--- license: cc-by-3.0 license_name: cc-by-3.0 license_link: https://creativecommons.org/licenses/by/3.0/ language: - en tags: - ViT - ResNet - Transfer_learning - Fine_tuning - Classification - Vision - Taxonomy - Biodiversity - DNA_barcodes - Insects - Species - BigData pretty_name: BIOSCAN-1M size_categories: - 1M Alt Text Website: https://biodiversitygenomics.net/1M_insects/ GitHub: https://github.com/zahrag/BIOSCAN-1M Zenodo: https://zenodo.org/records/8030065 Kaggle: https://www.kaggle.com/datasets/zahragharaee/bioscan-1m-insect-dataset Paper: https://arxiv.org/abs/2307.10455 ``` cite as: @inproceedings{gharaee2023step, title={A Step Towards Worldwide Biodiversity Assessment: The {BIOSCAN-1M} Insect Dataset}, booktitle={Advances in Neural Information Processing Systems}, author={Gharaee, Z. and Gong, Z. and Pellegrino, N. and Zarubiieva, I. and Haurum, J. B. and Lowe, S. C. and McKeown, J. T. A. and Ho, C. Y. and McLeod, J. and Wei, Y. C. and Agda, J. and Ratnasingham, S. and Steinke, D. and Chang, A. X. and Taylor, G. W. and Fieguth, P.}, editor={A. Oh and T. Neumann and A. Globerson and K. Saenko and M. Hardt and S. Levine}, pages={43593--43619}, publisher={Curran Associates, Inc.}, year={2023}, volume={36}, url={https://proceedings.neurips.cc/paper_files/paper/2023/file/87dbbdc3a685a97ad28489a1d57c45c1-Paper-Datasets_and_Benchmarks.pdf}, } ``` ## A Dataset Record BIOSCAN dataset provides researchers with information about insects. Each record of the BIOSCAN-1M Insect dataset contains four primary attributes: * DNA barcode sequence * Barcode Index Number (BIN) * Biological taxonomy ranking annotations * RGB image ######

I. DNA barcode sequence The provided DNA barcode sequence showcases the arrangement of nucleotides: * Adenine (A): Red * Thymine (T): Blue * Cytosine (C): Green * Guanine (G): Yellow ``` TTTATATTTTATTTTTGGAGCATGATCAGGAATAGTTGGAACTTCAATAAGTTTATTAATTCGAACAGAATTAAGCCAACCAGGAATTTTTA ... ```
Alt Text
######

II. Barcode Index Number (BIN) BINs, acting as an alternative to Linnean names, provide a genetic-centric classification for organisms, emphasizing the significance of genetic code in taxonomy. ``` BOLD:AER5166 ```
Alt Text
######

III. Biological taxonomy ranking annotations Taxonomic group ranking annotations categorize organisms hierarchically based on evolutionary relationships. It organizes species into groups based on shared characteristics and genetic relatedness.
Alt Text
######

IV. RGB image Original insect images from 16 most densly populated orders of the BIOSCAN-1M Insect dataset. The numbers below each image identify the number of images in each class, and clearly illustrate the degree of class imbalance in the BIOSCAN-1M Insect dataset.
Diptera: 896,234 Hymenoptera: 89,311 Coleoptera: 47,328 Hemiptera: 46,970
Lepidoptera: 32,538 Psocodea: 9,635 Thysanoptera: 2,088 Trichoptera: 1,296
Orthoptera: 1,057 Blattodea: 824 Neuroptera: 676 Ephemeroptera: 96
Dermaptera: 66 Archaeognatha: 63 Plecoptera: 30 Embioptera: 6
## Class Distribution Class distribution and class imbalance in the BIOSCAN-1M Insect dataset. Orders (top) and diptera families (bottom). The image demonstrates that class imbalance is an inherent characteristic within the insect community.
Alt Text