of their ATP
+0.67%
+Alage Dairy Farm
+LAS AF Lite software
+158
+AMPK activation
+real life decision-making
+IL-1α
+Immunofluorescence
+live bat experiments
+induction of neutralizing antibodies
+microenvironment
+Goal-directed resuscitation
+Table 3
+cre
+1%
+Table S3
+Western blot
+10 11 cfu/ml
+Th2 cells
+1996
+Type 1 and Type 2 pneumocytes
+cross-reaction with A/Wis/05
+12
+460
+lower
+novel hypoxia/HIF-1α-regulated targets
+Multivariable logistic regression analysis
+Creb3L1
+regression
+fluorescence
+proper protein processing, expression and function
+divergent
+1995
+H9N2/wis
+Dr. Hung-Jen Liu
+Description of all functional elements in the H. somni system
+Genotropin
+12 months
+chisquare test statistics
+STRING 9.01 Server
+serious
+FKBP11
+54
+larger
+3.0 mm polyester transwell inserts
+3,000
+a relative risk of 1.0
+HCV-infected hepatocytes
+dihydroorotate dehydrogenase
+viral replication
+human hypocretin receptor 2
+Abnormal muscle echogenicity
+negative staining
+235,000
+local health bureaus
+respiratory
+I49 and S31
+95
+269
+p ≤ 0.05
+Supernatants
+Mast cells
+most details of human mobility
+Multipartite viruses
+Understanding how viruses and their hosts co-evolve
+purifying selection and mutational saturation
+E11
+pDCs
+flavivirus
+E. coli BL21
+5.5
+45%
+0.1% crystal violet solution
+doripenem
+KPNA2
+82%
+observations, recordings and measurements
+k min
+37
+MVA
+local investigators
+PolK and the FA pathway
+UV
+total tau levels
+financial and economic impact surveys
+25
+pregnant women, the elderly, and potentially older children
+48 h
+Agnostic biosignatures
+J&K Scientific Corporation
+true knots
+Outbreak events
+60%
+France
+H5
+Gel electrophoresis
+SLEDAI
+IDO
+every day
+nocardiamides A and B
+Trx1-Prx1 disulfide-linked conjugate
+purchasing power parity
+NSCLC xenografts
+High-throughput
+Every single life lost to suicide
+$40.50 billion
+virions from supernatant of infected Vero cells
+hepatic stellate cells
+low accuracy rate
+THP1 cells
+complement evasion
+immunofluorescence
+Q411
+enhancement of inflammation
+the capsid
+FHV-1
+polymerase chain reaction-restriction fragment length polymorphism technique
+Zika virus infection
+reviews
+mechanical ventilation
+0.47 AE 0.07 g
+156 million
+traditional medicine
+reduce the production of TNF-α
+C-terminal domain
+Vibrio cholerae
+2%
+Relative lung weights
+4147
+Qiagen Gel Extraction Kit
+SRP154218
+61
+antigen presentation
+VOI
+-80°C
+2008-11-07
+new systematic review literature
+810
+SJPL cells
+Ae. aegypti and Ae. albopictus
+Pathogen-negative specimens
+Cufflinks
+Viruses
+minus-strand synthesis
+Mean Absolute Percentage Error
+9-fold
+a vaccinia virus vector
+three
+antiviral activity
+IL-17A
+Risk communication
+11 genes
+Contralateral mastectomy
+CVB3
+fl ow cytometry
+Nine RGs
+Ranaviruses
+strand synthesis
+linear quantitative similarity
+20
+inhibitors
+search engine data biases levels
+weight redistribution
+inflammasome signaling
+IFN-λ 4
+10
+Evolutionary
+DL
+analyses of standard biochemical parameters
+Thirty-three
+antiviral
+tertiary interactions
+GFP + cells
+Cystic fibrosis and COPD
+Neurotropic mouse hepatitis virus infection
+NPC1 and LAL
+Twenty-four
+ten
+IgG and IgM
+Lassa VLP egress
+routine
+EBOV-GP mediated virus entry
+79.7% of the variability in peak timing
+user bulletin no. 2 of the ABI Prism 7700 Sequence Detection System
+proportionality, reciprocity, and consideration of community goods
+3,000-49,000
+risk stratification in H1N1 pneumonia
+PLEX-ID/Flu assay
+2 weeks
+33%
+401
+twice a day
+CompuSyn
+95%
+At least two
+target cell membrane
+IFN-driven
+Left ventricular assist devices
+30 μM
+receptor signalling
+Cilnidipine
+evolution and functional differentiation
+counterproductive work behaviour
+lymphoid tissues
+BD Cytofix/Cytoperm solution
+trypsin
+high selection pressure
+tgG-RL fusion antigen
+saprophytic filamentous
+7
+Pancreatic cancer
+Cholinesterase
+nuclear factor-κB
+severe sepsis
+further evidence
+Our analysis
+5.3%
+XLStat
+Ten
+Purified DNA
+complex human behaviors
+spleen mononuclear cells
+50%
+5
+fibrosis
+CNS inflammation
+Cyp3a2 expression
+apoptotic cells with degraded DNA
+phylogenetic trees
+IFIT1
+human challenge studies
+intact
+two
+0.2%
+SGTs
+~25 ng L1/array
+go off duty
+13.6%
+Z Y V
+Mabtech
+three months
+productive RSV internalization by macropinocytosis
+cross-group bNAbs
+VSV
+stringent mitochondrial quality control mechanisms
+IL-4, IL-13 and OVA specific IgE
+pneumonia and acute respiratory distress syndrome
+respiratory syncytial virus and cholera
+An audit trail
+RNeasy
+BLAST
+exogenous protease
+high DENV-binding avidity
+acute renal failure
+covering the whole population of a country at a given point in time
+accuracy, speed, automation, and cost
+100-400 µl DAB
+Reverse genetics technology
+388
+mature naïve B cells
+I 2 statistic
+SAS 9.1.3
+suboptimal
+5 minutes
+recipient cells
+20 min
+accelerates pathways to tertiary care and intervention
+bell-like graphs
+polymerase activity
+the ability to fix complement or bind to Fc γ receptors
+Poisson regression
+our population represents a profoundly immunocompromised population
+secondary anti-mouse horse radish peroxidase conjugated antibodies
+Collagen deposition
+GeneJET RNA purification kit
+KFDV
+8.3%
+Amino acid sequence of proteins
+Twenty-two
+7%
+coexistence of monopartite and multipartite forms
+amantidine and rimantadine
+HMGB1
+disturbances
+TRIzol™ Reagent
+synthesis of the final modification mnm 5 U
+L2
+aggregated data
+CDOCKER
+26
+Angiogenesis
+membrane fluidity
+dystrophin
+Receiver Operating Characteristics curves
+zanamivir
+MgCl 2 addition
+knockdown of TSEN54
+filter paper
+63
+ACE2
+1
+airway mucosa
+E protein
+partial orthogonality
+mass accuracy
+virus production rate
+greatly
+VP60-eGFP fusion protein
+7500
+surface presentation
+43
+NF54
+chikungunya-VLPs
+TLR4 rs11536889 and CD14 rs2563298
+490,174 IEQ
+390 million
+mass spectroscopy
+trachea
+Seventeen
+pateamine A and hippuristanol
+44
+0.3%
+expression patterns similar to the other replicates
+hepatitis C virus or human immunodeficiency virus
+pseudouridine
+Ventilator-free days, length of ICU stay, and mortality
+exons 3-9
+viremic time points
+a novel cell permeable triterpenoid antioxidant
+HTT in distantly related species
+920
+100
+Thrombopoietin and neural cell adhesion molecule L1
+six
+3.00
+inducible
+95%
+Eleven
+kidney, lung and brain
+IL-10
+Zhejiang Province, China
+oligonucleotide
+HTT
+the Internet
+the ion
+DrugBank and TTD
+Logistic regression analysis
+intravenous immunoglobulins
+COVID-19
+MilkoScan FT120
+92
+A dedicated research coordinator
+significant protective effects
+gastrointestinal tract
+dermis
+MEDI-565 binding
+bats
+Immune Epitope Database
+114
+vehicle inoculated control animals
+the political calendar
+R205, K211, and R298 31
+Human antibodies of irrelevant specificity
+100 μg
+computer simulations
+Phase Five
+attenuated or inactivated whole viruses or partially purified viral proteins
+MMP2 and MMP9
+medication or humidification of air
+asthma
+86%
+Macrocystis pyrifera C. Agardh
+1 day
+Linkage disequilibrium
+drug-polymer ratio
+Pneumonia
+L1 protein expression
+Malaria
+62%
+bornavirus RNA
+multiple regression analysis
+Hepcidin
+bacterial sepsis and corticosteroids
+long-term complications and subsequent disabilities
+The Principal Investigator
+family resilience and biological resilience
+the corresponding author
+varying transmission with infectious cell density
+macrolides
+ethanol
+a constitutively expressed heat shock protein 70 family
+dwarfism and diarrhea
+PRRSV replication
+HDL-C QTL
+l p,i
+Ae. albopictus and Ochlerotatus
+necroptosis
+29%
+metagenomics
+PLP
+119
+IFITM3
+established sRNA reservoirs
+IVIg
+letting clemency prevail
+CBA assay
+genetic
+HiberixH
+abroad hospitals
+understanding the cellular metabolism, mode of infection
+protein A-sepharose Fast Flow beads
+computational
+automated DNA sequencing
+4
+tracking CDC surveillance data
+the longest ORF
+DDX1
+% of the travel costs
+upregulated
+carrier RNA
+one or two
+an overall larger source population size
+U UUAAAC slippery sequence
+cytokines
+PRRSV titers
+10%
+jargon
+± SEM
+60%
+Rc
+ACEi, ARBs, and aldosterone receptor blockers
+Arg292Lys, Asn294Ser, and His274Tyr
+10 μg recombinant hepatitis B vaccine
+correlates of infection or protection
+fully protonated or deprotonated
+peak-1: 1613.8
+Urinary vanin-1 and/or NGAL
+wild-type constraint
+-51.1%
+healers
+H7N9
+high-mannose-type
+primary fetal human hepatocytes
+Viruses
+β-defensins
+95%
+gated Cx3cr1 + Tcf4 + cells
+The cap
+diarrheal illness
+pathogen specific as well as situation specific criteria
+13-14
+dying colonies
+host body mass, and our direct measure of phylogenetic distance to humans
+minor patch releases
+genes related to innate or adaptive immune responses
+Tie2 signalling
+cellular metabolism
+eleven
+micro-RNAs
+dissimilarity matrix
+eight
+statistical
+eight
+17,187
+clade 2
+48
+Fifteen
+CD11b expression on the neutrophils
+5 days
+access to tools and knowledge
+30 min at room temperature
+Thompson Reuters
+viral diarrhea
+30 to 40 minute
+mitochondria
+5
+ribosomal frameshifting
+higher mortality, greater possibility of RRT and longer duration
+Serratia
+genomic sequences
+XLStat
+epidemiological, clinical, and virologic characteristics
+type I and type III
+length of stay and live outcomes
+abiotic and biotic
+500 nM
+virion-size particles containing electron-dense cores
+histological evaluation
+100%
+10 weeks
+restrict tissue damage and switch to recovery
+REDExtract-N-Amp Tissue PCR Kit
+fresh puromycin media
+RSI
+CD4+ T cells
+95%
+theoretical studies
+haplotype
+late summer of 2016
+apoptotic
+28.38 kcal/mol
+three
+murine AT2 cells
+augmented virus entry and replication
+Antibodies
+AT 1 receptors
+10-fold
+hundreds
+mean with positive and negative standard deviation for each diagnostic group
+Molecular mimicry
+STAT1 and STAT4 levels
+73.4% of the population
+isotopic quantification
+nine
+Z-FA-FMK and E64d
+Cattle
+50-80%
+an association between rs805297 and T2D duration
+Isotype, FMO, or another population
+seeking care for poultry
+Diseases causing hypoxemic respiratory failure
+alterations
+Echinococcus granulosus
+lipid
+streptavidin-coated magnetic beads
+Parsimony
+Selection for within-host growth
+4.0 deaths/10 000 population
+RNA binding motifs
+131
+H1N1 influenza
+21
+supernatant
+De-identified datasets
+E76G variant
+one
+The Journal of Infectious Diseases
+H5N1
+differential effect
+population density
+hope, resilience, optimism, and self-efficacy
+Heterosubtypic immunity
+Carollia perspicillata
+peripheral blood mononuclear cells
+parameter estimation
+unstable inflation
+culture
+HRV-78 of high virus titre and purity
+inhibited the translation of AaET transcripts
+millions of years
+cc-by
+Penicilin and streptomycin
+thousands
+dominant-negative function
+peacock
+RNAi
+one-way ANOVA and Fisher's least significant difference posttest
+Acute exacerbation
+single-stranded small RNAs
+40
+4
+nine
+mutational pressure
+bacterial meningitis
+required factors for parasite development
+hydrophobic residues
+cDNA
+Discovery Studio 3.5 Modeler block
+VP40 protein of EBOV
+three
+MALAT1 hairpin
+natural log transformation
+42
+sensitivity or specificity
+catalyze the hydrolysis of a variety of different RNA substrates
+Section III
+H7N9 virus specific antibodies
+misleading results
+A second alignment
+activate specific immune responses
+2.5% serum or 0.2% BSA
+one-way analysis of variance and Tukey's multiple comparisons test
+Training staff on SARI case management
+ribosome profiling
+functionally related genes
+One-way
+1.5%-19%
+Leica SP8 confocal microscope
+early clinical response
+70%
+microneutralization assay
+type II
+41 nM
+Movement proteins
+2019-05-07
+oxidative stress
+regions within a protein that lack a rigid or fixed structure
+Vero-SLAM cells
+retention of ACE2 activity
+5 days
+host behavior, survival rate, and/or fecundity
+The Global Change Master Directory
+RNase L
+0.8560.53%
+7
+24 hours
+Kvector
+EcAtg5
+HMGB1-TLR4
+Progress
+Fusogenic property of our VLPs
+Dr. Olivier
+GGT
+EGR1
+4 endosomal escape
+increased protective practices
+six
+antihypnozoite
+tissue degeneration and leukocytic infiltrates
+stimulates the activity of three DUBs
+39%
+immune deficiency syndromes and cancers
+expression data
+A nuanced understanding of the characters of inter-professional negotiations
+viruses
+ATII cells
+EAAAK, AAY, and GPGPG
+health equity
+gastroesophageal reflux and recurrent chest infections
+6
+P2, P3, and P9 residues
+Nine
+generalized immunosuppression
+5 days
+A virus
+λ
+SI, MMR, MAH, MMH, and AI
+alcoholinduced liver disease
+Direct epitope changes
+Lorenz Von Seidlein
+IFN-c
+3.168
+Department of Livestock Development
+biomedical research
+6 grades
+HCPS
+2009
+economic difficulties, improper integration with the rest of the society and family violence
+34 days
+symptomatic
+ChemStation software
+translation is arrested
+85
+effective germinal center activity
+85% of the spots on the array
+Free State Province
+therapeutic antibodies
+2
+Trimer phosphoramidite codons
+random-effects model
+22 minutes
+41%
+structure 11
+stainless wire
+Mef2c
+a relative risk of 1.0
+lymphocytes
+pleuritis
+repressing BmNPV replication in host cells
+all activity
+1 to 50 mg/L
+UDP-GlcNAc
+PCR
+survival
+1%
+Culture supernatants or mouse serum
+moment closure
+RIG-I activation
+FS values
+roles for receptor binding and low pH
+NIAID IRB
+zoonotic infectious disease emergence
+increased heart rate and lower RMSSD
+201
+mice
+functionally connected
+epidemic behavior
+1985
+liquid chromatography−tandem mass spectrometry
+mutual information, correlation, and random forest
+40%-50%
+250 nl/min
+data mining from previous epidemiological studies
+58.3%
+59.4%
+striped skunks
+potential differences in clinical and billing practices
+MHC binding or T cell restriction data and HLA gene frequencies
+Aptamers
+collections of closely related mutant spectra or mutant clouds
+Ethical
+caution
+Agglomeration
+Simeoni et al.
+Two
+interferons
+Hendra virus
+1,193
+3800
+misclassification rate
+Venovenous and venoarterial ECMO descriptions for respiratory support
+positive IEDB immunogenicity score and high degree of conservancy
+Laboratory testing to identify prognostic indicators
+delayed oseltamivir treatment
+gravity flow
+Liver disease
+nine
+virus biology
+2004
+40 hr
+Ducks and seabirds
+type 2 diabetes and extensive fatty liver disease
+QIAGEN RNeasy Kit
+9
+fast catalytic rate and high stability
+Four
+IFNL4
+2013-09-18
+RPM and qPCR
+secondary follicles
+Thermodynamic stability of the codonanticodon base-pairing interactions
+potent anti-tetherin activity
+Total viral richness
+Fisher exact test
+maximum parsimony method
+Clinical picture, laboratory detection, and epidemiological confirmation
+justRMA
+Manganese superoxide dismutase
+1.4%
+HPV PsV
+Statistical
+herd immunity generated by mass vaccination
+209
+IFN-α
+80%
+Rhinoviruses
+singular value decomposition and root-mean-square error
+M protein
+Programme EVA Centre for AIDS Reagents
+hospitals, doctors' offices, schools, airports and airplanes
+The C-terminal segment of the homomorph
+VEGF-A
+tyrosine
+acute otitis media
+10%
+bereaved by suicide
+Supplementary Table 2c
+different organs and species
+Forty
+binding conformation
+−80 • C
+mask type
+protection of the public from harm
+monocyte-to-M2
+break down plant saponins
+U modifications
+CPP-mediated siRNA delivery in vivo
+synonymous variation and variation in untranslated regions of the gene
+A-starting codons for serine and arginine
+80 to 100 percent
+Sequencing
+5.78-7.27 photons/s
+GraphPad Prism
+available pharmacokinetic data
+Social norms
+15
+Repetitive, incomplete and mixed sequences
+higher resolution and/or higher magnification images
+FACS
+a time-continuous deterministic function
+Xrn1p
+flavivirus
+NPs
+2013
+HBV
+2009
+denaturing PAGE
+IVPI
+patient stays
+ISG15
+oncolytic
+vaccination
+2.67
+eight-year
+issues linked to different layers
+The structural and dynamic properties of the ligands binding to the receptor
+80 mg/day
+a potent transcription factor
+scientific investigations of conspiracy theories
+82
+monocytes/ macrophages, memory T cells and NK cells
+reduced sensitivity to rotavirus
+fission vesicles
+electrical impulses and informative molecular signaling
+attraction and repulsion of glycolipids
+55
+immune and developmental regulation
+Coxsackievirus A6
+AMPK
+98
+diminished viral replication
+EAE
+Seven
+pressure time product *p < 0.05
+autophagy
+airborne transmission
+risk-map
+ribavirin and DMSO
+Mouse anti-IL-13 mAb clone DL11
+backwards tracing
+stress response
+30%
+215
+BIAevaluation 3.2
+demyelinization nodi
+cDNA
+four
+ScAtg8
+mortality prognostic factors
+twice
+WellRed D2 and LicorIR-800 dyes
+5.21 and 5.69
+infection-enhancement
+the femur volume
+Our ability to evaluate exercise performance
+IL-2
+abrasion or biting flies
+Plateau pressures
+monoplex PCRs
+slower replicative kinetics
+tosylsubstituted doubly activated enes
+methanol
+hydrophobicity
+21 days
+685 million
+STAT1 and STAT2
+TIM-3
+sialic acids
+131
+PNG
+random
+ARDS
+Nitrite oxide
+lethal H3N2 influenza A virus infections
+bearded vultures
+nucleotide substitutions per site reactions
+sixteen
+goblet cells
+10% SDS-PAGE
+isoliquiritigenin
+Adjustments based on population density and population in slums
+6.8, 5.7, and 5.2
+Table S2
+10%
+cancer
+Y
+high-quality
+intestinal epithelial barrier
+ELISPOT
+eIF4GI
+328
+Contact tracing
+Candidate scFv-phages particles
+4-20%
+ethidium bromide staining
+High molecular weight
+modification of U
+acute respiratory distress syndrome
+NF-κ B
+GADD34 and PKR
+GraphPad Prism 6
+QD649 quantum dots
+A surveillance system
+11 to 13 days
+Frizzled and Disheveled
+rdrr.io
+polyvinylidene difluoride membranes
+1.7
+IL-17 + γδ T cells
+increased HIV targeting and a reduction in p16 and p21 levels
+100
+Contact tracing
+Animal disease surveillance
+genome-wide mutational pressure
+Membranes with transferred proteins
+Real-time RT-PCR
+subjective judgement
+e-Myco Plus
+alveolar epithelial cells
+testosterone
+Acute kidney injury
+SNARE-SM-mediated membrane fusion
+Innaxon Biosciences
+ascending paralysis
+14
+Europeans
+viral protease enzyme activity
+best practice guidelines
+CCL2 and CXCL10
+protein misfolding and/or instability
+Public Health England
+EGP-based mitigation
+SK1
+trust and attenuates fear
+The pig
+WB analysis
+phosphorylation and glutathionylation
+viral infection
+59-deoxyribonucleotidase
+pellets
+.
+differential gene expression profile
+other passengers and traffic staff
+LGALS1
+cation adduct formation
+extreme values of costs
+PB2 residue 627
+10.3390/jcm9030623
+an important source of error
+rational and user-friendly
+domestic cattle and sheep
+suboptimal and adverse gene therapeutic responses
+TGF-β stimulation
+PBMCs
+Nextera XT
+pCAGGs-IRES-eGFP
+The metal ion
+protein propagation
+University of Peradeniya
+by mimicking sumoylation enzymes
+Cellular and viral determinants
+hepatic tolerance
+usage per 1000 codons
+Uniprot Taxonomy
+385
+appropriate curation and cross-calibration of standards
+the values determined for the 16S rRNA gene
+1%
+Low to modest neutralizing antibody titers
+2 µM 17-AAG
+θ 2
+when schools and day care centres are opened or closed
+Virions
+53
+17%
+Acute inflammation
+higher capacity of sample loading
+purified KUPEV OTU and GANV OTU
+RPL4 and RPS9
+transfection efficiency
+low
+the HA stem
+cc-by
+2 days
+identifying other coordinately regulated genes
+193
+7.8 mM
+Respiratory Multicode Assay
+EMBOSS:cons
+onestep-ahead residuals
+synovial recruitment of EPCs
+veterinarians
+worse
+Water bodies
+cancers and neurodegenerative pathologies
+TGF-β signaling
+Four
+cDNA microarray and oligonucleotide microarray analyses
+PERV transfer
+mortality in tissue culture
+J. Vieira
+Equation 3
+Spatial and temporal dynamics of RNA viruses
+Cx3cr1
+Compartmental models
+CHIKV RNA titers
+an asterisk
+SPSS 14.0
+a new method for predicting the interaction of drugs with nuclear receptors
+Stigmatising environments
+ZR viral RNA kit
+500-600
+tumor antiviral defenses
+PNM
+one-third
+2
+cryo-electron
+increasing Ag dose
+interaction of host cell and microbial components
+GAPDH mRNA
+KLW, SB and KEH
+Comparisons of TLRs
+cytotoxicity
+Oxidation of lipids and proteins
+The American Thoracic Society
+general psychological counselling
+Irreversible
+Visual inspection of the most likely chains of transmission
+24 hpi
+20
+amyloid-β A4 precursor protein-binding family A member 3
+2004
+21°C
+Marshfield Labs
+ORR
+Xigris ®
+500 ml of isopropanol
+specialized phospholipid biosynthesis
+unrestrained whole-body plethysmography
+six
+inhibition of RdRp activity
+limitations in the amount of urine available
+Doxycycline
+phagosomal escape and intracellular growth
+36%
+Statistical significance
+FlowJo 7.6.2 software
+fatty acid synthase
+face mask type
+scalloped
+three
+heat stress
+online
+sufficient medical services
+MHV infection of the spinal cord
+80%
+~73%
+CV disease and other chronic diseases related to aging
+CD4 + T Cell Enrichment Cocktail
+dihydrouridine
+viral lung titer
+week 25
+FluWatch
+Ten
+Colorado State University
+30
+Fully refined NMR structures
+viral load
+T CM and T EM phenotypes
+Mx1 ISG mRNA expression
+Odyssey Software
+comparable
+cytolytic elimination of hepatocytes that expressed HCV proteins
+ketoconazole
+moderately influenced
+6 HPI
+170
+24 hpi
+200 L of chloroform
+Atherosclerosis
+DNA vaccine
+revised and more complete datasets
+large sample cohorts and different populations
+lower
+MEGA 5.0
+UPR
+more than 600
+Algorithm 1
+.347
+evaluating which longitudinal data streams provide the most information
+pDCs
+27 years
+triplet periodicity
+Cryptosporidium infection
+chloroplasts
+2 9 500 mg
+55%-82%
+microbial variomes
+Pronase
+functional overlapping proteins
+Animal #4552
+information
+2 s
+reassortants or low pathogenic wild-type avian viruses
+ADAM17
+parallel alignment between two stems
+10%
+chimera type
+hygiene behaviors during the early phases of the influenza A 2009 pandemic
+PCR using primers for the AdE4 gene
+hydrophilic basic residues
+Adjunctive therapy with Traditional Chinese Medicine
+RT-PCR
+serological tests and PCR assays
+preterm lamb model
+High-performance thin-layer chromatography
+autoimmunity
+did not exist
+Y
+Renal damage
+pleurisy
+3,5-DCQA
+political orientation and endorsement of extraterrestrial cover-ups
+Antibodies
+elemental
+areas with analogous overlapping environmental conditions
+glioma cells
+a trait
+Nucleospin RNA II
+Dunnett's t-test
+Synergy volume
+early or late death
+oestriol
+PJ34
+24 h
+the 5 and 3 ends
+distinguishing avian, human and swine strains
+1 week
+71
+live-bird markets
+50
+pRL-SV40 Renilla luciferase vector
+work-in-progress
+cytotoxic bovine seminal RNase
+All binding of Siglec-8 to human tracheal cross sections
+glucose repression
+Inhibition zones
+antibiotic-containing plates
+The spectral radius of M
+250 ng total RNA
+5 February
+1 hour
+1/20 volume of reaction mixture
+103,962.85
+novel and known mutations
+93.8%
+3.7
+lymphoid organs
+fluorescence
+the day of VRC 308 enrollment and first injection
+n
+unrealistically optimistic
+a 45 kDa doublet
+16
+HIV-1 Nef
+212
+Additional studies
+15
+1 × 10 1 copies/μL
+Russia
+the intron
+24%
+S2
+a well-known c-secretase inhibitor
+economical development
+Licor Odyssey CLx imaging system
+Eppendorf MasterCycler ProS
+LPS ex vivo whole blood stimulation
+95%
+neuraminidase inhibitors
+mental health care
+Metropolis-Hastings Markov Chain Monte Carlo procedure
+Vaccination
+higher
+nsP2 and nsP3
+4 -PMO
+HopPER
+138
+12
+E-MTAB-2982
+analyzing and visualizing side-chain packing
+septic
+interleukin
+erythromycin and azithromycin
+when R t exceeded 1.0
+Nigericin
+ten
+ON1
+Barcodes not present in INOC30
+POLYMOD
+M81
+inability to generate products across the mutations
+inactivates pathogens
+a 2TCM
+age
+the IM
+SP-D
+Time of positivity
+One out of every ten
+isolation of V3 specific clones
+Sanofi-Pasteur
+Environmental vectors
+N1
+>10 3 NT50 titres
+c N
+autophagy
+Dynamic detection of plasma sCD138
+Three
+PANTHER-PSEP
+TFG
+N-terminal RD
+ISG20
+62
+lamin B1
+cc-by
+Light microscopy
+percentages
+IgG + PCs and plasmablasts
+virotherapy response
+independence between the samples
+NA
+deionized water
+two canine kidney tissue supernatant fluids
+leishmaniasis and dyslipidaemia research
+2 weeks
+208
+twice
+WHO
+NGD
+virus crawling and gliding
+47%
+six
+identical
+220
+skin contact or even ingestion by healthy animals
+nosocomial transmission of respiratory viruses
+760000
+transmission of sexually transmitted diseases
+87%
+rabbit reticulocyte lysates
+Adenoviruses and Betaherpes
+Tissue Differentiation-Inducing Non-Protein Coding RNA
+k 20 and k 21
+25 days
+the number of points that all hospitals claim
+B23
+the lung
+how much the segment deviates from the main orientation of the vasculature
+three
+a variety of factors
+health insurance
+red blood cells
+Morphological
+2μM
+Chi square test and Fisher exact test
+aliquots of the culture supernatants
+therapy of tinea capitis
+$30,205
+viral load in blood or disease presentation
+suppurative
+polyclonal
+Cell lysates
+22
+0.4%
+predominantly round or oval
+The oxygenator membrane
+6 h post injury
+Viruses
+MT1-MMP
+Primary endothelial cells
+mouse
+prevention
+VRC01
+MEDI3902
+detrimental
+98
+4 h
+NS4
+2007
+delayed early kinetics
+272
+5% skimmed milk
+s/p ratios
+logical extensions of classical probabilistic models
+flexibility of our approach
+acute respiratory distress syndrome
+RAGE, TLR2 and TLR4
+adult stage
+areas of Hendra replication
+RLR receptor pathway
+decreased virus titers
+hairpin-loops
+resazurin reduction assay
+eight
+Alanine transaminase
+steerable filters
+pronuclear injection
+Almost one million
+chromatin-level
+The TSC
+mass, retention time, and monosaccharide compositions
+crude DNA preparation and simple field-deployable detection devices
+Experimental validation
+SP-A and SP-D
+three
+Translocation of cytoplasmic NF-κ B to the nucleus
+R563
+205
+VV G1 protein
+Chloroquine resistance
+a mesh of proteins
+vRNA and the viral RdRps
+dimethyloxaloylglycine
+DENV1-4
+23 to 34 kcal/mol
+8
+IFN-γ
+70%
+six
+amino acid transport and protein synthesis
+sopE gene
+φ ¼ 0:0015
+Zrank
+zebularine
+Transfected
+poliovirus, coxsackievirus, and hepatitis B virus
+2 −ΔΔct method
+13.3 mg/L
+EBV-mediated B-cell transformation
+50%
+NSs-mediated
+DMF technologies
+Khanh Hoa Provincial Hospital
+three
+75%
+Pneumonia
+10.3%
+Ca 2ϩ
+Haloplex
+4697
+1.6 × 10 11 vp per mL
+<0.1
+p44K plasmid
+real time PCR
+Fifty eight
+polymyxin B columns
+natural IgG
+Long-term presence of viral nucleic acid
+34%
+ciliated cells and goblet cells
+BatchEffects
+TriZol
+respiratory illness
+SPSS V21.0
+IFITM3
+environmental
+10
+The PPI network
+optical absorbance
+optical density
+CVD and malignant invasive cancers
+equilibration
+expression of the viral structural protein prM
+neurological symptoms
+Two
+MMR, influenza, varicella and tetanus
+PCR
+how much you know to write the sequence
+Heat shock protein 90 beta
+time-series aerosol concentrations and size distributions
+400 M
+69
+measles
+Inclusion of data after day 4
+methanol
+PHA mitogen
+spectrophotometrically
+molecular
+different budding mechanisms
+Default settings
+cc-by
+three and seven days post-exposure
+binding to CAP256 UCA Ab
+undetectable
+Bursts of keywords
+20:80 CPTEG:CPH copolymer
+GFP + effector T cells
+49-74%
+refreshment and diuretic agents
+6%
+121,805
+Enterocytes
+18
+contact droplet infection of the nasopharynx
+72-83%
+dose-sparing formulations
+30-day
+The structure of the obtained CS-ES2-AF
+N-terminal 33-50 amino acid sequence
+569
+PR-mediated Gag cleavage
+Invitrogen
+didactic teaching
+loss of such waters
+36
+Overexpression of the HER-2 receptor
+1 hour
+development areas
+Oxygen
+intramolecular conformational changes
+influenza
+6Á6%
+anti-cancer
+TFA/triisopropylsilane /H2O solution
+0.00672
+SPSS
+21
+softer repulsion
+Illumina Pipeline
+inserted miRNA target sites
+54 yrs
+six
+No rectal temperature variations
+2017
+RNA
+IFN-α
+Total protein content
+Betweenness
+no comprehensive warning and response system
+antibodies directed primarily to conserved HA2 stem epitopes
+host cell receptors
+95 l of 80% ethanol
+exercise mimetics
+6-27 per 1000 children <5 years
+complementary studies
+β-actin gene expression
+Image-iT LIVE Green Reactive Oxygen Species Kit
+Caviwipes-1
+one-third
+decreased
+fifty
+Ethical
+critical policy insights
+Gene expression data
+2
+larger peptides
+1.34
+Grid values of fractional tree cover and built-up
+Infectious disease modelling
+variola major
+osteocalcin
+DIVA
+Two weeks
+0-15 years old
+Elevated Ka/Ks values
+PhyML 3.1
+whole cells
+Obtaining a good approximation of the pMHC complex geometry
+5
+real-time prediction of space-time disease spread
+filter with wavelengths 614/50 nm
+three
+CETP-mediated transfer activity
+fruits, seeds, and root vegetables
+two targets of each pathogen
+CodonW version 1.4.2
+20%
+$3,801
+cysteine protease caspase-1
+B1 and B2
+EMSA and supershift assays
+.95%
+ADE
+NCBI's Gene Expression Omnibus database
+0-50 bp
+NIH Guide for the Care and Use of Laboratory Animals
+CTG clearance
+100% GFP expression
+50%
+16%
+6.3 per 1000 patient-days
+glyceraldehyde-3-phosphate dehydrogenase
+x ij
+caramellar
+multiple comparisons
+GP structure and virion particles
+m
+twice a day
+ECs
+bluetongue virus
+Avonex
+Fiji software 64
+Twenty-two
+mutational reversions
+Recombinant wild-type EBOV expressing GFP
+24 hours
+to avoid triggering TLR9
+Perceiving the risk of an infectious disease
+no significant correlation
+information
+2400
+CCR5
+mean ± SD
+palmitoylation and myristoylation
+selective digestive
+IRE1-mediated signaling
+Increasing the vector dose or adopting a prime-boost regimen
+2 μ l of cDNA template
+quali tative tests of clot quality
+D 0
+Rh5
+downstream regions
+ALLN
+s st
+pleiotropic
+enhanced T-cell proliferation and CTL responses
+Distance
+14
+protease and phosphatase
+the quantile
+At least five
+3 of the annotated BKRF3 AUG
+therapy
+one
+increased HIV replication
+R-AFP
+advanced breast cancer
+pPAN-WT and pRTA-EGFP
+careful treatment
+3.0 × 10 3
+Proportionate amplification of differ-ent transcripts
+165
+Western blot analysis
+SNP
+S-sulfonates
+cap accessibility and 5′ leader secondary structure
+Develop healthy public policy
+GenElute mammalian total RNA
+43
+patients admitted in the NICU with cerebral haemorrhage
+4/6
+proteo-lipid mixture
+to accommodate the lack of observation of transmission events
+muscular
+flying fox
+FACSCalibur flow cytometer
+Dot coloring
+strandedness
+Carbamidomethylation
+provision of necessary background information
+multi-sectoral collaborations
+neonatal
+50%
+60 to 100 nm
+HBV and hepatitis C virus
+septic tanks
+historical and local
+International law
+mean values
+proteosomal degradation
+150 000
+NoVare
+pathogenesis
+incorporating the nucleoside analogue
+episodic memory decline
+microplate absorbance reader
+Vitrobot Mark IV
+Ifitm1
+18
+depletion
+Proteins responsible for host OST activity
+Eurasia and the Southwestern Indian Ocean
+bats might shift to other wild mammals or humans
+Eight
+pigs
+RCREVs
+0. 3
+10 µL of anti-SMAD4 antibody or rabbit IgG antibody
+triethylamine
+441
+pooled intravenous immunoglobulin
+19
+SAα2-6 Gal
+Peptides
+127
+FMDV
+any family member previously having been diagnosed with diabetes
+10
+80%
+FAB-MS +
+269
+100 ml of MEM TPCK-Trypsin
+rocaglamide
+robust biomarkers
+2012
+WHO
+All cultural
+iodine intake
+The growing problem of globally emerging infectious diseases
+13.2-51
+280 nm
+a specific drug
+inflammatory
+day 90
+10,000-15,000
+3hrs
+90-min
+Triplet loss
+Transducing the acutely injured lung
+toxic
+102 Sanger-based sequencing
+data from both genetic lines
+210
+Brazil
+SAMFIRE
+Thematic analysis
+to identify major sources of variation in synonymous codon usage
+18 h
+incongruent
+49%
+three
+half to three-quarters
+TMB substrate
+1238: 638
+pharmacological
+nontrivial
+AaHig
+IRF8 expression
+31%
+H1N1
+ATP
+Sepsis
+SWISSPROT database
+Abundant viral antigen staining
+to be inclusive
+neutrophils
+72 h of fermentation
+Mean fluorescence intensity values
+Chikungunya virus
+Lopinavir/ritonavir
+selective outcome reporting
+Katnal1 1H/1H mice
+antibody-selection pressure
+control inhibitors
+coordinate transcriptional activation of secretory component machinery
+IFNL
+qV
+Glasgow Modified Eagle's Medium
+discriminated the total cell lysate from the L1 RNP fractions
+Ca 2+ and electrolyte homeostasis
+SOLV-MAP
+LearnCoil VMF
+Breath samples
+checking for a woman's drug consumption
+epidemic threats
+keyword searching and the reference standard
+two
+liver
+142
+China
+osterix
+3.76
+severe malaria
+Quanto software
+scale images
+Disease transmission models
+Green fluorescence
+ADAM10
+35
+one-to four-week predictions
+Green Cross Veterinary Products
+Laboratory services relevant to infectious diseases and public health
+Glycoprotein B
+G4
+Vaccination against FeLV
+male
+Blood glucose levels
+25%
+immune globulins and T lymphocyte subsets
+virion internalization
+postal code of residence
+Fold change
+cryptogenic
+Total genetic variation
+Cycloheximide
+septic shock
+TTG
+the current state
+The adverse event
+18
+Mathematical models for intracellular virus growth
+Filter binding assays
+arboviral inoculum
+I PBVs
+Dissenting setting parameters of analysis 1 and 2
+lectins
+10%
+valid interactors
+B lymphocytes
+Nonalcoholic fatty liver disease
+severe line broadening
+rod-shaped
+transcription factor binding sites
+rotary
+age
+34
+oligomerization
+pVIII
+adenosine-stimulated chloride transport
+4 hours
+ELISA binding curves
+deep
+data collected
+Fermentas
+lung and stomach
+Labeling with fluorogenic probes
+~85%
+CSN subunit 8
+Valgancyclovir
+4.1
+house dust
+A AA.G and U UU
+fresh enterocytes, goblet cells, and mucus layer
+7 days
+energy-dependent
+serine moiety
+1361
+eM2
+21 days
+connectivity
+interferon γ and vitamin D
+oligomerization
+470
+93%
+over expression of blood coagulation
+contamination
+the contribution of infected cells and T cells to disease severity
+3 days
+tracheal swab samples
+5% fetal bovine serum
+Hippocrates
+green, magenta, and red
+fitted logistic regression model
+744
+100 µL of the Two-Component ABTS Peroxidase System
+k
+type I
+52%
+exposure of the virus to innate immune sensors
+Loop-mediated isothermal amplification
+protein overload in the ER
+IFN
+peak disease severity
+cellular
+viral genome
+Political and infrastructural issues
+to evade the type I IFN response
+IFN-α
+decreases the rate of CSFV proliferation
+6.0%
+SAM vaccines encoding influenza antigens
+GCs of growing follicles
+T cells
+Reed-Frost model
+N t and N 0
+First Affiliated Hospital of ZheJiang University
+four
+Nagelkerke Pseudo-R 2
+11
+subglottic aspirate sample
+daily
+antiviral, anti-tumor, and immunomodulatory
+Forty-eight hours
+antitumor
+The Future of Public Health in the 21st Century
+cytotoxicity
+380 ppm
+Global Virome Project
+our atomic model
+Confidence interval
+3 to 9 days
+increase treatment costs
+IFN-λ
+the intersection point
+the most critical mechanisms involved in innate immunity to infection
+13
+cholesterol
+supportive and rehabilitative
+qualitative information on the structure and localization of the peptide species
+Geneious 9.1.2
+C. burnetii
+RNAlaterH
+inability of TRTRVSRLY to block RRV binding
+LightCycler96 real-time PCR machine
+CD4 T cells
+immunity
+Quantitative analysis of epidemic spread within human communities
+detects the laser position and records the change of cantilever location
+E18
+In vivo metabolites
+intact -labeled siRNA molecules
+Plasmid
+100%
+DAPI
+21°C
+log-normal
+Rapid uptake of free calcium by the ER
+17
+95% confidence interval
+39 and 59 MO
+PAN RNA
+C-reactive protein level
+PrCR
+miosis
+host nuclear factors
+CD8 + T cells
+1,648
+the data give only indirect indications of the drug's action
+4.32±0.89 μM
+induction of a powerful and persisting anti-tumor immune stimulation
+70
+three
+Model-based analysis of tiling arrays
+three infected individuals
+12
+15-34 years
+DNA vaccine carriers
+PDI
+any structure on x
+nuclear export of viral intronless mRNAs
+138
+UTR
+Various elements of an mRNA molecule
+Table 2
+MARC-145 cells
+α-MEM-complete culture medium
+six
+pre-existing antibodies
+potent and novel SAIs
+Monitoring of pulmonary and vital parameters
+enzymatic removal of sialylated KS chains
+Apdm09
+E2 antigenic site 3
+PRISMA protocol
+help-seeking for suicidal behaviour
+Figure 4A
+island-to-island migrations
+sex and gender
+Fig 5
+93
+DVs and the producing cell line
+HEp-2 cells
+Papers on influenza
+IFITM3
+scientific
+alternative processes
+4-or 5-week
+Influenza A infection and immunosuppression
+≥5.6 mmol/L
+human-to-human transmission
+personal preventive measures
+foodborne illnesses
+Zika
+Eight
+Viral infection
+infection by a less virulent type of virus
+C3A hNTCP
+Descriptive statistical analyses
+prophylactic management
+low-quality reads and duplicates
+decrease diastoledependent left ventricle perfusion
+guinea pigs
+weight loss, poor productivity, and decrease in fertility
+Structural analysis
+Engineering vaccine design for manipulating antigen presentation and processing pathways
+37,930
+pro-inflammatory
+larger
+MBV and RsBV1
+Apdm09
+90/50 mmHg
+local written protocols
+GW4064
+intra-bloc trade
+low-salt buffer
+multispecies coalescent
+more research
+Arg 260 and Lys 257
+over 140
+University of Pennsylvania Institutional Animal Care and Use Committee
+WMid
+cross-species APOBEC3 expression
+more rigorous estimates of reproduction numbers
+loss of TRIM56induced monoubiquitination
+endosomal sorting of membrane proteins
+resistant phenotypes
+eight
+93,326
+Aptamers
+apoptosis
+Antigen-specific CD8 T cell-mediated
+Eighteen
+Western blotting
+plasmid DNA
+Composition
+25
+225
+immunosuppressive
+Direct RT-RPA
+4 h
+Zoletil 50
+Th17 profile
+the dosage will be increased or decreased
+four
+Replicating-competent reporter-expressing viruses
+5 μg/ml
+Foxp3 − Tr1 cells
+pCa37
+HIV-1-transfected HEK293T
+Cincinnati Children's Hospital Medical Center
+human monocytes-derived macrophages
+14 generations
+SNPs in ifitm3
+135
+431
+CD4
+liver
+IL-1b, IL-6, and RANTES levels
+affinity measurements, cell culture assays, or physicochemical properties
+AJAX
+hunting guns
+1,232
+54
+IGF-1R levels
+two signs that showed statistically significant association with risk
+Gaussian distributions
+one RFID tag
+fecal-oral route
+influenza virus
+monocytes, macrophages and DCs
+ethical
+Analyses of communication strategies with MCDA
+15
+the importance of host species for cross-infectivity
+high bacterial contamination
+30 months
+massive release of proteolytic enzymes
+our method
+unclear
+Primary influenza pneumonia
+Ca 2+ signaling
+Leukemia
+Vic-226-228HA
+saturating concentrations of substrate
+Chromosome walking
+long stretches of non-coding DNA
+Hemagglutination assays
+subtle fibrillar collagen accumulation
+Combination therapy
+Details and differences in approach
+PB2-588V
+proper PPP-RNA binding
+Table 4
+Overall survival
+Bac-to-Bac expression system
+488
+d cell
+Eighteen
+5HJ3
+normal prostate, primary prostate tumours and lymph node metastases
+doctors and nurses
+Sialic acid
+12hr
+HA, NA, and M1 genes
+Pulmonary infection
+IFITM-resistance in Env
+four
+the prodromal period
+Immunofluorescence
+months
+cDNA microarray
+viruses containing different nsP1a/4 variants
+transmembrane protein
+lungworms
+CEF
+viral camouflage patterns
+Minkowski metrics
+1774
+H7N9
+the state of chaperone association
+780
+the need for new treatments
+ouabain, bufalin, and rocaglamide
+149
+T
+ileal digestibilities of energy, protein and amino acids
+Organ-or tissue-specific patterns
+homodimeric CEACAM1 interactions
+P4, E5, and V8
+inflammation
+24 h
+P
+quality
+Viability assays
+Ten
+orthogroups
+RNAi delivery system
+Psychological support
+six
+miR-143
+OR
+7-11 days
+3 weeks
+~3.2 fold higher levels of antibodies
+fluc gene
+level of production
+multiple growth conditions
+zoonotic swine influenza viruses
+15 nt
+SSR69071
+H1
+rate of infection
+77
+SDS-PAGE
+10 thousand
+a mammalian protein
+29
+Three
+to identify the main principles by which public employees should operate
+Team-based
+escape from human MxA
+Cytochrome P450 1A proteins
+Hematologic conditions
+54%
+IFN-JAK/STAT axis antagonist genes
+co-administration with influenza vaccine
+Eight
+Information of each country's density of physicians and nurses
+20 µl
+eleven
+35
+EGFP-TARG1
+LoFi CHIKV
+cough
+systemic viral replication
+Four
+primary human dermal fibroblasts
+SYBR Green-based real-time PCR
+overinterpreting empirical results
+LN images
+cleaner living environment leads to higher incidence of autoimmune disorders
+Salmon calcitonin
+Seven
+protease
+Fourteen
+Health insurance status
+ICU mortality
+workplace
+U0126
+ID microneedle vaccination
+viruses
+Cryofibrinogenemia
+cyclosporin
+fairness and equity
+thrombin
+u
+peptide-specific spots per 10 6 cells
+300,000
+Replicates
+78%
+Category 2 and Category 3
+100
+ribozymes, catalytic RNAs closely related to viroids
+chimeric mAbs
+meninges and large blood vessels
+S-palmitoylation
+0.5-1.5 Mb
+5%
+triggers cytokine production
+heat treatment
+acyl-donor and -acceptor moieties
+HBM Basal Medium
+A hundred nanograms of diluted DNA
+community acquired pneumonia
+MobA89K
+33
+tumor weight
+disordered or displaced
+hMPV/NL/1/00
+their cellular functions
+PS
+Picornaviridae
+5 consecutive days
+Tregs
+5 μg commercially available EGF
+Pamela Martinez, Nicholas Jewel, and Stephen Kissler
+social or spatial effects on spreading patterns
+on the reverse strand
+twice
+alpha-NAGA
+2 −△△Ct method
+MAP and SS
+Influenza-specific reverse transcription PCR
+sterile
+40
+hygienic educational programs and disease prevention programs
+3 to 5 times more than baseline levels
+Charles River, Calco, Italy
+140
+monocytes
+three
+later stages
+Thermo Fisher
+attenuated and recombinant-vectored
+CD4 + and CD8 + T cells
+hypersensitive to pore-forming toxin
+an epidemic
+similar
+10 pfu
+males
+2002
+TGF-β and IL-6
+ImageJ
+English
+to reflect codon preferences of human genes and IAV
+Beijing
+AT-527
+virus spread
+Ae. albopictus
+HO-1
+H3N2 vaccine response
+antigenicity and pathogenicity
+pseudotype input
+R848
+Buffy coats
+40%
+Jean Gruenberg
+elongate the life span of SMA model mice
+reduced
+Cell-line studies
+Neutralizing antibody
+endothelial cells
+comparison of genetic similarity and differences between African and global strains
+18
+Salmonellosis and Campylobacteriosis
+14
+p38 MAPK
+ADG
+between March 2005 and December 2010
+TM
+FEELnc 45
+for some time
+online statistics regarding flu patients on a national basis every week
+PPRV virions
+13
+compartmental models or other aggregated models
+Seventy-four
+R 0
+m = S 6 i = 1 m i = 3.54
+arrests cell cycle
+Venn diagrams
+real-time quantitative PCR
+qPCR
+an acid wash
+3, 12, 18 months
+comprehensive
+Japan
+sufficient
+review board of Faculty of Medicine of University
+contact transmission
+Spectral analysis
+spreading
+assumptions about the structural characteristic of the network
+Further study
+SIVmac
+4247
+HL4029AH
+Epitope mimetics
+18
+269
+systemic oxidant stress
+viral nucleoprotein
+Substitution of amino acids in all mutant constructs
+Glycyrrhizin
+Fasteris
+subchorionic hematoma
+functional fraction of genome
+ChIP
+replication
+CsrA/ RsmA protein
+culture supernatants
+gene-specific PCR primers
+0.5
+peptide-specific CTLs
+ultraviolet spectrophotometry
+Maximum Expected Accuracy of the base pairs
+IL-17RA
+retain detectable sequence similarity over long distances
+subsystems and FIGfams
+12
+Thirty-eight
+22%
+-2
+Spain
+0.24 μ M
+ANS-DSF
+10.2-28.9%
+Uni-12 primer
+death receptor signaling
+immunoglobulinbound
+MD trajectories
+S. pneumoniae
+high-pressure nervous syndrome
+Prompt diagnostic and treatment
+THBS1
+high mutation rates, high yields, and short replication times
+Western blotting
+performance criteria for specific types of microorganisms
+Seven hundred fiftytwo
+143
+logistic equation
+233
+miPPR-21
+multiple-antibiotic-resistant strains
+which region of each oncoprotein is rich of the epitope
+inhibits the intersubunit rotations and prohibits the binding of EF-G
+we assumed that the disease is transmitted only via the airborne route
+a significant public health cost
+adenovirus infection
+damage
+Human astroviruses
+RT-PCR
+C plants
+CXCR4/7
+beta cell dysfunction
+a
+appropriate control measures
+loci-focused strain typing approaches
+a frame shift
+cDNA
+HSV
+Four
+The LINCS algorithm
+LC3-II
+enterprise risk management
+1,733
+calendar time t
+DENV and VSV infection
+low affinity and high affinity molecules
+95%
+CHO-K1 and VeroE6 cells
+N protein and L protein
+FcRn
+QIAamp DNA mini Kit
+271TP
+DI titer
+HNE activity assay
+Patients with one of the following characteristics
+local" QTL
+EC 50
+1997
+electronion interaction potential
+b d
+the Golgi compartment
+Bio-metric data systems chip
+November 2007
+Interdisciplinary cooperation
+knowledge of the observed peak
+hippocampal
+311
+48 hours
+scFv 10F
+50%
+lyssaviruses
+three
+Apoptotic
+9.5 hour
+10 S. pneumoniae GE
+Intratracheal delivery via microsprayer aerosolizer
+transmission rate
+F X 2 1
+educating the general public about the utility of NMC
+The absorbance at 450 nm
+ABI 7500 v. 2.3
+70%
+catalytic function and non-catalytic function
+VEID-based assays
+MicroRNAs
+Magnetic nanoparticles
+5000
+fall
+enhanced inflammatory reaction
+protein-suspended bead array platform multiplex kits
+15.3%
+anthelminthic
+17
+intervals
+5
+all influenza A viruses
+male sex, adulthood, and exposure to outdoors
+humoral
+Creative Commons Attribution Noncommercial License
+promotes the fusogenic activity
+the importance of improving the annotation of genetic variants in the mouse genome
+biased
+RNA affinity purification
+activated PrfA drives its own transcription
+procedure failure
+36 days
+inhibition of inflammation and homeostasis
+Cell lysates
+Six
+mice
+97%
+VV, RSV A2 and HSV-1
+distinguishing between bacterial and viral infections
+seven
+mass transfer is limited in biofilms
+infectious pulmonary tuberculosis
+heat shock response
+C-type
+inhibited in similar way PV egress
+50
+the number of infected mosquitoes
+evolution of novel reassortant variants
+30 min
+interests
+Nsp12 dimerization
+viral replication
+Phase II
+development of record-keeping systems, quality audits, and preparation of analytic datasets
+959
+neurological disorders
+spatially separated
+natural selection
+Host and infection dynamics
+Table 3
+Escherichia coli
+daily
+GAVVALSTTFA
+flow cytometry
+the possibility of a blunted illness
+readily deconjugated ISG15
+JEV infection
+33 min
+October 1st
+enhanced
+nuclear transport machinery
+acidosis
+Mx1
+a conservative test
+fingers, palm, thumb and connection
+bats and swine
+14
+travelers
+bulk modulus
+60 min
+50-60%
+6 weeks
+Me-Glc
+5 μl/min
+78%
+2,000 nM
+Oceanic
+FuzCav
+Veterinary Clinics and Hospitals
+immunofluorescence analysis
+mean values
+undetected infection
+host contamination
+higher
+endotoxin contamination
+Table 1
+UniProt 181
+1,4-butanediol
+Chinese herbal kombucha
+TMUV
+priming of RNA synthesis
+ten
+early MALS diagnosis
+statist scope thesis
+equal protein concentration
+HT7F and FLXR
+188
+dead-end
+MicroSpin G-25 columns
+shared transcriptional regulatory motifs
+5 min
+error as a risk state
+typical
+5 -UNN-3
+tumor
+more depressive symptoms are present
+fluorescent
+depression
+999
+26
+tyrosine kinase AXL
+free-to-publish
+selectively capture a variety of bioparticles at different locations in the channel
+1.8 mg/ml
+moderate BS and PP
+discordant
+how things work at a systems level
+European Center for Disease Control
+microlitre quantities of blood
+disease
+Thirty-one
+bacterial infection
+antigen-specific antibody probes
+multiple reassortments between different Eurasiatic strains
+Serum
+long-term physical and functional recovery
+Two-dimensional
+770
+Microtubule severing enzymes
+10 5Á6 EID 50 /ml
+viral replication and assembly
+DAPI
+oligomer concentrations of 50 nmol/L and higher
+instrumentation
+target variants that differ by only one or two nucleotides
+cyclopentane
+three
+0.02% butylated hydroxyanisole
+antigen plus NEI
+inflammatory cell infiltration and epidermal thickness
+AT-9010
+caveolin-1
+6
+61
+DC vaccines
+mutational pressure and translational selection
+Source data
+GAPDH
+Runx1 and Spi1
+Log-rank tests
+hemocytometer
+0.68%
+scRNA-seq
+>60%
+2004
+infants' weight and age
+An 'unusual' match
+lymphoma or leukemia
+polymerase chain reaction test
+interleukin-2
+priority lists of human and domestic animal pathogens present in Europe
+small
+Ku Shen
+Small angle X-ray scattering
+the size of the genome
+Rice
+2 days
+Creatine kinase
+52
+VEGF pathway
+HCs
+79.6%
+1993
+cholera
+rmzTab-M
+efficient epidemic mitigation
+coughing and sneezing
+5610 5 cells/well
+the nuclear transport apparatus
+biological events follow each other sequentially in a rolling fashion
+ten
+cytoplasmic membranes
+MDR-Ab
+a kozac sequence CCACCATGG
+broadly varying patterns from highly distinct peaks to poorly resolved generational clusters
+HCV core protein expression
+Δ med IDP
+Evidence of variable strength and on diverse conditions
+loose networks between ambulatory care services
+metabolic acidosis
+Geobacillus stearothermophilus
+hemagglutinin and neuraminidase
+H1N1
+0.1%
+GraphPad Prism
+blinded study personnel
+γ δ T cells
+H1-HT
+slightly biased, relatively stable and conserved ARO aromaticity
+5.6
+IL-15 and activating receptor HLA-G
+18 days
+Perkinsus olseni
+observations
+Liberia, Nigeria and Sierra Leone
+14
+2013
+user-defined
+any other pathogens
+total amounts of FAK and pY397-FAK
+mediates its binding to F-actin
+peritoneal
+equilibria
+five
+pseudogenes
+Seven
+omegaMap 0.5
+The accuracy of all constructs
+mice
+Three
+Parallel analysis
+NotI /SfiI
+study limitations
+proteins and synthetic polymers
+Manipulation of pre-mRNA splicing
+Multidimensional scaling
+background levels
+40%
+Africa
+b-actin
+diluted streptavidin-HRP conjugate solution
+Directional selection
+plaque assay
+pH-dependent conformational changes
+f~f c
+paucimannose
+Weaker effects
+4 h
+CD and SVA data
+wound healing
+a protocol
+Peacock
+pigs
+severity of the disease
+two
+positive
+molecular amplification of HSV DNA
+sepsis-related
+10 days
+twice or three times
+flow cytometry
+MatNH-and MatH-RNA3
+lytic buffer
+46%
+Waters Alliance Waters 2695 separation module and W2475 fluorescence detector
+7
+An electronic nose
+crisis client's absolute trust in MHCI workers
+GLA and SE
+R. rosea fractionation studies
+crossover region
+TruSeq HT preparation kit
+serum degradation
+750 times
+Sers nodavirus
+MM, HdP, and LF
+46%
+Shaking chills or shivering
+neutrophilic inflammation
+peptides
+Training health workers in the assessment and management of mental and substance use disorders
+A fraction
+FACS Vantage cell sorter
+an adequate database
+interdependence
+three
+cattle sample submissions
+oligonucleotides
+an LPAI progenitor
+avoidance-neutrality
+50:1
+IFNλ4p179
+one trusted official source of information
+Resonance overlap
+5%
+animal identification within a herd
+Data regarding underlying medical conditions
+share knowledge and resources
+1, 4, and 7 days
+a cascade of interactions with multiple cellular factors
+learning and teambuilding opportunities
+Donor plasma
+Multicollinearity
+technical and organizational
+NS2B-NS3 pro
+physiological functions, molecular biology, or genetic predisposition
+MT rates
+three
+smooth
+Atlastinmediated vesicle dimerization
+proteases
+increased EGFR internalization
+IL17A and IL17F
+DI water
+Ascites fluids
+Columbiformes
+four
+10%
+the classical secretion pathway
+Anterior Gradient 2 Homolog
+rapamycin complex
+four
+density-gradient centrifugation
+antibody epitopes
+1 min
+apoptosis
+changes in pH
+N-glycans
+primer dimers
+highly infectious diseases
+nystatin
+BEAS-2B
+rabies virus
+one fourth
+thin lines
+special
+regression modelling
+Stella
+pI:charge
+0.01
+infected cattle
+2009
+Six
+porcine peripheral blood mononuclear cells
+antibody responses against the target pathogen
+docking
+Detecting Mechanism of Action by Network Dysregulation
+2013
+peptide affinity
+Tarifa
+Two interacting proteins
+Gratuitous violence
+The flows W
+Bdetergent isolation
+Leghorns
+The % of blood tolerated in a reaction
+Dispositional pessimism
+GeneArt
+two
+Environmental sampling
+higher
+the explicit formal specifications
+splenic CD8+ T cells
+HLA type
+CFlow plus
+LSV2
+1 µM
+UVGI, EtO, and VHP
+characterization of entire proteomes
+R563 and K565
+APOBEC3G
+293
+sepsis-induced immunosuppression
+subclinical stages of JD
+nucleotide polymorphisms
+2018-02-20
+a proximally truncated SL6-like structure
+CTL019
+Cronbachs's alpha
+sequence similarities
+Sepsis
+virus-induced cytotoxicity
+ATG7
+antiviral activity
+nasopharyngeal and sinus infections
+ASL
+45
+risk of regional disease progression in experimental injury
+100 V
+2020
+hox
+TREM TREM
+50-90%
+size exclusion chromatography
+ELR1-IN
+CD209
+Crimean-Congo haemorrhagic fever
+formalin
+via email
+Nigeracin
+PR8
+covalently bound complexes
+Creatinine clearance
+serious adverse events
+week
+ICD code and Diagnostic and Statistical Manual of Mental Disorders
+proximal polyadenylation site
+acute weight loss
+High levels of sequence divergence and disparate interaction specificities
+Site-Align
+MYC deregulation
+auditory neuropathy spectrum disorders
+weight forms of GP
+gB
+14 out of 32
+two
+mdx mice
+epithelial migration, proliferation, and apoptosis
+Dramatic
+doxycycline
+hypophysitis and adrenal insufficiency
+control mice
+two
+NAFLD
+influenza infection
+IL-1Ra
+a collection of compounds derived from plasma or serum
+August, September and October
+winter
+flu-like
+Inflammation
+structural determination
+Sweden
+cross-immunity
+June, July, and August
+quantitative internal calibration
+248
+Oligonucleotide usage
+5
+cardiorespiratory symptoms
+solution space
+decreased significantly
+11%
+10%
+alternative substances
+HEK293T pLenti-mock cells
+via a break in the skin or inhalation of wind-blown cysts
+ACLF
+p.Tyr67His and p.Lys329Glu
+disease diagnosis, drug discovery, and vaccine development
+cellular detachment
+FBS
+heparan sulfate and chondroitin sulfate
+type I and type II
+Precision
+posttranslational modifications
+Spore concentrations
+IFI202b
+workforce reduction
+Genes with intron retentions
+200 kV
+the attending physician
+mucosal immune responses
+two
+cross-presentation mechanisms
+significantly higher
+a thorough search algorithm
+60%
+apoptosis of DC
+Bundesministerium
+rAdglob
+ES2
+condensed
+10
+TCM practitioners
+prespecified
+Total RNA
+pandemic and other emergencies
+sodium pentobarbital anaesthesia
+Mean synonymous site variability
+oxygen-tolerant
+Antisense RNAs
+U_UUU_UUA
+SGK1
+Five
+IL-10
+A small soluble delta peptide
+Ion trap instruments
+DNA methylation, histone modifications, and miRNA interference
+Bronchial epithelial cells
+public health intervention
+1 h
+p62
+six minutes
+G proteins
+Functional health
+low cytosolic amino acid concentrations
+diffusion
+D0
+increased toxin production
+64.5 kDa
+Scanning Electron Microscopy
+the template of sgRNA
+Charles River
+0.61
+ELISpot
+GQRSRI
+linear mixed models
+a human hepatoma cell line
+heat shock proteins or chaperone proteins
+Lassa virus
+positive
+3
+two
+quiescent intervals between them
+HUVECs and Jurkat cells
+eleven
+Inhibition of these early steps on the plasma membrane
+International Chemical Workers Union
+polydatin or resveratrol
+co-treated cells
+it can only allow monitoring of G4s in fixed cells
+two-thirds
+inflammatory-like
+test
+respiratory syncytial virus
+LB agar and broth
+no significant correlations between GC 3 and GC 12
+five
+rescue growth
+28S rRNA
+EBERs
+IFN-αω
+natural log-transformed concentrations in picograms per milliliter
+23,646
+Cot-1 DNA
+Gelatin
+consumers
+Evidence to support one or another evolutionary pathway
+UC Davis DNA Technologies Core
+three
+GAM
+1%
+Pfaffl formula
+four
+The New World temperate zone
+MS2 coat protein
+standard deviations
+Fold change
+Surfactant protein D
+septic shock
+severe ARDS
+91%
+4F/4R and 5F/5R
+Thailand
+Matrix metalloproteinases
+database curation
+knowledge score
+multiple gene products
+FilmArray Respiratory Panel
+QiAamp DNA Mini Kit
+yellow fever virus
+thorn prick
+raltegravir
+Streptococcus agalactiae
+24
+gp41 NHR and CHR
+functional HIV products
+67%
+dimensionality
+m
+Cells
+multiple biological functions
+8-12 weeks of age
+uncertain
+Ingenuity Pathway Analysis or MetaCore
+58%
+Entebbe, Uganda
+polygonal shapes
+two
+Ten
+the benefit of NIV versus oxygen in pneumonia-induced early mild ARDS
+de novo Ig synthesis
+reaction time threshold values
+PCR primer pairs
+sodium periodate
+10 mm
+CD8 T cells
+six
+NUP133
+apoptosis
+IHR and JEE core capacity scores
+social desirability bias
+antiviral treatment
+R 73 script
+permanent neurologic damage and psychiatric disorders
+Absolutely RNA miniprep kit
+Corrected parental information
+three
+every four hours
+lateral
+up to 7 days
+Transmissibility and severity
+40%
+one
+Kaplan-Meier
+UV transilluminator
+fatty acid synthase
+smoke inhalation-induced acute lung injury
+ethylene glycol bis-succinimidylsuccinate
+28
+actively induce autophagic flux
+life chaos
+potential confounding effect
+reverse genetics
+27
+recently
+7.7fold to 41.1-fold higher
+70 mg/kg
+viremia
+13
+supernatant of cells
+slow bonding
+future research directions
+global end-diastolic volume
+viral infectivity
+compartmental-based coalescent models
+discriminant measures
+3 to 5 weeks
+C-terminal
+saturation
+70 to 80%
+agarose gel electrophoresis
+second and third trimesters
+zero
+spatial maps of the infectious pressure
+their theoretical I
+49
+ECs
+lipopolysaccharide and other bacteria cell wall components
+American Type Culture Collection
+enhanced rVSV/EBOV GP infection
+Multiple-step contact tracing
+humoral immune responses
+Pulmonary hypertension
+excessive salt intake
+250,000 to 500,000
+Kinase prediction algorithms
+RpLP0
+Respiratory viruses
+dietary
+178
+vaccination
+to minimize animal experimentation
+promoter
+Sequence alignments of coding sequences containing RT stop codons
+routine screening of Herpesviridae
+peak inspiratory pressure
+2 months
+buffers
+transfection efficiency and pharmacokinetics of pDNA
+Electrode geometry
+nsP2 G641D and nsP4 C483Y
+increasing the match goal
+RC i
+RT-PCR
+Electrostatic interactions between host and phage proteins
+conjugative mating experiments
+the original input virus
+Th17
+The activity of the protease
+activated LNEPs
+Human Respiratory Syncytial Virus
+the modeller
+Chaos game representation
+unclear
+Biostim pulse generator
+GSH
+Ubiquitination
+secondary lymphoid tissue
+Sex, obesity and LVH
+VHTYG
+10.1002/cti2.1115
+3
+abnormalities of grey and white matter
+ULTRASCAN II version 9.9
+IAPV
+FGF
+Myotis mystacinus
+medians and interquartile ranges
+Three
+Leaf and root samples
+Total RNA
+Influenza A
+nM
+Influenza
+RSV subtypes
+The corresponding authors
+IRF7
+die
+37.4 and ∼100 kDa
+Landsberg erecta ecotype
+28
+ambiguity of codons and sequences
+mice
+15% to 35%
+Age and sex
+Statistical
+K310 and E311
+X k
+circulating monocytes
+wild ducks
+NS3/ 4A complex and NS5A protein
+48 hpi
+Electron
+day 0
+Thirteen
+over 50%
+H7N9
+eIF5B-dependent activation of IRESmediated XIAP mRNA translation
+OligoWalk
+NucZip model
+Acini count fold changes
+Risk assessment
+Chemical siRNA Modification
+serotype 1
+gH protein
+oxygen-free radicals
+Three
+Clean-Trace Luminometer
+Competitive ELISA
+Type I
+high altitude, low temperature and low oxygen tension
+serial dilution
+TGF-β
+Cys
+chloroform
+406
+internal genes
+8.43%
+Cap-independent
+different levels of exhaled methyl thiocyanate
+Intravenous blood
+RQ1 DNase
+SPSS 16.0 software
+19
+RLS
+Laboratory testing
+sensors of changing environments
+1%
+all variables
+age and gender
+24
+winter
+Influenza A virus
+similar distributions of distances between random structures
+A database
+61
+1.5
+172-198
+by binning into days
+de-identified data
+deposited calcium
+recreational and equestrian
+MassTag PCR
+16
+excellent separation
+Mycobacterium tuberculosis
+Cathelicidin
+polyester sheets
+cytosolic chaperonin
+relevant criteria
+negative binomial transmission function
+G-quadruplex
+genotyping studies of viruses
+confirmation of etiology by laboratory testing
+avoiding any type of vaccination
+life-threatening lung injury and respiratory distress syndrome
+7 d
+proportional
+mAb MR78
+on the top of the capsid proximal to the HBGA binding pocket
+transgene expression
+195-fold higher
+shrinkage
+increased demyelination
+anti-CD3ε
+N and NSs genes
+S. flexneri
+elevated cell proliferation and reduced migration
+over 90%
+pEGFP-C3
+24 hours
+All the professionals
+infection with S. pneumoniae
+Tim Berners-Lee
+20%
+ADAR
+PCA
+Listeria monocytogenes
+The occurrence and degree of autophagy
+4%
+studies on respiratory pathogens and clinical diagnostics
+112
+different outcomes of infection
+572
+four
+prophylaxis
+wafer masks
+an imputed value of 5
+manually or semi-manually
+20%
+4°C
+codon usage bias patterns
+herbs and nutritional substances
+cells lacking such signaling
+Anatinae
+general function prediction
+different values for the number of simulated chains
+Supplementary Table 1
+cytoplasm
+those from the hospital
+FCR3 and NF54
+Occupants
+50-219 nm
+2,025
+nucleolar localization
+antitoxins
+pseudoknots
+expand reverse transcriptase and oligo-dT primer
+TfR1
+Patient 3
+four
+ER
+ESCRT proteins
+H5N1 HPAI
+flies and mice
+4uC
+molecular targets causal for human disease
+50%
+Pegivirus, Pestivirus and Flavivirus
+aromatic and hydrophilic residues
+biomolecules
+increased affinity for heparin
+Recombination
+SnPP or ZnPP
+wt mice
+FASN
+resistance
+2
+a H-type pseudoknot or a series of hairpins
+Yca1 and Aif1
+Vps3 and Vps8
+Influenza type A
+affinity purification-mass spectrometry
+tetramer positive
+add in markers
+Influenza
+lack of appropriate posttranslational modification mechanisms
+The predicted localization
+higher CD4 + CD8 + T cell percentages
+63%
+increases
+Control and Prevention
+at least 4
+MetaGeneMark
+RV3
+SP-D
+tissue damage
+PLEX and immunosuppressive therapy
+inflammatory cell adhesion
+cationic
+Fecal samples
+Liprin-α4
+Interleukin-1b
+41
+villous immaturity and stromal changes
+IFIT1
+Collaborations
+evolutionary
+molecular diagnostics
+shifting between membrane bound and unbound conformations
+Dr. John Rose
+Phe420Ser
+55.5±2.33
+the proportion of infected individuals in a population
+12
+best tissue quality and high virus concentration
+BALB/c
+a delivery system
+IL-6 and IL-10
+Host ER stress and UPR
+every two weeks
+A1
+Eight
+siRNA, plasmid DNA, ASOs, and small drug molecules
+29 days of age
+a7 GFP expression
+Astrovirus, rotavirus, and caliciviruses
+metal-on-metal
+CcBV genome
+RSL3 and FIN56
+Pten overexpression lentivirus
+Localization probabilities and posttranslational modification scores
+95%
+inhibited viral replication
+PLA 2 s
+six
+monoclonal antibody therapy
+5 min
+correct
+12h
+enhances the efficiency of anti-PDL1 checkpoint blockade inhibitors
+SCHEMA
+Two third
+300,000-500,000
+chronic inflammatory processes during persistent infection or demyelinating diseases
+Culicinae
+Sialic acid
+VAP
+Fifteen
+U1D
+breeding or engineering resistant birds
+BLOSUM62
+Cide B
+D 95
+Respiratory dead space
+tissues and organs of the body
+Eight weeks
+7 days
+differences
+10%
+36%
+lack of PBD
+Gao, George Fu; Wu, Ying
+PCR
+K-string
+XmAb14045 and MGD006
+expression
+3
+The coiled-coil domain containing 137 gene
+orange
+similar levels of mean 16 s rRNA amplicon quantities
+insufficient resource preparation
+three
+The non-synonymous/synonymous rate ratio
+P. aeruginosa and E. coli
+replication
+1,114
+significantly reduced virus production
+ALI/ARDS
+3
+glucose and human chorionic gonadotrophin
+I log N
+intrinsic and extrinsic
+rBVs
+Heat-shock proteins
+5 days
+Ebola infection
+a novel broadly neutralizing epitope on HA stem region
+global surveillance
+endogenous NTCP
+cryostabilizing solution
+Thai
+18%
+10.1371/journal.pone.0048702
+15 nM
+Ontario Ministry of Health and Long Term Care
+dopamine D2 receptor
+Supportive therapy
+15%
+random variation
+February 2016
+Wikipedia
+three
+translation
+MHV-3
+a year
+Patients who required admission
+0.002% to 0.02%
+IFN molecular evolution
+bacterial
+280 days
+Systemic reactogenicity
+isolate 16681
+daily
+Knock down of PHBs expression
+Exendin-4
+Pneumonia
+ACE2
+DNeasy Blood & Tissue Kit
+more than 100 years
+Apoptosis
+specific degradation of complementary mRNA
+conserve energy
+microarrays or mass-sequencing methods
+6 to 15 days
+antigens
+SHC1, PI3K, and PLC-γ-1
+uORFs
+site entropy
+activation of immune cells
+severe lymphopenia, gastrointestinal symptoms, and liver and renal dysfunction
+AQP3 expression
+Lassa virus
+Primer-BLAST software
+AgeI and EcoRI restriction sites
+secretory
+aluminum
+a polyprotein
+Viable influenza A virus
+N150 days
+ImageJ/FIJI
+2 hours less
+47%
+41
+oral administration
+V2C cells
+sterile filtered PBS
+refolds into the highly stable postfusion structure
+political
+IRs
+RIG-I and TRAF6
+38%
+Two
+372
+Prevention Keywords
+34
+cc-by
+7 days
+multimerization
+STAT1 shRNA-transduced cells
+APMV-1
+TLR4
+bioluminescent and fluorescent RVFV
+host defense against certain pathogens and tissue inflammation
+77%
+Sp-cAMPS
+2017-12-21
+overestimated
+nsP2 G641D substitution
+Statistical Analysis System
+transacylation
+Hepatocyte proliferation
+20
+Exosomes
+mitotic figures
+low
+8.3 nM
+helical AIMs
+The ostrich
+Ϫ2FS product
+Two hundred and seventy-six
+A549
+1.0
+Cu 2
+acute, acute plus persistent, and persistent infections
+accuracy
+myosin II along with actin bundles
+cytochrome c ions
+lectins and other surface receptors
+Institut Pasteur
+R 0
+more resistant
+PBS-P
+random initialized and freshly trained
+Annett Kannegießer
+neuraminidase inhibitor antiviral drugs
+a patient
+The Application of Clinical Genetics
+tropical
+octameric
+electrochemiluminescence
+rz scores
+Super-Script III first strand synthesis kit
+cell cycle
+mediating entry and fusion of the virus into the hosts
+346
+ferrets
+Bag5
+R30K change
+Shaanxi, China
+G. Stark
+apoptotic stimuli
+Profiling table at genus level
+One
+Toyokuni et al.
+Microtiter plates
+binds a fluorogenic ligand and activates its fluorescence
+multiple interactions
+Csl4-NT
+mass dispensing
+Not all oligomers excise a targeted exon with equal efficiency
+four
+five
+behavior similar to the data
+6 days
+Constant EIT monitoring
+proviral
+presence of a species
+six well supported lineages of avian astroviruses
+Anti-tumor
+length of stay
+5016
+6 l/min
+Human ERManI
+building an evidence base
+between 6 and 8 days
+three standard deviation values above mean negative control serum
+high relapse rate of UC
+MSC-EVs
+mesenchymal stem cells
+cytokines and growth factors
+Two hundred forty-eight
+useful knowledge
+broad spectrum
+21
+discordant
+hormone responsive element
+metabolic
+rearrangement
+ten
+cellular Ca 2+ -regulated proteins or pathways
+PrimeScript RT-PCR Kit
+High resolution models
+4.2
+Feline upper respiratory infection
+GeneArt Technology
+monolayers with CPE
+43
+fibrotic
+Met, Y and PCP domains
+RAxML 88
+the number of the initially responding B cells
+Testing models of pathogenesis
+10%
+statistically significant
+467.3 g/mol
+decrease in plasticity
+other acute-care facilities
+a protein whose mRNA expression was altered by ILTV infection
+influenza
+secretion of intracellular proteins
+Gag and Env
+Emotional labour
+N. apis
+48
+a normal distribution
+stratum pyramidale
+ILTV replication
+13.8±0.9 hours
+extreme values of u
+Ala50, Tyr137 and Gln200
+anoikis
+swine
+gDNA from the parent strain 3D7
+C11R
+3
+prevention and vigilance
+game birds
+Tamura-Nei method 59 using Megalign Pro
+supportive care
+0.003 cm
+20
+enhances the type I interferon expression
+International Protein Index database
+Vertical transmission
+High throughput antibody sequencing
+delays in response efforts
+5.4%
+five
+viral
+low
+Stacked base interactions
+vacuolar proton ATPase inhibitor BAF
+The core sequence
+Stop-codon readthrough
+length and structure
+acute respiratory distress syndrome fusion circRNA
+Image-J plug-in
+Gene Ontology
+3
+Gating strategy
+BALB/c mice
+25
+5 days
+CCS-UFPE Ethical Committee
+washings
+BCM and GL
+viral replication
+productive infection of DCs and storage of viral progeny
+BLASTP and TBLASTN
+10%
+histologic progression to liver cirrhosis
+species-specific differences
+ZUFSP
+contacts of long duration
+TLR7
+lipid metabolism-related categories
+499 cells/mm 3
+SPSS 13.0
+dilated cardiomyopathy and chronic heart failure
+LD scans
+calibrated quality values
+9
+215,000
+20 h
+Type I interferons
+mRNA
+transmembrane
+silver
+between 19 and ~140,000
+MAS-1 R oncogene Gprotein coupled receptor
+lower respiratory tract infections
+1-way analysis of variance
+four years
+97% pair-wise identity
+DNA sequencing
+RSV-A ON1
+30
+computed tomography
+0.8610 LOOCV-AUC
+24 h
+Resource limitation
+310
+where the protease cleavage has occurred
+Dr. P. Gissen
+glycoprotein
+7/13
+MAR
+holidays
+large-scale tools
+1741
+challenge with divergent influenza subtypes
+ALI culture
+viruses of the Bunyamwera serogroup
+apoptosis
+Microtubule severing enzymes
+standardised HMDB IDs
+investigators at the Johns Hopkins Center for Public Health Preparedness
+low
+8 November 2011
+pseudotyping lentiviruses with RABV-G
+proteasomes
+Acute lung injury
+20%
+70-80%
+plasma
+intrinsic
+Ebola
+hemagglutinin and neuraminidase
+784
+virus transmission strictly based on epithelial modes
+2009
+epidemic modelling of data from 19th Century European smallpox outbreaks
+300
+cost
+endothelial cells
+depression and feelings of loneliness and despair
+4
+Beijing Vital River Laboratory Animal Co., Ltd.
+between 2 and 20
+logistic regression
+Smartphone camera
+Secondpapillomavirinae
+EVOC systems
+a resident physician
+fuse with lysosomes
+TLR15
+JetPRIME
+Actinomycin D
+more detailed analysis
+TLR4
+host entry factor CD81
+the correction factor n
+long poly DNA tracts
+17%
+molecular mimicry
+confocal microscopy
+two-sample proportion tests
+ARDS
+6
+The UFS
+eGFP pos
+Cap-independent translation
+Rabbits and cattle
+false-negative findings
+elevated ACE2 activity
+200
+Each study participant
+in the presence of rFGL2
+Quanti-tyOne
+GDI2
+149
+Malaysia
+50-60%
+6
+inhibiting the infiltration of immune cells
+GXXXT/S for myristylation
+12
+sub-micromolar inhibitory activities
+nine
+six
+12
+Group I conditions
+viral proteins
+Consistency
+pulmonary embolism and acute myocardial infarction
+novel, sensitive and specific biological markers
+their geographic location
+smokers and non-smokers
+three
+Pulsoximetry
+glycoprotein precursor processing
+level of gene expression
+S, E, I, and R
+Phylogenetic diversity of pathogens
+Nichirei-Histofine Simple Stain Mouse MAX PO
+a consecutive complementary base pair set
+virus particle and infectious virus release
+plaque assay
+filter degeneracy
+25%
+TRIAD microplate reader
+PEI-based
+random-effects model
+PB2, PB1, and PA
+Significant upregulation of eotaxin-2
+the individual with risk perceptual status
+isolation and air travel restrictions
+toothpaste
+China
+one-third
+EBV
+pigs
+cough, wheeze, bronchitis, or pneumonia
+meaningful comparison
+cc-by
+Six
+EBOV infection
+Sialic acid O-acetylation
+number of hosts in queue for location
+Z and h
+Mass-spectrometry
+A549 and H441
+disease and control parameters
+polarity in the lacZ gene
+Prof. Susan Zolla Pazner
+f i
+mutant
+our choice of prior distribution
+Two
+an unsaturated trihydroxy C18 fatty acid
+an equal portion of each patient's SIL spiked NPL sample
+uncertainty caused by the possibility of false negatives
+quarantine
+cardiovascular instability
+20 breaths min −1
+17
+Viral factories
+HMPV
+The specificity of PCR products
+the need for certain knowledge and skills
+Wild-type adult BALB/c mice
+Phylogenetic
+Activated protein C
+15 residues long
+DMC analyses
+F protein
+Northeast and Southeast China
+adenovirus replication-permissive animal models
+phylogenetic
+15-24 years
+blood sugar
+Vesicular stomatitis virus
+Leopards Hill virus
+low-glucose
+chest CTs
+replicative
+trachea
+ACE inhibitors and ARB
+30 minutes
+2 days
+regulates the function
+1963
+cortisol concentration
+Vaccine efficacy trials
+CLEC4C DTR mice
+epidemiology
+14
+the complete influenza incidence
+Elasmobranchs
+a pathogenic role for cytokine autoantibodies
+bacterial infection
+142
+three
+via intercalation into the pocket between two G-quartet units
+haphazard
+cervical, axillary, and inguinal lymph nodes
+Force
+adult-specific vaccination programs
+their perfect complements encoded on color-addressed microspheres
+Michel Camplo and Olivier Siri
+activates multiple immune pathways
+controversial
+Three
+Reverse database hits
+40
+active SJIA
+ORP analysis
+Monte-Carlo Markov chain samplings
+interfacility transfer
+Actin
+Highly Pathogenic Avian Influenza
+2.19-2.48
+Dyspnoea and cyanosis
+CL1-5 cells and NPC-TW01 cells
+continuous tissue oxygenation
+stakeholders
+C1 inhibitor
+15
+more extreme
+livestock movements
+PROSPERO
+Botanical drugs
+mice, ferrets and non-human primates
+One hundred
+12
+CRF07_BC
+decreased neuraminidase activity
+More than half
+35 kGy
+Nucleolar integrity
+IL-27R expression
+heteropentameric chloride channel receptors
+deficiency of SP-A and SP-D
+LF/HF ratio
+100 times higher
+One quarter
+demographics as well as the region of the household
+1998
+antibody-based methods
+HLA genes in humans are extremely polymorphic
+Cultivation
+Eight
+two
+protein-based
+clusters 1 and 2
+95%
+454
+HRP-conjugated mouse anti-human IgG Fc antibody
+nuclear transport machinery
+110
+Hjelle, Brian; Torres-Pérez, Fernando
+cell-free supernatant
+IgG
+human immunodeficiency virus
+clinical assessments
+Endosymbiogenesis
+Complex mechanistic models
+11 6 2 min
+every 3 years
+all of the anti-H9 sera
+Blood samples
+5%
+HAdV-E4
+SHFV
+cat G
+51
+Informed and voluntary consent
+TLR-induced
+flow cytometry
+flexibility
+65.6%
+IRF1
+H1-subtype IAVs
+106
+Wild-type missense levels
+pHOx Plus Blood Gas Analyzer
+June or July
+Surveillance data
+DMEM medium
+AMPKα1 phosphorylation and SIRT1 expression
+AP-1 DNA-binding activity
+HBZ
+mast cells
+a color
+Myc-tagged WT and mutant RNase L cDNAs
+B. subtilis OhrA
+large-scale animal movements
+2008
+different combinations of drugs and therapies
+pipeline v1.8.1
+GenBank
+IP-10, RANTES and IL-6
+2-10%
+histopathologic
+how the characteristics of the field change over time
+three days
+indirect cell membrane immunofluorescence
+Glomus cells
+25
+Menisdaurin
+GFP levels
+adaptive antiviral strategy
+Stanford University School of Medicine
+1959
+ribosome biogenesis
+Disseminated disease
+being female
+the bird age
+by regulating p21
+genetic similarity
+Mca-APK-Dnp substrate
+1 day
+translation, RNA metabolism, protein modifications and intracellular transport or membrane modifications
+XendoU
+PCR amplification
+380 nm
+endogenous levels of ACE2 protein
+L118A/I119A
+the sequential aggregate of the eight assigned gene segment lineages
+pneumonia
+Three weeks
+CPB
+11.5
+Phylogenetic algorithms
+50%
+Y-scores
+17%
+translational activity
+Chittagong Veterinary and Animal Sciences University
+PCR
+DN57opt, DN80opt and DN81opt
+dystrophin protein
+three
+35,114
+E2F8
+disease
+deterministic compartmental model
+polyadenylation
+82 years old
+50 mM mannose and 5 mM EDTA
+254 ± 12 pA and 622 ± 13 pA
+microvascular abnormalities
+IL4pred and IFNepitope
+encephalitis
+Twenty-four hours
+antibody produced from a single antigen-specific B cell
+ATPase Na/K transporting subunit alpha 1 and prohibitin
+The final logistic model
+injurious ventilation
+Gluc-expressing viruses
+IREI, ATF6, and PERK
+Molecular chaperones
+cytolytic
+dynamic transmission model
+Dr. Yanjin Zhang
+LLPS of the polySH3-polyPRM system
+Descriptive statistics
+The Global Fund to Fight AIDS, Malaria and TB
+amphiregulin/EGFR
+interleukin
+HLATyphon
+inflammatory
+severe parenchymal inflammation with no obvious airspaces
+the bacteria
+Cucumber mosaic virus and Plum pox virus
+impaired formation and deposition of immune complexes
+MPP software
+7
+ProteinChipH Fractionation Kit
+Angiotensin II
+48,692
+cell-free supernatant
+two
+cmnm 5 s 2 U
+all affected individuals, their family members and medical staff
+105
+12
+LAG3/CD49b double positive
+IgG antibody conjugating colloidal gold
+Levenshtein distance
+An improved blocking procedure
+protection against bacterial infections
+disruption of the genetic material
+nasopharyngeal colonization with respiratory bacteria
+800
+ferrets
+ΔPARF
+any time
+1.0 and 2.0
+26.7%
+T cells
+M. domestica spp.
+1963
+11
+green fluorescent protein
+specific features
+marginal
+MEWDS is underdiagnosed
+mobile POCT and properly trained, certified, and annually validated personnel
+4 th May 2015
+crowded conditions created by synthetic particles with narrow size distribution
+folding of siRNAs
+Higher
+body temperature
+Acute respiratory distress syndrome
+GS De Novo Assembler
+H7N9
+ssDNA TM
+Routine disease surveillance and the prompt identification and isolation of clinically ill animals
+pathophysiology of lung injury
+HRV-A infections
+HI and MN
+PID values
+change
+Matrix-assisted laser desorption/ionization-time of flight analysis
+70% to 30%
+mid-1970s
+sj/bTREC ratio
+TL1 and TL2
+69.48%
+CD11b
+Spheroid culture
+FADDL
+68%
+5.6 Â 10 6 /mol
+90%
+MS-based
+Quality control and deviations from HWE
+Two
+sugar RDCs or sugar conformation
+all of the eight-point dose response curves
+SVM
+3 h
+55.4 ± 5.0951 μM
+pcDNA3.1
+30 min
+ITS2 and psbA-trnH
+Five
+2015-01-15
+LeFE random forest machine learning algorithm
+Atg16l1
+α-Tubulin levels
+Further research
+helix F
+shRNA
+more than one genotype/lineage of each virus species
+11 fibronectin structures
+four
+Protein concentration of lysates
+NK cells
+Krt5 pos cells
+IFN induction and action in infected cells
+RNase A
+163.com
+relaxes the constraints on internationalization
+leopard
+spikes
+an APMV
+Embryonic day 0
+sequencing reads generated from the genomes of a large number of species
+McNemar's test for matched pairs
+CFSE lo alloactivated T cells
+2 h
+twice
+F i and A i
+Ni-affinity chromatography
+k nearest neighbor algorithm
+parasite granulomas
+viral RNA synthesis
+immune responses
+depression and alcohol use disorders
+RNA sequencing
+activation or cytokines
+Khyber Pakhtunkhwa Wildlife Department
+hippocampal T cells
+hydrolases
+escape mutations
+10%
+lymphoid tissue damage
+80%
+263
+Molecular diagnostics
+Autophagy
+300
+Influenza A virus X31 and Phil82X
+context-specific
+ELISA
+sialic acid
+81 %
+monitoring virus evolution
+16 mg/ mL
+increased expression of ACE2 and MAS-1 R proteins
+valid
+jpHMM scal
+CD40L-mediated apoptosis
+Glu
+Control samples
+Ifn-α
+FastQC v0.11.5
+3-5 days
+Critical illness
+27
+Sex and genus
+CD4 cell count
+antibody-dependent enhancement
+Hirt DNA
+23,000
+50-60kDa
+Comprehensive English and Spanish language literature reviews
+Tat protein expression
+ACE2 activity assessed against an artificial substrate
+quadruplet codons
+CD46
+endocrine disruptor
+vitamin D deficiency
+329
+proliferate
+glycoproteinspecific T cell responses
+UAF1
+therapeutic interventions
+4/11
+1.81 and 1.86
+Oligonucleotide site-directed mutagenesis
+100%
+extracellular
+69,5 %
+When the daily vaccination rate is fixed
+mannan
+Aminopeptidase N/CD13
+three
+p24 levels
+monobenzone-induced memory CD49b + cNK cells
+social marketing strategies
+1 hour
+secondary progressive MS post-mortem brain tissue
+IASOS
+t*
+Biphasic unfolding transitions
+length
+culling of unsold birds
+IFIT5
+confirmation of pandemic H1N1 influenza A infection
+bacterial toxins
+differentiating local transmission from a new focus
+Fruit bats
+protease sensitivity
+phage output titer
+PREP
+delayed oseltamivir therapy
+pathogens not tested for and thus with no data
+80%
+mice and humans
+the prediction of disease spread and the establishment of effective control measures will be hampered
+0.79
+21
+Phytohemagglutinin
+enzymatic
+thermodynamic parameters
+PFT
+LOS and NEC
+Education regarding the cognitive sequelae of critical illness
+growth-promoting signals
+WNV
+nsP3
+IL-10
+mutation of the other six residues
+26%
+G6PD-knockdown cells
+an underestimation of the population bottleneck
+operates other motion
+1976-2001
+IL-1β-induced inflammation
+receptor attachment
+16
+5-10 min
+Relative synonymous codon counts
+Method 1
+Hsp90
+Akaike Information Criterion
+Autodock 4.2
+2010
+Blood, duodenum, ileum, and spleen tissues
+37-40 mg/mL
+functionally influence digestive system function
+a binary judgment of having or not having a disease
+up-regulation of mTOR activities enhancing cell proliferation
+Phase 6
+CDR'
+chloride ion secretion
+24
+24 h
+three
+NS3pro
+mSAMD9L
+viral replication
+Pathogen-informative
+the protective effect of DIZE
+eight
+search behaviors related to HFMD vary throughout the province
+on the CRF and on the concomitant medication form
+spatial and temporal variability in the case-reproduction ratio
+SERCA
+UVimaging
+SaCyp
+socioeconomic, environmental, and ecological
+~2 μg/ml
+Tumors
+Twenty-seven
+reproducibility
+Lactobacillaceae
+secondary structure
+72 hr
+NLS-2
+Israel meningoencephalitis turkey virus
+Professor David Blackbourn
+Spiegelman's Monster
+patient records
+TLR4-dependent signaling
+School closure
+inflammatory cell recruitment and cytokine release
+circulating IgM
+low pH
+disease-free survival
+different types of regulators
+co-infection
+50 nt
+to guarantee safe and long lasting effects
+Virus distribution
+miPepBase
+PERCH
+Propensity scores
+between November and April
+1259.7 Da
+high-risk targets identified by security organizations
+single-stranded DNA binding protein
+ACE2
+MHC class II compartment
+several interesting candidates
+RotaShield TM
+Normal levels of complement system's proteins and plasma protein electrophoresis
+Hepatitis B
+30 °C
+49%
+hospital-associated
+0.2%
+people who live in urbanized areas
+erm
+counted
+206 nm
+V2
+in their soluble forms
+Microglial activation and increased proinflammatory cytokine production
+epitope identification
+CPU-and memorydemanding
+ω
+ACE2/Ang-
+0.5 M sodium bicarbonate
+High level of variability in BKV
+El Niño/Southern oscillation
+regulates ABCA1 expression
+VIRIP
+Concurrent bacteremia
+normal translation resumes
+an aMDA-5 autoantibody
+mouse
+In vitro trials
+mortality
+3.666 × 10 6 uL
+100%
+R 0 and ⁎ R
+The shortness of MLE of serial interval
+Penn State College of Medicine Flow Cytometry Core Facility
+3 days
+SFPQ
+DAPI
+four
+Superscript IV Reverse Transcriptase
+stress intensity
+IAV-bacterial co-infections
+RNA architecture
+ImageJ
+PE anti-Tim-3 antibody
+interactions between core proteins
+Disruption of CNS homeostasis, neuronal deterioration and inflammation
+class or family
+patients with both acute and chronic infection
+the unobserved component
+3 perl scripts
+four
+4
+C 15 H 10 O 5
+oseltamivir
+Western Lightning Plus ECL detection reagent
+12,000
+phylogenetic order
+pneumococcus
+30 s
+separate episodes
+whole blood
+cholesterol intracellular storage in host LDs
+erastin-mediated ferroptosis
+Tubulin
+88%
+114
+coupled and uncoupled
+2500 nt
+public reaction to a disease is frequently disproportionate to the number of cases
+rapid weight loss
+24-h
+structure-assisted design of small molecules
+23
+Weibo
+infection of PTH
+quantitative estimations of sequence similarities and dissimilarities
+108
+a past primary DENV2 infection
+1978
+CIS and VHL
+fluorescence activated cell sorting
+nonspecific symptoms
+antiviral drugs, ventilators, and general hospital care
+regulators of the protein-coding sequences
+Amazon Web Services Marketplace
+superior cost and resource effectiveness
+explore the public's views on the pandemic influenza vaccination
+cells in different cell cycle phases
+set new values in the input fields or move sliders
+2 weeks
+TBC2target
+individuals with chronic, underlying medical conditions
+UPR-induced NF-kappaB activation and ROS generation
+high
+1:10,000
+DCs
+t R
+receipt of any of six intervention components
+double positive cells
+contact duration
+Sera
+acid conditions
+antiviral
+ocular adverse reaction and serious derangements of electrolytes
+14
+RPL4
+150
+mitotic microtubule dynamics
+defense response to viruses
+text
+regulatory sequences or Transcription Factor binding sites
+S-palmitoylation
+HepaRG
+Figure 2
+infectious agents
+10% 8 M urea acrylamide gels
+R 3 and R 4
+cervical cancer cells
+53
+pig, sheep, and bovines
+GraphPad Prism 6
+cellular oxidative stress
+niclosamide
+10.3390/v2122559
+37%
+91%
+Doripenem
+3 weeks
+near the outer edge of the template tunnel
+CRP and PCT
+Acinetobacter baumannii
+Hominoid Old World primates
+ECG
+38%
+165
+endothelial cell pyroptosis
+Athens
+10
+means and standard deviations
+Drug treatment
+higher concentrations
+sharper slopes
+IS2404 PCR
+HindIII and EcoRI
+artiodactyls
+hemocytometer
+positively charged residues
+whenever
+1.76
+sites of MCMV antigen expression
+2.27/1,000 person-year
+400 ng of total RNA
+20
+Confocal
+muSOX-induced
+genotypic
+HNF-1 alpha mutations
+mucosally delivered subunit-vaccines
+concentrated
+15
+a lock and key
+Guangdong
+n > 400 vesicles
+host-related factors and environmental factors
+HIFs
+Five
+rhinovirus, coronavirus, influenza
+45 minutes
+clinical benefit
+PT cells
+random
+>95%
+56°C
+pharmacological agents
+FPIX in the DV
+statistical package
+11
+w52%
+type II pneumocytes
+poor prognosis
+high-affinity binding
+Fifty-two
+Table 2
+HIV-1
+84%-87%
+The ligation reaction of fragments 1 and 2
+2009
+pathway and network centric
+pooling samples
+functional incompetence
+alteration of the disulfide bond pattern
+CU-CPT9b
+log-rank test
+lung epithelium
+11%
+acid solution
+epithelial and endothelial cells
+Fisher's combined probability test
+73%
+6 months
+Alexa Fluor 594-labeled donkey anti-mouse IgG
+regulatory reasons
+VP88GFP-expressing cells
+Total eIF4E activity
+involve people in the decision making process
+IFN-α
+0.8 mg/kg
+carbohydrate
+antibodydependent
+multiple organ failure and death
+a trained nurse
+polarized and nonpolarized
+45.5%
+poor
+Figure 8B
+Titers
+lysine 2066
+Concomitant
+20%
+repeat dosing
+enterovirus 71
+Purified pDCs
+more severe leukemoid reaction, plasma leakage and coagulation disorders
+Troponin T
+PTX blocks T cell motion
+DC-derived IL-2
+PCR
+Comprehensive medical screening
+C23
+95
+the trimerization of independently folded monomers
+the nuclear membrane
+the best fit of the model to the data
+MGs
+cell-apoptosis induction
+guanylate-binding proteins 2 and 5
+Dengue fever
+Virus binding to host cell surface receptors
+Akaike Information Criterion
+Molecular chaperones
+vRNA
+protein quality control
+Epi Info 6
+AMCase
+ERK, p38 and Akt
+leukoencephalitis
+up to eight
+80.5%
+F-7000 fluorescence spectrophotometer
+Staphylococcus aureus
+0.68
+E10
+65
+∼14 days
+M-CSF-treated cells
+three
+4%
+particle formation
+12%
+405
+ΔP
+90
+56
+15
+whole genome short-read sequencing data
+re-infection of individuals or loss of immunity
+Marik and Corwin
+geographic isolation, population demography and vaccine coverage
+three
+450,480
+13%
+transmembrane Toll-like receptors
+two months
+significant
+methylated
+CC 50
+28
+the mechanism of frameshifting
+two
+Macrophages or the closely related myeloid suppressor cells
+Tocris
+Enhanced
+CXCL16
+five
+17.4%
+P1, 1B, 1C and 1D
+two-way repeated measures analysis of variance
+anti-vector blocking responses
+inflammatory
+MLKL
+age, sex, occupational status or family history
+black
+water fowl
+systematic and concrete planning
+PDI-dependent DT toxicity
+translation-level regulators
+Standard deviation for each mean
+worsening sepsis severity
+vaccine growth
+ACE1/ANG II/AT1R axis
+1040
+30 nm
+442
+329
+200 μL and 100 μL
+21%
+six
+Susceptible-Infectious-Recovered model
+all three structures
+15 min
+21,087.1 billion RMB
+plasmid A
+25 µL of antigen
+Figure 3
+six
+H5N1
+IP inoculation
+S. aureus Newman WT
+10%
+susceptibility to rupintrivir
+phosphadtidyl serine or other ubiquitous cell surface receptors
+POCT
+How G6PD is involved in the activation of the inflammasome
+person-centric model
+WATERGATE 3-9-19 pulse
+synthetic oligonucleotide
+a single introduction of infection
+C
+Charles M. Rice
+Microglia and macrophages
+eIF4E
+Sexrelated
+reacting to diagnostic needs in epidemic events
+one week
+Dell Precision TM T5500
+Arginine stereochemistry
+disease status
+Five
+similar results
+pain sensation
+a new family of viruses
+Affymetrix GeneChip Mouse Array
+Bovine serum albumin
+43.26 μg/ml
+Power calculation
+PEI/Luc NPs
+two
+into a parallel homodimer
+symptomatic disease
+Globalization
+spring and winter
+VIDISCR
+60,000
+0.1-0.5 µg/mL
+microfilariae
+None
+second-generation sequencing
+reBmBac
+primary cells
+Libraries
+ALI
+low
+heat-related illnesses and trauma-related injuries
+immunomics
+mitotic, meiotic, and postmeiotic
+vesicle swabs
+1 − θ = k 2 /
+240,000
+Nrf2
+diseases
+genome stability
+amino acid changes
+Baroreflex
+15 min
+27
+initiating on the wrong reading frame
+6.0%
+CVB3
+Caspase activity
+Kidney cortex
+stress fibers
+capsular types
+myeloma
+367
+Bronchial smooth muscles cells
+9 generations
+the Ministry of Health
+IL-10
+Figure 4d
+eleven
+Twenty-five
+high-touch surfaces
+Gene regulation
+to counteract enhanced muscle protein breakdown
+Isoelectric point
+R 11
+apoptotic
+Vaccinations
+digestive efficiency
+endemicity
+amorphous
+orthopaedic
+FCV and FHV-1
+hydrogen bondforming moieties
+H78-C10.0
+cDNA preparation
+LSECtin
+two different chromosomal fragments
+viral particles
+passive
+mean expression of all genes in each module
+Hrk and Bid
+13 March 2020
+Apdm09 activity
+10.1371/journal.pone.0002432
+55 C
+LMICs
+Public security
+autoimmune diseases
+nan
+40
+Sixty-one
+non-parametric 2-tailed Student t-test
+suspected
+hypoxia
+adaptation
+23
+Mimivirus
+Eleven
+elevates
+NHP endotoxemia
+Bio-Rad MyCycler thermal cycler
+five
+stringently controlled, definitive intervention trials
+four
+Foxp3
+Intravenous injection of immune globulin
+glycoarray
+stay in the office
+2009
+all links that ever appear available between nodes i and j
+bronchitis
+supersonic waves
+WHO 2009
+C22
+not all patients were managed with all four support strategies
+30.1 and 14.3 fold
+protocol standardisation
+NHP models
+to study emerging infectious diseases
+9256543256
+a quantifier and a qualifier transition
+sialic acids
+24 h
+recombinant proHNP1
+PCV
+Hepatocellular carcinoma
+formation of the cystine loop
+Red
+during the analysis of two closely related litters with four affected puppies
+>86%
+N-terminally truncated LASV rNP
+ten
+54
+genomic plasmids
+MLKL
+transitivity
+Sepsis
+Node coloring
+compensation for a temporary hypercoagulatory state of the body
+GSE103207
+modulators of the immune system or virulence factors
+syndromic
+Innate immune responses
+metaplasia of squamous epithelial cells
+mouse KAT2
+Twenty-one
+non-specific
+reactions
+Golgicide A
+T cells and dendritic cells
+cytopathic effects of poliovirus
+s
+hydrophobic degeneration
+Synonymous codon usage
+94%
+larvicide spraying
+the manufacturer
+festina lente
+HBoV 1/2/3
+t i
+respiratory epithelial cells
+Microsatellite instability
+0.132
+GENIE3
+56
+WBC counts, CRP, and PCT levels
+cryptic
+protein transduction domains
+end point RT-PCR
+turning points
+flow cytometry
+Gene Expression Omnibus database 1
+3 to 36 days
+18S
+population ageing
+more than 4000
+severe adverse reactions
+A450
+Xtract with identical parameters
+oral administration
+four
+CD81
+HPV infection
+high
+Newcastle disease virus
+four
+TBSV -strand RNA synthesis
+Particle mesh Ewald method method 15
+Comprehensive reviews on molecular actions of UDCA
+PCR
+to provide a searchable virtual library on the web
+Ribosomal protein S7 mRNA levels
+alphavirus
+Biosafety Level 3
+five
+synthetic influenza incidence data
+R 0
+20
+Logistic regression analysis
+social contact behavior
+100 million
+predicted DOF model
+BAC cDNA clones
+ISG-encoding lentiviral vectors
+symptom onset date
+parameter number
+RH
+cell lines
+12 hours
+50 to 70 % of injected embryos
+severe immunosuppression
+domestic livestock and/or farmed wildlife populations
+291
+a snowball approach
+individual-based models
+6 November 2013
+risk averseness
+CD8 T lymphocytes
+Quadratic discriminant analysis
+a review of a clearly formulated question
+EpiData
+tumor necrosis factor alpha
+linear trend
+78%
+light sensing
+MSP ox 1-4
+SUMO-1
+hexahistidine
+increased pulmonary inflammation
+extracellular matrix and regulation of blood pressure
+SnapGene
+January 2009
+IFITMs
+phylodynamic models
+TUB
+autophagy stimulation
+HRV specific semi-nested PCR
+CIAP
+wounding-healing
+27%
+6 weeks
+homodimer
+24 h
+idiosyncratic
+One million
+a washing step
+pcDNA3.1-Myc-PKR296R
+6 days
+All authors
+standard RT-PCR
+QIAmp DNA mini kit
+Drs. Richards, Pepine, Raizada, and Kim
+Spike-in controls
+Prediction and pre-warning
+Poisson distribution
+feedback of the results to HCWs
+high MOI or longer time points
+GUIs
+permutation test
+two-way
+12 weeks
+rhinovirus
+The possibility for such harms
+data from additional settings and years
+Gel filtration chromatography
+59.3% to 96.4%
+PCV-2 and PRRSV
+2 12.3
+TRACER v1.6
+MagExtractor-PCR & Gel Clean up kit
+71
+PureLink TM Viral RNA/ DNA Kit
+50%
+further investigation
+three
+regulating CII-induced differentiation of Th17 cells
+81%
+lysosomal cathepsin B
+Chest
+influenza viruses
+18%
+to reproduce the data on the age-dependent daily contact numbers
+21 days
+artificial protease substrates
+1.2-1.7
+10.5%
+Ebolaviruses
+nosocomial infections
+antibiotic-associated diarrhea
+HT and PLT
+inflammatory bowel disease
+hemodynamically
+p19 protein
+One hundred nanometer polystyrene nanostandard particles
+a set of parameter values ν
+Sepsis-3
+Genecore Corporation
+pCAGG-NP
+Fever
+Internal standards
+ethyl-substituted ThT
+LPS
+14
+PrtP
+1,028,840
+Antiviral chemoprophylaxis
+11 million
+an IFN-inducible protein
+critically ill patients with acute respiratory distress syndrome
+Gamma-secretase inhibitors
+rs117648444-C/T
+pAC-A
+mimivirus
+δ
+0.0012%
+lung
+calcium chloride method
+private clinics, psychiatric hospitals or nursing homes
+CD4 cell count and time since HIV diagnosis
+direct-acting antiviral agents
+inflammatory response
+elevated pH cyt
+Lassa hemorrhagic fever
+the managers of DAH grants
+DHFR mutant strain
+novel and longer CDR3 regions
+Single round selection
+82
+indirect calorimetry
+firebrick
+FUJIFILM Wako Pure Chemical, Ltd
+l tr
+three different matrix metalloproteases
+deoxypodophyllotoxin
+Respiratory syncytial virus
+Genomic DNA
+nonmonotonic
+Drug-induced acute fatal liver injury
+Cortex Magnoliae Officinalis
+0 to 1
+volatile metabolites in exhaled breath
+pBR322
+0.02 mg protein/ml
+courage
+56%
+proteomic approaches
+host-species specific defect
+oncogenic retroviruses
+population sensitivity and false positive rate
+apparent reduction of product level
+1
+Viral RNA
+313 nM
+clathrin-mediated endocytosis
+pDest14/N TAILHN
+Alignment of different mammalian ABCB1 protein sequences
+diarrheic calves
+cytoskeletal rearrangements and shape change
+dsRNA
+Visual Analog Scale
+Viral RNAs
+rabbit anti-human HSP90β mAb
+selective inhibitors
+exercise training
+14/3/2020
+black
+Surgical exploration
+ACE and KDR
+cytoplasmic LD abundance
+68.0 cases
+classic medulloblastoma
+21 days
+epitope-based
+38
+2.3 µm min −1
+14-day
+IL-12p35
+Viruses
+during the late stages of infection
+days during which supplemental oxygen was required
+VP24
+Miranda software
+95,000
+ISG15
+Respiratory epithelial cells and macrophages
+key mediator
+6 months
+16 of 18
+GLIDA
+Globalization and Health
+clinical trials
+545
+Syrian hamster transcriptome
+cc-by
+increased TTV burden
+Levinthal's paradox
+Vacuolating cytotoxin
+GS
+Study of the link between taxonomic proximity and genomic signature proximity
+vRNP export
+ORF as well as UTR sequences
+GHITM
+2 mg of total RNA
+E. festucae codon usage
+Two weeks
+Viral RNA
+90%
+public ground transport
+the same sample
+absolute quantification of transcript levels in single cells
+least-squares fitting
+serum sample
+onset of symptoms and outcome
+Microneedles
+haplotypes
+two large fragments
+7 head-to-tail β-strands
+TBI in sport
+30 min
+supernatants
+Sequences from different parts of the world
+λ = 280 nm
+60%
+HisPur™ Ni-NTA Resin
+Caffeic acid
+an integer between 0 and 15
+21
+Two out of four
+tet40
+DC-SIGN
+Gremlin-1 staining
+significantly increased
+suppressing
+Meningococcal
+Three
+three different replication mechanisms
+eight
+rabbit antihuman CD3
+amino acid R443
+113,228 compounds
+a regular stem
+log 10 /ml
+Supplementary Information Table S3
+Cufflink
+AT-9010
+RNA viral protein interactions with host proteins
+16
+PCR artifacts
+subclinically infected with PiCV pigeons
+8.5 ± 2.2 mL/kg
+missing value imputation, outlier removal and data normalisation
+Predicted xis and integrase genes
+transducing CD133-positive cells
+Japan
+further resolution of antibody epitopes
+P
+immunochemistry tests, cytogenetic studies, and molecular techniques
+the nature of the state
+changes in R 0 when R 0 > 1
+Eighty-nine
+MeOH extract
+1702 cell eq./m 3
+diagnosing, treating and preventing oral disease
+25%
+PYD
+F110_9318
+selective
+NCT01317745
+to identify LRDs caused by CRVs
+one
+5%
+sinapinic acid
+complement-dependent
+endocrine disruptors to radiation
+41.8%
+TRIF
+Smad4
+permanent
+HETATM record names
+RSV-GFP virus
+an outbreak
+antibiotic regimen
+fine particle aerosols
+quantitative attenuation and an endpoint of stable, permanent attenuation
+glycoprotein cleavage by the proprotein convertase furin
+the virus is able to cross the blood-brain barrier and stimulate inflammation
+200 μm
+demographic, geographic, and socioeconomic
+HBTU:HOBt
+scoring model
+0.2%
+total cell lysate
+Pane C
+global significance
+desiRm
+28%
+Skin cancer
+an M protein with a lower PID
+monophyletic
+ACJ
+Logistic regression
+87.6%
+the most elaborate and diverse clusters on the antigen surface
+essential associated proteins
+SR and KH
+C-terminal tails
+long carbon chain
+Alveolar macrophages
+March 2017
+goat anti-mouse IgG 10 nm gold conjugate
+71.8%
+lethal
+NUTS 0
+mice and in chickens
+sacral function
+GP2 residues
+synthesis of the NS3 viral protein
+NFKB1 and REL
+Written informed consent
+read counting, normalization and calculations of fold changes
+Discriminant analysis and principal component analysis
+calling attention clearly to a common or significant particular risk
+Los Alamos HIV sequence database
+1 month
+The area under a random curve
+intracellular transport and organisation of the genome
+148
+basement membrane component laminin
+Theiler's murine encephalomyelitis virus
+real-time PCR
+Allele frequencies
+Shannon Evenness Index
+Rapid pressure changes and the exhaust system
+primary particle size
+nurses
+Notch1
+63
+23 million
+38%
+any references to things that were deleted and definitions that are impossible
+Nikon NIS Element Software
+transcription of IFNα and IFNβ
+safety issues
+PTH
+100%
+4 hr
+SOD
+modulation of PAMPinduced immune responses
+1.1 mg
+vision impairment and floaters
+1179
+CCHF
+2008
+disperse
+increases the neuronal firing rates
+physiology
+Proadrenomedullin
+281
+lower
+thyroid function
+A/H1N1
+50
+adult haemoglobin
+deleting MEs
+27%
+NucleoSpin Extract II Kit
+Structural data
+graphs
+Baidu
+HEK293
+base-pairing required for RNA folding
+0.04 ± 0.02 Pa·s
+30
+inflammatory cytokine and chemokine production
+Institute of Tropical Medicine
+44%
+upon a HS
+the size of the protein coding area in the genome
+cytokine/chemokine levels
+Methodical analysis of the structure of DCIR
+1.6
+pro-and anti-inflammatory
+group E pigeons
+human and zoonotic
+immune response
+histopathological changes
+104 pg/ml
+renin-angiotensin system
+10-kDa
+the "mouth" of the F pocket
+unsuitability
+41
+differentiation of neural stem cells into astrocytes
+regulation of C3 function
+low quality sequence regions
+Telomere attrition
+Mycobacterium tuberculosis DarG-macro
+3.8
+Wageningen Bioveterinary Research
+bovine fetal fibroblast cells
+exacerbation severity
+reduced entry-enhancing activity
+GC B cell reactions
+moderate elevation of maturation markers
+SPI1 and SP2
+acute renal failure
+anchorage independent growth
+four iterative stages
+Over a million
+vaccine efficacy
+FACS
+2-3-week
+Forty-six
+disease severity
+Immunohistochemistry and PCR
+rhesus macaques
+de novo assays
+unparalleled information
+personal protective equipment
+guinea pig
+porcine Oct4 + Ccsp + colony cells
+IL-1β and TNF-α
+CD20
+GeoChip 2.0
+Viral proteins
+substrate proteolysis
+Euphorinae
+to optimize the system for endpoint measurements of enzymatic hydrolysis reactions
+reasonable
+HIV-1
+Cellfree supernatants
+RRV 31,32
+1%
+T-bet
+10 μg/mL oseltamivir phosphate
+HFMD transmissibility
+14 days
+Lyme disease
+inserting additional probes
+viral E proteins
+568 days
+to avoid underestimation of the number of CEA genes
+0 frame translation
+causal relationships between single predictors and outcome
+more than 40%
+S. agalactiae serotype III
+PCR and sequencing
+adult vaccines
+0.3%
+Eight
+5%
+46 years
+NS1 sequences of SA14-14-2 strain
+TLR3
+SOD and GSH-Px
+crossreactive
+Fifteen
+frequency-dependent relationship
+QSAR
+MHC class I
+Ub
+regulate motor deficits and neuroinflammation
+50%
+HBV, HCV, HIV, and West Nile virus
+Taconic Farms
+a rapid reversible head domain movement
+secondary over primary infection
+capacity building for improved infrastructure and administration
+Due attention to the soft periphery
+24%
+45 to 56%
+endo-lysosomal compartments
+H1N1
+transport medium
+mRNA variants
+wane
+56
+2 weeks
+CD274
+high similarity
+wild-type and TMPRSS2 KO mice
+relieved
+hamster
+Disease severity scores
+wobble uridine modification
+it can survive in host tissues for several days
+FITC-conjugated secondary antibodies
+PET, AFLP, and cardiomyopathy
+sepsis-associated AKI
+All data
+chromatin accessibility
+avoidable mortality rates
+to stringently evaluate the efficacy of tolerance induction protocols
+UV melting experiments
+Peptide-MHC class I binding
+nuclear targeting sequence
+ATRQβ-001 vaccination
+3 days later
+age, gender, risk factors, and secondary infection
+grew at an increasingly exponential rate
+RPMI
+health and maternal antibody status
+acute inflammation
+U6
+BGLAP
+hydrophobicity
+Full atom type and bond information
+Up to 50,000
+established exposure control guidelines
+Dating recombination events
+xtract
+live and inactivated
+independent reproduction numbers
+433
+GCrich ssDNA
+to com-
+show-tiling program
+Nature Research Reporting Summary
+Each death record
+Zoster neuralgia
+Hong Kong HA and NA sequences
+Open and transparent communication
+phylogenetics
+clustering
+IFN-c SNPs
+Virus stock
+IL-4
+lymphoid
+cellular proteostasis
+language
+Capacity building
+VSV
+GCSF
+pH1N1
+the effect of distance decay in the search scope
+82%
+CR1 SNP data
+lysenin
+2019-09-24
+mortality by suicide
+limitless
+acute diarrhea, vomiting, dehydration and high mortality in neonatal piglets
+Four
+Blastocystis spp.
+unbiased deep sequencing
+wild orangutans
+Combined GC content
+Activation and degranulation of polymorphonuclear neutrophils
+Paris, France
+epitope mapping
+four
+22
+neuroprotective
+heterogeneity
+over 1 billion
+74.8%
+anti-inflammatory
+probabilities
+RT-qPCR assay
+about 1 week
+Demyelination of the central nervous system
+CVA16
+interleukin-STAT3
+Nucleoside ms 2 i 6 A
+between 1 and 3
+62%
+VAS visualization
+324
+crowding
+H275Y
+poly I:C
+The nucleolus
+Asp406
+IFITM3
+Detailed field studies
+HA-activity
+RNA aptamer
+human
+Nucleic acid quality
+high fat diet mice
+TCBZ response in phase III sequestration based detoxification
+the analytic method and key themes
+asthma and COPD
+General linear models
+host cell cycle
+CRI SPR-Cas9 genome editing system
+cell cytotoxicity
+Aconitine
+12 and 6 pmol/25
+Qiagan Blood DNA Midi Kit
+endothelial cells
+protein
+10%
+UV light
+cold PBS
+Molecular Devices Spectramax 384 Plus spectrophotometer
+future studies
+by severity and relationship to treatment
+Ubc9 and PIASy
+White-tailed deer
+sensitivity analysis
+3 to 4 on the 5-point scale
+N. meningitidis and S. pyogenes
+virus-induced apoptosis of lung epithelial cells
+there were no significant differences between any of the time points
+single cell suspension
+2004
+m
+Healthcare utilization surveys
+aee-miR-11-5p
+host chaperone
+any known medical history
+Balamuthia mandrillaris
+Spearman's linear regression analysis
+renal dysfunction and failure
+85%
+HBP1 and fgl2
+body weight gain
+Tetramethylbenzidine
+similarities between poorly sequence-conserved proteins
+microbiome-derived epitopes
+BALB/c and C3H
+clinical
+Caudovirales
+airway surface liquid
+The determined current state
+HTSeq
+HPVs
+gemcitabine
+facilitating the assembly of the viral replicase complex
+flavivirus
+Out-ofphase regions
+5 and 24 hours
+PCR genotyping assays from tail biopsies
+SpectraMax M2 microplate reader
+twice
+bone marrow chimera
+AIV
+hierarchical
+Olympus IX-70
+C. burnetii
+difficulty accessing or affording food
+a realistic description of the epidemic
+DENV
+GCBS
+18
+depression
+Group 2d-1
+solubility
+no or little effects on cell permeabilization
+Further analysis
+beclin-1
+protective
+50
+anti-HA antibodies
+genetic instability
+6 hours
+Foxp3 − Tr1 cells
+73%
+three
+Patients ventilated with higher P max
+preexisting immunity
+C. burnetii
+24 h
+Restriction digest using BclI
+39,539
+innate immune cell types
+PhosphorImager
+50%
+THK
+small chromatic spots
+likelihood function
+Goat anti-mouse HRP-conjugated secondary antibody
+twice
+2 days
+ζ_i
+2012
+macrolide resistance
+mRNA depletion and PABPC relocalization
+LPA
+maximize the patient's quality of life
+HI and MN tests
+Definite Focus
+mAb
+activated germinal center centrocytes
+eleven
+The partition coefficient
+S4 Table
+318
+Activity budgets
+25,683
+three
+four
+hypertrophy of the myometrium
+de novo sphingolipid biosynthesis
+SEM
+contact tracing
+clinical decision making
+virological data
+whether our work can meet the expectations
+LC-MS/MS matrix effects
+common changes associated with lymphocyte activation and cell proliferation
+more than 25
+tapir
+quarantine or screening programs
+Large, multiplexed proteins
+SupTOC-Pam3CSK4-48h
+FISHView Version 5.5
+IL-1β
+Eli Lilly and Company
+Unpaired t-tests
+pools of peptides assigned to HIV-1 Env regions
+polyadenylated
+the extent to which nodes in a network tend to cluster
+the reciprocal values of the last serum dilution that completely inhibited
+chronic respiratory abnormalities, cardiac disease, immunodeficiency, and pregnancy
+Nigerian tobacco mosaic virus
+5 days
+medical authority
+1976
+MEF2C
+binding the IFN-␤ promoter
+Newcastle disease virus
+decreased FAP
+finding host-oriented drug targets
+5919
+10 ll
+Microglia
+r i 2
+three
+nitrocellulose membranes
+pfmdr1
+0.02 ng
+IFITM
+LysoTracker Red DND-99
+machine learning
+DMEM
+chemotactic
+k-means algorithm
+mortality
+linear regression models
+amplify most of the known mouse antibody sequences
+exploration of the basic interaction between the ventilation and the outbreak
+multiple residues/regions of the envelope glycoprotein
+phylogenetic trees
+druggability
+ATP hydrolysis
+higher incidence of waterborne infectious diseases
+alkylated RNA
+epifluorescence
+21 • C
+Non-LTR retrotransposons
+RNeasy Mini Kit
+greater access in the workplace
+neutral
+Genetic bottlenecks
+viral attenuation
+Research Electronic Data Capture software
+PRRS in pigs
+48
+confirmation of the serological relationship between these two types
+hydrolysable
+synergistic
+263
+P 0
+BD CBA Software
+Mechanical stretch during breathing
+unaltered
+Glycan Atlas
+Fourteen
+XendoU
+72
+HIV-2, hepatitis C and dengue viruses
+%ES
+Computerized
+R. tanguticum nanoparticles
+numerical stability
+physicochemical properties and formulation
+weekly
+15 min
+PyMOL™ software
+two groups in the biomarker study
+57%
+Cell lines stably expressing the or dual-luciferase HIV reporter
+an increase in the expression of VEGFA
+HYPV
+changes in the characteristics of cell metastasis-associated behavior
+four
+6MWT test and timed function tests
+72%
+100
+sequence alignments of selected flavivirus clades
+polarization of low-and high-avidity responses
+12%
+zero
+high
+HIV-1 entry
+IL-4 and IL-13
+Further examination of this phenomenon using historical ILI data
+hDC-SIGN and SIGNR1
+shrimp immunity against the virus
+mixed infection
+RTA transcripts level
+42 kDa
+Pertussis
+Leishmania infantum
+Yca1-dependent
+356
+CT
+Current protocols
+Six
+great advantages
+weekly
+IL-21
+Dr. Minetta Gardinier
+The importance of local circumstances and their possible impact on liability
+seven
+Research into the mechanisms of henipavirus pathogenesis
+zPicture
+317
+PaKiT01 cells
+culture
+dental records
+syndromic
+three
+InfluSim
+bspC gene deletions
+nasal turbinates
+The genetic information of flaviviruses
+10 2 copies
+Adenovirus type 14
+splicing
+a better model
+between September 2017 and September 2018
+θ r
+RNA interference
+SuperSignal West Pico Chemiluminescent Substrate
+Barabási-Albért model
+nucleic acid amplification tests
+thrombotic occlusions of medium and small vessels
+response in severe cases
+Isotype-matching coated beads
+Ministries of health and national policy-makers
+PhusionH high-fidelity polymerase
+acute fulminant hepatitis
+NaHCO 3
+Table 1
+10 minutes
+IELAGTLTLT
+C57BL/6J mice
+coherence
+risk assessment in air
+Means and standard errors of the mean
+Lr/100
+p6 pol -retaining PR
+TET-21 cells
+Twenty-two
+H5, H7, H9, N1 and N7
+woodchuck PBMCs and splenocytes
+Influenzalike-illness data
+discriminating positions within a set of highly similar sequences
+ontology
+259
+oligonucleosomal fragments
+338
+three
+population contact rates, travel patterns, climatic conditions, and geography
+8 of 13
+diff erent viral vectors
+QIAamp viral RNA kit
+suckling mice
+75,100%
+Symptomatic, potentially infectious and/or contaminated victims
+> 50%
+1838
+61 years
+ectopically expressed fusion protein
+6.25 g/mL
+Type II HSR
+liposomes and nanogels
+4 Ig domains and the long cytoplasmic domain
+three
+inverse dilutions
+mitigation measures
+Gene therapy
+Carbonate apatite
+reference database
+A pause of about three seconds for the first ribosome
+24 h
+a unique point
+More than 800
+4 to 8
+CXCL10
+5x loading buffer
+spray drying
+RNA cleavage and release from membranes
+63.9%
+deficiencies in mononuclear cells
+bovine submaxillary gland mucin
+11
+one
+pMKvector
+activate IFN-β production
+Transparency and honest communication
+anti-inflammatory
+30%
+ATP8B1
+Nextera XT DNA Sample Preparation kit
+NP evolution history
+Turner energy model
+Sep 2010
+24 h
+HeV Viral Antigen and Lesions in the Brain
+anti-Gag, anti-Env and anti-Tax
+lungs
+1335
+Novosphingobium aromaticivorans
+90%
+15
+inconsiderably higher
+The focus on influenza
+spo0A and sigH
+three times
+Respiratory syncytial virus
+negative baseline HAI responses
+Detailed binding between the protein and all nucleotides
+New York City
+subcortical
+less side effect
+Mfold v.3.4
+collagenase
+2,925
+frameshifting
+13
+958
+enveloped positivesense single-stranded RNA viruses
+protectin D1 levels
+4 hours
+miR-10a content
+A gradient from water and acetonitrile
+P. falciparum CSP
+vaccination of healthcare workers
+RNA polymerase
+Infrequent sneezing
+10
+covariates
+8,466
+Dectin-2
+19, 20, 24, 48
+foot-and-mouth disease
+2714
+seven
+cell membrane fractions
+Professor Padraic Fallon
+type I interferon production
+R software version 2.11.1
+1 μl
+Crystallography
+amphotericin B deoxycholate and flucytosine
+Virus group and independent virus-specific models
+Specimen rotator
+human exacerbations
+host species, cell type and virus type
+29
+zero
+host antiviral responses
+prM and E
+pH1N1 infection
+1:64
+presence of isoforms
+extremely hydrophobic
+PI3K isoform proteins
+cyclic diadenosine monophosphate
+isolated cases
+severe dehydration and diarrhea
+Survival analysis
+Eleven
+osteopontin
+VLPs containing recombinantly expressed VP1 capsid proteins
+EEA1
+113
+LTi cells
+three weeks
+twice daily
+acceptance and mindfulness
+Mammary secretions
+branch length
+back-splicing
+20 min
+2 days
+red
+20
+HIV screening and monitoring of IDUs
+Two
+Conditioning regimens
+PR3
+three
+viremia
+molecular
+0.001 TCID 50 /ml
+Phyllanthus urinaria
+MetaHitassembly
+94.6 per cent and 100 per cent
+Cytokines
+previous primary DENV2 and DENV3 infections
+a AMR gene
+1 hour
+HA of Aichi H3N2
+noninvasive assessment of severity of a broad range of pulmonary conditions
+1 km
+two
+ConSortß
+Research Electronic Data Capture system
+Induction of SOCS-3 expression
+asymptomatic
+novel viral lineages
+67
+Thermal stability of the nsP2 protease
+multivariate associations
+inducing antigen-specific antibody and T-cell responses
+169,000 years
+Arboviruses
+Dual luciferase activity
+treatment
+malonaldehyde
+B cells
+anhydrous acetic anhydride
+higher
+North Dakota Electronic Animal health Surveillance System
+enzymatic activity
+Enzymatic capping
+3%
+importance or essentiality
+BioPulverizer
+MAGE-G1
+entry to their borders
+6 months
+USKD
+HAV sequence alignment
+miRNA 21 and miRNA 128
+channel exchangers
+medium without or with increasing concentrations of EdC
+PRRSV replication
+to fulfill functions in the remodeling of ribonucleoprotein complexes
+prophylactic antibody therapies
+the outbreak threshold
+A random peptide library
+9
+The final height
+Phusion polymerase kit
+cc-by
+O. caudatum
+R 0
+antiviral treatment of influenza in hospitalized patients
+3.4 Kb long
+MEGA5
+59
+DNA methylation and histone methylation
+5 min
+influenza A viral infection
+58.3%
+Reporter HIV-1 particles
+Sendai virus
+The specificity of the reactions
+single stranded monoclonal beads
+risk communication
+written informed consent
+Histopathological
+long read lengths
+>98%
+one or two
+over 100 years
+Song and colleagues
+12%
+the inflamed CNS
+as percentage of total 100 platelets counted
+Plasmids containing various Rluc reporters
+standard TAT-5000 models
+Mean fluorescence intensity
+MTT solution
+cleavage
+Poisson distribution
+lyophilized LAMP assay mixes
+diagnostically-useful peptides
+synonymous sites
+ring-shaped distributions
+10 s
+TOM1
+human plasmacytoïd dendritic cells
+human mobility
+laboratory mice
+recruitment of individuals
+11
+modeling of sequencing errors
+133,469
+three
+change
+CXCL-8
+keratanase I
+5.3 mM Tris phosphine hydrochloride
+21 days
+positions 186, 226 and 196
+8559
+anti-GFP and anti-Flag
+CPV and VP2
+paper-based extraction and in situ amplification with lateral flow
+miRNAmediated antiviral effects
+platelet aggregation
+NF-B signaling
+epitope-specific response
+35-40%
+6.6 log 10 PFU/mL
+accumulation of phosphorylated eIF2a
+how the control group therapy compares with the treatment group
+compensatory anti-inflammatory response syndrome
+PEDV phylogenetic and phylogeographic data analyses
+2.5 mL
+More than 99%
+dual power supplies and dual network cards
+divergent transitions
+negative-sense
+flow cytometry
+confocal microscope
+BS
+A. C. G. T
+eight
+the first conserved a-helical segment of the LHR
+AT1 stimulation
+Aurora B protein
+immunogenicity studies
+Ruben Donis
+Purified RNA samples from HEK293 cells
+bowtie2
+early 2000s
+alveolar
+less than 10%
+April 2013
+rodents
+pHrodo red E. coli bioparticles conjugate
+parasitized red blood cells
+Our book chapter
+TARG1
+non-polyposis colorectal cancers
+1348
+based on the signal level degradation
+26
+Oral disease
+8%
+488
+4-fold antibody increase
+viral quasispecies heterogeneity
+cytokine assessment culture supernatants
+1 mL of 1% crystal violet in methanol
+increased risk of death or worsening disease
+Rosetta software
+Staphylococcus aureus
+0.5 g
+indicator diseases
+HBoV1 prevalence
+S. pneumoniae
+1000 simulated datasets
+OXA-23
+Uninfected cells
+confirmed H7N9 patients
+84.2%
+Infectious disease outbreaks
+to increase DO 2
+arterial
+differences in endosomal escape
+68 an ontology
+lower
+20%
+reduced body size
+16S rRNA gene highthroughput sequencing
+Amplified DNA
+EGD-e loci names
+Hemagglutination of RBCs
+between 4 pm and 8 am
+simian retrovirus 1 -related sequences
+control reactions
+changes in termination codon recognition
+viral replication
+DF1 cells
+genetic engineering
+MINK
+0.793
+Mitophagy
+GI-16
+Unspecific binding and cross-reactivity
+three
+oligosaccharides
+U5
+R a
+Zhoushan Archipelago of Zhejiang Province of China
+Anti-c-myc agarose conjugate
+more intact
+kg/day
+79
+Supernatant
+confocal microscopy
+10 days
+phylogenetic analyses
+2 h
+potential foci of infection
+35%
+liver
+HIV inactivation
+significantly greater
+mutation pressure is the only factor influencing evolution
+rabbit anti-ERp57 antibody and mouse anti-PreGn
+12 days
+Mn 2+
+importins
+PH
+CD8 + T cells
+AM
+hamster
+cis-regulatory
+Further information on research design
+Reaction mixture
+National Centre for Cell Sciences, Pune, India
+XF-hMSCs
+homo-tyrosine
+younger
+protein that contacts the hairpin of the MNV subgenomic promoter
+Site-directed mutagenesis
+Keyboards, headphones, desktops, mice and mobile phones
+Five
+ISG15
+mandatory
+heteroduplex mobility ratio
+41.2%
+morbidity and mortality
+ethanol-induced hepatocytes oxidative damage
+bacterial infections
+giant-cell syncytia
+MMTV and New World arenaviruses
+MN025547-MN026153
+ARDS and capillary leak syndrome
+6
+fiscal resource allocation decisions and poverty reduction
+kidney-lung cross-talk
+pink
+Seven hundred and sixty-three
+discovery
+lower
+Photoshop CS2
+three
+if viruses passaged through closely related hosts showed evidence of parallel genetic changes
+68 of 118
+PEDV infection
+100%
+Alcohol
+80 mL/kg/min
+more recent selective events within a species
+0.2% trypan blue dye exclusion
+35%
+persons >75 years
+NGO1634
+yeast and Drosophila
+51%
+bacterial genomic DNA
+FP-01.1, Flu-v and Multimeric-001
+The slow exchange of the imino N 1 with water
+its new tropism
+expression of wildtype EBNA1
+Italy
+pharyngeal viral load
+elevated mortality
+RT-PCR
+7.6%
+how they were treated and the advice which they were given
+tuber samples
+half-siblings
+100%
+The DL2000 marker and the protein low weight marker
+Afrotropics and Eastern Eurasia
+irrational use
+Unwanted emotional tension
+Bangladesh, the United States, and Canada
+2 to 5 hours
+5.2 × 10 9 PFU/mL
+luminescent signal
+Canu
+predictive performance
+cell-cell contact dependent mechanism
+endothelial cells and arterial smooth muscle cells
+8.5 and 9.5 min
+Visual maps for the spatial distributions of diarrhoea incidence and annual amplitude
+11.5
+reverses both attenuation in virulence and the enhanced frequency of infected cells
+potential circumstances under which an extra conceptual development is necessary
+1956
+groundwater involved in cementation
+$166.3
+Three
+Testing EEG reactivity
+two are known to transmit disease in humans
+sterile PBS
+r j
+raminidase
+daidzein
+phenotype
+Viral dsRNAs
+sinusitis, respiratory muscle weakness, and ventilator-associated pneumonia
+48 h
+network structures
+subnormal magnetic moment
+6 days
+2015
+IPS-1, Cardif, and VISA
+72
+Macropinocytosis
+eukaryotic receptors
+T-cell proliferation
+Discussion B-cell memory
+spontaneous remyelination
+IgG titer
+bluetongue virus
+Lung tissue sections
+Five
+improved performance
+cooperative unfolding of H4b and H5
+aquaporins
+histone acetyltransferase p300
+four
+during mitosis
+four
+binding
+autophagy/mitophagy and mitochondrial biogenesis
+5%
+RSV, rhinoviruses and influenzaviruses
+codon optimization
+RNA 2
+VP40 positivity
+Thioflavin-T fluorescence based assay
+49
+536
+decreased cell-cell and virus-cell fusion
+selecting effective features or feature combination
+whether any of the residues were non-essential
+20 μl MTT solution
+cell-free
+Training in new skills and competencies
+60-80%
+7 hours
+multi-phase Richards model
+Env
+dermis and oropharyngeal mucosa
+automated gel documentation system
+18
+chromosomal DNA
+by releasing a subset of different GFs
+BSA-colloidal gold suspension
+SNARE-Munc18-1-mediated membrane fusion
+autumn and winter
+glycoprotein-1
+10 min
+20 nM
+mouse plasma and breast milk
+60%
+chest
+Wilson and Reeder
+heterotaxy and various genetic syndromes
+placental mammals
+Flaviviruses
+Vascular endothelial growth factor
+Nitazoxanide
+ONPRC Institutional Animal Care and Use Committee
+mechanistic model
+TAF11
+different patterns of variation in the reproduction number
+illness
+500
+free Gln and Glu
+Jagged-1
+Hydralazine and labetalol
+cyp1a1 and cyp2j3
+10 min
+10,000
+translational bias
+infectious pathogens
+David Barker
+5.6.2
+second messengers
+AIDS
+Day 4 or Day 5 safety measure testing
+three
+UFS switching
+comparative Ct method
+30 minutes
+barrier-like
+Amyloid precursor protein
+aggression
+Descriptive
+42.9%
+41%
+Two
+MedCalc
+a mask
+innate immunity
+.
+Permitting greater flexibility in the form of the possible intervention
+many variant types
+those observed in viral genomes
+the corresponding authors
+total, soluble, and insoluble fractions
+qPCR
+pVax1
+proteolytic
+2 x 2 cm
+infectious
+notifiable infectious disease system
+SeaPorter TLR5
+2
+137
+pro-inflammatory factors
+27 μg/ml
+Foxp3 + IL-10 + CD4 + T cells
+additional sites
+GFP
+three
+380
+Nasal oxygen
+how many people were diagnosed with or dying from swine flu
+cynomolgus macaques
+the total number of ILI cases
+28
+core 1 and core 3 synthases
+twice
+AAV2-sFLT01
+live traps
+blood urea nitrogen
+2.64
+Restriction enzyme recognition sites
+61
+four
+tumor cell migration and invasion and macrophage infiltration
+cytoplasmic activity
+agitation, conjunctival hemorrhage, and coma
+Urine
+m-63
+2000 yuan
+RNA molecule
+Frequencies and basic descriptive statistics
+K E~B K b H
+plasma IL-4, IL-10 and INF-γ
+obtaining high-quality actionable data about suicidal behaviour
+single base pairs
+post-operative
+α synuclein proteinopathy
+prompt reporting of exposures and the symptoms of illness
+V
+inappropriate use of antimicrobials
+L:H ratios
+different gene constellations
+viral load
+τ a and τ b
+mouse
+eHEV infectivity
+300
+19
+dispersion
+Peroxisome proliferator activated receptor gamma
+outbreaks of disease
+minimal
+reduced tumor burden
+paddy straw and water
+HepG2 and Huh7 cells
+stability
+binds to and inhibits the Cdh1 activator protein
+Plasmids containing only the GFP or HA gene fragment
+reliable cellular function, individual development, and offspring reproduction
+geographic locality
+H5N1 HA DNA vaccines
+temporal change in gene expression
+reticulate
+SPSS 14.0
+Bovine coronavirus
+Macroevolution
+conserved primers
+proteins involved in the regulation of apoptosis
+Myeloid-derived suppressor cells
+substantial changes in the NMR spectrum
+December 2013
+Arg168
+MicroCal Origin software
+non-pH1N1 febrile illness
+co-infections with other enteric viruses, microbiota and management factors
+RNA-seq dataset
+Protein Data Bank
+EcoRI and PstI
+to balance specificity and sensitivity
+952
+Life Satisfaction Scale
+viral attenuation
+57
+Formal ethical approval from a medical ethical committee
+X-ray crystallography or NMR
+severe septic patients
+viral proteins
+Five
+PAO1
+100
+Infectious bronchitis
+a single virus particle
+Enhanced cmRNA Stability and ACE2 Protein Translation
+blocks
+calcein acetoxymethyl ester
+10 ml of a sonicated media containing 14 C-stearic acid
+recall decay
+6 g
+reverse transcriptase and PCR amplified
+females
+pulmonary
+household size
+further spread of the influenza virus
+2003
+t Ã
+days before and after treatment by INFγ
+anti-GP 1,2 antibodies
+Four
+four
+-578125.270 kj/mol
+to avoid saturation of the mass spectrometer detector
+larval Ae. albopictus
+rCyp
+401
+anti-FLAG M1 agarose affinity gel
+Bias
+upper respiratory infections
+IL-8
+CD11b + CD45 int cells
+protecting endangered animals
+300
+Bi anomalous signal
+vesicular compartments
+galactose
+Diagnosis and treatment of secondary bacterial infections
+observational studies
+increase risk of suicidal behavior
+IIV
+personal, religious or ethical beliefs
+6-8 mL/kg of ideal body weight
+three
+sixfold
+Four
+distance restriction
+O-acetylated sialic acids
+colony forming units
+malaria
+IFNλ4 isoforms
+Age related macular degeneration
+modest increases in sulfur amino acid source
+Room pressurization
+A new sachet
+coenzyme A
+41,947
+30 minutes
+mid-April 2009
+Philip Lambach
+stabilized matrix base method
+anti-acetyl-lysine antibody
+FAS
+phosphatidylinositol 3-kinase
+target cells
+2014
+clearance of RSV from the lungs
+Infection of the mouse thymus by highly virulent influenza
+CCK-BR
+differential
+China
+dominance
+MLV infectivity
+firefly luciferase
+English
+within a half hour
+H1N1, H7N9
+TNFa, COX-2 and NF-kB
+BiNGO
+donors of the Chongqing Eye Bank
+complete loss of lung aeration
+24, 28 and 32h
+new populations
+predictive factors of hospital mortality
+47
+affinity chromatography
+Prospective randomized trials
+retropepsin
+washing buffer
+five
+masking
+computer-actuated solenoid-valves
+The ribs and clavicle
+leukomyeloencephalopathy
+over 50 years ago
+community awareness and understanding of benefits of preventive health
+45-days
+selective
+Myeloperoxidase content
+>11,000
+IL-6 and IL-10
+GDT data
+40%
+according to the above-mentioned categories
+better therapies
+Anti-CEA radio-immunoconjugate anti-bodies
+four
+depressive symptoms
+virus-specific and cell-specific differences in antagonist functions
+influenza development
+Horizontal black lines
+eight
+drug-binding sites, structural components and mutation hotspots
+36 hours
+details
+4.90%
+100 μ l of BriteLite substrate
+greater generic conspiracist ideation
+2016-03-11
+10%
+chronic non-communicable diseases
+PXD015646
+growth inhibition test
+Oseltamivir
+26
+a stop codon
+1.82%
+allergic reaction
+enhanced inflammation
+cell ovarian, uterine and prostate cancers
+low oxygen levels
+unsupervised
+other cellular or viral proteins
+pathogenassociated molecular patterns
+amiloride
+Data-File S2
+Production of IFNa
+36,954
+late 1990s
+doffing practices
+immunosuppressive
+dementia and disability
+ITAF
+2-3 weeks
+Table S1
+59
+93.20%
+total RNA
+Viral RNA
+inhibited or enhanced the replication of one or more viruses
+ICH patients
+Plasmapheresis
+the GPs
+WHO
+The real CPI networks
+Consolidation
+TLR7
+58 %
+computer simulations
+ATF6α and ATF6β
+Inflammation
+cleaves
+Positive end expiratory pressure
+Per2
+Yersinia pestis
+Node color gradient
+a membrane-bound receptor, JAKs, and STATs
+FlowJo
+50.4%
+health workers
+16 minutes
+Chi-square test
+1995
+five
+RPMI
+BmBac
+50%
+interference by the contaminated proteins
+Surfactant Protein C
+Eleven
+integrin-focal ad- hesion signal transduction
+Relative gene expression
+lung function
+four
+germline heterozygous mutation of the GATA2 gene
+Ice-cold HSV-1 strain KOS
+cytolytic activity
+Additive manufacturing
+Dashed lines
+increased production of Th1 cytokines
+collectin
+well-shaped nanoparticles
+histopathological
+likelihood of receiving treatment for scour
+Technical thesauri
+600 days
+prevent a proper immune response
+Cox proportional hazards regression model
+every ten minutes
+rVSV vectors
+12 hrs
+40%
+Stem cells
+protective
+1
+Codon usage bias
+selection of siRNA-resistant viruses
+Burroughs Wellcome Fund
+AM strain
+late spring 1891
+more than 60
+biology/medicine
+desialylation of chicken erythrocytes
+Gene expression
+7.3%
+Bivalent-Analyte model
+TMV RNA
+important for tRNA to translate the genetic code
+H5N1
+Serial dilutions
+group 3 species D. minutum
+modified mRNAs
+Classical and neo-classical economics
+constitutional levels of circulating SP-D
+One hundred and seventy
+Alveolar macrophages
+virus genome replication
+ER-association for an mRNA
+identifying critical residues in escape mutants and crystal structures
+1985
+dimers
+Extracted nucleic acid
+three
+contrasting
+separate
+P
+Patients with non-recovery of Th2/Th1
+Photoactivatable Rac1
+Cox regression
+virology
+T
+Methylene blue
+development of ruminal acidosis
+recombinations and transpositions
+a standard curve of a serial dilution of virus
+semi-artificial and real-world HIV-1 Group M sequences
+reversed
+synthetic TLR ligands
+voluntary or involuntary displacement, and immediate or delayed displacement
+preset variables
+WT
+three
+2009
+naive plasma
+Six
+patient-reported outcomes
+three
+Acute respiratory illnesses
+The immune system
+sequence-specific and sequence-independent
+collaborative
+SRD-12B cells
+diminished expression and secretion of immunoglobulins
+PKR
+active/inactive
+8-hour
+the location of the deletion mutants
+Disassembly of the viral capsid
+rapamycin treatment
+fold back on itself
+cAMP
+fulminant hepatitis
+CBPV
+Histograms of the RF indexes
+15 days
+antimicrobial effects
+a true field test for nucleic acids
+Toll-like receptors
+eco-friendlier
+viral induced cancer development
+the environment
+30 min
+decreasing mitochondrial oxidation
+mice challenged with LPS 4 days after influenza infection
+Data capture concerning bicarbonate infusion and neuromuscular blockade agents
+49.0 nm
+Creb3-Arf4 signaling
+6.5-7.5
+43
+Compound 3b
+p38
+Numbers in brackets
+oncoinflammation
+five
+OASL
+obesity
+purified IPO
+7 days
+children and younger adults
+cHL
+18
+single, double, triple and quadruple substitutions
+eight
+dendritic cells
+a new model having broken-line relationships with the predictor
+double-stranded RNA
+BRT models
+disruption of H5
+heterogeneity
+PBMCs
+L2 epitope-based protein vaccine
+the state and cosmopolitan global justice
+CV disease
+EAD
+1999
+strategy using CPa and CPb DNA and protein
+mechanically ventilated
+3%
+29
+regulation of viral RNA levels and localization
+Relative nucleolar and nuclear localization
+the protective allele
+retention of a highly ordered stair-stepped conformation
+diacylglycerol and calcium
+increased constitutive STAT1 expression and strong STAT1 phosphorylation
+Small molecules
+Ambra1
+National Institutes of Health AIDS Research and Reference Reagent Program
+Personal Digital Assistant
+Twenty-nine
+Oxytetracycline
+S
+Figure 8
+four days and 11 days
+FCGR2B 232I/I
+ultra-high coverage sequencing
+RG
+receptor for human or murine norovirus
+asymptomatic
+CARBON CTRU trial statistician
+G. vaginalis
+cutaneous and mucosal epithelium
+40
+by using a NetNGlyc 1.0 server
+68
+Strepavidin-APC or PE
+boys
+oligodT anchor primer
+Paracoccidioides brasiliensis
+CBP and p300
+15 min
+another epidemic wave
+P. jirovecii infection
+malaria antigens
+60%
+Alternate mRNA spliced variants
+vectors
+Immunohistochemical
+large prospective studies
+each other
+YA laccase
+Stanford University Non-Medical Human Subjects Institutional Review Board
+between 400 and 700 bps
+8,157
+products of the unit cost and the number of test animals
+one-way
+expression of latent genes during the latency stage
+T cells
+DENV2
+G
+40
+3
+CHMP's recommendation
+FAK
+932
+a period of acclimatisation
+four
+exceptional and transferrable immunostimulatory potential
+10 μM
+health services delivery
+mitochondrial membrane
+ambient analyte assays
+non-fermentative bacteria and fungi
+plaque reduction neutralization test
+Leica TCS SP5 confocal microscope
+mutations mapping to bD
+Twenty
+A detailed literature review of available US-specific evidence
+Genotyping of all healthy controls
+1 hour
+weekdays
+extracted RNA
+CD86
+viral culture
+1976
+Asia
+ribosome profiling
+296
+their own poison
+T1a
+Fifteen
+slight modifications
+late viral genes
+Nasal washes and fecal swabs
+NETosis
+R563A
+2017-05-25
+inter-group score
+joint safety events and total joint replacements
+HCV
+acidic
+28
+PCA
+The serial interval
+to protect their respective mature virions
+Arg130
+T17
+cc-by
+45%
+140
+p k
+2-4 h
+Ion One Touch ES
+7 days
+0.6 kcal/mol
+detrimental to antiviral activity
+future opportunities for knowledge sharing
+D
+means and SD
+Hierarchical clustering
+E1
+New HRV type names
+chloroplast translation initiation factor 1
+Mn 2+ -dependent endoribonucleases
+Barbari
+positive selection on the viral population
+Congenital malaria
+acute lung injury
+great interest
+people will invest substantial resources in disease avoidance
+H7N9 viral RNA
+autoimmune thyroid disorders and type 2 diabetes
+12 days
+Reference ranges
+introduction and dissemination of AIVs
+sexual contact patterns
+Categories
+RNA secondary structures
+IL-17
+high titre RVFV nAbs
+CRISPR/Cas
+Genomic DNA
+25 L of RNase A and 50 L of propidium iodide
+the balance between pro-and anti-inflammatory cytokines
+precachexia, cachexia, and refractory cachexia
+right-skewed
+95.38%
+Residue 260 on GP1
+prophylactic
+bulky disordered domains
+cDCs, and pDCs
+Recognition of high immunogenic CD8+ T cell epitopes
+ePCR
+those reported previously
+The US Food and Drug Administration
+GFX™ PCR DNA and Gel Band Purification Kit
+10%
+4 hours
+tumor metastasis and development
+mass vaccination, screening tests using BTM, and active surveillance for PI cattle
+live, attenuated, or inactivated
+Montanide ISA 71 VG
+Thermo-Fisher Scientific
+IL-17 antagonistic therapy
+co-infections with other parasites; and beneficial symbioses
+unpaired Student's t-test
+6.7 hours
+>95%
+Icons
+substitution/codon/year and substitution/site/year
+systematic over-prediction of the number of new cases
+165 ± 20 nm 3
+brain-derived neurotrophic factor
+Telomere shortening
+binds Ars2
+iScript™ cDNA Synthesis Kit
+13
+Olympus Provis
+age-dependent efficacy
+DNA concentration
+transmission probability
+Asp452, Asp469, and Asp489
+intrinsic disorder
+coincidental upper respiratory infections or colonization
+V I
+53
+R t values
+immunosuppressive cytokines
+bronchial epithelial cells
+pressure differential pneumotachometer
+anti-diabetic
+15%
+HeLa cells
+two
+6 dpi
+A nitrogen tank
+histones H2A and H2B
+PGF2S
+39%
+three
+MG756 and MG770
+correlate with known spillover events into and between apes
+strengthening the Th1 response
+Chemiluminescence
+Phylogeny
+Mean shortest path length
+platelet activation
+Chinese herbal medicine
+livestock culling
+declined
+Spectral matching of measured MS/MS data with spectral libraries
+primary fever, coughing, and fatigue
+thymocyte proliferation
+Truncated Tat peptide and penetratin
+FACS
+15%
+exploitation of hydrocarbon
+Epitope mapping
+Analyzed and interpreted the data
+Prf1 2/2 hosts
+PD-1 and CTLA-4
+clinical terms as well as pathogen phrases for the main pathogens of disease
+FACS
+anti-FLAG antibody
+new methods of array construction
+15 min
+semi-adherence of the S2R+ cell line
+Nine
+protein-carbohydrate interactions
+Silica Microspheres beads
+AKT
+β-DG and dystrophin
+cartilaginous fishes
+ACE2 levels
+six groups
+open-wound area
+An effective vaccine against dengue
+herpes simplex virus type 1 and adenoviruses
+taurine
+p38 MAPK
+mule deer
+late pregnancy
+Antigen-presenting cells
+S7
+2
+Four hours
+client-server code
+0
+Beijing
+antimicrobial resistance
+activates a signaling cascade
+Morbillivirus C proteins
+three
+Activated CD4 T cells
+3%
+all bases with low quality scores
+sepsis
+755,999
+50%
+58%
+Thickened ileal mucosa
+6 or 7 days
+99%
+resazurin reduction assay
+ARCA
+real-time PCR
+7.01
+intensity-based absolute quantification plots
+MSF or WHO
+EBV and KSHV
+intact mammals
+antiviral activity
+Disulfide bond exchange
+FatiGo
+antiviral drugs
+50-fold
+lower BMIs
+H
+33%
+Japan
+an isolate from the Asian lineage
+125
+rZH501-M847-G
+S. paucimobilis
+RAF B
+positional clustering
+12 h
+Mitogen-activated
+Growth of recombinant rΔM2-2 CAN97-83
+to evade the effects of interferon
+herbal medicine identification
+24 hours
+HeLa cells
+decreased activity of Cyp3a
+lower
+Classical SELEX
+Alpha-1 antitrypsin
+many preschool-aged children still attend preschools during school holidays
+Phosphorylation by MLCK
+peak viral titer
+when R 0 < 1
+Mesenteric ischemia
+0.15
+dystrophin
+72 hours
+ketamine
+domain III region
+Wild-type IAVs
+black to gray and white
+4
+Stata
+ectodomain
+Phyre2 protein structure prediction webserver
+15
+poly RNA
+Cox-regression model
+Supernatants
+GMP
+AUC and DD
+D and A
+seven
+interaction fingerprints
+24.7 ± 2.1 kg
+an early oseltamivir treatment arm
+two
+PRIDE 60
+6
+low
+Nosocomial influenza cases
+-7.3 kcal/mol
+precise identification of the culprit pathogen
+rapid turnover
+optical absorption
+USP47
+80%
+human
+cellular
+10-50%
+best local estimates
+47%
+mesangial proliferation and glomerular hypertrophy
+day 30 after the first immunization
+17.4 kDa
+osteo-tendinous
+Dot coloring
+DB and GM
+Anguillicola crassus
+unsterile
+0.8 mL of 50% PEG1450
+artificial incubation errors
+Eight
+Nonspecific inhibitor MN-1
+nuclear proteins
+Early antibiotic therapy
+Strand-specific RT-qPCR
+TMS
+two
+Sangon Biotech Co., Ltd.
+optimism/pessimism
+Africa
+top 20 enriched GO terms
+3938
+ginsenosides
+paroxetine
+Gram-negative or Gram-positive bacteria
+PDZbinding motif
+neuraminidases
+Plaque purification
+50%
+black
+P. falciparum
+dysphagia, abdominal pain, diarrhea, and upper or lower GI bleeding
+600
+29
+40%
+x 1
+four
+HERC5
+Ethidium bromide
+an ancestral sequence
+MP-12-R16H/M250K
+1,847
+Biological process annotations
+modules for quality trimming, error correction, assembly, and haplotype reconstruction
+Sequence similarity search options
+US Biomax
+retention goals
+building, storing and querying biological sequence data
+Th1 memory cells
+standard deviation
+Putative paralogs and contaminants
+133 or 202 mg/ml
+high mortality rates
+conventional PCR and Sanger sequencing
+Qiagen RNeasy Plus Mini Kit
+63
+168
+97.3-99.7%
+Enterically administered oseltamivir
+mouse cohorts
+455 and 360
+proteins
+Haemophilus parasuis
+disease dynamic model
+Mg 2+
+24
+JM, RD, JV, GG and PL
+The natural history of pneumonia
+GGT and urease
+One mL fractions
+Manson
+DNase
+723
+Positive end-expiratory pressure
+Samples
+Co-evolution
+1%
+host
+USP18
+their state in the previous time step
+High APA-CHE III scores and organ support
+variables
+CD4 T cells
+QIAEX II gel extraction kit
+cytokine gene expression
+asthma patients with naturally occurring viral infections
+Virus infection and neutralization
+3.5 to 4.5 months
+39 million
+One
+Release from the Apical surface and the Basolateral surface
+Gel-permeation chromatography
+120 h
+Hashimoto's thyroiditis
+regression
+Retrovirus particles
+alterations
+Interferon-α and IFN-β
+2,700
+Diffraction
+demonstrating accountability to funders, legislators and the general public
+with respect to an unrooted tree
+20-cm
+nasal ciliated epithelium
+pharmacologic interventions
+Kidney injury biomarkers
+14 dpi
+Protein concentration of dialyzed samples
+nasal continuous positive airway pressure
+PGRS domain-harboring cells
+156
+factor antigens
+transcription factors
+significant
+693610
+Rickettsia conorii
+42 nm
+MHV
+GenBank
+seven
+to prevent unnecessary animal discomfort
+XendoU
+AR clusters
+submaximal bench stepping
+43
+Hokkaido University Hospital
+β-chemokine
+apoptotic cell death
+FACS Calibur
+SOAPaligner
+P-values
+IFNAR1/2
+priming via viral mRNAs
+1 hr
+Alien pathogens
+Huh7 cells treated overnight with Bafilomycin A1
+a discrete time interval
+cardiolipin
+Ethical approval and patient informed consent
+7
+Bands marked by black arrows
+International Committee on Taxonomy of Viruses
+24-h scratch test and transwell migration assays
+Caspase-1
+Vesicle fusion
+10 min
+inhibition of autophagy
+Supplementary Figure S1
+susceptible population fraction
+confidentiality reasons
+1.61
+98 kD, 64 kD and 50 kD
+1461
+IFN levels in the sera
+seven
+two
+dialectical
+Acetylation of histone
+the total set of recommendations
+vaccine-induced cytokine production
+infectious HCV particles
+20 min
+survival rate
+three
+0.156 to 2.50 mM
+IL-4
+Hematoxylin and eosin staining
+Bound fluorescence
+81%
+operational Bayesian theory
+initiate infection
+2013
+differing infectivity and virulence
+iScript cDNA synthesis kit
+CHIKV-LR
+Sixteen
+DDX60
+thoraco-abdominal sonography and scanography
+2-3
+Iκ Bα
+QuikChange II site-directed mutagenesis
+high density and variety of avian hosts
+3 to 7 days
+a balanced response of both CD4 + and CD8 + T cells
+Dwt
+O i−1
+21 Days
+NSP3 segment of RVA
+Autophagy inhibitors
+field and laboratory studies on mechanical transmission of pathogens by flies
+IFN-l3
+charged residues
+99.6%
+NHIP
+HISAT2 87
+18 days
+hepatitis C virus protein production
+one year
+2-3 %
+5.3%
+ImageJ
+Sub-clinical infection
+virus infection
+18S gene
+Autophagy
+Materials and Methods
+1000mg/L
+CrebA
+Evolutionary adaptation of pathogens
+NF
+cryo-electron tomography
+axonal loss
+The increase in fluorescence
+effective delivery
+65
+143
+490 nm
+anti-inflammatory
+5-α-dihydrotestosterone
+86.9%
+Creb3L3 transcript
+hypomodification
+Institutional Animal Care and Use Committee
+Vsfold5
+159
+reverses IFITM3's inhibition of viral replication
+80 to 90%
+anchors
+standard deviation
+direct acting antivirals
+values and processes that seek to redress the power disparities within institutions
+381
+Contact tracing
+10 ng/mL
+37-mm
+data
+dextran-rich phase
+Lymphopenia
+peak lung cellularity
+CXCR4
+immature, non-infectious, and empty subviral particles
+a single species
+early brain changes
+Euclidean distance
+hypoxia
+enhance
+C. xiaoi
+human DNA
+M-MuLV Reverse Transcriptase
+fever, anorexia, lethargy and diarrhoea
+GenBank
+p ij
+regulation of angiogenesis and the Warburg effect
+VP1 RNA
+a deglycosylated form of fulllength ACE2
+porcine circovirus type 2 and PRRSV or HEV
+0.66
+2003
+42
+3D
+anti-IL8:IL8 complexes
+physical parameters
+cytomegalovirus
+low
+brown hyenas and black-backed jackals
+Cost per test
+GFAP and MHC class II
+Spatial
+Nocodazole
+arthropod borne
+Deleterious hemodynamic effects
+inflammatory
+MV
+Dr Carl P. Blobel
+AM
+cap-dependent protein translation
+total cellular protein
+Non-infectious inflammation
+dogs presenting with dyspnea and secondary pulmonary hypertension
+1148
+T-17β-G
+60 minutes
+Magnetic
+GGGAAGC
+UFS duplex structure
+three
+120
+identical
+45%
+enzyme-linked immunosorbent assay
+seven
+three
+R
+Case #1
+30,000 Da
+IL-9
+Complementary DNA aliquots
+81093
+cap-independent translation
+8.605 nM
+Cysteine carbamidomethylation
+statistically significant
+four differential equations
+two
+infl uenza A
+10
+compound 20
+Western blotting
+PLP standard
+high GC content
+50%
+the square root of the variance
+an inflammatory response
+0.98
+10%
+non-infected DF-1 cells
+non-specific electrostatic interactions
+five
+2009
+Stratagene
+rational and user-friendly
+Cel I/II and terminal deoxy-nucleotide transferase enzymes
+phylogenetic analysis
+early 1980s
+90-100%
+syncytia
+cc-by
+obesity
+increased viral pathogenicity
+more than 50 years
+Continuous variables
+the major secondary structures are conserved
+three
+Methacholine
+proteases
+follicular burnout
+2A and 3C
+chemotactic
+reporter dye 5-FAM
+I/R
+cell survival in CRC
+10%
+bushpigs
+gene expression levels of ALV-J-specific genes
+4-12%
+Kuwait and Qatar
+diaphragm
+Western blot
+4%
+skin cancer progression
+at least twice
+Tight junctions
+106
+death and dying
+at least once daily
+Pathogenic
+road crashes, fires, and general floods
+geographic relationships between patients and resources
+EPX-mAb
+univariate linear models
+2 min
+bat flies
+CTSB/L and SMN isoforms
+Four
+Hypoxia
+respiratory signs
+UPF1
+17 and 16 datasets
+variable cell number
+inflammation and oxidative stress
+HeV viral antigen
+reasonable
+Internalized HIV-related stigma
+therapeutic cancer vaccines
+16
+SVBp32
+it can only reduce, but never completely abolish, endogenous gene expression
+Densitometric
+32
+an imbalance between Doxidants and antioxidants
+outbreaks of the same disease or diseases with similar routes of transmission
+IVC
+blood and tissue cultures
+suboptimal structure detection
+bicistronic luciferase reporter construct
+E64-resistant
+March
+pGEM-3Z/H
+39
+454
+one or more viral encoded glycoproteins
+HBGAs
+retrospective descriptive studies, drug selection studies and prediction studies
+based on the type of SCI
+NMRPipe and Sparky
+Row C
+mucus secreting glands
+surface contamination model
+oral
+50 μL of reconstituted Luciferin detection reagent
+Virus and genome detection
+80%
+mean ± standard deviation
+simple exponential smoothing
+Modification of A37
+combining both groups in outcome analyses
+neutralizing the biologic activity of the cytokine
+December 2019
+Naïve RM IgG
+axon growth and plasticity within the glial scar
+four
+developing a HIV-1 inoviral vaccine
+pleiotropic
+Three
+Study-entry laboratory tests
+10 ng/mL
+low-income countries
+316 mg L −1
+every two days
+depth estimation, posture estimation, and risk evaluation
+plasmid DNA that was not formulated in transfecting agents
+JuncBASE 49
+1995
+≈2-3 weeks
+Adaptive immune cells
+10, 25, 50, 150 or 200 mg/L
+antibody-escape mutants
+UV-C
+Alternative Hypothesis
+NOXderived ROS
+R&D
+upon request
+The probability that an infectious individual infects a susceptible
+KSOS and HYA
+three days
+the means with standard errors over 50 replicates
+five
+67%
+Poverty
+social distancing
+between 45 and 60 minutes
+T3
+Obesity
+reverse-phase
+FMDV
+SL-A
+<10 ng/dL
+Lithium Lithium
+distinct pattern of refines genes discriminating between two classes of leukemia
+in vivo
+straw-coloured fruit bats
+GSE65973
+10%
+Eighty
+extrinsic
+chronic obstructive pulmonary diseases and cystic fibrosis
+Candid #1
+Simplification of the next generation matrix
+Panel C
+NDV-Gag
+Highly elevated levels of various cytokines and chemokines
+ROS production by MDMs
+2 weeks
+160
+53
+close contacts
+SPSS 21.0
+BSR-T7/5 cells
+each assay
+4
+Assessment of clinical, microbiologic, and radiologic response to treatment
+avidin-biotin-immunoperoxidase
+95 per cent
+mortality follow-up at 30-days post-bronchoscopy
+Lymphocytes
+0.2 mm
+broad spectrum antibacterial drugs and antimalarial molecules
+40%
+Indonesia
+6,857,100
+Attenuation of live virus by deletion of IFN antagonist genes
+Apoptotic signaling
+13 M
+Enterococcus and Enterobacter
+S. pneumoniae
+Liver tissue samples
+ReoPro
+cruise ships and airplanes or airports
+significant
+our patients
+framework matrices
+REGN3470, 3471, and 3479
+AKI
+triggers a nonlytic expulsion of bacteria
+q
+antiviral therapies
+WNV
+48 hours
+further investigations for the presence of as yet unidentified organisms
+1011
+phagocytosis
+vaccines
+169
+residual confounding
+acetylserine
+Serologic diagnostic testing
+20 days
+satellite cells
+gut contractility
+purification of the virions
+regulatory T cells
+the weaning process
+VP40
+three
+E. chaffeensis inclusions
+an ensemble consisting of random trees
+50,000
+FCs, DFC, GC, nucleolar vacuoles
+Wilcoxon Mann-Whitney Test
+tens to thousands
+Hundreds of ISGs
+#2031 and #2032
+liver and spleen
+To address this possibility
+Ten
+5%
+83%
+10,000
+MAP1LC3/LC3
+Botulism and atropine poisoning
+what we stated as purpose of the test sets
+0.61
+Phlebotomine sand flies
+768
+Disorder in the inner shell
+experiments
+67
+Infectious bronchitis virus
+RNA processing and degradation
+Unpaired Student's t-test
+similar levels of LC3-II/LC3-I ratio
+Italy
+1%
+Bioinformatics
+IgG3
+Infection caused by respiratory viruses
+host defense against invading pathogens
+external standard method
+Hospital registration numbers
+point of care instrument placement
+further study
+peptidome
+Cleavage of the ACE-2 FRET peptide
+recombinant
+the cut-off
+plasma viral RNA
+≥20
+control standards, standard curves, and reliability statistics
+the interaction with other risk factors and potential confounders
+study participants
+immunoediting
+eight
+pro-inflammatory signaling
+one
+detection and diagnosis of specific bacteria 2−4 and viruses
+N s
+$50% of normal
+peracute fatality
+Peacetime
+previous report
+increased activation of STAT1 and OASL2
+Atg5-mediated mechanisms
+beginning, approaching, clustering, invading, migrating, and transmigrating
+statin levels
+tyrosine kinase receptor c-kit
+antimalarial
+anticipatory stigma
+a vertex
+68
+Eighteen
+10 min
+etiology
+18-20 h
+Plasmid DNA
+15 min
+10,000
+anti-ClfA MAb 11H10 or SAR114
+0.002%
+antimicrobial
+cDNA
+Human health risk assessment
+Polyclonal AD-1-specific antibodies
+60,078 kg
+10%
+IL-18
+GL, GA and CBX
+between wtRNA1 and Mag1-RNA3
+acoustic, light, RF, and chemical signals
+five
+Florida FeLV clade
+hundreds of thousands
+significant reductions in ammonemia
+chronic
+airways infections
+Chitin recognition
+Probe pair specificity
+RSV infection severity
+interval
+Bound proteins
+gastrointestinal parasites
+$20-100 million
+DENV1-FGA/89
+homologous structural alignment
+Cellular and viral determinants
+627
+100 g/l
+four
+Microarray sequences generated from these replicate experiments
+βactin
+step-wise
+Quercetin glycosides
+UL57
+Tissue samples
+over 80%
+54.25%
+192
+glycyrrhizin
+regional compliance and resistance
+diversity of PPE
+a community of more than one host species
+neutravidin agarose resin
+42
+a binary outcome
+quantitative RT-PCR
+1.3
+generalized linear model
+Two-thirds
+Ribosomal frameshifting
+Internet searching
+10%
+when the genomic information structures of model organisms are completely clear
+VK and JK
+exercise
+Anthrax LT
+lack of consensus
+ccdB
+similarities in terms of gene lengths
+selecting the appropriate workflow
+circulation of influenza viruses globally
+prevention, detection and management of outbreaks of communicable disease
+type III IFNs
+metaMS
+RIG-I-mediated antiviral responses
+46
+AutoDock Tools suite
+4689
+intensity
+S-HBsAg and HBcAg
+ARDS
+CD spectroscopy
+alpha-2,3 sialic acids
+indirect correlation between host and pathogen genetics
+1,090
+foreign medical teams
+Carole Baskin
+hepatocytes
+accurate knowledge of the dispersion parameter
+7 days
+Fragile X syndrome
+key
+serum levels of inflammatory cytokines
+The type of domains found in each toxin
+5%
+agent-based models
+unmotivated measures
+relative luminescence units
+growth factors
+Rfam 9 SEED or FULL alignment files
+OTULIN
+their m/z and retention times within tolerance levels
+700,000
+Bayesian
+early 1970s
+p *
+rs12979860
+serum
+Riboswitches
+high positive predictive value
+coinfections
+miR-200a-3p
+data with scattered peptides
+6925
+35
+The contact network
+Empirical
+medical volunteers
+CNS injury during meningitis
+endolysosomal
+Extracted nucleic acid
+measuring the tRNA levels in different time point
+The band containing the RTP
+TAP1-knockout mice
+directs the synthesis of a de novo initiated 19-nt product
+1.7 kb
+epidemiological factors and possible interventions
+increased viral replication
+5 days
+Genome cyclization
+monosaccharide composition and partial glycosidic linkage patterns
+HP23
+Power SYBR Green PCR Master Mix kit
+individual LTZs
+Glycosulphate
+Multi-photon excitation
+SPSS 17.0
+isoproterenol and transferrin
+Monotherapy with ritonavir-boosted protease inhibitors
+Yoyogi Park
+6.25 × 10 6 TCID50/mL
+immunohistochemical
+anti-Actin and anti-Lamin A
+IRDye goat anti-mouse or anti-rabbit
+ethnic differences
+alkaloids
+20
+Breath-holding spells
+respiratory diseases
+O-Acetylation of sialic acids
+components of their cellular hosts
+p65/p50 heterodimer
+children more than 6 months old
+Serum samples
+stimulation index
+methodological issues
+the level of the luminal ER chaperone BiP
+health authorities
+two
+Kibale red colobus
+effector immunity and inflammation
+LDH
+TRAFs
+Rnase-free water
+FastPrep
+RNMT
+12%
+diffuse
+20 μL
+Early echocardiography
+vocabulary and language
+a long-established incumbent strain
+0.1% SDS solution
+moles, bats, shrews, and elephants
+263.24 mm
+40.6%
+fractional modifiers
+replication and transcription activator
+gold and silver
+Seven hundred twenty-four
+consistency of epitope prediction
+hematoxylin and eosin
+13 weeks
+data-logging thermometer
+~2 × 10 −10 cm 2 /s
+oil-free surfaces
+QuikChange Site-Directed Mutagenesis kit
+T4 polynucleotide kinase
+predefined
+rolling-circle amplification
+Vervet monkeys
+viral infection
+GRK2i and BafA1
+proton conduction
+3
+a9 nAChR
+FRET analysis
+ciliated cells, mucus-producing goblet cells and basal cells
+450 nm
+Na + and K +
+vascular permeability
+EBOV growth
+Frequency of use and Room for innovation
+Foot-and-mouth disease
+animal phyla
+30 minutes
+complement-like immune response
+π ij
+ASD patients
+V3V5
+host
+regenerative processes
+viral loads
+cHV68
+40.7%
+HuNoV capsid protein
+Immunoglobulin deficiencies
+diagnostic needs
+purified VACV virions
+dysregulated
+fluctuating glucose conditions
+discrete domains
+Decentralization
+virus-endosome fusion
+between 10 and 100 nM
+1-7%
+correlation of amplification products to the presence or absence of a specific target
+SEV-induced activation of the ISRE promoter
+six
+genetic
+50%
+Mortality
+4.4 %
+TIM-1
+hydrophobic
+E1A-F
+LacZ
+BAL fluid total WBC count $510/mL
+Spatial heterogeneity
+8
+apolipoprotein A-I and haptoglobin
+cell viability
+post-transcriptional regulatory mechanism
+orangutan, marmoset, and gorilla
+alveolar epithelial and endothelial barriers
+30%
+Larger experimental datasets
+immunoblots
+diffuse thrombotic
+every supervisor's dreams
+250
+TRIM38 and TRIM56
+different outcomes
+Tachypnea
+coagulation factors
+194
+N35 -N34 -SGGRGG-C28
+six
+1A 10 and 6A 3 to 1A
+unacceptably high sample horizons
+University of Pittsburgh Investigational Review Board
+C14B1
+one reviewer
+Cut off value
+exponential growth rate
+61
+exogenous soluble neuraminidase
+polysomal
+A hexapeptide motif MYPPPY
+Belgian isolates
+N protein levels
+Alum
+17
+de-identified serum specimens with annotated data
+neuroprotection
+0.1
+ecologic
+TopHat2
+ammonium chloride
+the meanings of Sn, Sp, Acc and MCC
+115
+Formation of atelectasis
+availability of transportation or dependency of family members
+abdominal cramps, nausea, a high prevalence of vomiting, and diarrhea
+eight
+stochastic models
+aspartate-semialdehyde dehydrogenase gene
+STAT2 KO hamster
+dense
+vimentin
+pneumonia
+Clinical
+Blood samples
+G4-ThT complex
+11.5 d
+50 µL
+network modelling
+Th2/Th1
+GRB2
+genomic manipulations
+diffusion
+Dr. Juan Gambini
+HIV and TB
+Sec23a
+strong transcriptional changes in 244 genes
+34 weeks
+an appropriate workflow
+The rate of PERV transfer
+rs12252-C
+.
+SIgA
+RNeasy Mini Kit
+Yes, No, Unclear, and Not applicable
+production of the acute phase response proteins
+PCR-based suppressive subtractive hybridization techniques
+NSP2 expression
+21%
+more research
+GFP
+T cell response
+five
+covariates with sample size less than five
+350
+30 min
+privacy
+MbCD
+92%
+SK1
+74
+deISG15ylation activity
+bind the HIV-1 FSS
+11.8%
+more than 10 weeks
+systemic tumor resistance
+DAPP1 and CARD11
+k
+cap-independent
+to analyze the impact of PB1-F2 expression on host response
+Sera from pre-immune mice
+PP2A
+Polymerase incomplete primer extension cloning
+antiviral
+Varying the force loading rate
+heritable
+75%
+generalized linear modeling
+867
+Trolox and phosphate-buffered saline solutions
+28 kDa
+Cell proliferation
+PBMCs
+B cells
+50%
+TargetSearch and SWATHtoMRM
+erroneous interpretation of the data
+foci of mineral deposits
+83 of 463
+epicardial pacing
+Hsp90
+neopterin
+a memory phenotype
+DAPI Fluoromount-G
+3.33%
+the data generated by the simulation
+potential adverse effects
+FMP-specific CTLs
+Transmission electron microscopy
+Herpesviridae
+Fas
+DEFs at 12 and 24 hpi
+ventricular arrhythmia, cardiac dilation, and cardiac collapse
+the vaccine
+microarrays
+78
+carbonic acid
+The methylation to m 1 A 9
+ectodomain shedding of membrane proteins
+descriptive statistics
+two
+HCV genotype 1a
+10 min
+Urinary
+V H 1-69
+unfeasible TEM and/or NO n measurement
+20%
+>50%
+2016
+UGGT
+nsp1b, nsp2, and nsp11
+4% nondenaturing polyacrylamide gel
+IL28R
+acute-on-chronic liver failure
+high
+absolute humidity
+cellular ROS levels
+CodMod
+4 B-cell-penetrating peptide moiety
+515 mm 3
+2-3 weeks
+exerted an efficient viral replication
+Genome cyclization
+Microscopic
+NK cells
+Highly Pathogenic Avian Influenza
+particle size
+Cytotoxic doses of LT
+95.9%
+volume-amplified magnetic nanobead detection assay
+England and Wales
+6 mg
+timely testing
+virus elimination
+MADP1
+1 January 2009 and 31 May 2016
+Antisense oligonucleotides
+Excel
+tetramethyl benzidine
+a sequence domain
+fluorescent
+luciferase assay
+1-year mortality
+Three
+epitope enhancement
+an equally rapid decline
+patient-controlled analgesia
+.80%
+SCARB2
+relative local rearrangement in the palm domain
+18.0-20.0 g
+extracellular vesicles
+between 24 and 72 hours
+fluorescent
+attenuate IIS signaling
+three
+reemergence
+Infectiousness
+systematically
+global case definitions
+normal 6-12 h
+every 2-3 dpc
+RNA-silencing complex
+low-energy accidents
+620 nm/g
+CD8+ T cells
+BLASTn
+4.1%
+mediates attachment of virions to the host receptors
+Twenty-four hours
+renal function
+PLY
+glutathione reductase
+Twenty-four hours
+1952
+Novel antisense RNAs
+VP1
+2
+chemokines
+targeted therapy with cetuximab
+plant sourced materials
+airborne bacteria
+important
+HLA-A, -B and -C
+EPIFIL
+thirty
+Western blot analysis
+liver
+cellular component, biological process and molecular function
+ABH and Lewis antigens
+GRSF-1
+distribution shapefiles
+20 min
+PPRV-F VLPs
+9.4%
+PI4KB
+histocompatibility receptors
+immature cortical pericytes
+21
+Figure 1
+antiangiogenesis agents
+IgA avidity
+251-292
+three
+Travel restrictions
+contact precautions
+mosquitoes
+Significant increases in frameshifting
+GeneSpring
+illegal poisoning
+multivariable regression models
+bioactivity
+Fibrosis scores and liver function tests
+The T7 RNA polymerase promoter
+spatial dispersal
+nosocomial urinary tract, post-operative surgical site and blood stream infection
+two weeks
+Inhibitors
+Expression of SIRT7
+unbounded secular terms
+32
+1.5 h
+reduced electrostatic screening
+26
+biosafety level -4 pathogens
+Glucagon
+multiple mechanisms against HCV infection
+Acidosis
+chemokine
+21
+118
+Transferrin receptor 1
+GraphPad Prism software
+three
+decreased worker absenteeism
+beneficial or unfavorable
+all the piglet sera
+overexpansion due to bronchiolitis
+25
+2000
+mediates bioelectric responses to NGF
+subtle glycan shifts
+unsolicited
+intermolecular
+PCR-based suppressive subtractive hybridization
+D2 and D3
+143.4 ± 29.76
+products of the expected sizes
+SAM-dependent
+Early viral proteins
+10.0
+preservation of a U-turn motif in E.coli anticodon loop
+17
+supportive care and neuraminidase inhibitors
+over 80%
+bone marrow stem cells
+The nature and quality of air exchange, circulation and filtration
+genotypic changes
+hearing
+47
+statistical
+catB activity
+positive amplification of HBV target genes
+3,000 ps
+Epitopes or antigenic determinants
+15-80%
+Terlipressin
+7-8%
+its solubility
+viral replication and pathogenicity
+Tetraspanin proteins
+SARS PLpro
+Receiver operating characteristic curves
+false positive base calls
+three
+3 H-methyl transfer
+between November and December of each year
+DVG 70-114
+17%
+5 days
+lead inhibitor K31, K34, and 103772
+TRAF6
+134
+total protein concentrations
+Molecular simulations
+15-30%
+C
+Fainting
+splenic and BM
+JNK activation
+comorbidities
+sepsis induced cardiomyopathy
+30 min
+risks to health
+physicians' duty to care
+time-series analyses
+K and G
+severe cases of acne
+RANBP2
+Influenza A viruses
+4
+culture-based method
+blue, green and red
+mucosal/respiratory system
+ABCB4
+Cas12a
+999
+Dr. John Harty
+fixatives
+flexible and single-stranded
+FV10-ASW
+Bunyamwera virus
+sources of bias and heterogeneity
+severe consequences
+10 mA
+13 days
+0.412
+shutting off host protein synthesis
+lys627 mutation
+Fiji software 64
+confocal and orthogonal arrangements
+GSK2606414
+rhMPV/ ΔM2-2 infected cells
+influenza A infection status of the flock
+Plasmid pOFX310
+151
+10 412
+Applied Biosystems 7900 and 7500 real-time PCR instruments
+719 084
+The reduction of the average duration of stay
+Four
+electrostatic
+FMD symptoms
+Six
+Four days
+The infectiousness of second and subsequent re-infections
+China, Indonesia and Ghana
+systemic
+6.0 to 8.0
+58%
+100 %
+Personnel Protection Equipment
+2.2%
+Translation initiation
+blood
+113
+200 nm-240 nm
+suppression of virus endocytosis
+Urine and serum
+Contemporary tuberculosis
+RdRp
+perceived severity of the disease
+bats
+all users' data
+Glutathione
+peptide-ELISA
+platelet desialylation
+symptom onset
+79%
+cell tropism
+weight
+cell lysates
+fibrotic ATS plaques
+reverse-phase high-performance liquid chromatography
+11.5 ± 1.4 d
+nuclear entry
+Data
+the cat owners
+back-splicing
+native-like Env trimers
+Four hundred and twenty-three
+replicate efficiently
+porcelain mortar and pestle
+commercial ELISA tests
+ERK1 and ERK2
+clinical diagnosis
+Mechanistic
+hepatocellular carcinoma
+DR examination rooms
+5
+66%
+D1 ring
+MEGAN V5.2.1 and Mothur software
+RLU readings
+improve the outcome of CAP
+DC electric current
+two
+38
+lighter shade
+Guillain-Barré syndrome
+43
+pack size and Park ID
+Phylogenetic
+highly divergent strains
+DISOPRED v3
+50 μm
+cytoplasmic
+an increased rate of transplant rejection
+Four
+node degree, assortativity, and clustering at the level of triangles
+EBV
+IFITM proteins
+Potent vaccine delivery and adjuvant systems
+470
+one minus the probability of having no outbreaks greater than y cases
+LAMP1 pathway
+co-translational translocation
+the counted number at week t
+human enteroviruses
+Cxcr3
+S. sonnei
+tests
+virus binding to alpha-2,3-sialic acid
+The NCBI Bookshelf
+microbial molecules
+IFN-γ, IL-6 and IL-10
+delay the peak
+PEDV specific
+confounding or reverse causality
+lower lung lobes
+0.25%
+Further investigation
+50%
+1-13
+Activated STAT6
+Subcutaneous
+in depth tissue penetration
+innate immune response
+a hospital admission for an elective procedure
+phylogenetic
+SAL analogues
+Tamil Nadu
+RT-PCR, immunohistochemistry, and in situ hybridization
+Sichuan Agriculture University
+Emergence of intronless interferons
+DnaG-K6AY7A
+hydroxyproline
+dry materials
+S-palmitoylation
+30 weeks
+all eigenvalues
+responsive cytokines/chemokines
+Extracorporeal Membrane Oxygenation
+χ2 test
+pathogens
+SA Biosciences
+Machine learning algorithms
+standard precautions
+complementarity
+mobile apps or online sites
+196
+1,020
+recombination events between or within species
+58%
+seven
+increasing height of the peaks
+20%
+PVL cytotoxicity
+nausea, vomiting and abdominal pain
+mesenchymal
+35.7%
+2%
+9.4
+five
+WHO
+343,5 hours
+CDK4 and hTERT
+expression of viral RNAs and proteins from the transfected plasmids
+23 June
+High-throughput deep sequencing of the HIV genome
+Viennese
+Lymphocytopenia and pleural effusion
+prevention and the treatment of chronic ulcers
+peptide bonds
+38%
+Preparedness against pandemic influenza
+5 mL
+HMBS and HPRT1
+detection of a real outbreak
+R 0
+the supernatant/lysate of transfected cells
+avian
+six
+Oneway ANOVAs
+histopathological results
+an introduction text was presented to the participants
+35%
+0.05%
+membrane-anchored complex
+ResFinder and ABRicate
+UK
+in-house
+three
+VP8
+Sixteen hours
+increasing tissue repair pathways
+β-actin
+94%
+EFSA
+all domain III-specific monoclonal antibodies
+Blood and urine cultures
+16S RNA and the internal transcribed spacer region
+100 ml of the mix antibody-virus
+research
+hospital patients
+five
+Friend virus
+ClustalW
+a detailed description of the samples and sequencing protocol
+eliminate likely pathogens from a single specimen
+Clontech
+calculating more cases than the inputted population
+Data sharing
+Parasite burden
+cytotoxic T lymphocytes
+4
+3%
+negative
+Generalist strains
+A10L and L4R
+HSPG2 and CELA1
+Friedrich Sertürner
+3
+100%
+PhastSystem
+three
+its biological significance
+pre- anti-rabbit IgG secondary antibody
+different numbers or combinations of viral taxa
+speed of evolution and the adaptive route
+Ala152
+four PasAstV
+oxidoinflammatory
+liposomal dosage
+type 2
+≈60-70%
+The level of significance for terms and groups
+human IFN-l4 detection
+after 6-11 d of illness
+αA-crystallin
+Endothelial adhesion
+negative regulators of Th1 differentiation
+2.85 days
+18.3%
+0.76
+Cambodia and Lao PDR
+beta-blockers
+NK cells
+to provide an estimate of the severity of seasonal influenza epidemics
+intoxicating host cells
+four
+Virus staining
+identification of sites of viral persistence
+lack of patient-level severity of illness scoring
+The dimer
+global cognitive decline
+liver, intestine, subcutaneous fat and testis
+sporulation
+IL-10
+HRV species C
+94%
+shorter
+35
+SG formation
+cheetahs
+minor allele frequencies or genotype prevalence
+MalE-type ABC sugar transport system periplasmic component
+Promoter activity
+ARTD1
+31
+13, 17 and 19
+inhibit the function of AC and reduce the intracellular cAMP levels
+Human RAB7
+LNs
+Decentralization
+axons
+Inflammatory bowel disease
+HA-mediated membrane fusion
+10
+203
+Mouse Enzyme-Linked Immunosorbent Assay Kit
+make a final simple conclusion or relate the results of one prototype sequence
+JAC1
+tailored pharmacological and psychological treatments
+highquality reference databases
+0.032 to 1.074 mg ml À 1
+less than 5%
+mosquitoes
+pro and anti-apoptotic
+Poor treatment adherence, inappropriate inhaler use, or depression
+Seqman program
+Japanese
+Ankfy1
+gene sequence
+substantial differences between the 2 groups in the management of dogs
+supplementary material
+glycoside
+99.9%
+3-nitrotyrosine
+Rectangle in C
+antiviral function
+four
+dATP with Go Taq enzyme
+antiviral
+C62S substitution
+Analysis of volatile organic compounds in exhaled breath
+RT-PCR testing of LRT samples
+IL-1, IL-6, and NO secretion
+Fusion of transplanted stem cells with recipient cardiomyocytes
+distinct regulatory mechanisms in different cell types
+logical consistency, subjective interpretation and adequacy
+epidemiological model
+the mass balancing carbonyl moiety is released as a neutral fragment
+extendedspectrum betalactamase producing bacteria
+DNA-dependent
+pulmonary
+two
+the set of genes elevated in all CSF1-Fctreated
+reciprocal
+three
+30 h after LCMV infection
+Three-month-old SPF chickens
+Type II
+subunit vaccines
+Nineteen
+the accumulation of viral proteins
+rosiglitazone
+ERK1/2 and p38 MAPK
+host-protective function
+Purified H5 and H7 binding to immobilized MEDI8852
+Twenty-one
+FGD4
+9A8 mAb
+a conserved sequence within the reverse transcriptase gene
+500-600/min
+coalescent
+vsfold5
+0 to 28
+cytokinesTNF-α, MIP-2, and KC
+Dual-use discourse
+bronchoalveolar lavage
+a proline
+15
+Z proteins
+kinase R
+remyelinate nude axons
+GraphPad Prism 5
+Dr. A. Rudensky
+different clade
+600
+36 hours after challenge
+4500 V
+5 Mbp
+drug availability in n
+nine
+virion release
+27
+29%
+1.8
+prevention of serine-2 RNAPII degradation and RTCs formation
+codon:anticodon pairing
+DIs
+when schools and day care centres are opened or closed
+LO28
+Future studies
+plaque reduction assay
+to better recognize their viral targets
+apoptosis
+IFN1 and IFN3
+concatenated protein trees
+nLC-MS/MS
+Sabin I
+plant survival and performance
+crossing structure elements
+a double fate
+estimates of incidence or prevalence
+Viral RNA
+intentional release
+Area under the receiver operating characteristic curve
+SYBR Green I nucleic acid gel stain
+AGN
+TLR4/RAGE
+contaminated feed or water
+SNARE-Munc18-1-mediated membrane fusion
+25.74%
+gestalt pattern matching
+Creb3L3 transcript
+Plateau pressures
+increased influenza vaccination
+130
+gBlock templates
+pressure
+statistical significance and differential expression
+a strategy
+Glaucoma
+r-gene units with nascent pre-rRNA transcripts
+an IFN inducible gene
+Peptide or protein coding genes
+prevention of the MHV-3 mediated disease severity
+viral titers
+374
+Naïve CD4 + T cells
+repress translation
+viral infection
+Virtually irreversible binding
+3
+42 HI GMT
+highlight uncertainties or to practice a transparent decision-making process
+20X SSC and 10% SDS
+Belgium
+innate immune antagonism
+human immunodeficiency virus
+A421V and A553G
+0.91%
+0.5%
+1.18
+1.5 mL PBS
+correlates of protection
+HCV NS5A and core-NPT
+genes
+immune rejection
+RBV and ETAR
+ARDS susceptibility
+14 to 37%
+Four
+Ccr4
+Sharing of phages encoding virulence or antibiotic-resistance genes
+4-6 weeks
+Apoptosis
+P
+those obtained with the DDX19B mutant protein
+TMPRSS2:ETS fusion genes
+several unidentified orthologous pairs
+6 hr
+76
+11
+producers and veterinarians
+ECFP4 fingerprints
+SARS corona virus
+satisfactory DNA yields
+take part in the ETT
+MHV spike glycoprotein
+3
+Woolf test of homogeneity
+empirical data on laboratory-confirmed seasonal influenza
+drug resistance
+AST/ALT
+virus, bacteria, mycoplasma, and environmental factors
+anti-Salmonella Typhimurium protection
+helix α5
+inflammatory/ immune responses
+Immunoreactivity of these genes
+The level of actin
+statistical
+TNFα
+6%
+31 ± 14 d
+baculovirus
+effective
+identify property-specific toxicity attributes of particles
+45
+off-target Env-specific responses
+qRT-PCR and immunohistochemical assays
+Release of newly synthesized virions
+abrogation of the function of virus-specific CD8 + T cells
+atherogenesis
+QuickExtract
+Ebola virus and Pandoraea apista to human herpesvirus 2
+CnGB1
+more reservoir species than expected by chance
+hepatic lipid metabolism and hepatic carcinogenesis
+multitype
+viral life cycle, host immunological factors, or patient clinical symptoms
+OX40, TCR, CD28, and CD137
+Varicella-zoster
+G36-CD28z CART cells
+the supernatant
+anti-renalase monoclonal antibodies
+networkfocused public management
+CTL, HTL and BCL
+Virus titer
+Dual labeling
+light microscopy
+45%
+horseradish peroxidase-conjugated streptavidin
+effects of subclinical in utero infection
+usage preferences
+Campylobacter jejuni
+cut-off scores
+9,600
+1:1000
+BPD
+The author
+ADE phenomenon
+nasal turbinates, brain, and spinal cord
+Figure 7
+158
+lipid/steroid metabolism
+Saturation effects
+Cat intake number and mixed-age housing
+Gong and Peersen
+anti-N IgG
+p62/ SQSTM1
+54%
+100%
+lateral temporal and posterior cingulate regions
+11,000
+six
+borderline-significant preference of the second hypothesis over the first
+ImageJ software
+Bright-field and direct fluorescence of the transplanted lung
+155
+1,080
+His-Ala
+Chain size thresholds
+Purposive sampling and snowballing techniques
+Curosurf surfactant
+24
+biopsy spots
+GGO with ILS thickening
+constraint
+CDC
+elevated VSV replication
+The obtained best fit
+960
+LBMs
+G_GUC_UCU
+Parvovirus VP1
+images of the deflected PMNs
+guilt
+6
+A branched 2 -Lys-NHS
+Toll-like receptors
+Particulate matter
+54.5%
+26
+differential exon usage
+fetal bovine serum
+SIV Nef antagonism
+one
+isotype control antibodies
+DNA-hydrolyzing activity
+ShelX 30
+ZH501
+Student's t test
+association between BRD and SNPs
+NP/OP colonization with pneumococcus
+lymphoid atrophy
+.
+ratios of pre-to mature miR-122s
+cyclopentane
+moderate
+coordination
+helium
+influenza NP detection
+PB1-F2 expression
+10
+80%
+low to null activity
+non-parametric repeated-measure Friedman tests
+the receptor for poliovirus entry
+0.933
+IFNc
+Quantitative real-time PCR
+tyrosine phosphatases
+antibodydependent cellular cytotoxicity
+FKPB/Rapamycinbinding domain
+glycoproteins gB, gD and gH/gL
+end-point
+template switching
+E7
+an autonomous folding unit
+lipophilic dye DiD
+cellular
+1 min
+E
+absolute agreement
+3CD
+positive serology
+chlorination of the Ahda terminal methyl group
+Over 2000
+ChopNSpice
+β-actin
+Olex2
+76
+Spherical gold NPs
+SPPV-063
+symptom relief management
+R G = 1.21
+One hundred and twenty-one
+TUNEL assay, flow cytometry, and western blot
+hardiness
+SHFV nsp2
+GenBank
+respiratory, gastrointestinal, and urogenital tracts
+120 minutes
+SalI and NotI
+Pierce C18 Tips
+90.52 percent
+co-stimulatory
+FCA
+density-dependent
+male Swiss Webster mice
+28.37%
+therapeutic antibodies
+HI assays
+Infl uenza A viruses
+2.8%
+reduction in cellular mRNA levels
+immunosuppression
+reflectivity data
+Hydrophobic interaction
+HIV-RNA and CD4 counts
+six
+390
+The global budget system
+current vaccine strategies
+0.1 kcal/mol
+urbanization and deforestation
+10 min
+special ruler
+bioinformatics software
+high levels of all immunological genes studied
+platelets and tumour cells
+97 % to 100 %
+Severe trauma
+internal standards
+4
+10,535
+long-term neuromuscular, cognitive, and psychological symptoms
+sPLA2
+7 days
+MDCK cells
+P1
+Apoptosis
+permission to withdraw
+Unphosphorylated IFN-stimulated gene factor 3
+96
+parameters
+Network type models
+interleukin
+DDCt method
+>669 kDa
+1:640
+mediate isomerization of the SU-TM disulfide bond
+cardiac involvement of leptospirosis
+tyrosine kinase AXL
+32
+vomiting, diarrhea, and abdominal pain
+slowing down the infusion rate
+GL
+A. sinensis and S. miltiorrhiza
+Vps3/8 knockdown cells
+skin infection
+14
+exclusion
+rodents
+H5-VN04
+an anti-MPER specific response
+low replicative fitness
+phenotypic
+ATCV-1
+patchouli alcohol
+optimum pH and temperature
+HCV attachment and entry/fusion into the host cells
+50%
+2.9%
+50%
+contact tracing
+at least once a week
+metabolic process
+field-laboratory-bioinformatic protocol
+water/moisture and temperature
+random Gaussian distributions
+Depression
+The PTSD Module of the CIDI
+PK Solver
+Infectious
+PD-1
+sialic acid and galactose
+Asp
+Branching reliability
+retroviral
+blocked the toxic effects of deficiency in the BDNF/ TrkB signaling pathway
+length-dependent
+0.25%
+Mutational robustness
+lower preventative sense
+pressure support
+Just Another Gibbs Sampler software
+McNemar's test
+the tradeoff between call rate and accuracy
+cross-reactivity
+IEDB web server
+the number of model parameters
+Avastrovirus 1a
+Prophylactic
+Cellular lysates
+physiological
+Massively parallel signature sequencing
+Three hours
+the discovery of new viruses
+subsistence agriculture
+immunosuppressive effects
+2-to 3-fold
+GraphPad Prism 5
+none
+Coinfections and age at admission
+>50%
+Cooperativity and positive feedback
+important
+competition
+log TCID 50 / mL
+Plague
+Toxoplasma gondii
+valine
+polyfunctional
+3,173
+MB-003
+non-medical service workers
+daily
+Herbimycin A
+pigs
+ACE2
+n B m
+short-read data
+inter-and intrapatient variability
+granuloma formation
+ZIKV transfer across the placental barrier
+five
+10%
+PCR
+cyclic dinucleotide c-di-GMP
+hematological malignancies
+transparency
+hierarchical
+2.56
+DENV-MINI RNA
+Chi square tests
+Inducible expression of IL-33
+prediction
+three
+the highest MCCs
+Akt
+transcription 1 and STAT2
+10 days
+a t test
+15%
+®rm
+six
+suicide
+to benefit the reader
+electron density
+more than 10
+superoxide anions
+33-50 of ZGP and RGP
+r A
+623
+1 week
+contact intensity
+DENV-2
+994
+three
+tertiary lymphoid organs or ectopic lymphoid follicles
+529
+infection and endocytic uptake
+PPE fit
+swine
+membrane stabilizing effect
+young pigeon disease syndrome
+miRNAs
+poor absorption, rapid metabolism, and ultimately poor oral bioavailability
+nonspecific inhibition and misidentification
+chest
+Glaxo Smith Kline
+Associated bacterial BBP
+sex differences
+5c and 5d
+mathematical models
+19 th century
+malaria
+The long term consequences
+Any medical, psychiatric, social condition, occupational reason or other responsibility
+bird migratory routes
+machine learning-based tools
+Disease taxonomy
+mouse hepatitis virus and rotavirus group A
+Recovery data
+faecal stool
+dialectical
+D-Dimers or FDP
+membrane tubules
+signal loss or an individual leaving
+CBDs
+Enhanced intracellular calcium levels
+8.8610 5 M 21 s 21
+B cell activation bias
+EnVision Multilabel Reader
+Group I causes
+virus load
+Log scale
+viral genome alteration
+The RNA secondary structure
+1.80 ± 0.37
+5 days
+Syncytin-1
+fatty acid binding protein 1
+271
+platelet antigen
+405 nm
+ten
+unfolded protein response
+Global warming
+Supernatants
+urea
+early surveillance and accurate diagnosis
+ALI-cultured primary HBTE cells
+proteinase K
+liver transplantation
+collinear variables
+inflammatory
+Tc17 cell dysfunction
+Gata3
+brucellosis
+pipo
+10.0 g/kg
+B-1a cells
+higher retweet frequency
+on-site wastewater treatment
+Real data
+multiparametric
+cell migration
+flow cytometric analysis
+gel electrophoresis
+MAVS-dependent signaling
+epidemiological
+5-14 and 15-24
+comparative study
+long-term RNAi
+intranasal
+branching in phylogenetic analyses
+Availability of the complete EU-RMP in the public domain
+increased expression of GFT3C4
+Advanced age
+TAR
+pairs
+solithromycin
+nuclear
+MiRNAs
+rapid alteration in expression pattern
+Ononin
+HIV-2 Vif and Vif-SIVstm
+HDV
+anti-GP 1,2
+RanBP10 and cytochrome P450
+early registration
+intra-animal comparisons
+excessive activation of the immune system
+ratesof-influenza-related illness
+ribavirin
+premature translation terminations
+Normal liver
+CD4 and CD8
+low pH
+CD80 and CD86
+unmanageable risks
+an appropriate response
+83%
+Thirteen
+viral protein production and cytopathic response
+anti-thyroid drugs
+135
+cross-reactivity between Group 1 and Group 2
+The clinical outcome
+bibliometric
+virus replication
+60.8%
+twice
+symptoms
+OsSGT1
+ESPs
+coronavirus
+Golgi-resident GPI-anchored protein
+402
+GAPDH primers
+late in the ICU stay
+IFNL4
+x
+the extent and duration of an antimycobacterial therapy
+six
+alcohol-based
+R 0
+RPMI 1640
+non-interventional data research
+NMR spectroscopic investigations
+anxiety, vomiting and lightheadedness
+Embryonated egg inoculation
+LPS stimulation
+black
+Neutrality
+trypsin-digestion adhesion assay
+Constitutively expressed HADs and HBDs
+adaptive immunity against PRRSV infection
+Genotype 3
+viral supernatant
+i F 0 and i U 0
+Inositolrequiring enzyme 1
+IsdB
+HPAI H5N1
+986bp
+to protect and safeguard the well-being of HCPs
+pneumonia
+five
+confusion, ataxia, and seizures
+48 h
+CHO cells
+age
+well mixed
+Bispecific antibodies
+Virus-induced autoimmunity
+mediates host cell attachment and fusion
+public ground transport
+enrich the population of cells expressing GFP
+a standard procedure
+25%
+Flaviviridae
+0.65
+376
+Five
+Acute respiratory tract infections
+1918
+482
+sampling from the LRT
+INMI
+virus-specific antiapoptosis genes
+29%
+multiple APC subunits
+Palmitoylethanomide
+area quantification tool
+a comprehensive search for clinical trials
+Partial haplotype observations
+IFNL
+1-3%
+Let-7f and miR-24
+1088 base pairs
+100
+Grantham value
+Escherichia coli
+reovirus infection
+symptom
+two
+six
+three
+autophagosomes
+vacuolar-type H + -ATPase
+NS2B-NS3 pro proteolytic activity
+nine
+three
+17
+Genome structures of vectors
+chloroquine and desethylchloroquine
+GAMs and translog functions
+LAMP-to-glucose transduction
+P max
+bacterial loads
+males
+30 min
+BL21/pET28 a prokaryotic expression system
+additional power
+ϩ T cells
+Penicillium
+RNA3
+Four
+E. coli DH5α
+14 dpi
+epithelial islands
+Pairwise
+Brazil
+26 March
+3%
+the number of available animals was limited
+P-value
+100-110 kD
+influenza virus
+clinicians within the hospitals
+activate the immune system
+Microbiota data
+alveolar hemorrhage
+309
+College of Agriculture and Life Sciences
+pentobarbital
+100 ng total RNA
+nucleation and zipping
+T cells and NK cells
+another steady state of respiration had been achieved
+fever, malaise, meningitis, and encephalitis
+mammary gland
+Japanese encephalitis virus
+Risk and disease spread
+Providing the limited healthcare worker cadre with appropriate training and personal protective equipment
+M
+germline infection leading to endogenization
+31.38 ± 0.26d
+Hepatitis B virus
+70%
+microcephaly
+detailed spatio-temporal infection surveillance data
+VII
+ApoL1
+0.55
+twice
+an evolutionarily motivated score
+Los Alamos HIV-1 sequence database
+Critical response capability
+Gene-based therapy
+epitopes
+spatial and temporal
+inflammatory
+similarity between the query and template
+CRISPR-Cas
+72°C
+fluorescence intensity
+VSV particles
+genome-wide analysis
+Salmonella enterica serovar Typhi
+Filamentous phage particles
+16%
+100-120
+Autoreactive T cells
+Necrosis and apoptosis
+sequences with no predicted NoLS
+18%
+Hari et al.
+LysM-Cre +/-IFNAR fl/fl mice
+Infectious diseases
+lack of functional open reading frames
+drier
+neutralizing antibody
+Homologous
+Dew point temperature
+full-length clones for each identified gene
+sialocatabolism
+amphiphysin
+branch pattern and branch length
+lung tissue
+K 252
+Bm lymphocytes
+NPC1
+citation links
+5%
+1,920
+HIV
+genes showing V value below the cutoff limit of 0.15
+hold his or her breath
+3-5 min
+seven
+10 mj/cm 2
+ILI-syndrome
+infectious disease detection, assessment, and response
+airborne transmission
+SPSS 17.0
+where any given study would fall on an ethical spectrum
+information about the diet of exposed human and antibiotic use
+mtREV24
+21
+functional magnetic resonance imaging
+anisotropic
+α-chymotrypsin
+a template peptide
+MELD score
+5 d
+CrebA
+HPLC
+127
+13
+absorbance
+influenza
+mixed forest
+skeletal muscle
+motor neurons
+modulators
+20
+Oct-4 expression
+MH, CLD and PJ
+618
+Position Bias
+RNA levels
+GC7
+NdeI and BamHI
+Improved stability
+the disease is so stigmatised
+HopPER
+45 days
+cell-or organ-specific delivery or the complexity of mRNA pharmacology
+donkeys
+25 and 60 kDa
+alleviate endotoxininduced mortality
+increased production of infectious particles
+swabs
+oligo-A complex
+six
+ChAT
+IRES
+the patient or guardian
+hypothalamus
+regulators of innate immunity and proteins mediating transcription
+boosts trophic factor release
+2.45 GHz
+N4
+1 hr
+residual population immunity
+complement
+50%
+three
+140
+human eIF2s subunit
+by searching for their cognate antigens presented by macrophages
+9 dpi
+dynamin
+685
+an MOI of 0.5 PFU/cell of the rescue virus
+peptide pools
+Hand-held
+reduced, but measurable IFN-b
+0.1
+Access to a private car
+normal adult mice
+MODELLER 9v11 through HHpred
+Thermodynamics of eIF4E/14 complex formation
+r
+longterm memory consolidation
+600
+CD4 + cells
+18
+1,785
+a furin site
+34
+roach-allergic asthmatic
+B cells
+Table 4
+alveolar MΦs
+Many studies
+Salmonella Typhi
+6 nM
+Swiss PDB viewer
+Unraveling the common targets of the DEGs
+Written consent
+phosphatidyl-inositol-4 kinase-IIIa
+Untreated and vehicle treated lungs
+12
+two
+the genome types of the same species
+Size-exclusion
+December 2005
+6
+identical sequences and those with undetermined bases
+Ribozymes
+understanding the biology of HCs
+autophagy
+2 ml/kg
+situational awareness purposes
+label ubiquitin conjugation machinery
+600
+280°C
+15 years
+Protein expression from GAL1 promoter
+Synergism
+cattle
+6 to 12 ACH
+movement and infection spread
+17
+methodology
+severe viral hepatitis
+reinforced measures
+Pulmonary suppression of inflammation
+N = S + E + I + R
+23
+A large inoculum
+δ im ··
+two months
+Vps3/Vps8-dependent recycling pathway
+NP-hard
+91%
+12 to 15 days
+antiviral
+blood coagulation and viral genome replication
+ex vivo 3D
+Single particle
+£1.7 billion
+overuse of antibiotics
+Blue tongue virus
+2009
+targeted exome sequencing
+Lungs
+310 to 511.7 K
+50%
+CD46
+negative
+treatment
+IFN-β
+neutralization of PanAd3
+ubiquitination of IFNAR1
+chronic refractory inflammation
+$664 million
+NF-κ B
+39%
+Tbx5
+three
+research, authorship, and/or publication
+Plasma
+90% oxygen saturation target
+ImageJ
+PDIdependent DT toxicity
+108 mg/L
+Tissue sections from uninfected mice
+Arginase-1
+N-glycosylation
+25%
+0.053 PFU
+PI506
+divergent results
+Gram-negative
+1.5 mg/dl
+mediates virus-membrane fusion
+NS3pro inhibitory activity
+1-2%
+Pseudouridine
+one detected species
+four
+correct sequence
+complementation
+nonnegativity
+gastrointestinal and neurologic
+357 ± 94 ng/ml
+geographically distinct residential areas
+Type B Caps
+DEATH domain
+Thirty
+TRS base pairing
+inserted miRNA target sites
+Ideal body weight and body mass index
+Cl-inhibitor
+interactions of proteins encoded by strongly differentially expressed genes
+310
+8 fold
+2.5%
+p#0.05
+CT scans
+heat-sensitive and coldsensitive
+five
+all base pairs of G
+1/K m
+clinical trials
+MJ and JS
+endosomal membranes
+6.7%-20.6%
+cleavable cellpenetrating peptides
+recombinant virus
+310.5 Ϯ 71.2%
+Univariate and multivariate logistic regression analyses
+systemic corticosteroid
+644
+more than half a year
+RIG-I deltaCARD
+EpiFlu
+50%
+four years
+The production of two virion types
+2.6%
+78%
+HD mice
+Figure 1
+anti-cytokine neutralization
+pulmonary epithelium, angiogenesis, and the innate immune system
+Twenty-one
+socioeconomic deprivation
+CRISPR
+86.7%
+new targets for disease intervention
+3,000
+7,000
+0
+linear epitope
+1--3-imidazopyridine
+mandatory controls
+composition of the periciliary fluid
+cell cycle arrest, cell enlargement and resistance to apoptosis
+3000 to 60,000
+earlier initiation of droplet and contact precautions
+development
+abrogated
+Sexual minorities including gay men
+a constellation of genes
+electronic
+mucosal and systemic adaptive immune responses
+up to 8 generations
+dead-space/tidal volume ratio
+worsening
+neurotropic
+membrane cholesterol, the PI3K pathway, and actin
+ILCs
+XRN1
+Statistics Package of Social Sciences
+neutrophils
+one hour
+Streptomycin sensitivity
+consistent
+Slow Loris parvovirus 1
+67
+individual mandatory test and the herd screening test
+Veritas Luminometer
+four
+IFN-γ
+Bluetongue virus
+Bacterial adhesion to the surfaces of cells
+GAPDH mRNA
+pDest14/ N TAILW518
+Table 1
+solvent accessibility and proximity to the sialic acid receptor binding site
+virulence
+cc-by
+features separately from the background and human bodies
+Normal
+4,484,000
+promoter responses to RTA
+6%
+children's health
+0.95
+SZ129
+increased neuronal cell death
+coiled-coil signatures
+bacterial phagocytosis
+Glutaraldehyde-3-phosphate-dehydrogenase
+Trolox
+two
+twelve years
+A Ni-column
+loss of normal function
+18 days
+280-290 days
+axon diameters
+fine-tuning effect
+in-hospital mortality
+26
+Ka/Ks ratios
+18,193
+Zero time samples
+Semithin sections
+polygons
+better mitigation outcomes and minimizing wastage
+50%
+virus growth
+nitrates
+87%
+π
+endoplasmic reticulum-associated degradation system
+56
+expression of the ICP4 protein levels
+Jackson ImmunoResearch Laboratories
+horse-ownership
+Aligning multiple genomic sequences
+Carnoy's fixative
+48 kDa
+nine
+stress related hormones
+weaker
+Serologic testing
+lattice diagrams
+a threshold time
+its accessibility and usefulness in monitoring several physiological and pathological conditions
+72 hr pi
+Apoptosis
+luciferase activities
+a completely novel short protein
+Hemodynamic parameter
+32%
+3
+angiotensin II
+173
+chase additional genes
+231
+therapeutic treatments
+autophagosomes
+PGN
+Microtubule severing enzymes
+substoichiometric
+number of residues
+71 on-going One Health efforts
+Pulmonary function testing techniques
+abnormal enhancement of left ventricular wall
+HTT
+Hepadnaviruses
+Bayesian formulations
+lower temperature and scarce resources
+body temperature
+serum creatinine and blood urea nitrogen levels
+twice
+the need to attenuate each serotype
+knowledge of sequences gained with microarrays
+state of platelets
+30.3 %
+rip 1*
+neuroblastoma
+all windows
+Anti-b-actin
+cDNA
+BG isolates
+Cord blood and mobilized peripheral blood stem cells
+2.4.0
+The light and heavy chains
+eight
+DC-like phenotype
+lower
+63
+gastrointestinal digestion
+between postnatal week 1 and 2
+Bio-Rad iMark™ microplate reader
+autophagy and necroptosis
+JMP 12.0.1
+tuberculosis
+viral and cellular protein synthesis
+incidence of infection
+First, second, and third
+colorimetric
+artificial airways
+hexagon-centered-staraptamer complex
+1-2 months
+>80%
+100 M
+amino acids
+faster
+63 amino acid residues
+34
+10
+Prof. Teraoka
+The binding affinity between the NAG and the receptor
+Cigarette smoking
+Six
+HIV-1 p24 Antigen Capture Assay kit
+21
+6
+70%
+ERK
+RT
+Non-stained cell suspension
+Osawa and Singh
+cc-by
+G1 and S-G2-M
+PicoLab Rodent Diet 20 ad libitum
+increase
+earlier studies
+Extracellular matrix stiffness
+modified wobble uridines
+regional patterns
+TLR4
+1 hour
+flow cytometry
+≈200 kb
+50%
+Six
+mutual
+90%
+Delphi
+10% of the population were fully immune
+effective information
+analysis and dissemination of the results
+E protein in culture supernatants
+FoldX algorithm
+>80%
+14-day
+luciferase activity
+trk receptors
+disturbance of circulating lipoprotein levels and whole-body fat distribution
+Luciferase protein expression
+Spiroplasma mirum
+4.1 mg/dL
+NO •
+early recognition of subclinical mastitis
+reactivation of latent virus
+80%
+high proliferation ability
+inflammatory
+0.9993
+GC content and the mean nucleotide distance
+IFN induction
+one of the best results
+Four
+NTPase/dATPase activity
+peptides and nucleic acids
+The pathway to licensure
+ambisense plasmids
+influenza A H3-specific hemagglutinin RNA
+blood
+microorganisms
+Bloomington Stock Center
+prior
+herpes simplex virus and mouse hepatitis virus
+12 days
+antimicrobial
+Helsinki Declaration
+rofecoxib
+PA
+-11
+HVC model
+MnmEG and MnmC activities not being kinetically tuned
+Luciferase activity of cell lysate
+young to middle-aged adults
+15 µg
+informaticsdriven vaccine design
+MBP staining intensity
+biological
+selection for beneficial traits and against harmful traits
+1184
+unaffected
+SV40
+primary and secondary objective analyses
+metalloproteases M12
+Alveolar
+heterogeneous
+β-actin
+1-3%
+pH1N1 virus
+The percentage of patients who visited a neurologist/ psychiatrist or psychotherapist
+destabilization
+yellow
+low-voltage pulses
+Ten
+25%
+IL-2 and IL-6
+wwPDB
+School activities
+several cancer-related genes as well as a set of genes
+mechanically ventilated
+endoplasmic reticulum-derived vesicles
+Mucus extracts
+anti-PDI or anti-ERp57 antibody
+human and mouse STING
+One hundred and twenty
+HBV clearance or suppression
+several hosts are needed to maintain ebolaviruses
+gp350
+DMSO
+Albany model
+macrophages
+ATG5-12
+2 mL
+confidentiality; listening skills and understanding boundaries
+cluster
+T cells
+upper arms
+PUE system
+at 1:10,000 dilution
+Helper phage
+health care providers
+PSEDOPIPE approach
+functional avidity
+Blunt-ended siRNA
+p.Arg334Lys
+persistently and transiently infected animals
+Safety
+IFI27 and IRF7
+three
+Blood samples
+91%
+CDC
+bacterial infections or sepsis
+85 ± 6.2 g/l
+RPA43
+Nuclear Extract Kit
+alternative vaccines
+3 h
+virulence
+95°C
+Protein metabolism, cytoskeleton, and apoptosis
+10%
+SAA concentration
+MetaMorph 7.5
+Eight
+RT-LAMP
+PRRSV serology or PCR status
+fewer aSMA-positive myofibroblasts
+5%
+188
+hosts of pathogen-transmitting invertebrate blood-feeders
+24
+5%
+crested ibis
+Colorectal cancer
+Pneumonia
+disaster research
+Hopf bifurcations
+sequence data
+three
+A record of GCP training
+a NR
+the profile of proteins captured by the Trx1 trapping mutant
+standard methods
+Predictor independent variables
+specific functions
+NanoDrop ® ND-1000 spectrophotometry
+OD 450 nm
+pKa's
+400,000
+BCL-2 and transferrin receptor of the F81 cells
+adjuvants
+temperature, relative humidity and air pressure
+217
+FOXP3
+light-yellow
+2.83 eV
+Foodborne and waterborne IDTEs
+DAVID
+antimalarial drug-stimulated PfMDR1 ATPase activity
+dUTP
+l i and m i
+125
+demographic factors and distance from Lima
+Vortex with NS
+epithelial destruction
+0.92
+0.1%
+bromodeoxyuridine
+standardised parameter estimates
+0.6%
+QIV
+elevation, latitude, longitude, temperature, light, rainfall
+28 min
+whether the recoding event is responsive to polyamine levels in cells
+The complex structure
+LPBE
+0-7
+her previous quality of life
+asthma and COPD
+APPs
+14
+34%
+5.6-83.3%
+1 N HCl
+$140%
+1918
+a repressor domain
+bi-monthly
+loss of +1 frame FLuc translation
+Ni-NTA spin trap columns
+decreased tube formation
+6 days
+alimentary
+Trizol
+Confocal
+failure of hybridization
+TRIM21 binding
+Serpentovirinae
+whole genome sequencing
+>40%
+to elucidate the molecular basis of TS mutations
+Ordinate
+sparse and focal cell infiltrates
+GraphPad Prism
+novel and highly divergent viruses
+TLR9
+AP-1 NFAT and NF-κB
+Blood transfusion
+synchronising the epidemic trajectories in different population groups
+intermediate
+10 -12 days
+two years
+Full heroin dose− response curves
+51 mg/L of isoquercitrin
+30,453
+178
+BandScan 5.0
+ξ-heterogenity
+hypersporulation
+direct known interactions
+multiple
+different components of the JAK/STAT pathway
+culturally specific or unique emotions
+TGEV
+real applications
+Electrical Impedance Tomography
+ATG5
+Nanotechnology
+little attention
+381
+dysfunctional adipogenesis
+SMR
+Nasal swabs
+UniProt
+100%
+macrophages
+acute fatal
+NEAT1
+SPF animals
+Cross-species testing
+MHCcluster v2.0 server
+Mouse IgG diluted in triplicate
+NetNGlyc 1.0 Server and NetOGlyc Server
+viral immunopathology
+36 days
+a family of small peptides
+HPIV3
+mid-August
+via the inter-molecule disulfide bonds
+PRRSV
+sPD-1
+simple base pair maximization
+NANODROP-8000 spectrophotometer
+⁎ R
+IRESes
+great potential
+viral antigen
+focal augmentation of stretch
+multivariate
+Increasing hydrophobicity of these regions
+proinflammatory
+3.53
+200-300
+short versions of the full-length host proteins
+hepatitis C
+a set of sorted nodes V
+fold change from pre-vaccination
+Timing of the historical influenza season
+HCV core-stimulated CD4 + and CD8 + T cells
+PbrB
+Eight
+lung abnormalities
+Six hundred and fifteen
+CLS scores
+irregularity
+one
+co-evolution between the host and the pathogen
+Real-Time PCR Assay Design Tool
+Saunders and Monet
+ORF4 and ORF5
+Albumin
+recycling endosomes
+severe enteritis, vomiting and watery diarrhea
+English
+nitrated amino acid
+Supplementary Tables S2 and S3
+deep mutational scanning
+OME
+PARP13 catalytic domain
+arboviral
+CD13
+Yellow Fluorescent Protein
+ROS-calpain-ZO-1
+right-sequenced pMD-18T vectors
+230,460
+coelenterazine analog furimazine
+black
+Olympus BX50
+screen set
+Error bars and statistics
+DDB2
+20 minutes
+NHKs
+Knowledge of the suspected pathogen
+Specific long-range interactions between proteins
+luciferase activity
+77.1%
+massive lymphoma infiltration
+4 h
+RV-B
+test paper
+HA-influenza pseudotypes
+50%
+histomorphological approaches
+108
+A mechanism that forces interference between vaccine and revertant
+three
+69 %
+separation and isolation of small particles
+36
+up to 5 days
+SARS
+2-3 weeks
+98
+green fluorescent protein
+environmental guidance cues
+publication of this article
+SsRV-L
+CPU constraints
+Box plots
+0.96
+GIS
+twice
+RefFinder
+100
+Kaposi's sarcoma
+PP1a-96A
+clinical
+one of the principal investigators of the key trial of the intervention
+Calcium influx induced by suilysin
+viral vector-based approaches
+2.6%
+intrinsic disorder
+document-level classification
+moderately
+caspase-6
+2 months
+A. fumigatus
+Hematoxylin-eosin
+Student's t test
+epidemic extinction
+worldwide
+oral immunization
+removed from useable inventory
+5%
+a single protein
+The original tube without the swab
+10 ng/mL
+Total-Gabon
+difference in pathogen load
+Complex I activity and caspase 12 activity
+Alaska One Health Group
+34
+Concentration
+antiretroviral therapy
+90 nm and 240 nm standard calibration beads
+a patient in Hamburg
+immunisation
+AIRS
+HBV surface proteins
+to describe the characteristics of patients with TB requiring intensive care
+RVA and HAstV
+Allelic Discrimination
+500
+14,000 birds/km 2
+external infections
+2
+hNECs
+an uncontrolled inflammatory reaction and an inadequate immune response
+lysosomal vacuole
+53.9%
+quality of data sets
+Hax-1
+FRPP
+new viruses
+higher activation of ERK2
+0.05
+Less than 1%
+mediastinal
+Sequences from the Los Alamos HIV Sequence Database
+71
+US$ 866 000
+Fowlpox virus
+LGP2
+Ub-based suicide probes
+k
+Vanderbilt Clinical Research Center
+Outdoor activities
+testing cross-reactivity of the peptides
+A cluster
+between 2 to 7 aminoglycoside resistance genes
+CD 134
+maternal antibodies
+23
+entry of an antibodycoated particle into the cytosol
+Picornaviruses
+23
+P protein
+Picornaviridae
+branching process
+zero
+β-casein
+flow cytometry
+facilitators
+Cerebrospinal
+Fisher's exact test
+≤16.3%
+HIV-1 Tat
+DNA vaccine safety
+10.1099/mic.0.049601-0
+cell death
+12-19-year
+valine residue
+SCARB2 3 0 UTR
+4 hr
+Adaptive homeostasis
+Sixty-eight
+marked organ dysfunction
+mutation and evolution characteristics
+STATA 11.0
+refusal at follow-up
+Malnutrition and congestive heart disease
+murine herpesvirus-68
+more than
+1-specificity
+Division of Global Health Protection
+virus-specific neutralizing antibodies
+2004
+Lipid accumulation
+that used in SPR analysis
+Mann-Whitney test
+data augmentation
+HIV/AIDS
+Environmental Systems Research Institute, Inc
+hydrological processes
+Brazilian Information System for Notifiable Diseases
+MHV-3
+Disinhibition
+2,734
+compositional limitations and mutational pressure
+their effector functions
+important characteristics of interactions between respiratory viruses and their host cells
+45 minutes
+Birds
+confocal
+35%
+1,482
+hIgG
+spatial heterogeneity at the landscape scale
+Centers for Disease Control and Prevention
+Bartonella
+40 mm Hg
+24
+Ebola virus disease
+viral RNA
+4
+linear regression analysis
+EDTA
+four
+Further study
+staining
+over 50,000
+four
+polycrystalline powders and DMSO solutions
+Pteropus vampyrus
+Hypoalbuminaemia
+A549 cells
+an inventory of fixed features
+484
+1 μg/mL/peptide
+D
+Forty
+allocation of monitoring efforts
+promotes type I IFN signaling activation and decreases virus growth
+Trypan Blue
+cell debris
+Case-based
+ADOA
+13%-59%
+113 g
+it is based on the asymptotic distribution of the LRT
+Training and education
+A second elution in 90% acetonitrile
+DMSO
+successful introduction of new vaccines
+23%
+measures of epidemic risk and severity
+western-blots
+staff from EPHI and MoLFR or other appropriate animal health agencies
+p13-CW FAP
+crossspecies comparative analyses
+37.06%
+30
+pol l-leave
+point mutant strains
+IgG ADCVI activity
+standard conditions
+C57BL/6
+80%
+10
+HP H5N1
+2.14 log 10 cgeq/ml
+exon 6 of the mouse Ifnar2 gene
+85
+The corresponding author
+Understanding and predicting the direction and velocity of an invasion wave
+aberrations in histone 3' UTR processing gene transcription
+PEG-IFN/RBV
+sequence in the virus
+N protein expression levels
+postfusion conformation
+Eighteen
+1 h
+30%
+Hepatocellular carcinoma
+GraphPad Prism
+three
+Cancer cells
+a medication to prevent blood from clotting
+features calculated from sequence information only
+↓ cleavage sites
+CD4
+critical revision
+24
+59%
+stage-specific infectivity with individual heterogeneity
+mDCs
+lower BVDV prevalence
+alcohol-based
+basophils and eosinophils
+65%
+lymphocytic pleocytosis and hyperproteinorachia
+Growth rate post-NDV challenge
+4 weeks
+18-20 hours
+0.05
+HBZ-specific CD8 + T cells
+Social distancing
+Family
+SPIO
+regulatory and clinical trial complexity
+three
+around the mid length of the style
+cell polarity markers
+CHIKV-infected cells
+slower kinetics of light production
+to determine factors affecting the measurement of SP-D by ELISA
+98%
+the National Library of Medicine's controlled vocabulary
+QIAshredder columns
+0.1%
+experimental
+functional
+virulence
+One hour
+kDN measure
+The ability to detect the presence of GMO
+purity
+Five
+5-8 weeks
+28%
+toll-like receptor 4 signaling
+lethal
+2.478 Å
+Counselling on feeding options
+experimental condition
+two
+PARP10 mediated RNA ADP-ribosylation
+36.7 million
+0.110
+mice
+5-fold, 7-fold or 10-fold cross-validation
+Clip compression
+ActD
+mathematical ecology
+LSM 510 confocal microscope
+chest CT
+60S
+Type II
+15,618
+those currently being developed
+SOFA
+log K{d KL
+Grouping pre-diagnostic data into syndromes
+RTCs
+7%
+six
+ADCC
+seasons
+24 h
+position 42 and 214
+Antibiotic resistance
+3-month
+animal host receptors
+viruses
+adipose AGT
+whole lungs
+SCAU1105
+10 to 12 h
+sets with active and inactive inequalities
+REACTOME.db pathway database
+passive reporting
+heterogeneity
+hCD45, CD3, CD8, and CD19
+15 min
+Global fits
+open/accessible chromatin structures
+Generation of ROS
+distributive and other forms of justice
+Prosaposin
+multiplex PCR arrays
+ubiquitinated α-globin
+IMB-1406
+infectious virus being present
+134
+Long probes
+TRIzol reagent
+rainfall
+33.7%
+eastern Eurasian
+aortic volume
+Nine
+30 min at 4uC
+millions
+recruitment of circulating effector T cells
+signaling properties and downstream cellular function
+Fuhrman grade system
+serological
+pCMV ∆R8.2
+four
+prohibitin
+complete protection
+NIS Elements Viewer 4.20
+13 fold
+10% FCS and 5 mg/ml puromycin
+moderate water solubility and oral absorption
+an alternate elongated structure
+75%
+Delirium
+directions from each individual's home where most of the visited places are located
+Preferred Reporting Items for Systematic Reviews and Meta-Analyses
+reduction in the non-protein sulfhydryl moiety
+SUMO binding by Ubc9
+a single arginine residue
+by washing with Ca 2+ /Mg 2+ -free PBS
+the existence of each protein and the S-palmitoylation
+109
+83%
+intravenous injection
+10
+early 1980s
+1.1Gy/min
+full mediation
+Royal Children's Hospital Ethics in Human Research Committee
+adjustment for gender and severity of expiratory airflow obstruction
+specific nucleolar reorganization and altered activities of the nucleolus
+high infection probability
+20 min at 25uC
+culture medium
+high-level soluble expression of PRRSV strain
+M-CSF
+15 ml/well of 35% ethanol
+MPG-8
+their populations varied between clusters and strata
+similar levels of cell death
+FigTree
+haemolytic
+global influenza surveillance
+IFN receptor knockout mice
+Etoposide
+other G4 ligands
+BUNV
+regulate multiple host targets
+proinflammatory
+11.6
+FlexPepDock refinement protocol
+mutation rate
+69% of the genome
+IRF1
+Peptide
+elephants
+DisProt
+strial membrane protein networks
+regenerative medicine
+a reduction in POAF
+30-50%
+42
+66.6-79.4%
+1,178
+20
+LysM positive cells
+hydrophobicity/hydrophilicity characteristics
+so that all networks of a particular letter are the same size across inference methods
+Two
+inflammation
+CCK-8
+0.01
+25%
+mucus dehydration
+40%
+Small ruminants
+Biology
+1/µ H
+59UTR sequences
+CGR-24
+Loss of BRCA2 function
+ten
+Adrenomedullin
+p values less than 0.05
+greater binding efficiency
+infected wild type and IPS-1 2/2 infected mice
+UL39
+West Nile encephalitis and acute hepatitis
+a binary variable
+bacterial, fungal, viral, and parasitic pathogens
+The Picornaviridae Study Group
+EV-D70 and the coxsackievirus A24 variant
+NLRP3 inflammasome pathway
+inflammatory
+statistical comparisons of response rate
+Nine
+antiviral interferon responses from monocytes and DCs
+Trm cells
+Fig. 6
+uncertain
+SeV copy-back DVGs
+40
+homeostatic eosinophil influx
+11,782
+long-term swallowing disorders and aspiration pneumonia
+twice
+4
+five
+60 min
+2%
+5 kHz
+intra- and inter- chain disulfide bonds
+H7N9-RNA
+chemical and genetic
+the number of isolated cases
+sensitivity of the detection methods
+whether nature or nurture were responsible for distinguishing social hierarchy between two individuals
+circularity
+World Health Organization
+GNU Parallel 79
+cysteine codon
+Helsinki ethical principles
+55% and 64%
+30 min
+controlled field experiments and human behavioural risk studies
+neuropathological
+IL-10
+observed data
+Amoy
+DS-Cav1 adjuvanted with SAS + Carbopol
+62.5%
+1971
+15
+to prevent overheating of the photocatalyst-containing solution
+global fitting
+cc-by
+1.2-2.5 million years ago
+endothelial cell viability
+Bradford method
+Glatt Kosher
+infectious diseases outbreak
+shorebirds and seabirds
+apoptosis of monocytes/macrophages
+seeding kit
+cytolytic activity
+Simes p-values
+English
+59,000
+Ten
+NDV positive serum
+high parasite loads
+Genotype
+Infectious diseases
+Expertise in experimental design and statistics
+Candidiasis
+DFC
+.
+Advanced age, increased weight, sepsis, and renal replacement therapy
+1047
+overdispersion
+type I cells
+292
+11.9-fold lower
+nucleoplasm
+cough, fatigue, fever and myalgia
+pro-inflammatory mediators and related receptors
+re-activated
+35 canine parvovirus sequences
+EV71 and coxsackievirus A16
+convergent or divergent evolution
+1 hour
+PK domain
+pleural fluid
+25.2%
+Dynamic adaptive immune status monitor
+influenza A
+CAR-T cell therapy
+OAZ1
+homo-or heterodimers
+April 15, 2013 and April 14, 2014
+less biased estimates
+environmental and asymptomatic transmissions
+Emory Group
+U. parvum
+Type I IFN
+28
+cough
+likelihoods of the three scenarios of zero, low, and high vaccination coverage
+D~6
+Contact tracing
+phosphoinositide 3-kinase-AKT pathway
+autophagy
+5
+ECDC
+Trizol
+0.2%-1.2%
+Monocytes or macrophages and dendritic cells
+Chlamydiae, Rickettsiae, and L. pneumophila
+plasma leakage
+Almost two thirds
+Maxisorb 96-well plates
+activate b1 and b3 subunit-containing integrins
+Interferon-induced transmembrane proteins
+four
+SAs
+fungal
+early detection and intervention
+reduced the viral titer and increased IFNγ expression
+100μl of the substrate solution
+50%
+His37 tetrad
+1997
+Comp#1
+total protein content
+risk perception and coping
+0.001
+chemotaxis of inflammatory cells
+102
+ELISA
+broad, high-throughput binder generation and deep sequencing
+masks
+unit variance and centered
+mechanic dispersion
+daily
+SG protein interactions
+membrane remodeling
+99% confidence intervals
+cellular protein synthesis
+English
+PAXGENE Blood RNA Isolation Kit
+directly touching an infected host or contaminated surface
+bead-based and real-time TaqMan format
+29
+co-receptor localized near the receptor
+16%
+SIRT1
+one half
+trust
+5%
+pre-analysis data
+mortality
+The pulmonary circulation
+reversed
+thermodynamics
+low-population regions in the equatorial North of Brazil
+QIAampMinElute Virus Spin kit
+antigenic drift
+inflammatory cell infiltration, arterial hypoxaemia and pulmonary oedema
+gestational age and gender
+Handwashing-with-soap campaigns
+CD11c hi DC ablation
+10 μ M
+40.2%
+Reintubation due to upper airway problems
+H. Wardemann, Berlin
+Human metapneumovirus
+detaches kinesin from its surface
+proteomics
+48 h
+H244A
+red fluorescent protein
+60.3%
+6
+TCID50
+Vegetation mapping
+an acute onset and high fever
+Seoul National University Bundang Hospital
+IFN
+ecological
+Microarray data analysis
+hypothalamus, pons, medulla oblongata and spinal cord
+comparisons between variants in different clusters
+HKEGAFFLY
+One hundred and ninety
+three
+Fisher's exact tests
+10%
+after passage
+qRT-PCR
+6.78
+microplaque assay
+controls
+TMEDA
+stress hyperglycemia
+P58 IPK
+the nose and tracheal epithelium of the upper respiratory tract
+a more differentiated cell
+DayPattern and activities
+37°C
+NCTninducible -1PRF
+Within the liver
+codons
+Lewis-type fucosylation
+H4b, H5, and H4a/É 3
+treatment failures
+FimH
+FeLV-A
+medians, 25th and 75th percentiles
+70%
+IL-2 and IL-23A
+proinflammatory
+poliovirus
+virus spread
+higher potency
+future studies investigating the pathogenesis of BV
+HIV-infected women received inadequate information about postnatal care
+0.03%
+α-2,3-Gal
+Epidemiologic contact information
+foraging areas
+comp108520_c0_seq4
+Ae. albopictus
+BLASTn and BLASTx
+Lipid raft mediated endocytosis
+potent and complete
+Power
+polymorphism ss469415590
+β
+Cox proportional hazards regression model
+Reelin
+firmly pinching skin and toes with forceps
+Usability of the system
+aggregate the microbes
+porcine specific T lymphocyte lineages
+278
+QPCR
+transfection of HBP1-SiRNA into HUVECs
+four
+Pharmacogenetics
+two
+PKR expression
+cell death
+~53
+endothelial cells
+specific concerns by various federal agencies
+16
+d
+CXCR3 −/− antigen-specific effector T cells
+methanol fixation
+Cytokines IL-10 and TGF-β
+400,000
+nearly twenty years
+Four
+its small population of only 8 children
+MEGAscript T7
+G3BP1 and HDAC6
+siRNAs
+Nasal and/or oropharyngeal swabs
+cryoelectron
+people who seek medical attention each week
+hemorrhage
+Inhibition
+increased phagosome acidification
+flow cytometry assays
+mononuclear
+12%
+four
+3 min
+18 h postinfection
+Isochorismate synthase
+I A
+spurious functional enrichments
+100 ng/mL
+glial cells
+membrane-bound ribosomes
+44
+Sooty terns
+5%
+kilometres
+Electron beam radiation
+host cell receptors
+more difficult
+glomerular capillaries
+Proliferative diabetic retinopathy
+Indonesia
+3-5 days after infiltration
+Viral RNA quantities and cytokine levels
+1,664
+biological
+Inflammation
+precipitation method
+high environmental contamination
+HIS mice
+14, 20
+rejection of the null hypothesis of neutral selection
+Interferons and IFN-inducible genes
+0.19-1.08%
+the reliability of the microarray analysis
+AKT signaling
+TNF-a
+NMIA
+interaction-based
+Inflammation
+gene expression changes of well-established biomarkers associated to cancer progression
+NSs protein
+a good correlation between infectious dose and measured values
+100%
+CD4 + T cells
+KJ722809-KJ723456
+complex regulatory networks
+lack of trust on the potential use of these samples for financial gain
+0.75 h
+medicine
+5.9-6.3
+A 24 Cruzeiro reference sequence
+safety
+participants' estimation of the actual risk for infection
+50%
+tissue damage and diabetes
+non-radioactive cytotoxicity assay
+0.1%
+5-ml
+Immunofluorescence
+ActA and the bacterial phospholipases
+viral antigenic and genetic characterization
+penetrates
+Interpol
+hypoacetylation
+visited affected communities
+SEIR-like compartmentalization
+3-6 days
+devices capable of being deployed at the point-of-care
+12,500
+The bold letter
+spinning inoculation
+PKR and MX1
+drug toxicity
+plaque assay method
+Au 544 Tiop 204
+viral replication
+metabolism
+tightness of airway epithelia
+cell movement/invasion and proliferation
+autoimmune
+S8-600K
+Proteins and urea
+Ferritin
+136
+data by pairs of participants
+Transthoracic
+spatio-temporal
+pre-processing, filtering and assembly
+IL-1β
+10.5 years
+0.24 s −1
+necessary for the interaction
+p67 phox and IFIT2
+Pi
+Immunolabeling
+cycloheximide
+$87 million-dollar
+90%
+The virus stocks
+double mutant LT
+dropped substantially
+PMS/MTT color reaction
+controls
+D
+increase
+percentage of runs when there is a match
+absence of a zone of inhibition
+data bias
+50%
+culture supernatant
+98%
+3,129
+Plasmodium ovale hypnozoites
+37 C
+nine
+SARS and H5N1
+32
+studies
+lifespan, seed size, seed dispersal, height, and leaf longevity
+between 9 -27 %
+double negative T-cells
+ε A and ε B
+Supernatant
+putative TFBSs
+serum concentrations of selected serum proteins
+high R 2 and weak signal intensity
+pressure injuries
+goat anti-mouse AF 594
+Flow cytometric analysis
+68.4 %
+Detailed primers and PCR conditions
+43%
+heart development
+six-month mortality
+high potassium foods
+increased cancer incidence
+Python
+sputum cultures
+West Nile Virus
+DMSO
+1 min
+two
+bicinchoninic acid assay kit
+optimal pH and temperature, the influence of metal ions and the kinetic constants
+rTM
+margetuximab
+Durban data set
+70%
+episodic diversifying selection
+RNA 3D structures
+Retro-orbital pain and low platelets
+unadjusted
+880
+Antibodies at optimal concentrations
+1999
+NA surface protein
+FAT10
+enhances
+six
+pigs
+NLRP3 inflammasome activation
+Carbon tetrachloride
+Λ H
+10%
+three
+prolong survival of mice
+the community clinic
+acetic acid, ageing and hyperosmotic shock
+opposition, aggression or delinquency
+qRT-PCR
+probability distributions that represent our uncertainty about their values
+25
+equine cases
+logistical
+n = k*N γ
+aerosol pollution
+high fat diet mice
+objectives and strategies
+9.7%
+innate and adaptive immunity
+ClC-2
+Inflammatory and structural changes
+quadratic
+Culture media
+V and VI
+anti-Env broadly neutralizing Abs
+20 years
+disabilities or long-term health impairment
+digitalis
+BIAcore 3000
+Parameterization and calibration
+identifying transmission clusters
+80%
+190
+lead to targeted transduction of specific cell types
+WHO and the Joint United
+spinal cord tissue
+250,000 to 500,000
+>2,500
+Matrix metalloproteinases
+acute respiratory illness
+sandwich ELISA
+31
+CellTracker Green CMFDA and Red CMTPX
+individual proteins
+drastic travel restrictions
+Pakistan
+detailed information on AIV sequences
+poor outcome
+gene regulation
+simultaneously infers structures
+2 pmol siRNA per well
+upper motor neuron disease and peripheral neuropathy
+SDS-PAGE and Western blot
+Concanamycin-A
+0%
+Fig. 6
+90%
+10-40 years
+10 7.2 TCID
+dynamical models
+SWB and physiological health
+Histone H3 acetylation at lysine 56
+registers, recall systems, and target population monitoring
+BD FACS TM Lysing Solution
+macro-and microsteatosis
+AFOP
+229
+Contact tracing
+DTNF7
+10,820
+18.1%
+vector
+2 weeks
+5%
+four
+intracellular trafficking and endosomal escape
+Sanofi Pasteur
+A00-R99
+Nairobi, Kenya
+aggression
+23
+manipulation of resources
+re-expression
+Anthrax lethal toxin
+fetal brain defect
+antibodies or neutralizing epitopes
+40 min
+90%
+nuclear, mitochondrial, and plastid
+unadjuvanted
+Dual labeling
+faster spreading
+mAb binding
+390 million
+.01 or below
+CRISPR/Cas system
+TLR3 908T/C Missense
+by using an ABI Prism
+After the first 48 h
+somewhat surprising
+Prepman Ultra
+Harvested cell extracts
+vaccine development
+Temporal and spatial dynamics of RNA viruses
+Three days
+greater PrfA abundance
+Henan and Yunnan provinces
+ORF7
+Medium containing 100 mM KCl
+proline
+rabies vaccination
+480,000
+immunoinformatics based screening of vaccine target
+unwinds
+12812
+viral copies
+R t
+societal
+FUT2
+PCR-based assays
+saltout
+lipid rafts
+Enzyme linked immunospot assay
+intravenous
+luminescence
+Wilcoxon Rank Sum test
+CEACAM1-4L
+72 h after transduction
+SDP and Illumina BovineHD BeadChip
+fungus contamination
+intra-CDS microRNA pairing
+defensins and cathelicidin
+gene expression
+JC replication
+other residues
+1645
+cGAS NTase activity
+damaged
+Table 3
+the actual rate
+SMARCA2
+human cellular and metabolic processes
+clinical and economic
+P. aeruginosa
+70 µM propidium iodide
+HHV-5
+bulbospinal and corticospinal pathways
+all aspects of the work
+Three
+six
+positive, negative, or bifunctional
+pgsA-expressing vector
+activators of ER chaperone genes
+on-line
+The switch between the two regimes
+inferences of transmission events
+TM
+selection
+fold change from pre-vaccination
+Zika virus transmission
+28%
+30
+A medical director for WYD
+CAFE with a random birth and death model
+taxonomic color-code
+RNA antisense purification
+obesity, DM, statins, glucocorticoids, and shock
+γ −1 days
+alternative activation of alveolar macrophages
+RAD tests
+IL-17 + CD4 + Th17 cells
+Bats
+single amino acid substitutions at each CDR positions
+76.4 %
+EBNA1
+2016
+Clinical and laboratory information
+Food
+Frameshifting ability
+heterodimer complex
+cholesterol
+synchronizing the accumulation of the RNA transcript with the production of the partner protein
+twice
+30 mL agar
+21%
+plasma
+124
+malaria and dengue
+the lower airway
+Qiagen plasmid Giga kit
+0.34%
+RNA
+eight
+a flanking sink
+morphological and biochemical changes
+rhinovirus
+elevated
+354
+mol2db2
+HI metrics
+geographical and genetic data
+RTA
+antiviral
+HLA-A2
+HHV-7
+0.9160.02
+Polyploidy
+Agilent oligonucleotide microarray in situ hybridization plus kit
+affect the calculations
+phosphorylation dependent dimerization
+incorrect administration of medication
+classification ability of the models
+2
+gene expression-p62
+6.50 log 10 GCN/ml
+Polio, diphtheria, tetanus and meningitis
+IAV
+p ≤ 0.05
+NFAT
+BioEdit
+10%
+aromatic organic compounds
+NVSL97-7895 and SDSU28983
+Deletion of GARP on mouse Tregs
+nucleic acid testing
+survival and reproductive success
+nonspecific signs and symptoms that overlap with other infectious diseases
+Randomized controlled trials
+Six
+a deliberate smallpox release
+1 ¡ 2%
+Differential
+0.1%
+physiological
+Phase contrast and epifluorescent images
+c-di-GMP
+two-thirds
+outdoor access and intact male sex
+total RNA
+0.2-25 mg/dL
+Peak protein fractions from C
+sub-group building names
+other species or systems
+one or two
+FDR
+principal components
+reverse-transcriptase SuperScriptII
+197
+Base triple formation
+recent human HCC genomic data sets
+under isoflurane
+57
+thin-tailed distributions
+late in the exit pathway of the virion
+mosquito-borne
+gel shift analysis
+Immunopotentiators
+9.9
+downstream
+deposited sequence data
+None
+Patchouli alcohol
+100 %
+Apoptosis
+component loadings
+microarrays
+Anti-RSV IgG
+31.7Å
+LT
+2MEM
+CD8+ and CD4+
+6,191
+ACE2 levels
+3,340
+conformational
+ENaC
+PML
+web-based
+positive selection
+insulin resistance
+a large well
+75-96
+the presence of neighbourhood hubs
+14.3%
+~20%
+18
+injection of brine with different salt content, and tumbling of the muscle
+5 days
+H7N9
+p38
+Cells or supernatant
+immunostimulant
+LC-MS
+larger bottlenecks
+their use by many distinct viruses
+80%
+severe right heart failure
+50%
+14 days
+megapeptides
+Evolution of the polymerase complex
+to investigate this association by community-based survey
+3C
+Toll-like receptors
+biased observed NC values
+NSDV or GV
+3
+health workers at all levels
+mule deer
+RNAqueous kit
+SYBR Green II
+200+ hours
+Ch+2
+Social cohesion
+late passage MEFs
+50μCi/ml
+antigen dose
+Four
+y = 2.33 + 1.37
+defining and specifying classes
+five
+Ala18, Lys19, and Lys20
+technical issues
+99%
+fTLI and fPLI
+quantitative real-time PCR
+nasal, oral and conjunctival vias
+38
+183
+Kar2/Bip
+Δ
+pi-stacking
+Initiation, optimization and discontinuation
+u G and u D
+5 hours
+bỹ
+both clear and subtle allergic asthma phenotypes
+10%
+10%
+dInosinecontaining probes
+aggressive behavior
+Research
+Caselpa
+Cytoplasmic
+specific residues in the A-Box and B-Box
+A greedy search of the parameter space
+cytotoxic
+single-molecule RNA-FISH
+DNase
+DMD exons 2, 5 and 6
+The first integral
+extremely significant
+Aquatic birds
+Dengue, Yellow fever, Zika, and Chikungunya
+high viral infection
+ACE2
+the expression of most IRG proteins
+340
+NCK-8 and D-LANA-14
+accurate IOP monitoring
+cellular signaling
+psychometrically driven, definition-driven and data-driven
+16
+mechanisms of gene expression
+sepsis and RRT
+Sendai virus
+MTS-based cell viability assay
+Patchouli alcohol
+transcriptional slippage
+shared functional processes and gene families
+UBP1B
+discontinuous minus strand extension model
+IFNAR-1 mRNA levels
+A space filling model of the pentamer
+laboratory test orders
+lower
+2.4 billion RMB
+one
+ISG
+nanometer-sized particles can be conjugated with targeting ligands
+one
+79%
+the final counts
+general body condition and survival
+extensive cell proliferation, tissue thickening and reduced elasticity
+56%
+9.4
+1
+production of IFN-c and other pro-inflammatory cytokines
+H5N1
+vif coding sequences
+reduced production of viral particles
+viral antigen
+PET-CT
+Dry Polar
+rosiglitazone
+Ventilator associated pneumonia
+interferon regulatory factor 3 and 7
+1.6
+Jordan, India, Pakistan, Somalia and Tanzania
+enclosure in purple boxes
+within-farm epidemiological dynamics
+118
+degradation
+plasmacytoid dendritic cells
+sequence differences in the CD4 molecule
+safe
+abdominal incision or laparoscopy
+nPH85
+Mastadenovirus
+z20410
+2015
+f S
+TRIzol
+Bio Med Central
+ATP assay
+sensitivity
+PMC, CST, DXC, and LFX
+SIVsm
+Vaccination
+when injected intranasally
+the basic reproductive ratio
+TNF-α
+1-367 days
+Glycyrrhizic acid and glycyrrhetinic acid
+fitness constrains
+the college animal ethics committee
+coughing, wheezing and shortness of breath
+33.5%
+TaqMan W RNA-to-Ct ™ 1-Step Kit
+one month
+CD40
+herpes viruses
+2009
+IFN-β
+dose-dependent
+Two
+KM233145-KM233150
+age
+miRNA and mRNA profiles
+Quantitative real-time RT-PCR
+Anti-Tbet and anti-Gata3
+spore concentration
+C. albicans infection
+SPC staining in airways
+research
+reactive species
+neutrophils
+less than in adults
+detrimental
+Population coverage analysis
+5 minutes
+1000
+penicillin and cephalosporin
+Eighty-four
+put new labels to a historical event
+random temporal networks
+manual
+Antigen presenting cells
+AI
+Axxora LLC
+0%
+function
+Histidine-tagged recombinant protein
+Cut-3
+pDCs, mDCs and macrophages
+zinc protoporphyrin
+NEP
+regulation of
+weak
+480%
+600,000
+cytoplasmic
+faster and more effective treatments
+Nova virus
+CRISPR/Cas9-mediated genome editing technology
+SEDFIT
+less than 0.1%
+100ng of RNA
+reducing stay-time
+pancreatitis
+50-100 million
+The attenuation of possible unspecific byproducts
+density-gradient
+0.99
+RepeatMasker
+identical
+Mesothelin
+37.8%
+bone breaker illness
+UV-fluorescent
+Shanghai Institute of Cell Biology
+MK825341-MK825344
+RIP1-dependent
+three ORFs
+aggressive or sexual contacts
+170 kDa
+SMN2
+qRT-PCR analysis
+5 minutes
+logistics
+recruit RNA exosomes
+IP-10 expression
+0.5, 1, 2, and 5 pmol
+9.4%
+Prevenar™
+Gates and Bloomberg Foundations
+mice
+high-risk behaviors
+specificity determinants
+K63
+PGF and VEGFC
+412
+nosocomial infections, viral reactivations, and sepsis
+an accurate alignment
+a large number of individuals of two main species
+77.0%
+95
+client aggression
+LDH release level
+western blot analysis
+cellular delivery, stability against nuclease degradation, and side effects
+antiviral intervention
+extreme liberty-infringing methods such as isolation and quarantine
+common sense
+interesting histopathology, gross tissue, or laboratory medicine images
+HHT
+CD11b + Ly-6C lo monocytes
+Day 1 temperatures
+cell viability dyes
+enteric flora
+Population ancestry
+expression
+means to those ends
+R06E-J cells
+two
+airborne
+infection in mothers in contact with children in the home setting
+4%
+log-normal
+high levels of toxin accumulation
+miR-1306 may participate in apoptosis
+the first wave
+crystal violet
+45%
+human respiratory syncytial virus
+A standard curve of H 2 O 2
+Berlin
+nine
+Motifs 5 and 23
+small number of cases with a definite microbiologic diagnosis
+five
+RPMI-1640
+ACE inhibitors and beta-blockers
+within the olfactory mucosa of the nasal cavity
+spatial dispersal
+TNF-a
+Uniform proposal distributions
+riverine buffaloes
+OSHA
+virus assembly and replication
+SLC27A2 and ACSL3
+genomics and proteomics
+surveillance studies
+10%
+infection or alternative diagnoses
+cell adhesion and polarity
+multiplies the likely inaccuracies
+interstitial fibroblasts
+15%
+>90%
+development and maintenance
+chemotherapeutic response
+stress levels
+up to 4 weeks
+Heterogeneity
+QIAmp
+2007
+Rotarix
+Extracts prepared from pomegranate peels and seeds
+Events in the 13 languages
+Data that proved to be positively skewed with heterogeneous variance
+inhibits
+knowledge about the efficacy of masks and hand hygiene
+evade certain plant defense mechanisms
+all types of surface waters where a large number of people are bathing
+homology-independent metrics
+JAK tyrosine kinases
+UbcH8
+10
+knowledge deficits
+dissim 2
+Bead occupancy
+HAV
+48 h
+cynomolgus monkeys
+a single initial line beginning with a greater-than symbol
+2 Å
+regulating the establishment, maintenance and reactivation of latency in HCMV
+genotype 1
+pre-induction of Ifit2 in neurons
+Transcriptor first strand cDNA synthesis kit
+lost income
+swine flu
+All authors
+T cell redirection
+469
+limb and respiratory muscle quality
+The uncovering of associations between hosts and pathogens
+BHK suspension cells
+Eight
+Ceramide
+0.1 r c /τ
+recombinase enzyme
+aberrantly active transcription factors
+Rab11
+models of good public health practice
+humidity
+a natural species
+CLAMS metabolic cages
+Motif and SVM hybrid
+Travel time calculations
+cell culture supernatants
+personal health data and symptomatic staff in the work place
+Bile production
+One flow cell lane
+Mantel-Haenszel χ 2 and Fisher exact tests
+twenty
+Eight
+surface moisture, ERMI values, and Group 1 molds
+2
+miRNAs
+Boolean
+restored susceptibility to cleavage
+70S ribosomes
+three
+designing colontargeted drug delivery devices
+binding affinity
+Germany
+Eight
+serum-free medium
+death
+inhibit two evolutionary divergent members of the PC family
+37%
+Codivergence
+Vectastain ABC kit
+more vigorous and multispecific T cell responses
+three
+99 ± 0.5%
+one-third
+cap-dependent protein translation machinery
+Fractional exhaled Nitric Oxide
+A1555-G1595
+mediates spread of viral antigen to white matter through axonal transport
+diabetic phenotypic traits
+Graph-Pad
+E 338
+Belgium
+24 hours
+ELISpot
+randomization
+Influenza virus
+12
+polymerase chain reaction with Taq polymerase
+Heidi Larson
+The presence of a foreign material
+subclinical prenatal ZIKV exposure and postnatal social stress
+10 min
+S7 Fig
+lung inflation and injury progression
+MFL, IM and SV
+increased transmission
+34
+Resistance to influenza
+NVITAL
+fitness
+12
+sequencing
+underestimation of the seroconversion rate
+it missed the strong interactions from R563
+Clearance of apoptotic cells
+IRF-1 expression
+natural infection
+small changes in filter airflow resistance
+M A and M P
+HPLC experiments
+Targeting the genome of HSV-1
+high virulence of JaTH160
+systematic reviews and meta-analyses of non-randomized studies
+Matrix protein 2
+flow switching device
+two
+proteomic fingerprinting
+liver fluke physiology
+automated instruments and robotics-based techniques
+3 weeks
+increased viral loads
+Experimental cross-protection studies
+Respiratory epithelial cells
+suicides
+lamination
+less than 10,000
+EBOV
+legal provisions
+LoFreq
+eight
+defensins
+Functional antibodies to CS2
+possible undetected imported SARS-CoV-2 cases
+30 min
+pathogenic bacteria
+pharmacists
+angstroms
+random-effects model
+BEESWARM
+Prolonged treatment of PRRSV infected cells with 3-AB
+gammaherpesvirus-encoded lncRNAs
+IFIT1, 2, 3, and 5
+2
+15.4%
+four
+vRNA terminus interactions
+formal
+20 seconds
+orbital reduction factors
+A, B, and C
+impaired branching and deficient alveolisation
+0.38
+Taenia solium
+CRS grade 1-2
+Phylogenetic inference from molecular sequences
+mouse
+2.4 Å
+nine
+wild type A3BCTD
+five
+eight
+BLASTP
+10%
+6 days
+higher serum MDA levels
+cross-reactive antibody responses produced by adjuvanted vaccine
+Jackson score
+decreased food and water intake
+3 to 5 days
+non-human primates
+milk yield, growth performance and disease resistance
+5%
+the cell receptor
+four of 194 tested samples
+reduced
+0.0029%
+SYBR Green I nucleic acid gel stain
+broad-spectrum antibiotics
+Interferon-induced proteins with tetratricopeptide repeats
+tRNA shortage
+Whole blood
+to facilitate band size estimation
+145
+33
+microbes and toxins
+metaanalyses
+Reversed-phase liquid chromatography
+bioaerosols
+BV, LH, HA, MS, and CL
+tachycardia and hypertension
+Macrophages
+GIB-V or ViPR
+43.6%
+5000
+disease spread
+disease severity
+canonical PASs, cleavage signals and GU-rich regions
+serological
+hematopoietic
+negative controls
+Greek indices
+Laor, Wolmer, and Cohen
+RBC
+18
+monovalent aptamer combinations
+G
+characteristic
+90%
+nucleocapsid stability
+R 0 for canine rabies
+higher
+fluorescence intensity
+transgenes
+90%
+extra latent subclasses within an etiologic class
+21.4%
+128
+Inhibition of DNA polymerase α activity
+IL-7Rα + ILC1s
+different strategies based on experimental techniques
+Levodopa
+Three years
+elaD
+within the early trailer sequence
+Weighted Least Square with mean-and variance-adjusted estimation
+7 DPI compared to 2 DPI
+viscoelastic behavior
+0.289
+Univariate analysis
+exon-exon junctions
+Ki-67-labeled cycling cells
+background signal
+EBV, HHV 8 or other herpes viruses
+higher level of FGL2 secretion and increased fibrinogen deposition
+adherence of the RBCs to the F-expressing cells
+ENR-BSA dissolved in 0.5 M carbonate buffer
+25
+DNA corresponding to the target peptides
+Mitigating the spread of COVID-19
+Touchdown PCR
+PRRSV
+Student t test
+95
+>11 million
+pCaMPY-3xHA
+66
+partial or total loss of sensory or motor function in all four limbs
+Sel-Plex supplementation
+WNV E protein ectodomain
+mass spectrometry
+LPS-mediated TNF-α production
+β-actin
+five
+The Tulane University Institutional Review Board and the Sierra Leone Ethics Committee
+3 days
+four types of predictions
+two stable DNA hairpins
+South Africa
+Withdrawal
+454 junior next generation sequencing
+k v
+65%
+until the termination of the experiment
+GraphPad Prism
+immunological
+63%
+variable
+Sendai virus
+immunoregulatory and repairing
+SSEA-1 positive cells
+Vero cell line
+accurate information about the novel H7N9 threat
+20
+induction of ISGs
+Acute respiratory distress syndrome
+0.01%
+Y sim and Y exp
+histological
+Compounds 3e-h
+RTA-mediated promoter transactivation and subsequent synthesis of PAN RNA
+48 hr
+low-density lipoprotein receptors
+sponge-like soft tissues
+up to four months
+NFE2L2
+1953
+21 days
+Are you a sexual partner of an individual
+species abundance
+two on the antisense strand and one on the sense strand
+0.38
+Limitations in the optimization algorithm
+flow cytometry
+IFNLR1 loss of function
+3 days
+autumn or winter
+rs1965708-C and rs1059046-A
+monocytes
+Bonferroni-corrected p-values
+HN
+GBV-C database sequences
+supportive
+7 days
+17%
+more than 30
+FALA GPC and YALL GPC samples
+AB828190
+Expression of reporter protein
+Kodak BioMax Light films
+different stages of the life cycle
+228
+mobility
+1 h
+Five hundred
+Injection of the toxin
+B i and b ij
+reducing the susceptibility of previously exposed individuals
+10 to 78 million
+8.99 pg/ml
+Overall infections
+V3
+six
+splicing of mRNA
+3-5 days
+7 %
+drug diffusion, the PLGA surface and bulk erosion or swelling
+DAPI
+PRISM version 5.02
+three
+Commuting
+5-10%
+Intersection and Union
+firearms
+antiviral plus immunomodulator
+metagenomics, transcriptomics, microscopy, medical imaging and mathematical modelling
+two weeks
+broad-spectrum antiviral agents
+MAbs
+orange
+ADCC
+fitness drop
+The concept of epidemiological confirmation
+a locus obtained by merging two SNPs in LD
+Any descriptions too long for the figure legend
+ANC follow up and feeding option counselling
+vivax
+an explicit formulation
+Adaptive immune responses
+Whole blood
+epithelial barrier damage, exaggerated innate immune response, and cytokine storm
+amyloid
+DMEM
+glycerol, graphite oxide, and citric acid
+exopeptidase dipeptidyl peptidase 4
+32
+31.03%
+CL-2 and CL-3
+PFV Env amino acid sequence
+SADABS
+consensus scores
+higher
+a form to collect online epidemiological data
+Culture supernatant
+14,191
+enhanced transcytosis of HIV-1
+35
+monitoring for signs of postvaccination TMA
+diverse and unpredictable
+activates PI3K-, AKT-and mTOR signaling
+Vero E6 cells
+The entry of viruses into cells
+more severe hepatic tissue necrosis
+Five
+The interface between subunits N 0 and N +3
+improving health care
+1000
+clear steps for mitigating the risks presented by imported wildlife
+The nucleolus
+eleven
+liver sinusoid
+A volume of 256µg mL −1
+Livzon Pharmaceutical Group
+80.3%
+RNA editing
+perturbed signalling
+strategic RA and case-based RA
+$4,804
+blood samples
+PPRV H protein
+eight
+Cell media
+IFNL responses
+6.7%
+ΔG est,i
+77%
+four
+TABA
+natural autoAbs
+VSVs bearing uncleaved EBOV GP
+sleep disturbance, sexual dysfunction, and dizziness
+IEDB prediction server
+MIV boost
+flow cytometry
+0, 1.465, and 0.414
+position 78R
+resource allocation under pandemic preparedness plans
+GraphPad Prism 4
+epidemic
+day 3 or day 6
+Northern blot
+Rounding up of nuclei
+Reverse genetics
+viral clearance
+26 hrs
+1234
+pseudoknot
+generalized immunosuppression
+Induced fit and conformational selection
+14
+host nutrition
+meat or milk, skin, and wool
+214,500
+IRF-7
+interferon regulatory
+phenol/chloroform extraction-ethanol precipitation procedure
+knowledge of r and of the distribution h
+integrin α5β1
+HP-RNase
+1 × 10 5 cells/mL
+40%
+2-fold diluted supernatants
+Public health strategies
+5 μL
+pleiotropic
+haemoglobin
+proinflammatory responses of neutrophils
+Table 2
+7%
+Twenty
+12 hours
+transmission by airborne particles
+a widely accepted score
+heuristic evolution procedures
+The reassortant virus
+three
+16
+milk
+PCR-based diagnostics
+ROC curve
+BD Pharmingen or Biolegend
+24, 48, and 72 hours
+32
+lipoxins
+three
+ISG12-2
+greatly increase FIV prevalence
+a non-ionic and copolymer stabilizer agent
+host ribosome
+scoring
+sequences covered by the identified peptides
+natural herbs
+treatment
+modest
+P.-S.Y. and A.-B.F.
+inexpensive generic drugs
+HIV-1 entry
+PCSK
+The number of sections examined
+FOXP3
+18%
+112
+19
+non-replication of the findings
+health and exposure science
+Increased vascular permeability
+inter-individual differences and increasing age of the birds
+infections
+12
+GEEs
+inadequate
+the products of the catalytic reaction
+cc-by
+81
+Fisher's exact test
+86%
+two
+Nigeria
+96
+50 mM HEPES
+Infection
+27%
+a diarrheic piglet
+passes the configuration information to the parser bean
+differs by age
+autophagy-independent
+viral protein traYc and diVusion of viral infection
+DF-1 cell monolayers
+immune transfer
+Methicillin-resistant Staphylococcus aureus
+tryptophan
+SuperScriptH III First-Strand Synthesis SuperMix
+homogeneous nanoparticles
+four
+interpretation of documentation within the medical record
+one month
+interval distribution g with density g
+HCV pseudoparticles
+T cell lines
+data pooled from three independent experiments at each protein concentration
+18
+a decrease in enthalpy
+Bid
+RIG-I, MDA5 and TLR3
+HIV-TRACE
+cardiopulmonary resuscitation
+ρ I,R
+Negative SHAPE reactivity
+two
+chemically modified antisense oligonucleotides
+very limited
+Odyssey infrared imaging system software version 3.0.25
+UPDRS, SCOPA, or the PDQ-39
+PLINK
+Self-assembly
+>80%
+FMD
+a list of multiple gene products
+targeting CNS recovery following injuries and diseases
+pressor
+P and L proteins
+Receiver-operating characteristic curve analysis
+SRR1
+healthcare delivery goals
+32
+epithelium damage
+identify a set
+IAV, PPV, FCV, and PRRSV
+naïve cells
+events
+139
+Q n
+Other viral and bacterial etiologies
+Toren Finkel
+TargetScan 7.1
+neutralization
+epithelial or endothelial subsets
+calycosin-7-β-glucoside
+microenvironment
+anionic
+NP
+cis-cleavage activity
+HMGN2
+active and inactive conformations
+Phagocytosis
+VEGF
+wild-type viruses
+qPCR
+54%
+different routes
+Application of this procedure
+Seventy-five percent
+Ebola
+HCV replication complexes
+beet western yellows virus
+Official laboratory networks and research consortia
+$25
+46% to 64%
+Demographic population, removals and additions
+1%
+Spearman rank correlation analyses
+an improvement in AHR parameters and reducing specific IgE production
+two ERAD associated genes
+HIV-associated dementia
+ethical guidance and immediate HIS study design
+GAPDH mRNA titers
+functional peptide 11-mer
+Microglia
+proteolytic
+Goat-anti-rabbit IgG Alexa Fluor 594
+5-7 days
+Surveillance programmes
+autophagosome formation
+Four
+Long-term spatial and temporal scaling patterns of human movement
+Prevention before illness
+increase public interest in, and support of, research
+proinfl ammatory
+IkB degradation
+Pharmacists
+geographical
+43
+Comparative Ct method
+Karyopherin-α1
+anatomical irregularity of the foot and environmental conditions
+World Health Organization
+5%
+toxicity and emergence of drug-resistant parasites
+NS1, NS1-70K, and NP1
+FV2 protein
+H77-S
+informed written consent
+Salmonella
+their legal provisions
+MimoDB
+235
+400
+Haemagglutinin
+kidneys and, most of all, the intestine
+Interferon alpha
+blastx
+complete coding sequences
+all tested time points
+monkeys
+transmission of higher molecular weight ions
+TIB
+X-ray crystallography
+wider clinical studies
+spinal dislocation
+59%
+lung cancer
+monocyte-derived dendritic cells
+Pooled ORs and CIs
+Invitrogen Canada or Wisent
+Table S5b
+human immunodeficiency virus
+dietary amino acid homeostasis
+anti-CD3 antibody
+X 100
+two
+ER-association for an mRNA
+85%
+EVs
+Hsp70
+0.5 mCi of 3 H-methylthymidine
+PB2-701V
+810
+Blood
+25 TCR-like antibodies
+canine plasma protein
+NS5
+streptococcal toxic shock syndrome
+increases
+62.35%
+increases production of the acute phase response proteins
+The relationship between RG and BestKeeper
+Attempts to quantify such betweenstrain variation
+negligible
+rather well characterized
+allows the secondary structure of a given protein to be predicted using only sequence information
+3 μL of oleic acid
+lower titres
+Table 1
+substantial
+Sepsis
+Pneumonia
+Pancreatic islets
+PKR-induced stress granule assembly
+17
+a novel nucleic acid isothermal amplification method
+Twelve
+epithelial cell-like
+bacteria, viruses, fungi and parasites
+seven
+3
+1:4
+twenty-four
+Platinum complexes
+Biomarker
+antimalarial
+37,38
+excluded
+500
+IBV
+two fold
+32
+flaviviruses, influenza, and barley yellow dwarf virus
+TgM83+/−
+mitochondrial production of ROS
+C a
+co-purifies RNA and DNA
+98,000
+10% normal donkey serum
+October 2006 to February 2007
+AS-136A
+Infected cells
+IL-17-targeted immunotherapies
+MHV-3-induced fulminant hepatitis
+ICIs
+2019-07-10
+70 years
+one hundred and sixty
+data from functional HA studies
+HTNV-induced IFN expression
+activates protease
+23
+DAPI
+5.1 AE 0.4%
+EDTA
+reverse genetic method
+qRT-PCR using discriminating primers
+antiviral
+More than one criterion
+Contraction-induced injury
+PELOD-2
+proinflammatory signaling
+14 days
+Two-hundred
+robust expression and antiviral activity
+biphasic curves
+carotenoid biosynthesis
+reduced
+lack of immunogenicity above that seen with the placebo
+location-dependent
+PCR purification kit
+the spread of infection
+epidemiological data
+a critical recognition element for host proteins
+a value of 1
+p300/CBP
+pneumococcal
+0.5%
+translational elongation
+Complete polyprotein open-reading frame sequences
+by increasing the inoculum size
+protective
+LIBSVM package
+mixed growth
+DSMZ
+Anti-Flag beads
+the time when the serum was taken post disease onset
+Early evolution and diversification of nematodes
+Plasmid standards
+MP-12-derived NSs mutant viruses
+protective
+separate randomisation tables
+Fixation of mutations into nucleotide substitutions
+non-survivors
+sRAGE
+palmitoylation
+DNA editing
+inactivated by 1.74 log CFU/g
+Okadaic acid
+a defined set of information on the patient history
+A study clinician
+RF
+SOCS3
+six
+how to interface with public health services and resources
+Basic examples of variation
+60 minutes
+agarose gel electrophoresis
+ACT and the AQLQ
+Jugular blood
+binding of antibodies to intracellular, membrane-associated E1E2
+specific ligands
+mRNA and protein regulators
+Glucocorticoid
+median time from data collection to data entry into central database
+1999
+Dr D Piston 46 and Dr RY Tsien 47
+2.2%
+10%
+pulmonary aspergillosis
+7.7
+GRN mRNA stabilization
+PandemrixH
+Fig. 4
+L allele
+52%
+10 3 copies/ L
+Eight
+responses
+QArray2 microarray spotter
+ColorPhylo
+Receptor-binding
+nine
+20
+four
+tissue-specific targeting
+infection
+extended and flattened
+IFNAR1 phosphorylation, ubiquitination and degradation
+fresh fecal samples
+Diagnostic tests
+Antiviral T cells
+vitamin B12 and D depletions, hypothyroidism
+12-20
+proteomics, transcriptomics and other-omics data
+HA
+HBV and HCV
+a naturally occurring product found in a variety of fruits and nuts
+VSV*DG
+one
+PyMOL
+TDL-Vent
+TLR4
+Percoll gradient
+envelope incorporation onto virions
+Parameters b 1. to b 4
+DOPAL
+occurrence
+Influenza
+inflammatory
+glucose moiety
+526
+flawed
+AcmA anchor protein
+neuraminidase-inhibitor chemoprophylaxis
+to facilitate detachment and spreading
+K685 integrity
+12 hrs
+Fecal samples
+Seven
+research materials
+Qiagen RNeasy Mini Kit
+T-705
+data-driven modeling
+four
+multiplexed
+Supernatants from infected macrophage cultures
+solvent
+regulating the cytoskeleton under oxidative stress
+Glya68
+translate specific mRNAs during exponential growth
+evaporated sample
+transmission via aerosols
+as soon as the diagnosis of pneumonia was reached in the emergency department
+47%
+Sequence analysis
+cell phone data
+knowledge
+Hand searching of online journals
+β-barrel
+antibody levels
+a sequence coding for the 24 VP5 C-terminal residues
+extremely rapid transmission
+D199N
+interferon sensitive response element responsive promoter
+2002 to 2004
+feces
+16-18 mmHg
+TRPV1
+to recover the viruses and obtain the cell pellet
+The mucosal immune system
+LAVs
+7a
+southwestern
+CHD
+Representative nanoviruses and geminiviruses
+parvifoliquinone
+U ltraviolet germicidal
+membrane fusion
+nitrocellulose membrane
+transportation routes
+IAV, RSV and HRV
+natural
+CD31positive
+a solution of L 2 H in Et2O
+a γ type RNA-directed RNA polymerase
+TGF-b 1
+1 mM IPTG
+those of the birds to IBV
+identify, consider and report cases of potential concern
+mucus
+14 days
+MG, TO and DIR
+Microbeta luminometer
+polyclonal/mAb
+Helix elongation
+13 474
+current spillover surveillance efforts
+protecting chickens from lethal challenge of HPAIV H5N1 infection
+RT 2 Profiler Array Chicken Innate and Adaptive Immune Responses
+membrane proteins and lipids
+U UUC UUA
+anti-infiammatory
+IL-6
+limited quantity of blood samples available
+143
+Bowtie
+10 %
+13.48 ± 1.93 µM
+cc-by
+SINV Toto1101
+three
+Agouti
+migration and proliferation processes
+LTZs
+C-terminus
+75 mM
+gene ontogeny
+One hundred and forty-four
+Colony Collapse Disorder
+Reed -Frost model
+disease severity
+24 hours
+impaired gas exchange
+Viridans group streptococci
+Novel protection and treatment options
+cells with fragmented DNA genome
+fLAMP
+sympathetic activity
+symptomatic infection
+30%
+The ratio of infectious/total viral particles
+the number of MG participants
+disease detection, control and prevention efforts
+cellular DNA damage
+GW409544
+uncontrolled vascular leakage
+state anxiety
+national parks
+education and information
+spotted hyenas
+four
+γ
+body sizes
+His6 tag
+age and LOS
+Dell Precision™ T5500
+IFNβ
+22
+leukopenia and marked thrombocytopenia
+cigarette smoking
+The model of the HCMV gB structure
+ACE2 enzymatic activity
+Western blotting of whole cell lysates
+simplifies preparing an R project for launching on binder
+an ecologically determined community-level robustness
+Incorporation of Env glycoproteins into virions
+liver
+how well a gene is being translated
+ZL QZ
+H9N2 avian influenza virus
+intracellular compartments
+cell surface HS
+TLR3-deficient mice
+decreased 4-fold
+dried purified product
+hierarchical
+CT
+flaviviral proteins
+Very few
+PRF activity of DU177
+Four
+worse survival
+2019
+Cytokine-induced non-specific memory cNK cells
+LC3-II formation
+five days
+Plausible mechanistic pathways
+a predicted amino acid ABC transporter permease
+autophagy proteins
+tSNPs of CLEC5A
+IL-10
+43.2%
+anti-viral properties
+Toxoplasma gondii
+Plasmids encoding various XRN1 genes
+Poor test sensitivity
+hepatic
+IRF3 phosphorylation
+44%
+4T1 cells
+66
+Wolfram Mathematica and Excel
+disease surveillance platforms
+0.6%
+MetYPCP
+chronically wounded tissue
+herpes simplex virus 1 and KSHV
+Homo sapiens actin
+E123A, K124A, and E125A
+nucleotides 10-11
+4uC
+cell localization and post-translational modifications
+Total RNA from EV71
+Luciferase Assay System
+deep image extractors
+4%
+fungal aerosols
+Cardiac glycosides
+interferon-induced proteins with tetratricopeptide repeats
+IsoMIF
+colony formation of cells derived from primary epithelium
+pleurisy
+Plaque assay
+globally compromised
+95%
+analytical or culture grade purity
+organic matter in aquatic sediment
+52Á5%
+Outbred stocks
+U6
+the average age of infection
+10%
+Infection of a novel host
+IRE1 or ERN1, PKR-like
+Posttranscriptional
+Chikungunya Virus
+four
+inclusion bodies
+American Type Culture Collection
+pre-stacking about dynamic hinges
+Dendritic cells
+,20% of the wild-type mRNA yield
+RNA polymerase errors and from the lack of proofreading
+Bullying
+7-12 years
+Allobaculum
+juveniles
+expansion, range shift and new emergence of animal, plant and human diseases
+mitogen-activated protein kinase
+beta-arrestin
+two
+actin
+donated gametes
+MR899
+L1
+Fomitopsis betulina
+5' amino -modified PEDV specific probes
+Brassicaceae
+cytotoxic
+Climate warming
+a stress response
+75%
+circulating IFN-α
+1983
+coincident
+estimating intramolecular H-bond energy
+recruitment of occludin to the TJs
+∼20 min
+Determining the relative importance of priority setting criteria
+lysosomal proteases
+mitochondrial energy production and metabolism
+anxious or depressed
+cccDNA formation
+CO
+Participants' statements on their perceptions of illness and sickness-related absence
+Liver
+A minimum size or pooled study
+temperature-sensitive
+DNA replication
+metal interactions with the SsTroA protein
+widespread infection
+VP24 and VP35
+23
+>99%
+α6
+therapeutic vaccines
+CLIF-SOFA score
+1x
+Membrane-associated poliovirus proteins
+non-synonymous changes in PB1
+preexisting respiratory or cardiovascular diseases and hypertension
+FAS
+detection of both spiked viruses
+19.5-22.9
+Neuraminidase inhibitors
+CO 2
+Twenty-one
+frameshifting measurement
+chronic pain
+GRADE
+130
+three
+T and I
+1.7%
+pEGFP-C3
+48 h
+immune response and tropism of virus
+Human rhinoviruses
+geNorm and NormFinder applets
+CD4 T cells
+five
+when acutely injured
+endotoxin -induced sepsis
+300
+Interday precision
+surface protein Lig
+FACS analysis
+HIV-1 membrane fusion inhibition and proteolytic degradation
+TLS Pols
+24 h
+the SARS virus
+Autoimmunity
+platelet trapping and consumption
+R292K variant
+Integrins
+Victorian Infectious Diseases Reference Laboratory
+membrane tubules
+saves lives and reduces medical expenses
+PSMA
+Alerting timeliness
+lack of the multifunctional pUL97 protein
+anti-B220-APC and anti-IgD-PE
+nucleotides with incorrect nucleobases
+multiple ubiquitin-binding pockets
+Hsc70
+analysis of their codon distribution
+RNase A and RNase 1
+Streptavidin-alkaline phosphatase
+households
+High viral load
+seabirds
+black
+Negative
+B cells
+103
+reductions in R L and E L
+molecular adsorbent recirculating system and plasma separation and absorption system
+elastin and collagen
+6 weeks
+Internal loop
+37%
+Analysis of variance and least significant difference values
+The knowledge of these peculiar toxicities
+Activation
+agarose gel electrophoresis
+adolescents and the elderly
+Bacterial infections
+eight
+143
+two
+Carbamidomethylation of cysteines
+entry into the mammalian host
+Marburg virus
+Nine
+follow-up testing
+Error
+complement binding and opsonisation
+maximum two days
+areas
+1000
+many output poses
+CCCA
+Nitrogen-containing
+early apoptosis
+88
+9.3
+2
+monkeys
+Zetasizer
+PCBP2 protein
+Influenza A virus
+male
+16S ribosomal RNA
+external transmission rate
+prediction of cell fate
+20μl of MTT solution
+primitive macrophages in the embryonic yolk sac
+India, Pakistan, Bangladesh, and Afghanistan
+Predictive modelling
+Mortality
+16
+5 min
+transcription factors and lncRNAs
+3.6 per million
+38
+hours post-inoculation
+autoimmune
+twice weekly
+frameshifting
+four
+real-time PCR system
+E. coli
+immune response evasion/counteractions
+PMWS
+short-term mortality
+more than 25
+PENK
+No hallmark of infection
+alters
+90
+alpha-NAGA
+superoxide dismutase
+pseudoknot
+Time to in-hospital death
+25 mM cycloheximide
+translocation and subsequent exposure of microbial antigens to lymphocyte populations
+double-stranded oligo DNA
+positive inspiratory pressure
+Macrophages and monocytes
+343
+3 min
+antiviral
+1996
+Trojan
+>−300 HU
+admission to the ICU for severe respiratory failure
+portal hypertensive cirrhosis
+field studies
+negative siRNA control
+secondary structure element and Htype pseudoknot candidate dictionaries
+360 nm
+interferon-related genes and inflammatory cytokine genes
+22
+273
+advantages
+Claudin
+who wears masks
+CD11b
+dromedary camels
+Cation-exchange chromatography
+PDI
+IL-1b
+cell surface expression of both MHC class I and the IL-2 receptor
+culturing
+cholinergic
+presentation and disease severity
+Beads with oligo
+gp350+/CD154+
+high dose of virus inoculums
+boxes-and-whiskers plots
+UXT, RPS23, RPL4, and RPS9
+recall responses
+pneumocytic
+PC1score
+One unit
+leaky scanning and ribosome frame-shifting
+Apoptosis
+30%
+Six
+Clinical endpoints
+Greater than 60%
+23%
+V920
+csk homologous kinase
+Requirement for endotracheal intubation
+preparation of microparticles
+postsegregational killing
+the transmitted field
+NPs or NPCs
+30-85%
+cDNA
+mice, rat and rabbit models
+comorbidities, organ dysfunction or organ failure
+triplicate wells
+embryonic-like
+pseudovirions
+mechanisms of interaction between allergies and hosts
+Rab and Arf GTPases
+distinct spatiotemporal patterning
+lymph nodes
+M2e epitopes
+SEM
+EH
+twice a day
+cc-by
+425-430 nm
+leukocyte count
+significantly delayed
+Hamamatsu monochrome camera
+r n
+G3BP1 −/− mice
+Two
+targeted resequencing
+GAS
+Tetherin antagonism
+51.6%
+inhibit different steps of the life cycle of several viruses
+16
+250,000
+Anti-viral
+Pseudomonas pseudomallei
+The effect of a city acting as a hub of infection
+TOR
+non-inflation of the swim bladder and expanded the gut lumen area
+1 in 750,000 recipients
+cGMP-dependent protein kinase gene
+a suspected cryptococcoma
+epidemic management
+10%
+ten
+symmetrical
+sulfuric acid
+ELISA
+0.373
+decreased levels of isoprene
+LPS-TLR4
+7
+lung damage
+IAV
+biology
+porous materials
+12
+hypertensive rats
+63%
+nanomolar
+Sigma-Aldrich
+dermatology and neurology
+Throat swab specimens
+54 years
+mechano-sensitive transient receptor potential cation channels
+supernatants
+kinetics and magnitude of replicon replication and translation
+Liaison host
+2 weeks
+Nonnormally distributed continuous variables
+10 23
+deep learning and personal and professional mastery
+60 min
+25 to 30 nm
+Human bocavirus
+Ten-fold
+personal resources
+65
+Sokoine University of Agriculture
+ubiquitinated proteins
+enhanced significantly
+helium pneumoperitoneum
+19 to 26
+50 μl of 10% L-arabinose
+mouse DSS colitis model
+0.24 μ M
+Late dumping syndrome
+Twentyfive µL of calibration standard, quality control or sample
+a fourth outcome variable
+solubility and immunogenicity
+PANTHER
+SVM regression model
+Sigma-Aldrich
+an alarm
+exclusive human receptor preference
+unchanged
+woodchucks
+immunofluorescence
+Euclidean distance
+CellTiter Glo luminescent cell viability assay kit
+T cells
+Hajj
+TRIzol
+12
+B cell activation and antibody production
+cc-by
+In Situ Cell Death Detection kit
+The orthopaedic surgeon
+hepatitis A
+Bleeding
+Bellucci et al.
+a simple protocol and buffer set
+technical
+antigen specific
+DNA
+20 µL of 2 mg/mL MTT
+standardized
+CVDs
+macrophages and PRRSV
+a transduction control
+B
+30%
+A single infection
+T HIS PAPER
+no discrepancies
+whole blood
+influenza
+the most common season of HSES -winter
+Parasite-free M199 medium
+Maps
+C. gattii
+mutations
+The ArcGIS 9.3 Geometry calculator
+dispositional optimism/pessimism
+STMV Δ 150
+19
+shared culture media
+p65/p50 heterodimer
+Flaviviruses
+myostatin
+binding globulin
+immune tolerance
+influenza virus-dependent reporter gene expression
+clinical studies in heart transplantation
+glucose and lipid metabolism
+Mean cellular fluorescence
+Toxoplasma gondii
+severe disease, severe congenital malaria and even death
+exceptionally stable
+Iterative HFold
+EGFP
+eIF4F complex
+moderate
+after the functional data were acquired
+it becomes infected
+catabolic
+visceral pain and gastrointestinal disturbance
+80%
+disease
+LVDd
+15%
+different lengths of the polymer
+5%
+Temporary tracheostomy
+45F2 and 42E2
+regulatory
+84%
+differences in hospitalization access
+very low titres of viruses
+Inducible NOS
+increased expression of inflammatory cytokines
+non-classical
+Semi-nested PCR
+PPARγ
+Maputo, Mozambique
+19
+ventilator-induced lung injury
+a plugin for detecting and clustering potentially overlapping protein complexes from PPI data
+viral template
+secreted or bound HSP70
+claudin2
+CD63
+O'nyong-nyong virus
+retention of the downstream introns
+The percentage of cells with sparse heterochromatin at nuclear periphery
+MRE11 nuclease
+viral RNA isolation kit
+three
+two
+higher levels of tracheal viral load
+Expertopinion surveys
+5%
+NeuGc
+further research
+Trp371 and Ile375
+5.3 million
+1-11 µg/g FW
+39.29 and F10 to H5-VN04
+2012
+SIVrcm
+10 min
+72 hours
+foot-and-mouth disease
+149
+plasmid vectors
+bactofection
+head-directed neutralization
+the extent or weight of the correlation in the polymer chain
+SPSS 16.0
+VDAC2
+NS5 and NS5
+hACE2 transgenic mice
+Throat swab and sputum samples
+FLAGtagged construct
+fresh medium
+P. alecto and E. spelaea
+minor variants
+56
+6,200,000
+high-mobility group box 1
+Typhoon 9210 Variable mode imager
+January 2009
+53/169
+Ebola virus glycoprotein
+HAdV-7-induced pulmonary inflammation
+non-egg-adapted
+37 to 56 and 45 to 64
+inhibition of the host IFN-I response
+Sex hormones
+0.005-0.01
+multiplex PCR-based NGS
+28 days
+Nf
+migratory capacity
+entropy
+89.7%
+80%
+Akaike Information Criterion
+diagnosis, prognosis and guidance for targeted therapy
+95%
+a regulator of blood pressure
+SU11274
+sperm signaling pathways
+hematopoietic cells
+Spatial interpolation
+4.0 Å
+Neutrophil elastase
+Peptide-MHC class II binding
+WHO's next Director-General
+resources
+157
+53
+more than a century
+Table S1
+Fifteen
+cysteines
+1.1 mg
+epithelial barrier function
+Mx1
+nonporous surfaces
+incidences
+20
+ODE-and PDE-based approaches
+individual observations at a given time wave
+therapeutic
+spirothizamenthane compound
+NSs
+CR2
+satisfaction evaluations
+species divergence
+two aliquots
+34
+0.7 cm
+platform comparisons and benchmarking
+reduced acute motor deficits and improved cognitive performance
+inflammatory
+a burst of reactive oxygen species
+structural information
+dendritic cells
+40%
+1979
+Ling Gui Shu Gan Tang
+graphs
+JAK/STAT pathway
+grape pomace
+Association for the Assessment and Accreditation of Laboratory Animal Care -certified facilities
+caspase-6
+path-based
+Adenosine triphosphate
+Miro1 expression in islets
+departments or portfolios within agencies
+fresh rat blood
+cc-by
+10%
+Oxone
+explicitly
+Targeting viral RNAs
+World Journal of Gastroenterology
+4-20%
+63
+a mixed type 1 and 2 T-cell differentiation and activation pattern
+ERBs
+HIV linked
+cat-scratch
+VD
+local changes may have gone wrong long before ICP has reached the alarming value
+MRC-5
+FLUAV-HA-mediated
+1.1479
+MolProbity
+macrophages and DCs
+to explore the relationships between variables and samples
+Retinits pigmentosa
+100%
+second half of the year
+splicing correction efficiency
+Sri Lanka
+Compensation of volunteers participating in HIS research
+Point-of-care testing
+Characterization of these porcine transcripts/proteins
+to benefit the reader
+the dystrophin reading frame
+households
+sporulation
+Steroid-associated osteonecrosis
+Site-I binding
+inflammation
+94%
+3%
+begin viral clearance in the lung
+systolic
+90%
+47.97
+Event-based
+First Strand cDNA Synthesis Kit
+temperature, relative humidity, and floor surface moisture
+2005
+annual
+GP 1,2
+six
+Pakistan
+respiratory syncytial virus
+profound damage
+clotting of the circuit
+FlowJo v7.6
+within minutes after administration
+bind Ubc9
+Four
+1413
+combining selection for susceptibility and infectivity
+31%
+codon composition
+estimating seroconversion rates
+rabbit, murine and sheep
+CQR
+36 hours
+5
+7 and 13
+JMP12
+Bactrian camels
+China
+Infection control procedures
+mycophenolic acid
+The size of the highly mobile population
+64
+ColorPhylo
+severe acute respiratory distress syndrome
+hepatocytes cell death
+VZV
+two
+the top of the isopycnic gradient
+PKV
+EISS
+enterovirus and rhinovirus
+Makkah
+to evaluate the influence of LPS modification on PTX3 release
+an outbreak
+92-95%
+wood mice
+impedes viral replication
+proteaseencoding
+terpenoid backbone biosynthesis and p53 signalling pathway
+2.5 million
+Receptor binding
+12.5 µg
+mMSCs with passage number 4-6
+Fisher's exact test
+Cap thickness
+lysis buffer
+more than seven days
+1 hour
+108 nucleotides
+RNA antisense purification
+the certainty of the ME risk
+decreased rotavirus infectivity
+66.8%
+apoptotic cells
+participants' recall
+bottleneck
+Angiotensin-converting enzyme 2
+Five
+hundreds
+eight
+65
+Four
+influenza A virus
+dIgA Abs
+larger
+$0.75%
+Multivariate logistic regression analysis
+confocal
+exogenous PAMPs and endogenous alarmins
+increased values of their associated t test
+phage or cell-surface display techniques
+5.83 m/s
+2009
+RdRp
+Atg8 and Hfl1
+a threshold value
+Guangdong
+Dot blot
+Capsid-gene
+demyelination
+protection
+red
+enhances recognition by virus-specific CD8 T cells
+153
+Sanger sequencing
+2:1
+a viral gene
+spam mails
+H7N7 and HPAI H5N1
+tonsils
+96
+20%
+E2 glycoprotein, and the Capsid protein
+Superoxide radicals
+up to 21 hours
+how upset the patient was
+86.8-93.4%
+male gender
+Pearl River Delta
+307
+6
+home ventilation
+28,184
+18.1%
+3.0 log copies/mL
+RSV
+nine
+the sequence of PCR fragments
+BamHI
+new immunogenic and speciesspecific proteins
+hypothesismodification
+genome size
+four
+region C
+ribosome biosynthesis
+more than 66 months
+0.9677 Å
+CCL2 and PECAM1
+>60%
+ImageJ
+sumoylation of the RRM2 domain of hnRNPA1
+34
+18-29%
+44
+30
+C
+inside the capsid
+CCR5
+WNV
+Locations of compounds
+Hilleman
+Changes in interactions between the P-site loop and local rRNA structures
+DT administration to SiglecH DTR/DTR mice
+acidification inhibitors
+bioactive metabolites
+125
+Total nucleic acids
+1.5
+10 4.6
+AP180 CTD
+Blood cultures
+DAPI
+signal
+Resolution and mobility
+unethical
+overfitting the models to the study population
+20%
+Animal bocaviruses
+Presence of oropharyngeal mucositis
+surface plasmon resonance
+transcriptome
+regulatory mechanism of cell survival and cell death
+Alveolar recruitment
+Tears
+100 μl RANK receptor
+the importance of keeping their children at home when ill
+5%
+46673334
+increased fungal burden
+sensitivity, and throughput
+Data from at least 50 fields per experiment
+88.9%
+lipid tubules
+28
+G4 and other nucleic acid structural motifs
+2-7 days
+binding of polyfunctionalized gold nanoparticles
+78
+a standard curve
+four
+new experimental methods
+Tumbarello and colleagues
+virus morphology
+two
+80%
+host receptors
+Fc-FcR interactions
+individual social structure and movement patterns
+deleterious
+unique counter assays
+4
+Scopus
+NSs
+q f values
+Xenobiotics Biodegradation Metabolism
+6.4%
+PAE
+ZIKV NS2A V117
+Sequencing 99 clones
+74
+two
+32.8%
+I 2
+thousands
+clinical practice
+NCBI Genome Workbench and Integrative Genomics
+LPS
+FPR2/ALX
+50
+sensitization to each linked peptide
+weight loss
+Caspase-cleaved cytokeratin-18
+residential group homes and youth welfare institutions
+The identification of conserved coding and regulatory regions
+Pichia pastoris
+Australia and Japan
+TF-gene interactions
+MC
+kill both younger and older
+> 15
+delayed response
+Constraining the diabetes epidemic
+Nox-mediated ROS generation and Gbp5
+CD8 + T cells and CD68 + macrophages
+NZ European
+Humid conditions
+1977
+ω
+50 nmol/L
+eleven
+MNV titers
+the inclusion of many outliers
+healthy donor scores
+two
+tRNAs
+thinner capillaries and more conductive solvents
+different docking protocols
+2020
+low
+domain swapping
+adenovirus
+tumor-specific IgG antibodies
+CDC
+four
+buried residues
+Two
+viremia and joint swelling
+4,000
+ethical reasons
+20 mmol/l D-mannitol
+infectious and inflammatory conditions
+duration of carriage
+Cryptococcal meningitis
+3a and 3b
+80
+acute respiratory distress syndrome
+16 cmH 2 O
+DLBCL-like
+2006
+high throughput analysis
+20%
+EPEC
+SOS Médecins
+1.49m
+DNA gel elution buffer
+contact tracing
+P875A and P881A
+human rhinovirus
+four
+Community germs
+microtubule growth
+exosomal
+ectodermal
+farm workers
+10.1371/journal.pone.0163377
+Individual-based simulations
+people with chronic cardiovascular and respiratory conditions
+antioxidant and antifibrotic
+70
+hydrophobic peptide/peptide interactions
+TFIIH
+aging
+1%
+Author co-citation analysis
+age, sex, application of mechanical ventilation, and co-morbidities
+HSES
+285
+Community-acquired pneumonia
+five
+iTRAQ
+CC10-treated
+infectious diseases
+À1 ribosomal frameshifting
+Phu Tho province
+Interferon-gamma
+negative
+Dromedary
+TaqMan microRNA reverse transcription kit
+10%
+corridors
+Pneumonia
+organism spatial structure
+91
+CD4 T cells
+kaempferol and isorhamnetin
+3A visualized by coexpression of GFP
+2005
+DDX19
+mood disorders
+>5.0
+percentages of existing data
+Data
+Expression Array Manager
+HIV-specific qPCR assay
+to statistically assess the prevalence
+translation efficiency
+six
+viral encephalitis
+MyD88-and TIRAP-dependent pathways
+Methionine
+C-C motif chemokine receptor 5
+Antisera specific to viral GP1, GP2, and NP
+flavivirus NS2A protein
+Differences in daily transmission probabilities
+PFT group
+replication in infected lung tissues
+dilution factor
+Travel bans
+GraphPad Prism 7.0
+free energy
+4 C 2 repeats
+three
+Src
+B-cell epitope
+partially truncated NSs
+HSP-70
+B. mandrillaris
+G-protein-coupled receptors
+MTT assay and In vitro Immunomodulation Determination
+a pathogenic Nocardia
+an AUC score of 0.879
+complex
+Atg8
+Forward primer OS and reverse primer IAS
+15 months
+necroptosis
+complete spore survival
+0.5 ml/min
+ArfA
+ρ i
+hemodynamic stabilization
+research risks
+HO-1
+does not induce an IFN response
+mice and humans
+stronger mRNA secondary structure and slower translational elongation
+seven
+DTZ staining
+Removal of the incorporated radioactive label of ARTD10cat
+regions R4 and R5
+a subset of IFN-induced genes was upregulated
+Sigma-Aldrich Corporation
+red
+Shannon index
+PE9/PE10
+compartmental models
+188,496
+MILLIPLEX Analysis 5.1 software
+49
+Her new baby
+85%
+emergency food
+viral particles
+furin activity
+Nitrogen
+DC-SIGN
+Germany and USA
+antibody-escape variants of seasonal or novel influenza A viruses
+25
+posttranscriptional
+Toll and JAK-STAT
+geopolitical conflict
+Y 2
+confounding by population structure
+cellular networks
+Table
+foot-and-mouth disease
+identified priority actions
+hematological
+QoL
+HCDR2
+Animal lectins
+Hemodynamic alterations, hematologic change and, immunologic response
+pp120/HA4/ecto-ATPase
+social distancing
+immunosuppressive molecules
+639
+many factors
+a number of requirements
+Monte Carlo Markov Chain simulations
+The importance of environmental contamination
+logistic regression analyses
+Figure 6
+Urinary vanin-1 and/or NGAL
+four
+cough and pathologic pulmonary sound
+MaxQuant
+most or even many ways that such an estimation protocol might be conducted
+Japan
+trace-back from data based information to hard copy
+Galactomannan
+WHO
+Protein complexes
+mobility model
+exothermic
+epithelial injury
+template size of amino acid sequences
+India
+Guangzhou
+seasonal infection networks
+more than a dozen
+abnormal trafficking
+High tidal volume and minute ventilation
+Pneumonia
+In-Cell Western analysis
+a particular confined area between the two other groups
+discomfort versus safety of risk
+Critical Community Size 26
+host-and virus-specific factors
+time from study drug initiation to time of symptom alleviation
+Antifreeze proteins
+Hypertrophy-related miRNAs
+Increased oxidative damage
+Twelve µl of extracted nucleic acid
+poor mucosal antibody responses
+HAI or RT-PCR
+Circulating levels of SP-D
+red, yellow and green
+wild mice
+Efficient cleavage by the P1 and P1a proteases
+LPS/TNFa/IL-1b-induced apoptosis
+HTLV-1 protein expression
+CD8+ T cells
+1,562
+avian influenza virus and murine norovirus
+Rapid, efficient and cost-effective protein expression and purification strategies
+lysophosphatidic acid
+VER-155008
+phenylalanine
+allergic sensitization
+RSeQC
+early PVR membranes and retinal blood vessels
+Risk perception for becoming ill
+2009
+folate receptor-α
+binds and sequesters dsRNA
+6AAF and 6AAG
+570
+Multifunctional
+HLA and CFH polymorphisms
+postoperative scores
+degenerate primers and MGB-modified probe
+A summary
+8 h
+N88 on gp120
+14 days
+organic compounds and energyrich fuels
+7120
+Twista Studio Software
+specificity of the antibody-targeted approach with bacterial luminescence
+Olig2 nuclear immunoreactivity
+Cell-Titre Blue kit
+lung dysfunction
+p3xFLAG-Myc-CMV-24 expression vector
+roads
+Diagnosis
+35 years
+electron density
+the tip of the USP Fingers subdomain
+1996
+host proteins
+alterations to gut barrier function and impairments in nutrient absorption
+the absorbance activated droplet sorter
+MP-12-R16H/M250K-infected cells
+technology assessment committees
+Infections
+FR901277
+proteostasis
+proteases
+Newcastle disease virus
+Total RNA
+negative
+trauma
+100%
+1 h at 4uC
+HTLV-1
+3.5%
+H3N2
+four
+yeast ribosomes
+non-dividing cells
+the probability of an event occurring, and the effects of that event
+PAD4
+134
+uncapped viral RNA transcripts
+critical
+enveloped
+19
+haematophagous
+rabbits and hamsters
+hypoglycosylation of LASV GP
+1:6 to 6:1
+21616 TT
+acute myocardial infarction and cerebral ischemia
+101
+UVC light is likely to be effective against all airborne microbes
+WeChat and Qzone
+enhanced chemiluminescence
+The TPR motif
+11
+sequencing bias
+autophagy
+significantly higher
+logistic regression
+3 cos 2 À1 2 D E
+changes of scores of symptoms
+Nagoya Protocol
+increased white blood cell count and an increased neutrophil count
+significant reductions in titer
+a discussion about the structural differences between the two HEV virion types
+to calibrate the selected model
+FGL2 and fibrinogen deposition
+lameness
+HCV nonstructural proteins
+64
+Hes1
+health care professionals and the general public
+County of origin
+viral swabs
+ferrets
+plaque assay and ICID 50
+rats
+inflammatory networks
+IFN-responsive
+Islamov R. and coauthors
+110
+Eight
+87.4%
+luciferase activity
+96%
+RNA concentration and purity
+mannandependent pathway
+Two
+15%
+chimeric humanized mouse livers or primary human hepatocytes
+Vratza endemic regions in Bulgaria
+Cell Signaling Technology
+no relapse occurred during tapering steroids
+2.486
+75%
+AcmA
+ImageJ
+dual-targeting drugs
+67 out of 517
+components of the human services delivery system
+Group 2
+Haplotype effects
+low
+220 nm-500 nm
+small foreign peptides
+ABPP
+functional
+QÞ
+DAPI
+JEM-2200FS transmission electron microscope
+30%
+to block non-specific protein binding
+modern advanced delivery techniques
+confidence interval calculations
+Bracorhabdovirus
+RSV infection
+Ten
+increased genetic variability
+phosphorylation and citrullination
+125
+Central/East Africa
+Three
+A serious disease or condition
+Open and closed triangles
+three
+Scatterplots
+sequencing
+20
+20 min
+MeV RdRp
+miRanda and TargetSpy
+Ligated DNA
+inactivated, subunit, and live attenuated vaccines
+ILTV persistence
+Cuffdiff
+induction of p35 mRNA
+Acytostelium
+Plasmodium falciparum
+ubiquitous or tissuespeci fi c promoters
+Figure 5A
+TuMV P, FSko and ΔGDD mutants
+plasma samples
+resting microglia
+Beclin-1
+tnf-α, il-1β and il-6
+Simian tissue-culture adapted rotaviruses
+type I and type III
+19%
+Zaire
+G418 selection
+In-tAct
+Mining activity
+Arboviruses
+71%
+oxidative stress
+over 3600
+cellular defenses against pathogens
+tissue culture plastic
+concurrently
+2.90 ± 36.3 μM
+how to evaluate One Health processes
+age and weight
+higher invasion activity
+folate receptor-α
+GRSF-1
+P. vivax
+NanoDrop ND1000 spectrophotometer
+signal
+noradrenaline
+11 477
+increased expression
+RNA oligonucleotides
+6.5 µg/ml
+36.9 million
+1978
+6C
+IL-17-producing type 17 CD8 + T cells
+binds ISG15 conjugates
+White blood cell count and differential in the lung lavage
+I-TAC and IP-10
+more accurate and timely measures of AEs
+analysis of mathematical models
+Lipinsiki's rule of five
+four
+Heat exposure
+detectable
+seven
+FGF2 expression
+24 h
+NaCl particles
+Young age
+12 to 15 months
+Mnda, Herc6 and Cd274
+principal component analysis
+protein ubiquitination
+Three days
+Total RNA
+MEWDS
+to identify an optimal decision boundary
+EEG and GSR
+M4RT medium
+exemplary care
+statistical analyses
+fever and other symptoms of SARS
+29
+transmission of directly transmitted parasites among moving hosts
+210
+a His tag
+23 %
+an internal domain
+Bell's model
+SCO6450
+viral load
+Culex pipiens
+PLA2
+6%
+17
+CTL activity
+RNase H
+between day 6 and day 8
+Complementarity
+self-renewal of ES cells
+Spearman correlation analysis
+genomewide single-nucleotide polymorphism arrays
+coinfections
+20%
+EFA
+University of Pennsylvania Institutional Animal Care and Use Committee
+eight
+Students t -test
+cavity definitions by VolSite
+11
+permeability, affinity, selectivity, and cytotoxicity
+Positive mode electrospray ionization
+Excess fixative
+three
+neurodevelopmental
+Influenza A virus hemagglutinin
+c ij
+Neutrophils
+primates
+pandemic or reducing the AR
+7
+1 %
+five
+70%
+passerines
+0.3%
+protective
+nuclear extract
+microscopy
+SAS 9.4
+Antiβ-actin mAb
+63
+Wide-ranging
+an RNA that has all the genes required for replication
+Service/ operation volumes
+27
+30 minutes
+one million
+dead cells
+Three
+Two weeks
+Percutaneous transmission with sharps contaminated with infected bodily fluids
+4.2%
+diarrhea scores and diarrhea rate
+0.687 to 0.861
+cells lose the ability to form caveolae
+post-translational
+four
+142,407
+906,600
+lipid
+aPKB
+activated partial thromboplastin time
+Polysynaptic VSV vectors
+Isobaric tag for relative and absolute quantitation
+CCHFV
+two
+population density
+suppressed
+NanoDrop 2000 spectrophotometer
+six
+acute and subclinical
+Iranian
+40% to 50%
+one-third
+erythrocytes
+Scotland
+a pandemic
+further exposure
+biological
+β-blockers
+equifinality
+comparative LOD analysis
+red and blue
+selection
+Primary endothelial cells
+inverted microscope
+intracellular
+Reed and Muench
+attenuated immune response
+Weasel w 2.5
+phylogenetic distance between pairs of DRB1 alleles
+D/N -GFP Rab5
+Ningnanmycin
+IFN-b production
+9.0
+confidence intervals
+gas-phase fractionation
+Infected cells
+better optimization of MSC-based clinical treatments for inflammatory conditions
+three
+mice
+∆∆Ct values
+immunomodulatory
+plasma samples
+statistically similar
+4.4 ± 3.08 days
+dengue infection and yellow fever vaccination
+Bioluminescent
+IFN-α induced signal transduction
+GST
+more relevant information
+maintenance of a cold chain
+CD4+ Th9 cells
+Sizes of molecular weight markers
+B lymphoid malignancies
+Glucose oxidase
+accurate mass and time
+HCV
+0.7-fold
+preventing TB
+Parasitic infestation
+NEDD4, UBE3C and HECTD1
+higher than most of the metastasis samples
+3 days
+A 1 and A 2
+Ty-1
+mosquito
+1 month
+above 97%
+>60%
+IL-10 producing T cells
+macrophage polarization progression
+factors associated with each setting
+three months
+lower
+human immunology
+95%
+RNase A
+polygonal and dendritic-like
+increase its weight
+6
+random
+emergency medicine systems
+earlier diagnosis and initiation of antibiotic therapy
+V1V2
+feedlots
+transient confinement zones
+heterodimeric
+metal-based electrodes
+Prediction of T Cell Epitope NetCTL 1.2 server
+GraphPad Prism 5
+Antigenpresenting cells
+IC50
+Statistical
+MMPs
+Tecan Infinite 200 Pro
+α
+immunofluorescence assay and viral plaque assay
+FACSCalibur
+EBV, HSV-1, CMV, and VZV
+Four
+IAV cellular entry
+26
+The Journal of Infectious Diseases
+memory B cells
+Monocytes
+statistical reasons
+IL-6
+automated instruments
+Carboxyfluorescein
+4-6 weeks
+balance community
+Plasmodium
+serious danger signals
+reduced
+Signatures identifications and isolations of bio-particles
+π
+appropriate care and treatment guidelines
+Accell Cyclophilin B siRNA rhodamine labeled
+3
+35.7%
+viral replication
+DIP, NSIP, and LIP
+RVFV NSs
+leukocytes and tumor cells
+Candida 2H system
+immunodeficient NSG mice
+CELIA
+C-type
+antidiagonal and bit-parallel algorithms
+Host-target directed antibodies
+HIV amplification
+10%
+fitness for growth in monolayer culture
+integrating information from multiple ProSeqs
+5-amino acid CDRL3s
+enterovirus replication and PI4KB recruitment
+social status
+Spo0A
+7-7.5
+Systematic review findings
+rats and mice
+Infectious Bronchitis Virus
+agarose gel electrophoresis
+Airway and interstitial T RM cells
+it becomes infected
+mechanical ventilation
+proteins and nucleic acids
+pGEX-4T1 or pDEST17
+Image-Pro
+policy decisions
+to save editorial space
+4,390
+DNAzyme sensor
+land-use diversity
+R
+189
+to elucidate mechanisms of ALI pathogenesis
+Traumatic brain injury
+USP46
+Neutrophil accumulation in the myocardium
+alveolar epithelial cell
+PKR phosphorylation
+$3.81 per pool
+2 years
+Total RNA
+EF-hand Ca 2+
+nonstructural viral proteins
+nineteen
+H1N1
+unambiguous translation to trauma
+cholesterol concentration of the endosomal bilayer
+CD47 and CD31
+lipids
+within months of measles infection or vaccination
+Hubei
+2005
+Translation from the virus-or cell-like transcript
+inhibitor I9
+93% ± 3%
+2
+lung cancer, ARDS, pulmonary hypertension, pulmonary tuberculosis and silicosis
+IFIT2
+being too busy
+three
+the wide range of competing AIV subtypes
+national income differences
+cytoplasmic tail
+Neutrophil elastase
+anti-viral
+size, density, charge
+Mouse anti-HLA-A mAb
+ATP
+H7N9 RNA
+rabbit
+poliovirus RdRp
+the antigen gene
+24hrs
+Blood banks
+bring the reproductive number reliably below 1
+dendritic cells
+three
+26
+ANN algorithms
+quick door swing
+three
+high or low affinity
+Strongyloides stercoralis
+Blood and saliva
+cc-by
+Phoenix Pharmaceuticals Inc
+45
+Initial tool development, Pilot study and Validation study
+improving the health status of Canada's indigenous populations
+172,371,088
+250,000 mL −1
+ρ * → 0
+reduced cell binding
+Supernatants
+SINV-G mutator RdRp
+Paramagnetic Relaxation Enhancement experiments
+autophagy
+38
+>97%
+46
+suddenness and unpredictability
+partial pressure of oxygen in arterial blood
+virus shape
+27 to 35%
+four
+Codon
+homologous lysine residue
+4
+infection of cells with WT LCMV
+BUNV infection
+Glycosylation of GP2a and GP4 by glycans
+inflammatory
+DAP12
+critically limited
+artificial respiratory management
+13
+human diseases
+multigroup model
+plasma membrane
+Gaussia luciferase
+FESL SPC PMR ACF ED
+six
+G GP
+tetramer
+other lung function variables
+150 mM NaCl
+d ij
+20 μl
+overall survival
+green
+dyspneic
+Reed and Muench
+aromatic substances
+The HRC index
+CD39 and CD73
+PTMScan ® Ubiquitin Remnant Motif Kit
+improved cross cultural communication and improved rapport
+Neutralizing antibodies
+Infection
+BTV1-conferred autophagy and virus replication
+cough, difficulty breathing, and cough with vomit
+interest
+MOV10
+Eight
+innate
+Bias
+specimen transport media
+exclusion of other co-morbidities
+our technological limitations
+Loop primers and stem primers
+APMV-1
+predator
+Mapping land-use classes
+independently analyze all field notes and focus group and interview transcripts
+140 min
+pig convalescent-phase antiserum LL616
+10
+Pearson's correlation coefficient
+Mouse sera
+statistically significant
+singly mutated HN molecules
+251
+antiviral efficacy factor
+1000 TCID50 of a reporter-expressing Ebola virus
+rat
+mechanically ventilated
+further studies
+N-acetylglucosamine of GP
+an estimate in an academic report
+musculoskeletal
+less than 1 year after initiation of the immunization campaign
+mocktreated 2fTGH and U3A
+Culture supernatants
+~10 -9
+Forty-two
+nanometer and microsecond resolution
+blue
+Genespring statistical tool
+Reassortments of the 6 internal gene segments
+23.4%
+positive
+Bayesian network
+150
+culicids
+scattered transmission
+Poly I:C and LY-294002
+15 amino acids long
+Female
+full compliance of patients with screening recommendations
+viral RNA-dependent RNA polymerase
+Bio-Rad Protein Assay
+0.1%
+asthma
+suboptimal
+the effect of resolution is most important
+Soluble receptors and ligands
+mutant prevention concentration
+twice
+electrostatic interactions
+A calibration standard
+LoFreq
+10
+unpaired, two-tailed Student's t tests
+Whiskers
+mean and SD
+20 µL of a 2 mg/mL MTT solution
+10,000
+E2F1 and p75NTR
+TMPRSSs and PRSSs
+Society of China University Journals in Natural Sciences
+to encourage new research
+2019-nCoV
+increased
+30 min
+negligible
+1974
+10 days
+three
+183
+Escherichia coli and Klebsiella pneumonia
+R 0
+76
+seven
+Retail live-bird markets LBMs
+molecular module similarity
+EBOV infection
+One Health collaborations
+Forty-five
+along two relatively narrow ridges
+expand somewhat more rapidly
+SO rats
+Doctors without Borders, Partners in Health and the Red Cross
+42%
+M2 82 -specific
+Proteoglycans
+2004
+several infected contacts
+EpiData software
+0.47 and 0.37
+a 4-nt step
+agarose gel electrophoresis
+slows down
+quantitative
+Health Hazards
+proteasomal degradation
+Interferon-c
+more than 30
+murine pmacs
+eight
+194
+unnatural modified nucleoside analogues
+mean accuracy
+linguistic approaches for named entity recognition and named entity disambiguation
+cellular membranes
+clinicians
+assemble with 3A and/or become fluorescent
+The Norwegian Directorate of Health
+Ubiquitin-specific proteases
+chymase
+age, SOFA and diagnosis of influenza pneumonia
+hemagglutination-inhibition assay
+three
+chloroplast genetic engineering
+Astrovirus MLB3
+ESSENCE
+Nanosep® Centrifugal Filtration Devices
+3.5-4.0 x 10 4 cells/cm 2
+RNA content
+ACTB and GAPDH
+one
+genes associated with resistance to the antibiotic
+similar seroprevalence
+Blood transfusion
+White Plymouth Rock chickens
+Two hundred
+PLGA-NP-based vaccine delivery
+cc0
+statistical significance between groups
+Hepatocytes
+bite
+EBV
+GeneJET Gel Extraction kit
+21.7%
+Black background
+Recycling of the ribosomal subunits
+Ly49H
+Application of DisProt 11
+alloactivation
+A, B, C, and D
+paraseptal or irregular emphysema
+suicide
+FLUOstar OPTIMA plate reader
+Rebecca
+PRRS
+292V/I
+18%
+4%
+hundred microliters of inactivated PPRV Nig75/1
+10-cm
+5/5 homozygous
+two
+stochastic
+bromide stained 1.5% agarose gels
+620
+d max
+12
+2008
+viral NPs
+spina bifida and anencephaly
+Critically ill
+1.62 +/-2.13 and 9.82 +/-9.88
+Allometric scaling of peak VO 2
+Amyloid-b precursor protein
+immunohistological detection of MR
+VSV and NDV
+4.9%
+Specific human pathogens and antibiotic and zinc resistance genes
+influenza
+153
+long-term functional impairment
+hydrogen bonds
+Eleven
+herbal
+France
+hydrolysis
+s-RT-MELT
+age distribution
+many orders of magnitude
+5 to 6 days
+Asiatic citrus canker
+cytotoxic
+Porcine reproductive and respiratory syndrome virus
+increased BC risk
+AS and SW
+Lineage Modification
+to use sensor array signals to diagnose VAP using the machine learning technique
+PBMCs
+6.8%
+Exosomes
+NSDV
+discovery SNP and rs4803217
+viral infection
+38, 377
+a positive mismatch situation
+Health security
+cytotoxic
+five
+infection
+Active exclusion of proteins from the MW
+Murine Ifit2 protein
+See Tree
+Supplementary Data
+draining lymph nodes
+AlamarBlue
+15
+0.9832
+39
+Adenoviral vectors
+1 h
+host selectivity
+the standard deviation of the mean
+total RNA enriched for polyadenylated RNA
+Vim KD cells
+protein thermal stability
+4
+Mechanistic models
+heteroatoms
+degenerate oligonucleotides
+Gaithersburg, MD
+1.05
+18.8 days
+unidimensional
+mean total SOFA score
+reverse transcription-quantitative PCR analysis
+P 0
+ECMO
+Risk evaluation
+bacterial vaginosis
+Leptospirosis
+comparison with related studies
+a disease with a reproductive ratio R 0 = 1.75
+delay the infection progression
+HCV replication and core protein expression
+Threonine
+a fraction
+migration/invasive and soft agar colony assay
+autonomic
+virulence
+1918
+0.4-0.5
+full epidemic model
+Wild-type VSV-M protein
+3
+side, and end-on perspectives
+165
+70%
+7-8%
+hypertension
+100%
+entry that results from fusion with the plasma membrane
+Invasive cells
+Santa Cruz Biotechnology
+LAMP technology
+cell function
+40,000x
+4.16E-4 substitutions per site per year
+CRTC1 protein is stabilized in HBV-infected cells
+Increased intracranial pressure
+two
+1,593 bp
+Kruskal-Wallis test with post hoc Dunns analysis
+lack of resources, equipment or staffing
+stratified analyses based on such clinical characteristics were not possible
+pneumonia
+over one million
+Vero cells
+infection of Y. pestis 1418
+AR50_59
+contact-related covariates
+disappears
+genomic RNA
+formal risk assessments
+potential coding sequences
+kinesin-1 motors
+F 0
+24 hours
+sterility and absence of mycoplasmas
+1.5%
+SwissProt_Human database
+Visualization of the temperature factors
+alveolar collapse
+extracellular matrix
+C i
+64%
+RT-PCR/hybridization
+Poisson offspring distribution
+Fluoview
+Mitochondria Isolation Kit for Cultured Cells
+BLASTP
+13 to 56%
+Glu92
+SIR-type compartmental models
+vitamin D-binding protein
+northern France
+0.332
+One Health
+significant differences
+four
+non-formal educators and NGOs
+PF
+virologic
+virus-like
+bidirectional
+more than 1000 miles
+independently from neutropenia
+death protein 4
+MSC-CM treatment
+Europe
+viremia
+premorbid illnesses
+nt 515-554
+60%
+adenine
+96%
+Cl13
+diseased as well as healthy cattle
+69.2%
+297
+Qualitative research
+The expression level of individual genes and transcripts
+random forest
+transforming growth factor beta 1
+HSMPD
+Annexin V or Fixable Viability Dye
+STAT2
+78.6%
+95%
+Packaged +ssRNA
+285
+strengthen the public health system
+false alarm
+attenuates the inflammatory response
+individual scientists
+x k
+China and Southeast Asia
+marmosets
+FV10-ASW
+eukaryote adhesion and proliferation
+prophylactic
+genetic instability
+phylogenetic
+Growth rates
+T6SS-5
+FRG triple knock-out mice transplanted with human hepatocytes
+5%
+GFP
+stimulated only minimal, statistically insignificant, changes in the levels of immune stimulated genes
+sodium sulfite, EDTA, and transmissibility
+managing and analyzing large amounts of gene expression and mass spectrometry data
+27
+Ascosphaera apis
+H5N1-encoded miR-HA-3p
+actin control bands and PTC
+intramuscular immunization
+integrating community healthcare centers and clinics
+trypanothione reductase
+organ failure, infection, and GVHD
+0.2 mL/min
+network structure with response logistics
+individual probabilities
+differing codon usage preferences among sequences under comparison
+pre-cooled THF
+refrigeration
+subgenomic mRNA synthesis regulation
+two
+Forty-eight hours
+1.4%
+frameshift stimulation
+100%
+Twenty-four
+E1 protein overlapping peptide library
+128
+6.5 billion US dollars
+TBK1 phosphorylation
+hydroxyl
+Local transmission and clusters
+FDR threshold of 0.1
+100% confluent BSR cells
+Qβ bacteriophage virus-like particles
+less than 20%
+covalent probes
+single stranded monoclonal beads
+forced expiratory volume and FEV 1 %
+three
+W275A
+group 2 lesions
+condensation of the rDNAs
+Live vaccines
+80
+fused LOB7
+1.5 hours
+positive hits
+ESCRT-driven
+250 000-500 000
+IFN-λs
+zinc finger nucleases and transcription activator-like effector nucleases
+virus swallowed during inoculation
+Fig. 3
+CEACAM1+CD4 T cells
+HBV infection
+SV01 and SV02
+alveolar-capillary barrier injury
+3-5
+loneliness
+2 weeks
+500
+Targeting virus molecules
+intubation rate
+two
+12 hours
+2.5
+613
+one Au and two thiolates
+stress responses and transport functions
+THP-1 cell viability
+ImageJ
+changes in amino acid residues
+substantial differences among age groups
+3 days
+Prohormone convertases
+luciferase
+flow cytometry based neutralization assay
+β-actin expression level
+morphometric analysis
+Two
+Burkholderia pseudomallei
+extremely strong selection
+Eosinophil infiltration of the skin
+30
+adaptive Treg differentiation
+3 h
+50%
+apoptosis
+approach
+ENC
+1 h
+vesicular stomatitis virus
+0 to 6
+Endotoxemia
+40S
+RPV coat protein primers
+twice
+adjuvants
+oropharyngeal lesions
+gene duplication
+10%
+52.6% to 54.9%
+number of cell divisions
+Peripheral blood mononuclear cells
+through an iodixanol gradient
+higher airway pressure levels
+1.5-11.3%
+Student unpaired t test
+G 0
+Gulls
+12 to 51 h
+6,467
+eosinophilia and neutrophilic alveolitis
+zero
+other
+CCL2 and CXCL10
+220 mg/
+confocal
+three
+E. festucae
+MERS-CoV
+Plasminogen activator urokinase and integrin beta3
+DNA
+membrane curvature
+3
+cytoplasm
+Globalization and Health's 'Open Access' policy
+seroprotective responses
+a physical barrier
+Bayesian hierarchical model
+an observed morphologic change that differs from control or normal tissue architecture
+immunity and inflammation
+early 1950s
+economic and cultural pressures
+mTOR inactivation
+Student's t test
+possible change in the case mix
+pneumococcal vaccination
+docking analysis
+Macrophages and microglia
+sexual transmission
+Labeling of olivocochlear fibers
+ethidium bromide staining
+>80%
+De-MAND and DE analysis
+20 s
+MS endothelial cells
+99%
+10%
+QIAamp Viral RNA Mini kit
+5 min
+46%
+Avian influenza virus
+31
+Five
+cough or fever
+natural disease
+tRNA identity theory
+English
+1.37%
+Water
+39
+One hour
+pulmonary fibrosis
+they can describe a wide variety of errors
+AIV and AAVV-1
+80%-90%
+growth
+9.1 ± 0.5 particles per milliliter
+outbreak detection
+Quantitative northern blot analysis
+autophagy
+CSP
+infrastructure
+a directly transmitted infection and a vector-borne infection
+0.2%
+phosphorylates ERK1/2
+three
+12
+passive
+Lowry method
+6 V/cm
+plasma proteins
+which communities will be slowest to recover
+JFW, AJZ, and KYY
+twice daily
+cc-by
+64 and 68
+leukodystrophy and hypomyelination
+40%
+45%
+35%
+cell death
+to analyze viral recombination in a live host
+HCC occurrence
+RNA-protein interactions
+4,240 pg ml −1
+Steps 3 and/or 4
+two
+radiographic
+Febrile myoclonus
+photoreactive dissolved organic matter
+Promega CellTiter luminescent cell viability assay
+Epitope accessibility
+DISC-HSV
+two
+HAdV DNA
+non-specific psychological distress
+1 h
+CFE containing WT or mutated eEF1A
+ventilation
+50 µL
+protein stability
+the most current week
+coping appraisal
+MnmC
+glycine
+Two
+disease progression
+Neutrophils
+22
+70%
+glass coverslips
+Table 1
+vector-borne infections
+Medical Research Council
+Risk assessment
+reductive activity
+4% paraformaldeyde
+rapid and reliable diagnostic tools
+E. coli, wheat germ and rabbit reticulocytes extracts
+10% heat inactivated FBS and 1% PSN
+Differential scanning fluorimetry
+10%
+Molecular mimicry
+a group of probes that are within 500 bp of each other
+regenerated
+latent
+Computed
+two serine residues and one tyrosine residue
+A better understanding of the mechanisms acting at the maternal-fetal interface
+31
+lipid accumulation
+Figure 1
+zebrafish
+cTnI
+UV spectrophotometry, TEM and fluorimetry
+unfavorable outcome
+Ninety percent
+VA RNAs
+all data sets including X-ray structures
+10 3.76 TCID 50% /mL
+c i,j
+a latent period between an individual becoming infected and being able to transmit infection
+4 weeks
+F. betulina
+20%
+model 1, model 2, model 3
+conflicting results
+four
+appropriate or inappropriate activity of immunoregulatory networks
+Efforts to improve expression
+region-specific time series
+dramatic illness and identifiable travel groups
+2 − Ct method
+15%
+Each type of repeat unit
+hybridoma technology and recombinant technology
+GADD34 expression
+one hypervariable region
+susceptibility to active TB
+Connective tissue disease-associated interstitial lung disease
+PIDD
+mannosebinding lectin
+RNAs
+Aliquots of 200 µL of supernatant
+84%
+stronger FAM signal
+binds polyUb
+RAM-11-positive areas of atherosclerotic lesions
+11
+formalin
+8 weeks
+118.53
+Patrick Sawyer
+Dengue
+0.5 kcal/Å
+66.7%
+100%
+The empirical evidence and importance of connectivity correlations
+therapeutic in vivo studies
+AT2 cells undergoing apoptosis
+measurement of antibodies in BTM
+standard recombination software
+Figure 5a
+placental infection
+Base excision repair
+CASP9
+Geminiviridae
+8h post-infection
+Lactobacillus
+four
+stop free radical chain reactions by accepting electrons
+Trypsin-mediated cleavage of VP4
+six
+48.5%
+2
+maps
+Table 1
+Honduras
+Social distancing and quarantine measures
+stress
+Levels of nod1 transcripts
+90%
+more detailed work
+structural information
+BigDye Terminator v.3.1 Cycle Sequencing kit
+higher
+orchestrating inflammatory response
+fluorescent microspheres
+purine
+Table 1
+anti-viral
+MDA-MB-231
+independent test dataset, sub-sampling test, and Jack-knife test
+BC-3 and BCBL-1 cells
+enzymatic activity
+competing virus
+Methanol
+upper and lower respiratory tract infections
+Ventana Benchmark automated staining system
+Replication-Competent ALV LTR
+gene amplification method
+78
+Hemodynamic
+m47b
+29
+Trains of action potentials
+homogenous and viable
+−80 ∘ C
+cc-by
+Two-sample Kolmogorov-Smirnov test
+IRF2
+Three
+spearman rank correlation
+A minimum number of continuous, perfectly matching stretches
+inosine-5 -monophosphate dehydrogenase
+Atg9L
+Cote d'Ivoire
+day 3
+HSV-1 17+ 17
+adequate multidisciplinary and regional representation of relevant experts
+serotine bats and Daubenton's bats
+induction of the viral lytic cycle
+dengue model
+2-h
+under $5000
+24% to 34%
+levels of Ang-
+IPP software
+Zeta potential
+February 2016
+Viral titer
+Nucleotide sugar metabolism
+p30
+40
+RNA
+Professor of Medicine at the University of East Anglia
+Rhinovirusassociated illness
+8
+10-fold
+16%
+withholding antibiotic treatment
+Eliminating the hypodermic needle from vaccination
+scientific director
+31
+rapid reassortment detection
+Toho university medical center, Sakura hospital
+Apoptosis
+decreasing inflammation and accelerating blood vessel repair
+21 days
+ELISA and Western blotting assay
+isotope coded affinity tag technology
+Cytoplasmic tail
+Gag-specific CD8 + cells
+molecular tools
+cubic spline interpolation
+Inducible Hsp70
+Supplementation of 10% allantoic fluid
+a tryptophan metabolite
+if the vaccines will work
+12.9%
+average of the three last years of data
+cytotoxicity
+Sydney Carton
+1,294,310
+pro-inflammatory
+evolutionary entropy
+Ten
+7.4%
+Compound 7e
+Eleven
+Corticosteroid-induced ONFH
+2 hrs
+Splenomegaly
+public health workers
+100%
+Host resilience
+enhanced protein ubiquitination
+2.4%
+Inertial microfluidic
+under microscope and a photograph taken
+q
+UV Stratalinker 1800
+pluripotency genes
+H + leak and somewhat nonspecific cation conductance
+inflammatory damage
+35
+coordination
+T-test
+detoxification
+Simulated data
+proteaseencoding
+WT LCMV
+Mutations in the 1762/1764 positions of the X gene
+inhibitory
+Stool samples
+1, 846
+within the next year
+six primers
+immunomodulation, irritable bowel syndrome, and neurodevelopmental disorders
+ten
+Fig. S1
+Serogroup W sequence type 11
+Cyclin G Associated Kinase
+a PS
+V 1/2
+213
+Sodium dihydrogen phosphate dihydrate
+100
+significant induction of CLDN6-specific antibodies
+log of cell numbers per g faeces
+HA, M1 and NP production
+5-9
+Daily temperature differences
+premature aging
+mental health
+Dr. Julie Overbaugh
+a lock and key
+SafeStain or Coomassie Blue R-250 stain
+prolonged recruitment period
+> 20 mmHg
+three
+contact distribution model
+synthesis of L-carnitine
+antigens
+Persons infected abroad and returning to the EU
+data/analysis
+48 h
+antibodyantigen interactions
+chemopreventive
+TGF-β
+efferent
+2012
+analyses were not trapped at local optima
+40-80%
+RIG-I
+FDG-6-phosphate
+Genbank
+6 h
+anamnestic response
+public health sector and the curative sector
+Relative expression compared to control cells
+type-I IFNs
+65
+HSV-1 infection
+GP incorporation
+63
+Xaa-Pro
+200 PFU of LCMV strain WE
+Expression of the HAV insert
+amino acids 533-578
+one
+Allantoic fluid
+209
+GenePix Pro 6.1
+cc-by
+viruses bearing a negative-sense RNA genome
+four
+age-specific infection profile
+23
+Hepatocytes
+intellectual property issues
+Ten
+casting a wider net for contact tracing
+HIF-1 active cells
+3085
+Potyvirus
+TLR-mediated and other signals
+binds sialic acid residues to facilitate infection of target epithelial cells
+contigs
+1
+Ghs6 and M15.2
+j d
+little
+zoonotic infectious disease transmission
+exited the study
+ATG machinery
+fulminant
+winter waves
+RNA4 level
+T2DM
+at 1 or 5 µmol synthesis scale
+glycosylated
+control measures parameters
+GTP depletion
+3
+Vaccines and antiviral drugs
+10 g/g
+human IFNa/b or c as well as mouse IFNb
+Spain
+four
+cellpenetrating peptides
+10,436
+Hypertension
+increases membrane permeability to Ca 2+
+70%
+SPSS 13.0
+60
+79additional reactions and 10shatter libraries
+547
+mitochondria
+cytosol
+underreporting
+74
+economics
+biochemical
+Chi-square tests or Fisher exact tests
+tissue necrosis
+transcriptional and translational levels
+population growth
+Post-translational
+processing, protein stability, CSE and fusion
+using a blank sample and subtracted from test samples
+Data related to pre-transfusion hemoglobin levels and red blood cells
+AlexNet
+DNA-polymerases
+Antibiotics for Childhood Diarrhoea trial
+gene knock out and in-vivo imaging
+Siglec-8
+developing multivalent vaccines
+$5 mm
+the union
+115
+6
+monoterpenes
+4-parameter variable slope regression fitting
+early-branching clades
+endocytosis of APP
+slow cooling
+transfection at the OP cell stage
+Biofilm formation
+IFN-λ1 protein secretion
+S. pneumoniae
+20
+clustering
+qRT-PCR
+replacement of the transmembrane domain
+82%
+Central venous
+80.6%
+Charlson Comorbidity Index
+contain specific packaging signals
+three
+Neighbor-Joining method
+clinical microbiology
+200 genomes per day
+99%
+epithelial cells
+25%
+a fusion unit
+key strains
+transportation to a feedlot
+PCR primers
+FLAG tag or GFP
+48
+three
+Animalia
+Eight
+gender differences
+the antigenic nature of selected protein sequences
+Improved vaccination and delivery approaches
+fifty per cent
+the actual amount of drugs being consumed by the contact
+urban
+c-secretase
+Aptamers
+Multivariate
+Fold-induction
+cytoplasm
+IV titratable
+0% to 10%
+larger human trials
+inflammation
+accumulation of viral RNA during infection
+Written informed consent
+high titer
+Efficient restoration of circulating blood volume
+Dong Thap
+diarrhea
+carbamoyl phosphate synthetase 1
+MiSeq Reporter Software
+mitochondria
+interactions between core proteins
+vaccine efficacy trials
+removing them from their primary work
+panel D
+host epitopes
+stem 1
+integrated stress response
+acetylation
+6 minutes
+Acinetobacter baumannii
+novel and alternative targets
+MELD-Na
+May 2012
+Selleck Chemicals
+10 ml 5% acetic acid
+Two hundred forty-seven
+>80%
+DNA and RNA
+Protein engineering
+Variable expression of Zfp985
+insulin-like growth factor -1 receptor
+male sex, adulthood and exposure to the outdoors
+22%
+RNA
+Tel-Aviv University
+Three to four
+pp-NT assay
+zero-dead volume union
+20 min
+Twenty-two
+two
+55
+10
+poxvirus infected cells in chickens
+GBV-C
+weakly positive mumps antibody
+non-influenza respiratory viruses
+fluorescence-activated cell sorting
+Monocytes
+91%
+more uniform, spherical particles
+Xrn1
+research nurses and other clinic staff
+unpleasant and sometimes life-threatening disease
+10 4 cells/well
+Two
+HK1 uninfected and EBV-infected cell lysates
+0.2 μg per reaction
+does not bind target membranes
+lung tissues
+changes in the parameters that affect NK-and T-cell dynamics
+Bias
+cellular analysis of BAL fluid
+16
+a wide phylogenetic study
+further study
+integration into a point-of-care device
+retinal pigment epithelial cells
+438,000
+TNF stimulation for 5 min
+Centers for Disease Control and Prevention
+50%
+HRP-conjugated goat anti-guinea pig IgG antibody
+dialectical
+lethality
+52%
+AxioVision 4.8.2
+217
+A step function
+54
+fever, circulatory collapse with hypotension, hemorrhage and acute kidney injury
+240
+MTX
+multicolor
+10 30
+FA
+mathematical model and simulation
+biological functions
+qRT-PCR
+euthanasia
+every 24 hours
+three
+1990
+clinically astute
+28,914
+33 × 10 9 /L
+loglikelihood model
+28 kb
+T47D human breast cancer cells
+attenuated
+March to September 2016
+Mycobacterium tuberculosis
+low incidence of pertussis
+EBV and KSHV
+Reads
+6 days
+an assignment
+50 μm
+basal expression of ISGs
+Detection platforms
+a deviation of 1-3 residues
+Viral recognition by host factors
+ARC1905
+H7N9
+general cross-reactivity of anti-prM antibodies
+acute injury to lung tissue
+EAU histological scores
+localization, tissue, and cell specificity
+four
+TGFBR2
+pulmonary hepcidin level
+2 hours
+4%
+enzyme families
+CGCTAGCTACCCATGG
+pseudotype virus
+lower
+53
+A minimum concentration of 0.4 mM dNTPs
+nuclear factor of activated T cells
+αand γ-SG and α-DG
+965
+Understanding viral transmission
+DMEM
+NS4A
+diabodies
+high cost limit
+orthohepevirus A origin
+five day
+data analysis
+small horizontal lines
+EBERs
+41-fold
+R292K and E119V
+11 L/min
+a substitution in the gene rrlE
+4 min
+10.1371/journal.pone.0019705
+Eleven
+Serum
+English
+1994
+Sequence similarity richness and evenness
+four
+10%
+10, 10, and 16
+Electrostatic repulsion with protons
+John Kash
+CARD9
+de novo phospholipid biosynthesis
+local and global signals of evolutionary selection
+fold change from pre-vaccination
+miRNA sponge
+131,761
+Dr. Chris Fraser
+The area near the door
+TLR9
+80:10:6:4
+birds
+138
+4
+Human primary monocytes
+3 M LiCl
+inhibitory antiviral effects
+12%-15%
+NGO0564
+adult learning principles
+higher
+Local undertakers
+reverse transcriptionquantitative PCR
+E. albertii
+RNeasy Mini Kit
+the time frame to test for coevolution
+1000 units per week
+ICL repair and HR
+N f
+Network plots
+electrostatically favourable
+dampen pDC cytokine production
+ORFeome
+oligonucleotide probes 70 nucleotides in length
+69700 km 2
+Supplementary Materials
+5 days incubation
+a strategy
+acting upstream of caspase-11 gene expression
+30-40%
+Respiratory syncytial virus
+The genetic background of the line used
+environmental monitoring systems
+β-actin
+viral yield
+48
+IRF4 rs872071
+IL-1β
+CD172a low
+Idiopathic pulmonary fibrosis
+an underestimate
+IAV and IBV HA proteins
+canonical proteases
+E1, E2, and the core protein capsid
+cidofovir
+matrix-degrading enzymes
+ribosome biosynthesis
+21 days
+SNPs
+Strategic management of materials and personnel
+SDS-PAGE and TEM
+δ SI
+endometrium
+FLUOstar Omega microplate reader
+RNAs transcribed by host cell RNA polymerase
+perceptual discriminative power
+large-plaque viruses
+joint knowledge of chain size and the number of generations before extinction
+prophylactic strategies
+Innate immunity
+Th17 cells
+spread of infection
+Ninety-six
+cough-associated apnea, cyanosis, PHT and encephalopathy
+hyperinflammatory
+12
+2 days
+four
+pathogenic arenaviruses
+threshold of detection
+γδ T cells
+ImageJ
+Hsp27/eIF4E interaction
+Aging
+infectious diseases
+maintaining ionic gradients and modulating neuronal excitability
+Stop codon mutations
+antimicrobials
+DiNap
+formalin
+polymerase activity
+vaccine efficacy
+HIV frameshift site
+typical trees
+The CSIRO's triple adjuvant
+L. pneumophila
+CellTiter 96 Ò AQueous One Solution Reagent
+pigs and neonatal mice
+many Asian countries
+1xPBST
+improve medical graduates' knowledge and attitude toward community health
+orphans
+support for Enoplia
+58
+Golgi
+perinatal and early life
+four
+intramuscularly
+clustering
+the log of the marker area
+mnm 5 s 2 U
+FKBP11
+the brain
+EMAN
+triplex
+stress
+NT-proBNP levels
+empirical data
+reverse transcriptase, RNase H and a DNA-dependent RNA polymerase
+None
+Advisory Committee on Immunization Practices
+30%-58%
+Challenge trial refinements
+rMP12-PTNSs
+Bexsero and Trumenba
+mitochondria
+5
+CERVUS
+read count
+humoral response
+4%
+observed data
+SIGMASTAT
+Eleven
+restrict a broad range of highly pathogenic human viruses
+R 0 < 1
+Acutely infected
+Kenya
+95%
+Demographic groups
+antigen peptides
+PFAM and GO
+Eight
+RNGTT
+Nonstructural protein L
+specific
+Michaelis-Menten plot
+every 8 to 10 days
+100%
+Norwalk
+variable 3= untranslated regions
+50%
+small molecules, proteins, DNA, and virus particles
+once daily
+15
+Isoflurane
+food-borne
+GC7-triggered NP oligomerization
+robust
+10-19 years
+ocular
+Portugal
+IL18BP
+viral attenuation
+RaxML
+Neutrophil elastase inhibitors
+data
+social group learning
+gRNAs targeting HDAC5 exon 3 and exon 4
+P < 0.05
+83%
+25%
+low-titer inoculum
+paddy straw and water
+75 to 105 min
+lysates
+24
+five
+virus binding ability
+100μg/ml cycloheximid
+epistasis between any two sites would vary across different genetic backgrounds
+Google Earth
+potent and moderate antiviral agents
+Relative translation efficiency
+infection probability
+three
+1:500
+GP CL
+anti-RSV neutralizing antibody
+C-terminal segment of the homomorph
+1476
+Virus samples
+Uric acid
+unidentified viral pneumonia
+Ulp1
+the following
+8%
+NLRP3 inflammasome activation
+ATP5B
+Large aggregates
+7.5%
+mouse hepatitis virus and rotavirus group A
+6078
+Trizol reagent
+A functioning legal system
+delivers incoming viral particles to late endosomes
+ALI
+0.91 and 0.89
+epidemiological parameters
+BTV-1
+virus infection
+91.6%
+thousand
+serum albumin levels
+.91
+increasing global attention on rabies
+cc-by
+48 h
+Ribavirin
+1.2 million
+Two and a half billion
+97.5%
+Periodic assessment and improvement of the quality of data
+benzylpenicillin benzathine 2.4 MUI
+2007
+different types of commensal bacteria
+416
+reduction in disruptive handling
+50%
+viral proteins
+endemic equilibrium
+filamin A and the Src family kinase Lck
+national security and national interests
+IL-17
+SGs
+similar anatomical structures and bone density
+a reactive group
+Transition and transversion
+differential consequence
+phenylalanine, serine, and arginine
+10 IU/L
+ILI
+PR3A5 and 6G4
+preparation of sequencing libraries
+World Health Organization
+PKR-deficient
+Ficoll-density gradient
+4
+three days
+novel targets for the development of antiviral drugs
+the number of times pair ij has been in the sample space
+63%
+four
+SPSS 17.0
+the origin of eutherians
+HIV
+10.3389/fmicb.2019.00523
+mule deer
+three
+Sagrassum weighti
+reporting and recall biases
+g 3
+appropriated antibiotics
+non-uniformly weighted
+four
+Table 3
+Apolipoproteins
+CPV
+k
+Recombination
+long-term maintenance of therapeutic levels of vector-delivered transgenes
+adjuvants
+CCR5, SPP1 and b-actin
+H9N2-GFP
+anti-EGFR
+Egypt
+the government
+National CCHF prevention and control programmes
+reactivity
+computational epidemic models
+ORF1
+2,219
+MV with heliox
+nonfermenting yeast
+varies widely
+immune responses
+size, and minimal training
+4 weeks
+positive feedback for RIG-I signaling
+10 µM
+the 5 ′ end of potyviral RNAs
+499
+application to a greater pool of patients
+96%
+CFX96 Real-time PCR detection system
+20 min
+Chemiluminescence Reagent
+blood samples
+23
+10
+13.0%
+Shelter Neuter Return
+anti-SP-D and anti-megalin antibody
+Primary gastric epithelial cells
+rainfall
+Macrolides
+1% blocking solution
+conventional pandemic vaccines
+dynamics
+confocal
+The exact range of vertebrate hosts and their disease state upon infection
+text-free
+74
+Arrows
+5,000 bp
+20 mM Tris-HCl
+21 weeks
+28 nM AE 7
+inflammatory
+80%
+intermembrane domain 1 and the intracellular loop
+24 h
+computationally efficient
+LPS or zymosan
+mutation pressure
+sampling design
+a specific band corresponding to approximately 50-kDa molecular weight
+vasoconstrictor drugs
+eIF4E
+cross-border movements of animals and animal products
+3%
+inhibitory
+predictive certainty
+Initiation
+anti-pSrc
+random priming
+a set of rigid standards fixed for all time and in all contexts
+systemic
+unacceptably high
+I nfluenza
+20%
+2008-2009
+20-100%
+pol r,n,N,1
+differences in hemodynamics or UO
+taxonomy
+an intron
+2.5%
+Euclidean distance
+CAHFS Laboratory
+Secondary structure metrics
+8,950
+impact of the Great Depression
+EBOV surrogates
+hantavirus RNA
+human contact patterns and other host heterogeneity
+Low-dose vasopressin
+2 mg midazolam
+2%
+Forty-eight hours
+HPAI H5N1
+L = −1
+monocyte-attracting chemokines
+concussions
+three times a day
+infectivity of DI-244 particles
+substantial and durable
+ethidium bromide
+Comparative threshold cycle values
+0.5 and 0.65
+glycosylated SHH
+nucleolar accumulation of Pc
+detectable replicating virus load
+57%
+Microcephaly
+more efficacious
+eight
+virus-specific IgM, IgG, and IgG subclasses
+beta-galactosidase
+12
+DNase
+three
+other proteins in available databases
+spliced transcripts
+mahogany
+interactions between primers, template and polymerase
+Escherichia coli BL21-Goldenplus
+2.34 and 7.06 log10 copies/well
+elastin
+London
+adenoviruses
+the lymph node
+Blood samples
+lymphocytes
+more than 100
+10 μM EdU
+C. mellificae
+IFN-4
+18
+0.5-1 h
+incidence rate ratio
+Two different searches
+1.5% agarose gel
+Y ij
+ENSEMBL GeneView and the NCBI MapViewer
+Mann-Whitney U test
+CD8+ T cells
+interpretation of results
+look-alike regions
+between 10 6~1 0 7 bits
+venom serine carboxypeptidase
+genomic-based diagnosis and surveillance of hantavirus-borne outbreaks
+diverse astroviruses
+One week
+8,906,866 bp
+three
+M2
+YFP C-terminal fusions
+Bleeding
+hCT
+theragnostics
+3 days
+amino acid identity
+ingestion
+Infectious
+250
+3 days
+Basal autophagy
+Wales
+a third chemical
+pseudoknot-free base pairs
+cc-by
+non-overlapping epitopes
+0.3 Å
+Jalview
+viral and bacterial respiratory tract infections
+split-GFP reporter
+24 h
+Spl574
+effector memory cells
+cysteine
+Ciliary-mediated bead clearance
+rVSV
+12
+amelioration
+TNFRSF21
+optimum antigen loading efficiency, charge, stability and size of the NP
+51
+absence of a more comprehensive evaluation background
+end-expiratory lung volume
+mice and ferrets
+zoonotic
+40%
+2005
+The skeletal muscle
+45 %
+Supplementary Data
+no significant interaction effect
+antiperoxidase and antithyroglobulin
+inverted fluorescence microscope
+3526
+both kinds of strips
+cardiogenic shock
+Fifty-four
+HCV-induced NPCs
+55-min
+concurrent bacteremia
+transport of live animals
+Dr. S. Akira
+HMG CoA reductase
+performance
+separated virus
+ALV-J immune escape
+20uC with 0.4 mM IPTG
+2,747
+40-100%
+1600 bp
+HMBS and HPRT1
+animal models
+Ampelovirus
+to prevent the dissociation of RNA-protein complexes
+Formal information and hand hygiene
+Knockdown
+crude Polygonum aviculare
+influenza, cytomegalovirus and severe acute respiratory syndrome coronavirus
+41%
+inflammatory
+higher
+9 to 31%
+Synthetic peptide and multiple antigenic peptide based antigen
+Ponceau bands
+known miRNAs
+late 1970s
+emerging zoonoses
+Clean-catch mid-stream urine
+Mouth to mouth ventilations
+B and T lymphocytes
+ligase-like
+climate change
+All other ICU episodes
+L-Alanine isopropyl ester hydrochloride
+Chest infection
+tetra-peptide neck residues
+Victor 3 V Spectrophotometer
+yellow fever virus
+14.3%
+pathogenic
+1 to 5
+cell-matrix interactions
+phenformin-Zn 21 complex
+1394
+8.5 weeks
+confirmed transmission to contact-exposed pigs
+DIII variants with two independent mutations
+0.36 kg
+Intact MS2 PLP
+steroid information cards
+Finland
+pathophysiological
+HIV
+prevention and control measures
+loss events, and/or gene conversion
+Foursquare
+intracellular transmembrane glycoproteins
+controls
+reverse transcription-PCR
+percentages
+CMV reactivation
+stimulates the expression of NLRP3 and pro-IL-1β mRNA
+25-300 nm
+15
+14 hours
+non-overlapping epitopes
+75%
+carrier RNA
+injecting drug users
+30 min
+Orientation angle of the ligand binding to the receptor
+RPL4, EEF1A1, and RPS23
+similar
+Written informed consent
+mallards
+seven
+l k
+46%
+100%
+solid organ transplant recipients' increased vulnerability to these infections
+meaningful cut-offs
+donor cells
+Biacore X100 System
+cardiovascular diseases
+Beijing Institute of Microbiology and Epidemiology
+Febrile delirium
+cPK architecture
+Forward Inner Primer
+more than twice higher
+65%-70%
+the literature
+20
+Seven
+respiratory system resistance
+small interfering RNAs
+2 −ΔCT × 10
+Predictors of disease severity
+people at risk of impaired QoL
+unstable
+DENV infected cells
+Cpf1 nuclease
+3
+PA-PB1
+HRIC
+30 minutes
+5%
+IL-4/IL-13
+56%
+Positive-sense and negative-sense viral RNA
+37uC
+Crowding
+450-550 mg/m 2
+normal distribution
+31
+Excessive infiltration of polymorphonuclear leukocytes into the lungs
+resistant to C. rodentium-induced colitis
+logistic regression models
+crucial
+A DNA array
+Dilutions of immune or non-immune mouse sera
+30%
+NT-pro-BNP and myoglobin
+one to two weeks
+14 days
+ImageJ
+goat anti-mouse Alexa 555-conjugated antibody
+immunogen
+5-9 nucleotides downstream of the slippery sequence
+Noninvasive respiratory specimens
+Aviparvovirus
+Pattern recognition receptors
+unphosphorylated STAT
+Emetine
+less efficient VCP knockdown
+The amount of iron contained in cell lysates
+group 1
+65%
+antibacterial, antiviral, and antifungal
+10%
+ATP5B
+particles and the viral protein NS1
+intracellular calcium transient amplitude
+FeLV and FIV
+over all age and risk classes
+a balanced, rational response
+forty
+NK1.1 + CD3 +
+triplicate wells
+0.095
+minimum value
+CQ-loaded PLA nanoparticles system
+CD14 microbeads
+complicated use and high cost
+Enzyme dynamics in catalysis
+cohort
+2%
+clinical significance
+IFN-l3
+a sponge
+ineffective human to human transmission
+Core-on cells
+second half of 2019
+The FPT 100 %
+lowland rainforest
+5-20%
+Standardised triage procedures
+100-fold more native S598 peptide
+airborne precautions
+radius of gyration
+newly identified alleles
+Lorries
+Type VII
+cell migration
+5 days
+Fisher's exact test
+PA-Eastern
+DREAMS
+prevalence ratios
+7 days
+The UUUUU slippery sequence and the pseudoknot
+heterologously produced and purified TcdC protein
+210
+CXCR6
+phylogenetic incongruence
+disease manifestations among smokers
+Glucose concentrations at levels encountered in diabetes
+Pearson's correlation coefficients
+IFNβ promoter stimulator 1
+Perseus software algorithm
+Anti-stem antibodies
+Relative abundance
+DAPI staining of nucleus
+independent experimental data
+buffer on dissociation constants
+The standard
+bacterial respiratory infection
+connectivity and dilution
+mitochondrial RNA transcription and protein synthesis
+monocytes, macrophages and endothelial cells
+inhibitors
+recommendations for performance of these tests
+lactate dehydrogenase
+Cubs and subadults
+Approximately two-thirds
+sympathetic
+intramembrane cleavage
+logistic regression analysis and ANOVA
+RSV-inducible
+62%
+2%
+Antigen capture ELISA kits
+30 min
+1x MIC
+Pump It™ Automatic Delivery System
+phenanthroline
+3-5 %
+axis1
+to analyze the potential of TQ to induce apoptosis in Jurkat cells
+4-12% Bis-Tris gels
+8 hours
+NCBI RefSeq strains
+cytosolic cytochrome
+ATG12-ATG5 conjugation
+two
+Brainstem injury
+182
+Sigma-Aldrich
+35 476
+THBD expression
+vaccination status is checked and vaccination is started if needed
+tighter CD4 binding
+~30% to 40%
+40
+anti-BPI3V IgG
+excessive testing in stable patients
+GENIE3
+a BioSample record
+BACE1-APP interaction
+seven
+memory CD4+
+297
+C
+RNA backbone
+antiviral antibodies
+mass spectrometry
+Appropriate reference laboratories
+Caspase-3
+pigs have a full set of innate and adaptive
+48
+phenylalanine
+Five hundred ng purified DNA
+10 pM to 100 nM
+The niche approach
+Selectively relevant features
+1904
+Index case
+HEK293T cells
+70%
+weak points
+IL-10R blocked animals
+ZMapp
+lowest
+Public health interventions and individual-level adherence decisions
+C5a
+CXCL16
+differences in GVL effects
+m/z 100-1000
+over 90%
+61
+50
+unprocessed polyproteins
+ultrasound interpretation
+expression of additional IFN-inducible effectors
+selection frequency
+distance and travel times
+enterovirus and human rhinovirus genome
+read-level analysis
+studying
+different contractile behavior
+The pharmaceutical industry, its trade and access to medicines
+positive
+Negative trial data
+mutational noise
+1-25%
+ZMapp
+acute, convalescent, and chronic
+Associations between environmental temperature range and physiological tolerances
+In vivo testing
+AP-1 signaling
+Swiss-PdbViewer 4.1
+Pulmonary endothelium
+Gabon
+lysate
+5 : 1
+Imipenem and Meropenem
+FUS
+106
+Arthur Barth
+lipopolysaccharide
+graph-based signature concept
+stay home to care for sick children
+CDK and GRK2
+cc-by
+Passive incorporation
+127
+12-12-hour
+the fraction of number of new cases per case is decreasing
+idiosyncratic hybridization barriers
+115
+160 bp
+FXR/BSEP
+HTNV clearance and prevention of HFRS development
+100%
+2 weeks
+Antimicrobials
+respiratory symptoms
+One hundred and seventy-one
+Listeria
+More than 25%
+φ L
+Education and training of health workers
+viability and cytotoxicity
+Interferons
+Transcription of Gamma-1 genes
+zebrafish
+Capto Core 700 beads
+HFFF2
+ambiguity, interpersonal conflict, safety problems, and high job demands
+variable loop 2 -apex bnAb epitope
+normal organization of the nodes of Ranvier
+gonadal hormones
+stair ascending
+Four and eight weeks
+cardiotoxicity or myelosuppressive
+type II
+Lysates
+contact history
+sample processing methods
+between 10 to 20 ng/mL
+antagonistic to mutualistic
+5% SDS
+once a week
+five
+41.5 years
+cc-by
+reporter assay
+hypoglycosylation of viral GPC
+every 2 min
+2100 Bioanalyzer
+sequence divergence and diversity
+18%
+BPD and consequent pulmonary hypertension
+GPX4
+71
+adult population size, brood production, and foraging
+Dysregulation of ACE2
+values above a 3% threshold considered positive
+Prof. T. Honjo
+3
+NXY-059
+age and sex
+nuclear translocation factors
+NanoDrop spectrophotometer
+Ellman method
+SeqTrack
+Secondary structure content
+Betapropiolactone
+severe inflammatory responses
+Glycine
+6,772
+95% detection probability
+β 1
+Additional studies
+4
+PEI/DNA
+ATP binding
+zoonotic
+changing Asp552 to an Ala
+RII-SL
+115
+Bootstrap values below 70%
+a one-ended double-strand break
+two
+Dr Dario Campana
+Dividing the whole region into LTZ groups
+TransPlex reverse transcription
+Changes in fluid balance
+Therapeutic antibodies
+immunoinformatics based research
+Liesegang phenomena
+40 hours
+122 years old
+Correlation analysis of PCV
+locked in within the host body
+historical controls
+TRIZOL
+nucleotide and amino-acid similarities
+Table 4
+one organ or tract
+Four
+26/28
+70-90%
+IRES recognition
+t-test
+DMSO-d 6
+plaque reduction neutralization testing
+1%
+influenza virus antigen
+B cells
+.98%
+Ca 2+
+667
+620
+those suffering from pandemic flu and ONILIs
+Clinical data
+16
+ground glass opacities
+70%
+DVG recognition
+humans
+Shed ACE2
+cross-sectional studies
+eight
+available data
+90-100 thousand
+clinically or laboratory confirmed
+DeepView/Swiss-Pdb Viewer v3.7
+pulmonary
+in proximal tubule, podocytes, and mesangial cells
+suicide
+high-frequency surface decontamination
+optimal shape nor optimal spacing
+exogenous Ebola GP
+the number of residues of the peptide
+bone homeostasis and remodeling
+data were not available
+flow rates
+1,075
+between 11 and 25 May
+A qualified statistician
+natural selection
+molecular docking studies and thermodynamic analysis
+intubation and mechanical ventilation
+non-specific amplification
+100%
+1:80
+b
+functionality
+Recombination
+distance as well as mutual contact between subjects
+sodium
+replication-deficient adenoviruses
+10 mM ammonium acetate buffer and acetonitrile
+0.079 nmol/ml
+quintiles
+disengagement and silence
+5%
+3
+25%
+skeletal muscle TG content
+evaluation
+two to three times daily
+Increased numbers of people seeking medical care
+WZ and ZZ
+cytopathic
+89.66%
+NF-κB
+Coxiella burnetii
+an average fragment length of 200-500 bp
+ADAMTS-4
+important
+314
+Acute respiratory distress syndrome
+16s rRNA clones
+30
+EV71 VP1
+JEV serocomplex
+naïve T cells
+five
+12
+nine open reading frames
+S. pneumoniae
+by inhibiting the Spry1 gene
+smaller
+two or three atoms
+Four
+septic shock
+one-third
+PyBOP/DiPEA
+two hours
+demetallization
+confocal
+at least 40
+23
+IndiGO 2
+Engstrom
+an expected linear relationship between V and F
+an intracellular transcription
+aberrant sustained expression of pro-inflammatory cytokines and chemokines
+567
+limited
+aggravated immune response
+Bradford method
+Aging
+25%
+paramyxovirus family-specific and genus-specific primers
+sera
+Early etiological diagnosis
+Sample size
+higher knowledge scores
+five
+36 years
+KEMRI
+they underlie the majority of current mainstream pharma
+men
+45
+Further investigation
+GHRP
+Nacher and Araki
+60
+Rhinovirus
+environmental space
+ten
+Matrix protein 2
+an active cellular antiviral response
+papain
+one
+serum bilirubin
+18%
+tenascin C, CSPG4, and CD44
+Candida
+nuclease degradation
+FlowJo 10
+an acute CMV infection
+HE staining
+Native HNP1 from human leukocytes
+75%
+limited
+educational status, perception of the world and ambitions
+medical historians and paleopathologists
+p < 0.05
+a library containing 49 structural diverse drug-like molecules
+More than 8,000
+multiple alignments and subsequent truncations of the 59and 39UTRs
+human rotavirus infection
+C3a
+IAV
+MGBNFQ
+three
+carbon-bearing minerals
+Metropolis criterion
+cytokine production
+CTNNB1, CD44, STMN1 and LPL
+Mass and Conn
+60 min
+perinucleolar
+Neuroinflammation
+TIM-3
+25-40%
+Human APO-BEC3A
+60 to 80%
+59.5%
+Biotinylated goat-anti-mouse IgG
+3 mM DTT
+Genotyping for the Sgta alleles
+50%
+3-folds
+proteases
+Q89N
+the need to use the entire pathogen
+The index corresponding to the observed epidemic
+all levels of management
+blood culture
+susceptibility to infection and infectivity are controlled by the same set of genes
+$269,004
+20Á30%
+pUL21a
+flavonoids
+EPs 7630
+intravenous patient-controlled analgesia with fentanyl
+TRAF3 and TRAF6
+Ub-binding ZNF
+CesT
+30
+six
+BSL-4
+BCL2 family
+inhibits HCV replication
+Curves
+intracellularly
+antiviral therapies directed against measles
+humans
+twice
+Western blot analysis
+45%-90%
+20
+Thirty-four
+3
+Febrile seizures
+All authors
+Supportive care with appropriate infection control
+Culture based methods
+Statistical
+once
+immunisation levels
+Sin3A and MeCP2
+Hundreds
+increase
+Dulbecco's modified minimal essential medium
+nonaromatic substitutions
+0.25%
+three
+Selective IgA deficiency
+sustained inflammation, nephropathy and tissue iron deposition
+Saponin
+49.7%
+investigation of these parts of the pathogen's ecology
+ketamine/xylazine
+T-helper 1
+Antigens for the macaque ELISA
+Five
+SC236 or vehicle control
+stable SL structures and cyclization motif
+The extended stem-loop
+CDC Influenza Virologic Surveillance
+pseudohyphae
+phenolics, terpenoids and alkaloids
+Vector doses
+Gag retention
+hospitalized patients with an acute exacerbation of COPD
+CEA splice variant
+annealing temperature
+Migratory waterfowl
+lipid mixture
+iProt-Sub website
+10 and 5
+15 cm
+4, 7, and 9
+polygons
+those sequences for which the protein identity and function have been experimentally confirmed
+t
+The current state of the art in synthetic methodology
+abasic PNA 2
+low-and middle-income countries
+underlying rules
+lymphocytes
+DNA Platinum Taq Polymerase
+publication bias
+tinea imbricata
+have good transport and communication access in case of adverse events
+ACE2, Angiotensin- ] and Mas
+Receiver Operating Characteristic curve 27
+cell surface HS
+cognitive/affective
+neutralization assays
+AIDS and Hepatitis C and B
+ApoE4
+significant increases in fever rates
+ENPEP
+unique substitution and positive selection
+capsules, tablets, and solutions
+122
+33,238
+1 s
+159/89
+15-lipoxygenase
+how quarantine and class closures may affect different types of families
+resistance to drugmediated RdRp inhibition
+restricted DENV and VSV replication
+Influenza A
+results quick enough to guide point-of-care clinical decisionmaking
+autophagy enhancers
+TNF and IL-1
+Customization of health care
+Four
+drug-drug interactions mediated by CYP enzymes
+S-I-R equations
+IL-4 deficiency
+manidipine
+fear and fear reactions
+12
+target sets
+toll-like receptor 4
+harmonic frequencies
+enzymes
+Five
+seasonality
+Vimentin
+bronchiolitis, pneumonia, bronchitis, and croup
+50%
+Z-VAD-FMK
+PAML
+firefly/Renilla signal ratios
+hematoxylin and eosin
+immune CD4 + T cells
+EC6, PO1, and poliovirus 3
+agent-based or microsimulation models
+14
+DC maturation
+XendoU
+30,000
+modesty and trustworthiness
+Brains
+human respiratory virus dataset
+Lung aeration scores
+serological and virological methods
+mixed-effects logistic regression model
+27.4%
+Nosocomial transmission of respiratory viruses
+Practitioners, midwives and nurses
+Kruskal-Wallis test
+cGAMP
+macrophage polarization
+all public events
+Deborah Diamond
+nicotinamide adenine dinucleotide
+Sinopharm Chemical Reagent Co., Ltd
+1
+Prolonged expression
+infl uenza disease development
+1 μg/ml
+regulating the APC
+Infectious bronchitis
+hibernation
+stem 1 or stem 2
+three
+PDGFR-α
+public health
+60%
+Increasingly abnormal INR
+local
+anti-B220-APC and anti-IgD-PE
+TreeAnnotator
+vital status
+13%
+60%
+Plasmalogens
+Unfolding
+immunofluorescence
+TB, malaria, HIV, biochemistry, and haematology
+IRF-3
+artificial intelligence
+75.9-77.1%
+Coptis sp. and Berberis sp.
+rhinovirus/enterovirus
+chemoattractant
+Barnase
+2009
+Serial interval distribution
+DIs
+N j
+teledermatology
+47.3%
+exclusion
+social and cultural contexts
+9 m 3 /min
+glyceraldehyde-3-phosphate dehydrogenase
+Whole transcriptome spotted MEEBO microarrays
+low
+The funding sponsors
+cryo-em reconstruction
+3
+mortality
+Streptactin sepharose beads
+VirHostNet interface
+orthologous gene clustering
+blood parasites
+PB2
+viral culture
+10
+3.4
+zebrafish and stickleback
+relatively low
+take primary responsibility to establish a global partnership for development
+Population density
+CD1c + Dendritic Cell Isolation Kit
+inflammation-induced tissue damage
+family relationship
+microarray platforms
+77
+Pure water
+Supply issues
+Nterminal domain
+Tat
+PMA and ionomycin
+TaqR mastermix
+symptoms of severe neuropathogenesis
+>512 mg/L
+49
+Information on host-pathogen interactions
+the number of input dendrites
+2:2
+multi-agent
+F = 1/2d = 0.5
+neutrophilic inflammation and the ER stress response
+six
+30.5%
+T cells and neutrophils
+telestem
+differences in storage time and temperature
+binary
+human macrophages
+ViPR
+insulin resistance
+DiOC
+Weld of the nucleolus
+HTV ventilation
+Acute renal failure
+Rvs167
+UGG>GGG>CGG>AGG
+21.2±8.7%
+male
+32
+Metatranscriptomics
+63
+minimal seroprevalence
+stochastic
+69%
+0.6
+n
+two
+32
+98%
+2, 4 and 10 mins
+single-cell topological data analysis
+p-SCN-Bn-DFO
+MHC class II synthesis and ubiquitination
+rHc-CS
+Age and minority status
+≤ 0.05
+OcUGT1-assisted aglycon exchange
+blue
+97%
+34 • C
+HaploView 4.1
+Ebola VLPs
+unspecific translation initiation
+clinical observation and monitoring of hematological and chemical parameters
+respiratory CD103 + CD11b lo cDCs
+CyDyes
+1 h
+significant cell cycle arrest
+953
+Kristina Grant and Francine Cousinery
+reduced fusion capacity
+male gender
+lysates
+Bio-Rad iScript cDNA synthesis kit
+people made judgements about both likelihood and consequences
+Serfling regression
+memory CD8 T cells
+growth and differentiation
+commercially obtained from Upstate
+1000
+lactate dehydrogenase
+5-15
+multicycle growth curves
+fecal samples
+mouse hybridoma supernatants
+Diff-Quik
+Amitriptyline, venlafaxine and Fluoxetine
+reduced barrier function
+naïve T cells
+529 ± 169X
+gas chromatographic
+chronic fatigue and comorbidities
+sepsis
+18
+A421V
+4%
+10,988 nucleotides
+Sudden fall in tidal volume
+sepsis
+610
+numbers indicated by market managers
+counters and raw data
+ALI cultures
+17
+ER transmembrane cargo receptors
+repressor element-1 silencing transcription factor
+Uncapped mRNAs
+regression parameters
+Random contact
+mutations
+infect new targets
+Variability
+Pm isolation collected samples
+two
+serine-threonine kinase Raf-1
+51,709,000
+35
+macrophage
+polymerase chain reaction
+Mechanical ventilation status
+10-100 fold
+4uC
+t E max and t I max
+astrocytes or neurons
+a subset of these probes that map to unique target regions of the selected pathogens
+Argentina
+three
+geographic distance
+efficacy
+ZEN
+decreased platelet counts
+AMPs
+the additive constant term
+six
+static distributions of SA
+P3 1 12
+Interferon IFN-β
+separate
+Inflammatory
+116
+training on Ebola
+30 µM
+Comparison of its predictive value compared with type assignments based on VP1 sequences
+dose or treatment duration
+mucosal
+the apical surface of the airway epithelium
+Likelihood Ratio
+timing and impact of influenza epidemics
+IL-12p40
+8 hours
+23
+ubiquitination of proteins
+two
+Four
+sH5 3 -specific ELISA
+Avian influenza A
+macrophages
+long-distance travel
+ClarityChrom
+IFN-γ expression
+intracellular proteolysis
+fatal pathogenesis of C. albicans infection
+Glycosylation
+C. jejuni
+vector copies/spleen
+10,345
+6
+MEK1/2
+TE self-regulatory mechanisms
+1926
+detectable levels of viral RNA
+GBP5
+centrifugation
+travel restrictions
+flow cytometry
+macrolides or flouroquinolones
+92.8%
+Targeting host cell factors
+Dominant negative
+18 years or greater
+humans
+LpKS9 and LpAM9
+Cysteine residues within the peptide
+Sixty-one
+89%
+Data
+trivalent inactivated vaccine
+Genomic DNA
+ε m
+pleiotropic
+minor nucleotide substitutions
+eight
+acute respiratory distress syndrome
+paramyxoviruses
+relapses in MS patients
+I-TASSER server predicted 5 models
+influenza vaccination status
+individual student health data
+cellular prohibitin-1 and -2
+hydrolytic enzymes
+1999
+36 hpi
+GC content
+Respiratory diseases
+5.6 to 8.1 Å
+CTLA4
+HLA-A*02
+Detailed clinical information
+HA 1 and HA 2
+AM
+Mafb
+a-proteobacteria
+pathophysiological
+282
+0 to 20%
+first-pass uptake
+Purified M145K sample
+Child-Pugh score
+Comparative genomics
+troubleshooting and refinement of specific procedures
+Contracting an infectious disease
+polyhedrin
+bioinformatics tools
+Patients, parents, and/or their legal guardians
+Nanoparticle size, shape, and capacity for surface modifications
+the reporter protein
+predictive or explanatory
+induced sputum samples
+virus
+CEACAM1
+pneumonia
+every 10 minutes
+Beyotime Biological Technology Co., Ltd
+allele designations
+two
+55-64
+viral replication
+VP4/VP2 sequencing
+Innate responses
+most stakeholders
+CD8 T cells
+viscosity
+branching
+770
+one RFID tag
+31.0%
+Bonferroni tests
+temporal changes in lipids prior to disease onset
+favipiravir
+5%
+viral RNA abundance
+The pathogenesis of hantavirus infections
+the number of genes per spot
+discovery
+Mutagenesis of cj0669
+genetic evolution and dN/dS selection pressure
+60 days
+last distribution
+different levels of contact
+a doctor's certificate
+thiol reagent 2-Mercaptoethanol
+30%
+FOXP3 -Tr1 cells
+Peritoneal lavage fluids and serum samples
+all disasters are "local"
+15%
+TLR4
+GIV NS4
+their host's genome
+a docking software
+Archosauria
+12
+5%
+Four
+highthroughput sequencing technologies
+Membranes
+facultative
+infectious virus
+Disease modeling
+exposure to the virus
+Five
+pulmonary hyperinflammatory response
+200.6%
+reporting disincentives
+an algorithmic guide to action
+Five
+Anopheles stephensi and An. gambia
+r
+PS matching and multivariable adjustments
+FACScan flow cytometer
+A DNase treatment
+ubiquitin and Nedd8
+EBOV infected mice
+Equations 7 and 10
+Microaary analysis
+aqueous KCl
+IAV-responsive kinases
+4%
+anti-CTA1
+polymer-based
+late 2003
+EEG reactivity
+Unpaired t-test
+Synthetic constructs, incomplete and wrong sequences
+16S rRNA
+social and physiological
+fibroblasts and lymphocytes
+Bid
+bloodstream infection and the infection pathogen of New Bunya virus
+FIV
+exogenous siderophores or host proteins
+PepsNMR and speaq
+Ferritin
+Softmax pro 4.8
+312 K
+missense or nonsense mutations
+IFNλ4
+CYR61
+7.2 ± 2.1 pups
+approved and proven therapeutics or vaccines
+FHV-1
+plasmacytoid DCs
+r-gene products
+ssDNA
+melanoma differentiation-associated gene 5
+OH of Thr2
+argB-37
+viral antigen detection
+flow
+Evolutionary models that incorporate protein structural domains
+ABCB1-mediated
+Local sensitivity analysis
+CrebA
+FluA and FluB DNA-encoded monoclonal antibodies
+infectious diseases
+p1 or p5
+Bidimensional ultrasonography
+GLM models
+90 μL supernatant
+1,200
+Dehydroepiandrosterone
+LuxScan TM 3.0 software
+Disease similarity tools
+soluble viral receptors
+suboptimal base stacking energies
+H7N9 influenza susceptibility
+master equations
+ex-over str
+restrictions on publicly-available transcriptome assemblies
+1.2, 0.1 and 0%
+changes in oral health
+G1 and S-G2-M phases
+18 h
+60 %
+0.3-8.4%
+a helix
+Contact tracing
+1,675,933
+sequencing
+Table 1
+3 or 4
+Factors that change the translation fidelity and kinetics
+more resources for infection control
+Zika virus
+Additional file 1
+chloroform
+2 weeks
+23.1 g
+50 ng/l Proteinase K and 0.15% SDS
+structural SP-D polymorphisms
+Mean-field models
+cells without PA83 adding
+HindIII site
+Pre-stained Protein Ladder
+83.7%
+Erythrocyte sedimentation rate
+community gatekeepers
+LoxP sites
+444,751
+>7.5%
+ingestion of contaminated fecal pellets shed by infected mice
+absence and symptom reports
+subgenomic flavivirus RNA
+two
+NHE1
+five
+autophagy-associated proteins
+10
+Emerging infectious diseases
+galactosidase
+IL-17A
+compound 3a
+SVM algorithms
+AE
+medical journals
+single-species studies
+81%
+diabetics
+Post-death transmission
+Ekachai Jenwitheesuk
+Apdm09
+sialic acid receptors
+linear regression
+10 mg/ml
+three
+weak
+domesticated ungulates
+Average raw luminescence units
+plasmacytoid dendritic cells
+Ae {Bn
+374
+25%
+LightCycler 480
+1571
+Supplementary Text 10, Supplementary Table 8 and Supplementary Figure 20
+growth inhibition
+NSs-mediated PKR downregulation
+HE glycoprotein
+pcDNA3.1-SynORF5 plasmid
+BiP
+10 %
+three
+pregnancyassociated malaria
+3.74±0.18 μM
+CD8+ T cell infiltration into the CNS
+cystathionine γ-lyase
+crested ibis
+Uganda
+TRI Reagent
+transcription of both DRD2 and NCAM1
+Coutinho
+restriction digestion
+high-dose steroids
+no association of BK virus with nephritis
+further studies
+Allelic variation at Lsh and H2 loci
+a functional PPXY late domain
+R-Mix culture system
+2 days
+size exclusion chromatography
+an arginine
+PGs
+hygiene measures
+gravity model and the two-step floating catchment area method
+98%
+MTT-assay
+loss of fitness in mutants
+they only contain trace amounts of glycolipids
+27%
+12
+20,000
+MultiGauge software
+1000
+maternal antibodies
+differentiation of Tfh producing IL-21
+Aminoacylation
+binds and inactivates
+Ten
+Five
+methylene-THF
+QIAamp DNA Mini Kit
+qPCR analysis
+absorbances
+genotype 3
+the very ends of the segments
+acute inflammatory
+antimicrobial resistance
+hRID-fusion
+solvent
+260 million
+Species-specific miRNA-targeting of influenza A virus
+8
+30 minutes
+two
+*6,996 nt
+ERMS
+disease-related information
+Wilcoxon signed rank test
+NE-PER Nuclear and Cytoplasmic Extraction Reagents
+the D pocket
+PN, DN, NN, MC and Time
+Vimentin
+erasure of imprinting
+eggs from each hen
+D85
+high nucleotide sequence conservation
+>0.99
+0.22 mg/ml
+2-4 log
+Autophagy
+Glu
+proinflammatory mediator production
+4% PFA
+400
+24 to 32 hours
+a highly bioavailable supplement of organic Se
+2011
+reverse genetics
+14
+epidemiological change
+apoptosis
+jain
+18
+0.005 to 0.014 μg/mL
+28,616
+adaptive immune response
+IL-15
+three
+more than 200 mg/L
+March 11, 2020
+CD8+ T cells
+chaffinches
+Rickettsiae
+Nasal wash, serum and spleen samples
+Caraparu orthobunyavirus
+non-tumoral cells
+cholesterol-depleting agent
+alveolar macrophages
+2 to 9%
+one of the best performances of the challenge
+One-color Spike-in Kit
+three
+decreased ACE2 and increased ACE concentration
+transmission rate
+constant comparison method
+35%
+500
+mock-infected
+pyroptosis
+14 days
+Magnetic targeting
+probe-based real time amplification techniques
+Cytoplasmic tail of the A/M2
+PAK1, MINK and MAP4K2
+inhibitor quality
+FCV
+V5
+two
+interfere with cell cycle regulation
+38
+36-39
+multilevel
+charantia
+164
+Astrocytes
+redox imbalance
+Korean bat paramyxoviruses
+blue
+use the nuclear transport machinery and access the MW
+antiviral selectivity
+age and URI
+SDS loading buffer
+Two adjacent prM C-terminal transmembrane domains
+those at risk of disease progression
+170
+73.84%
+Anti-CD4 mAb
+mutation 6K1 T1210M
+Galactokinase recombineering
+≈100%
+a Kunitz-type serine protease inhibitor
+higher thermodynamic stability and RNA-like structural properties
+November 2004 to November 2014
+similar ones
+Semliki Forest virus
+18.8 kg/m 2
+ISG15
+DNA molecules in higher eukaryotes
+p j
+50%
+Immunoprecipitation
+aspartic acid/proline linker
+a non-TIB region
+TNF receptor type 1-associated DEATH domain protein
+Twenty-five
+2610 9
+TDMD of miR-27
+one day
+transient worsening of colonic disease
+A. albopictus
+increased
+10% water or 100 mM DTT
+burial rites
+cytopathic protection assays and multistep growth assays
+Photocatalysts
+six
+Santa Cruz Biotechnology
+flow trigger
+10
+6
+Hillary Clinton
+347 nt
+2=-O-methylation
+rib_host
+immobilized
+PRRSV glycoprotein 5
+13
+Displacement of the tRNAs
+obvious phenotypes
+13 C NMR
+T12 FEI electron microscope
+Sina Weibo
+25.0%-20.8%
+non-tuberculous
+0.15
+79
+Trans-Proteomic Pipeline
+their property in tertiary structure
+Dengue haemorrhagic shock
+42
+three
+siM2
+epitope mutations
+879
+nutrition
+severe acute respiratory syndrome and Middle East respiratory syndrome
+Tails
+κ = 1
+lack of national coordination
+CPB-caused oxidative stress
+Caco2 cells
+one
+an extended MDT
+The ER
+Behavior changes
+peripatetic workers
+Antibody scFvG36
+FeLV antigenemia
+neutrophil chemotaxis
+risk of exposure versus risk of serious illness and death
+early childhood
+Four hundred and thirty six
+10.1371/journal.pone.0006681
+GeoChip 2.0
+a physician
+two waves
+isolation and contact tracing
+HLA
+improved health
+Over 6%
+all possible sequence changes
+75%
+N-terminal caspase activation and recruitment domains
+codon optimization
+proline-rich peptides
+a private network of hospitals
+brain CT scan
+monoclonal
+Inherited and acquired variability in host immune responses
+assays
+commercial enzyme-linked immunoassay kits
+Viperin
+viral strain names
+pVSV-XN2
+MnmC
+United States and Australia
+two
+antibiotics usage and resistance
+β-casein
+sensitivity
+N63Y
+inter-patient variability
+ascovirus genes
+two
+the attending or on-call physician
+Relatively little
+intercellular adhesion molecule 1
+Biomarkers
+to avoid hydrolysis
+SuperScript III
+pharmacological agents
+the degree to which data correctly reflect the real world event being described
+under specific pathogen-free conditions
+May 22-June 10, 2015
+a node that exerts control over at least five other nodes
+Polymyxin B
+LA/DG
+Total RNA
+100 nM primers
+strong or good
+Influenza A pdm09
+cloning all predicted ORFs into flexible recombinational vectors
+a random distribution
+A fraction
+strategic alignment and alignment with regional/national priorities, policies and objectives
+experimental validation
+western medicine
+Unsupervised
+Th9 cells
+a dose of ten 50% lethal dose of VV-WR
+2.21 fold
+a, α 1 and α 2
+three
+98.1%
+E of M4 and M5/6
+similar to that observed the previous year
+antibodies
+Flavonoids
+North America, Asia and South America
+SMZ-CO and echinocandin
+in tubes with EDTA
+webchem
+aspects of resilience
+65.0 probable and confirmed cases
+EpiQuick Tissue Chromatin Immunoprecipitation Kit
+microbes and infection pathways
+five
+scattered light
+311
+rabbit anti-lprG antiserum
+flow cytometric
+powerful adjuvants
+CTSL
+anti-infective antibodies
+Birds and primates
+three
+uracil
+wprctile
+CCR8
+2.99
+Japan and South Korea
+serum-free growth medium
+the purity of the circular TFO RNAs
+Ribosome bound eEF2
+study methods
+Gene expression
+Animal Care and Use Committee
+3 million
+detergent-free PBS
+Pygmies and chimpanzees
+Viral load
+IV cidofovir
+18 days
+20
+ϳ1%
+injection site pain
+Hybridization
+DNA ligase
+Vero cells
+HCV diagnosis
+two or three
+efficient NSs accumulation
+Prospective cohort
+2
+20%
+after every few years of human circulation
+how people travelled here
+no impairment of chemotaxis
+Chromosomal
+NF-kB
+Seven
+Outbreaks
+Known copies of plasmid carrying the CCR5 gene
+404
+98%
+both the upstream SD sequence and the downstream hairpin
+RDP v4.0
+Antibody-directed modulation of immune cell checkpoint receptors
+small grey circles
+OvAstV-1
+rhizosphere
+pcUL132sigHA
+99.9%
+live-attenuated and inactivated/killed pathogens
+Communication systems
+inflammatory cells derived from the periphery
+the sum of the highest score obtained for each of 13 symptoms
+TCID 50
+2.5 hours
+Eight
+virus isolation
+spore levels
+119,334-bp
+surveillance cultures
+inflammatory mediators
+partial HIV-1 pol sequences
+RNA interference
+six
+it will fund the whole genome sequencing of Raja erinacea
+DENV2 infection
+sites for virus assembly
+BMDMs
+keep the ORFs after endogenization
+eight
+isolation or the molecular detection of MP
+protein kinases and epigenetic enzymes
+provisions to avoid renal failure
+how to prevent EVD
+10%
+outbreaks
+Class cancelation
+by using numbers
+surfactant proteins
+ULTRASCAN
+RPI1807
+respiratory diseases
+in vitro and in vivo experiments
+Six
+31
+LDH cytotoxicity assay kit
+42
+no significant differences in weight loss or survival were detected
+exosomes
+PCR-based methods
+improved durability of antibody
+Arvind Patel
+1.7 to 3.7
+Arginine deaminase
+55.5%
+mononeddylated
+rpoS
+S598 determinant
+IgG2 deficiency
+62
+LB, iron-depleted M9 and iron-rich M9 media
+Foxp3 − IL-10 high Tr1 cells
+protein aggregation
+Changes in cell permeability
+did not exacerbate EAE
+One millimole of R 1 OH and 1-ethyl-
+provincial laboratory system
+0.1%
+Vi-CELL cell viability analyzer
+IFN-γ
+F-measure
+10
+2,237
+molecular
+60%
+conflicting data
+targeting expression
+23%
+homogenous spot morphology as well as low background
+IBM SPSS Statistics 20
+106
+293T cells
+Alteration of SSTR2 expression in the MGT
+IRF1
+Atypical pneumonia and hepatitis
+50, 10, and 2 µM
+Residual impedence
+quantitative real time polymerase chain reaction
+cascaded hybridization events
+the transcriptome
+plasmapheresis
+Siddhartha Mukherjee
+human IgG Fc
+eighteen
+24
+log-normally distributed
+Fc Receptor γii Surfactant protein D
+Cirrhotic
+irrigation canals
+WS hMSCs
+paucity of data
+Internal forward and reverse primers
+GTPase RAB5
+120% of the relaxed length
+E. coli b-galactosidase
+mAb CR9114
+19
+1%
+two washes with cold D/B
+Src
+10
+interest
+multiple cell systems
+Flavivirus
+24.4%
+5-10%
+transportation of newly synthesized NPs to the nucleus
+P2Y12 −/− microglia
+Dendritic cells
+P1
+27
+Phi29 polymerase
+host-parasite
+sepsis
+public health
+20 hours
+PVR body mass
+Atg9
+66.4%
+polyethylene glycol 6000 and sodium dextran sulfate
+Vaccines
+50% and 100%
+relative light units
+$17%
+c-src kinase activity
+NCBI Basic Local Alignment Search Tool
+acute respiratory distress syndrome
+methanol
+individual sequence variants
+oxidative burst
+large variability in droplet size
+6 items relating to norms about male-female relationships and interactions
+Samples
+~10 kDa
+changes in the stop codon position
+TissueLyser
+3 min
+West Nile virus
+1 to 3 weeks
+100%
+LPS-induced lung injury and inflammation
+parasite persistence
+k − 1 quartet
+Disease transmission
+selective suppression of virus reproduction without adverse effect on the viability of host cells
+Stabilization by fusion to Nuc
+F. tularensis
+Attachment of polyethylene glycol polymer
+kakkonto
+WHO
+fresh medium
+RSV
+nine
+antibody fragments
+an S.pombe homolog of antizyme
+Cost-effective interventions
+2007
+less than one year
+multi-tasking
+95% and 70%
+green color
+Over 95%
+.
+straightforward estimation of the age-specific cumulative incidence of infection
+Unpaired t-test or Mann-Whitney U-test
+overloading
+lower
+binding and infection of PSV
+higher vector particles-to-cell ratio
+no differential effect of TAAR1 on cancer survival
+stress
+tetraspanin proteins
+LMP1 activation of NF-NB signaling
+Univariate
+HBoV
+Neurocognitive sequelae
+four
+genebased vaccines
+Epidemic intelligence
+circulating erythrocytes
+changes in bacterial numbers
+HTNV-triggered NEAT1 elevation
+b-Actin
+Cryo-EM data
+Sn 1
+Figure 3A
+CC mice
+antibody dependent intracellular neutralization
+cysteinyl-tRNA synthetase
+67.5%
+tRNA exon halves
+44
+Drug users, prostitutes and itinerant workers
+Respiratory health and function in adulthood
+B-WICH, NoRC and SWI/SNF
+standard deviation divided by mean
+V
+K efflux and mitochondrial reactive oxygen species
+sensitivity analyses
+Gingivitis
+proteasomal degradation of cyclin D1
+17%
+6A 2 to 1A 0
+hemorrhagic shock
+Greater than 95%
+ABCB1
+Monte Carlo simulation
+claudin 2
+Bacterial MOIs of 0.1 and 0.01
+environmental factors, school opening, and climate
+interstitial
+scale-free networks
+mouse anti-human antibody response
+calpastatin
+defensive
+potential key mechanisms for the host defense against NDV
+69/1113
+16 mg/dL
+14
+Escherichia
+More than 17,300
+recognize the ␣Gal epitope
+all year round
+colonic mucosal tissues
+Mathematical modeling
+serum β-D-gulcan and chest CT findings
+10 mg/mL low SPP dose
+mobile phones
+virus-infected cells
+phosphorylation of mammalian target of rapamycin
+83
+27.3%
+DB32-6
+104
+4
+rabbit reticulocyte lysate
+advance knowledge of major weather events
+lymphocyte-epithelial cell adhesion
+HIV-1, hCMV, HSV and KSHV
+Patients with destroyed lung secondary to other causes
+Rhabditia
+12 h
+ovarian
+automated term selection by double penalty smoothing 53
+LightCycler Nano
+an evolutionarily highly conserved superfamily of proteins
+lectin-glycoprotein interactions
+three out of seven
+sera of experimentally T. gondii immunized mice
+Saccharomyces cerevisiae
+chromatin immunoprecipitation assay
+ARIMA model
+CD4bs
+traditional plaque assays
+interfering with Vps3/Vps8dependent integrin recycling
+twice
+80%
+cytoplasmic
+1500
+The titer of the progeny virus
+cessation of granulocyte recruitment
+Three
+Med8
+Significant binding
+January 13
+light and dark gray
+138
+respiratory tract infections
+Rift Valley fever virus
+anti-CD70 therapy
+H9N2-subtype influenza
+three
+structure of database
+chaperone function
+CDOCKER
+90 min
+a bus station, a bus compartment, and a hospital
+Mouse monoclonal antibodies
+Pillar cells
+complementrelated
+The Journal of Infectious Diseases
+CD8 ϩ IFN-␥ ϩ T cells
+0.12
+MCPyV
+twice daily
+Cell one in the sensor chip without antigen
+ϳ20%
+laboratory fish
+by quantitative RT-PCR
+three
+future studies
+Smad1
+5 years
+1-43%
+March 2005
+viral
+FLAG-PCP
+Syk activity
+all the features derived from global alignment
+innate immune response
+sensitive
+high interindividual differences
+mRNA coding sequences
+mutations within SSP
+59
+mortality
+inflammatory
+natural selection
+peroxidase-labeled anti-mouse IgG
+Four
+ELISA kits
+370-Gln→Arg
+2-CTC resin and standard Fmoc chemistry
+CD11b + Ly-6C lo monocytes
+the system
+TSG-6 production
+any qualified researcher
+GM-CSF expression and immune tolerance
+a century
+Paris dicistrovirus
+bactericidal activity of GRA and GR-SU
+primers
+130
+acetic acid
+antiviral drugs
+63.96%
+mycological, histological, and genetic tests
+disease
+realistic parameter values and model based formulae and simulations
+12.6%
+93,390
+small and quiescent
+Polaxamer 188
+À1 RF induced NMD
+major immune mechanisms
+fusiogenic Env species
+14%
+CD4 + IL-17A + cells
+asthma
+ESCRT proteins
+elevated amounts of PB1
+seven
+Figure 1
+An ESE in exon 2 of CD200
+two models
+low temperature treatment of soybean seedlings
+5 to 100 nm
+type assignments
+TBP and YWHAZ
+relative gene expression
+delaying proper ventilatory support
+6 hours
+Oran Young
+contagious intranasal tumors of sheep
+methicillin-resistant S. aureus
+nanopure or Milli-Q quality water
+Phylogenetic
+twice
+type 1
+significantly reduced
+LRTIs
+Eight
+global changes in the chromatin structure and interactions of chromatin-binding proteins
+Phylogenetic clade
+Flowminder 13
+5 ml of 4x SDS PAGE sample buffer
+three
+1-phenyl-2-thiourea
+an OTU-like motif
+centrifugation
+TNF-α
+PBS
+ribosomal reinitiation after sORF2
+35
+phylogenetic
+severe pneumonia
+mathematical model
+two
+VP1 specific primers and DNA sequencing of the PCR products
+Teachers and other staff
+Virus inoculum
+30
+Longitudinal data
+B. subtilis
+lentiviral
+Heterorhabditis indica transcriptome dataset
+30-45 minutes
+chemokine
+30 minutes
+periderm
+it does not allow naked-eye visualization of G4s in solution
+2%
+45.4 ± 20.8 years
+symptomatic infection
+five
+pathogenesis
+10%
+4029
+a random association of mononucleotides
+20
+24 h
+macrophages and dendritic cells
+zero
+inflammatory
+74
+heterogeneous
+setting-appropriate
+nonspecific binding
+virulence
+2009
+TNFR
+humans
+Macrophages
+0.0387
+6 months
+VRC01
+41.4% increase in sensitivity
+Tedros Adhanom Ghebreyesus
+substrate accumulation
+rDNA copy number
+iron acquisition from hemoglobin or heme
+directed physical connections
+Lipofectamine 2000
+KAPA HiFi polymerase
+EIT parameter
+55.98%
+LH-H
+133
+Efficacy, noninferiority, and superiority
+PS1
+2-hour
+releases the complex of T0 and H0 into next circulation
+stable basetriplet interactions
+JEE
+n*m
+identifying the highly similar/dissimilar block in the unknown sequences
+Ordered and continuous data
+regions with sequences similar to transcripts of proteins from human, mouse and rat
+Metagenomics
+tracking and connecting all of the components of a model
+Parkinson's disease
+siRNAs
+subtractive
+genes expressed at or near the background level
+every 3 months
+100%
+greater differences
+10-days
+LDH release assay
+epidemics in various regions and subsequent acquisition of herd immunity
+negative selection
+IL-2
+a characteristic of the specific cell type
+adaptive online estimation
+type I IFN induction
+infiltration of macrophages
+veterinarians
+GraphPad Prism
+Indirect-ELISA
+30
+comparison between severe and non-severe cases
+clustering of genes
+Temperature and specific humidity
+Perturbation of mitochondrial membrane potential
+436
+overexpression of tRNA Lys mcm 5 s 2 UUU
+C7 and C8B
+aberrant methylation
+viral RNA quantities
+four
+Western blot analysis
+The University of Melbourne Animal Ethics Committee
+soft convergent overlap
+72 hours
+conductance
+Heuristic algorithms
+A twotailed Student's t test
+R VH 0
+27
+sera
+Viral phylogenetic analysis
+1, 3 and 24 h
+600 seconds or 900 seconds
+θ
+14th, 21st and 28th
+APOPercentage Apoptosis Assay
+percentages of neutrophils
+antiviral responses to IAV infection
+Immunosuppression
+Brassicaceae
+rOpenSci
+N
+to enable the calculation of subgroup averages
+Littermate controls
+higher response efficacy
+no significant similarity with human pathogens and other closely related pathogens
+airway epithelium
+viral
+39 days
+long-lived plasma cells
+Acyclovir
+49
+50
+15
+GLT-1
+Glutathione, SOD2, and ATP
+8
+5,000
+intubation
+Roughly 17, 000
+infiltration of CD8 + T cells into MM tissues
+local disease spread
+13%
+ERK pathway
+40-fold
+1:200
+MusD
+R6
+Autophagy
+65%
+75 years
+satellite data
+RSV
+multi-agent geosimulation
+TERA
+Nrf2 and HO-1
+C, NS3 and NS5
+Extensive PMN influx into the lungs
+early childhood
+trifluoromethanesulfonic acid /water
+ethidium bromide staining in 1× TAE buffer
+3,169
+a larger supply of beneficial, compensatory mutations
+2.53 μM
+non-parametric tests
+it did not internalize cells in such an efficient manner
+53
+social and ecological
+caveolae
+mutant PfCRT
+rMVA-GFP infected cells
+Firmicutes and Bacteriotedes
+Transfer of exosomes to B-CLL cells
+orchestrating immune responses
+Ebola GP
+ethical reasons
+standard deviation
+LOX and RUNX2
+dual color ELISPOT
+GFs like AREG or HB-EGF
+prevention measures of VAP
+FAST proteins
+new computational methods had to be developed
+ribosomal frame-shift sites
+Argonaute
+Similarity among county groups of the included environmental factors
+influenza virus A/WSN/33
+NALP4
+NGS assays
+a TMB kit
+10.20±1.23 μM
+Liu, Yong; Li, Jinxiu; Feng, Yongwen
+epitopes showing weak interactions with HLA alleles
+putamen and the primary motor cortex were activated
+IL12p70
+Passaging, immortalization and cloning
+management, the reconfiguration of our radiology department, and the workflow
+decreased
+HA-mediated binding to the receptor
+between 0.2 and 0.75 × 10 6 cells/mL
+Sufficient ART
+control IgG
+22
+CCK-8
+glutathione Sepharose beads
+Astroviridae
+Extracellular vesicles
+1,439
+95%
+ACE2
+prokaryotic
+immunoglobulins
+alveolar structure disorder-associated ILD
+Charadriiformes
+endocytic pathways
+pharmacological
+Table 4
+4% formaldehyde
+77.9 kDa and 64.7 kDa
+36 h
+45
+33.1 kDa
+immunocompetent hosts
+pediatric septic shock
+C. noxius and C. suffusus
+4%
+relatively mild
+RG-RV-A16
+Total RNA from infiltrated leaves
+resistance
+4%
+67%
+archival collections of Select Agents
+modulates FACT binding
+gaps
+YX, LT, YL, and SM
+IMB-1406
+enhanced proliferation
+11
+information about the study setting, time, vaccination
+Infection with both "classical" and highly pathogenic strains
+Over 80%
+memory CD8 T cells
+heteroclitic
+physical units of surface radiance
+ΔNLS-hTDP-43
+192
+blood glucose level
+recycling of β1 integrins
+ImageQuant
+Protemist XE robotic protein synthesizer
+inter-rater reliability
+HIV neurovirulence
+dimers
+bat flies
+488 nm
+I t
+when apoptosis is suppressed
+discontinuation of treatment exposes patients to immunization against the transgene product
+10
+cc-by
+paediatrics
+Nursing Care Plan
+Bacteria
+xenobiotic induction
+amantadine
+Phe 339
+definite
+Gift of Life
+nausea, vomiting, or diarrhea
+pentamidine
+gene flow between Eurasia and the Western Indian Ocean can occur
+rhesus macaques
+adult asthma exacerbation
+90%
+airway resistance
+linear regression analysis
+fever, cough, sore throat, body aches, nausea and vomiting
+revertant
+10
+the content, and all legal
+conserved antigenic epitopes
+proprietary dye
+high viral concentration
+mass spectrometry
+CD8+ T cells
+hypercoagulable
+Open Biosystems
+Variations
+research coordinators
+high titer serum IgG
+treatment with drugs
+36 and 48 h
+credit card
+Neutrophil enrichment
+682
+85
+systemic and local sources
+Unconditional logistic regressions
+1 year
+dynamin 2
+influenza Apdm09
+a focus on those at society's margins
+FAK P875A/P881A SCC cells
+affinity toward human serum albumin
+maximin
+half maximal inhibitory concentration
+0.5%
+Coxsackievirus B3
+30 min
+calf intestine alkaline phosphatase
+Unique pathways
+random-effects meta-analysis
+RSV viral genomes
+40-50 per minute
+the key factors shaping the interests of individuals and public health officers
+survival
+retaining virulent parasites in the population
+healthy diet, regular exercise, limiting cigarettes and alcohol, and mental harmony
+151
+18%
+ZIKV production
+risk assessment
+cortisol hormone
+live cell imaging microscopy
+ASLV-K
+the intercodon
+statistically significant
+green
+brain resident cells
+activation of JAK kinases and activation of ras-mediated signaling
+24 to 48 hours
+metabolic
+lactate dehydrogenase LDH 11
+19
+Three
+six
+microbiota
+Warning fatigue
+freeze-dried samples
+Excretory and Secretory Products
+moderately attenuated inflammation
+The bone marrow
+249
+RNeasy Mini Kit
+Reaction dynamics
+silicone injection compound
+28.4%
+1713
+significant role of these proteins in influenza infection
+WT bacteria
+Sven Ove Hansson
+gp120 and gp41
+Travel patterns
+100%
+commensal bacteria that are resident in the nasopharynx
+OmpA
+Subclade 2
+a dimer
+VLPs
+nonreceptor tyrosine kinase
+chicken plasma
+children under the age of 5
+air sampling
+Sandwich ELISA
+INSERM Jean Mérieux BSL-4 laboratory
+CD8
+northern blot analysis
+IFITM3 7
+increased breath sounds with no crackles
+STORM super-resolution
+Sixty-one percent
+12.8%
+community-acquired pneumonia
+protease
+17 years
+heterogeneous cell types
+the treatment level
+unreliability of their clamps
+141
+MHC class I
+800 sec
+GEE models
+exacerbation of liver damage
+microbial GO annotations
+Horizon Discovery
+One to three
+3
+study replication
+worse outcomes
+preclinical
+A/WSN/1933
+soft agar colony formation assay
+Viremia
+data journals
+internal consistency
+co-infection rate
+Thirty-nine
+2
+RNA3
+toll-like receptors
+lung macrophages and dendritic cells
+anti biotic
+a high value
+HTSeq-count
+100% and 80%
+simulated data
+one
+101
+lipid
+elevated capsid expression
+adverse effects of ART or symptoms of opportunistic infections
+LMP1
+q
+miRNAs
+hemagglutinin and neuraminidase
+Immunofluorescence
+reverse remodeling
+2012
+Epidemic potential zone
+5 min
+antiviral
+K d
+a table with a list of potential binding sites
+cycloheximide
+six
+IgG isotype
+virus
+chikungunya virus
+vaccine antigen selection
+health professionals' recommendations
+35 d
+seroconversion
+$200
+fungi
+430
+an extended PK
+IIF with anti-F and anti-N antibodies
+50%
+infection-protection
+Metasim
+the structure of the model 14
+24 hr
+700,000
+15 days
+HA and NA
+ACE2
+Panel analysis with two biomarkers
+foreign peptide insertions
+f 12 and f 13
+expression of the viral structural protein prM
+Anti-HBs mAb
+Forty six
+very light
+cleared tissue culture supernatant containing virus
+malaria, tsutsugamushi, and shigellosis
+chromatin condensation and apoptotic bodies
+408 to 419
+TCR-pMHC structures
+234
+nuclear-encoded transcripts
+precipitation titration of LAMP products
+Gabinete de Prensa
+TLRs
+multiple organs
+Myricetin
+molecular signatures
+2017-2018
+5 days
+daily or more frequently
+8 weeks
+local mucosal and systematic immune responses against PEDV infection
+9 dpi
+3
+controllable
+chemically conserved regions
+epidemios
+preferential mixing
+Platinum ® SYBR ® Green qPCR SuperMix-UDG
+nuclear factor erythroid 2-related factor 2
+Environmental factors
+serine
+500
+five
+τ 0
+94%
+>500
+αor β-integrin homologues
+ICIs
+fluorescence recovery t 1/2
+analogous conditions
+dramatically reduced sensing capabilities
+12,500 tons
+more difficult cases
+Fn-bound exosomes
+2009
+CIA
+to the amount of total proteins in the cell lysates
+Vegetative spread and growth structure
+760
+560
+Chongqing City
+static control measures based on reasonable but imperfect parameter estimates
+mass drug administration of praziquantel
+1310-1653 amino acid residues
+listening to their peer farmers and observing what they do
+Aedes aegypti mosquitoes
+4.5578 and 5.8000 keV
+autophagy
+information on common causes and associations of febrile illness
+ACE2
+dilemmas of connectedness
+regulations
+specific cell-mediated and humoral protection
+Motifs F1 and F2
+chloroquine, ribavirin, and arbidol
+oligomerization of unconjugated NP
+rhinovirus infection
+Binding of the cell receptor CD4
+encephalopathy
+photosensitizers
+99.98% and 100% identical
+China
+30 mL agar
+PB2
+internalization
+TNF-α, IL-1β, and IL-6
+CD63
+Biotinylated target sequences
+Human adenoviruses
+Cellular translation
+Statistical estimation of 0
+two-to sixfold
+one third
+Up to eight
+language
+kernel methods and support vector machines
+positive predicted value and negative predicted value
+neutralizing antibody titer
+high levels of full-length antibodies
+1µg/ml doxycycline
+sterile equipment
+0.8 ± 0.2 Å
+Biotin signal intensity
+Supplementary file 3
+sneezing and coughing
+191871919
+5 9 10 9 transducing units/mL
+condoms
+clade 1 bat CVs
+Sex-and age-matched controls
+Yangtze River Delta
+serine or phenylalanine
+sterile saline
+anti-Ago2 antibody
+Dr David Tyrell
+leader
+42%
+64.61 kDa
+24 hour
+posttranslational
+12
+anaphylatoxin C5a
+-yNpl4 113-580
+18,823
+France
+Reverse Transcription System of Promega
+sensitivity
+Index
+The combined keyword index
+±0.3 nm
+Mouse GE 4x44K v2 Microarray Kit
+refractometer
+harboring a pathogen
+Nurses who work in the community
+Viridans streptococcal bacteremia
+5,568
+West Nile virus
+multiple linear regression analysis
+pseudoacinar
+251
+Rate4site algorithm
+UK EMRSA-15 transmission parameters
+P21
+Virus species specific extraction efficiency biases
+thirty
+caring
+SL-5S
+MAPK
+CFA
+psychological distress
+EEG and GSR
+Types I, II, and III
+Epidermal growth factor receptor tyrosine kinase inhibitors
+adenovirus
+SIRP
+2013-08-07
+VCP
+Exploring how data can be shared more openly and quickly
+Tissue specimens
+oxidation of DNA, protein, and lipid peroxidation
+infection with emerging influenza viruses
+Cell proliferation
+70%
+collate microbiology data of isolates from hospital patients
+Fisher's exact test
+The asterisk
+IL2
+3
+size-separation
+3.5%
+less inflammatory mediators
+proliferation in the blood
+infected horses
+viral supernatants
+ROK 84/105
+881
+Aliberti and colleagues
+current trends continue
+to control the docking run
+type I
+250, 000-500, 000
+Dual Use Research of Concern
+10 mL equilibration buffer
+R 0
+Ovation RNA-Seq
+1575
+differential
+Orphan Drug
+Three
+IFNγ
+Flight data
+Acute variceal bleeding
+14 days
+separate populations
+local characteristics, patient composition, and the demands of hospital professionals
+RT-LAMP assay
+four
+IFN-ß and IL-6 production
+φ t
+2-4 µg/ml
+real time monitoring
+0.62
+CHIKV
+Poland
+2-D Quant kit
+the links
+FastPCR and GeneUp
+1.0
+Stronger neominophagen C
+bovine serum albumin
+outbreak and emergence events
+virus titer and D-antigen concentration
+ELISA
+the internal market for biomedical journals
+innate immune recognition of herpesviruses
+mild
+broad-spectrum
+EGFR
+Luciferase specific activity
+SARS PLpro catalytic mutant
+103
+Cyclic nucleotides and ions
+GTW04 and GTW05
+feasibility and bioactivity testing
+AMPK
+5 µl of the resultant cDNA
+enrichments for these functional categories of genes
+FUS
+neutralizing
+antigen detection immunofluorescence assay
+Gap and ambiguous positions
+MRSA and VRE
+University of Toronto Health Research Ethics Board
+3 h
+LMP2
+156
+stronger correlations
+tryptic soy broth
+oxidative stress
+5 nmol/L
+M- Gleason 3 and M-Gleason 5
+5%
+45%
+26
+refractory
+early viral gene expression
+The Netherlands
+Iterative HFold
+all four amino acid substitutions
+innate immune response
+6.83×10 12 M -1 s -1
+luciferase reporter expression
+climate variability
+22.8%
+slightly higher estimates
+viral segments
+E13.5
+between 7 and 42 pfu
+significantly decreased
+C of JEV
+logistic regression modeling
+ability to easily map functional roles into subsystems
+specimens sent to participating laboratories
+cleave a DR6 ligand peptide from APP
+site I
+1 hr
+Group 1 and 2 viruses
+A524V and S528N or S528T
+recombination
+proinflammatory
+359.4
+0.5
+conventional
+Nosema apis
+odds ratios and 95% confidence intervals
+polyubiquitination of the target protein
+5.76 log 10
+pathway enrichment
+RVFV
+p.Lys329Glu
+throat swabs
+P. alecto or P. conspicillatus
+low response rate
+autophagy machinery
+A simple PSEP
+blockade
+antigen-specific functional antibody titers and T-cell frequencies
+2002
+sequence homogeneity
+Disease relapse
+two division cycles
+epitope records
+humoral
+they might have different functions and be regulated by different biological processes
+Ultracentrifugation
+mice
+between 18 and 44%
+collagens, albumin, and fibrins
+Predicted regions encompassing recombination break-points
+Dysregulated
+HIV-1 CM22-261
+to determine a future foundation for common language and understanding
+acute respiratory distress syndrome
+Glutamate
+24 hrs
+flowCore R package
+3 days
+Demographic characteristics
+2.7 × 10 4 cells/0.1 mL
+further examination
+n*m
+Parkinsonian features
+bone crystals, collagen molecules, and non-collagenous organic proteins
+treatment procedures
+3.2%
+lymphocyte
+functional antibody titers
+EPs 7630
+5
+autoimmune
+Bronchitis or bronchiolitis
+3
+V2C cells
+One microliter from each dilution
+mixed LBMs
+80%
+Protective behavior associated with influenza outbreaks
+GenBank
+11 days
+APP processing
+Six
+DCs and macrophages
+0.5 %
+Branch #2
+pGEM-T-Easy vector
+caveolae-mediated
+monolayers of HEp-2 cells
+Mycobacterium tuberculosis
+less efficient envelopment of mature virions
+0.1 mg/ mL
+signs of active gastrointestinal bleeding
+P<0.05
+Thirty
+the sites interacting with ALP
+opsonic
+differential usage of three low frequent codons
+Acinetobacter baumannii
+asymmetric viral RNA replication
+reinforcing local suicide prevention activities
+10
+proinflammatory
+six
+Vpg
+how we would respond to that
+A list of all the dental faculties
+cellular locus of NKG2D ligand expression
+the opposing line
+Mineral oil
+A chance to become resistant to PRRS
+may act in the same manner and bind similar factors in human cells
+infectious virus production
+Dendritic cells
+ACL300
+CD1D-restricted NKT cells
+Sixty-one
+fiber-optic probe
+yellow
+siRNAs
+four
+difficulty with aerosol delivery, cost and potential harm to healthcare workers
+Phylogenetic
+identified roles
+q m Þ
+stochastic gradient boosting
+dose selection for phase 2b
+viral, parasitic and bacterial infections
+α4GnT
+two
+DUBs that formed covalent adducts with the indicated probes
+15
+quantitative PCR
+SupTOC-LPS-24h
+1996
+MDCK
+longer
+nucleolin, B23 and fibrillarin
+10D3 and Mab51
+May 2017
+zip code regions
+BHK-21 cells
+1 × 10 6 /µl
+Bacillus anthracis
+P
+22.8 ± 6.8
+N V and N H
+codon usage and dinucleotide composition
+Vasopressor therapy
+Eleven
+PNA coupled to Alexa Fluor 488
+Amyloid plaque burden
+ALI
+poly-L-lysine coated glass coverslips
+2 min
+prolonging the effectiveness of antiviral drugs
+preferential
+IL-1α
+compactness factor
+indirect ELISA
+6% to 16%
+commercial trypsin inhibitors
+Faecal
+clustering of receptors within the same cell surface
+DCs
+western blot analysis
+template-strand T30
+1%
+R software
+IFN-ω
+three
+10 days
+6.8%
+137,000
+children and young adults
+outcomes of collaborative efforts
+IDP profile analysis of hypothetical proteins
+October 20, 2014
+citrate buffer
+Disaster food
+10 kb
+monoclonal antibodies
+H. pylori WT or Δggt
+protective
+advance our understanding of post-EVD immunology
+Protein sequence alignments
+351
+phage libraries
+95%
+Means restriction
+public ground transport
+Leeds Clinical Trials Research Unit
+the maximum likelihood
+6 hours
+25%
+four
+volatile metabolic signatures
+Streptococcus pneumoniae
+critical
+frameshift
+high ventilation rate
+twice
+D 2 DR
+PD-L1
+fine scale discrimination
+Seizure-like
+5
+2 days
+dispanin family
+Adult stem cells or progenitor cells
+specific
+conjugation of SUMO molecules on multiple lysine residues
+paramyxoviruses
+flattened pellets at the bottom of tubes
+MRPL19
+higher titers of HA-specific antibodies and stronger T cell responses
+enolase
+University of Utrecht
+every 2 weeks
+10 min
+541
+50 µL min −1
+7%
+250-370 g
+an institutional review board -approved research protocol
+P1F12
+the cap of the viral mRNA
+8
+Ang II
+lymphocytopenia and hypoxemia
+one
+the development of robust vaccines
+57%
+significant difference in expression of total bactin
+0.3360.09
+HIV replication in cell cultures
+C3a and C5a
+ESTScan
+specimens
+PTGS2
+additional ORFs encoding putative proteins
+free movement of people
+six hours
+765
+gel electrophoresis
+translation of HIV-1 structural proteins
+6 mm
+amino acid sequences
+AIC and an F-test
+Four
+MxA
+620 000
+variability
+seven
+Circular dichroism
+45
+1 mo
+water-soaked diet
+informative transmission events
+The above sRNA dataset
+50%
+cisatracurium
+Viral RNA
+five
+human rhinovirus
+black and white
+strong support
+Eight week old female BALB/c and C3H mice
+200 million
+Separate Neighbor-Joining trees
+poor
+canonical
+ANOVA
+Purine or pyrimidine biosynthesis inhibitors
+twisting of 15
+95%
+thousands
+71%
+FRNT
+316
+sensitivity
+C and K
+glycoprotein processing
+computer-aided approach
+$1750 per day
+Body mass index and plasma albumin concentrations
+TcdC
+low viral copy number
+Five
+Escherichia Coli
+Plugins
+binding to a partner
+When fatal outcome was analyzed
+Wza
+export factors and adaptor proteins
+chemical, structural and biological
+2 CFU
+high-quality reads
+translation
+recombination estimates
+55
+Viral burden
+interleukin-2dependent T-lymphocyte proliferation
+10 h
+Free energy dG values of folding
+11.5 ± 2.5 μM
+5000
+overlap PCR
+vaccine properties that promote efficacy
+12 h
+sodium pentobarbital
+logarithmic scale
+Laboulbeniales
+diarrhoea
+Cotton
+pET32a
+the infection has the potential for sustained transmission
+within-household transmission
+Antibody titers
+SeqMan
+KX756441
+Collection of real-time translation traces
+high number of included studies and patients
+postentry stages
+intermediate monocytes
+kidney protective effects
+250
+20%
+1:40
+negative
+wildtype CCHFV
+A trafficking checkpoint
+half
+PKV
+28,392
+cysteine proteases
+Titres of IgM and IgG anti-HEV antibodies
+privacy and ethics
+Adrenal suppression
+ASFV
+piecewise constant function
+More than 2000
+four
+Renilla Luciferase Assay System
+50x MOI
+I C
+Fourteen
+V2-apex bnAb epitope
+14 to 120 days
+7 days
+oxidation
+levels of +1 frameshifting
+200,000 days
+iterative
+27
+SDS-PAGE
+collagen deposits
+Hit drugs
+S2 Protocol
+Corticosteroids
+three
+low molecular weight protein
+three proteins
+higher
+15.9%
+filovirus entry into host cells
+postnatal respiratory morbidity
+55 ± 4%
+4%
+payments to NIH and some NIH scientists
+cytokines and chemokines
+.
+equation
+2166
+95%
+Creative Commons Attribution Noncommercial License
+cytotoxicity
+sporulating EV
+Ca 2ϩ
+cognitive impairment, depression, and autonomic disturbances
+Trp371 at the coil and Ile375 at the short helix
+PhyML 3.0
+regions of predicted disorder
+enhanced local dynamics
+anti-atherosclerotic
+Constitutive expression of antiviral ISGs
+efficient clearance of HCV and prevention of posttreatment relapse
+method 3
+untreated cells
+5 μl of RNA template
+four
+gene set enrichment results
+155
+expectations with antiviral Abs
+Promega
+climatic variables
+Farm-1
+node to node connectivity
+Three
+1.0
+separate computer runs
+monitoring of a fluorescence amplification curve
+airborne transmission
+ketamine
+Physical HRQOL
+an epidemiologic risk factor
+eight
+pACYCT2
+severe hypoxemia and uncompensated hypercapnia
+who infected whom
+a 3'CITE
+access to leave
+virusadsorption-elution
+Belgian Science Policy Office
+Peroxidase-linked assay
+Photoshop CC
+3 h
+48-72 hours
+altered islet blood flow
+Mut-2 infection
+PX-UV
+Protein concentration
+~2%
+Trypsin
+1AE4-1AE5
+ISGs
+97 to 100%
+Pseudorabiesvirus
+virus allantoic fluid
+raw milk
+90-95%
+10 million
+intraoperative transfusion
+infants
+positive
+leukosis
+IgA
+Integrated optical density to area ratio
+Monocyte-derived
+subcutaneous, intradermal, and intramuscular
+injection of tunicamycin can induce acute liver and kidney damage
+58
+4G2
+move towards the front
+Recombination event 3
+mobile communities
+positive predictive value
+Madin-Darby Canine Kidney
+IFN1 phylogeny
+quantitative RT-PCR
+V79A
+WS
+maternal Abs
+ACE2
+NoV
+E 0
+300 to 450 nm
+glorious progress
+the copyright holder
+Parameters
+C++
+15 × 15 minutes of arc
+Fmoc-Lys-Wang resin
+Targeted sequence amplification strategies
+ruminant
+marginal
+CCID50
+68
+21% higher accuracy
+intracellular
+network structure
+1 h
+β-Propiolactone -inactivated virus
+register an account associated with a user-provided email address and password
+1 minute
+FAK-expressing cells
+sensitivity analysis
+$60%
+higher level of cytokine secretion
+5%
+antiviral
+8, 350 Da
+~10%
+ATII cells
+Transthyretin
+intermediate
+Mammalian cell culture
+soluble guanylate cyclase
+ten
+refuse to be seen by a health care provider
+Four
+boredom
+nsp11
+NF-κB
+picorna-like viruses
+Trizol
+Age-related increases in leakiness
+Brain samples
+2%
+12
+animal bleeding
+NMD-resistant
+swine flu
+PPI
+anti-Fas
+self-reported information
+100%
+oocyte maturation
+helix
+virus replication
+23°C/50% RH
+Parameter distributions for N and p
+critical illness polyneuropathy and myopathy
+lower
+Glyceraldehyde 3-phosphate dehydrogenase
+neutralization titers
+Probit analysis
+Phenix refine
+antimicrobial treatment
+phase analysis
+Node color gradient
+intensive turbulences
+DNA
+rheumatoid arthritis
+miR-HA-3p antagonist or control antagomir
+IF staining
+saline group
+pfcrt cDNA
+17,993,689 to 27,248,309
+Three
+dangerous clones that react with self antigens
+IL-8
+NEAT1
+novel functions of noncoding genome
+JEOL JEM-2100F
+MAPK signaling
+Quercetin
+the treating physician
+RPB2
+p2luc reporter vector
+92
+Various models
+pathogenic
+health workers
+tunable roadblocks
+3%
+natural selection
+high levels of PV proteins
+75%
+6247
+BALs and lung homogenates
+lower uncertainty of root state reconstructions
+Six hr
+IBOPE International net-AGB Nielsen Media Research
+Ubiquitination
+possible
+Wheezing
+high-throughput
+Slope FE
+pigs
+Geographic information systems
+receptor interference pattern
+o-phenylenediamine and H 2 O 2
+Evolution
+2 days
+0.916
+viruses
+Ammonia stripping
+a hallmark of SFTS
+four
+twice a week
+cancer pathogenesis
+Paired T-tests
+licensed
+T cells with the γδ receptor chains
+day 4 kallistatin
+inversion sites
+Clinical trial design
+cellular membrane
+real time PCR
+time-ofaddition and dose response experiments
+p ij
+diverse inorganic nanoparticles
+csn8
+vaccinia
+Student's t-test
+incidence rate ratio
+24
+chronic heart disease and bronchial asthma
+puncta positive
+13.5
+mouse M13 mAb
+ETEC infections
+intestine, lung, and liver tissue
+Fisher's Exact Test
+SAMD9L haploinsufficiency
+four
+when using the anti-bird IgY secondary antibody
+Gq
+Seven
+BCA Protein Assay Kit
+ferritin
+Improvements in surveillance and diagnostics
+Descriptive
+p65/RelA
+Genomic DNA
+cleavage of eIF4G
+Box and whisker plots
+WGD-derived
+7 days
+CART
+Estimated prevalence
+preexisting immunity and cold chain requirements, and lingering safety concerns
+rabbit hemorrhagic disease virus
+Crustin
+carboxyfluorescein-tagged PMOs
+Cell lysates
+fluorescence intensity
+Sepsis
+cholinergic hypofunction
+yeast-optimized
+tryptophan and cysteine
+95%
+PENK
+targeted biosensor
+survival rates of 90%-100%
+1,997
+digestive enzyme secretion and gastric motility
+mean fold changes ± standard errors
+monoclonal antibodies
+FeLV envelope protein gene
+allows the insertion of any sequence to generate the fusion protein
+The proper representation of both the sequence and structure of the interacting partners
+vesicular stomatitis virus pseudotypes
+neurons expressing high levels of viral proteins
+Four
+High-Capacity cDNA Reverse Transcription Kit
+5a,b
+52 ms long
+drops glanapon
+5 µl of lyzed solution
+Hantaviruses
+coinfecting variants
+A 5 diag
+569
+a natural leaky stop codon
+agarose gel electrophoresis
+three
+ceiling effects
+11
+pdpC
+Decoy receptor 3
+J. communis and J. oxycedrus
+inversely regulated
+difference in race
+27
+chi-squared tests
+0.26 mmHg
+hypoxic
+allograft fibrosis
+faster diluted
+60
+NHC-5=-triphosphate
+dry and dusty
+Dengue virus infection
+electric field force
+Isopropyl thiogalactoside
+a Control Area
+T cells
+perceived authority, trust, and situational control
+macrophages
+virus-specific antibody and T cell responses
+DUB specificity
+TransIT-LT1
+Driving pressure
+six
+including livestock
+low intensity noise
+blood and lung tissue samples
+to remove SDS and renature the proteins
+CRISPR/Cas9 system
+biological duplicates
+>10 kb
+1 week
+Site-specific binding of several inhibitors
+global defects in induction of IFN
+Thirty-three
+empty arrowheads
+deciduous
+expression by >5 fold
+hundreds
+GPC
+PR2
+phage display based epitope mapping
+> 50 %
+Excellent comprehensive reviews
+dual-host affiliated ISFs
+mass spectrometry
+compound partitioning and energy estimation of appropriate fragments
+lack of similarity
+diversify
+wound agents
+the stability of the pMHC-I complex
+γ = 1
+hMPV infection
+Rule induction
+mRNA decay assays
+HMPV A2
+RNApure Virus Kit
+January 2007 to December 2013
+anchorage-independent growth
+skunks and the foxes
+systemic inflammation
+0.1% sterile buffered peptone water
+AmelSCRB8
+Peak number and peak height
+recent data
+25.38%
+Ten
+distinct activation profiles
+Δ F max
+85%
+Endoplasmic reticulum
+350 -1800 Da
+quantitative information of θ
+an ICOA
+tattooing and scarification
+84%
+peripheral inflammatory stimuli
+In-hospital mortality and length of stay in the hospital
+significant reduction in both intracellular and extracellular virions
+Western blot and RT-qPCR analyses
+liver and the lung
+the distance between atom 2 and atom 1
+1
+proinflammatory chemokine profiles
+Media samples
+4,322
+microcephaly
+formation of atrial septal defects
+terminal
+IRES-dependent
+100
+postoperative morbidity and length of hospital stay
+training
+immunofluorescence
+N
+five
+11
+Proteomic data analysis
+Ulcer
+50 mg
+seniors
+breakdowns in IC measures
+peptides N10 and C12
+epidemic potential
+in vitro model of the lung
+60
+50-100 million
+temperature
+membrane-associated capsid
+10-20 mg/ml
+infections of RV1B
+Microarray
+100 GPID 50 of homotypic virus
+Sampling volume
+gp350
+radiation attenuated sporozoites
+dsRNA
+An increase in volume and acuity
+KGH
+45 years
+ASFV NP868R
+5950
+Catalan Influenza Reference Laboratory
+statistically significant differences between treatment groups
+Argentina
+PET
+original articles published in Chinese
+LC3 conjugation system
+Íris Eva Hauksdóttir
+estimation
+The number of macrophages containing engulfed cells
+3 h
+Video S2 NA-deficient influenza virus
+mRNA poly tail shortening
+data on the degree distribution of contact networks
+strong IFNβ promoter activation
+efficacy data
+enhanced viral replication
+different phenotypes
+previous TB infection and diabetes mellitus
+N-acetylmannosamine and pyruvate
+nurses and paramedics
+surface residues
+32
+Syndromic surveillance of influenza-like-illness
+70%
+future transcriptomic analysis
+Parvoviridae and Coronaviridae
+conclusions over all possible parameter values
+community data
+virus-induced apoptosis
+20 to 61
+the most dispersal-limited
+8 years
+human defensins
+10,000
+Th1 and Th17
+vascular endothelial walls
+p53
+81%
+Metropolis-Monte Carlo
+54
+11.3
+less than 5%
+15%
+230
+oxidative stress
+IFN2
+viral replication
+0.0195 and 0.0053
+ZINC36728034
+interpretation
+SLAM
+suspension multiplex
+GC-rich
+livestock industry
+Monoclonal antibodies coupled with the blockade assay
+positron emission tomography
+GENSCAN
+Cervix cancer
+RIPK1
+midnight
+Active Motif
+seroconversion
+immunoglobulin
+confocal
+loxP-STOP cassette
+60 min
+monoclonal antibody 17b
+VRC01 CDRL1 and CDRL3 loops
+mesenchymal stroma cells
+ISRE
+400
+biosecurity
+EF, -TUB, CypA, and RPL12
+15,054 nt
+hierarchical logistic regression model
+each set of partial haplotypes
+IFN-α/β
+reduce quantity and quality
+automated
+Milk sample
+MicroRNAs
+697
+passive
+B. bronchiseptica
+C 16 -palmitic acid
+qRT-PCR
+Enteroviruses
+12,285
+helical stent retraction
+p=4.86E-03
+papilloma virus, scaly leg mites and mycotoxins
+near-native molten globule-like folding intermediates and orphan subunits
+alert and response mechanisms
+helper phage VCSM13
+immunoconfocal
+Médecins Sans Frontières
+isotopic
+30 min
+SV-A
+high titer
+Three
+Aspergillus foetidus slow virus 2
+risk stratification
+myosin heavy chain expression
+pre-and post-peak milk production status
+extremely low
+pneumococcal outbreaks
+Pearson's analysis
+Student's t-test
+Hypoxia inducible factor-1α
+SEV-induced activation of the IFN-β promoter
+increasing time of divergence between types
+trachea and lungs of infected chickens
+64%-82%
+biopsy specimens
+Th1and Th2-type helper cells
+2007 Uganda outbreak
+interaction terms
+acute phase reactant response
+in vitro cell line assays
+12 hpi
+The control of antibiotic resistance
+The sequences surrounding AUG1
+Feces
+Invitek MSB Spin PCRapace Kit
+immunoglobulin replacement
+Three
+lysate from cells infected with UL21a deletion virus
+KYN
+-29.9704 kJ/mol
+87
+decapitation
+Myeloid differentiation factor 88
+10%
+55
+Seven
+onset of transmission
+aberrant recombenases transcription
+nonspecific psychological distress
+increased virus sensitivity to antibody neutralization
+copy choice recombination
+ICTV 8th edition
+ILI
+various cells
+Screening of libraries and studies on derivatives of small molecules
+Cell networks
+Linear regression analysis
+incurable cancer
+TLR3, TLR7/8, and TLR9
+CD4 + CD25 + T cells
+IFNG
+candidate constructs
+BVDV-1c strain AO554
+when the genome sequence has been fully resolved
+VB
+Ischemia-associated retinal degeneration
+understanding the implications of changing exposures on public health
+three
+hypertension, diabetes mellitus, coronary artery disease, and chronic kidney disease
+potential risks of zoonotic disease exposure
+4 to 15%
+PADRE
+colistin
+two
+tumor weight and volume
+the greatest dilution with OD ≥0.1 after background subtraction
+domestic or international pandemic outbreaks
+7 days
+one
+three
+the manufacturer
+ethanol
+via the exo-probe
+Mas receptor
+A system
+High Yield Capped T7 RNA Transcription Kit
+T oxoplasma gondii
+novel methods for the prevention and treatment of schizophrenia
+4
+PNG
+CUCUCU
+30 min
+otherwise
+induction of a robust antibody response
+fever, anorexia, and marked hematologic changes
+probiotic
+one
+IPO8
+Viral
+OCT4B mRNAs
+knee movement
+DNA repair, chromatin organization and DNA binding
+Bill & Melinda Gates Foundation
+three
+21 mmHg
+source control
+Institutional Biosafety Committee
+twice or once daily
+six
+early and sustained replication
+culling
+Ebola
+western blot analysis
+90%
+increased
+peripheral blood and lung samples
+over 30%
+higher than estimated
+vectors
+Active serological surveillance for viral antibodies
+PiCCO and Swan-Ganz
+increased exponentially
+Enterovirus A
+molecular beacons
+Euclidean distance
+fragment I, fragment II and fragment III
+by obtaining the vaccine on time
+complete lethality
+.100 cells/mouse
+nylon wool column passage
+DNASE I hypersensitivity studies and gel shifts
+Relative dinucleotide bias
+to correct hypovolemia
+unpaired t test
+hemodynamic parameters
+Short-chain fatty acids
+Cell culture medium
+3.8
+1999
+PCR-based techniques
+10 μ g/ml
+Six-eight week
+interest
+how the predicted TS probability distribution differs from the predicted neutral probability distribution
+nursing documentation of hypoxemia
+pinyin
+0.5 µmol/L
+100%
+Open Bable
+emerging infectious diseases
+fewer HFMD cases and a lower search volume
+lower protection
+viral genotype
+disruption of the leader± body TRS duplex
+Neural precursor cells
+30 h
+ClustalW version 2.1
+fluc genes
+Phylogenetic
+a minimum number of parameters
+30%
+DBS samples
+Obesity
+feedlot transport
+AT-II cells
+30 days
+CaMV is able to recombine
+two samples
+monitor the child and ensure proper hygiene
+ViaFect
+pseudotyped-virus
+NS1
+22%
+TRM is reduced
+TMP-SMX and fluoroquinolones
+two
+Induction of miR-21 expression
+glucose
+intervention focused on children
+60%
+Recombinant 4EBP1
+mechanical
+71
+FEI Tecnai Spirit transmission electron microscope
+sepsis
+the experimental condition
+the scattering curve
+sequential evolution information
+11
+a national response
+more than 3-fold EC50
+Biolayer interferometry
+500 million
+shRNAmediated silencing and nanobodies
+78%
+rats and mice
+Image J Software
+the number with symptom onset on day s
+59
+50 µM
+Plasmid DNA
+The first imported patient
+three
+viruses
+Rituximab
+38%
+miRanda and TargetSpy
+Nutrient Mixture F-12 Ham
+G ¼ À t 0
+increasing nasal residence time of antigen
+piezoelectric dispensers
+37.3 ± 3%
+1 mM PDS
+dengue infection
+virions
+broad functions that relate to the growth and development of a cell
+St. Boniface Hospital
+different factors
+binding with various compounds
+328
+to conserve the protein sequence
+T-cell factor /lymphoid enhancer factor transcription factors
+Type I IFNs
+k b
+a family of small non-enveloped viruses
+oncolytic and tumor vaccination
+Institutional Animal Care and Use Committee
+over a thousand
+6.34
+Tris-glycine gel
+Serum from healthy flounder
+Spray factor
+Mtb
+PMA
+malaria infection
+Smart Minimizer
+22, 23, 25 GeoSentinel and EuroTravNet
+Dimethyloxalylglycine
+Kaplan-Meier survival plots
+robust levels of PSMA-specific human IgG
+ACE2, Ang- and Mas
+Na + and Clions
+the diagnosis of ONFH
+assessable walking passes
+ISPPD-12
+Autophagy
+full-length RIG-I or melanoma differentiation-associated protein 5
+Facts and figures
+three
+anti-polyHis monoclonal antibody
+crescent-shaped forms
+mean values ± SEM
+Thirteen
+IPA core analysis
+lytic replicative cycle
+CCL21
+18 kDa
+Tail vein blood
+Package DESeq2 version 1.14.0
+Effective surveillance
+phagocytic cells
+triclabendazole
+10%
+Drugs that target host proteins
+Multiplex detection
+TUNEL-positive cells
+Pseudonyms
+10.3389/fcell.2020.00099
+GraphPad Prism 5
+1′-OH-MDZ
+adverse fitness effects
+wild type mice
+epigenetically controlled genes in the SP cultures relative to ST
+exon 51 in the DMD gene
+LWL1
+ECoV
+silica gel column chromatography
+core oligosaccharide
+cells acquiring exogenous mitochondria
+different markers and traits
+ABTS peroxide substrate solution
+eight
+three
+expert
+CPIs
+1.5
+control resources
+Pneumocystis jirovecii
+cell lysates
+I expression and bound peptides
+four
+Twelve months
+41
+B cells
+Picornaviridae
+Carbohydrates
+PFC's
+Aedes aegypti
+Data on statin dose or frequency of administration
+wrist watch and jewellery
+influenza vaccinations
+10 fg of genomic DNA
+Sixty
+delaydifferential equations with constant delays
+a regression curve
+inhibitory cellular responses
+Primates
+SEM
+Fifty-five
+knockdown of human SAMD9
+demographic
+137
+80-90%
+Pyroptosis
+50
+acquired immunity to the transgene product
+Artiifact
+metagenomics/transcriptomics
+the pylorus
+24 h
+Acute respiratory distress syndrome
+16
+Gram-stain
+Mexico and Victoria
+Protein Data Bank
+complementary
+stem 1
+bi-phasic
+intermediate or negative
+20%
+Image Lab
+data
+Biodegradable
+88
+Quantitative real-time reverse-transcriptase PCR
+bovine PDC-E2
+lymphnode, bone marrow, liver biopsy as well as autopsy material
+½A{B/C
+5 min
+instructive roles
+20
+IMG/VR v.2.0
+two
+1 h
+Rice cropping intensity
+1 month
+CT imaging, FDG, and NaF PET
+reduced
+flesh eating disease
+2 months to 10 years
+molecularly targeted therapies
+type I
+short half-life of immunoglobulin
+clinical
+Maxadilan
+an alternative inoculation route
+likely matches
+100 kV
+11
+vancomycin MIC
+the dose-response relation
+3 weeks
+temperature and the relative humidity
+The efficiency of deletion
+IBVs
+Karin Boucke
+Santa Cruz Biotechnology
+Four
+Infection with RSV
+five
+compensatory base pair substitutions
+Protein Data Bank
+New Zealand
+putative false positives
+both live and permeabilized cells
+asymptomatic infections
+viral replication
+FP7
+Purified gp90 protein
+microenvironmental
+HRV natural evolution
+Household-based studies
+satisfaction or knowledge acquisition
+sepsis
+good precision and repeatability
+16
+protein composition
+Anopheles stephensi
+91%
+The accuracy of expected value calculation
+Haemodialysis
+tse TSE
+western blotting
+Information Technology
+210/µL
+no additional steps for vector preparation were needed
+60-70%
+16%
+LPS and bacterial DNA
+139
+CXCL10
+Informed consent
+1 ml of faecal preparation
+cleavage site prediction
+light chain attachment
+cellulitis
+biomarker pattern recognition software
+Endotoxin-induced ARDS
+MatInspector
+representation of heterogeneity across different wards
+survival of virus in high titres for prolonged periods
+CCL20, CD36 and IL18RAP
+standard deviation
+China
+assessing the strength of various muscles groups in the upper and lower extremities
+active T cell response
+hepatitis C virus
+2009
+PCD
+oligonucleotides SF226 and SF227
+2000
+compensatory changes in the pathogen genome
+increasing the concentration of scrambled siRNA control
+total protein
+Santa Cruz Biotechnology
+comparably
+eEBLL-1
+global climate change
+Chun-Huei Project
+VEGFA
+Nelfinavir
+99%
+noroviruses
+Supplementary Information
+87
+newly identified alleles
+chronic complications or sequelaes
+Blood samples
+10000
+50%
+cross-protective immunity
+Non-ionic detergents
+36%
+a central part of an antibody
+Lagos State
+A/Vic/75
+Blood
+50
+restriction endonucleases
+RV
+seasonal
+macrophage protein expression levels
+greatest
+coffee ringspot virus and orchid fleck virus
+forward stepwise approach
+murine rotavirus
+four
+autoregressive model
+15 minutes
+Two
+over 10 000
+rapid localized amplification
+HCV epistasis
+secondary bacterial or viral infections
+Hand-washing
+C-2 0
+polymorphic rash, conjuctival changes and lymphadenopathy
+a professional textbook
+Four
+vaccination
+48 h
+full human adaptation
+KLH carrier proteins
+mouse hepatitis virus and equine arteritis virus
+control staining of cell nuclei
+eluate
+Shimadzu 2550 spectrometer
+interfering HMGB1-heparan sulphate interactions
+Saudi Arabia
+Ang II
+2019-nCoV
+15 µM
+Immunoglobulins
+outbreak data
+ILD
+all index case-patients
+38
+BTV induced cytopathic effect
+Eleven
+interview methods
+our ability to predict and control the expression of randomly inserted transgenes
+Human-to-human transmissions
+4-20%
+32
+regulation of protein sorting
+synthetic peptide conjugate
+surface Abs and LIVE/ DEAD Fixable Blue
+stable mesothelin overexpressing Panc02 tumors
+AIV
+traditional medicine
+very limited
+allergens and anti-metabolite proteins
+40%
+three
+enveloped
+dS values
+three
+70%
+less than 10%
+A negative HIV certificate
+127
+iatrogenic immune suppression
+FITC
+H7N9
+43-64%
+XBP-1
+time-since-infection model
+Table 2
+cell shrinkage, membrane blebbing and karyorrhexis
+published data
+Mean Absolute Percentage Error
+national health security
+rVSV
+PKR
+antioxidants
+HPRT1 and GAPDH
+low pathogenic
+one day
+antimicrobial resistance
+aas 149-157
+Two
+Heterogeneity
+ADAMTS13
+young adults
+Much further work
+relative risk reduction
+cleaved receptors
+AIV
+four
+influenza
+preventative counseling and condoms
+High-altitude pulmonary edema
+human-tohuman chains
+when γ is varied
+the derivative of the numbers in compartments with respect to the time
+cell death
+results
+ABCPred
+extracellular or secreted proteins
+Sin3-associated protein 30
+Two
+Infectious diseases
+D. discoideum
+γ
+cj0623, cj1575 and cj0669
+33.1 million
+lineage 9
+lymphopenia
+infectious virus persistence
+Addgene
+expression of early viral genes
+locally determined empirical measures
+immune
+ρ
+DNase I
+material resources or emotional support
+Creative Commons Attribution 4.0 International License
+130 μl of supernatant
+16
+the presence of isothermally generated amplicons
+6 months
+IBV
+nine
+conditioned medium from PPRV infected cells
+AP peptide conformation
+according to their average binding energy
+tumor cell killing by parvoviruses
+Neisseria gonorrhoeae
+Commensal
+exfoliation of superficial urothelial cells
+90 min
+gallotannins
+18.77, 15.48, and 12.82
+Hepatic inflammation
+MG132
+CMFDA
+liver, spleen, heart, salivary gland, and brain
+Four
+variation in the minimum budget
+VEGF signaling
+primary infection
+deep sequencing
+Twenty four
+near the octameric interface
+complementary
+48h
+desialylation endpoint titre
+Twelve
+intervening AO within the fragmented DNA
+Further investigation
+school-going
+soluble factors and metabolites
+38
+536.4 mg/ml
+an extract of Chinese star anise
+LPS and supernatants
+each city's error level reaches nearly 35.68 cases per week
+Targeting via extracellular activation of the nanocarrier
+validation
+endothelial cells
+Duration of exposure and ambient concentration of the substance
+10
+Markov chain Monte Carlo
+2Á5 9 10 4
+Macrophage plasticity
+influenza protein type a
+Trizol
+hepatic and renal
+8.7%
+maintenance of viral persistence
+age older than 65 years and hypoalbuminemia
+Fifth Center Hospital of Tianjin
+Bhattacharyya distance
+conformation and function
+P I
+E protein
+a passage of greater than 5
+13%
+the nucleus
+sudden temperature changes
+treated cells
+influenza A and measles
+Pseudomonas syringe
+ATP-fuelled molecular motors
+immune cells
+AS1411
+Hot and humid
+improved
+uptake of beads
+1942
+influenza
+Pa2 and Pb1
+temperature
+a commercial license
+Th2 differentiation rate
+27
+Nucleotide BLAST analysis
+À1 RF motifs
+Nineteen
+3
+Ae. albopictus
+G+C% atypicality
+obtaining a meaningful quanta generation rate
+5 th June 1963
+distrust of authorities
+89 to 100%
+Skin abrasion using an abrasive paper
+immunological recovery
+molecular replacement method
+mecA gene
+absorption
+ADAR-deficient MEFs or HeLa cells
+human pathogens
+production levels of more than 1 g IgG
+5%
+70
+infected
+attachment to the diaphragm
+BTV-1
+text mining
+0% to 40%
+three
+PiCV infectious status
+Dhx58
+648
+Data about transmission to healthcare workers
+HRCT of the chest
+base pairs
+Illness onset
+ZNHIT3
+recombinant virus
+their specificity
+p65
+heavy metals
+γ i
+quantitative
+multiple de novo assembly tools
+Excessive ROS production
+topologically complex and dense parts of the human PPI network
+another house was randomly chosen for inclusion
+ISG ORFs
+enveloped
+Nonlabeled oligonucleotide
+80 μL
+Protein Data Bank 49 entry 3ZZA
+the most conserved genome areas
+Samples
+40%
+7,000
+influenza
+Nucleic Acid/Protein Analyzer DU 1 800
+Temperature dependence of the inhibition constants
+δ-Crystallin
+commuting across provinces
+Previous reports
+7
+30 min
+ADRP/perilipin 2 protein expression
+Que-treated WS hMSCs
+non-retroviral integrated RNA virus sequences
+transplant vasculopathy
+strain-dependent transmissibility
+293T cells
+German psychologist Schwarzer
+Zymo DNA clean column
+absence of active
+interplay
+Outer primers
+3 of 11
+rabies epidemiology
+coevolve
+PER1, PER2, CLOCK, and BMAL1
+intestinal lamina propria DCs
+day 2-3
+NCBI Insights
+5,000
+VP2 and VP3
+intestinal focal adhesion kinase
+FFA
+genetic drift
+pneumococcal
+BAL
+symptom severity
+cardiac failure
+The preservation of A 4 under increased GC pressure
+1 h
+12
+laminin 332
+PQC factors
+prostate-specific membrane antigen
+JEE scores
+CD45-positive
+Acute respiratory distress syndrome
+similar to Survey 1 and 2
+new probes
+19
+0.81 ± 0.04
+FlowJo
+pre-existing immunity
+An interaction term between study year and intervention receipt
+GO assignments
+Leishmaniases
+Atg8 lipidation and elongation of the autophagosome
+ventricular fibrillation
+H5N1
+0.78 to 1.56 µg/mL
+H1N1-specific antibody responses
+One hundred and four
+More evidence on the underlying biological mechanism of HFMD transmission
+ten
+Carl Zeiss LSM 710 confocal laser scanning microscope
+liver-specific
+further annotation
+15%
+Physiological changes associated with pregnancy
+GCSF
+total number of carbons and double bonds
+expression of IFITM3 isoforms
+seven
+liposomes
+7 d
+8mM
+mineral nucleation
+reversible Markov chains
+rgPB2-K627E
+IAPV
+circular dichroism
+environmental trends
+increase the death rate
+Labeled RNA
+enhanced Gag cleavage
+diabetic
+TSB
+three point bending assay
+decreased SP-D serum levels
+severe disease outcome
+an MG
+19-22%
+enhancing epitopes
+Changes in TFH transcription factors
+Antigen-specific human memory B cells
+5%
+within first day of the fever
+arthropod borne
+15%
+168
+4%
+mathematical
+one
+Table 1
+gp41 and gp120
+raccoon and Canis lupus familiaris
+Peculiar
+2 g/ml human fibrinogen
+gene order
+species evenness in clusters
+personal hygiene, water treatment and food production
+human corneal and conjunctival tissue
+Trx1 and CD30
+adenosine-stimulated
+Juliana Idoyaga
+China's 2010 population census
+five days
+strengthen their capacities
+Log viral titer reduction
+two
+nine
+organizational culture
+87%
+All data supporting the findings of this work
+Information on healthcare use
+Profiler
+lack of strong inflammatory immune response
+The supernatant
+pragmatic decisions
+pairwise Significance Analysis of Microarrays
+Ponceau S
+A max
+hydrogen peroxide
+1.9
+UV absorption method
+ISG54
+regulation of the invasive and non-invasive tumors
+disclosure of HIV status to neighbors and low quality of HIV services
+Public health actions
+PRR ligands
+CGR-16
+EBV-mediated B-cell transformation
+macrophages
+the most promising
+its biological presence
+Cryptosporidium
+ADAR1
+Inhibition of NHE by EIPA
+Haploview 4.2
+PK domain
+PD98059
+0.25 mL
+40%
+stroke and heart attack
+HPV-16
+A549 lung cancer cells
+acute respiratory failure
+Figure 3A and Table 1
+R 0
+100%
+Davinch-K
+10-40 years
+Shortest path length
+Motion properties
+Pools containing varying numbers of heads of bodies
+IFNc
+ΔGDD
+28
+a temporally differential expression of transcript isoforms
+7%
+obesity and diabetes
+SHESIS
+high-energy projectiles being released from the explosive
+a structure for avoiding duplication of resources
+age, school class size data, and proximity between schools and households
+BCA Protein Assay Kit
+Twitching
+Platinum SYBR Green qPCR SuperMix-UDG with ROX
+a comprehensive list of kinases
+AT 1
+unstable inflation
+more than 400
+its role of regulator of the secretory pathway
+ELISA
+positive end-expiratory pressure
+IFNLR1
+Sixteen-week
+Time until recovery
+multifactorial
+Piggery workers
+movement through habitats unsuitable for infections
+CYP3A4
+4JK4
+350,000
+13
+S10
+16,529
+A properly calibrated model to data
+Rotavirus
+free fluorophore excess
+23,000
+host macromolecules
+2009
+LDH
+E1 and E2 sumoylation enzymes and SUMO-1
+A Hopf bifurcation
+Cufflinks
+Propionibacterium acnes
+RNA polymerase III
+AFR
+0.12-0.3%
+59 triphosphate RNA
+UCSC-GWAS Genome Browser
+weak buffer capacity
+isoflavonoids, saponins and polysaccharides
+10%
+Day 90
+important aspects of its biology
+1.8 Å resolution
+autophagosome
+post hoc Bonferroni tests
+human rhodopsin C9 tag
+antigenic recycling
+Virus-mediated T cell cross-reactivity
+The cell cytoplasm
+Aerial bronchograms
+tendencies of physical
+Further studies
+two fragments
+kinases
+54
+biogenic atmospheric O 2
+unchanged
+pFLAG-CMV-2
+5 days
+severe acute respiratory syndrome
+seasonal
+0.7%
+complete prevention or eradication of the disease
+six
+three
+3
+K m and V max
+P max
+UL44
+three weeks
+Fig. 3
+RvE1 analogue
+1-10 SFV DNA copies per 500 ng cellular DNA
+Escherichia coli
+four hour
+The PI
+lithium chloride and diammonium glycyrrhizinate
+6 months
+respiratory and influenza-like diseases
+Patient brains
+AMPKα1/SIRT1 signaling pathway
+INH prophylaxis
+MAMPs
+intoxicate the inoculated cell culture
+essential features to consider in relation with corresponding European or French standards
+5% glycerol
+Non-tuberculous mycobacteria
+means ± standard deviation
+The same forward primer and a different reverse primer
+Bacillus anthracis
+multiple lineages
+mMessage mMachine T7 Kit
+2 weeks
+ImageJ
+Mayotte
+Cap-selection
+Increasing ventilation rates in all locations
+16 hours
+the reason for the differences
+serum amyloid A
+cc-by
+IFNL4-TT
+PUFAs
+non-specific
+849
+intermediate snail host control, water, sanitation and hygiene programs
+biological
+spontaneous variations in length
+human diseases
+Indonesia
+Capture ELISA test
+An HAI titer of ≥1:40
+Inflammatory bowel disease
+Faster convergence and tighter bounds on R
+Sepsis
+IL29
+r
+spring 2009
+non-invasive tests
+C-type
+hospital-acquired pneumonia
+Follistatin
+spike-mediated axonal transport
+S1
++ cells
+Institute of Allergy and Infectious Diseases
+street onlookers and relatives
+partial information known about the structures of gp6 and gp3
+COPII turnover
+ShedP
+systemic hypotension
+Five
+1005.83 mU/mL
+EADock or MolDock
+18%
+NS5
+30 min
+vaccination programs
+aortic cross clamp time
+Travel restrictions
+lesser noddies
+nine
+IPI
+18
+T and B cells
+17%
+Genes with a correlation coefficient of -0.5 or less
+twice daily
+international diversity
+A/WSN/33/H1N1
+Stigmatising myths
+ES/MCDB201 medium
+MyoD family-a domain-containing protein
+38,775
+8.9 Â 10 4 /mol
+20 years
+14
+9%
+polar residues
+gallic acid
+increased severity of disease symptoms
+five
+khp γ /hki
+17
+woodchucks
+high-performance
+Byrnes et al
+four
+ran at their expected positions in the gel
+6 hpi
+GENIE3
+ERa
+Group 1 and 2 viruses
+mortality at the longest follow-up available
+198
+inhibited
+pathways related to cancer
+wild-type RSV or other RSV vaccine controls
+deep convolutional neural networks
+GADD34
+polyadenylation
+six
+critical
+p ij
+World Health Organisation
+Metabolism of vitamin D
+vesicular stomatitis virus
+GAPDH
+factor analytic findings
+luciferase
+elevated cardiac ACE
+systemic and LRT disease
+Maricopa county
+Hematoxylin -Eosin
+1{ Ð T 0 ldt
+WHO guidelines and methodology
+30-day mortality
+0 to 12
+Gel Doc EZ Imager
+68uC
+Twenty µl
+6 months
+60 μL
+NaAc
+diminishes phosphorylation of MTOR
+zeros
+6.5 min
+Image Lab Software
+an effective, robust and safe form of vaccination
+nuclease activity
+P78
+NF-kB, NFAT and survival genes
+Slide-A-Lyzer dialysis membrane
+recombinant OppA protein
+10
+extracellular matrix formation
+thermal cycler
+Clara cell 10 kDa protein
+Breakthrough Therapy
+$1525
+57%
+amyloid
+PPG co-treatment
+airway crosssectional area
+Surface water resources
+mortality
+Kazakhstan
+guided groups
+10
+237
+RSM
+marine invertebrates
+respiratory epithelial cells
+traditional Watson-Crick base pairing geometry
+straw-coloured fruit bat
+inhibition of cell proliferation
+spleen and liver
+African bats
+Dots and dashes
+Ebina et al.
+Dependence
+Pooled organ tissue
+IC II
+LIPS fluidphase
+diabetes, heart disease and kidney disease
+Type I and type III IFN signaling
+440 days
+DNA-coated gold particles
+A. nodosum
+data visualization
+153,880
+Bronchoalveolar lavage
+William MacEwen
+the pulse width
+improve
+20 percent
+multifaceted surveillance measures
+discrimination matrix
+Stephane Daffis
+Eleven
+Increasing the affinity for heparan sulfates
+13
+200
+a sequence profile
+susceptibles
+elderly
+normal rabbit IgG
+Poly A RNA cDNA
+clinician-scientist
+16 nt in the unstructured loop portion following the PBS
+elevated transcript and protein levels of B cell trafficking and organizing chemokines
+efficient binding
+HCVpp
+Apoptosis
+101,179
+eight
+having omitted this relevant information
+67%
+total NICD1 level
+broad-spectrum neutralizing antibodies
+Renal histological
+REMD-averaged
+hepatitis, hemorrhage, and abortion
+twice
+four
+The IFN signaling pathway
+herpesviridae
+V IDP
+TARG1-G123E
+four
+Superscript III RT
+AVE 0991
+774
+host cell death
+epithelial-mesenchymal transition and metastasis in malignancies
+PDI
+6 of 506
+a lack of oxygen in the blood
+age, sex, hospital and APACHE III
+to maintain the production of progeny virions
+UBF and B23
+579
+printing buffer
+school-wide transmission
+2-3 times per week
+an extended pathogen panel
+water
+proteomics and next-generation sequencing
+cc-by
+mainland China
+lectin
+24.9%
+summary statistics
+pleiotropic
+crossreactivity
+Selected reaction monitoring
+Taxol and doxorubicin
+24 hr
+H2
+hPOP1 and Nopp140
+IFN-λ4
+Avastrovirus 4
+segregation of p10 into speciesspecific microdomains
+NA R103K
+1.2 days
+closely connected with MNs
+one
+FccRIIB genetic polymorphism
+38%
+viral
+Complicated course
+shigellosis
+HIV-1 gp120
+regulatory/modulatory
+A549 cells constitutively expressing influenza A virus NS1 protein
+Palivizumab
+Lys170-Met179
+25 ml of methanesulfonic acid
+Samples without reverse transcription
+extrinsic
+one out of seven
+redundant
+Phenuiviridae
+population mobility
+viral pathogenesis and induction of immune response
+260-fold
+Th17
+retinoic acid signaling dysregulation
+lymphocyte proliferation
+24
+intracellular signalling pathways
+fold enrichment within astrocyte upregulated transcripts
+fitted hurdle regression models
+Supplementary Figure S1A
+nuclear localization of hLysRS
+Angiotensin-I antagonists
+Epigastric pain radiating to the back, nausea, and vomiting
+gaps introduced during alignment of additional sequences
+non-significant
+young adults
+Microbiological diagnosis
+7 days
+radioimmunoprecipitation assay buffer
+Proline
+lower titre ratios
+careful bioinformatics analyses
+10 times higher
+1000 times
+the connectivity map
+30-100 nm
+Gaussian
+HIV-1
+EFIRM
+tombusvirus VRCs
+3 hr
+13
+Environmental stressors such as chemical contaminants
+Immune-gene candidates from other insects
+males
+measles and flu
+119
+domestic and peridomestic mammals
+the SEM for duplicate PCRs
+medium-term mortality
+late 1980s
+antigenic variation-independent, universally active defensins
+280uC
+proportionality and reciprocity
+autoimmune diseases
+the original cut edges are restored
+mRNA levels and DNA alterations
+PRRSV
+Cytotoxic T lymphocyte activity
+24 h
+SGTs and SGAs
+scintillation counting
+Mayotte
+4
+investigators
+VRC-FLUDNA057-00-VP
+Monitors
+Genome-wide
+once per month
+54
+120
+11
+81%
+34
+454
+Phylogenetic
+atrophy and oncogenesis
+protection
+c-di-GMP
+TGUide Virus DNA/RNA Kit and T-Guide instrument
+Cystatin E
+Age
+flavivirus endemic regions
+weak anion exchange magnetic beads
+a tentative function
+ELISA kit
+DO mice
+Restrictive transfusion practice
+Seasonality
+exponential and the Cauchy model
+future studies
+individual inventory tables
+index patients
+AUG4
+each phase
+526
+Unpaired student's t-test
+increased to more than 1.0 × 10 9 /L
+epidemiological categories
+hydrogen bond surrogates
+454
+Primary porcine PTEC or PBEC
+wood wool
+CME
+baculovirus-expressed VLP vaccines
+drug-metabolizing enzymes and efflux transporters
+susceptible cells from infection
+miRNAs
+transendothelial
+activated CD8
+GenBank
+1,318/4,552
+Dmus51::su8-1 marker
+Peyer's patches
+human immunodeficiency virus
+transcription of host mRNAs
+higher 90-day mortality
+44
+10 min
+2% Alizarin Red S solution
+12
+inhibited
+ethical reasons
+location data
+random seroprevalence datasets
+13%
+eIF2a and PKR
+GenBank
+58
+New Zealand
+confocal microscopy
+1.1 × 10 −2 μ m 2 /s
+PBS
+Six
+RNase-free ddH 2 O
+trans-membrane domain
+17 nt
+Four
+lung injury
+66 %
+Late Presenters and AIDS presenters
+CV diseases
+no increased risk of intensive care admission or death
+accumulation of mistranslated proteins
+4.6
+Geelong, Victoria
+pre-diluted 1:100
+10 h
+constant region of mAb KZ52
+32
+2001
+Hantaan virus
+Orthomyxoviridae
+V1
+59%
+Bayesian Network Analysis
+broader social issues
+95
+25μl of Nano-Glo luciferase assay reagent
+.
+AT-II cell growth defect
+neuropathy
+piglets
+Destabilization of these short-lived host proteins
+SVR rate
+Gapdh mRNA
+1.1, 1.9, and 1.8-fold
+virucidal assay
+H9N2 viruses
+26%
+fat and connective tissue
+overlapping mutagenic PCR
+viruses
+parvoviruses
+on the surface of hepatocytes
+DEGs
+4
+important identified risks, important potential risks and missing information
+Feline pancreatic lipase immunoreactivity
+multiple TLR-ligand interactions
+90%
+Bed capacity and diagnostic capabilities
+individual risk of bias assessment
+bacterial substrates
+cDNA
+arthritogenic anti-CII specific Abs
+anti-DNA antibodies or autoimmunity
+Bibliometric
+293T cells
+cellular apoptosis
+Whole genome sequencing
+six
+two
+γ-glutamyl-ρ-nitroanilide
+the antiviral state
+delay
+insufficient levels of secreted IFN-β
+sufficient social investment
+block internalization and infection
+Jackson Laboratory
+physiological stress
+6.32
+Residues
+20%
+102
+0.4 to 0.8 μM
+phase contrast microscopy
+relatively short
+Sir Christopher Wren
+SRIPs
+30-to-140%
+5,000
+more than 1000
+hybridoma cells
+positive thinking
+coverage
+Caution
+MR volume and feeding frequency
+FDP-lysines
+40%
+laboratory analysis and patient interview
+Mann-Whitney test
+8AE3%
+Cooperation between the humoral and cellular arms of adaptive immunity
+55,000
+lipopolysaccharide -stimulated microglia
+100%
+nano-LC-ESI-Orbitrap MS
+Development of lung injury
+PKR degradation
+Seven
+70 %
+Carcinoembryonic antigen
+Nine
+SSSV
+Codon adaptation
+identical 59 and 39UTRs
+distant organ injury
+DC-SIGN
+two
+low absolute TEM frequencies in blood
+cc-by
+therapeutic
+36
+shorter CldU tracts
+D. Natarajan
+Illumina
+13 million
+noroviral CNS disease
+30%purified WT and ompB STOP ::tn bacteria
+2.4 and 0.46 µg/mL
+SO animals
+cause low pH-dependent hemolysis and fusion
+rapid advances and need for a new vaccine platform
+Phospholipase activity
+amino acid 560
+Digitonin
+resilience theory
+Soluble
+public health agencies
+2.5%
+Brazil
+lateral flow and microfluidic devices
+densely connected clusters
+10%
+39
+10 mM staurosporin
+Manders Overlap Coefficients
+2%
+VirD4-89K
+Oseltamivir
+three
+60%
+Conditioned media
+objective measures
+SYBR Green qPCR
+13%
+duck Tembusu virus
+contact tracing data
+TCID 50 values
+GBV-C glycoprotein E2
+bronchoalveolar lavage 20 fluid
+Adobe Photoshop
+TLR8 or TLR9
+in vitro transcription
+metastatic
+50% dystrophin expression
+lower expression of IL-10
+myofibroblasts
+antigen-specific CTLs
+growth arrest
+Sigma H
+CDK9-dependent phosphorylation of the Pol II CTD
+distinct HSV genotypes
+self-protection and personal health
+strong data
+68.1%
+when the same publication has multiple records in the literature resources
+46%
+discordant samples
+Labeled fragmented single-stranded cDNAs
+Self-limiting dyspnoea
+435,000
+LASV
+their attending physicians
+microscopic lesions
+C-C motif chemokine receptor 5
+pathway and network analyses
+15%
+necrotic cells
+incidence of wound
+decentralization
+proinflammatory
+de novo reconstructed gene models
+4 weeks
+ac30
+oxygen
+physiological
+92
+10.1007/s00247-017-3827-8
+xenophagy
+Sir William Leishman
+80/50 mmHg
+insulin clearance
+74
+400
+seven out of eight
+perfect matches to the genome
+Three
+proenkephalin
+Pearson's productmoment correlations
+genotypes PC48 and PC55
+12.5%
+measures to prevent renal impairment
+Peripheral venous blood samples
+two co-ordinating reviewers
+baseline cholesterol level and diabetes
+biomarkers
+more than doubled
+Viral screening of the NS
+inflammatory responses
+blood pressure and cardiovascular disease risk
+Middle East respiratory syndrome coronavirus
+diabetes mellitus, cirrhosis and various lung, renal and cardiac conditions
+10% SDS-polyacrylamide gel electrophoresis
+2004
+3-8 days
+two
+Analyst v. 1.4.2
+1:1
+crosstalks between MAPKs
+Spatial reasons
+sheep
+CXCR3
+half
+P5-LX-P1
+Shanghai Fifth People's Hospital Research Ethics Committee
+one value of d N /d S
+Cytoscape
+704
+rendered ineffective
+the kernel
+exponentially distributed
+Cold 10% TCA
+MicroRNAs
+speciestypical
+moved free
+slowing
+10%
+neuraminidase
+GP
+eIF4F complex formation
+influenza-like illness
+113
+protective
+Molrep 31
+MPXVs can be used as potential bioterrorism agents
+33.6 kb
+replicating isolates
+647
+semisolid medium
+decision support
+lignocellulosic and algal
+Influenza
+tRNA binding to the ribosomal A-and P-sites
+Biological Industries
+iNKT cells
+altered bases
+four
+iHsp70 upregulation
+increased ecto-ATPase levels
+killing all hosts in a local spatial cluster
+Accessing diversified antibody sources
+sex, gender and pregnancy
+IFI6 and IFIT1
+Nuclei
+21.7%
+Specific values for intercept and slope
+something that we did not already know
+25
+Viral infection
+3.73-fold
+Atomlab 500 Dose Calibrator
+73%
+World Health Organization
+pathogens and their toxins
+rates-of-influenza-related illness
+Bradford method
+Expanded molecular assays, full-length genomes or virus isolates
+GTP hydrolysis
+Early prevention
+global elimination of canine rabies
+prophylactic and therapeutic
+larger pitches would result in too much airway collapse
+convalescence sample
+Fig. 3
+Western blot analysis
+mobile phones
+V5 or V3V5
+atypical trajectories
+Supernatants
+confirmed their antigenic activities
+fever, rash, and conjunctivitis
+nucleotide constraint under mutation pressure
+adenovirus
+temperature
+CK-C
+aerobic
+Mycobacterium tuberculosis
+respiratory syncytial virus and influenza viruses
+Bed Rest
+Armed Forces Institute of Pathology
+ANNIE
+p38 MAPK pathway
+short tandem repeat iterations
+5.6 kg
+past events encountered by the immune system
+Horseradish peroxidase
+14
+sampling coincidence
+LCMV GP-α-dystroglycan interaction
+all forms of aspergillosis
+viral entry into target cells
+viral genome
+rectal swabs
+screening and ranking vaccine candidates
+30.1%
+Senegal and Israel
+DVG junction reads
+50%
+relational database management technology
+6269
+5%
+antibiotic
+steps 1 to 4
+fluorescent
+sensitivity, specificity and accuracy
+systematic blood culture and intravascular extremity cannula culture
+Specific synonymous changes
+p � 0.05
+in vitro assays
+proline
+8 and 24 hrs
+insulin-like growth factor binding protein 7
+different time points
+Yuma
+total or phosphorylated Iκ Bα levels
+twice a day
+reporter eGFP expression
+averages of the duplicates
+IFNc
+Specifi c
+BioEdit software v7.2.0
+fluorescence
+myeloperoxidase
+luciferase
+Chief Medical Officer
+USP-46
+Acute respiratory tract infection
+gastrointestinal
+3D7-KAHRP-KO
+National Cancer Institute
+household contacts
+conference proceedings and dissertation abstracts
+obtaining nutrients from the host
+a proper evaluation of several candidate genes
+partial frameshift
+HCV JFH1 virus
+PCR
+late spring and fall
+activates the PERK signal pathway
+ARHGAP15 and ZEB2
+2013
+>60% amino acid identity
+CedPV L protein
+Animal Welfare Act
+UV measurement
+2 times per week
+enzymatic
+Biosen C-Line
+three IAV strains
+6 weeks
+UL29, UL30, and UL39
+3' poly-A
+43
+poor
+infectious
+the median of the pairwise dissimilarities per cluster
+Cellular uptake of CPPÀPMO conjugates
+3.8% to 24.4%
+17 weeks
+MDSCs
+LPS induced production of proinflammatory cytokines
+matrix effects and the different extraction procedure
+intracellular Foxp3
+the size of a pixel
+National Control Institute of Veterinary Bioproducts and Pharmaceuticals
+1 nM and 7 nM
+mediating LMP1-induced oncogenic signaling
+DENV-2
+infection
+up to five
+paired Student's t test
+World Health Organization
+Supernatants
+90%
+both the sequence data and the antigen structure
+nosocomial
+bone-and tendon transplant material of deceased donor patients is stored
+Thr297
+June 11
+51
+down-regulated genes
+translational mechanism
+Pathogen recognition
+most domestic and wild animals
+stepped up HIV/AIDS control efforts
+IFITM3
+ELISA plates
+1.7
+Griess reagent
+virus invasion
+siRNAs
+DCs
+cinanserin
+mRNA secondary structure
+NiV M, F and G-protein-containing VLPs
+NLRs
+factors associated with increased risk perception of pandemic influenza in Australia
+RT-PCRs
+6-fold
+144 kDa
+15
+future reduced cat handling in their shelters
+antiviral
+two or more
+26%
+a fomite
+liver and lung cells
+1100
+Twenty two
+cholesterol
+IL-12+ IL-18
+S1-S2 sites
+Phylodynamics
+the reference genome
+FlowJo 7.6.2
+type I and III IFN-activated JAK/STAT signaling
+C-fms
+2005
+supportive
+three
+NK cells
+early, late and ori-Lyt
+increased knowledge of each other's roles, responsibilities, and expertise
+Stratagene
+gene expression with greater than two-fold up-regulation
+Dot1L
+eight
+to prevent VSV-G cleavage
+0.25 mg/ml
+5
+Ching-Chuan Liu's repository
+EXO84
+molecular biology, immunology, and medicine
+HAdV-5
+3
+ventilator time and survival
+A BAR
+Contact
+core protein expression and genome replication
+multidrug resistance
+information
+RA, SS, and SLE patients
+24
+enhances lymphocyte infiltration and causes lung tissue inflammation
+public debates
+99
+nucleus and cytoplasm
+respiratory syncytial virus
+Animals that serve as the natural host reservoirs
+TBFVs
+dasatinib
+rising
+24h
+Thermo Scientific Pierce Protein Research Products
+animal model results
+dystrophin exon 6 recognition and processing
+viral
+affects the immune response
+class III PtdIns3K activation and BECN1
+RNeasy Plant Mini Kit
+U3 snoRNA
+tumor suppressor
+HTNV infection
+Dr. Z. Matyáš
+imposed restrictions on their collection
+binding to cell membranes
+6 to 31 months
+greater
+The extent of aquaculture
+Motif 4
+gp41 transmembrane protein
+Incorporation of rhA3G Y
+500
+macaques
+SyBr Gold staining
+slow reaction, drowsiness, restlessness or convulsions
+A protein interaction network
+boceprevir and telaprevir
+avian influenza
+Safety
+DNA double-strand breaks
+METH and cocaine
+partially vaccinated
+Intramuscular fat
+two
+virus dependence on some host functions
+interesting characteristics at microscopic level
+A and g r
+23
+investing in preventing NiV
+59
+The estimated number of ventilators that can be used
+46
+0.05
+increasing interferon gamma release
+Monte Carlo simulation
+50%
+81%
+MP-12 and TSI-GSD-200
+PVDF-nitrocellulose membrane
+⌬%S
+peptidyltransfer
+Z jh
+clinical judgment and the patient's renal function
+PCV7
+formulations for routing mRNA to other tissues
+acute ischemic stroke
+85%
+responding to hurricanes
+PMN immigration
+a brief overview of anxiety and mood disorders
+vaccines, medications, and health advice
+GalNAc/GalN utilization pathway
+RPMI
+1 IFN receptor-deficient
+viruses that infect eukaryotic and prokaryotic cells
+molecular features of the entry process
+luciferase activity
+betagalactosidase reporter gene expression
+Improving the proliferation and migration of MSCs to a target tissue
+cdN
+positive
+four
+microglial development
+MAGEA3 and MART1
+10-1074
+more than 100h
+7111 nt
+1.1:1
+T cell activation
+IFNAR
+one week
+greater generic conspiracist ideation
+angiogenic
+the strain and its adaptation to the host
+2.4 ± 0.7x10 6 IU/mL
+Direct-zol RNA miniprep kit
+32
+HIV infection
+wells
+inflammatory
+0.45 mm-pore-size filters
+HCO 3 and CaCl 2
+TatB and TatC
+AP2-G
+8
+those in mock-infected cells
+labINR
+three
+Europe and the Middle East
+TP53 and STAT3
+novel therapeutic strategies
+immune response against viruses
+passive
+viral contamination of animal cells
+tens
+Functional group
+100 μ g mL
+production of VLPs
+control over their workload
+GGT activity
+226
+high sensitivity in detecting functional antibody responses against influenza HA antigens
+252
+100 µM L-cisdiltiazem
+cell differentiation
+GPS-data-loggers
+WeChat
+time of sample retrieval
+50%
+Table 4
+virus
+l C
+50
+RESCUE-ESE and ESEfinder
+MEDI-565
+ef®cient IMV assembly
+LP and MT
+ribozymes/viroids
+Chest
+70/100 000
+mouse cytokine antibody arrays
+CD8+ T cell response
+1.1
+tracing data
+six months
+Table S2
+maximum surface tension
+P12
+2-pentylfuran
+nine
+Less than 3 %
+tissue displacement
+H3.3
+acute respiratory distress syndrome
+household structure
+intravenous rocuronium
+6-fold
+pro-inflammatory
+increased β-galactosidase activity
+mega cities
+mortality rate
+50%
+Betulinic acid
+Five
+Large-scale experiments
+piglets
+Brefeldin A
+uneven allocation of resources
+multiple transfers of nucleic acids between different tubes
+Cryptosporidium
+Overlapping genes
+Dr. Adadevoh
+Sixteen
+anti-H5N1 effects
+u
+the staff asks the patient about
+online
+an OTU knock-out virus
+Qiaquick PCR purification kit
+DC activation markers
+basic cellular functions
+Two
+ArcGIS
+binding to the chromatography column
+cDNA
+centromeres
+19,238
+preschool attendance
+random-effects model
+PMN accumulation
+pull down the other
+SP-D
+vertebrate
+CD4-dependent
+rodents in Japan
+91Á4%
+medical-grade silicone and Platinum-Iridium poles
+sample size
+quantitatively calibrate the model for the processed municipalities
+monthly income and residence area
+0.48000
+Rapid tests
+optogenetics and infection biology
+ACE-1
+AEC Substrate Set
+ALG1 and ALG2
+200,000
+four
+GraphPad Prism 5.0
+80%
+genetic modifications
+phylogeny
+cloverleaf
+100%
+DBI and SMI
+Black African
+polar amino acids
+information sharing protocols
+n, n and n
+MDCK
+Acute respiratory distress syndrome
+transmit cytotoxicity inducing signals
+50, 100, 200, and 500 nM
+Library generation primers
+47.4%
+GAPDH
+HAV
+IL-18 secretion
+a factor six
+age
+PEEP = 6_noRM
+Fitting models with explicit individual factors
+age group and sex
+The incidence of the infection
+ribavirin
+individual patient emergency and nonemergency access to investigational drugs
+90%
+144
+-IIA
+α = 0.05
+12
+388
+nitroso or nitro adducts
+one hour
+Waist-to-hip ratio
+8.42%
+3,083
+statistical model
+Eleven
+16.3%
+metagenomic surveys of environmental samples
+more transcytosis
+Circoviruses
+5 minutes
+Ran Binding Protein
+detailed requirements for planning an MG
+6%
+viral load
+muSOX
+72 h
+Four
+1 day before illness onset
+>84%
+myricitrin
+12
+activated microglia
+9-40%
+Bim and PUMA
+genic lncRNAs
+caveolae-mediated endocytosis
+nucleotidylation of the NS5 Y26 residue
+Detection of the HA protein
+Animals Act 1986
+three
+polymerase activity
+dysfunctions in cerebro-cerebellar pathway
+Lung section slides
+CVP
+SLC14A2
+8.5 hours
+by considering different positions of one ion relative to the second ion
+1,4-dioxane
+5%
+Curcumin wt%
+viral M1 protein
+36 days
+common method bias
+Formalin
+IL-6, TNFα, and CXCL10
+23,221
+solubility or membrane location
+Phosphorylation of JNK or p38
+TLR7
+plaque assays in Madin-Darby canine kidney cells
+10 μg of fragmented aRNA and hybridization controls
+massive remodelling
+personnel changed each
+participate in the intracellular maturation of HNP1
+Variola
+Cell viability
+3 times daily
+VOCs profile
+critical
+Atlas.ti
+A human pegivirus
+anthropogenic
+water molecules
+FKBP11
+suicide
+The possibility of intentional contamination
+anti-phagocytic
+induce the genetic alteration at the chromosome level
+CpG10103
+Ying Wei Yau
+transplacental and transmammary transmission to puppies and kittens
+Sigmagenosys
+conformational change at a Leu residue
+AAY spacers between two adjacent epitope fragments
+RT-qPCR
+100 %
+PF-C cells
+CD4 + Foxp3 + Treg pool
+DDP
+Processive nucleic acid polymerases
+DUBs
+taxonomic
+Levels of PERC
+furin expression
+malignant
+November 17
+HeLa cells
+two
+antigen-production, delivery and adjuvanticity
+Vector-borne flaviviruses
+five
+the expected value of the relevant quantity
+Insight into the ecology of bird populations
+Epitope length
+GraphPad Prism Software
+firefighters and police
+2 μM monensin
+high virulence
+Meningococcal
+low
+predictive performance
+induced Gag retention
+different dietary practices and methods of food preparation
+7.5 Pa
+Acute phase proteins
+regulating immune system activity
+R V
+7%
+palatal fusion
+once
+UTY
+lift these macroscopic quantities to consistent microscopic realizations
+Placing the threshold at a minimum point in the distribution
+The efficiency of À1 PRF
+five days
+MP-12-NSs-Flag or its mutant viruses
+bioinformatics
+to speed up computing time
+linoleic acid
+hemodynamic instability
+important
+phosphate buffered saline
+our study results
+two-way analysis of variance
+160-320 and 320-640
+one
+2.1 km
+feedlot calves
+STS risk grade
+haemolymphatic
+membrane ruffling
+FEI Tecnai Spirit G2 transmission electron microscope
+PCR amplification product
+fold change from pre-vaccination
+4 h
+Graphs
+π i and π j
+10%
+dynamic age-specific fertility rates and death rates
+ERp57
+250 mg
+inflammation
+both cleaved fragments of caspase 9
+viral RNA and bacterial DNA extraction
+agarose gel electrophoresis
+93%
+Southeast Asia
+more than 20,000
+Escherichia coli BL21pLysS competent cells
+June 2017
+protease activity
+HLA-A * 01:01
+The ability to respond to a public health emergency
+metabolic activity
+murine latency model
+Radioactivity
+combat antimicrobial resistance
+Prevalence
+mitogenic
+The transition durations
+Valap
+P
+datasets
+An adoptive filter
+authentic culture models
+increased
+a very complex metabolic network
+four
+0.16 and 0.61
+ROS
+Θ
+The virus-containing AC flowthrough
+surveillance systems
+hypoxemic cerebral perfusion
+1000
+surface expression of CD4 and CD8
+20 μL/h
+poly
+Single round selection
+seventeen
+seven
+zero
+Breeding section 2
+microvascular endothelial cells
+reach receptors on the cell surface
+1′-OH-MDZ
+Tr1 induction
+Seven
+New England Biolabs, Ltd
+to facilitate binding to cell-surface CLR
+a common litter environmental effect and direct genetic effects
+avian-adapted strain
+one
+nucleoprotein antigen test kit
+Total RNA
+cc-by
+Vascular endothelial growth factor
+HFold-PKonly
+non-absorbent polyester
+TTF-1
+0.5 mM IPTG
+PERV restriction
+decreased bacterial uptake over time
+EGCG
+linear combinations of the original variables
+HBP1 and fgl2
+rotarod assay
+differences between the two groups were significant
+The position of a non-specific band
+surgical resection, radiotherapy, and chemotherapy
+MA
+The PI
+eight
+mean human case forecast error
+expression of RORγ t
+two-to threefold
+comparative methods
+VLPs
+80 million
+D. Gerlier
+a third fellow
+T-helper cells
+6-fold
+Africa
+15%
+Phytohemagglutinin
+the local background
+γδ T cells
+Cam R /Tet R
+Genomic DNA
+IL-6
+Q
+3.3
+Primer Premier and Primer-blast software
+Wildlife
+hemorrhage, thrombosis and infection
+assay buffer and 2 mM ethanol
+viral replication
+TLR2 with the ENV TMD
+low-and middle-income countries
+Preclearing beads
+mardi viruses
+antigen persistence and defects in viral clearance mechanisms
+5
+S. pneumoniae
+TT
+Primary LNEP-enriched cells
+MEGA4
+50000
+IRAV
+respiratory failure
+16%
+MxA GTPase
+cleavage
+Grubbs' test of outliers
+four
+Non-specific binding
+probe-target combinations containing many mismatches and dInosines
+IL-12p70, IL-6 and IL-15
+questions on suicidal behaviour
+Coinfections
+alpha-COPI functions
+10 mg/mL
+Vaccination
+challenge infection
+68 ± 7
+quantitative analytical approaches
+CD4 + LTi-like cells
+The infection
+VAP
+34.3%
+30-day mortality
+antigen-specific immune responses
+59 phosphate group
+Pseudotype HA
+magnetic wells
+Vaccines
+lipid composition and lipid type
+Multiple logistic regression
+Mina
+25%
+vesicular membranes
+ecological factors
+antiviral factors
+1957 and 1968
+TFH and GC B cells
+45%
+Sixty-nine
+previous work
+6-diamidino-2-phenylindole
+AMR reference laboratory
+f C and f RS
+insulin resistance
+20 mM
+unknown
+HAV1Cb probe set
+UFS duplex
+Crimean-Congo hemorrhagic fever virus
+a hospital admission for an elective procedure
+relationships either between or within the major clades
+lower motor neurons
+protein-protein interactions
+CARD9
+leucopenia and multiple patchy shadows
+macro-steatosis
+E.coli TG1 cells
+Beijing
+C-terminal
+Cell lysates
+226
+fish
+group IIA phospholipase A2 and complement factor H
+Right censoring
+total phenolics
+Organoid
+17.38
+reverse transcriptase
+cardiovascular diseases
+specificity and sensitivity
+10 µM E64
+24th November
+209 million Euros
+tissue homeostasis and repair
+negligible to low
+genotype Ia consensus sequences
+SIINFEKL peptide
+humanwildlife contact
+key items
+2009
+phagocytic function
+make their influenza sequences publicly available for analysis
+The LXXC lipoprotein motif
+comparison of genetic similarity and differences between African and global strains
+80-90%
+Poly-A pull-down
+Protein abundance
+Reducing air travel
+improvements in public health infrastructure
+western Panama
+Donor organizations
+2014
+soluble factors
+by overlying individual grids
+palmitoylated and myristoylated proteins
+lower percentile rank
+infectious RG3 patho gens
+mediates virion attachment and fusion to susceptible cells
+ligand-defined cavities
+186
+clear quarantine and isolation rules
+Mmp9
+skeletal development and maturation
+0.87
+3 weeks
+anti-inflammatory
+deprotonated
+hyperactive acute response
+Cerebrovascular diseases
+VSV-EBOV
+K562 and U937
+543 nm
+qRT-PCR
+information on the available overexpression plasmids and strains
+T-cell exhaustion
+FARV vOTU
+DENV-2
+oily, clear to yellow-brown liquid alkylating agents
+Japan
+PA, PB1 and PB2 subunits
+six
+respected
+excess base
+IFN signalling pathway
+estrogen receptor/progesterone receptor positive breast cancer
+bronchial smooth muscle cells
+0.1-0.6%
+a new family of demographic variables
+two-thirds
+18, 500
+24 hours
+A reduction in length of viral proteins
+GSH-ethyl ester
+villagers from Dielmo and Ndiop
+cleavage sites in candidate substrates
+lock onto a part of the foreign body
+Eighteen
+basic amino acids
+The FPKM
+Pan American Health Organization
+Tannins
+Cy3-labeled WGA
+msconvert
+metal binding
+VP1, VP2, VP3, and VP4
+7
+short and long-distance movement of the virus
+ligands
+private homes
+Y527 and W529
+iDVG-derived RNAs
+preservation of potentially-antigenic epitopes on the surface of target cells
+RCSB Protein Data Bank
+Bone marrow -MSCs
+four
+ra TiO 2 20
+hepatic and/or extrahepatic
+250 million years
+the ratio of the standard deviation divided by the mean
+prevalence data
+1.0 kcal/mol
+Sixty-four
+cellular mRNAs
+Proteomic
+regions of internal and terminal repeats
+AUG and UGG
+0.7 ± 0.5 μm
+liquid scintillation counting
+wild-caught snakes
+7-10 days
+TGFB1 and VEGFA
+Each image taken from different color channels
+antibody-secreting plasma cells
+30
+NLRP3 and caspase-1
+Caspase-8
+2013-2016
+CW WC DD YH
+1-605 and 1-619
+1/N
+12
+pulmonary edema and long-term fibrotic evolution and pulmonary function
+1 × 10 10 CFU/ml
+bioinformatics
+2.45 and 5.8 GHz
+18
+seven
+Eight days
+Hepatocellular carcinoma
+more than half
+adenovirus and M pneumoniae
+the national schedule
+novel overlapping genes
+March
+ancestral branches
+autocorrelation
+key contacts
+regulates host immune responses
+Amira
+12 days
+entropy
+passive immunization with an equine antitoxin
+30 000
+The chi-square test
+ClustPW
+limited clinical material and high CT value
+low fog machine
+NF-κB
+significant reduction in both intracellular and extracellular virions
+diversifying selection and correlated evolution
+fifth fraction
+TMHMM server v2.0 41
+23 November 2016
+samples
+10 − 4
+21 days
+10
+versatility
+Relative Luminescence Units
+prM protein
+spatial clustering of spill-over events
+H5Nx viruses
+rapid local depletion of susceptible individuals
+Interdigitated electrode
+unknown
+spacing
+$42 BILLION
+underestimating the extent of noise in the data
+their own helicases
+Marine Clade 1
+DNA High Sensitivity Chips
+LMP1 and LMP2
+down-regulation of inflammatory cytokines
+three
+30 min
+twice a week
+shrimp alkaline phosphatase
+0.009
+rbcL and atpA
+Nontuberculous mycobacteria
+Standard curve
+the Americas
+15 min
+flaviviral
+ROC analysis
+future productivity losses due to death
+symptoms
+cytokines and leukocyte markers
+host proteases
+Flaviviral NS1 protein
+lineagespecific
+10%
+COPI-coated vesicles
+at the host cell surface
+RB =ED 50 / ED 50
+codons within predicted epitopes
+actin-driven
+QIAamp MinElute Virus Spin Kit
+protective
+conflicts of interest
+mononuclear phagocytes
+Max
+electronic medical records
+gravity-diffusion models
+Transdisciplinary collaboration
+RBC, HGB, and PCV values
+infecteds
+B2M and PPIA
+densitometric
+Antigen preparation
+Loci with poor amplification
+10
+Basic information on market type and location
+antigens
+2.5
+5%
+Mann-Whitney test
+breathing room air
+Margarita RNA
+Westerners
+Parameters for modeling of disease outbreaks
+ABI3130XL Sequencer
+19
+PEI
+heterosexuals
+variable processing
+2
+σ
+HIV-1 neutralizing antibody 2G12
+lysosomal degradation
+IFITMs
+preclinical and clinical research
+an obvious À1 or +1 frameshift site
+functional shifting
+infectious mucus
+10
+Class-switch recombination
+therapies that prevent pneumonia and intractable lung injury from IAV infection
+10
+pJFH1-AM120-LacZ
+PROCHECK
+red spheres
+fetal microcephaly
+42%
+fluorophore conversion
+a tissue
+Simulated contact tracing data
+Ethical Committee of College of Medicine
+VSIG4 + RAW264.7 cells
+day 4 post infection
+uncoupling oxidative phosphorylation
+subunit associated protein 1-like 1
+manufacturing and distribution of vaccines
+Neal and Roberts
+neutralization antibody evasion
+TH1, TH2, and TH17
+broadens the total transmission-peak profile
+real-time RT-PCR
+1 mM
+CD8 T cell dysfunction
+anti-CMV treatment
+944
+hyperplasia of neuroendocrine cells within bronchioles
+39 years
+NetMHC 3.2 server
+optimal used codons with corresponding amino acid
+Acetylation
+IL-10
+Forty-one
+5
+EBV
+Licensed inactivated monovalent H1N1 influenza vaccine
+76
+interesting
+p53 activation
+H&E staining
+concepts
+0.3%
+every 2-3 days
+iterative
+Tracer
+Interferon
+halocins
+previous ZIKV exposure
+Monitoring of key physiological parameters
+SCSDVs
+p65-Tag2B
+1.6 million
+low amount of informative data
+intensely stained
+CFSE lo T cells
+2 hours
+African green monkey kidney cells
+chlorinated pyrrolnitrin
+IFN-b production
+epoprostinolium 11
+rituximab
+air passenger flows
+20%
+41
+1.6 million
+7 days to 13 years
+lower breadth and depth of sequencing coverage
+neutrophil infiltration
+mature seed sequences
+112
+4 days
+India
+a dimer
+ethanol
+clinical symptoms
+lessons
+ATA
+transforms the raw image file to a simplified file format
+antibody
+2D plot
+KCl
+TBEV from successful replication
+The basic reproductive number
+Publishers
+hospital-acquired anemia, iron deficiency anemia or chronic disease
+a region of the gene upstream of the ClosTron insertion site
+serological data
+consensus statement
+cataphoresis
+generalised linear models
+dextran sulfate
+87%
+six
+Circular dichroism
+woody
+similar clinical and functional results
+bacteriophage electron microscopy
+World Health Organization
+Rab5 GTP
+severe post-traumatic distress
+T cells-independent
+ν
+hits
+one
+rhesus macaques
+lymphocytes
+two-factor model
+intraperitoneal injection of LPS
+involved in the establishment or maintenance of a certain location at the membrane level
+similar to mammalian cell-derived counterpart antigen specificity
+UniProt database
+two-component compartmentalization assay
+Malaria
+Retroviruses
+cellular receptor SCARB2
+all but one
+GEO NCBI database
+intramuscularly
+two
+Influenza viruses
+five
+ferrets
+ZIKV
+at least two major open reading frames
+the unpaired apical loop of SL6
+20 mM HEPES, 150 mM NaCl, pH 7.5
+general population and health workers
+AllerHunter
+PKA
+0.5
+bivariate and multivariate logistic regression models
+AECs
+16%
+MW ligand
+33
+Aplysia california
+L11 and L1
+12%
+the anomalies
+p.Lys329Glu
+CMTR1
+Noroviruses
+HIV
+PRV
+10
+1%
+efficiency of the Bst DNA polymerase
+SC75741
+The right-hand side of the state system
+studies investigating zinc's potential effectiveness
+GDP at PPP
+CD11b hi CD103 -cDCs
+ICUs
+dual ethidium bromide /acridine orange staining
+100,000
+Streptomyces
+5-10%
+David L. Swerdlow
+asymptomatic
+PCR approach based on SYBR Green chemistry
+ICU mortality
+83
+whether improvements were due to the natural course of emotional crisis resolution
+32
+The mass ratio maintained between the two phases
+IFN-l3
+349
+sialometabolism
+F ear
+AIDA software and 2D densitometry
+enhancing
+24%
+Gas chromatography with mass spectrometry
+3.5%
+logistic regression
+ampicillin/sulbactam
+an effective measurement for assessing the quality of screening assays
+Nuclear DNA
+infectious diseases
+130 077
+1 to3.8%
+a binary coding of psychological distress
+32-33kDa
+occupational risk pyramid
+Digital Micrograph
+6
+halophilic
+Five
+miR-15a-3p
+EIT
+matrix protein
+Superdex 200 10/300 GL gel-filtration column
+decreased IFN-l3 plasma levels
+tissue samples
+90-day mortality
+blood meal
+zero coverage
+SIK1
+discriminate the SNPs
+RC i
+25%
+NPV
+CP6
+Table S1
+flying-foxes
+better health
+laser-scanning confocal microscope
+more than 375
+Lung tissue homogenates
+the level of gene expression
+Wolfgang Wende
+intramolecular hydrogen bond energy
+5 min
+pyramidal neurons
+CVTree
+82
+100%
+either with or without the polymerase expression plasmids
+temozolomide
+sheath and core
+inducible
+human genome annotation
+hSAMD9
+B cell translocation gene 2
+virion DNA produced by BC-1
+APC inducible vaccine universality
+molecular function, biological process, and cellular component
+repopulation of corpus callosum lesions
+71%
+generation of NO
+mass flowmeter
+Ketamin/Xylazin
+desiccation stress
+enhanced
+Type III IFNs
+brain tissue
+34
+mice
+universal coverage
+multi-ion permeation
+1 to 2 months
+Transverse mutations
+Investigational New Drug
+egg-based or cell-based
+MimoPro
+Data recorders
+Mass vaccination
+4,291
+virus replication
+bats
+ISGylate
+genetic
+lower
+Gotzsche
+PSI-BLAST
+σ i > 0
+8200
+steroids, retinoids, and thyroid hormones
+the stem region of HA
+3%
+what should be governed and how?
+99%
+immune evasion mechanisms
+FMV09-1180503
+Astrocytes
+host shutoff
+VHDL
+supernatant
+Covaris E210
+Chinese
+Groups of cells
+10%
+viral envelope glycoproteins
+high scores for PTSD in children and parents
+5-7 days
+HIV Tat-ADEVs
+lung hemorrhage and lung injury
+H7
+influenza and RSV
+macrolide and a 3rd generation cephalosporin
+534
+Richards model
+50%
+OCT
+combinatorial queries
+young pigeon disease syndrome
+Rab5b up-regulation
+Simian Immunodeficiency Virus
+neoplastic
+March 2014
+10-12 weeks
+10 min
+twice
+pMHC
+HCV796
+levels
+344
+from the patient's mother
+Cesarean section, and colostrum derivation
+owning a car in households with children
+IHC
+drug withdrawal group
+variables
+Theorem 1
+5 days
+Common risk factors
+CD40 ligation
+Thirty-six
+530-550 nm
+All authors
+IκBα expression
+incidence and severity
+Seventeen
+Guangdong
+28
+Drosophila
+leukocyte-driven
+250,000-500,000
+Viremia
+recent travel history from China
+Lactimidomycin
+Image-Pro ® Plus 4.5
+radixin and moesin
+wt-AMP structure
+different patterns are observed in nuclear eukaryotic genes
+additional studies
+AAAAAA
+English
+F1, F2 and F3
+neutral substitution rate
+~100-fold
+cell-surface HSPGs
+results consistent with those obtained from the ECGs
+apoplast and symplast
+exposure science
+Ebola
+HSV-1 UL11 and UL16
+HSP90
+HCV core
+ecotropic
+cough, difficulty breathing, and cough with vomit
+p.Lys329Glu
+Cristal Global
+nuclear accumulation of NFAT
+rapid VSIG4 downregulation
+immunomagnetic separation
+David Resnik
+to avoid clonal deviation
+North Asia
+mechanical
+306
+sequencing
+IFN-γ secreting cells
+Three
+protection
+0.45%
+AdHu5-OVA and MVA-OVA
+12
+40%
+inflammatory
+attendance records
+74
+26%
+N
+Weak X-Gal staining
+Single and double stranded RNA
+immunosuppressive
+2.8%
+Over 90%
+96
+1
+autophagy induction
+what is the subject of such regulations
+1.4%
+neither univer-sally good nor bad, but rather context specific
+devastating
+contact ferrets
+early diagnosis, treatment and isolation of patients
+81
+1.77-fold
+the usage of probes with a degeneracy greater than 10
+cases passage times
+money, time, staffing and parents
+worse outcomes
+MRC-5 and WI-38
+a viral ailment of poultry
+another cluster of viruses
+80
+four
+2.5 nm and 5 nm
+thrice
+microtubules and/or the actin cytoskeleton
+Zika virus infection
+Protein lysates
+Panel A
+Tables A1-A3
+membrane fluidity
+50 million
+pH1N1
+5 ml dispase I
+Links between nodes
+Carbamidomethylation of cysteines
+TSD
+methanol
+two influenza seasons
+0 to 1
+early syndromal information about disease
+Infection of oligodendrocyte cell bodies
+Pseudotyped particles
+WT
+PDZ domains
+Kilifi County in Kenya
+elemental
+shRNA-mediated silencing of the Tsg101 gene
+The PERK pathway
+NF-kB
+intraosseous
+BRD and the birth of persistently infected calves following transplacental infection
+χ2 test
+Old World and New World complexes
+Results for inhaled dose
+Immunoglobulin G
+back-translocation
+modest levels of human IgG
+326 nm and 20 μ L
+DPIs
+pathogen-associated molecules pattern
+CAR + /mPSCs Oct-4_hi clones
+Acute Respiratory Infections and lower respiratory tract infections
+Three
+dog TfR1
+virus absorption
+EBOV
+Guidelines for Blood Sampling in Nonhuman Primates
+complete genome sequences of bacteria
+CD4+ T cells
+viral uptake
+20 months
+APCs
+Certolizumab pegol
+PSI-BLAST
+years of obsessive uncertainty
+Luminex assay LiquidChip system
+weeks of local circulation
+two
+pericytes
+VEGF
+papain
+80S initiation complex
+cell surface glycosaminoglycan
+HRV-B104
+>26%
+CXCR2
+Bluetongue virus
+~25 Å
+coexistence and deep phylogenies
+folinic acid
+Aerosols
+7.0%
+30 nm
+Fibroscan
+Inflammation and photoreceptors degeneration
+mirVana miRNA Isolation Kit
+50 µl/min
+American Journal of Respiratory and Critical Care Medicine
+both frameworks
+73%
+SINAN
+95%
+post-translational modifications
+tetramethylbenzidine
+rs12252-CC
+high-throughput
+their genotype
+2%
+1 nm
+macrophages and MSCs
+6-carboxyfluorescein -NGR
+hand hygiene
+increase reliability of the diagnosis
+3,000
+HH
+20.7 days
+mice
+more than 50 ng/mL
+developing a general tool for de novo pMHC geometry prediction
+5
+CW3 persistence
+host, microbial and environmental factors
+mechanical signals
+39
+North America
+immunomodulatory
+Influenza NS1
+viral loads, viral clearance, and resolution of clinical symptoms
+proportional to its daily volume of passenger traffic
+enhanced neutrophil accumulation and tissue injury
+Globin cDNA
+reduced-intensity conditioning
+five
+age-dependent mortalities
+20
+Airway inflammation
+v hr
+clear signs of sickness
+3,600,000
+better
+early endosomes
+% of the travel costs
+concurrency
+LC-MS
+Thailand, Brazil, and the United Kingdom
+17%
+CRTCs
+antibiotics
+Primer Explorer
+standardization of sample procurement, testing and reporting procedures
+NDP52 and TAX1BP1
+different orientations
+miRNA screening
+SOCS-3 and IFNb mRNA induction
+PB1-F2
+C3′-endo
+targeting DI particle formation
+Partek Genomic Suite and the RefSeq data base
+AG129 mice
+illegal or unreported animal trades
+failure for recovery
+those in the natural precursor
+an alternative conformation
+social contacts
+2.5 billion
+lack of glycoprotein-specific antibodies for NSDV
+24 hours
+Leftover plasma
+cE80
+social vulnerability and disaster effects
+Ribosomal proteins
+Viral RNA/DNA
+migratory granulocyte dysfunction
+IRES-mediated expression systems
+Bead-bound antibodies specific for either HA or V5
+acute lung injury in vivo damage environment
+1980s
+cerebral tissues
+1 : 28 to 1 > 2560
+EK-X2
+patients' experiences
+5.4
+six
+10 min
+A third fluorochrome
+co-transfection with activated H-ras
+C-WS
+40%
+200,000
+differences in viral biology
+100
+deeper
+amplifiers of transmission
+1-5%
+10 gene copies/reaction
+practical
+China's Ministry of Health
+vital registration data
+65.90%
+Cycloheximide and staurosporine
+1820 cpm/well
+broader categories and themes
+Luminex 200
+Tanzania, Malawi, Zambia, Mozambique, and South Africa
+other causative agents of febrile illness
+to allow severe pathology to develop in susceptible lines
+0.1%
+TMEV
+within 7 days of the report of symptom onset
+severe pneumonia
+increased
+RML
+B cells
+650
+Quantitative reverse transcriptase polymerase chain reaction
+type 1
+70%
+1 mM IPTG
+5%
+␣ 3
+flow cytometric
+74.2%
+reassortment
+PFT-mediated
+red blood cells count
+SeqTrack
+immortalized cells
+Human population density
+Ifnar1 SA
+Streptococcus pneumoniae
+CD39 + CD4 + T cells
+USP46 activity
+disease management
+fluorescence
+Viral IDPs NS3 serine protease activity
+Biovermiculations
+phylogenetic incongruence
+DNA
+statistical and mathematical
+R v,obs
+lipid rafts
+57
+CNS production of transforming growth factor -β
+MT
+sublibrary
+Five
+Triglycerides
+collagen type II loss, and network integrity
+5 þ 4 ¼ 9 days
+DMTI Spatial
+52.6%
+Streamline-Heparin SN
+25%
+vimentin, Met, and FAK
+Itraconazole
+lymphopenia and anemia
+relaxed molecular clocks
+biosafety level 2 containment facilities
+101
+pcDNA3.1-HA-ULK1
+Chase-ABC
+membrane reservoir templates
+10
+7.3%
+TIA-1 and G3BP1
+phylogenetic incongruence
+avian pathology laboratory
+14B
+Mann-Whitney U test
+nicked dsDNA molecules
+Kidney Injury
+irrelevant variables
+miR-451, AMPK complex, and mTOR
+Th1, Th2, Th17, and Treg cells
+MERS prevention
+all-atom molecular dynamic simulations
+10%
+converted to uridylates
+bioavailability
+Heatmap
+Jotun Hein method
+the release of HMGB1 from apoptotic chromatin
+GraphPad Prism 6.0
+Early administration of antimicrobial therapy
+eight
+the edges
+Unambiguously aligned positions
+22%
+standard deviations of three repetitive measurements
+10
+Immunocompetent and neutropenic
+ClustalW
+Human enterovirus 71
+Results
+RSCU values
+Penh
+Ellman method
+Pneumonia
+2005
+transcripts and proteins
+augmented
+105
+optimism is significantly correlated with the internal locus of control
+Differential frequency of zoonotic and vector-borne transmission
+putative complete genomes
+disbelief in the effectiveness of measures
+Supplementary Table 3 Reagents
+bone formation
+0.05 Å /ps
+Benyviridae
+ten
+cell-free virions
+E271, R563, and R565
+RV, RSV, and IFV
+27:1%
+Candid#1
+laboratory
+important immune-activating effects
+Immune suppression
+one
+QuickCal software
+a sample of newspaper articles
+replication
+90
+severe joint and muscle pain, rashes, and fever
+<5 gene copies/reaction
+30
+an enhanced anti-tumor response
+nan
+7-16%
+muscle damage
+embryonic stage
+diminishing returns
+low-income countries
+PHASE statistical software
+neurobiology and immunology
+pro-surfactant protein C
+linear regression analysis
+a molecular chaperone
+cancer as a chromosomal disease
+63
+cells infected with influenza viruses
+Five
+TMB
+o1%
+additional datasets of AM images
+2,581
+methanol
+average number of SFU
+96.3%
+Western blot analysis
+hemiparesis to the locked-in syndrome
+Tissue DNA Kit
+52 ± 6%
+seven
+Intensive insulin therapy
+nectar
+every two weeks
+electrical impedance tomography
+plasma lipids
+IRAK1
+to prevent rejection of the fetus and placenta
+390-420 bp
+Muellerius capillaris
+TBEV
+crucial
+Dengue epidemics
+cross-linking reaction
+Treatment of rapamycin
+A longer residential stay or quarantine
+preventing HAIs
+Autoimmune hepatitis
+up to 8 weeks
+100%
+TRIM5α
+3569
+VLP-based
+interleukin-10
+Asp 20
+rabies, canine distemper and parvovirosis
+Method 2
+using both the numbers and the durations of contacts between individuals
+BBMap
+GraphPad Prism 7
+16
+translational efforts
+standard flask productivity assays
+drug treatments
+IFN1s
+Asians and Caucasians
+unity for two identical peptides
+Microcon Ultracel YM-10 filter devices
+BHK-21
+80
+pharmacological
+autophagy-regulating
+results
+Autophagy
+Redox stress
+25
+when all patients were considered
+MS
+adenovirus pneumonia
+homologous modules
+24 h
+The participant pathway
+Entropy
+blactamases
+ACTB
+HCV genotype
+Independent nuclear data
+chemotherapeutic agent
+eight
+399
+LC-MS/MS
+None
+Defensin
+Spumaretrovirinae
+complementarity determining region
+-80 o C
+Primer extension reactions
+fluorescence brightness values
+whether delayed chain termination is a unifying mechanism of inhibition
+CT
+1.35 billion and 573 million
+HPBV
+35
+suppression of humoral immunity
+three
+many pieces of the puzzle
+co-morbidity
+Stacking interactions and solvent displacement
+peptide-MHC-I tetramers
+one-third
+0.05%
+technical errors or PCR amplification inhibitors
+23.3-42.1%
+RSV
+Microsoft Excel
+size-exclusion chromatography
+2002-2003
+Chinese biomedical journals
+0.03%
+less than 10%
+hightemperature field sites
+24 hours
+dropping sutures
+linear regression analysis
+Meta-genomics
+CZ
+qPCR
+human IFN-l4
+H244A mutation
+four
+syncytia
+Forty-eight hours
+Children
+flexibility of our admission policy
+protective antibody response
+Petechiae
+at desk
+7.8 mg
+serum of patients with atypical pneumonia
+the need for informed consent
+Global gene expression profiles
+IFN-γ, TNFα, and gzmB
+off-target Env-specific responses
+ZIKV blood and tissue viral loads
+8096
+λ
+translation of the viral genome
+Plans
+research conducted in high-income countries
+alternate approaches are validated
+Esophageal candidiasis
+P Ͻ 0.05
+Gown and gloves
+Amplification of specific transcripts
+400 million
+Vero cells
+2014-08-12
+viral persistence
+CD4 + CD8 − T lymphocytes
+a trimeric core
+helix-lipid
+browse the questionnaire
+Soluble forms of TLRs
+Eight
+standard deviation of the observed C q values
+12 May 2017
+28.6%
+sotrastaurin
+chest
+deliberately selecting children's samples
+Deoxyribonucleic acid
+Presence of airflow obstruction
+solubilizing tag
+Fluosol DA 20%
+10 contiguous bps
+SIV infected macaques
+HeLa
+-6.96 mv
+95%
+Nine
+Free State Province
+influenza, dengue, or OFI
+plaques
+50%
+longer survival time
+Takashi Fujita
+different underlying biological mechanisms
+live attenuated tachyzoites
+grey scale
+IFN-c producing capacity
+protein-arginine deiminase 4
+transmission
+Four
+50µL
+30%
+C6
+apoptotic
+three
+a-cyano-4-hydroxycynnamic acid
+twenty
+Bavarian Data Protection Office
+5.8 mm
+cross-protection
+future crises in the HR sector
+one fourth
+P-I-type protease
+25%
+2-40 µM
+recurrence-free survival
+circRNAs
+internalizing EVs into recipient cells
+Lipid peroxidation
+Proteomic technologies
+EL4 lysates
+increases paracellular permeability
+16
+2-fold
+RNA ligase activity in HeLa cell extracts
+HBVspecific T cell response
+transcriptional activity of CRTC1 and CREB
+vaccination levels also increase
+2018-02-20
+32
+nitrocellulose filter binding assay
+15,589
+conversion from vendor formats into open data formats
+Coronaviridae
+shock-multiple organ failure
+inactivate the virus
+K 93 FITSRCRL and F 57 GYMTFVHF
+4500
+90%
+blockage of hippocampal LTP
+ATC code level 2
+high
+broad-spectrum diaminopyrimidine
+increased efficiencies in À1 frameshifting
+biosafety level 3
+two
+gene III fragment
+Complete medium
+3k sequences in D
+a segmented dsRNA virus
+waning vaccine efficacy, the influx of susceptible displaced people
+C3P3-G1 enzymes
+42%
+clustered regularly interspaced palindromic repeats /associated system
+3 × 10 4 lux
+Swiss albino mice
+most cases of early-stage ONFH were painless
+protein homeostasis, protein trafficking, and translation
+invading the surrounding brain tissue
+40
+Island of Yap
+human or animal
+seven
+sustaining public awareness and alertness
+2.67 μM
+Flavivirus genome replication
+enveloped virus
+n
+Ad5HVR7epB
+Aleatory
+delayed onset of disease signs
+mutations in ENaC
+29
+five
+53BP1, MDC1, and Claspin
+Cross-protection
+a regulatory link between oxidative stress and lymphocyte function
+130 µL
+1.4 million
+oxidative stress and lipid peroxidation
+traumatic
+PML NBs
+Ile-91
+product contamination, genetic instability, and residual virulence
+Haplotype D
+individual outcomes and better infectious disease control
+liver and vascular damage
+genetically stable
+six
+Cary Eclipse fluorescence spectrophotometer
+99%
+above 90%
+Gatekeeper training
+infection
+Nine
+a search probe
+polypeptide size
+positive
+sense chemical gradients in the environment and move toward favorable conditions
+pathogenic retroviruses
+transfusing to a level equal to or greater than 100 g/l
+10%
+the best parameter configurations
+helper virus
+mice that were heterozygous for the targeted mutation
+hyper-vigilant
+Macrolide efflux pump
+strong activities against parasites and pathogens residing in animal digestive tract
+cap-dependent
+R 0
+caseating lung lesions
+VAR2CSA-reactive monoclonal antibodies
+Q s
+viral pathogenesis and viremia
+15.8 µM
+psychometric evaluation
+1000-fold
+proof of identity
+DAVID
+HPLC fingerprinting coupled with chemometrics
+fractionated OrCRTs and MrCRT-60 kDa
+bi-functional
+influenza virus NS1
+C. albicans
+MDCK cells or HAE cells
+Pogostemon cablin Benth
+along the airway epithelium
+pandemic planning
+decreased cytokine production after infection
+ConA and recombinant mBAP31
+VE estimates specific to the elderly
+Rabbit anti-human polyclonal-HRP conjugate
+Box 2 in Section 3.1.6
+Full influenza vaccination
+ligand concentration dependent
+an exact match of the first target value
+Cytokines
+small sample size
+20 ng/ml
+a PL-CP knockout recombinant virus
+meningitis, otitis media, diarrhea and upper respiratory tract infections
+14
+Flag-tagged hnRNP A1
+a translational enhancer
+4.7%
+proteasomal degradation
+89
+de novo assembly
+unified
+mRNA with poly primers and AMV reverse transcriptase
+Shigella spp.
+>98%
+929
+20.4 ± 3.2 nm
+mice and primates
+viral RNA molecules
+real-time surveillance
+LR Clonase II reaction
+interferon system
+25 days
+Viral infections
+4 days
+Scientific Report
+CD11b + Ly-6C hi monocytes
+BSI and WPI
+three
+fluorescence microscope
+Psychological stress
+EBV integration sequences
+22
+hantavirus antibodies
+interfere with some of the important physiological functions carried out by NTCP
+Tubulin mRNA control
+respiratory syncytial
+20 seconds
+insertion of electrode needles into the skin
+from the position in the mapping
+The domains and items
+95%
+two
+systemic amyloidosis
+HRP-Streptavidin
+prism statistical package
+ZIKV
+Single-use nasal cannulas
+FSCN1 and VIME
+HI and MN
+ATG5
+nine
+Retroviral and lentiviral vectors
+Identifying new disease-associated variants
+Viral competence
+46/167
+eight
+an alternative information storage molecule
+93,744,624
+endosomal escape
+when disease expansion will either be most likely or least likely
+CARD9 deficiency
+widens the loop region
+H1N1
+50 μL of 0.16 M sulfuric acid solution
+viral genomic RNA
+reactogenicity
+oligos #3629 and #3716
+1 h
+26
+2006
+rotavirus
+5%
+ten
+AP-1 and Sp1
+A linear model
+Single base-pairs
+the epidemic dynamics
+dysfunction of TRP channel in mitochondria or lysosome
+lack of a statistical association
+Chi-square test
+laminar flow hood
+360
+Dengue fever
+80%
+antibodies
+37
+stochastic
+107
+other facilities
+Network centrality
+molecular methods
+their animal is usually pretty sick
+microglial receptors
+IL-10
+clinical risk factors
+Google Scholar
+psychotropic
+Uncertainty analysis
+Ten
+15 minutes
+intermembrane domain 1 and the intracellular loop
+time from symptom onset and time before the development of lower respiratory tract complications
+Relatively little
+1,440
+1
+1918–1920
+Stevioside
+Seventeen
+cross-linking between the viral RNA genome and the protein coat
+a key gene in the G1 to S phase transition
+Xrn1
+four
+S. exigua
+Acox1 and Cyp4a10
+ECMO
+vector-induced insertional mutagenesis
+Peptides
+Anti-rabbit HRP
+PCR and RPA amplicons
+ribozyme sequences
+bicarbonate
+The prior density p
+50 l of Bright-Glo substrate
+diminished cell growth
+RNA-dependent RNA polymerase
+glm
+spatial heterogeneity
+Single cell
+48%
+General linear models
+mice
+NK cells
+Psychotherapists
+65 years
+366
+beneficial and adverse community compositions
+RoundUp Ready™
+325 nm
+deoxyadenosine
+orange and numbered
+potential infectious confounders
+canonical correspondence analysis
+10 mM
+African green monkey cells
+Peptides containing polyarginine analogues
+TLR4
+Pulse oximeters
+GAPDH
+relapses and infections of systemic candidiasis
+VHFs
+G. dewevrei
+79.7%
+39 701
+group 1
+Hoogsteen interaction
+aerobiological
+Ongoing studies and increasing amounts of experimentally-verified PHI data
+innate immune cells
+glutamine
+insulin receptor and membrane metalloendopeptidase
+Regulated on Activation Normal T-cell Expressed and Secreted
+BCG
+A contrast
+Fisher's exact test or the Mann-Whitney test
+conserved
+addition of GalNAc in vitro
+93.0%
+1,075
+1 h
+18.5%
+SMARTselection algorithm
+pancreatic cancer
+to retain the integrity of the host sequence
+ÁÁC T method
+two
+Behavioral changes
+between 15 and 20 minutes
+look down upon us
+several pathways
+Information on health behaviours
+geographic level estimates of wealth
+cardiac or chest
+Publication order
+retention of particles expelled inside the masks
+UU
+89K-borne integrase
+plasma cytokine contents
+2%
+random numbers
+dromedary udder morphology
+six
+scale, resolution and pixel
+Royal Melbourne, St Vincent's, Austin, and Alfred Hospitals
+HCV particle formation
+means and standard deviation or median and interquartile range
+Respiratory syncytial virus
+tissue from four mule deer
+two
+apolipoprotein B100
+whether and how compassion is enacted
+The pharmacist and the statistician
+the vaccination itself
+PD-1/PD-L1 and CTLA-4
+Osteonecrosis of the femoral head
+surveillance
+cancer and autoimmune diseases
+their families
+nestin expression
+Lentivirus stock
+liposomes
+Nasopharyngeal aspirates
+medical provider costs or patient and carer costs
+increased expression of cell adhesion molecules
+100 μL of 0.25 M H 2 SO 4
+t+1 to t+D
+the α-chain of the IFN-I receptor
+Mice
+rapid test and western blot
+Eight
+CD14 + expression
+tracheal phantom
+recoding through -1 ribosomal frameshifting
+EV71
+bacterial pneumonia
+60 nm to 140 nm
+NW, CW, and RS samples
+2005
+oseltamivir
+very few
+pulmonary surfactant proteins
+modified IL-6 dynamics
+translation efficiency
+0%
+exhaustive
+1A and 1A 5
+S. maltophilia
+nil
+ten
+cellular endocytic machinery
+Creb3L1
+inflammatory
+α-secretase ADAM10
+227
+2%
+FITC-conjugated BSI-B4 isolectin
+AGR2
+79,656
+antagonistic proteins
+17
+IFNstimulated gene factor 3
+broncho-alveolar lavage
+breed- and/or subline-dependent
+identification of the optimal primer set/sets
+Product fluorescence
+over 25 thousand
+2-fold serial dilutions
+56
+bound to the active site
+6
+CXC
+44h post-infection
+homologous controlled human malaria infection
+age-associated deficits in Tcell signalling
+respiratory syncytial virus
+economic
+negative
+Total nuclear count
+BCA protein assay kit
+MERS-CoV
+24 h
+Thirty-nine
+€25
+34 years
+HRV-A 2A
+many variables
+Eighteen
+a reaction of foreign body granulomas
+clearance of microorganisms from the blood stream
+Non-informative priors
+AdC7-GRN
+Caspase-mediated processing of VP90
+Alphaviruses
+191871919
+14.333, 17.640 and 25.716
+20 hrs
+environmental health and food safety and inspection
+insect and plant viruses
+survivability of AIVs
+greater DNA-loading capacity
+childcare
+five week
+692
+Serum from mice immunized with OVA protein
+Interpretative Phenomenological Analysis
+CRT
+PCR
+p-TSC2
+two
+LIVE/ DEAD1 fixable dead cell stain kit
+four
+risk-benefit, risk mitigation and risk management
+3.448
+ten
+30-fold
+interevent contact time details
+three
+6 months
+Filter aerosol penetration
+endocytic vesicles
+human sepsis
+amiRNAs
+rodents
+25
+transcript-binding capacity
+Smad adaptor protein β2SP
+β-lactam antibiotics
+Transdisciplinary collaboration
+Post-fixed brains
+SNV prevalence
+CCHF viral and antibody kinetics
+the drug has no effect
+20 min
+inocula
+during lymphocyte maturation
+Mock-infected
+the need to exact expectations
+binds both Zn 2+ and Mn 2+ with high affinity
+Perl
+activation of an antiviral response
+80%
+Ethical approval
+1 mM CaCl 2
+Cote d'Ivoire
+glucuronyl transferase UGT1A1
+dual defect in secretion and potency
+botulinum neurotoxicity, inflammasomes and other immune system pathways
+Twelve
+Marmoset
+immunocompetent
+gap-repair procedure
+mineral oil
+p c *
+0.5
+CD11c Microbeads
+450
+PolyPhen
+DHE dye
+mucin glycosylation
+restrictive
+100 mm 3
+unusual mechanisms
+More intervention research
+28
+Building design and operation
+increased demand for psychological support services
+two
+500ng of RNA
+17
+all four parameters of disease and inflammation
+to obtain the highest surfactant effects
+minimal
+ethical responsibilities for individuals, collectives, governments, and donor agencies
+cystic fibrosis and hemophilia
+Correction for sliding base pairing
+protective
+Orbitrap Lumos
+NMR chemical shifts
+capsid C protein
+26
+Eight weeks
+visualization of contaminated air flow
+pairwise homoplasy index
+Maraviroc
+Renal cell apoptosis
+U01 AI-068636
+merozoites invasion and replication within red blood cells
+8,16
+MMTV entry
+Trypsin buffer
+simplifying
+a receptor for S. pneumoniae and H. influenzae
+decreased
+viral pathogenicity
+antibiotic exposure
+11
+three
+20 µl
+household size factor Household
+6 and 25
+viral DNA evolution
+the level of sg RNA7 synthesis
+optical density value
+10 min
+mutations affecting host receptor binding as well as pH dependency
+ionotropic as well as metabotropic receptors
+Super RX film
+Sera Laboratories International Ltd
+high fish densities and fast maturation
+antigen dose
+9
+naïve T cells
+48
+480 million
+cc-by
+secondary structural element
+primers for viral transcription
+collection volumes
+the sensitivity declared by the manufacturer
+meta-regression models
+Noninfected macaque serum
+lncRNA-protein interactions
+Genome size
+total disagreement between prediction and observation
+parasitism by schistosomes
+15.01
+Viral protein 2
+mRNA levels of target genes
+260/280 nm
+232,051
+IFNs
+NoV genogroup I
+bi-cistronic vector system
+secondary envelopment
+hairpin secondary structures
+1-3 kcal mol -1
+positive personal hygiene practices, health behaviors and perceptions of disease prevention
+indicator bacteria
+NEDSS architectural, software, messaging, and data specifications
+repeated acts of non-compliance
+difficult
+Germany
+F protein
+10 8 per hour
+viral growth
+similarity in various physical and chemical parameters
+life-lasting cognitive and psychosocial deficits
+disease transmission
+Increasing levels of tobacco smoking
+Bim
+myeloid cells
+40 AID 50
+deca-aspartate
+>97% of target regions
+The global community
+0.35 µM
+The requirement to maintain subject confidentiality
+23%
+Gluc1 and Gluc2
+Endothelial cells
+classical t-test
+poor cross-protection between different types of IBV
+well-studied human responses and pathways
+1/ 0
+events occurring in the endosome
+Pathological changes
+transient state of data collection
+23 months
+experimental wildtype DENV data
+Production of kits for the major farm animals
+synthesis of ISG56 mRNA
+high
+citizens
+lymphocytopenia and neutropenia
+Chronic pain
+absorption, distribution, metabolism, and excretion
+myeloid-derived suppressor cells
+TRAF1 −/− T cells
+500 million US$
+2862
+3 h post-treatment
+RVA
+Serum TG immunodetection measurements
+Blood and respiratory samples
+DMXAA
+4-hour
+369
+3.2%
+four
+Apolipoprotein E
+µM
+The date and time of AF
+Kaplan-Meier curve
+culture
+herd immunity to wane more quickly
+2B
+associated uncertainty in mapping
+Cellular ERK signaling pathway
+Δ t,i → g
+six
+stress and anxiety
+1 month
+viral gene products
+a humanized version of the murine antibody A5B7
+20 min
+HDL-bound esterase
+Unpaired Student t test
+yeast
+Western Pacific Region
+Figures 1
+POWV IgG
+NCBI Entrez Protein Database
+SAMtools
+Freeman-Tukey double arcsine transformation
+IL-21 and IFN-γ
+12
+cutaneous lesions, gastroenteritis, and/or progressive respiratory paralysis
+46
+How to properly examine the prediction quality
+912
+85.96 nM
+ex-vivo
+SGC7901 cells
+20 min
+Vacuolar ATP synthase
+Tsg101
+10
+Medical and public health needs
+H1 and H3
+oseltamivir
+M-NAPPA
+illegal feeding of swill to pigs
+13
+Volz model
+RTA
+modify the susceptibility to infection of specific tissues
+at doses of 5 and 10 lg
+53
+supernatants
+HAstV
+to urgently assess the needs of HIV patients
+structure or function
+24
+lipid mixing
+Non-significant
+homologous
+Translating the qualitative notion of fitness into quantitative terms
+5
+Student's unpaired t test
+No overlap in the location of significance
+Ceftriaxone and clotrimazole
+Marek disease
+phosphate-buffered saline
+Initiation factors
+Peak areas
+six
+political or socio-cultural
+increasing signs
+98.2%
+non-redundant
+MIF receptors
+proteomic studies
+adenovirus
+China
+Blood samples
+Ribozymes
+Animal Welfare Act
+the uncertainty during the model calibration period
+Orbitrap Fusion Lumos Tribrid
+herbal medicine 42, 43 and homeopathy
+216 bp
+the transit peptide and the protein product sequence
+increased immune activation and the inhibition of viral replication
+Further work
+maternally derived
+glycophorin B and complement receptor 1
+K
+Day 14 post-infection
+2500
+4°C
+error bars
+Elution buffer
+The influence of macrolevel events and conditions on psychological variables
+enhanced the notchedwing phenotype
+RSV
+below the detection limit
+TAT-Casp3
+aerogenous viral infections
+antifungal
+Hawaii and New Zealand
+real-time reverse transcription-polymerase chain reaction analysis
+blue
+5-10 min
+lysine 406
+Iba1 immunofluorescence
+antibiotic treatment
+Research Gaps
+2 to 3 weeks
+Alveolar
+ECL immunoblotting detection reagents
+cancer reductive
+Influenza A virus
+to avoid the facilitating effect of HDL on HCV entry
+T RACHEOBRONCHOMALACIA
+evaluating an H7N9 influenza vaccine
+enhanced the cytokine induction
+71
+Etf-1-GFP
+Illumina MiSeq paired-end reads
+cyclin D1 levels
+a nine-step protocol
+kB
+inhibited asthmatic responses
+the Sponsor
+catalytic activity
+reduced endothelial activation and protection of lung epithelial cells
+diarrhea, prevention of allergies, and treatment of a wide range of bowel diseases
+antigenically
+48%
+as soon as travel is booked
+AlkB homologues
+72
+oncolytic MV
+The University of Minnesota and the USDA
+43
+66%
+a simple adjunct next to the bedside
+CD15
+more vulnerable
+UV lamp
+33%
+an antigen
+the smoothing spline
+Peptide mass tolerance
+the unknown fraction
+American Type Culture Collection
+12
+Hazard ratio and 95% confidence intervals
+lowest
+metal binding sites
+AO
+CV titer
+UBF 1 and B23.1
+opportunistic
+55%
+trapped
+a predicted total mass of 60 kD
+homology
+Rb
+30 min
+C5aR
+Two
+functional trafficking network
+marked follicular and paracortical hypertrophy
+2 hrs
+pH 5.5 or 6
+24 hr post-inoculation
+KYL and GWYN
+five
+viral genome
+H1N1
+100:1
+34
+SOFA renal subscores
+uncertainties linked to population movement and records of infected individuals
+ϳ10%
+Reduction of the disulfide bond within the host cell
+cholangiocytes
+FKBP11
+three
+Hippocrates
+10.1186/1471-2334-14-21
+14th, 21st and 28th
+Ramachandran plot
+amino acids, small molecular peptides, and nucleotides
+formation of DNA:RNA hybrids
+age distribution and activity type data
+polarised transport from REs to the apical plasma membrane
+100 and 500 ng/ml
+one-third
+160
+latency I, II and III
+2014
+73
+bisphosphonates
+Dissociation curves
+suboptimal fertility
+host cellular RNA control pathways
+mutational
+two
+ACE2 receptor
+SPMs and lipid mediator class-switching
+Broad-reactive anti-M2 protein antibodies
+50%
+20%
+42%
+−80 °C
+1.42 million
+Shapiro-Wilk normality tests
+Thrombin
+LIVE/DEAD fixable near-IR cell stain
+five
+electron coupling reagent
+hybridizing complementary natural nucleic acids
+Quantity One
+SINV-G
+viral suppressors of RNA silencing
+Luminex R Bead-based Multiplex Assay
+cases in other dogs
+RNA
+six
+test set and Fischer randomization methods
+AA
+UV
+methanol-d4 and DMSO-d6
+serious injuries
+VP24 and VP35
+Microglia
+SsTroA
+endotoxins
+Cerebral toxoplasmosis
+DMF devices
+Four
+Bacillus thuringiensis operon
+ArcGIS version 10
+very tight binding
+196
+Formulation
+every 2 days
+high-intensity laser diode
+buffer A
+timeof-addition assay
+Jetprime
+spatial
+V FS
+respirable aerosol particles
+porous surfaces, non-porous surfaces, skin and mucous membranes
+glu-to-ala
+Regulation of the microbiota
+polymicrobial insult
+10%
+full-length SMN2
+homoscedastic
+activation of the innate immune system
+proximity between home locations addresses
+synplot2
+less than one hour
+VacA-mediated
+immune
+491
+F17
+Syk del/del and Syk inhibitor-treated
+real-time PCR
+Fisher and Paykel Health Care
+TRAF3 ubiquitination
+GBS
+low immunogenicity
+two plastic caps
+viral genomes
+OVA-specific IgE responses
+pneumonia
+manually
+SF162 and VI 1888
+UV light
+crucial
+Ginsenoside Rb1
+edema, neovascularisation and scarring
+Imperial College of London
+early, late and recycling endosomes
+Influenza A H1N1pdm
+PF-03084014
+full maturation of macropinosomes
+specific substitutions
+Vacuolation
+Interleukin 1 and 6
+191871919
+G proteincoupled receptors
+4 hpi
+attenuates both early and late inflammatory responses after reperfusion in MI
+50
+Statistical Analysis
+Campylobacter species
+The tomogram of a linear region of the Ebola virus
+nearly every month
+splicing and downstream transcriptional induction
+The phylogenetic tree
+78°
+written weekly reports
+N i
+interferon-alpha
+Glucose regulated protein 78
+electrophoresis
+good clinical conditions
+Efficacy
+nearby uninfected cells to produce interferon
+recent infection
+smaller
+Representative simian and avian sapelovirus reference strains
+randomized controlled trial
+violet-coloured
+four
+TAIL proteins
+PathoChip v3
+compound 9a
+eosinophilia
+8 hours
+bnAbs
+33
+4% PEG-8000 and 3% NaCl
+HPRT1 and HMBS
+Seroconversion
+inflammatory reactions
+a reassortant strain
+143
+fatal
+paired t-test
+18C/cycle
+containment becomes possible
+low-density
+panic, anxiety, and insecurity
+24%
+Brad Lowell
+phosphorescence oxygen analyzer
+267
+Acetylated targets
+miR-124
+Student's t-test
+emotional
+peptide-binding repertoire size
+IncuCyte ZOOM live cell microscope
+401
+Differentially expressed genes
+controlled, clinical studies
+additional neurological deficit
+Cytofix/Cytoperm
+Packaging in plant viruses
+Interferon-stimulated genes
+45%
+Total RNA Extraction kit
+different matrices will function best
+GBV-B
+leukocyte lineages or subsets
+MBP
+model
+17 months
+GBV-B
+antiviral defense
+IPTG
+increase frameshifting
+fresh Opti-MEM
+DNA templates
+Protein assay
+10.1%
+Drug target identification
+17.3 kDa
+cc-by
+immunologically privileged site
+25 h
+d
+ECL Plus Western blotting detection kit
+group 1
+SAB-155
+2 mM
+Single cell suspensions of splenocytes
+300Mb
+amine
+11
+Hepatitis B type e antigen
+Twenty
+Haploview 4.2
+191
+~20 nt
+adenovirus real-time PCR
+2012
+copper ion
+34%
+six
+model B
+79
+Maternal immunization
+Early and accurate diagnosis of PPRV infection
+WT and IFIT2 KO mice
+0.668
+two
+mean number of nucleotide substitutions per site
+moderately impaired LV
+14
+greater
+One third
+virophages and single-stranded DNA viruses
+11
+body temperature, and SOFA score
+mt cox1
+marginal likelihood estimation
+HY
+negative
+August 2010
+suffering
+D. virilis
+selenoprotein transcripts
+suboptimal
+7-10 d
+degradation
+nausea, nervousness and dizziness
+45
+Taiwan
+greater probability to elicit an immune response
+two-tailed Student's t-tests
+James Allison and Tasuku Honjo
+virus infectivity, fitness and pathogenesis
+1 day
+155
+physically more realistic
+Zeiss LSM 710 confocal microscope
+Western blot analysis
+twice
+25,421
+Data
+immunocompromised
+Mutational changes in the LTR regions
+onset of symptoms
+42%
+stronger immune responses against the delivered antigen
+four
+a likely realization of all possible connections that can occur between them
+bacterial culture
+glycoproteins
+new starting parameters are chosen at random and estimates are re-evaluated
+versatile natural products
+bacteriophages
+Human memory NK cells
+likelihood based method
+consultant and speaker fees and grant/research
+thymus
+Objective risk assessment
+loxP sites
+independence
+SA11 rotavirus
+cross protective antigens
+big data
+confocal microscopy and flow cytometry analyses
+1.4
+cell-surface receptors
+Yokoyama laboratory
+to restrict the spectrum of host usage
+DIs
+altered intranuclear distribution of UL44
+Antibiotic exposure
+data that has been extensively collated and analysed
+evolutionary tree alignment
+Table 1
+Isg15-deficient
+preventing moral complacency
+displaying a particular epitope
+Purified, quantitated vaccinia Lister strain DNA
+late March to July 2009
+Fit factor
+UV spectra of 9 and enzymatic product 9a
+ongoing transcription
+E5 protein
+two
+absolute quantification
+OPCML
+the society that is being modeled
+mucosal-protective
+Total VP5-positive/pfu particle numbers
+anatomically accessible self-constituents
+regulatory approaches to preventing prion-disease transmission
+A 1
+A pseudonymised extract
+24
+plaster of Paris
+online tutorials
+pneumococcal population structure
+GpSGHV and W. glossinidia
+the surface
+by translating different proteins from a common mRNA
+VFF testing
+whether the nuclear pore complex is involved or not
+p k
+IFNAR
+γ
+A compilation of our own sequence analysis
+circulating IL-6 and IL-10
+0.108-0.207
+different wells
+clinical
+recombinant VSV/LASV and reassortant ML29
+a specific biomarker
+1.4.1
+240
+38
+45 minutes
+decreases
+Born solvation
+stable 6-HB
+Dr. Yount and co-workers
+Eritoran from Eisai
+multiplication of viral hemorrhagic fever-causing LASV
+clinically comparable
+Monocyte Chemotactic Protein 1
+2009
+liver and bone regeneration
+High rates of CRAB and MRSA detection
+guanidine
+three cysteine residues
+8
+24%
+vimentin and Pol b
+DUF4280
+Soluble N-ethylmaleimide sensitive factor Attachment Protein
+information about less ill or asymptomatic pandemic patients
+de novo integration or recombination
+respiratory
+1:25-50,000
+RNA helicases
+82.4%
+15 nm gold layer
+218 or 219
+manidipine
+Comparative molecular field analysis and comparative molecular similarities indices analysis models
+Annotated ELM instances
+IRR
+sequence analysis of 24 randomly selected PCR
+25
+renal ADAM17 protein expression
+aerodynamic particle diameter, mass, and density profiles
+15 min
+Lorne Tyrrell and Norman Kneteman
+five
+Animal Welfare Act and the Guide for the Care and Use of Laboratory
+B cell-mediated humoral responses
+Seasonal influenza
+apoptotic morphological changes
+Cayman Chemicals 61
+42
+Real time PCR
+Platelet response
+Inactivation of the b-casein gene
+Cellfection ® II Reagent
+high morbidity
+lower reactivity
+crosstalk
+sub-Saharan Africa
+ionized air
+Medium 199
+132,048,347
+Understanding the mechanisms by which populations adapt to distinct environments
+crowdsourced
+knowledge-based
+a library of antibodies
+38
+E-protein
+2 days
+0.2 to 0.3
+higher compliance of the respiratory system
+zinc-finger
+5-h
+real time PCR test
+HTN
+participate in a research study
+IL-2, IFN-γ and TNF-α
+Table S9
+AMSTAR
+sequencing
+26
+recruitment of Egr-1 to ORF50P
+when the microbiota is reconstituted
+three
+Two
+1 h
+AP peptide conformation
+PHHs with IFNL4 TT/TT genotype
+GI disorders
+D'Alessio and De Lorenzo
+innate responses
+Astrocytes
+GII.11
+Sanger sequencing
+The availability of these libraries
+SUMOeome
+inflammation, opsonization, and membrane perturbation
+activation of the TLR/NF-κB and MAPK pathways
+600657
+Pulmonary hemorrhage
+DEPC-treated water
+3 weeks
+0.76
+Csl4-NT
+GSE76220
+polyI:C
+circular
+R A and R P
+Surveillance methods that can detect disease at an earlier stage
+maintaining normal intestinal function
+T4 Pnkp
+I=log
+a certain transition at a defined temperature
+oral cyclosporine
+diagnostic testing
+Seventy-six
+Zixing Huang and Shuang Zhao
+The environment
+meningitis
+1922
+three
+bronchiectasis and chronic sinusitis
+3, 7 and 8
+95% confidence interval and 80% power
+high glucose and Ang II
+cervical dislocation
+56.21
+their transmission
+cell type
+82 nucleotides
+6%
+naive CD4 + T cells
+TNF-␣ levels
+non-specific antibody binding
+Respondent-driven sampling
+99.96%
+physical units of surface radiance
+zero
+adjusted regression models
+in-gel trypsin digestion
+alkalie
+P. knowlesi
+M protein release
+Peptide or antibody libraries
+Six
+detailed comparison of each theme across the studies
+isothermal
+motor neuron perikaryon
+>40-fold
+perceived fear
+Regulatory T cells
+splenocytes
+strong oxidants
+high throughput methods
+RRIL
+adaptive immunity
+socialize action 1
+a motif directing mRNA to the perinuclear space
+10,000
+number of cases that occur before detection and initiation of an effective response
+CD8 T cells
+cellular responses to viral infection
+MagNa Pure LC Total Nucleid Acid Isolation Kit
+heat-unfolded nuclear reporter proteins or cytosolic proteins
+type I IFN
+Biomarker
+Sigma-Aldrich
+EBNA1 amino acid position 640 *
+>1000-fold
+better reactivity of the immune system
+functional protein
+PESTLE
+six
+MagNA Pure Compact RNA isolation kit
+3
+XML
+blast cells
+98%
+significant responses
+376
+Histidine
+three days
+70%
+sentinel surveillance system
+they do not have any contact with terrestrial vertebrate species
+5
+C. hominis DNA
+Eight
+842,000
+stimulates RIDD signalling to decrease ER protein folding load
+EZR
+46
+circular dichroism analysis
+37°C
+P 2
+floral
+bacteria
+system-level
+somitic
+Forty-two
+The existence of strains
+dynamic change
+21
+transcription factor binding differences
+linear regression analysis
+decreased virulence of the host
+macrophages and fibroblasts
+29%
+V E
+Midtemp t and Hightemp t
+US census data
+One Health approaches
+deregulation of viral protein accumulation
+R0
+Total cell DNA
+wild-type cells
+recycling endosomes
+Total RNA concentration
+projecting a health care systems' surge capacity for large-scale PHEs
+B. subtilis
+PDI
+PPRV Nig75/1
+two a-helices
+Z v,w
+Poor nutritional state and hypoalbuminemia
+51%-68%
+nonionic
+Tunneling nanotubes
+15.6 days
+Benjamini-Hochberg method
+EMSA
+LC3 puncta
+Zeiss Axioskop microscope
+1:10,000
+high-income countries
+Antiviral treatment
+specificity
+Antiuricosuric drugs
+mouse
+An investment case
+inter-clade cross-protection
+Germline alignment
+pooled serum samples of each flock
+selection for bronchoscopy
+Five hundred
+16 h
+one hydrogen bond
+traits known to affect mate choice
+sensitivity to γ-sec inhibition
+RIDD
+Eastern and Southern Africa
+TwitterScrapper
+macrophages and DCs
+nontrivial transitivity
+5 µL of EDAC or NHS
+10 2 copies of synthetic RNA
+diminished morbidity
+µ t and s t
+65
+cell-free virions
+RNA-binding proteins
+ORF54
+membrane fission
+adverse
+1997
+ATG7 and Beclin-1
+PCR products
+High viremia associated with hepatic necrosis and increase of liver enzymes
+system integrity and maintenance
+four
+DNase activity of IgGs
+Human embryonic stem cell-derived progenitor cells
+Poisson regression model analysis
+cyanurate degradation
+23
+ligand competition studies with other ligands
+our sample size
+viral loads
+outbreak 1
+a prototype downstream effector
+septic shock
+an intracellular viral restriction factor
+biogenesis of ribosomes
+70 kDa
+NS4B and NS5A
+infectious diseases
+50%
+simulation and analysis of complex network models
+108
+autophagy flux
+assumptions of independence
+Csl4 exosome
+ecological network theory
+33
+using standard techniques
+diminazene
+functional
+binding and entry assays
+lead responses
+increased copying fidelity of shorter segments
+hepatocellular carcinoma
+intrahost selective pressures
+low levels of immunoglobulins
+ER morphology
+plasmid DNA
+BCA protein assay reagent kit
+s n
+0.6 g CaCl
+Mfold
+statistical significance
+Mitochondrial function
+60 min
+1 s days
+113
+5,000
+relevant information
+methanol
+viral proteins
+P. Fortes
+unprecedented
+over 31 000
+alternative macrophage polarization
+twice
+Total RNA
+network degree distribution
+brain cells
+more rapid diagnosis
+92 %
+Hepatocellular carcinoma
+5%
+Staurosporine
+large-scale genes
+300
+cathepsin cleavage
+0-5 months
+mouse-adapted ZEBOV
+TGF-β
+repressed
+Co-morbidities
+ReverTraAceqPCR RT Kit
+viral
+identical
+inhibition of cytopathic effects
+Packaging signals
+PVDF
+Furin-mediated prM cleavage
+heterogeneous
+5.8%
+ATF4
+detection of serum HBsAg, HBeAg and viral DNA copies
+1,889
+different virulence factor genes
+Over 100 000
+SMIA
+a needle
+pPICZαA-NS2B-NS3 pro
+232
+Building unit
+three
+another dose of MTSSL
+40
+eRF1 concentrations
+mild hyperthermia
+3-fold
+Human DC-SIGN
+Ebola GP
+means ± the standard errors of the mean
+Inflammatory responses and intestinal microflora composition
+cellular invasion
+symptomatic and positively screened
+0.90
+2.6 cm
+36 hours
+Adjuvants
+poor
+ABCB1
+Danshen
+Rev-responsive element
+amyloid fibrils
+target cells expressing SCT-Y84A
+SSRs
+Purified PCV3 VLPs
+Free radical induced oxidative stress
+covalent attachment to other proteins
+Immobilon Western Chemiluminescent HRP Substrate
+endoplasmic reticulum
+human CMV
+PCR product of the TEF4 gene
+Meta-analysis
+medical record review
+Importance of community partnerships in disasters
+Unfamiliarity with the signs and symptoms
+Label-retaining cells
+molecular testing
+CentOS 5.4
+neurological
+air change rate
+enteritis
+peptide
+to give fold differences and standard deviations
+SHAKE
+serum-free medium
+single and double mutated variants of PeB-Lys
+MSM
+24-h
+Tanzania
+HRV and HEV
+Extensive poultry farm surveillance
+IL-10
+volunteers and participants' willingness to have more than one child
+Sec16A
+mediates fusion of viral and cellular endosomal membranes
+40%
+the Ho score
+vaccination
+peak airway pressure
+network structure of the form of communities
+day 8 p.i.
+differently
+the secondary structure
+pathogens
+anthorse
+GEO2R
+94
+9
+Acinetobacter spp
+Médecins Sans Frontières
+3057
+45.8%
+SPSS statistical package
+MSF and MSFsc
+bacterial
+Nationally aggregated data
+prevention of further disease spread
+TIRF
+ameliorated
+Coilin
+over a third
+viral pseudotypes
+5-fold
+0.2794
+49
+30 min
+The sequences of putative germline counterpart
+proteomic
+Hardy-Weinberg disequilibrium
+Sichuan province
+APOM coding exons
+seventy-five
+a certain time period post infection
+macrophages
+prevents AhR translocation
+ethical
+magnetic field distortions
+Sepharose
+PrimeScript™ 1st Strand cDNA Synthesis Kit
+m 6 A
+Animal models
+Institute for Health Care Improvement
+95%
+2 r IDP
+vaccine
+0.9
+65%
+APC-CD45
+Two
+Victor 3 V 1420 multi-label counter
+Asthma and obesity
+Ribozymes
+a system capable of meeting these benchmarks
+T 0
+cox proportional hazard model
+2004
+loss of the nuclear localization signal
+lipids, proteins, nucleic acids
+fragments of the abovementioned hypothesis
+antiviral response
+À1 FS
+lipid metabolism
+20,000
+the overall circumstances of infectious intestinal diseases
+Ag-specific baiting
+Space-time scan analysis
+0.99
+rotary
+High level of knowledge
+120
+read depths
+virologic surveillance
+nanodrop spectrometer
+prophylactic
+non-specific adsorption onto hydrophobic surfaces
+b-Actin
+biomarker levels
+ProSeq grouping Task results
+disease severity
+TLR9
+HRCT
+Durect Corporation
+Octet 7.1
+2014 to 2015
+SOCS3-siRNA therapy
+GraphPad Prism v6.0
+long-term maintenance of therapeutic levels of vector-delivered transgenes
+equation 1
+Ap4A
+anti-viral therapies
+79%
+One-way ANOVA, Tukey post hoc test
+bronchopulmonary
+accelerates
+five
+36.6%
+spring and fall
+haemocytometer
+HAART
+cytokines
+p56
+antimicrobial drug prescribing
+MyrB
+whether time taken off work influenced compliance or whether taking leave had a financial impact
+anti-interferon -c mAb AN18
+ulinastatin
+blood samples
+knowledge that may help people in the future
+G3
+Rabies
+878 m
+phalloidin-FITC
+mortality
+physical and biological laws
+one of those possibilities is chosen at random and recorded in the consensus sequence
+gene expression
+stem-loop A
+ON and 300
+Lamin B1
+lipid peroxidation products
+VP1 protein
+Contact tracing
+Climate Change Adaptation Roadmap
+population coverage tool from IEDB
+MX1 expression
+GNAS
+parameters usually associated with poor prognosis
+Vimentin
+Reverse-Phase Chromatography
+three
+0.9 to 4.6
+serve as the assembly platform for downstream signaling intermediates
+.85%
+higher lifetime expected risk
+cross-linking assays
+ClustalW
+IPO
+Mating with empty pGBKT7
+2.04 Å
+The initiation of CEACAM1-S-mediated IL-2 production
+excellent sensitivity
+knowledge about the host biology as well as societal and environmental factors
+19
+103
+one
+Urine
+The ratio between the motif and no-motif frameshifting frequency values
+Positional clustering
+Eight
+n A m
+4 mg/ml
+rgH7N9
+significant
+IFIT5-oligo-C complex
+P3N-PIPO
+4
+Gαi3-mediated
+oligomerization
+reverse transcriptases
+2008
+messenger RNA-based vaccines
+80 years
+Aspergillus species
+higher risk of pancreatic cancer
+Isoform 2
+QIAEX II Agarose Gel Extraction Kit
+COVID-19 disease
+Trauma, bleeding, cell injury, and irritant particles
+when inter-degree is big
+the specific swine flu symptoms
+communication and outbreak response activities
+215
+accuracy, relevancy, value-added data and interpretability
+respiratory disease
+pro-inflammatory
+52 kDa
+SILVA_123 database
+Ninety-nine
+PrCR
+98Á33%
+16:8 h
+Treatment with antiviral agents
+compression and contusion models
+Thirteen
+215
+generalists
+27
+4 h or 24 h
+1915-16
+neurological symptoms
+Aortic cross-clamp time greater than 85 min
+6
+IFIT1
+HCl or NaOH
+NPC1
+spacers
+10
+L2
+health informatics and practical concerns
+three
+25
+6
+90%
+decrease the overall compensatory potential of ACE2
+7.162.03 days
+Public health messages of emergency
+virgin coconut oil
+3c, 3d, and 3e
+SDS-PAGE
+temporary
+One single part to one figure and one experiment
+UG4
+size-biased household distribution
+Natural RNA extracted from virally infected cells
+70%
+a template
+PCR, Southern blot, northern blot and western blot
+demonstrating the possibility of using PI as an efficient tool to tackle novel tasks
+mRNA related to inflammation
+aequorin
+48 h
+cancer progression
+EBV-associated
+traditional methods
+affinityeluted fractions
+half
+Japan
+Early recognition
+human AEII cells
+0.2g, 0.6g and 1.0g
+single amino acid codon mutations
+40
+NGS
+190
+pathogen virulence
+MO2
+polydnavirus particles
+31
+27
+two-step qPCR
+species diversity
+Bonferroni elements
+BAG6 and AIF1
+different growth factors
+the pathophysiological context
+cell lines are well characterized and comply with regulatory guidelines
+significant compound crystallization
+respiratory dysfunction
+inappropriate use of antibiotics
+9
+Psoriasis
+10 8
+guinea pigs
+5
+0.5%
+Imported dengue
+CD8 + T-cell responses against Ad5 delivered vaccine antigens
+PB2 E627K, HA E190D and G225D
+IgG Fc
+45%
+the variable is not useful for prediction
+Viral RNA
+tryptophan-rich
+12
+cell survival
+Cytotoxic-T-lymphocytes
+clinical suspicion
+four
+proinflammatory cytokines
+hyperfilamentation
+LaSota and R2B
+2%
+cell cytotoxicity
+A threshold of 13% divergence on VP1 nucleotide sequences
+16 years and older
+desirable gene variants
+Levene's test for equality of variances
+its potential therapeutic use
+RPL19
+Fold change
+less than twenty
+2 0 -AMP
+humoral immunity
+1951
+Culture
+12,000
+six
+diethylstilbestrol ingestion
+0.5%
+10.360.6 Å
+50% inhibitory doses
+Na +
+MHCI
+315
+to ensure stable and consistent conditions
+1.92 Å
+therapy of genetic diseases
+Compound 61
+phylogenetic trees
+four
+20
+Immunosuppression
+vaccination and antivirals
+PARG
+identifying APC's involved in generating T RM within the nasopharynx
+Macrophages
+Sangeh
+22
+ten
+contamination with the wild type virus
+lipidation
+cytopathic
+The precise mechanism
+Ross River, Sindbis, and chikungunya viruses
+defining specific clinical target applications
+39%
+Dr. Hermann Katinger
+issues of reflexivity
+mallard duck
+1978
+all other linkages
+induce broadly reactive antibodies
+linearity
+human participants or animals
+abiotic stresses
+alanine
+1.7 million
+peak inspiratory airway pressure
+1 h
+liver accumulation
+common shrews
+significant
+twice a week
+F4-specific binding antibody responses
+Rotavirus-like Particles
+§2
+gD2-specific IgG and HSV-2 neutralizing antibodies
+the common structure
+Gag
+Unstimulated PBMC
+Ty1 retrotransposon
+younger age groups
+92
+homologous
+nurturance
+alkaline phosphatase-conjugated secondary antibodies
+Culture supernatant
+mid-September 2014
+airway hyperreactivity
+1:3.5
+shedding of cell surface proteins
+GEO
+The investigator and staff
+induced conformational changes
+four
+Persian
+Acute liver failure
+forward variable, reverse variable, and variable
+RNAdjuvant ®
+50 ms
+Demand-Control Model
+±12%
+White Leghorn
+Figure 4A
+MSC-mediated wound healing and revascularization
+7a
+1%
+7.9%
+radiation
+Presence of extracorporeal circuits
+S. cerevisiae
+Serum antibody titers
+neoliberalism
+Nucleic Acid Database
+0.15 M
+8-30%
+single nucleotide polymorphism in the amplicon sequence
+Pulmonary
+RIG-I
+functional HA
+UnaG green fluorescence reporter
+Direct and indirect ancestries
+human
+PONDR VLXT
+mild clinical signs
+policy guidance documents
+609.59 million
+Nephropathogenic infectious bronchitis virus
+177.8
+SGIV assembly in VAS
+lncRNAs
+University of Wisconsin-Madison
+cells or parasites
+The mucosal immune system
+GAPDH
+CD55
+fitness
+mammalian
+nonsmokers
+A 10% normal hamster brain homogenate
+Early identification of the disease
+hematophagous
+9.5%
+Seventeen point eight percent
+WM-115
+translational
+mononuclear
+LAIVs
+experimentally determined parameters
+technology to support rapid, high-volume, accurate annotation of genomes
+Pattern Recognition Receptors
+homeostatic genes
+come to work
+antibodies specific for cell surface antigens
+Predicting RNA secondary structures with pseudoknots
+Amersham ECL Prime Reagent
+1,294
+p40
+primer S 2865
+HSV-2 12
+clinical results generated by dPCR
+extensive purifying selection
+8 days
+HLA-B types
+comparison across HCW types
+temperature
+five
+Steric-blocking antisense oligonucleotides
+function on a per-cell basis decreases
+fluorescence-based thermal shift assay
+reduced accumulation of NP
+16.2%
+laboratory diagnostic tests
+Eight weeks
+mass spectrometry
+48 hr
+3%
+homology of viral and host genes
+RNA interference
+evidence of positive selection
+many weeks
+superoxide dismutase activity
+vital
+synergistic
+sialytransferases
+pulmonary surfactant
+rapidly succumb to sepsis or spontaneously recover
+a 5 sequence tract
+total population size
+Potential classes that were identified but not selected for detailed examination
+C-rich RNA motif
+internally developed clinical assays
+HBV sequences
+30-60 min
+17-26 %
+DTT
+a larger number of degenerated probes
+Thomas using lucinactant
+Coptis sp. and Berberis sp.
+SensiMix SYBR No-ROX One-Step Kit
+18-70
+virus-associated Gag
+100 nM
+enhance influenza A virus replication
+IL-10 and IL-15
+Contextualised detail about health-sector responses
+EXT
+potent
+performance of ecological niche models
+Nasal washes
+T cells
+any industry group or government organization
+GP 1,2
+acidosis
+≈5%
+Reed and Muench
+mimicry of short motifs
+Taiwan-CDC
+TEM
+BD Biosciences
+three
+Texcell
+amantadine
+Infected cells
+HiPerFect Transfection Reagent
+Appendix 1
+>90%
+hepatocytes
+to accommodate weak or strong inconsistencies
+23
+Immunity against EBOV GP
+DAPI
+immune stimulation and inflammation
+Professor Jiahuai Han and Dr. Jianfeng Wu
+InstantBlue
+attenuate the vascular permeability caused by viral infection
+apoptosis
+13
+20,000
+Protease activity
+Frameshifting
+A distribution with a larger variance
+six hours
+RAS1s
+viral miRNAs
+250:1
+weak
+men's susceptibility to disease
+Luciferase activities
+liver tumors
+hemagglutinin-neuraminidase gene
+Vaccination
+Carcinoembryonic antigen-related
+Pale-yellow
+2ʹ-OMe and PMO based ASOs
+three in vitro-transcribed full-length H9 HA gene RNA
+to determine the number of viable cells in cultures
+2009
+2.05
+Sequence complementary
+1 week
+The regulation of CSC self-renewal
+Founding Research Center for Emerging and Reemerging Infectious Diseases
+1%
+fluorescence
+E. coli ATCC 25922
+the longest estimated incubation time
+to minimize space
+The weighted distance matrix
+Fluvastatin
+allergenicity
+90%
+innate immunity
+resemblance
+Creb3L2/BBF2H7
+IL-10 and IL-28R
+1995
+phase-contrast
+FPS expression
+forcing the system out of the disease-free state
+Bid
+100 mm and 50 mm
+Far-UV
+Ticks
+AMPure XP system
+Organized lymphocytic foci
+48
+10 min
+1 hour
+Group IV
+SeV positive
+Propargylglycine co-treatment
+swine tracheal EVOC system
+,2-fold
+Ribavirin and 6-azauridine
+pentacyclic
+goblet cells
+1.15 hours
+Shewhart chart, CUSUM chart and EWMA chart
+Acute respiratory distress syndrome
+information about the peptides and the epitopes reactivity
+released into the blood stream
+Lanes 1 and 2
+Fisher's exact test
+nonredundant
+IFN signal transduction
+three
+D NA methylation
+1,234
+public health systems
+387
+27
+human immunodeficiency virus
+31.8%
+HBoVs
+neoplasms of lymphocytes and endothelial cells
+M pneumoniae reference strain FH
+to engineer mesenchymal stem cells
+clade 7
+Easy access
+mTreg lymphocytes
+conjugated them
+Q75FL0 and Q72PD2
+clinical scoring, temperature, and weight change
+frequency of EGFP + cells
+Se treatment
+junctional space
+17 AE 6 months after the estimated time of infection
+6 days
+Zoonoses
+Amino acid substitution of Tyr324Ile
+Intracellular
+three
+Crude correlations
+SGs
+The formation of the CypA:Cs complex
+5-fold
+Epidemic keratoconjunctivitis
+lower
+74.6%
+the corresponding standard derivation
+Chromatin
+LPM closure
+37.0%
+nucleocytoplasmic transport system
+immunoparalysis
+Bayesian
+poor pre-quake mental and physical health status and lower monthly wage
+The diameter of exposed bone
+Iowa
+Genetic selection
+The transmission of influenza infection
+the expression of DR5
+distinct patterns of dose dependence
+vaccine failure
+non-amplified whole genome extracted DNA
+infection outcomes
+ferret transmission model
+alphacoronavirus
+Influenza A virus H9N2
+Balb/c mice
+Cobalt protoporphyrin
+three
+no significant change
+posit ive
+LC3positive
+IFN-a species
+PSG1-FLAG
+antigenic variationevents
+GMCSF
+DNAeasy Tissue Kit
+30 nm
+20
+transcranial brain stimulation
+opportunities across sectors
+Porcine CCL25 high-expressed clone
+TPCK-treated trypsin
+Epithelial Adherens Junction Signaling
+seropositivity
+four
+antibiotic activity
+24
+Accu-Chek Performa System
+high-arousal positive affective states
+Two
+Nuclease-free water
+IFITM3 rs12252-C
+MAS
+E protein ectodomain
+large plaques
+side chain length and negative charge
+Intracellular trafficking
+Shared competencies
+42
+15
+one week
+~25 mg/kg
+potential therapeutic applications
+50 min
+Olympus FV10000 laser-scanning confocal microscope
+anti-inflammatory and associated complications
+naked HEV
+Additional file 4
+reports of retrospective diagnosis
+with LPS and/or IFNγ
+Greece and Turkey
+standard cultivation techniques
+The display mode
+Consistent predictions of CTL epitopes
+80%
+intact IFITM3
+25
+GenBank
+seven
+two
+Ceacam1-knockout
+less than one third
+phylogenetic implications and interpretations
+RUO
+72
+employee SWB and health
+endoplasmic reticulum
+codon:anticodon pairing
+Salmonella
+Identification and functional characterization of serine hydrolases
+AMV reverse transcriptase and random hexamers
+enhancing virus translation, RNA replication or playing a role in regulation between these processes
+Genome-wide purifying selection
+kinetic modelling
+ubiquitination and deubiquitination
+futile translocation
+TNF-α release
+4
+Enrichment analyses
+immunotherapeutic
+24 to 48 h postinfection
+10.1155/2018/2514901
+10%
+Quantity-One
+knock down rather than remove all DNA
+4-fold
+a relationship between two proteins
+glycosylated spike protein
+gluteal region
+Gram-positive
+RSV
+Sonidegib
+The whole signaling network
+Recovered viruses
+CD8 + T cells
+PO1
+possible risks/ harms as well as benefits
+low detectable viral load
+end-loop
+depletion of the BAC plasmid backbone containing the GFP expression cassette
+680 mm
+Atg5
+health gaps
+hydrophobic immune complexes
+stem cell-like characteristics
+proportional
+CXCL10
+any gaps in sphingolipid packing
+469
+a higher number of differentially expressed genes
+activation of Ire1's nuclease
+plateau pressure
+an intermediate and realistic level of sequence divergence
+more than a year
+means ± SEM
+300 dpi
+17,000
+HCV-specific T-cell immunity
+a new era
+general practice resilience
+substrate specificity
+2004
+IFNs
+IL-6
+greater than 2610 10 gc
+The estimator
+antigen-positive tumor cells
+NGI-1
+Communication with the pregnant women
+traumatic damage
+14.2%
+KP276585 to KP276611
+80%
+Toni Hoffmann
+cytoplasmic
+TNF␣-converting enzyme
+1,204
+taxane-induced cell death
+terminal branches
+synthesis and antiviral testing
+RPMI complete medium
+gp41 fusion intermediates
+52
+Membrane lipid oxidation
+p53 expression
+more than half
+Salmonella enterica and Helicobacter pylori
+patients presenting with severe fever and headache
+adapt to Vero cells
+wild-type homozygotes
+Stanford Shared FACS Facility
+quantitative real-time PCR analysis
+24%
+protein synthesis
+pneumococcal polysaccharide vaccination
+19
+Appendices B and C
+DNeasy Blood and Tissue kit
+Antibody fragments
+15
+wTNFα
+RVA
+direct antiviral activity
+CRISPR/Cas9
+2
+cell death
+presence of EBOV GP and VP40
+Innate antiviral immune defenses
+.95.9%
+complement binding
+20
+87%
+exposure to precipitation, soil moisture, and humidity
+>10
+to share new 'facts' and communicate advised control measures
+interstitial fibrosis
+EIA
+global translation attenuation and cellular stress conditions
+delirium
+Retail LBMs
+HRV infected primary human tracheobronchial epithelial cells
+3
+Individual study subjects
+antioxidant
+Gram-positive
+peptidoglycan recognition domains
+1.2 mL SPT TruTips
+economic, regulatory and practical
+SEN4030
+individuals who can infect a disproportionately large pool of susceptibles
+cross-presentation from these sites to APCs
+67%
+TBE
+the Cox regression model
+diterpenoid
+serological assays
+21
+overlapping ORFs
+10% fetal bovine serum
+4,710
+1.4
+25.49%
+stimulation of the interferon response to-and control of-RNA viruses
+DnaG
+Type I
+43 breaths per minute
+MS scans
+11,000, 12,110 and 16,940 cm −1
+women suffering from polycystic ovarian syndrome
+a vicious cycle
+Figure 3
+DI formation during passage in BHK cells
+Blood culture
+stimulation index
+diarrhea, abdominal pain, nausea, abnormal liver enzymes and decreased lymphocyte counts
+pathogen monitoring
+Ciliated cells
+RNA interference
+cure S. cerevisiae of the L-A virus
+misincorporation of A nucleotides
+quantitative temporal viromics
+Genes unchanged between test and control
+3500 Da to 2,000,000 Da
+assay
+TBK1
+distort its conformation or substantially rearrange the active site
+Ye Tian Shi
+reduced
+baseline
+Proteins
+3-4 months
+Minimal histological changes and inflammatory infiltrates
+dynamic problems
+nine
+RON tyrosine kinase
+two ER chaperones
+translational efficiency
+consensus sequence
+Mitochondria
+Austin Pets Alive!
+bank voles
+aberrantly used sites
+raw Ct values
+13 C NMR
+Sigma Genosys
+vascular remodeling, PAH, and atherosclerosis
+UDP-glc
+strong immunostimulatory activity
+stability of DNA
+clathrin and caveolae
+0.06% APS and 0.43% TEMED
+Synergy HT plate reader
+Multi-exon frame-shifting deletions
+viral replication
+thymic dysfunction
+monodispersed
+collecting blood for bacterial culture and sensitivity test
+62
+23
+viral
+increased fungal burden and pathogenesis
+Densitometry data
+EHPV1
+Milk
+CSC specificity
+impaired
+mice
+modulation of their physico-chemical properties
+At least three
+an acceptable representative
+50%
+treatments and cultures
+free amino groups
+76%, 71%, 75% and 37%
+ERAD tuning
+Influenza
+Protein concentration of cell extracts
+five
+a geographic link
+host transcripts
+Peak area of the SRM peaks
+93 million
+RTS,S
+lengthening the baseline period
+DNA from pathogens associated with respiratory syndromes
+cure or obviously remission of symptoms and signs of VKC
+20
+Plantago and Streptocarpus
+at the time of patient enrollment
+differential interference contrast
+AccSig results
+accuracy, precision, selectivity, sensitivity, and reproducibility
+10.3389/fmicb.2019.00050
+Fifteen
+companion animal owners
+Kruskal-Wallis test
+gene functional studies
+Real-time reverse transcriptional polymerase chain reaction reagent
+low MBL producers
+very active promotors of the field
+hepatitis E virus
+360 o every 10 bps
+Micro-computed tomography imaging
+80%
+SK2 mRNA or activity or S1P levels
+40-97%
+6.32
+samples sizes and prevision
+ferret
+Gag retention
+68-96%
+Short generation times and low reproduction number
+illumination time, illumination source and energy dose
+manual standard microbiological methods
+DCt method
+free-form text
+secretory IgA
+affinity enhancing effect
+11,308
+filamentous
+poor PM probe quality
+cancers and AIDS
+Thrombosis
+Coupling between translation and transcription
+protoberberines
+application of recombinant adeno-associated viruses
+1918 pandemic virus and recent H5N1 isolates
+October 2014
+mechanical unfolding experiments
+anti-ZIKV IgM
+PBS
+TCID 50
+Creative Comm ons Attribution 4.0 International License
+Stanford Large Network Dataset Collection
+massive accumulation of triglycerides and cholesterol
+67 nm
+autonomic nervous system
+60 minutes
+resting splenic NK cells
+Ceramonematina
+haemorrhagic disease
+Fiji software
+Plasmin and FXa
+CD4M9, G1 and 12p1
+100
+35.9%
+training and knowledge of psycho-traumatology
+88%
+PMN migration
+coinfecting variants
+10000
+three
+airborne infection
+E. coli strain Rosetta
+contact reduction and selective mixing
+necrosis
+The scale effect
+two silver NP populations appeared during the synthesis
+passive movement
+quantitative real-time PCR analysis
+social, political and ecological
+cerebral malaria
+global gene expression patterns
+PMA/ionomycin treatment
+eEF1A inhibitors
+37,400
+Rostock H7N1
+20%
+1426
+hepatitis C
+extra-pulmonary infectious diseases
+abrogate
+Rab GTPases
+Phylogenetics
+late 2002
+834
+Circular
+severe aggregation
+transmission among domestic poultry
+genomic
+SOF
+13.4 × 10 9 /L
+weeks
+Bootstrap methods
+safe technologies
+Rdisop, GenFormR and enviPat
+columnar rosette structures
+Natural HNP1
+if targets were up-or downregulated
+viruses with specific mutations on NP
+EPX-mAb
+increased surveillance
+progression of E. multilocularis infection
+aligned and conserved nucleotides
+most recent common ancestor
+retrograde transport
+no neutrophil infiltration
+Cytoplasmic Arg I and mitochondrial Arg II
+64%
+HMG CoA reductase
+developed countries
+Viral load
+linear, polynomial, and radial basis function
+Consistent differences due to probiotic feeding
+99.1%
+inflammatory cytokines, proteases and free radicals
+how things work at a systems level
+1 mm
+evaluation of the distribution of staining
+Standard curves
+Sepsis
+3 days
+an ancient bornavirus
+enhanced the antibody response in mice
+more than ten
+90.5% to 98.5%.
+mechanistic links between each scale and the next scale of organizational complexity
+mix of clinical services and patient case mix
+70%
+4
+Ang/Tie signalling
+the same school
+gel bottles
+to have the right
+MolProbity server
+0.63
+4
+undetectable
+cc-by
+nine
+1993
+recognition of the substrate-attached Ub chain
+accepting new packages
+Granulocytes
+Bayesian Skygrid coalescent model
+14%
+spectroscopic
+WHO
+receptor-destroying enzyme
+25%
+ImageXpress Micro XLS and MetaXpress PowerCore software
+77
+25 μM
+medicinal
+EDV
+ACE2
+Porosity
+SIB
+50 mins
+egfp-pbrB amplification
+bacteria to eukaryotic organelles
+5%
+H7 DNA and H7N9 MIV
+A short stimulation time
+generalized linear mixed models
+Cu 2
+CEACAM1
+Air sampling
+7
+HCC
+according to randomly assigned numbers
+55%
+protein regulation and abundance in the cell
+MaR1
+IE2
+RANBP2
+most of the affected Asian countries
+CHO-Neo
+2.54
+gastric
+to detect novel strains of influenza
+Mouse Diversity test A-array
+m 1 and m 2
+R 0
+eight
+T4 polynucleotide kinase
+Pneumovirinae
+96
+toxicity
+means ± standard deviation
+caspase-dependent pathway
+all putative mutation calls
+0.45
+1:2
+a non-fermenting Gram-negative bacillus
+meta-transcriptomic
+Peptides A and B
+one fifth
+capside protein encoding gene
+Celiac disease
+k-means clustering
+which duration, if applied to every edge, would produce the correct average probability
+RNAgraphdist
+months to years
+Graphpad Prism 5.03
+ensuring their own maintenance in nature
+LAMP test
+Ti
+Non-resolving ER stress-induced apoptosis
+hepatitis B virus
+One percent
+three
+Sequence data for P. cristatus
+slide labelling
+CEACAM1+
+simulated breathing frequency
+experimental data
+Protocols
+poor mucosal IgA antibody and T cell responses
+ethical
+1.6 M nBuLi in hexanes
+pathogenicity
+pathway analysis
+Sunnie Thompson
+using different cutoffs
+Tehran virus
+CRLs
+8-126
+synonymous codon usage bias
+TSP 1
+Eleven
+insufficient sample volume
+productively infected
+24,658,823
+transcriptional activity of BMP target genes
+T lymphocytes
+Complete inactivation of B. thuringiensis Al Hakam spores
+diisopropylfluorophosphate
+three
+10 to 50%
+SAMtools
+culture-specific supernatural thinking
+ventilation-free days
+interest and skill
+polio
+different cellular compartments
+host-mediated inactivation of viral RNAs
+IURs
+nutrient acquisition
+60 ∘ C extension step
+Candida albicans
+BTV-8 or Great Island virus
+GAPDH
+three weeks
+Combination therapies coupling with antiviral and immunomodulatory drugs
+hydrophobic stretch
+enteral nutrition
+hNPCs support H5N1 influenza virus replication
+five
+50%
+Carbamidomethyl cysteine
+11 months
+protein translation time lag
+Supernates
+dengue, hanta-virus and acute hepatitis
+20%
+five
+bleomycin-induced mortality
+5 days
+at the level of transcription
+temperatures
+options
+inter-individual variations
+Biomarker discovery
+broad-spectrum property
+1 h, 1 frame/min
+hairpin derivative
+shorter
+NCBI Reference Sequences database
+three
+Total effect rate
+Molbio
+better control and elimination of HBV infection
+cpe and PCR
+experimental
+ultracentrifugation
+winter resource shortage
+variation in C t values
+Primary antibody omission
+Disease occurrence data
+assessment and management of mental disorders
+CpG
+inhibits ubiquitination
+technical
+A manometer
+serum
+CD11b + myeloid cells
+allergic
+nonsurgical dental procedures
+ER-to-Golgi transport
+β
+phosphorodiamidate morpholino oligonucleotide
+direction
+amino acid sequence variations
+four
+genes involved in development
+natural caves
+IL-10 knock-out mice
+conventional monoclonal antibodies
+flow cytometry
+supplementary material
+PTB risk
+Queensland Institute of Medical Research Human Research Ethics Committee
+5 × 10 9 CFU/ml
+twice per day
+Sigma-Aldrich
+Horizontal transmission
+metabarcoding
+ten
+fever, lymphadenopathy and worsening respiratory symptoms
+Benjamini-Hochberg false discovery rate
+a series of infected events
+RNA and DNA
+SigmaPlot
+34%
+42%
+both local and global features
+blood
+puzzling
+treatment, severity and relapse
+Images
+Four
+fully stained cells from mice vaccinated with AdHu5-empty
+two primer pairs
+North America, France and Japan
+Macrocyclic peptides
+large droplets
+ZR Viral RNA ™ Kit
+21
+A variable
+isothermal amplification of targeted DNA
+180
+3918.34
+wt equilibrium
+PV-as well as HRV-infected cells
+Saksena et al.
+NAP-5
+inability to identify the cell type responsible for the change in gene expression
+TMS
+20%-30%
+placental
+procoagulant environment
+neutrophils
+hepatitis B or C
+epithelial cells
+early diagnosis and proper management
+siNC
+unactivated
+mean air pressure and mean vapor pressure
+Mascot Generic files
+specific B cell inhibition or a generalized state of immunosuppression
+HSPG
+Everybody
+a sample-based accumulation curve
+Sabin poliovirus type 1
+TYMP
+every 3 days
+100%
+2006
+averages of real data over 2003-2006
+ACE-1
+cleavage site sequence
+Easily cleanable receptacles
+20%
+Ca 2+ -mediated CaMKKβ and cellular energy
+hemacytometer
+health workers
+TIBV
+artifacts
+drug users and sex workers
+Additional studies
+high sensitivity
+98.1% to 99.6%
+nonadjuvanted or traditionally adjuvanted antigen
+inherent simplicity
+construction of an indoor contact network
+stabilizing
+blocked autophagy
+standard system development
+Semi-quantitative
+11
+hTERT
+N-terminus
+regulations/legislations
+Shaanvirus
+insufficient data
+8 hours
+data previously reported by several studies
+non-specifically recognizes DNA in the cytosol
+cathespin G
+eleven
+Wilcoxon rank sum test
+endocytosis
+Clade c
+neither control PP nor Idea-PP were toxic to host cells
+higenamine
+SJL mice
+Two
+attitudes
+decreasing kernel function of the distance
+Astrovirus-like contigs
+physical forms or non-physical forms
+0.017
+complete coding sequences
+two
+Google Flu Trends
+post-attachment neutralization assay
+synthetic hydrocarbons or higher-chain alcohols with high energy content
+Highly sensitive
+20
+P n
+confounding factors
+Enteric HAdV-F40 and F41
+Ten
+The catalytic cysteine
+Bacterial systems
+B cell clone
+ACE2
+two
+Alexander Fleming
+DVGs
+PF-S stem cells
+H3-WT TM-dependent
+4-fold
+756
+patients' arrival/discharge and outbreak detection and declaration
+4 hours
+R 0
+long-term control issues
+runny nose, sore throat and cough
+geographic, demographic, and psychological
+larger
+qPCR
+country of origin
+protein engineering and directed protein evolution
+26%
+an introduction and background to the classification project
+16942
+ECGs
+Europe, Africa, and the Americas
+observed
+1:40,960
+goat anti-pig IgA
+host-synthesized nutrients
+Branches
+Clustal alignments
+the MoA of compounds
+The basic reproduction ratio
+chimpanzees
+nasopharyngeal swabs
+Pressure ulcers
+high-dose corticosteroids
+Highresolution
+three
+Na + /K + ATPase
+patients that had more potent responses
+biotic
+Mann-Whitney U-test
+Cell viability
+Virulence
+1967
+1U6R
+Graph Pad Prism 5
+acidosis
+poor tumour differentiation and tumour embolus of portal vein
+flexible
+CD8 + T cells
+unstable
+Gasteiger-Marsili charges
+ERK5
+mice
+30 days of age
+Long-lasting, age-specific antigenic imprinting
+Nonspecific human IgG1 R347
+71
+hematoxylin and eosin
+Real-time quantitative PCR
+modern electronic devices
+fine-tuned
+post-operative hospital stay
+dysregulation
+2.0 ns
+Entomological
+total disagreement between prediction and observation
+Serum IL-10
+Peptide stocks
+20%
+producing DHF
+propargylamine
+IFN-γ
+ion mobility spectrometry
+10 min
+eIF2 GTP
+age and immune
+Urumqi City and in Yining City of Xinjiang Province
+hyperglycaemic hormone
+biological
+IL-8
+fold change from pre-vaccination
+neurodegenerative
+AdV DNA
+host-pathogen interactions
+B cells
+Fifteen
+Holm-Sidak procedure
+1.6 to 1
+IFNb-YFP reporter mice
+The number of contacts
+55%
+multidisciplinary
+Infectious diseases
+B cells
+preventing or delaying the development of diabetic renal disease
+100%
+95%
+brightfield
+The load generated when the wearer moves
+immunoglobulin genes
+ammonium buffer
+C:U mis
+Uninfected Mus dunni cells
+post exposure prophylaxis
+lung host defense
+2,000
+severe malaria
+Image-Pro ® Plus
+viral entry or replication steps
+7905
+X4%
+complete protection against HK68 heterosubtypic virus
+four
+cytokine dysregulation
+Fructus mume extract
+Erp72, ERGIC-53 and Golgin-97
+viral pneumonia
+10,000
+diffuse bilateral peri-hilar infiltrates
+1:1
+LBM environments
+inflammatory cell trafficking
+Th1-or Th17-type
+lfadherence
+mutations
+H5N1
+Total RNA
+4
+95%
+Five-hundred sixtyseven
+BD Biosciences
+8,870 to 18,300
+26 Å
+numerical titers
+head-tail junctions
+an incorrect strain
+more aggressive recurrence of PBC
+less than ½ inch across
+Disease dynamics
+axonal regeneration
+scanning electron microscopy
+,60-90%
+HBoV1-4
+24 µm
+immune response tests
+KLY-B
+increases the pH
+symptoms and signs linked to immunosuppression
+SSP myristoylation
+mouse and human full-length ORFs
+40
+ClusterPicker software
+native gel mobility shift assays
+5-10%
+proliferation, differentiation and survival of monocyte lineage cells
+fall of 2009
+medicine
+18,449
+essential travel
+good
+every 0.010 ps
+>75%
+rRNA
+trial case record forms
+one hour
+physiological processes
+AO length and target sequence
+fourth-order clades
+Gblocks 0.91b
+envelope glycoproteins
+viral antigens
+viral antigen and antibody levels
+inflammation, excessive secretion of respiratory mucus and pulmonary fibrosis
+21
+Two-tailed t test and ANOVA
+regulatory T cells
+human or animal derived substances
+One hundred and twenty-eight
+dynamic exclusion setting duration of 30 s
+GV
+molecular docking methodology using GOLD 5.0.1 program
+The Bonferroni method
+DCs
+225 ng
+black lines
+prematurity, low birth weight, birth trauma and asphyxia
+trimers, dodecamers and higher-order multimers
+EDTA-coated tubes
+250 μL of each solution
+Alissa Weaver
+Viability
+data-adaptive
+porcine aminopeptidase N
+Tf localisation
+p53 mRNA levels
+anti-adhesion
+13%
+lipid rafts of the plasma membrane
+0.49 μm
+an estimate of the severity of seasonal influenza epidemics
+HRP-conjugated secondary antibody
+FHV-1 nucleic acid
+allocating the existing resources and identifying new sources of investment
+Simulation study 2
+chronic obstructive pulmonary disease
+Information on delay of presentation and reason of travel
+65.6 ± 12.08
+five 85
+AEII cells
+heart rate variability
+pulmonary
+pET GST-Rluc-1
+Inhibition of Hsp90 activity
+>25%
+4.661 nM
+Valovirus
+Levi-Montalcini
+BALB/c and C57BL/6
+24
+bla NDM
+neurological toxicity
+The DermaVir Patch
+2.7-3.9
+5 0 -3 0 RNA ligase mechanisms
+Harbin
+Cy3-conjugated donkey anti-goat secondary antibody
+Nelson and Worobey
+viral life cycle
+senescence
+focus formation assay
+blood flow redistribution and an increased oxygen extraction ratio
+aquaporin 5 protein
+insect cells
+foodborne viruses
+reducing the incidence of disease by preventing its occurrence
+aerosol
+Chebolu and Daniell
+Mammalian IFITMs
+Mandarin
+Thirty-nine
+interferon-α
+eukaryotic pathogens
+protein
+mean ± s.e.m. P value
+A protein thus formulated can contain its most complete information
+duck RIG-I
+densitometry
+UCSC genome browser
+50 to 100 million
+NDV and AIV
+RT-PCR
+more uniform crops
+126 μm/s 2
+HBZ mRNA
+Student's t test
+specific causes of deaths
+frameshifting
+ZC3H4
+a more moderate initial culling intervention
+3AE0 days
+higher reliability of the luciferase signal
+extreme low coverage variants
+further study
+mitigation of epidemics
+increased tissue permeation and accessibility to the myocytes
+each candidate protein target
+Time of addition experiments
+NOESY
+the square brackets
+TEV protease
+propidium iodide
+GraphPad Prism 5.0
+12%
+four
+alveolar macrophages
+severe pathological injury or even death
+doctors
+TER levels
+icosaedral symmetry
+three
+micro-RNA Enrichment Analysis and Annotation with Over Representation Analysis
+Yca1 and Aif1
+inflammatory
+5 out of 10
+0.4 mL/min
+4-HNE
+RIG-I and melanoma differentiationassociated gene 5 product
+36.4%
+House Brackmann grade
+Bonferroni correction
+1 mg of HEK293 cell lysate
+five
+Adenovirus vectors
+cementation and even recrystallization
+cytoplasmic acetylated-lysine
+NL4-3
+45 min
+recombinant NP protein
+10%
+Viral quasispecies
+Prosearch
+mobilization of hematopoietic stem cells
+administration
+88%
+SV40, the growth hormone gene, and the b -globin gene
+HER2/ neu
+severe hepatocellular necrosis
+Twenty
+Complementary
+professional self-control
+100% of the signal
+a plasmid encoding the T7 RNA polymerase
+North-south
+2 h
+smaller
+384-well white plates
+Dulbecco's Modified Eagle's Medium
+Viral RNA
+4.948 Â10 À 3 sub/site/year
+2000
+5%
+institutional review board
+1 h
+two days
+94%
+unmanned aerial vehicles
+CD133 expression, ALDH activity, and chemoresistance assays
+Average Number of Students per Teacher
+SPOT CHEM SP-4420
+TranslatorX
+Primary
+Every effort
+obligate
+IFNγ
+20 min
+#VitalSigns
+mortality
+1.62 × 10 −6
+5%
+novel virus host factors
+adenoviral vectors
+4668
+two
+64-85 mmHg
+directly restoring the CFTR function
+Eight
+BMV RNA replication
+2015 and early 2016
+E1E2
+Positive end-expiratory pressure
+UV irradiation
+Zhejiang University Experimental Animal Ethics Committee
+866
+Probes targeting DUBs based on monoubiquitin
+consensus score accuracy
+Enzyme-linked immunosorbent assay
+10 mM of dithiothreitol
+GASBOR
+pressures
+73,33 %
+5%
+36%
+novel
+novel
+16%
+screen each specimen for a suite of microbial agents
+738
+65
+ILCs
+90%
+level of conservation
+five
+daily ring vaccination/case tracking capacity
+Auto Dock Tools soft
+Haloperidol and quetiapine
+WNV titers
+IgG
+immunological
+100 µL of the anti his-tag monoclonal antibody
+encapsulation and surface location of the Ag
+33.4 ± 16.6
+translation
+10
+Filter-binding experiments
+stimulation
+thymic stromal lymphopoietin
+τ
+fitness
+nine
+H3N8 subtype viruses
+WT, PC55, and PC48
+MAIT cells
+Cell free culture supernatant
+mixed response
+maximax
+schools
+496
+ColorPhylo
+Dera Ghazi Khan and Qalyub orthonairovirus
+long-term complications and subsequent disabilities
+rAd5 boost regimen
+heparin
+2001
+VAChT
+AKT activation after insulin treatment
+Microscopic
+18 years old or younger
+male
+6
+1.5 times higher
+61
+annexin A2
+1,447
+IAR
+19
+retention time, m/z, and intensity
+net positive charge
+RNA Integrity Number
+Primary HHV-6 infection
+NF-kB-dependent production of inflammatory cytokines
+PA T97I
+natural selection
+to be realistic regarding what a particular model is measuring
+every 5-7 days
+5xSDS-loading buffer
+RT-qPCR
+Variant or drifted viral strains
+Student's t-test
+2.13 log
+ROS-related DNA oxidation
+high-temperature, short-time method
+dendritic cell migration
+Twenty
+higher expression of p-c-Met
+interactions between natural selection and mutation pressure
+DAMMIN 54
+maximal signal
+30%
+antibiotics
+Diletta Valentini
+eIF2 and eIF4E
+specific activity
+their assembly
+six
+repetitive DNA and extensive non-coding regions
+Blood samples
+A/H7N9
+NF-kB
+suck hard candy, chew gum, or use repeat mouthwashes
+Spatial maps
+Qiagen One Step RT-PCR Kit
+Demographic and clinical data
+NNM or MNN
+PBL
+Primers
+hexadecyl
+arrhythmia
+Organisational
+relative fluorescent units
+13.8 and 1,042
+Day 0
+1016
+stable
+Cholera
+less than 12 hours
+WHO
+SeV LD RNA
+anti-HCV replicon activity
+American Type and Culture Collection
+75%
+8 hours
+pharmacologic agonism
+55-70%
+crystals from both the surface and deeper within the polymer phase
+Pfs48/45 protein
+NP
+SPSS 11.5
+NPC1 binding
+11.0%
+the average over all households sizes
+length
+Bone morphogenetic protein
+less risk of potential off-target side effects
+mice
+Semiquantitative scoring
+4
+totarol
+Translation blocking
+ITGB1
+Influenza B virus
+minimal variation between runs and far less variation
+RVFV Gn and Gc coding sequence
+MassARRAY MALDI-TOF System
+kaempferol
+origin-destination matrices
+15
+two key assumptions
+1 μg/ml doxycycline
+Sangon
+neutralization titer
+Two
+95%
+Clodronate -loaded liposomes
+Two
+42%
+published gene datasets containing corresponding patient survival data
+US$87.0 per patient
+immunomodulatory therapies
+69%
+Study weights
+Calcium ions
+NS1
+adaptive immunity to the vaccine antigen
+K11-and K33-linked polyUb preferentially
+phenylpropanoids and diterpenes
+49
+gB, gD or gH
+instruments
+hantavirus replication
+Rluc expression
+Genes inducing either a significant decrease or increase in RSPs production
+Fifteen percent
+HIV Pr/RT and Influenza H/N
+17.65%
+host-virus interaction and response to wounding
+detailed
+gating control
+Almost 25 %
+thrombo-inflammatory
+temporal or spatial
+1.0 mM
+CCR5
+90-95%
+DB s D
+expression of β2 integrins
+DAB-positive
+EPIFIL
+10 weeks
+West Nile virus
+Common contaminants
+7 -194-fold
+variability in species composition
+heavy metal ion tags
+15 min
+Th17 cell differentiation
+TMHMM version 2.0 server
+LC3-II
+inhibited TNF secretion
+RNAlater
+N7
+30 minutes
+TNF-α
+precast linear IPG strips
+secondary and exploratory
+Guidelines
+raw counts across samples
+10% to 15%
+3 μg total RNA per sample
+ImageJ/FIJI
+microcomputer-imaging
+Serum
+acidified, NPC1-positive
+1%
+Q s,t
+An audit
+Those entrusted with governance roles
+Protease B
+> 95%
+Sivelestat sodium
+those that are being treated
+IMOD
+ALS
+HEV infections
+qPCR data
+at the cytoplasm
+patients with very high MELD scores
+A galactose and GlcNAc residue
+siPTB-treatment for 72 h
+supernatants
+Commensal microbiota and myelin autoantigen
+IFAT
+five
+Two
+cancelling public gatherings
+a suitable cysteine in close membrane proximity
+once daily
+Chimeric antigen receptor
+servo-controlled centrifugal pump
+functional and non-functional
+self-splicing
+viral pathogenesis
+two groups
+antiviral
+PV-T362I
+Illumina HiSeq2500
+A549 and Calu-3
+peripheral T cells
+pmacs
+standard infectious particles
+ELISPOT assay
+127
+vehicle group
+Autophagy
+aa position 14
+1990s
+Genetic drift
+reductions in splenic or bone marrow macrophages
+4 mg/ml
+three
+growth phase
+deficiencies in desmosome processes
+14
+Control and STNx rats
+70%
+A response with such a large jump
+provides up-to-date information about viral biology
+incomplete sequencing
+11 cm
+SDS polyacrylamide gels
+hexon and penton base proteins
+HCV-infected
+Table 2
+Antibiotic therapy
+acute damage
+chemical and bioactive
+red
+10-15%
+The activity of known ISGs
+whooping cough
+winter
+detection of antibodies against different viruses
+100%
+0.8%
+77
+83.9%
+62.0%
+mol2db2
+farm-level sheep population numbers
+17.5824
+yellow
+likelihood ratio test
+window-type
+CD4+ T cells and monocytes
+Sepsis and multiple organ dysfunction
+311
+clinical guidelines
+Total RNA
+Intron-retaining transcripts
+fewer than half
+viral load
+Mann-Whitney U-test
+pgsA-expressing vector
+Plaque morphology
+JH6 gene family
+protein disulfide isomerase
+Hantaan virus infections
+mutation bias
+Many elements of uncertainty
+180 days
+TempEst
+density gradient centrifugation
+396
+1x MEM non-essential amino acids
+flat pre-GCs
+E-test and in-house PCR
+LA County Jail
+efficient
+inflammatory responses
+planning and evaluation
+3-fold
+48 h
+electrophoretic mobility
+Hurricane Ike
+every 2-3 days
+Termination-reinitiation
+assumptions
+systematic
+increased AMPK activity
+IFN-γ
+erythromycin
+25
+directs the fusion protein to the inner membrane of the mitochondria
+five
+H1N1 Viruses
+MFS-type transporter
+dust
+spread
+Fresh frozen and formalin-fixed tissues
+The contribution of randomness
+CD8+ T cells
+over-expression of the bak gene
+mutation site features
+performing such analysis with the best available evidence
+2014-2015
+A/H1N1
+The level of significance for asymmetry
+10%
+H1N1, H3N2, and H7N8
+receptor functions
+Glutamic acid
+immune model
+30 minutes
+32
+lyse
+Bayesian MCMC
+concrete suggestions for the national level
+B. burgdorferi
+malaria and tuberculosis
+the probability of observing the same or higher enrichment purely by chance
+cis-cleavage activity
+Ontology development software
+7a
+two linked Ub modules
+Enhanced BMV RNA replication
+Q7R and NAC
+max pooling
+cells treated with vehicle control
+individual-based models
+precursor cells in fetal liver
+polymerase chain reaction
+significantly decreased injury scores
+pattern recognition receptors
+red
+Hospital de Clínicas, Montevideo, Uruguay
+several hours
+Eleven
+ten
+16 h post-treatment
+a value v
+5 days
+Pfu polymerase
+USD 250.00
+lack of practical and affordable animal models
+G-C
+amines and amides
+more than a third
+macrophages
+GitHub
+Agilent Feature Extractor software
+0.2264, 22.022 and 0.4647
+PCR
+30 min
+signal transduction mediated by AFPR
+TLR4 signaling
+crystals of polyhedra
+MI
+standby
+50 million
+Western blot and immunofluorescence assays
+ImageJ
+5 to 3
+ACK lysis buffer
+All masked bases
+a progress note
+19
+twice
+twelve years
+diagnosing and monitoring of pulmonary diseases
+epidemiological data
+Bacteroidetes
+substantial
+immunodepression
+cc-by
+43
+A stock solution
+western blot
+logistic and Cox proportional hazards models
+The secondary entry receptor complex
+host immunogenetic variation
+12 kDa
+sixteen
+once every 3 d
+identification of possible pathway imbalances and eventually new therapeutic targets
+OCT
+inadequate
+MSA
+nuclear, granule and cytosolic proteins
+MHC-II peptides
+stent length, diameter and position with respect to the vertebrae
+Random jitter
+ViDiT-CACTUS virus discovery method
+50 g/ml BNeV VLPs
+Borrelia burgdorferi
+congestive heart failure
+nocturnal habits
+30% to 56%
+resistance to HIV progression
+serine monophosphorylated STAT1
+Language preference
+cave roofs and walls
+22%
+15 %
+five-year
+binding medium
+15%
+nine volumes of cold dilution buffer
+calibrators
+B
+immunocompetent
+India
+Biological Pathway Exchange
+> 70%
+1 hour
+14
+60-75%
+Mallard ducks
+rejection from PVAN
+105
+RIG-I/MDA5-dependent type I IFN signaling
+cytotoxic
+genetic and environmental
+K44 and K48
+tRNA-like
+75%
+drug sales data analysis
+sub-exponential growth models
+Total PEEP
+250 nm -650 nm
+did not change the levels of phosphorylated ERK1,2
+length K of the oligopeptides or oligonucleotides
+differential growth kinetics of wt versus HA mutant viruses
+63.40±3. 36
+Trinity assemble program
+Ebola
+16
+existing
+pragmatic selection of truly problematic assay plates
+severe disruption of the normal morphology of the microtubule cytoskeleton
+4,370,000 copies/ml
+caseinolytic protease
+CI
+>97%
+The required duration of a recurrence prophylaxis
+serine/threonine kinase p90Rsk
+gp41
+Cytological and biochemical
+12
+Ebolaviruses
+57
+statistical
+P63 and KRT5
+a hairpin structure and an aromatic T-stacking
+23%
+627 and 701
+polymorphisms
+Idea-PPs
+FIgM proteins
+the remaining genotypes
+statistical methods
+Myeloperoxidase
+more education
+6 ml of culture medium
+over one million
+bacteria from the nasopharynx samples
+0 to 36%
+high incidence of infection
+N protein
+variations in trapping catch rate
+1983
+RNase independent
+original research articles and case reports/case series
+L protein
+1.5 hour
+Formation of large syncytia
+2-3 days
+DNA templates
+metagenome scaffolds
+IL-1β production
+late endosomes and lysosomes
+37.5%
+Sigma-Aldrich
+mucosal effector cells
+27 February 2020
+26
+chemotherapy
+expansion segment 31
+decades of war, extreme violence, and deep oppression
+unambiguous
+cells
+lactose
+Biacore T200 Evaluation Software
+Breast cancer
+66
+dengue fever
+56 days
+traditional serological assays
+very fast or very slow
+The ISM
+containment strategies are not always accommodated within a single model
+pregnancyspecific antigens
+Responses
+mechanical ventilationassociated detrimental effects
+GP5 protein
+daily weather conditions
+88%
+38%
+eight
+Vector-specific antibodies
+Romosozumab
+Complementarity between numbered OSD domains
+Gram-negative bacterium
+neovessels
+human bronchial epithelial cell line
+2013-08-05
+1%
+five
+immune activation
+3 days
+real-time PCR
+curated
+cytoskeletal architecture
+more than five thousand
+Data derived from unfolding curves
+Influenza and respiratory syncytial virus
+DDX19
+HEK-293T cells
+RNeasy Plus Kit
+2 3 ¼ 8
+49
+4 h
+RT-PCR
+fairly good efficacy and acceptable tolerability
+$20 mM
+2015
+29
+G6PD deficiency
+an RNAdependent RNA polymerase
+58 kd
+negative correlation
+biological toolbox
+H-7650 transmission electron microscope
+1 mg/kg BW/ day
+antidopaminergic antipsychotic
+the Abstract
+Synonymous codons composition of a coding sequence
+absolute data counts
+H5 ectodomain-coding sequence
+EP-assisted intramuscular pDNA delivery protocols
+processes
+49% to 66%
+maturation signals
+Sigma Aldrich
+82%
+48-60%
+5.04%
+H1N1-infected MDCK cells
+patients who died within 21 days
+genetic regulation of embryonic myogenesis
+mortality
+e-week 31
+RT-qPCR
+350
+lineage-specific expansion
+59
+FLEXMAP3D
+various virus strains
+preserving its conserved epitope
+to identify potential protective antibodies induced with BCG
+coercive public health measures
+Kruskal-Wallis test
+jainScore
+GII.4 NoVs
+ARI
+a micro-stirrer
+non-matching residues
+Spearman correlation-of-rank coefficient
+T cell responses and virus control
+shuttling this complex to the HIV promoter and guide HIV transcription
+Nikon eclipse T300
+3
+345bp
+fusion protein expression
+hepatic lipid accumulation
+Oct-4 hyperexpression
+18
+immuno-compromised patients from the industrialized nations
+IL-6-induced CRP production
+80%
+indirect immunofluorescence
+Lima, Peru
+Golgi retention factor
+cc-by
+primer/adaptor
+influenza infection
+HCMV
+T s
++1 and −1 PRFs
+30 min
+electronic triggers
+85%
+viral replication
+specificity
+mathematical models
+Serum-free MEM-α medium
+seasonal festivals
+p33, p13, and p18
+digital high-speed videomicroscopy
+2,084 to 2,645
+AP and TM
+Re-5, Re-6, and Re-9
+below detection
+21
+2 to 79 days
+Confocal
+38%
+39%
+Vasoconstriction
+inflammatory
+reliable alignments
+necrosis of hepatocytes
+symmetrical
+influenza virus glycoproteins
+$15,516
+Guillain-Barré syndrome
+sequence data
+ICU mortality
+increasing amounts of pathogen metadata with higher resolution
+information about the underlying physical mechanisms that connect the signaling proteins to transcription factors
+Chen, Pei-Jer; Wu, T-C
+3 days longer
+internal consistency, split-half reliability, and test-retest reliability
+56 • C
+foamy
+24
+HMPV genome sequence data from Africa
+publication bias
+16
+infectious supernatant medium
+to avoid any induction of IFN-ab by the plasmid itself
+airway obstructive disease
+canarypox vector
+Background Medulloblastoma
+induced cell death
+imperfect sample purification
+MPO
+nucleotide composition analysis
+viral infection
+pseudo-mass
+ACBD3
+5 min
+Italy
+3 hour
+similar
+100
+2007
+positive natural selection
+386
+Big Sioux River Virus
+the possible mechanism of the improved anticancer effect
+when new infections are generated at the same rate at which infections are lost
+four
+fibrinolysis
+rhesus monkeys
+product quality, reduced antibiotic treatment, improved consumer protection and increased animal welfare
+airway epithelial cell
+monitoring the host's immune-response to infection
+Forward selection
+severely impaired F-actin polymerization
+ASGPR
+À1:5 kcal/mol
+mobile
+8%
+two
+IFN-γ
+nasal washes
+damage upon muscle contraction
+Virus
+disease severity
+cathepsin double knock-out cells
+four
+viral replication
+major histocompatibility complex encoded genes
+areas where Neu5Ac was added
+repeated chemoreflex stimulation of the sympathetic nervous system
+Forty one
+Non-receptive cells
+cytosolic oligomeric protein complexes
+natural regeneration and reforestation efforts
+three
+T cell treatment with SOCS3-siRNA
+direct
+x-ray
+347
+A3021-01
+long double-stranded precursor molecules
+120
+Eighteen
+Diagnosis and Treatment Program
+APMV-1
+Endogenous peroxidase
+human serum albumin
+Blood samples
+miR-30
+local convex hulls
+respiratory conditions
+curcumin
+clinical obesity
+FluoroTag TM FITC Conjugation Kit
+39.68 weeks
+Reed and Meunch method
+specific cell-mediated immune responses
+tuberculosis and Herpes B virus
+human
+the product of frequency and efficacy of the cleaning event
+Total RNA
+induction of increased TLR2 surface expression in lung endothelial cells
+nutrient starvation or pathogen invasions
+activation of SOCS3
+Reverse phase liquid chromatography
+species borders
+stimulation of the assembly of the viral replicase complex
+16.7 %
+Ad-induced IFN-ab
+85%
+92%
+color" or dual-reporter viruses
+1 hr
+sepsis
+cytotoxic T-lymphocyte antigen 4 inhibitors
+viGEN
+population size
+further details on passengers, frequency or duration of car use
+2010
+2-3 weeks
+discrete convolution function
+14%
+10 kilobases
+uridines
+Electrospray ionisation
+Thirteen
+metabolome
+zDOCK
+FlowJo
+preferences, tastes, obligations, information, habits and financial circumstances
+strand transfer
+increased pathogen prevalence and virulence
+69% lower
+murine antibodies
+HA and NA pairs that had not co-evolved
+Advancement in development and standardization of various kinds of PCR techniques
+increased rates of hospitalization or fatality
+turboRFP and Gaussia luciferase
+43%
+1 day
+age, sex, BMI and disease duration
+N160 glycan
+twothirds
+treatment with high-dose ribavirin
+glutathione and iron chelators
+Ethyl -epoxy-4-oxo-butanoate
+viral adaptation
+11
+UVA
+fulllength native protein
+three
+Picobirnavirus and HAdV-C
+how the virus moves
+Tight junctions
+epidemic
+UMR-CNRS 5558
+Relative gene expression
+80.8%
+22Á6%
+14
+n=3
+Asia
+N63Y mutant CVB3
+an infectious period
+deceased
+Oxidative stress
+45 min
+Cross-cultural data
+Ubiquitination
+GraphPad Prism 6
+indirect interactions
+rabiesspecific
+26G needles
+acute infection
+four
+its structure and its sequence
+Mast cells
+anywhere in the 5'-UTR through the start of the coding region
+technical and organizational
+45 min
+10%
+8%
+10 lg/ml
+SCV
+second
+similar growth kinetics
+T m À1
+cellular PAR levels
+predictive modelling
+77.5%
+higher
+triplicate
+anti-CD4 and antimyeloperoxidase antibodies
+no conflicts of interest
+UV-cross-linking
+2610 6
+biological tools
+6.8%
+macrophage SFM medium
+12-18 months
+12%
+no one evaluation was significantly different from that of the others
+plasmon-enhanced fluorescence
+illness
+65
+Lymphocytes in peripheral blood, spleen, and head kidney
+complex
+national or international performance standards and manu facturer's instructions
+master switch
+KSOS and HYA
+391
+Synthetic lethality
+0.044%
+40 and 60%
+enhanced Pr55 gag cleavage efficiency
+The expression of unigenes
+PPARα, PPARγ, and PPARδ
+Anthony Sadler, Hudson Institute of Medical Research
+deleted residues
+secondary Ab Alexa Fluor 594 goat anti-rat IgG
+Sequential Organ Failure Assessment score 19
+A single Zn 2+
+0.1%
+35980 out of 43010 RPIs
+data about zoonotic and emerging pathogens
+one
+thousands of years
+59-UTR
+endocytosis
+4/10
+discontinuous
+Data mining
+C
+the value of λ
+1573
+Molecular recognition features
+T cells
+5-95%
+Digital array
+SP cells
+uninfected
+High Pure Viral RNA Kit
+IL-2
+74.4%
+three
+Alveolar
+20 ppm precursor ion tolerance
+viral persistence
+HAE and in vivo
+MicroPoly Purist Kit
+54%
+the NTD's origins
+Herpesviridae
+chemical properties of individual amino acid
+Alveolar macrophages
+968
+Digital PCR
+Asterisks
+monoclonal
+B6 mice
+17
+basal constitutive activity
+cheetahs
+conserved regions of important antigens
+the diagnostic odds ratio
+Advance catheter
+17
+control or I.M. immunized mice
+vehicle treatment
+Cigarette smoking
+1/ times units
+Children less than 5 years of age
+MD90 and MD91
+expectations of recovery from influenza
+respiratory syncytial virus
+$3.5%
+5
+one-way
+T cells
+tight
+International reference standards and proficiency panels
+LoxP-fl anked stuffer DNA sequences
+oxidative and inflammatory damages
+pathogen
+6
+activated protein C
+CP ST11
+the HP
+Astacin
+immune evasion
+ADAM 10
+mass spectrometry instrumentation
+amino acid residue position
+drug addiction
+job demands
+three
+Lymphadenopathy
+Temporal
+Other types
+IAPV
+at the significant internal nodes
+Inflammatory responses
+L, M and S
+tRNA maturation
+less than 10 days
+0.99 Å
+human cells
+fine-scale pathogen identification and near-neighbor discrimination
+3.6
+gamma, Weibull and log-normal distributions
+inhibits the expression of Blimp-1
+the intensity of a negative control protein
+Conserved cysteines and aromatic residues
+four
+ELISA
+CIH
+Real-time US
+10
+A
+presenting epitopes to be recognized by the host immune system
+The column #
+C ik
+Ghana
+two
+mAb
+proinflammatory
+Tenericutes and Bacteroidetes
+24 hr
+E. siliculosus
+four
+zebrafish
+human ISG15-AMC activity
+suitability of homology modeling and docking studies
+PCR/ESI-MS
+zoster vaccine
+two-sample t test
+helical
+1.3 million
+regulators of adaptive immune cells
+six
+Cabb-S and Mark-S
+Six
+Public health
+Goat anti-rabbit 488
+15 kb
+acetylated testosterone glucoside
+blood flow
+postgraduate training for physicians from Lao PDR and China
+strain 17+
+Transfer of genetic information from mRNA into proteins
+increased influenza vaccine coverage
+eight
+Diprotodontia and Primates
+support those who are burdened by complying with restrictive measures
+tissue factor -TF pathway inhibitor imbalance
+IFN-a/b signaling pathway
+March 2012 and April 2014
+forecasts that can be hedged upon
+HF power
+recovery rate is the same for all compartment
+the number of correctly predicted positive and negative pairs
+17
+12%
+p38 MAPK signalling
+Restriction factors
+DMF
+Aurum Total RNA mini kit
+mildly neurovirulent
+an MOI of 1
+240 million
+index #
+9.4
+184
+heterogeneity
+public opinion
+RR2Y primers and probe
+Cathepsin inhibitor E64
+infectious virus
+UGTs and SULTs
+2
+a veterinarian
+13 years
+capture antibody against mouse IFNγ
+abruptly
+the ligand
+two
+cardiac fibrosis
+150 nt
+adequate immunity
+five
+wellbeing-reads
+Nairoviruses
+PTB
+purified lipopolysaccharide
+their correlation to the related Rfam structure annotation
+SQLite
+Fugu and Yijun
+Non-influenza respiratory virus infection
+memory B cells
+means ± the standard errors
+decreased CD81 binding
+Influenza
+NiV
+Aggregation of data
+18
+PB method
+ethical
+pathogen metadata
+environmental data from satellite imagery
+Treg cells
+hematological
+24th of November
+a TI cell marker
+infiltrating macrophages
+Pandemic H5N1 Influenza virus and SARS virus
+AME
+sialic acid
+circulating dendritic cells
+seventeen
+four
+qPCR
+adherence of P. vivax-infected red blood cells
+DC maturation
+95%
+5 days
+Decreased bacterial clearance and deteriorated lung injury
+DNAzol TM
+SL5 and the PPT region
+Ca 2+permeable ion channels
+densitometry analyses of DR6 protein expression
+to investigate the clinical characteristics and etiology of Bell's palsy
+thrombosis of the arteriovenous fistula
+human resources and laboratory
+HCoV
+supportive
+120 alleles
+SVG
+mean ± SEM
+active trading places
+UL39
+by plating serial dilutions
+DENV replication process
+qRT-PCR
+almost perfect
+Pooled samples
+FIV epidemiology and distribution
+chronic inflammation
+orientation of the pattern of interest
+IL-23
+respiratory syncytial virus
+7 min, 72 C
+DNA damage repair systems
+craniofacial abnormalities and growth retardation
+0.916
+infectious dust
+Cxcl5/6
+91
+co-infection
+VACV
+1,038
+cleavage probes
+microtubule cytoskeleton
+70 %
+Thirty
+VRC 500
+medium containing virus
+prevention of influenza-attributable pneumococcal disease
+gene gun and electroporation
+susceptible-only equilibrium
+unstable
+honeybees and wild bees
+Further information on research design
+seven
+Bta-miR-205
+43.5%
+A i and B i
+Design cues
+C. difficile toxin A and B
+WT
+2 mL of the culture
+45%
+patient trials
+MG756 and MG770
+transcription factor analysis
+− 10.0 ± 1.2 s −1
+monoclonal high affinity memory B cells
+samples that were compared to one another
+Table 2
+5.1 µM
+Six
+163 ng/ml
+activation relation
+RESP score
+SWISS-MODEL 43
+fluorescence recovery
+PN-SIA49
+Higher risk
+The Wilcoxon test
+low sensitivity
+8
+WNV and Japanese encephalitis virus
+LoFreq and VPhaser2
+Anti-apoptotic
+different subsets of ISGs
+Thirty minutes
+192 nm
+acetylcholine
+three
+ONT
+Matrigel
+Shading
+gRNA nuclear export
+angiopoietin-like protein 3
+storage vesicles
+an HIV test
+switch from the innate to adaptive immunity
+more detailed guidance
+to recruit cytosolic SNXs and retromer
+competing ASL conformers
+benefits outweigh risks
+the effect of very recent interventions manifest weakly in current
+achieving infection
+hybridization equilibrium
+58
+SR group
+86% identical
+phylogeographic
+36
+titer
+antibacterial
+DNA Ladder Extraction Kit
+a short sequence of k nucleotides
+cytochrome P450
+obese and morbidly obese
+Behavioral Leading
+differentiation, proliferation and survival of monocyte progenitor cells
+assessment of minimal residual disease
+0.99 mg/ml
+salivary lysozyme
+PCV
+HBZ-specific antibody production
+#0.2%
+antibody against a malaria antigen other than AMA1
+CCR4+ Mac1 tumor cells
+hypodermic
+HEV71 P1 and 3CD proteins
+eEF1Bc
+70 kVp
+Seven
+higher
+5 mins
+deciding which processes should be included
+Folding RNA secondary structures
+discrimination between the expression levels of four candidate target genes upon different treatments
+safe
+high levels of immunity
+whether gastroenteritis had developed within a week after departure
+higher copy number of r-genes
+enhanced PNA·RNA-RNA triplex formation
+13%
+Nitrite oxide
+15 min
+Ae. albopictus
+RNA viruses
+b 1 -AR
+optical tweezers
+HN mutants
+there is no identification
+multi-analyte
+quercetin
+Oct4 + swine stem/progenitor lung epithelial cells
+Colubraria attack
+pig farms
+Cyclophosphamide/total-body irradiation
+ferrets
+linear polyethylenimine
+Prism 5
+CD13
+phospholipase-and ROS-mediated glycocalyx damage
+11
+13
+48
+antivirals and vaccines
+HIV-1 Integrase
+2013
+Cowling, Benjamin J; Leung, Gabriel M
+nine
+NPT2
+gatherings of more than
+900
+mBed cluster size
+30 ∘ C
+110
+cap-dependent and IRES-dependent translation
+pET SUMO vector
+WT estimator
+DNA vaccines
+permeabilization
+the specificity of these kits
+10%
+T G 1 ¼0.28 s
+cytosolic compartment
+two studies
+bioinformatics analysis
+TDC
+IFNL4
+UV-fluorescent
+four
+specific pathogens
+1
+0.5 µg of total RNA
+viral replication
+Egress of enveloped viruses
+darker grey
+330-350 μm
+Escherichia coli
+red dot box area
+National institutes of Health and Suburban Hospital
+incidence and severity of symptoms
+IFN-γ
+Standard vaccination coverage, nutrition and mortality survey instruments
+−9.9 KJ/mol
+PD-L1
+infectivity estimates from studies of seasonal strains of influenza
+up to three days
+confocal microscopy
+IFNγ or IL-4
+calibration peaks
+sustained transcription of the transgene in muscle
+50%
+glycyrrhizin
+an outer housing and an inner cable
+5563
+LUS
+18
+10:1 to 15:1
+keratanase II
+The cleavage rate
+FTY720
+PCR product
+mTOR-inhibition
+Three
+COX-2
+the influence of genetic background and the choice of the correct tissues
+60 min
+HepG2
+R 0
+A glossary
+herring sperm DNA
+Fig. 2
+VZV infection
+two
+attenuate the loss of muscle mass
+fusion peptide
+Matrigel Matrix GFR
+A rise in sea level
+four
+457
+Figshare
+Adobe Photoshop
+hypothermia
+disease mechanisms and drug discovery
+Three
+NASH
+Chest
+Formalin-fixed, paraffin-embedded lung tissue
+4%
+ASP
+15, 60, and 80
+Type I IFN secretion by PDCs
+ER-Golgi trafficking
+20%
+high improvement on the efficacy of the treatment
+the unwinding resistance of stem S1
+blood
+1918
+CRISPR
+comparison groups
+40-60 nm
+p85α
+Maternal Oct4 expression
+primer walking method
+significant bias
+Integrin binding to the ECM
+detection time
+Africa
+immunomic regulatory networks
+up to 10 days
+WT mouse bone marrow-derived macrophages
+CD47/SIRPA ligation
+one
+Thirty-five
+Page Blue or Periodic Acid Schiff
+Immunofluorescence
+DNA replication and repair
+anonymous
+6 hrs
+12 weeks
+mimivirus-associated CAP
+world air traffic network
+infectious disease events
+astrocytes, endothelial cells and inflammatory cells
+glutamic acid
+100% protection
+to be doing that in the context of the health of the population
+corals
+170,000
+43
+N-terminal tagging
+Live bird markets
+102
+Multi-task Group LASSO
+L10H
+four
+Three
+antibiotic resistance
+d
+HB-EGF
+anti-inflammatory and anti-angiogenic
+Insertion of tail-anchored proteins into the ER membrane
+aliphatic side chain of leucine
+12
+glutathione affinity chromatography
+what we think is possible to observe in the new influenza season
+ABACBC PKs
+Antagonism of JAK/STAT signaling by both DNA and RNA viruses
+nephrotoxicity and myelosuppression
+VSV-ΔP technology
+30,600 Da
+spike recovery
+Increased worldwide mortality
+24
+an intracellular iron-storage
+inhibit the activation as WT lead to viable virus
+inspiration synchronized aerosol
+9.5 %
+one G residue
+R240A and R247A
+37
+filovirus entry
+non-specific
+Kenya
+TLR4
+hospitalisation
+ferrochelatase
+low and significant
+70 to 90%
+immunocompromised
+NK cells
+Trust
+0.05 mg/ml
+the stem cell
+eight
+similar
+AtRH2 and AtRH5
+Plasmid DNAs
+15 years 23
+5741
+TRIzol
+Complex CIII
+1 to 618
+Zanamivir and carrageenan
+transcriptional effects
+α and λ
+herpes viruses
+100 nm/s
+diffusion and sedimentation
+Zanamivir
+a molecular scaffold
+K562 leukemic cells
+attenuated
+Increased horizontal transmission and within-host parasite competition
+autophagy-dependent
+mannose trimming or ERManI
+16,977
+480±53 nm
+15%
+infectious disease risk and impact
+33%
+Quantifying transmission-relevant contacts among children at schools
+Pathway
+200
+Cathepsin E
+1302
+Histologic
+neoplastic
+López-García, King, and Noakes
+Alveolar
+17
+1.8 per million
+ΔΔCt
+3109
+phylogenetic signal
+30 min
+replication data and analysis scripts
+None
+antiviral gene upregulation
+CodonCode Aligner
+Duchenne muscular dystrophy
+four
+Singapore
+prevalence
+miR-30b
+RM cells
+71.4 ± 14.7 years
+Cronbach's alpha
+macrophages
+intra-regional trade bloc and extra-bloc imports of live poultry
+2014
+platelets
+enhanced tumor growth
+LC3-GFP
+Table 7
+Granger causality Wald testing
+FMP-specific CTLs
+1,942
+parasite
+5%
+Uranyl salts
+smear and culture tests of sputum, blood and urine
+pathway and network centric
+type I interferon production
+RIVM
+extracellular and intracellular viral particles counts
+temporal class
+amoebae
+adipocyte dysfunction, dyslipidemia, insulin resistance and mitochondrial dysfunction
+ten
+physical methods and chemical methods
+loss of cilia
+CD8+ T cells
+plastid transformation
+chromosomal DNA from C. difficile 630Derm
+at least 10 passages
+the i th age group
+antiviral cytokines
+Zhang Zhongjing
+PDB structure of 2BPV_A
+132
+Trials
+R 0
+cellular kinases
+Episode questionnaires
+perianal area
+Ten wt %
+conserved CTL epitopes
+Br-PepC7
+H7N9
+Dr. Shin Yonehara
+Electrostatic force
+3.5
+frequency of positive cells
+stochastic gradient boosting
+2000
+food intake data
+Human rhinoviruses
+population genetics
+T cell
+3, 7, 11, and 35
+Two days
+three
+the allele found on the most common haplotype
+written informed consent
+H7-specific antibody responses
+Lymphocyte count in BAL fluid
+one QTLR
+detergent-resistant membrane fractions
+≥57%
+Fida M. Khan
+,1/40
+over 80%
+mouse monoclonal 11G5a
+observations at focal points that are at wild/ domestic bird interfaces
+hypergeometric P-value calculation
+Transformants
+the government
+TNF, IFN-β, and IL-1β
+intracellular
+x 2 2
+CSF
+liver inflammation
+2BP
+US$15 billion
+CBPV
+immunomodulators
+CD8 + Vb8 + T cells
+IAV-infected human epithelial cells
+Cisatracurium
+renal replacement therapy
+Cell-and tissue-specific delivery of cmRNA
+STORK data manager
+Bid
+calnexin
+PPV and CMV
+15 min
+880
+8 µl
+de novo synthesis of nucleotide precursors
+4,045
+essential viral function
+0.84
+redox-regulated
+10 µg/mL of blasticidin
+European bank voles and South African four-striped mice
+binds DNA and regulates transcription
+education
+90%
+30.0%
+PRRSV
+three
+population level mixing and transmission
+,20
+Xing Tan and Miao-Ling Li
+T ventilation without RM
+ProteinPilot software
+2009
+Education
+Intensive Care Syndrome: Promoting Independence and Return to Employment
+Influenza research
+Molecular
+99.5%
+ρ H M Z Y H M
+three
+neomycin resistance
+larger study populations
+bleeding, infection and care
+Differentially expressed genes
+Y2HGold
+Cathepsin D
+1AE18
+The investigator of each participating center
+Costimulatory molecules
+Multiple comparisons
+reverse genetics platforms
+lesions
+aae-miR-263a-3p
+48 hours
+accurate representation of actual contact patterns
+First Strand cDNA Synthesis Kit
+insoluble aggregates
+2-21 and 28-39
+removed from display
+CPV 2a and 2b
+cathepsins B and L
+protecting mice against H1N1 IAV infection
+cross-contamination
+The first Nash equilibrium
+P-glycoprotein
+recombination
+Hypertension
+7.5% DMSO
+The Hoechst channel
+Five
+QIAamp DNA Mini Kit
+90%
+cholesterol
+100
+175
+expression of surface ESA
+1.75%
+1 mg/mL
+cleavability of the 3 0 -terminal phosphodiester bond
+adenocarcinoma
+400
+24 hours
+10 min
+routine
+prokaryotic IF2
+80%
+an ER stress inducer
+transient non-viral gene therapy
+Eleven
+ST cells
+CCR5 + CD4 + T cells
+10 to 44
+straight and confined migration
+PmaSLRNAs
+convergent coevolutionary patterns
+4 µM
+geometric centers
+biased
+NPPTL
+R
+43.75 ± 16.46 years
+v
+hyperglycemia, infection, disturbed wound healing, or gastrointestinal bleeding
+34
+3.75 × 10 7 PFU/mL
+inefficient metabolism of microbial products in the liver
+8% polyacrylamide gels
+Western blotting band
+Phylogenetic
+1/16 394
+antigenic
+20%
+significantly different
+calcium-dependent enzymes
+microbiome
+HLAassociated selection
+∆Br T
+disparate levels of FPS and SQS transgene products
+five
+STT3A
+act as an oncogene
+assessing the potential of metabolomics to establish vaccination status in infected animals
+insomnia, depression, and anxiety
+Silent codon modification
+11Thr/Thr
+pneumonia
+lung cancer
+The use of biomarkers
+acute myeloid leukemia and breast cancer cell lines
+2F5, 4E10 and 2G12
+eukaryotes
+predisposed
+Transcriptional slippage
+38%
+receptors
+probes for norovirus and rotavirus sequences
+adequate selection of parameters
+purified DNA
+Indonesia
+lighting on roads
+DSPA1 and DSPA3
+laboratory confirmed or suspected influenza Apdm09 infection
+PFU/mL
+fluorescent dye
+Chinese Han
+Fluorescently labeled target-specific probes
+cell rounding and syncytia
+IFNT
+autophagy
+Exosomes
+annexin A6
+oropharyngeal bacterial translocation
+IPP
+higher
+high MOI
+2-5 days
+Understanding the genetic basis of adaptive phenotypic change
+50%
+structural conformation
+oncogenesis and IFN-activated responses
+booster immunization with Tdap
+cIAP1/2 and NIK
+stay focused on the health of populations
+40%
+Kurtzke's Expanded Disability Status Scale
+higher
+Established sepsis/MODS
+cathepsin D and trypsin
+36
+63%
+process measures
+Specific revalidation
+by passing the extract through the column
+θ
+assay
+humans and chimpanzees
+2
+Three
+Gharwar
+22
+mitosis phase
+genetic diversity
+Glycyrrhiza glabra
+NK cells
+1980
+E/E1
+Inhaled corticosteroids
+genome sequencing method
+202
+455 and 360/HLA-A*0201
+poor outcome after HCT
+pCA-Dest14xx
+IFN-c
+QIAamp DNA Blood Mini Kit
+existing diary-based studies
+high fat diet
+SAP130
+Five
+H5N1
+energy
+Vero E6 cells
+5 min
+COA
+changes in the affinity/disaffinity between groups
+8 days
+epitopes having significant median similarity score lower than the non-epitopes
+Normal
+4%
+Sixty-nine
+alternative tests
+136
+Population health
+sale
+three
+live attenuated vaccines
+Akt-mTOR pathway
+HIV protective behaviours
+Traumatic spinal cord injury
+PCV2
+logistic regression models
+Exosomes
+heterologous infection systems
+Uncertainty
+self-tumor ags
+Alcaligenes faecalis
+HIV-related stigma
+avian to humans
+povidone-iodine
+statistical significance over control
+95%
+15
+Microglia
+ubiquinone biosynthesis
+Fn
+conventional antibiotic therapy
+IL-10
+heterogeneous
+around three weeks post-infection
+hepadnavirus
+8 weeks
+potential multicollinearity
+the timeline of a higher level process
+disease is eradicated
+Lipoid CO., Ltd
+urine and faeces
+structural cohesion
+500,000
+quantitative real-time reverse transcription PCR
+pyrimidine-rich
+low pH in the endosome
+acute cuprizone demyelination
+H3N8
+nearly 60 years
+five
+Core A, Core B, and Core C
+virus
+Four hundred
+De novo reconstructed gene models
+411
+2 weeks
+considerably off trend
+San Jose
+supertree
+poor self-rated health
+covering cough
+darker color
+15
+The cytoskeleton
+ISRE, IFN, and NF-κB promoter activities
+similar effects have been found for different epitopes derived from unrelated viruses
+methanol
+N i
+Gyrodactylus
+Availability of resources
+OriL-RNA1
+defense against C. albicans
+chimpanzee
+to bypass the HG barrier
+24 h
+one day
+Bm-P12A3C
+Integrated DNA Technologies
+80 mmHg
+H
+proteasomal degradation
+15.3%
+Corosolic acid
+33.3%
+heart rate and heart rate variability
+plaque assay
+viral genes or sometimes complete genomes inserted into host genomes
+NetMHCIIpan
+TLRs
+signal peptidase
+human epidermal growth factor
+infected cells
+dengue antibody
+Laboratory surveillance
+Intestinal tissue
+0.7%
+RBPs
+the mammary gland
+population structure
+AGR2-GST fused protein
+Status as a developed or resource-limited region
+independent monitoring
+LbrPGF2S and AKR1C3
+identified challenges
+Cotton effect
+fluorescent anisotropy-based binding analysis
+6 h
+Wnt/b-catenin signaling
+3 -disulfide functionalized PMO
+31%
+79.6%
+B3LYP
+SignalP and PrediSi
+the construction of synthetic cells
+plant cancer
+constant
+Microbiome profiles from 16S sequencing
+50%
+8.1
+80%
+Gaussian distributions
+eukaryotic expression plasmid
+a duplex semi-nested-RT-PCR
+acute respiratory distress syndrome
+biosignatures
+CMV pneumonia
+Eighteen of 21
+90%
+0.45
+schizophrenia, bipolar disorder and major depressive disorder
+463
+24 h
+57%
+antigen-encoding vaccines
+TRAF6 and UbcH7
+Three
+MS n
+detrimental
+remyelination
+30 mM-1 M NaCl concentration
+lower values
+human polyclonal antibodies
+Mann-Whitney test
+sIgA
+40 days
+ring vaccination
+SPSS statistical software version 12.0
+carbon fixation during photosynthesis
+C-6 of glucose core
+immunofluorescence
+essential
+sequentially and spatially conserved
+one
+3
+CMV-TRAF6 cells
+immune components in host cells
+flow cytometric
+detection reagent
+endosomal/lysosomal cholesterol accumulation
+25
+RStudio
+40
+P27 or replicase expression
+Protocol adherence
+twenty-four
+PrP Sc
+human spread
+seven days
+local political constraints
+one-third
+1964
+Major histocompatibility complex haplotype
+mean AAR
+exons 45-51 and exons 53-55
+Perkinsozoa
+90%
+scanning
+consistency in describing public health
+Five
+Five
+5 min
+data are available
+cleavage of VP4 by trypsin
+increased expression
+one single residue at position 134
+ovalbumin
+PMOs
+H. pylori
+potential epidemiological links between cases for a given data source
+Emerging and re-emerging infectious diseases
+551
+864
+More than 600
+low inter-and intra-group variation
+Interactions between time and treatment
+28.4 µg l -1
+Stepwise forward logistic regression
+open-source
+a number of subgroups
+PCNA
+TLR3 signaling
+cc-by
+complex life histories
+cc-by
+Translation of the no-stop mRNA
+plasmacytoid DCs
+In Vivo Imaging System kinetics system
+bone marrow progenitor cells
+allergens
+disaccharide repeats
+pancreatic islet hyperplasia
+surveillance systems
+40-min
+IL5 activates eosinophils and cause airway inflammation
+Estimating the growth rate of the outbreak
+luminescence expression
+respiratory intensive care unit
+3 to 12 weeks
+four
+35-40%
+Over-stabilized UFS
+Chart review
+Three
+affinity chromatography
+51%
+efficient
+cheetahs
+1:1
+ML inference
+infants and adolescents
+non-bound virions
+Retroviruses
+Yosef et al.
+Nineteen
+I. scapularis
+recombinant receptors
+8 negative single-strand RNA segments
+novel mutations
+Atg32
+Atom numbers
+X-31ca
+morphine addiction
+ataxia-telangiectasia
+the public health classification
+dropout rates were lower
+Tautomerism
+colonic ulceration
+10%
+One week
+SERCA2a
+cervical ectopy
+autophagy
+parasite biology
+153
+maximum likelihood estimation
+50%
+maximum temperature, specific humidity and latitude
+Rab5a
+epigenetic silencing of tumor suppressor genes
+Recombination Detection Program version 2
+potent
+3:10:22
+peripheral arterial
+lysosomes
+Specific
+31
+Brazil
+4 months
+binary logistic regression
+raw images
+non recurrent
+pediatric
+2012-2013
+80
+viral clearance
+new method of epidemic evaluation
+HCI
+asymmetric
+TGF-β activity
+Alphaviruses
+The NIH Institutional Biosafety Committee
+age, gender, and specific pathogen
+FccR polymorphisms
+written information
+5
+how the probability of contact between farms scaled with distance
+Induction of cell vacuolation
+pneumococcal HIS
+pressure and natural selection
+p.Lys329Glu
+disease duration, functional derange ment, age, gender, or smoking
+Plasmid pCDNA3.1-UL44-FLAG
+ILC2 cells
+state-run/funded public health care systems
+China, Japan and Korea
+lack of 'clean' seed yams
+24 h
+materials-based
+Maximum likelihood phylogenetic trees
+longer latent infection period
+morbidity and mortality from disease
+SFV
+RT-qPCR
+33 months
+pneumonia and sepsis
+Aligned nucleotide sequences
+the scale's factor structure
+increased ACE2 shedding from tissue
+Five
+inflammatory
+their etiology
+Antibiotic exposure
+higher
+H3K4 monomethylation
+toeprinting
+colorectal
+280uC
+190 kb
+trVLP
+asthma and COPD
+Juliana Idoyaga
+four
+Bronchoscopy
+three
+a single transcript
+Breast cancer
+3.9%
+alpaca
+STATA
+virulence factors of different pathogens
+scFvG36
+TC sensitivity to PI3K isoform protein inhibition or PKC inhibition
+microarray
+ORFs
+socioeconomic conditions
+unusual characteristics or high morbidity or mortality
+15
+quantitative
+three
+Cochran's nonparametric statistical test
+30 min
+85%
+hundreds and thousands
+Uncertainty
+mice
+MMPs
+TLR15
+R P isomer
+no band of NS5A-LacZ
+CD150/SLAM
+all sites have the same ω ratio
+mosquito dynamics
+multiple linear regression analysis
+Echography
+Rendered Z-stacks
+15 mM reduced glutathione
+The integrity of the innate/adaptive immune interface
+Pip6a
+RT-qPCR-based relative expression data
+culture, antigen detection, and PCR
+HER2-positive breast cancer
+Substitution S101N
+any risks
+100%
+canine sapovirus and canine kobuvirus
+silicone
+infectious contact
+local scale
+pivotal/registrational Phase 2 studies
+primary progressing remitting course and secondary progressing course
+1:1
+infection control systems
+Proteolytic digestion
+meat and egg production
+HEK293
+complement-mediated and/or antibody-dependent cytotoxicity
+Ϫ1.6
+HT
+Bars sharing the same letter
+Hela-S3 cells
+45%
+39
+Pass-through events
+tapeworms
+CD4+
+receptors predominantly expressed on neuronal cells
+Yap1 and Skn7
+between pH 6 and pH 7
+72 h
+the highest value obtained within 3 days of acute visit sputum collection
+adaptor ligation amplification
+EEA1
+fluorescence
+Quantitative phosphoproteomic
+Fragments per kilobase of transcript per million fragments mapped
+high and low priority diseases or pathogens
+tetraethylammonium and acetylcholine
+between 2 and 6 h post-infection
+endosomal release
+p
+1 week
+C6/36 cells
+T-bet
+500 µl of culture medium with 10% FBS
+VE decreasing
+the frame with the greatest mean brightness
+perinuclear area
+catalytic activity and transporter activity
+20
+its own translation
+1975
+Avian influenza
+Bacteriophages
+PtDds
+Nonspecific interstitial pneumonia
+cyclophilin A
+hours to days
+clumping and precipitation of the antigen out of solution
+Cell viability
+histological
+Binding site similarity
+keyhole limpet hemocyanin
+HSP90β
+IL-5, GM-CSF and IL-3
+management
+wt RNA
+LRTI
+a critical element of protection against pathogens
+1.67%
+Physicians
+a human telomerase-immortalized retinal pigment epithelial line
+deoxypodophyllotoxin
+CSFV-infected swine serum
+Fawa-l-luc-based
+fullerene
+IRAK4
+100 μL methanol
+70%
+induced folding to take place
+moral decisions
+three
+diffusion Eq
+an Figure 2 is not to scale
+SAND and eEF-1a
+Supplementary Information S3
+poor
+Halophilic
+TBC2target
+R 0 j
+NUPACK
+four
+Actin
+7
+mutations
+dehydration of lipid head groups
+pandemic
+random between-patient variation
+55
+HIV-1 nucleic acid amplification testing
+Public awareness of risk factors in relation to cancer prevention
+8-weeks
+regression models
+Japanese encephalitis
+Influenza pseudotypes
+Respiratory failure
+-TUB, EF, and CypA
+cc-by
+Evolutionary model
+50-100
+1976
+40% or less
+up or down regulation of other specific pathways
+five
+Statistical Complexity measures
+CD44, Sox2 and ALDH1
+methicillin-resistant Staphylococcus aureus
+statistically significant
+55
+Plates
+bio-security
+biological
+N-Terminal 6xHIS tag
+p38 MAPK pathway
+sCT targeting and localization to osteoclast
+gene expression data
+Glycosylphosphatidylinositol anchors
+increased mortality, duration of MV and paediatric intensive care unit stay
+Expression data
+tumor incidence and size
+2.05
+IGF-1R
+Glycoprotein D
+cluster members
+APOC1
+more Internet users
+R-squared, AIC and significance of the coefficients
+2 h
+enhances the NF-kappaB-dependent inflammatory cytokine production
+systematic bias in observed outcomes
+α
+CD8+ T cell and NK cell
+interleukin-7
+2.22 ng
+epithelial and endothelial cells surface
+7
+destabilization of USP18
+700 000
+IMGT-Ontology and Gene Ontology
+15-20 mg/L
+RNA
+immunosuppression
+Leukocytes and plasmacytoid dendritic cells
+four
+agr quorum sensing system
+106,682,518
+RF antitumor model
+residues Cys391 to Gln419 of BLV Env
+antigen dose-rather than magnitude-dependent
+Cambodia
+L-O2-X cells
+59
+Enhanced cmRNA Stability and ACE2 Protein Translation
+10 µL 1 m ethanolamine
+terms of hospital operation volumes
+induction of T-cell immune responses
+overall LOT-R scores
+Zymo Research viral RNA kit
+further analysis
+saline
+500 and 1000 meters
+a questionnaire
+chloroplast NADH dehydrogenase complex
+two
+CsrA activity
+creating custom interfaces
+MPRC, Pocheon
+2256
+the height of the entire stack of residues
+innate response
+neuraminidase
+coexpression of at least two nonstructural proteins
+30 min
+Bat capture and sampling
+Chihuahuas
+55 mmHg
+clinical course of HE
+comparative genomics tools
+350 copies per mL
+four
+stability
+strong anti-viral systemic responses
+Extracellular matrix deposition
+higher
+326,552
+30
+temporal autocorrelation
+Prior knowledge about sensitivities
+two
+robust multifunctional T-helper and cytotoxic T cell responses
+days to minutes
+viral progeny
+In vivo expression of vector-delivered firefly luciferase
+eHEV particles
+Cyclophosphamide
+Supernatants
+Th17
+splenic lymphocytes
+substrate
+Manila
+20
+Optimal codon
+TGFBR2
+UK Department of Health Critical Care Contingency Planning Working Group
+ID
+evidence
+The nucleus
+inflammatory
+N l
+piwi genes
+50%
+MeV inhibitory
+Cochrane collaboration's tool
+highly curved fission products
+Graphs
+Tukey's multiple mean comparison test
+total JNK or β-actin
+EGR1 mRNA levels
+Losartan
+bioinformatics
+ecological and epidemiologic
+Important biomarker patterns
+Phage rescue
+stable ensembles
+Hemagglutination inhibition
+analytical protocols
+tolerance exercise in ARDS survivors
+28 and 90 days after admission
+2 weeks
+Six
+completely degraded
+H9 HA protein
+Type I IFNs
+Younger age
+pigeon cells
+Adjusted values
+phagocytic ability
+patient safety
+5%
+9.9 million
+PsVs
+Twenty-one
+asymptomatic
+automorphism orbits
+Richard Hatchett
+IgH D-J rearrangement
+10%
+regulating secretory capacity
+RNA isolation or ACE2 protein assays
+Proxy measures
+immunogenic
+IL-10 receptor alpha-chain
+23%
+University of Pennsylvania Institutional Review Board
+dolichol-linked oligosaccharides
+6 hours
+Delphi 14 method
+eight
+disease transmission
+smallmolecule chemotherapeutic agents
+bisbenzimide
+apoptotic markers
+NaCl
+ventilation
+NCBI
+PROCR
+17-mer GCrich and AT-rich ssDNA oligomers
+media practices
+NS5A movement properties
+refractory fluid overload
+1988-1989
+dynamic phosphorylation pattern
+to revert the non-germline framework amino acid changes
+up-regulated discriminatory peaks
+shape features
+potential adverse effects
+β-lactam antibiotics
+Rice
+0.107
+Management guidance
+rabbit anti-GII norovirus polyclonal sera
+trypsin
+b and c
+Pomc expression to drop and NPY to increase
+canonical activators of SG formation
+AIDS patients
+a strong type I interferon response
+one hour
+ECDC
+climatologic data
+Voxels
+FACS Diva
+Polyomaviruses
+1 : 30; 1 : 90; and 1 : 180
+Oligonucleotide probes
+7.0
+two
+cysts
+9.9
+miRNAs
+Subviral particles and infectious virions
+19 days
+Between weeks 5 and 6
+Sleeve anastomosis
+its folding route would be riddled with kinetic traps and dead ends
+Each spectrum
+H3K4 trimethylation
+the primary recipient
+AMPKα1
+lymphoid
+pDUAL-HIV
+IRES-mediated initiation
+IL-23
+Methionine
+physiological relevance and greater clinical significance
+Little
+WBCs
+16
+Minkowski distance
+doctors and nurses
+inside the lesion
+one
+fancy hardware
+shRNA1110 and shRNA1755
+clearance of viral infection
+GraphPad Prism 6
+ρ
+ILT7
+diffuse pancreatic infiltration
+Bright-Glo Assay System and POWER SCAN HT
+T362I RdRp
+BALF
+splicing variants and the shed variants of RAGE
+huORFZ embryos
+chronic CD
+diphtheria toxin-like ADP-ribosyl transferases
+to ensure the precision of the exponents
+asf
+5 months
+single-molecule fluorescence
+American Type Culture Collection
+36.1%
+H1N1 and H5N1
+moderate malnutrition and clinically severe pallor
+One hour
+red spheres
+bactofection
+VLP for CHIKV
+definitions and management
+infection of the same host cell
+4,500
+XMRV
+thromboembolic
+Logistic regression analysis
+TNFR1deficient
+endoplasmic reticulum
+0.017% and 0.019%
+Dr. Klaus Strebel
+reduce the intact cat populations
+1,000
+binding to the N-RNA
+generalized linear models
+Orphan Drug
+histological analysis
+Kenya
+Five
+37
+enthalpy-entropy-compensation
+a one-way switch
+366
+a higher secretion
+transient adoption of social distancing measures
+mutual trust
+60-70%
+PE-conjugated streptavidin
+37%
+IFNγ and IL-10
+early critical factors
+1970s
+Collibacillosis
+200/μl
+ImageJ
+Xi'an
+6
+children with a limitation of intensive care treatment
+ACBD3
+GST-UL44
+Fwt
+LI-COR Odyssey or HRP substrate
+humoral immunity
+Healthmap or Medisys
+nucleic acids and peptides yearly trends
+500
+an MOI of 0.1 TCID 50 /cell
+BioTek plate reader
+two
+fifth
+inflammatory
+Flow Jo
+gold particles as fiducials
+angiotensin II-induced cardiac hypertrophy
+NF-κB
+RNeasy kit
+50%
+negative
+2,000 fold
+no cobblestone-like colonies
+SOF
+distributions and ratios
+bind to the MHC molecules
+Twenty seven
+multiple protective effects
+Bayesian
+meningoencephalitis
+TYMV PRO
+1 min
+eighteen
+Airway epithelial lining
+Alveolar
+Data
+24 hour
+nontarget tRNAs
+International Classification of Diseases
+tissue-resident macrophages
+Hecke and the Maitlands
+positive end-expiratory pressure
+number of sensitivity, specificity, and precision tests
+protection
+chromatin remodeling and/or transcription modification functions
+GLMNET
+melanoma
+decreased or unchanged reactivity
+IAV-infected
+60 min
+PA
+IFN-a
+Human TNF-a
+Inosine
+four
+the interaction of PTX3 with C1q
+Three
+PAMs and MARC-145 cells
+the number of living cultured cells
+F4/AS01
+A human norovirus
+Goggles
+monitor the spread and severity of the pandemic in real-time
+Non-stimulated PBLs
+Twenty-three
+S *
+face masks
+3
+agent based models
+tRNA modification
+C CUCCAGCGCGC
+24 hours
+3, 7 and 28
+the average number of secondary infections
+endemic
+mul-tinucleated giant cells
+eight
+susceptibility and infectivity
+the average from 10 animals per experimental group
+difference between survivors and non-survivors
+The envelope gene
+specific overlap of EGFR and CD151
+fear of side effects and doubts about the efficacy of the vaccines
+GenBank
+National Hospital for Tropical Diseases
+24
+CEACAM1
+Virus titration
+The inset
+firefly luciferase
+heparin-Sepharose beads
+IL-23
+Myf5
+Supplementary Table S1
+simple modifi cations of the widely used C2 algorithm
+type 1 regulatory T cells
+Ketamine and Xylazine
+Figure 18A
+IgM
+5 to 89 days
+cryo-electron tomography and microscopy
+macaque PBV
+once daily
+proliferation and migration region
+Serum NGAL levels
+hemagglutination tests
+myeloid
+four
+Influenza A
+7H10
+ApoE4
+more severe systemic inflammation
+DNA inversion
+5729
+11
+group 1
+acrylic board processing equipment kit
+hematoxylin and eosin
+augments
+1,6-hexanediol
+Fifteen
+limited
+Node color gradient
+influenza transmission
+0.22-µm-pore-size filter
+0.990 and 0.899
+Metadata on whether specific sequences originated from clinical sample or culture material
+2.5% goat serum
+extracellular
+after the project gets running
+27
+properties of both the basic reproductive number and the ultimate proliferation rate
+30 min
+~4 × MCD
+antiviral
+reducing cellular cAMP levels
+knowledge gaps
+hypertension
+162
+~10%
+endosomes or basolateral membrane
+Genome sequences of H5N1 influenza A viruses
+up-regulated
+Legislation and ministerial directives
+1104
+Cladograms
+N proteins
+marginal likelihood estimation via path sampling
+598,473
+faster Tl2
+banning large gatherings
+8
+general health, rectal temperature and signs of abortion
+critical
+100%
+distribution of each genetic group
+TLR target genes
+peptide-MHC microarrays
+Cell-surface-linked
+HRV-C
+ZsGreen-positive cell ratio
+0.024
+3
+IL-10 secretion
+Low heterozygosity
+26
+PCR reactions A and B
+asynchronous entry into the lytic cycle
+O/KEN/10/95
+22.3%
+ðDSÞ j i ¼ @S i @q j
+GRA24/p38
+Youden's Index
+2012
+acridine-based
+October 2010
+77%
+pulmonary metastases
+standardised physical assessments
+Laboratory data
+partial L-gene
+0.59%
+H3N2 and H1N1 influenza viruses
+cytochrome c
+Equatorial African
+flow cytometry
+Chlamydophila pneumoniae and Mycoplasma pneumoniae
+cattle, sheep, pigs and humans
+no genomic deletions
+Pediatric and pregnant/postpartum mother mortalities
+50-250 ppb
+more complex non-linear models
+IBV reassortants
+24 h
+actual travel patterns in South Africa
+fetal lung epithelial cells
+severe sepsis
+increased replication and pathogenicity in chickens
+previous or recent presence of infectious agents in a given population
+cross-presentation pathways
+ATG8-specific
+NF-B and mitogen-activated protein kinases
+49
+PfEMP-1 and EBA
+Docking sites for inhibitors of HIV-1 binding
+Remaining material
+peripheral blood
+autoantibody production
+NS gene reassortant
+anonymized
+QGIS
+linear regression models
+Beta-2 microglobulin expression
+viruses
+RefFinder
+lipids, proteins and nucleic acids
+C rs
+ELISA and IFA
+High hydrolytic capacity of cells
+Western blotting
+viral nucleic acid
+36,000
+endocytosis
+USA, Spain, and UK
+Lipofectamine™ 2000
+Pseudomonas spp., grampositive cocci and fungi
+Viral serology
+within the nucleoprotein gene
+Fisher's exact test
+three
+ciliated and non-ciliated airway cells
+Ratios for the protein of interest
+NSP2
+RNA interference
+128,119
+Odyssey Imaging Station and Image Studio software
+one third
+hepatitis G
+Newcastle Ottawa scale
+10%
+the edge of the insert
+maintainance of heterochromatin, DNA damage response and aging
+ΔMx
+neuronal cells
+generalized machine learning
+hypercaloric feeding
+T4 RNA ligase and -pCp
+34
+changing mortality and morbidity patterns in time and place
+48 h
+Administration of fluids
+influenza A
+the validation strategy
+.1%
+lamivudine
+systemic dysregulation of the inflammatory response
+Cytokines
+complete tumor rejection
+P. vivax
+FcγR-mediated binding and internalization of ADCs
+peak timing
+0.5 ml FBS
+Ͼ32
+~55%
+non-monocyte derived cell lines
+arbitrarily primed 454 sequencing
+CC IFN-l3
+mechanistic model
+logistic regression
+3
+Granzyme A
+host factor
+BSL-4
+150
+q B and q A
+EVD survivors
+four
+injured TI cells
+comparisons with certain types
+control of inflammation, metabolism and tissue repair
+sensitivity estimates
+w6/32 monoclonal antibody
+core self-evaluation
+500 million
+principal component analysis
+polydimethylsiloxane
+12%
+PureLink PCR Purification Kit
+198.8 ± 82.6 × 10 9 /L
+Confusion, Urea nitrogen, Respiratory rate, Blood pressure index
+R t
+molecular
+addition of the LIPS
+Taxonomically related host species
+0.3 mL/min
+2009
+Ebola parameters
+at least twice daily
+2009 and 2018
+3900
+32
+less than 10 days
+limitation of the availability of antibodies to Neovison vison proteins
+easier detection of the -1PRF product
+C200
+Fourteen
+nitrocellulose membranes
+RNeasy Plant Mini Kit
+85%
+Burkholderia cenocepacia
+many DNA and RNA-containing viruses
+electrophoretically homogeneous
+5 days
+80%
+65.0%
+naïve CD8 + T cells
+One-way repeated measures analysis of variance
+sek-1 MAPKK
+protein secondary structures
+HTLV-I viral proteins
+6
+two globular protein domains
+Extracorporeal membrane oxygenation
+70
+2.4 Å
+immunocompetent
+HBV-transgenic
+concomitant, and alternating glucose and drug infusions
+ketamine
+structural data retrieved from the PDB and comparative modeling studies
+Neutrophils
+PB1-F2
+U2AF 65
+Parreira and colleagues
+ε i
+88,000
+PI4P
+Cell-free
+risk score
+Lysozyme
+international political issues
+Tamiflu
+Plasmids containing each event
+BGI-Shenzhen
+73%
+14,381
+It starts to recombine
+five or six
+receptor-binding and neuraminidase activity
+IL-10
+A2
+introducing auto-correlation
+many infecteds will be detected before becoming infectious
+ICP4
+a computational approach for RBP -mRNA interaction prediction
+ProteinLynx Global Server 2.2.5
+1800 V
+17.7%
+Bangladesh
+9 years ago
+rapidly stimulated
+risk-factor associations
+Myeloid DC
+the same specific mutation
+5
+miRNA expression
+Pricing
+chloroquine and desethylchloroquine
+Global protein synthesis
+surgical procedures
+Meta-analysis
+a set of true transmission chains
+septic shock
+271
+Spectramax M3 Multimode Spectrophotometer
+relative light unit
+emergency preparedness
+GTP hydrolysis
+Tunicamycin
+inhibits virus adsorption and penetration in the early steps of virus replication
+v obs
+compound 6 and compound 66
+34.2 days
+50%
+AID iSpot EliSpot Reader
+positional overlap
+bronchioalveolar lavage fluid
+lymphocyte receptor complex
+Infectious disease
+24 h
+cells sensitivity to chemotherapy and androgen
+pheochromocytoma
+Nasal and pharyngeal swabs
+IL6
+ssc-miR-30d_R-1 levels
+E5564 and TAK-242
+GOLD fitness score
+an immune response to HA proteins
+programmed ribosomal frameshifting
+A3114-01
+unidentified host factors
+luciferase
+estrogen receptor alpha
+CD69
+proinflammatory
+TRIzol
+to ensure stable and consistent conditions
+HBV covalently closed circular DNA
+three
+One hundred fifty-three
+rs1042031
+size
+IFIT3
+dropwise 2 × 10 -6 M FB solution
+Geneious
+XRN1
+DNA or protein sequence
+IFAT
+SBE2/3 motif
+48 h
+vesicular
+44,4%
+100 μl of the neutralization mixture
+exon junctions
+consumers are left to interpret this uncertain data
+Chemometric
+96-well
+T, AT, and TT
+no evidence of infective endocarditis
+trimester of vaccination
+companion diagnostic test
+VALI
+MDT clinic
+no or very limited reactivity
+within the first 12 months
+EBOV VP40-associated EVs
+100 nm
+seasonal modification
+exogenous pr peptide
+CUG2-expressing cells
+Arenaviridae
+immortalized
+NSP4 + IFNa + pDCs
+microtiter
+aquatic birds
+Thirteen
+adult-onset hearing loss and refractive errors
+Genetic information
+RFID-based
+205
+weaning difficulties
+biosafety level 3
+Results
+77%
+1990s
+the substrate and concomitant generation of oxygen radicals
+decrease of replicative intermediates of WHV DNA in the liver
+6
+FF farms
+K189
+signaling receptors to transport machines
+a pathogen's
+Ribosome profiling
+mucus viscosity and respiratory exacerbations
+antigen processing and presentation
+immuno¯uorescent staining
+control variables
+Ribosomes
+sharing data and materials
+Nucleospin RNA Plus Kit
+20 min
+at least once daily
+IAVs
+Toll-like receptors
+universal SHI coverage
+Method 1
+138
+TAN buffer
+Transformants
+c
+low-density lipoprotein particle levels
+Hand hygiene
+unstimulated cells
+MLST website
+diagnostic tests with procalcitonine, urine antigen and blood cultures
+A/H5N1
+one-third
+486
+10 % nonfat milk TBST
+Prediction accuracy
+distinct genotypes
+impurities
+617
+HIV-1 gp120
+15
+NKG2D + CD8 + CD45 hi CTLs
+by detecting the virus titres
+a ranking of potential peptides
+IgG1
+non-ribosomal random hexamers
+eIF6
+kx v
+syntenic mapping
+HLA supertypes
+Myocardial ischemia/reperfusion injury
+inflammatory
+long-term infected cultures
+x azm
+L1 and IAP retrotransposition
+aerosol and droplet inoculation and infectivity
+K63-linked polyubiquitination of TRAF6
+RNA enriched for non-polyadenylated bacterial mRNA
+V2-apex bnAbs
+biological layers in the link
+three
+2 μM siRNA
+anti-ZIKV envelope protein mAb clone 0302156
+Adenoviral vectors
+many factors
+Bim
+Black blocks
+72%
+67.6 ± 1.2 kDa
+Caspase-1 activation and IL-1β maturation
+Omega RH32 meter
+clinicians for clinicians
+50%
+2 ± 0.2%
+MicroSpin Sephacryl S-400 HR columns
+medicinal
+recycling of selected cargo proteins
+three weeks
+2019-03-15
+Twelve
+3A
+natural history
+health
+eosinophilic and neutrophilic alveolitis
+culture supernatants of infected MDCK cells
+sandwich ELISA kits
+suspected pneumonia
+efficient rMP12-rLuc replication
+varied its breathing
+seizure or coma following fever
+both viral and bacterial replications
+morbillivirus antigen
+this was not a phenotype the model was trying to identify
+nine
+south East Asia
+equal probability
+30%
+influenza 127 and pneumococcal vaccinations 128, 129
+two-tailed
+ruminant
+chronic portal inflammation and granulomas
+pivotal
+PowerSoil Kit
+PGE2 and adenosine
+production of the Gag-Pol polyprotein
+immunized animals
+a combination of traits
+inadequate thoroughness
+4.8%
+cholesterol
+Brazil
+continued provision of better risk information
+secretory pathway
+3
+1,001/1,449
+malaria
+UPP1
+detection based on data collected routinely for other purposes
+The log copy number of the NDV genome
+RNA secondary structure analysis
+1980s
+Baculovirus vectors
+comparative Ct method
+T4
+MH976520
+hand-washing
+>500 nucleotides
+1
+high intracellular levels of tTA
+Maximum clade credibility trees
+brain tissue
+interstitial lung disease and lung involvement due to connective tissue disease
+200
+12 million
+human pathogens
+Phage display
+9A11
+a viral entry step
+82%
+small sample size
+febrile
+2.4-fold
+whether lamin A is a specific substrate for caspase-6
+giant component
+nonparametric
+54%
+expression
+one ELM instance
+2/16
+Competition experiment
+condom use
+poor phylogenetic resolution
+Orbitrap Lumos
+pathogenic
+cotranscriptionally
+36 days
+their expression at the surface of NIPARAB-infected producer cells
+local formation of thrombin
+amidine groups
+17
+infection free
+edematous
+IPTG
+NCBI's BLAST
+skin, footpad and eye
+Plasmacytoid dendritic cells
+KSHV-infected endothelial cells
+Infection transmission
+where pairwise differences between extraction protocols were significant
+DharmaFECT 1 transfection reagent
+Chlamydiaceae
+100 µl/well of anti-mouse IFN-γ
+flavivirus
+pessimism
+Nanodrop measurements
+Five
+insertions
+3
+6 years of age and older
+multiple potentially infective natural misfolded protein fibrils
+mast cell degranulation-related
+maintenance of cell polarity, tight junctions, and regulation of apoptosis
+Insects
+84.5%
+di and triubiquitin probes
+visual cues
+Ministries of Health and of Agriculture
+D°G 1 8
+Cyclin D3
+glycan interference
+microbicidal
+influenza viruses
+Child-Pugh class C
+Xiao, Yun; Zhang, Jingpu; Deng, Lei
+1.28263 KDa
+LLC-MK2 cells
+how recently the relevant literature had been published
+more people being correctly diagnosed and administered with antiviral drugs
+hindered the free movement of prostitutes and beggars
+27
+ARC -Onderstepoort Veterinary Institute
+B 0 AT1
+ECMO
+activation of the IFN-beta promoter
+CVs and dissimilarity between CV pairs
+activation of immunoproteasomes
+liquid handling
+Nonspecific-priming
+herpes virus-like particles
+general supportive care with management of symptoms
+viral antigens
+World Health Organization
+Three
+status
+oxygen demand
+c13C6
+Full distance matrices
+essential
+10
+72.7%
+a tendency for improvement
+Millipore
+100 mM to 1 pM
+hexon
+Richards model
+Hepatitis B immune globulin
+Synergy HT plate reader
+65 °C
+substantial improvements in forecasts of the trajectory and size of the epidemic
+methodological limitations
+IFN-γ
+528
+good efficacy
+capillary density
+Antifungal
+a similar phenotype
+TLS Pol kappa
+The basic reproduction number
+2.32
+mouse
+using patient identifiers
+levofloxacin
+IFN-I signaling
+how likely an individual changes its states at a step
+Reed-Muench method
+Thymic depletion and body weight loss
+mean + SEM
+DNA polymerase and RNase H
+data quality control and manual curation
+less than 10%
+GC13
+Vaccination against streptococcus pneumonia
+ICTV Committee
+Leon Cantas
+HP-PRRSV
+ALP, ANGL-NUB, and SAAN
+distinct gene signatures
+B. floridae Bfl-AGO2
+differential lectin-binding analysis
+12
+18
+system problems
+five months
+9.64 contacts per hour
+prognosis and survival
+CD3ζ-chain expression
+sorting occurs only when cargo molecules reach the TGN
+thirteen
+non-infectious causes
+9
+7
+E. coli BL21
+reagent and instrument specifications
+ActD
+growth
+1,081
+1%
+82
+VEEV
+inactive
+codon usage variation and nucleotide composition
+Middle East respiratory syndrome
+Network spreading processes
+ramified or activated states
+AMPK
+80:20
+rapid loss of cell function
+5 days
+Intrinsic host features
+renal tissue
+55%
+glucagon signaling
+59
+75%
+cartilage development and endochondral ossification
+3%
+whether it benefits a population
+alveolar macrophages
+2-4 days
+extracellular degradation
+spatial
+lower body and visceral adipose tissue weight
+mildly virulent selflimiting viral infections
+Italy
+lack of more detailed historical data
+8-12%
+reduction
+American
+Pulmonary surfactant
+Lipofectamine
+Viruses
+DNAMAN and DNASTAR
+0 to 71
+67
+30 and 22%
+internal loops
+Gene markers
+new growth
+spin filtration
+Germany
+Cu/Zn superoxide dismutase 1
+PromoCell
+endosomal acidification
+typhoid fever and Streptococcus pneumoniae
+rapidly changing guidance
+Carver College of Medicine Biosafety Level 3 Core Facility
+antiviral wastage
+Fever
+24 weeks
+differences in solvent accessibility
+Mantel-Cox log-rank test
+ecosystems
+strand synthesis
+ADAM17
+rhabdomyolysis
+Toll-or NOD-like receptors
+pre-existing immunity against adenovirus
+58
+three
+genus, species, and subspecies of priority zoonoses
+The epitopes
+HERV-K
+newly synthesized lipids and virus proteins
+DNA
+Cxcl1 and Ccl2
+Pichia pastoris
+0.63
+7.5, 8.2 and 8.0
+PCR target products
+hydrocortisone
+consistency in attribute measurement
+Mekelle
+16S rRNA gene
+variable subjective norm
+The chest radiograph
+four
+cytokine bead array
+Sequence alignment
+natural processes
+1/350
+the minimal distance found
+96% of the vesicle population
+clustering
+Tripartite motif family
+Soluble Barium salts poisoning
+Oleic and palmitic acids
+Five
+40%-90%
+four
+zero
+gaps
+G attachment protein and F fusion protein
+Liquid-liquid phase separation
+ATMPs
+simpler patient administration
+Cy5-dCTP
+World Reference Center for Emerging Viruses and Arboviruses
+GraphPad 5
+delivery
+through skin and respiratory mucosa
+verbal autopsy study
+Parasitology
+low and short-lived
+Aphid transmission
+Eastern cluster
+PTX3
+Cat L, Cat B, and Cat S
+type III L-lactic dehydrogenase
+pDCs
+NSDV/GV
+Rare copy number changes
+molecular assays
+activation of cell mobility and activation of actin cytoskeleton contraction
+health security
+Infection by the Sendai virus Cantell strain
+rop18
+LE/L membrane properties
+regenerative medicine
+to examine the activities of cell grown in tissue culture
+Global Outlier and Batch Effect Detection TMM-normalized LCPM
+spindle shaped
+Immunopurified Flag-RPB1 or GST-CTD
+An Assessment of Understanding
+cdh15
+hamsters
+expected
+pandemic
+100 μL pure DMSO
+equal to the product
+ion mapping
+red
+repeated structures of N-acetyllactosamine
+inflammasomes
+5-fluorouridylate
+good
+enzymatic and cytotoxic
+light microscope
+qualitative
+1.0 × 10 6 copies/mL
+size exclusion chromatography
+concomitant treatment
+host machinery
+identical extinction coefficients
+Cell death
+PI3K and PKC
+mass-spectrometry
+seaports
+CRP
+β-Actin
+malT
+standardized, molecular biology-based monitoring of large sample cohorts
+three
+1 mg ml -1 brefeldin A or 2 mM monensin
+>25%
+local transmission
+the termini of the MNV-1 genome
+between 414 nm and 496 nm
+supernatants
+DLS
+Gillespie-type
+plasma levels of 7.8-31.9 ng/ mL
+E2 glycoprotein and Capsid protein
+biological
+Dodie Bryce
+highly efficient cleavage
+norepinephrine
+An. gambiae mosquitoes
+Enzyme recognition
+Francisella tularensis
+inflammation
+3
+CTP synthase and ATP synthase beta subunit
+osteopenia
+1948
+37 • C
+87%
+phosphorylation of p-38MAPK
+injection of tunicamycin
+Standard enoxaparin dosing
+Empirical antimicrobial therapy
+91%
+LDPs
+62%
+purified or cell-free
+20
+Primer concentration and annealing temperatures
+clinical data
+intra-hepatic
+mock-infected
+97.6%
+recombinant adenovirus
+to maintain homoeostasis
+protein conformation
+daily
+IL-4 and IL-10
+apolar residue side-chains
+UBF
+more than 25
+arginase levels
+loss of infectivity
+a protein which has repeated ankyrin motifs
+culture
+12.8 AE 1.0 pN
+Luciferase kit
+Thirty-seven
+Water buffalo
+induction therapy
+vesicular stomatitis
+The apposition of the two membranes
+plasma
+Dujiangyan
+antiviral activity against HSV-1
+Access to food resources in clan territories
+shortages of ventilators
+45
+EBOV and VSV
+s 2 q
+micromolar
+diagnosis
+Additional file 1
+Detection of CHIKV antigen and viral RNA load
+12
+61 years
+inhibits
+An alternative structure
+a greedy algorithm
+toxic
+mutation rate and mutational tolerance
+cell-type specific antibodies
+the presence of neighbourhood hubs
+80-US210 nm
+a lookup table of exit tags
+serum cytokine concentrations
+Fluorescence imaging
+W2 algorithm
+immunofluorescence
+Asp151 and Glu228
+BD Biosciences
+evidence for divergence
+100
+58 ± 16 pN
+habitat heterogeneity
+HIV-1 gp120
+the PI
+quiescent
+N61A
+5%
+seven
+RNA viruses
+Table 2
+infection risk
+Atlas of Coiled Coils
+Cpb1 KO cells
+6 days
+72 h
+act at multiple points in the virus lifecycle
+acute hypoxemic respiratory failure
+Quantitative real-time PCR
+inhibited cell proliferation
+random hexamer oligonucleotides
+sequence redundancy
+genes that shape antibody diversity between species
+one-third
+160,742
+dengue viruses
+viruses with co-evolved glycoprotein pairs
+Root posterior probabilities
+glutamate toxicity
+preterm, severe postnatal respiratory infection, and maternal smoking
+Inhibition of IL-1b
+697
+genomic RNA
+64
+AMR
+conditional regulation of gene expression
+catalytically-dead versions of Xrn1p
+developing world communities with different population or healthcare characteristics
+isoliquiritigenin dimethylallyltransferase
+k
+HPeV
+fluorescence
+ISG induction
+p-JNK and p-p38
+bacteria, toxins and other macromolecules
+CV replication
+More than 100
+create a barrier to resistance
+Rcpp and RcppArmadillo
+according to different genetic models
+n
+mean and standard deviation
+1:160 and 1:640
+cough or fever
+genedeleted
+covariate
+plasma input functions
+rehydration therapy
+VAE, and VA-LRTI
+1:20
+13-18%
+attention-deficit-hyperactivity disorder
+General data
+The Health Belief Model
+E. Tabarés
+Virus titer
+48 hpi
+modifications in the E2 protein coding sequence were stably maintained
+less than 5 %
+0.39 g/d
+Four PERKspecific siRNAs
+group I
+arginine
+DogPicker
+.98%
+severe acute large bowel inflammatory disease
+3%
+luciferase activity
+titers calculated from our assay
+autocrine and paracrine
+3
+dysplastic lesions
+Plasmacytoid Dendritic Cell isolation kit II
+PPs
+P<0.05
+calculation of V −1
+Parity Rule 2
+ICAM1 high / CXCR1 low
+10 sec
+to Bax
+Ad proteins
+significant differences compared to control
+Influenza A/H7N9
+24 h
+1.6%
+inhibitory activity
+1918
+covalent intermediate
+KEM1 and SPA2
+Keratin
+opsonophagocytic
+28
+lectins-like receptors
+cholesterol
+SeV copy-back
+10 5.44 TCID 50 /mL
+dramatically reduced
+Actin polymerization
+Respiratory failure
+dopamine and norepinephrine
+IL-17 and IL-22
+F. tularensis LVS
+25%
+early surveillance and early diagnosis
+viral
+E. coli
+.10%
+innate immune pathways
+Diagnostic and typing
+133
+4-μm-thick sections of tissues
+Bradford assay
+Dr. Paul Rothman
+conspiracy theories
+expected log likelihood
+immunoprophylaxis
+138
+by ultrafiltration
+severe type 1 respiratory failure
+MNGC formation of macrophages
+Stain-Free
+Cry5B versus tunicamycin
+Col. Soltau
+815
+87
+C-reactive protein and procalcitonin
+SU-modified HSA
+adenoviruses or retroviruses 46
+DHE dye
+RNASET2
+35%
+a2,6-linked sialic acids
+165
+14/45
+Invasive Hia disease
+Immunofluorescence
+NCBI Gene Expression Omnibus
+-1.6 to +2.6 L/min
+unsufficient quantity and quality of the sample
+fluorescence polarization assay
+twelve weeks
+epistasis
+Kaposi's sarcoma associated herpesvirus
+Accreditation
+Intracellular trafficking of macropinosomes
+0.26
+Final individual per ferret values
+14
+validation criteria
+60
+viral load
+26
+becomes a constant scalar
+vDNA
+species-specific miRNAs
+Pneumonia and sepsis
+Aromatase
+Venn diagrams
+intracellular Ca 2+
+Denaturing PAGE assay
+Astroviruses
+5%
+therapeutic
+p38 MAPK and ERK1/2
+two
+Culture medium
+did not reverse this suppression trend
+9
+relative gene expression of the targeted genes
+Human case contact
+Expression of the target virus
+cc-by
+microscopic
+land-cover variables
+5%
+SLA-1*0401
+eight
+BD FCAP Array Software
+demographic and environmental covariates
+One hour
+NKV
+resistance to two antibiotics
+self-resolving acute UPEC infection
+Human IFNa
+five to six days
+MS² spectra
+sequential point predictions
+data from studies involving non-pregnant women
+50%
+regulates the expression of Fgl2
+99.96%
+cluster analysis
+PF-429242
+Anti-Ebola NAB
+p75NTR
+EPX-mAb based
+CD14, CD1D, and CD163
+Seventeen
+five groups
+Micrococcus Luteus
+14 amino acids
+intervention levels
+essentially the same risk estimates
+PBS
+high-avidity
+probabilities
+pUC57-p72 plasmid
+job conditions
+mean ± SD
+Revised taxonomy box
+subjects
+223.6 mg/dL
+field level diagnosis
+Membrane fusion
+CD55, CAR, and CD81
+2016-09-21
+changes
+Flanking sequences
+Inhaled administration of the peptide
+five
+EAV sg RNA synthesis
+ATCC
+Bisphosphonate-related ONJ
+glutinoic acid dilactone
+maleoyl-diamide 15
+mice
+167
+ERGIC-53
+rhabdomyolysis and acute kidney injury
+sitting-drop vapor diffusion method
+type 2 AEC
+macroecological host traits
+monkey kidney
+correlation coefficients and linear regression
+at least three
+effective management
+chisquare test
+SPSS 15.0
+18
+39
+99
+mechanical
+intraoral ulcerations with or without labial involvement
+11
+23%
+Se and selenoprotein function
+UV-visible
+the sponsor
+hypertension
+ten
+SMO and Gli1
+any amino acid
+a rapid increase
+antigen specific
+the DBD and IAD
+Statistical Package for Social Science version 20
+dysregulate host cell proteins
+AF2-helix
+A/ California/7/2009
+Project MTM2014-58091-P
+4a-j, 4l-n and 7a-e
+S pneumonia and Haemophilus influenza
+the balance of de-and remyelination
+deviations
+free days
+14 days
+Independent sample t test or one-way analysis of variance
+GenBank
+unchanged
+spatial heterogeneity
+how pedestrians are defined
+rhesus macaque genome scaffold Mmul_051212
+mean percentage of four independent experiments
+eight influenza transmission parameters
+RNA
+aging-related decline in cognition and neurodegeneration
+monoclonal
+Tumor necrosis factor alpha converting enzyme
+NPL-PEDV/2013
+Impaired p38 MAPK/AP-1 signaling
+72 h
+InfinityTM Cholesterol Liquid Stable Reagent
+activation of host DNA synthesis
+IRE1
+4-20%
+90%
+living cells
+288
+two-thirds
+minor discrepancies
+IntraHealth International
+virulent NDV
+IAV, RSV and HRV
+infectious disease
+strict ethical approval and monitoring
+DMSO
+CARNAC, Tfold and hxmatch
+adenovirus
+serum inflammatory
+95%
+polyadenylation
+socio-cultural
+1 h
+33
+anti-vector immune responses
+27%
+insect cells
+94:30%
+LNPs
+Five
+seven
+Jingxin Cao
+between the 32 nd and 20 th epidemiological weeks
+non-targeted lipidomics
+Serion ELISA classic M. pneumoniae kits
+15.0
+clinicians and record-keepers
+mPK-SL
+t-test
+HRP Color Development Reagent
+increased adiposity
+phylogenetic node
+context-dependent
+the predominant circulating strain
+activation of the IFNb promoter
+177
+the recommendations of the 1975 Declaration of Helsinki
+spinal cord parenchyma
+EndoFree Plasmid Mega Kit
+retention within cytoplasmic vesicles
+publics from danger
+reservoir of influenza virus
+cellular quality control function
+Vaccination
+10 1.5 -10 6.0 TCID 50 /mL
+physiological
+Peduncular
+18 weeks
+3
+dramatically reduces the levels of PA excreted into the environment
+0.67
+Laboratory biosafety
+Pierce Chromatin Prep Module
+five
+Viral RNA
+N-protein
+deep sequencing
+James Hilton
+bacterial expression system
+CON-PEDV
+fragmentary
+reporting bias
+VSV
+indepth
+cell debris
+3
+the highest number of people showing symptoms due to the pandemic virus infection
+cross-linked recombinant gp120
+benefit
+517
+threefold
+most of the respondents were prepared for the Zika outbreak
+Sweden
+Invitrogen
+25μg/well
+Cluster Resource's MOAB
+one
+Source data
+the corresponding standard derivation
+more hospitalizations and greater use of antibiotics
+30 days
+The number of participants experiencing DLTs
+10 and 15 days
+post-translational modification
+antiviral Group A
+Plots of the estimated means for trajectory solutions
+metatranscriptomic analyses of secondary lymphoid organs
+Two weeks
+poor
+66
+ten
+3 h
+explicit criteria
+12
+codon level information
+we were unable to extract all subgroup data from these trials
+TiO 2
+two years or more
+1%
+Felsenstein's peeling algorithm
+Influenza A nucleoprotein
+Unigene 32070 with 2182 bp in length
+HADDOCK v2.1
+seven
+at least twice
+over the course of a year
+Recombination
+Hwacheon
+Concentrations
+92%
+Untreated cells
+Angiogenesis
+antiretroviral activity
+30%-65%
+DuPV-2
+suppressed
+volume state therapy
+higher compliance to preventive practices
+genomic information
+whole-genome-based
+fold change from pre-vaccination
+aggressive and violent
+two
+bta-miR-455-3p
+G3BP1
+deep sequencing of RNA
+Ten
+Alpine goats
+TLS55
+fragilis
+Log drop 1
+nuclear pSmad1/5/8
+49
+an animal model
+losartan and pirfenidone
+PiCV
+Cryptococcal antigen
+DPGs
+23
+SYBR Premix Ex Taq TM Kit
+spo0F allele
+structural vaccinology
+pharmaceutical profiles
+2008
+cc-by
+logarithmically
+binding site comparison
+9
+losing their hydrogen bonds
+twice a day
+emotional exhaustion and burnout
+300
+TMB Substrate Set
+Adaption mutations in viral proteins
+elastic
+3
+a triage protocol for critical care
+Clarified supernatant
+salt bridges
+broad-spectrum
+between 2014 and 2015
+KPN_00 363
+the difference between the bottleneck inference of the optimal model and the baseline expectation
+cell surface expression of two adhesion molecules
+recruitment maneuvers and inhaled nitric oxide
+102
+HIV Tat protein
+119
+10%
+80
+Four
+Estimates of years lost due to disability
+RANTES and TRAIL
+40
+more than 1 peak in a year
+IsoMIF
+seven
+vertebrates and plants
+RIG-1
+alcohols, aldehydes, iodine, phenols, and chlorine
+intravenous insulin therapy
+IFIT1
+prophylactic
+conditioned media from cultured cells
+12, 33, 90 and 91
+16,000
+microtubules
+16
+purity and selectivity
+68%
+L. interrogans Copenhageni
+myelomonocytic cells
+USA Centers for Disease Control and Prevention
+performed the statistical analyses
+identification of target genes linked to a given locus
+EV71, influenza A virus and HSV-1
+TreeAnnotator
+archival samples were used
+independent
+metaanalysis
+91.5%
+35%
+23
+10.1042/bsr20182028
+StemFect RNA transfection kit
+Three
+Viral vectors
+Empirical evidence for unifying principles in biology
+root mean square error
+quantitative labelfree
+63%
+cytotoxicity
+Combination therapy
+surface-based molecular similarity method
+Macrolide resistance genes
+keeping cats in groups of ≥5 cats/group
+30%
+simplified techniques
+Eight
+formic anion
+cc-by
+BPD
+epochal evolution
+dental caries
+HTS
+American Association for Accreditation of Laboratory Animal Care
+nonantibiotic drugs
+four
+knock-out
+OVA/OVA/BAIC mice
+immunosuppressive
+patients with probable CIPNM
+WT gB
+wildtype mice
+GitHub
+ORF1 and ORF2
+gene sequence truncation
+Three
+The collection of data on perceptions associated with precautionary behaviors
+full tryptic specificity
+Susan Sontag
+M1 polarized microglia
+OD percentage of maximal binding
+CD41 and CD81 T cells
+RNA granule
+reduced
+demyelinization nodi
+whether viruses in general
+Epigentek protocol
+320
+Snail
+nine
+absolute vaccine efficacy
+one out of 1,790
+32
+A plasmid for DI-244 rescue
+viral replication
+more severe
+Diabetes mellitus
+multiple replicates and/or site-directed mutagenesis
+ZyMax TM streptavidin alkaline phosphatase conjugate
+70%
+ribonuclease inhibitor
+Microscopic
+antibodies against the virus
+mitogenic stimulation and cellular proliferation
+tailor-made model
+Quantitative
+logistic equation
+glycoprotein lactoferrin
+Five
+E i
+replacement therapy
+m E k
+phosphorylation, dimerization, and translocation into the nucleus
+infections, AGN, obstetric causes and nephrotoxins
+Data from 3 biological replicate experiments
+TBFVs
+SIRS
+regulator of pulmonary surfactant lipid levels
+urbanicity
+EBV integration positions
+whole antigen prepared from infected cell lysate
+University Hospital Medical Information Network Clinical Trial Registry
+Glutathione
+87%
+Exophiala
+more participants, particularly young adults, and newly diagnosed persons
+cardiac involvement
+rotary evaporator
+Hanyin
+2
+EGF
+Six
+Articles
+lack of cell specificity
+Identification of and targeting viral important components
+The funders
+neighborhood properties
+human rotavirus proliferation
+increased neutralization to infectious H5N1
+Pse-in-One
+1000 fg L. monocytogenes DNA template
+cc-by
+T low
+h ε
+The need to identify and address corruption and weak governance
+environmental and/or socio-economic variables
+Ethical review and approval
+ELISA
+recent advances in public health data collection
+assembling the cough measurement system and conducting the experiments
+five
+MAS3.0
+population social structure
+Total nucleic acid
+RNA-seq
+4
+protease inhibitor
+Cryptococcus yeast cells
+60 ms
+cell fusing agent virus
+males
+three
+eIF4E
+passive transfer of IgG
+QTL
+Kaplan-Meier method
+SAON-CD
+Sensitivity
+Cleared lysates with adjusted protein concentration
+nisin
+rate preferential mixing
+Mexican mestizos
+328
+YIP3
+1-adamantanamine hydrochloride
+Montreal Children Hospital Foundation
+UKR ECMO database
+under 500
+cytometric bead array technique
+NKp46, DX5 and CD43
+alphabetic
+HA alanine mutants
+Six-week
+withaferin
+by annotating the protein domain interacting with the respective motif
+TRAPPC6A
+clinical sample
+long repeat domain
+properties of individual amino acid residues and pairs of residues
+RNeasy Lipid Tissue Mini Kit
+100 μL 0.2 mol · L −1 H 2 SO 4
+library preparation
+Two weeks
+strain or subtype identification
+increased contact between people and distribution of pathogens in floodwater
+S11 and S6
+immunofluorescence
+Accurate assignment of primary infections
+reductions in ECMO flow
+95%
+nonspecific
+Four
+Genie III Instrument
+z-value calculations
+2% isofluorane
+acute fever stage
+Figure S1
+14
+2017
+severe acute respiratory syndrome
+five
+insights into the impact and efficacy of the DREAMS suite of prevention interventions
+once a week
+Bliss independence drug interaction model
+clinical signs
+56
+recurrent hepatitis
+SGs
+Rabensburg virus and Krasnodar virus
+6
+The bands containing the human 60S and 40S ribosomal subunits
+interfacial free energies
+2.38
+m
+reference sequence
+DRC, Malawi, and Uganda
+identified similarities
+eight
+pifithrin-a
+ICU admission criteria
+4%
+T helper cells
+Mwaiwathu
+NMR
+Blood
+human immunodeficiency virus-1
+Anti-angiogenesis therapy
+Sar1, Sec23, Sec24, Sec13 and Sec31
+Evolutionary ranking of genomic positions
+B2M and CA2
+bead beater
+to promote efficient internalization
+MirTarget2
+immobilized pH gradient strips
+20.9%
+Metadata management
+plasmatic protease factor D
+Fig. S1
+CEACAM1
+GAPDH, -TUB, and CypA
+the transition of the system from endemic to a disease-free state
+Frequent meetings between different service sites
+DENV-1
+TSEN54 variants
+SAMD9
+a convolutional layer
+Hamster tetherin
+marginal zone B cells
+Risk assessment
+nutrient-rich
+Non-acute events
+Viral richness heatmap
+volunteers
+50%
+subgraph centrality
+H2
+PseAAC
+Two
+Mathematical modeling techniques
+two
+Two weeks
+CD30
+MnmEG
+HCV 1b
+20
+11,323
+0.12-10 mM
+K
+VRC-FLUDNA057-00-VP
+Firmicutes and Bacteriodetes
+PHAX
+DCs
+1×10 −2
+putting the entire record together in chronological order would have been hopelessly confusing
+Four
+state sovereignty
+Pulmonary alveolar proteinosis
+Felis catus
+48 h
+VCR with higher antitumor effects
+nasal virus shedding
+borate buffer
+to check their stabilities under physiological stressful conditions
+Sequential testing
+1
+Africa
+N
+inflamed tissues
+L
+Actin
+Monthly mean near-surface air temperatures
+syndromic surveillance
+total RNA
+22%
+flow cytometry
+24 hrs postinfection
+Densoviruses
+Société de Réanimation de Langue Française
+informative priors
+supernatant
+protective
+RNA genomes
+BA and ER networks
+working and/or studying
+Neutralization
+pleiotropic
+sequence of the tails and the inter-domain linkers
+NaOH-NALC processing
+endocytic vacuoles
+stable STAT5bER pos memory B cell clones
+similar
+when more detailed data is available
+pathogenic infections to allergies and cancer
+P-site
+Short Tandem Repeat analysis
+reduced sensitivity
+a discrete region of the viral genome
+High levels of ZIKV RNA
+TRIzol reagent
+social distancing
+CAV1
+PaO 2 /FiO 2
+cELISA
+vector copies/spleen
+contact between two nodes
+25.55
+mfold
+six
+104
+penetratin
+84%
+accurate propagation of parameter uncertainty
+Factors predicting in-ICU mortality
+five
+AgPath-ID™ one-step RT-PCR reagents
+universal vaccination acted as a protection by creating an immune barrier
+PRISM software
+evaluation
+1 million
+Source data
+Degree
+a nuclear targeted LacZ reporter
+Metabolism
+BMI ≥ 30
+ROR1 and/or LMO3
+one
+overall reduction of B cells
+pyrimidine-rich
+N-linked deglycosylation
+Ubc
+the ventilator
+Bottleneck inference
+Frozen stocks
+MSC target homing to injured lung tissue
+AMCase2/2 mice
+Yields of the symptom consultation and CXRAY
+antibiotic regimens
+dendritic cell populations
+burden
+ubiquitination and degradation and dephosphorylation
+Mycobacterium tuberculosis
+mannosebinding lectin
+35
+2005
+each original variable's contribution
+Bérbérati
+Free ISG15
+mechanistically address this issue
+enhanced scientific understanding
+KCl or LiCl
+apoptosis pathways
+VH polymorphism
+strand displacement amplification
+rabies
+12 h
+humoral
+efflux activity of ABC transporters
+five
+hippocampus
+54
+late liver stage development
+10
+Imperial College
+RABV phosphoprotein P
+pericardial effusion or myocarditis
+DMSO
+Omniscript Reverse Transcription kit
+intradermal
+pcDNA3.1 and pEGFP-C3
+ZIKV
+Poly I:C
+δ ns
+1.3%
+antibody activity against human rotavirus
+English
+NO
+cell monolayers
+apicomplexans and ciliates
+an ancestral sequence
+560 IU/ml
+TranAlign
+western blot analysis
+48 h
+CrebA
+Demographic characteristics and pre-operation test data
+misfolding, unfolding, and functional inactivation
+low-molecularweight PEI
+FSC-H
+high seroprevalence places with larger sample sizes
+random contacts
+Hypogammaglobulinemia
+how to overcome infectious diseases caused by viruses
+4 weeks
+spoVG
+adverse outcomes such as ARDS and death
+Between 10 and 80 percent
+species jumps
+a more naïve population
+1 to m
+UCH L1 and UCH L3 inhibitors
+Redundant items
+The Battle Against
+Forsythia seeds
+1997
+infected
+western blot and again on the protein microarray
+5,852
+48 h
+supplemental oxygen-free days
+polynucleic acids
+Violence
+test set
+60 to 80 kDa
+50-fold
+western blot analysis
+IPTG
+increase the Cmax as well as the Cp in the first hour
+p B m
+most of the Gag-Pol
+PAMPs
+DDI-CPI
+7 days and for 14 days
+RNA viruses
+myocarditis and acute respiratory distress syndrome
+Apoptotic cell and erythrocyte contamination
+p53, p63, and p73
+Numerous organisms consistent with Leishmania species amastigotes
+Small interfering RNA
+1918
+LASV and ML29
+2004
+public health systems or specific legislative frameworks
+five
+9 days
+PCV3
+transgene expression
+experimentation
+keratinocytes
+a face shield
+nine months
+dashed light green line
+5 µg
+13 days
+19
+Adding new birds to cages already holding birds
+demographic and poultry exposure data
+skin samples
+epithelial barrier
+Stata/IC 10.0
+P i1t
+20
+essential
+proteolytic activity
+miRNAs
+20
+oligonucleotide primers
+T cellmediated cytotoxicity and death receptor signaling
+Biosafety laboratory 3
+RNA sequencing and ribosome profiling
+tRNA
+week 8
+flexibility
+Acquisition of HS binding
+Immunization with DNA
+AD
+Quik-Change mutagenesis
+Eighteen hr
+16
+specificity and sensitivity
+an active Ire1 nuclease domain
+De novo lipogenesis
+economic level and classification of the hospital
+blood-pressureregulating system
+7 days
+881.83 seconds
+H3N8
+a list of taxa with at least one Unclassified rank would be shown
+PRRSV
+Overzealous or non-resolving inflammatory responses
+individuals entering the infectious environment
+ER membranes
+twelve hours
+5 min
+1993
+Clonal malignant T cells
+trauma
+antiviral
+microarray and sequencing approaches
+VP5
+different mechanisms
+around half
+MRI
+χ 2 test
+almost 3 weeks
+Clostridioides difficile
+PPMOs
+Duck papillomavirus-3
+exchange flexibility
+DNA hybridization arrays
+Ginseng
+Longitudinal research
+four
+increased TNF-␣ and CCL5/RANTES
+microbially generated magnetite
+rifampicin and teicoplanin
+five
+1,560
+40
+lack of O-antigen
+mice
+Six weeks
+mice and cynomolgus macaques
+Hazard ratios
+definition, reported incidence rates and management recommendations
+SPDEF
+WT RdRp
+cleavage activation
+60 min
+a well-seasoned field scientist
+CGU
+Motif 2
+FBXO3
+sphingosine accumulation
+a control group
+The Na/K-ATPase signaling cascade
+1:1
+three
+CV-B5
+broad amplification of the host innate immune response
+microtubules
+command
+66.6%
+20
+higher total outbreak sizes
+transcription factors and signaling pathways
+assay
+typical dengue fever symptoms
+1980
+cage-like DNA structures
+CFH
+Section 3
+reversed associated pulmonary oxidative stress and lung inflammation
+62%
+autofluorescence is much lower than in Vero cells
+Italy
+probe-based real-time PCR and SYBR Greenbased PCR
+physiological function
+Alnylam
+0
+viral titer
+inside the 59 UTR
+EBVpositive
+data from randomized controlled trials
+3-4 days
+three
+41/137
+threequarters
+RNA-RNA recombination
+Blood samples
+COOT
+6
+the need for a separate elution step
+post-transcriptional gene regulation
+rDolphin
+Accurate identification of new antifreeze proteins
+5.3%
+50 min
+À1 RF
+hematomas
+Figure S8
+Total serum protein concentration
+DOX/GL-ALG NGPs
+villitis
+whom they shared a meal with
+nuclear export of all cellular mRNAs
+4
+Sterile phosphate-buffered saline
+heat-related illness
+self-sustained outbreaks in other countries
+Student's t-test
+orange and green
+GM-CSF overexpression
+pack years
+VSIV G
+cysteine proteases
+Statistical
+microscopy
+SPSS
+enhanced virulence
+better prognosis and chemosensitivity to sorafenib
+no conflicts of interest
+98%
+circulating granulocytes
+Syncytium formation
+381
+Natural Science Foundation of Jiangxi Province of China
+1918
+GraphPad Prism 5.0d
+Sephacryl S-200 resin
+six times per week
+phosphorylation
+sneezing, nasal discharge, and ruffled feathers
+inertial microfluidic system
+LT
+hydroperoxide
+infect cells
+cough, tachypnea and exercise intolerance
+HI metrics
+differences in time zones
+experimental
+Wnt signalling
+public health work
+4 °C
+200
+Shape and Spicoli
+0.01
+at the cell surface
+Studies reporting distribution of data only as ranges
+18 h
+low tidal volume therapy
+UAC
+5%
+capillary flow or filtration
+216
+enhancers
+93
+general composition
+wildlife
+5 days
+48
+R *
+vector control
+20
+higher number of B cells
+2494
+The error of each parameter
+Pathogenicity
+KT247592-KT247609
+20
+lymph tissue
+specific
+Bayesian Tip-association Significance
+two
+scl
+Forecasts
+Viable influenza A
+25
+0.45 μm
+viruses grown in H5 HA-transduced producer cells
+every 20 ps
+520
+Arrow
+challenge infection with a closely-related A virus
+Institutional Animal Care and Use Committee of the Centers for Disease Control and Prevention
+SuperSignal West Pico Chemiluminescent Substrate
+oxidative stress
+Partnering
+adaptive accessibility
+μ cell
+2.76
+−80 C
+PR8
+interactive
+CEACAM1
+endogenous
+RA-induced neuronal differentiation of P19 cells
+additional relevant articles
+significantly suppressed
+22.6%
+ELISA, virus microneutralization and ELISpot
+100
+a human viral diagnostic tool
+IFN-c expression
+4E11 anti-E monoclonal antibody
+Equation
+vegetative tissues in mature plants lost their ability to form callus
+384
+Unblinding a patient's treatment allocation
+apoptosis
+71
+a signaling cascade producing multiple biological active intermediates
+Bone marrow transplant
+VSVDG/LASVGP
+Mechanical ventilation
+Total nucleic acid
+virus-induced cell killing
+stochastic extinction
+19
+Behavioural
+tropical
+10 min
+antiviral
+Antibiotic susceptibilities
+up to eight
+Institutional Animal Care and Use Committee
+self-reported complications during the gestation period
+HIV, RSV, and autoimmune diseases
+a single 2A autocleavage site
+confocal
+ESCRT scission machinery
+binds
+to find nodes that connect to multiple communities
+kinetic tests on reporter cleavage
+52 kDa
+6 hr
+the patient's legal guardian
+6 × His-tag
+HRV-C
+mTOR
+propidium iodide
+24 h post-transfection lysates
+respiratory protection
+sampling recruitment will be ceased
+ifnlr1 cDNA
+leaf disks
+our alignment model
+immune signalling pathways
+Tulathromycin
+Fig
+0.5%
+RNA interference
+serine threonine
+Student's t test
+1 hr
+2
+ADV replication
+EBOV and VSV
+ZBP1
+Chronic kidney disease
+twelve
+medical-legal
+B-cell expansion
+141
+IFN antagonists
+cell type
+16 days
+Classical ecology
+the role of human mobility
+31
+low
+MATLAB
+SLAC
+2006
+Ensembl Biomart tool
+cysteine-glutathione disulfide
+worse
+24
+BALF cellularity
+PCR products
+43:1
+monomers
+non-labile
+type and polarity of the genomic nucleic acid
+two metagenomics tools
+97.83%
+Underground spaces
+partially RNase and protease insensitive
+cachexia
+Palmitic acid
+USP11
+binding to CAP256 UCA Ab
+IL-6
+EBV
+different effectiveness, associated costs, payoff structures and time scales
+Thirteen
+Sixteen
+obesity
+Programmed ribosomal frameshifting
+mutation
+influenza-specific CD8 + T-cells
+Thermo Scientific HyClone
+muscle protein metabolism
+H4N6 and H6N2
+nine
+Bangladesh
+Electrical impedance tomography
+potential natural or plant products
+Usp44 null mice
+VACV and HCMV
+negativity
+Quick-ligation kit
+41
+sensory nerve dysfunction, Friedreich's ataxia and Alzheimer's disease
+aphid species
+Chest
+type III IFNs
+T cell polarization
+data on ILI
+family and friends
+acute CHIKV infection
+Computational methods
+exposes its membrane lytic protein
+intraepithelial DCs
+two
+Africa
+internal ribosomal entry sites
+a perfect correlation
+232
+REMD simulations
+Frozen hydrated virus
+Four
+spleen and liver
+ubiquitination of proteins
+millimetres
+Coronary artery lesions
+DM
+bacteria
+a clinical algorithm
+productive infection
+75%
+Ingenuity IPA
+inducing Th1biased cellular responses
+C, C++, Java, and Matlab
+cytosolic components
+three
+47
+2009-12-17
+drug discovery
+unsaturated fatty acids
+gyrase
+2%
+intrinsic connectedness
+Enteric and respiratory diseases
+First strand cDNA
+aberrant
+segmented individuals
+3 days
+mitochondrial dysfunctions
+macaques
+coupled models
+1 week
+Linearized DNA
+the script used to calculate weighted averages of multiple effect sizes
+microRNAs
+ceftobiprole
+NaCl and 6% polyethylene glycol
+chemical synthesis
+alpha-omega complementation
+level of infection and wing hyphae score
+H1N1
+22.75%
+Gag-Pol polyprotein
+F10-like IgG titers
+19
+11
+163
+GPS Explorer 3.5
+Southbound voyages
+English and Chinese
+biacore data
+Sufficient information
+Nishiura, Hiroshi
+liver
+bicinchoninic acid -based protein assay
+restriction of virion release
+Galectin-3
+450 mT/m
+Jamaican fruit bats
+housekeeping genes
+Predictive
+regulating this synergistic induction
+viral loads
+hamsters
+slightly skewed
+White arrows
+7% to 30%
+10
+541
+1.15 days
+more than half
+fever, myalgia and headache
+G120A substitution
+39
+1881
+mutation of three codons under purifying selection
+RIG-I signaling
+High replication efficiency, broad tissue tropism and systemic replication
+Human mobility
+lactate dehydrogenase
+hemagglutinin and neuraminidase
+planning mitigation strategies for future pandemics
+472 nucleotides
+to provide comparable datasets and access rules to share data
+483
+autophagy and apoptosis
+500
+they will rush them to the hospital
+increased surveillance
+Eastern Cape
+A RNA structure
+Method 2
+PRINCE
+CM doctors
+viruses circulating in the Yangtze River Delta region
+GAPDH mRNA
+more complex conditions existed
+the number of sequences that contained a given predicted TM segment
+variably
+a functional inhibition of IFN-induced STAT activation and gene expression
+polyclonal goat antibody
+240.4 pg/mL
+normal
+R61A
+increased levels of collagen
+>90%
+rVV-N25 immunization
+specific culture inserts
+NOF Co.
+other relevant specimen types
+Porcine epidemic diarrhea virus
+30: 1
+13%
+twice a week
+Mon, Di, Ba and Fun clades
+human phenotypes
+Amentoflavone
+proteasome inhibition
+two
+to report the amount of RCA product fluorescently
+10%
+zero
+lack of awareness
+V x : V y
+2 weeks
+decrease antimicrobial prescribing and improve patient and pet owner satisfaction
+pBB-LEH
+chemokine and migration receptors
+replication
+Six
+correlation analysis
+12-month
+60 minutes
+Respiratory Syncytial Virus
+reduce levels of LDL-cholesterol and improve the inflammatory changes
+SAA and haptoglobin
+differential transition state energy barriers
+Pneumonia
+60 kDa
+antigen-specific T cell, B cell, and antibody responses
+DFMO
+40 min
+epidemiological
+Theoretical and experimental techniques
+β-actin
+loss of a repeat
+loops
+Clinical research associates
+numbers and percentages
+multiple
+NO synthase 54
+virus replication
+twice
+moderate
+IFIT-1 mRNA expression
+High minute ventilation
+immunogen-specific IgG
+to minimize de novo lipogenesis
+HPV, HSV and HIV
+Gene Set Enrichment Analysis
+14 dpi
+Erythrocyte invasion
+300 mL
+Student's t test
+natural reassortment
+Organ transplantation
+Begomovirus mutant spectra heterogeneity
+Human rhinoviruses
+leukocytes and edema-related protein
+Two 20 ml aliquots of PBS
+lipid-lowering statins, antibiotics, and anti-cancer drugs
+proinflammatory
+Spain
+Q
+nuclear localization
+<2 W
+nuclear matrix proteins
+Five
+good performances
+clathrin-dynamin endocytosis
+fever, diarrhea, and flu-like disease
+All the data obtained
+atomic bomb
+reducing gene flow at the level of the compatibility filter
+whole bacteria
+95%
+network visualisation of gene-metabolites relationships
+52
+genes up-regulated in infected larvae
+to maintain lymphoid homeostasis
+CaCl 2
+NOS-1
+their assembly
+barrier function
+orthologous
+Orthomyxoviridae
+SVQYH-PLA
+mathematical modeling
+transparent melting glue
+heterologous viral vectors and/or unrealistic dosing regimes
+simple models
+443
+53%
+bivalent vaccine antigen
+MHV-68
+influences HN's dimerization and its activation of F
+7.0 per 100 PY
+6h post-infection
+hippocampal abnormalities
+clusters of individuals with extreme TNF-a protein expression
+Penicillium purpurogenum Li-3
+no or weak external selection pressure
+10%
+age
+discrete syncytia
+randomly partitioning the alignment into equal sized subsamples
+T-001 and T-016
+accuracy of physicians' decisions
+long-lived antibody and memory T cell responses
+pSmad3
+large-scale protein production and antibody screening
+venovenous and venoarterial
+e ijk
+Select patient and standard DBS-RNA
+Renin-angiotensin
+5 min
+G
+IRs to drugs
+the positivity
+cell-selective pathogenesis
+mitigating the influence of the influenza virus
+long incubation period
+A/H1N1pdm09
+Age
+12
+72°C
+human factors
+Traumatic SCI
+clinical disease and macrophage infiltration
+T3SA+
+107
+Hospitalization
+PB1 and PB2
+entry border points
+PaBV-4
+a list of the most similar sequences stored in the DB
+clinical treatment
+5-10 min
+HMGB1-induced TLR4 signaling
+controls
+The stent wire
+intestinal mucosa
+infecting plants
+five
+15.8%
+external validity of previous findings
+type I IFN signaling
+inflammatory
+directly inactivate HSV-1 particles
+diagnosed patients with infectious diseases
+Health Commission of the People’s Republic of China
+Ventilator-associated pneumonia
+intact
+nonimmunocompromised
+676 amino acids long
+DisCVR
+high numbers of vaccines
+contact tracing
+ROS and iNOS
+The elderly, young children, pregnant women, and those with underlying medical conditions
+activity change comparison plots
+inhibition of viral RNA-dependent RNA
+non-enveloped, positive and single-stranded RNA viruses
+cyclin A protein expression
+increasing land-use, urbanization and climate change
+reverse genetics method
+JAK-STAT
+NMDA receptors
+The effect of a delay in each tracing step
+dependencies between opposite loops and stems
+Aldosterone
+healthy donors do not produce spontaneous sputum
+two
+Georeferenced environmental data
+Sixty six
+CC genomes
+Ad-infected mice
+390,650
+serious ARI
+infectious cDNA clones
+Borna disease virus
+13,321
+cell proliferation
+nine
+contact network models
+a node pair
+nanS
+Logistic regression modeling
+organic molecules
+ECO
+Ded1p
+one third
+anchoring the progeny virions to the cell
+Fourier decomposition theorem
+Lightning-Link HRP Conjugation Kit
+tobacco smoking
+7 cases per 100,000 individuals
+transcriptional
+eight
+99%
+illness
+differences in fluorescent intensity
+vectors containing His-tag or GST-tag
+30
+rheumatoid arthritis, amyloid dementia and cancer
+Clostridium botulinum
+platelet-derived growth factor α
+cAR1
+FACS
+inflammatory cells
+Eurosurveillance
+460 nm
+Canine parvovirus enteritis
+nonparametric
+destruction of ecological integrity
+Eighteen
+antirenalase monoclonal antibodies
+IMT
+oral
+intronless
+a bacteriophage
+Gentra Puregene Kit
+Huangshan
+5 weeks
+Virus infection
+wells of a chamber slide
+antibiotic therapy
+insect and bat behavioural ecology
+skin lesions
+enteric
+new therapeutic targets for neurodegenerative diseases
+immunofluorescence staining
+Several pathogens
+Guanidine
+every second day
+Clone Manager Professional v 9.3
+bleach
+endogenous naïve and activated CD8 + T cells
+coloric method of Kean
+RepeatMasker
+three
+HeLa
+10%
+translocates to the plasma membrane
+prevention of HIV infection
+Apaf1 IRES
+Tlr22
+several outbreaks
+destroy
+MELD-Na
+293T cells
+twice
+CHOP-induced apoptosis
+Thirty-five
+MEK1 and MEK2
+54.5-83.3%
+6770
+Vamp2
+three
+natural vertical transmission
+30
+two
+inflammatory cellular responses
+pollution
+Gut
+information on bacterial species/ strains, antibiotic resistance, or nonbacterial pathogens
+5%
+PfEBA-140
+NTMIs
+Henrietta Isabella Thurburn
+levels of inflammatory cytokines
+violence
+their behaviour
+IFN stimulation
+analytical
+two
+a regulator of complement cascade
+tuberculosis and meningococcal disease
+sodium ingestion
+increased expression of Hsp70
+phylogenetic
+213
+health concerns
+Bacteriocins
+rhinovirus
+HLA-A*02:01
+electric field gradient
+Induces focal adhesion
+respiratory illness surveillance
+amino acid differences at the receptor binding site
+1-34 g/mL
+huge amounts of enzyme secreted
+The proper selection of important interacting residues
+Potyviridae
+Illegal gutter oils
+Prof Deborah J. Lenschow
+proteasome α-4
+pneumonia
+1,677
+lack of dystrophin protein
+87.41-94.50%
+10 min at 72 C
+neutrophils
+reduced response to drug and motor complications
+14.4 days
+less than 10%
+malachite green aptamer
+worm counts
+aerosols
+TPM
+Tick-borne encephalitis virus
+X-bridge Amide column
+baroreceptors
+48h
+higher antibody levels
+20%
+dendritic cells
+truncated power law
+four
+seasonality
+CellC software
+Norway
+nsP2 and nsP4
+identification of new therapeutic targets
+Inflammasome activation
+broad-spectrum antibiotics plus voriconazole
+8
+linearity and sensitivity
+1
+decrease
+resilience training, contemplative practices, and peer support
+4
+eIF4E
+Figure 9
+Over 2,500
+structural
+advanced cirrhosis
+Nine
+Pam 2 Cys
+83%
+50 mm
+T7-DVG 546
+necrotic-ulcerative
+pulmonary exudation and consolidation regions
+2010
+elimination, equilibrium, and escape
+Empty vector transfection samples
+large-scale sequence analysis
+ACE2
+phosphonoacetic acid
+CXCL6
+day 8 post-infection
+dose response kinetics
+real-life epidemic investigations
+it can search for terms
+geometric mean antibody titers
+Specimens for histopathologic examination
+at or near the start of the repeats
+DQ485230
+BD FACS Aria III
+Tulathromycin
+5%
+1.5 g every 8 hours
+caspase-8 cleavage site prediction
+3 days
+after adjustment on the type of positive antibody
+52
+potential toxicities
+ImageJ 1.41
+older individuals and sometimes the very young
+F1-V protein
+2-year
+Short interfering dsRNAs
+foreign glycoproteins
+88.9%
+average and standard deviations
+Grafit 3.0-Grafit 5.0
+March 20, 2020
+36 weeks gestation
+RNaseL
+Malachite green-based assay
+endothelial cell tube formation
+Solid black line
+proteasome activity
+bacterial and viral infections
+the start of the 59 arm of stem 29
+Physiological scores
+overexpression of human PKR
+n i
+commonly observed traits in cardiac and renal pathologies
+host cell amino acids
+Imbalance
+53%
+one-way analysis of variance
+fission yeast
+Akira Ishihama
+5.65%
+the existence or absence of a social dilemma
+1 mM azide
+Sarcoplasmic reticulum
+active endosomal acidification
+Dual-Luciferase Reporter Assay System
+coronary artery lesions formation
+fold-C ave
+structured
+Lyon, France
+12-24 hr
+viral RNA synthesis
+White-tailed deer
+deterministic center manifold theory
+Xpert assay
+4 hours
+1%
+statistical method
+Ceftriaxone and clotrimazole
+supplemented brain heart infusion broth
+C-strain Riems
+Seven
+AorTech International
+Parsonnet Lab
+following inhibition of complex III
+Caspase
+observed data and R 0 inference
+basic processes essential to the virus life cycle
+87
+34
+NADPH oxidases and mitochondria
+myocarditis
+5000
+D-Se
+APCs
+deISGylase activity
+a claims data source
+Pneumococcal
+individual rights
+65°C
+387
+8200
+Beta-hydroxy-beta-methylbutyrate
+31st
+mutations in the E2 protein gene of enzootic
+two
+2
+ABI7500
+Acute Respiratory Distress Syndrome
+GeneAmp RNA PCR kit
+Tyr254
+0.35 s
+2.2%
+two
+few
+different targeting mechanisms are in operation
+Colistin
+Microscopy
+its prospective design
+innate lymphoid cells and lymphocytes
+Group A rotavirus
+Dysesthesias and peripheral paresthesias
+France
+Donor chimerism
+1959
+antibody production and purification
+NS1
+30%
+functional antibodies
+gene overlaps and protein multi-functionality
+HPRT
+the product of the separate dimension dissimilarities
+Delaunay tessellation
+confocal
+location allocation model
+water permeability
+non-immunized cows
+1% to 30%
+macaques
+VacA mediated-apoptosis
+56
+Three
+more than a decade
+mice
+statistical basis
+65 to 86%
+ic Virus
+animals will then either be passively immune or susceptible
+PI3K
+normal
+CHBAH
+f
+health care associated pneumonia
+Contact between humans and animals
+Five
+More than 11,000
+K125
+Ebola
+12 hours
+Programmed death -1
+Prism 5
+PEDV infection
+lung, liver, and spleen tissues
+9.8 K/mL
+hyperplasia
+89,856
+40%
+temperature ≥100.4°F
+TCs sensitivity to treatment with multifunctional cytokines or signal pathway inhibitors
+higher-order epistasis
+12 hours
+pathogen-associated molecular patterns
+CXCL2
+reversed the protection against H/R injury
+IL-4
+insufficient information about its construction and original item pool
+more protein abundance in T0 or 8 h versus baseline
+good
+159
+multi-looked image
+long lasting
+0.107-0.124
+Opa proteins
+DockTope 17
+at least yearly
+serious AEs and new-onset chronic medical conditions
+a coarse level view of unfolding events
+trans infection of HIV-1 in vitro
+Hepatitis C virus infection
+plasminogen
+minimize animal suffering
+anti-factor IX monoclonal antibody
+a heritable antiviral defence mechanism
+cell monolayer permeability
+one nurse to 1251 population
+prior knowledge of the genes
+2014
+natural SHFV reservoirs
+cap-dependent
+transmission dynamics
+infectious diseases
+10 μL of 10% CHAPSO
+five
+H7N9 infection
+Dkk3a
+NEBNext rRNA Depletion Kit
+4.58 days
+Node color gradient
+30 min
+Silent infection
+H4 and H6
+high titre stocks
+protein-sufficient
+730,000-1,151,000 N/m
+cytokine polarization and the expansion of Th17 cells
+two
+Thirty
+RIG-I RD
+the microtubule-organizing centre
+microvascular
+reduced expression of the total glycoprotein complex
+NS1, NS2 and NS3/NS3a
+Mary O'Riordan
+high inflammatory responses
+myelinated fibre diameter in cortical WM increased with age
+Differentiation between severe pulmonary oedema and ARDS
+May 17, 2009
+regulates the secretion of IL-1b
+fostering global health
+herpesvirus consensus PCR
+polyubiquitylation
+Burst size of infected cells
+urbanization
+six
+1-100 nm
+The alignment shown in Supplementary Table 1
+Deviance Information Criterion 36
+Clinical history and hospital admission dates
+Repetitive sequences
+one
+vaccination alone
+SINV genomes
+First-strand cDNA
+six
+less than 0.07 EU/mL
+.50%
+131
+four
+neutrophil and eosinophil binding to epithelial cells
+the observed frequency of the dinucleotide XY
+-80°C
+GraphPad Prism 5
+IFN-I signaling
+NDM-1
+20% to 30%
+RCSB Protein Data bank
+30-64 years
+twelve
+haplo-insufficiency
+histone H2B
+Ub1
+π and e
+one-step multigene metabolic engineering
+syndromic surveillance
+migratory birds
+disease severity
+t1
+superspreades
+redundant recognition of a single SG
+risky
+Phylogenetic analysis
+95%
+Up to 10
+sex, age, current marital status, highest educational qualifications, and ethnicity
+85-89 years
+I. Mechnikov
+PPXY
+Fibrillarin
+obvious motor deficits were present
+non-Dutch airlines
+Public health surveillance data
+2 µg/ml of puromycin
+ISG49, ISG54, and ISG56
+ribavirin and 5-fluorouracil
+preliminary
+antidiabetic
+an IFN-stimulated response element
+Adenovirus
+New technologies
+Amoeba
+differences in population-level attack rates decrease
+Iba1 and GFP
+viral transmissibility and replication in different host species
+serum-derived bovine immunoglobulin/protein isolate
+Trojan horses
+Expression and purification
+1147
+the x and y axes
+1 week
+magnetic streptavidin beads
+an efficient inflammatory response
+headache, fever, myalgia and fatigue
+MouseOx™ Pulse-oximeter infrared sensor collar clip
+thrombomodulin
+highly correlated sensor responses
+stabilizes heterologous protein production
+3
+performing statistics
+the functionality of these cells
+Homoplasy
+His-129, His-144, and Lys-173
+tamoxifen/clomiphene/ U18666a
+56
+3.2 µM
+Vimentin cDNA
+dihydroberberine and sunitinib
+68%
+CTNNB1 and CD44
+three
+C5AR1
+LASV GP
+cellular RNA degradation
+endogenous levels in plasma
+80
+Nucleotide second messengers
+PI4KB
+Y517
+neuroectodermal matrix cells
+mature and star miRNAs
+prepared protein structure
+Tymoviridae
+YFP-ZUFSP recruitment to DNA lesions
+Deoxyribonuclease
+delayed growth
+Analgesics
+Non-parametric
+2.5%
+1,250,000
+hepatocyte apoptosis
+Twenty-one
+amino acid
+Respiratory distress
+14
+titer
+three
+2 C-methylated compounds
+The demographic history of PPRV
+suboptimal host response
+Freeze-fracture
+oil extraction and chromatography
+faster
+oriRNA
+DC-SIGNR
+progress
+500,000
+Nanoluciferase signal
+pre-exposure prophylaxis
+Solieria filiformis and Ecklonia arborea
+639
+35%
+38
+Further information on research design
+Dengue virus
+there will be too few synonymous positions for synplot2 to assess
+Trial site coordinators
+Neuroinflammation
+H. influenzae
+prevention and control
+2009
+200 bp
+60 days
+calves are very sensitive to LPS
+Six
+A, C, and D
+DNA polymerase III alpha
+The media
+Co-infected
+limited
+tubescanner
+activation of GRK2
+PCV2 Rep and Cap proteins
+5 days
+B 1 and B 2
+parameters for selection of vaccine strains
+autophagy
+controls
+impaired fibrinolytic activity
+Cells
+SnapGene
+diminished IFN-λ, α, γ and β responses
+6 h
+55
+significant differences in infectious virus
+C5a
+IAI
+CRL-2455
+nine
+cytolysis
+25°C
+76
+24%
+JEM-2200FS transmission electron microscope
+RNA
+abundance
+7-Amino-Actinomycin
+NM_021822 and NM_001097446
+30
+multilocus sequence typing
+the point where the linkage stem forms
+cross-border infections
+proprietary SMART technology
+54
+124
+U6
+treatment of CCHF
+reactivation of human herpesvirus-6
+Ags associated with micro-/nanoparticles
+H5N1 and H7N7
+k
+1,000-10,000
+rhMPV
+Recombinant HA vaccines
+100uC
+the value of a year of life
+Over one fifth
+Reverse transcriptase-polymerase chain reaction
+Neuroblastoma
+MSMS protein sequence identification and future quantitative prospective MRM or antibodybased validation
+bloodstream and pneumonia
+X i
+nosocomial transmission
+maturing vesicles transitioning from early to late endosomes
+a dimer
+protocol
+HeSCs
+viruses with the avian-like residue
+health-evidence.ca registry
+S/B >3
+XPG and ERCC4
+117
+major histocompatibility complex
+Ifitm2
+phytochemical
+red
+ILI consultation rates
+STAT1 protein
+two complementary approaches
+quinine
+79,656
+ten times
+age
+LTβR −/− cells
+EM
+optimal collection and laboratory conditions
+Detectable antibody responses
+TLR signaling
+July
+immunological activities
+HFNC gas flow and patient inspiratory flow
+diagnosis and hospitalization
+ovarian cancer
+mass vaccination
+terrestrial
+presence/absence of indicated treatment
+3 of 506
+90%
+MEME
+participants' influenza infections
+Breseq and SNVer
+primary
+enhancer RNA
+ZLL
+d36-42
+1,170,000
+cysteine peptidases
+admissions data
+Pneumocystis jirovecii pneumonia
+two
+A40 and A41
+the starting location of a simulated epidemic
+IGF-1R
+in vitro, in vivo and clinical trials
+D b NP 366
+sputum-smear negativity
+whether docking is sampling sufficiently
+an influx of neutrophils
+23
+NK cells
+M180 and K243
+ppGalNAc-T2
+Deprotonation of the His37 tetrad
+potential connections
+157
+pharmacovigilance activities and aRMMs
+Luciferase expression
+packing in coiled-coil structures
+permission directly from the copyright holder
+24 hours
+alternative antiviral strategies
+Ten mL
+controlling infection after lethal challenge
+spectrophotometrically
+20%
+89
+1 h
+80 cfu/m 3
+reduce risk
+14Á8%
+mature NK cells
+Logistic regression
+two
+exacerbations
+A pool from all fractions of the gel filtration step in buffer C
+α5-integrin maturation
+20
+systematic, quantitative
+RPS25 and RPS5
+1
+move out of nucleus
+berberine and emodin
+whether T cell cross-reactivity is mostly a stochastic phenomenon
+ammonia
+four
+100%
+Bovine respiratory disease
+100% lethal infection
+by adjusting its pathways of escape
+Minkowski distance
+Kimura model
+12.0 days
+incident-light fluorescence and confocal microscopy
+between 16 and 38%
+SDDV
+Nuclear-targeted eGFP
+tri-antennary structures
+their enrolment status
+CcAstV
+Twenty-two
+false alarms
+Temporal data
+clotting factors
+polyphosphate kinase
+Shanghai Synchrotron Radiation Facility beamline BL18U1
+nonsense-mediated
+1200 bpm
+296
+Ecological and evolutionary theories
+aa-tRNA slippage
+Ext-KpnI et Ext-BamHI
+suicide prevention activities
+molecular
+106
+OmpB
+DENV infection
+chromosomal epigenetic modi fi cations
+MR766 and PR209
+Spn4A.RRLL and PF-429242
+10%
+18
+10,080
+non-coding regions
+ROS
+viral infection
+viremia
+GT-1a
+to monitor the variation in the process
+15 min
+52,293
+experimental data
+NeuN
+25.8%
+cancer growth
+10 copies/µl
+influenza virus infection
+45
+lack of awareness or recall bias
+molecular mimicry
+VSV-EBOV
+June 2012
+97.5%
+Relative mRNA accumulations in cells harvested at 24 h
+DNA microarrays
+24 h
+Screening
+distributed memory implementation
+Sixty-four
+Dr. Kevan Hartshorn
+HGF
+pre-processed ligand binding sites
+global climate change
+younger individuals
+172
+Dex
+5.74610 -6 M
+PVR body mass
+flow cytometry
+3% BSA
+23
+63%
+Zauberkugel
+NF-κB siRNA
+viral loads
+RNA Mfold
+12 hours
+137
+three
+hematoxylin-eosin
+rational and peaceful
+Electron
+catalytic cycle
+4%
+host genotype-specific responses
+FastTree v2.1.7
+Ultraviolet germicidal
+15 days
+Cis-splicing
+anachronistic diagnosis
+high-throughput sequencing approaches
+new tools
+cap-dependent mechanism
+Small non-coding RNAs
+pEF-GFP vector group and untransfection groups
+H5N1 neuraminidase activity
+24 h
+True Blue chromogenic substrate
+Cell proliferation
+PCNA or the viral DNA polymerase accessory factor UL44
+128 ng/ml
+t-test
+η
+TRAF6
+infiltrated inflammatory cells
+FastDNA spin kit
+Eclampsia
+ISG15
+Aspiration of the pathogenic gram-positive and gram-negative bacteria
+additional lateral forces or additional stiffness
+meta-CATS
+issuing a new plan
+239
+Genotypes and Phenotypes repository
+cc-by
+Reassortment
+Geneious assembler
+887
+genome copy titers
+PvuII site
+kusagin or verbascoside
+transient
+interpretation of the results
+Leishmania infantum
+serogroup A meningococcal disease
+real-time PCR
+BALB/c mice
+peptide dens25
+Astellas Pharma Inc.
+anti-trypanosomal
+Habitat
+previously described procedures
+Images from each hybridization
+biotinylated goat anti-mouse IgG
+lytic genes
+sodium
+Weibull distribution model
+cytoplasm
+bone length between the tibia plane and ankle part
+2
+H5-immobilized magnetic beads
+RNA1, RNA2 and RNA3
+Havcr1
+NH 2
+SPSS
+polyvinylidene fluoride filters
+Sveriges Radio
+more complete phylogenies
+25%
+large volumes of crystalloids
+enthalpy-entropy
+glutaraldehyde
+mapping the rural-urban transition
+milk yield, milk gross composition and udder morphology
+2%
+protoplast transformation of H. jecorina QM9414
+analysis of available data and literature
+severe clinical signs
+high quality
+HCV pseudoparticles
+stable
+WT mice
+Twenty
+1M Tris HCl pH 9.2
+EndNote
+1.3 to 13%
+100% susceptible
+Quantification of MOG immunoreactivity
+ImageStream system
+Slow waves
+781,000
+when the virus infects closely related hosts
+proinflammatory
+guinea pigs
+injection of type I IFN
+Written informed consents
+outcome
+proteomic heterogeneity
+three
+A drug module
+OR
+2 M HCl
+adenovirusmediated gene transfer
+Genome sequence data
+11
+36
+increases
+prevalence of high psychological distress
+Mannose-binding lectin
+sum of the elements m j=1 h j = 1
+purity
+355 kb
+AMBER score 11
+stem formation
+sap
+initiate age-dependent cell apoptotic processes
+chikungunyaassociated arthritis
+31,442 bp
+recognition of the stop-start motif
+3
+residue
+vertebrates
+2016-07-01
+machine learning
+case reports or retrospective studies
+Lack of quality dose/concentration response data
+Trypanosoma brucei rhodesiense
+fever, headache, visual and motor skill dysfunction
+early onset of respiratory insufficiency in adulthood
+innate effector cells
+kindergartens
+seven
+mild to severe
+dysbiosis
+positive, increasing, and concave
+six
+non-invasive mechanical ventilation
+CEO birds
+C ¼ 6:1
+tentative consensus
+PERK
+11
+RIG-I
+a disease or a disease concept
+remarkably
+Human BALF
+Management of patients on mechanical ventilators
+UPR or apoptosis
+Eighty-six
+glycolipid-associated a2,3-terminal SA
+peramivir
+Annual cycles
+Ly294002
+Blood
+Data
+eight
+once every hour
+rabbit reticulocyte lysates
+RNA
+8 h
+GENIE3
+Angiotensin-converting enzyme 2
+components of the nuclear transport machinery
+Lung capillary filtration coefficient
+Benjamini-Hochberg
+Acetylation
+phosphorylated
+RTIs
+acute respiratory illness
+IFN-γ production by T cells
+prevention and control of disease
+vagal reflex
+TW MRSA
+26%
+reac- tive oxygen species
+Crisis-affected community engagement
+0.3%
+the product will be replaced
+Translation
+GloGerm
+Registering both infarcts and interventions
+eIF2α
+2
+90 mM, 15 mM, 3 mM
+SOX2 expression in BCC tissues and cell lines
+Leica DMi8
+four
+FDA-Approved Drugs Bactericidal
+its reliability
+72
+HIV-1 sequence evolution
+7,070
+Australia
+real-time computation
+lung and blood DEG
+Enfuvirtide
+resazurin metabolism assay
+Mx activity
+PPE
+Extracted DNA from the buccal swabs
+persistent inflammation-immunosuppression and catabolism syndrome
+Confusion
+Electrophoresis on a 1% agarose gel
+multibasic cleavage sequence
+on request
+90 minutes
+direct evidence of HEV zoonotic infection
+GraphPad Prism 7
+Argentina
+1.4%
+an NdeI and an XhoI cleavage site
+negligible
+severe disease pathologies
+intact
+vacuolization of individual or groups of cells
+lysosomal proteases
+4
+non-pathogenic bacteria and attenuated pathogen bacteria
+Figure 1B
+data availability
+anti-toxin
+hyperimmune sera
+airborne and droplet transmission could occur between animals
+3% PEG-6000
+10
+early, guideline-informed DOF administration in shock
+reversion occurs
+freezethaw
+RSV and Rhinovirus
+literature
+disease incidence data
+underdetermined
+exosomes
+90%
+Cleaned data from each site
+eqolisins
+Written informed consent
+EMAN2 software package 61
+peptidase activity
+87.8%
+480
+SAa2-3Gal
+Harvard Gene Therapy Initiative
+any bias toward ssDNA sequences
+12% SDS-PAGE
+total duration of infectiousness
+263
+NF-kB
+three
+Frozen LV sections
+human population, agricultural, climatological, and ecological measures
+Microsoft Excel
+parasite glycoproteins
+Thrombocytopenia
+Asia, Africa, and North America
+smaller lungs
+tracheal epithelial cells
+Primer Express
+HapMap
+Merck
+reasonable
+2-3%
+10 11
+conflicts of interest
+flavin cofactors
+6-12 month
+1.1%
+ZODCK Server
+37 • C
+w i
+4-7 log 10 FFU/g
+N-terminus of prM protein
+SupTOC-LPS-24h
+Peak heights for extracted ions
+8 dpi
+orally
+1 week
+activated macrophages and dendritic cells
+fitness of individuals
+a standard curve
+10 copies/reaction
+one-sixth
+EXOC4
+900-fold
+Hydrogen bond and salt-bridge interactions
+mouse models
+188
+dynamic light scattering particle size analyzer
+influenza virus infections in males and females
+reduce the final epidemic size
+TNF-a expression
+hematologic malignancies and in rheumatoid arthritis
+SheddomeDB
+agarose gel electrophoresis
+6A n
+6 g/day
+probability mass functions
+CD4+
+jump
+NAFLD and NASH
+strong inhibition of b-gal expression and less color formation
+Pathguide.org
+partial sequencing
+70%
+interact with RelAp43
+calculations need some manual oversight
+BCMA-specific CAR-T cells
+Background gene lists
+Adult flies and cells
+off-target effects
+separate samples
+54-164%
+eosin
+IL-1β and IL-8 release
+TNF and IL-10
+2% agarose gels
+June 23 2007
+Student's t-test
+CD151 nucleation at viral particle binding sites
+ten
+advanced mapping strategies
+15 min
+terms of higher orders
+80%
+human HP strains
+public health
+SPSS 17.0
+gold standard reference set
+those for which a single edge connects them
+cardiomyocytes
+23.000
+ELISA
+five
+The curves
+equation
+FIV
+field-based studies
+Public health
+cell apoptosis
+EDTA, sodium citrate or lithium heparin
+neuroprotective
+20 minutes
+1a and 1b
+Purified HRV-B14 and -A16 virus stocks
+overlapping genes
+VP4
+Vacuolating cytotoxin A
+internalisation of S. epidermidis
+unclear
+one
+IRAV
+a wide range of actors in a participa-tory process
+virus:cell binding
+clear alveoli without inflammatory cell infiltration
+induce IL-10 secretion
+568RU
+87
+lower
+ACK lysis buffer
+cells
+pathways involved in acute inflammation and innate immune response
+mild type II
+electron microscopy
+surrogate neutralization assay
+Those under 18 years
+similarity between evolutionary profiles
+recruitment of HDACs
+RSV or VSV
+2 days
+891
+PTBP1 binding
+The evolutionary rate of each gene and concatenated genome
+translesion DNA synthesis
+drug resistance
+15
+lethality
+Quantitative
+influenza C virus
+knock-out models
+course of infection
+infectivity would decrease
+IFN type I suppression
+>25%
+12 h
+Asp18Ala and Ile70Ala
+30 min
+infected cells
+Ebola Virus Disease
+CellQuest Pro
+CD4 and CD8 T cells
+stop codons
+Neutralizing activity
+intestinal barrier-related genes
+CAG
+seven
+H3N2 and seasonal H1N1
+it does not require thermal cyclers
+FLUAV
+Influenza-Induced Inflammation
+3 days
+serum
+endocytic
+pandemic influenza
+Secreted proteins
+5,013
+alveolar macrophages
+enhanced understanding of the burden of disease
+VeroE6 or LLC-MK cells
+an increase in both phenotypes
+ConSortß
+asthma and COPD exacerbations and the common cold
+Supportive
+CNS dysfunction
+most closely related
+X
+eight
+incubation period
+trained-group
+20,698
+Most enolases
+Alouatta pigra
+Colchicine
+NO production
+identification and management of risk
+reticuloendothelial system
+lungs
+large protein complexes
+Four
+electron
+μCT x-ray imaging
+CD9-targeting siRNAs
+313
+F-scores
+South Africa
+assign unique patient identity numbers automatically
+cellular pathways
+vaccination behavior of adults
+M. musculus and T. gondii
+female
+20 h
+6-year
+selective
+wind-speed, rain and temperature
+curcumin
+79%
+overall performances of a classifier
+HuNoV-specific IgY
+cc-by
+SeV iDVGs
+fecal-oral route
+phosphoserine-dependent
+53 %
+Hypoxia
+bind to DNA directly
+5 minutes
+14 or 29 days
+direct binding of this transcription factor to DNA upstream of several putative target genes
+enhanced
+75
+BAL fluid
+CRTCs
+28
+more than half
+one or two variables
+100
+antiviral agents
+223
+PA E377K M1
+case-record forms
+801 × 106/L
+collagen
+l 63
+daily
+implementing temporary quarantine measures
+March
+CNPase
+haematoxylin and eosin
+cellular glutamine and glutamate
+mental health literacy
+daily
+337
+4 mm biopsy punches
+DH5α
+1952
+33
+influenza A viruses
+the third premise of the presumed consent argument
+over ten thousand
+12
+PLA2G16
+reduce or eliminate the incidence of specific diseases
+increasing disease emergence
+887
+18 years of age
+Human enterovirus 71
+untreated hBEC
+Further research
+The Consistency between Intersection and Union
+differ
+1.20 to 1.77 µm
+97%
+theoretical and experimental
+15
+flow cytometry
+cell supernatants
+Sigma
+Commercial kits
+bloodstream infection and pneumonia
+FRT-rpsL-neo
+>50%
+RNA structure
+E protein
+R i
+ID consults
+RT-qPCR
+it is most efficient to target the S patches only
+a family of controller proteins
+more rigorous inclusion and exclusion criteria
+degraded RNA molecules
+Epithelial cells
+Levy behavior
+intracellular virus particle yields
+probabilistic forecasts
+novel compounds
+ClustalW
+Sonication
+Anaemia
+p53 proteolysis
+March 11, 2020
+GlaxoSmithKline Biologicals S.A.
+default
+Linear epitope mapping
+decreased appetite
+TRIzol Reagent
+Platelet recovery time
+PEDV
+Sendai virus
+logistic regression
+a two-tailed Student's t-test
+20 ml
+over 60 years
+convection enhanced delivery
+IEDB population coverage prediction tool
+QuickGO user
+TiO 2 photocatalyst
+Mapping
+75%
+signal peptide
+Thirty-two
+cytoplasmic extracts following removal of replication complex membranes and nuclei
+patients who quickly improved upon antiviral treatment
+143
+108
+proinflammatory
+how uncomfortable
+SNARE complex assembly
+Hot spot analysis
+having data that point to where the needs for improvement exist
+7589
+10%
+Incomplete KD
+relative infection rates
+no cytopathic effect
+mean square
+LTA4 binding K565
+9 days
+LGAC
+increased cardiovascular expression of ACE2 and plasma Ang levels
+sequences of bona fide viruses
+wells coated with anti-human IgG or Gn
+uncontrolled hyperglycemia
+Pfold model
+56.6 kDa
+the ratio of the amount of Ub plus Ub2 over total Ub
+Incorporated EU
+20
+nucleotides +1 and +2
+Monte Carlo sampling of pose conformation
+progression of autoimmune disease
+2.06 Å
+vimentin solubility
+The observed distances
+1% deoxycholate
+infectious diseases
+TSEN54:p.Tyr119Glu
+western blot
+CO 2 gas
+1 and 2 days
+Health equity
+moral inspiration
+QseC
+lipoproteins
+usual principles of clinical ethics
+males and females
+Functional
+S. eriocheiris
+sinus mucosal organ cultures
+Est2p
+rRNA processing
+225 nM
+An immune cascade
+95%
+primary cultures derived from healthy cells
+avianlike
+21/100,000 persons
+phylogenetic
+27
+roach-allergic asthma
+50-90%
+100%
+Sepsis
+Innate immunity
+Percentages and 95% confidence intervals
+to provide the maximum concentration of chloroquine free base in the organic phase
+3 days after infection
+toxicity
+NTM, ARHGAP15 and ZEB2
+overt or subclinical disease
+Saudi Arabia
+stability of codon-anticodon interaction
+neuropsychiatric conditions
+indexed
+Genetic variation
+the time for the next alternating infusion
+standard gloves and 3 mask designs
+white
+Rab8
+three
+10%
+oligonucleotide adaptors
+neuronal activity
+Viral proteins
+CMC
+PRRSV replication
+five
+Adh1p
+Bio Med Central
+40%
+Lipofectamine TM 2000
+refractory persistent hypoxemia
+1 h
+mice
+fever, thrombocytopenia and leukopenia syndrome
+rapid degradation of the unstable PGH2
+baseline and emergent resistance variants
+Precision Antibody
+the N-terminal portion of the internal fusion loop
+the days by which all the animals died
+end-stage renal disease
+VEEV-induced apoptosis
+their own local-QTL
+50%
+conformational changes
+Biodistribution and persistence of DNA vaccines
+50%
+rhinitis
+increased SNA
+autophagy
+aMU
+8
+genes required for growth and differentiation
+Changbai Mountain
+3 weeks
+nonsynonymous substitution and synonymous substitution distances
+N-terminal 13aa region
+Binding of sH5 3
+2-3%
+nomenclature of FcR
+16 days
+phenotypic variance
+non-responders
+À12.5 to À10.6 kcal/mol
+33
+PXD008881
+discordant results
+Guillain-Barré syndrome and congenital microcephaly
+>80%
+Trim21 and Trim30
+transformation of the nuclear genome
+probability density function
+pgRNA encapsidation
+cardiovascular events
+every 4
+neurocognitive disorders and neurobehavioral deficits
+Lipinski rule-of-five
+Bliss independence model
+1.5 hours
+Kar2/Bip
+Ma5TE
+CLIR
+UCSF Interstitial Lung Disease Blood and Tissue Repository
+ssDNA PI
+phase-contrast
+45
+Hantavirus
+homologies to the putative epitope
+protein folding and secretion
+parameter inference and forecast of infectious diseases
+a technique aiming at detecting species-specific differences in a short region of DNA
+100% lethality
+Open surgical repair
+unclear
+a cold spot
+DMPG
+mediates nucleotide-binding and oligomerization
+Total cell lysate
+intrinsic stochastic fluctuations
+retroviral Env
+DMV formation
+the operators of the SSA is used
+a team approach
+Lamivudine
+nine
+sequencing error or intrahost diversification
+antigens
+MutS selectivity factor
+Implementation of diagnostics
+50%
+Transmissibility
+TBSV genomic RNA accumulation
+ribavirin, arbidol hydrochloride, and T-705
+arthropod-borne viruses
+nine
+taxa with morphologically indistinguishable eggs or oocysts
+A, B, D and E
+cross-correlation
+35,273.37 nM
+29
+LASV and ML29
+IAV NP
+2010 revisions to McDonald diagnostic criteria
+it requires interactions with the other species
+LPS
+11
+A 2 5 statistical design of experiment
+IL-1β
+Two hundred
+diarrhoea and faecal shedding
+country
+passage 4
+Lactate or sodium hydrate
+Mortality at 28 days and at 6 months
+cigarette smoking
+4%
+stability
+several fold
+EVPI
+people with direct or indirect exposure to swine
+> 10 5 nm 2
+Poor knowledge and skill
+Mobile phone call detail records
+negative colony effects
+Previous work
+Mycoplasma OTUs
+vimentin mRNA
+18 bp
+5%
+GAPDH
+0.1%
+their function
+cows and pigs
+Imatinib
+1949
+Immunohistochemical
+light microscopy
+IL-4
+Duct cells
+A fixed effects meta-analysis
+KAT2
+meticulous volume optimization
+larger antibody formats
+cell cycle arrest
+Scienti fi c Advisory Board
+Activation of caspase-9
+2009
+contact tracing information
+10% human serum
+Antibody-mediated enhancement
+labile intermediates
+Article 8
+TNF-α, IL-1β, and IL-6
+PAMs
+weighted networks
+limit of detection
+haplotype A
+47
+the area of MT in the jth sample
+estimates of individual connectivity and transmission of a directly transmitted pathogen
+MLV-infected B1 cells
+inside the nucleus
+40 min
+equilibrium in cytokine production
+t-test or Wilcoxon test
+60
+misclassification
+final candidate sequence
+between their residential patches and a common destination patch
+four
+emergence or destruction of the bistability
+cysts
+10 days
+isoflurane
+Fatty acid uptake
+9 days
+mineral-oil-spread
+PGE2
+potential differences in the degree to which specific viruses may influence these pathways
+MK-801
+The interactions predicted by cross-species conservation
+paclitaxel
+0.053
+subverts
+six months
+300 ns
+smaller LRT P-values
+Germany
+genomic DNA
+20
+10
+Intuition
+FiO 2
+Eco-social tipping points
+Immune/inflammation responses
+1
+Middle East respiratory syndrome
+sepsis and septic shock
+hepatocyte growth factor
+UVGI
+phloroglucinol units
+Appropriate anesthesia
+household intervention group assignment
+RVFV
+CD3-induced
+unsupervised hierarchical clustering
+hypothesis generating
+log-rank test
+Influenza
+Almeida-Filho
+by coach
+the choice of a drug target
+HA gene sequences
+Ni-NTA resin
+Neutralizing antibody response
+sugar residues
+Viral diarrhoea
+viral replication
+lysozymesensitive
+Excessive systemic TNF
+Genome cyclization
+ONO-6818
+Ten
+HPeV
+hypertension and atherogenesis
+infectious
+bicinchoninic acid protein assay
+text based examples
+Eurasian avian-like
+pYD-C235
+dynasore
+laboratory mouse
+Viral load
+pathogenicity of IBDV
+sub-population for whom risk beliefs are particularly low
+Anionic liposomes
+93.5-95.5%
+dsRNA regions and single-stranded RNA regions
+Random mutagenesis
+fungal aerosol sampling
+anti-plasmodial
+6
+146 selected variables
+AMR
+3-7 days
+substantial increases in plasma Ang- levels
+PLEX-ID
+nucleotide 2060
+a pool of all samples in the analysis
+viral clearance
+Autoregressive models
+NS1
+nine
+no difference in morphology between the right and left hemispheres
+exposure to LPS and hypoxia
+Intracellular
+dendrites and post-synaptic densities
+crucial physical terms
+diverse computational approaches
+three broadly neutralizing anti-HIV-1 antibodies
+outside lipid rafts
+to function adequately
+OAS1
+13,046
+Cell Profiler
+virus-contaminated objects
+1-3 million
+vibratome
+Gene Expression Omnibus
+linear regression
+DC-SIGNR VNTR
+cytopathic effect
+explicit household and school-based transmission
+western
+viral entry assay
+good
+953
+autopsic
+Three
+marrow aplasia
+12/61
+developing acute kidney injury
+future studies on the origin and function of enterovirus ROs
+ibalizumab
+40,430
+Accurate metrics for national epidemic and pandemic preparedness
+Detailed analyses of the locations of confirmed cases and their demographic and economic characteristics
+lack of precaution
+insects
+20% or more
+influenza or SARS
+TBP and YWHAZ
+oral swabs, anal swabs and blood
+viral protein 35
+bovine serum albumin
+Th e vector
+3 and 36 hpi
+EpiFlex
+2%
+3
+Ten
+accessing health care
+further work
+φ
+1,000
+DNAzyme
+calculate costs of a future intervention to prevent NiV
+cell proliferation and cellular redifferentiation
+The Database for Annotation, Visualization and Integrated Discovery version 6.8
+Department of Chest Diseases of Ege University Medical Faculty
+over half
+The amount of time elapsed since disease onset
+28 kDa
+dependent
+eRF1
+Margetuximab
+generation time
+IBM SPSS Statistics version 20
+inflammatory cell infiltrates
+4:1
+antigenic profile and reported in vivo efficacy as an animal vaccine
+Diagnostic test development
+52.2%
+western blot analysis
+overlay of c-di-GMP
+imaging probes of NSCLC
+DAD
+the corresponding author
+recombinant rVSV-VP1
+S. suis 2
+PB1 function
+systemic delivery to the central nervous system
+HRP-conjugated anti-human IgG antibody
+National plans
+invasion
+safety
+ISfinder
+5.0.1
+21 days
+Blood and serum samples
+Private disease-risk mitigation
+mild upper-airway diseases
+50-60%
+14 days
+natural
+less than 0.01
+DCs
+six
+growth promoting functions
+Quantitative
+77%
+increasing number of viral species they contain
+rapid and minimally invasive biomarkers of disease
+Temperature dependence of the inhibition constants
+antibodies from psittaciformes
+Rabbit anti-MBP antibodies and mouse anti-NF-H antibodies
+withdrawal of ongoing intensive care support
+p.Tyr67His
+FACS Diva Software
+12.3%
+165
+eosinophils
+between 20 and 30 years
+staphylocidal activity
+Group 1
+three
+inhibits the degradation of autophagosome
+syndromic
+ethics
+Model bias
+Four
+stem cells
+atypical antipsychotics
+Young adult and adult individuals
+its probability of replicating and producing progeny
+Bio Tool Kit
+five
+vector-insertion genotoxicity
+electrostatic interactions
+22 kDa-31 kDa
+Six weeks
+repetitive
+closed all live poultry trade markets
+Brazil
+18
+abbreviation
+Binding of the top three de novo derivatives to H1 site
+Bayes factor = 50
+no differences in the regulation
+by eye
+poor results
+uniform suppression of several innate immune parameters
+CD8 + T cells
+95%
+Three
+H1N1 strain
+4.13
+0.2
+δ 18 O
+2005
+Dorylaimia
+HA-8
+more rapid amplification
+unlinked
+Chinese herbal medicines
+Ecology
+Hexon positive cells
+24
+strong immunostimulatory activity
+8
+eight
+24 hpi
+90%
+propidium iodide
+JEOL JEM-1011 transmission electron microscope
+empirical measurements of distance and travel time
+threedimensional
+chromatin immunoprecipitation assay
+Signal transduction
+therapeutic failure and increased microbial resistance
+discirminaiton based on racial or ethnic origin
+bacterial pellet
+three
+HNF4a and HNF1
+Nuclear magnetic resonance spectroscopic
+Continuous bile flow
+Mutants of proISG15 and nairovirus OTUs
+Vb5.1/5.2
+BioLegend
+Fluorescence
+Maximum likelihood estimation procedures
+Cough
+Experiments that manipulate habitat
+very low
+270%
+primary injury
+in-depth proteomics studies
+creating a Master Cell Bank
+indirect immunofluorescence assay
+a clonal control
+infl uenza virus vaccine
+Bohle Iridovirus
+elevated
+France
+AutoDock parameter set-and distance-dependent dielectric functions
+28.8 h
+3
+CEP
+interventions
+1-day-old
+SuperScript IV reverse transcriptase with Oligo20 Primer
+peripheral residues
+none of the databases reviewed here requires strong passwords
+agent-based model
+825 children
+non-specific cross-reaction toward the other viruses
+Recombination between wild type virus and vaccine strains
+Twenty-four plaques
+PER1, PER2, CLOCK, and BMAL1
+counter-acting regulatory T cell activity
+65%
+Phylogenetic
+host anti-virus defense systems
+two
+differential immune responses
+PTN
+Eight
+Agilent human miRNA microarrays
+real-time surveillance of bacterial pathogens and foodborne disease
+release of intracellular IFNλ4
+owl monkeys
+P < 0.000001
+AmBisome and Abelcet
+outlying groups
+consultative
+The 4-nt bulge
+16
+NP and L CDS
+dissemination of the bacteria
+Arginine
+six
+pseudoknot
+host-microbe interactions
+more robust and reliable
+viral
+metagenomic
+2000
+Micro BCA protein assay kit
+24
+Twenty three
+The time evolution of the epidemic
+placental trophoblasts
+Deng Yiqun
+Fifty-two
+hepatic stellate cells or vascular endothelial cells
+148
+bone turnover markers
+55
+Bill and Melinda Gates Foundation
+Infectious disease outbreaks
+Apilimod
+Streptococcus pneumoniae
+viral strain
+IFN-c
+10
+CD4 or CD4bs-specific mAbs
+75%
+tris-phosphonium hexafluorophosphate
+marginal significance
+statistical algorithms
+Plasmodium knowlesi
+nucleotide changes
+a management perspec tive
+around 1000
+practical clinical use
+high degree of heterogeneity
+third microdomain
+its capacity to examine the effects of inhibitors on IAV entry
+macrophages and DCs
+daily
+2,700
+MGI
+Adequate preparation
+3DEM Loupe
+genotypes IV and II/III
+combination therapies
+27%
+Samples
+strains of JEV
+ten
+neutralization
+TLRs
+proteolytic cleavage of the ACE2 ectodomain
+The dimension of the polytope
+10
+5 mins
+the window of time for effectively applying control measures
+TLR, inflammasome and dectin signaling
+IBB-1
+allantoic fluid from mock-infected eggs
+every two days
+Spleen
+E Gn 3, AP-8 and AP-9
+nonconserved nucleotides
+11.7 T
+sialylated KS proteoglycan
+178
+antigens
+0.5 mg/mL
+substrate targets of viral proteinases
+site D1
+10%
+3.12 years
+2011-05-16
+12.7%
+SWI/SNF complex
+19
+an incumbent strain
+multifunctional
+prime T cells for the production of IFN-gamma
+mild to moderate
+BSSVS or a distanceinformed prior
+to guide further developments
+10%
+inflammatory cells
+Hospitalization history, previous antibacterial therapy, physical decline, and mechanical ventilation
+Palivizumab
+Inflammatory
+cathepsin C and Z
+LPS 10 ug/ml
+NADTs
+ImageJ
+HAstV
+Virus in imaging buffer
+double-precision arithmetics
+Purity and integrity of RNA
+immunomodulatory and proinflammatory responses
+dense smoke visualization
+13%
+enteric
+Biosafety concerns
+genotypes of mutant and wild-types
+778
+BCA kit
+sequencing quality
+immunocomplexes
+409
+2
+quantitative structure-activity relationships
+AI viruses
+cytoplasmic distribution
+its likelihood of being a genuine miRNA
+1-h
+IRF-3
+Four hundred nanograms of RNA template
+seed servers
+BiostaTGV 1
+4 hours
+three
+September 2012
+lack of full scientific certainty
+oxygen and steroids
+dsRNA
+poorly understood
+enterovirus RNA
+Cavernous
+Cross-reactive immune responses
+immune cells
+54%
+Homing endonucleases
+Total RNA
+good
+Influenza
+861
+intracellular cytokine staining
+NMR chemical shifts
+forward stepwise elimination
+50 nM pooled primer mixture and TaqMan PreAmp Master Mix
+0.1%
+Tat, Rev, and Nef
+intrinsic and innate pathways activated by foreign DNA
+Nakagawa Shinichi
+1
+internal distances
+inequality
+81
+196
+national security and national interests
+4%
+Ecological niche
+37°C
+National Institutes of Health
+aggressive tumor phenotypes
+Seal/H10N7
+alcoholbased
+hepatitis B surface antigen
+210 nm
+TMP/SMX
+Bafilomycin
+as 1 mm-thick layers
+NucZip
+Cell supernatants
+relatively modest
+systemic replication and neurotropism
+Proteases
+5
+subunit interactions
+functional mobility and partial dystrophin restoration in skeletal muscle
+necroptosis
+American Type Culture Collection
+below and above the diagonal
+48 hpi
+100%
+Functional avidity
+a functional PPXY domain
+134
+treatment facility
+GenBank
+intrahost CHIKV evolution
+10-20 ng/mL
+Oligonucleotides
+Internal mismatches
+10
+40 minutes
+Junwei Sun
+12%
+Beclin-1
+500 pg to 100 ng
+TCID 50 assay
+DNA library
+rapid induction of SOCS-3 expression
+high reliability of the assay
+CD4+ T cells
+Bond rotations or flexions
+acacetin
+dsRNA
+6
+200 µl diluted samples
+250 million
+technological, environmental, nutritional and internal
+ILI data
+immunity boosting
+a rapid investigation
+NIV-specific antibodies
+antibody fragments
+position 32
+Full length protein
+repopulation of the mouse liver with human hepatocytes
+phase separation
+uridylate
+Sigma-Aldrich
+Nuclei
+Understanding transcription factor mediated control of gene expression
+three
+ethanol
+>10%
+15 min
+Deletion of pbrB
+IL-12
+SBV infection
+24 h
+Nine
+acyclovir treatment
+new strategies for combating diabetes and other metabolic diseases
+IFN-β
+damaged cells and myelin debris
+effector T cells
+Samples
+89 Zr
+95.2%
+five
+January 2014 until June 2015
+Protein aggregates
+mitotically active basal keratinocytes
+vectorial
+Figure 3b
+NF-κB
+final concentration of 1 mM and 5 mM
+TCR/CD28
+10,000
+BTV-1
+vaccine perception
+ClustalW 24
+16 nm
+early pro-inflammatory responses
+three
+a random sample of residents in the village with the largest number of reported cases
+Formalin-inactivated JEV vaccine
+plasmid-driven
+early 2009
+three
+calciumdependent RNase activity
+BLASTN
+126/174
+Significance
+evidence of Ang/Tie involvement
+Patient 3
+NMIgG and NHIgG
+0.9
+country-specific time-Varying
+genome-wide
+proinflammatory
+IRF1-dependent
+intraspecific competition
+50-200 nm in diameter
+JEV
+2009
+CD73, CD90, CD105
+blood donors
+innate immune response and apoptosis
+a ratio of the estimates of animal to phenotypic variance
+oocyst excretion
+query structures
+more than 6000
+14 to 16 months
+binders
+28
+Network-based models
+AKT
+single-cell analyses
+undeniable
+fly cleaning
+the gel filter
+patients undergoing deep plexus or deep peripheral block
+South China Agriculture University Institutional Animal Care and Use Committee
+2009
+phenylalanine
+90%
+trend surface analysis
+insufficient inflammatory response
+autophagy
+Distinct Hsp70 isoforms
+financial
+28
+ammonium and glycine
+expert readers
+qPCR
+GM
+immunological response and wound healing activities
+434
+a platform for associating clustered gene expression data with specific cell types
+similar
+A minus RT control
+magnetic bead separation
+97.3%
+CD39, NPP and CD73
+excessive farm capacity
+a multifunctional protein
+automated Oases and PRICE assemblies
+twenty-five
+more than 50%
+C5aR
+InfluSim
+more potent proinflammatory
+many of the functions that have been demonstrated on other cells
+Eighteen-day-old
+trace homologues, and analyse evolutionary relationships
+All authors
+viral pellets
+antibiotics
+protein misfolding diseases
+5 min
+Viruses
+Stanford University IRB and the SCVMC IRB
+inflammatory
+ECP and EDN
+60%-90%
+cautious selection of appropriate patients
+ZS
+80%
+Socioeconomic factors
+8 August 2014
+nine
+driving pressure
+ϳ2 ml
+miRNAs
+E. coli LacZ gene
+Protein engineering
+cholestatic injury
+100%
+seven
+59.59%
+3 kcal/mol
+cryopreserved
+buffers under acidic conditions
+5.3%
+isopropanol
+increased mortality
+Impeding or evading the antiviral response
+Tarone-Ware test
+carbonated
+Antizyme
+Physicians
+endogenous kinases
+IFN-l3
+Eight
+1:1
+1977–1978
+D 2 DR/β-arrestin-2 interaction
+MALS
+parasite-released
+cell lysates and supernatants
+S 0
+s i
+post-transcriptional regulatory
+upon longer image exposure
+advanced warning of respiratory depression with fewer false alarms
+Normalized Shannon Entropy
+comparative threshold method
+a system to transport seriously ill or injured South Korean patients back to Korea
+decreased significantly and continuously
+Molecular characterization of measles virus
+reverse-transcriptase polymerase chain reaction
+airborne droplets
+287
+pigs
+quantitative real time polymerase chain reaction
+five
+diverse investigation processes
+Corsica
+expansion
+more-severe disease
+dementia and diabetes
+worse
+three
+1 hour
+one
+higher-level classification and standards activities
+microtitration infectivity assay
+low influenza vaccination rates
+72
+24
+180
+ds-RNA adducts
+PKR-dependent translation arrest
+Febrile status epilepticus
+6
+TS mutants
+revolt
+2 weeks
+50 to 60%
+80%
+HCV
+elastase-1
+CHMP6 and HDAC1
+acute respiratory distress syndrome
+Total RNA
+51
+longitudinal timing
+ParmEd
+recombinant human IL-13, -31 and -27
+active site titration assay, assembly assay and the dissociation assay
+mortality
+prophylaxis
+Supplementary Table S1
+cellular distress induced by viral infection
+A ratio of 1 : 9
+scanning and recognition of the AUG codon
+cell proliferation, migration, and morphogenesis
+NSP1
+monoclonal antibody clone 48
+P. alecto
+IL-18R
+anti-chicken IgY
+endothelial cells
+Illustra GFX PCR DNA and Gel Band Purification Kit
+BIPAP SB group
+IRF7
+Bayesian hierarchical logistic regression models
+PostgreSQL
+AT-9010
+Module Q
+36
+endosomal acidification
+non-TNBC breast cancer cells
+infections
+Image Studio software
+Vaccination
+gradually contaminated
+CO
+19
+seven
+27.34 μ M
+24 h
+laser scanning microscopy
+approximately
+a new collection of possible hosts
+differential degradation
+VSV-EBOV
+CDKN2C/p18
+0.01
+1,000
+solutions for population health
+serum-free medium
+domestic animals
+175
+extent
+1 mass
+Recombinant Inbred Strains
+Five
+258
+p.Tyr158His
+other individuals' choices
+100
+Climate change
+RNA structures that individually produce only small biological effects on virus replication
+down-regulation
+RMA+DABG algorithm
+an increasing trend
+direct binding of CBF1 to promoter sites
+628.286187.88 copies/ng DNA
+they suspected few people noticed it
+sepsis
+epithelium, vascular or interstitial components
+f 7 and f 8
+Eubank model
+Group 2d-1
+Newcastle disease virus
+17 days
+stainless steel
+relevance, significance, and utility
+Standprecision scoring function
+50
+systemic
+STATA statistical software
+it might reflect differences between categories in the alignment depth per gene
+single particle optical sensing
+w pq~c czb pq À Á
+two
+Bacterial clearance mechanisms
+late endosomes and lysosomes
+3= on the last ribose
+Institutional Animal Care and Use Committee
+cellular response to the infection
+Twelve
+adaptive immunity
+PFTs
+ancestral
+Associations with diseases caused by intracellular pathogens
+bacteriophage
+condom use or HIV prevalence
+extracellular ATP
+1.9 %
+Dexamethasone
+twice daily
+uPAR, gC1qR and cytokeratin-1
+stimulate myelin uptake
+early August 2014
+48%
+284
+astrocyte and microglia cells
+local compliance variation
+Saliva
+its ER-specific distribution
+alveolar
+interferon-γ and interleukin-12
+radio, bicycle, mobile phone, light source, television, and refrigerator
+55
+fluorescence
+80
+demographic, clinical, and outcome data
+overestimates
+6
+ribavirin
+protective
+Denmark
+heterologous
+a plasmid encoding the T7 RNA polymerase
+Biotinylated anti-Rabbit IgG
+4
+serial lumbar punctures
+ECG-grade emery paper
+epidemiological
+5= phosphorylated RNAs
+29
+more accelerated liver fibrosis progression
+Patients from rural areas
+cellular uptake
+asymmetrical
+mild EV cases
+end-matured
+multi-well spectrophotometer
+Lipoid
+120,000
+Student's t test
+lysis of cells
+Dual-Luciferase Reporter Assay System kit
+629
+IFIT1
+a role in maintaining the basement membrane
+millions
+UDP glycosyltransferase
+age or number of years
+10 days
+24,000
+the underlying process of disease transmission
+MyD88 and IRAK1 expression
+100
+ϳ11%
+cell growth
+19-year-old
+RNeasy Mini kit
+Many stakeholders
+∆E3 structure
+dasatinib
+clear viral particles
+CMV viral loads
+the Regulator
+n
+Albany and Madang
+consistent with the observation of clinical signs
+H1N1 infection
+p6 gag
+mediation
+acquaintance immunization
+SB, RK, ES and WH
+immune response
+five
+heterogeneity
+iVAX platform
+eight
+CRF01_AE subtype
+absorbance
+pro-inflammatory
+per minute of each type of breathing cycle
+endocytosis
+five-day
+Expelled secretions
+Free radical damage
+1.5 to 2.8 mM
+Pico Input Mammalian
+polypeptides of the expected molecular weight
+4%
+>30 days and ≤12 months
+Sera from pcDNA3.1 injected fish
+IRB ethical
+a signal peptide
+CCR2 molecule
+Hopf bifurcation
+Seven
+90.8-94.6%
+Antigenic shift
+14 dpi
+chemiluminescent substrate reagent
+persistently infected tick cells
+potential important functions that miRNAs have in host and pathogen interactions
+nsP2 and nsP3
+meta position for the addition reaction
+hybrid capture assays
+\0.05
+mucosal and keratinized epithelia
+four hours
+cc-by
+subcritical
+SI
+26.5 mm rainfall
+externalities
+10.1155/2014/540463
+statistical testing
+active replication of the virus
+incomplete protection
+2%
+7 days
+angiotensin type 1 and AT2 receptors
+A 3D structural model of the DENV-MINI RNA
+TPN-independency
+biomarkers
+sepsis
+mapping ADP-ribosylated targets during DNA damage
+Ni-affinity
+Supplementary Data 3
+ARDS
+Anderson and May
+CPV infection
+attributable fraction of cases exposed
+disease cases
+IL-10
+extensive
+57.71 ± 2.93%
+Zanamivir
+47%
+breakthrough infection during quarantine
+MDCK cells
+confocal
+Genbank
+0.16 mg/ml
+Human Respiratory Syncytial Virus
+Integration of syndromic and virologic surveillance
+10.6 mg/L
+24%
+neurological deficits
+risk factors that contributed to the spread of HPAI H5N1
+4
+SCARB-2
+public health authorities
+human CD200
+1 A
+health systems
+ongoing diversifying selection
+42
+raw Ct values
+light-activated
+Mass spectrometry
+>440,000
+6
+polymerase-dependent
+5099
+exercise and essential tasks
+0.4 mm
+NP surface charge
+pocket-binding domain
+onefold
+48 hours
+human telomerase RNA
+perceived or actual economic impact
+1
+viral gene expression
+EBM
+106
+≥2
+conservation awareness
+up to seven days
+a cascade of events initiated by the activation of insulin receptor substrates
+hydrolysable
+gammaherpesviruses
+cell-based
+A/H3N2
+Harbone
+IFN-γ and lytic molecules
+Mapping
+10.3%
+23 amino acid from the human tyrosinase signal peptide
+IFN-γ and tumor necrosis factor alpha
+The level of correspondence with the information environment
+steatosis score
+Berlin
+9.4
+type 1 pili
+canine transferrin receptor binding
+50 µl of the homogenate
+36 hours
+2 mM of ATP
+Four
+chemically deplete IgM Abs
+visualization of enterovirus ROs
+40
+macropinocytosis
+age-related mixing
+1 day
+two times the SD at each antibody concentration
+whiskers
+novel avian influenza viruses
+β-actin
+virus-infected, non-APC cells
+four
+30 min
+counter select any new mutant clones
+less suitable RGs
+the mechanisms that sustain hypertension during normoxia
+NS1
+November
+six
+risk-adjusted hospital mortality
+every week
+four
+cholestasis syndrome
+systems-level
+Collagen Type 1
+Hepatitis B virus
+8
+five
+Digidata 1322A
+Ficoll gradient
+4%
+desorption/ionisation time-of-flight
+P3 and P9
+minimal gene expression
+room temperature
+HEV71
+repeated introduction
+Antibody dependent enhancement
+α-helices
+RNA lacking 2'-O-methylation
+Gompertz model
+to avoid the extrapolation of divergence times too far into the past
+COX-2
+40 and 60%
+Aspergillus
+negative binomial autoregressive model
+inversion status
+5%
+5-10%
+the use of ECMO in patients with H1N1 influenza
+signs of disease
+AS-136A
+Rheumatoid factors
+China
+Begomovirus
+Eurogentec
+accommodation of the first codon
+Glycoproteins gB and gH
+Arg 705
+Review Manager
+particle size intervals
+exosomes
+Qiagen Viral
+CalcuSyn
+between 40,000 and 220,000
+epoxy resins
+Chikui behavior
+Celigo cytometer
+January
+141
+delayed fusion kinetics
+tumor progression
+to avoid direct contact transmission
+CPE and syncytia
+up-regulating transforming growth factor-β
+Cell membrane C1qR
+collaboration
+minks, pigs or cattle
+The safe and effective transportation of samples
+the structure that is predicted
+China
+Fuyang, China
+K1L and C7L
+developing a shared understanding between patients and providers
+Aptamers
+Dr. Dietrich Keppler
+pneumonia, acute respiratory distress syndrome, and death
+fusion partner
+DNA microarrays
+1030
+two
+Specific cDNA
+308
+crude mortality rates
+27
+Rockville
+dendritic cell maturation
+NK cells
+Sequence and structure
+antigen-specific B cell
+3 cm
+viral RNA synthesis
+six
+capillary electrophoresis
+Radio Immunoprecipitation Assay buffer
+mitochondria and the endoplasmic reticulum
+5-AZC
+least-squares fitting
+BDNF
+Flow cytometry
+overexpression or knock-out of the CHOP gene
+evolutionary pressure
+RanBP2
+VSV-G-pseudotyped lentivirus particles
+À70 C
+immunoblotting
+culture flasks
+feasibility reasons
+3.6%
+0.05
+ECL Plus Immunoblotting Detection Reagents
+any nonviral sequence
+generalized physiological state of an individual
+non-cardiac comorbidities
+0.11
+a system of coupled S-I-R equations
+positive detection of Mean 6 standard deviation
+Antigen I/II family proteins
+Bayesian network models
+MFE
+Time from symptom onset
+the known characteristics of the disease
+four
+the treatment of many infectious diseases
+isolates from Cameroon and Ethiopia
+Kenya
+one probe of the array
+IRF3 and IRF7
+c j
+calf diarrhea
+4
+release of LCMV DI particles
+Antiviral state
+ALV-J infected cells
+FOXO1, activator protein-1, and NF-κ B
+Biolayer interferometry
+IL-2 and CD25
+27-month
+no tissue fi xation and disruption are required
+survival
+H1N1 and H3N2
+serine monophosphorylation of STAT3 at S727
+E
+all four viruses
+OTPs
+Glutaraldehyde cross-linking
+1,998
+0.5 g RNA
+Viral genomic RNA
+one-seventh
+anti-inflammatory
+SSX2 and GAGE1
+Weight loss and temperature changes
+gradient SDS-PAGE and MALDI-TOF-MS
+HepG2 cells
+parasite switches
+22
+Pietrain pigs
+current standard opinions
+immune-fluorescence
+400
+LC16m8-derived recombinant vaccinia viruses
+T25
+FACSAria
+Phylogenetic
+spurious
+molecules of 4 Vpu
+MAVS
+amantadine
+virus replication
+Written informed consents
+Stockley, Twarock and Dykeman
+166
+each epidemic
+golden hamster, rat, and mouse
+14.9
+glyceraldehyde 3-phosphate dehydrogenase
+January 1, 1976
+double-layered microfluidics
+Antibody engineering
+78.8%
+recognition of sequence similarities following non-specific nucleic acid amplification
+5.86 nM
+Radiologic progression
+100,000
+PNA
+his writing desk
+log-rank test
+1 h
+CD4 + Foxp3 + regulatory T cells
+mosquito saliva
+Nikon X71
+positive signs
+CAIX expression
+APMV-4 and -5
+90%
+275
+over 8000
+HLA-DR
+HAV
+rRNA maturation defects
+LC3-II
+the uncertainty during the model calibration period
+61%
+progeny virions were produced
+20 min
+173
+chloroplast
+EasyChrom
+5%
+IFNγ
+58
+ubiquitin-proteasome and 20S proteasome
+Evidential Gene 62
+chemokine
+phenolic
+Professor Juraj Ivanyi
+0 and 302
+12,240
+bacterial pneumoniainduced AKI
+GII
+non-crossing
+dec-RVKR-CMK
+annual variations in the intensity of contact between children
+2fold
+BCA Assay Kit
+whether the codon biases of genes are influenced by mutation
+Tumour necrosis factor alpha
+2.4 Â 10 4 /mol
+myofiber necrosis
+macropinocytosis
+Direct correlation
+72°C
+ACTB and ALB
+Ag-specific Tfh cells
+87.41%
+one third
+The complete list of genes
+10%
+44-80%
+phase II clinical trials
+Thirteen
+ESI-05
+significant changes
+20 and 10 mM
+CATS
+vaccination failure
+0.011 ± 0.008 mg m −3
+DHF
+organs
+RR 0.66
+vasoconstrictors
+400 nM
+342
+TOCs
+Length of stay
+conversion of GL
+IFN-ab
+pathogenicity and immunogenicity
+E. coli dsb or B. subtilis bdb
+RIPA buffer
+quarantine
+viral genomic double-stranded RNA
+Alum
+the DO process
+poxvirus
+ED overcrowding
+bidirectional manual respiration valve
+250-fold
+identification time
+Dimension 1
+PCV3
+747
+45.9%
+Sepsis
+PCA1 combined with PCA2
+angiotensin type 1 and AT2 receptors
+Genetic studies
+16
+PCNA, BMP2 and IL-6
+anti-NP antibody
+feeding costs
+2 μg hepatoma mRNA
+Calf temperature
+MeN_TMF
+Dr E.Karsenti
+a snapshot from seven diagnostic laboratories
+secondary necrosis
+ZIKV
+grifonin-1
+another way of targeting a drug delivery system
+Pig density
+MOE
+15.5Å
+q
+disappear from the circulations in a few seconds
+Forty-four
+Spline smoothing
+amifostine
+antioxidant, anti-platelet aggregation, and anti-inflammatory
+venous thrombus formation
+immunosupression
+Forensic epidemiology and law enforcement/security
+MDM2
+M MRW
+March 10, 2004
+Viela Bio
+gel filtration chromatography
+measure of exposure to the virus
+1 per 2,000-10,000 nucleotides
+oseltamivir and zanamir
+current clinical practice
+polypeptide size
+αA-crystallin
+Five
+Real-time RT-PCR 29
+10 fg of L. monocytogenes DNA
+an anti-PD-1 antibody
+retrovirus
+high-fibre prescription veterinary diet
+zinc-dependent endoproteinases
+1%
+Amantadine
+Broken capsids and capsid swelling
+Flowjo version Legacy
+Orthologous relationships between IFITM family members
+triage
+25 th of June
+N-terminal signal peptide
+Dysregulation of the local RAS
+neuronal signaling-mediated regulation
+chain recognition and cleavage specificity
+IDO-KD MSC
+Carbo-free TM
+30%
+Plumbago indica
+10-76%
+verbal padding and hesitations
+KPNA2
+culture supernatant
+the science is unclear
+P50
+Few
+R Q 0
+data gathering, collaboration, needs assessment, and expert advice
+NE, and metalloproteases
+GEO database
+Diagnostic algorithms
+61
+whole-genome sequencing
+Spearman's correlation coefficient
+special
+HR-based DNA repair
+Lung lobes
+IFN-γ
+≥4
+October 2015
+340
+vital
+alum
+Supportive data Table S1
+immunological novelty
+2-3 weeks
+15N and 46R
+RHDV evolution
+two
+AMAs
+75%
+high-sensitivity C-reactive protein
+Canberra
+histopathologic evaluation
+the average of two biological replicates for each strain
+Antioxidant capacity
+antigen-specific tumor lysis
+higher η
+6.7610 23 nucleotide substitutions
+IFNAR1
+deep CNN models of high capacity
+immunity levels of individuals
+45%
+mixed lymphocyte reaction experiments
+identify
+3%
+56
+the effect of the threshold
+4% paraformaldehyde
+bacterial and viral infection
+Chinese natural language processing
+Median Tissue Culture Infective Dose
+cell division
+23.6%
+>90%
+several residues in GP2
+peptide A and peptide B
+endocytosis, actin dynamics and cell polarity
+ellipse
+exonic, intronic, or intergenic features
+sCJD and PD
+feline URI disease
+Resistance Monitoring System and AgConnect
+epoch change point
+Amiloride and the more potent derivative EIPA
+the invasive phenotype of infected cells
+stereomicroscope and digital camera
+16 hpi
+7.2 ± 0.6%
+conformationbased design
+less than 1
+30 min
+CEACAM1-4S
+Mini-Mental State Examination for Dementia Screening 35
+transitivity
+an open source data mining package
+inflammatory gene expression
+The dynamics of the system
+HI titers
+Reaper-15-065
+viremia control and spontaneous resolution of HCV infection
+macromolecules
+1{ P
+negative results
+MAP kinase
+global genomic cytogenetic arrays
+21,618
+inflammatory
+oseltamivir
+12
+stage IV
+73%
+H1N1 and H3N2 Influenza viruses
+further efforts may be necessary to foster enrolments
+20%
+random effect
+vaccination effectiveness, treatment efficiency and their associated costs
+z j
+5 days
+RANTES and CXCL10
+citation counts from different databases
+plaque assay techniques and immunofluorescence techniques
+2
+infection with velogenic NDV
+eight
+Western blotting
+malaria rapid diagnostic test
+recovered efficiently
+August 1999
+71%
+194
+19 days
+envelope interactions with viral entry receptors
+pMSCV-FLAG-HA-IRES-Puro
+1 U shrimp alkaline phosphatase
+bacterial infections
+29 days
+DNA and RNA
+promotion of structural interactions among viral proteins
+recombinant plasmids
+β-casein protein
+high affinity, class-switched antibodies
+Upcoming approaches based on systems and synthetic biology
+fatality, hospitalization and ICU usage data
+10-fold
+5%
+integrated surveillance
+tunicamycin
+early translation termination of the open reading frame
+inflammation, starvation, mechanical stress during development, and ER stress
+tRNA Lys mcm 5 s 2 UUU
+cytopathic effect reduction method
+primer-extended product
+Bio Med Central
+coercion of individuals
+b-actin immunoblot
+Peripheral blood samples
+refraining from GOFR
+Precise characterization of population structure
+suppressive T cells
+international collaborative investigation
+T cell activity
+occupational health departments
+CARD effector domains
+Bax
+EVD
+elevated expression of ISGs
+An assay for cell protection
+2015
+enzymes
+translation and protein expression
+phylogenetic
+Acute respiratory distress syndrome
+real-time PCR assay
+5-15%
+immune protection and bacterial copathogenesis
+the effective reproductive rate
+PETfold
+an observed variable
+5 bases
+GTG
+921
+flatworms, annelids, and mollusks
+MS/ MS spectra
+DiscoTope
+99.2%
+recombinant
+17%
+center manifold theory
+Losartan and Candesartan
+frequency of infections
+fusion pore formation and expansion
+ribavirin and oseltamivir
+DNASTAR 7.1
+λ i
+Superscript III and random hexamers
+Csk activity
+Sustained expression of pro-inflammatory cytokines
+conformation of the ring finger
+M2b or M2c polarization
+375
+T2 and V1 treatments
+strong translational selection
+lysines
+37 days
+3 coils
+anti-GP IgG titres
+four
+RNA library
+12%
+limited the initial infection
+passenger data
+DENV NS4B
+25-46
+within the firewall of a health system
+Seven
+two
+2011
+influenza
+interventions focused on domestic travel, population density, and climatic factors
+three
+7 days
+1998
+BAL fluids and lung samples
+LI-COR Odyssey CLx imaging system
+55
+phosphorylation of the regulatory light chain of myosin II
+summer of 2009
+probability density
+TRIM56
+hot springs
+targeted, site-specific imaging
+national governments
+25,000
+troponin I
+characterization and better knowledge of virus-induced inflammatory responses
+.RPX
+once every 4 weeks
+Physiological
+Monocytederived DC
+10218
+intestinal tract
+Pre-eclampsia toxemia
+on the indicated days of infection
+late-exponential phase
+12,543
+N protein
+MNV49.7
+1 week
+CFX96 Touch Real-Time PCR Detection System
+transcription artifacts or splicing noise
+H1N1 infection
+any other form of alternative aggregation
+interacting with the substrate
+Riksmusei Vänner
+FRET-based titration assays
+Alignment of the sigma class GSTs of trematodes
+alanine 149
+Infectious cDNA clones
+mixed bone marrow chimeras
+eIF4E
+Vago
+visual detection of nucleic acid on the dipstick
+autophagosome maturation
+Quercetin
+Ha Noi wholesale markets
+55%
+1 and 20
+p63
+chemical modification and denaturation-renaturation
+5 min
+Materials and Methods
+part_of relationships between classes
+180
+reverse genetics techniques
+day 49
+C/EBPβ
+14,037
+hnRNP A1
+bony ankylosis
+Lec2 sialylationdeficient cells
+2002
+21.0 mg/dL
+49 ± 17 and 19 ± 9 points
+41.5%
+20 nm
+Tumor dormancy
+27
+tumor metastasis
+when clinicians received laboratory results confirming influenza in their hospitalized patients
+IFN-γ and lytic molecules
+the microbiome
+Climate change and/or habitat loss
+Tumour mutational burden
+a formal comparison group
+Jamu
+by overlying individual grids
+gag and pol
+less than a million
+six
+45 min
+Human adenoviruses
+phosphorylation of its substrates Tks4 and Tks5
+63uC
+cells
+N1 eigengene
+30 min
+The coding sequence of GFP
+Suicide registration
+armored RNA
+Kullback-Leibler divergence
+determinants of antibiotic resistance
+the network's mean residual degree
+Odyssey CLx Imaging System
+HMS
+refractory
+overlap
+1 week and 4 weeks
+Suicide prevention
+513
+Rhizoctonia solani mycovirus 2
+42
+one putative parent lineage of AB476401/011C
+recovered
+FL3 channel with FSC
+Response costs
+quantitative rapid real-time PCR assays
+one mouse
+Exercises
+by injecting 5 milliliters of cell culture media through the trachea
+7.1.2
+M, V, T, and S
+RABV, VSV and NDV
+corneocytes
+Two
+Cell membranes
+430
+4%
+CD80
+88%-93%
+cardiac arrhythmia, pneumothorax or hemoptysis
+72 hours
+nine
+10%
+dynasore
+significant differences
+three times weekly
+H5N1
+microsatellites
+lack of the Cterminus
+endogenous progenitors
+p53
+reovirus type 3
+HCPs
+1.12
+intubation or mortality
+92%
+1918
+mobile coils
+Three
+the attending physician
+cyanobacterial genera
+every 3 days
+predictions that use only CDC ILI in all seasons
+CD204
+insufficient RNA for library preparation
+six
+KSFLVHREW
+Polio
+maturation of microglia within the CNS
+cc-by
+Mass spectra
+Primary microcephaly
+main blood cell populations
+aminopeptidase N
+mutation pressure and natural selection
+regulating cell growth and proliferation, inflammation, and cytokine production
+additional genes
+Reduced glomerular filtration rate and increased albuminuria
+adolescence
+HCV-infected
+ghrelin
+OriGene
+Daejeon St Mary's Hospital
+Self-efficacy
+Sequencing protocols
+one
+KT777545-KT777564
+pDCs
+1973
+Tyrosine kinase
+radiation protection
+> 95%
+deviation from optimal internal and external conditions leads to stress
+Endosomal escape
+60%
+Pneumonia
+Various interventions
+wildlife
+pBeloR26_E2rpsLneo
+high mortality rate
+factors required selectively for replication of influenza virus or propagation of dengue virus
+2019
+cc-by
+integrins
+CD21
+Saltless buffer
+ZetaView
+transparency of the selection process
+the given genome
+JNK and p38 MAPK signalling pathways
+80%
+twenty-six
+a pattern of highly correlated microbial and transcriptional abundances
+1389
+differences
+renal or circulatory dysfunction
+Myeloma culture supernatant or rabbit negative serum
+80%
+0.65 mV
+Reverse vaccinology
+Ethical frameworks
+An extended binding surface for RNA substrates
+NS2A V117
+Transcript subsets
+immune gene stimulation
+Bruker Avance III 600 MHz
+geocoding
+70%
+13
+0.065%
+mutations in the receptor-binding domain of HA
+1.0
+Adeno-associated viruses
+1,594
+dryness of the skin's surface
+169
+viruses actively infecting hosts and transient viruses acquired from diet or the environment
+cleave the MLV Env protein
+English
+their foreign policy
+IL-6 and IP-10
+biotin-conjugated rat anti-mouse IgE
+Alphapartitivirus
+R 0,V
+Bovine respiratory syncytial virus
+VP1
+NaOH-NALC processing
+Aldo1 and Eno3
+protective
+D222G
+All authors
+VAR2CSA
+two
+114
+Phenotypic and genotypic heterogeneity of PIDs
+STAT1
+Virulence genes
+∼50,000
+20
+intraosseus cannulation
+RT-qPCR
+more than four thousand
+24-48 hours
+a dengue diagnostic algorithm
+Electron Microscopy Data Bank and the Protein Data Bank
+hydrophobic domains
+BNP
+1292
+high fat diet
+TLR2 activation
+Curcumin treatment
+Photinus pyralis firefly luciferase
+86.5%
+Saturated fatty acids and cholesterol
+Vaccination against any of the Influenzas
+10 μg of each sample
+1.3%
+Heart transplantation
+hepatic γδT cells
+a measure of diversity
+Results-correlation
+nearby communities
+14,000
+endocrine emergencies
+6 months
+failure of the algorithm to establish good decision rules
+NPV and IRR
+increased virus titers
+the hybridization signal from a perfectly matching probetarget duplex
+mucosal cells
+M 1
+understanding of structure and function of WNV proteins
+African tropical rain forests
+varied arrangements of functional domains among paralogs
+pBeloR26_E2gif
+UK
+8,912
+it enables an analytically obtainable Bayesian score of model fitness
+Non-significant results
+Parasitaemia
+Computer-aided drug design
+level of proficiency
+signal peptidase
+RNA structure
+proper innate immune responses
+11
+p67 phox
+6750
+hospitals or travel clinics
+multiple RNA-binding domains as well as large intrinsically disordered regions
+258
+TRIM56
+mAb targeting PD-L1
+3% FBS
+isolation
+sterile
+on the side of the first exhaust filter
+The genomic region amplified by PCR
+culturing the live viruses
+12 h
+fusion lag time
+monopoly
+increases in ROS
+Prophylaxis
+1038
+human diseases
+Blue areas
+Respiratory syncytial virus infection
+sensitivity and precision
+2015
+the liver
+The Chinese Medical Journal
+AZIZ
+The ideals of the Open Data movement
+G36-CD28z CART cells
+LPS in sterile phosphate-buffered saline
+serine
+microglial cells
+less than 32610 23 ng of DNA
+total mRNA extraction kit
+0.00001
+an informative prior
+selected virus subtypes
+562
+specific
+more efficient implementation
+B and T cells
+Virus neutralisation assays
+0.04 to 0.06
+once every four months
+serum or serum albumin
+GAPDH primers
+lipids
+the minimum virus titres for positive reactions
+skeletal frameworks
+fluorescence-based
+Thirty-three
+621
+low
+3200
+disruption of the BBB
+Limited gene expression changes
+PND4
+two-period
+six
+three-month mortality
+GenBank
+small maximum population-level attack rates
+Healthcare workers
+PTX
+6 days
+G25 columns
+MAGT1 and TUSC3
+BF2
+Helicases
+Soluble histidine-tagged GP 1,2 and sGP
+1%
+parentheses
+Phylogenetic transmission networks
+Chile
+British Heart Foundation
+linear regression models
+pathogenspecific antibodies in host serum or plasma samples
+38.3 kDa
+log-phase cells and attractene reagent
+His287/ Gln288 and Arg294/Asp343
+APCs
+intracellular marker expression
+travel rates
+75%-80%
+four
+CC
+fibrogenesis
+MetShot
+production of fully infectious, filamentous virus
+C57BL/6 MEF lysates
+Reporting delays and underreporting
+The number of cells for each cell line
+prone positioning
+three
+highly specific to each species
+twice
+human movement
+10%
+an alternative structure may be formed
+knowledge of proteins
+Trizol-LS
+Gel 3100 Chemiluminescent and Fluorescent Imaging System
+LCMV RNA synthesis and budding
+assist Englishspeaking clinicians
+0.09
+33.4 million
+100% oxygen
+patients with expected outcomes
+viral fitness
+54
+the DDR
+50%
+pR16.939
+S/SE Asia
+RT-PCR
+Cell culture supernatant fluids
+25
+gradually
+uptake of BTV-1
+cleave cellular protease substrates
+1.8 ϫ 10 5 infectious particles
+training and testing our method
+antibody-mediated neutralization
+CCDC 996592
+Noroviruses
+Najmi et al.
+FastPrep-24instrument
+Q j
+brain tissue
+6 cm H 2 O
+after the peak of the hospital admissions in the series
+mature
+P max
+mosquito simulation model and a dengue simulation model
+50.91, 48.99 and 44.45
+6
+AD-like
+IFN-α levels
+EM Data Bank
+1 week
+modification of PRR pathways
+Sendai virus and human parainfluenza virus 1
+TLR2
+12
+events that threaten public health
+Earl Brown
+IFN-γ
+EMT
+Nikon Eclipse Ti
+4 days
+hurricanes or earthquakes
+functional validation
+gastrointestinal pathogens
+twice
+The blood fraction
+three
+small multi-look size
+145
+F10 and CR8020
+MED50%
+subtype identification
+anti-viral
+mortality
+Figure 1
+via the respiratory secretions
+expression of IL-18
+partial responses
+cholesterol
+bivariate X 2 tests
+collecting information on various forms and in personal journals
+30
+53
+Statistical
+cyclic nature
+9
+grp94 and PDIA6
+AgaR2
+BALB/c mice
+STRUCTURE_DIST
+46.1 %
+50%
+deconvolution assay
+Lymph vessels
+Shengmaiyin
+significantly better
+HCV p7
+a list of 1000 new peptide sequences
+The amount of scFv
+UV at A 280
+the varying dominance between HRV species
+neutralizing antibodies
+four
+1
+15%
+physiological health
+type 1 diabetes, rheumatoid arthritis, and multiple sclerosis
+malaria, tuberculosis and HIV
+CMs
+if they alone comprised the reservoir
+a substantially larger stockpile
+48
+fungal
+rab1b
+K6 score
+missing studies
+SDS-PAGE, western blot analysis and indirect ELISA
+RT-PCR
+clockwise
+Friction compensation
+tubular-shaped vacuoles
+A recent origin of plant viruses
+intrinsically disordered
+a role in mRNA destabilization
+MAFFT 41
+six
+E protein
+evolutionary model-based techniques
+clear cloacal shedding
+DAD
+pseudotyping lentiviruses with RABV-G
+luciferase
+Marburg virus GP immunogens
+35
+the intact wild type Sp1 site
+type 1
+ELISA titres
+time-dependent competing risks of treatment failure
+ribavirin
+10
+SRST2 and the S. aureus MLST profiles
+68
+impaired glucose utilization
+2
+cdN
+44
+leave-one-out cross validation
+the resulting annotations
+234
+55.1 ± 10.2 years
+continuous variables
+The level of SF2/ASF
+miR-1
+Laparoscopic surgery
+thermal control
+20 min
+dynamics
+19,537
+50 nm
+Lack of recovery of platelet count and persistence of leukocytosis
+Sanger sequencing
+individual variability of transmission rates
+Expert opinion
+degradation behaviour and tissue in-growth
+social distancing, use of antivirals and immunization
+Creative Commons Attribution License
+influenza
+~20%
+TCS
+ulcers in the oral cavity, tongue, or gingival regions
+host cell signaling pathways
+exhausted HBV-specific T cells
+twice a week
+efficacy
+optical
+flow cytometry
+short-range and longrange transportation data
+AQ treatment
+Grubbs' test
+>1,000 miles
+low frequency of GFP + events
+Pimobendan
+influenza
+Real-time PCR
+47%
+a population of intact cells
+nucleic acids
+a garden workplace
+enhance their entry or egress processes
+Graph visualization
+the tempo of replication
+up to 30 mins
+mobile phones and web based portals
+16 to 45
+puff
+6-8 h in permissive cells
+Mineral oil
+a local file
+Oxytetracycline
+pQuattro-tTA
+colleagues
+Coxsackievirus B3
+motifs for RNA binding proteins that bind to introns
+tidal volume measurement
+None
+ODYSSEY
+100%
+the type of information that underlies the ABC summaries
+chaperone cyclophilin A
+569
+ACE2 protein expression
+1557
+plaque assay
+antiviral prophylactic control
+The query that contributes to non-poliovirus matches
+23
+eight
+Fig. 7 D
+weighting
+40%
+Fever
+7.2
+cancer progression
+virologist
+LANA2
+124 406
+0.01%
+excessive activation of NETs
+83% recall on 3FP per patient
+neuroaminidases
+biotechnology and vaccine
+schematic
+Rab5
+80%
+LTβR signaling
+anti-parasitic
+CS, JN, and MM
+10 days
+15 min
+multifunctional regulators
+further analysis
+One-way or two-way
+pseudotyped
+GSE5418
+SBVp32
+53
+all forms of movement and contact between farms
+mouse and piglets
+aggression and impulsivity
+up to 3 months
+Information about social networks
+clinical drug development
+Basic Local Alignment Search Tool
+deep intronic mutations
+80%
+A single O. volvulus L3
+four
+NDPITools custom extract to TIFF/mosaic plugin
+leukocyterich buffy coats
+490
+Decision space
+Real-time PCR
+L-DNA
+the pandemic
+social distancing interventions
+x g sires
+4
+>18 years of age
+26%
+Japan
+cry wolf dilemma
+marine and freshwater
+by limiting dilution
+50%
+11
+Micro BCA TM Protein assay
+higher binding activity
+Gamma-camera imaging of infection
+human enterovirus C species
+172,833
+abrogation of particular DDR processes
+age and health status
+optimized techniques
+GAmediated neuroprotection
+lncRNAs
+12.45 Pa
+8
+93%
+30 000
+biosafety level-3
+Qiagen OneStep RT-PCR Kit
+EB4
+fuzzy connectedness image segmentation algorithm
+four
+posterior
+high false positive rate
+rapamycin has a dose-dependent effect on viral replication
+Plastid engineering
+behaviourally induced increases in colony temperature to combat parasites
+heterotrimeric
+contaminated hospital water supplies
+Behaviour change
+5 µM PERK inhibitor
+monocytes
+Polyphenols
+abundant surface proteins
+Genetic factors
+Microglia
+161
+IRES-dependent translation
+PCR techniques
+50.5%
+4
+1 hr
+serotype 1 carriage reservoir
+plant tannins
+mixing-vessel model
+PS liposome and apoptotic cells
+Hypoglycemia
+Uganda
+intensive acre unit rooms
+a stop codon or a nucleotide deletion
+Emil von Behring
+severe sepsis
+8 weeks
+146
+1.3%
+1111/100 000
+CC 50 /IC 50
+Student's t-test
+to draw and understand the real interactome
+3 to 14
+densitometry
+pathways enriched among proteins downregulated >2-fold
+standardized protocols
+DMSO
+three
+frequency
+nuclease-free water
+pooled WMDs
+1652 cost units
+a unidirectional air flow and a dry salt aerosol
+experimental testing
+fresh medium
+S epsis
+ECL Western Blot Detection Kit
+HRV-C
+allergic inflammation
+Responses
+World Association for the Advancement of Veterinary Parasitology
+12000-18000 Da
+elevated levels of exhaled ethane
+hospitalisation dates
+The Jackson Laboratory
+no significant changes in lymphocyte count dynamics
+OD 600 0.45
+ciliated cells and goblet cells
+many confounders
+self-interested use of domestic monies
+The United Nations' Human Development Index
+single nucleotide polymorphisms
+1.36-time higher
+2 Well ProPlate module
+uni-and multiparameter models
+maternal immunity and active immunity
+OHL
+cytoplasmic nucleocapsids
+significance at p < 0.05
+6-8 weeks
+the first author
+subways, offices, and schools/daycares
+MySQL
+intention-to-treat
+preliminary
+CellTiter Glo luminescent cell viability assay kit
+Saudi Arabia
+187,426
+smokers
+exudates containing 100% of free-ranging tachyzoites
+red blood cell
+limited exercise tolerance or the need for long-term oxygen therapy
+50 mL cultures
+strong reactivity
+peripherals
+VEGF receptors 1 and−2
+EEA1 + endosomes
+1%
+assays
+RNeasy mini kit
+muscle damage
+10 4.5 TCID 50 /mL
+Activation of PERK
+TLM B
+to decide the target condition
+95%
+200 lg of total protein
+LepA gene
+CM-leucine
+11
+Gene ontology
+very specific
+100-mm petri dish
+Heat
+LK and OAG
+to provide temporary support to the circulatory system
+betweenness centrality measure
+ELISA
+Memory T cells
+conservation consciousness
+proprotein convertase furin
+20 min
+Stimulatory elements
+18
+viral pathogenesis
+SOFA scores
+proinflammatory
+Thermotolerance
+no significant change in susceptibility to NFV
+did not changed
+rapid
+95%
+Unlabelled shRNA
+24 hrs
+two
+the virus-amplifying hosts
+LCMV PPXY late domain
+south-eastern China
+molecular
+biased hypermutation
+z j
+its solubility
+anti-PECAM antibody
+acute respiratory distress syndrome
+30
+interferon-stimulated genes
+1 and 2
+agonist-mediated
+in triplicate
+special
+geNorm
+apoptosis resistance and collagen synthesis
+Odyssey infrared imaging system
+Poly-induced severe liver injury
+Articles
+50%
+Guatemalan
+20 to 100 nm
+replication and spread
+Loss of myocyte contractile function
+μ
+viral loads
+infection
+m and n
+HCV persistence
+behavioral
+IL8
+6
+12-fold
+À7.1 AE 3.4 mV
+apelin-13
+metalloproteinase production
+Maximal CRP sensitivity of 92%
+mixed lymphocyte reaction
+α-helical
+agents' roosts
+coping appraisal
+Virus-derived sequences
+environmental
+an important step in the maturation of progeny virions
+0.391
+protein-and ligand-surface construction
+Group M
+0.9 days
+ADORA3
+less than 60 mmHg
+15.6 weeks
+RT-qPCR and western blot assays
+P c
+higher
+10
+inflammatory
+cGAS
+MN titer
+IFNAR1
+pleiotropic
+P2X 7 receptor and src tyrosine kinase activity
+three
+Dataset S1 KML
+Understanding the potential of a strain to produce pandemic-capable progeny
+four
+to prevent photocatalysis
+reaching the TGN
+speed, ease of purification and low cost of production
+MycoCosm
+its native promoter
+15
+anti-viral therapies
+CHP
+Forty-eight hours
+carbon chain linker
+shortening of the leg and gait abnormalities
+Kilpatrick, Chmura
+139
+Immunofluorescent
+circumstances
+Three
+seven
+mRNAtransfected CAR T cells
+Type 1 PRRSV strains
+inhibitory
+rodents
+America
+Victor 3 plate reader
+baloxavir marboxil
+α/β
+60-65 • C
+oil-covered pixel
+TIBV
+bleeding
+5.2%
+16%
+250 and 64
+both slaughter and sale stalls
+15
+germacrone
+Psychological and humanistic care
+2-35%
+Weibull
+Cardiovascular disease
+80%
+values from father's cells
+to allow us to be as comprehensive as possible in viral detection
+isoflurane
+female social status
+70-80%
+over 10 million
+cutoff used at the pruning step and assumed reporting rate
+paraffin-embedded sections of lung
+The 160 kDa band
+every 3 hours
+aging
+2
+Deletion
+seven
+Medical treatment
+anti-viral
+Acute pneumonitis
+Ensuring that the community receives appropriate health care
+85 %
+16%
+nucleotides 10 and 11
+steroids
+p53
+2.5 days
+natural killer cells
+0.08 kcal/ mol
+7
+12
+neutrophils
+1230
+Escherichia coli TE1
+hundreds of thousands of bits
+part of ORF1629
+33
+HTx
+LDH, CKMB and infarct size
+different viruses
+71%
+Ligand clouds
+cytochalasin B
+kanamycin
+69%
+CRP-XL-induced Ca 2+
+174
+Figure 4
+four
+unreliable
+25
+scabs
+3 weeks
+48 hpi
+5%
+restrains the differentiation of esophageal SCC stem cells
+indirect immunofluorescence
+COA
+R267 and F338
+StackReg plugin
+Forty-eight
+rearranged intracellular membranes
+CD8 + T-cell poly-functionality
+PEG 4000
+Secretion of GM-CSF
+76
+Catchment areas
+125 nM
+peptide
+vendor software
+Virus-like particles
+West Nile virus and Rift Valley Fever virus
+K63-linked Ub chains
+expression of the HPV oncoprotein E7
+hair-like pili
+6 h
+10.3390/v4102097
+chi-square or Fisher exact test
+cleanup columns
+Any technological progress
+Civets
+427
+1400
+13 th May 2014
+ruin, destruction, deterioration, damage, unhappiness, and loss
+ADV and coronaviruses
+NetMHCpan
+public health
+Acute respiratory distress syndrome
+40%
+FLUOstar Omega microplate reader
+prior information about the disease decayed slowly
+adeno-associated virus and rabies virus
+COX-2
+10 min
+PS-minus and non-cognate RNAs
+significantly inhibited mitogen-induced and virusspecific lymphocyte proliferation
+83%
+medium
+Neoproterozoic Era
+Logistic regressions
+yeast OTU DUB
+p53 levels
+a blue box
+focusing and astigmatism correction
+Old World and New World ancestral states
+Node color gradient
+multidetector CT scan results
+68 weeks
+β -actin
+39-KEALSDGI-46
+5%
+further calculations
+15 min
+health needs and benefits
+suicide prevention
+enhanced green fluorescence protein
+clinical judgement
+6.16
+Bcl11a
+Zika
+Mantel-Haenszel method
+11
+Clinical characteristics
+15.6%
+5%
+False-colors
+two
+horizontal and vertical velocity components
+RTE cycling rate
+four
+neurocysticercosis, tuberculoma, or brain tumor
+Elisa Plate Reader
+twice
+maintenance hosts
+starting material
+discrete large-effect substitutions in hemoglobin
+quantitative reverse transcription polymerase chain reaction
+Sigma-Aldrich
+one
+more than 3-fold
+thirty-one
+activates the PERK signal pathway
+GPM6B
+antigen stimulation
+legumain DNA vaccine
+acute gastroenteritis
+mitigation/containment policies
+R 11 R 22
+10
+12 factors that supported successful health event response
+daily
+Kozak
+Figure 18
+sterically crowded conformations, homogeneous controlled sizes, and structural stability
+Bayesian inference
+key
+Moloney murine leukemia virus reverse transcriptase and random primer
+20%
+PreScission Protease
+Motif 1
+20-37 residues
+skewed towards intermediate density
+desmin
+platinum-based
+Antithymocyte
+pMUM4/RhaGT/UgpA
+hexameric
+23.3%
+MassLynx 4 SP4
+E1
+mice
+lactalbumin alpha
+30 min
+RPMI 1640
+Pyruvate dehydrogenase E1 and E2
+magnetics, optics, and electronics
+HIV-1 vaccine design
+Serum samples
+140
+the native determinant
+M1 macrophages
+membrane tears and stretch-activated channels
+How to discriminate AFPs from other proteins
+bays 1 and 3
+neutralizing antibodies to CedPV
+no evidence for a discrete organization of T and B cell regions
+Western medicine
+lives may be lost and money wasted unnecessarily
+eIF4E-dependent survival signaling
+DAA sofosbuvir plus ribavirin
+zero-mode
+MouseOx™ Pulse-oximeter infrared sensor collar clip
+Immune and wounding-related genes
+a kind of nonlinear and dynamic model formulated by a differential equation
+2 statistic
+S
+host cell compartmentalization and the built-in molecular recognition features of networks
+30 min
+New Zealand
+95.2%
+academia
+measurement and process error
+75%
+a process that leads to the production of virus progeny
+Eight
+53/169
+TLR9 and/or TLR7
+binding site flexibility, bound ligands, and the binding site definition
+Paris, France
+K356R and S409N 21
+four
+ACA, cAR1 and PdsA
+influenza virus infections
+28S rRNA levels
+10.1186/1743-422x-8-494
+Protocol violations
+Ten
+NK cells
+surgery
+106
+research performed in developed societies
+hydroxylysine
+feces
+6,298
+TNF-α and IL-1β
+spore-forming
+daily
+public, commercial, or not-for-profit
+predominantly specific IgG1 serum antibodies
+three
+HCMV AD169
+17 days
+extraordinarily complex
+Primer pairs
+7
+June 2015
+more specific alleles and genes
+T RM cell markers
+polyepitopes
+EnVision detection system
+E45R, E121R and A142R
+humoral
+biophysical applications
+CFTR
+to review the current status of appropriate European monitoring systems
+GC B cells
+sub-Saharan Africa
+immune reconstitution
+expensive
+red triangles
+multi-dimensional
+Kaplan-Meier method
+twice daily
+422
+acute diarrhea
+DNA
+one
+exciting new therapeutic opportunities
+Contagious viral diseases
+electron transport chain and oxidative phosphorylation
+Virus isolation
+food
+textual sources
+H5 A/Vietnam/1194/2004
+limited number of sequences
+sugar and amino acid requirements
+biochemical approaches
+responsive hits on natural protein arrays
+recombinant genotype L22
+OD values
+2 −ΔΔCT threshold cycle method
+all available health data sources
+Figure 7
+ISG15 knock-out mice
+Exon 45 and 46 exclusion
+other vascular pathologies
+RiboMinus Eukaryote kit v2
+Amersham ECL western blotting detection reagent
+CD4 + T cells
+to better understand the acquisition and development of cryptococcosis
+BCL11A
+differences between the expressed and viral materials
+existing professional and scientific ethical principles
+Health
+Asialo-FET
+60%
+Cryptosporidium
+convulsions
+influenza virus infection/pathogenesis
+early termination of the NS1 and NP1 ORFs
+the main features of the life course
+thrice
+Figure 2
+TGF-β3
+I. ricinus
+western blot analysis
+2%
+N protein
+facilitative downhill diffusion at a rather low turnover
+10
+poor candidates for ICU admission
+Virus titers
+Measured activity
+Equivalent volumes of solubilization buffer versus supernatants
+ΔE vdW and ΔE elec
+None
+Pearson's correlation coefficient
+narrow-ranging species
+alphaherpesvirinae
+exercise
+an accelerated decline
+pol r,p,j
+5 days
+25
+ten
+24%
+GC content
+Aedes albopictus
+T3SS
+retroorbital bleeding
+n 1
+SCXK 2011-002
+21 days
+coagulation-related genes
+one third
+surfactant-producing human AEII cells
+B cell cytolysis
+The contribution of each gene to the variance of normalization factor ratio
+endoribonuclease-prepared siRNAs
+MicrobanH
+events
+the ER membrane
+21
+Ym-1
+Toxoplasma gondii and Neospora caninum
+Linda Aiken
+Proteins
+50%
+500
+severe hypoxaemia
+fibrosis
+1.4%
+The AQT
+general health preparedness measures
+MVA vaccines
+in vitro disassembly experiments
+NS1
+differences in experimental conditions
+LL-HA1/L/AcmA
+host specific
+underestimate GV
+AURKA
+unchanged
+Bowtie-0.12.8
+information
+50%
+to allow the formation of single-cell clones
+13 ± 2%
+viral components
+residence within intracellular or immune-privileged positions to hide
+14 days
+multiple linear regression analysis
+methods
+CH01 UCA Abs
+five
+SUMO-mediated post-translational modifications
+Receiver operating characteristic
+PyMOL molecular graphics program
+insertional mutagenesis
+by adding the corresponding empty vector
+26.5 μmol/L
+GTP
+18,342
+virus
+Bayesian
+V18, V120, A129, and I131
+zebrafish
+six
+62%
+an initial case date of April 13
+degenerate neurons
+P1-Thr
+easier access to specialized cells
+membrane disruption and cell death
+serious adverse events
+short-duration contacts
+Siglec-8binding ligands
+protein-free liposomes
+apoptosis
+Trizol reagent
+10À15 min
+Lanes 1 and 2
+2006
+increased
+improved collection and identification with parent collection
+Tat and TAR
+IC1
+Palivizumab
+age
+hepatomegaly
+phosphorylate cGKII
+via the respiratory tract
+functional MT, HEL and RdRp domains
+36
+PB2
+IFN-a/ b-induced ISGylation
+Addgene
+430
+30591
+entry of HSV-1 into receptor-negative CHO cells
+increased levels of the chemokine
+Particles
+Aal DNV
+lactobacilli
+diphtheria toxin receptor
+liver toxicity
+17
+80%
+naïve lymphocytes
+The Linear Constraint Solver algorithm
+2006 to 2007
+sodium sulfite
+3-5 days
+HAF-induced γδ T cell activation
+Gabon
+Histological confirmation or typical imaging presentation of HCC
+increases
+The ability to protect key assets and personnel
+t′
+Six
+1000 Å 2
+5%
+travel plans
+only the class or immediate teaching group was closed
+CD3, CD4, and CD8
+two-tailed Student's t test
+2.9 million
+plant immunity and responses of bacteria and archaea to threats to their genomes
+Th1 and Th2 cells
+the hospital's ethics committee
+5 μL aliquots
+F-7-G
+Gene sets
+The existence of an optimal control
+Microsoft Excel
+3-5 days
+HEK293T cell pools with stable knockdown RNF166
+a piece of the time series after the transients have decayed
+RNase L
+Overprinting
+pre-standing genetic variation
+nsP2 and nsP3 bound to dsRNA
+cannula colonisation
+receptor recognition
+guinea pig
+6 years
+when the knee angle is changed by the motion of wearer
+Venovenous ECMO
+Uninfected cells
+NLRP3 inflammasome/IL-1β secretion axis
+Nascent
+Western blotting, immuno-electron microscopy or functional screens
+structural alteration
+0.6 and 0.4
+R 0
+article search, identification, selection, data extraction, and coding process
+É 3
+little
+covalent complexes with ubiquitin
+aae-miR-286a-3p
+SINTBAD, TANK, and AZI2
+A quarter
+FXIIa
+A3079-01
+article 3
+three
+to eliminate frameshifting events occurring before the assay site
+PBS
+clathrin-mediated phagocytosis
+M
+twice
+3-amino ethylamine
+2500 cells/mm3
+actively use these tools
+Thirtythree
+two hours
+larger vesicles
+6%
+10-15 days
+allergen sensitization
+20 and 40 mM
+functional
+83
+why its expression was not enhanced by H5N1 infection
+limited signal dispersion
+infectious and inflammatory
+Drak2 -/-T cells
+Structural lung disease
+Serum lactate level
+three
+HIV replication
+50 min
+VUS
+22.2%
+CD14
+a two-arm fulllength IgG molecule
+viral protein synthesis
+565
+viral infections
+10%
+Serum HI-antibody positivity
+an AT
+data limitations
+N d i
+isolates
+4-9
+Gen Bank
+neutrophils
+member M2
+humoral
+modulating immune responses
+GeneXplain
+endothelial cell proliferation
+Streptococcus pneumoniae
+LASV NP
+60.4%
+PTMs of this protein
+four
+14 days
+10-15 min
+Epidemiologic
+50,000
+PathData
+years of post-MDA mf prevalence data
+GO
+32
+viral titer changes
+simulations of SEIR epidemics
+expression of the VP2/fluc product
+DNA vaccines
+influenza A
+PAF53
+PMA
+cardiovascular disorders
+60 hours
+10
+E. coli Origami strain
+reasonably small
+Logistic regression
+lower numbers of hospital admissions and reduced resource use
+CRISPR-Cas9
+1 week
+Asymptomatic Ebola virus infection
+IFNλ4 treatment does not cause cell death
+exercise
+pathogenic avian influenza H5N1 viruses
+IgK-VP2
+the frequency of mononucleotides x and y in a given sequence
+the author
+local Moran's I
+IFN-a/ß
+RNeasy
+HATU and DIPEA in NMP
+TNF-α
+decreased in number and faded
+data
+strand exchange computation modules
+medical therapies
+AMCase activity
+husbandry and environmental factors
+PA T97I
+four
+lack of PBD
+platelet aggregation
+14
+GFP u
+transcription factor binding activity of E1A proteins
+p.Ala52Val of aD N
+α-interferon atomization
+40-60%
+what should or should
+2
+IL-10
+SOAPsnp
+influenza and other viral infection
+a Q-Q plot
+RPMI 1640 GlutaMAX
+37
+1 × 10 1 copies/μL per reaction
+inorganic G4 probes
+1 μL USER enzyme
+38%
+65%
+Illumina sequencing
+disseminated injury
+3.3 days
+PCR inhibitor residues in nucleic acids
+Thermo Fisher Scientific shRNA library
+the probability of randomly picking a healthy individual
+handwashing with soap
+USP15 wild-type and catalytic mutants proteins
+apoptosis
+arrays
+44
+unidirectional
+ancient vaccinology
+Criminality
+PSV
+innate
+any advantage offered by the water
+glycan cap
+a diverse array of lymphoid tissue-like organization
+glycosylphosphatidylinositol
+333
+the upper dot
+centrifugation
+RSA59 and RSMHV2
+nuclearlocalization
+backward bifurcations in compartmental models
+114
+lick
+1 µg/mL of LPS
+357
+WGASA
+two-month olds
+numerical sequences
+very mild and focal inflammatory infiltrations
+Intensive network models
+host cell autophagy
+1 hour
+Equation
+colonic
+12
+increased apoptosis
+CiRNAs
+cardiovascular remodeling
+stimulates macrophages to release TNF-α and IL-6
+99.5%
+tissue kallikrein
+An adverse event
+multimeric SP-D protein
+Sialic acid
+dynamic light scattering and transmission electron microscopy
+translated ORF
+Sweetwater Branch virus and Beatrice Hill virus
+Cx. taeniopus
+M. pneumoniae
+Neue Hygiene- und Verhaltensregeln
+ImageJ
+the genome
+twice daily
+Nasopharyngeal swabs
+interferon and pneumonitis
+3 dpi
+improvement in left ventricular function
+severity, relationship to treatment, onset, duration and outcome
+Bernoulli random variables
+E6 or E7
+using a standardized questionnaire
+vaccinia-specific CTL responses
+54%
+four
+mammalian
+common allele matrix analysis
+anticancer drug, a liposome carrier, and targeting peptide
+cellsurface receptors
+complementary DNA oligos
+antibody-based immunoaffinity purification
+contact tracing
+Berthold luminometer
+the linker loop
+positively charged peptide
+15
+74%
+bioterrorism
+ischaemic heart disease and cerebrovascular disease
+one at a time
+enhanced neuronal survival
+G93 and D95
+2019
+236
+Expression
+virulent
+immune-induced demyelination
+>5%
+Node robustness
+phylogenetic oligonucleotide arrays
+reducing waste and promoting efficiency
+Gibbon
+The Frameshift Correction Model
+Nine
+The time varying diagnosis interval
+Maxquant MS Analysis Software
+H4b/H5
+Thirty to 35%
+PureGene DNA Isolation kit
+134
+inhibit the acidification of endosomes
+expression of Fgl2
+5-30%
+CREB-binding protein
+Ile
+neutrophils
+unpaired nucleotides in loops or bulges
+The ability to detect and respond to known and emerging pathogens
+ferret model
+cell-mediated
+poultry health problems
+StepOne TM System
+Positive predictive value
+knowledge about the frequency of diseases
+67%,
+no reactivity change
+normal
+201
+34 years
+neutralize much fewer viruses
+canonical LPS inducible cytokines
+Blood samples
+intra-sample cv
+discomfort and safety
+their effects on vertebrate ribosomes
+CRABP1
+Alexa Fluor-conjugated antibodies
+Phosphoinositide actuators
+epidemic cycles
+two
+1 × 10 4 CFU
+pathogenic microorganisms
+mobility capillary electrophoresis
+improves binding and neutralization activity to the H5 HA subtype
+siderophores
+interact with DNA
+predicted mortality
+1:10
+mammary gland alveolus
+global translation
+constant-1 Ig superfamily domain
+1:2
+T CM cells
+proteomic
+NMR spectroscopy
+Galloyl-HHDP-glucose
+Aglaia foveolata
+14 days after the first dose
+socio-economic
+Ten
+genes that vary across all conditions
+viral spreading
+Failure of RHA to properly restructure viral RNP
+the number and size of the pixels making up the representation of the region
+every 48 h
+cGAS
+Chi test
+PDK2
+melt-curve dissociation analysis
+Aggregation
+four
+epile psy
+Neutrophil extracellular traps
+underlying mechanisms of cell-to-cell heterogeneity of infection
+more than 0.4 ms
+late 1990s
+4%
+standard deviations of the mean
+indicative of myocarditis
+Mean number for RPA
+0.7 µg/ mL
+GTs and glycosidases
+Pomc
+four
+endstages
+passenger locator cards
+infected
+blue
+a whole year
+frozen 8 µM-thick OCT-embedded mouse lung tissue sections
+MS 1 data
+upon fusion of the MVB with the plasma membrane
+weight loss
+Alzheimer's disease
+15-30 min
+F cleavage site sequence
+influenza pandemics
+EF
+94.9%
+f L
+strict liver tropism
+the network of contacts
+k-means clustering algorithm
+stability of EHV-1
+an exact overview of the extent of infection and the affected fascial spaces
+100 and BLOSUM 62
+diffusion rate
+antivirus treatment
+Room air
+TEM
+pupal lethality
+Radiographic
+Input DNA
+age and urban/rural
+51
+rBN-N15D/R46K-R
+hate speech laws
+disease and injury causes
+normal human airway epithelial cells
+30-day
+a more controlled, time-matched study
+CHCA
+4 weeks
+one
+32-33kDa
+similar AUCs with multivariable models
+Sodium bicarbonate
+Hannover, Germany
+haemaglutination test
+Seven
+ligandconjugated liposomal anticancer drugs
+EPIFIL
+gray matter
+7.4-fold increased
+synergistic
+INSOC index
+weak
+CPE typical of PRRSV in MARC-145
+High-dose exposure
+extraintestinal diseases
+ionic
+6.8 billion
+damage to the developing airways and altered immune responses
+interaction with cell factors
+Microscopic
+160 million
+5 days
+reactogenicity
+EC and IEC
+32-bit
+Gene Ontology
+SRP033717
+viral subtype
+IL-25, IL-33 and TSLP
+50-95%
+IRF9
+Sequence composition and coaxial stacking
+ribosomal frameshifting
+asymptomatic
+90.2%
+colorimetric assay
+37 C
+recombination
+Temporal or spatial invasion of non-native pathogens
+drug screening studies
+its function as a p-eIF4E inhibitor
+The intramembrane helices of the first hydrophobic domain
+China1
+R software version 3.3.12016
+selected constituent genes of the N1 module
+Human genetic variation
+a linear regression model
+immunodiagnosis of S. japonicum infection
+quantitative structure-activity relationship study
+990 000
+EBV-related tumor progression
+sequencing errors
+Conformational maturation
+preventing diabetes
+leukocytes count
+RT-PCR
+allergic reactions
+Seasonal variations in the contact rate
+key actions
+decontamination protocols
+14 mM Magnesium acetate
+CC
+Intense patient pressure
+One-way hierarchical
+transmembrane
+dynasore-treated cells
+digital
+IFN-β1
+ori-Lyt
+Data/ analytical capacity and infrastructure
+Written informed consent or parental consent
+CO 2
+Detailed inspection
+the cytoplasm
+host susceptibility to HIV-1 infection
+CaCl 2
+30 min
+virus particles
+control subjects
+the sum of utilities of the individuals
+Hospital A
+Methionine and tryptophan
+nanoprecipitation
+Viral titers of ZIKV-Paraiba
+four
+maternal vaccination
+Deoxyhypusine synthase
+Marc Lipsitch
+ABCB1
+SD/09
+2D3 binding
+antioxidation capabilities
+genes reported to have pro-inflammatory activity
+ACTB
+mRNA silencing foci
+Newcastle disease virus
+293T cells
+4 weeks
+three
+Deep sequencing
+1918-1919 and 1919-1920
+HDI and health workforce
+lung T RM
+ZT33 and ZT39
+19.4%
+English, French, and German
+Alternative outbreak detection and declaration hypotheses
+Proteomic analysis
+Nm and Hi as well as M. catarrhalis
+126/96 mmHg
+notified a research assistant
+15
+pRNA3-DXhoR
+concomitant infection
+inference model
+numerous experimental constraints
+oseltamivir
+DENv1-4
+In-depth formative research
+PARP-1 auto-modification
+extraintestinal
+epithelial cell responses
+Materials and Methods
+further studies
+provide education in residential settings to indigenous people who live in remote areas
+nine
+cost per person in the modelled community
+PRNT
+upon request
+optimize therapeutic decision making
+a functional loss of protein
+universal vaccination in humans
+complex
+differential gene expression associated with the innate and the adaptive immune response
+flaviviruses
+6
+ciliated airway epithelial cells
+2
+Two
+Mcl-1-targeted
+respiratory disease
+CC 50 values >100 µM
+Synechococcus and Flavobacterium
+1.15
+aberrant polyadenylation
+87.5%
+rational shaping of immune responses
+mice to nonhuman primates
+the TSS
+Absorbance at 590 nm
+a model
+endosomal entrapment of Pip6a-PMO
+80%
+glycolipid-type
+inactivating a wide range of microorganisms
+chemokines, cytokines, and growth factors
+memory B cells
+Airborne transmission
+Hypothetical structures
+autocorrelation
+24
+1%
+Conditioning
+2
+Sequest data analysis software
+252
+PS-KH RdRp
+N.A.R.
+Streptococcus suis
+inter-specific virus recombination
+pulmonary capillary permeability
+anti-gB antibody titer
+shorter skeletons and some bent bones
+ф04ф44EE4
+copy numbers/mL
+genome-wide mutational pressure
+0 -self-isolate-to 1 -resuming normal activity
+9
+a panel of variants
+over 40
+Early radiation
+3 ′ poly tail
+CORINA
+Many years of research
+the academic community
+AcpS
+n
+CNP
+changes in diet, microbial intake and antibiotic exposure
+CD4 + T cells
+one fifth
+regulate excessive complement activation
+ATF4-CHOP
+H i
+Twenty-eight
+5 m
+2 log PFU/g liver
+NIV
+molecular
+0, 40, or 120 mM
+~40%
+class II aPMV-1
+molecular dynamics
+12
+Umbilical cords
+2007
+Picornaviridae
+291
+208
+conformational changes in substrate proteins
+18
+stimulation of IFN-target genes
+Picard
+K63 linkage
+Syp1
+9-14 days
+28
+PBS-only samples and S. aureus ΔisdB::erm
+RNA-sequencing
+long planning horizons
+6K and TransFrame
+8%
+1Á5 ml of serial dilutions prepared
+1%
+polybasic amino acids
+inappropriate sequestration of critical cellular signaling proteins
+mucus obtained from children
+rapid diagnostic tests
+6.73E-4 s/s/y
+>25% difference in complete VP1 nt sequences between isolates
+less than 50 kDa
+52
+Ingenuity Pathway Analysis
+six
+leukodystrophy
+Ebola Hemorrhagic Fever
+repRNA accumulation
+fifty-six
+0.5%
+SSP
+201
+cross-breeding
+Pre-stained markers
+how the emission probabilities are modeled
+anti-CYDV-RPV
+adverse events
+cough and wheeze
+NP-40
+day 10
+28 weeks
+phenolics
+unwell
+attitudes towards pH1N1 vaccination
+pulmonary disease
+hydro dynamics
+subsyndromes
+49
+nested RT-PCR
+Sar1, Sec23, Sec24, Sec13 and Sec31
+hundreds to few thousands
+through communities of potential vector organisms
+Mass data stored in the medical system
+biochemical and computational "selection" of particles
+cross-species transmission
+Understanding emergent disease theats
+on-going
+Natural herbs
+138 × 10 3 /μL
+spo0A and sigH
+reproduction number
+live virus
+restricted peptides from CSP
+Non-recognized peptides
+SDS
+Cox proportional hazard modelling
+Perturbation of the rafts
+A broad distribution of sites under positive selection
+asialoglycoproteins
+4 days
+susceptibility
+Agilent Feature extraction software
+Lachrymal fluid
+TransIT-mRNA Transfection Kit
+Co-infected
+977
+air travel patterns
+Step 2-4
+Nucleoprotein
+Data-driven individual-based simulation models
+three
+glass coverslips
+the folding of hLysRS and assembly of MSCs
+through control lines
+hijacking the replication apparatus of the host
+apoptotic bodies
+congenital tremors, reproductive failure, and multi-systemic inflammation
+13
+country-specific
+IgM
+Toll-like receptors
+Poisson
+higher amounts
+ECG leads
+Ad-SCT-HHD
+RSV
+X-ray scattering
+branching theory
+sedimentation in a sucrose gradient
+40
+6
+90-day
+19
+Interstitial pneumonia with secondary PH
+PCC
+A hot water bag
+20
+Reconstruction algorithms
+Situationist moral psychology
+mutational silencing of CBPs
+150 million
+Unsupervised PCA models
+higher processing capabilities
+time
+dipeptidyl
+correlation coefficient
+physical-dynamic properties of PcG
+mutation of the C:R interaction sites
+downstream
+v 0 and v s
+maritime quarantine
+IL-7 plasma levels
+physical barricades
+261
+3BEV
+RNA-seq
+10 min
+epidemic threshold theorem
+Central and South America
+collagen deposition and pulmonary fibrosis
+constant number, constant volume, and constant
+DENV infection
+Gleason 3 pattern
+smoking status
+P
+MDA5
+Treatment
+Six
+SLO and SpeB
+rnTrpL
+15
+4uC
+2-5A
+three
+increases
+PRISMA
+SPR analyses
+important
+the two terminal residues of the peptide
+Medical imaging
+18.0
+CP-binding conformation
+two
+force clamping
+Poly I:C
+10 angstrom
+nonspecific multiple displacement amplification
+surveillance
+3.7%
+dates of report of the infected animals
+acclimation ability
+N-linked glycosylation
+weather extremes
+humans
+four
+VECTASHIELD mounting media
+5 minutes
+they are far more abundant than the viral RNA
+stimulate chemotaxis and decrease viral infectivity
+B-CLL
+knowledge about the antigenicity and immunodominant region
+97%
+type I IFNs
+Preventive Medicine Association series
+tight junction formation
+suicide risk
+angiogenic
+anti-inflammatory
+""
+PML mobility or normal assembly into NBs
+More specific reagents
+Peptide arrays
+lower immunogenicity and increased stability
+NGR-modified nanocarrier
+Fisher exact test
+A, A, and A
+War and violence
+C-terminal tetraspanin
+P3 and P9
+ACE2 −/y mice
+in-silico
+modest increases
+2
+structural analysis
+Rituximab
+mice
+intraperitoneal ketamine/xylazine injection
+FreeBayes 78
+3 h
+30,000 MDCK II cells
+early 1919
+lifestyle factors and co-morbidities
+elevated levels of IRF4
+System dynamic models
+100 ng of the DT neutralizing antibody
+95%
+convenience methods
+Cloning and sequencing
+N63Y
+envelope-mediated
+43 g/l
+proteolytic
+options for selecting the SVM kernel type to be used
+Ubiquitin-specific proteases
+maternal and infant clinical characteristics
+cc-by
+seven
+pharmaceutical
+SUMOconjugated proteins
+electrochemical
+CQ
+ACC1
+1998
+residues Glu164, Glu205 and Lys344
+TMEV-specific IHC
+IFN-γ
+10%
+SLO-like ELFs
+61.9%
+different modeling steps and all available surveillance, genetic and experimental data
+≥50%
+HO-1
+Saccharomyces cerevisiae RTase
+defining genetic influences on the host response and outcomes in patients with sepsis
+Student's T-test
+transition rates between life and infection stages
+bacteria from the nasopharynx samples
+affinity purification
+pyrophosphatase
+Acidic fibroblast growth factor
+survival
+1248
+25
+EV71
+strains
+cross-neutralization studies and phylogenetic relationships
+10 min
+SA11 rotavirus
+the fraction of all trimmed segments which match their counterpart
+Indel mismatches
+Parameter values
+Medium
+NA
+34%
+MYC activity
+Immunostaining
+means ± SEM
+2 weeks PV
+cytotoxic T cells
+EDTA-free protease inhibitor
+endangered wildlife
+RV16
+1 mM Mn 2+
+zinc, potassium, and calcium
+binding of C. difficile Spo0A
+ACU
+schwannomin
+N-X-T/S
+96%
+binding of sera
+school closure
+inhibit HMGB1 release
+Guangxi and Hunan
+vasoconstrictor effect
+virus isolation and antibody detection in serum and milk
+Postoperative pulmonary complications
+the OST complex
+ACE2
+QDE-2
+NK cells
+tissue culture
+CLEC4C DTR mice
+ACE2
+GlcCER
+real-time RT-PCR
+a large number of new programs
+expression levels of all downstream genes
+canonical and noncanonical
+padlock probe
+GAPDH
+the normal barrier
+selected cellular gene transcripts
+the PI
+CEACAM1 BAC2 DNA
+the level of aggregation
+SKM-1 cells
+MDCK cells
+SD rats
+decreases
+malls, hospitals and public transport
+December
+10-fold
+infectious entry
+Dg and Dwt
+regulating the mechanical stability of red blood cells
+4 days
+RMSD calculations
+VSN model
+HCV
+tumor micro-environment
+Kindling
+43.59 %
+25%
+cc-by
+Arterial blood gas saturation
+how many people each case actually infects
+SGG-A, MJ-C and MXJ
+V but not F antigen
+The level of significance for terms and groups
+encodes 3A
+0 copies/ml
+Probiotic agents
+environmental surveillance data
+95.2%
+MERS
+AMR
+GRP170
+RC
+D502F
+Simply having those HLA types
+endosomal exit
+an irreversible T3SS inhibitor
+QIAamp Viral RNA Mini Kit
+altered expression of hepatic microRNA
+110
+Visitor data
+Singleplex PCR
+the trees
+other receptors play a role in viral entry
+Module N0
+polar and hydrophilic
+the antigen used for immunization
+pleiotropic
+Inhibition of hemolysis
+Two
+Interferon-induced transmembrane proteins
+Twentyfour
+30-min
+in triplicate
+Oneway ANOVA
+airborne transmission
+security and dissemination of sensitive human data
+F5L
+senior intensivists in charge of the respective ICUs
+losing bistability
+viral capsid
+6 months
+>0.6
+SJPL cells
+Thailand, Japan and China
+administrative positions held by senior workers
+WHO's regional and country offices
+RV-C and RV-A
+Hemolysins produced by GAS
+95%
+observations
+founder-specific modifiers
+rs2233860CC
+seven days
+repeated dosing of nanoparticles
+Pulmonary alveolar proteinosis
+iron-depleted
+Substitution rates and dates of ancient divergence
+6
+214 million
+increased faster
+BglII and subcloned into pQCXIB
+relative humidity
+deleterious
+Black pepper powder
+DAPI staining
+translocate to the action point
+hours
+Dengue virus
+30 sec
+protective antibodies
+VA supplementation
+10.3389/fimmu.2016.00535
+1.2-1.5 ×10 6 cells/mL
+premature aging and/or death of pathogenic immune cells
+obesity
+pulmonary hemorrhage
+8,825
+percentages
+quantitative meaning
+72 h
+Control group and LPS group
+PaO 2
+17.8%
+eliminate the collection of the top 25 most abundant ions
+Prohibitin
+diagnostic codes
+third pandemic waves
+protein factors
+correlation
+delphinidin 3-sambubioside
+Fifty-five
+formation of atelectasis
+DEFA1
+Core FertiQoL
+VSV-I and V920
+SCARB2
+albumin and transferrin
+reduce the inflammatory response
+12 months
+14,772
+leaky ribosomal scanning
+challenge
+rs12252-C
+35-40
+2
+C2a/Bb
+membrane anchor protein
+increase the ability to suppress bacterial replication
+Hitachi 7100 transmission electron microscope
+second half of the twentieth century
+449
+CD spectra
+cc-by
+extremely inconclusive
+TaqMan Array Cards
+integrative therapy
+arabinose
+thirteen
+HPV infection rates
+Newcastle disease
+24 hour
+114
+Transfection and expression protocol
+1 hour
+Protscale
+high background signal
+Whole blood
+13 weeks
+Adherence to simultaneous HIV and Mycobacterium TB treatment
+paired sera
+peacock
+CalcuSyn
+IFNAR1
+13
+Asian American
+corticosteroids
+Binomial response rates
+intrastrain variability
+62%
+Ratio A-Ratio Ao
+IL-4/ IL-13
+methylcellulose medium
+median confidence intervals
+Supernatants
+Three
+Proteolytic cleavage
+0.2 mg/mL
+eIF2α phosphorylation and ATF4
+the slopes of these lines
+25
+inflammatory
+67:11
+Protein-based lateral-flow devices
+nitric oxide
+splice correction assay
+Box1, Box2, and Box3
+Delaney et al.
+Phage therapy
+Three
+inflammatory cytokines
+mean m ¼ 9 days
+our prediction
+diastolic dysfunction or symptoms
+PV replication
+signaling transduction pathways
+at Ն20,000 ϫ g
+50 pmol of Pd 6 random hexamer primer
+EplBA holotoxin
+diversity in modeling approaches, and differences in measures of accuracy
+ten
+Romania
+poor diseasefree survival
+1,094,505
+5
+Table 4
+severe lung injury and catastrophic respiratory failure
+intron 16
+infection hazard function and survival function
+The link between our epidemiological model and the data
+virulence
+Sham-inoculated control animals
+non-uniform circular travelling-wave electroosmosis
+frustration, anger and anxiety
+preliminary
+February 2019
+narrow population bottlenecks
+2.2 ± 0.8 g/dL
+Fugong virus
+Kolmogorov-Smirnov and Shapiro-Wilk tests
+3.7%
+528
+RefSeq
+50%
+234
+truncated proteins
+ciliary beat pattern
+endpoints
+1
+PCR
+environmental and genetic
+5
+Circular dichroism spectra of peptides
+Zika Conformations and inhibition of Zika NS2B-NS3pro
+emergence or extinction
+chitin-binding
+chloramphenicol
+five
+Molecular evolutionary analysis
+PN-SIA28
+diffraction-limited dots
+11
+nonlinear
+3
+MAPE
+relative search volume
+Fibrotic diseases
+2004
+50 µM
+41%
+hemagglutinin
+probabilities
+naked virions
+extracorporeal blood purification modality
+46.89 KDa
+SE Asia
+urea
+Concanavalin A
+all viruses manipulate cellular processes to proliferate within the host
+double-stranded RNA-induced RNA silencing
+Sixteen
+RT-PCR
+16
+acidified LAMP1-positive
+five imputations
+37%
+close to the detection limit
+5 to 8 nt downstream of the slippery sequence
+10 ml
+0.25
+Three
+an epidemic stain
+4-6 h
+6.50 days
+Trizol LS
+luciferase reporter gene activity
+species-specific differences in miRNA expression
+averted productivity losses among caregivers
+21 days
+V iral respiratory tract infections
+21 292 and 31 083 TTF-1-binding peaks
+appropriate methods or models
+one week
+I49
+performance in multiple environments 1,2 and evolvability
+rapid neutralization tests
+wobble decoding efficiency
+airway smooth muscle cells
+p i
+lower risk
+324
+manufacturer-specific methods and algorithms
+a quencher dye
+satisfaction with money
+SEC61G, IL17RA, and HDAC11
+deadenylation
+error
+Coagulation disorders
+U46619-mediated
+Sinusal
+34-month
+Contaminants or pathogens
+Multiple measures
+10%
+1,737
+two hours
+Supplementary Table 2d
+Basigin/CD147 and CD36
+carryover
+À8.3 kcal/mol
+multiple sclerosis, inflammatory intestinal diseases and autoimmune diseases
+Sunshinevirus genus
+Twenty
+excellent internal consistency reliability
+gray-colored items
+standardize differences test
+thermal, mechanical and chemical
+10
+GII.4-2004
+vector survivorship
+when an intervention is introduced
+17,931 person-years
+an incorrect shape
+targeting of the ROCK pathway
+12% SDS-PAGE
+2′-Deoxyzebularine Incorporated into ssDNA
+uninjured TI cells
+Titanium dioxide or titania substrates
+18 days
+real time 3D simulation
+43710
+modernisation
+S-OIV
+hepatocellular carcinoma
+Table 2
+restrictions of informed consent
+as the sum of the scores for each parameter
+MPP software
+re-infection
+demyelinating
+delayed, transient or narrowly focused T cell responses
+3 days
+6
+JEV infection
+Activation of NF-B early following infection
+Participants with ARDS
+293T cells
+JSKM virus
+real-time polymerase chain reaction -based confirmation of Apdm09 infection
+1984
+CesT/CsrA polymerization
+10-fold cross-validation
+CRAB
+complete regeneration of the skin and the absence of scar formation
+15 minutes
+j f
+ice-cold buffer
+translational
+insufficient interaction with the epitope structures
+KD
+time series analysis
+Enhanced expression of Rab5 and dysfunction of the endothelial barrier
+m 1 G at position 37 of yeast tRNA Asp
+three
+nosocomial influenza infection
+0.5%
+15 June 2007
+the serial interval distribution
+six
+The GFP coding region
+nine
+N0
+Full sequence length recombinant F. hepatica Sigma Class GST
+migrant workers and their families
+half
+isobutyraldehyde or butanol derivatives
+0.02%
+Forty-four
+physiological and pathological
+MimoPro
+Taiwan National Health Research Institute
+Cys178 and His607
+N160 substitutions
+long-term
+18-24 hours post-infection
+100 μl of DMSO
+USP15 C250
+better survival with a higher BMI
+7 days post-infection
+close monitoring
+G protein-mediated
+multifunctional
+ten
+E804
+protects bacteria against alcoholic disinfectants
+high fever
+134,986
+schizophrenia
+AML cells
+my depression
+myelin basic protein
+1252 m
+27
+personal protective equipment and infection control measures
+60 L/min
+five
+A careful and targeted study design process
+surface capsid proteins
+neovascularization zones
+11%
+Two weeks
+28
+optimized binding to the pre-fusion E structure
+1.0
+Nanocarriers
+4 to 8 weeks
+sick animals and corpses
+six
+10
+cytokine signaling-6
+cancer and AIDS
+necrotic populations
+phylogeographic
+serum procalcitonin
+SIR epidemics
+RNeasy Mini kit
+14
+$285.70
+NHBE cells
+Cross-species transmission
+1,000
+respiratory epithelial cells
+two RNA species from rhMPV-infected cells
+CompaRNA
+p27 and p21 activation
+0.04%
+E T
+Twelve
+rhinovirus
+phosphorylated JUN
+Aspartic acid and asparagine residues
+Dynamic driving pressure during first 3 days of ECMO support
+Short interfering RNA
+transmission dynamics model
+Noroviruses
+dsRNA-binding
+Phylogenetic trees
+verbal consent
+reduced viral loads in the lungs
+Reduced gross and histopathological lesions
+glass extracellular
+572 years ago
+epidemiological
+every three days
+74% ± 2%
+mean generation time
+mass spectrometry and 1 H-NMR
+antiviral treatment
+10
+high phylogenetic resolution
+five
+growth, elevation, and midline fusion of the palatal shelves
+complex patterns of individuals arriving at and leaving a location
+1 week
+86%
+aerobactin
+78%
+PDGF-BB
+standard deviations
+AA 97 to 195
+containment strategy
+Filoviruses
+temperature and relative humidity
+ligation between fragments C and D
+dose
+Santa Rosa surveillance
+a macrophage
+2 minutes
+manage symptom and personal health data and organise diagnostic testing
+28%
+CPE
+An MS friendly solvent
+TssC
+1 hour
+225
+MZP inhibition
+The funders
+opportunistic screening
+Treatment of a variety of human ailments using mAbs
+32 million
+underdosing
+penicillin
+1 µl
+Alzheimer's disease
+four
+S k
+SNP plus VC
+CTLs
+Culture supernatants
+sIgA
+Cross-reactivity
+three
+1989
+cc-by
+Transferrin receptor
+immunosuppressive
+increased circularity and reduced area of microglia
+emergency services
+Downregulation of rDNA transcription
+urban slums
+Bio-Safe™ Coomassie G-250 stain
+CapoNPV
+44.55%
+unmethylated CpG recognition in DNA molecules
+high efficiency
+Short-term intubation ventilator
+viral infections
+normal coronary arteries
+IL-1β and IL-18
+Percoll gradients
+Growth medium
+pigs
+IAV replication
+26
+660
+Red
+> 95%
+kaempferol, ellagic acid derivative, and other bioactive molecules
+24 hours
+Incidence
+noroviruses
+selected SNPs and IA infection
+nursing
+non-treated
+psychological care and chronic illness management
+sweat chloride
+bind NE more rapidly
+105
+Correlation analysis
+Directional transsynaptic specificity
+Baseline data
+glutamine
+allosteric modulators
+10.4%
+global contribution to vaccine strain selection
+399
+73.2%
+Nearly two million
+240
+cc-by
+zebrafish and pufferfish
+Type 1 IFN responsiveness
+Q k
+proteins, lipids and carbohydrates
+6 months
+$33%
+cldn5
+8 pg/ml
+cytokine-induced lung injury
+GenScript USA Inc
+6
+vaccine supply
+Liver transplantation
+Mermithida
+to assemble all reads into a single genome sequence
+chronic neuroinflammation
+statistical significance
+twice the radius of gyration of the IDP domains
+oncogenic, immune evasion and EBV pathogenesis properties
+Mitochondria
+high viral titers in the lungs
+PtO 2
+12
+eight
+NF-κB
+16,529
+verapamil
+improving population mental health
+overlapping or obscured keypoints
+12,000 x g
+10 min
+0.898
+6 months
+nucleolar cavities or interstices
+the need for study participant consent
+27
+124
+outcomes of only patients undergoing non-ablative allogeneic transplants
+Perceiving risk
+we know exactly how many individuals they subsequently infected
+regulate key factors in the immune system
+PureLink ® RNA purification kit
+severe injuries
+logistic regression
+EPF
+caregivers
+Prp19 and Syf1
+cryo-electron microscopy of vitreous sections
+532
+phenol/chloroform extraction and isopropanol precipitation
+Sixteen
+Ty5
+fusion tags
+MHCI system
+bare polystyrene
+nuclear factor-B
+acetylation, phosphorylation and oxidation
+p 0.05
+Recombination
+~ 0,17 PFU/cell
+DAPI
+15%
+does not change
+usability, comfort, dexterity and impact on communication with patients
+7.26
+three
+limitations on cost, delivery and sustainability
+penicillin, cephalosporins and azithromycin
+linear epitopes or conformational epitopes
+CC
+NF-κB
+13%
+coping appraisal
+Adaptive Focused Acoustics™
+DAPI
+APOC1, SERPINA3, and CFLAR
+microscopic
+upstream intergenic promoters
+personalized
+40%
+coil-like
+4 days
+risk communication regarding protective behaviours
+PCR inhibition
+culture medium
+ALK testing
+Jackson Laboratory
+the membrane
+July 2008
+38.6 %
+storage temperature
+P. falciparum
+55.9%
+All data
+fresh medium
+awareness
+cyclophilin B
+two
+CAP patients at high risk of cardiac complications
+protein expression 161
+60 to 80%
+MMs
+AdV
+six
+hepatic infection
+E. Coli BL21
+each infected individual is removed with probability c
+29
+64.5%
+a5, b1 and b3 integrins
+9
+The emergency department
+highly specific
+prevention of human deaths
+total RNA
+Reed-Muench method
+Sierra Leone
+5
+IFITM3
+1.2 nM
+GraphPad Prism
+castration or death
+Sodium cations
+type 1
+Four
+a negatively-charged residue at position 250
+over 40
+untimely reporting, aggregation, and publication of data
+percentage analyses
+July 2014
+Hand washing
+interventions
+MgCl 2
+susceptibility, infectiousness, and mortality
+side-chains
+closed-format 3point scales
+selection for vector pesticide and antimicrobial resistance
+515F primer and 806R primer
+cell specificity
+patient-centred
+NO production
+adjuvant
+near completion
+neurological
+http://datasus.saude.gov.br
+RABV, VSV and NDV
+household-specific genomic variation
+similar results
+intracellular protein trafficking
+key elements of the successful real-time research response
+signaling pathways or proapoptotic Bcl-2 family members
+it undergoes rapid antigenic variation
+β SD t
+50%
+ICU
+histological
+15,000
+Western blot analysis
+2,000
+improve their service quality
+glycoprotein
+lavage fluids and cells
+upstream of the NS4 ORF
+natural selection
+immunosuppression
+YL, YZ, WZ
+NanoDrop 2000 UV-Vis spectrophotometer
+twenty-five
+CD29, CD44, and CD73
+β-galactose or N-acetylgalactosamine
+genome sequence data
+CD4 and CD8
+macrophages and dendritic cells
+pro-apoptotic signaling pathways
+urban
+approximately three dozen
+FKBP11
+National security
+11,325
+the combination of two distinct underlying mechanisms
+CpG TLR9
+quarantine
+AIV
+30 min
+GGO and consolidation
+S.D.
+genistein
+197
+45 min
+serial interval and human movement parameters
+hypoxemia
+increased risk of mortality
+statistical significance
+decreased virus production
+Integrase-mediated precise excision of mobile elements from the chromosome
+White spot syndrome virus
+P-gp
+the sample
+clearance/SVR
+public
+interfering with effective treatment
+silico
+spectral matching or clustering
+Eighteen
+E2-derived peptides
+green
+431
+∼5%
+After 2 d
+bacterial infection
+endoplasmic reticulum lumen
+seven
+10.53%
+less than 5%
+additional, useful information
+tRNA Gly CCC
+a transmembrane protein activated by protein misfolding
+Illustrated
+R2R correspondence
+HCV infection
+10 nM
+FLDS
+dynasore and chloroquine
+BF:BW ratios
+Schistosome genome-wide microarrays
+exon 3 skipping
+2019-nCoV
+almost no residual immunity
+Phosphorylated tau load
+lethal
+no relevant pathologies
+efferents
+both policies
+50%
+glutathione resin
+E5, E6 and E7
+large transmission clusters
+Mitochondrial
+immuno-active metabolites
+TLR4 antagonists
+up to 8 d
+the APC
+low-affinity p10 multimer interactions
+Bridge hosts
+two
+cellular biomarkers of illness
+reproduction number R and the reporting rate π
+day 3 post-infection
+11%
+STRING database
+1.37
+WST-1 cell proliferation assay
+vector-borne
+sanitation
+neoplastic tissue
+LN-resident DCs
+nine
+floating brain sections
+microbial
+nearly a hundred
+1,411,420 to 41,066,808
+cc-by
+Nsp2
+1 h
+10.1186/1471-2164-14-819
+low bacteria concentration in the sample
+3 years
+mammalian and mosquito cells
+host resistance
+binding buffer and column filter
+constitutively and continuously
+enzyme-linked immunosorbent assay
+Juan Carlos de la Torre
+host tropism
+The activity of b-glucuronidase
+3
+HRV-A25 and -A62
+21
+template size of amino acid sequences
+single chain Fragment variable
+innate effector cells
+pc4-LAIV
+BSEP, FXR1, and FXR2
+residues Thr77-Met84
+leukocytes
+2
+confirmation of the genuineness of the slow wave activity
+42%
+1.0
+leukocyte parameters
+health care providers
+nucleic acid
+fluorescence intensity
+more than 25%
+adenosine
+Sweden
+conserved coding sequences
+hippoboscid louse flies
+Seventy percent
+active
+automated image-based tracking methods
+212 m 3 /h
+snRNA U6
+400
+astrocytes
+18.3%
+prostaglandin E 2
+14 days
+collecting all relevant publication
+5%
+confidence interval
+temporal-window techniques for the change of parameter estimates with time
+protein signature candidates
+ACMSD
+Gene products
+78.8-78.9%
+Quantity One
+two protein products of env
+group 1 heterosubtypic protection from H5N1
+Bonferroni post-tests
+99%
+aneuploidy or gene fusions
+their workload
+Rt = 0 and there is no more
+delayed viral clearance
+The diffusive Network 1
+GraphPad PRISM7
+whole-blood cells
+Sputum
+G36-CD28z CART cells
+Quantitative real-time PCR RNA
+76-100%
+higher PTX3 release by human or murine DC
+a unique cohort of IQ memory-discrepant older adults
+Transplantation
+the start codon
+269,389
+controls were put in place
+Five
+dextran sulfate
+S6K
+3.87 ± 0.11
+caveolae-mediated endocytosis
+twice a day
+IL-6
+one year
+recruitment of processing proteins
+endogenous Hsc70
+Protein Sciences Corporation
+hypothyroidism and thyroid autoimmunity
+plasma COL1A1 content
+cc-by
+implement more informed actions
+Influenza A, B and C
+reconstituting different types of transporters
+effects on nutrient metabolism
+NANOG and L1TD1
+Bombyx mori nucleopolyhedrovirus
+scientific principles, available scientific evidence or WHO advice
+25
+ERK1/2, JNK, and p38
+homopolymers, isolated errors and hybridization artifacts
+CD8 + and CD4 + T cell epitopes
+HIV-1 Gag
+mutational pressure and natural selection
+ZIKV and USUV
+12 h
+PRRSV infectious clones
+A549 cells
+stochastic process of neutral drift
+6-week
+winter
+Dr. Mikhail Balayan
+H7N9
+allosteric
+JEV infection
+50-80%
+robust estimates of lung mechanics
+nucleotide regions that corresponded to each mature DENV protein
+301,651
+2.9
+John Sheehan
+Two microlitre of the FPM
+16.0.1
+rNMR
+the derivative or time rate of change
+vivax malaria
+Titrations of fluorochrome-conjugated anti-human secondary antibodies
+Flow cytometry
+Cuffmerge
+Turkey2004
+a very well-preserved mechanism for nucleolar retention
+exploration of a variety of approaches to cohort retention strategies
+Reduced gestational age
+interstitial pneumonitis and acute respiratory distress syndrome
+Pyruvate
+glyceraldehyde 3-phosphate dehydrogenase
+a 15-nucleotide thrombin-binding DNA aptamer
+Paladur mixed Cyanoacrylate
+2
+10
+70
+Polymorphisms
+higher splenic viral load
+U0126 or NH4Cl
+X-31
+catastrophic health expenditure
+three
+whether these microorganisms were causative pathogens
+hexagonal cells with 50 m radius
+higher cellular proliferation rates
+that for WT
+The slides
+to identify clinical and inflammatory features of airway inflammation
+Tri Reagent LS
+two-tailed Student t-test
+host movement
+defining a prior distribution for the parameterization and initialization of the underlying model
+contacts with a finite number of other individuals
+past outbreaks of Ebola virus disease
+one
+cell growth and apoptosis
+Three
+Bacillus Calmette-Guérin
+higher fluorescence-intensity populations
+blood-stage merozoites
+user-friendly
+heritable variation
+SEI300
+epitope spreading
+10%
+constrained disorder
+Olle Engkvist Foundation
+2.041
+protects colon epithelial cells from TNF-induced apoptosis
+PML NBs
+cytopenias, infections and infusion reactions
+situation report
+168h
+lack of fit
+A general and effective defense
+lung cancer cell growth
+MHV-68
+13
+M. gatae
+12 h
+1952
+by refolding the holo and apo quintuple mutant together in vitro
+chemical modification
+disordered domains
+immature type-II pneumocytes
+respiration
+ACE2 enzymatic activity
+Five
+computational evidence
+Matlab 6.1
+97%
+University of Rochester Committee of Animal Resources
+replicate
+MS2
+scoring systems
+Data parameters
+unclear
+More than 90%
+Area under the curve analysis
+antimouse IFN-c and IL-4 antibodies
+influenza transmission factors
+early growth response factor-1
+porcine MoDCs
+asthmatic wheeze and severe lower respiratory infections
+Bioinformatics approaches
+hospital crisis prevention plans
+clinical practice
+chemokine and cytokine profiles
+HGF
+Mitomycin C
+sleep disturbances
+selection
+Ontario
+new genes regulators of SG formation
+sodium vanadate
+age-dependent death rates
+A and B
+Glycogen amount
+lncRNA NRIR
+50%
+29 years
+collaborative cross
+a large study
+1 3 10 6 cells/well
+biospecimen
+Andrea Leibfried
+rifampicin
+antimicrobial management
+1
+greater antiviral potential
+Jonathan Yewdell
+aggregated NP
+APMV-1
+Huh7 and Hep3B cells
+five
+25%
+1%
+which patients were assumed to be susceptible
+surface exposed clusters of amino acids
+forty four
+transmission via food to humans
+New Zealand White rabbits
+AMPK and mTOR
+seasonal
+the original cDNA preparation
+BedTools
+time
+respiratory syncytial virus
+15
+CD8 + CD28 -T cells
+fluorescence polarization and isothermal titration calorimetry
+SES
+2.5% glutaraldahyde solution
+signs of disease
+AutoDock
+lack of data of bone marrow aspiration
+Neuroinflammation
+anthraquinones
+Espirito Santo
+RIPA lysis bufferextracted protein lysates
+0.99253 to 0.99980
+structure-function
+once or several times
+sex and age
+1992
+PCV3 cap gene
+JMP 7 or SAS 9.1
+a mixing matrix
+IFN-α-mediated cell apoptosis
+May 2009
+Hyperthermia
+no mutations in CORO1A and CD3D
+30 min
+antigenicity
+Sixty
+Prokaryotes
+FoxP3
+Influenza NA glycoprotein
+pulmonary alveolar hemorrhage and larvae
+Eighty-three
+Equine
+mice
+50,000×
+adaptation through mutation and selective pressure
+3.9
+suicide
+NPC-TW01
+negative pressure
+Thirteen
+Eighteen
+Calcein-AM
+7 months
+identical 5′ and 3′ crossover boundaries
+2%
+host cell machinery
+supplementary eIF3
+Supernatants
+ImageJ and Aperio Imagescope
+various autoimmune disorders
+Masopust
+3.5
+16
+sPLA2
+20 minutes
+SASP mediators
+2005
+BSL-4
+Increasing the time
+REPLACE
+Angiotensin-converting enzyme 2
+ABL90 Flex Blood Gas Analyzer
+fever, nausea and myalgia
+Oxidative stress
+graphdistance measure
+A plaque assay
+Autophagy
+helium analyzer
+cells isolated from these animals
+Publications that undoubtedly failed to meet all of the inclusion criteria
+Half
+trapping microorganisms
+mRNAs Dissimilarities
+Renilla luciferase 33
+13
+MitoSOX
+Consensus sequence coding target antigens
+subgenomic RNAs
+3,168
+streptococcal studies
+Animal research
+increases
+host genetic variations and sex differences
+MSFsc
+cytopathic
+Maternally expressed gene 3
+stepwise logistic regression with binomial errors
+bound to TAMRA-labeled mUb-PA
+the animal losses some of the characteristics valued by buyers
+five
+Nepal
+specific ladder bands
+Vero and BHK cells
+TRIzol
+growth-inhibited hybridoma cells
+The particle size of AnExILs
+Direct delivery of ODNs or nucleases into skeletal muscles
+agents
+compartmentalization of the viruses
+an edge
+endemic equilibrium
+70% to 80%
+eight
+15 min
+Caco-2 cells
+Gene ontology
+the probe
+Complement activation and consumption
+54
+STL
+20 mM ascorbic acid solution
+Mat0-RNA3 vector
+3-MA treatment
+higher mRNA stability and higher translation potential
+anti-viral therapies
+total effect rate
+peripheral lymphocytosis
+orange
+Dysregulation of the mucosal immune system
+six
+EAPC1
+totarane
+cathepsin G-like
+SL and PWH
+Recovery events
+two
+the mean of the serial interval
+independence between latent period 0 and the infectious period
+endomysium
+TNF-a and IFN-g
+RAN translation and frameshifting
+Structural details
+stigmatization and discrimination
+the next-generation matrix
+a species ability to respond to disturbance
+GADD34
+iatrogenic anaemia
+the correlations between the variables and component
+Continuous surveillance and genome sequence analysis
+Household epidemics
+Houghton and colleagues
+Exhaustive investigation
+overly disruptive
+36 weeks
+30 bp to 107 bp DNA fragments
+Bligh & Dyer lipid extraction technique
+C069
+Sequencing from LoFi-infected muscle
+90%
+influenza A
+Indonesia, Malaysia, Singapore and Thailand
+18
+Over-reliance on genomic studies
+relatively high
+total bilirubin levels
+Log-rank test
+Pulmonary TCs
+Culture aliquots
+4,096
+mousepox
+Scenario b
+30%
+1,000
+Twelve days
+important
+glycine
+RSV
+Arms races
+Kaplan-Meier product-limit method
+reduced RTA transcripts
+three
+does not significantly decrease viral replication
+0 to 2.7
+88541
+RelA
+oxidative
+HmE
+dusky
+Benjamini and Hochberg method
+short-term economic returns
+Intrinsically disordered proteins
+implemented interventions earlier
+The concentration of extracted RNA
+MAb 6D6
+resistance to common pathogens
+PCA
+hormones
+swine
+reduced viral protein
+10 mM phosphate
+Group C
+leucine
+primary C-OH
+p53 and the Bcl-2 family of proteins
+FlowJo
+0.1%
+slow
+NS3 protein of flaviviruses
+proteins
+6 months
+between 4-12 hrs
+HCV protease
+iSOCKET
+TMP/SMX
+90%
+Target gene expression
+Nucleic acid based testing
+the ability of the neural networks in dealing with alignment problems
+novel strategies
+restrictive strategy
+20
+99%
+milk production
+pro-inflammatory
+understanding this complex system
+temperature and rainfall
+Pneumocystis carinii and P. jiroveci
+5-fluorouracil
+candida's ability to evolve and ultimately escape the host immune surveillance
+Flower Pollination Algorithm
+Bradford method
+Humira
+cell type-specific ITAFs
+alter tumor cell morphology and status
+sourcing clinical specimens
+protein-protein interactions
+simulations
+ALI
+real-time PCR
+acceptable internal consistency and good patterns of construct and convergent validity
+activate the expression
+use of mobile devices
+1 minute
+bystander tissues
+agent-based models
+physiological
+complement activity blocker 2
+liquid impinger
+close to 100%
+Hepatoma stem cells
+GI dysfunction and nutritional feeding intolerance
+inhibits the replication of different families of DNA viruses
+53%
+CD4 − 8 − αβ T cells
+delta and sigma oxygen
+necessary basic precautions
+pinpoint novel targets to address DENV infection
+In vivo studies
+12
+MCF7
+The need for a common behavior
+1:40
+ScFv
+MRSA 63718
+12
+an aggregation of MDR-Ab cases
+3D finite element method
+HILIC-HPLC
+T~RzV
+Google Scholar and ISI Web of Science
+diagnostics
+coverage
+359
+EMCV ; IAV ; ZIKV ; HCVcc
+mAbs
+21
+laboratory information system datasets
+supply and demand for oxygen
+Naegleria
+SelP
+difficult decisions
+positive responses
+260
+H5
+off-diagonal cell
+pyrethroids
+the infection
+integration into host genomic DNA
+357
+Institutional Standards for Use of Animal Laboratory Animals
+SimPlot
+EBOV infection of murine peritoneal macrophages
+COVID-19
+Three
+serial interval
+GraphPad Prism 6.04
+lethality for chicken
+Five
+Physician factors, insurance status, hospital policies, and maternal preferences
+contribute data and implement metadata standards
+pleiotropic
+NIAID Influenza Research Database
+Based Oxygen Carriers
+ROC analysis tool
+influenza A
+4%
+K25
+anti-HCV activity
+14, 5, and 35
+how similar to their own circumstances were those who had died
+A263E
+14 %
+RNA
+more than 8 hours
+the above procedure
+spleen and lymph nodes
+wPipI
+the long-term outcome of the patient's neurodevelopment
+tenderness and pain
+quercetin
+concatemers
+innate immune responses
+DNase stop solution
+respiratory viruses
+390 million
+preS1 peptide
+A branching according to the feeding group
+97%
+Fc-dependent
+Codon optimization
+very low numbers of or no new infections per time period
+brain function and brain repair
+perceptions of swine flu
+viral shedding profiles or HI antibody titres
+76% and 96%
+multi-dimensional
+The corresponding authors
+50%
+108
+The cleavage site sequence
+ABCB1-mediated efflux
+junctional proteins
+Parr and Yang
+Sierra Leone
+decreased
+improved cross-reactivity
+tissue-resident immune cells
+sooty mangabey
+a graphical risk 10 assessment tool
+life-threatening blood-borne infections
+delays in seeking assessment and treatment, diarrhea, and poor nutritional status
+bats
+Genetic variations
+Circle size
+Anhydrous potassium carbonate
+3417
+horizontally transferred genetic elements
+no change in this gene expression
+7.6 ± 0.2 min
+reverse vaccinology
+VOSviewer v.1.6.5
+one fifth
+5 0 -OH groups
+DNase I treatment
+Qubit Fluorometer
+102
+tidal volume and resistance of the respiratory system
+distribution inequality
+particle-antigen linkages
+KAT2 enzyme activities
+Activated CD4 T cells
+Females
+Reducing land travel
+compartmental model
+Severe PAP
+residue 77
+targeted quarantine/vaccination
+stable RNA G4s in the 5 0 -UTRs
+One-way ANOVA
+HY
+chromogenic and fluorogenic
+inhibits Plasmodium invasion
+6%
+U3 and RNP
+12
+Nanozoomer C9600 Whole Slide Scanner
+19-fold
+36%
+C→T
+35 d
+more aggressive therapy
+VPg
+43
+Fish host NNV resistance
+adverse events and worsening of symptoms
+lower levels of disability
+a patient sample
+160
+four
+Rainbow trout sequences
+purifying selection
+hens eggs
+reverse transcription-polymerase chain reaction
+capped RNA
+murine ELISA development kits
+serum M2e-specific IgG response to the vaccine
+Listeria monocytogenes
+twice
+Acinetobacter baumannii
+study methodology
+clinical
+> 0
+divergent influenza subtypes
+0.3
+delivery of splice-switching oligonucleotides
+a prior suicide attempt
+18S rRNA
+individual differences
+regression of KS lesions
+cc-by
+28 days
+hV D i
+hematoxylin and eosin
+768
+30
+OPLS-DA
+the patients' medical records
+six
+clinical staff competency testing
+28
+52.7 ± 11.6 years
+Anopheles albimanus
+systemic corticosteroids
+12-15 hours
+The amounts of nitrites
+infections or non-survival
+domestic dogs and wild carnivores
+cloud-based
+pathogen associated molecular patterns
+IL-4 rs2227283 and IL-10 rs1800871
+NanC
+36
+ORFs
+hybridization with a perfectly matching target
+Univariate analysis
+electromagnetic, piezoelectric, electrostatic, and electrothermal
+inflammatory arthritis and autoimmune encephalomyelitis
+One hundred and ninety three
+gentamicin administration and oligomer-induced exon skipping
+hydrogen bonds of 5.0
+two
+differences in genetic background and environmental context
+SHC1, PI3K, and PLC-γ-1
+oxidized low-density lipoprotein
+I-TASSER online service tool
+adipocyte differentiation
+5
+meningitis
+AAT
+insane
+The dashed reference line
+EcSGA1
+Rabbit IgG
+high and stable expression levels
+Blood samples
+three
+A
+methanol-d 4 and DMSO-d 6
+Predicting the course of AMR
+Figure 4b
+two
+Sepsis
+Fifty-three
+Heparin
+mast cells
+2 hemagglutination units containing 2Á10 7 virus particles
+50%
+Gene ontology annotation
+72% identical
+Zn 2+ binding motif
+BLAST
+paracrine
+Sigma
+lower
+Respondent-driven detection
+nonlinear
+metabolic stress
+longer
+γ
+3
+mutation scanning throughput
+induction of IFN-c expression by Tregs
+duplicate ports
+NoLS candidate segment region
+Identification of specific pathways
+Two
+2%
+a i = 1
+12 IU/L
+four
+Exhausted CD4+ T cells
+1 h
+understanding how and where they put their resources
+risk assessments from authorities
+viral metagenomic
+nucleoside transporters
+Role-playing
+DNA, RNA, proteins, and other biomolecules
+35,394 nt
+clinical interventions
+availability
+papain
+a wash in
+1:1,000
+functionally consistent
+six
+Partek Genomics Suite
+3
+UCSF CHIMERA and MOE
+Bacillus anthracis
+Sabin oral poliovaccine
+mice
+bidirectional Sanger sequencing
+two-thirds
+Inhibitors against C3 and C5
+six
+alveolar neutrophil emigration
+communicational activities
+DAPI
+inner-body viruses
+10%
+Co-infection
+5-nt helical region
+p
+community doctors
+Icosahedral virions of 18 nm
+p38
+clustered transmission
+896
+Microarray data
+metabolic
+haplotypes E and E1
+University of Chicago
+chemical kindling
+prion-like fibrillary aggregates
+severe bottlenecking
+Univariate analysis
+Group 1 species
+3,080
+Z-FA-FMK
+P.F.S.
+Monoclonal
+anemia and the need to restore adequate oxygen delivery
+A/Victoria/361/ 2011-like virus
+VIGOR
+protein kinase A
+randomly
+more optimistic
+B cell survival
+serial passage of the wt RVFV ZH548 strain
+595
+1 hr
+RC i
+IL-8 and CXCL-1
+18 bp sequences
+polyclonal serum
+impediments to granularity and generalisability
+31%
+Affinity grid maps
+protective immune responses to T. gondii
+Nucleospin Plasmid QuickPure kit
+cholesterol mislocalization
+in-patients
+Five
+variation in the strength of directional selection against mutation pressure
+1:4 and 1:40
+80 to 100%
+ensuring patient safety
+dried bitter leaves
+kidneys and myocardium
+PI uptake
+343
+SEOV
+1.3 × 10 5 per well
+minimal
+in vitro
+eRF1
+1989 nucleotides in length
+Milstein Award
+stable
+10 μL
+R=2
+high cautious infection control measures
+One hundred
+vesicular stomatitis virus
+forty six
+4 hr
+vimentin intermediate filaments
+G1/S transition
+two
+1 min
+miR122
+New predictive biosurveillance supply/ demand architectures
+fecal-oral routes
+Physicians and health care providers
+two
+GNMT
+BCC cell migration and invasion
+health information technology services
+FlowJo software
+equine-derived products
+the lung
+cancer cell proliferation and metastasis
+preexisting immunity and immunological potency
+hepatic GFPdgn protein levels
+5.3%
+neuraminidase inhibitor resistance
+2 h
+total B cells
+shellfish
+Astrocytes
+experimental animal systems
+nm 5 U
+bDNA
+17
+Johns Hopkins Medicine Institutional Review Board
+Cell lysates and culture supernatants
+symptom score
+influenza A subtype H1N1
+regulating EV71 viral protein synthesis
+differences
+14 days
+four
+Colless Index
+Toll-like receptors
+$2300
+mut pcDNA3.1-NS1
+considerably high or completely abolished gliding activity
+low
+the nucleoprotein complex
+hemangiomas
+demographic change and sparsely populated areas
+reverse transcriptase negative control
+my thesis
+47%
+10218
+Six-week-old
+formation of pseudo-particles
+binding consequences
+The rank column
+Sewage metagenomics
+surface expression of WT or Δ F508 CFTRs
+Barach
+influenza periods
+1:3 forty eight hours
+>75%
+Transition probabilities
+k max
+trichloroethylene
+.90%
+respiratory infections
+increased host specificity and an innate immunity defect
+epigenetic regulation
+IgA and IgG
+Peste des petits ruminants
+using PicoGreen and a plate reader
+0.09
+Bat Circovirus Porto Alegre
+MSC-CM
+13,206
+CMV promoter
+naïve mice
+2020
+abrogates the radiationinduced increase in BRCA1 level
+2009
+anti-cancer, anti-inflammatory and anti-microbial effects
+few
+Tky/05
+a promising future for cancer therapy
+7
+increased expression levels of LC3-II and LC3 puncta
+ellipsometry
+alternative control measures
+cell membrane-derived vesicles
+gel electrophoresis
+half
+female
+apoptotic death of infected cells
+summer and Christmas holidays
+Figures 2C-E
+mass action mobility
+more than 3000 l
+liver cirrhosis
+33%
+Ն20 SFCs/10 6 PBMCs
+reasonable
+inhibits IRF7 translation
+2.8 days
+NeuroHIV
+to inform or change behavior
+electrophilicity index
+45%
+polyclonal anti-RSV antibodies
+known case counts
+serious consequences
+99 per cent
+Pneumonia
+a self-administered survey
+network sizes
+T7 RNA polymerase
+MarvinSketch
+Q5 site directed mutagenesis kit
+ORFeomes
+20%
+specific factors relating to disease severity
+Band intensity
+Scrub and murine typhus
+environmental context
+four
+90% in trans and 10% in cis
+astrocytes
+poorer prognosis
+insufficient data in Level I
+their roles in regulating host mRNAs
+Table 4a
+45
+414
+software name
+Foxp3 Transcription Factor Staining Buffer Set
+574
+nuclear localization of NP
+inhibits the human IFN-b gene
+multidrug-resistant
+AMA positive PBC sera and control negative sera
+832/13 cell line
+Abiotic reactions
+Real-time RT-PCR
+75%-80%
+three
+daily
+Creative Commons Attribution License
+Ser92, Glu72, Pro143, and Arg227
+14%
+Section 4.2.2
+2
+Guinea pigs
+ICU
+368
+13
+randomized controlled studies
+Risk as hazard
+10.6%
+20 L/min
+µ t and s t
+Six
+5 days
+37.5 ml min −1
+EGFR
+sources of contamination
+Differential cell counts
+S-foci
+Virus titration
+120 minutes
+licorice root
+1.6
+assay sensitivity
+N34, N44, and N51
+Qiagen-RNeasy Mini Kit
+fluorescent antibodies
+Vimentin
+outbreak dates
+seven
+lysosomes
+1%
+13
+Corticosteriods
+hepcidin
+Safety Review Committee
+quenched
+>70 mmHg
+Alternative reading frames
+3.6 kDa
+Centrifuge
+Functional residual capacity
+action potential duration shortening
+piperacillin/ tazobactam susceptibility
+pB ijk
+Guillain-Barré Syndrome
+more complex
+two
+reduces the growth
+r 2
+0.08-0.12mm
+ggplot2
+HCV reference sequence AF00906.01
+Antagonistic
+age, exposure history, medical-seeking behavior and underlying diseases
+influenza-associated encephalopathy
+iCyt Reflection or SY3200 Cell Sorters
+to reverse the cycle of neglect
+diVerent strategies
+non-radiative energy transfer
+cold
+quantitative pharmacological
+Robustness
+compromised cell fitness
+state-space model
+Magnetic Fluid Hyperthermia
+probability of cell activation
+low expression levels
+Oral and respiratory mucosa
+unchanged
+2.79610 -8 M
+Seventeen
+nucleic acids of pathogens
+Ribosome biogenesis
+low relative deviations
+ZIKV E protein
+2.5
+GRA and GR-SU
+ISG15 species-species differences
+lysosomal acid lipase
+P. amnii
+0.5%
+human NTCP
+Fold difference
+human TfR1
+Mean field theory
+Emerging diseases
+they will be followed until they achieve one of the aforementioned outcomes
+0 -negative
+Mann Witney Utest
+disulfide exchange in domain 2 of CD4
+Interest in research on IL-35
+inactivated monovalent
+39
+human embryonic kidney epithelial 293T cells
+Neutrophilic pulmonary infiltration
+PPE and procedures
+pulmonary inflammation during viral infection
+cryptococcal meningitis
+efficient direct N 1functionalization
+comparative genomic
+3%
+PEG-precipitated RSV
+2%
+multivariate
+by decreasing magnitude of difference between non-carriers and carriers
+25%
+Annotations
+1 mg/ml fetuin per well
+AAV-Ova
+air filtration
+weekly
+high-speed counter-current chromatography
+Drosha
+1000
+breast cancer survival
+immunized mice
+Ten
+4 days
+environmental aspects
+five
+aldehyde dehydrogenase
+solid Karmali media
+infect a wider host range
+lacZ
+Feedback regarding the mobile app and its content
+10
+phosphorylation of tyrosine resides in STATs
+phenolic
+Lemma 2
+antisense oligonucleotides
+RTA transport to the cytosol
+easy synthesis, relatively low cytotoxicity, and good degradability
+27 neuraminidase inhibitors
+2
+CT-scan
+HA
+resistant microorganisms
+pronounced genetic variation
+1 week
+headache, fever, nausea, or vomiting
+recombinant RNA 3s
+TREEVIEW
+exogenous IFN-g
+Maintaining animal health
+regression analysis and analysis of variance
+Sequence alignments
+oral fluid
+IFITM3
+November 1918
+the condition of the samples
+21 days
+8 weeks
+death
+lowest
+Quant-iT™ PicoGreen® dsDNA Assay Kit
+A statistically significant drop in nAb levels
+tissue damage and inflammation
+haplotypes shared by groups of strains of various sizes
+hypertension
+urine metabolites, blood glucose, pH value, liver function, and infectious agents
+6
+October to January
+Macrophage-tropic HIV-1 Env
+public health classification
+FP7
+GenScript USA Inc
+mutational pressure
+82 C
+Selecting culturally tailored messages and frequently used local communication networks
+stochastic branching process model
+mutations in one specific gene -GATA2
+DX600
+29
+Magmax Total RNA Isolation kit
+Keywords
+pro-apoptotic
+H 2 O 2 to oxygen and water
+four
+DC protein assay
+four
+Road traffic accident
+January 1, 2003 and December 31, 2008
+non-randomness index
+Xiuchen Guo
+the relevant university ethics committee
+− G non polar
+85% or 55%
+three
+increase
+Construction of porcine CCL25
+arthralgia
+spectrophotometry
+two stable DNA hairpins
+stx-positive
+oncolytic
+Statistical
+non-permeabilized condition
+working with highly pathogenic avian influenza viruses
+50 mg/mL
+B and C
+19
+3 years
+Humanistic care
+completion of the form
+IL-10
+46,864
+oxygen solubility
+Class cancelation
+MS data
+negative extraction control
+GraphPad Prism
+viral
+less than 12 weeks
+Dr. Stephen Dewhurst
+Pre-disaster preparedness, response planning, and policy initiatives
+cDNA template
+30-50%
+Serum
+interstitial fibrosis
+16 h
+University of Alberta Health Sciences Laboratory Animals Services facility
+X protein
+200,000
+Cryptococcal meningitis
+depressive-like behaviors
+VP4/VP2 coding region
+the number of mammalian species that overlap with the target species' geographic range
+52%
+Over two dozen
+12 h
+45 minutes
+Granzyme A
+enhanced the proliferation
+four
+63%
+Bradford reagent
+personal protective equipment
+heteroxenous
+improved
+Levey-Jennings plots
+γ-irradiation
+electrophysiology and immunohistochemistry
+experimental design of nucleolar targeting
+anti-ADAMTS13 antibodies
+poor clinical prognosis
+Pairs of sera
+bacterioruberin
+IP-10 and I-TAC
+herpesvirus
+10
+Physical interactions between human proteins
+northern, central and southern areas
+H9N2
+a stool sample and a nasopharyngeal swab
+5
+trade, demography, transportation and economics
+cathepsin B
+highly standardized
+poor cross-cultural communication
+Autophagy
+Tolllike receptor 3
+endogenous lamin is cleaved
+total cell or pre-IP extracts
+The construct bearing the double mutation
+24,604
+host sumoylation
+Cervical cancer
+comparative
+rLuc activities
+62%
+Amino acids
+VEEV, WEEV and EEEV
+statistical
+expression of genes involved in cell cycle progression
+J5E1 and J2G7
+77-01
+46
+CTP
+Chytra and colleagues
+60-day mortality
+Apoptosis
+Logistic Organ Dysfunction System score
+caveolae
+errors produced by the Taq polymerase
+Docking results
+Bound antibodies
+~30-32
+mild multifocal heterophilic infiltrates
+alignment of peaks across spectra and samples
+Data on clinical signs and symptoms
+cycle transit
+p
+Introgression of domestic Bactrian camel genes into wild camels
+two
+seven months
+220 per 100 000
+81 amino acids
+horses
+20-49
+maintenance of animal health, fertility and growth
+β-Actin
+membrane proteins
+decision-making
+KY and YXH
+10%
+five
+HLA-DR trafficking
+inclement
+Table 1
+N-linked glycosylation
+0.238 mg/ml
+MimicDB mimicDB
+SL6
+24 hours
+local ethics committee
+University of Pittsburgh Regional Biocontainment Center
+CPV-2c
+confocal microscopy
+P aramyxoviruses
+endpoint fluorescence reading
+Neutralization titers
+retained their unusually high connectivity
+a neutral alanine
+Beijing Municipal Center for Disease Control and Prevention
+improved clinical response outcomes
+set up a new control structure for infectious diseases
+glycosyltransfer
+48 h
+a
+country × attitudes and country × subjective norms
+Twenty-four
+the value R 0,9
+Definition-driven methods
+personal resources
+virus interaction with liposomes
+global species biodiversity
+11
+biologically active transcriptional changes
+A weight
+Number of amino acids from the target included in the alignment
+2341
+52 ms long
+α-cells
+m = N M /N H
+Surfactant
+Emiliania huxleyi
+Proteinase K
+KPN_03668
+cleavage of MLV Env by furin
+FACS LSR II
+cytopathogenic and noncytopatogenic
+50%
+Acute respiratory failure
+randomized placebo-controlled trials
+immune surveillance, metabolic activity, and detoxification of blood
+jackknife test
+a patient presenting with a symptom complex
+x
+IL-XPCI technique
+degeneration and necrosis
+50%
+moral technologies
+24%
+template
+ACE2
+Geoinformatics
+faecal diversion
+class-switched memory B cells
+bafilomycin and concanamycin
+Angiotensin
+phylodynamics
+13
+Bacterial infection
+δ-Secretase
+chronic hypernatremia
+206.1
+Apoptotic cells
+All-Stars Negative Control siRNA
+An abscess
+differences in immune-mediated pathology
+growth
+efficiently detect SNP
+IFN-γ
+frameshifted proteins
+ERAD regulation
+changes in systemic functions
+11
+54
+less than 1%
+MiR-210
+A, B and C
+110
+via a network of hydrogen bonds
+cell debris
+Scopus
+TonB
+eotaxin
+up to ten passages
+Spatial methodology 20
+F and HN
+54 probable and confirmed cases
+unfolded proteins or misfolded proteins can accumulate
+sex
+Determination of dominant covariates of polio incidence
+Jerusalem
+NF-kB and mitogen activated protein kinases
+an undirected weighted network
+cephalosporin
+three
+depletes M proteins
+alkaline proteases
+Bio Med Central
+147
+Switzerland
+PRP infectivity
+Cell fusing agent virus
+PE
+2-3 animals per cage
+arresting the cell cycle
+branch elongation induced by the within-host evolution model
+CMV promoter
+ROC analysis
+a gastrointestinal virus
+impulsivity
+David Relman
+partial protection at higher doses and evidence of increased acquisition at the low dose
+HopPER
+5 min
+The PERCH integrated analysis
+BAC DNA
+hCT oligomers and fibrils
+pulmonary edema
+25,421
+over 80%
+seven
+>0.338
+peptides with sequence length equal to 15
+tumor necrosis factor receptor-associated factor 6
+suicide monitoring effort
+.faa
+who has most contacts
+URTI
+author keywords and the title of articles
+overall pairwise comparison among the reference genes
+Reducing meetings and interpersonal communication
+bovine potency test protocol
+published reports
+25%
+Tables 7 and 8
+AutoFluo Quencher
+pdb1ji0A
+E. coli b-galactosidase
+RCA-based assay
+Fifteen
+Humanized mouse models
+cellular antiviral factors
+miniaturized and integrated
+analyze the validity of interventions
+Pseudomonas aeruginosa
+thromboelastogram, D-dimer, or other tests
+37.98%
+logistic regression
+Cell lysates
+lipid raft mediated, caveolin-1 associated endocytosis
+high power field
+Probiotics
+one
+taxonomic diversity
+12
+70%
+keyword searching
+any cleaved GP2 subunit
+Three to four
+pulmonary function problems or neurological function problems
+significant increase
+Luciferase activity
+150 cm 2 flask
+HA-signal
+epithelial progenitor cells
+13
+cytoskeletal structure maintenance, RNA processing and mitochondrial biogenesis
+2002-2003
+Sensitivity
+βselective
+chronic meningococcemia
+75%
+no major impact of missing data on GA
+Intranasal delivery
+two
+credibility tree
+reduced IFN responses
+mucosal airway edema
+elements of the host response may be maladaptive
+three
+the Study Coordinator
+viral immunity
+steric hindrance
+PyMOL
+1,785
+CT, LT-I and LT-II
+Richards growth model
+Jackson Immunoresearch
+Telomerase
+GLuc activity in cell lysates
+loses charge and detaches
+OVAspecific GC B cell response
+8 min
+logistic regression model
+between 28,715 to 29,102
+Trojan horse
+The Codon Adaptation Index
+80%
+geNorm
+sophisticated statistical procedures
+93
+Thirty-seven
+lipid accumulation
+respiratory failure, and poor outcomes
+Establishing the time of infection
+Two
+one
+significant viral replication
+FACSAria
+Student's t-test
+PaO 2
+Interspecific pathogen transmission
+90 days per year
+nutrients
+cell lysates
+k
+antibiotics
+pLHgb-PVX-m vector
+AA
+generated a PCR product of 302 bp
+regional climate models
+NPE
+morphological characteristics
+TI cells
+DVG-324NC ⌬70-114
+compensatory redundancy
+34
+ten
+reduces
+N/5/03
+fall-winter seasons
+Cation 105C
+Twelve
+human primary bronchial epithelial cells and smooth muscle cells
+every two days
+Mann-Whitney U test
+Confocal
+over 100
+Smad3
+L2
+adipocytes dysfunction
+RSV viral load from nasal swab and nasal wash
+7.5 mL/bag
+ligation
+pH sensitive
+IL-10-capturing T cells
+A sample of 100 pairs
+upregulation of ISG expression
+8000
+low concentration of TGF-b 1
+medical records
+lower
+HepG2.2.15
+High Capacity cDNA reverse transcription kit
+fourfold
+3-4 d
+IF
+continuous trait phylogeographic modeling
+Beijing
+TNF-α
+false
+predicted 7-O-GT activity
+T-cell epitopes
+NdeI
+65
+Marseille
+14
+IgG
+meta-analytical
+tension
+RGD-independent integrin
+COVID-19
+those at highest risk of complications
+syndromic surveillance
+anti-apoptotic
+viral RNA templates
+8.1%
+data expression
+Student's t-test
+c and w
+iScript™ cDNA Synthesis Kit
+31%
+time point of challenge and quantity of the pathogen
+Multivariate logistic regression analysis
+Alternative estimation methods
+Expression of siRNA-targeted proteins and actin
+three
+PCR and serological tests
+MBL-AB
+Whole inactivated virus influenza vaccines
+exhaustion
+Clinical specimens naturally exposed to disease
+nucleophilic water
+spore-forming bacterium
+poorer outcomes
+Migration positions of HiMark-prestained standards
+DNA vaccines
+Semi-quantitative RT-PCR
+N-terminal conjugation
+ZNF4
+0.05%
+limit of detection
+MA, MH, MMH and MAH
+dimethyl sulfoxide
+rhesus macaques
+Baseline data
+relative abundance of a bacterial genus
+QM5 fibroblasts and Vero epithelial cells
+peptide
+Vaccination
+Desktops
+Non-parametric Wilcoxon signed-rank test
+limited
+caspase-1
+18
+univariate regression
+three weeks
+CX3CR1 protein
+four
+RNA viruses
+NetCTL v1.2 server
+HSP90
+water
+exaggerated or dysregulated immune cell responses
+Point-of-care ultrasound
+antiviral ISG mediators
+overlapping PCR
+100 μM
+dox-repressible library
+Kolmogorov complexity
+Univariable meta-regression
+hepatitis B morbidity
+4.8 days
+optimal recruitment of YFP-ZUFSP to DNA lesions
+amino-terminal
+3-to 4-fold
+80%
+Equation
+enhanced virulence
+pH
+CUG
+eight
+Asn 26 and Ser 27
+disease
+2010
+two cesium chloride gradient centrifugations
+evidence of natural infection and spillover
+three
+diffusivity
+angiotensin
+septic shock-related deaths
+eleven
+Source Data
+specific treatments
+1100
+sequences similar to the query sequence
+21,223
+Central and South America
+more than 3 days
+week 5
+to understand the correlation between preparedness capacity and demographic information
+7 d
+10%
+membrane integrity
+5
+biological element cycling with isotopic fractionation
+three ω ratios
+tympanocentesis samples
+Protein kinase A
+Ultraviolet light
+60°C
+astrocyte function
+1:20
+the probability of each state
+a major shift
+wild-type rRNA base modification profile
+Concurrency
+not yet well established
+Mae Sot, Thailand
+The arrangement of the boxes
+sufficient data
+zoonotic disease management
+two-way repeated measures
+Immunosuppressive
+HT-29 cells
+demyelination syndromes
+counterfactual conditions
+overlapping substrates
+Ten
+RT-PCR with oligo dT primer
+primary cerebral lymphomas
+detailed
+Met and Thr
+NMDA receptors
+each group
+Cohen's effect sizes
+the normalized frequency of each triad in P
+C-SVM-classification
+5 days
+plasma samples
+taxonomically described viruses
+Twentyseven
+PathoChip assay sen-sitivity
+six
+40
+150,000
+SAS version 9.4
+urinary vanin-1 and NGAL
+glucocorticoid cortisol
+Antimicrobial resistance
+through its CTD1
+helix stability
+residue 17
+coagulation test
+Lab-on-a-Chip
+Seed characteristics
+hierarchical relationships
+patients
+FK506-binding protein family
+physiological
+PyMol
+recipient cells
+Methicillin-resistant Staphylococcus aureus
+CBP/p300
+Statin treatment
+asked questions
+Polymerase speed
+reagents
+CCK-8
+three
+T-cell activation
+106
+22
+17-DMAG, BGB324, and NCK-8
+persistent HRQoL decrements
+FASTA
+wooden
+3417F and 3417R
+English
+AEC I death
+polyethylene glycol 6000
+Gram-positive
+Fourier transform infrared spectroscopy
+5
+Mexico and the United States
+NKp46
+surveillance system or prospective study
+Insectivorous passerines
+kanamycin resistance protein
+1.90
+unclear
+H. Ghiasi
+a 1 mm, 34 gauge needle
+20%
+10%
+18
+school officials
+cc-by
+Validation of Instruments, Supplies, and Reagents and Personnel Qualification
+respiratory drive
+q x,i
+equally dire
+key cell types involved in innate immune defence
+inhaled air pollutants and cold
+shared protocols
+statistical significance
+19
+steroid metabolic process
+enveloped, positive-sense, single-stranded RNA viruses
+maps
+20 μM
+dose-response curves
+twice a day
+Flys-GCN
+Opti-MEM
+porcine cells
+x kj
+transmissibility
+T cells and macrophages
+funding for the prevention and control of NCDs
+2004
+RNeasy Mini kit
+MAVS
+MasterPure Gram-Positive DNA Purification Kit
+four
+ML-HSA
+attractive
+spatial distance between affected farms
+venoms
+quantitative polymerase chain reaction
+147
+pediatric
+striped field mouse population cycle dynamics and seasonal climate change
+20%
+R-con
+Bioanalyser
+lung diseases and obesity
+Thibaut Dort
+Inactivated HRV
+2A
+Quiescent endothelial cells
+hydrogen bonding
+applied pressure p, position, and dent depth h
+submicromolar concentration
+two
+ovocalyxyn 32
+Excessive ROS production
+IL-6
+HCMV infection
+administrative/organizational, environmental, and personal protective measures
+Egr-1 depletion
+an initial RNA3 transcript
+61%
+B cell malignancies
+epithelial proliferation
+encoded the M and H genes downstream from the p10 and P H promoters
+purified protein
+species susceptibility to infection and disease
+co-immunoprecipitation
+>90%
+Influenza
+protonation of histidines
+alcoholic
+Twenty two
+223
+nematode
+mast cells
+Cardiac remodeling
+The cloned fragments of all constructs
+serotype-specific
+Fourteen
+P. alecto and P. conspicillatus
+P. falciparum malaria
+RT-PCR
+mouse
+CD8+ and CD4+ T cells
+viral receptor binding, fusion, transmission, virulence and pathology
+logs
+influenza and vesicular stomatitis virus
+mitophagy
+Four days
+60%
+Singleheaded black arrows
+swine influenza virus
+N f and N i
+proper overexpression of scFv
+ancestral strains
+CD4 T cells
+stressinduced mutagenesis
+34
+12 weeks
+best practice approaches to aid effectiveness
+nine
+Escherichia coli and Enterococcus faecium
+gingivitis and peridontal disease
+54
+PI3 kinase
+reduced compliance
+chi-square test
+fails to inhibit necroptosis
+the nucleus
+Brogan et al.
+Almost three billion
+viral replication
+24
+184
+DISC1
+24 h
+a check list
+R
+7-15
+mouse synaptic-defective 1A
+angiogenic
+PRE9
+human serum albumin
+three
+Gene Ontology databases
+TIA-1, HuR, PABP, and TTP
+442
+Tan Tock Seng Hospital
+loopamp DNA amplification kit
+1/3
+SIRIC BRIO
+hepatopancreas
+5-20%
+Optical interferometry
+ACE2/Ang- axis
+R227
+2.13 to 5.57 L
+host shutoff defective
+Transient recombinant protein production
+higher
+linear regression
+Haploreg v4.1
+10 min
+hypoxic
+76
+treatment of the disease
+Paracrine
+GCK
+CD68
+the arithmetic mean
+antiviral treatment
+respiratory or unknown primary site of infection
+2-3 million
+50%
+Miamiensis avidus
+10
+a cluster of IFN-stimulated and immune mediating genes
+GSE79766
+UV
+Beclin1 and UVRAG
+walker motif B
+Vimentin
+permissive
+0.25%
+protein degradation
+amino acid sequences
+GraphPad Prism
+05SSU0968
+twice
+Folin-Ciocalteu method
+MLKL phosphorylation
+conflicting
+moral technologies
+5%
+107
+successive and mixed outbreaks of respiratory viral infections
+30%
+1.46
+43
+Oseltamivir
+severe iron uptake defects
+I VV and I VH
+Amidoblack staining
+Student's t test
+RIGID mode
+nine
+immunogenicity with a single dose
+the 3D structure of a protein-bound peptide
+gp18 LP
+Eleven
+object system
+Chi-square test
+None
+36
+α5β1 integrin
+Bariatric surgery
+autophagy
+Heat stress
+loxP sites
+Gene ID
+millions
+RSS
+randomized controlled trials
+Streptococcus pyogenes
+diuretic initiation
+CD 4+ CD 25+ T cells
+6 min
+b-TrCP
+c-fos
+evolutionary innovations related to the biochemistry of feeding
+3/24/2020
+Gene-targeting methods
+electron density difference curve
+Low tidal volume protective MV
+PTMs
+Katnal1
+issues of notification, response to minimal risk, responsibility and legal requirement
+wildlife
+HAART therapy
+7
+Creation and destruction of links
+discrepancies in specific areas
+Cas9 expression
+northern Arizona counties
+Menzies School of Health Research
+less good
+Human RNaseP gene
+80%
+50 µl PCR reaction system
+cachexia and weight loss
+to avoid false result
+62
+Respiratory protection
+CQ
+163
+EF, RPL12, and -TUB
+6 hours
+Eight
+Vaccination
+interspecies transmission of primate immunodeficiency viruses
+Pathogens
+an early type I interferon response
+CRISPR/Cas9
+Passive immunity
+TERA
+GAMs
+knowledge-driven matrix factorization
+Programmed ribosomal frameshifting
+decomposition method
+Osteocalcin
+28%
+20-fold
+highest load
+RNA Fragmentation Module Protocol
+5596
+GraphPad Prism 7.0
+TM967
+WNV
+11
+antioxidant defence
+seroconversion
+one-tRNA slippage mechanism
+6 months
+Investigator Statement
+secreted proteins
+38%
+cytomix
+The use of networks
+incorrect nucleotide incorporation
+one third
+120,940
+Stata
+307
+45 of 715
+four
+gene-specific
+lymphoma development
+at least three stages
+genome replication
+226
+X-ray-based
+intravenous corticosteroid treatment
+hapten-sensitized liver NK cells
+methylcellulose
+KSHV lytic
+DNA vaccination
+two PTB signals
+3,168
+monocytes or macrophages
+T-bet and IRF4
+a methodology
+four
+14
+Necrotic
+11
+Olig2 nuclear/EGFP cytoplasmic staining
+65
+influenza viruses
+binding of these proposed inhibitors with papain like cysteine proteases
+UniProt and GO
+the asthmatic phenotype
+long terminal repeat
+Hasegawa-Kishino-Yano model
+test paper
+institutional and social environments, partnerships, and locations
+chemokines
+Twitter messages and Facebook posts
+Human blood samples
+HIV-1
+5
+promiscuous epitope binding of HLA-DRB1 alleles
+0.4488
+Restriction
+four
+RSV vaccines
+3,5 days
+that of definite CAP patients
+mechanistic
+those of controls
+100%
+11.4 per 100 000 population
+12 cm H 2 O
+body mass
+flow cytometric
+HPAI H5N1
+IL-8
+immunohistochemistry
+18
+Five
+over two years
+RNAi
+categorical
+residual bilateral basal consolidations
+Codoncode
+mucosal protective barrier
+MAP into feces
+30
+CAIX + tumor cells
+A. fumigatus and lipopolysaccharides
+Cerebral vasculitis
+Rhat
+proteases, peptidases, and glycohydrolases
+0.54
+bacterial and protozoan pathogens
+means and SEMs
+Waterfowls
+specific cleavage of the isopeptide bond
+cellular metabolism and ECM-receptor interaction
+0.908
+HIV-1 Clade C
+arthropods
+attributable fraction and latent class analysis approaches
+Tetraspanins
+HCVpp bearing concurrent and later glycoproteins
+early-or recycling-endosomes
+60 minutes
+90-day
+LPSinduced activation of p-65-NF-κB
+Cefepime associated neurotoxicity
+minimal
+Australia or Europe
+232
+Fortyfour
+eukaryotic elongation factor 2 kinase
+1 year
+Shc
+viral RNA
+45 min
+PA63
+Group I
+glutamate cysteine ligase
+proteins
+ΔP
+lead-like molecules
+heterologous VLPs of the other three HBoVs
+inactivated vaccines
+contacts of much larger duration than the average
+intraoperative transfusion of packed RBCs
+ZMapp
+u X and u Y
+procoagulant activity
+left ventricular dysfunction
+Total RNA
+early ICU admission
+absolute humidity
+P/L-Selectin-mediated leukocyte migration
+2.5 Pa
+30 hr
+6%
+Chemical prophylaxis
+Exploratory
+600
+DegFact values and 95% confidence intervals
+serine-arginine protein kinase 2
+their function
+900 thousand
+biology
+USPs
+two
+Plasmid pTP-GP
+over 4 years
+3.77
+to replenish and maintain the airway T RM cell pool
+490 nm
+7−10-fold
+Shielding of viral RNA from interacting with OAS
+The R t of each of the nine jurisdictions
+Image J and SPSS
+16 hrs
+C-type
+an ensemble of connecting subnetworks
+taxa
+biotic or abiotic
+neuraminidase inhibitors and adamantanes
+To and colleagues
+QuantityOne
+5.8 cases per 100,000 people
+PolyJet In Vitro Transfection Reagent
+the subject's legally acceptable representative
+chromatography
+seven
+intestinal lesions
+MEGAclear
+enveloping vesicle
+CHO cells
+Escherichia coli and Klebsiella pneumoniae
+12
+Dr. Wakita
+urine output
+TAT peptide
+immunosuppressive
+34 kDa
+IBL Adenovirus IgG ELISA Kit
+text-mining
+real-time RT-PCR
+DN57opt
+p xy
+visual plausibility
+IBB-1
+fresh media
+groups differences in terms of the mean
+ModFit LT software
+MHV-A59
+Emergency medical service
+43.5 days
+to identify fungi
+antibiotic susceptibility testing
+pDCs
+SG dynamics
+sociodemographic
+1 hour
+Meteorological data
+when high amounts of PV 2A pro are synthesized
+posttranslational modifications
+single stranded viruses
+A more comprehensive measurement study
+AC4
+Programmed ribosome frameshifting
+accidents or specific cancer sub-types
+21
+down-regulated proteins
+ambient particulate matter pollution
+167
+residues 100-137
+manual checking of representative reads
+HSP70 and 90
+liberal oxygenation
+MSBH Spin PCRapace kit
+16.5%
+breast carcinoma
+MVA replication
+2 dpi
+pleiotropic
+Fig. 2a
+LDV
+10.1371/journal.pone.0147041
+Pseudoknot detection
+Aedes albopictus
+PB1-S704T
+three
+15 min
+NA-dependent hemagglutination
+Epidemiological and clinical
+observations
+various kinds of porters
+stage II and III melanoma
+long tubules
+antibody affinities
+Mechanical ventilation
+16 hours
+adaptors molecules
+B and influenza Th epitopes
+mutations in the dystrophin gene
+mitochondria-mediated pathway
+the nature of the host
+ACE2
+rAd/NP
+the reader
+A, B, and H7N-subtypes
+Nineteen
+B2M and CA2
+the average of the 32 model variants
+The probability of type 1 error α = 0.05
+less than 3%
+spo0A and sigH
+10
+2.1%
+rs368234815-DG
+26.7
+À31.2 kcal/mol
+HRA-III
+syndromic
+a further antigenic site for Asia-1 strains
+TPK1 and TPK2
+lytic reactivation is needed
+Parasite schizont samples
+50%
+glycosylation and disulfide-bond formation
+one
+polio persistence and population size
+post-infection lungs
+protein or some of its homologues
+United States Armed Forces Research Institute for Infectious Diseases
+IL-1b maturation
+cortical and thalamic
+11
+Coincidence filtering
+supernatant
+binding
+titer and productivity
+low binding rates
+Lungs
+Pili
+activation of proteolytic enzymes and auto-digestion
+U266-NC
+toxin levels
+60%
+two
+epicatechins
+8 mM MgSO 4
+eight
+clinically insignificant safety laboratory abnormalities
+658
+Prostaglandins
+PepMapper
+sensitise tumours cells depleted or over-expressing DUBs
+32% ± 5%
+j f
+no significant difference
+Martin-Loeches
+translocates to the nucleus
+MP-12 vaccine strain
+suppressive
+cough, purulent sputum, dyspnea or pleurisy
+The sizes of the family-level primer sets
+2 mL of cDNA
+South America
+pro-inflammatory
+endogenous and exogenous
+10 min
+4,300
+M. glareolus hepacivirus clade 2
+16
+Expression of Ciita mRNA transcripts
+disease severity
+Cellular restriction factors
+to prevent the possible reassortment of the hemagglutinin segment
+tube formation in vitro
+transmission distance
+treatment with AppDapxIDapxIIC culture supernatant
+PSV infection
+wireless proximity sensors
+MVA
+Ranunculaceae
+a triangle
+natriuretic
+HIV-1 entry
+autophagosome
+antibody titer
+fluorescence
+breath by breath impedance of the whole lung
+airway epithelium
+Phagebased
+hairpin-like
+a low number of printed pages
+the second 163-nt repeat
+G-quadruplex formation
+Data on examination findings, diagnoses, and antibiotic prescription
+5
+genotoxic
+QIAamp DNA 144 Blood Mini Kit W
+99%
+Peptide dens25
+G affinity columns and concentration of the mAbs
+80-90%
+Duplicate titles
+adenovirus
+genotypic diversity
+S. hadar
+three
+physician criteria
+increased ADG
+TLR3
+tolerogenic
+Latin America
+A stainless steel tray
+Hepatocellular carcinoma
+fluorescence
+SGH
+frequent colonizers
+Live viral load
+Hong Kong
+Genes
+WebLogo
+ten
+inflammatory
+the presence of neighbourhood hubs
+NKp30, NKp44, and NKp46
+IRF8
+>90%
+poikiloderma with neutropenia
+CD8 + T cells
+CELLO and SOSUI
+Cp values
+Vanin-1
+porcine pancreas lipase mix
+Fourteen
+8 hours
+RSV
+LC-MS
+High Capacity cDNA Reverse Transcription Kit
+15
+24
+beads proteome
+Dark grey shadows
+cDNA
+hundred twenty-eight
+60%
+64
+7-fold
+0
+140, 180, 70, and 40 μM
+viral protease
+epidemic curves
+prevention of serious illness
+ADM Protexin Ltd
+Tip dating
+chromosome 10q22.2-q23.1
+Seven
+B cells
+Further full genome sequencing and analysis
+6 h
+quaternary structure
+91.1%
+strict restriction on the interaction between HBV virions and the cell membrane
+feasible and safe
+5000
+lime
+Modification patterns
+by budding
+cases of influenza
+virus titers
+oligomerisation and autophosphorylation
+DENV growth
+SPSS
+Viral persistence
+200
+histopathological lesions and PCV antigens
+codon-anticodon
+1,988
+SEM
+extensive genetic mapping
+Fecal samples
+Europe
+four
+Novel cell culture models
+5%
+1.5.2.8
+flee
+valoneoyl
+Knowledge and beliefs
+2
+Vector Laboratories
+APCDD1
+donor 11 and donor 42
+reduced HRQoL
+all-atom root-mean-squared fluctuations
+HBSS
+10%
+RT-PCR from bronchoalveolar lavage
+the system's implementation and the general features of the collected data
+FEI Tecnai T12
+Reduced protection against heterologous influenza strains
+Tukey's honestly significant difference test and Bonferroni
+primary virus
+augmented
+viral core proteins
+daily
+Binding of the Large T antigen to the viral origin of replication
+purifying selection
+Six
+purpura and arthralgia
+linear fit model
+4%
+methylglyoxal
+2005
+cardiologists blinded to biomarker analyses
+The antigenome
+71
+small prospective uncontrolled trials
+B1 and B2
+lymphocytic
+CRT recombinant proteins
+secreted inflammatory mediators
+linkage stems and the root domain
+Jingshi Shen
+guinea pigs
+ISG expression and viral load
+À1 PRF efficiencies
+four
+application of RM in patients with healthy lungs
+A549 and Calu-3
+Àlog 10
+virus-specific and cell-specific
+Sackin's Index
+the globular fold of the CTD
+solid line and bigger
+β-glucuronidase
+Twelve
+genotype
+PBs
+Hypoxic preconditioning
+eight
+Core Hopping
+Western blot analysis
+Eight
+mRNA:rRNA interaction
+BaTS
+Three
+neutrophil elastase
+GRA24
+773.4 mg/L and 848.2 mg/ L
+Guillain-Barré syndrome
+2
+ISG
+antibody-dependent enhancement
+by email
+483
+normality
+40
+Immunohistochemistry
+serum medium
+antibody half-life extension technologies
+Commission of the European Communities
+Ubiquitin E3 ligases
+Corticosteroids
+hospital entry
+21.07 fold
+fusion of the viral and the host endosomal membranes
+Twenty-one
+Weather conditions and seasons
+full-length human IgG1
+47%
+Amnibacterium
+rs12979860 T/C and rs8099917 T/G
+107
+Heart failure
+the germline V, D and J gene matches to the query sequence
+13 days
+Nine
+70
+2,229
+Roche
+respond to it in some way
+positive and negative
+Xbal I and Xhol I
+treatment with MSCs
+intracellular cytokine staining and flow cytometry
+10 mg/mL
+S-phase cells
+RNAs
+purifying selection
+isoflurane
+Serine hyperphosphorylation of IRS-1
+907
+Presence of the intrinsically unfolded VPg domain
+lack of exposure to mosquito bites
+protein NS5B
+between 200 and 500 nm
+healthcare workers
+Herpes simplex virus
+target cells
+inhibits the formation of ion channels
+8
+Homologous structural analysis
+optical density
+2 x
+F up gi
+community cats
+11
+improvements in delivery strategies and the safety and stability of siRNA
+pigs
+~100 nm
+positivity
+multiple different polypeptide species
+analysis of the deep sequencing data
+bleomycin-induced the Ly6C hi monocyte pool expansion
+the corresponding author
+PI4P
+further validation
+H9N2 or H7N9
+allowed for an order of magnitude decrease in pulling speed
+upper respiratory and gastrointestinal tract
+less
+0.5 ml Stop-solution
+compositional constraints
+85%
+10%
+transduction frequency
+65.9%
+Hippocrates
+167 hours
+Nineteen
+African domestic carnivores
+Fourteen
+Vibrio anguillarum
+AP-9
+6
+60 min
+Peripheral blood samples
+NCBI
+additional eligible studies
+24 h
+efficient use of scarce health care providers and resources
+phylogenetic
+Leica DMi8
+11
+Principal Component Analysis
+more than one pathogen cultured from the same specimen
+SIM-SUMO dependent recruitment
+Cas9 mRNA and sgRNA
+virus-cell binding
+inflammasomes
+PCR based method
+proinflammatory mediators
+sumoylation
+reading and brisk walking on treadmill
+The phylogeny
+cytolysis
+dramatically increased
+7.12% ± 1.51%
+1536
+50 nM
+costly and detrimental
+100
+Table 5
+Clinical Pulmonary Infection Score
+HBoV
+neocortical regions
+sampling of young animals
+storage and binding conditions
+HCV core protein
+Toll-like
+allograft
+type I interferon response
+emergency
+using the integrated fraction collector
+samples
+Cholera
+Excess power
+3, 5, and 7 days
+Asthma Index
+36 years
+NK cells
+continuous chemical exposures, recurrent acute inflammation, or specific pathogens
+cell-based
+The hypothesis of human playing a role in ebolavirus maintenance
+pseudoknots
+Repeated follow-ups
+2165
+general practice and the broader primary care sector
+flow-cytometry
+Cleavage of the 5 0 transfer RNA leader by RNase P
+fluorescent dye of resazurin
+NIH ImageJ
+phosphoinositide 3-kinase /protein kinase B signaling
+patients and prescribers
+LPS-induced ALI
+detection sensitivity
+100%
+hubs
+by-stander DCs or unchallenged DCs
+virus replication
+High-throughput
+24 h
+Chemokines
+Contact surveillance
+Capsid protein modification
+a coronavirus
+viral-induced acute exacerbation of chronic airway inflammatory disease
+Yamagata and Victoria
+66
+45
+4%
+pulmonary thromboembolism
+microinjection of semisynthetic N-Ras
+H5 HPAI pseudotyped viruses
+QiagenOneStep RT-PCR Kit
+11
+40%
+all junctions of the canonical structural protein genes
+Human RNAse P
+Activity-based protein profiling
+genetic typing module
+two
+Rabbit hemorrhagic disease
+IR
+postoperative maintenance doses of corticosteroids
+Proteobacteria
+NF-κB activation
+conserved epitopes
+dityrosine C-terminus
+cytokine storms
+intermittent repeats of fast/directional and slow/confined migration
+20
+N-myristoylation or prenylation
+peptidyl Transition State inhibitors, latent TS inhibitors and TS mimics
+ventilator-associated pneumonia
+health individualism and gender
+proliferation, IFN-g production and memory phenotype
+iNR-Drug predictor
+Endosomal acidification
+Direct logistic regression
+GeneJET Gel Extraction kit
+one third
+52
+anti-inflammatory
+YWHAZ
+Parasitaemia
+consistent
+adhesion of those leukocytes to endothelial cells
+the distance to the next stop codon
+phylogenetic trees
+Hockey
+Camera trap protocols
+Harmony Analysis Software
+large-scale vaccine production
+immunofluorescence
+receptor-ligand pharmacophores
+Western blotting
+20 to 30 minutes
+proviral and viral loads
+ablate
+Signal Transduction PathwayFinder cDNA array
+Compound 18
+ROS scavengers
+13
+17
+IFN-g inducible protein 10
+CMV, EBV and HHV-8 DNA
+5138
+severe plasma leakage, severe bleeding, and severe organ impairment
+Gene Ontology
+antigenic recycling hypothesis
+0.81
+30.7%
+household systems
+stress granules
+adenovirus-infected cells
+long-term outcomes
+Systematic and ongoing training of staff in disaster skills and equipment usage
+T-helper cells
+correct identification and access privileges
+Zebrafish
+48 h
+San Francisco
+means ± SEM
+social, cultural and environmental
+homologs to the proteobacterial cmo 5 U genes
+risk/benefit
+hydrophobic residues
+PD-1 signaling
+Points shown as diamonds
+6
+a compound GA tablet
+ROS generation
+Ha3 as well as Eagan
+pseudotyped HIV-1/EBOV-GP
+rabbit anti-capsid antibody
+the immediate need
+macrophage activation
+vacuolar-type H + -ATPase
+late January to early February 2015
+2, 304, 700 km
+Supernatants
+cytosolic
+MessageAmp TM II-Bacteria RNA Amplification Kit
+mechanistic verification of the selected biomarkers
+T-box transcription factor T-bet and Eomesodermin
+2.95
+30 min
+a balance between pro-and anti-inflammatory cytokines
+95%
+trauma
+0.612
+The protein universe
+Hits with an e-value greater than 1610 23
+Arg
+immune responses from Th1 to Th2
+infection of genetically diverse WNV lineage I strains
+new or worsening impairments in physical, mental and cognitive functioning
+mice
+One SMRT cell
+the lung
+BEVS expression fields
+30 min
+86%
+0.5
+JMP 9.0
+particle production
+44
+MeanDecreaseAccuracy measure
+Ire1 R cells
+64%
+3 months
+1%
+probe-to-gene mapping
+a set of sequences representing a specific locus from a group of organisms
+Gene Aminopeptidase N
+African swine fever
+aberrant ER morphology
+differential consequence
+endogenous miRNAs
+adult stem cells
+alpha diversity measures
+ethanol/sodium acetate
+Carbosynth
+public attitudes and behaviour
+0.05 mg/mL
+TLR2
+τ
+colorimetrically
+primary prophylaxis
+BnAbs
+Surveillance with metal ions
+structural data
+T FH cells
+content validity of the overall scale
+30-day
+genetic differentiation
+dorsal and lumbar pain
+The accumulation of recombinant proteins
+watery diarrhea, nausea, and abdominal cramps
+the ATCC
+impaired neurogenesis
+6-month
+day-light
+residues with >25% reduction or enhancement in levels of cleavage
+DMD
+acrolein
+immune status
+alpha, beta and theta
+150-170
+other factors
+diapause incidence
+PE-Alexa Fluor 610 conjugated antimouse IFNc
+lack of control of virus replication in myeloid cells
+HIV Gag
+Vaccination with commercially available HBV vaccines
+TLR4-MyD88-NF-κ B signaling
+alternative pathways of dsRNA on primary hPAECs
+Acclimation ability and thermal tolerance
+chemokine-dependent PMN migration and inflammatory cytokine secretion
+CHIKV infection
+DNA damage
+ventilator-associated events
+by flow cytometry
+12-hour
+Ssd
+stabilizing leucine residue
+q of the bilayers
+80,000 Da
+niche-specific
+Figure 1
+vaccination intention
+memory B cells
+DeconSeq
+World Health Organization eHealth Technical Advisory Group
+the community
+3 billion
+HRP conjugated goat anti-chicken IgA
+a transmission pair
+Our method
+increases in morbidity and mortality
+PocketMatch and RAP-MAD
+40 years
+53
+110
+1.51, 2.53, and 1.59
+10-15%
+antibody secreting plasma cells
+number of reported contacts
+a standard PCR tube
+cytokine expression
+Sequences of the ITS region
+thermodynamic cycle
+statements made without citation to a verifiable source
+6
+cellular apoptosis
+STEM tomography
+ICU
+developing a safe and effective means of directing the fate of iPSCs
+entry mediated by a Marburg virus GP
+equinotoxin II and sticholysin II
+TRPT1 plasmid
+significant protection against MNV challenge
+interferon
+PI3K/AKT
+Gene Ontology
+AS
+FD Rapid GolgiStain Kit
+enhances cathepsin expression
+effector T cells
+.50%
+5 days
+Paraffin tissue sections
+cell regulatory mechanisms
+Íris Eva Hauksdóttir
+downregulating HLA antigens
+mRNA levels
+two
+infectious disease
+2009
+PEGA
+Peroxisome proliferatoractivated receptors
+Bonferroni correction
+quasispecies
+Yeast total protein samples
+Repeat virologic testing in lower respiratory tract specimens
+luciferase
+1,421
+spinoculation
+spo0A
+PRRSV NC
+RanBP2 depletion
+SHRiMP2
+degradation of the endothelial glycocalyx
+HIV-1 Gag-specific cells
+KP EMRs
+VE
+-1, -5 and -11
+the average expected surprisal of the transcriptome
+Single sequence prediction methods
+Four
+GCS above 8
+assuming one homogeneous human host population of infinite size
+viral RNA or protein synthesis
+3.6
+620
+mock-infected animals
+optimal control theory
+neutralization of EV71
+mr7000 microplate reader
+self-isolation
+2
+functional recovery
+viral particle release
+Santa Cruz
+55
+Drug resistance
+Environmental health/sanitation and food safety specialists
+Cytoplasmic protein
+cellular compartmentalization
+REBs
+type III
+16%
+Traditional Chinese Medicine
+membrane protein structure
+mouse
+over three quarters
+16 weeks
+bends down fastest
+SJS and TEN
+IPTG
+host ribosomal RNA
+1000
+size
+mammalian adaptation
+USDA, ARS DOE, or ORAU/ORISE
+a trimer of kinase dimers
+major variants
+3
+Viruses
+United Kingdom, Italy and France
+model B
+pFPAV227-HA
+Wsv477
+Turkey
+initiation efficiency
+Puromycin
+congeners
+59
+Samples for histological examination
+17
+nuclear egress
+IFN-c production
+15%
+LPA
+Source Data
+therapeutic
+Five
+C6/36
+taxonomical
+41,651
+RIPA lysis buffer
+FGFR1
+50 μl of RVFV-4seGFP
+948
+TNFα
+human rhinovirus
+22
+C57BL/6J mice
+to inform the prospective planning and continual evaluation and adjustment of health service provision
+S. pneumoniae and H. influenzae
+CD4bs bnAbs
+P ≤ 0.05
+85%
+a separate regression model
+protein/alum
+SuperSignal West Pico Kit
+UVinactivated
+mathematical models
+Paired ttests
+high-computational cost
+phosphorylation of ERK
+whether it could be involved in substrate interaction
+shorter
+16.3%
+cutaneous; gastrointestinal; and inhalational
+N p
+CASP9
+Cady and coworkers
+tethered proteins
+KT726940-KT726955
+15 min
+Batch processing
+West Nile virus, Hepatitis C virus and Japanese encephalitis virus
+3
+threshold
+8-fold
+enterotoxigenic Escherichia coli O86
+RLU
+induce pH-independent syncytium formation
+Gln 41
+taxonomically close species
+all the positions across each variant's genome
+The association between gender and the addressed behavior
+haemorrhagic nairoviruses
+viral metagenomics
+NCBI Gene Expression Omnibus
+drama, art, youth dialogues, music, and comic books
+NS4B 34
+murine herpesvirus-68
+SP-D
+BMV ER-derived invaginations
+t
+5 days pi
+E90R and T88G
+19
+features
+Deficiencies of the classical pathway
+Nanoparticles
+GATA2
+l E −1
+>100,000 RNA copies/ mL
+phylogenetic signal in a given trait
+total costs
+weekly data on the percentage of visits due to ILI
+MKK3/6 phosphorylation
+SignalP
+7
+Cellomics nucleus factor-B activation kit
+high rates of morbidity and mortality
+mediate RNAi
+Twenty-two
+1.5
+filovirus infection
+365
+AMC peptide substrates
+ten
+Epitope topology and membrane proximity
+Serum samples
+Anti-sense oligonucleotides
+extend their analysis and add additional experiments
+Beckman XL-A analytical ultracentrifuge
+hemophagocytic phenomenon
+cessation of proliferation and inhibited mitochondrial respiration
+peptide-based compound libraries
+0.958
+immunogenicity and protective efficacy
+CED -3
+special sequences of the antigens
+1-2 µmol/L
+352
+DIII
+nine
+Multiple Sclerosis Therapy Consensus Group
+structure-based hLTA4H inhibitor design
+a minigenome
+dialysis membrane
+2 hr
+enrichment of ligands over physically-matched decoys
+Gn and Gc
+deep sequencing, ever-more advanced imaging, and microscopic methods
+chronic remission
+Pseudotyped viruses expressing VN HA antigen
+385
+surface expression of CD86 and HLA-DR
+5 mg/ml actinomycin D
+Nf
+fitness reversion
+80
+15 μL of Ni-NTA agarose beads
+Pfu polymerase
+a specific gene
+1918
+International Health Regulation 2005
+JEOL JEM-1011 transmission electron microscope
+1 day and 4 days
+Failure to consider evolutionary trade-offs
+RSV
+high replication rates
+autophagy and apoptosis
+Candida albicans
+adenovirus and mutated coronavirus
+Donald Trump
+3700
+BioTek EL406 washer
+255,683
+40
+15%
+translation of T cell stimulation
+converge
+viscosity
+BMDCs
+less
+37.6%
+Infections
+92°
+information
+peptides
+balanced and unbalanced
+inflammatory myopathy
+Henipavirus and the unclassified proposed genera Shaanvirus
+understanding the specific role of each of these receptors in RSV infection
+61%
+Infl uenza
+Smoking status
+adverse
+ICAM-1 and P-selectin
+RBC-ghosts
+42
+194
+post-stroke BBB disruption
+T cells
+more potent Bi compounds
+Student's t test and Mann-Whitney U tests
+EBNA
+300 mM
+synchrony
+11
+disease prediction
+0.01%
+θ
+E. coli DH5α
+514
+Mas receptor
+Drosophila Schneider 2 cell expression system
+Z-scores
+CMV-ALI
+low-speed centrifugation
+Foxp3 RFP IL-10 GFP dual reporter mice
+CRY-DASH
+PSI scoring system
+Th1/Th2
+three
+0 to 5%
+7 weeks
+132
+internal human migration flows
+IL-8
+155
+phenotypic features
+5.7 days
+Genetic engineering
+three
+Neutrophils
+Bradford assay
+summer
+IFIT1
+0.1
+CDC
+13
+The conditions for the detection from the public health community of the intentional release
+1/ω H
+diagnosis of asthma
+bipartition
+conformational
+FTO gene
+Six
+CD62L and CCR7
+32
+Disabilities
+28.6%
+C839T
+253 years
+Intraregulatory links
+basic research on HPV
+18
+receptor-mediated
+exponential growth
+intensity of the signal generated by the probe
+10.34%
+Decreased survival of these cells
+Time points with significant correlations
+March 19, 2013 to October 31, 2016
+N145K
+Nine
+all the successive four bases in a given RNA sequence
+0.8%
+Lysate containing EHEC
+comparable to the divergence seen between the rat and mouse
+I 408 and N 410
+NS5
+10 6
+1 week
+3
+distant tumor nests
+MCS Wong, N Lee, TF Leung, TH Rainer
+SNAP
+paths
+loxP sites
+pGAD-BT2-N-His33
+organ edema and dysfunction
+1 out of 100
+1 h
+10
+inhibitory
+oral infection
+1, 3, and 5 quanta/hour
+SARS 209-221
+antibody level and symptom severity
+36.5 million
+10%
+Predicting the origin and emergence
+no effect on stress and coping
+PowerLyser ® Powersoil Isolation DNA kit
+45
+ClustalX 2.1
+calf intestine alkaline phosphatase
+innate immunity
+a list of contents
+25%
+CD200/CD200R
+7 or 9
+twice daily
+DisCVR
+amino acids
+March 11, 2020
+Optimism
+C T values
+clinical specimens from patients with sexually transmitted infections
+Asn77 and Glu114
+exogenous sterols
+heterodimeric gp130/LIFRβ receptor complex
+2016
+ChHV
+important
+DNA fragmentation
+morbidity and mortality
+Streptavidin-alkaline phosphatase
+LNPEP
+sales of over-the-counter remedies
+leishmaniases
+University of Alabama at Birmingham
+0.33% to 0.69%
+MyD88-dependent signaling
+Single splenocyte suspension
+Toxoplasma gondii
+hundreds
+heterogeneous
+The concentrations of circulating cytokines
+characteristics of the virus
+the blood circulation
+9-12 h
+α-catenin
+anti-HIV p24 capsid antibody
+Reactome Functional Interactome plugin
+platelet aggregation -Intensity of contact coagulation
+diminished
+protective
+1.5 and 2.0 mg/ml
+RNAi
+RSV and HRV
+every 10 minutes
+high mutation rates of RNA virus genomes
+1 h
+excess mortality
+ACE2
+0.01%
+C. albicans sc5314 17
+Cancer
+three
+relevance, publicity, appeals and revision and enforcement
+disorder prediction
+Akaike's information criterion
+Bst 2.0 WarmStart DNA Polymerase
+failure to feed via the enteral route
+Cell-permeant Halo-tag ligands
+Pain interference
+TvT c
+103
+n N
+post-HS nuclear translocation
+actual gaps
+DpAV4
+45%
+anti-inflammatory
+viral biofilm
+disruption of UFS base pairing
+111
+age-related decline in the immune function
+luminescence
+95%
+MicroRNA
+Samples of lung, intestine or bone marrow
+genomic and sgRNAs
+Pilot trial data
+nuclear import of parental vRNPs
+g ij
+10-months
+RNAi
+spermatogenesis
+decreases
+sneezing
+ligands enriched in flamed milieu
+0.818
+compromised HCV entry
+immune individuals living in endemic areas
+100 fold
+37
+alternative points of intervention
+CRP, LDH, leukopenia, and hypoxemia
+1 20 years
+Cell lysis
+limulus amoebocyte lysate test
+zero
+Epitope repeat protein gene
+PCR
+employers
+one
+20 % to 40 %
+Table 1
+P
+P,0.05
+acute, acute plus persistent, and persistent infections
+Frameshifting
+PhenDC3
+RdRp ORF
+lung
+supernatants
+Statistical analysis
+20 μM Ubc13/ MMS2
+1% aerosolized OVA or PBS
+drug resistance mutations
+decriminalized suicide
+allogeneic stem cell transplant
+Del155-160
+the virus lacks the necessary mammalspecific mutations
+results of strong clinical relevance
+nascent transcripts
+629
+high-fidelity immune phenotyping studies
+tension in the membrane-attached VP1 N terminus
+mangostin and y-mangostin
+chemotherapeutic
+mice and chicken
+The following criteria
+near the ATP binding region
+50%
+CV values of 1.740 and 0.824%
+58-59 of VP3 and 286-290 of VP1
+zoonotic cycles
+human proximal airways
+Taoyuan, Taiwan
+NOD-like
+10
+simplified versions optimised for speed
+Amoebozoa
+Asterisk
+HA/NA ratio
+IFN1
+Table 24
+model-specific weighting schemes
+Vero cells
+rRNA processing
+Faecal samples
+JEV and WNV
+Glycocalyx
+△G binding
+cheetahs
+maintaining homeostasis
+venovenous-extracorporeal membrane oxygenation
+Tabular and graphical summaries
+.3,000
+AAV mediated gene expression
+IAPV IGR IRES
+Acts of discrimination
+unusual light pigmentation, slow growth on PDA and hypovirulence
+1 %
+contact structure between individuals
+40-60%
+a wide dynamic range
+immunoglobulin receptor
+human PBMC cells
+Ten thousand
+AngII
+IFITM3 inhibits viral entry
+Identification of a putative ESE
+Isoflavones
+21
+a framework
+three
+Autophagy
+error-prone TLS
+HHV-6
+Cuautla
+1989
+N
+filovirus infection
+312-328
+a conventional feed-forward neural network
+Finding Longest Common Subsequence
+aliquots of the supernatants
+37,000
+889
+A and B
+receptors for growth factors and hormones
+good cell uptake
+role of tRNA binding on structure-functional relationships
+liver and lung cells
+IEDB population coverage tool
+diseases
+5% vaccination
+intramuscular
+treatment and/or prevention of a disease
+Toll
+Vaccination
+Stratification before surgery
+EV71 infection
+intestinal barrier-related genes
+Isolation of infected hosts
+Two
+0.25 % glutaraldehyde
+two groups or lineages and four sublineages
+LightCycler 96
+flow cytometric
+India
+70%
+a smaller reproduction number estimate
+12%
+Indonesia
+Sub-cellular fractions
+increased 25%
+The translocon
+IL-4
+additional resolution of non-vaccine serotype carriage
+one
+cancer therapeutics and treatments
+four
+The Sabin live, attenuated vaccine
+g ij
+43
+0.16 mg/ml
+compositional constraint
+10.1371/journal.pone.0222321
+15921
+results
+when readily available
+cell viability
+phone numbers, email, texting, social media and internet searches
+Nature Research Reporting Summary
+Two
+GdmCl
+perinucleolar heterochromatic masses
+25%
+pyrrolidinone
+Digoxigenin RNA Labeling Mix
+six
+stimulation with A. fumigatus
+inhibits
+red alga Eucheuma denticulatum
+flavivirus-derived NIRVS
+15 min
+65
+January 2, 2017
+cellular transcription
+viral
+DNA binding proteins
+toxicity
+miR-127-5p
+270 to 293 codons
+activate NF-kB pathway
+six
+CCHF
+mean ± SD
+sulfo-NHS-LC-biotin
+15 minutes
+OD280 nm
+Cu 2
+Physicians
+Tp2-class C9 protein
+Colony collapse disorder
+ALT levels
+neutrophil numbers
+4.7-6.4 Å
+Cell-penetrating-homing peptides
+HCV NS3 PRF
+Effective prevention and control
+The impact of PI on time to infection
+fluid overload, congestive heart failure and pulmonary embolus
+ANF and β-MHC
+five
+PDI and ERp57
+monolayers
+Infected cell images
+2,400
+additional filtering
+Rolling-circle amplification
+K127 and K164
+4
+ligand-inducible transcription factors
+Paraspeckles
+genome reduction
+cattle and buffalo
+Frequent displacement and limited contact information
+DNA fragmentation
+Rhabditida
+12
+all entries of vector n are equal
+nail biting
+caused a reduction in CatB release in rat pancreases
+Hand, foot, and mouth disease
+EBV
+biological mutations and crossovers
+Proteinase 3
+10.3390/molecules16086489
+57
+Specificity of the antibody
+pseudorabies virus
+QExactive mass spectrometer
+20
+16
+1:8, 1:4, and 1:2
+SRPK1
+48. 5 years
+14
+5
+138
+1968
+Serology testing
+14
+the aid community
+Very little
+viral replication
+Increased laboratory capacity
+Recombination frequency
+ubiquitin-dependent signaling
+Nonspecific antinuclear antibodies and/or smooth muscle antibodies
+conventional piglets
+Purified Drop-seq cDNA libraries
+bortezomib
+HIV-1 infection
+TSB
+4 DU/10 7 CCID50
+fluorescence microscopy
+tympanocentesis
+lytic
+42.5%
+72 h
+28
+Ubiquitin
+overall predictive power
+IFN-γ
+rational drug design
+suicidal behavior
+IgG, IgM, and complement component 3 and C4
+three
+mean 6 SEM
+salivary PoCT diagnostics
+9.5 hour
+HPVinduced caspase activity
+10%
+strategies
+A3B C-terminal domain
+helminth T. vulpis
+Kazan Federal University
+BCL2L11
+HMGB1
+replicase proteins
+Arizona
+BCA Protein Assay kit
+respiratory alkalosis
+RIP1 kinase
+SP-D
+the more extreme aspects of climate
+MHV-induced demyelination
+Cavalli-Sforza chord distance
+50%
+host resources
+Normalized cross correlation
+CD4 + CD25 + Forkhead box p3 + T lymphocytes
+no policy is implemented
+a defect in one of the final stages of glycoprotein complex assembly
+signal transduction pathways
+Lipofectamine 2000
+2012
+arterial
+IRF7
+Electrophoresis with 1.5% agarose gel
+Spo0A binding
+Multi-person pose estimation
+pGEM-2KS and pET21
+Fmoc-lysine-OH
+CRF07_BC
+reactions that occur in the absence of oxygen
+those with the highest IgG titers
+A waiver of consent
+Minor ion suppression/enhancement
+Neutralize the receptor binding sites
+invade to deeper areas of the cell layer
+7
+dengue hemorrhagic fever
+lower oxygen transfer rate
+accumulation of type I interferon
+meaningful phenotypes
+two-photon
+LexA system
+Ethiopia
+1 h
+complexity to ethical analysis
+a zoonotic disease
+sites evolving in a correlated manner
+NP and VP35
+patients with septic shock
+33%
+mammalian
+phlorotannins
+Dunn's test with correction for multiple comparisons or Bonferroni correction
+EVD diagnosis and isolation is immediately performed
+drive the maturation
+day 0 and at the time of euthanasia
+AP30451
+probabilistic evolutionary model
+Leica TCS-SP confocal microscope
+Internet search query data
+An HIV-1 DNA linearity panel
+by neutral proteases
+H. longicornis
+Kupffer cells
+mothers
+£30 000 per QUALY
+oseltamivir
+50%
+enhance the survival
+Seven
+sialic acid
+inflammation, excessive secretion of respiratory mucus and pulmonary fibrosis
+flow cytometry
+sGP
+Platelet recovery time
+Seeplex Meningitis ACE Detection kit
+total RNA extraction method
+SkT~38:98
+linear regression model
+entropy-based formalism
+cell migration
+6.0 per 100 PY
+Src
+2F5, 2G12 and b12
+hospital
+Baidu
+1957
+serpins
+amino-terminal sequencing
+influenza, nidoviruses, and rotaviruses
+VLP infected cells
+inflammasome-associated caspase-1
+safety issues surrounding environmental contamination or secondary immunization of non-target species
+20.7 months
+1 to 8 B to T cells
+C f
+immunohistochemical
+Wheat Germ Agglutinin
+genotype specific and host restriction
+APOBEC3G
+2 × 2 factorial trials
+30
+Complementary DNA
+docking and MD simulation
+negative controls
+the remainder of the collagen sequence
+50 μM of SB203580
+32
+CD8 + T cells
+EDS1 and PAD4
+RNA editing
+Persistent GC responses
+Computational docking
+cough
+EIA
+LacZ
+molecular ion mass fragmentation
+PGF2S
+palpation
+gentler epidemics
+40
+DISC1
+36
+21
+to safeguard successful resolution of inflammation
+labINR
+mitochondrial extracorporeal
+nine
+Range
+HSF1
+28 nt in length
+nucleotide composition and gene expression level
+Fligner-Killeen test
+vaccination
+pMAL-RH20
+Ago2 protein
+greater incidences of underlying diseases and poultry exposure history
+490
+b^2:3
+separate regulators
+18,156
+2/18
+1919
+CVID
+~3,000
+4:1
+clinical data
+relative humidity and cell growth conditions
+post-translationally
+computer vision
+Cisatracurium
+49
+de novo initiated RNA synthesis and the affinity of RNA binding
+C-statistic
+gp350
+7SK-associated
+cytopathic
+Nine
+Student's t test
+neutrophils
+The ER
+Caspase activity
+1 Â 10 7
+BD Biosciences
+Cellular lysates
+0.30 mg/kg
+reductions in pneumonia-attributable mortality
+Derepression of the nmt1 promoter
+over 50%
+65
+GRAVY and aromaticity
+Pneumonia
+14
+DENV-infected cells
+50 mM etoposide
+the relationship between CpG and RSCU
+image-based high-content assay
+High-quality genomic DNA
+salivary glands
+1.083 ± 0.083
+pseudovirus in vivo assay
+ROS
+Four
+30
+supernatants
+the flu
+hanging drop vapor diffusion
+Invitrogen and Jackson ImmunoResearch
+Didemnin B and Gamendazole
+eliciting
+interleukin-6 levels
+ESCs
+influenza A virus
+CISDCP
+RdRp
+high concentration of cytokines
+camels
+a trick of escapologism
+2,159
+Bio-Rad ChemiDoc system
+equal medians
+too much information too soon
+HEK 293 or VR1BL E1 cells
+GFP-positive
+SpO2 data
+IL-2, IL-6 and IL-10
+an existing PPE training program
+species diversity and SNV prevalence
+a productive infection
+APP/PS1
+ribonuclease
+TNF-a production
+TLR
+porcine alveolar macrophages
+EM-map normal mode analysis with elastic network model
+western blot analyses
+.50%
+swine and bovine
+870/14
+28%
+L-arabinose
+E3 Network
+eIF2α
+33 months
+33.3%
+individual selection coefficients
+Patients with malignancies
+coagulation
+15%
+Mushroom bacilliform virus
+susceptibility to several diseases
+secretions
+43%
+Nitric oxide
+at the top of the β-prism structure
+factual disease-related information
+recurrence rate
+P100-I
+140
+the standard deviation of duplicate data
+October
+TNF-α
+Ch25h
+extended regions of structural conservation
+acute deep vein thrombosis
+configuring each breath guided by the previous one
+Natural Killer cells
+CellQuest
+24 h
+postictal
+Bangui, Central African Republic
+cotranslational translocation, vesicle formation and trafficking
+high-resolution electron micrograph
+x i
+Epitope mapping by phage display 64-66
+systemic inflammation
+1a and 1b
+all genomic loci
+increased extracellular matrix proteins deposition in the heart
+40 mM citric acid wash
+The result below
+44%
+NK1 and NK2
+translation initiation factors
+microbial contamination level
+Macrophage activation syndrome
+tropical
+3.3% to 38.5%
+GPC 1, 3, and 4
+Our experimental system
+immunoblot
+lowers the pH
+how positively-charged amino acids or polyamines contribute to protease activity
+kappaB
+2012
+theoretical models
+overweight
+rcdk
+pro-inflammatory
+mutation of the catalytic residues
+35.5%
+sophisticated phylogenetic inference
+genetic instability
+NK cells
+Mueller Hinton
+Four
+454
+plating on laminin-coated plates
+A drain valve
+68.8-79.0%
+-COOH of alginic acid
+~80 bp
+RRVcholangiocyte binding and viral replication
+unclear
+culture-based assays and the Endospore Germinability Assay
+Corriere della Sera
+rolipram
+19
+to study a limited number of genetically similar target pathogens
+ticks
+NADC30-like PRRSV and HP-PRRSV
+biochemical
+ECG and GSR
+Spatial analyses
+four
+FMNH Pritzker Laboratory
+24
+apoptosis
+VP1, VP2, and VP3
+chains
+2U DNAse Turbo
+139
+granzyme A
+ribbons
+Generation time
+the averaged output of nine neural networks
+1997
+altered CQ binding
+6 days
+Arctic Environment, People and Health
+10 days
+the correct transgene DNA length
+HRP conjugated anti-goat IgG
+culture supernatants
+Grey
+Binding of IFNa/b to its receptor
+direct ribosomes to slip by one nucleotide in the 5 0 direction
+IFNc-induced gene expression
+patients with more severe illness
+standardised laboratory tests
+superior
+RSV G protein
+pigs have a full set of innate and adaptive
+viral
+ribavirin, lopinavir and ritonavir
+25
+Dr Mathias Faure
+Nonspecific amplification
+degrade only denatured proteins
+RT-qPCR
+The balance between revealing extant diversity and the continual evolution of new species
+80% to 90%
+cell lysates
+particle bounce on the agar surface
+FGFR1-4
+ImageJ software
+cellular trafficking
+Laser-capture microdissection of lumbar spinal cord sections
+15%
+membrane-spanning domain
+less abundant
+EMT
+1.2 days
+Ni 2+ -NTA agarose resin
+the number of people who consulted
+α-defensins
+1 pfu
+1.5-2 times higher
+markedly enhances
+The correct length of the peptides
+diminished virus neutralization activity
+sequence composition
+6 hours
+NCDs
+IL-2 and GM-CSF
+the final neck repeat of DC-SIGNR
+key factor
+Red Blood Cell Lysis Buffer
+GFP-LC3 vesicles
+3-7
+too few hits
+ATP
+endogenous gene regulation
+gp91phox and p22phox
+GoScript Reverse Transcription System
+human host defence
+it is also elevated in patients with decreased renal function
+Feature Extraction Software version 7
+Three
+an immunoreactive band
+2
+Maximum Likelihood Estimation
+VEGF and COX-2
+L10L and L10H
+non-enzymatic
+LTβR
+better correlation for the method
+one-third
+Variants with count input <10
+recent advances in the field of protein-protein interaction prediction
+quantitative RT PCR assay
+using the inertial microfluidics system
+the corresponding CV file will be kept
+increased affinity for human receptors
+defective viral particles
+RsYN1
+four
+gradient centrifugation
+CVTree3
+>0. 5 Secquence
+redirect elongating ribosomes to premature termination codons
+Reassortment
+a group of individuals with both clinical expertise and methodological expertise
+programmed cell removal
+MNP-mAb conjugates
+Riyadh and Al-Qassim
+compositional constraint
+Intratracheal delivery via microsprayer aerosolizer
+the time when the patient was at the ward for unrelated illness
+Sawyer et al.
+educated decisions
+virus-induced membrane structures
+22%
+wt HsIFNλ4
+Influenza virus and sindbis virus particles
+30%
+smaller volumes of hIgG products
+murine
+10 minutes
+Student's t test
+PPIA and HSP90
+REG3γ
+protection
+RSV G protein
+56.43%
+drug-induced cytotoxicity
+meningococcal, influenza and pneumococcal
+relatively stable
+HaeIII digestion of the COI PCR products
+pilot programs
+flow chart
+48 hours
+Six
+radioimmunoassays
+genetically engineered
+cell culture methods
+4 and 7
+<.05
+pivotal
+RNA structure opposing repression
+gene microarray
+Hipposideros pomona
+gene-level synonymous probesets
+1 hr
+g i
+Sweden
+SEOV and DOBV
+three
+endosome alkalinization
+GFP neg bystander cells
+15
+greater alignment with DGA recommendation and better diet quality
+41
+CD8 + T cell deficiency
+complete resolution of partial respiratory insufficiency
+Molecular surfaces of pMHC complexes
+through contact
+risk analysis, surveillance and response
+50-100%
+2,000-3,000 ps
+epitope tags
+low quality
+asymptomatic
+Old World fruit bats
+mid-summer to early fall
+proteins with specific biological activities
+type I interferons and TNFα
+9.2
+Epstein-Barr Virus
+MODELLER 9.11
+Public opinion
+The estimated copy number per PCR reaction
+actual risk
+suilysin
+Z-FA-FMK
+Four
+1.0
+hepacivirus RNA
+115
+The load generated when the wearer moves
+Plasmacytoid dendritic cells
+liver and renal functions
+the environment
+misdiagnosis and delayed treatment
+369
+112
+558
+differential conservation spanning protein length
+12.5% acrylamide gels in duplicate
+charge-charge interaction and hydrophobic forces
+repressive histone marks and a lack of gene expression
+Helicobacter pylori
+SBV
+when mismatches are centered
+VCR-OA
+CD59
+binds to IFNλR1
+ribosome profiling data
+calcium
+133
+Ningnanmycin
+three
+YM KI EK
+human administration and elicit an antibody response
+inflammatory control, autophagy and apoptosis
+1001
+white light
+on the ward
+cristae
+50%
+weight-loss
+public health
+the difference value of potential latency
+>70%
+EVD mathematical model
+3 h
+robust protection
+Wzi allelic typing
+haemagglutination inhibition assays
+HIV and tuberculosis infection
+Src kinase
+1975
+α i
+SREBP-1
+translation of mutant RNA
+not skewed
+cell-permeable protease inhibitors
+due to many internal and external factors
+leukocytes and physiological regulators
+clinical pulmonary infection score
+The location of capture
+Nuclear receptors
+deoxyribonucleotides
+near the diagonal line
+Collected serum
+nitrocellulose membranes
+ER-stress
+Toronto, Canada
+pulmonary injury
+Peptidases
+lysates
+very low
+neutralizing antibodies
+long term carriers
+all cause lethality rates
+2007
+21-28 days
+1956
+different dynamics
+PD-98059
+ECP and EPX/EDN
+r COM
+Early growth response 1
+Focus Group Discussions and individual interviews
+base composition
+8 d
+The firefly and Gaussia luciferase genes
+collect any available data
+codes of ethics
+Fibronectin CH50
+short incubation, high mortality, and fluid shift
+Macaca sylvanus
+hamilton depression scale
+leads to infection
+PCV-2
+conformational changes
+microtubule inhibitor drugs
+75,000
+spatial access to medical resources
+trans-epoxide 4
+higher IgG titers and DENV-2 specific neutralizing antibodies
+Fit Score value determination
+ACE2
+remodeling or bronchiectasis with segmental fibrosis
+5%-10%
+gp41
+three sequentially acting kinases
+19
+to assess national-level preparedness
+three
+ACE2
+26.7%
+qRT-PCR
+Long distance horse transportation
+PRRSV infected cells
+400
+January and February 2011
+Ribosomal RNA
+Provider orientation materials
+sELR1
+more than 15 000
+Real-Time RT-PCR
+Drug likeness
+liver samples
+peak shedding
+March 23 2014
+One-hundred and fifteen
+2.5%
+Table S2
+Network and pathway analysis
+5% skim milk
+10
+develop pandemic preparedness plans
+getting patients to practice better health habits
+Nine
+Storm phosphor-imager
+increasing age, extent of burn and presence or absence of inhalational injury
+110
+10 days
+Use of the Internet and social media
+immunity/antigenic
+Expression of glyceraldehyde 3-phosphate dehydrogenase
+intensive research
+S. Enteritidis strain 125109
+Vaccination
+one-way ANOVA
+the minimum number required for accurate monitoring
+Sweden
+ViDiT-CACTUS
+elevate the pH of acidic intracellular organelles
+stimulate the synthesis and accumulation of interleukin 12
+ALG1 and RDE1
+3.4 ± 0.1 kJ/mol
+Glycera
+300 mM imidazole
+excitatory and inhibitory
+cysteine residues
+high dose intermittently or low dose continuously ribavirin
+their role of signaling infectious patients
+mean alveolar pressure
+99%-100%
+cc-by
+tracks the input conformations
+PKE
+lignocellulose
+early detection of H. contortus
+goodness of fit tests
+Clinical, laboratory, and imaging data
+80%
+L. Glimcher
+effectiveness of PRRSV infection and lesions
+ARB algorithms
+two weeks
+winter
+1976
+therapeutic strategies
+Sardinia
+Obesity
+milder inflammation
+TGFBR1
+θ-defensin
+0.8 mg/ml
+LPS from Escherichia coli
+infections by a variety of pathogens
+phenol/chloroform/isoamyl alcohol
+Genome transport and entry to the nucleus
+Western Lightning Plus-ECL reagent
+68
+Affinity Purification-Mass Spectrometry
+cytochalasin D
+Pip6a
+molecular epidemiological methods
+S evere Fever with Thrombocytopenia Syndrome
+3.0 × 10 6
+cytokeratin 18
+EcoRI and XhoI
+12
+Sentinel 2
+SDS-PAGE
+Enrichment ratios
+≤ 2 days
+3 nt
+an overlapping 9-mer peptide pool
+different pathways that promote PB assembly
+nutritional
+RABV glycoprotein
+48
+Protecting immunosuppressed providers
+disease enhancement
+107
+to ensure their own survival and transmission
+colors and shapes
+U modification at position 3
+TSP
+different trends for sepsis risk
+30 min
+treatment with anti-HER2 therapies
+pH 7.0
+ELISA
+95%
+10.1155/2013/194976
+Peroneal motor and sural sensory single NCS
+TNF
+low yields
+Hematoxylin and eosin
+chronic stress
+Finland
+nosocomial transmission
+males
+lethal infection
+HA-driven
+MHC/peptide tetramer
+cases in which infection existed prior to hospitalization
+H9N2
+end-expiratory lung volume
+antiviral therapy
+PAMP dsRNAs
+Antigen detection tests
+cynomolgus macaques
+COPD
+an ''arm-like'' projection
+5%
+alveolarization
+better pandemic planning
+Chonbuk National University
+424
+four
+residue substitutions and receptor density
+KoRV
+16 days
+2 ACH
+IMOD
+1/20
+CS
+Uncertainty in the estimation of model parameters
+activating
+5/3/2020
+genomes with size more than 100 kb
+small receptive fields
+interdisciplinary
+the path cannot be divided into two equallength paths
+IL-4
+influenza A
+cooperative effects
+ubiquitinylation
+quantitative PCR
+A and B
+0.05%
+translational
+40%
+Rotavirus
+Thirteen
+stem cell differentiation
+NK cells
+pSTMV and pRP
+excitation light
+13
+B cells
+three
+lymph node
+gastrointestinal stromal tumor
+11
+high levels of specific IgG
+pulmonary infection and by hyperoxia
+IRE1a and PERK genes
+MobA89K
+840
+2017-12-07
+microscope
+Interactions between the epitopes in the context of the superstructure
+rHc-CS antigen based indirect-ELISA
+different functional variants
+DIG High Prime DNA Labeling and Detection Kit
+7,184,391
+N-acetylcysteine
+Phe, Met, and Ile
+pregnancyspecific P. falciparum antigens
+Nineteen
+transmissibility of virions
+rabbit anti-CD31 antibody
+a HIS4A::lacZ reporter cassette
+Diarrhoea cases
+Paleartic region
+74%
+Catabolism of the nucleotide sugars
+decreased the proportion of the lethally wounded AT I cells
+2009
+Tecan Infinite 200 PRO
+gene loss or gene reduction events
+deletion of genomic elements
+Kern's model
+47
+unmanned aerial vehicles
+3
+103 N
+Richness
+1,194 Å 2
+ea-utils
+NF-κB or AP-1
+firefly derived luciferase
+leukocytes
+IgV and IgC
+three
+Control animals
+48
+FRET-by-FLIM
+restrictive lung disease and pulmonary dysfunction
+1308
+endogenous ISG15
+U1
+2,352
+niche similarity in environmental dimensions
+act as DN inhibitors of CME and block uptake of transferrin
+angiogenesis
+Chi-square test
+the core, the matrix protein and the viral envelope
+an accessible sample matrix
+569/58.7 pg/ml
+explicit deterministic susceptible-infectious-recovered models
+hemoadsorption
+improved statistical methods
+Surfactant protein D
+Wnt signaling pathway
+CMV
+383
+fair sharing of research benefits and burdens
+RV
+FLDS
+cytotoxicity
+General practice response
+modified techniques
+policy-makers and public health experts
+anaerobic Gram positive bacteria
+pvmdr1 levels
+reduced ER chaperone production
+0.5 µM
+copies
+2005 ATS criteria
+ansamycin antibiotic GA
+HIS mice
+epidemiologic studies of sepsis
+1:1
+RNA extraction efficiency
+FAK-deficient
+16%
+Th2-type
+UFSP2
+95
+124.5
+Y
+Pattern recognition receptors
+• O 2 production
+T = 41 days of observations
+687
+antitumor efficacy
+20μl
+safe local practices of child care
+monocytes
+Immunohistochemistry
+pentamidine
+inadequate application of PEEP
+distant sites
+Viral infections
+15%
+Seventy-two hours
+nucleolar compartments or additional nucleolar bodies or aggregates
+electron
+IFITM1, 2 and 3
+Nitric oxide
+inhibition of HIV-1 reverse transcriptase
+12-day
+25%
+London, UK
+anti-inflammatory activities
+clinical and animal research
+representative photomicrographs of ACE2 immunohistochemical labelling
+Partial effect plots
+control procedures
+extracellular matrix
+mitigate motor deficits
+neutrophilic inflammation
+TS
+Theory of Heat
+the operational process
+rats
+Staffing pressures
+R igraph
+Mutations Y271A and I274A
+anti-apoptotic ability
+100-fold
+Diabetic nephropathy
+fresh medium
+10% of their preimmunization body weight
+how it was implemented
+yeast surface display
+national laws and regulations
+Written informed consent
+RT-PCR
+NdeI and NotI
+reduction of Entropy
+specificity
+infection of dengue viruses
+ROC curves
+an organ from one mouse
+33.3%
+tertiary transmission
+25% to 30%
+4 days
+70%
+H7N9
+antiproliferative and antigrowth effects
+C-Myc
+trypan blue exclusion method
+triggers the activation of specific repair mechanisms
+BioCaster
+RTIs
+28
+May 12, 2015
+missing information
+blood urea nitrogen
+good reliability for internal consistency
+25 µL reaction system
+acute respiratory distress syndrome
+capturing images at different places for one lesion
+cells
+isothermal amplification techniques
+Two mL of diluted tail DNA
+Whole-genome approaches
+Autophagy
+54%
+Nineteen
+circulating lymphocytes
+Graphpad Prism software
+CD226 and CD40 genes
+2.5 mg/ml
+severity of DSS-induced colitis
+embryonic
+Studying the sign of the eigenvalues of the Jacobian matrix
+Hantavirus
+intraluminal
+DNASTAR Lasergene
+median
+methodological
+containment
+baseline mortality
+early IFN expression
+discriminate different oligosaccharide structures
+359
+ImageJ
+immune response
+noncanonical functional residues
+reproductive number
+MARV GP 1 RBS
+GO annotation
+written informed consent
+29
+173
+The effects of scan rate
+TL2 of the 3 0 DB
+visual analysis of CT images
+6
+cellular therapy strategies for epithelial diseases
+Stealth™ RNAi Negative Control Duplex
+≈50%
+descriptive analyses
+478
+The structure of the full-length N protein
+Immunization with large number of plasmids
+CCR5
+Tukey-Kramer test
+3 fluorescent substrates
+Six
+flow cytometric
+Angiopoietin-like 4
+down-regulated
+two
+cDNAs
+endothelium
+Titer
+a subset of ALI patients who survived hospitalization
+Modifications
+a K consecutive base pairs set of TMEV molecules
+IFIT2 KO survival and lower kidney fungal titer
+Master PureTM Genomic DNA-Purification Kit
+Multiple plasmodial genomes
+Epithelial injury
+interstitial inflammation
+reduce mite numbers in a colony
+CaCl 2
+S 1 and S 2
+RV-A16 RNA
+intermolecular structure
+reaching 30 minutes per session
+Th1 and Th2 cells
+990
+when p,0.05
+QCapture 2AE70AE0
+cytoplasmic
+BJ, SD, and HN
+FDCs
+Two
+asymptomatic
+GFP fluorescence
+lipid matrix of H. volcanii
+free amines
+1984
+λ and α
+64
+Identity and purity of all compounds
+1 h
+procollagen II
+apicomplexans
+distribution pattern of comorbidities
+Our results
+innate immune responses
+ticks
+886
+1:2
+>70
+protects and soothes inflamed peri-wound skin
+18.449
+15-40%
+Two
+84
+Gram negative bacteria
+27
+pericellular fibrinolysis
+morphological
+DNA quantification in BAL
+HSP70
+MicroRNAs
+MyD88
+18
+two concepts c1 and c2
+host's transcriptional machinery
+2.7
+distance/ time/economic metrics
+MHCI and MHCII
+18
+TLC
+viral fitness
+numerous putative overlapping genes
+Beijing
+Passive
+QW101
+GHQ-12
+infection
+Leptospira
+α2,6-linked
+ferrets
+influenza
+translation of replication-associated protein
+30 min
+Heart failure
+defective immunoregulation of the middle ear inflammation
+when this IRES is activated and utilized during the virus replication cycle
+Multipotent hematopoietic stem cells
+increased expression of Bax protein
+v-ATPase inhibition
+8.4%
+three
+dermatitis, skin irritation, and DNA damage
+North America
+8
+Microscopy
+Ethics approval
+Japanese encephalitis virus
+0.1e5 mm
+simulation results
+responsive cytokines/chemokines
+full-length clones for each identified gene
+32
+a potent oxidant
+exponential fluorescence accumulation
+high level of homology
+82%
+Throat and nose swabs
+36.3%
+slight differences in the viral genomes
+Two
+1, 2 and 3
+24h
+Ψ and T.
+muscle and unmodified Morpholinos
+0.45 μm
+Cell culture supernatants
+155
+4
+Env protein
+Polymerase activity
+A slippery sequence
+Reed-Frosttype epidemics
+15
+4 weeks
+1/100 000
+24 days
+Glutamine
+enhances antiviral CD8 + T cell responses
+Details of the jurisdictions and/or portfolios that have endorsed the plan
+BCL2 family
+SWISS-MODEL
+the additional Exposed compartment
+p10 MPER
+The Freedom House
+EndNote X7
+systemic RAS independent mechanisms
+condom use
+tens of thousands
+crystal violet
+11
+strong cell-mediated immunity
+99.99%
+ρ
+two
+programmed À1 frameshifting
+depleted
+Netica software
+IBM SPSS statistics software
+packaging or labels
+MCP-1 and other cytokines levels
+chimpanzee
+Annotation counts
+M2
+Metastases
+AC cows
+Golgi-derived membranes
+Women
+phospho-PKR band
+DCt method
+pyruvate and Man-NGc
+10%
+atipamezole
+ammonium sulfate
+Phage Qb
+Bacterial vaginosis
+targeting of essential viral function
+text-based documents
+19%
+data from the recent 2009 H1N1
+magnetic bead method
+airway epithelial cells
+2016
+mouse
+2
+HPRS-103
+50 mg/mL high SPP dose
+2,712,033
+59.2%
+ligation mixture
+Michaelis-Menten dynamics
+240 million
+SDS 1.4
+lowering the temperature
+À26.9 kcal/mol
+Endogenization of retroviruses
+high-fidelity mutations
+participate in this research
+12 th day post infection
+MVASAG1
+Four
+314
+Twenty-four
+GEO
+Mumps
+flavivirus persistence
+The Immune Epitope Database
+1014
+class II transactivator
+hyperhomocysteinemia induced cardiovascular disease
+fluorescent tags
+conservation of the broad antiviral spectrum
+avian influenza A virus H5N1
+Blood glucose
+current observations with PBMCs
+PCT
+essential regulators of the immune response
+2.18.0
+bovine serum administration
+self-renewal and maintenance of glioblastoma stem cells
+HIV associated neurocognitive impairment
+Ad5
+L-arginine metabolism
+Africa and Asia
+pro-inflammatory cytokines
+astrocytic reactivity
+mucosal dysfunction, microbial translocation, and persistent immune activation and inflammation
+asexual
+14 day
+over 1,000 hours
+porcine enteric calicivirus Cowden strain
+fast linking dynamics
+EGFP
+stem S1 of the pseudoknot
+uranyl acetate
+single-cycle viral yield experiment
+large-scale manufacturing of cell-free products
+VP2
+immunosuppressive
+yeast HR
+5 days
+cc-by
+higher fluorescence readout
+2-4 h
+viral particles
+free energy minimization
+experimental details
+LMP7 was specifically lost by 50% and 80%
+plasma
+general practitioner
+monocytes, macrophages and dendritic cells
+fewer lung inflammatory cells and decreased acute lung injury
+bisdesethylchloroquine
+Type 1
+16
+Figure 11
+important
+18S ribosomal RNAs
+the weight of the two distributions
+More than 100
+One month
+300 K and 312 K
+four
+3
+the spleen
+histidine
+ligands that modulate autophagy
+cynomolgus macaques
+FACS
+COVID-19
+black
+antibiotics
+80%
+anomalous phasing
+V27A mutation
+bacterial etiology
+take part in the ETT
+3.2 mg/mL
+Hsp27
+several events
+Vaccination and challenge experiments
+PI
+antibody titer
+1
+12
+100% prevalence rate of infection with one or more viruses
+Examining the ethical perspectives motivating foreign policy for health
+The significance of the computed r value
+difficult
+France
+98%
+Gilbertiodendron dewevrei J. Leonard
+CO
+reversible
+seven
+60
+problems
+36
+75%
+2005
+2-fold
+10-day
+RIG-I and IPS-1-dependent signaling
+Untransformed M13 phage binding titers
+sM2 fused with or without CTA1
+CFSE and CMTPX
+side chain of mcm 5 s 2 U34
+35%
+RT 2 First Strand Kit
+importation
+17.2
+5 hours
+macrophages
+step up and administer the most immediate and effective punishment
+PBoV1
+extreme viral pathogenicity
+HBV DNA
+preferences for optimal AT-rich codons
+three
+susceptible depletion
+Holme and Kim
+T cells
+Cattle
+TANGO1
+Suddenonset severe chest or back pain
+97, 14, 6 and 0
+24 hours
+CD4+ or CD8+ T cells
+severe acute respiratory syndrome
+50−65 nm
+four
+sumoylated proteins
+relatively normal
+glycine decarboxylase
+haemolymph
+Baboons, macaques, and chimpanzees
+Cigarette smoking
+Hitachi 3300H spectrophotometer
+protein produced in the liver
+Britelite and XTT
+three
+increased transcript abundance and protein secretion
+increased viremia and decreased clearance from serum
+PhenDC3
+Rhipicephalus appendiculatus
+doxorubicin or camptothecin
+CellTiter-Glo ® Luminescent Cell Viability Assay
+Eight
+Phosphodiesterase
+HUVEC and THP-1 cells
+β i
+17
+neurodegenerative
+Small molecular inhibitors
+MyD88
+rosette structure
+Enrichment
+1-2 hours
+influenza A virus replication
+Media reports
+IL-10
+one of the two origins of viral lytic replication
+chloride currents
+oral inactivated PEDV
+ARDS
+cervical and iliac
+WT system
+viral load
+Little
+Two
+Superinfection exclusion
+NFkB activation
+apoptosis or autophagy
+herpes simplex virus type 1
+15 ml/kg
+2.5 mL of coupling buffer with 10% KLH or BSA
+a change in the nuclease resistant HCV replication complexes
+nurturance
+IFNGR1-IFNGR2
+An infectious biological agent
+BamHI/HindIII site of pET32a plasmid
+4.2%
+444
+nine
+ClustalW2
+Mov-Avg Cusum
+mCherry
+a large reduction in Ub-AMC cleavage
+weakened purifying selection
+Host immune mechanisms
+on the cellular membrane
+marsupials
+AffinityScript QPCR cDNA Synthesis Kit
+mortality
+Histofine Simple Stain MAX-PO kit
+Infiltrated spots
+E1 region 265-296
+data from three different representative mice
+four
+Daily ultrasound scans
+dietary sodium content
+Medical judgement
+hemolytic anemia
+5.5 days
+Professor Changjiang Weng
+85.7%
+seven different algorithms
+receptor-mediated endocytosis
+0.15 μM
+meeting abstracts
+6 months
+159
+six
+ELISA
+83
+linear regression
+312
+2001
+four
+host caspase-3 activity
+late July
+10
+phosphorylation dependent dimerization
+70%
+Detection microarrays
+normalized spectral abundance factor
+flow cytometry
+patient safety
+HCRC or MHCRC
+co-infections of virus and bacteria
+six-weeks
+pSUMO/Scorpine
+communication
+errors
+virions without virus diffusion
+97.4%
+10
+irRECIST and imRECIST
+siRNA library screening, western blot analysis, and northern blot analysis
+231
+a six-helix bundle
+drop-in surveillance
+MEGA6
+Niclosamide
+DTMUV
+programmatic access to the SEED data and methods
+ICOS
+seven
+oral and maxillofacial
+370
+two
+ten-fold
+Four
+Mayo Clinic Arizona Pathology Database
+PALS1 levels
+SDS-PAGE
+126
+phenol red-free complete RPMI
+the aortic volume
+Fecal transplantation
+Vaccines
+Selection bias
+grey arcs
+cloning into a T-vector
+doxycycline
+N-linked glycosylation
+three
+Diacylglycerols
+52
+viral attachment and membrane fusion
+position 461
+Anticonvulsants
+Xenograft rejection
+plus-strand G-to-A hypermutation
+SHAPE-predicted single-stranded regions
+virulent IBV challenge
+weight loss
+Systematic screens
+human or animal
+Vehicle or LPS
+1968
+systematic
+GTV strain DXM
+termination-reinitiation
+acetone/olive oil
+any assumption about the future benefits and risks
+20 mg/kg
+categorical
+-β
+leak contents
+Double-stranded RNA
+protein evolution
+Xofluxa
+HA stem-based
+decrease
+quasispecies
+a model analogous to that for minute virus of canines
+sex, age category, or the interaction between sex and age category
+biological
+Roche Fast Start Essential DNA Green Master Mix
+antigenic alteration to the viral particles
+Xin-Yi-Qing-Fei-Tang
+twice
+ARDS
+PNG
+100%
+6%
+down-regulated transcription of these genes
+Venn diagram analysis
+more stable
+a value of.9.5
+deteriorates
+CC 50
+pH
+4-6%
+dimethylaluminum chloride
+transmembrane anchor
+SCAU#0014
+climatic conditions
+E. ovinoidalis
+GIB
+DSPA/IFITM
+T705-RTP
+FAK-Ambra1 complex
+transmembrane domain
+7
+specialized centers
+Crohn's disease and ulcerative colitis
+high homology
+vaccinations
+Freshly trypsinized TZM-bl cells
+viral loads
+nine
+30% to 50%
+dissociation of RAGE homodimer
+respiratory etiquette and hand hygiene
+30%
+Age and gender
+Acinetobacter baumannii
+Hepatitis C virus
+viral glycoprotein-expressing cells
+8-9 and 37-40
+high E-CO
+ILP-based method
+kupffer cell
+39,305
+60
+decades
+T cells 1
+EFIRM
+ketamine or Telazol
+88%
+elevated mortality
+Patient recruitment
+MTT method
+signalto-noise cutoff
+from sick or dead poultry to humans
+how to respond to environmental and self-antigens
+10%
+viral protein synthesis
+6-12 weeks
+9
+Huh7
+Exploiting the underlying mechanism
+functional equivalence
+statistically significant
+PA replication
+OPLS-DA
+AUCs
+500:15,000
+13,672
+binding of a secondary receptor
+stem cells
+515.2 mM
+Dnmt3a activity
+every 3-4 days
+kernel parameter estimates
+serum
+LPA-induced DR6 expression
+mucosa
+17.3%
+intestinal amebiasis
+Int1
+presence-only maximum entropy
+gaps in current laboratory leadership learning programs
+an adaptive mechanism to refold unfolded and misfolded proteins in the ER
+LaSota
+every step in the viral life cycle
+passive lateral transfers
+early detection of a GI disease outbreak
+Asian countries
+4
+HCWs
+21
+02:55 pm
+transferred to seawater
+Other TPR-Containing Proteins
+one
+transmembrane densities
+ubiquitin
+ducks
+302
+the gene proportion associated with the respective term
+VEGF
+19%
+Ligands that bind G4 RNA
+disparate cultures and ethnicities
+chimpanzees
+ARRDC1
+inflammatory
+1/10th of the cell culture volume
+cerebral endothelial cells
+twenty-two
+96
+feces
+kip1
+unique substitution analysis
+b-actin
+Attributes key informants and health officials
+anti-Ly6g antibody
+trypan blue dye exclusion
+appropriate
+antisense-interfered SHAPE strategy
+R 0
+latently infected neurons
+caution
+multi-step
+1000
+24-hour
+Keimig
+fugitive
+one day
+cycle threshold values of the diluted M-vRNA standard with known copy numbers
+Two hundred
+Homocysteine
+18S
+38
+bioluminescent signals
+drug stockpile
+neutral proteases
+HepaRG
+deletion of codons +28 to +61
+levels of U6 snRNA
+PMO chemistry
+Arenaviral proteins
+type 1 interferon system
+100%
+21%
+544
+EL and the sensitivity of the test
+geocoding
+1 or 10 μg/ml
+Deafness
+RS
+41%
+B lymphocyte
+handheld devices
+five
+more than 50
+48 hpi
+moderate agreement
+$10-to 14-fold
+seed dispersal
+chloroplasts
+79%
+65%
+four
+poly particles
+Renal failure
+effective tetherin antagonist
+RIG-I
+Versions of the prototype for several isothermal techniques
+77.5 years
+RT-qPCR
+T-cell activation
+TGF-b 1
+macrophage infiltration
+Kupffer cells
+by using the telescopic locking nut and rotating locking nut
+29%
+37˚C
+less than 50%
+40 million
+Inspect3D
+translation, rotation, and differences in internal geometry relative to the initial predicted pose
+H9 infection
+RTA promoter activity
+À70 C
+dimeric
+Arterial blood gas
+F81 cells
+clinical and epidemiological
+AutoDimer
+small molecules
+poorer
+nine
+80uC
+different types of data
+5
+tribromoethanol
+cerebral blood flow
+some bias
+pro-inflammatory
+cardiomyocyte phenotype and morphology
+Supplementary
+Univariate
+20
+phase-contrast light microscopy
+binding to 2H5
+25-30%
+4
+mild to moderate gingivitis
+growth form
+ICU attending physicians
+host phylogeny
+Identifying important nodes to affect diffusion on networks
+273
+log ACE2 and age
+nsp2
+Respiratory failure
+increased transmission
+QY
+pattern recognition receptor
+immune cells
+poliovirus
+two
+NDP52 and TAX1BP1
+Twenty-five
+bacteria
+State R5
+A module-based regression
+Six
+ts and cold-adapted phenotype
+22.1
+blood stasis, hypercoagulability and vessel damage
+5%
+by dividing the wet weight by the dry weight
+33.5%
+contaim
+Sixty-eight weeks
+telomeric multimeric G4 structures
+5 nm for excitation and 10 nm for emission
+Chemoprevention
+nonmultiplicative effects of double genomic manipulations on growth
+relativestaff
+the deletion
+1930s
+less than 30 min
+496
+age-or location-specific subsets
+Type II pneumocytes
+increased capacity
+Upon target binding through the scFv domain
+L
+NGS technologies
+rs12252
+Western blotting
+CReP
+random effects model
+Fisher Scientific
+SCR-modules
+individual-based and other stochastic models
+culture media solution
+epithelial
+101
+three
+homotrimeric glycoprotein complexes
+herpes
+f i
+Blood samples from mice, ferrets and non-human primates
+AMR K. pneumoniae
+cluster-specific PTSD and depressive symptoms
+relative fluorescence intensity
+The link between infection rates and obesity
+Defensins
+G1 to G5
+Actin
+7 days to 6 months
+30 min
+virus biology
+extensive RNA structure
+selenomethionine
+Gaussia luciferase
+woodchuck model
+ratios
+10-fold
+Student's t test
+Over 168 million
+Phylogenetic
+three
+1 h
+invest more in global disaster surveillance
+5%
+14 November 2007
+Actin and actin-related proteins
+34%
+RGs
+0.25
+p value cutoff level
+disease management and control, and biosecurity measures
+protein unfolding
+NCL1-HT2A-Lin41
+destabilize
+EGR-1
+Central Africa
+midiprep kit
+108
+ischemic
+published conventional PCR assays
+cross-reactive
+The effect of drugs on mitochondrial DNA quantity per cell
+immune-checkpoint inhibitors
+10
+RPS15, ACTB and B2M
+MALDI-TOF-MS
+10%
+Activation of the TLR5-NF-κB signaling pathway
+three
+metal chelating motifs
+temperatures
+Four
+50 min
+inhibits the activity of intermediate molecules of the TLR-pathway
+PRWz and PRWWz
+ELISA reader
+closer collaboration and long-term commitments
+controversial
+intense work
+Spontaneously hypertensive rats
+4 h
+a population bottleneck
+interacting RNA molecules
+NSF-IOS-1831988
+good absorption, distribution, and oral bioavailability
+six
+ENC plot
+pr-E binding
+Victoria-and Yamagata-like lineages
+Zanamivir
+15
+organismal death
+surfactant proteins
+four
+chromatin
+Spectral analysis
+17
+Bronchial epithelial cells
+agar disc diffusion test
+independently
+Seven
+micrograms/kilogram body weight/minute
+58.46% and 53.84%
+vaccines and antivirals
+mucosal cellular responses
+To describe the strategy and the emergency management and infection control
+viral replication
+adjuvant function
+latency
+increase
+SPSS 18
+34%
+an adjuvant
+43
+11
+degradation
+zinc-finger
+human immunodeficiency virus
+new human pathogens
+Recombinant LCMV expressing LASV and MACV GPs
+daily
+lesion diameter
+>7 days
+patients who did not receive a prescription for malaria chemoprophylaxis
+Female A129 and 129Sv/Ev mice
+Critical care triage
+TIPs
+MAFFT 7.3
+epidemics
+National Hospital for Tropical Diseases
+exogenous as well as endogenous virus
+Three
+hydrophobic
+32
+baseline, or post CIH sympathetic activity
+Avastrovirus 4
+Microscopic Agglutination Titre
+IASOS
+7876
+Cas9 expression
+mTOR
+1918
+therapeutic
+diffusion-limited
+Four
+translational studies
+wild type mice
+an immunocompetent mouse model
+transcriptional silencing of the telomerase promoter
+OCT4
+Lung sections
+Inferred clusters
+intracellular
+rdrr.io
+The establishment of bat primary cell cultures
+distilled water
+future clinical treatment
+H9 rRT-PCR assay
+Log-rank test
+Programmed cell removal
+5%
+Bangui
+202,602
+Listeria monocytogenes strain EGD
+urbanicity
+water-saturated ethyl acetate
+trifluoromethanesulfonic acid /water
+63 years
+empty control vector DNA
+Grey
+cloning and expression
+Protein-bound 3-nitrotyrosine
+Gene duplication
+cytoplasmic fractions
+PIV
+PepTag ® Non-Radioactive Protein Kinase Assay kits
+apoptosis
+27 months
+Developing diagnostic tools and strategies
+112 bpm
+those obtained during the development steps
+inflammation
+Necrotic and apoptotic cells
+GC3S
+85.4%
+RNA
+abated the progression of renal disease
+SP-D, and KL-6
+Cy3labeled
+memory/plasma cells
+51%
+Oral ribavirin
+Intracellular proteases
+to constitutively activate NF-kB
+Th cells
+77.4%
+SSj14
+quadratic
+interference with a protein F-mediated membrane merger
+Sub-group analyses
+devastating pandemic
+via i.n. route
+Surgical-grade
+DENV NS2B3-dependent inhibition
+IFI6
+TGF-b/Smad3-dependent
+noise
+selective pressure for amino acid change coming from host immunity
+one
+chimeric
+digital
+various fatty acids
+additional allele values
+to reach public health decision makers
+elaD
+output structure of HFold-PKonly
+infl uenza viruses and other respiratory pathogens
+RPKM values
+blood samples
+2003
+interval
+co-expression of the C protein
+that observed in the crystal
+49
+between 5 and 10 M
+cytoplasmic counterpart
+All herd owners
+oxidative stress
+reproduction number
+NCBI Short Read Archive
+Further information on research design
+Anti-β-actin mAb
+Cushing's
+Bax
+Four
+5.7%
+215
+Anti-S1PR1 and anti-CD31
+normal
+different distance value cutoffs
+pro-inflammatory
+myofilament changes
+PRoVENT Writing Committee
+friends and relatives
+user-friendly
+50
+in vitro and in vivo
+NHI
+RhoA-binding kinase α
+extract B
+confer protection from viral pathogens to wild feline species
+90%
+Gene editing
+hepatoma cell growth
+suppressing the yield of virus particles
+MEDLINE
+treatment of various diseases
+influenza
+an in-frame control reporter
+low codon usage bias
+A fragment of BLV env encoding amino acid residues 326 to 418
+VIP information
+Effective vaccine and therapies
+fairness and legitimacy
+VERO cells
+21
+Ni 2 +/IDA metal chelating affinity column chromatography
+paediatrics
+ITGA3-mediated
+13
+uncertainty in clusters sizes
+new functions of ubiquitin
+Ecological and environmental factors
+country level intercepts β 0j and slopes β 1j
+a 0 = 0
+immunostaining cells
+animal medicine
+ZL, DW, and DL
+1-3%
+DAPI staining
+volunteers
+high dosages of cisatracurium
+gross domestic product per person
+reduced exacerbation/infection rates
+four
+ameliorated oxygenation
+1
+DAPI
+influenza
+serine protease 23
+a surplus
+1 mM
+age and BMI
+BCA protein assay kit
+Serum
+two
+The transcriptional profile of PBs
+ER stress-mediated
+Zheng Banqiao
+specificity and sensitivity
+does not cleave mRNAs encoding essential ER proteins
+up to 11 dpi or dpc
+participatory modelling
+six
+multifunctional biophotonic
+survival of lung tissue-resident memory CD8 + T cells
+regression from antiviral to susceptible status
+disseminated intravascular coagulation
+Nasal, buccal and fecal swabs
+39.1%
+20 and 10 hours
+mice
+HRV variability
+promoter activity
+10%
+genomic regulatory blocks
+Spunlace masks treated by ethanol
+primary infection
+The bound eEF1A
+HIV database
+a paracrine effect
+48%
+1930
+target-specific extension
+plasma HK
+homing efficiency
+ΔP
+15%
+five
+Reversible phosphorylation
+protection
+12-18%
+β Qkj
+inhibition of innate immune gene expression and impaired host defense
+prospective targets for modulation of host innate immune responses
+A21U, C24U, A26G and A28G
+law enforcement and EMS personnel
+suspicious
+vaccinia virus and hepatitis B virus
+size and surface charge
+the requirements specified by the reagents' manufacturers
+0.1 and 0.7
+second hairpin sample including compound 5
+p19
+TLR4, 5 and 6
+Student's t-tests
+interaction with other drugs
+MTT
+10
+Gene ontology and pathway enrichment analyses of pathogen-targeted host proteins
+Bid
+À1 RF signals
+least-squares
+evidence quality
+genetic association studies
+0.87
+Diffuse alveolar damage
+Arginine
+68%
+promiscuity
+ARDS
+α and λ
+cell culture medium
+48 h
+by supplying essential genes and mechanisms
+Whole cell yeast extract
+CSF and urine
+improved, stable or worsening
+polymorphisms
+Dr. Salvato
+to obtain valid sequences
+Virus isolation
+HuNoV
+RNasefree DNase
+EP
+human leukocyte antigen system
+GLmnet
+PAM8.1
+regulation of constitutive early expression of antiviral genes
+Twelve
+20
+minimum path length algorithm
+proteoliposome
+136
+Influenza
+chronic obstructive pulmonary disease
+peripheral blood
+Virus neutralisation
+improving the major theoretical and technical issues
+power analysis
+2006
+substantial differences from the WT results
+0.8 mg/dl
+licorice root
+64
+>99%
+nPCR
+Luminex multiplex technology
+Proteomic
+IL4, IL5, and IL13
+Berlin definition criteria
+Splenic macrophages
+ProteinChip PBS II reader
+1960s
+transient
+1 year
+total RNA
+Melanization
+M2 gene-end sequences
+antigen titer level
+molecular microbiological techniques
+amino acid position
+Total Internal Reflection Fluorescence
+noninfected cells
+rCD4 binding
+H2A.X
+strong proliferative and invasive capabilities
+4-8 kinase-dead mutants
+121 base pairs
+Oxidation of methionine residues
+260 nm absorbent
+April 18 to 20
+the value of normalized intensity texture map
+0.25% Trypsin-EDTA
+90.2%
+30 min
+data acquired from a sufficient number of participants
+19 and 20 July
+HCV persistence
+means ± SD
+PI3K/Akt/mTOR signaling
+shrunken class means of biomarker protein abundance
+added during the virus inoculation
+bleach
+Plos One
+ribosomal protein L22
+delayed dissemination from the lung
+Ifi27l2a
+RT-qPCR
+nine
+AQ 11
+indirect negative signals
+lack of power
+530
+110
+72%
+covalent binding to the electrophile
+mouse antibody test
+CV5
+size permutation test
+all Indigenous Australians
+Memorial University Institutional Animal Care Committee
+Age groups and admission diagnoses
+uncoupling protein 2
+PGD 2
+monkeys
+c-Jun and c-Fos
+VP2 and VP5
+Thirty-three
+the importance of maintaining access to a diverse group of funding institutions
+The funders
+nose washes
+needless aggression and violence
+5-NitroIndole
+CAMAG Automatic TLC Sampler-4
+WW1 isolate
+255
+PEDV RNA
+autoimmune encephalomyelitis
+decreased proliferation and migration
+pol trc-leave
+11
+parrot bornavirus 4
+37.1%
+Quil-A 25
+in vivo electroporation and gene gun delivery
+croup
+by changing the length of the outer housing
+ZIFIT Targeter
+blood, liver, heart, lymph nodes, spleen and other organs
+half
+causal
+fibrotic
+SP-D concentration
+Source control measures
+Mouse cytokine bead array kits
+151
+Ingestion of food or water contaminated with V. cholerae
+5 to 71%
+Diaminobenzidine
+bind to NPC1
+51%
+CSF
+novel non-coding elements
+useful tools to design stem-based immunogens
+HSAJB
+how infected cells and T cells may contribute to disease severity
+16s339F and 16s926R
+Superscript VILO cDNA synthesis kit
+prenatal GC exposure related hypertension
+prodromal
+absence of positional bias
+PRRSV-infected isolator piglets
+blood samples
+Ribavirin
+LASV infection
+capillary-like
+63
+interest
+TiO 2 NPs
+740
+Immunohistochemical
+pneumonia and exacerbations of chronic pulmonary disease
+tetraspanin CD151
+recall bias
+IRF-1
+2006
+the same transformation event
+behavioral traits
+which macrophage activation markers are relevant to the IRs
+molecular modeling
+excluded from further antiviral analysis
+Solanaceae and Cucurbitaceae
+an organizing element
+GRAS status
+Pulmonary aberrant immune response
+DOX-mediated cardiac dysfunction
+training data
+to categorise web-based information resources
+Detrimental signaling pathways in astrocytes
+Evolutionary entropy
+35% to 47%
+adrenaline and noradrenaline
+nuclear delivery
+viral load
+Population genetics
+sGP epitopes
+AP2
+15
+it is a major circulating subtype over long periods of time
+filamentous
+important and complex
+antiserum to U2AF65
+Axygen PCR cleanup kit
+Mann-Whitney U test
+Sigma-Aldrich
+Phylogenetic
+Placenta-derived stem/progenitor cells
+synthetic substrates
+molecular dynamics
+to penetrate through the openings of sewn seams
+1000
+pigs and cows
+A strong maternal immunization platform
+~7 s
+negative virus dissociation values
+infected individuals from either its own group or other groups
+an after-season assessment of severity and burden
+∼2%
+acetylation
+inhibition of IAP transposition by RNase L
+waterfowls
+9
+Fifty
+PGD2
+33,000 Da
+inhibition of cap-dependent translation initiation
+CD107a antibody
+Latency II
+efficacy and side effects
+19.3
+virus replication or transcription
+BD birthdeath model
+Recombinant plasmid pAHV-1 concentration
+400
+to ensure the isolation chamber internal pressure is both stable and secure
+14%
+oral triple therapy
+CSFV
+avian origin
+virologic suppression
+every 30 min
+C, D and E
+inhibits Ebola virus multiplication
+viral counter measures
+regulating mitophagy
+XRN1 and the exosome subunit gene RRP40
+more than double
+all splice sites
+key informants, TAP members and senior HERO staff
+factors for ribosome assembly
+GAPDH
+20%
+299
+13
+homodimeric
+nervous tissue
+TLR7, TLR8, and TLR9
+Morphometric
+3%
+7 × 10 11 pfu
+the corresponding author
+to avoid reinfection from littermates
+self-efficacy
+restricted feline immunodeficiency virus
+microbial virulence factors
+higher computational performance and better operability
+64%
+52.7%
+error filtering
+AEP
+ARDS severity
+1973
+Madang
+differences in infection at early time points
+a smear
+Ubiquitin
+gastric acid and pepsin
+septic shock
+five times
+Student's t-test
+Vaccination
+SF12 mental component score
+Mov-Avg Cusum method
+early-endosomes
+WT sequence
+30 minutes
+replication
+Inversion of the status quo
+30%
+90-95%
+100-500 times
+Diagnosis, Epidemiology, Therapy and Microbiology
+33
+500 meters
+biocatalyst
+Bliss independence model
+quantitative real-time PCR
+stimulated systemic immunity and mucosal immunity
+60
+Initial recruitment after the applied breath
+4 more days
+a swab of fecal or gut contents
+postpartum
+uninfected
+Principal components analysis
+selection markers
+the ultimate causes for colonial aggregation
+Lasergene
+1 h
+selected bacterial pathogens
+Midwives and nurses
+enlarging L2
+large
+oxytocin
+manage colonies
+cellular
+resourcetrade.earth
+upregulated mRNAs
+weak-to-no MPO inhibitory activity
+online learning
+understanding the more complex population biology of multi-host pathogens
+absence of AQP4
+pandemic influenza
+IE1 transcript
+western blot analyses
+nine
+immune responses
+10-fold
+Hepatocellular carcinoma
+live attenuated vaccines
+30 min
+Filgrastim
+in steps following the formation of immature virus
+packaging the WSSV 300 kb genome into the nucleocapsid
+continued surveillance of contacts
+28
+compounds that are enriched in the protein incubation with natural product extracts
+synthesis and secretion of AeET
+PKR dimerization
+Blood samples
+disordered carbon surface
+Mutual relationship analysis
+Pralidoxime
+Irf7
+C-terminal helix
+influenza virus infections
+33%
+via the aerosol route
+by a specific cytokine milieu
+Lys278 and Lys361
+12 km
+S k
+BSA
+Lcd/1
+BCL6
+an ensamble X
+our preclinical model
+abolished
+8
+anti-V mAbs
+80%
+tissue-print hybridization
+20-50%
+fit to theoretical underpinnings
+M protein
+878-Gly s -Ser s -879
+Mouse Anti-Nuclear Antibody IgG ELISA Kit
+LPBE-antibody titer
+60
+PDB files with the highest resolution
+specialized methods
+DNA sequencing
+Oncology and autoimmune diseases
+0.817 to 1.225
+viral loads in amniotic membranes
+fragments
+70% to 90%
+interactions
+A buffer injection
+A follow-up study with this regimen
+cytoplasmic loop
+bands or dots
+NPInter
+3 days
+37
+BTV1-induced autophagy initiation
+.80%
+HCMV UL40 peptide-induced conventional memory NK cells
+the cell nucleus
+nuclear SREBP-1
+2 hours
+therapeutic agents to targeted organs
+edges
+320
+The role of infectious agents
+18-26 nm
+single-stranded 59-ends
+RV-A and RV-C
+81%
+R30K
+livestock tracing schemes
+mild
+IFN-c
+recombination
+SPSS
+WT mice
+t-butanol
+IFN-c
+Six months
+weekly refresher training
+sepsis and septic shock
+80,000
+Neighborhood
+helix 26 of 18S rRNA
+single station WBGT observing platforms
+PPIA, B2M, and RPL4
+mutant viruses
+AQ 11
+protein-protein interactions
+less robust depletion of the targeted mRNA
+full-length precursor of membrane plus Env
+Basal Medium Eagle
+90% trans and 10% cis
+antigen presentation
+100%
+cc-by
+studies that model the human condition
+RNAi
+London
+170 μl
+100
+G1, S, G2, and mitosis
+rural areas
+a series of protein bands
+DNA fragmentation
+Glucose-6-phosphate dehydrogenase
+1457delA and A1475G
+proteins in the airways
+spatial correlation analysis
+Vaccine-specific residue changes
+2H5-A14 binding
+risk appetite and triggers
+the same direction of response
+close linkage
+Sociodemographic
+up to 42 days
+High Capacity cDNA Reverse Transcription Kit
+4%
+two weeks
+13,728.54 Da
+filamentous growth in haploid cells
+122
+polyethyleneimine I
+H5N1
+WT
+pre-MG surveillance
+region, sex, age and method
+Niclosamide, 600655, 600653, and 500199
+exon skipping
+Table 1
+Intensity functions
+CSE
+thermoregulation
+8.3
+four
+Oligomerization
+disease outbreaks
+Singapore
+The present study
+Refractory CMV disease
+CD4 + T cell-dominant response
+3
+making edge threshold less stringent
+The dose-response curve
+OriS
+relatively modest
+the type of cell and its state of activation
+number of patients
+cell culture media
+IFITM5 mutants
+cutoff values
+0.5
+15
+every 10 ps
+most infectious diseases
+The Jackson Laboratory
+2
+Center 9
+One microgram of the total RNA from each sample
+amino acid positions
+17
+PRINT technology
+DNA hypermethylation
+mental health issues
+twice
+491
+praziquantel
+Ag-specific effector and central memory T cells
+introduce disease into host populations
+18
+truncated forms of viral genomes
+90%
+the parameters of the network structure average degree n and clustering coefficient Φ
+necroptosis
+effective prevention and control measures
+3 mg/L
+SR proteins
+allergic asthma
+Copy number
+Oude Munnink, Bas B.; van der Hoek, Lia
+Pride
+SYNERGY
+Acute respiratory distress syndrome in adults
+17
+tTA gene
+CCHFv
+Tyr202
+viral sequence data
+bracoviruses
+Collinearity
+tomato Ty-1 resistance allele
+Coated microneedles
+200 μL
+VirB6-89K
+MG-132 and Bortezomib
+associated unique enzymes
+full-length or unskipped transcript
+59 end labeled using ATP and T4 polynucleotide kinase
+Major airway and bone landmarks
+scFv 10FG2
+10%
+0.5-4 kb
+a regulator of the homeostatic function of these cells
+1,300
+potato dextrose agar
+lysosomal proteins
+Severity of illness score
+99%
+The posterior distribution of indicator values
+plastic
+emancipatory theory
+Richards model
+seasonality problem
+Quantitative
+52%
+post-defervescent decline of IFN
+Four
+B regulatory cells
+the class level
+Analysis of the targeted mutant
+two
+1Á6 log 10 TCID 50 per 100 mg or gram
+individual-level variables
+SPSS version 12.0
+IfitmDel
+feature
+no-stop mRNA
+E. coli Rosetta cells
+agriculture personnel
+aortic glutathione peroxidase
+acute and self-limited
+presentation of a difficult diagnosis case in a young lady
+licensure
+mass-corrected residual trait values
+Sepsis and use of mechanical ventilation
+5 mg/mL of the respective polypeptides
+PPE
+false
+duplicate ports
+6%
+Thirty-one
+eliminated
+influenza RNA
+4
+cell tropism
+new antibiotic treatment or hospital admission
+d = 2
+80%
+enlarged end-systolic and enddiastolic diameters
+oxygenation index
+non-allergic rhinitis and influenza like-illness
+Affymetrix
+closure of triangles
+JEV progeny yields
+supplementary material
+Viral load detection
+human bocavirus and rhinovirus
+maintaining the ECMO run carefully and avoiding ECMO-related severe complications
+student t-test
+ADE-mediated severe dengue disease
+guanidine-cytosine
+Creative Commons Attribution 4.0 International License
+Arf1
+GraphPad Prism
+Neurophysiological
+adaptive
+hypertension
+intermediate
+1000 kDa
+regeneration of living tissues
+reduced phosphorylation of Csk
+better influenza vaccines
+1.5 million
+1189
+diaminopimelic acid-containing peptidoglycan
+8
+normality
+bovine tuberculosis, bubonic plague, and glanders
+Doxorubicin
+binding of Ang II to PT AT 1 receptors
+1.2%
+213
+tissue controls
+levers
+statistical power would be generally increased
+methylcellulose
+50%
+Detergent
+disease severity
+5552
+blocked infection at a step after viral attachment
+30%
+Oxygen affinity
+16
+high
+GTG-to-ATG
+269
+HEV permissive and nonpermissive
+Health individualism
+Innate immune response
+breeding catteries
+most efficient siRNA
+decline
+conceptualized and designed experiments
+CC10/FOXJ1 double Cre mice
+by introducing MyD88 or TRIF inhibitory peptides
+Humanized mouse models
+536
+CD4 + T-cell help
+ART
+nasal tissue
+Ghana
+conventional kinesin
+Respiratory virus infection
+40
+5%
+Oseltamivir
+300
+70%
+The PI
+microscope
+PPE use
+every 3-4 days
+three
+an extra 54 nucleotides
+1.5 h
+330
+125
+Sex and age
+Parenchymal pacifications
+accurate and early diagnosis
+low enzyme productivity, low catalytic efficiency, and pathogenicity
+macrophages
+polarized cells
+Lymphocytes
+Two
+conjugation
+both intravascular and topical administration of target agents
+linear dose
+weak cytosolic signals
+dihydrotestoesterone and testosterone
+~0.01
+Mechanisms
+an individual test using a serum sample
+dehydrogenase
+TRAIL-dependent
+viral plaque assays
+Dengvaxia
+ARDS
+four
+HBV
+TPIC without DOX
+1
+USP14
+reduction in nuclear factor-κB activity
+suppressive
+Jamieson
+ProMED-mail
+Nuclear factor kappa B
+dry
+healthy
+Molecular Imager5 Gel Doc6 XR
+use
+isoflurane
+filamentous growth
+DC-SIGN and L-SIGN
+targeted SpO2 range
+VP88GFP
+BAC2-12 transgenic mouse liver, kidney and small intestine
+50 µL
+8
+myeloperoxidase and elastase
+the interaction between evolutionary processes and spatial-temporal domains
+fetal hydrocephalus
+88 000
+morphological
+editing for clarity, grammar, and syntax
+international health risks
+viral dissemination and neurotropism
+11
+132
+multivariable logistic and proportional hazards regression models
+77%
+real-time
+over-the-counter medicines
+102-198%
+improving vaccination efficiency
+Enzymatic reactions
+serologic
+Vaccines
+continuous antigenic drift of seasonal influenza viruses
+high levels of MR
+TAAR1 RNA
+20 to 25 kGy
+further studies
+networks of higher quality
+GISs
+E2F8
+angiogenic blood vessels
+2009
+screening for bornavirus-related sequences
+wet-to-dry weight ratio of the lungs
+fewer and longer contigs
+Sip protein
+implementation
+interview studies
+gravity models
+healthy
+0.599x
+BCA Protein Assay Kit
+expression and secretion of functional antibodies
+reduced release of RSPs in the cell supernatant
+self-complementarity
+two weeks
+H5N1 pseudotype
+24
+6 months
+Immunoglobulin G
+microenvironment
+extracellular domain
+beneficially and detrimentally
+5.6%
+teleost
+h-index
+x k
+two
+Univariate and multivariate Cox proportional hazard regression models
+unfolding of H4b and H5
+bovine serum albumin
+similarities between proteins that share no obvious global similarity
+viral replication
+Tuberculosis
+important
+Rates of molecular evolution
+293T-Gluc
+EBOV
+epitope mapping
+substrate targets of viral proteinases
+attenuated and recombinant vectored
+every six months
+Gene expression
+inflammation, oxidative stress and fibrosis
+fecal material
+SP-D-deficient
+interventions
+two color western blotting
+Nestin-, GFAP-, and β-III tubulin-positive cells
+underlying chronic respiratory insufficiency and bacteremia
+interchangeable
+important
+PyMOL
+DMF technology
+3.2.4
+144
+300
+seryl-tRNA Ser CAG
+12 days
+46
+NPC1
+Table S4
+Fc epsilon receptor 1A surface receptor
+reovirus uncoating
+S510
+More than 500
+accumulation of a small degradation product
+new CPV-2a
+Survival time
+rat clathrin heavy chain
+TRAF6
+3
+2009
+GraphPad 6.0
+adoptively transferred T cells
+three
+ribosome production
+Aedes aegypti mosquitoes
+VSV
+neutralizing serum antibodies
+minority
+structural
+the nucleus
+GCs
+SDS-PAGE
+virus replication in the eye
+mutant viruses
+30
+1 : 30
+Duck embryo fibroblast monolayer
+Four
+four
+CD11b high Gr1 intermediate cells
+the specificity of SIBA
+chest CT
+metabolism cages
+pentraxins CRP and SAP
+Stochastic fluctuations on signaling networks of miRNAs
+Three
+spontaneous behavioral changes
+high rate
+log 10 2 −∆∆Ct value
+type II alveolar epithelial cells
+Ongoing inflammation
+15
+endoplasmic reticulum
+17-30 %
+high levels of cytolysis
+eukaryotic sequences
+98.2%
+UNAIDS and WHO
+four
+Knowledge of the likelihood of a large number of health professionals attending
+gel shift assays
+sources and model
+capsid stability, endosome penetration and endosomal escape
+Ratio scaling
+less than 7
+Genome signature
+reporting gaps or biases
+Imiquimod and CL264
+EGR1
+a group of genes participating in cellular homeostasis preservation under stress conditions
+Bhidden
+1.5x10 5 A549 cells
+CFRs
+CDCMN
+base composition
+autophagy
+low-to-intermediate weight loss
+definitive radiographic evidence of vascular ischemic pathology
+15
+16 and 24 h p.i.
+at least a 2 fold greater cytokine response
+novel exposure metrics
+humoral
+48 and 9
+bind to either or both EF and LF
+new sequences are easily detected
+to ensure complete literature retrieval
+very low
+Monomers
+angiogenesis
+% GFP reversion
+HPVE7, Survivin and WT1
+11.8%
+54%
+high affinity neutralizing IgG response
+Ikbke
+icteric syndrome
+EJC-independent NMD
+3
+18
+CYP450
+cDNA
+IRES
+Diseases that once killed millions of people
+Tumor volumes
+85%
+individuals who may be negatively affected by such communicative undertakings
+Mother-to-child transmission
+structural features of the network
+three
+Determinants of health
+Exergen
+Lyophilized
+efficient translation initiation
+PPE and hand hygiene
+peer-recruitment
+84%
+autoclave
+Hydrogen bonds with polarizability activity
+recombinant Scorpine
+1,000
+29%
+A glove port bung
+a component of the cytoplasmic exosome
+SD of the mean for each group of mice
+AT 1 -receptor blockade
+Southeast Asia
+eukaryotic and prokaryotic
+4 weeks
+G-quadruplex formation
+10%
+glycoconjugates
+spontaneous preterm birth
+The display mode
+␤-Globin divergence
+eIF2α
+polyproline-II helix
+Beijing Ditan Hospital Ethics Committees
+k-fold cross-validation
+500
+capillary electrophoresis
+MEGA4
+the base of the cell culture insert
+80%
+500
+binds
+TRAF6
+Optimization
+cattle herds
+27%
+Reassortment events
+1.5Å
+AST, ALT, and serum albumin
+GH signaling
+over-expression of the four genes of interest
+development of viral resistance or AIDS progression
+PRNT
+96
+IC interference
+Poor HRQoL
+Cell lysates
+tertiary care
+increases tumor cell adhesion
+NCBI GEO 165
+hematologic malignancies
+milder disease severity
+The Virus Variation Resource
+65%
+six
+IRF pathways
+insertional mutagenesis
+RNA structures formed by the repeats
+a protein cavity
+olefinic bond
+Transcription of negative RNA into positive sense mRNA
+Time-calibration of the evolutionary history
+nonlinear regression of concentration-response curves
+women
+antiviral strategies
+rib i
+total RNA
+HCV clearance
+61.6 kDa-long
+Escherichia coli lipopolysaccharide and Poly I/C
+Specific nucleic acids
+precipitating
+Sequence conservation
+renal XOD
+debris
+reduction of REE
+5%
+three
+Yang, Jing-tian; Ma, Bing-cun
+370 and 2736 copies/mL
+one week
+lactate, urea and pH
+Offset correction
+universal standards for data sharing
+n
+48 hours
+development and maturation of the ovary
+1.1 mg
+65.5 years
+5 ml of standard plasmid or cDNA sample
+3.23-fold
+higher airborne spread risks
+18
+Three
+lysis buffer
+No association
+14.5 μL
+S 0
+antimicrobial function of macrophages and Th1 adaptive immune responses
+Vitamin E radical
+mock inoculated with cell culture media
+10%
+Peak timing and intensity
+Electronic
+Sec16A
+BLAST
+TRIzol Ò reagent
+232
+IL-1β
+Sensitivity and specificity of the single peptide candidates
+ImageJ
+linear regression
+15 min
+1mm
+2.00 and 3.187
+immunosenescence
+disease distribution
+urbanicity
+21%
+pig
+close
+normal levels
+1 µg RNA
+polymeric
+GAPDH
+IFNb-YFP
+allergic airway resistance
+fluorescein
+% suppression = 100 × ]
+Edward Jenner
+Spleen weights
+none
+10%
+dramatic inhibition of HIV-1 replication
+19%
+hypoglycemia
+accelerates the epithelial repair
+1%
+viral lytic replication
+pathological consequences
+7,553
+risky
+Calculation of X
+reduce the death rate from CM
+Random forest probability estimation
+infection clusters
+force probes
+Qiagen QIAamp MinElute virus spin kit
+Dose-response curves and cytotoxicity
+avian
+age, sex, and prognosis
+CIb
+Forty
+appropriate messages
+bovine serum albumin
+MERS-CoV RNA
+U test
+Clinical CBC parameters
+83%
+South Africa
+Intravenous contrast-enhanced CT
+2339
+detectable viral sequences
+cc-by
+SLC35B2
+antigens
+2.78 days
+A1PiZ
+PSMA-DMAb
+Electricity
+astrovirus
+chemiluminescent
+XLPF
+Rituximab
+Specificity
+12month
+orders of magnitude less efficient
+JdP-C
+lipid peroxidation
+based on the probability distribution function of the training data along each feature
+a separate translation
+familyspecific genome size effects
+1:1.1
+pattern-recognition receptors
+immunohistochemistry
+TopoPSA-topological polar surface area-descriptor
+SARS-CoV-2
+880
+residue 701 of PB2
+communication and coordinated outbreak response
+CpG-methylated silent rDNA
+man-specific
+Sigma Chemical Co., St. Louis, MO, USA
+loading buffer
+polarized distributions of HA and NA
+2 hours
+poly I:C
+regions of statistically significantly reduced variabil- Transcription-regulatory sequences
+anti-oxidative
+Mixed messages from official sources
+10.1155/2017/7535320
+15
+18S rRNA
+moderate health consequences and a minor lifestyle impact
+three weeks
+BALF and lungs
+class A scavenger receptors
+in or near the apheresis donor area
+280°C
+important regulators of host response
+apoptosis
+galactosylation and rhamnosylation
+six
+four weeks
+Tapestation 4200
+Helicobacter pylori and Hantavirus
+inducible cells
+six
+Escherichia coli pHrodo bioparticles
+Viral evolution
+Integrin av
+genotype specific and host restriction
+T7 RiboMAX Express RNAi System kit
+annotated models
+2-3 hr
+74
+venoarterial
+FGF10 mRNA synthesis
+rZIKV
+SCSDVs
+vascular integrity
+airway epithelium
+syncytia
+bronchial lymph nodes
+nine
+NS
+PtdIns3P
+VQ29 and ADK2
+crystallization
+non-redundant functions
+twice daily
+pandemic influenza
+Korea
+100-fold more sensitive
+percentage of cells infected with NiV
+poly-L-lysine solution
+60
+Prompt management of the disease
+2AE7 or 3AE2 days
+inhibition of hsp90
+Ang 1-7
+making sense of such large-scale biologic sequence data
+vaccine candidates
+DAVID pathway analysis
+infection by the wild-type virus
+oseltamivir and ventilators
+hematoxylin and eosin
+mRNA regulation
+Fisher's exact test
+10
+Maxent model
+adhesion medium
+poor nutritional status
+200 nM
+eight
+polyclonal antibodies or anti-sera
+decreased
+ICPI and MDT assays
+membrane
+resource reallocation and immune evasion
+Pub1
+Odyssey 1 IR scanner
+NE-induced increases in lung compliance and mean linear intercept
+an epidemic
+116
+two
+Informed consent
+LAMC2-silenced Penl1 and Penl2 cells
+model-based methods
+winter and spring
+cryo-EM
+quit their job
+exhaled VOCs patterns
+Bid
+yolks
+PRRSV 1-4-4
+anti-WHs antibodies
+Gastroenteritis induced by RV
+6.96 nm
+90% to 95%
+hypertension
+continuous-time differential equation model
+inactivate a variety of pro-inflammatory and coagulation mediators
+Transform-derived baseline and noise values
+Regulatory T cells
+β-actin
+the number of host range expanding mutations and their frequency of appearance
+six
+Sepsis
+1 out of 66
+H275Y
+longer overall survival
+160.25 ± 9.47 mg/dL
+Lactobacillus brevis SP
+the fraction of pairs of links that overlap in time
+with Exportin
+44.9%
+China, India and countries of the former Soviet Union
+0.3 and 0.05 mm alumina powders
+specific input data
+viral exposure
+experimental validation
+skewed variables
+WT protein
+inadequate staffing
+oseltamivir carboxylate
+RBM4 and eIF6
+Twenty-eight days
+media
+reduces
+phagemia
+25
+social distancing
+2.7 Â 10 6 /mol
+running water
+HHV-8-infected plasmablasts
+Eight
+Targeted delivery of therapeutic payload
+GraphPad prism software
+when therapeutic intervention could be effective
+25 to 30%
+85
+four
+Bartha-DupGreen
+4
+E5, E6 and E7
+59ppp moiety
+Dispositional optimism
+24 hr
+after all individual infections have been accounted for
+immobilized ricin toxin
+38 kilodalton protein
+pseudo-distance
+outcome prediction and guidance to human and financial resources use
+a unique index primer
+monolayer cells
+virtual screening
+Interferon c
+fall-winter seasons
+DENV3
+Flv r
+−7.7 kcal/mol
+diabetic animals
+YPD-broth
+dynamic transmission models and economic analyses
+dcl-1
+slug tip
+447-687
+Th1
+7 days
+930
+1610
+36 hrs
+the state
+Sigma-Aldrich
+VersaMax ELISA microplate reader
+Dysregulation of the antibody response
+2 µg/mL
+graph based
+biosafe antigens
+50
+domain antibodies and single chain antibodies
+TLR4
+LC3
+Humoral immunity
+50 nm/min
+95%
+amino acid phenylalanine
+horses
+Ifit2
+structural remodeling
+0 0 4 4 0
+Whole-genome sequencing
+synergism
+6.0%
+intron retentions
+SDS-PAGE
+poxvirus
+niclosamide
+four
+212
+Pasteur pipette
+ZXH
+parsimony
+analytical traction
+ventilatory
+53.5%
+An unpaired t-test
+anticancer mechanism
+The binding of a peptide to MHC-I molecule
+Shanghai
+Suicide
+linearized plasmid DNA
+Vector biodistribution
+5-20%
+isothermal nucleic acid amplification techniques
+2 months
+a viral fusion protein
+sera
+1 h
+Metrics
+MEGAscript T7 Transcription Kit
+22
+more efficacious
+weekly rates
+three
+Formaldehyde or 5 to 10% chlorine bleach
+variola
+30 %
+Microarray data
+37uC
+many forms of acute critical illness
+IFN
+evidence of local reaction
+T pure
+1.10
+negative depletion of magnetically labeled cells
+humans, simians, and bats
+50%
+compares the sensitivity and specificity for different k-mer thresholds
+CLOCK and BMAL1
+6-8 weeks
+FlowJo.10
+HSV entry
+LM mice
+cell proliferation and apoptosis
+increases
+radiolabeled
+Scoring systems
+Western blotting
+4 weeks
+Early administration of antiviral treatment
+seven
+617
+advanced therapy medicinal products
+PrP Sc formation
+enhanced oxidative stress
+DDIT-3/CHOP
+group means
+current US CDC guidelines
+QAAFI/399/13/MLA
+kidney and spleen
+pre-emptive vaccination
+Malignant melanoma
+their own lytic-development independent promoters
+Water temperature
+primates and humans
+farnesyltransferase
+30 nm
+Carollia perspicillata
+red
+R 0
+treatment services
+med ik
+Extracted RNA
+Pan T Cell Isolation Kit
+14
+1 OD 600 of cells
+bacteriostatic
+phase separation
+the absolute count of white blood cells
+60 min
+2001
+Norwegian Veterinary Institute in Oslo
+wholesale markets
+pro-inflammatory
+probability
+Mechanisms, efficacy, and safety of rhAPC
+DLS
+substitution T70S
+USP48
+Richards model
+HuRef.chrY
+long-distance PCR
+the level of a threat
+three
+Cse
+public health emergency
+2%
+60 minutes
+AP2 and SP1
+33
+every 12-18 months
+Sister Vivian Bullwinkel
+95%
+AhR
+phenotypic DC maturation
+HIV-1-specific T-cell responses
+cell lysates
+anti-inflammatory, anticancer, and antiviral
+55c per dose
+9,700
+cartilage, bone, mammary glands or pancreas
+twice every day
+55.8%
+E1E2 global folding
+ten
+the corresponding author
+wheat germ agglutinin
+Chronic wasting disease
+four
+row-wise independent algorithm
+NBD and rhodamine
+bats
+situations
+SiO 2 /Au nanoshells
+CIH
+degradation of ER domains that contain misfolded and aggregated proteins
+0.5 mL of nutrient media
+mice
+immune response
+1 week
+transcript abundance
+hyaluronidases
+one
+barrier function
+Continuous sampling desiccation
+samples with small number of cells
+large dynamin-like GTPases
+Water, food, and fomites
+their communities
+two
+antiviral agents
+21-22%
+Viral
+IFN and NFκB signaling
+IFITM3
+CD4+ T cells
+George Anderson
+decontaminate the water
+decrease in the viral titer
+autophagy
+antibiotics
+1976
+time-consuming
+four
+the hospital always has its own supply of donor bone material
+thirteen
+Lineweaver-Burk and Dixon
+four
+40%
+decreased levels of SMN proteins
+The plaque assay
+Mechanical ventilation with heliox
+11
+28
+Logistic regression analysis
+severe unexplained diseases or syndromes
+Substances present in the sample matrix
+higher cost of electronic equipment and operating software
+CDV-H
+rapidly internalized
+fibers
+dermatitis
+MERS-CoV
+vinblastine, VCR, and vinorelbine
+recent advances in the management of septic shock
+Messenger RNA
+data that sometimes be there and sometimes not
+Extracorporal membrane oxygenation devices and ICU ventilators
+C. pipiens
+Packard Flow scintillation analyzer
+2-11
+8 and 15 dpi
+interact
+HRVs
+LightCycler 480 SYBR Green I Master
+by interacting with host erythrocyte cytoskeletal components
+4 out of 6
+Sixteen
+Figure 4C
+0.14 and 0.16
+1100 elements
+CD8 + Vb8 + T cells
+UV Stratalinker 1800
+φ −1
+feces
+Over 90%
+Antiviral responses
+32uC or 37uC
+100%
+septicaemia and pneumonia
+mRNA expressions of BSEP and FXR
+29
+16 dpi
+Five
+1.7 days ± 1.5 days
+120
+World Health Organization
+reduced the unwinding force of the rod
+proportionate mixing
+lentiviral vector
+conventional PCR and real-time PCR
+10 minutes
+five
+-382 cal K -1 mol -1
+PR PLTs
+moderate to perfect
+four
+pBBSmal vector
+polymerase chain reaction
+sertraline and bepridil
+one hour
+12
+three
+six
+Dual-luciferase reporter assay system
+2003
+ABMs
+33 months
+Acridine orange/ethidium bromide
+3
+Pennsylvania
+bias
+cardiologist-supported
+topological
+promoter-bound STAT1
+12
+829
+10%
+MMP-9
+Fig 9
+apoptosis
+pulmonary sepsis
+higher
+3 working days
+ELISA
+k i
+recombinase
+44
+Targeted cancer, hyperthermia, photodynamic and gene therapies
+SBC
+326
+epidemiology and molecular biology
+Oseltamivir
+Boran and Holstein-Friesian
+pH-indicator
+X-tile software
+cap-dependent
+both innate and adaptive characteristics
+25%
+standard error of the mean
+Standard anti-viral nucleoside analogs
+RV infection
+Hypercapnic respiratory failure
+65
+P C L j F 1
+1.0 nM
+vaccination coverage surveys, nutritional surveys and retrospective mortality surveys
+the brain was sliced into 1-mm thick coronal sections
+for some time
+autophagic vacuole formation and maturation
+b
+dengue virus replication
+16
+Enterobacteriaceae
+MCDA
+CedPV genome
+0.03%
+multiplicity
+four
+Influenza A viruses
+changing population health status
+dynamics of the host
+gated cells
+the 3 genomic regions
+12.5%
+immunocompromised patients suffering from toxoplasmosis
+penicillin, vancomycin, and linezolid
+21.6%
+After 2002
+TestXpertⅡsoftware
+Th17 cytokines
+ATG13 and FIP200
+non-influenza-related care
+video
+59-deoxyribonucleotidase activity
+three
+Dr. Robert B. Tesh
+93.79%
+perlecan protein
+positive selection pressure
+three
+desaturation of palmitic and stearic acid
+qualitative disagreements of system behavior with a priori expectations
+few
+viral titers and viral DNA copies
+liver-resident cells
+every US practitioner
+2019
+mechanistic background
+50%
+qRT-PCR
+Machine learning
+28
+silent codon change
+asialoglycans
+unfolded proteins 4E-BP1
+serial-ET
+A gonorrhoea-like infection
+cross-reacting memory B cells
+host responses to a pathogen
+Retro-orbital bleeding
+stress granules and processing bodies
+older age of patients and pre existing rheumatic problems
+three
+pressurized vascular delivery, laser, magnetic fi elds and gene gun delivery
+100%
+Temperature
+sheep and cattle
+degradation does not preclude microarray analysis
+serum amyloid A protein and alpha-1-acid glycoprotein
+TrxR
+Chemically modified ssDNAs
+chronic underlying diseases
+those from physical analysis of adenovirus genome entry
+age misreporting
+19 months
+Figure 3
+autophagy
+six
+virus yield assays
+bovine parvovirus and minute virus of canines
+Sixty
+Hsp90
+bats
+a cascade of signaling responses to upstream signals
+Complementation
+28
+12.4%
+biodiversity or water/food security
+Ϫ2/Ϫ1 PRF
+PhH
+MOLCAD
+orange and numbered
+mecA
+nucleotide substitutions per site reactions
+apoptosis and necroptosis
+lung endothelial apoptosis
+Phycodnaviridae and Poxviridae
+Skin biopsies
+Octadecylamine and mannose
+The study of immunology
+oligodendrocyte precursor cells
+High abundance
+f dec
+cc-by
+38
+rhesus IgG-specific antibody
+13
+reverse transcription quantitative PCR
+KP120516
+36-fold
+2,559 ± 2,860 ml
+tic Protein rin
+aerodynamic particle size, dose exposed to, and respiratory rate and volume
+15 days
+OD 450
+low protein expression or activity
+Hardy-Weinberg equilibrium
+Cell-and tissue-specific delivery of cmRNA
+μl
+30
+Mutations found in replicate samples
+acidic
+33%
+IL-6
+zebrafish
+Warthin-Starry silver impregnation
+IFN-I resistance
+a tablet-based, easily transportable, touch pad body resource
+Six
+Tryptophan
+limp and arthrocele
+beagles
+300 mg/day
+red
+up to 25% of diaphragmatic
+The theoretical foundations of the cross linking entropy model for secondary structure
+virus-induced cytokine storms and inflammation-related immune pathogenesis
+FMD
+Selected contig sequences or sequenced PCR products
+cytokine
+Uniformed Services University of the Health Sciences animal housing facility
+a reduced range of neutralization
+several hosts are needed to maintain ebolaviruses
+the ratio between hMPV genomic RNA and mRNA
+ADAM17-depleted cells
+Th1 and Th2 cells
+$441 to $8550 per person
+immune suppressive drugs
+DAMPs
+B-SHADE
+pMLKL
+common febrile convulsions
+Whittaker
+IFN-β
+patterns
+Newbler software v3.0
+a proxy value
+synthetic genomics techniques
+whole genome array-CGH
+0.3
+propidium iodide
+norovirus replication
+mortality
+10 minutes
+seh
+mAb reactivity
+Vero, MRC-5 and LLC-MK2
+4 day
+inefficient antioxidation and scavenging of ROS
+7
+areas affected by violent conflict
+Golden Gate cloning
+uteroglobin
+Minimally invasive, reliable, and specific tests
+heparan sulfates
+Qiagen RNeasy Mini Kit
+virus replication
+to maintain the plasmid-based expression of O-antigen
+pfcrt
+Biomolecules
+diGTP-biotin
+voluntary organisations
+GAPDH and PP2A
+eight
+secretion
+Heteranthery
+significant activity of the compound against the virus
+social support
+Lymphangiomas
+six
+Additional surveillance
+N-terminal 6
+biological
+$0.5
+Skaar and Barber
+six
+MD refinement of the TLR4 structure
+7.007
+proinflammatory
+increasing competency
+WF10
+a single cause for the differences observed may not exist
+A and B
+risk factors for severe influenza disease
+Ficoll-Hypaque density gradient centrifugation
+chronic infectious diseases and malignancies
+an asparagine in the HUS domain
+Large carefully conducted clinical studies
+450 and 690 nm
+low ionic strength environment
+a day-by-day tick box framework
+consequent organ dysfunction
+hierarchical folding hypothesis
+200 ml
+chronic immunodeficiency
+young ages
+two
+Fluorescence activated cell sorting
+India
+MutPred
+Mycobacterium tuberculosis
+cholesterol metabolism and MP infection status
+Frameshifting for expression of C.elegans antizyme
+reverse migration
+S. aureus
+90%
+Six to twelve-week-old female animals
+articles published in English and Chinese
+0.34
+tryptophane auxotrophy
+1 h
+a baseline state
+Eqs 3-7
+immunodeficiency in athymic patients
+enveloped, ambisense single-stranded RNA viruses
+95% confidence intervals
+massive apoptosis
+Projections of age-specific probabilities of death
+Tunel
+containment and eventual termination of inflammation
+Twenty-seven
+HCV replication
+relevance to infectious disease research
+0.7536
+methanol extract
+tubules
+E. coli S17-1
+alphavirus replicon RNA
+nonlinear regression of the concentration-response curves
+three to five per cent
+226Q and 228G
+StemProH AccutaseH cell disassociation solution
+DEP force
+22
+Ang II-converting activities
+~30 atm
+mRNA encoding irrelevant antibodies
+diagnostic services
+C-C
+feline herpesvirus and feline calicivirus
+two
+Blastomyces dermatitidis
+>50%
+Knockout of STT3A
+80%
+Influenza A viruses
+polyethyleneimine
+a delay in intubation by use of NIV
+interferon-α response-associated genes
+recombinant canine distemper virus expressing dTomato
+median
+NS residues 1 to 230
+1-6
+age, sex, and military status
+viral infections
+CD-HIT v4.5.4
+Over 40
+R2 = 0.52
+Amino acid frequencies
+mice
+US Department of Health and Human Services
+0.3 mmol/L
+sentinel monkeys and sentinel mice
+Onchocerciasis
+TRIM56
+35
+blood culture and Widal's agglutination test
+repeated structures of N-acetyllactosamine
+Six
+induction of other immune-related genes
+damage
+immunoresolvents
+90%
+CypA-mediated
+45%
+N80%
+mannosylated proteins
+IFN-γ
+time, regions, and individual ICUs
+hematoxylin and eosin
+TP/
+20 μg
+sucrose gradient fractionation
+mouse data
+Hepatitis G virus
+85
+brick-shaped
+Notch1 signals
+Soluble factors present in conditioned media
+11
+ABM
+conserved regions of TGEV strain H165
+no significant differences
+20
+reactive oxygen species and restored pH
+Medrio
+chemoprotective
+150-200 nM
+Thermo Scientific Pierce
+mechanistic
+peacock evolution
+Severe respiratory failure
+phylogenetic
+improve H7-specific HAI titers and neutralizing antibody responses
+lack of specificity
+access to treatment
+misrecognition of the RNAs
+>86%
+its antigenic properties
+ethical standards
+Five
+Immunisation against influenza
+influenza antiviral agents
+Available data
+genome-wide association study
+a-helical coiled coil fragments
+older
+risk-wise
+by reading the T m values from the melting curve
+A control scheme
+winter
+oscillations
+EB spheroids
+24 hours
+tautomerase
+Vaccination
+genotypes 1-3
+movement protein
+post-TGN
+AF-594 succinimidyl ester
+8 months to 6 years
+Transmission dynamics model
+eIF2α
+cigarette smoking
+10%
+unravel basic concepts in cell biology
+up-regulated mRNA levels
+61.29%
+cellular sphingosine
+0.62
+220uC
+reverse transfection protocol
+influenza
+differences in intracellular stability
+PD-1
+viridans streptococci
+5%
+monomeric
+Perceived information reliability or trustworthiness
+20 to 61
+selected for different recombinants
+polyclonal
+80%-100%
+murine trachea and bronchi
+four
+winter
+Biotinylated goat anti-NP antibody
+CFA
+the cumulative exponential growth rate
+preparedness and response behaviours
+reduced antimicrobial responses
+IL-22
+1 mM
+chikungunya and dengue viral infections
+The reported clinical attack rate
+wild boar
+Thirteen
+pH-dependent
+71%
+delayed timelines
+isoform 2
+10ug/mL AMQMLKETI peptide
+changes in exposures to pesticides and other contaminants in water
+alanine substitution
+various infections
+mitochondrial apoptotic pathway
+look up their own resources
+buffalo
+QIAamp DNA Blood mini kit
+Sequence based predictions of disorder
+30 November 2009 to 27 December 2009
+RNA level
+NanoDrop 2000 spectrophotometer
+28.4%
+1,000
+plasma kallistatin
+308,498
+sequence change saturation and purifying selection
+inappropriate patient management and antibiotic misuse
+philosophical
+EVD
+6C
+epidemics
+forced-choice
+SCARB2 mRNA and EV71 RNA
+overnight resting
+good discrimination
+one-way ANOVA
+Jensen-Shannon Divergence
+multivariate Cox regression analysis
+growth of C4 melanoma and CT26 colon carcinoma
+Löwenstein-Jensen
+30 min
+Limulus amebocyte lysate test
+SPSS
+seven
+80-100%
+by dividing the fatty acid specific radioactivity by the plasma water specific activity
+adenine
+>10-fold
+Interdom
+74
+Figure S2
+liquid-liquid phase transition
+25%
+isolation of the agent or pathognomonic histopathological criteria
+cisatracurium besylate
+FB concentration
+Andonegui and colleagues
+subjects sitting
+clinical signs
+r
+proliferation
+300
+older than 15 years
+The ID number
+flow cytometry
+virological surveillance
+refined analysis
+proprietary adjuvants
+immune infiltrates and lung consolidation
+lower N e comparator
+1010
+up to 2h
+October 2016
+macrophages
+DNeasy Blood & Tissue Kit
+CD4 + T cells
+Hippoboscid flies
+>95%
+sex-specific education programs
+bronchiolar epithelium
+camptothecin
+adverse health outcomes
+inhibits ERAD
+E.coli Top10
+KZ52
+oxygen
+integration of information from different sources of public genomic data
+de novo cap-dependent translation initiation
+The cooperation of several of these extended TM oligomers
+Human respiratory syncytial virus infection
+Combination of the immunopotentiators with polyvalent vaccine
+transitions
+paired endoplasmic reticulum membranes
+increase cooperation
+6-7%
+72 hours
+10 μ l of Laemmli's SDS reducing buffer
+when they are applied rapidly and early in an epidemic before many cases arise
+American Type Culture Collection
+cough
+rabbit-anti-goat bridging antibody
+lower
+a control
+ribosomal RNA cleavage
+Ten CpGs
+genetic drift
+241
+Empirical antibiotics and antifungal agents
+12%
+The investigator and staff
+HPRT1
+porcine gene annotation
+80 nM
+humidity
+integral
+endogenous lamin A protein
+evolutionary rates
+inhibited synaptic accumulation
+7
+molecular
+PTBP2
+68 days
+non-smoking uncomplicated asthmatics
+does not enter cells through the endosomal pathway
+covalent binding
+One hundred years
+sixteen
+baseline oxygen saturation
+activated macrophages
+Two
+petechial
+communicable disease issues and their implications
+182
+HLA-A*0201 molecules
+following infection or exposure to other stimuli
+IRF3 and NF-κB
+viral RNA or the viral replication proteins
+eight
+Mesenchymal stem cell therapy
+sequence features
+Swine influenza virus
+total RNA
+challenging
+mortality related to ventilation
+study group B
+no difference in HRV
+Mac-3 ϩ resident microglial cells
+BAL T-lymphocytes
+non-viral mRNAs
+computational analyses
+GGI pairs
+Foot-andmouth disease virus
+100
+FIGURE 6
+antiviral eye drops
+58.5%
+distance of 2.5 Å between the donor and acceptor atoms
+The effusion in the middle ear
+the data observed
+non-antitumor compounds
+Viral RNA in plasma
+RAGE
+S57 in AP1/AP2/AP3
+Leica DM5500B
+17 days
+significant alterations
+ACTB, TUBB, and GAPDH
+7 366
+r age
+Cleavage of the NDV F protein
+turkey red blood cells
+9.2 million
+15%
+large volume of daily incidences
+translational recoding
+The size of the contig
+two
+GCL and GS
+Gabriel M. Leung
+the proportion of persons without information about their date of illness onset
+high population turnover
+tumor cell apoptosis and tumor growth inhibition
+essential
+Mitochondria
+moving bees and brood between colonies
+More than half
+15
+One hundred and sixty-seven
+binding to TG was substantially reduced after sialidase treatment
+3-day old
+Sorting Nexins 13
+2%
+10 cm
+aids in the homing of leukocytes
+Influenza
+VP1 and VP2 proteins
+Long-range interactions
+47
+sodium pentobarbital
+logistic regression analysis and t-tests
+Platelets
+innate immune stimulation
+undetectable
+Forsythin
+MRW
+k
+antiviral
+18 hours
+90%
+F-S MLV
+DC-ablated mice
+site and edge description files
+Retroviruses
+indirect immunofluorescence
+non-significant
+1988
+CVP
+adaptive immune transcripts
+dimeric
+they do not form plaques
+Western blot assay
+Mimotopes
+8054
+Descriptive data analysis
+to provide sequential updates on forecasts
+measures of convergent validity
+6 to 11 months
+A taxonomy
+Aligning Sigma class GSTs of trematodes
+Streptomyces
+public/community engagement, vigilance and resilience
+Rhabdoviruses and retroviruses
+seven
+synthesis of infectious virions
+27 • C
+37
+170
+apoptosis
+1-100
+Marburg virus
+ACE2
+Kaplan-Meier survival curves
+P-M region
+NdeI and BamHI
+MDCK cells
+PCR amplification efficiencies and correlation coefficients
+TLRs
+water
+60%-80%
+EBV-latent
+reduced CSNK1E levels
+VWF-R1597W multimers
+52
+A dose-response curve
+Mycoplasma pneumoniae
+viral infection
+Vitality
+by titration with buffer alone
+virus-host coevolution and intra-host duplication
+their enrichment with various sources of gene sets and pathways
+methicillin resistant
+1,387,377
+Coliform mastitis
+7.5.6
+NEP
+between the nineteenth and twentieth centuries
+2 /FiO 2 ≤ 200 and higher BMI on admission
+genetic increase and growth of the genome
+10 2 -10 6 bacterial cells/mL
+A reduction to a cubic algorithm
+AM
+18 Å
+residual solvent peaks
+nine-amino acid cyclic
+SI = 7 + /2+56/2 = 39-56 days
+6 h
+enhanced phosphorylation of Egr-1
+5%
+Ma-Xing-Gan-Shi-Tang
+Eukaryotic elongation factor 1A
+wt-phase
+death
+machine-learning approaches
+life history, physiological, and ecological trait data
+IL1
+glucocorticoid therapy
+137
+18
+an association
+juveniles
+viral sequencing
+Blood withdrawn from healthy volunteers
+At least 80%
+pro-inflammatory
+10
+Hotspot
+E. coli-induced and CLP-induced septic mice
+3.4.1
+In the nucleus
+nine
+pesticide self-poisoning
+sucrose
+good sanitation and hygiene
+baseline severity of illness and comorbidities
+5 µM
+catalytic and transport activities
+Cryptosporidiosis
+the overall size of the RNA
+trypan blue exclusion
+seizure
+8,236
+Damage to the lung epithelium by respiratory pathogens
+Salmonella Enteritidis S1400 colonization
+confidence region
+non-availability of vaccine and lack of time
+M. E. J. Woolhouse
+Chi square test and Mann-Whitney U test
+33
+four
+differences in VLPs, cell types, or the readout assay
+0.1 mL Triton X-100
+lectins or adhesins
+seven
+quantitative RT-PCR
+Maprik district of the East Sepik Province
+17.4 months
+HEK293 and Vero cells
+Group H M
+Contact reduction measures
+Buddha
+Stc1
+Proper implementation of previous exposure profiles
+51
+cc-by
+WHO
+causal
+RNA fragmentation
+DNA/RNA Shield solution
+Rluc activities
+day 63
+87
+to model a response variable in terms of one or more independent predictor variables
+April 30, 2020
+50%
+cave roofs and walls
+5-HT 1A receptor
+R
+the RGD-containing GH loop
+Neutrophil gelatinase-associated lipocalin
+a fomite or individuals' hands
+GraphPad Prism ® software
+50%
+hydrolysable
+Gtx mRNA
+protein activity
+Sigma-Aldrich
+4′-halogenated
+40 min
+2,665 epitopes
+Contrast dye
+cell lysates
+Two
+Operon Biotechnologies
+CI and CII
+11 days
+they did not use antihistamines
+broad-spectrum
+nine
+ALV-J
+Phyllostomidae and Pteropodidae
+75-120 μM
+virus binding to the cell surface
+one
+five
+2012
+Two
+M-T hook structure
+shutting down
+ACBD3
+35%
+C2, and CD1
+ACADM
+nucleic acid purification and non-specific readout
+reporting precision
+cigarette smoking
+no differences in activated WT donor CD4 T cell survival
+Staff
+25
+SPSS 19.0
+translational fidelity
+international travellers and international conveyances
+cap-independent translation
+high levels of IRF9, STAT1, and STAT2
+174
+chloroplast genome sequences
+Epidemic
+protein polyubiquitination
+199
+paediatric nurses
+south China
+a gradient
+12
+interactions
+R 0
+TPCK-trypsin
+rational antibiotic therapy
+EBLN and EBLG
+Mean C values, standard deviation and coefficient of variation
+75%
+enzyme-LTA4 complex
+five
+8%
+what is known from the USA
+1 Â E À11
+tires, buckets, and discarded vehicles
+Attachment to and entry into a host cell
+five
+viral lower respiratory tract infections
+limited virus progeny
+Japan
+Ribavirin
+upregulation of Cdx2
+0.206
+utrophin
+100 million
+amyloidosis
+k
+Homology modeling
+fasting or inactivity
+children
+Chroparaviruses
+TBC2target
+High Resolution Computed Tomography
+visualization and monitoring of G4s structures
+noninferiority
+human noroviruses
+pDC Isolation Kit
+Promega
+Thirteen
+it has explored an area where not much research has been done
+AcHERV-VLP
+Modification of ISG15
+five
+phylogenetic clade
+Transform-derived baseline and noise values
+48 and 72 h
+69%
+enhancing antitumor immunity
+barium removal and the correction of hypokalemia
+three
+Data
+raising alertness for possible exposure to uncommon infectious diseases
+a double-sector epon charcoal-filled centerpiece
+schizophrenia
+the damaged blood gas barrier
+day 0, 3 and 7
+stimulate the release of renin
+DHHC2
+seven
+Distinguishing DENV1-4 at the point-of-care
+The question of whether such harms may be justified or not
+15 min
+characteristic or unusual migration patterns
+0.611 and 0.396
+statistical significance
+limitations in the database
+high genomic A + T content
+FPs
+data
+ISG15 and MX1
+host and/or vector associations
+amino acids
+NASH
+Angiotensin 1-7
+Carbohydrates
+2 to 7 days
+11.3 months
+eight
+recombinant proteases
+90%
+its HA partner
+three
+268
+cryo-conserved bacterial stocks
+ϵ-edges
+virus replication
+gastrointestinal diseases
+indirect ELISA
+Bafilomycin A1
+d s
+stochastic metapopulation epidemic model
+160 kilodaltons
+HTNV-specific CTLs
+gray
+5-33%
+supernatants
+blood pressure and end-organ damage
+16,663
+dramatic changes in health and functioning
+cyclic threshold values
+the thymus
+cellular lysates
+relevant studies
+delphi method
+L and A
+covalent homodimers
+>97%
+alternative
+Wide-bore pipette tips
+37
+converts a mild illness into a life-threatening infection
+selfassessment
+County of Santa Clara
+4 days
+H7N9
+80%
+ImageJ
+g-tubulin
+Communicable disease prevention and control
+12
+RNA-Seq
+MALDI-TOF
+The TNA
+major histocompatibility complex class II
+Escherichia coli and Bacteroides
+deer tick I. scapularis
+RNA concentration
+NF-kB luciferase reporter plasmid
+Tumor Necrosis Factor
+13,183
+novel coronavirus
+viral RNA genome copy numbers
+K63 polyubiquitination
+anisomycin
+rotavirus strain-specific
+five
+semi-structured
+mutations
+ccl2
+a phylogenetic network
+1:40,960
+14.5%
+the mean time between illness onset of two successive cases in the chain of transmission
+transitions between confinement and straight relocation
+T7 RNA polymerase
+72°C/5 min
+IRT
+98-10
+Sydney
+1 h
+H162A and K224A
+all pairs of origins and destinations
+AECs
+entry receptor complexes
+exudative and atrophic
+Barbari and Tellicherry
+17.4%
+GO and COG
+Influenza A H3N2
+51
+Cryptococcus
+14 days
+100
+http://elm.eu.org
+2 ferrets
+Blockade of these inhibitory receptors
+TLRs
+intracellular antibody fragments
+serine
+uman immunodeficiency virus infection
+IgG antibody to human herpes viruses
+uridine phosphorylase
+6.60%
+Host genetic variation
+Zaire Ebola glycoprotein
+Lys48-linked polyubiquitylation
+a novel approach to target new organs
+differentiated tissues
+cyclic epidemic pattern
+Rhinoviruses
+fluorescent antibodies
+BNSP333-coNiV-G
+Digital PCR Analysis software
+compound failures in man
+short-term and in-hospital risk for death
+inhibited
+24 h
+permeability
+Three
+WW Group IV
+T cell monitoring
+30 minutes
+125
+fibronectin
+33
+100 μg/ml or 10 mg/kg
+seven
+translocates from the intestine to the systemic circulation
+600 s
+inflammation
+15
+dynamic compliance
+AUC
+Recombinase-mediated DNA excision
+scr/Egr-1/CBP siRNA
+two
+foci of Fluoro-Jade C positive neurons
+United Nations General Assembly
+Baroreflex sensitivity and autonomic function
+0.1, 1, 10 and 100 mg ml À1
+substantial expression of GCSF and neutrophil β2 integrin
+renal replacement therapy
+three
+Prevalence
+24
+high rates of morbidity and mortality
+TM-align and 3DCOMB
+Four
+an exposure of the wild-type IRES to oxidative stress
+L = −1
+Targeted lncRNA
+Oropharyngeal and cloacal swab samples
+dualuse
+Venny
+Statistics calculated at intermediate times
+Pneumonitis
+molecular specificity
+histologic response to a GFD
+cell senescence
+Global fitting of the time courses
+Ethical approval
+nine
+hand-reared Mallards
+LCMV strain Armstrong 53b
+250
+purified human apoD standards
+terminal chitobiose
+gRNA synthesis
+ICAM-1
+key
+Packard Cobra gamma counter
+Historical experimental data
+13
+Differences in health seeking behaviour or healthcare access
+interruption of blood supply to the bone
+unexpected and unwanted side effects
+Health people
+GBS stimulation of host immune pathways
+2020
+CD4+
+Kaplan-Meier analysis
+PDTC
+correlation analysis and signal detection comparison
+RIG-I and MDA5
+microliter of unpurified product
+Charcoal yeast extract agar and Lowenstein Jensen media
+cellular stress conditions
+dasatinib
+congenital Zika syndrome
+clinical condition
+US Department of Veterans Affairs
+AAA+ ATPase p97
+sequence-specific
+integrates information from multiple alleles to assess risk against a similarly matched data cohort
+security reasons
+IL-35
+all STATs
+25 to 0.006 µg/mL
+Kunitz-like protease inhibitors
+the APC binding domain
+30 minutes
+host
+interesting
+thermodynamic
+chemotaxis
+Lys at position 627
+lipid scavenger ATG9
+gene-based
+CMV reactivation status
+weight loss and 10-20% mortality
+Guangzhou Center for Disease Control and Prevention, China
+5.5-6.5
+~8,000
+internal class definitions and structure of components
+increased pTDP-43 accumulation
+homology modeling
+focal adhesion
+seven
+the globular head of MA
+PaKiT01 cells
+CD4 T cells
+Movement
+QIAamp Viral RNA mini kit
+read the card themselves
+daily
+total viral nucleic acid
+viral shedding
+ubiquitination and degradation of PDCD4
+general response efficacy, self-efficacy, and response costs
+naïve cells
+cellular resources
+180 389
+Resistance to immunotherapy
+VaxiJen
+equal pairwise transmission probabilities
+cutaneous manifestations
+4%
+epithelial cells
+two
+Zeiss LSM 510 laser scanning confocal microscope
+fell apart
+unlimited flight capacity
+calcineurin
+step 3
+unfavorable side effects
+HPV capsid-reactive
+SDS/PAGE
+Angiotensin II
+non-infection-based disease
+real-time quantitative reverse transcription-PCR
+Quick isolation of cases
+symptom scoring system
+pairwise nucleotide p-distances
+1979
+trypan blue dye exclusion method
+antimalarial
+there are currently very few accepted gold standards
+any effect of the downstream oligo
+coverage cut-off of 300
+study sponsors
+septic and nonseptic patients
+single-cause proportional model
+canonical splicing
+cholera prevention and control
+lectin receptor
+RNA-RNA recombination
+in vivo CTL assays
+Retroviruses
+multiple cardiovascular diseases
+Ang II signaling
+Hepatitis G
+100%
+vaccination
+Inducing apoptosis
+major bleeding and infection
+Five
+0.756 0.673-0.839
+fire treatment
+48 h
+highresource settings
+5%
+Sanger method
+plasmonic dimer probes
+sevoflurane
+income data
+instructions from rescue command centers
+NPs
+C and V
+drastically increases
+244 ± 91%
+induced changes in farmers' behavior
+day 11
+PTSD patients
+fold difference relative to control
+Specific primers
+Evolution of the OAS family
+Two amino acid substitutions in the 130-loop of the receptor binding domain
+an important causal link between inflammation and the host hepatic innate immune response
+capsid physical interaction with chitin
+very steep
+semi-empirically determined parameters
+nCAA
+components of the inflammasome
+infection
+JYW and LLL
+Animal Experimentation Guidelines
+20
+N214A
+Salvadorian Ministry of Health
+lowest dose
+2005
+seven
+observation errors
+grp78/BiP, grp94 and PDIA6
+chemical modifications
+factors associated with death
+HBS-EP buffer
+multilocus sequence typing
+insectivorous bats
+DNA repair processes
+five
+TERA
+greater disease severity
+confidence interval
+10.1186/s13054-020-2786-x
+1.5%
+sepsis, head injury, acute lung injury and HIV/AIDS
+2500
+Infection
+10%
+932
+HRP-conjugated streptavidin
+tissue samples
+FGFR dimerization
+Moral struggle
+»40 amino acids
+suitable health facilities and good links
+a discrete binding profile
+chemical modifications of the surface chemistry
+Mokola virus
+Antigenicity
+FlowJo
+March 11, 2020
+an increase in the secretory IgA titer
+NEBNext Ultra DNA library prep kit
+squalene synthase and b-amyrin synthase
+CandidaOrfDB
+tionary
+MEME analysis
+harringtonine
+RNA affinity
+activated macrophages
+3 min
+Seroprevalence surveys
+A random-effect
+human polymorphisms
+Activation and polymerization of Bax and/or Bad
+Xbp1 regulated genes
+Optical restriction mapping
+Population sample sizes
+number of AKI patients
+hvKp
+national/international consensus treatment guidelines
+a linear epitope on VP1
+Modification indices
+79
+metabolic regulation of DCs by TLR4
+Receptors for CSFV recognition
+virion secretion
+R 0
+The SH3 domain and its PRM ligand
+seed sequence presence in 39 UTRs
+inhibitors A2, A3 and B3
+Burkitt's lymphoma
+Shanghai Oebiotech Corporation
+mucoadhesive ability of delivery system
+Fc-dependent viral clearance
+biochemical
+wide sensitivity priors
+54%
+protein domains
+investigation of the HA/NA balance
+F. hepatica
+OptiPrep gradient centrifugation
+antigen
+100
+Mimiviridae
+identifying disease features directly in human tissue
+overdose death
+40%
+Abcam
+autophagic
+CXCL10
+pulmonary parenchyma, bronchial wall, and muscle
+neutrophils, monocytes, and T cells
+Euclidean distances between AMR features
+Yersinia pestis
+JFH-AM120-LacZ
+Sites
+polyproteins 1a and 1ab
+better delineate its effects and putative indications
+seven
+79
+angiotensin-converting enzyme 2
+Granzyme A
+last year
+autoimmunity
+4-12% BT running gels
+viral RNA extracts from various control viruses
+11,700
+phylogenetic tree
+ebolavirus-like filovirus
+Extensive AAI editing
+two
+the next generation of vaccines
+extracellular signal regulated kinase pathway
+glyceraldehyde-3-phosphate dehydrogenase
+NE
+health risks to themselves and their families
+human or animal
+Shannon entropy
+5142
+antiviral
+H9 HA gene RNA
+DNase
+28,338
+National Health and Family Planning Commission of P. R. China
+Visual OMP TM 7.0
+no enhancement
+permanent ischemia
+two
+on linear and log scales
+lipid, polymer, peptide, and even inorganic nanomaterials
+glucocorticoid betamethasone
+54/58kDa
+Linear regression analysis
+passage number and immortalization processes
+conformational
+Toll-like receptors
+ARDS
+LC3-II coated autophagosomes
+monocytopenia
+school closure
+potent gene-specific siRNA molecules
+density
+degree, betweenness centrality, and random-walk centrality
+rDNA technology
+functional differences between the different length variants
+restrict
+regional
+investigational
+Qiaquick gel extraction kit
+Mallard plasma
+literacy status and pregnancy history
+Three
+absorbent materials
+Primers for each target segment
+Respiratory tract washes and cerebrospinal fluid
+εHOMO
+L100F, M104V and Q108F
+35-38%
+decreased
+social conformity
+Western blotting
+K11 Linkages
+16-24 hrs
+excellent outcomes
+80%
+HBV
+at the ends of the genome segments
+HRQoL
+1 hour
+24 h
+Denmark
+inhibit the cytokine-stimulated production of MDC
+Breakthrough infections
+gross contamination
+further examinations
+Illustra MicroSpin S200 HR columns
+30
+via isofluorane inhalation
+closely related
+antigen-presenting cells
+viral replication
+201
+ZIKV E protein
+ANOVA
+supplementary information
+Specificity
+eIF5B
+Global climate change
+Radiological
+Live bird markets
+bottleneck sizes and selection
+significance of individual rates
+size
+meta-analysis
+0.38 M NaCl buffer
+0.5%
+hypothesis-based research projects
+cross-species transmission and emergence of viral pathogens
+HeLa-R19 cells
+95%
+features whose presence was contingent on a particular choice of training or test set
+75 percent
+local background measured next to the membrane sheets
+lysine
+vaccines
+group III
+contact between the vectors and farmers
+Normalized Difference Vegetation Index
+Neural progenitor/stem cells
+days of mechanical ventilation
+to gauge prevalence rates of hospital-acquired multidrug resistant organisms
+four
+GRP78
+Vero E6 cells
+parasite restriction
+24
+RSV
+RV envelope proteins
+2-7 fold
+systemic CMV reactivation
+intracellular anti-mitochondrial autoAbs
+influenza
+13
+Phage display
+15 million
+American Type Culture Collection
+epidemiological observables
+more than 100 %
+45 days
+immunohistochemical
+preferential mixing
+109
+Life Technologies
+Student's t-test
+Policy-oriented operational research
+30 days
+Twenty-five
+18
+Mesogenic and lentogenic
+10%
+Homologous recombination
+retain infectivity
+chimpanzee
+Nosocomial influenza
+indwelling tubes
+1998
+quantitative
+protein and whole cell vaccines
+moderate-severe CAP
+VP1
+forming an interagency group, and joint capacity training
+BCL2 homology domains
+improved
+ERK1/2 and p38 MAPK
+target detection
+translation factors, ribosomal proteins and RNAmodifying enzymes
+while there was low rainfall
+PRRSV infection
+neutrophil numbers
+Creative Commons Attribution License
+baseline patient characteristics and study outcomes
+systematic
+Leishmania donovani
+enhanced chemiluminescence
+central-point parenteral vaccination
+Angiotensin converting enzyme 2
+the ability of 89K to excise from the host chromosome
+local geography and traffic
+RSV
+Targeted exon skipping
+data from three different representative mice
+29
+T
+consistent data collection methods
+doxorubicin
+hospital and calendar day of ICU admission
+BioMax Scientific Imaging Film
+two
+cc-by
+Tpt1
+significant difference in expression level
+4 hours
+60 %
+acceptable internal consistency
+ion trap mass analyzer
+rectal temperature
+20 min
+MARC-145 and CL-2621
+backward elimination
+RSV
+Equal amounts
+RIG-I/MDA5
+Computer-Processed Personal Data Protection Law
+NRT
+15 kg
+thinking
+5 minutes
+conserved regions that do not represent overlapping functional elements
+whether infection turns to acute or persistent progression
+neutrophil infiltration
+cell cycle progression
+differentially expressed
+PIKfyve and PIP 2
+Exonucleolysis
+peptide tryptophan
+changing their behavior
+NO
+increased expression of neutrophil related genes
+pertussis toxin
+flow cytometry
+less than 6 months
+cohabitation
+pH 5.5
+Retro-Q
+Natural products
+lowest
+Four
+Mesothelioma
+10 μmol/liter
+within 24 h of respiratory symptom onset
+93%
+Gln438 and Lys439
+myc-His tag
+DENV-faR
+quality-adjusted life-years
+carrier animals
+immunoblotting
+assumes that the construct can be reduced to a single dimension
+low
+pEYFP-N2
+fucose
+disseminated zoster or varicella
+complementarity bias
+RT-PCR
+reverse fluorescent strategy
+muscle hypoplasia and demyelination
+nephrotixic
+HCV-infected patients with low antibody titers
+decreased
+the total number of occurrences of the superior codon in the gene
+ferrets
+Enterococcoceae and Streptococcaceae
+PDT
+Stress ulcer prophylaxis
+2 weeks
+I7 protease
+Prolonged colonization with P. aeruginosa
+34
+GB14925-2001
+Ifnar1 SA mice
+the viral genome
+The pulmonary endothelium
+H1N1pdm09
+1%
+penton base loops bearing RGD motifs
+media release by health authorities
+insects
+lithotrophic
+His p 862 and Thr p 824
+NOD-like receptors
+0.1N HCl
+sequence-specific, spatial self-complementarity
+Almost half
+Cronbach's a of 0.7
+Guadalajara
+ribosome profiling
+75%
+nasal washes
+microRNA 122
+90%
+trend, seasonal, and remainder or residual
+global environmental change
+reducd hepatic and/or pheripheral clearance of circulating cholesterol
+binding the PjCaspase promoter
+an unzipped hairpin region
+transcriptional repression of collagen expression
+larvicide application
+epitopes having significant median similarity score lower than the non-epitopes
+APCs
+complementary sequences
+E. coli
+6.9kbp
+10 µL of FAs
+10%
+Per a 2 protein
+60 s or more
+The upsurge in interest in AMR
+The peptide's binding mode
+ZIKV-infected cells
+IFN-λ
+NanoDrop 2000 spectrophotometer and SDS/PAGE
+minus-strand synthesis
+hepatic
+CDC
+QIAquick PCR Purification Kit
+A deep nasopharyngeal swab
+VITEK R 2 -Compact automatic bacteria identification device
+all 4 serotypes of DENV
+1%
+QIAquick PCR purification kit
+Uganda
+Rayleigh distribution
+annexin V
+7 y and older
+amplification curves with relatively lower Ct values and obviously stronger fluorescent signals
+partial immunity
+stimulates TLR3 signaling and induces immune activation
+non-glycosylated proteins
+50%
+13.6% and 8.2%
+zinc finger nucleases
+heparin
+15
+less severe symptoms
+3 days
+conflict management skills
+reverse substitution R227S
+last-observation-carried-forward method
+Host genetic polymorphisms
+mock infected samples
+red spheres
+temporal lobe epilepsy and absence epilepsy
+rotavirus
+1977
+pH-independent syncytium formation
+transmission
+alveolar macrophages
+ZIKV infectivity
+19.8 ± 7.1
+oligonucleotide
+no infectious units
+Ganciclovir and cidofovir
+human behavior toward vaccination
+49
+GenBank
+6-days
+29
+A shielding ring with four plastic restraints
+polymicrobial aetiology
+viral tropism
+β-1,4-linked galactose residues
+red
+24
+Six
+Cdh1 phosphorylation-mediated
+Four
+19
+S
+51
+>1 class of drugs may be associated with IMHA in small animals
+770
+reference standards, calibration and more time
+enhanced
+MEGA 4.0
+Modulation of IFN signaling
+HLA-A*0201 molecules
+less than a week
+2,4-dinitrophenol
+potency of CEA-directed lysis
+E3 and 6K
+BLAST
+Phage supernatant
+xcms and CAMERA functions
+an assignment of probability to possible values of multiple quantities
+74
+erythrocyte binding properties
+growth-inhibitory activity
+amphotericin B
+D. melanogaster
+Bentiu PoC Camp
+GBF1
+monocytes and Kupffer cells
+two weeks
+JC Renauld
+90%
+Accidental Status Reports
+macrophage
+extracorporeal membrane oxygenation
+The epidemic curve
+host tropism
+rational prediction systems
+severity of illness
+pathogens
+Orbi-trap™HF-X 27
+a retrovirus
+73.7%
+two
+molecular
+loading control, β-actin
+BCC tissue samples and BCC cell lines
+100 %
+penetratin or Tat 48-60
+Percutaneous
+Comparison of the proportion of patients with any grade 3 or 4 adverse event
+DI water
+252
+liquid N 2
+Lipid accumulation
+castrated male
+ion precursors
+TAMs
+2 g
+one week
+splice variants of CEA
+Network leadership and management processes
+586
+57%
+Ub-7-amido-4-methylcoumarin
+5 to 17 month-old
+1400
+10.1186/s12934-015-0326-1
+TLR2 and TLR4
+correlated mutations
+the binding constant
+20%
+CBS
+TransDetect ® Cell Counting Kit
+Western blot analysis
+RV-C
+Single substitutions
+Niemann-Pick C1 disease
+understanding of complement inhibition and blockade of cellular immunity
+Six
+Using stakeholders to identify and help to prioritize future research directions
+LC3-positive organelles or LC3 puncta
+detection by host pathogen recognition receptors
+nucleozin
+membrane anchor protein
+RNA binding curves
+nonspecific inflammation
+airborne infectious particles
+1,200
+several times
+enteric fever
+Zoonoses
+Michaelis-Menten model
+ethanol
+iron depositions
+different mechanisms of action
+engagement of FcR in the presence of HA
+single gene polymorphism
+Sample collection date and location
+27
+Sequencing noise
+a cell-surface receptor and co-receptors
+type I interferons
+gender, age, mechanical ventilation, PICC insertion, application of hormones
+use of guideline
+mRNA expression
+cc-by
+baseline characteristics
+1997
+interrupting the subunits interactions
+1 hr
+46,427
+Chemi-Capt
+the union
+The manuscript
+30
+735
+5% 2-mercaptoethanol
+Three
+accurate
+response to stimuli
+Electronic proximity devices
+sequence identity
+Mycophenolic acid
+total differentially expressed genes
+MTCP1
+VR-2332 and CH-la
+61%
+mouse models of viral encephalitis
+Error bars
+three
+TCID 50 assay
+TLR9
+33-48%
+Berenil
+parasites
+emphysema
+anti-acetyllysine
+IP culling
+other members
+The need for informed consent
+two
+serial dilutions of the samples
+538-nm
+buffer A195
+Brazil
+halo-gravity
+cancers
+Active site
+10%
+lower ACE-2 activity
+Bacterial coinfection
+52%
+Tomas Kay and Eric Tremblay
+Public Health Emergency of International Concern
+Statistical
+12.5 mg/kg
+HI titers of NDV
+Monoclonal antibody
+15 µg/ ml
+increased
+proteins
+L. interrogans
+bioinformatic
+rWR-PRRSV-M
+2-16 h
+Tyr111 and Arg114
+20%
+kappa
+11/36
+on the surface membranes of erythrocytes red cells
+C 0
+transplacental transmission of virus from mother to fetus or adult transmission
+6%
+timeliness and completeness
+workplace/social contacts
+XLStat
+mRNeasy
+multipotent inflammatory
+very specific changes to nutritional quality
+insulin resistance, dyslipidemia, and hyperglycemia
+8
+LC-3 -related peptides
+monocytes, macrophages and dendritic cells
+respiratory infection
+Dr Agis Tsouros
+membrane transport, carbohydrate metabolism, and amino acid metabolism
+CA-STAT5bER
+caffeine
+endosomal acidification
+sensitivity
+FACS lysing solution
+Viral antigenic drift
+increase in intracellular cAMP
+6%
+a critical binding element
+cysteinyl
+SFVs
+10.1371/journal.pone.0014163
+Ambient temperature
+285
+antiretroviral, immunomodulatory, and antioxidant approaches
+21 days
+3-7 days
+β 1 + β 2 + β 3 + β 4 + β 5
+SNARE-Munc18-1-mediated liposome fusion
+266
+theme, and refinements
+eIF2B
+80640640
+carbohydrate-active enzymes
+branch length
+trpDC mRNA
+heterotrimeric
+antimicrobials-related problems
+Stress granules
+finite system sizes
+Kalman filter
+Plots of several alpha globin genes
+1987
+Sputum cultures
+different responses for different pandemic severities
+.50 mM, 3.88 mM and 6.63 mM
+50
+WBC and erythrocyte sedimentation rate
+Three
+bound DNA
+1986
+OD450
+S. Herzog
+pigs
+chronic hepatitis B infections
+450 nm
+IL-10 high T cells
+Epithelial cells
+microbial taxonomic profiles and host transcriptomic profiles
+tunicamycin
+Modified Eagle Medium
+six
+5-10%
+by exsanguination via the carotid artery
+Streptococcus pneumoniae
+biotinylation and western blot analyses
+increased lipid ROS levels
+the physician is not present in the ICU
+twice daily
+0.22 mm Sterivex
+DB
+fluorescence
+lipoprotein
+Dr. Li Tang
+MBL
+plateau pressure
+16S rRNA gene sequence analysis
+follow-up vaccinations
+Lausanne DNA Array Facility
+arginine
+318 days
+acetylated
+the protection elicited by vaccination
+scalefree
+28
+NCBI gene identifier number AY847351
+Class A virions
+patients with low PCT values did benefit from antibiotics
+an independent investigator
+Techniques to fully recover human antibodies
+HSPG
+inhibits H5N1 viral replication
+insert-free
+Phalloidin-iFluor 555
+8.2 ± 0.6 days
+Controlling the disease within the poultry population
+increased SIV-specific antibody responses
+66%
+all benchmark methods
+capacity
+efficient cell-based screening models
+SEM
+mRNA
+the complex calibrations of acceptable risk compound exponentially
+three
+SH3 and PDZ
+thermodynamic model
+Two weeks
+3
+hightemperature field sites
+1797
+80%
+NS2A protein
+increasing membrane fluidity
+IU/mg
+inflammation, angiogenesis, immunity, and insulin resistance
+2%
+NP and M1
+Enhancing the immune responses to pathogens
+Boreholes
+E. coli and BP
+Human movement
+clinical
+Miro1 expression
+2
+1 µg/ml Actinomycin D
+building a global consensus on laboratory leadership competencies
+exacerbates the effect of allergens
+cytotoxic effects
+informationdriven research
+PCR
+EMBOSS CHIPS
+First-strand cDNA
+Discovery curves
+A rank-based method
+bovine surfactant
+direct quantitation of multiple marker compounds
+mutation of this residue
+Pseudoknots
+rotaviruses
+0.62 to 0.83
+4 Pst I restriction sites
+MTT assay
+Adenovirus 5
+binding and degrading
+half
+type I and II IFN induced transcription of genes
+9.65%
+Corticosteroid administration
+biomaterials
+10%
+centrosome microtubule nucleation ef®ciency
+100%
+manual selection of representative genes
+three
+there are many infection-related sub-classifications
+oligosaccharides
+Nearly three quarters
+Trees
+Fractions containing long Ub chains
+42
+HIV-1 5 0 UTR IRES
+ROC AUC $ 0.920
+host infectivity
+longer sidechain
+non-steroidal anti-inflammatory drugs
+cytokine storm
+TEs or REs
+Phang Nga Province
+390,000
+MFold 3.2 and DINAMELT
+the coming rise in case counts
+biological
+a significant hit
+18
+serial dilutions of MHV68 BAC DNA
+Detailed sample information
+2-Ethyl benzoquinoline carboxylic acid
+FRC
+3
+Red Cell-Tracker
+10-day
+inefficiencies
+2513^21
+semi-quantification analysis
+Mouse Phenome Database
+Ottawa
+trypsin
+photons
+Monk and Buysse
+immunogenic
+shell-less
+mean ± standard error of mean
+aldehyde dehydrogenase
+PMNs and macrophages
+Three
+C-terminal amino acid mutation
+Human respiratory syncytial virus
+An extended GO annotation system
+28
+a high or a low indication of whether or not to start contact tracing
+Ultrafree-MC centrifugal filter units
+flowers
+GTR+G
+ischaemic heart disease and cerebrovascular conditions
+immunomodulatory
+stable Env glycoprotein-dependent virological or infectious synapses
+CRX-526, E5531 and E5564
+self-limiting
+phage display
+1.28+/-0.91
+p67 phox
+SSC versus FL1 dot plot
+prevaccination GMTs
+anhydrous Na 2 SO 4
+western Kazakhstan
+Sterile immunity
+Novel A/H1N1
+bovine RSV-specific antibodies
+infections with A/H3N2 virus alone
+four
+JC-1
+time-dependent reproduction number R
+immunogenicity of oligosaccharides
+3
+isolation rooms and operation rooms
+pneumovirus disease
+10
+Ion displacement
+risk factors
+8
+stoichiometry
+1986
+virus replication
+much closer to the parental strain
+DTX 880 multimode detector
+Trained staff from local CDCs
+antimicrobial resistance
+More than 99%
+serological evidence
+previously published methods
+20
+100%
+b-tubulin
+2.361.4%
+quercetin
+spleen
+dextran sulfate
+human
+four
+Tel Aviv Sourasky Medical Center
+loss of infectivity
+ERK activation
+48 hours
+RNeasy 96 well kit
+the infectivity
+between the pairs of NT 50 and % IgG bound
+Duration and frequency of contacts
+7
+HA1
+59.7%
+modification, palatability, and storage life of all available sources of proteins
+Tracheal supernatants
+10-2 to 10-4 substitutions/ site/year
+plasma
+reporter RNAs containing the mutant DPKI IRES
+higher incidences of underlying diseases and impaired immune functions
+Immunoreactivity
+West Nile virus and Japanese encephalitis virus
+NDM-HK PCV
+CPCV
+HDAC5 exon 3 and exon 4
+two
+molecular mechanisms of TCs
+Neutralizing antibodies
+Hazard identification
+foveal granularity
+10
+other arteriviruses
+HWE
+Hypercytokinemia
+102
+Coomassie brilliant blue R-250
+five
+area under concentration-time curve
+improve the biochemical behaviors of proteins it is fused to
+FPV and dermatophytosis
+six
+Each value
+Reads that mapped to the Bacteria database
+an infeasibly tight level of quarantine
+HCV NS5B
+soluble oligomers that form micelle-like structures
+23.05%
+PCR
+antibody recognition of the protein surface
+15%
+June 11, 2009
+German influenza sentinel surveillance system
+5′-AT 3 CAT 3
+646
+four
+Xenopus
+the activity of Th1/Th17 responses
+simple personal protective measures
+amyloid phagocytes
+IL11R
+10-min
+12%
+the kosher phenotype
+15 min
+both infected others and been infected themselves
+Murdoch University Human Research Ethics Committee
+Detected clusters
+inhibition of toxin expression
+17
+Amber10 Generalized Amber Force Field library
+TLR2, TLR4 and MyD88
+accurate and timely diagnosis of ASF infections
+B and D
+I 2 test
+Three months
+affected side
+cAMP/PKA signaling
+sepsis
+Atmospheric PM 10 and PM 2.5
+productive, lytic replication and non-productive, latent infection
+19 KDa lipoprotein and lipoarabinomannan
+618
+MAPK signaling
+Gaussian
+intracellular
+0
+participate in the uptake for degradation
+Chemical or Molecular descriptors
+inhalation anaesthetic
+between 21 and 25 million
+IMG/VR
+30 mins
+infection of HEp2 cells
+scenario C
+acute myocardial infarction
+to promote virus egress
+αβ T cells
+Wulf Droge
+280uC
+Aligning all the remaining sequences at once using MUSCLE
+RAFT
+Exponential phase bacteria
+70%
+aveloz
+10 of 1000
+33.1%
+20%
+avian influenza-related keywords
+Melioidosis
+Complement component 1q
+Fisher & Paykel Healthcare
+ire-1-xbp-1
+causes the accumulation of unfolded proteins in the ER
+HBV and/or HDV infection
+strain virulence
+genetic diversity
+to account for possible tagged primer biases and cross-contamination
+indoleamine 2,3-dioxygenase 1
+colorectal cancer
+fomite transmission
+Tidal recruitment
+Klebsiella oxytoca 1
+two structured round table consultations
+fucosylation
+MitoCapture Mitochondrial Apoptosis Detection Fluorometric kit
+host plants
+Three hundred and eighty-four
+0.1 M NaOH
+genome position
+40%
+malaria diagnosis
+ML
+stability
+δ
+Acanthamoeba
+overexpression
+50 μ L elution buffer
+β-actin
+existing or previous education and training
+intensity of infection
+Fatigue and faintness
+TNF-a
+susceptibility to infectious diseases
+low efficiency
+March 17, 2020
+Diagnostics
+seven
+special or expensive instruments
+less viral shedding
+29%
+enzymatic activity resembling tRNA ligases
+Thirty
+contextual information coupled with sequence similarity searches
+mtLSUrRNA
+CAST and PWK
+bone
+appropriate weights
+our two-dimensional cell culture monolayer
+prophylactic or therapeutic agents
+SAA1A −97delG allele
+11%
+MPO
+Chronic HBV infection
+The European Region
+Thirty-eight
+transiently transfected Hek293 cells
+purinergic
+twelve
+cytopathic effect
+481
+4 days
+Nine
+IL-4
+cell growth, proliferation, differentiation, and apoptosis
+plasma cells
+persistence
+decreased species diversity
+1%
+SkV-L-A1
+no biases
+Coefficients
+suboptimal
+13
+three
+25
+65.55 % of the total variation
+precision
+rural areas
+Caliper LifeSciences
+dox-treated / untreated ratios
+deionized water
+reduced antibiotic susceptibility
+lung and spleen
+faster degradation of the 5S rRNA transcript by the exosome
+Recoding
+6A 2 -1A 0
+Nanobodies
+gradient
+homogeneous mixing
+allows the user direct access to the KIH interactions
+matrix protein
+the names of the three nearest neighbours
+Metabolism of IFITM3 isoforms
+HeLa cells
+Virus diversity
+10
+FLuc ORF
+synthetic attenuated virus engineering
+SG and PB dynamics
+60%
+five
+phospholipase A2 motifs
+HEK-293T cells
+Fold change in expression
+S eq
+limited access to healthcare
+Cronbach's alpha coefficients
+Propofol
+preparation studies
+cytopathic
+rapid virus clearance from the respiratory tract
+Cyclovirus
+three independent experiments
+Section B5
+nuclear proteins
+M2e-specific serum IgG response
+oral fluid
+similar
+calcium-dependent
+circular plasmid DNA molecules that encode the vaccinating antigens
+lesions
+toxicity
+MHV-3 infection
+different residue positions
+Zinc supplementation
+IgA Á/ICs
+the size of the library was very small
+foreign proteins
+Urethane
+three
+algorithms
+Proline
+Prodromal, asymptomatic and afebrile infections
+Dengue
+33 years
+SSMD
+ventilatory
+68
+20%
+resolvins, protectins and maresins
+inhibitory
+Zoetis
+close to 20
+30,000
+one part in 10 5
+GAPDH and PP2A
+inter-sectoral networks
+influenza infection history
+α S,i and α V,i
+prevention of RSV infections in neonates and children
+Purified ATII cells
+Macrophages and neutrophils
+several hundred
+HSV-1
+PS 3 and 4
+cohort differences
+four
+regulates the sensitivity of the small intestine to radiation injury
+intermediate quality simulated draft
+HT29 cells
+clinical and technical development
+serum protein, albumin, and glucose levels
+template-based designing
+Three
+dominant and over-dominant model
+27%
+307
+robust exon 45 skipping
+Human cytomegalovirus
+Abcam
+Hematological, liver and renal function
+22-45%
+1997
+antiviral state
+virus receptor types
+Vimentin
+Four
+Agroinfiltration
+March 15, 2020
+1986
+norepinephrine
+URI
+1,485
+the percentage of inhibition
+70%
+19
+host cell helicases
+six
+suppressed
+coagulation tests
+cc-by
+400 μL
+a chart
+Yellow, Orange or Red
+ten
+intracellular tau aggregation
+12
+GGC
+automated quantification of immunofluorescence images
+5.5%
+Simplified Acute Physiologic Score II
+ΔG 1
+5 -CUGCAG-3
+48 hpi
+FXYD proteins
+oral and nasal mucosa
+36%
+Five
+CHIKV
+Ferroptotic
+95%
+8-weeks
+PfRh5
+DNA vaccine delivery method
+Macrophages and dendritic cells
+Sequences of E and E1 types
+Polyethylenimine
+PCR and sequencing analysis
+36
+NiV F or G
+1
+same ligand
+Modeling and simulation
+Giemsa
+SFCs
+50ng of RNA
+reliable proteome analyses for other cellular systems
+local network information
+Johns Hopkins institutional review board
+myelin sheath thickness
+Ralf Bartenschlager
+15.7%
+Vector Laboratories
+myricetin and rutin
+Image J
+15 per cent
+replication
+Liver
+suicide
+three
+clinicians
+peripheral blood mononuclear cells
+natural killer cells
+RT-qPCR analysis
+Albumin
+2,673,768 kb
+over $100,000
+Mersana
+strong assumptions of conditional independence between variables and the need of choosing prior distributions
+one
+2-5 days
+GTPase Atlastin
+HGF
+a group of molecules that recognize the molecular patterns of DAMPs
+Absence of microglia
+Resilience
+gender equality issues
+programmed À1 frameshifting
+intoxicate the host cell
+70%
+diluted cDNA
+Unconjugated Stat3 siRNA
+APOA2
+an appropriate animal model
+liver biopsy
+Glc 3 Man 9 GlcNac 2
+t-distributed stochastic neighbour embedding
+1:1000
+alcoholic liver disease, hepatitis B-induced fibrosis or HCC
+planar
+roughly the same
+Sanger sequencing of both 5 and 3 ends
+Storage samples of peripheral blood mononuclear cells and serum
+six
+Creative Commons Attribution License
+immunofluorescent
+1.35%
+25%
+residues 517-525
+an alternative approach that exclusively involved local personnel
+67%
+Withdrawal of care
+threshold
+early assessment of the relative contributions of local transmission versus case importation
+target-decoy strategy
+Heparanase
+co-morbidity
+Protonation state of H59
+indoors
+colistin ARB
+polymyxin B
+August
+sepsis
+Dr. Deckmyn
+Within-sample diversity
+488
+mycoplasmas and infectious bronchitis virus
+S ijk
+focus
+slightly reduced performance
+TRIzol1 Reagent
+2 mg of RNA
+YALL GPC
+icosahedral
+72 hours
+contusion and compression simultaneously both dorsally and ventrally
+70 %
+244
+supernatants
+Attenuation mechanism
+multinational corporation
+Hoppenheim Fund
+56.4 %
+complex
+5
+Sputum neutrophils
+single-specialty
+Tetherin
+protected mice against lethal influenza virus challenges
+urine, pleural and lumbar cultures
+p53
+the spring wave
+␣2,3-linked terminal SA
+electronic screening
+plasmid copy number
+MAVS
+influenza infection
+t½S/I
+viral titers
+800 seconds
+Amino Allyl MessageAmp II aRNA Amplification Kit
+proinflammatory
+disease spread
+estimation accuracy
+a vision, a plan and a set of strategies
+Town Cats and Palo Alto Humane Society
+simultaneous nearest neighbors
+cytosolic viral RNA sensors
+2-8 mg per mL
+occupational health physician
+Ebola survivors and EVD family members
+CD8 T cells
+Three weeks
+i21
+0.66
+seven
+to prevent cellular Trp production
+18
+35
+A single non-targeting siRNA
+Generalized Born/Surface Area implicit solvent model
+higher dynamic driving pressure
+simulations of the current outbreak
+nineteen
+214
+454
+tomato plant
+99 %
+152 mg testosterone
+leaving the cohort aspect ongoing
+High copy number amplifications in bacterial hosts
+Cri du Chat syndrome
+a reservoir of microorganisms
+spontaneous preterm delivery and early cesarean sections for deteriorating medical condition
+Boix
+assay
+Written informed consent
+acute and chronic GVHD
+2009
+Schematic
+mild, moderate or severe
+9.1%
+the size of each module
+further GBM tumor characterization
+12 hours
+Alveolar epithelial cells
+real time epidemic control
+Bland-Altman plot
+CD8 ϩ T cells
+55
+ZIKV-infected lumbosacral spinal motor neurons
+2fold
+K. pneumoniae isolates
+CCR5
+800
+BALF from ARDS patients
+À7.0 kcal/mol
+Merck Millipore
+P2
+100 million
+age group and HIV status
+the interplay between virus and host
+α
+v
+75
+Renal replacement therapy
+six
+biphasic
+nitrite levels in blood
+RNA replication
+twice per day
+insufficient DLCO
+21
+transmission divergence
+gut associated lymphatic tissue
+r A m
+four
+570,563
+2.0 kb
+four
+Over 70%
+interstitial motility
+goblet cells
+GST-NS1
+Three
+American robins
+97%
+Comparison of the protection patterns between wild-type and mutant ribosomes
+to report the amount of RCA product fluorescently
+ONX-0914
+modifications at the YxxxK motif
+2%
+413 flocks
+RNAHybrid
+alternative approaches
+a general set of mechanisms by which acetylation can regulate protein activity
+MIP-1β
+Vaccination
+proper Gag maturation
+pathological changes observed in liver
+10.3390/v10040211
+eight
+Subcellular Protein Fractionation Kit for Cultured Cells
+Aciclovir
+t R
+five
+80-90%
+PIWIL1, Ascorbic Acid and MTOR
+host mRNA synthesis machinery
+less than 50%
+specific investigations
+door-to-door notifications, text messages, and telephone notifications
+49%
+phosphorylation of this domain at Y88
+Behavioural changes
+5700 to 13000
+GAPDH mRNA
+heme-oxygenases
+B. mayotimonensis
+MS, MC, and AG
+EBOV GP
+Bio-Plex Pro™ Mouse Cytokine 23-plex Assay
+2.1 and 5.1 mg Kg −1
+throughput
+2.35-fold-higher
+Motif C
+energy expenditure
+coaxial stacking and parallel stem interactions
+crisis clients' permission
+biospecimens
+glucose substitution
+315 nm
+10 dpi
+binary images
+GLA-SE
+parental consent
+General Purification Procedure
+T min
+BioProjects
+the degree of a node
+40 min
+data submitted directly to GenBank
+outbreak development in West Africa
+NF-kB-dependent
+IgG PN-SIA49
+luminescent
+Serum immunoglobulins G fraction
+T cells
+clathrin-dependent endocytosis
+genotoxic
+internationally recognized human rights
+deep brown
+blood agar plates
+pH
+the region from −230 nt to 699 nt
+EU-RMP
+120 mcg
+grid
+41.1 new cases/100,000 inhabitants/year
+Twenty-seven
+172
+chromatin looping
+Ms Martin-Granel
+A3082-01
+lower levels of clustering
+Extravascular lung water content
+30%
+immune system disorders
+mannose binding lectin
+tBLASTx algorithm
+deadenylation
+6.6 ± 0.6 dpi
+Virus stocks
+different subtypes profile
+Escherichia vulneris
+Illumina short reads
+Apical ENaC
+25-30%
+1.0 × 10 1 copies/reaction
+θ H and θ F
+hypertension, asthma, or chronic obstructive pulmonary disease
+H1 and H3 subtypes
+the knob residue
+the algorithm
+The spatial correlogram
+WSN WT
+to avoid negative hemodynamic effects
+Immunoperoxidase staining
+SIINFEKL Ova-peptide
+FFA
+3%
+9,400
+eCLIP
+reference protein-protein interaction network
+HBsAg VLPs
+severe septic shock
+10 mL
+neuroinflammation
+Royal Society
+68 weeks
+single immunization
+alanine transaminase
+490
+individual clones
+Qiagen RNeasy Mini Kit
+genome wide mapping association studies
+two
+clustering and scatter/group plot analyses
+colony forming units
+being moral and behaving morally
+biological sequences
+age, sex and species
+chemical antibodies
+zoonotic
+6.1%
+biological olfactory system
+3,3-diaminobenzidine
+enzyme immunoassay
+2005
+7
+compartmental models
+Sera
+Three
+Quantity One
+ubiquitinated
+ten
+59%
+CXCL12
+90 to 120 min
+SWOT
+48.7%
+propagation patterns
+membrane tropism and solubility
+positive end expiratory pressure
+positive
+obsolete
+60%
+M. tuberculosis
+SPSS version 23
+R&D systems
+optimizing the MCC
+up to three
+Signal transduction
+Local and global outbreak dynamics models
+RNase A
+macrophage TNF production
+cell-mediated immune responses
+RT-PCR
+SD
+RT-PCR
+10
+cytosolic receptor PGRP-LE
+significant decrease of anti-HIV-1 activity
+viral
+asthma, pulmonary fibrosis, and chronic bronchitis
+seven
+D
+influenza vaccines
+> 60 ml/min
+TLR4
+Exposure to index case-patients
+PRISM 5.0
+multiorgan and multisystem
+60% to 70%
+a meaningful reduction in global mortality
+The percentage of cells infected with Dengue
+2014
+NF-κB
+more references
+disease severity
+208
+multiple mechanisms
+virus replication
+Hsp70
+microglial responses to local signals
+2014-08-07
+hypochlorous acid
+Endoglycosidases F1, F2, and F3
+Quercetin and kaempherol
+microbiological and epidemiological data
+GeneSpring software and GeneSpring default normalization
+1 day
+gain-in-function
+no cytotoxicity
+Pearson's χ test
+Interpretive memoranda
+three
+12-18%
+New Cooperative Medical Scheme
+10
+MS-based proteomics
+Cys783-His869
+aggregation of the F protein-bound BLPs
+cholesterol and sphingolipids
+plasma concentrations
+durable DENV2 neutralizing antibodies
+plasma glucagon levels
+various genes
+a natural barrier for metal ions
+nucleocapsid protein
+Four
+3.3160.33 cm
+10%
+R A 0 and R B 0
+HBV Pol
+-1 PRF
+KEM1 deletion
+malaria
+surface plasmon resonance experiment
+D AS and R SA
+Plasmodium falciparum
+Poly I : C
+environmental
+13
+alterations
+IC2
+outcome evaluation
+12S particles
+The monitors
+CD4 + or CD8 + T cells
+48 hours
+specific gene signatures
+60 to 400
+facilitates Dicer degradation
+local information about accessibility to health care
+intermediates
+Osterhaus
+HTS settings
+dissociation temperature
+a presumed infectious source
+World Health Organization
+60-69 g/l
+10
+Gal4-based Y2H
+reemerge from viral obscurity to spread pandemically
+changes in viral gene expression
+CD3+ and CD20+
+30-day spaceflight
+health and disease
+small mammals, marsupials, and birds
+flow head
+Size exclusion chromatography
+influenza replication
+exon 7 of the STAMBP gene
+Unaided cellular uptake of PMO
+ARDS
+recombinant RNAs
+PBC
+DCs
+neurological outcomes
+the neck region
+56%
+16s and COI
+Person-to-person
+spectrophotometrically
+CSFV
+collagen and elastin fibers
+multi-organism membrane fusion
+five
+over 10,000
+endosomal compartments
+human diseases and plant pathology
+visual inspection
+3.3 ± 1.3 months
+Forty-nine
+shortcomings of the methods or technology involved with screening
+E1
+anti-cancer effect
+ABC
+80%
+35 mL
+Time series comparison
+live poultry
+novel gene targets
+Pro-Ser-Pro
+Wild-type and Bcl-2 transgenic FVB mice
+MMDS
+genomic tiling array and exon-exon junction array
+caspase-11-dependent
+Infectious virus
+10 min
+q k i k
+Confocal
+Bar graph
+low infectivity
+cDNAs from healthy NPR and PR controls
+BVDV infection
+over-dispersion
+syn
+log-rank test
+<0.1%
+36
+stronger inflammatory responses
+65
+SM934
+genome-integrated sequences of viral origin
+systemic administration of 3-PPMO
+238
+herpes simplex
+restoration of effective immune status
+death
+15
+MAP p = 0.034
+events that are highly localized in time and space
+2 6
+live model viruses
+1 hour
+Monika Slominska-Wojewodzka
+5'
+50%
+advantageous and potentially detrimental
+2 µg/mL
+genomes
+Vietnam
+antigenomes
+Cellular mitogen Phytohaemagglutinin stimulation
+Antibacterial activity
+R 0
+type 2a
+innate and adaptive immunity
+WDR5
+unclear
+filamentous
+25
+seasonal phylogenetic clusters
+low methodological quality and selective publication of positive results
+Lower respiratory tract infections
+cytopathic effect
+Psychological support
+LAL evaluation
+Data
+7
+98%
+detergent separation
+databases of small molecules
+P,0.03
+liver biopsies
+trypsin treatment
+RGNNV
+25.0 mL
+changes in M
+a wide variety of matrices
+acts in repression at the rDNA promoter level
+0.26
+immune responses
+logistic model
+crypts
+joint pain
+10 or 100 IU/ml IFN-α
+15 min
+acute lung edema
+72 h
+one year
+major and minor
+OptiMEM
+SLU
+24
+immune cells
+3.7-to 5.2-fold
+Livestock production
+EBC
+symmetric cell division
+P3
+L. iners
+GraphPad Prism v. 6.04 graphing software
+5.5%
+VRE contamination
+Bats
+contigs
+a definitive pathogen
+cc-by
+purification of nucleic acid analytes from clinical specimens
+MA Ab test
+control measures
+Apoptosis
+SHH
+10 to 20%
+increases morbidity and mortality
+Interrater agreement
+priming of viral mRNA synthesis
+evolutionarily diverse organisms
+influenza virus activation
+limited safety information
+1 h
+C. albicans CFU
+elderly and immunocompromised patients
+sepherdin
+33
+199
+98%
+400-to 520-nm
+Sf9 cells
+urbanisation and largescale crowding
+Malaria, Typhoid, Traveler's diarrhea, Yellow fever
+eIF4G-PABP interaction
+Splenocytes
+EAE
+three
+1918
+1%
+poly polymerase 1
+black
+Bioinformatic tools
+mice
+GPs
+chicken anemia virus
+hydrophobic
+indigenous or imported
+adulthood
+Chest radiography
+seven
+results
+The PI or delegated local investigator
+Göttingen, Germany
+lower reporting rates and higher quantiles
+18
+robust memory CD4 T cell responses
+vital for their survival
+SPDEF
+phosphor-Cdc2
+abnormal increase of white blood cells
+viral nucleic acid
+Restricted maximum likelihood estimation
+Apoptosis
+two hours
+good leadership involves attention to the ethical aspects of priority setting
+controlling this variability
+r q,i
+37uC
+chronic rheumatism
+8 days
+four
+Kenya
+0.02 M EDTA
+CLS scores
+80 ± 9%
+poor factorial validity
+stochastic
+The controls
+increased reactivity in multiple proteins
+10~12 weeks
+Institutional Animal Care and Use Committee
+Olympus BX-51
+testkits
+inspiratory
+inhibits the replication of different families of DNA viruses
+mouse monoclonal antibody isotyping kit
+Waldeyer's tonsillar ring
+1 mM
+dashes
+VP1
+woodchuck model
+1.73
+exostosins
+mouse lung macrophages and dendritic cells
+Genes upregulated by EBV compared with resting B cells
+Ub-AMC
+Recombination
+conservation and information content
+glutinoic acid dilactone
+millions
+Total RNA
+TORC1
+2,500
+glycerol
+71,865
+Confocal
+4 mg/ ml OVA
+16
+csv
+hematoxylin and eosin
+RC i
+Mg 2+
+Cyclosporin A
+regions within countries
+The Ross-MacDonald model
+circRNAs with internal ribosome entry sites
+Normalizing by the mean of the row
+intradermal, subcutaneous, and intranasal injection
+Sugammadex
+50~100 mg ml −1
+STE12-bound promoters
+pIFN-γ cDNA
+Charcoal-burning poisoning
+three
+over $20 M
+non-regenerative anemia
+Panels A and B of figure 8
+Mouse Mesenchymal Stem Cell Functional Identification Kit
+contacts
+anti-mite and antimicrobial treatments
+RV
+a limiting amount of polymerase subunits
+trans-well assay
+embryonated chicken eggs
+subclinical persistent in utero infection
+ExiPrep Viral RNA Kit
+self-reported symptoms
+A 4ϫ objective
+to describe and calculate the cost of an already implemented behavior change communication intervention
+Mac2 positive cells
+cGAMP and IFI16
+9
+Lung sections
+12
+oligonucleotide names
+hyperoxia and endotoxemia
+120 h incubation
+volume constraints
+overexpression of EGR1
+systemic delivery to the central nervous system
+cytoplasmic RNA-and DNA-sensing receptors
+3.7%
+Cytolysis
+baicalin and wogonin
+nickel-chelated
+brucellosis
+H5N1 replication
+host cell biology
+two
+Blomberg's K-values
+four
+Eight
+zero
+nuclear localization sequences
+Laziosanità
+Gapminder
+cytopathic effects
+symptomatic cases suspected of having EV-A71 infection
+nuclei
+cell survival, death and metabolism
+ELISPOTassay
+further research
+greater endorsement of a range of real-world conspiracy theories
+Duke University Medical Center
+countries with low CL
+10-20%
+cysteine dyad residue
+plaque reduction inhibition assay
+lymphocytes and fibroblasts
+intuitiveness
+deep evolutionary history
+10 2 CFU/mL
+300 mm
+20 h
+Increasing the number of communities
+The AUC
+nucleophilic water
+the probability of each state
+single position mutations
+vRNA replication of DENV2
+MS/ MS fragmentation
+3 days
+transcription initiation complex
+decreased HIV-1 receptor expression and stabilization of the Th1 profile
+Nikon SMZ1500 microscope
+983 bp products
+master-slave regulatory units
+TranswellH chambers
+oxidative damage
+Influenza A
+training schools
+4 weeks
+identifi cation of the precipitating factor and their prompt treatment
+LQTS
+Secondary and tertiary base pairs
+2 hours
+an appropriate in-frame initiation codon
+2
+control group that was treated using only a roaster machine
+λ max
+Ae. albopitcus
+structure-based
+climate change-related impacts
+The Database for Annotation, Visualization and Integrated Discovery version 6.8
+Recursive PCR
+primer mismatches
+RNA silencing
+a day-by-day tick box framework
+~15%
+p-STAT5
+GL7
+Anti-b-actin
+4421
+residential buildings
+associate the resistance genes conclusively with their respective organism
+IL-12p40
+c-secretase
+Vpu initiation codon
+tryptophan
+the successful isolation of the desired antibodies
+an internal control
+promoter recognition and integrate responsiveness to the external stimulus tetracycline
+ALK
+GraphPad Prism
+Dysbiosis
+1 dpi and 6 dpi
+RNase T1 refolding
+conformational
+amplicons
+4 hours
+increased severity of colitis
+Antibody avidity
+building trust or developing transparent legal agreements
+5-ethynyl uridine
+Global health studies
+metabolic
+Six
+rationales
+3D
+Arenavirus GPs
+baseline and emergent resistance variants
+pulmonary pathology
+IL-1β and IL-6
+DURC
+DNeasy blood and tissue kit
+TNA
+Weybridge, UK
+Beclin-1
+The introduction
+nonsevere aplastic anemia
+discharge diagnostic codes
+26%
+describing and representing models common to a repository
+94%
+eight
+50 pfu/mL
+tumors
+CD4 + T cells
+Csf2
+average life span
+PRAMS
+Labrador Retriever
+Three
+induced antibody titer
+HIV-1 p24 CA Antigen Capture Assay Kit
+viral RNA
+prior genetic knowledge
+122.8%
+Healthcare workers
+higher
+unknowns
+oxygenation parameter
+MEK/Erk
+PEIs
+2-3 fold
+20%
+simulations with no demographic turnover and low migration rates
+Leveraging existing resources while reinforcing networks and maintaining relationships
+an up-to-date guideline
+contagious adults
+0.5%
+7.9%
+maintenance of function
+Mitochondrial morphology and virion
+pig density; climate; and land cover
+25%
+virulent
+characteristics of natural pathogens
+Signal amplification
+p65-EGFP fusion expression plasmid
+protein composition analysis
+mouse ISG15-PA
+disease surveillance reports
+11 months
+CC001
+organ-specific autoimmune disease
+structured crowding
+65 of 67
+two
+S306, K307, T330 or T332
+Illumina TruSeq
+Tissues
+cleaves
+High Pure PCR Purification Kit
+1.1 to 1.5 bits
+>3,000
+OP differentiation into mature oligodendrocytes
+Antigen-expression
+Advanced respiratory monitoring
+mild ulcer and minimum inflammation
+VQ29 would not remain significant
+potential risk
+DNA sequencing
+25 days
+Meier Kaplan
+~19%
+22
+Varian Cary Eclipse
+PCR inhibitors
+general linear models
+122.2
+bmercaptoethanol
+USP18-deficient mouse embryonic fibroblasts
+one
+Antigenic reactivity
+post-transcriptional
+EDTA
+global trade and travel
+estimated sample size requirements
+increased
+enemy release
+75 amino acids
+shielding of the free Cys163 in the N domain
+southeastern China
+RSV
+immunohistochemical
+U0126 or NH 4 Cl
+stringently controlled
+10 days
+B cell
+Extremes of age
+dramatically decreased
+to compare resource capacities across geographic areas and resource types
+The eel virus European X
+three
+10%
+ADAR
+151
+h, k and l
+1 January 1997 to 30 November, 2016
+2%
+bi-ventricular pacemaker
+1.5-2 h
+two
+90%
+sZ0.821
+handles
+homomeric channels
+data output
+The RdRp domain
+tDC accumulation
+biphasic
+28%
+neutralize vacuolation induction
+z
+detecting microorganisms in human clinical samples and infectious viruses in numerous animal species
+N-linked glycan sites
+Table 2
+by bearing either fruits or flowers
+intravenous administration of zanamivir
+sperm
+9,300 km
+oedema, tissue injury and inflammation
+2-to 7-fold
+42.5%
+physiological and pathological
+MiniBEST Universal RNA Extraction Kit
+confidentiality of the donor's identity
+attenuates LPS-induced endothelial barrier dysfunction in vivo
+combining molecular genetic and epidemiological data
+four
+Gaussian
+72 h
+deteriorated
+3-5 days
+Beijing, Tibet, Shanghai, Tianjin, and Hainan
+leukocytes and mast cells
+South Korea
+The first tier
+Different procedures
+reduced hyperoxiainduced DNA damage
+1:1,213
+Ubiquitination
+5%
+Disulfide bonds
+Forty
+community structures and host and vector movement
+the emergence of new epidemic strains
+high mannose N-glycans
+Thai Ministry of Public Health
+Group B
+Optimization
+sadness, fear, surprise and happiness
+those traveling for leisure or those visiting friends and relatives
+2M H 2 SO 4
+Total V T
+8 weeks
+absence of negatively charged E271
+40%
+resazurin
+hospitalacquired
+cells
+age
+1 mg/ml
+Ungulates, carnivores, and rodents
+isolation specificity filter
+Positron emission tomography
+20
+eighteen
+High-energy collision activated dissociation -MS/MS
+Clinical manifestations of hepatomegaly
+70%
+Polymorphisms with the lowest P values
+excess serotonergic agonism
+several functional regions
+RevertAid First Strand cDNA Synthesis Kit
+their role and relevant laws and regulations
+eIF5B
+human-wildlife contact
+Dualluciferase assay system
+DAMPs
+migration fractions
+14
+measures of hypothesised variables thought to influence behaviour
+geographic boundaries
+a spring
+Ang-II-converting activity
+GraphPad Prism
+experimentally determined
+F GEV
+Dr. Siba Samal
+ZBDM-1
+dyspnea
+cytosine arabinoside
+B16 melanoma
+RT and p24
+phylogenetically
+epithelial cells
+pEF-GFP vector group
+codon substitution
+rabbit anti-HBV core antigen polyclonal antibody
+Fluorescent
+Zymosan
+Ang formation from Ang II
+surveillance
+mild
+a population health approach
+activation and suppression of host immune response
+1:200
+confidentiality
+aggregation of the intrinsically disordered protein, tau
+phylogenetic
+viral transmission and replication
+fluorescent marker and the ATP assay
+MDCK cells
+fever
+Canine calicivirus
+colinearity
+co-pathogenesis hypothesis
+Precise comparison of viral population composition
+environmental microbes
+Average percent transmittance
+10 2 copies
+500 mmHg
+Ub recognition and catalysis
+miRNA profiling
+38 years
+TCID50 assay
+three
+vaccines and therapeutic agents
+mouse-models
+ninety-two
+Duplicate reports
+15.2 kb
+DCs
+independent
+5572
+no shedding
+2.1%
+Mild exposure
+6 months
+Heilongjiang-SYXK-2006-032
+Tat peptide
+necrotic cells
+450
+Three
+very limited change in speed
+HaCaT cells
+almost two decades
+Modification indices
+Evolutionary models that incorporate protein structural domains
+antiviral CD8 T cell responses
+data for a specific sister clade comparison
+The presence of a foreign material
+CD4, and class I and II MHC molecules
+extremely violent offenders
+1.51 minutes
+ricin intoxication
+491
+10
+the maximum case number over a single phase of outbreak
+1.6 cmH 2 O
+cleavage of their interchain disulfide bond
+IL-18 and IL-1β
+enhanced SG formation
+clinal and seasonal
+224
+Stockholm, Sweden
+Mutagenesis by overlap extension PCR
+Processing Bodies
+MP-12 and NSs
+histidine moieties
+Table S2
+over 300
+serum samples
+cc-by
+4.3 ± 0.2 m
+ACE2
+PACSCAN
+rs12979860 5
+Baltimore Group VI and VII
+limited availability of antiviral agents
+genus Nairovirus
+10
+differences in gene transcription, genome replication and/or viral protein synthesis
+infection with prokaryotic pathogens
+Geneart
+1984
+30-50%
+cytokine profiles
+Pithovirus sibericum
+Developers B and D
+Ammonium sulfate
+seven
+severe capillary leakage syndrome
+Supernatants
+controls
+reduced FRC
+conserved
+guinea pigs
+High-dose systemic corticosteroids
+iGPCR-Drug
+Four hundred
+PCR and Sanger sequencing
+target selection
+remain at risk
+Urine peptide diagnostic and prognostic biomarkers
+by allocation of an estimated % surface involved
+infection
+gentamicin
+clumps of cellular debris
+Endocytic uptake of CPPs and their cargo
+TSEN54
+Agencourt AMPure XP beads
+minigenome replication
+PCNA and pUL44
+jl S
+outside the room
+all over the tumor sections
+two
+117
+seven
+71%
+Mixed effect models
+The extent of RNA degradation
+95% confidence intervals for bias
+bedside examination
+variance of dinucleotide frequencies
+the SN
+male immunity
+tuberculosis and meningococcal disease
+IL10 2592
+selection bias
+March 11, 2020
+fusion-defective
+STAT3-mediated
+46
+brown
+MPP software
+meropenem
+serum allergenspecific IgE antibodies
+4 to 5
+tumorderived connective tissue growth factors and SDF-1
+rapid protection against HPAI virus infection
+experimental models
+hit-and-run therapeutic application
+infection of about half a log
+blood capillaries
+adenosine-uridine -rich element RNA binding factor 1
+CPS misprocessing
+Free State Province
+L3 Thr 94 germline residue
+1889
+cell death
+M2
+Axl and TIM-1
+E protein-membrane interaction
+0.40
+MR volume
+pandemic-H1N1-09 influenza infection
+acute respiratory distress syndrome
+pyridylimidazopyridine derivatives
+de novo short RNA primers
+60 L/min
+increased inflammation and mortality
+Cα-Cβ-side chain model
+antigen-specific
+GraphPad Prism
+four
+seventh inpatient building
+AdoHcy hydrolase
+the Berlin definition
+3,3-diaminobenzidine
+N-glycosylation
+Tucson and New York
+Every row value count from the matrix G
+circRNAs synthesis
+1.49 mg/dl
+mean ± standard deviation
+specificity of these pathways to nonviral exacerbations
+NP1
+Chi-square or Fisher's exact test
+Hsp72
+Glycyrrhizin
+Nineteen
+trans-Golgi
+factors
+five
+mice
+3.6 • C
+BASV
+Seven days
+non-parametric testing
+Variant frequencies
+sub-Saharan Africa
+10%
+T ype I and III
+inconsistent results
+Exacerbations
+Ac-DEVD-AMC
+Illumina
+IL-6
+a single chromosome
+direct DNA binding of LRF
+monkeys
+clinical
+ordinal scoring
+48h
+less than 10 %
+risk of infection
+disease signal overlap
+neglecting infections with mal-adapted strains
+Neural precursor cells
+OTR and TS
+5.64
+Nup98
+apoptosis
+812.25 mg/m 2
+PF573228
+SEOV
+type-I and II
+citation exporter
+safety and others equity
+Twenty-one
+cell type-dependent
+89.6 Env
+made a mistake
+99%
+PEG8000
+5% to 8%
+Desmosterol
+blood pressure, cortisol, cholesterol, and cytokines
+chest
+0 and 1
+excellent linear agreement
+extensive sequence diversity among viruses in the same family
+FIGURE 1
+splicing
+intraperitoneal inoculation
+None
+a
+isometric polyhedral
+separately
+type 1
+X-ray diffraction data
+Quantitative real-time PCR
+High throughput screening
+antiviral activity
+when treated with methotrexate
+poor immune responses
+ambisense
+CARD-9
+39,756
+tumor-confining
+Angiotensin II
+Local Ethical Committee
+MUSCLE
+mixing patterns
+a minority
+75%
+export blockage
+95%
+Expression of the human CEACAM1 transgene
+All authors
+DVGs
+shorter turnovers
+1000 bp
+Metal toxicity
+TGEV
+2 fold
+interact with FKBP11 in the osteoblast cells
+bacteremia and urinary tract infections
+50%
+University of Pennsylvania School of Veterinary Medicine
+polyclonal immune stimulation
+receptor binding site
+highly pathogenic
+informatics
+PCNA ubiquitination
+Release of AMPs
+standard deviation
+Gel electrophoresis
+surgical fixation of their femur fracture
+eHAV
+nucleocapsid
+influenza
+cattle and monkeys
+synthetic
+multiple realizations
+five fold
+porcine
+0.9%
+two
+30
+severe acute respiratory syndrome
+C-type
+Plasma cells
+optical particle counter
+The Global
+Bayesian statistical frameworks
+South Africa
+Nonalcoholic steatohepatitis
+patients admitted to the critical care unit
+Future studies
+computed tomography
+inhibition of cell proliferation and angiogenesis
+Proteolytic cleavage
+Activated CD4+ T cells
+microglial cells
+tissue sodium concentration MRI
+Arab countries
+10%
+EVD
+Dr. Susan Weiss
+time from infection to symptom onset
+Total RNA
+The inset
+Cost effectiveness
+RAB5-DN
+the disease
+group 1 viruses
+the number of those vaccinated
+avian strains
+500
+FACSCalibur
+WebLogo
+air-supply/air-exhaust systems
+DestiNA Genomica SL
+excellent communications and coordination mechanisms
+PFGE
+KEGG pathway identifiers
+Pediatric Logistic Organ Dysfunction 2
+0 to infinity
+103-3308 ng/mL
+counter-selection
+89%
+variola
+VWF antigen concentration
+the predicted epitope
+13
+0.2 %
+funerals and transmission to health workers
+deleterious
+Five-to two-hundred microliters of clinical sample
+miosis, dim vision, headache, and eye pain
+a major redistribution
+complement activation
+AKC lysis buffer
+Human rhinovirus
+endosomal TLRs and most NALPs
+RR
+NSs proteins
+5 minutes
+Coomassie blue dye
+Amph-FL
+Secretion of IFN-γ by spleen cells
+1 litre of ethanol
+economic development
+four
+talocrural joints
+IL-18
+À7.4 kcal/mol
+single-stranded RNA
+Annexin A3
+SP-A
+Papua New Guinea
+5166
+activate ERK signaling
+17.8%
+Sample size
+class I, II, and III
+PXD012785
+18 to 20 g
+Figure 1
+similar clinical disease outcomes
+PCV2
+describing the level of knowledge and practice of nurses in pain management
+informal behavioural changes
+Build37 coordinates
+stem-loops
+three
+1.8 million
+ensure there are high quality reviews in all public health topic areas
+RIG-I, MDA5 and LGP2
+autophagy-associated proteins
+lytic transcripts
+all mothers
+5%
+NF-κB and MAPKinase activation
+a-2,6-linked sialic acid receptor
+L. lactis
+substantially change the pandemic wave
+SHP-2
+10 h
+10 −100
+different tissues of healthy juvenile orange-spotted grouper
+WGASA
+12
+IL-17
+NSs
+topical corticosteroids
+Y549H
+autophagy inhibitors
+DNA microarray analysis
+1.5
+compound and unitary
+the completion of Stanford IRB Serious Adverse Event case report forms
+endoplasmic reticulum
+the ER
+Monitoring P L through esophageal pressure assessment
+bacterial artificial chromosome
+Adenoviruses
+serve as the receptor for virus attachment and infection of cells
+ACE gene polymorphism
+Cambodia and China
+influenza virus replication
+Ded1p preparation
+629
+300 × g
+Transcytosis
+mouse
+Steered Molecular Dynamics
+x
+pharmacological arrest of the osteoclast
+ORs
+IL-12p35
+emergency transportation
+energy level of myocardial cells
+Caregiving in the home
+Emergency Response Coalition
+protecting women of childbearing age against rubella
+by adding 500 µl of 80% cold ethanol
+pilin domain
+four
+48.3%
+Blood samples
+age, sex, and weight
+Susceptibility and Worry
+translation initiation
+6 months
+war and conflict
+superspreading
+viral loads
+infection with A virus
+their structure
+gel filtration
+posting to Ebola treatment centres
+amino acid sequences of the M2 and NA proteins
+Disease/Phenotype web-PAGE
+P58 IPK
+the nucleus
+polyfunctional
+1000
+CTI
+Quantified GlyGly sites and the results of the t tests
+April 18
+Highly sensitive
+3%
+HIV
+influenza A viruses
+His-RIG-I
+reference materials
+swine flu
+common haplotypes on IA risk
+sequence dependent
+E1
+Biomolecules
+NP-31 and NP-450
+Intensity
+Fixable Aqua Dead Cell Stain kit
+alginate nanocarriers
+EPF supplementation
+119 000 to 206, 000
+Hoechst 33342 nucleic acid stain
+PRC1 and PRC2
+Germany
+success
+Fifteen
+27
+intergenic
+EGFR tyrosine kinase activity
+Spectral data
+13
+Nosocomial and imported infections
+6
+six
+12.55 ng/mL
+1 μg/mL
+78.70%
+Lys57 and others not yet identified
+male
+RSPs
+long noncoding RNAs
+low redundancy of interactions found between these databases
+alpha1-antitrypsin
+Data
+A parallel treatment with L-fucose
+Changing G4-C16 into A-U
+six months
+gamma
+enhanced the stimulatory capacity
+a series of NSs mutants
+30 days to 3 months
+Z ika virus
+2004
+Morita−Baylis− Hillman reaction
+gene chip technique
+disaggregated viewership data
+IAVinduced IL-1β
+describing the magnitude and characteristics of vaccine-induced immunity
+CORDS
+R
+EA
+Fractions showing high absorption peaks at 280 nM
+NPD
+sECP level
+PB1-F2 and PA-X
+ROC curves
+Bio-Rad Trans-Blot Cell
+a strong shift
+to ensure the uniqueness of the sets
+key host-parasite roles
+deSolve
+Medical diagnosis of historical figures based on textual evidence and other artifacts
+neurons
+35
+22.2%
+Bioworks 3.3
+three
+Paracrine adhesion factors
+predict option
+Python
+apron and gloves
+400,000
+Up to 11
+InvivoGen
+Salmonella-associated gastroenteritis
+0.2 mM
+physicians, respiratory therapists, and critical care nurses
+Energy functions
+100%
+5 kHz
+FHV-1
+Ten
+Kaplan-Meier method
+Man9GlcNAc2 oligomannose-type glycans
+homotypic parallel 3-helix coiled-coil domains
+infection and incubation
+generalized additive models
+Depletion of intestinal commensals
+influenzarelated search queries
+declined dramatically
+50%
+sulphated L-iduronic acid
+lower respiratory tract infections
+measles
+CD8 + T cell-mediated selective pressure
+MinElute Gel Extraction Kit
+In-vitro RNA
+Six
+AIV exchange risks
+secretion of type I interferon proteins
+Bonferroni correction
+56%
+Higher absolute lymphocyte numbers
+elevated plasma ACE2 activity
+Fig 5E
+acetone extracts of two plants
+RSV
+DAVID 6.7 Functional Annotation Tool
+Cleavage
+commercial layer chickens
+five
+SOCS3, Irf1, and Interferon-gamma
+NCBI gene identifier number AY847351
+Endocrine glands
+Over 60 %
+4 to 80 • C
+lung neoplasia
+Gag-specific CD8 + cells
+mild perivascular mononuclear inflammatory infiltrate and moderate congestion
+shedding amounts
+growth factor receptor tyrosine kinases
+LASV/MOPV
+six
+photocatalytic TiO 2 NPs
+Modified live vaccines
+Recognition and Tolerance, Immune Response, and Killing and Memory
+96
+A human challenge model
+500 μL RIPA lysis buffer
+Basic chemical principles
+significant differences
+Shotgun approaches
+25
+Rab5a-Rac-VE-cadherin
+Recombinations and mutations
+Acute kidney injury
+1931
+hydrophobic
+DEC205, Cadm1, and surface Clec9A
+photoreceptor arrestin
+latent infections
+1000
+inhibition of amplification
+U
+new models
+innate immune response
+TLR4-MyD88-NF-κ B signaling
+Genetic analyses of variants found in clinical screenings
+94%
+Public trust and confidence
+selected tissues
+enabling DIVA approach for FMD
+Myxoviruses
+prophylaxis
+consistent information
+Five-micrometer
+ternary complex
+equation 12
+Membrane-bound PDI
+349
+Co-translational misfolding
+less than that added experimentally
+luciferase induction
+per capita income
+438
+2003
+none
+Russia
+multiples of the G1 mean length
+ZL and YJ
+ELISA-array assay
+R18 and DiOC
+A and U nucleotides
+four
+rapamycin
+94.2-94.8%
+4%
+GAE
+modulation of autophagy
+twenty-seven
+distantly related vertebrate hosts and invertebrate vectors
+human
+Twenty-four hours
+1990
+cancer vaccination
+mice
+pressure equalization tube
+Knockdown resistance
+E. coli
+JD and ES
+9.9E-05
+FRC INview TM
+natural habitats
+Lung cytokine
+100 μl of elution buffer
+reduced kinetic stability
+Focused-echocardiography
+reversion
+89
+Gr-1 + CD11 + b cells
+NeuNAc
+Tfh cells and Th17 cells
+Explicit solvent MD simulations of nucleic acids
+Tumor protein 53
+as the mean
+BSL-3 conditions
+Cyclins and cyclin-dependent kinases
+5.2 deaths/10 000 population
+SPSS 17.0
+study protocol
+stable temperatures
+SYBR
+one of the non-bridging oxygens
+Nuuk Declaration
+Hepatitis C
+TRIzol reagent
+bind Siglec-8-Fc
+gastrointestinal diseases
+9%
+LC3-II
+slightly reduced
+multiple biomarkers may be able to overcome the limitations of one or a few
+human naïve CD4 + T cells
+Axio Imager A2
+One hind leg
+Blood samples
+dysregulation of SPM pathways
+tandem MS
+More than 10%
+inflammatory networks
+Rabbit polyclonal antibody against E protein
+YN IBV
+therapeutic, diagnostic, or prophylactic
+bovine IgG
+GA
+The NIH Institutional Biosafety Committee
+clinical ILI consultation rates
+public health policy
+pg cortisol/mg hair
+1 month
+500 μL aliquot
+Thirty-four
+patient characteristics
+January 1997
+RSAD2
+a detection antibody
+60 minutes
+IgM serology
+6A n
+2 h
+co-purified NAs
+recombination events
+thermal
+256
+consideration of methods for rapidly recruiting and training "surge capacity" translators
+other flaviviruses
+NF-κB
+publicly available
+Access to health care
+Comparison of plasma cytokines and chemokines
+receptor-destroying enzyme
+transmission electron microscopy
+reproductive and somatic
+Endothelial progenitor cells
+Three
+cellular movement, developmental disorders, cell cycle, molecular transport, and cellular development
+EBOV
+8
+five
+matrix-assisted
+mediate some unknown functions
+influenza
+Transfection efficiency
+65 °C
+the slope of each growth curve
+adjuvants
+unpredictable
+increase the OCT4 mRNA levels
+Table 1
+transmembrane
+furin
+resistance to matrix inhibitory drugs
+30 min
+serotype replacement
+viral RNA
+Northern blot analysis
+7 days
+95%
+direct fusion and receptor-mediated endocytosis
+trkA and p75
+five
+base compositional constraints
+Influenza A virus and the bacterium Streptococcus pneumoniae
+fluorescent WGA-labelling
+Six
+50%
+genetic diversity
+IFNL4
+Site-heterogeneous
+Phi29
+5 mM DTT
+endogenous AKT1
+90d mortality
+to identify any sample differences
+One hundred and five
+ischemic
+Data-driven methods
+knowledge of population susceptibility
+polyclonal antibodies
+AgaR2-recognizable sites
+two
+protected mice from RSV infection
+the ER
+Generating and characterizing transgenic mice
+A/Shandong/01/2013
+mouse
+failure in the formation of functional tertiary structure of the triplex formation
+four
+experimental validation in biological system
+psychological predictors and outcomes of endorsing conspiracy theories
+TLR9
+genomes
+USUV
+genes
+type 1 and 2 interferons
+83%
+preference for one type of codon over another
+at least 12 weeks of treatment
+Successful experiences of preventive model
+Asia
+Peak demand for both outpatient and inpatient care
+two
+more infections in the acute phase
+high shear stress
+16
+N-terminal
+knowledge
+S598 or S598 Q600Y
+80%
+Numerous infectious pathogens
+The overall effect from meta-analysis
+z-scores
+one-dimensional SDS-PAGE
+fruit bats
+mitigation effectiveness
+severe PAP with continuous need of oxygen
+explicit consideration of multiple introductions
+adjuvant
+base triples
+Flow cytometric
+RMA standardized method
+Linear and K29-linked di-Ub
+metabolic pathways
+10
+once-weekly
+MICROBExpress TM Kit
+infectious agents
+nine
+The pharmacophore with van der Waals surface
+William Coley
+China
+unclear
+DNEV
+adjacency matrix output
+3 0 ends of at least some cleavage products
+4 weeks
+CX3CR1
+crowded tropical cities
+the standard viral genome
+65%
+glycans
+DMD patients
+The capsule
+biological
+difficult
+RdRps
+low basal levels of IFR
+cell death
+11
+1 week
+high levels of incorporation
+26%
+4%
+H7N9
+30 min
+NaCl reabsorption
+Autoclaved mycelia
+The CLDB
+subtle contacts
+an HIV test that was negative
+three
+1 to 37 cases per 1000 infantyears
+1
+comparative threshold cycle value method
+12% SDS-PAGE
+all three viruses
+generality
+BVDV-1c strains
+inflammatory
+765
+IL-6 and IL-8
+a lineage 5 isolate
+emerging infectious disease threats
+90%
+An edge
+Germany
+65%
+7%
+3 days
+PyVs
+Phenylalanine tRNA
+2 mL
+E39
+viral infection prevention strategies
+Lck
+66.1% and 75.0%
+47
+65-74
+tau pathology
+HBoV DNA load
+purified HA protein
+16.9%
+covalent binding at the surface of particles
+38
+Vital dyes
+the same set of K
+Bioanalyzer RNA 6000 nano reagent kit
+DNA vaccines expressing only HBsAg
+26.8 ± 8.8%
+Sheath tissue
+cytolytic activity
+agarose gel electrophoresis
+high viral titers
+MinStem and MinLoop
+antifungal
+normalised relative risk values R k at exact case locations
+alternative activation by MR antagonism
+6 weeks
+280uC
+physicians' oversights and absenteeism
+1 week of age
+CVTree3
+Plasma samples
+genome composition bias
+polymerization of tubulins to extraordinarily stable microtubules
+Plasmodiophora brassicae
+noninvasive and specific circulating markers of several cardiovascular diseases
+Clone 5
+low number of interactions or binding site residues involved
+18,139
+three
+blood flow
+DPC-333
+35
+absent ; mild ; moderate ; severe and very severe
+G 1
+accuracies
+0.56 and 0.57
+American Type Culture Collection
+Genomic DNA
+ferrets
+silencing of LC3
+T cell differentiation
+filamentous
+GSH
+Rt
+by plating and counting CFUs and fluorescent intensity
+Guinea, Liberia, and Sierra Leone
+10 mM BrdU
+IRT images of an animal's eye temperature
+endosomal acidification
+Vero
+biospecimen practices
+appropriate model viruses
+to identify pneumonia and influenza cases
+95%
+one week
+cc-by
+hyperpolarization
+hepatitis B
+extracellular matrix components
+10%
+monocytes or dendritic cells
+general effects of nutrition on infection outcomes
+nine
+23
+IL-17
+using 1 ll of neat extract and running 25 cycles
+over 40
+Interferon-inducible PKR
+phenotypic correlations between leukocyte subsets and acute phase proteins
+pre-existing impairments in lung function
+real-time PCR
+yield
+three
+guinea pigs
+demyelination
+solvent
+708
+120
+Illumina Hiseq 2000
+alcohols, aldehydes, iodine, phenols, and chlorine
+intratracheally delivered
+δ-Secretase
+pathological tests
+518-L-infected 293T cells
+the true value of the parameter
+cell-free supernatant
+ordinary differential equations
+cytosolic
+measurements made from different wells during an experiment on the same day
+NSP1 protein
+Non-parametric Mann-Whitney tests and one-way ANOVA
+statistical significance
+Outdoor climate
+blood-borne virus infections
+milder acute respiratory tract infections
+W371A mutation
+guaranteed health insurance, workers' compensation and disability insurance
+normalized 4-gram frequencies
+100%
+a mRNA that is directly transcribed from the genomic S segment
+psychological
+b
+BBB injury and leukocyte recruitment
+June 2023
+antiviral
+Plasmacytoid dendritic cells
+Four
+It would be too late
+6A 2 -1A 0
+Endoperitrophic face
+r I ~I=N
+dilution and connectivity
+HeLa cells
+2009
+eight weeks
+NSD6-30 and NSD56-80
+partial protection
+membrane sialic acid residues
+5-15%
+44
+winter
+The SRM atlas
+pCR8/Gateway workflow
+Eosinophils
+mental health intervention work
+autophagosome-like functions
+SNPs of IL-28B
+factor
+CaseViewer
+beneficial
+11.8 amino acids
+59
+detergent
+Acute respiratory distress syndrome
+BHK-21 cells
+infection by SAFV-3 isolates
+Student's ttest
+clinical and laboratory characteristics or prognosis
+human rhinovirus and Adbased vector systems
+Pure household models
+Element k i j of K
+honey bee
+UN heterodimer
+Ten
+1968
+eIF2α
+yUfd1 NBM
+15
+use of non-sterile gloves
+Mtb-susceptible
+Klenow DNA polymerase
+NdP, CG, OP, HM and GP
+RNA
+High quality filovirus recombinant protein antigens
+an exacerbation
+increase the efficiency of replication
+early protection against RSV infection
+once every 3-4 weeks
+µ
+anti-rabbit secondary antibody
+Health related quality of life
+MDRI
+kidney and liver
+different determinants and drivers
+dsRNA
+seven
+one quarter
+branches of their phylogeny
+two
+chromosome 14q13
+WARS
+severe lung injury and pulmonary edema
+PPRV nucleic acids
+high-performance liquid chromatography
+human disease impact
+630
+directly transmitted infections
+68
+HIV-1
+NeoMarkers
+Two paralogues of the class III HDAC Sir2
+pathogen emergence events
+achievements and trends on current nanobiotechnology systems integration
+enhancing ACE2 activity
+animal welfare purposes
+27
+A
+proteins
+HDV infection
+mfold predictions of the secondary structure of the ''stop-start'' region
+CvME
+Bovine serum albumin and PBS controls
+modification of Ubiquitin
+immunoglobulin type domains
+100.000
+3
+cleavage activation
+0.54%
+A pseudoknot
+Kaplan-Meier method
+COPD
+age-and disease-dependent disruption of lipid rafts
+interparatopic distance
+virulence
+VAP
+110 rpm
+3 h
+0.5 g/ml
+spring 2011
+ImageJ
+pseudoknot thermodynamic parameters
+CPP-steric block ON conjugates
+pGDENV1 3.3
+anxiety, depression, and diminished self-esteem
+porcine IFN-β
+ANOVA
+15 min
+1980s
+HDONAs
+adenoviral transport
+under-reporting
+90 copies of an ORF2 dimer
+non-monocyte derived cell lines
+20
+6.5 g/dL
+invalid
+TLR9-independent
+one minute
+a gate including Lin À /Sca-1 þ cells
+RAGE
+ALV-J
+sheddase ADAM17
+NK cells
+0.1 Mbp
+SaO2 and SpO2
+pathogen exposure
+Cs 2 CO 3 and hydroxybromides or iodides
+wet electrochemical reaction
+influenza
+UW 14-537
+every 4
+H5N1
+pessimism
+Seasonal influenza
+downregulation
+competency in medical knowledge
+Luciferase activity
+neutrophils
+30 min
+DENV titers to WT levels
+Northern blotting
+0.5 mM
+30 min
+non-redundant datasets
+349
+MILLIPLEX MAP
+Geneious 7.0
+Human immunodeficiency viruses type 1 and 2
+the model produced by the training set
+TMEV
+Parameters of oxygenation, hemodynamics and lung mechanics
+Poly I:C
+methylation
+rapamycin
+correlated
+test kits developed for seasonal influenza A and B viruses
+resilience to mutation
+VS
+winter
+different gene expression trends
+mortality-related DNAm
+H5N1 and H7N9
+Consensus shuffling
+four
+Fc receptors
+infecting capsids
+inhibiting the translation of the cap 0-modified mRNA
+More than 2,000,000
+Circadian disruptions
+desert woodrat
+bronchopneumonia
+Dr. S. Ludwig
+individual immunity
+nonhuman primate models
+2 h
+susceptible
+Antemortem testing for human rabies
+claudin 1 overexpressing cells
+increases the antiretroviral potential of IFNa
+EVD
+Normal rabbit or mouse IgG
+functional divergence in AP2 group genes
+Supplementary Table 1
+a fraction
+10 days
+5 days
+a severe malaria patient's isolate
+relatively discrete groupings of control, mild MPP and severe MPP groups
+ventilator-induced lung injury model
+NLR proteins
+20:1
+Categorical variables
+94
+28 days
+enhances transcription of many oncogenes
+once their mobilization occurs
+normal lung parenchyma
+Arterial blood gases
+16
+Siglec-8
+negative
+30 days
+35fold
+H3N2 and H1N1
+WHO Rapid Advice Guidelines
+A DSMB
+52
+different epitopes at GP
+60 hours
+mutation pressure and natural selection
+highly flexible
+polyclonal human serum
+Binding of these inhibitors
+non-pulmonary
+G ¥ ¥
+autophagy
+van den Driessche and Watmough
+Sonication
+DAVID
+KstR
+C3
+routine diagnostic testing
+lipid-rafts clustering
+non-pharmaceutical measures
+formation of membrane tubules
+41%
+The filled area
+four
+Nucleospin Tissue XS kit
+BAX-BAK-mediated mitochondrial outer membrane permeabilization
+egr-1 and KSHV ORF50 transcriptional activity
+Biguanide
+Human CD4-IgG2 immunoadhesin
+intestinal microvilli
+primary amine coupling
+Trizol Total RNA Extraction Kit
+45.2%
+they might complement one another
+IFN-α
+manidipine
+the death certificate and registration of causes of death
+mild lysis
+host species, cell type and virus type
+M1 and M2
+sequencing errors
+low
+higher background
+supportive information
+trophoectodermal cells
+DL algorithms
+infants
+transferrin receptor
+189
+Bivariate data
+receptor-mediated endocytosis
+R563A
+auxin and cytokinin
+3-5 days
+CD3d gene expression
+CD spectra
+alkaline phosphatase
+dengue disease severity
+CD40-CD40L
+XJ
+346
+six
+Neoangiogenesis
+Shigella
+encapsulation with inspissated pus
+PRR ligation
+193
+Antisense oligomer-mediated exon skipping
+a rapid, easy, mobile, NAT method of high sensitivity and specificity
+Rt
+inhibit the formation of syncytia
+negative effect exerted by PHBs against TMEV infection
+M2 macrophage activation
+early anamnestic Ab responses
+Our focus groups and pilot testing
+255
+73%
+current research
+viral pneumonia
+GADPH
+pre NDV challenge growth rate
+psychometrically driven, definition-driven and data-driven methods
+survive the EBOV challenge
+caveolin
+polyfunctional
+22%
+two
+high resistance levels
+influenza
+ImageJ
+laboratory techniques or comparative information
+TRPM2 channel
+M-CSF
+524 APTYSW 529
+10
+abrupt onset thoracic pain
+PBS-immunized mice
+suppresses
+X-ray film
+EBOV
+transmission electron microscope
+Serum AST
+strong backward scattering of light
+at least 14
+de novo protein synthesis kinetics
+Five
+analysis of local characteristics of the protein chain
+viral attenuation
+activated stellate cells
+viral genomic RNA
+Vincenzio Tiberio
+additional references
+Cys31-32 disulfides
+human PBMCs
+MAb
+Government-funded public health activity
+10 min
+bacteria and viruses
+self and non-self
+low
+Total viral richness
+antigenic interaction
+DEP technique
+cyclocephaloside II
+Immediate implementation of effective isolation and infection prevention measures
+T-cells
+23
+Error bars of dose-response curves
+revolutionize healthcare
+IL-1b and IL-18 cytokine concentrations
+serum levels of RBP
+skin inflammation
+pigs
+real-time RT-PCR
+FHCRC database
+deposited calcium
+X-ray scattering
+56
+X
+membrane pore formation
+Interaction
+health care workers
+IFN-γ gene expression
+age specific
+inflammatory cytokines
+HTV ventilation induced damages of lung structure
+eight
+Creative Commons Attribution License
+Drosha, Dicer1, and Ago1
+22
+stopping research, informing public authorities or not publishing results
+Pine oil
+defects in enforced virus replication and a reduction in the innate immune response
+26%
+seven
+shorter lipid chain distances
+donor sex and BMI
+PiCV rCP
+P = 0.05
+To avoid false positive results
+698
+36
+branching processes
+Titration of virus stocks or samples
+the hierarchy of responses to either HCV or HIV antigen stimulation
+obesity
+predicted rates based on these 3 parameters and actual cholera incidence
+initial rates
+ABC parameter inference
+maxillofacial
+age and sex
+mean temperature, humidity, longitude and latitude
+Positive and negative controls
+2 min
+control group that was treated using only a roaster machine
+limited data
+alpha and beta diversity indices
+600 km
+lung endothelial cells
+1.25 mm collimation
+real-time reverse-transcription PCR
+southern Poland
+Calvin Schwabe
+The Ebolavirus Virus Pathogen Resource
+difference image
+FXII
+Retention of study participants
+few people have access to media and vaccination
+pseudoknot
+extra-pulmonary manifestations
+translation, replication or RNA stability
+IL-1b and IL-12
+accelerates healing
+gene therapy
+Turkey
+5%
+prior contacts
+488
+Southern blotting
+The difference in the quantity of the chemical components
+the first identified homomorph
+Western blotting
+V5-tag expression
+reovirus
+TNFα
+approximate post mortem interval
+Monsalvo and colleagues
+Virus-containing cell culture supernatants
+infection
+P. tomentosa
+E. chaffeensis 16S rDNA and mouse Gapdh
+antibiotics
+GFP-positive
+univariate analysis
+Student's t-test or one-way ANOVA
+larvae
+Multi-Tissue Dissociation kit #1
+between 2 and 15 days
+23%
+Favipiravir
+55%
+apoptosis or oncosis
+Isothermal titration calorimetry
+nonsteroidal anti-inflammatory drugs and/or simple analgesics
+Filter paper
+13
+30 min
+public health incidents
+a wide number of pathogens
+USP5
+local disease surveillance and risk communications efforts
+the information that is determined by the extent of homology among the compared sequences
+increased by more than 4% each year
+Twitter or other Internet data
+HRV-A and -C
+anti-goat AF488 antibody
+12
+acute respiratory distress syndrome
+NPPB
+spatiotemporal
+12%
+−1 frame stop codon
+directing the anti-viral activity of PML NBs
+Viral RNA
+Clinical algorithms based on biomarkers
+Broadly reactive
+62.1
+IL-6
+death
+4 million
+Further studies
+EBOV-GP 1976
+fluorescence quantification
+12 h
+essential for HBV gene expression
+Hardy-Weinberg equilibrium
+real-time identification and characterization of epidemics
+population migration
+Treatment with adult haemoglobin
+67%
+4'/G
+Hydrogen peroxide
+three
+similar results
+≥1:40 hemagglutinin inhibition titer
+phylogeny
+mutarotase
+Tracer 1.5
+6 weeks
+six days
+suppress Yop translocation 20 and protect macrophages from apoptosis
+Patient clinical data and serum samples
+41
+weak emphasis on duty to care
+Porod-Debye
+SBE2/3 motif
+immunomodulatory
+influenza B seropositivity
+Negative staining of viruses
+Fourier
+Figure 6
+Apoptosis
+293 FT cells
+a BF test
+rate of separation
+exacerbation
+viral respiratory infections and norovirus outbreaks
+integration time: 10 sec, sensitivity: 200 or 230 and Filter set 1
+DISMOD II
+SUMO modiWcation
+iNR-Drug predictor
+ribosomal mRNA entrance channel
+30 nM and 1 mg/mL
+STAT1 and GRB2
+intra-clade VP1 divergence
+Wild-type
+n
+14
+alerted the group members about the disease
+14.96 ±11.82
+SWBV and BAV
+Kolmogorov-Smirnov test
+SELDI-TOF technology
+HPAI H5N1
+ZIKV
+analyzed
+95%
+cellular lysates
+mixing within camps only and no mixing between camps
+HTNV infection
+three
+CCL-2 and MX-1
+HMGB1
+52
+3-Indolepropionic acid
+markers of HIV disease progression
+1 wk
+scatter plots
+parameters i and j
+12 min
+HCV and HIV
+HMPV A2
+Neutrophil longevity
+Pneumococci, S. aureus, and GAS
+RNase inhibitor
+viral DNA
+2× TBE urea sample buffer
+the loop of an extensive hairpin
+middle cerebral artery occlusion
+860
+Cerebral malaria and severe malarial anemia
+B-cell related trafficking and organization
+X-ray scattering
+A549 cell line
+CGI methylation
+RNA helicase DDX3
+two different random 6 nt sequences
+four
+99.99%
+10%
+a protein in the mitochondrial respiratory chain complex
+Genetyx 11.1
+volume of news coverage
+flow cytometry
+an association between susceptibility and levels of MatAb
+development of severe disease
+identification and analysis of bifurcations in the system dynamics
+Medical mask
+Autoubiquitinated TRAF3
+LFQP results
+replication and transcription of the viral genome
+highest
+Flow cytometry
+140
+camel agribusiness
+alternative splicing
+modernity
+More than half
+Spanish
+Zeiss Axiovert 200 M microscope
+complex
+Artifactual recombination
+Anomalies
+ReverTra Ace Kit
+Non-physiological artefacts caused by shRNA expression
+plasmacytoid dentritic cells
+Rapid and accurate identification of sexually transmitted infections
+100%
+EGFP reporter
+three
+murine leukemia virus
+more tests in different conditions
+Travel time
+548
+Turner et al.
+Fifty
+adherence to mucosal epithelial cells
+Annexins
+cycles
+CarboSil 20 80A
+anti-inflammatory
+reproductive number
+three separate PCA clusters
+28
+phosphorylate STAT1 and STAT2
+S, S1 and S2
+pGEM-2KS and pET21
+Twenty
+322
+to ensure that equal numbers of cells were infected
+PK15 porcine
+TRAF3 and TRAF6
+Female shrew #3
+mutations existent in templates
+King Abdulaziz University
+differentially expressed proteins
+TDP-43 depletion
+Retromer binding
+pre-processing of the binding sites
+BFRF1 and BFLF2
+preventive restrictions of freedom or exclusion from society
+23
+6 ± 0.7%
+Glutathione Sepharose 4B resin
+PRE ribosomal complexes
+an agreement to the reference
+31
+15
+implausible uninformative prior distributions
+Benchmarking experiments
+6.02e23
+InVS
+cleave
+7 of 13
+15%
+Alveolar macrophages
+The nucleus of a cell
+Supplementary Table S3
+information about the structural interactions between serum antibodies and their antigens
+unique lipid compositions
+BHK-21 cells
+polycyclic aromatic core
+biological
+more severe AOM
+homogeneous population mixing within a district
+VIDISCA-454
+31
+department within Peru
+100%
+cytoplasmic, perinuclear foci
+observable and unobservable modeling approaches
+kallistatin levels
+splenomegaly, rash and arthralgias
+1083099-2
+Standardising more microbiological diagnostics
+C γ
+complement fragments, ROS and pro-inflammatory cytokines
+CIb
+pDCs
+S0-F and F-S0
+5
+DNA damage and actinomycin D treatment
+A 260
+a drug that inhibits the helicase activity of eIF4A
+millisecond scale molecular dynamics
+Macrophages
+DQ red BSA
+D3
+ACLF
+Rao
+Olympus BX41
+hyperbolic
+mycobacteria, nocardia, herpes viruses, and fungi
+Day 2
+12
+rodent
+log-likelihood ratio-test
+2380
+560 000
+a measure of conspiracist beliefs
+polypeptide epitope
+Standardization of plate reading equipment
+A leader sequence from human tPA
+Measurement of visual-evoked cortical potentials
+the phagosome
+GA
+Piercy and colleagues
+H5-HA
+Daubenton's bats
+More than half
+PV EF3
+whether cancer is
+Simple Modular Architecture Research Tool
+Tables S1 and S2
+an opening through the membrane
+2
+56
+immunity, nutrients, energy, and bioactive factors
+1993-2004
+1:2 and 1:3 ratio
+SFTS
+Economic concern
+Nuclear factor kappa-B
+decreased virus shedding
+policy guidelines
+90 minutes
+Yoyogi Park
+protein mass spectrometry
+200.6%
+2003
+Melanoma
+delivery and stable expression of siRNA
+Solvent exclusion
+Four
+half
+potential contamination
+steady state
+phosphorylation
+carotids
+Influenza A
+Reassortant strains
+30 s
+chronic diseases, cancer, immunotherapy, and immunocontraception
+means ± SEM
+mycophenolate mofetil
+23
+225
+80%
+Precursor firefly and Gaussia luciferase reporter gene constructs
+Section 2
+Zika
+hundreds of millions
+increased surfactant degradation or lung tissue inflammation
+1.7 years
+whether the cellular immune response is protective or facilitates the onset of severe disease
+3 times a week
+correlated
+bornaviruses
+19,800
+fibroblast
+severe acute respiratory syndrome
+CD4 + T cells
+Heme oxygenase-1
+admission
+rapidity of manufacture
+coupon collector's model
+0.76
+the row and column labels
+Cases
+Dr. Y. Liang
+Abnormal protein expression
+Wizard SV 96 Genomic DNA Purification System
+TBE-C
+Mouse kidney cortex lysates
+Centers for Disease Control and Prevention
+MAGT1 and TUSC3
+covalent cross-links
+further investigations
+natural selection
+less than several hours
+ALV groupspecific antigen
+12
+prothrombin time-international normalized ratio
+Advantage 2 Polymerase Mix
+81.5%
+Reperfusion
+observable growth rate and duration of the infectious period
+Spain
+1789
+sepsis
+60 years of age
+external validity
+threshold dependent parameters and threshold independent parameters
+Cell Signaling Technology
+S1P
+SPSS version 13.0
+RiboPicker
+Influenza virus M2 protein
+analysis score of 4.0
+Ionotropic GABA A receptors
+57
+Excel
+IL-8 and MCP-1
+Latent tuberculosis
+different genetic backgrounds and environmental factors
+RESTV and LLOV
+Agencourt AMPure XP beads
+cytokine concentrations
+user-friendly and validated tools
+993
+wild-type or mutant peptide
+according to specific analytical approaches and the individual required steps
+Streptomycin
+tissue and aquaporin specific
+Letters
+Statistical
+29
+cells that do respond
+Site-directed mutagenesis method
+1%
+11 h
+oseltamivir
+Classically-activated
+flagellin
+18
+Two milliliters of the harvested virus-containing supernatants
+TNFα
+local membrane instability
+mechanical
+histologic evidence of cardiac damage
+growth medium
+Hippocrates
+SBML
+Beijing Children's Hospital
+The square root
+ZIKV-specific immunity
+suspended confessions and funeral ceremonies
+NF-jB
+Huntington disease
+mechanical ventilation
+PDCD4
+NH 4 Cl
+cell proliferation, cell differentiation, and apoptosis
+Close to one-third
+PCR
+September and October of 2014
+Molybdenum cofactor
+fibrinogen deposition
+interventional strategies
+Convincing people to adopt prudent health behaviors
+eEF1A
+Privacy issues
+1/10 th of the starting material for the IP
+Natural selection and mutation pressure
+mixed viral populations
+reverse transcriptase polymerase chain reaction method
+homeostasis or regenerative capacity
+> 100 days
+pluripotency
+40
+Sample size
+4809
+39.2%
+severe anemia
+testkits
+Bril regulatory sequences
+xcms
+56.7 months
+300 K
+non-linear
+DOR and codon usage bias
+emerging bat-borne viruses
+Type 2
+denaturation of template
+Low level expression of the replicative machinery
+replicative
+higher radiation energies and improved alignment
+21
+infection
+T cell immunity
+Lemma 1
+n overnight culture
+4, 842
+viral cultures, antigenemia, and PCR assays
+Object detection and tracking techniques
+viral yields
+V18A, R44K, and S195P
+vaccinated animals
+a new site
+6
+5
+Primers designed to mutate designated residues
+Nedd8
+11%
+contribute to the entry of Ebola viruses
+Incidence
+Aromatase
+MΦ polarization
+15
+Thirty minutes
+Different Lys and Arg isotope forms
+Systemic corticosteroids
+Metabolomics
+cofactor
+ELISA
+temperature effects
+residue 77
+8%
+recall of the poster's message
+virologic characteristics or molecular epidemiology
+Group 1
+Mann-Whitney U test
+39%
+Mesenchymal stem cells
+4,833
+nocodazole
+fully de-identified data
+Allocation concealment methods
+antibodies to currently circulating influenza viruses
+neuroprotective
+cTn
+37
+200 nm
+stochastic
+Six
+NG2, Nestin, Pax6 and Sox1
+computer-aided drug design
+Leica TCS SP5 Confocal Laser Scanning Microscope
+12
+7
+0.996
+mechanical stability
+mixed effects model
+75%
+DENV amplification
+the relative amounts of total sGP and GP 1,2 produced
+perilymphatic
+how many diagnostic samples they could process per week
+Surfactant administration
+CD163
+1:10000
+diagnostics, therapeutics and vaccines
+ileal tissue
+substitutions of G with inosine
+the ratio of the transfected reporter constructs
+ImageJ
+The endothelium
+neutrophils
+not robust
+91 days
+Co-immunoprecipitation assay
+Two-dimensional position information
+pro-inflammatory
+Hsp90 activity
+99%
+cancer antigen 125
+elevated induction of IFNb-stimulated genes
+57.0-66.3%
+mixing patterns
+significant differences
+inhaled diethyl ether
+WNV RNA replication process
+Pearson's chi-squared test
+low PaO 2 and low PaCO2
+West Nile virus
+14-21 days
+15
+conservative or moderately conservative rrs and groEL strategies
+Primary viral pneumonia
+the untranslated region of the PIV5 M mRNA
+MS2 and PhHV
+Nmd3 adaptor
+Traditional Chinese Emergency Medicine
+Flavones
+MDCK-SIAT1 cells
+aquaporin 4
+10%
+Spotfire
+Clonetech
+HBsAg
+70
+existing social ties
+CreERT2
+1 h
+targeting extracellular CIRP
+Six
+50%
+weak hypotheses on the dynamics of the time-varying parameters
+2 weeks
+25 July 2015
+72
+5%
+KX982264
+HeV or NiV
+One hundred
+a few hours
+Geneious
+fear
+-A2 or -A24 alleles
+Common cold
+SDHA/YWHAZ
+The unconstrained problem
+relative mrna expression levels
+viral plaque assay
+10%
+hospital
+gloves
+Percentage of number of ILI visits to number of total clinic attendances
+eighteen
+aromatase
+high cell-density fermentation
+IFNλ
+the specific RNA segment
+150 μL SDT buffer
+18.3 and 16.2
+descending paralysis, bulbar palsies and respiratory failure
+Acetylcholine
+Sexual transmission
+sepsis survival and/or organ dysfunction
+interfering with the formation of the apoptosome
+Over a quarter
+RIG-I RD
+priming of resident cells of the CNS
+abnormal nuclei
+Online Supporting Information S1, S2, S3, and S4
+MKP-1 expressions
+Forty-four
+Fifteen to 20
+University of Colorado Hospital
+Taiwan
+10
+an inhibitor of PAK1
+7
+Surveillance for hospitalized patients with severe acute respiratory infections
+two to three times
+spontaneous lymphoproliferation
+Neutralization
+proteins and RNAs
+co-infection
+Accession numbers, alignments, dates and locations of the isolates analyzed
+six
+AIV-specific CTL cytotoxicity
+IFITM variants 1-3
+cattle medicine
+severe RSV bronchiolitis
+16 layer variant
+DENV envelope protein
+the mutation
+Selection ''corrected'' recombination rate estimates
+lower respiratory tract
+t + 2 and t + 3
+Every 4 weeks
+the number of the initially responding B cells
+-Leu incorporation
+stability and cost
+levels of trust and transparency
+Aldevron
+a transition to a more malignant phenotype
+inflammation during HCV infection
+IRF7
+inhibited cell-binding
+58%
+neutralizing antibodies against target epitopes on the viral surface
+conservation patterns or co-evolution measures
+structure
+rifampicin
+4
+DMEM
+10%
+5 min
+four
+90 min
+homo-oligomers
+eleven
+experimentally obtained T cell tracks
+2 weeks
+2005-2006
+2
+on the periphery of the pocket
+weak
+SuperScript III First-Strand Synthesis System
+Four
+high body-wide skeletal muscle dystrophin production
+haematoxylin and eosin staining
+μs-ms conformational exchanges
+by sorting
+ADAM17
+less than 2 weeks
+help-seeking
+Bland-Altman plots
+sterile endotoxin free PBS
+TGF-β
+SARS coronavirus PLpro
+rural
+MHV-3
+mammalian cell lines
+Tetra-, penta-and hexanucleotide SSRs
+sorting of cell populations
+HPV01 and HPV08
+The County Education Officer
+Climate change
+RNAeval
+48 hours
+60 µL/min
+1957
+increased secondary bacterial infection
+WNV
+thin-layer chromatography
+a complete CDS
+iterative and reflexive
+weekly
+a signal to noise ratio of 5 and valley depth of 3
+Prism 6
+a putative trajectory of increasing viral fitness
+Hantaan virus
+four
+significant variance differences
+10.50 ± 0.48 μ g/mL
+R0
+OAS1
+Microscopic
+12h
+human influenza A virus replication
+1,000,000 JPY
+Clinicaltrials.gov
+microarray dot electrodes
+inducible expression of C6
+Cell culture supernatants
+increased expression of IL-1b
+RecoP51 ATPase
+vaccine efficacy
+prior infection
+sources of error
+gp41 binding
+proinflammatory cytokines
+no non-specific reactions
+antiviral medications
+144
+two-way approach
+efficient membrane vesiculation
+inhibitor experiments
+most of these postulated principles
+3
+Chronotype
+Cutaneous transmission of the hands, arms, and face
+Tautomerism
+relevant to influenza virus
+12.8 kDa
+397
+~300 hours
+P2 index
+Caspase-8
+IL-6, IP-10 and TNFα
+good
+ViennaNGS 38
+11,496
+Recombinant proteins
+mucosal homeostasis
+PE-conjugated mouse IgM
+X-31ca
+dead cells
+24h
+parasite growth, survival, and persistence
+0.01 M PBS
+MPER peptide
+14,000
+enhances surface expression of H5-HA
+TGF-β1 expression
+Backward stepwise logistic regression
+epitope characterization
+Seventy-five percent
+section 2
+65%
+key pathological features of encephalitis
+single nucleotide polymorphisms and short insertions/deletions
+One hundred
+inflammatory
+RNA
+bases that interact with specified L3 basic thumb amino acid side chains
+one
+undesirable side effects
+Aicardi-Goutières syndrome
+Nucleic acid hybridization
+0.7 second
+EDEM1
+EMR
+microtubules
+multi-looked image
+regulating cell growth and proliferation, inflammation, and cytokine production
+PMO, PNA, and 2¢-OMe/PS
+viral respiratory infection
+higher
+Megress C18 analytical column
+virus -infected cells
+Western-blot
+TRIZOl reagent
+at least three
+variability
+1% agarose gel electrophoresis
+a miniaturized automated fluorescence microscope
+three
+CDKN1A
+Variation of dinucleotide 1-2
+399
+More than 50%
+26.4 ± 8.1 mm
+Lassa Fever
+tools available from the EMBL
+Ghana
+surfactant proteins B and C
+70%
+prior or simultaneous evolution of new or modified transcriptional control sequences
+aggregation, adhesion and release response
+LD analysis
+bat
+virus-triggered apoptosis
+transcriptional activation of HDAC2
+Acute respiratory distress syndrome
+A proper patient selection, a cooperative patient, and clinician skills
+backward procedure
+six
+19.4%
+type-I pneumocytes
+vaccinia virus-infected HEp-2 cell lysate
+2DE
+vaccine growth and antigen production are not affected
+60-90%
+40%
+absolute humidity
+2 h
+IVIG therapy
+5
+Resveratrol and NS1619
+74.47
+illnesses
+MiPepBase
+cat odor
+Population-level selection
+oral mucositis and abdominal pain
+standard deviation from 3 independent experiments
+policy
+P < 0.05
+temporal immunofluorescence
+distribution
+clinical and education
+amphibole fibres
+adequate and neutral
+Sigma Stat 3.11
+polymorphism
+HSV-2 DNA
+Orf8 orf8
+Food and water quality
+surgical face masks
+acquaintance immunization
+Standard protocols
+Indicating medians as 12 well as minimum and maximum point estimates
+257
+24 h
+diarrhea
+compact interfaces
+published spore survival results
+one
+Chest tightness
+KE1 and KE3
+IFNλ1-4
+alamarBlue
+200 ml of pelleted yeast
+Two weeks
+applications and granted patents
+TB treatment using LOF
+Staphylococcus aureus
+encapsidation
+CTLA-4
+SOCS-3
+1.3 mg/mL
+nanorobots
+cc-by
+H1N1
+UNIFESP Research Ethics Committee
+I j and S i
+MicroRNAs
+Four
+nodes and links
+active lignin
+in vivo functional end points and histopathology and biochemical markers
+32 kilometers
+nuclear but not nucleolar staining of the Flag
+wild type but not Ifnar1 SA tissues
+SWISS-MODEL 32 and POLYVIEW-3D 33
+Nikon Eclipse Ti
+avidity
+PM0079652
+Cationic polymers
+Recombinant sequences
+thirteen
+integrating various inputs and responding appropriately
+Supernatants
+1000
+5.0
+PCR-based assays
+E 0
+highly specialized staff and equipment
+LAMP analysis
+spillover events and species jumps
+seven
+gender-and age-matched healthy adults
+variation in codon usage
+ribonucleoprotein granules
+antagomiRs
+PSII
+every 10 minutes
+538 nm
+0.5%
+E
+After 2 d
+three
+PIKfyve-dependent
+inactivating virulence associated proteins
+1%
+suicidal
+humans
+other active forms
+1,240
+100%
+V max
+diabetes
+DENV-2 E protein
+biological post-translational modifications
+high standards of infection prevention and control
+12
+mAb 4G2
+lower-level EAE and an earlier recovery from symptoms
+competing
+decreased the virus load
+111
+40
+Cytotox-One Homogeneous Membrane Integrity Assay
+Chromatographic separation before MS
+30 days
+the conditions within the GI tract
+cc-by
+ERdj4
+Sevag method
+3000-4000
+PfNHE1
+issues and questions
+D endritic cells
+histopathological changes
+Green bars
+0.5 %
+Specific PCR and RT-PCR
+Limiting the duration of prophylaxis
+CD11b + Ly-6C hi monocytes
+Chinese strains and foreign strains
+862.25
+STAR
+4 week incidence
+quantitative immunofluorescence
+cross-presentation of antigens and DC maturation
+genotype I and II
+12 h post-infection
+Biomphalaria
+Weekly R t
+the mutant background
+1,120
+high-speed straight migration of lung-infiltrating T cells
+rabbit anti-Influenza A Virus Nucleoprotein
+LPS and CTB
+residue 294G
+PCR primers
+Marburg virus
+Common sense
+WHO
+impaired
+enteric bacilli
+335
+parasites
+HRV infection
+disappeared from the genes they were switching off
+prostate biopsy samples
+Significant antigenic diversity
+sarcomatoid and biphasic
+hTDP-43
+70%
+detected in situ
+Pearson's correlation coefficients
+Grade 1 and 2
+TMPRSS2 expression
+AMR
+Gross pathologic
+the cognate receptor of brain-derived neurotrophic factor
+119
+enhance viral capsid expression and/or viral titers
+NGS
+evidence of T-cell exhaustion and/or senescence
+tubules
+350
+10 2 pfu
+2012-10-31
+six
+strong binding of 5S rRNA and rRNA-derived transcripts
+more than 3 weeks
+Bin Song
+cross-regional assistance
+chikungunya, dengue and West Nile
+Netherlands
+patient genetics
+salivary proteins
+chloride channel conductance
+À80 C
+10%
+another level of stringency
+membrane environments
+3D
+viral titration
+1.55
+R2, R6, and R7
+four
+enhancement of HAI surveillance activities and capacities
+Twenty
+inducible nitric oxide synthase
+twice
+discontinuous minus strand extension model
+Nikon Eclipse TE2000-U research microscope
+David H. Edgell
+AUP 1031
+Southern Africa, Eastern Africa, the Middle East and South Asia
+PAMPs
+ad hoc scripts in the R language
+DESeq2
+streptavidin-biotin-peroxidase complex method
+54
+Evaluation of an overall national response
+PRP-containing supernatants
+IFN-γ
+220
+Geographically weighted regression
+Lentiviral reporter viruses
+LysM-expressing
+48 hours
+Supernatants
+16 weeks
+carboxyfluorescein succinimidyl ester
+criminal law and public health
+100%
+pulmonary or other rare diseases
+APC activity
+elastase
+infection cases
+normal cell cycle
+Antibody of F4/80
+40 046 238
+1
+I622A
+direct contact
+Student's t test
+Incomputable clinical data
+PRJNA523863
+annual or seasonal reformulation of vaccines
+mouse cells
+Dulbecco modified Eagle medium
+Morphometric
+anti-sera to Olig2
+62.4%
+F
+4
+HIV genes
+more than 10-fold
+glycan array
+nine
+Southern blotting
+cardiomyocyte apoptosis
+MIP
+viral infections
+20%
+three
+inflammation and coagulation
+Bangladesh
+Antioxidant scavenging of free radicals
+synergistic and cross-talk effects
+15 Å
+MEDI4893*
+low-level lipid mixing
+Thimphu
+22 μg/ml
+the standard curve of the peak area and concentration
+37
+the process generating the data
+Libreville
+Ifnar -/mice
+impractical
+poultry trade
+Human cytomegalovirus
+38.3uC
+Autoimmune PAP
+protected cells P
+periods of extensive genotypic change
+K48
+intracellular compartments
+keywords
+E64d
+D'Agostino normality test
+The optimal amount of each studied tissue
+mortality
+1953
+type 1 interferon signaling pathway
+stroke, delirium and cognitive impairment
+Sialic-acid receptor expression
+occupancy density
+CSFV RNA
+alter
+three fundamental, yet simple observations
+Five of 10
+extrinsic
+Descriptive statistics and correlations
+particle deposition fraction
+4%
+1918
+Random Peptide Libraries
+hypertension and hyperglycaemia
+mice
+Decision trees
+plasmacytomas, hybridomas, CHO and BHK cells
+20.36 days
+reverse emergency call system
+Primer annealing
+10 mM NH 4 Cl
+necrosis and apoptosis
+Mann-Whitney U test
+NiV-specific total antibody levels
+Inhaled corticosteroids
+disulfide-stabilized
+10
+10-fold serial plasmid dilutions
+ERK, p38, and JNK
+Chi-square and two-tailed Fisher's exact tests
+4%
+influenza M2 protein
+53
+mild, moderate, severe, and critical
+active virus replication
+EMT
+mouse monoclonal vimentin or FLAG antibodies
+unknown mechanisms
+formal
+nationwide interventions
+a higher share of b-strands
+M2-2
+astrocytic or neuronal cell cultures
+VP1
+antiviral treatment and prophylaxis
+RV
+HPAIVs
+90 days
+pro-and antiinflammatory plasma cytokines levels
+6-8 weeks
+Genotype BA.2
+biologically active
+Paneth cells
+twice daily
+0.1 µg to 10 µg
+Tcf4, Pdca1, and Cx3cr1
+SNRca SNRt Post injection
+6
+The structure of the nesting
+GISs and visualized health data
+adolescence
+general limitations
+5.16%
+Recombinant
+Zenon Alexa Fluor
+Enzyme conjugate
+embryonic myogenesis
+IRES-dependent
+Molecular evolutionary rate and divergence times
+physical properties of mucus as a hydrogel
+epitopes on the lateral ridge and A strand of EDIII
+Glc 3 Man 9 GlcNac 2
+RNA complementary to the Leader gene
+19
+12/12
+MetaGenome Analyzer
+Braak staging
+PB1 D27N
+NanoDrop 1000
+vaccination
+48.4%
+NK cells
+R 0
+solute concentrations
+tracheal explants
+mouse anti-Flag and Cy3-labeled secondary antibodies
+Custom software
+C-reactive protein
+Group B streptococcus
+activated adhesion function of white blood cells
+binding to TLR9
+ozone
+Lesquerella fendleri
+0.7%
+Three
+Coalescent theory
+enrichment of virus particles
+low-temperature
+influenza
+5%
+genetic
+heterodimeric integrin Mac-1
+An analytical balance
+longer
+E. cava
+bats
+more reexperiencing, avoidance, and arousal symptoms
+Z-FA-FMK
+Vancomycin
+attenuated
+totivirus
+protease monitoring
+morphological changes
+high-density interval
+a trimeric molecule
+myocarditis
+to evade host immune response
+1%
+monoclonal antibody to a-tubulin
+CNGRC/PEG/PEI/DNA vector
+CXCL10
+one week
+underestimates the true value
+bone marrow suppression or teratogenicity
+Slime and capsular material
+14
+disease diagnosis
+boredom
+Vps4p
+cross-strand hydrogen bonding
+50 mL 1:10 diluted purified toxin
+NCBI Sequence Read Archive
+no swelling or other signs of inflammation
+lower risk of URI
+a web resource
+؊2/؊1 ribosomal frameshifting
+Cervia and Ravenna
+aZsKs
+nine
+persistent sub-lethal ER stress
+a network of interconnected hosts with different epidemiological roles
+1955
+dust, fumes, smoking
+cuboidal
+BC023105
+HVC studies and field studies
+lowered, but did not entirely prevent the IL-6 response
+cardiac malformation and death shortly after birth
+Humanistic care
+190
+106
+proinflammatory
+a serine protease inhibitor
+interferons, antiviral chemicals, and vaccines
+to maintain a roughly fixed rate of generation of filtered trajectories
+uncommon septal wall hyalinization
+three
+86%
+increased coal burning
+Alaska Native people and Asian/ Pacific Islanders
+90%
+10
+Isolates RV39 and RV610
+PCBP2
+amino acid sequences aligned using ClustalW2
+200-300 mg
+all investigators for the main trial
+1 day
+the effects of NS5 on the host cell cycle
+biliary glycoprotein-1
+Over 30
+Cohen's kappa coefficient
+Inactivated vaccines
+SGG-A, MJ-C, and MXJ
+viruses
+>30
+recovery
+decreased
+medians with interquartile ranges
+increased CPY secretion
+Custom scripts
+higher bocavirus prevalence
+two
+high quantum yields, and extinction coefficients
+controlling or preventing diseases
+19mer
+Manual counting with a hemocytometer
+HSV/CMV reactivation
+zones 1b and 2b
+viral replication
+β-glucuronidase
+Genome-Plex DNA and TransPlex RNA
+Category 1
+enveloped RNA viruses
+3.75 µg of HA per dose
+the numbers of the GBS isolates sequenced were small
+macaques
+increased duration of mechanical ventilation and length of hospital and ICU stay
+signaling properties and downstream cellular function
+lactobacilli
+600
+Restriction of the analysis to patients meeting the Berlin definition for ARDS
+a methyl donor
+seven
+Juniperus rigida
+4
+previous reported studies
+immunodiagnostic
+2007
+virus replication
+captured exosomes
+Asterisks or pound signs
+70
+1536
+using a response surface method
+vaccination campaigns and programmes
+6
+false positives
+type III
+45 %
+39
+2117
+MCF-7
+ATP
+high degree of risk aversion
+50%
+non-specific
+mortality, blood bacteria clearance, and cytokine response
+weighted histogram analysis method
+Orlando, Florida, Portland, Oregon and Honolulu, Hawaii
+July to November
+cleaves this polyprotein
+278
+RF model
+mucosal surfaces
+fibrinogen
+immunosuppressive drugs
+SRV-1 and baboon endogenous virus sequences
+½0,1
+19,218
+Closed-reference OTUs
+three to eight
+clinical, epidemiological and laboratorial
+30 min
+pskHBoV1 plasmid
+57.2%
+JHMV infection
+silkworm genomic locations
+increased resting energy expenditure and with reduced survival rate
+another species or genetic element
+28,000
+Band shifts
+parenteral vaccinations
+West Nile Virus transmission intensity
+complementary RNA
+GalK/kanamycin dual mutagenic cassette
+HMBS and HPRT1
+endogenous inflammatory cells
+6.7 g/kg/day
+nine days
+supernatants
+4
+on the cell surface
+over 4,000
+Four out of nine
+two
+new selectable markers
+active-site cysteine
+drop of DRM
+External stimuli
+protective against bovine as well as human RSV
+instant
+eight
+a trimeric core
+cellular replication and growth
+most of the globular N domain
+tremor, tachycardia, or arrhythmias
+KS or lymphoma
+day 10
+regulates the location of Src
+95 %
+Kernel-based metapopulation models
+below 1
+Pneumonia and other lower respiratory tract infections
+Z B,v i,j
+five
+89%
+eight
+40%
+CC10 protein
+cc-by
+Total RNA
+positive pressure mechanical ventilation
+Lipidation of Atg8 by PE
+CD4 and CD8 T cells
+1
+neuronal dysfunctioning
+bacterial
+to differentiate between type I and type III IFNs
+6 out of 11
+1.0 and 5.0 μg/ml
+Infections
+fold changes
+endosomal TLR signaling
+cell death
+Killer
+West Nile virus
+Mink enteritis virus
+RNA polymerase complex, viral RNA, nucleoprotein and nuclear export proteins
+Duchenne muscular dystrophy
+SSP C-terminal region
+susceptible-infected-recovered -like
+stress
+Five
+microglia
+improved therapies
+Two
+arrowheads
+179
+Tbf1p
+opportunistic infections
+oseltamivir
+measles
+the stem 1 hairpin
+ring vaccination together with contact tracing and isolation is likely to be successful
+40%
+one-third
+two
+220,305,266 filtered reads
+IL4 and IL4RA
+FlowJo
+99% on average
+80%
+the local Ethical Committee
+intragenic and intergenic
+LOF
+plaque reduction inhibition assay
+lentivirus-mediated siRNA
+age
+unclear
+antibody recognition of HA2
+low transplacental anti-pertussis immunoglobulin G levels
+High viral RNA levels
+Vic+Chick N1
+2.5 μl IAA
+ImageQuant
+STING
+social distancing
+Salmo trutta
+18 months
+point mutations
+Morbillivirus F GPs
+Imaris
+1 year
+ΔG RS 0
+17
+Half
+morphological and physicochemical
+bradykinin
+influenza viruses
+SinoGenoMax
+flow cytometry
+modern diagnostic and data management techniques
+a cell adhesion molecule
+5 days
+bacterial infections and accidental injuries
+FDG imaging FDG
+synaptotagmin IV
+Hepatitis B
+cc-by
+demyelination
+Epidemiological
+Spectra
+2
+formalin inactivation
+National governments
+Influenza vaccination status
+B2M and PPIA
+mutagenicity
+364
+NF-κB
+70.5%
+biased gene usage and decreased junctional diversity
+Normalized Difference Vegetation Index
+hepatitis C virus
+12% or 15%
+40 μg
+14-20%
+B. pseudomallei
+High flow oxygen therapy
+electronic medical records
+whispovirus
+5S rRNA, tRNA and miRNA
+37.9%
+six
+75%
+vesicular compartments
+cDCs displaying antigen uptake and processing capabilities
+48 h pi
+ARI rate
+lower transepithelial resistance
+µ i
+asterisks
+Acute diarrhoea
+70%
+influenza virus receptor α2,6-linked sialic acid
+50%
+Shannon entropy analysis
+reduced liver damage
+cardiomyocytes
+three
+Ru521
+Sendai virus
+recovered
+false discovery estimation
+Statistical
+charge density
+RlucCVB3
+WHO and CDC
+potential bio-markers of infectious disease
+cisplatin
+mildly hypertrophic
+novel host receptors
+30
+TNF-α
+1× non-essential amino acids solution
+5 0 -nucleotide-tagged primers
+immunization strategies employing E protein alone or subunits of E proteins
+ultra microspectrophotometer
+36
+4%
+bimodal
+8.15%
+the extent of disorder
+HySS
+infected erythrocytes
+reagent chemistry is delivered directly to the test well
+NaCl
+38
+95%
+40%
+cross-reactive
+membrane rafts
+molecular engineering
+40
+sumoylated products
+a set of nodes in which hosts reside
+Negative regulation of SFKs
+dsRNA
+immune
+non-hospitalized SARI
+pocket-binding domain
+chloral hydrate
+FNRG
+FC-ScSED1 cassette
+two-step models
+street location
+two major populations of peptides
+translation from input RNA
+normal distribution
+MegAlign
+neuroinflammation and proinflammatory cytokines
+macrophages
+equilibrium buffer
+Peroxidase-linked assay
+Ifnar1 SA animals
+335
+blood ion levels
+SB-265610
+pT7-SA-Rz plasmid
+diminishes
+diagnostic and therapeutic
+EV associated CD63
+BLAT
+Thirteen
+1807
+simplified
+a significant asymmetric trend
+VersaMax ELISA microplate reader
+Evoked
+Limiting antigen Avidity Enzyme Immuno-Assay
+38
+more than 100 times per year
+IBDV sequences
+independent dataset test, subsampling test, and jackknife test
+multiple steps of the viral life cycle
+GC7 incubation with the NP monomer
+HMGB1-A-BOX
+GeneJuice transfection reagent
+40-60%
+CD11b
+pigs
+amplification bias
+55
+sR R 0
+anaerobic respiration nitrate
+Targeting the reverse transcriptase
+Fever-CT
+Focal adhesion kinase
+RMSDs
+macropinosomes
+positive selection
+HIST1H1B
+promoting ongoing T cell activation and effector responses
+MMTV
+2763
+21 days
+3000 rpm
+increased perivascular recruitment of immune cells
+H7 cross-reactive cells
+dye absorbance
+Model 3
+increased binding avidity
+0.230 mg/ml
+350,000
+outer PCLSR primers
+MLV reverse transcriptase and random primers
+twice
+measured cell percentages with RNA-seq data
+heparinase I
+Scrambled siRNA
+sprawl
+chi-square or Fisher's exact test
+0.158 nm
+induction and in vivo cellular sources of IFN-I
+thymus-derived natural T reg cells
+Two microliters of the RT-PCR product
+JNK protein kinase
+7.8 pg/mL
+cardiorespiratory and laboratory parameters
+800
+Steroids
+tumor suppressor functions
+37
+continued risk assessment, surveillance, and vigilance
+60%
+the study of HIV release and spread
+12
+restoration of the absent dystrophin protein
+vacuolar alteration to subepidermal blisters
+electrostatic binding to nucleic acid
+Kaplan-Merier estimates
+host neutralizing antibodies
+acute and clinically signifi cant deteriorations of unidentifi able cause
+westeast
+Essential CL3 requirements and French/European standards
+224.2 kcal?mol 21
+for their newborn nutrition
+Protein ubiquitination
+ROS
+Herpesvirus saimiri
+10 thousands
+robotic manipulator
+40
+Yale University
+pairwise sequences as independent
+support vector machine and pair-wise sequence similarity
+three
+day 5
+resveratrol dry suspension
+CD4
+legal action
+EBV-mediated B-cell transformation
+overlap very closely
+50%
+1.4 years
+1.72
+tenth
+Mammal sympatry
+Bayesian relaxed clock
+10%
+Parkinson's disease
+167
+gPCs and cPCs
+all forms of life
+fixation monitoring
+Sec23a
+repressible
+weekly
+Gas trapping
+2 h
+microplate reader
+genome-wide evolution events
+archaeal genes
+flavonoids
+reduced symptoms and reduced virus shedding
+CD8+ T cells
+enrichment of eosinophils, basophils and mast cells
+all data from enrolled participants
+pertussis
+viral replication
+PCV evolution
+75%
+high in PRRSV-infected pig herds
+β-actin
+The experience of fear
+nuclear pore interacting protein family
+specific point mutations
+6-17%
+blue
+calculator
+ammonia
+eukaryotic translation elongation factor
+the general susceptible population
+no previous knowledge about distribution or models is needed
+powe rful
+five
+reversible myelosuppression, diarrhoea, nausea and vomiting
+140
+cellular and humoral
+three
+VLPs
+worse overall and recurrence-free survival
+template switching
+IFN-stimulated gene expression
+Twenty-four hours
+Truncated protease L
+HA glycosylation
+CpG and UpA dinucleotides
+a homolog of the pleiotropic regulator AbrB
+1 out of 2,430
+4
+Whenever a previous radiograph was available
+Transcriptome
+Lyme disease
+school-age children
+divided cells
+Combretastatin A4
+toltrazuril
+wire diameter of 0.51 mm
+five
+strong predictors of unfavorable outcome
+1984
+inhibiting tyrosine kinase or mitogen-activated protein kinase
+early warning systems
+amphotericin therapy
+D
+myocarditic
+6 to 8 weeks of age
+Bayesian phylogenetic
+Red deer
+interferon signaling
+time-consuming and costly purification steps
+decreasing clinical severity
+peak load reduction
+260aa
+0.43 months
+epithelial and endothelial cells
+Interaction with viral RNA
+Hsc70
+0.69
+Active and passive cigarette smoking
+PEG concentration
+forward and reverse primers
+the AME
+a midwestern child with fatal CA-MRSA sepsis
+potential scan rate and BS concentration
+knowledge acquisition bottleneck
+Y184F
+TNA
+chromatin binding of PcG proteins
+q
+absorbance at 280 nm in 6M guanidine hydrochloride
+SDS-PAGE
+close to 100%
+Exogenous cGAMP
+type II
+Compound 7e
+the second intron of AGAMOUS
+small molecules
+MQANFLW
+12
+community health workers
+B. tabaci
+omega peptides of ß-Gal
+RSV
+logarithmic width
+missense mutations
+AD
+JTT and variable rates
+S-TuD
+high ratio of seeing a doctor
+deliberate
+IL-1β
+7.59%
+three
+Linear Quantitative Profiling Method
+biomedical
+Positive or negative correlations
+40 minutes
+adverse effects on the gastrointestinal tract
+vegetables and bird eggs
+Ciprofloxacin
+experimental methods
+Zen
+amino acid composition, binary profile
+kissing dimers
+HBoV
+Animal Health Service, Deventer, The Netherlands
+176
+time lag in tracing for casual contacts
+66%
+Camel iPSCs
+quasispecies diversity
+higher total IgM and total IgG concentrations
+bornavirus infection
+Total RNA
+187,003
+stigmatisation and discrimination or material or economic harms
+Group 4 and 6
+hepatitis C
+The Web Interface
+ERK1/2 signaling
+5-10-fold
+23
+bicinchoninic acid
+PseAAC
+log
+GraphPad Prism 5
+pertussis toxin
+MDDCs
+15-30 min
+sick-days
+separately
+13%
+TNF-α
+SFTSV
+None
+positive
+multi-group SEM
+three
+rearrangement of the IgH locus
+Breast feeding
+proteins
+X-tremeGENE HP DNA transfection reagent
+56%
+Obtaining recombinant renalase protein and preparation of monoclonal antibodies
+centralized mitigation
+Q-TOF hybrid
+80%
+1960s
+safety
+to assess construct validity, reliability and acceptability
+r j
+IL-6
+late November, 2009
+gene expression changes
+HIF-1
+three
+plasma osmolality as well as blood volume and pressure
+kinetic data for GMP incorporation
+Glial fibrillary acidic protein
+biotinylated RT primers
+116
+10-45%
+GraphPad Prism
+LMP1 amino acid residues
+B cell
+Lorisidae
+Non-English articles
+GraphPad Prism
+per-protocol
+F. Fontana
+acute mesenteric ischemia
+alignments
+polymin P
+Firmicutes and Proteobacteria
+0.05
+> 80%
+Chemokines
+Protease inhibitor
+4
+Unit-length HBV linear DNA
+Lys48-linked polyubiquitylated GFP
+six
+CMV and EBV
+Algorithm 3
+5%-20%
+pi
+2000
+anterior mediastinal mass
+WNV
+chronic inflammation, respiratory infections, oxidative stress, and ART
+ANOVA
+Oxford Nanopore Technologies
+cytotolytic and/or noncytolytic mechanisms
+CARD9
+493
+Dr. Emanuel Goldman
+50%
+eight
+ACE2/ACE activity
+awk
+NADPH cytochrome P450 reductase
+VCSM13 interference-resistant helper phage
+no significant change in lung ANDV titers
+44 %
+conditions necessary for viral persistence
+splice correction-mediated up regulation of reporter gene activity
+negligent harm and non-negligent harm
+ESPLINE Influenza A&B-N and BD Directigen Flu A
+TSR models
+mir-21 and NLRP3 inflammasome
+fermentation of undigested carbohydrates by intestinal microflora
+Univariate
+localisation of active adhesion components
+PCV-2, PRRSV, PRV and SIV
+human or porcine donor trachea or bronchi
+acute respiratory distress syndrome
+1,394
+1968
+flow-limited uptake of donepezil
+50%
+Bergmann glia and Purkinje cells
+SPSS 17.0
+.4,000
+223,336
+5 EU/kg body weight/dose
+disease-free survival
+univariate analyses
+176
+21%
+Primers MA1197, MA1198, and MA1199
+IFN
+15
+six
+Facility for Biotechnology Resources of FDA/ CBER
+56
+11
+severely impaired cardiac function
+60%
+remote homology detection of proteins
+WNV replication, viremia, and peripheral spread
+public healthcare professionals
+650 nm
+70
+smaller
+genes from both North American and Eurasian swine lineages
+disease severity
+IRE1α depletion
+two
+by regulating components of their catalytic environment
+IRES activity
+sarcoendoplasmic reticulum Ca-ATPase
+not significant
+species-level identification
+efficient processing and secretion
+codons with the relative synonymous frequency <0.2
+reverse genetics
+timing and protein turnover
+Triathler TM multilabel tester
+R 0
+porcine
+CSF cell count and with CSF IgG index
+expression plasmids
+guinea pig sera against FMDV
+40-95%
+non-permissive or abortive infection
+defining the functional units of living organisms
+cc-by
+rVV-N25
+single-stranded RNA viruses
+interaction of cleaved L2 with an unknown intracellular receptor
+50%
+IgG Fc
+Ly6c and Ccr2
+SVM regression model
+two
+IL-10-expressing neutrophils
+host-receptor interactions
+mAb therapy
+one week
+pathological
+autophagy
+the sequence of native antigen
+Inclusiveness
+ρ *
+2014
+the distance of the corresponding data point from the restrain curve
+Three
+eight
+southern China
+3
+render patients asymptomatic
+1,793
+H 2 O
+methyltransferase, acetyltransferase and IL-10
+Acute kidney injury
+cells of the innate immune system
+OligoAnalyzer
+implemented the most aggressive and sustained community measures
+2020
+triangle on the 5 0 of the primer
+21 days
+m edges are formed
+Live-cell imaging
+Cochrane Risk of Bias tool
+lentogenic, mesogenic, and velogenic
+4 days
+second codon AT preference
+years old
+Kamlangdee et al
+green and orange
+Astra Zeneca Research Collection
+group 1B
+qRT-PCR
+a seasonal pattern
+stigmatisation
+prior definition of nonrecombining loci in the genome
+Allergenicity
+the sum of ordinal responses
+extraction from whole blood
+14.6 h
+the extent of an animal's range
+expansion of deleterious, nonsynonymous mutations
+France
+to maintain maximum efficiency in translation of viral gene products
+negative control
+Twentyfive
+genetic mutation
+cancer cell
+to increase section adherence to the slide
+mutation pressure
+multivalent
+280uC
+organisms
+transient CAL
+13.07 ± 2.95 days
+Supernatants
+R rs
+site-directed mutagenesis of our overexpression vectors
+making the HSES diagnosis
+a specificity index
+NTM diseases
+The respiratory database
+10 s
+vaccination history
+The chi square test
+placental Hofbauer cells
+influenza
+international recommendations on ventilation associated pneumonia prevention
+$252,851
+IFITM-mediated inhibition of IAV infection
+compound 14 to disrupt Hsp27/eIF4E interaction
+177
+pentamidine
+EBV
+patchouli alcohol
+both directly or indirectly
+1.06, 1.36 and 0.94 Å
+February 17, 2010
+CTMCs
+pancreatic
+normalizing circulating RAS activities
+NS1
+Comparison of means using student's t test
+vulnerable groups and hardto-reach populations
+paracrine factors
+DC-SIGN
+2 weeks
+Sixty-four
+18
+nsP3
+short peptides
+LOXL2
+nosocomial infection
+Macroglobulin complement related
+limitations in NGS technologies
+consensus
+IBV
+fluorescence
+standard operating procedures and guidance documents
+rat IgG
+a much larger pool of individuals
+HP and LP
+recombination-primed replication
+neutralizing antibodies
+24 hours
+15%
+ribavirin and Oseltamivir
+Figure 3A
+sCJD, ALS, and some sRPNDds
+mucosal immunity
+Cre and FLP
+Hydrophobic interactions
+chest
+Antigenic shift or mutation in the virus
+stable expression of mCLDN6 and hCD46
+biosignatures
+quantitative real-time polymerase chain reaction
+terminal gal-α-Neu5Gc
+14 days
+pET26b-CSFV-NS5B
+Salmonella Typhimurium
+Bonferroni
+Nrf2 activation
+cancer cells in the host
+ImageJ software
+Δt = 1 hour
+a meta-analysis
+Focal adhesions
+assembly sites
+a multimerization domain
+general hospital infection control policies
+searching strategies
+Twenty-two
+SREBP-1c and ACCα
+Nitric oxide
+fomites warmed to human body core temperature
+cross-reactive memory B cells
+nearly identical clustering
+Epithelial injury
+Peripheral blood
+Gaussian curvature
+gel-electrophoresis
+gp-340
+sizeable bias
+behavior concerns
+Experts' evidence
+14 days
+coefficient
+100 fg L. monocytogenes DNA template per reaction
+non-mammals
+Fomitopsis betulina
+13.4 ± 0.8 min
+a large population
+Relative adrenal insufficiency
+AP2Ls
+oranges
+EI
+M2, NP, NA, and conserved regions of HA
+π C
+Illumina sequencing adapters and barcodes
+CDRs
+AUG
+13
+promotes lipogenesis in the liver
+10%
+CuFi-8 air-liquid interphase cell cultures
+genes
+rabbit anti-PUMA antibodies
+Anemia
+population growth and movement
+MignovillardY02
+10 to 80 nm
+global OHQoL
+42
+hemorrhaging
+different concentrations /ml)
+50,000
+primer annealing mixture
+5.78-7.27 photons/s
+rebound phenomena at treatment discontinuation
+Ed395 and the deglycosylated form
+anhydrous Na 2 SO 4
+occurrence
+14 440
++886 4 22853487
+13
+combined mean/median lung inflammatory scores
+8-14
+22
+renoprotective effect nor cost-saving effect
+Oddysey Sa Infrared Imaging System
+endocrine
+321%
+27uC
+33
+the probability of drawing an edge between two arbitrary vertices
+IFN-λ
+day 7
+all of the added PEI interacts with oligo DNA probes
+Four to five
+compositional constraints under mutational pressure and natural selection
+complicated
+Streptavidin-coated magnetic beads
+proteomic
+Recombinant CypA
+RPMI-1640
+publication and dissemination of scripts, guidelines and scientific advice
+appropriately high levels of intracellular gene expression
+NA
+Env fusion activation
+ORF1p
+223
+19%
+14 continuous days
+TRAFs
+Chimera
+diagnostic sensitivity, specificity and efficiency
+Single-cycle kinetics
+audio recorders and field notes
+pathogenicity
+6.3 ± 3.7 days
+nine
+Site-directed mutagenesis and computational homology modeling
+enormous structural changes
+diabetic
+5 µg/mL
+E45 and E52
+murine macrophage cell line J774.1
+alpha-tocopherol
+inverted dT
+significant alterations in signalling pathways
+HDAC5
+23
+bl2seq program
+eleven
+bacteria, viruses, and protozoa
+animal brains
+positive for neutralizing antibody
+Respiratory epithelial
+moderated-t statistics
+integrin b3
+vesicular transfer between these compartments
+seven
+P and M2-1
+germ-line cells
+all species
+20%
+qualitative or at most semi-quantitative analysis
+Sabin I
+viruses, bacteria, fungi, and parasites
+Whether someone is choosing action for its own sake
+Annexin V-FITC and PI
+different amplification reactions
+convergent va-lidity
+mammalian myelin CNPase
+considerable differences in cellular adaptive immune parameters
+627,000
+conspiracist ideation
+protein clustering at postsynaptic sites
+Naso-pharyngeal swabs
+mAb murononab
+Seven
+Read length distributions
+Alternative forms of non-informative prior distribution
+43%
+Hsc70
+Negative-sense
+four
+Premix Ex Taq
+60 ml of 1:20 diluted sera
+human-mediated amplification of exotic milkweed
+LysoTracker Red DND-99
+panic attacks and delusions
+four
+12%
+suicide
+Mitochondrial ToxGlo Assay
+the TTX
+HDF5
+IFNλ4p179
+to accommodate the large rigid structure that is being forced on the space
+C. pipiens
+suppression
+influenza vaccines
+IL-10 and TGF-1
+NAs
+SAA
+Activation of the P2X7r
+rMVA-GFP + cells
+Peak 2
+self-efficacy and work related resilience
+two-step PCR
+Viral load
+herpes and dengue
+50%
+Information Theory
+arrows
+472 nucleotides
+ICD-9 577.0
+Luciferase expression
+limiting dilution assay
+receptivity, proximity, fragmentation, and lack of shared understanding
+8%
+GM3
+insertion and deletion probes
+NAC, trolox and PDTC
+non-specific changes
+FAPs
+a suitable correction procedure
+A neutrality plot
+nsP2 and nsP3
+substantial
+1918
+Bradford assay
+Akabane virus
+PRRSV
+the head kidney
+four
+orange, light blue, dark blue, and maroon
+neuroendocrine tumor
+Figure S11
+poly-ubiquitin chains
+immune responses
+cell shrinking, cell membrane blebbing and chromatin condensation
+MTT assay
+research, authorship, and/or publication
+planning, monitoring and evaluation tool
+cough
+mathematical models
+disease, chronic renal failure and any chronic inflammatory disease
+Purinosomes and glutamine synthetase foci
+severe infections
+pNL4-3.luc
+IAPV IGR IRES +1 frame translation
+Vanderbilt Children's Hospital
+macrophages, dendritic cells and microglia
+DMEM
+Prion diseases
+63%
+pHIV-1 NL4-3
+anti-inflammatory
+therapy with cidofovir
+increases neuronal excitability
+JF693612-23
+0.2
+Viral co-infections
+Purifying Selection
+Nidus
+mass spectrometry
+RV-induced acute diarrhea
+Michael Whitt
+fluorescence resonance energy transfer
+cytotoxic
+20.3%
+4.23 mM
+organotypic raft culture
+immunofluorescence
+National Guide for the Care and Use of Laboratory Animals
+engagement of the RNA sensor RIG-I
+Morpheus
+furamidine
+NCBI database
+Two tailed student t-test
+The procedure for the generation of these peptides
+small nucleolar RNAs and ribosomal RNAs
+Electricity
+Aβ
+alamarBlue viability assay
+cancer
+more protein abundance in T0 or 8 h versus baseline
+4.13%
+Gene therapy
+79
+pathway
+WH and AA
+RING domain
+multivariate linear regression analysis
+reducing viral load through anti-viral intervention
+Northern blot analysis
+HRV-16 nt 626-1045
+abundant numbers of antigen positive cells
+psychiatric taxonomy
+CD8 T cells
+N40
+SurveyTracker
+S1P-mediated cleavage of GP-C
+nsp1
+microglial
+digestive vacuole
+findings from the subjective perception of risk
+82
+extreme plasticity
+urban-based policies and programs
+greater protection of the target RNA against benzonase activity
+seasonal or pandemic outbreaks
+Saudi Arabia
+three
+CD 8+
+Vaccination
+NLM controlled vocabulary
+science communication
+Poland and Belgium
+eIF3f
+Mara Sullivan
+Neutrophils
+6.5 and 3
+The ability to use less pure CaO
+Mueller-Hinton broth
+antibody responses
+inflammatory
+Chikungunya
+rates of illness
+80%
+ZIKV infection
+quarantining interventions
+2010
+Innate immunity
+≈300 million doses
+0.685 to 0.909
+paths through a background physical interaction network
+targeted technical recommendations
+DNA titration curves
+U937 cells
+Stockpiling by the worried well
+one
+Cancer
+extracellular DAMPs
+four
+South Africa
+SPSS 16.0
+NETosis
+twice daily
+biomedicine
+FASTA
+v-crk sarcoma virus CT10
+preventing efficient binding to the protein complex
+specific regions of the brain
+64%
+DNA damage
+respiratory failure, sensorial disturbances, and petechiae
+rapid lateral flow test
+disulfide bonds
+differences in phagosome acidification
+>9000 J/L
+Exposure to successive drift mutants
+broadly overlapping
+warming-induced stress
+much higher
+Amino acid substitutions
+stable
+hubs
+Mint3 depletion
+Sepsis
+36-through 59-month
+interaction tests
+membrane-free
+fluorescence
+rectally
+a transient external force
+100%
+membrane-bound ribosomes
+100ng/well sRecE in TBS buffer
+taxonomy
+PTMs
+16
+10 years
+entrapped M2e-PP gradually
+Streptococcus pneumoniae
+1 × 10 −15 M
+Figure 4A
+two
+deterministic model
+co-localization with clathrin
+yellow
+20 μl
+programmed ribosomal frameshifting
+medical technical care
+WorldClim database
+superior microscopic imaging
+A nonessential viral gene
+valid values for parameters governing outbreak dynamics
+IL-10 and IL-15
+oxygen and energy
+7-9
+coverage of health topics
+Error bars of frameshifting efficiency
+Hemagglutination of erythrocytes
+cc-by
+liver-resident NK cells
+virus protection
+trophozoites
+DENV
+pro-inflammatory
+the value associated with the highest sum of sensitivity and specificity
+covalent
+3.55 years
+liver CD8+ T cells
+ISGylation
+NPs
+Twitter
+Titanium dioxide
+anti-HIV
+0Á25
+144
+two
+− 1
+5.6 per cent
+sequencing of the ITS region of rDNA
+Ribavirin
+ELISA
+neutralized SFTSV
+10-25%
+Coding sequences and the whole genome of bovine muscle proteins
+A thermal-cycler
+later peaks tend to be smaller and more variable than earlier ones
+Adhesion
+30%
+9 years
+2 d
+3-hydroxyphthalic
+DNase-like
+effective contact with the pathogen
+PEG linkers
+PMLI to PMLVIIb
+pyroptosis
+LLTTNKD to HIV gp120
+80-160 IU/mg
+concentration-dependent
+fusogenic
+TOR
+incorporated the genome
+454
+86.5%
+enhanced pathophysiology
+autoreactive B and T
+nongenomic
+host switching events
+outside the VAS
+Transmission hotspot, transmission foci
+Serum-free
+3
+longer
+Cuffquant
+neuronal cell death
+R. B. T.
+nurses and ambulance staff
+a split-plot design of independent experiments
+Th1 cells
+The radiographic score
+previously raised concerns
+3%
+three
+40%
+enteritis, pneumonia, polioencephalomyelitis and reproductive disorders
+156 CFU mL −1
+genotoxicity
+four
+high transmission in the acute stage of HIV infection
+Twenty-four hours
+Detection limit
+5 µL of eluate
+plant species, tissue types and culture conditions
+Fluorescence-activated droplet sorting
+indicators related to health, water, and sanitation
+myelitis and possibly encephalitis
+recombinant ZIKV-Env protein
+216
+2008
+10 4 RNA copies/ mL
+$15 million
+binding of AtRH5 to the RIII REN
+species are more likely to be polymorphic
+the binding of selectin P
+enriched
+vulnerable and destitute populations
+stem-loop tertiary interactions
+M9
+55% to 85%
+hydrogen
+2,000,000
+EBV
+classical SIR model
+Pneumonia and meningitis
+commensal
+T
+well-defined borderline
+Further research
+3
+4°C
+to ignore these issues
+Rotavirus vaccination
+2018
+pB12VG1 and pB3BG29
+blood supply
+B cells
+Severe cases of influenza in pregnant women
+ratios of oligo-dT:random hexamer-primed expression
+manufacturing of viral vaccines
+AhR
+Epitope mapping
+4 h
+AUF1
+high titers of virus
+Ion Ampliseq Designer
+female gender
+flow cytometric
+Department of Statistics
+Het.-heterogeneity
+0.05 mg/ml
+several nuclear receptor ligands
+3
+CTF RNA features
+bronchoalveolar lavage
+biological events follow each other sequentially
+2
+FADS
+Blood samples
+50-100 million
+15 years
+respiratory syncytial virus and parainfluenza virus
+two-thirds
+IFN
+January to September 2008
+PaDEL software
+80%
+48 hours
+Robert Tigerstedt
+the expression of a luciferase reporter gene
+through a graded series of ethanol and water
+PhosphorImager
+25%
+Transgenic mice
+10%
+Shannon entropy
+Endotoxemia
+$625
+49 h
+Mast cells
+RNA
+human immunodeficiency virus -1-associated morbidity and mortality
+Fisher method
+plasmids and bacterial arti fi cial chromosomes
+the profile of each protein sequence
+18
+0.2762 and 0.1939
+CD38
+Mitomycin C
+enveloped and nonenveloped
+PSG1 and FLAG-Fc
+three
+93-102%
+autoimmunopathies
+5%
+emergence of intronless IFNs
+neuropathy and nephropathy
+two
+higher
+hamster's sera diluted in 1% BSA
+virus neutralization
+Evaluation
+Immunological tolerance
+Mechanical ventilation
+RNA-binding proteins
+via a simple multinomial expression
+four
+initial signs and symptoms
+virus-satellite associations
+viral
+48%
+ICNARC database
+less
+Brosnihan
+as a fraction of the endpoint area occupied by cells over the baseline scratch area
+physiological temperatures
+by passing the information down the tree from the root
+Parasites
+ISGs
+24 of 28
+Paolo Freire
+5
+phenol/chloroform extraction and column filtration
+Tracing and quarantine
+lipid membrane fusion and infection with RNA viruses
+TLR
+all mediators
+CCR5D32
+4%
+bacterial-induced proteins
+weaning
+Venn diagramming functional annotation, hierarchical clustering, and pathway enrichment
+0.96
+10%
+contact diaries
+3 h
+tumor regression
+10
+tumor immunity
+negatively regulated
+13%
+greater than 4 hours
+pyridylimidazopyridine derivatives
+electric field and liquid flow rate
+Hepatitis B
+three
+swine flu
+proliferation and apoptosis
+total number of viral reads
+analyses
+lineages
+NG2 1 OP cells
+manidipine resistance
+functional gene diversity
+30 min
+the data from surveillance system j at time t
+periodic boundary conditions
+October 2009
+severe thrombocytopaenia
+detection
+formaldehyde
+67%
+Corporate managers
+respiratory tissue samples
+lymphocytes
+a single 33 mg/kg loading dose
+oneway
+DNA vaccination
+Computer software
+21
+Yersinia pestis
+0.8%
+Optimal case definitions
+Bacterial sepsis
+claudin 1 mRNA
+1 mM to 20 mM
+31
+The relationship between the biologic activity and molecular structure
+Gram-staining and observation of cell morphology
+Drug-resistant bacteria
+novel therapeutics
+alveolar
+HOCl
+A226V mutation
+IL21
+pathogen spread
+12
+a midiprep
+undetectable infection
+non-integrating, transiently expressing vectors
+SAa2-6Gal glycans
+Ang II
+between 1989 and 1993
+helical
+activating antigen-presenting cells of the innate immune system
+mutations at position taneously assigned to two distinct amino acids
+differential intracellular events
+a national GIS database
+polyvinylidene difluoride membrane
+X33 cells
+human IAV cases
+All the bases above the given threshold
+NF-kB
+RNeasy Mini Kit
+data
+Asthma or COPD
+HEV-specific PCR, sequencing and phylogenetic analysis
+meningeal
+One hundred nineteen
+PRNT
+EV71 and CV-A16
+replication of the influenza virus
+binding affinity, processivity and frameshift fidelity
+Osteonectin
+liposomes
+60%
+0.51
+95
+K562 human leukemia cells
+to assess their MLST types
+K TI :K TE ratio
+Public Health Emergency of International Concern
+The following equation
+autism, multiple sclerosis and various neurological syndromes
+Protein-templated reactions
+in biological triplicate
+Macrophages
+4--1--1-butanone
+two
+Flight traffic
+enhance the folding and assembly of down-stream target proteins
+Schlesinger group
+TPM2uf+I+G model
+logistic regression modeling
+Vietnam
+three
+MEDI8852
+1983
+a guide to 15
+14
+25%
+a consensus narrative
+limiting the extent of outbreaks and eliminating the infection
+PhysiScore
+inoculation
+transfer learning
+o5%
+renal tubular necrosis/apoptosis and inflammatory responses
+coat protein and three movement proteins
+27,534
+Rhodaminelabeled
+supernatant
+Streptococcus pneumoniae
+eleven
+changes in tropism or attenuation
+K119 ubiquitinated H2A
+very favorable
+intracranial
+CRISPs
+L-amino acid-oxidase1
+respiratory tract epithelium
+bias in capture techniques
+30min
+Magnisort human CD14 positive selection kit
+weak
+CBS
+mental reward
+accuracy
+Glucose-6-Phosphate Dehydrogenase deficiency
+27-nt Peptide-siRNA
+the best performing caller
+35,151
+Indirect ELISA assay
+PaO 2 /FIO 2
+FimA
+0.13-0.15 M
+RNA polymerase II-dependent promoters
+lnc-ISG15 and ISR2
+three
+28
+four
+86%
+Gaussian priors
+accuracy, precision, recall, G-means and Matthew's
+bicistronic mRNAs
+Mean ± SEM
+immune cells
+tobacco mosaic tobamovirus
+10-day
+Informed consents
+Timeliness and completeness
+TM-replacement
+41
+5
+limiting viral protease activity significantly hinders virus infection
+HPRT
+Clusters
+Enteric infections
+vaccines and antivirals
+mechanical pain hypersensitivity
+rotary evaporator
+mutation pressure
+2.8 million
+free hemoglobin
+3
+9102
+young people's wellbeing
+32
+TransIT-LT1
+immune response
+detailed data
+Hypersensitivity pneumonitis
+TGF-β and IL-10
+two novel nucleotides
+250,000
+variation
+27
+weeks or years
+3 out of 4
+pseudoknot
+cleavage
+early expansion of cd T cells
+Purified cDNA
+activate similar components of the JAK-STAT pathways
+heteromolecular
+nonparametric Friedman test
+linkage-specificity
+CSFV infection and proliferation
+serum samples
+yeast lifespan
+8, 121, and 392
+80%
+hemocytometer
+p38 MAPK
+#2089 and #3788
+Western blot
+ligands for multiple TLRs
+168 ± 56 and 215 ± 88
+two interrupted absorbable sutures
+Paraffin-embedded tissues
+weather changes
+1 January 2020
+1918
+IAV
+MDR-TB and low serum levels of antituberculosis drugs
+113
+24 hours
+DMSO
+a large repertoire of PRRs
+8
+DNA sequencing
+mass casualty incident
+septic shock and multiple organ failure
+an ion source, the mass analyzer, and an ion detection system
+Relative risks and weighted mean differences with 95% confidence intervals
+lymphoid and inflammatory tissue
+Sierra Leone
+18 candidate gene
+GO term
+234
+trauma, cancer, multiple comorbidities, and invasive device use
+January 21, 2020
+big data
+220
+Plasmid DNA
+5%
+Simplot
+host movement
+sequence-specific majorgroove triplex formation
+A second tRNA
+Descriptive statistics
+CapoNPV
+72 h
+qRT-PCR
+50ul packed volume of Protein G sepharose beads
+means ± SD of three independent experiments
+glycan cap and mucin-like domains
+in vitro transcription
+51.14557
+suicide prevention activities
+five
+80-83 nt
+respiratory compliance
+Thucydides
+presence of infectious virus
+IFN
+Public health surveillance and clinical surveillance
+kinetics
+environmental factors and inherited genetic predisposition
+Trigger factor chaperone tig
+TYLCMAV
+90%
+48 h
+three
+differences
+Text S1
+severe renal injury
+protein degradation
+6.3%
+drops rapidly
+39,000
+HCV modified membranes
+UUG and GUG
+The protocol
+Beyotime Institute of Biotechnology
+biological properties of cell populations
+BigDye Terminator Cycle Sequencing Kit
+they can be very efficiently transfected with plasmid DNA
+microwave selectivity heating
+loss or reduced expression of the transgenic insert
+host taxonomic classification and taxonomic rearrangements
+Raf, VEGFR, and PDGFR
+initiate innate or adaptive immunity
+intraplaque vascularization
+applications
+Chlorogenic acid
+wavelet analysis
+unmet medical needs
+73
+glycan identification or functional studies
+a lack of RNA editing activities
+10.1186/s40779-020-0233-6
+immunostaining for surface HA protein
+38-52%
+cc-by
+ribonuclease H
+Perforin
+acute myeloid leukemia
+L. monocytogenes
+death of the host
+Throat swabs
+30% to 40%
+the slippery site
+11
+367
+Total endospore concentrations
+PoS = PoA
+8
+postoperative length of stay
+de novo synthesized viral genomic DNA
+Partek analysis of variance tools
+PaLoc genes
+13
+identical viral sequences
+Five to 10 mL
+sCMV-fluc
+codon CUG
+hemodynamic changes
+networks
+hybrid-type N-glycans
+over 2000
+mAb targets
+12
+nasal epithelium
+gene silencing
+seed lysates
+mAbs 40G1 and 2D8
+three
+HK
+Four
+1462
+d
+Translational sciences
+inferior resolution
+NMA
+HA
+37
+30
+Idiopathic pulmonary fibrosis
+secretory membrane transport
+6%
+C to B
+MAPK
+0.9
+CXCL16
+12.5 µg/mL
+TMA
+A1
+C429
+10,000
+mDC cells
+Eight
+cellulose synthase
+airflow
+multiple existing gene and protein annotations
+Schistosomiasis
+elevated ground-state fluorescence
+developing, skilled and expert
+Pentobarbital-Natrium
+composition vector
+immunoreactive cells
+pneumonia
+78%
+sequence evolutionary patterns
+12,470
+9.4 days
+ACT and TUBB
+Supernatant
+putrescine and urea
+ssDNA
+tissue-drift
+virus titer
+non-evaporating collection media
+bronchiecstasis
+agents
+immunogenicity of NS1-truncated LAIV candidates
+β-actin gene
+2009-2010
+relative values
+450 mg
+tens of thousands
+to prevent bleeding after transplantation
+a dedicated group
+consensus shuffling and coincidence filtering protocols
+tRNA adaptation indexes
+Acetylation
+how much the terms of different genetic variants are overlapping
+5.42 ± 0.11 log CFU/g
+GPS
+PPMO
+antiviral
+ammonium sulfate precipitation and column chromatography
+World Health Organization
+HIV-1
+Sex
+Relatively little
+20 U/ml recombinant human IL-2
+intracardiac puncture
+autoimmunity
+significant sequence similarity
+AMD
+RDP4 Beta 4.97
+immunology and microbiology
+competing
+activating and maintaining TRegs
+H7 protein
+ER stress
+changes in 25S rRNA structure
+B and T cellular responses
+strand β4
+American Type Culture Collection
+changes in trading and commercial policies
+1.2 Â 10 6 /mol
+histological
+ERK activation
+multivariable models
+30 min
+pertussis and syphilis
+30%-purified or gradient-purified bacteria
+14%
+entry by filoviruses
+when they find a uni-
+DNA extraction kit
+SMS and FE
+sinus tachycardia with non-specific ST-T wave changes
+monocyte polarization
+distribution of these investigational products and education on their proper use
+Vitek2 compact
+lower viral loads
+translocates from the nucleus to the cytoplasm of the cell
+translation elongation factors
+M
+10%
+Motif E
+EMCV
+molecular mimicry
+α-2,6 linkage
+consumption coagulopathies
+H9N2-subtype
+fibronectin
+3.1 and 1.2 years
+to prevent or mimic phosphorylation
+L, C, and G
+Imaris
+TU212 and HEP-2
+α-PfSRA P3
+anti-inflammatory
+Runx2
+low-power micropumps
+XKB may be a promising agent for lowering of blood lipids
+Glycyrrhizin
+medium or water
+δ 13 C
+Hp
+lethal infection with influenza virus
+Phosphorylation of STAT1 and STAT2
+Analysis of HCV intrahost genetic variation
+14 to 17 kb
+innate immune defenses
+absolute quantification
+respiratory viruses and some bacteria
+estimation error
+the ts and ca phenotype
+25%
+DENV
+amphiregulin
+150 mM to 1M NaCl
+6 hours
+severe complications and even death
+I O based on justified initial infected population fraction
+19
+16
+SIVmac239
+OVA-HEL
+Tertiary interactions between underlined residues
+people are sufficiently aware of the infection to change their behaviour
+continuous medical education
+knockdown of IFITM3
+ISFVs
+PV-infected WT cells
+4.9%
+inhibits EV71 replication
+RPE-1 cells
+endoplasmic reticulum stress
+seven
+Student's
+DU156WT
+viral infection inhibition
+fixed length feature vectors
+Western blotting
+WGASA
+cytoplasmic
+30 sec
+Codon usage bias
+Twenty
+25%
+diseased lungs
+PF-C cells
+DIZE
+southwestern Minnesota and eastern South Dakota
+influenza nucleoprotein antigen positive cells
+immunohistochemical
+TBD
+Table 2
+COVID-19
+θ
+GAPDH
+Whole blood
+R55
+≥60 days
+ISGF3
+18
+proteasome
+nutrition
+Alcohol
+Isolated monocytes and macrophages
+WP disease signs
+a density of infected individuals
+89
+Sauls
+a remarkable overlap
+25 mM NaCl
+65uC
+random, thin collagen fibers with blood vessels
+viral replication
+WHO
+80S
+active during the period
+2004
+12
+fluorescent microscope or confocal microscope
+her parents
+week 3
+Takeda Science Foundation
+FASTA format sequences
+spinal muscular atrophy
+5
+47
+the large train
+breast cancer
+three
+6.1 AE 0.2%
+pyrimidopyridazine scaffold
+54.6%
+how the test statistic is considerably affected
+89 days
+Enrolment, follow-up and clinical event data
+herbicide tolerance
+seven
+0 to 1
+4-10%
+Tyr402
+Systemic immune system dysregulation
+11
+Functions of glycosylation
+BMCMC methods
+elemental
+Ligand binding
+statistical
+between 28 days to 12 years
+Hepatitis C virus infection
+Scavenging of oxidative stress
+43S PIC
+GBF1
+a meta-analysis
+light blue
+mineralocorticoid
+greater stability
+DP96R
+Dengue
+therapeutic
+several orders of magnitude
+privacy
+over 5000
+bronchoconstriction
+Helicobacter pylori
+ClustalX
+0.24 s −1
+DCs
+RNA transcripts
+lyses the infected tumor
+text mining
+gene transfer studies
+hybridization prediction algorithms
+30 of 47
+eosinophil cationic protein
+cascade invasive reaction and gold nanoparticle hybridization
+Statistical
+OsSGT1
+0.5%
+they are based on a relatively limited number of viruses
+35%
+cough and fever
+6.2%
+simplistic models
+Forty-nine
+One hundred and ninety-nine
+prospective controlled clinical trials
+viral fusion
+Collect and share experiences of Arctic stakeholders
+five
+11
+decreases
+30
+Limited T-dependent recognition
+completely degraded
+CDH UK
+Image J software version 1.48
+50%
+Alkhurma virus
+no cases will ever leave the source city
+prime-boost regimen
+random values
+hypoxia-regulated targets
+enrichment
+A supporting workflow
+12
+Two to four
+24
+gathering the data, designing the article, and discussing and editing the manuscript
+nonspecific
+Translation
+Model 6230B time-of-flight mass spectrometer
+RNA extraction
+All three segments encoding the different reporter genes
+infection models
+1943
+pluripotent
+40%
+Descriptive statistics
+SEC14L2
+development of left ventricular dysfunction
+outcomes
+ER proteins
+different stimulation of the immune system
+CD33
+1
+2H5 and m1Q
+28.39 μM
+2,321
+waning immunity
+eIF2 signaling
+GlcNAc
+correlation between some variables
+2 terabytes
+10% serum
+written protocols
+cell spreading
+Cytation 5 fluorescent
+leptospirosis
+MRSA 63718
+shape, size, number, composition, and disassembly process
+DNA
+antiviral Treatment T and Hospitalization H
+viperin
+C
+15 min
+24 h
+human VH domains
+multivariate
+absorbance
+928
+Blue
+nuclear factor of activated T cells
+9%
+Particle size and count data
+X_XXY_YYZ
+authorized users
+donor cells
+genetic relatedness
+nonstructural proteins 1 and 2 of human respiratory syncytial virus
+hidden Markov model
+ANOVA
+Angiogenesis
+31%
+Pregnant staff
+Triton X-100
+permutation tests and CV-ANOVA
+measureable loss of activated donor CD4 T cells
+65-69 years
+6
+Anionic lipids
+ADP-ribosylation
+20%
+43.6%
+repeating 7-day's CPI data
+cystine loop FP motif
+good disinfection of the floor
+45 min
+Pasteur Institute
+a significant decrease in binding activity
+Dectin-2 promotor
+RNA structure probing experiments
+no clinical signs or viraemia
+5
+a study that explored the attitudes and knowledge about NMC
+NSC-34 cells
+Decreases in B-ALP
+SUMO-1
+degree of an infected population
+2%
+geNorm
+Extrinsic
+power law dispersal model
+maximum-likelihood estimation
+Ginsenoside Rb1
+viral RNA
+sends electromagnetic backpropagated signals to the mobile phone carried with the person
+scanning electron
+40
+96-well plates
+HIV-1 Gag
+predictive modelling
+ability of influenza to spread by airborne transmission
+Cell Counting Kit-8
+ten
+invasion of vascular endothelial cells
+BS-RNase
+Alveolitis at BAL examination
+specificity and sensitivity levels around 70%
+innate
+~two-fold
+perfusion
+four
+higher RT efficiency and its greater stimulatory effect
+milrinone
+R 0
+40-50%
+DNA binding and transcriptional regulation
+Fasting times
+gene functional class
+expensive electrophoresis equipment and gel imaging systems
+kappa statistic
+9 August to 7 October 2014
+common ancestry
+The polymerase protein family
+Salicylaldehyde
+galT
+make metadata more easily findable
+blood
+Fcc receptors binding
+multimembrane spanning proteins
+80%
+World Health Organization
+6
+41
+RNA levels
+primary transmission vectors
+rats
+60%
+Relevance scores
+Development of an ethical and decision-making framework
+serum
+cAMP
+MoTra Prim and MoSp Prim cells
+normal distributions
+tick flaviviral infection
+equal to
+35%
+trait expression post cell entry
+alkylated hydrocarbons
+4.1
+48.26%
+92%
+proximity to
+classical expectations
+DENV-1
+MTT analysis
+27.3%
+fluorescence
+probable PTB
+5 min
+MAPKs activation
+two well-supported breakpoints
+RT-qPCR
+170
+The interaction of PrP C to PrP Sc
+twice as fast
+Georgia
+cytotoxicity
+256
+basic hygiene practices
+over 70
+A549 cells
+hemorrhagic stroke
+cell apoptosis
+OVA
+March 11, 2020
+serial 10-fold synthetic mimics dilutions
+MUSCLE
+Five
+reporting of patient data
+Negative and positive air pressure
+healthy
+IFN-γ
+Influenza Endpoint Case Report Form
+the ability for sorting target droplets simultaneous and continuously in real-time
+biofuels research and bioremediation
+buffer P0
+ROC curves
+survival and virulence genes
+22%
+Site-directed mutagenesis
+Antigen experienced
+absorbance
+10 min
+early intervention, education and rehabilitation
+1.1 weeks
+improvement of antibiotherapy delivery
+TQLV/TELV
+80.96%
+Sigma-Aldrich
+Monocytes
+four
+titer
+hemagglutinin and neuraminidase
+>25%
+2.5 μl of Mg acetate
+A portal-specific alteration
+prokaryotic
+100%
+low incidence in the other viruses
+RanBP5
+Beta-actin
+coinfection
+peptides of length L = motif length+2 * flank length
+phosphorylation and ubiquitination
+885
+1992
+secondary prevention
+RRAGD
+1.5%
+Mann Whitney test
+two
+improvement in sequencing technologies
+to minimize analytical differences
+~2-, 4-and 5-fold
+Random numbers
+44
+33
+R82
+loss of potency
+Alkyne functionalized acrylate and acrylamide
+CaMKKβ
+a member of the team
+selection
+TBSV RNA accumulation
+6-12 h
+Shikimic acid
+Myocardial hypertrophy
+removal increased the R-factor
+1900
+influenza
+Daniel Macharia
+loss of endothelial barrier integrity
+Clinical diagnostic assays targeted to nucleic acid markers
+an up-regulation of the target genes
+24 hours
+RTA secondary structure
+renal pathology
+48 h
+AAT proteolysis
+to evade the antiviral effects of the R99 peptide fusion inhibitor
+Flow cytometric analysis
+10 days
+Genome resequencing
+Total PEDV RNA
+ion conduction
+30 min
+endosomal membrane
+260
+High drug-toxicity and emergence of drug-resistant candida species
+apoptosis and autophagy
+one hour
+p53
+residual interaction with ACBD3
+an adjuvant
+4.32 ¥ 10 4 genome copies per microlitre
+GraphPad Prism software
+decreased
+Ceacam1
+COST Action on FAP
+Usurping ESCRT components
+fast-track management
+CFTR RT-PCR product
+Scorpions
+Primer3
+neutrophil
+causative pathogen
+Vps3/8 knockdown
+neural retina leucine zipper
+pandemic
+Ayurvedic and Unani
+dysfunctional
+mortality
+neutrophil dysfunction
+Tetherin
+white colonies
+combined intervention strategies controlling infection, inflammation, and necrosis
+Pleural effusion
+4%
+trafficking of the entire glycoprotein complex
+the tibia
+lung-resident NK and possibly NKT cells
+APMV-4 cDNA
+SP24
+serum IFN-α levels
+time-lag
+nearly similar intensity
+17
+N-terminal tag
+a major peak
+R
+E1, E2, and E3 enzymes
+20%
+airway epithelial injury
+measures of target protein expression
+equally strong T cell responses
+1 day
+White Leghorns
+upregulation of the UPR pathway within the ER
+conformational change
+febrile convulsion or seizure
+modified homozygosity values
+Tunicamycin
+Different proportions
+trachea, lungs, spleen, and brain
+Carbamidomethylation of cysteine
+myelin basic protein
+contact reduction measures and the isolation of cases
+TMEV-IDD and shamtreated mice
+modularity
+360.5
+Dr. Lonny Levin and Dr. Jochen Buck
+1,394
+artificial neural networks, and statistical models such as Hidden Markov
+11 days
+they possess strong homologies within a wide spectrum of organisms
+viral patterns
+7%
+2001
+four
+102
+abzymes
+120,000
+rank correlation coefficients
+10%
+synovial
+new accurate experimental approaches
+276
+Dr. Ralph Reisfeld
+technological limitations in molecular modeling and phenotypic assays
+infectious cell death
+functional and morphological
+China
+oxytocin
+woundhealing
+HAV
+generalized weakness so that the patient is unable walk or sit up without assistance
+exponentially distributed
+6 years 7 months
+cytoplasmic proteins
+species-specific miRNAs
+three
+CCL5 mRNA
+species analysis model
+tetraloop
+Increased IL-1β secretion
+rare
+0.25
+Transient airflow limitation
+counts
+41.6%
+Viable titers of H5N1 influenza virus
+immunohistochemistry
+cholinergic
+mRNAs
+R 0 estimates generated from initial growth rates
+strong
+1991
+95%
+CNS infiltration by peripheral innate immune cells
+CTA1
+protein stability
+Luminescence
+3
+how central a given node is in the network
+nine
+GP CL -NPC1 binding
+xanthine oxidase
+sLTF
+viral pseudotyping with a foreign glycoprotein
+physical trauma
+variability of three technical replicates within a single nAb experiment
+S1PR1 signaling
+thrombin and FXa
+pKa i A
+70%
+mannose binding receptors
+4 -PMO
+4%
+Cell surface levels of HG-CD147
+80 µl of the detection antibody cocktail
+22
+direct batto-human and human-to-human spread
+an organ donor
+The significance of differences among four groups
+10%
+250
+Rab5 positive macropinosomes
+hepatitis C
+8 to 10%
+cystatin F
+BHI broth
+cytochrome c
+RT-qPCR
+GP
+12 days
+Web Appendix 1
+the RNA template
+the AUC
+50%
+exogenous Tat injections
+DAPI
+target genes
+liquefaction and cavitation of the granuloma
+Id2
+Korea
+305
+DHHC protein
+other countries
+war-related displacements
+striatial functioning and the pathophysiology of Huntington's disease
+MicroBCA Protein Assay Kit
+single cell genomics
+Uganda
+Twenty-five
+three
+390 million
+genomes of LPAIV, EDSV, and NDV
+bone bank administrator and the responsible orthopaedic surgeon
+1.26
+75
+Google Maps
+lysis temperature
+G ik
+110
+CXCL9/10/16 ELISA Serum and BAL
+monodisperse lipoplexes
+10%
+XOD mRNA transcript
+mean C t values
+digital LAMP assays
+necropsy
+1 h
+cytoplasm
+Virus titers
+£2.6 billion
+strong in vitro expression of both antigens
+eleven
+Dulbecco's minimum essential medium
+70%
+scientific misinformation
+DCs
+16
+species-specific secondary antibody
+hypoglycosylation patterns
+ether
+14,786
+Results for the full study set
+annual mean temperature and annual precipitation
+30 minute
+ClustalW2
+MMTV
+Sigma-Aldrich
+Strong purifying selection
+WT1D
+local events
+a robust and distinctive immune response
+positive spatial autocorrelation
+P E
+74%
+phylogeny
+IP-10
+25%
+RLUC reporter vector pRL-TK
+HS-GC tandem MS
+Chi-squared test and Fisher's exact test
+a chemical that can be used to synthesize plastics, rubber or fuels
+prior MERS-CoV infection
+wild type genotypes
+mice, guinea pigs, hamsters, and non-human primates
+60 ng/μL
+30 min
+markedly enhanced PR-mediated Gag cleavage efficiency
+cytokine induction
+Forty-six
+5 min
+AML blasts
+niche similarity
+IL-6
+higher
+Nglycosylation of G N
+ecological niche theory
+one sample t tests
+human vaccine vectors for human pathogens
+natural
+The presence of any positive signal
+P2-Ser, P5-Asn and P9-Met
+HIV/AIDS
+Dithiothreitol
+1995
+RNA concentration and specific dye activity
+SAEs
+viral extinction
+thymidine kinase
+Individual gaps and lapses
+97%
+local
+APN
+assessing the importance of mask use in respiratory disease transmission
+attenuated replication and foot swelling
+post-translational protein modifications and interactions
+1% Triton X100
+Further efforts
+Mitochondrial DNA
+1.8-2.1
+80 PFU/brain
+quarantine-induced backward bifurcation
+protect against Ebola virus infection
+6.8
+Two
+Influenza associated accidental mortality risks
+conserved
+NF-κB
+formalin and UV
+mnm 5 U and Q modifications
+Yu and colleagues
+dsRNA thoracic inoculation
+three
+MHC class II-restricted
+Signals
+CD8 + memory cells
+Julian Gordon and Prasanthi Gandhi
+to describe in detail the contacts between individuals in a healthcare setting
+91
+bioactive agents
+The site of attachment of BAF to the ATPase
+pathological
+Six
+cardiovascular disease, carcinogenesis, and immune system diseases
+granulocytes
+HA
+visual cues
+40%
+HSGPs
+induced and constitutive immune assumptions
+3
+M1 macrophages
+one specific antibody per target protein/peptide
+monoacylates
+oval
+b P for Egger 9 s test
+novel
+-actin
+3.1 kcal/g
+both sensory and motor nerves were injured
+343
+Biodistribution of the vaccine
+S. aureus
+prolong transgene persistence and transcription
+21-nt Peptide-siRNA
+co-receptors
+measurement of kidney function, lipids, and troponin
+NN theory
+bullet-shaped
+Twostep qPCR
+PRJNA420089
+1 ml of media
+Peroxidase
+Two
+20%
+4 times biweekly
+CIp-P TET -GTW
+DCL-2 protein
+80
+RF prob
+2%
+IFN-γ, IL-4, and IL-10
+90 °C
+public clonotypes
+87
+none
+1000
+clinical signs consistent with FeLV or FIV
+AOX1
+male transmission model
+lipid
+RT-PCR
+1486
+100 ng
+survey
+Plasma
+optimal stability and activity
+a line for generating the profile map
+13-17h
+six
+426
+34
+IMPDH
+VSV*M q
+Completely overlapping sense and antisense DNA oligomers
+every other day
+Supernatants
+Chinese hamster ovary cells
+None
+glycoprotein cleavage
+endo H and PNGaseF
+16 classical HA and 9 classical NA subtypes
+AF induction
+Ago2 protein
+after birth
+0.05
+liposomal amphotericin B
+barotrauma or negative hemodynamic effects
+phosphorylation state
+TBSV repRNA replication
+p
+between nucleotide positions 140 and 434
+W86 and D89
+61
+JM
+the amount of amplified target DNA
+Five
+16S rRNA
+TANK-binding kinase 1
+induction in response to VacA
+cellular debris
+pHLsec vector
+resistant to virus infection
+NanoLuc-E6 fusion protein
+1%
+200-fold
+Kupffer cells
+White precipitate of magnesium pyrophosphate
+Minimum Essential Medium
+atypical
+advanced wavelet-based transforms
+AAP
+liver, thymus, spleen or lymph nodes
+M2e
+293T triple transfection of pCMV1MLVGP1
+morphine dependent rats
+>70 million
+proteins
+respiratory diseases
+108 months
+decreased antiviral activity
+Merck India Ltd
+glycerol
+bacterial
+immunogenic
+7.8-500 pg/mL
+distinct/genetic alterations in large regions of human genome
+simultaneous and successive mini-epidemics
+heritability
+miR-29b
+1.69 × 10 −3 substitutions/site/year
+headaches, vomitings, cerebellar signs, and seizures
+3,3′ -diaminobenzidine
+Eighteen
+Stigma against seeking help for suicide
+Twenty-eight
+Epitope A
+Macenta
+Wild-derived inbred strains
+synergy, no interaction and antagonism
+CedPV-specific sequences obtained from the high throughput sequencing
+sibling and UCB donor sources
+ISG-encoding lentiviral vectors
+by following normal national procedures
+homogeneous colors
+zero
+the impact of error
+Histamine
+PolyI:C
+CHIKV and H. sapiens
+Ͼ25%
+5 1
+phlebovirus entry
+homeostatic
+primate only, mammal only, and fish only
+28 April
+piglets
+extensive hemorrhage and nodule formation
+immunolabeling fixed cells
+SF370
+2 times
+post-second wave
+Formation of the first two canonical base pairs
+1 hour
+SARS-CoV
+SOD2
+17.2%
+microtubule-associated proteins
+A MOI of 0.4
+2020-02-05
+2 kb
+wortmannin and 3-methyladenine
+digitizable therapeutics and local synthesis
+six
+MEGA
+Bombali virus
+controlled in vivo human infections
+disappear
+HEV RNA
+hepatitis B
+case definitions, facility types, and eligibility determination
+Asymptotic decline
+antiviral
+viral titers
+chito-oligosaccharides
+treatment groups
+ANOVA
+Knowledge
+end-point titration in MDCK cells
+pFcRn mRNA
+China
+protection from heroin addiction
+10% FBS
+embryonated hens' eggs
+group 1
+Q B i,j
+cc-by
+Herpes simplex virus type 1
+Vital registration data
+by spinfection
+tissue protein analysis
+at acceptance events
+measurement refinement
+HCV-infection and Atg-proteins
+singletons
+Interstitial cystitis and irritable bowel syndrome
+VIDISCA-454
+VgrG
+EV exchanges in the 5 1 UTR
+intracranial
+ibuprofen
+confidence intervals
+diphtheria
+34
+RSA59 and RSMHV2
+rhIFITM3
+Over 60%
+Data in panels A, B, and G to J
+16 days
+74-100%
+strong antibody response
+transactivates the EGFR
+nano-size
+two
+10%
+838
+pandemic influenza planning decisions
+lymph nodes
+kidney injury molecule-1
+high α-helicity content
+Coreceptor usage
+2016
+HCMV
+viral propagation
+S. Typhimurium
+6-8 week old
+mCLDN6 or DisOva
+V HH s of cameloide heavy chain antibodies and single domain antibodies
+herbal group
+degradation properties
+react with bacterial surface antigens
+A genomic inversion
+heterozygosity
+20,000
+laboratory procedures employed in viral culture and RT-PCR testing
+6.4%
+LC-MS/MS
+KSHV
+Traditional Chinese Medicine
+C 16 -palmitic acid
+GA2
+September to November
+repetitive sequences
+DENV
+multiplex family level primers
+hydrogen bond
+β-actin
+odds ratios
+nine
+Pediatric Dengue Cohort Study
+home and work communities
+limit virus spread
+apoptosis
+Figure 8
+The total number of hospitalization days
+10.1186/1471-2334-11-128
+~40%
+11,399
+another direction
+adeno, squamous and small cell carcinomas
+Crude protein extracts
+Dr. Sulaiman Daud
+5
+MacroGenics and Zai Lab
+I=log
+the potential of the H5N1 virus to disseminate systemically
+Four
+Phylogenetic
+Viral Spectrum Assembler
+0.64
+antigenic drift
+autophagosome
+90-day all-cause mortality
+Hair
+fibrosis of the lung, allergic asthma, and COPD
+from days to several weeks
+Virus titration
+cell signalling
+cystic fibrosis
+apoptosis
+λ
+Length of hospital stay
+Subversion
+significant down-regulation
+13
+Pichia pastoris
+r~1:31
+Two sgRNA sequences
+50%
+1.1%
+92%
+Nineteen
+12
+100
+Significance Analysis of Microarrays
+Thirteen
+four
+disease prevention and control
+mortality
+RT of a UGA codon
+pyogenic bronchopneumonia
+Staff shortages and staff motivation
+C-terminal dependent cytoplasmic interactions
+Olympus CellR
+axonal transport
+0.41-0.60
+pathways associated with antigen processing and presentation
+30%
+S. aureus
+naked DNA
+uncontrolled cell death or abnormal gene expression
+Near infrared spectrometry
+health services
+MEME
+2 days
+antigenic drift
+10 times the mean standard deviation of the background fluorescence level
+12
+viral transmission
+134 and 135
+Expedited
+3 days
+viruses
+60 to 70%
+secures efficient viral translation
+Disaggregation of heat shock-induced SINT-speckles
+six
+NCBI Primer BLAST program
+the last figure
+BLASTN and BLASTP
+George Eliot
+NF-κB upregulation
+growth cues
+Figure S5A
+two
+circumsporozoite
+GFP-3035B
+WHO
+eEF1A
+Homotype-independent antibody
+inverted repeats
+acute and chronic
+10
+17
+30%
+5.12 and 4.39 log10 EID50
+fast clinical improvement and improvement of most laboratory abnormalities
+2009
+S2, S1, and S1 0 Ubbinding pockets
+Cellular pathogen recognition receptors
+vehicle or dexamethasone
+Nuc
+Montevideo, Uruguay
+two
+Gene-specific primers
+GM130 and Golgin 45
+nuclease activities
+ORF5
+IFN induction
+35,114
+Fifty-five
+5 µM
+−1 frameshift
+human antibody B cell repertoire
+sophisticated
+2008
+24 h
+k
+200μl
+334
+rs368234815
+578
+10 °C per min
+Bile acids and Farnesoid X Receptor agonists
+21RR22, 25RRK27, and 31RR32
+Creative Commons Attribution Noncommercial License
+The one spot that differed consistently between three independent experiments
+mMASS
+IFN-α
+eIF2B
+induce humoral responses
+MERS-CoV polymerase chain reaction test kits
+mice
+months
+DNA extraction
+491
+Protein folding
+mean ± SE
+competition between unwanted proteins for plastic binding spots
+sex and age
+15 min
+harm
+Peptide Ac2-26
+neighbourhood contact hubs
+being out of the ideal therapeutic window
+close interaction with computer sciences
+Predictive accuracy of MFE folding
+HLA-DQ/DR
+1393
+Stable expression of exogenous genes
+75%
+10.8 weeks
+polyubiquitination and subsequent proteasome-mediated degradation
+MEGA 7
+178
+173
+A/T bias
+2213 Dalton +
+62 years
+stockpiling of pharmaceutical agents
+Acute respiratory distress syndrome
+POCT-enabled spatial grids
+arthropod taxa
+FIV-infected
+PARG
+exogenous ALV infection
+P2 receptor antagonists
+IAP retrotransposition
+5%
+growth on selective medium
+Serological testing and removal of infected animals
+three
+Escherichia coli DH5α
+Chickens
+microglial
+Ventilator-associated pneumonia
+Pre-senescent astrocytes
+loss aversion
+75:25
+15
+25 copies/ g
+bootstrap value of 70%
+IFN-λ
+low GC%
+11
+MNV-1 replication
+Experiences of natural disaster, war and civil conflict
+2089
+1860s
+immune components in host cells
+α-defensin 5
+antiviral immunity
+movement networks and contact tracing networks
+>2-fold
+5 days
+cost effectiveness and safety issues
+Bleomycin
+Y34S
+frameshifting ef®ciency
+V2
+Influenza A virus WSN33
+N at 701
+Thirty-five
+any medically important laboratory abnormality
+PI cattle
+May 27, 2001
+morbid obesity
+titanium
+Macrogen Korea
+Finland
+11
+fluorescence
+100 ll of the culture medium
+relaxed sequence specificity
+CD38/CADPR/Ca 2+
+Seven
+PLEX-ID/Flu assay
+TDP-43 and FUS and SGs
+that of the WT virus
+wildtype
+Sanger sequencing protocol
+Luria Bertani
+VSV-G
+40 min
+p24
+S i
+rabbit polyclonal anti-NP antibody
+argon
+FMDV
+spontaneous DNA damage
+impairment of virus assembly and/or spread
+Integration and coordination of surveillance systems
+viral contamination
+mouse or human antisera
+physiology and metabolic rate
+90%
+Running water
+pairwise comparisons
+lipopolysaccharide
+14
+C-terminal
+bacterial proteins
+3 of 4
+MatrixMatchMaker v2
+vector-borne zoonotic diseases
+dye
+the impact
+Blood Service protocols
+cross-matching
+low levels of AR
+bats
+serum free DMEM media
+sepsis
+cold months
+PCT
+Detailed
+100 mm
+experimental error or interferences
+cross-species transmission
+the local/distal status of the QTL
+single nucleotide polymorphisms
+minimal
+host genetic factors
+930
+weakly acidic condition
+5%
+The diagnosis of influenza
+agarose gel
+53%
+its web link
+calculation of supplemental oxygen-free days per definition 2
+139
+PrimeScript RT reagent Kit
+by clicking at their names
+enormous variation among strains
+geminin
+Indonesia
+48 hours
+pH1N1
+a contact matrix
+type-II
+the average number of secondary cases infected by a single primary case
+less than 10 variant sites per kb
+chronic myelogenous leukemia
+greater transmission heterogeneity
+December 1, 2009
+Standard multiplex PCR
+influenza infection
+it is known to be one of the metabolites produced by the metabolism of oxygen
+medium
+the TSC
+Virus titer
+turnover rate
+blood gas changes
+mediates several-fold enhanced transfection
+Vaccines and antivirals
+1.5 million
+19
+mean with SEM
+2009
+60
+IFITM5
+Puromycin
+Transcriptomic
+challenge
+80%
+ferrets and non-human primates
+whether observed differences among results are compatible with chance alone
+decreased growth rates
+PyMol software
+Coulombic potential
+rank-sum tests and Fisher's Exact tests
+six1a
+10%
+toxicity
+62%
+DENV-faRexpressing cells
+formation of G-quadruplex
+XPR1
+two to three weeks
+24 hours
+South America
+Pichia pastoris
+1444
+Galangin
+ROS production
+pulmonary fibrosis
+electricity-free
+five
+I49, S29, S31, and S58
+Uganda and Nigeria
+different types and subtypes
+Equation
+T cells
+seven
+David Held
+low
+enhanced chemiluminescence ECL detection kit
+intervention at the root cause
+quenching procedures
+Staphylococcus aureus
+bnAbs
+fruit bats
+minimize side effects to normal cells
+Xbp1 regulated genes
+Human B cell hybridomas
+58
+reaction speed
+Bartels
+increased vaccinations
+short-tandem repeat analysis
+Rarefaction
+nsP3
+limited access to the materials
+The conformation of the ribosome
+infectious agents
+speciesspecific
+absolute humidity
+8-fold
+2009_4556
+clinical diagnostic uncertainty or error
+3/100py
+exposure or treatment with glucocorticoids
+PBS solution
+50-85% growth inhibition
+8
+neurons, immune memory populations, and long-lived plasma cells
+posttranslational processing
+increased transmission
+central nervous system
+A 5¢ common leader sequence of 65±221 nucleotides
+special considerations
+18000 to 19000
+90%
+geometric mean
+24 h
+ranks of data
+they all combine a diurnal with a nocturnal pollinator
+Population density
+Phosphorylation of STAT2
+previous relevant reports and experiences in day-to-day clinical practice
+less than 1
+frameshifting promoting signals
+The logarithm transformation
+normalized RNA samples
+an underestimation of the recombination rate
+cellular arm
+MPG
+R 0,N = √ 6
+Hayflick limit
+druginduced NP aggregation in cytosol
+pseudotyped viruses
+comorbid conditions
+Ethyl acetate fraction of the H. cordata extract
+20.9%
+HIV-1 gag-pol mRNA
+Pathogen spillover
+stratification
+functional
+confocal laser microscopy
+C 36 H 24
+lung morphology
+airway epithelium
+IL-21
+3 h
+proteasome-associated isopeptidase activity
+frog
+Area CA3
+jet injection or particle injection routes
+all of its neighbors becomes infected
+drugs
+BoHV-4
+extended backcalculation
+serum
+P. pastoris cell pellets
+confocal microscopy
+GIDEON
+CESAR
+Na +
+binding affinity to H1
+chelates potassium ions
+GPC shedding
+0.017
+pro-inflammatory and anti-inflammatory cytokines
+PROTEINTECH
+within the normal ranges
+Gene expression
+three
+2011
+vimentin
+liver stiffness level and extent of liver injury
+96.7%
+IgA responses
+d V
+ferret model
+a PL that is missing an acyl chain
+68%
+protection against EBOV
+nitric oxide
+complications and transmission of the disease
+surveillance of selected infectious disease agents
+KC411776-KC411814
+injury/ poisoning and diseases of the digestive system
+Supporting Notes
+low
+reporter activity
+homologous recombination repair
+A subset of Envs
+PICV
+all free strand regions
+128,119
+Diffraction data sets
+Construct T30/P2
+51
+a transcript that mimics the wild-type TCRV N mRNA
+four
+June 2009
+infectious viral progeny
+Broad-range PCR
+coping appraisal
+supplementary material
+influenza A positive or negative
+further infection
+54
+0.25 mL per dose
+biotin
+Stratagene GeneMorph II Random Mutagenesis Kit
+amantadine
+D 3 Ultra TM DFA Respiratory Virus Screening Kit
+Phage heads
+we further characterized selected genes identified at single-cell resolution
+CA9, coxsackievirus B2, and EC6
+pesticide restriction
+Mosaik alignment tool
+selective
+twelve
+influenza, hepatitis C, dengue and viral hemorrhagic fever viruses
+more than 1 hour
+Skyline
+major histocompatibility complex class I antigen
+Specific PCRs
+10.91, 38
+swine
+ADCC
+CCHFV vOTU DUB activity
+30,000
+ALI and ARDS
+antibody-mediated neutralization
+80%
+Phenylmethanesulfonyl fluoride
+PMTCT
+Amplify
+six
+10%
+22,000
+IMG/VR
+828
+i.n. and oral routes
+IBD rate
+45%
+Germination and culturing
+applications of CSF1-Fc in liver regeneration
+murine TOMM20 and duplicate FRB domains
+Xrn1p interacts with L-A Gag
+spatial segregation between populations
+ribonuclease activity
+essential information on the transmission and seasonality of influenza
+radiationattenuated
+antibody crosslinking the DEC-205
+rapid, label-free progenitor cell
+isotope labeled SILAC method
+influenza and henipaviruses
+poor
+relative gene expression of the targeted genes
+HS-Csn8KO livers
+block the activation of RIG-I CARD
+turripeptide
+decreased concentration of both KYNA and TSG-6
+GENIE3
+excessive levels of cytokines
+Manidipine-resistant virus
+288
+2 -phosphotransferase activity
+monocytes, tissue macrophages and dendritic cells
+stronger activation of pSTAT1
+NF-κB activation
+M4 and another replicate
+branch lengths
+comparison between survivors and non-survivors
+The temptation to become a standard
+pathological situations
+extraction kit, volume sample, and concentration procedure
+when influenza virus RNA is detected by host cell pattern recognition receptors
+luciferase activity
+FlowJo
+EPF
+6 weeks
+more than 100
+Heroin
+Microsoft Excel
+1918, 1968, and 2009
+antigen-antibody interaction
+RV-C9 and -C53
+Japan
+0% etiologic fraction
+access, egalitarianism, security and benefits
+HNSCC
+catalase
+267-Phe→Tyr
+rubber seal
+5.5
+polymorphonuclear cells from lymph nodes or myoblasts
+interstitial fluid concentration gradients
+Actin
+detected DNA from dead bacteria
+individual levels of each FFAs
+0-60%
+evolutionary hypothesis testing
+a region specific to the target gene and a high melting domain
+tandemly arrayed duplicated genes
+39
+5% non-fat dry milk
+9hpi
+preclinical and clinical drug/micro-organism exposure-response relationships
+Dr Margaret Chan
+parasite pressure
+degraded
+14 days
+hamster
+Homogenous mixing
+defense against a pathogen
+Serial dilutions of cDNA
+thermal stability
+degradation
+Lower variant frequencies thresholds
+expert opinion
+TBK1
+The venipuncture site
+regional or national intervention forecasts
+mAbs 447-52D and F425-B4E8
+Transcribing the glycoprotein gene
+fever, reduced consciousness, seizures, and focal neurological deficits
+Cytosolic NP
+cholesterol
+lung-derived virus-specific CD4 + effector T cells
+CD3 + T lymphocytes
+China
+1.02 per one frequency increment
+five
+10 6
+335
+epithelial or endothelial subsets
+blood transfusion
+the regression coefficient for human capital
+relatively modest
+75%
+pseudoknot
+NCBI GEO
+Storage samples
+Po 0.05
+75Á0%
+Mutagenic nucleosides
+reduced remyelination
+virus shedding and seroconversion
+45
+A list of known waterborne pathogens
+mouse studies
+Septic shock
+high abundance viral species
+efflux via the P2X7R
+UniProt Knowledgebase
+IL-12
+pregnancy
+Tumor necrosis factor alpha
+RVFV titer
+10,000
+1%
+Return array
+SigmaStat
+two
+Gln-89 and Ile-91
+anthropogenic
+to keep the reading frame intact
+reasonable
+natural polyphenols
+group masking
+CD4 + CD25 + Foxp3 + expression
+viral neutralization
+lung lesions
+the rate using the PEG as the crowding molecules
+2007-03-13
+70%
+0.2 volumes
+pre-pandemic vaccination
+ABC
+Quantity One
+spore dispersal
+RVF
+CifarNet
+Acoustic communication
+PepMapper
+51.3% to 7.0%
+XF culture supplements
+Antibody-mediated passive immunity
+April 17
+Five
+LTQ Velos Pro mass spectrometer
+MATLAB operations
+30
+vaxia trials
+-1 PRF
+4 days
+dendritic cells
+21%
+Student's t-test
+2 min
+80 GC/rxn
+one electrophysiology-trained physician
+Count data of the annotated transcripts from individual samples
+58
+cellular adhesion
+Hungary
+Pneumococcal surface protein A
+TMB and H 2 O 2
+macrophages
+day 18
+TG
+Thirteen
+human population density, land cover and land use
+Early identification of suspect cases
+a matrix protein and an RNA-dependent RNA polymerase
+time in minutes
+ABCG2 transporter
+multiorgan inflammatory disease
+10,000 Hz
+cdk2, -4, -6, and cyclin E
+1-mer features of sequence and structure
+FLOT2 and IZUMO
+dramatically diminishes the infection
+Ag85A
+memory inflation
+lower the titer of the virus
+RNA-Seq
+FerrD2
+age, sex and batch effects
+gshF
+IRE1 or ERN1, PKR-like
+let-7b and miR-26a
+Rab GTPases
+Erroneous matching read pairs in the plasmid control
+2,000
+negative
+high-ISG patients
+5 days
+implicit solvation models
+>70
+rational and user-friendly
+Tang Ben Cao
+blood samples
+good quality
+ensemble energies
+pathological IFN-α responses
+Forty-four
+cluster heart rate dynamics
+the census unit
+TCR
+pathogens
+Twenty-three
+sperm maturation process
+glucose
+highly attenuated mutants of Lm
+Patient-specific DNA vaccines
+Comparative genomic analysis
+Turning off all central air conditioners
+when Weekly CPS in a PHC jurisdiction exceeds 30.0
+multiple factors
+The reporting rate
+immunosenescence
+accuracy difference
+Group 3
+rimantadine
+Four
+physicochemical
+GP1 attachment glycoprotein
+unpaired
+methyl red indicator
+four
+probability ratio plots
+RIKEN BioResource Center
+Luciferase activity
+BRD4 and the transcription elongation factor P-TEFb
+host cell cholesterol homeostasis
+neuropathy
+hypoxia
+Subunits of the OST complex
+LIKHAAN
+Nikon TE300 inverted microscope
+XNT effects
+15
+gas exchange
+live bird retail stalls
+75%
+LIR-containing proteins
+space-time disease diffusion
+the degree of separation between positive and negative controls
+Y′
+Zn 2+
+antimicrobial
+less than 95%
+infection
+CpG island methylation
+outside of a patient's room
+19.6
+excitotoxicity & neuroinflammation
+February-March
+eight
+2009
+10 %
+Electrophysiologic abnormalities
+in vitro dissociation assay
+TNFa, MCP-1 and IL-6 secretion levels
+confocal
+to represent the range of log fold changes
+four
+Fibrogenic
+900 μL of recovery medium
+reverses IFITM3's inhibition of viral replication
+Fatty acids
+homotrimeric HA
+peptide H1-P25
+nucleic acid precipitant
+Clarifying the origin of DAECs
+four
+The ratio between Gag and Gag-Pol
+four
+pain and depression
+>0
+western blot
+VP1 capsid
+UTP
+Fifty-three
+induction of local immunity at the port of pathogen entry
+gross national product
+Type II cells
+significantly higher
+58.8 IU/mg 78
+Integrin 2 1
+Dbp3p
+The notion of proportionality
+Volatile
+5%
+change of tryptophan fluorescence
+47
+13%
+NMDA receptor
+hydrophobic part
+B
+583
+adaptive sequence divergence
+nephrology clinic
+PA-X degradation activity
+oligodendrocyte
+gestational stage
+24, 48, and 72 h
+21 days
+3
+academic credit and career advancement
+mechanical properties
+whether or not they had SP
+DEP
+hypoglycemic
+cleave
+active or inactive
+weighted least squares
+neuraminidase inhibitors
+PTX3 mRNA expression
+false discovery rate
+machine learning methods
+Down syndrome
+it is absent from known SBP homologues
+6 hours
+psychometrically driven and definition-driven methods
+Tukey's post hoc test
+1:20 dilutions
+female sex workers
+UV-irradiated samples
+specific viral proteins
+69.9%
+2
+30 ms
+s L i
+17
+× 10 6 colony forming units per milliliter
+Eleven
+14
+Cholera toxin B
+CD8 + T cells
+2009
+VSV infection
+waste of aerosol
+95%
+phylogenetic
+fungi and plants
+chronic renal disease and immunodeficiency
+Mutational bias
+42.6%
+35,151
+cis-acting mRNA destabilizing elements
+38.7%
+Lung injury
+11
+plasma levels of Ang-
+Multiple linear regression
+6
+vaccination uptake
+cynomolgus monkeys
+Ebola GP
+PmLac25-F and L25Re
+43
+32
+autumn and winter
+TNFα
+396
+DENV protein/lipid and protein/ protein interactions
+Coronavirinae
+variability
+VSIG4
+3.0%
+secondary
+odds ratios with associated 95% CI
+Equivalent volumes
+650
+Target DNA
+−80 • C
+fever-CT unit
+5.7 days
+CVTree3
+RT-qPCR
+1 to 3 cycles
+IFN-c
+Cytotox ® 96 assay kit
+Total RNA
+Natural Killer cell receptors
+high linkage disequilibrium
+45.028
+28-30 nm
+Mass gatherings
+weak CD4 binding
+RNAhybrid and RegRNA
+ImageJ
+its own promoter
+optimised
+worse
+Oil administration
+consistent
+Over a half
+5 μL
+improvement
+Markov chain Monte Carlo
+over 50%
+comparable
+Microglial cells
+acidic
+similar size
+58
+contact heterogeneities
+four
+29
+Sofosbuvir
+influenza tests
+microvesicles or secretory autophagosomes
+twelve
+TRAF6
+CMV viral load data
+LV ejection fraction nor plasma BNP levels
+NOD1 and NOD2
+Type 1 error adjustment
+receptors for host invasion
+ID
+Five
+rhino C
+DI particle release
+two
+positive
+four weeks
+transcytosed virus
+divergence and recombination
+twice daily
+357
+A nucleic acid test for HCV and HIV
+5.2 days
+microbes
+Viral entry glycoproteins
+An amiRNA targeting LacZ gene
+microvesicles
+developmental phase transition and flowering
+the generation of an accurate superposition
+hepatocellular injury and fibrogenesis
+various self-assembling viral proteins
+0.8 mg/kg
+Hepcidin
+Key Laboratory of Sericulture
+angiogenesis
+LigScore1 and PLP1
+five
+800 V/cm
+oxidative
+Nagelkerke R 2
+ELISA kits
+stop condition
+every month
+Centers for Disease Control and Prevention
+fluorescence spectrophotometer
+reduced
+5.5-6.8 minutes
+cc-by
+mediates growth, inflammation and apoptosis
+259, 694, 910, 1002 and 1023
+IFN-α
+Interleukin-18
+reverse transcriptase quantitative PCR
+Whole Blood Genomic DNA Isolation Kit
+Bright-Line Hemocytometer
+liberation of sugar chains from glycoproteins
+Acute lung injury and acute respiratory distress syndrome
+Self-administered feedback questionnaire
+Clinical evaluation, laboratory investigations, and electrocardiography
+Vaccinia virus
+Arieh Ben-Naim
+2,500 square meters
+viral and host factors and contact opportunities
+coagulation and fibrinolytic functions
+6%
+2
+FN1 and laminin
+16 h
+trained study personnel
+Over 100
+PPXY late domain
+the best ANFIS model
+0.1 %
+a careful assessment of their morphology
+Blood drawing
+IFNγ stimulation for mHLA-DR expression
+Community-acquired pneumonia
+Compound 14
+−20 ∘ C
+the earliest event associated with infection-viral entry into the host cell
+3,320
+one-way
+1918
+highly divergent sequences
+homeostasis
+a general set of mechanisms by which acetylation can regulate protein activity
+Clustal W 6.0 software
+A mutated site
+weekly
+size exclusion chromatography
+sunitinib and sorafenib
+information from the primary rescue response teams
+comparable to seasonal flu
+53 kDa
+non-neutralizing/interfering Abs
+Logistic regression analysis
+1998
+80%
+parenteral nutrition
+0.3%
+mathematical models
+elevated AST
+two
+two
+Interleukin 18
+An intervention targeting schools
+disintegrate
+implementation expenditures during the 2012-2014 interventions
+A sequence logo
+mitochondrial uncoupling and Ca 2+ sensitive potassium channel activation
+IFITM3
+15-fold
+striated muscle cells
+70%
+central nervous system pathology
+E protein's interaction with pr
+behavioral changes
+4.3 × 10 5 IFU/mL
+protein kinase B
+adapter ligation
+95%
+individuals
+THBD
+skeletal dystrophin
+3
+paracellular permeability of cell layers
+heteroskedacity
+consumption of the precursor proteins following KKS activation
+722 bp
+miniature computers
+Mutational pressure
+a future phenomenon risk
+PMAdifferentiated
+CD4 and Foxp3
+456
+IL-21
+HLH
+higher
+molar ratios of protein:HOCl of 1:1000
+C4 from Callitrichine herpesvirus 3
+within-host evolution
+social wellbeing and optimism for the future
+gluconeogenesis
+T. whipplei bacteremia
+two weeks
+1 hour
+monocytes
+The quantity β
+reverse genetic techniques
+Bonferroni correction
+monocytes and macrophages in mammals
+Ten
+WSN-PB2-GFP11
+earlier initiation of transmission-based precautions for symptomatic patients
+seven
+glycan sequences
+ROS
+development of ARDS
+CalcuSyn
+potential markers of bacterial infection
+GO and REACTOME
+3
+Corticosteroids
+structural proteins
+outliers
+Hashimoto thyroiditis
+209
+Ser78 and Ser81 of CHOP
+HIV Env
+MetaMorph
+cytokines
+Fifty
+efficient virus release
+the liver
+EGFP fluorescence
+Autophagy
+Ibrahim
+carnivores and ungulates
+culture dishes
+EV71 replication
+16.78%
+~60%
+lower
+emodin
+therapeutic
+7%
+dialysis modality, efficiency of dialysis, and nutritional status
+five
+2 ml of purified linear DNAs
+inflammatory
+Adenosine
+respiratory infection
+viral titer growth rate
+Tab. 1A and 1B
+c
+0.29
+four
+23
+High dietary fluorine
+up to two weeks
+Ub 75 -thioester
+supplemental near-patient air sampling
+epithelial damage
+dispersion models
+improvement in FVC after therapy
+senile
+averaged
+cycle threshold
+10
+iodine labels
+Single-nucleotide polymorphisms
+haematoxylin and eosin
+methanol/chloroform
+density gradient centrifugation
+95%
+to clarify the importance of the details of contact and propagation mechanism
+greater than 1
+lymphocyte penetration
+a series of orthogonal axes
+residue-and surface-based methods
+Asterisks
+nAbs
+4 days
+Alveolar TII cells
+projections at multiple time points
+SYTO9 and SYPROred
+electronic data collection methods and automated analysis
+80%
+0.5%
+six
+late-exponential phase
+30%
+Thirteen
+glucocorticoids
+Raul Andino
+effecting insulin clearance
+metapopulation model
+Survey datasets
+Recombination
+MDA5
+Polyethylenimine
+specific targets
+all nodes
+black horizontal dashed lines with arrows
+Trizol
+8,263
+CP-readthrough protein fusion
+4 days
+worsening disease outcome
+16
+image patches
+many tools for data analysis
+a drug or toxin triggering IMHA
+Nantou, Lianhua and Yuehai
+Viruses
+29 %
+living changes
+Genotyping of P. jirovecii
+R 0
+Effelterre et al
+6 to 7 days
+K153R and S223N/G
+Thermo Fisher
+Important Bird Areas and agricultural land
+IFN-α
+exothermic
+receptor binding
+high mortality in humans
+influenza
+all degrees of neuronal injury
+H. influenza, and pneumococcal isolates
+K1L and C7L
+four
+Negative binomial generalized linear models
+ruminant
+Mag and Hon
+higher
+N-terminus
+decrease in ACE2 is not a general response to kidney injury
+ACE2
+type 1
+Eid-Ul-Adha
+28
+1%
+infectiousness
+quantitative levels of antibodies
+2%
+normal kidney architecture
+hepatitis B
+EB-NPCs
+ISM
+goat-anti-mouse-Cy3
+none
+15-45%
+in duplicate
+both interventions were equally effective
+Statistical tests
+human health
+the band
+HIV-suppressive RNase 6
+Recombinant Cap protein
+tegument VP16
+angiopoietin-2 and markers of endothelial dysfunction
+1 H-NMR
+121
+cross-Validation
+reduces the viral titres of the four DENV serotypes
+65
+12
+5.51
+AS03 adjuvant
+VA IACUC committee
+Neurally adjusted
+direct inhibition of repair
+N 2
+twelve
+antiviral activity
+1 million
+29 days
+2-10%
+Mann-Whitney U-test
+B240818
+astrocytes and endothelial cells
+2012
+four
+NGS
+Host heterogeneity
+28
+stochastic Langevin equations
+SPSS 15.0
+codon115
+50%
+unrealistic and suboptimal
+Newcastle disease virus
+CV risk
+inhibit L. interrogans to mammalian cells
+visualizing certain texture patterns of lung diseases
+mild
+pDC and NK cells
+consideration of titer and thermal amplitude
+89
+180
+environmental viruses
+Metronidazole
+0.05
+55.5%
+5%
+Flow cytometry
+Ile45Arg/Thr49Arg
+John R. Mascola and Richard Wyatt
+interlaboratory data sharing and assessment
+Successive passaging of the viruses through the hosts
+3.6%
+Antibody production tests
+eleven
+protective
+50%
+38 %
+5%
+Anti-β-actin mAb
+patients with similar and suspected syndromes
+inhibits viral DNA synthesis
+chest radiograph
+more than one focus
+0.236
+ALI
+Statistical
+Table 1
+Smad2
+T-domain and receptor binding R-domain
+virion maturation
+Two
+Virus entry
+NucleoSpin Tissue kit
+low
+F O k,ν
+advances in basic understanding and vaccine development
+Partial F test
+Antimicrobial resistance
+Disability
+bacteria
+Treg deficiency
+ineffective repair mechanisms
+lipids
+NS5A
+anti-steatotic
+S M
+3 dpi
+estimate the posterior density
+IRV with fitness advantages
+public health messages
+the link between outer shell and capsid core of enveloped viruses
+improving the sensitivity, accuracy, speed and throughput of experiments
+Father
+origin and evolutionary patterns
+Hand hygiene compliance
+systemic actions
+Further studies
+62.2%
+life history traits obtained from the literature
+the treating physician
+pleiotropic
+carbohydrate-binding sites
+two
+trace amounts of DNA or RNA of a particular sequence
+GDZ and GDL
+Crossover regions
+Trypsin
+RIDD
+322.1 pg/mL
+APVs
+Strong 10 N95 masks
+disaster base hospital
+virtual screening
+N-acetyl group
+Cav-1
+ENaC phosphorylation
+small-molecule adjuvant
+amoxicillin
+2000
+A/California/04/2009
+adjuvants
+less than 1 %
+DNA glycosylases, nucleases and DNA polymerases
+Blood feeding
+ER stress
+influenza virus
+2 weeks
+Adaptation of pathogens
+alopecia
+Farm animal proteomics tandem MS analyses
+its own promoter
+Katja van Nieuland and Thales de Haulleville
+confirmed case data
+four
+84%
+SeV and MeV-Edm
+50%
+CRTC1
+viral
+Sleeve gastrectomy and Roux-en-Y gastric bypass
+62 420
+cell-intrinsic properties or other mechanisms involved in regulating viral replication
+biological denitrification
+CNS degeneration
+three
+CIITA
+bat specialized
+TFA salts
+2013
+femoral bone
+122
+various choices
+electrons
+flexibility
+weak-damping effect
+HA
+A summary of the secondary structure pointers
+IFNλ activity
+6-9 days
+vector age profile
+E-cadherin
+36,811
+KS and JD
+self-amplifying replicon systems
+Image J
+the protection index
+3 -adjacent to A 36 in phenylalanine tRNAs
+35
+toroidal-homotrimers
+host cellular processes
+Local prevalence
+Hsc70
+replication of the challenge virus
+innate and adaptive immune systems
+between three and four
+up to two weeks
+critical care
+EBOV GP
+provide important support to neurons and modulate synaptic activity
+17
+November 2012
+viral protease
+minipigs
+Idd9.2
+16S rRNA
+minimal
+ambiguous
+ARV drugs
+hormonal
+1990's
+Viral titer
+food and environmental virology
+viral docking proteins
+Pro-inflammatory
+four
+iBLOT transfer system
+privacy issues
+up-regulation of MHC class II molecules
+surgical treatment
+illness onset
+pulmonary manifestations
+62
+judgments about people
+Kruskal-Wallis test with Dunn's multiple comparison
+Glycosylphosphatidylinositol anchors
+diffuse occurrence of positive cells with high-intensity labeling
+15, 30, 60, 90 and 120 minutes
+infecting
+mechanically ventilated critically ill patients
+36 or 12 h
+quality of the modeled structure
+Cox2 transcriptional start site
+end-expiratory positive airway pressure and pressure support
+Identifying and Prioritizing New Preventive Vaccines for Development
+isothermal titration calorimetry
+1-2 nM heavy chain
+Genome-wide significance
+Age
+2A pro
+asymmetry
+more than a half million
+locally weighted scatterplot smoothing
+Demographic parameters
+four
+53
+IFNs
+27 to 49%
+cytokine production
+KE
+molecular simulations
+after composting
+Chris Weiss and Hongwei Liu
+phosphorylation of bcl-2 and apoptosis
+30 min
+avian influenza control
+Emphysema
+all probes derived from their respective sequence group
+CLONTECH vectors LNCX and pIRES2-EGFP
+Poly-L-lysine
+Paired Wilcoxon tests
+negative-sense RNA viruses
+IFNβ
+Three
+right lung tissue
+supplementation with omega-3 fatty acids
+Eleven
+person re-identification and distance estimation
+std
+fluorescence resonance energy transfer -based mixing assay
+5
+serum creatine kinase
+Demographic details
+Cancer
+occupation
+AGR2-GST-beads
+sitafloxacin
+5%
+MxA 60
+global body
+24 hr
+non-functional aggregates
+DeMAND and DE target predictions
+loose stool and fever
+Y148R
+when the diffusion constant decreases
+patterns of continual immune selection mechanistically
+Pediatric Cardiac Critical Care Consortium
+273
+KPN_00466
+plosntds.org
+individualized medicine and precision forensics
+chorioretinitis, abortions, mental defects, and death
+5%
+Phylogenetic
+1%
+controlled
+Hepatitis B virus
+CPP-ELD peptide administration
+Hunter strains
+personal, religious or ethical beliefs
+Altered CRP and ESR values
+high power field
+virus-infected sample labels
+Door to balloon time
+global health security needs to be a priority
+E protein
+geo-referenced data
+PD
+TAT peptide
+156
+nasal swab samples
+15 min
+three
+respiratory syndrome virus
+Hepatitis C virus VFs
+Identifying those LBMs that could act as viral reservoirs
+RORγ t and arylhydrocarbon receptor
+in advance
+the major domains that interact with the host receptor
+caution
+recombination
+feeding stages
+Semi-preparative or preparative column
+6-8 weeks
+7.1
+b' s,t
+50
+Beijing Children's Hospital
+sequence similarity
+Enterovirus
+naïve ferrets
+progress in our appreciation of the neutrophil biology
+the sill
+binding of these proposed inhibitors with papain like cysteine proteases
+the literature
+24
+T-helper type 2
+50% tissue culture infectious dose
+53.7%
+Bacterial culture
+Multitest Imk Lymphocyte kit and Trucount tubes
+Readthrough at the test stop signal
+more than 50 times
+300,000
+patients with high geographical mobility
+two more weeks
+Plates
+singletons
+twice
+vasoconstriction
+canonical AA metabolism
+impairs the virus cell-fusion step by inducing cellular membrane changes
+envelope-mediated membrane fusion
+150
+innate immunity
+their strategies for establishing and maintaining cooperative relationships with crisis clients
+canonical polyA
+Cancer
+SDIs
+14
+long-term improvements in cognitive function
+Argonaute-like
+27
+gp120
+Alveolar macrophages
+0.5 mg/mL
+2.6 million
+biosafety reasons
+N
+colorimetric MTT assay
+63
+8 seconds
+Base stacking energies
+molecular mimicry
+ANNOVAR
+5%
+heterosubtypic crossimmunity
+Cardosa and colleagues
+Multiplex PCR
+when the viral polymerase loses processivity during virus replication at high titers
+M and W
+60%
+ecosystem and land-use changes
+DMD
+1000
+RA
+our data suggesting that muscle and peripheral nerve functions are normal
+Threonine
+flow cytometry-based bead array systems
+SPSS
+neutrophils and macrophages
+quarantine
+the control coefficient
+7-day old
+10,000
+Thailand
+bias the polyclonal antibody response toward non-entry neutralizing epitopes
+1,440
+accuracy
+6
+rs12979860 polymorphism
+in vitro and in vivo models
+Matrix coding strategy
+Pathogenic
+The disease ratio
+IFIT3 and ICAM5
+Genetic engineering
+Anemia, advanced gestational age, and preeclampsia
+Blockade of AaHig
+one
+C
+1
+good
+Myr-47/WT b bait peptide
+activates apoptosis
+Env proteins
+de-identified data
+PLX5622
+attenuated or virulent ASFV strains
+cancer
+influenza A
+reducing permeability whilst preserving a pneumotropic effect
+mutational
+Specifi c primers
+turkey red blood cells
+ORF5
+M1
+Apoptosis
+citrate
+standardized test method and exclusive barcode tags
+Structural
+Netherlands Food and Consumer Product Safety Authority
+all mortality and reduced disease severity
+Crohn's disease and ulcerative colitis
+transparency data and measurements
+CD169 ϩ population
+homogenates
+firefly or Gaussia luciferase
+4,585 mg
+A batch of incomplete genomes
+detecting the binding of Egr-1 and CBP at RTA promoter
+anthelmintic treatment
+stem nucleation
+Myeloperoxidase
+chimpanzees
+Pneumonia
+Seattle, USA and Shanghai, China
+Ekman
+Cuffquant
+permeate a target via diffusion
+0.1 g/day
+coronary artery disease and type-2 diabetes
+steroids
+Creb3-Arf4 signaling
+actin
+Cathepsin S
+Paroxysmal hypertension
+10
+influenza A virus replication
+anisotropy
+639
+chronic disease prevention programs
+24
+type I
+Toll-like receptors
+increases the INR
+100 μL DPBS
+GU wobble pairing
+The 95% confidence interval of the effective reproduction number
+Influenza
+96 ng/µL
+195
+six
+preventing violent crime
+1 to 10 3 copies/ml
+cholesterol
+Dual-host flaviviruses
+congruent
+demographic characterisations
+remyelination
+four
+R247A
+implausible
+CC10 protein
+TT virus
+fast hopping between ssRNA and hairpin intermediate
+50%
+Muscle
+Estimates of the measles case reproduction number
+twice
+dynamic genetic interactions
+30 min
+tripeptide proteasome inhibitors
+PKV infection
+geometry
+potential infective contact
+Eluted RNA
+Xbp1 mRNA
+cardiovascular disease
+larger effective population size
+complementary scoring functions
+H5N1
+Population coverage analysis
+alveolar macrophages
+Residue 75
+Standard deviations
+60°C/h
+deleterious mutational fitness effects
+four
+72 hours
+national and international surveillance systems
+high variant allele rate
+antigen processing and presentation of exogenous antigen and regulation of T cell differentiation
+communicate and collaborate
+IFN-c-secreting
+Carbamidomethylation
+negatively
+Splenocytes
+1 hour
+Fourteen common peaks
+values over 600 V/cm 2
+higher rates of mislabeling
+autophagosomes
+3.5-fold
+9.7%
+Tracheas, lungs, mammary glands, and nipples
+1891
+the virus CSFV replication
+H7N9
+132
+short-and long-term projections
+adequate antibiotics
+regulated expression of the protein of interest
+Binding of epitopes to MHC-I molecules
+10 2 CFU/mL
+Mycobacterium tuberculosis
+IL-10 and TGF
+a coiled-coil domain
+two
+2015-06-08
+improving the stress management of employees
+hamsters
+CHIKV-caused disease
+erythrocyte membrane epitopes
+Coomassie dye R-250
+protein target identification
+crystallization solution
+repressors
+bicinchoninic acid assay kit
+the BMV genome
+111
+100%
+32
+geometric means
+A common language
+2415
+abzymes
+Dakar Bat and Bukulasa bat virus
+neural progenitor marker nestin
+Gray's test
+GC
+Studies describing barriers on clinical or research data
+Apps
+inhibition of cell proliferation
+semidark conditions
+curve of the Haitian hyperimmune sera
+surveillance
+Soybean oil
+sGP-reactive antibodies
+ELISA reader
+hot plate
+Expression levels
+1 hr
+H1N1
+virophages
+90-day mortality
+,1
+public, political and scientific credibility
+An amplicon from the V8 region of the 16 s gene
+the highest antibody titers
+it does not rely on the creation of any immunoaffinity reagent
+decreased the protein level HCVcc at 10 MOI
+algorithms
+Bats
+Bacteriophages
+filamentous
+University Research Company
+peakMonitor
+gold particles as fiducials
+vitro cell culture system
+BalTec HPM-010
+1:50
+viral mechanisms targeting type I IFNs
+FimA NMR model
+ImageQuant LAS 4000 system
+limitations
+dementia
+detection of toxoplasma
+PAMs
+P241L, R242K, and H552Q
+246
+overnight incubation of the transformed cells
+effects of additional counts on single days
+antiviral activity
+ICAM-1 overexpression
+mitochondrial disturbances
+High Capacity cDNA Reverse Transcription Kits
+The glycocode
+Ͼ5%
+Ancestral sequences
+further clinical validation
+MCAo
+Western blotting
+Qiagen Viral RNA Mini kit
+calcium phosphate precipitation and Fugene-6
+I. Indigotica
+50%
+kyphotic correction
+SPC-TNF tg mice
+24
+Sepsis
+Peptides
+Sex
+R&D system
+AS03 B -H5N1
+Animal survival
+YKR051W
+γ-CyDs
+8%
+a nasal spray
+proteins that promote DNA synthesis
+perivascular
+Jen Sheng
+how this matrix varies with hospital ward structure
+human infection
+case counts
+sRNA from virus-infected and virus-free plant samples
+516
+random-effects model
+understanding the pathophysiology of tonsillar disease
+escalation of the coverage and intensity of these interventions
+six
+structural matching
+linear regression analysis
+CCL2
+mediates viral entry
+histological confirmation
+M. pneumoniae
+Two hundred sixty-four
+60.6%
+Hymenopteran
+100 ms
+P2X7R
+salivary glands
+Adoptive transfer of BMDCs from SFB colonized mice
+analytical results on the interactions between mixing decisions and disease dynamics
+Therapy
+policy change
+Glu426
+Acinetobacter baumannii
+noricumazole A
+92.7%
+ouabain, digoxin and lanatoside C
+chloroplast transgene products
+traditional logistic regression models
+strong dilution in those patches, and weak connectivity
+low
+95%
+Lung toxicity
+The structure of a protein
+HCA and PCA
+weak affinity
+immunological
+B
+4
+Drug repurposing
+b-isomer
+MYC
+.90%
+one
+little or no effect on L-A copy number
+methylation
+genes
+Human anti-EBOV Zaire Glycoprotein IgG titers
+ABC transporters and metal ions
+A framework for MCDA model validity testing
+HFMD
+Three hundred ninety-one
+1, 2 and 5
+poxvirus-vectored
+baseline HVPG and mean pulmonary artery pressure
+Cell-cell fusion
+population aging
+27
+six times faster
+apoptotic
+Cirrhotic and non-cirrhotic
+fluorescence
+Optical density values at 450 nm
+stops
+4.5% to 12.7%
+Acetaminophen
+RSA59
+FACSDiva
+CD11c
+evolutionary
+2019-07-24
+M1 and NP
+RIG-I
+ocular conditions
+Treatment success
+Mutations affecting dystrophin exon 16
+39 and 59 MO treatments
+Onset of symptoms
+relatively better protection
+G1
+2 hour
+the Laplace transform
+1 µg of an unrelated antibody
+48 hpi
+cytomegalovirus
+two
+Jos Seegers
+using the free EGFP and free mCherry samples
+12-16 breaths per minute
+35.5% total calories supplied as fat and 14% as saturated fat
+21
+30 atm
+four
+four
+decreases
+60%
+30-45 kDa
+more than 50
+increased separation between the two distributions
+LAMP
+w i
+IFN-γ
+Pharmexa-Epimmune
+Hepadnaviridae
+3
+output consensus sequence
+rather short
+adjusted odds ratio
+lipid droplets
+novel treatments of prostate cancer
+collaboration across disciplines, sectors, organizations, and national borders
+December 2015
+Encephalomyocarditis virus
+HA
+household structure
+7.8-fold
+Thirty-six hours
+pathogenesis
+epithelial brushings
+Biased viral samples
+399
+56-100%
+resident memory T cells
+unresolved
+5 min
+transmission of HIV
+Parameter estimates
+Igf-1
+Anti-β-actin mAb
+pyrazole
+between QW170/218-like and Sw43-like strains
+Xbp1 signaling
+IL-1β and IL-18
+6ice
+augmented changes in histopathology
+PCR-based molecular diagnostic assays
+ROC curves and C-indexes
+Richard Smith and Jo Coast
+their protease activities
+Patient PBMCs or murine splenocytes
+β-casein
+phenol: chlororform extraction of the supernatants
+brain parenchyma
+a gift card
+0.16
+land-based surveillance
+higher titers of opsonic antibodies
+25%
+sequence-specific primers
+PUUV genetic differences
+Daimond-Blackfan anemia
+3 h
+5
+complications arising from selection of revertants of deleterious virus mutations
+21
+three
+1
+T
+renal tubule epithelial cells
+early and late viral groups
+UBP43
+immuno-stimulants
+selected for strong/weak folding
+lipid and fatty acid metabolism
+knowing when there may be an inaccurate report of a change
+PCR-based site-directed mutagenesis
+identifies the consensus or major viral genome present in a particular isolate
+D-dimer
+SNARE-Munc18-1-mediated liposome fusion
+AD-4 and AD-5
+21 dpi
+government authority and the rural raisers
+antigens
+viral dsRNAs
+Revolutionary Wealth
+pARDS
+sepsis-induced capillary leak and development of pulmonary edema
+Donor source
+TNF-α KO mice
+7
+RNA runoff transcripts
+ten
+VLPs
+bone repair and revascularization
+discovery SNP
+ten
+Macrocyclic
+mortality
+6 non-structural proteins
+570 nm
+Mg 2+
+An in-depth analysis
+7 days
+10:90
+Eqs 5, 6 and 7
+6-8 ft 2
+mast cells
+BHK-21 cells
+three
+151
+four
+E2 glycoprotein
+1343
+Dendrogram on Figure 1A
+group III
+Chinese herbal medicine
+The Effective Size
+EGR1
+loss of the FG-rich region
+high levels of CD11c and MHC Class II
+clinical outcomes
+local orientational disorders
+48
+the image
+6000
+it will be a transmission hotspot
+5-7
+less
+cumulative proportion of the population infected
+Simple sequence repeat
+ul3-ul4 and ul30-31
+PCR, real-time-PCR, and Multiplex PCR
+after resin cleavage and purification steps
+the highest value obtained within 3 days of acute visit sputum collection
+Serial 10-fold dilutions of the cloned plasmid
+1 mass
+112
+TNF-α
+TNF
+Proteins
+NCs
+CD4 T-cells
+0.011 ± 0.008 mg m −3
+Nonspecific sites in the membrane
+Influenza and Human Adenovirus
+homeostatic model assessment to quantitate insulin resistance
+Fc-dependent viral clearance
+Careful choice of efficient delivery
+Our next result
+volutrauma, atelectrauma and biotrauma
+centrifugal filter tubes
+5 min
+220
+20.78%
+the retroperitoneal region
+Establishing a healthy environment
+Ifnar1 SA mice
+low
+immune checkpoints
+292bp
+pessimism
+conventional nutritional supplementation or the infusion with an amino acid cocktail
+40
+chromosome 15
+HLA-typed normal tissue arrays
+porcine circovirus 3
+sexual promiscuity or moral degeneration
+7 days
+gene-expression profiling
+Met·tRNA MET
+structural determinants in the interstitium
+F4/AS01
+coinhibitory
+Transfection with high levels of gH/gL DNA
+peptide
+most cells examined by confocal microscopy
+hypertension
+3 h
+The sex of the individual flies
+all-regions conditions
+sumoylation
+liver diseases
+91%
+surveillance systems
+seven
+failure to accommodate the intention-behaviour gap
+chloramphenicol resistance
+cytoplasmic E7 production
+Calpain
+68%
+DC-SIGN
+Hsc70
+arrests the cell cycle
+seven
+disease outcome
+60
+5%
+luciferase activities
+single association signal
+break out
+19%
+encapsulation
+cholera and dysentery
+four
+Atg5
+acceptable
+0.45 mM PVDF membrane
+national epidemic curves
+focal adhesion
+Bayesian hierarchical model
+T526A, Y527A or W529A
+TGF-β signaling
+Sepsis
+artifacts of the particular partitioning of the data into training and test set
+TakaRa MiniBEST Universal Genomic DNA Extraction Kit
+undergo apoptosis
+NIH AIDS Reagent program
+control chart-based algorithms
+age 65 years
+mSTING R168A
+contingency planning
+50%
+belief state
+Antiretroviral therapy
+complementary RNA products
+lower
+3 days
+Hep-2 cell line
+phasic ASM contraction
+cerebral cortex
+increased viral replication
+using previously defined cutoffs
+NP 89-97 and NP 198-206
+99.6%
+harmful risk factors
+remifentanil and midazolam
+four
+β ρ
+independent dataset test, subsampling test, and jackknife test
+separate the different phases in the space of the parameters
+IMG/VR
+NF-κ B-dependent transcription
+X4%
+59 to 69.1 o C
+Pana et al
+3
+physiological and biochemical similarities
+IS/885/00 and IS/1494/06
+binding to GAGs
+An ongoing study
+biomolecule structure characterization
+ORF2
+London
+Affymetrix probe sets
+Lack of time
+partial correlation coefficients for mean daily prevalence and the value of a particular parameter
+Cell death
+Maximax
+Mutating the lower stem of IRENE
+p = 1
+long-term follow-up studies
+ZIKV
+>70fold
+disease severity, microbiological findings and anti-infective agents
+Cox Proportional Hazards regression analysis
+Fisher's exact tests
+Muc5AC
+C-terminal residues Arg73-Lys100
+CD36
+0, 15, 30, 45, and 60 min
+autocorrelation
+Iterative HFold
+Plasmodium, C t
+answer questions or follow instructions
+10 to 20
+Inhaled hyperosmolar agents
+every 3 months
+gut microbiota metabolism of dietary fiber
+systemic inflammatory response syndrome
+19 days
+19
+1.1
+Extended Data Table 2
+Forssman disaccharide
+65.8%
+T and B cells
+as findings are presented elsewhere
+WNVCp
+1:10
+TNF-α
+IL-17
+low
+Metabolic stability
+4 weeks
+Two-way
+Liberal oxygenation
+Four
+inflammatory
+internal controls
+cope, make decisions, and return their lives to normal
+87
+100 nM
+MBP columns
+pathogenicity
+GVHD
+GL-ALG NGPs
+6.3%
+higher order structures
+ATP and NO
+RT-qPCR protocol
+Genetic reassortment
+viral nuclear transport
+AIRS
+none
+index read
+PCR
+Water soluble dual function probe
+H1-influenza A-specific T cell responses
+Genome structural annotation
+EBOV
+25
+more reliable state
+115
+The plasmid linearized with the BamHI
+Roland W. Herzog
+0.05
+55
+hepatocytes
+Nine
+pBSTNAV
+2 months
+Pierce BCA protein assay kit
+phylogenetic error
+high resolution
+high
+practices and therapeutic schemes that are different from those of others
+1997-2004 and 2005-2010
+high seasonality
+a clinical isolate
+TNF-α-converting enzyme
+1996
+gel electrophoresis
+artificial detail
+bats
+pigs
+NNAlign
+DNase
+low-viral-load group
+Renilla luciferase assay
+six months
+distinct
+Chemokine
+Figure 7
+LGALS3BP and BST2
+No significant difference
+influenza pseudotypes
+significantly
+36
+20
+geographic distributions, growth conditions and harvesting seasons
+The motif length, encoding of flanks and peptide length
+vesicular trafficking
+ML-estimation and moment estimation
+pulmonary arterial hypertension and hereditary hemorrhagic telangiectasia
+Retroviral vectors
+nuclear transport
+no significant association
+The curves
+significant differences
+SUMO-HMGB1-A-BOX fusion protein
+1 h
+apocynin
+SA
+Seven
+FasL, LIGHT and TL1A
+100 μl GloLysis buffer
+Selected religious MG event of Tamil Nadu
+12%
+transit peptide cleavage sites
+myocardial dysfunction
+half an hour
+49
+The HI test
+Texas, U.S.A
+genital structure of males
+PPP-RNA binding
+1.8 mL of the supernatants
+15
+tandem arrays
+ribosomes
+the annotation with the highest Smith-Waterman score
+multiorgan
+kidneys
+sex and body weight
+over 100
+Lipofectamine LTX
+experimental evidence
+Search strategy and database name
+Three
+Portsmouth genome
+the same tree topology
+biochemical
+interventions to improve the health of the worst-off sub-populations
+trimerisation of the N-terminus of TM
+malaria, enteric fever and diarrhea
+fungal load
+conformation
+29
+54
+inefficiency means waste
+four
+Plum Island Animal Disease Center Institutional Animal Care and Use Committee
+limited availability of published results
+Direct exposure to body fluids or contaminated materials from infected patients
+five
+Tissue samples
+Having a household with children
+NDP52 and TAX1BP1
+1,282
+antigenically
+tripeptidyl peptidase II
+hydrophobic
+transgenic memory B cells
+162
+better thermal behavior, plasticity, toughness and biodegradability
+comparative parameters
+1892
+after the colonization of the New World
+VEP
+adenosine
+through ENTs or CNTs
+62%
+a relative ranking of country capacity
+Three hundred nineteen
+superinfection exclusion
+Apoptosis
+Flaviviridae
+secondary structures and RNA elements important for cyclization of the genome and virus viability
+infection
+miRNA-based antiviral therapeutic interventions
+aerobic processes
+Cox B5 and EV-D68
+antagomiRs and sponges
+Chase expression
+commitment, and vision
+bacterial, fungal, viral, and parasitic pathogens
+base compound
+ISGs
+a clear management plan
+chronic juvenile arthritisl CNS
+UNDP-PCR method
+large and aromatic side chains
+ELISA reader
+x i and x j
+LASV LCMV JUNV anti-LASV NP
+baseline drug resistance
+unnatural anthropogenic disturbances
+cerebral, circulatory and/or respiratory failures
+Correct integration of mCherry constructs
+71%
+Cellomics Multiparameter Cytotoxicity 3 Kit
+10.3390/v6125047
+MetaMorph microscopy analysis software
+20-24 hours
+50
+Figure S2
+inefficient
+over 885
+Sensitivity
+PG
+20%
+IL-1β
+control mAb reactivity by flow cytometry
+the same
+validation
+host cell proteins
+Early recognition and prompt treatment of severe pneumonia
+discontinuation of the causative agent
+proinflammatory
+Four
+BG-Sentinel traps
+94%
+SILAC Protein Quantitation Kit
+3%
+mucosal humoral and systemic
+novelty
+viral replication sites
+base excision repair
+transmembrane ER resident enzymes
+45
+non-linear increase in disease risk
+viral replication
+Site 1
+administration routes
+Liver diseases
+alveolar
+a selection marker
+the present study
+3
+60 min
+Anti-thyroid
+adhesion
+adefovir
+Japan
+3
+Heterophil/neutrophil recruitment to the infected site
+tracr-R, AF3 and AF2
+p47 phox
+immunochromatographic
+intracellular radioactivity
+Neutropenia
+TRAP
+erythrocyte receptors
+biological post-translational modifications
+a i = 0
+six
+cc-by
+ImageJ
+porcine trypsin and endoproteinase LysC
+982 nm
+codon usage
+32.9%
+IDEAL-Q
+q18S RNA gene
+inhibition of neutrophil elastase
+bioinformatic
+6
+hepatic venous
+Sidak
+PB2 627K
+12,630
+Benzonase and reducing agent
+VSV
+UV-visible
+small arteries, veins and arterio-venous anastomosis
+strong structuring of the FTLSV phylogeny by provinces or area
+antigenic site B
+adaptor ligation amplification
+200 mL
+eight
+Inhibition of the redistribution of ACE enzymes
+peri-urban
+30
+do not exchange genetic material frequently
+SM patients
+infant respiratory distress syndrome
+Nosocomial bacterial meningitis
+The BioProject database
+drug-resistant mutant
+mechanical damage to neural and vascular structures
+modifications
+natural disasters
+30.8%
+Salivary glucose oxidase
+distilled water
+three hours
+31
+influenza A
+January 1, 1995
+Twenty-six
+Fresnel diffraction theory
+wild-type mice
+muscle viability
+genotoxic
+unidentified importations, relapse cases or unreported locally acquired sources of infection
+12
+they use a little different set of tRNA molecules
+Peter Stä heli
+Blood spot-containing filter paper
+their ability to combat anoikis
+three
+Acquisition of data
+GAPDH
+Hsp42p
+serious suicide attempts
+weight gain
+IRF7
+Highfidelity
+Wilcoxon nonparametric test
+SYBR Premix Ex Taq
+selected results of clinical or animal-model research
+zoonotic infections
+transgene compartmentalization
+syncytium formation
+b-Catenin
+1975
+SpreaD3
+coincides with standard GA b-isomer crosspeak patterns
+synonymous codons
+Bourcier et al.
+mink
+codons
+1
+ISG15
+1/μ V
+Important information
+1/Z
+human, avian, and swine influenza viruses
+creating an effective regime of regulation
+Protein from the supernatant
+nine
+endocytosis
+Zika virus
+faecal bird-samples
+arterial or venous walls
+multifunctional
+alternative splicing
+pulmonary stem/progenitor epithelial cells
+RPMI-1640
+signaling pathway
+T cell-mediated immune response to various myelin antigens
+75.8%
+2,000
+ages that lie outwith the age range of humans
+average peptide spectral matches
+hundreds of nanomolar
+R IBM 0
+selectionist
+Phylogenetic trees with molecular clocks
+reduced F cleavage
+changes in virulence
+catalyzed thiol-disulfide exchange
+52%
+Escherichia coli strain DH5α
+Pneumonia etiology studies
+129
+community assembly data
+66, 89, 96, 99 and 100 per cent
+TRIzol Reagent
+65 ml/kg
+repair of the injured lens epithelium
+10
+A short region of the NS5 gene
+Biomed, China
+increased risk of heterologous A09 illness
+cytokine
+succinic semialdehyde dehydrogenase
+Pro76 and Gln73
+the infection in the lungs
+China
+Axioplan 2 Imaging
+Clontech's TALON Metal Affinity Resin
+Ther eaction
+Agilent Scanner G2505C
+CTL response
+Human tissue
+CC10-treated
+Apdm09
+machine learning
+ModFit LT curve fitting algorithm
+The ENC
+Myc-Sirt1
+The use of communications
+GP
+day 9
+increased survival
+twice
+1918
+Mutation sites targeted to influence overall activity
+Females
+FastDigest Restriction Endonucleases and Phusion polymerase
+216
+geNorm V
+lamin cleavage site
+10 min
+33uC
+pandemic
+CWP232228
+between 9 and 22 months
+circulatory shock
+4 h
+a trained study worker
+4,380
+31.1%
+acetylated histones and BRD4
+1.41 to 2.00
+composite primary key
+two-dimensional random diffusion model
+Peripheral
+Six
+39
+Qiagen RNAeasy columns
+4.3%
+differences in the ligands
+CD4 + CD25 + Foxp3 + Treg
+interferon-induced transmembrane proteins
+Termination-reinitiation frequency
+1975
+once a month
+Dry cough
+a signaling cascade
+did not exist
+TCR
+Subgroup FeLV-A
+20 µL
+Non-specific cross-reacting bands
+~30 nm
+an explanation
+20
+74
+face velocity, fiber diameter, packing density, filter thickness and charge density
+1968
+acute fibrinous or organizing pneumonia
+0.2
+public trust in government
+coinfecting agents
+three
+Mathematical models
+increased endothelial permeability
+NE
+6°C
+Strayer's group
+Hazard ratio with 95% confidence interval
+effector memory T cells
+industry guidance
+ZðtÞ
+extracorporeal membrane oxygenation
+29%
+molecular docking studies and thermodynamic analysis
+Elastase
+11
+Incident of renal replacement therapy
+functional NSs protein
+HEK293 cells
+anti-HIV drugs
+by adding up the number of daily cases every seven days
+viremia
+a gradient
+100%
+similarity to reference databases
+C5aR
+elongation mediated by viruses
+previous findings based on immunohistochemistry
+Ethics approval and consent to participate
+selenocysteine and pyrrolysine
+2 h
+clues for therapies
+inflammatory responses
+2,377
+À 1 frameshifting
+Oidium lycopersicon
+acoustic cavitation
+integrated relative error
+parts of the mature domain
+rotavirus infection
+non-sense mediated decay
+13 ± 5%
+The treatment showing greatest therapeutic efficacy
+novel vaccinal approaches
+diversified steroids
+myocardial infarction
+0.154 and 0.188
+Infection
+four days
+Herpesviruses
+Protein Data Bank
+strategies that optimally exploit the use of IL-17
+nongroup A streptococci
+30.6%
+endonucleolytic nicks
+research into human locomotion
+mRNA reduction
+critical
+five days
+African
+Uganda
+Vimentin and CD209
+Johnson & Johnson
+RPKMs
+poliovirus capsids
+particles
+1 µg 7SK-as RNA
+competitive exclusion, superinfection, recombination
+Public distrust in journalists
+Resource Description Framework
+ACE2
+1000
+red deer
+9
+four weeks
+Plasmodium knowlesi
+host RNA synthesis
+five
+one per 309,312 bp of sequence
+individual-cell components
+Negative template controls and positive controls
+viral antigens
+2019-nCoV
+1.02 nM
+78
+46 h
+close connectivity to China and south-east Asia
+logarithm-transformed antibody levels
+R. australis infection
+Serum-free DMEM
+oral health status
+RNase L antagonistic
+CP32M
+10
+necrotic
+effective therapeutic strategies
+IFNa production
+improvement of detection methods
+Chest-X rays
+stakeholder
+30 min
+large outbreaks occur with significant probability
+12 months
+poor/insufficient preventive practices
+54 days
+unknown
+vinyl chloride material
+1 × 10 1 copies
+local pharmacies
+chimpanzee studies
+GADD34
+integer number of segments
+CD8 + T cells
+more than 100 million
+Tissue
+membranous
+Intravenous or intrarterial injections
+RNA-seq
+Student's -test
+less
+cc0
+pattern recognition receptors
+viral structure and function
+hand washing and use of mask
+Toxocara infection
+progressive disease with high mortality
+bone marrow
+many studies used modified AKI criteria
+constant vs. age-dependent mortality rates
+21 days
+disintegrates
+cardiovascular disease
+microplate reader
+18
+3,000-fold
+MBP
+TP model
+Substrate binding
+six
+TLR7 and TLR9
+whether they are critical genes in the response to MDV infection
+men
+Thirteen
+diploid cells
+The nature of the release profile
+Lys291 and Lys292
+11,700
+Capillaria species
+Intracellular Zn 21
+Mca-APK-Dnp fluorogenic substrate
+Pregnancy
+23
+synthetic social contact networks
+to distance the fluorophore from the cleavage site
+non-toxic
+370
+people who are in
+Health
+vascular
+Dkk-3
+LAMP1
+Metropolis criterion
+Ca 2+
+LYC-OA
+acute respiratory distress syndrome
+141 mm
+2009
+18
+virus titration and pathology per day
+vivo
+Hasegawa-Kishino-Yano model
+Apoptosis
+45 days
+96
+2012
+140 μl of each sample
+353
+traditional lectures
+AMI
+16%
+NCBI's Gene Expression Omnibus
+25%
+22
+15
+50%
+responses to variation in sodium and potassium intake
+shRNA expression plasmids
+0.45%
+Cg1
+supernatants
+p38 MAPK
+L. braziliensis
+Weibo
+pulmonary pathophysiological
+intravenous
+Cell monolayers
+linkage-specific reactivity in EL4 lysates
+Three
+PD-1 and CTLA-4
+plasmon-enhanced fluorescence
+nine
+1-15%
+phosphorylation of eIF4E
+Immunity
+strict correlation
+proteasome activity
+12
+4G5
+mice and rhesus macaques
+300
+IRE1, PERK, and ATF6
+XML
+TII cells
+MMP7
+highly heterogeneous concepts
+28-day
+those reported in Hapmap
+sadness
+Independent Nearest-Neighbor Hydrogen Bonding model
+conserved regions of the genome
+30 min
+12°C
+Equine Arteritis Virus
+CD209
+host immunity and pathogen virulence
+500 μg/ml
+HHV-6 infection status
+reduced circulating lipid levels
+PRPF31
+Simplified Acute Physiology Score II
+Aqua
+antioxidants
+TRIM21
+NaCl
+Pearson χ 2 test
+ωP
+Image Pro Plus
+R2 = 0.78
+five
+controlling the population of active Kir2.1 at the plasma membrane
+64
+higher-transmissibility scenario
+A site
+January 20
+7000
+several questions
+Human memory B cells and plasma cells
+NZ European
+pneumonia-related ARDS
+bird counts with selected sampling and PCR testing
+Neutral red -containing viral stocks
+Sputum purulence
+S100
+genetic drift
+their genetic distance to their MRCA
+12.9%
+affinity on the edge of the OTU-ISG15 interface
+2012
+synergism
+in the following way
+135
+ts53 and wild-type viruses
+CFSE
+neutrophils
+guidelines
+the makeup of the matter between the respective electrodes
+the principle of close proximity interaction
+30
+excellent immunogenicity
+mice
+20
+knockout of expression of the corresponding viral protein
+data regarding vaccination status and oseltamivir prescriptions
+591
+LPSinduced NO and PGE2
+Cross entropy
+western blot analysis
+acute gastroenteritis and severe watery diarrhea
+2
+Cell Culture of Human Cell Lines A549 and HEK293 cells
+three
+0.69
+μ
+the peak and final size of the outbreak
+four
+CaCo-2 cells
+tumor size and location
+Herd immunity threshold
+Vaccination
+RNA integrity
+cm
+High force
+The density of the MAb 9.2 reactive bands
+protein-protein recognition
+influenza
+663
+protect commercial poultry operations and subsistence farmers
+Meleagris gallopavo β 1 -AR
+neutralizing monoclonal antibodies
+100
+white blood cells
+N6
+200
+Wet Bulb Globe Temperature
+immunofluorescence assay
+to develop effective preventive and control measures
+EMCV-infected wt mice
+30
+s
+an RNA virus mutagen
+rotary
+error rates
+Joint hypermobility
+higher mortality
+More detailed epidemiological studies
+high performance liquid chromatography
+F4/AS01 and AdC7-GRN
+preanalytical and the analytical procedures
+Four
+The amplification of GAPDH
+24 h
+direct contact
+Three
+ATP
+wavelet coherence
+>600,000
+McCloskey, Brian; Heymann, David L.
+heat shock
+Biochanin A
+macrophages or dendritic cells
+positive
+condition
+724
+host-derived lipid membranes
+prevalence
+1 min
+A threshold
+Five
+24 h
+6 months
+9 to 43 amino acid residues
+exceed the response
+10 mg/mL
+non-pharmaceutical intervention
+IL-8
+ventilator days
+canine airway tree
+PRV vaccine strain Barth K61
+90 days
+33 per cent
+critical
+chikungunya and Zika
+46.7%
+16
+additional factors were influencing drug delivery
+the background image
+mathematical models
+thirty
+animal lectins could be strong candidates of receptors for GPs
+Lentiviral particles
+infected or transfected cells
+Figure 6A
+CEACAM1
+cutoff choice
+inducible recombinase transgenic lines
+signaling cascades
+binding specificities for ClfA and alpha-toxin
+DS-Cav1-adjuvant mixtures
+twice
+predefined connectivity between locations
+thousands
+Influenza A virus
+feces of diarrheic pigs
+how the sequences can diverge
+entry and infection by members of other virus families
+over 100 million
+31%
+compound 3m
+rotavirus
+increased
+fourth site A
+HIV infection
+environmental factors
+The ACT
+gene expression-based molecular characterizations
+a functional emergency medical response system
+influenza H1N1 virus
+CFTR
+the corresponding author
+linear regression
+Acute lung injury
+18 h
+site 39
+Basic Local Alignment Search Tool
+Chinese CPV-2c strains
+pNP-saccharide
+87%
+PCR
+preoperative VA-ECMO
+controlling
+differential causes
+95,835
+ubiquitination
+disorders of the central nervous system, trauma and sepsis
+Related searches discovery tool
+six
+MapReduce
+491 and 581 bp
+16
+KSHV and EBV
+Immunofluorescence assay
+Investing on Aedes associated ZIKV advanced operational research
+C-type lectins
+0.35 to 10 µm
+yeast life span extension
+Imaris software
+GRK2 kinase activity
+oligomerization
+275
+11
+influenza A
+Cog4 and Cog7
+Two
+200
+bioinformatic
+between passages 3 and 10
+increased caspase 3/7 activity
+luciferase reporter constructs
+Transient association of functionally related components
+respiratory
+missing classifier
+myeloperoxidase and CD68
+signal transduction pathways
+initial similarity searches
+the wt
+36 weeks
+Colony forming units
+HFIP in DCM
+Ten
+1.3 years
+AIRS
+to ensure intracellular amastigote growth
+positive
+Mamu-A4*14:03
+three splice sites
+Additional file 1
+1 h
+health seeking behaviors of the population
+bacteriophages
+protection against weightloss
+three
+two
+Sangon
+coiled-coil
+29 pmol/ml/min
+Airway epithelial cells
+limited plasma volume available
+Western blot
+evolutionary adaptation of a species to novel environmental conditions
+almost five million
+PI3P production
+G_RUU_UUU
+C2
+postvention
+Microarray analyses
+intracellular membrane tubes
+slight differences among the different subtypes
+Multidrug-resistant
+Cuizhu, Huaqiang North and Huafu
+Accommodations and incentives
+counterintuitive results
+Membrane-destabilizing peptides
+NES3
+Camels
+3I14 in mediating ADCC
+daily data
+G. dewevrei
+1.72 nm
+immunological elucidation of other pig-pathogen interactions
+3 days
+hypotension, inflammation or prolonged survival
+0.5
+Adhesion
+model deviance
+more severe kidney injury
+32 weeks
+cc-by
+Neutrophils
+p68 Gag and p3 Gag
+platelet
+Transepithelial electrical resistance
+CRY2/CIBN fusion to inositol phosphatase
+1|5|5~25
+720
+The RNA extracted from FTA cards
+indirect selection of mutations
+apoptosis
+53
+E. coli O157:H7
+33
+antiviral
+96-well plates
+antiviral
+30.8 nM/min
+to assist clinicians in the diagnosis and treatment of viral diseases
+Blast2Go
+SDS-polyacrylamide gel zymography
+Progeny viruses
+Respiratory syncytial virus
+2 h
+clinical and radiological findings
+sSBV and SBVDNSs
+predominant
+68%
+phylogenetic
+attack rate
+47 and 62%
+age distributions in 5 year age bands by administrative area
+0.005 EU/mL
+Hereditary spectrin deficiency
+every 3 days
+sialic acid receptor binding
+antibody therapies using incomplete antibodies
+Bowman-Birk
+A broad set of haplotypes
+selfoligomerization
+Economic risks
+September
+identification mistakes
+cell viability of human osteosarcoma cells
+improved goodness-of-fit and somewhat improved discrimination
+16.28 units
+day −1
+~60-100 nm
+90.2%
+ITCH, WWP1 and Nedd4
+Cytokine-containing media
+family signature motifs
+Deborah Diamond
+protein
+human proximity
+cancer associated antigens
+reporter gene or modi fi ed gene expression
+to deliver Met-tRNA i Met to the ribosome
+ciliopathy
+bioactive
+Five
+expression patterns
+plasmodium infection
+TOTO-3 or Vectashield mounting medium with DAPI
+four
+the lung
+HRV 3C protease
+at the top of the circle
+Red Cross Children's Hospital
+100 KDa Millipore tubes
+16
+PRSS1 and PRSS3
+2-sided unpaired t-tests
+5%
+ISGs
+pharmaceutical immunomodulators
+TRIzol
+Age-and sex-associated differences in exposure and severity of infection
+2
+Travel as risk factor for an influenza infection
+G
+the sampling and the number of sessions
+broncho alveolar lavages
+150-300
+individuals
+MC filed
+93%
+texts
+70-80%
+glial cells
+negligible virucidal effect
+vaccination
+2010-04-27
+a vaccinia virus vector
+≥4
+Joshua Lederberg
+crucial
+2,851
+two identical inverted terminal repeats
+Spherical IAV particles
+250 × 10 3 /mL
+ACE2
+Nucleic acid diagnostics
+dystrophin restitution
+95%CIs
+their critical role in the initiation of Ag-specific response
+Educated and literate populations
+Korean bat Miniopterus schreibersii
+inflammatory
+a multigene family
+acute respiratory infections
+Paired-end sequencing 2 × 100 bp
+conspicuous
+15
+T cells
+5
+PS-dependent
+eight
+nuclear factor-κB
+disease severity
+lower
+150 µL of 1x dPBS
+hippuristanol
+2001
+membranes
+E. coli and S. cerevisiae
+murononab
+case reporting rate and specificity
+all protein import pathways
+co-morbid conditions
+30 min
+N-terminal half
+a volume of PBS equal to the volume of stimulation reagents
+zeroes
+nucleolar accumulation
+mechanical ventilation and oxygenation
+viral nucleoprotein
+L11 P-site loop
+two
+MRW
+TLR8
+random
+Nigeria
+Cytometric Bead Array Mouse Inflammation Kit
+human diseases
+latent class analysis
+the surface of the heart
+Autographa californica Nucleopolyhedrovirus
+2.5 3 10 5 to 2 3 10 7 events
+blockage
+three
+amino acid changes
+very similar results
+high-level expression and protein stability
+developmental time is a significant factor
+Aquavac IridoV
+graphic enhancement
+phosphorylation of Egr-1
+current technological advances
+under 40 years
+guinea pigs
+binding and catalytic activities
+larger
+ILI or other forms of surveillance data
+crawling and gliding
+two
+CX3CR1 and IRF4
+a devoted and reliable spouse
+interpretation of KIH interaction networks
+disease severity
+Logistic regression
+RANTES
+p50/p65 heterodimer
+62%
+~25 times
+intron
+83%
+EBV pathogenesis
+6
+θ
+100 µL of the mixture
+Pfam
+M
+2
+E154
+Parker Hydrophilicity
+continuous attempts in the rational design of melanocortin receptor molecules
+21 dpi
+2.8%
+21
+bioinformatics software tools
+70.3%
+6 and 12 ml/kg
+type II
+4 h
+HI metrics
+N protein expression
+Fc gamma receptors
+lower
+one hour
+indirect selection of polymerases with higher mutation rates
+U6 mRNA
+Hsp40 and P58 IPK
+reverse transcriptase-polymerase chain reaction
+public, commercial, or not-for-profit
+clonazepam
+5000-10,000
+One hundred twentyeight thousand four hundred twenty
+maximum likelihood estimation procedure
+inverted microscope
+The oil spill and oil-free surfaces
+combined intervention strategies controlling infection, inflammation, and necrosis
+1 h post-MRSA addition
+Influenza vaccination
+negative
+56 DCs
+Twelve
+spinal cord stimulation
+the standard deviation of the mean
+monocistronic
+0.2 µg/mL
+~20%
+eight
+E. coli
+Rio Declaration on Environment and Development
+fetal
+36%
+IgA
+the slope of the linear fit and its 95% confidence interval
+macropinocytic pathway
+haemolymphatic
+the prevalence of Borna disease
+65 years or over
+GAVVALSTTFA
+13.8%
+an uptake scan
+Sir Tim Berners-Lee
+surprise
+long TSS isoforms produced from the neighboring genes
+AUC
+Heat-killed SCHU P9 antigen
+myristylation
+passive
+33
+Colostrum and milk
+lipid metabolism and the interferon response
+2,992
+58
+three
+low frequency of GFP + events
+the geographic distance
+thaumatin-like protein 5 and 33-kD
+the virus circulating through the aphid
+essential
+GDS-15
+polyplex
+63.26%
+.50%
+IFN-λ 1, 2, 3 and 4
+Medium containing both chloramphenicol and spectinomycin
+haemangioma development
+surgical masks
+psycho-social
+6,500
+postcolumn infusion experiments
+means, standard deviations, medians, and percentages
+43
+RIG-I knockdown
+36
+TREM-1
+Forty-eight hours
+Oral rehydration solution
+Direct ascertainment of R a and R a,t
+cc-by
+pHylox2
+48 h
+filovirus infection
+total disagreement between prediction and observation
+four
+fragmentation of chromosomal DNA
+electronic
+unpaired t test
+229
+TG mRNA
+>40%
+2.9%
+natural killer cells and cytotoxic T lymphocytes
+serial interval events
+Western blots
+0.3%
+ketoconazole
+15
+holding places for suspected Ebola cases
+immunosenescence
+IL-4
+GO term enrichment analysis
+20%
+Molecular Medicine
+capped dicistronic
+endothelial cells
+chemoresistance
+alternative folds involving L2
+three
+high-quality
+Cholesterol, tocopherol, or bis-lipid moieties
+six-month
+poorly soluble in water
+repetitive sequences
+programed cell death
+immobilized metal ion affinity chromatography
+Oxidative stress
+MegaBLAST
+92%
+AIDS patients
+PfRH5 and PfRipr
+peptidoglycan spheres
+SMAD4 and TGFBR2
+Five
+mAb 8C6
+Ventricular hemorrhage
+4,168,266 bp
+73%
+stress-induced autophagy
+suppressive
+effect of soluble factors from PBECs on PDC functions
+strawberry preserves
+obesity
+A variety of methods
+mice
+6.7 Ϯ 0.5 hours
+Toehold switch RNA sensors
+temporal sequence of infections
+case report form
+pgsA/L. casei
+female
+extracellular matrix
+four
+National security
+a symmetric approximation of the empirical fluxes
+mutational bias
+limiting IFN-I's contribution to ongoing immune activation
+contagion
+Sera
+cells of the myeloid compartment
+Rep ctrl and rep exp
+lymphatic spread of liver tumours
+50
+clarithromycin
+Proteins
+inhibition of VEGF-mediated angiogenesis
+virus neutralization by VRC01
+gp120 disulfide bonds
+1.5-fold
+Severe fever with thrombocytopenia syndrome
+ferrets
+complex
+105,050
+ribosomes
+517
+50%
+Wild type VSR plasmids
+Eight
+lung
+100%
+9A8 mAb
+2017-05-11
+Knockdown of endogenous EK
+GSK-3β
+mediators
+regulatory
+a correlation with disease severity
+1,000
+Thirteen
+LacdiNAc
+10 µg/ml
+12
+four
+CodMod
+indirect information of the proteins role in disease
+apoptosis
+exhaustion
+c 0
+300 to 350 g
+if the solution used has a composition that is optimized for the LAMP reaction
+10%
+saturation
+MS/MS
+potential synergistic and antagonistic epistasis among variants
+10 cm
+downstream amplifier
+traditional ritualistic practices
+regression or time-series analysis of seasonal ILI data
+IECs
+CD11b + Ly-6C hi monocytes
+Atherosclerosis
+Caspase 10
+more efficient and effective use of these limited resources
+HIV-1 attachment and infection
+10%
+lung mechanics and oxygenation
+1.6
+USPs
+intracranial instillation of wtVSV
+mucosal immune barrier
+alveoli
+Open lung biopsy
+alveolar pressure
+52
+veno-venous extra-corporeal membrane oxygenation
+C3a, C4a and particularly C5a
+animal care
+18y
+copy number differences
+Area Under Receiver Operating Characteristic
+genogroup II
+four
+Media
+Multi-tasking
+physiological affinity range
+4,453
+100 FFUs
+Algorithm 1
+spleens
+Statistical analysis
+100% methanol
+selective autophagy adaptor proteins
+Phylogeographic inferences
+IFN-SNPs
+host species-specific difference in viral entry receptors
+those with neurological diseases
+498
+active bleeding or rebleeding
+NlaIII anchoring enzyme
+three-quarters
+German animal welfare act
+mRNA expression
+4 mg/mL
+3,064,887
+0.847
+limited number of sites and target pathogens
+indirect flight information
+Gram-negative bacteria
+NOX2
+SIGNR3
+Hematology and serum chemistry analyses
+super-resolution microscopy, nano-SIMS and EM
+59CCAGTCAGAACCGGAAAGCCA39
+modulates eIF4A activity
+1.56
+15 min
+F = 222.19
+HCMV replication
+between 1-5 days
+antigen-specific antibody secreting cells
+five
+Specific Abs
+SPIs
+serum PTX3 level
+Mann-Whitney U test
+Ribavirin
+TRIzol
+3 weeks
+IL-35
+Largest Population
+endothelial cell growth medium
+an OTU
+positively regulates
+isolation chambers
+100,000
+Serum samples
+34%
+USP18
+a path of length 1
+20 million generations
+Clonogenic assays
+>1000 revisions
+hydrophilic
+25%
+II
+simian adenovirus
+three
+Appion
+NO
+18
+porcine teschovirus
+more than double
+2,6-sialyllactose
+Trolox
+please fill all the GPS distance in the blank
+11ml
+IBM SPSS Statistics 20
+the infection with OPV
+linear and circular
+vision or intention
+1 h
+Poland, Italy, Spain, Denmark, Germany, and the United Kingdom
+Lipidomics
+Stable oligomerization of trimeric subunits
+a full consensus AU-rich element
+The trimerization of the CLZ domain
+cc-by
+The information sharing protocol
+Prolonged denudation of the basement membrane
+infected NHBE cells
+T cells
+an emerging epidemic
+6 months
+ACEI and ARB use
+81.5 years
+Relion3.0beta
+glass beads
+O:1a
+Clontech
+a mouse model of OIS
+accumulation
+$20 nt
+Matrix blank
+four
+20 μ m
+immunostaining in the HCs
+7-15 years
+unpredictably
+Oral and nasal/pulmonary
+viral
+Spermine
+substantial reductions
+100%
+related to this study
+pRb-binding domain
+identical
+Marburg virus
+1000-fold
+DHA
+antibody-dependent infection
+a contact matrix
+Western blot analysis
+fluorescent
+FeatureCountsv1.5.0-p3
+Eight
+Flexiviridae 1 and Closteroviridae
+health personnel, primary and critical healthcare facilities
+Rhipicephalus pulchellus Tetralaris
+endosomal release of vectors
+mosquitoes
+Growth medium
+pro-inflammatory
+~50%
+murine
+adaptations to the host
+TissueLyzer LT
+Group 3
+quantitative temporal viromics
+financial savings
+21,121
+infect
+jl S
+2ˆ10 5 cells/well
+100%
+4%
+Flow cytometric
+confocal microscopy
+highly significant
+influenza
+Zika modeling
+IL-2, IL-4, or IL-17A
+efficient function of the incoming viral genomic RNA
+DS and CP
+Overexpression screening
+2 × 10 3 TCID 50
+array
+telomerase
+binding immunoglobulin protein
+Pre-DCs
+water mean temperature
+human adenovirus
+Neutrophils
+Re-blot Plus Mild Solution
+cells
+12%
+women
+transmissibility
+Hyperactivation of some inflammatory cells
+3 days
+18
+pre-rRNA processing events
+encephalitis and pneumonitis
+drug administration error
+three
+PCR product
+four
+7 days
+Cox proportional hazards regression model
+to avoid immune surveillance
+antisense nucleotides nucleotide 2 or 2′
+Npl4 MPN groove
+cross-reactivity
+Leica confocal software
+hormonal
+Orthomyxoviridae
+672
+Foucauldian discourse analysis
+one
+12
+ALI in sterile systemic inflammation
+Six
+Isodielectric
+statistically significant
+51 to 80 per 100,000 under-five children
+twice
+inflexible
+global screening
+NSP2
+7 h
+macropinocytosis
+Three
+The Simulation Wizard
+blood monocytes and dendritic cells
+constant electron charge density
+Targeted temperature management
+35,854 mmHg/min
+QIAamp DNA Stool Mini Kit
+contaminated water or food supplies
+quantitative
+47.1 years
+The patient's consciousness and respiratory function
+tools from graph theory
+late stages
+immune-regulatory function
+sequence analysis
+38-41 kDa
+F incorporation into virions
+30 min
+cc-by
+ORF1
+The authors
+Spleen samples
+eighteen
+Taiwan
+influenza A
+barriers
+IRF1 occupancy
+RHuIFN-α
+evading mosquito immune response
+Thirteen
+100%
+A trimer of GP 1,2 molecules
+4
+American Type Culture Collection
+50%
+225
+YGS-DDI
+mouse
+Bell model
+Cow
+anti-Ub and anti-UFM1
+PVC
+HBoV1
+IFN-γ expression
+five months
+sterilizing microorganisms
+mutagenic
+iNOS
+10 µM
+rodent
+fair sharing of benefits and burdens
+middle to below-middle
+brain homogenate
+718
+2 h
+TRPML1/MCOLN
+Target-spike levels
+Mimivirus
+MPG
+FlowJo
+474
+40
+EST2 mRNA abundances
+Epistasis
+Prism 7
+eight
+C3a and C3b
+monocytes/macrophages and dendritic cells
+NAb titres to ChAdOx2
+Data of clinical characteristics obtained from our literature review
+neurotropic Pseudorabies virus and lymphotropic retroviruses
+log likelihood
+decreased
+The oral cavity
+Cultured Acanthamoeba trophozoites
+1 mg of total RNA
+90%
+Creative Commons Attribution 4.0 International License
+higher inflammatory state
+The overall effect from meta-analysis
+50%
+ectoparasites and a few nematodes
+two different combinations of 5 immunogens
+databases and Pubmed searches
+high-throughput sequencing technology
+Gene expression coefficient of variation between different groups of individuals
+ventilator dependence risk score
+9 lg of hemagglutinin
+MIR19A
+Fifty-one
+written informed consent
+protein processing and modification, proteasome synthesis, and galactose metabolism
+epidemics
+ΔG est,i
+TruSeq DNA Nano Kit
+ImageJ
+QIIME
+E62H
+Level of cognitive function and/or terminally ill status
+4,298
+blunting in vivo influenza A virus infections and preventing virus-induced disease
+100%
+leisure facilities
+its effect on the developing fetus
+restructuring one's perceptions to come to grips with situations
+4
+high specificity and PPV
+monobasic
+10 2 copies/ mL
+67.9%
+GeoChip 2.0
+50%
+evolutionary changes
+More than 50%
+30 µl
+Ribavirin
+at the early stage of PRV replication
+-strand synthesis
+1% mf
+the characteristics of the population studied
+qPCR
+48 h
+180
+cytotoxic
+β -galactosidase
+detection of cancer markers or interleukins
+PEG
+5.3 g/dL
+Fcgr2b signalling
+cultural differences
+all passengers will be quarantined
+90%
+apicolateral
+critical coverage
+Wuhan
+3.5 kDa
+IFIT1 or IFIT5
+Tlr4
+day 28
+22
+Filoviruses
+24.7 AE 3.8%
+Digoxigenin
+anti-NF-κB and anti-NLRP3
+metastatic mineralization
+LRTs
+not defined epitopes within gp120 or gp41
+HCV Amplicor Specimen Preparation kit
+PERCH
+Annexins
+HPV05
+Guangxi Zhuang Autonomous Region
+circular
+serotype replacement
+vectors
+Total nucleic acid
+Chi square or Fisher's exact tests
+Extracorporeal membrane oxygenation respiratory support
+Strep-tactin
+epithelial
+ARP1 and ARP3
+Reports of sample handling effects
+13
+effectors in saliva
+fluorescence
+Thirty-two
+cohorts with H1N1 patients
+A375 control cells
+threataffect
+acidic
+Amide hydrogen/deuterium exchange
+bucketed/integrated spectra
+target cell type
+Rhabdoviridae
+parrot bornavirus 1 to 8
+broad-spectrum
+American Type Culture Collection
+Tris-glycine gels
+33%
+3D-Gene FFPE Gene Expression Analysis Reagent kit
+use of mobile devices
+MN219409
+overexpression of Rev or hnRNP A1
+asthma
+cleavage of the probe
+airborne transmission
+Selleck Chemicals
+viral nucleoprotein expression
+USP18
+archive log
+Trajectories
+normal distributions and a Euclidean distance
+viroporin
+singletons
+conventional surgery
+39 and 59 end regions
+LDH
+four
+short time span estimates
+neutralization activity
+IFITM3
+Anti-ZIKV IgG antibodies
+77
+mitochondrial DNA-encoded protein expression
+1 week
+κ
+four-point scoring scale
+13
+potassium carbonate
+quality of notification data
+90%
+95% per year
+multipartitism
+statistically significant difference
+attachment to ERA was significantly lower than to PP
+several months
+RNA
+SpeI/SandI and SandI/EcoRI
+Interleukin 1a and IL-1b
+33 months
+C3a and C5a
+active viral replication
+T.K.
+93.2%
+reducing MT markers or improving metabolic health
+functions in the regulation of cardiovascular and renal functions
+highspeed spreading
+transgenic
+cytoplasm
+Five
+IgG
+chains of transmission across consecutive school days
+false
+R i
+5.0 µM
+37.84%
+CD Hybridoma
+One-dimensional
+TFR1
+metabarcoding
+Kaplan-Meier plots
+96
+human phospholipases
+two
+immunofocus forming assay
+Dilutions of PAA, GDA and the alcohols
+D 2 DR/βarrestin-2 interaction
+epidemiological
+an HA tag
+Between sub-populations
+water-insoluble toxic cell wall components of the bacterium
+Renilla luciferase gene expression modified
+apical side of palatal epithelium
+Malnutrition and diarrhea
+CN
+unmanned aerial systems
+stochastic simulations
+a measurement tool to assess systematic reviews
+Thermo Scientific Revert Aid First Strand cDNA Synthesis Kit
+English
+an immune response
+8
+DOCK 3.x programs
+reasonable speculations
+free radicals, fatty acids or inorganic phosphate
+mutation
+inflammatory cells and kidney cells
+7350
+490 nm
+T cell
+diminishes blood pressure and glomerular injury
+Viral RNA mini kit
+1%
+10
+AT-511
+stimulatory
+tracheal lavages
+glutathione
+b-glucuronidase
+HFNC < HFNC+PP ≤ NIV < NIV+PP
+enhances the type I interferon expression
+Pearson's, Spearman's or Kendall's
+Multi-run metadata
+54.8%
+HMPV positive clinical samples
+DnaSP
+March 2010
+buffy coats
+Tioman virus
+neurotropism
+clear cell tumorigenesis
+14 days
+GS-5734
+HCV and VSV replication
+158
+NK cells
+Molecular Medicine
+12
+Xs ik and Xa ik
+duck
+2 or 5 days
+>95%
+Hemagglutinin and neuraminidase
+>80%
+one-third
+HFMD
+opal stop codon
+endogenous opioid
+2026
+the precursor form GPC
+Twenty-four
+a ij
+Nigeria, Ivory Coast and Senegal
+Genome defence
+0.1 J cm −2
+one
+10.2/100,000
+17798
+mathematical models
+blastn
+protein quality
+genotype and allele frequency
+Array-Pro Analyzer
+The SPR phenomenon
+6.94
+overloading the cellular folding and post-translational processing apparatus
+silver
+gastroenteritis
+IGR IRES-mediated
+18
+QIAquick Gel Extraction Kit
+nine
+The parameters of the algorithms
+HIV-1 entry
+catalysis
+apoptotic DNA fragmentation
+epidemiology, clinical features, and treatment options
+excessive neutrophil activation
+ratio discrepancies in gene expression experiments
+low
+200 µL of dimethyl sulfoxide
+disease reproductive number
+virus-host interactions
+liquid nitrogen
+China and Uruguay
+Male Swiss-Cox mice
+70
+5-19 yr olds
+30 min
+RNA-Seq data
+102
+TNF-a
+∆F
+RQ1 RNase-free DNase
+Two
+neuroinflammatory
+Rhinoviruses
+anti-oxidative capacity
+elevated temperatures
+18 days
+SP6 transcription
+four
+hydrophobic
+112
+dissemination and neurovirulence
+different reports
+Evans blue dye
+standardized difference and p values
+Intuition
+R
+an aphid-specific watery saliva protein
+Kaohsiung Medical University
+Cell lysate
+Tf-EE
+Melting curve analysis
+SpectraMaxM5 plate reader
+significant
+kelch-like protein 9
+Health facility transmission
+worse
+palliation
+by promoting ERK pathway activation
+three
+Five hours
+10% to 50%
+its solubility
+Virus-derived epitopes
+ecological niche modeling applications
+Four
+Intractable
+Acute Respiratory Distress Syndrome
+less than 50%
+HLA-DQ/DR
+changing the social parameters
+KEX1
+500873
+N-Viral RNA complex
+GTR+G
+erastin's lethality
+UTRs
+bacterial alcohol dehydrogenase quinoproteins
+PCT
+cognate naïve T cells
+hippocampus
+4-fold
+Disposable protective gloves
+Correspondence analysis
+elimination of all P. falciparum
+30
+heavy metal ion tags
+200 pfu/gr
+Pathogens
+atrophy of immune system organs
+crystallographic
+four
+8 hours
+Macrophages and dendritic cells
+Titron X-100
+eleven
+STAT1
+IC-ELISA, LIPS and nucleic acid-based tests
+Bruker REFLEX MALDI
+group B
+NeST
+Sensitive reactions to recombinant antigen gD
+MeV-Alaska
+M1 and NS1B
+Modification indices
+respiratory
+Epigenetic changes
+Micro-Cal ITC200 isothermal titration calorimeter
+SIV plasma viremia
+46.8%
+30 minutes
+human RNAse P
+mutational spectrum of ASPM gene
+knee angle
+increased expression, distribution and re-organization of AQP9
+Dendritic cells
+colocalisation
+Edmonston
+dormant or quiescent cell nucleoli
+vascular development and trophoblast behavior
+5 ng/ml
+Fisher's exact test
+test method
+H2O
+AnchorDock
+276
+21,085
+complicated
+AUGUSTUS
+antibody-dependent
+7 months
+in-frame translation
+Comp#1
+cold CIT Wash Solution
+Genes
+Lipofectamine RNAiMax
+four
+B-1a cells
+15
+100 mg of LTA and 700 mg/kg Dgalactosamine
+Berberine
+release of transaminases and histology
+Bayesian prediction modeling
+WHO study coordinators
+a synthetic population
+aseptically
+bacterial pneumonia
+1 or 10 mM NaIO 4 pretreatment
+vertebrate prey
+cytoplasmic mCherry expression
+machine learning
+high serum levels of NSE
+M. glareolus hepacivirus RMU10-3382
+J399EM
+CaMKKβ -AMPK-mTOR
+reBmBac-silkworm expression system
+70-90%
+20 to 61
+those recently reviewed in the literature
+Linear multiple regression analysis
+significantly higher
+The arrangement of the genes
+87
+Stanford TNG Radiation Hybrid Panel
+feature extraction, amino acids classification, and residues deletion
+colonization in the gut and infection of the bladder
+Lipid vesicles
+25%
+data from individual mice
+apoptosis and inflammation
+22.8%
+10
+10 min
+publication of this article
+MEV NS1
+predicted mortality, sedation strategy and PEEP strategy
+non-random
+8
+reachability
+rRNA degradation
+social distancing
+human tetherin
+A detailed description of the different substrate trapping protocols
+ACE2-Ang -mas
+MCP-1
+Predicting the potential for vaccine reversion
+ART
+green fluorescence
+probabilistic models
+Pearson coefficients of determination
+E-toxate
+N-terminal sequencing of the products
+j
+β-glucuronidase
+1341
+SAS
+50 ng/ml
+epidemic
+4 weeks
+viperin
+pigs, bats, and cattle
+fibrosis
+threedimensional
+NHE-1
+HIV V2-apex bnAbs
+86%-100%
+direct inoculation of pathogen
+Proteins N, P, and L
+Cla and Clb
+intrinsic risks
+3I14 in mediating ADCC
+compartmental models
+protection experiments
+moderate to high
+H5N1 HPAI
+oneway ANOVA
+Structural studies
+social contact networks
+to assimilate the ILI/Wikipedia data into the transmission model
+bioluminescence
+Chemotherapy
+did not stabilise NSs
+post-exposure time-dependent and particle-specific differences
+proteinase K
+complex I deficiency
+fatigue, joint pain as well as loss of appetite and memory
+Tobacco mosaic virus
+Odyssey Imager
+were not significantly changed
+choose another hospital
+Western blot analysis
+TGF-β levels
+chronic inflammatory disorders
+evolutionary surveillance tool
+ability to act to reduce pathogen fitness
+6
+increased blood pressure
+enhanced
+NMM
+tumour progression, resistance to chemotherapy and poor prognosis
+21 days
+More than 3 billion
+compound 3a
+H74L
+The World Health Organization
+segments
+CSFV NS3
+The network of relationships between minerals and biology
+6.5 million
+open source databases
+how DIZE is mediating its effects
+subtype-specific primers
+anti-psychotic
+bound conformations
+20-30%
+Apical membrane antigen 1
+five
+2.54
+preparedness for infectious diseases
+fingerprint-based methods
+controlled infection of nasal cells from multiple individuals
+32
+easily identifiable brain lesions or birth defects
+kittiwake viruses
+t E nm
+180 days
+demographic
+three additional signs and symptoms
+tumors
+IPB-2011-6
+no incorporation
+Hemagglutination assay
+blunt-tipped microneedles
+ELISPOT reader
+human inflammatory bowel disease
+homologous
+QIAamp Viral Mini Kit
+TurboFect reagent
+196
+H1N1pdm09
+Pr160 gag-pol
+IFITM3
+cross-sectional
+septic rats
+transmission dynamics model
+95% quantiles
+cumulative cases of 280
+Structured crowding
+microbiology
+MSC homing to damaged lung tissue
+community-specific data
+Four
+Excess annealed probe
+transmission intensity
+four
+shrinkage
+IL-17
+4
+adenosine stretch
+mortality after lower respiratory tract infection
+26
+three
+mitochondrial DNA
+0.45 μm
+Weekly health status reports
+40
+T7 promoter upstream of the Rluc gene
+2.5 h
+electrophoresis
+RSCU
+VOSviewer
+logistic regression
+N-linked glycan sites
+125
+not efficient
+NA1/NA2
+T
+all full text articles
+PDF
+vaccination and treatment games
+anti-trypanosomal agents and DNA minor groove binders
+phosphoprotein P protein
+homologous proteins
+1,120
+R5
+0.1 mg/ml
+activate PKR autophosphorylation
+a week
+14
+10,669
+those for the positive control group
+public health decision makers
+surveillance period, name of medical facility, sex, and age 10
+969
+DNA-based
+NGAL mRNA expression in lung tissue was increased
+10%
+epithelial injury
+25
+HSBP1
+VCP status
+the amount of risk
+All authors
+neurons and glia cells
+30 min
+five-fold crossvalidation
+CD4 and CD8 T cells
+identical
+intubation and ventilatory support
+open work spaces
+the size of age groups
+reassortment of several relatively low pathogenic influenza strains
+optical tweezers
+Impairment of germinal centre reactions
+72
+BALB/c mice
+ABC target density
+flow cytometry and surface staining
+self-organizing maps analysis
+circulating RAS activity
+intussusception
+MOI of one
+Rapid diagnosis of involved pathogens
+cumulative result
+Swiss-PdbViewer software
+four
+up to two months
+High flow/AirVO
+2-CTC resin and standard Fmoc chemistry
+signal intensities
+Hepatocyte growth factor HGF HGF
+Prion diseases
+necrotic
+fitted well
+Sigma-Aldrich
+Relaxation of virus particle binding
+technical artifacts
+3
+anti-sense molecules
+673,624
+Diffusion-weighted
+10 copies/mL
+membranous
+2-tailed Student's t tests
+suffix-tree algorithms
+three
+safety and accessibility to the endothelium
+Species specificity index
+6408
+200 µL of bacterial overnight culture
+47.2618.1 years old
+influenza
+LAIV-LAIV
+late-endosomal/lysosomal compartments
+suboptimal dosing
+three continents along the equator
+1918
+Z -FA-FMK
+CF
+traffic congestion, e.g., rush hour, and severe winter weather conditions
+genetic and ecological
+UV-vis absorption spectroscopy
+Pneumonia
+Ca 2ϩ -dependent lectins
+Complex I
+eleven
+24 hpi
+155
+20 mL of RNase-free water
+strict insistence on certain criteria
+PXD009999
+fine-tuning regulations
+Wilson disease and autoimmune liver disease
+reactive gliosis
+ORF1a/1b
+10-fold
+seven
+5 years
+building local knowledge and capacity for action
+reduced infection of A549 cells
+estimates of dispersal scale and infection rates
+Eight
+dipeptidyl peptidase-1
+Six
+Drug screening
+four
+activation of signaling
+poor prognosis
+creatine phosphokinase activity
+iodixanol gradient centrifugation
+Vif plasticity
+four
+11%
+dual nuclear/cytoplasmic localisations of a given protein
+polyamidoamine
+Statistical analysis
+antibodies
+274
+Hepatic injury
+Cytoskeleton
+Mycetoma agents
+14
+maternal age, gestational age, and number of previous pregnancies
+1796
+8 out of 10
+improving the health of Taiwan's citizens
+Five
+Glaucoma
+a microtubule plus end-directed kinesin motor
+Zhi Ning
+Microbial biofilm
+more than a million
+Content analysis
+apoptotic and necrotic
+IgG
+SMN2-GFP
+2018-02-02
+innate immune impairment
+IFITM3
+above 0.90
+14
+China
+highly pleiotropic
+Cyclic dicarba analogues
+direct intraoperative analysis and histology
+17.7
+Receptor antagonists
+12%
+5 mM
+four
+wide-bore
+Actb
+11%
+February 11, 2020
+protection
+flight-based quarantining
+CCL5
+their reliability as reference genes
+7
+1 ~ 3 quanta/h
+T-cell costimulation
+distinctive
+necropsied
+effective
+visualization and monitoring of G4s structures
+Luciferase
+hepaciviruses
+details of how transmission may vary spatially
+measurable, low-level viremia and viral shedding
+severe viral hepatitis
+silent mutations
+6408
+data on contact networks
+Bright Model OTF Cryostat
+enlarged cistern magna and calcifications in brain parenchyma
+Tacit
+at least 10 years
+Timeliness
+2
+overfitting
+host response
+perforin-dependent
+g = 0
+the effective control of the disease
+Fecal samples
+support
+a bar
+return to oestrus rate
+the TGN and late endosomes
+six
+favorable for activity
+HP-PRRSV
+interactions of motif 1 with an unspecified molecule
+Amyloid-like
+callers' physical and linguistic capabilities
+the amount of, rather than resistance to, infection
+per min/per mole of enzyme
+pathogenspecific characteristics and venue-specific characteristics
+8
+BspE1 restriction sites
+lamina propria
+gene delivery by AAV
+ΔLAZ
+1,000 replicates
+2.0 to 2.5
+5.0
+Mycobacterium tuberculosis
+Sepsis
+The Schedule of Assessments
+Table 3
+IL-1b production
+protective
+Nineteen
+BSRI
+1, 2, 3 and 4
+suppression of tumor growth
+corruption and stealing of resources
+33
+low expression tumors
+trpD
+the discount rate
+1.38
+IFN-stimulated gene factor 3
+pGFP and pVSV-G
+p53, p27 and p21
+10%
+viruses, Nosema, bacteria, and Crithidia
+positive-feedback
+France and Switzerland
+Complementary DNA
+Ten
+negative results
+the active form of the kinase
+changes in the microbiology of the intestinal tract
+Xerostomia
+4,6-diamidino-2-phenylindole
+25 mL
+NP373 and NP458
+ARDS
+inflammatory cytokine and chemokine production
+10 days
+seryl-tRNA synthetase gene
+Egr-2
+habitat saturation processes
+criticism
+prolonged air leak
+gut microbiota
+Electrode gel
+10 min
+many Alphaproteobacteria
+18
+mild disease
+DNase I treatment
+growth disorder, glucose intolerance, and the suppression of the immune system
+Systematic synonymous-site mutational analyses
+Th2
+1072
+peroxisome proliferator activated receptor alpha
+influenza
+six
+bacterial superinfection
+aberrant regulation of viral transcription
+20 minutes
+viral attenuation
+50 mL
+HGT
+isoflurane
+Western blot analysis
+RNase A
+At least 20-50 clear ciliary cross-sections
+anaccumulation of multinucleated cells
+BD Biosciences
+12
+I and Q
+Institutional Animal Care and Use Committee
+binding
+enterovirus RNA
+53.9%
+EGFR
+bronchiolitis, pneumonia, croup or asthma
+high spatiotemporal contact network complexity
+threonine
+1:100
+HAP pocket
+ELISA kits
+adhesion
+QIAquick PCR Purification kit
+2002
+greater benefits
+position 465
+brefeldin A or monensin
+pneumotachograph system
+Recombinants
+1,486
+DNA microarray
+optimal immunogenic processing
+culture motion
+cryo-electron microscopy and X-ray crystallography
+3.4
+up to ten minutes
+twofold
+Nine
+Three
+Mechanical ventilation
+GDC and DS
+Dppa2, Dppa4 and Mvh
+42
+Bacillus anthracis
+Baird
+ALI
+∼78 MYA
+grey literature
+to suppress RSAD2 expression and apoptosis
+the cutoffs and the assumed reporting rate
+CAR + /mPSCs Oct-4_hi
+glyceraldehyde-3-phosphate dehydrogenase
+28
+7.1%
+Binding assays
+94%
+crawling and gliding motions
+cognitive behavioral therapy
+Autophagy
+vitamin C2
+1 μg/ml trypsin
+four
+NSs4KR
+Immunoblot images
+ORs with 95% CI
+Lumi-Light western blotting substrate
+45%
+viruses
+24 hpi
+RNaseL
+HD-Ad-lacZ
+Matrix gene
+418
+Procaspase 3
+Meta-analysis
+particle size
+potential EVD cases in their families
+37 years
+ovine developmental model
+Triglyceridemia and Hypofibrinogenemia
+15.4%
+10 mm
+YxY
+50%
+72 h
+Perceived susceptibility
+one pre-assigned day
+Maxent
+high relative expression
+a mobile virus source
+Three to four
+glucose levels
+4
+0.4 Å
+oxidized low-density lipoprotein
+coating and blocking
+March 2014
+propidium iodide staining assay
+high concentration of NAs
+ANOVA
+clinical prediction score
+HA
+Beclin 1
+two
+hyper-arousal
+36 and 48 h
+Acute organ dysfunction
+10.1371/journal.pone.0219321
+21
+spraying of all households
+human immunodeficiency virus-1 mRNA
+pDCs
+T-lymphocytes
+hepatitis B reactivation
+40 minutes
+Amplified PCR products of all actual cDNAs were sequenced
+7 days
+mMACS Streptavidin Kit
+antiviral
+Multi-walled carbon nanotubes and reduced graphene oxide
+global health and funding agencies
+0.05 Da
+Eighteen
+1979
+enzymes, ion channels, GPCRs, and nuclear receptors
+GAPDH
+GoogLeNet
+respiratory tract injury
+decreased viability
+3D structure
+EBV-specific
+four core experts
+plasma
+19%
+cytochrome c reduction
+regulatory and purchaser outlooks
+85%
+a single, relatively recent calibration
+clusters of significant marker -LogP values
+ACE2
+mosquito control and raising public awareness
+microbial cell membrane
+intermediate binding
+disease ecology
+E or Ed395
+patient age and sex
+its ability to promote autophagy evasion in immune cells
+Gene names and fold-changes
+98% room air
+24
+effective antiviral agents
+HPAIs
+infectious diseases
+2
+cc-by
+C S
+Not being vaccinated
+the corresponding author
+The mutation to the right of the amino acid position
+Binding site visualizations
+limited
+respirators
+SIRT7
+WHO
+Bayesian
+L-Arabinose
+significantly suppressed
+hypothalamus
+tenofovir disoproxil fumarate
+RODS
+430 BC
+redox
+1 and 2
+3.7%
+1 hour
+40 Kilodalton
+UV-C radiation
+Model 2a
+epidermal growth factor receptor
+S1 Text, section 2
+wound healing, cell therapy, and drug therapies
+13
+4.4%
+Nashville, TN
+A degree of control
+I-TASSER
+500 million
+Table 7
+Influenza-A
+β-defensins
+relapse
+COPI-coated vesicles
+50%
+subcellular localization of the viral protein
+two
+Atgus
+8
+Uric acid
+91% to 100%
+digital CCD
+not closing schools
+Shorter protein fragments
+Host factors co-opted for replication of plus-stranded RNA viruses
+health care codes of ethics
+bicinchoninic acid protein assay
+mismatch repair proteins
+Two
+1,280
+FLAG tag
+RNA7 synthesis
+cultural context
+CHK1 phosphorylation
+A tail of GGEKEKEK
+dsRNA
+0.1 M
+van Elden et al. 57
+ΔATG5 and ΔBECN1
+1/150
+63%
+Mowiol
+3.1-fold
+Public Health Physician
+Swabs from the choana or oral cavity
+Resveratrol
+Lelystad
+vaccine hesitancy
+45
+Polycomb-mediated epigenetic regulation
+robust primary assays
+1%
+repRNA
+high frequency of point mutations
+young adults
+overprinting
+cholesterol accumulation
+PHR2
+Hygienic
+RNA-Seq
+between 7 and 43 million
+40%
+monitoring and surveillance of diseases of economic importance to swine producers
+autophagic markers
+pH1N1
+high and low estimates of vaccination coverage
+three
+oxygenation improvement
+residues G502-A506
+À80 C
+4%
+12 to 29 weeks
+past influenza pandemics
+5%
+An increase in evaluations
+TDP-43 cytoplasmic inclusions
+males have a high mortality rate after infection with this MHV A59 strain
+human immunodeficiency virus and murine leukemia virus
+YFV-17D
+BFA-sensitive
+1000
+asthma control
+a standard tool to transfect cells in vitro
+SIB
+coiledcoil-barrel assemblies that have more than 6 helices
+hepatoprotective and antioxidant
+payment
+Alanyl aminopeptidase
+Carriage of pathogens
+Lipofectamine 2000
+anti-inflammatory
+one RFID tag
+35-40%
+Annexin V positive cells
+glass needles
+cytopathic
+5 minutes
+668.87
+50%
+dehydroabietic acid
+507 amino acids
+Infectious conditions
+cooperative contribution of minority variants
+70%
+8%
+two-way
+RNeasy Minikit
+five week
+exp
+nucleotides
+HIV/AIDS
+August
+Fresh guinea pig blood
+1.18
+alpha-satellites or Circoviruses
+ATHENA
+pGGVs
+neuroinflammation
+PrediSi
+excluded
+p65
+SHAPE
+51,265
+The NIH Database for Annotation, Visualization and Integrated Discovery
+17
+decreased bone mineral density and osteoporosis
+CCHFV
+estimation of key epidemiological parameters based on cumulative case counts
+GAPDH
+Monitoring the capping efficiency
+further sets of CBF1 dependent promoters
+2009
+efficacy
+IgM Heavy Chain µ
+5%
+Gwangju Center of Korea Basic Science Institute
+Herolab E.A.S.Y. Win32
+internal controls
+thermodynamic hypothesis
+U1 small nuclear ribonucleoproteins
+complement
+helix angles of 15
+a gradual decline in both innate and adaptive immune functions
+CO 2 gas
+virus-induced cytokine dysregulation
+H5N1 and pH1N1 strains
+xTAG RVP
+Limited availability of IFA
+non-specific amplification
+vivo-morpholinos
+seven-stranded beta sheet
+late 1990s
+public health experts
+Modified Vaccinia Ankara viral-vector
+E64d
+phenotypic
+epithelial cells
+MagNA Pure LC instrument
+polarised effector memory cells
+percentage of total working pressure of the respiratory system
+decreasing ILI
+80%
+50%
+30%
+Mayer's Hematoxylin
+CSIRO Black Mountain Laboratories
+30 min
+100 ng
+Histidine, tyrosine, and aspartic acid
+arterial hypotension
+cross-hybridization
+Google
+Perth, Western Australia
+201
+29 out of 30
+36
+MLB1
+they fail to induce an immune response in a short period
+November 9
+PKR
+depletion of immune cells
+Plasmodium
+IPV
+Viral titre
+485
+RFP-Flag-transfected PAMs
+nifedipine and ethosuximide
+Jennifer Pocock
+circulatory and respiratory
+Strategic risk assessment
+MD OCT-pool
+liver, spleen, and kidneys
+IL-17
+B j
+Restoration of circulating blood volume and perfusion to tissues
+HCV
+longevity of protection
+H60 and Mult1
+NIS-Elements BR 3
+co-infection
+practical considerations for clinicians and patients
+1.11
+South Africa
+3.8%
+38 weeks
+infection control personnel
+day 0
+Respiratory epithelial cell culture systems
+IL-1b
+19%
+100%
+60 min
+VFD
+calcium phosphate biomaterial particles
+nine
+The supernatant
+updated sensitivity estimates
+57%
+Wilcoxon tests
+male
+heparin
+CpG and UpA dinucleotide suppression
+tbage and tneub
+when there was a saturation of fluorescence intensity
+≥14 days
+0.22
+pro-inflammatory
+RNA sequencing
+Four weeks
+nucleomegaly
+HOMO and LUMO sites
+steric pressure from protein crowding
+19.4%
+BioRobot EZ1 Workstation
+LNPs
+The structure of LmPGF2S protein
+CHI 660C Electrochemical Analyzer/Workstation
+>80%
+suppressive
+JAK/STAT pathway antagonism
+molecular mass in daltons
+a switch in frequency
+Vpu
+Genomic DNAs
+137
+Ten
+4-14%
+RNA structural selection
+SAR114
+relative humidity variables
+98.9%
+pol t,i
+16
+Germany
+tumour necrosis factor-alpha and of interleukin -8
+six
+BSA, trypsin, thrombin, and IgG
+maximum likelihood methods
+ACE2
+FCGR3A 158V
+51.8%
+six
+biometric parameters
+NJtree.txt
+how results are to be interpreted
+toxin-containing supernatant
+Elovl7 and Rapgef5
+prepartum immunizations
+through TLRs
+NMA
+ACK lysing buffer
+40 to 80%
+Malawi
+The loop
+a constant risk of infection
+various portfolios of interventions
+age-dependent population size
+TGFBR2 3 -UTR
+K
+11,500
+antithrombotic activity
+RNA levels
+Comparable gene induction of 37 ISGs
+ν i
+a complete interacting profile
+137
+rapid rise in portal pressure
+Asian pacific region
+viral replication
+NP-specific CD4 + T EM cells
+generation 2
+consequences of in utero acquired silent pathology
+lung inflammation and injury
+eight
+A. terreus Li-20
+11,972 IEQ/kg
+4-6 h
+murine studies or in vitro human studies
+details of the spatial organisation of genomic signatures
+HIV Pr/RT and Influenza H/N
+Huh7.5-HCV cells
+complete workflow comparisons and comparisons of individual analysis steps
+reduced gradually
+they generally provide far more information than has been experimentally verified
+temperate regions
+COVID-19, and the
+IL-28 and IL-29
+10 am and 10 pm
+78%
+GenBank accession numbers
+The secondary structure of the selected aptamers
+72.3%
+phylogenetics
+reaction
+506
+Tef4p
+CaMV 35S promoter sequence
+plaque
+8
+nail polish
+increased length of stay
+ZIKV-infected
+Syndecan-1
+quick design and efficient production
+between 5.6 and 87.8%
+gC1qR/p32
+homologous recombination
+ϳ31 ng of antigen-specific IgG per l of serum
+Cell surface-specific labeling of proteins
+greater disease severity
+compliance factor
+flight records, Google Trends and the World Health Organization's FluNet data
+Twelve
+44.2%
+Immunomics
+web-based
+increased expression of CD27 on human memory B cell
+caution
+Hockey
+PolK
+ZBMD-1
+data points derived from the same intervention policies
+interferon-gamma
+increased promoter occupancy of C/EBPβ
+contact numbers and information
+HI assay
+The model
+cats
+lung epithelial
+cell culture, electron microscopy and serology
+eight
+coordinated coregulation
+Membrane fluidity of SLBs
+spring season
+A
+Figure 5
+proglumide
+temperate regions
+Purified heparan sulfate
+Error-bars
+fnbA and ica
+Food hygiene education of the consumers
+Translocation of mRNA and tRNAs
+prolonged viral and fungal prophylaxis therapy
+immunohistochemical
+process technology
+flaviviruses
+patients with AIDS who have survived and have received ART
+Coarse-grained models and allatom simulation
+Multivariate logistic regression
+15 min
+neutrophils or platelets
+mineral oil layer
+Protein disulfide isomerase
+a combination of different Ub-based probes
+seven
+ten
+blue
+age
+G6PD-deficient
+ELISA
+1 h
+an emerging new pathogen
+The orientation of the J-oligos
+Plasmodium detection
+three
+sensitivity
+unchanged
+ACE2
+Python
+50%
+ciliated cells and goblet cells
+2,318,115,958
+a waiver of parental consent and Institutional Review Board approval
+stepped-up pneumococcal vaccination
+K/R
+EBOV GPmediated infection
+Lipofectamine 2000
+humoral
+E MM
+Gott's rule
+Figure S2 TLR2
+Beclin-1 dependent
+plasma membrane and endosomes
+1.2 µg mL −1
+summer or autumn
+Multiple linear regression analysis
+replication and shedding of influenza virus
+27
+neuroinflammation
+β
+nanostructures
+mutation and recombination
+animal illness and old age
+Rhesus Macaques
+TBK1
+Tracey Baas
+The references of the eligible articles and relevant reviews
+RPL27A
+7.34 ± 0.22 days
+Predeveloped forms
+1-specificity
+vaccination
+amino acid tryptophan
+Bernoulli variable
+throughout the year
+glucocorticoids
+cDNA
+phophorylation of p50 and p65
+46%-75%
+between 17 and 26 minutes
+The CT of retrovirus Env
+111
+feed additives
+Praziquantel
+70
+8 to 3
+44
+GAPDH
+a relative risk of 1.0
+between one and seven months
+James Boyer
+stem/progenitor cells
+ACE2-Ang--Mas axis
+300,000
+Four
+difficulty of inducing incorporation of transplanted cells into the host cell structure
+Viral loads
+boceprevir and telaprevir
+nosocomial
+0.908
+orf8
+four
+stainless steel
+cholera
+Four
+Appendix B
+LXA 4
+Overall and substructure
+less inhaled and oral CS usage
+GFP
+mutational hotspots and cold-spots
+Travelling in public transport
+G∪G
+1 mg/ml
+rotavirus and hepatitis virus
+300 mM
+hierarchical folding hypothesis
+9,949
+Escerichia coli DH5a and E. coli BL21
+P low
+July 2014
+generating anti-tumor CD8 T cells
+42 years
+infection by inhalation
+SDS-PAGE
+elegant graphics for data analysis
+key
+drug discovery and biochemistry
+2013
+internal ribosome entry site
+GFP-NLS-tagged
+Five
+ϕ r
+it guaranteed that the smallest LTZ consisted of at least 100 individuals
+DAPI
+Primary Provider Medical Records
+other routes and gates
+Human tracheal and bronchial epithelium
+2009
+National Center for Biotechnology Information Sequence Read Archive
+picornavirus replication
+microscopic lesions
+20%
+IL-8 and CXCL-1
+Serum MDA levels
+viral excretion
+weak T-cell responses
+TUNEL-positive tumor cells
+Q-3.75 µgHA + AS03 A
+three
+7 months
+Increasing genotypic diversity
+Thirteen
+Excel
+Standardised
+the dysfunction of a7
+arrested internalization of Ankfy1 and EBOV
+Honeycomb lesions
+MAdV-1
+RT-PCR assays
+Additional descriptions and figures
+what constitutes a strain
+311
+high background in the negative control wells
+subtractive hybridization methods
+cell proliferation, migration, maturation, and apoptosis
+FMDV serotypes A, O, and C
+cc-by
+6
+phylogeographic parameters
+18
+29-37%
+mediates the binding of Fn to the exosomes
+directly carried out on the submitted tissues
+Brazil
+p38 MAPK pathway
+CXCL8
+23
+Microtubules
+Nineteen
+T cells
+cold-like symptom scores
+NRK-52E cells
+Pneumonia
+treatment to M1-like statuses
+sulfate
+23%
+HA and NA
+HEK293T cells
+shorter than 7
+preference for one type of codon over another
+Moelling, Karin; Broecker, Felix
+97.5%
+interactions
+MS2-mHCV
+3,066
+B3LYP/6-31G* level
+C. parvum
+inflammation
+enzyme-linked immunosorbent assay
+via peripheral venipuncture
+896/1433
+Anopheles darlingi
+NP-and M1-specific T-cell responses
+Thailand
+2 weeks
+innovative coping strategies
+human subjects
+two
+several positive regulatory domains
+virus replication
+projecting AMR
+extended key networks
+NTM-associated IRIS
+Vast chemical libraries
+stoichiometry
+Cryptosporidiosis
+HeteSim measure
+72 h
+MFold
+0.029
+25.1%
+nasopharyngeal aspirates
+innate immune responses
+increase bacterial pathogenicity
+277
+1142
+different time points
+Microparticles
+diet and exercise
+Figure 4I
+10
+RNeasy Mini kit
+MD simulation
+prevention and/or treatment of pulmonary fibrosis
+noise
+Three
+pTDP-43
+1,974
+labeling of proteins
+unpaired Student's t-test
+2010
+domestic chickens
+2008
+viral replication
+alveolar
+RNA-seq
+I C
+Metformin
+20 μM Z-FA-FMK or E64d
+worm-like chain model
+SBP, pneumonia, UTI, and bacteremia
+group II
+isolated pulmonary capillaritis
+increased ISG expression at baseline
+E2 peptide P9
+antibody detection systems
+96 %
+Infections
+previously conducted studies
+85%
+Centre for Disease Control Surveillance Weekly Reports
+Tumor-associated antigen-specific cellular immunity
+Corticosteroid
+specificity
+ovarian cancer
+synonymous site conservation
+fecal microbiome
+pro-resolving
+increases
+ORF1 and ORF2
+B.subtilis and E.coli
+Particulate antigens
+TAC1
+SH454
+technical challenges
+microplate spectrophotometer
+serum antibody-independent viral clearance
+BST2
+one in four
+clear ER and Golgi staining
+to identify dominant T-cell epitopes
+31
+biosafety level 3
+gp-340
+altered proton permeability and channel gating
+significant differences
+All the possible sequences
+Viral fusion proteins
+relative gene expression
+low molecular weight solutes
+DNA Lad-der™
+ImageJ
+IL-8
+ChIP-seq
+SARS to influenza to Middle East respiratory syndrome
+10.3390/jcm9020330
+340
+73%
+May to August 2010
+plaque assay
+92%
+the presence of neighbourhood hubs
+different arenavirus protein expression mechanisms
+Schistosoma mansoni glutathione S-transferase
+22
+Sequences of oligonucleotides and mutagenesis primers
+one hour
+inflammatory
+9.27 million
+TGFBR2
+6-10 mg/kg/day
+43
+2009
+T RM cells
+specific imminent threat
+3, 10, 12, and 6
+1958
+48 hours
+nuclear and cytoplasmic
+three
+BHQ
+52
+an amplicon
+activation kinetics and threshold induction temperature
+calculations may be made when only partial data for a given day are available
+Keratinocytes
+2 weeks
+lung tissue
+Twelve weeks
+urgent proposals for comprehensive suicide prevention
+asthma, allergic rhinitis, and atopic dermatitis
+Japan
+IP block
+ACE2 protein
+week 6
+improving the folding model behind the algorithmic framework
+HIV infection
+verification of predictions
+S-phase-dependent
+Cockroaches
+volatile organic compounds
+hematologic
+pUL21a
+TGFβ, IL-10, CSF, and EGF
+viremic
+caveolin-dependent
+basic virus research
+viral-vectored
+gene-level tests
+four-digit HLA typing
+79:18%
+Two
+Kinesin super family protein 2A
+exited the study
+0 % to 27 %
+HuH7 cells
+furin
+multimeric
+24 hours
+compensatory mutation
+93 patients
+12-14
+tumor
+fucose residues
+L pro
+poly-uracil stretch
+coagulation
+E. coli-induced decrement in arterial oxygenation
+defense against Gbps
+0.2%
+ITC analysis
+negative charge on the non-bridging oxygens
+extensive training
+airborne transmission of IAVs
+11 months
+Mag1-RNA3
+six
+NS1B protein
+stabilizes membrane tubules
+1918 pandemic
+CEACAM1
+improving function and compensating for deficits
+ImageJ
+bicistronic
+uridylates
+25
+six
+residue 60
+baseline data
+intracellular proteases
+nucleotide substitutions per site
+protozoan infection dynamics
+experimental groups and the pooled control
+MRSA
+HO-1
+control medium
+third
+pandemic influenza and West Nile Virus
+533
+N165S
+increases
+Unsupervised and supervised methods
+routinely collected information covering a whole country or a major part of a country
+168 hours
+31%
+pivotal
+MEK/ERK-dependent STAT1 activation
+increased numbers of CD163 ϩ macrophages
+10%
+homologous recombination via interspersed repeated sequence elements
+55%
+the condensed chromosomes
+strong
+1 hour
+Inhibition of the suppressor function of Tregs
+PE positive cells
+1 to 2 ACH
+Providing more knowledge about disease causes
+nine
+late 1990s
+public health
+degradation
+36
+35-40 %
+saxitoxin
+decreased
+CNKI
+Bio-Plex
+Chromas
+pleiotropic
+Benzoyl-L-arginine amide
+twice
+self-reporting
+5%
+125/134
+Naphthalene
+three
+high
+migration, waning efficacy, and demographic turnover through births and deaths
+working pressure of the respiratory system
+strong type I IFN production
+semiquantitative scoring system
+8,735
+television or newspaper
+steroidal glycosides
+HC and IDC
+UGT1A1
+9
+schools and workplaces
+a snapshot of the recombinant HBV strains
+Chloroquine
+OPHID
+7-week
+Amyloidogenic processing
+emergency/crisis response
+CD8 + T and B cells
+the unwinding force
+intestinal disorders
+impaired dimerization
+Biosecurity measures
+Empty backbone plasmids
+Virus dose and infection time
+Genetic information
+their respective HA subtype reference protein sequence
+artificial construct
+whether a hypothesised model has adequate fit
+Mosquitoes
+mammalian adaptation signatures
+42
+certain signaling pathways
+2 h
+hWJSCs
+FAK-expressing SCC cells
+the spread of infection between cities
+8
+models that allow for a behavioral shift
+Taiwan
+prevention
+Notch1
+1
+cycloheximide
+AP30451
+cc-by
+6.1
+plaque assay
+30
+0.025% Tween 80
+.4
+Melting point analysis
+ubiquitin C
+Wash buffer A
+54 h
+96 hr
+pSC11-M
+RO4929097
+arginine-proline-rich RNA binding domain
+anticodon binding and aminoacylation domains
+pairwise nearest-neighbor interactions
+P1F12 binding
+assembly platforms of processing complexes
+padlock probes and rolling circle amplification
+LNEs
+Table 1
+2.5 million
+Millipore Corporation
+pooled serum samples
+analogue
+Immunoprecipitated α5β1 integrin
+Subsurface environments
+The study
+90 minutes
+rVV-Empty
+17.9%
+nutrients
+standard error of the means
+50%
+Egr-1
+generation of a specific immune response
+by blating each gene in one cluster to NCBI and HMP database
+alignment analysis
+Purified goat-anti mouse antibody
+eukaryotic-1 frameshifting
+37.1%
+an increase in complex size
+log 2 9.560.6
+Y11
+2
+more references
+an intron
+information to local stakeholders and actors
+plasma viral load
+16
+Nc'
+genetic testing
+influenza virus nucleocapsid protein
+more rapid, sensitive, and specific detection of virus
+PPRV-F VLPs
+ganciclovir and cidofovir
+49
+RMS L
+Immunisation against IAV
+4%
+angioprotectin
+self-limiting mild illness
+adenosines and pyrimidines
+fibrinolysis
+Background scattering
+Anti-AFP antibody
+replication-associated proteins
+vesicles and tubules
+Lys-315
+binding virus genomic RNA
+tgfb
+The nucleolus
+intra-arterial RH
+glucuronide
+p24
+0.5 mL
+SENPs
+1296
+IL-18
+quasineutral mutation
+more severe hypoxemia and comorbidities
+IL-10
+64
+the potential interest of a lung biopsy
+Western blot analysis
+3%
+Differential equation-based models and cellular automata
+separation
+to identify the direct targets of each viral protein
+Ambion, Abcam, and LifeSpan BioSciences
+JEV and MVE
+ICU LOS
+vascular endothelial cells
+three
+25%
+underlying cardiovascular disease
+CH-E, KC, and GG
+Confidence intervals
+dsRNA
+clinical and climatic
+four
+cc-by
+phosphorylation of Bruton's tyrosine kinase
+1.5 million years
+COVID-19
+F a = 14%
+0.5 days
+further exploration of possible causes of heterogeneity
+Composite scores
+The expression of fgl2
+case definitions, facility types, and eligibility determination
+110 kDa and 75 kDa
+different cox-proportional hazards models
+fluorescence signals
+enhanced chemiluminescence reagents
+Clinician-Administered Posttraumatic Stress Disorder Scale
+standard deviation from the mean
+inclusion bodies
+54
+18 hours
+bias
+Disability
+VP40
+virus isolation using culture methods followed by complete genome sequencing
+positive
+PharmMapper
+Constructs lacking the uORFs
+their members
+60%
+scavenger receptor SR-A6
+spurious amplicons
+20.5%
+4 weeks
+PKC
+bacterial coinfections
+0.1%
+34
+enhances the maintenance of stem cells
+1.58
+novel technologies
+increased numbers of encephalitis cases
+Dulbecco's modified minimal essential medium
+intravenous pentamidine
+bronchopulmonary dysplasia
+autoregulator
+higher
+Acute Lung Injury
+123 mmHg
+chronic liver disease
+by treating purified virions with chymotrypsin
+improving access to vaccines in low-resource settings
+trypsin-like proteases
+infrared
+interaction tests
+280uC
+155
+F = −2
+30%
+Statistical modeling
+according to their individual schedules
+drought, aquifer depletion, and intractable local differences
+X, B and D-arginine
+support
+Randomization
+Nosocomial
+1297
+ATP
+high thermostability
+thousands
+rHPIV3 clinical isolate 1 -EGFP
+human cohorts
+synonymous codon positions
+higher parasite growth
+139
+values of viral RNA extracted from 19 viral respiratory pathogens
+R 0
+frontline HCWs with intensive patient contact and staff with no patient contact
+synovial tissues
+The Pneumonia Severity Index
+hf c i
+inducible expression of C6
+interpret the results of binding experiments
+Cargo receptors or transmembrane cargoes
+mortality of an aging population
+extensive blood vessel formation
+R 0
+whether the results of different herbal medicines were pooled
+RIG-I and MDA5
+compromised cell function and reduced contractile force generation
+mice
+Huh7.5.1
+A450
+impaired NOX/p38 MAPK/AP-1 signaling
+ATF4
+replication-dependent spread of virus to the lower respiratory tract
+sphingolipids
+proteolytic cleavage of GPC
+Ten-fold series dilutions of standard substance
+viral taxonomy and protein attributes
+57.7%
+mucins and gastrointestinal pathology
+strengthens the homology hypothesis
+OCT4 expression
+VEGF
+picornavirus RT-PCR hybridization assay
+six
+0.002, 0.025 and 0.153
+$80%
+children or elderly
+piglets
+females
+ENCODE webserver
+monensin
+Thirty-four
+Cell-free culture supernatant
+three
+NCBI PubMed
+bronchoalveolar lavage fluid cells
+DNA and RNA synthesis
+Akt-1
+129Sv and C57 SOD1 G93A mice
+light transmission
+43
+cytosolic factors
+surgical site infections
+situs inversus totalis and situs ambiguus
+written informed consent
+membrane fusion
+CD8 motility
+T1
+Metropolis Monte Carlo search algorithm
+antibiotic efflux
+differentially expressed genes
+dichotomous variables
+66
+changes to their addresses or phone numbers
+Antibiotics
+Basic epidemic models
+constraints on the protein structure
+free IgG molecules
+30
+Mass dog vaccination
+NF-κB activation
+diverse
+Amino acids
+a mutation on both alleles
+6 days
+Myd88
+duplicates
+Discovery studio
+PK
+Fifty ml of the dilutions
+Folliculitis
+irrefutable
+86%
+HIV-1 protease and HCV
+third
+zinc-dependent endopeptidases
+µW-level
+IZUMO and FLOT2
+nine
+IFNL4 expression
+negative and ambisense polarity
+dual antiplatelet therapy
+Nipah group
+a pair of primers and a probe
+IFNs
+73.4%
+293F cells
+1918
+twice
+Benjamini and Hochberg
+multiplex PCR subtyping assays
+life, dignity, and wishes
+40 million
+20 residues long
+purulent lung infection-induced ARDS
+miRNA expression
+proinflammatory
+repeat imaging
+false interpretations
+gp41 NHR
+br and k
+mock-infected controls
+Pearson correlation
+sulfated glycans
+mouse
+directional migration of leukocytes
+vague, ambiguous, or otherwise avoid explicit statements of position
+SERINCs
+IRF7
+10%
+full responsiveness to-and control of-RNA viruses
+13
+viral
+PubMed and Google Scholar
+MyD88-adaptor-like
+governmental initiatives and investments to improve infection control
+protein production
+Michael Weekes
+by thin-plate smoothing splines
+a very brief, non-articulate stereotyped voice
+Vesicular stomatitis Indiana virus
+θ ij
+virulence factors associated with viral pathogenesis
+inductively coupled plasma-atomic emission spectrometry
+increased immunogenicity
+PHP and PERL
+NaBH 3 CN
+0.35
+lower-respiratory-tract infections and bronchiectasis
+Old World
+adventitious viruses
+ANN-based algorithms
+duck-rice agro-ecosystem
+2008-11-02
+Fomites
+300
+Indirubin
+ILI
+10 μ M
+clear biological contexts
+radiographic features
+APMV DNA
+sialoglycoconjugate receptor
+specific molecular pathways
+h3H5
+highly pathogenic
+nosocomial
+a list of coordinates for each localization
+severe bronchiolitis
+deforestation of forest areas
+nasopharyngeal carcinoma
+> 86%
+low molecular-mass
+x β = 08β
+Host genotype
+myelin
+virus mammalian host adaptation
+21.1 million
+1960s
+infection after immunosuppressive therapy
+Monocytederived Macrophages
+11 568
+caveolin-1
+pH dependence
+wrong parameter settings
+type I interferon
+0.04 nM
+Mark Carney
+73%
+no significant difference
+Respiratory syncytial virus
+CW3 immunodominant
+ECL
+Arg-His-Arg-Arg
+serum viremia
+an insurance
+ability to induce dedifferentiation or reprogramming of RPE cells
+bacterial multidrug efflux pumps
+Non-invasive diagnostic tests
+TCID 50 titration
+communes and towns
+four
+contagion
+cyclase
+72%
+max
+renal Ang II content and intrarenal Ang II signaling
+International Institute of Tropical Agriculture
+biodiversity
+anti-Ki67
+116
+TMB
+Credentialing
+43.9 years
+VP30-RNA binding
+mesenchymal cell populations
+PageRuler TM Prestained Protein Ladder
+mouse macrophages
+multiple-organ failure
+spo0A and sigH
+11.7 %
+different patterns in vertebrate and invertebrate host organisms
+respiratory diseases
+two
+Ten
+pleopods
+Th1 and Th2 differentiation
+Presatovir
+50%
+Quarantine or isolation
+4-dimethylamiopryidine
+β -actin
+45 years
+all immunogenic nucleic acids
+the CHO genome
+Entrez search menus
+100%
+microbiological evidence of infection
+regulation of angiogenesis
+treatment of infected individuals
+mobile DR units
+bacterial entry
+ionic channels
+Juniperus
+10 3.6
+1 Â 10 7 VSV-specific B cells
+95
+March 2005
+pivotal
+trypsin
+The efficiency of fork restart events
+U-ISGF3
+capped, polyadenylated viral mRNAs
+~8900
+5% or less
+sentinel sites
+3.0, 2.3 and 2.9
+C-score value
+PROMALS
+clusters of significant marker -LogP values
+1991
+t 1
+Wuhan
+ST cells
+International Humanitarian Law and International Human Rights Law
+Nucline
+primary lung endothelial cells
+five
+70
+SC09
+South East Asia
+IFN-g
+proHNP1B
+female
+oxidative stress
+11
+causespecific hazards model
+1410
+70%
+Cord blood
+1 Airy unit pinhole diameter
+broth microdilution
+20 to 50%
+Dnmt3a
+a tracing probability p c *,121/R 0 pre
+TiO 2
+YFV-17D
+-2FS increases more than 2-fold
+0.22-μm
+immunity
+cancer, tuberculosis, and the self-monitoring of blood glucose
+127
+1,000,000
+51.7%
+Twenty
+pandemic
+pro-inflammatory
+clathrinmediated
+6
+DAPI
+supernatant containing viruses
+laboratory observations, mechanistic studies or pre-treatment assessment
+Intravenous drug abuse
+ran until no individuals remained infectious
+samples collected from the field
+solubilized sample
+aging
+37 • C
+1.32-to 2.26-fold
+shRNA
+Zeiss LSM 510 confocal microscope
+Lipofectamine 2000 transfection reagent
+Qualitative case study methodology
+TYLCSV
+REV specific diagnostic assays and epitope-based marker vaccines
+deaths that would not have occurred in the presence of sufficient resources
+5%
+induction of apoptosis and epithelial permeability
+anti-DBL3cVAR1 serum and IgG
+mild disease
+RV-C
+pPAM
+Fasciola hepatica and Moniezia expansa
+viruses
+antigen specific IFN-c producing CD8+T cells
+early 1990s
+25%
+poultry exposure and comorbidities
+mesenchymal stem cells
+GDC-central proteins and proteins in DSs of PPI networks
+8%
+Sample collection & handling
+phosphorylation of protein tyrosines
+CRP
+extreme mutation rates
+the family
+IFN-inducible transmembrane protein-1
+Lactobacillus species
+a much more stronger increase
+actin
+YYU Hospital
+Increased collagen deposition
+8
+three
+severely immunocompromised
+therapy failure
+total viral antigens
+ImageJ2x
+reconstructed epidemic trees
+hemagglutination
+18 h
+van der Waals interactions
+GFP
+Mouse-adapted EBOV
+aetiologies
+antiviral activity of TOCs treated with TLR ligands
+viral uptake
+The prevalence of specific serotypes
+SAP30, p62 and p44
+structural proteins
+mtDNA copy number in cells and lactate levels in cell culture media
+a TaqMan reaction
+IRB
+methods that lend themselves to predictability
+Eight
+TF TCF4
+5.6 9 10 6 /kg
+the acceleration of MW-RCA
+negative
+Cell-surface biotinylation
+severity of their hypoxaemia
+alveolar macrophages
+0.5 million
+natural intermediate hosts
+2-14 days
+remove another 5 μL from the tube
+in or beneath the epithelium
+nanolitre vapour diffusion
+Cells and supernatants
+Four
+fungal
+trial treatment, assessments, data collection and follow-up
+Turkey
+safety and efficacy
+Holistic Virgin Coconut Oil
+εHOMO
+full-length lamin C
+The molecular mechanism
+OP differentiation and oligodendrocyte regeneration
+Interferon peptides
+Five
+extracting NAs
+immunosuppressants
+When financial circumstances deteriorate
+RSVS Clinical Pathology Laboratory
+G1-PB2 627K
+1 year
+Oligonucleotides
+Live virus
+Protection after Lordsdale ORF2 VRP vaccination
+DVG 70-114
+Favipiravir
+meaningful
+Vaccinia Virus Infection
+PRJEB15275
+4513
+Coronavirus
+autophagic responses
+Increased morbidity and mortality
+Meropenem
+Hypoxaemia
+progenitor cells of lung
+mRNA
+nucleolar activity
+otolaryngologists
+Packaging with Hyperphage
+a single viral genealogy
+Feline immunodeficiency virus
+control at the airports where it is likely to have the largest relative marginal impact
+chronic obstructive pulmonary disease
+2.54
+>28,000
+PCR and double enzyme digestion
+NCPAP
+maintenance of good data quality
+22.77 and 20.1 kDa
+5 min
+100 ml/well of recombinant PyCSP protein
+Neutropenia
+50%
+two
+IgG 1 isotype control mAb
+Civil registration systems
+equal to 1
+Representative-hydrophobic-only
+viperin
+IgM levels
+95%
+Diffuse alveolar haemorrhage
+K77
+29%
+Vasculitis and subsequent multi-organ infection
+serological
+57.6%
+Node color gradient
+malaria, HIV, childhood vaccination, and maternity services
+mosquitoes
+six
+higher-order multimers
+GenePix 4000B
+three
+large structural deviations
+20%
+intervention arm
+measurements for which P 0 was between 0.7 and 0.9
+farmed fish
+Confocal immunofluorescence
+activin A
+access to STT3B
+fever, hemorrhage, hypotension, and renal injury
+biological
+morulae
+GBP5, RARRES3 and VAMP5
+host protein synthesis apparatus
+70%
+isolated protein
+24 hours
+MiRNAs with overlapping coordinates
+APPENDIX 2
+spatio-temporal mixed effects regression model
+cell growth
+4, 5, and 11
+failure
+The biological significance of HA stability
+neurons
+90%
+water temperatures
+Latent variable projection methods
+2008
+AVI-4658
+P56L, P58Q and P59N
+ethnic differences
+Spain
+PBS with calcium and magnesium
+once a week
+66
+backward' contact tracing
+fantasy
+metaphylaxis with anticoccidials
+2007
+poisson process
+five
+Sefton A
+challenge with divergent influenza subtypes
+Heart rate
+German animal care guidelines
+slow convergence rate
+21
+serum TG
+A P value of <0.05
+host protein translation
+expression of NP
+30 nm
+hyperglycemic
+1990s
+opportunistic and highly antimicrobial-resistant bacteria
+Spanish influenza
+attenuation
+26 SDS sample buffer
+a validated geriatric construct of increased vulnerability to physiologic stressors
+three
+weekly case counts
+100 nL of 3 × 10 10 ffu/mL rVSV
+UL122 and UL123
+Western-blot
+Group T
+cholera
+multiple edges
+ssRNA viruses
+24 hr
+megalocytiviruses
+BigDye terminator reagents
+Influenza in immunocompromised individuals
+the prediction of pseudoknots
+500 µl RIPA buffer
+All data
+Residues interacting with the second ATP
+recombinant viruses
+hemangioendothelioma endothelial cells
+Coupling between translation and transcription
+linear
+increases
+macrophages
+nucleolar dominance
+silver mirror reaction
+immunofluorescent
+regulates NOX -derived superoxide generation
+High
+landeri group
+liposomal delivery of the protein
+Vimentin
+every 4 to 8 hours
+12 heads per hectare of rice fields
+every 4 hours
+KPNA2
+149
+tentative
+Ingenuity Pathway Analysis tool
+VEGF and COX-2
+the Z-score of log2-transformed RPKM expression levels
+Dynactin 1
+microbial
+randomization and follow-up of some non-influenza cases
+University of Pittsburgh Institutional Animal Care and Use Committee
+13
+inflamed CNS and blood
+roe deer
+24 and 48 h
+inactivation of phospholipase A2
+baboon
+39.0%
+ORF1 and ORF2
+To confirm the presence of subgenomic RNA
+cathepsin B
+The accuracy of mass spectrum
+macrophages
+computational methods for genomic data analysis
+Alternative pathways
+differential subcellular trafficking and cytosolic partitioning
+a clickable map
+late-stage immune suppression
+the media
+Akt phosphorylation
+dampening the antiviral response
+pressure equilibration between the rooms
+according to the corresponding reported procedures
+17
+1920
+epidemics
+Dialysis incidence
+dInosines at these positions will restore hybridization
+memory B cells
+three generations
+biting insects and aerosols
+two
+Diagonal vector
+HYG
+SOD-1, HSP-70 and TRX
+All data points
+total loop length
+in-house real-time PCR
+PRRSV
+drought, varying external light conditions or in response to reactive oxygen species
+XD packed against the folded region of N TAIL
+HRV transmission, infection patterns and diversity
+20
+Conserved vRdRp domains
+our method
+fold change
+content validity ratio
+48 hours
+transmembrane pores
+viral lytic antigens
+0.80
+exert their inhibitory function by binding the target sequence
+the brain's ability to absorb new information
+invasive pneumococcal disease
+Network
+The Identical Protein Report
+Human papillomaviruses
+IL-17 may participate in suppressing local or systemic inflammations during viral infections
+Noninferiority
+Transmission prior to the rash
+cloacal shedding
+A history of recurrent wheezing or asthma
+Irf5 and Irf1
+102
+543
+restricted
+24 h
+≥65 years
+Conservation of the GA 6 sequence
+quantitative lethality assay
+Eye, conjunctival, and nasal turbinate tissues
+Social influence
+ρ
+spatial heterogeneities
+higher
+Spearman's correlation coefficient
+The front person
+eight
+Human Leukocyte Antigens 1
+signaling molecules
+specificity of the response
+mathematical modeling
+DNA metabarcoding approach
+interferon
+antisense oligonucleotides
+64%
+36
+2 days
+public health practice
+frequent mutations in the HIV-1 genome
+zinc ions
+sevoflurane inhalation
+The EMBO Practical Course on Computational RNA Biology
+15%
+TNT-PNA oligonucleotides
+1889
+seven
+between 70 and 96%
+MIP-2
+36 KDa
+1 to 30,000 nM
+562 nm
+Federal regulations and incentives
+38
+sequence analysis
+cellular viability
+IFITM3
+V-Quest
+OIE listed animal diseases
+Agencourt AMPure XP beads
+proteolytic enzymes and low pH environments
+lower infection rates
+Three days
+emerging zoonoses
+Cell count
+small particles
+Cytoskeleton-dependent intracellular transport
+>100
+.500 V.cm 2
+Zinc, potassium, iron, magnesium and calcium
+gene gain-loss events and mutation rates
+To evaluate the efficacy of adoption of mass vaccination programs
+89.5%
+41
+West Nile virus
+25
+immunocompromised
+RBC transfusion
+Stanford Shared FACS Facility
+Agrin signaling
+non-canonical
+endoprotease
+diarrhea
+Switzerland, France, and Belgium
+48 hr
+immunofluorescence
+to protect young infants from RSV infections
+Twelve
+personalized medicine, improved outcomes, and less dialysis
+Valine
+antidrug titers and affinities
+rhinovirus
+Chikungunya
+CAP
+Yonsei University Health System Institutional Review Board
+90 to 100% inhibition
+decreased antigen-induced spot counts
+continuous epidemiological surveillance
+2 months
+acute respiratory distress syndrome
+nanoscale movements of domains or loops
+VP4 and VP7
+thirteen
+subgroups
+Five
+15,495
+plasmid pTRC-fimA
+MEG3 and siRNA negative control
+24 h
+molecular components
+UV
+NA activity
+σA
+independently
+Bovine serum albumin
+The ABR
+The RNA genome
+12 h
+6.3 per 100,000 personyears
+histolopathologic
+M1 mRNA expression
+mortality
+TOPHAT2
+Eight
+statistically significant
+low social cohesion
+complexity
+1 to 2 h exposure
+Oct-4
+control virus infections
+significant
+8 weeks
+percent inhibition above or below expected
+unmodified uridine
+minimise the risks
+increased proteasome degradation
+Opensource Field Operation And Manipulation
+oral
+Solvent accessibility
+14%
+peripheral blood mononuclear cells
+10-fold
+ion migration
+active
+Peru
+the base of the cell culture insert
+54%
+Antiviral
+August 2016
+IMHA
+how we understand and talk about antibiotics
+Gastric mucosal biopsies
+FDR < 0.05
+three
+six
+cc-by
+murine
+Contig files
+conserved RGD and KGE integrin recognition
+40 min
+Nine per cent
+neurotropic viruses
+chimpanzee AdC7
+Unconditional logistic regression
+λ − µ
+the necessary convexity of the integrand in the objective functional holds
+Each term in the rate equation model
+Embryonic myogenesis
+Parasites
+USD 18,000
+62 %
+equal molarity
+keratinocyte monolayers
+mathematical modelling
+gallic acid
+ASD-like rather than schizophrenia-like behavioral impairments
+Cd 21 and Hg 21
+pneumonia
+p
+degradation
+36/45
+recalculation of BIC penalty functions
+frameshifting
+discriminate their variable contributions
+Sigma-Aldrich
+Recombination
+3 days
+a website registry
+bonetargeted
+82%
+RBC transfer to the target organ
+focus-forming units per milliliter of supernatant
+Serum samples
+substances, objects, and patterns
+Libraries of Ab V genes
+atg8
+tertiary and quaternary infections
+proteins of the retinoblastoma family
+mutational fitness effect
+inhibits viral replication
+downstream of the pseudoknot
+one
+Inflammation
+JNK
+Cross-protective antibodies
+retrospective frozen specimens
+Easterners
+86%
+328
+cholesteatoma
+The percentage of IFN-γ-positive cells
+Heparinized blood samples
+Uruguay
+low RH environments
+8
+CT imaging
+L1
+genes highly expressed in the brain
+atelectotrauma
+50-100 million
+CD200 tr
+VR2332 replication
+murine norovirus
+Zika
+mTOR
+WNV replicase
+Common motif/pattern with amino acid sequence and location
+1.4
+oral clobazam and levetiracetam
+16 hour
+Smad3 binding
+Comparable delays in onset of severe disease
+patient number of contacts, length of stay and contact tracing
+a protein of 161 amino acid residues
+Infection
+NCBI Basic Local Alignment Search Tool
+Three
+Seventeen
+3 to 10%
+lower or negative
+Blood-based testing
+Binding of both TRAP and regA
+enhances resistance to JE and reduces viral burden
+54,628,373
+GraphPad Prism 5.0
+shuts down host cell translation
+SLiMs
+TssL and TssM
+Gibbs sampling
+those vaccinated with intent
+volunteers
+19%
+one third
+50%
+90 to 95%
+EBNA2
+CD8α + LN-resident DCs
+Position 2 and 9
+six
+studies
+50 μg/mL
+disappear
+w = 1.00
+thin-layer chromatography
+QoC-scores
+coagulation factor XII
+Saudi Arabia
+at least 5 million
+G 1 phase arrest
+cellular uptake
+wollamide B
+proteomic analysis
+apilimod
+3.20 Å, 38, 39
+their scores are added
+Asn 578
+hepatocellular
+hybridization
+Binding of Fob1 at RFB
+no supporting evidence
+GCN4
+three
+CAIII
+24-well plates
+13
+passenger data
+Urine
+time and fast information
+7
+105
+IFN2
+SAPS II
+less than 5%
+sodium citrate buffer
+the injection loop
+transcriptional modules
+Acute lung injury and acute respiratory distress syndrome
+pulse rate
+cytomegalovirus promoter
+The inhibition of ICOS and ICOSL
+0.9166
+21
+oxygen
+13,701
+inferred GRN
+1-200 kDa
+dynamic
+cytoplasmic OCT-4B isoform
+compliance
+100%
+Dr. Defu Zheng
+50,000
+embedded depth
+gap columns
+an 8% acrylamide/8 M urea gel
+H
+lighter regions
+D51
+immunoregulatory cytokines or chemokines
+56,671
+tick cell receptors
+IL-1b
+Thr90, Pro88 and Glu190 of GRIK1
+CSFV 2.3
+Five ll of eluate
+20 ng/ml
+SJIA Urine Peptide Biomarkers
+Protein extraction and solubilization
+mRNA levels
+Qiagen PCR purification kit
+5 mm
+avian influenza H5N1
+Student's paired t-test
+Introduction of a watershed
+respiratory events
+patient safety
+p65
+protein kinase C activity
+The polyprotein
+Model-based evaluations
+T2 and T3
+DW, JT, EG, and BG-B
+spring
+one third
+Q fever
+activation of apoptosis and secretion of growth factors
+Cell-penetrating peptides
+1,645
+isolation
+HADs
+mitochondrial metabolism, glycolysis, and multiple cell signaling pathways
+RSV
+closed tube system
+UTP
+Horizontal transmission
+4% paraformaldehyde
+Seneca Valley virus
+quite different clinical pictures
+polyclonal anti-Cav-1 antibodies
+low-viral loads
+Capsular polysaccharides and anthrax toxin
+chemo-virus and chimeric systems
+1917
+Socio-economic status
+exosomal analysis
+extended toeprints
+CME
+Defining these factors
+Actin dynamics
+25
+dynamic range and sensitivity
+Lung protective ventilation
+vesicular trafficking
+The concept of robustness
+kinetic
+comparisons across viral families
+90%
+increase fastest
+a follow-up of the fixed population in the community
+reduced Ang II formation
+disorder in the C protein
+HIF-α
+nicarbazin treatments
+hyperresponsiveness to cholinergic stimuli
+48 h
+dual skipping of either exons 44 and 45 or 45 and 46
+IL-10 family cytokines
+plasmid
+gene transcriptional dysregulations
+12%
+H7N9
+Mimotopes
+Re-admission to hospital
+T20
+Biomedical Advanced Research and Development Authority
+Trp, Tyr, and Phe
+tuning the activities and relative abundances of the tRNA-modifying enzymes
+Histopathological
+Interleukin-1 receptor antagonist
+complexity
+Thr519
+unsold poultry
+CDR2 regions of heavy and light chains
+100 bp DNA Ladder Plus GeneRuler
+13
+600 ppm
+60 ms
+daily
+Cationinteractions between arginine and phenylalanine side chains
+150,000×
+17
+selective immunoadsorption
+four
+population-based
+suppress or facilitate viral replication
+pO 2
+M. hyopneumoniae
+means ± SEM of each group
+the value of k
+Ten µL
+8 : 1
+African DENV strain
+via needle puncture through the side of the tube
+viral replication
+RNeasy Mini Kit
+RNA sequencing
+Immunoblotting
+15.8%
+Vaccine use
+RAS
+F. tularensis
+TRAM
+Treatment planning software
+blood plasma IFN-α levels
+Ag85B
+tissue samples
+7G8 polymorphisms
+rs12252-CC
+chimpanzees, macaques, or marmosets
+Medical educators
+17
+497
+Ten microliters of CCK-8 reagents
+poly-lysine diluted 1:10 in milliQ H 2 O
+inflammatory responses
+Candida albicans
+peak VO 2
+0.0291
+4.8%
+site B
+2-3 weeks
+Airway T RM cells
+0.01
+pharmaceutical and pharmacokinetic challenges
+Doctors
+coffilin
+12
+3%
+Bayesian skyline plots
+30.5%
+His27
+NS4
+physicochemical
+Shallow insertion of the fusion loop
+recombinantly expressed ubiquitin, SUMO1 and ISG15
+Descriptive statistics
+Global fitting of experimental data to well-characterized binding reactions
+perfect sensitivity and specificity
+Dextra Laboratories
+FlowJo
+RAND Corporation
+duplicates/repetition
+Follistatin-Like 1
+30 μL of NT80/82 30% slurry
+Deployment of technical elimination teams
+uniform lethality
+DMSO
+slightly longer
+1918
+new cooperation among institutes in Kazakhstan
+0.2% saponin
+several dozen
+21 days
+Colorado
+Wildtype
+15 days
+more stable
+coat protein of CYDV-RPV
+51
+VHL
+IL-17
+diff erentiate patients with chronic carbon dioxide retention
+intrinsic connectedness
+ArcMap 10.2
+Protein Thermal Shift Dye Kit TM
+InfA-NP
+Peptides and proteins
+one week
+pierisins
+multistate
+NF-κB/p65 nuclear translocation
+lung pathogenesis
+Spearman correlation
+E2 and E1
+inflammatory conditions
+10-14.5 mg/mL
+1 × 10 −9 M
+zanamivir
+15.2 nm
+two
+Grenoble, France
+six hour timepoint
+binds immune complexes at acidic pH and releases them at neutral pH
+zero cases should be counted
+contrast
+greater
+Richards model
+dsRNA binding
+identical
+IFN-γ production
+frequent and direct response experience
+two ligand binding sites
+Geminiviridae
+codon choice
+IFN I, CCL2, and defensins
+154.7
+200
+2007
+effectiveness
+cytosolic proteins
+multidrug resistance protein 1
+polyubiquitin coat formation
+HEK transected cells
+PKR Ϫ/Ϫ cells in culture
+Yinpterochiroptera
+138
+more sophisticated methods
+H 2 -antagonists
+Avian infectious bronchitis
+310 363
+anti-H1N1 IgG
+23
+inactivated, live attenuated and DNA chimeric vaccines
+cardiotoxicity prevalence
+novel technological advances
+RanBP5
+compound 14
+nine
+viral supernatant
+complementation
+virus type
+4
+realists
+Enfuvirtide
+GraphPad Prism
+Q75FL0
+425
+proteolytic
+18β -glycyrrhetinic acid
+one potential N-glycosylation site
+intron 6
+10 min
+how far in advance travelers planned their itineraries
+mountains, lakes, and rivers
+new diagnoses
+pattern recognition receptors
+Renilla/Firefly luciferase bicistronic
+histidine label
+secondary structures of cmRNA
+inhibitory synapses
+Additional research
+15
+contacts within close proximity
+430
+control genome sequences from 8 wolves
+multiplex real-time PCR assays
+T
+eight
+clinicians
+acute trauma, extremely preterm birth, and late presentation to the emergency units
+lung mRNA silencing
+Desmognathus
+One Earth, One World, One Health
+interview and partner tracing
+2 h
+the toxicity of 4 ÀPMO
+17
+Increased media use
+relative ease of their implementation
+BIV
+p ≤ 0.05
+lack of data on clusters
+binding/entry of virions mediated by GP 1,2
+semilogarithmic
+1600
+increased
+leave-one-out cross validation
+IgYs
+ether
+BCL-6
+H5N1
+HIVrelated stigma
+bradykinin
+1184
+selepressin
+gradient
+influenza virus
+ω-O-acylceramide
+>90%
+honestly significant difference tests
+University of Zurich Centre for Travel' Health
+1892
+dopaminergic neuronal cells
+drug development; high throughput screening; reporter mice; age-related disorders
+The sequence conservation among orthologs
+0.7 Å
+the PI must inform the KCTF in writing
+viral titers
+sepsis
+persistent viral production up to 30 days post-infection
+FeLV viraemic
+40%
+mice
+African lion
+spo0A
+Mx1
+Phylogenetic
+Associations with proliferating T cells
+Syncytiogenic
+Blood samples
+hepatocytes
+3 days
+murine
+OA, soybean oil and soybean phospholipid
+physical knots
+sinusoidal and anteroinferior ST elevation
+GraphPad Prism4
+severe inflammatory diseases
+instability element 1
+10 min
+virusspecific
+Axio Imager Z2
+50%
+Complicated
+100%
+5
+lymphopenia
+two groups
+rice cultivation and flooding irrigation
+Constant returns to scale
+output feature maps
+real-time PCR assay
+Influenza A
+manipulating the genetically programmed basal or induced levels of defensin expression
+stochastic
+lovastatin
+HA imprinting
+contact rate between infectious and susceptible individuals
+tilmicosin and tylvalosin
+ZFNs
+resource-poor settings
+antiviral
+cosavirus A
+KOD-plus-Neo
+Stata software version 15
+5
+12
+Poly binding proteins
+CS
+The partition coefficient
+96
+IRF3
+GRADE
+KIH packing between the associated helices
+prior antibiotic treatment
+nuclear localization signals
+basal activity of AMPK
+Node ages and correspondent 95% highest posterior density intervals
+Angiotensin Converting Enzyme-2
+XLStat
+no seasonality
+two
+655
+H7N9 case reporting and identification
+2 to 180 kDa
+protective immunity
+Improved quality of care
+caution
+mechanical
+14 days
+inhibits acidification of the trans-Golgi compartment
+antigenomic
+increase BMV RNA levels per cell
+meta-analysis
+90
+reliable energy parameters
+PicoPure RNA Isolation Kit
+arginase
+middle of 1990s
+NCBI Influenza Virus Resource
+25 L of RNase A and 50 L of propidium iodide
+Mutation of His208
+preferred codons
+Frequency of transmission events
+misfolded proteins storage and proteostasis control
+PTIO
+11%
+immunocompetent
+five to nine
+200 µL of rVSV-VP1
+differences on ORF layout
+speeds up the identification of genes and proteins
+H5N6
+23%
+Four
+they offer no improvement over other established infection models
+tumor size
+IFN-β
+2 weeks
+Pollination syndrome theory
+G0-arrested cells
+Ni 2+ -NTA agarose resin
+Eight
+RPs
+300
+3500
+respiratory support
+Nasal cannulas
+wearing a nose clip
+Six hours
+2-CTC resin and standard Fmoc chemistry
+regulation of proliferation, differentiation, cell adhesion and apoptosis of cells
+The pathogenesis of rhinoviral infection
+GW motif
+NucliSens easyMAG
+Rev-responsive element
+20
+B cells, DCs, and NK cells
+Vero cell adapted PPRV Coimbatore field isolate
+putative regulatory mechanisms
+intent-to-treat principle
+asymptomatic controls
+Three
+low sensitivity
+HIV-2
+local translation of ACE2 in affected organs
+one per million
+DAPI-stained nuclei
+Developing and conducting trainings
+Agincourt AMPure XP beads
+host mimicry
+translocates to the nucleus to activate gene transcription
+eight
+V regions
+Bayesian
+Biological information stored in databases
+Complexity and dynamic range of protein concentrations
+a shift in the interference pattern
+Z-score
+biosynthesis and metabolism functions
+nuclear metabarcoding markers
+prediction algorithms
+exploration
+multiple strains
+higher MDA levels
+Ten
+fresh antibody
+check your spam filter
+3A
+cardiac
+Tannins
+99
+national security agencies
+fluorescent proteins
+1× PBS
+91
+those developed in clinical laboratories
+human kidney
+PKR, Hck, and p38
+TCM extract library
+CIRMF
+protective immunity against influenza virus infection
+Residue 294G
+ribosomes with ongoing translation
+One month
+three
+high-dose inotropes and vasopressors
+CD8 T cells
+27.3%
+30 mins
+interlaboratory strain variation
+E. coli or in P. pastoris
+non-blood fed, nulliparous and inseminated females
+a stricter, 1 m criterion for contact data retention
+recombinant technology
+P
+vitreous
+WBC
+Centre for Reviews and Dissemination guidelines
+changing viral receptors
+monoclonal
+10 cm and 50 cm
+Watson-Crick and wobble basepairs
+150-180 mg/DL
+polymorphic, conformationdependent epitopes
+Caspase-Glo 3/7 assay kit
+spleen and liver samples
+Department of Infectious Disease Epidemiology
+0.677 and 0.323
+types of land cover and agriculture
+Newcastle disease
+autoxidation and self-conjugation
+24
+Dr. Praveen K. Gupta
+16
+via the receptor CD155
+S6 Table
+reference category
+5 weeks
+SLLTEVETPTRSEWECRCSDSSD
+Parker et al
+Bob Darnell's lab
+CSPG GAG side chains
+Cathepsin S
+5%
+Blood-based testing
+fold change >1.50 and p-value < 0.05
+zero
+GUCCUUCCAA and UGUGU
+LBR and Rab5
+Supplemental oxygen use
+reduced proinflammatory cytokine secretion
+how it is perceived and dealt with by both the innate and adaptive immune response
+what percentage of the population is vaccinated
+Insulin-Transferrin-Selenium and 1 ng/ml EGF
+Ventilatory adequacy
+zoonosis
+ulcerative colitis and Crohn's disease
+MDA levels
+IMPUTE
+10 to 50 µm
+6 nM
+one bent or buckled end
+The schedule of enrolment, intervention and follow-up assessments
+Italy
+α5 integrin
+Rab GTPases 5 and 11
+congenic marker staining
+Sensing of HCV by RIG-I or MDA5
+proximal tubular cells
+70%
+LPS-primed BMMs and dendritic cells
+Participant samples with GST MFI levels above a threshold of 1,000
+15.2 ± 6.4 days
+SPSS 13.0
+Age-at-exposure related effect
+11
+DENV infection
+strikingly different
+30 minutes postinjection
+cellular machinery
+intestinal healing and anti-inflammatory function
+sporozoite proteoforms
+mouse tumor models
+Ravn GPcl
+Weibo
+viral infectivity
+particle detection and tracking, trajectory classification, and physical modeling
+15.4
+Metagenomics
+European Centre for Disease Prevention and Control
+π
+Vim À / À
+lytic agent
+chemical
+6000
+X-ray crystallography and NMR techniques
+Hardy-Weinberg equilibrium
+5%
+taphonomy
+notum
+21,000
+Ova-specific ELISA
+1 h
+Fieldworkers
+protecting a naïve population from pathogen invasion
+Dr. Ervin Fodor
+SCI
+rgPB2-K627E + Q591K
+Solvent
+luciferase assay
+Autophagy
+Model B
+Seryl-tRNA synthetase
+4E-BP1
+shorter QT and PR intervals
+thousands
+954
+monophyletic
+decreased
+temporal distance
+blood transfusion
+NH 4 Cl
+Sir Horace Smirk
+separate excel files
+vaccination planning
+lipid A
+interactions with Lsm11 NTD
+50%
+1.5%
+50 ng/ml
+interests
+Intranasal protein-based or attenuated vaccines
+inhibits Vsig4 gene transcription
+411 aa
+mucins
+US-guided punctures or injections
+9.1 ± 2.2 days
+illness
+μ
+50
+29
+F6
+neurotrophic factors
+TCS
+88
+binds to viral protein PB1-F2
+chemiluminescent
+serious consequences
+A probe and an enhancer
+Gly88
+HA and NA
+893.9 Å 2
+caplacizumab
+Cervix uteri cancer
+subendocardium
+overrepresentation of hospitalized patients
+non-segmented negative sense RNA virus replication
+throat and nose swabs
+univariate logistic regression
+cc-by
+50%-57%
+Olympus IX-70
+Error bars
+TLR-3
+Dr M. Harris
+Killer virus
+100%
+infectious matters
+A short fused-silica capillary with a tapered tip 37
+an item
+100
+inflammation
+Genetic algorithms
+CiteSpace V
+degraded
+100%
+3 to 6 days
+Quantitative real-time reverse transcription polymerase chain reaction
+a model using a simple regression
+Thyroid hormones
+serum nitric oxide levels
+APC8
+oropharyngeal cells
+Egr-1 mRNA upregulation
+16%-33%
+one
+Host shifts
+esophageal and intestinal smooth muscle
+sequence-specific geometry
+to determine viral propagation
+NIRVS
+six
+100%
+8 to 10 ml/kg
+prophylactic
+macrolide
+42-fold
+extinction risk
+SEED alignment
+progression of some CMV infection disease
+12%
+actinomycete
+high local concentrations of the toxin
+protective
+3 and 5
+Mock-infected mice
+Western Lightning Plus-ECL reagent
+a sample size of 158 patients
+past behaviour
+Outliers
+37 °C
+more than 10 million
+A concentration of 0.3 M and a high MOI
+2 hours
+six
+C-type
+inhibits viral attachment
+initial muscle strength
+Japan
+hospital ownership and geographic location
+more extensive molecular and genetic analysis
+deposition of collagen and fibronectin
+ivermectin and importazole
+a short temporary inability to perform liver transplantation
+Anti-HA antibody in peripheral blood sera
+five
+pPG-COE-DCpep/L393
+Lung tissue
+z-dock and Hex
+155 bp
+the end of the primers
+Pogge
+a standard Susceptible-Infected-Susceptible model
+Lipoteichoic acids
+Glasdegib
+28-day mortality
+PARRIS
+an N-terminal amphipathic helix
+throughput
+facilitating the release of LCMV virus particles
+dewaxing and hydrating
+predictive AUC
+sfRNA
+premature mortality
+specialized transcriptional coupled chromatin readers
+16
+5% Chelex 100
+Significance intervals
+protease sensitivity
+viral glycosphingolipids
+1
+4,735
+Multiple independent rescues
+TMB
+1.873 6 0.375
+human peripheral blood
+15
+activation of AhR signaling
+seven
+ESCRT pathway
+UN/N
+PDQuest
+basic reproduction number
+Chain B of PDB code 4WSB
+a terminal position
+Oseltamivir
+nucleotide 858
+disposable overalls and powered air-purifying respirators
+p A m
+10 min
+Monotonicity
+four
+metaarrestin
+10 ml of trypan blue solution
+LCMV production
+patients requiring mechanical ventilation
+ZIKV-prME pooled peptides
+TrxR
+IFNc
+high and similar
+monolayers
+Leiden, the Netherlands
+The sequence of scFv-A4
+Experimental variability
+Liquorice
+Approximate Bayesian computation
+Pseudomonas aeruginosa lectin LecB
+IL-10R blockade
+Lewis rats
+number of tips
+changes of nearest neighbors
+GL-treatment
+immunofluorescence
+volume capnography
+important mediators of apoptosis
+acetic
+medicinal materials
+to prevent harmful immune responses and inflammatory diseases
+Mutation of the catalytic residues
+37
+to identify and rank the most important factors driving the risks
+absorbance
+herpes simplex virus keratitis
+I/R injury, sepsis, and multiple organ failure
+H = 1
+UPR
+GADD34 expression
+0.003
+focus forming units /ml
+12 h
+Highly sensitive
+Protein Data Bank
+rank-based method
+30 to 50%
+28 weeks
+5-Fluorouracil
+Twenty-four hours
+SuperSignal West Dura chemiluminescent substrate
+PKR
+UV and heat-inactivated
+APC10
+Intrinsic
+Yang
+CD8+ T cell
+10 out of 10
+immunofluorescence microscopy
+EBV
+day 13
+GU325783
+Four
+natural reservoirs of HIV-1
+high costs associated with increasing inspection rates
+three
+data
+DENv2
+reaching sufficient vaccination coverage
+antidepressants to antiasthmatic and anti-inflammatory agents
+professional health care workers
+IgM
+matrix metalloproteinases
+SARS-CoV 7
+EGR1 upregulation
+graphlet degree centrality
+neutrophils, DCs and pDCs
+AD3BF2D
+viruses
+spatial dispersion parameters
+six
+planned road connections
+similar
+4,217 nucleotides in length
+the stem region of the hemagglutinin protein
+USP15
+Receiver operating characteristic curves
+Sekisui XenoTech
+signature performance
+␤-cell function
+epithelial cells
+transfected 293T cells
+HTSeq-count
+infection
+Identifying the binding motif and binding register
+Data on the in-hospital case fatality of different pesticides
+scores with biomarkers
+October 2003
+luciferase-tagged HCVpp
+Those studies targeting only the VLPs of the microbiota
+antibody recognition of the protein surface
+E. histolytica
+48 hour
+proinflammatory
+30 min
+Functional enrichment
+rare individual host susceptibilities
+GP 1,2
+antiviral tests
+to assist virus dissemination
+restricts influenza viruses
+Genomic DNAs isolated from r + or r 0 cells
+67
+r~0:2
+distributional
+a TLS
+Viral protein 3A
+1918
+Health education
+lamina of the cortex
+ImageJ
+126
+Logistic regression analysis
+cerebral palsy and epilepsy
+attenuated viral vectors
+Rhesus macaque and sooty mangabey RNA samples
+binding to its receptor CXCR2
+quality assurance procedures
+cases with onset
+mean ± SD
+an appropriate likelihood
+2 days
+Negative binomial regression models
+Central Nervous System Tumors
+a dose of 2.0 x 10 7 TCID 50 /fish
+42.51 months
+Equimolar amounts of Mag and Hon
+CmoA and CmoB
+high flow devices would not be withdrawn
+Jingmenviruses
+sterile cotton swabs dipped in normal saline
+forest rodents
+SMARCA2
+Ticks
+dengue virus
+anti-proteolytic potency
+Xpert induced sputum/gastric lavage results
+levels
+cyclin dependent kinases
+dendrimer
+intrinsic disorder
+40%
+site-specific
+Endosomal acidification
+national surveillance reporting and/or autopsy requirements
+2.5%
+inhibit viral infection
+200,000
+5099
+ENC values
+nucleoli
+attack rates and costs
+compartmental models
+an aliquot of the extract containing 700 mg of protein
+opposite and unintended consequences
+focus-forming units per ml
+Four
+very few mutations between ancestor and descendent
+1 week
+AT-II and bronchioalveolar stem cells
+anti-TIM-3 mAb
+94.2%
+46
+Y. pestis
+149-100 × 10 9 cells/L
+Particular attention
+21%
+CEM Liberty TM microwave peptide synthesizer
+cells clogging the NA binding membrane
+World Health Organization
+epsin N-terminal homology domain
+April of 2014
+Unconventional Protein Secretion
+one year
+amplified
+cellular
+outpatients
+pulmonary bacterial colonization
+36 h post Pm infection of mice
+attenuated bone erosion
+input data quality
+24 h after administration
+literature
+Defensins
+diverse abundance
+optimize parasite growth and development
+30 min
+Eq.
+impaired decision-making represents a potential endophenotype of suicide vulnerability
+candidates for development of novel cbDVG-based adjuvants
+1890
+C5
+linear
+neighbourhood contact hubs
+protein biosynthesis
+vesicles
+IRESes
+to ensure that the embryo will be supplied with sufficient nutrients and oxygen
+Regulation of protein translation
+Tetraspanins
+7 days
+significant change
+Lipid cores and fibrous caps
+Katnal1 1H/1H mouse brains
+pharyngeal
+71%
+Jackson Laboratory
+inflammatory
+Met residue
+20%
+Lys63-linked ubiquitination
+Klebsiella
+2003
+13
+Resveratrol
+Bl and Bt
+p
+Ͻ 300 g/mol
+mdx mice
+antiacetyl-lysine antibodies
+20,000
+further assay development
+2-month
+divergent fibrogenic diseases
+M V
+vibrating mesh nebuliser
+IRES elements
+their legal department
+PCR Kleen Spin Columns
+Malaria transmission
+catabolic
+seven
+Cd2? uptake into MDCK cells
+80%
+Gilead Sciences
+the effective irreversible uptake from the input
+μnx * 2 /α 2
+4
+Gram-positive
+phylogenetic
+Chemical siRNA Modification
+0.155
+Mitochondrial AntiViral Signaling
+more than 200 million
+Detailed studies
+Fluorescence intensity
+HCV RNA levels
+North Africa
+100 nM thapsigargin
+mamastrovirus
+more than 8 months
+lncRNA NKILA expression
+global health
+protein tyrosine phosphate
+parasite spread, disease severity and parasite evolution
+type I 0 and II 0
+antibodies to a variety of structural and nonstructural viral proteins
+externally regulated transcription
+B
+Arrangements
+pending
+Asian studies
+Super-Pose version 1.0
+CAV16
+PERK or IRE1a
+Fugene
+Research
+Computational methods
+55
+CSFV and PHA stimulation
+λ 1
+electronic, steric, geometrical, and quantum property profiles
+numerous dysregulated networks and cellular functions
+2 kbp
+DCs of four independent donors
+EcoRI and SalI
+divides the sequences of an RNA alignment into subgroups with different consensus structures
+dependent on contact with the host cell
+All military care providers
+5-7
+Dr Taubenberger
+1.84%
+29
+lack of sufficient host contact networks
+four
+public land
+Intelligence Program
+6.00 days
+Stockholm format
+prohibitive memory limitations
+flow cytometry
+IL-17A
+M1
+reminders
+3.4 to 7.2 mg/dL
+cell-cell adhesive junctions
+Short-Term Scientific Missions
+a series of weights
+adjustments using a constant correction factor
+7.4
+383
+1 d
+77.0%
+28%
+occupational status
+limits the interpretation of our results
+pBzMM150
+Transmission of GAS
+E1-A226V
+The virus organ system tropism
+HS
+LAG3
+120
+Consortium RNA spike-in control mix
+ORF29a and ORF65
+Cellular supernatant samples
+via the SecA secretory system
+2 h
+hemadsorption site
+five
+Andalusia
+dynamic global trends
+susceptibility and resistance after IV infection
+preventive
+equal to the following
+E1E2 global folding
+severe acute respiratory infection
+MRSA
+hemorrhage
+NLRP3
+8
+Strain 630Derm
+His60 Ni Superflow Resin
+APASL definition
+RT-PCR, IFA and TEM assays
+β-MAN, MAL and PLD
+1817
+endoplasmic reticulum
+intracellular
+G
+twice per day
+aged
+mechanistic
+physiological barriers
+decreases the chance of being infected
+accompanying adults
+University of Nebraska Medical Center and the National Institutes of Health
+24-h
+amplifying primers and additional internal sequence primers
+neuronal
+viral RNA
+10.1%
+other major gross or histological changes
+those of wild-type cells
+serology
+unclear
+116
+national suicide prevention strategies
+S. enteritidis or C. perfringens
+48 hours
+fetal intestinal cells
+hematoxylin and eosin
+C1-INH
+Pools 2 and 5
+0.4 to 0.6
+immunofluorescence
+statistically significant
+poorly vascularized
+30 and 40
+small number of patients
+gaps in oseltamivir
+RANTES
+H3N2 data
+HCV seropositivity
+20
+ambient temperature
+700,000
+output as raw data files
+hypothesis
+positively charged residues
+reference structures
+4 h
+58.3 per 10,000 persons
+genotyping in HRV
+Australia
+gametocyte formation
+13
+twice
+respiratory distress
+inconsistent adherence
+dementia and mental confusion
+history operation and current situation
+statistical significance analyses
+diabetes
+T-2
+RNeasy Mini kit
+upper and lower RTIs
+20-21 May
+Quantitation
+no viral replication is observed following challenge
+a near-absent upstream IFN induction
+L 2
+A-SAA
+levels of CTL activity
+Virus isolation
+The Adaptive Neuro-Fuzzy Inference System
+convincing effectiveness
+host cell entry of HIV and SIV
+300 µM E64
+28-day and 90-day mortality
+seven
+23
+lack of funding
+IL-8
+iodoacetamide
+National Institute of Standards and Technology
+warmer distal airways and lungs
+reducing biological threats
+tDCs
+MobA89K
+aliquots of GI digests
+Nine
+higher
+acute mountain sickness
+1957-1958
+ImageJ
+in vivo efficacy
+follicular B cells
+science
+53
+local information flow
+demonstration of absence of disease exacerbation
+gene genesis, lateral gene transfer, and gene loss
+greenblocks
+10
+24 hrs
+Five
+higher rates and levels of exposure
+RNA replicases
+30%
+C4 mediated neutralization of Ad5
+enhancing antioxidant enzymatic processes and free radical scavengers
+Occasional solitary fibers
+one typical infection person
+CD4 + T cells
+the location of distal-eQTL
+hydrochloric acid
+nuance and complexity
+several to hundreds
+15 days
+copyediting, typesetting and review
+Bypass surgery and angioplasty with stenting
+novel cellular proteins hijacked by KSHV
+54
+dichotomous variables
+robustness
+one day
+2 weeks
+Adobe Illustrator
+looking for adverse events
+preparedness and response to disease outbreaks
+oral fluid intake
+over a decade
+a black border
+Link density
+RNA viruses
+1 month
+MRSA
+eIF2a phosphorylation
+77%
+p62/SQSTM1
+23
+oxidative stress and chronic retinal inflammation
+its relatedness to the pathogens' original host
+30
+one gene
+a number of different cellular proteins
+cytoplasmic pathway
+WT mice
+33
+other, more important, activities
+10%
+lung edema
+12 or 13
+Unmanaged planning, limited public infrastructure and informal employment and economies
+-1
+PRDX1
+PEDV infection
+S. pneumoniae
+common vampire bat ecology
+actively transported to the cell periphery and released prior to cell lysis
+ACTB, TUBB and GAPDH
+peptide ligands
+SOFA
+immunohistochemistry and immuno flow cytometry
+1 : 9 or 1 : 12
+loss of the gene product or a substantial reduction in gene function
+Viral and bacterial infections
+EGFP and F4/80 cells
+opaque liquids
+89.1%
+clodronate-liposomes
+Sensitivity
+late June 2015
+28652
+susceptibility
+providing the information desired
+a family of IFN-and virus-induced proteins
+NF-κB
+competition between strains
+IFN-λ3 rs12979860
+nutrient availability
+controlling tumour growth
+protection against SIVs
+shedding of the L-selectin receptor from the cell surface
+I1R, I2R, and I3R
+standard formulas
+E53 IgG
+Anticoagulant
+20 minutes
+4 to 5 months
+80%
+Plasmid DNA cloned with HBV or HCV sequence
+passage bias mutations
+Isoflurane
+leukocytes
+IRF-7
+1%
+aberrant complement activation
+viable virus released during coughing
+higher than 80 %
+urinary ACE
+monkeys
+0.5 ml terminal transferase
+ANDV Gn-derived peptides
+158
+Eight
+GiRaF
+weakly
+cytolyctic
+allelic interactions
+treating other diseases
+490 nm
+thermodynamic
+penicillin
+species-dependent
+multicolor flow cytometry
+100 %
+Local room temperature and relative humidity
+constant factor β
+differentially
+Diagnosis and hospitalization
+0.3% H 2 O 2
+tertiary base pair interactions
+duplicate on cells
+93.4-98.9%
+non-pathogenetic control variants
+dengue haemorrhagic fever
+middle east respiratory virus
+Tekmira
+21,005 ± 870
+48%
+Membrane cholesterol
+macrophages
+5%
+induce inflammation and ALI
+100% sensitivity
+0.2%
+Abundance
+alcohol dehydrogenase
+V149A
+maternal physiology
+electrophoretic
+6
+HCWs
+ligand binding mode
+personal records
+neurological disease
+nine
+altered phagosomal compartmentalization of DENV
+adhesion of particles with Ag or Abs bound to their surfaces
+translation in cell-free translation systems
+Kanzlerin
+0.2 mg/ml
+gut recognition and binding
+ELISA assays
+caution
+crucial for reactivity
+glutamic acid
+HIV-1 entry inhibitors
+Integrated DNA Technologies
+Diagnostics
+Descriptive statistics
+upregulation of STAT1 and STAT6 expression levels
+to detect anti-PPRV antibodies
+isolates binding and fusion processes from endocytosis
+Humidity
+133
+epidemic network topology
+traditional phylogenetic methods
+antiviral drug
+ethical
+HHT
+MRSA
+PI
+2.7 million influenza-related deaths
+nucleoproteins or capsid proteins
+gloves, gowns, masks, respiratory protection, and positivepressure ventilation suits
+13.4%
+4
+size exclusion chromatography
+IFITM3
+viral secondary structure
+expression level of RTA
+overexpansion of hematopoietic precursors
+triangles
+2015100910396112v1
+24 h
+intermolecular interaction analysis
+A * 11
+E protein trimerization
+cell culture supernatant
+448
+infectivity factor
+antiviral
+statistically significant
+an attached lipid moiety
+mitochondrial ROS
+Symptomatic
+RT-PCR analysis
+exosome-less
+explicit within-host dynamics
+High-mobility-group-box chromosomal protein 1
+1/µ M
+10 days
+the number of steps required to find either a match
+1621
+AtRH2 and AtRH5 helicases
+two
+S. dysenteriae
+TTSuV1
+traffic crashes, residential fires and violence
+respiratory support including extracorporeal membrane oxygenation
+BRCA1
+human carcinogenesis
+IL-17A/F
+sterile solutions
+rMP12-SFSNSs
+AS03 A and AS03 B
+intimate
+4 weeks
+restoration of some negative charge at the N3 center
+weight gain and uncontrolled hyperglycemia
+ubiquitin-specific
+cap-dependent translation in HeLa extracts
+reinitiation efficiency
+Early detection
+4q27
+1333
+PCR product
+PI3K and Atg7
+four
+alters C-type lectin utilization
+2004
+hepatocytes
+potential therapeutic target
+amino acid metabolism
+three
+Compound Topographical Index
+i
+36 h post-infection
+ICU attending physicians
+146
+solvation environment
+developed countries
+Understanding the mechanics of a signaling pathway and its downstream targets
+little
+Dengue
+amodiaquine and chloroquine
+unit vectors
+tonometry
+reverse transcription
+Axl, Dtk, and Mer
+Enteral feeding
+6%
+milliseconds
+exponential
+human AFP may interact with these signalling molecules
+Glutamate
+bind pRB and displace E2F
+A to G
+Ubiquitination
+2000
+50 mL 1:10 diluted purified toxin
+4%
+filter paper
+exon-skipping efficiency
+epigenetic markers
+44
+Ultrasound
+NSs protein
+mRNA circularization
+sinI
+CFU and protein concentration
+an entire BAC clone
+rVV-Empty-inoculated macaques
+neutrophils
+WHO Programme for Prevention of Blindness and Visual Impairment
+Leishmania donovani
+rRNA
+CPT2
+Sterile 0.9% NaCl warmed to body temperature
+viral genetic complexity
+The dose of cuprizone
+Data
+improves
+Af1521
+w A ¼ P e2A wðeÞ
+changes in the periphery of the lung
+successful HPV16 infection
+no additional insight would have been gained
+18
+20%
+research groups
+MHV RNA synthesis
+95.8%-100%
+between 9 and 23 months
+0.26%
+HIV/AIDS
+3
+every 2 h
+cancer metabolism
+potential drug targets
+cysteine
+Becton Dickinson
+φ
+>97%
+PD-1△ex3
+1 day
+VRPs
+an episome
+overall AR
+Hundred percent
+pleiot ropic
+BBB permeability
+Rota A
+lipofectamine 2000
+reaching an effective intracellular concentration
+by flow
+Lamivudine
+Disheveled
+mitophagy
+7
+CD45RA isoform and chemokine receptor CCR7
+pre-existing conditions
+Bayesian hierarchical logistic regression models
+Three
+restricting vK1L -C7L
+zoonotic spillover
+5%
+60
+Card9 -/-cDCs or FLT3L-DCs
+Q
+-1 AUA
+423
+Receipt of pre-travel health advice
+school evaluation purposes
+25%
+2.7%
+plasmid
+Multiple Sequence Alignments
+pRen2 plasmid
+viremia
+mitogen-activated protein kinase ERK1/2 signaling pathway
+flexible models
+95%
+BiPAP-Vision™ ventilator
+hatcheries
+inositol
+2014 CDC guidelines
+WHO Class IV
+lack of standardization
+7%
+bariatric surgery
+ESKD
+TNF-α
+3526
+Ganciclovir
+clinical
+two
+enveloped
+three days
+PLOS Medicine Editors
+MAP3K7/mTOR
+cycloaddition reactions
+52,000
+CEACAM1
+68 nucleotides
+61
+Hc-CS
+ten
+thymic epithelial cells
+four
+highly efficient counterstrategies
+1 mg/mL
+VEGFR2 phosphorylation
+Ptrach
+intestinal immune system
+Furaciline and nistatine
+RABV and VSV
+antiretroviral therapy
+6 hour
+complete genomes of CRESS-DNA viruses
+Glyceraldehyde 3-phosphate dehydrogenase
+the binding of purified SP-D
+DMD mRNA knock up
+one hour
+100 μ l of Bright-Glo luciferase reagent
+5-8 million
+host ferritin
+50%
+wheeze, shortness of breath, chest tightness and cough
+400
+50 kDa Amicon filter
+active immunization
+28.2±25.2 months
+1918
+mobility model
+31 min
+CEACAM1
+1610 25 substitutions/site/year
+PubChem
+Restore PLUS stripping buffer
+HIV-1 capsid
+248,000/μl
+exhaled breath
+2.7
+least accumulation of inflammatory cells
+X and Y motifs
+SAPs
+Uruguayan
+DAVID
+immune suppression
+Cell Signaling Technology, Beverly, MA
+Conditioned medium
+3 min
+Cytoplasmic RNA
+n
+3-7 days
+TB-vaccine
+humoral immune responses
+a putative binding site for SF2/ASF
+macrophages or NK cells
+Nsp9
+Climate changes
+the number of closed walks that the node touches
+PBECs/growth factors
+ribosome binding and translational efficiency
+SLEV, YFV and DENV
+ModRefiner 33
+Figure 4A
+neuraminidase
+Ubc9
+fungi
+Controls
+humidity
+Safety issues
+GFP
+space group P4 1
+non-specific binding of the antibody
+straightforward diagnosis
+social distancing and isolation
+Fibrinolysis
+TCA
+clinical signs of infection
+Fluorescent Image Analyzer FLA3000 phosphorimager
+8-10-day
+robust NAb responses
+all the images collected in a single tomographic tilt
+656
+2009
+2.0 ps
+a health sector coordination body
+5%
+Carvalho and Lawrence
+pulmonary embolism, stroke, and deep vein thrombosis
+DNA
+m of K 2 hh
+integrin β1
+total protein concentrations
+trachea, bronchi and bronchioles
+20 min
+temperature, percent carbon dioxide, and humidity
+12.5%
+66 new-synthesized SAIs
+45.9 years
+bind to D 2 DR
+gradually
+six
+variability in infection age
+LoFreq
+sputum PCR
+Retinoic acid
+ICP4
+464
+six
+20 ng of human gDNA
+enzymes
+RR MScl and PP MScl
+18 h
+latent cysts
+Immunohistochemical
+Mr J.J. Gouws
+Azurin
+in vivo model
+Nikon Eclipse TE2000U photomicroscope
+R software
+293T
+EBOV entry
+Missing values
+enhance protein secretion
+Cell populations
+prevention of hematoma enlargement
+Apotosis
+Ducks
+population health benefit
+generalized additive models
+28-day survival rate
+JcDV capsids
+a new water
+CPB time
+based on staining intensity and fractional quantity of stained cells in a sample
+differences and similarities
+cGMP stimulation by natriuretic peptides
+time
+Multivariable Cox analyses
+0.5%
+differential cell counts
+Missing cytogenetic risk
+20.15% per household per year
+stochastic branching process model
+Non-replicating mRNA-based nanovaccines
+ER-associated degradation
+29
+antibody and cytotoxic T cell responses
+A-VPK
+goats and sheep
+calibration beads and a specifically formulated antibody-fluorochrome conjugate
+three
+proof of efficacy
+83,376
+more negatively charged
+infection
+pouchitis
+1000 mg/m 2 bd
+NP
+twice
+ALC on D7
+Hydras and planarians
+virus replication
+one
+different chemical groups of amino acids
+75 nm
+10 4
+Biotechnology Research in an Age of Terrorism
+7.23 × 10 8 cells/ml
+12.12 days
+viral infectious titers
+TDMD of miR-27
+10%
+60%
+innate immune response
+three
+Discrepancies
+Waterborne diseases
+preS1
+150-fold
+infectious bronchitis
+4 hours
+TGFB1, TNFA and IL10
+2 h
+Cytokine
+neurotropic viruses
+preferential mixing
+Anti-human IgG conjugated to HRP
+Oxidative stress
+five weeks
+The SAE reviewer
+PPI
+EPS 26a
+The ENC
+A/J mice
+CEA
+high affinity TCR specific for self-antigens
+2009
+temperature
+local STI clinics
+belief in a range of conspiracy theories are inter-correlated
+finding a novel and effective treatment
+immunofluorescence analysis
+by consensus
+lipoplexes
+Sindbis virus infection
+Respiratory infection
+1.54 to 2.21
+megalin
+inhibition of cGAS
+to demonstrate how community structure affects epidemic dynamics
+morphometric
+poor clinical outcomes
+recombination efficiency
+Bio-Rad
+Protein
+gels
+Veterinary Medicine
+depletion
+abundant glycogen granules and short microvilli
+capacity
+68%
+EV-A71 replication and dissemination
+Epistasis
+PEDV RNA
+alternative hypotheses
+frequency of journeys, infrequent but very long distance trips
+413
+hematopoietic and mesenchymal stem cells
+5 μL
+Ubiquitination
+mutants
+glutathione
+multivariate logistic regression model
+Relative rate parameters
+methionine
+5%
+higher
+Flow cytometry
+12
+desethylchloroquine
+Human noroviruses
+exponential distribution with the weakening parameter
+Confusing word choice
+mock-infected cells
+Cell surface asialoglycans
+glutamic acid
+less than 2%
+experienced surgeons
+JPRED algorithm
+model = 0
+the side chain and the main chain
+R. felis
+1.008
+inducible
+Tables A5 and A6
+B. subtilis
+K48 chains
+fivefold
+2005 International Health Regulations
+The Collaborative Cross
+18 months
+Plans
+pH 4.5
+oligopeptide
+13
+inflammation and necrosis
+Ub and/or ISG15
+transport and housing
+endocytic uptake of TPIC
+ambient aerosol concentrations
+HCV
+QY EON
+150
+short peptides binding specifically to the spike proteins
+Genomic Studies
+hatching rates
+Whole Rhesus Monkey Genome Microarray
+Human resource training
+437D PSK
+24 h
+Normalizer Signal and Batch Correction
+JTT matrix-based method
+Uganda
+Sanger sequencing
+endothelial activation may be an enhancing event
+0.5 mg/g of leaf mass
+Four
+S598 Q600Yspecific CTL
+western blotting
+15.49 ± 4.01%
+to provide a diverse set of epitopes for targeting
+cc-by
+good fortune
+antimalarial
+broader
+200,000
+matrigel
+necrosis
+Colume Viral DNAout Kit
+surveillance practices, population risk factors, transmission dynamics and pathogen evolution
+nanotechnological
+8.7 Â 10 5 /mol
+30 min
+eIF4E
+Hsc70
+143
+three
+ACE2 activity
+ε ij
+memory cells
+≥1.8
+WKY rats
+a-fibrinogen mRNA expression
+this effect
+a single peak
+60% and 50%
+Fob1
+No
+~10%
+Twenty-seven
+58 %
+17.0.0
+implementation of interventions
+clinical and epidemiological
+39.39%
+a stack of flat, closely arranged cisternae
+Phosphorylation of STAT1 at Tyr 701
+Further study
+GM-CSF
+snG:U mis assays
+Twenty-three
+insulin sensitivity
+One strain of HRV-C
+Salamanders
+1990
+more significant
+Cy3 fluorescence intensity
+the chorionic layer
+mouse
+samples
+CGMP
+CFTR expression
+glycoprotein
+selection bias
+hypertension
+ODE
+Renal replacement and mechanical ventilation
+910
+OsSGT1-catalyzed reaction
+RNase 2
+Successful introduction of PR PLTs into inventory
+Balb/c mice
+Prospective immunological studies
+one-third
+underreporting
+flow cytometry and immunoblotting
+Model 3
+13
+AAG
+veterinarians, farmers, ranchers, tanners and food processors
+expression of LPL and CD36
+glycyrrhizin
+LCMV-dependent B-cell activation
+maintain its specific functions
+50
+lower SP-D serum levels
+4 h
+Ψ
+New York City
+integrity of the GI tract
+antiviral costs
+BMG Clariostar
+Whole cell lysate
+prospective screening of fragment and lead-like subsets of ZINC
+100 million
+three
+1104
+CD56 dim NK cells
+DDBJ/EMBL/GenBank
+outbreaks
+Chemical protection experiments
+by way of a personal identification number
+maternal and foetal tissue
+Ag-specific tolerance mediated by Tregs
+chemical-space
+SIR models
+environmental contamination
+TCRγ/δ+ T Cell Isolation Kit
+ATP synthase
+three
+IL-12
+YFV-17D
+Odyssey imaging
+QIAmp ® DNA Blood Mini Kit
+Sf9-rHA
+a composition believed to impart conformational flexibility
+10
+25%
+Monocytes
+37%
+identification of the organ system targeted for diagnosis
+H274Y
+the main issues
+epidemic evidence synthesis
+every 30 min to 6 h
+twice daily
+CD141 + XCR1 + DCs
+11
+scatter plots and regression analysis
+the barrier of the nuclear membrane
+Ambient temperature
+a uniform and symmetric relevance measure
+impulsivity
+10.7 pg/ml
+13
+over two years
+712
+protein concentration
+diversion of resources to contacts of contacts is harmful
+two
+Twelve
+NFκβ, cFos, and AP-1
+3.1.1
+double-stranded RNA
+2008
+probability distribution models
+15 minutes
+50 ng of cDNA
+Epstein-Barr-virus
+Disrupting formation of the ectodomain cystine loop
+220
+Multiple logistic regression
+organ failure
+47.4%
+Proteomics
+35-100%
+a new protective antigen against TB
+nally
+EIA/RIA 1 × 8 Stripwell plates
+tools where the upper and lower quartile for the pairs do not overlap
+IFIT5-oligo-C complex
+N-glycosylation
+Dong Thap
+Bats
+N i
+20%
+499
+8h
+Q162 to S170
+Traditional Chinese medicine
+resequencing, microbial typing, and single nucleotide polymorphism discovery
+Alternative splicing
+unintegrated
+mean AE SEM
+Binding by DgB, DgD or DgH virions
+three to seven weeks
+EMT
+weak power caused by low levels of interspecies divergence
+The water molecule that coordinates with y39
+new members of the CE protease clan
+K E
+Enterococcus faecium NCIMB 10415
+High flow
+5,398
+gB
+non-neutralizing
+13
+CSU Institutional Biosafety Committee
+post-transcriptional gene regulation
+network building
+vascular remodeling and plaque instability
+insufficient geographical sampling
+STING signaling
+Written informed consent
+at delivery
+viral budding
+36
+CT values
+H1, H2, and H3 subtypes of influenza A viruses
+secretory components
+18 years
+IL-18
+Zero Heat Flux Cutaneous thermometers
+guinea pigs
+Kaplan-Meier curves
+high performance liquid chromatography
+five
+gut BT
+one week
+endocytic capacity of DC-SIGN and L-SIGN
+Infants who had unknown BPD status
+lagging research
+BAL
+30
+5
+50 per cent
+Linear mixed models
+novel approaches
+1, 459
+A terms
+31
+neuroinflammatory disorders
+Questionnaire
+20.6±0.1%
+Stakeholders
+DEC-205
+Further research
+the patient's primary care team
+production of infectious LCMV progeny
+hegemonic
+four
+inferring ribosome positions and reading frames
+Life Technologies
+intervention
+Bio-1D
+nuclear
+signs of diarrhoea and general well-being
+Total RNA
+VEGF
+rare
+robust PKR mRNA synthesis
+25
+slightly different
+ABI Prism Big Dye Terminator Cycle Sequencing Kit 3.1
+LOD 95
+viral groups
+aggregation according to logical rules
+three helix coiled-coil domains
+public confidence
+lactoferrin and vitamin D-binding proteins
+acute respiratory infection
+lung ANG2 expression as well as protein content
+QIIME
+48
+Tissues
+Antinociceptive data
+0.02%
+phosphorylation dependent dimerization
+SLE and RA
+chronological
+NLRs
+measurement of IgG antibody
+SP-A2 1A 1
+GenomePlex reactions
+TMV replication
+IFNλ4
+rodent
+HMGB1
+E. coli
+Early contact inhibition
+1/500
+Leviviridae and Cystoviridae
+5.0Å
+susceptibles
+15h
+three or four
+neuroprotective
+EFE promoter
+cytokines
+physician and laboratory reporting and manual analysis of surveillance data
+clotted plasma proteins
+PIAS
+774
+4
+One to two months
+48 hours
+population diversity
+CA clan
+Eight
+The prognostic value of NLR and of C-reactive protein
+STAT acetylation
+differential phosphorylation
+Berberine
+peripheral T-cell lymphomas non-otherwise specified
+LFA-1
+MATLAB
+Half credit
+HBc particles
+CSIRO Australian Animal Health Laboratory's Animal Ethics Committee
+30 min
+1 day
+neuronal NLGN2
+Mucin sulphation
+an overlapping epitope on ClfA001
+isotype PE control
+vivo-morpholinos
+pseudoatom representations of EM density maps
+Stability of chloroquine and desethylchloroquine
+supernatants
+higher DENV IgG titers and DENV2 specific neutralizing antibodies
+Adobe Photoshop
+Thorough cleaning
+tumor suppressor
+Ms. Inamine
+accumulation of Atg8
+Apoptosis assays
+12 h
+whether it could alleviate PEVD-infected diarrhea and intestinal injury
+statistician
+virus yield
+predictions
+two
+myelin base protein
+Poisson Regression
+phosphorimager analysis
+recombinant His-tagged PRRSV N protein
+Prioritization of predictions
+IVT RNA in solution
+Whole mouse lungs
+issued interim guidelines
+divergence and natural selection
+CXCL10 secretion
+phylogenetic incongruence
+components
+host range expansion
+ICAM-1
+one
+Global static compliance
+ten
+MS/MS fragments
+bacteria-infected and virus-bacteria coinfected patients
+C sto
+>2,000
+mice to nonhuman primates
+ISGs
+0.97
+if they had any sample positive for CRE
+4
+Multivariate statistical analysis
+strains that cause natural human diseases
+observe the lung from different angles
+transcription of a subset of genes transcribed by Pol II
+thirty-five
+30 min
+SIEMENS, Diff-Quik™ Stain Set
+2014/15
+17Á9%
+immunocompromised
+18
+decreased protein yield
+Over 90%
+Interferon drugs
+The investigator
+658
+1/τ o
+60%
+Small molecule inhibitors of protein translation
+diffuse occurrence of positive cells with high-intensity labeling
+Nearly half
+Any further responses from the reviewers
+Concurrent plasma
+polymorphisms in CLDN1 gene
+past 500 years
+84/50 mmHg
+GraphPad Prism 4.0
+four
+preprocessed data sets
+Fraction of inspired oxygen
+neurotransmitter abnormalities and occult diffuse brain injury
+biomolecules
+supportive care
+vaccination control
+Anakinra or Kineret
+12
+frequency counts, percentages, and exact 95% confidence intervals
+loss of bacterial infectivity
+20%
+adapting LABs
+120
+NMA
+Baidu
+time to exacerbation and each module's expression
+total growth inhibition
+Aministration of oxygen alone
+42
+four
+cells critical to regulating injury repair
+all the facets of infectious virion production
+James Cook University
+a dual reporter assay
+40%
+six
+BAY 11-7082
+serine residues
+IVIG refractory
+16S rRNA gene sequences
+54%
+35,424
+<100 per cell
+our choice of serial interval
+ANSM
+justified
+IL-12
+18 November 2016
+nasal cannula thermistor
+Bluetongue
+parametric
+s mzs
+LOcally WEighted Scatterplot Smoothing regression modelling method
+aggregation
+MEDI8852
+32
+hepatic neutrophil migration
+RFL11
+16S rRNA gene sequencing
+evaluation
+late July/ early August
+MnmC
+higher survival rates
+life chaos
+spleen and liver
+U 8 and A 8
+sequence no. 6-14
+porcine fetus samples
+Unpaired t-test
+2,773,479
+motor coordination
+20
+Latex
+16 h
+co-infections or multiple infections
+Opr-S3-ArgTAG 3
+anoikis
+De novo-synthesized sequence
+series preliminary experiment
+75 U/ml
+Infection events
+behaves so poorly
+6,000 L/cow
+more detailed genetic information
+chronic inflammatory myopathy
+0 to 60 μ g/ml
+213 SVQYHPL 219
+one-way
+PWK/PhJ
+macrophages
+ulcerative colitis
+RNA transcripts blocked with ribavirin
+31.4%
+patients who required liver support devices or liver transplantation
+30%
+geographic information systems and other geospatial tools
+rare earth ion-doped phosphors
+LOE
+lung/thorax index >0.24
+susceptibility, viral replication, or transmissibility
+twelve
+BM2fluc expression
+485 nm
+395 kDa
+alpha-macroglobulin
+VEGF
+Methods
+sequence X
+12
+glucose transport stimulatory
+seven
+Blood
+confidence intervals
+anti-ZIKV NS1
+Table S3 and Figure S4
+blood vessels
+angiogenesis
+fetal programing events and cardiovascular dysfunction
+epithelial cells of the respiratory tract
+10
+Erasmus MC
+serogroup classification
+the coefficients for the AR terms
+distributional assumptions
+Heparin
+inhibited the autophagosome accumulation
+The lungs
+molecular dynamics
+Leuprolide
+Student's Ttest
+mammals
+traditional media
+Extramedullary haematopoiesis
+G0/G1
+340
+30
+Shapiro-Wilk test
+8-isoprostane
+trend selection criteria
+Each protein ratio
+254
+bacteria, fungi and protozoa
+48.46%
+Nikon TS100 Eclipse inverted microscope
+vascular leak syndrome
+one-way
+high-dose
+24
+12
+2003
+monoclonal antibodies
+Wanfang and Chongqingvip
+isofluorane overdose
+200 µL of 0.2% crystal violet in 20% ethanol
+positive
+Sandwich ELISA
+Disruption of the mouse mdr1a P-glycoprotein gene
+mAb 4G2
+microplate reader
+Molecular dynamics
+3
+Arunachal Pradesh
+48 hours
+structural complexity and abundance variation of different constituents
+1,170
+dire consequences
+Radiation exposure
+site-directed mutagenesis
+plastic beakers
+Dengvaxia
+r0
+mild and severe
+posterior distributions that are maximally different from prior beliefs
+mouse
+antagonize influenza A virus replication
+VACV
+aerobic and anaerobic
+its own promoter
+Sequence based epitope prediction
+1 week
+CD4 + CD45Rb high T cells
+protection against enteric and other diseases in children
+gL
+Rabipur
+TBSV replication
+65uC
+antiviral immunity
+WH211 and WH303
+multi-omic
+2 weeks
+organelles
+P < 0.05
+oxygenation
+ligands
+the substrate
+Student's t-test
+102
+2175
+critical positions
+religiosity
+daily
+the average of Y
+adults
+cellular aggregation of hepatocytes
+PCR results
+ϕ P→Q
+China
+AmphoB
+50 μg
+Creative Commons Attribution Noncommercial License
+Nikon A1 MP multiphoton confocal microscope
+VP2 protein
+Seven
+95% of the variance in the transcriptomic and microbiomic data
+Chemically assembled electronic nanotechnology
+Efficient delivery of siRNA into cells or organs in vivo
+protective
+maintenance medium
+pleating
+antiviral
+recovered, infectious recombinant RABV
+elevated levels of STING dimers
+occupational stress traditions
+to illustrate that this method can apply to plant
+4 L
+exogenous adjuvants
+more than 3,400
+12Á7%
+FUS-like or hnRNPA2-like aromatic interactions
+High specificity, potency and safety
+24.7 ± 2.1 kg
+genes involved in oxygen transport, protection against reactive oxygen species, and host defense
+Z-scores for each individual nucleotide
+30 min
+animal models
+Dead cells
+Southeast Asia
+FoldX
+225
+Dinguiraye, Guinea
+population averages as box and whisker plots
+long non-coding RNA expression
+13%
+miRanda and TargetSpy
+the cell or host environment they infect
+zoonotic
+MAb8430
+93.5 days
+V9G and LS266
+WNV strain NY-99
+URA3 gene insertion
+Drew Weissman
+0.2% ethylenediaminetetraacetic acid
+empirical use of antimicrobial drugs
+ROs
+primary and immortalized cell types
+CPE, infectivity, cell susceptibility, and attachment activity
+type 1 regulatory T reg cells
+their respective double-stranded promoters
+zebra-conspecific and rhinos
+angiotensin-converting enzyme 2
+1 and 4 days
+lectin-carbohydrate interactions
+2-minute epochs
+DENV-2
+CVCVA5
+fragile
+goat anti-human IgG-HRP conjugate
+Death rates
+Three
+An internal membrane
+the fusion loop at the tip of flavivirus E DII
+IL-1β and IL-6
+18,000
+differences in the absorption route
+Wistar rats and C57Bl/6 mice
+ganglioside antigen GD3
+Oligonucleotides
+35
+Illustra GFX PCR DNA and Gel Band Purification Kit
+hematopoietic
+an adapter-linked random nonamer
+H1N1
+PPs
+Psychosocial
+E1
+MSC-secreted CXCL12
++5I
+H4a
+19
+antiviral
+periparasitic
+220
+NORs
+Replicate experiments
+PKR
+Numbers
+FgPV-1
+30
+75%
+Genomic DNA
+pairs detected by the PPI calculation
+Citrus tristeza virus
+Chondroitin sulfate proteoglycans
+4-6 week
+pVAK1
+herpesviruses
+small
+asthma and juvenile onset diabetes
+microarray
+488
+figure 2
+T. brucei infection
+terminal, poor body condition, further medical attention needed, and healthy
+ribonucleoprotein complex structure
+cytoprotective
+once per day
+a likely interaction
+weeks
+B21 haplotype
+their advice
+Two
+encouraging active discussion of pandemic issues
+Acute respiratory distress syndrome
+VACV and HCMV
+a relatively variable region flanked by conserved regions
+2 sub-sections
+hyaluronic acid
+three
+ICD codes
+Pseudomonas aeruginosa
+a k and b
+CD4 T cells
+Sigma-Aldrich
+UPF1
+A table of random numbers
+one third
+suppression of proliferation and elevation of apoptosis
+KRAS
+22%
+Validated constructs of interest
+southwestern
+subtype
+protein-folding machinery
+no preformed virus was present
+they allow insights into heterogeneities in the population
+Grape pomace
+1,562
+hepatomegaly and periportal edema
+2 ml of DpnI
+2013-11-22
+increased virus replication
+ADA
+anti-adhesion
+disease transmission
+the standard curve
+Epidemiological parameters
+outside of the lungs
+formation of the antiterminator SL2
+2
+Rho activation
+86.8%
+risk as hazard, risk as liability and risk and precaution
+transferring DNA plasmid to Caco-2 cells
+19%
+PubMed
+RNA structures that accelerate the replication of viruses
+lymphocyte count
+generate genetic diversity
+807
+Quercetin
+1.5 to 2 mM
+granulocyte macrophage
+Chi-square tests
+Unit-length HBV linear DNA
+American Type Culture Collection
+Single nucleotide polymorphisms
+three
+Four
+multiple sclerosis 29 and systemic lupus
+methyl cellulose overlay media
+33.8%
+once a month
+missing values in grey
+adjacent promoter activity
+direct-acting antiviral agents
+mild respiratory illness
+wortmannin
+1200
+Type II
+gene-dependent decrease or increase of mRNA copy numbers
+Cp > MIC
+DDCt method
+warming
+steroids and immunosuppressive drugs
+RNA viruses
+pre-formed immune complexes
+Supernatant
+8
+4
+NSP3
+spatial location, physiological traits and/or social behavior
+19
+developmental immaturity of innate and adaptive immune systems
+JACET
+four
+data dependent
+21
+79
+respiratory disease
+CVTree3
+changes
+340 bp and 320 bp
+societal interpretation
+T
+group 2
+128
+beta-adrenergic receptor and rhodopsin
+no conflicts of interest
+A H1N1
+pulmonary vascular leakage and the severity of acute lung injury
+B cell phenotypes accumulating in the CNS
+CNS infections
+the placenta in exosomes
+feedback and interventions
+Vasculotide
+malaria
+supplementary
+right-censored
+four
+101
+90
+>500 × 106/L
+19.4%
+CC 50
+animal disease detection
+14 days
+verbal consent
+all stakeholders
+five-fold higher
+6 grades
+200
+systemic inflammatory response syndrome
+17
+24
+Myeloperoxidase
+2.014 Da
+Animal Care Guidelines
+value of trust and the principle of transparency
+protective
+subgroup survival analysis
+therapeutic
+TNTs or endocytosis
+headache and confusion
+mammary gland
+6-month
+statistical
+rule changes
+120
+1483
+2243
+well adapted
+H1N1 virus
+579
+Accessory genes
+around the borders of Guatemala
+dengue
+Dr. Yount and co-workers
+decreased
+public health education
+antibody to F4/80
+humoral
+blocks Ebola infection
+␣
+alveolar
+protein A affinity chromatography
+control images
+disease
+EBOV
+60S
+viral
+lack of sustainable funding
+DB32-6
+Forty-eight hours
+PEDV and RVA
+over 10,000
+a sequence that was identified as an epitope
+a large portion of a network
+clathrin-independent uptake route that leads to acidic endosomes
+bovine blood
+suboptimal freezing, storage, or thawing of the cells
+higher
+12th-14th March
+perfectly matching stretches
+six
+TRIzol
+WT
+gag sequences
+pre-commit to vaccine purchases
+ρ I,R
+95%
+Phylip's SEQBOOT
+2,000 JPY
+increases in poultry stock and sales during Chinese New Year festivities
+pNGAL and UO
+PI
+severe
+95% confidence intervals of the median
+according to both their isoelectric points and their molecular weight
+filtered homogenate
+Acute Lung Injury
+hyperuricemia
+MEGAN
+binary and ternary
+PR-8
+haemagglutination test
+develop arthritis
+potential problems
+clinical FMD
+immunohistochemical analysis
+Servo-I ventilators and cuffed endotracheal tubes
+80%
+Argentina
+Hit drugs
+1
+SCII
+Rosiglitazone
+maintenance of R e below 1
+the amount of P*
+microbial clearance
+minimum selective concentration
+100%
+GPC 2
+10.3390/v11040379
+⎡
+2.4 ± 0.6 mm
+relationships
+3 and 5
+122
+37 1C
+a variety of functionalities
+allergic rhinitis
+VEGF
+compliance with targets
+Transfer RNAs
+the ratio of positive to negative absorbance value
+less than 3 fold
+degradation products of the RTP
+hemagglutinin
+GABA abnormalities
+surface plasmon resonance
+calnexin
+Proteases
+Four
+FAST CAT Assay kit
+more distant region of DFC
+phospholipid-transporting activity
+sizes and surface properties
+288 million
+Virus aliquots
+Microscopic
+CEACAM/PSG
+An array of optimal Minkowski coefficients
+inhibits hemagglutination
+the risk of a disease
+PCR
+macrophages
+means ± SD
+PKR
+fetal morbidity
+mass spectrometry
+T2D to stroke over time
+60
+0.05% saponin-TBS
+Noninvasive
+reduced short-term mortality and incidence of barotrauma
+children and psychopathy
+3AL4
+10.5694/mja2.50049
+urinary ACE2
+School of Informatics, Xiamen University
+high avidity antibodies and functional antibody responses
+100 µL of serum diluent
+transcription and translation of separate cotransfected genes
+JMN3-003
+overcoming IFITM3
+Effector cells
+Continued disease surveillance
+Pharmacology
+DNA sequences
+FluView
+qvalue � 0.01 and log 2 fold-change � 1
+the swine flu
+differences in mechanism in nuclear pore engagement and genome import
+136
+absolute data counts
+the small and large intestine
+Viroporins
+evolutionarily
+FCB2 strain gametocytes
+host response
+11,956
+p65
+more data
+South-East Asia
+Centers for Disease Control and Prevention
+trypsin
+uncertain
+attenuation
+signs of infection
+the extent of such a bias in the study is probably limited
+Nanodrop 2000c
+6 hrs
+highly pathogenic virus strains
+21
+PhusionH High-Fidelity DNA Polymerase
+4
+10%
+SET, a DNase inhibitor
+simulation models
+high-frequency oscillating needles
+Nasotracheal
+42.2%
+Accurate diagnosis of acute febrile illness
+Kraemer and colleagues
+mean signal intensities
+MIP algorithms
+a spectrum of phenotypically similar diseases
+above data
+genome assembly
+Lipofectamine 2000
+Influenza pseudotypes
+mechanisms of viral suppression
+public health monitoring
+PA-Cter
+Th17 cells
+siRNA
+three
+median and range or mean and standard deviation
+5 days
+MCD
+cleaved lamin C
+1/δ
+three
+Supplementary Data
+Voltage-gated
+High Pure Viral Nucleic Acid Kit
+Twenty four hours
+28%
+B2M
+CG processing of proHNP1
+hypervariable region
+RNeasy minikit
+77%
+intravital
+Caspase-3
+10 days
+Ebola
+Screening of immunogenic peptides
+Neutrophils
+1:1,600
+chromosomal position effects and epigenetic modi fi cations
+twice
+Consolidation
+four viral structural proteins
+stimulated systemic immunity and mucosal immunity
+the difference in fitness from WT
+by limiting dilution
+CD71 availability on reRBCs
+N MicrobeWiki
+upregulated
+Hedgehog signaling pathway
+Pentraxin 3
+prokaryotic adaptive immunity
+control of animal populations
+Jones-Taylor-Thornton substitution model
+antigen-specific B cell
+Frameshifting rates
+to inform further research on influenza forecasting
+if an equally satisfactory response follows the adjuvanted seasonal influenza vaccine
+Reassortment
+ESLD
+false positives
+peste des petits ruminants virus
+microscopically
+statistically significant differences between groups
+Rapamycin
+Polymerase chain reaction technology
+11
+predictive probabilities for exceedence of reporting thresholds
+IL-2 + CD40L + CD4 + T cells
+replicative senescence
+independent factors of MDRI
+disease risk
+fomite route
+RT-LAMP and rRT-PCR
+ferret
+300 km
+higher-order epistasis
+Influenza vaccination
+antibody repertoires from separate human tissues
+2009
+1%
+Seventeen
+pulmonary fibrosis
+enhancement of T cell responses against foreign or tumor antigens
+60%
+enteric fever
+solid tumors
+Temporal
+the structures of underlying diffusion networks
+four
+6C-Mut
+seasonal influenza infection cases
+three
+three
+Rhesus monkeys
+Serine/ Arginine-rich proteins
+operating characteristic curve analysis
+mitochondria
+Attribute weighting
+primed template
+immunosuppressive viruses
+Type and number of internal monosaccharides and their linkages
+serum SP-D
+Penicillium marneffei
+A manuscript with more than 2 authors
+10 days
+genome replication
+guinea pig Fcγ receptors
+compliance with PPE use and doffing protocols
+Control variables
+New Zealand White Rabbit
+10%
+3′-UTRs
+11
+tafenoquine
+viral clearance
+poor adaptive immune responses
+48 h
+aminoacyl-tRNA binding
+monoclonal
+large areas of necrosis and more mitosis
+dynamical models in the differential networks
+an extended shape
+CummeRBund
+serious risk of bias
+Po 0.05
+four
+China
+Anti-mouse F4/80 antibody
+secretory pathway protein-based inhibitors
+50%
+synonymous codon
+6
+30 minutes
+Interferon-induced transmembrane protein 3
+mRNAbased
+13
+Five
+any difference between the movement or cases on weekdays and on weekends
+hydrolysis of ubiquitin substrates
+Mock-inoculated tissues
+membrane
+Suppressor tRNAs
+VZV
+Red-billed teal
+4.4%
+60 mm petri plate
+0.611
+important
+Madang
+Inaccuracies in past predictions
+non-specific biding of the NDs
+N-terminal residues
+isotropic internal strain
+n
+2 weeks
+six
+Analysis of all three inflammatory parameters
+bronchitis
+Diarrhoea
+genes associated with complex disease susceptibility
+simplified acute physiology score
+exposure to pathogens
+manual analysis of the top 100 cited articles
+Bayesian
+29%
+thrombus formation
+resistance to pulling
+FCGR2B 232T/T
+Collection of exhaled breath condensates
+did not require oversight by an ethics committee
+SLE Responder Index of ≥4
+molecular pathways implicated in suicidal behavior
+nasal specimen swab
+237
+HIV-specific
+aggrecan
+Japanese university students aged 17-21 years with and without hypertensive parents
+30
+HPRT
+5.5
+R
+senescent neuronal cells
+on the Internet
+NAs
+72 hr
+PM 2.5
+Transient hypotension and transient hypoxia
+dsRNA RF
+systolic blood pressure
+1:100
+anti-FLAG mAb
+sequence mutation
+hTERT
+Five
+4 weeks
+Intralesional
+case incidence data and the distribution of the serial interval
+maximal interior thoracic breadth
+collection of exhaled breath
+0.02
+requirement for DDX19
+simulation
+HLA-B17, B18, B35 and DR-2
+CEACAM1
+physicians
+8
+physiology, gene expression, metabolism, and antiviral defenses
+volunteer
+IL8RNAi-HD-Ad
+10
+Public health and food control laboratories
+Molecular docking
+6.8%
+Anti-CD16/32 clone 2.4G2
+U-U and A-G
+543
+20
+equilibrium
+two
+72 hours
+Scars
+IFITM3 and SERINC5
+E2F-dependent apoptosis
+simple
+B. mori ribosomal protein s3 gene
+interactions between viruses and hosts
+patterns of episodic, divergent selection on surface exposed amino acids
+800 mg of respective PHAs
+Agent Based Models
+background noise
+wane
+transmission rates
+Glucagon
+Atg5conditional-knockout mice
+protein A-sepharose Fast Flow beads
+sepsis
+Tetrandrine
+16
+CTV
+A pdm09
+practical
+cellular architecture
+nosocomial
+deposition
+marked tumor
+IL6, TNF, TLR4 and ADIPOQ
+generate novel viral subtypes or strains
+hexokinase
+physician fatigue
+Camel
+vesicle fusion
+viruses
+host pattern recognition receptors
+neutralizing activity
+dengue virus
+antibody titers
+synergistic protective effect
+well founded
+hWJSCs
+15
+Metastatic disease
+eliciting elevated levels of serum neutralizing Abs and mucosal IgA
+CLIMEX, DYMEX, MIASMA models
+virulence
+constant factor β
+T cells
+Acute lung injury
+TRIzol LS reagent
+a plant factor
+acute myocardial infarction, stroke and inflammatory diseases
+linear mixed-effects model
+host factors
+TPIC
+Comparative molecular field analysis and comparative molecular similarity indices analysis
+binding positions
+20 g/m 2
+Statistically significant pairs
+C
+human polyclonal antibodies
+advances
+codon usage variation
+buffer or the indicated peptides
+Three main streams
+Department of Anaesthesiology and Critical Care Medicine
+mutate
+hydroxy fatty acids
+PPARγ transcriptional activity
+2D molecular fingerprints
+2011
+more than a decade
+rVSV/EBOV GP
+bias
+circular
+chicken beta actin promoter
+Rat primary hepatocytes
+Five
+continuous variables
+P owassan virus
+Glycopeptides
+Medicine and Public Health
+0.8 ml
+random phage libraries
+EV71
+5-day
+respiratory distress
+single doses
+lipid transporter activity
+1,932
+Leishmania elongation factor-2
+age and residential area code
+hematopoietic cells
+activating the IP
+water extraction and ethanol precipitation
+pValac
+Lenti-X concentrator
+dexmedetomidine
+17%
+Thef low-through
+DLD and ED
+Siglec1
+pseudotyping
+MV vectors
+Aneuploidy
+Meta-analysis and machine learning
+A 0
+viral host breadth
+contamination with infectious agents
+Tissue Plasminogen Activator signal sequence
+Bordeaux luteovirus
+written informed consent
+EdgeR algorithm
+US National Institute of Allergy
+GP targeted to the cell surface
+immunogenic antigens
+increases replication rates and infectivity of the virus
+subcutaneously
+63
+Optimism
+elevated production
+pDCs
+Chile
+8%
+Longdistance
+human monocyte-derived
+JavaScript
+induces vesicles that colocalize with ATG5 and LC3
+24
+0
+Cholinergic hypothesis
+Tunisia and Sudan
+12.8 ± 0.7
+Lysophosphatidic acid
+Two
+Dr. Robert Putnak
+HIV
+WP1130
+confocal staining
+two
+IAV
+High priority zoonotic pathogen subsets
+Eight
+mScarlet-i
+codon immediately 59 of the native reinitiation site
+Stem cells
+Microglia
+16S ribosomal RNA gene sequencing
+chimeric humanized mouse livers or primary human hepatocytes
+40%
+EBOV GP1
+50
+0.25%
+the 5 1 end of the genome
+MAbs
+26
+The knowledge of the role of a given biomolecule
+number of infected, recovered, deceased, and quarantined cases
+a simple 3-state HMM indel model
+rats, guinea pigs, and hamsters
+88.2%
+core epitope
+26%
+31 °C
+14%
+small libraries of viruses with single nucleotide substitutions
+Fluorescence in the FAM channel
+Evolution Surveillance and Tracking Algorithm for Resequencing arrays
+alveolar
+SDHA, GAPDH, and HRPT1
+Two-way ANOVA test
+RS and SCV
+Transwell membrane
+Unnecessary panic and disruption to society
+AND
+by passing the eluate pool over cation exchange resin
+non-homologous recombination events
+FACS caliber
+48-286 MB
+HKL-2000 38
+A site
+Virus titers
+TFRC and PGK1
+phosphorylation
+1976
+joint and/or comparative analyses with the DO and the founder strains
+Five
+Long-term use of corticosteroids and immunosuppressive agents
+114/60 mmHg
+A code number
+50%
+A. fumigatus
+Data processing pipelines
+slightly
+reciprocal
+Chronic inflammatory disease
+Analyses of different clones for each sample
+outside the STING dimerization surface
+EM ultrastructural
+XTT and CellTiter Glo staining
+MLV entry
+70%
+Fully quantifiable parasitaemias
+MetaDB
+sensitivity
+20 petabytes
+IRF8
+Autophagy
+C6/36 cells
+chemoenzymatic
+surgical site complications
+diminished pulse pressures, tachycardia, and hypotension
+Table 1
+100 nt
+significant
+Six
+eggs
+CPPs
+melting temperatures of approximately 60 • C
+FADS
+Attachment to sialic acid residues on target cell membranes
+34
+nucleoprotein
+decreases
+three
+HIV
+T88G
+enzymes as well as substrates availability
+StataMP 11.0
+Protein A Sepharose
+8,263
+three
+Th1/Th17-mediated autoimmune diseases
+Commercial aggrecan
+90%
+response costs
+amyloid-like
+Masquelet technique
+Transition and transversion
+tryptophan
+great modification and optimization
+445,000
+Variants that demonstrated enhanced stereoselective hydrolysis of compound 1
+Saudi Arabia
+58 years
+59-untranslated region
+release of all of these EV-associated proteins
+disease prioritisation
+Sec31 and Sar1 and Sec23
+Miro1 ablation
+7.4 hours
+DVGs
+lipidated
+pandemics and preparedness
+two
+Reverse transcriptase-PCR
+0.0330°/15.0479sec
+mouse IgG1 antibody and vehicle
+mammalian regulatory networks are incomplete for most biological processes
+1 hour
+Normalized Shannon Entropy
+murine
+AMCase
+West Nile virus
+Lung cancer
+2.31 IU
+mild HFMD activity
+disease severity
+1232
+polymerase slippage
+human myelin proteins
+Overflowed
+Eight
+QIAquick PCR purification kit
+titles
+they will be reported in the published results
+RACE-PCR method
+50-60% of VO2max
+localizing to either endosomal or lysosomal compartments
+fluorescence intensity
+Accumulation of ileal bile acids
+lymphoid follicles
+synergistic protective effect
+necropsy
+human dynamics
+Kir2.1 function
+Trial endpoints
+primers specific for the human beta-globin gene
+a frame shift within the first exon of IFNL4 gene
+2006
+48 hours
+increased adiposity, oxidative stress and dyslipidemia
+Western blotting
+three
+selection of pair-aware candidate paths
+confocal
+Twenty-four
+pair-housed
+CVA21
+E protein, premembrane protein and non-structural protein 1
+growth restriction
+excluding nonventilated patients
+Wambizzi
+phantom model
+42%
+2 h
+when antigens invade mucosa
+Hepcidin
+Langerhans cells and dermal dendritic cells
+15 kb
+crucial
+association and its N terminus
+hypersecretion of proinflammatory cytokines
+improve outbreak detection
+CAP-1
+four
+logistic regression
+Overall survival
+the level of gene expression
+rate of making and breaking links
+increase the frameshift efficiency
+congenital
+Hybridization
+masks
+transmission electron microscopy
+GFP- cells
+#359 and #1190
+underlying structures of networks
+PDBid = 2VIR
+HEK transected cells
+gastric and liver cancers
+RNA capping
+57 years
+SiglecH
+activities that are purely expressive in nature
+63%
+Kidney failure
+10-fold
+additional risk minimisation measures
+cell death
+Eighteen
+16,111
+clinical symptoms
+Bgp1
+inhibition of translation initiation, cell proliferation, and migration
+highly virulent
+HOX antisense intergenic RNA myeloid 1
+outcome and responses to mechanical ventilation
+an open conformation
+Elsevier B.V.
+intact ICOS
+BPV and CPV
+dyspnea
+cc-by
+heme binding, oxygen affinity, and protein stability
+Individuals with ARDS on presentation
+Mexico City and Washington, DC
+polyacrylamide gels
+72.2%
+lower
+BLAST
+respiratory inhalation
+Sharing of data
+non-infectious particles
+T j
+$1.4 billion
+KDEL
+correlation
+vaccine preparation
+k
+H5pp
+TAC1
+15-20%
+D_null
+Cox proportional hazards regression model
+Niclosamide
+Viral growth
+each location in each area
+Total RNA
+Golgi apparatus
+CREB
+peripheral blood
+phylogenetic
+nondiscrimination
+amino sugars
+viral mRNAs
+19.5%
+a puromycin resistance cassette
+less than $10
+protein aggregation
+autophagy activation
+trends observed in germinability
+12-30%
+T cells
+class probabilities
+SeqScape ® Software v2.5
+Nitric oxide
+all HA subtypes
+MAFFT v.7.221
+100%
+exogenous NK cells
+Fourier
+10 days
+75%
+RT-LAMP PCR
+LAMP reactions
+timelines needed to produce viral vaccines
+2 −△△Ct method
+influenza subunit vaccine
+Anti-S antibodies
+Tfh cells
+SL3-2-1m RNA
+criteria for institutional preparedness and contingency plans
+changed to alanines
+extent and location of the surgical incision
+98%
+public health units
+10
+four passages
+TLR9
+STAT2
+type I or I & II IFN
+10%
+>70%
+3406 grams
+well-informed
+TCID 50
+clinical disease
+renalase
+overt signs of distress
+MG132 and bortezomib
+the likelihood of malevolent use
+Small world networks
+ligand defined binding sites
+3034
+chemical exposures and environmental health
+p27
+enhanced CD8 T cell expansion
+fluorescent or luciferase
+10 minutes
+10-15 cm
+Foot-and-mouth disease virus
+two decades
+1.5 mTorr
+15
+Acute bronchiolitis
+plasma renin activity
+RESCUE-ESE and ESE finder
+ultracentrifugal
+C V and C H
+646 fitted sets of parameters
+54
+social distancing
+maximum likelihood methods
+40%
+Public playground
+Cas9 mRNA
+rules
+15 min
+15
+Log-rank test
+6
+The Coalescent Bayesian skyline plot
+trends in influenza
+11, 158
+27
+immunoblot
+false discovery rate
+DNA intercalating SYBR Green I dye
+freshly voided eggs
+VAP
+DEP
+15
+topical drops of atropine and tropicamide
+aminoglycosides
+rZHDNSs-GFP
+Kaplan-Meier log-rank test
+TLS Motion Determination server
+International Committee of Medical Journal Editors
+twice daily
+10 min
+better viral progeny production and release
+interfering with ribosome assembly
+protein expression
+original antigenic sin
+diverse cytokines and growth factors
+SpectraMax M2 plate reader
+age groups
+60
+97.55%
+Vaccination of household contacts
+21 days
+The total number of hospitalization days
+NF-κB
+HTx
+millimetres
+ligandreceptor binding
+the local state is specifically associated with the topologies of the phylogenies tested
+87%
+German-and English-speaking samples
+insect cells
+boxplots
+identifying new strategies that result in complete control of virus
+Axiovert 200M
+Grouping organisms by epidemiological functions
+circular TFO RNA
+Bangladesh
+.75%
+eight
+ancient retroviral germline infections
+Fig. 11b
+Estimation of model parameters
+five
+AC, LP and GR
+N-glycosylation motif NYS
+Ten percent
+sLAMC2 level
+public dialogue
+confirmatory diagnosis
+60uC
+40 μM importazole or 25 μM ivermectin
+NNAlign server
+HOXA10
+nonbinding species
+a serious illness
+pharyngeal viral RNA load
+bone development
+TLR-signaling
+14 days
+reduced viral control
+hipothesis
+protective
+novel genes
+overlapping functional elements
+Caribvet
+globalization and environment
+renalase monoclonal antibodies
+MAVS
+another viral resistant strain
+18
+antibody-dependent
+cytokine storms
+1.1%
+in vitro culture systems impose bottlenecks on RNA viruses
+deep changes in the patterns of host's gene expression
+ODEs
+none
+92%
+CNS-enriched
+48
+Global budgeting
+MEGA 7
+random regression weights
+Baidu maps
+PBL Interferon Source
+436
+NC mimics and inhibitors
+ribosomal frameshifting
+their genotype
+diarrhea index
+key internal structural proteins
+Standard admission criteria
+crystal violet
+small
+log 10 of the highest serum dilution
+chemiluminescence detection kit
+6-day
+significantly potentiated
+pRH3 0 /IRE and pYESTrp1/IRP
+intracisternal R-type particles
+IFN-γ
+provides the mechanism for recognition and response
+mean ± SD
+12.6%
+data set
+1.7-2.2
+cluster 4
+viral infection or malnutrition
+399
+Dengue disease
+inflammation
+16.5%
+mean excess degree
+viral attachment and endocytosis
+yeast alcohol dehydrogenase
+4 days
+pathogens
+C57BL/6 mice
+one hour
+2009
+gene duplication
+flaviviruses
+10 minutes
+grass silage
+dried blood spots
+5 to 32 years
+Silica gel
+4%
+78
+40 km/h
+early reverse transcription products
+M2-prone
+mass cytometry with dimensionality reduction algorithms
+markedly
+dengue virus nonstructural proteins
+twice daily
+more optimized HIV treatment protocols
+Long-range electrostatics
+7.7%
+CXCL4
+335.7±168.0 µm
+Pierce BCA Protein Assay Kit
+BCL11A transcription
+ZO-1
+CHIKV disease
+approximately linear
+IL-10
+25,963
+Rayleigh light scattering method
+stimulates the phosphorylation
+intensive care
+10
+DNA shuffling
+degradative removal of certain cytoplasmic components of the cell
+how dispersed the distribution of the alphabet elements is
+statistical testing
+Fugong virus
+Diphenhydramine and epinephrine
+African Green Monkeys
+colonization from infection
+medical treatment
+EGR1
+40-70%
+11-14 days
+100 µL per well of the TMB-Complete substrate
+Peptide affinity to HLA molecules
+RNA replication, RNA packaging, and intercellular spread
+protective level of the Group 1 stem-pocket directed BnAbs
+bodychecking
+Any variable found to violate the proportional hazards assumption
+25
+438
+clinical samples
+at an end of the peptide binding groove
+internalising the bacteria within epithelial cells and survival within macrophages
+according to the genus part of an organism's binomen
+CK/NJ/02 virus
+Restoration of functionally efficient adaptive responses
+degrades
+HIV/AIDS
+722
+endothelial cells were intact and proliferating
+a herbal medicine
+K
+radiotherapy
+65 to 75%
+4
+16, 884 antibody bound per cell
+2%
+a ligand-protein interaction analysis
+IRE/IRP interaction
+daily
+Gene expression profiling
+GAPDH and PP2A
+Molecular detection
+repeated antigenic boosts
+Lombardy, Italy
+231
+74
+ERK1/2
+TI cell cytokine production
+human respiratory syncytial virus and hepatitis C infection
+HHalign
+Xuorescence
+723
+gene-gene interactions
+high basal HSP expression
+mice
+pFLAG-CMV-2
+herpetic stromal keratitis
+275.7
+life-threatening
+dengue hemorrhagic fever
+A highly alkaline hand soap
+Reaction conditions
+920
+a preparedness kit
+FIV subtype B
+Rabbits, hares, and rodents
+classical and hybrid PRE states
+age
+staying at home
+noncanonical pathway
+New Zealand
+GP receptor binding sites
+population's aging
+day 38 and 56
+9.2 million
+interactions with negatively charged glycosaminoglycans
+Cefepime
+humidified
+Canis familiaris and Rhinolophus ferrumequinum
+IFAT
+N =10ϫ 10 6
+effective and safe
+5, 7, and 8
+copy-back DVGs
+external infections are relatively rare
+29
+1440 minutes
+previously published data
+Engstrom® and Hamilton G5 or Galileo®
+23 years
+IFITM
+selectivity determined by the tertiary structure of the substrate protein is lost
+oxidative stress induced senescence
+The strong recommendation
+transmission by the vector
+polymerase chain reaction
+Spatial isolation
+higher morbidity
+Reporter gene ZsGreen
+influenza
+acts as a marker for the pathway in porcine GCs
+9.1 ± 1.5 nm
+regression of the herpetic keratitis signs
+ELISA
+Table 14
+egr-1 expression
+twice
+m i I
+Oral hairy leucoplakia
+advice and entry screening
+336 nm
+TRP84
+temperature dependence
+Respiratory specimens
+predator blocking primers
+Caveolae-mediated endocytosis
+A standard curve
+respiratory samples
+ANOVA model
+One-way
+antigenic drift
+Table 3
+stromal tissue
+tolerance to low concentrations of virus
+four
+oxidative stress
+a set of rules
+promotes cell survival and cellular defenses
+February 2016
+27
+2 fold
+Visible light-responsive antibacterial photocatalysts
+5min
+fluorescent emission
+paired t-tests
+Extracted RNA
+8
+Reports about new mutations
+Flow cytometry
+iSOCKET
+Fisher exact test
+M
+the binding of a key silencer element
+hypotheses about the directions of associations
+vaccine strain
+taxa
+Prothrombin time testing
+15%
+Picornaviruses
+shelters with higher URI
+810
+trypsin
+delays
+Nanovaccinology
+colocalization with polyubiquitin
+comparable antiviral activity
+Glycomic
+78017
+multipotent stem cells
+Virus
+CSF B cells
+526
+monomeric and dimeric
+pathological inflammatory reactions
+Body mass index
+higher fraction
+5-10%
+unique estimates of variances and the influence of covariates
+Bart's Heart Centre
+200 nm
+random networks
+model-based detection algorithms
+ethidium bromide
+SAGV and GETV
+R2
+HIV-1
+John Sheehan
+ARDS patients
+microfluidic
+Contacts between infected people
+68
+1 day
+248
+cytokine storm
+Poisson correction method
+million
+transmission electron microscopy
+historical diseases
+global degradation of cellular RNA and inhibition of translation
+high viral load and severe disease
+sufficient microbiology laboratory testing
+PatchDock rigid-body server
+PCCs of both PPI pairs and GGI pairs
+double negative T-cells
+significantly increases EV release
+ethics committee of Affiliated Hospital of Guangdong Medical College
+ZFYVE9
+MrModeltest 2.2
+p38 and ERK MAPK pathways
+RNA easy kit
+>5 years of age
+liver disease
+mosquito surveillance programs
+NPC1
+1 ml of each reaction
+HA-8
+high
+down-regulation of Nup155 and IPO5
+1,482
+Table 2
+MAbs against definite epitopes
+every 2 d
+443 nM
+dogs
+Successful communication
+Three thousand and fifty-four
+False alarms
+association
+HA
+comp101225_c0_seq1
+630 nm
+three
+IRF7
+odds ratio
+59-deoxyribonucleotidase
+population average
+Nucleospin RNA XS
+1918
+worm egg production
+regulates cell morphology and motility
+apparent variability
+Semi-quantification
+The precise link between this PGF formulation and the pairwise approach
+sLAMC2
+inflammatory infiltrates
+cytokines
+SERINC3 and SERINC5
+autophagy and cathelicidin
+Chemokines
+NGR-TNF
+ORs for all AR clusters
+1525
+R package ape
+0.829
+43%
+mouse spleens
+Multiple sclerosis
+IL-1β
+destruction of vital cellular functions
+200
+influenza-related pneumonia
+70.8%
+δ-crystallin
+increased steric bulk
+30 min
+thousands
+galangin
+salty food preference
+microtubule dynamics
+Exposure to index case-patients for >12 hours
+xacerbations
+two
+binding of Coomassie blue
+more robust CD4 and CD8 responses
+297, 300, 305, 324, 375 and 426
+richness and diversity of structural and nucleotide variations
+cell context-dependent
+80-100%
+lower coverage
+Forty-four
+receptor
+salivary glands
+MHV-3 infection
+continuous ventilation
+similar to that in March
+MS2 phage
+γ1 Fc
+Median admission PCTs of 3.4 ng/ml
+The effects of these pathways on the regulation of other host defenses
+EV-G
+Multipartite viruses
+working with health workers to develop their own abilities to identify unhealthy working conditions
+Epstein-Barr virus
+3
+HRV and RSV
+SHCBP1
+3I14
+compartmental models
+FOS and KLK3/ PSA
+susceptible animals
+10 kDa dextran-AF488
+NDV
+mean + SD
+1-way
+glutathione
+interrelationships with genetic risk factors
+siRNA-mediated silencing efficacy
+IL-6 and CD40L
+acacetin is an inferior antioxidant to isoginkgetin
+3 w1
+NTAP-Tat
+generation of a recombinant strain
+50%
+an autophagy inhibitor
+dialectical and linear thinking
+100%
+gD
+PiCV
+Adenoviruses
+> 55,000
+asthma patients with naturally occurring viral infections
+low pH-dependent
+large surveillance populations
+venous blood
+significant effects
+neutrophil elastase
+Hepatic ischemia-reperfusion
+7
+Ubiquitination
+25%
+90 °C
+virus-induced cytopathicity
+Artificial gene sequences
+infections outside the intestinal tract
+temperate-zone
+Arms races
+DDX19
+forty-three
+alleviates proinflammatory cytokine production by LPS
+type I IFNs
+mixed method approaches
+acid fast bacilli
+differentiation of conventional CD4+ T cells
+2013
+dimethyl sulfoxide and glycerol
+the time for n to fill its demand
+Excel
+synergism
+Hofbauer cell hyperplasia
+SM934
+R 9
+systematic evolution of ligands by exponential enrichment
+Western blot
+KLK3/PSA
+EVs derived from L. rhamnosus GG
+75%
+NiV and HPiV3
+alkaline phosphatase-labeled mouse IgG
+antibody-based assays
+University of Manitoba
+monitoring the À1 PRF efficiency
+Alphaherpesviridae
+46 kDa
+TG levels
+PRNT 50
+early translation termination and ribosome dissociation
+Mycobacterium chelonae
+Hepatitis B
+H5N1 neuraminidase
+61
+gag, pol, and env genes
+metal shared
+three
+influenza-like illness
+whenever R 0 > 1
+PEDV
+CEACAM family genes
+on the outer edge of each monomer
+rearrangement of the IgH locus
+phylogenetic
+Flag-MAGE-G1
+Human mobility
+less than 1 month
+Seven
+peptide vaccines, recombinant protein vaccines, and virus-like particles
+hospital volume, surgeon volume, and the rate of laparoscopic surgery
+2 days
+A first tRNA
+63.3%
+less than 50 cells/mm 3
+nanotube number on macrophages increases after infection
+Mid-turbinate sampling
+antigenic distinct structures in brain tissue sections
+endodermal epithelium of the embryonic foregut
+Pooled cDNAs
+current functions
+53
+Hybridization
+protective
+34
+several
+three
+S1P recognition motifs
+16%
+development of regulatory T cells
+EDC/NHS chemistry
+cysteine protease
+epitopic amino acids
+Three microliters of template RNA or water
+Drs. Sun, Zhao, and Zhou
+56 o C to 70 o C
+escape mutants
+898
+immunosuppressive
+epitope sets
+infectious diseases
+VACV
+high confidence
+SGIV and RGNNV replication
+π j
+4061/6179
+three
+permutation test
+Drs. Linda Wyatt and Bernard Moss
+private disease-risk mitigation
+improve exogenous peptide presentation
+mucosal reaction
+Successive developmental stages
+1 million
+Pseudomonas aeruginosa
+RNA modification to m 5 C
+FlowJo
+Kolmogorov-Smirnoff test
+Protein arrays
+ECMO
+Tobacco mosaic virus replicase protein
+11
+negative controls
+Ventilator-associated pneumonia
+one of each viral segment
+genomics, proteomics and cellomics
+proteins
+7000
+cough
+Bayesian procedure
+rhesus monkeys
+45 hours
+South China Primate Research & Development Center
+it results in widespread infection
+viral RTI
+Burkina Faso
+eight
+IL-4 and IL-10
+CFSE
+BSA stock solution
+nearly certain premature death
+40%
+precedent vaccination or exposure
+precursor proteins
+meta-analysis
+CCL5 mRNA positive
+Respiratory syncytial virus
+induces apoptosis
+cross-reactive
+RNA Polymerase II
+QIAquick PCR Purification Kit
+social vulnerability
+carbohydrate-active enzymes
+Eight
+allergic sensitization
+any human proteins
+host demography
+26%
+2 years
+ducks
+Oligoribonucleotides P1 and P2
+Complete NA inhibition
+20
+within the paper
+minimal attention
+G6PD deficiency
+18
+219
+organ support, treatment of precipitating events and prevention of complications
+antifibrinolytic agents
+GTP hydrolysis
+Balapiravir
+SREBP-1
+6.34 PD 50 per dose
+siRNAs
+NS5B inhibitors RASs
+health needs overwhelm available human and material resources
+IL-17c
+alter interactions with HIV-1 capsid
+1.5 × 10
+external transmission rates
+DNA extracted from the corresponding specimens
+43 breaths per minute
+Pseudouridine
+56
+Noroviruses
+ROS
+health protection and health promotion
+novel and exploratory behavior
+AQP3
+Knowledge about complex structures
+1 h
+co-phylogenetic
+Statistical methods
+logistic regression
+the study of disease in humans
+Bonferroni correction
+viral load suppression
+phylogeny-instructed mutagenesis
+syndromic
+a small, N-terminal hydrophobic signal peptide
+35,955 Da
+Autoantibodies
+activity of conjugates
+early recognition and management of sepsis
+microbial biofilm formation
+DI-RNAs
+Rhipicephalus
+centrally operated
+1974
+V 388 G 389 P 390 E 392 and I 408 N 410
+Classical epidemic models
+Blood glucose concentration
+the number of class levels
+18 h
+free sulfhydryls
+Dame Sally Davies
+2900
+more compact
+HaMStR 13
+A rapid, specific and sensitive diagnostic test
+Baseline signal intensity values of 1
+2156
+20%
+10 min
+high
+subsequent bacterial infections
+25%
+10 million
+urban and rural
+54.6%
+hemagglutination
+E1 cleavage
+Herpesviruses
+cc-by
+basic life support courses
+vaccinia virus DNA
+cc-by
+complementary DNA encoding human RPE65
+pUC19-FR-HuFulHEV3f
+Oligonucleotide DNA sequences
+GATA3
+64 to 32
+ATPase subunit of terminase
+the input of the next hidden layer
+protection against higher APACHE II and SOFA scores
+NOS
+Cpb1
+detectable and high virus neutralization
+67
+sum of the cytokines secreted by all living cells in the culture
+Sequence complementary
+HCA, PCA and PCO
+12%
+Antibody repertoires
+tracheobronchial aspirates
+Caenorhabditis elegans
+four
+Ten
+Western blotting with an anti-Flag antibody
+Tubulin
+Bangladesh, Mexico, Oman and Algeria
+daidzein
+5 mL water
+2 h
+The true number of infected individuals
+virulence
+Hantaan virus
+stimulate TLR9
+frameshifting
+1
+betweenness centrality
+host cell-and pathogen-specific
+46
+1.9% ± 0.6%
+Succinate dehydrogenase subunit B
+subtle
+eleven
+113-580
+MegaBLAST
+likelihoods
+inflammatory monocytes
+P INF
+glucose, 10% FBS and 2 mM L-glutamine
+RNase T1
+Eighteen
+cardiovascular disease
+49%
+reverse transcription-PCR
+Chi-squared and I 2 tests
+overlapping read pairs
+binding of C. difficile Spo0A
+vaccine strain selection
+epithelial and sub-mucosal cells
+FFU per milligram of tissue
+cerebral
+DNA damage
+P60
+miR-21 inhibitor transfected cells
+a nuclear localization signal
+time after exposure when photographs were taken
+women
+three more days
+Cell Counting Kit-8 or CellTiter-Glo assay
+2-CTC
+H9
+one per cent
+limiting potential toxic side-effects
+2-chlorotrityl chloride resin
+9
+autoimmune
+any event supported by five or more methods with p-values #10 25
+25
+manual worker
+RV-C and RV-A
+France
+Almost two-third
+C160A
+influenza virus-inducible reporter genes
+detecting mixed infections of STIs
+their prevalence and distribution in the environment
+10%
+high levels of oxygen
+Inflammation
+100%
+infected mice
+segmented
+L
+psychological recovery
+Real time visualisation of chest expansion
+160 µM
+diffractometer setup
+arthralgias and myalgias
+13.9%
+3 weeks
+convergence
+coronary atheroma plaque vulnerability or acute coronary syndrome
+influenza
+SPSS 17.0
+monthly
+a complete diagnostic agreement
+Inebilizumab
+metabolite fingerprinting
+association
+Queensland Institute for Medical Research
+decitabine
+acetic acid
+75.7%
+staining intensity of foci
+Neuro2a cells
+poor homology between forward and reverse primer sequences
+lack of an adequate number of sufficiently homogenous studies
+China
+positive and negative selection
+environmental
+Lungs
+metatherian
+inability to identify the individual impact of each of the predictive factors
+CRC
+Ac-Phe-tRNA
+three weeks
+fourteen
+oxidative
+increased and prolonged expression of the viral interferon antagonist
+15 March 2020
+standard deviations tight and complex regulation of GalE expression in E. coli W
+CsrA
+oral acyclovir
+phagocytic activity
+anti-mouse IgA
+standard checkerboard titration procedures
+21% to 83%
+R-AFP fractions from gel filtration chromatography
+cell-secreted enzymes
+water, sanitation, and hygiene infrastructure
+Mobile phone-based surveillance systems
+Angiotensinconverting enzyme 2
+6
+mathematical model
+China
+Saudi Arabia
+Two
+9 days
+respiratory muscle failure or upper airway obstruction
+13%
+heterologous
+COX-2
+ward, MRSA type and study phase
+Julian Flowers
+UTRs
+Shelter staff
+34
+Branch-Site Random Effects Likelihood analysis
+NFκB
+four
+gastrointestinal symptoms
+spatial aggregation levels
+TA proteins
+the project's scope
+74%
+IFN-α
+six days
+phylogenetic
+JEV, WNV, or DENV-2 replicon
+genotype affiliations
+complex
+A discrete Gamma distribution
+45 min
+C-type lectin family
+The proportion of invariable sites and the number of bootstrap runs
+SPBN-Ig-Gag
+AP activity
+modulate the production of various cytokines and chemokines
+greater than 30
+30-50%
+deliberate strategies
+rs368234815
+pulse pressure
+axonal and synaptic defects
+Real-time cell growth curves
+pDCs
+hki
+replication of other APMVs
+CD8 + T cells
+RG-1 monoclonal antibody
+Unigene annotation
+Safety
+autonomy status
+another host population
+81%
+Schering-Plough
+Intermittent migration
+HA activity and plaque phenotype
+1 additional expected imported-and-reported case
+necrosis of hippocampal progenitor cells
+anti-arrhythmic
+Simulations
+59
+20 min
+trypsin
+Binding assays
+large-scale screens of common genetic variation and disease-causing mutations
+MHC-family
+primer redundancy
+3 x 10 5
+the corresponding author
+low concentrations
+J774A.1
+ImageJ 63
+the liver and other tissues
+food production, quality and food safety
+58
+tropical
+ISGs
+insects and arachnids
+IFN-λ
+methanolic RC stock
+R&D Systems
+trypsin
+virus infection
+79
+large-scale multiple simulations
+photomicrographs at higher magnification
+rugged and barren
+autonomy is classified into 6 Iso-Resource Groups
+Comparison of conserved DNA or protein sequences
+functional residues
+grouper and barramundi
+300 μ L
+macrophages
+Feed intake
+non-model-based algorithms
+naive
+sepsis
+dialectical
+axonal integrity
+A nasopharyngeal aspirate
+TADs
+cynomolgus macaques
+Y271A and I274A
+Loop Mediated Isothermal Amplification
+WS and HGPS
+rotavirus
+2009 H1N1 virus presence
+an IPTG inducible promoter
+reduction of surfactant production
+A proline in position +1
+Taoyuan, Taiwan
+three
+Naive T cells
+tumor suppressor
+Early mobilization
+1 H NMR
+HRV-A
+5 hours
+~90%
+Granzyme A
+1%
+pH 4.5
+IMHA
+neuroprotective properties
+Am ixture of H 2 and HD
+all-cause and cardiorespiratory mortality
+cytokines transcription
+Dromedary camels
+1AE49-2AE55
+Escherichia coli DH5a
+less than one
+three
+heterogeneity in study populations and study design
+$536,000
+1.49m
+3
+Vitribot Mark IV
+hemocytometer count
+TMA
+28
+96 mg/dl
+over 800
+ISDS Sustainable Surveillance Workgroup
+the adapter sequence to trim
+LBs
+genetically modified models and biological reagents
+Huh-7 hepatoma cells
+cecal ligation double puncture
+IL-6 signaling
+methanol
+frameshifting
+initiation or maintenance of the persistent infections
+viral gene expression
+microplate scintillation counter
+obesity
+polyhedrin
+CXC
+humoral immune response
+5-year
+6-8 weeks
+PPR infected hosts
+Limited datasets
+TAAR1 mRNA and functional protein expression
+identification and annotation of functional residues
+628 bp
+T cells
+B-cell and T-cell
+gas exchange
+increases in travel between the city and outside
+A single promoter
+decision making in health practices
+viral capsid protein
+subtropical area
+cell aspect ratio
+differentiation, proliferation, activation, and function of different effector cells
+K~12
+CPT-cGMP
+placement of Oscheius tipulae
+4
+0.0006 s
+DC-SIGN
+postoperative narcotic
+4,629
+Monte Carlo sampling
+15%
+19 kb
+survival
+The coiled coil
+2% BSA
+$1,525
+goat, pig, skunk, red fox, and gray fox
+observed values
+Phenol/chloroform extraction
+contact, mobility and transmission features
+17 hours
+10%
+virus induced inflammation
+Enterococcus hirae
+819
+Deficiency of NLRP3 or caspase-1
+two weeks
+total cholesterol
+controlling bath endemic and epidemic FMD
+ChemmineR
+Informed consent
+Droughts or extended dry periods
+structural
+NGS panels
+12 ± 1%
+37
+no reactivity
+ERM proteins
+incidences of ESKD, clinical remission, and death
+21 days
+cellular, biochemical, and molecular
+RID epidemic health protective behaviours
+pandemic response
+codon optimality and mRNA structure
+MIC and MBC values of the phenolic extracts
+79 years
+a protein of unknown function
+Small sensors
+classification purposes
+Linear regression
+Hosmer-Lemeshow statistics
+RAN
+those observed in other countries in the same year
+Pulmonary viral infection
+Strong assortative mixing patterns by age
+four
+1002
+The HA or Myc epitope tag
+293T cells
+OmniscriptH reverse transcription system
+Spleen, kidney, and liver of flounder fish
+B 2 -microglobulin
+complete hydrolysis of proteins
+higher risks and lower benefits
+drug development, disease diagnosis, and targeted therapy
+central nervous system
+SF206
+Twenty-five
+greater stability
+7
+Principal Component Analysis
+UV radiation
+Examination of patterns of host-pathogen adaptation across space
+endoplasmic reticulum
+16
+19
+cubic spline interpolation
+H7N9
+effective candidates
+AM
+K-Pax2
+VN3040
+IfitmDel
+Influenza
+parvovirus
+DSPB
+Newcastle disease virus
+Ubiquitination
+4 months
+Pulsoximetry
+Three
+849
+Mouse anti-human IgG1
+two hydrophobic pockets
+Tyramide signal amplification kit
+DMRIE-C reagent
+5.6 h
+finishing the analysis and writing of this article
+Rickettsia
+five
+IFNγ +
+DNA microarrays
+Fluorescence intensities
+68.6%
+the unfolded protein response
+42.30%
+Additional studies
+proviral DNA
+antimicrobial agents
+T3SS-secreted invasin IpaB
+Plasmodium falciparum
+viral mutation
+disease ecology
+mammalian expression cassette
+Cytokines and successive chemokines
+Codes of professional conduct
+MetaGenomic Species
+16
+viral homologues of human cytokines
+out-patient and in-patient settings
+Known or suspected adverse effects
+tracking HFMD trends
+Tissues
+NagA deacetylase
+Antimicrobial peptides
+252
+3,000
+reactivation of HIV-1
+functional macrophage polarization
+communication networks
+10% H 2 SO 4 solution
+hours
+synergistic
+chikungungya fever
+SDS-PAGE gels
+higher transmission rates
+administration of cAMP-elevating agents
+Caspase-11
+Forty-three
+17
+serological test of anti-BV antibodies
+GenomeScan and FGENESH
+60 min
+41.3%
+brivudine
+~5%
+Normal chicken Ig antibody
+both clinical and preclinical researchers
+8.3%
+Rab5a
+cytopathic effects
+autoimmune type and nonautoimmune type
+1:5
+HmC
+R *
+number of required clones
+rupintrivir
+reduced/oxidized glutathione
+All estimates of costs, outcomes, and cost-effectiveness
+phosphoprotein interaction networks
+standardization of modeling practice
+recombinant full-length IFNλ4p179 protein
+three
+chronic inflammation
+ratios
+dinucleotides
+normal
+0.05
+the distance from the tip to the bottom of the plate
+862
+midazolam
+eight
+Vaccine
+Vibrio cholerae
+high-flow nasal cannula
+Southern and Eastern Africa
+8
+a complete history recorded
+decrease to normal levels
+4070A
+missing amino acid
+1918 and 1919
+differential
+their most recent "ordinary" week
+Kernel densities
+seasonal changes
+innate immune activation
+30
+40
+random
+97
+colloidal blue staining
+EGFR tyrosine kinase activity
+research, authorship, and/or publication
+35.3%
+Significant sequence similarity
+cross-reactivity
+4°C
+GM-CSF
+mid-1980s
+Mean synplot2 p-value
+GNB4
+1%
+45
+Septic shock patients
+TRAF2 and TRAF6
+seven
+JY
+SY568
+disease
+language difficulties
+7 to 14 days
+Contact rates with contaminated environmental reservoirs and shedding rates
+Plasmid pHH-Gluc
+the patient's general condition
+wider spacing of ventilation supply/extract grilles
+Human norovirus infection
+bovine rotavirus
+viral load
+7
+13.6%
+experimental testing
+Pooled fractions from SGR cell lysate
+None
+ligated DNA
+endocytic pathway
+mild inflammation
+180 people/km 2
+6 ± 0.4%
+5 days
+96 h
+Percutaneous radiofrequency thermal ablation
+the system of equations
+Cs 2 CO 3 and 2-iodoethanol
+American Tissue Culture Collection
+liver injury
+S. lividans
+1952
+45 min
+50 μl of SLA-II marker
+875
+ethidium bromide stain
+16%
+fine filamentous skeleton
+S
+ARIMA model
+Over 25%
+119
+M2e
+Mouse IgG
+tested per cell culture flask
+664 million
+HCC cell proliferation
+The resource of ECMO
+computational methods
+20 µl RNA
+lung inflammation and collagen deposition
+5 to 30%
+Adherence
+residues 162-172
+P i
+52
+human respiratory viruses
+neutralize live virus
+the following points
+Saxifraga stolonifera
+IRF-3
+microglia and macrophages
+PowerPoint
+1953
+The ability to adapt to multiple species
+JTT+Ŵ
+travel insurance
+cell migration
+c continuous size distribution model
+Apoptosis
+80%
+infl uenza
+electrostatic interactions between the protein and the ligands
+level of variation in the average values of reference gene stability
+five
+agarosesupporting matrix
+0.44
+Negative or positive pressure state
+disease-modifying
+DNA replication
+3%
+positive correlation
+HSP90
+artificial RNA
+60-62%
+more of a role
+anti-inflammatory
+highly positively-charged
+co-immunoprecipitation method
+A more blood brain barrier permeable ARB
+mutation
+five
+every 10 minutes
+enzymatic
+six
+161
+IFN-α, TNF-α and IL-6
+tTNF-NGR
+five
+non-PAM-type
+CðtÞ
+QIAamp DNA kit
+Paramyxoviruses
+endosomal release
+enterobactin synthetase
+Scrambled shRNA
+four
+exon 2 exclusion
+wildlife host species richness
+Megrivirus
+0.15 casual infections per day
+isoflurane
+APC and GSK3β
+Over one hundred
+13
+deteriorating environmental foundations
+11.0 days
+Bradford's method
+VR1112
+51%
+diffusion
+20 pfu
+Tibet and Xinjiang
+1 week
+spoIIAA, spoIIE, and spoIIGA
+predictive performance
+Renilla luciferase activity
+Primer3
+anorexia
+complex relationships among variables involved in a disease process
+HFMD
+Junín virus
+10d treated cells
+61
+Rnf13
+10-30%
+heteromolecular system
+western blot analysis
+inflammatory mediators
+one
+areas which have been relatively neglected by local health information systems
+removal of the hydroxyl residue
+Three
+Airway T RM cells
+viroplasms
+Infusion hypersensitivity
+Ang II
+adamantanes and NA inhibitors
+Intra-host molecular evolution
+Abcam, Hongkong
+By choosing the taxonomy label and typing the appropriate keywords
+move away from the narrow biomedical model
+network analysis
+respiratory infections
+F = 1 − exp
+5′ UTR
+more than thousand
+PNPP substrate
+3 min
+table 1
+Accumulation of ATZ within the ER
+reduced NK cell number
+recombinant tissue factor pathway inhibitor
+host body temperature, immune pressure, codon and nucleotide usage patterns
+GC apoptosis
+infectious virus production
+consolidations
+293T cells
+International Prospective Register of Systematic Reviews
+good
+Geolocation approaches
+trypsin fragments
+RNeasy ® Mini Kit
+Plasmid pUC-Ad5-hex
+Brazil
+antigen binding
+Five
+Akonni
+equine antitoxin
+Atg6
+Renal cell carcinoma
+3.6
+August and September 2004
+accurate serological characterisation of CSFV isolates
+BZ-X710
+neuronal cells
+pulmonary cancer pathophysiology
+inflammatory
+positive
+virus collected from separate infected cell cultures
+rainfall
+neuraminidase inhibitors
+molecular pharming
+46%
+Early-life exposure to severe RSV infection
+low-cost system construction
+2017
+physiological functioning
+evolutionary information and structural features of the predicted proteins
+The -10bp mutation
+7000 pg/ml
+Lonza
+sialic acid receptors
+FACS analysis
+taxa
+constitutive ACE2 shedding
+Specific pathogen free
+Authors
+PBS
+SuperSignal West Pico Kit
+19
+6 months
+48 h
+mixed linear regression models
+VP4/VP2
+Beckman
+PTBP1
+Non-conservative substitutions
+C. albicans
+proteolytic cleavage of eIF4G
+25-60
+fetuin bt
+cough, respiratory distress, asthma-like symptoms, and chest tightness
+undiagnosed
+DI-244
+ROS
+$23.25
+Supportive care and antiviral agents
+influenza illness
+145
+60 million
+chlamydia
+cyanoacrylate adhesive
+10%
+JFH1
+one third
+Kaplan-Meier estimates
+SAS 9.3
+human infection
+flexibility
+13000×g
+55
+antigen-antigen comparisons
+MTB diagnostic NAATs
+veno-venous extracorporeal membrane oxygenation
+alveolar macrophages and dendritic cells
+Siberia
+a survival benefit
+chimeras
+CpG content
+β ≥ 0
+51
+Cohort studies
+protracted symptoms
+to ensure they elicit balanced immune responses
+A. aegypti actin
+Tetherin
+9.6%
+assembly of replication factories
+perfusion
+increased DC-targeting properties and subsequent activation of T cells
+bacterial presence and host responses
+pigs
+A standard ELISA
+41
+1%
+EcoRI and HindIII
+0.59%
+diseases and antimicrobial resistance genes
+serum
+laryngeal carcinoma
+NucleoSpin RNA kit
+PRRSV epitopes
+The quarantine of people suspected of being exposed to an infectious agent
+283
+cytokine secretion
+M.pneumoniae
+1 day
+formation of long tubules
+exposure to poultry and gender
+prognostic markers
+mathematical models and statistical methods
+DMSO solution
+how many recombinants of the same type were isolated
+1,049
+ARDS
+genetic distances
+9
+loose packing between proximal helices
+10000
+Ceacam1 2/2 T cells
+Sequence conservation
+avascular necrosis of the femoral head
+64
+Palmitoylation
+Dr Natalia Frias-Staheli
+viral transitions
+alveolar macrophage activity
+physical decontamination methods are better than chemical methods
+Source data
+decreased damage to the liver
+death certificates
+global governance
+West Africa
+enhances transcytosis
+45
+contaminating peptidases
+an order of magnitude faster
+enhanced virulence
+GIPSy
+immunoproteasome
+unusual stability
+BME-SIR
+12.6 Gr%
+viral non-structural proteins
+SV02
+spillover transmission
+AlkB-specific substrate binding
+Optimum-Gene ™ algorithm
+placebo control
+Respiratory Syncytial Virus
+single nucleotide polymorphism analysis
+HABP 36727
+13
+Inverse orientation
+TYLCMaV
+three
+bioactive messengers
+CD8 + T-cells
+Twenty-one
+economics and finance
+The human decision-making process
+Thorax
+continuous transmission of virus among animals
+Four
+1966
+NUP57, RNA15, SPC29 and YGR251w
+Thymidine kinase and gE
+CHBAH
+components of the type IVB secretion system
+41.6%
+nine-day window
+$37.0 billion
+B cell antibody production
+TRIzol Plus RNA Purification Kit
+ventilator setting
+dependent lung regions may be recruiting with adequate PEEP
+sections incubated without primary antibodies
+increasing membrane fluidity
+two hours
+142
+residue 134
+EH
+Total RNA
+Luciferase
+RACE analysis
+5 ng/mL
+system-wide unbiased molecular measurements
+15,000
+humoral
+flow cytometry
+1 day
+Ser222
+SZ and XW
+ImageJ
+N * V
+acute
+picornavirus
+Autoregressive integrated moving average modelling
+0.067
+inhaled material
+pAD-GFP
+intracellular Ca 2+ and ROS balance
+Ethanol
+cells viability
+IgG
+2%
+weekly
+2 Hz
+counselling
+30-day mortality
+edges
+IBa
+RNA recombination
+sub-epithelial SMCs
+age
+λ 1 = Λ1 µ1m * = 4.0
+44
+Metabolization of UDP-glc
+ADPribose
+sharing a health facility
+younger age
+polymerase chain reaction multiplex naso-pharyngeal swab
+Epstein-Barr virus
+TIP3P model
+Human RAB7
+control subjects without animal exposures
+winter
+Increased relative humidity
+Fifty to 100
+Trypanosoma brucei and Plasmodium
+Appendix A
+Mice and cottons rats
+five
+sacrificing predictive accuracy
+Catpac
+Senescence b-Galactosidase Staining kit
+NSIP
+three
+14
+SuperScript III
+RNAfold WebServer
+enhanced survival
+QAIzol reagent kit
+fieldbased tests
+UTIs, meningitis, and sepsis
+inflammatory cytokines
+decreased circulating lymphocytes
+elevated cell proliferation and reduced migration
+POLR1-mediated transcription of rRNA and rate of host translation
+five
+1 : 1600
+Tidwell RR et al
+genetic systems
+A solution
+bacteria, fungi and viruses
+hard upper bound
+RPA and PCR
+negative
+Variations in litter size
+azathioprine
+Actin or GAPDH
+CD8 T RM cells homing to the lungs and/or airways
+less than 70% amino acid identity
+at the surface
+PIAS1
+5000
+protecting cells from physical damage
+bioinformatics workflow
+16th of July
+epithelial
+late 19th century
+one hour
+118.1 Ϯ 3.4%
+Volumes of interest and corresponding maximum standardized uptake values
+LPS composition
+Post-transcriptional
+prompt treatment with medications
+science and security issues
+well-established viral features
+Chloroquine
+Telaprevir and Boceprevir
+the corresponding author
+site specific labeling
+DAPI
+recombinants
+48 hpi
+Thirty-two
+an extracellular matrix protein
+Numerous residues within the C:R interaction sites
+twice a week
+Gaelle Noel
+32,505
+GRP94, GRP78, ATF4, and CHOP
+county-level
+K391E and E51K
+prevent animals from weight loss
+LTA mediated cytokine secretion
+population growth and consumption habits
+rZIKV-RGN-mNS2A
+Nerve agents
+RT-PCR
+edge durations
+atomic layer deposition
+thin layer chromatography
+size
+25
+submicroscopic, membrane associated vesicles
+jasmonate
+f B
+LYPB
+Identification of drug-target interaction networks
+technical
+bronchitis
+six weeks
+Vector competence
+b R1
+Oseltamivir
+33%
+cc-by
+Memorial Sloan Kettering Cancer Center
+switches to primer-independent synthesis of full-length antigenomic RNA
+lipid peroxidation and cellular injury
+wild-type cells
+unpredictable clinical consequences
+eBioscience
+1002
+amino-terminal methionine
+prophylactic and therapeutic countermeasures
+Subtype B and C
+PAMs genomic DNA
+MTB infection
+viral RNA
+0.4%
+Plasma and PBMCs
+Quantitative PCR or Western blotting
+multi-step virus growth curves
+minuscule
+viral
+Maintaining a sufficient level of pressure in the tracheal tube cuff
+Caspases
+non-commercial
+water-exposed quenching profile
+21
+trypan blue exclusion test
+biological
+six
+GST pull-down experiments
+metabolic pathways
+nuclear accumulation of polyadenylated mRNA bulk
+classic sigmoidal curves
+neurological disorder
+FDA
+Hypsugopoxvirus
+five
+IgM and IgG2b isotypes
+affinity chromatography
+serine peptidase/prolyl oligopeptidase
+crucial
+at the entrance of the aerodigestive tract
+soluble scFv expression
+Mx1 mRNA
+L929-conditioned
+significantly different
+mice, rats and rabbits
+DC urine
+a multiplicity of 0.1 and 1
+sPLA2 activity
+pNL4-3-Luc.E-Rvariant
+seven
+postoperative outcomes
+Retinopathy of prematurity
+cell tropism, persistent infection, and vaccine candidates
+default values
+200 μl BlaM1 VLPs
+T7 polymerase
+982
+5 minutes
+The phylogram
+3
+pluripotency marker Oct4
+vaccine candidates for fasciolosis
+four criteria
+how uncomfortable
+T-cell
+ISG expression
+cAMP
+primeboost
+0.05
+international data
+E5
+Bioinformatics
+EBV infected cells
+international airplane flights
+phylogenetic networks
+IFITM3 trafficking
+10.1155/2020/9629747
+The corresponding author
+regional population clusters
+Spn4A
+24 weeks
+2-10 times greater than non-pregnant women
+10 centimeters
+30% to 45%
+hepatitis B virus and influenza A virus
+cell death
+SARS coronavirus PLpro
+antiarrhythmic
+36 h
+Binding of peptides to the HHD and H74L molecules
+Antiepileptic therapy
+2005
+41%
+rRNA synthesis and nucleolar size
+IU and IP HIV-1 infection
+the study
+severe respiratory acidosis
+increases
+recycling tubules and vesicles
+IDO1-induced nutrient depletion
+seven
+nanovaccine
+Prophylactic and the therapeutic formulation
+50 aa
+four
+adaptations to overcome genetic divergence between the reservoir and spillover hosts
+Phylogenetic trees
+the liver
+189
+airports for control
+reproduction number
+VRC01 CDRL1 and CDRL3 loops
+below and above its corresponding threshold values
+2149
+ELISA plates
+unique
+delayed response
+binds RNA
+40S
+S. aureus ATCC 25923
+the size of each module
+cell proliferation and oncogenic activity
+minor pathological changes
+transmission chain
+time windows one to three weeks shorter and longer than the proposed eight weeks
+0.2941
+USA, Australia, Hong Kong, and China
+over billions of years
+Latin America
+3,4-dihydroxyphenyllactic acid
+resources allocated to region l
+mounting a detectable antibody response
+mitochondria
+hydrogen peroxide
+IE adhesion to CSA
+Compound Topographical Index data
+carcinogenesis
+Sensitivity
+melanoma-reactive
+An alarm
+blood monocytes and dendritic cells and spleen macrophages
+29
+111
+serum
+Metamorph
+recombinant inovirus
+724
+pJD366-18
+degree of hypoxemia
+atopy and allergic sensitization
+research ethics
+novel
+infectious disease management
+20 µL
+the truncated N6 position of A37
+Scherle method of weight displacement
+loss of infectivity
+1 to 100 nm
+77.8%
+1.1-1.2
+RV-B
+active
+Anti-LTA mAb-binding kinetics to purified LTA
+71
+AIV H6N1
+hepatitis, liver fibrosis and cirrhosis
+EnzyChrom L-lactate assay kit
+12 days
+major T cell epitopes in VLP forming components
+establishes persistence
+Bio Med Central
+model
+Second Affiliated Hospital of Guizhou Medical University
+Figure 1A
+β-Actin
+Twenty-one
+offset correction strategy
+Ficoll-Paque gradient
+innate immune response
+Clathrin mediated endocytosis
+2004
+ADAM2
+Muguga Cocktail
+densitometry
+RR1 soybean DNA
+57.7%
+HuSiDa
+a potent immunosuppressive fusion protein
+Begg's test and Egger's test
+36
+critical information
+13
+Institutional Review Board 4
+centrifugation
+ER stress and UPR activation
+TNF-a
+immune reconstitution inflammatory syndrome
+iterative
+1,188
+washing with water
+subcompartments
+100 Species Vertebrate Multiz Alignment
+F and L
+gorillas and chimpanzees
+27
+outbreak duration
+T-cell immunity
+signal intensities
+Coronaviridae M protein
+critical knowledge gaps
+Pulmonary surfactant
+Noninfluenza viruses
+therapeutic
+Advanced Scholar Search
+Mann Whitney U-test and χ 2 test
+ΔcscAR + pBaSP
+Screening for CMV
+moment relations
+tryptophan
+severe preeclampsia
+100%
+Qiagen IPC
+IFN-α-induced apoptosis
+a medical doctor
+Two
+GraphPad Prism
+nisin controlled expression
+A soluble and flexible amino acid peptide linker
+women
+Pansinusitis
+multiple cellular factors
+CRISPR/cas9
+Formalin-inactivated influenza virus
+sites that are conserved between CypA and Ran-Cyp
+PCR and nested PCR
+Conflicting
+Angiogenesis
+initiate their escape from the endosomes
+Beilong virus and J virus
+ss469415590
+a segment of the M gene
+3,000
+endogenous antigen presentation
+11
+vRNA
+outlying cases of rapid movement or longer persistence of infection
+34 kb
+renal neutrophilic infiltrate
+3 days for reaction
+statistical significance
+5-to 25-fold
+64%
+HFD
+whole supernatants
+Picard
+Lamivudine
+Overall mortality
+vulnerable or underrepresented population groups
+two
+oseltamivir
+CD8 + T cells
+905 image slices from 120 patients
+12% intensity
+CBPV
+NK cells
+60 %
+KO mice
+fetal red blood cells
+attenuating viral protein synthesis
+inflammatory mediators
+stability during a drying process
+confounding
+10,000
+combinations of viruses that previously infected human, swine and avian hosts
+residue 77
+HDL
+Changes in the length and composition of this spacer
+rhinovirus or enterovirus
+21
+statistically significant
+b
+improvement of the underlying mood disorder
+lose focus
+GeneJET Gel Extraction Kit
+poor prognosis
+atipamezol
+reinnervates the paralyzed muscle fibers
+hemoglobin
+32
+Inaccessible trajectories
+Student's-t test and ANOVA
+Ebola Reston virus
+T and I
+hydrolase L1 protein
+1 mM DTT
+visualizing and analyzing trends and patterns in scientific papers
+Autoclaved nanopure water
+hypoxemia
+cell specific responses
+29%
+Plasmids for CRISPR-Cas9 genome editing
+misfolded, modified or unwanted proteins
+equal volume
+4
+480%
+selective packaging of BMV RNAs is not directly linked with membrane remodeling
+0.2
+colorimetric assay
+modulation of cell apoptosis
+200
+28
+isatin moiety
+mRMR with forward feature selection
+three
+mismatches
+Key human pathogenic arboviruses
+High consumption of dietary fructose
+to immobilize proteins
+30 days
+Traditional Chinese herbal medicine
+6.8 to 7.2
+10%
+guidance
+naïve T cells
+32
+α R
+Biomatters
+297.7 g
+Colon epithelial tissue
+LacZ staining of bladder wholemounts
+hemocytometer and Trypan Blue dye exclusion method
+Urea
+SPSS 12.0
+59 and 39 ends
+NSs-mediated transcriptional suppression
+discriminate viral targets at the level of both their genotype and subgenotype
+the functional IFN-λ4 protein
+mammalian-like
+proteins in the exocyst complex
+DAVID Bioinformatics Resource v6.7
+Interferons
+macrophage and T cell data
+Loop matching strategies
+managing and analyzing large amounts of gene expression and mass spectrometry data
+28 kDa
+IFN-γ signalling
+earlier
+MDCK cells
+full mediation
+g
+a library of HCV pseudoparticles
+55%
+83%
+39%
+Stress
+the intensity of the host inflammatory response
+the nature of arising hazards
+28 th April
+six
+≈0.4
+an influenza outbreak
+V1V2 domain
+radiological
+oxidative damage
+− 0.3 cut-off
+classical morphology
+924, 559 and 390 nt
+CellTiter-Glo kit
+saline and 2.5% ethanol
+QIAamp DNA Mini Kit
+to minimize the load
+Multiple organ dysfunction syndrome
+50%
+6 weeks
+lung TLR4 expression
+25%
+Markov chain Monte Carlo methods
+5 0 ends
+Recognition and Tolerance, Immune Response and Killing and Memory
+to semiquantitatively measure the fusion variants in a complex sample
+ECMO
+55%
+BSM of natural origin
+710
+1000 mU mL −1
+phase 4
+structured
+EJB
+thymic atrophy and polyclonal B cell activation
+Influenza NP
+more than half
+no relatedness at all
+microarray-based expression analyses
+23,801
+Nucleic Acid Amplification Tests
+IFITM3-positive
+pneumolysin
+α-SMA
+98
+An amplicon-based metagenomic library
+GO term and manual annotation
+patient #226
+10 Å
+Btk phosphorylation
+EF-P
+EIF2AK3
+8
+critical components of the innate defence system during pneumococcal infection
+three
+infection
+dysregulation of several key miRNAs
+L-CDR2
+0.74
+Science
+400 nM of each primer
+point of need testing
+RIII
+illumination-induced heat
+Four
+mosquito
+293T cells
+frameshifting
+47 to 81%
+HIV-1
+Mycobacterium abscessus
+airway infection
+Two week-old
+VA-MENGOC-BC
+10-23 days
+by checking the complete blood count
+self-reliance at individual nodes and clusters
+regenerative medicine
+Funding mechanisms
+3027
+M5
+Total RNA
+ACE2 marker
+SgrS
+mTOR, Raptor, Glb and DEPTOR
+two
+changes in behavior
+EBV
+University of Vermont
+120
+virulence plasmids
+150 kDa
+Rhythm control strategy
+16-34 min and 8-25 min
+GRM model
+surveys or cohorts geographically settled close to their residence
+Grubb's test
+1987
+1:1
+apoptosis
+1954
+glutamine
+fully validated
+3-AB
+Carbohydrates
+sensitivity
+ZIKV
+Living Image 3.2
+CS&T beads
+Titer reduction
+P. falciparum malaria
+STAT3 or STAT6 knockout cells
+to detect changes in threats
+bronchiolar obliteration and DAD
+7-day
+0.1%
+a set of detected pseudoknots
+0% survival
+denatured proteins
+PaLung cells
+vaccine development
+Werner syndrome and Hutchinson-Gilford progeria syndrome
+Mutations in the coding genes for HA and NA
+IFN-γ
+responses
+quantitative reverse transcription polymerase chain reaction assay
+statistically significant
+two
+27.3%
+four
+viral strategies
+PKR
+D23
+704
+cytotoxic
+Network models
+Fourteen days
+IFN-α
+IL-6, IL-8, and MCP-1
+Backbone flexibility
+The natural stop-start motif
+Ang II
+fluorescent
+biocompatibility
+a compendium of an approximately twice the size of full-text consultation work
+747
+stimulating the nitric oxide production
+cytoprotective
+Synthetic genomics and synthetic biology
+other miniaturized and large-size high-speed CE instruments
+the malfunction to control cell death
+60.1%
+T1-T17
+Highlighted sequences
+polysaccharide intercellular adhesin
+aminoacid substitutions
+caspase-3
+Image J version 1.48
+1
+Haploreg
+camels
+natriuretic peptides and their receptors
+Linear regression analysis
+50
+Complications of intensive care procedures
+China
+efficient replication of infected virus in respiratory epithelial
+Maxima with too close a spatial overlap or at an image edge
+six
+refseqgene
+a network of narrow pores
+higher
+DSBs
+heterologous prime-boost regimens
+tumor metastasis
+epithelial cells
+72 h posttransfection
+48 hr
+significant stalling
+two pairs of closely associated dimers
+limiting an ongoing outbreak
+QIAquick PCR Purification Kit
+stunted
+codon adaptability, mRNA structure, tRNA usage
+tumor-bearing mice
+negative-strand RNA viruses
+a third group of rhinoviruses
+Different groups DCs
+over 1200
+indirect
+24h
+4 weeks postvaccination
+parrot bornavirus 1 to 8
+elevated
+two
+PCR cross-contamination
+air travel
+115
+cysteine
+IFN-γ
+significant differences
+96 h
+19 kDa protein
+several
+Rhinovirus and Coronavirus
+HRP-conjugated
+Complex patterns of multiple crossovers
+less than 5%
+good ANFIS's parameter
+1,584
+pig
+HmA
+reverse vaccinology
+8.7 million
+a cellular protein continuously degraded by proteasome
+recombinant antigens
+exponential
+birth
+C = 10 6
+44%
+fear of illness, contagion and death
+NFKBIZ
+hostcell protein localization
+histopathological patterns
+synergistic
+Image J
+early risk factors for severe PJP and 90-day mortality
+information on HIS
+273
+quantitative and/or spatial transcript expression patterns
+Poisson
+ATPase activity
+bacterial composition
+addressing health issues in complex systems such as the Arctic
+type I IFN
+one
+30 minutes
+55-10%
+a suitable slippery sequence
+development of disease control strategies
+three
+miR-148a
+dynamical epidemic SIR model
+Annexin V
+true-nonmutation calls
+travel and tourism, vulnerable groups, social and demographic, and surveillance and reporting
+77-84
+Obstacles to the implementation of lung-protective ventilation
+adipocyte dysfunction
+ten
+Poly I:C and Sendai virus
+TGF-β 1
+Supernatants
+14 months
+265.4 weeks
+21
+NK cells
+an RSV outbreak
+zero
+the PLC
+hepatoprotective and antioxidant
+CPT1
+all regions we considered
+5
+BWA and Bowtie2
+The underlying network structure
+desmoglein-specific cytoplasmic region
+percent dimerization
+one or two
+Five-fluorouracil
+human AXL + DCs
+ZIKV Natal RGN SRIPs
+neurological disorders
+homology modeling
+278
+4
+16th
+The cell pellet
+denoising of lowerresolution density maps
+oncogenic
+by APCs
+Subcritical transmission
+6
+An entire living world
+conjugated antibodies
+H1N1 M1
+Six
+membrane fusion
+Elevated CK values
+1.75-and 2.40-fold
+989
+inflammatory
+nonspecific recruitment of cellular endonucleases
+real quotes
+93,326
+within tight junctions
+The Martini script
+2D electrophoresis
+CD8 + T cells
+a specific diagnostic test
+P-I
+billions
+scanning densitometry
+Blood samples
+HLA concentrations and bioactive lipids
+Sera
+antioxidant, antiviral, anticancer, antimicrobial and anti-inflammatory
+Standardised triaging and triage procedures
+Real-time PCR
+Sigma-Aldrich
+GSE129949
+Point-of-care ultrasound
+90 million
+methylene blue dye
+whether individuals perceive themselves to be at risk for type 2 diabetes
+histological
+3 h
+DNA nanoswitch
+PDI global knockout mice
+logrank test
+Deutero GmbH
+treatment
+60%
+axis 1
+convenience and short treatment times
+Acute chest syndrome
+apoptosis
+bacterial-specific
+infectious complications
+three months
+the migration graph
+cGAS K335 monoubiquitination
+Phe, Tyr, Trp, and Cys
+CCX754 or CCX771
+temporal class
+antigenicity/immunogenicity and accessibility
+induction of type I IFNs
+IL-17A
+Triton lysis buffer
+100:1 or less
+two
+Written informed consent
+Liver
+potential
+antiviral immunity
+18
+MDAs
+5-14 years
+serum levels of sCD86 were significantly elevated
+Endocytosis
+SDS-PAGE
+routine workflow processes
+F240 and T32
+hamster
+episodic diversifying selection
+~92%
+an investigational therapeutic
+Bound bacteria
+gp350-positive
+blood culture
+catalytic dyad
+LPS
+aerosol propagation
+Patient viral RNA copy numbers
+none
+2 -ΔC T
+two
+3 weeks
+ASOs
+Stromelysin-1
+poly-arthralgia
+two-tailed Student t-test
+mitochondrial kinase
+Rudolph Virchow
+Swiss-model server
+40-50%
+infection rate
+50-70%
+HSV-1-stimulated pDCs and CD4 T cells
+sentinel cells
+Th2
+containment failure
+sEV uptake and paracrine senescence activation
+704
+genomic signatures
+Immunofluorescence
+MutS homologue 5
+IC 50
+270uC
+2.1 days
+mean ± sem
+unacceptable
+S phase-specific DAC incorporation
+15 weeks
+18
+AIV
+docking scores
+initiation, propagation, and termination
+decolonized
+50%
+HEK293 Flp-In TREx cells
+60uC
+severe heart failure
+deliberative
+Overlap extension PCR
+Core Hopping
+norovirus assembly and release
+86%
+6
+Mmp9
+21
+BSL-2
+social processing and social cognition
+PCV13
+implementation of M&E activities
+an independent assessment of the national laboratory network
+15
+four
+pneumonia
+grifonin-1
+semantic-linguistic annotations
+HBoV-1
+Wuhan, China
+150 μL DMSO
+1000
+virus-like microorganisms
+Total Worker Health initiative
+a feature detected in four independent replicates
+RNA enzymes
+Defining the adequate cutoff
+type I interferon responses
+stability of helix H3
+Adherence to proper infection control measures
+uniform vectors of physicochemical properties of proteins
+mutagenic and tumorigenic properties
+in-season and off-season
+Mef2c
+The effect of MEDI8852 to prevent influenza transmission
+Fluconazole
+CAP
+48 h
+15%
+21.36 μg/ml
+superior safety
+Baseline characteristics, active problems and APACHE II
+excess B-1a cells
+Alveolar hemorrhage
+Eighteen
+recurrent infections and functional recovery
+add oligonucleotide tail to 3′OH ends
+neutralise the fusion protein
+The tet R gene
+␣2,3-linked SA
+three
+deamination
+ace2
+cell viability and tumor growth
+ECL detection
+Non-small cell lung carcinoma
+understanding how eHEV spreads
+mineral oil
+Disease severity
+mild and selflimited upper respiratory tract infections
+exogenous trypsin
+40-60 seconds
+The supernatant
+population homogeneity
+Control 11A minibody
+LC3B-positive structures
+interact with FKBP11 in the osteoblast cells
+different transmission clusters
+Car3, Fmo2, Hdc, and Ker13
+senescent
+normal pregnancy and immune responses
+human pathogens
+retroviruses
+different epitopes
+mice
+structures
+fasting glucose, insulin, triglycerides, and hepatic fat
+essential functional genomic elements
+Illumina Hiseq2000
+30 minutes
+Service provision to overseas workers
+MW2 and LAC
+IEDB
+78-88%
+mammals and marsupialia
+AQP3 water channels
+120
+five
+resistance can widely spread
+100% identity of their R. landeri with Bos taurus
+dependency insurance
+silence PDI expression
+MgNH 4 PO 4 •6H 2 O
+EGFR kinase activation
+viral load
+.50%
+moesin and radixin
+Non stem cells
+whether tDCs are also depleted
+the region's priority zoonoses
+Specificity, avidity and dynamics of influenza A virus -receptor interactions
+chicken
+heparinized microcapillary tubes
+Rs2563298
+the TM region
+211
+1
+seven
+chronic obstructive pulmonary disease
+oxidative stress
+90%
+NS1
+serodiagnosis
+confidence interval
+Gas6
+100 mL of C3 buffer
+transcriptome
+1%
+Branchiostoma floridae Bf--AGO2
+Four days
+analysis of multiple alignments for upstream regions of orthologous genes
+fusion inhibition or co-receptor modulation
+HRPs
+S. aureus
+genome sequencing
+immunosuppressive and immunomodulatory
+ACE2
+Mass spectrometry
+molecular mimicry
+pulse oximetry
+Malignancy
+sepsis-related organ failure assessment
+Plasma ACE2 activity
+Outer membrane vesicles
+five
+Supplementary Text S1
+An ECLS Service
+an artefact
+MBC assay
+Tumor Volume = /2
+Animalia
+519
+anesthesia
+Biojector 2000
+mycoplasma contamination
+Severe joint pain
+orders of magnitude worse
+11
+regional commanders
+Tri-pure reagent
+follow up with other small molecule analogs
+diarrhea
+PrimeScript RT-PCR Kit
+eIF3d
+electrical
+five
+antinuclear antibody and rheumatoid factor
+electrostatically charged polypropylene filters
+30 to 40
+cDNA
+25
+93
+flotation through a discontinuous iodixanol density gradient
+lower titer Nab specificities
+heat shock
+Addgene
+membrane fragments and viral particles
+ProteOn 3000 instrument
+B2M
+two-item measures
+The Red Queen hypothesis
+DC
+0.67 and 6.7 µg/g
+12.9%
+AUG and UGG
+antiinflammatory, antibacterial and antiviral
+Seventh Programme
+heart rate and cardiac output
+HI activity
+seven
+The scope and limits of self-control
+TGFE1
+Im-ageNet pre-trained
+Inappropriate initial antimicrobial treatment and transfusion of blood products
+AONs can only specifically target one exon at a time
+oncostatin M
+Apo E
+survival after liver transplantation
+nanoviruses or babuviruses
+twice
+Viral infectivity
+∼10%
+24 h
+Helium
+HIV, RSV, and DENV
+72
+taking antibiotic medicines
+the scenario in which the vaccine and vector share cross-immunity
+IL-15
+Titers
+Pulmonary/lung fibrosis
+centrosome function
+infectious bronchitis virus
+dsDNA
+Symmetry
+Health Research Innovation Centre 53, University of Calgary
+averages across the ensemble
+luciferase activity
+IDO-KD MSCs
+Glycan processing
+heterozygous-diploid
+T cells and B cells
+6 months
+tribromoethanol
+Spearman rank-order
+single-stranded RNA and reverse-transcribing viruses
+population density
+major
+Frameshift efficiency
+knowledge about Ebola virus transmission routes
+finer temporal resolution
+metabolic disease
+rapidly inserts in the target membrane
+antibody response
+inhibits Apdm09 replication
+key aspects of transmission dynamics
+immunotherapy of cancer
+higher order structure
+CDKN2C
+confined T cells
+Ω
+most probable links
+immunological pressure
+CTF + CGR and random forest
+Germany
+initial seeding events and small-scale outbreaks
+SITR trajectories
+ubiquitin binding
+MYC
+neurodegenerative
+infants
+.20%
+addressing the far q k space under attenuation of the specular axis
+traditional herbal medicines
+microvascular endothelial cells
+accumulate mutations
+Y. enterocolitica
+at the RPE and the photoreceptor level of the retina
+syndrome
+replication
+14%
+haplotype changes
+24 hours
+Diarrhea and rashes
+Hoechst dye
+ClustalW
+Twenty
+whole-genome sequencing
+a systematic and sensitive method
+Communication
+10 min
+glycyrrhetinic acid
+self-referral
+TREM2
+functional changes
+TIRAP and TRIF
+type II
+Matched fluorescein conjugated isotype control antibodies
+Adjusted P-value
+Ni2+ nitrilotriacetic acid column
+800 gene probes
+using separate sutures to the abdominal musculature and the skin
+second quarter of 2019
+biological
+De novo virus protein synthesis
+seven
+Substitution rates
+licorice root
+to facilitate pathogen survival and multiplication
+GOrilla
+peptide
+Murine BM-derived VSELs
+one bp
+A pause in unzipping
+3′SLe X
+8:40
+TfR1
+Natural reassortment
+supernatants of HUH-7 cells
+10
+Apoptosis and necrosis
+G, F and M
+intrinsic properties of the pathogen
+16.6 ml/cmH 2 O
+a level of an individual mouse
+Trained innate immunity
+cross-reactivity with HCV antigens
+DNA lesions
+assessing school performance
+Influenza Apdm09
+Tobler's First Law
+athymic
+whether NF-kB targeting would also alter cytokine production
+biochar yield
+individual siRNAs
+exogenous IL-1␤
+Belmont Report
+seven
+25 to 46 kcal/mol
+Stage II
+15
+1610 6
+initiation
+5.7 Å
+Enzyme reporters
+less than half
+50 %
+a group of proteins induced by heat shock, or hyperthermia
+97%
+Ebolavirus glycoproteins
+Changes in body weight
+eight
+Digital PCR Analysis Software
+52/250
+29
+60%
+10,000
+personalized
+Every question
+unglycosylated sites
+heroin−KLH
+TRIzol TM Reagent
+5 -UNN-3
+one fourth
+cardioprotection
+relapse
+4%
+viral RNA
+tuberculosis and meningococcal disease
+Imperiale and Casadevall
+professional groups
+1997
+negative peptides
+three
+arms race dynamics
+16-fold
+The T m at 295 nm
+P max
+cc-by
+100 μl
+TCS
+80%
+Nucleobond PC 2000 EF kit
+apolipoprotein D and RNase2
+isolation
+1990s
+the corresponding author
+7 days after each dose
+glycoprotein fusion activity
+highly focal movement of individuals
+to dryness under reduced pressure
+microtubule assembly in neurons
+a few hundred
+likelihood ratio test
+Y. pestis 91001
+HIV gp120
+The final refined structure without water molecules
+Gene content, number, and structure
+1.47-fold higher
+fluorescent-tagged
+MBC assay
+cryptdins
+mucous membranes
+I-TASSER
+Italy
+neuroticism and conscientiousness
+150
+oligo-A complex
+NS1 protein
+P. vivax malaria
+elevated plasma C-reactive protein and procalcitonin levels
+GFPpolyA
+morbidity
+Arbidol
+block the autophagic response
+33.4 years and 30.5 years
+to disinfect all hard surfaces
+16 000
+timeinvariant characteristics
+chloroquine treatment
+20 mg
+25%
+Upshaw-Shulman syndrome
+cell-or organ-specific delivery or the complexity of mRNA pharmacology
+IL-10
+28,648
+Text S1
+20-30%
+H5N1 infection
+The strategy producing the lowest mean cost
+Four
+ORRs of 50-60%
+50 μl
+174
+safety and tolerability
+13
+B-and T-lymphocytes
+influenza Apdm09
+EachÑ i
+therapeutic
+The text describing Fig. 5
+uncoupling
+multiple displacement amplification
+Wild birds
+3 hr
+ACE
+non-coding regions
+some of the segment termini lacked this consensus sequence
+tumorspecific antigens in the colon
+inhalation of excreta from infected rodent hosts
+a global order
+R. australis infection
+Kilifi Clinical Trial Facility
+vertebrate genomes
+653,519
+2-8
+b
+822
+Mann-Whitney and Chi-Square tests
+individuals across the lifespan
+quantitative analyses of host protein responses
+a short strand of RNA bound to a protein complex
+RTCD1
+sequence-based criteria
+Cellular infiltrate
+antigenic boosts
+Ang-
+Class II
+Viral
+inducing the cell-surface expression
+how it might exercise its relevant taxation or legislative powers
+γ carboxylate
+1.000
+detailed overviews of Rfam families
+High Pure RNA Tissue Kit
+all stakeholder groups
+fast breathing with confusion
+Applied Biosystems SDS2.2
+change in protein expression
+transcription of IFN-stimulated genes
+Ten
+TCI Chemicals
+distinct structures
+19
+SAMD9
+41.81 ± 10.29 × 10 9 /L
+three
+R0
+NsP1
+how to manage infected and affected persons
+CD206 + TAMs
+MEME and FEL analysis
+27
+by washing the filters in 1 ml of THY medium
+eight
+an active UPS
+Quorum Sensing
+their agreement
+CXCR3A receptor
+malignancy and infection
+CedPVinfected
+access to health care resources
+hundreds
+infectious progeny
+human albumin levels and alanine aminotransferase activities
+Timed phylogenies
+W ðjÞ k
+Ksv
+immunological memory cells
+Infectious diseases
+surface HLA-DR expression
+yeast genomic DNA
+The detailed mechanism
+virus entrance and amplification
+34%
+Disassembly of the viral capsid
+60 min
+specific memory mimicry
+>25%
+viruses and microorganisms
+pathogenic
+chemically modified antisense oligonucleotides
+environmental, medical and agricultural significance
+0.5%
+Serum samples
+sphingosine-1-phosphate
+ANGs
+Ficoll density-gradient centrifugation
+T cells
+evolutionary
+Mock-treated A9 cells
+GFP
+SARS-CoV 3a
+enhanced the transcription of the p35 subunit of IL-12p70
+PI-stained protoplasts
+chromatographic immunoassay
+>40-fold
+5 × 10 5 cells per well
+the HMM
+102
+two bacterial species
+respiratory pathogen transmission
+Triterpenoids
+AlphaView Software
+39%
+blockchain technology
+Transportan
+IL-12
+1 to 16 g/mL
+100 µM
+ACE2
+greater generic conspiracist ideation
+pyrimidine-based TSA nucleosides
+13 amino acids
+age-specific
+NL-means filter
+biotinylated
+real-time PCR
+55%
+mononuclear cells
+vitamin E
+IFN gamma
+Virus samples
+Ethical
+pcDNA3.1-LacZ
+tumors
+Nursing Care Plan
+essential
+Twenty
+inflammatory
+17 January 2020
+0.5 g of sequencing-grade modified trypsin
+0.057 to 0.437
+Balamuthia mandrillaris
+disease prediction
+identity
+student's t test
+sample size
+G23C
+12%
+below the value of 1
+excessive proliferation
+13 years
+N
+Creative Commons Attribution 4.0 International License
+layer chickens
+symptom onset times
+5 mM QX-314
+69%
+CHIKV nsP2 and nsP3
+63%
+Innate and adaptive
+overall separability of patient groups
+primitive streak stage
+Table 1 and Figs 1 and 2
+13%
+Four
+no disruption of nucleoli
+purveyors of risk communication
+many differentially expressed genes do not necessarily need to carry the responsible mutation
+illness
+epidemiological compartment models
+The length of these loops
+higher attack rates
+pAAV-MCS vector
+3 µg of immunogenic protein
+98.6%
+flow cytometric
+5 × 10 9 /L
+nine
+β-Actin
+low MHC class I and low TcR avidity
+2610 4 ffu/ml
+11,500
+2.66 weeks
+30 minutes
+water, sanitation and food habits
+89%
+electrocompetent E. coli cells
+M2 homotetramer
+in 100 μl water
+innate immune response
+mRNA encoding a reporter protein
+release of ACh
+VGSCs
+P½jT; M
+a large set of chest radiographs
+EH, SF, HH, and ME
+proximity to airports and the presence of national highways or freeways
+conservation consciousness
+RNAi
+R4
+SRA-toolkit
+NP868R capping enzyme
+261
+NGS
+Escherichia coli DH5a
+pediatric
+15
+3-7 days
+hyperoxic
+Response to antibiotic treatment
+single cell-encapsulation
+Public Health Service grants
+concentration-inhibition curves
+20 to 61
+Flaviviral NS5
+Panel a
+I mig
+2B and 3A
+translation of a second ORF
+sets of differential equations
+Characterizing unknowns
+GraphPad Prism 6
+503,124
+3,590
+STAT1 and JAK1
+F-test
+Nearly 50%
+Molecular detection
+HVR
+major obstacles
+0.5%
+SPSS version 17.0.1
+compartmentalization
+the localization of brainstem injury
+Toll-like receptors
+Triterpenic
+60%
+YFV
+tissues near the inoculation site
+Five-week
+five
+later in life
+71.4%
+f i
+12 hours
+compartment models
+STATA 12
+tumor antigens
+Delayed onset
+IL-6 and TNF-α
+16 hours
+pathogen growth
+Ϯ SE
+ARH3
+22%
+an elegant strategy for evading antibody-mediated immune responses
+2 min
+HCV subgenomic RNA replicon cells
+transcriptomic response
+17
+Leukocyte-associated immunoglobulin-like receptor 1
+Accurate interpretation of past and contemporary population demographic scenarios
+Antimicrobial stewardship
+features that did not appear in a majority of rules
+Madrid
+host RNA polymerase III
+nine
+IMX313
+Secondary bacterial infections
+270uC
+CX3CL1
+Commercially available PEI
+A pixel
+synplot2
+40
+other reports from previous studies performed in Mexico
+48 h
+tenfold
+laboratory capacity or expertise
+four
+straw-coloured fruit bats
+picornaviruses
+J-sL and X-wZ
+10 min
+two primary anchors
+the latent period
+discovering lead compounds with anti-trypanosomal activity
+5%
+72%
+77
+Src/ FAK-dependent
+recombinant baculovirus infection
+lower
+σ
+increased transmission
+BAG6 and AIF1
+TGF-b signalling
+carbon source, pH, temperature, and cofactors
+nine
+on the farm of origin
+doxorubicin
+k elec
+ROC curves
+Jensen-Shannon divergence
+Alternative splicing in RL2-SP1
+confounding
+Ang-2
+different levels of distinct proteins
+IL-10
+Brazilian state
+Surveyor TM Mutation Detection Kit Standard Gel Electrophoresis
+gold, carbon and silica
+the complexity of the health problem
+3 mins
+monophosphate
+development
+Induction of the gene of interest
+12% polyacrylamide gel
+XLSTAT
+GraphPad Prism software
+Bradford kit
+genetic complement abnormalities
+didactic teaching methods
+microplate reader
+added attention
+surveys or interviews
+research, education, clinical practice, product development and distribution, and health promotion
+Remodelling
+ERK, AKT, and STS3
+a p38MAP kinase inhibitor
+increased membrane-bound protein intensity
+997
+predicted
+almost total skipping of exon 23
+six hours
+Ag
+IL-17A
+Continued surveillance
+LPS
+L1 pixels
+adaptation to the host's immune response
+amplify conserved target nucleic acid sequences of the virus
+dissociates from the sensor molecules
+information on them is confined
+2016
+double-stranded RNA binding
+two forward primers, two reverse primers and one RPA probe
+inflated false-positive rates and/or reduced power
+4.4%
+6 bp index sequence
+stem dependent neutralization
+M-ABA
+proliferation and survival
+low
+univariate
+6%
+280,000-970,000 N/m
+epidemic preparedness
+HuR
+0.88 million metric tons
+molecules
+fib rinous
+neutralizes charge
+total inoculum size
+overuse of antiviral treatment and prescribing behaviour
+Dedicated Python scripts
+saponin, flavonoids, and plant oils
+E134N
+all of the n 0 old nodes
+vaccine for influenza
+she will be replaced
+ϳ3.5 h
+s + d
+1.0 ml/min
+450
+the most appropriate reference genes
+neurological abnormalities
+the set of selected primers to amplify all genomes in the target set
+RT-PCR
+higher replication
+Antibody-based passive immunity
+Spain
+Reductions in disease duration
+receptorbinding proteins
+R 0
+translation efficacy
+Spo0A
+1 day
+stable transformation and transient expression
+The number of M genome segments
+January 2012
+biologically active transcriptional changes
+field evaluation of ACE
+plastic
+efficient priming
+pericentriolar region
+4
+Benjamin Lemaire
+IPA
+unit mass resolution
+Red or purple boxes
+blood
+encephalomyocarditis virus
+insufficient oxygenation
+FastQC, version 0.11.2
+extraterrestrial coverup conspiracies
+DTMUV
+mouse
+DNA constructs encoding the GP protein and/or recombinant purified GP protein
+R 0
+5 min
+1946
+Resfinder
+nairovirus-infected cells
+IL-6
+decreased pH conditions
+ALB and ACTB
+PrimeScript5RT reagent Kit with gDNA Eraser
+Dr Margaret Chan
+2AE5%
+University Hospital Essen, Germany
+Spaniard
+MMR and MGL
+Sepsis-induced multi-organ dysfunction and injury
+CNS invasion by JEV
+temperatures
+NetMHCpan predictor
+DiGeorge syndrome
+Further studies
+immune
+The agreement with the Polymod data
+s
+Five
+30
+Effects either on binding avidity or on membrane structure and trafficking dynamics
+Nowotny
+0.8 to 3.8 mg per lane
+13%
+Robust Multichip Average -based
+cysteine residues
+a period of city economy development
+nonsynonymous amino acids
+CASP7
+27%
+new protein folds
+microorganisms
+69.7%
+probabilistic transmission dynamic model
+99%
+increases cell attachment and migration
+PI3K-Akt-mTOR
+endoscopic stapler-cutter
+replicative speed
+inspiratory limb
+selftransmissible
+4455
+Richards model
+Benzonase nuclease
+lactate clearance
+Kruskal-Wallis
+to be able to promptly test scientific hypothesis in proof-of-concept studies
+STAT1
+similarity
+competent vectors
+tyrosine-protein kinase Src
+Ly49C/I and CD62L
+six
+prophylactic treatment
+The amount of complications related to anti-malarial drug use
+79.8%
+CS Bio
+microarray
+pharmacophore potency
+Mechanical ventilation
+cell surface attachment factor and/or receptor
+improve growth performance
+ferroptosis of tubular kidney epithelium
+usual source of care, citizenship status, and ability to speak English
+lung perfusion
+false positive evidences
+over 65 year olds
+83.9% protein sequence identity
+early diagnostics of MS
+The innate immune system
+TRAIL-R
+16%
+seven
+500 kHz
+twice
+100 μL
+RV-A
+two orders of magnitude
+C-reactive protein
+RT-PCR
+human immunity and the dengue virus
+mRNA
+allosteric
+T2DM
+JASCO-815 CD spectropolarimeter
+astrocytes
+intracellular localization
+four
+siRNAs
+statistical significance between the groups
+Mean and standard deviation
+intercellular signaling systems
+mottle
+site-specific PEGylation and fusion to an Fc region
+experiment fold change datasets
+strengthened expression correlations
+Standard checkerboard microdilution method
+Total spleen MNCs and K562 tumor cells
+culturing techniques
+Feliformia and Caniformia
+disaggregate
+RPMI 1640
+SPSS version 16.0
+single cell suspensions of lung and spleen tissue
+Avian influenza
+Five
+SB diets
+4
+Endpoint OSD fluorescence
+three
+graph-theoretic
+96.4%
+the degree to which each emotion contains both negativity and positivity
+The Ethics Committee of the University of Yamanashi
+pathways enriched among proteins downregulated >2-fold
+H66
+72uC
+2 µl of cDNA
+Megachiroptera and Microchiroptera
+2/164
+using a hemocytometer
+splenocytes
+20
+transmission
+Institutional Animal and Ethics Committee of National Brain Research Centre
+ZipScore downstream+ZipScore upstream
+cell-free transmission
+sufficient similarity
+steroids
+birds
+personality psychology, experimental psychology, psychological risk factors, and developmental psychology
+proteins are digested into peptides
+Tumor size and lymph node status
+activates mitochondrial β-oxidation
+eight
+RNase A
+80%
+APC3, APC7, and APC8
+370 kDa
+GloMax luminometer
+98.4%-100%
+photoreceptors
+85%
+23
+more than two weeks
+prevention
+up-regulated
+MELD-Na
+Anything might go wrong
+in-hospital mortality
+protective
+the proportion of household contacts who exhibit symptoms
+NES domain of NP
+9 h
+influenza-derived dimeric peptide diINF-7
+separate reads
+32%
+the calculation is stable
+246
+September 2021
+plastid transformation
+cytokines
+direct
+haemolymph
+serum proteome profiles
+30 min
+three
+yellow fever virus and Japanese encephalitis virus
+300
+Pearson's Chi-Square test
+previously exposed mice
+relative expression levels
+coagulation, hemoglobin, and renal function
+mental health outcomes
+conceptual translations
+0.5 to 1.0
+ICD chapters or NCD categories
+L = 50
+pRSET-A expression vector
+synaptic structure, function, and remodeling in the central neurons
+paracrine senescence
+high resolution risk projections
+real-time PCR
+four
+29
+nerve conduction studies and needle electromyography
+9 months
+Movebank
+severe infection
+Lactic acid levels
+100%
+attenuated reporter activities
+25-50%
+Author names
+DP2-BSW
+cytochrome P450 enzymatic activity or cell viability
+a set of standards
+overemphasis on CD8 T cell stimulation
+LB medium
+Binding of DEHP and its metabolites to progesterone receptor
+luer catheter
+8-week-old
+V protein
+good reproduction of both the direction and magnitude of peptide expression measurements
+16 weeks
+E
+Copy number variation
+Adenovirus-derived Ad-5 vector
+hot wire anemometer
+GGU, GUU, GGA and GAA
+zfh2
+human prion protein
+49% to 66%
+16
+Droughts
+livestock bones
+random
+Toronto, Canada
+5 and 10 min
+7 days
+HISG
+24.96%
+98
+distance tolerance
+Saturated ammonium sulphate solution
+integrated
+buy bottled water
+50-100 million
+one year
+metastatic renal cell carcinoma
+miRNAs
+Understanding the structure
+Qiagen
+autophagy elongation complex
+1 year
+individual case data
+508 kDa
+Existing classification systems of relevance
+BRCC36
+107
+Data
+the virus needs to be present at a high concentration
+IELAGTLTL
+DNA fragmentation
+Melbourne, Australia
+four
+Supplementary Material Tables S2-S5
+poor
+each pig
+graphical
+ICP4 protein synthesis
+NoD web server
+several members of the mTBFV subgroup
+tissue damage of infected airways
+Foreign policy
+Influenza
+CA2 and ACTB
+twice
+Taxa
+structural and non-structural
+methacholine
+EOMA cells proliferation
+recombinant viral vectors
+Lnc-DC
+Cathepsin C
+AE PKR inhibition AE
+micromolar concentrations
+77
+94
+80,000
+High-resolution studies
+specific IgM level
+assays
+Fascaplysin
+51
+PpcD
+pathogenetic model
+male
+twice daily
+DOBV rN protein
+TC-containing wash products
+selection of resistant mutants
+fluorescent probe dihydroethidium
+Baroreflex sensitivity and autonomic function
+slightly more serum stability
+89
+Global Outbreak Alert and Response Network
+survival
+The level of significance for terms and groups
+mouse
+Saudi Arabia
+liquid nitrogen
+five
+nsP4
+Age-and sex-matched 8-to 10-weekold mice
+chimeric progeny
+veno-venous ECMO
+inertial impaction
+bacterial transmission
+recruitment of Egr-1 to ORF50P
+TMPRSS2 and HAT
+DotKnot-PW
+high titer of DENV antibody posi-tives
+log-normal
+IgG
+2004
+CAP
+TOPORS
+MaR1
+heparan sulfate proteoglycans
+arresting of mitochondrial motility
+most of the ORFs of a phylogenetically isolated virus
+optimized regression parameters
+9.6%
+ticks
+infectious laryngotracheitis virus
+combinatorially barcoded
+ISI Web of Knowledge
+smallpox
+colistin and temocillin
+T-cell reconstitution
+Recombinant EBOV glycoprotein antigen
+Base compositions
+0.1
+CRTC2
+by measurement of the eGFP expression level
+specificity of antibodies to the corresponding peptide
+their own context
+different mobility and travel capabilities
+uptake of SP and endosome acidification
+iteratively finer
+TDP-43
+Omadacycline
+polymeric immunoglobulin receptor
+Understanding the epitope-based antibody-mediated neutralization
+another individual is randomly chosen
+robust antibody responses
+highly trained personnel and undamaged mosquitoes
+MUpro and iStable
+69.7%
+62
+25%
+fire intensity and postfire climatic conditions
+compounds
+7
+manufacturer's directions
+10 ll
+mRNAs Dissimilarities
+Ct values from realtime RT-PCR
+clinical
+Ellis and Ramankutty
+binding of Spo0A-DBD
+twice
+Thyroid transcription factor-1
+Cx3cr1
+Venturi masks
+an elongation reaction of three steps of PCR
+larger animals
+colostral
+0.7%
+22
+thoracic
+QIAamp DNA Blood Mini Kit
+SFSV and PTV
+STAT6 activation
+20 µM
+providing
+D4, D5, and D6
+JEV infection
+DAPI
+Zeta potential
+surveillance of wild birds and LBMs
+Evaluation
+Brazil
+Computational docking operation
+DLMO
+LC3 conjugation system
+␥
+random hexamers
+organic fluorogenic ligands/probes
+100%
+state estimate
+Ubiquigent
+1969
+transfection with the kahrp knockout vector
+The algorithm
+Table 4A
+expression of surfactant-associated protein A and AQP5
+three
+B.Chiranjivee
+Viral persistence
+A site s *
+drug abuse and prostitution
+Viral RNA
+30 minutes
+miRDeep2
+contact timing details
+monocytes and macrophages
+serum markers of brain injury correlate well with the extent of CNS damage
+Bands corresponding to HeV G and NiV G
+70%
+over 50%
+complicated, severe, and fatal
+IPS-1-dependent RLR signaling
+1 ml of DMSO
+10-100 mM
+mutational pressure
+0.5-1 h
+situations in which a genotype becomes dominant in an evolving population
+easy preparation, biocompatibility, inertness, and intense light emissions
+Syrian hamster/Andes virus lethal disease model
+water
+does not change
+All risks included in the Summary of Safety Concerns regarding MEs
+higher human mobility
+differential activity in induction of ISGs
+Responses
+5 mL of the RT-PCR product
+hydrogen peroxide assay kit
+lentiviral titer
+bronze-standard data
+TatN12
+10 6
+bacterial non-coding RNAs
+asymptomatic
+drug-metabolizing enzymes
+site-directed mutagenesis
+MxA
+Kaposi sarcoma and non-Hodgkin lymphoma
+three
+cyclin A expression
+hearing loss involving mid-high frequency
+26%
+44.241 µM
+55
+informational privacy
+interaction model
+three highly ordered stem-loop elements
+Ebola, MERS-CoV, and now Zika
+Biological systems and processes
+hepatosplenic
+picoliter scale sample injection volumes
+highrisk agents/toxins
+infectious diseases
+31%
+inflammatory
+lipid
+the stalk domain
+non-linear
+one-way ANOVA or Student's t-test
+U2OS or HeLa cells
+68
+substantial heterogeneity in repeated vaccination effects
+Y148
+tyrosine phosphorylation site
+neurologic disease
+a tool to manipulate and analyze high-content screening data
+biofilm formation
+the gp1 alignment
+IFN-induction and RNAi by shRNAs
+4,158
+high neutralizing potency
+367
+candidate vaccines
+saturable quenching of benzoquinoline fluorescence
+56%
+125
+28.2 to 67.4%
+K0.2 to 0.2
+Five
+3
+48 h
+Supernatants
+linear curve
+nucleotide sequences
+scarcity of available data
+IFN-c
+8-pCPT-cGMP
+an alternative mechanism
+one million
+classical methods
+antitermination
+V920
+progeny accumulation
+common naive T cell precursors
+reverse transcription
+doctors
+PTGS
+poor satellite geometry or multipath signal errors
+Nine
+January 20, 2020
+Ref. 25
+Bayesian
+probes with reverse complementary orientation
+totipotent zygote
+via an amino C12 linker
+sodium cyanide
+fluorescence
+1/100000
+antibody phage display technology
+anion gap
+GraphPad Prism
+69
+Chongqing City
+12 weeks
+damaged tissues
+Biochemical
+250
+medical applications
+yearly
+GATHER
+High flow
+human papillomavirus
+low XC titers
+5 to 30 ml
+improved dystrophin diaphragmatic targeting
+the infection of Ebola
+the binding energy
+stable
+older
+the signal
+VLP
+pemphigoid and linear IgA
+virus replication
+transjugular
+GraphPad Prism 5.0
+24 hours
+Okadaic acid and GW5074
+1000
+596
+renal cell carcinoma and imatinib-resistant gastric cancers
+2016
+CD4 + T cells
+30 μg
+0.3 ng/mL
+efficient TRIM21 activity
+Boyden chamber migration protocol
+time to peak viraemia
+virus shedding
+Northern blot analysis
+HI metrics
+Projections of income per capita
+Defects in potassium channels
+immunofluorescence
+higher
+Type I
+0.97
+polymyxins
+labellings
+seven
+four
+excellent
+Horizontal dotted lines
+one professor
+high levels of QN resistance
+US-granted
+Environmental contamination
+40-50 times
+Sequence diversity
+MARC-145 cells
+7
+covalent
+extensive uptake of surfactant
+safety, efficacy, production and costs
+Body temperature
+4 days
+14 days
+number of contacts, length of stay and contact tracing
+salt-sensitive hypertension
+prostate
+disruption
+NanoDrop spectrophotometer
+receptor levels on the target cells
+EGR1
+Advance Purchase Commitments and other financial innovations
+SEC and glutaraldehyde cross-linking
+5 L/min
+African countries
+Empty EL4 targets
+22%
+EVD preparedness
+IFN-c
+tripeptide sequence RGD
+influenza A virus
+cell differentiation, phylogeny and RNA stability
+common parasites of camel and dhumba
+adipocytes
+4 hours
+combination therapies
+Anti-GALT serum
+21
+Herd size
+Protégé
+50%
+CD16 and CD66b
+Half
+respiratory mucosal cells
+CAST, PWK, and WSB haplotypes
+VER-155008
+shape parameter alpha
+DNA amount
+Seven-valent PCV vaccine-serotypes
+Data Snapshots
+poorly differentiated/stem cell phenotypes
+H antigen motifs
+lower macrophage protection
+uppercase
+25%
+Positive RT-PCR results
+L protein
+Ag concentration on target cells
+VP40 and GP
+Deionized water
+Outbreaks
+R t values
+cDNA
+4
+Antibody-mediated neutralization
+12/69
+a voucher for the local Farmer's Market
+IL-12p70
+immunoprecipitation with normal mouse IgG
+inhibition of RNA transcription
+via lentivirus transduction
+Foxp3 + CD4 + T cells
+by recording only patient date of birth and gender on the data collection form
+Tours, France
+ADAM17
+20%-40%
+miRbase and MetaMirClust
+comparative approaches and single sequence methods
+accountability, ownership, cultural engagement and diversity
+other criteria
+low-income countries
+organelle membranes
+antagonistic activity
+capability maturity model
+17,129-27,659
+two epidemic periods
+IFN-stimulated gene 20 kDa protein
+extracellular SOD
+Core body temperature
+Stress granules
+CypA
+classical methods of microbe discovery
+Bone marrow
+DNase/RNase free water
+plasmids encoding the HIV-1 Env
+Protein subunits in S-layers
+3308.5 g
+oxidizing conditions
+TD20/20 luminometer
+1 717
+aggregation of over 70% of total protein
+Specificity
+genome-wide
+p33
+translation elongation efficiency
+TRAF3 and TRAF6
+regulators of cell proliferation
+Stabilized Matrix Method
+population structure
+ducks
+enteropathogens, oncogenic viruses, and other respiratory pathogens
+C3aR
+14
+toilet facilities
+Loss of INPP5A
+discriminative metabolic features
+imperfect sample purification to eliminate eukaryotic nucleic acids
+WOR1F and WOR1R
+anti-gp120 Abs
+10%
+poor outcome
+type 1 and type 2
+PPARγ activation
+evolved dramatically
+toxin inactivation
+strategies for enhancing social distancing
+Eight
+PPV
+macrolide resistance
+LLPS
+CD4 ϩ T cells
+1/μ H,V
+from onset of pneumonia to onset of ALI
+S1P
+residues 1591-1605 of VWF polypeptide
+three
+WHO Global Health Estimates
+GLUT4
+RNA granules
+293T cells
+48 h
+Anti-β-actin
+affinity maturation
+US Environmental Protection Agency
+Raw animal blood
+realtime turbidimetry
+trends over time
+anticoccidial efficacy
+66.5 ± 5.4 kg
+dashed lines
+nucleotide position 2282
+4 days
+Normalized
+changes in S codons
+Between 500,000 and 700,000
+the cell cycle
+Expression Array Manager
+Five
+inhibit NK cell function
+address these issues
+Maurer's formula
+vaccination-induced effects on the immune system
+major histocompatibility complex, class II and IGJ
+Du et al.
+cyanobacteria
+APACHE III
+GenScript Inc
+cc-by
+dko mouse
+1988
+Serum samples
+Culture of nasopharyngeal secretions
+In vivo transduction of satellite cells
+PPRV H
+SEM
+a panel of time-ordered GII.4 VLPs
+active surveillance
+emulsion PCR
+sustained induction of NF-κ B
+GenBank
+hypodynamia, nausea and thrombocytopenia
+distance
+a week
+Determining the level of microalbuminuria
+generalized epilepsy and inherited epilepsy
+three
+seven
+pathogen
+Infant immune repertoires
+type I IFN
+66.67%-100%
+5,500,000 to 11,700,000
+DNA strands with different domains
+80%
+Lessons learned
+laboratory support
+residues K160 and R298
+a stable karyotype
+severity of disease
+Ethical Committee of Hospital Clinic
+confidence intervals
+87%
+prototrophy or nourseothricin resistance
+A1AT
+adenosine-dependent fibrosis
+10%
+SLY and RBMY
+866
+pIRES-Rgp
+70-80%
+rapid killing and a wide range of activity
+244
+Agarose gel electrophoresis
+The effect of reticulate evolutionary events
+recombinant viruses
+23.0 ± 13.3
+GeoChip 3.0
+cardiology
+9%
+URI
+it becomes inconvenient when organism number gets enormous
+665 μM
+phage-related
+four
+NPC1 ϩ /Rab7 ϩ vesicles
+Isoform 1
+RSV subtype
+they are not filtering layers
+bone erosion
+binding site comparison
+Correlation analysis
+O
+cathepsins
+Nairoviruses
+helical conformation
+H5N1 pathogenesis and therapeutic and prophylactic development
+30 ug
+Geometric means
+2014-2015
+Murine embryonic stem cells
+mathematical models of infectious disease epidemics
+Poisson
+high salt concentrations
+23
+Three
+an increase in the number of elderly people with tuberculosis
+progressive consolidation
+35
+to identify risk factors for the susceptibility to RTIs
+66%
+ImageJ or FIJI
+syndromic
+January and February
+Error bars
+20.5%
+2 weeks
+alternative health care providers
+sudden onset of fever, nausea, vomiting, weakness and jaundice
+Interstitial lung diseases
+lack of effective prevention or treatment
+recombination
+other proteins
+gram-negative pathogens
+Table A1
+E. coli BL21 cells
+inflammation
+seven
+microvascular endothelial cells
+Primary NHBE cells
+TLRs and NLRs
+differences in husbandry practices and herd structure
+initiation of ART
+selective proton line broadening
+microchip-based
+CPU-and memory-demanding
+four
+nucleotides +10, +11, and +12
+Over 800 000
+260±98 μmol/l
+ground-glass opacities
+structural integrity
+153
+eGFP pos -CC10 low cells
+acute respiratory distress syndrome
+pleural effusion
+A threshold of 13% divergence on VP1 nucleotide sequences
+P<0.05
+Elke Muhlberger
+Lab software
+10%
+N2
+predisposition biomarkers
+stable hydrogen bonds
+ScriptSeq v2 RNA-Seq Library Preparation kit
+g i~g
+TNF-α and IL-1β
+amino acids
+H120
+36%
+The PLPIHS framework
+Kit W-v -+/+
+a rigorous expert panel reference standard
+severe dehydration
+Forty-nine
+how to identify the selectivity ratio of the receptor subtype
+5-HT
+5.2%
+four
+does not result in consistently and significantly increased toxin levels
+Conserved regions of disorder
+Both data sets
+Macrophages
+14%
+workplace policies
+Identification of relevant interacting proteins
+2 μl
+antiviral use or the use of face masks
+gene expression
+Asia
+55%
+Drug likeness
+PubMed
+,45 amino acids in length
+C9 and E8
+33 days
+sister
+three
+the local environment
+89%
+NS1-27
+Budapest
+MGB modification
+unconjugated anti-RANK IgG
+neutral
+Molecular dynamics simulations
+numeric integral
+3
+organ lysates
+stomach probe
+yellow
+increase
+a predicted loop of 7 nt
+publishing this work
+29 years
+Complementary positive stranded RNA
+1980
+Pseudoknots
+60
+Predictive performance
+regulating the function of DCs
+9.3 days
+IL-10 and SOCS
+integrated framework
+5%
+667
+root, bulb, stem, leaves, flower, and anther
+IFN-α
+positive associations
+twice
+87%
+four to six
+29%
+binding to dsRNA
+~83 weeks
+inconsistent
+Tri-color flow cytometry
+Dr. Hong-Bing Shu
+R III 0
+exon skipping
+DNA
+physiological
+manufacturer
+1.7
+alters blood hemostasis and sustained leukocyte activation
+ELG1
+standard deviation
+S. Guerra
+infected neurons
+ISG15
+blue-white screening
+ferrets
+six
+most sequences had no hits
+70.6%
+the host
+HepG2
+biodegradable PLA nanoparticles
+Genome-wide
+predictions based on the Richards model
+nucleolin
+clonal loss or clonal dysfunction
+compressed file
+1 h
+safe communication
+ATP/P2 receptor/CaM
+molecular biology and biochemistry
+microtubules
+less than 5 M
+Western blot
+B. anthracis-derived peptidoglycan
+inside the nucleus
+kallikrein levels
+NFE2L2
+JAM3 and CLEC14A
+12
+2A and 3C
+pneumonitis
+relative concentration
+milk yield and ovarian function
+cystic fibrosis
+DENV3
+AS03 A and AS03 B
+Disease transmission models
+10-100 nm
+IL-15
+Farmers
+Adenoviruses
+within normal ranges
+a branching process
+linear regression
+transcriptome
+vertical diplopia
+yeast to mammals
+LASV and ML29
+Hospital de Clínicas, Montevideo, Uruguay
+AB462810/007Lm-1vp
+Dromen van vaccines
+0.5%
+Six
+macaques
+Seven
+1.6%
+the mean
+IV infections
+symptoms
+centrifugation
+Ecuadorian
+5
+atf-6, pek-1, and ire-1
+curcumin
+malaria
+pneumonia
+the ratio of the foreground to background median intensity
+4.91
+COLDAIR
+exceptionally severe
+adjacent cells
+text analysis
+stronger IgG titer and higher IgG/IgM ratio
+14 days
+2 %
+oxygen use
+Genomewide
+chimeric polyhedra
+CpAM-induced structural changes
+organisms
+disease in swine
+H5N1
+marmosets
+Smoking
+Human astroviruses
+the disassembly of HPV16 capsids
+Fatty acids
+aENaC
+trachea
+863
+513
+fourteen days
+three
+Thresholds for undertaking testing both in hospital and in the community
+toothpaste
+10%
+Serial dilutions of MAdV-1
+allantoic fluid
+3 × 10 5 cells per well
+two months
+NGO0326 and NGO1577
+viral-encoded antagonists of the immune response
+the best fit of the GGM to the data
+a capsid protein
+VP2
+rounded down to the nearest integer value
+three
+rotavirus infection
+Orthobunyavirus
+hostspecific adaptations
+proinflammatory
+neuroepithelial
+Near half
+TM fusion peptide binding
+cc-by
+mediates self-assembling of liposomes
+morphological and physiological
+viral RNA
+transdisciplinary
+five
+cc-by
+Disseminated intravascular coagulation and acute respiratory distress syndrome
+mean ± SEM
+3%
+heterogeneity
+26.4 nm
+Alpha diversity
+the following pattern
+15 min
+proinflammatory
+60%
+60%
+2019-03-05
+fluorescently conjugated monoclonal antibodies
+least-square fitting methods
+Colonic contents and feces
+inflation of test statistics and over-confidence in parameter estimates
+Transcriptome and proteome
+no cross immunity
+24 to 48 h
+5th century BC
+public health spending
+Root mean square error
+>1.00
+inhibited
+nine
+1.0 ng/mL
+Two
+IPM-infiltrating cells
+more than 100
+SIGLEC6
+The average value of the negative controls
+VIM
+Haploview
+Zero Truncated Poisson regression
+Serotype A
+Peptide surface accessibility
+Reagent compatibility
+disruption of the tetramerization motif
+corticosteroids
+insurgence of resistance
+G and SH
+a new infectious disease infrastructure
+comorbidities, different ages, and different life experiences
+wild type infected mice
+5 h
+miR-192
+Get4 and Get5
+HA and NA
+γ-catenin
+40.0%
+ILD
+days 11, 12, 22, and 23
+RBC lysis buffer
+H3 methylation
+stems
+sections
+outside the nervous system
+five
+55.1%
+sequence similarity
+Tetramerisation
+plasmid DNA or A20 cells
+weekdays
+d 0
+the variables suitable for Cox's multivariate proportional hazard regression model
+CHO cell system
+each GO category
+0.1%
+RAW cells
+less than 4 PFU per g of infectious PEDV
+B conjugated peptide
+1000 times smaller
+anti-DOCK2 and anti-GAPDH antibodies
+albumin
+Sox 2
+fluorescence uptake microscope
+purifying selection
+cc-by
+normal saline and human albumin
+Corticosteroid use
+high workload
+Y19/Y20
+LMW SP-D
+m 7 Gppp-cap
+Suitable concentration ratios
+PacBio contig 2 and Gallus gallus v4 and v5
+membrane fluidity
+HMG-CoA reductase inhibitors
+stem cell markers
+Descriptive statistics
+conformational changes
+21-64 years
+microscopy
+R 0
+invasion, adhesion, differentiation and development
+visit hospitals
+R t
+increased hydrophobicity and positive charge
+non-vaccine type replacement disease
+133 6 32 mM
+membranes
+cytokine response
+IMG/VR
+stress experience
+Images
+to prevent slippages
+Variations in host abundance
+seven
+pathophysiologically inducible factor
+RNA
+9 days
+standard deviation
+Existing and new methodology
+generation of soluble GST-fusion proteins
+reverse genetics system
+Ethiopia
+strong polyclonal CD4 and CD8 T cell responses
+93%
+Figure 2a
+APACHE-II
+20%
+Rio de Janeiro, Brazil
+social distancing
+CentroidFold v0.0.9
+communitybased scouts
+enhance the share of patient information among healthcare providers
+21 days
+human type II collagen
+antibodies against various complement factors
+irrelevant peptide
+5.65
+an expert pediatric cardiologist
+6
+high and low estimates of vaccination coverage
+RNeasy fibrous kit method
+optimism
+hPIV3-C
+developmental
+inhibition of histone deacetylation
+cell surface expression of ABCG2 protein
+Professor Steven Webb
+more relaxed constraints
+Nigeria
+six
+False mediation
+critical care
+connectivity of groups
+1 -4 year old
+acute meningoencephalitis
+PyMol v1.1rc2pre
+HCV infection
+peramivir
+1975
+Japan
+RNase 1 PEG-derivative
+100 ml of each infectious dilution
+Hyperpyrexia
+B-cell antibody responses and T-cell immunity
+Tryptophan fluorescence
+12
+1019
+34 000
+1%
+Leptospirosis
+100%
+8
+HBV/G core protein
+Co-infection
+Total RNAs
+A useful biomarker
+Maximum likelihood estimates of p, q, and s
+CF small airways
+a coincidence
+anorexia and nasal discharge
+mm9 mouse reference genome coordinates
+high glutathione-dependent lipid peroxidase activity
+Twenty four hours
+pASP
+28 days after the third dose
+prediction and circular dichroism
+unrelated antibodies
+three
+meta-transcriptomics
+hospital levels A, B, and C
+3900
+Bayesian model
+high titers
+the sequence of the analogue 2* 3* 4* 5*
+five
+An ACI sample
+bear bile
+early prophylaxis
+NS1
+SP-A
+EK Nordwest und Zentralschweiz
+proper functioning of the Golgi
+a calibration of anti-HA to HA binding
+the full structural cassette of SFV
+Filgrastimmobilized PBSCs
+12 h
+data
+A standard curve
+the sequence of applying tools
+antiviral factors
+robust surveillance and effective outbreak investigation capabilities
+Supernatants containing infectious virus particles
+central nervous system dysfunction and acute respiratory dysfunction syndrome
+ORF1a
+every 6 months
+implant-associated osteomyelitis
+low numbers
+Sixteen
+pan-cultural
+ePCR
+dynamic strain
+À1 PRF
+Compound 3b
+6
+one-third
+1-bromo-2-chloropropane
+120
+100%
+Ethyl isopropyl amiloride
+rats and dogs
+chemokines in the lung
+Climate Monitoring, Analysis, and Prediction
+Total RNA
+Natural selection and mutation pressure
+15 min
+29.2 years
+Eleven
+MHC haplotypes
+48 h
+predicted deaths
+to adopt the geometry of a Watson-Crick pair
+Applied Biosystems Perkin Elmer 7300 sequence detection system
+Mouse Inflammation Kit
+six
+Canine TfR
+JACR 5139
+fundamental
+extracellular and mitochondrial proteins
+eIF5 and ribosomal proteins S6 and L4
+7,200,092
+Ith
+mid-to-late nineteenth century
+top, middle and bottom panels
+gap of knowledge
+viral nucleic acids
+CRTC1 protein
+complementarity determining regions
+multi-dimensional, inclusive rather than exclusive, broad rather than narrow
+MAPKs
+parameterizing the heterogeneous transmission model of infectious diseases
+Enhancement of DENV2 infection
+human 293 T cell line
+Ga-citrate
+U18666A
+10 min
+compound 20
+Prism 6.0
+RT-PCR amplicons
+viral RNA translation/replication and virion maturation and secretion
+Six
+21/102
+T-cell-based
+2.5 hours
+117
+one week
+atf-6 mutant animals
+12
+2009
+mean ± SD
+RIG-I and PKR depletion
+dysfunctional mitochondrial systems
+10 %
+Amplicon sequencing
+ADAR
+MLN-4760
+1 × 10 3 p.f.u. ml −1
+infants with acute or chronic lung or brain injury often have abnormal HRC
+MDMs
+viral clearance
+March to August 2009
+planning process
+56,365 4 = 225,460
+R 0
+4%
+ALV-J gp85 protein
+X4
+7
+NanoDrop 2000 spectrophotometer
+16 ö¥M
+11,323
+allows the growth rate to change
+60 °C
+41
+17 years
+direct co-culture
+limited access
+HCV infection
+RIVM
+fresh DMEM medium containing 100 µg/ml ampicillin
+CEACAM1
+cytokeratin-positive epithelial cells
+Motif 19
+0.112 µM and 6.897 µM
+Variances in the expression levels
+12000
+Vaccination
+gallbladder
+cell cycle arrest
+body size and/or age
+Virological surveillance
+enhances sensitivity
+actions that qualify
+678
+Leukoreduction
+Wambizzi
+Larval Xenopus
+Seven
+Ras palmitoyl transferase
+5 μm sections
+5.7%
+4%
+NHS South West/Exeter research ethics committee
+influenza
+mutagen resistance
+caused by insulin resistance in the liver and muscle
+80%
+30 min
+immature myeloid cells
+5%
+PBS
+reach everyone in the population
+subtle shifts in cell populations
+Figure 4
+CD4 + CD25 + regulatory T cells
+virus isolation
+diarrhea
+antioxidant activity
+QXXS
+syncope, weight loss, rib fracture, and pneumonia
+innate immune regulators
+the EB4
+the liver
+7
+C-lectins
+10
+diagnosis and guided puncture of pleural effusion
+156
+limitations in available data
+50% GFP expression
+cartoon
+nomogram
+apoptosis and necroptosis
+data from the paper published first
+similar
+79
+low fidelity and processivity of their polymerase
+NMR and mass spectrometry analysis
+ISGylated proteins
+Bolt LDS Buffer and Bolt Reducing Agent
+PIV LRTD
+heterogeneous microenvironment
+100%
+μ i
+Genome sequence 3908
+5 days
+circadian variations
+increases HN oligomerization
+text messages
+p10 ectodomains
+Four
+3-to 4-fold
+normal neurodevelopment
+eight
+cross-species poxvirus infection
+Luciferase signal
+a transient reduction in
+HPAI viruses
+MODS and AKI
+improving
+specific examples and case studies
+Ubc9
+Viral vector expression of the sCHIKV proteins
+liver mass and perfusate volume
+positively regulate replication of HIV-1
+cellular debris
+homogeneity
+plaque assay
+NanoDrop
+pGEM-T Easy vector
+modified HE assessment scale
+febrile illness and a high rate of abortions
+Chitinase
+C-C motif chemokine receptor 5
+guavaSoft
+universal
+Luteovirids
+3.0%
+Sia
+ECs
+117
+starvation
+degradation
+12
+Total RNA from each sample
+Recovirus
+Fluidigm Real-Time PCR Analysis software
+post-traumatic osteoarthritis
+A semi structured questionnaire
+cell migration
+maintaining electrolyte balance and blood osmotic pressure
+HBeAg
+30 min
+mediates the structural integrity of axons
+DOWNLOAD
+general pathogenic mechanisms
+suboptimal responses
+80%
+daily
+refugees, internally displaced persons and the homeless
+capsid
+lethal
+2-12 day
+Transmission heterogeneity
+1 hour
+GenBank
+firefly luciferase
+quantitative real-time PCR
+An external data management agency
+The nucleoli
+Preparedness against pandemic influenza
+cellular transcription factors
+right ventricular dysfunction and valvular heart diseases
+microbial communities
+pre-cleared protein complexes
+2,128
+Pulmonary oxidative stress and lung inflammation
+well-characterized signal transduction cascades
+Fusion inhibitor aggregation propensity
+36%
+Japan
+inflammatory cells
+HD5
+EGFRvIII
+allocating existing resources and identifying new sources of investment
+DI-72 repRNA
+AS-IV
+A case definition
+a safe and reliable testing platform
+41
+hydrolysis of MBP
+human clinical trials
+vesicular
+asthma and COPD
+retrieving unigenes sharing the high sequence similarity with flavonoid GTs
+rhesus macaque
+eukaryotic elongation factor 1A
+contact tracing
+native antigens
+5 minutes
+Farnesylation
+SHG-44 and C6 glioma cells
+a software package for mining viral signals from microbial genomic data
+stay home
+virucidal
+removing all I and D placeholders
+a residue we have previously shown to be highly conserved in all clinical strains
+8,777
+nasal potential difference measurement and intestinal current measurement
+around the site of mutation
+bronchodilator responsiveness
+Virus growth
+Healthcare professionals
+36%
+SCARB2 3 0 UTR
+individual ZIKV or USUV cDNA clones
+NIH 3T3 and M. dunni cells
+severe impairment of gas exchange and respiratory failure
+partial subgraphs of a network
+a viral reference genome
+four
+two
+68.3 to 100%
+66 mM
+colorectal cancer
+PCR primers 515F and 806R
+Bias
+1918
+conserved quantities
+43%
+Csn8 deficiency in the liver
+Cellular reprogramming
+Antigenic epitopes of pathogens
+nc F1766L
+protein/peptide
+2001
+401
+nine
+6 days
+greatest
+P. falciparum
+suicide prevention interventions
+shear wave elastography
+further research
+Coupling between patches with non-identical parameters
+further studies to decipher the genotype-phenotype interactions for peacock
+phenylalanine assay
+AF
+positive strand-specific RT-PCR
+road segments
+the sample size in this present study is very limited
+to halt coronavirus spread
+virulence and host range
+1.4 Â 10 5 /mol
+eight
+reduced FRC
+Two weeks
+pH, temperature, antibody and antigen concentration, and incubation time
+BC
+77.3%
+standard SDS-PAGE and 2DE
+diagenesis
+Loop-mediated isothermal amplification
+IGF-1
+HCV replication
+EV-A71
+Proteomics
+10
+95.1%
+neuroinflammatorymediated
+IL-28B
+clinical trials
+treatment with valgancyclovir
+ablation and cervical conization
+Flavivirus NS2A protein
+bacillithiol
+euryale
+our medical center
+conduction of monovalent cations across the Vpu channel
+Fluorescent quantitative real-time PCR technique
+19,000
+Horizontal black lines
+Wnt3a
+repressed expression
+data variability
+2009
+global
+CEO groups
+stent outer diameter
+ERAD
+different steps of preparation and comparison
+6-12 weeks
+oral immunization
+A1pp
+353
+hilar height ratio
+Contemporary fragmentation of lion populations
+XhoI
+1 h 30 min
+RanBP2
+PON1
+fresh complete growth medium
+Pulmonary
+None
+all three ProSeqs
+standard deviations
+viral RdRPs
+4.82-fold
+sequential multi-drug chemotherapy
+strains that did not transform
+Population structure
+H5N1
+identify
+35823.62 ± 3598.81 renminbi
+non-linear least squares fitting
+43
+ampli®ed DNA
+50 %
+IL13
+tissue collapse
+Equal amounts
+biological, biochemical, and medical fields
+B n
+happy people
+5 h
+integrin expression and cell adherence
+LDHA
+rhesus and pigtail macaques
+mortality
+Splenic viral loads
+eight years
+zymosan
+second-trimester pertussis vaccination
+enteroendocrine and immune cells
+30 min
+p38 MAPK signaling
+functional and phylogenetic intraspecific and interspecific components
+Cryptococcus
+increased pathogen incidence
+k 3
+the way in which Emergency Committees develop their advice for the Director General
+viral loads
+Low ROS concentration
+2017-01-03
+clinical signs and symptoms
+host apparatuses and cellular processes
+increases PR8-specific mucosal IgA levels
+antibodies
+rabbits
+genetic diversity in the host population
+regularization
+blocks the antiviral effects of ISGylation
+five
+Appropriate ratios between staff and children
+100
+bacterial colonization epidemics in military
+A bistable area
+SLEV
+The selection of optimal immunogen
+apoptosis and necroptosis
+1.5%
+serum ferritin
+showed no improvement of disease outcome
+A g i
+all packaging elements
+acute respiratory distress syndrome
+smallpox transmission
+correct trafficking of peripheral proteins
+24 h
+validation of specific reference gene
+alternative immunization strategies
+Corticosteroids
+variable posttranslational modifications
+PEDV
+Re]
+promoting good community hygiene
+GFP-Trap agarose beads
+IL-12p70
+30 minutes
+C-reactive protein
+there were no significant differences between any of the time points
+rhinovirus
+0.26-0.88 pmole DNA/1
+Better lungs compliance and larger proportion of recovered functional lung size
+SPSS
+host erythrocyte
+90
+Filamentous phage particles
+viral dissemination medium
+the public
+Respiratory specimens
+30
+49
+3.5-fold
+Ifitm1, 2, and 3
+32
+National Center for Biotechnology Information GenBank database
+over 20
+six
+Acute renal failure
+bias
+DeBosT script
+directionality theory
+carbohydrate
+animal-vector-human interface
+13
+solid circles
+epithelial cells
+subtype B
+Retroviral vectors for expression of IFITM1, 2 and 3
+homology analyses
+Helper T-cell response
+the size of the bi-stability window
+anticipation
+effective responses
+greater depression, impulsivity, risky behavior, and aggression
+dynamic temporal
+heavy edges
+false positive rate
+Nine
+siNP
+Emulsion
+March
+low GC%
+paired sera
+9 days
+to prevent death of the host cell
+within or just outside of the D-loop
+6
+individual consent
+phylogenetic methods
+19
+four
+Docking experiments
+heart failure
+λ
+transient interactions
+480 × 10 6 / L
+Viruses with RNA genomes
+Production of type I IFN
+CAIX expression on bile duct epithelial cells
+Natural Killer cells
+30 min
+Spo0A
+10
+Protein expression
+Quantitative indicators
+6 months
+6146
+20%
+greatly reduced
+linear mixed-effect
+10 copies/reaction
+HFRS incidence in China
+1%
+56SDS sample loading buffer
+65% protection
+shifts into different families of dipteran vectors
+A, B and C
+pneumonia
+all the proteins included in at least one subject-specific signature
+USP18 C61A/C61A mice
+strong positive selection
+model projections
+replication
+0.1%
+Promoter context
+experimental strategy
+KLF4
+Staffed beds
+frameshifting
+altered appetite or vomiting
+Path model analysis with maximum likelihood
+0.738
+24 h
+Phosphorylation of eIF2
+548
+PBMC specimens
+Evos
+C and D
+764
+LPS
+MDCK cells
+The Institutional Ethics Committee of Tangdu Hospital
+Lentivirus
+2005
+equipment shipping and data management
+membrane fusion
+E488 and E491
+vaccinating whole households
+false-positive results
+more than four thousand
+cytosolic
+β-actin
+buffer substitute for NPs
+4 weeks postinfection
+238.439
+viral genotype status
+72 °C
+once
+NADPH oxidases and mitochondria
+seven
+large sampling intervals and high transmission rates
+leadership
+Accession signal
+bactericidal antimicrobial agents
+respiratory tract
+10%
+cough, sputum, and chest pain
+The structure of these networks
+precise HA0 cleavage
+Magnetic bead separation
+genetics
+1000
+transcriptional activation of a p53-responsive reporter construct
+penetratin
+45 min
+5 0 -ppp
+a single mouse
+17 hour
+8
+Egr-1
+compounds
+48
+favipiravir
+immune evasion and suppression
+Specific humidity
+cFLIP
+low
+SIgA
+polyvalent
+2003
+attitude questions
+China1
+1892
+Montreal Acute Hepatitis C Cohort study
+IFN-λs
+de novo
+All data pertinent to the cloning process
+three
+exo-hASCs
+fetal myoblasts
+Gateway™ destination vectors
+pcDNA3.1-HBc
+outer sequence space
+inherent complexities
+NetNGlyc 1.0
+measurement of immune mediators
+ARDS prognosis
+6 min
+giving more detailed information about the biological context of the respective motif
+Native VLPs
+polymerase chain reaction
+5%
+expression of genes involved in cell cycle progression
+arachidonic acid
+Ultrasound images and videos
+better PPV or NPV
+one
+SEQUEST software
+Finding a live virus in a healthy bat specimen
+Supervision and feedback
+Potentiometric
+3.4%
+Guidelines for use of personal protective equipment
+rotavirus infection
+T. cati
+Van and Dogubeyazit
+analytical sensitivity and specificity
+Flow cytometric
+systemic anti-IL-10R blockade
+dry-blotting system
+macrophages and lymphocytes
+250 ms
+Dura chemiluminescent substrates
+15 min to 18 hours
+28
+320
+reproducible quantities of vaccine antigen to the dermis
+Streptococcus pneumoniae and Haemophilus influenzae
+48 hours
+to improve cell attachment
+protein metabolism, cytoskeleton, and apoptosis
+environmental exposure to lithium
+Harbin04B
+MYY
+eight
+VILI and worse outcome
+Germany
+3 μg RNA per sample
+low cost of an ED visit
+Psoralen
+Sharan et al.
+Combination strategies
+SHIVIG
+The damage of TJ
+degree distributions
+39 kDa JV 2C protein
+96
+4 h
+a DxxxLV motif
+5 -3 direction
+1997
+CPPs
+516 bp
+flow cytometry
+8.3 %
+tissue culture isolation
+using the two expression systems
+SCD buffer
+NPC1 protein
+1000, 800, 600, 500, and 300 nts
+DAVID and UniProt
+Kpax2
+LC3B localization to autophagosomes
+Highthroughput shotgun mutagenesis
+trained interviewers
+The edges in the PGRN
+eIF4G and PABP
+The topology of the reconstructed tree
+knockdown of GADD34
+7
+twenty-four
+waterdamaged homes
+genotypic fingerprinting methods
+1.5 h
+hemagglutinin
+disturbed normal physiology
+three
+influenza
+membrane oxygenator infection
+teleconference and/or e-mail
+grown enormously
+May 8, 2015
+acute infections and chronic infections
+strong mucosal and systemic immune responses
+caricatures of actual social structures
+β -actin and GADPH
+Pulmonary microvascular endothelial cells
+χ = 1
+uncertainty of alignments
+Similar results
+Sec16A
+0.2
+1
+10.1155/2014/654712
+restriction enzymes
+Diagnostic equipment
+50 %
+102
+74 µg/g FW
+elderly persons
+streptavidin-biotin amplification step
+Chi-square or Fisher's exact test
+Hemera Biosciences
+species-specific hemoglobin capture
+Chonbuk National University
+MNV infectious culture system
+lipopolysaccharide
+tumour necrosis factor-α
+alanine aminotransferase
+BMI
+surprising results
+93
+two hours
+PIKfyve
+tissue damage
+273
+48.1%
+12/1,000
+5
+The image
+Kruskal-Wallis test
+over 300 y
+arenavirus
+G43, I44 and G123
+The corresponding authors
+14
+CD8+ lymphocytes and NK cells
+explosive injuries
+72%
+The last 28 kb of the prophage genome
+1.5 ± 0.1
+mRNA expression
+IFN-β
+dTDP-43 protein levels
+70%
+H60 and Mult1
+how viral infections influence the host response
+Müller glia
+Ͻ0.05
+logarithmic
+distinctive evolutionary and transmission dynamics
+pathogenesis
+phenylalanine
+our method
+CH25H
+nucleolar interior
+Dropout strategy
+a tool
+85%
+degraded
+viral sharing between humans and all mammals
+E. coli BL21
+168 h
+7% to 9%
+IL-21
+Dulbecco's minimal essential medium
+Clostridium difficile
+psoriasis, asthma and inflammatory bowel disease
+24 h
+red blood cells
+12
+33/170
+108
+occurrences of LD
+7
+flavivirus
+48 h
+Any matrix similar to a symmetric matrix
+four
+DNA samples
+5 min
+1918
+Viral RNA-specific probes
+children and educators
+Each random set of parameters
+molecular functions and regulatory pathways
+Nine
+American Type Culture Collection
+the chief thoracic radiologist
+H7N9 virus
+B lymphocyte and other inflammatory cells
+75
+Three or more calves
+septic shock
+public health managers
+comp107981_c1_ seq2
+in vitro transcription using templates
+chemotactic guidance
+analogue
+the GB
+ATG7
+X-ray computed tomography
+multiple periods
+H 2 O 2
+Secondary structure elements
+proteases that recognise motifs that are absent in wt NSs
+SF162, VI 1888 and 92RW009
+10.1017/s0950268820000254
+BCL11A
+120
+Thirty-one
+Fig 5D
+Further studies with larger sample sizes
+fungal fragments
+lower respiratory tract disease
+M. pneumoniae and IBV
+highfidelity
+Molecular docking
+Sequencing
+January 2008
+quantitative PCR
+Twenty
+release
+30,000
+increased
+1:20,000
+Inspection of the median and IQR of the y-inflection point
+Evolution
+Protein folding and response to stress
+fusogenic
+ciliary motions
+10
+NK cells
+Polly Roy
+18-20 hours
+70.4%
+Sequencher 5.0
+five
+vacuette tubes
+chest X-ray
+sophisticated
+relative node depth
+antileishmanial
+acetylation
+western blot
+no disruption to their shape
+four
+memory cells
+missense induced MCADD
+host proteins
+Type II
+The data
+Proteasome inhibition
+effective medium theory
+reactive oxygen species and ozone
+macrophage and neutrophil recruitment
+higher infection rates
+outcomes of infants in the NICU
+temporal trends and harmonic terms for seasonality
+a larger epidemic size
+aerosol transmission
+extracellular matrix protein production
+12 %
+Nine
+Ficoll density gradient centrifugation
+Four
+PBS
+14%
+tolerability
+100
+glycoproteins
+basic virus transmissibility
+protein a sepharose
+ρ
+more consistent
+93%
+targeting Bid
+acontextual, readily exchangeable 'units' of information
+splenic macrophages
+1-3%
+guanylate binding protein 5
+murine McCoy fibroblast cells
+5% hydrogen peroxide or 70% ethyl alcohol
+variations in sample size
+mosquitoes
+drowning effect
+= / ).
+1 µg total RNA
+an alternative frame
+14-days
+ER stress inducer
+the guanine in strand 2 is replaced by an adenine
+necessary for activity
+50%
+mutually consistent
+13
+LOF
+Colony collapse disorder KBV
+detrimental consequences
+KEGG
+four
+Cyclin-dependent kinase 2
+the type of agent and the method of its release
+UAP56/BAT1
+operator variability
+demographic characteristics and severity of lung injury and overall illness
+RNF125
+M <
+the area under the receiver operating curve
+lack of information
+2.39
+high sensitivity
+sphingolipids
+long-term effects on workers' health
+13
+1TAE-Mg buffer
+SR proteins
+0.64
+academic purposes
+rare human serotypes or non-human serotypes
+therapeutic
+acute respiratory distress syndrome
+Sanger sequencing
+the patient
+Arg-Ser
+age-, and in some strains also gender-dependent
+the hospital billing office
+Duck enteritis virus
+therapeutic studies
+regulation of RNA replication and virus assembly
+rabies outbreak samples
+synergistic
+HGF, FGF-basic and VEGF
+residue 4
+85
+6.4
+APACHE II, SOFA, and MOSAIC methods
+study personnel
+Gancyclovir
+Réunion Island
+Gene-start
+100 µL
+cell culture samples
+E. faecalis
+virus transmission strictly based on epithelial modes
+infectious pulmonary tuberculosis
+phase contrast microscopy
+5 μl
+TTF-1
+the transmembrane region of NPC1
+partially missing data
+assembly-defective Gag multimerization
+>60%
+Nano-immuno stimulators
+isoxazole
+35
+20 μ L Protein A/G Plus-agarose
+Three
+30
+15
+PrimeScript TM II 1st Strand cDNA Synthesis Kit
+Twenty-seven
+One unit
+50 beats per minute
+119
+85%
+cRNP formation
+IDO activity in astrocytes
+black grain
+pKa groups of the side chains
+GMTs
+evolution
+BigDye Terminator v.3.1 Cycle Sequencing kit
+homology-dependent methods
+2054
+Pairwise interactions
+IRF-1
+6-Azauridine
+housekeeping proteins
+Fuji LAS-4000
+30 minutes
+11
+cloacal swabs and blood samples
+a technique that allows a computer to recognize and analyze human language
+959
+individual records of all hospital stays
+50 pmol
+fecal samples
+24 hours
+primary targets of the underlying pathological processes
+centrifugation
+Antioxidant activities of the extracts
+Australian and New Zealand Intensive Care-Research Centre
+not being better informed about diseases
+endemic prevalences
+splenocytes
+external validation
+three
+Two microliters of sequencing reaction product
+BP-MS
+interaction with an ICAM-1-like molecule
+senescence
+acute kidney injury
+DAMPs
+apoptotic
+isolation and quarantine
+24 hrs
+the switchover position on the receptor RNA
+1,232
+effective long term inhibition against influenza A virus replication
+an HA tag
+force-field-based methods
+0.2 μm
+an extra translation product appeared
+two
+Leptopilina heterotoma
+graphdistance
+airways
+AgI/II proteins
+mitogen-activated
+muscular training
+SSM or LSQ
+level 2 biocontainment facility
+contact avoidance
+popular internet sites
+Treatment at 24 HPI
+phospho-Tyr
+The diagnosis of PRRSV infection
+weak signal intensity
+E. necator DNA
+two tetherin variants
+ORR
+Secreted LOX
+Aversive
+bicinchoninic acid assay
+Partial BglII digestion
+toxin domains
+astrocyte
+differences
+late endosomes and lysosomes
+Two
+four
+Global budgeting
+read-through of premature stop codons
+Hemolysis
+ENC
+diaminobenzidine dye-kit
+50 ml
+T cells
+Carrageenan containing nasal sprays
+computational subtraction
+dendritic cells
+high efficiency and stable knockout
+means ± SD of three independent determinations
+sensitivity analysis
+to induce a strong ER stress response in mosquito cells
+Global Virome Project
+Monitoring heparin regimen
+10.1371/journal.pone.0138138
+Edward Jenner
+10.1128/mra.01085-19
+multiple Br U residues
+viral evolution
+further analysis
+TBK1
+knowledge about glycan-binding properties
+two
+H2-Q10
+16 hours
+German hospitals
+Protein Sciences Corporation, Meriden, CT, USA
+2,253
+FIB-SEM
+Additional scenarios shaded grey
+in vitro assays
+the urgency needed for guidelines to be developed
+S n
+gene expression level and codon usage bias
+attenuates
+hexadecane
+several hundred
+E15
+53
+7 days
+EMCV and CV luciferase expression
+withdrawal of care
+90%
+20%
+over 4000
+71625 ng/ml
+35%
+an additional method to assess DNA repair capacity
+Positive reaction
+26,895
+DI/II H244A
+Applying machine learning techniques
+nine
+intracellular stores
+activation of the cascade systems
+new strategies for controlling FTLSV
+Candida and Aspergillus
+L.inn::vgc infected mice
+Large felid leukoencephalomyelopathy
+to formulate protein sequences
+Colour intensity
+fourfold
+0.5%
+more complex
+increased AR expression
+Protein-protein interaction patterns
+c n = C n /M n
+serum samples
+28%
+Nuclear Extract Kit
+kindergartens, primary and secondary schools
+hegemonic neoliberal socio-political pressures
+vasopressin and analogues
+Pathogenic
+LRF regulation of a truncated MBP promoter
+MD progression
+520
+Thermo Scientific
+puromycin
+Statistical
+p 1
+twice
+RHPA pseudovirus
+three
+95%
+11 respiratory RNA viruses
+reporter-expressing pseudoparticles
+Three
+29%
+TMPRSS4
+40-90%
+Lung and kidney
+XDS
+structural standards
+The height of the patients
+head-to-head
+CD4 T cells
+degree distributions p and p
+29
+S 0 and S ∞
+zymosan ALI
+15
+Pneumonia
+hospital acquired pneumonia
+16.9 o C
+Humira
+activating PKD2 and p38 kinases
+peptide sequences
+monitoring of those emergent strains with a shorter infectious duration
+The interactions of bacteria with the cell-expressed receptors
+tobacco control, sexually transmitted infections, Aboriginal health, and vaccination
+decreased viral load in hepatitis C virus infection
+Attribute weighting models, artificial neural network, deep learning, and decision trees
+16
+10 min
+Inactivated vaccines
+dalargin and PEGylated nanoparticles
+Drug-induced haemolysis
+Image J
+Reads with multiple reported alignments
+processing speed and sensitivity
+South-to-South migration
+relevant email contacts
+biological
+dry AMD-like pathology
+64.1%
+Reactive astrogliosis
+ΔG u 0
+how their driving, and thus their fuel consumption, impacts the environment
+simultaneously identify and subtype multiple respiratory viruses
+100%
+multidrug resistance
+20 days
+upregulation of Mcl-1
+4¢ 6-Diamidino-2-phenylindole
+adenovirus VA1 non-coding RNA
+Ahlquist
+FPASSA
+38
+inhibit
+flux balance and downstream routines
+Altered PR dimerization kinetics or activity
+skin and fur
+3 hours
+9
+27 June 2016
+RBC transfusion
+Microstrain
+Ca2 + -dependent
+summer and in the winter
+262
+viral
+monoclonal high affinity memory B cells
+0.05
+A421V
+Lysosomal dysfunction
+proteolytic
+preparing
+albumin levels
+MASCOT 1.9 search engine
+aged domestic and non-domestic cats
+Pneumonia
+350 ± 110 nM
+enzyme labelled immunocomplexes
+6 NU50CK000410
+zone of inhibition
+semi-quantitative
+Immunosuppressive therapy
+HIV
+docile behavior
+ISPM-36
+one year
+Cumulative NO release total
+6.6
+December 31, 2019
+8 four
+Prospective trials
+30%
+cardiac protection
+50%
+220-234 and 267-276
+consistent estimates
+Ranksum
+Chest/abdominal/pelvic
+sodium sulfite
+noteworthy
+Norovirus
+14
+Abundance
+aerosol or respiratory droplet transmission
+developing anti-cancer drugs
+DC
+Nineteen
+every two weeks
+200.6%
+nasal mucosa, lung, and brain
+20-30%
+0.787
+N-glycosylation pathway
+robust z scores
+198
+five
+cDNA derived from 20 ng total RNA
+complete knowledge of pathogenicity and deep research of efficacy
+white powder
+Statistica
+viral capsid proteins
+limited drug supplies
+population entities and mixing groups
+Correlation analysis
+to allow the calculation of topological properties of phylogenetic trees
+a cluster file generated using 270 samples from Hapmap2
+blockade of Ang II action or Ang- supplementation
+Significance
+shoot regeneration
+BioEdit software
+E-E dimer
+RBC transfusion
+75.25%
+all the class V, D and partial class R nodes
+different methods
+acts as an inhibitor of Nox assembly
+national and/or local organizations promoting animal welfare and responsible pet ownership
+late 1990s
+mucosal splashes with saliva from primates
+torsional restraint model
+Urine samples
+plaque assays and qPCR
+vaccination records of pilgrims
+76.8%
+10 to 70%
+facemasks
+a series of mass/charge ratio peak clusters
+AT-II cells and Club cells
+Nucleoli
+Monophosphoryl lipid A
+33
+Hemocytometer
+each modeler focuses on an individual area
+65%
+7-12 days
+Sir William Leishman
+within the epithelium
+more than one state variable
+acetylcholinesterase
+27.5%
+TLR9
+hemagglutination inhibition
+active infant immunization
+point-of-care lung ultrasound
+homophilic interactions between fulllength CEA proteins
+45
+hybrid -physical/digital -strategy
+Institutional Animal Care and Use Committee
+alleviating rheumatoid arthritis
+epoxygenases
+nontuberculous
+Fisher's exact test
+Normal distribution of data
+primary mammary epithelium
+HA16-5 and NZ-M16
+Aneurismal subarachnoid haemorrhage
+haptoglobin and apolipoprotein A-I
+When all inclusion and exclusion criteria are verified
+sample clustering
+Ads
+56 years
+Speed of deamination
+6 h and 18 h
+47
+ER stress pathways
+oil-degrading community members
+Antibody-mediated passive immunity
+viroplasms
+Twenty-eight
+vector-induced insertional mutagenesis
+5%
+Baptist Missionary Hospital
+98
+coelenterazine-h
+temperature, relative humidity and absolute humidity
+a week
+the discontinuation of drug therapy
+5 minutes
+HMBS
+GGA
+Human bronchial epithelial cells
+knowledge
+1,245
+urinary vanin-1 and NGAL
+Dendritic cells
+Table 1
+1 h
+which actions to take and when
+central China
+Mongolia, China, and Africa
+advanced PCs
+48
+an expanded tRNA pool
+27
+wild-type FUS
+20%
+10%
+endothelial function
+heparan sulphate and chondroitin sulphate
+ribosomal biogenesis pathway
+alveolar
+7.0
+Mutations within the WT GPC
+Biospecimen research programs
+Costar Highbinding 96 well plate
+Arg50
+the police
+limited receptor distribution
+SMP values and medical comments from doctors
+4
+passage through the late endosomal compartment
+RT-qPCR assay
+poorly understood
+Hawkes process and the Bellman-Harris process
+five
+active site water
+anti-and pro-phagocytic
+the foreign gene
+SDS 2.2 Software
+Sf9 cells infected with NPC1 domain A baculovirus
+17
+Discovery Studio 2016
+translational medicine
+added restriction enzyme sites
+RBC lysis buffer
+emergency medicine
+chronic inflammatory
+SARS and H5N1/97
+RNA
+CAPN1, CAPN7, CTSL
+transcriptional mechanisms
+LC3
+Levene's test
+Crucell
+8 days
+Bio Med Central
+Viral-induced cytotoxicity
+six
+345
+Cytoplasmic leakage of cathepsins
+effectiveness of the 2014/15 influenza vaccine against the A epidemic strain
+DNA/RNA shield
+transmission, establishment of sustained viremia and disease development
+specificity adaptors
+death
+CALCR and ADIPOQ
+Further information on research design
+increase control over the viral threats
+Rapid depalmitoylation
+bright field microscopy
+eleven
+by consensus and a third reviewer
+Five
+Renal involvement
+N = 6056
+long-term risk reduction
+17.0
+shorter
+Antigen/peptide specific immunotherapy
+3'-to 5'
+bacteria, fungi, protozoa, and viruses
+integrating these experimental resources
+40 out of 64
+false spike of reports
+malignancy
+two
+late stages of flux
+dilute suspensions of cylindrical rods
+downstream procedures
+waypoint stations
+Aspergillus fumigatus
+61
+Cross entropy
+within the structural coding region of the viral RNAs
+changes migration
+ISGs
+inflammatory
+amplify sequences spanning different exons
+respiratory failure and mechanical ventilation
+intravenous
+53.4% identical
+Radix Salviae Miltiorrhizae
+two
+Hemorrhagic fever with renal syndrome
+logarithmic values
+ZIKV
+Worksite immunization
+Deleting two different regions
+a toxin
+pCMV-Myc vector
+RNA tertiary interactions
+Eluted DNA
+overexpression analysis
+yellow
+Chicken Line 15I5
+fever-CT and fever-DR
+0.9%
+40
+within-host spatial structure
+type II
+17
+finding an appropriate immunogen
+12
+35 mm glass-bottom
+almost 60 years ago
+phycodnaviridae
+2% agarose gel
+SOFA scoring
+Bio-metric data systems chip
+Welldesigned
+excess monthly all-cause and respiratory-related deaths
+Nsp2
+hypoglycosylation of LASV GP
+low pH
+total RNA of synchronous parasite culture
+Laboratory tests
+PC5-2 bound to NSCLC cell surface
+one
+dendrograms
+N220HHDpBudCE4.1
+preventing contrast-induced nephropathy
+humans and swine
+HIV-1 protease
+Mesenchymal stem cells
+-3.34 Å to +3.68 Å
+Enrichr and STRING
+18
+2 months
+μ
+tubulin or actin-related components
+The spectrum of ThT alone
+N phi and N pho
+Gadolinium
+SAC j
+gentamicin
+Astrobiology
+ferrets
+PRBCs and WBCs
+full genome sequencing
+Respiratory syncytial virus infection
+85
+secure
+Serum samples from 77 healthy volunteers
+MS8MS8/RF3rf3
+BL21 Rosetta pLysS strain
+accuracy
+84
+219 to 221 amino acids
+USP18 C61A/C61A
+kinetic
+anti-inflammatory
+high control
+Jumia.com
+disease surveillance
+greater than 0.99
+12
+human FccRII
+overspecificity
+2MEM
+survey design and sampling weights
+67
+counts the occurrence frequencies of all 16 segments
+0.3%
+NanoTemper NHS NT-647 labeling kit
+10%
+Mycoplasma gallisepticum and M. synoviae
+generation of negative and positive ions
+12.5 mg
+Scores
+introduction of vasopressors
+antiinflammatory and immunomodulatory approaches
+decreased
+existing literatures
+systemic thrombosis, emboli, or circuit clotting
+bat SARS-related coronaviruses
+heart failure
+IgM natural antibodies
+10%
+Drug efficacy
+375
+five
+1,894
+Ginsenoside Rb1
+stakeholder vetting
+wheat, maize and chicken histone H4 genes
+F 2
+medium
+DIVA-GIS
+5%
+health-seeking behavior
+Sangon Biotech
+avian influenza A virus
+NNAlign
+preexisting disease
+chicken cells
+13.7 ± 5.7 weeks
+18%
+follow up and referral services
+15%
+notification database
+human reactions
+threading algorithms
+Normalized Shannon Entropy
+ApaI digestion
+135S-like particles
+HTLV-1 protein expression
+uniform cell population
+infectious diseases
+silkworm chrysalis ingestion
+graphically
+Immunoblot
+a pair of eigenvalues
+prematurely entering S phase
+X-ray diffraction data
+biochemical
+increased substantially
+four
+The site of onset and distribution of involvement between UMNs and LMNs
+Toll-like receptors
+Geminis 2-8
+Cuba
+patchouli alcohol
+8 min
+−80 • C
+χ 2 -or Fisher test
+actin-dependent
+1 h
+Red button formation
+rod-shaped
+until transmission drops to low levels
+RPA and PCR
+time
+3.7%
+Coxiella burnetii
+S100 series molecules
+TC-1 cells
+1.23-1.42
+P. falciparum strains
+stem-loop
+A protein
+Guidance
+standard deviations of the mean for each group of mice
+Kriging
+variability
+78.3% and 58.6%
+protocol adherence
+conformational states
+lungs
+45%
+tuberous sclerosis 1/2 complex
+alpha herpesvirinae
+World Association for Disaster and Emergency Medicine
+orthologous
+1 day
+3.7
+disease model
+epithelial cells
+conjugating enzymes
+Cultures supernatants
+heuristic
+10 pN
+67% c
+5% skimmed milk powder
+the protection of human subjects
+three
+unique exosomal profiles amongst cell types
+95% CI
+60-90%
+a facultative intracellular microorganism
+statistically significant interactions
+GeoChip 2.0
+fever, fatigue, and muscle ache
+Tumorigenesis
+AMPK
+Vaccination and intensive care with artificial ventilation
+18S rRNA
+tick-borne encephalitis
+6 months
+fifteen
+IFN-α signaling by specialized myeloid cells
+0.1 µl
+UTRs
+0.21 -1.50
+sea surface temperature
+Encapsidated pH1N1 RNA
+Thirty-three
+skin and eye tissues
+Hemagglutinin
+NAC-CESS
+flow cytometry
+high-density oligonuclotides microarrays
+Clusiaceae
+Infarct and border zone tissue
+glycoconjugate
+highest level
+vaccination
+enzymatic
+3a-d
+10 8 50% embryo infectious dose per ml
+7.4 and 7.1
+NAbs
+28 days
+culture supernatants
+2-3 s
+Sample volumes
+Acquiring detailed movement information
+edges
+outbreaks
+αA-crystallin
+Three
+Purified viral DNA
+HIV-1 nucleotide sequence data
+rpoB
+hind paws
+rhinovirus
+The optimal concentration of primer and probe concentration
+95
+Toremiphene and clomiphene
+summer of 2012
+446
+H1 NC 99 and H5 INDO 05
+K48-linked polyubiquitinated PCNA
+TRIzol
+E. ovinoidalis
+K114A, K115A, and K140A
+6 million
+L-arabinose
+His-tagged gHA1
+polymeric
+those mediating the protection
+2001
+boys
+4%
+small horizontal lines
+inflammatory cytokines
+AHR
+CFTR
+3
+PB2
+1.33 billion
+Polyadenylation
+26,747
+Fasta-Format
+SIS
+FUS has little charge
+Equal amounts
+HO-1 and β-actin
+dosage-dependence
+treatment for a secondary bacterial pneumonia
+significance
+12
+structural changes
+48 h
+scientifically
+3,000
+OATP1B1-mediated
+FRT, IEL, and LPL
+three
+investigational influenza vaccines
+50 μL of Ultra-Pure™ DEPC-Treated water
+A panel of short peptides derived from P5
+PR and ROC
+DTNF1 to DTNF7
+Mathematical models like InfluSim
+viruses and tumors
+Z-FA-FMK
+tiletamine and xylazine anesthesia
+112
+100%
+NLR family pyrin domain containing 3
+local translation of ACE2 in affected organs
+IFN1
+% GI covered
+Affymetrix GeneChip Porcine Gene 1.0 ST Array
+observed incidence
+chronic oto-sino-pulmonary
+virus
+Ad endosomal escape
+an experienced expert
+Amplification of the expected products
+Four
+nine
+ILI
+20 %
+Targets binding
+DNA-binding hairpin pyrrole-imidazole polyamide
+viroplasms
+10
+capturing all methods used by public health
+CypA
+ORF3
+rDNA promoter methylation
+caveolin-1
+Logistic regression
+H7N9
+SPSS 16.0
+The name and any other identifying detail
+VSEL images
+Hopelessness
+key temporal trends in polio incidence
+the Golgi
+walking and running abilities
+11,260
+Pten PCR products
+by adjusting ventilator settings
+2,200
+Companion animals
+gene expression
+host cell kinases
+higher opioid affinities and lower titers
+apoptosis
+fear of infection and illness
+MICRO-CHECKER 2.2.3
+Rv0341
+subtype C viruses
+bioterrorism
+0.2
+25 µL of the PCR master mix
+,1
+significant difference
+RNA replication
+lack of laboratory resource capacity and technology
+60 min
+Eq 1
+circular dichroism spectroscopy
+1225
+FIV Ple subtypes
+SDs
+unequal rates of evolution
+intraspecies
+immunogold labeling
+glutinoic acid dilactone
+all the eGFR equations
+IMOD
+chromogenic LAL endotoxin assay
+Clinicaltrials.gov
+92
+30 days
+GTP binds to the open form of the enzyme
+replication proteins
+Respiratory Unit
+castor
+37.88%
+attachment factors
+fast and opportunistic colonization of new niches
+disease
+Griffithsin
+eight
+PLP2 -strepII
+S. haematobium
+host response
+50 μl frozen stock
+RNase L ankyrin repeats 1 and 2
+efficiency of epitope processing
+The requirement for glutathione
+One day
+World Health Organization
+PrimeScript RT reagent kit
+labile colostral factors
+TNFα, IL-8, and MCP-1
+crosstalks between MAPKs
+IFN-γ
+C5L2
+adherent
+Tuning appropriate host response
+RNA binding proteins
+infectious pulmonary tuberculosis
+Drs. Kouacou Konan and Takaji Wakita
+many resources
+Efflux measures
+three months
+Sensitive survey research
+Receptor-ligand pharmacophores
+resistance-associated polymorphisms
+43
+5%
+cell-intrinsic control of intracellular infection
+4
+biotynylated anti-Ly-6 G antibody
+20%
+bibliometric analysis
+innate immunity
+monogenic
+Consecutive sites of inhibitor incorporation
+Folding of the peptides
+activated/transitional
+sheath and core
+increased mortality, weight loss, and pulmonary dysfunction
+21 days
+Linearity
+transcription factors, kinases, and ubiquitin E3 ligases
+Listeria species
+PAN
+57
+17
+unit cost data
+sequential
+2011
+idiotypic network regulation
+2 hours
+The study statistician
+substitution on cationic groups
+work will be stopped immediately
+5.8 days
+safety, specificity, and usability
+Anti-H9N2 mouse serum
+69Á5%
+final editorial amendments
+delivery of the polymerase genes by virus infection
+Th1
+García and colleagues
+Noteexpress
+2-3 million
+aptamers
+Epidemiological criteria
+1000-fold
+chickens
+when the estimator is not on the boundary
+travel time
+Microcirculatory dysfunction
+quarantine-free with mass action incidence
+Receptor-negative cells
+Identification of drug-target interactions
+risk
+MSCVH and MSCG primer mixes
+prognosis and diagnosis
+90%
+four conserved long imperfectly repeated sequences
+intramuscular
+70.7%
+79.7 kDa
+12
+bacterial coinfection
+20
+ferrets
+autophagy
+immune-surveillance escape
+Total RNA
+zoonotic viruses
+control reproduction number
+temperate staphylococcal phage 80α
+air-liquid
+a specific corneal layer
+viral shedding
+student's t-test
+T. gondii-challenge
+50
+Acute gastroenteritis
+20%-30%
+B. bronchiseptica
+MHV TRS
+20,000 per well
+30 min
+Two to three
+inflammation
+accessory functions
+Livedo reticularis
+JX978431 and U95501.1
+all proteins quantified
+virus-encoded
+competition assay
+everyone
+McCoy's 5a medium
+Clusters of dystrophin-positive fibers
+Albany model
+9-20 Å
+Tied values
+HCV RNA replication
+10000 FFU F-MuLV in RPMI
+phosphorylation dependent dimerization
+survival experiments
+nucleotide identities
+DICE
+1 minus the confidence limits of the relative risk
+30-40
+hands
+4% formaldehyde
+577
+control group that was treated using only a roaster machine
+cosmetics
+severe infectious diseases
+Fiji
+Proteomics
+dispersal
+Strain difference between field virus and vaccine candidate virus
+stochastic individual-based model
+21
+low HR variability punctuated by HR decelerations
+short circuit current
+six
+$85%
+experiments
+τ ij
+23.8%
+superoxide radical
+future external validation
+2007
+herpes genitalis
+full social networks at participating school and households
+colorimetric substrate
+ω-O-acylceramide
+GBD cause categories
+sizes
+18 hours
+CYBB
+dysfunction in epithelial tissues
+autocrine IFN action
+2,468
+dicotyledons
+53
+k
+10%
+I7 protease
+import their genetic material to the host cells' nuclei
+immune competence
+5% FBS
+hydrophobic pockets
+54 million
+Spo0A binding
+CD31
+28
+human interactome
+blood-feeding
+SGs
+ConSurf
+22.1%
+scavenging sites
+Protein concentrations
+eNOS
+at the slippery sequence
+Isotype-matched negative control antibodies
+post-processing
+Polyethyleneimine
+health care students and primary care providers
+15.2%
+fusion and cell-cell fusion
+PPRV
+encouraging results in the salvage treatment of mucormycosis
+34.6%
+Batypical
+basic hygiene measures
+highly consistency
+various Ca 2+mobilizing mechanisms
+heterogeneities in tree heights
+fibrinogen deposition
+To apply and assess the tools that we develop
+Copy numbers of LCMV S or L segment genomic RNAs
+barcoded primers 27F and 338R
+Pooled serum samples
+Three-day-old fungal cells
+methanol-d 4
+responses
+peptides
+choosing appropriate media channels and determining the best timing for release
+312
+Escherichia coli
+determination of predominantly autocrine IFN effects
+enter cells, migrate to nucleus, bind to nucleoli and induce cell death
+45
+microPET, microCT, and microSPECT modalities
+exponential growth model
+Six
+AGR2
+aspartic acid
+non-numeric data
+Nucleotides G 1 through C 5 and A 111 through A 118
+β-actin
+hemagglutinin
+neutralization or entry/infection studies
+nucleotide differences
+1 ml
+ST49
+80%
+Information gain
+trends
+Feed digestibility
+Cuprizone ingestion
+regression tree analysis
+statistically significant
+Humidity
+6 months
+Twenty μl CM-H2DCFDA
+tracheobronchial
+BepiPred
+antigenic and genetic analyses
+B25%
+Transmission electron microscopy
+20 minutes
+p38 MAPK activation
+three
+Decision tree
+0.2 ng
+GGT
+infect
+six
+the percentage of positive cells
+Cognitive dysfunction
+at least half a century
+mTOR
+Protease inhibitor 6
+0.5% crystal violet solution
+parents of children who were asked to go into quarantine
+Retro-2.1 and compound 25
+intestinal infection
+John Sheehan
+unknown clinical specimens with co-infection
+CAR
+16 hpi
+APCs
+crypt cells
+Infections
+contrast enhancement
+TGFβ
+East African clades
+0.92
+q~0:7
+LYS170-MET179 and LYS265-ASN274
+divergence parameter t
+peri-operative
+improving insulin tolerance
+bcyclocitral
+Univariate analysis
+phospholipids
+C and D
+to curb the excesses of government power
+blood
+HA-and FLAG-functionalized MPCs
+bicinchoninic acid method
+14 days
+daily cumulative doses of dexmedetomidine
+lung damage
+Disaster-resilient infrastructure
+102 cochleae
+parechovirus type 3
+N6-methyladenosine on mRNA
+NS1 protein function
+a linear salt gradient
+other polymorphisms in LD with the studied ones
+pro-apoptotic
+a spray of protonated ions
+Six hundred
+fear of being caught by police officers
+RAN
+flying-foxes
+non-pharmaceutical interventions
+lower values of the transmission rate t
+contact tracing
+ANN, SVM and MLR models
+hemagglutinin and neuraminidase
+1999
+78%
+atypical
+ELISA
+Homologous recombination
+99%
+WHO
+Olympus FluoView FV1200 laser scanning confocal microscope
+AMR
+activate NF-κ B
+48 h
+antiviral Th1 and CTL responses
+30% sucrose
+Grade 226
+tree age, cultivar, and horticultural care
+India
+increased
+luciferase activity
+antigenic mutation of the M2 protein
+Lyon, France
+to ensure the findings are based on a reliable statistics
+5%
+R. rosea
+ketamine and daptomycin
+pulmonary morphological changes
+Protein A chromatography
+multiple imputation
+rolling-circle amplification
+200-250 bp size selected cDNA fragments
+Individual liberty
+NM_013693
+688
+An effective disaster response
+recombinase polymerase amplification
+viremia, provirus load, and blood cytokine profile
+MNs and ZFNs
+Antigenic drift
+calpains and cathepsins
+infecting polarized HAE cultures
+several signalling pathways as deregulated
+LDH
+M1 with vRNA and NP
+catalytic function
+768,195
+Loss of air-blood barrier integrity
+Au-Ag nanorods and DNA cross-linked polymeric shell
+bacterial resistance
+Fever
+James Falvo
+0.1%
+ELISA Kits
+virulent strain
+Type A
+3.3%
+viral transmission to vertebrate hosts
+0.05%
+Peptide ligands
+expression of CD80, CD86 and MHC class II molecules
+Article 7
+20%
+18 million
+10 ml peripheral blood
+meta-analysis
+factorial
+by sequencing
+159
+enhanced
+Forty-five days
+palivizumab
+Mu Mup47
+UVC
+competitive antagonism for the TLR4-MD2 receptor complex
+2000
+4-5 weeks
+viral loads
+Vd and Cpeak
+IFIT proteins
+A & E wards
+lesions in both the spleen and liver
+medicinal
+social distancing
+interferogenic
+caspases 3, 7, and 9
+point mutation in NA
+b
+high SD value
+WR-LUC and VSV-FL
+protective immunity
+cell lysis of CHO-59C cells
+rapid fibrosis progression
+room temperature
+single agents
+PB1 T123A and PA T97I
+antibody testing
+upregulate
+DB32-6
+Sendai
+Meticulous
+visual based selection
+morbidity and mortality
+another cell
+Substrate rigidity
+an alpha helix
+recombinant Scorpine
+high-mannose-type
+Testing for EBV and KSHV
+immunological cross-reactivity
+Cardiac Resynchronization Therapy
+EI and EE aeration of the corresponding voxel
+Controlled studies
+I nfluenza A virus
+The conditions that must be met for such a gene to be discovered
+Adenoviral strains
+ILTV
+Rifampin
+any publication bias
+square root model
+1961
+RNase-free DNase I enzyme
+15-20 pN and > 20 pN
+full-length antihuman PCSK9
+RP-HPTLC
+ultraviolet radiations or redox inhibitors
+ProtTest
+system function
+Ca 2+ ATPase
+age, gender, and job
+molecular characteristics
+Avian influenza virus replication
+Nedd4 family ligases
+85
+unsecured decisions
+PLY and inflammasomes
+symbiotic
+Sample preparation
+1.5%
+EV-71 2A and 3C protease
+antigenicity
+communication and information gathering
+Tukey's honestly significant difference post-hoc test
+CAR + /mPSCs
+clathrin mediated endocytosis
+46
+morphological features of apoptosis
+Ni-NTA agarose columns
+immunohistochemistry and flow cytometry
+Multiple stepwise regression analysis
+South Africa
+Mixing
+VZV prophylaxis
+CPV-2
+BALF protein concentration
+mSAMD9L
+heuristic model
+pDNA-based gene delivery
+TissueScan TM Disease Tissue quantitative polymerase chain reaction arrays
+mature miRNA
+The need for reintubation after failed extubation
+air travel
+cytomegalovirus promoter
+adhere to the medication regimen
+GDP
+phospho-p38 MAPK level
+230 to 1011
+adding relevance to the discovery of novel viruses
+decreased mean arterial pressure and increased vasopressor support
+50 μL
+66
+parts of proteins sharing a common evolutionary history
+distance Gamma distribution
+phosphorylated and thus activated proteins
+organ failure
+qualitative assay
+peptides, supervised classification, bootstrapping, and ROC analysis
+GenePix 4000B Scanner
+15
+adults
+t
+DC maturation
+cc-by
+XIV century
+reactivation of only a subset of the cellular population
+four
+community structure
+562 nm
+epidemiological
+relatively small polymers of amino acids
+strong and engaged network leadership
+adhesins
+ovipository sites
+8
+CITE
+5.4 million
+ACE2
+all data
+36%
+α1AT
+dexamethasone and hydrocortisone
+two
+5′-RVIFLVI-3′
+PhenoSense HCV NS5B assay
+AMPure XP system
+expertise
+4:1
+SU6656-mediated reductions of viral replication
+42
+The Student's two-tailed t-test
+HPLC-qTOFMS analysis of the active fraction
+Transplantation
+0.1%
+luminescence
+Monte Carlo simulations
+interaction partners of MAGE-G1
+Grainyhead
+U937
+four
+optimization of the fermentation conditions
+68
+anti-BMP2, anti-VEGF and anti-tubulin
+FeLV viral RNA and provirus DNA
+GPSbased technology
+brain drain
+ST239
+two-way ANOVA or area under the curve analysis
+route of exposure
+Microsoft Excel
+pGBKT7-BM2C
+other infectious diseases
+ubiquitin-modification
+Qiagen RNeasy mini kit
+eight
+helicase activity
+neutralize or alter the activities of multiple host proteins
+epidemiology
+Non-adherence to anti-tuberculosis therapy
+Cells expressing NGFR
+637
+Vero cells
+lysosomal membranes
+lifespan
+Vector Laboratories
+63
+disease transmission dynamics
+Cytoscape5
+nylonspotted 60 mer oligonucleotides
+Quantitative PCR
+regulating its polymerase activity
+solutions
+stable or transient expression of CIITA
+reinitiation
+44,776
+fluorescence
+r j and r q
+non-parametric Spearman's rank correlation coefficient
+Pip6a-and Pip6b-PMO conjugates
+5.65
+heroin
+Hypervariable viruses
+conductivity
+point-by-point
+0.3%
+Recombinations and mutations
+ca. 15 kb
+Time
+Lack of selective cytotoxicity
+23.5 6 2 kDa
+Biacore T100 Evaluation Software
+Mesothelin
+at the apical pole of T84 cells
+Very few
+significant
+The readings
+DNA sequences encoding the matrix proteins of LASV or MOPV
+Prior engagement with communities
+Antibodies
+2 × 75 cycles
+divergent middle region
+Reproducibility
+velocity
+five
+log-rank test
+King Faisal University in Saudi Arabia
+any of the other two stop codons
+ECLIPSE and COPDGene
+p < 0.05
+Antimicrobials
+sex, prior receipt of seasonal vaccine, or VTEU site
+lost
+B3 days
+protease
+506
+pitavastatin
+MG132
+JEV
+inhibition of VF formation
+core protein
+Interested colleagues
+stable
+every 2 days
+Average Ratio
+Shapiro-Wilk test of normality
+a space
+trained and experienced farm personnel
+NMA
+95uC
+62%
+versatile
+FeLV-positive
+Veterinary thermometers
+DNA or RNA
+394delTT
+Written informed consent and verbal assent
+79%
+a small number of studies
+12 months
+7 days
+significantly elevated IL-13 levels
+single-membrane phagosomes
+32
+less than one-half
+enhancements in stability
+Human respiratory syncytial virus
+deficiency of complement inhibitors
+competition-ELISAs
+Randomised controlled trials
+The itinerary
+Increased severity of illness on presentation
+RNeasy Mini Kit
+FeLV
+Regression analysis
+MBX2254 and MBX2270
+CC-23
+recognition and tolerance
+0.87
+Recombination
+human surveillance systems
+Dilution
+75%
+Professor Rapp
+airway mucus and the epithelial lining fl uid
+Strongyloidiasis
+liver and kidney
+Serial dilution of virus stock
+0.3 mg/mL
+Infectious pestiviruses
+recorded symptoms
+lung and spleen
+lateral associations
+Eighty-nine
+ligand-inducible transcription factors
+death receptors
+Reagents and materials D 2 DR
+prolonged PP sessions
+integrated regulatory networks
+Virus-induced exacerbation
+toxin production
+multivariate analysis
+active heme metabolism
+serology tests
+42
+label
+molecular biology/microbiology subject area and presence of article keyword "hospital"
+Bio-Rad Gel Doc XR system
+tumor masses
+Clue gene ontology and CluePedia
+interdisciplinary and holistic
+SPSS 17.0
+5.7%
+expression of SeV NP protein
+Guatemala
+C3
+close association between HPVs and CD151-enriched domains
+Peptide-driven pharmacophoric hypothesis
+six
+APACHE II
+ZsGreen
+S-palmitoylated
+5
+Total RNA
+Sanger sequencing
+central nociceptive changes
+5%
+Dr. Hung-Jen Liu
+520
+All the dots
+ER membranes and ribosomes
+Three
+1918
+Fifty-seven
+RNA binding
+25
+dimer dissociation constant
+Kaplan-Meier Survival curve
+Alveoli
+Markov Chain Monte Carlo
+fluorescence
+3-dimensional
+protection against respiratory challenge
+tachyzoites and bradyzoites
+data entry and initial cleaning of the data
+brain monitoring of post-CA patients
+4 days
+a rooted, timed, bifurcating tree
+robust mucosal antibody responses
+Cytoskeletal
+Ceres
+reducing treatment costs and cytotoxicity
+99.7%
+clinical disease
+proteasome inhibition
+peripheral CD4+
+STAT1 levels
+Genomic coordinates and annotations
+6 days
+IRF1 genes
+livers, spleens, and head kidneys
+data from S = 100 epidemics
+secondary antibodies
+normalized gene expression level data
+MOIs above 100-200
+melanoma
+M8
+antiviral treatment
+CHIKV pseudovirus neutralization
+87.5%
+5 × 10 6 particles
+tiling arrays
+Descriptive
+viral replication
+28%
+constraints and capacities of locally operating public health systems
+5 days
+Transcription factors
+113
+ANOVA
+advanced quantitative spatially-resolved understanding of HCV replication dynamics
+lncRNA-mediated
+leishmaniasis
+NO
+density-dependent
+NTHi
+f T
+NF-κB p65 protein levels
+challenge experiments
+117
+Chi-square or Fisher exact tests
+seven
+morbidity and mortality
+cc-by
+different origins of lung pathologies
+Helium
+lower mortality
+TCID 50 values
+stronger adaptability to the host
+Thirty-four
+IFKKAG
+blood
+all the tweets in Cycle 42 containing a photo
+9600
+light and electron microscope
+2
+IFN-γ
+conformity without excessive loss of statistical significance
+48 hours
+eukaryotic
+log L*
+biennial
+LPS
+3630
+subtractive method
+Author names
+higher than controls
+Kruskal-Wallis test
+B cells
+60% to 70%
+ACE
+daily
+expression of SPI-1
+pandemic influenza
+every four months
+375
+economic
+a subset of primate CD4 receptors
+Vaccination
+phagocytic cells
+Two
+regulation of host immune responses
+complexity
+The sum of confidences
+157 and 53 ng/mg protein
+plates
+>90%
+A. caninum
+148
+plasmid with different dilutions
+enterolactone
+Molecular dynamics simulation
+diagnosis, procedures, drug administration, and facility descriptors
+pneumonitis
+map coordinates scaled to match the transcript map
+Peak R 0
+mean SI
+Elast-eon E2As
+chromosome 12p11
+To assess the association between growth and breadth of the developing immune system response
+YXXh
+blood, stool and bronchoalveolar lavage fluids
+SBP tag
+Viniferifuran
+failed
+social-contextual factors
+All authors
+construction and rescue
+2%
+pENTR-SH
+N-hydrogen
+bans on unsafe funeral practices and implementing local quarantines
+arenaviruses
+input data
+HRV-A
+tiger
+pre-oxidized, denatured proteins
+250 to 300kbp
+single stranded RNA
+MAb immunoglobulins
+real-time VOC sensors
+PAMGO Consortium
+ducks and geese
+IgM-positive
+1162
+hair follicle
+JTV1/AIMP2
+Bayes empirical Bayes approach
+friendship-formation dynamics models
+PLY
+syncytium formation
+22
+endosomal escape
+CLDNs
+1 in 4
+Sonali Kochhar
+5-10 days
+Propofol
+The Q matrix
+starlet
+ISGylation
+k B T
+10.7554/elife.48401
+HCs
+Expression of simian vacuolating virus 40 small T antigen
+metabarcoding diet studies
+histological
+statistical significance of differences
+no cytoplasmic release of cytochrome-C
+10 mM
+retrospective
+4-hydroxycoumarin
+Zeiss LSM 700 confocal microscope
+Shannon's diversity index
+Volume Control mode
+54%
+Shigella flexneri infection
+Linux
+blocks Golgi export
+COVID-19
+higher rates of hospitalization in males
+awareness
+urbanization
+2.4.0
+EST2
+endotoxins
+higher levels of viral mRNA transcripts in tissue culture
+700, 000
+oxygenation and compliance of the respiratory system
+ARDS
+yellow green
+they tend to be short, degenerate, and occur frequently throughout the genome
+real-time PCR
+translational selection
+Idelalisib
+biweekly
+6 months
+the averaged output of nine neural networks
+six hours
+grp94 and PDIA6
+low computational cost and independency from available crystallographic structures
+Sixty-six
+over 80,000
+molecular targets causal for human disease
+cough, dyspnea and eventually fever
+pathogens associated with STIs
+Two milliliter fractions
+PTX
+Department of Surgery
+5th and 95th
+polarized
+1 μg/ml of DAPI
+19.8%
+16%
+anti-CD4 antibody
+microplate reader
+detection policy
+reversed
+manidipine resistance
+HeLa and Huh7 cells
+twice per day
+SPSS 17.0
+The Bill and Melinda Gates Foundation
+motif-D active-site loop
+to health
+two different concentrations
+recombination between attL and attR sequences
+112
+Frameshift construct and oligonucleotides À1 FS
+impaired assembly and secretion of very low-density lipoproteins
+interpandemic years
+NCI-H460 cell viability
+Mouse models
+a set of genomes with the same nucleotide genome
+ultrafiltration
+Neuromuscular blocking agents
+symptom management
+immunofluorescence
+Table 3
+72 h
+135
+ROS
+Incorporation and the role of host proteins
+nearly as potent
+5,976
+photographs
+Changes in the natural environment
+80.8 mg/L
+Worry
+commercial laying flocks
+5.4 U/g Hb
+H5N1/H7N9 infection is independent of climate factors
+Angiotensin-Converting Enzyme 2
+A
+2 × 150
+influenza replication
+antiviral therapy
+myeloid cells
+85%
+Argentina
+C reactive protein
+public health insurance
+3.6 million flu-related tweets
+two
+modulating secretory capacity either during drug-induced or physiologic ER stress
+Creatine-kinase
+4.3 ± 2.64 years
+develop interventions tailored to specific cultural groups
+RNA extraction from lenses
+minors
+western blot analysis
+inflammatory
+restriction of virus replication
+HIV-1 entry inhibition
+5 days
+negatively affects STAT phosphorylation
+every three days
+75%
+Conservancy
+Lung consolidation
+neutral red staining
+5
+Ebola virus disease
+Airway epithelial cells
+M and NS
+50% of control levels
+destructive inflammation
+Laminins
+NAs
+ACLY
+HIV, and HSV-1 and -2
+Gene specific PCR primers
+35
+kobuvirus
+A/D
+9 days
+Bray-Curtis dissimilarity index
+25%
+Pediatric out-of-hospital cardiac arrest
+anti-PTX3 antibody-crosslinked magnetic beads
+anti-and pro-fibrotic
+the pathway of transitions to State C0
+24
+selective inhibitors
+overestimation of K
+medical emergency diseases
+FGL2-induction
+Mortality
+PTM score
+a comprehensive dataset of all the known MOKV isolates available
+RevertAid TM Premium First Strand cDNA Synthesis Kit
+16
+2-fold
+LD 100 baboons
+12.6%
+Sex and gender differences
+cytopathic effect
+delayed time-to-death
+GTPase Rac 1
+Commuting
+planned behaviour
+severe anaemia
+7.2K
+conoporin
+Stepwise binary logistic regression analysis
+ARVO X Multi Label Reader
+nucleotide constraint
+Efficient replication
+LCMV Z
+patients who received iNO and patients who were managed routinely
+Corticosteroids
+over two weeks
+Zika virus and Dengue virus
+4 and 7
+the sum of the scores divided by 20
+disease monitoring
+Gaithersburg, MD
+Web Appendix 1
+positive association
+LC-MS
+quick
+MKP-1
+62.4%
+37%
+mutated fragment
+LGALS3BP/90K
+Eight
+20%
+FACScan and CELLQuest
+inflammatory
+Tdh2p
+83%
+household size
+unfamiliar
+clinical
+NN-DNJ
+Environmental risk factors
+Verbal assent
+chronic social isolation
+sustained exposure to IFNs
+23
+cefepime or ceftazidime
+respiratory secretions
+Complementary DNA
+green, orange, and yellow
+RM cells
+Transcriptional activity
+SAC55
+plasmacytoid DCs
+important
+Further studies
+Benjamini-Hochberg procedure
+Pneumococcal vaccine
+Chi-square test
+the ER of host cells
+when we consider triples in addition to pairs
+JEVinfected BL/6 mice
+head and ovary
+5
+10 min
+237
+A single ontology
+resazurin
+N-terminal IL2 secretion leader peptide
+40-50%
+17
+1 nm
+canine norovirus RNA
+TUT1
+Phylogenetic and population genetic methods
+Large patient heterogeneity
+antigens
+doxorubicin
+CSFV infection and proliferation
+transcellular biosynth esis
+uncontrolled virus replication and spread
+.71
+oxcarbazepine
+Endometrium p-4E-BP1
+C H 2-C H 3 interface
+dsRNA
+2012
+12.05 per 100,000
+values for the parameters and states
+Akt and PI3K
+pairwise distances
+isopropanol wash
+ouabain
+students individually
+RAG1
+3.7 Å
+dissociation of the SecA dimer
+Bacillus and Lactobacillus
+The proportion of the ribosomal bands
+Nucleotide +1
+RIG-I and TLR7
+PDK4
+eHEV
+ATPase activity
+naïve B cells
+Metabolite-corrected donepezil
+critically ill
+the complement system
+ACE2
+phenol/chloroform
+soluble complex
+perturbation
+Enzo Life Sciences
+18 h
+Hitachi 7100 transmission electron microscope
+17 min
+APCs
+up-regulation
+virus mutants
+H275Y
+membrane permeability
+four
+RABV glycoprotein
+information about their structure, amino acid sequence and functional context
+bit-string representations of molecular structure and properties
+area, race, age and gender
+drug-drug interactions or toxicities
+Sinopharm Chemical Reagent Beijing Co., Ltd
+Social amoebas
+Igor Pro
+CEACAM1-Q89A-Fc
+Gendicine TM and Oncorine TM
+three
+SARS, hepatitis viruses, influenza viruses 16 or HIV
+Source-tracking techniques
+genomic GC skew
+Type III IFNs
+fever
+EM's mortality rate
+type II
+liquid cooling system
+119
+RIPA
+Guinea pigs
+Taqman Chromosome Conformation Kits
+10,639
+Eight
+CEACAM1
+19 years and 57 years
+clinical
+ISGylation
+62
+several
+20%
+116 billion pounds
+40%
+leukocytes
+Culture supernatants
+measurement issues
+epithelial dysplasia
+RPL27-GFP
+Forty negative sera
+twice
+86.5%
+10 trillion
+30 s
+100 per cent
+12-14 h
+DNA vaccines
+stress
+RNA viruses
+biological
+89%
+Influenza A virus
+virologic
+Amplicons
+Blood tubes
+leukocyte transendothelial migration signalling pathway
+TCID 50
+refolding of the pseudoknot after ribosome passage
+7 days
+bird cell proteins
+REML
+10 min
+Advanced Querying Tool
+5,142
+seven
+Community-acquired
+ESV, CYV and MXV
+hly and plcA
+caution
+RNA editing
+Dr. Oliver Schildgen
+20 mL fresh media
+42,918
+16 hours
+Gnotobiotic pig sera
+S. pneumoniae
+2442
+five
+ADAM9 and ADAM12
+normalized reporter value
+4.9 million
+database molecular alignment
+PCR products
+51
+8 weeks
+almost 5 times greater
+15%
+transporter and ion channels
+nanopore sequencing
+highly conserved viruses with two receptor-binding variants
+51.08 years
+residues within the transmembrane domain
+contact networks
+two
+cc-by
+MERS-CoV
+activation of the p53 tumour suppressor protein
+edema toxin and lethal toxins
+An ontology
+Solithromycin Solithromycin
+an entry gate for proteome wide analysis of the virus-host system
+AY628152-69 and AY633510-39
+oxycodone
+nonallergic individuals
+laboratory confirmation
+3:1
+T
+plain buffer
+Cox proportional hazards models
+nondominant
+Renal denervation
+t 1/2
+EP
+Seven days
+serious dangers will be possible outcomes of any course of action
+less favourable
+two
+3 days
+cross-reactivity
+relaxin
+CEL files
+agitation of the product during illumination
+a vector carrying components necessary for replication
+RSV
+day 25
+N, S-blocked glutathione diesters
+Gaussia luciferase
+three
+RFAMSEQ
+The resulting recovered protein
+Ten
+twice daily
+unbiased deep sequencing
+total protein content
+4-5%
+Ebola and Lassa fever viruses
+joint analysis of multiple alleles
+April 2009
+−26.5 ± 5.0 mV
+6-8 h
+1
+domain of M2
+relative input
+influenza vaccination for populations and antiviral treatment for individuals
+inactivation of the viral envelope protein
+eight
+remarkably similar
+IMEX
+discrete interaction sites on the viral genome
+6
+89-224 PFU
+Anti-CD8-APC-Cy7
+27
+Isotype antibody pull-down and uninfected cells
+unencapsulated phase variants
+develop and test the proposed predictive model
+7,200
+splenic CD8 + CD25 + Foxp3 + T cell populations
+Arabia
+810
+1 h
+16 h post-infection
+other factors
+14
+10%
+long distance dispersal
+Protein aggregates
+IFNAR-1 mRNA levels
+S1PR1 selective agonist CYM-5442
+less than 32 weeks
+phylogenies
+acute-on-chronic liver failure
+7-phloroeckol and dieckol
+80%
+R t
+localize to the outer membrane
+3 s
+Substrate concentrations
+metagenomics
+infectivity
+Supernatant
+temperature or vapor pressure
+IP-10, TGF-a, and PDGF-AA
+ECDC
+structural and functional
+0.2%
+identification of gene regulatory regions
+abundant experience
+ceftobiprole
+Stanford
+75%
+reference-free
+V2-apex bnAb epitope
+Supernatants
+overexpression of usp-46
+dengue-endemic areas
+slowly dissociate from the ribosome
+Beclin-1
+The set of results of ciliary ultrastructure and NO n measurement
+2018-07-16
+host DNA polymerase
+disease severity and mortality
+local activation of innate immunity
+γ irradition
+SP-D
+Streptococcus
+HI assays
+context specific
+immune electron microscopy
+398
+the patient's clinical information
+Identify-Isolate-Inform Tool
+Computing servers
+Weekly CPS based prediction
+26%
+Visualisation
+burn patients at risk for AKI
+six
+G, C
+sedation
+aggressive treatment
+demyelination
+novel preventative strategies or therapeutic modalities
+Liaoning Province
+LASV entry
+Nesteruk, Igor
+proton transport models
+matching of the circulating strains with vaccine strains each year
+sodium hydroxide standard solution
+inner capsid protein VP6
+50%
+European Virus Archive
+gender
+facilitate nuclear membrane transition
+20
+Dual-Luciferase Reporter Assay System
+28%
+goat anti-cat HRP or phosphate conjugated antibody
+6 hrs
+planning
+mathematical scenario models
+91%
+OCT compound
+pathogen
+7 days
+both M and C
+lymphopenia
+Short read data from the Western English Channel
+World War I
+hydrophilic
+4
+Mosquito-borne flaviviruses
+70%
+to better adapt to its primary host's environment
+damaged organelles, unnecessary proteins, and foreign substances
+pLD-FPS-SQS
+Proliferating T cells
+ethical reasons
+10.1186/1471-2334-7-17
+48-hours
+twelve
+Molecular docking technology
+K2CO3 and appropriate benzyl bromide
+twice every week
+SYBR green-based quantitative real time PCR
+oseltamivir
+14.71%
+Multiplex PCR analysis
+carbon and oxygen
+four
+histologic
+five
+nasopharyngeal carriage
+10
+outputs
+MLKL phosphorylation
+adhesion molecules and toxins
+3 weeks
+Twelve
+Ninety-four
+Ad5/HVR2-MPER-L15
+SAM software
+TAC
+20
+immunosuppresion
+Luciferase activity
+HBGAs
+data type
+0.136 and 0.167
+46-92%
+64
+6
+May, 2009
+real-time PCR
+function as tumor suppressors in lung cells
+TSC2 interference
+7.0 persons
+98%
+300m above mean sea level
+HMDP strains
+studies with larger sample sizes
+1.4%
+systemic or selective
+Hungary and Greece
+Iberian lynxes
+hs-CRP and PMN count
+Nose-Hoover temperature coupling and isotropic scaling
+ROS
+SW/WN03 genotype
+viral RNA of PUUV
+ignorance of the reporting rate
+oblique rotation
+16-20 h
+12 hours
+MEGAclear
+Analysis of pH-dependent protein stability
+ExomeDepth
+Ten
+significantly decreased anti-HTNV activity
+a screening protocol for healthy subjects who are interested in participating in vaccine clinical trials
+All systems with an H-index above the 75th percentile
+Birth weight
+Human bocavirus 1
+up to 3
+enhanced replication/transcription of the mutated segments
+possible response pathways
+15%
+increased relapse and a trend toward improved OS in the MA cohort
+amoeboid
+18
+cell viability
+2.3 ml
+5.5 to 6.0 ml
+isolation
+four
+6
+HFIP-mediated release from the solid support
+National Yang-Ming University
+reinitiation mechanism
+24
+33
+I
+non-viral macromolecular delivery
+the vertical average of the 500 ROC curves
+different types of constructs
+yawning or refractory
+texture information
+490 nm
+preparedness
+6 months to 14 years
+independent viral protein-interacting proteins
+89.8%
+two bilayers
+H1N1pdm
+survival
+modification CS with FITC or Cy5.5
+Proheads
+Lectin immobilization
+BAL fluid
+cc-by
+target-mediated clearance
+A H3N2 Switzerland
+GEDV
+XNT
+Limb muscle weakness
+catalytic subunits
+0.1% formic acid
+Biochemical
+Data
+Figures 2c and 2d
+apoptosis
+H1 and H3
+DNA sequencing and restriction endonuclease digestion
+urease
+2,145
+structural proteomics
+reaction mix in desalted and sterilized water
+six months
+39.6 weeks
+8 Open Reading Frames
+broad-spectrum inhibitors
+5%
+influenza infection and transmission mechanisms and absenteeism behaviour of symptomatic students
+local vampire bat-prey interactions
+a second TL2/PK1 pseudoknot
+ViSpA
+Dr. Zijian Xie
+secondary bacterial pneumonia
+increases the endosomal pH
+five
+Sections of paraffin-embedded organs
+levels of IgA
+ANDV and PUUV infection
+tRNA Arg mcm 5 UCU
+Bafilomycin A1
+constitutive
+mean ± SEM
+1997
+10%
+plasminogen
+Ad5.ZIKV-Efl
+single site antigen/epitope incorporation at fiber or protein IX
+flow cytometry
+Pregnancy
+29
+Belief in Conspiracy Theory Inventory
+0.813
+detection of anti-drug antibodies
+visa
+H-2D b
+Ub activity
+Th1-and Th17-type immune responses
+stringent selection criteria
+90 min
+S1 Database
+increase endosomal pH
+Sequential lobar collapse
+reducing or eliminating socioeconomic and racial/ethnic disparities in health and healthcare
+differences in the peptides sequences and their lengths
+JM109 competent cells
+100 μL 0.05 m iodoacetamide
+Human rhinovirus C
+Europe and the USA
+phagosomes
+Dendritic cell
+protocol deviations
+disrupted the integrity of polarized Caco-2 cells
+mammalian and human life
+1952.84 km 2
+T cells
+A lay summary of the results
+TIIA
+crowded living conditions and exposure to indoor air pollution
+70
+TLRs
+RNaseL
+reference lists of retrieved original articles
+10
+recovered
+in eye banks with specialised areas and trained staff
+338
+endothelial cell responses
+IL-17RA and IL-23
+Counter Selection BAC Modification Kit
+Moral distress
+reaction mixtures
+enhanced release of IL-10
+impacts on household well-being
+other enteroviruses
+differential transmissibility of segmented variants
+99%
+activation of STAT4
+basolateral or apical sides
+Congolese tropical rain forest
+test utilization
+T S
+10
+SUDV and BDBV
+surveillance
+CCL5, Mx1, and IL-8
+the variable
+9.4%
+September and October
+high IF medical journals
+only one neighbor can become infected
+quick clearance via digestive tract
+monensin
+irradiated BALB/c recipients
+2017
+local priorities
+air samples
+H7N9 positive
+modular
+information
+high-volume mechanical ventilation
+five
+M1
+ITCH, Nedd4, and WWP1
+pseudocenters
+2006
+anti-phosphotyrosine
+changes in actin morphology and polymerization
+NP adaptation to the importin-α isoforms of a particular species
+NEBNext Ultra RNA Library Prep Kit
+bidirectional influences
+146
+perl
+Purified PRRSV CH-1R antigen
+lipoproteins
+B&K Universal Group Limited
+AP180 CTD
+Betaine
+Spearman correlation coefficient
+synovial
+Activation of coagulation and alveolar epithelial injury
+Ifitm2
+Household observed serial intervals
+viroporin function
+capita birth rate and population size
+binders
+alternative
+62%
+SAL analogues
+edges
+19 days
+multiple stochastic runs
+cross-protective
+20%
+causal interactions between HDL proteins
+Dr. Bin Gotoh
+Parsonnet Lab
+a person
+spherical vesicular compartments
+95%
+IFN-a
+Rhinolophus ferrumequinum
+three
+TMP/SMX
+Chordopoxvirinae
+Darwinian evolution
+The large trophozoite
+zoonotic pathogens
+text mode
+Goat-anti-mouse IgG CyTM3
+to avoid cell debris
+30%
+Mucosal barriers
+2,928
+Syndecans
+serious pulmonary disease
+twice
+Cyst morphology
+Recombinant human apoM
+Anti-Nup62 siRNAs
+pEVL
+RTC13 and RTC14
+anti-FLAG, anti-HA, and anti-Ubc9
+its population size
+Serious Protocol Deviation
+Eight
+membrane protrusions
+plasmid DNA mutation
+low fidelity
+lycopene β-cyclase
+enhanced chemiluminescence
+TRIM56 E3
+595 Enoticumab
+deeper
+Free energy and network entropy
+1.28
+glycine GGC and alanine GCU codons
+117
+cell viability
+six
+2 h
+severe comorbidities or failure of ART
+IL-6
+Data acquisition
+The spectral range between 650-950 nm
+DEP
+CPV 2
+venules
+TIM3
+996
+nephrotoxicity
+necrotic
+RIG-I and MDA5
+information recorded in the hospitalisation data
+30 ng of RNA
+Degenerate primers targeting the glycoprotein gene
+5
+overarching ethical principles
+Statistica v10 software
+Transmembrane proteins with an N-terminal ectodomain
+6 hours
+transduce patient spheroids
+cell surface HS
+3-amino-9-ethylcarbazol
+cholesterol-enriched
+pDCs and NK cells
+computational efficiency
+consistent estimates of the peak attack rate
+4 hours
+33
+pcDNA 3.1 vector
+Sequence similarity
+twelve
+5-50 USD
+hantavirus amplification
+40 mothers
+Release of infectious VSV and DENV virus
+1.5 M NaCl
+NS3/4A
+half
+,3-fold
+Blast
+substrate-hydrolase screenings
+publications
+less weight loss
+120 h post-inoculation
+lack of available tap
+barcoded tetramers
+the exact paratope
+twice
+53
+10,000
+confidentiality agreements
+a three-domain polypeptide
+virus polymerase complex
+RNA polymerase II
+Vimentin
+Five
+tumor necrosis factor alpha and interleukin 1beta
+60 min
+an individual
+exonucleolytic
+a contact investigation
+Puumala virus
+sorafenib
+2013
+full growth medium with serum
+FlowJo
+human, avian, and swine influenza viruses
+55 kBq/kg
+FACSCalibur instrument
+Descriptive
+M-T hook structure
+Charlson-Deyo comorbidities
+30 m
+raw data from array scans
+ImageJ 1.47n
+Vaccinia virus infection
+a cut off at P,0.05
+autophagosomes
+eight
+0.2 v/v 300 mM HCl
+Vaginal discharge
+Continuous infusion of antibiotics
+SPSS version 13.0 and Amos version 7.0
+binding of HuNoV VLP to all three types of saliva
+normalized pseudoviruses
+Tick-borne relapsing fever
+read through the full text of each selected article and summarize key metadata
+GeneJet PCR purification kit
+three
+91%
+viral entry
+2500
+genetic variants conferring susceptibility or influencing progression and severity of disease
+31.4-39.7
+calcium
+peritoneal NK cells
+the specificity of the GFP reversion
+30 μL
+reovirus replication
+RT-PCR and/or virus isolation
+Ebola and Marburg viruses
+phosphorylation by various ligands
+PIRO score
+18
+nonspecific psychological distress
+an individual typically roams
+mcm 5 group of the near cognate Arg-tRNA
+Kampar, Malaysia
+H5N1 HA
+CleanCap
+Sample size
+Uganda
+endogenous peroxidase activity
+amino acid diversity
+2014
+PLY
+three
+S G
+one or two
+numerous mismatches
+400
+viral RNA
+cytoplasmic fractions
+10 2 -10 6 bacterial cells/mL
+purified mitochondria
+pressure ≤ 30 cm H 2 O
+39
+Drosophila melanogaster
+Substitution of Y = 0
+inflammation
+Local testing procedures
+insertion of miR-192 or scrambled targeting sequences
+Viral DNA and RNA
+Lipopolysaccharide
+100 nt
+basal autophagy
+Genetic resistance of more susceptible breeds
+frequency of non-synonymous mutations
+conventional molecular biological techniques
+HCPS
+DI particles
+Pleural effusion and diagnosis of adenoviral pneumonia
+Amyotrophic lateral sclerosis
+3.5 kDa
+7
+MVA
+BMP7
+engagement with Ub
+VCV
+myocardial ischemic and reperfusion injury
+Natural RNA G4s
+Human mAb reactivity
+Neostigmine and glycopyrrolate
+3 M TMAC and 45 C
+low transduction levels
+the attending physician
+three
+Systems Genetics Core Facility
+N
+remote enhancers
+Human respira t ory syncytial virus
+GraphPad Prism 5
+cellular antiviral restriction factors
+180
+forecasted strains
+clusters of isolates
+touching and removing tapes
+genomic changes
+complex pathways
+Universal primer-PCR
+RPMI 1640
+cervical, thoracic and lumbar
+CCL-141
+reductions in central subfield thickness
+raltitrexed
+oncolytic immunotherapy
+HA-specific antibody responses
+9
+8
+93%
+TLR7
+ChAT
+host attachment rate
+MicroRNA-133b
+H5N1 titres
+656
+Tuberculosis
+autumn
+haemagglutinin esterase gene
+fecal excretion of PA by bacteremic mice
+pancreatin
+the ratio of T helper cells to cytotoxic T cells
+3P54_A template
+Phylogenetic trees and matrices of phylogenetic distance from humans
+rice gall dwarf virus
+0% to 50%
+Alpl
+eleven
+acetyl coenzyme A carboxylase
+1 mL
+30 L
+negative control
+cytotoxic T lymphocyte antigen 4
+Influenza
+glycoproteins
+using 10 random sections of each brain, SC and ON of each animal
+cc-by
+a small gift
+Zn 21
+Signaling via TLR9
+potential O-glycosylation sites
+512 × 512 px
+24 hpi
+8.86
+broad-spectrum
+160 µg membrane protein extracts
+host cells and tumor cells
+written informed consent
+24 hr
+one extra strain of influenza B virus
+Identification of mimotopes
+2-3-4
+co-occurrence scores
+medical centers, regional hospitals, and local hospitals
+five
+a double-strand RNA
+fusion protein precursor/glycoprotein
+double-membrane vesicles and multilamellar structures
+mediated efficient primary infection
+ONOO
+sCR1/TP10
+AMREP
+Datasets
+VP088
+APACHE II
+major histocompatibility haplotype as well as DC subset frequency and function
+23,646
+Twenty-eight
+40%
+10 days
+an NS6 chimera
+virus-induced cell mortality
+Philips CM-10 electron microscope
+three
+CCP4
+PC3
+vector recognition and particle formation
+high neutralizing ability
+10 7Á7 50% egg infectious dose /ml
+immune reaction
+IGV and Artemis
+Java
+Venturi mask
+HA
+immunologic
+every week
+outpatients
+hydrophobic interactions
+Inflammation
+0.2
+consensus sequences
+cross-sectional study
+21.6%
+three
+TUL
+Flowcytometric
+Statistical models
+0%
+Viral DNA
+282
+succeeded beyond all predictions
+UV and visible light
+evasive strategies
+Hand washing, psychological stress, social support, and shift work
+cellular RBPs
+1.57
+2009
+Mann-Whitney U test
+DI water
+62
+cytokines
+NFkB-dependent
+34.4%
+better immune responses
+mouse serum
+5228
+The concentrations of fluoresceinated PPMO in liver and spleen
+388 × 850 cm 2 roller bottles
+cells
+sites or alternative slippages
+diminished disease activity index
+Node color gradient
+12
+acute replication of gammaherpesviruses in vivo
+213
+OneStep RT-PCR and TaKaRa Ex Taq kits
+Bottleneck
+Sphingosin kinases
+10 −3 -10 −5 s/s/y
+factors other than the effectiveness of interventions
+ST and FI
+Scaffold
+observations up to some fixed time
+forty
+Cell Counting Kit-8
+Thirty-one
+0.4%
+pneumonia
+Global Moran's I
+the average interval between infection of a primary and a secondary case
+β-herpesvirinae
+hospitalized noncritical patients
+Merkel cell
+P-LPE
+sex differences in the prevalence of HBV and development of liver cancer
+N2-N3
+biweekly SHIVIG administrations
+inhibits protein transport through the Golgi protein
+PCP
+370
+48 h
+admetox
+5765 mM
+adaptive networks
+parasites
+15
+structure
+44%
+6-8 week old
+standard deviation
+fever, rash, arthralgia, and conjunctivitis
+in-hospital survival
+electron microscopy, immunofluorescence, and ELISA
+RVs
+538
+disintegration of the rotor at speed
+"-"
+physiologic
+Loop-mediated isothermal amplification
+25 days
+Invitrogen Corporation
+Microarray data
+67%
+2 mM monensin
+additional modes of RNA synthesis
+ORFx
+5/9
+IL-10
+Cell apoptotic
+non-psychology journals
+23
+20-30%
+61.93%
+RNA
+modifications
+depressed
+virulence
+1,196
+2D molecular fingerprints
+flexible policies, frameworks and incentive structures
+association with the cell periphery
+COPD
+NF-κB
+telomerase activity
+simultaneous amplification and barcoding with a single oligo
+Ascosphaera apis
+neonatal ICU and a variety of health-care interventions
+six
+RPISeq models
+type I diabetes and Hashimoto's thyroiditis
+attacks
+1 week
+CBP
+two consecutive lysines
+reduced RSV-G protein synthesis
+33
+180 units of the capsid protein VP60
+non-ICH patients
+CCL4
+turkeys
+bushmeat
+protective equipment
+90%
+TNF-α, IL-1β, and IL-6
+526
+periphery
+HIV-1 specific primers
+unsaturated fatty acyl chains
+SPOT IMAGING Software
+viral RNA synthesis
+lags
+Double-stranded DNA
+influenza virus replication
+arginine-lysine
+HCV NS3 PRF
+densitometric quantification
+ACGIH's formula
+nuanced
+Haversian and trabecular
+absorbance at 450 nm
+Influenza Virus
+John Sheehan
+travel at all
+4.2%
+Over 60%
+RSPs of dengue 2, 3 and 4
+Outbreaks, emerging infections, and bioterrorism
+Middle East, Central Africa, and Egypt
+2138
+H7N9 and H5N1
+isobolograms
+mounting an inflammatory response
+causes other than the study agent
+a known association
+Kaplan-Meier method
+GraphPad Prism 6
+AlexNet
+HEK-293T cells
+seroconversion factor
+ER stress and DNA damage response
+Four
+7671-fold
+0.1% Triton X-100
+central tendency or other basic estimates AND variation or associated estimates of uncertainty
+confirmation of etiology by laboratory testing
+Ingenuity Pathway Analysis 5.5
+63 out of 68 associations
+1.38 out
+267
+Further information on research design
+dengue control
+frameshifting
+Receiver Operating Characteristic curve 27
+79%
+mobile
+apoptosis
+50-60%
+energy intake
+CMV
+1718
+2003
+two
+six
+PRRSV replication and proliferation
+10%
+84 hours
+monocyte-derived
+previous history of statin use
+the outbreak
+simplicity
+adverse events
+Further prospective validation
+high error rate of the polymerase
+CHOP and ATF4 cooperation
+human immunodeficiency virus rapid testing
+less than 5%
+PE_PGRS proteins
+SiglecH
+Ang II
+3219
+progressive disease
+PBMCs
+active migration of tumor cells
+IL-10
+Five
+Genomic coordinates
+medical applications
+1:229
+temperature, humidity, and illuminance
+Acute respiratory viral infections
+highly fluctuating
+IRAV
+The percentage of identity
+Optical density
+C 21 H 22 O 9
+AKT and PLK1
+6 mM
+extracorporeal
+hands-on practical training
+estimated transmission distance
+Acyclovir
+Asian populations
+a MM
+HRPs
+Soybean oil
+Three
+Datasets for TAAR1 expression
+transfer of contaminants by means of the door swing
+matrix protein M
+Fc-dependent viral clearance
+a regulatory network and a set of regulatory modules
+P bin
+pharynx epithelium
+IRF7
+14 days
+2014
+mouse lung
+precision criteria
+filamentous
+CPP mediated toxicity
+clinical and psychological
+viral plaque assay
+90 %
+their use in human therapy
+swine
+Immune complex and complement depositions
+immunogenicity
+co-infection by wt and variants
+1% Triton X100
+CPE
+Phosphate-buffered saline
+genetic drift
+H4a
+redundant mechanisms and incomplete C' depletion
+DNA sequencing
+24
+phosphorylation sites
+NOX-1
+b-G and b-GA
+current spillover surveillance efforts
+30,000
+phase C
+rRT-PCR
+substitution of T with X U
+statistically significant
+Inflammation
+IkB
+monosaccharides, amino acids, and fatty acids
+both strategies
+four
+absence of viremia and protection from swelling
+K359H
+human immunodeficiency virus
+men who have sex with men /bisexuals
+0.03
+Four
+cytoplasmic azurophil granules
+DSC
+tracing
+Wnt signaling pathway
+T-cell activation
+two sample Kolmogorov-Smirnov tests
+governs tissue-repairing environment
+12
+80%
+molecular dynamics
+labelretaining cells and BASCs
+PA induced IL-6 and IL-8 expression
+other studies made elsewhere
+three
+insoluble debris
+High-affinity CD8 + T cells
+Recombination
+4%
+one
+blood neutrophil count
+A combination of several features
+greater
+99%
+281
+IL-6 and IL-17A
+conserved primers
+molecular
+demographics
+nanomedicines
+one
+Algid malaria
+dramatically suppresses antiviral response gene activation
+epigean sites
+natural immuno-adjuvanticity
+85,652
+pathological changes in exosomal cargo and function
+pseudoknot conformational plasticity
+2,000 to 5,000 Chinese yuan
+ssRNA
+96.4% GFP-positive plaques
+identifying suspected cases that may have a higher chance of testing positive
+Golgi
+CO 2 inhalation
+alignment problems
+recombination in other RNA viruses
+35
+12
+a vasodilator peptide
+the standard deviation of the mean
+50, 60 or 100 mM
+molecular peaks with Na + adduction
+10,649
+environmental temperature and relative humidity
+paediatric intensive care unit
+NASFinder
+different recombinant lineages
+kDa
+corticosteroid
+MS analysis software
+individual vaccination status
+end-anchoring
+Module gene expression levels and cell differentials
+the need for Nef to antagonize SERINC5
+93.3%
+HSV-1 gB 3A or GS3217 virus
+Cre 2 control mice
+cellular protein translation
+sym-sub assays
+five
+Data
+Family members
+Pathogens and vectors
+Influenza
+3.96
+140